Citation
Effect of Omnigen-AF (registered trademark) and Heat Stress Abatement during the Dry Period on Subsequent Performance of Cows

Material Information

Title:
Effect of Omnigen-AF (registered trademark) and Heat Stress Abatement during the Dry Period on Subsequent Performance of Cows
Creator:
Fachetti Fabris, Thiago
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (96 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Sciences
Committee Chair:
DAHL,GEOFFREY E
Committee Co-Chair:
LAPORTA,JIMENA
Committee Members:
SANTOS,JOSE EDUARDO

Subjects

Subjects / Keywords:
dairy -- dry -- heat -- period -- stress
Animal Sciences -- Dissertations, Academic -- UF
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Animal Sciences thesis, M.S.

Notes

Abstract:
Environmental factors such as high humidity and temperature can cause heat stress. Heat stress during the dry period reduces milk yield in the next lactation. Previous data have shown that feeding OmniGen-AF before and during periods of heat stress increases dry matter intake (DMI), reduces respiration rate (RR) and rectal temperature (RT), and it may improve immune status of heat stressed dairy cattle. The objective of the present experiment was to evaluate the effect of heat stress (HT vs CL, during the dry period) and dietary treatment (Control vs. OG) during and after the exposure to heat stress on dairy cow performance. At least 60 days before dry-off, cows were randomly assigned to OG or Control treatments based on the 305-d mature equivalent milk yield. Cows were supplemented with 56 g/d of OmniGen-AF or equal amount of AB20 as control during the last 60 days of lactation, dry-period and up to 60 days in milk. Cows were assigned to four treatments in a completely randomized design with a 2x2 factorial arrangement of treatments. Cows were dried off 45 d before expected calving and, within OG and Control they were randomly assigned to receive only shade with no evaporative cooling (HT, n = 36), shade with evaporative cooling (fans and soakers, n = 30), heat stress with placebo (HT, n = 17), heat stress with OG (HTOG, n=19), cooling with placebo (CL, n = 16) and cooling with OG (CLOG, n = 14). The present study demonstrated that HT vs. CL increases RR and RT, and OG supplementation improves thermoregulation of cows exposed to HT by reduction in RR and a tendency to reduce RT. Cows exposed to HT vs. CL reduces DMI during the dry period. The exposure to CL and OG treatment improves milk yield in the next lactation. Also, OG supplementation improves L-selectin mRNA gene expression during late and early lactation of Holstein cows and tended to increase neutrophil volume during the dry period. However, CL and OG improve cow performance and OG supplementation may be a strategy to improve the immune status of cows. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2017.
Local:
Adviser: DAHL,GEOFFREY E.
Local:
Co-adviser: LAPORTA,JIMENA.
Statement of Responsibility:
by Thiago Fachetti Fabris.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Classification:
LD1780 2017 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 EFFECT OF OMNIGEN AF AND HEAT STRESS ABAT E MENT DURING THE DRY PERIOD ON SUBSEQUENT PERFORMANCE OF COWS By THIAGO FACHETTI FABRIS A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMEN T OF THE REQUIREME NTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2017

PAGE 2

2 2017 Thiago Fachetti Fabris

PAGE 3

3 To dairy producers, industry, and dairy consumers around the world

PAGE 4

4 ACKNOWLEDGMENTS I thank my committee members who were more than generous with their expertise and precious time. A special thank you to my advisor Dr. Dahl for his countless hours of reflecting, reading, encouraging, and most of all patience throughout the entire process. Thank you Dr. Laporta and Dr. Santos for agreeing to serve on my committee. I would like to extend my appreciation to Dr. Laporta for all her patien ce and commitment, which contributed to professional development during these 2 years of my Master of Scien ce program. I also would like to extend my gratitude to Dr. Santos, who contributed to my critical thinking and data analysis that are essential for high quality research. I also would like to thank you my uncle Rogrio Isler that had an important contrib ution to my academic life and guidance since veterinary school. Finally, I would like to thank my parents for all the support and teaching throughout my entire life and for that, I am grateful.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 7 LIST OF FIGURES ................................ ................................ ................................ ......................... 8 LIST OF ABBREVIATIONS ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................................ ... 11 CHAPTER 1 REVIEW OF LITERATURE ................................ ................................ ................................ 13 Introduction ................................ ................................ ................................ ............................. 13 Economic Impacts ................................ ................................ ................................ .................. 14 Thermoregulatory Response and Management ................................ ................................ ...... 14 Cooling Systems ................................ ................................ ................................ ..................... 19 Shad e ................................ ................................ ................................ ............................... 19 Free Stall Barn ................................ ................................ ................................ ................. 20 Feeding Strategies to Alleviate Heat Stress ................................ ................................ ............ 21 Physiology of the Mammary Gland during the Dry Period ................................ .................... 28 Summary ................................ ................................ ................................ ................................ 34 2 EFFECT OF NUTRITIONAL IMMUNOMODULATION AND HEAT STRESS D URING THE DRY PERIOD ON SUBSEQUENT PERFORMANCE OF COWS ............ 35 Summary ................................ ................................ ................................ ................................ 35 Introduction ................................ ................................ ................................ ............................. 36 Materials and Methods ................................ ................................ ................................ ........... 37 Treatments, Experimental Design and Cows ................................ ................................ .. 37 Data Measures and Sample Collection ................................ ................................ ............ 39 Statistical Analysis ................................ ................................ ................................ .......... 40 Results ................................ ................................ ................................ ................................ ..... 41 Measurements during Dry Period ................................ ................................ .................... 41 Production Variables during Lactation ................................ ................................ ............ 42 Discussion ................................ ................................ ................................ ............................... 43 Conclusions ................................ ................................ ................................ ............................. 49 3 NUTRITIONAL AND HOUSING STRATEGIES DURING THE DRY PERIOD TO AMELIORATE THE NEGATIVE IMPACT OF HEAT STRESS ON IMMUNE STATUS OF DAIRY COWS ................................ ................................ ................................ 58 Summary ................................ ................................ ................................ ................................ 58

PAGE 6

6 Introduction ................................ ................................ ................................ ............................. 59 Materials and Methods ................................ ................................ ................................ ........... 61 Tr eatments, Experimental Design and Animals ................................ .............................. 61 Immune status ................................ ................................ ................................ .................. 62 Gene Expression ................................ ................................ ................................ .............. 64 Statistical Analysis ................................ ................................ ................................ .......... 6 5 Results ................................ ................................ ................................ ................................ ..... 67 Neutrophil Function ................................ ................................ ................................ ......... 67 Gene Expression ................................ ................................ ................................ .............. 67 Hematology ................................ ................................ ................................ ..................... 68 Discussion ................................ ................................ ................................ ............................... 68 Conclusion ................................ ................................ ................................ .............................. 71 4 GENERAL DISCUSSION AND SUMMARY ................................ ................................ ...... 84 LIST OF REFERENCES ................................ ................................ ................................ ............... 87 BIOGRAPHIC AL SKETCH ................................ ................................ ................................ ........... 96

PAGE 7

7 LIST OF TABLES Table page 2 1 Ingredient composition and nutrient content of late lactation, prepartum and postpartum diets ................................ ................................ ................................ ................. 50 2 2 Effect of evaporative cooling and OmniGen AF supplementation on Hematocrit and blood total protein during the dry period ................................ ................................ .......... 52 2 3 Eff ect of evaporative cooling and OmniGen AF supplementation on temperature humidity index, dry period length, gestation length, rectal temperature, respiration rate, body weight and calf birth weight during the dry period ................................ .......... 53 2 4 Effect of evaporative cooling and OmniGen AF supplementation on dry matter intake, milk yield, milk composition, body weight, and feed efficiency during lactation ................................ ................................ ................................ ............................. 54 3 1 Effect of OmniGen AF supplementation on Neutrophil function during late lactation of dairy cows ................................ ................................ ................................ ..................... 72 3 2 Effect of evaporative cooling and OmniGen AF supplementation on n eutrophil f unction during the dry period ................................ ................................ .......................... 73 3 3 Effect of evaporative cooling and OmniGen AF supplementation on hematology profile during the dry period ................................ ................................ ............................. 74 3 4 Effect of OmniGen AF supplementation on L selectin and CXCR2 mRNA gene expression during late lactation, dry period and early lactation of dairy cows ................. 75 3 5 Genes evaluate d, their probe sequence and catalog number of primer ............................. 76

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Average THI during the dry period of cooled and HT treatment pens ............................. 55 2 2 Effect of evaporative cooling and OmniGen AF supplementation during the dry period on DMI from 7 to 9 weeks relative to calving ................................ ..................... 56 2 3 Effect of evaporative cooling and OmniGen AF supplementation during the dry period on milk yield up to 9 weeks postpartum ................................ ................................ 57 3 1 Effect of evaporative cooling and OmniGen AF supplementation during the dry period on neutrophil function of dairy cows ................................ ................................ ..... 77 3 2 Neutrophil total phagocytosis (%) and neutrophil oxidative burst (%) changes across time during the dry per iod, regardless the treatment ................................ ........................ 78 3 3 Changes in the hematology profile across the dry period of dairy cows ........................... 79 3 4 Changes in Hemo globin (g/dL) across the dry period of dairy cows ............................... 80 3 5 Effect of OG supplementation on L selectin mRNA gene expression during late gestation according to the time on feeding ................................ ................................ ....... 81 3 6 Effect of OG supplementation on L selectin mRNA gene expression of dairy cows during lactation ................................ ................................ ................................ ................. 82 3 7 Effect of OG supplementation on CXC R2 mRNA gene expression of dairy cows during lactation ................................ ................................ ................................ ................. 83

PAGE 9

9 LIST OF ABBREVIATIONS ADF Acid detergent fiber BCS Body condition score BW Body weight CBW Calf birth weight CL Cooling CLOG Cooling with OmniGen AF supplement ation CP Crude protein DM Dry matter DMI Dry matter intake DNA Deoxyribonucleic acid GL Gestation length HCT Hematocrit HT Heat stress HTOG Heat stress with OmniGen AF supplementation LDPP Long day photoperiod MFI Mean fluorescence intensity mRN A Messenger ribonucleic Acid NDF Neutral detergent fiber NE L Net energy for lactation NFC Non fibrous carbohydrates OG OminiGen AF PRL Prolactin PRL R Prolactin receptor RNA Ribonucleic acid RPN R umen protected niacin RR Respiration rate

PAGE 10

10 RT Recta l temperature SCS Somatic cell score THI Temperature humidity index TMR Total mixed ration TNZ Thermoneutral zone TP Total protein TUNEL Terminal deoxynucleotidyl transferase dUTP nick end labeling

PAGE 11

11 Abstract of Thesis Presented to the Graduate Scho ol of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EFFECT OF OMNIGEN AF AND HEAT STRESS ABAT E MENT DURING THE DRY PERIOD ON SUBSEQUENT PERFORMANCE OF COWS By Thiago Fachetti Fabri s May 201 7 Chair: Geoffrey E. Dahl Major: Animal Science s Environmental factors such as high humidity and temperature can cause heat stress. Heat stress during the dry period reduces milk yield in the next lactation Previous data have shown that feed ing OmniGen AF before and during periods of heat stress increases dry matter intake (DMI), reduces respiration rate (RR) and rectal temperature (RT), and it may improve immune status of heat stressed dairy cattle. The objective of the present experiment wa s to evaluate the effect of providing heat stress abatement (HT vs CL, during the dry period) and dietary treatment (Control vs. OG) during and after the exposure to heat stress on dairy cow p erformance. At least 60 days before dry off, sixty six multi paro us Holstein cows were randomly assigned to OG (n = 33) or C ontrol (n = 33) treatments based on the 305 d mature equivalent milk yield Co ws were supplemented with 56 g/d of OmniGen AF or equal amount of bentonite AB20 as control during the last 60 days of lactatio n, dry period and up to 60 days in milk Cows were assigned to four treatments in a completely randomized design with a 2x2 factorial arrangement of treatments. Sixty six multi parous c ows were dried off 45 d before expected calving and, within OG and Control they were randomly assigned to receive only shade with no evaporative cooling (HT, n = 36), shade with evaporative cooling (fans and soakers, n = 30 ) resulting in four treatments heat stress with placebo (HT, n = 17), heat stress with OG (HTOG n=19), cooling

PAGE 12

1 2 with placebo (CL, n = 16) and cooling with OG (CLOG, n = 14). The present experiment demonstrated that compared with CL, HT increase d RR and RT, and OG supplementation improve d thermoregulation of cows exposed to HT by reducing RR and ten ding to reduce RT. Cows exposed to HT had reduce d DMI during the dry period compared with CL cows The exposure to CL and OG treatment improved milk yield in the next lactation. Also, OG supplementation improve d L selectin mRNA gene expression during late and early lactation of Holstein cows and tended to increase neutrophil volume during the dry period. However, CL and OG improve d cow performance and OG supplementation may be a strategy to improve the immune status of cows.

PAGE 13

13 CHAPTER 1 REVIEW OF LITERAT URE Introduction Environmental factors such as humidity and temperature can cause heat stress during the dry period, and cows under heat stress during this phase of the lactation cycle have impaired milk yield in the subsequent lactation which negatively i mpacts profitability of dairy farms (Dahl et al., 2016) Heat s tress occurs when the temperature of the environment is greater than the radiation are environmental factors that influence the intensity of the heat stress. One of the tools to measure the intensity of heat stress in dairy cattle is the temperature humidity index (THI), which expresses the degree of thermal stress for a given environment (Collier and Beede, 1985). Based on the equation reported by Dikmen et al. (2 008), the THI can be calculated as: THI = (1.8T+32) ((0.55 0.0055RH) (1.8T 26)), in which T = air temperature (C) and RH = relative humidity (%). Previous studies have shown that heat stress compromises physiological and production parameters of dairy cows producing more than 35 kg/day when the THI is greater than 68 (Zimbelman et al., 2009) According to Renaudeau (2011), the severity of heat stress depends o n the magnitude (intensity and duration) of the heat stress and the possibility of recovery during the night (i.e. at lower temperatures). Cooling management during the dry period increases milk yield in the subsequent lactation when compared with non cool ed heat stressed cows (Tao et al., 2011), and it improves measures of immune function during the transition period (do Amaral et al., 2011), but the mechanism by which immune function is improved remains unclear. Previous studies have shown that environmen tal factors such as photoperiod and ambient temperatures can be manipulated during the dry period of dairy cows to improve performance on their subsequent lactation (Tao et al., 2011; Velasco et al., 2008), but there is a

PAGE 14

14 lack of information of feeding str ategies to reduce the effect of heat stress during the dry period. Thus, the aim of this review of literature is to describe the effects of heat stress and feeding strategies during the dry period on the subsequent lactation performance of dairy cows. Econ omic Impacts Climate change has captured the attention of the international scientific community as well as the dairy industry and the overall population during the last decade, and hotter summers have become more frequent around the globe. Heat stress neg atively affects profitability of dairy farms in the United States. According St Pierre et al. (2003), hot weather reduces milk yield and the estimated total economic losses during the summer for the United States dairy industry exceeds $897 million annuall y. In states such as Florida and Texas, the economic losses on a dairy cow basis have been estimated at $337 and 383/cow/year, respectively (St Pierre et al., 2003). Heat stress abatement using cooling systems may avoid some of the negative effects of heat stress and reduce economic losses (St Pierre et al., 2003). It is well known that heat stress during the dry period reduces milk yield in the next lactation (Tao et al., 2012b; reviewed by Dahl et al., 2016). A recent economic study estimate d that if cows do not receive evaporative cooling during the dry period, the economic losses to the United States dairy industry could be as much as $162 million dollars per year, assuming a reduction of 1 kg/d in the subsequent lactation ( Ferreira et al., 2016) Thus, heat stress during the dry period has a significant negative impact on dairy farm proftability. Thermoregulatory Response and Management Heat stress for long periods influences the thermoregulatory responses of animals and reduces productivity. Genetic se lection programs have increased animal productivity by ambient temperatures because of the relationship between production level and metabolic heat

PAGE 15

15 production (Re naudeau, et. al., 2011). Homoeothermic animals are capable of maintaining body temperature (i.e. thermoregulation) through losses of heat to the environment via heat dissipation (Legates et al., 1991). Basically, thermoregulation is the balance between hea t gain and heat loss (Legates et al., 1991; Fuquay, 1981). Different thermoregulatory mechanisms can be altered in order to increase the heat dissipation when the animal is under heat stress; some of the physiological mechanisms are the reduction of metabo lic rate, cardiovascular responses, changes in behavioral responses (Legates et al., 1991; Renaudeau, et. al., 2011), altered blood hormone concentrations, increased RR and body temperature, and increased evaporative water loss (Armstrong, 1994). Heat pro duction, non evaporative heat loss, and evaporative heat loss are the three main factors impacting heat exchange. Non evaporative heat loss is subdivided into heat exchange by conduction, convection, or radiation, which can be negative or positive, dependi ng on the environmental temperature. Non evaporative heat loss requires a thermal gradient to operate and it is the primary route of heat exchange on temperatures below 35C (Berman, 2003). However, as environmental heat load approximates body temperature, the evaporative heat loss is the only mechanism available to the animal to maintain its body temperature (Collier et al., 1981; Burgos et al., 2007). Evaporative heat loss only occurs in one direction, through heat loss from the body to the environment (I UPS Thermal Commission, 2001). When the temperature exceeds the TNZ and cows are exposed to high temperatures for a prolonged amount of time, they experience periods of increased body temperature (Collier et al., 1981; Collier et al., 2006). The increase i n body temperature occurs because of the reduced capacity to lose heat through the skin and the accumulation of heat (IUPS Thermal Commission, 2001). Thus, cooling systems may be used to limit heat accumulation by improving heat loss (Ryan et al., 1992; Co llier et al., 2006).

PAGE 16

16 Animals accumulate heat throughout the day in response to environmental heat and failure to dissipate the heat increment of metabolism and digestion (Beede and Collier, 1986). Reduction of metabolic heat production and increase metabol ic heat loss (i.e. evaporative mechanisms) are two responses that occur when animals are exposed to elevated ambient temperature (Yeck and Stewart, 1959). But under heat stress conditions, the alternatives for reduction of heat accumulation by reducing fee d intake (metabolic heat production) and improving heat losses through thermoregulatory mechanisms without reducing production are limited (Legates et al., 1991; Fuquay, 1981). The body accumulates metabolic heat that can be divided into heat generated for maintenance and heat increment (Coppock, 1984; Renaudeau, et. al., 2011). Maintenance and production vary according to physiological state, such as pregnancy, lactation, and growth, and health status (Fuquay, 1981; Coppock, 1984). In order to maintain the rmal equilibrium, animals have four ways to perform heat loss: conduction, convection, radiation, and evaporation (Fuquay, 1981). The surface area per unit of body weight (BW) influences the response of heat loss through conduction and convection, which is affected by the magnitude of the temperature gradient between the animal and the air and the conduction of heat from the body core to the skin and from the skin to the surrounding air (Hansen, 1990). Genetic selection may be an alternative to reduce the negative effects of heat stress on animal production and increase profitability of dairy farmers (Collier and Beede, 1985). The Zebu breeds, which are better adapted for hot and warm environments are shown to have relatively thin skin (Dowling, 1955). The surface area of the body is important to heat dissipation. It was shown that thick skin is not essential for adaptability to a hot environment, but the function of the follicles and the glands of the papillary layer may be critical characteristics for hea t tolerance (Dowling, 1955). Animals exposed to conditions of high air temperature and

PAGE 17

17 radiation and low humidity have differences in heat tolerance because of the differences in the capability to dissipate heat through vaporization of sweat on the skin su rface (Dowling, 1958). Another possibility would be to introduce a genetic characteristic that could improve thermoregulation of dairy cows. The slick haplotype, which is found in Senepol cattle, has been introduced into the Holstein breed by cross breed ing to evaluate thermoregulation in these animals. It confers cattle with short and sleek hair coat. Dikmen et al. (2014) demonstrated that cows with slick hair have improved thermoregulatory ability compared with cows that do not have slick hair, and the former had less milk yield depression during the summer season than the latter. Under heat stress conditions, animals use physiological adjustments to increase heat flow, which is the amount of heat transferred per unit of time between the body and its env ironment when both are at different temperatures. Heat flow increases to support the evaporation of water in the skin and in the surface areas of the respiratory tract when cows are exposed to hot conditions (Renaudeau, et. al., 2011). The skin and mucosal surfaces of the body act directly with the environment to exchange heat. Animals exposed to heat stress have increased cutaneous blood flow, which moves heat from the body core to the periphery and increases heat flow through conduction and convection (Ch oshniak et al., 1982). However, under high temperatures, the capacity for heat flow through convection and conduction is reduced because of the smaller to the difference between environmental and body surface temperatures and, therefore, evaporative heat f low plays the dominant role in the thermoregulation of animals. Evaporative heat loss is mediated by sweating during hot conditions and, as temperatures increase, the respiratory rate begins to elevate to improve heat dissipation as heat stress become mor e severe (Berman, 2005). The two primar y responses displayed by an animal under high

PAGE 18

18 temperature and humidity are panting and sweating (Fuquay, 1981). Sweating leads to evaporative heat loss from the skin surface, whereas when panting occurs, heat is remov ed in the form of vaporized water from the lungs (Renaudeau, et. al., 2011). At high temperatures, evaporative cooling is the dominant strategy of heat loss in dairy cows (Ryan et al., 1992; Gebremedhin and Wu, 2001). This mechanism is affected by air volu me and velocity, ambient temperature, and relative humidity (Fuquay, 1981; Ryan et al., 1992; Collier et al., 2006), and cooling systems may be used to improve heat dissipation through evaporative cooling and increase performance of dairy cows (Ryan et al. 1992; reviewed by Collier et al., 2006). When cattle experience high temperature s the rate of evaporative heat loss of a resting thermoregulatory animal must be increased in order to maintain thermal balance (heat loss via evaporation), which leads to an increased in sweating and RR (IUPS Thermal Commission, 2001). However, heat stress causes a reduction in DMI (Tao et al., 2012b) and reduces cow performance (Renaudeau, et. all, 2011). Different management approaches may be used to improve heat loss of dairy cattle, i.e. evaporative cooling (Ryan et al., 1992). Shade provides an efficient means to shield an animal from direct sunlight and trees may be a natural shade for cattle (Renaudeau, et. al., 2011). Shade is essential to limit losses in milk produc tion and reproductive efficiency (Collier, et al., 2006). However, if cows are managed in areas where the THI exceeds 68, cooling systems may be provided to maintain the cows under favorable conditions and improves their performance. Because heat stress r educes milk yield and reproductive efficiency, and implementation of a cooling program with shade, soakers, and fans should be considered to alleviate the negative effects of heat stress, although an economic analysis need to be performed before installati on of the equipment.

PAGE 19

19 Cooling Systems The reduction of the negative effects of heat stress on dairy cow performance can be achieved through application of housing interventions (Ryan et al., 1992). These interventions include shade to block direct solar ra diation, water spraying to increase conduction, and ventilation to improve convection and enhance evaporative cooling (Ryan et al, 1992). Ideally, a combination of all these methods should be used (Armstrong, 1994). When the THI exceeds 68, high producing dairy cows start to experience reduce d milk yield and cooling systems are important to abate it (Zimbelman et al., 2009). Three basic management strategies may be applied to overcome the negative effects of heat stress, including physical modification, nu tritional management and genetic selection to develop breeds that are less susceptible to the effect of heat stress (Beede and Collier, 1986). Shade The installation of well designed shade may reduce the heat load on a cow and shade protects cattle from s olar radiation, and it is an important first step to limit the negative effect of heat stress and improve performance (Collier et al., 1982a; Collier et al., 2006). Radiation is the transmission of heat in the form of electromagnetic microwaves through the space (Lewczuk et al., 2014). Animals are directly exposed to radiation in open lots and they receive substantial amount of heat throughout the day (Collier et al., 1981; Fuquay, 1981). As stated by Collier et al. (1981) cows under shade had lower RT (38. 7 and 39.6C), reduced RR (78 and 114 breaths/min), and yielded more milk compared with cows that did not receive shade. Cows exposed to shade have increased conception and minimizing heat stress by providing shade reduced the summer depression in fertili ty compared with cows that were not exposed to artificial shade (Roman Ponce et al., 1976). Also, cows exposed to shade during the last trimester of gestation tended to have greater BW compared with cows not provided with artificial shade.

PAGE 20

20 The increased B W may be partially explained by increased cal f birth weight from calves born from cows managed in shaded area The reduced birth weight in calves born from cows with ou t heat abatement was associated with reduced concentrations of estrone sulfate in plasm a which is produced by the placenta. These results suggest a negative impact of heat stress on conceptus function (Collier et al., 1982a). Therefore, it is important to provide large space allocations to increase the shaded area and improve ventilation, s ince it is a critical factor in hot, humid climates (Armstrong, 1994). Free Stall Barn Environmental temperature has a profound effect on animal productivity and under high temperatures and humidity, such as in the Southeast region of the United States, e vaporative cooling is compromised. High temperature and relative humidity increases body temperature and reduces DMI which negatively impact s milk yield of dairy cows (Ryan et al., 1992; Thatcher, 1974). Cooling systems may be used to provide comfort for dairy cattle with sprinklers, fans, and shade, and these are frequently used in free stall barns (Igono et al., 1987). Free stall barns have been installed across the United States to improve animal performance and to protect cows from variable weather con ditions. There are a variety of cooling systems that may be applied inside the barn to alleviate the effect heat stress through heat exchange, i.e., s oakers and fans (Ryan et al., 1992). Evaporative cooling improves milk production compared with cows that are maintained under open shade (Armstrong et al., 1988). Sprinklers are needed to create droplets large enough to wet the cow`s hair coat to the skin and the fans create air movement over the cow`s body, improving the evaporative cooling at the skin leve l, and thereby increasing heat loss to the environment (Collier et al., 2006; Renaudeau, 2011). The sprinkler needs to be applied intermittently to allow time for the moisture to evaporate from the skin. Under arid conditions,

PAGE 21

21 another approach that may be used is a fogger or mister system, and such systems can be used in high humidity regions during daytime hours when relative humidity is low (Renaudeau, 2011). Sprays providing a fine mist on the body surface of the cows associated with forced air improves milk yield under heat stress condition (Ryan et al., 1992) Cooling systems such as misters may be applied on the feed line, and have been used to improve animal production, but such approaches have had little success in improving animal production in humi d areas in the absence of fans to improve air flow across the skin (Armstrong, 1994). A broad spectrum of physical systems may be applied to alleviate the effect of a hot, humid climate, such as the conditions found in Florida and throughout the United Sta tes during summer months. However, cooling systems are not the only factor that may influence animal performance. Other tools can be used in association with environmental modifications to reduce the effect of heat stress in dairy cattle, such as an approp riate nutritional management. Cows under heat stress have reduced feed intake as consequence of a physiological strategy to reduce metabolic heat production (Renaudeau, 2011). Several studies have shown feeding strategies to reduce the effect of heat stres s in dairy cattle during lactation, but more studies need to be done to evaluate the effect of diet manipulation with the goal of diminishing the consequences of heat stress during the dry period. Feeding Strategies to Alleviate Heat Stress Heat stress during the dry period reduces DMI and when evaporative cooling is applied during this phase of the lactation cycle, DMI of dairy cows is increased compared with cows that were not exposed to evaporative cooling systems (Tao et al., 2012b; Dahl et al., 201 6). As DMI declines with heat stress, so does the metabolic rate and this results in a decrease in heat production by the animal (Yeck and Stewart, 1959; Renaudeau et al., 2011). The reduction in DMI is dependent on the environment al temperature and humidi ty to wh ich cows are exposed.

PAGE 22

22 Heat stress also alters water metabolism (Yeck and Stewart, 1959; West, 1999) because of the increased water loss through the skin (McEwan Jenkinson and Mabon, 1973). Subsequent to intake of nutrients, there are three major fa ctors that affect nutrient utilization, including, the potentially absorbable nutrients in the diet consumed, digestion of the diet, and nutrient absorption from alimentary tract mucosa; and all of these factors are impacted under heat stress conditions (B eede and Collier 1986; Farooq et al., 2010) H ormonal and physiological processes have also been studied to better understand the effect of heat stress in the metabolism and endocrine changes may play an important role in the decline of productivity (West et al., 1999). Cows under heat stress respond with lower thyroid hormone concentrations (triiodothyronine and thyroxine), which is probably a physiological strategy to reduce metabolic heat production in the cow (Collier et al., 1982a; Johnson et al., 1988 ). Thus, cows exposed to heat stress may have a different metabolic state (Collier et al., 1982a) and dietary strategies are important to increase energy intake (West et al., 2003). Other hormonal responses that indicate heat stress are increased epinephri ne and norepinephrine concentrations in the plasma (Alvarez and Johnson, 1973) and alterations in catecholamine concentrations might be responsible for a reduction in the passage rate in the digestive tract, which results in l ess intake which limits total nutrient intake (West et al., 1999). The lower dry matter intake in heat stressed cows accounts for approximately 35 to 50% of the reduction in milk yield and the shift of metabolism may be responsible for a large portion of the remainder (Rhoads et al., 2009; Wheelock et al., 2010 ). Practically, two main nutritional strategies are proposed to minimize the reduction of energy and nutrient intake under heat stress conditions. First, by using high energy or protein concentrate diets to overcome the low DM I and, second by using low heat increment diets to improve DMI (Moody et al., 1967, Chen et al.,

PAGE 23

23 1993; Chan et al., 1997). In fact, the concept of increased dietary energy density i.e. highly digestible carbohydrates or better quality protein in the diet relative to fiber follows the idea that fiber has a greater heat increment relative to concentrates because of the reduced effic iency of utilization for acetate relative to protein and glucose (Baldwin et. al., 1980). Several extensive nutritional strateg ies for managing heat stressed dairy cows have been published (Sanchez et al., 1994; West et al., 1999b; Chan et al., 1997; Baumgard et al., 2011 ) and various dietary approaches or feeding strategies have been used to alleviate the adverse effect of heat s tress with varying degrees of success (Moody et al., 1967; Chan et al., 1997; Chen et al., 1993). The aims of the different dietary approaches in order to minimize the effects of heat stress are to maintain water balance, nutrient and electrolyte intakes and/or to satisfy the special nutrient demands during heat stress, such as vitamin and mineral requirements (Renaudeau et al., 2011). Because of heat stress, cows may have increased requirements for mineral s ; cows exposed to high temperature have increased losses of mineral s through the skin by sweating; potassium and sodium having the largest losses (McEwan Jenkinson and Mabon, 1973). Under heat stress condition, i.e. no shade, feeding increased concentrations of dietary potassium (0.66% vs. 1.08%) increas es dry matter intake and milk yield (Mallonee et al., 1985). During heat stress conditions and because of panting and/or sweating, animals lose a significant amount of minerals that leads to disturbed acid base balance in the blood (McEwan Jenkinson and M abon, 1973; Collier et al., 2006). Long term heat stress leads to panting and sweating, which can result in disturbed mineral availability; another consequence from panting is the increased occurrence of respiratory alkalosis that results in reduced blood bicarbonate concentration. This may compromise rumen buffering capacity and increases the chance of acidosis (West, 2003). The combination of decreased DMI and a strategy to increase concentrate

PAGE 24

24 rather than forage leads to further reduction of the bufferi ng capacity. It increases the risk of rumen acidosis during heat stress and consequently increases the needs for dietary buffers during heat stress conditions (Sanchez et al., 1994). Thus, m ineral supplementation may be used to correct it and o n e experimen t showed that heat stressed cows fed with high concentrate diets have increased milk yield with supplementation of dietary sodium bicarbonate compared with cows that did not receive sodium bicarbonate (Schneider et al., 1986). The reduction of energy and n utrient availability because of thermal load may limit milk synthesis of dairy cows, and as an attempt to overcome this issue, energy density of the diet is often increased under high environmental conditions but without success in rescuing milk yield of h eat stressed cows (McDowell et al., 1964; Moody et al., 1967). Fat supplementation under high temperatures has not shown improved performance of dairy cows (Moody et al., 1971). However, other experiments show that increasing the energy content of the diet via fat supplementation can partially overcome the effect of heat stress on milk yield (Knapp and Grummer, 1991) and the formulation of diets with low heat increments can also help improve feed intake and performance under heat stress conditions (Huber et al., 1996). In another experiment, cows housed under shade and fed high quality protein (combination of blood, fish and soybean meal) increased milk yield by 2.4kg/d compared with cows housed under shade and fed low quality protein i.e. corn gluten meal ( Chen et al., 1993) showing the importance of nutritional management under heat stress conditions. Feeding high fiber diets to cows exposed to hot environment decreases DMI. However, in one experiment, high fiber diets increased fat corrected milk per kil ogram of DMI (increased feed efficiency) when cows were exposed to high temperatures, but body weight tended to be reduce d (West et al., 1999b). During heat stress, energy intake may be one limiting factor for

PAGE 25

25 cattle production and the proposed idea to in crease energy density and concentrate and reduce forage content in the diet may be a strategy (reviewed by West et al., 2003). A reduction in the forage content is related with the reduction of the bulkiness of the diet, which stimulates DMI and increase d energy intake (reviewed by West et al., 2003). Highly fermentable carbohydrate and low fiber diets may be used to improve energy intake, but it must be balanced with the increased potential for rumen acidosis related with high grain diets (West, 1999). H e at stress could alter the oxidative status of cows during the transition period ( Bernabucci et al., 2002) Therefore supplementation with antioxidant vitamins may improve the performance of heat stressed cows The capacity for increased performance under heat stress conditions through micronutrient supplementation depends on the physiological status within each species, for example, growing versus reproductive states (Renaudeau, et al., 2011). Vitamin C supplementation may be used as an alternative to impr ove feed consumption and increase growth and carcass performance when broiler chicks are exposed to heat stress conditions (Kutlu, 2001). Vitamin C also assists with folic acid absorption by reducing it to tetrahydrofolate, which then acts as an antioxidan t ( Ramendra et al., 2015) Ano ther essential vitamin, folic acid is important for two critical functions, including biological methylation (i.e. transfer of a methyl group to homocysteine) and synthesis of nucleotides (i.e. it plays an important role in th e formation of purines) and thus it can be supplemented to dairy cows. During heat stress folic acid supplementation improves metabolic efficiency ( Graulet et al., 2007) and the combination of vitamin C and folic acid supplementation could have an antioxid ant effect ( Ramendra et al., 2015) In addition to the effect of heat stress on the metabolism of dairy cows (Wheelock et al., 2009), choline supplementation may play an important role in the hepatic metabolism of heat

PAGE 26

26 stressed dairy cows ( Overton and Wa ldron, 2004). Supplementation of rumen protected choline during the transition period stimulates hepatic metabolic changes of fatty acid and improves performance during early lactation. Ano ther report demonstrated that feeding rumen protected choline durin g the transition period of dairy cows increased insulin and haptoglobin concentration and improved milk components (Leiva et al., 2015). However, in one experiment that evaluated choline supplementation to heat stressed broilers researchers did not see im provements in their performance (Sakomura et al., 2013). Other feed additive that may be used to reduce the negative effects of heat stress is nicotinic acid or niacin. Niacin increases cutaneous vasodilation, which is called flushing and high doses of niacin lead to a stronger vasodilation response that affects the entire body (Gille et al., 2008) Thus, niacin might increase peripheral vasodilation and increase heat dissipation from the body to the environment (IUPS Thermal Commission, 2001). The in creased blood flows and vasodilation in the peripheral tissues increases heat loss through evaporative and convective mechanisms, and may improve the performance of dairy cows when exposed to heat stress during the dry period (Beede and Collier, 1986). Acc ording to Cheng et al. (2006), vasodilatory prostanoids such as prostacyclin and prostaglandin D2 are stimulated after niacin administration. The stimulation in vasodilation may play a role in the dissipation of heat in response to niacin supplementation An experiment performed at the University of Arizona showed that rumen protected niacin (RPN) supplemented to the diet improved thermoregulatory mechanisms in dairy cows and reduced RT of lactating dairy cows exposed to heat stress (Zimbelman et al., 2010) Zimbelman et al. (2013) demonstrated that supplementation of lactating cows with RPN reduced vaginal temperature, confirm ing a previous observation. In a third experiment, a dose

PAGE 27

27 response to RPN was observed, such that as the dose of RPN increases, sweat ing rate and water intake increase and body temperature decreases (Rungruang et al., 2014). Heat stress impacts performance of dairy cows and nutritional strategies to improve productivity ha ve had different degrees of success. An interesting finding when looking into improving the immune status of dairy cows was that OmniGen AF might improve thermoregulatory ability of those animals (Brando et al., 2016). OmniGen AF is a feed additive that has been used o n dairy farms to improve immune parameters. Previou s studies have shown that OmniGen AF supplementation during the transition period improves immune status of animals (Wang et al., 2004; Brando et al., 2016). The migration of immune cells to the site of inflammation is coordinated by cell adhesion molecul es, i.e. L selectin (Zakrzewicz et al., 1997). It was previously shown that OmniGen AF supplementation increases L selectin mRNA expression in response to a pathogen in sheep (Wang et al., 2004). Ryman et al., (2013) observed increased L selectin and IL 8R mRNA expression when cows received OmniGen AF supplementation, which suggests that the additive may be improving immune system response. Indeed, the IL 8R on the surface of neutrophils is important to the migration of these cells to the site of infe ction and to maximize neutrophil function against microbial infection in mice ( Del Rio et al., 2001) Thus, increased L selectin mRNA gene expression of cows exposed to dietary treatment may be important to the health of animals after parturition. Other re search has shown that supplementing OmniGen AF to dairy cows for 30 days prior to parturition improves the immune status after calving (Wang et al., 2007), which may demonstrate that an adaptation period of 30 days is appropriate to identify an immun e response. Brando et al. (2016) showed an increased number of polymorphonuclear cells in the endometrium of cows receiving OmniGen AF supplementation, which may lead to a reduction in

PAGE 28

28 the incidence of endometritis because of the increased number of immun e cells present in the endometrium. OmniGen AF supplementation increases milk production when cows are exposed to heat stress during the dry period and it may affect thermoregulation of dairy cows (Brando et al., 2016). According to the manufacturer, Omni Gen AF is composed of a mixture of active dried Saccharomyces cerevisiae dried Trichoderma longibrachiatum fermentation product, niacin, d calcium pantothenate, riboflavin 5 phosphate, choline chloride, thiamine monohydrate, biotin, calcium carbonate, vit amin B12, pyridoxine hydrochloride, menodione dimethylpyrimidinol bisulfate, sodium aluminosilicate, calcium aluminosilicate, folic acid, diatomaceous earth (Brando et. al., 2016). In addition OmniGen AF supplementation may be an important feed source to alleviate the negative effect of heat stress in dairy cattle ( Brando et al ., 2016; Hall et al., 2014). Physiology of the Mammary Gland during the Dry Period The mammary gland is a complex, highly specialized tissue that is responsible for provi ding the nutrients necessary for the survival of newborn mammals. Mammary gland development is important to support milk yield after parturition. The lactation curve is a function of mammary cell number and secretory capacity per cell, and a reduction in milk production of heat stressed cows is a result of impaired mammary growth during the dry period (Tao et al., 2011). The dry period is necessary for dairy cows and generally a dry period length of 45 60d is recommended to attain maximal milk yield in the next lactation and shortening the dry period to 20 days or less, or the absence of dry period severely reduces milk yield in the following lactation (Sawa et al., 2012). Mammary gland involution and redevelopment are important for milk yield in the subsequent lactation (Hurley, 1989). A nonlactating period between successive lactations known

PAGE 29

29 a non productive period active manageme nt during this stage can often be neglected by farmers (Smith and Todhunter, 1982). During the dry period, the mammary gland goes through three different processes: active involution, which starts right after the cessation of milk removal and represents th e period of transition of the tissue from a lactating to a nonlactating state; steady state of involution, which represents the nonlactating state; and finally, the redevelopment (growth) phase, when much of lactogenesis and colostrogenesis occur (Smith an d Todhunter, 1982; H urley, 1989). After dry off, the cessation of milk removal leads to rapid changes in mammary secretory cell activity because of engorgement of cisternal spaces, ducts and alveoli with milk constituents, and accumulation of milk initiat es the process of mammary gland involution. Mammary involution is a remodeling process of the gland that is mediated by programmed cell death, i.e. apoptosis, and involution is necessary for the subsequent processes, such as, growth (Hurley, 1989, Capuco e t al., 1997). Involution of the secretory tissue is followed by dramatic changes in the components secreted during the transition from lactating to nonlactating stages. Adequate involution of the mammary tissue may be necessary for full proliferation and differentiation of the mammary epithelium during late dry period to achieve maximal milk yield in the next lactation (Oliver and Sordillo, 1989). The changes in structure of the mammary gland begin within 48 hours after the interruption of milk removal (Ho lst et al., 1987) and epithelial cell function shifts during the transition from a lactating to a nonlactating state (Hurley, 1989). Because of the cessation of milk removal, the alveolar lumen and the epithelial cells increase in size (Capuco et al., 1997 ). As involution progresses between day 3 and day 7, a reduction in fluid volume of the mammary

PAGE 30

30 gland occurs (Holst et al., 1987), and similarly, alveolar lumen and epithelial cell size decrease as the mammary gland involutes (Capuco et al., 1997). Re cent studies have looked at the mechanisms involved in mammary involution and redevelopment, i.e. epithelial cell apoptosis and proliferation. The relationships between these two processes, involution and proliferation, should be areas of interest wi th regard to mammary gland function of dairy cows (Hurley 1989). The changes in the mammary cell appearance are not only histological but also ultrastructural and that is consistent with the decrease in milk production by the epithelial cells ( Hurley, 1989 ) Secretions in the mammary gland decrease during involution because of reduction in synthesis and secretion by the epithelia or other cell types into the alveolar lumen, absorption of milk components in the lumen by epithelial cells, lower transcellular transport and secretion into the lumen, invasion of leukocytes into the lumen, ingestion by phagocytes, altered junctional complexes between epithelial cells and digestion by soluble enzymes in the lumen. In contrast to many epithelial cell secretions, lac toferrin and NAGase increase during involution ( Hurley, 1989) Lactoferrin is thought to participate in the nonspecific immune defense during mammary gland involution and NAGase activity increases in mammary gland secretions during tissue synthesis and wit h the invasion of leukocytes (Smith and Todhunter, 1982) Dairy cows are susceptible to new intra mammary infections during the dry period as a result of shifts in mammary immune defenses. The protective factors associated with the mammary gland may be d ivided into three systems: 1) a phagocytic cellular component; 2) the acquired immune system; and 3) bacteriostatic and bactericidal proteins (Oliver and Sordillo, 1989). The action of mammary phagocytes appears to be important to understand the immune def ense during mammary involution. The cells that can be found in the mammary gland are from

PAGE 31

31 two different morphologies, including polymorphonuclear neutrophils and macrophages (Paape and Miller, 1992). Neutrophils are the most predominant immune cell presen t in the mammary gland during the early dry period and decline the dry period advances, whereas macrophages and lymphocytes increase. The mammary phagocytes tend to be more phagocytic on days 5 to 6 after dry off (i.e. early dry period) and less phagocytic after 15 days dry (Paape and Miller, 1992). In recent years, from the perspective of the mammary gland, the dry period has been divided in two periods, early dry period (first 4 weeks), the involution period, and late dry period (last 3 weeks) mostly rela ted with cell proliferation ( Tao et al., 2011; Wohlgemuth et al., 2016 ). At the beginning of the dry period, mammary gland involution is driven by autophagy and apoptosis (Wilde et al., 1997, Sorensen et al., 2006). Apoptosis and autophagy are cellular mec hanisms responsible for the programmed destruction and bulk recycling of cells, respectively. It has been speculated that heat stress may negatively affect mammary gland remodeling and thus milk production in the next lactation (Tao et al., 2011). Apoptot ic activity increases during the first three days after cessation of milk removal (Annen et al., 2008) and decreases later in the dry period (Sorenson et al., 2006) Apoptosis and autophagy are important for the renewal of mammary cells during the early dr y period and to 2007). At the same time, the renewal process of the mammary gland produces a large amount of cellular debris (Capuco et al., 2003), which ne eds to be cleared from the mammary gland by immune cells, such as macrophages and neutrophils, to accelerate involution and subsequent mammary gland development. Heat stress negatively influences the immune status of dry cows as evidenced by decreased lymp hocyte proliferation and lower antibody production to a non specific antigen (do Amaral et al., 2011) Therefore, increased immune activity of cooled cows

PAGE 32

32 might lead to superior mammary gland involution in the early dry period and consequently improved cel l proliferation during late dry period, which may explain the greater milk yield of cooled compared with non cooled cows (Tao et al., 2011). Heat stress also increases the expression of heat shock proteins which have an anti apoptotic effect ( Seigneuric et al., 2011) ; and that may also impair mammary gland involution and negatively affect milk yield. During the early dry period autophagy increases and that may be responsible for the removal of the increased cellular debris present during this phase (Zarzyn ska et al., 2007) Autophagy related protein 7 and microtubule associated protein light chain 3 were used to assess autophagy in the mammary gland of cows ( Wohlgemuth et al., 2016). Relative to cows under heat stress, autophagy was increased when dry cows were exposed to cooling systems (soakers, fans and shade) during the early dry period and it was indicated by increased expression of microtubule associated protein light chain 3 ( Wohlgemuth et al., 2016), and that may set the stage for mammary c ell proliferation after active involution ends (Tao et al., 2011; Wohlgemuth et al., 2016). Prolactin (PRL) plays an important role in mammogenesis and lactogenesis in dairy cows (Tucker et al., 2000). The mammary gland expresses prolactin receptor (PRL R) a member of the cytokine receptor superfamily, and PRL mediates its effect through the activation of this receptor. In addition to the effect on cell proliferation, PRL plays an anti apoptotic effect in mammary cells of mice (Tonner et al., 2000) and cat tle (Accorsi et al., 2002). Environmental factors such as temperature and photoperiod can be manipulated to affect immune status and mammary cell proliferation during the dry period and milk yield in the next lactation. Long day photoperiod (LDPP) during the dry period negatively affects milk production in the subsequent lactation (Auchtung et al., 2005) and decreases immune function compared with cows that were

PAGE 33

33 exposed to short day photoperiod (Auchtung et al., 2004). Long day photoperiod exposure in dry cows also impairs mammary cell proliferation (Wall et al., 2005), which may be responsible for the reduced milk production in the subsequent lactation (Auchtung et al., 2005). Prolactin signaling has been implicated as an endocrine mediator of the LDPP eff ect in dry cows (Dahl, 2008). Because LDPP increases circulating PRL and reduces PRL R in diverse tissues, and specifically in the mammary gland (Auchtung et al., 2005), it follows that a PRL signaling is reduced with LDPP. Following the same pattern of photoperiod, heat stress during the dry period affects prolactin signaling, by increasing circulating PRL concentrations (Tao, et al., 2011). It is possible that the altered PRL and PRL R activity are responsible for the compromised mammary gland developme nt of heat stressed dry cows (Tao et al., 2011). Based in the same idea that LDPP impact mammary gland development and milk yield; heat stress during the dry period negatively affects mammary gland development and subsequent lactation when compared with co oled cows (Tao et al., 2011). Other hormones may be re lated to the negative effect on milk yield in the subsequent lactation when cows are exposed to heat stress, such as progesterone and glucocorticoids. Progesterone (Collier et. al., 1982) an d glucocorticoid (Wise et al., 1988) concentrations increase when cows are exposed to heat stress, and both hormones prevent murine mammary gland involution by decreasing epithelial cell apoptosis (Feng et al., 1995). As milk production is a function of m ammary cell number and the activity of those cells (Capuco et al., 2003), any management intervention that can increases mammary cell number may lead to an increase in milk production. During the early dry period ( i.e. the first 4 weeks), the mammary gland undergoes lower cell proliferation rate compared with the late dry period ( i.e. the last 3 weeks). Heat stress reduces mammary epithelial cell proliferation during the

PAGE 34

34 transition period compared with cooled cows and consequently reduces milk yield in the subsequent lactation (Tao et al., 2011). However, other strategies that may be used to improve immune status and reduce the negative effects of heat stress, such as nutritional manipulation, are additional tools for dairy farmers to implement during the dr y period and improve performance of these animals after calving, as determined by greater milk yield and more robust immune function. Summary Heat stress during the dry period negatively affects the performance of dairy cows in the subsequent lacta tion. In addition to the effect on milk yield, heat stress during the dry period also affects immune status and mammary gland development of dairy cows. Nutritional management is important to overcome some of the effects of heat stress during the transitio n period. Emerging evidence in other studies indicates that OmniGen AF supplementation improve immune status and allow cows to combat the effects of heat stress during the dry period. The goal of this research was to evaluate the effect of OmniGen AF suppl ementation on the performance and health of heat stressed cows during the dry period.

PAGE 35

35 CHAPTER 2 EFFECT OF NUTRITIONAL IMMUNOMODULATION AND HEAT STRESS DURING THE DRY PERIOD ON SUBSEQUENT PERFORMANCE OF COWS Summary Cows that suffer from heat stress during the dry period have impaired milk yield in the subsequent lactation. Feeding OmniGen AF (OG) to lactating cows during heat stress might increase dry matter intake (DMI) and reduce respiration rate (RR; breaths per minute) and rectal temperature (RT; C), but effects on dry cows are not known. We hypothesized that prepartum evaporative cooling and dietary treatment would attenuate the effects of heat stress and improve cow performance in the next lactation. At least 60 days before dry off (late lactation), cows were randomly assigned to dietary treatments (Control, fed with 56 g/d of placebo AB20 and OG, fed with 56 g/d of OmniGen AF) based on the 305 d mature equivalent milk yield. Cows were dried off 45 d before expected calving and, within each dietary t reatment; they were randomly assigned to either heat stress (HT) or cooling (CL) treatments. After dry off, treatments included heat stress with placebo (HT, only shade, 56 g/d of placebo, n = 17), HT with OG (HTOG, 56 g/d of OG, n = 19), cooling with plac ebo (CL, shade, fans and soakers, 56 g/d of placebo, n = 16), and CL with OG (CLOG, 56 g/d of OG, n = 1 4 ). After parturition, all cows were kept under the same evaporative cooling system and management, and cows continued to receive OG or Control treatmen t until 60 DIM. Cows receiving CL treatment during the dry period had reduced afternoon RT (CL vs. HT; 38.9 0.05 vs. 39.3 0.05 C) and RR (CL vs. HT; 45 1.6 vs. 77 1.6 breaths/min). Respiration rate was also decreased by HTOG treatment compared wi th HT treatment (HTOG vs. HT; 69.7 1.6 vs. 77.2 1.6 breaths/min). There was an interaction between heat stress and dietary treatment ; HTOG cows tended to have lower morning RT compared with HT cows. During the dry period, OG reduced DMI relative to Con trol treatment. There was an effect of CL on calf birth weight (CBW), in which CL cows had calves

PAGE 36

36 with greater birth weight than calves born from HT cows (CL vs. HT; 40.6 1.09 vs. 38.7 1.09 kg). Treatments did not affect hematocrit, concentration of to tal protein in blood, and BCS of cows. Cows offered CL, CL OG and HTOG treatments had greater BW at parturition (746.8 16.7 794.9 17.9 and 762.9 14.9 kg, respectively) than HT treatment (720 16.2 kg). Gestation length (GL) was approximately 4 d lon ger for CL cows compared with HT cows. Cows offered CL, CL OG and HTOG treatments produced more milk (40.7 1.6 41.3 1.6 and 40.5 1.6 kg/d, respectively) than HT treatment (35.9 1.6 kg/d). Treatment did not influence postpartum BW and DMI in the fir st 60 DIM, and they averaged (661.5 15.8 kg and 19.40.7 kg/d, respectively). These results confirm that exposure of dry cows to heat stress negatively affects milk yield in the subsequent lactation and prepartum evaporative cooling of dry c ows and OG sup plementation can abate the negative effects of heat stress in the dry period on subsequent performance. Introduction Heat stress negatively affects the performance of dairy cows in the subsequent lactation ( Tao et al., 2012b ) Mammals possess highly regu lated physiological mechanisms to maintain homeostasis when the temperature exceeds the TNZ, which is the range of ambient temperature in which an animal does not have to expend large amounts of energy to control its body temperature. Heat stress occurs wh temperature exceeds 27 C even with low humidity the effective temperature is above the TNZ for high producing dairy cows (Armstrong, 1994). Animals utilize physiological and behavioral mechanisms to maintain body temperature in hot and humid climates. Several indexes have been used to estimate the degree of thermal heat stress experienced by dairy cows, such as the THI, which is associated with increased RT in heat stressed cows (Dikmen and Hansen, 20 09). Dairy cows experience heat stress when THI is greater than 68 ( Zimbelman et al., 2009) and heat stress

PAGE 37

37 negatively affects profitability of the United State dairy industry (St. Pierre et al., 2003). Specifically, during the dry period, heat stress has a negative effect on subsequent milk yield ( Tao et al., 2011 ) and reduces GL and CBW (Tao et al., 2012a; reviewed by Tao and Dahl, 2013). A common management practice for heat stress abatement is to alter the environment and provide active cooling of cows using fans and soakers. In addition, nutritional management practices, alone or in combination with active cooling, have been proposed to reduce the effect of heat stress during the dry period. In the present experiment Omnigen AF (OG; Phibro Animal Healt h Corporation, Teaneck, NJ) or Control was supplemented before, during and after the dry period to Holstein dairy cows. A preliminary report indicated that f eeding OG increased DMI and reduced RR and RT in lactating cows under heat stress (Hall et al., 201 4). Nevertheless, the effect of OG supplementation for heat stress management in dry cows is not known. To date, no studies have been conducted to evaluate the effect of OG supplementation before, during and after the dry period to cooled and heat stressed cows. We hypothesized that OG supplementation before, during and after the dry period, approximately 160 days of supplementation, would reduce the negative effects of heat stress during the dry period and improve subsequent performance of dairy cattle. T herefore, the objective of this experiment was to determine if OG supplementation improves thermoregulation of dairy cows under heat stress conditions during the dry period and whether the OG supplementation improves cow performance after parturition. Ma terials and Methods Treatments, Experimental Design and Cows The experiment was conducted during the summer of 2015 at the University of Florida Dairy Unit (Hague, Florida). The University of Florida Institutional Animal Care and Use

PAGE 38

38 committee approved all treatments and procedures. A 2 x 2 factorial arrangement of treatments was used to evaluate the effects of dietary treatment (Control vs. OG) upon performance of dairy cows with or without heat stress abatement Brando et al. (2016) reported that OmniGen AF contains a mixture of active dried Saccharomyces cerevisiae dried Trichoderma longibrachiatum fermentation product, niacin, vitamin B 12 riboflavin 5 phosphate, d calcium pantothenate, choline chloride, biotin, thiamine monohydrate, pyridoxine hydroch loride, menodione dimethylpyrimidinol bisulfate, folic acid, calcium aluminosilicate, sodium aluminosilicate, diatomaceous earth, calcium carbonate, rice hulls, and mineral oil, but full formulation is proprietary. Sixty days before dry off, cows were rand omly assigned to OG or control (placebo) treatments based on mature equivalent milk yield in the previous lactation. Before dry off, all cows received evaporative cooling and managed according to the procedures of the University of Florida dairy farm. Cows that did not receive OG were fed 56 g/d of bentonite as a Control (AB20, Phibro Animal Health Corporation). Cows were dried off 45 d before expected calving and dietary treatment continued throughout the dry period and the first 60 DIM. After dry off, tr eatments were: heat stress, only shade (HT, n = 17, 56 g/d of placebo), HT with OG (HTOG, 56 g/d of OG, n = 19), cooling with shade, fans and soakers (CL, 56 g/d of placebo n = 16), and CL with OG (CLOG, 56 g/d of OG n = 11). After parturition, all cows we re kept under the same cooling system and management, and dietary treatments continued until 60 DIM. Cows were housed in sand bedded free stall barns throughout the experiment. During the dry period, t he pen for CL and CLOG cows was equipped with active co oling systems including shade, soakers (Rain Bird Manufacturing, Glendale, CA) and fans (J&D Manufacturing, Eau Claire, WI), whereas the pen for HT and HTOG cows only received shade. When the ambient temperature exceeded 21.1 C, fans automatically turned on and the soakers were activated for

PAGE 39

39 1.5 min at 5 min intervals. Photoperiod (14 h light/10 h dark) of the barn for dry cows on all treatments was controlled using metal halide lights. The lights provided approximately 250 lux intensity at eye level of co ws and were kept on from 0600 to 2000 h. After calving, all cows were housed in the same sand bedded free stall barn with shade, soakers and fans for cooling. The THI was calculated based on the equation reported by Dikmen et al. (2008): THI = (1.8 T + 3 2) [(0.55 0.0055 RH) (1.8 T 26)], where T = air temperature (C) and RH = relative humidity (%). Air temperature and relative humidity of each pen in the barn for dry cows were recorded every 15 min by Hobo Pro Series Temp probes (Onset Compute r Corp., Pocasset, MA). Data Measures and Sample Collection At least 60 d before dry off, cows were separated into two groups. They both received the same total mixed ration (TMR; Table 2 1), but one was supplemented with OG whereas the other received pl acebo. During the dry period, all cows were fed the same TMR (Table 2 1) and remained receiving OG or placebo control treatments diets during the entire dry period. Daily DMI of individual cows was measured from dry off to calving using a Calan gate system (American Calan Inc., Northwood, NH). Body weight and BCS were measured once each week during the dry period. Total daily water intake for each pen (HT and CL) was recorded during the dry period and individual water intake/d was estimated by dividing wate r consumption by the number of cows in each pen (L/d). Hydration status of individual cows was monitored by assessing HCT percentage three times a week (1400, Mon Wed Fri). After collection, hematocrit analysis was performed and blood samples were immediat ely placed on ice and centrifuged at 2,619 g for 20 min and TP was assessed. Rectal temperature was measured twice daily, at 0730 and 1430 h, by using a digital thermometer (GLA M700, GLA Agricultural Electronics, San Luis Opispo, CA), and RR was measure d thrice weekly at 1400 h (Mon Wed Fri) by counting the

PAGE 40

40 flank movements for one minute. After parturition, all cows were managed identically as a single group and received forced cooling. Cows were milked twice a day and daily milk yield was recorded for t he first 9 weeks of lactation. The concentrations of true protein, fat and lactose in milk were measured using the AfiLab TM milk analyzer (Kibbutz Afikim, Israel) at each milking and somatic cell score (SCS) was measured once a month at the southeast DHIA laboratory. The AfiLab TM milk analyzer is based on the optical characteristics of light scattering of matter such as milk fat, protein and lactose; and the values obtained using AfiLab TM are well correlated with DHIA measures (Kanyiamattam et al., 2014). A common diet (Table 2 1) was fed to all cows after parturition and DMI was recorded for the first 60 DIM Statistical Analysis Data were analyzed in two distinct periods, the dry period, when treatment with evaporative cooling was provided or not, and duri ng the postpartum period. Descriptive statistics was used to describe the daily mean and respective standard deviation for THI. For the dry period, the responses RT, RR, HCT, TP, BW, BCS, and DMI were analyzed by mixed models using the MIXED procedure of S AS version 9.4 (SAS Institute Inc., Carry, NC). The statistical models included the fixed effects heat stress (HT vs. CL) dietary treatment ( control vs. OG), the interaction between heat stress and dietary treatment week prepartum ( 1, 2, 3, 4, 5, 6, 7), the interactions between heat stress and week prepartum, the interaction between dietary treatment and week prepartum, and the interaction between heat stress, dietary treatment and week prepartum, and the random effect of cow nested within dietary t reatment and evaporative cooling. The THI was calculated for every hour throughout the entire experiment and the THI was averaged by day. During the dry period, the mean THI value for each day was used as covariate for analyses of RT, RR and DMI. For the p ostpartum period, the responses milk yield, milk composition, BW, SCS, feed efficiency, and DMI were analyzed by mixed models using

PAGE 41

41 the MIXED procedure of SAS. The statistical models included the fixed effects heat stress (HT vs. CL), dietary treatment (Co ntrol vs. OG), the interaction between heat stress and dietary treatment, week postpartum (1, 2, 3, 4, 5, 6, 7, 8, 9), the interactions between heat stress and week postpartum, the interaction between dietary treatment and week postpartum, and the interact ion between heat stress, dietary treatment and week postpartum, and the random effect of cow nested within dietary treatment and heat stress Data on GL and DPL were analyzed by the MIXED procedure of SAS with statistical models that included the fixed eff ects heat stress (HT vs. CL), dietary treatment (Control vs. OG), the interaction between heat stress and dietary treatment Calf birth weight was analyzed by the MIXED procedure of SAS with a statistical model that included the fixed effects of calf gende r (male vs. female), heat stress (HT vs. CL), dietary treatment (Control vs. OG), and the interaction between heat stress and dietary treatment. Models were fit to the data and distribution of residuals and homogeneity of variance were evaluated. Data that did not fit the assumptions of normality were transformed before analyses and LSM and respective SEM were back transformed for presentation according to Jorgensen and Pedersen (1998). The Kenward Roger method was used to obtain the approximate degrees of freedom. The covariance structure that resulted in the best fit model based on the smallest The LSM SEM are reported. Differences with P 05 were considered statically significant and between 0. 05 P 10 was referenced as a tendency. Results Measurements during Dry Period Pens for heat stressed and cooled cows had similar THI (Figure 2 1) during the dry period, which was expected, because the cooling system in the c urrent experiment was designed to cool the animals and not the environment. During the dry period, the THI was measured from

PAGE 42

42 June 4 th to October 10 th 2015 and the mean daily THI and the diurnal pattern of DHI were always above 68 throughout the experiment (Figure 2 1 inset). During the dry period, there was a significant effect of heat stress on RT (morning and afternoon) and RR; HT cows had increased ( P < 0.01 ) morning and afternoon RT and RR ( Table 2 3). Supplementation with OG also decreased ( P < 0.01) RR (Table 2 3). There was an interaction ( P = 0.07) between heat stress and dietary treatment for RR (Table 2 3); HTOG cows tended to have lower morning RT compared with HT cows ( 0.065 C Table 2 3). During the dry period, HT and OG treatments reduced DM I relative to CL and Control treatments respectively (Table 3; P = 0.10 and P = 0.07, respectively). Cal ves born from CL cows were heavier f birth weight was greater ( P = 0.02) compared with calves born from HT cows (Table 3). No differences in HCT, TP ( Table 2 2) and BCS (Table 2 3) were detected among treatments. As a group, HT cows consumed more water than CL cows (41.40 vs. 21.5 L ). During the dry period, BW was collected daily to produce a weekly mean value for further analysis. Cows receiving prepar tum c ooling were heavier ( P = 0.08) compared with HT cows and OG supplementation increased ( P < 0.01) BW compared with cows that did not receive OG supplementation. Gestation length was 3.8 2.0 days longer ( P = 0.01 ) for CL cows compared with HT cows ( Ta ble 2 3), but there was no treatment effect ( P = 0.30 ) with OG supplementation, (1.5 1.9; Table 2 3) compared with Control cows. Production Variables during Lactation Cows exposed to HT during the dry period had decreased ( P < 0.09 ) milk yield compared w ith cows provided with CL regardless of OG treatment (Figure 2 3). Until 9 weeks postpartum, CL cows produced (40.7 1.6 kg/d) more milk relative to HT cows (35.9 1.6 kg/d). No treatment effects on milk fat, protein or lactose concentrations, and SCS were observed during lactation (Table 2 4). There was increased ( P < 0.10) milk yield of cows that received OG

PAGE 43

43 supplementation (Table 2.4). There was a significant difference ( P < 0.03 ) in milk yield when HT cows were supplemented with OG compared with HT cows (HTOG vs. HT, 40.5 1.6 vs. 35.9 1.6 kg/d). However, there was no difference in milk yield when OG was fed to CL cows (CL vs. CLOG, P < 0.81). During the postpartum period, there were no differences in DMI (Figure 2 2) and BW among treatments (Tabl e 2 4). There were no differences on parity among groups (P = 0.18). After analyzed, parity was averaged among all groups and yielded 2.77 0.21. Discussion Dry cows that experience heat stress suffer a number of negative outcomes during heat stress and in the subsequent lactation (Tao and Dahl, 2013). For example, RT and RR increase with heat stress (Tao et al., 2012b; Wohlgemuth et al., 2016 ), whereas dry matter intake decreases relative to dry cows that are actively cooled (Tao et. al., 2011). Heat s tress also negatively alters immune status of dry cows as evidenced by decreased lymphocyte proliferation and less antibody production to a non specific antigen (do Amaral et al., 2011) Further heat stress has residual negative effects on immune status in the subsequent lactation including neutrophil phagocytosis and oxidative burst activity ( do Amaral et al., 2011 ). Dry cows that experience heat stress also produce less milk in the subsequent lactation because of reduced mammary cell proliferation during the prepartum period (Tao et al., 2011). Thus, active cooling is one of several management approaches to abate these effects of heat stress o n dry cows. However, other feed based options may be available to alter the physiological responses observed with hyperthermia, including OG supplementation. The average THI during the entire experiment remained above 68 during day and night, and because cows are exposed to heat stress conditions when THI is greater than 68 ( Zimbelman et al., 2009), our treatment co nditions induced heat stress in the absence of cooling. Further, the

PAGE 44

44 cooling system was effective to overcome the impact of heat stress on cooled cows compared with heat stressed cows as demonstrated by a 0.4 C reduction in afternoon RT, and a 32 breaths/ min reduction in RR. Those responses are similar to previous reports that cooled cows had decreased afternoon RT and RR (Tao et al., 2012b). Previous studies indicate that Ho lstein heifers supplemented with OG had a lower RR when compared with heifers with out supplementation ( Hall et al., 2014). Following the same pattern, the present experiment demonstrated that OG supplementation to heat stressed cows reduced RR when compared that received HT treatment. In addition to the effect on RR and RT, heat stress ed cows had higher consumption of water relative to cooled cows (41.5 vs. 21.5 L ), which is consistent with previous experiments (Tao et al., 2011). Therefore, the HT treatment in the present experiment was appropriate to evaluate the hypothesis that OG su pplementation before, during and after the dry period (approximately 160 d) would overcome the effects of heat stress during the dry period and improve cow performance in the subsequent lactation Exposure of cows to heat stress for long periods influence s the thermoregulatory responses of animals and reduces animal productivity (Renaudeau, et. al., 2011). Cows accumulate heat throughout the day in response to environmental heat and failure to dissipate the heat increment of metabolism and digestion (Beede and Collier, 1986). However, cows exposed to CL, CLOG and HTOG were capable of dissipat ing more heat to the environment and maintain ing its body temperature at lower levels compared with HT cows. It indicates that the t reatments imposed with evaporative c ooling and dietary supplementation with OG reduced some of the negative effect of heat stress which was also discussed by Beede and Collier ( 1986 )

PAGE 45

45 in which physical modification and nutritional management may be applied to minimize the negative effect of heat stress. The reduction in application of cooling systems, such as shade, evaporative cooling, ventilation and the combination of these systems (Armstrong, 1994). Cooling systems, s uch as sprinkles are needed body Such system improves evaporative cooling at the skin level, thereby increasing heat loss to the environment (Collier et al., 2006; Renaudeau, 2011) which may explain why CL cows had reduced RT and RR. However, the mechanism by which OG supplementation improves thermoregulation and reduces RT and RR is still unknown and further studies are warranted During the dry period, HT d ecreases DMI in cows compared with CL cows (do Amaral et al., 2009; Tao et al., 2011 ). Following the same pattern in our experiment, CL cows had greater DMI than HT cows, whereas OG supplementation decreased DMI during the dry period compared with Control cows At parturition, CL cows had higher BW relative to HT cows. Decreased BW of HT cows may reflect the high energy demand to maintain body temperature in HT cows and could be a result of decreased DMI during the dry period. Previous studies have reported lower DMI and BW gain during the dry period under heat stress conditions (do Amaral et al., 2009; Tao et al., 2011 ). The difference in BW may be partially explained by greater fetal growth in cows exposed to CL systems and OG supplementation which may p artially explain the reason that there were no differences in BCS among treatments. Following parturition, nutrient demands increase to initiate and sustain lactation. Indeed, after parturition and c onsistent with increased nutrient demand to sustain a higher level of milk yield after the peak of lactation, one experiment demonstrated that cooled cows had higher DMI

PAGE 46

46 at 6 weeks postpartum compared with heat stresse d cows ( Tao et al., 2011 ). However, there was no difference in postpartum DMI in the present experiment, which is consistent with a number of other reports and likely reflects the relatively brief duration of intake recording in those studies (do Amaral et al., 2009; Tao et al., 2011 ). Thus, the increase in milk yield precedes the increase in DMI and since DMI was only measured for 9 weeks the separation of DMI according to milk had not yet become apparent Previous studies indicate that heat stress dur ing the dry period reduces GL when compared with cooled cows (Tao et al., 2012a; reviewed by Tao and Dahl, 2013 ). In ewes and cows, newborns from heat stressed dams during late gestation had decreased birth BW relative to those born from cooled dams (Brow n et al., 1977; Collier et al., 1982b; Tao et al., 2011 ). The observed reduction in birth weight might be explained by the decreased GL and dry period length measured in the present experiment. Cows receiving HTOG treatment tended to have longer GL and dry period length when compared with HT cows, which would explain heavier calves at birth. In the same pattern, CL cows had heavier calves at birth relative to HT cows. These results are consistent with the longer GL of CL and OG cows. It is known that heat s tress during the dry period decreases milk yield in the next lactation (Tao et. al., 2011; West et al., 2003), which is consistent with our results Similar to the present experiment, Adin et al. (2009) did not observe differences between cooled cows and h eat stressed cows in milk fat yield, whereas others have observed greater milk fat yield in cooled cows compared with heat stressed cows (Avendano Reyes et al., 2006; do Amaral et al., 2009; Tao et al., 2011). Milk protein yield was significantly greater f or CL cows compared with HT cows, which is consistent with previous studies (Adin et al., 2009; do Amaral et al., 2009; do Amaral et al., 2011). Higher milk protein yield measured in the present experiment resulted from

PAGE 47

47 the higher milk yield of CL cows, be cause there was no difference in protein percentage between groups OmniGen AF supplementation of heat stressed dry cows during late lactation, the dry period, and through 60 DIM increased milk yield in the subsequent lactation compared with heat stressed dry cows receiving Control diet although supplementation of OG to CL cows was without significant effect. OmniGen AF supplementation also increased milk fat yield relative to HT cows without supplementation, which reflects the higher milk yield of HTOG co ws and similar trends were observed for milk protein and lactose yields. It has been reported that OG supplementation during the transition phase resulted in greater milk yield relative to cows that received Control diet (Brando et al., 2016), although t he magnitude of the increase was less than that observed in the present experiment. Similar to the report by Brando et al. (2016), we did not show differences in SCS among treatments. Collectively, the present experiment extends previous work and suggests that supplementation with OG before, during and after the entire dry period improves lactation performance in cows exposed to HT. Compromised mammary growth caused by heat stress during the dry period may originate from impaired mammary involution during the early dry period ( Tao et al., 2011; Wohlgemuth et al., 2016 ) In the beginning of the dry period, mammary gland involution is driven by autophagy and apoptosis (Wilde et al., 1997; Sorensen et al., 2006). Apoptosis and autophagy are mechanisms respons ible for the elimination and recycling of cells, respectively, and are important for the renewal of mammary cells during the early dry period and cell same time, the renewal process of the mammary gland causes accumulation of a large amount of cellular debris (Capuco et al., 2003), which has to be cleared from the mammary gland by

PAGE 48

48 immune cells, such as macrophages and neutrophils, to establish full involution and subsequent mammary development. Therefore, decreased immune activity may slow mammary gland involution in the early dry period and consequently lead to lower cell proliferation during the late dry period, and thus explain the lower milk yield observed with dry period HT cows. And, immunomodulation through a dietary supplement early in the dry period may reverse some of the negative effect of heat stress on immune function. The lactation curve is a function of mammary epithelial cell number and secretory capacity per cell, and mammary cell number is a function of the difference between cell proliferation and apoptosis ( Capuco et al., 2003). It is possible that the reduced milk yield in heat stressed cows is caused by impaired mammary growth during the dry period (Capuco et al., 2003) and indeed Tao et al. (2011) reported that heat stress decreases the proliferation of mammary epithelial cells when compared with cooled cows supporting the idea that increased mammary growth supports the higher milk yield o bserved in cooled cows. Effects of OG supplementation on milk yield may be related to the impact of OG on immune function, particularly in the early dry period. Heat stress increases the expression of heat shock proteins that have an anti apoptotic effect ( Seigneuric et al., 2011) and thus may impair mammary gland involution and negatively affect subsequent milk yield. Further, heat impaired chemotaxis and phagocyto sis. OmniGen AF is an immunomodulatory supplement (Wang et al., 2007; Nace et al., 2014), and r ecent studies have shown that OG supplementation improves immune status of heat stressed dairy cattle (Hall et al., 2014; Brando et al., 2016) Thus, in the pre sent experiment, OG supplementation before the heat stress was imposed in the dry period may have improved immune function and allowed for accelerated mammary

PAGE 49

49 involution relative to heat stress alone, but further analysis is needed to evaluate the effect o f OG supplementation on immune status during the dry period. This mechanism would also be consistent with the lack of additional effect of OG in cooled cows. However, further investigation is needed to confirm any effect of OG supplementation on mammary g land development in the early dry period. Conclusions Heat stress during the dry period negatively affects the performance of dairy cows in the next lactation, that is, heat stressed cows produce less milk when compared with cooled cows. Compared with on ly heat stressed cows, OG supplementation in combination with cooling systems improves milk yield. Heat stress negatively affects thermoregulation of dry cows, by increasing physiological responses, such as, RT and RR, and prepartum evaporative cooling sys tems and OG supplementation partially reverses these responses. Heat stress reduces GL and CBW and prepartum evaporative cooling and dietary treatment abate its negative. However, cooling dry cows improve dairy cow performance in the subsequent lactation, and OG supplementation may be implemented in association with cooling systems to overcome the negative effects of HT during the dry period.

PAGE 50

50 Table 2 1. Ingredient composition and nutrient content of late lactation, prepartum and postpartum diets Diet 1 In gredients, % DM Late lactation Prepartum Postpartum Corn silage 16.4 50.0 21.6 Bermuda grass hay --17.0 --Alfalfa hay 19.2 --23.9 Triticale silage 2.0 ----13.4 20.0 12.0 Corn, finely ground 26.6 --19.7 Soybean hulls 3.8 3.4 --Citrus pulp, dry 3.8 --5.9 Whole cottonseed 3.8 --4.8 Soybean meal, solvent extract 47% CP 6.0 --5.7 Saturated free fatty acids 2 1.0 --1.1 Mineral vitamin premix, late lactation 3 3.6 ----Mineral vitamin premix, prepartum 4 --4.0 --Acidogenic salt product 5 --5.0 --Mineral vitamin premix, early lactation 6 ----4.8 Mycotoxin binder 7 0.4 0.6 0.5 Nutrient content, DM basis NE L 8 Mcal/kg 1.65 1.53 1.67 OM, % 91.5 93.0 0.3 90.9 0.5 CP, % 16.4 13.6 0.3 18.5 0.8 NDF, % 30.7 44.1 2.3 29.8 1.1 Forage NDF, % 15.9 30.3 2.3 17.6 0.8 ADF, % 19.9 26.5 2.0 19.3 0.5 Nonfibrous carbohydrates, 9 % 41.7 34.1 1.9 39.9 0.5 Starch, % 26.7 20.0 3.0 23.8 0.8 Ether extract, % 5.5 4.5 0.1 5.3 0.3 Ca % 0.71 0.76 0.02 0.87 0.05 P, % 0.37 0.32 0.01 0.35 0.01 Mg, % 0.36 0.59 0.03 0.45 0.03 K, % 1.43 0.95 0.11 1.62 0.07 S, % 0.22 0.32 0.02 0.23 0.02 Na, % 0.54 0.05 0.02 0.54 0.01 Cl, % 0.48 0.68 0.04 0.59 0.06 DCAD, 10 m Eq/kg 330 123 32 364 41 1 Late gestation diet was fed at least 60 days before dry off. Prepartum diet was fed from 231 d of gestation to calving and postpartum diet from calving to 60 DIM. 2 Energy Booster Mag; Milk Specialties, Eden Prairie, MN. 3 T he late lactation mineral and vitamin supplement contained (DM basis) 12.4% ground corn grain, 29.8% sodium sequicarbonate, 14.3% DCAD Plus (Arm and Hammer Animal Nutrition, Trenton, NJ), 13.2% calcium carbonate, 7.7% magnesium oxide, 6.6% sodium chloride, 6.6% dicalcium phosphate, 0.99% ClariFly Larvicide (Central Life Sciences, Schaumburg, IL), 0.38% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.22% Intellibond Vital 4 (Micronutrients, Indianapolis, IN), 0.20% Rumensin 90 (Elanco Animal Heal th, Greenfield, IN), 0.0017 ethylenediamine dihydriodide, 0.16% of a premix containing vitamins A, D and E and 5.7% potassium chloride. Each kg contains 6.0% Ca, 1.1% P, 3.9% Mg, 10.2% K, 0.13% S, 9.7% Na, 7.2% Cl.

PAGE 51

51 520 mg Zn, 120 mg Cu, 430 mg Mn, 7 mg Se, 3.6 mg Co, 12 mg I, 160,000 IU vitamin A, 28,000 IU vitamin D, 750 IU vitamin E, and 400 mg of monensin. 4 The prepartum mineral and vitamin supplement contained (DM basis) 64.1% corn gluten feed, 8.2% calcium carbonate, 15.7% magnesium sulfate hepathydra te, 6.0% magnesium oxide, 2.3% sodium chloride, 0.42% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.27% Intellibond Vital 4 (Micronutrients, Indianapolis, IN), 0.002% ethylenediamine dihydriodide, 0.66% of a premix containing vitamins A, D an d E, 0.37% Rumensin 90 (Elanco Animal Health, Greenfield, IN), and 2.0% ClariFly Larvicide (Central Life Sciences, Schaumburg, IL). Each kg contained 13.6% CP, 3.7% Ca, 0.7% P, 5.5% Mg, 0.9% K, 1.1% Na, 1.6% Cl, 2.6% S, 788 mg Zn, 180 mg Cu, 581 mg Mn, 9 m g Se, 4.4 mg Co, 16 mg I, 104,000 IU vitamin A, 30,000 IU vitamin D, 1,500 IU vitamin E, and 800 mg of monensin. 5 SoyChlor, West Central Soy, Landus Cooperative, Ames, IA. 6 The early lactation mineral and vitamin supplement contained (DM basis) 19.4% Lys AAmet blood meal (Perdue Agribusiness, Salisbury, MD), 26.8% sodium sesquicarbonate, 14.4% DCAD Plus (Arm and Hammer Animal Nutrition, Trenton, NJ), 5.7% potassium chloride, 13.2% calcium carbonate, 4.0% dicalcium phosphate, 7.7% magnesium oxide, 6.6% sodi um chloride, 0.22% Intellibond Vital 4 (Micronutrients, Indianapolis, IN), 0.39% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.0015% ethylenediamine dihydriodide, 0.32% of a premix containing vitamins A, D and E, 0.11% biotin 2%, 0.22% Rumens in 90 (Elanco Animal Health, Greenfield, IN), and 1.0% ClariFly Larvicide (Central Life Sciences, Schaumburg, IL). Each kg contains 17.2% CP, 6.2% Ca, 0.9% P, 4.5% Mg, 10.4% K, 11.5% Na, 7.2% Cl, 0.2% S, 605 mg Zn, 143 mg Cu, 490 mg Mn, 8 mg Se, 4.4 mg Co, 12 mg I, 160,000 IU vitamin A, 28,000 IU vitamin D, 1,500 IU vitamin E, and 460 mg of monensin. 7 NovaSilPlus, BASF, Florham Park, New Jersey. 8 Calculated using the NRC (2001) according to the chemical composition of the dietary ingredients and adjusted for 21, 11 and 20 kg of DM intake for the late gestation, pre and postpartum periods, respectively. 9 Calculated as follows: NFC = DM (ash + CP + ether extract + NDF NDF insoluble CP). 10 Calculated as follows: DCAD = [(mEq of K) + (mEq Na)] [(mEq of Cl) + (mEq of S)].

PAGE 52

52 Table 2 2. Hematocrit and blood total protein of cooled or heat stressed cows during the dry period (~ 45 d) and receiving OmniGen AF ( OG) or not for 60 days before, during, and after the dry period. C ooling (CL; n = 15), heat str ess (HT; n = 16), CL with OG (CLOG; n = 14) or HT with OG (HTOG; n = 19). Variable CL HT TRT CLOG HTOG SEM T1 1 P Value T2 2 T1 x T2 3 Hematocrit, % 30.74 30.67 30.53 30.45 0.46 0.87 0.64 0.98 Total Protein, g/dL 7.29 7.40 7.33 7.35 0.08 0.42 0.99 0.58 1 T1 = effect of heat stress (HT vs. CL). 2 T2 = effect of dietary treatment (OG vs. Control). 3 T1xT2 = treatment 1 by treatment 2 interaction.

PAGE 53

53 Table 2 3. Temperature humidity index (THI) of the pens, dry period length (DPL), gestation length (GL), rec tal temperature (RT), respiration rate (RR), body weight (BW) and calf birth weight (CBW) of cooled or heat stressed cows during the dry period and receiving OmniGen AF ( OG) or placebo control from 60 d before dry period to 60 d after calving (total of 16 0 days). C ooling (CL; n = 15), heat stress (HT; n = 16), CL with OG (CLOG; n = 14) or HT with OG (HTOG; n = 19). CL HT TRT CLOG HTOG SEM T 1 2 P Value T 2 3 T1 x T2 4 Pen THI 77.6 77.90 2.56 DPL, d 47.6 43.9 49.5 45.5 1.54 0.01 0.28 0.90 GL, d 278.2 274.4 279.6 276 4.43 0.01 0.30 0.97 RT am., C 38.59 a 38.84 c 38.69 b 38.77 b,c 0.04 <0.01 0.56 0.02 RT pm. C 38.92 39.31 39.00 39.28 0.05 <0.01 0.62 0.25 RR, breaths/min 45.2 a 77.2 c 43.6 a 69.7 b 1.59 <0.01 <0.01 0.07 BW 1 kg 746.8 720. 0 794.9 762.9 16.45 0.08 <0.01 0.88 BCS 3.5 3.41 3.41 3.55 0.08 0.79 0.74 0.15 CBW, kg 40.6 38.7 43.1 39.7 1.09 0.02 0.11 0.48 DMI, kg/d 11.0 10.3 10.2 9.3 0.46 0.10 0.07 0.90 1 During the dry period, BW was collected weekly and averaged for the stati stical analyze (7 weeks before calving). 2 T1 = effect of heat stress (HT vs. CL). 3 T2 = effect of dietary treatment (OG vs. Control). 4 T1xT2 = treatment 1 by treatment 2 interaction.

PAGE 54

54 Table 2 4. Dry matter intake (DMI), milk yield, milk composition, bo dy weight (BW), and feed efficiency of cooled or heat stressed cows during the dry period and receiving OmniGen AF ( OG) or not throughout the dry period and early in lactation. C ooling (CL; n = 15), heat stress (HT; n = 16), CL with OG (CLOG; n = 11) or H T with OG (HTOG; n = 19). CL HT TRT CLOG HTOG SEM T 1 3 P value T 2 4 T1x T2 5 DMI, kg/d 19.6 19.2 19.1 19.7 0.7 0.86 0.85 0.50 Milk yield, kg/d 40.7 35.9 41.3 40.5 1.6 0.09 0.10 0.24 Fat, % 3.55 3.71 3.73 3.63 0.07 0.66 0.48 0.09 True protei n, % 2.85 2.89 2.89 2.83 0.03 0.68 0.62 0.13 Lactose, % 4.70 4.63 4.70 4.65 0.02 0.01 0.61 0.82 Fat yield, kg/d 1.43 1.31 1.50 1.47 0.07 0.25 0.10 0.53 Protein yield, kg/d 1.13 1.01 1.17 1.14 0.05 0.10 0.11 0.39 Lactose yield, kg/d 1.93 1.72 2.03 1 .90 0.09 0.07 0.13 0.68 SCS 3.26 2.68 3.78 3.36 0.50 0.32 0.24 0.87 Body weight, kg 2 654.8 650.2 670.3 670.9 15.75 0.89 0.26 0.87 Feed efficiency 1 2.13 1.98 2.32 2.15 0.1 0.11 0.08 0.90 1 Feed efficiency = kilograms of 3.5% FCM per kilogram of DMI. Fee d efficiency was calculated from calving until 60 days postpartum. 2 After calving, BW was collected weekly and averaged for the first 9 weeks in lactation for statistical analysis 3 T1 = effect of heat stress (HT vs. CL). 4 T2 = effect of dietary treatme nt (OG vs. Control). 5 T1xT2 = treatment 1 by treatment 2 interaction.

PAGE 55

55 Figure 2 1. Average THI 2.56 during the dry period of cooled and HT treatment pens. Open ) represent cooled and heat stressed pens, respectively. Th e inset represents the average THI in hour of the day during the entire period. Dashed lines represent the threshold when cows start to experience the effect of HT and solid line represents the daily average THI/hour.

PAGE 56

56 Figure 2 2 Effect of cooling (CL; n = 15), heat stress (HT; n = 16), CL with OG (CLOG; n = 11 or HT with OG (HTOG; n = 19) during the dry pe riod on DMI from 7 to 9 weeks represent heat stressed cows and ) represent supplemented (OG) heat stressed and cooled cows, respectively. Data were split into prepartum and postpartum periods and analyzed separately. During the prepartum period, HT and OG supplementation reduced DMI ( P = 0.10 and P = 0.07); during the postpartum period, no differences in DMI among treatments. Shade represents th e prepartum period. The pooled SEM was 0.46 for the prepartum period and 0.67 for the postpartum period. Heat stress tended (P = 0.10) to reduce DMI compared to CL cows during the dry period.

PAGE 57

57 Figure 2 3 Effect of cooling (CL; n = 15), heat stress (HT; n = 16), CL with OG (CLOG; n = 14) or HT with OG (HTOG; n = 19) during the dry period on milk yield up to 9 weeks represent heat stressed cows and cooled ) rep resent supplemented (OG) heat stressed and cooled cows, respectively. After calving, all cows were managed and housed under same conditions. Main effect of heat stress ( P = 0.09), main effect of dietary treatment ( P =0.10) and main effect of interactions ( P = 0.24); SEM = 1.62.

PAGE 58

58 CHAPTER 3 NUTRITIONAL AND HOUSING STRATEGIES DURING THE DRY PERIOD TO AMELIORATE THE NEGATIVE IMPACT OF HEAT STRESS ON IMMUNE STATUS OF DAIRY COWS Summary Dairy cows exposed to heat stress during the dry period have decreased immune function, mammary cell proliferation, as well as decreased milk yield in the subsequent lactation compared with cooled cows. However, strategies to abate the negative effect of heat stress during the dry period have been used to improve milk yield and perf ormance of dairy cattle. The objective of the present experiment was to evaluate the effect of heat stress (HT vs CL, during the dry period) and the effect of dietary treatment (Control vs. OG) to dairy cows before, during and after the exposure to heat st ress (during dry period) on immune function, hematology and immune related gene expression of dairy cows. At least sixty days before dry off, cows were cooled (i.e. shade, fans and soakers) and divided into two groups: Control (fed 56 g/d of AB20; Control ) and OmniGen AF (fed 56 g/d of OmniGen AF; OG). Cows were dried off 45 d before parturition and further split into cooling (shade, fans and soakers; CL) or HT (only shade) pens, which resulted in 4 treatments: HT (n=17), CL (n=16), HT with OG (HTOG, n=19) and CL with OG (CLOG, n=14). Rectal temperature was measured twice daily and RR was recorded at 14:00 from dry off to calving. The average THI during the dry period was 77.8, which demonstrate s that cows were exposed to heat stress continuously during the dry period. After calving, all cows were kept at the same environment and exposed to cooling systems, i.e. fans and soakers. Blood samples were collected before dry off ( samples were grouped as: 15 to 30, 31 to 60, 61 to 90, and more than 90 days on supplementation), during the dry period (25 days relative to dry off) and during lactation (at 14, 35, and 67 DIM) from a subset of animals (HT, n = 12; CL, n = 12; HTOG, n = 11 and CLOG, n = 9) to evaluate L selectin ( CD62L copies per ng of total mRNA)

PAGE 59

59 and CXCR2 (also known as IL8 R ) mRNA gene expression in immune cells. Additional blood samples were collected 3 d before dry off and during the dry period at d 3, 7, 14 and 25 relative to dry to evaluate neutrophil function and blood hematology (HT, n=8; C L, n=7; HTOG, n=8 and CLOG, n=6). Before dry off, OG tended to increased L selectin expression in peripheral immune cells and there was no difference among treatments in the expression of CXCR2 in peripheral immune cells compared with Control cows. Hematol ogy data was assessed and red blood cells volume, white blood cell volume and neutrophil volume were similar between HT and CL treatments during the dry period, but hematocrit percentage was decreased under heat stress conditions. There were no differences in hemoglobin volume and lymphocyte volume between HT and CL treatments; however, OG decreased hemoglobin volume levels compared with Control. Dietary treatment and prepartum evaporative cooling improved L selectin mRNA gene expression after calving. The results of the present experiment indicate that OmniGen AF supplementation may improve the immune status of dairy cows during the dry period and in the subsequent lactation, but additional studies have to be performed to understand the mechanism by which O G supplementation improves the immune status and performance of dairy cattle. Introduction Exposure to high humidity and temperature causes heat stress. Dairy cows exposed to heat stress during the dry period have impaired milk production in the next lacta tion (Dahl et al., 2016) which negatively impacts profitabilit y of dairy farmers. Mammary cell number and secretory capacity per cell is related to milk yield. Heat stress during the dry period compromises mammary gland growth and consequently reduced milk yield in the subsequent lactation (Capuco et al., 2003) Mamm ary gland development during the dry period may be important for increasing milk production in the next lactation (Hurley, 1989).

PAGE 60

60 The nonlactating period of dairy cows is important for full recovery of the mammary gland tissue to support maximal milk yiel d. After dry off, at the cessation of milk removal, the mammary gland undergoes rapid changes and through a process of involution. Mammary gland involution is a remodeling process of the mammary gland that is mediated by programmed cell death (apoptosis) ( Hurley, 1989; Capuco et al., 1997) In the past years, and from the perspective of the mammary gland, the dry period has been divided in two periods, early dry period (involution) and late dry period (cell proliferation) ( Tao et al., 2011; Wohlgemuth et al ., 2016 ) In the beginning of the dry period, mammary gland involution is driven by autophagy and apoptosis (Wilde et al., 1997; Sorensen et al., 2006). Apoptosis and autophagy are mechanisms responsible for the destruction and recycling of cells, respecti vely. Both of these processes are linked to immune reactions, thus immune status may alter their progression. During the dry period, dairy cows have higher susceptibility to intramammary infection (Oliver and Sordillo, 1989 and Lasceiles et al., 1979) and mammary phagocytic mechanisms during this period may be important to mammary gland involution. Recent studies have looked at the mechanisms involved in mammary involution and redevelopment under heat stress ( Tao et al., 2011; Wohlgemuth et al., 2016 ). The changes in the mammary gland are not only histological but also ultrastructural and are consistent with the decreasing milk production by the epithelial cells ( Hurley, 1989) During mammary gland involution, the phagocytic activity is higher on days 5 to 6 after dry off (early dry period) compared to days 15 to 22 after dry off. Neutrophils are the most abundant immune cell in the mammary gland during involution and decrease as the dry period advances, whereas macrophages and lymphocytes increase (Paape an d Miller, 1992). Therefore, the association between heat stress during the dry period and reduced immune status of dairy cows may be important to understand the involutory process of the mammary

PAGE 61

61 gland during early dry period and subsequent mammary cell pro liferation. Strategies that improve the immune status of dairy cows under heat stress conditions, for example, OmniGen AF supplementation, may be useful to abate the negative effects of heat stress. OmniGen AF is a feed additive that reduces the negative e ffect of heat stress in the dry period on lactation (Chapter 2) and appears to improve the immune status of dairy cows ( Brando et al ., 2016) The objective of the present experiment was to evaluate the effect of OmniGen AF supplementation before, during a nd after heat stress in the dry period on immune status, hematology and immune cell gene expression of dairy cows. Materials and Methods Treatments, Experimental Design and Animals The experiment was conducted during one summer (2015) at the University of Florida Dairy Unit (Hague, Florida). All of the treatments and procedures were approved by the University of Florida IACUC. A 2 X 2 factorial design was used to evaluate the effects of feeding control additive (fed 56 g/d of AB20; Control) or OmniGen AF ( fed 56 g/d of OmniGen AF; OG) upon performance of dairy cattle experiencing heat stress during the dry period. Treatment groups were as follows: heat stress, only shade (HT, n=17, 56 g/d), HT with OG (HTOG, n=19, 56 g/d), cooling with shade, fans and soake rs (CL, n=16, 56 g/ d ), and CL with OG (CLOG, n=11, 56g/d). At least, sixty days before dry off (last 60 DIM) ; c ows were randomly assigned to OG or Control treatments based on mature equivalent milk yield in the previous lactation. Cows that did not receive OG were fed 56 g/d of bentonite as a placebo control (AB20, Phibro Animal Health Corporation). Cows were dried off 45 d before expected calving and Control and OG treatments continued when cows were exposed to HT or CL treatments. After parturition, cows were kept under the same cooling system and management, and continued receiving OG or control treatment until 60 DIM consistent with late lactation and

PAGE 62

62 dry period treatment. Cows were housed in a sand bedded free stall barn during lactation and the dry pe riod. The THI was calculated based on the equation reported by Dikmen et al. (2008): THI = (1.8 T + 32) [(0.55 0.0055 RH) (1.8 T 26)], where T = air temperature (C) and RH = relative humidity (%). During the dry period, t he pen for CL and CL OG treatments was equipped with active cooling, including shade, soakers (Rain Bird Manufacturing, Glendale, CA) and fans (J&D Manufacturing, Eau Claire, WI), whereas the pen for HT and HTOG treatments only received shade. When the ambient temperature exce eded 21.1 C, fans automatically turned on and the soakers were activated for 1.5 min at 5 min intervals. Photoperiod (14 h light/10 h dark) of the barn for dry cows on all treatments was similar and controlled using metal halide lights. The lights provide d approximately 250 lux intensity at eye level of cows and were kept on from 0600 to 2000 h. After calving, all cows were housed in the same sand bedded free stall barn with soakers and fans for cooling. Air temperature and relative humidity of each pen in the barn for dry cows were recorded every 15 min by Hobo Pro series Temp probes (Onset Computer Corp., Pocasset, MA). All cows were fed a common close up total mixed ration TMR (Table 2 1) during the entire dry period and daily DMI of individual cows was measured from dry off to calving using a Calan gate system (American Calan Inc., Northwood, NH). Rectal temperature (RT) was measured twice daily (0730 and 1430), and RR were counted thrice weekly (1400 h, Monday Wednesday Friday) for all cows during the d ry period to confirm the heat strain on cows. Immune status Blood samples were collected at 3, 3, 7, 14 and 25 days relative to dry off to evaluate neutrophil function from a subset of animals (CL = 7, HT = 8, CLOG = 6, HTOG = 8). For neutrophil functio n assay, blood was collected from coccygeal vessels into two Vacutainer tubes containing acid citrate dextrose. Neutrophil abundance and function was assessed within 4 h of

PAGE 63

63 blood collection. Hematology analysis was conducted to assess the number and concen tration of blood neutrophils using an automated blood analyzer (Procyte Dx Hematology Analyzer, IDDEX laboratories, Westbrook, ME). To measure neutrophil phagocytosis and oxidative burst, M dihydrorhodamine (DHR) 123 (Sigma Aldrich, St. Louis, MO) was added to all tubes and incubated at 37C for 10 myristate, 13 acetate (PMA; Sigma Aldrich) was added to one of the four tubes. Heat inactivated Escherichia coli ( E. coli ) bacterial suspension (10 6 cells/mL) labeled with propidium iodide (Sigma Aldrich) was added to of the two tubes containing only DHR to establish a bacteria to neutrophil ratio of 40:1 l eading to four tubes: tube 1 (DHR), tube 2 (DHR+PMA), tube 3 (DHA + E. coli ) and tube 4 (DHR + E. coli, replicate) All tubes were vortexed and incubated at 37C for 30 min with constant rotation. Then, all tubes were removed and placed immediately on ice to stop neutrophil phagocytosis and oxidative burst activity. Tubes were processed in an automate d lysing system (Q Prep Epics immunology workstation, Beckman Coulter, Fullerton, CA) on the 35 was added to each tube. All tubes were vortexed and kept on ice until reading at BD Accuri C6 software (Becton, Dickinson Im munocytometry system, Sao Jose, CA). After assessing the data on flow cytometer, percentage of phagocytosis, percentage of neutrophil oxidative burst, mean fluorescence intensity (MFI) for phagocytosis ( measure of the number of bacteria phagocytized per neutrophil) and MFI for oxidative burst ( measure of the number of radicals oxygens produced by neutrophils) was analyzed using SAS (SAS Institute Inc., Car y, NC)

PAGE 64

64 Gene Expression Samples for quantitative mRNA expression for L selectin and IL8 R were collected in three distinct periods, before dry off, during the dry period, and during the postpartum period from a subset of animals (n = 44 ; CL = 12, HT = 12, CLOG = 9, HTOG = 11). Blood samples were collected wh en cows were receiving control or OG supplementation during late lactation. Because the total amount of time of supplementation varied before dry samples were grouped as: 15 to 30, 31 to 60, 61 to 90, and more than 90 d on supplementa tion. During the dry period, blood samples were collected at 25 days relative to dry off and after parturition, and blood samples were collected at 14, 35 and 67 days relative to calving for L selectin and IL8 R analysis. For gene expression in peripheral white blood cells, standard curves were created by using a construct based on primer and probe sets from Thermo Fisher Scientific ( CXCR2 cat no. Bt03203292048_s1; CD62L cat no Bt03223211_m1; Carlsbad, CA, United States). Sequences were extended 50 bp in for each gene. Constructs were cloned into pUC plasmids and grown in bacteria using an ampicillin resistant media. Plasmid DNA purification was completed using the GeneJET Plasmid Miniprep Kit (Cat no. K 0502, Thermo Fisher Scientific). Plasmids were linearized by restriction endonuclease treatment. Samples were ethanol precipitated and analyzed in a spectrophotometer to determine nucleic concentration (ng/ul). Copy number was determined using absorbance at 260 and the molecular weight of the plasmid. Samples were then diluted to create a 6 point linear standard curve. Samples and standards were run in duplicate on a 96 well plate and analyzed using a CFX96 optics unit mounted on a C1000 touch base (Bio Rad USA). Twenty five ng total RNA was analyzed per unknown well and amplified using primers and mastermix (Fast Virus 1 step, Thermo Fisher Scientific, cat no. 44434). Total copies per well was interpolated from standard curve data, then converted to cop ies/ng of RNA.

PAGE 65

65 Statistical Analysis Data on quantitative mRNA expression for CD62L and IL8 R were analyzed in three distinct periods, before dry off, during the dry period, and during the postpartum period. For the analyses before dry off, mRNA expression was analyzed by mixed models using the MIXED procedure of SAS version 9.4 (SAS Institute Inc., Carry, NC). The model included the fixed effects of dietary treatment (Control vs. OG), days on treatment (30, 60, 90, and more than 90 d), and interaction betw een treatment and days on treatment, and the random effect of cow nested within treatment. During the dry period, the statistical models included the fixed effects heat stress ( HT vs. CL ), dietary treatment ( Control vs. OG ), and the interaction between hea t stress and dietary treatment During the postpartum period, the statistical models included the fixed effects of heat stress ( HT vs. CL ), dietary treatment ( Control vs. OG ), the interaction between heat stress and dietary treatment day postpartum (14, 35, 67 d), the interactions between heat stress and day postpartum, dietary treatment and day postpartum, and heat stress and dietary treatment and day postpartum, and the random effect of cow nested within dietary treatment and evaporative cooling. Data o n neutrophil function (total phagocytosis, double positive, MFI phagocytosis and MFI oxidative burst) was analyzed in two distinct periods, before dry off and during the dry period. For the analyses before dry off, neutrophil function was analyzed by mixed models using the MIXED procedure of SAS version 9.4 (SAS Institute Inc., Ca ry, NC). The model included the fixed effects of dietary treatment (Control vs. OG). During the dry period, the statistical models included the fixed effects heat stress ( HT vs. C L ), dietary treatment ( Control vs. OG ), the interaction between heat stress and dietary treatment day relative to dry off (3, 7, 14 and 25 d), the interactions between heat stress and day relative to dry off, dietary treatment and day relative to dry off, and heat stress and dietary treatment and day relative to dry off, and the random effect

PAGE 66

66 of cow nested within dietary treatment and evaporative cooling. Hematology data was analyzed during the dry period. The model included the fixed effects fixed effects heat stress ( HT vs. CL ), dietary treatment ( Control vs. OG ), the interaction between heat stress and dietary treatment day relative to dry off (3, 7, 14 and 25 d), the interactions between heat stress and day relative to dry off, dietary treatment and da y relative to dry off, and heat stress and dietary treatment and day relative to dry off, and the random effect of cow nested within heat stress and dietary treatment Basophil data was analyzed by linear mixed models using the GLIMMIX procedure of SAS ve rsion 9.4 (SAS Institute Inc., Car y, NC). The statistical models included the fixed effects heat stress ( HT vs. CL ), dietary treatment ( Control vs. OG ), the interaction between heat stress and dietary treatment day relative to dry off (3, 7, 14 and 25 d) the interactions between heat stress and day relative to dry off, dietary treatment and day relative to dry off, and heat stress, dietary treatment and day relative to dry off. Models were fit to the data and distribution of residuals and homogeneity of variance were evaluated. Data that did not fit the assumptions of normality were subjected to the Box Cox power transformation using the TRANSREG procedure of SAS before the final statistical analysis. Transformed data subjected to statistical analyses had their LSM and SEM back transformed for presentation according to Jorgensen and Pedersen (1998). The Kenward Roger method was used to obtain the approximate degrees of freedom. The covariance structure that resulted in the best fitted model based on the Ak criterion was selected for the analysis of data with repeated measurements. Differences with P P tendency.

PAGE 67

67 Results Neutrophil Function Before dry off, the percentage of cell undergoing oxidative burst tended to increase with OG compared with Control treatmen t (59.7 vs. 50.3 4.9%, respectively; Table 3 1). Cows that received OG supplementation did not increase MFI phagocytosis compared with Control cows ( P = 0.19, Table 3 1), which is a measure of the number of bacteria ( E. coli ) being phagocytized per neutr ophil. Further, no difference was observed for MFI oxidative burst ( P = 0.41, Table 3 1). Neutrophil phagocytosis tended to be higher when cows were receiving OG treatment compared with Control treatment (66.2 vs. 56.5 4.6; P = 0.15, Table 3 1). After dr y off, there were no differences in MFI oxidative burst, MFI phagocytosis, neutrophil phagocytosis and neutrophil oxidative burst among treatments (Table 3 2). In addition, CLOG treatment had increased total phagocytosis compared with CL (P = 0.06), HT (P = 0.05), and HTOG treatments (0.07) on day 3 relative to dry off (Figure 3 1). Also, CLOG had increased neutrophil oxidative burst (%) compared with CL treatment on day 3 relative to dry off (P = 0.08, Figure 3 1). There were no differences on parity among groups (P = 0.18). After analyzed, parity was averaged among all groups and yielded 2.77 0.21. Gene Expression Cows fed OG during late lactation tende d to have ( P = 0.12) increase d L Selectin mRNA gene expression in immune cells. There were no differe nces in IL 8R mRNA gene expression between Control and OG treatments before dry off (P = 0.70, Table 3 4). Also during the dry period, L selectin and IL 8R mRNA gene expression was similar among treatments (Table 3 4). After calving, there was an interacti on ( P = 0.05) between heat stress and dietary treatment After calving, CLOG treatment had increased L selectin mRNA gene expression on 14 DIM (P = 0.10, Figure 3 6), 35 DIM (P < 0.01, Figure 3 6) and on 67 DIM (P = 0.02, Figure 3 6) compared with

PAGE 68

68 CL treat ment, but no differences were observed with OG treatment in cows that did not receive prepartum evaporative cooling The expression of IL 8R mRNA gene expression did not differ among treatments after calving (Table 3 4). Cows that were exposed to HT treatm ent had increased (P = 0.10) IL 8R mRNA gene expression on 35 DIM compared with CL treatment (Figure 3 7). Hematology White blood cell volume, hemoglobin volume, platelet volume, red blood cell volume, hematocrit (%) and reticulocytes volume were assessed from blood samples of cows at 3, 3, 7, 14, and 25 d relative to dry off. Red blood cells, hematocrit, hemoglobin volume, platelet volume, neutrophil volume, lymphocyte volume, eosinophil volume and monocyte volume were different across time (Figure 3 3). Red blood cells, white blood cell volume and neutrophil volume were similar between HT and CL treatments during the dry period (Table 3 3), however OG supplementation tended to increase neutrophil volume compared with Control ( P = 0.13, Table 3 3). Cows e xposed to HT treatment had fewer ( P = 0.06) platelet s compared with CL treatment (Table 3 3). Exposing cows to HT reduced (P = 0.02) h ematocrit compared with CL treatment (Table 3 3). There were no differences in hemoglobin levels between HT and CL treatme nt; however, compared with Control, OG reduced (P < 0.01) hemoglobin volume (Table 3 3) and there was a triple interaction among dietary treatment, prepartum evaporative cooling and day relative to dry off ( P < 0.01, Figure 3 4) There were no differences on lymphocytes volume, eosinophil volume, basophil volume and monocyte volume among treatments. Discussion Heat stress during the dry period reduces milk yield in the subsequent lactation and OmniGen AF supplementation may be provided to improve milk yie ld of dairy cows (Brando et al., 2016; Chapter 2). Dairy cows are at a higher risk of infection during the transition of the

PAGE 69

69 mammary gland from a lactating to a non lactating state increased mammary gland pressure after abrupt cessation of milk removal ( O liver et al., 1956) and immune status may be important during early dry period to defend against intra mammary infections. Strategies to improve the immune response during late lactation and early dry period may be useful to increase production and health of dairy cows. Further understanding of the effect of heat stress on mammary phagocyte activity in the early dry period may be important to comprehend the phagocytic defense during involution. As demonstrated previously (Chapter 2), rectal temperature and respiration rate were increased under HT treatment compared with CL and OG treatment. The THI in the present experiment was 77.8 (Chapter 2), which demonstrate that cows were exposed to heat stress conditions and the treatments were appropriate to evaluate the effect of heat stress (HT vs. CL) and dietary treatment (Control vs OG) and its interaction on immune status of dairy cows. The migration of immune cells to the site of inflammation is coordinated by cell adhesion molecules, i.e. L selectin (Zakrzewic z et al., 1997). It was previously shown that OmniGen AF supplementation increased L selectin mRNA expression in response to a pathogen in sheep (Wang et al., 2004). In the present experiment, there was a tendency of the OG treatment to increase L selectin mRNA gene expression before dry off, which may result in increased migration of immune cells trough the endothelial vessels. During involution of the mammary gland, period neutrophils are the most predominant immune cell present in the gland and the numbe r of cells decreases as the dry period advances (Paape and Miller, 1992). However, in our experiment cows that received OG treatment before dry off started the dry period with immune cells with increased L selectin mRNA gene expression. This may lead to a larger number of immune cells arriving to the mammary gland, i.e. neutrophils, because of the increased capacity

PAGE 70

70 of adhesion and migration through the endothelium. Therefore, the increased number of immune cells during involution may lead to an accelerate involution of the mammary gland. Ryman et al. (2013) show ed increased L selectin and IL 8R mRNA expression when cows received OmniGen AF supplementation, which suggests that th is feed additive may influence immune system response. Indeed, the IL 8R on the surface of neutrophils is important to the migration of these cells to the site of infection and to maximize neutrophil function against microbial infection in mice ( Del Rio et al., 2001) However, in the present experiment, there were no differences i n the expression of IL 8R at any point among treatments. Results from the current experiment demonstrate that cooling prepartum cows and OG supplementation did not improve IL 8R mRNA gene expression in leucocytes. After parturition, increased L selectin m RNA gene expression of cows exposed to dietary treatment and prepartum evaporative cooling may be important to health of animals after parturition. Brando et al. (2014) showed increased number of polymorphonuclear cells in the endometrium of cows receivin g OmniGen AF supplementation, which may lead to a reduction in the incidence of endometritis because of the increased number of immune cells present in the endometrium. Before dry off the tendency of increased neutrophil phagocytosis of cows that receiv ed dietary treatment may be important during early dry period (involution). The mammary phagocytes tend to be more phagocytic on days 5 to 6 after dry off (i.e. early dry period) and less phagocytic after 15 days dry (Paape and Miller, 1992). However, in t he present experiment, neutrophil phagocytosis and neutrophil oxidative burst analysis had reduced activity on day 7 relative to dry off compared to 3, 14, and 25 days relative to dry off. Thus, there may be a transient reduction on neutrophil function af ter the first few days of high activity, and then its function reascend with the proximity of the parturition.

PAGE 71

71 Recent studies have demonstrated the importance of optimal involution of the mammary gland, i.e. autophagic activity (Wohlgemuth et al., 2016) an d epithelial cell proliferation during the dry period to achieve increased milk yield in the subsequent lactation (Tao et al., 2011). Thus, increased L selectin that was observed with OG treatment before dry off may also be important for the clearance of t he cellular debris that is being produced during early dry period. It may lead to an acceleration of the involution of the mammary gland leading to optimal cell proliferation, which may be explain the increased milk yield observed in Chapter 2. In th e present experiment, the value of all blood parameters was within the normal range of dairy cows. However, the increased hematocrit of HT relative to CL treatment may be have been caused by an increased water intake of cows that did not receive prepartum evaporative cooling. Also, the tendency of dietary treatment to increase neutrophil volume associated with increased L selectin mRNA gene expression may be important to improved immune response. Conclusion Cows that received OG supplementation tended to ha ve increased L selectin mRNA gene expression and neutrophil activity at dry off, which may maximize mammary gland involution during the early dry period and increase mammary epithelial proliferation during late dry period. Cooled cows that have received di etary treatment and prepartum evaporative cooling had higher L selectin mRNA gene expression after calving compared to cooled cows. The mechanism by which OG supplementation improves immune response remains unknown. It is important to apply strategies to i mprove immune response and to better understand the mechanisms by which immune response is shifted in response to heat stress and its impact during involution.

PAGE 72

72 Table 3 1. Effect of dietary treatment (Control vs. OG) during late lactation on n eutrophil function of dairy cows (Control, n = 15; OG, n = 14). Variable Control ( n = 15) T2 1 ( n = 14) SEM P value (T 2 1 ) MFI phagocytosis 2 12987 15873 2523 0.41 MFI oxidative burst 3 24113 32696 4554 0.19 Total Phagocytosis, % 4 56.5 66.2 4.6 0.15 Oxidative burst, % 5 50.3 59.7 4.9 0.19 1 Main effect of dietary treatment (T2; Control vs. OG). 2 Mean Fluoresc ence Intensity (MFI, green wavelength) indicating the mean amount of reactive oxygen metabolites produced by the neutrophils. 3 Mean Fluorescence Intensity (MFI, red wavelength) indicating the mean number of bacteria phagocytized by neutrophils. 4 Total ph agocytosis of Escherichia coli (percentage of neutrophils). 5 Percentage of neutrophils positive for phagocytosis and oxidative burst.

PAGE 73

73 Table 3 2. Effect of heat stress (HT vs. CL) and dietary treatment (Control vs. OG) on n eutrophil function of dairy cows during the dry period (CL = 7, HT = 8, CLOG = 6, HTOG = 8). Variable CL HT TRT CLOG HTOG SEM T1 1 P value T2 2 T1xT2 3 MFI phagocytosis 4 27022 27590 37160 29843 4836 0.54 0.22 0.46 MFI oxidative burst 5 20935 22548 21229 22937 3579 0.64 0.93 0.99 Total Phagocytosis, % 6 58.7 61.4 66.9 61.4 3.97 0.74 0.29 0.33 Oxidative burst, % 7 53.5 57.3 61.5 59.1 4.10 0.87 0.25 0.46 1 T1 = effect of prepartum evaporative cooling (CL vs. HT). 2 T2 = effect of dietary treatment (OG vs. Control). 3 T1xT2 = treatm ent 1 by treatment 2 interaction. 4 Mean Fluorescence Intensity (MFI; green wavelength) indicating the mean amount of reactive oxygen metabolites produced by the neutrophils. 5 Mean Fluorescence Intensity (MFI; red wavelength) indicating the mean number o f bacteria phagocytized by neutrophils. 6 Total phagocytosis of Escherichia coli (percentage of neutrophils). 7 Percentage of neutrophils positive for phagocytosis and oxidative burst.

PAGE 74

74 Table 3 3. Effect of heat stress (HT vs. CL) and dietary treatment (Co ntrol vs. OG) on hematology profile during the dry period of dairy cows (CL = 7, HT = 8, CLOG = 6, HTOG = 8). Variables TRT P Value CL HT CLOG HTOG SEM T 1 1 T 2 2 DAY 3 T1xT2 4 Red blood cell count ( 10 6 /l) 6.2 6.04 6.2 5.8 0.22 0.24 0.6 <0.01 0.58 Hemat ocrit (%) 31.7 30 31.5 28.7 0.92 0.02 0.41 0.06 0.58 Hemoglobin (g/dL) 5.6 5.1 4.4 4.7 0.34 0.77 <0.01 <0.01 0.11 Platelet count ( 10 3 /l) 263.9 264.4 228.1 332.2 27.9 0.06 0.42 0.04 0.07 Reticulocytes ( 10 3 /l) 7 5.5 7.8 5.9 2.4 0.48 0.82 0.12 0.96 Di fferential leukocytes ( 10 3 /l) Neutrophils 3.25 3.29 3.81 3.48 0.24 0.55 0.13 <0.01 0.46 Lymphocytes 9 8 9.3 8.5 3.05 0.78 0.9 0.02 0.98 Eosinophils 0.71 0.52 0.52 0.78 0.1 0.73 0.74 <0.01 0.04 Monocytes 1.21 0.95 0.93 0.91 0.21 0. 51 0.47 0.02 0.59 Basophils 43.3 31.4 62.5 36.8 0.14 0.58 0.21 0.90 White blood cell count ( 10 3 /l) 23.7 14.8 20 17.7 6 0.35 0.94 0.71 0.58 1 T1 = effect of prepartum evaporative cooling (CL vs. HT). 2 T2 = effect of dietary treatment (OG vs. Contro l). 3 Day relative to dry off (3, 7, 14 and 25). 4 T1xT2 = treatment 1 by treatment 2 interaction.

PAGE 75

75 Table 3 4. Effect of dietary treatment (Control vs. OG) on L selectin and IL 8R mRNA gene expression during late lactation of dairy cows (OG, n = 20; Contro l, n = 24). Effect of heat stress (HT vs. CL) and dietary treatment (Control vs. OG) on L selectin and IL 8R mRNA gene expression during early dry period and on subsequent lactation of dairy cows (n=44; CL = 12, HT = 12, CLOG = 9, HTOG = 11). 1 All cows were exposed to evaporative cooling. Cows were receiving dietary treatmen t (OG and Control) for at least 60 days before dry off. 2 Days receiving dietary supplementation. 3 Cows were dried off 45 days before expected calving. Cows were exposed to heat stress (HT and CL) and dietary treatment (OG and Control). Samples were coll ected on day 3, 7, 14 and 25 relative to dry off. 4 Cows were kept at the same environment and were still receiving dietary treatment (OG and Control) until 60 DIM. L selectin mRNA gene expression was evaluated on 14, 35 and 67DIM. 5 T1 = effect of prepar tum evaporative cooling (CL vs. HT). 6 T2 = effect of dietary treatment (OG vs. Control). 7 T1xT2 = treatment 1 by treatment 2 interaction. Late Lactatio n 1 T2 Control SEM T2 Day 2 T 2xDay L selectin 9763 6942 1278 0.12 0.46 0.84 CXCR2 3395 3569 557 0.84 0.94 0.70 Dry Period 3 CL HT CLOG HTOG SEM T 1 5 T2 6 T1xT2 7 L selectin 11723 12454 22121 12612 4540 0.41 0.29 0.31 CXCR2 5113 4199 3300 4721 1 238 0.78 0.58 0.34 Early Lactation 4 CL HT CLOG HTOG SEM T 1 T 2 T1xT2 L selectin 7198 14584 24951 14032 5061 O.84 0.07 0.05 CXCR2 2283 4176 4208 4733 1230 0.27 0.26 0.45

PAGE 76

76 Table 3 5. Genes evaluated, their probe sequence and catalog number of primer. Gene symbol Probe Sequence Catalog Number CD62L CTAGTCCAAGATGTCAAAAAATAAA Bt03223211_m1 CXCR2 GAGGAAGTTCTGATTTGTAGCATTT Bt03292048_s1

PAGE 77

77 Figure 3 1. Effect of cooling (CL; n = 7), heat stress (HT; n = 8), CL with OG (CLOG; n = 6) or HT with OG (HTOG; n = 8) during the dry period on ne utrophil function of dairy cows. (A) Mean Fluorescence Intensity (MFI, green wavelength) indicating the mean amount of reactive oxygen metabolites produced by the neutrophils. Effects of heat stress (P = 0.65), dietary treatment (P = 0.93) and the interact ion between heat stress and dietary treatment (P = 0.99). Effect of DAY (P = 0.02), and the interaction among heat stress dietary treatment and DAY (P = 0.88). (B) Mean Fluorescence Intensity (MFI, red wavelength) indicating the mean number of bacteria p hagocytized by neutrophils. Effects of heat stress (P = 0.54), dietary treatment (P = 0.22) and the interaction between heat stress and dietary treatment (P = 0.46). Effect of DAY (P < 0.01), and the interaction among heat stress dietary treatment and DA Y (P = 0.55). (C) Oxidative burst (% of neutrophils). Effects of heat stress (P = 0.54), dietary treatment (P = 0.22) and the interaction between heat stress and dietary treatment (P = 0.46). Effect of DAY (P < 0.01), and the interaction among heat stress dietary treatment and DAY (P = 0.70). (D) Total phagocytosis of Escherichia coli (% of neutrophils). Effects of heat stress (P = 0.074), dietary treatment (P = 0.30) and the interaction between heat stress and dietary treatment (P = 0.33). Effect of DAY (P < 0.01), and the interaction among heat stress dietary treatment and DAY (P = 0.48). O represent heat stressed cows and cooled cows, ) represent supplemented (OG) heat stressed and cooled cows, respectively. Data are presented as mean SEM.

PAGE 78

78 Figure 3 2. Neutrophi l total phagocytosis of Escherichia coli (%) and neutrophil oxidative burst (%) changes across time during the dry period of dairy cows, regardless the treatment (CL, HT, CLOG and HTOG). Neutrophil total phagocytosis of Escherichia coli (%) and neutrophil oxidative burst (%) was descreased on day 7 compared to days 3, 14 and 25 reelative to dry off (P < 0.01)

PAGE 79

79 Figure 3 3. Changes in the hematology profile during early dry period of dairy cows (Procyte Dx Hematology Analyzer, IDDEX laboratories, Westbroo k, ME) (A) Lymphocyte count (K/ L) Effects DAY (P = 0.08). (B) Neutrophil count (K/ L) Effects DAY (P < 0.01). (C) Red blood cell count (M/ L) Effects DAY (P < 0.01). (D) Reticulocyte count (K/ L) Effect of DAY (P = 0.12), (E) Platelet count (K/ L) Effect of DAY (P = 0.04) (F) Hematocrit (%). Effect of DAY (P = 0.07)

PAGE 80

80 Figure 3 4. Hemoglobin (g/dL) blood concentration of dairy cows during early dry period. Effect of heat stress (P = 0.77), dietary treatment (P < 0.0 1), DAY (P < 0.01), and interaction among heat stress dietary treatment and DAY (P < 0.01). There was a reduction on hemoglobin concentration of CLOG on day 7 among all treatments (P < 0.01) and HTOG cows had reduced hemoglobin concentration on day 7 com pared with CL cows (P < 0.05). Data is presented as LSM SEM.

PAGE 81

81 Figure 3 5. Effect of OG supplementation and evaporative cooling on L selectin mRNA gene expression during late lactation according to days receiving the dietar y supplementation. Effect dietary treatment (P = 0.12), DAY (P = 0.46) and interaction between dietary treatment and DAY (P = 0.84). Cows receiving OG treatment had higher L selectin gene expression after an interval of 15 30 days of supplementation compar ed with control treatment ( P = 0.09). During late lactation, cows receiving OG treatment tended to increase L selectin mRNA gene expression compared with Control treatment (P = 0.12).

PAGE 82

82 Figure 3 6. Effect of heat stress (HT vs. C L) and dietary treatment (Control vs. OG; before, during and after the dry period) on L selectin mRNA gene expression of dairy cows during early lactation (14, 35 and 67 days in milk). Cows under CLOG treatment had higher L selectin gene expression compare d to CL treatment. Effect of heat stress (P = 0.84), dietary treatment (P = 0.07) and interaction between heat stress and dietary treatment (P = 0.06). Effect of DAY (P = 0.93), interaction between DAY and heat stress (P = 0.97), interaction between DAY an d dietary treatment (P =0.37) and interaction among heat stress and dietary treatment and DAY (P = 0.48).

PAGE 83

83 Figure 3 7 Effect of heat stress (HT vs. CL) and dietary treatment (Control vs. OG; before, during and after the dry period) on IL 8R mRNA gene expression of dairy cows during early lactation (14, 35 and 67 days in milk). Cows exposed to HT had higher IL 8R mRNA gene expression on day 35 compared to CL cows. Effect of heat stress (P = 0.27), dietary treatment (P = 0.26) and interaction between heat stress and dietary treatment (P = 0.46). Effect of DAY (P = 0.30), interaction between DAY and heat stress (P = 0.59), interaction between DAY and dietary treatment (P =0.98) and interaction among heat stress dietary treatmen t and DAY (P = 0.51).

PAGE 84

84 CHAPTER 4 GENERAL DISCUSSION AND SUMMARY the experiments to understand the physiology of animals exposed to heat stress during la te gestation date to the showing nutritional strategies with beneficial effects under heat stress conditions. Since that time, a nimal performance has changed and milk yield has more than doubled in the past 40 years (Oltenacu and Broom, 2010). More experiments are necessary to find feasible interventions to improve health, reproduction and performance of dairy cows exposed to heat stress. Heat stress has a profound effect on the profitability of dairy cows during lactation and during the dry period (St Pierre et al., 2003; Ferreira et al., 2016), but cooling systems are usually neglected during the dry period, even though it is well kwon that heat stress during late gestation improves milk yield in the subsequent lactation (Tao et al., 2012b; Chapter 2). However, economic studies showing feasible strategies to be applied are scarce and more studies are necessary to demonstrate the feasibility of cooling systems during late ges tation in different environmental conditions. Thus, producers will be able to decide and implement new strategies to abate the negative effects of heat stress during the dry period and improve profitability. The aim of the studies described in this thesis was to evaluate the effect of prepartum evaporative cooling and the effect of dietary supplementation to dairy cows before, during and after the exposure to heat stress (during dry period) on dairy cow performance, immune function, hematology and immune related gene expression. The experiment described in Chapter 2 indicates that prepartum evaporative cooling improves thermoregulation of dairy cows, by reducing RT and RR of dairy cows exposed to high temperature and humidity. Under high temper ature and humidity, s oa k ers are needed in association with fans. However, under arid

PAGE 85

85 conditions (low humidity), a fogger or mister system must be applied to improve performance (reviewed by Renaudeau, 2011). In our experiment, OmniGen AF supplementati on is another alternative that was evaluated and it improves thermoregulation of dairy cows by reducing RR and a tendency to reduce RT when cows are exposed to heat stress during the dry period. Prepartum evaporative cooling and OmniGen AF supplementation improved milk yield in the subsequent lactation, which is consistent with previous studies (Tao et al., 2012b; Brand o et al., 2016). The decreased milk yield of HT cows is due to compromised mammary gland growth during the dry period (Tao et al., 2012a). It has been proposed that mammary gland involution and mammary gland redevelopment are important to maximize the number of cell s at the end of the dry period (Tao et al, 2012a; Wohlgemuth et al., 2016), which then supports higher milk yield in th e subsequent lactation of cows exposed to prepartum evaporative cooling relative to those that experience heat stress (Chapter 2). That led to the hypothesis that OmniGen AF supplementation might improve the immune status of dai ry cows and accelerate the involution period leading to accelerated redevelopment (increased number of epithelial cells) and support higher milk yield in the subsequent lactation. In Chapter 2 it was demonstrated that OmniGen AF supplementation increases m ilk production in the subsequent lactation of cows that were exposed to heat stress during the dry period. The experiment described in Chapter 3 demonstrated that OmniGen AF supplementation increases L selectin mRNA gene expression during late and early la ctation, and that improved immune status in late lactation might be related with accelerated involution and redevelopment of the mammary gland during the dry period of heat stressed animals. This could be part of the explanation for the increased milk yiel d of HTOG cows observed in Chapter 2. However, further research is needed to evaluate the effect of OG supplementation on mammary

PAGE 86

86 gland involution and redevelopment to confirm this hypothesis. It is also important to understand the effect of pre partum evaporative cooling during early and late dry period of cows exposed to heat stress. In summary, the results presented in this thesis demonstrate that prepartum evaporative cooling during the dry period and OmniGen supplementation befor e, during and after the dry period improves performance of cows, by increasing milk yield in the next lactation. Additionally, OG supplementation improved L selectin mRNA gene expression during late and early lactation of dairy cows.

PAGE 87

87 LIST OF REFERENCES Accorsi, P. A., B. Pacioni, C. Pezzi, M. Forni, D. J. Flint, and E. Seren. 2002. Role of prolactin, growth hormone and insulin like growth factor 1 in mammary gland involution in the dairy cow. J. Dairy Sci. 8 5:507 513. Alvarez, M. B., and H. D. Johnson. 1973. Environmental heat exposure on cattle plasma catecholamine and glucocorticoids. J. Dairy Sci. 56:189 194. Annen, E., C. Stiening, B. Crooker, A. Fitzgerald, and R. Collier. 2008. Effect of continuous mi lking and prostaglandin E2 on milk production and mammary epithelial cell turnover, ultrastructure, and gene expression. J. Anim. Sci. 86:1132 1144. Adin, G., A. Gelman, R. Solomon, I. Flamenbaum, M. Nikbachat, E. Yosef, A. Zenou, A. Shamay, Y. Feuermann, S. J. Mabjeesh, and J. Miron. 2009. Effects of cooling dry cows under heat load conditions on mammary gland enzymatic activity, intake of food water, and performance during the dry period and after parturition. Livest. Sci. 124:189 195. Armstrong, D. V., M. E. Wise, M. T. Torabi, F. Wiersma, R. Hunter and E. Kopel. 1988. Effect of different cooling systems on milk production of late lactation Holstein cows during high ambient temperature. J. Dairy Sci. 71(Suppl. 1):212 (Abstr.). Armstrong, D. V. 1994. He at stress interaction with shade and cooling. J. Dairy Sci. 77:2044 2050. Auchtung, T. L., J. L. Salak Johnson, D. E. Morin, C. C. Mallard, and G. E. Dahl. 2004. Effects of photoperiod during the dry period on cellular immune function of dairy cows. J. Da iry Sci. 87:3683 3689. Auchtung, T. L., A. G. Rius, P. E. Kendall, T. B. McFadden, and G. E. Dahl. 2005. Effects of photoperiod during the dry period on prolactin, prolactin receptor, and milk production of dairy cows. J. Dairy Sci. 88:121 127. Avendao Reyes, L., F. D. Alvarez Valenzuela, A. Correa Caldern, J. S. Saucedo Quintero, P. H. Robinson, and J. G. Fadel. 2006. Effect of cooling Holstein cows during the dry period on postpartum performance under heat stress conditions. Livest. Sci. 281:2535 2547 Baumgard, L. H., J. B. Wheelock, S. R. Sanders, C. E. Moore, H. B. Green, M. R. Waldron, and R. P. Rhoads. 2011. Postabsorptive carbohydrate adaptations to heat stress and monensin supplementation in lactating Holstein cows. J. Dairy Sci. 94:5620 5633. Beed, D. K., and R. J. Collier. 1986. Potential nutritional strategies for intensively managed cattle during thermal stress. J. Anim. Sci. 62:543 554. Berman, A. 2003. Effects of body surface area estimates on predicted energy requirements and heat stres s. J. Dairy Sci. 87:1400 1412.

PAGE 88

88 Berman, A. 2005. Estimates of heat stress relief needs for Holstein dairy cows. J. Anim. Sci. 83:1377 1384. Bernabucci, U., N. Lacetera, B. Ronchi, and A. Nardone. 2002. Effects of the hot season on milk protein fractions i n Holstein cows. Anim. Res. 51:25 33. Box, G. E., and D. R. Cox. 1964. An analysis of transformations. J. Royal Stat. Soc. Series B. 26: 211 252. Brando, A. P., R. F. Cooke, F. N. Corr, M. B. Piccolo, R. Gennari, T. Leiva, and J. L. Vasconcelos. 2016. Physiologic, health, and production responses of dairy cows supplemented with an immunomodulatory feed ingredient during the transition period. J. Dairy Sci. 99:5562 5572. Brown, D. E., P. C. Harrison, F. C. Hinds, J. A. Lewis, and M. H. Wallace. 1977. He at stress effects on fetal development during late gestation in the ewe. J. Anim. Sci. 44:442 446. Buffington, D. E., R. J. Collier, and G. H. Canton. 1983. Shade management systems to reduce heat stress for dairy cows. Trans. Am. Soc. Agric. Eng. 26(6):1 798 1802. Burgos, R., L. J. Odens, R. J. Collier, L. H. Baumgard, and M. J. VanBaale. 2007. Evaluation of different cooling systems in lactating heat stressed dairy cows in a semi arid environment. Prof. Anim. Sci. 23:546 555. Capuco, A. V., R. M. Akers, and J. J. Smith. 1997. Mammary growth in Holstein cows during the dry period: Quantification of nucleic acids and histology. J. Dairy Sci. 80:477 487. Capuco, A. V., S. E. Ellis, S. A. Hale, E. Long, R. A. Erdman, X. Zhao and M. J. Paape. 2003. Lactation persistency: Insights from mammary cell proliferation studies. J. Anim. Sci. 81:18 31. Collier, R. J. R. M. Eley, A. K. Sharma, R. M. Pereira, and D. E. Buffington. 1981. Shade management in subtropical environment for milk yield and composition in Hols tein and Jersey cows. J. Dairy Sci. 64:844 849. Collier, R. J., D. K. Beede, W. W. Thatcher, L. A. Israel, and C. J. Wilcox. 1982a. Influences of environment and its modification on dairy animal health and production. J. Dairy Sci. 65: 2213 2227. Collier R. J., S. G. Doelger, H. H. Head, W. W. Thatcher, and C. J. Wilcox. 1982b. Effects of heat stress during pregnancy on maternal hormone concentrations, calf birth weight and postpartum milk yield of Holstein cows. J. Anim. Sci. 54:309 319. Collier, R. J. G. E. Dahl, and M. J. Vanbaale. 2006. Major advances associated with environmental effects on dairy cattle. J. Dairy Sci. 89:1244 1253.

PAGE 89

89 Collier, R. J. and Beede D. K. 1985. Thermal stress as a factor associated with nutrient requirements and interrelat ionships. In Nutrition of Grazing Ruminants in Warm Climates (ed. LR McDowell), pp. 59 71. Academic Press, Inc., Orlando, FL, USA. Chan, S. C., J. T. Huber, K. H. Chen, J. M. Simas, and Z. Wu. 1997. Effects of ruminally inert fat and evaporative cooling o n dairy cows in hot environmental temperatures. J. Dairy Sci. 80:1172 1178. Chen, K. H., J. T. Huber, C. B. Theurer, D. V. Armstrong, R. C. Wanderley, J. M. Simas, S. C. Chan and J. L. Sullivan. 1993. Effect of protein quality and evaporative cooling on l actational performance of Holstein cows in hot weather. J. Dairy Sci. 76:819 825. Cheng, K., T. J. Wu, K. K. Wu, C. Sturino, K. Metters, K. Gottesdiener, S. D. Wright, Z. Wang, G. Oineill, E. Lai and M. G Waters. 2006. Antagonism of the prostaglandin D2 r eceptor 1 suppresses nicotinic acid induced vasodilation in mice and humans. Proc. Natl. Acad. Sci. USA. 103: 6682 6687. Choshniak, I., D. McEwan Jenkinson, D. R. Blatchford, M. Peaker. 1982. Blood flow and catecholamine concentration in bovine and caprine skin during thermal sweating. Comp. Biochem. Physiol. 71C: 37 42. Dahl, G. E. 2008. Effects of short day photoperiod on prolactin signaling in dry cows: A common mechanism among tissues and environments. J. Anim. Sci. 86:10 14. Dahl, G. E., S. Tao, and A. P. A. Monteiro. 2016. Effects of late gestation heat stress on immunity and performance of calves. J. D airy Sci. 99:1 6. Das, R., L. Sailo, N. Verma, P. Bharti, J. Saikia, Imtiwati and R. Kumar. 2016. Impact of heat stress on health and performance of dairy animals: A review. Vet. World EISSN: 2231 0916. Del Rio, L., S. Bennouna, J. Salinas, and Y. E. D enkers. 2001. CXCR2 Deficiency confers impaired neutrophil recruitment and increased susceptibility during toxoplasma gondi infection. J. Immunol. 167:6503 6509. Dikmen, S., E. Alava, E. Pontes, J. M. Fear, B. Y. Dikmen, T. A. Olson, and P. J. Hansen. 20 08. Differences in thermoregulatory ability between slick haired and wild type lactating Holstein cows in response to acute heat stress. J. Dairy Sci. 91:3395 3402. Dikmen, S. and P. J. Hansen. 2009. Is the temperature humidity index the best indicator of heat stress in lactating dairy cows in a subtropical environment? J. Dairy Sci. 92:109 116. Dikmen, S. F. A. Khan, H. J. Huson, T. S. Sonstegard, J. E. Moss, G. E. Dahl and P. J. Hansen. 2014. The SLICK hair locus derived from Senepol cattle confers the rmotolerance to intensevily managed lactating Holstein cows. J. Dairy Sci. 97:5508 5520.

PAGE 90

90 do Amaral, B. C., E. E. Connor, S. Tao, M. J. Hayen, J. W. Bubolz, and G. E. Dahl. 2009. Heat stress abatement during the dry period: Does cooling improve transitio n into lactation? J. Dairy Sci. 92:5988 5999. do Amaral, B. C., E. E. Connor, S. Tao, M. J. Hayen, J. W. Bubolz, and G. E. Dahl. 2011. Heat stress abatement during the dry period influences metabolic gene expression and improves immune status in the transition period of dairy cows. J. Dairy Sci. 94:86 96. Dowling, D. F. 1955. The thickness of cattle skin. Aust. J. Agric. Res. 6:776 785. Dowling, D.F. 1958. Significance of sweating in heat toleran ce of cattle. Aust. J. Agric. Res. 9: 579 586. Farooq, U., H. A. Samad, F. Shehzad and A. Qayyum. 2010. Physiological Responses of Cattle to Heat Stress. World Appl. Sci. J. 8:38 43. Feng, Z., A. Marti, B. Jehn, H. J. Altermatt, G. Chicaiza, and R. Jaggi 1995. Glucocorticoid and progesterone inhibit involution and programmed cell death in the mouse mammary gland. J. Cell Biol. 131:1095 1103. Ferreira, F. C., R. S. Gennari, G. E. Dahl, and A. De Vries. 2016. Economic feasibility of cooling dry cows acros s the United States. J. Dairy Sci. 99 9931 9941. Fuquay, J. W. 1981. Heat stress as it affects animal production. J. Anim. Sci. 51:164 174. Gebremedhin, K. G., Wu B. 2001. A model of evaporation cooling of wet skin surface and fur layer. J. Thermal Bio l. 26:537 545. Gille, A., E. T. Bodor, K. Ahmed, and S. Offermanns. 2008. Nicotinic acid: Pharmacological effects and mechanisms of action. Annu. Rev. Pharmacol. Toxicol. 48:79 106. Graulet, B., J. Matte, A. Desrochers, L. Doepel, M. F. Palin, and C. Gir ard. 2007. Effects of dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 90:3442 3455. Hansen, P. J. 1990. Effects of coat colour on physiological responses to solar radiation in Holsteins. Vet. Rec. 127:333 334. Holst, B. D ., Hurley, W.L ., Nelson, D. R 1987. Involution of the bovine mammary gland: histological and ultrastructural changes. J. Dairy Sci. 70(5):935 44. Huber, J. T. 1996. Amelioration of heat stress in dairy cattle. Pages 211 243 in Progress in Dairy Science. C. J. C., Philips, ed. CABI, Oxon., U.K. Hurl ey, W. L. 1984. Mammary function during the nonlactating period: enzyme, lactose, protein concentrations, and pH of mammary secretions. J. Dairy Sci. 70:20 28.

PAGE 91

91 Hurley, W. L. 1989. Mammary gland function during involution. J. Dairy Sci. 72:1637 1646. Hall L. W., F. A. Rivera, F. Villar, J. D. Chapman, N. M. Long, and R. J. Collier. 2014. Evaluation of OmniGen AF in lactating heat stressed Holstein cows. Page 16 in 25th Annual Florida Ruminant Nutrition Symposium. Accessed Oct. 15, 2015. http://dairy.ifas. ufl.edu/rns/2014/2014 Igono, M.O., Johnson, H. D., Steevens, B. J., Krause, G. F., Shanklin, M. D. 1987. Physiological, productive, and economic benefits of shade, spray, and fan system versus shade for Holstein cows during summer heat. J. Dairy Sci. 70: 1069 1079. IUPS Thermal Commission. 2001. Glossary of terms for thermal physiology. Jap. J. Phys. 51: 245 280. Johnson, H. D., P. S. Kaitti, L. Hahn, and M. D. Shanklin. 1988. Short term heat acclimation influences on lactation of Holstein cattle. Missou ri Agric. Exp. Sta. Res. Bull. No 916. Columbia. Jrgensen, E., and A. R. Pedersen. 1998. How to obtain those nasty standard errors from transformed data and why they should not be used. Biometry Research Unit Internal report 7. Danish Institute of Ag ricultural Sciences. pp 20. Kutlu, H.R. 2001. Influences of wet feeding and supplementation with ascorbic acid on performance and carcass composition of broiler hicks exposed to a high ambient temperature. Archiv fr Tierernahrung 54:127 139. Kanyiama ttam, K. and A. De Vires. 2014. Agreement between milk fata, protein and lactose observations collected from the dairy herd improvement association (DHIA) and a real time milk analyzer. J. Dairy Sci. 97:2896 2908. Lasceiles, A. K. 1979. The immune system of the ruminant mammary gland and its role in the control of mastitis. J. Dairy Sci. 62:1647 1664 Leiva, T., R. F. Cooke, A. P. Brando, R. S. Marques and J. L. M. Vasconcelos. 2015. Effects of rumen protected choline supplementation on metabolic and perf ormance responses of transition dairy cows. J. Anim. Sci. 93:1896 1904. Legates, J. E., B. R. Farthing, R. B. Casady and M. S. Barrada. 1991. Body temperature and respiratory rate of lactating dairy cattle under field and chamber conditions. J. Dairy Sci. 74:2491 2500. Lewczuk, B., G. Redlarski, A. Zak, N. Ziolkowska, B. Przybylska Gornowicz and M. Krawczuk. 2014. Influence of electric, magnetic, and electromagnetic fields on the circadian system: current stage of knowledge. BioMed. Res. Int. 169459.

PAGE 92

92 Mc Dowell, R. E., G. L. Ford, E. G. Moody and P. J. Van Soest. 1964. Physiological responses of lactating cows fed dietary fats at high temperatures. J. Dairy Sci. 47:692(Abstr.). Moody, E. G., P. J. Van Soest, R. E. McDowell and G. L. Ford. 1967. Effects of high temperature and dietary fat on performance of lactating cows. J. Dairy Sci. 50:1909 1924. Moody, E. G., P. J. Van Soest, R. E. McDowell and G. L. Ford. 1971. Effect of high temperature and dietary fat on milk fatty acids. J. Dariy Sci. 54:1457 1460. Nace, E. L., S. C. Nickerson, F. M. Kautz, S. Breidling, D. Wochele, L. O. Ely, and D. J. Hurley. 2014. Modulation of innate immune function and phenotype in bred dairy heifers during the periparturient period induced by feeding an immunostimulant for 6 0 days prior to delivery. Vet Immunol. Immunopathol. 161:240 250. NRC. 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Sci. Washington, DC. Oliver, J., F. H. Dodd and F. K. Neave. 1956. Udder infections in the dry period. IV. The re lationship between the new infection rate in the early dry period and the daily milk yield at drying off when lactation was ended by either intermittent or abrupt cessation of milking. J. Dairy Res. 23 204. Oliver, S. P and L. M. Sordillo 1989. Approaches to the manipulation o f mammary involution. J. Dairy Sci. 72:1647 1664. Oltenacu, P. A. and D. M. Broom. 2010. The impact of genetic selection for increased milk yield on welfare of dairy cows. Anim. Welfare 39 49. Overton, T. R. and M. R. Waldron. 2004. Nutritional managemen t of transition dairy cows strategies to optimize metabolic health. J. Dairy Sci. 87:(E. Suppl.): E105 E119. Paape, M. J. and Miller, R. H. 1992. Influence of involution on intramammary phagocytic defense mechanisms. J. Dairy Sci. 75:1849 1856. Ryan, D. P and M. P. Boland. 1992. Evaluating two different cooling management systems for dairy cows in hot, dry climate. J. Dairy Sci. 75:1052 1059. Ryman, V. E., S. C. Nickerson, F. M. Kautz, D. J. Hurley, L. O. Ely, Y. Q. Wang, and N. E. Forsberg. 2013. Effec t of dietary supplementation on the antimicrobial activity of blood leukocytes isolated from Holstein heifers. Res. Vet. Sci. 95:969 974. Renaudeau, D., A. Collin, S. Yahav, V. Basilio, J. L. Gourdine, and R. J. Collier. 2011. Adaptation to hot climate an d strategies to alleviate heat stress in livestock production. Animal, Volume 6, Issue 05, pp 707 728.

PAGE 93

93 Rhoads, M. L., R. P. Rhoads, M. J. Vanbaale, R. J. Collier, S. R. Sanders, W. J. Webber, B. A. Crooker and L. H. Baumgard. 2009. Effects of heat stress and plane of nutrition on lactating Holstein cows: production, metabolism, and aspects of circulating somatotropin. Rhoads, M. L., J. W. Kim, R. J. Collier, B. A. Crooker, Y. R. Boisclair, L. H. Baumgard, and R. P. Rhoads. 2010. Effects of heat stress a nd nutrition on lactating Holstein cows: II. Aspects of hepatic growth hormone responsiveness. J. Dairy Sci. 93:170 179. Roman Ponce, H., W. W. Thatcher, D. E. Buffington, C. J. Wilcox, and H. H. Van Horn. 1976. Physiological and Production responses of d airy cattle to shade structure in a subtropical environment. J. Dairy Sci. 60:425 430. Rungruang, S., J. L. Collier, R. P. Rhoads, L. H. Baumgard, M. J. de Veth, and R. J. Collier. 2014. A dose response evaluation of rumen protected niacin in thermoneutra l or heat stressed lactating Holstein cows. J. Dairy Sci. 97:5023 5034. Sakomura, N. K., N. N. A. Barbosa, F. A. Longo, E. P. da Silva, M. A. Bonato and J. B. K. Fernandes. 2013. Effect of dietary betaine supplementation on the performance, carcass yield, and intestinal morphometrics of broilers submitted to heat stress. Brazilian J. Poultry Sci. 15:105 112. S anchez, W. K., M. A. McGuire, and D. K. Beede. 1994. Macro mineral nutrition by heat stress interactions in dairy cattle: review and original resear ch. J. Dairy Sci. 77:2051 2079. Sawa A, M. Bogucki, W. Neja. 2012. Dry period length and performance of cows in the subsequent production cycle. Arch Tierz 55:140 147. Schneider, P. L., D. K. Beede and C. J. Wilcox. 1986. Responses of lactating cows to d ietary sodium source and quantity and potassium quantity during heat stress. J. Dairy Sci. 69:99 110. Seigneuric R., H. Mjahed, J. Gobbo A. Joly, K. Berthenet, S. Shirley, and C. Garrido 2011. Heat shock proteins as danger signals for cancer detection. Front. Oncol. 1:37. Shwartz, G., M. L. Rhoads, M. J. VanBaale, R. P. Rhoads, and L. H. Baumgard. 2009. Effects of a supplemental yeast culture on heat stre ssed lactating Holstein cows. J. Dairy Sci. 92:935 942. Smith, K. L., D. A. Todhunter. 1982. The physiology of mammary gland during the dry period and the relationship to infection. Page 87 93 in: Proc. 21st Annu. Mtg. Natl. Mastitis Counc., Inc., Louisvi lle, KY. Sobolewska, A., M. Gajewska, J. Zarzynska, B. Gajkowska, and T. Motyl. 2009. IGF I, EGF, and sex steroids regulate autophagy in bovine mammary epithelial cells via the mTOR pathway. Eur. J. Cell Biol. 88:117 130.

PAGE 94

94 Sorensen, M. T., J. V. Nrgaard, P. K. Theil, M. Vestergaard, and K. Sejrsen. 2006. Cell turnover and activity in mammary tissue during lactation and dry period in dairy cows. J. Dairy Sci. 89:4632 4639. St Pierre, N. R., B. Cobanov, and G. Schnitkey. 2003. Economic losses from heat str ess by US livestock industries. J. Dairy Sci. 86(E.Suppl.): E52 E77. Tao, S., J. W. Bubolz, B. C. do Amaral, I. M. Thompson, M. J. Hayen, S. E. Johnson, and G. E. Dahl. 2011. Effect of heat stress during the dry period on mammary gland development. J. Da iry Sci. 94:5976 5986. Tao, S., A. P. A. Monteiro, I. M. Thompson, M. J. Hayen, and G. E. Dahl. 2012a. Effect of late gestation maternal heat stress on growth and immune function of dairy calves. J. Dairy Sci. 95:7128 7136. Tao, S., I. M. Thompson, A. P A. Monteiro, M. J. Hayen, L. J. Young, and G. E. Dahl. 2012b. Effect of cooling heat stressed dairy cows during the dry period on insulin response. J. Dairy Sci. 95:5035 5046. Tao, S. and G. E. Dahl. 2013. Invited review: Heat stress effects during lat e gestation on dry cows and their calves. J. Dairy Sci. 96:4079 4093. Tonner, E., G. J. Allan, and D. J. Flint. 2000. Hormonal control of plasmin and tissue type plasminogen activator activity in rat milk during involution of the mammary gland. J Endocri nol. 167:265 73. Tucker, H. A. 2000. Hormones, mammary growth, and lactation: a 41 year perspective. J. Dairy Sci. 83:874 884. Velasco, J. M., E. D. Reid, K. K. Fried, T. F. Gressley, R. L. Wallace and G. E. Dahl. 2008. Short day photoperiod increases m ilk yield in cows with reduced dry period length. J. Dairy Sci. 91:3467 3473. Wall, E. H., T. L. Auchtung, G. E. Dahl, S. E. Ellis, and T. B. McFadden. 2005. Exposure to short day photoperiod during the dry period enhances mammary growth in dairy cows. J Dairy Sci. 88:1472 1478. Wang, Y. Q., S. B. Puntenney, N. E. Forsberg, 2004. Identification of the mechanisms by which OmniGen AF, a nutritional supplement, augments immune function in ruminant livestock. Proc., West. Sec., Am. Soc. Anim. Sci. 55:349 4 35. Wang, Y. Q., S. B. Puntenney, J. L. Burton, and N. E. Forsberg. 2007. Ability of a commercial feed additive to modulate expression of innate immunity in sheep immunosuppressed with dexamethasone. Anim. 1:945 951. West, J. W. 1999a. Nutritional strat egies for managing the heat stressed dairy cows. J. Anim. Sci. 77:21 35.

PAGE 95

95 West, J. W., G. M. Hill, J. M. Fernandez, P. Mandebvu and B. G. Mullinix. 1999b. Effects of dietary fiber on intake, milk yield, and digestion by lactating dairy cows during cool or hot, humid weather. J. Dairy Sci West, J. W. 2003. Effects of heat stress on production in dairy cattle. J. Dairy Sci. 86:2131 2144. Wheelock, J. B., R. P. Rhoads, M. J. Vanbaale, S. R. Sanders and L. H. Baumgard. 2009. Effects of heat stress on energeti cs metabolism in lactating Holstein cows. J. Dairy Sci. 93:644 655. Wilde, C. J., V. P. C. Addey, P. Li, and D. G. Fernig. 1997. Programmed cell death in bovine mammary tissue during lactation and involution. Exp. Physiol. 82:943 953. Wise, M. E., D. V. Ar mstrong, J. T. Huber, R. Hunter, and F. Wiersma. 1988. Hormonal alterations in the lactating dairy cow in response to thermal stress. J. Dairy Sci. 71:2480 2485. Wohlgemuth, S. E., Y. Ramirez Lee, S. Tao, A. P. A. Monteiro, B. M. Ahmed, and G. E. Dahl. 20 16. Short communication: Effect of heat stress on markers of autophagy in the mammary gland during the dry period. J. Dairy Sci. 99:4875 4880. Zarzynska, J., B. Gajkowska, U. Wojewodzka, E. Dymnicki, and T. Motyl. 2007. Apoptosis and autophagy in involuti ng bovine mammary gland is accompanied by up regulation of TGF beta (1) and suppression of somatotropic pathway. Pol. J. Vet. Sci. 10:1 9. Zimbelman, R. B., R. P. Rhoads, M. L. Rhoads, G. C. Duff, L. H. Baumgard, and R. J. Collier. 2009. A re evaluation of the impact of temperature humidity index (THI) and black globe humidity index (BGHI) on milk production in high producing dairy cows. Pages 158 168 in Proc. So uthwest Nutr. Man. Conf., Tempe, AZ. Univ. Arizona, Tucson. Zimbelman, R. B., L. H. Baumgard and R. J. Collier. 2010. Effects of encapsulated niacin on evaporative heat loss and body temperature in moderately heat stressed lactating Holstein cows. J. Dairy Sci. 93:2387 2394. Zimbelman, R. B., R. J. Collier, and T. R. Bilby. 2013. Effects of utilizing rumen protected niacin on core body temperature as well as milk production and composition in lactating dairy cows during heat stress. Anim. Feed Sci. Technol. 180:26 33.

PAGE 96

96 BIOGRAPHICAL SKETCH Thiago F. Fabris was born in So Paulo, Brazil. In 2009, he entered the Pontifcia University Catlica of Minas Gerais in Veterinary School and obtained his B.S. in 2014. In 2014, he moved to Gainesville, Florida, USA and joined the Animal Sciences program as an M.S. student in the spring semester of 2015. His M.S. work focuses on the effect of OmniGen AF supplementation and heat stress during the dry period on thermal physiology, immune function and mammary gland developme nt.