Citation
The Effect of Glutathione on High Molecular Weight Adiponectin Secretion from 3T3-L1 Adipocytes during Endoplasmic Reticulum Stress

Material Information

Title:
The Effect of Glutathione on High Molecular Weight Adiponectin Secretion from 3T3-L1 Adipocytes during Endoplasmic Reticulum Stress
Creator:
Eudy, Brandon J
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (61 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Food Science and Human Nutrition
Committee Chair:
PERCIVAL,SUSAN S
Committee Co-Chair:
HENKEN,ROBIN J
Committee Members:
ANTON,STEPHEN D
Graduation Date:
8/6/2016

Subjects

Subjects / Keywords:
Adipocytes ( jstor )
Cell death ( jstor )
Disulfides ( jstor )
Endoplasmic reticulum ( jstor )
Insulin resistance ( jstor )
Messenger RNA ( jstor )
Obesity ( jstor )
Palmitates ( jstor )
Secretion ( jstor )
Type 2 diabetes mellitus ( jstor )
Food Science and Human Nutrition -- Dissertations, Academic -- UF
adipocytes -- chop -- glutathione
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Food Science and Human Nutrition thesis, M.S.

Notes

Abstract:
Obesity and metabolic syndrome are serious conditions afflicting many in the US and worldwide. These conditions are often associated with chronic low-grade inflammation, oxidative stress, and endoplasmic reticulum (ER) stress. Glutathione (GSH) is an important intracellular antioxidant and also assists protein folding in the ER. Little attention has been given to GSH concerning possible roles in metabolic health. GSH has been shown to be associated with higher levels of the insulin-sensitizing adipokine, adiponectin, in human plasma. Adiponectin exists in several isoforms. The high molecular weight (HMW) form of adiponectin is thought to have the most potent insulin sensitizing effect. Whether GSH plays a role in adiponectin secretion and oligomerization has not been previously investigated. GSH may protect against metabolic dysregulation by ameliorating ER stress and increasing HMW adiponectin secretion in stressed cells. The aims of this study were to determine the effects of intracellular GSH concentration on ER Stress and HMW adiponectin secretion in 3T3-L1 adipocytes. ER stress was induced by treatment with palmitate (1 mM) and the effect of GSH pre-treatment (1 mM) was also investigated. To show that palmitate induced ER stress, XBP1s mRNA expression and CHOP protein expression were measured. mRNA expression of the ER chaperone Ero-1a was measured to evaluate the effects of palmitate and GSH treatment on protein folding. Adiponectin was measured by ELISA. GSH pretreatment did not spare secretion of HMW adiponectin into the cell culture medium. GSH pre-treatment prevented induction of CHOP and ERO-1a, but had no effect on splicing of XBP1. Given that CHOP is implicated in ER stress associated cell death, the intracellular GSH concentration may direct cell fate in response to ER stress. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2016.
Local:
Adviser: PERCIVAL,SUSAN S.
Local:
Co-adviser: HENKEN,ROBIN J.
Statement of Responsibility:
by Brandon J Eudy.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Eudy, Brandon J. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Classification:
LD1780 2016 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

THE EFFECT OF GLUTATHIONE ON HIGH MOLECULAR WEIGHT ADIPONECTIN SECRETION FROM 3T3 L1 ADIPOCYTES DURING ENDOPLASMIC RETICULUM STRESS By BRANDON EUDY A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR TH E DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2016

PAGE 2

© 2016 Brandon Eudy

PAGE 3

To p ersistence

PAGE 4

4 ACKNOWLEDGMENTS I want to first thank Dr. Percival for accepting me into her lab and making my endeavor s possible. Your willingness to let me pursue this project and discover its ins and outs of pursuing this work on my own have allowed me to learn so much. I also appreciate Dr. Henken and Dr. Anton for serving on my committee and offering encouragement and providing me with additional insight to my project. I thank all of my lab and class mates who have made this experience even more enjoyable. Cheryl, thank you for trying to keep me in line. Mom and Dad, I appreciate your support throughout the past two years and for helping me make this possible.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ............................ 4 LIST OF TABLES ................................ ................................ ................................ ..... 6 LIST OF FIGURES ................................ ................................ ................................ ... 7 LIST OF ABBREVIATIONS ................................ ................................ ....................... 9 ABSTRA CT ................................ ................................ ................................ ............ 12 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ . 14 Introduction, Obesity, and t he Metabolic Syndrome ................................ ............. 14 Endoplasmic Reticulum Stress in t he Adipocyte ................................ .................. 15 Adiponectin ................................ ................................ ................................ ...... 19 Glutathione ................................ ................................ ................................ ....... 20 Glutathione a nd ER Stress ................................ ................................ ................ 22 Specific Aims ................................ ................................ ................................ .... 25 2 MATERIALS AND METHODS ................................ ................................ .............. 28 Cell Culture a nd Treatments ................................ ................................ .............. 28 Measurement o f Total Glutathione ................................ ................................ ..... 29 Measurement of Total a nd HMW Adiponectin ................................ ..................... 29 Western Blot Analysis ................................ ................................ ....................... 30 RNA Isolation a nd RT qPCR ................................ ................................ ............. 31 Oil Red O Staining ................................ ................................ ............................ 31 3 RESULTS ................................ ................................ ................................ ........... 34 Glutathione Uptake Into 3T3 L1 Adipocytes and Effect o f ER Stress o n Glutathione Concentrations ................................ ................................ ............ 34 Effect o f Glutathione Pre t reatment o n UPR Markers i n 3T3 L1 Adipocytes During ER Stress ................................ ................................ ........................... 35 Glutathione Does not Attenuate the Decrease i n HMW Adiponectin Secretion Caused b y Treatment W ith Palmitate ................................ .............................. 36 Glutathione Pre t reatment Lowers Ero Gene E xpression ................................ 36 4 DISCUSSION ................................ ................................ ................................ ...... 45 LIST OF REFERENC ES ................................ ................................ ......................... 54

PAGE 6

6 BIOGRAPHICAL SKETCH ................................ ................................ ...................... 61

PAGE 7

7 LIST OF TABLES Table page 2 1 Primer sequences used for RT qPCR. ................................ ........................... 33

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Thiol mediated protein retention. Proteins such as adiponectin may form disulfide bo nds with the ER chaperone ERp44 ................................ ................ 27 3 1 Oil Red O staining of 3T3 L1 adipocytes ................................ ......................... 3 8 3 2 Glutathion e uptake into 3T3 L1 adipocytes ................................ ..................... 3 9 3 3 Intracellular glutathione concentrations in 3T3 L1 adipocytes during ER stress ................................ ................................ ................................ ........... 40 3 4 GSH pre treatment prevents induction of CHOP duri ng palmitate induced ER stress ................................ ................................ ................................ ........... 41 3 5 GSH pre treatment does not decrease XBP1s mRNA expression during palmitat e induced ER stress ................................ ................................ .......... 42 3 6 Adipon ectin secretion, Total and HMW ................................ ........................... 4 3 3 7 GSH pre t reatment decreases ERo 1 mRNA expression ............................... 44 4 1 Hypothetical mechanism of action explaining how increased intracellular g lutathione alters UPR signaling ................................ ................................ .... 53

PAGE 9

9 LIST OF ABBREVIATIONS µg microgram µL microliter µM micromolar ARE Antioxidant response element ATF4 Activating transcription factor 4 ATF6 Activating transcription factor 6 AMPK adenosine monophosphate kinase ANOVA Analysis of variance BCL2 B cell lymphoma 2 Bid BH3 interacting domain death protein BMI Body mass index BSA Bovine serum albumin C Celsius CHOP CAAT/enhancer binding homologous protein ddH 2 O Double distilled water DM1 Differentiation medium 1 DM2 Differentiation medium 2 DMEM DR5 Death receptor 5 DsbA L D isulfide bond A oxidoreductase like protein DXM Dexamethasone Eukaryotic translation initiation factor 2 alpha

PAGE 10

10 ELISA Enzyme linked immunosorbent assay ER Endoplasmic reticulum ERp44 Endoplasmic reticulum resident protein 44 Ero 1 E ndoplasmic reticulum oxidoreductase alpha GCL Glutamate cysteine ligase GRP78 78 kDa glucose regulated protein GR Glutathione reductase GSH Reduced glutathione GSSG Oxidized glutathione GSTP Glutathione S transferase Pi HDL High density lipoprotein IBMX Isobutyl 1 methylxanthine IRE1 I nositol requiring kinase 1 IRS 1 insulin receptor substrate 1 JNK c Jun N terminal kinase kDa Kilodalton KEAP1 Kelch like ECH associated protein 1 HMW High molecular weight MetS Metabolic syndrome MPA Metaphosphoric acid mRNA Messenger RNA Nmoles nanomoles NAC n acetyl cysteine

PAGE 11

11 NF N uclear factor kappa light chain enhancer of activated B cells NRF2 Nuclear factor (erythroid derived 2) like 2 PBS Phosphate buffered saline PDI protein disulfide isomerase PERK D ouble stranded RNA activated protein kinase like ER kinase p eroxisome proliferator activated receptor alpha RIPA Radio immunoprecipitation assay RNA Ribonucleic acid RNS Reactive nitrogen species ROS Reactive oxygen species RT qPCR Real time quantitative polymerase chain reaction RPL13A Ribosomal Protein L13a SDS Sodium dodecyl sulfate siRNA Small interfering RNA TNF Tumor necrosis factor alpha TZD Thiazolidinedione UPR Unfolded protein response WAT White adipose tissue WT Wild type XBP1 X box binding protein 1

PAGE 12

12 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science THE EFFECT OF GLUTATHIONE ON HIGH MOLECULAR WEIGHT ADIPONECTIN SECRETION FROM 3T3 L1 ADIPOCYTES DURING ENDOPLASMIC RETICULUM STRESS By Brandon Eudy A ugust 2016 Chair: Susan S. Percival Major: Food Science and Human Nutrition Obesity and metabolic syndrome are serious conditions afflicting many in the US and worldwide. These conditions are often associated with chronic low grade inflammation, oxidative stress, and endoplasmic reticulum ( ER ) stress. Glutathione (GSH) is an important intracellular antioxidant and also assists prote in folding in the ER. Little attention has been given to GSH concerning possible roles in metabolic health. GSH has been shown to be associated with higher levels of the insulin sensitizing adipokine, adiponectin , in human plasma. Adiponectin exists in sev eral isoforms. The high molecular weight (HMW) form of adiponectin is thought to have the most potent insulin sensitiz ing effect . Whether GSH plays a role in adiponectin secretion and oligomerization has not been previously investigated. GSH may protect ag ainst metabolic dysregulation by ameliorating ER stress and increasing HMW adiponectin secretion in stressed cells. The aim s of this study were to determine the effects of intracellular GSH concentration on ER Stress and HMW adiponectin secretion in 3T3 L1 adipocytes. ER stress was induced by treatment with palmitate (1 mM) and the effect of GSH pre treatment (1 mM) was also investigated. To show that palmitate induced ER

PAGE 13

13 stress, XBP1s mRNA expression and CHOP protein expression were measured . mRNA expressi on of the ER chaperone ERO measured to evaluate the effects of palmitate and GSH treatment on protein folding. Adiponectin was measured by ELISA. GSH pretreatment did not spare secretion of HMW adiponectin into the cell culture medium. GSH pre treat ment prevented induction of CHOP and ERO , but had no effect on splicing of XBP1 . Given that CHOP is implicated in ER stress associated cell death, the intracellular GSH concentration may direct cell fate in response to ER stress .

PAGE 14

14 CHAPTER 1 INTR ODUCTION Introduction , Obesity, and the Metabolic Syndrome Our current food environment is characterized by nutritional abundance. The typical Western diet is comprised of meals high in fat and carbohydrates, and includes a great deal of snacking. Taken t ogether, these factors have played a part in the increased prevalence of chronic disease observed over the past several decades including obesit y and diabetes. These disease states are part of the metabolic syndrome (MetS), a term used to characterize the presence of a combination of the following conditions: high blood glucose, high blood pressure, low high density lipoprotein (HDL), high body mass index (BMI), and high serum triglycerides (1) . These pathologies can wreak havoc in overall health and are a serious problem in US. D ata from the 2003 2006 National Health and Nutrition Examination Survey show prevalence of MetS in the US to be approximately 34% (2) . Numerous lifestyle interventions, drugs, and surgeries a re available as treatments, but vary in effectiveness . Obesity represents a particularly difficult condition to treat. This may stem from the multi factorial nature behind what causes this pathology. Although excess energy consumption is certainly implicated, genetics and other factors also play a role (3 5) . For example, o besity is accompanied by oxidative stress and chronic low grade inflammation . Furthermore, obese individuals have been shown to have altered gut mic robiota and altered ratios of important hormones including leptin and adiponectin (6 8) . Another pertur bation that occurs at the cellular level in response to chronic over nutrition is endoplasmic reticulum (ER) stress. Indeed, adipose tissue isolated from obese mice and humans show heightened markers of ER stress (9) . Furthermore, ER stress

PAGE 15

15 causes induction of the unfolded protein response (U PR), which may potentially activate several inflammatory pathways. Therefore, ER stress may provide a crucial link between obesity, adipose tissue inflammation, and insulin resistance. Insulin resistance is a hallmark of metabolic disease. Of interest is t he adipokine, adiponectin. Adiponectin is secreted by white adipose tissue (WAT) and plays roles in glucose metabolism and insulin sensitivity. However, higher BMI is known to be associated with lower concentrations of circulating adiponectin. In particula r, the high molecular weight (HMW) isoform of adiponectin seems to be closely correlated with metabolic health. Treatment of diabetic subjects with thiazolidinediones (TZDs) improves insulin sensitivity by increasing circulating HMW adiponectin concentrati ons. Therefore, novel treatment for obesity and related pathologies may focus on increasing HMW adiponectin secretion from adipocytes. Glutathione is an important intracellular antioxidant and may be protective against ER stress. For example, GSH may regul ate ER chaperones which are involved in the synthesis and secretion of HMW adiponectin from the ER. The aim of this study is to determine whether increased glutathione concentrations in adipocytes may favorably modulate the UPR induced by palmitate treatme nt and blunt the decrease in HMW adiponectin seen in this condition. Endoplasmic Reticulum Stress in the Adipocyte The ER is an organelle found in all eukaryotic cells and serves as the l ocation for synthesis, assembly, and secretion of new proteins. Homeo stasis of this system must b e carefully maintained in order to meet cellular protein demand, while avoiding overwhelm ing the secretory pathway . In times of increased stres s, UPR signaling is induced primarily by activation of three ER transmembrane protein s in response to accumulation of misfolded proteins in the ER lumen : double stranded RNA activated

PAGE 16

16 protein kinase like ER kinase (PERK), inositol requiring kinase 1 (IRE1), and activating transcription factor 6 (ATF6.) Although each of these proteins activ ates its own unique signal transduction pathway, they share the same means of activation and converge upon many of the same transcriptional targets. Therefore, these pathways together encompass the entire UPR signaling pathway. These proteins normally bind to 78 kDa glucose regulated protein (GRP78), the master regulator of the UPR. When concentrations of misfolded proteins are high inside of the ER lumen, GRP78 dissociates from these proteins and binds misfolded proteins instead, allowing for activation of PERK, IRE1, and ATF6. Increased phosphorylation of PERK and IRE1 are strong indicator s of ongoing ER stress, as is proteolytic cleavage of ATF6 (10) . UPR activation is a dynamic process that determines cell fate during ER stress. The UPR begins as an adaptive pathway with emphasis on cell survival. However, as greater amounts of cellular stress accrue, the UPR experiences a paradigm shift towards promot ing cell death (11) . The dynamics of the UPR involved in determining cell fate are complex and this introduction will only briefly highlight key targets. In short, splicing of the X box bindin g protein 1 (XBP1) transcript by IRE 1 promotes cell survival by increasing lipid synthesis and upregulating ER chaperones (12, 13) Th e PERK pathway is also implicated in cell survival. PERK phosphorylates the transcription factor Nuclear factor (erythroid derived 2) like 2 (NRF2), which triggers its dissociation from Kelch like ECH associated protein 1 (KEAP1.) Free NRF2 then interacts with antioxidant response elements (ARE) in the promoter regions of many antioxidant genes causing their upregulation. PERK is also thought to be protective by transiently

PAGE 17

17 A central pro tein related to ER stress associated cell death is CAAT/enhancer binding homologous protein (CHOP) (13) . CHOP is located downstream of PERK and upregulated during prolonged ER stress. CHOP can reduce expression of BCL 2 anti apoptotic proteins and ha s also been shown to upregulate death receptor 5 (DR5), both of which factors promote a pro apoptotic phenotype (14, 15) . Furthermore, CHOP may be involved in mediating other forms of cell death in response to ER stress (16) . Pyroptosis is a type of programmed cell death that shares features of apoptosis and necrosis and is a typical response of cells to unresolvable inflammation. Cleavage of caspase 1 is a key feature defining pyro ptosis (17) . CHOP is thought to be involved in caspase 1 cleavage , resulting in cell death by pyroptotis . Treatment of primary mouse hepatocytes with tunicaymcin resulted in caspase 1 cleavage. However, knockdown of Chop using siRNA ameliorated this effect (18) . Finally, ER stress may also promote cell death by increasing intracellula r ROS and Ca 2+ release into the cytosol and mitochondria (11) . The UPR is highly responsive to nutritional status. Therefore it is logical that dysregulated energy metabolism would disrupt thi s pathway, particularly in the adipocyte. ER stress was first linked with obesity by Ozcan et al. in 2004 (10) . Ob/ob mice and mice fed high fat diets both showed increased PERK phosphorylation, JNK activation, and GRP78 protein expression in adipose tissue. Several factors may contribute to obesity induced ER stress. In obesity, adipocytes face hypox ia and increased concentrations of free fatty acids, both of which factors further contribute to ER stress. Indeed, in vitro studies have shown that the saturated fatty acid (SFA), palmitate activates the UPR (19, 20) . The mechanism by which palmitate induces ER

PAGE 18

18 stress is not well understood. However, one hypothesis points to accumulation of SFA in the ER membrane, which may interfere with fluidity b y replacing phosphatidylcholine residues (21) . Increased UPR activation causes changes in inflammatory signaling to immune cells. All three UPR pathways have been shown to upregulate nuclear factor kappa light chain enhancer of activated B cells (NF Jun N terminal kinase (JNK) (22) . Both of these pathways are pro inflammatory and may inhibit tyrosine phosphorylation of insulin receptor substrate 1 (IRS 1), leading to insulin resistance. Inflammation and insulin resistance are two downstream consequences of ER stress important to the adipocyte that will be discussed below. Chronic UPR activation may directly cause insulin resistance. In 2001, Harding et al. showed that ER stress in Perk / mice, was marked with a compensatory increase in phosphorylation of IRE1. Perk / mice experienced heightened type 2 diabetes disease cells (23) . Furthermore, UPR activation in adipose tissue of mice interferes with IRS 1 signaling by IRE1 dependent JNK activation (10) . This observation suggests that obesity associated ER stress may have direct consequences on insulin sensitivity and link obesity with type 2 diabetes. Prolonged ER stress may also contribute to adipocyte cell death, which is implicated in inflammation and metabolic disease. When a cell is not able to cope with ER stress, cell death is favored over adaptation. Cinti et al. showed macrophage infiltration i n adipose tissue was 90% localized to adipocytes showing morphological features of necrosis (24) . On the contrary, adipocyte apoptosis has also been shown to cause increased macrophage infiltration. (25) . Inactivation of the pro apoptotic protein BH3 int eracting domain death agonist (Bid) reduced macrophage infiltration and TNF

PAGE 19

19 in adipose tissue of obese mice. Furthermore, insulin resistance was higher in wild type mice compared to their Bid / littermates. These data suggest multiple ce ll death pathways may be activated in adipocytes during obesity induced ER stress. However, it was later verified by ultrasound imaging that adipocytes undergo pyroptosis in obesity induced ER stress, a cell death pathway which shares features of apoptosis and necrosis (16) . Therefore, future research should critically consider the mechanism behind cell death in adipocytes. In summary, adipocyte cell death promotes inflammation in WAT and further inc reases insulin resistance in humans and animal models. Therefore, targeting cell death in the adipocyte may have implications in resolving metabolic dysregulation. Adiponectin Adiponectin is recognized as an anti inflammatory adipokine, or adipo cytokine s ecreted by adipocytes. It was discovered in 1995 by four independent labs (26 29) . Since its discovery, adiponectin has been studied due to its inverse correlation with obesity, type 2 diabetes, and MetS. Obese and diabetic subjects hav e been shown to have lower circulating concentrations of adiponectin (30) . This asso ciation has garnered interest in adiponectin as a target for prevention or treatment of metabolic diseases including obesity and type 2 diabetes . Interestingly, adiponectin concentrations are shown to be higher in women than men and are also higher in centenarians and their offspring (31) . The presence of higher levels of adiponectin in centenarians has harbored questions as to whether adiponectin ma y also contribute to longevity. Disulfide bonding is crucial in the assembly of higher order complexes of adi ponectin (32) . The HMW form, which is an octadecamer consisting of eighteen adiponectin monomers, has been shown to behave d ifferently than the other forms and may be

PAGE 20

20 most relevant to metabolic health. The liver and skeletal muscle ar e key tissues where adiponectin exerts its insulin sensitizing effects. A diponectin exerts insulin sensitizing properties through the adenosine monophosphate kinase (AM PK ) and p eroxisome proliferator activated receptor alpha ( ) pathways b y binding to its transmembrane protei n receptors AdipoR1 and AdipoR2 (33, 34) . AdipoR1 shows high affinity for globular adiponectin while AdipoR2 shows high affinity for the HMW isoform (35) . There is some evidence that ER stress alters assem bly and secretion of adiponectin in adipocytes. 3T3 L1 adipocytes subjected to hypoxic conditions, similar to what is seen in obese adipose tissue, have been shown to have increased GRP78 mRNA expression , indicating ER stress (36) . Importantly, adipon ectin mRNA expression was reduced in this cell culture model. Other in vitro studies have also observed relationships between ER stress and adiponectin concentr ations . Liu et al. observed increased ER stress in 3T3 L1 cells treat ed with thapsigargin along with decrea sed adiponectin concentrations (37) . Another study using human adipose stem cells showed that ER stress induced by palmitate decreased secretion of the HMW form of adiponectin specifically into the cell culture medium (19) . Total adiponectin was also decreased in cell lysates. These experiments show that ER stress results in decreased adiponectin concentrations and secretion into the extracellular environment. Glutathione Glutathione is a tripeptide consisting of glutamate , cysteine, and glycine, covalently bonded in that respective order. Glutathione has spurred much interest over the past 40 years because it is a powerful intracellular antioxidant and plays an important role in maint aining cellular redox status (38) . GSH exerts antioxidant activity

PAGE 21

21 by reacting with intra cellular reactive oxygen species (ROS) and reactive nitrogen species (RNS), subsequently converting them to more benign forms at the cost of its own oxidation to glutathione disulfide ( GSSG ) . Oxidized gluta thione may be recycled by enzymatic activity of glutathione reductase (GR) and NADPH as a corresponding source of reducing equivalents. GSH is also involved in reduction of hydrogen peroxide and other various lipid peroxides by acting as a substrate for the enzy me glutathione peroxidase. Besides its antioxidant activity, glutathione is an important storage form of sulfur and cysteine. Glutathione also assists in the removal of xenobiotics. In the intracellular environment, glutathione exists primarily in the reduced form , but in the extracellular environme nt, oxidized glutathione is the pre dominant form. The ratio of GSH : GSSG also varies by cellular compartment (39, 40) . For example in the cytosol and mitochondria, GSH may represent over 98% of the total glutathione pool. Th is may reflect the role of GSH i n ameliorating oxidative stress in these compartments, especially the mitochondria. In the endoplasmic reticulum (ER), as much as 50% of total glutathione has been reported to be as GSSG (41) . This is essential as the ER requires a slightly oxidizing environment to ensue correct protein folding. In many cases of chronic disease, the intracellular GSH : GSSG ratio is lower than normal and is an indicator of oxidative stress. Howe ver, the total amount of intracellular glutathione may of GR. Therefore, boosting intracellular glutathione concentrations may be an effective means of reducing the damage caused by ROS in many cell and tissue types. Glutathione is present in dietary sources, but poorly available. It is found in animal sources such as beef and poultry, but quickly degraded by proteases in the stomach

PAGE 22

22 and poorly absorbed by cells. Consuming foods rich in the amino acids cysteine and glycine, or foods known to increase GSH biosynthesis, such as alliums and cruciferous vegetables may be the optimal way to increase GSH through dietary means. In viv o studies often show GSH to be poorly absorbed. However, not all studies show this. Kovaks Nolan et al. found GSH to undergo transport across the epithelium in humans (42) . However, glutathione was increased only in liver and red blood cells, not in plasma. Another ex vivo study showed exogenous GSH was absorbed into isolated kidney cells treated with the glutathione synthetase inhibitor, buthionine sulfoxomine. These cel ls did not show signs of GSH depletion, implying that exogenous GSH was indeed absorbed. (43) . These data suggests that GSH is able to be transported across membranes in these cell types. However, Future studies are needed to understand the conditions w hich allows optimal cellular GSH uptake and determine the differences in GSH transport between cell types. Recently, supplemental forms of GSH with increased bioavailability have recently been developed as dietary supplements for human use. GSH in this for m has been shown to be highly bioavailable. A clinical trial showed that 1000mg GSH / day significantly increased glutathione concentrations in PBMC after 1, 3, and 6 months of supplementation compared to a placebo (44) . The maximum increase in lymphocyte GSH was approximately 3 0%. However, whether GSH was increased in other tissues, such as the adipose tissue was not measured and should be a subject of future studies. Glutathione and ER Stress Reducing cell death in adipose tissue is a potential target in alleviating adipose tis sue inflammation and insulin resistance . ER stress has been shown to be implicated in adipocyte cell death and CHOP is an important transcription factor in this process

PAGE 23

23 (45) . Furthermore, ER stress is also known to deplete intracellular glutathione concentrations due to increased protein folding demand, ROS production, and initiation of cell death during severe ER stress (46, 47) . The PERK pathway of the UP R is highly sensitive to misfolded proteins in the ER lumen as well as oxidative stress. Therefore, bolstering intracellular GSH concentrations may protect against PERK ATF4 CHOP activation by preventing the accumulation of misfolded proteins and am eliorating oxidative stress. Although glutathione contributes to the maintenance of the redox state inside of the ER lumen, it is not well understood how modulating intracellular glutathione concentrations affects the UPR . Giordan o et al. recently showed t hat treating HepG2 cells with glutathione ethyl ester showed no decrease in GRP78 or CHOP mRNA expression (48) . However, a study performed in mice showed that treatment with the GSH precurso r, n acetyl cysteine (NAC) reduced oxidative stress and ER stress after liver ischemia reperfusion (49) . ER stress severity was determined by GRP78, AFT4, and CHOP protein expression. Interestingly, GSH concentrations were lower in the mice who did not receive NAC treatment. The above studies are insightful, but do not c learly show whether increased GSH concentrations may independently reduce ER stress or modulate the UPR. More research is needed to elucidate how GSH may alter UPR activation and contribute to determining cell fate during ER stress. GSH may also have prote ctive effects indirectly related to the UPR. For example, GSH may directly reduce non native disulfide bonds (aka misfolded proteins) which accumulate during ER stress (41) . GSH may also reduce oxidized protein disulfide isomerases (PDI), which catalyze the formation of disulfide bonds in newly assembled

PAGE 24

24 proteins. Together, these processes show that GSH support s rearrangement of disulfide bonds, which is crucial for correct protein assembly (50, 51) . Therefore, bolstering intracellula r GSH concentrati ons may ameliorate ER stress by assisting in protein folding. ERp44 and ERo folding. Erp44 is a member of the PDI family and binds to proteins, retaining them in the ER until they become correctly folded. Ero 1 works oppositely of ERp44 by binding to it and releasing any previously bound proteins for secretion from the cell. ERo can also facilitate disulfide bonding in proteins and is tho ught to be rate limiting factor in this process . ERp44 and ERo 1 together form a system known as thiol mediated protein retention, which is crucial for proper assembly of proteins requiring significant p ost translational modifications (52) . ER o mRNA expression is upregulated in ER stress by the PERK and ATF6 pathways (53) . Increased ERO 1 activity may interfere with thiol mediated protein retention, which could cause premature release of proteins from the ER (54) . Indeed, previous work in human adipose stem cells seems to support this. In response to palmitate induced ER stre ss, these cells showed lower secretion of HMW adiponectin in the cell culture medium (19) . Additionally, ERo mRNA expression was upregulated. In summary, GSH is able to reduce PDI proteins including ERp44, which could influence disulfide rearrangement. GSH also regulates protein folding by counterbalancing ERo , possi bly preventing secretion of immature proteins. Therefore, it is tempting to speculate that bolstering intracellular concentrations of GSH may antagonize ERo complete assembly of HMW adiponec tin to occur before it is secreted from the cell.

PAGE 25

25 Specific Aims Specific Aim I . Investigate the effect of augmenting total glutathione concentrations on glutathione depletion during palmitate induced ER stress in 3T3 L1 adipocytes . It is not known whether extracellular GSH is readily taken up by 3T3 L1 adipocytes. Therefore, I propose to incubate cells with extracellular GSH and measure glutathione concentrations in the cell after 20 hours. Palmitate, in the free fatty acid form will be used to induce ER stress in 3T3 L1 adipocytes for 24 hours. A time course experiment will be conducted and intracellular glutathione concentrations will be measured in cells pre treated with GSH or vehicle. Specific Aim I I. Determine effect of GSH on U PR activation during palmitate induced ER stress. The role of intracellular GSH status in protecting against ER stress is not fully understood. Furthermore, it is not known whether GSH may modulate the UPR in response to ER Stress. Therefore, I propose to investigate the effect of augmented intracellular glutathione concentration s on UPR activation in 3T3 L1 cells during palmitate induced ER stress. CHOP protein expression and splicing of XBP1 will be measured to assess activation of the PERK and IRE1 arms of the UPR respectively. Specific Aim III. Determine the effect of GSH on adiponectin secretion and Ero mRNA expression during palmitate induced ER stress . Pre treating 3T3 L1 adipocytes undergoing ER stress with GSH may improve secretion of HMW adiponectin by reducing the negati ve consequences of ER stress. It is hypothesized that GSH treatment will accomplish this by ameliorating oxidative stress and assisting in protein folding. In addition to its antioxidant potential, GSH may catalyze disulfi de rearrangeme nt in misfolded proteins. GSH also works antagonistically of Ero protein that has been shown to be involved in regulating adiponectin secretion. Several

PAGE 26

26 antioxidant compounds including tocopherols, ( ) catechin from green tea polyphenol s, and hydroxycinnamic acid derivatives have previously been shown to increase adiponectin concentrations in 3T3 L1 cells (55 57) . However, the increases shown in these studies may have resulted from increased adiponectin mRNA expression, rather than post translational events. Furthermore, HMW adiponectin was not measured, nor was secretion of adiponectin into cond itioned medium.

PAGE 27

27 Figure 1 1. Thiol mediated protein retention . Proteins such as adiponectin may form disulfide bonds with the ER chaperone ERp44. This allows retention of the target protein in the ER lumen, allowing for the required post translational modifications to take place. Ero 1 facilitating thiol mediated retention by binding to it and releasing the previously bound protein.

PAGE 28

28 CHAPTER 2 MATERIALS AND METHODS Cell C ulture and Treatments 3T3 L1 cells were obtained from the American Type Culture Collection (ATCC® CL173 g/L glucose and 584 mg/L L glutamine (Cellgro) , supplemented with 1% Penicillin (100 U/ml) / Str ept omycin (100 µg/ml) (Sigma ), 10% calf serum, and incubated at 37°C in 5% CO 2 . Once fibroblasts were 2 days post confluent, differentiation into adipocytes was initiated by switching to differentiation medium 1 (DM1.) This was Day 0. DM1 consists of DMEM supplemented with 10% fetal bovine serum (FBS), 0.5 mM 3 Isobutyl 1 methylxanthine (IBMX) (Sigma), 1 µM dexamethasone (DXM) (Sigma), and 1.5 µg/ml insulin (Sigma). Cells were incubated i n DM1 for 48 hours before being switched to a post differentiation medium consisting of DMEM supplemented with 10% FBS, and 1.5 µg/ml insulin. A stock solution of glutathione (50 mM) was prepared by dissolving GSH (Sigma) in deionized water. The solution w as then sterilized using a 0.2µ syringe filter and stored at 80°C in 0.5 ml aliquots. For glutathione pre treatments, mature adipocytes (day 9) were treated with 1 mM GSH or equivalent volume of saline solution for 20 hours. ER stress was induced by treat ing cells with 1 mM palmitate (Sigma.) For ER stress experiments, cells were cultured in DMEM supplemented with 10% FBS, 1% Penicillin/Streptomycin , and 0.75% fatty acid free bovine serum albumin (BSA ) (58) . Palmitic acid was dissolved in 0.1M aqueous NaOH and incubated at 37°C for 45 minutes before being quickly dissolved in medium supplemented with 0.75% BSA at 37°C. The resulting medium was incubated overnight before being used the following

PAGE 29

29 day. To indu ce ER stress, palmitate was added to a final concentration of 1 mM. Medium containing 0.75% BSA served as a control for these experiments. Fatty acid free BSA (Sigma ) was purchased or prepared by the method adapted from Chen (59) . Briefly, 5g BSA was dissolved in 50ml deionized H 2 O and pH was lowere d to 3.0 using 0.1 M HCl. 2.5g activated charcoal (Sigma) was then added. The resulting slurry was magnetically stirred at 4°C overnight before being transferred to multiple microfuge tubes and centrifuged at 13,000 rpm for 20 minutes. The supernatant was collected and pH was adjusted to 7.0 by addition of 0.1 M NaOH. The resulting solution was then sterile filtered using a 0.2µ filter and degassed before being stored at 4°C. Thapsigargin (Santa Cruz Biotechnology) was used as a positive control for ER stress marker experiments. A 1 mM stock solution was created by dissolving thapsigargin in DMSO and the final concentration of thapsigargin used in experiments was 1 µ M. Measurement o f Total Glutathione Total intracellular glutathione was measured using a commercial assay kit (Cayman Chemical ) . Cells were washed with cold phosphate buffered saline ( PBS ) before addition of cold MES buffer. Cells were then scraped and transferred to a 1.5 ml Eppendorf tube before being sonicated twice in ten second bursts. To cell lysates, an equal volume of meta phosphoric acid (MPA) was added . After 5 minutes of incubation with MPA, lysates were centrifuged for 4 minutes at 12,000 rpm to precipitate proteins . De proteinated cell lysates were stored at 80°C for future analysis. Measurement of t otal and HMW adiponectin Total and HMW adiponectin was measured in conditioned medium using a commercial ELISA kit (Alpco Adiponectin (Mouse) Total, HMW ELISA.) This protocol was modified from the method designed Harris et al (60) which adapted the original protocol to be

PAGE 30

30 more suitable for mea suring adiponectin in conditioned medium. To measure HMW adiponectin, 50 µ L of conditioned medium was incubated with 100 µ L protease solution before being neutralized by 100 µ L sample pre treatment buffer. This protease specifically digests lower order iso forms of adiponectin, isolating the HMW isoform for analysis. The sample was then diluted 25 times before being assayed according to the standard protocol. To measure total adiponectin, 50 µ L of conditioned medium was added to 200 µ L sample pre treatment b uffer. The sample was then diluted 75 times before being assayed according to the standard protocol. Western Blot A nalysis Cells were washed with cold PBS before being scraped in 1xRIPA buffer supplemented with protease inhibitors (Pierce) and phosphata se inhibitors (PhosSTOP, Sigma). The cell lysate was then sonicated twice in ten second bursts. Cellular debris were pelleted by centrifugation at 12,000 rpm for 20 minutes at 4°C. The Bradford method (Biorad) was used to determine total protein concentration s. Cell lysates containing 40 µ g protein were dissolved in SDS running buffer (Thermo Fisher Scientific) and boiled at 70°C for 10 minutes before being loaded onto a 12% Bis Tris ge l for electrophoresis. Samples were ran in duplicate against M olecular weig ht standards (Precision Plus, dual color, Bio Rad) and MagixMark XP Western Protein Standard s (Invitrogen.) The gel was then transferred onto a nitrocellulose membrane ( Biorad ) before being blocked for 1 hour in blocking buffer consisting of TBST (tris buf fered saline, pH 7.4 and 0.01% Tween 20) supplemented with 5% BSA or non fat dry milk. The blocked membranes were washed and incubated with primary antibodies overnight at 4 ° C. Membranes were probed as follows: CHO P (1:1000) ( Cell Signaling Technologies ) . Following incubation with primary antibodies, membranes were subsequently probed with the correct secondary

PAGE 31

31 antibody: anti rabbit secondary antibody conjugated to horseradish peroxidase (1:2000) (Cell Signaling Technologies). tubulin was used as a prote in loading standard. The primary antibody was directed against stripped membranes as follows: (1:5000) (Sigma) before probing with the secondary antibody, goat anti mouse secondary antibody conjugated to horseradish peroxidase (1:2000) (Cell Signaling Tech nologies). Membrane bound antibodies were detected using an electrochemiluminescent detection reagent ( Thermo Fisher Scientific ) . RNA isolation and RT qPCR Cells were lysed in cold RNAzol RT lysis buffer ( Sigma ) and stored at 80°C for future analysis. Fro zen cell lysates were thawed by placing on a dry heat block set at 37°C for 5 minutes. Lysates were then centrifuged at 12,000 rpm for 5 minutes and residual and checked for purity. cDNA was synthesized using a commercial high capacity reverse transcription kit (Applied Biosystems.) RT qPCR was performed using Power SYBR Green PCR Master Mi x (Applied Biosystems ) and the CFX96 Real Time PCR system (Bio Rad) according to th e instructions . The standard curve method was used for quantitation of results . Stand ard curves featured the original sample and three 10 fold serial dilutions of the original sample . mRNA concentrations were standardized to the housekeeping gene RPL13a . Primer sequ ences are shown in T able 2 1 . Oil Red O Staining Mature 3T3 L1 adipocytes (Day 9) were stained with Oil Red O by the following method (Derived from biolonza.) Cells were gently washed with cold PBS before a 2% paraformaldehyde solu tion in PBS was added. Cells were incubated at room

PAGE 32

32 temperature for 90 minutes. Cells were then washed with ddH 2 O before 1 ml of a working solution of Oil Red O was added for 5 minutes. Cells were then washed again with ddH 2 O before observed under a phase contrast microscope at 100x magnification. Photos were taken with a digital camera ( Canon ) . Statistical Analysis Statistics were performed using SigmaPlot 11. Data are expressed as mean ± SD or mean ± SE. test was used to determine whether glut athione treatment significantly increased intracellular glutathione concentrations. A one way ANOVA was used to determine differences in gene expression, protein expression, and adiponectin secretion between treatment groups. A two way analysis of variance (ANOVA) was used to determine differences in intracellular glutathione concentrations during ER stress . Time and treatment group were factors and glutathione concentrations were the quantity being compared. For post hoc analysis, the Holm Sidak method was used. A p value of <0.05 was considered significant for these experiments.

PAGE 33

33 Table 2 1. Primer sequences used for RT qPCR. Gene XBP1s XBP1u ERo RPL13A TGAGTCCGCAGCAGGT GCTTGGGAATGGACACGCTG CGATATACAGTCCCCCGATG GCAAGTTCACAGAGGTCCTCA A TGTCAGAGTCCATGGGAAGA GCACATAGTCTGAGTGCTGCG ACTTTTTCCTCGCCCAGAAG GGCATGAGGCAAACAGTCTTT A

PAGE 34

34 CHAPTER 3 RESULTS The aim of this study was to investigate any protective effects of bolstering glutathione concentrations in 3T3 L1 adipocytes during ER stress. 3T3 L1 adipocytes were grown to maturity. The presence of lipid droplet accumulation was shown using Oil Red O staining (Figure 3 1). An aqueous solution of glutathione (1 mM) was used as pre treatment before treatment with palmitate (1 mM) to induce ER stress. Following these treatments, glutathione concentrations in the cell were measured. To investigate the effect of in creasing glutathione concentrations on UPR signaling, CHOP and XBP1s were measured by western blotting and RT qPCR respectively. Adiponectin secretion was measured by ELISA and gene expression of the ER chaperone, ERO 1 was measured using RT qPCR. Glutath ione uptake into 3T3 L1 adipocytes and effect of ER stress on glutathione concentrations Uptake of GSH into mature 3T3 L1 adipocytes was determined by incubating cells with GSH (1 mM) or vehicle (saline) for 20 hours. Cells were washed with PBS before being lysed in cold MES buffer. Intracellular glutathione was measured using a commercial colorimetric assay. Glutathione concentrations were reported as n mole s glutathione / mg cellular protein . Total protein was determined using the Bradford method. To d etermine how palmitate induced ER stress affects intracellular glutathione concentrations, a tim e course experiment was performed. C ells were pre treated with or without GSH as described above . Fresh media was then added containing palmitate (1 mM) or vehicle (0.75% BSA) and cells were incubated for 6, 12, or 24 hours. Cells were lysed and assayed for glutathione concentration s as described above . 20 hours following incubation with GSH, cells showed a significant increase in glutat hione

PAGE 35

35 concentrations (approximately 60%) , implying uptake of reduced glutathione into the cell ( F igure 3 2 ) . During ER stress, glutathione concentrations decreased after 12, and 24 hours. GSH pre treatment did not ameliorate this effect ( Figu re 3 3 ) . Effec t of glutathione pre treatment on UPR markers in 3T3 L1 adipocytes during ER stress CHOP protein expression was measured to assess activation of the PERK pathway of the UPR. 3T3 L1 adipocytes were treated with 1 mM palmitate or vehicle (0.75% BSA) for 12 h ours. Additionally, the effect of 20 hours pre treatment with 1 mM GSH was investigated . Cells were lysed in cold 1XRIPA buffer supplemented with protease and phosphatase inhibitors. Total protein content was determined using the Bradford method. 3T3 L1 adipocytes treated with thapsigargin for 12 hours were used as a positive control . Densit ometric analysis was performed on protein bands . 3T3 L1 cells treated with 1 mM palmitate showed an approximate 50% increase CHOP induction at 12 hours ( Fi gure 3 4 ) . Interestingly, GSH pre treatment completely ameliorated this effect. Activation of the IRE 1 pathway of the UPR results in cleavage of a 28 base pair intron from XBP1 (XBP1u), resulting in the spliced variant of the gene, XBP1s. XBP1s and XBP1u mRNA expression was measured to assess activation of the IRE 1 pathway of the UPR. 3T3 L1 adipocytes w ere treated with 1 mM palmitate or vehicle (0.75% BSA) for 12 hours. Additionally, the effect of 20 hours pre treatment with 1 mM GSH or vehicle was observed. Total RNA was isolated using RNAzol RT lysis buffer. 1 µ g RNA was reverse tra nscribed using a com mercial kit. RT qPCR was performed and results were quantified using the standard curve method. Data were normalized to the housekeeping gene, RPL13a. Expression of XBP1s was approximately 6 fold higher in

PAGE 36

36 cells treated with palmitate compared to controls ( Figure 3 5, A ) . GSH pre treatment had no significant effect on XBP1s mRNA expression. No significant change in XBP1u was observed in cells treated with palmitate or pre treated with GSH ( Figure 3 5, B ). Glutathione does not attenuate the decrease in HMW adiponectin secretion caused by treatment with palmitate A study by Mondal et al. showed human adipose stem cells secrete less HMW adiponectin under ER stress (19) . To determine if ER stress has a similar effect on HMW adiponectin secretion in 3T3 L1 adipocytes, adiponectin was measured in conditioned medium after 24 hours of treatment with palmitate (1 mM.) The effect of 20 hours of GSH pre treatment (1 mM) was als o investigated. Adiponectin concentrations were quantified using ELISA and standardized to total cellular protein to obtain the units of ng adiponectin / mg cellular protein. Total protein was de termined using the Bradford method. Total and HMW adiponectin were both quantified . Treatment with palmitate did not significantly decrease total adiponectin secretion from 3T3 L1 adipocytes after 24 hours Figure 3 6, A . However, a significant decrease in HMW adiponectin was observed ( ~60 % ) ( Figure 3 6, B). GSH pre treatment did not ameliorate this effect. Surprisingly, GSH pretreatment also resulted in a small, but significant decrease in t otal adiponectin secretion relative to non palmitate treated controls. Glutathione pre treatment lowers ERo ERo one of the primary oxidoreductases found in the ER and thought to be the rate limiting enzyme in disulfide bond formation. Here, ERo expression was measured to determine if ER stress induced by palmitate upregulates ERo expression in 3T3 L1 cells and whether GSH pre treatment has influences ERo

PAGE 37

37 expression. 3T3 L1 adipocytes were treated with 1 mM palmitate or vehicle (0.75% BSA) for 12 hours. Additionally, the effect of 20 hours pre trea tment with 1 mM GSH or vehicle was ob served. Total RNA was isolated using RNAzol RT lysis buffer . 1 µ g RNA was reverse transcribed using a commercial kit (Applied Biosystems.) RT qPCR was performed and results were quantified using the standard curve method. Data were normalized to the housek eeping ge ne, RPL13a. ERo expression was not significantly affected by palmitate treatment, indicating that this gene was not upregulated in ER stress (Figure 3 7) . However, GSH pre treatment suppressed ERo expression by approximately 80%.

PAGE 38

38 Figure 3 1. Oil Red O staining of 3T3 L1 adipocytes. Photos were taken Day 9 after differentiation using a phase contrast microscope (100x magnific ation) and a digital camera (Ca non). Oil Red O dye selectively stains lipids a red color.

PAGE 39

39 Figure 3 2 . Glutathione uptake into 3T3 L1 adipocytes . Mature 3T3 L1 adipocytes were incubated with 1 mM GSH or vehicle ( saline ) for 20 hours. Cells were lysed in MES buffer and deproteinated using 5% MPA. The supernatant was analyzed for total glutathione concentrations. Data represent three independent experiments and are reported as mean ± SD test ( P= 0.0 26 ).

PAGE 40

40 Figure 3 3 . Intracellular glutathione concentrations in 3T3 L1 adipocytes during ER stress . Mature 3T3 L1 adipocytes were incubated with 1 mM GSH or vehicle ( saline ) for 20 hours. The media was then removed and cells were incubated with fresh media supplemented with palmitate (1 m M) or vehicle (0.75% BSA) for 6 , 12 , or 24 hours. Cells were lysed in MES buffer and deproteinated using 5% MPA. The supernatant was analyzed for total glutathione concentrations. Data represent three independent experiments and are reported as mean ± SD analyzed by two way ANOVA. Different lowercase letters denote significant differences between treatment groups ( P< 0 .05 vs. treatment) . a b b b b a a a a

PAGE 41

41 Figure 3 4 . GSH pre treatment prevents induction of CHOP during palmitate induced ER stress. 3T3 L1 adipocytes were pre treated with 1 mM GSH or vehicle for 20 hours prior to treatment with 1 mM palmitate or vehicle for 12 hours. CHOP protein expression in cell lysates was measured by western blotting tubulin. Cells treated with thapsigargin were used as a positive control. Data represent densitometric analysis of relative densities of each protein band . Results are reported as mean ± SD of three independent experiments analyzed by ANOVA ( P< 0 .001 for all significant differences ). Different l owercase letters denote significant differences between treatment groups. b a c CHOP tubulin Veh Palm Palm GSH (+) Thap ~27 kDa ~ 50

PAGE 42

42 Figure 3 5 . GSH pre treatment does not decrease XBP1s mRNA expression during palmitate induced ER stress. 3T3 L1 adipocytes were treated with 1 mM palmitate for 12 hours. The effect of 20 hours pre treatment with GSH was also investigated. RT qPCR was performed t o assess splicing of the XBP1 transcript. Data were normalized to RPL13A and reported as a fold increase from vehicle treated cells. Results were reported as mean ± SD of t hree independent experiments ( P <0. 01) ( A) . XBP1u mRNA was also measured. No significant changes were shown in cells treated wi th palmitate or palmitate + GSH (B) . Different lowercase letters denote significant differences between treatment groups.

PAGE 43

43 Figure 3 6 . Adiponectin secretion , Total and HMW. 3T3 L1 adipocytes were pre treated with 1 mM GSH or vehicle ( saline ) for 20 hours prior to treatment with 1 mM palmitate or vehicle (0.75% BSA) for 24 hours. Conditioned media was collected and centrifuged for 4 minute s at 12,000 rpm to pellet cell debris. Total (A) and HMW (B) adiponectin was quantitated using ELISA and standardized to total cellular protein. R esults are reported as mean ± SD of three independent experiments analyzed using ANOVA . P value s are ( P =0.029 ) and ( P<0.0 01 ) for total and HMW adiponectin respectively. Different lowercase letters denote significant differences between treatment groups. a a,b b a b b

PAGE 44

44 Figure 3 7 . GSH pre treatment decreases ERo 1 mRNA expression . ERo 1 mRNA expression was measured using RT qPCR. 3T3 L1 adipocytes were treated with 1 mM glutathione or vehicle (saline ) before being treated with 1 mM palmitate or vehicle (0.75% BSA) for 12 hours. Data were normalized to RPL13A and reported as a fold change from vehicle treated cells. Results were reported as mean ± SD of three independent experiments. (P = 0.015) . Different lowercase letters denote significant differences between treatment groups.

PAGE 45

45 CHAPTER 4 DISCUSSION Glutathione is one of the major endogenous antioxidants in the human body. Many chronic diseases, including obesity and type 2 diabetes are associated with oxidative stress, ER stress, glutathione depletion , and lower antioxidant capacity. Recently , GSH su pplements with higher bioavailability have been proven to increase intracellular GSH in lymphocytes, erythrocytes, and buccal cells (44) . Whether the s ame effect would be seen in cells of peripheral tissues remains to be determined. The ability of various cell types to uptake GSH from the extracellular environment would be one important factor. Therefore, one of the aim s of this study was to show that extracellular GSH is able to influence intracellular glutathione concentrations in 3T3 L1 adipocytes. It was also investigated w hether higher concentrations of glutathione may confer resistance to ER stress in this same cell line . Mature adipocytes were pre treated with or without GSH before being treated with the free fatty acid, palmit ate. Palmitate is known to induce both ER stress and oxidative stress and was used in this study to mimic high concentrations of fatty acids that adipocytes may be exposed to during obesity (61) . In addition, ER stress has been shown to decrease HMW adiponectin secretion; therefore, the effect of GSH on adiponectin secretion during ER stress was also evaluated . Dietary sources of glutathione are known to have poor bioavailability. Furthermore, concentrations of glutathione in the extracellular environment are between one and three orders of magnitude low er than that inside of the cell (62) . Th is, in combination with the hydrophilic nature of glutathione and lack of specific importers has popularized the idea that glutathione uptake into cells is poor. Conversely, a small

PAGE 46

46 number of studies have reported GSH uptake into cells (42, 43) . The se data support the idea that 3T3 L1 adipocytes uptake GSH from the extracellular environment. Incubating 3T3 L1 adipocytes with 1 mM GSH for 20 hours resulted in an approximate 60% increase in tot al glutathione concentrations. Numerous possible glutathione transporters have been identified, many of which are non specific (63) . It is possible than non specific transporters such as the organic ion transporter family ( OAT ) may mediate GSH uptake across the plasma membrane. The exact roles and mechanisms of these transport ers with respect to GSH are still being investigated. Alternatively, GSH may not cross the plasma membrane intact. 3T3 L1 cells and many other cell types express glutamyl transpeptidase, which may cleave GSH, resulting in free cysteine. C ysteine may then be taken up by the cell via amino acid transporters. An increase in intracellular cysteine could also explain the increased glutathione concentrations reported here. ER stress is involved in the pathology of obesity and is associated with oxidative stress and glutathione depletion. Glutathione is able to neutralize ROS and is thought to contribute to proper folding of proteins by maintaining the pool of reduced PDI in the ER. Although glutathione may contribute to proper protein folding , other studies have questioned its importance. Tsunoda et al. showed that GSH was dispensable to many protein folding features of the ER, but may still be important in folding large proteins with several disulfide bonds (40) . It was hypothesized that treatment with palmitate would deplete glutathione concentrations in 3T3 L1 adipocytes and pre treatment with GSH would ameliorate this effect . Indeed, a f ter 12 or 24 hours of palmitate treatment, intracellular glutathione concentrations decreased by ~50%. However, GSH pre -

PAGE 47

47 treatment did not ameliorate this effect. Interestingly, there was a trend towards lower glutathione concent rations 6 hours following pa lmitate treatment in cells pre treated with GSH . The non allosteric feedback inhibition of glutamate cysteine ligase (GCL) by glutathione may explain this. The se data are in line with previous studies showing that saturated free fatty acids induce oxidativ e stress to cells by UPR signaling or other pathways (64) . These data also suggests that any protective effects of augmenting glutathione concentrations during ER stress is likely to occur early during the onset of stress or by a mechanism that does not rely only on free GSH acting as an antioxidant or assisting in protein folding. Although, pre treating 3T3 L1 adipocytes with GSH did not prevent glutathione depletion during palmitate induced ER stress, GSH pre treatment did show other biological effects, such as significantly decreasing induction of CHOP, a downstream target of the PERK eIF2 ATF4 signaling pathway associated with ER stress induced cell death. The spliced variant of XBP1 (XBP1s) was also measured as a marker for activation of the IRE1 pathway of the UPR and wa s upregulated in response to palmitate. GSH pre treatment did not significantly affect XBP1s mRNA expression. XBP1s binds to ER stress response elements in its target genes and is involved in lipid synthesis, endoplasmic reticulum associated protein degrad ation ( ERAD ) and initiation of adipogenesis (65) . Therefore, XBP1s is thought to promote cellular adaptation to ER stress. XBP1s overexpression in murine embryonic fibroblasts conferred resistance to ER stress and insulin resistance . Furthermore, obese XBP1 +/ mice sho wed insulin resistance and increased PERK phosphorylation compared to WT mice (10) . Seeing that GSH pre treatment completely ameliorated CHOP expression , but did not a ffect

PAGE 48

48 XBP1s, it is tempting to speculat e that increased intracellular GSH concentrations may modulate UPR signaling in response to ER stress, possibly conferring stress resistance and promoting adaptation over cell death. Adipocyte cell death has been shown to be associated with adipose tissue inflammation and insulin resistance during obesity. It has been shown that adipocytes undergoing cell death in obese adipose tissue show morphological features of pyroptosis, a programmed form of cell death resulting in inflammation (16) . M ice lacking CHOP seem to be protected against pyroptotic cell death (66) . Therefore, CHOP induction may be crucial in adipocyte pyroptosis . The fact that GSH strongly prevented CHOP induction by palmitate treatment poin ts to a possible role of GSH in reducing adipocyte cell death during obesity. The mechanism by which GSH prevents CHOP induction is not known. However, CHOP is more highly induced in mice lacking glutathione S transferase Pi ( GSTP ), a protein catalyzing S glutathionylation of proteins, compared to WT mice during ER stress. This implies that protein S glutathionylation of proteins upstream of CHOP m ay regulate its expression. (67) . Protein S glutathionylation has been shown to occur when cells are facing oxidative stress and may influenc e protein function (67, 68) . The binding of GSH to cysteine residues on proteins occurs more readily when intracellular glutathione concentrations are high and the redox environment is mildly oxidizing in order to facilitat e disulfide bonding. Conversely, protein de glutathionylation is favored under reducing conditions and can be mediated by redox proteins including thioredoxins and glutaredoxins. It was recently reported that S glutathionyl ation of key ER stress proteins c an alter UPR signaling . B one marrow derived dendritic cells and murine embryonic

PAGE 49

49 fibroblasts cells lacking GSTP showed increased mRNA and protein express ion of CHOP and IRE1 in response to treatment with the pharmacological ER stress inducers thapsi gargin or tunicamycin (67) . Therefore, higher glutathione concentrations may be ER protective by increasing S glutathionylation of UPR proteins . However, f urther studies are needed to confirm that excess glutathione concentrations directly increase s S glutathionylation of proteins . Interestingly , GSH pre treatment did not significantly affect XBP1s gene expression even though IRE1 expression has been shown to be regulated by S glutathionylation. Therefore, the PERK pathway of UPR signaling may be more susceptible to glutathione concentrations than IRE1. Besides acting as a reservoir for energy storage, adipocytes partake a signaling role by secreting adipokines such as leptin and adiponectin. Adiponectin is an anti inflammatory adipokine with insulin sensitizing properties and is inversely correlated with BMI. ER stress is associated with decrease d adiponectin secretion. Mondal et al. showed that murine adipose stem cells secr eted less adiponectin (total and HMW) during ER stress (19) . Furthermore, this decrease was associated with a small, but significant increase in mRNA expression of the redox active protein ERo . ERo may prevent folding of adiponectin into i ts HMW form by interfering with thiol mediated protein retention and causing premature secretion of adiponectin from the cell (52) . Therefore, I aimed to determine whether GSH pre treatment may increase HMW and total adiponectin secretion during ER stress , perhaps by antagonizi ng ERo activity . GSH pre treatment did not have any effect on HMW adiponectin secretion after 24 hours of incubation with palmitate in 3T3 L1 adipocytes . Interestingly, GSH pre treatment slightly decreased total adiponectin secretion relative to vehicle and cells

PAGE 50

50 treated with palmitate alone. There was no significant difference between adiponectin concentrations in conditioned media between palmitate and vehicle treated cells at 24 hours. Also, GSH pretreatment resulted in decreased ERo mRNA expressio n relative to both vehicle and palmitate treated cells. Therefore, it is possible that GSH may regulate ERo at the transcriptional level. I hypothesized that GSH may act antagonistically of ERo by maintaining a pool of reduced PDI in the ER. This cou ld allow for proper assembly of HMW adiponectin before the protein i s secreted. In this case, I expecte d that GSH would increase HMW adiponectin secretion from 3T3 L1 adipocytes during ER stress. It was also hypothesized that ERo would be upregulated during ER stress, as CHOP is known to upregulate ERo mRNA expression (69) . However, I did not see this occurrence, perhaps because palmitate is a mild ER stress inducer compared to pharmacological agents such as thapsigargin. The observed suppression of ERo mRNA express ion by GSH may also explain why total adiponectin secretion was low er in GSH pre treated cells. ERo the rate limiting enzyme in disulfide bond formation in the ER. Therefore, decreased ERo expression could actually prevent disulfide bonding and secretion of many proteins, including adiponectin. This study pointed out potential roles of GSH as a signaling molecule outside of its normal roles as an antioxidant and in assisting with protein folding. Few studies have investigated how increasing glutathione status in the cell affects ER stress related outcomes. Further more, it was shown that exogenous GSH was able to increase intracellular GSH, perhaps by directly crossing the plasma membrane. Although, the se data show that higher initial glutathione concentrations may not prevent its depletion by

PAGE 51

51 palmitate, protein bou nd g lutathione was not measured and may represent an additional pool of intracellular glutathione. GSH pretreatment ameliorated CHOP induction in 3T3 L1 adipocytes during ER stress. Increased S glutathionylation of proteins is a plausible mechanism. Howeve r, future studies should determine whether S glutathionylation is depende d on glutathione concentrations, in addition to GSTP activity. Furthermore, exactly which UPR proteins are glutathionylated also remains to be determined. GSH has been shown bind to t ranscription factors c jun and NF kB , inhibiting their function (70) . It is also plausible that GSH could bind to the transcription factor ATF4 , preventing it from upregulating CHOP. This study showed that GSH pre treatment did not increase H M W adiponectin secretion from 3T3 L1 adipocytes during ER stress . The lack of effect of GSH on HMW adiponect in secretion suggests that redox chaperones other than Ero may be more important in maintaining secretion of HMW adiponectin during ER stress. Indeed , disulfide bond A oxidoreductase like protein (DsbA L) has been shown to localize in the ER and prevent the decrease in HMW adiponectin secretion by thapsigargin induced ER stress in 3T3 L1 adipocytes (71, 72) . T herefore, future studies should invest igate regulation of this chaperone during ER stress . A li mitation of this study is that intracellular adiponectin concentrations were not measured. Therefore, it cannot be known whether the decrease in HMW adiponectin secretion was due to impaired synthesis or secretion. Finally, GSH suppressed ERo expression, which is in line with previous studies showing that ERo upregulated by CHOP during ER stress. Th erefore, ERo also be regulated by S glutathionylation of its upstream proteins.

PAGE 52

52 In summary, GSH may play a role in determi ning cell fate during ER stress by tilting UPR signaling towards survival, rather than cell death. This could be favorable during obesity and MetS , as adipocyte cell death is linked to inflammation and insulin resistance. Therefore, bolstering intracellular glutathione concentrations in the adipocyte may help prevent these comorbidities. Future animal studies could point out whether highly bioavaila ble oral glutathione supplements may be effective in increasing adipocyte glutathione concentrations . Glutathione may also be increased by hormetic compounds in food that target the NRF2 pathway, such as curcumin and sulphoraphane (73) .

PAGE 53

53 Figure 4 1 . Hypothetical mechanism of action explaining how increased intracellular glutathione alters UPR signaling . Increased intracellular glutathione in the presence of oxidative stress favors S glutathionylation of proteins containing cysteine residues. ATF4 (mouse and human) contains multiple cysteine residues which may serve as targets for S glutathionylation, perhaps inhibiting the DNA binding activity of the protein . Downstream effects incl ude decreased CHOP and Er o 1 expression. Decreased availability of Er o 1 may prevent release of thiol retained proteins from the ER, including adiponectin. BRANDON EUDY © 2016

PAGE 54

54 LIST OF REFERENCES 1. Eckel RH, Grundy SM, Zimmet PZ. The metabolic syndrome. Edtion ed. Lancet. England, 2005:1415 28. 2. Ford ES, Li C, Zhao G. Prevalence and correlates of metabolic syndrome based on a harmonious definition among adults in the US. J Diabetes 2010;2(3):180 93. doi: 10.1111/j.1753 0407.2010.0007 8.x. 3. Dunham Snary KJ, Ballinger SW. Mitochondrial genetics and obesity: evolutionary adaptation and contemporary disease susceptibility. Free Radic Biol Med 2013;65:1229 37. doi: 10.1016/j.freeradbiomed.2013.09.007. 4. Shungin D, Winkler TW, Croteau Cho nka DC, et al. New genetic loci link adipose and insulin biology to body fat distribution. Edtion ed. Nature. England, 2015:187 96. 5. O'Rahilly S, Farooqi IS. The Genetics of Obesity in Humans. Edtion ed. In: De Groot LJ, Beck Peccoz P, Chrousos G, et al. , eds. Endotext. South Dartmouth MA: MDText.com, Inc., 2000. 6. Musso G, Gambino R, Cassader M. Obesity, diabetes, and gut microbiota: the hygiene hypothesis expanded? Edtion ed. Diabetes Care. United States, 2010:2277 84. 7. Kalliomaki M, Collado MC, Salm inen S, Isolauri E. Early differences in fecal microbiota composition in children may predict overweight. Edtion ed. Am J Clin Nutr. United States, 2008:534 8. 8. Al Hamodi Z, Al Habori M, Al Meeri A, Saif Ali R. Association of adipokines, leptin/adiponect in ratio and C reactive protein with obesity and type 2 diabetes mellitus. Edtion ed. Diabetol Metab Syndr. England, 2014:99. 9. Ozcan L, Tabas I. Role of endoplasmic reticulum stress in metabolic disease and other disorders. Annu Rev Med 2012;63:317 28. d oi: 10.1146/annurev med 043010 144749. 10. Ozcan U, Cao Q, Yilmaz E, et al. Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 2004;306(5695):457 61. doi: 10.1126/science.1103160. 11. Malhotra JD, Kaufman RJ. Endoplasm ic reticulum stress and oxidative stress: a vicious cycle or a double edged sword? Antioxid Redox Signal 2007;9(12):2277 93. doi: 10.1089/ars.2007.1782. 12. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 2001;107(7):881 91.

PAGE 55

55 13. Oyadomari S, Mori M. Roles of CHOP/GADD153 in endoplasmic reticulum stress. Cell Death Differ 2004;11(4):381 9. doi: 10.1038/sj.cdd.4401373. 14. McCullou gh KD, Martindale JL, Klotz LO, Aw TY, Holbrook NJ. Gadd153 sensitizes cells to endoplasmic reticulum stress by down regulating Bcl2 and perturbing the cellular redox state. Mol Cell Biol 2001;21(4):1249 59. doi: 10.1128/mcb.21.4.1249 1259.2001. 15. Yamagu chi H, Wang HG. CHOP is involved in endoplasmic reticulum stress induced apoptosis by enhancing DR5 expression in human carcinoma cells. J Biol Chem 2004;279(44):45495 502. doi: 10.1074/jbc.M406933200. 16. Giordano A, Murano I, Mondini E, et al. Obese adipocytes show ultrastructural features of stressed cells and die of pyroptosis. J Lipid Res 2013;54(9):2423 36. doi: 10.1194/jlr.M038638. 17. Fink SL, Cookson BT. Apoptosis, pyroptosis, and necrosis: mechanistic description of dead and dying eukaryotic c ells. Infect Immun 2005;73(4):1907 16. doi: 10.1128/iai.73.4.1907 1916.2005. 18. Lebeaupin C, Proics E, de Bieville CH, et al. ER stress induces NLRP3 inflammasome activation and hepatocyte death. Cell Death Dis 2015;6:e1879. doi: 10.1038/cddis.2015.248. 1 9. Mondal AK, Das SK, Varma V, et al. Effect of endoplasmic reticulum stress on inflammation and adiponectin regulation in human adipocytes. Metab Syndr Relat Disord 2012;10(4):297 306. doi: 10.1089/met.2012.0002. 20. Yin J, Wang Y, Gu L, Fan N, Ma Y, Peng Y. Palmitate induces endoplasmic reticulum stress and autophagy in mature adipocytes: implications for apoptosis and inflammation. Int J Mol Med 2015;35(4):932 40. doi: 10.3892/ijmm.2015.2085. 21. Leamy AK, Egnatchik RA, Young JD. Molecular mechanisms and the role of saturated fatty acids in the progression of non alcoholic fatty liver disease. Prog Lipid Res 2013;52(1):165 74. doi: 10.1016/j.plipres.2012.10.004. 22. Hotamisligil GS. Endoplasmic reticulum stress and the inflammatory basis of metabolic dise ase. Edtion ed. Cell. United States: 2010 Elsevier Inc, 2010:900 17. 23. Harding HP, Zeng H, Zhang Y, et al. Diabetes mellitus and exocrine pancreatic dysfunction in perk / mice reveals a role for translational control in secretory cell survival. Edtion e d. Mol Cell. United States, 2001:1153 63. 24. Cinti S, Mitchell G, Barbatelli G, et al. Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. Edtion ed. J Lipid Res. United States, 2005:2347 55.

PAGE 56

56 25. Alkhou ri N, Gornicka A, Berk MP, et al. Adipocyte apoptosis, a link between obesity, insulin resistance, and hepatic steatosis. Edtion ed. J Biol Chem. United States, 2010:3428 38. 26. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF. A novel serum prote in similar to C1q, produced exclusively in adipocytes. J Biol Chem 1995;270(45):26746 9. 27. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K. cDNA cloning and expression of a novel adipose specific collagen like factor, apM1 (AdiPose M ost abundant Gene transcript 1). Edtion ed. Biochem Biophys Res Commun. United States, 1996:286 9. 28. Nakano Y, Tobe T, Choi Miura NH, Mazda T, Tomita M. Isolation and characterization of GBP28, a novel gelatin binding protein purified from human plasma. J Biochem 1996;120(4):803 12. 29. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose specific gene dysregulated in obesity. J Biol Chem 1996;271(18):10697 703. 30. Pires A, Martins P, Pereira AM, et al. Pro inflammatory triggers in childhood obesity: correlation between leptin, adiponectin and high sensitivity C reactive protein in a group of obese Portuguese children. Rev Port Cardiol 2014;33(11):691 7. doi: 10.1016/j.repc.2014.04.004. 31. Atzmon G, Pollin TI, Crandall J, et al. Adiponectin levels and genotype: a potential regulator of life span in humans. Edtion ed. J Gerontol A Biol Sci Med Sci. United States, 2008:447 53. 32. Frizzell N, Rajesh M, Jepson MJ, et al. Succination of thiol groups in adipose tissue proteins in diabetes: succination inhib its polymerization and secretion of adiponectin. Edtion ed. J Biol Chem. United States, 2009:25772 81. 33. Caselli C. Role of adiponectin system in insulin resistance. Mol Genet Metab 2014;113(3):155 60. doi: 10.1016/j.ymgme.2014.09.003. 34. Yadav A, Katar ia MA, Saini V. Role of leptin and adiponectin in insulin resistance. Clin Chim Acta 2013;417:80 4. doi: 10.1016/j.cca.2012.12.007. 35. Yamauchi T, Kamon J, Ito Y, et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Edtion ed. Nature. England, 2003:762 9. 36. Hosogai N, Fukuhara A, Oshima K, et al. Adipose tissue hypoxia in obesity and its impact on adipocytokine dysregulation. Diabetes 2007;56(4):901 11. doi: 10.2337/db06 0911.

PAGE 57

57 37. Liu M, Xiang R, Wilk SA, et al. Fat specif ic DsbA L overexpression promotes adiponectin multimerization and protects mice from diet induced obesity and insulin resistance. Edtion ed. Diabetes. United States, 2012:2776 86. 38. Christophersen BO. The inhibitory effect of reduced glutathione on the l ipid peroxidation of the microsomal fraction and mitochondria. Biochem J 1968;106(2):515 22. 39. Montero D, Tachibana C, Rahr Winther J, Appenzeller Herzog C. Intracellular glutathione pools are heterogeneously concentrated. Redox Biol 2013;1(1):508 13. do i: 10.1016/j.redox.2013.10.005. 40. Tsunoda S, Avezov E, Zyryanova A, et al. Intact protein folding in the glutathione depleted endoplasmic reticulum implicates alternative protein thiol reductants. Elife 2014;3:e03421. doi: 10.7554/eLife.03421. 41. Chakra varthi S, Jessop CE, Bulleid NJ. The role of glutathione in disulphide bond formation and endoplasmic reticulum generated oxidative stress. EMBO Rep 2006;7(3):271 5. doi: 10.1038/sj.embor.7400645. 42. Kovacs Nolan J, Rupa P, Matsui T, et al. In vitro and e x vivo uptake of glutathione (GSH) across the intestinal epithelium and fate of oral GSH after in vivo supplementation. J Agric Food Chem 2014;62(39):9499 506. doi: 10.1021/jf503257w. 43. Hagen TM, Aw TY, Jones DP. Glutathione uptake and protection against oxidative injury in isolated kidney cells. Kidney Int 1988;34(1):74 81. 44. Richie JP, Jr., Nichenametla S, Neidig W, et al. Randomized controlled trial of oral glutathione supplementation on body stores of glutathione. Eur J Nutr 2015;54(2):251 63. doi: 10.1007/s00394 014 0706 z. 45. Hotamisligil GS. Inflammation and endoplasmic reticulum stress in obesity and diabetes. Int J Obes (Lond) 2008;32 Suppl 7:S52 4. doi: 10.1038/ijo.2008.238. 46. Bhandary B, Marahatta A, Kim HR, Chae HJ. An involvement of oxida tive stress in endoplasmic reticulum stress and its associated diseases. Edtion ed. Int J Mol Sci. Switzerland, 2012:434 56. 47. Higuchi Y. Glutathione depletion induced chromosomal DNA fragmentation associated with apoptosis and necrosis. J Cell Mol Med 2 004;8(4):455 64. 48. Giordano E, Davalos A, Nicod N, Visioli F. Hydroxytyrosol attenuates tunicamycin induced endoplasmic reticulum stress in human hepatocarcinoma cells. Mol Nutr Food Res 2014;58(5):954 62. doi: 10.1002/mnfr.201300465.

PAGE 58

58 49. Sun Y, Pu L Y, Lu L, Wang X H, Zhang F, Rao J H. N acetylcysteine attenuates reactive oxygen species mediated endoplasmic reticulum stress during liver ischemia reperfusion injury. World Journal of Gastroenterology : WJG 2014;20(41):15289 98. doi: 10.3748/wjg.v20.i41.152 89. 50. Malhotra JD, Miao H, Zhang K, et al. Antioxidants reduce endoplasmic reticulum stress and improve protein secretion. Edtion ed. Proc Natl Acad Sci U S A. United States, 2008:18525 30. 51. Cuozzo JW, Kaiser CA. Competition between glutathione and pr otein thiols for disulphide bond formation. Nat Cell Biol 1999;1(3):130 5. doi: 10.1038/11047. 52. Anelli T, Alessio M, Mezghrani A, et al. ERp44, a novel endoplasmic reticulum folding assistant of the thioredoxin family. Edtion ed. EMBO J. England, 2002:8 35 44. 53. White Gilbertson S, Hua Y, Liu B. The role of endoplasmic reticulum stress in maintaining and targeting multiple myeloma: a double edged sword of adaptation and apoptosis. Front Genet 2013;4:109. doi: 10.3389/fgene.2013.00109. 54. Wang ZV, Schra w TD, Kim JY, et al. Secretion of the adipocyte specific secretory protein adiponectin critically depends on thiol mediated protein retention. Edtion ed. Mol Cell Biol. United States, 2007:3716 31. 55. Landrier JF, Gouranton E, El Yazidi C, et al. Adiponec tin expression is induced by vitamin E via a peroxisome proliferator activated receptor gamma dependent mechanism. Edtion ed. Endocrinology. United States, 2009:5318 25. 56. Ohara K, Uchida A, Nagasaka R, Ushio H, Ohshima T. The effects of hydroxycinnamic acid derivatives on adiponectin secretion. Edtion ed. Phytomedicine. Germany, 2009:130 7. 57. Cho SY, Park PJ, Shin HJ, et al. ( ) Catechin suppresses expression of Kruppel like factor 7 and increases expression and secretion of adiponectin protein in 3T3 L1 cells. Edtion ed. Am J Physiol Endocrinol Metab. United States, 2007:E1166 72. 58. Oliveira AF, Cunha DA, Ladriere L, et al. In vitro use of free fatty acids bound to albumin: A comparison of protocols. Biotechniques 2015;58(5):228 33. doi: 10.2144/0001 14285. 59. Chen RF. Removal of fatty acids from serum albumin by charcoal treatment. J Biol Chem 1967;242(2):173 81.

PAGE 59

59 60. Harris CA, Haas JT, Streeper RS, et al. DGAT enzymes are required for triacylglycerol synthesis and lipid droplets in adipocytes. Edtio n ed. J Lipid Res. United States, 2011:657 67. 61. Boden G. Obesity and free fatty acids. Endocrinol Metab Clin North Am 2008;37(3):635 46, viii ix. doi: 10.1016/j.ecl.2008.06.007. 62. Lushchak VI. Glutathione homeostasis and functions: potential targets f or medical interventions. J Amino Acids 2012;2012:736837. doi: 10.1155/2012/736837. 63. Bachhawat AK, Thakur A, Kaur J, Zulkifli M. Glutathione transporters. Biochim Biophys Acta 2013;1830(5):3154 64. doi: 10.1016/j.bbagen.2012.11.018. 64. Guo W, Wong S, X ie W, Lei T, Luo Z. Palmitate modulates intracellular signaling, induces endoplasmic reticulum stress, and causes apoptosis in mouse 3T3 L1 and rat primary preadipocytes. Am J Physiol Endocrinol Metab 2007;293(2):E576 86. doi: 10.1152/ajpendo.00523.2006. 6 5. Sha H, He Y, Chen H, et al. The IRE1alpha XBP1 pathway of the unfolded protein response is required for adipogenesis. Cell Metab 2009;9(6):556 64. doi: 10.1016/j.cmet.2009.04.009. 66. Endo M, Mori M, Akira S, Gotoh T. C/EBP homologous protein (CHOP) is crucial for the induction of caspase 11 and the pathogenesis of lipopolysaccharide induced inflammation. J Immunol 2006;176(10):6245 53. 67. Ye Z, Zhang J, Ancrum T, Manevich Y, Townsend DM, Tew KD. S Glutathionylation of Endoplasmic Reticulum Proteins Imp acts Unfolded Protein Response Sensitivity. Antioxid Redox Signal 2016. doi: 10.1089/ars.2015.6486. 68. Ghezzi P, Romines B, Fratelli M, et al. Protein glutathionylation: coupling and uncoupling of glutathione to protein thiol groups in lymphocytes under o xidative stress and HIV infection. Mol Immunol 2002;38(10):773 80. 69. Li G, Mongillo M, Chin KT, et al. Role of ERO1 alpha mediated stimulation of inositol 1,4,5 triphosphate receptor activity in endoplasmic reticulum stress induced apoptosis. J Cell Biol 2009;186(6):783 92. doi: 10.1083/jcb.200904060. 70. Ghezzi P. Protein glutathionylation in health and disease. Biochim Biophys Acta 2013;1830(5):3165 72. doi: 10.1016/j.bbagen.2013.02.009. 71. Liu M, Chen H, Wei L, et al. ER localization is critical for D sbA L to Suppress ER Stress and Adiponectin Down Regulation in Adipocytes. J Biol Chem 2015. doi: 10.1074/jbc.M115.645416.

PAGE 60

60 72. Liu M, Zhou L, Xu A, et al. A disulfide bond A oxidoreductase like protein (DsbA L) regulates adiponectin multimerization. Edtion ed. Proc Natl Acad Sci U S A. United States, 2008:18302 7. 73. Bryan HK, Olayanju A, Goldring CE, Park BK. The Nrf2 cell defence pathway: Keap1 dependent and independent mechanisms of regulation. Biochem Pharmacol 2013;85(6):705 17. doi: 10.1016/j.bcp.20 12.11.016.

PAGE 61

61 BIOGRAPHICAL SKETCH Brandon Eudy was born in 1991 in New Bern, North Carolina. He attended North Caroli na State University from 2009 2013, where he graduated cum laude with a BS in chemistry. During his undergraduate career, he developed an avid interest i n the field of nutrition , which motivated him to pursue his MS in the D epartment of Food Science and Hu man Nutrition at the University of Florida. After graduating, Brandon will continue his education by pursuing a PhD in nutrition al s cience s to prepare him for a career in nutrition science research.