Citation
Regulation and Function of Zinc and Zinc Transporters during ER Stress

Material Information

Title:
Regulation and Function of Zinc and Zinc Transporters during ER Stress
Creator:
Kim, Min Hyun
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (111 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Nutritional Sciences
Committee Chair:
COUSINS,ROBERT J
Committee Co-Chair:
COLLINS,JAMES FORREST
Committee Members:
LEEUWENBURGH,CHRISTIAAN
DRIVER,JOHN P

Subjects

Subjects / Keywords:
apoptosis -- steatosis -- upr -- zinc -- zip14
Nutritional Sciences -- Dissertations, Academic -- UF
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Nutritional Sciences thesis, Ph.D.

Notes

Abstract:
Extensive endoplasmic reticulum (ER) stress damages the liver causing apoptosis and steatosis, despite the activation of the unfolded protein response (UPR). Restriction of zinc from cells can induce ER stress, indicating zinc is essential to maintain normal ER function. Zinc transporter ZIP14 (SLC39A14) is abundantly expressed in liver. ZIP14 transports extracellular and organellar zinc into the cytosol of cells. We found ZIP14 expression was highly increased in mouse liver after administration with tunicamycin (TM), a potent ER stress inducer. However, the precise roles of zinc and/or ZIP14 in the UPR are unclear. This project has explored a role for ZIP14 during induced ER stress using Zip14-/- (KO) mice, which exhibit impaired hepatic zinc uptake. Major finding of the project is that ZIP14-mediated hepatic zinc uptake is critical for adaptation to ER stress by preventing sustained apoptosis and steatosis. Impaired hepatic zinc uptake in Zip14 KO mice during ER stress coincides with greater expression of pro-apoptotic proteins in the UPR pathway. In addition, ER stress-induced Zip14 KO mice show greater levels of hepatic steatosis due to higher expression of genes involved in de novo fatty acid synthesis, which are suppressed in ER stress-induced wild type (WT) mice. During ER stress, the UPR-activated transcription factors, activating transcription factor 4 (ATF4) and activating transcription factor 6 alpha (ATF6 alpha), transcriptionally up-regulate Zip14 expression. Mechanistically, ZIP14 mediates zinc transport into hepatocytes to inhibit protein-tyrosine phosphatase 1B (PTP1B) activity, which acts to suppress apoptosis and steatosis associated with hepatic ER stress. Zip14 KO mice show greater hepatic PTP1B activity during ER stress. Furthermore, WT mice were fed different levels of zinc to examine the importance of dietary zinc intake on the adaptation to TM-induced ER stress. Mice fed zinc deficient diet exhibit increased hepatic apoptosis and steatosis during TM-challenge, which coincides with greater PTP1B activity. These results show the importance of zinc trafficking and functional ZIP14 transporter activity for adaptation to ER stress. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2017.
Local:
Adviser: COUSINS,ROBERT J.
Local:
Co-adviser: COLLINS,JAMES FORREST.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2018-02-28
Statement of Responsibility:
by Min Hyun Kim.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
2/28/2018
Classification:
LD1780 2017 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

REGULATION AND FUNCTION OF ZINC AND ZINC TRANSPORTERS DURING ER STRESS By MIN HYUN KIM A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2017

PAGE 2

2017 Min Hyun Kim

PAGE 3

To my family

PAGE 4

4 ACKNOWLEDGMENTS First, I would like to thank my major advisor Dr. Robert J. Cousins for giving me the opportunity to do resear ch in his prestigious lab. He has shown amazing passion, energy and dedication to science and research, which would be a great role model throughout my life as a scientist. I would also like to thank my committee members Dr. James Collins, Dr. Chr istiaan Leeuwenburgh, and Dr. John Driver for their support and advice. Their invaluable guidance made this dissertation successful. Also, I would like to thank my current and past lab members, Dr. Tolunay B. Aydemir, Jinhee Kim, Dr. Catalina Troche, Dr. Inga Wessels, Dr. Gregory Guthrie, Dr. Shou mei Chang, and Oriana Teran In particular Dr. Aydemir provided great help and discussion throughout these years. I appreciate Dr. Moon Suhn Ryu for introducing this Nutritional Sciences program, which enabled me to have a chance to study at the University of Florida. The biggest thanks go to my family, especially my wife, Eun Young Chun, for her tremendous love and support. I sincerely cheer her upcoming new life as a graduate student. My wife; Yunah, my daugh te r; and my parents have been the greatest motivation for me to pursue th e PhD studies with the best. Lastly, I praise my Lord, Jesus Christ.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 14 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 16 ER Stress and the UPR Signaling Pathway ................................ ............................ 16 ER Stress and the UPR ................................ ................................ .................... 16 UPR Mediated Apoptotic Cell Death ................................ ................................ 17 ER Stress in Liver Disease ................................ ................................ ............... 19 Zinc and Zinc Transporters ................................ ................................ ..................... 21 Zinc and Its Physiologic Functions ................................ ................................ ... 21 Mammalian Zinc Transporters ................................ ................................ .......... 22 Function and Regulation of ZIP14 ................................ ................................ .... 23 ER Stress, Zinc and Zinc Transporters ................................ ................................ ... 25 PTP1B, ER S tress and Zinc ................................ ................................ .................... 26 Study Aims ................................ ................................ ................................ .............. 28 2 MATERIALS AND METHODS ................................ ................................ ................ 29 Mice and Diets ................................ ................................ ................................ ........ 29 Treatments ................................ ................................ ................................ .............. 30 Biochemical Analyses ................................ ................................ ............................. 30 Histological Analysis ................................ ................................ ............................... 30 PTP1B Assay ................................ ................................ ................................ .......... 31 Cell Culture and siRNA Knockdown ................................ ................................ ....... 31 Western Blotting ................................ ................................ ................................ ..... 32 Quantitative Real Time PCR (qPCR) ................................ ................................ ...... 32 MTT Assay ................................ ................................ ................................ .............. 33 Chromatin Immunoprecipitation (ChIP) Assay ................................ ........................ 33 3 DETERMINATION OF CHANGES IN ZINC METABOLISM AND ZINC TRANSPORTER EXPRESSION DURING ER STRESS ................................ ........ 39 Introductory Remarks ................................ ................................ .............................. 39 Results ................................ ................................ ................................ .................... 40

PAGE 6

6 TM Administration Alters Hepatic Zinc Homeostasis ................................ ........ 40 TM Administ ration Alters Zinc Transporter Expressions Including ZIP14 ......... 40 HFD Mediated ER Stress Increases Hepatic Zinc Uptake and ZIP14 Expression ................................ ................................ ................................ .... 41 Discussion ................................ ................................ ................................ .............. 42 4 DELINEATION OF SPECIFIC ROLE OF ZIP14 DURING ER STRESS ................. 50 Introductory Remarks ................................ ................................ .............................. 50 Results ................................ ................................ ................................ .................... 52 Zip14 KO Mice Do Not Display Hepatic ER Stress under Steady State Conditions ................................ ................................ ................................ ..... 5 2 Zip14 KO Mice Display Impaired Zinc Uptake during TM Induced ER Stress .. 53 Zip14 KO Mice Display Higher Apoptosis during TM Induced ER Stress ......... 53 Zip14 KO Mice Show a Greater Level of Hepatic Steatosis during TM Induced ER Stress ................................ ................................ ........................ 55 Zip14 KO Mice Display Impaired Hepatic Zinc Accumulation, which Coincides with Higher Apopt osis and Hepatic Steatosis during HFD Induced ER Stress ................................ ................................ ........................ 56 Increased PTP1B Activity is Observed in Zip14 KO Mice during ER Stress ..... 57 Discussion ................................ ................................ ................................ .............. 59 5 IDENTIFICATION OF THE TRANSCRIPTION FACTOR(S) THAT REGULATE ZIP14 EXPRESSION DURING ER STRESS ................................ .......................... 74 Introductory R emarks ................................ ................................ .............................. 74 Results ................................ ................................ ................................ .................... 75 Zip14 mRNA Expression is Regulated at Transcriptional Level during TM Treatment ................................ ................................ ................................ ...... 75 Zip14 is Transcriptionally Regulated by ATF4 and ATF6 during TM Treatment ................................ ................................ ................................ ...... 75 Discussion ................................ ................................ ................................ .............. 76 6 DETERMINATION OF THE IMPACT OF ZINC DEFICIENCY ON ER STRESS IN VIVO ................................ ................................ ................................ ................... 82 Introductory Remarks ................................ ................................ .............................. 82 Results ................................ ................................ ................................ .................... 83 No Activation of UPR in Mice Fed ZnD ................................ ............................. 83 Dietary Zinc is Essential for Suppression of ER Stress Induced Apoptosis by Regulating the Pro Apoptotic p eIF2 Pathway ................... 84 Dietary Zinc is Essential for Suppression of ER Stress Induced Steatosis ...... 85 During ER Stress, PTP1B Activit y was Increased in Mice Fed ZnD ................. 85 Discussion ................................ ................................ ................................ .............. 86 7 CONCLUSIONS AND FUTURE DIRECTIONS ................................ ...................... 94

PAGE 7

7 LIST OF REFERENCES ................................ ................................ ............................... 99 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 111

PAGE 8

8 LIST OF TABLES Table page 2 1 Primers and probes for ER stress and lipid metabolism associated genes ....... 35 2 2 Primers and probes for ZIP transporter genes ................................ .................... 36 2 3 Primers and probes for ZnT transporter genes ................................ ................... 37 2 4 Zip14 primers used for hnRNA detection and ChIP PCR ................................ ... 38

PAGE 9

9 LIST OF FIGURES Figure page 3 1 TM mediated ER stress increases hepatic zinc uptake measured by AAS. ....... 44 3 2 TM mediated ER stress increases hepatic zinc upta ke measured by 65 Zn uptake. ................................ ................................ ................................ ................ 45 3 3 TM mediated ER stress changes hepatic expression of multiple zinc transporters including ZIP14 in mouse liver ................................ ....................... 46 3 4 TG mediated ER stress increases zinc concentrations and ZIP14 expression in mouse liver.. ................................ ................................ ................................ ... 47 3 5 TM mediated ER stress increases total cellular zinc concentrations and ZI P14 expression in HepG2 hepatocytes.. ................................ ......................... 48 3 6 HFD mediated ER stress increases zinc concentration and ZIP14 expression in mouse liver. ................................ ................................ ................................ .... 49 4 1 Zip14 KO mice do not show hepatic ER stress under steady state conditions. .. 63 4 2 Zip14 KO mice display impaired hepatic zinc uptake during TM induced ER stress. ................................ ................................ ................................ ................. 64 4 3 Hepatic concentration of NHI and manganese are comparable between WT and Zip14 KO mice during TM challenge. ................................ .......................... 65 4 4 Zip14 KO mice display increa sed apoptosis during TM induced ER stress. ....... 66 4 5 Dietary zinc supplementation does not reduce the hepatic expression of pro apoptotic proteins in Zip14 KO mice. ................................ ................................ .. 67 4 6 Zinc supplementation rescues ER stress mediated apoptosis in Zip14 knockdown hepatocytes. ................................ ................................ .................... 68 4 7 Zip14 KO mice exhibit a greater level of hepatic triglyce ride accumulation after TM induced ER stress.. ................................ ................................ .............. 69 4 8 HFD fed Zip14 KO mice show greater hepatic ER stress induced apoptosis and triglyceride accumulation. ................................ ................................ ............ 70 4 9 ER stress induced apoptosis is reduced in Ptp1b knockdown hepatocytes. ...... 71 4 10 ZIP14 is required to suppress hepatic PTP1B activity after TM administration and HFD.. ................................ ................................ ................................ ........... 72

PAGE 10

10 4 11 Proposed model for ZIP14 mediated zinc transport and inhibition of PTP1B activity. ................................ ................................ ................................ ............... 73 5 1 Up regulation of Zip14 mRN A by TM treatment is regulated at the transcriptional level in hepatocytes. ................................ ................................ .... 78 5 2 The Zip14 promoter contains a CRE sequence, a potential binding site for ................................ ................................ ............................... 79 5 3 Zip14 is transcriptionally regulated by ATF4 and ATF6 during TM treatment in hepatocytes. ................................ ................................ ................................ ... 80 5 4 Time dependent regulation of Zip14 ................................ 81 6 1 No difference in food intake and net body weight change was found among mice fed with zinc manipulated diets ................................ ................................ .. 88 6 2 No activation of ER stress markers in mice fed a ZnD.. ................................ ..... 89 6 3 Mice fed ZnD display a delay ed hepatic zinc accumulation, which coincides with greater expression of pro apoptotic proteins.. ................................ ............. 90 6 4 Dietary zinc is essential for suppression of ER stress induced apoptosis and steatosis.. ................................ ................................ ................................ ........... 91 6 5 Mice fed ZnD display greater liver damage during TM challenge. ...................... 92 6 6 Mice fed ZnD display greater hepatic PTP1B activity during TM challenge.. ...... 93 7 1 Role of ZIP14 mediated zinc transport in ER stress adaptation. ........................ 98

PAGE 11

11 LIST OF ABBREVIATIONS AAS Atomic Absorption Spectrophotometry ACC Acetyl CoA Carboxylase ACOX1 Acyl CoA Oxidase Act D Actinomycin D AE Acrodermatitis Enteropathica ALT Alanine Aminotransferase ANOVA Analysis of Variance APOB Apolipoprotein B APOE Apolipoprotein E ATF4 Activating Transcription Factor 4 BW Body Weight C/EBP CCAAT enhancer binding Proteins cAMP Cyclic Adenosine Monophosphate CD36 Cluster of Differentiation 36 ChIP Chromatin Immunoprecipitation CHOP C/EBP homologous Protein CHREBP Carbohydrate resp onsive Element binding Protein CRE cAMP response Element CREBH cAmp response Element binding Protein H d Days DNA Deoxyribonucleic Acid

PAGE 12

12 ER Endoplasmic Reticulum ERAD ER a ssociated Degradation FA Fatty Acid FABP Fatty Acid binding protein GRP78/BiP 78 kDa Glucose regulated Protein GRP94 94 kDa Glucose regulated Protein HFD High Fat Diet H&E Haematoxylin and Eosin hnRNA Heterogeneous Nuclear RNA hr Hours IRE1 Inosit ol requiring Enzyme 1 KO Knockout LPS Lipopolysaccharide MMP Matrix Metalloproteinase MRE Metal Response Element mRNA Messenger RNA MT Metallothionein MTF MRE binding Transcription Factor MTT 3 (4,5 Dimethylthiazol 2 yl) 2,5 Diphenyltetrazolium Bro mide NHI Non heme Iron PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PDI Protein Disulfide Isomerase PERK Double stranded RNA activat ed Protein Kinase like ER Kinase PMSF Phenylmethylsulfonyl Fluoride

PAGE 13

13 Peroxisome Proliferator acti vated Receptor PTP1B Protein Tyrosine Phosphatase 1B RNA Ribonucleic Acid SCD1 Stearoyl CoA Desaturase 1 SD Standard Deviation SDS Sodium Dodecyl Sulfate siRNA Small Interfering Ribonucleic Acid SLC Solute Carrier TBP TATA binding Protein TdT Term inal Deoxynucleotidyltransferase TG Thapsigargin TM Tunicamycin TPEN N,N,N,N tetrakis (2 pyridyl methyl)ethylenediamine TUNEL TdT mediated dUTP Nick End Labeling UPR Unfolded Protein Response WAT White Adi pose Tissue wk Weeks WT Wild Type XBP1 X b ox Binding Protein 1 ZIP Zrt Irt like Protein ZnA Zinc adequate ZnD Zinc deficient ZnS Zinc supplementation ZnT Zinc Tranporter

PAGE 14

14 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for the Degree of Doctor of Philosophy REGULATION AND FUNCTION OF ZINC AND ZINC TRANSPORTERS DURING ER STRESS By Min Hyun Kim August 2017 Chair: Robert J. Cousins Major: Nutritional Sciences Extensive endoplasmic reticulu m (ER) stress damages the liver causing apoptosis and steatosis, despite the activation of the unfolded protein response (UPR). Restriction of zinc from cells can induce ER stress, indicating zinc is essential to maintain normal ER function. Zinc transport er ZIP14 (SLC39A 14) is abundantly expressed in liver. ZIP14 transports extracellular and organellar zinc into the cytosol of cells. We found ZIP14 expression was hi ghly increased in mouse liver after administration with tunicamycin (TM), a potent ER stress inducer. However, the precise roles of zinc and/or ZIP14 in the UPR are unclear. This project has explored a role for ZIP14 during induced ER stress using Zip14 / (KO) mice, which exhibit impaired hepatic zinc uptake Major finding of the project is that ZIP14 mediated hepatic zinc uptake is criti cal for adaptation to ER stress by preventing sustained apoptosis and steatosis. Impaired hepatic zinc uptake in Zip14 KO mice during ER stress coincides with greater expression of pro apoptotic proteins in the U PR pathway. In addition, ER stress induced Zip14 KO mice show greater levels of hepatic steatosis due to higher expression of genes involved in de novo fatty acid synthesis, which are suppressed in ER stress

PAGE 15

15 induced wild type (WT) mice. During ER stress, t he UPR activated transcription factors, activating transcription factor 4 ( ATF4 ) transcriptionally up regulate Zip14 expression. Mechanistically, ZIP14 mediates zinc transport into hepatocytes to inhibit protein tyrosine phosphatase 1B (PTP1B) activity, which acts to suppress apoptosis a nd steatosis associated with hepatic ER stress. Zip14 KO mice show greater hepatic PTP1B activity during ER stress. Furthermore, WT mice were fed different levels of zinc to examine the importance of dietary zinc intake on the adaptation to TM induced ER s tress. Mice fed zinc deficient diet exhibit increased hepatic apoptosis and steatosis during TM challenge which coincides with greater PTP1B activity. These results show the importance of zinc trafficking and functional ZIP14 transporter activity for adap tation to ER stress.

PAGE 16

16 CHAPTER 1 INTRODUCTION ER Stress a nd t he UPR Signaling P athway ER Stress a nd t he UPR The endoplasmic reticulum (ER) is a cellular organelle where appropriate folding, assembly, modification, and trafficking of proteins happens ( 1 ) In addition, the ER is a site for calcium storage and lipid biosynthesis. Since the ER is a specialized organelle that synthesizes and secretes proteins and lipids it must have a fine quality control system to prevent aggregation and accumulation of unfolded or misfolded proteins O nly properly folded proteins are transferred to Golgi, whereas improperly folded proteins are retained in the ER lumen and then degrade d through the ER associated degradation (ERAD) process ( 2 ) The normal ER function can be compromised by pharmacological stimuli such as the exogenous chemicals, tunicamycin (TM) and thapsigargin (TG) ( 3 4 ) and by physiological stimuli such as con sumption of a high fat diet (HFD) viral infection, oxidative stress or chronic alcohol consumption ( 5 9 ) The perturbed ER function is collectively termed as ER stre ss. P rolonged ER stress is associated with many diseases and developmental abnormalities ( 10 ) In response to ER stress, mammalian cells ac tivate a special pathway known as the unfolded protein response (UPR ) to preve nt the prolonged stress The UPR comprises three dis crete signaling pathways: activating transcription factor 6 (ATF6 ) branch, inositol requiring enzyme 1 (IRE1) branch, and double stranded RNA activated protein kinas e like ER kinase (PERK ) branch ( 11 ) ATF6, IRE1 and PERK are sensors that localize on ER membrane where they monitor ER homoeostasis. During an unst ressed state, ER luminal domains of ATF6, IRE1 and

PAGE 17

17 PERK are bound to a ER chaperone, 78 kDa glucose regulated protein (GRP78/BiP), which acts to prevent activation of the se sensors Upon ER stress, ATF6, IRE1 and PERK are dissociated from GRP78 which caus e activation of IRE1 and PERK by trans auto phosphorylation, and the activation of ATF6 by proteolytic cleavage The se three branches, so called UPR adaptation pathways, operate in concert during ER stress but utilize unique signal transduction. These adap tation pathways act to relieve the protein burden of the ER by employing two adaptive mechanisms to return normal ER function ( 12 ) First, ATF6 and IRE1 branc hes enhance the folding capacity of the ER via induction of ER resident molecular chaperones and folding enzymes including GRP78 and 94 kDa glucose regulated protein (GRP94 ) ( 13 15 ) GRP78 and GRP94 are constitutively expressed under steady state in many organs. During ER stress, their expression is highly up regulated to restore ER homeostasis by playing various roles in protein folding, assembly and degradation ( 13 ) Second, the IRE1 and PERK branches reduce the biosynthetic load of the ER by attenuating protein synthesis at both the transcri ptional and translational level. At the transcriptional lev el, IRE1 increases gene expression involved in ERAD thereby facilitating the clearance of unfolded proteins ( 16 ) At the translational level, PERK mediated phosph orylation of eukaryotic initiation factor 2 ( ) induces global attenuation of mRNA translation ( 17 ) If ER stress is mitigated and ER homeostasis is reestablished in a timely fashion, cells can survive without furth er insult UPR M ediated A pop totic Cell D eath Under chronic or irreversible ER stress conditions, the adaptive pathway of the UPR fails to mitigate ER stress and ER function remains perturbed. UPR signaling will

PAGE 18

18 then instead trigger apoptotic cell death ( 12 ) Short term induction of apoptosis during severe ER stress may be beneficial to the organism as it can pr event the potential for aberrant signaling from damaged cells ( 14 ) However, sustained apoptosis from ER stress results in numerous pathological conditions such as hepatic steatosis, neurodegenerative diseases, diabetes, atherosclerosis, renal failure, and obesity ( 9 18 ) Therefore, prevention of ER stress induced apoptosis has been considered as a therapeutic target for ER stress associated diseases ( 19 20 ) Several mediators have been implicated in ER stress induced apoptosis. One of the major mechanisms of UPR mediated apoptotic cell death includes sequential steps beginning with PERK ( 21 ) Although p cellular survival during early and reversible ER stress by attenua ting global mRNA translation, the protein acts differently during chronic ER stress to induce apoptotic cell death p selectively en hances the translation of activating transcription factor 4 (ATF4 ), which then upregulates C/EBP homologous protein (CHOP ), which is a transcription factor that induces expression of apoptosis associated components. Thus, e nhanced and sustained activation of the pro apoptotic p F4/CH OP pathway is a hallmark of unresolved ER stress The transcription factor CHOP is the most extensivel y studied pro apoptotic component in the UPR signaling pathway. CHOP has been linked to mechanisms of such as protein phosphatase 1 regulatory subunit 15 A (PPP1R15A), Bcl 2 like protein 11 (BCL2L11), Tribbles homolog 3 ( TR I B3 ) and Bcl 2 binding component 3 ( BBC3 ) ( 22 ) Studies using Chop / mice have shown that CHOP is required for ER stress induced apoptotic cell death under multiple pathological conditions ( 23 25 ) Apoe / mice

PAGE 19

19 are a comm only used animal model of atherosclerosis. Chop / and Apoe / double knockout mice display reduced levels of apoptosis and plaque growth compared to normal Apoe / mice ( 25 ) In addition, deletion of Chop exhibited a protective effect from ER stress induce d apoptosis in the renal tubular epithelium in mi ce administered with TM ( 26 ) These findings suggest that suppression of the pro apoptotic p by lowering CHOP expression, could be a promising therapeutic target to ameliorate chronic ER stress and its associated diseases. ER Stress in Liver D isease The l iver is a central organ which plays mult iple roles in normal systemic metabolism including carbohydrate metabolism, glycogen storage, biosynthesis of amino acids, plasma protein synthesis and secretion, regulation of lipoprotein secretion, cholesterol biosynthesis, and xenobiotic metabolism ( 27 ) Therefore, it is not surprising that hepatocytes are enriched in ER to facilitate those functions. ER stress has been implicated in various liver disease s such as hepatic steatosis, chronic viral hepatitis B and C, alcohol induced liver injury, hyperhomo cysteinemia, and ischemia reperfusion injury ( 19 ) V arious factors may contribute to hepatic ER stress including oxidative stress, hepatic viral infection s metabolic dis orders, chronic al cohol consumption, drug abuse and chemical toxicity ( 18 ) M ultiple studies modeling hepatic steatosis h ave shown that excessive accumulation of triglycerides is highly associated with ER stress ( 9 28 29 ) TM t rea tment suppresses gene expression of transcription factors and components involved in lipid synthesis such as Srebp1 c and Fasn ( 29 ) Furthermore, ablation of UPR pathway components results in development of hepatic steatosis in liver of mice

PAGE 20

20 administered TM indicating ER stress and UPR si gnaling are related to lipid homeostasis ER stress induced hepatic steatosis is associated with prolonged expression of CHOP, suggesting apoptotic cell death also influences the disturbed hepatic lipid homeostasis ( 29 30 ) In ob/ob mice, GRP78 overexpression reduced ER stress markers, which coincided with reduced levels of hepatic triglyceride and cholesterol c ontents, and improved insulin sensitivity ( 28 ) These data suggest that ER stres s is a major contributor to hepatic steatosis. Mechanistically, major UPR compo nents such as X box binding protein 1 ( XBP 1 ) ATF6 GRP78 and GRP94 may regulate hepatic lipid metabolism. Liver specific Xbp1 knockout (KO) mice exhibited significantly decreased level of hepatic lipid production, showing hypocholesterolemia and hypotrigl yceridemia ( 31 ) During TM challenge, Atf6 KO mice accumulated a markedly greater level of triglycerides with hig her mortality, whereas WT mice could recover from t he insults ( 32 ) A h epatoprotective role of ER stress responsive chaperones, GRP78 and GRP94, also has been reported. Liver specific Grp78 KO mice displayed fa tty liver and exacerbated liver injury in response to alcohol feeding, high fat diet, and toxins, which are well known mediators of hepatic ER stress ( 33 34 ) Similar to Grp78 liver specific deletion of Grp94 in mice led to focal steatosis and liver injury ( 35 ) Furthermore, the KO mice showed hyp erproliferation of liver progenitor cells, and subsequent accelerated development of liver tumors. Collectively, these studies suggest that functional UPR activation is essential to overcome ER stress and to prevent further hepatic damage

PAGE 21

21 Zinc a nd Zinc Tr ansporters Zinc and Its Physiologic F unctions Zinc was first established as an essential mineral in plants in 1869 and in experimental animals in 1934 ( 36 ) Essentiality of zinc in humans was recognized in 1961 when the observation was made in the middle eastern dwarfs who were severely zinc deficient ( 37 ) Total body zinc is normally bet ween 1.5 2.5 g in adult human, and is ubiquitously distributed in tissue s. In particular, skeletal muscle, bo ne, skin, and liver contain a great proportion of it. About 95% of zinc is located in the intracellular space, espec ially in the cytosolic vesicles. Free zinc exists at very low concentrations inside of the cell. Abundant sources of dietary zinc include oy ster s organ meats, and flesh of mammals, crustaceans, and fish ( 38 ) Although severe zinc deficiency is rare, nearly half of the world population is reported to be a t risk of a marginal zinc deficiency ( 39 ) Typical symptoms of severe zinc deficiency are growth retardation, hypogonadism, delayed sexual maturation, dermatitis, diarrhea and intestinal inflammation ( 40 ) In experimental s etting s zinc deficient animals and humans have shown decreased cell proliferation, tissue damage, stress intolerance, impaired development, and immune deficiency ( 41 43 ) It is now well established that z inc is required for normal cellular functions as it has catalytic, structural, and regulatory roles ( 44 ) Zinc does not exhibit redox chemistry, unlike iron and copper, which allows the metal to be involved in various physiological events without risk of oxidative damage. Zinc serves a catalytic role in more than 50 zinc metalloenzy mes, including tissue nonspecific alkaline phosphatase ( 45 ) The structural function for zinc is illustrated in zinc finger proteins which have zinc binding motifs ( 46 ) These cysteine and histidine contai ning motifs require zinc to produce a

PAGE 22

22 tetrahedral complex. Removal of zinc from zinc finger proteins causes loss of function due to misfolded structure s In addition, zinc can regulate gene expression and signal transduction. The regulatory role of zinc wa s first identified when it was shown to display a regulatory mechanism for metallothionein (MT) gene expression ( 47 ) The metal response element (MRE) binding transcription factor (MTF ) is a zinc dependent transcription factor that is influenced by zinc status. Zinc has been shown to modulate activity of a number of kinase s and phosphatase s through which the metal controls various signaling pathways ( 48 ) Mammalian Zinc Transporters To maintain zinc homeostasis, mammalian cells use 24 known zinc transporters that tightly control the traf ficking of zinc in and out of cells and subcellular organelles. These transporters are within two families: ZnT (Zinc Tranporter ; SLC30) and ZIP (Zrt Irt like protein; SLC39) ( 49 51 ) The ZnT family transports zinc from the cytoplasm to the extracellular space or organelles thereby reducing intracellular zinc levels. On the other hand, the ZIP family transports zinc into cells from the extracellular space or or ganelles to the cytoplasm in order to increase intracellular zinc levels. The expression of mammalian zinc transporters is regulated both transcriptional ly and posttranscriptional ly Some of the transporter genes, such as ZnT1 and Zip10 are regulated by MTF 1, a zinc responsive transcription factor by which cellular zinc availability transc riptionally controls expression ( 52 53 ) During high zinc status, MTF 1 induces the expression o f ZnT1 whereas it suppresses the expression of Zip10 which acts as an important mechanism for cellular zinc homeostasis. On the other hand, expression of Zip4 which is a major intestinal zinc transporter that import zinc at apical membrane, is controlle d at both the transcriptional and posttranscriptional level ( 54 55 )

PAGE 23

23 It has been shown that Zip4 mRNA is stabilized during zinc deficiency which leads to enhanced level of ZIP4 mediated zinc uptake. On the contrary, Zip4 mRNA is destabilized and degraded during high zinc condition s in order to prevent excessi ve zinc accumulation. Zinc deficiency also induces the transcription factor KLF4 which in turn regulates Zip4 ( 56 ) A number of physiological stimuli including c ytokines and hormones have also been shown to regulate the expression of these transporters. For example, t reatment of lipopolysaccharide (LPS) altered expression of many zinc transporters in dendritic cells thereby reducing intracellular zinc ( 57 ) Similarly in mouse liver, administration of LPS or turpentine altered gene expression of multiple zinc transporters including Zip14 thereby c ontributing to hypozincemia during the acute phase response ( 58 ) Ablation of some of these zinc transporters results in zinc dyshomeostasis and numerous metaboli c defects. One well known example is the mutation of Zip4 in humans which causes acrodermatitis enteropathica (AE) ( 59 ) AE is characterized by dermatitis, alopecia, and diarrhea caused by systemic zinc deficiency d ue to lack of a functional ZIP4. T argeted deletion of Zip1 Zip2 and Zip3 produces a phenotype that is more sensitive to dietary z inc d eficiency during pregnancy, as shown in mouse models ( 60 61 ) Mutation of Zip13 was found in the human Ehlers Danlos syndrome, of which symptoms include impaired joints and aberrant scar formation ( 62 ) Studies using Zip13 KO mice have demonstrated that mutation of Zip13 results in zinc deficiency in the ER due to zinc trapping in vesicular stores ( 63 ) Function and R egulation of ZIP14 ZIP14, a member of the LZT (LIV 1 subfamily of ZIP zinc transporters ) subfamily of zinc transporters is a metal transporter encoded by Slc39a14 gene ( 64 ) ZIP14

PAGE 24

24 contains multiple transmembrane domains, localizing at the plasma membrane and in endosomes where the transporter transports zinc into the cytoplasm ( 65 66 ) In human tissues, t he expression of ZIP14 is shown to be most abundant in liver, and is also significant in intestine, pancreas, and heart ( 64 ) ZIP14 was initially well characterized as a zinc tra nsporter, but further studi es have shown that it also transports non transferrin bound iron, manganese and cadmium under certain circumstances ( 65 67 68 ) although ZIP14 transport affinities may differ among the se metals. ZIP14 is responsive to inflammation Administration of LPS or turpentine increased Zip14 gene expression in mouse liver ( 58 ) Interleukin 6 ( IL 6 ), a pro inflammatory cytokine, is involved in the ZIP14 up regulation since the event was not observed in mice lacking IL 6. Of note is tha t the IL 6 dependent upregulation of hepatic ZIP14 expression is an important event for inflammation induced hypozincemia, which i s potentially associated with host defense by reducing available serum zinc ( 69 ) Ad ditionally, interleukin IL ) and nitric oxide mediators of inflammation, are also involved in ZIP14 expression in murine hepatocytes ( 70 ) ZIP14 expression was also elevated in response to LPS treatment in c ultured sheep pulmonary cells ( 71 ) Development of the Zip14 KO mouse model further rev ealed the physiological r ole of ZIP14. Phenotypically, Zip14 KO mice exhibited low grade chronic inflammation (metabolic endotoxemia) due to impaired gut barrier function ( 72 ) The genotype also displays enlarged pancreat ic islets w ith hyperinsulinemia and greater body fat ( 73 ) which is a general feature of type 2 diabetes and obesity. In adipocytes, ablation of Zip14 resulted in in creased cytokine production, serum leptin level, hypertrophied adipocytes, and dampened insulin signaling ( 74 ) Of importance is that ZIP14 is

PAGE 25

25 essential for hepatic zinc uptake as Zip14 KO mice showed impaired hepatic zinc uptake ( 73 75 ) indicating the transporter serves as a major hepatic zinc channel. ZIP14 mediated zinc uptake was shown to be critical during liver regeneration and hepatocyte proliferation ( 75 ) ER Stress, Zinc a nd Zinc Transporters The ER is an important organelle for cellular zinc metabolism as it is an intracellular zinc storage site ( 76 ) Zinc is an essential cofactor for numerous proteins including metalloenzymes and transcription factors ( 77 ) Since these proteins acquire zinc at an early period i n the secretory pathway, it is not surprising that normal zinc homeostasis is required for maintaining ER function. At the same time, requirement for zinc in normal ER function highlight s the importance of functional zinc transporters in deliver ing zinc to the organelle. Disturbed z inc homeostasis and zinc transporter activities have been implicated in ER stress and UPR activation. In Saccharomyces cerevisiae zinc depletion using limited zinc medium induced UPR activation, indicating zinc is required for E R function ( 78 ) Similarly, treatment with N,N,N,N tetrakis (2 pyridyl methyl)ethylenediamine (TPEN) a potent zinc chelator, induced UPR activation in some mamma lian cell lines such as HeLa and HepG2 cells ( 78 79 ) A rat model of alcoholic liver disease created by zinc deficiency was shown to trigger ER stress induced apoptosis indicating the importance of zinc for adaptation to ER stress ( 80 ) Since zinc homeostasis is maintai ned by zinc transporters, these proteins have been associated with ER stress and UPR. Administration of TM altered expression of numerous zinc transporter genes in mouse liver during induction of ER stress ( 79 ) These included ZnT1, ZnT3, ZnT5, ZnT7, ZnT10 among the ZnT family, and Zip1 Zip3

PAGE 26

26 Zip4 Zip5 Zip6 Zip13 and Zip14 among the ZIP family. Indeed, ablation of zinc transporters was shown to influence ER str ess and UPR activation. Knockdown of ZnT5 and ZnT7 in HeLa cel ls resulted in exacerbated ER stress ( 81 ) ZnT5 and ZnT7 are localized in the earl y secretory co mpartments of the ER. Therefore, this indicates the importance of zinc transport into the ER to maintain ER function. Similar to ZnT5 and ZnT7, ZIP7 is an intracellular zinc transporter that localizes to the ER ( 50 ) In mice lacking Zip7 intestinal epithelium showed induction of ER stress in proliferative progenitor cells, resulting in massive level of apoptosis ( 82 ) Mutation in Zip13 resulted in cellular zinc deficiency due to zinc trapping in vesicles, and the eve nt was associated with a significant induction of ER stress ( 63 ) In the human neuroblastoma cell line, SH SY5Y, Z nT3 displayed a protective role during ER stress ( 83 ) In response to TM challenge, cells with knockdown of ZnT3 showed less cell viability due to greater ER stress compared to control cells. Of note is that ZnT3 was most highly up regulated transporter among ZnT fami ly following TM administration in mouse liver ( 79 ) Among ZIP family, Zip14 was most highly up regulated transporter, suggesting a potential role for ZIP14 during dance in liver. However, no studies have been conducted to show a role for ZIP14 during ER stress. PTP1B ER S tress and Zinc Protein tyrosine phosphatase 1B (PTP1B) is a ubiquitously expressed protein phospha tase that is involved in multiple signaling pathways ( 84 ) PTP1B is localized to the ER. At the ER, the c atalytic site of PTP1B is exposed to the cytoplasm, although the protein can be cleaved and released from the ER in response to certain stimuli ( 85 ) PTP1B can dephosphorylate multiple receptor tyrosine kinases including the insulin receptor, epidermal growth factor receptor, and insulin like growth factor 1 receptor.

PAGE 27

27 These allow PTP1B to be implicated in many human diseases such as cancer and metabolic syndromes ( 86 87 ) PTP1B has been implicated in ER stress and UPR signaling It wa s first characterized using embryonic fibroblasts isolated from Ptp1b KO mic e where lack of PTP1B resulted in decreased level s of ER stress induced apoptosis and UPR activation in response to pharmacological ER stress inducers ( 88 ) The study indicated that PTP1B was invo lved in the IRE 1 branch of UPR signaling via an unclear mechanism. In liver tissue, PTP1B may play a significant role during ER stress since PTP1B expression was markedly incre ased in livers of mice under chronic ER stress induced by high fat diet feeding and genetic obesity ( 89 90 ) and in hepatic cells treated with pro inflamm atory cytokine s and free fatty acid s to induce ER stress ( 91 92 ) Using liver specific Ptp1b KO mouse, it was demonstrated in vivo that PTP1B is a critical mediator of hepatic ER stress and UPR signaling as the liver specific Ptp1b KO mice exhibited significantly reduced level of ER stress compared to wild type mice ( 93 ) In another study the liver specific Ptp1b KO mouse showed decreased expression of phosphorylated apoptotic pathway components of UPR as well as reduced activation of IRE1 and its down stream effectors ( 91 ) Collectively, these data indicate that ablation of PTP1B can influence multiple branches of UPR pathway, potentially ameliorating ER stress at least in the liver tissue. This raises a possibility that PTP1B inhibitors may be considered as a therapeutic target in the tr eatment or prevention of ER stress related diseases ( 94 ) In this context, of note is that zinc is a well known inhibitor of many phosphatases including PTP1B ( 95 ) Indeed, i t has been demonstrated that zinc binds to PTP1B to

PAGE 28

28 inhibit its activity ( 96 ) and this was supported b y increased PTP1B activity in a setting of impaired zinc uptake caused by Zip14 knockdown in hepatocytes ( 75 ) However, whether zinc acts to inhibit PTP1B activit y in a model of ER stress has not yet been studied. Study Aims In conclusion, observations discussed above led to the hypothesis that zinc and functional zinc tran sporter activity are required for adaptation to ER stress To investigate this hypothesis, f our specific aims were set in this dissertation project: 1. Determination of changes in zinc metabolism and zinc transporter expression during ER stress. 2. Delineation of a specific role of ZIP14 during ER stress. 3. Identification of the transcription factor(s) that regulate Zip14 expression during ER stress. 4. Determination of the impact of zinc deficiency on ER stress in vivo

PAGE 29

29 CHAPTER 2 MATERIALS AND METHODS Mice and Diets Development and characterization of the murine Zip14 KO mice w ere previously described ( 73 ) A colony of Zip14 +/ heterozygotes on the C57BL/6/ 129S5 background was used to produce KO and Zip14 +/+ (WT) mice. Young adult (8 16 wk of age) male WT and KO mice were used throughout the se studies The same response to treatments was seen in female mice, but only m ales were used for the experiments reported here. Mice had free access to a chow diet (Harlan Teklad 7912) and tap water, and were maintained with a 12 hr light dark cycle. To model high fat diet induced ER stress, WT and Zip14 KO mice were fed either the chow diet (17 kcal% fat) containing 63 mg zinc/kg or a high fat diet (HFD; 60 kcal% fat, Research Diets, New Brunswick, NJ; D12492) containing 39 mg zinc/kg for 16 wk. For the dietary zinc manipulat ion study, mice were given a 5 day acclimation period, the n were fed egg white based purified diets (AIN 76A) that contained <1 mg Zn/kg diet (zinc deficient diet; ZnD), 30 mg Zn/kg diet (zinc adequate diet; ZnA), or 180 mg Zn/kg diet (zinc supp lementation diet; ZnS) for 2 wk with free access to deionized drinkin g water. Other compositions among the three purified diets were identical except zinc contents ( 97 ) All purified diets were purchased from Research Diets (New Brunswick, NJ). For controlle d zinc intake experiments, e ach mouse was maintained individually in a shoebox cage with a wire mesh floor to pre vent zinc recycling through an intake of excreted feces or urine. Mice were anesthetized by isofluorane inhalati on prior to injections and euth anasia by cardiac puncture. All research protocols were approved by the University of Florida Institutional Animal Care and Use Committee.

PAGE 30

30 Treatments ER stress was induced by intraperitonea l administration of TM ( Sigma St. Louis, MO) or TG (Sigma) dissolv ed in 1% DMSO/150 mM glucose at 2 mg/kg bw or 1 mg/kg bw respectively. All mice were sacrificed between 9 AM and 10 AM. Collected tissues were snap frozen in liquid nitrogen and stored at 80 C Biochemical Analyses T issue and serum zinc concentrations w ere measured using flame atomic absorption spectrophotometry (AAS) as described previously ( 73 ) Hepatic non heme iron (NHI) concentrations were analyzed colorimetrically ( 98 ) Serum alanine aminotransferase (ALT) activity was measured using a colorimetric end point assay ( 75 ) Liver triglycerides were measured using a colorimetric assa y (BioVision Research, In some experiments, to assess zinc absorption and tissue distribution, 65 Zn (2 Ci, Perkin Elmer, Waltham, MA) was given to mice by oral gavage 3 hr prior to sacrifice Accumulated 65 Zn in tissue and plasma was measured by gamma scintillation spectrometry. Histological Analysis Liver tissues were fixed in 10% formalin in phosphate buffered saline (PBS) embedded in paraffin, and sectioned to 4 m in thickness. For histo logical analysis, the sections were stained with hematoxylin and eosin. Apoptotic cells in the liver were detected by terminal deoxynucleotidyltransferase (TdT) mediated dUTP nick end labeling (TUNEL) assay by using a In Situ Apoptosis Detection Kit (Abcam Cambridge, with xylene and ethanol, then incubated with proteinase K for 20 min at room temperature. This was followed by incubation with TdT labeling reaction mix for 90 min

PAGE 31

31 OH ends of DNA fragments generated during apoptosis and catalyzes the attachment of biotin labeled deoxynucleotides. The biotinylated nucleotides were detected via a streptavi din horseradish peroxidase conjugate, which produces a brown substrate with an ad dition of diaminobenzidine PTP1B Assay PTP1B activity was measured as described previously ( 75 ) with slight modifications. Briefly, total lysates were obtained by homogenization of tissues using a HEPES buffer supplemented with protease inhibitor cocktail (Thermo Fisher Scientific) and Bullet Blender (Next Advance). After homogenization and centrif ugation, protein lysates were incubated with PTP1B substrate (ELEF pY MDYE NH2) (AnaSpec, Fremont, CA) dissolved in 20mM HEPES buffer for 30 min at 30C. Sodium orthovanadate, a nonspecific phosphatase inhibitor (Sigma), and 3 (3,5 dibromo 4 hydroxybenzoyl ) 2 ethyl N [4 [(2 thiazolylamino)sulfonyl]phenyl] 6 benzofuransulfonamiade, a PTP1B specific inhibitor (Calbiochem, San Diego, CA), were used for positive controls of phosphatase activity inhibition. Released inorganic phosphate levels were measured using a colorimetric phosphate assay (Biovision, Mountain View, CA). Assays were normalized to total protein concentration using the bicinchoninic acid assay (BioRad, Richmond, CA). Cell Culture and siRNA Knockdown The h uman hepatocellular carcino ma cell line H epG2 (ATCC, Manassas, VA) was supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Sigma). Cells were maintained at 37 C in 5% CO 2 HiPerFect transfection reagent (Qi agen,

PAGE 32

32 Valencia, CA) was used to transfect siRNA for human Zip14 (Thermo Fisher 4392420), Atf4 (Qiagen SI03018345), Atf6 (Ambion 115887) Ptp1b (Cell Signaling 13348) or negative control siRNA (Dharmacon, Pittsburgh, PA) into cells at a final concentration of detected usi ng qPCR and immunoblotting. The transfected cells were treated with TM (1 g/ml, unless specifically indicated) or vehicle (DMSO) to induce ER stress. In zinc supplementation experiments, zinc acetate (Sigma; 2.5 20 M) and pyrithione (2 Mercaptopyridine N oxide sodium salt) (Sigma; 50 M) were added to the culture medium for 30 min. Western Blotting Tissue samples or cells were homogenized in RIPA lysis buf fer Santa Cruz, Dallas, TX) supplemented with protease and phosphatase inhibitors (Thermo Fisher, San Jose, CA) using Bullet Blender (Next Advance, Averill, NY) or a sonicator (Thermo Fisher). Proteins were separated by SDS PAGE and transferred to a nitro cellulose membrane. A polyclonal rabbit antibody against ZIP14 was raised in house as described previously ( 58 ) Purchased antibodies were GRP78, CHOP, phosphoryl ated 52 ) (Santa Cruz Biotechnology, Santa Cruz, CA), ATF4, GRP94, PTP1B (Cell Signaling, Boston, MA), ATF6 (Novus Bio, Littleton, CO) and Tubulin (Abcam, Cambridge, MA). Immunoreactivity was visualized using enhanced chemiluminescence reagents (T hermo Fisher). Quantitative Real Time PCR (qPCR) Total RNA from tissue samples or cells was isolated using TRIzol reag ent (Ambion, Austin, TX) and then homogenized using the Bullet Blender (Next Advance). Isolated RNA was treated with Turbo DNA free reage nt (Ambion) to prevent DNA

PAGE 33

33 contamination. To determine mRNA expression, qPCR was performed using EXPRESS One Step Superscript Mix (Invitrogen, Carlsbad, CA). Amplification values were normalized to a value of TATA binding protein (TBP) mRNA. The primer/pro be sequences of genes involved in ER stress and lipid homeosta sis are provided in Table 2 1 The primer/probe sequences for zinc transporters are provided in Table 2 2 and 2 3 In experiments detecting the transcriptional activity of Zip14 primers spannin g exon 5 and intron 5 junction of Zip14 were designed to measure unspliced heterogeneous nuclear RNA (hnRNA). The hnRNA was quantified by qPCR using SYBR Green (Applied Biosystems). The primer seq uences used are provided in Table 2 4 The reaction conditio ns for PCR were 95 C for 10 min, followed by 40 cycles of 95 C for 15 sec and 60 C for 60 sec, and a final cycle at 60 C for 1 min. Melting curves were obtained after PCR to ensure only a single product was amplified. MTT Assay The MTT assay in HepG2 cells was performed using the MTT Cell Proliferation Chromatin Immunoprecipitation (ChIP) Assay C hIP assay s were performed as described previously ( 99 ) with slight modifications. Briefly, TM or vehicle treated HepG2 cells were cross linked with 1.1% (v/v) formaldehyde for 10 min, followed by addition of 0.125 M glycine to stop cross linking. Cells were lysed with nuclei swelling buffer (5 mM PIPES, pH 8.0, 85 mM KCL, 0.5% NP 40), centrifuged at 6000 xg for 5 min at 4 C and the supernatant was discarded. The pellet (nuclei) was re suspended in RIPA buffer followed by sonication using a BioRup tor (Diagenode, Liege, Belgium) for 15 min (15 cycles of 30 sec on and 30 sec off on high power) to produce 200 to 500 bp DNA fragments. DNA fragment size

PAGE 34

34 after sonication was ensured by electrophoresis using a 1.6% agarose ge l. DNA was immunoprecipitated with ChIP (Cell Signaling). Thereafter cross links between protein/DNA complex were removed by incubating with 5M NaCl. DNA was analyzed by qPCR with primers designed to detect the Zip14 promoter binding an other downstream region that did not include the putative binding sites. The Zip14 promoter primers used are provided in the T able 2 4

PAGE 35

35 Table 2 1. Primers and probes for ER stress and lipid metabo lism associated genes Gene Grp78 Forward Reverse Probe TTCTGCCATGGTTCTCACTAAA TTGTCGCTGGGCATCATT FAM AGACTGCTGAGGCGTATTTGGGAA BHQ1 Chop Forward Reverse Probe CAGCGACAGAGCCAGAATAA CAGGTGTGGTGGTGTATGAA FAM TGAGGAGAGAGTGTTCCAGAAGGAAGT BHQ1 Chrebp Forward Reverse CTGGGGACCTAAACAGGAGC GAAGCCACCCTATAGCTCCC Acc Forward Reverse TGACAGACTGATCGCAGAGAAAG TGGAGAGCCCCACACACA Scd1 Forward Reverse CCGGAGACCCCTTAGATCGA TAGCCTGTAAAAGATTTCTGCAAACC Cd36 Forward Reverse TGGAGCTGTTATTGGTGCAG TGGGTTTT GCACATCAAAGA Fabp Forward Reverse GCTGCGGCTGCTGTATGA CACCGGCCTTCTCCATGA Forward Reverse CTGCAGAGCAACCATCCAGAT GCCGAAGGTCCACCATTTT Forward Reverse TGGCATCATCACTGGTGTGTT GTCTAGGGTCCGATTGATCTTTG Acox1 Forward Reverse GCCCAACTGTGACTTCCATC GCCAG GACTATCGCATGATT Apoe Forward Reverse GCTGGGTGCAGACGCTTT TGCCGTCAGTTCTTGTGTGACT Apob Forward Reverse CGTGGGCTCCAGCATTCTA TCACCAGTCATTTCTGCCTTTG Tbp Forward Reverse Probe TCTGCGGTCGCGTCATT GGGTTATCTTCACACACCATGAAA FAM TCTCCGCAGTGCCCAGCATCA BHQ1

PAGE 36

36 Table 2 2. Primers and probes for ZIP transporter genes Gene Zip1 Forward Reverse Probe TCCTCAAGGTCATTCTGCTCCTA CCCTTTCTCTTGAAGCACCTTAGA FAM CTGCTCACTGGCCTTCTCTTTGTCCAA BHQ 1 Zip2 Forward Reverse Probe CTGCTTGCTCTTCTGGTTCTCA GACCTGTAGCTGCA TCCATCTG FAM ACTGGGCTGTGGCCTTACTCCCATCTAC BHQ1 Zip3 Forward Reverse Probe CTGGGCTACGCCGTTCTG GGGACGTGCTCTGTGTCCTT FAM CTTTCTCAAGTGGTGAGCCCTGAATCCC BHQ1 Zip4 Forward Reverse Probe CTCTGCAGCTGGCACCAA CACCAAGTCTGAACGAGAGCTTT FAM CAATCTCCGACAGTCCAAACAGACCCAT BHQ1 Zip5 Forward Reverse Probe GGGCAGCCTCATGTTTACCA CCACATCAGCCGTCAGGAA FAM CCCTATTGGAGGAGCAGCTAGTGCCC BHQ1 Zip6 Forward Reverse Probe GCCACAGCCAGCGCTACT ATCACCATCCAGGCCAATGT FAM CGGCGTCCTTCAGCTCCTCTCGA BHQ1 Zip7 Forward Reverse Probe AGGCATCAAACACCAC CTGG TGCGGAGATCAGCACTGTG FAM CTGTCACCCTCTGGGCCTACGCACT BHQ1 Zip8 Forward Reverse Probe CTAACGGACACATCCACTTCGA CCCTTCAGACAGGTACATGAGCTT FAM ACTGTCAGCGTTGTATCCCTCCAGGATG BHQ1 Zip9 Forward Reverse Probe AAATTCCCGTTTGCTTGGAA CAGTTTCGAAAGGCGCTTAGG FAM ACCACGC GTTTAAACA BHQ1 Zip10 Forward Reverse Probe CGGCAGTCGGTCAGTATGC AACATGCCGGCAGTGATTG FAM AACAACATCACACTCTGGAT BHQ1 Zip11 Forward Reverse Probe CACTGAGTGGAAGGCATCTTTCT TGAGGTGTTGAAGTTGAGTCTAGTGA FAM TCGAGGCTAACCCCTACTTGTCCCACC BHQ1 Zip12 Forward Reverse Pr obe GGTTGTAAATTTGTCCTGCATGAA TTGGGCTTGGGTTGTGTTG FAM CCTCCCATTCACCC BHQ1 Zip13 Forward Reverse Probe AGGAATGTGAACTGGAAGAATGC GGTGTCAGCCAAGGGAAATAGT FAM AAGCCATAATCCCC BHQ1 Zip14 Forward Reverse Probe GTAAACCTTGAGCTGCACATTAGC TGCAGCCGCTTCATGGT FAM TGGCCTC ACCATCCTGGTATCCGT BHQ1

PAGE 37

37 Table 2 3. Primers and probes for ZnT transporter genes Gene ZnT1 Forward Reverse Probe CACGACTTACCCATTGCTCAAG CTTTCACCAAGTGTTTGATATCGATT AGTCTGCTCTCATTCTTCTACAAACTGTCCCTAAGC ZnT2 Forward Reverse Probe CCG ACCAGCCACCAAGAC TGGAAAGCACGGACAACAAG FAM CGGCTCGATGCCAGCCGAA BHQ1 ZnT3 Forward Reverse Probe GGTGGTTGGTGGGTATTTAGCA CAAGTGGGCGGCATCAGT FAM ACAGCTTGGCCATCAT BHQ1 ZnT4 Forward Reverse Probe GCTGAAGCAGAGGAAGGTGAA TCTCCGATCATGAAAAGCAAGTAG FAM CAGGCTGACCATCGC TGCCGT BHQ1 ZnT5 Forward Reverse Probe CTGCTCGGCTTTGGTCATG CGGCCATACCCATAGGAGGA FAM TTTGCTGCCCTGATGAGCCGC BHQ1 ZnT6 Forward Reverse Probe TCCCAGGACTCAGCAGTATCTTC GCCCCAGCAAGATCAATCAG FAM TGCCCCGCATGAATCCGTTTG BHQ1 ZnT7 Forward Reverse Probe CCTCTCTTTCGC TTTTGTGGAA GTGGAAGGAGTCGGAGATCAAG FAM ACTCTACGGCATCTGGAGCAACTGCCT BHQ1 ZnT8 Forward Reverse Probe TGGGTGGTATCGAGCAGAGAT ACACCAGTCACCACCCAGATG FAM TCGGTGCCCTGCTGTCTGTCCTT BHQ1 ZnT9 Forward Reverse Probe GCACTGGGCATCAGCAAAT GAAAAGCCGTACGGGTGAGA FAM TGTTCAA ACACCAGATCC BHQ1 ZnT10 Forward Reverse Probe GCACTGGGCATCAGCAAAT GAAAAGCCGTACGGGTGAGA FAM CTCTGAACTGGAGTGAGC BHQ1

PAGE 38

38 Table 2 4 Zip14 p rimers used for hnRNA detection and ChIP PCR Gene Zip14 ( hnRNA ) Forward Reverse TCCAAGTCTGCAGTGGT GTT ACAATTGGGCCTCACCCAT Zip14 (ChIP) Forward Reverse TTCCGGAGGCAGGAGGA CAGCTTAGCCGGTGCGT

PAGE 39

39 CHAPTER 3 DETERMINATION OF CHANGES IN ZINC METABOLISM AND ZINC TRANSPORTER EXPRESSION DURING ER STRESS Introductory Remarks Zinc is an essential mineral required for normal cellular functions ( 100 ) To maintain zinc homeostasis, mammalian cells use 24 known zinc transporters that tightly control the trafficking of zinc in and out of cells and subcellular organelles. These transporter s are within two families: ZnT and ZIP ( 51 ) A number of physiological stimuli h ave been shown to regulate the expression and the function of these transporters. Ablation of some of these transport ers results in zinc dyshomeostasis and numerous metabolic defects. Zinc and zinc transporters have been implicated in ER stress and UPR activation Zinc deficiency may induce or exacerbate ER stress and apoptosis. In yeast and some mammalian cells, the UPR was activated by zinc restriction ( 78 79 ) A number of zinc transporters also have been associated with ER s tress and the UPR. Administration of TM altered expression of numerous zinc transporter genes in mouse liver including ZnT3 ZnT5 ZnT7 Zip13 and Zip14 ( 79 ) Ove rall, these previous studies suggest that ER stress alters zinc homeostasis, and that disturbed zinc homeostasis may cause ER stress. However, those studies were mostly conducted in in vitro exper imental setting. Furthermore, Homma et al. examined expressi on of zinc transporters at the transcript level in mouse liver, but did not determine actual zinc concentration s in liver tissue and did not examine protein expression of zinc transporters during ER stress ( 79 ) Thus, it remains uncertain whether ER stress changes zinc metabolism. As use of TM is an extreme experimental model to induce ER stress, examination of zinc metabolism in response to physiologically relevan t ER stress model such as HFD feeding is required.

PAGE 40

40 Therefore, the purpose of the research reported in this chapter is to determine changes in zinc metabolism and zinc transporter expression during ER stress. This focus will include the changes in zinc ho meostasis following pharmacologically and HFD induced ER stress in tissues such as liver, pancreas, white adipose tissue (WAT) and kidney, all of which are known to be affected by ER stress. In addition, the response s of zinc transporters, especially ZIP 14, to ER stress are described. Results TM Administration A lters Hepatic Zinc H omeostasis First, to test the effect of ER stress on zinc homeostasis, TM, a potent ER stress inducer, was intraperitoneally injected into mice (2 mg/kg) to induce systemic ER stress. TM is an enzyme that blocks N glycosylation of newly synthesized protein s. Thus treatment with TM triggers accumulation of misfolded or unfolded proteins in the ER lumen, which induces ER stress and activates the UPR. When measured by AAS, TM injec ted mice showed significantly higher level s of hepatic zinc concentration along with hypozincemia compared to vehicle injected mice (Figure 3 1 A and 3 1B ). Especially 12 h after administration, liver zinc concentration of TM group was ~15% higher than the control group. 65 Zn administration by oral gavage confirmed markedly increased zinc uptake after T M in liver (~1.6 fold) (Figure 3 2A ), but no difference in zinc uptake was observed after TM in other tissues such as pancreas (Figure 3 1C, 3 2C), WAT (Figur e 3 1D Figure 3 2D), spleen (Figure 3 1E) and kidney (Figure 3 2E). Thus, following experiments focused mainly on liver tissue. TM Administration A lters Zinc T ranspor ter Expressions I ncluding ZIP14 As zinc homeostasis is maintained by zinc transporters, hepatic gene expression of zinc transporters were examined. Among ZIP family transporters, Zip14 gene

PAGE 41

41 expression was most highly upre gul ated by TM (~8.2 fold) (Figure 3 3A ), and its time dependent gene and protein expressions showed its expression peaked at 12 h after TM, which coincided with e xtra zinc uptake (Figure 3 3C and D) Significant changes in Zip2 Zip6 Zip7 and Zip8 mRNA expression were also observed (Figure 3 3A) In addition, a number of ZnT family transporters including ZnT1 ZnT3 ZnT5 Z nT7 ZnT8 and ZnT10 showed significantly altered gene expressions by TM (Figure 3 3B) The increased hepatic zinc concentration and ZIP14 expression were also observed in mice injected with another E R stress inducer, TG ( 1 mg/kg), an inhibitor of the ER C a 2+ ATPase ( Figure 3 4A and B ). As liver tissue is comp osed of multiple cell types, human hepatoma HepG2 cells were used to support an in vivo study. To measure total cellular zinc level in HepG2 cells, TM treated cells we re intensively sonicated to disrup t all cellular membranes, then the lysates were incubated with the zinc fluorophore, FluoZin3 AM. Thus, intensity of fluorescence represents the cellular labile zinc concentration. In agreement with in vivo data, TM treatment significantly increased fluore scence ( ~2.1 fold after 12 h) (Figure 3 5A ), which coincided with incr eased ZIP14 expression (Figure 3 5B ). Collectively, these results suggest that pharmacologically induced ER stress increases zinc uptake in liver through zinc transporter regulation. HF D Mediated ER Stress Increases Hepatic Zinc Uptake and ZIP14 E xpression Use of TM is an extreme experimental model to induce ER stress. HFD feeding has been used to t rigger ER stress in rodents and has more physiological rel evance ( 9 ) Therefore, indices of ER stress that were measured in the TM model we re also analyzed after feeding WT and Zip14 KO mice with a HFD (60 kcal% fat) or chow diet (12 kcal% fat) for 16 w k After 16 wk, body weight of HFD fed mice increased 10.21 2.60 g, whereas chow fed mice gained 2.78 0.15 g, assuring validity of HFD feeding.

PAGE 42

42 Hepatic zinc concentration s in HFD fed mice were ~17% greater compared to chow fed mice, indicating that HFD increases zinc uptake (Figure 3 6A). qPCR and western blotting showed an enhanced hepatic Z IP14 expression by HFD (Figure 3 6B and D ), indicating increased ZIP14 expression might contribute to the elevated hepatic zinc accumulation. No difference was obse rved in gene expression of ZnT family transporters after HFD (Figure 3 6C). Discussion When protein folding capacity of ER is disrupted, cellular metabolism is largely altered by activation of UPR pathways to restore the ER homeostasis. This includes enha ncing expression of ER chaperones and reducing translation of mRNA to reduce the cellular protein burden ( 11 ) Several lines of evidence point to the metabolism of some metals being altered during ER stress. Mice injected with TM exhibited hypoferremia and iron sequestration in spleen and liver ( 101 ) The change in iron metabolism during ER stress was regulated by inductio n of h epcidin, a master regulator of iron metabolism. Regarding zinc metabolism, it has been shown that TM administration into mice alters hepatic gene expression of multiple zinc transporters ( 79 ) This observation is supported by the present study in which ZIP14 mediated hepatic extra zinc uptake was observed along with hypozincemia aft er TM and TG treatment (Figure 3 1A, B, Figure 3 2A, and Figure 3 4A, B ), demo nstrating ER stress also alters zinc metabolism. As pharmacological inducti on could be an extreme model, a HFD induced ER stress model was also examined which would be more physiologically relevant experimental model. It was previously demonstrated that 16 wk of HFD feeding to mice could induce ER stress in liver ( 9 ) In response to HFD,

PAGE 43

43 additional hepatic zinc uptake possibly via ZIP14 activity, was similar to t hat seen in pharmacological models of ER stress (Figur e 3 6 ). M ore zinc may be required to assist protein folding process under this stress condition as zinc is a structural component of many proteins or as a regulatory factor (15) This is particularly t rue in the liver, a key organ for protein synthesis and maturation. As ER function is dependent on zinc avail ability to provide zinc for zinc metalloproteins ( 102 ) increased zinc may play a role in the restoration of ER homeostasis. This notion is supported by previou s reports where zinc deficiency i nduced ER str ess was illustrated, indicating zinc is essential for normal ER function The research question addressed was whether the increased hepatic zinc uptake after ER stress would be benefi cial or harmful in terms of stress adaptation. Zinc may be beneficial in facilitating adaption to ER stress by mechanisms discussed above. This notion is supported by the western blotting data where a significant reduction of CHOP expression, a common marker of ER stress induced apoptosis, was seen alongside increased zinc acc umula tion and ZIP14 expression. This observation suggest s that ZIP 14 med i a ted zinc accumulation may be required to suppress apoptosis. On the other hand, in the sense that metals may exhibit toxicity when their cellular concentration is too high, it is als o possible that elevated zinc level may aggravate ER stress. For example excessive accumulation of some metals such as manganese ( 103 105 ) cadmium ( 106 108 ) and fluoride ( 109 ) can induce ER stress and UPR activation The se research questions are inv estigated in c hapter 4.

PAGE 44

44 Fi gure 3 1. TM mediated ER stress increases hepatic zinc uptake measured by AAS. Mice were administered with TM (2 mg/kg) or vehicle for up to 24 h. Serum was collected via cardiac puncture and liver, pancreas, WAT and spleen were collected for measurement of zinc concentration s Zinc concentration of liver (A) serum (B), pancreas (C), WAT (D) and spleen (E) measured by AAS. All data are represented as mean SD. n = 3 4 mice. *p < 0.05.

PAGE 45

45 F igure 3 2. TM mediated ER stress increases hepatic zinc uptake measured by 65 Zn uptake Mice received 2 Ci of 65 Zn by oral gavage, which was followed by TM injection. Mice were sacrificed 12 h after TM administration. Radioactivity of liver (A), plasma (B ), pancreas (C), WAT (D) and kidney (E) was measured and divided by tissue weight. All data are represented as mean SD. n = 3 4 mice. *p < 0.05.

PAGE 46

46 Figure 3 3. TM mediated ER stress changes hepatic expression of multi ple zinc transporters inclu ding ZIP14 in mouse liver. (A and B) Relative expression of members of the ZIP family (A) and ZnT family transporter (B) genes in liver s of mice after administration of TM (2 mg/kg) or vehicle. (C and D) Time dependent expression of Zip14 mRNA (C) and immu noblot analysis of ZIP14 and markers of ER stress (D) in liver lysates after TM administration for the indicated times. All data are represented as mean SD. n = 3 4 mice. *p < 0.05, **p < 0.01, ***p < 0.001.

PAGE 47

47 Figure 3 4. TG mediated ER stress increase s zinc concentration s and ZIP14 expression in mouse liver. Mice wer e administered with TG (1 mg/kg) or vehicle for 6 h. (A) Hepatic zinc concentration m easured by AAS. (B) Immunoblot analysis of GRP78 and ZIP14 in liver lysates. All data are represented as mean SD. n = 3 4 mice. *p < 0.05.

PAGE 48

48 Figure 3 5 TM mediated ER stress increases total cellular zinc concentrations and ZIP14 expression in HepG2 hepatocytes. (A) Total cellular zinc concentrations were determined by measurement of fluorescence afte r incubation with FluoZin3 AM (5 M) following treatment with TM (1 g/ml) or vehicle. (B) Immunoblot analysis of ZIP14 and markers of ER stress in lysates of HepG2 cells after TM (1 g/ml) or vehicle treatment. All data are represented as mean SD. *p < 0.05.

PAGE 49

49 Figure 3 6. HFD mediated ER stress increases zinc concentration and ZIP14 expression in mouse liver. Mice were fed the HFD or a chow diet for 16 wk. (A) Hepatic zinc concentration of mice. (B and C) Relative gene expression of members of the ZI P family (B) or ZnT family (C) transporter in mouse liver. (D) Immunoblot analysis of ZIP14 from liver lysates of mice. All data are represented as mean SD. n = 4 mice, *p < 0.05.

PAGE 50

50 CHAPTER 4 DELINEATION OF SPECIFIC ROLE OF ZIP14 DURING ER STRESS Introd uctory Remarks To maintain zinc homeostasis, mammalian cells use 24 known zinc transporters that tightly control the trafficking of zinc in and out of cells and subcellular organelles. A number of physiological stimuli h ave been shown to regulate the expre ssion and fu nction of some of the se transporters. A blation of some of them results in various types of dyshomeostasis. For examp le, ZIP14 (SLC39A14), a zinc transporter abundantly expressed in liver, pancreas, and intestine, is upregulated in response to i nflammatory stimuli in mouse liver, which led to hepatic zinc accumulation and hypozincemia a component of the acute phase response ( 58 73 75 ) S ome zinc transporters have been shown to be associated with ER stress and the UP R pathway Administration of TM altered gene expression of multiple zinc transporters in mouse liver including ZnT3 ZnT5 ZnT7 Zip6 Zip7 Zip13 and Zip14 ( 79 ) These observations are supp o rted by the data in chapter 3 where expression of many zinc t ransporters including ZIP14 were altered (Figure 3 3) It has been shown that these ER stress responsive zinc transporters influence ER stress ad aptation. Indeed, TM induced ER stress was exacerbated in ZnT5 / ZnT7 / cells by limiting zinc transport into the secretory pathway ( 81 ) Knockdown of Zip13 in HeLa cells activated the UPR by trapping zinc in vesicles ( 63 ) These data imply that ER stress controls zinc metabolism via regulation of zinc transporters, and thus, dysfunctional zinc transporter activity may cause ER stress. Chronic ER stress is involved in th e development of various liver diseases such as hepatic steatosis, chronic viral hepatitis B and C, alcohol induced liver injury,

PAGE 51

51 hyperhomocysteinemia an d ischemia reperfusion injury ( 19 ) In particular, the development of hepatic steatosis has been shown to be highly associated with ER stress ( 9 ) Treatment with TM suppresses expr ession of genes involved in lipid synthesis such as Srebp1 c and Fasn Ablation of UPR pathway components results in development of hepatic steatosis in the TM administered mouse liver, indicating ER stress and UPR signaling are related to lipid homeostasis ( 29 ) In particular ER stress associated hepatic steatosis is associated with prolonged expression of CHOP, suggesting apoptotic cell death also influences the disturbed hepatic lipid homeostasis ( 29 30 ) PTP1B is a ubiquitously expressed protein phosphatase that is involved in multiple signaling pathways such as the insulin signaling pathway ( 84 ) Dysregulation of PTP1B has been implicated in ER stress. PTP1B expression was increased in ER stress induced by TM and HFD, and deletion of the protein in vivo and in vitro significantly reduced ER stress associated apoptosis and steatosis. ( 88 91 93 ) Using liver sp ecific Ptp1b KO mic e, it was demonstrated in vivo that PTP1B is a critical mediator of hepatic ER stress and UPR signaling as these mice exhibited significantly reduced level s of ER stress compared to wild type mice ( 93 ) In further study, the liver specific Ptp1b KO mice and CHOP, which are pro apoptotic components of UPR. This indicates that ablation of PTP1B can ameliorate ER str ess at least in the liver As zinc is a known inhibitor of PTP1B activity via bindin g to a specific site ( 75 96 ) there is a possibility that zinc mediated suppression of PTP1B may positively influence ER stress adaptation.

PAGE 52

52 Of interest is that ZIP14 mediated extra hepatic zinc uptake observed in chapter 3 (Figure 3 1A and 3 3D) may be critical to suppress ER stress induced apoptosis, as the enhanced hepatic ZIP14 expression after TM administr ation coincides with extra zinc uptake. The l iver is a site where increased zinc accumulation was o bserved after TM administration. Therefore, the purpose of the research reported in this chapter is to delineate a role for ZIP14 during TM and HFD induced ER stress. The e ffect of ZIP14 mediated zinc accumulation on PTP1B activity is also examined. To examine the specific role of ZIP14, the conventional Zip14 KO mouse model is primarily used. To support observations found in the mice HepG2 hepatocytes were transfected with Zip14 siRNA to knockdown Zip14 Results Zip14 KO Mice Do Not Display Hepatic ER Stress u nder Steady S tate C onditions This chapter aims to examine the potential role of ZIP14 during ER stress ZIP14 was focused on among zinc transporters b ecause ZIP14 is a major zinc importer of the liver, and the enhanced hepatic ZIP14 expression seen after TM administration coincided with extra zinc uptake (Figure 3 1A and 3 3D), which may suggest that ZIP 14 is responsible for the event Given that the he patic extra zinc uptake was followed by a marked suppression of CHOP, a pro apoptotic UPR protein (Figure 3 3D), a hypothesis was produced that ZIP14 mediated extra hepatic zinc uptake is critical to suppress ER stre ss induced apoptosis. To test the hypoth esis conventional Zip1 4 KO mice were used. Consistent with chapter 3, hepatic ZIP14 expression was markedly elevated following TM administration ( Figure 4 1A). Under steady state conditions liver s of Zip14 KO mice did not show any indices of UPR activati on such as enhanced expression of GRP78, GRP94 or CHOP compared to WT mice (Figure 4 1B D).

PAGE 53

53 Zip14 KO Mice D isplay Impaired Zinc U ptake d uring TM Induced ER S tress Zip14 KO mice have been shown to display an impaired hepatic zinc uptake ( 73 ) As expected, following TM ad ministration, Zip14 KO exhibited significantly less hepatic zinc upta ke compared to WT mice (Figure 4 2A ). After 12 h of TM administration zinc concentration s of Zip14 KO mice were ~78% compared to that of WT. R adioactivity measurements after 65 Zn adminis tration also showed impaired hepatic zinc uptake in Zip14 KO mice during ER stress (Figure 4 2B ). C onsistent with C hapter 3, no difference in 65 Zn level was observed in other tissues including pancreas, kidney, and WAT (Figure 4 2D F), further supporting t he rationale to focus on the liver Since ZIP14 can contribute to uptake of manganese and non transferrin bound iron under certain circumstances the hepatic concentration of these metals after TM administration was measured. The level of the non heme iron (NHI) and manganese were comparable between WT and Zip14 KO mice during TM challenge, indicating compared with iron and manganese, zinc is the only metal of which hepatic concentration is different in this setting (Figure 4 3A and B). Zip14 KO Mice D ispl ay Higher Apoptosis during TM Induced ER S tress Next, expression of UPR pathway components including pro apoptotic pathway proteins (p ATF4 and CHOP) and adaptation pathway proteins (GRP78 and GRP94) were examined to determine how the KO mice responded to ER stress. Immunoblot analysis of WT mice showed a marked suppression of pro apoptotic pathway p roteins after 24 h TM (Figure 4 4A ). Compared to WT mice Zip14 KO mice displayed greater expressions of p eIF analysis showed that ATF4 and CHOP expression were respectively ~2.6 fold, and ~2 fold higher in Zip14 KO mice. TUNEL assay in mouse liver se ctions showed a significantly

PAGE 54

54 greater number of TUNEL positive cells in Zip14 KO compared to WT (~2.3 fold), indicating that Zip14 KO experienced higher levels of apopt osis during ER stress (Figure 4 4B ). S erum ALT levels were also higher in Zip14 KO after TM (~2.5 fold) indicating greater liver damage (Figure 4 4C ), which perhaps was caused by increased apoptosis. GRP78 and GRP94 are ER chaperones induced by UPR during ER stress to assist in protein folding. Zip14 KO mice express ed significantly less GRP9 4 compared to WT mice (~ 0.6 fold) (Figure 4 4A ), which may indicate impaired ER protein folding In HepG2 cells, higher expression of ATF4 (~4.5 fold) and CHOP (~ 2 fold) and less expression of GRP94 (~ 0.5 fold) were also observed after TM treatment whe n Zip14 was knocked down ( Figu re 4 6 C first 4 lanes ). T he q uality of Zip14 knockdown using siRNA trans f ection was ~90% (Figure 4 6 A ). To direct ly test the effect of zinc, it was examined if dietary zinc supp lementation could ameliorate the extensi ve ER s tress induced apoptosis shown in Zip14 KO mice. WT and Zip14 KO mice were fed either a zinc adequate diet (ZnA; 30 mg Zn/kg diet) or a zinc supplemented diet (ZnS; 180 mg Zn/kg diet) for 2 wk, after which mice were injected with TM (2 mg/kg) for 24 h. Howe ver, ZnS fed Zip14 KO mice did not show any reduction in pro apoptoti c protein expression (Figure 4 5 ). Although the re sult was different from what was initially hypothesized this evidence was not enough to conclude that zinc does not influence the ER str ess induced apoptosis. This may be because additional zinc could not be taken up into the liver without ZIP14, a major liver zinc transporter. To overcome this, an in vitro experiment was conducted where we knocked down Zip14 and then supplemented zinc ac etate alo ng with pyrithione a zinc ionophore. Pyrithione was added to improve cellular zinc access under these in vitro

PAGE 55

55 condition s TM treated Zip14 knockdown cells showed ~24% less cellular zinc level compared to its control, when it was measured by Fluo Zin3 AM (Fi gure 4 6B ). To determine an optimal zinc supplementation condition, we tested various doses of zinc acetate ranging from 2.5 M to 20 M. When more than 5 M of zinc acetate were added along with pyrithione, TM treated Zip14 knock down cells exhi bited a similar level of cellular zinc based on FluoZin 3 fluorescence, to that of TM treated control cells (Figure 4 6B ). Thus 5 M of zinc acetate was used afterwards to model zinc supplementation In response to TM, zinc supplemented Zip14 knockdown ce lls expressed markedly reduced expression of ATF4 (~41%) and CHO P (~37%) proteins compared to non zinc supplemented Zip14 knockdown cells (Figure 4 6C ). After supplement ation, ATF4 and CHOP expression in Zip14 knockdown cells were not significantly differe nt from control cells. In addition, expression of GRP94 was increased (~1.9 fold) after zinc supplementation in Zip14 knockdown cells. The decrease in cell viability shown in TM treated Zip14 knockdown cells was ameliorated by zinc supplementation (Figure 4 6D and E ). Collectively, these data indicate that supplementation of zinc prevents the severe ER stress shown in the Z IP14 ablated condition, demonstrating a direct effect of zinc on preventing ER stress induced apoptosis. Zip14 KO Mice Show a Greater L evel of H epatic Steatosis during TM I nduced ER S tress Prolonged ER stress in the liver has been linked to the occurrence of hepatic steatosis, and may result from damage after the UPR fails to restore ER protein folding homeostasis. Therefore, lip id hom eostasis in Zip14 KO mice was examined during TM challenge Greater levels of lipid droplet accumulation in Zip14 KO mice were observed

PAGE 56

56 in H&E staining of liver section s after TM admin istration (~1.9 fold) (Figure 4 7A ). Qua ntification of triglyceride s in the liver also showed that the Zip14 KO mice accumulated significantly higher level s of triglyceride compa red to WT (~1.8 fold) (Figure 4 7B ). As hep atic lipid homeostasis is mostly maintained by four mechanisms including de novo fatty acid (FA) synthesis, FA oxidation, FA uptake into the liver and lipoprotein secretion from the liver expression of genes of key enzymes in the se mechanisms were measured to elucidate where lipid metabolism is dysregulated in Zip14 KO mice After TM administration, gene s inv olved in de novo FA synthesis such as Srebp1c Acc Fasn and Scd1 were significantly suppressed in WT mice (Figure 4 7C ). Expression levels of Srebp1c Fasn and Scd1 were reduced ~60%, ~85%, and ~74% respectively. In the same setting, Zip14 KO mice show ed reduced gene expressions of Srebp1c Acc Fasn and Scd1 which were ~2.5 fold, ~2.2 fold, ~3.2 fold, and ~4 fold higher than WT, respectively, indicating FA synthesis in Zip14 KO mice is higher during ER stress. There was no significan t difference in g ene expression related to other pathways of lipid metabolism including FA oxidation, FA uptake, and lipoprotein secretion (Figure 4 7D ). Collectively, these data suggest that Zip14 KO mice have higher level s of ER stress mediated hepatic steatosis due to g reater FA synthesis. Zip14 KO Mice Display Impaired Hepatic Zinc Accumulation, which Coincides with Higher Apoptosis and Hepatic Steatosis during HFD Induced ER S tress To investigate the effects of ER stress in Zip14 KO mice in a more physiologically rele vant setting, indices of ER stress that were measured in the TM model were analyzed after feeding WT and Zip14 KO mice with a HFD (60 kcal% fat) or chow diet (12 kcal% fat) for 16 wk As shown in C hapter 3, h epatic zinc concentration s in HFD fed WT mice we re ~17% higher compared to chow fed WT mice, indicating that HFD

PAGE 57

57 inc reases zinc level s in the liver However, hepatic zinc levels in HFD fed Zip14 KO mice were unchanged compared to chow fed Zip14 KO mic e (Figure 4 8A), possibly due to impaired zinc uptake In ac cordance with a previous report ( 9 ) both genotypes showed UPR activation in response to HFD feeding which was validated by elevated protein levels of UPR components including p CHOP, GRP78 and GPR94 (Figure 4 8B ). However, HFD fed Zip14 KO mice expressed greater level s of pro apoptot ic p (~2.1 fold), ATF4 (~4 fold) and CHOP (~3 fold) compared to HFD fed WT mice indicating that ablation o f Zip14 worsens ER stress associated apoptosis in this setting. Similar to the TM administration model, HFD fed Zip14 KO mice expressed a lower level of GRP94 than HFD fed WT mice (~0.5 fold). Regarding steatosis, hepatic TG accumulation after HFD feeding was ~42% higher in Zip14 KO mice, although it was not stat istically significant (Figure 4 8C ). This observation coincided with significantly higher mRNA expressions of Srebp1c (~1.7 fold), Fasn (~1.8 fold), and Scd1 (~1.9 fold) (Figure 4 8D ), suggesting a greater level of FA synthesis during HFD in Zip14 KO mice. These results from the HFD model support the hypothesis that ZIP14 med iated zinc uptake is critical for suppress ing ER stress induced apoptosis and hepatic steatosis. Increased PTP1B Activity is O bserved in Zip14 KO Mice during ER S tress The n ext research aim was to elucidate the possible mechanism underlying the phenotypes shown in ER stress induced Zip14 KO mice. PTP1B, a protein phosph atase that regulates several pathways such as the insulin sig naling pathway, has been implicated in ER stress. PTP1B expression was increased in ER stress induced by TM and HFD. D eletion of the protein in vivo and in vitro significantly reduced ER stress associated apoptosis and steatosis. ( 88 91 93 ) As zinc is a known non competitive

PAGE 58

58 inhibitor of PTP1B activity via binding to a specific site ( 75 96 ) a hypothesis was produced that Zip14 KO mice would exhibit increased P TP1B activity during ER stress du e to impaired zinc uptake, thereby resulting in greater apoptosis and steatosis. In agreement with previous reports, knockdown of Ptp1b in HepG2 hepatocytes resulted in significantly reduced expression of p compared to control cells, suggesting suppression of PTP1B reduces ER stress induced apoptosis (Figure 4 9A). This was supported by measurement of cell viability using the MTT assay During TM treatment Ptp1b knockdown cells displayed higher cell viability than control cells (Figure 4 9B). A lthough Zip14 KO mice expressed less PTP1B expression than WT (~0.6 fold), their PTP1B activity was not di fferent ( Figure 4 10A and C ). Following TM administration, hepatic PTP1B expression was increased in both WT and Zip14 KO mice, and the expression levels were not statistically different betwe en the two genotypes. (Figure 4 10A ). However, measurement of PT P1B activity revealed a significantly higher level of PTP1B activity in Zip14 KO mice compared to W T (~1.7 fold) (Figure 4 10B ). T he s ame pattern was observed in the HFD model. PTP1B activity was significantly greater in HFD fed Zip14 KO mice compared to H FD fed WT (~1.5 fold), although the protein levels were similar between HFD fed WT mi ce and HFD fed KO mice (Figure 4 10C and D). In vitro studies were conducted to te st a direct effect of zinc on PTP1B activity HepG2 hepatocytes were transfected with Zi p14 siRNA or control siRNA, t hen an established zinc supplementation protocol (Figure 4 6B) was used to treat cells either with or without concurrent TM treatment. Similar to in vivo results, cells lacking Zip14

PAGE 59

59 show ed significantly higher PTP1B activity i n response to TM treatment than cont rol cells (~1.5 fold) (Figure 4 6F ). However, the increased PTP1B activity was significantly reduced with zinc supplementation. No additional effect of zinc supplementation was observed in TM treated control cells. Colle ctively, these data suggest that normal cells suppressed PTP1B activity during ER stress by facilitating extra zinc via ZIP14 induction, whereas the Zip14 zinc uptake altered this process This could be a potential mechanism underlying z inc mediated adaptation against ER stress. Discussion The major finding reported in this chapter wa s that ZIP14 mediated hepatic zinc accumulation provides a beneficial effect in suppressing suppress apoptosis and steatosis induced by ER stress. In respon se to ER stress, Zip14 KO mice expressed greater levels of CHOP as well as its upstream modulat ors, p 4 4A ). This was confirmed with greater numbers of TUNEL positive cells in Zip14 KO mice (Figure 4 4B ). Additionally, i n Zip14 knoc kdown HepG2 cells, supplementation of zinc could reverse the higher expression of pro apoptotic proteins and co rresponding cell death (Figure 4 6D and E ), demonstrating a direct effect of zinc on ER stress induced apoptosis. As prolonged apoptosis causes m any pathogenic disorders suppression of p TF4/CHOP pathway is important for adapting to ER stress. In particular, suppression of CHOP, a downstream effector o f the pro apoptotic pathway, could be a therapeutic target that leads to ER stress adaptation. This was illustrated in an experiment using Chop KO mice where the genotype exhibited an apoptosis resistant phenotype in response to ER stress. These data collectively demonstrate that ZIP14 mediated hepatic zinc uptake influences the p which apopt osis is suppressed.

PAGE 60

60 A p otential direct target of zinc that influences the p F4/CHOP pathway was examined. In this chapter, the data suggests that zinc can modulate the p /ATF4/CHOP pathway, possibly thr ough suppression of PTP1B. This enzyme i s an ER resident protein tyrosine phosphatase which regulate s various pathways including insu lin and leptin signaling ( 110 ) D ys regulation of PTP1B activity was demo nstrated to contribute to the pathogenesis of various disea ses such as cancer and diabetes. Furthermore, there has been a significant effort to develop PTP1B inhibitor s as drug target s ( 111 ) Additionally, PTP1B has been implicated in ER stress ( 112 ) Since ER stress increases PTP1B expression, its deletion was effective at improving ER stress adaptation ( 91 ) In vitro Ptp1 b knockdown in fibroblasts made them more resistant to ER stress induced apoptosis ( 88 ) I n vivo liver specific Ptp1b KO mice showed decreased expression of the p e indexes of metabolic syndrome during TM and HFD induced ER stress ( 91 93 ) Although it is still unclear how inhibition or deletion of PTP1B can directly inhibit ER stress induced apoptosis these report s strongly suggest that suppression of the activity of PTP1B can be a therapeutic target to overcome ER stress. Z inc is a known inhibitor of PTP1B by physically binding to it ( 96 ) It has been reported that overexpression of ZIP14 in AML12 hepatocytes could suppress PTP1B activity ( 75 ) Based on these reports, a hypothesis was produced that ER stress induced mice would increase hepatic ZIP14 expression in order to suppress PTP1B activity by facilitating additional zinc uptake. In response to TM administration and HFD feeding, PTP1B protein ex pression was increased (Figure 4 10A and C ). However, only Zip14 KO mice showed signif icantly elevated PTP1B activity whereas the activity of WT mice remained

PAGE 61

61 unchanged (Figure 4 10B and D). The d irect effect of zinc on PTP1B activity in Zip14 knockdown HepG2 cells was demonstrated using zinc supplementation (Figure 4 10F ). However, further investigation will be required since these data are still observational. Although knockdown of Ptp1b reduced apopt osis in hepatocytes (Figure 4 9), i t would be interesting if zinc supplementation could suppress the ER stress response if PTP1B was overexpressed. Apoptosis could also be potentiated with Zip14 ablation due to lack of GRP94 expression during ER stress. GR P94, a n ER chaperone, binds to misfolded proteins and assists in their appropriate folding ( 113 ) Deletion of GRP94 has been shown to potentiate ER stress ( 114 ) Zip14 KO mice did not express GRP94 at the level s shown in W T mice (Figure 4 4A and 4 8B ). Supplementation of zinc in Zip14 knockdown cells increased GRP94 expre ssion after TM treatment (Figure 4 6C ), indicating impaired zinc uptake obstructed the induction of GRP94 The proteomic profile analy sis revealed that zinc supplemented pigs (2425 mg zinc/kg) had increased pancreatic GRP94 expression ( 115 ) Alth ough additional research is needed, it is possible that zinc modulate s GRP94 expression, or that GRP94 may require zinc as a cofactor like other ER folding proteins such as Calreticulin and Calnexin ( 116 117 ) Disrupted hepatic lipid homeostasis is another feature of unres olved ER stress. This has been observed in cells with compromised UPR function. Genetic ablation of the of hepatic steatosis ( 118 ) Loss of ATF4 increased free cholesterol in rodent liver s ( 119 ) and liver specific deletion of XBP1 produced hypocholesterolemia and hypotriglyceridemia ( 31 ) Similarly liver s of Zip14 KO mice showed potentiated triglyceride accumulation after TM administration (Figure 4 7 A and 4 7 B). Hepatic

PAGE 62

62 steatosis in Zip14 KO mice resulted from higher expression of genes involved in de n ovo FA synthesis including Srebp1c Acc Fasn, and Scd1 (Figure 4 7 C), as there was no significant difference in gene expression involved in FA oxidation, FA uptake, and lipoprotein secretion between KO and WT mice (Figure 4 7 D). This is different from oth er ER stress associated hepatic steatosis models such as the KO mouse in which dysregulation of FA oxidation and lipo protein secretion caused increased lipid accumulation ( 29 ) Similar to apoptosis, z inc mediated PTP1B suppression may explain the cause of hepatic steatosis in Zip14 KO mice since liver specific Ptp1b KO mice showed improved lipid metabolism during HFD feeding compared to WT mice ( 93 ) Ptp1b KO mice exhibited markedly less expression of Srebp1c Fasn and Acc All of these were increased in TM injected, and HFD fed Zip14 KO mice in report from the experiments in this dissertation Thus, Z IP14 mediated z inc uptake is required to suppress FA synthesis during ER stress possibly through inhibition of PTP1B activity.

PAGE 63

63 Figure 4 1. Zip14 KO mice do not show hepatic ER stress under steady state conditions (A) Immunoblot analysis of ZIP14 from liver lysates o f WT and Zip14 KO mice 12 h after TM (2mg/kg) or vehicle administration (B and C) Relative gene expression of Grp78 (B) and Chop (C) in liver of WT and Zip14 KO mice under steady state. (D) I mmunoblot analysis of ZIP14 and markers of ER stress in liver ly sates of WT and Zip14 KO mice under steady state. All data are represented as mean SD. n = 3 4 mice.

PAGE 64

64 Figure 4 2. Zip14 KO mice display impaired hepatic zinc uptake during TM induced ER stress. (A) Hepatic zinc concentration s measured by AAS in mice after administration of TM (2mg/kg) or vehicle for up to 24 h. (B F) Mice received 2 Ci of 65 Zn by gavage, which was followed by TM (2mg/kg) injection. Mice were sacrificed 12 h after TM administration. 65 Zn uptake in mouse liver (B), plasma (C), pancreas (D), kidney (E) and WAT (F). All data are represented as mean SD. n = 3 4 mice. *p < 0.05. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 65

65 Figure 4 3. Hepatic concentration of NHI and manganese are comparable between WT a nd Zip14 KO mice during TM challenge. WT and Zip14 KO mice were administered with TM (2mg/kg) or vehicle for 12 h, and were sacrificed. (A) Hepatic NHI concentrations were analyzed colorimetrically. (B) Hepatic manganese concentrations were measured by AAS All data are represented as mean SD. n = 3 4 mice.

PAGE 66

66 Figure 4 4. Zip14 KO mice display increased apoptosis during TM induced ER stress. (A) Immunoblot analysis of ER stress markers from liver lysates of WT and Zip14 KO mice (n= 3 4, pooled samples ) after administration of TM (2mg/kg) Individual blots (24 h after TM, n = 4) were measured using digital densitometry. (B ) Representative images of TUNEL assay s of liver sections of WT and Zip14 KO mice 24 h after administration of TM (2mg/kg) or vehicle TUNEL positive cells in field were quantified. Images are at 40X magnification; bars = 25 m (F) Serum ALT activity of WT and Zip14 KO mice 24 h after administration of TM (2mg/kg) or vehicle (n = 3 4). All data are represented as mean SD. *p < 0.05. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 67

67 Figure 4 5. Dietary zinc supplementation does not reduce the hepatic expression of pro apoptotic proteins in Zip14 KO mice. WT and Zip14 KO mice were fed either with zinc adequate d iet (ZnA; 30 mg Zn/kg diet) or zinc supplementation diet (ZnS; 180 mg Zn/kg diet) for 2 wk, after which mice were injected with TM (2 mg/kg) for 24 h. Immunoblot analysis of ER stress markers from liver lysates of WT and Zip14 KO mice (n= 4, pooled samples ) after administration of TM (2mg/kg)

PAGE 68

68 Figure 4 6. Zinc supplementation rescues ER stress mediated apoptosis in Zip14 knockdown hepatocytes. (A) Relative expression of Zip14 mRNA in HepG2 hepatocytes transfected with Zip14 siRNA or control siRNA (B E ) HepG2 cells were incubated for 30 min with zinc acetate and pyrithione (50 M), which was followed by incubation with TM (1 g/ml) or vehicle. (B) Total c ellular zinc concentrations were determined by measurement of fluorescence after incubation with Flu oZin3 AM (5 M). ( D and E ) Cell viability was measured using the MTT assay. All data are represented as mean SD. *, # p < 0.05. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 69

69 Figure 4 7. Zip14 KO mice exhibit a greater level of hepatic triglyceride accumulation after TM induced ER stress. (A) Representative images of H&E stained liver sections of WT and Zip14 KO mice 24 h after administration of TM (2mg/kg) or vehicle. The lipid droplet area in the field was measured Images are at 10X magnification; bars = 100 m. (B) Liver triglyceride levels of WT and Zip14 KO mice were measured 24 h after administration of TM (2mg/kg) or vehicle (n = 3 4). (C and D) Relative expression of genes that regulate FA synthesis (C), FA oxidation, FA uptake, and lipoprotein secretion (D) were measured in livers of WT and Zip14 KO mice 12 h after administration of TM (2mg/kg) or vehicle (n= 3 4). All data are represented as mean SD. Labeled means without a common letter differ signific antly (p < 0.05).

PAGE 70

70 Figure 4 8. HFD fed Zip14 KO mice show greater hepatic ER stress induced apoptosis and triglyceride accumulation. Mice were fed the HFD or a chow diet for 16 wk.(A) Hepatic zinc concentration of WT and Zip14 KO mice (n = 4). (B ) Immu noblot analysis of ER stress markers from liver lysate s of WT and KO mice (n = 4, pooled samples used). Individual blots (HFD, n = 4) were measured using digital densitometry. (C) Liver triglyceride levels were quantified in WT and Zip14 KO mice (n = 4). ( D ) Relative expression of genes that regulate FA synthesis were measured in livers of WT and Zip14 KO mice (n = 4). All data are represented as mean SD. *p < 0.05. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 71

71 Figure 4 9. ER stress induced apoptosis is reduced in Ptp1b knockdown hepatocytes. HepG2 hepatocytes were transfected wit h Ptp1b siRNA or control siRNA, which was followed by incubation with TM (1 g/ml) or vehicle for 24 h. (A) Immunoblot analysis of PTP1B and ER stress markers from cell lysates. (n = 3, pooled samples used). Individual blots (n = 3) were measured using digital densitometry. (B) Cell viability was measured using the MTT assay. All data are represented as mean SD. *p < 0.05. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 72

72 Figure 4 10 ZIP14 is required to suppress hepatic PTP1B activity after TM administration and HFD (A and B) Immunoblot analysis of PTP1B protein (A) and measurement of PTP1B activity (B) in livers of WT and Zip14 KO mice 12 h after administration of TM (2mg/kg) or vehicle (n = 3 4, pooled samples used for panel A). (C and D) Immunoblot analysis of PTP1B protein (C) and measurement of PTP1B activity (D) in livers of WT and Zip14 KO mice fed with HFD or Chow for 16 wk (n = 4, pooled samples used for panel C). (E and F) Immunoblot analysis of PTP1B protein (E) and measurement of PTP1B activity (F) in HepG2 hepatocytes transfected with Zip14 siRNA or control siRNA. Cells were pre treated with zinc acetate ( 5 M) and pyrithione (50 M) for 30 min before TM (1 g/ml) treatment for 12 h All data are represented as mean SD. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 73

73 Figure 4 11. Proposed model for ZIP14 mediated zinc transport an d inhibition of PTP1B activity.

PAGE 74

74 CHAPTER 5 IDENTIFICATION OF THE TRANSCRIPTION FACTOR(S) THAT REGULATE ZIP14 EXPRESSION DURING ER STRESS Introductory Remarks UPR activation induces a variety of genes involved in protein folding, degradation, and trafficki ng to restore ER homeostasis via activation of transcription 1 ( 12 ) For example, genes such as Grp78 Grp94 and P rotein disulfide isomerase ( Pdi ) are transcriptionally up regulated by ATF6 and XBP 1 during the UPR activation ( 120 ) In the pro apoptotic pathway of the UPR, ATF4 transcriptionally up regulates Chop mRNA expression ( 121 ) In chapter 3, it was demonstrate d that Zip14 gene expression is significantly elevated by TM administration in mouse liver and HepG2 hepatocytes (Figure 3 3 and 3 5 ). Previous reports that performed global transcriptional profiling suggest that Zip14 is one of the genes targeted by trans cription factors involved in UPR signaling. RNA sequencing data from liver specific Atf4 KO mice showed significantly reduced Zip14 mRNA induction by T M administration in the se KO mice compared to WT mice ( 119 ) S imilar ly RNA sequencing analysis from isolated Atf KO fibroblasts showed no induction of Zip14 mRNA in response to TM treatment ( 122 ) These data suggest that the transcription factors ATF4 and/or up reg ulate Zip14 mRNA during TM treatment. T he purpose of the research reported in this chapter is to identify the transcription factor(s) that regulate Zip14 gene expression during TM induced ER stress. For efficie nt gene manipulation, HepG2 hepatocyte s were used for these experiments. This chapter will focus on identification of transcriptional regulation of the Zip14 gene by TM treatment and analysis of the Zip14 promoter region in order to find

PAGE 75

75 affinity to the Zip14 promoter region was examined using ChIP PCR. Results Zip14 mRNA Expression is Regulated at Transcriptional Level during TM T reatment Dur ing TM treatment of the HepG2 cells mRNA expression of Zip14 was increased in dose de pendent manner, and treatment with actinomycin D (Act D), a transcription inhi bitor, suppressed its induction (Figure 5 1A). This indicated that Zip14 induction is likely regulated at the transcriptional level This was supported by the time dependent increases in both Zip14 mRNA and Zip14 hnRNA, a pre mRNA present before splicing. Their similar expression patterns following TM treatment (Figure 5 2B), demonstrated transcr iptional regulation of Zip14 mRNA by TM. Zip14 is Transcriptionally R egula ted by ATF4 and ATF6 during TM T reatment the cAMP response Element (CRE) seque nce (TGACGT(C/A)(G/A)) (Figure 5 2A ) Matinspector software analysis revealed that the Zip14 promoter has a strong potential binding site 94 to 89, which matches wi th the core motif of the CRE (Figure 5 2B ). This sequence was conserved in mouse and human Zip14 HepG2 cells were transfected with either Atf4 or siRNA to determine which transcription factor was responsible for Zip14 upregulation (Figure 5 3A and B ). Knockdown of Atf4 resulted in significantly reduced Zip14 induction both 6 h and 24 h after TM t reatm ent (Figure 5 3C ), whereas knockdown of reduced induction only 2 4 h after TM treatment (Figure 5 3E ). This suggests that Zip14 may be a time dependent regulation To ensure actual binding of transcriptio n factors to

PAGE 76

76 the potential binding site of the Zip14 promoter, ChIP PCR was conducted Detection of DNA enrichments revealed that ATF4 highly bound 6 h after TM treatment, then the binding w as reduced thereafter (Figure 5 3D ). However, enhanced binding of w as only detected 24 h after TM (Figure 5 3F ). Western blotting showed that ATF4 expression was induced until 12 h after TM treatment and then decreased by 24 h (Figure 5 4A ). This may account for the time dependent regulation of Zip14 by ATF4 and A bind after ATF4 expression is reduce d (Figure 5 4B) These data demonstrated that Zip14 induced ER stress. Discu ssion UPR activation induces a variety of genes involved in restoring ER homeostasis via the activation of 1 ( 12 ) The data in the current chapter indicates that one aim of UPR pathwa y is to modulate zinc metabolism based on the finding that Zip14 is a transcriptional ta rget of ATF4 and 4B significant bindi ng affinity to the TGACGTGA ( 123 125 ) The Zip14 promoter has a CRE TGACGcGc) (Figure 5 2A) and it was demonstrated that b oth ATF4 CRE like sequence after TM treatment in a time dependent manner leading to production of Zip14 transcripts The se data confirm the observation from previous global transcriptional profiling which showed significantly reduc ed Zip14 gene expression after TM treatment in liver specific Atf4 KO mice ( 119 ) and in KO fibroblasts ( 122 ) The ATF4 mediated Zip14 gene modulation may indicate that the UPR aims to increase cellu lar zinc availability through this transcriptional mechanism This is supported by a previous report where XBP 1 mediated h ZnT5

PAGE 77

77 upregulation was demonstrated during ER stress via direct binding to its promoter ( 81 ) As ZnT5 is a zinc importer that provides zinc into the early secretory pathway, the upregulation of ZnT5 through the UPR pathway implies an increased zinc requirement in the ER during ER stress. I mpaired hepatic GRP94 expression during ER stress shown in Zip14 KO mice (Figure 4 4A and 4 8B ) support s this notion, sugg esting functional zinc transporter activity is required for complete induction of UPR targets. Although further investigation is required, GRP94 m ay be an enzyme regulated by zinc or the zinc responsive transcription factor, MTF 1 Similar to the regulation of z inc transporter s such as Zip14 and ZnT5 it has been reported that ER stress transcriptionally up regulates h epcidin, which is a master regulator hormone for iron metabolism ( 101 ) CREBH has been shown to bind to the Hepcidin promoter region, cau sing iron accumul ation in mouse liver and spleen. Indeed, Crebh KO mice did not induce Hepcidin mRNA expression following TM administration. Of note is that the Zip14 promoter lacks the sequence required for the CREBH binding, therefore CREBH mediated Zip 14 regulation w as not examined in this project.

PAGE 78

78 Figure 5 1. Up regulation of Zip14 mRNA by TM treatment is regulated at the transcriptional level in hepatocytes. (A) Relative expression of Zip14 mRNA in HepG2 hepatocytes treated with TM (1 g/ml) and /or a ctinomycin D (2 g/ml) for 12 h. (B) Relative expression of Zip14 mRNA and hnRNA in HepG2 hepatocytes treated with TM (1 g/ml) or vehicle

PAGE 79

79 Figure 5 2. The Zip14 promoter contains a CRE sequence, a potential binding site for (A ) Consensus motif of CRE and bin ding motifs of ATF4 and ATF6. (B ) The sequence of mouse and human Zip14 promoter region s (from 120 to +1). Identical nucleotides are indicated by an asterisk T he TGACG sequence (from 94 to 89) is marked by a box.

PAGE 80

80 Figure 5 3. Zip14 is transcriptionally regulated by ATF4 and ATF6 during TM treatment in hepatocytes. HepG2 hepatocytes were transfected with control siRNA, Atf4 siRNA (A, C, E) or Atf6 (B, D, F) siRNA. (A and B) Relative expression of Atf 4 (A) and Atf6 mRNA (B) after siRNA transfection (C and E ) Relative expression of Zip14 mRNA in TM treated HepG2 cells (1 g/ml) after transfection with control siRNA, Atf4 siRNA (C ), or Atf6 siRNA (E ). (D and F ) Enr ichment of DNA bound to the ATF4 anti body (D ) or the ATF6 antibody (F ) were measured by qPCR after ChIP assays in TM treated HepG2 cells (1 g/ml) Non specific rabbit IgG antibody was used as a negative control. All data are represented as me an SD. *p < 0.05, **p < 0.01.

PAGE 81

81 Figure 5 4. T ime dependent regulation of Zip14 Immunoblot analysis of ATF4 and full length and cleaved ATF6 in TM treated HepG2 cells (1 g/ml). (B) Proposed model for time dependent regulation of Zip14 by ATF4 and ATF6 during earlier and later ER stress. T he T GACG sequence, a binding site for ATF4 and ATF6 is marked with red

PAGE 82

82 CHAPTER 6 DETERMINATION OF THE IMPACT OF ZINC DEFICIENCY ON ER STRESS IN VIVO Introductory Remarks Systemic zinc deficiency has been associated with a number of human disorders such as growth retardation, immune deficiencies, dermatitis, sexual immaturit y and neurodegenerative disorders ( 100 ) Furthermore, z inc deficiency has been implicated in ER stress. Zinc restriction mediated by treatment of cells with a cell permeable zinc chelator, TPEN, induce s ER stress and results in activation of the UPR in some eukaryotic cell lines and yeast ( 78 79 ) In HeLa cells, zinc deficiency in the cytosol and other organel les induced by knockdown of Zip13 which transports vesicular zinc to the cytosol has been shown to cause ER stress ( 63 ) I t has also been demonstrated that hepatic zinc deficiency mediated by chronic ethanol expos ure in rats triggered ER stress mediated apoptotic cell death ( 80 ) However it has not been established if consumption of a zinc deficient diet can induce ER stress in an in vivo model. Furthermore, the impact of dietary zinc on apoptotic cell death and other insults caused by ER stress is unclear In order to obtain answers to these questions, the purpose of this chapter is to determine the impact of dietary zinc deficiency on ER stress in vivo To examine this q uestion mice were fed either a zin c deficient, zinc adequate or zinc supplementation diet for 2 weeks, then TM was administered to model ER stress. This chap ter will focus on indices of ER stress including apoptosis and hepatic steatosis in mice fed diets that supply low, adequate or supplemented amounts of zinc In addition, activity of PTP1B was measured in this setting since previous chapters have presented data indicating that zinc mediated PTP1B inhibition is important for ER stress adaptation.

PAGE 83

83 Resul ts No Activation of UPR in Mice F ed ZnD M ice were fed ZnD ( <1 mg Zn/kg diet) or ZnA ( 30 mg Zn/kg diet) for two weeks. During the dietary zinc manipulation period, there was no statistical difference in week ly food intake (Figure 6 1A) or net body weight ch ange (Figure 6 1B) among groups. After two weeks of the controlled zinc intake period, mice fed ZnD displayed significantly decreased levels of serum, liver, and pancreatic zinc compared to those of ZnA mice, demonstrating ZnD triggered systemic zinc deple tion in the mice (Figure 6 2 A). As the liver and pancreas are highly affected by ER stress, gene and protein expression of GRP78 and CHOP, which are common markers of UPR activation, were analyzed in these two organs. In general, ER stress leads to inducti on of GRP78 and CHOP through UPR activation ( 11 ) However, no dif ference in expression of GRP78 or CHOP mRNAs was observed in the tissues of mice fed ZnD (Figure 6 2 C, E G ). CHOP protein expression was not detected by immunoblot in either tissue since the protein is only expressed during ER stress. GRP78 protein was not different. These results indicate that diet mediated zinc deficiency is not a factor that causes ER stress in a mouse model, unlike previously reported in vitro experiments that modeled zinc deficiency using a TPEN treatment ( 78 79 ) Although zinc deficiency mediated by the ZnD diet did not cause differences in markers of ER stress in mice, it is possible that zinc might play a role dur ing induced ER stress. Thus the next research aim was to investigate the response of the liver to pharmacologically induced ER stress when the zinc content of the diet was varie d After two w ee ks, the levels of serum zinc and liver zinc (Figure 6 3A) reflected the amount of dietary zinc provided to each gr oup. Following the TM injection, extra zinc was

PAGE 84

84 accumulated in t he liver during (Figure 6 3A), which was c onsistent with obser vations in the C hapter 3. However, the level of extra zinc uptake during the TM challenge followed the dietary zinc level. The ZnS group had a significantly greater level of extra hepatic zinc accumulation by 48 hour after the TM was administered, whereas the ZnD group displayed a delayed accumulation by 12 h after TM administration. Dietary Zinc is E ssential for Suppression of ER Stress Induced A poptosi s by Regulating t he Pro A poptotic p eIF2 /ATF4/ CHOP P athway To examine whether diet ary zinc content influences adaptation to ER stress markers of the UPR were analyzed. In comparison to ZnA group mice fed ZnD diet expressed greater levels of p eIF2 ATF4, and CHOP, especially later in the TM c h allenge (24 h and 48 h) (Figure 6 3B and C ). To the contrary, mice fed ZnS diet showed less expression of those proteins. Expression of GRP78 and GRP94 tended to increase in the ZnD group, suggesting that requirement for ER chaperones might be enhanced in the ZnD group in order to help maintain protein folding. To confirm the western blot data, the extent of apoptosis was evaluated using the TUNEL assay in sectioned liver tissue (Fig ure 6 4 A). Consistent with pro apoptotic protein expression patterns, grea ter amounts of T UNEL positive cells were observed in mice fed ZnD during the TM challenge compared to those fed ZnA and ZnS. There was no difference in TUNEL positive cells between ZnA and ZnS groups Taken together, these observations suggest that adequat e dietary zinc is required for suppression of ER stress mediated apoptotic cell death via modulation of the pro apoptotic p eIF2 CHOP pathway.

PAGE 85

85 Dietary Zinc is Essential for Suppression of ER Stress I nduced S teatosis ER stress has been shown to cause hepatic steatosis and tissue damage ( 29 32 ) To test for the accumulation of lipid d roplets in mice, liver sections were stained with H&E. Lipid droplets were more abundant in mice fed ZnD diet in response to TM compared to those fed ZnA and ZnS (Figure 6 4B). No difference was obs erved between ZnA and ZnS groups This was supported by a direct measurement of liver triglyceride s where mice fed ZnD showed significantly greater triglyceride level s compared to other groups during the TM challenge (Figure 6 4C). Next, serum ALT was measured to analyze liver tissue da mage caused by ER stress ( Figure 6 5 ). Serum ALT is a common marker of liver damage, since ALT can leak into the plasma from damaged hepatocytes (30). ZnD mice displayed higher levels of ALT activity in their serum during the TM treatment com pared to mice fed ZnA and ZnS groups No difference was observed between ZnA and ZnS groups During ER S tress, PTP1B Activity w as Increased in Mice F ed ZnD As described in de tail in the C hapter 4, zinc may contribute to ER stress adaptation by suppressing PTP1B activity. Thus, hepatic PTP1B acti vity was measur ed in mice fed diets with the different amounts of zinc During TM challenge, PTP1B expression was increased, however, the protein expression levels were comparable among the three groups (F igure 6 6A). In contrast PTP1B activity was signif icantly elevat ed in mice fed ZnD, whereas activity in ZnA and ZnS was not differe nt from untreated controls (Figure 6 6B ). These results suggest that the higher levels of ER stress induced apoptosis and steatosis during ZnD diet might result from the eleva ted PTP1B activity due to low availability of zinc.

PAGE 86

86 Discussion Zinc is essential for normal ER function, and its deficiency has been suggested to cause ER stress ( 79 81 ) This perception is largely based on in vit ro experiments that used TPEN, a cell perme able zinc chelator, to restrict available zinc ( 78 79 ) I n previous reports, the addition of TPEN to cells activated the UPR in yeast and mammalian cells. These condition s produce an equimolar chelation of TPEN: Zn that leads to cell death (126, 127) In this chapter, it was demonstrated that after 2 weeks, there was no activation of UPR markers in mice fed a ZnD that yielded signs of dietary zinc deficiency. The discrepancy between previous in vitro experiments and current in vivo experiments may be derived in part from the systemic homeostatic mechanisms in animals. Human and animals fed a lo w zinc die t can react to reduced zinc intake to maintain the cellular zinc homeostasis ( 44 ) Therefore, consumption of a low zinc diet may not be a critical factor that triggers ER st ress in vivo However, it should still be noted that ZnD may potentiate ER stress in a much longer and severe setting of zinc deficiency. In the current study, a 2 week period of dietary zinc manipulation was used as it provides enough time to induce sign atures of systemic zinc deficiency in t he mouse model according to previous observations (128, 129) Long term (e.g. > 1 month ) zinc deficient diet feeding was avoided because it trigger s a number of complications A number of pathological conditions, such as diabetes, neurological disorders, and hepatic steatosis, are related to ER stress ( 18 ) Disturbed zinc homeos tasis has been implicated in the se diseases ( 80 ) Thus this chapter aimed to inve stigate the impact of dietary zinc sta tus on ER stress in mice induced by TM administration. In this study, the liver was focused upon since it is the site where a massive number of

PAGE 87

87 proteins are synthesized, which makes this organ more susceptible to prote in mis folding. Addi tionally, observations from C hapter s 3 and 4 showed no changes in zinc homeostasis in other tissues including the pancreas, kidney, WAT, and spleen (Figure 3 1 and 3 2). In agreement with these results, Sun et al. reported that zinc defi ciency induces ER stress mediated apoptosis in liver s of rats after chronic ethanol consumption ( 80 ) Collectively, our findings suggest that a diet providing an adequa te source of zinc is critical for adapt ing to ER stress and suppressing apoptotic cell death.

PAGE 88

88 Figure 6 1. No difference in food intake and net body weight change was found among mice fed with zinc manipulated diets. Mice were fed either ZnD (<1 mg/kg diet), ZnA (30 mg/kg diet), or ZnS ( 180 mg/kg diet ) diets for 2 wk. Weekly food intake (A) and net change in body we ight (B) during dietary study. All data are represented as mean SD. n = 15 mice.

PAGE 89

89 Figure 6 2. No activation of ER stress markers in mice fed a ZnD. Mice were fed either ZnD (<1 mg /kg diet) or ZnA (30 mg/kg diet) diets for 2 wk. (A) Serum, liver, and pancreatic zinc concentration measured by AAS. (B E) Relative expression of Mt 1 (B and D) and Grp78 (C and E) in liver and pancreas. (F and G ) Immunoblot analysis of GRP78 in liver (F) and pancreas (G) of mice. In panels F and G, individual blots were analyzed by digital densitometry. All data are represented as mean SD n = 3 4 mice. **p < 0.01, ***p < 0.001.

PAGE 90

90 Figure 6 3. Mice fed ZnD display a delayed hepatic zinc accumulation, which coincides with greater expression of pro apoptotic proteins. Mice were fed either ZnD (<1 mg/kg diet), ZnA (30 mg/kg diet), or ZnS ( 180 mg/kg diet ) diets for 2 wk, which was followed by administration of TM for the indicated time. (A) Hepatic zinc co ncentration s were measured by AAS. (B) Immunoblot analysis of markers of ER stress in liver lysates of mice. (n= 3 4, pooled samples ) (C) Individual samples (48 h after TM, n = 4) were blotted and measured using digital densitometry. All data are represent ed as mean SD *p < 0.05 compared with ZnA or ZnS, #p < 0.05 compared with ZnD or ZnA. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 91

91 Figure 6 4. Dietary zinc is essential for suppression of ER stress induced apoptosis and steatosis. Mice were fed either ZnD (<1 mg/kg diet), ZnA (30 mg/kg diet), or ZnS ( 180 mg/kg diet ) diets for 2 wk, which was followed by administration of TM for 48 h. (A) Representative images of the TUNEL assay in liver sections of mice. Images are at 40X magnification; bars = 25 mm. (B) Representative images of H&E staining in liver sections of mice. Images are at 10X magnification; bars = 100 mm. (C) Quantification of triglycerides in livers of mice. All data are represented as mean SD n = 3 4 mice. L abeled means without a common letter differ significantly (p < 0.05).

PAGE 92

92 Figure 6 5. Mice fed ZnD display greater liver damage during TM challenge. Mice were fed either ZnD (<1 mg/kg diet), ZnA (30 mg/kg diet), or ZnS ( 180 mg/kg diet ) diets for 2 wk, wh ich was followed by administration of TM for the indicated time. Ser um ALT activity of mice was measured. All data are represented as mean SD n = 3 4 mice. Labeled means without a common letter differ significantly (p < 0.05).

PAGE 93

93 Figure 6 6. Mice fed ZnD display greater hepatic PTP1B activity during TM challenge. Mice were fed either ZnD (<1 mg/kg diet), ZnA (30 mg/kg diet), or ZnS ( 180 mg/kg diet ) diets for 2 wk, which was followed by administration of TM for 48 h (A) Immunoblot analysis of PTP1B in liver lysates of mice (n= 3 4, pooled samples ). (B) M easurement of PTP1B activity in livers of mice. PTP1B inhibitors were used as negative controls of the assay. All data are represented as mean SD n = 3 4 mice. Labeled means without a common lette r differ significantly (p < 0.05).

PAGE 94

94 CHAPTER 7 CONCLUSIONS AND FUTURE DIRECTIONS The gener al aim of this project was to gain a better understanding of the regulation and function of zinc and zinc transporters during ER stress and in the UPR pathway. To e xamine this, four specific research aims were set: determination of changes in zinc metabolism and zinc transporter expression during ER stress; delineation of the specific role of ZIP14 during ER stress; identification of the transcription factor(s) that regulate Zip14 expression during ER stress; and determination of the impact of zinc deficiency on ER stress in vivo To investigate these aims, the Zip14 KO m ouse model was primarily used for in vivo experiments Zip14 KO mice are a suitable model for the se research aims as the se mice display impaired hepatic zinc uptake, which enables us to observe what happens when the zinc requirement is increased during ER stress. In parallel, HepG2 hepatocytes were used to support the animal studies As described in t he schematic model (Figure 7 1 ), TM and HFD induced ER stress triggers ZIP14 mediated zinc accumulation in mouse liver. During TM induced ER stress, a cycle is initiated where Zip14 up regulation in hepatocytes is modulated at the transcriptional level b y UPR ZIP14 mediates zinc transport into hepatocytes to inhibit PTP1B activity, which acts to suppress apoptosis and steatosis associated with hepatic ER stress. In support of this model, i mpaired hepatic zi nc uptake in Zip14 KO mice during ER stress coincides with greater expression of pro apoptotic proteins in the UPR pathway including phosphorylated eIF2 ATF4 and CHOP In addition, ER stress induced Zip14 KO mice show greater levels of hepatic steatosis due to higher expression of genes involved in de novo FA synthesis, which are

PAGE 95

95 suppressed in ER stress induced wild type mice. During ER stress, the UPR activated transcription factors, ATF4 and ATF6 transcriptionally up regulate Zip14 expression. And fin ally, Zip14 KO mice showed greater hepatic PTP1B activity during TM and HFD induced ER stress. In this project, the function of hepatic ZIP14 was primarily focused upon Future studies could focus on other zinc transporters of which expression is signi ficantly increased during ER stress. For example, ZnT3 gene expression was markedly enhanced (~15 fold) in mouse liver following TM administration. Although hepatic abundance of ZnT3 protein is known to be low, its expression after TM could be significant, which raises the possibility of a potential role for hepatic ZnT3 during ER stress. This notion is supported by previous report that showed a protective role of ZnT3 during ER stress in neuroblastoma cells ( 83 ) Similar to its function in the brain, ZnT3 may play a protect ive role in the liver during ER stress. In addition, expression of ZIP2, ZIP6, ZIP7, ZnT1, ZnT5, ZnT7, and ZnT10 were significantly altered in TM challenged mouse liver, but their function has not been examined using in vivo model s In addition, function o f ZIP14 in other tissues could be further studied. Although zinc concentration and ZIP14 expression were not changed following TM injection in pancreas, kidney, spleen and adipose tissue at the time of examination (12 h after TM administration), there is s till the possibility the zinc homeostasis is altered at different time point during a TM challenge Of interest is role of ZIP14 in pancreatic tissue as the tissue is known to express significant amount s of ZIP14 and is highly affected by ER stress. A pot entia l future study could examine a role for zinc in the aggresome, which is a recently discovered cellular structure (130) The aggresome was first identified in the

PAGE 96

96 characterization of a mutation of the cystic fi brosis transmembrane conducting regulator (CFTR), which produces a phenotype of protein misfolding and aggregation (131, 132) Aggresome formation occurs when the capacity of the proteasome is exceed ed by the production of misfolded or unfolded proteins. Similar to what the UPR does for ER str ess adaptation, aggresomes play a cri tical role in clearance of ER stress by sequestering aggregated proteins in cells (133) To my knowledge, the effect of zinc or other metals on formation and/or function of agg resome has not been studied. N ormal aggresome formation requires a number of proteins. Therefore, it would be interesting to examine if the aggresome formation is influenced in response to cellular zinc status and/or zinc transporter activity possibly through zinc regulated or zinc dependent proteins. Additionally, the potential role of matrix metalloproteinase (MMP) during ER stress and in the UPR pathway is of interest MMPs are zinc dependent metalloenzymes involved in the various physiologic reactions including hydrolytic breakdown of connective tissue (134) Activity of MMPs has been implicated in human pathologies including cancer, arthritis, and heart disease (135) Some MMPs such as MM P 3 plays a role in the ER stress induced apoptosis. It has been shown that TM treatment increases MMP 3 expression, which participates in neuronal apoptotic signaling (136) Similarly MMP 9 is also shown to enhance ER stress in motor neurons, triggering neurodegeneration (137) It is well established that zinc is required for functional MMP activity (138, 139) which leads to a hypothesis that cellular zinc status and/or zinc transporter activity infl uence the MMP mediated apoptosis during ER stress.

PAGE 97

97 Supporting that notion, it has been shown that hepatic MMP 9 expression is influenced by dietary zinc level and functional ZIP14 activity in sepsis model of mice (1 40) As shown in our model (Figure 7 1), ZIP14 is represented as a cell surface protein. Si nce ZIP14 undergoes endocytosis (66) such re localization may yield physiologic outcomes that remain to be examined.

PAGE 98

98 Figure 7 1. Role of ZIP14 mediated zinc transport in ER stress adaptation. Based on the data in this report, a cycle is proposed where ER stress sequentially transcription of Zip14 leading to increased ZIP14 in hepatocytes. Enhanced transporter activity in creases intracellular zinc concentration leading to inhibition of PTP1B activity.

PAGE 99

99 LIST OF REFERENCES 1. Ellgaard L & Helenius A (2003) Quality control in the endoplasmic reticulum. Nature reviews. Molecular cell biology 4(3):181 19 1. 2. Hampton RY (2002) ER associated degradation in protein quality control and cellular regulation. Current opinion in cell biology 14(4):476 482. 3. Nair S et al. (2007) Toxicogenomics of endoplasmic reticulum stress inducer tunicamycin in the small in testine and liver of Nrf2 knockout and C57BL/6J mice. Toxicology letters 168(1):21 39. 4. Zhang X et al. (2014) Endoplasmic reticulum stress induced by tunicamycin and thapsigargin protects against transient ischemic brain injury: Involvement of PARK2 dep endent mitophagy. Autophagy 10(10):1801 1813. 5. Ji C & Kaplowitz N (2003) Betaine decreases hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury in alcohol fed mice. Gastroenterology 124(5):1488 1499. 6. Zhang K & Kaufman RJ (2008) From en doplasmic reticulum stress to the inflammatory response. Nature 454(7203):455 462. 7. Li J et al. (2012) Accumulation of endoplasmic reticulum stress and lipogenesis in the liver through generational effects of high fat diets. Journal of hepatology 56(4): 900 907. 8. Zhang K (2010) Integration of ER stress, oxidative stress and the inflammatory response in health and disease. International journal of clinical and experimental medicine 3(1):33 40. 9. Ozcan U et al. (2004) En doplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306(5695):457 461. 10. Schrder M & Kaufman RJ (2005) The mammalian unfolded protein response. Annu. Rev. Biochem. 74:739 789. 11. Schroder M & Kaufman RJ (2005) ER stress and the unfolded protein respo nse. Mutation research 569(1 2):29 63. 12. Rutkowski DT et al. (2006) Adaptation to ER stress is mediated by differential stabilities of pro survival and pro apoptotic mRNAs and proteins. PLoS biology 4(11):e374. 13. Zhu G & Lee AS (2015) Role of the unfo lded protein response, GRP78 and GRP94 in organ homeostasis. Journal of cellular physiology 230(7):1413 1420.

PAGE 100

100 14. Walter P & Ron D (2011) The unfolded protein response: from stress pathway to homeostatic regulation. Science 334(6059):1081 1086. 15. Teske B F et al. (2011) The eIF2 kinase PERK and the integrated stress response facilitate activation of ATF6 during endoplasmic reticulum stress. Molecular biology of the cell 22(22):4390 4405. 16. Baird TD & Wek RC (2012) Eukaryotic initiation factor 2 phosphor ylation and translational control in metabolism. Advances in nutrition 3(3):307 321. 17. Harding HP, Zhang Y, & Ron D (1999) Protein translation and folding are coupled by an endoplasmic reticulum resident kinase. Nature 397(6716):271 274. 18. Yoshida H (2 007) ER stress and diseases. The FEBS journal 274(3):630 658. 19. Malhi H & Kaufman RJ (2011) Endoplasmic reticulum stress in liver disease. Journal of hepatology 54(4):795 809. 20. Marciniak SJ & Ron D (2006) Endoplasmic reticulum stress signaling in dise ase. Physiological reviews 86(4):1133 1149. 21. Hetz C (2012) The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nature reviews. Molecular cell biology 13(2):89 102. 22. Marciniak SJ et al. (2004) CHOP induces death by promoting protein synthesis and oxidation in the stressed endoplasmic reticulum. Genes & development 18(24):3066 3077. 23. Oyadomari S et al. (2002) Targeted disruption of the Chop gene delays endoplasmic reticulum stress mediated diabetes. The Journa l of clinical investigation 109(4):525 532. 24. Song B, Scheuner D, Ron D, Pennathur S, & Kaufman RJ (2008) Chop deletion multiple mouse models of diabetes. The Journal of cl inical investigation 118(10):3378 3389. 25. Thorp E et al. (2009) Reduced apoptosis and plaque necrosis in advanced Cell metabolism 9(5):474 481. 26. Zinszner H et al. (1998) CHOP is impli cated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes & development 12(7):982 995.

PAGE 101

101 27. Bechmann LP et al. (2012) The interaction of hepatic lipid and glucose metabolism in liver diseases. Journal of hepatology 56(4):952 964. 28. Kammoun HL et al. (2009) GRP78 expression inhibits insulin and ER stress induced SREBP 1c activation and reduces hepatic steatosis in mice. The Journal of clinical investigation 119(5):1201 1215. 29. Rutkowski DT et al. (2008) UPR pat hways combine to prevent hepatic steatosis caused by ER stress mediated suppression of transcriptional master regulators. Developmental cell 15(6):829 840. 30. Fu S, Watkins SM, & Hotamisligil GS (2012) The role of endoplasmic reticulum in hepatic lipid ho meostasis and stress signaling. Cell metabolism 15(5):623 634. 31. Lee AH, Scapa EF, Cohen DE, & Glimcher LH (2008) Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 320(5882):1492 1496. 32. Yamamoto K et al. (2010) Induction of liver steatosis and lipid droplet formation in ATF6alpha knockout mice burdened with pharmacological endoplasmic reticulum stress. Molecular biology of the cell 21(17):2975 2986. 33. Ji C et al. (2011) Liver specific loss of glucose regulated protein 78 p erturbs the unfolded protein response and exacerbates a spectrum of liver diseases in mice. Hepatology 54(1):229 239. 34. Chen W T et al. (2014) GRP78 as a regulator of liver steatosis and cancer progression mediated by l oss of the tumor suppressor PTEN. Oncogene 33(42):4997 5005. 35. Chen WT et al. (2014) Liver specific knockout of GRP94 in mice disrupts cell adhesion, activates liver progenitor cells, and accelerates liver tumorigenesis. Hepatology 59(3):947 957. 36. O'Dell BL (1984) History and status of zinc in nutrition: Introduction. Federation proceedings Federation of American Societies for Experimental Biology (USA) 37. Prasad AS, Schulert AR, Miale A, Jr., Farid Z, & Sandstead HH (1963) Zinc and iron deficiencies in male subjects with dwarfism and hypogonadism but without ancylostomiasis, schistosomiasi s or severe anemia. The American journal of clinical nutrition 12:437 444. 38. Hambidge KM & Krebs NF (2007) Zinc deficiency: a special challenge. The Journal of nutrition 137(4):1101 1105. 39. Brown KH & Wuehler SE (2000) Zinc and human health: results of recent trials and implications for program interventions and research (Micronutrient Initiative).

PAGE 102

102 40. Prasad AS (2003) Zinc deficiency: has been known of for 40 years but ignored by global health organisations. BMJ: British Medical Journal 326(7386):409. 41. Keen CL & Gershwin ME (1990) Zinc deficiency and immune function. Annual review of nutrition 10(1):415 431. 42. Abbasi AA, Prasad AS, Rabbani P, & DuMouchelle E (1980) Experimental zinc deficiency in man. Effect on testicular function. The Journal of l aboratory and clinical medicine 96(3):544 550. 43. Hambidge M (2000) Human zinc deficiency. The Journal of nutrition 130(5):1344S 1349S. 44. King JC & Cousins RJ (2014) Zinc. 11th. ed. In: Shilis ME, ed. Modern Nutrition in Health and DIsease. Baltimore, M D: Lippincott Williams & Wilkins :189 205. 45. Suzuki T et al. (2005) Two different zinc transport complexes of cation diffusion facilitator proteins localized in the secretory pathway operate to activate alkaline phosphatases in vertebrate cells. Journal of Biological Chemistry 280(35):30956 30962. 46. Laity JH, Lee BM, & Wright PE (2001) Zinc finger proteins: new insights into structural and functional diversity. Current opinion in structural biology 11(1):39 46. 47. Maret W (2000) The function of zinc me tallothionein: a link between cellular zinc and redox state. The Journal of nutrition 130(5):1455S 1458S. 48. Cousins RJ, Liuzzi JP, & Lichten LA (2006) Mammalian zinc transport, trafficking, and signals. Journal of Biological Chemistry 281(34):24085 24089 49. Lichten LA & Cousins RJ (2009) Mammalian zinc transporters: nutritional and physiologic regulation. Annual review of nutrition 29:153 176. 50. Jeong J & Eide DJ (2013) The SLC39 family of zinc transporters. Molecular aspects of medicine 34(2 3):612 6 19. 51. Kambe T, Tsuji T, Hashimoto A, & Itsumura N (2015) The Physiological, Biochemical, and Molecular Roles of Zinc Transporters in Zinc Homeostasis and Metabolism. Physiological reviews 95(3):749 784. 52. Langmade SJ, Ravindra R, Daniels PJ, & Andrews GK (2000) The transcription factor MTF 1 mediates metal regulation of the mouse ZnT1 gene. Journal of Biological Chemistry 275(44):34803 34809.

PAGE 103

103 53. Lichten LA, Ryu M S, Guo L, Embury J, & Cousins RJ (2011) MTF 1 mediated repression of the zinc transporter Zip10 is alleviated by zinc restriction. PloS one 6(6):e21526. 54. Dufner Beattie J et al. (2003) The acrodermatitis enteropathica gene ZIP4 encodes a tissue specific, zinc regulated zinc transporter in mice. Journal of Biological Chemistry 278(35):33474 33481. 55. Weaver BP, Dufner Beattie J, Kambe T, & Andrews GK (2007) Novel zinc responsive post transcriptional mechanisms reciprocally regulate expression of the mouse Slc39a4 and Slc39a5 zinc transporters (Zip4 and Zip5). Biological chemistry 388(12):130 1 1312. 56. Liuzzi JP, Guo L, Chang SM, & Cousins RJ (2009) Kruppel like factor 4 regulates adaptive expression of the zinc transporter Zip4 in mouse small intestine. American journal of physiology. Gastrointestinal and liver physiology 296(3):G517 523. 57 Kitamura H et al. (2006) Toll like receptor mediated regulation of zinc homeostasis influences dendritic cell function. Nature immunology 7(9):971 977. 58. Liuzzi JP et al. (2005) Interleukin 6 regulates the zinc transporter Zip14 in liver and contribu tes to the hypozincemia of the acute phase response. Proceedings of the National Academy of Sciences of the United States of America 102(19):6843 6848. 59. Andrews GK (2008) Regulation and function of Zip4, the acrodermatitis enteropathica gene. (Portland Press Limited). 60. Dufner Beattie J, Huang ZL, Geiser J, Xu W, & Andrews GK (2005) Generation and characterization of mice lacking the zinc uptake transporter ZIP3. Molecular and cellular biology 25(13):5607 5615. 61. Dufner Beattie J, Huang ZL, Geiser J Xu W, & Andrews GK (2006) Mouse ZIP1 and ZIP3 genes together are essential for adaptation to dietary zinc deficiency during pregnancy. Genesis 44(5):239 251. 62. Giunta C et al. (2008) Spondylocheiro dysplastic form of the Ehlers Danlos syndrome an auto somal recessive entity caused by mutations in the zinc transporter gene SLC39A13. The American Journal of Human Genetics 82(6):1290 1305. 63. Jeong J et al. (2012) Promotion of vesicular zinc efflux by ZIP13 and its implications for spondylocheiro dysplas tic Ehlers Danlos syndrome. Proceedings of the National Academy of Sciences of the United States of America 109(51):E3530 3538.

PAGE 104

104 64. Taylor K, Morgan H, Johnson A, & Nicholson R (2005) Structure function analysis of a novel member of the LIV 1 subfamily of zinc transporters, ZIP14. FEBS letters 579(2):427 432. 65. Liuzzi JP, Aydemir F, Nam H, Knutson MD, & Cousins RJ (2006) Zip14 (Slc39a14) mediates non transferrin bound iron uptake into cells. Proceedings of the National Academy of Sciences 103(37):13612 13 617. 66. Aydemir TB, Troche C, Kim M H, & Cousins RJ (2016) Hepatic ZIP14 mediated Zinc Transport Contributes to Endosomal Insulin Receptor Trafficking and Glucose Metabolism. Journal of Biological Chemistry 291(46):23939 23951. 67. Girijashanker K et al. (2008) Slc39a14 gene encodes ZIP14, a metal/bicarbonate symporter: similarities to the ZIP8 transporter. Molecular pharmacology 73(5):1413 1423. 68. Pinilla Tenas JJ et al. (2011) Zip14 is a complex broad scope metal ion transporter whose functional prop erties support roles in the cellular uptake of zinc and nontransferrin bound iron. American Journal of Physiology Cell Physiology 301(4):C862 C871. 69. Jurado RL (1997) Iron, infections, and anemia of inflammation. Clinical Infectious Diseases 25(4):888 89 5. 70. Lichten LA, Liuzzi JP, & Cousins RJ (2009) Interleukin oxide to the upregulation and functional activity of the zinc transporter Zip14 (Slc39a14) in murine hepatocytes. American Journal of Physiology Gastrointestinal and Li ver Physiology 296(4):G860 G867. 71. Thambiayya K et al. (2011) LPS induced decrease in intracellular labile zinc,[Zn] i, contributes to apoptosis in cultured sheep pulmonary artery endothelial cells. American Journal of Physiology Lung Cellular and Molec ular Physiology 300(4):L624 L632. 72. Guthrie GJ et al. (2014) Influence of ZIP14 (slc39A14) on intestinal zinc processing and barrier function. American Journal of Physiology Gastrointestinal and Liver Physiology :ajpgi. 00021.02014. 73. Aydemir TB et al (2012) Zinc transporter ZIP14 functions in hepatic zinc, iron and glucose homeostasis during the innate immune response (endotoxemia). PloS one 7(10):e48679. 74. Troche C, Aydemir TB, & Cousins RJ (2016) Zinc transporter Slc39a14 regulates inflammatory s ignaling associated with hypertrophic adiposity. American Journal of Physiology Endocrinology and Metabolism 310(4):E258 E268.

PAGE 105

105 75. Aydemir TB, Sitren HS, & Cousins RJ (2012) The zinc transporter Zip14 influences c Met phosphorylation and hepatocyte prolife ration during liver regeneration in mice. Gastroenterology 142(7):1536 1546 e1535. 76. Yamasaki S et al. (2007) Zinc is a novel intracellular second messenger. The Journal of cell biology 177(4):637 645. 77. Vallee BL & Falchuk KH (1993) The biochemical b asis of zinc physiology. Physiological reviews 73(1):79 118. 78. Ellis CD et al. (2004) Zinc and the Msc2 zinc transporter protein are required for endoplasmic reticulum function. The Journal of cell biology 166(3):325 335. 79. Homma K et al. (2013) SOD1 as a molecular switch for initiating the homeostatic ER stress response under zinc deficiency. Molecular cell 52(1):75 86. 80. Sun Q et al. (2015) Zinc deficiency mediates alcohol induced apoptotic cell death in the liver of rats through activating ER an d mitochondrial cell death pathways. American journal of physiology. Gastrointestinal and liver physiology 308(9):G757 766. 81. Ishihara K et al. (2006) Zinc transport complexes contribute to the homeostatic maintenance of secretory pathway function in ve rtebrate cells. The Journal of biological chemistry 281(26):17743 17750. 82. Ohashi W et al. (2016) Zinc Transporter SLC39A7/ZIP7 Promotes Intestinal Epithelial Self Renewal by Resolving ER Stress. PLoS genetics 12(10):e1006349. 83. Kurita H, Okuda R, Yok oo K, Inden M, & Hozumi I (2016) Protective roles of SLC30A3 against endoplasmic reticulum stress via ERK1/2 activation. Biochemical and biophysical research communications 479(4):853 859. 84. Feldhammer M, Uetani N, Miranda Saavedra D, & Tremblay ML (2013 ) PTP1B: a simple enzyme for a complex world. Critical reviews in biochemistry and molecular biology 48(5):430 445. 85. Stuible M & Tremblay ML (2010) In control at the ER: PTP1B and the down regulation of RTKs by dephosphorylation and endocytosis. Trends in cell biology 20(11):672 679. 86. Lavens D, Piessevaux J, & Tavernier J (2006) Review: negative regulation of leptin receptor signalling. European cytokine network 17(3):211 219. 87. Lessard L, Stuible M, & Tremblay ML (2010) The two faces of PTP1B in ca ncer. Biochimica et Biophysica Acta (BBA) Proteins and Proteomics 1804(3):613 619.

PAGE 106

106 88. Gu F et al. (2004) Protein tyrosine phosphatase 1B potentiates IRE1 signaling during endoplasmic reticulum stress. The Journal of biological chemistry 279(48):49689 496 93. 89. Zabolotny JM et al. (2008) Protein tyrosine phosphatase 1B expression is induced by inflammation in vivo. Journal of Biological Chemistry 283(21):14230 14241. 90. Dub N & Tremblay ML (2005) Involvement of the small protein tyrosine phosphatases T C PTP and PTP1B in signal transduction and diseases: from diabetes, obesity to cell cycle, and cancer. Biochimica et Biophysica Acta (BBA) Proteins and Proteomics 1754(1):108 117. 91. Agouni A et al. (2011) Liver specific deletion of protein tyrosine phos phatase (PTP) 1B improves obesity and pharmacologically induced endoplasmic reticulum stress. The Biochemical journal 438(2):369 378. 92. Parvaneh L et al. (2010) Palmitate and inflammatory state additively induce the expression of PTP1B in muscle cells. Biochemical and biophysical research communications 396(2):467 471. 93. Delibegovic M et al. (2009) Liver specific deletion of protein tyrosine phosphatase 1B (PTP1B) improves metabolic syndrome and attenuates diet induced endoplasmic reticulum stress. D iabetes 58(3):590 599. 94. Delibegovic M & Mody N (2013) PTP1B in the periphery: regulating insulin sensitivity and ER stress. Protein Tyrosine Phosphatase Control of Metabolism (Springer), pp 91 105. 95. Haase H & Maret W (2005) Fluctuations of cellular available zinc modulate insulin signaling via inhibition of protein tyrosine phosphatases. Journal of Trace Elements in Medicine and Biology 19(1):37 42. 96. Bellomo E, Massarotti A, Hogstrand C, & Maret W (2014) Zinc ions modulate protein tyrosine phosp hatase 1B activity. Metallomics : integrated biometal science 6(7):1229 1239. 97. Kim MH, Aydemir TB, & Cousins RJ (2016) Dietary Zinc Regulates Apoptosis through the Phosphorylated Eukaryotic Initiation Factor 2alpha/Activating Transcription Factor 4/C/EB P Homologous Protein Pathway during Pharmacologically Induced Endoplasmic Reticulum Stress in Livers of Mice. The Journal of nutrition 146(11):2180 2186. 98. Rebouche CJ, Wilcox CL, & Widness JA (2004) Microanalysis of non heme iron in animal tissues. Jour nal of biochemical and biophysical methods 58(3):239 251.

PAGE 107

107 99. Xie L & Collins JF (2013) Transcription factors Sp1 and Hif2alpha mediate induction of the copper transporting ATPase (Atp7a) gene in intestinal epithelial cells during hypoxia. The Journal of b iological chemistry 288(33):23943 23952. 100. King JC, Shames DM, & Woodhouse LR (2000) Zinc homeostasis in humans. The Journal of nutrition 130(5S Suppl):1360S 1366S. 101. Vecchi C et al. (2009) ER stress controls iron metabolism through induction of hep cidin. Science 325(5942):877 880. 102. Eide DJ (2006) Zinc transporters and the cellular trafficking of zinc. Biochimica et biophysica acta 1763(7):711 722. 103. Chun HS, Lee H, & Son JH (2001) Manganese induces endoplasmic reticulum (ER) stress and activa tes multiple caspases in nigral dopaminergic neuronal cells, SN4741. Neuroscience letters 316(1):5 8. 104. Oubrahim H, Chock PB, & Stadtman ER (2002) Manganese(II) induces apoptotic cell death in NIH3T3 cells via a caspase 12 dependent pathway. The Journal of biological chemistry 277(23):20135 20138. 105. Seo YA, Li Y, & Wessling Resnick M (2013) Iron depletion increases manganese uptake and potentiates apoptosis through ER stress. Neurotoxicology 38:67 73. 106. Hiramatsu N et al. (2007) Rapid, transient i nduction of ER stress in the liver and kidney after acute exposure to heavy metal: evidence from transgenic sensor mice. FEBS letters 581(10):2055 2059. 107. Biagioli M et al. (2008) Endoplasmic reticulum stress and alteration in calcium homeostasis are i nvolved in cadmium induced apoptosis. Cell calcium 43(2):184 195. 108. Kitamura M & Hiramatsu N (2010) The oxidative stress: endoplasmic reticulum stress axis in cadmium toxicity. Biometals : an international journal on the role of metal ions in biology, b iochemistry, and medicine 23(5):941 950. 109. Kubota K et al. (2005) Fluoride induces endoplasmic reticulum stress in ameloblasts responsible for dental enamel formation. The Journal of biological chemistry 280(24):23194 23202. 110. Zabolotny JM et al. ( 2002) PTP1B regulates leptin signal transduction in vivo. Developmental cell 2(4):489 495. 111. Zhang S & Zhang ZY (2007) PTP1B as a drug target: recent developments in PTP1B inhibitor discovery. Drug discovery today 12(9 10):373 381.

PAGE 108

108 112. Popov D (2012) E ndoplasmic reticulum stress and the on site function of resident PTP1B. Biochemical and biophysical research communications 422(4):535 538. 113. Little E, Ramakrishnan M, Roy B, Gazit G, & Lee AS (1994) The glucose regulated proteins (GRP78 and GRP94): fun ctions, gene regulation, and applications. Critical reviews in eukaryotic gene expression 4(1):1 18. 114. Mao C et al. (2010) Targeted mutation of the mouse Grp94 gene disrupts development and perturbs endoplasmic reticulum stress signaling. PloS one 5(5) :e10852. 115. Pieper R et al. (2015) Impact of high dietary zinc on zinc accumulation, enzyme activity and proteomic profiles in the pancreas of piglets. Journal of trace elements in medicine and biology : organ of the Society for Minerals and Trace Eleme nts 30:30 36. 116. Tan Y, Chen M, Li Z, Mabuchi K, & Bouvier M (2006) The calcium and zinc responsive regions of calreticulin reside strictly in the N /C domain. Biochimica et biophysica acta 1760(5):745 753. 117. Leach MR, Cohen Doyle MF, Thomas DY, & Wi lliams DB (2002) Localization of the lectin, ERp57 binding, and polypeptide binding sites of calnexin and calreticulin. The Journal of biological chemistry 277(33):29686 29697. 118. Zhang K et al. (2011) The unfolded protein response transducer IRE1alpha prevents ER stress induced hepatic steatosis. The EMBO journal 30(7):1357 1375. 119. Fusakio ME et al. (2016) Transcription factor ATF4 directs basal and stress induced gene expression in the unfolded protein response and cholesterol metabolism in the liv er. Molecular biology of the cell 27(9):1536 1551. 120. Kubota H et al. (2004) The endoplasmic reticulum stress response is stimulated through the continuous activation of transcription factors ATF6 and XBP1 in Genes to Cel ls 9(3):261 270. 121. Ameri K & Harris AL (2008) Activating transcription factor 4. The international journal of biochemistry & cell biology 40(1):14 21. 122. Wu J et al. (2007) ATF6alpha optimizes long term endoplasmic reticulum function to protect cells from chronic stress. Developmental cell 13(3):351 364. 123. Wang Y et al. (2000) Activation of ATF6 and an ATF6 DNA binding site by the endoplasmic reticulum stress response. The Journal of biological chemistry 275(35):27013 27020.

PAGE 109

109 124. Koyanagi S et al (2011) cAMP response element (CRE) mediated transcription by activating transcription factor 4 (ATF4) is essential for circadian expression of the Period2 gene. The Journal of biological chemistry 286(37):32416 32423. 125. Luo S, Baumeister P, Yang S, Ab couwer SF, & Lee AS (2003) Induction of Grp78/BiP by translational block: activation of the Grp78 promoter by ATF4 through and upstream ATF/CRE site independent of the endoplasmic reticulum stress elements. The Journal of biological chemistry 278(39):37375 37385. 126. Cao J, Bobo JA, Liuzzi JP, & Cousins RJ (2001) Effects of intracellular zinc depletion on metallothionein and ZIP2 transporter expression and apoptosis. Journal of leukocyte biology 70(4):559 566. 127. Fraker PJ (2005) Roles for cell death in zinc deficiency. The Journal of nutrition 135(3):359 362. 128. Moore JB, Blanchard RK, McCormack WT, & Cousins RJ (2001) cDNA array analysis identifies thymic LCK as upregulated in moderate murine zinc deficiency before T lymphocyte population changes. The Journal of nutrition 131(12):3189 3196. 129. Blanchard RK, Moore JB, Green CL, & Cousins RJ (2001) Modulation of intestinal gene expression by dietary zinc status: effectiveness of cDNA arrays for expression profiling of a single nutrient deficiency. Proc eedings of the National Academy of Sciences 98(24):13507 13513. 130. Thul PJ et al. (2017) A subcellular map of the human proteome. Science 356(6340). 131. Jensen TJ et al. (1995) Multiple proteolytic systems, including the proteasome, contribute to CFTR processing. Cell 83(1):129 135. 132. Johnston JA, Ward CL, & Kopito RR (1998) Aggresomes: a cellular response to misfolded proteins. The Journal of cell biology 143(7):1883 1898. 133. Kopito RR & Sitia R (2000) Aggresomes and Russell bodies. EMBO reports 1(3):225 231. 134. Whittaker M, Floyd CD, Brown P, & Gearing AJ (1999) Design and therapeutic application of matrix metalloproteinase inhibitors. Chemical reviews 99(9):2735 2776. 135. Coussens LM, Fingleton B, & Matrisian LM (2002) Matrix metalloproteinase inhibitors and cancer trials and tribulations. Science 295(5564):2387 2392.

PAGE 110

110 136. Kim E M et al. (2010) Matrix metalloproteinase 3 is increased and participates in neuronal apopt otic signaling downstream of caspase 12 during endoplasmic reticulum stress. Journal of Biological Chemistry 285(22):16444 16452. 137. Kaplan A et al. (2014) Neuronal matrix metalloproteinase 9 is a determinant of selective neurodegeneration. Neuron 81(2) :333 348. 138. Tezvergil Mutluay A et al. (2010) The requirement of zinc and calcium ions for functional MMP activity in demineralized dentin matrices. Dental Materials 26(11):1059 1067. 139. Isaksen B & Fagerhol M (2001) Calprotectin inhibits matrix meta lloproteinases by sequestration of zinc. Molecular Pathology 54(5):289 292. 140. Wessels I & Cousins RJ (2015) Zinc dyshomeostasis during polymicrobial sepsis in mice involves zinc transporter Zip14 and can be overcome by zinc supplementation. American jou rnal of physiology. Gastrointestinal and liver physiology 309(9):G768 778.

PAGE 111

111 BIOGRAPHICAL SKETCH Min Hyun Kim was born in Seoul, South Korea. He received his B. S in food and n utrition from Yonsei University in 20 10, and received his M.S. from the same department in 2012. Min Hyun came to the University of Florida in fall 2013 to begin his Ph.D. studies in nutritional s ciences he focused on the physiologic function of mammalian zinc transporters. He rec eived his Ph.D. from the University of Florida in the summer of 2017.