Citation
Intracellular Trafficking of Adeno-associated Virus Type 2

Material Information

Title:
Intracellular Trafficking of Adeno-associated Virus Type 2
Copyright Date:
2008

Subjects

Subjects / Keywords:
Capsid ( jstor )
Coinfection ( jstor )
Dependovirus ( jstor )
DNA ( jstor )
Endosomes ( jstor )
Gene therapy ( jstor )
Heparin ( jstor )
Immunocytochemistry ( jstor )
Infections ( jstor )
Viral DNA ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright the author. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
8/8/2002
Resource Identifier:
80594347 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

INTRACELLULAR TRAFFICKING OF ADENO-ASSOCIATED VIRUS TYPE 2 By WU XIAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2002

PAGE 2

This work is dedicated to my grandparents, Rongchang Xiao and Xing Su.

PAGE 3

iii ACKNOWLEDGMENTS I would like to express my sincere appreciation to Dr. Jeffrey A. Hughes, the chairman of my committee. Without his cordial welcome and consideration for me, I would not have been able to achieve my Ph.D at the University of Florida. Without his understanding and tolerance, I would not have been able to have such a degree of freedom to choose my research direction. Last but not least, without his help in every sense in my academic trainings, I would not have been able to go through my Ph.D program at all. I extend my gratitude to Dr. Nicholas Muzyczka for providing me whatever I needed to finish my Ph.D project in his lab. There are so many things I learned from him that a person could only possibly learn from one of the greatest scientists in his area. I would also like to thank my other committee members, Dr. Hartmut Derendorf, Dr. Gunther Hochhaus, and Dr. Edwin M. Meyer. They all have been very willing to give me any help I asked for, and I can always count on them. Many other people have also been very helpful to my Ph.D project, including Pei Wu, Ken Warrington, Sergei Zolotukhin, Mark Potter, Rodney Brister, Shaun Opie, Weijun Chen, Kevin Nash, Corinna Burger, and Corinne Abernathy. In addition, I also acknowledge all the personnel and graduate students in the Department of Pharmaceutics for their friendship and assistance.

PAGE 4

iv Finally, I want to thank my wife, Ping Liu, who is also a graduate student in the Department of Pharmaceutics, for her encouragement, understanding, and advice throughout my Ph.D program.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.......................................................................................iii LIST OF FIGURES.............................................................................................viii ABSTRACT..........................................................................................................ix CHAPTERS 1 INTRODUCTION...............................................................................................1 AAV Biology......................................................................................................1 AAV Infectious Entry Pathway....................................................................1 Receptor binding..................................................................................2 Endosomal trafficking...........................................................................2 Cytoplasmic events..............................................................................4 Nuclear entry........................................................................................5 Viral uncoating......................................................................................5 AAV Replication..........................................................................................5 AAV Rep proteins and DNA synthesis..................................................6 AAV capsid proteins.............................................................................7 Viral Assembly............................................................................................8 Production of AAV Vectors................................................................................9 Cloning of AAV Vectors............................................................................10 Purification of AAV Vectors.......................................................................11 AAV Gene Therapy.........................................................................................12 Transgene Expression of rAAV Vectors....................................................13 Altered Tropisms by Capsid Modifications................................................14 Specific Aims..................................................................................................16 To Study the Natural Infectious Entry Pathway of AAV in the Absence and Presence of Ad......................................................................................16 To Study the Capsid Mutants that are Defective in Transduction.............17 2 MATERIALS AND METHODS.........................................................................18 Cell Culture.....................................................................................................18 Production of Virus..........................................................................................18 Production of Ad.......................................................................................18 Production of rAAV Vectors......................................................................18

PAGE 6

vi Production of Wild-Type AAV Particles.....................................................19 Fluorescent Dye Conjugation of AAV and Viral Infection................................20 Production of A20 Monoclonal Antibody.........................................................21 Immunocytochemistry.....................................................................................22 Confocal Microscopy.......................................................................................22 Detection of Viral DNA from Cytoplasmic and Nuclear Fractions....................22 Subcellular Fractionation and AAV Dot Blotting..............................................23 Analysis of Endosomal Trafficking Markers....................................................25 Thapsigargin Inhibition of Free Nuclear Diffusion of Dextran..........................26 Receptor Binding and Cell Internalization of rAAV Mutants............................26 Nuclear Entry of rAAV Mutants.......................................................................27 Real-Time PCR Detection of Mutant rAAV DNA.............................................27 3 DEVELOPMENT OF SUBCELLULAR FRACTIONATION METHODS USING IODIXANOL GRADIENT....................................................................................28 Introduction.....................................................................................................28 Results and Discussion...................................................................................29 Characterization of Iodixanol Gradient Subcellular Fractionation.............29 Isolation and Dot Blotting Detection of AAV DNA.....................................30 Phenol-chloroform extraction enhances the detection........................32 SSC solution enhances DNA binding to the membrane.....................32 Precipitation of DNA does not improve the detection.........................34 Conclusion......................................................................................................35 4 AAV NATURAL INTRACELLULAR TRAFFICKING.........................................36 Introduction.....................................................................................................36 Results and Discussion...................................................................................36 Production of AAV Virions.........................................................................36 Fluorescent AAV Shows A Slow Nuclear Entry Pattern............................38 Immunocytochemistry Shows A Persistent Perinuclear Localization of Intact AAV Particles..............................................................................39 Viral DNA Follows the Same Slow Nuclear Entry Pattern as Viral Proteins ..............................................................................................................44 AAV Rapidly Escapes From Light Endocytic Organelles into Cytoplasm..46 Conclusion......................................................................................................47 5 AAV INTRACELLULAR TRAFFICKING IN THE PRESENCE OF AD.............49 Introduction.....................................................................................................49 Results and Discussion...................................................................................50 Immunocytochemistry Shows Ad Significantly Enhances the Nuclear Translocation of Intact AAV Particles....................................................50 DNA Blotting Shows Ad Capsid Proteins Can Facilitate AAV Nuclear Translocation.........................................................................................50 Endosomal Trafficking of AAV Is Not Altered by Ad..................................53

PAGE 7

vii NPC Inhibitor Does Not Block Ad Facilitated AAV Nuclear Translocation55 Conclusion......................................................................................................57 6 INTRACELLULAR TRAFFICKING OF AAV CAPSID MUTANTS....................59 Introduction.....................................................................................................59 Results and Discussion...................................................................................60 Cell Surface Binding and Internalization Study.........................................60 Virus Nuclear Translocation Study After 4 Hrs Postinfection....................65 Conclusion......................................................................................................65 7 CONCLUSIONS AND FUTURE DIRECTIONS...............................................68 Conclusions....................................................................................................68 Future Directions.............................................................................................69 Mechanism of AAV Nuclear Translocation................................................69 Endosomal Escaping................................................................................69 LIST OF REFERENCES....................................................................................71 BIOGRAPHICAL SKETCH.................................................................................82

PAGE 8

viii LIST OF FIGURES Figure page Figure 3-1. Continuous iodixanol gradient subcellular fractionation of PNS of HeLa cells................................................................................................31 Figure 3-2. Test of DNA dot-blot conditions.......................................................33 Figure 4-1. Characterizations of Purified AAV Virions........................................37 Figure 4-2. Fluorescent-dye-conjugated AAV infection......................................40 Figure 4-3. A20 immunocytochemistry detection of intact AAV particles............42 Figure 4-4. B1 antibody immunocytochemistry detection of intact AAV particles.43 Figure 4-5. Slot-blot detection of AAV DNA........................................................45 Figure 4-5. Subcellular fractionation of AAV.......................................................48 Figure 5-1. A20 immunocytochemistry of AAV with Ad co-infection...................51 Figure 5-2. DNA slot blotting detection of AAV DNA with Ad co-infection..........54 Figure 5-3. Subcellular fractionation of AAV with Ad co-infection.......................56 Figure 5-4. AAV/Ad co-infection with NPC inhibitor............................................58 Figure 6-1. Generation of rAAV capsid mutants.................................................61 Figure 6-2. Virus cell binding and internalization studies....................................63 Figure 6-3. Real-time PCR detection of GFP genes...........................................64 Figure 6-4. Virus nuclear translocation studies at 4hrs postinfection..................66

PAGE 9

ix Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INTRACELLULAR TRAFFICKING OF ADENO-ASSOCIATED VIRUS TYPE 2 By Wu Xiao August 2002 Chair: Jeffrey A. Hughes, Ph.D Department: Pharmaceutics Adeno-associated virus type 2 (AAV) is a small (25 nm) non-enveloped parvovirus that has emerged as a major player in viral gene therapy. AAV is non-pathogenic and has demonstrated transduction and long-term expression of transgenes in the brain, liver, muscle, retina, and vasculature of experimental animals. Several clinical trials of AAV gene therapy are undertaken. To optimize the AAV-mediated gene therapy, a better understanding of its biology is critical. It has been shown that AAV enters host cells through a receptor-mediated endocytosis process, and the single-stranded viral genome finally converts to double-stranded DNA in the nucleus and then integrates into human chromosome 19. In this study, we have examined the cytoplasmic trafficking and nuclear translocation of AAV using fluorescent-dye-conjugated AAV, A20 monoclonal antibody immunocytochemistry, and subcellular fractionation techniques followed by DNA slot/dot-blotting. Four capsid mutant recombinant

PAGE 10

x AAVs were also used to further characterize the intracellular trafficking properties of AAV. Our results indicate that AAV enters the cell rapidly and escapes from early endosomes with a t1/2 about 10 mins postinfection. Cytoplasmically distributed AAV accumulates around the nucleus and viral uncoating happens before or during the nuclear entry about 16 hrs postinfection, when viral proteins and DNA contents are readily detected in the nuclear fraction. In the presence of adenovirus (Ad) co-infection, however, cytoplasmic AAV quickly translocated into the nucleus as intact particles as early as 40 mins, and this enhanced nuclear translocation of AAV is not blocked by the nuclear pore complex inhibitor, suggesting an unknown mechanism for AAV nuclear entry. AAV endosomal escaping does not seem to be affected by Ad co-infection.

PAGE 11

1 CHAPTER 1 INTRODUCTION AAV Biology Adeno-associated virus type 2 (AAV) is a nonpathogenic human parvovirus with a diameter around 25 nm (8). Its single-stranded (ss) 4.7-kb DNA genome is packaged into three viral capsid proteins—VP1 (87 kDa), VP2 (73kDa), and VP3 (62kDa)—that form the 60-subunit viral particle in a ratio of 1:1:20, respectively (74). Its linear ssDNA contains two open reading frames (ORF) flanked by two inverted terminal repeats (ITR) of 145 nucleotides each (89). The upstream ORF encodes four overlapping nonstructural replication proteins (Rep), Rep78, Rep 68, Rep52, and Rep40 (58), and the downstream ORF codes for the capsid proteins (Cap). After infection to host cells, the ssDNA genome of AAV is converted to a double-stranded template in cell nuclei (22, 23) and finally integrated into host genome at chromosome 19q13.3-qter (52, 53, 60) to establish a latent infection. In the presence of a helper virus co-infection, such as herpesvirus or adenovirus (Ad), however, AAV undergoes a productive replication in which progeny virions are produced (62). AAV has demonstrated a broad tropism of infection, including lung, neurons, eye, liver, muscle, hematopoietic progenitors, joint synovium, and endothelial cells, etc. (60). AAV Infectious Entry Pathway It has been shown that AAV, like other nonenveloped virus, enters its host cells through a receptor-mediated endocytosis process (108). Virons escape

PAGE 12

2 from early or late endosomes before entering cell nuclei, where they release their genomes for chromosome integration or lytic production cycles (6, 16, 17, 20, 35, 82). Receptor binding Heparan sulfate proteoglycan (HSPG) was identified to be the primary receptor for AAV to attach to the cell surface (72, 91). Efficient cell entry of AAV, however, requires a secondary co-receptor. Two co-receptors, including integrin v5 and fibroblast growth factor receptor 1 (FGFR1), have been identified so far (70, 71, 73, 90). The antibody against integrin v5 specifically blocks AAV cell internalization but not binding (82), and transforming FGFR1 to AAV nonpermissive cell lines makes them permissive to AAV (70). After binding to its receptors, AAV is endocytosed in clathrin-coated pits, and this event is regulated by dynamin, a 100-kDa cytosolic GTPase (17). Dominant expression of mutant dynamin abolishes rAAV transduction (17). It averagely takes 4.4 contacts and 3.2 s between AAV and the cell surface for viral particles to bind their receptors, however, the transmembrane process of AAV only takes 64 ms after the binding (83). Endosomal trafficking Endosomal trafficking of AAV has been studied by several groups (6, 16, 34, 35, 82). Acidification of endosomes is necessary for efficient recombinant (r) AAV transgene expression, because both the vacuolar H+-ATPase inhibitor, bafilomycin A1, and NH4Cl (which enhances the pH of endosomal compartments within 1 min after treatment) are able to inhibit rAAV vector transduction (6, 16,

PAGE 13

3 35). Interaction between AAV and integrin v5 is able to activate Rac1/ phosphatidylinositol-3 kinase (PI3K) signal transduction pathway (82), which is involved in cytoskeleton regulation and necessary for AAV nuclear migration. Both the dominant negative form of the small GTP-binding protein Rac1 and the PI3K inhibitor, wortmannin, lead to significant reduced nuclear migration of viral genome (82). Disruption of microtubules and microfilaments by nocodazole and cytochalasin B also blocks the nuclear translocation of AAV DNA (82). It is unclear whether viral particles are still in endosomal compartments or have already escaped from the endosomes in these inhibition processes. There have been controversies about the stages of viral endosomal escaping. Using the NH4Cl inhibition approach, Bartlett et al. showed AAV escapes from early endosomes within 40 min postinfection (6). Douar et al. claimed AAV routed to late endosomes before escaping into cytoplasm by showing brefeldin A, a fungal antibiotic that causes early endosomes to form a tubular network and prevents early to late endosome transition, inhibited rAAV luciferase expression by 2-3 logs (16). It should be stressed that the possibility of AAV early endosomal escaping, however, cannot be excluded in this case because the polymerization of early endosomes caused by brefeldin A may also restrain the viral escaping, in addition to its prevention of endosomal maturation. The only line of direct evidence showing AAV resides in late endosomes was shown by Hansen et al. in a sucrose gradient subcellular fractionation experiment (35). In human embryonic kidney (HEK) 293 cells, an AAV permissive cell line, AAV appeared in both transferrin-colocalized early endosomes and -galatosidase ( -

PAGE 14

4 Gal)-colocalized dense or late endosomes (35). In contrast, in NIH 3T3 cells, an AAV nonpermissive cell line, AAV accumulated only in early endosomal compartments (35). In both cell lines, however, similar amount of endosomally escaped AAV were found (35), suggesting factors other than early or late endosomal processing may also account for the differences in terms of permissiveness of these two cell lines. It was found that rAAV particles recovered from infected cells failed to provide original scales of transduction efficiency, suggesting endosomal processing physically alters the virions (35). It is unknown so far what these physical changes are. Cytoplasmic events Although we have known that AAV must escape from endosomes to deliver its gene to the nuclei (6, 16, 17, 20, 35, 82), details are lacking about this procedure. Several groups have found that endosome-escaped AAV was subjected to ubiquitin-proteasome system (UPS) degradation in the cytoplasm (16, 20, 105). Inhibition of UPS by the cell-permeable tripeptidyl aldehyde proteasome inhibitors MG-101 (20, 105) or MG-132 (16, 20, 105) showed enhanced transduction efficiency of rAAV vectors in HepG2 cells, HeLa cells, HEK 293 cells, IB3 cells, and fetal ferret fibroblasts. However, enhancement of rAAV transgene expression was not observed in cardiac or skeletal muscle cells (20), suggesting the ubiquitinization of AAV is not uniform in all cell types. Although the ubiquitinization of AAV has been found in many cell types, purified AAV particles are not good substrates for UPS degradation compared

PAGE 15

5 with heat-denatured AAV particles (105), suggesting endosomal processing is prerequisite for this event. Nuclear entry The nuclear entry process of AAV is not yet clear, and findings about the pattern of AAV nuclear accumulation are controversial. Using fluorescent dye tagged AAV virions, Bartlett et al. and Girod et al. found a perinuclear accumulation mode of AAV up to 4 hrs postinfection to HeLa cells (6, 27). Using the same strategy combined with DNA Southern blotting technique, in contrast, Hansen et al. and Sanlioglu et al. found AAV quickly translocated into the nuclear regions of HeLa cells and 293 cells by showing about 76% or 82% of the input AAV DNA in nuclei after 2 hrs postinfection (34, 82). The mechanism of how AAV crosses the nuclear membrane is not well elucidated. Based on the study of purified nuclei, Hansen et al. showed wheat germ agglutinin—a material that physically blocks the nuclear pore—could not prevent AAV from penetrating the nuclear membrane, and proposed AAV enters nuclei through a nuclear pore independent pathway (36). Viral uncoating The capsid of AAV must disassemble for the release of viral genome. Currently it is unknown when this event happens, however, it was proposed the uncoating procedure happens in cell nuclei (6, 34, 82, 108). The direct evidence showing viral uncoating is lacking. AAV Replication The lytic productive replication of AAV requires a helper virus co-infection, such as Herpes virus or Ad (63). In the absence of helper virus, AAV DNA

PAGE 16

6 integrates in a double-stranded form into the host cell genome at chromosome 19 of tissue culture cells to establish a latent infection (46). The most extensively studied AAV helper virus is Ad. It has been known that five Ad proteins are required for the complete helper function to AAV replication: E1A, E1B, E2A, E4, and VA RNA proteins (103). E1A is a transactivator that upregulates the transcriptional activity of a number of Ad genes and AAV Rep and Cap genes as well. E1B and E4 work jointly to facilitate the timely transportation of viral mRNAs. E4 gene is also involved in efficient AAV DNA replication. E2A and VA RNA can increase the viral mRNA level, especially Cap mRNA, by enhancing its stability and translation efficiency (63). In the presence of the helper virus co-infection, the chromosome-integrated AAV genome can be rescued and go through productive replication cycles. AAV Rep proteins and DNA synthesis AAV genome consists of Rep and Cap ORFs flanked by two ITRs (89). The Rep ORF encodes four overlapping Rep proteins, and the Cap ORF encodes three overlapping capsid proteins. Two large Rep proteins, Rep78 and Rep 68, are products of the alternative splicing of a transcript driven by p5 promoter in the genome, and two small Rep proteins, Rep 52 and Rep 40, are alternative products of a transcript driven by p19 promoter (63). The large Rep proteins are crucial in regulating the AAV life cycle. During latent infection, AAV Rep78/68 proteins negatively regulate AAV gene expression and lead to site-specific integration of AAV genome into host chromosome. In the presence of helper virus, however, Rep78/68 proteins turn into transactivators of AAV gene expression and replication. The small Rep proteins Rep52/40 do not seem to be

PAGE 17

7 required for efficient AAV DNA replication but for ssDNA packaging in the viral assembly step instead (63). The replication of AAV DNA follows a single-strand displacement mechanism (8). The 3’ end of AAV palindromic ITR serves as the primer to initiate the synthesis of the complementary strand the same way as other parvovirus DNA replication, or the so-called “rolling hairpin model”, and the terminal resolution requires Rep78/68 proteins (63). The synthesized ssDNA, either sense or antisense, can be packaged into capsid proteins or go through the next round of replication. AAV capsid proteins Three overlapping capsid proteins, VP1 (87kDa), VP2 (72kDa), and VP3 (63kDa), are synthesized from different start codons under the same promoter p40 (8). All three capsid proteins share their C-terminal sequences and differ in their N-terminal amino acids, and each AAV particle consists of 60 VP proteins containing 3 VP1, 3 VP2, and 54 VP3 (74). Mutations or deletion of VP1 showed no effect on viral particle formation, indicating VP1 is not required for AAV packaging. However, viral mutants lacking normal VP1 have defects in their infection or transduction, suggesting the VP1 specific region is responsible for the infectivity of AAV (37, 40, 95, 102). It has been shown that the VP1 Nterminus of parvovirus, including AAV, has a conserved phospholipase A2 (PLA2) active domain (108). What role this PLA2 region possibly plays in viral infection is still undetermined. VP1 alone is not able to form virus-like particles (VLP) (Warrington et al., unpublished data).

PAGE 18

8 VP2-protein-specific N-terminal region contains a nuclear localization signal (NLS)—PARKRL—between the amino acid 29 and 34 of VP2 (40). It should be noted that due to the overlapping profile of the three capsid proteins of AAV, this NLS signal is also contained in VP1 but not in VP3. Hoque et al. showed VP2 alone can form VLPs, and deletion of the NLS region of VP2 abolishes its ability to form VLPs (40). Preliminary data in Muzyczka’s group showed mutant rAAV vectors lacking VP2 demonstrated similar level of transduction efficiency as rAAV vector, suggesting this protein is not essential for viral packaging or infectivity (Warrington et al., unpublished data). VP3 is the major building block for AAV particles. Transfecting cells with a plasmid containing VP3 alone did not produce VLPs (40), however, if a NLS from simian virus 40 large T antigen was fused to the N-terminus of VP3 protein, or VP3 was co-expressed with VP1 or VP2, VLPs were ready to form (40, 61, 79). These results indicate that VP3 alone, as long as translocated into nuclei, is able to form VLPs, and one possible function of VP1 and VP2 is to bring VP3 from cytoplasmic region to the nuclear region of cells by forming VP1/VP3 complex or VP2/VP3 complex, although direct evidence of such interactions is not available right now. Viral Assembly Using immunocytochemistry and DNA in situ hybridization techniques, Wistuba et al. showed that during the course of AAV/Ad co-infection, AAV Rep proteins were first distributed sporadically in the cell nuclei about 10 hrs postinfection. In the meantime, Cap proteins were not detected. In a later stage, Rep proteins spread homogenously in cytoplasmic and nuclear region, but not in

PAGE 19

9 nucleoli. Viral DNA colocalized with Rep proteins in the nucleus. Cap proteins were synthesized later than Rep proteins, and with VP1 and VP2 found predominantly in nuclei, VP3 was distributed equally in cytoplasmic and nuclear regions. Assembled AAV capsids were first detected in nucleoli about 12 hrs postinfection. The size of AAV containing nucleoli gradually increased, and AAV particles spread all over the nuclei and cytoplasm about 20 hrs postinfection, demonstrating nucleoli is the site of AAV capsid assembly (99). The step of AAV capsid assembly has been described as a formation of empty capsid particles followed by insertion of viral genome (64). By studying the interactions between AAV Rep and Cap proteins, Rep proteins and viral DNA, and the Rep protein themselves, Kleinschmidt’s group proposed that Rep78/68, after covalently linked to the 5’ end of the AAV genome during DNA replication (100), bring the viral DNA to the preformed capsid for packaging. Small Rep52 protein, as a helicase (9, 10, 42), unwinds the tangled different forms of AAV genome and “pump” the ssDNA from its 3’ end into the preformed capsid. Interactions among Rep78, Rep68, Rep52, and capsid proteins have been established, and the interaction sites between Rep and Cap have been mapped to the amino acid 322 to 482 (21, 44, 100). Details about the order of Rep-Cap interaction are yet to be defined. Production of AAV Vectors The uses of AAV for basic research or gene therapy application require the production of high-yield and pure AAV vectors. To this end, the cloning and purification of AAV vectors have been generated and improved since 1980s.

PAGE 20

10 Cloning of AAV Vectors Wild-type AAV was first cloned as a plasmid pSM620 by Samulski et al. in 1982 (80). Generation of rAAV vectors was initiated by either replacing AAV Cap gene in AAV genomic cassette with a foreign gene, or co-transfecting cells with two plasmids: one contained AAV Rep and Cap genes without ITR, and the other contained the foreign genes flanked by viral ITRs (38, 57, 81). Both of these approaches required Ad co-infection, and thus brought Ad contamination to the AAV preparations. In addition, the yield of AAV with these methods did not meet the requirement of clinical studies (33). Efforts have been made to generate helper-free cloning system for AAV production. Xiao et al. reported a plasmid pXX6, which contains Ad helper gene E2A, E4, and VA RNA (63), provides the Ad helper function necessary for efficient AAV replication in 293 cells, which is transformed with Ad E1 genes (103). Thus by co-transfecting 293 cells with three plasmids—one provides viral Rep and Cap genes, one provides Ad helper genes, and the last one provides target genes flanked by ITRs—rAAV vectors can not only be produced without Ad contamination, but also with higher yields (103). Grimm et al. created a plasmid pDG that assembles both AAV Rep/Cap genes and Ad helper genes into one construct, reducing the three-plasmid transfection procedure to a twoplasmid system (32). Attempts to generate rAAV packaging cell line have been made by stably transfecting cells with these plasmids, shedding a light on the possibility of producing rAAV vectors completely free of laborious transfection procedures (14, 25, 54, 69, 93).

PAGE 21

11 Purification of AAV Vectors The first purification method for AAV was based on CsCl gradient centrifugation, and this method is still used today in many labs (2). Major drawbacks of this method include that it is unable to efficiently remove contaminating non-viral proteins, the ratio of genome-containing particles to infectious particles is above 1,000 (meaning 99.9% of viral particles are noninfectious), and the potential toxicity of CsCl is unacceptable to the US Food and Drug Administration (FDA) for the manufacturing of marketed products (2, 92). To improve the AAV vector purification method, especially for large-scale purification, people have tried to use column chromatography as a replacement for CsCl gradient. Based on the knowledge that A20 monoclonal antibody recognizes intact AAV particles (99), Grimm et al. created an AAV-specific immuno-affinity column purification system by coupling A20 antibody to a separose matrix (32). Since the interaction between HSPG and AAV was discovered (72, 91), heparin columns have been extensively used in the purification procedure of AAV vectors. Because many cellular proteins bind to heparin, these contaminating proteins are usually removed by a step-iodixanol gradient centrifugation (109), or by protease digestion followed by solvent extraction (1) before subjected to heparin columns. When a detergent— deoxycholic acid—was used to lyse the cells, protein contaminants were greatly reduced, making the single-step heparin column purification possible (2, 13). Column chromatographic purification significantly enhanced the recovery of AAV vectors (about 70% from the crude cell lysates) and reduced the ratio of genome-

PAGE 22

12 containing AAV particles to infectious particles to less than 50 (1, 2, 13, 15, 32, 92, 109). The most recent and advanced method for the production of a National Reference Standard rAAV vectors as granted by the National Gene Vector Laboratory was described by Potter et al. (68). In their protocol, large scales of cells are lysed by deoxycholic acid and the cell lysates are generated by a Microfluidizer processor (model M-110, Microfluidics International Corporation). Cell lysates are subjected to a round of Pharmacia FPLC XK/26 column chromatography containing the streamline heparin chromatography matrix, a round of phenyl-sepharose hydrophobic interaction chromatography, and a round of heparin affinity column. Viral vectors thus produced give a ratio of genomecontaining particles to infectious particles as low as 6 (68). AAV Gene Therapy AAV has emerged as one of the most promising viral vectors for gene therapy. Long-term transgene expression induced by rAAV vectors has been established in lung, neurons, eye, liver, muscle, hematopoietic progenitors, joint synovium, endothelial cells, and guts (60), and new reports about AAV gene therapy come out weekly. Several clinical trials of AAV gene therapy for the treatment of cystic fibrosis and hemophilia B are currently underway (24, 43). It is not the purpose of this section to make an extensive review about current applications of AAV gene therapy. Instead, the following contexts will focus more on the mechanisms underlying the idea of AAV gene therapy.

PAGE 23

13 Transgene Expression of rAAV Vectors The basic idea of using AAV as a gene therapy vector, as mentioned above, is to package foreign genes into AAV capsid proteins (38, 57, 81). Foreign genes are flanked by AAV ITRs and under the control of different cellular or viral promoters for a stronger expression (104). Unlike wild-type AAV, whose genome goes through site-specific integration into host chromosome during latent infection (52, 53), rAAV genes normally stay episomally in the cells, and two reports showed the second-strand DNA synthesis is the rate-limiting step for efficient rAAV transduction (22, 23). More detailed studies on the rAAV genome in the cells transduced, however, showed a coexisting image of multiple DNA forms. Experiments on muscles and livers showed the sense and antisense ssDNA molecules of rAAV could anneal to each other to form a double-stranded (ds) linear DNA. Annealed dsDNA can be converted into the more stable ds circular form. Circular monomer dsDNA may combine with each other to form a ds circular dimer. Intermolecular recombination of ds circular dimer through their ITRs leads to the concatemerization of rAAV DNA. Linear ds monomer may also form episomal ds concatemers. Integration of such concatemers has been observed, and all these ds forms of rAAV DNA can utilize cellular transcriptional/translational machineries for transgene expression (11, 18, 19, 59, 65, 106). Combined with the above information, it is clear that when the input rAAV vectors are not abundant enough for a large amount of annealed dsDNA to form, the second-strand DNA synthesis of the rAAV DNA is the rate-limiting step for its transgene expression. In the presence of a sufficient amount of ssDNA, however, second-strand DNA

PAGE 24

14 synthesis is not required anymore and the transgenes carried by rAAV are ready to be expressed in the cells. Altered Tropisms by Capsid Modifications The broad tropism of AAV provides rAAV vectors a wide application area (60). On the other hand, the broad tropism also reduces the targeting effects of the vector delivery (74). To increase the targeting of rAAV vectors, two goals have to be achieved: 1) reducing the natural tropism of AAV, and 2) increasing the tissue specificity of AAV. For these purposes, four groups have been trying to locate the sites on AAV capsid for receptor binding and the sites exposed on the surface of the capsid by doing extensive capsid mutagenesis experiments (26, 75, 87, 102). A heparin binding motif used by several viruses for receptor binding was identified as XBBBXXBX (in which B is a basic amino acid and X could be any amino acid) (102); however, this motif is not present on the heparin negative mutants found in above results, suggesting the mutations in those heparin negative mutants cause the conformational changes of viral capsid but do not directly contact HSPG receptor (74). Based on the studies of these heparin mutants, the positions on AAV capsid that are responsible for HSPG binding have been narrowed down to a loop region of VP3 (26, 75, 87, 102), and preliminary data in MuzyczkaÂ’s lab shows that double mutations at amino acid 585 and 588 of AAV capsid protein abolish its heparin binding activity (Opie et al., unpublished data). Evidence also shows other regions on VP3 loop, such as position 509-532, are also involved in heparin binding (102), indicating the heparin binding of AAV requires a certain conformation of the capsid. Positions responsible for secondary receptor binding are not defined so far.

PAGE 25

15 Girod et al. first showed that the amino acid 587 of AAV capsid is exposed to the surface and can be used for the insertion of a 14-amino acid integrin ligand to target AAV to its non-permissive cell lines (26). This position was further explored by others to target tumors (31), the human luteinizing hormone receptor (87), or the human vascular endothelial cells (66). Besides position 587, the Nterminus of VP2 protein has also been shown to be able to tolerate foreign ligand insertion and retarget the vectors (102, 107). Fusing a single-chain fragment variable region (sFv) of a monoclonal antibody against the CD34 molecule to the N-terminus of VP2 protein of AAV demonstrated enhanced transduction to the CD34+ human myoleukemia cell line KG-1, which is normally resistant to rAAV (107), and inserting a serpin ligand at position 34 of the N-terminus of VP2 leaded altered tropism of rAAV vectors (102). The final goal of AAV capsid mutagenesis is to eliminate the AAV natural receptor binding property and to transplant target-oriented ligands, so that the so-called second-generation rAAV vectors can be made with equivalent titer as wild-type capsid rAAV. As an alternative approach to AAV capsid modification, Bartlett et al. explored the possibility of physically linking foreign ligands to AAV particles (4). To make rAAV vectors containing -Gal to transduce AAV non-permissive megakaryocytic leukemia cell lines, they first chemically crosslinked an AP-2 antibody that can recognize the integrin IIb3 on the surface of human megakaryoytes to an A20 antibody that only recognizes intact AAV particles (99). The formed bispecific F(abÂ’ )2 antibody complex was attached to AAV using its A20 part. Thus

PAGE 26

16 modified rAAV vectors gave 70 times higher -Gal transgene expression in megakaryocyte DAMI and MO7e than control (4). Ried et al. combined the above two approaches by cloning an immunoglobulin G (IgG) binding domain of protein A, Z34C, into the green fluorescent protein (GFP) containing rAAV capsid amino acid position 587 (77). The resulted rAAVZ34C-GFP vectors were then bound to different human hematopoietic cell surface protein antibodies at this insertion site. rAAV-GFP vectors modified this way were readily transduce hemotopoietic cell lines, which are non-permissive to wtAAV (77). Specific Aims Since AAV has been extensively used for gene therapy, understanding its natural infection events in more detail will benefit the future applications of this gene delivery vector. The overall object of this thesis is to study the virus-cell interaction during the early phase of viral infection. Two specific aims are described below. To Study the Natural Infectious Entry Pathway of AAV in the Absence and Presence of Ad The interactions between AAV and cellular components were studied using fluorescent virus confocal microscopy, A20 immunocytochemistry, and subcellular fractionation followed by DNA hybridization techniques. Some unclear or controversial issues in the AAV infection events, such as viral endosomal escaping, nuclear migration, viral uncoating, and nuclear translocation were addressed. The effects of the helper virus Ad on AAV infection process were studied in parallel.

PAGE 27

17 To Study the Capsid Mutants that are Defective in Transduction Our previously generated capsid mutant rAAVs contain a group of noninfectious mutants (102). Some of these mutants—mut22, mut37, and mut40—are suspected to be trafficking defective. Mut22 demonstrates a normal heparin-binding pattern, suggesting it is defect in cell internalization, endosomal trafficking, nuclear translocation, or uncoating steps. Mut37 and mut40 only partially bind heparin column, indicating inefficient primary receptor binding may account for its defect. Another mutant, mut41, that carries mutations near those of mut40, also shows partial defect in heparin binding but has a transduction efficiency close to the wild-type rAAV vector, suggesting the intracellular trafficking of mut40 is also impeded at certain steps. Therefore, mut41 was also included in this mutant study as a control to mut40.

PAGE 28

18 CHAPTER 2 MATERIALS AND METHODS Cell Culture HeLa cells and HEK 293 cells were obtained from the American Type Culture Collection (Manassas, VA) and grown in DulbeccoÂ’s modified EagleÂ’s medium (DMEM) supplemented with 10% fetal calf serum, 100 U/mL penicillin, and 100 U/mL streptomycin at 37 oC in a 5%-CO2 atmosphere. Production of Virus Production of Ad Ad was produced as described previously by infecting two cell factories (68) of HEK 293 cells and purified by two rounds of CsCl gradient (102). Empty Ad capsid ts369 was a kind gift from Patrick Hearing (State University of New York at Stony Brook). Production of rAAV Vectors rAAV vectors containing GFP gene were produced by co-transfecting 293 cells with plasmids pIM45, pXX6, and pTRUF5 and titered as described (102). Plasmid pIM45 supplies the Rep and Cap genes of AAV (56) and is used for sitedirected mutagenesis (Stratagene, La Jolla, CA) of mutant rAAVs. pXX6 provides Ad helper functions (103), and pTRUF5 contains the GFP gene that is driven by the cytomegalovirus (CMV) promoter and flanked by AAV ITRs (45). For each rAAV-UF5 vectors, either wild-type or mutant capsid vector, twenty 15-cm dishes of 293 cells at 80% confluency were transfected by above three

PAGE 29

19 plasmids in the molar ratio of 1:1:1 using the calcium phosphate method (109). Cells were harvested 48 hrs after transfection by centrifugation at 1,140xg for 10 mins, and the pellets were resuspended in 10-mL lysis buffer (0.15 M NaCl, 50 mM Tris-HCl [pH 8.5]). Cell suspensions were freeze-thawed in dry ice-ethanol bath and 37oC bath for three times and then treated with 50 U/mL Benzonase (pure grade; Nycomed Pharma A/S) at 37oC for 40 mins. Cellular debris was pelleted by centrifugation at 3,700xg for 20 mins and the clear supernatants were subjected to a step-iodixanol gradient and heparan sulfate affinity column purification as described (109). Titers of the rAAV-GFP vectors were measured by their GFP expression using a serial dilution method as described (102, 109). Production of Wild-Type AAV Particles Wild-type AAV was generated by transfecting a cell factory of Ad (multiplicity of infection (MOI)=5) infected 293 cells with plasmid pSM620 (80), and viral particles were purified by iodixanol step-gradient and heparan sulfate affinity column as described (68, 102, 109). Viral stocks were titered by a DNA slot blotting method (68) except that the hybridization probe was synthesized from the xba I fragment of the plasmid pIM45 (56) using the North2South™ biotin random prime kit (Pierce, Rockford, IL) and the membrane was developed using North2South™ chemiluminescent nucleic acid hybridization and detection kit (Pierce, Rockford, IL). The purity of the labeled virus was assessed by electron microscopy (EM) (68) and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie Blue staining or immunoblotting (102).

PAGE 30

20 Fluorescent Dye Conjugation of AAV and Viral Infection AAV stocks were labeled with Alexa FluorTM 488 fluorescent dye using a protein labeling kit (Molecular Probes, Eugene, OR) according to the manufacturer’s instruction. Labeled virus was dialyzed extensively against 10mM Tris [pH 7.8]-150 mM NaCl with 10% glycerol (6) and further purified by heparin affinity column (102, 109) as described above. Dye-to-viral particle ratios of the Alexa Fluor™ 488 labeled AAV preparations were calculated according to the manufacturer’s instruction, in which the viral particle numbers were determined by DNA slot blotting method and adjusted by the empty-to-full particle ratio obtained from the EM results, and 7.5 g of protein approximately equals to 1012 AAV particles (6). HeLa cells were plated into 35-mm culture dishes containing 22-mm coverslips (Fisher Scientific, Atlanta, GA) pretreated with 50µg/mL type 1 rat tail collagen (Collaborative Biomedical Products, Bedford, MA) in 0.02 N acetic acid. Cells were infected by the purified fluorescent AAV with a MOI of 10,000 DNA particles per cell when 70% confluence was achieved, as described previously with modifications (5, 6, 51). Cells were exposed to the virus for 10 mins at 37oC in the serum-free binding buffer (DMEM supplemented with 10mM HEPES [pH 7.3] and 1% bovine serum albumin), washed twice with binding buffer and once with serum-containing DMEM (DMEM containing 10% fetal calf serum, 100 U/mL penicillin, and 100 U/mL streptomycin), and incubated further at 37oC in the serum-containing DMEM medium for the indicated time. In the case of Ad coinfection, cells were exposed to Ad at a MOI of 10 infectious particles per cell

PAGE 31

21 throughout the experiment courses. Cell samples taken at each time-point were washed three times with binding buffer and twice with phosphate buffer saline (PBS) before being fixed by 4% paraformaldehyde for 10 mins at room temperature. Fixed cells were then stained with 1 M SYTO 64® red fluorescent dye (Molecular Probes, Eugene, OR) for 40 mins at room temperature according to the manufacturer’s instruction, and mounted in glass slides using the VectaShield® for fluorescence mounting medium (VectorLaboratories, Inc., Burlingame, CA). For control experiments, cells were treated by free dye solutions (0.1 L of the 1mL stock, which gave approximately the same amount of fluorescent signal as labeled virus) the same way as they were treated by fluorescent AAV. To localize the nuclei, fixed cells were stained with 1 g/mL DAPI (4’,6’-diamidino-2-phenylindole; Molecular Probes, Eugene, OR) for 5 mins at room temperature and visualized by a Zeiss Axioplan 2 fluorescence microscope (6). Production of A20 Monoclonal Antibody Hybridoma cells secreting A20 monoclonal antibody was kindly provided by Jurgen A. Kleinschmidt (Deutsches Krebsforschungszentrum) and seeded in a 24-well tissue culture dish at a one-cell-per-well ratio. Cells were allowed to grow confluent in serum containing DMEM medium and 50 L supernatant from each well was taken and incubated with 100 L rAAV containing GFP gene (2 103 GFP units/mL) at 37oC for 40 mins. The mixtures were titered for their GFP expression in 293 cells as described (102) and the hybridoma cell strains corresponding to the lowest GFP titers were chosen for A20 production.

PAGE 32

22 Selected hybridoma cells were grown in five 15-cm dishes in the serum-free DMEM and A20 monoclonal antibody was purified from the supernatants using a HiTrap® r protein A column (Amersham Pharmacia Biotech, Piscataway, NJ). The amount of protein was measured by a MILTON ROY Spectronic 601 spectrometer and the purity of A20 preparation was tested by SDS-PAGE followed by Coomassie Blue staining. Immunocytochemistry Immunocytochemistry was performed using unlabeled AAV based on a published method (82) with A20 monoclonal antibody or B1 antibody (ARP Inc., Belmont, MA) as the primary antibody and Cy3-labeled goat anti-mouse immunoglobulin G (IgG, Amersham Pharmacia Biotech, Piscataway, NJ) as the secondary antibody. Nuclear staining was performed using SytoX green nucleic acid staining dye (Molecular Probes, Eugene, OR). Confocal Microscopy Confocal microscopy was performed on a Bio-Rad 1024 ES confocal microscope. For each sample, a series of 0.5m horizontal sections were made through the cells and images representative of the center five or six layers were collected and combined into one picture. Detection of Viral DNA from Cytoplasmic and Nuclear Fractions HeLa cells were seeded in 35-cm dishes and infected by AAV with or without Ad co-infection as described above. After two washes with binding buffer and one wash with PBS, cells were then trypsinized in 1 mL trypsin at 37oC for 10 mins, washed twice with 1 mL PBS each time, and fractionated into cytoplasmic versus nuclear parts as described previously (55, 88) with minor modifications.

PAGE 33

23 Briefly, after the 10-sec vortex in the homogenization buffer with 0.5% NP40, cells were placed on ice for an additional 1 min, and the wash step was performed three times in stead of twice. Purity of each part was tested by immunoblotting of histone H3 using an anti-histone H3 polyclonal antibody, antiPCNA antibody, and anti-hnRNPC antibody (Upstate Biotechnology, Lake Placid, NY), and acid phosphatase activity assay using a EnzChek® acid phosphatase assay kit (Molecular Probes, Eugene, OR) (34). Viral DNA in each sample was isolated by a modified Hirt method (39, 68) and visualized by slot blotting. Ad coinfection was performed as above except when empty Ad capsid was used, the MOI was 1,000 capsids per cell. When the nuclear pore complex (NPC) inhibitor—thapsigargin (Sigma, St. Louis, MO)—was used, cells were pre-treated with 0.5 g/mL thapsigargin in culture medium at 37oC for 40 mins (29, 41), and this concentration of thapsigargin was maintained in the medium during all the following incubations. Subcellular Fractionation and AAV Dot Blotting HeLa cells were seeded in 10-cm dishes and allowed to grow up to about 90% confluence. Virus was added to cells with a MOI of 105 particles per cell in the binding buffer, and cells were incubated at 37oC for 10 mins, with or without 10 MOI of infectious Ad. After the initial 10-min exposure, cells were washed twice with binding buffer, once with serum containing DMEM, and incubated in serumcontaining DMEM with or without Ad (MOI = 10) at 37oC for the indicated time periods. In some experiments, cells were incubated at 4oC immediately after adding virus for 1 hr, or pre-cooled to 4oC for 10 mins before adding virus, then

PAGE 34

24 incubated at 4oC for 1 hr (17). Homogenization of cells was performed according to a method described previously (35). Briefly, cell samples were washed twice with binding buffer, twice with PBS, and trypsinized with 10 mL trypsin at 37oC for 10 mins. Trypsinized cells were washed twice with 10 mL ice-cold PBS, once with 10 mL ice-cold homogenization buffer (0.25 M sucrose, 10 mM triethanolamine [pH 7.6], 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 10 g of aprotinin per mL), and homogenized in a Kontes Dounce tissue grinder (Fisher Scientific, Atlanta, GA) at 4oC until about 80% cell lysis was achieved as monitored by trypan blue uptake. Postnuclear supernatant (PNS) was collected as described (35) and diluted to 6 mL with homogenization buffer. Each 6-mL PNS sample was mixed with equal volume of 60% iodixanol (GibcoBRL, Grand Island, NY) and centrifuged at 200,000 g in an SW41 Ti ultracentrifuge rotor at 15oC for 24 hrs to form 30% continuous iodixanol gradient (68). Twelve 1-mL fractions were collected from the bottom of each tube and labeled with the bottom fraction as fraction 1 and the top fraction as fraction 12. Density of each fraction was measured by weight. In some cases, twenty-four 0.5 mL fractions were collected for each tube. Viral DNA was isolated according to previously described methods (35, 50). Briefly, each fraction was mixed with equal volume of 1N NaOH and heated at 65oC for 1 hr to release viral DNA. Samples were then extracted once with phenol/chloroform/isoamylalcohol (Invitrogen, Carisbad, CA) and once with chloroform, mixed with equal volume of 20 SSC solution, and analyzed as described above using a dot-blot apparatus (Bio-Rad, Hercules, CA). For free virus ultracentrifugation, about 107 viral particles were diluted in 6

PAGE 35

25 mL homogenization buffer, mixed with 6 mL 60% iodixanol, and centrifuged as above-mentioned. Viral DNA from each fraction was then isolated and detected accordingly. Iodixanol gradient ultracentrifugation of viral DNA was performed by adding AAV DNA isolated from 108 viral particles to the gradient followed by centrifugation and dot blotting. Gel films were scanned using a Gel Doc 2000™ gel documentation system (Bio-Rad, Hercules, CA) and signal densities were measured by Quantity One® quantitation software version 4.2 (Bio-Rad, Hercules, CA). Analysis of Endosomal Trafficking Markers Analysis of markers for endocytic organelles was performed based on the published methods with minor modifications (35). Briefly, early endosomes were labeled by pulsing the cells with 50 g/mL biotinylated human holotransferrin (Molecular Probes, Eugene, OR) at 37oC in serum containing DMEM for 10 mins. Cells were then homogenized and centrifuged as described above. Thirty L of each fraction was boiled in SDS sample buffer and loaded on a NitroBind® nitrocellulose membrane (Fisher Scientific, Atlanta, GA) through a dot-blot apparatus. Signals were detected using a North2south™ chemiluminescent nucleic acid hybridization and detection kit (Pierce, Rockford, IL). To study the migration of free transferrin in 30% continuous iodixanol gradient, 1 g of biotinylated human holotransferrin was diluted in 6 mL homogenization buffer and mixed with 6 mL 60% iodixanol. Centrifugation, fraction collection, and signal detection were performed as described above except that each fraction was loaded directly on the membrane. Dense endocytic vesicles were marked

PAGE 36

26 by acid -Gal activity (35) using a FluoReporter® lacZ/galactosidase quantitation kit (Molecular Probes, Eugene, OR) except for the modification to the reaction buffer (200mM sodium citrate [pH4.0], 0.1% Triton X-100 (35)). Thapsigargin Inhibition of Free Nuclear Diffusion of Dextran Fixable Alexa Fluor™ 488 conjugated 10 kDa dextran was purchased from Molecular Probes (Eugene, OR). Thapsigargin inhibition experiment was performed as described previously (29) except that the dextran was administered into cells through an Influx™ pinocytic cell-loading reagent (Molecular Probes, Eugene, OR) according to the manufacturer’s instruction. Cell samples were fixed and stained with SYTO 64® red fluorescent dye and DAPI as described above, and observed on an Applied Precision deconvolution microscope. Receptor Binding and Cell Internalization of rAAV Mutants Studies of the receptor binding and cell internalization of rAAV mutants were performed based on the published methods (82, 102). In vitro heparin binding assays of pIM45, mut22, mut37, mut40, and mut41 were performed using a heparin affinity column, and viral capsid proteins were detected by immunoblotting (102). In vivo cell binding/internalization experiments were conducted as described (82). Briefly, MOI of 100 viral particles were incubated with HeLa cells at 4oC for 1 hr with rocking. Unattached viruses were then washed out by PBS and cell samples were shifted to 37oC for 2 hrs’ incubation. After incubation, cell samples were either scraped or trypsinized for 10 mins and washed twice with PBS. Viral DNA from each sample was isolated (39, 68) and detected by real-time polymerase chain reaction (PCR) method (68).

PAGE 37

27 Nuclear Entry of rAAV Mutants pIM45, mut22, mut37, mut40, and mut41 were incubated with HeLa cells at 37oC with a MOI of 100 for 4 hrs. Nuclear fractions of virus-treated cell samples were isolated (55, 88) and DNA from each fraction was detected by real-time PCR technique (68). Real-Time PCR Detection of Mutant rAAV DNA Real-time PCR detection was performed using ABI PRISMTM 7700 Sequence Detection System and a TaqMan® Universal PCR Master Mix (Applied Biosystems, Foster City, CA) based on a published method (68). GFP was chosen as the marker gene, and primers used were TTCAAAGATGACGGGAACTACAA (upstream) and TCAATGCCCTTCAGCTCGAT (downstream). The TaqMan probe sequence was 6FAM-CCCGCGCTGAAGTCAAGTTCGAAG-TAMRA. Samples were run at 50oC for 2 mins, 95oC for 10 mins, and 40 cycles of 95oC (15 secs)/60oC (1 min) amplification.

PAGE 38

28 CHAPTER 3 DEVELOPMENT OF SUBCELLULAR FRACTIONATION METHODS USING IODIXANOL GRADIENT Introduction For the purpose of studying the cytoplasmic trafficking of AAV, especially the endosomal trafficking, a subcellular fractionation of PNS must be performed to locate the AAV particles in each subcellular compartment. A current available method reported for the subcellular fractionation of AAV infected tissue culture cells was based on sucrose and percoll gradient ultracentrifugation (35). In this method, a sucrose gradient was used to separate different cytosolic compartments, and a percoll gradient was used to further isolate membrane structures. More specifically, after the infected cells were washed once in homogenization buffer (0.25 M sucrose, 10 mM triethanolamine [pH 7.6], 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 100 g of aprotinin per ml), they were homogenized until about 60% cell lysis is achieved (about 15 strokes), and the cell membrane disruption was monitored by trypan blue uptake. The nuclei and intact cells were removed by centrifugation, and the PNS was layered onto a 2mL 1.5 M sucrose cushion for centrifugation. Fractions at the top of the sucrose cushion were found to contain the endocytic organelles, and were concentrated by ultracentrifugation at 135,000 × g for 1 h. The organelles were then further separated by Percoll solution (8% Percoll, 0.25 M sucrose) density gradient

PAGE 39

29 ultracentrifugation in at 35,000 × g for 1 h, and fractions were again concentrated as described above (35). This subcellular fractionation method contains one round of sucrose centrifugation, one round of percoll centrifugation, and two rounds of concentration centrifugations. In those authors’ research, studies were performed on a one-hr time point basis (35). In our research design, however, as many as of seven different time points for each treatment were taken, making this approach laborious and error prone. To solve this problem, we developed a new iodixanol gradient subcellular fractionation method that only requires a single-step 24-hr ultracentrifugation, greatly reducing the workload and on-hand procedures. The idea was originated from the finding that 30% continuous iodixanol gradient is able to separate full (DNA containing) and empty AAV particles, and the full AAV particles migrate towards the bottom of the gradient (68). It was demonstrated that using our method, the free AAV migrates to the bottom layers of the gradient with dense (late) endosomes in the middle and light (early) endosomes on the top. Results and Discussion Characterization of Iodixanol Gradient Subcellular Fractionation AAV enters cells through a receptor-mediated endocytosis pathway via clathrin-coated pits (17), and this endocytic processing is critical for efficient rAAV transgene expression (6, 16, 35). In this study, cell PNS contents were fractionated by a continuous iodixanol gradient centrifugation method and AAV DNA was isolated for the detection of viral localization. The density of this gradient is ranging from 1.32 g/mL to 1.04 g/mL, from the bottom to the top

PAGE 40

30 (Figure 3-1A). Free virus was found at the bottom layer of this gradient (Figure 3-1A, fraction 2, density 1.22 g/mL; Figure 3-1B, lane 1), light endocytic organelles were localized at the top two fractions (Figure 3-1A, fraction 11 and 12, density 1.04 g/mL), as indicated by transferrin—an early endosome marker— after trapped inside the endosomes (Figure 3-1B, lane 3), and dense endocytic organelles were localized in the middle of the gradient ranging from fraction 4 to fraction 9 (Figure 3-1A, density less than 1.16 g/mL), as indicated by acid -Gal activity—a marker for dense endocytic vesicles (Figure 3-1A). Isolated viral DNA was found at fraction 9 and 10 (Figure 3-1B, lane 2) and free transferrin, when not trapped inside early endosomes, was at the bottom layers (Figure 3-1B, fraction 1 and 2) of this gradient. Isolation and Dot Blotting Detection of AAV DNA Low molecular weight viral DNA is usually isolated based on a Hirt method (39). This method employs protease digestion of viral and cellular proteins to release viral DNA, SDS and high-salt precipitation of genomic DNA and some cellular proteins, phenol-chloroform extraction to remove soluble proteins, and ethanol precipitation of low molecular weight viral DNA. Through this approach, high-quality viral DNA can be purified for further molecular biological uses, such as real-time PCR performed in this thesis project (68). Due to the large amount of samples handled in the iodixanol gradient subcellular fractionation procedures, however, the Hirt method is laborious and unnecessary for dot blotting detection. For the particular purpose of subcellular fractionation DNA isolation, we adopted and characterized a more recently developed method for viral,

PAGE 41

31 Figure 3-1. Continuous iodixanol gradient subcellular fractionation of PNS of HeLa cells. A. Density distribution of the 30% continuous iodixanol gradient ( ) and -Gal activity distribution in the gradient ( ). B. Migration of different materials in the gradient. Lane 1: free virus; lane 2: isolated AAV DNA; lane 3: transferrin in early endosomes; and lane 4: free transferrin. A B

PAGE 42

32 especially AAV DNA isolation (35, 50). In this method, viral protein and cellular proteins are dissolved in 0.5N NaOH at 65oC for 1 hr. Proteins are then removed by phenol-chloroform extraction and viral DNA is loaded directly on the hybridization membrane in solution after “neutralized” by mixing with equal volume of 20xSSC solution. This method is well suited for large-amount sample handling and dot blotting because for dot blotting method, a large volume of DNA-containing solution can be passed through a small area of hybridization membranes and the precipitation of DNA is not absolutely required. We tested this method as follows before applying it to the next experiments. Phenol-chloroform extraction enhances the detection After 2-hr infection with AAV, cell PNS samples were fractioned on 30% continuous iodixanol gradient. Twenty-four 0.5 mL fractions were collected and incubated with equal volume of 1N NaOH at 65oC for 1 hr. Samples were either loaded directly on the hybridization membrane or extracted with phenolchloroform before loaded on the membrane through a slot-blot apparatus. In Figure 3-2A, results clearly show that more viral DNA bands were detected with a phenol-chloroform extraction step (right panel) than without (left panel). This result indicates that although proteins were dissolved by NaOH, they can still interfere with DNA-hybridization membrane interaction, and a round of phenolchloroform extraction is able to greatly remove the proteins in the solution and enhance the detection limit of viral DNA. SSC solution enhances DNA binding to the membrane After gradient fractions were treated with 0.5N NaOH, a 20xSSC was used to

PAGE 43

33 Figure 3-2. Test of DNA dot-blot conditions. A. NaOH treated fractions from iodixanol gradient were subjected to Hirt DNA extraction and slot blotting without (left panel) or with (right panel) phenol-chloroform extraction step. B. Fractions from iodixanol gradient were treated with NaOH, extracted with phenolchloroform, and then either mixed with 20xSSC or directly loaded on the hybridization membrane for dot blotting. C. Fractions from the gradient were either treated with NaOH+phenol-chloroform+20xSSC and loaded on the membrane, or treated with NaOH+Hirt+EtOH precipitation before subjected to dot blotting. B A C

PAGE 44

34 “neutralize” the solution (50). In our experiments, the effect of 20xSSC was tested in terms of the viral DNA detection, either in the case of the fractionation of PNS of AAV infected cells (Figure 3-2B, “10min”), or the fractionation of the gradient where only the purified virus was added (Figure 3-2B, “virus”). In both cases, mixing equal volume of 20xSSC with NaOH treated fractions greatly enhanced the detection limit, suggesting the increase of salt concentration will increase the DNA-membrane binding activity (Figure 3-2B). On the contrary of the “neutralization” explanation, we found that adding 20xSSC (pH 8.0) did not change the pH value of the NaOH treated fractions (pH 14), suggesting pH does not interfere with the DNA-membrane interaction and this interaction is dependent on the salt concentration. Precipitation of DNA does not improve the detection Compared with traditional Hirt method, NaOH treatment followed by phenolchloroform extraction and 20xSSC mixing can reduce significant amount of onbench work in dot blotting. To compare the efficiency of these two methods, PNS samples of HeLa cells infected by AAV for different periods were taken and fractioned as described above. Fractions were treated with 0.5N NaOH by mixing with equal volume of 1N NaOH and then either went through the phenolchloroform plus 20xSSC protocol, or extracted with phenol-chloroform followed by ethanol precipitation to generate purified viral DNA. Side-by-side comparison showed no obvious difference between these two methods (Figure 3-2C), indicating the simple DNA detection method we adopted is equally efficient to the standard method.

PAGE 45

35 Conclusion In this part of thesis project, we developed a 30% continuous iodixanol gradient method to fractionate the subcellular compartments of AAV infected HeLa cells. This method has been shown capable of separating virus escaped from endosomes into the cytoplasm from virus trapped in endosomal compartments, including light (early) or dense (late) endosomes. An easy viral DNA detection method was also tested and results demonstrate that for efficient DNA detection, a phenol-chloroform extraction step is necessary, increasing the salt concentration of DNA-containing solutions by 20xSSC can enhance the DNA-hybridization membrane interaction, and samples thus treated can be subjected to dot blotting directly without precipitating DNA using ethanol. The development of this system provides us a powerful tool to study AAV intracellular trafficking events.

PAGE 46

36 CHAPTER 4 AAV NATURAL INTRACELLULAR TRAFFICKING Introduction AAV has demonstrated a broad tropism in terms of infected cell types (60). It has been shown that the AAV enters cells in clathrin-coated pits, and this process requires dynamin, a 100-kDa cytosolic GTPase (17). Three receptors have been identified for AAV to enter its host cells. HSPG is necessary for AAV to make a stable contact with the cell surface (72, 91). Efficient cell internalization of AAV, however, requires another cellular receptor, such as integrin v5 receptor (82, 90) or FGFR1 (70). The AAV cytoplasmic trafficking events, viral uncoating, and nuclear translocation, although under extensive studies (6, 16, 17, 27, 34-36, 82), are still not fully understood. In this section of the thesis work, we studied the infectious entry process of AAV by tracing AAV proteins, viral DNA, and intact viral particles using fluorescent-dye labeled AAV, A20 antibody immunocytochemistry, and subcellular fractionation techniques. Results and Discussion Production of AAV Virions Wild-type AAV was produced by transfecting 293 cells with plasmid pSM620 (80) and purified by step-iodixanol gradient and heparin affinity column (109). EM, SDS-PAGE Coomassie blue staining, and Western blotting studies of the AAV preparations indicate no contamination of Ad, cellular proteins, or degraded

PAGE 47

37 Figure 4-1. Characterizations of Purified AAV Virions. A. EM image of AAV. B. Coomassie blue staining of AAV capsid proteins. C. Western blotting of AAV capsid proteins. A B C

PAGE 48

38 AAV capsid proteins (Figure 4-1A, 4-1B, and 4-1C), and the empty-to-full particle ratio of AAV is about 3:7, as calculated from EM results (Figure 4-1A). Fluorescent AAV Shows A Slow Nuclear Entry Pattern Using fluorescent virus to study the viral infection—particularly for the study of AAV—at early stages has been commonly used lately (5, 6, 34, 51, 82, 83). In our experiment, a green fluorescent dye—Alexa Fluor™ 488 was used to covalently label AAV. The calculated dye-to-virus ratio of labeled virus preparations was between 1 and 2, which is close to the values reported elsewhere (6, 82, 83). Before incubation, cells were pulsed by labeled AAV at 37oC for 10 mins to allow internalization, as described (6, 51). Cell samples were counter-stained with red SYTO 64® dye, which gave the shape of the whole cell (Figure 4-2A,B), and nuclei position was detected by DAPI staining (data not shown). In agreement with previous report (6), fluorescent virus (yellow) showed a gradual perinuclear accumulation during the first 4-hr infection period (Figure 42A). Furthermore, majority of the viral signal maintained this perinuclear pattern up to 12 hrs postinfection before diffusing into the nuclear area at 16 hr postinfection, as shown in Figure 4-2A. Large amount of fluorescence could be detected inside the nuclei since 24 hrs postinfection, and after 48 hrs postinfection, fluorescent signals could solely be detected in the nuclear region (Figure 4-2A). It has been our experience that dialysis alone is not sufficient to remove the excessive amount of free dye from the labeled virus in the reaction. In addition to an extra heparin-affinity-column purification step, we performed a free-dye control experiment to eliminate the possibility of free-dye artifact (see Chapter 2

PAGE 49

39 Materials and Methods ) (Figure 4-2B). In contrast to AAV infection, majority of free Alexa Fluro™ 488 dye rapidly entered cell nuclei from 2 hrs to 8 hrs postinfection (Figure 4-2B), when labeled virus still resided outside the nuclei (Figure 4-2A). Since 12 hrs postinfection, the free dye started to migrate out of the nuclei and could only be found in the cytoplasm at 24 hr postinfection (Figure 4-2B). This distinguished distribution pattern of free dye from labeled AAV suggests that the unremoved dye molecules did not bring contamination to the AAV results. Immunocytochemistry Shows A Persistent Perinuclear Localization of Intact AAV Particles Fluorescent-dye-labeled virus can only provide information about viral proteins. Whether those fluorescent signals represent intact viral particles or dissociated capsid proteins, however, is unknown. To address this question, we performed an immunocytochemistry assay using A20 monoclonal antibody (Figure 4-3A and 4-3B). A20 antibody has been demonstrated to be able to specifically recognize the intact AAV particles with a defined 3-D structure and used to detect intact AAV particles in immunocytochemistry (49, 99, 101). In agreement to fluorescent virus data (Figure 4-2A), AAV showed a gradual perinuclear accumulation pattern during its early infection (up to 12 hrs postinfection, Figure 4-3A). In contrast to fluorescent virus results, however, intact AAV particles continuously stay outside cell nuclei throughout the 48-hr experimental period, although some small clusters of intact AAV particles may be observed inside nuclei since 24 hrs postinfection (Figure 4-3A and B). Whether this small amount of intact AAV particles found in nuclei were caused by AAV

PAGE 50

40 Figure 4-2. Fluorescent-dye-conjugated AAV infection. A. Infection of HeLa cells using fluorescent AAV. B. Incubation of HeLa cells using free fluorescent dye.

PAGE 51

41 nuclear translocation, cell division, or capsid reassembling (99) is unknown, but the seemingly colocalization of AAV signals with nucleoli suggests the last possibility, because empty AAV capsids are first assembled in nucleoli before spread to the whole cell area (99). These data and fluorescent virus data together indicate the nuclear entry of AAV follows a slow and regulated mode. A control experiment was performed to show only when both AAV and A20 are present can we observe the signals (Figure 4-3C). We also sought to determine the localization of disassembled AAV capsid proteins by using B1 antibody immunocytochemistry. B1 antibody has been shown to recognize only dissociated AAV capsid proteins but not intact AAV particles (99). We hypothesized that the combined use of A20 and B1 immunocytochemistry would help provide direct evidence when and where the viral uncoating happens. Although successful uses of B1 for immunocytochemistry has been demonstrated in AAV production experiments (99), due to the inability to use large amount of virus in infection studies and very little viral particles disassemble in early infection stage, we have shown here that background interference could not be eliminated in this case (Figure 4-4) because B1 antibody alone could give the same intensity of signals as AAV+B1. Background interference is not a problem in B1 immunocytochemistry of AAV production study because in that case a large amount of viral capsid proteins are synthesized.

PAGE 52

42 Figure 4-3. A20 immunocytochemistry detection of intact AAV particles. A. Immunocytochemistry detection of AAV intact particles at different time points. B. Nuclear staining of 10 min and 12 hr time points. C. Control experiments showing the specificity of A20 antibody.

PAGE 53

43 Figure 4-4. B1 antibody immunocytochemistry detection of intact AAV particles.

PAGE 54

44 Viral DNA Follows the Same Slow Nuclear Entry Pattern as Viral Proteins With the knowledge of the migration of viral proteins (Figure 4-2A) and intact viral particles (Figure 4-3A), we further studied the viral infection by tracing the viral DNA using a slot-blot method. Cells were fractionated into cytoplasmic and nuclear parts, and no cross-contamination was confirmed by showing no histone H3 in cytoplasmic part (Figure 4-5C) and less than 0.5% acid phosphatase activity in nuclear part. As supplementary control experiments, the presence of proliferating cell nuclear antigen (PCNA) and heterogeneous nuclear ribonucleoprotein complex (hnRNPC) in each fraction was also examined by Western blotting (Figure 4-5C). PCNA is normally found in cell cytoplasm, and is only present in the nuclei of dividing cells, such as HeLa cells (88). The hnRNPC shuttles between the cytoplasm and nucleus but predominantly resides in the nucleus (48, 76). Typical distributions of PCNA and hnRNPC further proof the integrity of the cytoplasmic and nuclear fractions. As for the slot blotting results, no observable amount of viral DNA can be seen in the nuclear fractions until 16 hrs postinfection, and the amount of DNA inside cell nuclei then gradually increased to a significant level at 48 hrs postinfection (Figure 4-5A). The nuclear translocation of viral DNA coincides with that of the viral proteins (Figure 4-2A), while intact AAV particles remain outside nuclei (Figure 4-3A). These data suggest that the AAV, after accumulates perinuclearly, uncoats prior to or during the entry of cell nuclei. Interestingly, similar endocytic process and long-term perinuclear accumulation pattern were also found in AAV type 5 infection to HeLa cells (3), despite its capsid has only 45% homology to that of AAV (12) and it requires different cellular receptor to enter the cell (96).

PAGE 55

45 Figure 4-5. Slot-blot detection of AAV DNA. A. Slot-blot results of AAV DNA extracted from cytoplasmic and nuclear fractions after indicated periods. B. Quantification of nuclear DNA vs total DNA. C. Western control experiments showing the purity of cytoplasmic (cyt) or nuclear (nuc) fractions.

PAGE 56

46 AAV Rapidly Escapes From Light Endocytic Organelles into Cytoplasm AAV enters cells through a receptor-mediated endocytosis pathway via clathrin-coated pits (17), and this endocytic processing is critical for efficient rAAV transgene expression (6, 16, 35). The use of brefeldin A, which caused early endosomes to form a tubular network, lowered luciferase expression of rAAV by 2-3 logs (16), and ammonium chloride inhibition study suggested AAV escape from early endosomes of HeLa cells from 40 mins to 90 mins postinfection (6). In this study, cell PNS contents were fractionated by a continuous iodixanol gradient centrifugation method. After initial 10-min incubation with HeLa cells, AAV was readily detected in the cytoplasm in both early-endosome-trapped and endosome-escaped forms (Figure 4-6A, “37oC 10min” to “37oC 8hr”). Increasing amount of virus left early endosomes with the proceeding of infection by showing an elevated ratio of escaped versus endosome-associated AAV (Figure 4-6B). Incubation of virus with cells at 4oC for 1 hr showed no free virus in this gradient (Figure 4-6A, “4oC entry”), indicating the virus attached to the cell surface was efficiently removed by trypsinization ( Chapter 2 Materials and Methods ) and the free virus signals mentioned above truly belong to the virus escaped from endosomes. However, virus in this treatment was found in early endosomes (Figure 4-6A, “4oC entry”), suggesting a rapid viral endocytosis between the addition of virus to cells and transfer of cells to 4oC. This observation was confirmed by the view that AAV crosses cell membrane in about 1.2 seconds and enters endosomal compartments in the range of 64 milliseconds (83). When both cells and virus were pre-cooled to 4oC before incubation at 4oC for 1 hr (17), no signal was identified (Figure 4-6A, “4oC

PAGE 57

47 no entry”), indicating no viral entry occurred. No significant amount of AAV was detected in dense-endocytic-vesicle region throughout the research courses. Our data, similar to the result of a study that canine parvovirus co localizes with transferrin—an early endosome marker—for hrs during infection (67), agree with the early-endosome-escaping model, and more than half of the entered AAV could be found in the cytosol as early as 10 mins after the incubation (Figure 46A and 4-6B). In another report, however, AAV was found in both light (early) and dense (late) endocytic organelles of AAV permissive 293 cells, but only in light endocytic vesicles of NIH 3T3 cells which are less permissive to AAV, despite the fact that about same amount of endosome-escaped virus could be detected in both cell lines (35). We also noticed a small fraction of AAV virions (about 10%, Figure 4-6A,B “37oC 8hr”) are persistently associated with early endosomes although more than half of the virions escapes from this compartment as early as 10 mins. This finding suggests there may be divergent behaviors in the same population of the virus. Conclusion In summary, our results based on the study of the major AAV population using fluorescent virons, A20 immunocytochemistry, cytoplasm-nucleus fractionation, subcellular fractionation, and DNA hybridization techniques suggest that AAV enters the cell rapidly and escapes from early endosomes with a t1/2 about 10 mins postinfection. Cytoplasmically distributed AAV accumulates outside the nucleus and viral uncoating happens before or during the slow nuclear entry around 16 hrs postinfection.

PAGE 58

48 Figure 4-5. Subcellular fractionation of AAV. A. Dot-blot detection of AAV DNA from the fractionated PNS of AAV infected HeLa cells at the indicated conditions. B. Intensities of escaped virus signals (fraction 2) and early-endosomeassociated virus signals (fraction 11 and 12) were plotted as the ratio of escaped to endosome-associated virus.

PAGE 59

49 CHAPTER 5 AAV INTRACELLULAR TRAFFICKING IN THE PRESENCE OF AD Introduction Ad is able to provide helper function for the lytic production of AAV virions using its E1A, E1B, E2A, E4, and VA RNA early genes (63, 103), and this helper function is believed to be due to the facilitation of AAV second-strand DNA synthesis (8, 22, 23, 63). It is not well studied whether this helper virus could also contribute to AAV life cycle during its infectious entry phase. Ad attaches to its host cells through the coxsackie-adenovirus receptor (7). Its interaction with integrin v3 and v5 facilitates both the internalization and membrane permeabilization of Ad to the host cells (97, 98). Despite the similarity of cell entry patterns between Ad and AAV, fluorescent-dye-labeled Ad and AAV were found localized at different subcellular compartments after internalization (6), suggesting these two viruses do not have physical contacts during their cytosolic trafficking. In this section of the thesis, we studied whether Ad also facilitate the intracellular trafficking of AAV, especially its nuclear translocation process when Ad is co-infected using the experimental methods we developed in the previous two chapters.

PAGE 60

50 Results and Discussion Immunocytochemistry Shows Ad Significantly Enhances the Nuclear Translocation of Intact AAV Particles The rate-limiting step of the productive AAV replication is the second-strand synthesis (22, 23), and this process can be facilitated by Ad co-infection (60, 74). In this study, we tested if Ad co-infection could also enhance the AAV infection in terms of its nuclear translocation. In contrast to the situation with Ad co-infection, intact AAV particles were readily detected as early as 40 mins post-infection in the presence of Ad using A20 immunocytochemistry method, and significant nuclear localization of intact AAV particles was observed throughout the 24-hr experiment period (Figure 5-1). It should be noted that during all courses of this experiment, AAV intact particles were found distributed in both cytoplasmic and nuclear regions, and in the presence Ad co-infection, AAV capsid synthesis starts from 12 hrs postinfection (99). Therefore, signals in time courses after 12 hrs also reflect the de novo produced AAV particles (Figure 5-1). DNA Blotting Shows Ad Capsid Proteins Can Facilitate AAV Nuclear Translocation DNA slot blotting was performed the same way as described in Chapter 4. The viral DNA data in the presence of Ad also showed that viral DNA started to enter cell nuclei as early as 40 mins postinfection, and the amount of viral DNA found in nuclei gradually increased (Figure 5-2A). This finding confirmed the above A20 immunocytochemistry results (Figure 5-1). After 8 hrs postinfection, in agreement with previous results (62), newly synthesized viral DNA were observed by showing more DNA signals than input (12 to 48-hr data, Figure 52A). Reduced amount of AAV DNA found in 48-hr nuclear sample was probably

PAGE 61

51 Figure 5-1. A20 immunocytochemistry of AAV with Ad co-infection. A. A20 immunocytochemistry from 10 min to 24 hr postinfection. B. Nuclear staining at 10 min and 40 min.

PAGE 62

52 due to the damages to the nuclei caused by viral replication. Combined with immunocytochemistry data, it is clear that Ad can significantly increase the nuclear translocation of intact AAV particles. This helper function of Ad is unlikely caused by Ad early gene expression—which normally occurs from 1 hr through 5 hrs postinfection (86), but may rather be provided by its capsid components. To test this theory, we used empty Ad particles to perform the same DNA slot-blot experiment. Because the ratio of Ad particle titer to infectious titer is usually 1,000:1 (86), a MOI of 1,000 Ad empty particles was employed in comparison to previous MOI of 10 infectious particles. Although this adaptation makes our control experiment use 10-fold less amount of Ad particles, the low yield of empty Ad particles did not allow us to make an exact match. Still, Ad facilitated AAV nuclear translocation was observed when empty Ad capsids were used, although there may appear to be a delay of this procedure (Figure 52B). This result shows empty Ad capsid alone is able to help intact AAV nuclear translocation, and the early gene expression of Ad is not absolutely required. It has been shown that both active and transcription-defective Ad particles can induce extracellular signal-regulated kinase ½ (ERK½) and p38 kinase pathways at 10 and 20 mins postinfection, respectively, but transcription-defective Ad particles are relatively less efficient than active Ad (94). ERK½ and p38 have been found able to activate PLA2 activity by phosphorylate the enzyme (28, 47, 78). A conserved PLA2 domain is found in all parvovirus, including AAV (108), and expressed proteins of this domain on AAV demonstrated PLA2 activity (27). Preliminary data in our lab indicate that AAV particles also show this PLA2

PAGE 63

53 activity (Opie et al., unpublished data), and mutations to the N-terminus of AAV VP1 that contains the PLA2 domain cause infection defective AAV mutants (27, 102). Taken together, the interaction between AAV and Ad is possibly mediated by their cross-talk in their respective signal transduction pathways, although the function of AAV PLA2 activity in AAV infectious process is not clear yet. Alternatively, Ad capsid proteins have been shown to alter the integrity of cellular membranes (84, 85), which may also contribute to the increased permeability of nuclear membrane to AAV. Endosomal Trafficking of AAV Is Not Altered by Ad Ad internalizes cells with a t1/2 of 2.5 mins (51), escapes from early endosomes with a t1/2 of 5 mins by disrupting the endosomes using its penton base (86), quickly undergoes a stepwise uncoating to release its structural proteins (within 10 to 15 mins), and finally injects its DNA contents into the nuclei through the nuclear pore (30). More than 80% Ad proteins are associated with the nuclei within 1 hr of infection (51). Despite its rapid endosomal escaping and nuclear accumulation, it is implausible that Ad assisted the endosomal trafficking of AAV in that AAV is able to leave endosomes efficiently in the absence of Ad (Figure 4-5A and 4-5B), and previous results show Ad and AAV enter cells through distinct endocytosis pathways (6). In this study, AAV was similarly found in both early-endosome-associated and free forms in the presence of Ad co-infection, and the ratio of escaped versus endosome-associated virus showed a same increasing trend (Figure 5-3A and 53B), suggesting Ad—consistent with earlier results that Ad and AAV undergo different endocytic pathway (6)—does not alter the endocytic processing of AAV.

PAGE 64

54 Figure 5-2. DNA slot blotting detection of AAV DNA with Ad co-infection. A. Slot-blot data of AAV in the presence of MOI 10 infectious Ad. B. Slot-blot data of AAV in the presence of MOI 1,000 empty Ad particles. A B

PAGE 65

55 Due to the nuclear entry, the relative amount of escaped virus found in PNS in this treatment, however, was significantly lower than that without Ad co-infection (comparing Figure 5-3B and Figure 4-5B). This result further supports that Ad facilitates AAV nuclear translocation after AAV endosomal escaping. NPC Inhibitor Does Not Block Ad Facilitated AAV Nuclear Translocation Since Ad does not alter the endocytic pathway of AAV, we hypothesized its facilitation of AAV nuclear translocation was due to the change of NPC function. This hypothesis was tested by studying AAV nuclear entry in the presence of Ad co-infection when cell NPCs were blocked by thapsigargin, an inhibitor of the endoplasmic reticulum/nuclear envelope-resident calcium pump (29, 41). Thapsigargin was shown to inhibit NPC complex by blocking the free nuclear diffusion of 10 kDa dextran (Figure 5-4C) as described (29). AAV thus treated showed same rapid nuclear entry (Figure 5-4A), however, its replication was delayed by 12 hrs compared to the drug free result (Figure 5-2A) by showing a nuclear/cytoplasmic DNA overturn at 24 hrs postinfection instead of 12 hrs. In addition, no cytopathic effect was observed for drug treated cells after 48 hrs postinfection (data not shown). When the Ca2+ -free SMEM, which is necessary for the function of thapsigargin, was replaced by DMEM, normal AAV replication profile was restored (Figure 5-4B). These results show that the Ad enhanced AAV nuclear translocation is independent of the NPC function because AAV nuclear entry was not affected by thapsigargin but other replication factors were blocked by this drug, showing a 12-hr delay of AAV DNA replication (Figure 54A).

PAGE 66

56 Figure 5-3. Subcellular fractionation of AAV with Ad co-infection. A. Dot-blot detection of AAV DNA from the fractionated PNS of AAV/Ad infected HeLa cells at the indicated conditions. B. Intensities of escaped virus signals (fraction 2) and early-endosome-associated virus signals (fraction 11 and 12) were plotted as the ratio of escaped to endosome-associated virus. A B

PAGE 67

57 In another report, AAV alone was found to be able to enter the isolated nuclei even when the NPC was physically blocked by wheat germ agglutinin (36). Our data agree with their NPC independent AAV nuclear translocation model, although they did not use Ad in their experiment. As suggested previously, PLA2 activity on AAV capsid can be activated by Ad co-infection, the efficiency of AAV nuclear entry therefore is possibly depended on the state of PLA2 activity. More work in this direction is required to fully understand the nuclear entry mechanism of AAV. Conclusion In summary, our results in this chapter show that in the presence of Ad coinfection, cytoplasmic AAV quickly translocated into the nucleus as intact particles. The enhanced nuclear translocation of AAV is independent of NPC but may rather due to the cellular signaling kinases activated by Ad infection. Further studies on the interaction of AAV with the nucleus are required to fully understand the nuclear entry process of this virus.

PAGE 68

58 Figure 5-4. AAV/Ad co-infection with NPC inhibitor. A. Slot-blot detection of AAV DNA in the presence of Ad and NPC inhibitor in the Ca2+-free SMEM. B. Slotblot detection of AAV DNA in the presence of Ad and NPC inhibitor in DMEM. C. Control experiment showing the functionality of the NPC inhibitor. Panel 1-3: without drug; panel 4-6: with drug; panel 1 and 4: fluorescent 10kDa dextran; panel 2 and 5: nuclei stain; panel 3 and 7: merged image from previous two.

PAGE 69

59 CHAPTER 6 INTRACELLULAR TRAFFICKING OF AAV CAPSID MUTANTS Introduction In a previous project I participated, we have generated a series of capsid mutants of rAAV carrying GFP using site-directed mutagenesis technique (102). The amino acid alanine was used to replace clusters of charged amino acids throughout the capsid region of AAV, and 48 capsid mutants were thus generated (Figure 6-1A). Cell lysates containing each mutant were titered based on their GFP expression at both 32oC and 39oC with Ad co-infection, and mutants were categorized into four classes based on their GFP titers (Figure 61B). Class 1 mutants have similar titers to the wild-type capsid rAAV, class 2 mutants are partially defective (infectious titers 2-3 logs lower than wild-type rAAV), class 3 contains temperature sensitive mutants, and class 4 mutants are totally defective (infectious titers 4-5 logs lower than wild-type rAAV) (102). Some of the mutants in class 4, including mut22, mut37, and mut40, are of our interest. These mutants bind or partially bind to the HSPG receptor, as shown by heparin affinity experiments, they have complete capsid structure that can be readily detected by A20 antibody, and they contain normal amount of DNA in their capsids. We hypothesized therefore that these mutants must defect in the steps of intracellular trafficking between cell membrane internalization and viral uncoating. In this part of thesis, we have studied the cell binding, internalization, nuclear localization, and replication profiles of these three mutants plus another

PAGE 70

60 class 2 mutant, mut41. Mut41 was chosen because it carries mutations close to those on mut40, and both mut41 and mut40 partially bind heparin column. However, mut41 shows a much higher infectious titer than mut40, indicating other trafficking flaws also contribute to the defect of mut40. Therefore, mut41 was studied as a control for mut40. Results and Discussion Cell Surface Binding and Internalization Study Heparin column binding assay was performed as described (102). In Figure 62A, T indicates the total virus loaded on the column, F means the flow-through fraction, W is the washing fraction, and E is the eluted fraction. As shown by heparin binding assay, mut22 binds to heparin, the primary receptor of AAV, just as well as the wild-type capsid virus pIM45, suggesting it is not defective in cell binding. Mut 37 also binds to heparin, but less efficiently compared with Mut 22 and pIM45. Mut40 and mut41 bind heparin column inefficiently, suggesting the inability to bind the cell surface accounts partly for their low infectious titers (102) and high DNA particle-to-infectious particle ratio (Table 6-1). To study the in vivo cell binding and internalization of mutant viruses and pIM45, equal amount of DNA-containing particles of each mutant were incubated with HeLa cells at 4oC for 1 hr for cell binding. Unbound virus was then removed by washing the cells extensively and cells were then shifted to 37oC for 2 hrs. Cell samples were either digested using trypsin for 10 mins to remove the surface-bound virus (trypsin) for the determination of internalized virus, or collected by scraping (scrape) for the determination of total virus associated with the cells. Viral DNA in each sample was isolated and detected by GFP real-time

PAGE 71

61 Figure 6-1. Generation of rAAV capsid mutants. A. A putative secondary structure of AAV capsid proteins showing positions of alanine scanning mutants. B. Comparison of infectious titers of virus wild-type or mutant capsid rAAVs contained in cell lysates. Copyright © American Society for Microbiology, Journal of Virology, Vol. 74(18), 8635-47, 2000. A B

PAGE 72

62 PCR method ( Chapter 2 Materials and Methods ). In agreement with heparin binding assay results (Figure 6-2A), mut22 binds to cell surface as efficiently as pIM45, and mut37, mut40, and mut41 only have the cell binding capabilities of 17%, 31%, and 2% of that of pIM45, respectively (Figure 6-2B, scrape; Figure 62C, % attached; Table 6-1). It should be noticed that mut37, although showed higher heparin binding capacity in the in vitro study, demonstrated lower cell binding efficiency than mut40. In the condition we used here, about 56% of the input pIM45 attached to the cells. Efficient AAV cell internalization requires additional interactions between AAV and cellular factors, such as integrin v5 and FGFR1 (70, 71, 73, 90). In this cell internalization analysis, mut22 and mut37 did not demonstrate any defect by showing 93% and 86% of bound virus finally internalized, respectively, close to the internalization efficiency of pIM45 (97%) (Figure 6-2B, trypsin; Figure 6-2C, internalized; Table 6-1). Only 31% of bound mut40 and 42% of bound mut41 entered cells, indicating they are not only defect in the cell binding, but also deficient in cell internalization. Sensitivity of the real-time PCR GFP measurement was tested by running a serial dilutions of pTRUF5 plasmid corresponding to 10 to 1010 DNA containing viral particles. Threshold cycle value (CT) was taken at the 45o angle of each run (Figure 6-3A), and the linear range of the measurement was shown to be between 1,000 to 108 DNA containing particles (Figure 6-3B). All data measured in this chapter of experiments fell into this linear range.

PAGE 73

63 Figure 6-2. Virus cell binding and internalization studies. A. Heparin column binding assay. T: total; F: flow-through; W: wash; E: elution. B. Equal amount of DNA particles of rAAVs were incubated with HeLa as described in Materials and Methods . Viral DNA for each rAAV type was isolated and measured by realtime PCR to determine the cell surface binding and internalization. C. Interpretation of B. % internalized was determined by dividing viral DNA associated with “scrape”-treated cells with DNA associated with “trypsin”-treated cells. % attached was the percentage of an attached mutant of the attached pIM45.

PAGE 74

64 Figure 6-3. Real-time PCR detection of GFP genes. A. CT values of serial dilutions of standard plasmids. B. Linear range of detection. X axis represents corresponding viral particle numbers. A B

PAGE 75

65 Virus Nuclear Translocation Study After 4 Hrs Postinfection Equal amount of DNA containing particles of each type of virus was incubated with HeLa cells together with a MOI of 10 infectious particles of Ad for 4 hrs, and viral DNA was then isolated from cell nuclei and analyzed by real-time PCR. Four-hr nuclear accumulation results were shown in Figure 6-4 and Table 6-1. Both mut37 and mut40 showed less than 10% nuclear accumulation of their DNA compared with pIM45, suggesting the inefficient nuclear entry, in addition to inefficient receptor binding, also contributes to their defect in transduction. Despite of its inefficient binding as shown in the receptor binding experiment (Figure 6-2), mut41 delivered about 3% of its DNA into the nuclei within 4 hr postinfection, which is about 18% efficient of wild type pIM45. This result indicates that although mut41 binds to its receptor inefficiently, but extended incubation will lead more viral particles to enter, and this mutant is not defective in intracellular trafficking once gets internalized (Figure 6-4, Table 6-1). As for mut22, the nuclear delivery of its DNA is about 30% efficient as pIM45 (Figure 6-4, Table 6-1). Also this mutant showed no defect in receptor binding and cell internalization in the previous experiment (Figure 6-2). The reason for the inefficient transduction of this mutant, therefore, may be the inability to uncoat in the nuclei, and requires more extensive study. Conclusion From the preliminary data generated from above studies, we have found that mutations on AAV capsid can cause inefficient cell binding (mut37, mut40, and mut41), inefficient viral internalization (mut40 and mut41), or inefficient nuclear entry (mut37 and mut40). In addition, viral uncoating difficulty may also account

PAGE 76

66 Figure 6-4. Virus nuclear translocation studies at 4hrs postinfection. A. Viral DNA detected in cell nuclei after 4hrs infection. B. Viral DNA detected in the nuclei was compared with that of pIM45 (%wt) and the total input DNA (%input).

PAGE 77

67 Table 6-1. List of data about pIM45, mut22, mut37, mut40, and mut41 pIM45(UF11) Mut22 Mut37 Mut40 Mut41 Mutations --268-272 NDNHYNANAY 527-532 KDDEEKAAAAAA 561-565 DEEEI-AAAAI 585-588 RGNR-AGAA DNA titer 3.6x1011 1.97x1012 4.02x1010 1.05x1012 1.89x109 ICA titer 1.7x1010 2.5x107 3.0x106 9.0x106 1.2x107 DNA/ICA 21.2 7.88x104 1.34x104 1.17x105 1.57x102 HS binding 100% 93% 17% 31% 2% Internalization 97% 72% 70% 30% 42% DNA in nuc 4hr (% of pIM45) 100% 28.47% 4.54% 6.75% 17.78% for the defects in transduction efficiency (mut22). More detailed studies, including viral endosomal trapping, routing to lysosomal degradation, cytoplasmic degradation mediated by ubiquitalization, and viral uncoating difficulty inside nuclei are required to fully unveil the critical infection obstacles for these capsid mutants.

PAGE 78

68 CHAPTER 7 CONCLUSIONS AND FUTURE DIRECTIONS Conclusions Based on our studies on the intracellular trafficking pattern of AAV in the absence and presence of Ad co-infection, we conclude that AAV shows distinct infectious patterns in these two situations. Without Ad co-infection, AAV slowly accumulates outside the nuclei, and viral DNA enters the nuclear region after the viral uncoating happens. With Ad co-infection, however, intact AAV particles quickly translocated into cell nuclei, and uncoating in this case happens in the nuclei. This finding will explain some controversial results reported from different groups in terms of AAV nuclear accumulation (6, 27, 34, 82). We also found that the Ad facilitated intact AAV particles nuclear translocation is NPC independent, suggesting an abnormal way of nuclear entry for AAV. The NPC independent nuclear entry of AAV was also discovered by another group using different experimental methods (36). Regarding the endosomal trafficking of AAV, our data agree with the previously proposed early-endosome escaping model (6), and we showed direct evidence that AAV escapes from early endosomes to the cytoplasm. In addition, we defined this endosomal escaping time profile to be about 10 mins postinfection. These data partly explains the finding that some single fluorescent virions can be found in the nuclei as early as 15 mins postinfection (83).

PAGE 79

69 Future Directions Mechanism of AAV Nuclear Translocation Although in Chapter 5, we proposed a hypothesis that the PLA2 activity in the N-terminus of VP1 protein of AAV may play a role in the nuclear envelope penetration, and PLA2 has been reported to be activated by Ad induced p38 and ERK½ kinase activities (28, 47, 78), direct evidence showing the interaction between PLA2 activity and nuclear envelope is still missing. This missing link in AAV infection step is currently under active studies in our lab and other groups world wide. Endosomal Escaping The N-terminus of VP1 is buried inside the capsid structure under normal conditions (49) but can be exposed in certain situations (102). It is likely that endosomal processing may cause some conformational changes to AAV capsid structure, and these changes are crucial for rAAV transduction (36); however, we still have no idea what these changes are and how they contribute to the viral endosomal escaping. We also do not know whether the PLA2 region in AAV capsid is exposed in this step or after virus enters the cytoplasm. This topic would be another missing link in AAV infection and has not been addressed systematically to the author’s knowledge. Another issue regarding endosomal trafficking is early or late endosome escaping. Early and late endosomes differ from each other in their pH values and the enzymes fused during the maturation of endosomal compartments. What roles do the acidity and enzyme contents of endosomes play are yet to be defined. From a previous project of us, we generated a series of capsid mutant rAAVs that are defective in transgene

PAGE 80

70 expression (102). We hypothesize some of these mutants are defective in endosomal trafficking, and thorough studies on all these mutants may help understand the endosomal trafficking, and perhaps some other trafficking issues of AAV.

PAGE 81

71 LIST OF REFERENCES 1. Anderson, R., I. Macdonald, T. Corbett, A. Whiteway, and H. G. Prentice 2000. A method for the preparation of highly purified adenoassociated virus using affinity column chromatography, protease digestion and solvent extraction J Virol Methods. 85: 23-34. 2. Auricchio, A., M. Hildinger, E. O'Connor, G. P. Gao, and J. M. Wilson 2001. Isolation of highly infectious and pure adeno-associated virus type 2 vectors with a single-step gravity-flow column Hum Gene Ther. 12: 71-6. 3. Bantel-Schaal, U., B. Hub, and J. Kartenbeck 2002. Endocytosis of adeno-associated virus type 5 leads to accumulation of virus particles in the Golgi compartment J Virol. 76: 2340-9. 4. Bartlett, J. S., J. Kleinschmidt, R. C. Boucher, and R. J. Samulski 1999. Targeted adeno-associated virus vector transduction of nonpermissive cells mediated by a bispecific F(ab'gamma)2 antibody Nat Biotechnol. 17: 181-6. 5. Bartlett, J. S., and R. J. Samulski 1998. Fluorescent viral vectors: a new technique for the pharmacological analysis of gene therapy Nat Med. 4: 635-7. 6. Bartlett, J. S., R. Wilcher, and R. J. Samulski 2000. Infectious entry pathway of adeno-associated virus and adeno-associated virus vectors J Virol. 74: 2777-85. 7. Bergelson, J. M., J. A. Cunningham, G. Droguett, E. A. Kurt-Jones, A. Krithivas, J. S. Hong, M. S. Horwitz, R. L. Crowell, and R. W. Finberg 1997. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5 Science. 275: 1320-3. 8. Berns, K. I., and C. Giraud 1996. Biology of adeno-associated virus Curr Top Microbiol Immunol. 218: 1-23. 9. Brister, J. R., and N. Muzyczka 2000. Mechanism of Rep-mediated adeno-associated virus origin nicking J Virol. 74: 7762-71.

PAGE 82

72 10. Brister, J. R., and N. Muzyczka 1999. Rep-mediated nicking of the adeno-associated virus origin requires two biochemical activities, DNA helicase activity and transesterification J Virol. 73: 9325-36. 11. Chen, Z. Y., S. R. Yant, C. Y. He, L. Meuse, S. Shen, and M. A. Kay 2001. Linear DNAs concatemerize in vivo and result in sustained transgene expression in mouse liver Mol Ther. 3: 403-10. 12. Chiorini, J. A., S. Afione, and R. M. Kotin 1999. Adeno-associated virus (AAV) type 5 Rep protein cleaves a unique terminal resolution site compared with other AAV serotypes J Virol. 73: 4293-8. 13. Clark, K. R., X. Liu, J. P. McGrath, and P. R. Johnson 1999. Highly purified recombinant adeno-associated virus vectors are biologically active and free of detectable helper and wild-type viruses Hum Gene Ther. 10: 1031-9. 14. Clark, K. R., F. Voulgaropoulou, D. M. Fraley, and P. R. Johnson 1995. Cell lines for the production of recombinant adeno-associated virus Hum Gene Ther. 6: 1329-41. 15. Debelak, D., J. Fisher, S. Iuliano, D. Sesholtz, D. L. Sloane, and E. M. Atkinson 2000. Cation-exchange high-performance liquid chromatography of recombinant adeno-associated virus type 2 J Chromatogr B Biomed Sci Appl. 740: 195-202. 16. Douar, A. M., K. Poulard, D. Stockholm, and O. Danos 2001. Intracellular trafficking of adeno-associated virus vectors: routing to the late endosomal compartment and proteasome degradation J Virol. 75: 1824-33. 17. Duan, D., Q. Li, A. W. Kao, Y. Yue, J. E. Pessin, and J. F. Engelhardt 1999. Dynamin is required for recombinant adeno-associated virus type 2 infection J Virol. 73: 10371-6. 18. Duan, D., P. Sharma, L. Dudus, Y. Zhang, S. Sanlioglu, Z. Yan, Y. Yue, Y. Ye, R. Lester, J. Yang, K. J. Fisher, and J. F. Engelhardt 1999. Formation of adeno-associated virus circular genomes is differentially regulated by adenovirus E4 ORF6 and E2a gene expression J Virol. 73: 161-9. 19. Duan, D., P. Sharma, J. Yang, Y. Yue, L. Dudus, Y. Zhang, K. J. Fisher, and J. F. Engelhardt 1998. Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue J Virol. 72: 8568-77.

PAGE 83

73 20. Duan, D., Y. Yue, Z. Yan, J. Yang, and J. F. Engelhardt 2000. Endosomal processing limits gene transfer to polarized airway epithelia by adeno-associated virus J Clin Invest. 105: 1573-87. 21. Dubielzig, R., J. A. King, S. Weger, A. Kern, and J. A. Kleinschmidt 1999. Adeno-associated virus type 2 protein interactions: formation of preencapsidation complexes J Virol. 73: 8989-98. 22. Ferrari, F. K., T. Samulski, T. Shenk, and R. J. Samulski 1996. Secondstrand synthesis is a rate-limiting step for efficient transduction by recombinant adeno-associated virus vectors J Virol. 70: 3227-34. 23. Fisher, K. J., G. P. Gao, M. D. Weitzman, R. DeMatteo, J. F. Burda, and J. M. Wilson 1996. Transduction with recombinant adeno-associated virus for gene therapy is limited by leading-strand synthesis J Virol. 70: 520-32. 24. Flotte, T. R., and B. J. Carter 1995. Adeno-associated virus vectors for gene therapy Gene Ther. 2: 357-62. 25. Gao, G. P., G. Qu, L. Z. Faust, R. K. Engdahl, W. Xiao, J. V. Hughes, P. W. Zoltick, and J. M. Wilson 1998. High-titer adeno-associated viral vectors from a Rep/Cap cell line and hybrid shuttle virus Hum Gene Ther. 9: 2353-62. 26. Girod, A., M. Ried, C. Wobus, H. Lahm, K. Leike, J. Kleinschmidt, G. Deleage, and M. Hallek 1999. Genetic capsid modifications allow efficient re-targeting of adenoassociated virus type 2 Nat Med. 5: 1438. 27. Girod, A., C. E. Wobus, Z. Zadori, M. Ried, K. Leike, P. Tijssen, J. A. Kleinschmidt, and M. Hallek 2002. The VP1 capsid protein of adenoassociated virus type 2 is carrying a phospholipase A2 domain required for virus infectivity J Gen Virol. 83: 979-90. 28. Graves, L. M., K. E. Bornfeldt, J. S. Sidhu, G. M. Argast, E. W. Raines, R. Ross, C. C. Leslie, and E. G. Krebs 1996. Platelet-derived growth factor stimulates protein kinase A through a mitogen-activated protein kinase-dependent pathway in human arterial smooth muscle cells J Biol Chem. 271: 505-11. 29. Greber, U. F., and L. Gerace 1995. Depletion of calcium from the lumen of endoplasmic reticulum reversibly inhibits passive diffusion and signalmediated transport into the nucleus J Cell Biol. 128: 5-14. 30. Greber, U. F., M. Willetts, P. Webster, and A. Helenius 1993. Stepwise dismantling of adenovirus 2 during entry into cells Cell. 75: 477-86.

PAGE 84

74 31. Grifman, M., M. Trepel, P. Speece, L. B. Gilbert, W. Arap, R. Pasqualini, and M. D. Weitzman 2001. Incorporation of tumor-targeting peptides into recombinant adenoassociated virus capsids Mol Ther. 3: 964-75. 32. Grimm, D., A. Kern, K. Rittner, and J. A. Kleinschmidt 1998. Novel tools for production and purification of recombinant adenoassociated virus vectors Hum Gene Ther. 9: 2745-60. 33. Grimm, D., and J. A. Kleinschmidt 1999. Progress in adeno-associated virus type 2 vector production: promises and prospects for clinical use Hum Gene Ther. 10: 2445-50. 34. Hansen, J., K. Qing, H. J. Kwon, C. Mah, and A. Srivastava 2000. Impaired intracellular trafficking of adeno-associated virus type 2 vectors limits efficient transduction of murine fibroblasts J Virol. 74: 992-6. 35. Hansen, J., K. Qing, and A. Srivastava 2001. Adeno-associated virus type 2-mediated gene transfer: altered endocytic processing enhances transduction efficiency in murine fibroblasts J Virol. 75: 4080-90. 36. Hansen, J., K. Qing, and A. Srivastava 2001. Infection of purified nuclei by adeno-associated virus 2 Mol Ther. 4: 289-96. 37. Hermonat, P. L., M. A. Labow, R. Wright, K. I. Berns, and N. Muzyczka 1984. Genetics of adeno-associated virus: isolation and preliminary characterization of adeno-associated virus type 2 mutants J Virol. 51: 32939. 38. Hermonat, P. L., and N. Muzyczka 1984. Use of adeno-associated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells Proc Natl Acad Sci U S A. 81: 6466-70. 39. Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures J Mol Biol. 26: 365-9. 40. Hoque, M., K. Ishizu, A. Matsumoto, S. I. Han, F. Arisaka, M. Takayama, K. Suzuki, K. Kato, T. Kanda, H. Watanabe, and H. Handa 1999. Nuclear transport of the major capsid protein is essential for adenoassociated virus capsid formation J Virol. 73: 7912-5. 41. Iborra, F., Jackson, DA., and Cook, PR. 2001. Coupled Transcription and Translation Within Nuclei of Mammalian Cells Science. 293: 11391142.

PAGE 85

75 42. Im, D. S., and N. Muzyczka 1990. The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity Cell. 61: 447-57. 43. Im, D. S., and N. Muzyczka 1992. Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization J Virol. 66: 1119-28. 44. Kay, M. A., C. S. Manno, M. V. Ragni, P. J. Larson, L. B. Couto, A. McClelland, B. Glader, A. J. Chew, S. J. Tai, R. W. Herzog, V. Arruda, F. Johnson, C. Scallan, E. Skarsgard, A. W. Flake, and K. A. High 2000. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector Nat Genet. 24: 257-61. 45. King, J. A., R. Dubielzig, D. Grimm, and J. A. Kleinschmidt 2001. DNA helicase-mediated packaging of adeno-associated virus type 2 genomes into preformed capsids Embo J. 20: 3282-91. 46. Klein, R. L., E. M. Meyer, A. L. Peel, S. Zolotukhin, C. Meyers, N. Muzyczka, and M. A. King 1998. Neuron-specific transduction in the rat septohippocampal or nigrostriatal pathway by recombinant adenoassociated virus vectors Exp Neurol. 150: 183-94. 47. Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi, and K. I. Berns 1990. Site-specific integration by adeno-associated virus Proc Natl Acad Sci U S A. 87: 2211-5. 48. Kramer, R. M., E. F. Roberts, S. L. Um, A. G. Borsch-Haubold, S. P. Watson, M. J. Fisher, and J. A. Jakubowski 1996. p38 mitogenactivated protein kinase phosphorylates cytosolic phospholipase A2 (cPLA2) in thrombin-stimulated platelets. Evidence that proline-directed phosphorylation is not required for mobilization of arachidonic acid by cPLA2 J Biol Chem. 271: 27723-9. 49. Krecic, A. M., and M. S. Swanson 1999. hnRNP complexes: composition, structure, and function Curr Opin Cell Biol. 11: 363-71. 50. Kronenberg, S., J. A. Kleinschmidt, and B. Bottcher 2001. Electron cryo-microscopy and image reconstruction of adeno-associated virus type 2 empty capsids EMBO Rep. 2: 997-1002. 51. Kube, D. M., and A. Srivastava 1997. Quantitative DNA slot blot analysis: inhibition of DNA binding to membranes by magnesium ions Nucleic Acids Res. 25: 3375-6.

PAGE 86

76 52. Leopold, P. L., B. Ferris, I. Grinberg, S. Worgall, N. R. Hackett, and R. G. Crystal 1998. Fluorescent virions: dynamic tracking of the pathway of adenoviral gene transfer vectors in living cells Hum Gene Ther. 9: 367-78. 53. Linden, R. M., P. Ward, C. Giraud, E. Winocour, and K. I. Berns 1996. Site-specific integration by adeno-associated virus Proc Natl Acad Sci U S A. 93: 11288-94. 54. Linden, R. M., E. Winocour, and K. I. Berns 1996. The recombination signals for adeno-associated virus site-specific integration Proc Natl Acad Sci U S A. 93: 7966-72. 55. Liu, X. L., K. R. Clark, and P. R. Johnson 1999. Production of recombinant adeno-associated virus vectors using a packaging cell line and a hybrid recombinant adenovirus Gene Ther. 6: 293-9. 56. Maher, P. A. 1996. Nuclear translocation of fibroblast growth factor (FGF) receptors in response to FGF-2 J Cell Biol. 134: 529-36. 57. McCarty, D. M., M. Christensen, and N. Muzyczka 1991. Sequences required for coordinate induction of adeno-associated virus p19 and p40 promoters by Rep protein J Virol. 65: 2936-45. 58. McLaughlin, S. K., P. Collis, P. L. Hermonat, and N. Muzyczka 1988. Adeno-associated virus general transduction vectors: analysis of proviral structures J Virol. 62: 1963-73. 59. Mendelson, E., J. P. Trempe, and B. J. Carter 1986. Identification of the trans-acting Rep proteins of adeno-associated virus by antibodies to a synthetic oligopeptide J Virol. 60: 823-32. 60. Miao, C. H., H. Nakai, A. R. Thompson, T. A. Storm, W. Chiu, R. O. Snyder, and M. A. Kay 2000. Nonrandom transduction of recombinant adeno-associated virus vectors in mouse hepatocytes in vivo: cell cycling does not influence hepatocyte transduction J Virol. 74: 3793-803. 61. Monahan, P. E., and R. J. Samulski 2000. Adeno-associated virus vectors for gene therapy: more pros than cons? Mol Med Today. 6: 43340. 62. Muralidhar, S., S. P. Becerra, and J. A. Rose 1994. Site-directed mutagenesis of adeno-associated virus type 2 structural protein initiation codons: effects on regulation of synthesis and biological activity J Virol. 68: 170-6.

PAGE 87

77 63. Muzyczka, N. 1992. Use of adeno-associated virus as a general transduction vector for mammalian cells Curr Top Microbiol Immunol. 158: 97-129. 64. Muzyczka, N., and K. I. Berns 2001. Parvoviridae: The viruses and their replication., p. 2327-2360. In D. M. Knipe, and P. M. Howley (eds), Fields Virology, Fourth ed. Lippincott Williams and Wilkins, New York. 65. Myers, M. W., and B. J. Carter 1980. Assembly of adeno-associated virus Virology. 102: 71-82. 66. Nakai, H., T. A. Storm, and M. A. Kay 2000. Recruitment of singlestranded recombinant adeno-associated virus vector genomes and intermolecular recombination are responsible for stable transduction of liver in vivo J Virol. 74: 9451-63. 67. Nicklin, S. A., H. Buening, K. L. Dishart, M. de Alwis, A. Girod, U. Hacker, A. J. Thrasher, R. R. Ali, M. Hallek, and A. H. Baker 2001. Efficient and selective AAV2-mediated gene transfer directed to human vascular endothelial cells Mol Ther. 4: 174-81. 68. Parker, J. S., and C. R. Parrish 2000. Cellular uptake and infection by canine parvovirus involves rapid dynamin-regulated clathrin-mediated endocytosis, followed by slower intracellular trafficking J Virol. 74: 1919-30. 69. Potter, M., K. Chesnut, N. Muzyczka, T. Flotte, and S. Zolotukhin 2002. Streamlined large-scale production of recombinant adenoassociated virus (rAAV) vectors Methods Enzymol. 346: 413-30. 70. Qiao, C., J. Li, A. Skold, X. Zhang, and X. Xiao 2002. Feasibility of generating adeno-associated virus packaging cell lines containing inducible adenovirus helper genes J Virol. 76: 1904-13. 71. Qing, K., C. Mah, J. Hansen, S. Zhou, V. Dwarki, and A. Srivastava 1999. Human fibroblast growth factor receptor 1 is a co-receptor for infection by adeno-associated virus 2 Nat Med. 5: 71-7. 72. Qiu, J., and K. E. Brown 1999. Integrin alphaVbeta5 is not involved in adeno-associated virus type 2 (AAV2) infection Virology. 264: 436-40. 73. Qiu, J., A. Handa, M. Kirby, and K. E. Brown 2000. The interaction of heparin sulfate and adeno-associated virus 2 Virology. 269: 137-47. 74. Qiu, J., H. Mizukami, and K. E. Brown 1999. Adeno-associated virus 2 co-receptors? Nat Med. 5: 467-8.

PAGE 88

78 75. Rabinowitz, J. E., and R. J. Samulski 2000. Building a better vector: the manipulation of AAV virions Virology. 278: 301-8. 76. Rabinowitz, J. E., W. Xiao, and R. J. Samulski 1999. Insertional mutagenesis of AAV2 capsid and the production of recombinant virus Virology. 265: 274-85. 77. Rajagopalan, L. E., C. J. Westmark, J. A. Jarzembowski, and J. S. Malter 1998. hnRNP C increases amyloid precursor protein (APP) production by stabilizing APP mRNA Nucleic Acids Res. 26: 3418-23. 78. Ried, M. U., A. Girod, K. Leike, H. Buning, and M. Hallek 2002. Adenoassociated virus capsids displaying immunoglobulin-binding domains permit antibody-mediated vector retargeting to specific cell surface receptors J Virol. 76: 4559-66. 79. Robinson, M. J., and M. H. Cobb 1997. Mitogen-activated protein kinase pathways Curr Opin Cell Biol. 9: 180-6. 80. Ruffing, M., H. Zentgraf, and J. A. Kleinschmidt 1992. Assembly of viruslike particles by recombinant structural proteins of adeno-associated virus type 2 in insect cells J Virol. 66: 6922-30. 81. Samulski, R. J., K. I. Berns, M. Tan, and N. Muzyczka 1982. Cloning of adeno-associated virus into pBR322: rescue of intact virus from the recombinant plasmid in human cells Proc Natl Acad Sci U S A. 79: 207781. 82. Samulski, R. J., L. S. Chang, and T. Shenk 1989. Helper-free stocks of recombinant adeno-associated viruses: normal integration does not require viral gene expression J Virol. 63: 3822-8. 83. Sanlioglu, S., P. K. Benson, J. Yang, E. M. Atkinson, T. Reynolds, and J. F. Engelhardt 2000. Endocytosis and nuclear trafficking of adenoassociated virus type 2 are controlled by rac1 and phosphatidylinositol-3 kinase activation J Virol. 74: 9184-96. 84. Seisenberger, G., M. U. Ried, T. Endress, H. Buning, M. Hallek, and C. Brauchle 2001. Real-time single-molecule imaging of the infection pathway of an adenoassociated virus Science. 294: 1929-32. 85. Seth, P. 1994. Adenovirus-dependent release of choline from plasma membrane vesicles at an acidic pH is mediated by the penton base protein J Virol. 68: 1204-6.

PAGE 89

79 86. Seth, P., M. C. Willingham, and I. Pastan 1984. Adenovirus-dependent release of 51Cr from KB cells at an acidic pH J Biol Chem. 259: 14350-3. 87. Shenk, T. 1996. Adenoviridae: The Viruses and Their Replication, p. 2111-2148. In B. Fields, Knipe, DM., Howley, PM. et al. (ed.), Fields Virology, 3rd ed. Lippincott Raven Publishers, Philadelphia. 88. Shi, W., G. S. Arnold, and J. S. Bartlett 2001. Insertional mutagenesis of the adeno-associated virus type 2 (AAV2) capsid gene and generation of AAV2 vectors targeted to alternative cellsurface receptors Hum Gene Ther. 12: 1697-711. 89. Sperinde, G. V., and M. A. Nugent 1998. Heparan sulfate proteoglycans control intracellular processing of bFGF in vascular smooth muscle cells Biochemistry. 37: 13153-64. 90. Srivastava, A., E. W. Lusby, and K. I. Berns 1983. Nucleotide sequence and organization of the adeno-associated virus 2 genome J Virol. 45: 55564. 91. Summerford, C., J. S. Bartlett, and R. J. Samulski 1999. AlphaVbeta5 integrin: a co-receptor for adeno-associated virus type 2 infection Nat Med. 5: 78-82. 92. Summerford, C., and R. J. Samulski 1998. Membrane-associated heparan sulfate proteoglycan is a receptor for adeno-associated virus type 2 virions J Virol. 72: 1438-45. 93. Summerford, C., and R. J. Samulski 1999. Viral receptors and vector purification: new approaches for generating clinical-grade reagents Nat Med. 5: 587-8. 94. Tamayose, K., Y. Hirai, and T. Shimada 1996. A new strategy for largescale preparation of high-titer recombinant adeno-associated virus vectors by using packaging cell lines and sulfonated cellulose column chromatography Hum Gene Ther. 7: 507-13. 95. Tibbles, L. A., J. C. Spurrell, G. P. Bowen, Q. Liu, M. Lam, A. K. Zaiss, S. M. Robbins, M. D. Hollenberg, T. J. Wickham, and D. A. Muruve 2002. Activation of p38 and ERK signaling during adenovirus vector cell entry lead to expression of the C-X-C chemokine IP-10 J Virol. 76: 155968.

PAGE 90

80 96. Tratschin, J. D., I. L. Miller, and B. J. Carter 1984. Genetic analysis of adeno-associated virus: properties of deletion mutants constructed in vitro and evidence for an adeno-associated virus replication function J Virol. 51: 611-9. 97. Walters, R. W., S. M. Yi, S. Keshavjee, K. E. Brown, M. J. Welsh, J. A. Chiorini, and J. Zabner 2001. Binding of adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer J Biol Chem. 276: 20610-6. 98. Wickham, T. J., E. J. Filardo, D. A. Cheresh, and G. R. Nemerow 1994. Integrin alpha v beta 5 selectively promotes adenovirus mediated cell membrane permeabilization J Cell Biol. 127: 257-64. 99. Wickham, T. J., P. Mathias, D. A. Cheresh, and G. R. Nemerow 1993. Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment Cell. 73: 309-19. 100. Wistuba, A., A. Kern, S. Weger, D. Grimm, and J. A. Kleinschmidt 1997. Subcellular compartmentalization of adeno-associated virus type 2 assembly J Virol. 71: 1341-52. 101. Wistuba, A., S. Weger, A. Kern, and J. A. Kleinschmidt 1995. Intermediates of adeno-associated virus type 2 assembly: identification of soluble complexes containing Rep and Cap proteins J Virol. 69: 5311-9. 102. Wobus, C. E., B. Hugle-Dorr, A. Girod, G. Petersen, M. Hallek, and J. A. Kleinschmidt 2000. Monoclonal antibodies against the adenoassociated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection J Virol. 74: 9281-93. 103. Wu, P., W. Xiao, T. Conlon, J. Hughes, M. Agbandje-McKenna, T. Ferkol, T. Flotte, and N. Muzyczka 2000. Mutational analysis of the adeno-associated virus type 2 (AAV2) capsid gene and construction of AAV2 vectors with altered tropism J Virol. 74: 8635-47. 104. Xiao, X., J. Li, and R. J. Samulski 1998. Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus J Virol. 72: 2224-32. 105. Xu, R., C. G. Janson, M. Mastakov, P. Lawlor, D. Young, A. Mouravlev, H. Fitzsimons, K. L. Choi, H. Ma, M. Dragunow, P. Leone, Q. Chen, B. Dicker, and M. J. During 2001. Quantitative comparison of expression with adeno-associated virus (AAV2) brain-specific gene cassettes Gene Ther. 8: 1323-32.

PAGE 91

81 106. Yan, Z., R. Zak, G. W. Luxton, T. C. Ritchie, U. Bantel-Schaal, and J. F. Engelhardt 2002. Ubiquitination of both adeno-associated Virus type 2 and 5 capsid proteins affects the transduction efficiency of recombinant vectors J Virol. 76: 2043-53. 107. Yang, J., W. Zhou, Y. Zhang, T. Zidon, T. Ritchie, and J. F. Engelhardt 1999. Concatamerization of adeno-associated virus circular genomes occurs through intermolecular recombination J Virol. 73: 9468-77. 108. Yang, Q., M. Mamounas, G. Yu, S. Kennedy, B. Leaker, J. Merson, F. Wong-Staal, M. Yu, and J. R. Barber 1998. Development of novel cell surface CD34-targeted recombinant adenoassociated virus vectors for gene therapy Hum Gene Ther. 9: 1929-37. 109. Zadori, Z., J. Szelei, M. C. Lacoste, Y. Li, S. Gariepy, P. Raymond, M. Allaire, I. R. Nabi, and P. Tijssen 2001. A viral phospholipase A2 is required for parvovirus infectivity Dev Cell. 1: 291-302. 110. Zolotukhin, S., B. J. Byrne, E. Mason, I. Zolotukhin, M. Potter, K. Chesnut, C. Summerford, R. J. Samulski, and N. Muzyczka 1999. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield Gene Ther. 6: 973-85.

PAGE 92

82 BIOGRAPHICAL SKETCH Wu Xiao was born on July 31, 1971, in Beijing, P.R. China. Wu graduated from Beijing Medical University (now Peking University Health Science Center) with a Bachelor of Science in pharmacy degree in July 1993. Wu joined the School of Pharmacy, Memorial University of Newfoundland, Canada, in 1997 and obtained his Master of Science degree in pharmacy in 1999. Starting January 1999, Wu joined the Department of Pharmaceutics, College of Pharmacy, University of Florida, and received his Doctor of Philosophy in pharmaceutical sciences in August 2002 under the supervision of Dr. Jeffrey A. Hughes and Dr. Nicholas Muzyczka.