Citation
Use of Bovine Somatotropin to Hasten Puberty Achievement of Bos indicus-Influenced Beef Heifers

Material Information

Title:
Use of Bovine Somatotropin to Hasten Puberty Achievement of Bos indicus-Influenced Beef Heifers
Creator:
Piccolo, Matheus Betelli
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (75 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Sciences
Committee Chair:
MORIEL,PHILIPE
Committee Co-Chair:
ARTHINGTON,JOHN DAVID
Committee Members:
VENDRAMINI,JOAO MAURICIO BUENO

Subjects

Subjects / Keywords:
bovine -- somatotropin
Animal Sciences -- Dissertations, Academic -- UF
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Animal Sciences thesis, M.S.

Notes

Abstract:
A 3-yr study evaluated the effects of three pre-weaning 14-d apart injections of bovine somatotropin (bST) on growth and reproductive performance of beef heifers. On d 0 of each yr, Angus x Brangus heifers (n = 15 heifers/treatment/yr; BW = 147 +- 20 kg; Age = 134 +- 11 d) were stratified by BW and age, and randomly assigned to receive a subcuteaneous injection of saline (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28. Cow-calf pairs were managed as a single group on bahiagrass (Paspalum notatum) pastures from d 0 until weaning (d 127). From d 127 to 346, heifers were grouped by treatment, allocated to bahiagrass pastures (1 pasture/treatment/yr), and fed a molasses-based supplement (2.9 kg/heifer daily; DM basis) until d 346. Blood samples were collected on d 0, 14, 28, 42, and then every 9-10 d from d 179 to 346. In yr 3, liver biopsy samples were collected on d 0, 42, and 263. Heifers were exposed to Angus bulls from d 263 to 346. Heifers administered bST injections had greater pre-weaning overall plasma concentrations of IGF-1 and ADG from d 0 to 42 (P 0.25) compared to SAL heifers. Heifers from bST group tended to achieve puberty 26 d earlier (P = 0.10), had greater percentage of pubertal heifers on d 244, 263, 284, and 296 (P < 0.04), tended to have greater overall pregnancy percentages (P = 0.10), and had greater (P < 0.05) calving percentages in yr 1 and 2 (but not yr 3; P = 0.68) compared to SAL heifers. Liver mRNA expression of GHR-1B and IGF-1 were greater for BST vs. SAL heifers on d 263 (P < 0.02). Hence, three half-dose injections of bST administered to suckling beef heifers at 14-d intervals (between 135 and 163 d of age) induced long-term impacts on liver gene expression and may be a feasible management practice to enhance puberty attainment and pregnancy percentages of Bos indicus-influenced beef heifers. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2018.
Local:
Adviser: MORIEL,PHILIPE.
Local:
Co-adviser: ARTHINGTON,JOHN DAVID.
Statement of Responsibility:
by Matheus Betelli Piccolo.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
LD1780 2018 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

USE OF BOVINE SOMATOTROPIN TO HASTEN PUBERTY ACHIEVEMENT OF BOS INDICUS INFLUENCED BEEF HEIFERS By MATHEUS BETELLI PICCOLO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF TH E REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2018

PAGE 2

2018 Matheus Betelli Piccolo

PAGE 3

To my loving parents, Teresa e Jos Alberto

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank God, without him nothing of this would be possible and to my parents, Teresa Cristina Betelli Piccolo and Jos Alberto Piccolo; all my grandparents, which I am blessed to have pre sent in my life To my brothers, Thomas e Rafael Betelli Piccolo; for all the support, guidance and enc ouragement, and love given to me throughout my life. Each one of them has a special meaning to this accomplishment in my life, and all are majorly responsible for me being able to fulfill my education goals. My family and in speci al, my parents, provided all the opportunities for me t o become the person I am today. I would like to thank all my committee members, Dr. Philipe Moriel, Dr. John Arthington and Dr. Joo Vendramini for the patience, friendship and trust beyond measure tha t they putted on me. Dr. Philipe Moriel deserves especial thanks, for guiding me since 2015 and giving me so many opportunities and for pushing me to become a better student and person, despite of all the headache that I gave to him. His teachings went bey ond the academic and therefore I will always have a great respect for him. Appreciation is also extended to Dr. Reinaldo Cooke, who always made himself available to help me and in several occasions give me valuable advices and for that I am extremely than kful I would like to thank Dr. Corwin Nelson for the help during the laboratory analysis of my experiment, and Dr. Geoffrey Dahl for the help and patience with me when I needed. I would like to thank my former advis o r Dr. Jos Luiz Moraes Vasconcelos for introducing me to science for the career opportunities he provided, for his many teachings and even for his annoying way of doing thing s but in special for his support Along with Dr. Vasconcelos, I am extremely thankful for having made part of the study group that he advises;

PAGE 5

5 Conapec was the best part of my undergraduate carrier in terms of developing skills, acquiring experience in the field and making many friends and important contacts in the agribusiness. I am also deeply grateful to all the staff at the Range Cattle Research and Education Center. In particular, Mrs. Julie Warren, for her help on field and on the lab and also for being a friend; Mrs. Andrea Dunlap for always being helpful and available when I needed the most; Mr. Austin Bateman, Mr. Cl ay Newman, Mr. Tom Fussell, and Mr. Ryann Nevling for all their help when working with cattle and friendship. Special thanks for my friends Achilles Vieira Neto, Umberto Pardelli and Miguel Miranda for being always present when needed, and always pushing me to get my head up. support during the last 8 years of my life, nothing would be the same without them. I would like to thank Juliana Ranches for all her help, teachin g me lab procedures or helping me in the field and support as a friend, becoming her friend was a great surprise that living in Ona provided to me. Also, I would like to thank all the friends that I made in Ona, Joo Sanchez, Jos Dias, Pedro Mamede, Hiran Marcelo, Gleise Silva, Marcelo Vedovatto, Aline Moraes, Kely Koriaken, JK, C aio, YanYan, Amanda, Nayara, Jhone, Rhaiza, and others for all the help and friendship during my period here. Last but not least, to my friends in Gainesville, Luara, Felipe, Hend yel, Paula, Roney, Andr, Amanda, Fernanda, Jason, Camilo and everybody else that as them made Gainesville a little happier even if just for a moment.

PAGE 6

6 TABLE OF CONTENTS p age ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 8 LIST OF FIGURES ................................ ................................ ................................ ......................... 9 LIST OF ABBREVIATIONS ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................................ ... 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .................. 14 2 LITERATURE REVIEW ................................ ................................ ................................ ....... 16 Metabolic Imprinting ................................ ................................ ................................ .............. 16 Potential Mechanisms ................................ ................................ ................................ ............. 16 Organ structure ................................ ................................ ................................ ................ 16 Cell number ................................ ................................ ................................ ..................... 17 Clonal selection ................................ ................................ ................................ ............... 17 Epigenetics ................................ ................................ ................................ ...................... 18 Evidences of Metabolic Imprinting in Beef Heifers ................................ ............................... 18 Somatotropic Axis ................................ ................................ ................................ .................. 19 Nutrition vs. Somatotropic Axis vs. Puberty Achievement ................................ .................... 24 Exogenous Bovin e Somatotropin Structure, Synthesis and Secretion ................................ 26 Strategies to Explore the Effects of Metabolic Imprinting in Beef Cattle Production Systems ................................ ................................ ................................ ............................... 31 3 PRE WEANING INJECTIONS OF BOVINE ST ENHANCED REPRODUCTIVE PERFORMANCE OF BOS INDICUS INFLUENCED REPLACEMENT BEEF HEIFERS. ................................ ................................ ................................ ............................... 32 Introduction ................................ ................................ ................................ ............................. 32 Material and Methods ................................ ................................ ................................ ............. 3 3 Animals and Diets ................................ ................................ ................................ ........... 33 Sample and data collection ................................ ................................ .............................. 35 Laboratory analyses ................................ ................................ ................................ ......... 37 Statistical analyses ................................ ................................ ................................ ........... 39 Results ................................ ................................ ................................ ................................ ..... 40 Discussion ................................ ................................ ................................ ............................... 42 Conclusion ................................ ................................ ................................ .............................. 48 LIST OF REFERENCES ................................ ................................ ................................ ............... 60

PAGE 7

7 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ......... 75

PAGE 8

8 LIST OF TABLES Table page 3 1 Average nutritional composition of concentrate offered during the post weaning phase (d 127 to 346) to beef heifers ................................ ................................ ................... 50 3 2 Primer sequences and accession number for all gene transcripts analyzed by quantitative real time PCR 1 ................................ ................................ .............................. 51 3 3 Pre and post weaning growth performance of beef heifers ................................ .............. 52 3 4 Pre and post weaning plasma IGF 1 concentrations of beef heifers ................................ 53 3 5 Liver mRNA expression (fold increase1; yr 3 only) of beef heifers ................................ 54 3 6 Reproductive performance of beef heifers ................................ ................................ ......... 55

PAGE 9

9 LIST OF FIGURES Figure page 3 1 Pre (A) and post weaning (B) body weight of beef heifers that received a s.c. injection of saline solution (SAL; 5 mL; 0.9% NaCl) o r 250 mg of sometribove zinc (BST; Posilac, Elanco) on d 0, 14, and 28 (n = 15 heifers/treatment annually; 3 yr).. ...... 56 3 2 Percentage of pubertal beef heifers during the post weaning phase ................................ 58 3 3 Calving distribution (% of heifers that calved) of beef heifers ................................ .......... 59

PAGE 10

10 LIST OF ABBREVIATIONS ADG Average daily gain AI Artificial insemination AKT Protein kina se B or PKB bST Bovine somatotropin BW Body weight CP Crude protein CV Coefficient of variance DM Dry matter DNA D eoxyribonucleic acid EW Early weaned FSH Follicle stimulating hormone GH Growth hormone GHR Growth hormone receptor GHRH Growth hor mone releasing hormone IFAS Institute of Food and Agriculture Sciences IGF 1 Insulin like growth factor 1 IGF1R Insulin like growth factor 1 receptor IGFBP Insulin like growth factor binding protein IVDOM In vitro digestible organic matter JAK Janus kinase mRNA Messenger Ribonucleic acid N Nitrogen NaCl Sodium chloride NDF Neutral detergent fiber

PAGE 11

11 NEFA Nonesterified fatty acids NEg Net energy for growth NEm Net energy for maintenance NW Normally weaned P4 Progesterone PI3K P hosphatidylinosito l 3 kinase RNA Ribonucleic acid SAL Saline ST Somatotropin STAT Signal t ransducer and activator of t ranscription TDN Total digestible nutrients

PAGE 12

12 Abstract of Thesis Presented to the Graduate School of the University of Florida in Part ial Fulfillment of the Requirements for the Degree of Master of Science USE OF BOVINE SOMATOTROPIN TO HASTEN PUBERTY ACHIEVEMENT OF BOS INDICUS INFLUENCED BEEF HEIFERS By Matheus Betelli Piccolo August 2018 Chair: Philipe Moriel Major: Animal Scienc es A 3 yr study evaluated the effects of three pre weaning 14 d apart injections of bovine so matotropin (bST) on growth and reproductive performance of beef heifers On d 0 of each yr, Angus Brangus heifers (n = 15 heifers/treatment/yr; BW = 147 20 kg ; A ge = 134 11 d) were stratified by BW and age, and randomly assigned to receive a s ubcuteaneous injection of saline (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28. Cow calf pairs were mana ged as a single group on bahiagrass ( Paspalum notatum ) pastures from d 0 until weaning (d 127). From d 127 to 346, heifers were grouped by treatment allocated to bahiagrass pastures (1 pasture/treatment/yr) and fed a molasses based supplement (2.9 kg/hei fer daily; DM basis) until d 346. Blood samples were collected on d 0, 14, 28, 42, and then every 9 10 d from d 179 to 346. In yr 3, l iver biopsy samples were collected on d 0, 42, and 263 Heifers were exposed to Angus bulls from d 263 to 346. Heifers adm inistered b ST injections had greater pre weaning overall plasma concentrations of IGF 1 and ADG from d 0 to 42 ( P but similar BW at weaning and post weaning ADG ( P from b ST group tended to achieve puberty 26 d earlier ( P = 0.10), had greater percentage of pubertal heifers on d 244, 263, 284, and 296 ( P

PAGE 13

13 0.04), tended to have greater overall pregnancy percentage s ( P = 0.10) and had greater ( P 0.05) calving percentage s in yr 1 and 2 (but not yr 3; P = 0.68) compared to SAL heifers. Liver mRNA expression of GHR 1B and IGF 1 were greater for BST vs. SAL heifers on d 26 3 ( P 0.0 2 ) Hence, three half dose injections of b ST administered to suckling beef heifers at 14 d intervals (between 135 and 163 d of age) induced long term impacts on liver gene expression and may be a feasible management practice to enhance puberty at tainment and pregnancy percentages of Bos indicus influenced beef heifers

PAGE 14

14 CHAPTER 1 INTRODUCTION Improving the reproductive performance of replacement beef heifers is one of the major factor s affecting overall efficiency and productivity of cow calf ope ration s (Bagley, 1993). A major determinant of lifetime productivity of beef heifers is the age at puberty attainment and conception relative to the initiation of their first breeding season (Day and Nogueira, 2013) Additionally, overall cattle herd productivity is positively cor related with percentage of heifers becoming pregnant early in their first breeding season (Lesmeister et al., 1973) which also leads to improve d reproductive performance over the next 6 parturitions (Cushman et al., 2013) Due to their tolerance to elevated environmental heat and humidity conditions, Bos indicus influenced cattle are common across southeastern United States (Turner, 1980) G rowing Bos indicus cattle require approximately 10% less net energy for maintenance compared to Bos taurus breeds (NRC, 1996). However, heifers with B indicus influence typically attain puberty at older ages, which reduces their reprod uctive performance compared to B. taurus heifers (Short et al ., 1994). An extensive literature is available regarding post weaning development of beef heifers (Wiltbank et al., 1969; Short and Bellows, 1971; Ferrell, 1982; Warnick et al., 1991; Cooke et al., 2008; Moriel et al., 2017). Nonetheless pre we aning strategies may hav e a greater impact on puberty attainment of beef heifers compared to post weaning management practices (Roberts et al., 2007). This greater impact of pre weaning strategies may be attributed to metabolic imprinting effects which is the concept that physiological outcomes to nutritional /stress challenges occurring during a critical window of early life can persist for long periods, even after the removal of such challenges (Lucas, 1991). For instance, b eef heifers early w eaned (EW) a t 70 d of age and limit fed a high co ncentrate diet for 90 d after w eaning had similar body weight ( BW ) and average daily gain ( ADG ) during the breeding season, but

PAGE 15

15 hastened puberty attainment compared t o heifers that were weaned at 270 d of age and pro vid ed similar post w eaning management (Moriel et al., 2014) In addition, c irculating insulin like growth factor 1 ( IGF 1) impacts gonadotropin activity required for the first ovulation in beef heifers by influencing hypothalamic pituitary secretory activity (Schillo et al., 1992) and augmenting the effects of gonadotropins in ovarian follicular cells (Spicer and Echternkamp, 1995). In agreement, heifer ADG and plasma IGF 1 concentrations from 70 to 160 d of age explained approximately 34% of the variability i n age at puberty (Moriel et al., 2014). Thus, metabolic imprinting may be explored to optimize reproductive performance of beef heifers. Post weaning injections of exogenous bovine somatotropin ( b ST ) increased plasma concentrations of IGF 1 and hastened p uberty attainment in B taurus heifers (Cooke et al., 2013). P otential impacts of pre weaning injections of bST on puberty attainment of beef heifers, particularly B. indicus influenced heifers remains unknown It was hypothesized that pre weaning injectio ns of bST would enhance growth and percentage of pubertal and pregnant beef heifers compared to saline injections. Hence, a 3 yr study evaluated the effects of pre weaning injections of bST on blood parameters and liver gene expression measurements associa ted with somatotropic axis, growth, and reproduction of B indicus influenced beef heifers.

PAGE 16

16 CHAPTER 2 LITERATURE REVIEW Metabolic Imprinting during critical prenatal development stages, may have lasting impacts on growth and adult function ( Caton and Hess, 2010). However, in most mammalian species, organ development is no t complete at birth and continues during the immediate postnatal period. For example maturation of pancreatic islets and development of neuronal systems in the hypothalamus of rats continue during the suckling period (Kaung, 1994). Early in postnatal life organisms have the ability to respond to environmental conditions that are unknown to normal development, through adaptations at the cellular, molecular and biochemical levels (Patel and Srinivasan, 2002). Consequently as created to incorporate the adaptive body responses to specific nutritional conditions occurring during a limited stage of susceptibility in early postnatal life. These responses may permanently affect the physiology and metabolism of the organism (Lucas 1991; Waterland and Garza, 1999; Patel and Srinivasan, 2011) Potential Mechanisms P structure or function includes : induced vari ations in organ structure, alterations in cell number, clonal selection, and epigenetics (Waterland and Garza, 1999). Organ S tructure Morphologic modifications occurring during organogenesis may affect the ability of each cell to generate and respond to external signals within the organism. For example, nutrition induced alterations on organ vascularization may affect the cellular responses to nutrients or

PAGE 17

17 hormonal signals. During limited periods of organogenesis, the fate of cells depends on externally derived signals from adjacent and distant cells. Therefore, it is plausible that local concentrations of nutrients and metabolites may modulate the end result of organogenesis (Waterland and Garza, 1999). Cell N umber During development, organ mass increases either by increasing the number of cells (hyperplasia) or cell size (hypertrophy). However, different tissues experience distinct and limited periods of hyperplastic and hypertrophic growth. Cell growth rate is nutrient dependent, and hence, nutritional deprivation or surplus, during critical pe riods of cell division, may lead to permanent changes in cell number, regardless of subsequent nutrient surplus (Waterland and Garza, 1999). For instance, offspring born from ewes fed 50% of their total digestible nutrients (TDN) requirements from d 28 to 78 of gestation had lesser secondary muscle fibers compared to offspring born from nutrient unrestricted ewes (Zhu et al., 2004). The number of muscle fibers is determined during the prenatal muscle development, and does not increase during the postnatal l ife. Thus, prenatal nutrition has profound effects on muscle growth and development during the later postnatal life (Zhu et al., 2004). C lonal S election Cellular proliferation of all organs involves the proliferation of a finite population of founder cells As cell proliferation proceeds, early genetic and epigenetic modifications that occur within individual cells distinguish them from others in subpopulations of rapidly dividing cells. Thus, the nutrient environment may induce an incorrect base pairing du ring deoxyribonucleic acid (DNA) replication, and result in subtle effects on cellular metabolism that may be transmitted to daughter cells (Waterland and Garza, 1999; Fenech, 2010). Vitamins and minerals serve as cofactors for enzymes and protein structur es involved in DNA synthesis, repair

PAGE 18

18 and maintenance of genome integrity (Neibergs and Johnson, 2012). Hence, suboptimal intake of vitamins and minerals may permanently damage the DNA and alter the genomic stability (Fenech, 2010). Epigenetics The epigenet ic process is a genetic modification not explained by changes in DNA sequence (Riggs et al., 1996) occur ing during periods of genome reprogramming, such as embryogenesis and gestation (Jirtle and Skinner, 2007). Methylation of DNA and histone modifications are the major mechanisms of epigenetics (Thiagalingam et al., 2003). Methylation of DNA molecules is highly correlated with gene expression and consists of DNA methyltransferases adding methyl groups at cytosine purine guanine (CpG) islands that are often associated with the promoter region of genes (Simmons, 2011). Hypomethylation at the promoter regions of DNA enhances messenger RNA (mRNA) transcription, whereas hypermethylation is associated with suppressed mRNA transcription (Simmons, 2011). The methyl ation pattern varies among cells in different tissues (i.e. oocytes and sperm DNA are less methylated compared to cells in somatic tissues, such as muscle), and is maintained during DNA replication, which allows the specific methylation pattern to be trans mitted to progeny cells (Waterland and Garza, 1999). In mice, dietary restriction of methyl donor molecules, such as folic acid, methionine, vitamin B 12 and choline were associated with DNA hypomethylation, whereas post weaning supplementation of such met hyl donors increased methylation of a wide variety of genes (Neibergs and Johnson, 2012; Bermingham et al., 2013). Evidences of Metabolic Imprinting in Beef Heifers Gasser et al. ( 2006 ) demonstrated that beef heifers EW at 3 mo of age and fed to achieve greater ADG (1.27 vs. 0.85 kg/d) until 9 mo of age attained puberty 100 d sooner than heifers no rmally weaned ( NW ) at 9 m o of age Later, Gasser et al. ( 2006 ) reported that the hastened

PAGE 19

19 puberty achievement in EW heifers fed high concentrate diet was attributed to t he high energy consumption, and not due to a direct effect of EW, because NW heifers and a second group of EW heifers fed to achieve growth rates similar to NW heifers achieved puberty at the same age ( 308 26 and 330 25 d of age ). Such early activation s of puberty attainment cannot be attributed solely to greater ADG and BW of EW vs. NW heifer s but rather to metabolic imprinting induced effects. For instance, Moriel et al. (2014) observed that b eef heifers EW at 70 d of age and limit fed a high co ncent rate diet for 90 d after w eaning had similar BW and A DG during breeding season, but hastened puberty attainment compared to heifers that were weaned at 270 d of age and pro vided similar post w eaning management (Moriel et al., 2014). Therefore those result s demonstrate the existence of a critical moment (3 to 6 mo of age) for nutritional stimuli to induce early activation of the reproductive axis, decrease age at puberty achievement, and increase reproductive success of beef heifers (Gasser et al., 2006a) In addition, altering the circulating concentrations of components of the somatotropic axis through enhanced plane of nutrition seems to be involved in this early activation of puberty (Moriel et al., 2014). Somatotropic Axis The somatotropin axis is an es sential constituent of multiple systems controlling growth (Leroith et al., 2001) and reproduction (Hess et al., 2005) ; connecting nutrition to liver function, gene expression and secretion of gonadotropins in the brain and a wide variety of tissue metabolism (Thakur et al., 1993; Jiang et al., 2007; Rhoads et al., 2007; Wathes et al., 2007; Allen et al., 2012) A considerable part of metabolism development and somatotropic axis regulation directly derives from liver function. The l iver occupies a unique an vital role in nutritional physiology by being distinc tively positioned to respond to nutrients absorbed acros s the gastrointestinal tract and rumen and to modulate the profile of nutrients available to the rest of the body (Donkin, 2012) The liver also performs essential functions i n the body through the

PAGE 20

20 expression of genes encoding plasma proteins, clotting factors glucose and lipids metabolism secretion of IGF 1 and others (Jun germann and Katz, 1989) Furthermore, liver gene expression is influenced by transcription factors related to environment and autocrine or paracrine signal responses (Costa et al., 2003) and may have age related variations on expression due to epigenetic control, altered sensibility and health status (Slagboom and Vijg, 1989) T he somatotropic axis consists primarily of growth hormone (GH), GH receptor (GHR 1A, 1B, 1C), IGF 1 IGF binding proteins (IGFBP 1, 2, 3, 4, 5, and 6 ), and IGF receptors (IGF 1R), which are essential for growth and ma mmary development, and involved in mediating tissue r esponses to energy intake (Leroith et al., 2001; Radcliff et al., 2004) At th e hypothalamic level, the somatotropic axis comprises of two sets of neurons that synthesize and release growth hormone releasing hormone (GHRH) or somatostatin, the excitatory and inhibitory regulators of GH release from the pituitary respectively (Daftary and Gore, 2005) Growth hormone stimulates hepatic synthesis of IGF 1, and is stimulated by ghrelin and inhibited by IGF 1 via a negative feedback loop (Kojima et al., 1 999) In addition, GH antagonize s insulin action s leading to nutrient partitioning effect s (Lucy, 2008) decreased lipogenesis and enhanced lipolysis in adipose tissue, and increased muscle protein accretion in growing animals and milk protein synthesis in lactating cows (Etherton and Bauman, 1998) Physiological actions of GH are initiated by the binding to GHR, activating the JAK STAT transduction pathway. Activated GHR associates with Janus kinase 2, which when activated, phosphorylates STATs on tyrosines that bind to specific DNA sequences and activate gene transcription (Leroith et al., 2001; Carter Su et al., 2016) There are three different GHR promoters in cattle; each one transcribes different exon 1 sequences ( GHR 1A, 1B, and 1C ; Kim, 2014) Although the mRNA is different in exon 1, the receptor protein is the same, beca use

PAGE 21

21 the GHR protein is encoded in exons 2 through 10 of the mRNA (Edens and Talamantes, 1998) Additionally, each GHR is expressed differently, as to location and concentration in the body; GHR 1A mRNA is solely present in the liver, where it represents the bulk of liver GHR mRNA, whereas GHR 1B and 1C mRNA are expressed in a wide variety of tissues, including muscle and adipose tissue (Lucy et al., 2001) Furthermore, age related differences also affect expression of the exon 1 sequences (Lucy et al., 1998) whereas the binding of GH to GHR 1A increase d with calf age, leading to enhanced synthesis of IGF 1 and declining serum concentr ations of GH as calv es develop ed (Badinga et al., 1991) Transcripts belonging to the GHR 1A are expressed exclusively on liver tissue, where it accounts for approximately 50% hepatic GHR transcripts, whereas GHR 1B and 1C account for approximately 35 and 15%, respectively (Kim, 2014) However, GHR 1B and 1C transcripts are expressed to a higher degree on overall body tissues, accounting for approximately 70 and 30% of total GHR transcripts, respectively (Jiang and Lucy, 2001; Kim, 2014) Growth hormone dissociates slowly from hepatic membrane, which may account for some long term actions of GH (Badinga et al., 1991) Bovine IGF 1 is a single chain, polypeptide hormone with a molecular weight of approximately 7.6 kDa and involved in carbohydrate, protein and fat metabolism, and cell proliferation and differentia tion (Leroith et al., 2001; Daftary and Gore, 2005) The IGF 1 receptor is widely expressed in the body tissues, including muscle, adipose tissue, hypothalamus, pituitary, gonads and reproductive tract (Lui, 2017) The binding of IGF 1 to IGF1R and one of the six IGF binding proteins modulate the activity of IGF 1 within target tissues (Leroith et al., 2001; Daftary and Gore, 2005; Hess et al., 2005) Over 90% of IGF 1 in blood is bound to one type of IGFBP (Hess et al., 2005) Potentiation of IGF 1 actions involves interaction of individual binding proteins (i.e., IGFBP 1, 3, and 5) with the cell surface, thereby increasing

PAGE 22

22 the bioavailability of IGF 1 in the microen vironment surrounding cells and enhancing ligand receptor association (Roberts et al., 2001) The IGFBP bind s to IGF 1 with high affinity, transport ing IGF 1 among body tissues, regulating their metabolic clearance, enhancing or blocking its binding to IGF1R and providing cell type specific targeting (Le Roith et al., 2001), thereby indirectly participating in control of IGF 1 bioavailability and bior eactivity (Silva et al., 2009). Additionally, IGFBPs have a conserved structure which can be divided in three do mains of similar size: cysteine rich amino and carboxy terminal domains, joined by an unconserved central, linker domain (Baxter, 2013) Several factors are known to affect IGF 1 production such as age (Badinga et al., 1991), gender, nut rition and physiologic state (Lucy, 2008) Anabolic effects of systemic IGF 1 are related to relative abundance of IGFBP 3 (Armstrong and Benoit, 1996) whereas IGFBP 2 is associated with poor nutritional status (Armstrong and Benoit, 1996) In agreement, Roberts et al. (1997) reported that serum concentrations of IGFBP 2 of beef cows at 2 wk postpartum diminished, whereas serum concentrations of IGFBP 3 increased in cows that resumed estrus by 20 wk postpartum compared to anestrous cows. However, age and nutrition had little or no effect on GHR 1B mRNA expression in the semitendinosus muscle a nd subcutaneous adipose tissue (Lucy et al., 2001). In contrast, GHR 1A mRNA expression increased with age (Lucy et al., 2001) and growth rate of calves (Radcliff et al., 2004). This is attributed to GHR 1B having characteristics of housekeeping gene promo ters, while GHR 1A is different from 1B or 1C because it is liver specific and controlled by a variety of developmental and metabolic signals (Kobayashi et al., 1999) High feeding levels (Radcliff et al., 2004) has been shown to affect multiple components o f the somatotropic axis of cattle (Thissen et al., 1994) Growth hormone binding to hepatic

PAGE 23

23 membrane is highly correlat ed with GHR 1A mRNA expression (Radcliff et al., 2003), which is also highly correlated with hepatic expression of IGF 1 mRNA (Lucy et al., 2001). Thus, an increased hepatic expression of GHR 1A consequently enhances IGF 1 synthesis (Radcliff et al., 2004) Conversely, Smith et al. (2002) reported that newborn calves with increased nutrient intake had greater plasma concentrations of insulin and IGF 1, but had no effect s on semitendinosus muscle expression of GHR and IGF 1 mRNA. Furthermore, heifers fed to achieve greater ADG had less serum concentrations of IGFBP 2 and greater serum concentrations of IGF 1 as animals approached puberty, which were correlated with increased liver mRNA expression of GHR 1A and IGF 1 shortly after first estrus (Radcliff et al., 2004) Weller et al. (2016) fed prepubertal heifers at 100 d of age to achieve high, low or maintenance gains during an 84 d feeding period. Heifers from high and low gain groups achieve d similar body fat mass, but both had gre ater body fat mass compared to the maintenance group. These a uthors observed that high gain heifers had greater plasma IGF 1 concentrations and liver mRNA abundance of GHR, IGF 1, and IGFBP 3 compared to maintenance and low gain heifers. In contrast, IGFBP 2 liver mRNA abundance was lower in high gain heifers than in maintenance heifers (Weller e t al., 2016) Allen et al., (2012) evaluated the metabolic regulation of neuroendocrine function of major metabolic sensing neurons located in the arcuate nucleus of the hypothalamus, by enhancing feed intake and ADG from 3 to 6 m o of age. Authors reporte d greater ADG, serum concentrations of insulin and IGF 1 and liver weights in heifers fed to achieve higher ADG, and these findings were correlated with 346 differently expressed genes. Furthermore, enhanced nutrition decrease d mRNA expression of GHR and n europeptide Y in the arcuate nucleus which were suggested to participate in the metabolic status permitting reproductive maturation (Allen et al., 2012)

PAGE 24

24 Nutrition vs. Somatotropic A x is vs. Puberty Achievement Day and Anderson (1998) proposed that the period from birth to puberty in beef heifers could be divided into infantile (birth to 2 mo of age), developmental (2 to 6 mo of age), static (6 to 10 mo of age) and peripubertal period s (10 to 12 mo of age). D uring the infantile period, pulsatile secretion and ovarian inhibition of LH secretion increas e at approximately 6 w k of age and is fully e stablished by 8 w k of age After this stage heifers enter the developmental period whe n th ere is a greater GnRH secretion by the hypothalamus which stimulates follicular growth and estradiol concentrations, and hence, the number of follicles peaks at approximately 14 wk of age (Dodson et al., 1988; Evans et al., 1994; Rawlings et al., 2003) However, LH secretion effects are inhibited due to a strong negative feedback caused by enhanced estradiol concentrations stimulated by the higher GnRH production, leading to a decrease in follicle numbers, which will remain at low levels throughout the static phase (Schillo et al., 1982; Day et al., 1987; Day and Anderson, 1998) In summary, each period has specific and important steps that contribute to the successful reproductive development of beef heifers (Gasser, 2013) Nonetheless as discussed below, later evidences demonstrated that the developmental phase may have the greatest impact on puberty attainment of beef heifers. A ccelerated growth rate during the pre weaning phase ha s been shown to decrease age at puberty attainment of beef heifers (Gasser et al., 2006a; Gasser et al., 2006b; Gasser et al., 2006c; Gasser et al., 2006d; Moriel et al., 2014) In an sequence of experiments, Gasser et al., ( 2006a,b,c, d) reported greater frequency of LH pulses (Gasser et al., 2006c), mean LH c oncentrations (Gasser et al., 2006b), follicular growth wave, and accelerated decrease in the negative feedback of estradiol on LH secretion (Gasser et al., 2006b,d) for EW heifers experiencing greater ADG compared to NW heifers.

PAGE 25

25 N utrition induced metabol ic signals leading to early activation of the reproductive axis in heifers are not fully understand yet. However, heifers approaching puberty experience an increase in serum concentrations of IGF 1 and LH (Yelich et al., 1996). Cooke et al. (2013) conclude d that heifers with elevated circulating IGF 1 concentrations experience d hastened puberty establishment independently of growth rate, nutritional plane, body fat content, and circulating leptin concentrations. T herefore adequate circulating concentration s of nutrition related hormones, such as IGF 1 may be needed to achieve ovulation (Velazquez et al., 2008) D uring periods of positive nutritiona l status, animals experience greater circulating concentrations of IGF 1 and GH, enhanced liver mRNA expression of IGF 1 and GHR 1A and consequentl y, higher binding capacity of IGF 1 and GH to its receptors (Breier, 1999) leading to positive influence on hypothalamic control of LH secret ion and reproductive development of prepubertal heifers (Schillo et al., 1992). Loca l and systemic GH and IGF 1 exert stimulatory or permissive roles at each level of the hypothalamic pituitary gonadal axis and follicular development and maturation (Schams et al., 1999; Silva et al., 2009) For instance, circulating IGF 1 participates on gonadotropin secretion and activity requir ed for the first ovulation and puberty establishment in heifers by influencing hypothalamic pituitary secretory activity ( Schillo et al., 1992) while amplifying gonadotropins effects in follicular cells (Spicer and Echternkamp, 19 95). Addit ionally, l oc al and systemic IGF 1 stimulate cell proliferation, mitogenesis and steroidogenesis of granulosa cell s (Mani et al., 2010) stimulati ng FSH action and promoting follicular growth, differentiation and maturation (Mazerbourg et al., 2003 ; Silva et al., 2009 ) Furthermore in vivo dose response studies demonstrated that bovine recombinant GH acted through increased peripheral concentrations of insulin and IGF 1 to posit ively affect follicle development in heifers (Gong et

PAGE 26

26 al., 1997; Silva et al., 2009) I nsulin play a more important role as estradiol stimulator than IGF 1, however, IGF 1 and 2 can inhibit insulin stimulated estradiol secretion by granulos a cells of follicles through comp eti tion for binding sites (Spicer and Echternkamp, 1995) Insulin like growth fator 1 receptor, IGF 1 and IGFBPs mRNA are present in the brain, pituitary, gonads and reproductive tract (Daftary and Gore, 2005) Daftary and Gore (2003) also observed that in vitro IGF 1 treatment o f explanted preoptic area anterior hypothalamuses of peripubertal mice indicated that IGF 1 had stimulatory effects on GnRH gene expression. Addition ally, the pattern of hypothalamic IGF 1 mRNA expression changes with time increasing during neonatal phase decreasing during prepubertal hiatus and then increasing as it approaches pubertal maturity (Daftary and Gore, 2003) Hence, management and nutr itional strategies that enhance circulating IGF 1 concentrations are expected to hasten puberty achievement of beef heifers. One strategy capable of increasing plasma IGF 1 concentrations is the use of injections of bovine somatotropin (Buskirk et al., 199 6). Exogenous Bovine Somatotropin Structure, Synthesis and Secretion Exogenous b ovine ST (bST) is available as a recombinant protein in a sustained release formulation (Posilac, Monsanto) Commercial use of bST to increase milk production in lactating da iry cows was approved by t he U.S. Food and Drug Administration (FDA) in 1993. Since then multiple dairy herds in US have used bST, bringing productive and ec onomic benefits to producers (Raymond et al., 2009) G reat research efforts has been targeted to its use (Etherton and Bauman, 1998; Tarazon Herrera et al., 2000; Santos et al., 2004; Carriquiry et al., 2008; Carstens et al., 2010) r anging from enhancement of milk yield (Binelli et al., 1995; Bauman, 1999; Tarazon Herrera et al., 2000) growth (Bass et al., 1992; Moallem et al., 2004) reproduction performance (Santos et al., 2004; Cooke et al., 2013) and prod uction of leaner

PAGE 27

27 carcasses (Nanke et al., 1993; Binelli et a l., 1995; Schlegel et al., 2006) to increase in the productive efficiency while diminishing negative environmental impacts (Capper et al., 2008) Bovine s omatotropin s are known to affect nutrient partitioning between muscle and adipose tissue lead ing to alterations in growth (Bauman and Vernon, 1993; Bilby, 2005) Injections of bST s timulate the production of IGF 1 in the same manner as endogenous GH, with circulating concent rations of IGF 1 increas ing shortly after bST treatment (Gong et al., 1993; Bilby et a l., 1999; Cooke et al., 2013) Furthermore, bST applications decrease plasma leptin and lipid synthesis (Bauman et al., 1994; Etherton and Bauman, 1998) As a result, th ese coordinated changes in physiological pathways alter the partitioning of absorbed nutrients involv ing a variety of tissues, and affect ing the met abolism of all nutrient classes ( carbohydrate, lipid, protein, and minerals ), modulating plasma concentrations of other metabolites and hormones such as NEFA, glucose and insulin (Hess et al., 2005) I n lactating dairy cows, bST affects milk production by partitioning nutrients towards milk synthesis (Etherton and Bauman, 1998) Adiposity is negatively correlated with GH concentrations (Gluckman et al., 1987) In adipose tissue, ST treatment decreases glucose uptake and stimulates insulin uptake of glucose by adipocytes (Etherton and Louveau, 1992) For instance, g lucose ut ilization by adipose ti ssue of ST treated pigs is reduced in approximately 30% of whole body glucose turnover (Dunshea et al., 1992) thereby decreasing li pid synthesis while possibly increasing lipolysis in adipose tissue (van der Walt, 1994) These responses when combined enabl e nutrient partitioning to other tissues C ows treated with bST had increase d hepatic gluconeogenesis and reduce d whole body glucose oxidation ; therefore enhancing gluco se hepatic output and glucose availability for other tissues such as the mammary parenchyma. Additionally, ST also reduces he patic response to

PAGE 28

28 insulin allowing the liver to sustain increased rate s of gluconeogenesis that are critical to support the increa se in milk synthesis (Bauma n et al., 1994) R esponses of the somatotropic axis to ST treatment are dependable of somatotropic axis maturation and ability to respond to available somatotropin. Animals are born with functional somatotropic axis (Dunshea et al., 1992) and exogenous ST trigger s body responses as early as 1 d of ag e in beef cattle (Govoni et al., 2004) However, maturation is of great importance in the ontogeny of growth regulation, and therefore ST might have diminished effects during early stage s of life (Campbell et al., 1991) Badinga et al., (1991) reported that ST receptors in bovine hepatocytes increase with a ge peaking with 6 mo of age and declining thereafter. I n rats, ST receptor mRNA in the brain decrease with age and increases with age in peripheral tissues (van der Walt, 1994 ; Lobie et al., 1993 ) I n humans, serum concentrations of IGF 1 and IGFBP 3 increase with age and pubertal stage (Juul et al. 1994 ; Jull et al. 1995 ). In agreement, Velayudhan et al. ( 2007) observed delayed responses on serum IGFBP 3 concentrations coupled with relatively slower growth rate s to exogenous bST treatment in animals starting bST treatment with 200 d of age compared to 250 and 300 d Furth ermore, heifers under positive energy balance experienced enhanced serum IGF 1 concentrations after bST treatment compared to heifers under negative energy balance, s uggesting a possible uncoupling of the somatotropic axis during negative energy balance (Yung et al., 1996) Due to its lipolytic effects, bST has be en used for the production of leaner carcasses. Holstein steers administered bST injections experienced greater G:F and ADG compared to non treated control steers independently if treatments were administered during the growing or finishing phase s A dditi onally animals that received bST injections during growing and finishing phase s had reduced carcass quality grade and lipid accretion but increased lean muscle

PAGE 29

29 accretion (Schlegel et al., 2006) Moreover, animals treated with bST throughout the study had s pleen and kidney weights 7.5 and 23% greater than non treated cohorts respectively (Schlegel et al., 2006) B eef catt le treated daily with 33 g of bST/kg of BW from 200, 250 or 300 d of age until 400 d of age experienced greater ADG, G:F and longissimus muscle area compared to untreated cattle H owever, growth responses and serum concentrations of IGF 1 and IGFBP 3 wer e more pronounced when treatment started at older ages (Velayudhan et al., 2007) Likewise, serum concentrations of IGFBP 3 increased only after 100 d of bST treatment (starting at 200 d of age ) indicating that the response s in serum concentrations of IGFB P 3 to exogenous bST w ere delayed in younger animals (Velayudhan et al., 2007) Zulu et al. (2002) suggested that steroidogenesis effects of IGF 1 on follicular cells occur through stimula tion of FSH, LH and LH receptor s Gong et al. ( 1993) reported increased number of small follicles and grea ter peripheral insulin concentrations in Hereford x Friesian heifers receiving 25 mg of bST daily c ompared to non treated heifers. In agreement bST administration at the beginning of timed AI protocol s or at the time of AI improve d pregnancy rates and sti mulate d embryo development in lactating dairy cows (Moreira et al., 2001; Moreira et al., 2002 ) Santos et al. (2004) reported a decrease d embryo mortality for bST vs. non treated dairy cows (6.7 vs. 14.0% ). To gether, these results indicate t hat bST treatment may increase fertil ity through effects on oocyte maturation embryonic development, and altered oviduct/uterine functions (Moreira et al., 2001) Conversely, Oosthuizen et al. ( 2017) reported negative effects of bST application at the b eginning of timed AI protocol on reproductive performance of beef heifers. A pplication of 650 mg of bST at the start of a timed AI protocol decrease d the percentage of heifers pregnat to AI ( 42.5 vs. 29.9 % for control vs. bST respectively ) but not on fin al percentage of pregnan t heifers These results are in agreement with Bilby et al. (2004) that

PAGE 30

30 reported negative effects on embryo development when cows treated with bST achieved plasma concentration s of IGF 1 above 600 ng/ml. T hese results indicate the e xistence of a threshold w h ere IGF 1 ha s stimulating effects on reproductive performance, but exceeding this threshold may have deleterious effects. Additionally, lactating dairy cows treated with two sequential injections of bST (325 mg at AI and 14 d afte r AI ) had 27% greater pregnancy rate at 66 d post AI whereas a single treatment of 325 mg of bST at the time of AI had no impact on any reproductive measures compared to non treated cows (Ribeiro et al., 2014) Nonetheless, bST doses of 200 and 500 mg generated similar responses on serum concentrations of IGF 1 (Bilby et al., 1999) However, 500 mg of bST decreas ed conception and pregnancy rates within the first month of trea tment ( Cole et al., 1991 ) Also daily applications of bST (25 mg/d) during synchronization protocol of dairy heifers decreased plasma estradiol concentrations by 30% while inhibiting developmen t of preovulatory follicles and enhancing development of second follicle wave (Lucy et al., 1994) Post weaning b ST treatment also ha s effects on puberty achievement of heifers Age at puberty in he ifers is negatively correlated with ADG and bST treatment has enhanced growth performance of prepubertal animals (Groenewegen et al., 1990; Bauman et al., 1994; Velayudh an et al., 2007) In contrast Moallem et al. ( 2004) reported no reduction in age at puberty despite of enhanced growth performance of dairy heifers treated daily with 0.1 mg/kg BW of bST from 90 to 314 d of age. Similarly Buskirk et al. (1996) reported that bST treated heifers experienced enhanced ADG but no differences in age at puberty compared to non treated cohorts Moreover, dairy heifers fed a high energy diet and receiving daily bST injections (25 g/kg of BW) tende d to have a greater BW gain compared to heifer s offered the same diet with out bST injections H owever, pregnancy and calving percentages of bST treated heifers did

PAGE 31

31 not differ compa r ed with non treated heifers under the same growth rate (Radcliff et al., 2000) B eef heifers receiving 250 mg of bST ev ery 14 d for 210 d after weaning had similar growth performance, decreased circulating leptin concentration and backfat thickness but at tained puberty sooner compared to non treated heifers (Cooke et al., 2013) In contrast, Buskirk et al. (1996) applied 250 mg of bST to beef heifers every 14 d for 112 d starting at 120 d of age, and observed no significant effects on puberty ach ievement Strategies to Explore the Effects of Metabolic Imprinting in Beef Cattle Production Systems Metabolic imprinting effects are associated with critical and transitory window s in which early nutritional interventions may result in long term consequences to animal metabolism. Therefor e, identifying strategies that are able to explore those critical periods of development and enhance calf performance may provide unique opportunities to optimize feed resources and increase the profitability of beef cattle management systems. Early weanin g beef calves prior to the breeding season is a strategy that was capable of eliciting metabolic imprinting effects and hasten ing puberty attainment of beef heifers (Moriel et al., 2014) However, few beef producers are willing to adopt th is management pra ctice due to the lack of information on calf management following EW and the high costs associated with feeding concentrate based diets throughout the entire period of calf development Therefore, the evaluation of alternative management systems for beef h eifers is required. It was hypothesized that preweaning injections of b ST would enhance growth and percentage of pubertal and pregnant beef heifers compared to saline injections. Hence, this 3 yr study evaluated the effects of preweaning injections of b ST on blood parameters and liver gene expression measurements associated with somatotropic axis, growth, and reproduction of Bos indicus influenced beef heifers.

PAGE 32

* Reprinted with pe rmission from the Journal of Animal Science ; Piccolo, M. B., J. D. Arthington, G. M. Silva, G. C. Lamb, R. F. Cooke, and P. Moriel. 2018. Preweaning injections of bovine somatotropin enhanced reproductive performance of Bos indicus influenced replacement beef heifers. J. Anim. Sci. 96:618 631. doi:10.1093/jas/sky016. Available from: http://dx.doi.org/10.1093/jas/sky016 CHAPTER 3 PRE WEANING INJECTIONS OF BOVINE S T ENHANCED REPRODUCTIVE PERFORMANCE OF BOS INDICUS I NFLUENCED REPLACEMENT BEEF HEIFERS Introduction A major determinant of lifetime productivity of beef heifers is the age at attainment of puberty (Lesmeister et al., 1973; Day and Nogueira, 2013). Day and Anderson (1998) proposed that the period from birth to puberty in beef heifers could be divided into infantile, developmental, static, and peripubertal periods. Enhancing the ADG and nutrient intake of beef heifers during the developmental phase (60 to 180 d of age) hastened follicle siz e (Gasser et al., 2 006c, 2006d ) and puberty attainment (Moriel et al., 2014). Ci rculating IGF I impacts the go nadotropin activity required for the first ovulation in beef heifers by influencing hypothalamic pi tuitary secretory activity (Schillo et al., 1992) and augmenting t he effects of gonadotropins in ovarian follicular cells (Spicer and Echternkamp, 1995). In agreement, heifer ADG and plasma IGF 1 concentrations from 70 to 160 d of age explained approximately 34% of the variability of age at puberty (Moriel et al., 2014). These responses may be a ttributed to metabolic imprint ing, which is the concept that body physiological responses to early life nutritional challenges can persist for long periods, even after the removal of such challenges (Lucas, 1991). Thus, metabolic i mprinting may be explored to optimize repro ductive performance of beef heifers. Postweaning injections of bovine ST hastened puberty attainment of Bos taurus heifers (Cooke et al., 2013). However, less emphasis has been placed on pre vs. post weaning

PAGE 33

33 mana gement strategies, despite their greater impact on attainment of puberty in beef heifers (Roberts et al., 2007). It was hypothesized that preweaning injections of bovine ST would enhance growth and percentage of pubertal and pregnant beef heifers compared to saline injections. Hence, this 3 yr study evaluated the effects of preweaning injections of bovine ST on blood parameters and liver gene expression measurements associated with somatotropic axis, growth, and reproduction of Bos indicus influenced beef h eifers Material and Methods The 3 yr experiment described herein was conducted at the University of Florida, Institute of Food and Agricultural Sciences, Range Cattle Research and Education Center used in these experiments were cared for by acceptable practices as outlined in the Guide for t he Care and Use of Agricultural Animals in Research and Teaching (FASS, 2010) and approved by the IFAS Animal Research Committee. Animals and Diets On d 0 of each year (n = 3 yr), 30 cow calf pairs were selected from four herds of mature, lactating, Angus Brahman crossbred beef cows (10 3 yr of age). Only cow calf pairs with heifer calves of similar BW and approximately 120 to 150 d of age (147 20 kg; 134 11 d) were selected for the study. The age criterion was based on previous results indicating t hat beef heifers of approximately 70 to 180 d of age were suscep tible to long term, nutrition induced impacts on postweaning puberty attainment (Moriel et al., 2014). Immediately after selection, cow calf pairs were stratified by heifer BW and age, and hei fers were randomly ass igned to receive an s.c. injec tion of a saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28. Injections were always administered in the neck, alternating betwe en the right and left side of the heifer. The interval

PAGE 34

34 between injections (every 14 d) and dosage (250 mg) of sometribove zinc was chosen according to Buskirk et al. (1996) who successfully reported an increase in plasma IGF 1 concentrations after similar dosage and interval between bovine ST injections, without any detrimental effects to heifer growth and physiological parameters. The injections containing 250 mg of sometribove zinc were prepared by transferring the contents of a standard, commercially ava ilable injection of Posilac (500 mg of sometribove zinc) into a sterile container and determining its total volume, and then, the total volume was split in half to achieve the 250 mg dosage, which was administered to each heifer using sterile syringes. The number of injections (n = 3 injections) was selected so that the plasma IGF 1 concentrations remained increased for a total period of 42 d after the first bovine ST injection, which corresponds to the age window (70 to 180 d) that heifers were susceptible to n utrition induced impacts on pu berty (Moriel et al., 2014). All cow calf pairs were managed as a single group, without access to concentrate, and grazed the same bahiagrass ( Paspalum notatum ) pastures (4 pastures/yr; 4 ha/pasture) from d 0 until weanin g (d 127). Immediately after weaning, cows returned to their original herds, whereas heifers were sorted by treatment, transferred into one of eight bahiagrass pastures (one pasture per treatment; 0.8 ha/pasture), and offered the same concentrate supplemen tation strategy until the end of the study (d 346). Treatment groups were rotated among the eight bahiagrass pastures every 9 to 10 d throughout the study to prevent any potential confounding effects of pasture on the variables investigated herein. Postwea ning concentrate was formulated using NRC (2000) and designed to allow heifers to achieve 60% of their mature BW at the initiation of breeding season (assuming a ma ture BW of 499 kg; based on average BW of ma ture cows in the same location; Moriel et al., 2 017). Concentrate supplementation was offered three times weekly (Monday, Wednesday, and Friday) at 0800 h to achieve an average daily intake of 2.9 kg of

PAGE 35

35 supplement DM per heifer daily from d 127 to 346. Nutritional composition of concentrate supplement i s shown in Table 1. All cows and heifers were provided free choice access to water and a salt based trace mineral and vitamin mix during the entire study (University of Florida, Institute of Food and Agricultural Sciences, Cattle Research Mineral, Brookvil le, OH; 16.8% Ca, 4% P, 20.7% NaCl, 1.0% Mg, 60 mg/kg Co, 1,750 mg/kg Cu, 350 mg/kg I, 60 mg/kg Se, 5,000 mg/kg Zn, 441 IU/g of vitamin A, 33 IU/g of vitamin D3, and 0.44 IU/g of vitamin E). In each year, free choice access to long stem stargrass ( Cynodon nlemfuensis ) hay was offered when pasture availability was limited (d 263 to 346). Heifers were exposed to mature Angus bulls from d 263 to 346 (one bull per group). Bulls passed the breeding soundness exam 90 d before the start of the study and were rotat ed between treat ment groups every 9 to 10 d during the breeding season to remove any potential effects of bull on the variables investigated herein. Sample and Data C ollection Individual heifer shrunk BW was recorded on d 0 and 42, after 6 h of feed and wa ter withdrawal, and then approximately every 28 d from d 127 to 346, after 16 h of feed and water withdrawal. Full BW of heifers were recorded on d 14 and 28 to avoid any potential impacts of shrink induced stress on blood metabolites and hormones during t he period of treatment injections. Hip height of heifers was assessed on d 179 and 346 Blood samples (10 mL) were collected from all heifers via jugular venipuncture into tubes (Vacutainer, Bec ton Dickinson) containing sodi um heparin (158 United States Ph armacopeia units) for plasma harvest on d 0, 14, 28, 42, 127, 234, 263, and 2 96 to determine the plasma con centrations of IGF 1. Blood samples (10 mL) also were collected from al l heifers via jugular venipunc ture into tubes (Vacutainer, Becton Dickinson) c ontaining no additives for serum harvest at 9 to 10 d intervals from d 179 to 346 to determine the serum concentrations of progesterone (P4). Blood samples were immediately placed on ice following collection and then

PAGE 36

36 centrifuged at 1,200 g for 25 min at 4 C. Plasma and serum samples were stored frozen at 2 0C until later laboratory ana lysis. Onset of puberty in this study was defined as the first increase in concentrations of P4 greater than 1.0 ng/mL. T he first increase in concentra tions of P4 that exc eeds 1.0 ng/mL is associated with females containing a luteal structure because of ovulation or luteinization suggesting onset of puberty (Perry et al., 199 1). Body weight at pu berty was determined using the ADG, and initial and final BW measurements of th e respective 28 d interval when puberty was attained (BW at pu berty = initial BW of the respective 28 d interval + [ADG of the respective 28 d interval number of days between the day at puberty attainment and initial BW collection]). Percentages of pregn ant heifers were determined by palpation of the uterus and its contents per rectum by a trained veterinarian approximately 45 d after the end of the breeding season. Heifers were checked twice daily for calving. Calving date was converted to Julian date, a nd calf birth BW was obtained within 12 h of birth. P regnancy loss was calculated as percentage of heifers diagnosed pregnant at approximately 45 d after the end of breeding season, bu t failed to calve. Calving dis tribution was reported as the percentage o f heifers that calved weekly relative to the total number of heifers per treatment. Hand plucked samples of pastures, concentrate, and hay were collected every 56 d from d 0 to 346, dried in a forced air oven at 56 C for 72 h, ground in a Wiley mill (Mode l 4, Thomas Wiley Laboratory Mill, Thomas Scientific, Swedesboro, NJ) to pass a 4 mm stainless steel screen, and pooled across month within each year. The pooled concentrate samples were analyzed in duplicates by a commercial laboratory (Dairy One Forage L aboratory, Ithaca, NY) for concentrations of CP (method 984.13; AOAC, 2006), TDN (Weiss et al., 1992), and NEm and NEg (NRC, 2000). Nutritive analyses of pooled samples of pastures and hay were performed

PAGE 37

37 at the University of Florida Forage Evaluation Suppo rt Laboratory using the micro Kjeldahl technique for N (Gallaher et al., 1975) and the two stage technique for in vitro organic matter digestibility (IVDOM; Moore and Mott, 1974). Average nutritional composition of pastures during the preweaning phase was 42.0% IVDOM and 10.9% CP (DM basis), whereas the average nutritional composition (DM basis) of pastures and hay during the postweaning phase was 35.3% and 46.3% IVDOM and 9.6% and 7.2% CP NDF, respectively. Based on the results obtained in yr 1 and 2, live r biopsy sample collections (six heifers per treatment) were performed on d 0, 42, and 263 of yr 3 to de termine the long term impact of treatments on liver mRNA expression of genes associated with energy metabolism. All liver samples were collected via nee dle biopsy, following the procedure described by Arthington and Co rah (1995). Immediately follow ing collection, 100 mg of wet liver tissue per heifer was stored into 1. 5 mL of RNA stabilization solu tion (RNAlater, Ambion Inc., Austin, TX), kept on ice for 1A and 1B (GHR 1A and GHR 1B), IGF 1, IGF binding protein 3 (IGFBP 3), and 40S ribosomal protein S9 (RSP9). Primer sequence for each gene is shown in Table 2. Lab oratory A nalyses Plasma conc entrations of IGF I were deter mined using a human specific commercial ELISA kit (SG100; R&D Systems, Inc., Minneapolis, MN) with 100% cross reactivity with bovine IGF I and previously validated for bovine samples (Moriel et al., 2012). Intra and inter assay CV for IGF 1 assay were 1.60% and 3.65%, respectively. Plasma P4 concentrations were determined using a solid phase, competitive, chemiluminescent enzyme immunoassay (Immulite 1000, Diagnostics Products Corp.) previously vali dated for bovine samples (Martin et al., 2007). Detectable range and intra assay for pla sma P4 concentrations were, re spectively, 0.2 to 40 ng/mL and 4.38%

PAGE 38

38 A detailed description of procedures for mRNA isolation and tissue gene expression was described b y Cappellozza et al. (2014). Briefly, total RNA was extracted from liver tissue samples using the TRIzol Plus RNA Purification Kit (Invitrogen, Carlsbad, CA). Extracted RNA was quantified via UV absorbance (UV Mini 1240; Shimadzu Scientific Instruments, In c., Columbia, MD) at 260 nm, incubated (2.5 g) at 37 C for 30 min in the presence of RNase free (DNase; New England Biolabs Inc., Ipswich, MA) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit with random hexamers (Applied Bi osystems, Foster City, CA). Real time PCR was completed using the SYBR Green PCR Master Mix (Applied Biosystems) and gene specific primers (20 pM each) with the StepOne Real Time PCR system (Applied Biosystems). At the end of each real time PCR, amplified products were subjected to a dissociation gradient (95 C for 15 s, 60 C for 30 s, and 95 C for 15 s) to verify the amplification of a single product by denaturation at the anticipated temperature. A portion of the amplified products was purified with th e QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) and sequenced at the Oregon State University Center for Genome Research and Biocomputing (Corv allis, OR), whereas the remain ing portion was sequenced at the Department of Animal Science from Unive rsity of Florida to verify the specificity of am plification. All amplified prod ucts represented only the genes of interest. Primer sequence of target genes was validated by previous studies, except for GHR 1B, which was designed based on the bovine gene se quences deposited in the National Center for Biotechnology Information and using the Primer Express v.3.0.1 software (Applied Biosystems, Foster City, CA). Responses were quantified based on the threshold cycle (CT) and were normalized to geometrical mean of CT values from

PAGE 39

3 9 Grove et al., 2008). Statistical A nalyses All d ata were analyzed as a complete randomized design using SAS (SAS Institute Inc., Cary, NC, USA, version 9.4) with Satterthwaite approxi mation to determine the denominator degrees of freedom for the test of fixed effects. He ifer was the experimental uni t, whereas heifer within treat ment year was included as random effect in all analyses. Growth and physiological results were analyzed using the MIXED procedure, whereas reproductive binary data (puberty attainment, percentage of heifers that became pregnant and calved, pregnancy l oss, and weekly calving distri bution) were analyzed using the GLIMMIX pro cedure. Heifer ADG, BW and age at puberty, and mature BW on d 263 were tested for fixed effects of preweaning treatment, year, and treatment year. Heifer B W, plasma IGF 1, liver mRNA ex pression, puberty at tainment, and calving distribu tion were tested for fixed effects of treatment, day of the study (or week of calving season), year, and all resulting interacti ons, using heifer within treat ment year as the subject. Results from d 0 were included as covariates in each respective analysis but removed from the model when P > 0.10. Proper covariance structure for each repeated measure analysis was selected based on the lowest Akaik e information c riterion. Compound symmetry co variance structure was used for statistical analyses of postweaning heifer BW, plasma IGF 1 concen trations, and liver mRNA expression of IGFBP 3. Autoregressive 1 covariance structure was used for the analyses o f preweaning heifer BW, liver mRNA expression of IGF 1 calving distribution, and pu berty attainment. Unstructured covariance struc ture was used for the statistical analyses of liver mRNA expression of GHR 1A and GHR 1B. All results are reported as least s quares means. Data were separated using PDIFF if a significant F test was detected. Significance was set at P P

PAGE 40

40 Results Heifer BW on d 0 did not differ ( P covariate ( P < 0.0001) in the s tatistical analyses of prewean ing heifer BW. Effects of treatment year day of the study, and treatment year were not detected ( P and post weaning heifer BW. Effects of treatment day of the study were detected for p reweaning ( P = 0.01; Figure 3 1 a ), but not for postweaning BW of heifers ( P = 0.50; Figure 3 1 b ). Heifers administer ed preweaning injections of bo vine ST tended ( P = 0.09) to be heavier on d 42, but had B W on d 14 and 28 and from d 127 to 346 that did not differ ( P 17) compared with SAL heif ers. Effects of year were detected ( P = 0.0007) for mean postweaning BW of heifers, which was great est in yr 2, least in yr 3, and intermediate in yr 1 ( P respectively). Effects of treatme nt year were not detected ( P pre and post weaning phase s, age and BW at puberty attain ment and percentage of mature BW on d 263 ( Table 3 3 ). Heifers assigned to BST had greater ( P = 0.03) A DG from d 14 to 28 and 0 to 42, less ADG from d 127 to 346 ( P = 0.04), and ADG from d 0 to 127 and 127 to 346 that did not differ ( P Table 3 3 ). Hip height on d 179 and 346, and hip height change f rom d 179 to 346 did not differ ( P Table 3 3 ). Effects of treatment year and treatment year day of the study were not detected ( P and post weaning plasma concentrations of IGF 1. Effect of treatment day of the study was not detected ( P = 0.83) for preweaning plasma concentrations of IGF 1, but BST heifers had greater ( P = 0.05) overall plasma IGF 1 concentrations from d 0 to 42 compared to SAL heifers, after covariate adjusted fo r plasma IGF 1 concentrations obtained on d 0 ( P < 0.0001; Table 3 4 ). Effect of treatment day of the study was detected ( P = 0.04) for postweaning plasma concentrations of IGF 1. Heifers treated with BST had greater ( P = 0.008)

PAGE 41

41 plasma concentrations of IGF 1 on d 234, but plasma concentrations of IGF 1 on d 263 and 296 did not differ ( P Table 3 4 ). Liver mRNA expression of GHR 1A, GHR 1B, and IGF 1, but not IGFBP 3 ( P = 0.77), was covariate adjusted ( P treatment day of the study were detected ( P 1B and IGF 1, but not for GHR 1A and IGFBP 3 ( P Table 3 5 ). Liver mRNA expression of GHR 1B and IGF 1 did not differ ( P on d 42 but was greater ( P 0.02) for BST vs. SAL heifers on d 263 ( Table 3 5 ). Overall liver mRNA expression of GHR 1A and IGFBP 3 did not differ ( P tween treatments ( Table 3 5 ). Heifers assi gned to BST had BW at puberty and percentage of mature BW on d 263 did not differ ( P P = 0.10) to achieve puberty 26 d earlier than SAL heifers ( Table 3 6 ). Effects of treatment year were not detected ( P pregnancy percentage, pregnancy loss, calving date, and calf BW at birth, except for overall calving percentage ( P = 0.03; Table 3 6 ). Heifers assigned to BST tended ( P greater over all pregnancy percentage and less pregnancy loss compared to SAL heifers ( Table 3 6 ). Overall calving percentage was greater ( P did not differ ( P = 0.68) between treatments in yr 3 ( Table 3 6 ). Calving date and calf BW at birth did not differ ( P Effects of treatment year and treatment year day of the study (or week of the calving season) were not detected ( P uberty attainment ( Figure 3 2 ) or calving distribution ( Figure 3 3 ). Effect of treatment day of the study was detected ( P = 0.03) for puberty attainment. The percentage of pubertal heifers was greater ( P heifers on d 244, 263, 284, and 296 and tended ( P = 0.08) to be greater for BST vs. SAL heifers

PAGE 42

42 on d 273 ( Figure 3 2 ). Effect of treatment week was not detecte d ( P = 0.78) for calving distri bution ( Figure 3 3 ). Discussion Beef heifers early weaned at 70 d of age and limit fed a high concentrate diet for 90 d after weaning had similar BW and ADG during breeding season, but hastened puberty attainment compared to heifers that wer e weaned at 270 d of age and provided similar postweaning management (Moriel et al., 2014). The exact nutrition mediated mecha nisms involved in thi s early activation of the repro ductive axis in beef heifers are unknown. However, circulating IGF I impacts g onadotropin activity required for puberty achievement in beef heifers (Butler and Smith, 1989; Schillo et al., 1992; Spicer and Echternkamp, 1995). Thus, metabolic imprint ing may be explored by identifying strategies that can increase heifer ADG and plasma IGF 1 during the developmental phase leading to optimized future reproductive performance In the present study, heifers administered preweaning injections of bovine ST had an 8.6 ng/mL increase in mean plasma IGF 1 concentrations, a 7.5% increase in ADG from d 0 to 42, and tended to be heavier on d 42 compared to heifers administered saline solution. Other studies demonstrated that postweaning bovine ST injections increased plasma IGF 1 concentrations (Cooke et al., 2013), but did not increase postweaning ADG of Angus Holstein heifers administered 500 mg of sometribove zinc every 14 d from 6 to 10 mo of age (Carstens et al., 1997) and Angus Hereford heifers injected with 250 mg of sometribove zinc every 14 d from 6 to 13 mo of age (Cooke et al., 2013). The increase in BW gain and circulating IGF 1 concentrations following bovine ST injections varied from 0% to 45% compared to control treatments (Dalke et al., 1992; Houseknecht et al., 1992), and several factors, such as plane of nutrition, age, and anim al size, may explain this large variation (Rausch et al., 2002). Body weight gain and circulating IGF 1 response to bovine ST are positively influenced by cattle age

PAGE 43

43 and nutritional status (Rausch et al., 2002; Radcliff et al., 2004). Cattle somatotropic a xis is functional at birth (Granz et al., 1997), and the response to ST begins as early as 1 d of age (Govoni et al., 2004), gradually increasing as age increases (Velayudhan et al., 2007). Li kewise, plasma IGF 1 concentra tions following bovine ST injectio n were greater for Holstein heifers gaining 1.2 vs. 0.8 kg/d (Radcliff et al., 2004). Multiple mechanisms may be involved in the BW gain of ca ttle following bovine ST injec tions, including the repartitioning of nutrients toward muscle ra ther than adipose t issue depos ition (Breier, 1999), enhanced long bone growth (Buskirk et al., 1996), improved nitrogen retention (Eisemann et al., 1986), and increased circulating IGF 1 induced synthesis of muscle (Jiang and Ge, 2014) and noncarcass tissues (Early et al., 1 990). Multiple 14 d apart administrations of bovine ST during the pos tweaning phase reduced subcuta neous fat thickness by 9.2% without impacting LM depth, marbling scores, and BW gain (Cooke et al., 2013). Although body composition was not eval uated in the present study, it is unlikely that three 14 d apart injections of bovine ST substantially affected body co mposition and nutrient require ments of heifers, leading to similar overall pre and post weaning growth performance. Hip height throughout the postwe aning phase did not differ between treatments, indicating that bone growth did not differ. Our results perhaps indicate that the increment on bovine ST induced ADG from d 0 to 42 may be the result of increased feed intake and gut fill, as reported by Enrig ht et al. (1990). Heifer BW on d 0 and 42 were recorded after shrink, but it is possible that gut fill was not completely elimi nated after shrink. The less ADG from d 42 to 127 for BST vs. SAL heifers, and lack of differences on overall prewe aning ADG from d 0 to 127, sup ports this rationale of potential gut fill effects. In addition, muscle protein deposition from d 0 to 42 perhaps was not sufficient to dramatically impact heifer BW at weaning. Nevertheless, preweaning bovine ST

PAGE 44

44 injection s in the present s tudy success fully increased plasma IGF 1 concentrations and ADG of heifers during the developmental phase of the reproductive axis in beef heifers (Day and Anderson, 1998). The binding of GH to GHR 1A stimulates hepatic synthesis of IGF 1 (Smith et al., 20 02) and is highly correlated with liver mRNA expression of GHR 1A and IGF 1 (Lucy et al., 2001). Transcription of the growth hormone receptor gene (GHR) is initiated from multiple transcription start sites, generating GHR 1A, GHR 1B, and GH R 1C mRNA that d u ntranslated region, but still encode the same amino acid sequence (Jiang and Lucy, 2001). The GHR 1A mRNA is only expressed in the liver (Lucy et al., 1998), whereas GHR 1B and GHR 1C mRNA are expressed in a wide array of tissues, includin g liver, skeletal muscle, adipose tissue, and mammary gland (Jiang et al., 1999; Jiang and Lucy, 2001). Hepatic synthesis of IGF 1 is regulated primarily at the transcriptional level (Thissen et al., 1994) and is the major source of circulating IGF 1 (Yaka r et al., 1999), which is also responsible for stimulating the hepatic expression of IGFBP 3 mRNA (Thissen et al., 1994). Thus, an increased hepatic expression o f GHR 1A mRNA enhances the cap acity for GH binding (Lapierre et al., 1992) and the hepatic synt hesis of IGF 1 (Radcliff et al., 2004). Nutrient intake and BW gain positively affect the abundance of GHR 1A, IGF 1, and IGFBP 3 in the liver (Thissen et al., 1994; Smith et al., 2002; Radcliff et al., 2004). Holstein heifers administered daily injections of bovine ST (25 g/kg of BW from 120 to 247 d of age) had greater liver mRNA expression of IG F 1, but similar liver mRNA ex pression of GHR 1A and IGFBP 3 (Radcliff et al., 2004). In the present study, preweaning injections of bovine ST did not impact liv er mRNA expression of GHR 1A and IGFBP 3 throughout the study, and GHR 1B and IGF 1 mRNA on d 42. Following bovine ST administration to lactating and nonlactating dairy cattle, plasma IGF 1

PAGE 45

45 concentrations increase after 3 d, peak at ap proximately 7 to 8 d, and grad ually return to baseline concentrations starting at 12 d post injection (Bilby et al., 1999, 2004). Hence, it is possible that the timing of liver sample col lection was not optimal to detect the peak expression of liver mRNA of IGFBP 3, IGF 1, GHR 1B, and GHR 1A. Detection of greater mean plasma IGF 1 concentrations from d 0 and 42, but similar liver mRNA expression of IGF 1 on d 42 be tween BST vs. saline heifers support this rationale. Nevertheless, the primary goal for the collection of liver mRN A expression data was to evaluate any potential carryover effects of preweaning injections of bovine ST on postweaning liver gene expression. Preweaning injections of bovine ST increased liver mRNA expressi on of GHR 1B and IGF 1 approxi mately 221 d after t he last injection of bovine ST, despite the simi lar postweaning nutritional man agement and ADG between treatments, which may be an evidence that preweaning injections of bovine ST caused metabolic imprinting effects Similarly, Moriel et al. (2014) reporte d that beef heifers ear ly weaned at 70 d of age and limit fed a high con centrate diet for 90 d after weaning had similar BW and ADG during breeding season compared to heifers normally weaned at 270 d of age, but had increased liver IGF 1 mRNA expression 70 d after all heifer groups w ere allocated to the same post weaning nutritional management (Moriel et al., 2014). Further studies are required to identify the metabolic imprinting mechanisms influencing the postweaning gene expression and reproduction of BS T injected heifers Despite the greater liver mRNA expression of IGF 1 at the start of the breeding season, postweaning plasma IGF 1 concentrations were greater for BST heifers on d 234, but not at the start and 33 d after the start of the breeding season. This response indicates that the greater liver mRNA expression of IGF 1 on d 263 did not translate into greater systemic concentrations of IGF 1 on that same day. The greater plasma IGF 1 concentrations of BST heifers on d 234,

PAGE 46

46 however, may indicate that liver mRNA expression of IGF 1 was likely greater for BST vs. SAL heifers before the start of the breeding season and that the magnitude of differences on liver mRNA expression of IGF 1 was declining during the postweaning phase leading to similar plasma I GF 1 concentrations on d 263 and 296. Therefore, one could speculate that the potential metabolic imprinting effects of preweaning bovine ST injections on liver metabolism of IGF 1 may not have persisted after d 263. The impact of bovine ST injections on p uberty attainment of beef heifers has been variable. Injections of bovine ST (250 mg every 14 d from 120 to 232 d of age) did not impact attainment of puberty of Angus Simmental crossbred heifers (Buskirk et al., 1996). Postweaning bovine ST injections ( 250 mg of bovine ST every 14 d from 6 to 13 mo of age) increased the percentage of Angus Hereford heifers attaining puberty at the start of breeding season (Cooke et al., 2013), but had no impact on attainment of puberty of Angus heifers administered bov ine ST (350 mg every 14 d from 7 to 14.5 mo of age) compared to control treated heifers (Hall et al., 19 94). In the present study, pre weaning injections of bovine ST tended to decrease age at puberty by 26 d and hastened the percentage of pubertal heifers immediately at and during the first 33 d after the initiation of the breeding season compared to saline injections, despite their similar nutritional management, ADG, and BW during breeding season. The tendency to advance puberty supports our hypothesis a nd is likely a result of the increased plasma IGF 1 concentrations and ADG during the developmental phase of the reproductive axis in beef heifers (Day and Anderson, 1998). The exact mechanism for such responses on puberty attainment of these heifers canno t be determined in the present study and the discussion of all po tential mechanism leading to the enhanced puberty attainment is beyond the scope of this article

PAGE 47

47 Heifers should attain puberty before the initiation of the breeding season because the perce ntage of pregnant heifers was 21% greater in heifers mated on third vs. first postpubertal estrous cycle (Byerley et al., 1987; Perry et al., 1991), and the timing of conception in the first breeding season impacts lifetime productivity (Lesmeister et al., 1973). Heifers classified as cyclic at the initiation of breeding season had greater overall pregnancy and calving percentages to the first breeding season (Moriel et al., 2017). Beef heifers that conceived early during their initial breeding season and c alved within the first 21 d period of the calving season had greater overall pregnancy percentage and calf weaning weights for the first six parturitions (Cushman et al., 2013). They also remained in the herd longer compared to females that calved during t he second and third 21 d period of calving season (Cushman et al., 2013). In agreement with our hypothesis and the rationale described above, preweaning injections of bovine ST increased the overall pregnancy percentages in yr 1, 2, and 3, and calving perc entages in yr 1 and 2. Calving distributi on, however, did not differ be tween treatments, which was unexpected. Thus, the greater overall reproductive efficiency of BST heifers is likely because o f the greater percentage of pu bertal heifers at the initiatio n and during the first 30 d of the breeding season, highlighting the import ance of age at puberty attainment for B. indicus in fluenced heifers. Taken together, the results of the current study indicate that major limiting factor for reproductive success of B. indicus influenced heif ers is the delayed attainment of puberty because of poor environment induced growth performance of heifers. It also suggests that successful pregnancy and calving percen tages can occur even under sit uations of poor growth perform ance, if heifers are administered preweaning injections of bovine ST and become pubertal before the initiation of breed ing season.

PAGE 48

48 It is important to note that heifers were slightly lighter than expected at the initiation of the breed ing season (% of matur e BW), and for that reason, only 20 to 40 % of all heifers were considered pu bertal at the start of the breeding season. This is likely a result of the imp acts of environmental con ditions reducing postweaning growth performance of heifers, as reported pr eviously in cohorts at the same location (Moriel et al., 2014). In addition, the fact that only 20 to 40 % of heifers were pubertal at the initiation of the breeding season indicates that bull breeding power was not a limiting factor for the reproductive performance of heifers. Calving percentages in yr 3 did not differ between BST and SAL heifers. This response was surprising considering that this was the only variable measured in the present study that demonstrated an effect of treatment year. Further evaluation revealed that heifers in yr 3, regardless of treatment, had the lightest mean BW during the postweaning phase compared to heifers in yr 1 and 2, which could be attributed to differences in environmental conditions as postweaning nutritional man agement of heifers was similar across year. Likewise, overall puberty attainment was less f or yr 3 vs. 1 and 2 (30% vs. 42% and 52%, respectively), and overall pregnancy percentage was less in yr 2 and 3 vs. 1 (60% and 63% vs. 90%, respectively). Hence, th e similar postweaning nutritional management and ADG of heifers among year ( P = 0.19), and lack of treatment and treatment year interactions for postweaning BW and ADG, indicates that the similar calving percentage between treatments in yr 3 may be attri buted to heifers being the lightest, which limited the overall puberty attainment and pregnancy percentage, and prevented similar treatment effects observed for calving percentages in yr 1 and 2. Conclusion In conclusion, preweaning injections of bovine ST (250 mg every 14 d between 135 and 163 d of age) increased p uberty attainment of beef heif ers at the initiation of their first breeding

PAGE 49

49 season, overall pregnancy percentage in all 3 yr, and calv ing percentage in 2 of 3 yr. In addition, prewean ing injectio ns of bovine ST led to long term effects on plasma IGF 1 concentrations and liver mRNA expression of gene s associated with energy metab olism and known for positively influ encing repro duction in beef cattle. These latter responses may be indicators of metab olic imprinting, but further measures are warranted to elucidate the actual metabolic imprinting me chanisms that may be occurring.

PAGE 50

50 Table 3 1 Average nutritional composition of concentrate offered during the post weaning phase ( d 127 to 346) to beef heifers that receive d a pre weaning s.c. injection of saline solution (SAL; 5 mL ; 0.9% NaCl) or 250 mg of sometribove zinc (BST ; Posilac Elanco, Greenfield, IN) on d 0, 14 and 28 ( n = 15 he ifers/treatment annually; 3 yr). Item Post w eaning concentrate 1 Ingredient 2 kg DM daily Molasses 1.0 Crude glycerin 1.0 Dried distillers grains 0.59 Soybean meal 0.30 Ca carbonate 0.009 Phosphoric acid 0.009 TDN 3 % of DM 81.3 CP, % of DM 15.4 NEm 4 Mcal/kg of DM 2.05 NEg 4 Mcal /kg of DM 1.39 Ca, % of DM 0.55 P, % of DM 0.40 1 Concentrate samples were collected monthly from weaning (d 127) until the end of the study (d 346) for wet chemistry analysis of all nutrients. 2 Ingredients were hand mixed immediately before feedin g. Concentrate w as provided 3 times weekly (Monday, Wednesday, and Friday) at 0800 h in amounts to achieve a target daily DM intake of 2.9 kg/heifer from day 127 to 346 3 Calculated as described by Weiss et al. (1992). 4 Calculated using the equations pro posed by the NRC (2000).

PAGE 51

51 Table 3 2 Primer sequences and accession number for all gene transcripts analyzed by quantitative real time PCR 1 Target gene Primer sequence Accession no. Cyclophilin Forward 5' GGTACTGG TGGCAAGTCCAT 3' NM_178320.2 Reverse 5' GCCATCCAACCACTCAGTCT 3' IGF 1 Forward 5' CTCCTCGCATCTCTTCTATCT 3' NM_001077828 Reverse 5' ACTCATCCACGATTCCTGTCT 3' IGFBP 3 Forward 5' AATGGCAGTGAGTCGGAAGA 3' NM_1745 56.1 Reverse 5' AAGTTCTGGGTGTCTGTGCT 3' GHR 1A Forward 5 CCAGCCTCTGTTTCAGGAGTGT 3 AY748827 Reverse 5 TGCCACTGCCAAGGTCAAC 3 GHR 1B Forward 5 AGCCTGGAGGAACCATACGA 3 Reverse 5 TAGCCCCATCT GTCCAGTGA 3 RSP9 Forward 5 CCTCGACCAAGAGCTGAAG 3 DT860044 Reverse 5 CCTCCAGACCTCACGTTTGTTC 3 1 Primer sequence for IGF 1 IGFBP 3 and GHR 1A genes were obtained from Coyne et al. (2011), whereas the primer sequence for C yc lophilin and RSP9 genes were obtained from Cooke et al. (2008) and Janovick Guretzky et al. (2007), respectively. Primer sequence for GHR 1B gene was designed based on the bovine gene sequences deposited in the National Center for Biotechnology Information and using the Primer Express v. 3.0.1 software (Applied Biosystems, Foster City, CA)

PAGE 52

52 Table 3 3 Pre and post weaning growth performance of beef heifers that received a s.c. injection of saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28 (n = 15 heifers/treatment annually; 3 yr) 1 Treatment P value Item SAL BST SEM Treatment yr Treatment yr Pre weaning (d 0 to 127) ADG, kg/d d 0 to 14 1.26 1.35 0.06 0.46 0.18 < 0.0 1 d 14 to 28 0.99 1.09 0.04 0.78 0.03 <0.01 d 28 to 42 1.00 0.97 0.04 0.27 0.40 <0.01 d 0 to 42 1.07 1.15 0.03 0.56 0.03 0.07 d 42 to 127 0.80 0.74 0.02 0.48 0.04 <0.01 d 0 to 127 0.89 0.88 0.0 2 0.66 0.50 <0.01 Post weaning (d 127 to 346) ADG, kg/d d 127 to 262 0.12 0.13 0.03 0.36 0.71 0.02 d 127 to 346 0.30 0.28 0.02 0.14 0.61 0.20 Hip height, cm d 179 115 116 0.6 0 0.66 0.66 < 0.0 1 d 346 123 123 0.6 0 0.48 0.87 0.11 Hip height c hange cm 7.8 7.4 0.37 0.79 0.41 < 0.0 1 1 Individual heifer shrunk BW were assessed on d 0, 14, 28, and 42, after 6 h of feed and water withdrawal, and then every 28 d from d 127 to 346, after 16 h of feed and water withdrawal Heifers and their dams were managed as a single group without access to concentrate supplementation during the pre weaning phase (d 0 to 127). After weaning (d 127), heifers were sorted by treatment, allocated into 1 of 8 bahiagrass pastures (1 pasture/t reatment), and offered the same concentrate supplementation strategy until d 346.

PAGE 53

53 Table 3 4 Pre and post weaning plasma IGF 1 concentrations of beef heifers that received a s.c. injection of saline solution (SAL; 5 mL; 0.9% N aCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28 (n = 15 heifers/treatment annually; 3 yr). 1 Treatment P value 2 Item SAL BST SEM P 3 Treatment Day Treatment Pre weaning plasma IGF 1, ng/mL Overall (d 0 to 42) 4 94.8 103.4 3.16 0.83 0.05 Post weaning plasma IGF 1, ng/mL d 234 166.9 197.2 8.00 < 0.0 1 0.04 0.19 d 263 181.9 184.5 8.00 0.82 d 296 181.0 181.0 8.00 0.98 1 Blood samples were collected from jugular vein from all heifers on d 0, 14 28, 42, 127, and then every 9 to 10 d from d 179 to 346. Blood samples for the assessment of plasma IGF 1 concentrations were selected to represent the period of pre weaning injection s (d 0, 14, 28, and 42), day of weaning (d 1 27), and then 28 d before (d 23 5 ), immediately at (d 263 ), and 33 d after (d 296) the start of the breeding season. 2 Effects of day, but not treatment yr and treatment yr day of the study ( P detected for pre and post weaning plasma IG F 1 concentrations ( P < 0.0001). 3 P value for the comparison of treatment within day. 4 Average plasma IGF 1 concentrations of blood samples collected on d 14, 28, and 42, after covariate adjusted for plasma IGF 1 concentrations obtained on d 0 ( P < 0.000 1).

PAGE 54

54 Table 3 5 Liver mRNA expression (fold increase 1 ; yr 3 only) of beef heifers that received a s.c. injection of saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28 (n = 15 heifers/treatment). 2 Treatment P value Gene 3 SAL bST SEM P 4 Treatment Day Day Treatment -----Fold increase -----GHR 1A 5 1.77 1.84 0.18 0.15 <0.0 1 0.79 IGFBP 3 5 1.58 1.96 0.15 0.44 <0. 01 0.12 GHR 1B d 42 3.59 4.36 0.4 1 0.22 0.02 <0.01 0.76 d 263 0.72 1.70 0.41 0.02 IGF 1 d 42 1.50 1.87 0.17 0.15 <0.01 0.04 0.22 d 263 0.93 1.85 0.17 < 0.0 1 1 Responses were quantified based on the threshold cycle (CT) and were norma lized to average CT of Cyclophilin and RSP9 and assessed at the same time as the targets. Within each target gene, results are expressed as relative fold change (2 ) using the average of all samples as reference, as described by Ocn Grove et al. (2008). 2 Heifers and their dams were managed as a single group without access to concentrate supplementation during the pre weaning phase (d 0 to 127). After weaning (d 127), heifers were sorted by treatment, all ocated into bahiagrass pastures (1 pasture/treatment) and offered the same concentrate supplementation strategy until d 346 3 Liver mRNA expression of GHR 1A GHR 1B and IGF 1 but not IGFBP 3 ( P = 0.77), were covariate adjusted to respective mRNA expression obtained on d 0 ( P 4 P value for the comparison of treatment within day. 5 Average liver mRNA expression of GHR 1A and IGF BP 3 obtained on d 0, 42, and 263.

PAGE 55

55 Table 3 6 Reproductive performance of beef heifers that received a s.c. inject ion of saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco, Greenfield, IN) on d 0, 14, and 28 (n = 15 heifers/treatment annually; 3 yr). 1 Treatment P value Item SAL BST SEM P 2 Treatment yr Treatment yr Age at puberty 3 d 414 388 12.9 0.45 0. 10 0.48 Body weight at puberty 4 kg 291 285 5.7 0 0.46 0.34 0.37 Mature BW d 263 5 % 54.7 56.2 1.22 0.69 0.16 <0.01 Overall pregnancy % 6 68.9 82.2 6.11 0.17 0.10 0.0 1 Overall calving % y r 1 73. 3 93.3 6.48 0.05 0.03 0.02 0.08 y r 2 33.3 86.7 6.48 <0. 01 y r 3 66.7 60.0 6.48 0.68 Pregnancy loss 6 % 11.1 2.2 3.66 0.28 0.08 0.20 Calving date 6 Julian d 277 284 5.8 0 0.25 0.34 0.38 Calf birth BW 6 kg 26.1 25.0 1.00 0.57 0.41 < 0.0 1 1 After weaning (d 127), heifers were sorted by treatment, allocated into 1 of 8 bahiagrass pastures (1 pasture/treatment), and offered the same concentrate supplementation strategy until d 346. Heifers were exposed to yearling Angus bulls from d 263 to 346 (1 bull/group). Every 9 to 10 d, heifers were rotated among the same 8 bahiagrass pastures from d 127 to 346 and bulls rotated among heifer treatment groups from d 263 to 346. 2 P value for the comparison of treatment within day. 3 Heifers were con sidered pubertal after the first increase in plasma progesterone concentrations that exceeded 1.0 ng/mL (Perry et al., 1991). 4 Body weight at puberty = initial BW of the respective 28 d interval + (ADG of the respective 28 d interval number of days betw een the day at puberty attainment and initial BW collection) 5 Assuming a cow herd mature body weight of 499 kg (Moriel et al., 2017). 6 Pregnancy rates were determined via rectal palpation at approximately 45 d after the end of the breeding season. Pregn ancy loss calculated as percentage of heifers that were categorized as pregnant at approximately 45 d after the end of breeding season, but did not deliver a live calf. Heifers were observed twice daily for calving. Calving date were determined using Julia n date, and calf birth BW obtained within 12 h of birth.

PAGE 56

56 Figure 3 1 Pre ( A ) and post weaning ( B ) body weight of beef heifers that received a s.c. injection of saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco) on d 0, 14, and 28 (n = 15 heifers/treatment annually; 3 yr). Body weight on d 0 did not differ among treatments ( P covariate in the BW analyses ( P < 0.0001). Effects of treatment day of the study were detected for pre weaning BW ( P = 0.01; SEM = 1.28), but not for post weaning BW of heifers ( P P = 0.09. 160 170 180 190 200 210 220 230 240 250 260 270 14 28 42 127 Pre weaning heifer body weight, kg Day of the study SAL BST

PAGE 57

57 Figure 3 1. Continued. 240 250 260 270 280 290 300 310 320 330 179 207 235 263 296 317 346 Post weaning heifer body weight, kg Day of the study SAL BST

PAGE 58

58 Figure 3 2 Percentage of pubertal beef heifers that received an s.c. injection of saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometri bove zinc (BST; Posilac, Elanco) on d 0, 14, and 28 (n = 15 heifers per treatment annually; 3 yr). Heifers were we aned on d 127. Heifers were con sidered pubertal after the first increase in serum progesterone concentrations that exceeded 1.0 ng/mL (Perry et al., 1991). Heifers were exposed to mature Angus bulls from d 263 to 346 (one bull per treatment). Effects of treatment day of the study were detected ( P = 0.03; SEM = 6.09) for puberty achievement from d 179 to 346. P P = 0.08. 0 10 20 30 40 50 60 70 80 90 100 179 189 198 207 217 226 235 244 254 263 273 284 296 307 317 328 337 346 Pubertal heifers, % of total heifers Day of the study SAL BST

PAGE 59

59 Figure 3 3 Calving distribution (% of heifers that calved) of beef heifers that received an s.c. injection of saline solution (SAL; 5 mL; 0.9% NaCl) or 250 mg of sometribove zinc (BST; Posilac, Elanco) on d 0, 14, and 28 (n = 15 heifers per treatment annually; 3 yr). Heifers were weaned on d 127 and exposed to mature Angus bulls from d 263 to 346 (one bull per treatment). Every 9 to 10 d, heifers were rotated among the same bahiagrass pastures from d 127 to 346 and bulls rotated among heifer groups from d 263 to 346. Effects of year, treatment, treatm ent year, treatment week of calving season, and treatment week of calving season year were not detected ( P for calving distribution. 0.0 10.0 20.0 30.0 40.0 50.0 60.0 70.0 80.0 90.0 100.0 110.0 1 2 3 4 5 6 7 8 9 10 11 12 Calving distribution, % of heifers that calved Week of the calving season SAL BST

PAGE 60

60 LIST OF REFERENCES Allen, C. C., B. R. C. Alves, X. Li, L. O. Tedeschi, H. Zhou, J. C. Paschal, P. K. Riggs, U. M. Braga Neto, D. H. Keisler, G. L. Williams, and M. Amstalden. 2012. Gene expression in the arcuate nucleus of heifers is affected by controlled intake of high and low concentrate diets. J. Anim. Sci. 90:2222 2232. doi:10.2527/jas.2011 4684. AO AC. 2006. Official methods of analysis. 18th ed. AOAC Int., Arlington, VA. Armstrong, J. D., and A. M. Benoit. 1996. Paracrine Autocrine and Endocrine Factors that Mediate the Influence of Nutrition on Reproduction in Cattle IGF I Perspective Paracrine Autocrine and Endocrine Factors that Mediate the Influence of Nutrition on Reproductio. J. Anim. Sci. 74:18 35. Arthington, J. D., and L. R. Corah. 1995. Liver biopsy procedures for determining the t race mineral status in beef cows. Part II. ( Video, AI 9134). Extension TV, Dep. Commun. Coop. Ext. Serv., Kansas State Univ., Manhattan. Badinga, L., R. J. Collier, W. W. Thatcher, C. J. Wilcox, H. H. Head, and F. W. Bazer. 1991. Ontogeny of hepatic bovine growth hormone receptors in cattle. J. Anim. Sci. 69:1925 1934. Bagley, C. P. 1993. Nutritional management of replacement beef heifers: a review. J. Anim. Sci. 71:3155 3163. doi:/1993.71113155x. Bass, J. J., S. C. Hodgkinson, B. H. Breier, W. D. Carter, a nd P. D. Gluckman. 1992. Effects of bovine somatotrophin on insulin like growth factor I, insulin, growth and carcass composition of lambs. Livest. Prod. Sci. 31:321 334. doi:10.1016/0301 6226(92)90078 I. Available from: http://www.sciencedirect.com/science/article/pii/030162269290078I Bauman, D. E. 1999. Bovine somatotropin and lactation: From basic science to commercial application. In: Domestic Animal Endocrinology. Vol. 17 p. 101 116. Bauman, D. E., D. H. Beermann, R. D. Boyd, P. J. Buttery, R. B. Campbell, W. V. Chalupa, T. D. Etherton, K. Klasing, G. T. Schelling, and N. C. Steele. 1994. Metabolic Modifiers: Effects on the Nutrient Requirements of Food Producing Animals. National Academy Press, Washington, D.C. 1994. Bauman, D. E., and R. G. Vernon. 1993. Effects of exogenous bovine somatotropin on lactation. Annu. Rev. Nutr. 437 461. Baxter, R. C. 2013. Insulin like growth factor binding protein 3 ( IGFBP 3 ): Novel liga nds mediate unexpected functions. J. Cell Commun. Signal. 3:179 189. doi:10.1007/s12079 013 0203 9. Berge, P. 1991. Long term effects of feeding during calfhood on subsequent performance in beef cattle. Livest. Prod. Sci. 28:179 201.

PAGE 61

61 Bilby, C. R. 2005. Eff ects of polyunsaturated fatty acids and bovine somatotropin on endocrine function, embryo development, and uterine conceptus interactions in dairy cattle. University of Florida. Bilby, C. R., J. F. Bader, B. E. Salfen, R. S. Youngquist, C. N. Murphy, H. A. Garverick, B. A. Crooker, and M. C. Lucy. 1999. Plasma GH, IGF I, and conception rate in cattle treated with low doses of recombinant bovine GH. Theriogenology. 51:1285 1296. doi:10.1016/S0093 691X(99)00072 2. Bilby, T. R., A. Guzeloglu, S. Kamimura, S. M Pancarci, F. Michel, H. H. Head, and W. W. Thatcher. 2004. Pregnancy and bovine somatotropin in nonlactating dairy cows: I. Ovarian, conceptus, and insulin like growth factor system responses. J. Dairy Sci. 87:3256 3267. doi:10.3168/jds.S0022 0302(04)734 62 1. Available from: http://dx.doi.org/10.3168/jds.S0022 0302(04)73462 1 Binelli, M., W. K. Vanderkooi, L. T. Chapin, M. J. Vandehaar, J. D. Turner, W. M. Moseley, and H. A. Tucker. 1995. Comparison of Growth Hormone Releasing Factor and Somatotropin: Body Growth and Lactation of Primiparous Cows. J. Dairy Sci. 78:2129 2139. doi:https://doi.org/10.3168/jds.S0022 0302(95)76840 0. Available from: http://www.sciencedirect.com/science/article/pii/S0022030295768400 Breier, B. H. 1999. Regulation of protein and energy metabolism by the somatotropic axis. Domest. Anim. Endocrinol. 17:209 218. doi:10.1016/S0739 7240( 99)00038 7. Available from: http://www.sciencedirect.com/science/article/pii/S0739724099000387 Buskirk, D. D., D. B. Faulkner, W. L. Hurley, D. J. Kesler, F. A. Ireland, T. G. Nash, J. C. Castree, and J. L. Vicini. 1996. Growth, reproductive performance, mammary development, and milk production of beef heifers as influenced by prepubertal dietary energy and administration of bovine somatotropin. J. Anim. Sci. 74:2649 2662. Bu tler, W. R., and R. D. Smith. 1989. Interrelationships between energy balance on postpartum reproductive function in dairy cattle. J. Dairy Sci. 72:767 783 Byerley, D. J., R. B. Staigmiller, J. G. Berardinelli, and R. E. Short. 1987. Pregnancy rates of b eef heifers bred either on pubertal or third estrus. J. Anim. Sci. 65:645 650. doi:10.2527/jas1987.653645x. Available from: http://www.ncbi. nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citati on&list_uids=3667429 Campbell, R. G., R. J. Johnson, M. R. Taverner, and R. H. King. 1991. Interrelationships Between Exogenous Porcine Somatotropin (pST) Administration and Dietary Protein a nd Energy Intake on Protein Deposition Capacity and Energy Metabolism of Pigs J. Anim. Sci. 69:1522 1531. Cappellozza, B. I., R. F. Cooke, M. M. Reis, P. Moriel, D. H. Keisler, and D. W. Bohnert. 2014. Supplementation based on protein or energy ingredient s to beef cattle consuming low quality cool season forages: II. Performance, reproductive, and metabolic responses of replacement heifers. J. Anim. Sci. 92:2725 2734. doi:10.2527/jas2013 7442.

PAGE 62

62 Capper, J. L., E. Castaneda Gutierrez, R. A. Cady, and D. E. Ba uman. 2008. The environmental impact of recombinant bovine somatotropin (rbST) use in dairy production. Proc. Natl. Acad. Sci. 105:9668 9673. doi:10.1073/pnas.0802446105. Available from: ht tp://www.pnas.org/cgi/doi/10.1073/pnas.0802446105 Carlacci, L., K. C. Chou, and G. M. Maggiora. 1991. A Heuristic Approach to Predicting the Tertiary Structure of Bovine Somatotropin. Biochemistry. 30:4389 4398. doi:10.1021/bi00232a004. Carriquiry, M., W. J. Weber, and B. A. Crooker. 2008. Administration of Bovine Somatotropin in Early Lactation: A Meta Analysis of Production Responses by Multiparous Holstein Cows. J. Dairy Sci. 91:2641 2652. doi:10.3168/jds.2007 0841. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0022030208711391 Carstens, G. E., D. E. Glaser, F. M. Byers, L. W. Greene, and D. K. Lunt. 2010. Effects of bovine somatotropin treatment and intermittent growth pattern on mammary gland development in heifers. 2378 2388. Carstens, G. E., D. E. Glaser, F. M. Byers, L. W. Greene, and D. K. Lunt. 1997. Effects of bovine somatotropin treatment and intermittent growth pattern on mammary gland development in hei fers. J. Anim. Sci. 75:2378 2388. Carter Su, C., J. Schwartz, and L. S. Argetsinger. 2016. Growth hormone signaling pathways. Growth Horm. IGF Res. 28:11 15. doi:10.1016/j.ghir.2015.09.002. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1096637415300290 Caton, J. S., and B. W. Hess. 2010. Maternal plane of nutrition: Impacts on fetal outcomes and postnatal offspring responses. Page 104 122 in: Proc. 4th Grazing Lives tock Nutrition Conference. B. W. Hess, T. DelCurto, J. G. P. Bowman and R. C. Waterman (eds.) West. Sect. Am. Soc. Anim. Sci., Champaign, IL. Cole W. J., K. S. Madsen, R. L. Hintz, R. J. Collier. 1991. Effect of recombinantly derived bovine somatotropin on reproductive performance of dairy cattle. Theriogenology: 36:573 595. Cooke, R. F., J. D. Arthington, D. B. Araujo, G. C. Lamb, and A. D. Ealy. 2008. Effects of supplementation frequency on performance, reproductive, and metabolic responses of Brahman cro ssbred females. J. Anim. Sci. 86:2296 2309. Cooke, R. F., D. W. Bohnert, C. L. Francisco, R. S. Marques, C. J. Mueller, and D. H. Keisler. 2013. Effects of bovine somatotropin administration on growth, physiological, and reproductive responses of replaceme nt beef heifers. J. Anim. Sci. 91:2894 2901. doi:10.2527/jas.2012 6082. Costa, R. H., V. V. Kalinichenko, A. X. L. Holterman, and X. Wang. 2003. Transcription Factors in Liver Development, Differentiation, and Regeneration. Hepatology. 38:1331 1347. doi:10 .1016/j.hep.2003.09.034.

PAGE 63

63 Coyne, G. S., D. A. Kenny, and S. M. Waters. 2011. Effect of dietary n 3 polyunsaturated fatty acid supplementation on bovine uterine endometrial and hepatic gene expression of the insulin like growth factor system. Theriogenology 75:500 512. Cushman, R. A., L. K. Kill, R. N. Funston, E. M. Mousel, and G. A. Perry. 2013. Heifer calving date positively influences calf weaning weights through six parturitions. J. Anim. Sci. 91:4486 4491. doi:10.2527/jas2013 6465. Daftary, S. S., and A C. Gore. 2003. Developmental changes in hypothalamic insulin like growth factor 1: Relationship to gonadotropin releasing hormone neurons. Endocrinology. 144:2034 2045. doi:10.1210/en.2002 221025. Daftary, S. S., and A. C. Gore. 2005. IGF 1 in the brain as a regulator of reproductive neuroendocrine function. Exp. Biol. Med. 230:292 306. doi:10.1177/153537020523000503. Dalke, B. S., R. A. Roeder, T. R. Kasser, J. J. Veenhuizen, C. W. Hunt, D. D. Hinman, and G. T. Schelling. 1992. Dose response effects of r ecombinant bovine somatotropin implants on feedlot performance in steers. J. Anim. Sci. 70:2130 2137. Day, M. L., and L. H. Anderson. 1998. Current concepts on Control of Puberty. J. Anim. Sci. 76:1 15. Day, M. L., K. Imakawa, P. L. Wolfe, R. J. Kittok, an d J. E. Kinder. 1987. Endocrine mechanisms of puberty in heifers: estradiol negative feedback regulation of luteinizing hormone secretion. Biol. Reprod. 37:1054 1065. doi:10.1095/biolreprod31.2.332. Day, M. L., and G. P. Nogueira. 2013. Management of age a t puberty in beef heifers to optimize efficiency of beef production. Anim. Front. 3:6 11. doi:10.2527/af.2013 0027. Available from: http://www.animalfrontiers.org/cgi/doi/10.2527/af .2013 0027 Dodson, S. E., B. J. McLeod, W. Haresign, a R. Peters, and G. E. Lamming. 1988. Endocrine changes from birth to puberty in the heifer. J. Reprod. Fertil. 82:527 538. doi:10.1530/jrf.0.0820527. Donkin, S. 2012. The Role of Liver Metabolism Duri ng Transition on Postpartum Health and Performance. 23rd Annu. Florida Rumin. Nutr. Symp. 97 107. Available from: http://dairy.ifas.ufl.edu/RNS/2012/8DonkinRNS2012.pdf Dunshea, F. R., D. M. Harris, D. E. Bauman, R. D. Boyd, and A. W. Bell. 1992. Effects of porcine somatotropin on in vivo glucose kinetics and lipogenesis in growing pigs. J. Anim. Sci. 70:141 151. doi:10.1016/0309 1740(93)90040 O. Early, R. J., B. W. McBride, and R. 0. Ball 1990. Growth and metabolism in somatotropin treated steers: II. Carcass and noncarcass tissue components and chemical composition. J. Anim. Sci. 68:4144 4152.

PAGE 64

64 Edens, A., and F. Talamantes. 1998. Alternative Processing of Growth Hormone Receptor Transcrip ts. Endocr. Rev. 19:559 582. Eisemann, J. H., H. F. Tyrrell, A. C. Hammond, P. J. Reynolds, D. E. Bauman, G. L. Haaland, J. P. McMurtry, and G. A. Varga. 1986. Effect of bovine growth hormone administration on metabolism of growing Hereford heifers: dieta ry digestibility, energy and nitrogen balance. J. Nutr. 116:157 163. Enright, W. J., J. F. Quirke, P. D. Gluckman, B. H. Breier, L. G. Kennedy, I. C. Hart, J. F. Roche, A. Coert, and P. Allen. 1990. Effects of long term administration of pituitary derived bovine growth hormone and estradiol on growth in steers. J. Anim. Sci. 68:2345 2356. Etherton, T. D., and D. E. Bauman. 1998. Biology of somatotropin in growth and lactation of domestic animals. Physiol. Rev. 78:745 761. Etherton, T. D., and I. Louveau. 19 92. Manipulation of adiposity by somatotropin and B adrenergic agonists: a comparison of their mechanisms of action. In: Proceedings of the Nutrition Society. p. 419 431. Evans, A. C. O., G. P. Adams, and N. C. Rawlings. 1994. Follicular and hormonal devel opment in prepubertal heifers from 2 to 36 weeks of age. J. Reprod. Fertil. 102:463 470. doi:10.1530/jrf.0.1020463. FASS. 2010. Guide for the care of use of animals in research and teaching. Fenech, M. 2010. Dietary reference values of individual micronutr ients and nutriomes for DNA damage prevention. Am. J. Clin. Nutr. 91:1438 1454. doi:10.3945/ajcn.2010.28674D.1. Ferrell, C. L. 1982. Effects of postweaning rate of gain on onset of puberty and productive performance of heifers of different breeds. J. Anim. Sci. 55:1272 1283. doi:10.2527/jas1982.5561272x. Freetly, H. C., K. A. Vonnahme, A. K. McNeel, L. E. Camacho, O. L. Amundson, E. D. Forbes, C. A. Lents, and R. A. Cushman. 2014. The consequence of level of nutrition on heifer ovarian and mammary developme nt. J. Anim. Sci. 92:5437 5443. doi:10.2527/jas2014 8086. Gallaher, R. N., C. O. Weldon, and J. G. Futral. 1975. An aluminum block digester for plant and soil analysis. Soil Sci. Soc. Am. J. 39:803 806. Gasser, C. L. 2013. Joint Alpharma beef Species sympo sium: Considerations on puberty in replacement beef heifers. J. Anim. Sci. 91:1336 1340. doi:10.2527/jas.2012 6008. Gasser, C. L., E. J. Behlke, D. E. Grum, and M. L. Day. 2006a. Effect of timing of feeding a high concentrate diet on growth and attainment of puberty in early weaned heifers. J. Anim. Sci. 84:3118 3122. doi:10.2527/jas.2005 676.

PAGE 65

65 Gasser, C. L., G. A. Bridges, M. L. Mussard, D. E. Grum, J. E. Kinder, and M. L. Day. 2006b. Induction of precocious puberty in heifers III: Hastened reduction of est radiol negative feedback on secretion of luteinizing hormone. J. Anim. Sci. 84:2050 2056. doi:10.2527/jas.2005 638. Gasser, C. L., C. R. Burke, M. L. Mussard, E. J. Behlke, D. E. Grum, J. E. Kinder, and M. L. Day. 2006c. Induction of precocious puberty in heifers II: Advanced ovarian follicular development. J. Anim. Sci. 84:2042 2049. doi:10.2527/jas.2005 637. Gasser, C. L., D. E. Grum, M. L. Mussard, F. L. Fluharty, J. E. Kinder, and M. L. Day. 2006d. Induction of precocious puberty in heifers I: Enhanced secretion of luteinizing hormone. J. Anim. Sci. 84:2035 2041. doi:10.2527/jas.2005 636. Gluckman, P. D., B. H. Breier, and S. R. Davis. 1987. Physiology of the Somatotropic Axis with Particular Reference to the Ruminant. J. Dairy Sci. 70:442 466. doi:https ://doi.org/10.3168/jds.S0022 0302(87)80028 0. Available from: http://www.sciencedirect.com/science/article/pii/S0022030287800280 Gong, J. G., G. Baxter, T. A. Bramley, and R Webb. 1997. Enhancement of ovarian follicle development in heifers by treatment with recombinant bovine somatotrophin: a dose response study. J Reprod Fertil. 110:91 97. doi:10.1530/jrf.0.1100091. Available from: http://www.reproduction online.org/cgi/content/abstract/110/1/91 Gong, J. G., T. A. Bramley, and R. Webb. 1993. The effect of recombinant bovine somatotrophin on ovarian follicular growth and development in heifers. J. Endocrinol. 97:247 254. Govoni, K. E., T. A. Hoagland, and S. A. Zinn. 2004. The ontogeny of the somatotropic axis in male and female Hereford calves from birth to one year of age and its response to administration of exogenous bovine somatotropin. J. A nim. Sci. 82:1646 1655. Granz, S., F. Ellendorff, R. Grossmann, Y. Kato, E. Muhlbauer, and F. Elsaesser. 1997. Ontogeny of growth hormone and LH beta FSH beta and alpha subunit mRNA levels in the porcine fetal and neonatal anterior pituitary. J. Neuroen docrinol. 9:439 449. Groenewegen, P. P., B. W. McBride, J. H. Burton, and T. H. Elsasser. 1990. E fect of Bovine Somatotropin on the Growth Rate, Hormone Profiles and Carcass Composition of Holstein Bull Calves Domest. Anim. Endocrinol. 7:43 54. Hall, J. B 2013. Nutritional development and the target weight debate. Vet. Clin. North Am. Food Anim. Pract. 29:537 554. doi:10.1016/j.cvfa.2013.07.015. Available from: http://dx.doi.org/10.1016/j.cvfa. 2013.07.015 Hall, J. B., K. K. Schillo, B. P. Fitzgerald, and N. W. Bradley. 1994. Effects of recombinant bovine somatotropin and dietary energy intake on growth, secretion of luteinizing hormone, follicular development, and onset of puberty in beef heife rs. J. Anim. Sci. 72:709 718.

PAGE 66

66 Hess, B. W., S. L. Lake, E. J. Scholljegerdes, T. R. Weston, V. Nayigihugu, J. D. C. Molle, and G. E. Moss. 2005. Nutritional controls of beef cow reproduction. J. Anim. Sci. 83:E90 E106. doi:/2005.8313_supplE90x. Houseknecht, K. L., D. E. Bauman, D. G. Fox, and D. F. Smith. 1992. Abomasal infusion of casein enhances nitrogen retention in somatotropin treated steers. J. Nutr. 122:1717 1725. Janovick Guretzky, N.A., Dann, H.M., Carlson, D.B., Murphy, M.R., Loor, J.J., Drackley, J.K., 2007. Housekeeping gene expression in bovine liver is affected by physiological state, feed intake, and dietary treatment. J. Dairy Sci. 90:2246 2252. untranslated region of the bovine growth hormon e receptor mRNA: Isolation, expression and effects on translational efficiency. Gene 265:45 53. Jiang, H., C. S. Okamura, and M. C. Lucy. 1999. Isolation and characterization of a novel promoter for the bovine growth hormone receptor gene. J. Biol. Chem. 2 74:7893 7900. Jiang, H., and X. Ge. 2014. Mechanism of growth hormone stimulation of skeletal muscle growth in cattle. J. Anim. Sci. 2014.92:21 29. Jiang, H., Y. Wang, M. Wu, Z. Gu, S. J. Frank, and R. Torres Diaz. 2007. Growth hormone stimulates hepatic e xpression of bovine growth hormone receptor messenger ribonucleic acid through signal transducer and activator of transcription 5 activation of a major growth hormone receptor gene promoter. Endocrinology. 148:3307 3315. doi:10.1210/en.2006 1738. Jirtle, R L., and M. K. Skinner. 2007. Environmental epigenomics and disease susceptibility. Nat. Rev. Genet. 8:253 262 Jungermann, K., and N. Katz. 1989. Functional specialization of different hepatocyte populations. Physiol. Rev. 69:708 64. doi:10.1152/physrev 1989.69.3.708. Available from: http://physrev.physiology.org/content/69/3/708.abstract%5Cnhttp://www.ncbi.nlm.nih.go v/pubmed/2664826 Juul, A., P. Bang, N. T. Hertel, K. Main, P. Dalgaard, K. Jorgensen, J. Muller, K. Hall, and N. E. Skakkebaek. 1994. Serum Insulin Like Growth Factor 1 in 1030 Healthy Children, Adolescents, and Adults: Relation to Age, Sex, Stage of Puberty, testicular Size, a nd Body Mass Index. J. Clin. Endocrinol. Metab. 78:744 752. Juul, A., P. Dalgaard, W. F. Blum, P. Bang, K. Hall, K. F. Michaelsen, J. Muller, and N. E. Skakkebaek. 1995. Serum Levels of Insulin Like Growth Factor (IGF) Binding Protein 3 (IGFBP 3) in Healt hy Infants, Children, and Adolescents: The Relation to IGF 1, IGF 2, IGFBP 1, IGFBP 2, Age, Sex, Body Mass Index, and Pubertal Maturation. J. Clin. Endocrinol. Metab. 80:2534 2542.

PAGE 67

67 Kaung, H. L.1994. Growth dynamics of pancreatic islet cell populations duri ng fetal and neonatal development of the rat. Dev Dyn. 200:163 175 Kim, J. W. 2014. Modulation of the Somatotropic Axis in Periparturient Dairy Cows. Asian Australasian J. Anim. Sci. 27:147 154. doi:http://dx.doi.org/10.5713/ajas.2013.13139. Kobayashi, Y. M. J. VandeHaar, H. A. Tucker, B. K. Sharma, and M. C. Lucy. 1999. Expression of Growth Hormone Receptor 1A Messenger Ribonucleic Acid in Liver of Dairy Cows During Lactation and After Administration of Recombinant Bovine Somatotropin. J. Dairy Sci. 82:1 910 1916. doi:10.3168/jds.S0022 0302(99)75426 3. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0022030299754263 Kojima, M., H. Hosoda, Y. Date, M. Nakazato, H. Mat suo, and K. Kangawa. 1999. Ghrelin is a growth hormone releasing acylated peptide from stomach. Nature. 402:656 660. doi:10.1038/45230. Kurz, S. G., R. M. Dyer, Y. Hu, M. D. Wright, and M. L. Day. 1990. Regulation of luteinizing hormone secretion in prepub ertal heifers fed an energy deficient diet. Biol. Reprod. 43:450 456. doi:10.1095/biolreprod43.3.450. Lapierre, H., C. K. Reynolds, T. H. Elsasser, P. Gaudreau, P. Brazeau, and H. F. Tyrrell. 1992. Effects of growth hormone releasing factor and feed intake on energy metabolism in growing beef steers: Net hormone metabolism by portal drained viscera and liver. J. Anim. Sci. 70:742 751. Le Roith, D., C. Bondy, S. Yakar, J. L. Liu, and A. Butler. 2001. The somatomedin hypotheis. Endocr. Rev. 22:53 74. doi:10.1 210/edrv.22.1.0419. Available from: https://academic.oup.com/edrv/article lookup/doi/10.1210/edrv.22.1.0419 Lesmeister, J. L., P. J. Burfening, and R. L. Blackwell. 197 3. Date of First Calving in Beef Cows and Subsequent Calf Production. J. Anim. Sci. 36:1 6. doi:10.2134/jas1973.3611. L obie P. E ., G arca Arag n J., L incoln D. T., B arnard R., W ilcox J. N., and W aters M. J., 1993. Localization and ontogeny of growth hormone receptor gene expression in the central ne rvous system. Dev. Brain Res.74. 275 Lorenz K. Studies in animal and human behavior. Cambridge, MA: Harvard University Press, 1970 Lucas A 1991. Programming by early nutrition in man Wiley, Chichester ( Ciba Foundation Symposium 156) p38 55 Lucy, M. C. 2008. Functional Differences in the Growth Hormone and Insulin like Growth Factor Axis in Cattle and Pigs: Implications for Post partum Nutrition and Reproduction. Reprod. Domest. Anim. 43:31 39. doi:10.11 11/j.1439 0531.2008.01140.x.

PAGE 68

68 Lucy, M. C., C. K. Boyd, A. T. Koenigsfeld, and C. S. Okamura. 1998. Expression of somatotropin receptor messenger ribonucleic acid in bovine tissue. J. Dairy Sci. 81:1889 1895. doi:10.3168/jds.S0022 0302(98)75760 1. Available from: http://dx.doi.org/10.3168/jds.S0022 0302(98)75760 1 Lucy, M. C., J. C. Byatt, T. L. Curran, D. F. Curran, and R. J. Collier. 1994. Placental lactogen and somatotropin: hormone bindi ng to the corpus luteum and effects on the growth and functions of the ovary in heifers. Biol. Reprod. 50:1136 44. doi:10.1095/biolreprod50.5.1136. Lucy, M. C., H. Jiang, and Y. Kobayashi. 2001. Changes in the Somatotrophic Axis Associated with the Initiat ion of Lactation. J. Dairy Sci. 84:E113 E119. doi:10.3168/jds.S0022 0302(01)70205 6. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0022030201702056 Lui, J. C. 2017 Molecular and Cellular Endocrinology Regulation of body growth by microRNAs. Mol. Cell. Endocrinol. 456:2 8. doi:10.1016/j.mce.2016.10.024. Available from: http://dx.doi.org/10.1016/j.mce.2016.10 .024 Mani, A. M., M. A. Fenwick, Z. Cheng, M. K. Sharma, D. Singh, and D. C. Wathes. 2010. IGF1 induces up regulation of steroidogenic and apoptotic regulatory genes via activation of phosphatidylinositol dependent kinase/AKT in bovine granulosa cells. Re production. 139:139 151. doi:10.1530/REP 09 0050. Martin, J. L., K. A. Vonnahme, D. C. Adams, G. P. Lardy, and R. N. Funston. 2007. Effects of dam nutrition on growth and reproductive performance of heifer calves. J. Anim. Sci. 85:841 847. doi:10.2527/jas. 2006 337. Mazerbourg, S., C. A. Bondy, J. Zhou, and P. Monget. 2003. The insulin like growth factor system: A key determinant role in the growth and selection of ovarian follicles? A comparative species study. Reprod. Domest. Anim. 38:247 258. doi:10.1046/ j.1439 0531.2003.00440.x. Moallem, U., G. E. Dahl, E. K. Duffey, A. V Capuco, and R. A. Erdman. 2004. Bovine Somatotropin and Rumen Undegradable Protein Effects on Skeletal Growth in Prepubertal Dairy Heifers*. J. Dairy Sci. 87:3881 3888. doi:https://doi.o rg/10.3168/jds.S0022 0302(04)73527 4. Available from: http://www.sciencedirect.com/science/article/pii/S0022030204735274 Moore, J. E., and G. O. Mott. 1974. Recovery of resi digestion of forages. J. Dairy Sci. 57:1258 1259. Moreira, F., C. Orlandi, C. A. Risco, R. Mattos, F. Lopes, and W. W. Thatcher. 2001. Effects of Presynchronization and Bovine Somatotropin on Pregnancy Rates to a Timed A rtificial Insemination Protocol in Lactating Dairy Cows. J. Dairy Sci. 84:1646 1659. doi:10.3168/jds.S0022 0302(01)74600 0. Available from: http://linkinghub.elsevier.com/retrieve /pii/S0022030201746000

PAGE 69

69 Moreira, F., L. Badinga, C. Burnley, and W. W. Thatcher. 2002. Bovine somatotropin increases embryonic development in superovulated cows and improves post transfer pregnancy rates when given to lactating recipient cows. Theriogenolo gy. 57:1371 87. Moriel, P., S. E. Johnson, J. M. B. Vendramini, V. R. G. Mercadante, M. J. Hersom, and J. D. Arthington. 2014. Effects of calf weaning age and subsequent management system on growth and reproductive performance of beef heifers. J. Anim. Sci 92:3096 3107. doi:10.2527/jas.2013 7389. Moriel, P., P. A. Lancaster, G. C. Lamb, J. M. B. Vendram ini, and J. D. Arthington. 2017 Effects of post weaning plane of nutrition and estrus synchronization on reproductive performance of Bos indicus influenced beef heifers. J. Anim. Sci. 95:242. doi:10.2527/asasann.2017.497. Available from: https://www.animalsciencepublications.org/publications/jas/abstracts/ 95/supplement4/24 2a Moriel, P., R. F. Cooke, D. W. Bohnert, J. M. B. Vendramini, and J. D. Arthington. 2012. Effects of energy supplementation frequency and forage quality on performance, reproductive, and physiological responses of replacement beef heife rs. J. Anim. Sci. 90:2371 2380. Mulliniks, J. T., S. R. Edwards, J. D. Hobbs, Z. D. Mcfarlane, and E. R. Cope. 2017. Postweaning feed efficiency decreased in progeny from high milk producing beef cows. 235 239. doi:10.2527/asasws.2017.0007. Nanke, K. E., J G. Sebranek, K. J. Prusa, and L. F. Miller. 1993. Effects of Porcine Somatotropin (PST) Administration on the Fat/Lean Content and Processing Properties of Pork Belliest. Meat Sci. 35:341 353. Neibergs, H. L., and K. A. Johnson. 2012. Nutrition and the g enome. J. Anim. Sci. 90:2308 2316. doi:10.2527/jas2011 4582. N RC. 1996. Nutrient Requirements of B eef C attle. Revised 7th ed. Natl. Acad. Press, Washington, DC. NRC. 2000. Nutrient Requirements of Beef Cattle. Revised 7th ed. Natl. Acad. Press, Washington, DC. Ocn Grove, O. M., F. N. T. Cooke, I. M. Alvarez, S. E. Johnson, T. L. Ott, and A. D. Ealy. 2008. Ovine endometrial expression of fibroblast growth factor (FGF) 2 and conceptus expression of FGF receptors during early pregnancy. Domest. Anim. Endocrin ol. 34:135 145. Oosthuizen, N., P. L. P. Fontes, D. D. Henry, F. M. Ciriaco, C. D. Sanford, and L. B. Canal. 2017. Administration of Recombinant Bovine Somatotropin Prior to Fixed time Artificial Insemination and the Effects on Pregnancy Rates and Embryo D evelopment in Beef Heifers.

PAGE 70

70 Patel, M., and M. Srinivasan. 2002. Metabolic programming: Causes and consequences. J. Bio. Chem. 277:1629 1632 Patel, M. S., and M. Srinivasan. 2011. Metabolic programming in the immediate postnatal life. Ann. Nutr. Metab. 58: 18 28. Perry, R. C., L. R. Corah, R. C. Cochran, J. R. Brethour, K. C. Olson, and J. J. Higgins. 1991. Effects of hay quality, breed, and ovarian development on onset of puberty and reproductive performance of beef heifers. J. Prod. Agric. 4:13 18. Phillip s, W. A., J. W. Holloway, and S. W. Coleman. 1991. Effect of pre and postweaning management system on the performance on Brahman crossbred feeder calves. J. Anim. Sci. 69:3102 3111. doi:10.2527/1991.6983102x. Radcliff, R. P., B. L. McCormack, B. A. Crooke r, and M. C. Lucy. 2003. Growth hormone (GH) binding and expression of GH receptor 1A mRNA in hepatic tissue of periparturient dairy cows. J. Dairy Sci. 86:3920 3926. Radcliff, R. P., M. J. VandeHaar, L. T. Chapin, T. E. Pilbeam, D. K. Beede, E. P. Stanis iewski, and H. A. Tucker. 2000. Effects of diet and injection of bovine somatotropin on prepubertal growth and first lactation milk yields of Holstein cows. J. Dairy Sci. 83:23 9. doi:10.3168/jds.S0022 0302(00)74850 8. Available from: http://www.ncbi.nlm.nih.gov/pubmed/10659959 Radcliff, R. P., M. J. VandeHaar, Y. Kobayashi, B. K. Sharma, H. A. Tucker, and M. C. Lucy. 2004. Effect of dietary energy and somatotropin on components of the somatotropic axis in Holstein heifers. J. Dairy Sci. 87:1229 35. doi:10.3168/jds.S0022 0302(04)73273 7. Available from: http://www.ncbi.nlm.nih.gov/pubmed/15290971 Radunz, A. E., F. L. Fluharty, A. E. Relling T. L. Felix, L. M. Shoup, H. N. Zerby, and S. C. Loerch. 2012. Prepart postnatal growth glucose tolerance and carcass composition. J. Anim. Sci. 4962 4974. doi:10.2527/jas2012 5098. Rausch, M. I., M. W. Tripp, K. E. Govoni, W. Zang, W. J. Weber, B. A. Cro oker, T. A. Hoagland, and S. A. Zinn. 2002. The influence of level of feeding on growth and serum insulin like growth factor I and insulin like growth factor binding proteins in growing beef cattle supplemented with somatotropin. J. Anim. Sci. 80:94 100. R awlings, N. C., A. C. O. Evans, A. Honaramooz, and P. M. Bartlewski. 2003. Antral follicle growth and endocrine changes in prepubertal cattle, sheep and goats. Anim. Reprod. Sci. 78:259 270. doi:10.1016/S0378 4320(03)00094 0. Raymond, R., C. W. Bales, D. P h, D. E. Bauman, D. Clemmons, R. Kleinman, D. Lanna, S. Nickerson, and K. Sejrsen. 2009. Recombinant Bovine Somatotropin ( rbST ): A Safety Assessment Recombinant Bovine. J. Dairy Sci.

PAGE 71

71 Rhoads, R. P., J. W. Kim, M. E. Van Amburgh, R. A. Ehrhardt, S. J. Fran k, and Y. R. Boisclair. 2007. Effect of nutrition on the GH responsiveness of liver and adipose tissue in dairy cows. J. Endocrinol. 195:49 58. doi:10.1677/JOE 07 0068. Ribeiro, E. S., R. G. S. Bruno, A. M. Farias, J. A. Hernndez Rivera, G. C. Gomes, R. S urjus, L. F. V. Becker, A. Birt, T. L. Ott, J. R. Branen, R. G. Sasser, D. H. Keisler, W. W. Thatcher, T. R. Bilby, and J. E. P. Santos. 2014. Low Doses of Bovine Somatotropin Enhance Conceptus Development and Fertility in Lactating Dairy Cows. Biol. Repro d. 90:1 12. doi:10.1095/biolreprod.113.114694. Available from: https://academic.oup.com/biolreprod/article lookup/doi/10.1095/biolreprod.113.114694 Rice, L E. 1991. Nutrition and the Development of Replacement Heifers. Vet. Clin. North Am. Food Anim. Pract. 7:27 39. doi:https://doi.org/10.1016/S0749 0720(15)30808 2. Available from: http://www.sciencedirect.com/science/article/pii/S0749072015308082 Riggs, A. D., R. A. Martienssen, V. E. Russo. 1996. Introduction. In: V. E. Russo, R. A. Martienssen, A. D. Riggs, editors, Epigenetic mechanisms of gene regulation. Cold Spring Harb or Laboratory Press, Plainview, NY. p. 1 4. Roberts, A. J., R. N. Funston, and G. E. Moss. 2001. Insulin Like Growth Factor Binding Proteins in the Bovine Anterior Pituitary. Endocrine. 14:399 406. Roberts, A. J., S. I. Paisley, T. W. Geary, E. E. Grings, R. C. Waterman, and M. D. MacNeil. 2007. Effects of restricted feeding of beef heifers during the postweaning period on growth, ef ciency, and ultrasound carcass characteristics. J. Anim. Sci. 85:2740 2745. Roberts, A. J., 3rd Nugent, R. A., J. Klin dt, and T. G. Jenkins. 1997. Circulating Insulin Like Growth Factor I Insulin Like Growth Factor Binding Proteins Growth Hormone and Resumption of Estrus in Postpartum Cows Subjected to Dietary Energy Restriction. J. Anim. Sci. 1909 1917. Santos, J. E. P., S. O. Juchem, R. L. A. Cerri, K. N. Galvo, R. C. Chebel, W. W. Thatcher, C. S. Dei, and C. R. Bilby. 2004. Effect of bST and Reproductive Management on Reproductive Performance of Holstein Dairy Cows. J. Dairy Sci. 87:868 881. doi:10.3168/jds.S0022 0302(04)73231 2. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0022030204732312 Schams, D., B. Berisha, M. Kosmann, R. Einspanier, and W. M. Amselgruber. 1999. Po ssible role of growth hormone, IGFs, and IGF binding proteins in the regulation of ovarian function in large farm animals. Domest. Anim. Endocrinol. 17:279 285. doi:10.1016/S0739 7240(99)00044 2. Schillo, K. K., D. J. Dierschke, and E. R. Hauser. 1982. Reg ulation of luteinizing hormone secretion in prepubertal heifers: increased threshold to negative feedback action of estradiol. J. Anim. Sci. 54:325 336. Schillo, K. K., J. B. Hall, and S. M. Hileman. 1992. Effects of nutrition and season on the onset of pu berty in the beef heifer. J. Anim. Sci. 70:3994 4005. doi:10.2527/1992.70123994x.

PAGE 72

72 Schlegel, M. L., W. G. Bergen, A. L. Schroeder, M. J. VandeHaar, and S. R. Rust. 2006. Use of bovine somatotropin for increased skeletal and lean tissue growth of Holstein st eers. J. Anim. Sci. 84:1176 1187. Schneider, J. E. 2004. Energy balance and reproduction. Physiol. Behav. 81:289 317. doi:10.1016/j.physbeh.2004.02.007. Schoppee, P. D., J. D. Armstrong, R. W. Harvey, M. D. Whitacre, A. Felix, and R. M. Campbell. 1996. Imm unization against growth hormone releasing factor or chronic feed restriction initiated at 3.5 months of age reduces ovarian response to pulsatile administration of gonadotropin releasing hormone at 6 months of age and delays onset of puberty in heifer. Bi ol. Reprod. 55:87 98. doi:10.1095/biolreprod55.1.87. Available from: http://www.ncbi.nlm.nih.gov/pubmed/8793063 Short, R. E., and R. A. Bellows. 1971. Relationships among weight gains, age at puber ty and reproductive performance in heifers. J. Anim. Sci. 32:127 131. Short, R. E., R. B. Staigmiller, R. A. Bellows, and R. C. Greer. 1994. Breeding heifers at one year of age: Biological and economical considerations. In: M. J. Fields and R. S. Sand(ed.) Factors Affecting Calf Crop. p. 55 68. CRC Press, Boca Raton, FL. Silva, J. R. V, J. R. Figueiredo, and R. van den Hurk. 2009. Involvement of growth hormone (GH) and insulin like growth factor (IGF) system in ovarian folliculogenesis. Theriogenology. 71:1 193 1208. doi:10.1016/j.theriogenology.2008.12.015. Slagboom, P. E., and J. Vijg. 1989. Genetic instability and aging: theories, facts, and future perspectives. Genome. 31:373 385. doi:10.1139/g89 057. Smith, J. M., M. E. Van Amburgh, M. C. Daz, M. C. Luc y, and D. E. Bauman. 2002. Effect of nutrient intake on the development of the somatotropic axis and its responsiveness to GH in Holstein bull calves. J. Anim. Sci. 80:1528 1537. doi:10.2527/2002.8061528x. Spicer, L. J., and S. E. Echternkamp. 1995. The ov arian insulin and insulin like growth factor system with an emphasis on domestic animals. Domest Anim Endocrinol. 12:223 245. doi:0739 7240(95)00021 6 [pii]. Available from: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citati on&list_uids=7587167 Tarazon Herrera, M. a, J. T. Huber, J. E. P. Santos, and L. G. Nussio. 2000. Effects of bovine somatotropin on milk yiel d and composition in Holstein cows in advanced lactation fed low or high energy diets. J. Dairy Sci. 83:430 434. doi:10.3168/jds.S0022 0302(00)74899 5. Available from: http://dx.doi.org/10 .3168/jds.S0022 0302(00)74899 5 Thakur, M. K., T. Oka, and Y. Natori. 1993. Gene expression and aging. Mech. Ageing Dev. 66:283 298.

PAGE 73

73 Thiagalingam, S., K. H. Cheng, H. J. Lee, N. Mineva, A. Thiagalingam, and J. F. Ponte. 2003. Histone deacetylases: unique players in shaping the epigenetic histone code. Ann. N. Y. Acad. Sci. 983:84 100. doi:10.1111/j.1749 6632.2003.tb05964.x. Thissen, J. P., J.M Ketelslegers and L. E. Underwood. 1994. Nutritional regulation of the insulin like growth factors. Endocr. Rev. 15:80 101. Turner, J. W. 1980. Genetic and biological aspects of Zebu adaptability. J. Anim. Sci. 50:1201 1205. doi:10.2134/jas1980.5061201x. Van Soest, P. J., J. B. Robertson, and B. A. Lewis. 1991. Methods for dietary fiber, neutral detergent fiber, and non starch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74:3583 3597. Velayudhan, B. T., K. E. Govoni, T. A. Hoagland, and S. A. Zinn. 2007. Growth rate and changes of the somatotropic axis in beef cattle administered exogenous bovine som atotropin beginning at two hundred, two hundred fifty, and three hundred days of age. J. Anim. Sci. 85:2866. doi:10.2527/jas.2007 0281. Available from: https: //www.animalsciencepublications.org/publications/jas/abstracts/85/11/0852866 Velazquez, M. A., L. J. Spicer, and D. C. Wathes. 2008. The role of endocrine insulin like growth factor I (IGF I) in female bovine reproduction. Domest. Anim. Endocrinol. 35:325 342. doi:10.1016/j.domaniend.2008.07.002. van der Walt, J. G. 1994. Somatotropin Physiology a Review. South African J. Anim. Sci. Suid Afrikaanse Tydskr. Vir Veekd. 24:1 9. Waterland, R. A., and C. Garza. 1999. Potential mechanisms of metabolic imprinti ng that lead to chronic disease. Am. J. Clin. Nutr. 69:179 197. doi:10.3945/an.112.002683. Wathes, D. C., M. Fenwick, Z. Cheng, N. Bourne, S. Llewellyn, D. G. Morris, D. Kenny, J. Murphy, and R. Fitzpatrick. 2007. Influence of negative energy balance on cy clicity and fertility in the high producing dairy cow. Theriogenology. 68:232 241. doi:10.1016/j.theriogenology.2007.04.006. Weiss, W. P., H. R. Conrad, and N. R. St. Pierre. 1992. A theoretically based model for predicting total digestible nutrient values of forages and concentrates. Anim. Feed Sci. Technol. 39:95 110. Weller, M. M. D. C. A., R. L. Albino, M. I. Marcondes, W. Silva, K. M. Daniels, M. M. Campos, M. S. Duarte, M. L. Mescouto, F. F. Silva, and S. E. F. Guimares. 2016. Effects of nutrient int ake level on mammary parenchyma growth and gene expression in crossbred (Holstein Gyr) prepubertal heifers. J. Dairy Sci. 99:9962 9973. doi:10.3168/jds.2016 11532. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0022030216307202

PAGE 74

74 Wiltbank, J. N., C. W. Kasson, and J. E. Ingalls. 1969. Puberty in Crossbred and Straightbred Beef Heifers on two Levels of Feed. J. Anim. Sci. 29:602 605. doi:10.2527/jas1969.294602x. Avai lable from: http://dx.doi.org/10.2527/jas1969.294602x Wiseman A. R. M D Redden, C M Spencer, A L McGee, R Reuter, D L Lalman; 23 Effects of Timing of Weaning on Calf Performance and Maintenance En ergy Requirements in Primiparous Beef Cows., Journal of Animal Science Volume 96, Issue suppl_1, 1 March 2018, Pages 12 13, https://doi.org/10.1093/jas/sky027.024 Yakar, S., J. Liu, B. Stannard, A. Bu tler, D. Accili, B. Sauer, and D. LeRoith. 1 999. Normal growth and development in the absence of hepatic insulin like growth factor. Proc. Natl. Acad. Sci. USA 96:7324 7329. Yelich, J. V., R. P. Wetteman, T. T. Marston, and L. J. Spicer. 1996. Luteinizing hormone, growth hormone, insulin like growth factor I, insulin and metabolites before puberty in heifers fed to gain at two rates. Domest. Anim. Endocrinol. 13:325 338. Yung, M. C., M. J. VandeHaar, R. L. Fogwell, and B. K. Sharma. 1996. Effect of Energy B alance and Somatotropin on Insulin like Growth factor I in Serum and on Weight and Progesterone of Corpus Luteum in Heifers. J Anim Sci. 74:2239 2244. Zhu, M. J., S. P. Ford, P. W. Nathanielsz, and M. Du. 2004. Effect of maternal nutrient restriction in sh eep on the development of fetal skeletal muscle. Biol. Reprod. 71:1968 1973.

PAGE 75

75 BIOGRAPHICAL SKETCH Matheus Betelli Piccolo was born in Jundia, So Paulo, Brazil, in June 1993. He is son of Teresa Cristina Betelli Piccolo and Jos Alberto Piccolo. Mathe us obtained his B.S. in Animal S ciences from So Paulo State University ( UNESP, Botucatu, Brazil) in 2015. During his undergrad program, he was mentored by Dr. Jos Luiz Moares Vasconcelos, who gave him the opportunity to work closely to livestock producer s and to engage in research development through Conapec Jr. During his final semester in college, he completed his final internship at the Mountain Research Station in Waynesville, NC. Under the guidance of Dr. Philipe Moriel, working in research trials r elated to beef cattle nutrition and immunity. In the first semester of 2016, worked as the field technician, conducting field research with beef cattle with Elanco Animal Health in the state of Mato Grosso do Sul, Brazil. On June 2016 was accepted at the U F graduate school and began working on his M.S. degree. He intends to complete his program by summer 2018 working on metabolic imprin ting on bee f heifer development under the o rientation of Dr. Philipe Moriel.