Citation
Drug Discovery Targeting Serotonin G Protein-Coupled Receptors in the Treatment of Neuropsychiatric Disorders

Material Information

Title:
Drug Discovery Targeting Serotonin G Protein-Coupled Receptors in the Treatment of Neuropsychiatric Disorders
Creator:
Felsing, Daniel E
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (218 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Pharmaceutical Sciences
Medicinal Chemistry
Committee Chair:
BOOTH,RAYMOND G
Committee Co-Chair:
SLOAN,KENNETH B
Committee Members:
JAMES,MARGARET O
MORGAN,DRAKE
Graduation Date:
4/30/2016

Subjects

Subjects / Keywords:
Agonists ( jstor )
Canals ( jstor )
Inurement ( jstor )
Ligands ( jstor )
Locomotion ( jstor )
Medical treatment ( jstor )
Molecular structure ( jstor )
Pharmacology ( jstor )
Receptors ( jstor )
Serotonin receptors ( jstor )
Medicinal Chemistry -- Dissertations, Academic -- UF
autism -- desensitization -- psychosis -- serotonin
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Pharmaceutical Sciences thesis, Ph.D.

Notes

Abstract:
Clinical data show that activation of 5-HT2C G protein-coupled receptors (GPCRs) can treat obesity (lorcaserin/Belviq) and psychotic disorders (aripiprazole/Abilify), including schizophrenia. 5-HT2C GPCRs are members of the 5-HT2 sub-family of 5-HT GPCRs, which include 5-HT2A, 5-HT2B, and 5-HT2C GPCRs. 5-HT2C is structurally similar to 5-HT2A and 5-HT2B GPCRs, but activation of 5-HT2A and/or 5-HT2B causes deleterious effects, including hallucinations and cardiac valvulopathy. Thus, there is a challenge to develop drugs that selectively activate only 5-HT2C. Prolonged activation of GPCRs by agonists reduces their function via a regulatory process called desensitization. This has clinical relevance, as 45% of drugs approved by the FDA target GPCRs, and agonist drugs (e.g., morphine) typically lose efficacy over time due to desensitization, which invites tolerance. Agonists that cause less desensitization may show extended clinical efficacy as well as a more acceptable clinical dose range. We hypothesized that structurally distinct agonists of the 5-HT2C receptor may cause varying degrees of desensitization by stabilizing unique 5-HT2C receptor conformations. Discovery of 5-HT2C agonists that exhibit minimal desensitization is therapeutically relevant for the pharmacotherapeutic treatment of chronic diseases such as obesity and psychotic disorders. The 5-HT7 receptor has recently been discovered as a druggable target, and selective activation of the 5-HT7 receptor has been shown to alleviate locomotor deficits in mouse models of Rett Syndrome. Additionally, buspirone has been shown to display therapeutically relevant affinity at 5-HT1A and is currently in phase II clinical trials to treat stereotypy in children with autism. The 5-PAT chemical scaffold shows high affinity towards the 5-HT7 and 5-HT1A receptors. Modulations around the 5-phenyl moiety were able to improve selectivity in binding towards the 5-HT7 receptor, whereas modulations of the alkyl chains bonded to the vital basic nitrogen modulated 5-HT1A selectivity. The lead candidate, (+)-o-F-5-PAT, was shown effective in attenuating three separate murine models of stereotypy and two models of drug-induced hyperlocomotion. Therefore, the 5-PAT chemical scaffold is a unique chemical scaffold enabling discrimination of therapeutic function of the 5-HT7 and 5-HT1A receptors in vivo. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2016.
Local:
Adviser: BOOTH,RAYMOND G.
Local:
Co-adviser: SLOAN,KENNETH B.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2017-05-31
Statement of Responsibility:
by Daniel E Felsing.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Daniel E Felsing. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
5/31/2017
Classification:
LD1780 2016 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

DRUG DISCOVERY TARGE TING SEROTONIN G PRO TEIN COUPLED RECEPTORS IN THE TREATMENT OF NEUROPSYCHIATRIC DIS ORDERS By DANIEL E. FELSING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2016 1

PAGE 2

2016 Daniel E. Felsing 2

PAGE 3

To my mother, father, grandmother, both sisters, friends, colleagues and all those that encouraged and supported me through this journey 3

PAGE 4

ACKNOWLEDGMENTS I would like to extend my genuine gratitude to my committee chair, Dr. Raymond Booth, for his support and direction through these five years in graduate school. His constant advice and encouragement allowed me to grow as a young scientist and were a tremen dous source of inspiration for me in the completion of this dissertation. I would additionally like to thank my thesis committee members: Dr. Ken Sloan for his expertise in physical chemistry, Dr. Margaret James for teaching me everything I know about xenobiotic metabolism, and Dr. Drake Morgan for educating me on the validity of in vivo rodent models in the treatment of mental disease states. Furthermore, I would also like to thank the post docs in my lab for teaching me lab techniques and helping me out during the challenging times of graduate school: Dr. Tania CordovaSintjago for helping me make sense of my in vitro experiments through in silico models Dr. Yue Liu for expanding my repertoire of molecular biology assays, Dr. Da rio Ambrosini for synthesizing the di halogenated 4PAT library and expertise in organic synthesis, Dr. Rajendar Ve mula and Mr. Chuck Perry for synthesizing the 5PAT library and answering my synthesis questions, but especially Dr. Clint Canal, for his encouraging support when troubleshooting experiments, his persistence in answering my scientific curiosities, and showing me what it takes to become a successful scientist. I would also like to thank all my colleagues in the department for their support and encouragement. In addition, I must thank the guest committee members Dr. David Janero and Dr. Joanna Peris for becoming a scientific sounding board whenever I needed them and voluntarily lending their time and wisdom from their drug discovery efforts to aid me in mine. Likewise, I must also thank Dr. Alexandros Makriyannis for welcoming me to the 4

PAGE 5

Center for Drug Discovery at Northeastern University and supporting my scientific endeavors wholeheartedly. 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES .......................................................................................................... 10 LIST OF FIGURES ........................................................................................................ 12 LIST OF ABBR EVIATIONS ........................................................................................... 16 ABSTRACT ................................................................................................................... 18 CHAPTER 1 SEROTONIN GPCRS AS MOLECULAR TARGETS FOR THE TREATMENTS OF NEUROPSYCHIATRIC DISEASE STATES ..................................................... 20 G Pr oteinCoupled Receptors (GPCRs) ................................................................. 20 Introduction ....................................................................................................... 20 Structure ........................................................................................................... 20 GPCR Signaling ............................................................................................... 23 Serotonin (5HT) ..................................................................................................... 26 5 HT Biosynthesis ............................................................................................ 27 5 HT Metabolism .............................................................................................. 27 5 HT2 GPCRs ......................................................................................................... 28 5 HT2A GPCR ................................................................................................... 28 5 HT2B GPCR ................................................................................................... 30 5 HT2C GPCR ................................................................................................... 30 Discovery ................................................................................................... 30 Distribution ................................................................................................. 31 Ligands ...................................................................................................... 31 RNA Editing ............................................................................................... 37 5 HT2C Neural Circuitry .............................................................................. 38 5 HT2C Knock Out Mice .............................................................................. 41 5 HT7 GPCR ........................................................................................................... 42 5 HT1A GPCR ......................................................................................................... 44 Mechanisms for Regulating GPCR Homeostasis ................................................... 45 Molecular Desensitization ................................................................................. 45 G Protein Receptor Kinases (GRKs) ................................................................ 47 Arrestin .......................................................................................................... 48 Protein Kinases ................................................................................................ 50 Internalization ................................................................................................... 51 Protein Phosphatases ...................................................................................... 53 Resensitization ................................................................................................. 53 Downregulati on ................................................................................................ 55 5 HT2C GPCR Desensitization .......................................................................... 55 6

PAGE 7

Desensitization in the Clinic .............................................................................. 57 Impact of 5 HT2C GPCR Desensitization in Humans and Translational Validity ........................................................................................................... 58 In Vivo Behavioral Screens for Antipsychotic Activity ............................................. 58 DOI induced HTR ............................................................................................. 58 Locomotor Activity ............................................................................................ 60 Stereotypic Jumping ......................................................................................... 61 Glutamate Antagonist induced Hyperlocomotion and Stereotypic Rotations .... 61 Central Hypothesis and Goal of this Dissertation .................................................... 62 AIM 1: Lead Optimization of the (2S 4 R ) trans 4 phenyl N N dimethyl 1,2,3,4tetrahydronaphthalene2 amine (4 phenyl 2 aminotetralin; 4PAT) Scaffold Targeting Serotonin 5HT2 GPCRs for the Treatment of Psychosis ...................................................................................................... 62 AIM 2: Characterization of Signaling Outcomes from Chronic Agonist and Inverse Agonist Ligand Interaction with 5HT2C GPCRs In Vitro and In Vivo .............................................................................................................. 63 AIM 3: Lead Optimization of the 5phenyl N N dimethyl 1,2,3,4 tetrahydronaphthalene 2 amine (5phenylaminotetralin; 5PAT) Scaffold Target ing the 5 HT1A and 5HT7 GPCRs for the Treatment of Autism Spectrum Disorders ...................................................................................... 64 2 LEAD OPTIMIZATION OF THE (2S,4R) TRANS 4 P HENYL N,NDIMETHYL 1,2,3,4TETRAHYDRONAPHTHALENE 2 AMINE (4 PHENYL 2 AMINOTETRALIN; 4 PAT) SCAFFOLD TARGETING SEROTONIN 5 HT2C GPCRS FOR THE TREATMENT OF PSYCHOSIS ................................................ 82 Specific Aim 1 ......................................................................................................... 82 Methods .................................................................................................................. 83 Compounds ...................................................................................................... 83 In Vitro Pharmacology ...................................................................................... 84 In Vivo Pharmacology ...................................................................................... 85 DOI Induced HTR and Locomotion. ................................................................. 85 Statistical Analyses .......................................................................................... 86 Results .................................................................................................................... 87 Binding Affinities of Monohalogenated 4PATs at 5 HT2 GPCRs and Off targets ........................................................................................................... 87 trans m Cl4 PAT at 5 HT2 GPCRs and Off targets .... 87 trans m Br 4 PAT at 5 HT2 GPCRs ......................................... 88 Binding Affinities of Dihalogenat ed 4 PATs at 5 HT2 GPCRs and Off targets ........................................................................................................... 88 Function of Di halogenated 4PATs at 5 HT2 GPCRs ...................................... 89 Dihalogenated 4PATs Block DOI induced HTR ............................................. 89 Binding Affinities of 6 and 7substituted 4 PATs at 5 HT2 GPCRs and Off targets ........................................................................................................... 89 trans 3 Cl6 OMe 4 PAT (CMAT), 7l, at 5 HT2 GPCRs and Off targets .............................................................................................. 90 Discussion .............................................................................................................. 90 7

PAGE 8

3 LORCASERIN OR RO 60 0175 AS A MORE SELECTIVE TOOL TO STUDY 5 HT2C GPCR ACTIVATION IN VIVO ? A DIRECT COMPARISON ......................... 105 Specific Aim 1 ....................................................................................................... 105 Results .................................................................................................................. 106 In Vitro Pharmacology .................................................................................... 106 In Vivo Pharmacology .................................................................................... 108 Discus sion ............................................................................................................ 1 09 4 CHARACTERIZATION OF SIGNALING OUTCOMES FROM CHRONIC AGONIST AND INVERSE AGONIST LIGAND INTERACTION WITH 5 HT2C GPCRS I N VITRO ................................................................................................ 120 Specific Aim 2 ....................................................................................................... 120 Methods ................................................................................................................ 122 Compounds .................................................................................................... 122 Human 5HT2C S407A GPCR Construct ........................................................ 123 In Vitro Pharmacology .................................................................................... 123 Functional Desensitization and Resensitization ............................................. 124 Statistical Analyses ........................................................................................ 125 Re sults .................................................................................................................. 126 5 HT2C Ligand Pharmacology ......................................................................... 126 Agonist dependent Desensitization of the 5HT2C GPCR ............................... 127 Inverse Agonist dependent Resensitization of the 5HT2C GPCR .................. 129 Liganddependent Desensitization of 5HT2C S407A GPCR .......................... 129 The Effect of PKC on 5HT dependent Desensitization of the 5HT2C GPCR 131 Discussion ............................................................................................................ 131 5 IN VIVO CHARACTERIZATION OF SIGNALING OUTCOMES FROM CHRONIC AGONIST LIGAND INTERACTION WITH 5 HT2C GPCRS ................. 151 Specific Aim 2 ....................................................................................................... 151 Methods ................................................................................................................ 153 Compounds .................................................................................................... 153 In Vivo Pharmacology .................................................................................... 153 Result s and Discussion ......................................................................................... 154 6 LEAD OPTIMIZATION OF THE 5 PHENYL N,NDIMETHYL 1,2,3,4 TETRAHYDRONAPHTHALENE 2 AMINE (5 PHENYLAMINOTETRALI N; 5 PAT) SCAFFOLD TARGETING THE 5 HT1A AND 5 HT7 GPCRS FOR THE TREATMENT OF AUTISM SPECTRUM DISORDERS ........................................ 158 Specific Aim 3 ....................................................................................................... 158 Methods ................................................................................................................ 160 Compounds .................................................................................................... 160 Cell Culture ..................................................................................................... 160 Radioreceptor Competition Binding Assays ................................................... 161 8

PAGE 9

In Vitro Functional Pharmacology ................................................................... 162 In Vivo Pharmacology .................................................................................... 163 Idiopathic Stereotypic Jumping ................................................................ 164 MK 801induced Stereotypic Rotations and Hyperlocomotion ................. 165 Amphetamineinduced Hyperlocomotion ................................................. 165 DOI induced HTR .................................................................................... 166 Symptoms of Serotonin Syndrome .......................................................... 166 Social Interactions .................................................................................... 167 Statistical Analyses ........................................................................................ 167 Results .................................................................................................................. 168 Binding Affinities of 2, 3, 4, 5, 6 halongenated 5PATs at 5 HT7 and 5HT1A GPCRs and Off targets ....................................................................... 168 Binding Affinities of 5, 7, 8 and N, N substituted 5PATs at 5 HT7 and 5HT1A GPCRs and Off targets ....................................................................... 169 Function of (+) o F 5 PAT at 5 HT7, 5 HT1A, 5 HT2 GPCRmediated Signaling ..................................................................................................... 170 (+) o F 5 PAT Attenuates DOIinduced HTR ................................................. 171 (+) o F 5 PAT Attenuates the MK 801 induced Rotations and Locomotion but not Amphetamineinduced Locomotion ................................................. 172 (+) o F 5 PAT Reduces Idiosyncratic Jumping .............................................. 173 (+) o F 5 PAT Increases Social Interactions Without Causing Serotonin Syndrome .................................................................................................... 173 Discussion ............................................................................................................ 174 7 CONCLUSIONS ................................................................................................... 188 APPENDIX A EFFECT OF LIGAND PRETREATMENT ON 5 HT2C CONSTITUTIVE ACTIVITY .............................................................................................................. 191 B LIST OF PUBLICATIONS RESULTING FROM THE WORK IN THIS DISSERTATION ................................................................................................... 194 REFERENCES ............................................................................................................ 195 BIOGRAPHICAL SKETCH .......................................................................................... 218 9

PAGE 10

LIST OF TABLES Table page 2 1 trans m Cl4 trans m Br 4 PAT at serotonin 5HT2, 5 HT6, 5 HT7, 5 HT1A, histamine H1, and dopamine D2 GPCRs. ....................................................................................... 100 2 2 Binding affinity values of di halogenated4 PAT analogs at 5HT2A, 5 HT2B, 5 HT2C and H1 GPCRs. ........................................................................................ 101 2 3 Functional potency and efficacy values of di halogenated4 PAT derivatives at the 5 HT2C GPCR. ........................................................................................ 102 2 4 Binding affinity values of substitutedN,Ndimethyl 1,2,3,4tetrahydronaphthalen2 amines at 5HT2A, 5 HT2B, 5 HT2C, and H1 GPCRs. .... 103 2 5 Binding affinity values for lorcaserin and Ro 600175 at the human and murine 5HT2 GPCRs ....................................................................................... 104 3 1 Functional potency and efficacy values of lorcaserin, 5HT, DOI, and Ro 60 0175 for the human and murine 5HT2 GPCRs. ............................................... 119 4 1 Binding affinity values for agonists at the agonist and antagonist radiolabeled orthosteric binding sites at the 5HT2C GPCR. .................................................. 143 4 2 5 HT2C agonist functional results for IP3 production in transiently transfected CHO K1 cells. ................................................................................................... 144 4 3 Literature potency and efficacy value of 5HT2C inverseagonist decreasing IP3 production in various cell lines. ................................................................... 145 4 4 EC50 values for stimulating IP3 production of 5 HT2C agonists were ........................................ 146 4 5 Emax values of 5HT, Ro 60 trans m Br 4 trans 4 PAT, and aripiprazole at desensitized and nondesensitized 5 HT2C re ceptors. .............................................................................................. 147 4 6 EC50 and Emax values of 5HT, Ro 600175, lorcaserin, mCPP, and DOI, and trans m Br 4 PAT at WT and S407A mutant 5HT2C GPCRs. .................... 148 4 7 Emax values of 5HT, Ro 60 trans m Br 4 PAT, at desensitized and non desensitized 5HT2C S407A GPCRs ................. 149 4 8 Emax values 5 HT, Ro 60 trans m Br 4 PAT at desensitized 5HT2C WT receptors and 5HT2C S407A GPCRs ............ 150 10

PAGE 11

6 1 Binding affinity values of 2, 3, 4 halogenated 5PATs at 5 HT7 and 5 HT1A GPCRs. ............................................................................................................ 183 6 2 o F 5 PAT at select panel of aminergic GPCRs. ............................................................................................................ 184 6 3 Binding affinity values of 5and N, N substituted 5PATs at 5 HT7 and 5HT1A GPCRs. .................................................................................................... 185 6 4 Functional potency and efficacy values of (+) o F 5 PAT at the 5HT7, 5 HT1A, and 5HT2 GPCRs. ................................................................................. 186 6 5 5 HT syndrome symptoms were not observed following (+) o F 5 PAT administration. .................................................................................................. 187 11

PAGE 12

LIST OF FIGURES Figure page 1 1 A computer aided image of a 5HT2 GPCRs ..................................................... 66 1 2 A representation of a GPCRs relationship with scaffolding proteins. ................. 66 1 3 Ternary c omplex model. .................................................................................... 67 1 4 Graphic representation of GPCR functional selectivity. ...................................... 67 1 5 Chemical structure of serotonin (5HT). .............................................................. 68 1 6 5 HT bio synthesis. .............................................................................................. 68 1 7 5 HT metabolism by monoamine oxidase (MAO). .............................................. 68 1 8 5 HT2C signaling via G q to stimulate PLC. ......................................................... 69 1 9 Chemical structure of ketanserin. ....................................................................... 69 1 10 Chemical structure of Al 34662. ......................................................................... 70 1 11 Chemical structure of fenfluramine. .................................................................... 70 1 12 Chemical structure of mesulergine. .................................................................... 70 1 13 Chemical structure of SB 206553. ...................................................................... 70 1 14 Chemical structure of SB 242084. ...................................................................... 71 1 15 Chemical structure of clozapine. ......................................................................... 71 1 16 Chemical structure of olanzapine ...................................................................... 71 1 17 Representation of the pharmacaphore for 5HT2C GPCR activation. .................. 72 1 18 Chemical structure of mCPP. ............................................................................. 72 1 19 Chemical structure of DOI. ................................................................................. 72 1 20 Chemical structure of Ro 600175. ..................................................................... 73 1 21 Chemical structure of WAY 161503. ................................................................... 73 1 22 Chemical structure of lorcaserin. ........................................................................ 73 1 23 Chemical structure of aripiprazole. ..................................................................... 73 12

PAGE 13

1 24 trans 4 PAT. .............................................................. 7 4 1 25 Chemical structure of varenicline. ....................................................................... 74 1 26 Localization of 5HT2C in the limbic cort icostriatal circuit. ................................... 75 1 27 Chemical structure of 8OH DPAT. .................................................................... 75 1 28 Chemical structure of LP 211. ............................................................................ 76 1 29 Chemical structure of SB 269970. ...................................................................... 76 1 30 Chemical structure of 5CT. ................................................................................ 76 1 31 Chemical structure of LY 293284. ...................................................................... 77 1 32 Chemical structure of WAY 100635. ................................................................... 77 1 33 Schematic representation of homologous desensitization. ................................. 78 1 34 Schematic representation of heterologous desensitization. ................................ 79 1 35 Chemical structure of DAMGO .......................................................................... 79 1 36 Chemical structure of etorphine. ......................................................................... 80 1 37 Chemical structure of morphine. ......................................................................... 80 1 38 Chemical structure of PMA. ................................................................................ 81 1 39 Chemical structure of sphingosine. ..................................................................... 81 1 40 Representation of clathrin triskelion and clathrin coated vesicle. ........................ 81 2 1 C trans m Br 4 PAT. ..................................................... 93 2 2 C trans m Cl4 PAT. ...................................................... 93 2 3 trans m CF34 PAT. ................................................... 94 2 4 trans 4 CAT. .............................................................. 94 2 5 Scaffold of 6, 7, and 3 substituted 4PATs ........................................................ 95 2 6 trans m Cl 4 PAT at human 5HT2A, 5 HT2B, 5 HT2C, and H1 GPCRS. .............................................................. 95 2 7 R epresentative functional responses of ( ) trans m Br 4 PAT at human 5HT2A, 5 HT2B, 5 HT2C, and H1 GPCRs. ............................................................... 96 13

PAGE 14

2 8 trans m I 4 trans 3, 5 Br 4 trans 3, 5 Cl 4 PAT ............................................................ 97 2 9 Attenuation of the DOI Induced H TR ................................................................. 98 2 10 Representative functional response of trans 3 Cl6 OMe 4 PAT, 7l at 5 HT2A, 5 HT2B, 5 HT2C and H1 GPCRs. ............................................................... 99 3 1 Representative functional responses for lorcaserin and Ro 600175. .............. 113 3 2 Lorcaserin and Ro 600175induced HTRs and locomotor activity. .................. 115 3 3 Effects of lorcaserin and Ro 600175 on DOI induced HTRs and locomotor activity. ............................................................................................................ 116 3 4 Effect of 5 HT2C antagonist, SB 242084, on lorcaserininduced HTRs and hypolocomotion. .............................................................................................. 117 4 1 Agonist structures used to desensitize the 5HT2C GPCR. ............................... 136 4 2 Inverse agonist structures used to resensitize the 5HT2C GPCR. ................... 138 4 3 Agonist dependent desensitization of the 5HT2C GPCR. ................................. 139 4 4 Inverse agonist resensitization of the 5HT2C GPCR. ....................................... 140 4 5 5 HT induced desensitization of the mutant S407A 5HT2C GPCR. ................. 141 4 6 Effect of the PKC inhibitor chelerythrine on 5HT induced 5HT2C GPCR desensitization. ................................................................................................. 142 5 1 DOI induced HTRs in C57Bl/J6 mice after 4 day chronic treatment of 5HT2C agonists. ........................................................................................................... 156 5 2 DOI induced locomotion in C57Bl/J6 mice after 4 day chronic treatment of 5HT2C GPCR ligands. ........................................................................................ 157 6 1 5 PAT substituted scaffold. ............................................................................... 176 6 2 Chemical structure of (2S) (+) o F 5 PAT ........................................................ 176 6 3 (+) o F 5 PAT dose dependently blocks the DOI induced HTR. ...................... 177 6 4 Effect of (+) o F 5 PAT administration on stereotypic rotations and locomotor activity induced by MK 801. ............................................................................. 178 6 5 Effect of (+) o F 5 PAT administration on amphetamine induced hyperlocomotor activity. ................................................................................... 180 14

PAGE 15

6 6 (+) o F 5 PAT (1 and 3 mg/kg) dosedependently attenuates idiopathic stereotypic jumping in C58/J mice. .................................................................. 181 6 7 (+) o F 5 PAT does not alter locomotor behavior. ............................................ 181 6 8 (+) o F 5 PAT (5.6 mg/kg) increases social interactions with vehicletreated C57BL/6J mice littermates while subsequently decreasing grooming. ............. 182 A 1 Representative figures of Ro 600175 and trans m Br 4 PAT induced 5HT2C GCPR desensitization. ............................................................................. 192 A 2 Comparison of basal values of de/resensitized 5HT2C GPCRs. ...................... 193 15

PAGE 16

LIST OF ABBREVIATIONS 5 HT AKAP ATP AC AADC CNS cAMP DAMGO DAG DOI DMEM FDA GDP GTP G protein GPCR GRK HTR HEK I.P. IP3 I.V. KO mGluR Serotonin A kinase anchoring proteins Adenosine tri phosphate Adenylyl cyclase Amino acid decarboxylase Central nervous s ystem Cyclic adenosine monophosphate [ D Ala2, N MePhe4, Gly ol5] enkephalin Diacylglycerol 2, 5 dimethoxy 4 iodoamphetamine Dulbeccos modified Eagles medium US Food and Drug Administration Guanine diphosphate Guanine triphosphate Guanosine nucleotidebinding proteins G proteincoupled receptor G protein receptor k inases Headtwitch response Human embryonic kidney Intraperitoneal Inositol phosphates Intravenous Knock out Metabotropic glutamate receptors 16

PAGE 17

MAPK MAO PNS PAT PMA PIP2 PDE PLC PLD PKC PP2A POMC PDZ RNA S.C. SERT SAR TMH TPH VTA WT Mitogen activated protein kinase Monoamine oxidase Peripheral nervous system P henyl a mino t etrahydronaphthalene Phorbol 12myristate 13 acetate Phosphatidylinositol bisphosphate Phosphodiesterase Phospholipase C Phospholipase D Protein kinase C Protein phosphatase 2A Pro opiomelanocortin P SD 95/ D iscslarge/ Z O 1 homology Ribonucleic acid Sub cutaneous Serotonin transporter Structure activity relationship Transmembrane helix Tryptophan hydroxylase Ventral tegmental area Wild type 17

PAGE 18

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DRUG DISCOVERY TARGE TING SEROTONIN G PRO TEIN COUPLED RECEPTORS IN THE TREATMENT OF NEUROPSYCHIATRIC DIS ORDERS By Daniel E. Felsing MAY 2016 Chair: Raymond G. Booth Co chair: Kenneth Sloan Major: Pharmaceutical Sciences C linical data show that activation of 5HT2C G proteincoupled receptors (GPCR s) can treat obesity (lorcaserin/Belviq) and psychotic disorders (aripiprazole/Abilify ), including schizophrenia. 5HT2C GPCRs are members of the 5HT2 sub family of 5 HT GPCRs, which include 5HT2A, 5 HT2B, and 5HT2C GPCRs. 5 HT2C is structurally similar to 5 HT2A and 5 HT2B GPCRs, but activation of 5HT2A and/or 5HT2B causes deleterious effects, including hallucinations and cardiac valvulopathy. Thus, there is a challenge to develop drugs that selectiv e ly activate only 5HT2C. Prolonged activation of GPCRs by agonists reduces their function via a regulatory process called desensitization. This has clinical relevance, as 45% of drugs approved by the FDA target GPCRs, and agonist drugs (e.g. morphine) typically lose efficacy over time due to desensitization, which invites tolerance. Agonists that cause less desensitization may show extended clinical efficacy as well as a more acceptable clinical dose range. We hypothesized that structurally distinct agonists of the 5HT2C receptor may cause varying degrees of desensitization by stabilizing unique 5HT2C 18

PAGE 19

receptor conformations. Discovery of 5HT2C agonists that exhibit minimal desensitization is therapeutically relevant for the pharmacotherapeutic treatment of chronic diseases such as obesity and psychotic disorders. The 5 HT7 receptor has recently been discovered as a druggable target, and selective activation of the 5HT7 receptor has been shown to alleviate locomotor deficits in mouse models of Rett Syndrome. Additionally, buspirone has been shown to display therapeut ically relevant affinity at 5HT1A and is currently in phase II clinical trials to treat ster eotypy in children with autism Th e 5PAT chemical scaffold shows high affinity towards the 5HT7 and 5HT1A receptors. Modulations around the 5phenyl moiety were able to improve selectivity in binding towards the 5HT7 receptor wher e as modulations of the alkyl chains bonded to the vital basic nitrogen modulated 5HT1A selectivity. The lead candidate, (+) o F 5 P A T, was shown effective in attenuating three separ ate murine models of stereotypy and two models of drug induced hyperlocomotion. Therefore, t he 5 PAT chemical scaffold is a unique chemical scaffold enab l ing discrimination of therapeutic function of the 5 HT7 and 5HT1A receptors in vivo 19

PAGE 20

CHAPTER 1 SEROTONIN GPCRS AS MOLECULAR TARGETS FOR THE TREATMENTS OF NEUROPSYCHIATRIC DISEASE STATE S G Protein Coupled Receptors (GPCRs) Introduction G proteincoupled receptors (GPCRs) are the largest class of membranebound receptors in the human body, with 791 genomically classified into 6 categories: glutamate, rhodopsin, adhesion, frizzled, taste type 2, secretin ( Bjarnadottir et al., 2006) in addition to at least 140 orphan receptors whose endogenous ligands remain unknown ( Tang et al., 2012 ) GPCRs transduce signals from the external environment across the plasma membrane from a variety of stimuli, including: phot ons, odorants, nucleotides, peptides, lipids, chemical transmitters, and even proteins. Although coded for by <2% of the human genome ( Bockaert and Pin, 1999) GPCRs govern a variety of physiological processes, including sight, smell, touch, mood, immune responses, plus others. They constitute the molecular targets of 45% of therapeutically approved drugs an d other GPCRs have the potential to serve as new drug targets ( Drews, 2000) However, genetic mutations of these GPCRs are known to correlate to a variety of human diseases including: retinitis pigmentosa, dw arfism, diabetes insipidus, hypothyroidism, obesity, and neurological diseases ( Tao, 2006) Thus the investigat ion of GPCR signaling and regulation mechanisms is warranted for the potential improvement in human healthcare. Structure The primary structures of GPCRs vary greatly, which allow s them to modulate the plethora of psychological responses to individual stim uli. Nevertheless, they share common structural motifs to determine both ligand specificity, as well as, function. GPCRs are composed of amino acid residues that together form 7 transmembrane domains, each spanning roughly 2025 amino acids, in the form of 20

PAGE 21

helices. The residues that comprise these transmembrane domains tend to be hydrophobic, located within the cellular membrane to not jeopordize receptor membrane integrity. The primary sequence of these transmembrane domain regions for classA GPCRs show s similarity between related receptors subtypes Homologues of a given receptor subtype are 8595% similar within these regions, 6080% for related subtypes, 3545% for receptors of the same family, and 2025% or less for unrelated receptors ( Strader et al., 1994) Transmembrane residues form a threedimensi onal multi helix barrel that comprises a binding pocket, in which an entity is able to convey or block stimulus to the cell. GPCRs also contain an extracellular N terminus and intracellular C terminus as well as 3 extracellular and intracellular loops that interconnect the hydrophobic transmembrane domains ( Strader et al., 1994 ) A representation of the protein structure of a GPCR and ligand pocket can be seen in Figure 11 Many GPCRs also share several discrete structural features such as two conserved cysteine residues in the second and third extracellular loops that f orm a disulfide bridge restricting the conformational freedom of the receptor ( Strader et al., 1994) Specfically, c lass A GPCRs also contain an glutamine/aspartic acid, arginine, tyrosine (E/DRY) motif that governs the receptors constitutive activity, activation, and G protein recognition ( Rovati et al., 2007) The biogenic amine receptors, GPCRs whose endogenous ligands contain one or more basic nitrogen and are synthesized from manipulations of dietary amino acids (i.e. serotonin, dopamine, histamine, norepinephrine), utilize this E/DRY motif in which a highly conservative aspartate residue in transmembrane helix 3 i s a chief molecular determ inant in binding basic nitrogens of biogenic amines. Without this residue, ligand affinity and efficacy are abolished ( Scwartz and Rosenkilde, 1996) Additionally, cysteine residues within the 21

PAGE 22

cytoplasmic tail are thought to be a site for palmitoylation, a post translational modification that inhibits G protein activation without altering the overall structure of a GPCR ( O'Dowd et al., 1989) GPCRs are able to carry out a variety of physiological functions through their genetic diversity, yet still need processing to attain their quaternary structure and cellular localization to their associated effectors. The cDNA of a GPCR is transcribed into mRNA within the nucleus and the n translated into a pri mary acid sequence within ribosomes. From there, the protein is extruded from the ribosome into the endoplasmic reticulum whose contiguity with the Golgi apparatus affords efficient transit. Finally, GPCRs are packaged into intracellular vesicles on the tr ans face of the Golgi apparatus and transported to the desired cellular location. Due to the fluidity of the memb anous environment in which a GPCR is located and the need to be in direct contact with associated effector systems, they are commonly accompani ed by scaffolding proteins, which utili ze proteinprotein interactions via specific motifs within the intracellular C terminus, involving serine and threonine residues. These serine and threonine residues specify which signaling pathways a GPCR signals thr ough, via short distance proteinprotein interactions with scaffolding/cytoskeletal proteins. P SD 95/ D iscslarge/ Z O 1 homology (PDZ) domains are one such class of scaffolding proteins. PDZ domains can link a variety of monoaminergic GPCRs to effectors such as protein lipase C (PLC), protein kinase C (PKC) ( Van Huizen et al., 1998) Na+H+ exchanger, and erzin, as well as others ( Hall and Lefkowitz, 2002) (Figure 1 2). Additional types of scaffolding proteins, such as A kinase anchoring proteins (AKAP) are non PDZ scaffolding proteins, are known to couple protein kinase A (PKA) in response to adrenergic receptor activation and modulate adrenergic 22

PAGE 23

receptor desensitization ( Fan et al., 2001) Additionally, metabotropic glutamate receptors (mGluR) have been found to associate with a number of Homer family proteins, affecting mGluR constituti ve activity, as well as, inositol phosphate (IP3) signaling downstream ( Brake et al., 1997) Arrestins are another major class of GPCR scaffolding proteins ( Lohse et al., 1990) which are now known to interact with a plethora of GPCRs to initiate G proteinindependent signal ing pathways and/or desensitize the GPCR However, these proteins are not governed by specialized motifs in sequence but are governed by specific receptor events such as phosphorylation by G p rotein receptors kinases (GRKs) to promote binding ( Krupnick and Benovic, 1998) The quatenary structure of the orthosteric binding pocket of a GPCR dis criminate s among different ligands and signal ing pathways Cellular localization and cell health ( Alemany et al., 2007) may alter the specific quaternary structure of a GPCR and thus the ability of a GPCR to discriminate ligands and function intracellularly. Expression levels can have a direct effect as well, influencing the coupling efficiency with G proteins ( Berg et al., 1999) and extent of dimerization with similar o r unrelated receptors ( Rios et a l., 2001 ) The discrete structure of GPCRs is essential to discriminate various molecular stimuli and convey psychological effects. GPCR Signaling GPCRs get their name from the proteins they signal through, guanosine nucleotidebinding pr oteins (G proteins), which are heterotrimeric proteins each composed of , and subunits. In humans, there are 21 subunits 6 subunits, and 12 subunits ( Downes and Gautam, 1999) The subunit can be generally characterized into four subtypes: si, inhibits q12, stimulates Rho 23

PAGE 24

guanine nucleotideexchange factors and/or phosphodiesterase (PDE) ( Simon et al., 1991, Malbon, 2005). These heterotrimeric proteins are molecular switches that convey a stimulus from the GPCR to downstream effector systems in the intracellular signal cascade. This switch is regulated by the guanine triphosphate (GTP) hydrolase activity and whether the subunit is bound to GTP (the active state) or bound to guanosine diphosphate (GDP) (the inactive state) ( Oldham and Hamm, 2008) In the active state, the subunit, a ~35kDa protein, dissociates from the ~35 kDa and 15 kDa subunits, which exist as a dimer, to modulate downstream messengers ( Malbon, 2005) until the GTPase activity of the subunit hydrolyzes GTP to GDP. Although less in known about the signaling mediated by the subunits studies show it can modulate ion channel activity, PLC phospholipase A (PLA), AC, GRK and protein recruitment ( Clapham and Neer, 1997) Constitutive activity, or basal activity, is defined as when a GPCR to undergoes agonist independent conformational changes from the inactive to active state. Constitutive activity has been described in over sixty GPCRs and mutations modifying constitutive activity are known to cause several naturally occurring diseases ( Seifert and Wenzel Seifert, 2002) such as hyperthyroidism, congenial night blindness, retinal pigmentosa, Kaposis sarcoma, among others. Constitutive activity can also be positively or negatively modulated by both natural and induced mutations to the receptor. Constitutive activity has been shown in a variety of receptors systems coupling to siq (in both high and low expression systems). For neurotransmitter receptors, constitutive activity may be responsible for basal neuronal activity ( Seifert and Wenzel Seifert, 2002 ) Differences in constitutive activity can vary greatly even between closely related rec eptors; i.e when both serotonin 5HT2A and 5 HT2C receptors were expressed to the same density in a 24

PAGE 25

heterologous system, 5HT2A receptors showed a significantly lower level of constitutive activity (as inositol phosphate production) than did 5HT2C receptors ( Grotewiel and Sanders Bush, 1999 ) Consituitive acitivty of a receptor is uneffected when the receptor is stablilized by a neutral antagonist, however, constituitive activity is decreased when an inverse agonist stabilizes inactive conformations of the receptor ( Seifert and Wenzel Seifert, 2002) Activating G protein subunits requires the receptor to undergo dramatic conformational changes some distance away from the ligandbinding site(s) ( Kristiansen, 2004) The ternary complex model has been widely accepted as a heuristic model of GPCR activation. It shows that a receptor is in equilibrium among three states: inactive, active unbound to G protein, and active coupled to G protein, dependent upon the occupancy of a guanine nucleotide binding site ( De L ean et al., 1980) Ligands may have different affinities for each of t hese receptor states, whereby a ligand may have a different affinity for the inactive receptor, Ka, than the active receptor bound to G protein, Ka/ ( Kenakin, 2004) (Figure 1 3 ). However, this model does not account for the entire realm of constitutive activity, inverse agonism, and allosteric modulation, and these must be taken into account. Thus an extended cubic model of GPCR multistates structure function has been defined ( Conn et al., 2009) It is thought that the conformational change of the receptor resulting in G protein activation involves the movement of transmembrane helix (TMH) III relative to TMH VI, as demonstrated for the adrenergic receptors ( Gether et al., 1997) This movement is thought to loosen the rigidity of the receptor in the inactive highenergy st ate and expose the G protein binding sites of the receptor ( Bourne, 1997) Historically, in terms of ligand classification for GPCRs, it was thought that a ligand could be only an agonist, partial agonist, antagonist, or inverse agonist. These 25

PAGE 26

molecular pharmacology designations were once believed sufficient to explain the therapeutic effects of a ligand in vivo However, it is now known that this classification is too simplistic. Ligands can stabilize unique/specific conformations of a receptor, activating/inactivating only an individual pathway the receptor couples to, a phenomenon called functional selectivity or ligands bias ( Shonber et al., 2014) (Figure 1 4 ). This could take the form of activating/inactivating s vs. q signaling pathways, or even modulating the desensitization and/or downregulation of a receptor Functional selectivity offers medicinal chemists an opportunity to identify specific pharmacophores able to finetune the signaling output of a GPCR drug target to favor therapeutic signaling over information pathways that may invtie adverse events. Sero tonin ( 5 HT ) Serotonin, 5hydrox ytryptamine (5 HT) (Figure 1 5 ) was first isolated from bovine serum in 1948 as a vasoconstrictor ( Rapport et al., 1948 ) It was named sero- tonin, since it was first isolated in serum and affected the vascular tone 5 HT receptors have significant function in practically all organ syst ems, including, nervous, gastrointestinal, cardiovascular, pulmonary, and genitourinary ( Berger et al., 2009) Although 5HT is most commonly associated with neurological function, in which it governs mood, memory, anger, appetite, reward, and sexual behavior among other cognitive functions ( Berger et al., 2009) around 95% of 5HT exists in the gut, where it governs motility, secretion, and sensation ( Gershon and Tack, 2007) The GPCRs that modulate these effects are classified into 6 receptor families with 14 distinct isoforms having been cloned ( Barnes and Sharp, 1999) They are also accompanied by the 5HT3 ligand gated, Na+ and K+, ion channel and serotonin transporter (SERT), which assists in recycling 5HT bac k into neurons from the 26

PAGE 27

synapse ( Aan het Rot et al., 2009) While less than one in a million CNS neurons produce 5HT ( Gershon and Tack, 2007) every brain region expresses multiple subtypes of 5HT GPCRs ( Berger et al., 2009 ) 5 HT GPCRs modulate multiple neurotransmitter systems both excitatory and inhibitory, including: dopamine, glutamate, norepinephrine, and GABA, amon g others. 5 HT Biosynthesis 5 HT is synthesized via a twostep process from the amino acid Ltryptophan, utilizing tryptophan hydroxylase (TPH) and either 5hydroxytryptophan decarboxylase or amino acid decarboxylase (AADC) (Figure 16 ). The first step which is rate limiting, is the hydroxylation of tryptophan by TPH There are two isoforms of TPH: TPH1 is responsible for the hydroxylation throughout the periphery, while TPH2 governs the hydroxylation inside the central nervous system (CNS) ( Torrent et al., 2012) 5 HT is polar with a cLogP around 0.26, and does not efficient ly crossing of the bloodbrain barrier thus both isoforms of TPH are needed. 5 hydroxytryptophan can then be decarboxylated to 5HT by 5 hydroxytryptophan decarboxylase or AADC. 5 HT Metabolism 5 HT is rea dily metabolized by monoamine oxidase (MAO) first into the corresponding aldehyde, then to the inert carboxylic acid metabolite 5 hydroxyindoleacetic acid, which can be readily eliminated from the body by the kidneys (Figure 17 ). A secondary pathway also occurs in that serotonin can be methylated by N methyl transferase once or twic e into N methyl serotonin or N,N dimethyl serotonin ( Axelrod, 1962) The majority of serotonin is metabolized with in the liver, although other organs such as the brain and lung also contribute to 5HT metabolism 27

PAGE 28

5 HT2 GPCRs The 5 HT2 receptor family consists of three isoforms (5 HT2A, 5 HT2B, and 5HT2C) that display ~ 50% similarity of the total sequence identity and display ~80% related sequence homology with in their seven transmembrane domains ( Julius et al., 1990) Additionaly, the 5HT2A, and 5HT2C subtypes share 87% and 90% total seqeunce indentity between human and murine counterparts ( Saltzman et al., 1991) The three 5HT2 isoforms share similar coupling partners, q to stimulate PLC. Figure 18 shows t he canonical 5 HT2 signaling cascade of PLC which involves the conversion of phosphatidylinositol 4,5bisphosphate (PIP2) into inositol 1,4,5triphosphate (IP3) and diacylglycerol (DAG) ( Gresset et al., 2012, Lyon et al., 2014) IP3 is hydrophilic and is released into the cytosol where it activates IP3 receptors in the endoplasmic reticulum to mobilize Ca2+ ions. DAG is more lipophilic than IP3 and is involved in the phosphorylation of many enzymes, most notably PKC ( Rhee, 2001) Chemical compounds that activate 5HT2 receptor s stimulate, in a concentrationdependent manner, the production of these IP3 secondary messengers, which is routin ely quantified as an index of 5HT2 functional outcome. However, 5HT2 receptors are known to signal via other signaling cascades, such as PLA, phospholipase D (PLD ) and GRK2 ( Nagatomo et al., 2004) PLA cleaves PIP2 into arachidonic acid ( Dennis, 1994) whereas PLD cleaves phosphatidylcholine to generate phosphatidic acid and choline ( Peng and Frohman, 2012) while GRK 2 phosphorylates the receptor to initiate G proteinindependent signaling. 5 HT2A GPCR The 5 HT2A GPCR is a main stimulatory 5 HT receptor and is expressed ubiquitously throughout the CNS, with highest expression in cortical regions like the neocortex, pyriform cortex, and claustrum, as well as caudate nucleus, nucleus 28

PAGE 29

accumbens, hippocampus, and olfactory tubercles ( Pazos et al., 1985, Titeler et al., 1998) The 5 HT2A GPCR is most prominently thought of as the hallucinogenic receptor, since the effects of hallucin ogens are mediated through the partial agonist activity at the 5 HT2A receptor ( Gonzalez Maeso et al., 2007) These hallucinogenic effects can be classified clinically into: 1) somatic symptoms (dizziness, nausea, and tremors); 2) perceptual changes (altered visual perception of objects (enhanced colors, breathing shapes, kaleidoscopic visual patterns ) amplification in touch, auditory, and taste sensations); and 3) psychic changes (mood alterations and lability, distortions in time and space perception, and depersonalization) ( Nichols, 2004) Hallucinogens can be classified into three categories based on chemical str ucture: phenethylamines, tryptamines, and ergolines. Ligands of these types are generally considered illicit by the government, causing deleterious side effects, with no therapeutic potential. Blockade of the 5HT2A GPCR has been shown to atenuate ampheta m ine induced locomotor activity and is a common feature of most antipsychotics, in addition to blocking the dopamine D2 receptor ( Weiner et al., 2001) T he 5HT2A receptor is also expressed in the periphery where it mediates (vascular and nonvascular) smooth muscle contraction and platelet aggregation ( Nagatomo et al., 2004) Peripheral 5HT2A antagonists have therapeutic efficacy as antihypertensives. T he selective 5HT2A antagonist, ketanserin (Figure 19 ) is classified b y the World Health Organization as an antihypertensive and is available for use in Europe ( Van der Starre and Solinas, 1996) P eripheral 5 HT2A agonis m may also be therapeutic in attenuating in traocular pressure. T he 5 HT2A agonist AL34 662 (Figure 1 1 0 ) produces this therapeutic effect, and because i t is unable to cross the bloodbrain barrier, it does not produce hallucinogenic side effects ( Sharif et al., 2007) 29

PAGE 30

5 HT2B GPCR The 5 HT2B GPCR is mostly known for its association with cardiac complications. P rolong ed 5 HT2B activation leads to pulmonary hypertension ( Launay et al., 2002) and cardiac valvul opathy ( Elangbam et al., 2008) as was shown with the diet drug fenfluramine ( Figure 111). The anorexi genic effect of fenfluramine was due to its indirect 5 HT2C agonism, yet it also indirectly activated the 5 HT2B receptor, which elicited cardiac complications in many patients and thus was ultimately taken off the market. Althoug h the 5 HT2B receptor is known today mostly for its association with cardiovascular side effects, it was first discovered through the contraction of gastric fundus in rat ( Vane, 1959) In addition to being distributed throughout the cardiovascular and gastrointestinal systems, the 5 HT2B receptor is expressed minimally with in the CNS in restricted brain regions ( Barnes and Sharp, 1999) Although much less is known about its central function, roles in anxiety ( Kennett et al., 1998) and locomotion ( Doly et al., 2008) have been proposed. Most potential therapeutics now aim to avoid interaction with 5HT2B receptor altogether because of deleterious side effects of 5HT2B rec eptor activation. 5 HT2C GPCR Discovery The 5 HT2C GPCR was identified in 1984 from radioligand binding studies of porcine choroid plexus and originally named 5 HT1C, due to the high affinity displayed by [3H]5 HT and relatively low affinity for selective 5HT1A, 5 HT1B, and 5HT2A receptor ligands ( Pazos et al., 1984a, b ) The human 5HT2C receptor was then cloned in 1991 and subsequently renamed into the 5HT2 family due to its close sequence homology with the 5HT2A receptor ( Saltzman et al., 1991) The 5HT2C receptor shares > 80% homology in amino acid sequence of the transmembrane 30

PAGE 31

domains with the other two isoforms of the 5HT2 family, 5 HT2A and 5 HT2B receptors ( Julius et al., 1990) However, unlike the 5 HT2A and 5HT2B receptors, the 5 HT2C receptor is almost exclusively expressed within the central nervous system ( CNS ) 5 HT2C receptors are also unique among GPCRs in that 5 HT2C mRNA is commonly edited post transcriptionally to produce a variety of endogenously expressed isoforms ( Burns et al., 1997) Distribution The 5 HT2C GPCR is distributed ubiquitously within the CNS, with highest expression in the choroid plexus, but significant levels are also observed in the substantia nigra, basal ganglia, hypothalamus, hippocampus, prefrontal cortex, nucleus accumbens and vental tegmental area (VTA) ( Pazos et al., 1987, Roth et al., 1998, Bubar and Cunningham, 2007) There is very little evidence of protein expression outside the CNS but some groups have reported 5HT2C receptor expression in rat lung ( Wang et al., 1999 ) and kidney, where it m ediates vasoconstriction ( Moran et al., 2008) but the therapeutic relevance here is minimal. The presence of 5HT2C receptors in multiple hypothalamic areas of the br ain is believed to modulate appetite regulation ( Nilsson, 20 06 ) Additionally, t he expression of 5 HT2C receptors in the mesolimbic areas such as the VTA and nucleus accumbens i s hypothesized to modulate the dopamine system affecting the hedonistic influences of reward ( Bubar and Cunningham, 2006) Ligands Antagonist/inverse agoni st: M esulergine (Figure 1 12) was one of the first 5 HT2C receptor antagonists discovered that displays selectivity over the 5HT2A receptor ( Closse, 1983 Pazos et al., 1984a, b ) Mesulergine displays 1.4 nM affinity for the 5 HT2C receptor, while displaying a 19 nM affinity for 5HT2A receptor, showing 31

PAGE 32

~10 fold selectivity ( Bonhaus et al., 1997) ; however mesulergine also displays 1.9 nM affinity at the 5HT2B receptor, showing little selectivity at the 5HT2C receptor over the 5HT2B receptor ( Cussac et al., 2002 ) M esulergine is commonly used to identify and radiolabel the 5HT2C receptor due to its early discovery high affinity, and relative selectivity displayed at 5HT2C receptor SmithKline Beec ham Pharmaceuticals were one of the first pharmaceutical companies to target the 5HT2C receptor ( Forbes et al., 1993) and through lead optimization t wo selective antagonist probes SB 206553 and SB 242084, were developed SB 206553 (Figure 1 13) possesses ~100fold selectivity for the 5HT2C receptor over the 5HT2A receptor, displaying affinities of 12 nM and 1.6 M respectively ( Kennett et al., 1996) However, SB 206553 also displays a high affinity of 5.5 nM at the 5HT2B receptor ( Cussac et al., 2002) thus again making it diffic ult to differentiate between 5 HT2C and 5 HT2B receptors A similar indoline 1 carboxamide derivative, SB 242084 Figure (114) was reported a year later to display increased affinity and selectivity at the 5 HT2C receptor compared to SB 206553. SB 242084 displayed affinities of 1 and 158 nM at the 5 HT2C and 5HT2 A receptor respectively ( Kennett et al., 1997) SB 242084 also displays selectivity for binding the 5 HT2C receptor over the 5HT2B receptor with an affinity of 46 nM at the 5 HT2B receptor ( Cussac et al., 2002) Solubility issue s do arise with SB 242084, which limit s SB 242084 as an in vivo pharmacolgic tool; i.e. the original report required the use of the emulsifying agent (polyethylene glycol) in a 1:1 ratio with DMSO to be dissolved at 10 mM ( Kennett et al., 1997) Both SB 206553 and SB 242084 dis played 1 M affinities at related 5HT1, 5 HT7, dopamine D2, D3, and Adrenergic 1 receptors subtypes. SB 206553 and SB 242084 represent some of the 32

PAGE 33

best probes to delineate the effects of 5HT2C receptor antagonism in vivo due to the high affinity and selectivity displayed at the 5HT2C receptor Many atypical antipsychotics, antidepressants, and anxiolytics display 5 HT2C receptor affinity. These data, along w ith altered receptor levels of patients diagnosed with psychiatric conditions (like schizophrenia, obsessive compulsive disorder, and depression ( Herrick Davis et al., 2000) ) suggest that the 5 HT2C receptor to plays a significant role in numerous ps ychiatric diseases. Atypical antipsychotics, like clozapine ( F igure 115) and olanzapine (Figure 116), dis play high affinity and inverse agonist activity at the 5 HT2C receptor mediated IP3 signaling pathway whereas typical antipsychotics, like chlorpro mazine and spiperone, display neutral antagonist activity, and block this inverse agonist effect of atypical antipsychotics with in over expressed in vitro cell systems ( Herrick Davis et al., 2000 ) Yet clozapine and similar 5HT2C ligands that antagonize 5HT2C receptor function are thought to be beneficial in alle viating the negative symptoms of schizophrenia ( Wood et al., 2001) Agonists: The structure of the endogenous agonist, 5HT (Figure 1 3 ) gives insight into the molecular determinants r equired for 5HT2C activation. The simplistic structure contains a highly flexible primary amine connected two carbons away from a planar hydroxyl substituted indole moiety. T hrough structure activity relationship (SAR) studies a common pharmacaphore for 5HT2C activation has been delineated and contains four characteristics, a positively ionizable moiety ( i.e., a basic amine ), attached within a few carbon atoms to an aromatic ring system ( i e. indol e or phenyl moiety), with two hydrophobic pock ets on flanking either side of the aromatic ring system (Figure 1 17) ( Ahmed et al., 2009) This pharmacaphore is very similar to that of the 5HT2A and 5HT2B receptor, and thus many agonists do not discriminate activation between the three 5HT2 subtypes 33

PAGE 34

1 (3 chlorophenyl) piperazine hydrochloride (mCPP) (Figure 1 18) was one of the first 5 HT2C partial agonists reported ( Conn and Sanders Bush, 1987) the original report claimed selectivity in activation of the 5HT2C receptor (in rat choroid plexus) over 5 HT2A receptor (i n rat cerebral cortex). However later studies in clonal cell lines revealed mCPP is not as selective at the 5 HT2C receptor as once thought. mCPP displays an affinity of ~13 nM at displacing [3H]5 HT from the 5 HT2C receptor, while showing affinities of 85 and 40 nM at the 5HT2A and 5HT2B, respectively ( Bentley et al., 2004 Kimura et al., 2004, Knight et al., 2004) The selectivity of activation at the 5 HT2 C receptor mediated Ca2+ signaling was minimal compared to 5 HT2A and 5 HT2B receptor mediated Ca2+ showing EC50 values of 81, 63, 223 nM for the 5 HT2C, 5 HT2B, 5 HT2A receptors, respectively. However, mCPP displayed an efficacy of 65%, compared to 5HT, at the 5 HT2C receptor, opposed to ~23% at both the 5HT2B and 5HT2A receptors ( Porter et al., 1999) mC PP also displayed relevant affinity (<1 M) at several other serotonergic and related GPCRs including 5HT1A, 5 HT1B, 5 HT1D, 5 HT7, adrenergic 1A, 1B, 2A, 2B, 2C, histamine H1 and the 5 HT3 ligand gated ion channel and SERT. mCPP represented an earl y tool to distinguish 5 HT2C receptor activation in vivo but must commonly be accompanied by selective 5 HT2A/5 HT2B antagonists to ellucidate 5HT2C specific effect s. Phenethylamines represent a common chemical scaffold to investigate 5HT2C activation, similarly to the 5 HT2A receptor Specifically, ()2,5 d imeth o xy 4 i odoamphetamine ( DOI) (Figure 1 19) is used to radiolabel and activate the 5HT2C receptor both in vitro and in vivo DOI displays an affinity of 2.4 nM at the 5HT2C receptor while displa ying affinities of 0.7 and 20 nM for the 5HT2A and 5HT2B receptors respectively. DOI has been reported as a nonselective partial agonist in 5 HT2mediated Ca2 +dependent signaling with EC50 values between 110 nM and an 34

PAGE 35

efficacy of ~60%, relative to 5 HT, for all three 5HT2 subtypes ( Porter et al., 1999) Thus, DOI can not discriminate 5HT2Cspecifc physiological effects in vivo over those mediated by 5HT2A and 5HT2B by itself The in doleamine Ro 60 0175 (Figure 12 0 ) was one of the first 5 HT2C specific ligands developed by HoffmanLa Roche to treat anxiety ( Martin et al., 1995) Ro 60 0 175 displays high affinity at th e 5 HT2C receptor of 6 nM, but also displays similar affinities of 36 and 5 nM at the 5 HT2A and 5HT2B receptors, respectively ( Knight et al., 2004) Ro 60 0175 additionally activated 5 HT2mediated Ca2 +dependent signaling in all three receptor subtypes, yet showed 14fold selectivity for act ivation of the 5 HT2C over the 5HT2A receptor. Ro 60 0175 displayed EC50 values of 32, 1, 446 nM and Emax values of 84, 79, 69% (compared to 5HT) for the 5 HT2C, 5 HT2B, 5 HT2A receptor mediated Ca2 +dependent signaling, respectively ( Porter et al., 1999) Due to Ro 60 1075 displaying 14fold selectivity for activation of 5 HT2C over the 5HT2A receptors and high CNS permeability, in conjunction with minimal e xpres sion of the 5HT2B recept or in the CNS, Ro 600175 represents one of the best current pharmacologic probes of distinguishing central 5 HT2C activation in vivo Substituted quinazolines have also demonstrated selective activation of the 5HT2C receptor ( Welmaker et al., 2000) WAY 161503 (Figure 1 21) represents the best pharmacologic tool from these medicinal chemistry efforts with a binding affinity of 3 nM at displacing [125I ]DOI from the 5 HT2C receptor. R eports show WAY 161503 possesses minimal selectivity in binding or Ca2+dependent mobilization for the 5HT2C over the 5HT2B and 5HT2A receptors, w ith binding affinities of 3 18, 60 nM and EC50 values of 0.8, 7 1.8 nM at the 5HT2C, 5 HT2B, and 5HT2A receptors, respectively. WAY 161503 displays full agonism at all three 5HT2 receptor subtypes 35

PAGE 36

in both Ca2+ mobilization and IP3mediated signaling pathways ( Rosenweig Lipson et al., 2006) The FDA approved the anti obesity drug lorcaserin (Belviq Ar ena Pharmaceuticals) (Figure 122 ) on June 27, 2012. According to the FDA brief, l orcaserin is a selective 5 HT2C receptor agonist showing 14and 60 fold selectivity for 5 HT2C receptor mediated IP3 production vs 5 HT2A receptors and 5 HT2B receptors, respectively ( Arena Pharmaceuticals, 2012) Lorcaserin displays low affinity, <600 nM at 5 HT1 A, 5 HT3, 5 HT4 E, 5 HT5 A, 5 HT6 and 5HT7 receptor s ( Thomsen et a l., 2008) Clinical trials showed that 12.8%, 19.5%, and 31.2% of patients had achieved the primary clinical objective, a >5% reduction in body mass following lorcaserin adminatrstion of 10 mg q.d., 15 mg q.d., and 10 mg b.i.d., respectively ( Bai and Wang, 2010) Improvements in secondary clinical objectives of total cholesterol, low density lipoprotein, triglycerides, and bloodpressure were also exhibited ( Chan et al., 2013) The atypical antidepressant aripiprazole (Abilify ) (Figure 1 23), marketed for treatment of major depressiv e disorder, bipolar disorder, and schizophrenia is another phenyl piperazine that shows 5 HT2C recept or affinity ( Ki=15 nM ), along with D2 (0.34 nM) D3 (0.8 nM) 5 HT1A (1.7 nM), 5 HT2A (3.4 nM) receptor affinity as well ( Otsuka Pharmaceuticals, 2013) However, as opposed to most atypical antipsychotics, the antidepressant aripiprazole shows partial agonist activity at the 5HT2C receptor (EC50 ~1000 nM, Emax ~40%) while not activating either 5HT2A or 5 HT2B receptors. This pharmacologic profile at the 5HT2 rece ptor subtypes has been hypothesized to correlate with the minimal weight gain associated with aripiprazole compared to other antipsychotics ( Zhang et al., 2005) 36

PAGE 37

Phenylaminot etralins represent another novel chemical scaffold to activate the 5 HT2C receptor subtype ( Booth et al., 2009) Specifically trans (2 S 4 R ) 4 phenyl N N dimethyl 1,2,3,4tetrahydronaphthalene2 amine ( trans 4 phenyl 2 dimethylaminotetralin, ( trans 4 PAT) (Figure 1 24 ) demonstrates selectivity in binding and activation at the 5 HT2C receptor over the 5 HT2A and 5 HT2B receptors. trans 4 PAT dis plays affinities of 30, 94, 1 00 nM for the antagonist radiolabeled 5 HT2C ([3H] mesulergine) 5 HT2B ([3H] mesulergine) and 5 HT2A ([3H]ketanserin) receptor binding sites respectively ( Sakhuja et al., 2015) Interestingl y, tra ns 4 PAT is the first chemical moiety to activate the 5 HT2C receptor mediated IP3 production with an EC50 value of 20 nM while blocking/inactivating the same signaling pathway mediated by the 5 HT2A and 5 HT2B receptors. The 4 PAT scaffold represents a unique tool to inves tigate 5 HT2C receptor activation in vivo and possesses an attractive preclinical pharmacologic profile for the treatment of neuropsychiatric disor ders RNA E diting 5 HT2C receptors are unique as compared to ot her 5HT GPCRs, in that 5HT2C mRNA undergos post transcriptional modification, with the primary mRNA sequences altered by doublestranded RNA adenosine deaminases ( Burns et al., 1997) D eaminases can change five 5HT2C adenosine residues int o inosines in the fifth exon of the RNA transcript, creating a possible 32 mRNA transcripts capable of yielding 24 different 5 HT2 isoforms ( Olaghere da Silva et al., 2010) This edi ted section of 5 HT2C mRNA in particular encodes the 2nd intracellular loop of the receptor, which is crucial for G protein binding and maintaining the receptor in active conformations. Of t he 24 possible 5HT2C receptor isoforms, four are the most psysiologically relevant and pharmacologically distinct: valine, asparagine, valine 37

PAGE 38

(VNV); valine, serine, valine (VSV); the fully edited valine, glycine, valine (VGV) and unedited isoleucine, asparagine, isoleucine (INI) ( Werry et al., 2008) mRNA ed iting alter s binding of both 5HT and exogenous ligands at these physiologically relevant VSV, VNV, and VGV 5HT2 C isoforms compared to the unedited INI 5HT2C isoform where the degree of editing decreases ligand affinity (i.e. the affinity of 5 HT is lowest at the most edited isoform, VGV) ( Fitzgerald et al., 1999) Additi o n ally, t hese isoforms exhibit altered receptor expression, constitutive activity, and the relative efficacy of ligands. Wildtype 5HT2 C shows the highest basal activity and lowest relative agonist efficacy Whereas the fully edited isoform, the VGV isoform exhibits a n ~75 % reduction in receptor expression and basal activity, but shows a 4fold greater response in IP3 production induced by 5 HT whereas the VSV isoform, the most abundant 5HT2C isoform in the human brain, also displays a modest reduction of consti tutive activity (~50%) and a gain in relative agonist efficacy (2.5 fold) ( Herrick Davis et al., 1999) Brain regions (such as cerebellum, hypothalamus, amygdala, and hippocampus) have varying patterns of 5HT2 isoform expression ( Werry et al., 2008) The se alterations in expression, function and localization of the 5 HT2C editted isoforms add to the complexity of delineating the normal physiological function of the 5 HT2C receptor, although an increase in the quantity of edited/lower activity isoforms is associated with suicide in humans ( Dracheva et al., 2008) In addition to post transcriptional editing, naturally occurring 5HT2 polymorphisms, like C23S, are proposed to regulate ligand potency and efficacy at the 5HT2C receptor ( Okada et al., 2004) 5 HT2C N eur al C ircuitry Mesolimbic : O ne of two main therapeutically relevant functions of 5 HT2C receptor in the CNS is the ability of the 5 HT2C receptor to modulate downstream 38

PAGE 39

dopamine signaling in the mesolimbic and mesocortical pathways, which is associated with reward behavior and volitional control ( Di Giovanni et al., 1999, Di Matteo et al., 2000, De Deurwaerdere et al., 2004) The role of modulating this pathway gives rise to the notion that the 5 HT2C rec eptor is a therapeutic target for a variety of psychobehavioral disease conditions including schizophrenia ( Wood et al., 2001) and psychostimulant addiction ( Bubar and Cunningham, 2006) Utilizing in vivo microdialysis and electrophysiology techniques Di Matteo et al. were able to demonstrate that the administration of selective 5HT2C antagonist SB 242084 dosedependently (160640 g/kg i.v.) increased the basal firing rate of the VTA dopamine neurons. Dose s of the selective 5HT2C/5 HT2B antagonist S B 206553 (1 and 2.5 mg/kg i.p.) were also shown to increase dopamine efflux in the nucleus accumbens, known to be involved in processing rewarding stimuli. A reciprocal effect of a decrease in the basal firing rate of the VTA dopamine neurons was caused by the injection (160640 g/kg i.v.) of the selective 5HT2C agonist Ro 600175. These data suggest that the 5 HT2C receptor has a direct inhibitory control of the mesolimbic dopamine neuron activity ( Di Matteo et al., 1998 1999, Di Matteo et al., 2000) Since these studies, the re have been repeated observations that a ctivation of 5 HT2C receptors usually through Ro 600175 treatment, to decrease dopamine neuron firing rate through reduced dopamine efflux in the nigrostriatal, mesolimbic, and mesocortical pathways; whereas inact ivation/blockade of central 5HT2C receptors, u tilizing SB 206553 or SB 242084, increases dopamine efflux and firing rates in said brain regions ( Di Giovanni et al., 1999, Alex and Pehek, 2007) Preclinical data also suggest that lorcaserin shares a therapeutic profile similar to the anti smoking medication varenicline (Chantix Pfizer )(Figure 1 25) in rodent models, reducing nicotine self administration, nicotineinduced 39

PAGE 40

hyperlocomotion, nicotine internoceptive cue, and reinstatement of nicotineseeking beh avior ( Chan et al., 2013, Higgins et al., 2013) The mechanism of action of lorcaserin is 5 HT2C receptor dependent, whereas varenicline has been proposed to work through nicotinic receptors ( Rollema et al., 2007) Through the use of selective pharmacologic tools, the mapping of 5HT2C mediated pathways neuronal networks in the limbic system has been delineated (Figure 1 26) ( Bubar and Cunningham, 2008) T he dopamine mesoaccumbens pathway, in particular the dopamine neurons originat ing in the VTA and projecting to the nucleus accumbens mediates the reinforcing effects of food, sex, and drugs of abuse. 5HT2C receptor co localization in the mesoaccumbens pathways coupled to modulation of the dopamine system gives rise to the notion t he 5HT2C pharmacotherapeutics may be efficacious in reducing the hedonistic qualities of addiction ( Bubar and Cunningham, 2006) 5 HT2C therapeutics also offer enhanced safety profiles compared to dopaminergic ligands because they are not liable to the deleterious locom otor side effects commonly associated with direct dopaminergic drugs ( Platt et al., 2002 ) Hypothalamic : N umerous 5 HT2C receptor agonist s have shown to elicit hypophagia in animals that can be directly blocked by the addition of selective 5HT2C antagonists ( Clifton et al., 2000, Schreiber and De Vry, 2002) The a norexic effects of 5 HT2C receptors are hypothesized to be mediated by proopiomelanocortin (POMC) neurons located in arcuate nucleus of hypothalamus. Activation of 5HT2C receptors triggers the conversion of POMC, a peptide precursor, into melanocyte stimulating hormone ( MSH). This MSH acts on the melanocortin 4 receptor in the paraventricular nucleus of the hypothalamus to induce satiety ( Heisler et al., 2002, Halford et al., 2007, Adan, 2013) 40

PAGE 41

Numerous n onselective 5 HT2C agonists namely amphetam ines have been shown to produce hypophagia ( Gibson et al., 1993) The indirect serotonin agonists fenfluramine and phentramine (Fen Phen) were shown to be clinically effective at reducing weight gain and controlling appetite ( Weintraub et al., 1984 ) H owever due to unwanted cardiovascular side effects later attributed to the 5 HT2 B receptor ( Fitzgerald et al., 2000 ) the diet drug FenPhen was removed from market. Several other nonselective 5 HT2 agonists have been shown to elicit weight lose in rodents. Both mCPP and Ro 60 0175 have been shown to reduce body weight and food intake following repeated s.c. injections ( Vickers et al., 2000) Additionally, the elucidation of lorcaserin, a selecitive 5HT2C full agonist, as a treatment for obesity confirms a modulatory role of the 5HT2C receptor to regulate food consumption. While it has been demonstrated that acute and chronic administration of the selective 5HT2C antagonist, SB 242084, does not increase food consumption in rats ( Kennett et al., 1997) chronic blockade of the 5HT2C receptor is still hypothesized to mediate the weight gain associated with antipsychotic use ( Reynolds et al., 2006) 5 HT2C Knock Out M ice Further evidence from 5HT2C receptor knock out (KO) mice support a role of the 5HT2C receptor in the behavior involved in psychotic states. 5HT2C KO mice do not exhibit hypolocomotion after 5HT2C agonist treatment ( Fletcher et al., 2009) In the DOIinduced head twitch response (HTR) 5 HT2C KO mice also elicited 50% less HTRs when compared with their wildtype littermates ( Canal et al., 2010) In a model of rodent impulsivity, the 5choice serial reaction time test, 5HT2C KO m ice showed distinct im pairment in attention processes. I n addition, 5 HT2C agonists that reduce impulsive responding i n wild type mice were ineffective in the 5HT2C KO mice ( Fletcher et al., 2013, Pennanen et al., 2013) Furthermore, the hypolocomotor and 41

PAGE 42

hypophagic effects elicited by the systemic administration of lorcaserin and Ro 600175 are abolished in 5HT2C KO mice ( Fletcher et al., 2009) Similar strains of C57BL/6J 5 HT2C receptor KO m ice also displayed compulsive behaviors like nonnutritive clay chewing, neat screen chewing, and reduced head dipping ( ChouGreen et al., 2003) These data taken together further argue for the role of the 5HT2C receptor in regulating psychotic states and feeding behavior 5 HT7 GPCR The 5 HT7 GPCR has recently been identified as a mammalian serotonergic receptor that activates adenylate cyclase ( Plassat J, 1993, Ruat et al., 1993) There are three subtypes found in humans 5 HT7A, 7 B, 7 D, that show low sequence homology (39 58%) between transmembrane regions of other 5HT receptors ( Bard et al., 1993) The three subtypes only differ in the length of the C terminus T he human cDNA of the 5HT7A receptor encodes for four hun dred and forty five amino acids; t he 5HT7B isoform is a truncated variant shortened by thirteen amino acids; whereas the 5HT7 D isoform has an extended C terminus lengthened by ninety eight amino acids compared to the 5 HT7A receptor The 5HT7 A and 5HT7 B variants are homologous in rats and humans ( Thomas and Hagan, 2004) Radioligand binding assays have revealed a distinctive pharmacological profile for 5HT7 receptors that is similar across variants ( Eglen et al., 1997) The three human subtypes do not show marked differences in their pharmacological profile or functional coupling to AC ( Krobert et al., 2001) 5 HT7 receptors are expressed throughout the CNS, peripheral nervous system (PNS), and periphery ( Matthys et al., 2011) In the periphery, the 5HT7 receptor is mainly located within smooth muscles cells in the gastrointestinal ( Janssen et al., 2005) and cardiovascular ( Jahnichen et al., 2005) systems where it 42

PAGE 43

mediates smooth muscle relaxation. Autoradiography studies applying the 5HT derivative, 5car boxamidotryptamine (5CT) (Figure 1 30) which displays selectivity towards 5HT7 and 5HT1A receptors, showed a high number of binding sites within the thalamus, hypothalamus, amygdala, and substantia nigra, after the addition of the masking ligands. In si tu hybridization assays also suggested the 5HT7 receptor was expressed in the thalamus and hippocampus ( Gustafson et al., 1996) The selective antagonist, [3H]SB 269970, also confirmed that the 5 HT7 is shown to be located most abundantly in the thalamus, but also in hypothalamus, amygdala and certain brainstem nuclei ( Varnas et al., 2004) The pharmacophore for activation of the 5HT7 receptor closely resembl es that of 5 HT1A receptor. The availability of the selective 5HT7 agonists is limited relative to the other 5HT GPCRs, as illustrated by the high affinity shown towards the the 5HT1A agonist 8OH DPAT (Figure 1 27) which was previously thought exclusively selective for the 5HT1A receptor. M any pharmalogical efforts to develop 5 HT7 selective agonists have failed because resulting ligands are also recognized by the 5HT1A receptor ( Holmberg et al., 2004 Leopoldo et al., 2004) LP 211 (Figure 1 28) represen ts one of the most selective 5HT7 agonists showing 20fold selectivity for binding the 5HT7 receptor over the 5HT1A receptor Furthermore, LP 2211 induces hypothermia in WT mice but not in 5HT7 KO mice ( Hedlund et al., 2010) In addition, improvements of memory in the novelty preference task, exploratory behavior in the marble burying test, motor abilities in Dowel test, and anxiety r elated profiles in a light/dark test were observed following LP 211 systemic chronic administration in a methyl CpG binding protein 2 (MECP2) KO mice model of Rett syndrome ( an autism spectrum disorder ) ( De Filippis et al., 2014 ) 43

PAGE 44

R ecent advances in the availability for selec tive 5 HT7 antagonists have improved th e ability to distinguish 5HT7 localization and function in vivo SB 269970 (Figure 1 29) has shown to be ~10,000fold selective between the 5HT7 and 5HT1A rec eptors, with Ki values of 1.3 and >10,000 nM, respectively and 50fold selectivity between all other 5HT subtypes ( Hagan et al., 2000, Lovell et al., 2000) Utilizing the selective antagonist SB 269970 and analog SB 626104, it has been demonstrat ed that blockade of central 5HT7 receptors leads to increased latency to onset of rapid eye movement sleep (REM) with less time spent in REM sleep in rats and inhibition of 5HT induced hypothermic response in guinea pigs ( Thomas and Hagan, 2004) 5 HT1A GPCR The 5 HT1A GPCR was the first fully sequenced 5HT GPCR, identified by screening a genomic library for homologous sequences to the 2 Adrenergic GPCR ( Kobilka et al., 1987, Albert et al., 1990) The 5 HT1A receptor displays high affinity for 5 HT and has been pharmacologically distinguished from the other 5HT GPCRs Selective full agonists include 8OH DPAT and LY 293284 (Figure 1 31) while there are several semi selective partial agonists like buspirone, aripiprazole, amphetamines, ergotamines, and clozapine. For a while, the n on selective antagonists like propranolol, spiperone, and pindolol were the only antagonist tools available for the 5HT1A receptor. Since, a number of selective silent antagonists have been discovered, with WAY 100635 (Figure 1 32) among the most potent and selective ( Fletcher et al., 1996) 5 HT1A GPCRs are broadly distributed throughout the CNS and are expressed by all 5 HT neurons presynaptically (as autoreceptors) and by numerous nonse rotonergic (as heteroreceptors) neurons ( Pazos et al., 1985) G enerally, the effect 44

PAGE 45

of 5 HT1A activation is inhibitory and act s by reducing neuronal firing rates. Activation of 5 HT1A receptors can elicit numerous physiological effects including hypothermia ( Lesch et al., 1990) hyperphagia ( Lesch et al., 1990) and serotonin syndrome ( Hjorth et al., 1982) but may also elicit antidepressant activity ( Celada et al., 2004) Mechanisms for Regulating GPCR Homeostasis Desensitization, in pharmacological terms, is the loss of response subsequent to a continual or repeated dose of ligand ( Hausdorff et al., 1990) and can also be called tachyphylaxis. However, this should not be confused with downregulation, the proteolytic cleavage of GPCRs usually in lysosomes, which contributes to GPCRs overall desensitization profile. Molecular Desensitization Molecular desensitization of GPCRs can be classified into two categories: homologous and heterologous. Homologous desensitization occurs when a specifi c receptor is activated, and an a gonist stabilizes conformations that allow the response of that receptor to be attenuated without affecting any other receptor system. Heterologous desensitization, on the other hand, attenuates the response to a variety of ligands through multiple receptor subtypes and occupancy statuses ( Chuang et al., 1996) Homologous desensitization occurs through direct alterations to the GPCR itself, whereas heterologous desensitization involves GPCR modification in addition to altering signal ing components downstream of the receptor. Although both processes decrease overall receptor function, the underlying mechanisms and proteins involved are different, yet both depend on the key step of receptor phosphorylation ( Kelly et al., 2008) Functional desensitization o f a GPCR can be reversed by a process called resensitization, which increases a GPCRs function. 45

PAGE 46

The classical model of homologous desensitization can be described as follows: first, an agonist binds to the receptor stabilizing a conformation that activates a heterotrimeric G protein; second, a GRK is translocated to the membrane, where it binds to the activated receptor as a substrate. After binding to the receptor, the GRK phosphorylates the receptor on certain amino acid residues, usually serine or threonine residues because of their hyrdoxyl moieties and similar side chains. For certain GRK subtypes, free G protein subunits recruit and bind GRKs and aid in the recruitment towards activated receptors ( Inglese et al., 1993) Third, arrestin can now bind to the phosphorylated receptor, eliminating further G protein coupling th rough steric interference and leading to internalization, which is often mediated by clathrin coated pits. The receptor arrestin complex can be degraded in lysosomes or recycled, the later involving receptor dephosphorylation by protein phosphatases and tr anslocation back to the cellular m embrane (depicted in Figure 133 ). The ultimate fate of the receptor is often determined by the length and concentration of agonist exposure ( Kelly et al., 2008) Heterologous desensitization utilizes different cellular machinery than homologous desensitization and exhibits unique differences in receptor desensiti zation. Heterologous, or agonist independent desensitization, was first characterized in the the adrenergic receptor ( Benovic et al., 1985) where a cAMP dependent kinase was shown to phosphorylate the adrenergic receptor and arrest the adenylate cyc lase signaling system. After a receptor is activated, second messengers of a signal cascade can activate protein k inases, such as PKA or PKC. These kinases can then phosphorylate the agonist occupied receptors or agonist unoccupied receptors of similar or different subtypes of receptor. Arrestins, as well as other sca ffolding proteins, assist in internalizing of rece ptor/scaffolding protein 46

PAGE 47

complex into the cytosol, and the internalized receptor complex can then be downregulated or recycled (Figure 134). These processes (homologous and heterologous d esensitization) can be additive, whereby the secondary messenger kin ases and GRK s can phosphorylate receptors independently for further desensitization, or, synergistically, where PKA/PKC can phosphorylate the GRK on serine residues to directly enhance GRK induced receptor desensitization ( Cong et al., 2001) ( recombinant desensitization). Both of these processes may reduce the potency and efficacy of a ligand t o stimulate further the G protein signaling pathways at a receptor G Protein Receptor Kinases (GRKs) GRKs are known to phosphorylate GPCRs at dist inct amino acid residues in the intracellular loops of GPCRs particularly the 3rd and C terminal loops. GRKs belong to a group of kinases called serine/threonine kinases, because they phosphorylate serine or threonine residues on their hydroxyl moieties. GRKs typically phosphorylate 34 serine/threonine residues within a 56 residue span ( Gurevich and Gurevich, 2006) There have been 6 mammalian c DNAs of GRK subfamilies cloned to date and, with the exception of GRK1 (exclusively expressed in the retina) and GRK4 (exclusively expressed in the testes), the other 4 GRKs are expressed ubiquitously ( Inglese et al., 1993) These GRKs also share key struc tural features: a core catalytic domain consisting of ~ 260 amino acids flanked by an amino terminal ~185 amino acids and a carboxy terminal, of variable length. Both termini are thought to be crucial in proteinprotein interactions and receptor recogniti on ( Pitcher et al., 1998) In particular, the aminoterminus of some GRKs (i.e. GRK2) also contains a regul ating G protein signaling (RGS) homology domain that binds sequesters G q ( Tesmer et al., 2005) In addition GRK2 interacts with a 47

PAGE 48

number of other proteins in vitro to a ffect receptor desensitization, endocytosis and G prot ein independent signaling mechanisms. Most important is the arrestin signaling cascade, but G subunits, clathrin, phosphoinositide kinases, tubulin as well as erzin are also shown to be linked ( Evron et al., 2012) GRKs once thought only to be involved with phosphorylation of receptors for the recruitment of arrestins have subsequently been f ound to posses a more extensive role in receptor signaling and regulation. One specific interaction is that of GRK2 with G whereby G can stimulate a translocation of GRK2 to the membrane ( Li et al., 2003) in addition to desensitization G proteincoupled inwardly rectifying potassium channels (GIRK) ( Raveh et al., 2013) Similarly, it has been reported that in striatal neurons GRK2 q qcoupled signaling and desensi tize the mGluR5, thus targeting it for internalization in a phosphorylationindependent manner ( Ribeiro et al., 2009) Arrestin Soluble arrestin proteins are essential to the molecular mechanism of GPCR desensitization and downregulation or resensitization. An arrestin was first identified in rod outer segments as a 48kDa protein that quenches light dependent signal transduction in photoreceptor cells ( Wilden et al., 1986) Another form of arrestin, arrestin, was discovered a f ew years later and shown to attenuate 2 adrenergic receptor signaling ( Lohse et al., 1990) To date, four families of arrestins have b een identified: the visual, conal arrestin1, and arrestin2. The visual and conal arrestins are exclusively located in the rod and cone cells in the eye, respectively, to fac ilitate light dependent signaling whereas the nonvisual arrestins are located ubiquitously throughout the body and interact with a diverse number of receptors. Most neurons express both types of nonvisual arrestin, but predominantly express 48

PAGE 49

arrestin1. arrestin2 is most prominently expressed in the olfactory epithelium to regulate olfaction via olfactory receptors ( Krupnick and Benovic, 1998) Arrestin proteins bind to distinct forms of activated receptors that have been phosphorylated, usually accompanying GRK phosphorylation patterns. It has been hy pothesized that there are sequential multisite interactions between GPCRs and arrestins that have two steps, where: (1) GPCRs has to be phosphorylated and (2) GPCRs undergo con formational changes that result from receptor activation ( Gurevich and Gurevich, 2006) arrestin1 preferentially binds to a adrenergic receptor that has been phosphorylated by GRK, but not PKA, a process that also prevents G s stimulation ( Pitcher et al., 1992 ) This mechanism also pertains to visual arrestin, whose binding to rhodopsin receptors is light dependent but is significantly enhanced when phosphorylated by rhodopsin kinase, a GRK ( Kuhn et al., 1984) Upon arrestin binding, receptors cannot activate G pr oteins, and the association with arrestin switches the receptor into a different signaling mode (i.e., desensitized) and elicits entry of the complex into the endocytotic pathway, where other effector systems may come into play. These distinct signaling modes can be pharmacologically distinguished, with ligands exhibiting bias towards either G protein or arrestin pathways ( Luttrell and Gesty Palmer, 2010) For example, biased ligands of the opioid receptor were some of the first to be discovered. DAMGO, ( D Ala2,N MePhe4, Gly ol5]enkephalin) (Figure 1 35) and etorphine (Figure 1 36 ) induce rapid opioid receptor desensitization via arrestin desensitization pathway s, whereas morphine (Figure 137 ), a common analgesic, is not readily desensitized via arrestin ( Zhang et al., 1996) Instead, morphine is thought to recruit PKC regulated phosphorylation, as morphine desensitization of the opioid receptor can be blocked by PKC inhibitors, which do not affect the desensitization of the opioid receptor 49

PAGE 50

induced by DAMGO ( Johnson et al., 2006) While both DAMGO and morphine produce robust opioid receptor desensitization, these data sugg est that opioid receptors activated by morphine are desensitized by a different molecular mechanism than the opioid receptors desensitized by DAMGO. Distinguishing the molecular requirements that gov ern the two distinct receptor desensitization pathways could translate to the generation of bias ligands which elicit reduced desensitization for other GPCR systems. Protein Kinases Proteins convey signals throughout all eukaryotic cells and in many differ ent sub cellular structures. One of the most frequent ways protein function is altered is by the process of phosphorylation, adding a PO4 3 moiety. Proteins that catalyze this reaction, commonly using adenosine tri phosphate (ATP) as substrate, are called kinases. Kinases are encoded by some 518 distinct humans genes comprising 1.7% of the human genome ( Manning et al., 2002) Of particular importance to GPCRs is the AGC group of kinases, named after three of the most prominent families within the group (PKA, protein kinase G, and PKC). There are 16 families in this group of kinases, some of whi ch are exclusively found in metazoans, but of most relevance to 5 HT2 receptors is PKC for the regulation of lipid based second messengers. These two families are activated by the increase of their second messengers, cAMP, or DAG and Ca2+, respectively, which are associated with their phosphorylating action. Since 5HT2 GPCRs signal through G q to activate PLC, and ultimately activate PKC downstream to elicit further cell signaling, a desensitization mechanism that dampens receptor coupling to G proteins w ould serve as a negative feedback loop. PKC activation by phorbol 12myristate 13acetate (PMA) (Figure 1 38 ) induces internalization and desensitization of the 5HT2A receptor in the absence of 50

PAGE 51

agonist. These data, coupled with the fact that when 5HT was pre incubated with the PKC in hibitor sphingosine (Figure 139) subsequent internalization and desensitization of the 5 HT2A receptor were blocked ( Bhat tacharyya et al., 2002) suggest that PKC can heterologously desensitize the 5HT2A receptor, although less is known for the role of PKC in the desensitization of the 5HT2C receptor. Internalization Cells regulate themselves in a variety of ways to maintain homestasis including internalization and externalization of substances across the plasma membrane such as ions, nutrients, toxins, large proteins, and pathogens. For macromolecules and pathogens, the phys ical exchange of cell membrane is required. Plasma membrane exchange is the process whereby a lipid bilayer membrane is fused with or detached from the extracellular plasma membrane. In some cases, such as macrophages, membrane exchange can happen quickly, exchanging the entirety of their extracellular membrane surface area every 33 minutes ( Steinman et al., 1976) rather slowly allowing receptors to reside within the extracellular membrane for hours to days. Objects enter the cell via four main types of endocytosis: clathrin mediated, caveolaemediated, micropinocytosis, and phag ocytosis. Most commonly, clathrindependent and caveolaedependent pathways pertain to GPCR endocytosis and recycling. Particularly with class A GPCRs, clathrin is known to be involved arrestin1and 2mediated internalization ( Goodman et al., 1996 ) Clathrin consists of three heavy and three small chains that form a triskelion structure. When multiple triskelions aggregate they form a polyhedral lattice to surround and delineate an inter nalization vesicle ( Figure 140). Triskelions are extremely flexible and structurally adapt to form themselves around a variety of internalized receptors ( Pearse et al., 2000) Clathrin mediated 51

PAGE 52

internalization is often accompanied by adaptor proteins, particularly AP2, which link the receptors, arrestins, and other proteins to the forming clathrin lattice to be internalized as one aggregate ( Pearse et al., 2000) A ~100kD GTPase, called dynamin, is then often responsible for cutting of the newly formed clathrin lattice from the extracellular membrane. This process is also involved in cellular vesicle formation during biogenesis of membranous organelles, cytokinesis, and pathogen resistance ( Henley et al., 1999) The GPCR complex within endocytotic vesicles usually undergoes one of two fates at this point. Either the receptor is dephosphorylated by protein phosphatases and the receptor vesicle complex is recycled back to the extracellular membrane to proceed with normal function or, alternatively, the internalized vesicle fus es with lysosomes that degrade the receptor into amino acids. The vesicles containing class A GPCRs can be categorized into two groups dependent on which process the receptor vesicle complex favors: either recyclization or degradation. Class A receptors, l ike the 2 adrenergic receptor and opioid receptors, favor quick recycling from an unstable receptor vesicle complex resulting in rapid dissociation from arrestin, which may occur before internalization, and subsequent recruitment of protein phosphatas es. Class B receptors, like the vasopressin 2 receptor and angiotensin I receptors, form stable internalized receptor vesicles and slowly dissociate from arrestin to allow recruitment to lysosomes for degradation. Differential ligands, concentration and length of exposure to agonist are thought to direct which of these two routes (recycling or degradative) a receptor vesicle complex ultimately takes. 52

PAGE 53

Protein Phosphatases Phosphorylation, as mentioned earlier, remains a key regulatory mechanism of receptor activity and fate. Protein kinases phosphorylate key residues to terminate G protein mediated activity and target the receptor for possible internalization. Protein phosphatases are the reciprocal enzymes to kinases in this process. If the cell needs the phosphorylated receptor back to the plasma membrane in functional form, a phosphatase must remove the phosphat e moiety from the key residues i n the receptor. This dephosphorylation event allows for the possibility of the receptor to stimulate G proteins once again. There are seven known groups of serine/threonine phosphatases encoded by the human genome, with multiple variants in each group ( Shi, 2009 ) The most important group in regard to class A GPCR regulation is protein phosphatase 2A (PP2A), known to dephosphorylate a variety of GPCRs, notably the 2 adrenergic GPCR ( Vasudevan et al., 2011) Phosphatases have a heterotrimeric subunit structure and consist of a 65k Da structural A component (2 isoform s), a regulatory B component (16 isoforms) and a 36k Da catalytic C component (2 isoforms) utilizing two Mn(II) ions as cofactors for dephosphorylation ( Xu et al., 2006) These subunits consist of mostly consecutiv e doublelayered alpha helices that align into a C shaped quaternary structure. The regulatory subunit plays keys roles in substrate specificity and localization of each enzyme. The role of PP2A in the recycling of phosphorylated 5HT2C receptors is still unclear. Resensitization Resensitization can be defined as the process that restores the responsiveness of the desensitized receptor either in the continued presence or absence of desensitizing stimulus ( Vasudevan et al., 2011) This process in terms of 53

PAGE 54

GPCRs is mediated almos t exclusively by dephosphorylation of specific amino acid residues on intracellular loops and the C terminal tail of the GPCR although there are processes before and after dephosphorylation that can alter receptor function. A lterations in receptor function could encite adverse effects resulting from chronic ligand exposure. The molecular mechanisms of both positive and negative regulation of 5 HT2C receptor function are needed to gain a holistic view of the signaling potential of the 5 HT2C receptor within any cellular system. The molecular mechanisms of resensitization are less well understood than desensitization for class A GPCRs. Howver, literature has concluded that protein phosphatases must dephosphorylate certain intracellular residues to allow heterotrimeric G protein binding. In order to accomplish this feat, certain scaffolding proteins like the AKAPs must first associate with the receptor complex to recruit the phosphatases. Specifically for the 2 a drenergic receptor a particular AKAP, gravin, is known to associate with the 2 a drenergic receptor and increase with agonist stimulation ( Shih et al., 1999) Phosphoinostol 3 kinase (PI3K) was also shown to play a modulatory rol e in resensitization, PI3K phosphorylates the endogenous inhibitor of PP2A, I2PP2A, to block the dephosphorylation of amino acids on the GPCR and promote lysomal degradation ( Nienaber et al., 2003) In some receptor systems, like the opioid receptor in primary neuronal cultures ( Arttamangkul et al., 2006) and 5HT2A receptors expressed in HEK cells ( Gray et al., 2001) desensitization can be internalizationindependent. Therefore, the receptor complex can be phosphorylated and dephosphorylated without ever le aving the extracellular membrane It is clear that desensitization and resensitization have distinctive mechanistic players and are regulated independently. 54

PAGE 55

However, both affect receptor signaling and are potentially exploitabl e avenues to improve clinica l drug efficacy regarding chronic ligand exposure. Downregulation Desensitized GPCRs can be recycled back to the membrane (resensitization) or degraded (downregulation). While both desensitization and downregulation can decrease GPCR signaling, they are in fact two distinct molecular processes. Downregulation is defined as a reduction in radioligand binding sites detected in a total membrane faction, which is generally induced by repeated or prolonged activation of receptors, w hereas desensitization is the redistribution of functional receptor from the cell surface ( Tsao and Zastrow, 2000) Desensitizat ion can be recovered from in the for m of resensitization, whereas recovery from downregulation involves biosynthesis of new protein ( Doss et al., 1981) For GPCRs, downregulation is usually associated with translocation from the membrane t o lysosomes for degradation ( Ko et al., 1999) Ligandinduced receptor internalization occurs rapidly in comparison with receptor downregulation, and can lead to multi ple physiological consequences other t han receptor degradation ( Gruenberg and Maxfield, 1995) Thus, downregulation is dependent on the internalization of the receptor, yet receptor internalization does not predispose or conishn the receptor to degradation. When the receptor endocytotic complex fuses with the lysosome, the acidic environment and acid hydrolase degrade a GPCR into c omponent amino acids for further protein synthesis ( Settembre et al., 2013) 5 HT2C GPCR Desensitization The mechanisms of 5HT2C receptor de/resensitization have received relatively little attention compared to other GPCRs, including 2adrene opioid, and dopamine D2 receptors. Some reports indicate that 5HT2C ligand efficacy may 5 5

PAGE 56

impact the extent of receptor de/resensitization at each individual signaling pathway. Reports suggest that each signaling pathway may be i ndependen tly regulated from other s under homologous desensitization ( Berg et al., 1998) For example, ( Stout et al., 2002) et al. found that pretreatment of Chinese hamster ovary (CHO) cells with partial agonists lysergic acid diethylamide (LSD) and quipazine activates the 5HT2C receptor dependent aracha donic acid ( AA) pathway while moderately desensitizing the IP3 pathway. The extent of 5 HT2C receptor m RNA editing also impact s the degree of ligand induced desensitization and re sensitization ( Porter et al., 2001) as well as receptor trafficking ( Marion et al., 2004 ) Furthermore, 5 HT2C receptors and the closely related 5 HT2 A receptor may be desensitized or resensitized by antagonist s/inverse agonists dependent on the specific ligand pretreatment and what in vitro system is being studied ( Gray and Roth, 2001 Van Oekelen et al., 2003) More over, the 5HT2C receptor shows rapid and prolonged agonist dependent desensitization to both effec tor pathways IP3 and AA, although at varying rates not directly correlated to agonist efficacy ( Stout et al., 2002 ) The m olecular mechanisms of desensitization and re sensitization may be uniq ue for different GPCRs, because each GPCR has unique signaling outcomes and distinct sequences of serine/threonine residues capable of phosphorylation by discrete kinases. For example, the 5HT2C receptor activates PKC downstream of G protein stimulation, but PKC may phosphorylate 5HT2C receptors to alter the balance between 5HT2C receptor inactivation and recycling. Limited literature exists for the desensitization mechanism of the 5 HT2C receptor regarding the kinases and residues involved. Backstrom et al. reported that deletion of the PSD 95, Discs Large, Zona Occludens proteins 1 ( PDZ ) binding domain, specifically residue S459, significantly enhances 5 HT induced receptor 56

PAGE 57

desensitization and inhibits receptor recovery to the plasma membrane, but to the authors best knowledge, the potential effect o f other residues on 5 HT2C desensitization remains unknown, in contrast to the 5HT2A receptor ( Backstrom et al., 2000) T he direct PKC activator, phorbol 12myri strate 13acetate (PMA), induces 5 HT2A receptor internal ization, an effect blocked by the PKC inhibitors sphingosine and staurosporine ( Kagaya et al., 1990, Rahman and Neuman, 1993, Bhattacharyya et al., 2002) Ligand bias, in regards to involvement of PKC has been implicated for ligandinduced internalization of the 5 HT2A receptor ( Raote et al., 2013) shown by the requirement of phosphorylation by PKC for 5 HT induced internalization but not for dopamine or clozapineinduced internalization. In addition, t wo serine residues were found to have a significant impact on agonist induced 5 HT2A receptor desensitization, S188 in the 2nd intracellular loop along with S421 in the C terminus ( Gray et al., 2003 ) of which an amino acid homologue exists for the 5 HT2C receptor, S407. Desensitization in the C linic Drug induced GPCR d esensitization in the clinic has been well documented in a number of situations, mostly detrimental to a patients health. Pain medications, with emphasis on the drugs targeting the opioid receptor, are known to develop rapid tolerance and require escalating doses when treating chronic pain. These drugs are known to cause robust receptor desensitization in vitro and this desensitization is one of the foremost limitations in current pain management ( Williams et al., 2013 ) Additionally, illicit drug abusers are often compelled to take escalating doses to generate the same euphoric feeling as when they first tried the drug. Patients continue taking escalated doses leading to increas ed deleterious side effects and the possibi lity of lethal overdoses ( Riley et al., 2016 ) Similarly asthma 57

PAGE 58

rescue medications, such as salbutamol the putative 2a drenergic receptor are known to invoke receptor desensitization in vitro ( Gimenez et al., 2015) and are required to give black box w arning that long term and frequent use results in the reduction in efficacy of lifesaving treatments to anaphylaxis ( FDA, 2008) Impact of 5 HT2C GPCR D esensitization in H umans and T ranslational V alidity T herapeutics targ eting the 5HT2C GPCR combat obesity and are proposed to treat psychiatric disorders. These dis ease states require chronic administrat ion of a pharmaceutical regimen. If such therapeutics were to develop rapid tolerance, similar to some opioid, 5HT2A, or adrenergic receptor agonists, the tolerance could be detrimental to the long term therapeut ic efficacy. If this desensitization process is ligand directed and/or otherwise easily modulated, it could be beneficial to design functionality into small molecule therapeutics resulting in reduced 5HT2C desensitization, similar to the bias ligands desi gned for the 2 adrenergic receptor ( Carr et al., 2014) Specific enzymes and factors must govern this process, and identification of this collection of cellular machinery would also improve the ability to screen for 5HT2C receptor desensitization in vitro Ideally this in vitro model would translate easily and accurately into an in vivo m urine model of either obesity or psychoses relat ed s tates In Vivo Behavioral Screens for Antipsychotic Activity DOI induced HTR The DOI induced head twitch response (HTR) in rodents is a reliable dosedependent in vivo pharmacologic screen that has low variability between observers, subjects, and repeated administrations. The DOI induced HTR displays decent face validity for demonstrating stereotypic tic behavior and translational validity in the treatment of neurological diseases such as the positive symptoms of schizophrenia 58

PAGE 59

( Canal and Morgan, 2012) Hallucinogen ic compounds in humans, most commonly DOI induce the HTR mainly through 5HT2A receptor agonism. This pharmacologic mechanism has be delineated through the use of 5HT2A KO mice. These mice do not show a HTR after treatment with DOI, but restoring the 5 HT2A receptor to cortical neurons in the 5HT2A KO mice additionally restores the DOI induced HTR ( Gonzalez Maeso et al., 2007) Furthermore, 5 HT2A receptor agonists that do not cause hallucinations in humans, like lisuride, also do not cause a HTR in rodents. The 5 HT2C GPCR has also been proposed to modulate the DOI i nduced HTR. 5 HT2C KO mice elicited 50% less HTRs compared to their wild type littermates ( Canal et al., 2010) In addition, selective 5HT2C agonists and antagonists modulate the HTR in rodents ( Canal et al., 2013a) Most antipsychotics block this effect via their 5HT2A antagonist activity, yet these antipsychotics also possess relevant 5HT2C activity, so the 5HT2A/5 HT2C polypharmacologic profile in this rodent model may be synergistic. The DOI induced HTR in rodents may model a variety of psychiatric states including hallucinogenesis, schizophrenia, and obsessivecompulsive disorder, but most accurately predicts 5HT2 receptor activity ( Canal and Morgan, 2012) Considering that classical hallucinogens are the main inducers of the HTR in rodents and 5HT2A agonists that do not produce hallucinations in humans also do not produce a HTR in rodents it would therefore be easy to assume that the HTR simply models hallucinogenesis in rodents, yet slight complications arise. For example, 5hydroxytryptophan (5HTP), D fenfluramine ( Darmani, 1998) and the cannabinoid 1 receptor antagonist/inverse agonist SR141716A all induce HTR, with no report of hallucinogenic activity in humans. Additionally, the HTR induced by any class of compound can be blocked directly by a 5HT2A antagonist, suggesting the HTR in 59

PAGE 60

rodents is mediated primarily through by 5HT2A. However, due to modulatory capabilities of the 5HT2C receptor in this assay, this in vivo screen will be used to test the effect s of chronic administration of 5HT2C ligands known to modulate 5HT2C receptor function and druginduced psychotic behaviors. Locomotor Activity It has been demonstrated repeatedly that interventions glob ally attenuating dopaminergic ac tivity in adult mammals produce hypoactivity ( Beninger, 1983) Thus dopamine blocking agents such as 6OH DPAT, lesions in dopamine ascending systems, or drugs that block catecholamine synthesis can elicit hypolocomotion. On the contrary, global activation of dopaminergic systems have commonly been found to elicit stimulatory effects and/or stereotypies, depending on the dose. Dopaminergic agonists like amphetamines, cocaine, apomorphine, and LDOPA all elicit these effects ( Cole, 1978) In fact, through positron emission tomography it has been demonstrated that there is an increase in amphetamine induced synaptic dopamine concentrations in patients diagnoised with schizophrenia ( Breier et al., 1997) This can explain why amphetamine administration in schizophrenics often exacerbates psychosis symptoms Dopaminergic dysfunction (usually hyper dopaminergic neurotransmission) has long been thought to contribute to the pathophysiology of psychoses in humans ( Heinz and Schlagenhauf, 2010, Howes et al., 2012) Systemic amphetamine causes the release of dopamine from intraneuronal vesicles in addition to inhibiting competitively dopamine reuptake via the dopamine transporter (DAT). This results in globally increased s ynaptic levels of dopamine, predominantly in the nigrostriatal and the mesolimbic syste ms ( Cole, 1978) The increase in synaptic dopamine is correlative to the increased locomotor activity following amphetamine admi nistration. 60

PAGE 61

Therefore, amphetamineinduced hyperlocomotor activity is hypothesized to model positive symptoms of schizophrenia. M odulation of the amphetamine induced hyperlocomotor activity in rodents has long been used as a model to screen drugs for antipsychotic activity ( Arnt, 1995) Stereotypic Jumping Genetically engineered strains of mice are often used to model neurological disease states. The C58/J inbred mouse strain has several genetic manipulations that have been associated with autism such as tryptophan hydroxylase 2 (the ratelimiting enzyme in central 5HT biosynthesis) and a behavioral profile that reflects core symptoms in autism, inc luding deficits in sociability, motor stereotypy and impaired communication ( Moy et al., 2009, Moy et al., 2014) This model displays predictive validity for drugs blocking the stereotypic jumping behavior readily observed in these C58/J mice and the stereotypic events in humans ( Crawley, 2007) Glutamate Antagonist induced Hyperlocomotion and Stereotypic Rotations Dysfunction of glutaminergic neurotransmission, specifically in th e diminished transmission of hippocampal pathways, is thought to be part of the pathophysiology involved in psychoses ( Tamminga, 1998 ) In fact, administration of noncompetitive antagonists of the N methyl D aspartate ( NMDA ) GPCR, like MK 801 and ketamine, to schizophrenic patients results in a doserelated increase in both positive and negative symptoms ( Anis et al., 1983, Javitt and Zukin, 1991) The behavioral responses in rodents following acute administration of a noncompetitive NMDA antagonist are hyperlocomotion, stereotypic behavior (repetitive clockwise or anti clockwise rotations) and cognitive deficits ( Verebey et al., 1981 Ford et al., 1989) The hyperlocomotion and stereotypic rotations are easily observed and quantifiable 61

PAGE 62

via automated video monitoring detection and are thus used to mimic psychotic states. This model has predictive validity in assessing the antipsychotic activity of a compound in humans ( Pratt et al., 2012 ) Central Hypothesis and Goal of this Dissertation The central hypothesis tested here is that novel phenyl N N dimethyl 1,2,3,4tetrahydroanphthalene 2 amine ( p henyl a mino t etralin PAT) compounds with serotoninergic activity are suitable for development as novel antipsychotic s with optimal preclinical therapeutic profiles. The goal s of the dissertation are to charac terize the molecular determinants for binding and function and the regulation of functinal receptor for novel substitutedPAT derivatives synthesized in our laboratories at human serotonin 5HT2A, 5 HT2B, 5 HT2C, 5 HT7, and H1 GPCRs. In vivo antipsychotic efficacy of PAT analogs i s evaluated using three different rodent models of psychosis, the serotonin 5HT2 agonist HTR model, amphetamine induced locomotion and MK 801 induced stereotypic rotations The goals are pursued according to the following 3 Specific Aims: AIM 1: Lead Optimization of the (2 S 4 R ) trans 4 phenyl N N dimethyl 1,2,3,4tetrahydro n a phthalene 2 amine (4 phenyl 2 aminotetralin; 4 PAT) Scaffold Targeting Serotonin 5 HT2 GPCRs for the Treatment of Psychosis (2 S 4 R ) T rans 4 phenyl N N dimethyl 1,2,3,4 tetrahydronaphthalene2 amine (4 phenyl 2 dimethylaminotetralin, 4 PAT) possesses a unique quality of enhancing 5 HT2C receptor mediated inositol triphosphate (IP3) signaling while reducing IP3 signaling at the closely related 5 HT2A and 5HT2B G proteincoupled receptors (GPCRs) T here is no therapeutic potential for compounds activating 5 HT2A and 5 HT2B receptors as activation results in hallucinations and cardiovascular toxicity, respectively However, 5 HT2C receptor agonists have therapeutic utility, as evidenced by the recent approval of the selective 5 HT2C agonist lorcaserin 62

PAGE 63

(Belviq) for obesity ( Arena Pharmaceuticals, 2012) Moreover preclinical studies suggest activating 5 HT2C receptors may be therapeutic for treating both positive (hallucinations) and negative (cognitive impairment) symptoms of schizophrenia ( Jensen et al., 2010) ( Wacker and Miller, 2008) ( Wood et al., 2001 ) T his a im tests the hypothesis that substituents at meta positions of the 4 phenyl moiety and at the 6,7 position of t etrahydronaphthalene ring of trans 4 PATs can im prove selectivity or affinity at 5 HT2C receptors over phylogenetically closely related off targets, the 5 HT2A, 5 HT2B, and histamine H1 GPCRs. The trans 4 PATs with optimal 5 HT2 pharmacologic profile (Ki<100 nM, and agonism at 5 HT2 C without activation of 5HT2A, 5 HT2B, and H1) were assessed further in mouse models of ps ychoses. One such model, the ()2, 5 dimethoxy 4 iod oamphetamine (DOI) induced headtwitch response (HTR) in rodents, has shown predictive validity for compounds treating psychotic states ( Canal and Morgan, 2012) and was used to evaluate further antipsychotic potential of potential trans 4 PAT lead compounds. Other putatively selective 5 HT2C agonist standards, lorcaserin and Ro 600175, also were also evaluated in the same preclinical models. AIM 2: Characterization of Signaling Outcomes from Chronic Agonist and Inverse Agonist Ligand Interaction with 5 HT2C GPCRs In Vitro and In Vivo Desensitization of GPCRs via chronic ligand exposure reduces the therapeutic efficacy of many currently approved medications. This aim tests the hypothesis that electronic and steric features of 5HT2C ligands impact, positively or negatively, the degree of de/resensitization associated with activation and inactivation of 5HT2C receptor signaling. 5 HT2Cmediated activation of phospholipase C and accumulation of the second messenger [3H]IP3 in response to chronic (20hour ) 5 HT2C agonist and inverse agonist ligand treatment was measured in CHO K1 cells transiently transfected with the human w ild type 5HT2C 63

PAGE 64

receptor. A variety of agonist and inver se agonist molecules, including 4PATs with different electronic and topological propoerties or features were compared for their effects on 5 HT2C homologous de/resensitization. The role of PKC phosphorylation (in response to PLC activation) on 5HT2C agonist induced desensitization was determined by the use of the selective PKC inhibitor chelerythrine. The role of amino acid S407 (located within the C terminus of the 5 HT2C receptor) on 5 HT2C recept or mediated agonist induced desensitization was investigated through the use of the point mutant, S407A. Given demonstration that 5 HT2C ligand s modulate the DOI induced headtwitch response (HTR) ( Canal and Morgan, 2012) and 5HT2C knockout (KO) mice show a 50% red uction to the DOIinduced HTR compared to wild type littermates ( Canal et al., 2010) the 5 HT2C agonist induced desensitization also was evaluated in vivo regarding the ability of the test compounds to elicit the DOI induced HTR response. Agonists were administered chronically (4successive days) and DOI was administered on the 5th, 10 minutes later headtwitches and lo comotor activity were quantifie for 10 minutes Information learned will be useful for drug design and development purposes regarding avoidance of detrimental desensitization or resensitization in chronically treated pharmacotherapeutic regimens targeting the 5HT2C receptor. AIM 3 : Lead Optimization of the 5 pheny l N N dimethyl 1,2,3,4 tetrahydro n aphthalene 2 amine ( 5 p henyl a minot etralin; 5 PAT) Scaffold Targeting the 5 HT1A and 5 HT7 GPCRs for the Treatment of Autism Spectrum Disorders Another library of N,Ndi methyl tetrahydronapthelenes with the phenyl moiety a t the 5 position (5PATs) was synthesized from progress made in the research of 4PATs for the treatment of psychoses. New structureactivity reports of the recently cloned 5HT7 GPCR suggest 5 PATs could selectively bind and activate the 5HT7 and closely related 5HT1A receptors ( Leopoldo et al., 2011) Limited 64

PAGE 65

pharmacological probes have demonstrated the 5HT7 GPCR modulates circadian rhythms ( Hedlund, 2009) which are disrupted in nearly all neuropsychiatric conditions, including autism spec trum disorder (ASD). Furthermore, the 5HT7 GPCR shows a high receptor population within the thalamus, a brain region known to regulate motor behavior ( Guillery and Sherman, 2002) Corroborating this fact is that selective 5HT7 antagonists are less effective at reducing locomotor behavior in 5HT7 KO mice ( Jordan et al., 2008) 5 HT1A receptor activation may also elicit a therapeutic outcome, as 5 HT1A agonists have been shown to treat L DOPA induced dyskinesia associated with Parkinsons disease. In addition, buspirone, which possesses high affi nity (21 nM) at the 5HT1A receptor ( Sundaram et al., 1992) is clinically effective at treating restricted and repetitive behaviors in children with autism ( Chugani et al., 2015) This aim assessed the molecular deter minants of the 5PAT scaffold for ligand b inding to the orthosteric binding pocket of the 5HT7 GPCR along with the closely related 5HT1A receptor, using 5PATs with substitutions at the ortho, meta, and/or para positions of the 5phenyl moiety. Other 5PAT analogues with various 2amine group su bstituents as well as 5 phenyl substituents to phenyl at the 5position were investigated to understand electronic, lipophilic, and steric structureactivity requirements for binding and function at the 5HT7 orthosteric binding site. 5 HT7/Gsmediated ac tivation of adenylyl cyclase and accumulation of second messenger cAMP was measured in HEK cells that were stably transfected with the human wildtype 5HT7 for select analogues possessing optimal binding profiles (Ki<50 nM). Based on evidence implicating the 5 HT7 and 5HT1A receptors to modulate repetitive motor behavior s, it was hypothesized that dual action 5PAT chemical leads would be efficacious at reducing stereotypies associated with 65

PAGE 66

associated with autism. Henceforth, the effect of the lead 5PAT was quantified in three models of rodent stereotypy: 1) idiopathic stereotypic jumping in C58/J mice, 2) DOI induced HTR, 3) MK 801induced rotations in addition to social interactions to assess the preclinical pote ntial to of 5PAT drug candidates for the treatment of autism spectrum disorders. Figure 11 A computer aided image of a 5 HT2 GPCRs and 5 HT bound in the orthosteric ligand pocket. Figure 12. A r epresentation of a GPCR s relationship with scaffolding proteins 66

PAGE 67

Figure 13 Ternary complex m odel. R is receptor, A is agonist ligand, B is G protein. Figure 14 Graphic representation of GPCR f unctional s electivity. 67

PAGE 68

Figure 15 Chemical structure of s erotonin (5 HT) Figure 16 5 HT b iosynthesis. Tryptophan i s hydroxylated by tryptophan hydroxylase (TPH) and then decarboxylated by amino acid decarboxylase (AADC) Figure 17 5 HT metabolism by monoamine oxidase (MAO) 68

PAGE 69

Figure 18 5 HT2C signaling via G q to stimulate PLC. The classical signaling cascade following 5 HT2C activation via PLC involves the catalysis of PIP2 into IP3 and DAG IP3 is released into the cytosol where it activates IP3 r eceptors in the endoplasmic reticulum to mobilize Ca2+ ions. DAG in the pres ence of Ca2+ activates PKC. Figure 19 Chemical structure of k etanserin. 69

PAGE 70

Figure 110. Chemical s tructure of Al 34662. Figure 111. Chemical structure of f enfluramine. Figur e 112. Chemical structure of m esulergine. Figure 113. Chemical structure of SB 206553. 70

PAGE 71

Figure 114. Chemical s tructure of SB 242084. Figu re 1 15. Chemical structure of c lozapine. Figure 116. Chemic al structure of olanzapine. 71

PAGE 72

Figure 117. Representation of the pharmacaphore for 5HT2C GPCR activation. ( Ahmed et al., 2009) Figure 118. Chemical structure of mCPP. Figure 119. Chemical s tructure of DOI. 72

PAGE 73

Figure 120. Chemical s tructure of Ro 600175. Figure 121. Chemical s tructure of WAY 161503. Figure 122. Chemical structure of l orcaserin. Figure 123. Chemical s tructure of a ripiprazole. 73

PAGE 74

Figure 124. Chemical s tructure of trans 4 PAT Figure 125. Chemical structure of v arenicline. 74

PAGE 75

Figure 126. Localization of 5HT2C in the limbic corticostriatal circuit. ( Bubar and Cunningham, 2008) 5 HT2A and 5HT2C GPCRs are localized to both DA and GABA neurons in the VTA, and both receptors are localized to GAB A medium spiny neurons in the nucleus accumbens In the PFC, the 5 HT2A receptor is predominantly localized to pyramidal glutamate neurons, with lesser expression in GABA interneurons and dopaminergic terminals. The 5HT2C receptor, on the other hand, is predominantly localized to GABA interneurons in the PFC, with lesser expression in pyramidal glutamate neurons in this region. In the amygdala, 5H T2A and 5HT2C receptors are localized on both GABA interneurons and pyramidal glutamate projection neurons. The 5HT2A receptor in the hippocampus is localized to pyramidal neurons as well as GABA interneurons, while the 5H T2C receptor is thought to be l ocalized to cell bodies pyramidal neuro ns that synapse locally upon pyramidal glutamate projection neurons. Figure 127. Chemical s tructure of 8OH DPAT. 75

PAGE 76

Figure 128. Chemical s tructure of LP 211 Figure 129. Chemical s tructure of SB 269970. Figure 130. Chemical s tructure of 5CT. 76

PAGE 77

Figure 131. Chemical s tructure of LY 293284. Fi gure 132. Chemical s tructure of WAY 100635. 77

PAGE 78

Figure 133. Schematic representation of homologous d esensitization. ( Kelly et al., 2008) 1) Agonist binds to receptor to stabilize active conformations 2) G proteins dissociate from activated recept or to signal through their effector systems 3) Distinct kinases (GRK) phosphorylate serine and threonine residues on only agonist stabilized receptor conformations 4) Arrestin binds the phosphorylated receptors 5) Arrestin bound receptors are internal ized via an endocytotic vesicle complex 6) Internalized receptors can be dephosphorylated or downregulated via lysosomes 7) Dephosphorylated receptors can be recycled back to the membrane for further function 78

PAGE 79

Figure 134. Schematic representation of heterologous d esensitization. ( Kelly et al., 2008) 1) Agonist binds to receptor to stabilize active conformations 2) G proteins dissociate from activated receptor to signal through their effector systems 3) Distinct kinases (GRK) phosphorylate serine and threonine residues on agonist stabilized receptor conformations, agonist unbound receptor conformations, and unrelated receptors 4) Arrestin binds the phosphorylated receptors to be internalized via an endocytotic vesicle complex. The internalized receptors can be dephosphorylated and recycled back t o the membrane or downregulated via lysosomes Figure 135. Chemical s tructure of DAMGO. 79

PAGE 80

Figure 136. Chemical structure of etorphine. Figure 1 37. Chemical structure of m orphine. 80

PAGE 81

Figure 138. Chemical s tructure of PMA Figure 139. Chemic al structure of s phingosine. Figure 140. Representation of clathrin triskelion and clathrin coated vesicle. 81

PAGE 82

CHAPTER 2 L EAD OPTIMIZATION OF THE (2S,4R) TRANS 4 PHENYL N,NDIMETHYL 1,2,3,4TETRAHYDRONAPHTHALENE 2 AMINE (4 P HENYL 2 A MINO T ETRALIN; 4 PAT) SCAFFOLD TARGETING SEROTONIN 5 HT2C GPCRS FOR THE TREATMENT OF PSYCHOSIS Specific Aim 1 The hit ( ) trans (2S,4R) 4 phenyl N,Ndimethyl 1,2,3,4 tetrahydroanphthalene 2 amine ( 4 p henyl 2 a mino t etralin; trans 4 PAT) was first synthesized as a sigma receptor ligand ( Wyrick et al., 1993) but was later found to have high affinity at the histamine H1 GPCR ( Booth et al., 1999) I t was subsequently ) trans 4 PAT also interact s with the se rotonin 5 HT2 GPCR family which is phylogenetically closely related to H1 ) Trans 4 PAT was selective for binding as well as activating the 5HT2C receptor over the 5HT2A and 5HT2B receptors ( Booth et al., 2009) Such a pharmacological profile could be advantageous regarding drug discovery to treat obesity due to the ability of 5HT2C receptors to modulate melacortin 4 GPCRs in the hypothalamus ( Lam et al., 2008) and to treat neuropsychiatric disorders due to activity of 5 HT2C receptors to modulate the mesolimbic dopamine system ( Di Matteo et al., 2000) The structure ) trans 4 PAT was modif ied based on inferences from molecular modeling and docking studies ( CordovaSintjago et al., 2012a, CordovaSintjago et al., 2012b CordovaSintjago et al., 2014) with the aim of expanding the structure activity relationship (SAR) of this chemotype at the othosteric binding pocket of the 5HT2C receptor Th e derivatives ( ) trans (2S,4R) 4 (3 [meta]bromophenyl) N,Ndimethyl 1,2,3,4tetrahydronaphthalen2 amine ( ) trans m Br PAT, Figure 21 ) and ( ) trans (2S,4R) 4 (3 [meta] chloro phenyl) N,Ndimethyl 1,2,3,4tetrahydronaphthalen2 amine ( ) trans m ClPAT, Figure 2 2 ) are more potent and efficacious 5HT2C receptor agonists in vitro and functionally through the 82

PAGE 83

triad of in vivo psychosis models DOIinduced HTR, and MK 801 and amphetamine locomotor activity ( Canal et al., 2014) Meanwhile, the derivatives ( ) trans (2S,4R) 4 (3 [meta] triflouromethanephenyl) N,N dimethy l 1,2,3,4tetrahydronaphthalen2 amine ( ) trans m CF34 PAT Figure 23 ) and ( ) trans (2S,4R) 4 ( cyclohexyl ) N,Ndimethyl 1,2,3,4tetrahydronaphthalen2 amine ( ) trans 4 CAT Fig ure 24 ) ( CordovaSintjago et al., 2014) have high affinity for the 5HT2C receptor over the 5HT2A, 5 HT2B, and H1 receptors, but, demonstrate inverse agonism at the 5HT2C receptor Addition al 4 PAT analogs with substitutions at the C(4), C(6), and C(7) positions of the tetrahydronapthelene scaffold (Figure 2 5 ) were synthesized in order to delineate the structure activity relationship (SAR) for the 4PAT scaffold at the 5HT2A, 5 HT2B, 5 HT2 C, and H1 GPCRs Methods Compounds The 4 PAT s were synthesized in our lab as a racemic mixture. The two enantiomers were resolved on the chiral stationary phase high performance liquid chromatography (HPLC) and converted to hydrochloride sal ts as previously described ( Booth et al., 2009) All PAT derivatives were > 99% pure, according to H1 NMR and HPLC. 5 HT hydrochloride (99%) was purchased from Alfa Aesar (Ward Hill, MA) ()2,5 D imethoxy 4 iodoamphetamine purchased from Sigma Aldrich (St. Louis, MO) L orcaserin hydrochloride (> 98% ) was purchased from Chem Scene, and [3H]m yoinositol (specific activity 22.5 Ci/mmol) was purchased from PerkinElmer Life and Analytical Sciences (Waltham, MA). 83

PAGE 84

In V itro Pharmacology H uman embryonic kidney 293 (HEK293) cells were transfected with 10 g human serotonin 5 HT1A, 5 HT2A, 5 HT2B, or 5 HT2C INI, 5 HT6, 5 HT7, histamine H1, or dopamine D2 receptor cDNA using Lipofectamine 2000 reagent (Invitrogen/Life Technologies, Carlsbad, CA ). Cell membranes were collected 48 hour s later via centrifugation at 15,000 g, three successive times, and then stored in 80C Cell membranes were incubated with test c ompounds in increasing con centrations from 0.1 to 10,000 nM, to compete for receptor orthosteric binding sites labeled with 1 nM [3H]ketanserin (5HT2A) or 2 nM [3H]mesulergine (5HT2B, 5 HT2C) [3H]LSD (5 HT6), [3H]5 CT (5 HT1A, 5 HT7), [3H]mepyramine (H1), [3H]raclopride (D2) Non specific binding w as determined in the presense of 10 M mianserin (5 HT2A, 5 HT2B, 5 HT2C) 10 M 5 HT (5 HT1A, 5 HT6, 5 HT7), 10 M mepyarime (H1), 10 M spiperone (D2), and was <10% of total biding in all case s. After a 90minute equilibration on a plate shaker (300 rpm) at room temperature, the incubation mixtures (test compound, radioligand, 35 mg protein with a final volume of 250 L) were rapidly passed through GF/B filters using a Mach 2 cell harvester (Tomtec, Hamden, CT) and subsequently washed with 50 mM Tris HCl. Filter disks were dried then placed in vials containing 2 mL of scintillation cocktail (ScintiVerse; Thermo Fisher Scientific, Waltham, MA) and counted for [3H ] induced scintillation using a BeckmanCoulter LS6500 counter (Indianapolis, IN). 5 HT2 receptor mediated IP3 hydrolysis assays were used to measure the functional responses of the synthesized compounds compared to 5HT. In brief, HEK293 cells were transiently transfected with a subty pe of cDNA, were labeled 24 hours later with 1 mCi/mL [3H]myoinositol, seeded into 48well plates, and incubated overnight in a humidified incubator at 37 C under 5% carbon dioxide /95% air Cells 84

PAGE 85

were washed with i nositol free DMEM and then treated with t est compounds or 5HT for 45 minutes. The reaction was stopped by addition of 100 mM formic acid. A nion exchange columns containing AG 1X8 resin (Bio Rad Laboratories, Hercules, CA) were used to bind and collect [3H ] IP3. [3H ] Induced scintillations then were measured. Each functional assay of test compound contained triplicate measurem ents of 11 concentrations, 0.1 10 ,000 n M. In V ivo Pharmacology Male C57Bl/6 mice were obtained at 8 weeks of age from The Jackson Laboratory (Bar Harbor, ME) for headtwit ch response (HTR) and locomotion studies; they were allowed to acclimate to the temperature (23C) and humidity controlled vivarium for at least 1 week before testing. The vivarium was illuminated from 7:00 AM to 7:00 PM. Mice were housed in pairs for HTR and locomotion studies. Standard rodent pellets and drinking water (Purina 5001; LabDiet, St. Louis, MO) were available ad libitum. Experiments were conducted at approximately the middle of the light phase. PATs Ro 600175, lorcaserin, and DOI were disso lved in sterile MilliQ water (Millipore Corp., Billerica, MA). All compounds were administered systemically (by intraperitoneal or su bcutaneous injection) in a volume of 0.01 mL /g body weight. All behavioral procedures were approved by the University of F lorida and Northeastern University Institutional Animal Care and Use Committee and were performed in accordance with the Guide for the Care and Use of Laboratory Animals. DOI Induced HTR and Locomotion. Ex perimentally nave mice were habituated to the tes ting room for approximately 30 minutes. Testing consisted of administration (subcutaneously) of MilliQ water (vehicle), PATs (3.0, 5.6, or 10.0 mg/kg), Ro 600175 (1.0, 3.0, or 5.6 mg/kg), lorcaserin (1.0, 3.0 or 5.6 mg/kg) followed 10 minutes later by an injection of 85

PAGE 86

the 5HT2 agonist DOI (1.0 mg/kg). Ten minutes later, mice were placed into a clear Plexiglas openfield chamber (43x 43 cm; Med Associates, St. Albans, VT) for a 10minute observation period. During this session, HTRs, defined as rapid and di screte back and forth rotation of the head, were counted by a trained observer who had been blinded to the drug treatment conditions. A camera videotaped the session, and activity (distance traveled in cm) was calculated by Ethovision software (Noldus Info rmation Technology, Leesburg, VA). Statistical Analyses All data were analyzed were analyzed using in GraphPad Prism, 6.0 (San Diego, CA). Binding affinity d ata were fit using the one site fit Ki model that constrains the Hill slope to 1.0. Two site curve fitting analysis did not result in an improved fit (data no t shown). Approximate Ki values were determined by the conversion of the IC50 data using the equation Ki=IC50/1 +L/KD, where L is the concentration of radioligand. Ligand affinities are present ed as their mean values SEM All Ki experiments were replicated at least a minimum of 3 times. In vitro functional data were fit using the log(agonist) vs. response Variable slope ( four parameters) model. Calculations of unpaired t test and oneway analyses of variance (ANOVA) with Tukeys multiple comparison post hoc tests were performed to compare Ki and EC50 values of individual compounds. Ordinary oneway ANOVAs were used to assess differences between drug treatments for the DOI induced HTRs and hyperlocomotion, with Tukeys post hoc test used for multiple comparisons. P values are noted with asterisks in figures and are defined as *, P < 0.05; **, P < 0.005; ***; P < 0.0005; and ****, P < 0.0001. All asterisks in figures represent differences fr om vehicle group unless explicitly stated otherwise. 86

PAGE 87

Results Each of the novel 4 PAT analog s studied consists of 4 stereoismoers a pair of cis and trans enantiomers with the (2S,4R) ( ) trans enantiomer demonstrating highest affinity at 5HT2 receptors. Binding Affinities of Mono halogenated 4 PATs at 5HT2 GPCRs and Off targets Pharmacologic competition binding assays revealed that two analogs, ( ) trans m Cl 4 PAT and ) trans m Br 4 PAT displayed high affinity at the 5HT2C receptor ( Ki= 8 13 3 .1 nM respectively ) ( ) trans m Cl4 PAT had selectivity for binding at the 5 HT2C GPCRs over binding at the serotonin 5 HT2A, 5 HT2B, 5 HT6, 5 HT7, histamine H1, dopamine D2 GPCRs (5, 4.4, 27.4, 9.5, 1.25, and 13.9fold respectively ) ) trans m ClPAT enantiomer had a 5fold and 21fold higher affinity at 5 HT2A and 5 HT2C subtypes respectively relative to (+) m ClPAT ( p <0.05) ) trans m Br 4 PAT had selectivity for binding at the 5 HT2C receptor over binding at the 5 HT2A, 5 HT2B, 5 HT6, 5 HT7, H1, D2 receptors, ( 1.7, 1.1, 9.9, 3.5, 2.3, 5.8 fold, respectively ) ) trans m Br 4 PAT had a 17fold and 17fold higher affinity at 5 HT2A and 5 HT2C subtypes respectively relative to (+) m Br 4 PAT ( p <0.05) (Table 2 1). Both lead analogs were further tested for functional analysis in vitro at 5 HT2 and H1 receptors. Function of ) and (+)trans m Cl 4 PAT at 5 HT2 GPCRs and Off targets ) and (+) enantiomers of trans m Cl 4 PAT were for assessed for their potency and efficacy to impact serotonin 5 HT2A, 2 B, 2 C and histamine H1 mediated production of IP3. The ) trans m Cl4 PAT enantiomer behaved as a partial agonist at the 5 HT2C receptor and had a mean potency of 4010 nM. The Emax ) trans m Cl 4 PAT enantiomer was 68 7% of the Emax of endogenous agonist 5HT. ( ) trans m Cl 4 PAT exclusively activated 5 HT2C receptors over 5 HT2A, 5 HT2B 87

PAGE 88

receptors to mediate IP3 production, up to the maximal concentration tested 10 M. At histamine H1 ) trans m Cl4 PAT enantiomer was an inverse agonist with a potency (IC50) of 10 nM and an Imax of 15% (Figure 2 6 ) Function of ) trans m Br 4 PAT at 5 HT2 GPCRs The ) trans m Br 4 PAT enantiomer was for assessed for potency and efficacy to impact 5 HT2A, 2 B, 2 Cmediated production of IP3. The ) trans m Br 4 PAT enantiomer behaved as a partial agonist at the 5 HT2C receptor and had a mean potency of 193.2 nM. The Emax ) trans m Br 4 PAT enantiomer was 63 13% of the Emax of endogenous agonist 5HT at 5 HT2C receptors. ( ) T rans m Br 4 PAT exclusively activated 5HT2C receptors over 5 HT2A and 5 HT2B receptors to mediate IP3 production, up to the 10 M concentration tested (Figure 2 7 ). Binding Affinities of Di halogenate d 4 PATs at 5HT2 GPCRs and Off targets T he effects of halogen substitution on the 4phenyl moiety of the 4 PAT scaffold on binding the 5 HT2 and H1 receptors were examined. As previously demonstrated ( Sakhuja et al., 2015) (+) trans derivatives displayed a several fold lower affinity towards the receptors of interest than th ) tr ans counterparts ) T rans m I 4 PAT showed the highest affinity ( Ki= 101 nM ) at 5 HT2C receptors (T able 2 2 ) ) trans 3, 5 Cl4 PAT ( 3c ) derivative displayed the next highest affinity at 5 HT2C receptors ( Ki= 201 nM ) ) trans 3, 5 Br 4 PAT ( 3d ) deri ) trans 3, 5 I 4 PAT ( 3d ) derivative had the next highest affinity at 5 HT2C ( Ki= 356 nM and 342, respectiv ely ) None of these analogs exhibited significant improvements in selectivity at 5HT2C over 5HT2A, 5 HT2B, and H1 receptors. ) trans 3 OMe 4 PAT ( 3f ), with the electron donating OMe moiety, also ha d significant 5 HT2C affinity ( Ki= 543 nM ) but s howed no selectivity versus the 5 HT2A, 5 HT2B, and H1 receptors. 88

PAGE 89

Function of Di halogenated 4 PATs at 5HT2 GPCRs ) trans m I 4 PAT ( 3a ) trans 3, 5 Cl4 PAT ( 3c ) trans 3, 5 Br 4 PAT ( 3d ) trans m OMe 4 PAT ( 3f) compounds showed the desired functional pharmacology at the 5 HT2 receptors, i.e. t hese compound were partial agonists relative to the endogenous agonist, 5HT, at the 5HT2C receptors. None of the four active compounds exhibited any activation up to 10 M at the 5 HT2A and 5 HT2B receptors ( Figure 28 A and B ). Di halogenated 4 PATs Block DOI induced HTR The HCl salts of the di halogenated 4PATs were injected intraperitoneally into male C57Bl/6 mice at the doses of 5.6 and 10 mg/kg for HTR and locomot ion assays. Administration of DOI to mice elicited an average of 37.9 2.3 HTRs over 10minutes. B oth 5.6 and 10 mg/kg ) trans m I 4 PAT significantly reduced DOI headtwitches by 70 and 80%, respectively (p<0.0001), whereas the (+) enantiomer had no activity at the same doses (Figure 2 9 A) Similar results were obtained for the trans 3, 5 Br 4 PAT ( 3d ) enantiomer blocked 41% of the HTR (p<0.001) at both 5.6 and 10mg/kg doses, whereas the (+) enantiom er showed no activity (Figure 2 9 B) Surprisingly, both the (+) as w ) enantiomers of trans 3, 5 Cl4 PAT ( 3c) were able to block the HTRs at a dose of 10mg/kg; the (+) enantiomer reduced HTRs ) enantiomer reduced HTRs by 47% (p<0.0001) (Figure 2 9 C ) None of the compounds tested in the DOI HTR significant ly reduced locomotor activity. Binding Affinities of 6 and 7 substituted 4 PATs at 5HT2 GPCRs and Off targets The results of radio rece ptor binding experiments undertaken to delineate the impact of stereochemistry in addition to substitutions at the 6,7positions of the dimethylaminotetralin scaffold on affinity at 5HT2A, 5 HT2B, 5 HT2C and histamine H1 89

PAGE 90

receptors are shown in Table 2) trans 4 PAT enantiomers show higher affi nities at the 5HT2A, 5 HT2B, 5 HT2C and histamine H1 receptors than the affinities of the (+) trans 4 ) trans 3 Cl6 OMe 4 PAT (CMAT) compound, 7l showed an 4.3 fold enhanced selectivity in binding the 5HT2C receptor over the H1 receptor as compared to 0.086fold for the ) trans 4 PAT, 1b Functional of ) trans 3 Cl 6 OMe 4 PAT (CMAT), 7l, at 5 HT2 GPCR s and Off targets T he functional potency and efficacy of CMAT regarding 5 HT2mediated IP3 production was investigated. CMAT activated 5 HT2C receptors with a potency of 34 10 nM and an Emax of 230%, relative to basal while not activating the 5HT2A, 5 HT2B, H1 receptors at tested concentrations of up to 10 M (Figure 2 10). This desirable pharmacological profile sets CMAT apart from all other non4 PAT 5 HT2C agonists, like lorcaserin and Ro 600175, which also activate 5HT2A and 5HT2B receptors Discussion In general substituting both meta positions (3, 5) of the 4phenyl moiety with a halogen moiety did not enhance selectivity towards the 5 HT2C over the 5 HT2A, 5 HT2B, and H1 receptors. The additional halogen derivatives either maintained or compromised 5 HT2C selectivity, i n comparison with the lead, ( ) trans m Br 4 PAT, which poss esses selectivities of 5, 2, 7.5 for 5 HT2C over 5 HT2A, 5 HT2B, and H1, ) trans 3, 5 Cl4 PAT was the most selective of the newly synthesized molec ules: exhibiting 4, 4.5, and 24fold selectivity for 5 HT2C over 5 HT2A, 5 HT2B, and H1 receptors, respectively. E fficacies and potencies at the 5 HT2C receptor also were reduced compared to the lead when both meta positions were substituted with a halogen moiety 90

PAGE 91

The addition of a single large and highly lipophilic iodine atom at the met a position ( 3a) did not improve affinity at the 5HT2C receptors compared to the other 4 PATs containing single halogens at the meta position (e.g. Ki values of F=30, Cl=8, Br=13 and I=10 nM ) T rans m I 4 PAT ( 3a) had an EC50 value (11 1.3 nM) at the 5 HT2C receptor comparable to trans m Cl4 PAT (37 1.1 nM ) ) tr ans m Br 4 PAT ( 19 2.8 nM ) ( Canal et al., 2014) respectively. Yet the eff icacy of ) trans m I 4 PAT ( 3a ) for the 5 HT2C receptor was only 28% of the efficacy of 5 HT ) trans m Cl4 P AT ) trans m Br 4 PAT had efficacy of 68% and 63% (respectively) compared to 5 HT It appears that the efficacy is inversely related to the size of the halogen atom at the 3 position. The increased steric parameters and lipophilicity associated with the large iodine halogen atom may interfere with the interactions of the ligand at r esidues F6.44, M6.47, and C7.45, gleaned from in silico and mutagenesis experiments to be in the proximal vicinity of a halogen atom in the meta positioned halogen when a 4PAT is bound to the 5HT2C receptor. These residues are unlikely to participate in halogen bonding but are located on the TMDs 6 and 7 known to be crucial in G protein activation ( Bockaert and Pin, 1999) T he derivative containing a single electrondonating methoxy substituent at the meta position of the 4 PAT scaffold abolished all selectivity between the four receptors subtypes, but maintain ed moderate binding affinity ( Ki= 50 nM), potency ( EC50= 59 nM), and efficacy ( Emax= 50% of 5HT) at the 5 HT2C receptor. This indicates that increased electron density of the pendant phenyl ring confers high affinity, putatively, by forming interactions with binding pocket amino acids across receptors. T he addition of a second highly electronegative fluorine atom in the meta position (i.e. 3, 5 di F 4 PAT) also abolished selectivity between 5 HT2 91

PAGE 92

and H1 receptors, perhaps disrupting the electron density of the 4phenyl moiety that influences receptor binding selectivity. It appears that the portion of the H1 receptor binding pocket that binds the 4phenyl moiety of 4PATs is more sterically limited as compared to the binding pocket of 5 HT2 receptors. For example, substitutions to the 4phenyl moiety of the 4PAT scaffold significantly hindered H1 binding while having mixed results for the 5 HT2 receptors. Thus, 4 PATs that possess 4phenyl m oieties that are sterically large demonstrate higher affinity at 5HT2 over H1 receptors, but 4 phenyl substituents that increase electron density of the 4phenyl moiety do not confer selectivity for any of the 5HT2 subtypes. The in vivo DOI induc ed HTR data correlate well with the in vitro results. For ) trans m I 4 PAT blocks ~75% of the HTR at a dose of 5.6mg/kg ) trans 3 ,5 I 4 PAT was less potent in blocking the HTR and possessed lower affinity at the 5HT2 and H1 recept ors T he (+) trans 3, 5 Cl4 PAT derivative blocked the HTR at a dose of 10 mg/kg, whereas the other (+) derivatives were inactive in the HTR assay (+) Trans 3, 5 Cl4 PAT has relevant affinity at 5 HT2A ( Ki= 240 nM) and 5HT2C ( Ki= 360 nM) receptors but showed no agonism at the 5 HT2A or 5 HT2C receptors up to 1 0 M. Accordingly, it appears the (+) trans 3, 5 Cl4 PAT functioned as a 5HT2A antagonist to block the HTR induced by the 5HT2A agonist DOI. The incorporation of additional halogen moieties at the 3 position of the 4PAT scaffold was largely unsuccessful at enhancing selectivity for the 5 HT2C receptor over 5 HT2A, 5 HT2B, and H1 receptors. The combination of 6methoxy and 7 chloro substitutions to t he tetrahydronaphthyl moiety of 4 PAT had minor effects on 5 HT2 and H1 binding affinity, relative to unsubstituted 4PAT. However, when a 92

PAGE 93

chloro group was also substituted at the R3 position o f the phenyl moiety (Figure 25 ), H1 affinity was significantly reduced while not affecting 5HT2 af finity. Thus, selectivity in binding the 5HT2C over the H1 receptor is clearly achievable within the 4 PAT chemical scaffold. Analogs developed from this research inform how to eliminate H1 receptor mediated activity while preserving 5 HT2C agonist functi on. Eliminating H1 activity for ligands targeting the 5HT2C receptor may reduce adverse effects such as drowsiness and weight gain c ommonly attributed to blockade of the H1 receptor Figure 2trans m Br 4 PAT. Figure 2 trans m Cl4 PAT. 93

PAGE 94

Figure 2trans m CF34 PAT. Figure 2trans 4 CAT. 94

PAGE 95

Figure 25. Scaffold of 6, 7, and 3 substituted 4 PATs Figure 26. Representative function ) trans m Cl4 PAT at human 5 HT2 A, 5 HT2B, 5 HT2C, and H1 GPCRS. (*=P<0.05 different from basal values) 95

PAGE 96

Figure 27. R epresent ative functional responses of ( ) trans m Br 4 PAT at human 5 HT2A, 5 HT2B, 5 HT2C, and H1 GPCRs (*=P<0.05 different from basal values) 96

PAGE 97

A B Figure 2trans m I 4 trans 3, 5 Br 4 trans 3, 5 Cl 4 PAT at A) 5 HT2A and B) 5HT2B GPCRs 97

PAGE 98

A B Figure 2 9 Attenuation of the DOI Induced HTR for compounds A) ( trans m I 4 trans 3, 5 Br 4 trans 3, 5 Cl4 PAT Each data point represents the mean SEM of at least 6 different subjects. (****=P<0.0001, ***=P<0.001, **=P<0.01 different from DOI) 98

PAGE 99

C Figure 2 9 Continued Figure 210. Representative functional response of trans 3 Cl6 OMe 4 PAT, 7l at 5 HT2A, 5 HT2B, 5 HT2C and H1 GPCRs (*=P<0.05 different from basal values) 99

PAGE 100

Table 2 ) trans m Cl4 ) trans m Br 4 PAT at serotonin 5HT2, 5 HT6, 5 HT7, 5 HT1A, histamine H1, and dopamine D2 GPCRs Affinity was determined in transiently transfected HEK cell lines expressing protein of interest. (Mean Ki values SEM f rom at least three independent experiments) 100

PAGE 101

Table 22 Binding affinity values of di halogenated4 PAT analogs at 5 HT2 A, 5 HT2 B, 5 HT2 C and H1 GPCRs. Affinity was determined in transiently transfected HEK cell lines expressing protein of interest. (Mean Ki values SEM f rom at least three independent experiments) 101

PAGE 102

Table 2 3. Functional potency and efficacy values of di halogenated4 PAT derivatives at the 5HT2C GPCR. Values listed in the table are mean EC50 (nM) and Emax (% of 5 HT response) SEM from at least three independent exper iments. Data was obtained from HEK cells transiently transfected with 5HT2C receptors. 102

PAGE 103

Table 24. Binding affinity values of substitutedN,Ndimethyl 1,2,3,4tetrahydronaphthalen2 amines at 5 HT2A, 5 HT2B, 5 HT2C, and H1 GPCR s. Affinity was determined in transiently transfe cted HEK cell lines expressing protein of interest. (Mean Ki values SEM f rom at least three independent experiments)a( Canal et al., 2013a) ; b( Booth et al., 2002) ; c( Canal et al., 2013b) 103

PAGE 104

Table 2 5. Binding affinity values for lorcaserin and Ro 600175 at the human and murine 5 HT2 GPCRs Values listed in th e table are the mean Ki values SEM, in nM, from at least three independent experiments using [3H]ketanserin to radiolabel the 5HT2A GPCR and [3H]mesulergine, to radiolabel the 5HT2B and 5HT2C GPCRs both ~2 nM 104

PAGE 105

CHAPTER 3 LORCASERIN OR RO 60 0175 AS A MORE SELECTIVE TOOL TO STUDY 5 HT2C GPCR ACTIVATION IN VIVO ? A DIRECT COMPARISON Specific Aim 1 In 2012, l orcaserin (Figure 1 22) (Belviq) was the first drug approved by t he FDA to target 5HT2C GPCRs for the treatment of obesity. Previous reports state that lorcaserin has 18and 104fold selectivity for activation of the 5HT2C over the 5 HT2A and 5 HT2B GPCRs (respectively) in the functional IP3 accumulation assay. Yet reports on the binding profile, using [125I]DOI, a nonselective 5HT2 agonist, to r adiolabel 5HT2 receptors, showed only 7 and 11fold selectivity for the 5 HT2C receptor over the 5 HT2A and 5 HT2B receptors, respectively, while showing negligible affinity to the other serotonin receptors subtypes and transporter ( Thomsen et al., 2008) The pharmacologic selectivity of lorcaserin displayed at the 5HT2 receptors was thought to yield a wide therapeutic window to elicit weight l oss effects while not triggering the two most likely side effects; hallucinations (5 HT2A) and cardiovascular complications (5 HT2B) This therapeutic window has been confirmed in the clinic, where in prescribed doses lorcaserin significantly reduces weight, but do es not cause hallucinogenic or cardiovascular adverse effects. Thus, lorcaserin may also display desirable antipsychotic based on selective 5 HT2C activation ( Higgins et al., 2012, Harvey Lewis et al., 2016) Ro 60175 (Figure 1 20) displays high affinity for the 5HT2C receptor (Ki= 6 nM ) and shows 6fold selectivity for binding the 5HT2C receptor over the 5HT2A receptor, with no selectivity over 5HT2B ( Knight et al., 2004) Ro 600175 partially activates 5HT2mediated Ca2 +dependent signaling at all three receptor subtypes, showing 14fold selectivity for the potency in activation of 5HT2C over the 5HT2A receptor, displaying EC50 values of 32 and 446 nM and Emax values of 84 and 69% 105

PAGE 106

(compared to 5HT) for the 5HT2C and 5HT2A receptor Ca2 +dependent signaling, respectively ( Porter et al., 1999) Ro 60 0175 has been d emonstrated to reduce meal size and weight in rats. This effect was directly blocked by the addition of selective 5HT2C antagonist SB 242084 (Figure 1 14) suggesting that the appetite control was mediated primarily through 5HT2C activity ( Clifton et al., 2000, Vickers et al., 2000) Additionally, Ro 600175 has been reported to attenuate DOI induced HTRs and DOI induced locomotor activity in C57B6/J mice ( Canal et al., 2013a) Due to the selectivity of Ro 600175 for activating the 5HT2C receptor over the 5HT2A receptor and lack of localization of 5HT2B receptors in the CNS, Ro 600175 has long represented the best pharmacologic tool to investigate 5HT2C activation in vivo However due to the potent ial of Ro60 0175 activating cardiac 5 HT2B receptor s, the therapeutic value of Ro600175 is limited. In this study, we compared the in vitro pharmacologic profile of lorcaserin to Ro 600175 at 5 HT2 receptors using the antagonist/inverse agonist radioligands: [3H]mesulergine (5HT2C & 5 HT2B) and [3H]ketanserin ( 5 HT2A). We also compared function regarding inositol phosphate production at all three 5HT2 receptor subtypes We then compared the in viv o effects of lorcaserin to Ro 600175 in murine models of psychosis and locomotor behavior. Results In Vitro P harmacology The binding affinities of lorcaserin, Ro 600175, 5HT, and DOI at the human and murine 5HT2 GPCR s and using antagonist/inverse agoni st radioligands, of lorcaserin, Ro 600175, 5 HT, and DOI are summarized in Table 2 5 Lorcaserin displayed low potency to displace the antagonist/inverse agonist radioligands, ([3H]mesulergine at 5 HT2C and 5HT2B receptors and [3H]ketanserin at 5 HT2A 106

PAGE 107

receptors) with Ki v alues of 57050, 1500230, 27040 nM for human 5 HT2C, 5 HT2A, and 5 HT2B, respectively and exhibiting selectivities for 5HT2C over 5HT2A and 5HT2B of 2.70 and 0.46, respectively. Lor caserin also bound to murine 5 HT2 receptors with similar affinities as at the human receptors with Ki values of 62080 and 2600130 nM for murine 5 HT2C and 5 HT2A rece ptors, respectively. Lorcaser in displayed significantly lower potency than Ro 600175, 5HT, DOI at displacing the antagonist radiolabel s at all three 5 HT2 receptor subtypes (p<0.0001). Agonist activation of 5 HT2 receptors leads to an increase in inositol triphosphate ( IP3) levels. The functional activity of lorcaserin was assessed at human and mouse 5 HT2 receptors and compared to 5 HT DOI, and Ro 60 0 175. The potencies and efficacies can be seen in Table 31 while representative curves can be seen in Figure 31 Lorcaserin was a full agonist with an EC50 of 6.31.3 and 15 .4 nM for the human and murine 5 HT2C receptors, respectively similar to that of 5 HT ( EC50 values 112.8 and 174.3 nM) DOI ( EC50 values 1.50.48 and 112.5 nM), and Ro 600175 ( EC50 values 2.30.25 and 132.9 nM), respectively Lorcaseri n was also a full agonist at human 5HT2B receptors ( EC50 of 37011 nM) but was significantly (p<0.0001) less potent at 5HT2B than 5 HT DOI, and Ro 600175 (EC50 values of 92, 61, 1.40.25) Lorcaser in displayed partial agonism at the human 5 HT2A receptor, yielding 80 % of the maximal response for 5 HT si milar to that of Ro 60 0175, 81 % The EC50 value of 110 .1 and 2709 nM for the human and murine 5 HT2A receptors, respectively showed that lorcaserin was significantly less potent than that of 5HT ( EC50 of 30 6 and 30 2 nM ) DOI ( EC50 of 1 0.2 and 2 0.8 nM ) and Ro 600175 ( EC50 of 33 4.5 and 58 6.3 nM ), respectively (p<0.0001). Lorcaserin was 19fold & 62fold less potent at activating the 5 HT2C receptor over the 5 HT2A, and 5 HT2B receptors, respectively. 107

PAGE 108

In Vivo Pharmacology Administration of DOI (1.0mg/ kg) produced 36.2 HTRs whereas administration of vehicle produced 2.60.8 HTRs during a 10minute session. L orcaserin alone (3.0mg/kg) produced 4.10.9 HTRs, which was not statistically different than vehicle A dministration of Ro 600175 (3.0mg/kg) prod uced 12 0.7 HTRs which was significantly greater than vehicle (p<0.0001), or lorcaserin (p<0 .001) ( Figure 3 2 A ) L ocomotor behavior was recorded simultaneously during the HT R experiments. Mice receiving DOI (1.0mg/kg) or vehicle alone traveled a total distance of 3200240 and 2500200 cm, respectively during a a 10min HTR experiment The administration of lorcaserin (3.0mg/kg) significantly reduced the locomotor activity (to 690130 cm (p<0.001) ) in comparison to vehicle and DOI treatment How ever, Ro 600175 (3.0mg/kg) resulted in the mice traveling 1700310 cm statistically different from vehicle alone (P<0.05) ( Figure 3 2 B ) Lorcaserin and Ro 600175 (3.0mg/kg) we re then administered prior to DOI (1.0mg/kg) to assess whether they could blo ck DOI induced HTR. Lorcaserin at 3.0 and 5.6mg/kg prior to DOI produced 443.0 and 452.1 HTRs respectively ; Ro 600175 3.0 and 5.6mg/kg, produced 312.4 and 321.7 HTRs respectively. Neither drug s effect was s tatistically different from the 36.0 HTRs produced by DOI (1.0mg/kg) alone (i. e., neither lorcaserin nor Ro 600175 blocked HTRs, produced by DOI ( Figure 3 3 A ) ) The locomotor activity during t hese assays was also recorded, m ice rec eiving DOI (1.0mg/kg) alone traveled 3200240cm. Mice receiving DOI (1.0mg/kg) and lorcaserin at (3.0 or 5.6mg/kg) traveled 1300180 and 1000 100 respectively, whereas mice receiving DOI (1.0mg/kg) and Ro 600175 (3.0 or 5.6mg/kg) traveled 150019 0 and 1100130 cm All treatments of lorcaserin and Ro 108

PAGE 109

6 0 0175 statistically reduced locomotor activity th an with DOI alone, (p<0.0001) ( Figure 3 3 B ) In order to determine if 5 HT2 C receptors contributed to the hypolocomotion effect of lorcaserin, the selective 5 HT2C antagonist, SB 242084, was given 10 min utes pri or to lorcaserin administration at 1 mg/kg, and locomotor activity was then assessed. When the 5 HT2C antagonist, SB 242084, was given at 1.0mg/kg prior to lorcaser in administration mice traveled 2400 230 cm, reversing the lorcaserininduced hypolocomotion to a level not different than in vehicle treated mice ( Figure 3 4 B ) HTRs were also recorded during this assay. A ddition of 1.0 mg/kg SB 242084 (5 HT2C antagonist but no 5HT2A activity) to 3.0mg/kg lorcaserin increased t he number of HTRs to 7 .3 .1 which was stat istically greater the vehicle alone (p<0.05) ( Figure 3 4 A ) Discussion Drugs that selectively activate the 5 HT2C GPCR over the 5 HT2A and 5 HT2B GPCRs have the potential to be attractive therapeutics for not only obesity, but also for psychiatr ic disor ders and drug addiction Two previous studies report lorcaserin to have such pharmacologic properties with ~18 and ~90fold selectivity for the activation of the human 5 HT2C receptor over the 5 HT2A and 5 HT2B receptors, respectively ( Smith et al., 2005 Thomsen et al., 2008) The potency of lorcaserin is slightly decreased for the murine 5 HT2C receptors in comparison with the human 5 HT2C receptors Lorcaserin is a full agonist at the murine 5 HT2A receptor but a partial agonist ( ~75% ) at the human 5 HT2A receptors I n terms of selective 5 HT2C activation, lorcaserin appears to display an acceptable in vitro ( pre ) clinical the rapeutic profile for the obesity indication 109

PAGE 110

In previous studies using [125I]DOI, a potent, nonselective 5 HT2 agoni st to radiolabel the receptors as displaceable ligand, lor caserin displayed a selectivity of 7 fold and 11fold for binding to the 5 HT2C receptor over the 5 HT2A and 5 HT2B receptors, respectively ( Thomsen et al., 2008 ) Here, we report reduced affinity for lorcaserin at the 5 HT2 receptors when measured by displacement of an antagonist/invers e agonist radiolabel. The Ki values were reduced by ~38, 14, and 1.5 fold for the 5 HT2C, 5 HT2A, 5 HT2B, receptors, respectively when compared to values obtain from using the agonist radiolabel [125I]DOI ( Thomsen et al., 2008) The selectivity of lorcaserin for binding the 5 HT2C receptor subtype was al so greatly reduced, to ~3 and 0.5 fold over the 5 HT2A and 5 HT2B receptors, respectivel y. This suggests that lorcaserin is able to discriminate between agonist l iganded (activ e ) conformations of the 5 HT2C receptor over the inverse agonist/antagonist l iganded ( inactive ) conformations The semi rigid benzazepine ring structure of lorcaserin i s likely to have impact on the conformations of 5 HT2 receptors it prefers to bind. Ro 600175, 5 HT and DOI are full agonists at 5 HT2C receptors, yet, displace antagonist radiolabel to a much greater e xtent (10 fold) than lorcaserin. T he reason for this difference is not entirely clear, but may reflect, at least in part the highly flexible strucutres of Ro 600175, 5 HT and DOI by virtue of which these ligands may be able to stabilize a variety of active conformations of the 5 HT2C rec eptor. For example, the basic nitrogen atom present in the structures of Ro 60 0175, 5 HT and DOI, which is critical for binding to the 5HT2C GPCRs, has a high degree of conformational flexibility, being connected to an aromatic moiety by a two carbon chain that has unrestricted rotation about the carboncarbon bonds When the basic nitrogen moiety of these ligands contact s the 5 HT2C residue D3.32, essential for 5HT2 C binding, the remaining moieties are able to freely rotate and 110

PAGE 111

stabilize a greater assortment of 5 HT2C conformations, some of which are more prone to displacement of antagonist radiolabel than are others However, the engagement of the basic nitrogen of lorcaserin to the 5HT2C residue D3.32 rotationally contrains this region of the ligand and therby limits the potential variety of lorcaserinreceptor complexes that can result with a high degree of preference for the active (agonist labeled) conformation ( s) of the 5 HT2C recept or The molecular characteristics of lorcaserin described above that selectively activate subsets of 5HT2C receptor conformations may beneficially translate in vivo to improve therpeutic outcomes in the treatment of psychosis. To investigate the potential of lorcaserin as an antipsychotic, we used the DOI induced HTR assay Typical and atypical antipsychotics are antagonist/inverse agonist at the 5 HT2A receptor, which translates in this in vivo model to block the HTR. 5 HT2C agonism has been recently hypothesized to be therapeutically relevant in psychotic disorders ( Higgins et al., 2013) and additionally modulates the DOIinduced HTR ( Canal et al., 2010) In these current studies lorcaserin a putative 5 HT2C and 5HT2A agonist failed to block the HTR at all doses tested, most likely due to agonism displayed at the 5 HT2A receptor at high concentrations. Attenuating the DOI induced HTR is a robust screen to predict antipsychotic activity of ligand and, lo rcaserin failed to do so lorcaserin probably would not be an optimal therapeutic for psychotic disorders Meanwhile, t he lorcaserininduced hypolocomotion effect was readily reversed to vehicle levels by using the selective 5 HT2C antagonist, SB 242084 1. 0mg/kg, suggesting, that 5 HT2C receptor activation mediates the hypolocomotion effect. In any event, hypolocomotion translates to sedative effects, a phenomenon which has been reported for lorcaserin ( Shram et al., 2011) 111

PAGE 112

Ro 600175 shares a similar pharmacologic profile as lorcaserin regarding activation of both 5HT2A and 5 HT2C receptor mediated IP3 formation and does not block the DOI induced HTR. In fa ct, Ro 60 0175, unlike lorcaserin, induces HTR s in mice following acute adm inistration. T his finding contradicts an earlier report showing that 10.0 mg/kg Ro 600175 did not elicit HTRs in rats ( Martin et al., 1998) Like lorcaserin, Ro 600175 also causes hypolocomotion (sedation) but to less of an extent than lorcaserin. These results are likely due to the 5 fold higher potency of Ro 600175 for activating murine 5HT2A receptors as compared to lorcaserin. 5 HT2A receptor activatio n results in HTR and hyperlocomotion and counteract s 5 HT2C receptor activation regarding several animal behaviors These data taken together indicate that lorcaserin is functionally selective for activating 5 HT2C receptors both in vitro and in vivo co mpared to Ro 600175 Accordingly, lorcaserin is currently a better pharmacologic tool than Ro 600175 to discriminate 5 HT2C effects in vivo from the effects of the phylogenetically closely related receptors, the 5 HT2A and 5 HT2B receptors. 112

PAGE 113

A B Figure 3 1. Representative functional responses for lorcaserin and Ro 600175 at A) human 5HT2C B) human 5HT2A C) human 5HT2B GPCRs 113

PAGE 114

C Figure 3 1. Continued 114

PAGE 115

A B Figure 3 2 Lorcaserin and Ro 600175induced HTR s and locomotor activity A) HTR after administration of vehicle, lorcaserin (3.0mg/kg), Ro 600175 (3.0mg/kg). B) Locomotor activity after administration of vehicle, lorcaserin (3.0mg/kg), Ro 60 0175 (3.0mg/kg) Each data point represents the mean SEM of a t least 6 different subjects. (****=P<0.0001, ***=P<0.001, *=P<0.05) 115

PAGE 116

A B Figure 3 3 Effects of l orcaserin and Ro 6001 75 on DOI induced HTRs and locomotor activity A) Lorcaserin and Ro 600175 (3.0 &5.6 mg/kg) pretreatment did not alter the number o f HTRs induced by DOI (1.0 mg/kg) B) Lorcaserin and Ro 600175 (3.0 & 5.6 mg/kg) pretreatment did alter the locomotor activity induced by DOI (1.0 mg/kg). Each data point represents the mean SEM of at least 6 different subjects. (****=P<0.0001 dif ferent from DOI, **=P<0.01 different from lorcaserin) 116

PAGE 117

A Figure 34. E ffect of 5 HT2C antagonist, SB 2420 84 (1.0mg/kg), on lorcaserininduced A) HTRs B) hypolocomotion. Each data point represents the mean SEM of at least 6 different subjects. (****=P<0.0001 different from Vehicle, ++++=P<0.0001 different from SB 242084 1.0 / lorcaserin 3.0) 117

PAGE 118

B Figure 34. Continued 118

PAGE 119

Table 3 1 Functional potency and efficacy values of l orcaserin, 5HT, DOI, and Ro 600175 for the human and murine 5 HT2 GPCRs Table 31 Continue d Values listed in th e table are the mean EC50 and Emax (% of 5 HT response) values S.E.M from at least three independent experiments 119

PAGE 120

CHAPTER 4 CHARACTE RIZATION OF SIGNALING OUTCOMES FROM CHRONIC AGONIST AND INVERSE AGONIST LIGAND INTERACTION WITH 5 HT2 C GPCRS IN VITRO Specific Aim 2 The 5 HT2C GPCR is a member of the class A super family of seven transmembrane spanning GPCRs and a drug target for obesity and neuropsychiatric disorders. Cellsurface expression levels and signaling capacity of class A GPCRs are modulated by receptor desensitization and resensitization processes governed by discrete ligand binding events which can lead to drug tolerance (desensitization) or hypersensitivity (resensitization) Based on current understanding that different ligand structures bind and stabilize different GPCRs conformations ( conformational selectivity ) we tested the hypothesis that different structural classes of 5HT2C orthosteric agonists (Figure 4 1) and inverse ag onists (Figure 4 2) differentially impact 5HT2C de/re sensitization processes. To measure the extent of de/resensitization, c anonical 5HT2CGq mediated PLC signaling was quantified in CHO K1 cells transiently expressing the human 5HT2C INI r eceptor The index of de/resensitization reflects the population of functinally competent 5 HT2C receptors at the plasma membrane capable of signaling via this canonical signaling pathway. To quantify 5HT2C receptor desensitization, a 5HT2C agonist is incubated with the clonal cells at 1 M for 20 hours (experimentally determined optimal concentration and time), and, subsequently (after washing cells), the same agonist over a full concentration range (110,000 nM) is incubated with the same cells and the signaling response is measured with determination of agonist potency (EC50) and efficacy (Emax). Desensitization is operationally defined as a n Emax value that is significantly lower than the Emax value of the agonist determined in a nondesensitized 120

PAGE 121

experiment. For the endogenous full agonist 5 HT, the Emax in the desensitization experiment was 63 2 .2 % less relative to the nondesensitiz ation experi ment, i.e., 5 HT produced robust desensitization of 5HT2Cmediated PLC signaling Other 5 HT2C agonists tested includ e lorcaserin, Ro 600175, DOI, mCPP, WAY 161503, ) trans m Br 4 PAT ) trans m 4 PAT (results are reported and discussed below) To quantify 5HT2C resensitization, a 5 HT2C inverse agonist is incubated with the clonal cells at 1 M for 20 hours, and, subsequently (after washing cells), 5HT over a full concentration range (110,000 nM) is incubated with the same cells and signaling response is measured with determination of 5 HT potency (EC50) and efficacy (Emax). Resensitization is defined as an increase in 5HT efficacy relative to control cells that did not receive the 20hour incubation with inverse agonist L igand structuredep endent resensitization of 5 HT2C receptor signaling was observed for 5 HT2C inverse agonists tested including the commercially available inverse agonists SB 260553 and clozapine, and novel 4PAT type inverse agonists ) trans m CF34 PAT and ) trans 4 CAT (results are reported and discussed below) Regarding the molecular mechanisms of 5HT2C desensitization and resensitization, m utational analysis implicated 5 HT2C residue S407 in 5 HT2C receptor agonist dependent desensitization. PKC, activated by 5 HT2C activation of PLC signaling, was ruledout here as being involved in the mechanism(s) of 5HT2C desensitization (results are reported and discussed below) 121

PAGE 122

Methods Compounds unless noted. 5 HT hydrochloride was purchased from Alfa Aesar (Ward Hill, MA). ()2,5 dimethoxy 4 iodoamphetamine ( DOI) hydrochloride (> 9 8 % ), 1 (3 chlorophenyl) piperazine hydrochloride (mCPP), R o 600175 fumarate clozapine, SB 206553 hydrochloride 95%) were purchased from Sigma Aldrich (St. Louis, MO). WAY 161503 hydrochloride and mesulergine hydrochloride were purchased from Tocris Biosciences (Bristol, U.K.). L orcaserin hydrochloride (> 98%) was purchased from Chem Scene. [3H]M yoinositol (specific activity 22.5 Ci/mmol) was purchased from PerkinElmer Life and Analytical Sciences (Waltham, MA). The 5HT2C agonist ) trans (2S,4R) 4 phenyl 2 dimethylaminotetralin ( ) trans 4 PAT) ( Booth et al., 2009) and the 3 phenyl substituted 5HT2C agonist analogs of PAT, ( ) trans (2S,4R) 4 (3[meta] bromophenyl) N,N dimethyl 1,2,3,4 tetrahydronaphthalen2 amine ) trans m B r 4 PAT ( Canal et al., 2014) ), the 5HT2C inverse agonist, ( ) trans (2S,4R) 4 (3[meta] trifluoromethyl phenyl) N,N dimethyl 1,2,3,4tetrahydronaphthalen2 amine ( ) trans m CF34 PAT ) ( Liu et al., 2016) and ) trans (2S,4R) 4 cyclohexyl 2 dimethylaminotetralin ( ) trans 4 CAT) ( Canal et al., 2011b, Sakhuja et al., 2015) were synthesized in our lab oratory, as a racemic mixture. The two enantiomers were resolved on the chiral stationary phase HPLC and converted to hydrochloride salts as previously des cribed ( Booth et al., 2009) All PAT derivatives were > 99% pure, according to H1 NMR and HPLC 122

PAGE 123

Human 5 HT2C S407A GPCR Construct The human wildtype (WT) 5 HT2C INI GPCR cDNA plasmid was obtained from Missouri S&T cDNA Resource Center (Rolla, MO). Point mutation of 5HT2C residue 407 from serine (wild type) to alanine was made by polymerase chain reactions using the QuikChange II SiteDirected Mutagenesis Kit (A gilent Te chnologies, Santa Clara, CA) according to the manufacturers protocol. Mutagenesis and sequencing primers were obtained from Life Technologies (Carlsbad, CA), The primers used to make the h5 HT2C S407A point mutant were 5' cgccactgctttggctgggagggagct 3' (s ense) and 5' agctccctcccagccaaagcagtggcg 3' (antisense) P olymerase chain reaction was performed as previously described, with optimization ( Canal et al., 2011a) Parental DNA in the reaction mixture was di gested using DpnI at 37C for 1hour. Digestion mixture (2 mL ) was transformed into 50 mL of XL1 Blue supercompetent cells by heat pulse at 42C f or 45 seconds. The transformed reaction was incubated in Super Optimal broth with Catabolite repression medium (SigmaAldrich), and then plated onto LB agar plates containing 100 mg/mL ampicillin. Single colonies were selected for sequencing, and the point mutation was confirmed by Genewiz (South Plainfield, NJ). In Vitro P harmacology For competitive binding assays, human embryonic kidney 293 (HEK) cells were used. For IP3 functional de/re sensitization assays, Chinese hamster ovary (CHO) K1 cells were used because CHO cells robustly survived extensive drug washout procedures Both cell types were maintained in Dulbecco's modified Eagle's medium (DMEM) with 8% fetal b ovine serum and 1% penicillin streptomycin. All cells were cultured in a humidified incubator at 37 C with 5% carbon dioxide95% air C ells were used in assays from pass age 4 to 20 and grown to 7080% confluency when they were 123

PAGE 124

washed and then transiently transfected with 15 HT2C pcDNA (5 HT2C INI or 5 HT2C INI S407A) and 30 t. The culture medium used for transfection was 6 mL DMEM containing 5% dialyzed fetal bovine serum and 4 mL Opti MEM. Functional D esensitization and R e sensitization 5 HT2C receptor mediated phosphoinositide hydrolysis w as measured to investigate 5HT2C ligand induced desensitization or resensitization. Media were removed 24 hours post transfection and replaced with 14 mL of inositol free DMEM containing 5% dialyzed fetal bovine serum. C ells were then detached via scraping and 2 Ci/mL [3H]myo inositol was added. C el ls were seeded per well into 48well CellBind plates (Corning, Lowell, MA), and placed in an incubator. A period of 2 4 hours was allowed for the cells to adhere to the plate. Once the cells had adhered, 1 M ligand was added to each cell well to begin desensitization while control cells received vehicle (inositol free DMEM), after which the cells were allowed to incubate under culture conditions for predetermined times up to 20 hours The concentrations used t o de/re sensitize the receptors were >25fold higher than their EC50/IC50 values, eliminating the possibility of differences in desensitization based on divergent ligand potencies. For inhibitor studies, 10 M of chelerythrine, a cell permeable PKC inhibitor, was given 10 minutes prior to inducing receptor desensitization. Upon completion of desensitization, media were removed, and all cells were washed with phosphate buffered saline (PBS) three times, 5 minutes each. Cells were then restimulated with spec ified compounds from 1 10 ,000 n M with 100 mM LiCl and 10 M pargyline ( final concentrations ) in quadruplicate for 45 min ute s in inositolfree DMEM to obtain doseresponse curves For agonist induced desensitization, the same agonist initiating 124

PAGE 125

desensitization was used to restimulate the receptor; for inverse/antagonist resensitization, 5HT was used to restimulate the receptor. To stop the reaction, media were removed, and 400 L of 50 mM formic acid was added to each well The acid cell extra ct was neutralized 1hour later with 20 0 L 150 mM ammonium hydroxide, and the culture plates were frozen at 40C at least overnight. After thawing and centrifugation at 1000g for 5 min utes the supernatant from each cell extract was added to individual BioRad anionexchange columns containing AG 1X8 resin. After washing each loaded column with 10 mL dH2O, [3H]IP s were eluted with 4 mL 800 mM o f ammonium formate into vials. One mL of eluate was mixed with 10 mL scintillation cocktail (ScintiVerse Cocktai l, Fisher), and [3H] scintillations were counted on a PerkinElmer Tri carb 2190TR liquid scintillation counter. The data presented are from at least three independent experiments. Statistical Analyses Data were analyzed using nonlinear regression curvefi tting algorithms in GraphPad Prism, 6.0f for Mac (San Diego, CA). Data were fit using the log(agonist) vs. response (three parameters) model. The degree of desensitization was defined by the following equation: ( ) 100 ( ) = % Calculations of oneway analyses of variance (ANOVA) with Tukeys multiple comparison post hoc test were performed to compare inter ligand effects on WT 5 HT2C receptor desensitization. Calculations of two way a nalyses of variance with Sidaks multiple comparison post hoc test were performed to compare the differential effects of ligand induced desensitization between WT and S407A 5HT2C receptors and to 125

PAGE 126

compare the effects of SB 242084 incubation in conjunction with agonist incubation on the 5 HT2C receptor basal signaling Ligand efficacies and potencies are presente d as their mean values ( SEM ), with the adjusted p values from aforementioned statistical analyses. P values are noted with asterisk s in figures and are defined as *, P < 0.05; **, P < 0.005; ***; P < 0.0005; and ****, P < 0.0001. All asterisks in figures represent differences from vehicle group unless otherwise stated. Results 5 HT2C Ligand Pharmacology Binding affinities (Ki) at the 5 HT2C receptor were obtained for test agonists (Table 41) in competition binding assays using the 5 HT2C antagonist radiolabel [3H]mesulergine and compared to literature values. The affinities using the 5HT2C agonist radiolabel, [125I] DOI, also are shown fo r comparison purposes in Table 41. The Ki value for 5HT regarding displacement of [3H]mesulergine was 6312 nM identical with the Ki values for other agonist ligands DOI (5812 nM) and R o 600175 (4912 nM ) In contrast the affinity of the full agonist lorcaserin for the antagonist radiolabeled 5 HT2C receptor was 570 46 nM which was more than 9fold lower than the affinity of 5 HT (P<0.0001) Another difference regarding lorcaserin compaerd to other 5HT2C agonist ligands is that it had much hi gher affinity regarding displacement of the agonist radiolabel over the antagonist radiolabel for the 5HT2C receptor. For example, 5HT displayed a ~ 4 fold higher affinity, whereas lorcaserin displayed a ~40fold higher affinity at the 5HT2C receptor rad iolabeled by the agonist radioligand compared to antagonist/inverse agonist radioligand. The agonist DOI had an intermediate effect, demonstrating 24fold higher affinity for the agonist labeled receptor. 126

PAGE 127

The potencies (EC50) and efficacies (EMAX relative to the maximal IP3 formation produced by 5 HT in the same assay ) of the test agonists stimulating PLC/ IP3 were determined in CHO cells transiently transfected with the human 5HT2C receptor The EC50 values for 5 HT, R o 600175, WAY 161503, lorcaserin, mCPP, DOI ) trans m Br 4 PAT and ) trans 4 PAT are shown in Table 42 With the exception of mCPP and aripiprazole, the potencies of all agonists tested were not statistically different. Post hoc tests revealed that mCPP and aripiprazole were less potent than 5HT, DOI, Ro 600175, WAY 161503, and lorcaserin (P<0.05). Regarding efficacy R o 600175, WAY 161503, lorcaserin, mCPP, and DOI were full agonists that elicited the same Emax for IP3 production as did 5 HT (Table 4 2 ). ) T rans m Br 4 PAT and ) trans 4 PAT were partial agonist s relative to 5HT (P<0.05) The 5HT2C ligands SB 206553 trans 4 ) trans m CF34 PAT, and mesulergine were determined pre viously by our group and other s to be inverse agonists that reduce basal (constitutive) 5HT2C receptor dependent IP3 production ( Herrick Davis et al., 2000, Canal et al., 2011a Canal et al., 2011b, Sakhuja et al., 2015, Liu et al., 2016) The potency and efficacy of the 5HT2C inverse agonists are shown in Table 43. Agonist d ependent Desensitization of the 5 HT2C GPCR After a 20 HT2Cexpressing CHO cells, after washing, the potency (EC50) of the agonist ligands ( 5 HT, Ro 600175, WAY 161503, lorcaserin, mCPP, DOI trans m Br 4 PAT trans 4 PAT ) to stimulate IP3 product ion w as not different than the potency to stimulate IP3 production in 5 HT2Cexpressing CHO cells that had not been pret reated with the agonist (Table 44). In contrast, as shown in Figure 43 and Table 45, with the exception of aripiprazole, there was a significant ( F9,36, = 63.5; P<0.0001) reduction of agonist ligand 127

PAGE 128

efficacy (Emax) to stimulate IP3 production in 5 HT2Cexpressing CHO cells that had been pretreated (incubated) with agonist ligand, i.e., the 5HT2Cexpressing CHO cells were desensitized to the IP3stimulating effects of the agonist ligands (except, aripiprazole). Importantly, except for the antipsychotic drug aripiprazole, 5HT2C receptor desensitization occurred for both full and partial agonists. As shown in Figure 43 and summarized in Table 45, t he 5 HT2C full agonist l orcaserin desensitized 5 HT2C receptor mediated IP3 signaling to the largest extent, as demonstrated by an 852 .3 % reduction of lorcaserin Emax in the desensitization experiment compared to control cells The endogenous 5 HT2C full agonist 5 HT also desensitized the 5 HT2C receptor mediated IP3 signaling as demonstrated by a 632.2 % reduction of 5 HT Emax in the desensitization experiment compared to control cells The other 5HT2C full agonists tested, R o 600175, DOI mCPP, WAY 161503, all desensitized 5 HT2C receptor mediated IP3 signaling to a similar extent as did 5 HT, as evidenced by percent reductions in Emax values in the desensitization experiments, i.e., 605.4, 734.2, 692.1, and 790.35, respectively, compared to nondesensitized cells As shown in Figure 43 and summarized in Table 45, compared to the 5HT2C full agonists, the 5HT2C receptor partial agonists trans 4 PAT, and trans m Br 4 PAT produced far less 5HT2C desensitization regarding IP3 signaling. Thus, trans 4 PAT, and trans m Br 4 PAT had Emax values that were reduced by 288.2 and 385.8% ( respectively ) in desensitized cells compared to nondesensitized cells. In summary, with regard to magnitude of agonist induced reduct ion of 5 HT2C receptor mediated IP3 signaling (i.e. desensitization), r ank order was lorcaserin > WAY 161503 128

PAGE 129

> DOI mCPP = 5 HT = Ro 600175 (full agonists) > trans m Br 4 PAT = trans 4 PAT > aripiprazole (partial agonists) Inverse Agonist dependent R esensitization of the 5HT2C GPCR To assess 5 HT2C receptor resensitization, CHO c ells expressing 5HT2C receptors were treated with an inverse agonist ligand at 1 M for 20 hours After washing the cells, the efficacy of 5HT to stimulate 5 HT2C receptor mediated IP3 production w as assessed, resensitization defined as an increase in the Emax value of 5HT As shown in Figure 44 e ach of the 5HT2C inverse agonists caused resensitization of the 5 HT2C receptor (F5, 25=27.84) Thus, the effi cacy of 5 HT was increased by 696.3, 415.4, 293.6, 279.1, 264.6 % by the pretreatment of the cells with the inverse agonists SB 206553, trans 4 CAT clozapine, mesul e rgine and trans m CF34 PAT respectively (Figure 44). Ligandd ependent Desensitization of 5 HT2C S407A GPCR Serine residue S407 of the 5HT2C receptor at the distal end of the intracellular C terminus is the homologue of S421 in the 5HT2A receptor and S421 is involved in agonist induced 5 HT2A receptor desensitization ( Gray et al., 2003) For the experiments in this section, 5 HT2C residue S407 was mutated to alanine, which cannot be phosphorylated, to test whether phosphorylation of S407 is an important mechanism in ligand dependent 5HT2C receptor desensitization. In summary, neither the potency ( EC50) nor efficacy ( Emax) of each 5 HT2C agonist ligand tested at the S407A 5 HT2C receptors was significantly different than for the WT 5HT2C receptor (Table 46 ). In contrast to the nondesensitized CHO cells expressing 5HT2C S407A receptors, using the desensitization protocol above wherein agonists (1 M) are incubated with CHO cells expressing 5HT2C S407A receptors for 20 hours, there was 129

PAGE 130

observed significant desensitization (lowered Emax) of agonist induced 5HT2C receptor mediated IP3 production (Table 47). Thus, after th e desensitization protocol t he Emax of 5 HT was reduced by 384.1% compared to CHO cells expressing 5HT2C S407A receptors that were not desensitized. In the same manner, the Emax for DOI, lorcaserin, m CPP, Ro 60 0175, trans m Br 4 PAT was reduced by 386.0, 54 5.2, 55 7.0, 71 3.8, 64 8.0 % in desensitized cells expressing S407A 5 HT2C receptors, compared to nondesensitized cells expressing S407A 5 HT2C receptors. The magnitude of desensitization elicited at the 5HT2C S407A receptors was significantly less compared to WT 5HT2C receptors f ollowing 5 HT DOI and lorcaserin pretreatments (Figure 4 5 Table 48 ) For example, in cells expressing WT 5 HT2C receptors p re incubation with 1 M 5 HT for 20 hours reduced 5 HT Emax by 63 2 .2 % H owever in CHO cells expressing S407A 5HT2C receptors, the Emax of 5 HT reduced by 384.1 % following 5 HT pretreatment (P<0.005) Pretreatment of cells expressing WT 5 HT2C receptor s with 1 M DOI for 20 hours redu ced the efficacy of DOI by 734.2 % but DOI pretreatment of CHO cells expressing S407A 5 HT2C receptors resulted in a 386.0 % reduction in the Emax of DOI (P < 0.00 5 ) Similarly p retreatment of cells expressing WT 5HT2C receptor with 1 M l orcaserin for 20 hours reduced the Emax of lorcaserin by 852 .3 %, yet lorcaserin pretreatment of CHO cells expressing S407A 5 HT2C receptors reduced the efficacy of lorcaserin at the 5HT2C receptors by 545.6 % (P < 0.005 ) In contrast the magnitude of 5HT2C receptor desensitization was not different between WT 5HT2C receptors and S407A 5HT2C receptors for Ro 60 175, mCPP, and trans m Br 4 PAT (Figure 4 5 Table 48 ) 130

PAGE 131

The Effect of PKC on 5 HT d ependent D esensitization of the 5 HT2C GPCR PKC is a princi pal downstream effector in the 5HT2C receptor mediated signaling pathw ay ( Neves et al., 2002) suggesting the hypothesis that the phosphorylating activity of PKC may play a role in ligandinduced 5 HT2C receptor desensitization. To assess this hypothesis, a selective PKC inhibitor, cheleryt hr ine ( Ki =700 nM ( Herbert et al., 1990) ), was administered together with 5 HT to determine whether PKC inhibition blocks 5 HT induced 5 HT2C desensitization. However, due to the short half life of chelerythrine ( 80 min ute s) ( Absolinova et al., 2010) a shorter desensitizationinducing paradigm than previously employed in the above experiments was used (i.e. a 1hour incubation with 10 M 5 HT ) Under these conditions 5 HT induced desensitization reduced the efficacy of 5HT for stimu lating IP3 production by 453.0 % compared to 5HT2Cexpressi ng cells that were not pretreated with 5 HT When the PKC inhibitor chelerythrine (10 M) was included in the above experiments (added 10 min utes prior to the experiment) the efficacy of 5 HT was reduced by 524.8 % which was not st atistically different than 5HT induced 5 HT2C receptor desensitization without the PKC inhibitor (F igure 4 6 ) Chelerythrine also had no effect on 5 HT induced IP3 production in nondesensitized cells Thus, PKC does not appear to be involved in 5HT induced desenstization of the 5 HT2C receptor. Discussion Findings in this study provide new insights into de/resensitization of the 5HT2C receptor, a physiologically important GPCR and validated drug tar get. For example, 5HT2C signaling desensitization occurred to a lesser extent when the 5HT2C receptor was chronically stimulated with partial compared to full agonists. Thus, regarding cells chronically treated with agonist, the Emax values for the pheny laminotetralin partial 131

PAGE 132

agonists trans 4 PAT and trans m Br 4 PAT were not negatively impacted to the same extent as the Emax values of the full agonists, 5 HT, R o 600175, WAY 161503, lorcaserin, mCPP, DOI, which have widely varied structures (see below). Moreover, the 5 HT2C partial agonist aripiprazole, a phenylpiperazine linked to a dihydroquinolinone moiety, produced no 5HT2C signaling desensitization at all. It appears that partial agonist activity, ra ther than agonist structure, exerts more influence on the degree of 5HT2C receptor desensitization elicited Nevertheless, ligand structure does impact desensitization. For example, structurally distinct full agonists produced differences in the degree o f ligand induced 5HT2C receptor desensitization of the canonical IP3 signaling pathway. Thus, 5HT2C signaling desensitization occurred to a great extent when the 5HT2C receptor was chronically stimulated with the tetrahydrobenzazepine lorcaserin, compar ed to the indole endogenous agonist 5HT in this case, both ligands are full agonists that produce the same maximal efficacy (Emax) when they stimulate the 5 HT2C receptor acutely. In fact, the full agonist lorcaserin also produced greater desensitization of 5 HT2C signaling that the other full agonists, the indole Ro 600175, the phenethylamine DOI, and the phenylpiperazine mCPP. Likewise, ligand structure impacts the resensitization process. Thus, for cells chronically treated with 5HT2C inverseagonis t ligands, the tetrahydropyrroloindole SB 206553 produced an enhancement of 5HT mediated signaling (i.e., increased Emax) that was larger than the phenylaminotetralin trans m CF34 PAT, the cyclohexylaminotetralin trans CAT, the ergoline mesulergi ne, and the dibenzodiazepine clozapine. 132

PAGE 133

While ligand structure and degree of efficacy (i.e., partial vs. full agonism) impacted desensitization and resensitization, to our surprise, the degree of ligandinduced 5HT2C desensitization and resensitization was not directly correlated to the potency of a ligand to stimulate or inhibit 5HT2Cmediated IP3 production. Thus, DOI and trans m Br 4 PAT, which have similar potencies as 5HT2C agonists ( EC50 values of 5 and 18 nM, respectively) produced a different extent of 5 HT2C receptor desensitization, i.e., the DOI Emax was reduced by 73%, whereas, the trans m Br 4 PAT Emax was reduced by 38%. Additionally, the 5HT2C inverse agonists SB 206553 and trans m CF34 PAT display equivalent potencies (IC50 values of 17 and 24 nM, respectively), however, pretreatment with SB 206553 increases the efficacy of 5HT at 5 HT2C receptors to a greater extent (69%) than trans m CF34 PAT (26 %). It is suggested here that the impact of ligand structure on 5HT2C GPCR desensitization and resensitization processes involves unique interactions in the binding pocket between ligand and receptor that govern the conformation of the receptor, impacting, intracellular molecular events involved in desensitization and resens itization such as receptor phosphorylaton, receptor sequestration, or receptor internalization. Herein, S407 was important in the desensitization mechanism for 5HT, DOI, and lorcaserin (all full agonists), but, not the full agonists mCPP and Ro 600175, or, the partial agonist trans m Br 4 PAT. The role of 5HT2C residue S407 in the desensitization process seemed not to be dependent on efficacy of the agonist. Thus, the importance of the 5 HT2C residue S407 to the 5HT2C receptor desensitization proces s varies with agonist ligand structure, presumably because agonists with distinct 133

PAGE 134

chemical structures differentially impact 5HT2C receptor conformation, including the spatial orientation of S407 in the resulting [receptor ligand] complex. The commerciall y available 5 HT2C full agonists tested here, Ro 60 0175, lorcaserin, WAY 161503, mCPP, and DOI as well as the endogenous agonist 5HT, contain one or more halogens/hydrogen bond donors located on opposite side of the aromatic ring system to the basic nitrogen moieties (i.e. analogous to the 5OH moiety of 5 HT). These agonists ( Meanwell, 2011) are thought to form hydrogen/halogen bonds with residues W6.48 ( Bray and Goddard, 2008) and/or Y7.43 ( Canal et al., 2011a) in TMH 6 and 7 of the 5HT2C receptor. Such interactions may stabilize active conformations of the 5HT2C receptor that allow for greater accessibility of residues to intracellular ki nases that cause phosphorylation, leading to desensitization of 5HT2C receptor mediated IP3 signaling. The trans 4 PAT and trans m Br 4 PAT analogs lack a hydrogen bond donor in a position that is analogous to the 5OH moiety 5 HT, perhaps explaining why the 4PATs are partial (not full) agonists. This disniction may also link both structural as well as partial agonist (efficacy) considerations as to why trans 4 PAT and trans m Br 4 PAT produce less 5HT2C desensitization compared to standard full agonists and the endogenous full agonist 5HT, i.e., the 4 PAT compounds may stabilize ( a ) 5 HT2C receptor conformation(s) that results in less phosphorylation and less receptor desensitization. Additionally, rotational flexibility around the basic nitrogen moiety of 5HT2C agonists may influence 5HT2C receptor conformation stabilized, and the magnitude of 5 HT2C receptor desensitization. This hypothesis is supported by the result that lorcaserin and WAY 161503, which contain basic nitrogen moieties within a constrained 134

PAGE 135

nonaromatic ring system, elicit more 5 HT2C receptor desensitization (85 and 79%, respectively) than either of the highly flexible indoleamines, 5HT and Ro 60 0175 (63 and 60%, respectively). P rolonged incubations of 1 M 5 HT2C i nverse agonists SB206553, trans 4 CAT, clozapine, mesulergine, trans m CF34 PAT reliably increase the signaling response of the 5 HT induced 5 HT2C receptor mediated IP3 signaling, with a robust response at 20 hours ( by 69, 41, 29, 27, and 26%, respectively) Pretreatments with 5 HT2C inverse agonists for 8 hours or less did not resensitize the 5 HT2C receptor aan observation which confirmed a previous r eport showing no effect of a 30minute SB206553 pretreatment on 5HT2C signaling efficacy ( Schlag et al., 2004) The lack of 5 HT2C resensitization following 5 HT2C inverseagonist pretreatment of 8 hours or less may be due to the fact that g ene transcription and translation of the 5 HT2C receptor increases after prolonged inverse agonist treatment Our data imply th at PKC is not involved in short term (< 1 hou r) 5 HT induced desensitization of the 5 HT2C receptor, consistent with a lone previous report ( Berg et al., 2001) Other literature reports for the 5HT2A receptor, in contrast, show a significant role for PKC in short term 5 HT induced desensitization for the 5 HT2A receptor ( Anji et al., 2001 Bhattacharyya et al., 2002) demonstrating an unique difference between the 5 HT2C and 5HT2A receptor desensitization mechanisms I t has been hypothesized that PKC may only play a significant role after longterm 5 HT2C desens itization ( Roth et al., 1995) whereas GRK may mediate short term 5 HT2C desensitization. 135

PAGE 136

Figure 4 1. Agonist s tr uctures used to desensitize the 5 HT2C GPCR. 5 HT Ro 600175 DO I mCPP lorcaserin WAY 161503 136

PAGE 137

trans 4 PAT trans m Br 4 PAT Aripiprazole Figure 41 Continued 137

PAGE 138

SB 206553 Clozapine trans 4 CAT trans m CF34 PAT Mesulergine Figure 4 2. Inverse agonist structures used to resensitize the 5 HT2C GPCR. 138

PAGE 139

Figure 4 3. Agonist dependent desensitization of the 5HT2C GPCR. Cells expressing 5HT2C GPCR were treated with 1 washed, then restimulated with the same agonist. The desensitized Emax was compared to the Emax of nondesensitized cells (negative control). (****=P<0.0001, ***=P<0.001 different from control, ++++=P<0.0001, +++=P<0.001, +=P0.05 different from 5 HT induced desensitization) 139

PAGE 140

Figure 4 4. Inverse agonist re sensitization of the 5 HT2C GPCR. Cells expressing 5hours, washed, then re stimulated with 5HT (1 nM The Emax values after resensitization were compared to a 5HT stimulation of nonresensitized cells (negative control). (****=P<0.0001, ***=P<0.001, **=<0.01 differen t from control, +++=P<0.001, ++=P<0.01, +=P<0.05 different from SB 206553) 140

PAGE 141

Figure 4 5 5 HT induced d esensitization of the mutant S407A 5HT2C GPCR. Cells expressing 5for 20 hours, washed, then re stimulated with 5HT (1 nM 10 Emax was compared to Emax of non desensitized cells along with the desensitized Emax of WT 5 HT2C receptor (*** =P<0.001 compared to 5HT induced 5HT2C receptor desensitization, ****=P<0.0001 c ompared to DOI induced 5HT2C receptor desensitization, ***= P<0.001 compared to lorcaserinind uced 5HT2C receptor desensitization) 141

PAGE 142

Figure 4 6 Effect of the PKC inhibitor chelerythrine on 5 HT induced 5 HT2C GPCR d esensitization. Cells expressing 5HT and chelerythrine for 1 hour, washed, then restimulated with 5HT (1 10,000 n M). The desensitized Emax was compared to the Emax of nondesensitized cells, and Emax of the cells not receiving chelerythrine (positive control). (****=P<0.0001 di fferent from 5 HT2C WT receptor control) 142

PAGE 143

Table 41. Binding affinity values for agonists at the agonist ([125I]DOI) and antagonist ([3H]mesulergine) radiolabeled orthosteric binding sites at the 5HT2C GPCR. Affinity was determined in transiently transfected HEK cell lines expressing protein of interest. (Mean Ki values SEM f rom at least three independent experiments) 1( Wainscott et al., 1996) (AV12), 2( Thomsen et al., 2008) (HEK293), 3( Cussac et al., 2002) (CHOK1), 4( Bonhaus et al., 1997) (CHOK1), 5( Sakhuja et al., 2015) (HEK293), 6( Booth et al., 2009) (CHOK1), 7( Canal et al., 2014) (HEK293) 143

PAGE 144

Table 42. 5 HT2C agonist functional results for IP3 production in transiently transfected CHO K1 cells. Values listed in the table are mean EC50 (nM) and Emax (% of 5 HT response) SEM from at least three independent exper iments. Data was obtained from CHO cells transiently transfected with 5HT2C receptors (*=P<0.05 significantly different from 5HT) 144

PAGE 145

Table 43. Literature potency and efficacy value of 5HT2C inverseagonist decreasing IP3 production in various cell lines. Values listed in the table are mean EC50 (nM) and Emax (% of 5 HT response) SEM from at least three independent experiments. Data was obtai ned from CHO cells transiently transfected with 5HT2C receptors.(*=P<0.05 significantly different from SB 206553)a( Canal et al., 2011b, Sakhuja et al., 2015 ) (HEK),b( Herrick Davis et al., 2000) (COS7), c( Liu et al., 2016) (HEK), d( Canal et al., 2011a) (HEK) 145

PAGE 146

Table 44. EC50 values for stimulating IP3 production of 5HT2C 20 hours. Values listed in the table are mean EC50 (nM) and SEM from at least three independent experiments. Data was obtai ned from CHO cells transiently transfected with 5 HT2C receptors. (*=P<0.05 significantly different from 5HT) 146

PAGE 147

Table 45. Emax values of 5HT, Ro 60 trans m Br 4 trans 4 PAT, and aripiprazole at desensitized and nondesensitized 5HT2C receptors. Values listed in the table are mean Emax (% of 5 HT response) SEM from at least three independent experiments. Data was obtained from CHO cells transiently transfected with 5HT2C receptors 147

PAGE 148

Table 46 EC50 and Emax values of 5 HT, Ro 60trans m Br 4 PAT at WT and S407A mutant 5HT2C GPCRs. Values listed in the table are mean EC50 (nM) and EMAX (% 5 HT response) SEM from at least three independent exper iments. Data was obtained from CHO cells transiently transfected with 5HT2C rec eptors (*=P<0.05 significantly different from 5 HT). 148

PAGE 149

Table 47. Emax values of 5HT, Ro 60 trans m Br 4 PAT, at desen sitized and nondesensitized 5HT2C S407A GPCRs Values listed in the table are mean EMAX (% 5 HT response) SEM from at least three independent experiments. Data was obtained from CHO cells transiently transfected with 5 HT2C receptors. 149

PAGE 150

Table 48. Emax values 5 HT, Ro 60 trans m Br 4 PAT at desensitized 5HT2C WT receptors and 5HT2C S407A GPCRs Values listed in the table are mean EMAX (% 5 HT response) SEM from at least three independent experiments. Data was obtained from CHO cells t ransiently transfected with 5 HT2C receptor. 150

PAGE 151

CHAPTER 5 IN VIVO CHARACTERIZATION OF SIGNALING OUTCOMES FROM CHRONIC AGONIST LIGAND INTERACTION WITH 5 HT2C GPCRS Specific Aim 2 In the previous chapter s, it was d emonstrated that 5HT2C partial agonists such as 4 PAT type compounds produce less desensitization of 5HT2C signaling through the canonical pathway than full agonists. Moreover, resul ts in the previous chapter suggest that ligand structural parameters impact the agonist conformation(s) of 5HT2C receptor that is stabilized, thereby, impacting the degree, and, perhaps, the molecular mechanism of 5 HT2C receptor desensitization. Studies in this chapter were designed to determine if the 5 HT2C desensitization that occurs in vitro using the recombinant human 5 HT2C receptor expressed in CHO cells, translates in vivo to a murine model of 5HT2C function T he DOI ind uced HTR in mice is an in vivo index of 5 HT2 GPCR activation, although generally thought to reflect 5 HT2A more than 5HT2C activation. Nevertheless, g iven that the 5HT2C receptor KO mice exhibit half the number of DOI induced HTRs as WT littermates ( Canal et al., 2010) 5 HT2C GPCR activation is an important component the DOIinduced HTR. The DOI induced HTR response was chosen over other 5HT2C behavior al readouts like feeding behavior and anxiolytic behavior in an elevated plus maze because DOI induced HTR displays better translational validity in predicting the antipsychotic potential, high reproducibility between observers, and low betweensubject and w ithin subject variability ( Canal and Morgan, 2012) Studies were designed to test the hypothesis that 5HT2C agonist induced desensitization of 5HT2C receptor signaling leads to desensitization regarding the 5HT2C receptor mediated component of the DOI induced HTR in mice. A corollary 151

PAGE 152

hypothesis tested is that 5HT2C agonist ligand structure impacts desensitization of the DOI in duced HTR, as was shown for 5HT2C signaling, in vitro In particular, following from the in vitro studies in the preceding chapter, the 5 H T2C agonists evaluated in vivo with regard to 5HT2Cmediated DOI induced HTR in mice included, mCPP, Ro 600175, WAY 161503, lorcaserin and trans 4 PAT. When those in vitro studies (preceding chapter) were undertaken, the mouse 5HT2C receptor cDNA was not available. Accordingly, results from in vivo studies in this chapter regarding 5HT2C receptor mediated effects on the DOI induced HTR in mice are interpreted in light of known (and potential) structural and functional interspecies differences between the mouse and human 5 HT2C receptor s. By extension, 5HT2C agonist ligand structural impact on mouse D O I induced HTR are interpreted in the context of the in vitro results that used the human 5HT2C receptor. A number of other considerations could impact interpretation of the results from the in vivo DOI induced HTR studies. The unedited (INI) isoform of the 5HT2C receptor in which the in vitro desensitization was elucidated, is not the most physiologically abundant isoform of the r ecep tor. Edited isoforms of this receptor, like VSV and VGV modulate their desensitization differently in response to distinctive ligand exposure ( Marion et al., 2004) which could pr oduce variability when comparing the in vitro and in vivo results. The 5HT2C receptor is also known to homodimerize with itself ( Herrick Davis et al., 2004, Mancia et al., 2008) and possibly heterodimerize (unpublished data) with the 5HT2A receptor in vitro Dimerization of these receptors in vivo could also significantly affect the extent of desensitization. 152

PAGE 153

An additional caveat regarding the in vivo studies in this chapter is that many 5HT2C receptor ligands also have 5HT2A affinity, including the ligands tested here, i.e., mCPP, Ro 60 0175, WAY 161503, lorcaserin and trans 4 PAT. Given that the 5 HT2A receptor is involved i n mediat ing the DOI induced HTR and 5 HT2A receptors can be desensitized by both agonists and antagonists ( Berry et al., 1996, Willins et al., 1999) results herein are interpreted relative to possible contributions of the 5HT2A receptor. Method s Compounds unless noted. ()2,5 D imethoxy 4 iodoamphetamine ( DOI) hydrochloride (> 9 8 % ), 1 (3 chlorophenyl) piperazine hydrochloride (mCPP), R o 60 0175 95%) were purchased from Sigma Aldrich (St. Louis, MO). WAY 161503 hydrochloride and was purchased from Tocris Biosciences (Bristol, U.K.). L orcaserin hydrochloride (> 98% ) was purchased from Chem Scene. The 5HT2C agonist (2S,4R) 4 phenyl 2 dimethylaminotetralin ( trans 4 PAT) ( Booth et al., 2009) was synthesized in our lab oratory as a racemic mi xture. The two enantiomers were > 99% pure according to H1 NMR and chiral stationary phase HPLC, and the hydrochloride salt was used as previously described ( Booth et al., 2009) In Vivo Pharmacology The DOI induced HTR assay was performed using adult mal e C57Bl/6J mice. The mice were obtained from Jackson Laboratories at approximately 8 weeks of age and allowed to acclimate to the temperatureand humidity controlled colony room for at least 1 week prior to testing. Mice were housed three per standard cag e and allowed 153

PAGE 154

unlimited access to laboratory chow and water. Ligands were dissolved in sterile saline prior to behavioral testing, and administered in a volume of 0.01 mL/g body weight Experiments were carried out at approximately the middle of the light phase (lights on at 6 am, and lights off at 6 pm) All experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals, as promulgated by the National Institutes of Health, and were approved by the Northeastern Universitys Institutional Animal Care and Use Committee. Prior to every injection, mice were habituated to the testing room for approximately 1 hour C57Bl/6J male mice recei ved injections of either vehicle or 1.0 mg/kg or 3.0 mg/kg drug (n 5 /treatment). These doses, which did not cause a HTR on their own, were given via one intraperitoneal injection for four consecutive days On the 5th day, DOI was given ( 1.0mg/kg) and 10 minutes later the mice were placed in a clean transparent rectangul ar field, and HTRs were recorded for 10 minutes. A HTR was defined as a clear, rapid, left to right or right to left tic movement of the head of the mouse. A trained observer who was blinded to dr ug treatment counted the H TRs M eanwhile, a n overhead video camera taped the session, and locomotor activity (distance travelled in cm) was analyzed and calculated by Ethovision software (Noldus Information Technology Inc ., Leesburg, VA) The mice were then promptly anesthetized with isoflourane and the brains wer e collected, chilled in iso propyl alcohol, froxen by dry ice and stored at 80 C Results and Discussion M ice injected receiving vehicle for 4 consecutive days elicited 402.5 HTRs after a 1.0 mg/kg dose of DOI on day 5 After a 4day chronic daily administration of each of 154

PAGE 155

the 5HT2C agonists (Ro 600175, WAY 160503, mCPP, lorcaserin, trans 4 PAT), there were significantly less HTRs ob served in response to DOI on day 5. Thus chronic administration of 1.0 mg/kg mCPP reduced the number of DOI induced head twitches to 161.4, producing the greatest desensitization effect (P<0.0001) C hronic treatment with 1.0 mg/kg WAY 161503 or Ro 600175 reduced the DOI induced HTRs to 232.8 and 241.9, respectively as induced by D OI on day 5 (P<0.01) Chroni c 4 day treatment with 3.0 mg/kg l orcaserin or trans 4 PAT resulted in 2 84.0 and 27 3.0 HTRs, respectively induced by DOI on day 5 (P<0.05) (Figure 5 1 ). These data suggest that chronic 4 day administration of the 5 HT2C agonists mCPP, Ro 60 0175, and WAY 16150 3 desensitize the DOI induced HTR to levels observed with 5 HT2C receptor KO mice (~50%) ( Canal et al., 2010) whereas lorcaserin and trans 4 PAT produced comparatively less desensitization of DOIinduced HTR after chronic treatment with each of the 5HT2C agonists. There was no effect seen on the DOI induced locomotion of these mice following chronic treatment (Figure 52 ). It is noted, h owever, t hat these data must be interpreted relative to the polypharmacology of each of the 5HT2C ligands tested, i.e., the ligands have relevant affinities at closely related receptors, such as 5HT2A, 5 HT2B, H1, Adrenergic and other receptors ( Roth, 2014) Nonetheless these preliminary studies provide rationale for further investigation of 5HT2C agonist impact on desensitization in vivo In addition, brains of mice were excised shortly after the in vivo studies herein were completed for future autoradiographic studies to radiolabel and quantitate 5HT2C as well as 5HT2A receptor levels to document ligandinduced changes in levels of both receptors. 155

PAGE 156

Figure 51 DOI induced HTRs in C57Bl/J6 m ice after 4 day chronic treatment of 5HT2C agonists C57Bl/J6 m ice received daily administration of 5HT2C agonist for 4 consecutive days, on the 5th DOI induced HTR were recorded. Chronic administration of all f ive 5 HT2C agonists attenuated the DOI induced HTR. Each data point represents the mean SEM of at least 6 different subjects. (***=P<0.001, **=P<0.01, *=P<0.05 different from vehicle.) 156

PAGE 157

Figure 52 DOI induced locomotion in C57Bl/J6 m ice after 4 day chronic treatment of 5 HT2C GPCR ligands. No effect was noticed for any drug. Each data point represents the mean SEM of at least 6 different subjects. 157

PAGE 158

CHAPTER 6 LEAD OPTIMIZATION OF THE 5 PHENYL N,NDIMETHYL 1,2,3,4 TETRAHYDRONAPHTHALENE 2 AMINE (5 P HENYL A MINO T ETRALIN; 5 PAT) SCAFFOLD TARGETING THE 5 HT1A AND 5 HT7 GPCRS FOR THE TREATMENT OF AUTISM SPECTRUM DISORDERS Specific Aim 3 5 P henyl N N dimethyl 1,2,3,4tetrahydroanphthalene2 amine ( p henyl a mino t etralin; 5 PAT) was first synthesized as part of a medicinal chemical project to improve selectivity of the PAT scaffold at 5 HT2 receptors over the H1 receptor. T he more active enantiomer showed limited slecetivity for the 5 HT2 GPCRs (Ki=70 700 nM) over the histamine H1 (Ki>1,000 nM) GPCR whereas 5 PAT bound with high er affinity at the 5 HT1A and 5 HT7 receptors ( Ki values of 9 0.4 and 7 0.6 nM ) respectively. 5 PAT was also shown to be enantioselective in binding to the 5HT7 and 5HT1A receptors: the 5 PAT enantiomer showed >100fold affinity over the (+) enantiomer at both 5 HT1A and 5HT7 receptors (affinity results given in Table 4 2) The current version of the Diagnostic and Statistical Manual of Mental Disorders (DSM5) designates autism spectrum disorders (ASD) as a collection of neurodevelopmental disorders characterized by diagnostic criteria of "persistent deficits in social commu nication and interaction" and "restricted, repetitive patterns of behavior, interests, or activities", while also associated with high incidences of cognitive dysfunction. ASD affects nearly 1% of the population ( Berg and Geschwind, 2012) Currently, the antipsychotic medications aripiprazole and risperidone are approved to treat irritability associated with ASD, yet no medications are approved to treat the cor e symptoms of ASD, and thus represents an unmet therapeutic need ( Ghosh et al., 2013) 158

PAGE 159

The high affinity of 5 PAT at 5 HT1A and 5 HT7 receptors suggested it could be pharmacotherapeutic for repetitive motor (stereotypical) behaviors associated with autism spectrum disorder (ASD) and related neuropsychiatric disorders, based on the localization of 5 HT1A and 5HT7 receptors in brain regions governing locomotor activity and modulation of dopamine neural activity. Additionally, the selective 5HT7 partial agonist, LP 211 ameliorates multiple stereotypic events shown in a murine model of Rett syndrome (one of the disorders falling under the umbrella of ASD) and enhances spati al attention in a murine model of attention deficit hyperactivity disorder (ADHD) ( Ruocco et al., 2014) Furthermore, pharmacological a ctivation of the 5 HT1A receptor has been shown to treat L DOPA induced dyskinesia. Mo reover, buspirone, which possesses high affinity and partial agonist activity at the 5HT1A receptor ( Sundaram et al., 1992) is clinically effective at treating restricted and repetitive behaviors in children with autism ( Chugani et al., 2015) It was hypothesized that substitution at the C(5) phenyl ring and 2 amine positions of the 5PAT scaffold (Figure 6 1 ) might improve affinity and selectivity at 5 HT1 A and 5 HT7 receptors over 5 HT2, dopamine D2, and histamine H1 receptors to provide improved pharmacologic tools for delineating 5HT7 and 5HT1A function in vivo Accordingly, medicinal chemical and pharmacological studies were undertaken with the 5 PAT scaffold to provide 5HT1A and 5HT7 receptor ligands with (partial) agonist activity that might demonstrate preclinical efficacy in rodent models of ASD and related neuropsychiatric disorders. 159

PAGE 160

Methods Compounds The 5 PAT s were synthesized in our lab oratory as a racemic mixture. The two enantiomers were resolved via chiral stationary phase high performance liquid chromatography (>99% purity by HPLC as well as [1H] NMR) and converted to hydrochloride sal ts as previously described ( Booth et al., 2009) 5 HT hydrochloride (99%) was purchased from Alfa Aesar (Ward Hill, MA) and ()2,5 dimethoxy 4 iodoamphetamine ( DOI ) fro m Sigma Aldrich (St. Louis, MO). AS19 (>98%) was purchased from Tocris Biosciences (Bristol, U.K.). [3H]5 Carboxamidotryptamine (5CT) (specific activity 14.81 Ci/mmol) was purchased from PerkinElmer Life and Analytical Sciences (Waltham, MA). Cell Culture Human embryonic kidney 293 cells (HEK, ATCC CRL1573) were maintained in Dulbecco's modified Eagle's medium (DMEM) with 8% fetal bovine serum and 1% penicillin streptomycin. Cells were grown in a humidified incubator at 37 C with 5% carbon dioxide95% air The cDNA encoding the human 5HT7 wild type receptor was obtained from UMR cDNA Resource Center (Rolla, MO). HEK293 cells were grown to 30% confluency washed, transfec 5 HT7 receptor subtype cDNA mixed with 30 MEM, and placed in an incubator. Cells were passaged within a few days therafter and incubated with 500 g/mL of G418 selection antibiotic Several clones were individually selected and grown to confluency. The receptor density o f the clones was screened and a high expressi ng clone ( 1pmol/mg protein) with a KD for 5 CT of 0.7 nM was identified. This clone was grown further and cell m embranes were regularly collected from pass ages 4 to 20, by centrifugation in a 160

PAGE 161

Sorvall Legend X1R tabletop centrifuge (Thermo Fischer Scient ific, Pittsburgh, PA). The membrane s were washed by centrifugation at 15000 g for 15 min utes at 4C, three successive times, in 50 mM Tris, 10 mM MgCl26H2O, and 0.1 mM EDTA at pH 7.4 (assay buffer) and stored at 80C Radioreceptor Competition Binding Assays Radioligand competitive displacement binding assays were performed in 96well plates, similar to methods used previously ( Booth et al., 2009) The radioligand used to label the 5 HT7 and 5H T1A receptors was 5carboxytryptamine (5CT), at a concentration near the Kd value of 0.9 and 0.56 nM respectively Non specific binding was determined in the presence of 10 M 5 HT and was <10% of total binding The other target receptors 5HT2, D2 and H1, were screened with methods detailed above. Incubation of radioreceptor binding assay mixtures was for 90 min utes at 2 7C on a plate shaker (300 rpm) Incubations were terminated at room temperature by rapid filtration of the reaction mixtures through Whatman GF/B filters using a 96 well cell harvester ( Brandel, Gaithersburg, MD ) and the filters were washed three times with 50 mM Tris HCl. Filters containing bound [3H]5 CT were dri ed, placed in vials containing 1 mL scintillation cocktail (ScintiVerse Cocktail; Thermo Fischer Scientific, Pittsburgh, PA), allowed to equilibrate overnight, and then counted for [3H ] induced scintillation using a PerkinElmer Tri carb 2190TR liquid scintillation counter. Each binding experiment incorporated eleven ligand con centrations (0.1 10,000 nM, half log units) in quadruplicate, and each experiment was performed a minimum of three times. Outliers were validated using the Grubbs test (Graphpad QuickCalc). 161

PAGE 162

In Vitro Functional Pharmacology 5 HT7G sm ediated cAMP product ion and 5HT1AG imediated reduction of 1.0 90 ) forskolin stimulated cAMP were measured using PerkinElmers Lance Ultra cAMP kit, with methods described by the manufacturer ( Caron et al., 2010) and the following optimization. HEK293 or CHO K1 cells expressing 5HT7 or 5 HT1A receptors, respectively, were harvested in HBSS (Lonza, Hopkinton, MA) and then pelleted by centrifugation at 200g at 37 C for 5 min. Cells were resuspended in stimulation buffer (1 HBSS, 5 mM HEPES, 0.5 mM IBMX, 0.1% BSA, pH 7.4). Cells were counted usi ng a hemocytometer (Hausser Scientific, Horsham, PA) and diluted to 500 (5HT7) or 600 (5 H T1A test compound diluted in stimulation buffer with (5HT1A CHO K1) or without (5HT7 added to each well of a 384well plate (Greiner BioOne, Monroe, NC). The plate was incubated at room temperature for 30 minutes After incubation, the reaction was anti cAMP mixed in cAMP d etection buffer The plate was incubated at room temperature for 1 h our to reach equilibrium. cAMP levels were detected by the FRET emission at 665 nM using Synergy H1 reader with a Lance filter cube (BioTek, Winooski, VT). 5 HT2G q signaling was measured using the Cisbio (Bedford, MA) IP One HTRF assay (which detects inositol phosphate 1 (IP1) ) as previously described ( Canal et al., 2013b) In short, HEK293 cells transiently transfected with WT 5 HT2A, 5 HT2B, 5 HT2C receptors were incubated in serum free DMEM for 1 hour. Cells were then harvested and pelleted by centrifugation at 200g at 37C for 10 minutes, followed by resuspension 162

PAGE 163

in serum free DMEM. Cell number was counted using a hemocytometer (Hausser Scientific Horsham, PA), and 500 cells/mL were used. Five of cell suspension and 5 of test compound in stimulation buffer (included in kit and containing 50 mM LiCl) were added to each well of a 384well plate The plate was incu bated at 37C for 2 hours. After incubation, the reaction was termi nated by adding 5 of the donor (IP1 d2) and acceptor (anti IP1 cryptate) fluorescent conjugates in lysis buffer. The plate was incubated at room temperature for 1 hour to reach equilibrium. Inositol phosphate 1 levels were assessed by the ratio of fluores cence emission at 665 nM and 620 nM (fluor escence resonance energy transfer, HTRF) using a Synergy H1 plate reader with an HTRF filter cube (BioTek, Winooski, VT). Experiment s were performed with duplicate for 5 HT and triplicate for all other drugs, and each independent experiment was performed a minimum of three times. In Vivo Pharmacology Male C57Bl/6J mice were obtained at ~8 weeks of age from The Jackson Laboratory (Bar Harbor, ME); they were housed four/cage and allowed to a cclimate to the temperatur (23C) and humidity controlled vivarium for at least 1 week before testing. The vivarium was illuminated from 7:00 AM to 7:00 PM, with ad libitum access to chow and water. Experiments were conducted at approximately the middle o f the light phase. The v ehicle was MilliQ water (EMD Millipore, Billerica, MA) for all compounds, except AS 19, which was prepared in a maximum (i.e., for the 10 mg/ kg dose) of 5% DMSO in water (2.8 and 1.5% DMSO for the 5.6 and 3 mg/kg doses, respectively). All compounds were administered systemically by subcutaneous injection, unless otherwise noted in a volume of 0.01 mL/g body weight. Ten minutes after the admini stration of the last compound, m ice were placed into an openfield (43 43 cm, 163

PAGE 164

Med Asso ciates, St. Albans, VT) for behavioral observation. The openfield was cleaned with AccelTB disinfectant and dried prior to the testing of each mouse. Automated measuring of behaviors, including distance traveled (cm) and rotations (360 body rotations around an animals axis), was performed by Noldus Ethovision XT9 software and an overhead camera tracking system (Noldus Information Technology, Leesburg, VA) linked to a Dell Precision T5600 PC. All other behaviors were scored by treatment blinded observer(s ). All behavioral procedures were approved by the University of Florida and Northeastern University Institutional Animal Care and Use Committee and were performed in accordance with the Guide for the Care and Use of Laboratory Animals. Idiopathic Stereoty pic Jumping Sixteen adult male C58/J mice (>75 days old) were used to test the effects of (+) o F 5 P A T on stereotypic jumping. Mice received with either vehicle or (+) o F 5 P A T (1.0 or 3.0 mg/kg s.c.) and then placed in an open field chamber 10 minutes l ater. Jumping was defined as a mouse rearing on its hind legs along a wall or in a corner and jumping so that all four feet were off the ground simultaneously, often repeatedly (jackhammer jumping). Jumps were counted over a 10minute session. Each mouse was tested four times using a random testing strategy, twice with vehicle and once for each dose o f (+) o F 5 P A T (1.0 and 3.0 mg/kg). T hus each mouse served as its own control. After each testing session, a drug washout period of 8 days was instituted b efore repeated testing. Inclusion criterion of 10 jumps per/10minute testing session after receiving vehicle was established prior to testing, one mouse did not qualify. One mouse was sacrficied due to obvious weight loss. Two other mice were found dead i n their home cages, w ith no apparent physical trauma. One mouse did not jump >10 times 164

PAGE 165

in a 10 minute period when treated with vehicle (inclusion criteria) and was excluded. T hus, only 12 mice completed the study. MK 801induced Stereotypic Rotations and H yperlocomotion C57BL/6J mice were used to test the effects of 5PATs on MK 801elicited stereotypic rotations and hyperlocomotor behavior Vehicle or (+) o F 5 P A T (5.6 mg/ kg) was administered s c. 10 minutes prior to injection of vehicle or MK 801 (0.3 mg /kg) sc. Ten minutes later, mice were placed in the open field plexiglass chamber (43 x 43 cm, Med Associates, Inc.) for a 30min ute observation and recording period. An overhead camera videotaped the session and locomotor activity (distance travelled in cm) was calculated by Ethovision software (Noldus Information Technology Inc.). Mice were only used once in this experimental model and each test group contained at least 6 subjects. The vehicle control group was the same for MK 801 and amphetamine experim ents. Data analysis was performed by observers blinded to the treatment conditions. Amphetamine induced H yperlocomotion C57BL/6J mice previously used in MK 801 experiments after drug washout period were habituated to the testing room for approximately 30 minutes. Locomotor activity testing consisted of administration (i.p.) of saline (vehicle), (+) o F 5 P A T 5.6 mg/kg) followed 10 minutes later by an injection of vehicle or the dopamine transporter i nhibitor and substrate, amphetamine (3.0 mg/kg). Locomotion was assessed exactly as noted in the MK 801 during the 30 minute observation period. Mice were tested only once in this model, and no mice were excluded from analyses. Data analysis was performed by observers blinded to the treatment conditions. 165

PAGE 166

DOI induced HTR C57BL/6J mice from MK 801 and amphetamine studies were reused after a 4week drug washout period and were approximately 4 months old at the time of testing. M ice were habituated to the test ing room for approximately 30 minutes. Testing consisted of administration (subcutaneously) of Milli Q water (vehicle), (+) o F 5 P A T (1.0, 3.0, 5.6 mg/kg), AS 19 (3.0, 5.6, 10 mg/kg) or (+) or 8OH DPAT (0.5 mg/kg) followed 10 minutes later by an injec tion of the 5HT2 agonist DOI (1.0 mg/kg). Ten minutes later, mice were placed into a clear Plexiglas openfield chamber (43x 43 cm; Med Associates, St. Albans, VT) for a 10minute observation period. During this session, HTRs, defined as rapid and discrete back and forth rotation of the head, were counted by a trained observer who had been blinded to the drug treatment conditions. A camera videotaped the session, and activity (distance traveled in cm) was calculated by Ethovision software (Noldus Informatio n Technology, Leesburg, VA). Symptoms of Serotonin Syndrome C57BL/6J mice were used to observe if a therapeutically relevant dose (5.6 mg/kg) of (+) o F 5 P A T elicits symptoms of serotonin syndrome such as flat body posture, forepaw treading, grooming, head weaving, hind limb abduction, moon walking, piloerection, Straub tail, and tremor, as previously described ( Haberzettl et al., 2014) For e ach observation session, two C57BL/6J littermates were injected s.c. with either vehicle or 5.6 mg/kg (+) o F 5 P A T and placed into the open field for observation 10 min utes later. Two observers blinded to treatment recorded the occurrence of serotonin syn dromelike responses (SSR) during 6 onemin ute sessions, each separated by 5 min utes (6 min utes of recorded observation over a 30minute period), for each mouse. SSR were determined as not present (=0) or present (=1) during each observation 166

PAGE 167

session, for a total score of between 0 and 6. Additionally, the total number of HTR and rear ing s displayed across all six observation sessions were also recorded. The number of subjects/group was seven. Social Interactions During the SSR observation session previously mentioned above, we scored the number of social interactions produced by each mouse. A social interaction was defined as one mouse approaching another, resulting in direct noseto body/noseto nose contact between the appr oaching mouse and the recipient One mouse walking by the other mouse that involved body contact was not scored as a social interaction. The same blind observers scoring SSR also scored social interactions blind to treatment. No mice were excluded from analyses. The number of subjects/group was vehicle = six, and (+) o F 5 P A T 5.6 mg/kg = five. Statistical Analyses All data were analyzed using in GraphPad Prism, 6.0 (San Diego, CA) Binding affinity d ata were fit using the one site fit Ki model that constrains the Hill slope to 1.0. Two site curve fitting analysis did not result in an improved fit (data not shown). Approximate Ki values were determined by the conversion of the IC50 data using the equation Ki=IC50/1 +L/KD, where L is t he concentration of radioligand. Ligand affinities are presented as their mean values ( SEM ). Calculations of unpaired t test and oneway analyses of variance (ANOVA) with Tukeys multiplecomparison post hoc tests were performed to compare Ki values of individual compounds. In vitro functional data were fit using the log(agonist) vs. response v ariable slope ( four parameters) model. Comparisons between stereotypic jumping scores obtained from the C58/J mice were performed with oneway repeated measure ANOVA, utilizing Dunnetts post hoc tests 167

PAGE 168

were used for multiple comparisons. Ordinary oneway ANOVAs were used to assess differences between drug treatments for the DOI induced HTRs MK 801induced stereotypic rotations, and drug induced hyper locomotor behavior, social interactions and symptoms of serotonin syndrome, with Tukeys post hoc test used for multiple comparisons. P values are noted with asterisks in figures and are defined as : *=P < 0.05; **=P < 0.005; ***=P < 0.0005; and ****= P < 0.0001. All asterisks in figures represent differences from vehi cle group unless explicitly shown. Results Binding Affinities of 2, 3, 4, 5, 6halongenated 5 PATs at 5HT7 and 5 HT1A GPCRs and Off t argets The unsubstituted parent 5 PAT compound displayed high stereoselectivity for binding the 5 HT1A and 5 HT7 receptors radiolabeled with [3H] 5 CT, with the and (+) enantiomers showing affinities of 90.4 and 4400930 nM (P<0.0001) for the 5HT7 receptor and 7 0.6 and 810 170 nM (P<0.0001) for the 5HT1A receptor, respectively (Table 41) In contrast to unsu bstituted parent 5PAT wherein the enantiomer had higher activity, it was the (+) enantiomer of o F 5 PAT (Figure 6 2) and o Cl5 PAT that showed the highest affinity at the 5 HT1A and 5 HT7 receptor s. (+) o F 5 P A T showed an affinity of 20 3 and 6 0.7 nM for the 5 HT1A and 5 HT7 receptors, respectively, while (+) o Cl 5 PAT had affinity of 36 4.6 and 6 0.6 nM for the 5 HT1A and 5 HT7 receptors, respectively. All meta and para substituted 5PAT analogs did not enhance affinities for the 5HT7 and 5HT1A receptors as compared to the unsubstituted parent compound, 5PAT Additionally, compounds with electrondonating moieties on the 5 phenyl group were synthesized, but show ed no enhancement in affinity or selectivity regarding the 5 HT1A or 5 HT7 r eceptor s, compared to the parent 5PAT The binding affinities of both 168

PAGE 169

enantiomers of the lead compound o F 5 P A T were additionally screened at relevant off target receptors: human 5HT2A, 2 B, 2 C, adrenergic 1, 2, histamine H1, and dopamine D2 and murine 5HT2A 2 C GPCRs to ascertain compound selectivities and provide mechanistic insight of o F 5 P A T induced observed behavioral effects. The (+) enantiomer of o F 5 P A T displayed a higher affinity than the enantiomer at the 5 HT7, 5 HT1A, 5 HT2B, and 5HT2C GPCRs (P<0.01) but interestingly this trend was reverse d at both the mouse and human 5HT2A receptor s, i.e., o F 5 P A T displayed the higher affinity at mouse and human 5HT2A receptors (Table 42). Neither o F 5 P A T enantiomer displayed relevant affi nity (>1 M) at the adrenergic ( 1, 2) histamine H1, and dopamine D2 GPCRs Binding Affinities of 5 7, 8 and N, N substituted 5 PATs at 5HT7 and 5 HT1A GPCRs and Off t argets Compounds with substitutions at the 5position, 7and 8positions of the tetrahydronaphthalene ring, 2amine moiety of the 5PAT scaffold were used to investigate the structureaffinity requirements of the 5HT7 and 5HT1A receptor orthosteric binding pockets. The new 5 PAT derivatives did no t show enhance d binding affinity at either the 5 HT1A or 5 HT7 receptors as compared to the parent 5PAT moiety. The (+) and 5 naphthalene derivatives displayed equal affinities at the 5HT7 receptor (~20 nM) and 5HT1A receptors (~100 nM), demonstrating a loss of stereoselectivity. N ota bly replacement of the 5 phenyl moiety for a 5 anthracene moiety reduced affinity at both 5 HT1A (Ki=1300 380) or 5HT7 (Ki=440 110 nM) receptors as compared to the parent 5PAT (P<0.05), suggesting steric lim itations in the region of the orthosteric binding pocket of the 5 HT1A or 5 HT7 interacting with the 5substituted moiety of 5PATs R eplacement of the 2N,Ndimethyl with 2 N,Ndipropyl reduced 169

PAGE 170

affinity at 5 HT7 (K i =835.8) receptors compared to the parent 5PAT (P<0.001) but maintained affinity at 5 HT1A (Ki=13 nM) receptors In contrast to unsubstituted5 phe n yl 2 N,Ndipropyl 5 PAT wherein the enantiomer had higher activity, it was the (+) enantiomer of 2N,Ndiproyl o F 5 PAT that showed the highest affinity at the 5HT1A and 5HT7 receptors. T his disparity in stereoselectivity was concurrent with that observed previously with the 2 N,Ndimethyl 5 PAT and (+) 2 N,Ndimethyl o F 5 PAT compounds. Function of (+) o F 5 P A T at 5 HT7, 5 HT1A, 5 HT2 GPCRmediated S ignaling The functional profile of (+) o F 5 P A T at the serotonergic GPCRs is summarized in Table 44. (+) o F 5 P A T behaved as a partial agonist regarding 5 HT7 receptor mediated G s cAMP signaling, with an EC50 value of 34 13 nM and Emax of 33 11% (compared to AS 19). The o F 5 P A T enantiomer also displayed partial agonism at the 5HT7 receptor although it was much less potent than the (+) enantiomer and displayed a n EC5 0 value of 380 80 nM and Emax of 29 6.8 % (compared to AS 19) It is noted that the functional activi ty of the o F 5 P A T enantiomers was consistent with their binding affinity, i.e., (+) enantiomer > enantiomer (+) o F 5 P A T also behaved as a potent partial agonist of 5 HT1A receptor mediated G i cAMP signaling showing EC50 values of 40 15 nM and a Emax of 48 10% (compared to the putative 5HT1A agonist 5 CT). The o F 5 P A T enantiomer did not have appreciable affinity or activity at the 5HT1 A receptor. (+) o F 5 P A T also was a partial agoni st regarding 5 HT2C and 5HT2A receptor mediated IP3 production. At the 5HT2C receptor (+) o F 5 P A T had an EC50 value of 230 70 nM and an Emax value of 87 13 % (compared to 5HT). However, at the 5HT2A 170

PAGE 171

receptor (+) o F 5 P A T displ ayed much lower potency of 3,500 830 nM (P<0.05) and an Emax of 39 4.3 % (compared to 5HT) (P<0.05) than at the 5 HT2C receptor (+) o F 5 P A T did not show agonist activity at the 5HT2B receptors when tested at concentrations up to 10 M. (+) o F 5 P A T A ttenuates DOI induced HTR Both enantiomers of o F 5 P A T were effective at blocking DOI induced HTR. A stereoselective effect was observed in the reduction of HTRs consistent with o F 5 P A T stereoselective binding and agonist function at 5 HT1A and 5HT7 receptors, i.e., the (+) enantiomer was better than the ena ntiomer (P<0.001) The stereoselectivity of the behavioral effect exhibited by o F 5 P A T is consistent with the binding and functional activity displayed at 5 HT7 and 5HT1A receptors and suggests that the behavioral effects elicited by o F 5 P A T administration were 5HT7and 5HT1Areceptor mediated. Nevertheless, (+) o F 5 P A T has relevant 5HT2A activity (Table 44), which may impact the HTR assay. To assess contributions of 5 HT7/5 HT1A receptor mediated mechanism as opposed to the direct 5HT2A, 2C mechanism s, two dual 5HT7/5 HT1A standards, AS19 and 8OH DPAT, were evaluated in the HTR assay. AS19 (10 mg/kg) and both enantiomers of 8OH DPAT (0.5 mg/kg) effectively reduced the DOI induced HTR, (P<0.01) and (P <0.0001), respectively. Yet A S19 and 8OH DPAT show negligible affinity towards the 5HT2A and 5HT2C receptors ( Knight et al., 2004 ) suggestive of a 5HT7/5 HT1Adependent mechanism In fact, the stereoselectivity observed for 8 OH DPAT binding at 5 HT1A receptor s ( Lejeune et al., 1997) was consistent regarding the reduction of the DOI induced HTR, i.e., the (+) enantiomer was the more active (Figure 6 3). (+) o F 5 P A T was not as potent compared to (+) 8 OH DPAT at blocking the DOI 171

PAGE 172

induced HTR but (+) o F 5 P A T was far more potent and efficacious than AS 19 in the attenuation of the DOI induced HTR (P<0.01) (+) o F 5 P A T A ttenuates the MK 801 induced R otations and Locomotion but not Amphetamine induced Locomotion MK 801 induces stereotypic behavior in C57Bl/6J mice that is manifested as repetitive 360 rotati onal circling Mice receiving vehicle rotated 50 7 times during a 30minutes session. Mice receiving 5.6 mg/kg (+) o F 5 P A T alone elicited 52 10 rotations a number not different from vehicle treated animals Mice administered 0.3 mg/kg MK 801 rotated 310 30 times which was significantly higher than that of vehicle, (P<0.0001). MK 801 in duced rotatio nal behavior was attenuated by (+) o F 5 P A T Mice administered 5.6 mg/kg (+) o F 5 P A T prior to 0.3 mg/kg MK 801 administration rotated 110 21 times (P<0.0001) (Figure 64 A ). A ttenuation of MK 801induced stereotypic rotations resulting from (+) o F 5 P A T was also accompanied by the attenuation of MK 801induced hyper locomotor activity. Mice traveled 14000 1200 cm in 30 minutes after the administration of 0.3 mg/kg MK 801, whereas mice r eceiving vehicle traveled 6900 750 cm (P<0 .01) The administration of 5.6 mg/kg (+) o F 5 P A T alone did not produce hyper locomotor activity (8100 1600 cm) when compared to vehicle. However, pretreatment with 5.6 mg/kg (+) o F 5 P A T significantly attenuated the hyper locomotor activity induced by MK 801, with mice traveling 9000 900 cm (P <0.05) (Figure 64B). Amphetamine also induced hyper locomotor activity in C57Bl/6 mi ce similar to MK 801 via modulation of dopaminergic neurotransmission Mice traveled 19000 2900 cm following administration of 3.0 m g/kg amphetamine. Administration of 5.6 mg/kg (+) o F 5 P A T 172

PAGE 173

prior to amphetamine also produced hyperlocomotor activity ( 13000 2300 cm ) similar to amphetamine (Figure 6 5) (+) o F 5 P A T R educes Idiosyncratic Jumping C58/J mice administered vehicle jumped 39 6.3 times in a 10minute session. Both doses of (+) o F 5 P A T (1.0 mg/kg and 3.0 mg/kg) significantly attenuated the naturally occurring jumping behavior, in a dosedependent manner (F1,15=19.12) (P<0.001) Administration of 1.0 mg/kg (+) o F 5 P A T resulted in 15 4.0 jumps whereas 3.0 mg/kg (+) o F 5 P A T resulted in 0.3 0.2 jumps in a 10minute session (Figure 6 6 ). This (+) o F 5 P A T induced attenuation in stereotypic jumping behavior was not accompanied by a (+) o F 5 P A T induced alerations in l ocomotor behavoir Locomotor activity in C58/J mice following administration of both doses of (+) o F 5 P A T (1.0 mg/kg and 3.0 mg/kg) was comparable to the locomotor activity of C58/J mice administered vehicle ( Figure 67 ). (+) o F 5 P A T Increases Social Interactions Without Causing Serotonin S yndrome Multiple symptoms of s erotonin syndrome were measured in C57Bl/6 mice following administration of vehicle and 5.6 mg/kg (+) o F 5 P A T Serotonin syndrome symptoms of flat body posture, forepaw treading, head weavings, moon walking, piloerection, Straub tail, tremors were not observed following vehicle or 5.6 mg/kg (+) o F 5 P A T administration. N atural rearing behavior (25 5.3) was reduced following 5.6 mg/kg (+) o F 5 P A T administration (9 3) (P<0.0001), suggestive of 5HT1A activation (Table 45). During the assessment of symptoms of serotonin syndrome following (+)o F 5 P A T administration it was noted that mice after receiving (+) o F 5 P A T displayed increased sociability compared to tho s e receiving ve hicle. During the same six one173

PAGE 174

minute observation session, s mice treated with vehicle engaged in 2.3 0.78 social interactions, whereas mice receiving 5.6 mg/kg (+) o F 5 P A T showed an increased 9.1 2.6 social interactions (P<0.05). Grooming behavior during these sessions was also attenuated following (+) o F 5 P A T administration. Vehi cle treated mice groomed 18 1.8 times whereas 5.6 mg/kg (+) o F 5 P A T treated mice groomed 7 1 times (P<0.05) (Figure 6 8). Discussion The 5 PAT chemical sca ffold has high affinity at both 5 HT7 and 5HT1A receptors and selectivity over other aminergic GPCRs Analogs with ortho halogen substitutions on the 5phenyl ring of the 5 PAT scaffold did not show enhanced 5 HT7 affinity but did demonstrate increase d selectivity for the 5 HT7 receptor over the 5HT1A receptor. Analogs with meta and parahalogenated substitutions did not show increased affinity or selectivity towards the 5HT7 or 5 HT1A receptor s. Electron donating moieties around the 5 phenyl ring also significantly reduced affinity towards the 5HT7 receptor R eplacement of the 5phenyl moiety of 5 PAT with a 5 anthracene moiety abolished 5HT1A affinity (1300 nM) and significantly attenuated 5HT7 affinity (440 nM) compared to the parent 5PAT compound. These data suggest that the region of the orthosteric binding pocket of the 5 HT1A and 5HT7 receptor s that interacts with the 5phenyl moiety of 5 PAT is sterically limited i.e., bulky substitutions around the 5 phenyl moiety reduce 5 HT1A and 5HT7 affinity. Howev er alterations in the length of the alkyl chain attached to the 2 amine of 5 PATs enhanced selectivity towards the 5HT1A receptor displayed by the increased selectivities at the 5HT1A receptor of N,Ndi propyl 5 PAT and (+) N,Ndi propyl o F 5 PAT compared to equivalent N,N di methyl analogs. T hese results 174

PAGE 175

are in accordance with similar 2aminotetralins previously reported ( Holmberg et al., 2004) These data together argue that the orthosteric binding pocket of the 5 HT1A receptor is more accommodating for steric substitutions around the 2amine of the 5PAT scaffold than is the orthosteric binding pocket of the 5HT7 receptor Of the over thirty 5 PAT derivatives synthesized in our laboratory (+)o F 5 P A T shows the highest affinity and potency at the 5 HT7 rece ptor. T hus (+) o F 5 P A T represents the best chemical probe from our synthetic library to characterize the pharmacotherapeutic effect of selective 5 HT7 activity in vivo Administration of (+) o F 5 P A T was shown to be efficacious at attenuating idiopathic stereotypic jumping as well as repetitive behavoirs induced through glutaminergic and serotonergic chemical neuromodulation in a dosedependent manner This suggests (+) o F 5 P A T exhibits behavioral ef fects on stereotypy via partial agonist act ivity at the 5 HT7 and/or 5HT1A receptors. H owever it is noted that the activity of (+) o F 5 P A T at 5 HT2C receptors may additionally contribute to the attenuation of stereotypic behavior (+) o F 5 P A T did not affect locomotor activity on its own following acuta administration or the hyper locomotor activity induced by amphetamine, which suggests that (+) o F 5 P A T is not chiefly working through dopaminergic mechanisms Social interactions between mice were also increased following (+) o F 5 P A T tre atment. E fficacy in the aforementioned in vivo behavior models of stereotypy show s face validity for compounds in the treatment of the core symtoms of ASD (stereotypies and social deficits) Thus (+) o F 5 P A T and possibly fellow 5PAT analogs could have the therapeutic potential as a novel drug candidates for the treatment of the core symptoms of ASD 175

PAGE 176

Figure 61. 5 PAT substituted scaffold Figure 62. Chemical structure of (2S) (+) o F 5 PAT 176

PAGE 177

Figur e 63. (+) o F 5 P A T dosedependently blocks the DOI induced HTR. (+) o F 5 PAT dosedependently blocks the DOI (1.0 mg/kg) induced HTR in C57BL/6J mice similarly to both enantiomers of 8OH DPAT (0.5 mg/kg), while AS 19 attenuates the DOIinduced HTR to a lesser degree. Each data point repres ents the mean SEM of at least 6 different subjects. (****=P<0.0001, **=P<0.01 in comparison with HTRs induced by DOI alone) 177

PAGE 178

A Figure 64. Effect of (+) o F 5 P A T administration on stereotypic rotations and locomotor activity induced by MK 801. Each data point represents the mean SEM of at least 6 different subjects. A) (+) o F 5 PAT (5.6 mg/kg) attenuated stereotypic rotations elicited by MK 801 (0.3 mg/kg) in C57Bl/6J mice. (****=P<0.0001 different from MK 801induced rotations) B) (+) o F 5 P AT (5.6 mg/kg) attenuated the hyperlocomotor behavior elicited by MK 801 (0.3 mg/kg) in C57Bl/6J mice (**=P<0.01, *=P<0.05 different from MK 801 induced locomotor activity) 178

PAGE 179

B Figure 64. Continued 179

PAGE 180

Figure 65. Effec t of (+) o F 5 P A T administration on amphetamineinduced hyper locomotor activity Each data point represents the mean SEM of at least 6 different subjects. (**=P<0.01, different than amphetamine induce locomotor activity) 180

PAGE 181

Figure 66 (+) o F 5 P A T (1 and 3 mg/kg) dose dependently attenuates idiopathic stereotypic jumping in C58/J mice. Each data point represents the mean SEM of at least 6 different subjects. (***=P<0.001, *=P<0.05, different from control mice) Figure 67 (+) o F 5 P A T does not alter locomotor behavior. Data are from stereotypic jumping experim ents with C58/J mice (left) and DOI elicited HTR experiments with C57BL/6J mice ((+)o F 5 PAT plus vehicle treated control group) (right). Each data point represents the mean SEM of a t least 6 different subjects. 181

PAGE 182

Figure 68 (+) o F 5 P A T (5.6 mg/kg) increases social interactions with vehicletreated C57BL/6J mice littermates while subsequently decreasing grooming. Shown are the mean SEM number of s ocial interactions across six 1m in ute observation sessions and mean/6 SEM number of sessions in which mice displayed grooming. Each data point is from at least 6 different subjects. (*=P<0.05 different from vehicle) 182

PAGE 183

Table 61. Binding a ffinity values of 2, 3, 4 halogenated 5PATs at 5 HT7 and 5HT1A GPCRs. Affinity was determined in transiently transfected HEK cell lines expressing protein of interest. Values expressed as mean Ki SEM in nM, from at least three independent experiments. 183

PAGE 184

Table 62. Binding a ffinity values of (+) and o F 5 P A T at select panel of aminergic GPCRs. Table 62. Continued Affinity was determined in transiently transfected HEK cell lines expressing protein of interest. Values expressed as mean Ki SEM in nM, from at least three independent experiments. 184

PAGE 185

Table 63. Binding a ffinity values of 5 and N, N substituted 5PATs at 5 HT7 and 5HT1A GPCRs. Affinity was determined in transiently transfected HEK cell lines expressing protein of interest. Values expressed as mean Ki SEM, in nM, from at least three independent experiments. 185

PAGE 186

Table 64. Functional potency and efficacy values of (+) o F 5 P A T at the 5HT7, 5 HT1A, and 5HT2 GPCRs Values listed in the table are mean EC50 (nM) and Emax (% of 5 HT/AS19 response) SEM from at least three independent experiments. Data was obtained from HEK cells transiently transfected with protein of interest. 186

PAGE 187

Table 65. 5 HT syndrome symptoms were not observed following (+) o F 5 P A T administration Table 65. Continued Values listed in the table are mean number o f events observed during six 1minute sessions. Each data point represents the mean SEM of at least 6 different subjects. 187

PAGE 188

CHAPTER 7 CONCLUSIONS In this dissertation, we evaluated the structure activity relationship of novel phenyl substituted 2 N,N dimethyl 1,2,3,4 tetrahydronaphthalene2 amine analogs of 4 PAT at serotonergic GPCRs. 4 PAT analogs targeted the 5HT2 C receptors, selectively activating 5HT2C receptor mediated IP3 signaling while maintaining antagonism/inverse agonism at the 5HT2A and 5HT2B receptor mediated IP3 signaling pathway Select substitutions were made at the 3, 5 6 and 7 positions of the 4 PAT scaffold aimed to enhance ligand affinity, potency, and efficacy at 5 HT2 C receptors over the 5HT2A, 5 HT2B, and histamine H1 GPCRs. The addition of a single halogen atom (Cl or Br) at the 3 position of the 4PAT scaffold increased ligand affinity, potency, and efficacy at the 5HT2C receptor o over the parent 4PAT whereas th e dual of halogen atom s at both the 3 and 5 position s of the 4PAT scaffold compromised ligand affinity, potency, and efficacy at the 5 HT2C receptor as compared to the parent 4 PAT Additionally, halogenation of the 3 position with a concurrent 6methoxy substitution improved ligand selectivity for the 5 HT2 C over H1 receptors. Efficacy in the DOI induce d HTR, an in vivo model of rodent psychoses, confirm s that lead 4PATs possess preclinical therapeutic properties that, if proven trasnlatable, could be exploited for the treatment of psychotic disorder s such as schizophrenia. Information gained from these experiments further aids in SAR knowledge discriminating between the phylogenetically related 5HT2A, 2B, 2C and H1 GPCRs. A robust desensitizatio n response to the IP3 signaling pathway was observed resulting from prolonged agonist exposure to 5HT2C receptors transiently expressed in CHO cells. Agonis t induced desensitization of 5 HT2C receptor mediated IP3 signaling 188

PAGE 189

corelated with agonist efficacy at the 5HT2C receptor. Yet d iscrete 5 HT2C agonist characteristics such as the rigidity of ring system, steric accessibility of basic nitrogen, and location of hydrogen bond donors also appear to influence the extent of 5 HT2C receptor mediated IP3 desensitization This suggests th at specific agonist induced receptor conformations are preferentially phosphorylated and desensitized, which may represent an exploitable avenue for medicinal chemists to improve therapeutic efficacy of compounds targeting the 5HT2C receptor. This proposition is supported by the attenuation of receptor desenstization following select agonist pretreatments at the point mutant S407A 5HT2C receptor when compared to the WT 5 HT2C receptor, i.e. the S407 a mino acid is crucial in the mechanism of 5HT2C receptor desensitization by discrete agonis t induced conformations of the WT 5HT2C receptor. Additionally 5 HT2C receptor resensitization of IP3 signaling readily occurs in CHO cells resulting from the prol onged exposure to inverse agonists in vitro Atypical antipsychotics sucha s clozapine commonly display inverseagonist activity at the 5HT2C receptor I nverse agonist induced resensitization of the 5 HT2C receptor mediated IP3 signaling could contribute to the negative side effects commonly caused by prolonged antipsychotic use Effects of 5 HT2C receptor de/resensitization were not inevitably observed in vivo in the DOIinduced HTR assay most likely due to off target activities of 5 HT2C ligands at 5 HT2 A and 5 HT1 receptors known to modulate the HTR The 5 PAT chemical scaffold shows high affinity towards the 5HT7 and 5HT1A receptors Discrete s ubstitutions of halogens around the 5phenyl moiety of the 5 PAT scaffold improved selecti vity at the 5HT7 over the 5 HT1A receptor specifically (+) o F 5 P A T (3.7 fold) compared to the unsubstituted 5 PAT (0.7 fold). In contrast, 189

PAGE 190

substitutions at the 2 amine position of the 5PAT scaffol d improved selectivity at the 5 HT1A over 5HT7 receptors, shown by N,N di propyl 5 PAT (6 4 fold) over the N,Ndimethyl parent compound (1.3fold). The lead 5PAT analog, (+) o F 5 P A T was shown to be a potent partial agonist at both the 5HT7 and 5HT1A receptor The in vitro pharmacologic profile displayed by (+) o F 5 P A T was refeleted in its efficacy in three different in vivo models of stereotypy the DOI induced HTR assay the MK 801 induced rotation assay and idiopathic jumping. (+) o F 5 P A T also improved sociability without affecting locomotor behavior Thus (+) o F 5 P A T and other 5PAT analogs display salutary proterties in preclinical models of neurological disorders that, if translatable, would suggest their utility as potential therapeutics for ASD. 190

PAGE 191

APPENDIX A EFFECT OF LIGAND PRETREATMENT ON 5 HT2C CONSTITUTIVE ACTIVITY The 5 HT2C INI receptor used in the present studies displays basal or constitutive activity ( Herrick Davis et al., 1999 ) i.e. this GPCR can activate G protein and stimulate IP3 production independent of agonist ligand. Ligand pretreatment, even after washing, can alter basal constitutive signaling, compared to un treated cells. A representative figure can be seen for both R o 600175 and trans m Br 4 PAT pretreatments (Supplementary Figure 1A and B) This phenomenon been reported previously for DOI at 5 HT2C receptors expressed in CHO cells ( Devlina et al., 2004) For the studies report ed herein, it was found that different 5HT2C ligands differentially modulate 5HT2C receptor basal constitutive IP3 production. To control for this phenomenon when interpreting the effect of ligandinduced 5HT2C receptor de/resensitization on ligand effi cacy, the basal 5HT2C receptor mediated IP3 values of the nondesensitized cells were used to determine the magnitude of ligand efficacy for agonist pretreated, inverseagonist pretreated, and vehiclepretreated conditions (i.e. desensitization, resensit ization, and control Emax values). To determine whether this phenomenon was the result of insufficient drug washout or continued activity of the intracellular PLC signaling cascade, the 5HT2C neutral antagonist, SB 242084, was added in conjunction with agonist/inverse agonist pretreatment. The alteration 5HT2Cmediated IP3 basal signaling resulting from the pretreatment of several agonist and inverse agonists was not blocked by the addition of 100 nM SB 242084, indicating that the agonist stimulated PLC cascade may still be active as a result of ligand pretreatment (i.e., the wash protocol utilized was sufficient) (Supplementary Figure 2 ). 191

PAGE 192

A B Figure A 1 Representative figures of A) Ro 600175 and B) trans m Br 4 PAT induced 5HT2C GCPR desensitization. Cells expressing 5HT2C receptor were treated with 1 hours, washed, then restimulated with differing concentrations of the same agonist (110,000 N M) and compared to non desensitized cells. Control cell basal values in open circles, desensitized basal values in open squares for A) Ro 600175 and B) trans m Br 4 PAT. 192

PAGE 193

Figure A 2 Comparison of b asal values of de /re sensitized 5 HT2C GPCRs. Cells expressing the 5HT2C WT recept or were treated with 100 nM SB 242084 or vehicle 10minutes prior to pretreatment with 1 M of select 5HT2C ligands for 20 hours, then the 5HT2C receptor mediated basal IP3 signaling was compared 193

PAGE 194

APPENDIX B LIST OF PUBLICATIONS RESULTING FROM THE WORK IN THIS DISSERTATION Canal CE, Morgan D, Felsing D, Kondabolu K, Rowland NE, Robertson KL, Sakhuja R, Booth RG (2014). "A Novel AminotetralinType Serotonin (5HT) 2C Receptor Specific Agonist and 5HT2A Competitive Antagonist/5HT2B Inverse Agonist with Preclinical Efficacy for Psychoses." The Journal of Pharmacology and Experimental Therapeutics 349(2): 310318. Canal CE, Felsing DE, Liu Y, Zhu W, Wood, JT, Perry CK, Vemula R, Booth RG (2015). An Orally Active PhenylaminotetralinChemotype Serotonin 5HT7 and 5 HT1A Receptor Partial Agonist That Corrects M otor Stereotypy in Mouse Models. ACS Chemical Neuroscience 6: 12591270. Kondabolu K and Morgan D, Felsing D E Sakhuja, R, Booth RG. A novel serotonin 5HT2C agonist with 5HT2A/2B antagonist/inverse agonist activity for schizophrenia: Characterization of the molecular pharmacology of 4(meta chloro) phenyl N,N, dimethyl 1,2,3,4 tetrahydronaphthalene2 amine and efficacy in three rodent models of psychosis. 2016, in preparation. Sun Z, Canal CE, Kondobolu K, Felsing DE, Travers S, Kim MS, CordovaSintjago T, Booth RG. Novel 4Aryl 6,7 SubstitutedN,NDimethyltetrahydronaphthalen2 amines with Enhanced Selectivit y for Serotonin 5HT2 G Protein Coupled Receptors 2016, in preparation. Felsing DE, Canal CE, Booth RG Ligand d ependent Desensitization and Resensitization of the Serotonin 5HT2C G Protein Coupled Receptor. Neuropsychopharmacoogy. 2016, in preparation. Felsing DE, Canal CE, Booth RG Lorcaserin or Ro 600175 as a more selective tool to study 5HT2C receptor activations in vivo ? A direct comparative study Neuropharmacology. 2016, in preparation. Ambrosini D and Felsing DE Canal CE Booth RG. Synthesis and biological evaluation of novel 4 (substituted phenyl) 2 dimethylaminotetralins as drug candidates for obesity and psychoses 2016, in preparation. 194

PAGE 195

REFERENCES Aan het Rot M, Mathew S, Charney D (2009) Neurobiological mechanisms in major depressive disorder. Canadian Medical Association Journal 180:305313. Absolinova H, Jancar L, Jancarova I, Vicar J, Kuban V (2010) Spectrophotometric study of time stability and acidbase characteristics of chelerythrine and dihydrochelerythrine. Central European Journal of Chemistry 8:626 632. Adan R (2013) Mechanisms underlying current and future anti obesity drugs. Trends in Neurosciences 36:133 140. Ahmed A, Choo H, Cho Y, Park W, Pae A (2009) Identification of novel serotonin 2C receptor ligands by sequential virtual screening. Bioorganic & Medicinal Chemistry 17:45594568. Albert P, Zhou Q, Van Tol H, Bunzow J, Civelli O (1990) Cloning, functional expression, and mRNA tissue distribution of the rat 5Hydroxytryptami nelA receptor gene. The Journal of Biological Chemistry 265:5825 5832. Alemany R, Perona J, Sanchez Dominguez J, Montero E, Canizares J, Bressani R, Escriba P, Ruiz Gutierrez V (2007) G proteincoupled receptor systems and their lipid environment in health disorders during aging. Biochimica et Biophysica Acta 1768:964975. Alex K, Pehek E (2007) Pharmacologic mechanisms of serotonergic regulation of dopamine neurotransmission. Pharmacology & Therapeutics 113:296320. Anis N, Berry S, Burton N, Lodge D (1983) The dissociative anaesthetics, ketamine and phencyclidine, selectively reduce excitation of central mammalian neurones by N methyl aspartate. British Journal of Pharmacology 79:565575. Anji A, Hanley N, Kumari M, Hensler J (2001) The role of protein kin ase C in the regulation of serotonin2A receptor expression. Journal of Neurochemistry 77:589597. Arnt J (1995) Differential effects of classical and newer antipsychotics on the hypermotility induced by two dose levels of D amphetamine. European Journal o f Pharmacology 283:13. Arttamangkul S, Torrecilla M, Kobayashi K, Okana H, Williams J (2006) Separation of mu opioid receptor desensitization and internalization: endogenous receptors in primary neuronal cultures. The Journal of Neuroscience 26:41184125. Axelrod J (1962) The enzymatic N methylation of serotonin and other amines. Journal of Pharmacology and Experimental Therapeutics 138:2833. 195

PAGE 196

Backstrom J, Price R, Reasoner D, Sanders Bush E (2000) Deletion of the serotonin 5HT2C receptor PDZ recognition motif prevents receptor phosphorylation and delays resensitization of receptor responses. The Journal of Biological Chemistry 275:2362023626. Bai B, Wang Y (2010) The use of lorcaserin in the management of obesity: a critical appraisal. Drug Design, Devel opment, and Therapy 5:17. Bard J, Zgombick J, Adham N, Vaysse P, Branchek T, Weinshank R (1993) Cloning of a novel human serotonin receptor (5HT7) positively linked to adenylate cyclase. The Journal of Biological Chemistry 268:2342223426. Barnes N, Shar p T (1999) A review of central 5HT receptors and their function. Neuropharmacology 38:10831152. Beninger RJ (1983) The role of dopamine in locomotor activity and learning. Brain Research Reviews 6:173196. Benovic J, Pike L, Cerione R, Stanieszewski C, Yoshimasa T, Codina J, Caron M, Lefkowitz R (1985) Phosphorylation of the mammalian betaadrenergic receptor by cyclic AMP dependent protein kinase. The Journal of Biological Chemistry 260:70947101. Bentley J, Adams D, Bebbington D, Benwell K, Bickerdike M, Davidson J, Dawson C, Dourish C, Duncton M, Gaur S, George A, Giles P, Hamlyn R, Kennett G, Knight A, Malcolm C, Mansell H, Misra A, Monck N, Pratt R, Quirk K, Roffey R, Vickers S, Cliffe I (2004) Indoline derivatives as 5HT2C receptor agonists. Bioorg anic & Medicinal Chemistry Letters 14:23672770. Berg J, Geschwind D (2012) Autism genetics: searching for specificity and convergence. Genome Biology 13:247262. Berg K, Maayani S, Clarke W (1998) Interactions between effectors linked to serotonin receptors. Annals of the New York Academy of Science 861:111120. Berg K, Stout B, Cropper J, Maayani S, Clarke W (1999) Novel Actions of Inverse Agonists on 5HT2C Receptor Systems. Molecular Pharmaclogy 55:863872. Berg K, Stout B, Maayani S, Clarke W (2001) Differences in rapid desensitization of 5hydroxytryptamine2A and 5hydroxytryptamine2C receptor mediated phospholipase C activation. The Journal of Pharmacology and Experimental Therapeutics 299:593602. Berger M, Gray J, Roth B (2009) The Expanded Biolog y of Serotonin. Annual Review of Medicine 60:355366. 196

PAGE 197

Berry S, Shah M, Khan N, Roth BL (1996) Rapid Agonist Induced Internalization of the 5 Hydroxytrptamine2A Receptor Occurs via the Endosome Pathway In Vitro. Molecular Pharmacology 50:306313. Bhattachar yya S, Puri S, Miledi R, Panicker M (2002) Internalization and recycling of 5HT2A receptors activated by serotonin and protein kinase C mediated mechanisms. Proceedings of the National Academy of Sciences of United States of America 99:14475. Bjarnadottir T, Gloriam D, Hellstrand S, Kristiansson H, Fredriksson R, Schioth H (2006) Comprehensive repertoire and phylogenetic analysis of the G proteincoupled receptors in human and mouse. Genomics 88:263273. Bockaert J, Pin J (1999) Molecular tinkering of G pr oteincoupled receptors: an evolutionary success. The EMBO Journal 18:17231729. Bonhaus D, Weinhardt K, Taylor M, Desouza A, McNeeley P, Szczepanski K, Fontana D, Trinh J, Rocha C, Dawson M, Flippin L, Eglen R (1997) RS 102221: A novel high affinity and s elective, 5HT2C receptor antagonist. Neuropharmacology 36:621629. Booth R, Fang L, Huang Y, Wilczynski A, Sivendran S (2009) (1R, 3S) Trans PAT: A novel full efficacy serotonin 5HT2C receptor agonist with 5HT2A and 5HT2B receptor inverse agonist/ antagonist activity. European Journal of Pharmacology 615:19. Booth R, Moniri N, Bakker R, Choksi N, Nix W, Timmerman H, Leurs R (2002) A novel phenylaminotetralin radioligand reveals a subpopulation of histamine H1 receptors. The Journal of Pharmacology and Experimental Therapeutics 302:328336. Booth R, Owens C, Brown R, Bucholtz E, Lawler C, Wyrick S (1999) Putative sigma3 sites in mammalian brain have histamine H receptor properties: evidence from ligand binding and distribution studies with the novel H1 radiioligand [3H] ( ) trans 1 phenyl 3 aminotetralin. Brain Research 837:95105. Bourne HR (1997) How receptors talk to trimeric G proteins. Current Opinion in Cell Biology 9:134142. Brake P, Lanahan A, O'Brien R, Roche K, Barnes C, Huganir R, Worley P (1997) Homer: a protein that selectively binds metabotropic glutamate receptors. Nature 386:284288. Bray J, Goddard WI (2008) The structure of human serotonin 2c G proteincoupled receptor bound to agonists and antagonists. Journal of Molceular Graphics and Modelling 27:6681. 197

PAGE 198

Breier A, Su T, Saunders R, Carson R, Kolachana B, De Bartolomeis A, Weinberger D, Weisenfeld N, Malhotra A, Eckelman W, Picklar D (1997) Schizophrenia is associated with elevated amphetamineinduced synaptic dopamine concentrations: Evidence from a novel positron emission tomography method. Proceedings of the National Academy of Sciences of United States of America 94:25692574. Bubar M, Cunningham K (2006) Serotonin 5HT2A and 5HT2C receptors as potential targets for modulation o f psychostimulant use and dependence. Current Topics in Medicinal Chemistry 6:19711985. Bubar M, Cunningham K (2007) Distribution of serotonin 5HT2C receptors in the ventral tegmental area. Neuroscience 146:286297. Bubar M, Cunningham K (2008) Prospects for serotonin 5HT2R pharmacotherapy in psychostimulant abuse. Progress in Brain Research 172:319346. Burns C, Chu H, Rueter S, Hutchinson L, Canton H, Sanders Bush E, Emerson R (1997) Regulation of serotonin2C receptor G protein coupling by RNA editing Letters to Nature 387:303308. Canal C, Booth R, Morgan D (2013a) Support for 5HT2C receptor functional selectivity in vivo utilizing structurally diverse, selective 5HT2C receptor ligands and the 2,5 dimethoxy 4 iodoamphetamine elicited headtwitch re sponse model. Neuropharmacology 70:112121. Canal C, CordovaSintjago T, Liu Y, Kim M, Morgan D, Booth R (2013b) Molecular pharmacology and ligand docking studies reveal a single amino acid difference between mouse and human serotonin 5HT2A receptors that impacts behavioral translation of novel 4phenyl 2 dimethylaminotetralin ligands. The Journal of Pharmacology and Experimental Therapeutics 347:705716. Canal C, CordovaSintjago T, Villa N, Fang L, Booth R (2011a) Drug discovery targeting human 5HT2C re ceptors: Residues S3.36 and Y7.43 impact ligand binding pocket structure via hydrogen bond formation. European Journal of Pharmacology 673:112. Canal C, Morgan D (2012) Headtwitch response in rodents induced by the hallucinogen 2,5dimethoxy 4 iodoamphet amine: a comprehensive history, a reevaluation of mechanisms, and its utility as a model. Drug Test Analysis 4:556576. Canal C, Morgan D, Booth R (2011b) A novel, functionally selective serotonin 2 receptor ligand blocks putative psychotomimetic effects of () 2,5 dimethoxy 4 iodoamphetamine in mice. The College on Problems of Drug Dependence Annual Meeting, Hollywood, Florida 2011. 198

PAGE 199

Canal C, Morgan D, Felsing D, Kondabolu K, Rowland N, Robertson K, Sakhuja R, Booth R (2014) A novel aminotetralintype serotonin (5HT) 2C receptor specific agonist and 5HT2A competitive antagonist/5HT2B inverse agonist with preclinical efficacy for psychoses. The Journal of Pharmacology and Experimental Therapeutics 349:310318. Canal C, Olaghere da Silva U, Gresch P, Watt E, Sanders Bush E, Airey D (2010) The serotonin 2C receptor potently modulates the headtwitch response in mice induced by a phenethylamine hallucinogen. Psychopharmacology 209:163174. Caron M, Blouin J, Gauthier N, Roby P, Beaudet L, Padros J (2010) Meas uring performance of an automated and miniaturized LANCE ultra cAMP assay for the Gi coupled 5HT1A receptor a comparative study. PerkinElmer, Inc Montreal, QC, Canada H3J 1R4 https://www.perkinelmer.com/lab solutions//resources/docs/APP_C67838009120A_01.pdf Carr RI, Du Y, Quoyer J, Panettieri R, Janz J, Bouvier M, Kobilka B, Benovic J (2014) Development and characterization of pepducins as Gs biased allosteric agonists. The Journal of Biological Chemistry 289:3566835684. Celada P, Puig V, Artigas F (2004) The therapeutic role of 5HT1A and 5 HT2A receptors in depression. Journal of Psychiatry and Neuroscience 29:252265. Chan E, He Y, Chui C, Wong A, Lau W, Wong I (2013) Efficacy and safety of lorcaserin in obese adults: a metaanalysis of 1year randomized controlled trials (RCTs) and narrative review on short term RCTs. Obesity Reviews 14:383392. ChouGreen J, Holscher T, Dallman M, Akana S (2003) Compuls ive behavior in the 5HT2C receptor knockout mouse. Physiology & Behavior 78:641649. Chuang T, Iacovelli L, Sallese M, De Blasi A (1996) G proteincoupled receptors: heterologous regulation of homologous desensitization and its implications. Trends in Pharmacological Sciences 17:416421. Chugani D, Chugani H, Wiznitzer M, Parikh S, Evans P, Hansen R, Nass R, Janisse J, Dixon Thomas P, Behen M, Rothermel R, Parker J, Kumar A, Muzik O, Edwards D, Hirtz D (2015) Efficacy of low dose buspirone for restricted a nd repetitive behavior in young children with autism spectrum disorder: a randomized trial. The Journal of Pediatrics 170:4553. Toxicolgy 37:167203. Clifton P, Lee M, Douri sh C (2000) Similarities in the action of Ro 60 0175, a 5HT2C receptor agonist, and d fenfluramine on feeding patterns in the rat. Psychopharmacology 152:256267. 199

PAGE 200

Closse A (1983) [3H]Mesulergine, a selective ligand for serotonin2 receptors. Life Sciences 32:24852495. Cole SO (1978) Brain mechanisms of amphetamineinduced anorexia, locomotion, and stereotypy: a review Neuroscience & Biobehavioral Reviews 2:89100. Cong M, Perry S, Lin F, Fraser I, Hu L, Chen W, Pitcher A, Scott J, Lefkowitz R (2001) Regul ation of Membrane Targeting of the G Proteincoupled Receptor Kinase 2 by Protein Kinase A and Its Anchoring Protein AKAP79. The Journal of Biological Chemistry 276:1519215199. Conn P, Christopoulos A, Lindsley C (2009) Allosteric modulators of GPCRs: a novel approach for the treatment of CNS disorders. Nature Reviews Drug Discovery 8:4154. Conn P, Sanders Bush E (1987) Relative efficacies of piperazines at the phosphoinositide hydrolysis linked serotonergic (5HT 2 and 5HT 1C) receptors. The Journal of Pharmacology and Experimental Therapeutics 242:552557. CordovaSintjago T, Sakhuja R, Kondabolu K, Canal C, Booth R (2012a) Molecular determinants for ligand binding at serotonin 5HT2A and 5HT2C GPCRs: experimental affinity results analyzed by molecular modeling and ligand docking studies. International Journal of Quantum Chemistry 112:38073814. CordovaSintjago T, Villa N, Canal C, Booth R (2012b) Human serotonin 5HT2C G proteinligan d docking and mutagenesis studies. International Journal of Quantum Chemistry 1:121. CordovaSintjago T, Villa N, Fang L, Booth R (2014) Aromatic interactions impact ligand binding and function at serotonin 5HT2C G proteincoupled receptors: Receptor hom ology modeling, ligand docking, and molecular dynamics results validated by experimental studies. Molecular Physics 112:398407. Crawley JN (2007) Mouse behavioral assays relevant to the symptoms of autism. Symposium: Neurobiology of Autism 17:448459. Cus sac D, NewmanTancredi A, Quentric Y, Carpentier N, Poissonnet G, Parmentier J, Coldstein S, Millan M (2002) Characterization of phospholipase C activity at h5HT2C compared with h5HT2B receptors: influence of novel ligands upon membrane bound levels of [ 3H]phosphatidylinositols. Naunyn Schmiedebergs Archives of Pharmacology 365:242252. Darmani NA (1998) Cocaine and selective monoamine uptake blockers (Sertraline, Nisoxetine, and GBR 12935) prevent the dfenfluramine induced headtwitch response in mice. Pharmacology Biochemistry and Behavior 60:8390. 200

PAGE 201

De Deurwaerdere P, Navailles S, Berg K, Clarke W, Spampinato U (2004) Constitutive activity of the serotonin2C receptor inhibits in vivo dopamine release in the rat striatum and nucleus accumbens. The Journa l of Neuroscience 24:32353241. De Filippis B, Nativio P, Fabbri A, Ricceri L, Adriani W, Lacivita E, Leopoldo M, Passarelli F, Fuso A, Laviola G (2014) Pharmacological stimulation of the brain serotonin receptor 7 as a novel therapeutic approach for rett syndrome. Neuropsychopharmacology 39:25062518. De Lean A, Stadel J, Lefkowitz R (1980) A ternary complex model explains the agonist specific inding properties of the adenylate cyclasecoupled betaadrenergic receptor. The Journal of Biological Chemistry 255:71067117. Dennis EA (1994) Diversity of group types, regulation, and function of phospholipase A2. The Journal of Biological Chemistry 269:1305713060. Devlina M, Smith N, Ryan O, Guida E, Sexton P, Christopoulos A (2004) Regulation of serotonin 5HT2C receptors by chronic ligand exposure. European Journal of Pharmacology 498:5969. Di Giovanni G, De Deurwaerdere P, Di Mascio M, Di Matteo V, Espositio E, Spampinato U (1999) Selective blockade of serotonin2C/2B receptors enhances mesolimbic and mesostriatal dopaminergic function: a combined in vivo electrophysiological and microdialysis study. Neuroscience 91:587597. Di Matteo V, Di Giovani G, Di Mascio M, Esposito E (1998) Selective blockade of serotonin2C/2B receptors enhances dopamine release in the rat nucleus accumbens. Neuropharmacology 37:265272. Di Matteo V, Di Giovani G, Di Mascio M, Esposito E (1999) SB 242 084, a selective serotonin2C receptor antagonist, increases dopaminergic transmission in the mesolimbic system. Neuropharmacology 38:11951205. Di Matteo V, Di Giovanni G, Di Mascio M, Esposito E (2000) Biochemical and electrophysiological evidence that Ro 600175 inhibits mesolimbic dopaminergic function through serotonin2C receptors. Brain Research 865:8590. Doly S, Valjent E, Set ola V, Callebert J, Herve D, Launay J, Maroteaux L (2008) Serotonin 5HT2B receptors are required for 3,4methylenedioxymethamphetamineinduced hyperlocomotion and 5HT release in vivo and in vitro. The Journal of Neuroscience 28:29332940. Doss R, Perkins J, Harden T (1981) Recovery of betaadrenergic receptors following long term exposure of astrocytoma cells to catecholamine: role of protein synthesis. The Journal of Biological Chemistry 256:1228112286. Downes G, Gautam N (1999) The G protein subunit gene families. Genomics 62:544 552. 201

PAGE 202

Dracheva S, Chin B, Haroutunian V (2008) Altered serotonin 2C receptor RNA splicing in suicide: association with editing. Molecular Neuroscience 19:379382. Drews J (2000) Drug discovery: a historical perspective. Science 287:1960 1964. Eglen R, Jasper J, Chang D, Martin G (1997) The 5HT7 receptor: orphan found. Trends in Pharmacological Sciences 18:104107. Elangbam C, Job L, Zadrozny L, Barton J, Yoon Y, Gates L, Slocum N (2008) 5Hydroxytryptamine (5HT) induced valvulopathy: Compositional valvular alterations are associated with 5HT2B receptor and 5HT transporter transcript changes in SpragueDawley rats. Experimental and Toxicological Pathology 60:253262. Evron T, Daigle T, Caron M (2012) GRK2: multiple roles beyond G proteincoupled receptor desensitization. Trends in Pharmacological Sciences 33:154164. Fan G, Shumay E, Wang H, Malbon C (2001) The scaffold protein gravin (cAMP dependent Protein Kinaseadrenergic receptor via the rec eptor cytoplasmic Arg 329 to Leu413 domain and provides a mobile scaffold during desensitization. The Journal of Biological Chemistry 276:2400524014. FDA (2008) Advair Diskus, Advair HFA, Brovana, Foradil, Perforomist, Serevent Diskus, and Symbicort Information (Long Acting Beta Agonists). (Research, C. f. D. E. a., ed) http://www.fda.gov/Drugs/DrugSafety/PostmarketDrugSafetyInformatio nforPatientsandP roviders/ucm108111.htm Fitzgerald L, Burn T, Brown B, Patterson J, Corjay M, Valentine P, Sun J, Link J, Abbaszade I, Hollis J, Largent B, Hartig P, Hollis G, Meunier P, Robichaud A, Robertson D (2000) Possible role of valvular serotonin 5HT2B receptors in the cardiopathy associated with fenfluramine. Molecular Pharmaclogy 57:7581. Fitzgerald L, Iyer G, Conklin D, Krause C, Marshall A, Patterson J, Tran D, Jonak G, Hartig P (1999) Messenger RNA editing of the human serotonin 5HT2C recept or. Neuropsychopharmacology 21:82S 90S. Fletcher A, Forster E, Bill D, Brown G, Cliffe I, Hartley J, Jones D, McLenachan A, Stanhope K, Critchley D, Childs K, Middlefells V, Lanfumey L, Corradetti R, Laporte A, Gozlan H, Hamon M, Dourish C (1996) Electrophysiological, biochemical, neurohormonal and behavioural studies with WAY 100635, a potent, selective and silent 5HT1A receptor antagonist. Behavioural Brain Research 73:337353. Fletcher P, Soko A, Higgins G (2013) Impulsive action in the 5choice serial reaction time test in 5 HT2C receptor null mutant mice. Psychopharmacology 226:561570. 202

PAGE 203

Fletcher P, Tampakeras M, Sinyard J, Slassi A, Issac M, Higgins G (2009) Characterizing the effects of 5HT2C receptor ligands on motor activity and feeding behaviour i n 5HT2C receptor knockout mice. Neuropharmacology 57:259267. Forbes I, Kennet G, Gadre A, Ham P, Hayward C, Martin R, Thompson M, Wood M, Baxter G, Glen A, Murphy O, Stewart B, Blackburn T (1993) N ( l Methyl 5 indolyl) N' (3 pyridy1)urea Hydrochloride: the first selective 5HT1C receptor antagonist Journal of Medicinal Chemistry 36:11041107. Ford L, Norman A, Sanbe P (1989) The topography of MK 801 induced locomotor patterns in rats. Physiology & Behavior 46:755758. Gershon M, Tack J (2007) The serotonin signaling system: from basic understanding to drug development for functional GI disorders. Reviews in Basic and Clinical Gastroenterology 132:397414. Gether U, Lin S, Ghanouni P, Ballesteros J, Weinstein H, Kobilka B (1997) Agonists induce conformati adrenoceptor. The EMBO Journal 16:67376747. Ghosh A, Michalon A, Lindeman L, Fontoura P, Santarelli L (2013) Drug discovery for autism spectrum disorder: challenges and opportunities. Nature Reviews Drug Discovery 12:777790. Gibson E, Kennedy A, Curzon G (1993) dFenfluramine and dnorfenfluramineinduced hypophagia: differential mechanisms and involvement of postsynaptic 5HT receptors. European Journal of Pharmacology 242:8390. Gimenez L, Baar neur F, Vayttaden S, Clark R (2015) Salmeterol efficacy and bias in the activation and kinasemediated desensitization of Beta2adrenergic receptors. Molecular Pharmaclogy 87:954964. Gonzalez Maeso J, Weisstaub N, Zhou M, Chan P, Ivic L, Ang R, Lira A, Br adley Moore M, Ge Y, Zhou Q, Sealfon S, Gingrich J (2007) Hallucinogens recruit specific cortical 5 HT2A receptor mediated signaling pathways to affect behavior. Neuron 53:439452. Goodman O, Krupnick J, Santini F, Gurevich V, Penn R, Gagnon A, Keen J, Benovic J (1996) Betaarrestin acts as a clathrin adaptor in endocytosis of the beta2adrenergic receptor. Nature 383:447450. Gray J, ComptonToth B, Roth B (2003) Identification of two serine residues essential for agonist induced 5HT2A receptor desensitization. Biochemistry 42:1085310862. Gray J, Roth B (2001) Paradoxical trafficking and regulation of 5HT2A receptors by agonists and antagonists. Brain Research Bulletin 56:441451. 203

PAGE 204

Gray J, Sheffler D, Bhatnagar A, Woods J, Hufeisen S, Benovic J, Roth BL (2001) Cell type specific effects of endocytosis inhibitors on 5hydroxytryptamine(2A) receptor desensitization and resensitization reveal an arrestin, GRK2 and GRK5 independent mode of regulation in human embryonic kidney 293 cells. Mol Pharma col 60:10201030. Gresset A, Sondek J, Harden T (2012) The phospholipase C isozymes and their regulation. Subcellular Biochemistry 58:6194. Grotewiel M, Sanders Bush E (1999) Differences in agonist independent activity of 5HT2A and 5HT2c receptors revealed by heterologous expression. Naunyn Schmiedebergs Archives of Pharmacology 359:2127. Gruenberg J, Maxfield F (1995) Membrane transport in the endocytotic pathway. Current Opinion in Cell Biology 7:552563. Guillery R, Sherman S (2002) The thalamus as a monitor of motor outputs. Philosophical Translations of the Royal Society of London 357:1809 1821. Gurevich V, Gurevich E (2006) The structural basis of arrestinmediated regulation of G proteincoupled receptors. Pharmacology & Therapeutics 110:465502 Gustafson E, Durkin M, Bard J, Zgombick J, Branchek T (1996) A receptor autoradiographic and in situ hybridization analysis of the distribution of the 5HT7 receptor in rat brain. British Journal of Pharmacology 117:657666. Haberzettl R, Fink H, Bert B (2014) Role of 5HT1A and 5HT2A receptors for the murine model of the serotonin syndrome. Journal of Pharmacological and Toxicological Methods 70:129133. Hagan J, Price G, Jeffrey P, Deeks N, Stean T, Piper D, Smith M, Upton N, Medhurst A, Middlemiss D, Riley G, Lovell P, Bromidge S, Thomas D (2000) Characterization of SB 269970A, a selective 5HT7 receptor antagonist. British Journal of Pharmacology 130:539548. Halford J, Harrold J, Boyland E, Lawton C, Blundell J (2007) Serotonergic drugs : effects o n appetite expression and use for the treatment of obesity. Drugs 67:2755. scaffold proteins. Circulation Research 91:672680. HarveyLewis C, Li Z, Higgins G, Fletcher P (2016) The 5HT2C receptor agonist lorcaserin reduces cocaine self administration, reinstatement of cocaineseeking and cocaine induced locomotor activity. Neuropharmacology 101:237 245. 204

PAGE 205

Hausdorff W, Caron M, Lefkowitz R (1990) Turning off the signal: desensi tization of Beta Adrenergic receptor function. Federation of American Societies for Experimental Biology 4:28812889. Hedlund P, Leopoldo M, Caccia S, Sarkisyan G, Fracasso C, Martelli G, Lacivita E, Berardi F, Perrone R (2010) LP 211 is a brain penetrant selective agonist for the serotonin 5HT7 receptor. Neuroscience Letters 48:1216. Hedlund PB (2009) The 5HT7 receptor and disorders of the nervous system: an overview. Psychopharmacology 206:345354. Heinz A, Schlagenhauf F (2010) Dopaminergic dysfunction in schizophrenia: salience attribution revisited. Schizophrenia Bulletin 36:472485. Heisler L, Cowley M, Tecott L, Fan W, Low M, Smart J, Rubinstein M, Tatro J, Marcus J, Holstege H, Lee C, Cone R, Elmquist J (2002) Activation of central melanocortin pa thways by fenfluramine. Science 297:609611. Henley J, Cao H, McNiven M (1999) Participation of dynamin in the biogenesis of cytoplasmic vesicles. Federation of American Societies for Experimental Biology 13:S243S247. Herbert J, Augereau J, Gleye J, Maggr and J (1990) Chelerythrine is a potent and specfic inhibitor of protein kinase C. Biochemical and Biophysical Research Communications 172:993999. Herrick Davis K, Grinde E, Mazurkiewicz J (2004) Biochemical and biophysical characterization of serotonin 5HT2C receptor homodimers on the plasma membrane of living cells. Biochemistry 43:139630113971. Herrick Davis K, Grinde E, Niswender C (1999) Serotonin 5HT2C receptor RNA editing alters receptor basal activity: implications for serotonergic signal transduction. Journal of Neurochemistry 73:17111717. Herrick Davis K, Grinde E, Teitler M (2000) Inverse agonist activity of atypical antipsychotic drugs at human 5hydroxytryptamine2C receptors. The Journal of Pharmacology and Experimental Therapeutics 295:226232. Higgins G, Sellers E, Fletcher P (2013) From obesity to substance abuse: therapeutic opportunities for 5HT2C receptor agonists. Trends in Pharmacological Sciences 34:560570. Higgins G, Silenieks L, Rossmann A, Rizos Z, Noble K, Soko A, Fletcher P (2 012) The 5 HT2C receptor agonist lorcaserin reduces nicotine self administration, discrimination, and reinstatement: relationship to feeding behavior and impulse control. Neuropsychopharmacology 37:11771191. 205

PAGE 206

Hjorth S, Carlsso A, Lindberg P, Sanchez D, Wik strom H, Arvidsson L, Hacksell U, Nilsson J (1982) 8Hydroxy 2 (di n propylamino)tetralin, 8OH DPAT, a potent and Sselective implified ergot congener with central 5HT receptor stimulating activity. Journal of Neural Transmission 55:169188. Holmberg P, S ohn D, Leideborg R, Caldirola P, Zlatoidsky P, Hanson S, Mohell N, Rosqvist S, Nordvall G, Johansson A, Johansson R (2004) Novel 2aminotetralin and 3aminochroman derivatives as selective serotonin 5HT7 receptor agonists and antagonists. Journal of Medic inal Chemistry 47:39273930. Howes O, Kambeitz J, Kapur S (2012) The nature of dopamine dysfunction in schizophrenia and what this means for treatment. Archives of General Psychiatiry 69:776786. Inglese J, Freedman N, Koch W, Lefkowitz R (1993) Structure and mechanism of G proteincoupled receptor kinases The Journal of Biological Chemistry 268:2373523738. Jahnichen S, Glusa E, Pertz H (2005) Evidence for 5HT2B and 5 HT7 receptor mediated relaxation in pulmonary arteries of weaned pigs. Naunyn Schmiedebergs Archives of Pharmacology 371:8998. Janssen P, Prins N, Moreaux B, Meulemans A, Lefebvre R (2005) Characterization of 5 HT7 receptor mediated gastric relaxation in conscious dogs. American Journal of Physiology and Gastrointestinal and Liver Physiology 289:G108G115 Javitt D, Zukin S (1991) Recent advances in the phencyclidine model of schizophrenia. The American Journal of Psychiatry 148:1301 1308. Jensen N, Cremers T, Sotty F (2010) Therapeutic potential of 5HT2C receptor ligands. The Scientific Wor lds Journal 10:18701885. Johnson E, Oldfield S, Braksator E, Gonzalez Cuello A, Couch D, Hall K, Mundell S, Bailey C, Kelly E, Henderson G (2006) Agonist selective mechanisms of muopioid receptor desensitization in human embryonic kidney 293 Cells. Molec ular Pharmaclogy 70:676685. Jordan L, Liu J, Hedlund P, Akay T, Pearson K (2008) Descending command systems for the initiation of locomotion in mammals. Brain Research Reviews 57:182191. Julius D, Huang K, Livelli T, Axel R, Jessell T (1990) The 5HT2 rec eptor defines a family of structurally distinct but functionally conserved serotonin receptors. Neurobiology 87:928932. Kagaya A, Mikuni M, Kusumi I, Yamamoto H, Takahashi K (1990) Serotonininduced acute resensitization receptors in human platelets via a mechanism involving protein kinase C. The Journal of Pharmacology and Experimental Therapeutics 255:305311. 206

PAGE 207

Kelly E, Bailey C, Henderson G (2008) Agonist selective mechanisms of GPCR desensitization. British Journal of Pharmacology 153:379388. Kenakin T (2004) Principles: Receptor theory in pharmacology. Trends in Pharmacological Sciences 25:186192. Kennett G, Trail B, Bright F (1998) Anxiolytic like actions of BW 723C86 in the rat Vogel conflict test are 5 HT2B receptor mediated. Neuropharmacology 37:1603 1610. Kennett G, Wood M, Bright F, Cilia J, Piper D, Gager T, Thomas D, Baxter G, Forbes I, Ham P, Blackburn T (1996) In vitro and in vivo profile of SB 206553, a potent 5HT2C/5 HT2B receptor antagonist with anxiolytic like properties. British Journal of Pharmacology 117:427434. Kennett G, Wood M, Bright F, Trail B, Riley G, Holland V, Avenell K, Stean T, Upton N, Bromidge S, Forbes I, Brown A, Middlemiss D, Blackburn T (1997) SB 242084, a selective and brain penetrant 5HT2C receptor antagonist. Neur opharmacology 36:609620. Kimura Y, Hatanaka K, Naitou Y, Maeno K, Shimada I, Koakutsu A, Wanibuchi F, Yamaguchi T (2004) Pharmacological profile of YM348, a novel, potent and orally active 5HT2C receptor agonist. European Journal of Pharmacology 483:374 3. Knight A, Misra A, Quirk K, Benwell K, Revell D, Kennett G, Bickerdike M (2004) Pharmacological characterisation of the agonist radioligand binding site of 5HT2A, 5 HT2B and 5HT2C receptors. NaunynSchmiedebergs Archives of Pharmacology 370:114123. Ko J, Arvidsson U, Williams F, Law P, Elde R, Loh H (1999) Visualization of timedependent redistribution of D opioid receptors in neuronal cells during prolonged agonist exposure. Molecular Brain Research 69:171185. Kobilka B, Frielle T, Collins S, Yang Feng T, Kolbilka T, Francke U, Lefkowitz R, Caron M (1987) An intronless gene encoding a potential member of the family of receptors coupled to guanine nucleotide regulatory proteins. Letters to Nature 329:7579. Kristiansen K (2004) Molecular mechanisms o f ligand binding, signaling, and regulation within the superfamily of G proteincoupled receptors: molecular modeling and mutagenesis approaches to receptor structure and function. Pharmacology & Therapeutics 103:2180. Krobert K, Bach T, Syversveen T, Kvi ngedal A, Levy F (2001) The cloned human 5HT7 receptor splice variants: a comparative characterization of their pharmacology, function and distribution. NaunynSchmiedeberg's Archives of Pharmacology 363:620632. 207

PAGE 208

Krupnick J, Benovic J (1998) The role of r eceptor kinases and arrestins in G proteincoupled receptor regulation. Annual Review of Pharmacology and Toxicolgy 38:289319. Kuhn H, Hall S, Wilden U (1984) Light induced binding of 48kDa protein to photoreceptor membranes is highly enhanced by phosphorylation of rhodopsin. Federation of European Biochemical Societies 176:473478. Lam D, Przydzial M, Ridley S, Yeo G, Rochford J, O'Rahilly S, Heisler L (2008) Serotonin 5HT2C receptor agonist promotes hypophagia via downstream activation of melanocortin 4 receptor. Endrocrinology 149:13231328. Launay J, Herve P, Peoc'h K, Tournois C, Callebert J, Nebigil C, Etienne N, Drouet L, Humbert M, Simonneau G, Maroteaux L (2002) Function of the serotonin 5hydroxytryptamine 2B receptor in pulmonary hypertension. Nature Medicine 8:112911135. Lejeune F, NewmanTancredi A, Audinot V, Millan J (1997) Interactions of (1) and (2) 8 and 7hydroxy 2 (di n propylamino)tetralin at human (h)D3, hD2 and h serotonin1A receptors and their modulation of the activity of serotoninergic and dopaminergic neurones in rats. The Journal of Pharmacology and Experimental Therapeutics 280:1241 1249. Leopoldo M, Berardi F, Colabufo N, Contino M, Lacivita E, Perrone R, Tortorella V (2004) Studies on 1arylpiperazine derivatives with affinity for rat 5 HT7 and 5HT1A receptors. Journal of Pharmacy and Pharmcology 56:247255. Leopoldo M, Lacivita E, Berardi F, Perrone R, Hedlund P (2011) Serotonin 5HT7 receptor agents: Structureactivity relationships and potential therapeutic applications in central nervous system disorders. Journal of Pharmacology and Experimental Therapeutics 129:120148. Lesch K, Poten B, Shnle K, Schulte H (1990) Pharmacology of the hypothermic response to 5HT1A receptor activation in humans. European Journal of Clinical Pharmacology 39:1719. Li J, Xiang B, Su W, Zhang X, Huang Y, Ma L (2003) Agonist induced formation of opioid receptor G proteincoupled receptor kinase (GRK) G beta gamma complex on membrane is required for GRK2 function in vivo. The Journal of Biological Chemistry 278:3021930226. Liu Y, SantiagoCordova T, Canal C, Booth R (2016) Molecular determinants of the PAT binding. Molecular Pharmacology. Lohse M, Benovic J, Codina J, Caron M, Lefkowitz R (1990) Betaarrestin: a protein that regulates beta adrenergic receptor function. Science 248:1547 1550. 208

PAGE 209

Lovell P, Bromidge S, Dabbs S, Duckworth D, Forbes I, Jennings A, King F, Middlemiss D, Rahman S, Saunders D, Collin L, Hagan J, Riley G, Thomas D (2000) A novel, potent, and selective 5HT7 antagonis t: (R) 3 (2 (2 (4 methylpiperidin1 yl) ethyl)pyrrolidine1 sulfonyl)phenol (SB 269970). Journal of Medicinal Chemistry 43:342345. Luttrell L, Gesty Palmer D (2010) Beyond desensitization: physiological relevance of arrestin dependent signaling. Pharmacological Reviews 62:305330. Lyon A, Taylor V, Tesmer J (2014) Strike a pose: Gaq complexes at the membrane. Trends in Pharmacological Sciences 35:2330. Malbon CC (2005) G proteins in development. Nature Reviews Molecular Cell Biology 6:689701. Mancia F, Assur Z, Herman A, Siegel R, Hendrickson W (2008) Ligand sensitivity in dimeric associations of the serotonin 5HT2C receptor. EMBO Reports 9:363369. Manning G, Whyte D, Martinez R, Hunter T, Sudarsanam S (2002) The protein kinase complement of the human g enome. Science 298:19121934. Marion S, Weiner D, Caron M (2004) RNA editing induces cariation in desensitization and trafficking of 5hydroxytryptamine 2C receptor isoforms. The Journal of Biological Chemistry 279:29452954. Martin J, Bos M, Jenck F, Koheler C, Moreau J, Sleight A, Stadler H, Wichmann J (1995) 5HT2C receptor agonists and antagonists in animal models of anxiety. European Neuropsychopharmacology 5:209. Martin J, Bos M, Jenck F, Moreau J, Mutel V, Sleight A, Wichmann J, Andrews J, Berendsen H Broekkamp C, Ruigt G, Kohler C, Van Delft A (1998) 5HT2C receptor agonists: pharmacological characteristics and therapeutic potential. The Journal of Pharmacology and Experimental Therapeutics 286:913924. Matthys A, Haegeman G, Craenenbroeck K, Vanhoenacker P (2011) Role of the 5HT7 receptor in the central nervous system: from current status to future perspectives. Molecular Neurobiology 43:228253. Meanwell NA (2011) Synopsis of some recent tactical application of bioisosteres in drug design. Journal of Medicinal Chemistry 54:25292591. Moran A, Ortiz de Urbina A, Martin M, Gafcia M, Rodriguez Barbero A, Dorado F, Roman L (2008) Characterization of contractile 5hydroxytryptamine receptor subtypes in the in situ autoperfused kidney in the anaesthetized rat. European Journal of Pharmacology 592:133137. 209

PAGE 210

Moy S, Nadler J, Young N, Nonneman R, Grossman A, Murphy D, D'Ercole J, Crawley J, Magnuson T, Lauder J (2009) Social approach in genetically engineered mouse lines relevant to autism. Genes, Brain and Be havior 8:129142. Moy S, Riddick N, Nikolova V, Teng B, Agster K, Nonnemnan R, Young N, Baker L, Nadler J, Bodfish J (2014) Repetitive behavior profile and supersensitivity to amphetamine in the C58/J mouse model of autism. Behavioural Brain Research 259:200214. Nagatomo T, Rashid M, Muntasir H, Komiyama T (2004) Functions of 5HT2A receptor and its antagonists in the cardiovascular system. Pharmacology & Therapeutics 104:5981. Neves S, Ram P, Iyengar R (2002) G protein pathways. Science 296:16361639. Nichols D (2004) Hallucinogens. Pharmacology & Therapeutics 101:131181. Nienaber J, Tachibana H, Prasad S, Esposito G, Wu D, Mao L, Rockman H (2003) Inhibition of receptor adrenergic receptor function and ameliorates press ure overload heart failure. The Journal of Clinical Investigation 112:1067 1079. Nilsson BM (2006) 5Hydroxytrptamine 2C(5HT2C) receptors agonists as potential antiobesity agents. Journal of Medicinal Chemistry 49:40234034. O'Dowd B, Hnatowich M, Caron M Lefkowitz R, Bouvier M (1989) Palmitoylation of the human B2adrenergic receptor. The Journal of Biological Chemistry 264:75647569. Okada M, Northup J, Ozaki N, Russel J, Linnoila M, Goldman D (2004) Modification of human 5HT2C receptor function by Cys 23Ser, an abundant, naturally occurring amino acid substitution. Molecular Psychiatry 9:5564. Olaghere da Silva U, Morabito M, Canal C, Airey D, Emeson R, Sanders Bush E (2010) Impact of RNA editing on functions of the serotonin 2C receptor in vivo. Front iers in Neuroscience 4:110. Oldham W, Hamm H (2008) Heterotrimeric G protein activation by G proteincoupled receptors. Nature Reviews Molcular Cell Biology 9:6071. Pazos A, Cortes R, Palacios J (1985) Quantitative autoradiographic mapping of serotonin r eceptors in the rat brain. II. Serotonin2 receptors. Brain Research 346:231249. Pazos A, Hoyer D, Palacios J (1984a) The binding of serotonergic ligands to the porcine choroid plexus: characterization of a new type of serotonin recognition site. European Journal of Pharmacology 106:539546. 210

PAGE 211

Pazos A, Hoyer D, Palacios J (1984b) Mesulergine, a selective serotonin2 ligand in the rat cortex, does not label these receptors in porcine and human cortex: evidence for species differences in brain serotonin2 rece ptors. European Journal of Pharmacology 106:531538. Pazos A, Probst A, Palacios J (1987) Serotonin receptors in the human brain--III. Autoradiographic mapping of serotonin1 receptors. Neuroscience 21:97122. Pearse B, Smith C, Owen D (2000) Clathrin coat construction in endocytosis. Current Opinion in Structural Biology 10:220228. Peng X, Frohman M (2012) Mammalian phospholipase D physiological and pathological roles. Acta Physiologica 204:219226. Pennanen L, Van der Hart M, Yu L, Tecott L (2013) Impact of Serotonin (5HT)2C Receptors On Executive Control Processes. Neuropsychopharmacology 38:957967. Arena Pharmaceuticals (2012) Lorcaserin hydrochloride NDA 22529 approval letter. In: Endocrinologic and Metabolic Drugs Advisory Committee (Research, C. f. D. E. a., ed) http://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/Drug s/EndocrinologicandMetabolicDrugsAdvisoryCommittee/UCM303198.pdf Otsuka Pharmaceuticals (2013) Abilify Full US Prescribing I nformation. In: Otuska Pharmaceuticals (Research, C. f. D. E. a., ed) http://packageinserts.bms.com/pi/pi_abilify.pdf Pitcher J, Freedman N, Lefkowitz R (1998) G proteincoupled receptor kinases. Annual Review of Biochemistry 67:653692. Pitcher J, Lohse M, Codina J, Caron M, Lefkowitz R (1992) Desensitization of the isolated beta2adrenergic receptor by betaadrenergic receptor kinase, cAMP dependent protein kinase, and protein kinase C occur s via distinct molecular mechanisms. Biochemistry 31:31933197. Plassat J AN, Hen R (1993) Molecular aloning of a mammalian serotonin receptor that activates adenylate cyclase. Molecular Pharmacology 44:229236. Platt D, Rowlett J, Spealman R (2002) Behavi oral effects of cocaine and dopaminergic strategies for preclinical medication development. Psychopharmacology 163:265282. Porter R, Benwell K, Lamb H, Malcolm C, Allen N, Revell D, Adams D, Sheardown M (1999) Functional characterization of agonists at recombinant human 5HT2A, 5 HT2B and 5HT2C receptors in CHO K1 cells. British Journal of Pharmacology 128:1320. 211

PAGE 212

Porter R, Malcolm C, Allen N, Lamb H, Revell D, Sheardown M (2001) Agonist induced functional desensitization of recombinant human 5HT2 receptors expressed in CHO K1 cells. Biochemical Pharmacology 62:431438. Pratt J, Winchester C, Dawson N, Morris B (2012) Advancing schizophrenia drug discovery: optimizing rodent models to bridge the translational gap. Nature Reviews Drug Discovery 11:560579. Rahman S, Neuman RS (1993) Multiple mechanisms of serotonin 5 HT2 receptor desensitization. European Journal of Pharmacology 238:173180. Raote I, Bhattacharyya S, Panicker M (2013) Functional selectivity in serotonin receptor 2A (5 HT2A) endocytosis, recy cling, and phosphorylation. Molecular Pharmacology 83:4250. Rapport M, Green A, Page I (1948) Partial purification of the vasoconstrictor in beef serum. The Journal of Biological Chemistry 174:735741. Raveh A, Cooper A, Guy David L, Reuveny E (2013) None nzymatic rapid control of GIRK channel function by a G proteincoupled receptor kinase. Cell 143:750760. Reynolds G, Hill M, Kirk S (2006) The 5HT2C receptor and antipsychotic induced weight gain mechanisms and genetics. Journal of Psychopharmacolgy 20:15 18. Rhee SG (2001) Regulation of phosphoinositidespecific phospholipase C Annual Review of Biochemistry 70:281312. Ribeiro F, Ferreira L, Paquet M, Cregan T, Ding Q, Gros R, Ferguson S (2009) Phosphorylationindependent regulation of metabotropic glutamate receptor 5 desensitization and internalization by G proteincoupled receptor kinase 2 in neurons. The Journal of Biological Chemistry 284:2344423453. Riley E, Evans J, Hahn J, Briceno A, Davidson P, Lum P, Page K (2016) A longitudinal study of mult iple drug use and overdose among young people who inject drugs. American Journal of Public Health 13. Rios C, Jordan B, Gomes I, Devi L (2001) G proteincoupled receptor dimerization: modulation of receptor function. Pharmacology & Therapeutics 92:7187. Rollema H, Chambers L, Coe J, Glowa J, Hurst R, Lebel L, Lu Y, Mansbach R, Mather R, Rovetti C, Sands S, Schaeffer E, Schulz D, Tingley FI, Williams K (2007) Pharmacological profile of the alpha4beta2 nicotinic acetylcholine receptor partial agonist vareni cline, an effective smoking cessation aid. Neuropharmacology 52:985994. 212

PAGE 213

Rosenweig Lipson S, Zhang J, Mazandarani H, Harrison B, Sabb A, Sabalski J, Stack G, Welmaker G, Barrett J, Dunlop J (2006) Antiobesity like effects of the 5HT2C receptor agonist WAY 161503. Brain Research 1073:240251. Roth B, Palvimaki E, Berry S, Khan N, Sachs N, Uluer A, Choudhary M (1995) 5Hydroxytryptamine2A (5HT2A) receptor desensitization can occur without downregulation. The Journal of Pharmacology and Experimental Therape utics 275:16381646. Roth B, Willins D, Kristiansen K, Kroeze W (1998) 5Hydroxytryptamine2family receptors (5hydroxytryptamine 2A, 5hydroxytryptamine 2B, 5hydroxytryptamine 2C): where structure meets function. Pharmacology & Therapeutics 79:231257. Roth BL (2014) PDSP. http://kidbdev.med.unc.edu/databases/kidb.php: UNC. Rovati G, Capra V, Neubig R (2007) The highly conserved DRY motif of class A G proteincoupled receptors: beyond the g round state. Molecular Pharmaclogy 71:959964. Ruat M, Traiffort E, Leurs R, Tardivel Lacombe J, Diaz J, Arrang J, Schwartz J (1993) Molecular cloning, characterization, and localization of a highaffinity serotonin receptor (5HT7) activating cAMP formati on. Proceedings of the National Academy of Sciences of the United States of America 90:85478551. Ruocco L, Treno C, Gironi Carnevale U, Arra C, Boatto G, Nieddu M, Pagano C, Illiano P, Barbato F, Tino A, Carboni E, Laviola G, Lacivita E, Leopoldo M, Adriani W, Sadile A (2014) Prepuberal stimulation of 5HT7 R by LP 211 in a rat model of hyper activity and attentiondeficit: permanent effects on attention, brain amino acids and synaptic markers in the frontostriatal interface. Plos One 9:1--16. Sakhuja R, Kondabolu K, CordovaSintjago T, Travers S, Vincek A, Kim M, Abboud K, Fang L, Sun Z, Canal C, Booth R (2015) Novel 4substitutedN,Ndimethyltetrahydronaphthalen2 amines: synthesis, affinity, and in silico docking studies at serotonin 5HT2 type and hist amine H1 G proteincoupled receptors. Bioorganic & Medicinal Chemistry 23:15881600. Saltzman A, Morse B, Whitman M, Ivanshchenko Y, Jaye M, Felder F (1991) Cloning of the human serotonin 5 HT2 and 5HT1C receptor subtypes. Biochemical and Biophysical Research Communications 181:14691478. Schlag B, Lou Z, Fennell M, Dunlop J (2004) Ligand dependency of 5hydroxytryptamine 2C receptor internalization. The Journal of Pharmacology and Experimental Therapeutics 310:865870. Schreiber R, De Vry J (2002) Role of 5 HT2C receptors in the hypophagic effect of m CPP, ORG 37684 and CP 94,253 in the rat. Progress in NeuroPsychopharmacology & Biological Psychiatry 26:441449. 213

PAGE 214

Scwartz T, Rosenkilde M (1996) Is there a 'lock for agonists 'keys' in 7TM receptors? Trends i n Pharmacological Sciences 17:213216. Seifert R, Wenzel Seifert K (2002) Constitutive activity of G proteincoupled receptors: cause of disease and common property of wildtype receptors. NaunynSchmiedebergs Archives of Pharmacology 366:381416. Settembr e C, Fraldi A, Medina D, Ballabio A (2013) Signals for the lysosome: a control center for cellular clearance and energy metabolism. Nature Reviews Molecular Cell Biiology 14:283296. Sharif N, McLaughlin M, Kelly C (2007) AL34662: a potent, selective, and efficacious ocular hypotensive serotonin2 receptor agonist. Journal of Ocular Pharmacology and Therapeutics 23:1 13. Shi Y (2009) Serine/threonine phosphatases: mechanism through structure. Cell 139:468484. Shih M, Lin F, Scott J, Wang H, Malbon C (1999adrenergic receptors with protein kinases and phosphatases and the role of gravin. The Journal of Biological Chemistry 274:15881595. Shonber J, Lopez L, Scammells P, Christopoulos A, Capuano B, Robert Lane J (2014) Biased agonism at G protein coupled receptors: the promise and the challenges a medicinal chemistry perspective. Medicinal Research Reviews 0:1 45. Shram M, Schoedel K, Bartlett C, Shazer R, Anderson C, Sellers E (2011) Evaluation of the abuse potential of lorcaserin, a serotonin 2C (5HT2C) receptor agonist, in recreational polydrug users. Clinical Pharmacology and Therapeutics 89:683692. Simon M, Strathmann M, Gautam N (1991) Diversity of G proteins in signal transduction. Science 252:802 808. Smith B, Smith J, Tsai J Schultz J, Gilson C, Estrada S, Chen R, Park D, Prieto E, Gallardo C, Sengupta D, Thomsen W, Saldana H, Whelan K, Menzaghi F, Webb R, Beeley N (2005) Discovery and SAR of new benzazepines as potent and selective 5HT2C receptor agonists for the treatment of obesity. Bioorganic & Medicinal Chemistry Letters 15:14671470. Steinman R, Brodie S, Cohn Z (1976) Membrane flow during pinocytosis: a sterologic analysis. The Journal of Cell Biology 68:665687. Stout B, Clarke W, Berg K (2002) Rapid desensitization of the serotonin2C receptor system: effector pathway and agonist dependence. Journal of Pharmacology and Experimental Therapeutics 302:957962. 214

PAGE 215

Strader C, Fong TM, Tota M, Underwood D (1994) Structure and function of G proteincoupled receptors. Annual Rev iew of Biochemistry 63:101132. Sundaram H, Newman Tancredi A, Strange P (1992) Pharmacological characterisation of the 5 HT1A serotonin receptor using the agonist [5H]8OH DPAT, and the antagonist [3H]spiperone. Biochemical Society Transactions 20:145S. T amminga CA (1998) Schizophrenia and glutamatergic transmission. Critical Reviews in Neurobiology 12:2136. Tang X, Wang Y, Luo J, Liu M (2012) Orphan G proteincoupled receptors (GPCRs): biological functions and potential drug targets Acta Pharmacologica S inica 33:363371. Tao Y X (2006) Inactivating mutations of G proteincoupled receptors and diseases: Structure function insights and therapeutic implications. Pharmacology & Therapeutics 111. Tesmer V, Kawano T, Shankaranarayanan A, Kozasa T, Tesmer J (200 5) Snapshot of GRK2 310:16861690. Thomas D, Hagan J (2004) 5HT7 Receptors. Current Drug Targets CNS & Neurological Disorders 3:8190. Thomsen W, Grottick A, Menzaghi F, Reyes Saldana H Espitia S, Yuskin D, Whelan K, Martin M, Morgan M, Chen W, Al Shamma H, Smith B, Chalmers D, Behan D (2008) Lorcaserin, a novel selective human 5 hydroxytryptamine2C agonist: in vitro and in vivo pharmacological characterization. The Journal of Pharmacol ogy and Experimental Therapeutics 325:577587. Titeler M, Lyon R, Glennon R (1998) Radioligand binding evidence implicates the brain 5 HT2 receptor as a site of action for LSD and phenylisopropylamine hallucinogens. Psychopharmacology (Berlin) 94:213 216. Torrent M, Gelenberg A, Vrana K (2012) Boosting serotonin in the brain: is it time to revamp the treatment of depression? Journal of Psychopharmacolgy 26:629635. Tsao P, Zastrow M (2000) Downregulation of G proteincoupled receptors. Current Opinion in N eurobiology 10:365369. Van der Starre P, Solinas C (1996) Ketanserin in the treatment of protamineinduced pulmonary hypertension. Texas Heart Institute Journal 23:301304. 215

PAGE 216

Van Huizen R, Miller K, Chen D, Li Y, Lai Z, Raab R, Stark W, Shortridge R, Li M (1998) Two distantly positioned PDZ domains mediate multivalent INAD phospholipase C interactions essential for G proteincoupled signaling. The EMBO Journal 17:22852297. Van Oekelen D, Luyten W, Leysen J (2003) 5HT2A and 5HT2C receptors and their atypi cal regulation properties. Life Sciences 72:24292449. Vane JR (1959) The relative activities of some tryptamine analogues on the isolated rat stomach strip preparation. British Journal of Pharmacology 14:8798. Varnas K, Thomas D, Tupala E, Tiihonen J, Hall H (2004) Distribution of 5HT7 receptors in the human brain: a preliminary autoradiographic study using [3H]SB 269970. Neuroscience Letters 367:313316. adrenergic receptor function: An emphasis on receptor resensitization. Cell Cycle 10:36843691. Verebey K, Kogan M, Mule S (1981) Phencyclidineinduced stereotypy in rats: Effects of methadone, apomorphine, and naloxone. Psychopharmacology 75:4447. Vickers S, Benwell K, Porter R, Bick erdike M, Kennett G, Dourish C (2000) Comparative effects of continuous infusion of mCPP, Ro 60 0175 and dfenfluramine on food intake, water intake, body weight and locomotor activity in rats. Br J Pharmacol 130:13051314. Wacker D, Miller K (2008) Agonis ts of the serotonin 5HT2C receptor: preclinical and clinical progression in multiple diseases. Current Opinion in Drug Discovery & Development 11:438445. Wainscott D, Lucaites V, Kursar J, Baez M, Nelson D (1996) Pharmacologic characterization of the hum an 5hydroxytryptamine2 receptor: evidence for species differences. The Journal of Pharmacology and Experimental Therapeutics 276:720727. Wang D, Post M, Cutz E (1999) Expression of serotonin receptor 2c in rat type II pneumocytes. American Journal of Res piratory Cell and Molecular Biology 20:11751180. Weiner D, Burstein E, Nash N, Croston G, Currier E, Vanover K, Harvey S, Donohue E, Hansen H, Andersson C, Spalding A, Gibson D, Krebs Thomson K (2001) 5Hydroxytryptamine2A receptor inverse agonists as ant ipsychotics. The Journal of Pharmacology and Experimental Therapeutics 299:268276. Weintraub M, Haday J, Mushlin A, Lockwood D (1984) A doubleblind clinical trial in weight control use of fenfluramine and phentermine alone and in combination. Archives of Internal Medicine 144:11431148. 216

PAGE 217

Welmaker G, Nelson J, Sabalski J, Sabb A, Potoski J, Graziano D, Kgan M, Coupet J, Dunlop J, Mazandarani H, Rosenzweig Lipson S, Sukoff S, Zhang Y (2000) Synthesis and 5hydroxytryptamine (5HT) activity of 2,3,4,4atetrah ydro 1H pyrazino[1,2]quinoxalin 5 (6H)ones and 2,3,4,4a,5,6hexahydro1H pyrazino[1,2]quinoxalines. Bioorganic & Medicinal Chemistry Letters 10:19911994. Werry T, Loiacono R, Sexton P, Christopoulos A (2008) RNA editing of the serotonin 5HT2C receptor and its effects on cell signalling, pharmacology and brain function. Pharmacology & Therapeutics 119:723. Wilden U, Hall S, Kuhn H (1986) Phosphodiesterase activation by photoexcited rhodopsin is quenched when rhodopsin is phosphorylated and binds the intri nsic 48kDaprotein of rod outer segments. Proceedings of the National Academy of Sciences of United States of America 83:11741178. Williams J, Ingram S, Henderson G, Chavkin C, Von Zastow M, Koch T, Evans C, Christie M (2013) Regulation of muopioid receptors: desensitization, phosphorylation, internalization, and tolerance. Pharmacological Reviews 65:223254. Willins D, Berry S, Alsayegh L, Backstrom J, Sanders Bush E, Friedman L, Roth B (1999) Clozapine and other 5hydroxytryptamine2A receptor antagonis ts alter the subcellular distribution of 5hydroxytryptamine2A receptors in vitro and in vivo. Neuroscience 91:599606. Wood M, Heidbreder C, Reavill C, Ashby C, Middlemiss D (2001) 5 HT2C receptor antagonists: potential in schizophrenia. Drug Development Research 54:8894. Wyrick S, Booth R, Myers A, Owens C, Kula N, Baldessarini R, McPhail A, Mailman R (1993) Synthesis and pharmacological evaluation of 1phenyl 3 amino1,2,3,4 tetrahydronaphthalenes as ligands for a novel receptor with sigmalike neuromo dulatory activity. Journal of Medicinal Chemistry 36:25422551. Xu Y, Xing Y, Chen Y, Chao Y, Lin Z, Fan E, Yu J, Strack S, Jeffrey P, Shi Y (2006) Structure of the protein phosphatase 2A holoenzyme. Cell 127:12391251. Zhang J, Kowal D, Nawoschik S, Lou Z Dunlop J (2005) Distinct functional profiles of aripiprazole and olanzapine at RNA edited human 5HT2C receptor isoforms. Biochemical Pharmacology 71:521529. Zhang L, Yu Y, Mackin S, Weight F, Uhl G, Wang J (1996) Differential opiate receptor phosphorylation and desensitization induced by agonists and phorbol esters. The Journal of Biological Chemistry 271:1144911454. 217

PAGE 218

BIOGRAPHICAL SKETCH Daniel Eric Felsing was born in 1989 to Marlyn and Carol Felsing, and has two younger sisters Kristen and Alex. He attended Edgewater High S chool in Orlando, Fl orida and after graduation in 2007 he was accepted into the University of Florida fo r undergraduate studies He was graduated from the University of Florida in May 2011 with a B .S. in b iochemis try and a B.A. in percussion performance. As an undergraduate he took an interest in neuroscience drug discovery, which prompted him to pursue a doctor al degree in the D epartment of M edicinal C hemistry at the University of Florida beginning in June 2011. He w as mentored by Dr. Raymond Booth and completed his Doctorate of Philosophy from University of Florida in May 2016. 218