Citation
Effect of Huanglongbing Antimicrobial Therapies on the Asian Citrus Psyllid, Diaphorina Citri Kuwayama (Hemiptera: Liviidae), and Their Endosymbiont Community

Material Information

Title:
Effect of Huanglongbing Antimicrobial Therapies on the Asian Citrus Psyllid, Diaphorina Citri Kuwayama (Hemiptera: Liviidae), and Their Endosymbiont Community
Creator:
Smith, Eliott Merrill
Publisher:
University of Florida
Publication Date:
Language:
English

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
STELINSKI,KIRSTEN SUZANNE
Committee Co-Chair:
STELINSKI,LUKASZ LECH
Committee Members:
WANG,NIAN
Graduation Date:
12/14/2018

Subjects

Subjects / Keywords:
antibiotics
antimicrobials
citrus
diaphorina
endosymbionts
fitness
haunglongbing
oxytetracycline
streptomycin

Notes

General Note:
The bacterial pathogen, Candidatus Liberibacter asiaticus, and its vector, Diaphorina citri, are global pests of citrus production. Revenue received by Florida orange growers between the years 2006-2011 declined by 18% from CLas damage. There is no cure for infected plants nor a method to prevent pathogen and vector spread. The Florida Commissioner of Agriculture issued a crisis exemption for use of three commercial antimicrobials on citrus in 2016. FireLine, Mycoshield, and FireWall are labeled primarily as prophylactic treatment of foliar bacterial pathogens. It is unknown whether these compounds will contribute to management of D. citri. The purpose of this study was to investigate the effect of two of these antimicrobial compounds, oxytetracycline and streptomycin, on the fitness, behavior, and transmission capacity of D. citri. Oxytetracycline and streptomycin were administered orally to D. citri through foliar application on plants and in artificial diet bioassays to assess their effects on endosymbiont densities, reproductive output, longevity, feeding behavior, host selection, and the inoculation capacity of D. citri. We determined that oxytetracycline elicited the greatest reduction in endosymbiont titer and D. citri fitness parameters compared with streptomycin and control treatments. Deterrent effects were observed in response to oxytetracycline as compared with control treatments. Cumulatively, these data suggest that antimicrobials used for CLas management, particularly oxytetracycline, elicit lethal and sublethal effects in D. citri. Further investigations are needed to confirm the efficacy of these compounds against D. citri in the field and to determine whether applications of higher antimicrobial doses will reduce pathogen transmission.

Record Information

Source Institution:
UFRGP
Rights Management:
All applicable rights reserved by the source institution and holding location.
Embargo Date:
12/31/2019

Downloads

This item has the following downloads:


Full Text

PAGE 1

EFFECT OF HUANGLONGBING ANTIMICROBIAL THERAPIES ON THE ASIAN CITRUS PSYLLID, DIAPHORINA CITRI KUWAYAMA (HEMIPTERA: LIVIIDAE), AND THEIR ENDOSYMBIONT COMMUNITY By ELIOTT SMITH A THESIS PRESENTED TO THE GRADUATE SCHOOL OF TH E UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2018

PAGE 2

2018 Eliott Smith

PAGE 3

To my family

PAGE 4

4 ACKNOWLEDGMENTS I thank Dr. Kirsten Pelz Stelinski Dr. Lukasz Stelinski Dr. Nian Wang, Dr. Sylvia Bonilla, Dr. Andres Sandoval Mojica, Dr. Torrence Gill, Dr. Gustavo Rivas, Dr. Mahnaz Rashidi, Austin McGowan, and Paul Carr for the invaluable help they have provided in complet ing th is work.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 12 Economic Impact of HLB in Florida ................................ ................................ ......... 12 Symptoms and Signs of HLB ................................ ................................ .................. 12 Vector of HLB ................................ ................................ ................................ ......... 13 Endosymbionts of D. citri ................................ ................................ ........................ 13 Management of HLB in Florida ................................ ................................ ............... 15 Thesis Objective ................................ ................................ ................................ ..... 16 2 RESPONSE OF DIAPHORINA CITRI ENDOSYMBIONTS TO ANTIMICROBIALS ................................ ................................ ................................ 1 7 Materials and Methods ................................ ................................ ............................ 21 Insect and Plant Cultures ................................ ................................ ................. 21 Endosymbiont Densities ................................ ................................ ................... 21 Construction of qPCR Standard Curves ................................ ........................... 22 Statistical Analysis ................................ ................................ ............................ 23 Results ................................ ................................ ................................ .................... 24 Discussion ................................ ................................ ................................ .............. 24 3 PERFORMANCE OF D. CITRI IN RESPONSE TO AN TIMICROBIAL THERAPY ................................ ................................ ................................ ............... 29 Materials and Methods ................................ ................................ ............................ 31 Insect and Plant Cultures ................................ ................................ ................. 31 Longevity ................................ ................................ ................................ .......... 31 Fecundity and Fertility Assays ................................ ................................ .......... 32 Plant Inoculation ................................ ................................ ............................... 33 ELISA ................................ ................................ ................................ ............... 34 Statistical Analysis ................................ ................................ ............................ 35 Results ................................ ................................ ................................ .................... 36 Longevity ................................ ................................ ................................ .......... 36

PAGE 6

6 Fecundity and Fertility Assays ................................ ................................ .......... 37 Plant Inoculation ................................ ................................ ............................... 38 ELISA ................................ ................................ ................................ ............... 38 Discussion ................................ ................................ ................................ .............. 38 4 BEHAVIORAL RESPONSE OF DIAPHORINA CITRI TO ANTIMICROBIALS ....... 51 Materials and Methods ................................ ................................ ............................ 53 Maintenance of Insect, Pathogen and Host Plants ................................ ........... 53 Settling Bioassay ................................ ................................ .............................. 53 Feeding Inhibition Assay ................................ ................................ .................. 54 Statistical Analysis ................................ ................................ ............................ 55 Results ................................ ................................ ................................ .................... 56 Settling Bioassay ................................ ................................ .............................. 56 Feeding Inhibition Assay ................................ ................................ .................. 57 Discussion ................................ ................................ ................................ .............. 57 5 SUMMARY AND CONCLUSION ................................ ................................ ............ 62 LIST OF REFERENCES ................................ ................................ ............................... 64 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 76

PAGE 7

7 LIST OF TABLES Table page 2 1 Primers and probes used for qPCR. Adapted from Chu et al. (2016). ................ 28 3 1 Mean cumu lative fecundity per female counted every 5 d period. ...................... 45 3 2 Mean cumulative fertility per female counted every 5 d period. .......................... 47 3 3 CLas inoculation by D. citri. ................................ ................................ ................ 49

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Absolute quantification of Carsonella and Wolbachia titers in D. citri ................. 27 3 1 Mortality effects of oxytetracycline, streptomycin, and imidacloprid on D. citri ... 43 3 2 Mean fecundity per female per 5 d. ................................ ................................ .... 44 3 3 Mean egg hatch per female per 5 d. ................................ ................................ ... 46 3 4 Inoculativity of D. citri ................................ ................................ .......................... 48 3 5 ELISA detection of streptomycin and oxytetracycline ................................ ......... 50 4 1 Settling preference of D. citri ................................ ................................ .............. 60 4 2 Feeding of D. citri ................................ ................................ .............................. 61

PAGE 9

9 LIST OF ABBREVIATIONS AI Active ingredient CLas Candidatus Liberibacter asiaticus CUPS Citrus under protective screen D. citri Diaphorina citri ELISA E nzyme linked immunosorbent assay HLB Huanglongbing

PAGE 10

10 Abstract of The s is Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EFFECT OF HUANGLONGBING ANTIMICROBIAL THERAPIES ON THE ASIAN CITRUS PSYLLID, DIAPHORINA CI TRI KUWAYAMA (HEMIPTERA: LIVIIDAE), AND THEIR ENDOSYMBIONT COMMUNITY By Eliott Smith December 2018 Chair: Kirsten Pelz Stelinski Major: Entomology and Nematology The bacterial pathogen, Candidatus Liberibacter asiaticus, and its vector, Diaphorina citr i are global pests of citrus production. R evenue received by Florida orange growers between the years 2006 201 1 declined by 1 8 % from CLas damage There is no cure for infected plants n or a method to prevent pathogen and vector spread. The Florida Commissi oner of Agriculture issued a crisis exemption for use of three commercial antimicrobials on citrus in 2016. FireLine, Mycoshield, and FireWall are labeled primarily as prophylactic treatment of foliar bacterial pathogens. I t is unknown whether these compou nds will contribute to management of D. citri The purpose of this study was to investigate the effect of two of these antimicrobial compounds, oxytetracycline and streptomycin, on the fitness, behavior, and transmission capacity of D. citri Oxytetracycli ne and streptomycin were administered orally to D. citri through foliar application on plants and in artificial diet bioassays to assess the ir effects on endosymbiont densities, reproductive output, longevity, feeding behavior, host selection, and the inoc ulation capacity of D. citri We determined that oxytetracycline elicited the greatest reduction in endosymbiont titer and D. citri fitness

PAGE 11

11 parameters compared with streptomycin and control treatments D eterrent effects were observed in response to oxytetr acycline as compared with control treatments. Cumulatively, these data suggest that antimicrobials used for CLas management, particularly oxytetracycline elicit lethal and sublethal effects in D. citri Further investigations are needed to confirm the eff icacy of these compounds against D. citri in the field and to determine whether applications of higher antimicrobial doses will reduce pathogen transmission.

PAGE 12

12 CHAPTER 1 INTRODUCTION Economic Impact of HLB in Florida Florida is the largest producer of orange s in the United States, and the third largest producer in the world (Singerman & Useche 2016). Bearing acreage of citrus in Florida has steadily declined between the years 2000 and 2014 (Hodges et al. 2014). This decline is largely due to a bacterial disea se of citrus commonly referred to as citrus greening disease or Huanglongbing (HLB). HLB was first described in China in 1919 (Bov 2006). HLB was not found in Florida until 2005 (Bov 2006). HLB has now spread to every citrus producing region in Florida. It is estimated that Florida orange growers have lost $ 7.80 billion in revenue from HLB damage between the years 2006 and 2014, which equates to about 18% of revenue (Hodges et al. 2014). During this same period, HLB related job loss in Florida is estimate d to total 60,101 (Hodges et al. 2014). HLB has also been reported in Africa, Oceania, South America, and several states in North America (Bov 2006). Symptoms and Signs of HLB In Florida, HLB is putatively caused by the bacterial pathogen Candidatus Liber ibacter asiaticus (CLas). Although this is the most prevalent pathogen associated with HLB, Candidatus Liberibacter americanus (CLam) and Candidatus Liberibacter africanus (CLaf) are also associated with HLB in Brazil/China and South Africa, respectively ( Bov 2006; Gottwald 2010) The pathogen is a fastidious, gram negative, phloem limited, Alpha proteobacteria (Garnier et al. 1984; Jagoueix et al. 1994; Bov 2006). Nearly all commercially available citrus species are suscept ible to HLB (Folimonova & Acho r 2010). CLas infected plants exhibit phytohormonal changes and

PAGE 13

13 callose depositions in leaves, as well as decreases in sieve pore diameters (Ko h et al. 2012; Killiny & Nehela 2017). Symptoms of HLB include chlorosis / blotchy mottling of leaves, small / lo psided; bitter tasting fruits, yield declines, root loss, and eventual tree death in 7 10 years (Folimonova et al. 2009). A tree can be infected with HLB, but remain asymptomatic for 1 2 years before noticeable symptoms appear (Gottwald 2010). The physiolo gical changes that generate the HLB symptoms in infected plants are currently unknown. Vector of HLB CLas is primarily transmitted to citrus plants via the insect vector Diaphorina citri Kuwayama (Hemiptera: Liviidae), which primarily feeds on phloem plant sap (Bov 2006 ; Ebert et al. 2018 ). D. citri has been documented to feed on as many as 65 different species of plants within the rutaceous subfamily Aurantiodae (Grafton Cardwell et al. 2013). Transmission of CLas entails an initial acquisition by D. citr i. The continuous feeding of D. citri enables them to encounter a greater number of bacteria during feeding. After acquisition, the pathogen goes through a latency phase where it passes through the gut membrane, replicates in the hemolymph, and enters into the salivary gland. The final phase is inoculation, where CLas passes through the salivary gland and into the plant (Grafton Cardwell et al. 2013). Inoculation can occur while D. citri is probing for an adequate feeding spot or while it salivates into a p lant before or during the feeding process. CLas transmission rates are highest in D. citri that acquire the pathogen during nymphal feeding (Inoue et al. 200 9 ). Endosymbionts of D. citri D. citri feeds on a diet of nutrient poor plant phloem, which common ly lacks methionine and leucine, essential amino acids for insect development (Sandstrm &

PAGE 14

14 Moran 1999). To overcome this challenge, D. citri has acquired an endosymbiotic bacterium named Candidatus Carsonella ruddii. This bacteria is facultative and belong s to the class Gammaproteobacterium (Nakabachi et al. 2006), and is found in the cytoplasm of the bacteriocytes, a symbiont colonized organelle of D. citri (Subandiyah et al. 2000; Baumann 2005). A second endosymbiont found in D. citri is a Betaproteobacte rium named Candidatus Profftella armature, which provides defensive benefits, such as the production of diaphorin (Ramsey 2015; Nakabachi et al. 2013). Candidatus Profftella armature is found in the syncytium of the bacteriocytes (Subandiyah et al. 2000; B aumann 2005). A third endosymbiont found in D. citri is an Alphaproteobacteria named Wolbachia which is estimated to be found in 40% of insect species (Zug & Hammerstein 2012). Wolbachia has been associated with cytoplasmic incompatibility, parthenogenes is, male killing, feminization, and changes in the resident bacterial community (Rousset et al. 1992; Zchori Fein et al. 1992; Riegler & Stauffer 2002; Zabalou et al. 2004; Werren et al. 2008; Audsley et al. 2018). Additionally, Wolbachia has been shown to repress phage lytic cycle genes of CLas in D. citri (Jain et al. 2017). It is hypothesized that mode of action either involves components of immune activation or competition with pathogens for limited host resources (Molloy & Sinkins 2015; Zug & Hammerstein 2015; Amuzu & McGraw 2016; Chu et al. 2018). Due to this, it is a favorable candidate to serve as a biological control program. To optimize Wolbachia as a form of biological control, the endogenous Wolbachia should be cleared or reduced (Do bson & Rattanadechakul 2001), allowing a novel Wolbachia strain to be introduced into the host. Insects have been found in nature

PAGE 15

15 or experimentally derived to be Wolbachia free, single infected, or colonized by more than one strain of Wolbachia, also known as superinfected or co infected (Dobson et al. 2001; Kang et al. 2003; Fu et al. 2010; Joubert et al. 2016; Chu et al. 2018) Whether a Wolbachia free, single infected, or super infected host is used, the novel Wolbachia strain selected for introduction should be capable of spreading through the population and capable of introducing a desired trait into the host. One such desired change used in mosquitoes is reduced pathogen transmission rates (Ferguson et al. 2015; Amuzu & McGraw 2016; Ant et al. 2018; C arrington et al. 2018). Management of HLB in Florida There are three main components to a crop protection management strategy: biological control, cultural control, and chemical control. Manipulating Wolbachia is one form of biological control. Entomopat hogenic fungi, natural predators, and parasitoid wasps are additional forms of biological control being tested against D. citri (Michaud et al. 2004; Hunter et al. 2011; Hoy & Nguyen 2001). Cultural control focuses on prevention. Some strategies include r educing movement of infected plant material, planting certified disease free stock, quarantine C.U.P.S., aggressive monitoring for D. citri and HLB, and tree removal and replanting when CLas is detected in a grove. Methods of chemical control for management of D. citri include use of systemic insecticides, such as imidacloprid, thiamethoxam and clothianidin (Dewdney et al. 2016). These chemicals are typically applied throu gh soil drenches and area wide sprays for young and mature trees, respectively (Rogers & Shawer 2007, Qureshi et al. 2009). Oxytetracycline hydrochloride (FireLine 17 WP), Streptomycin sulfate (FireWall

PAGE 16

16 50 WP), and Oxytetracycline calcium complex (Mycoshie ld) are three antimicrobial compounds have recently received emergency exemptions for use in citrus groves. These compounds are formulated as foliar spray treatments, and are used with the hope of reducing titers of CLas in infected tree. Thesis Objective Tetracycline derivatives and streptomycin are a few of the limited number of antibiotics currently registered for agricultural use (Zhang et al. 2014). Zhang et al. (2014) reported that streptomycin sulfate was ineffective at reducing CLas titers in infec ted citrus scions while oxytetracycline hydrochloride effectively reduced CLas titers, but exhibited a phytotoxic effect on plants at high application rates. Tetracycline has been shown to reduce Wolbachia titers in mosquitoes (Dobson & Rattanadechakul 200 1). However, oxytetracycline hydrochloride, streptomycin sulfate, and oxytetracycline calcium complex have not been evaluated for use as insecticidal treatments against D. citri. Because D. citri is colonized by four different bacteria, Candidatus Carsonel la ruddii, Candidatus Profftella armatura, Wolbachia and CLas, the use of these antimicrobial agents on citrus have the potential to a ffect the titers of some or all of these bacteria. The objective of this study was to analyze the effects of these antiba cterial treatments on D. citri by investigating the endosymbiont community, fitness, and behavior. Since the endosymbionts of D. citri are essential for nutrient acquisition and important for defense, it is hypothesized that reductions in endosymbiont tite rs caused by antimicrobial compounds will a ffect D. citri fitness and behavior.

PAGE 17

17 CHAPTER 2 RESPONSE OF DIAPHORINA CITRI ENDOSYMBIONTS TO ANTIMICROBIALS Diaphorina citri harbor two of their four endosymbionts in a specialized organ called a bacteriome, whic h contains uninucleated bacteriocytes and multinucleated syncytium cells. Bacteria can be vertically transferred to developing oocytes through the bacteriome (Koga et al. 2012; Dan et al. 2017). The primary, obligate endosymbiont, Candidatus Carsonella rud dii, is located in the cytoplasm of the bacteriocyte cells and provides nutritional benefits (Thao et al. 2000; Nakabachi et al. 2006; Nakabachi et al. 2013). Candidatus Profftella armatura is a secondary, facultative, defensive and nutritional endosymbion t present in the cytoplasm of the syncytium cells (Nakabachi et al. 2013). Wolbachia is a facultative endosymbiont that can be found in the bacteriome, somatic, and reproductive cells (Dobson et al. 1999; Hosokawa et al. 2009). Wolbachia is well known to c ause reproductive changes in its host, such as cytoplasmic incapability, male killing, parthenogenesis, and feminization (Werren et al. 2008). Wolbachia has also been associated with immune priming, infection resistance, and nutritional benefits (Bian et a l. 2010; Hos okawa et al. 20 09 ; Rances et al. 2012). Some hosts appear to require Wolbachia to produce viable offspring while others experience reduced longevity, fecundity, and fertility with Wolbachia infections (Fleury et al. 2000; Dedeine et al. 2001 We eks et al. 2001). Candidatus Liberibacter asiaticus (CLas) is the fourth endosymbiont associated with D. citri and is the putative causal agent of Huanglongbing (HLB). CLas has been reported throughout D. citri body and is transmitted to plants after it en ters the salivary glands (Ammar et al. 2011a,b). Once D. citri becomes infected with CLas, they experience morphological abnormalities and reduced longevity, but they have higher fecundity and fertility and an increased

PAGE 18

1 8 propensity for dispersal (Martini et al. 2015; Ghanim et al 2016; Pelz Stelinski & Killiny 2016). This equates to a net benefit for D. citri and CLas. Successful elimination of D. citri endosymbionts has not been demonstrated experimentally, which may be due to the obligate relationship of endosymbionts with their host (Douglas 2007). In the aphid Buchnera system, obligate and facultative symbiont have been cleared with varying effects, including reduced body weight, longevity, relative growth rate, survival to adulthood, length of embryos, number of embryos, total proteins, duration and quantity of feeding, and variation in host plant utilization, amino acid content and accumulation (Ohtaka & Ishikawa 1991; Prosser & Douglas 1991; Douglas 1992; Douglas 1995; Wilkinson & Douglas 1995; Adams & Douglas 1997; Machado Assefh et al. 2015). When host bacteria were manipulated in other systems, such as the families Alydidae, Culicidae, Drosophilidae, and Dryinidae, similar effects were observed (Dobson & Rattanadechakul 2001; Lee et al. 2016; Espinos a et al. 2017; Wong et al. 2017). Some of these studies utilized the antimicrobial compounds oxytetracycline, penicillin, streptomycin, or erythromycin. Oxytetracycline exhibits activity against gram negative and gram positive bacteria by blocking translat ion. It binds to the 30s ribosomal subunit, which inhibits bacterial protein synthesis by preventing the association of amino acyl tRNA with the A site of the bacterial ribosome (Chopra & Roberts 2001; Sykes & Papich 2014). Because this binding is reversib le, oxytetracycline is consider ed bacteriostatic, or growth inhibiting (Sykes & Papich 2014). Erythromycin inhibits protein synthesis by stimulating the dissociation of peptidyl tRNA from the 50s ribosome and is considered bactericidal (Menninger & Otto 19 82; Kohanski et al. 2010). Ampicillin, which has a similar mode of

PAGE 19

19 action as penicillin, is active against gram negative and gram positive bacteria. It disrupts bacterial cell wall synthesis by inhibiting transpepidase enzymes, which are necessary for the final step in bacterial cell wall formation and is considered bactericidal (Yocum et al. 1980). Streptomycin inhibits protein synthesis initiation and elongation by irreversibly binding to a single site on 16s rRNA within the 30s ribosomal subunit and is c onsidered bactericidal (Spotts & Stanier 1961; Goldberg 1965; Allison & Lambert 2014; Hong et al. 2014). The bacterial symbiont Wolbachia can be experimentally eliminated in cell culture with oxytetracycline treatment, but is resistant to erythromycin trea tment (Hermans et al. 2001; Fenollar et al. 2003). Neither tetracycline nor erythromycin are able to clear Wolbachia infection in filarial nematodes; however, tetracycline inhibits nematode molting (Smith & Rajan 2000). Oxytetracycline successfully elimina tes bacterial symbiont, Burkholderia, from its host, Riptortus pedestris (Lee et al. 2016). Oxytetracycline and ampicillin were incapable of clearing Bemisia tabaci of their primary endosymbiont, Portiera aleyrodidarum yet both were capable of clearing se condary symbionts, resulting in accelerated B. tabaci development and increased survival of offspring (Ruan et al. 2006). A similar effect was observed when ampicillin was used to eliminate naturally occurring Serratia from aphid strains, which resulted in an increase in aphid longevity (Koga et al. 2007). Streptomycin has exhibited a negative fitness effect on Romalea microptera but resulted in no reduction in Encephalitozoon bacterial spores (Johny et al 2007). Significant emphasis is currently being pl aced on development of cures for citrus Huanglongbing (HLB), but in the interim, the citrus industry is in need of short term

PAGE 20

20 solutions to combat this disease. One potential method that is being investigated with significant previous precedence is deployme nt of antimicrobial compounds to target and kill the causal pathogen within trees. The Florida Commissioner of Agriculture issued a crisis exemption for use of three commercial antimicrobials on citrus in March 2016. FireLine (oxytetracycline hydrochloride ), Mycoshield (oxytetracycline calcium complex), and FireWall (streptomycin sulfate) are labeled for use on other crops primarily as prophylactic treatment of foliar bacterial pathogens. Studies have shown antibiotic treatments to significantly lower C Las titers in trees (Zhang et al. 2011; Zhang et al. 2013 a,b ). Antimicrobial efficacy depends on effective penetration and systemic movement of the material into the phloem. Trees are treated with foliar applied antimicrobials; however, little is known about t he penetration of the material into the phloem, mobility within the phloem, or the concentration necessary to eliminate the bacterium. In addition, psyllids feeding on treated plants may ingest antimicrobials within the phloem, which may affect feeding, fi tness, and transmission capacity if the materials negatively impact endosymbiont or CLas populations. Antimicrobial treatments for psyllids may negatively affect a variety of psyllid biological features, including fecundity, transmission capacity, life sp an, developmental time, and behavior (Prosser & Douglas 1991; Hermans et al. 2001; Machado Assefh et al. 2015). Comprehensive examination of the effects of antimicrobial treatment on D. citri biology will assist in determining the utility of incorporating these materials into an IPM program for HLB management. The goal of this study is to determine whether antibiotics are effective in eliminating or suppressing D. citri endosymbionts.

PAGE 21

21 Materials and Methods Insect and P lant C ultures D. citri were obtained f rom a laboratory culture reared in insect proof insectary at the University of Florida Citrus Research and Education Center in Lake Alfred. This colony was established in 2000 from a field population collected in Polk Co., Florida (28.0 N, 81.9 W). The D citri were reared at 25C, L14:D10 photoperiod, and 55% RH on CLas negative Citrus macrophylla Plants and psyllids were tested once a month via real time polymerase chain reaction analysis (Li et al. 2006) for the presence of CLas to verify the cultures remained free of CLas. CLas positive D. citri and plants were maintained in a separate rearing chamber from CLas negative D. citri and plants under the same environmental conditions. Endosy mbiont D ensities The objective of this experiment was to determin e whether antimicrobial compounds effect D. citri microbiota by quantifying specific endosymbiont genes with quantitative polymerase chain reaction (qPCR). Antimicrobials were administered orally through a diet solution containing 17% solution (Sigma Aldri ch, St. Louis, Missouri, USA) and 0.5 mg ml 1 of either oxytetracycline hydrochloride (Sigma Aldrich, St. Louis, Missouri, USA), streptomycin sulfate (Gibco Life Technologies, Grand Island, NY, USA), ampicillin sodium salt (Fisher Bioreagents, Pittsburg, Pennsylvania, USA), or erythromycin (Acros Organic, Pittsburg, Pennsylvania, USA). Feeding arenas were constructed according to Russel & Pelz Stelinski (2014) with slight modifications. Arenas consisted of 60 mm plastic petri dishes with the top removed. A single layer of parafilm was stretched over the top of the arena and 300 l of diet solution was placed on top of the first parafilm layer. A 60 mm circle of filter paper (no. 5, Whatman

PAGE 22

22 International Ltd, Kent, UK) was placed on top of the diet solution and then a second layer of parafilm was stretched over the filter paper to maintain moisture within the arena. Ten adult D. citri of mixed age were collected from a CLas negative insectary and placed inside each feeding arena. Dishes were maintained at 2 5C, L14:D10 photoperiod, and 55% RH in an insectary. D. citri were allowed to feed for 72 h, after which they were removed from feeding rings and their DNA was extracted using the Qiagen DNeasy Blood and Tissue Kit (Qiagen Inc., Valencia, California, USA) according arthropods (Pelz Stelinski et al. 2010). DNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Lafayette, Colorado, USA) and di luted to 15 ng 1 for subsequent quantitative real time polymerase chain reaction (qPCR) analysis. Each treatment was replicated 10 times. Construction of qPCR Standard C urves Standard curves were generated to quantify endosymbiont gene titers in indivi dual D. citri Template DNA was prepared for conserved genes of D. citri endosymbionts and the D. citri housekeeping gene wingless The 16s gene was used for Candidatus Carsonella ruddii and the ftsZ gene was used for Wolbachia For wingless Ca. C. ruddii and ftsZ plasmids containing the target gene fragments were constructed to obtain DNA templates for qPCR standard curves. Gene fragments were amplified using primers and PCR conditions described in Chu et al. (2016) and presented in Table 2 1. Gene frag ments were cloned into the pGEM T easy vectors (Promega, Inc., Madison, Wisconsin, USA) and then transformed into E. coli JM109 was conducted using the QIAprep Spin Mini prep Kit (QIAGEN Inc., Valencia, California,

PAGE 23

23 USA). Plasmids were digested with PstI (New England Biolabs Inc., Beverly, QIAquick PCR Purification Kit (QIAGEN Inc., Valenci a, California, USA). Serial dilutions of each target were use in subsequent standard curve qPCR reactions. Symbiont titers were quantified as described by Chu et al. (2016). Quantification of symbiont titers in individual D. citri were conducted using a 9 6 well fast Time PCR System (Thermo Fisher Scientific Inc., Waltham, Massachusetts, USA). Ca C. ruddii and Wolbachia were amplified using the SYBR Green PCR Master Mix (Applied Biosystems, Inc., Foster City, California, USA). Taq man assays with PerfeCTaq PCR ToughMix, Low ROX (Quanta BioSciences Inc., Gaithersburg, Maryland, USA) was used to amplify D. citri wingless gene. One microliter (15 ng) of D. citri primer and p wingless Wolbachia CLas, and COX ). Three technical replicates were used for standard curves DNA reaction and two technical replicates were used for each sample DNA reaction. The qPCR conditions was one cycle of 95C for 10 min, 40 cycles of 95C for 15 seconds and 58C (Carsonella and Wolbachia ) or 60C ( wingless CLas, and COX ) for 30 seconds, and a final cycle of 72C for 30 s. Dissociation curve analyses was conducted for SYBR green assays. Statis tical Analysis Copy numbers of the three target genes in the template DNA were calculated as described by Chu et al. (2016) (Table 2 1), and then divided by the wingless gene copy number in the same sample. Means were normalized using a square root transfo rmation. The effect of antimicrobial were compared using a one way analysis of

PAGE 24

24 variance ( ANOVA ) with post p<0.05 Individual means were compared using a two tailed unpaired T test. Analyses were performed usin g GraphPad Prism 5 (GraphPad Software, La Jolla, California, USA). Results Endosymbiont D ensities One of four antimicrobial compounds were added to artificial diet solutions to determine their activity against D. citri endosymbionts (Figure 1 1). Titers o f Carsonella (6.621.39) and Wolbachia (10.982.14) were lowest observed in D. citri treated with oxytetracycline. Carsonella titers were reduced by oxytetracycline compared to control (P=0.052, t= 2.073, df=19), streptomycin (P=0.042 t=2.182, df=19), and erythromycin (p=0.011 t=2.82, df=20). Wolbachia titers were reduced by oxytetracycline and erythromycin compared to streptomycin (P=0.056, t=2.037, df=19 and P=0.097, t=1.746, df=19 respectively), but not compared to control (P=0.283. t=1.104, df=19 and P= 0.639, t=0.477, df=19 respectively). When streptomycin was added to diet solutions, the largest mean titers of Carsonella (22.647.30) and Wolbachia (45.4619.43) were observed in D. citri but there was not a significant difference in titers compared to c ontrol psyllids (P=0.507, t=0.678, df=18 and P=0.136, t=1.561, df=18 respectively). Discussion Insect bacterial symbiosis i s a common and ancient phenomenon (Brownlie & Johnson 2009; Douglas 2014). Ca. C. ruddii is an obligate bacterial symbiont present i n all species of the family Psyllidae and provides nutritional benefits to their hosts (Nakabachi et al. 2006; Tamames et al. 2007). D. citri has cospeciated with Carsonella and passes it vertically to the offspring (Th ao et al. 2000; Dan et al. 2017 ). Wol bachia is another endosymbiont prevalent in D. citri populations (Chu et al. 2018). Although the

PAGE 25

25 effects of Wolbachia on D. citri are not fully known, it is believed to play a defensive role and impact CLas densities within the psyllid (Fagen et al. 2012; Jain et al. 2017). The purpose of this study was to quantify the effects of antimicrobial activity against two of D. citri endosymbionts, Carsonella and Wolbachia Tetracycline derived antimicrobials have frequently been reported to reduce bacterial symbi onts in insects (Douglas 1992; Dobson & Rattanadechakul 2001; Lee et al. 2016). Although clearing primary symbionts, such as Buchnera from A. pisum (Douglas 1992) has been demonstrated, symbiont clearing is not always possible (Smith & Rajan 2000; Hermans et al. 2001; Ruan et al. 2006). It has previously been reported that Wolbachia titers in D. citri have been experimentally reduced by oxytetracycline and streptomycin (Rivas et al. personal communication). Additionally, Ruan at al. (2006) was capable of el iminating Wolbachia from B. tabaci with tetracycline, ampicillin, or rifampicin at a concentration of 50 g ml 1 There was an observed reduction in D. citri primary symbiont, Carsonella, after treatment with oxytetracycline, but no treatment significantly reduced Wolbachia titers compared to control. Wolbachia can be located in somatic and germ cells, as well as the bacteriome (Dobson et al. 1999; Hosokawa et al. 2009). Carsonella is located in the bacteriome of D. citri (Nakabachi et al. 2006). Antimicrobial compounds must be ingested and pass through the gut epithelium in order to reach the endosymbionts. It al so must be capable of passing though the cell membrane of the bacteriome in order to reach Carsonella. Reductions in Carsonella indicate that this might be possible, which is supported by

PAGE 26

26 previous work (Chopra & Roberts 2001). Tetracycline is capable of cr ossing the outer membr ane of gram negative bacteria. Wolbachia has been used as a biocontrol agent in A. albopictus against vectors of human pathogens by blocking disease transmission (Dobson et al. 2001; Ant et al. 2018; Carrington et al. 2018). This leav es a potential to use the symbionts of D. citri as a possible management strategy for CLas (Douglas 2007). Symbiont manipulation could be potentially utilized to reduce disease transmission in a similar way to A. albopictus or help in preventing insecticid al resistance (Chen & Stelinski 2017; Carrington et al. 2018). Foliar sprays of antimicrobials need to penetrate the leaf cuticle in order to reach the phloem, where D. citri feed (Yang et al. 2015). Complete removal of D. citri symbionts may be impossible due to the obligate nature D. citri shares with its symbionts.

PAGE 27

27 Figure 2 1. Absolute quantification of (A) Carsonella and (B) Wolbachia titers in D. citri after feeding for 3 d on diet solution containing an antimicrobial. Different letters over bars ind way

PAGE 28

28 Table 2 1. Primers and probes used for qPCR. Adapted from Chu et al. (2016). TCGAGCGCGTATGCGAATAC GCGTTATCCCGTAGAAAAAGGTAG AGACGGGTGAGTAACGCG GTATGCCACGTCGCATTCCAGA GCCAAAACTGCTAAGGGCATTC ATCCAGATGCTTACGCTGG Primers F: GCTCTCAAAGATCGGTTTGACGG R: GCTGCCACGAACGTTACCTTC Probe TTACTGACCATCACTCTGGACGC F: TGGGAACGCCATATGCTAAT R: GTCCCAATGGGTTGTTCATC AGCAGCCAGAGAAGCAAGAG TACGTCGCACACCTTCAAAA Adapted from Chu et al. (2016).

PAGE 29

29 CHAPTER 3 PERFORMANCE OF D. CITRI IN RESPONSE TO ANTIMICROBIAL THERAPY The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae) is the primary vector for the pathogenic bacterium, Candidatus Liberibacter asiaticus (CLas), the causal agent of citrus greening disease, or Huanglongbing (HLB) (Jagoueix et al. 1994 ; Bov 2006) HLB is the most devastating disease of the citrus, worldwide. It is responsible for a 30% decrease in acreage and 50% decrease in production in Florida from 2008 2014 due to the decline and ultimate death of infected trees. CLas annually costs the Florida citrus industry over 300 million dollars in losses which accounts for approximately 19 % of average grower revenues ( Hodges et al. 2014; Hodges & Spreen 2015). D. citri acquire CLas while feeding on the phloem of infected citrus trees, and the disease is spread by the adults flying to and then feeding upon uninfected citrus trees (Manjunath et al. 2008; Jagoueix et al. 1994) Huanglongbing management currently relies on effective suppression of ACP with insecticides. Intense use of insecticides has caused widespread indications of insecticide resistance in ACP populations (Chen & Stelinski 2 017). Significant emphasis is currently being placed on development of cures for HLB, but in the interim, the citrus industry is in need of short term solutions to combat HLB. One potential method that is being investigated with significant previous preced ence is deployment of antimicrobial compounds to target and kill the causal pathogen within trees. The Florida Commissioner of Agriculture issued a crisis exemption for use of three commercial antimicrobials on citrus in March 2016. FireLine (oxytetracycli ne hydrochloride), Mycoshield (oxytetracycline calcium carbonate), and Firewall (streptomycin sulfate) are labeled for use on other crops primarily as

PAGE 30

30 prophylactic treatment of foliar bacterial pathogens. Studies have shown antibiotic treatments to signifi cantly lower C Las titers in trees (Zhang et al. 2011; Zhang et al. 2013a,b; Zhang et al. 2014) Antimicrobial efficacy depends on effective penetration and systemic movement of the material into the phloem. Trees are treated with foliar applied antimicrobi als; however, little is known about the penetration of the material into the phloem, mobility within the phloem, or the concentration necessary to eliminate the bacterium. In addition, psyllids feeding on treated plants may ingest antimicrobials within the phloem, which may affect feeding, fitness, and transmission capacity if the materials negatively impact endosymbiont or C Las populations. In addition to CLas, Diaphorina citri have three other bacterial endosymbionts., including Candidatus Carsonella rud dii an obligate nature with its host and provides nutritional benefits to D. citri (Thao et al 2000; Nakabachi et al. 2006; Tamames et al. 2007; Nachappa et al. 2011; Riley et al. 2017). This is important for D. citri fitness since their diet of plant phlo em is largely deficient in amino acids (Douglas 1993; Sandstrm & Moran 1999; Macdonald et al. 2012). It is common for phloem feeding insects to utilize bacteria for this function and to maintain them in specialized bundles of cells called bacteriomes (Bau mann et al. 1995). Previous studies have shown reductions in the obligate endosymbiont Buchnera aphidicola when antimicrobials were administered to Acyrthosiphon pisum (Griffiths & Beck 197 4 ; Prosser & Douglas 1991; Chen et al. 2000; Koga et al. 2007) It is not known whether the foliar antimicrobial applications have a fitness effect on D. citri or their endosymbionts. The goal of this study was to evaluate whether antimicrobial therapy for CLas infected citrus also has potential to control psyllid

PAGE 31

31 populat ions. The results from these experiments will provide a clear indication of whether the utility of antimicrobials extends beyond reducing Las titers in trees to also reducing CLas transmission and controlling ACP populations. We hypothesized that antibioti cs used to treat citrus plants infect with CLas would also have a negative impact on D. citri endosymbionts and, therefore, reduce host fitness. The current objectives were to: 1) evaluate th e effect of dietary exposure to antibiotics on D. citri survival ; 2) quantify the effect of antibiotic exposure on D. citri fecundity and fertility; and 3) determine whether antibiotic treatment reduces transmission of CLas by D. citri Materials and Methods Insect and Plant C ultures D. citri were reared in a secure, in sect proof insectary at the University of Florida Citrus Research and Education Center (Lake Alfred, Florida). The D. citri culture was established in 2000 from feral D. citri collected in Polk County, Florida (28.0 N, 81.9 W) prior to detection of C Las in the state. D. citri were reared on a mixture of Citrus spp and Murraya spp. grown free of insecticides at a 14:10 h light: dark cycle, 243 C, and 6010% R.H. Plants and insects were regularly screened using quantitative real time polymerase chain rea ction (qPCR) analysis to confirm that colonies remained free of C Las infection (Li et al. 2006). Longevity The effects of oxytetracycline (Sigma Aldrich, St. Louis, Missouri, USA) or streptomycin (Gibco Life Technologies, Grand Island, NY, USA) on the sur vival of D. citri adults were evaluated in feeding arenas. Feeding arenas were constructed according to Russel & Pelz Stelinski (2014) with slight modifications. They were made from 60 mm plastic petri dishes with the top removed. A single layer of parafil m was

PAGE 32

32 stretched over the top and 300 l of diet solution was placed on top of the parafilm. A 60 mm circle of Whatman qualitative no. 5 filter paper (Whatman International Ltd, Kent, UK) was placed on top of the diet solution to absorb the solution. A sec ond layer of parafilm was stretched over the filter paper. Dishes were maintained at 25C, L14:D10 photoperiod, and 55% RH in an insectary. Each feeding arena contained 300 of an artificial diet solution comprised of 17% sucrose, and one of the following treatments: oxytetracycline, streptomycin, imidacloprid (1.0 mg ml 1 positive control) (Bayer CropScience LP, Research Triangle Park, North Carolina, USA), or water (negative control). Antibiotics were evaluated at a low and high concentration (1.0 mg ml 1 or 5.0 mg ml 1 respectively). Fifteen 5 d old D. citri adults from a CLas negative insectary were added to feeding arenas and mortality was recorded every 3 d and live insects were transferred to new feeding arenas with fresh diet solutions. The expe riment was terminated after 30 d or when all insects were dead. Each treatment was replicated three times. The entire experiment was replicated 5 times on different dates. Fecundity and Fertility Assays The reproductive output of D. citri exposed to oxyt etracycline or streptomycin treated plants was evaluated in a greenhouse assay. Five month old Citrus macrophylla plants reared in an insect free greenhouse without exposure to insecticide received foliar applications of streptomycin (0.4 mg ml 1 FireWall 50WP, Agrosource, Tequesta, FL, USA), or oxytetracycline (0.3 mg ml 1 FireLine 17WP, Agrosource, Tequesta, FL, USA) 0.40 mg ml 1 FireWall 50WP (+) 0.01 mg ml 1 Grounded 0.30 mg ml 1 FireLine 17WP (+) 0.0025 mg ml 1 Dyne Amic (Helena Chemical Company, Collierville, Tennessee, USA), 0.0025 mg ml 1 Dyne Amic, 0.01 mg ml 1 Grounded (Helena Chemical Company, Collierville, Tennessee, USA), 1.0 mg ml 1 imidacloprid (Bayer

PAGE 33

33 CropScience LP, Research Triangle Park, North Carolina, USA), and water for a control. A ll treatments were dissolved in Nanopure water. Treatments were applied until runoff using a handheld sprayer. Plants were allowed to dry before exposed to D. citri One female and three male CLas negative D. citri aged at 3 days post adult emergence wer e enclosed on a Citrus macrophylla plant with an insect proof, mesh sleeve. A curved metal rod was used to reduce direct contact between the mesh screen and the plant. Plants were kept in an insectary at 24 3 C, 60 10% R.H. with a L14:D10 photoperiod. Females were allowed to oviposit on citrus plants with new growth (flush) over a 25 d period. Total eggs laid (fecundity) were counted under a stereoscope each 5 d period, then transferred to newly treated plants with flush to encourage new oviposition eve nts. To determine if compounds containing AI oxytetracycline or streptomycin had an effect on the number of hatched eggs (fertility), plants were maintained as previously described for 6 d after adult removal. The total number of nymphs on plants were cou nted every 3 d under a stereoscope and recorded Plant Inoculation To measure inoculation of D. citri after feeding directly on oxytetracycline or streptomycin, approximately 400 adult D. citri were collected by aspirating from the insectary containing CLa s (+) plants and insects. D. citri were placed in 4C for two hours for easy handling and short term storage. D. citri were transferred as groups of 20 to feeding arena (Russel & Pelz Stelinski 20 14 ) containing feeding solution containing with oxytetracycl ine (1mg ml 1 or 5 mg ml 1 ), streptomycin (1mg ml 1 or 5 mg ml 1 ), imidacloprid (1mg ml 1 ), or Nanopure water for a negative control. After three days, adults were removed from feeding arena, sexed and 6 total D. citri 3 males and 3

PAGE 34

34 females, were placed o n a CLas ( ) plant contained within an insect proof mesh sleeve. Adults were allowed to feed and oviposit on a plant for two weeks before being removed. F1 generation adults were removed from plants upon emergence and stored in 80% EtOH at 20C. Plants an d D. citri were maintained at 24 3C, 60 10% R.H., and L14:D10 photoperiod. After 90 d, leaves were collected as above. Prior to D. citri exposure three leaves were subsampled to quantify the baseline CLas titer in each plant. Leaves were collected from the top, middle, and bottom of the plant. Midribs were excised 100 mg of finely chopped leaf tissue was ground under liquid nitrogen with glass beads (Tissuelyzer, Qiagen, Valencia, CA, USA). Nucleic acid extraction was performed with the DNeasy Plant Min i Kit (Qiagen, Valencia, CA, USA). Samples were diluted to 10 ng l 1 and stored at 20C for later qPCR detection of CLas and COX titers. Conditions for qPCR were described in Li et al. (2006) and run on a 7500 Fast Real Time PCR Machine (Applied Biosyste ms, Foster City, California, USA). Primer and probes used are listed in Table 2 1. ELISA Absorption of streptomycin by plants following soil applications was assessed using an enzyme linked immunosorbent assay (ELISA) (Plexense Inc., Davis, California, US A). Five month old C. macrophylla plants removed from soil and roots rinsed in distilled water. Plant roots were placed in an Eppendorf tubes containing 35 ml of Scotts MiracleGro (The Scotts Company LLC, West Palm Beach, Florida, USA) at a concentration o f 4.5 g/L. Deionized water for a negative control, 5 mg ml 1 Oxytetracycline or 5 mg ml 1 Streptomycin were added to the fertilizer before plant roots were placed into the solution.

PAGE 35

35 After 48 hours, plants were removed from Eppendorf tubes, then re potted in potting soil. Plants were placed in a cage containing 10 psyllids. After an additional 72 hours, D citri and plant leaves were removed from plants. Preparation of samples for small molecule ELISA was prepared by following the protocol provided by Plexen se (Plexense Inc., Davis, California, USA). Leaf midribs were isolated, chopped, and 100mg were added to 1.5 ml Eppendorf tubes with a ceramic bead. Sample was frozen in liquid nitrogen and ground into a powder using TissueLyser II (Qiagen, Valencia, CA, U SA). Samples were centrifuged for two minutes at 13,000 rpm. 500 l reagent A was added to each sample, vortexed, and centrifuged for 5 minutes at 13,000 rpm. 200 l of the supernatant was diluted 20 fold in reagent A. To detect quantity of oxytetracyclin e or streptomycin, 50 l of diluted reagent B and 50 l of standard solution or diluted sample was added to a well on a 96 well ACCEL ELISA Strip plate (Plexense Inc., Davis, California, USA), mixed gently, and allowed to incubate for 30 minutes at room te mperature. Liquid was dumped from each well and washed by filling each well of ACCEL ELISA Strip with wash solution using a squeeze bottle for rinsing. Rinsing was repeated 4 times. Wash solution was dumped from each well and wells were dried. 100 L of re agent C was added to each well of ACCEL ELISA strip and incubated at room temperature for 15 minutes. Absorbance values were measured at 655 nm using the Spectra Max 250 microplate reader. Concentrations of samples were calculated from the curve generated from the samples used as standards. Statistical A nalysis Inoculation efficiency following antimicrobial exposure were calculated according to the CLas gene copy number in leaves using nested qPCR. Differences in life history

PAGE 36

36 characteristics were compared a mong treatments by normalizing the data with a square root transformation and then with an analysis of variance (ANOVA) followed by post hoc inoculation), Kaplan Meier log rank Mantel Cox analysis (longevity), or two tailed T test (ELISA). Results Longevity Feeding solutions containing oxytetracycline or streptomycin were orally administered to D. citri to determine the mortality inducing effects of these compounds (P< 0.0001, X 2 = 264.5, df= 5). There was an observed mortality effect on D. citri compared to control when 1mg ml 1 1 a feeding solution (Fig. 3 1). Five mg ml 1 of oxytetracycline exhibited an approximate 40% and 100% mortality effect of D. ci tri after 3 d and 10 d respectively. This mortality effect was comparable to that of the positive control of imidacloprid at the same time points. Five mg ml 1 of oxytetracycline also differed from 1mg ml 1 0.0001), which exhibited an approximate 25% and 63% mortality effect at the 3 d and 10 d time points respectively. D. citri mortality on untreated plants was approximately 20% and 30% during the 3 d and 10 d time points respectively. Neither 5 mg ml 1 nor 1 mg ml 1 streptomycin exh ibited a mortality effect on D. citri compared to controls. By the 29 d time point, there was approximately 40% survival associated with control and streptomycin treatments.

PAGE 37

37 Fecundity and Fertility Assays Plants with developing leaf tissue, or flush, were treated with oxytetracycline or streptomycin to determine their fitness effects on D. citri fecundity. Mean fecundity (Figure 3 2) per 5 d period (P= 0.04, F= 3.14, df= 6, 34) and cumulative fecundity (Table 3 1) over a 25 d period (treatment: P=0.01, F=3 .77, df=6, 34; days: P=0.01, F=4.164, df=4, 34) were measured. Plants treated with streptomycin (+) Ground or Grounded had the lowest mean fecundity per 5 d: 1.22 eggs and 1.07 eggs respectively. Streptomycin (+) Ground (P=0.02, F=4.087, df=8) and Grounde d (P=0.01, F=3.09, df=8) were the only treatments that exhibited a negative fitness effect on D. citri average 5 d fecundity compared to control plants. They were also the only treatments to exhibit a negative fitness effect, compared to controls, on cumul ative fecundity by the 20 d time point. All treatments exhibited a negative effect on average cumulative fecundity per female (P = 0.01, F = 3.77, df =6, 24) by the 25 d time point compared to control treatments. Nymph presences was recorded to measure the fitness effects of active ingredient oxytetracycline and streptomycin on D. citri reproductive output. Mean fertility (Figure 3 3) per 5 d period (P = 0.05, F = 2.46, df = 6, 34) and cumulative fertility (Table 3 2) over a 25 d period (treatment: P<0.0001 F=8.83, df=6, 34; days: P<0.0001, F=12.32, df=4, 34) were measured. Mean fertility per 5 d period differed between treatments with streptomycin (+) Grounded and Grounded exhibiting the lowest means of 0.53 and 0.40 nymphs per 5 d period respectively. Di fferences in fertility were seen starting at the 20 d time point for oxytetracycline (Table 3 2). When the adjuvant Dyne Amic was applied alone or in conjunction with oxytetracycline, cumulative fertility different from control as early as the 10 d time po int. The mean cumulative fertility associated with the adjuvant Grounded, when applied alone or with streptomycin,

PAGE 38

38 differed from the mean of streptomycin alone or control treatments at all treatments afte r the 5 d time point. Plant Inoculation To test the inhibitory effects on inoculation of streptomycin and oxytetracycline, D. citri were orally exposed to these compounds at 5mg ml 1 and 1mg ml 1 and then released onto CLas free plants (P= 0.08, F= 2.17, d f = 5, 34). Mean infection in the oxytetracycline tr eatment differed from plants treated with 1mg ml 1 imidacloprid. No treatment significantly differed from control plants in mean CLas copy number, but plants treated with 5mg ml 1 oxytetracycline exhibited only 25% infection. ELISA Plant roots were soaked in antimicrobial solution to determine their potential to adsorb and translocate the antimicrobials to the leaves. Both streptomycin and oxytetracycline were observed in higher concentrations in the leaves of treated plants compared to control plants (P< 0.0001, t= 19.06, df= 16 and P< 0.0001, t= 57.71 df= 4, r espectively). A mean difference in antimicrobial concentrations was detected between D. citri that fed on plants treated with oxytetracycline versus controls (P=0.004, t=3.209, df=24). A difference was not observed between insects that fed on streptomycin treated plants versus control plants (P=0.77, t=0.29, df=81) Discussion Many management strategies have been tested and implemented for HLB, but there is no cure for infected trees and there is no guaranteed method to exclude D. citri from citrus groves. This enables infected D. citri to spread CLas to uninfected trees, and the reverse of uninfected D. citri acquiring CLas from infected trees (Inoue et al. 2009; Pelz Stelinski et al. 2010). This has resulted in the implementation of foliar applied

PAGE 39

39 formulations of antimicrobials to reduce CLas titers in citrus trees. FireLine 17WP is one antimicrobial approved for foliar use in Florida citrus. When applied at field rates, it contains 54.9 g ml 1 of t he active ingredient (AI) oxytetracycline. FireWall 50WP is a second antimicrobial approved for foliar use in Florida citrus. When it applied at field rates, it contains 263.2 g ml 1 AI of streptomycin. It has previously been shown that antimicrobials can reduce CLas in infected plants through graft based application (Zhang et al. 2014). The goal of this study was to determine if the antimicrobials used in Florida citrus have a fitness effect on D. citri. To test this, we measured longevity, reproductive o utput, and inoculativity of D. citri as well as plant root uptake of these antimicrobials. These studies show that the antimicrobials have an effect on specific fitness parameters of D. citri under laboratory conditions, but it is not known if the effects observed here will be of biological significance to field population of D. citri Adults D. citri are the primary vector for CLas dispersal (Hall et al. 2012), but adults are not as efficient at acquiring the CLas bacteria as the nymphal stage (Pelz Steli nski et al. 2010). Mortality associated with 5mg ml 1 oxytetracycline was at 100% by 10 d after the initiation of the assay This mortality effect is sufficient to kill uninfected adults D. citri before a large percent can acquire CLas (Pelz Stelinski et al. 2010; Ammar et al. 2016) or kill the nymphal stage before they develop into adults (Tsai & Liu, 2000). It is also in line with previous work by Ohtaka & Ishikawa (1991), where heat treatment was shown to reduce endosymbiont levels and harm aphid develo pment and longevity. Another study by Prosser and Douglas (1991) indicated that reduction of endosymbiont titers reduced life span due to an accumulation of toxic nitrogenous waste product and a reduction of amino acids acquired through feeding. Koga et al

PAGE 40

40 (2007) showed a 100% reduction in the endosymbiont titers of Serratia and Buchnera when Acyrthosiphon pisum was fed ampicillin or rifampicin respectively. This clearing of endosymbionts resulted in a reduction in aphid longevity. No other treatments tes ted, other than 1mg ml 1 imidacloprid, which is a known insecticide, had a 100% mortality inducing effect on D. citri Although there was a mean reduction in longevity associated with 1mg ml 1 oxytetracycline, 33% and 15% survival were observed at the 14 d and 29 d time point respectively. Accounting for a possible increase in development time to reach adulthood under variable conditions (Tsai & Liu 2000), some D. citri will most likely still be capable of reaching adulthood before they are killed by mortal ity inducing effects of 1mg ml 1 oxytetracycline. This could be a result of a reduction in obligate endosymbionts, but not complete remove, resulting in reduced mortality compared to 5mg ml 1 oxytetracycline (Ohtaka & Ishikawa 1991). Mc L ean et al. (2011) a nd Koga et al. (2007) showed a reduction in endosymbionts resulted in a reduction in oviposition events by A. pisum. In this study we used field application rates of FireLine and FireWall and observed no reduction in average 5 d fecundity or fertility bet ween D. citri on treated or control plants unless the adjuvant Grounded was applied. There was an observed difference in cumulative fecundity and fertility between control plants and all treatments, but this was not usually statistically significant until the 15 d 25 d time points (Table 3 1; Table 3 2). It is possible that the treatments used in this study did not reduce endosymbiont titers, and therefore no accompanying reduction in fecundity or fertility was observed. Additionally, the reduction in fer tility and fecundity associated with Grounded shown here (Figure 3 2; Figure 3 3; Table 3 1; Table 3 2) may indicate it is not an ideal adjuvant for future use.

PAGE 41

41 Although no antimicrobials tested here significantly reduced mean CLas copy number between inoc ulated plants compared to control plants, previous studies have shown that specific antimicrobials can reduce CLas titers in citrus leaves through foliar application (Yang et al. 2015), graft application (Zhang et al. 2014) and trunk injection (Hu et al. 2 018). The lack of significant reduction could be due to low replication numbers and might be more significant upon further replication. Further replication should reduce the variance observed between samples, which would help indicate if there is truly a s ignificant difference between treatments and controls. Even without significant differences observed, there still remains a biological trend indicating that oxytetracycline inoculated plants have fewer CLas titers compared to plants inoculated with control D. citri This could indicate that fewer CLas bacteria are being salivated into plants because fewer CLas bacteria remain in D. citri that fed on oxytetracycline or streptomycin. Although there is a large concentration of CLas in plants that were fed on b y 5mg ml 1 treated D. citri that observation may not persist with greater replication. CLas is commonly found in the salivary glands of D. citri and is transferred from the salivary glands to the plant during the feeding process (Pelz Stelinski & Killiny 2016). Verifying that the antimicrobials can reach the leaves and D. citri indicated that they might also come in contact with CLas as it is being transmitted acting to slow the spread of CLas. To test the concept of trunk injections on D. citri we used an ELISA based assay to detect antimicrobials in citrus leaves and in D. citri that fed on those leaves. We found mean differences between both streptomycin and oxytetracycline in leaves from control and treated plants, indicating the antimicrobials are r eaching the feeding location of D. citri We further tested D. citri for presence of these antimicrobials

PAGE 42

42 with the same ELISA based assay and found mean differences in antimicrobial concentrations, indicating that D. citri were being orally exposed to the se antimicrobials through a process similar to trunk injection.

PAGE 43

43 Figure 3 1. Mortality effects of oxytetracycline, streptomycin, and imidacloprid on D. citri as displayed by percent survival Kaplan Meier longevity curves. Different letters indicate a significant difference among means according to the lo g rank (Mantel

PAGE 44

44 Figure 3 2. Mean fecundity per female per 5 0.05 by a one

PAGE 45

45 Tabl e 3 1. Mean cumulative fecundity per female counted every 5 d period. Different letters indicate a difference among means according to a two way ANOVA with a Tukey's .05).cumulative fecundity. 25.1721.64 a 42.8328.50 a 60.5635.29 a 76.8934.70 ab 86.3939.77 b 15.147.56 a 48.7114.45 a 55.2916.02 a 64.7123.52 ab 64.7123.52 b 2518.67 a 43.2525.30 a 51.532.28 a 55.530.60 ab 55.530.60 b 21.417.26 a 34.630.41 a 55.427.09 a 69.624.15 ab 78.426.33 b 37.6623.68 a 37.6623.68 a 37.6623.68 a 37.6623.68 b 37.6 623.68 b 28.51.5 a 28.51.5 a 28.51.5 a 28.51.5 b 28.51.5 b 32.528.54 a 73.1753.24 a 81.6752.73 a 113.9262.17 a 133.9275.01 a

PAGE 46

46 Figure 3 3. Mean egg hatch per female per 5 0.05 by a one

PAGE 47

47 Table 3 2. Mean cumulative fertility per female counted every 5 d period. 19.7513.05 a 43.4226.62 ab 49.9225.21 ab 54.4224.71 b 54.4224.71 b 17.714.73 a 30.5710.18 bc 36.1410.09 bc 42.4315.0 bc 42.4315.0 bc 7.758.37 a 15.512.2 5 bc 2320.03 bc 24.7519.96 bcd 24.7519.96 bcd 16.215.46 a 27.226.46 bc 35.825.0 bc 43.822.84 b 43.822.84 b 3.03.16 a 3.03.16 c 3.03.16 c 3.03.16 cd 3.03.16 cd 2.03.74 a 2.03.74 c 2.03.74 c 2.03.74 d 2.03.7 4 d 28.021.73 a 76.7955.72 a 83.2959.51 a 99.1272.03 a 99.1272.03 a Different letters indicate differences among means according to a two way ANOVA with a Tukey's

PAGE 48

48 Figure 3 4. Inoculativity test results. Plants were teste d 90 d post treatment. Different way ANOVA with a Tukey posttest.

PAGE 49

49 Table 3 3. CLas inoculation by D. citri. Results of CLas inoculation to healthy C. macrophylla by infected D. citri treated with antimicrobials. Positive plants indicated by Ct < 35.

PAGE 50

50 Figure 3 5. ELISA detection of (A) streptomycin in citrus leaves (B) and psyllids that fed on treated leaves (C) and oxytetracycline in citrus leaves (D) and psyllids that fed on treated leaves. Concentrations determined a standard curve. Diff erent tail T test.

PAGE 51

51 CHAPTER 4 BEHAVIORAL RESPONSE OF DIAPHORINA CITRI TO ANTIMICROBIALS Diaphorina citri are a major pest of global citrus production (Bov 2006; Grafton Cardwell et al. 2013) due to their status as vectors of Candidatus Liberibacter asiaticus (CLas), the causal agent of citrus greening disease. Current management strategies rely on chemical and behavioral manipulation to reduce damage caused by D. citri (Boina et al. 2009 ; Rogers & Dewdney 2016). Current Integrated Pest Management (IPM) programs to reduce HLB rely on insecticidal management of D. citri populations, maintenance of pathogen free nursery stock, and tree removal to limit transmission of inoculum to susceptibl e citrus (Rogers & Dewdney 2016; Grafton Cardwell et al. 2013). Aggressive use of insecticides and limited available modes of actions have led to increases in populations of D. citri that are resistant to currently available insecticides. Biological contro l of D. citri populations with the ectoparasitoid Tamarixia radiata is also used for management of D. citri in organic groves; however, parasitism rates rarely exceed 20% (Qureshi et al. 2009). There is an urgent need to develop alternative strategies for sustainable D. citri control. Recent effort to control CLas populations in citrus, which include applications of antimicrobial compounds, may offer one such novel strategy for managing D. citri particularly when combined with a traditional insecticidal s pray program. Efforts to screen and develop bactericides and other curative products are underway. Recently, Section 18 emergency exemptions were issued for the use of three commercially available antibiotic compounds in citrus, streptomycin sulfate (FireW all 50WP, AgroSource, Inc.), oxytetracycline hydrochloride (FireLine 17WP, AgroSource, Inc.), and oxytetracycline calcium complex (Mycoshield, Nufarm Americas, Inc. ). Ampicillin,

PAGE 52

52 carbenicillin, penicillin, cefalexin, rifampicin and sulfadimethoxine are eff ective in eliminating or suppressing CLas when applied using graft based chemotherapy (Zhang et al. 2014) FireWall and FireLine are approved management of several other agricultural diseases in addition to HLB, including fire blight in apple and pear crop s. Antimicrobial treatments for psyllids may negatively affect a variety of psyllid biological features, including fecundity, transmission capacity, life span, developmental time, and behavior (Prosser & Douglas 1991; Hermans et al. 2001; Machado Assefh et al. 2015). Comprehensive examination of the effects of antibiotic treatment on D. citri biology will assist in determining the utility of incorporating these materials into an IPM program for HLB management. Chemical manipulation of D. citri with neonico tinoid insecticides relies on irreversible binding of the compounds to the post synaptic nicotinic acetylcholine receptors in the Central Nervous System (CNS) (Ware & Whitacre 2004), which causes rapid and continuous firing of nerve signals from the neuron with subsequent inactivation of the neuron (Schroeder & Flattum 1984; Buckingham et al. 1997; Matsuda & Sattelle 2005). Insects exhibit increased mortality and reduced probing following exposure to imidacloprid (Boina et al. 2009; Serikawa et al. 2012; Mi randa et al. 2016). FireWall 50WP and FireLine 17WP are intended to reduce CLas titers in infected plants, but they may also alter the response of D. citri to host plants. We hypothesize that antimicrobial treatments will have a repellant effect on D. citr i ; in which case, psyllids would preferential ly select and settle on untreated host plants. Finally, we hypothesize that if D. citri are repelled by antimicrobials, they will not feed on treated plants as much as untreated plants. In this study, we evaluat ed whether: 1) antimicrobials inhibit D. citri

PAGE 53

53 feeding on an artificial diet, and 2) antimicrobial treatment deters settling of D. citri on citrus seedlings in a greenhouse bioassay. Materials and Methods Maintenance of Insect, Pathogen and Host Plants Un infected adult ACP used in behavioral bioassays were obtained from a laboratory culture at the University of Florida, Citrus Research and Education Center (Lake Alfred, USA). The culture was established in 2000 from field populations in Polk Co., FL, USA ( 28.0 o N, 81.9 o W) prior to the discovery of HLB in FL. The culture is C. sinensis (L.) Osb.]. Monthly testing of randomly sampled D. citri nymphs and adults by qPCR was conducted to confirm that psyllids are uninfected. CLas free host plants used in the experiments were cultivated from C. sinensis seed in a greenhouse without exposure to insecticides. The nursery obtained plants were confirmed negative for CLas infection by qPCR. Uninfected and CLas infected plants were maintained in separate secure enclosures with minimal risk of cross contamination. Settling B ioassay Three to five month old Citrus macrophylla plants with new leaf growth, called flush, and of uniform height (7 10 cm) were used f or settling assays. A seedling treated with an antimicrobial was paired with a designated control seedling, spaced 0.5 m apart on opposite sides of a 0.6 x 0.4 x 0.4 m screen cage. Five replicate cages were spaced 1 m apart and rearranged every 24 hours to minimize location effects. The experiment was conducted in a climate controlled room at 25C, L14:D10 photoperiod, and 55% RH. Each plant served as an experimental unit.

PAGE 54

54 Each treated received a foliar application of 0.4 mg ml 1 FireWall 50WP (Agrosource, Tequesta, Florida, USA), 0.3 mg ml 1 FireLine 17WP (Agrosource, Tequesta, Florida, USA), 1.0 mg ml 1 Admire Pro 4.6F (Bayer CropScience LP, Research Triangle Park, North Carolina, USA), or deionized water. Fifteen D. citri adults of mixed age and gender f rom a CLas free laboratory culture were collected in a vial and starved for two hours. At the onset of the experiment, D. citri were released into the center of each and allowed to settle on seedlings. D. citri settled on seedlings, or found dead, were rec orded 4 h, 8 h, 24 h, 48 h, and 72 h after release. Preferences were assessed by the number of adults found on each host plant at each time point. The entire experiment was replicated five times. Feeding I nhibition A ssay The objective of this experiment w as to determine whether antimicrobial compounds inhibit D. citri feeding by quantifying honeydew production by D. citri following exposure to the compounds in an artificial diet. The sucrose solution consisted of oxytetracycline hydrochloride (Sigma Aldric h, St. Louis, Missouri, USA) and streptomycin sulfate (Gibco Life Technologies, Grand Island, NY, USA) dissolved in a 17% sucrose solution at a concentration of 5.0 mg ml 1 or imidacloprid (Admire Pro 4.6F) dissolved in a 17% sucrose solution at a concen tration of 1.0 mg ml 1 Feeding arenas were constructed according to Russel & Pelz Stelinski (2014) with slight modifications, and consisted of 60 mm plastic petri dishes with the top removed. A single layer of parafilm was stretched over the top of the ar ena. Three hundred l of sucrose solution was placed on top of the first parafilm layer. A 60 mm circle of Whatman qualitative no. 5 filter paper (Whatman International Ltd, Kent, UK) was placed on top of the sucrose solution. A second layer of parafilm w as stretched over the

PAGE 55

55 filter paper to maintain moisture within the filter paper. Ten female adult D. citri of mixed p of the first layer of parafilm. The lid was placed onto the arena and the arena was inverted. A second 60 mm circle of Whatman qualitative no. 5 filter paper was placed underneath the feeding D. citri to collect excreted honeydew droplets. Dishes were m aintained at 25C, L14:D10 photoperiod, and 55% RH in an insectary. After 72 h the filter papers were collected and stained with ninhydrin (Sigma Aldrich, St. Louis, MO) in acetone (1% weight/volume), as described by Boina et al (2009). Feeding rates were determined by enumerating the number of honeydew droplets, stained purple by the ninhydrin treatment. The experiment was replicate seven times. Statistical Analysis A repeated measures ANOVA was used to determine if there was a significant difference in th e mean number of D. citri that settled on antimicrobial versus control treated seedlings across time points. For the feeding bioassay, the mean number of honeydew droplets excreted by D. citri in each treatment were compared with ANOVA, followed by means s to determine differences among treatments. Individual means for the settling and feeding inhibition assay were analyzed using a two tailed unpaired T test. A significance values of used to determine significance. Analyses were performed using GraphPad Prism 5 (GraphPad Software, La Jolla, California, USA).

PAGE 56

56 Results Settling B ioassay The objective of this experiment was to determine if FireLine 17WP or FireWall 50WP had a ho st selection effect on D. citri This was assessed by comparing the percent of total D. citri selecting host plants at each time point. Fewer D. citri were observed on oxytetracycline treated than control plants 24 h after D. citri were released into the c ages ( P = 0.02, F= 8.00, df= 1, 9). The lowest percentage of adult D. citri observed on oxytetracycline treated plants (23%) occurred after 48 h and 72 h after release (Figure 3 1 D E). This difference was significant at both 48 h ( P = 0.01, F= 11.37, df= 1, 9) and 72 h ( P = 0.003, F= 16.81, df= 1, 9). A higher percentage of D. citri settled on oxytetracycline treated seedlings than control seedlings after 4 h ( P = 0.79, F= 0.07, df= 1, 9) (Figure 3 1A). Streptomycin treated plants experienced a larger percenta ge of adults settling at all five time points than controls although there was never more than a ten percent difference between treatments Thirty six %, 23%, and 23% of settled D. citri selected streptomycin treated plants at 24 h, 48 h, and 72 h respect ively, which equates to a 13% reduction in settling as compared to control, after the 24 h time point. C. macrophylla plants sprayed with FireLine 17WP had the lowest percentage of settled adult D. citri after 48 h and 72 h (Figure 3 1 D E) compared to ot her treatments tested. The lowest percentage of adult D. citri settled on C. macrophylla seedlings treated with imidacloprid after 4 h, 8 h, and 24 h (Figure 3 1 A C), with approximately 17% of settled D. citri choosing imidacloprid treated seedlings over control seedlings within the first four hours. This percentage nearly doubled to 33% after 8 h). A lower percentage of D. citri settled on imidacloprid treated seedlings than on control plants at

PAGE 57

57 every time point (Figure 3 1). Settling was used to quantif y host deterrence caused by foliar treatment. The greater the observed difference in settling between treated and control plants signified a greater deterrent effect from the treatment. Feeding I nhibition A ssay The objective of this experiment was to dete rmine whether antimicrobials reduced feeding of adult D. citri Ninhydrin stains on filter paper was used to quantify D. citri feeding. The greater number of ninhydrin stains equated to more honeydew excretions, which was used to quantify the amount of fee ding. Honeydew production was lower when D. citri fed on diets containing 5.0 mg ml 1 oxytetracycline for 72 h compared with control diet solution (P= 0.0897, t= 1.846, df= 12). All treatments reduced the amount of honeydew droplets produced by adult D. ci tri after 72 h compared to untreated diets (Figure 3 2), but there was no observed significance Discussion Numerous reports have demonstrated reductions in insect fitness in response to ant ibiotic mediated suppression of bacterial symbionts. In a previous study (Rivas et al. personal communication), exposure to streptomycin and oxytetracycline through artificial diet or treated citrus cuttings reduced D. citri fitness and decreased populati ons of Wolbachia in the insects compared to those fed on antibiotic free food sources. Deleterious effects on insect fitness are often associated with behavioral alterations, by altering responses to host or environmental cues or by altering feeding behav iors (Lu et al. 2016). The purpose of this investigation was to evaluate the behavioral effects of antibiotic treatments on D. citri

PAGE 58

58 The results of this study demonstrate that antimicrobial treatment alters the feeding behavior of D. citri adults compare d with insects not exposed to antibiotics in their diet. We observed reduced feeding on diets containing oxytetracycline compared with antibiotic free diets. This suggests that the gustatory cues received by D. citri when feeding on sucrose diets may be al tered when oxytetracycline is incorporated into the diet. Additional investigations are needed to determine whether feeding reductions in response to oxytetracycline and streptomycin are associated with other behaviors, such as the amount of time spent pro bing or ingesting diet substrates (Wilkinson & Douglas 1995; Serikawa et al. 2012; Machado Assefh et al. 2015). Although D. citri prefer to settle on citrus flush compared to mature leaf tissue (Mann et al. 2012; Stamou et al. 2016), they can be deterred from ideal host plants that have received a foliar application of insecticides (Ichinose et al. 2010; Tiwari & Stelinski 2013), kaolin clay (Miranda et al. 2018), and varying plant extracts (Zaka et al. 2010; Ouyang et al. 2013 ; Kuhns et al. 2016 ). Moreov er, D. citri feeding is reduced in response to some insecticides, such as cyantraniliprole, imidacloprid, and flupyradifurone ( Boina et al. 20 09 ; Tiwari & Stelinski 2013; Chen et al. 2017 ). Feeding reduction is an important component in managing CLas trans mission, as the pathogen is acquired and transmitted by D. citri during feeding. Continuous feeding for approximately 30 min on infected trees is required for pathogen acquisition, and 5 7 h of feeding on trees is required for transmission to healthy plant s (Grafton Cardwell et al. 2013 ). Thus, the spread of the pathogen may be reduced by deterring the vector from feeding on citrus plants (Chiyaka et al. 2012 ; Nakasuji et al. 1975 ; Nauen 1995 ; Nauen et al. 1998 ).

PAGE 59

59 Host selection is a complex behavior regul ated by the CNS in response to stimuli. Insects predominately receive stimuli from plants in the form of visual, olfactory, and gustatory nerve response (Gullan & Cranston 200 9 ). Changes in these cues can change insect responses to host plants. This study indicated that antimicrobial compounds applied to citrus for reduction of CLas might deter some D. citri feeding and settling The application of feeding deterrents, such as insecticides, is an important component of HLB management (Grafton Cardwell et al. 2013 ). Previous observations of reduced fitness of D. citri treated with antimicrobials may be directly associated with reduced feeding. Further field scale evaluation is needed to determine the efficacy of oxytetracycline and streptomycin for preventing new CLas infections. The properties of antimicrobial treatments identified by this investigation may prove to be of additional value in reducing HLB incidence beyond direct reduction of the pathogen in plants.

PAGE 60

60 Figure 4 1. Settling preference of D. ci tri adults on citrus plants compared to control plants at (A) 4 h, (B) 8 h, (C) 24 h, (D) 48 h, (E) 72 h after release of adults. Bars with different letters indicates significant difference by unpaired two tail T test (P < 0.05).

PAGE 61

61 Figure 4 2. Feeding of D. citri as measured by honeydew production. Bars with difference letters are significantly different following an unpaired two tail T test (P < 0.10).

PAGE 62

62 CHAPTER 5 SUMMARY AND CONCLUSION Huanglongbing is a bacterial disease of citrus caused by the pathoge n Candidatus Liberibacter asiaticus (Bov 2006). CLas is transmitted by Diaphorina citri For this reason D. citri is a major pest of citrus. In March 2016 the Florida C ommissioner of A griculture issued a crisis exemption for the use of three commercial antimicrobials for control of citrus Huanglongbing: FireLine (oxytetracycline hydrochloride), Mycoshield (oxytetracycline calcium complex), and FireWall (streptomycin sulfate), which are labeled for use primarily as prophylactic treatment of foliar bacteri al pathogens. D. citri feed on a diet of plant phloem, which lacks key amino acids necessary for D. citri growth and survival (Douglas 1993). To overcome this challenge, D. citri have developed a symbiotic relationship with the bacteria Candidatus Carsonel la ruddii, Candidatus Profftella armature, and Wolbachia (Nakabachi et al. 2006; Nakabachi et al. 2013; Ren et al. 2017). We hypothesized that antibiotics used to reduce CLas infection in citrus would also reduce titers of these endosymbiont s resulting in a reduc tion in D. citri fitness. To test this hypothesis, D. citri were exposed to anti biotics i n a series of bioassays to quantify their effects on insect fitness host selection, and feeding behavior Additionally, we evaluated the capacity of the anti b iotics to translocate from the roots to the leaves and subsequently be detected in D. citri We observed a reduction in Carsonella titers and insect survival when D. citri fed on oxytetracycline in artificial diet compared to control diet. In addition to reduced survival, reduced CLas inoculation settling deterrence, and feeding inhibition were also observed in response to oxytetracycline treatments. Similar effects on fitness and

PAGE 63

63 behavior were not observed in response to streptomycin. Cumulatively, these results indicate that oxytetracycline may be a useful management tool for management of CLas transmission and D. citri in addition to management of plant CLas infection In the future it would be useful to evaluate to effect of antimicrobials on the en dosymbiont Profftella, as it is maintained in a different location within the bacteriome than Carsonella (Nakabachi et al. 2013). Profftella plays an important role in D. citri defense; therefore, reduction in Profftella concentration may have a negative e ffect on the fitness of D. citri Negative fitness effects following exposure to antimicrobials may also be associated with changes in the gut microbiota of D. citri although their exact role in D. citri physiology is unknown (Subandiyah et al. 2000). Al though CLas titers were reduced in plants inoculated by CLas infected D. citri it will be important to follow up these experiments by evaluating CLas titer change s in D. citri following dietary exposure to antibiotics Reductions in the CLas titer of infe cted D. citri may indicate that anti bioti cs can be used to reduce the pathogen to concentration s that are insufficient to cause an infection in plant s In addition, electrical penetration graph recordings and evaluation of host olfactory cues in response t o antimicrobials will be useful for elucidating the mechanisms underlying the effect of these compounds on host selection and feeding b ehavior Further investigation is also needed to determine the dos e response of D. citri to foliar and soil applied antim icrobials and to quantify the amount of antimicrobial ingested M ass spectrometry and bacterial inhibition assays should be conducted quantify antimicrobials in citrus phloem and ingested by D. citri during feeding in order to determine efficient applicati on rates of antimicrobials for management of CLas in the field

PAGE 64

64 LIST OF REFERENCES Adams D, Douglas AE. 1997. How symbiotic bacteria influence plant utilisation by the polyphagous aphid, Aphis fabae Oecologia 11 0: 528 532. Allison DG, Lambert PA. 2014. Mo des of action of antibacterial agents. Molecular Medical Microbiology. Tang Y W, Sussman M, Lui D, Poxton I, Schwartzman J [eds.], Elsevier Inc., Amsterdam. 2 ed: 583 597. Ammar E D, Shatters RG, Lynch C, Hall DG. 2011a. Detection and relative titer of Can didatus Liberibacter asiaticus in the salivary glands and alimentary canal of Diaphorina citri (Hemiptera: Psyllidae) vector of citrus Huanglongbing disease. Annals of the Entomological Society of America 104: 526 533. Ammar E D, Shatters RG, Hall DG. 2011 b. Localization of Candidatus Liberibacter asiaticus, associated with citrus Huanglongbing disease, in its psyllid vector using fluorescence in situ hybridization. Journal of Phytopathology 159: 726 734. Ammar E D, Ramos JE, Hall DG, Dawson WO, Shatters RG Jr. 2016. Acquisition, replication and inoculation of C andidatus Liberibacter asiaticus following various acquisition periods on Huanglongbing infected citrus by nymphs and adults of the Asian citrus psyllid. PLoS ONE 11: e0159594 Amuzu HE, McGraw EA. 2 016. Wolbachia based dengue virus inhibition is not tissue specific in Aedes aegypti PLoS Neglected Tropical Diseases 10: e0005145. Ant TH, Herd CS, Geoghegan V, Hoffmann AA, Sinkins SP. 2018. The Wolbachia strain wAu provides highly efficient virus trans mission blocking in Aedes aegypti PLoS Pathogens 14: e1006815. Audsley MD, Seleznev A, Joubert DA, Woolfit M, O'Neill SL, McGraw EA. 2018. Wolbachia infection alters the relative abundance of resident bacteria in adult Aedes aegypti mosquitoes, but not la rvae. Molecular Ecology 27: 297 309. Bian GW, Xu Y, Lu P, Xie Y, Xi ZY. 2010. The Endosymbiotic Bacterium Wolbachia Induces Resistance to Dengue Virus in Aedes aegypti PLoS Pathogen 6: e1000833. Baumann P, Baumann L, Lai CY, Rouhbakhsh D, Moran NA, Clark MA. 1995. Genetics, physiology, and evolutionary relationships of the genus Buchnera: intracellular symbionts of aphids. Annual Re view of Microbiology 49: 55 94. Baumann P. 2005. Biology of bacteriocyte associated endosymbionts of plant sap sucking insects Annual Review of Microbiology 59:155 189. Boina D, Onagbola E, Salyani M, and Stelinski L. 2009. Antifeedant and sublethal effects of imidacloprid on Asian citrus psyllid, Diaphorina citri Pest Management. Science 65: 870 877.

PAGE 65

65 Bov JM. 2006. Huanglongbi ng: a destructive, newly emerging, century old disease of citrus. Journal of Plant Pathology 88: 7 37. Brownlie JC, Johnson KN. 2009. Symbiont mediated protection in insect hosts. Trends in Microbiology 17: 348 354. Buckingham SD, Lapied B, Corronc HL, Gro lleau F, Sattelle DB. 1997. Imidacloprid actions on insect neuronal acetylcholine receptors. Journal of Experimental Biology 200: 2685 2692. Carrington LB, Tran BCN, Le NTH, Luong TTH, Nguyen TT, Nguyen PT, Nguyen CVV, Nguyen HTC, Vu TT, Vo LT, Le DT, Vu N T, Nguyen GT, Luu HQ, Dang AD, Hurst TP, O'Neill SL, Tran VT, Kien DTH, Nguyen NM, Wolbers M, Wills B and Simmons CP. 2018. Field and clinically derived estimates of Wolbachia mediated blocking of dengue virus transmission potential in Aedes aegypti mosqu itoes. Proceedings of the National Academy of Science of the United States of America 11: 361 366. Chen D Q, Montllor CB, Purcell AH. 2000. Fitness effects of two facultative endosymbiotic bacteria on the pea aphid, Acyrthosiphon pisum and the blue alfalf a aphid, A. kondoi Entomologia Experimentalis et Applicata 95: 315 323. Chen XD, Seo M, Stelinski LL. 2017. Behavioral and hermetic effects of the butenolide insecticide, flupyradifurone, on Asian citrus psyllid, Diaphorina citri Crop Protection 98: 102 109. Chen XD, Stelinski LL. 2017. Resistance management for Asian citrus psyllid, Diaphorina citri Kuwayama, in Florida. Insects 8: 103. Chiyaka C, Singer BH, Halbert SE, Morris JG, van Bruggen AHC 2012. Modeling Huanglongbing transmission within a citrus tree. Proceedings of the National Academy of Science USA 109:12213 12218. Chopra I, Roberts M. 2001. Tetracycline antibiotics: Mode of action, application, molecular biology, and epidemiology of bacterial resistance. Microbiology and Molecul ar Biology Rev iews 65: 232 260. Chu C C, Gill TA, Hoffmann M, Pelz Stelinski KS. 2016. Inter population variability of endosymbiont densities in the Asian citrus psyllid ( Diaphorina citri Kuwayama). Microbial Ecology 71: 999 1007. Chu CC, Hoffmann M, Braswell WE, Pelz S telinski KS. 2017. Genetic variation and potential coinfection of Wolbachia among widespread Asian citrus psyllid ( Diaphorina citri Kuwayama) populations. Insect Science 00: 1 12. Dan H, Ikeda N, Fujikami M, Nakabachi A. 2017. Behavior of bacteriome symbio nts during transovarial transmission and development of the Asian citrus psyllid. PLoS ONE 12: e0189779.

PAGE 66

66 Dedeine F, Boultreau M, Vavre F. 2005. Wolbachia requirement for oogenesis: occurrence within the genus Asobara (Hymenoptera, Braconidae) and evidence for intraspecific variation in A. tabida Heredity 95: 394 400. Dewdney MM, Rogers ME, Brlansky RH. 2016. Huanglongbing (citrus greening). Florida Citrus Pest Management Guide PP 225: 1 3. ill SL. 1999. Wolbachia infections are distributed throughout insect somatic and germ line tissues. Insect Biochemistry and Molecular Biology 29: 153 160 Dobson SL, Marslan dEJ, Rattanadechakul W. 2001. Wolbachia induced cytoplasmic incompatibility in sin gle and superinfected Aedes albopictus (Diptera: Culicidae) Journal of Medical Entomology 38: 382 387 Dobson SL, Rattanadechakul W. 2001. A novel technique for removing Wolbachia infections from Aedes albopictus (Diptera: Culicidae). Journal of Medical Entomology 38: 844 849. Douglas AE. 1992. Requirement of pea aphid ( Acyrthosiphon pisum ) for their symbiotic bacteria. Entomologia Experimentalis et Applicata 65: 195 198. Douglas AE. 1993. The nutritional quality of phloem sap utilized by natural aphid po pulations. Ecological Entomology 18: 31 38. Douglas AE. 1995. Reproductive failure and the free amino acid pools in pea aphids ( Acyrthosiphon pisum ) lacking symbiotic bacteria. Journal of Insect Physiology 42: 247 255. Douglas AE. 2007. Symbiotic microorga nisms: untapped resources for insect pest control. Trend s in Biotechnology 25: 338 342. Douglas AE. 2014. The molecular basis of bacterial insect symbiosis. Journal of Molecular Biology 426: 3830 3837. Ebert TA, Backus EA, Shugart HJ, Rogers ME. 2018. Beha vioral plasticity in probing by Diaphorina citri (Hemiptera, Liviidae): ingestion from phloem versus xylem is influenced by leaf age and surface. Journal of Insect Behavior 31: 119 137. Espinosa MS, Virla EG, Cuozzo S. 2017. Wolbachia infection responsibl e for thelytoky in dryinid wasps. The case of Gonatopus bonaerensis Virla (Hymenoptera: Dryinidae). Neot ropical Entomology 46: 409 413. Fagen JR, Giongo A, Brown CT, Davis Richardson AG, Gano KA, Triplett EW. 2012. Characterization of the relative abundanc e of the citrus pathogen Ca Liberibacter asiaticus in the microbiome of its insect vector, Diaphorina citri using high throughput 16S rRNA sequencing. The Open Microbiology Journal 6: 29 33.

PAGE 67

67 Fenollar F, Maurin M, Raoult D. 2003. Wolbachia pipientis growt h kinetics and real time PCR. Antimicrobial Agents and Chemotherapy 47: 1665 1671. Ferguson NM, Kien DT, Clapham H, Aguas R, Trung VT, Chau TN, Popovici J, Ryan PA, O'Neill SL, McGraw EA, Long VT, Dui le T, Nguyen HL, Chau NV, Wills B, Simmons CP. 2015. Modeling the impact on virus transmission of Wolbachia mediated blocking of dengue virus infection of Aedes aegypti Science Translational Medicine 7: 279. Fleury F, Vavre F, Ris N, Fouillet P, Bouletreau M. 2000. Physiological cost induced by the maternally transmitted endosymbiont Wolbachia in the Drosophila parasitoid Leptopilina heterotoma Parasitology 121: 493 500. Folimonova SY, Achor DS. 2010. Early events of citrus greeni ng (Huanglongbing) disease development at the ultrastructural level. Phytopathology 100: 949 958. Folimonova SY, Robertson CJ, Garnsey SM, Gowda S, Dawson WO. 2009. Examination of the responses of different genotypes of citrus to Huanglongbing (citrus gree ning) under different conditions. Phytopathology 99: 1346 1354. Fu Y, Gavotte L, Mercer DR, Dobson SL. 2010. Artificial triple Wolbachia infection in Aedes albopictus yields a new pattern of unidirectional cytoplasmic incompatibility. Environmental Microbi ology 76: 5887 5891. Garnier M, Danel N, Bov JM. 1984. The greening organism is a gram negative bacterium. International Organization of Citrus Virologists Conference Proceedings 9: 115 124. Ghanim M, Fattah Hosseini S, Levy A, Cilia M. 2016. Morphologica l abnormalities and cell death in the Asian citrus psyllid ( Diaphorina citri ) midgut associated with Candidatus Liberibacter asiaticus. Scientific Reports 6: 33418. Goldberg IH. 1965. Mode of action of antibiotics. American J ournal of Medicine 39: 722 752. Gottwald TR. 2010. Current epidemiological understanding of citrus Huanglongbing. Annual Review of Phytopathology 48: 119 139. Grafton Cardwell EE, Stelinski LL, Stansly PA. 2013. Biology and management of Asian citrus psyllid, vector of Huanglongbing pat hogen. Annual Review of Entomology 58: 413 432. Griffiths GW, Beck SD. 1974. Effects of antibiotics on intercellular symbiotes in the pea aphid, Acyrthosiphon pisum Cell and Tissue Research 148: 287 300. Gullan PJ, Cranston PS. 2009.The Insects: An Outlin e of Entomology 3rd Edition. Wiley Blackwell.

PAGE 68

68 Hall DG, Richardson ML, Ammar E D, Halbert SE. 2012. Asian citrus psyllid, Diaphorina citri vector of citrus Huanglongbing disease. Entomologia Experimentalis et Applicata 146: 207 223. Hermans PG, Hart CA, T rees AJ. 2001. In vitro activity of antimicrobial agents against the endosymbiont Wolbachia pipientis. Journal of Antimicr obial Chemotherapy 47: 659 663. Hodges AW, Rahmani M Stevens TJ, Spreen TH. 2014. Economic impacts of the Florida citrus industry in 2012 13. Gainesville, FL: University of Florida, Food & Resource Economics Department. Hodges AW Spreen TH 2015. Economic Contributions of the Florida Citrus Industry in 2014 15 and for Reduced Production. Gainesville, FL : University of Florida Food & R esource Economics Department. Hong W, Zeng J, Xie J. 2014. Antibiotic drugs targeting bacterial RNAs. Acta Pha rmaceutica Sinica B 4: 258 265. Hosokawa T, Koga R, Kikuchi Y, Meng X Y, Fukatsu T. 2009. Wolbachia as a bacteriocyte associated nutritional mutua list. Proceedings of the National Academy of Sciences 107: 769 774. Hoy MA, Nguyen R. 2001. Classical biological control of Asian citrus psylla. Citrus Guide 81: 48 50. Hu J, Jiang J, Wang N. 2018. Control of citrus Huanglongbing via trunk injection of pla nt defense activators and antibiotic s. Phytopathology 108: 186 195. Hunter WB, Avery PB, Pick D, Powell CA. 2011. Broad spectrum potential of Isaria fumosorosea against insect pests of citrus. Florida Entomologist 94: 1051 1054. Ichinose K, Bang DV, Tuan D H, Dien LQ. 2010. Effective use of neonicotinoids for protection of citrus seedlings from invasion by Diaphorina citri (Hemiptera: Psyllidae). Journal of Economic Entomology 103: 127 135. Inoue H, Ohnishi J, Ito T, Tomimura K, Miyata S, Iwanami T, Ashihara W. 2009. Enhanced proliferation and efficient transmission of Candidatus Liberibacter asiaticus by adult Diaphorina citri after acquisition feeding in the nymphal stage. Annals of Applied Biology 155: 29 36. Jagoueix S, Bov JM, Garnier M. 1994. The phloe m limited bacterium of greening disease of citrus is a member of the alpha subdivision of the proteobacteria. International Journal of Sys temic Bacteriology 44: 379 386. Jain M, Fleites LA, Gabriel DW. 2017. A small Wolbachia protein directly represses pha Candidatus mSphere 2: e00171 17.

PAGE 69

69 Johny S, Lange CE, Solter LF, Merisko A, Whitman DW. 2007. New insect system for testing antibiotics. Journal of Parisitology 93: 1505 1511. Joubert DA, Wal ker T, Carrington LB, De Bruyne JT, Kien DHT, Hoang NLT, Chau NVV, Iturbe Wolbachia superinfection in Aedes aegypti mosquitoes as a potential approach for future resistance management. PLoS Path ogens 12: e1005434. Kang L, Ma X, Cai L, Liao S, Sun L, Zhu H, Chen X, Shen D, Zhao S, Li C. 2003. Superinfection of Laodelphax striatellus with Wolbachia from Drosophila simulans. Heredity 90: 71 76. Killiny N, Nehela Y. 2017. Citrus phytohormonal respons e to Candidatus Liberibacter asiaticus and its vector Diaphorina citri Molecular Plant Microbe Interactions 30: 666 678. Koga R, Tsuchida T, Sakurai M, Fukatsu T. 2007 Selective elimination of aphid endosymbionts: effects of antibiotic dose and host genot ype, and fitness consequences. Microbial Ecology 60 : 229 239. Koga R, Meng XY, Tsuchida T, Fukatsu T. 2012. Cellular mechanism for selective vertical transmission of an obligate insect symbiont at the bacteriocyte embryo interface. Proceedings of the Natio nal Academy of Sciences USA 109: 1230 1237. Koh EJ, Zhou L, Williams DS, Park J, Ding N, Duan YP, Kang BH. 2012. Callose deposition in the phloem plasmodesmata and inhibition of phloem transport in Candidatus Liberibacter asiat 687 697. Kohanski MA, Dwyer DJ, Collins JJ. 2010. How antibiotics kill bacteria: from targets to networks. Nature Reviews Microbiology 8: 423 435. Kuhns EH, Martini X, Hoyte A, Stelinski LL. 2016. Repellent activity of botanical oil s against Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Liviidae). Insects 7: E35. Lee JB, Park KE, Lee SA, Jang SH, Eo HJ, Jang HA, Kim CH, Ohbayashi T, Matsuura Y, Kikuchi Y, Futahashi R, Fukatsu T, Lee BL. 2016. Gut symbiotic bacteria stimulate ins ect growth and egg production by modulating hexamerin and vitellogenin gene expression. Development and Comparative Immunology 69: 12 22. Li W, Hartung JS, Levy L. 2006. Quantitative real time PCR for detection and identification of Candidatus Liberibacter species associated with citrus Huanglongbing. Journal of Microbiology Methods 66: 104 115.

PAGE 70

70 Macdonald SJ, Lin GG, Russell CW, Thomas GH, Douglas AE. 2012. The central role of the host cell in symbiotic nitrogen metabolism. Proceedings: Biological Sciences 279: 2965 2973. Machado Assefh CR, Lopez Isasmendi G, Tjallingii WF, Jander G, Alvarez AE. 2015. Disrupting Buchnera aphidicola the endosymbiotic bacteria of Myzus persicae delays host plant acceptance. Arthropod Plant Interactions 9: 529 541. Manjunath KL, Halbert SE, Ramadugu C, Webb S, Lee RF. 2008. Detection of Candidatus Diaphorina citri and its importance in the management of citrus Huanglongbing in Florida Phytopathology 98: 387 396. Mann RS, Ali JG, Hermann SL, Tiwari S Pelz Stelinski KS, Alborn HT, Stelinski LL. 2012. Induced release of a plant vectors to plants infected with a bacterial pathog en. PLoS Pathogens 8: e1002610. Martini X, Hoffmann M, Coy MR, Stelinski LL, Pel z Stelinski KS. 2015. Infection of an insect vector with a bacterial plant pathogen increases its propensity for dispersal. PLoS One 10: e0129373. Matsuda K, Sattelle DB. 2005. Mechanism of selective actions of neonicotinoids on insect acetylcholine recept ors, pp 172 183 In Clark JM, Ohkawa H III [eds.], New discoveries in agrochemicals: American chemical society symposium series. Oxfor d University Press, Oxford, UK. McLean AHC, Asch MV, Ferrari J, Godfray HCJ. 2011. Effects of bacterial secondary symbionts on host plant use in pea aphids. Proceedings of the Royal Society B. 278: 760 766. Menninger JR, Otto DR. 1982. Erythromycin, carbomycin, and spiramycin inhibit protein synthesis by stimulating the dissociation of peptidyl tRNA from ribosomes. Antimicrobi al Agent s and Chemotherapy 21: 811 818. Michaud JP, Olsen LE, Olsen LE. 2004. Suitability of Asian citrus psyllid, Diaphorina citri as prey for ladybeetles. BioControl 49: 417 431. Miranda MP, Yamamoto PT, Garcia RB, Lopes JPA, Jopes JRS. 2016. Thiamethox am and imidacloprid drench applications on sweet orange nursery trees disrupt the feeding and settling behavior of Diaphorina citri (Hemiptera: Liviidae). Pest Management Science 72: 1785 1793. Miranda MP, Zanardi OZ, Tomaseto AF, Volpe HXL, Garcia RB, Pra do E. 2018. Processed kaolin affects the probing and settling behavior of Diaphorina citri (Hemiptera: Liviidae). Pest Management Science 74: 1964 1972.

PAGE 71

71 Molloy JC, Sinkins SP. 2015. Wolbachia do not induce reactive oxygen species dependent immune pathway a ctivation in Aedes albopictus Viruses 7: 4624 4639. Nachappa P, Levy J, Pierson E, Tamborindeguy C. 2011. Diversity of endosymbionts in the potato psyllid, Bactericera cockerelli (Triozidae), vector of zebra chip disease of potato. Current Microbiology 65 : 1510 1520. Nakabachi A, Yamashita A, Toh H, Ishikawa H, Dunbar HE, Moran NA, Hattori M. 2006. The 160 kilobase genome of the bacterial endosymbion t Carsonella. Science 314: 267. Nakabachi A, Ueoka R, Oshima K, Teta R, Mangoni A, Gurgui M, Oldham NJ, van Echten Deckert G, Okamura K, Yamamoto K, Inoue H, Ohkuma M, Hongoh Y, Miyagishima S, Hattori M, Piel J, Fukatsu T. 2013. Defensive bacteriome symbiont with a drastically reduced genome. Current Biology 23: 1478 1484. Nakasuji F, Kiritani K, Tomida E. 1975. A computer simulation of the epidemiology of the Rice Dwarf Virus. Research on Population Ecology 16: 245 251. Nauen R.1995. Behaviour modifying effect so flow systemic concentrations of imidacloprid on Myzus persicae with special reference to an antifeed ing response. Pesticide Science 44:145 153. Nauen R, Hungenberg H, Tollo B, Tietjen K, Elbert A .1998. Antifeedant effect, biological efficacy and high affinity binding of imidacloprid to acetylcholine receptors in Myzus persicae and Myzus nicotianae Pest icide Science 53:133 140. Ohtaka C, Ishikawa H. 1991. Effects of heat treatment on the symbiotic system of an aphid mycetocyte. Symbiosis 11: 19 31. Ouyang G, Fang X, Lu H, Zhou X, Meng X, Yu S, Guo M, Xia Y. 2013. Repellency of five mineral oils against D iaphorina citri (Hemiptera: Liviidae). Fl orida Entomologist 96: 974 982. Pelz Stelinski KS, Brlansky RH, Ebert TA, Rogers ME. 2010. Transmission parameters of Candidatus Liberibacter asiaticus by Asian citrus psyllid (Hemiptera: Psyllidae) Journal of Econ omic Entomology 103: 1531 1541. Pelz Candidatus Diaphorina citri (Hemiptera: Liviidae) Annals of the Entomol ogical Society of America 109: 371 376. Prosser WA, Douglas AE. 1991. The aposymbiotic aphid: An analysis of chlortetracycline treated pea aphid, Acyrthosiphon pisum Journal of Insect Physiology 37: 713 719.

PAGE 72

72 Qureshi JA, Kostyk B, Stansly PA. 2009. Control of Diaphorina citri Psyllidae) with foliar and soil applied insecticides. Proceedings of Florida State Horticultural Society 122: 189 193. Ramsey JS, Johnson RS, Hoki JS, Kruse A, Mahoney J, Hilf ME, Hunter WB, Hall DG, Schroeder FC, MacCoss MJ, Cilia M. 2015. M etabolic interplay between the greening insect vector. PLoS One 10: e0140826. innate immun e priming in Wolbachia population dynamics and growth rates of endosymbionts mediated dengue interference. PLoS Pathogen 8: e1002548. Riegler M, Stauffer C. 2002. Wolbachia infections and superinfections in cytoplasmically incompatible populations of the E uropean cherry fruit fly Rhagoletis cerasi (Diptera, Tephritidae). M olecular Ecology 11: 2425 2434. Candidatus Carsonella Bactericera cockerelli Genome Announcement 5: e00236 17. Rogers ME, Shawer DB. 2007. Effectiveness of several soil applied systemic insecticides for managing the Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Proceedings of Florida State Horticultural Society 1 20: 116 119. Rogers ME, Dewdney MM. 2016. 2016 Florida Citrus Pest Management Guide. In Brlansky RH, Dawson WO, Duncan LW, Estes MR, Fishel FM, Futch SH, Graham JH, Hilf ME, Inserra RN, Noling JW, Parsons LR, Peres NA, Ritenour MA, Roberts PD, Salyani M, S chubert TS, Sellers, B, Sieburth PJ, Singh M, Stansly PA, Stelinski LL [eds.], University of Florida, Institute of Food and Agriculture Science Extension Publication. Gainesville, FL. Rousset F, Bouchon D, Pintureau B, Juchault P, Solignac M. 1992. Wolbach ia endosymbionts responsible for various alterations of sexuality in arthropods. Proceedings of the Royal Society B: Biological Sciences 250: 91 98. Ruan Y M, Xu J, Liu S S. 2006. Effects of antibiotics on fitness of the B biotype and a non B biotype of th e whitefly Bemisia tabaci Entomologia Experimentalis et Applicata 121: 159 166. Russell CW, Pelz Stelinski KS. 2014. Development of an artificial diet and feeding system for juvenile stages of the Asian citrus psyllid, Diaphorina citri Entomologia Experi mentalis et Applicata 154: 171 176. Sandstrm J, Moran N. 1999. How nutritionally imbalanced is phloem sap for aphids? Entomologia Experimen talis et Applicata 91: 203 210.

PAGE 73

73 Schroeder ME, Flattum RF. 1984. The mode of action and neurotoxic properties of the nitroethylene heterocycle insecticides. Pesticide Biochemistry and Physiology 22: 148 160. Serikawa RH, Backus EA, Rogers ME. 201 2. Effects of soil applied imidacloprid on Asian citrus psyllid (Hemiptera: Psyllidae) feeding behavior. Journal of Economic Entomology 105: 1492 1502 Stamou M, Simpson CR, Alabi OJ, Nelson SD, Srilakshmi T, Jifon JL. 2016. Quality matters: influences of citrus flush physicochemical characteristics on population dynamics of the Asian citrus psyllid (Hemiptera: Liviidae). PLoS ONE 11: e0168997. sity of Florida/IFAS, EDIS document FE 983. Smith HL, Rajan TV. 2000. Tetracycline inhibits development of the infective stage larvae of filarial nematodes in vitro Experim ental Parasitology 95: 265 270. Spotts CR, Stanier RY. 1961. Mechanism of streptomy cin action on bacteria: unitary hypothesis. Nature 192: 633 637. Subandiyah, S., N. Nikoh, S. Tsuyumu, S. Somowiyarjo, and T. Fukatsu. 2000. Complex endosymbiotic microbiota of the citrus psyllid Diaphorina citri (Homoptera: Psyllidae). Zoological Science 17: 983 989. Sykes JE, Papich MG. 2014. Canine and feline infectious diseases. W.B. Saun ders, St. Louis, Missouri, USA. Tamames J, Gil R, Latorre A, Peret J, Silva FJ, Moya A. 2007. The frontier between cell and organelle: genome analysis of Candidatus Ca rsonella ruddii. BMC Evolutionary Biology 7: 181. Thao ML, Moran NA, Abbot P, Brennan EB, Burckhardt DH, Baumann P. 2000. Cospeciation of psyllids and their primary prokaryotic endosymbionts. Applied Environmental Microbiology 66: 2898 2905. Tiwari S, Stel inski LL. 2013. Effects of cyantraniliprole, a novel anthranilic diamide insecticide, against Asian citrus psyllid under laboratory and field conditions. Pest Management Science 69: 1066 1072. Tsai JH, Liu YF. 2000. Biology of Diaphorina citri (Homoptera: Psyllidae) on four host plants. Journal of Economic Entomology 93: 1721 1725 Ware GW, Whitacre DM. 2004. The pesticide book, pp 70 71. Meister Media Worldwide Willoughby, OH, USA.

PAGE 74

74 Weeks AR, Reynolds KT, Hoffmann AA. 2001. Wolbachia dynamics and host effec ts: what has (and has not) been demonstrated? Trends in Ecology and Evolution 17: 257 262. Werren JH, Baldo L, Clark ME. 2008. Wolbachia : master manipulators of invertebrate biology. Nature Reviews Microbiology 6: 741 751. Wilkinson TL, Douglas AE. 1995. A phid feeding, as influenced by disruption of the symbiotic bacteria: an analysis of the pea aphid ( Acyrthosiphon pisum ). Journal of Insect Physiology 41: 635 640. Wong ACN, Wang QP, Morimoto J, Senior AM, Lihoreau M, Neely GG, Simpson SJ, Ponton F. 2017. G ut microbiota modifies olfactory guided microbial preferences and foraging decisions in Drosophila Current Biology 27: 2397 2404. Yang C, Powell CA, Duan Y, Shatters R, Zhang M. 2015. Antimicrobial nanoemulsion formulation with improved penetration of fol iar spray through citrus leaf cuticles to control citrus Huanglongbing. PLoS ONE 10: e0133826. Yocum RR, Rasmussen JR, Strominger JL. 1980. The mechanism of action of penicillin. Penicillin acylates the active site of Bacillus stearothermophilus D alanine carboxypeptidase. The Journal of Biological Chemistry 255: 3977 3986. Zabalou S, Riegler M, Theodorakopoulou M, Stauffer C, Savakis C, Bourtzis K. 2004. Wolbachia induced cytoplasmic incompatibility as a means for insect pest population control. Proceeding s of the National Academy of Science of the United States of America 101: 15042 15045. Zaka SM, Zeng, XN, Holford P, Beattie GAC. 2010. Repellent effect of guava leaf volatiles on settlement of adults of citrus psylla, Diaphorina citri Kuwayama, on citrus. Insect Science 17: 39 45. Zchori Fein E, Roush RT, Hunter MS. 1992. Male production induced by antibiotic treatment in Encarsia formosa (Hymenoptera: Aphelinidae), an asexual species. Experientia 48: 102 105. Zhang M, Powell CA, Zhou L, He, Z, Stover E, D uan Y. 2011. Chemical compounds Candidatus Liberibacter 1103. Zhang M, Powell CA, Guo Y, Benyon L, Duan Y. 2013a. Characterization of the microbial communi ty structure in Candidatus Liberibacter asiaticus infected citrus plants treated with antibiotics in the field. BMC Microbiology 13: 112. Zhang M, Powell CA, Benyon LS, Zhou H, Duan Y. 2013b. Deciphering the bacterial microbiome of citrus plants in respons Candidatus infection and antibiotic treatments. PLoS ONE 8: e76331.

PAGE 75

75 Zhang M, Guo Y, Powell CA, Doud MS, Yang C, Duan Y. 2014. Effective antibiotics Candidatus affected citrus plants iden tified via the graft based evaluation. PLoS ONE 9: e11 1032. Zug R, Hammerstein P. 2012. Still a host of hosts for Wolbachia : analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7: e38544. Zug R, Hammerstein P. 2015. Wolbachia and the insect immune system: what reactive oxygen species can tell us about the mechanisms of Wolbachia host interactions. Frontiers in Microbiology 6: 1201.

PAGE 76

76 BIOGRAPHICAL SKETCH Eliott Smith is from Chicago, Illinois, USA. He achieved a Ba chelor of Science with a major in c rop s cience from University of Illinois Urbana Champaign in May 2016. He joined Dr. Pelz He received his Masters of Sceince from the University of Florida in December 2018.