Citation
Non-Ionotropic Nicotinic Acetylcholine Receptor Signaling

Material Information

Title:
Non-Ionotropic Nicotinic Acetylcholine Receptor Signaling
Creator:
Gould, Timothy M
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (202 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Chemistry
Committee Chair:
HORENSTEIN,NICOLE ALANA
Committee Co-Chair:
BRUNER,STEVEN DOUGLAS
Committee Members:
MURRAY,LESLIE JUSTIN
BUTCHER,REBECCA ANN
PAPKE,ROGER LEE
Graduation Date:
8/6/2016

Subjects

Subjects / Keywords:
Ion channels ( jstor )
Journalism ( jstor )
Messenger RNA ( jstor )
Nicotinic receptors ( jstor )
Plasmids ( jstor )
Receptors ( jstor )
RNA ( jstor )
Signals ( jstor )
T lymphocytes ( jstor )
Viability ( jstor )
Chemistry -- Dissertations, Academic -- UF
acetylcholine -- alpha7 -- inflammation -- nicotinic -- non-ionotropic -- receptor -- signal -- transduction
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Chemistry thesis, Ph.D.

Notes

Abstract:
Transmembrane receptors like those sensitive to acetylcholine are typically classified as either ionotropic or metabotropic with respect to their cellular function. However, studies indicate there may be non-ionotropic function(s) associated with some ligand-gated ion channels such as the nicotinic acetylcholine receptors (nAChR). This dissertation tests the hypothesis that non-ionotropic or metabotropic-like nAChR function(s) exist, thus the primary objective was to execute experiments that would generate data to address this hypothesis. Specifically within the context of immune cell function, alpha7 subunit-containing nAChR and the putatively associated homopentameric receptor have been implicated in the regulation of inflammation-related signal transduction activities. Currently, research on the cholinergic anti-inflammatory pathway and nAChR-dependent regulation of inflammation is somewhat confounded by the observations that while nAChR proteins have been detected in several types of immune cells, no macroscopic nAChR-dependent ionotropic function has been experimentally demonstrated in such cells. Experiments herein with human T lymphocyte cell lines (Jurkat) support the native expression of alpha7 and other nAChR subunit mRNA but the cells lack detectable ion channel function. Nonetheless, experiments with mitogen-stimulated Jurkat cells demonstrate that ligands with known activities on alpha7-containing nAChR (GTS-21 and NS6740) affect intracellular signaling including NF-kappaB activation, cytokine (IL-2) synthesis, cell survival and apoptosis. The effects of GTS-21 and NS6740 were also associated with changes in expression of nAChR subunit mRNA, including alpha7. The signaling/survival effects induced by GTS-21 and NS6740 in stimulated Jurkat cells were not blocked by an antagonist of alpha7 nAChR ion channel function, were not sensitive to a non-selective muscarinic acetylcholine receptor antagonist, and were not dependent on extracellular calcium. At high concentrations GTS-21 and NS6740 were effective regulators of such effects whereas efficacious nAChR ion channel agonists such as nicotine were not. Importantly, GTS-21 and NS6740 effects on Jurkat cell signaling were largely persistent even in putatively alpha7-deficient cells, indicating that alpha7 nAChR may not be involved in this regulation. Taken together and in conclusion, these studies suggest that GTS-21 and NS6740 may impact immune cell signaling through an alpha7 nAChR-independent, non-ionotropic mechanism. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2016.
Local:
Adviser: HORENSTEIN,NICOLE ALANA.
Local:
Co-adviser: BRUNER,STEVEN DOUGLAS.
Statement of Responsibility:
by Timothy M Gould.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Gould, Timothy M. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Classification:
LD1780 2016 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

NON IONOTROPIC NICOTINIC ACETYLCHOLINE RECEPTOR SIGNALING By TIMOTHY MICHAEL GOULD A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2016

PAGE 2

© 2016 Timothy Michael Gould

PAGE 3

To Emily

PAGE 4

4 ACKNOWLEDGMENTS I thank my wife and family for their constant support and intrepid belief that I can achieve my goals whatever they may be . Most especially I than k my mother Kathy, father Jack, and brothers Jeffrey and Jonathan. I also thank Rick, Linda and Jameson Fetzer, for their constant support and encouragement. I thank Korey Wilson, Dr. Kyle Powers, Dr. Wil liam Alvarez, William Allred, Dan Trimble, Darcy and Tim Krentz, for their invaluable friendships and mentorships. I thank my high school chemistry teacher, Dr. Scott McCord, for teaching me that education is about communicating the use of reasoning for th e purpose o f understand ing concepts and not about knowing facts. I thank my undergraduate professors and academic research mentors Dr. Ashwin Vaidya, Dr. Ravindran Chella and Dr. Samuel Grant, for providing research opportunities and for their endorsements and support of my academic pursuits. I thank Dr. Steven Bruner, Dr. Rebecca Butcher and Dr. Leslie Murray, for serving as members of my Ph . D . dissertation supervisory committee. Additionally, I thank Dr. Brian Law, Dr. Edgardo Rodriguez and Dr. Eliot Sp indel, for their critical feedback and guidance regarding numerous topics relevant to this dissertation. I thank my fellow graduate student peers and staff in both the Department of Chemistry and the Department of Pharmacology and Therapeutics for their support . I especially thank members of the Horenstein and Pa pke research groups . I thank Dr. Chengju Tian for conducting Patch clamp experiments with advice from Dr. Can Peng. I thank Dr s . Paramita Chakrabarty , Ganesh Thakur and Peter Crooks for kindly providing materials used in these studies .

PAGE 5

5 I thank the Department of Chemistry and College of Liberal Arts and Sciences at the University of Florida, National Institutes of Health (grant number GM57481) , and the United States Israel Binational Science Foun dation for research and travel funding support. Finally, I thank Dr. Nicole Horenstein and Dr. Roger Papke, for mentoring me in the art of scientific research throughout my course of study at the University of Florida.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 17 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 19 Background and History ................................ ................................ .......................... 19 Cys Loop Receptors: Structure and Function ................................ ......................... 20 2 PROJECT RATIONALE ................................ ................................ .......................... 28 Non Ionotropic Signaling Hypotheses ................................ ................................ ..... 28 Relevant Paradigms: 7 nAChR ................................ ................................ ............. 29 The Cholinergic Anti Inflammatory Pathway ................................ ........................... 30 Additional Factors Potentially Relevant to nAChR Function in Immune Cells ......... 32 Chaperone/Accessory Proteins ................................ ................................ ........ 32 Other Nicotinic Acetylcholine Receptor Subunits ................................ ............. 33 The duplicated form of the 7 nAChR subunit encoded by CHRFAM7A ... 33 Non 7 nAChR subunits ................................ ................................ ............ 35 Effective nAChR Agents in Immune/Inflammation Related Models .................. 36 GTS 21 ................................ ................................ ................................ ...... 36 NS6740 ................................ ................................ ................................ ...... 38 Putative In vitro Models of Inflammation or Immune Cell Activation ....................... 39 3 METHODS ................................ ................................ ................................ .............. 43 Cell Culture ................................ ................................ ................................ ............. 43 Chemical s and Reagents ................................ ................................ ........................ 43 Transient Transfection ................................ ................................ ............................ 44 Patch Clamp Electrophysiology ................................ ................................ .............. 45 RNA Extraction ................................ ................................ ................................ ....... 46 Reverse Transcription Polymerase Chain Reaction (RT PCR) .............................. 46 Agarose Gel Electrophoresis ................................ ................................ .................. 47 Secreted Luciferase (SLuc) Reporter Assay ................................ ........................... 47 Cell Viability (MTS) Assay ................................ ................................ ....................... 48 Caspase Assay ................................ ................................ ................................ ....... 48

PAGE 7

7 Western Blotting ................................ ................................ ................................ ..... 49 Enzyme Linked Immunosorbent Assay (ELISA) ................................ ..................... 50 Molecular Cloning and Recombinant Protein Expression ................................ ....... 52 Genome Editing ................................ ................................ ................................ ...... 56 Data and Statistical Analysis ................................ ................................ ................... 58 4 RESEARCH STUDIES ................................ ................................ ........................... 61 On Human T Lymphocytes (Jurkat and Jurkat Dual Cells) ................................ ..... 61 Evidence for nAChR Expression and Electrophysiological Findings ................ 61 NF B Luciferase Reporter System ................................ ................................ .. 65 Putative Nicotinic Drug Effects on ................................ ................................ .... 66 NF B reporter activity and cell viability (survival) ................................ ...... 66 Interleukin 2 and CHRNA7 expression ................................ ...................... 72 Caspase activity (apoptosis) ................................ ................................ ...... 76 Putative Nicotinic Drug Effects Independent of ................................ ................ 79 Extracellular calcium ................................ ................................ .................. 79 Nicotinic receptor antagonist ................................ ................................ ...... 80 Muscarinic receptor antagonist ................................ ................................ .. 82 Proposed Model on Regulation of Jurkat Dual Signaling by GTS 21 and NS6740 ................................ ................................ ................................ ......... 84 Gene Editing ................................ ................................ ................................ ..... 84 Rationale and approach ................................ ................................ ............. 84 Construct design and synthesis ................................ ................................ . 86 Delivery, selection and expansion ................................ .............................. 88 Validation of gene disruption ................................ ................................ ...... 89 Dependence of putative nicotinic drug effects on CHRNA7 expression ..... 93 On Human Monocytes (THP1 Lucia Cells) ................................ ............................. 96 NF B Luciferase Reporter System ................................ ................................ .. 97 Evidence for CHRFAM7A but not CHRNA7 Expression ................................ ... 98 Putative Nicotinic Drug Effects on ................................ ................................ .... 98 NF B reporter activity and cell viability (survival) ................................ ...... 98 Phosphorylation and degradation of I B ................................ ................ 101 TNF expression ................................ ................................ .................... 104 CHRFAM7A and CHRNB2 expression ................................ .................... 105 On Mouse Primary Microglial Cells: ................................ ................................ ...... 108 Putative Nicotinic Drug Effects on TNF Secretion and Cell Viability .................. 108 On Recombinant Human 7 nAChR Intracellular Domain (ICD) Proteins: ........... 110 Cloning, Expression and Characterization ................................ ............................ 110 5 CONCLUDING REMARKS ................................ ................................ ................... 143 On Experimental Limitations ................................ ................................ ................. 143 On Jurkat T Lymphocytes ................................ ................................ ..................... 143 On THP1 Lucia Monocytes ................................ ................................ ................... 145 On Primary Mouse Microglial Cells ................................ ................................ ....... 146

PAGE 8

8 On Recombinant Human 7 nAChR ICD Proteins ................................ ............... 146 APPENDIX A RT PCR DETECTION OF NICOTINIC ACETYLCHOLINE RECEPTOR SUBUNIT TRANSCRIPTS FROM HUMAN T LYMPHOCYTES (JURKAT DUAL CELLS) ................................ ................................ ................................ ................. 147 B EFFECTS OF 7 nAChR ION CHANNEL AGONISTS AR R 17779 AND CHOLINE ON CONCANAVALIN A INDUCED NF B ACTIVATION AND JURKAT DUAL CELL VIABILITY ................................ ................................ ......... 148 C EFFECTS OF 7 nAChR ANTAGONIST tkP3BzPB ON CONCANAVALIN A INDUCED NF B ACTIVATION AND JURKAT DUAL CELL VIABILITY .............. 150 D EFFECTS OF GTS 21 AND NS6740 ON NF B ACTIVITY AND VIABILITY OF UN STIMULATED JURKAT DUAL CELLS ................................ ........................... 151 E EFFECTS O F PI3K INHIBITOR WORTMANNIN ON CONCANAVALIN A INDUCED NF B ACTIVATION AND JURKAT DUAL CELL VIABILITY .............. 152 F SPECUALTIVE COMMENTARY ON PUTATIVE INTERMEDIATES INVOLVED IN nAChR MEDIATED T CELL N F B SIGNALING AND SURVIVAL .................. 153 G EFFECTS OF NICOTINIC DRUG TREATMENTS ON CHRNB2 EXPRESSION IN CONCANAVALIN A STIMULATED JURKAT DUAL CELLS ............................ 156 H PUROMYCIN SURVIVAL STUDIES WITH A7R3HC10 AND JURKAT DUAL CELLS ................................ ................................ ................................ .................. 157 I RT PCR DETECTION OF CHRFAM7A BUT NOT CHRNA7 IN THP1 LUCIA CELLS ................................ ................................ ................................ .................. 158 J SPECULATIVE COMMENTARY ON A POTENTIAL MECHANISM FOR nAChR MEDIATED REGULATION OF NF B SIGNALING IN THP1 LUCIA CELLS ................................ ................................ ................................ .................. 159 K MICROGLIAL LPS VERSUS TNF DOSE RESPONSE AND TNF ELISA STANDARD CURVES ................................ ................................ .......................... 162 L DIALYSIS OF RECOMBINANT 7 nAChR ICD PROTEINS ................................ 163 M ANNOTATED AMINO ACID SEQUENCE OF THE HUMAN 7 nAChR INTRACELLULAR DOMAIN ................................ ................................ ................. 164 LIST OF REFERENCES ................................ ................................ ............................. 166 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 202

PAGE 9

9 LIST OF TABLES Table page 1 1 Expression of n AChR in non excitable tissues ................................ ................... 24 1 2 Putative functions of nAChR in non excitable tissues ................................ ......... 26 3 1 RT PCR primer specifications ................................ ................................ ............ 60 3 2 PCR primer specifications for CRISPR Cas9 construct cloning ......................... 60 3 3 PCR primer specifications for recombinant protein constr uct cloning ................. 60 4 1 Summary of whole cell electrophysiology data ................................ ................. 114

PAGE 10

10 LI ST OF FIGURES Figure page 1 1 Structure of nAChR ................................ ................................ ............................ 27 2 1 In vivo model of the cholinergic anti inflammatory pathway ................................ 41 2 2 Diagram of CHRNA7 and CHRFAM7A protein monomers ................................ . 42 4 1 Detection of CHRNA7 mRNA expression but not nAChR ion channel functi on in Jurkat cells ................................ ................................ ................................ .... 115 4 2 Activation of Jurkat Dual cell NF B secreted luciferase (SLuc) reporter by mitogens ................................ ................................ ................................ ........... 116 4 3 Effects of nAChR drugs on mitogen induced NF B reporter activity and Jurkat Dual cell viability ................................ ................................ .................... 117 4 4 Normalized effects of nAChR drugs on mitogen induced Jurkat Dual NF B activity and viability ................................ ................................ ........................... 118 4 5 Mitogen and nAChR drug effects on IL 2 expression in J urkat Dual cells ........ 119 4 6 Mitogen and nAChR drug effects on CHRNA7 expression in Jurkat Dual cells 120 4 7 Effects of nAChR drugs on mitogen stimulated Jurkat Dual cell caspase 3/7 activation and viability ................................ ................................ ....................... 121 4 8 Decreases of ConA induced NF B reporter activity and cell viability by GTS 21 and NS6740 are not dependent on extracellular Ca 2+ in Jurkat Dual cells .. 122 4 9 Decreases of NF B reporter activity and Jurkat Dual cell viab ility by GTS 21 and NS6740 are not dependent on the 7 nAChR ion channel antagonist MLA ................................ ................................ ................................ .................. 123 4 10 Decreases of NF B reporter activity and Jurkat Dual cell viability by GTS 21 and NS6740 are no t dependent on the non selective mAChR antagonist atropine ................................ ................................ ................................ ............ 124 4 11 Proposed model of NF B/IL 2 signaling and survival/apoptosis in mitogen stimulated Jurkat Dual cells ................................ ................................ .............. 125 4 12 Disruption of CHRNA7 expression in A7R3HC10 (clone 10) cells .................... 126 4 13 Disruption of CHRNA7 and CHRNB2 expression in Jurkat Dual cells (polycl onal) ................................ ................................ ................................ ....... 127

PAGE 11

11 4 14 Disruption of CHRNA7 expression in Jurkat Dual cells (monoclonal) ............... 128 4 15 Disruption of CHRNA7 and CHRNB2 in Jur kat Dual cells increases the response to NF B activation by mitogens ................................ ....................... 129 4 16 Effects of nAChR drug treatments on NF B reporter activity and cell viability in CHRNA7 and CHRNB2 modifieded J urkat Dual cells (polyclonal) .............. 130 4 17 Effects of CHRNA7 disruption on ConA induced NF B reporter activity and cell viability in monoclonal Jurkat Dual cell populations exhibiting CHRNA7 KO p henotypes ................................ ................................ ................................ . 132 4 18 Activation of the NF B luciferase reporter by LPS in THP1 Lucia cells ........... 133 4 19 Effects of nAChR drugs on LPS induced NF B reporter activity and cell viability in THP1 Lucia cells ................................ ................................ .............. 134 4 20 GTS 21 effect on LPS induced NF B reporter activity in THP1 Lucia cells is abrogated by pre application of NS6 740 or Btx ................................ ............ 135 4 21 GTS 21 and NS6740 differentially regulate phosphorylation and degradation state of I B in LPS stimulated THP1 Lucia cells ................................ ............ 136 4 22 Effects of GTS 21 and nicotine on TNF mRNA levels in LPS stimulated THP1 Lucia cells ................................ ................................ .............................. 137 4 23 Effects of nAChR drugs on CHRFAM7A and CHRNB2 expression in THP1 Lucia cells ................................ ................................ ................................ ......... 138 4 24 Effects of GTS 21 and NS6740 on LPS induced TNF secretion and viability of primary mouse microglial cells ................................ ......................... 139 4 25 PCR amplification of recombinant human 7 nAChR ICD inserts .................... 140 4 26 Example of restriction digest analysis of human 7 nAChR ICD plasmid clones ................................ ................................ ................................ ............... 141 4 27 Expression of recombinant human 7 nAChR ICD proteins in E. coli .............. 142

PAGE 12

12 LIST OF ABBREVIATIONS 5 HT B t x A7R3HC10 ACh AChBP AChE Akt AP 2 AR AR R 17779 ATP BCIP bp Cas9 CD3 cDNA ChAT CHRFAM7A CHRNA7 CNS ConA 5 hydroxytrypta mine bungarotoxin Clone 10 of human embryonic kidney 293 cells Acetylcholine Acetylcholine binding protein Acetylcholinesterase RAC serine/threonine protein kinase Activating protein 2 Adrenergic receptor (3 S ) Spiro[1 azabicyclo[2.2.2]octane 3,5' oxazolidine] 2' one hydrochloride Adenosine triphosphate 5 Bromo 4 chloro 3 indolyl phosphate base pair C RISPR associated protein 9 Cluster of differentiation 3 Complimentary deoxyribonucleic acid Choline acetyltransferase Ch olinergic receptor, nicotinic, alpha 7, and family with sequence similarity 7A fusion 2 base pair deletion polymorphism of CHRFAM7A Choli nergic receptor, n icotinic, alpha 7 Central nervous system Concanavalin A

PAGE 13

13 CRISPR DAG DMEM DNA DSB DsRed DTT EDTA EGTA ELI SA ELM EPL ER FBS GABA gRNA GTS 21 HEK 293 HEPES HSQC IC 50 ICD I B Clustered regularly interspaced short palindromic repeat Diacylglycerol Deoxyribonucleic acid Double stranded break Discosoma sp. red fluore scent protein Dithiothreitol Ethylenediaminetetraacetic acid Ethylene glycol tetraacetic acid Enzyme linked immunosorbent assay Eukaryotic linear motif Expressed protein ligation Endoplasmic reticulum Fetal bovine serum aminobutyric acid Guide ribonuclei c acid 3 [(3 E ) 3 [(2,4 dimethoxyphenyl)methylidene] 5,6 dihydro 4 H pyridin 2 yl]pyridine Human embryonic kidney 293 cells 2 [4 (2 hydroxyethyl)piperazin 1 yl]ethanesulfonic acid Heteronuclear single quantum coherence spectroscopy Half maximal inhibitory c oncentration Intracellular domain N uclear factor of light polyp eptide gene enhancer in B cells inhibitor protein ,

PAGE 14

14 I K IL 1 IL 2 IP 3 IPTG JAK2 KO LB LCK LGIC LPS mAChR MLA mRNA MTS nAChR I B kinase Interleukin 1 Interleukin 2 Inositol triphosphate Isopropyl D 1 thiogalactopyranoside Janus kinase 2 Knockout Lysogeny broth Leukocyte specific protein tyrosine kinase Ligand gated ion channel Lipopolysaccharide Muscarinic acetylcholine receptor Methyllycaconitine Messenger ribonucleic acid 3 (4,5 dimethylthiazol 2 yl) 5 (3 carboxymethoxyphenyl) 2 (4 sulfophenyl) 2H tetrazolium Nicotinic acetylcholine receptor NACHO NBT NE NF B NHEJ NMR NP 40 Nicotinic acetylcholine receptor regulator Nitro blue tetrazolium Norepinephrine Nuclear factor light chain enhancer of activated B cells Nonhomologous end joining repair Nuclear magnetic resonance Nonyl phenoxypolyethoxylethanol

PAGE 15

15 NS6740 OD 600 ORF PAM PBS PC12 PCR PI3K PIP2 PKC PLC PMA PNS PVDF RFP RIC 3 RID RLU RNA RNAi RT PCR SDS PAGE sgRNA SH2 1,4 diazabicyclo[3.2.2]nonan 4 yl (5 (3 (trifluoromethyl) phenyl) furan 2 yl) methanone Optical density at 600 nm Open reading frame Positive allosteric modulator Phosphate buffered saline Pheochromocytoma derived cell line Polymerase chain reaction Phosphoinositide 3 kinase P hosphatidylinositol 4,5 bisphosphate Protein kinase C Phospholipase C Phorbol 12 myristate 13 acetate Peripheral nervous system Polyvinylidene fluoride Red fluorescent protein Resistance to inhibitors of cholinesterase protein 3 Residual inhibition or desensitization Relative luminescence unit Ribonu cleic acid Interfering ribonucleic acid Reverse transcription polymerase chain reactio n Sodium dodecyl sulfate polyacrylamide gel electrophoresis Single guide RNA Src homology domain 2

PAGE 16

16 SLuc SpCas9 Src STAT3 TBE TBST TCR THP 1 tkP3BzPB TLR TM3 TM4 TNF ULK4 WT Secreted luciferase Cas9 endonuclease derived from Streptococcus pyogen es Proto oncogene protein tyrosine kinase (derived from sarcoma) Signal transducer and activator of transcription 3 Tris buffer , boric acid and ethylene glycol tetraacetic acid Tris buffered saline containing Tween 20 T cell receptor Tamm Horsfall protein 1 (cells) 1,2,4,5 tetra ( 5 [1 (3 benz yl)pyridinium]pent 1 yl ) benzene tetrabromide Toll like receptor Transmembrane domain 3 Transmembrane domain 4 Tumor necrosis factor Unc 51 like kinase 4 Wild type

PAGE 17

17 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NON IONOTROPIC NICOTINIC ACETYLCHOLINE RECEPTOR SIGNALING By Timothy Michael Gould August 2016 Chair: Nicole Horenste in Major: Chemistry Transmembrane receptors like those sensitive to acetylcholine are typically classified as either ionotropic or metabotropic with respect to their cellular function . However, studies indicate there may be non ionotropic function(s) ass ociated with some ligand gate d ion channels such as the ni cotinic acetylcholine receptors (nAChR) . This dissertation tests the hypothesis that non ionotropic or metabotropic like nAChR function ( s ) exist, thus the primary objective was to execute experimen ts that would generate data to address this hypothesis . S pecifically within the context of immune cell function , 7 subunit containing nAChR and the putatively associa ted homopentameric receptor have been implicated in the regulation of inflammation related signal transduction activities . Currently, r esearch on the cholinergic anti inflammatory pathway and nAChR dep endent regulation of inflammation is somewhat confounded by the observation s that while nAChR proteins have been detected in several types of immune cells, no macroscopic nAChR dependent ion otropic function has been experimentally demonstrated in such cell s . E xperiments herein with human T lymphocyte cell lines (Jurkat) support the native expression of 7 and other nAChR subunit mRNA but the cells lack detectable ion channel function. Nonetheless, experiments with mitogen -

PAGE 18

18 stimulated Jurkat cells demonstrate that ligands with known activities on 7 containing nAChR (GTS 21 and NS6740) affect intracellula r signaling including NF B activation , cytokine (IL 2) synthesis , cell survival and apoptosis . The effects of GTS 21 and NS6740 we re also associated with changes in expression of nAChR subunit mRNA , including 7 . Th e signaling/survival effects induced b y GTS 21 and NS6740 i n stimulated Jurkat cells were not blocked by an antagonist of 7 nAChR ion channel function, were not sensitive to a non selective muscarinic acetylch oline receptor a nta gonist , and were not dep endent on extracellular calcium. At high concentrations GTS 21 and NS6740 were effective regulators of such effects whereas efficacious nAChR ion channel agonists such as nicotine were not. Importantly , GTS 21 and NS6740 effects on Jurkat cell signaling were largely persistent even in putativel y 7 defi cient cells , indicating that 7 nAChR may not be involved in this regulat ion . Taken together and in conclusion , these studies suggest that GTS 21 and NS6740 may impact immune cell signaling through a n 7 nAChR in dependent, non ionotropic mechanism .

PAGE 19

19 CHAPTER 1 INTRODUCTION Background and H istory Nicotinic acetylcholine receptor (nAChR) subunits form a diverse family of pentameric transmembrane receptor protein complexes traditionally known to function as ligand gated ion channels (LGICs). Research on nAChR began at the beginning of the 20 th century upon the discovery of the neurotransmitter acetylcholine (Loewi and Dale) , along with postulate ( 1 3 ) . It has since been deduced that t he binding of the endogeno us ligand acetylcholine to the r eceptor in the extracellular space facilitates receptor conformation change that creates a conduction pathway thereby allowing transient pas sage of small cations down their concentration gradient ( e.g. Na + and Ca 2+ flux int o the cytosol and K + ion flow out of the cell ) . O bservat ion of this phenomenon was demonstrated by electrophysiological techniques that measured the cha nge in muscle fiber membrane potential upon application of acetylcholine as well as the independent electrical stimulation of nerv e ( 4 , 5 ) . These studies led to an extensive period of study on synaptic transmission and the electrical properties of excitable cells containing nAChR . Several years later, the isolation, characterization and cloning of several nAChR protein subuni ts followed , which was largely supported by refinement of molecular technique s ( 6 8 ) . tors and are pharmacologically and functionally distinct from muscarinic acetylcholine receptors (mAChR). Contributing to functions in both the central and peripheral nervous system s (CNS and PNS ) , nAChR affect membrane ion permeability; while m uscarinic receptors are trans membrane proteins they do not form ion channels and primarily

PAGE 20

20 mediate tissue responses to the parasympathetic nervous system as well as some cholinergic function in the CNS . N icotinic receptors are often studied in cortical and mesolimb ic regions of the CNS , where they are implicated in cognitive functions such as learning, memory and addictive behavior ( 9 11 ) . T he majority of excitatory currents in the CNS are evoked by glutamate receptors, yet nAChRs still influence membrane potential, functioning more so in the modulation of synaptic tone and plasticity; thus nAChRs are often diffusely distributed across cell bodies rather than exclusively local ized at synapses in the CNS ( 12 ) . Additionally, ni cotinic receptors are present in the brainstem (medulla) and ganglia outside the CNS, contributing to the generation of autonomic signals from the PNS . Muscle type nAChRs act as the mediators of muscle excitation, initiating threshold de polarization that stimulates the action potentials driving skeletal muscle contraction. Historically, nAChR have been studied within the context of synaptic transmission in excitable cells. Alt hough these receptors were initially characterized in excit a ble muscle and nervous tissues, they are also present in non excitable cells of epithel ial and connective tissues. Thus nAChR are widely expressed in various tissue types and have been indicated to be involved in the regulation of diverse cellular functio ns (Tables 1 1 and 1 2). In recent years, much work in the field has established the significance of nAC hR dependent physiology in many non excitable cell types (see references in Table 1 2) . Cys L oop Receptors: Structure and Function Nicotinic receptors are a member of t he C ys loop receptor superfamily a group of homologous transmembrane proteins that form pentameric LGICs ( 13 ) . These types of receptors can be gated , meaning activated ( i.e. opening of the ion channel pore ) , by

PAGE 21

21 the binding of neurotransmitters. K nown transmitters operating on these channels in vertebrates include acetylcholine (ACh), serotoni n (5 hydroxytrypta mine , 5 HT), aminobutyric acid (GABA) and glycine. Nicotinic receptors and t ype 3 serotonin receptors conduct cations down their concentration gradients which typically depolarize s membrane s promoting excitation at synapses; whereas GABA (types A & C) and glycine re ceptors conduct anions down their concentration gradients which typically facilitates membrane hyperpo larization (in mature neurons), thereby preventing depolarization and inhibiting action potentials at synapses. Nicotinic receptors and other LGICs co e volved from ancestral proteins prior to the development of the nervous system. Bacteria, algae and protozoa related to species that evolved before the development of the nervous system utilize homologs of these ancestral proteins, some of which are relate d to nAChR ( 14 , 15 ) . At least 16 different nAChR subunit proteins ( 1 7, 9 and 10, 1 4, , , and ) evolv ed in the lineage of humans. Nicotinic receptors containing these subunits form either heteropentamers with at least two subunits and two ligand binding sites, or homopentamers composed of all subunits with five pu tative ligand binding sites ( 16 ) . Each subunit contains an amino terminal extracellular domain (approximately 200 residues), a hydrop hobic transmembrane domain composed of four helices, and a hydrophilic intracellular domai n between the third and fourth helices of the transmembrane domain; the relatively short carboxy ter minal sequence following the fourth helix is extracellular. The intracellular domain s are the most highly v ariable region s in both sequence length and composition, among differen t subunits and between species ( 17 ) . In addition to the pair of cysteine residues tha t form the

PAGE 22

22 eponymous Cys loop, subunits have a second pair of adjacent (vicinal) cysteine residues located in a subdomain identified as the C loop, which is required for acetylcholine binding. At least two subunits are present per receptor pentamer ( 13 ) . Orthosteric ligands bind to the extracellular region, where an aromatic ligand binding pocket forms at the subunit interface, adjacent to one surface of the subunits in the pentameric complex. A major unresolved problem in the field is a lack of high resolution experimental structures for a complete nAChR. Homology models are available ( 18 , 19 ) , but have relativ ely low homology to human nAChR (approximately 25%) and only represent the extracellular domain . Such models provide a static representation of receptor stru cture at an instantaneous moment; however, proteins are dynamic molecules with many mobile residues (particularly those near ligand binding sites), and it is important to note that receptor conformational change between open a nd closed states can occur on a sub microsecond timescale ( 20 ) . The s tructural models shown in Figure 1 1 are based on the crystal structure of snail acetylcholine binding protein (AChBP) from Lymnaea stagnalis ( 18 ) , and more recently , an ACh BP mutated to have 64% identity with the extracellular domain of human 7 nAChR ( 21 ) , as well as electron micrograph data on a nAChR s imilar to muscle type receptors which was isolated from the electric ray, Torpedo marmorata ( 19 ) . Together the se data characterized the structure of the extracellular ligand binding domain , and roughly characterized (at low resolution ) the transmembrane doma in and a small portion of the intracellular domain (Figure 1 1) . The majority of the intracellular domain is predicted to be intrinsically disordered ( 22 ) ,

PAGE 23

23 and no three dimensional structural data exists for any nAChR subunit intracellular domain. From a functional perspective, the putatively disordered nature of the intracellular domain s may be favorable, allowing the s e part s of the receptor to be flexible in th e formation of various, transient protein protein interactions ( 23 ) . Analysis of nAChR and other LGIC intracellular domain amino acid sequences predicts several phosphorylation sites and putative sites for interactions with G proteins ( 17 , 22 , 24 ) ; there is also direct experimental evidence for phosphorylated nAChR ( 25 27 ) . While the diverse nAChR intracellular domains are not well characterized, their ability to interact with kinases, phosphatases and other intracellular signaling proteins is consistent with d ata indicating that some LGICs may have metabotropic like activities . Interestingly, the nicotinic receptors of some non neuronal cells ( e.g. those found in leukocytes) challenge whether the function of these receptors is strictly ionotropic . Although n AChR molecules are detected in various hematopoietic white cell types, studies have failed to demonstrate macroscopic nAChR dependent ion channel activity in these cells using electrophysiological methods ( 28 ) .

PAGE 24

24 Table 1 1. Expre ssion of nAChR in non excitable tissues Organ system Cell type s Detection method s Subunits identified References Respiratory Airway and bronchial epithelial cells, Airway fibroblasts, Bronchial smooth muscle cells, Alveolar t ype II cells, Vascular endothelial cells RT PCR Microarray Quantitative PCR In situ hybridization Immunofluorescence Western blot 1, 3 5, 7 1, 2, 4 ( 29 34 ) Cardiovascular Cardiomyocytes, Vascular endothelial cells, Cardiac and endothelial fibroblasts, Arterial and endothelial smooth muscle cells RT PCR FACS Immunohistochemistry 1 7, 9, 10 1 4, ( 35 37 ) Integumentary Skin keratinocytes, Melanocytes, Skin fibroblasts, Epidermal granulocytes, Merkel cells RT PCR Immunofluorescence Immunohistochemistry Western blot 3, 5, 7, 9, 10 2, 4 ( 38 44 ) Gastrointestinal Oral , esophageal , pancreatic and colon epithelial cells , Colon smooth muscle cells , Enterochromaffin cells RT PCR Immunofluorescence Immunohistochemistry Western blot 3, 5, 7 2, 4 ( 45 50 ) Urinary Luminal and basal urothelial cells , Renal tubule, renal cortex and bladder epithelial cells , Renal glomerular endothelial cell s , Mesangial cells RT PCR Quantitative PCR Flow cytometry Immunofluorescence Immunohistochemistry Western blot 1 7, 9, 10 1 4 ( 51 57 )

PAGE 25

25 Table 1 1. Continued O rgan system Cell type s Detection method s Subunits identified References Reproductive Leydig cells , Sertoli cells , Spermatogonia , Spermatocytes , Oviduct and cervical epithelial cells RT PCR In situ hybridization Immunofluorescence Immunocytochemistry Immu noprecipitation Western blot 1 5, 7, 9, 10 1 4 ( 58 63 ) Musculoskeletal Tendon and ligament fibroblasts , Synovial cells , Periosteal cells , Osteoclasts , Osteoblasts RT PCR In situ hybridization Immunofluorescence Immunohistochemistry Western blot 1 7, 9 , 10 2 4 ( 64 71 ) Immune T and B lymphocytes, Monocytes, Macrophages, Dendritic cells, Eosinophil s RT PCR FACS Northern blot Immunofluorescence Immunocytochemistry Western blot ELISA 2 7, 9 , 10 2 4 ( 72 77 ) Endocrine Pituitary cells, Adrenal medul lary cells, Pancreatic islet cells, Pulmonary neuroendocrine cells RT PCR Sequencing Immunofluorescence Immunocytochemistry Western blot E lectrophysiology 2 7, 9 2 4 ( 78 80 )

PAGE 26

26 Table 1 2. Putative f unctions of nAChR in non excitable tissues Organ system Functions/processes indicated Subunits involved References Respiratory Development, secretion, epithelial plasticity, adhesion, motility, prolifera tion, apoptosis 3, 7 ( 34 , 81 84 ) Cardiovascular Angiogenesis, endothelial growth and tone, migration, proliferation, survival an d apoptosis 7, 9 ( 36 , 37 , 85 90 ) Integumentary Epitheliali zation, differentiation, keratinization, cornification, migration, adhesion, proliferation, apoptosis 3, 7, 9 ( 38 , 39 , 41 , 44 , 49 , 91 96 ) Gastrointe stinal Epithelial plasticity and tone, motility, adhesion, proliferation, survival and apoptosis 3, 4 , 7 2, 4 ( 43 , 50 , 97 99 ) Urinary Urothelial plasti city, renal tone, micturition, reabsorption, fibrosis, proliferation 3, 7, 9 ( 51 , 54 , 100 102 ) Reproductive Fertilization, acrosomal reaction, motility, gametogenesis 7 4 ( 58 , 60 , 61 , 103 , 104 ) Musculoskeletal Bone and synovia remodeling, matrix formation, fibrosis, mineralization, differentiation, proliferation, apoptosis 1, 2, 4 1, 2, 4 ( 64 , 67 , 105 108 ) Immune Inflammation, he matopoiesis, migration, secretion, differentiation, proliferation, survival and apoptosis 4, 5, 7 ( 72 , 7 3 , 77 , 109 111 ) Endocrine Development, secretion 6, 7 4 ( 78 , 112 )

PAGE 27

27 Figure 1 1. Structure of nAChR . Models of human nAChR are shown as ribbon diagrams and adapted from pd b structures 2BG9 and 4HQP. A) The Cys loop nAChR peptide chain and dom ain organizati on depicted as a single monomer , B ) Top view of the extracellular region and vestibule of a homopentamer c ontaining all subunits with five orthosteric binding sites. E ach subunit is represented by a different color. The ligand binding pocket forms at the interface between adjacent subunits where the C loop hinges in and out upon ligand binding. Dashed arrows indicate r eceptor twist that occurs when isomerizing between open and closed conformations. C) Side view of the nAChR pentamer depicting the extracellular and transmembrane domains; note the majority of the intracellular domain s are missing from all experimentally determined structural models. D) Close up view of the orthosteric ligand binding site indicating the cysteine residues that form the disulfide bridges (yellow) of the C loop (cyan) and Cys loop (magenta). View also reveals important conserved aromatic re s idues at the orthosteric ligand binding site, which create a electron rich pocket for interaction with cationic ligand motifs such as the quaternary amine grou p of acetylcholine. Ligand binding domain r esidue orientations were selected from the Dunbrac k rotamer library. Model generated using Chimera software (UCSF).

PAGE 28

28 CHAPTER 2 PROJECT RATIONALE No n Ionotropic Signaling Hypothese s The classical view on nAChR function defines the s e receptor s to be ionotropic rather than metabotropic. Based on previous st udies summarized in Tables 1 1 and 1 2, it is apparent that nAChR are implicated in the regulation of a number of processes in non neuronal cells. For some non excitable cell types ( e.g. epithelial and endothelial cells), macroscopic nAChR dependent ion c urrents have been reported using electrophy s iological methods ( 113 , 114 ) ; yet, there have been no such data r eported for leukocytes expressing nAChR. However, studies indicate that nicotinic receptor ligands still affect intracellular signal transduction activities in leukocytes ( 109 , 115 117 ) . The se observations are consistent with the hypothesis that nAChR may affect signal transduction pathways in a manner that does not require activation of the receptor ion chann el, i.e. via a non ionotropic , or metabotropic like , signaling mechanism . This umbrella hypothesis contains two sub hypotheses: one is that nAChR can directly affect signal transduction mechanisms , and the other is that this activity can occur independent of ion flux through the receptor channel. If these hypotheses were validated, it would necessitate reformation of the dichotomous functional classifications of trans membrane receptors as either ionotropic or metabotropic as both would apply to nAChR in s ome cases . There are some pre existing observations that are in agreement with and supportive of these hypotheses. One is the observation that nicotinic drugs can affect cell signal ing in leukocytes despite any direct e vidence demonstrating the requiremen t for channel ion flux. Another invokes recent proteomic findings, which detected several

PAGE 29

29 (>30) auxiliary proteins that associate with ion channels , with many of such proteins being membrane anchored or coupled to intracellular signaling cascades ( 118 121 ) . It is plausible that ligand binding to nAChR may affect intracellular signaling through direct protein protein interactions without causing the receptor cha nnel to open. It is also possible that ligand binding to nAChR may temporarily cause the ion channel to open, but only after the channel closes with a ligand remaining bound to the receptor is intracellular signaling activated. If the later were true, th en within certain paradigms it would not be possible to determine whether intracellular signaling effects of a ligand are dependent on ion channel activation or not if the ligand can put nAChR in both ligand bound open and closed receptor states ; t herefore , data involving the use of ligands that can open the receptor ion channel are often ambiguous with respect to the cell signaling effects dependence on channel activation. The goal of this thesis and series of studies are to gather data that will address the validity of these hypotheses. Relevant Paradigms : 7 nAChR The 7 nicotini c acetylcholine receptor subu nit and homopentameric receptor subtype is a therapeutic target for a wide range of cognitive and peripheral disorders . El ectrophysiological studies have distinguished the ionotropic properties of 7 nA ChR from other nAChR types by its rapid activation/deactivation kinetics with respect to channel open/closing rates , high permeability to Ca 2+ and low probability of channel opening ( 122 126 ) . There are at least two potential functional outcomes of ligand s binding to this receptor: (i) transient activation of the ion channel, and (ii) induction and stabilization of alternative, drug bound channel closed conformati onal states typically , which hypothetically may be associated with activation or

PAGE 30

30 modulation of downstream signal transduction processes in some cell specific contexts . T his project is focused on understand ing the molecular me chanism(s) associated with these phenomena in the context of immune cells and the regulation of inflamm at ory signaling . The Cholinergic Anti Inflammatory Pathway The 7 nAChR subunit is a current drug target for pharmacological control of inflammation ( 127 ) . The role of 7 nAChR in the regulation of inflammation was first demonstrated when 7 knockout (KO) mice failed to attenuate pro inflammatory cytokine secretion in response to bacterial endotoxemia in contrast to wild type (WT) mice ( 77 ) . It ha s since been understood that a ch olinergic anti inflammatory pathway ( or reflex ) functions through autonomic vagal signaling in vivo ( 128 ) . Mechanistic physiology studies delineated how the nervous and immune systems communicate through the vagus to function in the cholinergic anti inflammatory pathway (Figure 2 1) : Sensory neurons in peripheral tissues can respond to infectious agents and inflammatory signal ing molecule s ( e.g. LPS, IL 1 ), which leads to the activation of afferent vagal fibers projecting to the nucleus tractus solitarius causing glutamate rele ase in the medulla oblongata ( 129 ) . The nucleus tractus solitarius innervates the dorsal motor nucleus of the vagus, which sends vagal sensory signals to pre ganglionic efferent neurons. Vagal efferent fibers can release ACh in ganglia at the celiac and superior mesenteric plexus, activating post ganglionic peripher al adrenergic splenic neurons ( 130 ) . Norepinephrine release in the spleen activates 2 adrenergic receptors on T lymphocytes, stimul ating ACh synthesis in T cells ( 131 ) . It is thought that such activated T cells can enter circulation and release ACh through the bl oodstream where

PAGE 31

31 it may act on 7 containing nAChR in peripheral leukocytes to attenuate inflammatory signaling . The nicotine mediated attenuati on of pro inflammatory cytokine secretion in macrophages was shown to occur through m odulation of the transcription factor NF B ( 109 ) , which controls the synthesis of several inflammatory cytokines and immune cell survival signals ( 132 ) . There are several molecular intermediates and multiple signal transduction pathways that may interact and conver ge on NF B activation in l eukocytes ( 132 ) . Some reports indicate that modulation of NF B by nAChR may also involve coincident modula tion of the JAK2/STAT3 pathway ( 115 , 127 ) . Studies demons trate that either electrical or pharmacological stimulation of the cholinergic anti inflammatory pathway are potentially effective therapeutics for in vivo models of inflammation and infection ( 53 , 133 138 ) . New pharmacological agents targeting nAChR, which typically have some degree of selectivity for 7 type nAChR , have been developed and are being evaluated fo r treatment of inflammation and inflammatory pain related disorders ( 139 141 ) . Interestingly , as it is relevant to a putative non i onotropic signaling phenomenon, some of the agents that are effective in these paradigm s evoke only partial or very wea k activation of the receptor ion channel and more effectively stabilize ligand bound closed (desensitized) receptor states ( 141 ) . There are also reports indicating that nAChR antagonists (characterized by the ability to prevent ion channel activation) can attenuate t he secretion of microglial pro inflammatory cytokines in vitro ( 142 ) . As it relates to the understanding of ionotropic versus non ionotropic function , generally t here are some inconsistent results regarding the nature of the effects that nAChR ion channel agonists and antagonists e xert in immune and inflammation related

PAGE 32

32 paradigms ( 142 144 ) . Importantly and relevant to the context of this dissertation, it has yet to be directly demonstrated in the literature whether or not regulation of inflammatory signaling by nAChR requires channel activation, and whether or not such regulation is dependent on 7 nA ChR in a cell specific manner. Additional Factors Potentially Relevant to nAChR Function in Immune Cells Chaperone/ Accessory Proteins Resistance to inhibitors of cholinesterase 3 ( RIC 3 ) is known to be a chaperone and/or regulatory protein required fo r the maturation and regulation of nAChR ion channel function ( 145 ) . The expression of RIC 3 has a generally positive correlation with 7 nAChR channel function ( 146 , 147 ) . Data indicate this is consistent with a mechanism whereby RIC 3 expression enhances the surf ace expression process ( i.e. folding /assembly/trafficking) of functional 7 nAChR and not protein expression levels ( 148 ) . Reports sugges t that the facilitation of mature functional 7 nAChR by RIC 3 involves interactions with regions of the 7 subunit intracellular domain at the putative amphipathic helix ( 149 ) . Interestingly , RIC 3 may differentially affect other nAChR types such as those containing 4 and 2 subunits ( 146 , 148 ) . The effect of RIC 3 expression on 4 and 2 contain ing nAChR however has not been consistently reported in the literature, and different effects have been observed depending on the type of cell in which the nAChR were characterized , i.e. heterologous expression in Xenop us laevis oocytes versus expression in mammalian cells ( 146 , 148 , 150 ) . RIC 3 expression is associated with decreas ed 4 2 nAChR channel function in X . laevis ( 146 ) , but increased 4 and 2 subunit protein levels and corresponding ion channel function in transfected mammalian ce lls ( 148 , 150 ) . These data would suggest that there might be

PAGE 33

33 additional cell specific factors regulating the function of RIC 3 as a molecular chaperone of nAChR. Additionally, s tudies with immune cells in vitro indicate that RIC 3 expression levels are dependent on pro inflammatory stimulation ( 151 ) , which may suggest a potential role for RIC 3 in inflammation related immune cell signaling. Furthermore, p roteomic studies identified thirty nine proteins associated with 7 nAChR only when RIC 3 was co expressed ( 152 ) , with many of such proteins affecting the cell cycle , cytoskeleton, protein processing/trafficking, and signal transduction activities. In addition to RIC 3, t he recently identified transmembrane protein NACHO was reported to promote assembly of functional 7 nAChR expressed on the cell surface, suggest ing that it may also be an important molecular chaperone of nAChR ( 153 ) . Other Nicotinic Acetylcholine Receptor Subunits The duplicated form of the 7 nAChR subunit encoded by CHRFAM7A A nother unclear aspect with regard to 7 nAChR function in the human immune system is why some leukocytes e xpres s alternative forms of the 7 nAChR subunit encoded by CHRFAM7A ( 28 , 111 , 154 157 ) . In addition to the CHRNA7 gene, which encodes the 7 nAChR subunit, most humans harbor an additional 7 subunit r elated gene, CHRFAM7A , with approximately 10% of individuals having only one copy and only rare indivi duals missing CHRFAM7A in both alleles ( 158 ) . Both human CHRNA7 and CHRFAM7A loci map to region 13 on the long arm of chromosome 15 (15q13) ( 159 ) ; the hybrid gene CHRFAM7A includes partial duplication of the CHRNA7 gene (exons 5 10) , which is fused to another partially duplicated gene ( ULK4 ) in a head to tail manner . ULK 4 encodes unc51 like serine/threonine kinase (1275 residues total). There is also a known and identified 2 bp deletion polymorphism of CHRFAM7A

PAGE 34

34 ( ) ( 160 ) . Copy number variation frequency and/or altered transcript levels of CHRFAM7A and/or have been associated with several neuropsychiatric disorders such as some forms of schizophrenia, bipolar disorder, epilepsy and ( 161 165 ) . The biological function of CHRFAM7A is unclear, however stud ies suggest that in addition to psychiatric disease it may also be involved in cholinergic r egulation of inflammation ( 154 , 166 , 167 ) , and theref ore it may also be associated with inflammatory disease ( 168 ) . Functional s tudies show ed that expression of CHRFAM7A was down regulated by LPS in the human monocyte cell line THP 1 ( 111 ) , and heterologous co expression of CHRFAM7A and CHRNA7 subunits suppressed chan nel activity of functional 7 nAChR in Xenopus laevis oocytes ( 158 ) . The latter result makes sense considering that putative protein monomers translated from possible CHRFAM7A ORFs would be truncated at the amino terminus, and therefore would be missing a substantial part of the extracellular ligand binding domain present in full length receptors ( Figure 2 2 ). This then leads to the premise that CHRFAM7A may not create a functional ligand binding domain, and it is thus reasonable to expect that the expression and ass embly of CHRFAM7A monomers into pentameric receptors would confer altered ligand receptor tropism. Despite the reported functional effects that were dependent on CHRFAM7A expression ( 111 , 158 ) , it remains unclear whether or not CHRFAM7A arose in the human gene pool for biological purpose. Considering there are numerous neurological, immunological and potentia lly other types of disorders correlated to CHRFAM7A mutations and/or dysregulation of its expression, further investigation is warranted to understand the biological significance, origin and consequences of CHRFAM7A .

PAGE 35

35 Non 7 nAChR subunits In addition to 7 nAChR subunits, several types of immune cells have been reported to express other nAChR subunit s ( 74 , 75 , 169 176 ) . These reports indicate that there can be heterogeneity in the expression profile of nAChR subunits depending on the immune cell type, tissue location and activation state of the cell(s). Although th ere is convincing eviden ce to suggest that the 7 subunit is involved in cholinergic anti inflammatory effects mediated by vagal signals ( 77 ) , the identification of non 7 nAChR sub unit mRNA and proteins in many immune cells suggests additional roles of nAChR that are at present largely uncharacterized from a holistic perspective considering the broader implications of cholinergic function in the immune system. Some neuronal for the metabolism of acetylcholine independent of cholinergic synaptic input , therefore such cells express choline transporter, choline acetyltrans fe rase (ChAT) and acetylcholin esterase (AChE) ( 177 ) . Lymphocyte acetylcholine synthesis is depen dent on immune stimulation ( 178 , 179 ) , suggest ing that lymphocyte synthesized acetylcholine functions in an autocrine/paracrine manner dependent on the cell activation stat e. A number of studies from independent research groups have reported immuno modulatory effects suggested to be mediated by nAChR in immune cells where 7 subunits were not detected ( 170 , 173 , 176 , 180 ) ; many of these studies suggested involvement of NF B with the effects dependent on 2 containing nAChR. Additionally, 9 and 10 containing nAChR, which initially were characterized in the cont ext of inner ear cells as ionotropic receptors with pharmacology that is also sensitive to -

PAGE 36

36 bungarotoxin ( Btx ) ( 181 , 182 ) , have specifically been implicated in nAChR dependent regulation of immune cell activities ( 171 175 , 183 , 184 ) . A recent study concluded that 9 containing receptors are involve d in non ionotropic regulation of monocyte function ( 185 ) . Effective nAChR Agents in Immune/Inflammation Related Models Since demonstrating a vagal mediated cholinergic anti inflamma tory pathway dependent on the 7 subunit ( 77 ) , numerous studies have investigated the effect of various agen ts selective for 7 nAChR in experimental models of inflammation or inflammatory disease. Additionally, d ue to 7 nAChR also being implicated in several cognitive disorders, it has previously warranted the development, identification and characterization of drugs that can selectively target 7 nAChR for such pharma co therapeutic considerations. The following nAChR drugs are examples of agents that have been partially characterized in the therapeutic contexts of both inflammation and cognition. GTS 21 T he 7 nicotinic receptor ligand 3 (2,4 dimethoxybenzylidene) anabaseine ( DMXB ) , also known as GTS 21 , is a compound whose history began initially with relevance to cognition . With respect to its ionotropic pharmacology, GTS 21 is characterized as a low effic acy partial agonist of human 7 nAChR ( 186 , 187 ) , and it effectively induces residual inhibition or desensiti z ation of 7 receptor s readily upon ion channel activation ( 188 ) . It binds to the orthosteric site in the receptor ligand binding domain, and is known to be an a ntagonist of other nAChR subtypes and 5 HT 3 receptors ( 187 , 189 , 190 ) .

PAGE 37

37 GTS 21 initially emerged in behavioral model studies a s a potential therapeutic agent for cognitive deficits ( 191 , 192 ) . It was subsequently investigated at the cellular level for effects on neuroendocrine cell survival, where at low concentrations it was shown to be protective (up to 10 M ) but toxic at high concentrations (30 M or greater) in a manner dependent on intracellular protein kinases ( 193 ) . From electrophysiological studies, a t such high concentrations GTS 21 has been demonstrated to elicit persistent desensitizatio n of 7 nAChR ( 188 ) . These observat ions suggested that GTS 21 effects on cell survival may be associated with its ability to effectively induce receptor desensitizati on , and such processes are likely coupled to the regulation of intracellular protein kinases ( 193 ) . A few years after developing as a potential cognitive therapeutic agent, GTS 21 was demons trated to have therapeutic potential for inflammation related disorders, presumably due to its previously characterized activity on 7 nAChR. GTS 21 has been shown to decrease severity of pancreatitis ( 194 ) , improve survival in endotoxemia and sepsis ( 195 ) , and inhibit pro inflammatory cytokine levels in a number of inflammation related experimental models ( 53 , 116 , 196 208 ) . These studies largely conclude that the anti inflammatory effects of GTS 21 are dependent on 7 nAChR based on inference from the previously characterized pharmacological activity of GTS 21, or because its effects were sensitive to known antagonists of 7 nAChR or absent in 7 knockout animals . In contrast, a recent study showed that some of the beneficial effects GTS 21 has on inflammation in experimental sepsis are persistent in CHRNA7 deficient animals ( 209 ) . Yet t here is general agreement among reports that the mechanism of

PAGE 38

38 anti inf lammatory activity exerted by GTS 21 involves effects on NF B activation ( 195 , 210 , 211 ) . NS6740 T he diazabicyclononane compo und NS6740 is another co mpound whose history initially began with r egards to cognition , albeit as a null agent . NS6740 was in itially characterized to bind 7 nAChR with n M affinity ( 212 ) , however NS6740 does not efficaciously activate the human 7 nAChR ion channel ( 141 , 212 ) . NS6740 also exhibits some electrophysiological properties similar to that of GTS 21 and can induce prolonged desensitization of 7 nAChR ( 141 ) . S tudies also suggest that NS6740 binds to the orthosteric site in 7 nAChR as responses to ACh were inhibited with co application of NS6740 ( 141 ) . A nother interes ting and related electrophysiological property of NS6740 is its ability to generate large 7 nAChR ion currents when it is co applied at some (lower) desensitizing concentrations with the positive allosteric modulator (PAM) PNU 120596, however at high conc entrations (greater than 30 M ) NS6740 renders 7 nAChR insensitive to potentiation with the PAM. Since NS640 does not generate notable 7 nAChR ion currents applied alone but large currents when applied with the 7 PAM PNU 120596 it ha s been referred to agonist ( 141 ) . Silent agonists are defined as compounds with little or no agonist activity by themselves, but induce the receptor into a desensitiz ed state that can be rendered conductive upon application of a PAM. NS6740 was in i tially evaluated in a cognitive paradigm and compared to a nother diazabicyclononane derivative of similar binding affinity (NS6784) , which was characterized as an efficacious ionotropic agonist of 7 nAChR in contrast to NS6740

PAGE 39

39 ( 212 ) ; this evaluation was conducted in order to determine whether or not putative cognit ive enhancements d ue to the 7 nAChR ligands were dependent on ion channel activation . NS6784 was demonstrated to be effective at improving cognitive performance whereas NS6740 was not, suggesting that the cognitive enhancement was associated with ion channel activation. Importantly, although ineffective in the cognitive model, NS6740 was able to antagonize the effects of an alternative agonist of greater efficacy ( 212 ) , indicati ng that it was able to penetrate the CNS and bind to the orthosteric site. Similar to the history of GTS 21, shortly after its appearance in the literature with reference to cognition, NS6740 was later described as an effective regulator of microglial pro inflammatory cytokine secretion while other known efficacious 7 nAChR ion channel agonists were not ( 142 ) . NS6740 was also demonstrated to b e therapeutically effective in model s of inflammation related pain and such anti nociceptive effects of NS6740 were not observed in 7 deficient animals ( 141 ) . Putative I n vitro Models of Inflammation or Immune Cell Activation In order to investigate the hypothesis regarding non ionotropic nAChR signaling within the context of the cholinergic anti inflammatory pathway, in vitro models of ng immortalized mammalian immune cell lines expressing native nAChR have been utilized in the following research studies . Various types of human and rodent leukocyte s were studied in vitro including T lymphocytes, monocytes and microglial cells. Some cel l lines used in the following experiments were previously genetically modified with reporter gene insertions to allow measurement of

PAGE 40

40 specific inflammation related regulatory transcription factor protein activities ( i.e. NF B ) . S tudies in the 1970s and e arly 1980s gave preliminary indications that nAChR a re natively present in leukocytes such as human T lymphocytes , functioning in their development/differentiation ( 213 , 214 ) . Upon tissue insult, b oth T lymphocytes and monocytes/macrophages move to the site of insult , with T lymphocytes function ing in the specific recognition of inva sive pathogens and subsequent recruitment of non specific mononuclear cells to help destroy them . D epending on the type of insult , both lymphoid and mononuclear cells secrete specific cytokines in response to infection and/or tissue damage , a process that leads to inflammation. Sinc e cytokine synthesis and secretion triggered by inflammatory stimuli requires activation of the transcription factor NF B ( 215 ) , and because several aforementioned experimental observations suggest a role for NF B in the cholinergic regulation of inflammation , human immune ce ll lines designed to allow measurement of NF B activity were specifically chosen to serve as experimental models to address the hypotheses previously described . T he following in vitro studies thus explore the effects that select nAChR agents have on infl ammation related signaling ( e.g. NF B) under differ ent stimulatory conditions, and the molecular mechanism(s) by which they operate .

PAGE 41

41 Figure 2 1. In vivo model of the cholinergic anti inflammatory pathway . Neural circuits are an integ ral component of the immune response to pathogens and inflammation. Infectious stimuli, such as endotoxins ( e.g. LPS), are detected by toll like receptors (TLRs) on leukocytes, promoti ng NF B activation and secretion of pro inflammatory cytokines. The d etection of cytokines and/or the infectious agent(s) causes vagal nerve fibers to relay sensory signals to the CNS, where they are integrated to efferent cholinergic motor neurons that release acetylcholine in the celiac ganglion. Activation of postgangli onic adrenergic neurons releases norepinephrine in the spleen, stimulating T cells to synthesize acetylcholine. Circulating T cells provide a source of acetylcholine, which may act through leukocyte 7 containing nAChR to inhibit NF B signaling and suppress inflammatory cytokine production. The cholinergic anti inflammatory pathway can thus attenuate high levels of inflammation . Therefore drugs selective for 7 type nAChR, such as GTS 21, have ther apeutic potential for pharmacological control of inflammation .

PAGE 42

42 Figure 2 2. Diagram of CHRNA7 and CHRFAM7A protein monomers. Full length and partially duplicated 7 nAChR monomeric peptide sequences are depicted as coded horizontal bars. The ratio of each individually coded bar length to the total composite bar length is approximately equal to the ratio of amino acids (a.a.) within each coded segment to the total number of a.a. in each protein monomer. Intron excision positions are indicated with arr ows, roughly to t he same scale.

PAGE 43

43 CHAPTER 3 METHOD S Cell Culture Cell types used in the following studies include HEK 293 and clonal derivatives, Jurkat and clonal derivatives, THP 1 and clonal derivatives , and primary mouse microglia l cells . All cells were culture at 37 ° C in a humidified atmosphere containing 5% CO 2 . Jurkat (Clone E6 1 , TIB 152 TM ) and THP 1 (TIB 202 TM ) cells were purchased from the American Type Culture Collection (Manassas, VA) . Jurkat Dual and THP1 Lucia cells containing a genomicall y integrated NF B secreted luciferase reporter gene were purchased from InvivoG en (San Diego, CA). All Jurkat and THP 1 cells were cultured in RPMI 1640 growth media supplemented with 10% (v/v) fetal bovine serum (FBS), 50 un its/mL penicillin and 50 g /mL streptomycin. Jurkat Dual media always contained 50 g /mL zeocin and THP1 Lucia media contained 50 g /mL zeocin every other passage to maintain selection of the NF B luciferase reporter . Primary mi croglia, HEK 293 , and A7R3HC10 (Clone 10) cells which are HEK 293 cell s stably transfected with human CHRNA7 and RIC3 genes ( 124 ) , were cultured in , supplemented with 10% FBS, 50 u nits/mL penicillin, 50 g/mL streptomycin. A7R3HC10 cells were cultured with 450 g/mL geneticin and 15 g/mL hygromycin B to maintain selection of CHRNA7 and RIC3 genes, respective ly. All c ells were passaged approximately every 3 4 days, no more than 30 times for use in exp eriments. Chemicals and Reagents Acetylcholine chloride , choline chloride, (L) nicotine, methyllycaconitine (MLA), phorbol 12 myristate 13 acetate (PMA) and concanavalin A (ConA), we re purchased

PAGE 44

44 from Sigma Aldrich (St. Louis, MO) . GTS 21 was provided by T aiho Pharmaceutical Co. (Japan). AR R 17779 was purchased from Tocris Bioscience (UK). Wortmannin was purchased from Invivogen (San Diego, CA). NS6740 was prepared as described in ( 216 ) , and kindly provided by Dr. Ganesh Thakur (Northeastern University) . Additionally, tkP3BzPB was kindly provided by Dr. Peter Crooks. PNU 120596 was synthesized by Drs. Ji ngyi Wang and Kinga Cho jnacka as previously described ( 217 ) . PMA, NS6740 and PNU 120596 were initially dissolved in DMSO as a concentrated stock solution, then diluted into serum free RPMI 1640 on the day of experiments (maximum of 0.1% DMSO ). All other reagents were dissolved directly in serum free RPMI 1640 the day of experiments. Transient Transfection Transient transfection s of plasmid DNA containing CHRNA7 and RIC 3 genes were used in preliminary electrophysiology experiments with Jurk at cells (Clone E6 1). Transfections were performed using X tremeGENE 9 DNA transfection reagent (Roche Life Science) at a 4:1 transfection reagent volume to plasmid DNA mass ratio. Jurkat cells were re suspended in 10 mL of serum free growth ( approximat ely 50 % confluent) in 10 cm cell culture dishes prior to receiving transfection cocktails . The transfection reagent and DNA were diluted in se rum free media and mixed for 10 15 minutes to allow DNA reagent complexes to form prior to adding the transfect ion cocktail to cells in a slow dropwise manner . All transfection cocktails contai ned 500 L serum free media, 20 L transfection reagent and 5 g of total plasmid DNA. As a positive control, c ells were co transfected with plasmid DNA containing genes coding for DsRed , a red fluorescent protein (RFP), allowing for visual identification of cell s that received and

PAGE 45

45 expressed transfected DNA using a fluorescent microscope (excitation wavelength approximately 560 nm). Cells were incubated with transfection mixtures and selected for patch clamp electrophysiology experiments approximately 48 hours po st transfection. Patch Clamp Electrophysiology (By Dr. Chengju Tian, Ph.D.) Glass coverslips (12 mm) were coated with 0.1 mg/mL poly D lysine at 37 °C for 5 minutes. Jurkat cells were plated onto coverslips the day of recording, and A7R3HC10 cells we re pl ated onto the coverslips 1 4 days before recording. Whole cell voltage clamp recordings were performed at room temperature using an Axopatch 200B amplifier (Molecular Devices). Briefly, cells were bathed i n external solution containing 165 mM NaCl, 5 m M KCl, 2 mM CaCl 2 , 10 mM glucose, 5 mM HEPES, and 1 M atropine, pH 7.35. Patch pipettes (3 5 M ) were filled with a n internal solution containing 120 mM CsCl, 2 mM MgCl 2 , 10 mM EGTA, 10 mM HEPES, and 5 mM M g ATP, pH 7.35. Drug solutions were applied by Picospritzer III (General Valve, Fairfield, NJ) vi a pressure (10 20 psi). The application pipette was positioned approximately 10 15 m from the cell. Recordings were filtered to 5 kH z and digitized at 20 kHz with DigiData 1322A (Molecular Devices) using Clampex 9.2. Both the input resistance and w ord access resistance were monitored by a 10 ms/10 mV pulse before each response. The whole cell recordings were analyzed with Clampfit 10.3. Cells with access resistance greater than 40 M were excluded from analysis. Responses were measured as peak cu rrents.

PAGE 46

46 RNA Extraction RNA extractions were performed using the SV Total RNA Isolation System (Promega). Approximately 1 5 × 10 6 cells were harvested for each RNA extraction. Cells were pelleted then re suspended/washed in 1X, ice cold phosphate buffer ed saline (PBS), pH 7.4. The cells were then re pelleted and kept on ice prior to lysis in buffer containing guanidine thiocyanate and mercaptoethanol. Briefly, the lysates were diluted (if they were too viscous to pipet) and heated to 70 °C for 3 minutes, followed by centrifugation at 12,000 rpm for 10 minutes to clarify from precipitated protein and other cellular debris. The clarif ied lysates were then precipitated with ethanol and applied to silica spin column s . Nucleic acids bound to the silica were washed and then treated with DNase to digest any contaminating genomic DNA. Remaining bound RNA was washed twice and finally eluted with nuclease free water. Total RNA in the elutions was quantified using a nanodrop UV spectrophotometer (Thermo Scientific) . Reverse Transcription Polymerase Chain Reaction (RT PCR) RT PCR was performed using Super Script III One Step RT PCR System (Li fe Technologies). Thermocycling conditions were as follows: first cDNA synthesis with reverse transcriptase (53 °C, 25 minutes), then initial denaturation (94 °C, 2 minutes), followed by 40 PCR cycles of denaturation (94 °C, 15 seconds), annealing (temper ature = average melting temperature of primers minus 5 °C, 30 seconds), and extension (68 °C, 1 minute per kb of amplicon size ), then 1 final extension (68 °C, 5 minutes). A standard mass of total RNA (typically 0.25 1 g ) was used as template for each RT PCR reaction. Primer specifications are provided in Table 3 1 .

PAGE 47

47 Agarose Gel Electrophoresis Agarose gels were cast f rom 1 % agarose / 1X TBE buffer (w/v) solutions heated to boiling. A stock solution of ethidium bromi de (10 m g/mL) was then added to the heated liquid agarose TBE solutions at a ratio of 3 L per 50 mL of gel solution. Gels solidified at room temperature for no more than 30 minutes and were subsequently submerged into an electrophoresis chamber containin g 1X TBE. Samples were loaded into gel wells and direct current equivalent to a potential field of roughly 80 V was applied across gels until the sample dye front passed approximately ¾ of the total gel length. Nucleic acid present as bands in the gels w ere visualized with a UV transilluminator and gel images were captured with either BioRad ChemiDoc XRS+ imaging system , a digital or polaroid camera. Secreted Luciferase (SLuc) NF B Reporter Assay The day prior to experiments , Jurkat Dual or THP1 Lucia reporter cells were re suspended in serum free RPMI 1640 at a density of 1 2 × 10 6 cells/mL . Cells were then seeded into clear 96 well flat bottom plates and incubated overnight a t 37 °C to allow cells to equilibrate. Serum was removed from experiment media for two reasons: 1) synchronization of cell cycles to the arrested G 0 phase ( 218 ) , and 2) elimination of undesired experimental variables potentially present in serum ( 124 ) . T he following day, n AChR d rug treatments were applied to c ells and then the cells were placed back in the incubator for 1 hour. After the 1 hour incubation period with the nicotinic drugs, NF B activators (stimuli) were then applied to appropriate cells. Total well volumes were equal to 200 L . After stimulating cells , they were placed back in the incubator for 24 hours. Subsequently, end point luminescence assays were performed by transfer ring

PAGE 48

48 20 L of medium from ea ch well and mixing it with 50 L of a freshly prepared aqueous solution containing the luciferase substrate, coelenterazine (Quanti Luc, Invivogen), together in a separate opaque white 96 well plate. Within 5 minutes, the plate s were assayed for relative luminescence units (RLU), which were measured and quantified using a plate reader (BioTek Synergy 2). Cell Viability (MTS) Assay MTS reagent (CellTiter 96 Aqueous One Solution Cell Proliferation Assay) was purchased from Promega (Madison, WI). Cells were cultured and treated with nicotinic ligands and NF B stimuli as previously described in the luciferase assay. After performing luciferase assays or at the end point of experiments , MTS reagent was added to drug treatment plates at an approximate concentration of 320 g /m L. Cells conditioned with MTS rea gent were then returned to the incubator for an additional 4 hours, during which time viable cells converted the reagent to its chromophore containing, formazin based product ( 219 ) . After 1 4 hours, cells were retrie ved from the incubator and well absorbance was measured at a wavelength of 490 nm using a microplate reader (BioTek Synergy 2) . Wells conditioned with MTS reagent and media only (no cells) were used to determine background absorbance levels, which were su btracted from all absorbance values upon data analysis. Caspase Assay The Apo ONE Homogenous Caspase 3/7 Assay was purchased from Promega (Madison, WI). Cells were cultured and treated with nicotinic ligands and NF B stimuli as previously described for t he luciferase and MTS assay s except the total incubation period time for stimulated cells with the drug treatments was 18 hours . The caspase

PAGE 49

49 reagents (lysing buffer con taining pro fluorescent Caspase 3/7 substrate) were mixed and 50 L of this solution wa s added to each well of empty whi te 96 well flat bottom fluorescence assay plates. P lates containing cells that received drug treatments were then retrieved from the incubator and an equal volume (50 L ) of cell containing medium was transferred from the treatment plates to the assay plates containing the solution of cell lysis buffer and caspase substrate. The assay plates were then covered and left at room temperature for approximately 1 hour. After 1 hour incubating at room temperature, the white plat es were mixed using an orbital shaker at approximately 300 rpm for 30 seconds and then the fluorescence of each well was measured using a plate reader (BioTek Synergy 2) ; the excitation and emission wavelengths for the measurements were 490 nm and 525 nm, respectively. Western Blotting Primary antibodies targeting I B (#9242), phospho rylated I B Ser32/36 (#9246), and tubulin (#2144) were purchased from Cell Signaling Technology (Danvers, MA). Secondary alkaline phosphatase conjugated antibodies (sc 203 4 and sc 2047) were purchased from Santa Cruz Biotechnology (Dallas, TX). Prior to lysis, cells were pelleted and washed twice with ice cold 1X PBS, pH 7.4. Cytosolic protein lysates were generated with NP 40 lysis buffer containing phosphatase and prote ase inhibitors, harvesting approximately 1 × 10 7 cells per mL of lysis buffer. Cells were lysed on ice for 30 minutes, followed by 10 minutes of centrifugation at 4 °C and 12,000 rpm to generate clarified lysates. Samples were then mixed with an equal vo lume of 2X Laemmli sample buffer containing 200 mM dithiothreitol (DTT) and placed in a boiling water bath for 5 minutes. Next, samples were loaded into polyacrylamide gels and

PAGE 50

50 SDS PAGE was performed. The dye front was run through the stacking layer at a pproximately 70 V, then through the resolving layer at approximately 130 V, in continuousl y stirred ice cold tank buffer. After SDS PAGE, proteins were transferred from the polyacrylamide gels to PVDF membranes. Electroblot transfer was performed at 90 V for approximately 2 hours in continuously stirred ice cold tank buffer. After blot transfer, membranes were incubated in blocking solution (TBST containing 5% non fat dried milk) on an orbital shaker overnight at 4 °C. The followi ng day, membranes were washed (4 × 5 minutes, shaking) in TBST, and then incubated overnight at 4 °C with primary antibodies diluted 1000 fold in blocking solution. The next day, membranes were washed (3 × 10 minutes, shaking) in TBST, and then incubated with secondary alkaline phosphatase conjugated antibodies diluted 500 fold in blocking solution on an orbital shaker at ro om temperature for 1 2 hours. M embranes were finally washed (4 × 5 minutes, shaking) in TBST prior to developing blots in a Tris buffered solution contain ing the alkaline phosphatase substrate, BCIP/NBT (Santa Cruz Biotechnology), pH 9.5. Blots were convert ed to digital format using a BioRad ChemiDoc XRS+ imaging system. Enzyme Linked Immunosorbe nt Assay (ELISA) ELISA was performed to measure secreted T NF levels from primary mouse microglia cells. Mouse primary microglial cells, obtained as a gift (Dr. Paramita Chakrabarty, Ph.D.), were harvested from a culture bed of astrocytes by shaking at 150 rpm for 30 45 minutes to collect cells in the astrocy te conditioned media suspension. The cells were centrifuged at 300 g for 5 minutes and approximately 80 90 % of the astrocyte conditioned media supernatant was removed. Microglia were re suspended

PAGE 51

51 in the remaining conditioned media and DMEM containing 1 0 % FBS at a density of 2 × 10 5 cells/mL , and then evenly seeded into clear 96 well plates. The cells were incubated for 24 48 hours after initial seeding to allow cells to equilibrate and adhere to plates before the start of experiments. Nicotinic rece ptor ligands were delivered and incubated with the cells for 30 minutes and subsequently LPS was appli ed to the cells at 10 ng/mL to stimulate TNF production. After addition of LPS, primary m icroglia were incubated for 4 hours prior to taking TNF meas urements. To quantify the amount of TNF released by the cells, a sample of supernatant media was extracted from each well culture and analyzed using Mouse TNF Ready Set Go ELISA kit (eBiosciences, San Diego CA s instruct ions. Briefly, NUNC Maxisorp ® plates were coated with mouse TNF capture antibodies overnight at 4 °C and then washed prior to addition of the TN F containing samples. After adding samples containing TNF , the plates were re washed and secondary detec tion antibodies were added to the plates. The plates were washed again before adding the detection enzyme followed by addition of its substrate, which produces a chromophore containing product. Upon the production of chromophore, absorbance values were m easured from a plate reader (BioTek Synergy 2) using Gen5 software (BioTek, Winooski VT). The data were converted from absorbance values to concentrations of TNF by interpolating from a known standard curve . The standard curve was generated from independent control samples of TNF prepared at known concentration s and proces sed via ELISA in parallel with each experiment .

PAGE 52

52 Molecular Cloning and Recombinant Protein Expression The DNA sequence coding for the human 7 nAChR subunit was synthesized and codon optimize d for bacterial expression in E. c oli strain K 12 (Genewiz Inc. ) . From this template gene, f our different plasmid constructs were generated which containe d the nucleotide sequence corresponding to only the intracellular domain (ICD) of the human 7 nAChR subunit (amino acid s 318 469, Genbank reference sequence NM_000746.5). The synthesis of all four plasmid constructs began with a PCR amplification of th e 7 nAChR ICD nucleotide sequence us ing the codon optimized human 7 nAChR subunit gene sequence as template. All four primer sets used to contained exact sequence complimentary to the template s (18 b p ). T he remaining non comp limentary reg ion of the primer sequences (approximately 20 30 bp ) contained restriction enzyme site s so that the amplified PCR product s could be digested with the appropriate endo nucleases and ligated into their respecti ve plasmid vectors directional cloning method . PCR thermocyc ler conditions for the amplifications were as follows: step 1 at 94 °C for 2 minutes, step 2 at 94 °C for 15 seconds, step 3 at 57 °C for 25 seconds, step 4 at 70 °C for 1 minu te, step 5 at 94 °C for 15 seconds, step 6 at 62 °C for 15 seconds, step 7 at 70 °C for 45 seconds, repeat steps 5 7 for 25 cycles, and a final step at 70 °C for 5 minutes . Two of the four PCR inserts generated were cloned into plasmid pET30a (between NcoI and HindIII restriction sites) to encode linear recombinant proteins that could be puri fied by affinity chromatography; thus the corresponding PCR primer sets also contained sequence coding for six histidine (His) residues on t he

PAGE 53

53 the forward or reverse primer . For those two linear constructs, t he 6X His tag was positioned a t the amino terminus of the 7 ICD in one construct and at the carboxy terminus of the 7 ICD immediately prior to the stop codon in the other . Regarding t he other two constructs , the corresponding PCR inserts were cloned into pTWIN1 between SapI restriction sites , which is a plasmid designed for intein mediated expressed protein ligation (EPL) , a process that can f acilitate protein cyclization by ligation of the pr amino and carboxy termin i ( 220 ) . C ycl ic constructs were desired for the purpose of m imic king the natural orientation of the end s of the 7 nAChR ICD loop as it wou ld exist in pentameric form the amino and carboxy ends of the ICD would be within a few Angstroms of each other and both directed toward the intracellular face of the plasma membrane. O n e of the cyclic constructs was designed to directly fuse the amino an d carboxy residues of the ICD (residue 318 linked directly to residue 469), and the other was designed to link the amino and carboxy residues with a short non arbitrary linker pe ptide sequence (Cys Arg Ala Met ) in order to improve the efficiency of the int ei n mediated cyclization process ( 220 ) . After their digestion and purification, the ligation of amplified 7 ICD insert sequence s into pET30a and pTWIN1 plasmids were performed with T4 DNA ligase at room temperature for 10 15 minutes . Immediately after ligation reactions, a pproximately 50 100 n g of the ligation products were mixed with freshly thawed TOP 1 0 E. coli cell pellets on ice for 30 minutes prior to transformation via heat shock (42 ° C for 45 seconds followed 3 minutes on ice ). T ransformed bacteria were then recovered in 0.25 mL liquid out growth media for 1 hour in a shaking incubator at 37 ° C and 225 rpm. Recovered cells were then spread onto agar plates containing either 50

PAGE 54

54 g /mL kanamycin (pET30a) or 100 g /mL ampicillin (pTWIN1) and incubated over night at 37 °C. A pprox imately 16 hours later , single colonies were picked from the plates and inoculated into 5 mL liquid cultures containing standard lysogeny broth (LB) with eit her kanamycin or ampicillin , accordingly . The cultures were propagated in a shaking incubator at 37 ° C and 225 rpm for another 12 16 hours prior to harvesting 1 mL of the bacterial culture s for the isolation of amplified plasmid DNA . Plasmid DNA was pu rified from the cells using t he QIAprep Spin Miniprep Kit protocol (Qiagen) and quantified using a nanodrop UV spectrophotometer ( Thermo Fis her Scientific ). P urified plasmids were analyzed for correct incorporation of t he human 7 ICD sequence by two methods: restriction digest analysis , and DNA sequencing at the University of Florida I nterdisciplinary Center for Biotechnology facility. Plasmids identified with the correct insertion were archived and stored at 80 °C and then la ter transformed in to BL21 E. coli for protein expression . Transformation into BL21 cells was the same procedure as that for TOP10 cells (previously described). Approximately 16 hours post transformation, single colonies were inoculated into 5 mL liquid cu ltures containing LB and appropriate antibiotic ( i.e. kanamycin or ampicillin). Cultures were propagated for approximately 16 hours in a shaking incubator at 37 °C and 225 rpm and then inoculated into larger 250 mL cultures containing LB and appropriate a ntibiotic. Isopropyl D 1 thiogalactopyranoside (IPTG) was added to the cultures at a working concentration of 0.25 mM to induce protein expression when the culture optical densities (OD 600 ) i.e. the absorbance value of the liquid culture measured at 600 nm reached approximately 0.6 units. After adding IPTG, cultures were transferred to a shaking incuba tor at a lower temperature of 18 °C

PAGE 55

55 and 225 rpm for 6 hours to retard the protein expression rate which can enhance the efficiency of prope r protein foldi ng. After 6 hour s of IPTG induced protein expression , cells were collected by centrifugation at 5000 rpm for 30 minutes. The supernatant was discarded and cell pellets were kept at 80 °C for 24 hours prior to lysis. Upon lysis, cells were thawed and th en re suspended in 10 mL of lysis buffer (0.1 M Tris HCl, 0.5 M NaCl, 1 mM EDTA, pH 8.0). Cells were lysed on ice via sonic ation using 15/15 second on/off intervals to prevent excessive heating. Following sonication, 2% T riton X 100 (v/v) was added to th e lysates and NaCl and EDTA concentrations were increased to 1.5 M and 20 mM, respectively. Lysate s were then clarified by centrifugation at 15,000 rpm for 30 minutes at approximately 4 °C. The supernatants were stored at 4 °C for later analysis via SDS PAGE and the remaining pellets were washed and re suspended with 10 mL of wash buffer (0.1 M Tris HCl, 20 mM EDTA, pH 8.0). The washed and re suspended pellets were centrifuged at 15,000 rpm for 5 minutes at 4 °C. The resulting supernatants were then sto red at 4 °C for later analysis via SDS PAGE. Remaining pellets were re suspended with 20 mL of a denatu ring buffer containing chaotrope and reducing agents (8.0 M urea, 100 mM DTT, 0.1 M Tris HCl, pH 9.0) , and then continuously stirred at room temperature using a mechanical arm rotating at 50 rpm for 2 3 hours or until pellet material completely dissolved. For each fraction harvested , 10 L were loaded into polyacrylamide gels to analyze p rotein expression via SDS PAGE; direct current equivalent to appr oximately 70 V was applied across the gels while proteins traveled through the stacking layer and that of 130 V was applied while proteins traveled thr ough the resolving layer of the gels.

PAGE 56

56 P rotein bands of interest were excised from gels and subjected for in gel digestion and amino acid sequence analysis by mass spectrometry at the University of Florida (Dr. Kari Basso, Ph.D.). Genome Editing Targeted editing of genomic protein coding DNA in HEK 293 and Jurkat Dual cells was perform ed in order to disrupt th e expression of select genes of interest ( e.g. CHRNA7 ). The method of disruption involved the application of the clustered regularly interspaced short palindromic repeat (CRIS PR) and CRISPR associated (Cas) nuclease protein 9 system (CRISPR Cas9) . Guide R NA sequences were designed to target the relevant genes in the sequence region within the first 200 bp downstream of the ir open reading frames (ORFs) . Guide RNA sequences were selected using the guide RNA design algorithm provided by the Feng Zhang lab ( crispr.mit.edu ) . The guide RNA sequences were generated from synthetic oligonucleotides that were a nnealed together, then phosphorylated and ligated into the backbone plasmid PX459 V2.0 (Addgene plasmid no. 62988 ) via the Feng Zh ang lab oratory cloning protocol ( 221 ) . The PX459 V2.0 plasmid contains mammalian expression cassettes coding for the Cas9 endonuclease de rived fro m Streptococcus pyogene s (SpCas9) , an insertion site for single guide RNA (sgRNA) sequences , and a selectable marker for resistance to the antibiotic puromycin. PX459 V2.0 also contains a bacterial expression cassette with a selectable marker for ampicill in resistance to allow the plasmid to be propagated in E. c oli . Ligation reactions were performed with T4 DNA l igase at room temperature for 10 15 minutes. Immediately after ligation reactions, approximately 50 100 n g of the ligation products were mi xed with freshly thawed TOP10 E. coli cell pellets on ice for 30 minutes prior to transformation via heat shock (42 °C for 45 seconds followed 3 minutes

PAGE 57

57 on ice). Transformed bacteria were then recovered in 0.25 mL liquid out growth media for 1 hour in a sh aking incubator at 37 °C and 225 rpm. Recovered cells were then spread onto agar plates containing 100 g /mL ampicillin and incubated overnight at 37 °C. Approximately 16 hours later, single colonies were picked from the plates and inoculated into 5 mL liqu id cultures containing LB and ampicillin . The cultures were propagated in a shaking incubator at 37 °C and 225 rpm for another 12 16 hours prior to harvesting 1 .5 mL of the bacterial cultures for the isolation of amplified plasmid DNA. Plasmid DNA was purified from the cells using the QIAprep Spin Miniprep Kit protocol (Qiagen) and quantified using a nanodrop UV spectrophotometer ( Thermo Fisher Scientific ). Purified plasmids were analyzed f or correct incorporation of guide RNA sequence s via DNA sequencing at the University of Florida Interdisciplinary Center for Biotechnology facility. T ransient t rans fection s of the SpCas9 plasmids into mammalian cells were performed with X tremeGENE 9 (Roche) or Lipofectamine® 3000 transfection reagent s (Thermo Fisher Scientific). In addition to SpCas9 containing plasmids, cells were co transfected with RFP containin g plasmids to monitor transfection efficiency and expression levels over time using a fluorescent microscope . Prior to transfection, c ells were collected and re suspended at an approximate density of 2.5 × 10 5 cells/mL in their standard growth media and t hen seeded into clear 6 well plates ; cells were then incubated for at le a st 6 hours to allow cells to equilibrate. A total of 2 g of plasmid DNA was transfected into each well containing cells . After transfection, c ells were allowed to incubate with tra nsfection complexes for approximately 4 5 days to allow cells enough time to express the CRISPR Cas9 machinery and develop potential

PAGE 58

58 resistance to puromycin. During this period, RFP expression levels were monitored periodically with a fluorescent micros cope to roughly quantitate the relative ratio of RFP expressing cells to those not expressing RFP. When expression levels reached peak level s (after approximately 5 days), cells were passaged into growth media also containing puromycin. Puromycin was inc luded in the media at the minimum concentration sufficient to prevent survival of non transfected cells after 72 hours (determined by visual inspection under microscope) ; this concentration was determined empirically to be approximately 1 g /mL by independ ent experiments . Cells were cultured in puromycin containing media for 5 days before removing puromycin from the media at the next passage. After removal of puromycin, cells were propagated in their standard growth media for 3 4 weeks to expand the pop ulation of cells until there was a quantity of cells (approximately 10 7 ) that would yield a sufficient harvest of total RNA . Disruption of gene expression was then assessed by RT PCR analysis usi ng gene specific primers. Data and Statistical Analysis Cel l based assays performed in 96 well plates were designed such that each drug treatment was applied to 8 individual wells; thus each treatment group was a column of 8 wells in a 96 well plate. Microplates can be subject to edge effect artifacts that may occ ur due to uneven temperature and evaporation gradients across wells, with the largest systematic deviations occurring at the plate periphery ( 222 ) . Considering such possible limitations, the data were typically analyzed after discarding data values taken from wells containing cells at the plate edges . For SLuc measurements, d ata values were typically nor malized and expressed such that 0% represents the average

PAGE 59

59 value taken from wells containing untreated cells, and 100 % represents the average value taken from wells containing cells treated with stimuli but no drug treatment. For viability and caspase meas urements , a background signal needed to be accounted for and the data values were normalized and expressed such that 0% represents the average value taken from wells containing the experiment medium / reagent but no cells (background), and 100% represents th e average value taken from wells co ntaining cells treated with stimuli but no drug treatment . Unpaired t applied and p values were calculated to determine the degree of statistically significant diffe rences between treat ment groups; significance levels are indicated as follows: *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.0001. Considering that inherent experimental error and variability are often attributed to false discoveries based on data marked by relatively low s tatistical significance ( i.e. 0.001 < p < 0.05, also referred to as the 3 rule), effects in that range of statistic al s ignificance are interpreted bearing in mind such potential caveats ( 223 ) . All c ell based assay data and statistics were analyzed with Microsoft Excel and Prism 6 software (GraphPad).

PAGE 60

60 Table 3 1. RT PCR p rimer specifi cations Target gene Forward sequence Reverse sequence Amplicon size (bp) GAPDH ACGGATTTGGTCGTATTGG TGGCATGGACTGTGGTCAT 516 GAPDH GTCAAGGCTGAGAACGGGAA GGAGATTCAGTGTGGTGGGG 934 CHRNA3 CHRNA4 CHRNA7 GGGTGTGTTAGCGTCTCTCC ATCCCCTCCGAGCTCA TCTG TGGACGTGGATGAGAAGAA AGGGACACGCATGAACTCTG GGACACAGAAGGACGGTGAG TTCCCACTAGGTCCCATTC 827 895 414 CHRFAM7A TGTCCATGTCCGGGTTCAAG TATGCCTGGAGGCAGGTACT 358 and/ or 422* CHRNA9 CHRNA10 CHRNB2 AAGCTCCTGTGTGGTGGATG TCTCAAGCTGTTCCGTGACC GACCGCACAGAGATCGACTT GA CATCCGGGTAAGGCTCAG AGCAACTGGAAGACGGTGAG CGTCATCTTCTCGCCACAGT 226 762 267 CHRNB3 CHRNB4 SLUC TGTTGCTGTCCTCTTGGGTT GGACTGATTACCGCCTGACC CTGTTGCTGAGGCAAAACCC GGTCGAACGGGAAAAACGTG TCTTGCAGGCGCTCTTGTAG CCTCTCCAATCCCTCCCTGA 618 210 363 IL 2 TCCCAAACTCACCAGGATG C GGCCTGATACGTTTTAAGTGGG 339 TNF CACCACTTCGAAACCTGGGA CAGAGGCCTCAGCAATGAGT 577 * P otential transcript variants ( refer to Genbank reference sequences NM_139320.1 and NM_148911.1 ) Table 3 2. PCR primer specifications for CRISPR Cas9 construct cloning Construct target (gRNA sequence) For ward sequence Reverse sequence Amplicon size (bp) CHRNA7 CACCG GGTTGCGAGTCATTGGCCAC AAAC GTGGCCAATGACTCGCAACC C 28 CHRFAM7A CACCG GCAATTGGAACTGAAAATGC AAAC GCATTTTCAGTTCCAATTGC C 28 CHRNA7/ CHRFAM7A CACCG GAACTCTTGAATATGCCTGG AAAC CCAGGCATATT CAAGAGTTC C 28 CHRNB2 CACCG ATAAGCTTGTTGTAGCGGGA AAAC TCCCGCTACAACAAGCTTAT C 28 Bold nucleotide letters correspond to target gene sequences Table 3 3 . P CR p rimer specifications for recombinant protein construct cloning Construct Forward sequence Reverse sequence Amplicon size (bp) r h A7ICD N 6X His CAGTATCATATGCACCATCATCACCACCAT GACCCGGAT CACGCTAAGCTTCTTCTCTTAACGATCAACCAC GCAGGC 498 r h A7ICD C 6X His GTGTAGTTGTGTAGTGATACGTCTGTCATA TGCACCACCATGACCCGGAT GATAGAAGCTTTTAATGGTGATGGTGATGGTGA CGATCAAC CACGCAGGC 520 r h A7ICD cyclic GAGTCGTGCTCTTCCAACTGCCACCACCA TGACCCGGAT GCATGTTGGTGCTCTTCCGCAACGATCAACCAC GCAGGC 498 r h A7ICD cyclic+linker CCACCAGCTCTTCCAACTGCAGAGCCATG CACCACCATGACCCGGAT TGTAGTGCTGTAGCTGCTCTTCCGCACATACGA TCAACCACGCAGGC 514

PAGE 61

61 CHAPTER 4 RESEA RCH STUDIES On Human T Lymphoc y tes (Jurkat and Jurkat Dual C ells) Evidence for nAChR Expression and Electrophysiological Findings Introduction : Previous studies indicated that although leukocytes (including T lymphocytes) express various nAChR subunits ( 72 , 74 , 75 , 224 ) , oddly, electrophysiological approaches have failed to demonstrate macroscopic endogenous nAChR mediated ion channel currents in these cell types ( 28 ) . This study inv estigates the nati ve expression of select nAChR subunit mRNA in Jurkat cells, with a specific focus on the 7 subunit and associated chaperone protein RIC 3 . This study also characterizes some electrophysiological properties of WT and transfected Jurkat cells in the presence of ac etylcholine and the type II PAM PNU 120596. Data/Results : Jurkat cells were fi rst analyzed for the expression of CHRNA7 ( 7 subunit) coding mRNA via RT PCR. Additionally, Jurkat cells were tested for the presence of RIC 3 coding mRNA due to its potential influence on the expression and maturation of functional 7 nAChR delivered to the plasma membrane ( 146 ) . Panel A of Figure 4 1 indicates that a positive signal corres ponding to the predicted CHRNA7 associated RT PCR product (414 bp) but not RIC 3 associated product (346 bp) was detected in the reaction mixture using Jurkat cell RNA as template. Jurkat Dual cells were later evaluated for the presence of other select nAChR subunit mRNAs (Appendix A); data in Appendix A indicate that RT PCR products associated with 9, 2 and 4 nAChR subunits were also detected. Since these RT PCR experiments suggest ed that Jurkat cells express endogenous nAChR mRNA molecules, and because other group s report ed the positive

PAGE 62

62 detection of CHRNA7 protein mol ecules in Jurkat cells ( 225 ) , Jurkat cells were subsequently tested for n AChR dependent ion channel function via whole cell patch clamp methods (Figure 4 1, panel B). Similar to previous studies which report ed no detect able macroscopic ion currents in leukocytes ( 28 , 75 ) , indeed no ACh evoked and PAM potentiated ion channel responses were detected in un transfected WT Jurkat cells as indicated by the null representative trace in Figure 4 1 , panel B (i). Since the RT PCR data suggested that Jurkat cells might exp ress CHRNA7 but not RIC 3 under basal conditions, one hypothesis consistent with the se data could be that RIC 3 expression is required to detect ionotropic activity in Jurka t cells. As shown in Figure 4 1 , panel B (ii), when Jurkat cells were transfected with RIC 3 alone , no measurable ACh evoked or PAM potentiated ion currents were detected . Interestingly, when human CHRNA7 and RIC 3 were co transfected, Jurkat cells exhibited measurable ACh and PAM evoked ion currents, indicated by the repres entative t race shown in Figure 4 1 , panel B (iii); however, such responses were several fold small er in peak current magnitude s in comparison to control A7R3HC10 cells stably expressing CHRNA7 and RIC 3 , as shown by the representative trace in Figure 4 1 , panel B (i v). N ote the current scale i s larger for the traces in Figure 4 1, panel B (iv). Table 4 1 contains the average values and number of replicates corresponding to each of the represe nt ative traces shown in panel B of Figure 4 1 . Discussion /Conclusions : A unique feature and conundrum regarding nAChR mediated regulation of i mmune and inflammatory signaling is the absence of detectable nAChR dependent ion channel activity in immune cells, demonstrated in this study and reports by others ( 28 ) . A lthough Jurkat RNA samples yielded positive RT PCR signal s

PAGE 63

63 suggest ing the presence of multiple nAChR subunit coding mRNA s including 7 , the data failed to show measurable ACh or PAM enhanced ACh evoked ion currents from Jurkat cells. These results suggest that Jurkat cells constitutively transcribe 7 and other nAChR subunit mRNA s , and others have reported the identification of 7 proteins and the positive bi n ding of epibatidine and Btx to Jurkat cell membranes ( 225 ) . A t present the failure to detect endogenous nAChR depende n t ion c urrents in these cells, which are still immeasurable eve n following transfection of RIC 3 , and in the presence of an 7 nAChR ion current enhancing PAM, cannot be definitively explained . These data however support the hypothesis that if there is function of nAChR in Jurkat cells it may be non ionotropic. Consistent with previous reports , ion currents were detected fro m Jurkat cells co transfected with exogenous human CHRNA7 and RIC3 genes ( 226 ) . In the present study it was observed that RIC 3 and CHRNA7 co transfected Jurkat cells produced ACh evoked currents that were relativ ely small compared to A7R3HC10 control cells co expressing CHRNA7 and RIC 3. However, in contrast to what was observed in this study, others reported currents from such co transfected Jurkat cells roughly 5 fold larger in magnitude ( 226 ) . Yet these data could suggest that Jurkat cells may contain or alternatively lack unknown cell specif ic factors that suppress 7 containing nAChR ion channel function irrespective of RIC 3 . The data are consistent with the former because if s uch putative factors were present in the cell and not absent , then they may have been saturated or effectively titrated when CHRNA7 was tra ns fected and overexpressed in the cell, as a result yielding some unsuppressed and detect able ion channel activity. Alternatively , endogenous Jurkat CHRNA7 could be intrinsically

PAGE 64

64 different from CHRNA7 expressed as a result of transfection of the exogenous CHRNA7 containing plasmid , and this could also explain why ion c urrents were observed only in the case where exogenous CHRNA7 (and RIC3 ) were delivered to Jurkat cells. However, as it is relevant to this possibility, data indicate that Jurkat CHRNA7 mRNA t ranscr ipts are 100% identical in the corresponding amino acid sequence to the mature neuronal CHRNA7 sequence ( 225 ) ( from which the transfected plasm id containing CHRNA7 was derived ) , thus arguing that Jurkat specific CHRNA7 protein isoforms are not involved . However, one cannot rule out cell specific post translational covalent modifications, which c ould regulate receptor function ( 25 , 227 ) . Regarding the possibility that cell specific factors might regulate the permission of ion channel function in Jurkat cells, regulation through protein protein complex interactions may play a role . T here is experimental evidence s uggesting that 7 nAChR form s complexes with other immune cell receptor proteins such as the T cell rec eptor (TCR) because 7 nAChR subunits and TCR proteins co immunoprecipi tated from Jurkat cell lysates ( 225 ) . There may also be a functional consequence associated with this observation as o thers demonstrated that activators of the TCR, e.g. concanavalin A ( ConA), have direct effects on 7 nAChR ion channel function: ConA suppressed channel activity of exogenously transfected 7 nAChR subunits in Jurkat cells, an effect which was shown to be dependent on the TCR and Src tyrosine kinase activities ( 226 ) . Cons istent with these experimental observations , it is hypothesized that physical interaction (s) w ith such putative complexes precl udes the ionotropic function of nAChR in Jurkat cells .

PAGE 65

65 NF B Luciferase Reporter System Introduction : In the following set of studies, a transcriptional reporter system was employed to measure the activity of the transcrip tion factor NF B , which controls the expression of immune and inflammatory factors ( e.g. cytokines) and also influence s survival /death signaling in immune cells ( 132 ) . For these studies, Jurkat Dual cells contained an NF B driven reporter gene stably integrated into the genome immediately downstream of repeated NF B consensus sequence binding sites ; the reporter gene codes for a luciferase enzyme designed for secretion (SLuc, Genbank ID: JQ941881.1 ) . Using this type of experimental system, one can correlate NF B activity with the relative amount of luminescence (luci ferase activity ) that the cells produ ce ( 228 ) . Data/Results: Figur e 4 2 demonstrates that when Jurkat Dual cells were treated with ConA for 12 hours, an intensification of the RT PCR signal corresp onding to the NF B driven SLuc fragments were detect ed , indicating that ConA treatment increased the reporter gene ( SLuc ) synthesis at the mRNA level. In Figure 4 2, panel B, the data demonstrate that after 24 hours of ConA treatment, induction of functional SLuc protein activity can be quantified by end point luminescence assay. Analogously, in Figure 4 2, panel C, the data demonstrate that after 24 hours of treatment with the phorbol ester PMA, a concentration dependent increase in the NF B driven SLuc reporter activi ty is ap parent and measurable using Jurkat Dual cells. Discussion/Conclusions: These studies establish a metric for the relative transcriptional activity of NF B in Jurkat Dual cells in response to mitogen (ConA and PMA) treatments in a concentration d ependent manner. T hese preliminary experiments were performed to validate and characterize the NF B reporter system in order to

PAGE 66

66 determine appropriate mitogen concentrations that would ensure the stimuli would produce significantly different enhancements of SLuc activity in comparison to un stimulated cells it was determined by these initial empirical studies that roughly a 5 to 10 fold enhancement of SLuc activity w as required; hence NF B stimulations in subsequent experiments were conducted with approx imately 5 g /mL ConA or 100 n g /mL PMA. Hereafter, SLuc activity will be referred to as NF B reporter activity. Putative Nicotinic Drug Effects on NF B reporter activity and cell viability (survival) Introduction : Considering the potential role of nACh R in the regulation of immune and inflammatory signaling and the possible involvement of NF B in these processes, the NF B luciferase reporter system was then utilized to test whether drugs targeting nAChR could modulate NF B activation induced by ConA or PMA in Jurkat Dual cells. Various types of nAChR ligands ( e.g. ion chann el agonists, antagonists, silent agonists ) were tested for their ability to modulate the ConA and PMA induced NF B reporter activity from Jurkat Dual cells , with a particular foc us on nAChR ligands that have some degree of selectivity for 7 nAChR , GTS 21 and NS6740 . In addition to its control of immune cell cytokines and inflammatory signaling, NF B is also coupled to proliferative and apoptotic (survival/death) signaling pathw ays ( 132 , 229 , 230 ) . In lymphocytes ( e.g. Jur kat cells) , inhibition of NF B activation has been reported to induce apoptotic cell death ( 231 233 ) . Considering previous observations regarding NF B con trol of apoptosis/survival, t he follo wing experiments also ascertained whether or not the nAChR drugs affect Jurkat Dual cell viability, which is assumed to reflect the survival (proliferative) state of the cell.

PAGE 67

67 Data/Results: Panels A and B of Figure 4 3 shows the apparent effects that nic otine, GTS 21 and NS6740 have on ConA and PMA induced NF B reporter activity . Regarding ConA stimulated cells (Figure 4 3, panel A), n icotine trea tment increased the NF B reporter activity in a concentration dependent manner and wa s ineffective at suppressing this activity under the conditions tested ; the 7 selective efficacious agonists choline and AR R 17779 were also tested and found to be ineffective suppressor s of ConA induced NF B reporter activity ( refer to data in Appendix B ). As previously described in Chapter 2 with respect to their electrophysiol ogical behavior , GT S 21 is a weak partial agonist and NS6740 is a silent agonist of human 7 nAChR . GTS 21 and NS6740 both produced concentration dependen t decrease s of the ConA induced NF B reporter activity, which is assum ed to reflect suppression of N F B activation. Remarkably, tkP3BzPB, which was previously characterized by electrophysiological studies as an 7 nAChR ion channel antagonist with se lectivity for 7 nAChR ( 234 ) , also significantly decreased ConA induced NF B reporter activity at concentrations equal to or greater than 10 M (Appendix C). I n a parallel fashion, nicotine, GTS 21 and NS6740 were tested for effects on PMA induced NF B activation in Jurkat Dual cells (Figure 4 3, panel B). Similar to the e ffects in ConA treated cells, nicotine increased PMA induced NF B reporter activity in a concentration dependent manner and was thus ineffective at suppressing this activity . GTS 21, however, produced bimodal or biphasic effects on the PMA induced NF B reporter activity in contrast to the observed monophasic effect s on NF B reporter activity in ConA stimulated cells; GTS 21 exhibited a suppressive effect on NF B

PAGE 68

68 reporter activity in ConA treated cells at concentrations where it potentiated the NF B re porter activity in PMA treated cells ( e.g . 100 M ) . GTS 21 progressiv ely increased the PMA induced NF B reporter activity at concentrations approaching 100 M , and then decreased that activity at higher concentrations. NS6740 also exhibited bimodal effe cts on NF B reporter activity in PMA stimulated cells, however the effect magnitudes were different than those of GTS 21. NS6740 significantly increased PMA induced NF B activity at 1 and 3 M , and significantly decreased that activity at concentratio ns equal to or greater than 100 M . Regarding the bimodal nature of the effects of GTS 21 and N S6740 in PMA stimulated cells, n ote the mode shift point f rom increasing to decreasing the NF B reporter activity was more potent for NS6740 relative to GTS 21 . Immediately following the NF B experiments, an MTS based cell viability assay was conducted using the same cells/treatments to determine if the nAChR drug treatments resulted in decreased cell viability (Figure 4 3, panels C and D ). If cell survival were compromised due to the drug treatments, the number of viable cells could affect the resulting NF B reporter activity levels that were measured. The MTS viability rea gent to a chromophore containing formazin based product; the amount of light absorbed from the generated chromophore is directly proportional to the number of viable cells in the sample ( 219 , 235 ) . Nicotine treatment did not significantly reduce cell viability over the indicated concentration ranges for either ConA or PMA stimulated Jurkat Dual cells. GTS 21 and NS6740 however did reduce cell viability in a concentration dependent manner, with significant effects observed at the high M

PAGE 69

69 concentrations tested. GTS 21 was more potent than NS6740 at reducing viability in ConA stimulated cells, whereas NS6740 was more potent than GTS 21 at reducing the viability of PMA stimulated cells. Since the viability data shown in panels C and D of Figure 4 3 originated from th e same cells /treatments as those producing the NF B data shown in panels A and B of Figure 4 3 , t hese two measurements were normalized to each other and are thus a lso expressed as the N F B values divided by the viability values mea sured from each well ( Figure 4 4 ). When the data were normalized in this manner , only 30 300 M NS6740 treatments give n to ConA stimulated cells resulted in decreased NF B reporter activity levels. GTS 21 and NS6740 treatments also modulated the NF B reporter and cell viability of un stimulated Jurkat Dual cells, with some qualitativel y different effects observed with respect to the NF B reporter activity but largely similar effects on cell viability (Appendix D). Discussion /Conclusions : This study demonstrates that the presence of high concentrations of GTS 21 and NS6740 modulate the NF B reporter activity and viabi lity of mitogen stimulated Jurkat Dual cells. In summary, most nAChR ligands previously characterized in ionotropic systems to be efficacious ion channel agonists were relatively ineffective at modulating the mitogen induced NF B reporter activity and di d not reduce cell viability , whereas GTS 21 and NS6740, as well as an antagonist with selectivity for 7 nAChR appeared to be more effective modulators of the NF B reporter activity and also decreased viability . Interestingly, especially when considering the normalized data, GTS 21 and NS6740 had divergent effects on the NF B reporter activity in ConA stimulated cells in contrast to their similar effects in PMA stimulated cells. Also, GTS 21 and NS6740 effects were largely biphasic, which may suggest th at

PAGE 70

70 they act on multiple pharmacological targets in Jurkat Dual cells; this then would be c ontrary to the idea that GTS 21 and NS6740 are selectively targeting 7 nAChR . R egarding treatmen ts with GTS 21 and NS6740 in mitogen stimulated Jurkat Dual cells, th ere are instances where a correlation exists between decreased NF B reporter activity and decreased cell viability. It is possible that the GTS 21 and NS6740 effects on the NF B reporter activity reflect changes in the associated activity of NF B, howe ver the co incident effects observed on the viability of the cells confound the interpret ation of these data because the effects of GTS 21 and NS6740 could involve an NF B independent effect on viability thereby producing a secondary effect on the NF B r eporter activity observed. Alternatively, considering the role of NF B in lym phocyte apoptosis and survival ( 231 , 232 ) , it is also possible that the effects on viability may be secondary to effects on NF B. C omparing the effect magnitudes of GTS 21 and NS6740 treatments on the NF B reporter activity versus those on viability did not always follow a one to one cor respondence , and generally effects on the NF B reporter activity were typically observed at lower concentrations than those on viability . Also n ote that the 100 and 300 M GTS 21 treatments given to PMA stimulated cells resulted in significantly increase d NF B reporter activity but signifi cantly decreased cell viability . If it were correct to assume that the GTS 21 and NS6740 effects on the NF B reporter activity reflect effects on the NF B activation state, then these studies are consistent with the hypothesis that nAChR may play a role in NF B dependent signal transduction via a non ionotropic mechanism . This is supported by the findings that: 1) the electrophysiological properties of some effective nAChR drugs used in this study correlate with the ability to induce non conducting receptor states , and 2) no evidence

PAGE 71

71 for nAChR dependent ion channel activity could be demonstrated for such cells putatively expressi n g nAChR . In either case, the data clearly demonstrate GTS 21 and NS6740 can diminish t he viability of mitogen stimulated Jurkat Dual cells, and notably , diminished cell survival has previously been reported for GTS 21 at such concentrations using PC12 cells ( 193 ) ; however in that study cell survival could be rescued with an 7 nAChR antagonist. If agents with previously known and characterized mechanisms of action could achieve abrogation of the deleterious effects that GTS 21 and NS6740 have on Jurkat Dual cell viability the n it may help inform on the mechanism of cell death. Prior studies also report ed the attenuation of GTS 21 induced toxicity in PC12 cells by pharmacological agents wit h known protein tyrosine kinase inhibitory activities ( 193 ) , however such agents were not evaluated in the context of th is study . These findings are consistent with coincident involvement of NF B dependent cell survival/death pathways such as apoptosis, however other general cytotoxic mechanisms cannot yet be definitively ruled out. NF B activation through the TCR is dependent on PI3K ( 236 ) , an enzyme whose activity is critical for T cell survival ( 237 ) ; it was therefore not surprising that activation of NF B via ConA was decreased by the PI 3K inhibitor wortmannin in a concentration dependent manner and this effect also correlated with lo ss of cell viability (Appendix E ). Such data indicate there may be a requirement for PI3K in these sig naling paradigms , and other reports indicate that PI3K activity is regulated by the protein tyrosine kinase LCK in T cells ( 238 ) . If mitogen induced NF B activity and cell viability could be diminished by inhibition of LCK in Jurkat Dual cells, then it would also

PAGE 72

72 suggest involvement of LCK in the regulation of these effects . Relevant to cell fate, PI3K is directly coupled to anti apoptotic or pro surviv al pathways via downstream activation of Akt ( 239 , 240 ) . Treatment with the PI3K inhibitor wortmannin or wit h GTS 21 or NS6740 effectively reduced the NF B reporter activity and viability of Jurkat Dual cells under some conditions. Considering that the pharmacological effects of GTS 21 and NS6740 with respect to decreased NF B reporter activity and cell viability measurements resemble that of wortmannin, one hypothesis consistent with these observations is that GTS 21 and NS6740 decreased cell viability by a mechanism involving inactivation of PI3K and/or Akt. Examining the activation state of those enzymes under such conditions would help inform whether or not that hypothesis is valid. Appendix F contains continued discussion beyond the scope of these data with regard to putative intermediates and mechanisms by which they may operate. In summary, t hese studies demonstrate that high concentrations of GTS 21 and NS6740 modulate T cell survival , possibly via regulation of NF B . Further studies are required to understand the precise molecular target(s) of GTS 21 and NS6740 , mechanism(s) and pathway(s) governing how GTS 21 and NS6740 modulate T cell NF B s ignaling and survival and the identity of the molecular signaling intermediates involved in such pathways. Interleukin 2 and CHRNA7 e xpression Introduction : Interleukins are small protein cytokines that function as signaling molecules secreted by leukocyt es to regulate their activities, development and differentiation ( 241 ) . In T lymphocytes ( e.g. Jurkat cells ) , it has previously be en shown that synthesis of the i nterleukin 2 (IL 2) cytokine is regulated by NF B transcription

PAGE 73

73 factors ( 242 ) , while this regulation may also be coupled to a positive feedback mechanism as IL 2 binding to the IL 2 receptor induces the nu clear expression of NF B ( 243 ) . Th us , if IL 2 tran scription were controlled by NF B in T cells ( e.g. Jurkat) , then one would expect the extent of the NF B rep orter activity to correla te with the relative quantity of IL 2 mRNA synthesized by the cell. Based on this premise , this study tested whether or not GTS 21 and NS6740 treatments which were previously shown to modulate the mitogen induced NF B reporter ac tivity and viability of Jurkat Dual cells have correlative effects on IL 2 mRNA levels. Additionally, the following study also investigated whether or not nicotine, GTS 21 and NS6740 affect nAChR subunit (CHRNA7 and CHRNB2) expression at the transcription al level in mitogen stimulated Jurkat Dual cells. Data/Results: Regarding mitogen , nicotine, GTS 21 and NS6740 effects on IL 2 levels , the following analysis was c arried out with consideration of the effects that th ese agents had on the NF B reporter activities depending on the mode of activation ( i.e. by ConA versus PMA ) . P anel A of Figure 4 5 indicates that after 12 hours of ConA stimulation alone, the RT PCR signal representative of the relative amount of IL 2 mRNA increased, suggesting that ConA induced transcription of the IL 2 gene. Pre treating Con A induced Jurkat Dual cells with 100 M nicotine did not diminish the IL 2 signal, howe ver pre treating cells with 100 M GTS 21 partially diminished the IL 2 signal and pre treating cells with 100 M NS6740 completely abolished this signal in comparison to the group treated with ConA only. Similarly, an increase in the intensity of the RT PCR signal representative of the level of IL 2 mRNA was detected in cells treated with PMA alone for 12 hours compar e d to untreated cells (Figure 4 5 , panel B ).

PAGE 74

74 Pre treating PMA induced Jurkat Dual cells with 100 M nicotine did not attenuate this signal, nor did pre treatment with 100 M GTS 21. Pre treating PMA induced Jurkat Dual cells with 100 M NS 6740 did not abolish the IL 2 signal as it did in the manner observed with ConA stimulated cells. Previous experiments indicated that 100 M GTS 21 and NS6740 treatments could reduce the viability of Jurkat Dual cells after 24 hours, however the present e xperiment was conducted at a different end point (12 hours) and quantitative differences in the total amount of RNA present in samples was controlled for by using an equivalent amount of template RNA (by mass) for each RT PCR reaction. Figure 4 6 contains data pertaining to mitogen and nAChR drug effects on CHRNA7 mRNA levels. Panel A of Figure 4 6 indicates that after 12 hours of ConA stimulation alone, the RT PCR signal representative of the relative amount of CHRNA7 mRNA decreased, suggesting that ConA treatment alone reduced transcription of the CHRNA7 gene. A similar ef fect wa s apparent for the case whe n cells were treated with 100 M NS6740 alone. In comparison to the group treated with ConA only, pre treating ConA induced Jurkat Dual cells with 100 M nicotine further diminished the CHRNA7 signal intensity albeit slightly, while pre treating cells with 100 M GTS 21 or NS6740 dimi ni shed th e signal to a greater extent. ( The same nAChR drug treatments were also evaluated for their effects on CHRNB2 m RNA levels in Con A stimulated Jurkat Dual cells, see Appendix G ). Similar effects were observed with respect to PM A stimulated cells ( Figure 4 6 , panel B): the CHRNA7 RT PCR signal decreased for Jurkat Dual cells treated with PMA alone for 12 hours compar ed to untreated cells. Comparing to cells treated with PMA alone, pre treating PMA stimulated cells with 100 M nicotine did not

PAGE 75

75 attenuate the apparent CHRNA 7 signal, however pre treatment with 100 M GTS 21 or NS6740 further reduced the intensity of the CHRNA7 signal . Discussion /Conclusions : T hese data are generally consistent with the mechanism whereby IL 2 ge ne transcription is positively controlled by NF B activity; for instance, note that 100 M GTS 21 decreased the ConA induced NF B reporter activity and reduced the IL 2 signal induced by ConA, whereas 100 M GTS 21 increased the NF B reporter activity a nd did not attenuate the IL 2 signal induced by PMA. Since both mitogens (ConA and PMA) and nAChR drug treatments affected the IL 2 and CHRNA7 mRNA signal s in Jurkat Dual cells as indicated by RT PCR, it suggest s that these treatments are coupled to the r egulation of both IL 2 and CHRNA7 gene expression. The mitogens increased IL 2 sig nals as predicted ( indicating up regulation of gene expression) , whereas they decreased CHRNA7 signals (indicating down regulation of gene expression). The nAChR drugs modu lated mitogen induced IL 2 signals in a manner consistent with the relative effects such treatmen ts had on the NF B reporter activity . GTS 21 and NS6740 were found to be more effective regulators of IL 2 signals, consistent with observations from the NF B studies. Additionally, GTS 21 and NS6740 were also effective regulators of CHRNA7 signals. In contrast to the ir differential effects on IL 2 levels comparing ConA versus PMA stimulated cells , GTS 21 and NS6740 treatments affected CHRNA7 signals in a roughly equivalent manner comparing ConA and PMA stimulated Jurkat Dual cells . This sugg ests that the nAChR drug effects on CHRNA7 expression are independent of stimulation by ConA versus PMA but the effects on IL 2 expression are dependent on the mitoge n type . P re treatment of GTS 21 or NS6740 decreased CHRNA7 signal s of

PAGE 76

76 mitogen induced cells in comparison to cells treated with mitogen alone, indica t ing t hat the presence of mitogen together with either GTS 21 or NS6740 exacerbates down regulation of CHR NA7 gene expression. In conclusion, this study demonstrates that Jurkat Dual cell IL 2 and CHRNA7 mRNA levels are dependent on the pr esence of T cell mitogens and GTS 21 and NS6740 treatments. The drug effects on mitogen induced IL 2 levels are consiste nt with the relative effects on the NF B reporter activities de scribed in the previous section. These findings corroborate the notion that IL 2 synthesis is controlled by NF B and suggest that regulation of NF B/IL 2 by GTS 21 and NS6740 occurs at the pre transcriptional level. GTS 21 and NS6740 were also effective at regulati n g transcription of CHRNA7 . These studies demonstrate the utility of GTS 21 and NS6740 for the pharmacological control of T cell IL 2 levels via a mechanism consistent with regulation controlled by NF B. However, su ch e ffects may also be coupled to the regulation of nAChR subunit expression . Further studies are required to understand the exact mechanism(s) coupling immune cell activation with the control of nAChR subunit and cytokine expression, i.e. how these proce sses are regulat ed as well as the identify of the molecular in termediates involved . C aspase a ctivity (apoptosis) Introduction : The previous section demonstrated that the nAChR drugs GTS 21 and NS6740 prevent mitogen stimulated Jurkat Dual cell survival, e videnced by measurements indicating significant loss of viability . I f the activation of programmed cell death (apoptosis) occurred as a result of such drug treatments th en it w ould account for the observed effects on cell viability. T he following experim ents addressed whethe r or

PAGE 77

77 not the ind uction of apoptosis in Jurkat Dual cells occurs as a result of treatments with GTS 21 and NS6740 , and if so, whether the putative effects co rrelate with decreased cell viability. Specifically, t his study evaluates whet her caspase 3/7 protease activities are triggered in Jurkat Dual cells by GTS 21 and NS6740 under the same conditions that w ere previously shown to modulate the NF B reporter activity and decrease cell viability. An increase in the activity of caspase pr oteases indicates the induction of apoptosis in mammalian cells ( 244 ) . Data/Results: Figure 4 7 (panels A and B) shows the observed effects of nicotine, GT S 21 and NS6740 on caspase 3/7 activities in ConA and PMA induced Jurkat Dual cells. The same drug treatments applied to the same cells were evaluated in parallel for comparison of their effects on cell viability (panels C and D). At 100 M , GTS 21 treatment significantly increased caspase 3/7 activity of both ConA and PMA stimulated Jurkat Dual cells , which also corresponded with significant reduction of cell viabili ty (Figure 4 7, panels A and C); note that at 100 M , GTS 21 decreased t he NF B reporter activity induced by ConA but increased the NF B reporter activity induced by PMA (refer ring back to Figure 4 3). NS6740 treatments increased caspase 3/7 activity and reduced cell viability in a concentration depende nt manner; the effect s of NS6740 on caspase 3/7 activ ity we re inversely proportional to the reduction of viability. As previously observed, nicotine did not reduce cell viability and no statistically convincing trend was established regarding the relatively null effects that nicotine treatment had on caspase 3/7 activity in Jurkat Dual cells . The results of the experiment examining nAChR drug effects on cell viability shown in Figure 4 7 were qualitatively consistent with the previous viability data shown in Figure 4 6; howev er

PAGE 78

78 these two results indicate apparent differences in the nAChR drug effect magnitudes between the two experiments. It is noted however that these were independent experiments that did not proceed with the same assay end point times , and this may potentia lly explain the apparent quantitative differences observed in viability measurements comparing the results of the two experiments . The caspase/viability measurements expressed in Figure 4 7 were taken at an earlier end point considering that caspase 3 lev els in apoptosis induced Jurkat cells are likely to peak at time points less than 24 hours after induction of apoptosis ( 245 ) . Discussion /Conclusions : In some cases, t he effects of GTS 21 and NS6740 o n mitogen stimulate d Jurkat Dual cell s we re dose dependently associated with decreased NF B reporter activity, decreased viability and increased caspase 3/7 activity. T he caspase data suggest that regulation of the NF B reporter activ ity and cell viability by GTS 21 and NS6740 involves cell death proceeding by an apoptotic rather than a non apoptotic mechanism . In other studies with Jurkat cells, the induction of apoptosis (also determined by an increase of caspase 3/7 activity) was associated with PI3K inhibition and decreased phosphorylation of Akt ( 246 , 247 ) . Again, c onsistent with these observations is t he hypothesis that GTS 21 and NS6740 regulate NF B and apoptotic intracellular signaling in mitogen stimulated Jurkat Dual cells via a mechanism dependent on PI3K/Akt. This study demonstrates that the pharmacological targeting of nAChR may be a useful strategy for modulati n g T cell apoptotic signaling .

PAGE 79

79 Putative Nicotinic Drug Effect s Independent of Extracellular c alcium Introduction : As it is r elevant to the hypotheses stated in th e project rationale regarding putative non ionotropic functions of nAChR, it is necessary to determine whether or not alter ations of Jurkat Dual cell signaling induced by GTS 21 and NS6740 are dependent on nicotinic receptor ion channel acti vity. To better understand the involvement of ion flux via channel activation, t he following experimen ts tested wheth er or not the GTS 21 and NS6740 induc ed effects on NF B reporter activity and cell viability require extracellular Ca 2+ . The se experiments thus evaluated the nature of GTS 21 and NS674 0 effects on the NF B reporter activity in ConA stimulated Jurkat Dual cells in the prese nce of calcium containing versus calcium free media. Data/Results: Figure 4 8 indicates the effects that 100 M GTS 21 and NS6740 have on the NF B reporter activity and viability of ConA stimulated Jurkat Dual cells in the presence and absence of Ca 2+ i ons in the cell culture media. The effect of 100 M GTS 21 or NS6740 reduced the ConA stimulated NF B reporter activity and cell viability of Jurkat Dual cells in both calcium containing and calcium free media relative to control cells stimulated with Co nA but not treated with GTS 21 or NS6740 . Furthermore, some of the drug treatment effects were exacerbated for cells in the presence of calcium free media, especially with respect to NS6740 treatments. Discussion /Conclusions : Since nAChR ion channels can be permeab le to Ca 2+ ions , it is commonly assumed in the literature that increases of intracellular Ca 2+ associated with cell signaling activities involving nAChR occur as a result of extracellular Ca 2+ influx through the receptor ion channel into the cyt osol. However,

PAGE 80

80 there are instances in the literature suggesting that nAChR mediated increase of intracellular Ca 2+ signals may not be dependent on extracellular Ca 2+ ion fl ux through the receptor channel ( 173 ) , specifically with reference to nAChR in Jurkat cells ( 225 ) . The data from the present study sugge st that the effects on the NF B reporter activity and cell viability induced by GTS 21 and NS6740 i n Jurkat Dual cells do not require extracellular Ca 2+ . Since cell death induced by these nicotinic agents is independent of extracellular Ca 2+ , the data ar e consistent with the hypothesis that nAChR may impact cell survival signaling and the potentially associated NF B signal transduction activities via a non ionotropic mechanism. Nicotinic receptor a ntagonist Introduction : Nicotinic receptor antagonists a re defined by their functional a bility to block or inhibit current responses mediated by the receptor ion channel. Studies indicate that 7 nAChR ion currents activated by GTS 21 are specifically bl ocked or inhibited by the antagonists B t x and MLA ( 186 , 248 ) , and the anti nociceptive effects of NS6740 were sensitive to pre treatment with MLA ( 141 ) . If the previously described effect s of GTS 21 and NS6740 on the NF B reporter activity and viability of Jurkat Dual cells were dependent on ion flux through 7 nAChR ion chan nels, then one would expect the effect s of these agents to be abrogated in the presence of such antagonists assuming they are able to effectively bl ock ion currents . The following experiment tested that hypothesis, examining whether or not the effects on the ConA induced NF B reporter activity and cell viability induced by GTS 21 and NS6740 are sensitive to MLA, a n antagonist of 7 nAChR mediated io n currents. It is noted that under certain conditions (typically at low nM concentrations), MLA has been

PAGE 81

81 observed to have inverse agonist like activity and can slightly increase potentiated 7 ion currents but MLA effectively block s such current responses at 1 M ( R. Papke lab, unpublished findings). Data/Results: Figure 4 9 shows the results of pre treating ConA stimulated Jurkat Dual cells with 1 M MLA prior to treating cells with 100 M GTS 21 or NS6740 (treatments that were previously shown to affect NF B reporter activity and cell viability). Control cell groups demonstrated that application of 1 M MLA alone increased the ConA induced NF B reporter activity and cell viability com pared to cells stimulated with ConA only , but this manifests as the reverse effect when the NF B and viability data are normalized to each other . Treating cells with 100 M GTS 21 or NS6740 alone reduced the ConA induced NF B reporter activity and cell viab ility (as previously described). However, the GTS 21 and NS6740 effect s remained largely insensitive to pre application of MLA. There was a slight abrogation of the GTS 21 induced decrease of the NF B reporter activity by pre treatment with MLA (low degree of statistical significance) , but this was not the case for the corresponding viability measurements. Note however these effects are largely nullified upon normalization of the data (Figure 4 9, panel C) . These results are in contrast to previous studies, which showed that MLA pre treatment protected PC12 cells f rom the toxic effects of 100 M GTS 21 ( 193 ) . Discussion /Conclusions : Others have reported the failure of classical 7 nAChR antagonists B tx and MLA to block putative nAChR dependent in tracellular signaling effects in Jurkat cells ( 225 ) , while such antagonists may even have activity on their own in some i mmune cell paradigms ( 142 , 225 ) . Notably, data shown in Appendix

PAGE 82

82 C demonstrates that the 7 nAChR antagonist tkP3BzPB exhibited activity in the Jurkat Dual model. The data from the present study suggest s that the effect s of GTS 21 and NS6740 on NF B reporter activity and cell viability in ConA stimulated Jurkat Dual cells are not dependent o n MLA sensitive nicotinic receptor i on channel activity , because MLA failed to block such effects with any convincing degree of statistical significance . GTS 21 is considered a partial agonist of functional 7 nAChR ion channels, and at concentra tions gre ater than 3 0 M , peak ion current responses we re suppressed ( 248 ) . Thus, the effect of 100 M GTS 21 on 7 nAChR is unlikely to evoke efficacious ion channel activation even if Jurkat Dual cells exhibited properties characterist ic of functional nACh R ion channels. Furthermore, NS6740 applied alone does not efficaciously activate the human 7 nAChR ion channel ( 141 , 212 ) . Therefore, b oth GTS 21 and NS6740 applied at 100 M are thermodyn amically more likely to put 7 nAChR into desensitized, non conducting closed states ( 141 , 188 ) . This study demonstrates further evidence consist ent with the hypothesis that nAChR have non ionotropic signaling function(s). However, the data are also consistent with the possibility that the effects of GTS 21 and NS6740 are not mediated by MLA sensitive nAChR, which may suggest that 7 nAChR is not involved . Muscarinic receptor a ntagonist Introduction : Acetylcholine receptors are pharmacologically distinguished by their selective binding of either nicotine or muscarine, respectively classified as nAChR or mAChR . Muscarinic receptor s have been extensively studied and characterized as G protein coupled receptors that can affect various intracellular signal transduction processes. Atropine is a competitive antagonist of all known mAChR types (M1 M5)

PAGE 83

83 ( 249 ) . Thus, if the effects of either GTS 21 or NS 6 7 40 on the NF B reporter activity and cell viability in stimulated Jurkat Dual cells occurred due to activation of m uscarinic receptor s , then such effects should not persist in the presence of enough atropine to saturate and effectively inhibit any putativ e mAChR activity present in the cell. The following experiment therefore tested whether or not effects on the NF B reporter activity and cell viability associated with GTS 21 and NS6740 treatments in ConA stimulated Jurkat Dual cells are sensitive to the presence of the non selective muscarinic receptor antagonist atropine . Data/Results: Figure 4 10 shows the effect of pre treating ConA stimulated Jurkat Dual cells with 1 M atropine prior to treating cells with 100 M GTS 21 or NS6740 . T his experiment was performed in parallel with the experiment and corresponding data reported in Figure 4 9 , and hence these two ex periments shared control groups ( i.e. untreated cells , cells treated with ConA , GTS 21 or NS6740 onl y) . In Figure 4 10, a n independent contr ol group demonstrates that ap plication of 1 M atrop ine alone increased the ConA induced NF B reporter activity and cell viability compared to cells stimulated with ConA alone . The suppressive effect s of 100 M GTS 21 or NS6740 on the ConA induced NF B reporter activity and cell viability were no t sensitive to pre treatments of atrop ine prior to GTS 21 or NS6740 treatment s . Note that for Figure 4 10, all effects on the NF B reporter activity were concomitant with similar effects on viability; therefore similar to those data in Figure 4 9, the ef fects are generally not apparent when the NF B data are normalized by the viability data (Figure 4 10, panel C).

PAGE 84

8 4 Discussion /Conclusions : According to other reports , T lymphocytes express all five mAChR subunits as well as other non 7 nAChR subunits ( 250 252 ) , indicating that muscarinic type G protein coupled receptors and non homomeric 7 nAChR may also form in these cells, however their functions remain lar gely unknown. It is noted that a nother study failed to detect M1 and M2 muscarinic receptor subunits in Jurkat cells ( 253 ) . There are no reports in the literatur e of GTS 21 or NS6740 effects on muscarinic receptor systems, however there are a few studies indicating that mAChR manipulation can affect NF B signaling in other non T cell types ( 254 257 ) . T he data from this study suggest that the GTS 21 and NS6740 effect s on NF B reporter activity and cell viabilit y observed in ConA induced Jurkat Dual cells are not dependent on mAChR activation. Proposed Model on Regulation of Jurkat Dual S ignaling by GTS 21 and NS6740 Figure 4 11 depicts a cartoon diagram summarizing the effects of GTS 21 and NS6740 on the regula tion of NF B/IL 2 signaling and survival/apoptosis in ConA and PMA stimulated Jurkat Dual cells. Gene Editing Rationale and a pproach Introduction: Ascribing dependence of a cellular effect e.g . due to the pres ence of a pharmacological agent to the function of a sp ecific gene product has become a more technically feasible problem to address recently with the development of molecular knock down and knockout approaches . For instance , if t he expression of a particular gene of interest could be abolished, then one would be able to ascertain whether or not a cell ular effect is dependent on expression of the gene by examining the nature of the effect under cases when the gene is or is not expressed. This same

PAGE 85

85 rationale is applied to the following studies , and the primary goal was to abolish the expression of the human CHRNA7 gene in Jurkat Dual NF B reporter cells to ascertain whether or not GTS 21 and NS6740 induce d modulation of the NF B reporter ac tivity and cell viability are dependent on the expression of CHRNA7 . This section first introduce s how the expression of a particular gene of interest can be abolished by application of the CRISPR Cas9 system , which can facilitate permanent total disruption of a target gene of interest rendering it inoperative ( i.e. knock ou t , KO ) ( 258 ) . This approach is , in some respect , superior to other knockdown type approaches such as RNA interference (RNAi), because knockdowns at best can only produce transient and partial diminishment of gene expression in contrast to knockouts, which are permanent ly retained in progeny cells . The CRISPR Cas9 system utilizes the specialized acti vities of specific endonuclease enzymes that function to cleave both phosphodiester backbone strands in genomic DNA yielding a double stranded break (DSB) at specific sequence sites . The DSB target site within a given DNA sequence can be specified by shor t (approximately 20 bp) nucleic acid sequences that code for short single stranded guide RNA ( gRNA) molecules complimentary to the target sequence . W hen the gRNA is expressed in cells, it binds to the specified target sequence location within the DNA whil e forming a complex with an endonuclease enzyme ( e.g. Cas9) that functions to cleave phospho ester bonds in both strands of the DNA proximal to that specified sequence location. After a DSB occurs in a cell, e ndogenous cellular mechanisms for repairing DSB s are activated, the most common mechanism being non homologous end joining (NHEJ) repair ; however NHEJ is typically inefficient at repair ing DSBs in a

PAGE 86

86 manner that r e stores the original sequence in t he correct reading frame ( 259 ) . As a result, NHEJ repair usually leads to insertion/ deletion (indel) mutations ( 260 ) ; therefore , when DSB s occur with in an ORF of a gene of interest, it is likely that indel mutations will cause a frameshift in the protein coding sequences immediately dow nstream of the DSB site. Consequently, transcription of the frame shifted gene sequence yields m RNA transcripts coding for a protein with different codon s downstream from the DSB site, which may include premature stop and/or nonsense codons . When this typ e of aberrant m RNA containing a frameshift and codon mutations is transcribe d , it is recognized at ( 261 ) , which degrades the aberra nt m RNA instead of translating it . If such changes were to occur in both copies of a n endogenous gene ( i.e . both alleles), it would completely abolish expression of the functional gene product . Construct design and s ynthesis T he primary goal of the follo wing studies was to abolish the expression of CHRNA7 in Jurkat Dual NF B reporter cells by applying the CRISPR Cas9 system. Thus, it was first necessary to determine suitable target sequence regions in CHRNA7 for a CRISPR Cas9 mediated event leading to disruption of CHRNA7 ( i.e. determine suitable g RNA sequence s ). Homo pent a meric 7 type nAChR contain five 7 protein subunits encoded by the CHRNA7 gene. However part of the CHRNA7 sequence is potentially duplicated in CHRFAM7A . Therefore , i n order to cover all potential copies of CHRNA7 present in the cell, three gRNA seque nces were de si gned to selectively target CHRNA7 , CHRFAM7A or both genes ( see Table 3 3). A fourth non arbitrary gRNA was also designed to target the CHRNB2 gene coding for 2 nAChR protein subunits , since

PAGE 87

87 some reports indicate that 2 containing nAChR may also influence NF B signaling in some immune cell types ( 170 , 176 ) . The gRNA target sequences were determined using the CRISPR design tool , a (c rispr.mit.edu). This algorithm allows the user to input a target DNA sequence (23 500 nucleotides) and scans the seq uence for possible CRISPR guide se quences and off target matches with in the selected genome (human) . Possible guide s equences and their potential off target matches are listed and indexed according to the predicted degree of target specificity. DNA sequences used as input s for guide sequ ence determination s included the first 200 nucleotides immediately downstream of start codons (exon 1) within CHRNA7 , CHRFAM7A and CHRNB2 ORFs ; for the guide targeting both CHRNA7 and CHRFAM7A , the DNA sequence corresponding to the first 200 nucleotides im mediately downstream from the site where CHRNA7 sequence first appears in CHRFAM7A was used as the input DNA sequence . In order to achieve efficient disruption of gene expression by this method, it is generally preferred to position the DSB site as close to the start codon as possible. This he lps ensure that corresponding frame shift mutation event s happen near the beginning of the ORF, thus making the activation o f non sense mediated decay and disruption of functional gene product more likely to occur. O nce target sequences within the genes were determined, the n ucleic acid sequences coding for the sgRNA corresponding to each target sequence were synthesized and cloned into Addgene plasmid no. 62988 , which contains a Cas9 endonuclease expression cassette . Correct incorporatio n of the guide RNA sequences were confirmed by DNA sequencing at the University of Florida Interdisciplinary Center for Biotechnology Research facility.

PAGE 88

88 Delivery, selection and e xpansion Upon incorporation of the correct target g RNA sequences into the CRISPR Cas9 plasmid, the constructs then contain ed the appropriate machinery necessary to generate the desired DSBs at the respective target DNA sites within the cell. Purified plasmid constructs were then delivered to cells and tested for their functional efficacy . The CRISPR Cas9 plasmid constructs were delivered to cells via transient transfection using cationic lipid based transfection reagents ( e.g. Lipofectamine). A separate plasmid coding for RFP was always co transfected with t he CRISPR plasmids to allow for estimation of transfection efficiency by visual inspection with a fluorescent microscope. Importantly, the CRISPR plasmid construct s also contain a n other expression cassette that can confer cell s with transient resistance t o the antibiotic puromycin. This allows for a selection process to be applied using puromycin: in the presence of puromycin , populations of cells can be enriched for those that receive d CRISPR plasmids (survivors) while those that did not recei ve CRISPR p lasmid should not survive . In order to perform such a selection, it was first necessary to determine the minimum concentration of puromycin required to prevent cell survival in the absence of the plasmid conferring resistance to puromycin ( i.e. generate a kill curve) . The minimum puromycin concentration required to prevent cell survival was determined empirically by independent experiment s , and estimated to be approximately 1 g /mL for both A7R3HC10 a nd Jurkat Dual cells ( Appendix H ). Immediately after t ransfection, cells were initially cultured without puromycin for 3 5 days to provide enough time for the expression of functional CRISPR Cas9 and puromycin resistance machinery. Puromycin was then added to the cell growth medium at 1 g /mL a nd cells wer e

PAGE 89

89 selected for a p eriod of 5 7 days . After selection, the enriched populations of cells were further propagated in an expansion phase (3 4 weeks) until enough cells could be collected and analyzed to evaluate the putative effects on gene expression. V alidation of gene d isruption A pilot study was first performed to test if the CRISPR Cas9 constructs w ere able to effectively disrupt CHRNA7 in A7R3HC10 cells. This was done because initial studies indicated that transfection and selection of Jurkat Dual cells would be more difficult to achieve due to their poor transfection properties and suspended mode of culture. In contrast to suspended cells ( e.g. Jurkat Dual ), when performing such an antibiotic selection with adherent cells, non viable cells detach from the culture vessel surface whereas viable cells remain attached. This makes it relatively straight forward to determine whether or not the selection is working by simply inspecti n g the cells under a microscope during this process . Because the delive ry, selection and expansion phases are rather lengthy processes (5 6 weeks total), the use of A7R3HC10 cells allowed for a more expeditious initial proof of principle assessment of the construct efficacies with respect to disrupting expression of CHRNA7 . Data/Results: Previously, the CHRNA7 and RIC3 genes (each present within different plasmids) were transfected into HEK 293 cells, and the transfected plasmids/genes were selected for stable incorporation into the cellular genome yielding the clonal pop ulation of A7R3HC10 (clone 10) cells ( 124 ) . Figure 4 12 demonstrates that upon RT PCR analysis with CHRNA7 and RIC3 specific primers, robust signals for thes e two genes are apparent in the product mixtures generated from clone 10 cells but not HEK 293 cells. Clone 10 cells were transfected with CRISPR Cas9 plasmid constructs targeting CHRNA7 , taken through selection and expansion phases, and

PAGE 90

90 subsequently tota l RNA was isolated and analyzed for disruption of CHRNA7 expression via RT PCR. Figure 4 12 indicates that the CHRNA7 signal was partially diminished in the RT PCR products derived from clone 10 cells that received CRISPR Cas9 plasmid containing CHRNA7 sp ecific gRNA, but not in clone 10 cells that received empty vector (CRISPR Cas9 plasmids without gRNA) or CRISPR Cas9 plasmids containing CHRFAM7A specific gRNA. After validating that the CRISPR Cas9 constructs effectively diminish ed expression of CHRNA7 in A7R3HC10 cells evidenced by RT PCR analysis , the process was repeated with Jurkat Dual cells. Analogously, Jurkat Dual cells were subjected to the same delivery/selection/expansion process previously described. Subsequent RT PCR analyse s indicated tha t the constructs were also effective at diminishing CHRNA7 expression in Jurkat Dual cells (Figure 4 13 , panel A ) . Panel A of Figure 4 13 indicates that the CHRNA7 signal was partially diminished in the RT PCR products derived from Jurkat Dual cells that received CRISPR Cas9 plasmid containing CHRNA7 / CHRFAM7A specific g uide RNA, but not in control Jurkat Dual cells that received empty vector (no g uide ) or un transfected WT Jurkat Dual cells not taken through subsequent antibiotic selection and expansion . Th e heterogeneous (polyclonal) population of modified Jurkat Dual cells (corresponding to the cells which generated bands in lane 3 of the gel shown in panel A of Figure 4 13) was then diluted into single cell cultures in order to propagate monoclonal popu lation s of (theoretically) homogen e ous genotypes for further evaluation. The end goal wa s to isolate and identify a clonal population of Jurkat Dual cells with complete disruption of CHRNA7 expression . The single cell cultures were isolated and identifie d by visual inspection

PAGE 91

91 with a micro scope and subsequently propagated until enough cells were present to harvest RNA and analyze CHRNA7 disruption again by RT PCR (approximately 3 4 weeks) . Figure 4 14 shows the results of an RT PCR analysis of seven suc h monoclonal populations. Clones 1 and 2 were derived from a mixed polyclonal population of Jurkat Dual cells transfected with CRISPR Cas9 plasmids containing a CHRNA7 specific g RNA , whereas clones 3 7 were derived from a mixed population of Jurkat Dual cells transfected with CRISPR Cas9 plasmids containing a CHRNA7/CHRFAM7A specific g RNA . The RT PCR CHRNA7 signal representative of clones 1 2 was partially diminished, while that signal was considerably diminished for clones 3 7 in comparison to the CHRNA7 signal generated from WT cell s and cells that received CRISPR C as9 plasmid with no specified g RNA. Discussion /Conclusions : These studies demonstrate the relative efficacy of CRISPR Cas9 constructs targeting CHRNA7 in A7R3HC10 (clone 10) and Jurkat Dual cells. The CRISPR Cas9 construct containing a CHRNA7 specific guide was effective at disrupting CHRNA7 in c lone 10 cells. Clone 10 cells delivered constructs containing no guide RNA or CHRFAM7A specific guide did not affect the CHRNA7 PCR signal, d emonstrating that the disruptive effect on CHRNA7 was dependent on the presence of the CHRNA7 specific guide RNA . H owever, regarding the disruptive effect on CHRNA7 in clone 10 cells, the data suggest this process was not 100% efficient as indicated by th e residual CHRNA7 RT PCR signal . Notably, in clone 10 cells CHRNA7 is likely present in multiple copies because it was transfected into the cells within a plasmid that was selected for in stable clonal cell derivative s . This then leads to t wo potential i nterpretations : 1) e ither the CRISPR Cas9 system was not completely efficient at

PAGE 92

92 disrupting all CHRNA7 co pies within clone 10 cells, and/or 2) all copies were disrupted but because the CHRNA7 specific RT PCR primers are downstream of the DSB site, aberrant frame shifted yet undestroyed mRNA was still detected and amplified by RT PCR. With the current data, it does not allow one to discriminate between these two possibilities. However if the latter possibility were true, then in the presence of a translatio n inhibitor ( e.g. anisomycin) the amount of putatively undestroyed yet aberrant mRNA w ould increase because non sense mediated decay is initiated u pon t ra nslation at the ribosome. Likewise, the a forementioned points remain possibilities for the CRISPR Cas 9 dependent effects o n CHRNA7 in Jurkat Dual cells. In contrast to clone 10 cells however, CHRNA7 was not introduced via a plasmid and therefore only two copies of CHRNA7 and two copies of CHRFAM7A should exist in the Jurkat Dual cell genome. For the sak e of interpreting the following experiments with CRISPR modified Jurkat Dual cells , it is assumed that all copies of CHRNA7 were disrupted for the monoclonal cell populations exhibiting a weak phenotypic CHRNA7 RT PCR signal like that of clones 3 7 (Figu re 4 14), due to the previously described argument that these weak signals may be r epresentative of aberrant frame shifted yet undestroyed CHRNA7 mRNA. It is therefore then assumed that no CHRNA7 protein is made in such cells . Further analy sis is necessar y to validate the s e assumption s with certai nty. For example, the genomic region s where the CHRNA7 specific disruptions were targeted in CHRNA7 and CHRFAM7A could be amplified by PCR and sequenced to inform whether or not disruption occurred in all copies of CHRNA7 . Alternatively, evaluating whether or not Jurkat Dual cells express CHRNA7 proteins may be informative on this issue. Achieving disruption of CHRNA7 in the Jurkat Dual reporter cells permits a novel

PAGE 93

93 tool for unambiguous assessment s on the depen dence of functional CHRNA7 expression for observable cellular effects . Dependence of putative nicotinic drug effects on CHRNA7 e xpression Introduction : The disruption of CHRNA7 in the Jurkat Dual NF B reporter cells via CRISPR Cas9 provides a novel mod el system where CHRNA7 deficient cells can be tested to determine whether or not experimental treatments are dependent on CHRNA7 proteins present in the cell. The immediate experimental goal and motivation for carrying out the gene editing studies wa s to dete rmine whether or not effects of GTS 21 and NS6740 on NF B reporter activity and cell viability in Jurkat Dual cells are dependent on expression of CHRNA7 . The following experiments thus inve stigated the effects of CHRNA7 (as well as CHRNB2 ) disruptions in mitogen s timulated Jurkat Dual cells, characterizing b oth the cell sensitivity to NF B activation induced by mitogens and the nature of effects that the previously characterized GTS 21 and NS6740 treatments have on the NF B reporter activity and cell viability in the modified cell lines. Data/Results: Cont rol WT Jurkat Dual cells as well as control cells that were processed through the CRISPR Cas9 selection and expansion procedure with empty plasmid vector (no g RNA), in addition to polyclonal populations of cells which received CRISPR Cas9 plasmid construct s containing either CHRNA7/CHRFAM7A or CHRNB2 specific gRNAs , were stimulated with mitogens ConA and PMA per the previous ly described NF B activation experiment protocol s . Figure 4 15 indicates that in comparison to both control cell groups, CRISPR Cas9 treated cells with CHRNA7/CHRFAM7A or CHRNB2 targeted g RNAs were approximately 3 fold more sensitive to ConA induced NF B activation (e videnced by the NF B reporter activity

PAGE 94

94 measurements shown in panel A) , and approximately 1.5 2.5 fold more sensitive to PMA induced NF B activation (panel B) . Figure 4 16 shows the comparative effects that the same GTS 21 , NS6740 and nicotine treatme nts ha d on the mitogen stimulated NF B reporter activity and cell viability in control and polyclonal populations of CHRNA7 and CHRNB2 modified Jurkat Dual cells. Pre treatment with 100 M GTS 21 further decreased the NF B reporter activity but not cel l viability in CRISPR Cas9 modified cells stimulated with ConA in comparison to the WT and control (no g uide ) cell groups (panels A and C) . The observed increase s in NF B reporter activity due to 100 M GTS 21 treatments applied to control cells stimulat ed with PMA were also partially suppressed in the CRISPR Cas9 modified cells , however viability effects were largely unaffected (panels B and D) . No striking differences in effects on NF B reporter activity were observed comparing NS6740 or nicotine trea tments between control and CRISPR Cas9 m odified cells (panels A and B) . H owever the data indicate increased viability effects with NS6740 treatment for some CRISPR Cas9 modified cells compared to controls , those effects primarily observed with CHRNB2 modi fied cells (panels C and D) . F igure 4 17 shows the result of experiments evaluating the effects of GTS 21 and NS6740 in ( two ) isolated CHRNA7 modified monoclonal Jurkat Dual cell populations, which are presumed to express no CHRNA7 protein (clones 3 and 6 ). Remarkably, d ecreases of the ConA induced NF B reporter activity and cell viability by treatment with GTS 21 or NS6740 were persistent in all cells examined including those with a putative total disruption of CHRNA7 . However, differences in the effec t magnitudes of 100 M GTS 21 and NS6740 treatments are apparent comparing

PAGE 95

95 CHRNA7 affected cells versus control cells that received CRISPR Cas9 plasmid containing no guide RNA. Discussion /Conclusions : Gene editing via CRISPR C as9 provides a novel method for study ing the functional effects of gene expression . Data from this study indicate that the CHRNA7 targeting CRISPR Cas9 constructs w ere effective at selectively disrupting CHRNA7 expression in both A7R3HC10 and Jurkat Dual reporter cells, evidenced b y clearly attenuated CHRNA7 RT PCR signals. Additionally, the data indicate that CHRNB2 expression was also disrupted in Jurkat Dual cells at the polyclonal level. Compared to control cells, p olyclonal populations of CHRNA7 and CHRNB2 modified Jurkat Du al cells exhibited greater sensitivity to NF B activation induced by the mitogens ConA and PMA , however this effect was not observed in the monoclonal Jurkat Dual cell populations exhibiting the putative CHRNA7 KO phenotype (data not shown) ; these results thus remain unclear with respect to their significance . E ffects of GTS 21 and NS6740 on NF B reporter activity and cell viability were nonetheless persistent in both polyclonal populations of CHRNA7 and CHRNB2 modified Jurkat Dual cells. Comparing suc h polyclonal populations to controls, the effects of GTS 21 on the NF B reporter activity were altered in magnitude to some extent but th e effects of NS6740 were not ; however decrease s of viability as a result of NS6740 treatments were partially reduced i n the CHRNB2 modified cells. Furthermore, in monoclonal populations of Jurkat Dual cells putatively expressing no CHRNA7, important ly bo th GTS 21 and NS6740 effects on ConA induced NF B reporter activity and cell viability were persistent in these cells . T here were some apparent differences in the ConA induced NF B reporter activity compared to control cells ( e.g. GTS 21 and

PAGE 96

96 NS6740 treatments at 100 M ), however such differences were not observed with respect to cell viability effects. Consistent with these findings, another independent study recently reported that al though CHRNA7 deficient mice displayed a more severe septic phenotype in an experimental model of sepsis, GTS 21 nonetheless had beneficial anti inflammatory effects in the CHRNA7 deficient animals ( 209 ) . T aken together, t h is stud y suggests that it is unlikely that CHRNA7 play s a critical role in the GTS 21 and NS6740 induced regulation of T cell NF B activation and survival because the data indica te that the expression of CHRNA7 is not required for the decreased NF B reporter activity and cell viability effects induced by high concentrations of GTS 21 or NS6740 in ConA stimulated Jurkat Dual cells. Based on these findings, it is thus concluded that the 7 nAChR homopentamer does not mediate the GTS 21 and NS6740 induced effects on the NF B reporter activity and cell viability in mitogen stimulated Jurkat Dual cells. Further studies are necessary to identity the pharmacological target(s) of GTS 21 and NS6740 in t hese T cell signaling paradigms. This study along with those described earlier in this chapter implicate 9 , 2 and 4 containing nAChR as possible candi dates , since evidence for expres sion of these nAChR subunits has been demonstrated in Jurkat Dual cells while there is also evidence that may suggest GTS 21 and NS6740 affect CHRNB2 expression (Appendix G ) . On Human Monocytes (THP1 Lucia C ells) As it relevant to inflammation and the ch olinergic anti inflammatory pathway in vivo , both lymphocytes and monocytes migrate to local sites of inflammation upon tissue insult ( 262 ) . R eports also indicate that monocytes may express multiple nAChR

PAGE 97

97 subunits including 3, 4, 7 (and its duplicated form), 9, 10, 2 and 4 ( 157 , 183 , 185 , 224 , 263 ) . The infiltration of leukocytes expressing multiple nAChR subunits (including lymphocytes, monocytes and macrophages ) to inflammatory sites in tissues suggests that each cell and nAChR type could play a unique role in the cholinergic anti inflammatory response, however this remains poorly understood from an integrative perspective. Relevant to the rationale of this dissertation, i t was recently suggested that monocytes exhibit a non ionotropic nAChR dependent regulation of inflammation related activit y ( 185 ) . P re vious studies have also implicated the involvement of NF B and the duplicated form of 7 nAChR subunits (CHRFAM7A) in the regulation of monocyte inflammatory signaling ( 111 ) . NF B Luciferase Reporter System Since m onocytes are the precursor s to macrophages and are critical mediators of inflammatory cytokine signal ing controlled by NF B ( e.g. TNF , interleukins), an in vitro experimental model of inflammation using a human monocyte cell line was employed to investi gate the role of 7 nAChR and its duplicated form in NF B mediated inflammatory signaling. Analogous to the Jurkat Dual cell NF B reporter system, a similar NF B driven SLuc reporter system has been developed using the immortalized human monocytic cell line, THP 1 (THP1 Invivogen). In the following studies, lipopolysaccharide (LPS) was used to stimulate SLuc ( NF B ) activity in THP 1 Lucia monocytes as LPS serves to mimic bacterial infection and produce inflammation like effects ( 264 ) ; LPS is structurally akin to the lipid and carbohydrate co ntaining components of bacterial cell walls. In THP 1 cells, LPS activates NF B signaling through toll like receptor 4 (TLR4) ( 265 , 266 ) . The N F B reporter system in

PAGE 98

98 THP 1 Lucia cells was initially characterized by a concentration response study and incremental doses of LPS were used to increase SLuc ( NF B ) activity (Figure 4 18 , panel B ); LPS treatment was als o associated with an increase in the SLuc RT PCR signal (Figure 4 18, panel A) . These studies were initially executed to determine a suitable concentration of LPS to yield a robust and reliable (approximately 10 fold) increase in the SLuc activity. A sti mulation protocol using 1 g /mL LPS was then applied to subsequent studies that tested the effects of nAChR agents on LPS stimulated NF B activation in THP1 Lucia cells. Hereafter, SLuc activity will be referred to as NF B reporter activity. Evidence for CHRFAM7A but n ot CHRNA7 Expression THP1 Lucia cells were also analyzed for the native expression of CHRNA7 transcripts under basal conditions; these experiments failed to detect a CHRNA7 mRNA signal from THP1 Lucia cells however CHRFAM7A RT PCR signals were detected from six inde pendent samples derived from THP1 Lucia cells ( Appendix I ). These findings are also in agreement with previous reports ( 111 ) . Putative Nicotinic Drug Effects on NF B reporter activity and cell viability (survival) Introduction (NF B) : Considering the role of NF B within the context of inflammatory signaling in immune cells, THP 1 Lucia NF B reporter cells were used as an in vitro experimental model of infla mmation due to the hypothesis that they may exhibit n AChR dependent regulation of NF B. The following studies thus investigated whether or not nAChR agents affect LPS induced NF B reporter activity in THP1 Lucia cells. Observations from the previous st udies with Jurkat Dual cells indicated that GTS -

PAGE 99

99 21 and NS6740 induced regulation of NF B reporter activity was consistently associated with loss of viability. Therefore, the following experiments evaluated whether or not such treatments also altered the viability of LPS stimulated THP1 Lucia cells. Data/ Results: Panel A of Figure 4 19 indicates that both acetylcholine and nicotine failed to effectively attenuate the LPS induced NF B reporter activity of THP1 Lucia cells at the M concentrations teste d . However , at concentrations greater than 10 M, GTS 21 and NS6740 effect ively modulated the LPS induced NF B reporter activity, which is assumed to reflect effects on NF B activation . The effe ct of GTS 21 on LPS induced NF B reporter activity was in hibitory, with an estimated IC 50 slightly greater than 100 M . In contrast to GTS 21, NS6740 had biph asic effects on the LPS induced NF B reporter activity in THP 1 Lucia cells: low M concentrations significantly increased this activity with a maximal e ffect at approximately 30 M , while concentrations greater than 100 M significantly decreas ed the NF B reporter activity . The differential effects of 30 M NS6740 and 100 M GTS 21 on the NF B reporter activity were attenuated when both compounds were applied to the same cells ( Figure 4 20 , panel A ). The inhibitory effect of 100 M GTS 21 on the NF B reporter activity was abolished by pre treating THP 1 Lucia cells with 1 M B t x (Figure 4 20, panel B ) , a snake toxin that selectively binds to some nAC hRs including those containing 7 subunits and acts as a competitive antagonist of ion channel function ( 8 , 267 ) . Experiment r esults shown in panel B of Figure 4 19 indicate that GTS 21 and NS6740 reduced LPS stimulated THP1 Lucia cell viability at concentrations equal to or greater than 3 00 M , with NS6740 being more potent than GTS 21. Neither

PAGE 100

100 acetylcholine nor nicotine treatment significantly affected viability measurements from LPS stimulated THP1 Lucia cells o ver the concentrations tested. Since the viability data shown in panel B of Figure 4 19 originated from the same cells as those producing the NF B data shown in panel A of Figure 4 19, similar to treatment of the Jurkat Dual cell data these two measurements were normalized to each other and are thus also expressed as the NF B values divided by the viability values mea sured from each well (Figure 4 19, p anel C ). Discussion /Conclusions : These studies demonstrate that at high concentrations drugs with previously characteri zed activities toward 7 containing nAChR impact LPS induced NF B reporter activity from THP 1 Lucia cell s . Importantly however, no CHR NA7 RT PCR signal was detected but positive CHRFAM7A RT PCR signals were detected from THP1 Lucia cells. Nevertheless, t he data indicate that GTS 21 eff ec ts on NF B reporter activity were sensitive to B t x , which may implicate the involvement of Btx s ensitive nAChR including those containing 1, 7 , 9, and 10 subunits ( 181 , 182 , 267 , 268 ) . N ote that B t x treatment alone signif icantly increased LPS induced NF B reporter activity, suggesting there may be a basal level of nAChR function involved in th e r egulat ion of NF B in THP 1 Lucia cells . Surprisingly , the effect of NS6740 was qualitativel y different than that of GTS 21, and NS6740 yielded a biphasic response , which could be an indication of multiple pharmacological targets . The d ifferential effe cts of GTS 21 and NS6740 were attenuated when both compounds were applied t o the same cells, however it remains unclear whether or not these compounds act on the same target. The qualitative differences in the responses to GTS 21 compar ed to NS6740 in LPS induced THP 1 Lucia cells could suggest that

PAGE 101

101 these two compounds operate on different target s, or that they may have qualitatively different effects on the same target . The latter possibility is reasonable because these agents are known to induce multipl e nAChR functional states dependent on the concentration applied ( 141 , 188 ) . However, f urther evaluation is re quired to make a definitive conclusion in this regard. Similar to what was observed in stimulated Jurkat Dual cells, this study demonstrates that GTS 21 and NS6740 reduce cell viability of LPS stimulated THP1 Lucia cells at high concentrations, which may suggest cytotoxic effects. It was previously demonstrated that loss of viability as a result of GTS 21 or NS6740 treatment could be associated with caspase activation and presumably induction of apoptosis in Jurkat Dual cells, however coincident effects o n caspase were not evaluated in this study. Others have shown that LPS exposure confers anti apoptotic survival signals in monocytes that require increased NF B activation ( 269 , 270 ) ; therefore decreases of LPS induced NF B activation may be associated with apoptosis . However at present there are no data that directly addresses whether or not apoptosis is involved and whether or not the cytotoxi c effects of GTS 21 and NS6740 we re mediated by nAChR. Phosphorylation and degradation of I B Introduction : Due to the pr ior observation that GTS 21 and NS6740 have divergent effects on NF B activation in LPS stimulated THP 1 Lucia cells, it prompted a study on the mechanism by w hich these compounds might impact NF B. It was hypothesized that GT S 21 and NS6740 regula te the NF B reporter activity by disrupting the NF B activation process , i.e. before the NF B driven transcriptional event rather than after it. If this hypothesis were true, then the GTS 21 and NS6740 -

PAGE 102

102 induced effects on the LPS stimulated NF B repor ter activity should also manifest in cell activities at the final event triggering activation of NF B , i.e. phosphorylation of the NF B inhibitor protein I B . Phosphorylation of I B catalyzes dissociation of the NF B/I B inhibitory complex, allowing NF B to translocate to the nucleus and activate transcription of its downstream gene products ( 271 , 272 ) . The phosphorylation of I B may also lead to its subsequent proteasomal degradation ( 273 ) . Operating by such regulation, it follows that when NF B is activate d I B phosphorylation and degradation should increase, whereas inactive NF B should be associated with less I B phosphorylation and degradation. Using this regulatory premise , the following experiments tested whether the differential effects of GTS 21 and NS6740 reciprocate differential effects on the phosphoryla tion and degradation state of I B in LPS stimulated THP 1 Lucia cells, thus assessing the hypothesis invoking coincident involvement of I B . Data/Results: Figure 4 21 indicates that phosphoryl ated I B was detected in THP 1 Lucia cell lysates after cells were stimulated with LPS for 30 and 60 minutes; the data also indicate a coinci dent loss of signal for total I B proteins at these time points, which is interpret ed as an indication of proteaso mal degradation . Because the data shown in Figure 4 19 demonstrated that NS6740 and GTS 21 had significantly different and oppo sing effects on the LPS induced NF B reporter activity at 30 and 100 M , respectively, it was hypothesized that pre treating TH P 1 Lucia cells with these particular drugs at such concentrations would cause reciprocal effects on the phosphorylation and/or degradatio n state of I B . Indeed, the differential effects th at GTS 21 and NS6740 had on the LPS induced NF B reporter activit y at such concentrations

PAGE 103

103 correlated with differential effects on the total and phosphorylated I B levels detected (Figure 4 21, panel E). These observations are consistent with the reciprocal regulatory effects on I B as predicted. Discussion /Conclusion s : These experiments demonstrate that GTS 21 and NS6740 altered the distribution state of I B phosphorylation and degradation in LPS stimulated THP1 Lucia cells. The observed effects were consistent with the putative nAChR drugs affecting the NF B acti vation process at a pre transcriptional level. The results support the hypothesis that GTS 21 and NS6740 affect LPS induced NF B signaling by a mechanism that involves a signal transduction event prior to the phosphorylation and d egradation of I B . The antibo dies targeting phosphorylated I B used in these experiments were generated from serine phosphorylated epitopes and phospho tyrosine I B antibodies were not evaluated . It is assume d that effects on I B phosphorylation observed in the experiments we re indicative of a phosphorylation event occurring at I B serine residues 32/36, presumably via the canonical I B kinase (IKK2) complex pathway ( 274 ) . However the following considerations are noted. Antibodies are subject to cross reactivity, particularly those that react with phosphorylated epitopes ( 275 ) . Panel C of Figure 4 21 indicates there were non specific proteins that c ross reacted with the phospho I B antibody, and others have reported similar cross reactivity issues u sing phospho I B antibodies ( 276 ) . Moreover, there are indications of potential cross talk between phospho serine and phospho tyrosine epitopes with signaling through SH2 domains ( 277 ) . In summary, it is concluded that GTS 21 and NS6740 modulate LPS induced transcriptional activity of NF B in THP1 Lucia cells by altering the phosphorylation and

PAGE 104

104 degradation state of I B ; the mechanism and molecular intermediates by which this regulation occurs would thus involve event(s) prior to phosphorylation of I B . Appendix J contains continued dis cussion beyond the scope of these data regarding putative molecular intermediates involved in nAChR mediated regulation of NF B and the mechanism(s) by which they m ight operate. TNF e xpression Introduction : Transcription of the pro inflammatory cytokin e TNF is positively controlled by LPS induced NF B activation in human monocytes ( 278 ) . Considering this observation and the previously described observation that nAChR drugs modulate the LPS induced NF B reporter activity in THP 1 Lucia cells , then such drugs should affect TNF mRNA levels to a similar extent because TNF synthesis is controlled by NF B and it has been previously demonstrated with the I B experiments that the nAChR drug mediated regu lation of NF B occurs at a pre transcriptional level. The following study therefore tested the extent to which nicotine and GTS 21 treatment affect LPS induced TNF mRNA levels in THP1 Lucia cells. Data/Results: Figure 4 22 indicates that no TNF RT P CR si gnal was generated when using template RNA fro m THP 1 Lucia cells treated with 100 M GTS 21 or nicotine alone for 12 hours. After 12 hours of stimulation with LPS, the TNF fragment was apparent in the RT PCR product mixture, suggesting that LP S ind uced transcription of TNF mRNA. When THP 1 Lucia ce lls were pre treated with 100 M GTS 21 or nicotine for 1 hour prior to a 12 hour incubation period with LPS, the TNF fragment bands were less intense than those corresponding to samples treated with

PAGE 105

105 L PS alone, suggesting that the nAChR drug s attenuated the amount of TNF transcripts. Given at equivalent concentration s , GTS 21 treatm ent yielded a less intense TNF band than nicotine treat ment did for LPS stimulated THP 1 Lucia cells, suggesting that G TS 21 was more effective than nicotine at reducing the amount of TNF mRNA present in LPS stimulated THP 1 Lucia cells. Discussion/ Conclusions: This study demonstrates that the nAChR drugs nicotine and GTS 21 attenuate LPS stimulated TNF mRNA signals in THP1 Lucia cells. In previous studies with THP1 Lucia cells, GTS 21 was characterized to be more effective than nicotine at suppressing the LPS induced NF B reporter activity, while in this study it was also found to be more effective than nicotine at a ttenuating the TNF mRNA signal in LPS stimulated THP 1 Lucia cells. This finding is consistent with the nAChR drug de pendent regulation of TNF mRNA synthesis occurring via NF B control at a pre transcriptional level . CHRFAM7A and CHRNB2 expression Introduction : Although CHRNA7 transcripts were not detected, CHRFAM7A transcripts were detected in THP1 Lucia cells, and a prior study also implicated a functional consequence of LPS treatment on CHRFAM7A expression in THP 1 cells ( 111 ) . Therefore, the following experiments evaluated whether CHRFAM7A mRNA levels are dependent on the p resence of the nAChR drugs GTS 21 or nicotine in LPS stimulated and un stimul ated cells. The e ffects of such nAChR drug treatments on CHRNB2 mRNA levels were also examin ed due to implications that may suggest involvement of CHRNB2 in the modulation of inflammation related signal ing in THP 1 cells ( 157 ) .

PAGE 106

106 Data/Results: The effects of 100 M GTS 21 and nicotine treatments on the CHRFAM7A and CHRNB2 RT PCR signals generated from LPS stimulated and un stimulated THP1 Lucia cells are shown in Figure 4 23 . Regarding CHRFAM7A signals (panel A), tw o RT PCR products were detected: t he 422 bp frag ment which corresponds to the amplicon that would be generated from the non mutated (WT) CHRFAM7A mRNA template sequence , and the 358 bp fragment which correspond s to the amplicon that would be generated from mRNA transcribed from a 2 bp deletion polymorph ism of this gene, denoted as . Treatment with GTS 21 and nicotine increased both CHRFAM7A signals and decreased the CHRNB2 signal in comparison to untreated cells. While there were no apparent effect s of LPS treatment alone on CHRFAM7A or CHRNB2 si gnals, in the presence of GTS 21 the CHRFAM7A but not CHRNB2 signal s differed comparing treatments with and without LPS . Discussion /Conclusions : I n this st udy the mRNA species corresponding to the duplicated forms of 7 nAChR subunits encoded by CHRFAM7A were detected from T HP 1 Lucia cells ; the mRNA species corresponding to CHRNA7 was not detected from THP 1 Lucia cells and these findings are consistent with a previous report ( 111 ) . The r esults in this study may suggest that THP 1 Lucia cells contain both CHRFAM7A transcript variants 1 and 2 (GenBank accession numbers: NM_139320.1 and NM_148911.1, respectively) , assuming the two RT PCR signals detected are representative of those mR NA species. This then would suggest that THP 1 Lucia cells are either heterozygous for CHRFAM7A (harboring alleles of WT CHRFAM7A and ) , or a polyclonal cell population. The CHRFAM7A transcript variant 1 (protein ID: NP_647536.1) has more sequ ence identity coverage of CHRNA7 than

PAGE 107

107 transcript variant 2, and is fused at the amino terminus to ULK4 at the fourth intron splice site from the amino terminus of CHRNA7 . Translation of this ORF would yield a hybrid gene product with approximately 76.7% a nd 1.0% of aligned ( protein coding) sequence identity to CHRNA7 and ULK4 , respectively. The transcript variant 2 (protein I D: NP_683709.1) results from the 2 bp deletion polymorphism and lacks an internal exon co mpared to transcript variant 1; transcript variant 2 is missing the star t codon of transcript variant 1 and translation of this transcript initiates further downstream relative to transcript variant 1. Translated monomers of transcript variant 2 would yield a protein with approximately 64% sequence identity to CHRNA7 monomers. It is thus expected that putative CHRFAM7A monom ers, if expressed and assembled into nAChR, would exhibit intrinsically different extracellular domains and possibly a significantly altered degree of ligand tropism due to considerable truncation of regions that form the ligand binding domain. Consistent with this prediction is the experimental observation that co expression of CHRFAM7A with CHRNA7 in Xenopus la ev is oocytes resulted in down regulatio n of 7 nAChR ion currents ( 158 ) . However, w ithout evidence demonstrating that GTS 21 and NS6740 bind to C HRFAM7A containing nAChR, it remains unclear whether or not these agents mediate their effects through putative CHRFAM7A proteins expressed in THP1 Lucia cells. Given that CHRNB2 transcripts were also detected in THP1 Lucia cells, it may also implicate the possibility for formation of unique nAChR containing CHRFAM7A and CHRNB2 subunits, which have yet to be characterized or identified in vivo . Nicotinic receptor s containing CHRNA7 and CHRNB2 subunits have recently been identified and characterized with novel

PAGE 108

108 pharmacology ( 279 , 280 ) , however if CHRNA7 were not present in THP1 Lucia cells this may not be relevant . In conclusion, t his study suggests that THP 1 Lucia cells express mRNA transcripts coding for CHRFAM7A while CHRNA7 transcripts were not detected . This may sugges t the basal expression of CHRFAM7A but not CHRNA7 in THP1 Lucia cells . Experiments demonstrate d that CHRFAM7A and CHRNB2 mRNA signals were inversely dependent on the presence of nicotine and GTS 21, while the effect GTS 21 had on CHRFAM7A signals was depe ndent on the presence of LPS. These results may suggest that GTS 21 and nicotine treatments up regulate CHRFAM7A and down regulate CHRNB2 in THP 1 Lucia cells, while regulation of CHRFAM7A by GTS 21 may be dependent on the activation state of the cell. Fu rther studies are required to determin e whether or not GTS 21 has direct effect s on CHRFAM7A protein function, and if so , whether those effects have dependence on CHRNB2 proteins and/or LPS treatment. However , this notion is likely questionable because i m portantly CHRFAM7A monomers contain a large ablation of the ligand binding domain that would be present in CHRNA7 monomers. On Mouse Primary Microglial Cells : Putative Nicotinic Drug Effects on TNF Secretion and Cell Viability Introduction: GTS 21 and NS6740 were previously reported in the literature to be the most efficacious of a number of nAChR agents tested for suppression of LPS induced TNF secretion from rat microglia ( 142 ) ; h owever, these studies did not evaluate the viability or survival state of the cells with GTS 21 and NS6740 treatments. Therefore, the following study aimed to recapitulate these experiments and tested the effects of GTS 21 and NS6740 on LPS induced primary mouse microglial TNF

PAGE 109

109 secretion, however additionally this study i nclude d an analysis on cell viability as a result of such treatments . Data/Result s : Panel A of Figure 4 24 shows that both GTS 21 and NS6740 treatments significantly suppressed LPS induced TNF release from mouse microglial cells as measured by ELISA (refer to Appendix K for associated standard curve and LPS concentration response curves) . The relative magnitudes of GTS 21 and NS6740 effects on LPS induced TNF levels were generally in agreement with those previously reported ( 142 ) . GTS 21 and NS6740 also had significant effects on the viability of cells at the higher concentrations of those tested ( Fig ure 4 24 , panel B ). Similar to the expression of the Jurkat Dual and THP1 Lucia NF B and v iability data, because the microglial TNF and viability data were measured from the same cells/treatments these data were also expressed as the TNF values normalized by the viability values (Figure 4 24, panel C). Discussion/Conclusions: T h e data demonstrate that effects by GTS 21 and NS6740 on LPS induced microglial TNF secretion at some lower concentrations tested do not produce significant decreases in cell viability, however at higher concentrations the decrease in TNF secretion may be confounded by or secondary to the loss of viability . This demonstrates another example where caution should be exercised in the interpretation of data reporting on the suppression of inflammation related factors by nAChR drugs in immune cells without concomitant data reporting on the survival state of the cell.

PAGE 110

110 On Recombinant Human 7 nAChR Intracellular Domain (ICD) Proteins : Cloning, Expression and Characterization Introduction : A secondary sub hypothesis related to the primary non ionotropic signaling hypothesis of this dissertation, is that nAChR mediate non ionotropic effects via intracellular protein protein interactions. Furthermore, is the hypothesis that nAChR mediate such interactions with ot her proteins through their ICD s . T herefore, in order to study these putative phenomena , it was desired to generate synthetic or rec ombinant proteins corresponding to the human 7 nAChR ICD with the intention of using such proteins as a tool to detect and identify unknown but potentially interactive protein partners. Thus the following studies piloted the molecular cloning and expression of recombinant human 7 nAChR ICD protein s in E. coli . Four constructs were made and characterized: two linear monomers with poly histidine affinity labels at the amino or carboxy termini, and two intein containing constructs that would facilitate cyclization of the ICD protein at the amino and carboxy termini either with or without a short non arbitrary peptide linker at the ligation site. Cyclic ICD proteins were designed to mimic the natural structural orientation of this domain as it would form in functional nAChR both the amino and carboxy ends (facing TM3 and TM4, respectively) of the ICD orient toward the intracellular surface of the plasma membrane and are in close proximity to each other. Data/Results: The human 7 nAChR gene was first codon optimized for expression in E. coli , then su bsequently synthesized and incorporated into a plasmid vector . PCR ampli fication of the construct inserts were generated using the primers sequences specified in Table 3 3 and the codon optimized human 7 nACh R gene as template. Figure 4 25 indicates the presence of the four construct inserts as PCR

PAGE 111

111 products immediately after amplification. After the PCR inserts were ligated into their respective cloning plasmids, restriction digest analys es identified potential clones , which were then confirmed by DNA s equencing. An example restriction analysis is shown in Figure 4 26 , identifying two of the construct clones. The human 7 ICD construct clone s were then transformed and expressed under the control of the bacteriophage T7 RNA polymerase in BL 21 E. coli . Lysis and fractionation demonstrated that all recombinant human 7 nAChR ICD proteins were predominantly present a s inso luble species (Figure 4 27 ). Lowering expression temperatures to 18 °C did not yield soluble recombinant protein s under non denaturing conditions , and dialysis from denaturing to non denaturing buffer s did not bring recombinant proteins in to the non denat uring solution to any notable extent (Appendix L , panel A ). Discussion /Conclusions : F our recombinant human 7 ICD protein constructs were successfully cloned and expressed in E. coli . DNA sequencing analyse s verified correct nucleotide sequences of plasmid clone s, and mass spectrometry analyse s verified the recombinant protein identities as the human 7 ICD. However, d ifficulties regarding the solubility of these recombinant protein species in common non denaturing solution buffers were encountered. Upon fractionation of the cellular lysates containing the expressed recombinant proteins, it was observed that the recombinant proteins largely aggregated and predominantly partitioned into insoluble fractions ( i.e. inclusion bodies) ; partial aggregation into insoluble fractions was even observed under denaturing conditions in the presence of 8 M urea. Therefore, only very low (negligible) yields of the recombinant 7 ICD proteins could be solubilized in non denaturing solutions. Due to fixed intrinsic properties associated with recombinant proteins that

PAGE 112

112 form insoluble aggregates, it limits the utility of such pro teins because they are not stable in the solution state, which is typically a requirement for further characterization and experimentation. Consequently, due to these practical limitations, no functional studies on 7 nAChR ICD facilitated protein protein interactions were investigated. Currently no experimental structural data has fully characterized any nAChR ICD. Appendix M provides an annotated diagram of the human 7 ICD primary amino acid sequence. Electron microscopy data identified an helical p attern present in the ICD proximal to TM4 of Torpedo nAChR ( 19 ) , however the majority of nAChR ICDs are largely structurally uncharacterized. Previous work employed predictive models to structurally characterize the ICD region of the Torpedo nAChR subunit ( 22 ) ; the majority of this protein segment was predicted to be highly disordered, meaning lack of secondary structure ( helices and sheets) and a high degree of flexibility of the polypeptide chain. These predictions were confirmed experimentally, and recombinant Torpedo ICD also expressed primarily as irreversible aggregates; 15 N HSQ C NMR spectra of such species revea led the characteristics of an unstructured and unfolded polypeptide ( 22 ) . Eukaryotic linear motif analysis of the Torpedo ICD identified highly disordered regions predicted to bind a number of protein kinases and phosphatases, as well as SH2 and AP 2 domains ( 22 ) . Similarly, ELM analysis of the human 7 nA ChR ICD identified a number of protein binding motifs within large regions of predicted disorder ( 17 ) . The prediction that the 7 nAChR ICD region is intrins ically disordered is experimentally supported by these studies , as the expressed recombinant 7 ICD proteins behaved primarily as insoluble aggregates.

PAGE 113

113 Intrinsically disordered proteins are though t to bind multiple protein partners and act as allosteric switches in protein interaction networks ( 281 ) . For human membrane bound receptor proteins like nAChR, intrinsically disordered regions preferentially occur in cytoplasmic regions ( 282 ) , and intrinsic disorder is a distinct feature of proteins with intracellular sign al transduction functions ( 283 ) . Based on the principles of protein folding, if an intrinsically disordered protein were in the presence of a binding partner then it would rapidly fold and bind to the partner to form an ordered complex. Because ordered protein spec ies are more likely to be soluble in non denaturing solutions, this leads to the hypothesis that co expression of the intrinsically disordered 7 nAChR ICD proteins with putative protein binding partners ( e.g. SH2 domain containing kinases) would yield an ordered soluble protein complex .

PAGE 114

114 Table 4 1. Summary of whole cell electrophysiology data . This table includes current r esponse value s of cont rol and transfected Jurkat cells to applications of 1 mM ACh or 150 M ACh plus 15 M PNU 120596. Responses were measured as peak currents relative to baseline holding currents. Data are averages ± S.E.M. for the numbers of cells indicated. Cell type Tr ansfection ACh (pA) ACh + PNU (pA) Jurkat None 0 ( n= 4 ) 0 ( n= 3 ) Jurkat RIC 3 & RFP 0 ( n= 3 ) 0 ( n= 5 ) Jurkat CHRNA7 , RIC 3 & RFP 27 ± 4 ( n= 7 ) 217 ± 127 ( n= 5 ) A7R3HC10 None 935 ± 323 ( n= 3 ) 862 ± 278 ( n= 3 )

PAGE 115

115 Figure 4 1. Detection of CHRNA7 mRNA expressio n but not nAChR ion channel function in Jurkat cells . A) RT PCR products were generated using gene specific primers for GAPDH , CHRNA7 and RIC 3 . The g el indicates a positive signal for CHRNA7 but not RIC3 associated PCR products using Jurkat cell RNA as the reaction template. Approximately 1 g of template total RNA wa s used for each RT PCR sample. B ) Representative whole cell currents from Jurkat cells and human 7 transfected HEK (A7R3HC10) cells evoked by 3 s applications of either 1 mM ACh or 150 M ACh + 15 M PNU 120596: (i) Control Jurkat cells; (ii) Jurkat cells transfected with RIC 3 + RFP (DsRed); (iii) Jurkat cells transfected with CHRNA7 + RIC 3 + RFP; (iv) Control HEK 293 cells stably transfected with CHRNA7 and RIC 3 (A7R3HC10 cells ) . Not e that the upper scale bar applies to traces in (i iii), while the lower scale bar, which is 3 fold larger, applies to the traces in (iv). G el shown in panel A is representative of a single experiment .

PAGE 116

116 Figure 4 2. Activation of Jurkat Dual cell NF B secreted luciferase (SLuc) reporter by mitogens . T cell mitogens ConA and PMA induce synthesis of an NF B driven luciferase reporter gene ( SLuc ) in Jurkat cells . A) The RT PCR signal corresponding to the secreted luciferase reporter mRNA ( SLuc ) increase d in Jurkat cells after 12 hours of ConA treatment. Approximately 500 n g of template total RNA w as used for each RT PCR sample. B ) and C) After 24 hours of treatment, ConA ( panel B ) and PMA ( panel C ) increased the relative SLuc reporter activity in a con centration dependent manner . Gel shown in panel A is representative of a single experiment.

PAGE 117

117 Figure 4 3. Effects of nAChR drugs on mitogen induced NF B reporter activity and Jurkat Dual c ell viability . The effects of 1 hour pre treatment with nicotine, GTS 21 or NS6740 on Jurkat Dual cell NF B reporter activity and cell viability induced by ConA (panel s A & C) and PMA (panels B & D ) are shown as conc entration response curves. Data v alues of nAChR drug treatment groups were normalized relative to control groups stimulated with either ConA or PMA alone (100% NF B activity /viability ) and un stimulated cells which did not receive any treatments (0% NF B activity). There was also a group containing reagent/experiment medium only and no viable cells ( 0% viability ). In all experiments the stimulatory concentration of ConA was approximately 5 g /mL and that of PMA was 100 n g /mL. End point NF B luminescen ce assays were performed 24 hours post stimulation. End point viability assays were performed 1 4 hours immediately after NF B assays. Asterisks indicate the level of statistical significance for effects of drug treatment groups compared to re spective c ontrol groups given stimulus only; *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001; n=6.

PAGE 118

118 Figure 4 4. Normalized effects of nAChR drugs on mitogen induced Jurkat Dual NF B reporter activity and viability . The normalized effects of 1 hour pre treatment with nicotine, GTS 21 or NS6740 on ConA (panel A) and PMA (panel B) stimulated Jurkat Dual cell s are shown as concentration response curves. NF B measurements were directly divided by viability measurements and then normalized. Asterisks indicate the level of statistical significance for effects of drug treatment groups compared to re spective control groups given stimulus only; *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001; n=6.

PAGE 119

119 Figure 4 5 . Mitogen and nAChR drug effects on IL 2 expression in Ju rkat Dual cells . RT PCR using GAPDH and IL 2 gene specific primers was performed with RNA extracts from Jurkat Dual cells treated for 12 hours with either 100 M nicotine, GTS 21, NS6740, 5 g /mL ConA (panel A) , 100 ng/mL PMA (panel B) or co mbination thereof. RNA concentration s were determined and approximately 250 n g of R NA extract was used to standardize the total mass of template for each reaction. Gel show n in panel A is representative of two replicate experiments and panel B gel represents a single experiment.

PAGE 120

120 Figure 4 6 . Mitogen and nAChR drug effects on CHRNA7 expression in Jurkat Dual cells . RT PCR using GAPDH and CHRNA7 gene specific primers was performed with RNA extracts from Jurkat Dual cells treated for 12 hours with either 100 M nicotine, GTS 21, NS6740, 5 g /mL ConA (panel A) , 100 ng/mL PMA (panel B) or co mbination thereof. RNA concentration s were determined and approximately 5 0 0 n g of R NA extract was used to standardize the total mass of template for each reaction. Gels sho wn in both panels are representative of a single experiment.

PAGE 121

121 Figure 4 7. Effects of nAChR drugs on mitogen stimulated Jurkat Dual cell caspas e 3/7 activation and viability . T he effects of 1 hour pre treatment with nicotine, GTS 21 or NS6740 on ConA (Panel A) and PMA (Panel B) stimulated Jurkat Dual cell caspase activities are shown. Regarding data v alues in panels C and D, nAChR drug treatment groups were normalized relative to control groups stimulated with either ConA or PMA alone (100% viabilit y ) and a group containing reagent/experiment medium only and no viable cells (0% viability ). Normalized caspase/viability values are shown in panels E and F. End point caspase 3/7 assays were performed in parallel with cell viability assays, 18 hours pos t stimulation. Asterisks indicate the level of statistical significance for effects of drug treatment groups compared to re spective control groups given stimulus only; *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001; n=6.

PAGE 122

122 Figure 4 8 . Decrease s of ConA induced NF B reporter activity and cell viability by GTS 21 and NS6740 are not dependent on extracellular Ca 2+ in Jurkat Dual cells. Jurka t Dual cells were re suspended and seeded for experiments in calcium containing or calcium free media. The cells we re incubated for 2 hours to allow cells to equilibrate prior to applying GTS 21 and NS6740 treatments (also prepared in calcium containing or calcium free media). After 1 hour of incubation with GTS 21 and NS6740, cells were stimulated with 5 g /mL ConA f or a total of 12 hours prior to measuring NF B reporter activity and cell viability . Asterisks indicate the level of statistical significance for effects of drug treatment groups compared to re spective control groups; *p<0.05, **p<0.005, ***p<0.0005, *** *p<0.0001; n=6.

PAGE 123

123 Figur e 4 9 . Decrease s of NF B reporter activity and Jurkat Dual cell viability by GTS 21 and NS6740 are not dependent on the 7 nAChR ion channel antagonist MLA . Jurkat Dual cells were re suspended in serum free media and incub ated for approximately 16 hours to allow cells to equilibrate prior to experiments. MLA was applied alone for 30 minutes prior application of GTS 21 and NS6740. 30 minutes after GTS 21 and NS6740 applications cells were stimulated with 5 g /mL ConA. NF B reporter activity was measured 24 hours post ConA stimulation. Asterisks indicate the level of statistical significance for effects of drug treatment groups compared to re spective control groups; n.s. (not significant), *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001; n=6.

PAGE 124

124 Figure 4 10 . Decreases of NF B reporter activity and Jurkat Dual cell viability by GTS 21 and NS6740 are not dependent on the non selective mAChR antagonist atropine . Jurkat Dual cells were re suspended in serum free media and incubated for 16 hours to allow cells to equilibrate prior to experiments. Atropine and GTS 21 were applied alone for 30 minutes prior to stimulation with 5 g /mL ConA. For the case where atropine and GTS 21 were co applied to the same cells, atropine w as applied first followed by GTS 21 (30 minute incubation periods with each treatment) and then ConA. NF B reporter activity was measured 24 hours post ConA stimulation. Asterisks indicate the level of statistical significance for effects of drug treatm ent groups compared to re spective control groups ; n.s. (not significant), *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001; n=6.

PAGE 125

125 Figure 4 11 . Proposed model of NF B /IL 2 signaling and survival/apoptosis in mitogen stimulated Jurkat Dual cells. The above diagram depicts the regulat ory effects GTS 21 and NS6740 have of NF B, IL 2 and cell survival /apoptosis signaling in mitogen stimulated T cells. ConA activates the TCR inducing downstream activation of NF B dependent on PI3K . PMA activates PKC in ducing downstream activation of NF B independent of the TCR pathway. GTS 21 and NS6740 block ConA induced NF B activation and IL 2 transcription while increasing caspase activation leading to pro apoptotic signaling and loss of cell survival. These eff ects are proposed to act through nAChR via a non ionotropic mechanism independent of ion channel activation. Model suggests GTS 21 and NS6740 also down regulate transcription of CHRNA7 .

PAGE 126

126 Figure 4 12. Disruption of CHRNA7 e xpression in A7R3HC10 (c lone 10) cells . RT PCR was used to analyze c lone 10 cells treated with CRISPR Cas9 plasmid constructs targeting CHRNA7 , CHRFAM7A , or empty vector control (no guide ). After plasmid transfection, selection and expansion phases , total RNA was harvested from the cells and quantified. A pproximately 500 n g of total RNA from each sample was used as template for each RT PCR reaction. Gel shown is representative of a single experiment.

PAGE 127

127 Figu re 4 13. Disruption of CHRNA7 and CHRNB2 e xpression in Jurkat Dual cells (polyclonal) . RT PCR was used to analyze Jurkat Dual cells treated with CRISPR Cas9 plasmid constructs targeting CHRNA7 /CHRFAM7A (panel A), CHRNB2 (panel B) or empty vector control (no g uide ). After plasmid transfection, selection and expansion ph ases, total RNA was harvested from the cells and quantified. Approximately 500 n g of total RNA from each sample was used as template for each RT PCR reaction. Gel shown in panel A is representative of two replicate experiments and panel B gel represents a single experiment.

PAGE 128

128 Figure 4 14. Disruption of CHRNA7 expression in Jurkat Dual cells (monoclonal) . RT PCR was used to analyze monoclonal variants derived from heterogeneous population s of Jurkat Dual cells treated with CRISPR Cas9 plasmid construct s targeting CHRNA7 (clones 1 2) or CHRNA7/CHRFAM7A ( clones 3 7, derived from cells corresponding to lane 3 of Figure 4 13 ). The polyclonal c ells were diluted to a density of 5 cells/mL and seeded into 96 well plates at well volumes of 0.1 mL ; wells co ntaining only one viable cell were identified and the progeny of th at cell were cultured in isolation and propagated for 4 5 weeks. After expansion of the monoclonal populations, total RNA was harvested from the cells and quantified. A total of 7 clone s (indicated by the numbers above the lanes in figure) were then analyzed by RT PCR. Approximately 3 00 n g of total RNA from each sample (clone) was used as template for each RT PCR reaction. Gel shown is representative of a single experiment.

PAGE 129

129 Figure 4 15. Disruption of CHRNA7 and CHRNB2 in Jurkat Dual cells increases the response to NF B activation by mitogens . Control and CRISPR Cas9 modified cells were stimulated with 5 g /mL ConA or 100 ng /mL PMA . End point NF B reporter activity assays were performed 24 hours post stimulation. All cell populations tested except WT had previously undergone selection and expansion phases after receiving initial CRISPR Cas9 p lasmids. Legend indicates cell type and guide RNA target sequence .

PAGE 130

130 Figure 4 16. Effects of nAChR drug treatments on NF B reporter activity and cell viability in CHRNA7 and CHRNB2 modifieded Jurkat Dual cells (polyclonal). Polyclonal populations of Jurkat Dual cells (those characterized by RT PCR in Figure 4 13) were evaluated and compared for the effects of 1 hour pre treatment with nicotine, GTS 21 or NS6740 on ConA and P MA stimulated NF B reporter activity and cell viability. Panels A and B show the normalized NF B values, panels C and D show normalized viability values, and panels E and F show NF B values normalized by the viability values. Regarding NF B data, nAChR drug treatment groups were normalized relative to control groups stimulated with either ConA or PMA alone (100% NF B ) and a group of untreated cells (0% viability). Regarding viability data, nAChR drug treatment groups were normalized relative to control groups stimul ated with either ConA or PMA alone (100% viability ) and a group containing reagent/experiment medium only and no viable cells (0% viability ). The data were also expressed as the normalized NF B/viability values. End point NF B assays were performed 24 hours post stimulation followed immediately by cell viability assays .

PAGE 131

131

PAGE 132

132 Figure 4 17. Effects of CHRNA7 disruption on ConA induced NF B reporter activity and cell viability in monoclonal Jurkat Dual cell populations exhibiting CHRNA7 KO phenotypes . Monoclonal populations (clones 3 and 6) of CHRNA7 disrupted Jurkat Dual cells (those indicated in panel A) were compared for the relative effects of 1 hour pre treatment s with 100 M GTS 21 , or 0.1 100 M NS6740 on ConA induced NF B reporter activity (panel B) and cell viability (panel C) . Data are also expressed as the NF B values normalized by the corresponding viability values (panel D). End point NF B assays were performed 24 hours post stimulation followed immediately by cell viability assays .

PAGE 133

133 Figure 4 18. Activation of the NF B luciferase reporter by LPS in THP1 Lucia cells . LPS induce s synthesis of an NF B driven reporter gene ( SLuc ) in THP1 Lucia cells . A) The RT PCR signal corresponding to the secreted luciferase rep orter mRNA ( SL uc ) increased in THP 1 cells after 12 hours of LPS treatment. Approximately 500 n g of template total RNA w as used for each RT PCR sample. B) After 24 hours of treatment, LPS increased SLuc NF B reporter activity in a con centration dependent manner . Gel shown in panel A is representative of a single experiment.

PAGE 134

134 Fi gure 4 19 . Effects of nAChR drugs on LPS induced NF B reporter activity and cell viability in THP1 Lucia cells . Plot shows the concentration dependent effects of 1 hour pre treatments with acetylcholine (ACh), nicotine (Nic), GTS 21 and NS6740 on NF B reporter activit y (panel A) and cell viability (panel B) in LPS stimulated THP 1 cells. Panel C shows the NF B data normalized by the corresponding viability data. Cells were incubated wit h nAChR drugs for 1 hour prior to stimulation with 1 g /mL LPS . NF B reporter assays were per formed 24 hours post stimulation and viability assay was performed 1 4 hours after the NF B assay . Data v alues corresponding to nAChR drug treatment groups wer e normalized relative to control groups stimulated with LPS alone (100% NF B activity /v iability ) and un stimulated cells which did not receive any treatments (0% NF B activity). Viability measurements were normalized to a group containing reagent/experi ment medium only (background) and no viable cells (0% v iability ). Asterisks indicate the level of statistical significance for effects of drug treatment groups compared to control group given stimulus only : * p<0.05, **p<0 .005, ***p<0.0005, ****p<0.0001; n =6.

PAGE 135

135 Figure 4 20. GTS 21 effect on LPS induced NF B reporter activity in THP 1 Lucia cells is abrogated by pre application of NS6740 or B t x . A) THP 1 Lucia c ells were treated with NS6740 or GTS 21 for 30 minutes prior to LPS stimulation; in the competition experiment s cells were treated with NS6740 for 30 minutes prior to applying GTS 21 (30 minutes) then LPS. B) Pretreating THP 1 Lucia cells with Btx for 30 minutes prior to 100 M GTS 21 (30 minutes) blocks the inhibitory effect of GTS 21 on NF B reporter activity . C) NF B data shown in panel A we re normalized to corresponding viability values (not shown). Asterisks and pound sign indicate the level of statistical significance for effects of drug treatment groups compared to control group given LPS only : #,*p<0.05, **p<0.005, ***p<0.0005, ****p<0. 0001 ; n=6 .

PAGE 136

136 Figure 4 21 . GTS 21 and NS6740 differentially regulate phosphorylation and degradation state of I B in LPS stimulated THP 1 Lucia cells . Western blotting experiments examined the differential effects of GTS 21 and NS6740 on the phosphorylation and degradation state of I B in LPS sti mulated THP 1 Lucia cells. A C) Representative immunoblots are sho wn for each protein targeted with antibodies, indicating the SDS PAGE migration distance and relative antibody specificity achieved. D) LPS ( 1 g /mL) induce s time dependent phosp horylation and deg radation of I B in THP 1 Lucia cells. E) Pre treating THP 1 Lucia cells with GTS 21 or NS6740 for 30 minutes prior to a 1 hour LPS stimulation period had differential effects on blot intensities representing both tot al I B and phosphorylated (p I B ) protein amounts present in cytosolic lysates . All blots shown are representative of a single experiment.

PAGE 137

137 Figure 4 22 . Effects of GTS 21 and nicotine on TNF mRNA levels in LPS stimulated THP 1 Lucia cells . RT PCR was performed with TNF and GAPDH specific prime rs using RNA extracted from THP 1 Lucia cells given nAChR drug treatments. GTS 21 and nicotine were applied to cells at 100 M for 30 minutes prior to stimulation with 1 g /mL LPS. Cells were incubated for 12 hour post stimulation prior to harvesting RNA. An equivalent mass of total RNA (approximately 2 50 ng) was used as template for each reaction. Gel shown is representative of a single experiment.

PAGE 138

138 Figure 4 23 . Effects of GTS 21 and nicotine on CHRFAM7A and CHRNB2 expression in LPS stimulated and un stimulated THP 1 Lucia cells . RT PCR using GAPDH and CHRFAM7A (panel A) or CHRNB2 (panel B) gene specific primers was performed with RNA extracts from THP 1 Lucia cells treated for 12 hours with either 100 M nicotine, GTS 21, 1 g /mL LPS or co mbination thereof. RNA concentration s were quantified and approximately 5 0 0 n g of R NA extract was used to standardize the total mass of template for each reaction. Gel shown is representative of a single experiment.

PAGE 139

139 Figu re 4 24 . Effects of GTS 21 and NS6740 on LPS induced TNF secretion and viability of primary mouse microglial cells . A) Mean amounts of TNF released by LPS stimulated microglial cells after pre treatment with GTS 21 or NS6740 as determined by ELISA. Cells were treated with nAChR ligands for 30 minutes prior to stimulation with 10 ng/mL LPS. ELISA was performed 4 hours post stimulation. B) Immediately after subjecting samples for ELISA analysis, viability assays were performed on the same ce lls/treatment groups. Data values corresponding to nAChR drug treatment groups were normalized relative to control groups stimulated with LPS alone (100% NF B activity/ viability) and a group containing reagent/experiment medium only (background) and no viable cells (0% viability ). C) The TNF data were also normalized by the viability data. Asterisks indicate the level of statistical significance for effe cts of drug treatment groups compared to control group given stimulus only : * p<0.05, **p<0 .005, ***p<0.0005, ****p<0.0001; n=6.

PAGE 140

140 Figure 4 25 . PCR amplification of recombinant human 7 nAChR ICD inserts . PCR products were visualized in ethidium bromi de stained agarose gels under UV light . The products were later digested and purified prior to ligation into cloning vectors .

PAGE 141

141 Figure 4 26 . Example of r estriction digest analysis of human 7 nAChR ICD plasmid clones . Plasmids were digested with DraII I and the reaction products were visualized in ethidium bromide stained gels under UV light.

PAGE 142

142 Figure 4 27 . Expression of recomb inant human 7 nAChR ICD proteins in E. coli . Single colonies corresponding to each of the 7 nAChR ICD protein constructs were inoculated into liquid cultures containing LB and protein expression was induced for 6 hours at 18 °C . Cells were lysed in 0.1 M Tris HCl buffer containing 0.5 M NaCl and 1 mM EDTA, pH 8.0. The lysates were clarified by centrifugation (S) and then washed once (W) prior to re suspending the final pellet in a denaturing buffer containing 8M urea, 100 mM DTT and 0.1 M Tris HCl (P). A) N terminal poly histidine tagged 7 nAChR ICD ; B) C terminal poly histidine tagged 7 nAChR ICD; C) Intein fused (pre) cyclic 7 nAChR ICD without linker, expressed as the fu ll (uncleaved) fusion protein; D) Intein fused (pre) cyclic 7 nAChR ICD with linker, expressed as the cleaved form . Arrows indicate bands corresponding to 7 nAChR ICD proteins.

PAGE 143

143 CHAPTER 5 CONCLUD I N G REMARKS On Experimental Limitations Co incident effects on cell viability consistently confounded the interpretation of the putative nAChR drug effects on the immune ce ll inflammation related factors observed in vitro . There were cases were nAChR drug induced effects were observed without any apparent effects on viability; however this could reflect differences in the end point readout times used to generate the measure ments, and it is possible that effects on viability may have been observed if measurements were taken at different end points. The impact of temporal variations in end point measurements was not closely examined and therefore this represents a significant limitation for these studies. The cholinergic anti inflammatory pathway is a complex integrated physiological response with many different cell types and receptor systems likely at play. The investigation of putative nAChR drug effects on experimentally induced inflammation in vitro therefore does not accurately model how such processes proceed in vivo . Further investigation is required to characterize the effects that the putative nAChR agents may have on inflammation in vivo . On Jurkat T Lymphocytes Wh ile endogenous 7 nAChR molecules (both mRNA and protein) have been detected in Jurkat cells, no nAChR dependent ion channel function could be detected in these cells even in the presence of PAMs, which potentiate 7 type nAChR ion currents. Failure to de tect ionotropic function in these cells does not prove that it does not exist, however at present the data indicate that nAChR likely do not form functional ion channels in Jurkat cells. It is possible that Jurkat cells either contain or lack

PAGE 144

144 endogenous c ellular factors that negatively regulate ion channel function. Transfection of RI C 3 and CHRNA7 into Jurkat cells yielded cells with detectable ion channel function, suggesting that Jurkat cells may contain rather than lack such putative cellular factors a s these factors might be overcome ( effectively titrated) when the CHRNA7 gene dose was increased by transfection. In the absence of detectable endogenous nAChR ion channel function, drugs capable of target ing 7 nAChR nevertheless modulated mitogen stimu lated Jurkat Dual cell signaling activities , including NF B reporter activi t y , cell survival , cytokine (IL 2) transcription/ synthesis, and induction of apoptosis , as well as diminished CHRNA7 transcription . The data may suggest that the GTS 21 and NS6740 effects on cell viability are c orrelated with the induction of apoptosis. D ecreases in ConA stimulated NF B reporter activity and cell viability induced by GTS 21 and NS6740 were no t dependent on extracellular calcium , nor were these effects sensitive t o the known 7 nAChR antagonist MLA or the non selective muscarinic receptor antagonist atropine. Remarkably, the e ffects of GTS 21 and NS6740 on NF B reporter activity and cell viability were persistent even in putative CHRNA7 deficient cells. The data are consistent with the hypothesis that GTS 21 and NS6740 af fect signal transduction via a non ionotropic mechanism, however it is concluded that homomeric 7 nAChR is not required for the characterized effects of GTS 21 and NS6740 in Jurkat Dual cells . However, these studies do not rule out the possibility that CHRNA7 may still be involved in other inflammation related signaling not measured with in these experimental systems.

PAGE 145

145 On THP 1 Lucia M onocytes The expression of CHRFAM7A and CHRNB2 but not CHRNA7 wa s detected from THP1 Lucia cells, which may suggest that CHRFAM7A and CHRNB2 but not CHRNA7 are involved in nAChR function(s) in THP1 Lucia cells . However it is unclear whether or not the nAChR drugs used in these studies act on CHRFAM7A and/or CHRNB2 co ntaining nAChR in THP1 Lucia cells . Similar to some of their effects in Jurkat Dual cells, GTS 21 and NS6740 also modulated NF B reporter activity , cytokine (TNF ) transcription/expression, I B phosphorylation/degradation, and cell viability in THP1 Lu cia cells . A ddition ally GTS 21 and NS6740 modulated mRNA signals indicating effects on CHRFAM7A and CHRNB2 expression. Experiments suggest that the GTS 21 effect on LPS induced NF B reporter activity was sensitive to Btx, indica ting involvement of nAC hR types that bind Btx such as those containing 1, 7, 9 or 10 subunits . GTS 21 and NS6740 had qualitatively different pharmacological effects on NF B reporter activity , similar to what was observed with respect to GTS 21 treatment in PMA stimulated Jurkat Dual cells. Such observations suggest that GTS 21 and NS6740 may have multiple ( non 7 ) pharmacological targets that may be at play in these paradigms. The divergent effects of GTS 21 and NS6740 on LPS induced NF B reporter activity and the acti vity state of I B were consistent with a mechanism that impacts the NF B activation process at the I B phosphorylation and degradation level, indicating that this regulation occurs prior to phosphorylation of I B in the NF B activation pathway. This provides additional mechanistic insight on the regulation of intracellular NF B signaling by nAChR ligands in immune cells.

PAGE 146

146 On Primary Mouse Microglial Cells It was demonstrated that GTS 21 and NS6740 suppress t he secretion of the pro inflammatory cytok ine TNF from LPS activated mouse microglial cells . These effects were previously characterized in the literature with respect to rat primary microglia , however there was no evaluation indicating effects on cell viability/survival under such conditions. It was determined that both of these agents also impact the viability of LPS stimulated microglia, suggesting that regulation of TNF levels may, under some conditions, also be coupled to the survival state of the cell. On Recombinant Hu man 7 nAChR ICD Proteins The ICD region of human 7 nAChR subunit monomers was successfully cloned and expressed as recombinant proteins in a bacterial host. However upon characterizing the physical properties of the expressed 7 nAChR ICD proteins it was demonstrated th at the proteins predominantly formed as insoluble aggregates. Aggregation was observed at low expression temperatures and partial aggregation was still observed even in the presence of denaturing solutions containing chaotrope. This experimental observat ion is consistent with the notion that the human 7 ICD protein region is largely intrinsically disordered as predicted by structural models. Due to the intrinsic properties of the recombinant 7 nAChR ICD proteins, no significant amount of recombinant protein could be isolated in non denaturing solutio n and therefore no structural data were obtained. Co expression of a protein bind ing partner together with the 7 nAChR ICD proteins may yield a stable soluble complex that is ordered in its structure, however this feat remains to be exper imentally demons trated.

PAGE 147

147 APPENDIX A RT PCR DETECTION OF NICOTINIC ACETYLCHOLINE RECEPTOR SUBUNIT TRANSCRIPTS FROM HUMAN T LYMPHOCYTES (JURKAT DUAL CELLS) RT PCR products identified in ethidium bromide stained agarose gels indicate the presence of 7, 9, 2 and 4 nACh R subunit mRNA . Approximately 300 n g of total RNA derived from WT Jurkat Dual cells w as used as template for each reaction probed with GAPDH and nAChR subunit specific primers. Red annotations indicate a positive reaction product band of expected size. Gel shown is representative of a single experiment.

PAGE 148

148 APPENDIX B EFFECTS OF 7 nACh R ION CHANNEL AGONISTS AR R 17779 AND CHOLINE ON CON CANAVALIN A INDUCED NF B ACTIVATION AND JURKAT DUAL CELL VIABILITY The 7 nAChR ion channel agonists AR R 17779 and choline were ineffective at suppressing ConA induce d NF B reporter activity i n Jurkat Dual cells ; there were slight ly significant increases in ConA induced NF B reporter activity as a result of AR R 17779 and choline treatments given at high M to low mM concentrations . No si gnificant effects on cell viability were observed . Bot h AR R 17779 and choline have been characterized as full and relatively selective agonists of 7 nAChR ion channel function ( 284 , 285 ) . Notably as it relates to inflammation related signaling, AR R 17779

PAGE 149

149 was also reported to be ineffective at ameliorating disease severity in an experimental colitis model ( 144 ) . As mentioned in previous studies, another report also indicated that several different agonists of nAChR ion channel function were ineffective at suppressing TNF release form LPS stimulated microglial cells ( 142 ) . These data are consistent with the hypothesis that nAChR regulate signal transduction activities via a no n ionotropic mechanism , because if such regulation were dependent on io n channel activation then efficacious agonists of the ion channel should also be efficacious regulators of signal transduction activities, however this was not observed.

PAGE 150

150 APPENDIX C EFFECTS OF 7 nACh R ANTAGONIST tkP3Bz PB ON CONCANAVALIN A INDUCED NF B ACTIVATION AND JURKAT DUAL CELL VIABILITY The 7 nAChR selective antagonist tkP3BzPB decreased ConA induced NF B reporter activity (above, panel A) and Jurkat Dual cell viability (above, pane l B) in a concentration dependent manner ; tkP3BzPB effects are also expressed as the NF B data normalized by the viability data (above, panel C) . This antagonist was shown to be selective for 7 nAChR and capable of inhibiting ion channel currents with a recovery time constant near 25 minutes; it was concluded that tkP3BzPB behaved as a potent, selective and slowly reversible inhibitor of 7 nAChR ion currents in a manner comparable with or greater than that of MLA ( 234 ) . Other reports in the literature also indicat e that another 7 selective ion channel antagonist, MLA, reduced LPS induced TNF release from microglia, with similar effects reported for GTS 21 and NS6740 ( 14 2 ) . The above data are consistent with nAChR regulating signal transduction activities via a non ionotropic mechanism because tkP3BzPB has been characterized as an antagonist of nAChR channel activity and thus would not be expected to activate nicotinic receptor ion channel s .

PAGE 151

151 APPENDIX D EFFECTS OF GTS 21 AND NS6740 ON NF B ACTIVITY AND VIABILITY OF UN STIMULATED JURKAT DUAL CELLS In the absence of stimulation by the mitogens ConA or PMA, GTS 21 and NS6740 primarily increase the NF B reporter activity (above, panel A) and decrease Jurkat Dual cell viability (above, pan el B); the effects are also expressed as the NF B data normalized by the viability data (above, panel C). The effects on NF B repo rter activity are in contrast to those observed in stimulated cells where GTS 21 and NS6740 decreased the NF B reporter ac tivity. However, the data suggest that at high concentrations these agents may diminish cell survival , and therefore the effects on viability appear to be independent of mitogen stimulation .

PAGE 152

152 APPENDIX E EFFECTS OF PI3K INHIBITOR WORTMANNIN ON CONCANAVA LIN A INDUCED NF B ACTIVATION AND JURKAT DUAL CELL VIABILITY Concanavalin A acts on the TCR to activate NF B signaling in T cells, and this process is dependent on PI3K activity ( 2 36 ) . Therefore ConA induced activation of NF B in Jurkat Dual cells should be prevented in the presence of the potent PI3K inhibitor wortmannin ( 286 ) . Indee d this was consistent with observation as indicated by the data shown above. Pre treating Jurkat Dual cells with wortmannin prior to stimulating cells with ConA dose dependently reduced NF B reporter activity (panel A); wortmannin also dose dependently d ecreased cell viability (panel B), with significant effects on viability at concentrations equal to or greater than 3 M ; wortmannin effects are also expressed as the NF B values normalized by the viability values (panel C). PI3K activity has previously been directly linked to apoptosis and cel l survival, where inhibition this activity correlated with loss of survival and induction of apoptosis ( 240 ) . These studies demonstrate the likely requirement of PI3K activity for ConA induced NF B activation in Jurkat Dual cells. The effect the PI3K inhibitor wortmannin had on NF B reporter activity and Jurkat Dual cell viability parallels that of some nAChR ligands such as GTS 21 and NS6740, which may potentially suggest that GTS 21 and NS6740 regulate NF B activation and cell viability via a mechanism involving PI3K inactivation.

PAGE 153

153 APPENDIX F SPECUALTIVE COMMENTARY ON PUTA TIVE INTERMEDIATES INVOLVED IN nACh R MEDIATED T CELL NF B SIGNALING AND SURVIVAL In regards to ConA stimulated T cell sign aling, previous work demonstrated that ConA binds to antigen receptor proteins in the TCR complex ( 287 ) , inducing tyrosine phosphory lation and activation of phosphoinositide 3 kinase (PI3K) ( 236 ) . T he TCR mediated activation of PI3K and NF B is also dependent on Src protein tyrosine kinases ( 288 , 289 ) . N icotine dependent mobilization of intracellular calcium signaling was found to be dependent on th e Src kinase LCK in Jurkat cells ( 225 ) . I nterestingly, it was shown that 7 nAChR subunits physically associate with the Src homology 2 (SH2) domain containing p85 subunit of PI3K and the SH2 domain of Src kinases ( 290 ) . Eukaryotic l inear motif (ELM) analyses have identified that the 7 nAChR subunit intracellular domain (ICD) contains a region predicted to bind SH2 domain containing proteins around Y386 ( 291 ) ; moreover, 7 nAChR ion channel function was dependent on SH2 containing Src kinase mediated phosphorylation at residues Y386 and/or Y442 of huma n 7 nAChR subunits ( 25 ) . Therefore considering these observations , one mechanistic hypothesis is that some nAChR drugs presumably capable of a ltering NF B activation do so by altering properties of nAChR subunit intracellular domains in a manner that disrupts canonical NF B signaling interactions , i.e. those with k inases containing SH2 domains such as LCK and PI3K. For instance, GTS 21 and NS6740 might bin d to and subsequ ently alter the conformation of nAChR in such a way as to promote complex formation with SH2 domain containing proteins at the ICD of nAChR subunits ; such putative complexes, if stable and composed of the signaling prot eins required for tra nsduction of canonical NF B signaling, could preclude or diminish that

PAGE 154

154 signaling. The re direction of signaling pathw ays via phosphotyrosine binding adaptor recruitment ( 292 ) . Additio nally, the co precipitation of nAChR subunits with SH2 domain containing protein kinases involved in canonical NF B signaling strengthens the experimental evidence in s upport of this hypothesis ( 290 ) . This hypothesis would be strengthened if experiments were to demonstrate that such putative complexes with nAChR and SH2 domain containing proteins were triggered to form in the presence of nAChR drug with known modulatory effects on NF B. Notably, the relative nAChR drug effects on NF B signaling were dependent on the mode of NF B activation, i.e. by ConA or PMA. As it is relevant to the PMA stimulated T cell signaling paradigm, PMA activates NF B through a PKC dependent pathway ( 293 , 294 ) . PMA activates PKC by mimicking the structure of the endogenous PKC activator diacylgly cerol (DAG) ( 295 ) . Activation of NF B by PMA is distinguishable from activation by ConA because PMA can diffuse past the immunological synapse at the plasma membrane, thus bypassing the signaling processes upstream of endogenous PKC activation, i.e. where mem brane associated phospholipase C (PLC) hydrolyzes p hosphatidylinositol 4,5 bisphosphate (PIP2) to inositol triphosphate (IP 3 ) and DAG, causing downstream release of intracellular calcium through IP 3 sensitive Ca 2+ receptors on the endoplasmic reticulum (ER ). Conversely, ConA binds to the TCR complex thereby activating its downstream enzymes during T cell activation, including tyrosine phosphorylation of PLC ( 296 ) . PKC signaling can be activated by calcium dependent ( e.g. , , ) and calc ium independent isozymes ( e.g. , , , ). TCR stimulation activate s PKC at the plasma membrane

PAGE 155

155 ( 297 ) , but others have shown that PKC is not activated by P MA ( 298 ) , and PKC does not translocate to the Jurkat cell plasma membrane upon PMA stimulation ( 299 ) . PKC also associates with the membrane upon TCR/CD3 stimulation ( 300 ) , and studies indicate that PKC activity is required for survival signals in T cells that a lso require PI3K ( 237 ) . Pre treating Jurkat cells with PMA abolished the effects TCR/CD3 stimulation had on PI3K activation, while PKC inhibition reversed this effect with potential inv olvemen t of PKC ( 301 ) , suggesting that PKC may also be requir ed for PMA signaling to NF B. In attempt to understand the observed differential effe cts nAChR drugs had on NF B signaling in these two modalities ( i.e. ConA versus PMA), first assuming a mechanism in which nAChR dependent regulation of signaling occurs via intermediate protein kinases, a hypothesis consistent with these data and observations follows that because th ese two NF B signaling pathways triggered by the mitogens were previously shown to be dependent on different PKC isoforms and/or PI3K activities, if the involvement of intermediate(s) is present in one mode of signaling and not the other , and if regulation by the nA ChR drugs were directly coupled to the activity of such intermediate(s), then the nAChR drug effects would therefore also be differentially dependent on the mode of signaling. This hypothesis may be tested by examining the nature of the nAChR drug effects previously demonstrated to produce differential effects on NF B reporter activity depending on the mode of mitogenic stimulation ( i.e. by ConA vs. PMA) under conditions when such PKC isoforms are rendered active versus inactive.

PAGE 156

156 APPENDIX G EFFECTS OF NICOTINIC DRUG TREATMENTS ON CHRNB2 EXPRESSION IN CONCANAVALIN A STIMULATED JURKAT DUAL CELLS The above gel indicates effects that nAChR drug treatment s had on Jurkat Dual cell CHRNB2 RT PCR signals in the presence and absence of ConA. RT PCR using GAPDH and CHRNB2 gene specific primers was performed with RNA extracts from Jurkat Dual cells treated for 12 hours with either 100 M nicotine, GTS 21, NS6740, 5 g /mL ConA or co mbination thereof. RNA concentration s were determined and approximately 4 0 0 n g of total R NA extract was used to standardize the total mass of template for each reaction. Gel shown is representative of a sing le experiment.

PAGE 157

157 APPENDIX H PUROMYCIN SURVIVAL STUDIES WITH A7R3HC10 AND JURKAT DUAL CELLS Prior to performing an antibiotic selection with puromycin , a concentration response study determined that approximately 1 g /mL puromycin was sufficient to prev ent survival of non transfected A7R3HC10 cells (panel A) and Jurkat Dual cells (panel B); images above were taken after 72 hours in the presence of puromycin .

PAGE 158

158 APPENDIX I RT PCR DETECTION OF CHRFAM7A BUT NOT CHRNA7 IN THP1 LUCIA CELLS RT PCR products gen erated from THP1 Lucia cells using GAPDH , CHRNA7 and CHRFAM7A specific primers were identified in ethidium bromide stained agarose gels. Gels shown in panels A and B indicate the absence of CHRNA7 fragments in the RT PCR products generated from six inde pendent RNA samples derived from THP1 Lucia cells (panel A) . Panels C and D however indicate the presence CHRFAM7A fragments in the RT PCR products generated from such THP1 Lucia cells samples , corresponding to the partially duplicated forms of the 7 nAC hR subunit. Positive controls were total RNA samples derived from A7R3HC10 cells. Negative controls were RT PCR reactions performed in the absence of template.

PAGE 159

159 APPENDIX J SPECULATIVE COMMENTARY ON A P OTENTIAL MECHANISM FOR nACh R MEDIATED REGULATION OF NF B SIGNALING IN THP1 LUCIA CELLS The following speculative commentary identifies potential molecular intermediates and proposes a regulatory mechanism that may be involved in nAChR mediated regulation of NF B in THP1 Lucia cells, which may serve to guide direction(s) for future studies . It has been demonstrated that I Ks (which also directly phosphorylate/activate I B ) can also phosphorylate substrates containing SH2 domains, such as the p85 subunit of PI3K ( 302 ) . The human 7 M3 M4 intracellular domain or cytosolic loop (defined between residues 318 and 469) has eight potential serine phosphorylation sites and two potential tyrosine phosphorylation sites ( see Ap pendix M ); a predicted SH2 binding domain surrounds Y386 ( 22 ) . Src protein tyrosine kinases ( e.g. LCK) have previously been demonstrated to regulate 7 nAChR channel function by phosphorylating Y386 and/or Y442 ( 25 ) ; inhibiting Src kinases prevented the onset of receptor desensitization, suggesting that ty rosine phosphorylated receptors are coupled to the desensitized state. In leukocytes, LCK can directly phosphorylate an SH2 domain at the N terminus of the I B subunit in the cytosolic NF B/I B complex, causing dissociation of I B and nuclear transloc ation of NF B ( 303 306 ) . LCK also regulates nAChR mediated intracellular calcium signals in leukocytes ( 225 , 226 ) , and Src kinases have co immunoprecipitated with nAChRs through SH2 domains ( 26 , 307 ) . Similar to the speculative mechanisms discussed for NF B regulation in Jurkat Dual cells, one hypothesis consistent with these observations is that nAChR regulate NF B signaling in leukocytes through a like mechanism involving complex formation with

PAGE 160

160 SH2 domain containing Sr c kinases ( e.g. LCK, PI3K). The proposed mechanism suggests that during NF B activation, nAChR ligands can induce effects on receptor conformation that recruits SH2 containing proteins ( e.g. LCK) to phosphorylate and/or form a complex with nAChR, which c ould alter the extent of canonical I B phosphorylation by I Ks. Alternatively, nAChR may induce effects that alter canonical phosphatase activities ( 308 ) , or alter other pathways that feedback on the regulatory state of the NF B/I B complex (e.g. PI3K/Akt and JAK2/STAT3) ( 309 ) . Examining the effects of LCK inactivation on the nAChR drug mediated NF B effects, and/or evaluating whether such putative intermediate complexes form with nAChR under such conditions may be informative as to whether or not the suggested intermediates and competitive recruitment regulatory mechanism are involved.

PAGE 161

161 A proposed model of nAChR mediated regulation of NF B signaling is depicted above as a schematic cartoon. LPS stimulates the TL R4 signaling cascade, causing I K s to phosphorylate I B at the I B /NF B complex in the cytosol, promoting the dissociati on of NF B fro m the inhibitory complex and translocation to the nucleus. Activated NF B binds to its regulatory element DNA sequence, recruiting RNA polymerase to promote transcription of downstream gene products such as the pro inflammatory cytokine TNF . It is pro posed that nAChR drugs induce a phosphorylation event at the nAChR intracellular domain, thus potentially recruiting SH2 containing protein kinases to form a complex at the nAChR intracellular domain thereby altering the extent of I B phosphorylation and NF B activation . Pdb files used to depict molecular structures include: 2BG9 (nAChR); 1FCP (LPS); 3FXI (TLR4); 1BHH (SH2 domain of LCK); 4KIK (I K); 1IKN ( I B /NF B complex); 1IKN ( I B ); 1VKX (NF B/DNA complex); POPE (phospholipid bilayer).

PAGE 162

162 APPENDI X K MICROGLIAL LPS VERSUS TNF DOSE RESPONSE AND TNF ELISA STANDARD CURVES Panel A above indicates the dose response relationship obtained for the amount of TNF released in response to incremental doses of LPS. The LPS induced TNF quantities rel eased by primary mouse microglial cells were determined by taking the ELISA absorbance readings, and then converting the measured absorbance values with those corresponding to known amounts of TNF (standard curve, panel B).

PAGE 163

163 APPENDIX L DIALYSIS OF RECOM BINANT 7 nAChR ICD PROTEINS

PAGE 164

164 APPENDIX M ANNOTATED AM INO ACID SEQUENCE OF THE HUMAN 7 nACh R INTRACELLULAR DOMAIN

PAGE 165

165 The primary amino acid sequence of the human 7 nAChR intracellular domain (as defined by the indicated N and C terminal residue s) is provided, showing the location of potential phosphorylation sites; the location of a putative SH2 binding domain is also indicated. The majority of the 7 intracellular domain peptide region is predicted as intrinsically disordered (region between helices), and currently no tertiary or quaternary experimental structural information is ava ilable for this protein segment.

PAGE 166

166 LIST OF REFERENCES 1. Dale H. Pharmacology and Nerve endings (Walter Ernest Dixon Memorial Lecture): (Section of Therapeutics and Pharmacology). Proceedings of the Royal Society of Medicine. 1935;28(3):319 32. Epub 1935/01/01. PubMed PMID: 19990108; PMCID: PMC2205701. 2. Dale HH. The action of certain esters and ethers of choline, and their relation to muscarine. J Pharmacol Exp Ther. 1914;6:147 90. 3. Langley JN. On the reaction of cells and of nerve endings to certain poisons, chiefly as regards the reaction of striated muscle to nicotine and to curari. The Journal of physiology. 1905;33(4 5):374 413. Epub 1905/1 2/30. PubMed PMID: 16992819; PMCID: PMC1465797. 4. Del Castillo J, Katz B. Electrophoretic application of acetylcholine to the two sides of the end plate membrane. The Journal of physiology. 1954;125(1):16 7p. Epub 1954/07/28. PubMed PMID: 13192778. 5. Del Castillo J, Katz B. Changes in end plate activity produced by presynaptic polarization. The Journal of physiology. 1954;124(3):586 604. Epub 1954/06/28. PubMed PMID: 13175201; PMCID: PMC1366294. 6. Miledi R, Molinoff P, Potter LT. Isolation of the choline rgic receptor protein of Torpedo electric tissue. Nature. 1971;229(5286):554 7. Epub 1971/02/19. PubMed PMID: 4925349. 7. Ballivet M, Patrick J, Lee J, Heinemann S. Molecular cloning of cDNA coding for the gamma subunit of Torpedo acetylcholine receptor. P roc Natl Acad Sci U S A. 1982;79:4466 70. 8. Changeux JP, Kasai M, Lee CY. Use of a snake venom toxin to characterize the cholinergic receptor protein. Proc Natl Acad Sci U S A. 1970;67(3):1241 7. Epub 1970/11/01. PubMed PMID: 5274453; PMCID: PMC283343. 9. Levin ED. Nicotinic systems and cognitive function. Psychopharmacology (Berl). 1992;108(4):417 31. Epub 1992/01/01. PubMed PMID: 1357713. 10. Morielli AD, Matera EM, Kovac MP, Shrum RG, McCormack KJ, Davis WJ. Cholinergic suppression: a postsynaptic mecha nism of long term associative learning. Proc Natl Acad Sci U S A. 1986;83(12):4556 60. Epub 1986/06/01. PubMed PMID: 3459190; PMCID: PMC323773. 11. Picciotto MR. Nicotine as a modulator of behavior: beyond the inverted U. Trends Pharmacol Sci. 2003;24(9):4 93 9. Epub 2003/09/12. doi: 10.1016/s0165 6147(03)00230 x. PubMed PMID: 12967775.

PAGE 167

167 12. Nashmi R, Lester HA. CNS localization of neuronal nicotinic receptors. J Mol Neurosci. 2006;30(1 2):181 4. Epub 2006/12/29. doi: 10.1385/jmn:30:1:181. PubMed PMID: 171926 71. 13. Cooper E, Couturier S, Ballivet M. Pentameric structure and subunit stoichiometry of a neuronal nicotinic acetylcholine receptor. Nature. 1991;350(6315):235 8. Epub 1991/03/21. doi: 10.1038/350235a0. PubMed PMID: 2005979. 14. Sakarya O, Armstrong K A, Adamska M, Adamski M, Wang IF, Tidor B, Degnan BM, Oakley TH, Kosik KS. A post synaptic scaffold at the origin of the animal kingdom. PLoS One. 2007;2(6):e506. Epub 2007/06/07. doi: 10.1371/journal.pone.0000506. PubMed PMID: 17551586; PMCID: PMC1876816. 15. Wessler I, Kirkpatrick CJ, Racke K. The cholinergic 'pitfall': acetylcholine, a universal cell molecule in biological systems, including humans. Clin Exp Pharmacol Physiol. 1999;26(3):198 205. Epub 1999/03/19. PubMed PMID: 10081614. 16. Papke RL. Merg ing old and new perspectives on nicotinic acetylcholine receptors. Biochem Pharmacol. 2014;89(1):1 11. Epub 2014/02/04. doi: 10.1016/j.bcp.2014.01.029. PubMed PMID: 24486571. 17. Stokes C, Treinin M, Papke RL. Looking below the surface of nicotinic acetylc holine receptors. Trends Pharmacol Sci. 2015;36(8):514 23. Epub 2015/06/13. doi: 10.1016/j.tips.2015.05.002. PubMed PMID: 26067101; PMCID: PMC4532579. 18. Brejc K, van Dijk WJ, Klaassen RV, Schuurmans M, van Der Oost J, Smit AB, Sixma TK. Crystal structure of an ACh binding protein reveals the ligand binding domain of nicotinic receptors. Nature. 2001;411(6835):269 76. Epub 2001/05/18. doi: 10.1038/35077011. PubMed PMID: 11357122. 19. Unwin N. Refined structure of the nicotinic acetylcholine receptor at 4A resolution. J Mol Biol. 2005;346(4):967 89. Epub 2005/02/11. doi: 10.1016/j.jmb.2004.12.031. PubMed PMID: 15701510. 20. Colquhoun D, Sakmann B. Fluctuations in the microsecond time range of the current through single acetylcholine receptor ion channels. Na ture. 1981;294(5840):464 6. Epub 1981/12/03. PubMed PMID: 6273743. 21. Li SX, Huang S, Bren N, Noridomi K, Dellisanti CD, Sine SM, Chen L. Ligand binding domain of an alpha7 nicotinic receptor chimera and its complex with agonist. Nature neuroscience. 2011 ;14(10):1253 9. Epub 2011/09/13. doi: 10.1038/nn.2908. PubMed PMID: 21909087; PMCID: PMC3489043.

PAGE 168

168 22. Kukhtina V, Kottwitz D, Strauss H, Heise B, Chebotareva N, Tsetlin V, Hucho F. Intracellular domain of nicotinic acetylcholine receptor: the importance of being unfolded. J Neurochem. 2006;97 Suppl 1:63 7. Epub 2006/04/26. doi: 10.1111/j.1471 4159.2005.03468.x. PubMed PMID: 16635251. 23. Janin J, Sternberg MJ. Protein flexibility, not disorder, is intrinsic to molecular recognition. F1000 Biol Rep. 2013;5:2. Epub 2013/01/31. doi: 10.3410/b5 2. PubMed PMID: 23361309; PMCID: PMC3542771. 24. Kabbani N, Nordman JC, Corgiat BA, Veltri DP, Shehu A, Seymour VA, Adams DJ. Are nicotinic acetylcholine receptors coupled to G proteins? Bioessays. 2013;35(12):1025 34. Epu b 2013/11/05. doi: 10.1002/bies.201300082. PubMed PMID: 24185813. 25. Charpantier E, Wiesner A, Huh KH, Ogier R, Hoda JC, Allaman G, Raggenbass M, Feuerbach D, Bertrand D, Fuhrer C. Alpha7 neuronal nicotinic acetylcholine receptors are negatively regulated by tyrosine phosphorylation and Src family kinases. J Neurosci. 2005;25(43):9836 49. Epub 2005/10/28. doi: 10.1523/jneurosci.3497 05.2005. PubMed PMID: 16251431. 26. Swope SL, Huganir RL. Molecular cloning of two abundant protein tyrosine kinases in Torpe do electric organ that associate with the acetylcholine receptor. J Biol Chem. 1993;268(33):25152 61. Epub 1993/11/25. PubMed PMID: 8227079. 27. Swope SL, Qu Z, Huganir RL. Phosphorylation of the nicotinic acetylcholine receptor by protein tyrosine kinases . Ann N Y Acad Sci. 1995;757:197 214. Epub 1995/05/10. PubMed PMID: 7541972. 28. Villiger Y, Szanto I, Jaconi S, Blanchet C, Buisson B, Krause KH, Bertrand D, Romand JA. Expression of an alpha7 duplicate nicotinic acetylcholine receptor related protein in human leukocytes. J Neuroimmunol. 2002;126(1 2):86 98. Epub 2002/05/22. PubMed PMID: 12020960. 29. Carlisle DL, Hopkins TM, Gaither Davis A, Silhanek MJ, Luketich JD, Christie NA, Siegfried JM. Nicotine signals through muscle type and neuronal nicotinic ac etylcholine receptors in both human bronchial epithelial cells and airway fibroblasts. Respir Res. 2004;5:27. Epub 2004/12/14. doi: 10.1186/1465 9921 5 27. PubMed PMID: 15588326; PMCID: PMC544394. 30. Conti Fine BM, Navaneetham D, Lei S, Maus AD. Neuronal nicotinic receptors in non neuronal cells: new mediators of tobacco toxicity? Eur J Pharmacol. 2000;393(1 3):279 94. Epub 2000/04/20. PubMed PMID: 10771024.

PAGE 169

169 31. Lam DC, Girard L, Ramirez R, Chau WS, Suen WS, Sheridan S, Tin VP, Chung LP, Wong MP, Shay J W, Gazdar AF, Lam WK, Minna JD. Expression of nicotinic acetylcholine receptor subunit genes in non small cell lung cancer reveals differences between smokers and nonsmokers. Cancer Res. 2007;67(10):4638 47. Epub 2007/05/19. doi: 10.1158/0008 5472.can 06 4 628. PubMed PMID: 17510389. 32. Sekhon HS, Jia Y, Raab R, Kuryatov A, Pankow JF, Whitsett JA, Lindstrom J, Spindel ER. Prenatal nicotine increases pulmonary alpha7 nicotinic receptor expression and alters fetal lung development in monkeys. J Clin Invest. 1 999;103(5):637 47. Epub 1999/03/13. doi: 10.1172/jci5232. PubMed PMID: 10074480; PMCID: PMC408124. 33. Sekhon HS, Proskocil BJ, Clark JA, Spindel ER. Prenatal nicotine exposure increases connective tissue expression in foetal monkey pulmonary vessels. Eur Respir J. 2004;23(6):906 15. Epub 2004/06/29. PubMed PMID: 15219006. 34. Zia S, Ndoye A, Nguyen VT, Grando SA. Nicotine enhances expression of the alpha 3, alpha 4, alpha 5, and alpha 7 nicotinic receptors modulating calcium metabolism and regulating adhes ion and motility of respiratory epithelial cells. Res Commun Mol Pathol Pharmacol. 1997;97(3):243 62. Epub 1997/12/05. PubMed PMID: 9387186. 35. Dvorakova M, Lips KS, Bruggmann D, Slavikova J, Kuncova J, Kummer W. Developmental changes in the expression of nicotinic acetylcholine receptor alpha subunits in the rat heart. Cell Tissue Res. 2005;319(2):201 9. Epub 2004/11/19. doi: 10.1007/s00441 004 1008 1. PubMed PMID: 15549397. 36. Heeschen C, Weis M, Aicher A, Dimmeler S, Cooke JP. A novel angiogenic pathwa y mediated by non neuronal nicotinic acetylcholine receptors. J Clin Invest. 2002;110(4):527 36. Epub 2002/08/22. doi: 10.1172/jci14676. PubMed PMID: 12189247; PMCID: PMC150415. 37. Wu JC, Chruscinski A, De Jesus Perez VA, Singh H, Pitsiouni M, Rabinovitch M, Utz PJ, Cooke JP. Cholinergic modulation of angiogenesis: role of the 7 nicotinic acetylcholine receptor. J Cell Biochem. 2009;108(2):433 46. Epub 2009/07/23. doi: 10.1002/jcb.22270. PubMed PMID: 19623583; PMCID: PMC3140170. 38. Arredondo J, Chernyavsk y AI, Jolkovsky DL, Webber RJ, Grando SA. SLURP 2: A novel cholinergic signaling peptide in human mucocutaneous epithelium. J Cell Physiol. 2006;208(1):238 45. Epub 2006/04/01. doi: 10.1002/jcp.20661. PubMed PMID: 16575903. 39. Arredondo J, Nguyen VT, Cher nyavsky AI, Bercovich D, Orr Urtreger A, Kummer W, Lips K, Vetter DE, Grando SA. Central role of alpha7 nicotinic receptor in differentiation of the stratified squamous epithelium. J Cell Biol. 2002;159(2):325 36. Epub 2002/10/23. doi: 10.1083/jcb.20020609 6. PubMed PMID: 12391028; PMCID: PMC2173052.

PAGE 170

170 40. Bowers JW, Schlauder SM, Calder KB, Morgan MB. Acetylcholine receptor expression in Merkel cell carcinoma. Am J Dermatopathol. 2008;30(4):340 3. Epub 2008/07/23. doi: 10.1097/DAD.0b013e31816797e4. PubMed PMI D: 18645305. 41. Chernyavsky AI, Arredondo J, Marubio LM, Grando SA. Differential regulation of keratinocyte chemokinesis and chemotaxis through distinct nicotinic receptor subtypes. J Cell Sci. 2004;117(Pt 23):5665 79. Epub 2004/10/21. doi: 10.1242/jcs.01 492. PubMed PMID: 15494367. 42. Hagforsen E. The cutaneous non neuronal cholinergic system and smoking related dermatoses: studies of the psoriasis variant palmoplantar pustulosis. Life Sci. 2007;80(24 25):2227 34. Epub 2007/03/08. doi: 10.1016/j.lfs.2007. 01.045. PubMed PMID: 17341425. 43. Nguyen VT, Hall LL, Gallacher G, Ndoye A, Jolkovsky DL, Webber RJ, Buchli R, Grando SA. Choline acetyltransferase, acetylcholinesterase, and nicotinic acetylcholine receptors of human gingival and esophageal epithelia. J Dent Res. 2000;79(4):939 49. Epub 2000/06/01. PubMed PMID: 10831096. 44. Zia S, Ndoye A, Lee TX, Webber RJ, Grando SA. Receptor mediated inhibition of keratinocyte migration by nicotine involves modulations of calcium influx and intracellular concentration . J Pharmacol Exp Ther. 2000;293(3):973 81. Epub 2000/06/28. PubMed PMID: 10869400. 45. Al Wadei MH, Al Wadei HA, Schuller HM. Pancreatic cancer cells and normal pancreatic duct epithelial cells express an autocrine catecholamine loop that is activated by nicotinic acetylcholine receptors alpha3, alpha5, and alpha7. Mol Cancer Res. 2012;10(2):239 49. Epub 2011/12/23. doi: 10.1158/1541 7786.mcr 11 0332. PubMed PMID: 22188668; PMCID: PMC3340883. 46. Kirchgessner AL, Liu MT. Immunohistochemical localization of nicotinic acetylcholine receptors in the guinea pig bowel and pancreas. J Comp Neurol. 1998;390(4):497 514. Epub 1998/02/05. PubMed PMID: 9450532. 47. Matteoli G, Boeckxstaens GE. The vagal innervation of the gut and immune homeostasis. Gut. 2013;62(8):12 14 22. Epub 2012/10/02. doi: 10.1136/gutjnl 2012 302550. PubMed PMID: 23023166; PMCID: PMC3711371. 48. Nemethova A, Michel K, Gomez Pinilla PJ, Boeckxstaens GE, Schemann M. Nicotine attenuates activation of tissue resident macrophages in the mouse stomach through the beta2 nicotinic acetylcholine receptor. PLoS One. 2013;8(11):e79264. Epub 2013/11/14. doi: 10.1371/journal.pone.0079264. PubMed PMID: 24223920; PMCID: PMC3815157.

PAGE 171

171 49. Nguyen VT, Ndoye A, Grando SA. Novel human alpha9 acetylcholine receptor reg ulating keratinocyte adhesion is targeted by Pemphigus vulgaris autoimmunity. Am J Pathol. 2000;157(4):1377 91. Epub 2000/10/06. PubMed PMID: 11021840; PMCID: PMC1850172. 50. Pettersson A, Nilsson L, Nylund G, Khorram Manesh A, Nordgren S, Delbro DS. Is ac etylcholine an autocrine/paracrine growth factor via the nicotinic alpha7 receptor subtype in the human colon cancer cell line HT 29? Eur J Pharmacol. 2009;609(1 3):27 33. Epub 2009/03/17. doi: 10.1016/j.ejphar.2009.03.002. PubMed PMID: 19285065. 51. Becke l JM, Birder LA. Differential expression and function of nicotinic acetylcholine receptors in the urinary bladder epithelium of the rat. The Journal of physiology. 2012;590(Pt 6):1465 80. Epub 2012/01/18. doi: 10.1113/jphysiol.2011.226860. PubMed PMID: 222 50215; PMCID: PMC3382334. 52. Bschleipfer T, Schukowski K, Weidner W, Grando SA, Schwantes U, Kummer W, Lips KS. Expression and distribution of cholinergic receptors in the human urothelium. Life Sci. 2007;80(24 25):2303 7. Epub 2007/03/06. doi: 10.1016/j. lfs.2007.01.053. PubMed PMID: 17335853. 53. Chatterjee PK, Yeboah MM, Dowling O, Xue X, Powell SR, Al Abed Y, Metz CN. Nicotinic acetylcholine receptor agonists attenuate septic acute kidney injury in mice by suppressing inflammation and proteasome activit y. PLoS One. 2012;7(5):e35361. Epub 2012/05/16. doi: 10.1371/journal.pone.0035361. PubMed PMID: 22586448; PMCID: PMC3346807. 54. Jaimes EA, Tian RX, Raij L. Nicotine: the link between cigarette smoking and the progression of renal injury? Am J Physiol Hear t Circ Physiol. 2007;292(1):H76 82. Epub 2006/08/22. doi: 10.1152/ajpheart.00693.2006. PubMed PMID: 16920799. 55. Jain G, Jaimes EA. Nicotine signaling and progression of chronic kidney disease in smokers. Biochem Pharmacol. 2013;86(8):1215 23. Epub 2013/0 7/31. doi: 10.1016/j.bcp.2013.07.014. PubMed PMID: 23892062; PMCID: PMC3838879. 56. Yeboah MM, Xue X, Duan B, Ochani M, Tracey KJ, Susin M, Metz CN. Cholinergic agonists attenuate renal ischemia reperfusion injury in rats. Kidney Int. 2008;74(1):62 9. Epub 2008/04/11. doi: 10.1038/ki.2008.94. PubMed PMID: 18401335; PMCID: PMC2667336. 57. Zarghooni S, Wunsch J, Bodenbenner M, Bruggmann D, Grando SA, Schwantes U, Wess J, Kummer W, Lips KS. Expression of muscarinic and nicotinic acetylcholine receptors in the mouse urothelium. Life Sci. 2007;80(24 25):2308 13. Epub 2007/03/06. doi: 10.1016/j.lfs.2007.01.046. PubMed PMID: 17337281.

PAGE 172

172 58. Bray C, Son JH, Kumar P, Meizel S. Mice deficient in CHRNA7, a subunit of the nicotinic acetylcholine receptor, produce sperm wi th impaired motility. Biol Reprod. 2005;73(4):807 14. Epub 2005/06/10. doi: 10.1095/biolreprod.105.042184. PubMed PMID: 15944242. 59. Calleja Macias IE, Kalantari M, Bernard HU. Cholinergic signaling through nicotinic acetylcholine receptors stimulates the proliferation of cervical cancer cells: an explanation for the molecular role of tobacco smoking in cervical carcinogenesis? Int J Cancer. 2009;124(5):1090 6. Epub 2008/12/03. doi: 10.1002/ijc.24053. PubMed PMID: 19048619. 60. Jaldety Y, Glick Y, Orr Urtr eger A, Ickowicz D, Gerber D, Breitbart H. Sperm epidermal growth factor receptor (EGFR) mediates alpha7 acetylcholine receptor (AChR) activation to promote fertilization. J Biol Chem. 2012;287(26):22328 40. Epub 2012/05/12. doi: 10.1074/jbc.M111.292292. P ubMed PMID: 22577141; PMCID: PMC3381193. 61. Kumar P, Meizel S. Nicotinic acetylcholine receptor subunits and associated proteins in human sperm. J Biol Chem. 2005;280(27):25928 35. Epub 2005/05/17. doi: 10.1074/jbc.M502435200. PubMed PMID: 15894803. 62. S chirmer SU, Eckhardt I, Lau H, Klein J, DeGraaf YC, Lips KS, Pineau C, Gibbins IL, Kummer W, Meinhardt A, Haberberger RV. The cholinergic system in rat testis is of non neuronal origin. Reproduction. 2011;142(1):157 66. Epub 2011/04/13. doi: 10.1530/rep 10 0302. PubMed PMID: 21482687. 63. Wolff M, Noreikat K, Ibanez Tallon I, Lips KS, Kolle S, Kummer W. Cholinergic receptors in the murine oviduct: inventory and coupling to intracellular calcium concentration. Life Sci. 2012;91(21 22):1003 8. Epub 2012/04/07 . doi: 10.1016/j.lfs.2012.03.016. PubMed PMID: 22480510. 64. Bajayo A, Bar A, Denes A, Bachar M, Kram V, Attar Namdar M, Zallone A, Kovacs KJ, Yirmiya R, Bab I. Skeletal parasympathetic innervation communicates central IL 1 signals regulating bone mass acc rual. Proc Natl Acad Sci U S A. 2012;109(38):15455 60. Epub 2012/09/06. doi: 10.1073/pnas.1206061109. PubMed PMID: 22949675; PMCID: PMC3458367. 65. En Nosse M, Hartmann S, Trinkaus K, Alt V, Stigler B, Heiss C, Kilian O, Schnettler R, Lips KS. Expression o f non neuronal cholinergic system in osteoblast like cells and its involvement in osteogenesis. Cell Tissue Res. 2009;338(2):203 15. Epub 2009/10/13. doi: 10.1007/s00441 009 0871 1. PubMed PMID: 19820967. 66. Forsgren S. Presence of ChAT mRNA and a very ma rked alpha7nAChR immunoreaction in the synovial lining layer of the knee joint. Life Sci. 2012;91(21 22):1043 7. Epub 2012/04/10. doi: 10.1016/j.lfs.2012.03.028. PubMed PMID: 22483691.

PAGE 173

173 67. Ma Y, Li X, Fu J, Li Y, Gao L, Yang L, Zhang P, Shen J, Wang H. Ace tylcholine affects osteocytic MLO Y4 cells via acetylcholine receptors. Mol Cell Endocrinol. 2014;384(1 2):155 64. Epub 2014/02/11. doi: 10.1016/j.mce.2014.01.021. PubMed PMID: 24508663. 68. Romano SJ, Corriveau RA, Schwarz RI, Berg DK. Expression of the n icotinic receptor alpha 7 gene in tendon and periosteum during early development. J Neurochem. 1997;68(2):640 8. Epub 1997/02/01. PubMed PMID: 9003051. 69. Sato T, Abe T, Chida D, Nakamoto N, Hori N, Kokabu S, Sakata Y, Tomaru Y, Iwata T, Usui M, Aiko K, Y oda T. Functional role of acetylcholine and the expression of cholinergic receptors and components in osteoblasts. FEBS Lett. 2010;584(4):817 24. Epub 2010/01/14. doi: 10.1016/j.febslet.2010.01.001. PubMed PMID: 20067796. 70. Schubert J, Beckmann J, Hartma nn S, Morhenn HG, Szalay G, Heiss C, Schnettler R, Lips KS. Expression of the non neuronal cholinergic system in human knee synovial tissue from patients with rheumatoid arthritis and osteoarthritis. Life Sci. 2012;91(21 22):1048 52. Epub 2012/05/10. doi: 10.1016/j.lfs.2012.04.032. PubMed PMID: 22569293. 71. Wu LZ, Duan DM, Liu YF, Ge X, Zhou ZF, Wang XJ. Nicotine favors osteoclastogenesis in human periodontal ligament cells co cultured with CD4(+) T cells by upregulating IL 1beta. Int J Mol Med. 2013;31(4) :938 42. Epub 2013/02/28. doi: 10.3892/ijmm.2013.1259. PubMed PMID: 23443505. 72. Battaglioli E, Gotti C, Terzano S, Flora A, Clementi F, Fornasari D. Expression and transcriptional regulation of the human alpha3 neuronal nicotinic receptor subunit in T ly mphocyte cell lines. J Neurochem. 1998;71(3):1261 70. Epub 1998/08/29. PubMed PMID: 9721752. 73. Blanchet MR, Langlois A, Israel Assayag E, Beaulieu MJ, Ferland C, Laviolette M, Cormier Y. Modulation of eosinophil activation in vitro by a nicotinic recepto r agonist. J Leukoc Biol. 2007;81(5):1245 51. Epub 2007/02/10. doi: 10.1189/jlb.0906548. PubMed PMID: 17289799. 74. Kawashima K, Yoshikawa K, Fujii YX, Moriwaki Y, Misawa H. Expression and function of genes encoding cholinergic components in murine immune cells. Life Sci. 2007;80(24 25):2314 9. Epub 2007/03/27. doi: 10.1016/j.lfs.2007.02.036. PubMed PMID: 17383684. 75. Peng H, Ferris RL, Matthews T, Hiel H, Lopez Albaitero A, Lustig LR. Characterization of the human nicotinic acetylcholine receptor subunit alpha 9 (CHRNA9) and alpha 10 (CHRNA10) in lymphocytes. Life Sci. 2004;76(3):263 80. Epub 2004/11/09. doi: 10.1016/j.lfs.2004.05.031. PubMed PMID: 15531379.

PAGE 174

174 76. Sato KZ, Fujii T, Watanabe Y, Yamada S, Ando T, Kazuko F, Kawashima K. Diversity of mRNA expre ssion for muscarinic acetylcholine receptor subtypes and neuronal nicotinic acetylcholine receptor subunits in human mononuclear leukocytes and leukemic cell lines. Neurosci Lett. 1999;266(1):17 20. Epub 1999/05/21. PubMed PMID: 10336173. 77. Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, Li JH, Wang H, Yang H, Ulloa L, Al Abed Y, Czura CJ, Tracey KJ. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature. 2003;421(6921):384 8. Epub 2003/01/01. doi: 10.10 38/nature01339. PubMed PMID: 12508119. 78. Perez Alvarez A, Hernandez Vivanco A, McIntosh JM, Albillos A. Native alpha6beta4* nicotinic receptors control exocytosis in human chromaffin cells of the adrenal gland. FASEB J. 2012;26(1):346 54. Epub 2011/09/16 . doi: 10.1096/fj.11 190223. PubMed PMID: 21917987; PMCID: PMC3250250. 79. Sala F, Nistri A, Criado M. Nicotinic acetylcholine receptors of adrenal chromaffin cells. Acta Physiol (Oxf). 2008;192(2):203 12. Epub 2007/11/17. doi: 10.1111/j.1748 1716.2007.018 04.x. PubMed PMID: 18005395. 80. Yoshikawa H, Hellstrom Lindahl E, Grill V. Evidence for functional nicotinic receptors on pancreatic beta cells. Metabolism. 2005;54(2):247 54. Epub 2005/02/04. doi: 10.1016/j.metabol.2004.08.020. PubMed PMID: 15690320. 81. West KA, Brognard J, Clark AS, Linnoila IR, Yang X, Swain SM, Harris C, Belinsky S, Dennis PA. Rapid Akt activation by nicotine and a tobacco carcinogen modulates the phenotype of normal human airway epithelial cells. J Clin Invest. 2003;111(1):81 90. Epu b 2003/01/04. doi: 10.1172/jci16147. PubMed PMID: 12511591; PMCID: PMC151834. 82. Tsurutani J, Castillo SS, Brognard J, Granville CA, Zhang C, Gills JJ, Sayyah J, Dennis PA. Tobacco components stimulate Akt dependent proliferation and NFkappaB dependent su rvival in lung cancer cells. Carcinogenesis. 2005;26(7):1182 95. Epub 2005/03/26. doi: 10.1093/carcin/bgi072. PubMed PMID: 15790591. 83. Fu XW, Wood K, Spindel ER. Prenatal nicotine exposure increases GABA signaling and mucin expression in airway epitheliu m. Am J Respir Cell Mol Biol. 2011;44(2):222 9. Epub 2010/05/08. doi: 10.1165/rcmb.2010 0109OC. PubMed PMID: 20448051; PMCID: PMC3049233. 84. Wongtrakool C, Wang N, Hyde DM, Roman J, Spindel ER. Prenatal nicotine exposure alters lung function and airway ge ometry through alpha7 nicotinic receptors. Am J Respir Cell Mol Biol. 2012;46(5):695 702. Epub 2012/01/17. doi: 10.1165/rcmb.2011 0028OC. PubMed PMID: 22246862; PMCID: PMC3359906.

PAGE 175

175 85. Arias HR, Richards VE, Ng D, Ghafoori ME, Le V, Mousa SA. Role of non ne uronal nicotinic acetylcholine receptors in angiogenesis. Int J Biochem Cell Biol. 2009;41(7):1441 51. Epub 2009/04/30. doi: 10.1016/j.biocel.2009.01.013. PubMed PMID: 19401144. 86. Dasgupta P, Rastogi S, Pillai S, Ordonez Ercan D, Morris M, Haura E, Chell appan S. Nicotine induces cell proliferation by beta arrestin mediated activation of Src and Rb Raf 1 pathways. J Clin Invest. 2006;116(8):2208 17. Epub 2006/07/25. doi: 10.1172/jci28164. PubMed PMID: 16862215; PMCID: PMC1513051. 87. Dasgupta P, Rizwani W, Pillai S, Kinkade R, Kovacs M, Rastogi S, Banerjee S, Carless M, Kim E, Coppola D, Haura E, Chellappan S. Nicotine induces cell proliferation, invasion and epithelial mesenchymal transition in a variety of human cancer cell lines. Int J Cancer. 2009;124(1 ):36 45. Epub 2008/10/11. doi: 10.1002/ijc.23894. PubMed PMID: 18844224; PMCID: PMC2826200. 88. Heeschen C, Jang JJ, Weis M, Pathak A, Kaji S, Hu RS, Tsao PS, Johnson FL, Cooke JP. Nicotine stimulates angiogenesis and promotes tumor growth and atherosclero sis. Nat Med. 2001;7(7):833 9. Epub 2001/07/04. doi: 10.1038/89961. PubMed PMID: 11433349. 89. Li XW, Wang H. Non neuronal nicotinic alpha 7 receptor, a new endothelial target for revascularization. Life Sci. 2006;78(16):1863 70. Epub 2005/11/11. doi: 10.1 016/j.lfs.2005.08.031. PubMed PMID: 16280133. 90. Villablanca AC. Nicotine stimulates DNA synthesis and proliferation in vascular endothelial cells in vitro. J Appl Physiol (1985). 1998;84(6):2089 98. Epub 1998/06/11. PubMed PMID: 9609804. 91. Arredondo J, Chernyavsky AI, Marubio LM, Beaudet AL, Jolkovsky DL, Pinkerton KE, Grando SA. Receptor mediated tobacco toxicity: regulation of gene expression through alpha3beta2 nicotinic receptor in oral epithelial cells. Am J Pathol. 2005;166(2):597 613. Epub 2005/0 2/01. PubMed PMID: 15681842; PMCID: PMC1602318. 92. Arredondo J, Chernyavsky AI, Jolkovsky DL, Pinkerton KE, Grando SA. Receptor mediated tobacco toxicity: alterations of the NF kappaB expression and activity downstream of alpha7 nicotinic receptor in oral keratinocytes. Life Sci. 2007;80(24 25):2191 4. Epub 2007/02/13. doi: 10.1016/j.lfs.2007.01.013. PubMed PMID: 17291542; PMCID: PMC1973165. 93. Arredondo J, Chernyavsky AI, Jolkovsky DL, Pinkerton KE, Grando SA. Receptor mediated tobacco toxicity: cooperat ion of the Ras/Raf 1/MEK1/ERK and JAK 2/STAT 3 pathways downstream of alpha7 nicotinic receptor in oral keratinocytes. FASEB J. 2006;20(12):2093 101. Epub 2006/10/03. doi: 10.1096/fj.06 6191com. PubMed PMID: 17012261.

PAGE 176

176 94. Arredondo J, Chernyavsky AI, Grand o SA. Nicotinic receptors mediate tumorigenic action of tobacco derived nitrosamines on immortalized oral epithelial cells. Cancer Biol Ther. 2006;5(5):511 7. Epub 2006/04/04. PubMed PMID: 16582591. 95. Chernyavsky AI, Marchenko S, Phillips C, Grando SA. A uto/paracrine nicotinergic peptides participate in cutaneous stress response to wounding. Dermatoendocrinol. 2012;4(3):324 30. Epub 2013/03/08. doi: 10.4161/derm.22594. PubMed PMID: 23467535; PMCID: PMC3583894. 96. Grando SA, Pittelkow MR, Schallreuter KU. Adrenergic and cholinergic control in the biology of epidermis: physiological and clinical significance. J Invest Dermatol. 2006;126(9):1948 65. Epub 2006/08/17. doi: 10.1038/sj.jid.5700151. PubMed PMID: 16912692. 97. Xu W, Gelber S, Orr Urtreger A, Armst rong D, Lewis RA, Ou CN, Patrick J, Role L, De Biasi M, Beaudet AL. Megacystis, mydriasis, and ion channel defect in mice lacking the alpha3 neuronal nicotinic acetylcholine receptor. Proc Natl Acad Sci U S A. 1999;96(10):5746 51. Epub 1999/05/13. PubMed P MID: 10318955; PMCID: PMC21931. 98. Cucina A, Dinicola S, Coluccia P, Proietti S, D'Anselmi F, Pasqualato A, Bizzarri M. Nicotine stimulates proliferation and inhibits apoptosis in colon cancer cell lines through activation of survival pathways. J Surg Res . 2012;178(1):233 41. Epub 2012/04/24. doi: 10.1016/j.jss.2011.12.029. PubMed PMID: 22520577. 99. Li LF, Chan RL, Lu L, Shen J, Zhang L, Wu WK, Wang L, Hu T, Li MX, Cho CH. Cigarette smoking and gastrointestinal diseases: the causal relationship and underl ying molecular mechanisms (review). Int J Mol Med. 2014;34(2):372 80. Epub 2014/05/27. doi: 10.3892/ijmm.2014.1786. PubMed PMID: 24859303. 100. Beckel JM, Kanai A, Lee SJ, de Groat WC, Birder LA. Expression of functional nicotinic acetylcholine receptors i n rat urinary bladder epithelial cells. Am J Physiol Renal Physiol. 2006;290(1):F103 10. Epub 2005/09/08. doi: 10.1152/ajprenal.00098.2005. PubMed PMID: 16144967; PMCID: PMC2760261. 101. Rezonzew G, Chumley P, Feng W, Hua P, Siegal GP, Jaimes EA. Nicotine exposure and the progression of chronic kidney disease: role of the alpha7 nicotinic acetylcholine receptor. Am J Physiol Renal Physiol. 2012;303(2):F304 12. Epub 2012/05/04. doi: 10.1152/ajprenal.00661.2011. PubMed PMID: 22552933; PMCID: PMC3404588. 102. Dodmane PR, Arnold LL, Pennington KL, Cohen SM. Orally administered nicotine induces urothelial hyperplasia in rats and mice. Toxicology. 2014;315:49 54. Epub 2013/11/26. doi: 10.1016/j.tox.2013.11.002. PubMed PMID: 24269753.

PAGE 177

177 103. Nelson L. alpha bungaroto xin binding by cell membranes. Blockage of sperm cell motility. Exp Cell Res. 1976;101(2):221 4. Epub 1976/09/01. PubMed PMID: 986947. 104. Meizel S, Son JH. Studies of sperm from mutant mice suggesting that two neurotransmitter receptors are important to the zona pellucida initiated acrosome reaction. Mol Reprod Dev. 2005;72(2):250 8. Epub 2005/06/11. doi: 10.1002/mrd.20336. PubMed PMID: 15948184. 105. Walker LM, Preston MR, Magnay JL, Thomas PB, El Haj AJ. Nicotinic regulation of c fos and osteopontin exp ression in human derived osteoblast like cells and human trabecular bone organ culture. Bone. 2001;28(6):603 8. Epub 2001/06/27. PubMed PMID: 11425648. 106. Yanagita M, Kashiwagi Y, Kobayashi R, Tomoeda M, Shimabukuro Y, Murakami S. Nicotine inhibits miner alization of human dental pulp cells. J Endod. 2008;34(9):1061 5. Epub 2008/08/23. doi: 10.1016/j.joen.2008.06.005. PubMed PMID: 18718366. 107. Paic F, Igwe JC, Nori R, Kronenberg MS, Franceschetti T, Harrington P, Kuo L, Shin DG, Rowe DW, Harris SE, Kalaj zic I. Identification of differentially expressed genes between osteoblasts and osteocytes. Bone. 2009;45(4):682 92. Epub 2009/06/23. doi: 10.1016/j.bone.2009.06.010. PubMed PMID: 19539797; PMCID: PMC2731004. 108. Rothem DE, Rothem L, Dahan A, Eliakim R, S oudry M. Nicotinic modulation of gene expression in osteoblast cells, MG 63. Bone. 2011;48(4):903 9. Epub 2010/12/21. doi: 10.1016/j.bone.2010.12.007. PubMed PMID: 21168537. 109. Wang H, Liao H, Ochani M, Justiniani M, Lin X, Yang L, Al Abed Y, Wang H, Met z C, Miller EJ, Tracey KJ, Ulloa L. Cholinergic agonists inhibit HMGB1 release and improve survival in experimental sepsis. Nat Med. 2004;10(11):1216 21. Epub 2004/10/27. doi: 10.1038/nm1124. PubMed PMID: 15502843. 110. Skok MV, Grailhe R, Agenes F, Change ux JP. The role of nicotinic receptors in B lymphocyte development and activation. Life Sci. 2007;80(24 25):2334 6. Epub 2007/03/17. doi: 10.1016/j.lfs.2007.02.005. PubMed PMID: 17363009. 111. Benfante R, Antonini RA, De Pizzol M, Gotti C, Clementi F, Loca ti M, Fornasari D. Expression of the alpha7 nAChR subunit duplicate form (CHRFAM7A) is down regulated in the monocytic cell line THP 1 on treatment with LPS. J Neuroimmunol. 2011;230(1 2):74 84. Epub 2010/10/12. doi: 10.1016/j.jneuroim.2010.09.008. PubMed PMID: 20926142.

PAGE 178

178 112. Gahring LC, Myers E, Palumbos S, Rogers SW. Nicotinic receptor Alpha7 expression during mouse adrenal gland development. PLoS One. 2014;9(8):e103861. Epub 2014/08/06. doi: 10.1371/journal.pone.0103861. PubMed PMID: 25093893; PMCID: PM C4122369. 113. Macklin KD, Maus AD, Pereira EF, Albuquerque EX, Conti Fine BM. Human vascular endothelial cells express functional nicotinic acetylcholine receptors. J Pharmacol Exp Ther. 1998;287(1):435 9. Epub 1998/10/09. PubMed PMID: 9765366. 114. Maus AD, Pereira EF, Karachunski PI, Horton RM, Navaneetham D, Macklin K, Cortes WS, Albuquerque EX, Conti Fine BM. Human and rodent bronchial epithelial cells express functional nicotinic acetylcholine receptors. Mol Pharmacol. 1998;54(5):779 88. Epub 1998/11/ 06. PubMed PMID: 9804613. 115. de Jonge WJ, van der Zanden EP, The FO, Bijlsma MF, van Westerloo DJ, Bennink RJ, Berthoud HR, Uematsu S, Akira S, van den Wijngaard RM, Boeckxstaens GE. Stimulation of the vagus nerve attenuates macrophage activation by acti vating the Jak2 STAT3 signaling pathway. Nat Immunol. 2005;6(8):844 51. Epub 2005/07/19. doi: 10.1038/ni1229. PubMed PMID: 16025117. 116. Kox M, van Velzen JF, Pompe JC, Hoedemaekers CW, van der Hoeven JG, Pickkers P. GTS 21 inhibits pro inflammatory cytok ine release independent of the Toll like receptor stimulated via a transcriptional mechanism involving JAK2 activation. Biochem Pharmacol. 2009;78(7):863 72. Epub 2009/07/07. doi: 10.1016/j.bcp.2009.06.096. PubMed PMID: 19576181. 117. Oloris SC, Frazer Abe l AA, Jubala CM, Fosmire SP, Helm KM, Robinson SR, Korpela DM, Duckett MM, Baksh S, Modiano JF. Nicotine mediated signals modulate cell death and survival of T lymphocytes. Toxicol Appl Pharmacol. 2010;242(3):299 309. Epub 2009/11/10. doi: 10.1016/j.taap.2 009.10.020. PubMed PMID: 19896492; PMCID: PMC2813922. 118. Kabbani N, Woll MP, Levenson R, Lindstrom JM, Changeux JP. Intracellular complexes of the beta2 subunit of the nicotinic acetylcholine receptor in brain identified by proteomics. Proc Natl Acad Sci U S A. 2007;104(51):20570 5. Epub 2007/12/14. doi: 10.1073/pnas.0710314104. PubMed PMID: 18077321; PMCID: PMC2154472. 119. Lee A, Fakler B, Kaczmarek LK, Isom LL. More than a pore: ion channel signaling complexes. J Neurosci. 2014;34(46):15159 69. Epub 20 14/11/14. doi: 10.1523/jneurosci.3275 14.2014. PubMed PMID: 25392484; PMCID: PMC4228125.

PAGE 179

179 120. Paulo JA, Brucker WJ, Hawrot E. Proteomic analysis of an alpha7 nicotinic acetylcholine receptor interactome. J Proteome Res. 2009;8(4):1849 58. Epub 2009/08/29. doi: 10.1021/pr800731z. PubMed PMID: 19714875; PMCID: PMC2891571. 121. Jones AK, Buckingham SD, Sattelle DB. Proteins interacting with nicotinic acetylcholine receptors: expanding functional and therapeutic horizons. Trends Pharmacol Sci. 2010;31(10):455 62. Epub 2010/08/03. doi: 10.1016/j.tips.2010.07.001. PubMed PMID: 20674046. 122. Papke RL, Porter Papke JK. Comparative pharmacology of rat and human alpha7 nAChR conducted with net charge analysis. Br J Pharmacol. 2002;137(1):49 61. Epub 2002/08/17. doi: 10.1038/sj.bjp.0704833. PubMed PMID: 12183330; PMCID: PMC1573461. 123. Uteshev VV. Evaluation of Ca2+ permeability of nicotinic acetylcholine receptors in hypothalamic histaminergic neurons. Acta biochimica et biophysica Sinica. 2010;42(1):8 20. Epub 2010 /01/01. PubMed PMID: 20043042; PMCID: PMC2796867. 124. Williams DK, Peng C, Kimbrell MR, Papke RL. Intrinsically low open probability of alpha7 nicotinic acetylcholine receptors can be overcome by positive allosteric modulation and serum factors leading to the generation of excitotoxic currents at physiological temperatures. Mol Pharmacol. 2012;82(4):746 59. Epub 2012/07/26. doi: 10.1124/mol.112.080317. PubMed PMID: 22828799; PMCID: PMC3463224. 125. Yu CR, Role LW. Functional contribution of the alpha7 subu nit to multiple subtypes of nicotinic receptors in embryonic chick sympathetic neurones. The Journal of physiology. 1998;509 ( Pt 3):651 65. Epub 1998/05/23. PubMed PMID: 9596789; PMCID: PMC2231006. 126. Zhao L, Kuo YP, George AA, Peng JH, Purandare MS, Sc hroeder KM, Lukas RJ, Wu J. Functional properties of homomeric, human alpha 7 nicotinic acetylcholine receptors heterologously expressed in the SH EP1 human epithelial cell line. J Pharmacol Exp Ther. 2003;305(3):1132 41. Epub 2003/03/11. doi: 10.1124/jpet .103.048777. PubMed PMID: 12626641. 127. de Jonge WJ, Ulloa L. The alpha7 nicotinic acetylcholine receptor as a pharmacological target for inflammation. Br J Pharmacol. 2007;151(7):915 29. Epub 2007/05/16. doi: 10.1038/sj.bjp.0707264. PubMed PMID: 17502850 ; PMCID: PMC2042938. 128. Rosas Ballina M, Tracey KJ. Cholinergic control of inflammation. J Intern Med. 2009;265(6):663 79. Epub 2009/06/06. doi: 10.1111/j.1365 2796.2009.02098.x. PubMed PMID: 19493060.

PAGE 180

180 129. Mascarucci P, Perego C, Terrazzino S, De Simoni MG. Glutamate release in the nucleus tractus solitarius induced by peripheral lipopolysaccharide and interleukin 1 beta. Neuroscience. 1998;86(4):1285 90. Epub 1998/08/11. PubMed PMID: 9697133. 130. Rosas Ballina M, Ochani M, Parrish WR, Ochani K, Harris YT, Huston JM, Chavan S, Tracey KJ. Splenic nerve is required for cholinergic antiinflammatory pathway control of TNF in endotoxemia. Proc Natl Acad Sci U S A. 2008;105(31):11008 13. Epub 2008/08/02. doi: 10.1073/pnas.0803237105. PubMed PMID: 18669662; PMC ID: PMC2504833. 131. Rosas Ballina M, Olofsson PS, Ochani M, Valdes Ferrer SI, Levine YA, Reardon C, Tusche MW, Pavlov VA, Andersson U, Chavan S, Mak TW, Tracey KJ. Acetylcholine synthesizing T cells relay neural signals in a vagus nerve circuit. Science. 2011;334(6052):98 101. Epub 2011/09/17. doi: 10.1126/science.1209985. PubMed PMID: 21921156. 132. Napetschnig J, Wu H. Molecular basis of NF kappaB signaling. Annual review of biophysics. 2013;42:443 68. Epub 2013/03/19. doi: 10.1146/annurev biophys 083012 130338. PubMed PMID: 23495970; PMCID: PMC3678348. 133. Han Y, Ling MT, Mao H, Zheng J, Liu M, Lam KT, Liu Y, Tu W, Lau YL. Influenza virus induced lung inflammation was modulated by cigarette smoke exposure in mice. PLoS One. 2014;9(1):e86166. Epub 2014/0 1/28. doi: 10.1371/journal.pone.0086166. PubMed PMID: 24465940; PMCID: PMC3897646. 134. Saeed RW, Varma S, Peng Nemeroff T, Sherry B, Balakhaneh D, Huston J, Tracey KJ, Al Abed Y, Metz CN. Cholinergic stimulation blocks endothelial cell activation and leuk ocyte recruitment during inflammation. J Exp Med. 2005;201(7):1113 23. Epub 2005/04/06. doi: 10.1084/jem.20040463. PubMed PMID: 15809354; PMCID: PMC2213139. 135. Wittebole X, Hahm S, Coyle SM, Kumar A, Calvano SE, Lowry SF. Nicotine exposure alters in vivo human responses to endotoxin. Clin Exp Immunol. 2007;147(1):28 34. Epub 2006/12/21. doi: 10.1111/j.1365 2249.2006.03248.x. PubMed PMID: 17177960; PMCID: PMC1810444. 136. Xiong J, Yuan YJ, Xue FS, Wang Q, Cheng Y, Li RP, Liao X, Liu JH. Postconditioning wi th alpha7nAChR agonist attenuates systemic inflammatory response to myocardial ischemia -reperfusion injury in rats. Inflammation. 2012;35(4):1357 64. Epub 2012/03/07. doi: 10.1007/s10753 012 9449 2. PubMed PMID: 22391744.

PAGE 181

181 137. Yamakawa K, Matsumoto N, I mamura Y, Muroya T, Yamada T, Nakagawa J, Shimazaki J, Ogura H, Kuwagata Y, Shimazu T. Electrical vagus nerve stimulation attenuates systemic inflammation and improves survival in a rat heatstroke model. PLoS One. 2013;8(2):e56728. Epub 2013/02/21. doi: 10 .1371/journal.pone.0056728. PubMed PMID: 23424673; PMCID: PMC3570456. 138. Zhao M, He X, Bi XY, Yu XJ, Gil Wier W, Zang WJ. Vagal stimulation triggers peripheral vascular protection through the cholinergic anti inflammatory pathway in a rat model of myocar dial ischemia/reperfusion. Basic Res Cardiol. 2013;108(3):345. Epub 2013/03/23. doi: 10.1007/s00395 013 0345 1. PubMed PMID: 23519622. 139. Clark RB, Lamppu D, Libertine L, McDonough A, Kumar A, LaRosa G, Rush R, Elbaum D. Discovery of novel 2 ((pyridin 3 yloxy)methyl)piperazines as alpha7 nicotinic acetylcholine receptor modulators for the treatment of inflammatory disorders. J Med Chem. 2014;57(10):3966 83. Epub 2014/05/13. doi: 10.1021/jm5004599. PubMed PMID: 24814197. 140. Freitas K, Ghosh S, Ivy Carrol l F, Lichtman AH, Imad Damaj M. Effects of alpha7 positive allosteric modulators in murine inflammatory and chronic neuropathic pain models. Neuropharmacology. 2013;65:156 64. Epub 2012/10/20. doi: 10.1016/j.neuropharm.2012.08.022. PubMed PMID: 23079470; P MCID: PMC3521074. 141. Papke RL, Bagdas D, Kulkarni AR, Gould T, AlSharari SD, Thakur GA, Damaj MI. The analgesic like properties of the alpha7 nAChR silent agonist NS6740 is associated with non conducting conformations of the receptor. Neuropharmacology. 2015;91:34 42. Epub 2014/12/17. doi: 10.1016/j.neuropharm.2014.12.002. PubMed PMID: 25497451; PMCID: PMC4312719. 142. Thomsen MS, Mikkelsen JD. The alpha7 nicotinic acetylcholine receptor ligands methyllycaconitine, NS6740 and GTS 21 reduce lipopolysacchar ide induced TNF alpha release from microglia. J Neuroimmunol. 2012;251(1 2):65 72. Epub 2012/08/14. doi: 10.1016/j.jneuroim.2012.07.006. PubMed PMID: 22884467. 143. Hayashi S, Hamada T, Zaidi SF, Oshiro M, Lee J, Yamamoto T, Ishii Y, Sasahara M, Kadowaki M . Nicotine suppresses acute colitis and colonic tumorigenesis associated with chronic colitis in mice. American journal of physiology Gastrointestinal and liver physiology. 2014;307(10):G968 78. Epub 2014/09/27. doi: 10.1152/ajpgi.00346.2013. PubMed PMID: 25258409.

PAGE 182

182 144. Snoek SA, Verstege MI, van der Zanden EP, Deeks N, Bulmer DC, Skynner M, Lee K, Te Velde AA, Boeckxstaens GE, de Jonge WJ. Selective alpha7 nicotinic acetylcholine receptor agonists worsen disease in experimental colitis. Br J Pharmacol. 2 010;160(2):322 33. Epub 2010/04/29. doi: 10.1111/j.1476 5381.2010.00699.x. PubMed PMID: 20423343; PMCID: PMC2874854. 145. Halevi S, McKay J, Palfreyman M, Yassin L, Eshel M, Jorgensen E, Treinin M. The C. elegans ric 3 gene is required for maturation of ni cotinic acetylcholine receptors. The EMBO journal. 2002;21(5):1012 20. Epub 2002/02/28. doi: 10.1093/emboj/21.5.1012. PubMed PMID: 11867529; PMCID: PMC125878. 146. Halevi S, Yassin L, Eshel M, Sala F, Sala S, Criado M, Treinin M. Conservation within the RI C 3 gene family. Effectors of mammalian nicotinic acetylcholine receptor expression. J Biol Chem. 2003;278(36):34411 7. doi: 10.1074/jbc.M300170200. PubMed PMID: 12821669. 147. Williams ME, Burton B, Urrutia A, Shcherbatko A, Chavez Noriega LE, Cohen CJ, A iyar J. Ric 3 promotes functional expression of the nicotinic acetylcholine receptor alpha7 subunit in mammalian cells. J Biol Chem. 2005;280(2):1257 63. Epub 2004/10/27. doi: 10.1074/jbc.M410039200. PubMed PMID: 15504725. 148. Dau A, Komal P, Truong M, Mo rris G, Evans G, Nashmi R. RIC 3 differentially modulates alpha4beta2 and alpha7 nicotinic receptor assembly, expression, and nicotine induced receptor upregulation. BMC neuroscience. 2013;14:47. Epub 2013/04/17. doi: 10.1186/1471 2202 14 47. PubMed PMID: 23586521; PMCID: PMC3637639. 149. Castillo M, Mulet J, Gutierrez LM, Ortiz JA, Castelan F, Gerber S, Sala S, Sala F, Criado M. Dual role of the RIC 3 protein in trafficking of serotonin and nicotinic acetylcholine receptors. J Biol Chem. 2005;280(29):27062 8. Epub 2005/06/02. doi: 10.1074/jbc.M503746200. PubMed PMID: 15927954. 150. Lansdell SJ, Gee VJ, Harkness PC, Doward AI, Baker ER, Gibb AJ, Millar NS. RIC 3 enhances functional expression of multiple nicotinic acetylcholine receptor subtypes in mammalian cells. Mol Pharmacol. 2005;68(5):1431 8. Epub 2005/08/27. doi: 10.1124/mol.105.017459. PubMed PMID: 16120769. 151. Ben David Y, Mizrachi T, Kagan S, Krisher T, Cohen E, Brenner T, Treinin M. RIC 3 expression and splicing regulate nAChR functional expressi on. Molecular brain. 2016;9(1):47. Epub 2016/05/01. doi: 10.1186/s13041 016 0231 5. PubMed PMID: 27129882; PMCID: PMC4850696. 152. Mulcahy MJ, Blattman SB, Barrantes FJ, Lukas RJ, Hawrot E. Resistance to Inhibitors of Cholinesterase 3 (Ric 3) Expression Pr omotes Selective Protein Associations with the Human alpha7 Nicotinic Acetylcholine Receptor Interactome. PLoS One. 2015;10(8):e0134409. Epub 2015/08/11. doi: 10.1371/journal.pone.0134409. PubMed PMID: 26258666; PMCID: PMC4530945.

PAGE 183

183 153. Gu S, Matta JA, Lord B, Harrington AW, Sutton SW, Davini WB, Bredt DS. Brain alpha7 Nicotinic Acetylcholine Receptor Assembly Requires NACHO. Neuron. 2016;89(5):948 55. Epub 2016/02/16. doi: 10.1016/j.neuron.2016.01.018. PubMed PMID: 26875622. 154. Costantini TW, Dang X, Coim bra R, Eliceiri BP, Baird A. CHRFAM7A, a human specific and partially duplicated alpha7 nicotinic acetylcholine receptor gene with the potential to specify a human specific inflammatory response to injury. J Leukoc Biol. 2015;97(2):247 57. Epub 2014/12/05. doi: 10.1189/jlb.4RU0814 381R. PubMed PMID: 25473097; PMCID: PMC4304420. 155. Costantini TW, Dang X, Yurchyshyna MV, Coimbra R, Eliceiri BP, Baird A. A Human Specific alpha7 Nicotinic Acetylcholine Receptor Gene in Human Leukocytes: Identification, Regula tion and the Consequences of CHRFAM7A Expression. Molecular medicine (Cambridge, Mass). 2015;21:323 36. Epub 2015/04/11. doi: 10.2119/molmed.2015.00018. PubMed PMID: 25860877; PMCID: PMC4534468. 156. Severance EG, Dickerson FB, Stallings CR, Origoni AE, Su llens A, Monson ET, Yolken RH. Differentiating nicotine versus schizophrenia associated decreases of the alpha7 nicotinic acetylcholine receptor transcript, CHRFAM7A, in peripheral blood lymphocytes. Journal of neural transmission (Vienna, Austria : 1996) . 2009;116(2):213 20. Epub 2008/12/17. doi: 10.1007/s00702 008 0164 y. PubMed PMID: 19082523. 157. van der Zanden EP, Hilbers FW, Verseijden C, van den Wijngaard RM, Skynner M, Lee K, Ulloa L, Boeckxstaens GE, de Jonge WJ. Nicotinic acetylcholine receptor expression and susceptibility to cholinergic immunomodulation in human monocytes of smoking individuals. Neuroimmunomodulation. 2012;19(4):255 65. Epub 2012/03/24. doi: 10.1159/000335185. PubMed PMID: 22441542. 158. Araud T, Graw S, Berger R, Lee M, Neveu E, Bertrand D, Leonard S. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of alpha7*nAChR function. Biochem Pharmacol. 2011;82(8):904 14. Epub 2011/07/02. doi: 10.1016/j.bcp.2011.06.018. PubMed PMID: 2 1718690; PMCID: PMC3162115. 159. Gault J, Robinson M, Berger R, Drebing C, Logel J, Hopkins J, Moore T, Jacobs S, Meriwether J, Choi MJ, Kim EJ, Walton K, Buiting K, Davis A, Breese C, Freedman R, Leonard S. Genomic organization and partial duplication of the human alpha7 neuronal nicotinic acetylcholine receptor gene (CHRNA7). Genomics. 1998;52(2):173 85. Epub 1998/10/23. doi: 10.1006/geno.1998.5363. PubMed PMID: 9782083.

PAGE 184

184 160. Gault J, Hopkins J, Berger R, Drebing C, Logel J, Walton C, Short M, Vianzon R , Olincy A, Ross RG, Adler LE, Freedman R, Leonard S. Comparison of polymorphisms in the alpha7 nicotinic receptor gene and its partial duplication in schizophrenic and control subjects. American journal of medical genetics Part B, Neuropsychiatric genetic s : the official publication of the International Society of Psychiatric Genetics. 2003;123b(1):39 49. Epub 2003/10/29. doi: 10.1002/ajmg.b.20061. PubMed PMID: 14582144. 161. Sinkus ML, Lee MJ, Gault J, Logel J, Short M, Freedman R, Christian SL, Lyon J, L eonard S. A 2 base pair deletion polymorphism in the partial duplication of the alpha7 nicotinic acetylcholine gene (CHRFAM7A) on chromosome 15q14 is associated with schizophrenia. Brain research. 2009;1291:1 11. Epub 2009/07/28. doi: 10.1016/j.brainres.20 09.07.041. PubMed PMID: 19631623; PMCID: PMC2747474. 162. Kunii Y, Zhang W, Xu Q, Hyde TM, McFadden W, Shin JH, Deep Soboslay A, Ye T, Li C, Kleinman JE, Wang KH, Lipska BK. CHRNA7 and CHRFAM7A mRNAs: co localized and their expression levels altered in the postmortem dorsolateral prefrontal cortex in major psychiatric disorders. The American journal of psychiatry. 2015;172(11):1122 30. Epub 2015/07/25. doi: 10.1176/appi.ajp.2015.14080978. PubMed PMID: 26206074. 163. Swaminathan S, Huentelman MJ, Corneveaux JJ, Myers AJ, Faber KM, Foroud T, Mayeux R, Shen L, Kim S, Turk M, Hardy J, Reiman EM, Saykin AJ. Analysis of copy number variation in Alzheimer's disease in a cohort of clinically characterized and neuropathologically verified individuals. PLoS One. 2012; 7(12):e50640. Epub 2012/12/12. doi: 10.1371/journal.pone.0050640. PubMed PMID: 23227193; PMCID: PMC3515604. 164. Rozycka A, Dorszewska J, Steinborn B, Lianeri M, Winczewska Wiktor A, Sniezawska A, Wisniewska K, Jagodzinski PP. Association study of the 2 bp deletion polymorphism in exon 6 of the CHRFAM7A gene with idiopathic generalized epilepsy. DNA and cell biology. 2013;32(11):640 7. Epub 2013/09/13. doi: 10.1089/dna.2012.1880. PubMed PMID: 24024466; PMCID: PMC3806399. 165. Leonard S, Breese C, Adams C, B enhammou K, Gault J, Stevens K, Lee M, Adler L, Olincy A, Ross R, Freedman R. Smoking and schizophrenia: abnormal nicotinic receptor expression. Eur J Pharmacol. 2000;393(1 3):237 42. Epub 2000/04/20. PubMed PMID: 10771019. 166. Dang X, Eliceiri BP, Baird A, Costantini TW. CHRFAM7A: a human specific alpha7 nicotinic acetylcholine receptor gene shows differential responsiveness of human intestinal epithelial cells to LPS. Faseb j. 2015;29(6):2292 302. Epub 2015/02/15. doi: 10.1096/fj.14 268037. PubMed PMID: 25681457; PMCID: PMC4763870.

PAGE 185

185 167. Sinkus ML, Graw S, Freedman R, Ross RG, Lester HA, Leonard S. The human CHRNA7 and CHRFAM7A genes: A review of the genetics, regulation, and function. Neuropharmacology. 2015;96(Pt B):274 88. Epub 2015/02/24. doi: 10.1016/ j.neuropharm.2015.02.006. PubMed PMID: 25701707; PMCID: PMC4486515. 168. Baird A, Coimbra R, Dang X, Eliceiri BP, Costantini TW. Up regulation of the human specific CHRFAM7A gene in inflammatory bowel disease. BBA clinical. 2016;5:66 71. Epub 2016/04/07. d oi: 10.1016/j.bbacli.2015.12.003. PubMed PMID: 27051591; PMCID: PMC4802402. 169. Kuo Y, Lucero L, Michaels J, DeLuca D, Lukas RJ. Differential expression of nicotinic acetylcholine receptor subunits in fetal and neonatal mouse thymus. J Neuroimmunol. 2002; 130(1 2):140 54. Epub 2002/09/13. PubMed PMID: 12225896. 170. van der Zanden EP, Snoek SA, Heinsbroek SE, Stanisor OI, Verseijden C, Boeckxstaens GE, Peppelenbosch MP, Greaves DR, Gordon S, De Jonge WJ. Vagus nerve activity augments intestinal macrophage p hagocytosis via nicotinic acetylcholine receptor alpha4beta2. Gastroenterology. 2009;137(3):1029 39, 39.e1 4. Epub 2009/05/12. doi: 10.1053/j.gastro.2009.04.057. PubMed PMID: 19427310. 171. Chernyavsky AI, Arredondo J, Galitovskiy V, Qian J, Grando SA. Str ucture and function of the nicotinic arm of acetylcholine regulatory axis in human leukemic T cells. International journal of immunopathology and pharmacology. 2009;22(2):461 72. Epub 2009/06/10. PubMed PMID: 19505399. 172. Chernyavsky AI, Arredondo J, Sko k M, Grando SA. Auto/paracrine control of inflammatory cytokines by acetylcholine in macrophage like U937 cells through nicotinic receptors. International immunopharmacology. 2010;10(3):308 15. Epub 2009/12/17. doi: 10.1016/j.intimp.2009.12.001. PubMed PMI D: 20004742; PMCID: PMC2829366. 173. Mikulski Z, Hartmann P, Jositsch G, Zaslona Z, Lips KS, Pfeil U, Kurzen H, Lohmeyer J, Clauss WG, Grau V, Fronius M, Kummer W. Nicotinic receptors on rat alveolar macrophages dampen ATP induced increase in cytosolic cal cium concentration. Respir Res. 2010;11:133. Epub 2010/10/06. doi: 10.1186/1465 9921 11 133. PubMed PMID: 20920278; PMCID: PMC2955664. 174. Koval L, Lykhmus O, Zhmak M, Khruschov A, Tsetlin V, Magrini E, Viola A, Chernyavsky A, Qian J, Grando S, Komisarenk o S, Skok M. Differential involvement of alpha4beta2, alpha7 and alpha9alpha10 nicotinic acetylcholine receptors in B lymphocyte activation in vitro. Int J Biochem Cell Biol. 2011;43(4):516 24. Epub 2010/12/15. doi: 10.1016/j.biocel.2010.12.003. PubMed PMI D: 21146628.

PAGE 186

186 175. Simard AR, Gan Y, St Pierre S, Kousari A, Patel V, Whiteaker P, Morley BJ, Lukas RJ, Shi FD. Differential modulation of EAE by alpha9* and beta2* nicotinic acetylcholine receptors. Immunology and cell biology. 2013;91(3):195 200. Epub 20 13/02/13. doi: 10.1038/icb.2013.1. PubMed PMID: 23399696; PMCID: PMC3596513. 176. Hao J, Shi FD, Abdelwahab M, Shi SX, Simard A, Whiteaker P, Lukas R, Zhou Q. Nicotinic receptor beta2 determines NK cell dependent metastasis in a murine model of metastatic lung cancer. PLoS One. 2013;8(2):e57495. Epub 2013/03/08. doi: 10.1371/journal.pone.0057495. PubMed PMID: 23469004; PMCID: PMC3585320. 177. Kawashima K, Fujii T. Expression of non neuronal acetylcholine in lymphocytes and its contribution to the regulation of immune function. Frontiers in bioscience : a journal and virtual library. 2004;9:2063 85. Epub 2004/09/09. PubMed PMID: 15353271. 178. Fujii T, Yamada S, Watanabe Y, Misawa H, Tajima S, Fujimoto K, Kasahara T, Kawashima K. Induction of choline acetyltr ansferase mRNA in human mononuclear leukocytes stimulated by phytohemagglutinin, a T cell activator. J Neuroimmunol. 1998;82(1):101 7. Epub 1998/04/04. PubMed PMID: 9526852. 179. Rinner I, Kawashima K, Schauenstein K. Rat lymphocytes produce and secrete ac etylcholine in dependence of differentiation and activation. J Neuroimmunol. 1998;81(1 2):31 7. Epub 1998/04/01. PubMed PMID: 9521603. 180. Xanthoulea S, Deliaert A, Romano A, Rensen SS, Buurman WA, van der Hulst RR. Nicotine effect on inflammatory and gro wth factor responses in murine cutaneous wound healing. International immunopharmacology. 2013;17(4):1155 64. Epub 2013/11/10. doi: 10.1016/j.intimp.2013.10.022. PubMed PMID: 24201082. 181. Glowatzki E, Fuchs PA. Cholinergic synaptic inhibition of inner ha ir cells in the neonatal mammalian cochlea. Science. 2000;288(5475):2366 8. Epub 2000/07/06. PubMed PMID: 10875922. 182. Goutman JD, Fuchs PA, Glowatzki E. Facilitating efferent inhibition of inner hair cells in the cochlea of the neonatal rat. The Journal of physiology. 2005;566(Pt 1):49 59. Epub 2005/05/10. doi: 10.1113/jphysiol.2005.087460. PubMed PMID: 15878942; PMCID: PMC1464729. 183. St Pierre S, Jiang W, Roy P, Champigny C, LeBlanc E, Morley BJ, Hao J, Simard AR. Nicotinic Acetylcholine Receptors Mod ulate Bone Marrow Derived Pro Inflammatory Monocyte Production and Survival. PLoS One. 2016;11(2):e0150230. Epub 2016/03/02. doi: 10.1371/journal.pone.0150230. PubMed PMID: 26925951; PMCID: PMC4771711.

PAGE 187

187 184. Mishra NC, Rir sima ah J, Boyd RT, Singh SP, Gund avarapu S, Langley RJ, Razani Boroujerdi S, Sopori ML. Nicotine inhibits Fc epsilon RI induced cysteinyl leukotrienes and cytokine production without affecting mast cell degranulation through alpha 7/alpha 9/alpha 10 nicotinic receptors. J Immunol. 2010;18 5(1):588 96. Epub 2010/05/28. doi: 10.4049/jimmunol.0902227. PubMed PMID: 20505147; PMCID: PMC2954495. 185. Richter K, Mathes V, Fronius M, Althaus M, Hecker A, Krasteva Christ G, Padberg W, Hone AJ, McIntosh JM, Zakrzewicz A, Grau V. Phosphocholine an a gonist of metabotropic but not of ionotropic functions of alpha9 containing nicotinic acetylcholine receptors. Scientific reports. 2016;6:28660. Epub 2016/06/29. doi: 10.1038/srep28660. PubMed PMID: 27349288. 186. Briggs CA, McKenna DG, Piattoni Kaplan M. Human alpha 7 nicotinic acetylcholine receptor responses to novel ligands. Neuropharmacology. 1995;34(6):583 90. Epub 1995/06/01. PubMed PMID: 7566493. 187. Meyer EM, Kuryatov A, Gerzanich V, Lindstrom J, Papke RL. Analysis of 3 (4 hydroxy, 2 Methoxybenzyl idene)anabaseine selectivity and activity at human and rat alpha 7 nicotinic receptors. J Pharmacol Exp Ther. 1998;287(3):918 25. Epub 1998/12/24. PubMed PMID: 9864273. 188. Papke RL, Kem WR, Soti F, Lopez Hernandez GY, Horenstein NA. Activation and desens itization of nicotinic alpha7 type acetylcholine receptors by benzylidene anabaseines and nicotine. J Pharmacol Exp Ther. 2009;329(2):791 807. Epub 2009/02/19. doi: 10.1124/jpet.108.150151. PubMed PMID: 19223664; PMCID: PMC2672872. 189. Briggs CA, Anderson DJ, Brioni JD, Buccafusco JJ, Buckley MJ, Campbell JE, Decker MW, Donnelly Roberts D, Elliott RL, Gopalakrishnan M, Holladay MW, Hui YH, Jackson WJ, Kim DJ, Marsh KC, O'Neill A, Prendergast MA, Ryther KB, Sullivan JP, Arneric SP. Functional characterizati on of the novel neuronal nicotinic acetylcholine receptor ligand GTS 21 in vitro and in vivo. Pharmacology, biochemistry, and behavior. 1997;57(1 2):231 41. Epub 1997/05/01. PubMed PMID: 9164577. 190. Gurley DA, Lanthorn TH. Nicotinic agonists competitivel y antagonize serotonin at mouse 5 HT3 receptors expressed in Xenopus oocytes. Neurosci Lett. 1998;247(2 3):107 10. Epub 1998/07/09. PubMed PMID: 9655604. 191. Arendash GW, Sengstock GJ, Sanberg PR, Kem WR. Improved learning and memory in aged rats with chr onic administration of the nicotinic receptor agonist GTS 21. Brain research. 1995;674(2):252 9. Epub 1995/03/20. PubMed PMID: 7796104.

PAGE 188

188 192. Meyer EM, Tay ET, Papke RL, Meyers C, Huang GL, de Fiebre CM. 3 [2,4 Dimethoxybenzylidene]anabaseine (DMXB) select ively activates rat alpha7 receptors and improves memory related behaviors in a mecamylamine sensitive manner. Brain research. 1997;768(1 2):49 56. Epub 1997/11/22. PubMed PMID: 9369300. 193. Li Y, Papke RL, He YJ, Millard WJ, Meyer EM. Characterization of the neuroprotective and toxic effects of alpha7 nicotinic receptor activation in PC12 cells. Brain research. 1999;830(2):218 25. Epub 1999/06/15. PubMed PMID: 10366678. 194. van Westerloo DJ, Giebelen IA, Florquin S, Bruno MJ, Larosa GJ, Ulloa L, Tracey K J, van der Poll T. The vagus nerve and nicotinic receptors modulate experimental pancreatitis severity in mice. Gastroenterology. 2006;130(6):1822 30. Epub 2006/05/16. doi: 10.1053/j.gastro.2006.02.022. PubMed PMID: 16697744. 195. Pavlov VA, Ochani M, Yang LH, Gallowitsch Puerta M, Ochani K, Lin X, Levi J, Parrish WR, Rosas Ballina M, Czura CJ, Larosa GJ, Miller EJ, Tracey KJ, Al Abed Y. Selective alpha7 nicotinic acetylcholine receptor agonist GTS 21 improves survival in murine endotoxemia and severe sepsi s. Critical care medicine. 2007;35(4):1139 44. Epub 2007/03/06. doi: 10.1097/01.ccm.0000259381.56526.96. PubMed PMID: 17334244. 196. Cai B, Chen F, Ji Y, Kiss L, de Jonge WJ, Conejero Goldberg C, Szabo C, Deitch EA, Ulloa L. Alpha7 cholinergic agonist prev ents systemic inflammation and improves survival during resuscitation. Journal of cellular and molecular medicine. 2009;13(9b):3774 85. Epub 2009/07/16. doi: 10.1111/j.1582 4934.2008.00550.x. PubMed PMID: 19602049; PMCID: PMC3046874. 197. Chatterjee PK, Al Abed Y, Sherry B, Metz CN. Cholinergic agonists regulate JAK2/STAT3 signaling to suppress endothelial cell activation. American journal of physiology Cell physiology. 2009;297(5):C1294 306. Epub 2009/09/11. doi: 10.1152/ajpcell.00160.2009. PubMed PMID: 19 741199; PMCID: PMC2777398. 198. Giebelen IA, van Westerloo DJ, LaRosa GJ, de Vos AF, van der Poll T. Stimulation of alpha 7 cholinergic receptors inhibits lipopolysaccharide induced neutrophil recruitment by a tumor necrosis factor alpha independent mechan ism. Shock (Augusta, Ga). 2007;27(4):443 7. Epub 2007/04/07. doi: 10.1097/01.shk.0000245016.78493.bb. PubMed PMID: 17414429. 199. Giebelen IA, van Westerloo DJ, LaRosa GJ, de Vos AF, van der Poll T. Local stimulation of alpha7 cholinergic receptors inhibit s LPS induced TNF alpha release in the mouse lung. Shock (Augusta, Ga). 2007;28(6):700 3. Epub 2007/07/11. doi: 10.1097/shk.0b013e318054dd89. PubMed PMID: 17621262.

PAGE 189

189 200. Hilderman M, Qureshi AR, Al Abed Y, Abtahi F, Lindecrantz K, Anderstam B, Bruchfeld A . Cholinergic anti inflammatory pathway activity in dialysis patients: a role for neuroimmunomodulation? Clinical kidney journal. 2015;8(5):599 605. Epub 2015/09/29. doi: 10.1093/ckj/sfv074. PubMed PMID: 26413288; PMCID: PMC4581391. 201. Kox M, Pompe JC, G ordinou de Gouberville MC, van der Hoeven JG, Hoedemaekers CW, Pickkers P. Effects of the alpha7 nicotinic acetylcholine receptor agonist GTS 21 on the innate immune response in humans. Shock (Augusta, Ga). 2011;36(1):5 11. Epub 2011/03/04. doi: 10.1097/SH K.0b013e3182168d56. PubMed PMID: 21368716. 202. Kox M, Pompe JC, Peters E, Vaneker M, van der Laak JW, van der Hoeven JG, Scheffer GJ, Hoedemaekers CW, Pickkers P. alpha7 nicotinic acetylcholine receptor agonist GTS 21 attenuates ventilator induced tumour necrosis factor alpha production and lung injury. British journal of anaesthesia. 2011;107(4):559 66. Epub 2011/07/21. doi: 10.1093/bja/aer202. PubMed PMID: 21771746. 203. Loram LC, Harrison JA, Chao L, Taylor FR, Reddy A, Travis CL, Giffard R, Al Abed Y, Tracey K, Maier SF, Watkins LR. Intrathecal injection of an alpha seven nicotinic acetylcholine receptor agonist attenuates gp120 induced mechanical allodynia and spinal pro inflammatory cytokine profiles in rats. Brain, behavior, and immunity. 2010;24(6): 959 67. Epub 2010/04/01. doi: 10.1016/j.bbi.2010.03.008. PubMed PMID: 20353818; PMCID: PMC2902784. 204. Norman GJ, Morris JS, Karelina K, Weil ZM, Zhang N, Al Abed Y, Brothers HM, Wenk GL, Pavlov VA, Tracey KJ, Devries AC. Cardiopulmonary arrest and resusc itation disrupts cholinergic anti inflammatory processes: a role for cholinergic alpha7 nicotinic receptors. J Neurosci. 2011;31(9):3446 52. Epub 2011/03/04. doi: 10.1523/jneurosci.4558 10.2011. PubMed PMID: 21368056; PMCID: PMC3758544. 205. Rosas Ballina M, Goldstein RS, Gallowitsch Puerta M, Yang L, Valdes Ferrer SI, Patel NB, Chavan S, Al Abed Y, Yang H, Tracey KJ. The selective alpha7 agonist GTS 21 attenuates cytokine production in human whole blood and human monocytes activated by ligands for TLR2, TL R3, TLR4, TLR9, and RAGE. Molecular medicine (Cambridge, Mass). 2009;15(7 8):195 202. Epub 2009/07/14. doi: 10.2119/molmed.2009.00039. PubMed PMID: 19593403; PMCID: PMC2707516. 206. Sitapara RA, Antoine DJ, Sharma L, Patel VS, Ashby CR, Jr., Gorasiya S, Ya ng H, Zur M, Mantell LL. The alpha7 nicotinic acetylcholine receptor agonist GTS 21 improves bacterial clearance in mice by restoring hyperoxia compromised macrophage function. Molecular medicine (Cambridge, Mass). 2014;20:238 47. Epub 2014/03/26. doi: 10. 2119/molmed.2013.00086. PubMed PMID: 24664237; PMCID: PMC4069272.

PAGE 190

190 207. Wu S, Zhao H, Luo H, Xiao X, Zhang H, Li T, Zuo X. GTS 21, an alpha7 nicotinic acetylcholine receptor agonist, modulates Th1 differentiation in CD4+ T cells from patients with rheumatoi d arthritis. Experimental and therapeutic medicine. 2014;8(2):557 62. Epub 2014/07/11. doi: 10.3892/etm.2014.1754. PubMed PMID: 25009619; PMCID: PMC4079428. 208. Vukelic M, Qing X, Redecha P, Koo G, Salmon JE. Cholinergic receptors modulate immune complex induced inflammation in vitro and in vivo. J Immunol. 2013;191(4):1800 7. Epub 2013/07/16. doi: 10.4049/jimmunol.1203467. PubMed PMID: 23851693. 209. Nullens S, Staessens M, Peleman C, Schrijvers DM, Malhotra Kumar S, Francque S, Matteoli G, Boeckxstaens G E, De Man JG, De Winter BY. EFFECT OF GTS 21, AN ALPHA7 NICOTINIC ACETYLCHOLINE RECEPTOR AGONIST, ON CLP INDUCED INFLAMMATORY, GASTROINTESTINAL MOTILITY, AND COLONIC PERMEABILITY CHANGES IN MICE. Shock (Augusta, Ga). 2016;45(4):450 9. Epub 2015/12/01. doi: 10.1097/shk.0000000000000519. PubMed PMID: 26618987. 210. Wu J, Jiao ZY, Zhang Z, Tang ZH, Zhang HH, Lu HL, Cianflone K. Cross talk between alpha7 nAChR mediated cholinergic pathway and acylation stimulating protein signaling in 3T3 L1 adipocytes: role of NFkappaB and STAT3. Biochemistry and cell biology = Biochimie et biologie cellulaire. 2015;93(4):335 42. Epub 2015/05/20. doi: 10.1139/bcb 2015 0023. PubMed PMID: 25985797. 211. Yue Y, Liu R, Cheng W, Hu Y, Li J, Pan X, Peng J, Zhang P. GTS 21 attenuates lipopolysaccharide induced inflammatory cytokine production in vitro by modulating the Akt and NF kappaB signaling pathway through the alpha7 nicotinic acetylcholine receptor. International immunopharmacology. 2015;29(2):504 12. Epub 2015/10/23. doi: 10.10 16/j.intimp.2015.10.005. PubMed PMID: 26490221. 212. Briggs CA, Gronlien JH, Curzon P, Timmermann DB, Ween H, Thorin Hagene K, Kerr P, Anderson DJ, Malysz J, Dyhring T, Olsen GM, Peters D, Bunnelle WH, Gopalakrishnan M. Role of channel activation in cognit ive enhancement mediated by alpha7 nicotinic acetylcholine receptors. Br J Pharmacol. 2009;158(6):1486 94. Epub 2009/10/23. doi: 10.1111/j.1476 5381.2009.00426.x. PubMed PMID: 19845675; PMCID: PMC2795215. 213. Mizuno Y, Dosch HM, Gelfand EW. Carbamycholine modulation of E rosette formation: identification of nicotinic acetylcholine receptors on a subpopulation of human T lymphocytes. Journal of clinical immunology. 1982;2(4):303 8. Epub 1982/10/01. PubMed PMID: 6982902.

PAGE 191

191 214. Strom TB, Sytkowski AJ, Carpen ter CB, Merrill JP. Cholinergic augmentation of lymphocyte mediated cytotoxicity. A study of the cholinergic receptor of cytotoxic T lymphocytes. Proc Natl Acad Sci U S A. 1974;71(4):1330 3. Epub 1974/04/01. PubMed PMID: 4364534; PMCID: PMC388221. 215. Lib ermann TA, Baltimore D. Activation of interleukin 6 gene expression through the NF kappa B transcription factor. Molecular and cellular biology. 1990;10(5):2327 34. Epub 1990/05/01. PubMed PMID: 2183031; PMCID: PMC360580. 216. Peters P, Olsen GN, Nielson S F, Nielson EO. U.S. Patent 72,8232004. 217. Williams DK, Wang J, Papke RL. Investigation of the molecular mechanism of the alpha7 nicotinic acetylcholine receptor positive allosteric modulator PNU 120596 provides evidence for two distinct desensitized stat es. Mol Pharmacol. 2011;80(6):1013 32. Epub 2011/09/03. doi: 10.1124/mol.111.074302. PubMed PMID: 21885620; PMCID: PMC3228536. 218. Langan TJ, Chou RC. Synchronization of mammalian cell cultures by serum deprivation. Methods in molecular biology (Clifton, NJ). 2011;761:75 83. Epub 2011/07/15. doi: 10.1007/978 1 61779 182 6_5. PubMed PMID: 21755442. 219. Green LM, Reade JL, Ware CF. Rapid colorimetric assay for cell viability: application to the quantitation of cytotoxic and growth inhibitory lymphokines. Jo urnal of immunological methods. 1984;70(2):257 68. Epub 1984/05/25. PubMed PMID: 6609997. 220. Evans TC, Jr., Benner J, Xu MQ. The cyclization and polymerization of bacterially expressed proteins using modified self splicing inteins. J Biol Chem. 1999;274( 26):18359 63. Epub 1999/06/22. PubMed PMID: 10373440. 221. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR Cas9 system. Nature protocols. 2013;8(11):2281 308. Epub 2013/10/26. doi: 10.1038/nprot.2013.143. PubMed PMID: 24157548; PMCID: PMC3969860. 222. Lundholt BK, Scudder KM, Pagliaro L. A simple technique for reducing edge effect in cell based assays. J Biomol Screen. 2003;8(5):566 70. doi: 10.1177/1087057103256465. PubMed PMID: 14567784. 223. Colquhoun D. An in vestigation of the false discovery rate and the misinterpretation of p values. Royal Society Open Science. 2014;1(3):140216 . doi: 10.1098/rsos.140216.

PAGE 192

192 224. Blanchet MR, Israel Assayag E, Daleau P, Beaulieu MJ, Cormier Y. Dimethyphenylpiperazinium, a nic otinic receptor agonist, downregulates inflammation in monocytes/macrophages through PI3K and PLC chronic activation. Am J Physiol Lung Cell Mol Physiol. 2006;291(4):L757 63. doi: 10.1152/ajplung.00409.2005. PubMed PMID: 16782754. 225. Razani Boroujerdi S, Boyd RT, Davila Garcia MI, Nandi JS, Mishra NC, Singh SP, Pena Philippides JC, Langley R, Sopori ML. T cells express alpha7 nicotinic acetylcholine receptor subunits that require a functional TCR and leukocyte specific protein tyrosine kinase for nicotine induced Ca2+ response. J Immunol. 2007;179(5):2889 98. Epub 2007/08/22. PubMed PMID: 17709503. 226. Komal P, Gudavicius G, Nelson CJ, Nashmi R. T cell receptor activation decreases excitability of cortical interneurons by inhibiting alpha7 nicotinic recep tors. J Neurosci. 2014;34(1):22 35. Epub 2014/01/02. doi: 10.1523/jneurosci.2093 13.2014. PubMed PMID: 24381265. 227. Lublin DM, Griffith RC, Atkinson JP. Influence of glycosylation on allelic and cell specific Mr variation, receptor processing, and ligand binding of the human complement C3b/C4b receptor. J Biol Chem. 1986;261(13):5736 44. Epub 1986/05/05. PubMed PMID: 2939068. 228. Cooper JT, Stroka DM, Brostjan C, Palmetshofer A, Bach FH, Ferran C. A20 blocks endothelial cell activation through a NF kappa B dependent mechanism. J Biol Chem. 1996;271(30):18068 73. Epub 1996/07/26. PubMed PMID: 8663499. 229. Van Antwerp DJ, Martin SJ, Kafri T, Green DR, Verma IM. Suppression of TNF alpha induced apoptosis by NF kappaB. Science. 1996;274(5288):787 9. Epub 1996 /11/01. PubMed PMID: 8864120. 230. Grimm S, Bauer MK, Baeuerle PA, Schulze Osthoff K. Bcl 2 down regulates the activity of transcription factor NF kappaB induced upon apoptosis. J Cell Biol. 1996;134(1):13 23. Epub 1996/07/01. PubMed PMID: 8698809; PMCID: PMC2120920. 231. Wu M, Lee H, Bellas RE, Schauer SL, Arsura M, Katz D, FitzGerald MJ, Rothstein TL, Sherr DH, Sonenshein GE. Inhibition of NF kappaB/Rel induces apoptosis of murine B cells. The EMBO journal. 1996;15(17):4682 90. Epub 1996/09/02. PubMed PMI D: 8887559; PMCID: PMC452200. 232. Wang CY, Mayo MW, Baldwin AS, Jr. TNF and cancer therapy induced apoptosis: potentiation by inhibition of NF kappaB. Science. 1996;274(5288):784 7. Epub 1996/11/01. PubMed PMID: 8864119.

PAGE 193

193 233. Yin D, Woodruff M, Zhang Y , Whaley S, Miao J, Ferslew K, Zhao J, Stuart C. Morphine promotes Jurkat cell apoptosis through pro apoptotic FADD/P53 and anti apoptotic PI3K/Akt/NF kappaB pathways. J Neuroimmunol. 2006;174(1 2):101 7. Epub 2006/03/15. doi: 10.1016/j.jneuroim.2006.02.00 1. PubMed PMID: 16529824. 234. Lopez Hernandez GY, Thinschmidt JS, Zheng G, Zhang Z, Crooks PA, Dwoskin LP, Papke RL. Selective inhibition of acetylcholine evoked responses of alpha7 neuronal nicotinic acetylcholine receptors by novel tris and tetrakis az aaromatic quaternary ammonium antagonists. Mol Pharmacol. 2009;76(3):652 66. Epub 2009/06/27. doi: 10.1124/mol.109.056176. PubMed PMID: 19556356; PMCID: PMC2730394. 235. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to p roliferation and cytotoxicity assays. Journal of immunological methods. 1983;65(1 2):55 63. Epub 1983/12/16. PubMed PMID: 6606682. 236. Lu Y, Cuevas B, Gibson S, Khan H, LaPushin R, Imboden J, Mills GB. Phosphatidylinositol 3 kinase is required for CD28 bu t not CD3 regulation of the TEC family tyrosine kinase EMT/ITK/TSK: functional and physical interaction of EMT with phosphatidylinositol 3 kinase. J Immunol. 1998;161(10):5404 12. Epub 1998/11/20. PubMed PMID: 9820515. 237. Altman A, Villalba M. Protein ki nase C theta (PKC theta): a key enzyme in T cell life and death. Journal of biochemistry. 2002;132(6):841 6. Epub 2002/12/11. PubMed PMID: 12473184. 238. Taichman R, Merida I, Torigoe T, Gaulton GN, Reed JC. Evidence that protein tyrosine kinase p56 Lck re gulates the activity of phosphatidylinositol 3' kinase in interleukin 2 dependent T cells. J Biol Chem. 1993;268(27):20031 6. Epub 1993/09/25. PubMed PMID: 8397196. 239. Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, Segal RA, Kaplan DR, Gree nberg ME. Regulation of neuronal survival by the serine threonine protein kinase Akt. Science. 1997;275(5300):661 5. Epub 1997/01/31. PubMed PMID: 9005851. 240. Franke TF, Kaplan DR, Cantley LC. PI3K: downstream AKTion blocks apoptosis. Cell. 1997;88(4):43 5 7. Epub 1997/02/21. PubMed PMID: 9038334. 241. Farrar WL, Mizel SB, Farrar JJ. Participation of lymphocyte activating factor (Interleukin 1) in the induction of cytotoxic T cell responses. J Immunol. 1980;124(3):1371 7. Epub 1980/03/01. PubMed PMID: 6153 680. 242. Maggirwar SB, Harhaj EW, Sun SC. Regulation of the interleukin 2 CD28 responsive element by NF ATp and various NF kappaB/Rel transcription factors. Molecular and cellular biology. 1997;17(5):2605 14. Epub 1997/05/01. PubMed PMID: 9111330; PMCID: PMC232110.

PAGE 194

194 243. Arima N, Kuziel WA, Grdina TA, Greene WC. IL 2 induced signal transduction involves the activation of nuclear NF kappa B expression. J Immunol. 1992;149(1):83 91. Epub 1992/07/01. PubMed PMID: 1607664. 244. Nicholson DW, Ali A, Thornberry N A, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA, et al. Identification and inhibition of the ICE/CED 3 protease necessary for mammalian apoptosis. Nature. 1995;376(6535):37 43. Epub 1995/07/06. doi: 10.1038/376037a0. Pu bMed PMID: 7596430. 245. Rodriguez Lafrasse C, Alphonse G, Broquet P, Aloy MT, Louisot P, Rousson R. Temporal relationships between ceramide production, caspase activation and mitochondrial dysfunction in cell lines with varying sensitivity to anti Fas ind uced apoptosis. The Biochemical journal. 2001;357(Pt 2):407 16. Epub 2001/07/06. PubMed PMID: 11439090; PMCID: PMC1221967. 246. Bai HW, Badaboina S, Park CH, Choi BY, Na YH, Chung BY. Centipedegrass extract induces apoptosis through the activation of caspa ses and the downregulation of PI3K/Akt and MAPK phosphorylation in leukemia cells. Int J Mol Med. 2015;35(2):511 8. Epub 2014/12/02. doi: 10.3892/ijmm.2014.2012. PubMed PMID: 25435190. 247. Du HP, Shen JK, Yang M, Wang YQ, Yuan XQ, Ma QL, Jin J. 4 Chlorobe nzoyl berbamine induces apoptosis and G2/M cell cycle arrest through the PI3K/Akt and NF kappaB signal pathway in lymphoma cells. Oncology reports. 2010;23(3):709 16. Epub 2010/02/04. PubMed PMID: 20127010. 248. Nai Q, McIntosh JM, Margiotta JF. Relating n euronal nicotinic acetylcholine receptor subtypes defined by subunit composition and channel function. Mol Pharmacol. 2003;63(2):311 24. Epub 2003/01/16. PubMed PMID: 12527802. 249. Dale MM, Rang HP, Ritter JM, Flower RJ, Henderson G. Pharmacology. 7th ed: Elsevier; 2012. 250. Kawashima K, Fujii T, Moriwaki Y, Misawa H, Horiguchi K. Non neuronal cholinergic system in regulation of immune function with a focus on alpha7 nAChRs. International immunopharmacology. 2015;29(1):127 34. Epub 2015/04/25. doi: 10.101 6/j.intimp.2015.04.015. PubMed PMID: 25907239. 251. Suriyo T, Thiantanawat A, Chaiyaroj SC, Parkpian P, Satayavivad J. Involvement of the lymphocytic muscarinic acetylcholine receptor in methylmercury induced c Fos expression and apoptosis in human leukemic T cells. Journal of toxicology and environmen tal health Part A. 2008;71(16):1109 23. Epub 2008/06/24. doi: 10.1080/15287390802114725. PubMed PMID: 18569623.

PAGE 195

195 252. Kawashima K, Fujii T, Moriwaki Y, Misawa H. Critical roles of acetylcholine and the muscarinic and nicotinic acetylcholine receptors in th e regulation of immune function. Life Sci. 2012;91(21 22):1027 32. Epub 2012/06/05. doi: 10.1016/j.lfs.2012.05.006. PubMed PMID: 22659391. 253. Alea MP, Borroto Escuela DO, Romero Fernandez W, Fuxe K, Garriga P. Differential expression of muscarinic acetyl choline receptor subtypes in Jurkat cells and their signaling. J Neuroimmunol. 2011;237(1 2):13 22. Epub 2011/07/12. doi: 10.1016/j.jneuroim.2011.05.010. PubMed PMID: 21742386. 254. Khan MR, Uwada J, Yazawa T, Islam MT, Krug SM, Fromm M, Karaki S, Suzuki Y , Kuwahara A, Yoshiki H, Sada K, Muramatsu I, Anisuzzaman AS, Taniguchi T. Activation of muscarinic cholinoceptor ameliorates tumor necrosis factor alpha induced barrier dysfunction in intestinal epithelial cells. FEBS Lett. 2015;589(23):3640 7. Epub 2015/ 11/01. doi: 10.1016/j.febslet.2015.10.029. PubMed PMID: 26519558. 255. Xu ZP, Song Y, Yang K, Zhou W, Hou LN, Zhu L, Chen HZ, Cui YY. M3 mAChR mediated IL 8 expression through PKC/NF kappaB signaling pathways. Inflammation research : official journal of th e European Histamine Research Society [et al]. 2014;63(6):463 73. Epub 2014/02/14. doi: 10.1007/s00011 014 0718 4. PubMed PMID: 24522860. 256. Xu ZP, Yang K, Xu GN, Zhu L, Hou LN, Zhang WH, Chen HZ, Cui YY. Role of M3 mAChR in in vivo and in vitro models of LPS induced inflammatory response. International immunopharmacology. 2012;14(3):320 7. Epub 2012/08/23. doi: 10.1016/j.intimp.2012.07.020. PubMed PMID: 22910223. 257. Schliebs R, Heidel K, Apelt J, Gniezdzinska M, Kirazov L, Szutowicz A. Interaction of interleukin 1beta with muscarinic acetylcholine receptor mediated signaling cascade in cholinergically differentiated SH SY5Y cells. Brain research. 2006;1122(1):78 85. Epub 2006/10/10. doi: 10.1016/j.brainres.2006.09.014. PubMed PMID: 17026971. 258. Fried land AE, Tzur YB, Esvelt KM, Colaiacovo MP, Church GM, Calarco JA. Heritable genome editing in C. elegans via a CRISPR Cas9 system. Nature methods. 2013;10(8):741 3. Epub 2013/07/03. doi: 10.1038/nmeth.2532. PubMed PMID: 23817069; PMCID: PMC3822328. 259. R oth DB, Porter TN, Wilson JH. Mechanisms of nonhomologous recombination in mammalian cells. Molecular and cellular biology. 1985;5(10):2599 607. Epub 1985/10/01. PubMed PMID: 3016509; PMCID: PMC366995. 260. Han YH, Austin MJ, Pommier Y, Povirk LF. Small de letion and insertion mutations induced by the topoisomerase II inhibitor teniposide in CHO cells and comparison with sites of drug stimulated DNA cleavage in vitro. J Mol Biol. 1993;229(1):52 66. Epub 1993/01/05. doi: 10.1006/jmbi.1993.1007. PubMed PMID: 8 380617.

PAGE 196

196 261. Mangiarotti G. Coupling of transcription and translation in Dictyostelium discoideum nuclei. Biochemistry. 1999;38(13):3996 4000. Epub 1999/04/09. doi: 10.1021/bi9822022. PubMed PMID: 10194311. 262. Rand ML, Warren JS, Mansour MK, Newman W, Ri ngler DJ. Inhibition of T cell recruitment and cutaneous delayed type hypersensitivity induced inflammation with antibodies to monocyte chemoattractant protein 1. Am J Pathol. 1996;148(3):855 64. Epub 1996/03/01. PubMed PMID: 8774140; PMCID: PMC1861724. 26 3. Kalashnyk OM, Gergalova GL, Komisarenko SV, Skok MV. Intracellular localization of nicotinic acetylcholine receptors in human cell lines. Life Sci. 2012;91(21 22):1033 7. Epub 2012/03/01. doi: 10.1016/j.lfs.2012.02.005. PubMed PMID: 22365965. 264. Fourn ie GJ, Lambert PH, Meischer PA. Release of DNA in circulating blood and induction of anti DNA antibodies after injection of bacterial lipopolysaccharides. J Exp Med. 1974;140(5):1189 206. Epub 1974/11/01. PubMed PMID: 4607609; PMCID: PMC2139721. 265. Lien E, Means TK, Heine H, Yoshimura A, Kusumoto S, Fukase K, Fenton MJ, Oikawa M, Qureshi N, Monks B, Finberg RW, Ingalls RR, Golenbock DT. Toll like receptor 4 imparts ligand specific recognition of bacterial lipopolysaccharide. J Clin Invest. 2000;105(4):497 504. Epub 2000/02/23. doi: 10.1172/jci8541. PubMed PMID: 10683379; PMCID: PMC289161. 266. Zhang FX, Kirschning CJ, Mancinelli R, Xu XP, Jin Y, Faure E, Mantovani A, Rothe M, Muzio M, Arditi M. Bacterial lipopolysaccharide activates nuclear factor kappaB t hrough interleukin 1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J Biol Chem. 1999;274(12):7611 4. Epub 1999/03/13. PubMed PMID: 10075645. 267. Gotti C, Hanke W, Schlue WR, Briscini L, Moretti M, Clementi F. A functional alpha bungarotoxin receptor is present in chick cerebellum: purification and characterization. Neuroscience. 1992;50(1):117 27. Epub 1992/09/01. PubMed PMID: 1357590. 268. Berg DK, Kelly RB, Sargent PB, Williamson P, Hall ZW. Binding of bungar otoxin to acetylcholine receptors in mammalian muscle (snake venom denervated muscle neonatal muscle rat diaphragm SDS polyacrylamide gel electrophoresis). Proc Natl Acad Sci U S A. 1972;69(1):147 51. Epub 1972/01/01. PubMed PMID: 4333037; PMCID: PMC427564 .

PAGE 197

197 269. Mishra S, Mishra JP, Gee K, McManus DC, LaCasse EC, Kumar A. Distinct role of calmodulin and calmodulin dependent protein kinase II in lipopolysaccharide and tumor necrosis factor alpha mediated suppression of apoptosis and antiapoptotic c IAP2 ge ne expression in human monocytic cells. J Biol Chem. 2005;280(45):37536 46. Epub 2005/09/13. doi: 10.1074/jbc.M504971200. PubMed PMID: 16154993. 270. Sato K, Taniguchi T, Suzuki M, Shinohara F, Takada H, Rikiishi H. Dual role of NF kappaB in apoptosis of T HP 1 cells during treatment with etoposide and lipopolysaccharide. Leukemia research. 2004;28(1):63 9. Epub 2003/11/25. PubMed PMID: 14630082. 271. Cordle SR, Donald R, Read MA, Hawiger J. Lipopolysaccharide induces phosphorylation of MAD3 and activation o f c Rel and related NF kappa B proteins in human monocytic THP 1 cells. J Biol Chem. 1993;268(16):11803 10. Epub 1993/06/05. PubMed PMID: 8505309. 272. Ganchi PA, Sun SC, Greene WC, Ballard DW. I kappa B/MAD 3 masks the nuclear localization signal of NF ka ppa B p65 and requires the transactivation domain to inhibit NF kappa B p65 DNA binding. Molecular biology of the cell. 1992;3(12):1339 52. Epub 1992/12/01. PubMed PMID: 1493333; PMCID: PMC275704. 273. Henkel T, Machleidt T, Alkalay I, Kronke M, Ben Neriah Y, Baeuerle PA. Rapid proteolysis of I kappa B alpha is necessary for activation of transcription factor NF kappa B. Nature. 1993;365(6442):182 5. Epub 1993/09/09. doi: 10.1038/365182a0. PubMed PMID: 8371761. 274. O'Connell MA, Bennett BL, Mercurio F, Man ning AM, Mackman N. Role of IKK1 and IKK2 in lipopolysaccharide signaling in human monocytic cells. J Biol Chem. 1998;273(46):30410 4. Epub 1998/11/07. PubMed PMID: 9804806. 275. Sahara N, Vega IE, Ishizawa T, Lewis J, McGowan E, Hutton M, Dickson D, Yen S H. Phosphorylated p38MAPK specific antibodies cross react with sarkosyl insoluble hyperphosphorylated tau proteins. J Neurochem. 2004;90(4):829 38. Epub 2004/08/04. doi: 10.1111/j.1471 4159.2004.02558.x. PubMed PMID: 15287888. 276. Buffington SA, Sobotzik JM, Schultz C, Rasband MN. IkappaBalpha is not required for axon initial segment assembly. Molecular and cellular neurosciences. 2012;50(1):1 9. Epub 2012/03/27. doi: 10.1016/j.mcn.2012.03.003. PubMed PMID: 22445657; PMCID: PMC3383875. 277. Lee JY, Chiu YH , Asara J, Cantley LC. Inhibition of PI3K binding to activators by serine phosphorylation of PI3K regulatory subunit p85alpha Src homology 2 domains. Proc Natl Acad Sci U S A. 2011;108(34):14157 62. Epub 2011/08/10. doi: 10.1073/pnas.1107747108. PubMed PMI D: 21825134; PMCID: PMC3161555.

PAGE 198

198 278. Haas JG, Baeuerle PA, Riethmuller G, Ziegler Heitbrock HW. Molecular mechanisms in down regulation of tumor necrosis factor expression. Proc Natl Acad Sci U S A. 1990;87(24):9563 7. Epub 1990/12/01. PubMed PMID: 2263611 ; PMCID: PMC55212. 279. Thomsen MS, Zwart R, Ursu D, Jensen MM, Pinborg LH, Gilmour G, Wu J, Sher E, Mikkelsen JD. alpha7 and beta2 Nicotinic Acetylcholine Receptor Subunits Form Heteromeric Receptor Complexes that Are Expressed in the Human Cortex and Dis play Distinct Pharmacological Properties. PLoS One. 2015;10(6):e0130572. Epub 2015/06/19. doi: 10.1371/journal.pone.0130572. PubMed PMID: 26086615; PMCID: PMC4472343. 280. Wu J, Liu Q, Tang P, Mikkelsen JD, Shen J, Whiteaker P, Yakel JL. Heteromeric alpha7 beta2 Nicotinic Acetylcholine Receptors in the Brain. Trends Pharmacol Sci. 2016;37(7):562 74. Epub 2016/05/18. doi: 10.1016/j.tips.2016.03.005. PubMed PMID: 27179601. 281. Ferreon AC, Ferreon JC, Wright PE, Deniz AA. Modulation of allostery by protein int rinsic disorder. Nature. 2013;498(7454):390 4. Epub 2013/06/21. doi: 10.1038/nature12294. PubMed PMID: 23783631; PMCID: PMC3718496. 282. Sigalov AB, Uversky VN. Differential occurrence of protein intrinsic disorder in the cytoplasmic signaling domains of c ell receptors. Self/nonself. 2011;2(1):55 72. Epub 2011/07/22. doi: 10.4161/self.2.1.14790. PubMed PMID: 21776336; PMCID: PMC3136905. 283. Sigalov AB. Protein intrinsic disorder and oligomericity in cell signaling. Molecular bioSystems. 2010;6(3):451 61. E pub 2010/02/23. doi: 10.1039/b916030m. PubMed PMID: 20174674. 284. Alkondon M, Pereira EF, Cortes WS, Maelicke A, Albuquerque EX. Choline is a selective agonist of alpha7 nicotinic acetylcholine receptors in the rat brain neurons. The European journal of n euroscience. 1997;9(12):2734 42. Epub 1998/03/28. PubMed PMID: 9517478. 285. Mullen G, Napier J, Balestra M, DeCory T, Hale G, Macor J, Mack R, Loch J, 3rd, Wu E, Kover A, Verhoest P, Sampognaro A, Phillips E, Zhu Y, Murray R, Griffith R, Blosser J, Gurley D, Machulskis A, Zongrone J, Rosen A, Gordon J. ( ) Spiro[1 azabicyclo[2.2.2]octane 3,5' oxazolidin 2' one], a conformationally restricted analogue of acetylcholine, is a highly selective full agonist at the alpha 7 nicotinic acetylcholine receptor. J Med Chem. 2000;43(22):4045 50. Epub 2000/11/07. PubMed PMID: 11063601. 286. Arcaro A, Wymann MP. Wortmannin is a potent phosphatidylinositol 3 kinase inhibitor: the role of phosphatidylinositol 3,4,5 trisphosphate in neutrophil responses. The Biochemical jour nal. 1993;296 ( Pt 2):297 301. Epub 1993/12/01. PubMed PMID: 8257416; PMCID: PMC1137693.

PAGE 199

199 287. Oettgen HC, Pettey CL, Maloy WL, Terhorst C. A T3 like protein complex associated with the antigen receptor on murine T cells. Nature. 1986;320(6059):272 5. Epub 1986/03/20. doi: 10.1038/320272a0. PubMed PMID: 2938011. 288. Hohashi N, Hayashi T, Fusaki N, Takeuchi M, Higurashi M, Okamoto T, Semba K, Yamamoto T. The protein tyrosine kinase Fyn activates transcription from the HIV promoter via activation of NF kappa B like DNA binding proteins. International immunology. 1995;7(11):1851 9. Epub 1995/11/01. PubMed PMID: 8580083. 289. Cooke MP, Abraham KM, Forbush KA, Perlmutter RM. Regulation of T cell receptor signaling by a src family protein tyrosine kinase (p59fyn). Cell. 1991;65(2):281 91. Epub 1991/04/19. PubMed PMID: 2015626. 290. Kihara T, Shimohama S, Sawada H, Honda K, Nakamizo T, Shibasaki H, Kume T, Akaike A. alpha 7 nicotinic receptor transduces signals to phosphatidylinositol 3 kinase to block A beta amyloi d induced neurotoxicity. J Biol Chem. 2001;276(17):13541 6. Epub 2001/03/30. doi: 10.1074/jbc.M008035200. PubMed PMID: 11278378. 291. Stokes C, Treinin M, Papke RL. Looking below the surface of nicotinic acetylcholine receptors. Trends Pharmacol Sci. 2015. Epub 2015/06/13. doi: 10.1016/j.tips.2015.05.002. PubMed PMID: 26067101. 292. Lundgren TK, Scott RP, Smith M, Pawson T, Ernfors P. Engineering the recruitment of phosphotyrosine binding domain containing adaptor proteins reveals distinct roles for RET rec eptor mediated cell survival. J Biol Chem. 2006;281(40):29886 96. Epub 2006/07/19. doi: 10.1074/jbc.M600473200. PubMed PMID: 16847065. 293. Diaz Meco MT, Berra E, Municio MM, Sanz L, Lozano J, Dominguez I, Diaz Golpe V, Lain de Lera MT, Alcami J, Paya CV, et al. A dominant negative protein kinase C zeta subspecies blocks NF kappa B activation. Molecular and cellular biology. 1993;13(8):4770 5. Epub 1993/08/01. PubMed PMID: 8336714; PMCID: PMC360103. 294. Tong Starkesen SE, Luciw PA, Peterlin BM. Signaling t hrough T lymphocyte surface proteins, TCR/CD3 and CD28, activates the HIV 1 long terminal repeat. J Immunol. 1989;142(2):702 7. Epub 1989/01/15. PubMed PMID: 2536062. 295. Castagna M, Takai Y, Kaibuchi K, Sano K, Kikkawa U, Nishizuka Y. Direct activation o f calcium activated, phospholipid dependent protein kinase by tumor promoting phorbol esters. J Biol Chem. 1982;257(13):7847 51. Epub 1982/07/10. PubMed PMID: 7085651.

PAGE 200

200 296. Secrist JP, Karnitz L, Abraham RT. T cell antigen receptor ligation induces tyrosin e phosphorylation of phospholipase C gamma 1. J Biol Chem. 1991;266(19):12135 9. Epub 1991/07/05. PubMed PMID: 2061301. 297. Keenan C, Volkov Y, Kelleher D, Long A. Subcellular localization and translocation of protein kinase C isoforms zeta and epsilon in human peripheral blood lymphocytes. International immunology. 1997;9(10):1431 9. Epub 1997/11/14. PubMed PMID: 9352348. 298. Weissman AM, Ross P, Luong ET, Garcia Morales P, Jelachich ML, Biddison WE, Klausner RD, Samelson LE. Tyrosine phosphorylation of the human T cell antigen receptor zeta chain: activation via CD3 but not CD2. J Immunol. 1988;141(10):3532 6. Epub 1988/11/15. PubMed PMID: 3263430. 299. Tsutsumi A, Kubo M, Fujii H, Freire Moar J, Turck CW, Ransom JT. Regulation of protein kinase C isofor m proteins in phorbol ester stimulated Jurkat T lymphoma cells. J Immunol. 1993;150(5):1746 54. Epub 1993/03/01. PubMed PMID: 8436813. 300. Thebault S, Ochoa Garay J. Characterization of TCR induced phosphorylation of PKCtheta in primary murine lymphocytes . Molecular immunology. 2004;40(13):931 42. Epub 2004/01/17. PubMed PMID: 14725789. 301. Liu Y, Liu YC, Meller N, Giampa L, Elly C, Doyle M, Altman A. Protein kinase C activation inhibits tyrosine phosphorylation of Cbl and its recruitment of Src homology 2 domain containing proteins. J Immunol. 1999;162(12):7095 101. Epub 1999/06/08. PubMed PMID: 10358153. 302. Comb WC, Hutti JE, Cogswell P, Cantley LC, Baldwin AS. p85alpha SH2 domain phosphorylation by IKK promotes feedback inhibition of PI3K and Akt in r esponse to cellular starvation. Molecular cell. 2012;45(6):719 30. Epub 2012/02/22. doi: 10.1016/j.molcel.2012.01.010. PubMed PMID: 22342344; PMCID: PMC3319231. 303. Kang JL, Jung HJ, Lee K, Kim HR. Src tyrosine kinases mediate crystalline silica induced N F kappaB activation through tyrosine phosphorylation of IkappaB alpha and p65 NF kappaB in RAW 264.7 macrophages. Toxicological sciences : an official journal of the Society of Toxicology. 2006;90(2):470 7. Epub 2006/01/25. doi: 10.1093/toxsci/kfj096. PubM ed PMID: 16431847. 304. Kang JL, Lee HW, Kim HJ, Lee HS, Castranova V, Lim CM, Koh Y. Inhibition of SRC tyrosine kinases suppresses activation of nuclear factor kappaB, and serine and tyrosine phosphorylation of IkappaB alpha in lipopolysaccharide stimulat ed raw 264.7 macrophages. Journal of toxicology and environmental health Part A. 2005;68(19):1643 62. Epub 2005/10/01. doi: 10.1080/15287390500192114. PubMed PMID: 16195219.

PAGE 201

201 305. Livolsi A, Busuttil V, Imbert V, Abraham RT, Peyron JF. Tyrosine phosphoryla tion dependent activation of NF kappa B. Requirement for p56 LCK and ZAP 70 protein tyrosine kinases. European journal of biochemistry / FEBS. 2001;268(5):1508 15. Epub 2001/03/07. PubMed PMID: 11231305. 306. Mahabeleshwar GH, Kundu GC. Tyrosine kinase p56 lck regulates cell motility and nuclear factor kappaB mediated secretion of urokinase type plasminogen activator through tyrosine phosphorylation of IkappaBalpha following hypoxia/reoxygenation. J Biol Chem. 2003;278(52):52598 612. Epub 2003/10/10. doi: 10 .1074/jbc.M308941200. PubMed PMID: 14534291. 307. Swope SL, Huganir RL. Binding of the nicotinic acetylcholine receptor to SH2 domains of Fyn and Fyk protein tyrosine kinases. J Biol Chem. 1994;269(47):29817 24. Epub 1994/11/25. PubMed PMID: 7961974. 308. Geraghty P, Eden E, Pillai M, Campos M, McElvaney NG, Foronjy RF. alpha1 Antitrypsin activates protein phosphatase 2A to counter lung inflammatory responses. American journal of respiratory and critical care medicine. 2014;190(11):1229 42. Epub 2014/10/24. doi: 10.1164/rccm.201405 0872OC. PubMed PMID: 25341065; PMCID: PMC4315812. 309. Shravah J, Wang B, Pavlovic M, Kumar U, Chen DD, Luo H, Ansley DM. Propofol mediates signal transducer and activator of transcription 3 activation and crosstalk with phosphoin ositide 3 kinase/AKT. Jak stat. 2014;3:e29554. Epub 2014/08/12. doi: 10.4161/jkst.29554. PubMed PMID: 25105067; PMCID: PMC4124059.

PAGE 202

202 BIOGRAPHICAL SKETCH Timothy (Tim) Michael Gould was born a Florida native . He attended primary school in central Florida, and graduated from Astronaut High School in May of 2004. Tim enrolled at Florida State University on an academic scholarship in August of 2004, where he remained to complete an undergraduate B.Sc. degree in c hemical and b iomedical e ngineering, graduating with Honors in May of 2009. Under the direction of Dr. Sam Grant, A ssociate P rofessor in the Department of Chemical and Biomedical Engineering, Tim completed an undergraduate thesis project at the National High Magnetic Field Laboratory where he applied d iffusion based magnetic resonance imaging techniques to characterize neuroanatomical deficits associated with genetic and environmental models of amyotrophic lateral sclerosis. Post baccalaureate, Tim moved to northern California where he worked as an app lications engineer in the industrial sector for approximately 18 months. In August of 2011, Tim moved to Gainesville, Florida to begin his Ph.D. studies in the Department of Chemistry at the University of Florida under the direction of Dr. Nicole Horenste in and Dr. Roger Papke. Tim met his wife Emily in November of 2011, they became engaged to wed in December of 2012, and were married i n August of 2013. Tim received his Ph.D. from the University of Florida in 2016 .