Citation
Interaction of Triclosan with Human and Sheep Phase II Enzymes

Material Information

Title:
Interaction of Triclosan with Human and Sheep Phase II Enzymes
Creator:
Jackson, Erin N
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (160 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Pharmaceutical Sciences
Medicinal Chemistry
Committee Chair:
JAMES,MARGARET O
Committee Co-Chair:
LUESCH,HENDRIK
Committee Members:
SLOAN,KENNETH B
DENSLOW,NANCY D
Graduation Date:
8/8/2015

Subjects

Subjects / Keywords:
Enzymes ( jstor )
Estrogens ( jstor )
Liver ( jstor )
Metabolism ( jstor )
Placenta ( jstor )
Protein isoforms ( jstor )
Sheep ( jstor )
Steroids ( jstor )
Sulfates ( jstor )
Women ( jstor )
Medicinal Chemistry -- Dissertations, Academic -- UF
glucuronidation -- inhibition -- metabolism -- pregnancy -- sulfonation -- triclosan
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Pharmaceutical Sciences thesis, Ph.D.

Notes

Abstract:
Triclosan, a widely used antibacterial, is now prevalent in the environment and has been detected in various human tissues. Unrelated to its mode of antibacterial action, triclosan has been shown to interact with off-target proteins and elicit endocrine disrupting effects. A major pathway of elimination of triclosan is glucuronidation, therefore we sought more information on its detoxication by glucuronidation in people. These studies examined triclosan glucuronidation in human liver microsomes (HLMs) and proteomic analysis was used to quantify the expression of UGT isoforms. Studies were also undertaken to identify whether individuals with a common polymorphism that results in reduced glucuronidation of some drugs, UGT1A1*28, exhibited reduced clearance of triclosan. In 47 HLMs, rates of triclosan glucuronidation varied over 16-fold, suggesting that there exists great interindividual variability of triclosan clearance by glucuronidation in a population. Statistical analysis of UGT isoform expression and rates of triclosan glucuronidation in 47 HLMs demonstrated that UGTs 2B4 and 1A4 accounted for 44% and 15%, respectively, of the variance in triclosan glucuronidation. Individuals with the UGT1A1*28 polymorphism did not exhibit reduced triclosan conjugation Triclosan demonstrated inhibitory activity towards major human sulfotransferase and sulfatase enzymes, which catalyze the forward and reverse steps, respectively, of sulfonation, an important phase II conjugation reaction. Hepatic and placental cytosol from pregnant ewes treated with triclosan exhibited lower sulfotransferase activity towards estradiol than cytosolic samples from vehicle-treated controls. In both tissues, the presence of triclosan significantly inhibited estrogen sulfotransferase activity. Additional studies examined the direct inhibitory effect of triclosan and triclosan-sulfate on sulfatase activity in human hepatic and sheep placental microsomes. Triclosan was a weak inhibitor of steroid sulfatase, but was a competitive moderately potent inhibitor of human arylsulfatase in male and female HLMs, with Ki values in the low micromolar range. Triclosan-sulfate competitively inhibited arylsulfatase activity in microsomes from sheep placenta and female human livers with moderate potency, <50 micromolar. Triclosan-sulfate was more potent than triclosan at inhibiting estrone sulfatase. The effect of triclosan on estradiol sulfate secretion was also examined in HEK 293T and JEG-3 cells transfected with human SULT1E1. Results showed that triclosan inhibited estradiol conjugation in a concentration-dependent manner. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2015.
Local:
Adviser: JAMES,MARGARET O.
Local:
Co-adviser: LUESCH,HENDRIK.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Erin N Jackson.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Classification:
LD1780 2015 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

INTERACTION OF TRICLOSAN WITH HUMAN AND SHEEP PHASE II ENZYMES By ERIN N. JACKSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2015

PAGE 2

2015 Erin N. Jackson

PAGE 3

To my grandmother, my mother, my sister, and my best friend

PAGE 4

ACKNOWLEDGMENTS First, I would like to thank God for affording me t he opportunity to pursue my graduate education under the instruction of my advisor, mentor, and chair of my degree supervisory committee, Dr. Margaret O. James. Dr. James presented me with my first research opportunity where, among numerous other things, s he taught me how to think independently and allowed me to learn and develop personal and professional skills that span beyond the realm of scientific research. I am forever grateful for her continuous guidance, patience, advice, and encouragement throughout my academic career . The pursuit of this degree has been one of the most challenging, yet rewarding , experiences in my adult life and I am certain this dissertation would not be possible without the unceasing prayers and support from my family and friends. For that reason, I owe my sincerest gratitude to all those who have prayed for me, encouraged me, and believed in me when I did not believe in myself. Specifically, I would like to thank my mother, Charlene Jackson, my sister, Erica Ward, and my best fr iend and partner, Sheldon McLean , who are all constant source s of prayers and support, and have facilitated my success in this program . Because of all of you, I am here, and words could never fully convey my appreciation. I would also like to extend my appreciation to my committee members, Dr. Kenneth Sloan, Dr. Hendrik Luesch, and Dr. Nancy Denslow, who all willingly gave of their time, attention, suggestions , and laboratory equipment . To all the other professors in the College of Pharmacy, particularly D r. Raymond Bergeron and Dr. Anthony Palmieri, whose conversation and support served as great encouragement and motivation, I cannot imagine this journey without you. In addition, I acknowledge Dr. Taimour Langaee and Dr. Philip C. Smith for genotyping and quantifying UGT 4

PAGE 5

expression in the human liver samples, respectively; Dr. Jonathan Shuster for his statistical expertise; Dr. Charles Wood for conducting the sheep exposure experiments and providing the sheep liver and placenta tissues used in the studies; Dr. Brian Law for the donation of cells used in the experiments , and Dr. Jonathan Sheng for the generous gift of the vector used for transfection. Finally, I would like to thank the former and current members in the James research lab for their humor, lab assistance, and friendship. In particular, I acknowledge Laura Faux for patiently extending her help with the use of different instruments and for providing necessary insight on numerous projects. You all helped make this journey through graduate school less stressful and more enjoyable, and I hope these friendships continue for years to come. 5

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 11 LIST OF ABBREVIATIONS ........................................................................................... 13 CHAPTER 1 INTRODUCTION TO TRICLOSAN AND PHASE II METABOLISM OF XENOBIOTICS ....................................................................................................... 18 Triclosan ................................................................................................................. 18 Identity, Manufacture and Use .......................................................................... 18 Exposure .......................................................................................................... 19 Toxicity ............................................................................................................. 21 Metabolism ....................................................................................................... 25 Phase II Metabolism ............................................................................................... 27 UDP Glucuronosyltransferases ........................................................................ 28 Nomenclature ............................................................................................. 30 UGT tissue distribution and expression ..................................................... 30 Enzyme characteristics .............................................................................. 33 Interindividual variability and polymorphisms ............................................. 35 Sulfotransferases ............................................................................................. 37 Nomenclature ............................................................................................. 39 SULT tissue distribution and expression .................................................... 40 Enz yme characteristics .............................................................................. 41 Interindividual variability and polymorphisms ............................................. 42 Estrogen Sulfotransferase ................................................................................ 42 Estrogens, pregnancy, and fetal development ........................................... 46 Possible disruption of normal fetal development by inhibitors .................... 47 Sulfatases ......................................................................................................... 51 Significance and Specific Aims ............................................................................... 53 Specific Aim 1: Triclosan Glucuronidation ........................................................ 54 Specific Aims 2 and 3: Effect of Triclosan on Formation and Hydrolysis of Estrogen Sulfates .......................................................................................... 54 Specific aim 2 ............................................................................................. 5 5 Specific aim 3 ............................................................................................. 56 2 INDIVIDUAL VARIABILITY IN TRICLOSAN GLUCURONIDATION ....................... 69 Introduction ............................................................................................................. 69 Materials and Methods ............................................................................................ 71 6

PAGE 7

Chemicals ......................................................................................................... 71 Tissue Samples ................................................................................................ 71 Assay ................................................................................................................ 72 UGT2B4 Kinetics Assay ................................................................................... 73 Genotyping ....................................................................................................... 74 Proteomics ....................................................................................................... 74 Data Analysis ................................................................................................... 74 Results .................................................................................................................... 75 Triclosan Glucuronidation ................................................................................. 75 Genotyped HLMs ............................................................................................. 75 Enzyme Kinetics ............................................................................................... 77 Discussion .............................................................................................................. 77 Conclusion .............................................................................................................. 80 3 EFFECT OF TRICLOSAN ON ESTRADIOL SULFATE FORMATION IN SHEEP .. 93 Introduction ............................................................................................................. 93 Materials and Methods ............................................................................................ 93 Chemicals ......................................................................................................... 93 Tissue Samples ................................................................................................ 94 LC MS/MS Analysis of Triclosan in Tissues ..................................................... 95 Assay ................................................................................................................ 96 Data Analysis ................................................................................................... 96 Results and Discussion ........................................................................................... 97 Conclusion .............................................................................................................. 98 4 EFFECT OF TRICLOSAN AND TRICLOSANSULFATE ON SULFATE HYDROLYSIS ....................................................................................................... 100 Introduction ........................................................................................................... 100 Materials and Methods .......................................................................................... 101 Chemicals ....................................................................................................... 101 Tissue Samples .............................................................................................. 101 Inhibition of Arylsulfatase Activity Assay......................................................... 102 Inhibition of Steroid Sulfatase Activity Assay .................................................. 103 HPLC Analysis ............................................................................................... 103 Data Analysis ................................................................................................. 104 Results .................................................................................................................. 104 Discussion ............................................................................................................ 106 Conclusion ............................................................................................................ 107 5 EFFECT OF TRICLOSAN ON ESTRADIOL SULFONATION AND SULFATE SECRETION IN HUMAN SAMPLES .................................................................... 117 Introd uction ........................................................................................................... 117 Materials and Methods .......................................................................................... 118 Chemicals and Cells ....................................................................................... 118 7

PAGE 8

Est radiol Sulfonation Kinetics Assay .............................................................. 119 Cell Culture ..................................................................................................... 120 RNA Extraction and cDNA Synthesis ............................................................. 121 Expression of SULT1E1GFP ......................................................................... 122 Treatment ....................................................................................................... 123 HPLC Analysis ............................................................................................... 123 Data Analysis ................................................................................................. 124 Results .................................................................................................................. 124 Discussion ............................................................................................................ 126 Conclusion ............................................................................................................ 127 6 CONCLUSIONS ................................................................................................... 132 LIST OF REFERENCES ............................................................................................. 137 BI OGRAPHICAL SKETCH .......................................................................................... 160 8

PAGE 9

LIST OF TABLES Table page 1 1 US triclosan production data (pounds per year) by repor ting year from the US EPA, 2012 .......................................................................................................... 67 1 2 Reported concentrations of triclosan in human samples .................................... 68 2 1 Triclosan glucuronida tion by individual UGT isoforms ........................................ 87 2 2 Kinetics of triclosan glucuronidation by the human UGT i soforms with highest activities .............................................................................................................. 87 2 3 Triclosan glucuronidation activity (nmol/m in/mg protein) and UGT expression (pmol of isoform/mg protein) in HLMs ................................................................. 88 2 4 G enotyped human liver microsomes .................................................................. 91 2 5 UGT1A1 expression does not predict triclosan glucuronidation activity ............. 91 2 6 Pearson’s correlation coefficients between individual UGTs and tri closan glucuronidation activity ....................................................................................... 92 2 7 Apparent kinetic constants for triclosan glucuronidation catalyzed by UGT2B4. ............................................................................................................ 92 3 1 Effect of triclosan treatment on estrogen sulfonation in fetal sheep directly infused with vehicle (saline) or triclosan. ............................................................ 99 4 1 The inhibitory effect of triclosan concentrations up to 1 mM on steroid sulfatase activity toward 2 M estrone3 sulfate in male and female human liver microsomes. .............................................................................................. 115 4 2 The inhibitory effect of triclosansulfate concentrations up to 0.1 mM on steroid sulfatase activity toward 0.2 M estro ne3 sulfate in female human liver microsomes. .............................................................................................. 115 4 3 The inhibitory effect of triclosansulfate concentrations up to 1 mM on steroid sulfatase activity toward 2 M estrone3 sulfate in femal e human liver microsomes ...................................................................................................... 116 5 1 Apparent kinetic constants for 5 M PAPS observed at different E2 concentrations with human SULT1E1. ............................................................. 130 5 2 Estradiol conversion to estradiol 3 sulfate in transfected and nontransfected JEG 3 cells. ...................................................................................................... 130 9

PAGE 10

5 3 The inhibitory effect of triclosan on SULT1E1 activity towards 50 nM estradiol in transfected HEK 293T cells. ......................................................................... 131 10

PAGE 11

LIST OF FIGURES Figure page 1 1 Structure and chemical properties of triclosan. ................................................... 57 1 2 Biotransformation of triclosan by UDP glucuronosyltransferases (UGTs) and sulfotransferases (SULTs). ................................................................................. 57 1 3 Glucuronidation reaction scheme. Figure modif ied from (Rowland et al., 2013). ................................................................................................................. 58 1 4 Dissection diagram of a representative microsomal UDP glucuronosyltransferase allele name. ................................................................. 59 1 5 mRNA expression values for several human glucuronosyltransferases involved in the biotransformation of xenobiotics.. ............................................... 60 1 6 Hypothetical topology model for human UGT ..................................................... 61 1 7 Sulfonation reaction scheme. ............................................................................. 62 1 8 The formation of sulfate esters by sulfotransferases and subsequent hydrolysis by sulfatase enzymes ........................................................................ 63 1 9 The expression of five human sulfotransferase enzymes in four different tissues ................................................................................................................ 64 1 10 Estradiol sulfonation by SULT1E1 ...................................................................... 65 1 11 Proposed mechanism for sulfatase reaction. ...................................................... 66 2 1 UGT1A1, 1A7, and 1A9 catalyzed glucuronidation of triclosan. ......................... 82 2 2 Graph illustrating more than 7fold variability in rates of glucuronidation of 10 M triclosan in HLMs from male and female donors. .......................................... 83 2 3 Graph illustrating more than 16fold variability in rates of glucuronidation of 1 mM triclosan in HLMs from male and female donors. ......................................... 84 2 4 Graph showing a significant correlation between UGT2B4 expression and triclosan glucuronidation activity in the HLMs. .................................................... 85 2 5 Triclosan glucuronidation kinetics with UGT2B4 ................................................. 86 3 1 Graph illustrating a significant effect of triclosan treatment on estrogen sulfonation in all sheep placenta ......................................................................... 99 11

PAGE 12

4 1 Michaelis Menten curve illustrating 4MeUS kinetics in male human liver microsomes ...................................................................................................... 109 4 2 Inhibition plots for the effect of triclosan on 4MeUS hydrolysis in male human liver microsomes ............................................................................................... 110 4 3 Inhi bition plots for the effect of triclosan on 4MeUS hydrolysis in female human liver microsomes ................................................................................... 111 4 4 Inhibition plots for the effect of triclosansulfate on 4MeUS hydrolysis in sheep placental microsomes ............................................................................ 112 4 5 Inhibition plots for the effect of triclosansulfate on 4MeUS hydrolysis in female human liver microsomes ....................................................................... 113 4 6 Concentrationresponse curve showing the effect of triclosansulfate on 0.2 M estrone sulfate hydrolysis in one female human liver sample ..................... 114 5 1 Estrogen sulfotransferase mRNA express ion in JEG 3 cells ............................ 128 5 2 Michaelis Menten curve illustrating the effect of [PAPS] and [E2] on human SULT1E1 activity .............................................................................................. 128 5 3 Illustration of transfection success using fluorescent microscopy to observe SULT1E1 GFP ................................................................................................. 129 5 4 SULT1E1 activity towards estradiol in transfected and nontransfected HEK 293T cells in the presence and absence of 10 M triclosan. ............................ 130 12

PAGE 13

LIST OF ABBREVIATIONS 4' OH CB18 2,2',5' trichlorobiphenyl 4 ol 4MeU 4 methylumbelliferone 4MeUS 4 methylumbelliferyl sulfate ACTH Adrenocorticotropin ARS Arylsulfatase ATCC A merican Type Cell Culture ANOVA Analysis of variance BCA Bicinchonic acid BROD Benzyloxyresorufin O debenzylase BSA Bovine serum albumin CYP450 Cytochrome P450 DHEA Dehydroepiandrosterone DMEM Dulbecco’s Modified Eagle’s M edium DMSO Dimethyl sulfox ide DTT Dithiothreitol E1 Estrone E1S Estrone 3 sulfate E2 17

PAGE 14

ESI Electrospray ionization EST Estrogen s ulfotransferase FBS Fetal bovine serum FG Formylglycine GFP Green fluorescent protein HEK Human embryonic kidney HFG HLM Hydroxyformylglycine Human liver microsomes HPLC High performance liquid chromatography IACUC Institutional animal care and use committee ICBR Interdisciplinary Center for Biotechnology Research IRB Institutional Review Board MRM Multiple reaction monitoring NHANES National Health and Nutrition Examination Survey OH PCBs Hydroxylated polychlorinated biphenyls PAP 3’ phosphoad enosine 5’ phosphate PAPS 3’ phosphoadenosine 5’ phosphosulfate PCBs Polychlorinated biphenyls PCR P olymerase chain reaction PHAHs P olyhalogenated aromatic hydrocarbons PIC A Tetrabutylammonium hydrogen sulfate PMSF P henylmethylsulfonyl fluoride p NP p nitrophenol PROD Pentoxyresorufin O depentylase PSB loop Phosphate binding loop 14

PAGE 15

S N 2 S econd order nucleophilic substitution STS S teroid sulfatase ; Arylsulfatase C SULT Sulfotransferase SULT1E1 Estrogen sulfotransferase TA Thymine adenine TCA T richloroacetic acid TEA Triethanolamine TRC Triclosan Tris Tris(hydroxymethyl)aminomethane TTP Time to pregnancy UDP U ridine diphosphate UDPGA U ridine 5’ diphosphoglucuronic acid UGT UDP glucuronosyltransferase UV U ltraviolet 15

PAGE 16

Abstract of Disserta tion Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INTERACTION OF TRICLOSAN WITH HUMAN AND SHEEP PHASE II ENZYMES By Erin N. Jackson August 2015 Chair: Margaret O. James Major: Pharmaceutical Sciences Triclosan , a widely used antibacterial , is now prevalent in the environment and has been detected in various human tissues. Unrelated to its mode of antibacterial action, triclosan has been shown to interact with off target proteins and elicit endocrine disrupting effects. A major pathway of triclosan elimination is glucuronidation, therefore we sought more information on its detoxication by glucuronidation in people. These studies examined t ric losan glucuronidation in human liver microsomes (HLMs) and proteomic analysis was used to quantify the expression of UGT isoforms . Studies were also undertaken to identify whether individuals with a common polymorphism that results in reduced glucuronidati on of some drugs, UGT1A1*28, exhibit ed reduced clearance of triclosan. In 47 HLMs, rates of triclos a n glucuronidation varied over 16fold, suggesting that there exists great interindividual variability of triclosan clearance by glucuronidation in a populat ion. Statistical analysis of UGT isoform expression and rates of triclosan glucuronidation in 47 HLMs demonstrated that UGTs 2B4 and 1A4 accounted for 44% and 15%, respectively, of the variance in triclosan glucuronidation. I ndividuals with the UGT1A1*28 polymorphism did not exhibit reduced triclosan conjugation . 16

PAGE 17

Triclosan demonstrated inhibitory activity towards major human sulfotransferase and sulfatase enzymes, which catalyze the forward and reverse steps, respectively, of sulfonation, an important phas e II conjugation reaction. H epatic and placental cytosol from pregnant ewes treated with triclosan exhibited lower sulfotransferase activity towards estradiol than cytosol ic samples from vehicletreated controls . In both tissues, the presence of triclosan significantly inhibited estrogen sulfotransferase activity. Additional studies examined the direct inhibitory effect s of triclosan and triclosansulfate on sulfatase activity in human hepatic and sheep placental microsomes. Triclosan was a weak inhibitor o f steroid sulfatase, but was a competitive, moderately potent inhibitor of human arylsulfatase in male and female HLMs, with Ki values in the low micromolar range. Triclosansulfate competitively inhibited arylsulfatase activity in microsomes from sheep pl acenta and female human liver s with moderate potency , <50 M . T riclosan sulfate was more potent than triclosan at inhibiting estrone sulfatase. The effect of triclosan on estradiol sulfate sec retion was also examined in HEK 293T and JEG 3 cells transfected with human SULT1E1. R esults show ed that triclosan inhibit ed estradiol conjugation in a concentrationdependent manner. 17

PAGE 18

CHAPTER 1 INTRODUCTION TO TRICLOSAN AND PHASE II METABOLISM OF XENOBIOTICS Triclosan Identity, Manufacture and Use Triclosan, 5 chloro2 (2,4 dichlorophenoxy) phenol, is a halogenated diphenyl ether that is a commonly used ingredient in various consumer products regulated throughout North America, Europe, and Asia (Dann and Hontela, 2011). Figure 1 1 shows the structure, and the physical and chemical properties of triclosan. Introduced to the healthcare industry more than 40 years ago, triclosan was originally used as a surgical scrub in hospitals (Jones et al., 2000). It has since been increasingly employed as a synthetic preservative and antibacterial agent in numerous personal care products o f daily use, including disinfectants, hand soaps, skin creams, toothpastes, deodorants, and cosmetics, typically in concentration ranges from 0.10.3% of product weight (McAvoy et al., 2002; Sabaliunas et al., 2003). As a stable solid with a melting point of 5457 C, some manufacturers have opted to incorporate triclosan into plastics and fibers (Dann and Hontela, 2011). Consequently, triclosan is often used in several industrial and household products, including plastic cutting boards, furniture, and spor ts equipment (Bester, 2003; Dann and Hontela, 2011). A recent report based on the Chemical Data Reporting system maintained by the US Environmental Protection Agency (EPA) estimated that in 1998 triclosan production had increased 100fold since 1986 ( Nazar off et al. , 2012). Table 1 1 illustrates the increased production of triclosan over time. Due to its widespread use, triclosan and some of its derivatives are some of the most commonly encountered substances in the environment. 18

PAGE 19

Triclosan’s antibacterial pr operties derive from its potent inhibition of the enoyl acyl carrier protein reductase, an enzyme essential in fatty acid synthesis in bacteria (McMurry et al., 1998; Levy et al., 1999). By blocking the active site of the enzyme, triclosan prevents the bac teria from synthesizing fatty acid, which is necessary for reproducing and building cell membranes (McMurry et al., 1998; Levy et al., 1999). However, since humans do not express this enzyme, triclosan has long been thought to be essentially harmless to them. Exposure Current evidence suggests that the two most probable routes of human exposure to triclosan are ingestion and percutaneous absorption. Triclosan is lipophilic and can be absorbed by humans through the skin after topical application of shampoo or aerosol deodorant or through the gastrointestinal tract upon brushing or rinsing with triclosancontaining toothpaste or mouthwash, respectively (Bagley and Lin, 2000; Lin , 2000). The swallowed fraction from a normal amount of toothpaste (~12 g) varies between 5 and 40% (Barnhart et al., 1974; Baxter, 1980). Following oral administration, the rates of absorption through the gastrointestinal tract and detox ication by the intestine and liver are critical controlling steps that regulate the availability of free triclosan to vital organs, and subsequently its acute toxicity (DeSalva et al., 1989). Personal care products containing triclosan (soap, shampoo, toothpaste, etc.) are commonly rinsed down the drain after use, where they become part of the domestic wastewater and are treated in wastewater treatment plants (Reiss et al., 2002; Singer et al., 2002; Hua et al., 2005; von der Ohe et al., 2012). Levels of triclosan in sewage treatment plants (<0.01 120 mg/kg ( Adolfsson Erici et al., 2002) and 1000 8000 n g/g ( Bester, 2003) ) , natural waters (104431 ng/ L ( Morrall et al., 2004) ; 5.1 13.7 ng/L (Fair 19

PAGE 20

et al., 2009) ; and undetectable to 6.5 ng/ L (Wu et al., 2015) ) and even drinking water (undetectable to 14.5 ng/ L (Bedoux et al . , 2012 ) and 060 ng/ L (Padhye et al., 2014)) have been reported from a number of different sources in nanogram per gram, nanogram per liter, microgram per liter or microgram per kilogram amounts. In a study of 139 streams across the USA, Kolpin et al. (2002) expressed that triclosan was detected in 57.6% of surface waters monitored. According to von der Ohe et al. (2012), although most wastewater treatment technologies are generally effective in removing triclosan (~90%), some are not specifically designed to remove micropollutants, suggest ing that triclosan may be left to “enter the environment, disperse and persist to a greater extent than expected” (Singer et al., 2002; Bester, 2003). Others claim that triclosan is not a persistent chemical. Owing to its hydrophobic nature, they hold that approximately 3040% of triclosan will biodegrade, and an additional 3050% will undergo sorption to sludge (Bester, 2003; Sabaliunas et al., 2003) or immobilize in (and not volatize from) soils (McAvoy et al., 2002; Fuchsman et al., 2010). Nonetheless, due to its lipophilicity (log Kow = 4.8), triclosan has the potential to bioaccumulate in fatty tissues and build up over time in freshwater species and mammals if it is not readily conjugated and excreted (Valters et al., 2005; Fair et al., 2009; Bedoux et al . , 2012; Lan et al., 2015). In addition to aquatic organisms, triclosan has been detected i n several human samples, including urine, breast milk , and amniotic fluid ( Bradman et al., 2003; Arbuckle et al., 2015(a); Arbuckle et al., 2015(b); Xue et al., 2015) . Table 12 illustrates the concentration ranges of triclosan levels detected in numerous human samples. More specifically, it has been found in the plasma of nursing mothers in Sweden (range 0.0138 ng/g), and in human breast milk samples (range 20

PAGE 21

<0.0 180.95 ng/g) (Allmyr et al., 2006). As triclosan and its metabolites are excreted primarily in urine in humans (Queckenberg et al., 2010), urine represents a vital biomonitoring tool for exposure assessment. Maternal urinary biomarkers, for instance, are often used to assess fetal exposure to xenobiotics (Philippat et al., 2013). Data from the National Health and Nutrition Examination Survey (NHANES) revealed that urinary concentrations of triclosan (free plus conjugated ranging from 2.43,790 g/L) were detectable in nearly 75% of Americans over the age of 6 (Calafat et al., 2008) , and more recent studies detected free triclosan in 80% of pregnant women in Canada (Arbuckle et al., 2015(a)) . Other studies showed that there were also detectable l evels of free triclosan in human adipose tissue (0.61 ng/g), liver (2.65 ng/g), and brain (0.03 ng/g) (Geens et al., 2012). Toxicity Triclosan has been found to exhibit biological activity that spans beyond its antibacterial function. Potential health iss ues surrounding triclosan use include endocrine and enzymatic metabolism disruption, antibiotic resistance, and the formation of carcinogenic by products (Levy, 2000; 2001; Schweizer, 2001; Veldhoen et al . , 2006; Crofton et al., 2007; Gee et al . , 2008; Zor rilla et al., 2009; Stoker et al., 2010). Triclosan is a phenolic xenobiotic with structural similarity to thyr oid hormones, steroid hormones, and hydroxylated polychlorinated biphenyls ( OH PCBs), which have been shown to be endocrine disrupters. T he effec t of triclosan on the thyroid hormone system and its ability to disrupt hormone homeostasis has been studied in a variety of species ( Veldhoen et al . , 2006; Crofton et al., 2007; Gee et al . , 2008; Zorrilla et al., 2009; Stoker et al., 2010; Manservisi et al., 2014; Zhang et al., 2015). Animal studies, for example, 21

PAGE 22

have shown that tadpoles exposed to small amounts of triclosan (levels below 1 part per billion) experienced disruption of the thyroid system (Veldhoen et al . , 2006). These low levels coincide wit h what has been measured and reported in people and natural waters, suggesting that triclosan may also pose a threat to the human thyroid system (Veldhoen et al . , 2006; Calafat et al . , 2008). Other cell based bioassays revealed that at environmentally relevant concentrations, triclosan could interact with the estrogen and androgen receptors and exert both estrogenic and androgenic effects (Gee et al . , 2008). Additionally, triclosan demonstrated aryl hydrocarbon receptor (AhR) agonist and antagonist activit ies in hepatoma cells (Ahn et al., 2008). Furthermore, due to its near neutral pKa (~8), triclosan has the potential to dissociate in typical environmental conditions, ranging from fully protonated (~pH 5.4) to completely deprotonated (~pH 9) (Young et al., 2008). Bedoux et al. (2012) reviewed how triclosan has shown to be biodegradable, reactive towards chlorine and ozone, and photounstable. More specifically, it has the ability to be transformed into potentially more harmful and persistent compounds, such as methyl triclosan ( an aquatic life toxicant ) after methylation; chloroform (a suspected cancer causing substance); more highly chlorinated phenols and diphenyl ethers after chlorination; and chlorinated dibenzodioxins after photooxidation (Lindstr m et al . , 2002; Balmer et al., 20 04; Lores et al., 2005; Fiss et al . , 2007; Bedoux et al . , 2012). In mouse studies, t hese more highly chlorinated derivatives produced from triclosan exhibited higher acute toxicity than triclosan itself (Kanetoshi et al . , 19 92). Repeated use of triclosan products has also been suggested to promote antibiotic resistance in bacteria and allow resistant bacterial strains to develop 22

PAGE 23

(Bra o udaki and Hilton, 2004). Bacteria use multiple mechanisms to achieve resistance to biocides and those believed to be associated with triclosan resistance are the same mechanisms involved in antibiotic resistance. These mechanisms include target mutations, increased target expression, active multidrug efflux pumps, and enzymatic activation/degradation (Schweizer, 2001). As stated previously, several studies have illustrated that triclosan acts on a specific bacterial target in the bacterial fatty acid biosynthetic pathway, the enoyl acyl carrier protein reductase, or FabI (McMurry et al., 1998; Lev y et al., 1999). However, there is increasing concern surrounding this action as antibiotics, not antimicrobials, are designed to target specific cellular components of bacteria (Levy, 2000). The fear is that biocides, like triclosan, may share bacterial t argets with antibiotics and continuous use of the biocide may “select resistance against clinically useful drugs” (Schweizer, 2001). In turn, this could render antibiotics essentially useless to those in need (i.e. individuals with compromised immune syste ms) (Levy, 2000; 2001). This idea has been supported by experimental studies demonstrating that mutations affecting InhA, the FabI homolog in Mycobacterium tuberculosis, resulted in triclosan resistance and also caused resistance to isoniazid, a medication often used to treat tuberculosis (Schweizer, 2001). The ability of triclosan to interact with drug metabolizing enzymes has also been documented. Cytochrome P450 (CYP450) enzymes are important phase I biotransformation enzymes that metabolize numerous endogenous and exogenous compounds. T riclosan has been shown to induce several cytochrome P450dependent hepatic activities , including pentoxyresorufinO depentylase (PROD), benzyloxyresorufinO debenzylase O deethylase (EROD), 23

PAGE 24

as well as increase CYP450 2B1/2 protein expression in vitro in rat hepatocytes (Jinno et al., 1997). However, low concentrations of triclosan have also been shown to inhibit PROD activity (Ki 1.48 M) and EROD activity (Ki 0.24 M) in rat liver microsomes in vitro (Hanioka et al., 1996). Additionally, in vitro evidence presented by Jacobs et al. (2005) demonstrated that at a 10 M concentration, triclosan is a moderate affinity ligand for the human pregnane X receptor (hPXR), demonstrating approximately 50% f old activation of normalized PXR activity relative to that of 10 M rifampicin, a potent CYP3A4 inducer in humans. The hPXR is responsible for regulating the expression of CYP3A4, one of the most abundant phase I metabolizing enzymes in the human body, whi ch plays a significant role in catalyzing the biotransformation of about 50% of pharmaceuticals (Luo et al., 2002; Jacobs et al., 2005). As a result, exposure to compounds like triclosan that are capable of upregulating the transcriptional activation of CY P3A4, pose the risk of altering the metabolism of drugs that are CYP3A4 substrates. This, in turn, could heighten the possibility of adverse effects. Triclosan can also interact with phase II enzymes by directly inhibiting and indirectly inducing them (Wa ng et al., 2004; Wang and James, 2006; Zorilla et al., 2009). Triclosan exposure to rats not only induced isoform specific increases in phase II enzyme (UGT and SULT) mRNA expression, but upon 4 days exposure to t riclosan, liver microsomal glucuronidation activity toward thyroxine increased (Paul et al., 2010). In addition, Wang et al. (2004) demonstrated that triclosan serves as a substrate and inhibitor of the glucuronidation and sulfonation detoxification pathways. It has also been shown that triclosan c an inhibit sheep placental estrogen sulfotransferase activity toward 17 estradiol in a mixed competitive/uncompetitive manner, with Ki values in the 24

PAGE 25

low nanomolar range (James et al., 2010). In this same study, triclosan also inhibited estrone sulfonation, exhibiting an IC50 value of less than 1 nM (James et al., 2010). Metabolism Undergoing conjugation via phase II detoxification pathways can reduce triclosan’s toxicity . Although triclosan metabolism has not been studied extensively, it has been document ed that biotransformation via sulfonation and glucuronidation are triclosan’s primary routes of metabolism ( DeSalva et al., 1989; Wang et al . , 2004; Provencher et al., 2014). Figure 1 2 illustrates the triclosan glucuronide and sulfate metabolites formed by UGTs and SULTs, respectively. UDP glucuronosyltransferases (UGTs) and sulfotransferases (SULTs) are two vital detoxification enzymes that have exhibited overlapping substrate specificities (Pacifici et al., 1993). Owing to its hydroxyl group, triclosan is a substrate for both phase II enzymes and, subsequently, has a relatively fast turnover rate in the human body, exhibiting a half life shorter than 24 hours (Queckenberg et al., 2010). Queckenberg et al. (2010) recently characterized triclosan absorpti on and pharmacokinetics in human subjects. Of the triclosan absorbed after dermal administration of a cream containing 2% triclosan, the majority of the substance was excreted in urine within 24 hours. Similarly, the glucuronide metabolite was the primary triclosan conjugate detected in urine samples from forty six human volunteers (Provencher et al., 2014). Free (unconjugated) triclosan was found in all but 2 of the participants (95.7%), the glucuronide conjugate was found in virtually all the samples (97. 7% of the total triclosan concentration) and the triclosan sulfate represented 21.7% of the samples (Provencher et al., 2014). Even more recently, studies by Arbuckle et al. (2015a ) have demonstrated that glucuronide metabolites and free (unconjugated) for ms of triclosan were detected in 25

PAGE 26

99% and 80%, respectively, of maternal urine samples from a study of nearly 2,000 Canadian pregnant women. Other studies have further confirmed that triclosan is converted to its glucuronide and sulfate conjugates in human liver microsomes and cytosol, respectively (Wang et al., 2004). Although triclosan sulfate and glucuronide were formed in the human liver at comparable rates when studied at low concentrations relevant to environmental exposure (1 to 5 M), the glucuronidation pathway is expected to predominate at triclosan concentrations greater than 20 M (Wang et al . , 2004). These reports support previously published findings by DeSalva et al. ( 1989) who demonstrated that all triclosan detected in human plasma was in its conjugated form. Unlike previous findings, pharmacokinetic studies by SandborghEnglund et al. (2006) showed that within 3 hours of a single 4 mg oral dose of triclosan to ten human volunteers, peak levels of unconjugated triclosan were observed in the pl asma (3035% of the total) and small amounts of unconjugated triclosan in the urine. The discrepancy between these results remains unclear. Additional studies have further illustrated the conjugation potential of triclosan upon percutaneous penetration of rat skin and dermal metabolism in diffusion cells fitted with human skin to reflect in vivo dermal penetration. After in vitro topical application of a 64.5mM 3H labeled triclosan solution, conjugation of triclosan was demonstrated, particularly to the gl ucuronide conjugate and to a lesser extent to the sulfate during passage through the skin (Moss et al., 2000). Whereas 23% of the total triclosan dose penetrated through rat skin, only 6.3% of the dose penetrated human skin (Moss et al., 2000). These in vitro studies illustrated that triclosan is a substrate for skin cytosolic 26

PAGE 27

sulfotransferases and dermal microsomal glucuronosyltransferases (Moss et al., 2000). An earlier study demonstrated that application of 1% triclosan in a soap formulation to the skin of rats and guniea pigs produced triclosan glucuronide as the major urinary metabolite (Black et al., 1975). More recent studies in B6C3F1 mice have also shown that triclosan is absorbed and metabolized by the skin to the sulfate and glucuronide conjugates (Fang et al., 2014). It should be mentioned that the ratio of these conjugations in vivo may depend on substrate concentration relative to the respective Km values (Temellini et al., 1991). With respect to enzyme affinity, triclosan sulfonation in polar bear liver was comparable to that in human liver (Sacco and James, 2005). Phase II Metabolism The biotransformation of endogenous and exogenous molecules consists of enzymatic processes that have been classified into phase I and phase II reactions. These cl assifications can often be misleading, in that they suggest there exists a sequential order in which these processes must occur; this is not the case. As a result, p hase I reactions may also be referred to as functionalization reactions because they typica lly uncover or introduce polar functional groups ( OH, SH, NH2) into a molecule. Phase II reactions, on the other hand, are generally called conjugation reactions because they often convert these functional groups into more hydrophilic compounds via the addition of a chemical moiety that is ionizable at physiological pH. These reactions are essential to convert lipophilic compounds into more water soluble, readily excreted metabolites in bile, urine, or feces. UDP glucuronosyltransferases (UGTs) and sulfo transferases (SULTs) represent key phase II drug metabolizing enzymes that metabolize numerous endobiotic and xenobiotic substrates. While glucuronidation and sulfonation may contribute to the conjugation of the same substrate, it is important to 27

PAGE 28

keep in m ind that there are several factors that determine which route of biotransformation is taken, including the dose or exposure level of the xenobiotic, the affinity of the xenobiotic for the specific SULT or UGT forms that metabolize it, the properties of the SULT or UGT enzyme, and/or the availability of cosubstrate. Unlike sulfotransferases, glucuronosyltransferases are low affinity, high capacity enzymes, and thus typically have significantly higher Km values for the same substrates undergoing biotransformation via sulfonation (Sacco and James, 2005). UDP Glucuronosyltransferases Glucuronidation is a phase II metabolic detoxification pathway that plays a significant role in the metabolic elimination and detoxification of many endogenous compounds (i.e. ster oid hormones, bile acids, and bilirubin), and drug and nondrug xenobiotics (i.e. “dietary, environmental, and industrial chemicals”) (Manevski et al., 2011; Rowland et al., 2013). These reactions are catalyzed by microsomal enzymes of the UDP glucuronosyl transferase (UGT) superfamily (Rowland et al., 2008) and require the cosubstrate, uridine 5’ diphosphoglucuronic acid (UDP -Dglucuronic acid; UDPGA), to transfer glucuronic acid to nucleophilic groups on structurally diverse substrates (Manevski et al., 2011; Rowland et al., 2013). While there is in vitro and in vivo evidence that some UGTs may use alternate uridine based sugars as the glycosyl donor (Tang, 1990; Radominska et al., 1993; Senafi et al., 1994; Chen et al., 2003; Mackenzie et al., 2003), the contribution and significance to drug metabolism of these alternate sugars in catalyzing glucuronidation reactions has not been thoroughly explored (Rowland et al., 2013). Nonetheless, conjugation can occur at hydroxyl, 28

PAGE 29

carboxylic acid, amino, and thiol f unctional groups. Again, this clearance mechanism assists in the conversion of lipophilic compounds to more polar, hydrophilic substances. Substances resulting from glucuronidation are known as glucuronides ( pKa ~4 5 ), and are typically much more water soluble than the aglycones from which they were originally synthesi zed. Apart from the -Dglucuronide conjugate that is produced during this second order nucleophilic substitution (SN2) reaction, uridine diphosphate (UDP) is also produced (Miners and Mackenzie, 1991; RadominskaPandya et al., 1999; Tukey and Strassburg, 2000). Figure 1 3 depicts the mechanism for the glucuronidation reaction. It has been postulated that upon substrate binding in the aglycone binding site, the C1UDP bond of UDPGA is destabilized by the nucleophilic attack of the substrate, leading to gluc uronide formation ( Hochman and Zakim, 1984). The transition state is believed to consist of a partially forming bond between the nucleophilic atom in the aglycone and a “partially breaking bond between the C1 atom and the UDP” of UDPGA ( Noort et al., 1990; RadominskaPandya et al., 1999). Glucuronide conjugates excreted in the bile may undergo extrahepatic recycling as a result of conjugate hydrolysis by glucuronidase and reabsorption of the parent compound by the intestine (Fisher et al., 2000). Although glucuronidation typically reduces pharmacological activity, there are certain instances where it is responsible for the activation of a drug. Upon direct administration to the central nervous system, morphine6 glucuronide, for example, is more potent than morphine itself at inducing analgesia (Christrup, 1997). Similarly, glucuronidation may serve as a bioactivation event for carboxylic acids. Some acyl glucuronides, for instance, may rearrange to form nonhydrolyzable conjugates or may 29

PAGE 30

covalently bind to cellular macromolecules, resulting in toxicity (Bailey and Dickinson, 1999; 2003). Nomenclature There is a system of nomenclature that places all the UGTs in a single superfamily, which is divided into families and subfamilies of enzymes based on their a mino acid sequence similarities. To date, there are 22 human UGTs, which are divided into four gene families: UGT1, UGT2, UGT3, and UGT8 (Mackenzie et al., 1997; 2005; Tukey and Strassburg, 2000) and three subfamilies: 1A, 2A, and 2B. Figure 14 illustrate s the naming system for a specific UGT allele. The two major families for xenobiotic glucuronidation are UGT1 and UGT2. Members of the 1A family exhibit more than 50% similarity in amino acid sequence to one another, but less than 50% similarity to members of the 2B family because the UGT2B family are encoded by separate genes (RadominskaPandya et al., 1999). While UGT1 and UGT2 family enzymes are most efficient at using UDPGA as the sugar donor for glucuronidation reactions, UGT3 and UGT 8 enzymes more oft en use UDP acetylglucosamine or a nucleotide sugar, such as UDP glucose and UDP xylose (Mackenzie et al., 2011). Only 7 of the various hepatically expressed enzymes appear to be of great significance to drug and xenobiotic metabolism and elimination: UGT1 A1, 1A3, 1A4, 1A6, 1A9, 2B7, and 2B15 (Kiang et al., 2005; Miners et al., 2010). Generally speaking, UGT1 enzymes catalyze the glucuronidation of small phenolic substrates and bilirubin, while UGT2 enzymes metabolize larger molecules, like steroids. UGT t issue distribution and e xpression The liver is a wellperfused organ that encompasses an extensive capacity for phase II metabolism and hence, serves as the major detoxification organ. As expected, 30

PAGE 31

UGTs are primarily expressed in this tissue, but also exhi bit variable expression in extrahepatic tissues including the intestine and kidney (Daidoji et al., 2005; Ohno and Nakajin, 2009; Rowland et al., 2013). In reference to drug metabolism, the kidneys and gastrointestinal tract are considered to be the sites of most importance of extrahepatic metabolism (Bowalgaha and Miners, 2001; Gaganis et al., 2007; Knights and Miners, 2010). Biotransformation in the intestine, for instance, is especially important f or orally ingested xenobiotics, such as triclosan. In re gards to UGT mRNA expression, there is a significant difference between different organs and between the same organs in different individuals (Rowland et al., 2013; Figure 1 5 ). While traditional methods for quantifying mRNA expression of UGTs (i.e. polymerase chain reaction (PCR) methods) may be specific, they are indirect and can sometimes lack correlation to protein expression. As a result, an alternative and novel targeted quantitative proteomics approach utilizing liquid chromatography tandem mass spec trometry with stable isotope labeling has been established to measure proteins in biological matrices (Fallon et al., 2013(a); Fallon et al., 2013(b)). This method may permit better estimations of xenobiotic clearance and rates of glucuronidation and may, subsequently, reduce the existing gap between “extrapolations to in vitro / in vivo predictions of metabolism” (Fallon et al., 2013(a); Fallon et al., 2013(b)). Despite these differences in expression, it is widely accepted that there is a greater abundance of UGT2B mRNA compared to UGT1A, and UGT2B4 is the most abundant isoform in human liver (Izukawa et al., 2009; Ohno and Nakajin, 2009; Court et al., 2012). Data regarding the renal expression of UGT is severely limited. While numerous UGTs may be expressed in the kidney, it is believed that 31

PAGE 32

UGT1A9 (45%), 2B7 (41%), and 1A6 (7%) account for approximately 95% of total renal UGT expr ession (Rowland et al., 2013). The pattern of ontogeny of UGTs has been extensively studied to determine any age dependent developmental changes in UGT activity (Strassburg et al., 2002; Zaya et al., 2006; Miyagi and Collier, 2007; 2011; Court, 2010; Miyagi et al., 2012). The onset of UGT activity has been reported during the late second or third trimester of pregnancy, with express ion levels of UGT1A3 in fetal and neonatal liver approximately 30% of that found in adult tissue (Strassburg et al., 2002). UGT1A1 mRNA and protein expression and activity in fetal liver, however, is practically nonexistent until after parturition when the enzyme reaches adult levels within 36 months of age (Kawade and Onishi, 1981; Strassburg et al., 2002; Miyagi and Collier, 2011). Alternatively, approximately 25% of adult liver expression of UGT2B4 is present in the neonate (Strassburg et al., 2002). UG T1A9 is also well expressed in neonatal liver (50% of adult expression level) and like 1A1, exhibits significant development in expression by 12 months of age (Miyagi et al., 2012). Similarly, approximately 80% of UGT1A4 activity is detected by age 6 (Miya gi and Collier, 2007). Despite these significant developmental changes in UGT expression, there are still discrepancies concerning the significance of aging on hepatic clearance of xenobiotics via glucuronidation (Verbeeck et al., 1984; Miners et al., 1988 ; Argikar and Remmel, 2009). The rate of glucuronidation of a xenobiotic can also be influenced by the tissue concentration of UDPGA (Sacco et al., 2008). The liver and other tissues, via NAD+dependent dehydrogenation of UDP glucose, can synthesize UDPGA. Hepatic UDPGA concentrations in humans were measured at 279 + 4 5 M , while reported intestinal 32

PAGE 33

concentrations were significantly lower (19.3 + 4. 5 M ) (Cappiello et al., 1991). These liver concentrations are similar to what has been reported in other mammals, including rats (400 M) and guinea pigs (413 M) (Goon and Kl aassen, 1992; Yamamura et al., 2000). Hepatic UDPGA concentrations in fish were measured at 21 M (carp), 115 M (trout), and 246371 M (catfish) (Zhivkov et al., 1975; Sacco et al., 2008). Enzyme c haracteristics UGTs are transmembrane proteins that are l ocalized in the endoplasmic reticulum (ER) (Burchell and Coughtrie, 1989). Most of the UGT protein, including the substratebinding site, is located on the luminal side of the ER membrane, with a small portion of the polar carboxyl terminus on the cytosoli c side (RadominskaPandya et al., 1999). Hnninen and Alanen initially proposed and confirmed that the UGT enzyme was buried behind a lipophilic barrier (Hnninen and Alanen, 1966). With their glucuronidation inhibition studies, Hnninen and Alanen demonst rated that the inhibitory potency of aliphatic alcohols positively correlated with their lipid solubility (Hnninen and Alanen, 1966; R adominska Pandya et al., 1999). As UDPGA is biosynthesized in the cytoplasm, t he positioning of the UGT active (binding) site on the luminal side of the ER suggests that there is an active transport process that carries the charged UDPGA from the cytosol to the inside of the ER, (Bossuyt and Blanckaert, 2001; Wlcek et al., 2014) and perhaps the removal of charged glucuronides from the luminal side of the ER to the cytosol (Meech and Mackenzie, 1997; 1998; RadominskaPandya et al., 1999). Several theories have been proposed about this transport process, one of which suggests the existence of transporters (Ouzzine et al., 2003) (Figure 16 ). Another theory holds that the UGTs themselves form 33

PAGE 34

dimers, making a “gate” by which the hydrophilic cosubstrate can gain access into the buried catalytic site in the membrane (Meech and Mackenzie, 1997; 1998) . The idea is that after conjugat ion, the glucuronide exits the luminal space via the same channel formed by the UGT dimers, and removal of the aglycone promotes disaggregation of the dimer. This dimeric separation allows the “two monomers to diffuse along the lipid bilayer and dimerize w ith other partners” (RadominskaPandya et al., 1999). While individual UGT enzymes exhibit distinct, and sometimes overlapping, substrate and inhibitory selectivity (Miners et al., 2010), the idea of dimerization, likely within the agylcone recognition dom ain between two different UGT monomers, has raised the possibility of heterodimers forming new substrate recognition sites that are different from the homodimeric forms of the enzymes (Ouzzine et al., 2003). O ne striking characteristic across all UGTs, irr espective of isoform, is the hydrophobicity of their substrates. This feature may be the result of the localization of UGTs within the membrane and the active site being positioned on the lumenal side of the ER. As a result, more hydrophobic substrates are expected to be better glucuronidated because their lipophilic nature promotes diffusion across biological membranes and facilitates tra nsport to the UGT active site (Ouzzine et al., 2003; Rowland et al., 2013). Furthermore, hydrophilic compounds serve as poor or nonsubstrates of UGTs, and instead are metabolized by soluble sulfotransferases (O uzzine et al., 2003). Interestingly, substrate size has not been illustrated to be critical for binding. This suggests that the UGT active site is both large and fl exible enough to accommodate substrates of different sizes or that only the functional group of the substrate enters the active center (O uzzine et al., 2003). 34

PAGE 35

Numerous studies have noted the significance of the N terminus of UGTs in aglycone substrate binding, and suggested that it may contain “structural determinan ts for substrate recognition” (O uzzine et al., 2003). Data supporting this claim demonstrated that exchanging the N terminal end of the protein between two UGT2B isoforms caused an interchange of their respective substrate s pecificities (Mackenzie, 1990; O uzzine et al., 2003). Additional studies have suggested that the C terminal half of the protein assists in binding the cosubstrate, UDPGA (Mackenzie et al., 1997). More recently it has been discovered that all UGTs contain a “conserved ‘signature sequence’ of 29 amino acids believed to be involved in the binding of the UDP sugar” (Mackenzie et al., 2005; Rowland et al., 2013). Interindividual variability and p olymorphisms Large differences in enzy me expression levels in various organs as well as the presence of allelic variants that compromise the catalytic activity of an enzyme can greatly contribute to interindividual variability of glucuronidation capacity across a population (Rowland et al., 2013; Tam, 1993). Genetic mutations in the coding regions and/or promoters of UGTs may result in loss of enzyme function (Rowland et al., 2013). Genetic variation of UGT1A1, for example, can result in enzyme deficiency, which can lead to severe and sometimes fatal diseases depending on the degree to which UGT1A1 activity is compromised (Rowland et al., 2013). More specifically, the UGT1A1*28 polymorphism can cause a UGT1A1 deficiency, which can lead to the accumulation of unconjugated bilirubin resulting in G ilbert’s syndrome (Yamamoto et al., 1998; Udomuksorn et al., 2007). Gilbert’s syndrome is a common hereditary condition in which a liver enzyme does not efficiently metabolize bilirubin, the resulting substance 35

PAGE 36

when the liver breaks down old red blood cell s (Innocenti et al., 2004). As a result of this enzyme abnormality, elevated levels of bilir ubin can be found in the blood. A normal UGT1A1 gene is characterized by the presence of six thymine adenine (TA) dinucleotides in the TATA box like sequence in the promoter region, designated A(TA)6TAA (Bosma et al., 1995; Monaghan et al., 1996; Biondi et al., 1999; Farheen et al., 2006). Individuals with the UGT1A1*28 polymorphism and Gilbert’s syndrome, however, have a TA insertion (Hsieh et al., 2007). The presence of seven TA repeats (designated A(TA)7TAA) instead of the wildtype number of six, results in reduced UGT1A expression and activity (Raijmakers et al., 2000; Innocenti et al., 2004). The TATA binding protein (TBP) is an essential transcription factor th at is necessary for transcription initiation, as it is the first factor in the transcription complex to bind to the TATA box and recruit other transcription factors (Hsieh et al., 2007). The binding affinity of TBP for the TATA box can be affected by alter ations in the nucleotides of the TATA box and can subsequently influence transcription. The proposed mechanism for the observed decrease in UGT1A1 activity of individuals with a TA insertion is believed to result from decreased affinity of the TATA box lik e sequence for the TBP (Hsieh et al., 2007). Different studies suggest that Gilbert’s syndrome is prevalent in approximately 515% of a population (Monaghan et al., 1996; Biondi et al., 1999; Lampe et al., 1999; Borlak et al., 2000; Raijmakers et al., 2000). In the Caucasian population, approximately 50% are wildtype [TA6/TA6], 40% are heterozygous mutant [TA6/TA7], and 10% are homozygous mutant [TA7/TA7] genotypes ( O’Dwyer and Catalano, 2006). Like that of the Caucasian group, the proportion of homozygous mutant [TA7/TA7] genotypes in 36

PAGE 37

individuals of African origin is approximately 10%, whereas this genotype is less than half that in the Asian population (Beutler et al., 1998; Lampe et al., 1999; O’Dwyer and Catalano, 2006). Sulfotransferases Sulfoconjugati on has been observed as early as 1875 by Baumann (Klaassen and Boles, 1997) and is an essential reaction in the phase II biotransformation of various endogenous and foreign substances, including drugs, toxic chemicals, hormones, and neurotransmitters. Ther e are two classes of sulfotransferases: 1) membrane bound sulfotransferases, located in the Golgi apparatus, and 2) cytosolic sulfotransferases. The membranebound sulfotransferases are responsible for modifying proteins, peptides, glycosaminoglycans, and lipids, while cytosolic sulfotransferases (SULTs) sulfonate relatively small endobiotics and xenobiotics, including steroids, neurotransmitters, and bile acids (Gamage et al., 2006). Sulfotransferase reactions are catalyzed by members of the sulfotransferase superfamily, which involves the transfer of a sulfuryl group (SO3 -) from the universal cosubstrate, 3’ phosphoadenosine5’ phosphosulfate (PAPS), to a nucleophilic/acceptor site on the substrate (Strott, 2002). The sulfate acceptor (often R OH) and enzy me cosubstrate (PAPS) bind to a sulfotransferase enzyme, producing desulfonated PAPS, 3’ phosphoadenosine 5’ phosphate (PAP), and the sulfate or sulfoconjugate. Figur e 17 illustrates the sulfonation reaction scheme. Members of the sulfohydrolase or sulfat ase gene family can subsequently hydrolyze the sulfonated product and regenerate the substrate as a free, de sulfonated entity ( Figure 18 ). The acceptor group involved in the reaction often classifies the type of sulfoconjugation that takes place. For example, phenols or alcohols would undergo O sulfonation, amides N sulfonation, and 37

PAGE 38

thio phenols or thiols , S sulfonation (Strott, 2002). O sulfonation represents the dominant cellular sulfonation reaction because the hydroxyl group present in a number of comp ounds like phenols, alcohols, and hydroxylamines is the most common acceptor of the sulfuryl gr oup (Klaassen and Boles, 1997). Sulfoconjugation is often effective in rendering xenobiotics less active, allowing them to be readily excreted because they are m ore water soluble than the parent chemical. In most cases, sulfate conjugation is coupled with a decrease in the biological activit y and an increase in the detox ication and excretion of the sulfonated metabolites. With pKa values between 1.5 and 2, sulfates remain fully ionized at physiological pH in biological systems (Strott, 2002), which decreases their passive penetration through cell membranes (Glatt et al., 2001). The sulfate esters formed by numerous endogenous and exogenous substrates, including steroid hormones, neurotransmitters, and alcoholic and phenolic drugs, are generally biologically inactive. Despite its classification as a detoxification enzyme, however, sulfotransferases are also sometimes responsible for the activation of xenobiotics (i.e. aromatic amines, the hydroxy methyl metabolites of methyl substituted polycyclic aromatic hydrocarbons) and other mutagenic and carcinogenic compounds that have been implicated in various cancer forms (Coughtrie, 1996; Strott, 2002; Gamage et al., 2005). The sulfate group resulting from O sulfonation is electronwithdrawing and serves as a good leaving group in certain positions, thus some sulfates are short lived and result in electrophilic compounds (Glatt et al., 2001). These sulfates that subsequently become strong electrophiles may covalently bind with DNA, proteins, and other cellular nucleophiles (Glatt et al., 2001). 38

PAGE 39

Furthermore, sulfoconjugation by membrane sulfotransferases can influence protein and peptide functionality. During posttranslational modificiation, for example, the tyrosine residues in numerous secretory and membrane proteins and peptides co mmonly undergo poorly reversible/irreversible sulfonation, which significantly alters their functionality (Huttner, 1988; Niehrs et al., 1994). Some neuropeptides, like cholecystokinin (CCK), require tyrosine sulfonation to become biologically active, while other peptides, like leu enkephalin, are inhibited by such sulfonation (Huttner, 1988; Unsworth et al., 1982). Similarly, the biological activit y of glycoprotein hormones can be significantly affected when the sugar residues become sulfoconjugated (Baenziger, 1996; Hooper et al., 1996). Nomenclature Sulfotransferases are a multigene family of enzymes that have often been named after their substrat es, but like UGTs, different SULTs have overlapping substrate specificities making this naming system misleading (Glatt et al., 2001). Nomenclature for this enzyme superfamily now follows the pattern established for other enzyme superfamilies. Members of e ach family, indicated by the Arabic number after “SULT,” display at least 45% amino acid sequence similarities, whereas members of each subfamily show at least 60% amino acid sequence identity (Glatt et al., 2001) . Although 13 human cytosolic SULT isoforms have been identified, four families exist in human tissues: SULT1, SULT2, SULT4, and SULT6. Of these four, the SULT1 and SULT2 families are the largest and most responsible for conjugating the majority of endogenous and xenobiotic SULT substrates (Kauffma n, 2004). However, SULT1A1 and SULT1E1 are responsible for most of the hepatic sulfotransferase activity of phenols and estrogens, res pectively (Glatt et al., 2001). 39

PAGE 40

SULT tissue distribution and e xpression Although sulfotransferase activity has been detect ed in numerous adult tissues, including the liver, kidney, intestine, brain, adrenals, and platelets, SULT activities toward different substrates can exhibit vast differences in respect to tissue distribution (Figure 1 9 ). Sulfotransferase is more developed than glucuronosyltransferase in midgestation human fetal liver (Pacifici et al., 1993). Unlike some P450s and UGTs, which are absent or present at low levels in the fetus (Hines and McCarver, 2002; McCarver and Hines, 2002), cytosolic and membranebound sulfotransferases are expressed in the placenta and the developing human fetus (Barker et al., 1994; Hume and Coughtrie, 1994; Hume et al., 1996; Richard et al., 2001; Stanley et al., 2001; Alnouti and Klaassen, 2006). Maximal expression of human hepatic SULT1E1, specifically, has been found during the initial stages of liver development (828 weeks gestational age) (Duanmu et al., 2006). Studies have even detected hepatic SULT1E1 enzyme activity between 17 and 21 weeks of gestation (Miki et al., 2002). St anley et al. (2005) also discovered robust levels of SULT2A1 in fetal liver and a number of extrahepatic tissues. The sulfonation reaction has a strict requirement for PAPS, whose cellular concentration is often the limiting factor that determines the ext ent of sulfonation of a xenobiotic substrate. Although PAPS concentrations vary between tissues, the liver serves as the tissue with the greatest concentration (steady state concentration in the liver is approximately 50 M). However, compared to tissue co ncentrations of UDPGA (200 nmol/g of liver), PAPS concentrations are low (480 nmol/g tissue) (Klaassen and Boles, 1997). PAPS has been detected in a number of human tissues (Cappiello et al., 40

PAGE 41

1989), including the human fetal liver (10.1 + 0.9 nmol/g tissue), adult liver (23.4 + 2.4 nmol/g tissue), and placenta (3.6 + 1.1 nmol/g tissue) (Cappiello et al., 1990). In mammals, all tissues are able to carry out the synthesis of PAPS, whose availability in vivo is dependent on its synthesis from endogenous sulfate, degradation, and utilization (Klaassen and Boles, 1997; Strott, 2002). Sulfate (SO4 2 -) is an important nutrient in various cellular and metabolic processes necessary for human growth and development. It may be synthesized from the diet (magnesium sulfa te, sodium sulfate, etc.) and from the catabolism of proteins and sugar sulfates or the intracellular metabolism of sulfur containing amino acids, like methionine and cysteine (Dawson, 2011). However, as fetal tissues have “a limited capacity to produce s ulfate,” the developing fetus relies on sulfate transported (via placental sulfate transporters) from the maternal circulation (Dawson, 2011). There is evidence that during pregnancy, circulating serum sulfate concentrations have increased and reached peak levels in the second and third trimesters (Tallgren, 1980; Morris and Levy, 1983; Cole et al., 1984; 1985). Enzyme c haracteristics SULTs are composed of an motif containing helices that surround a fivestranded parallel sheet (Wang and James, 2006). The sheet comprises the PAPS binding site and the core of the catalytic site (Wang and James, 2006). Crystallography studies have discovered that struc tural features of the binding domain for PAPS (a phosphate binding loop (PSB loop)) are conserved in both classes of sulfotransferases (Yoshinari et al., 2001; Wang and James, 2006). The substratebinding region of SULTs, which is usually a deep, flexible, hydrophobic pocket containing different amino 41

PAGE 42

acids responsible for distinct (yet often overlapping) substrate specificities, constitutes the largest extent of structural variation (Wang and James, 2006). The proposed reaction mechanism, as observed in the crystal structures of human estrogen sulfotransferase (SULT1E1), suggests that upon binding of the estradiol, catalysis is initiated by the conserved His107 acting as a catalytic base, coordinating with the acceptor group of the substrate (Pedersen et al ., 2002). The histidine abstracts a proton from the 3hydroxyl position of estradiol, leaving the oxygen nucleophilic enough to attack the 5’ sulfate group of PAPS. To advance catalysis, Lys47 undergoes a conformational change where it binds with the bridg ing oxygen between the 5’ phosphate and 5’ sulfate group from PAPS, and assists with the dissociation of the sulfonate (Pedersen et al., 2002). This mechanism suggests that a serine not only interacts with the 3’ phosphate of PAPS to position it in catalyt ic mode, but it may also play a vital role in regulating the action of Lys47 in controlling the dissociation of the sulfonate group (Negishi et al. , 2001; Pedersen et al., 2002). Interindividual variability and p olymorphisms As is the case with UGTs, genet ic polymorphisms and interindividual variation have been described for sulfotransferases (Glatt et al., 2001). More specifically, greater than a 50fold interindividual variation for SULT1A1 activity towards 4nitrophenol has been observed (Raftogianis et al., 1997). Estrogen S ulfotransferase Sulfonation plays a vital role in the transport of steroids. Natural estrogens are steroid hormones that, w hile present in both men and women , are usually present at considerably higher levels in women of reproductive age. Estrone (E1), estradiol (E2), and estriol (E3) are the three major naturally occurring estrogens. The sulfated, inactive 42

PAGE 43

forms of estrone and dehydroepiandrosterone (DHEA) are the primary “transport forms” of steroids and serve as the precursors of androgen and estrogen biosynthesis (Morato et al., 1965; Hobkirk, 1985; Mortola and Yen, 1990). Estradiol, in vivo, is interconvertible with estrone by the action of hydroxysteroid dehydrogenase. The liver serves not only as a site for biosynthesis of estrogens, but also as a site for their biotransformation (Hern ndez et al., 1992). Estrone, estradiol, and their metabolites may undergo sulfonation by sulfotransferases (SULTs), but may also be deconjugated by s ulfatases (STSs). While estrone sulfate (concentrations as high as 4 ng/mL in fetal plasma and 2 ng/mL in maternal plasma) is the major component of circulating estrogens, estradiol (circulating estradiol sulfate concentrations approxi mately 1 ng/mL) is the most active form of estrogen (Tsang, 1974; Carnegie and Rober tson, 1978; Wood et al., 2003). Sulfonation serves as a highaffinity, low capacity conjugation reaction that can effectively operate at low substrate concentrations (Sacco and James, 2005). The phenol sulfotransferase, SULT1A1, has a Km for the steroid hormone, estradiol , of approximately 2 M (Harris et al., 2000) and similarly, the hydroxysteroid sulfotransferase, SULT2A1, exhibits a Km for estradiol 3 sulfonation of approximately 1.5 M, and 3 M for estradiol 17sulfonation (Wang and James, 2005). Although 17 estradiol may be efficiently metabolized by SULT1A1, 1A3, and 2A1 at high enough concentrations, estrogen sulfotransferase (SULT1E1) has an extremely high affinity for estrogen substrates (Glatt et al., 2001). The Km for E2 sulfonation by SULT1E1 is about 4 nM (Zhang et al., 1998). 43

PAGE 44

Estrogen sulfotransferase, or SULT1E1, belongs to the family of cytosolic sulfotransferases and is the major isoform responsible for estradiol sulfonation at physiological concentrations (Rohn et al., 2012). SULT1E1 isolated from different species had a mo nomeric molecular weight ranging from 30 kDa in the mouse (Hobkirk et al., 1983; Hobkirk et al., 1985) to approximately 36 kDa in humans (Kapoor et al., 2007). Activity for this specific isoform has been found in male and female reproductive tissues, kidne y, brain, liver and the adrenal cortex (Hobkirk, 1985). As sulfotransferases and PAPS are both present in the midgestation human fetal liver, estrogen sulfotransferase activity has been demonstrated in human fetal brain, skin, lungs, liver, and kidneys (W engle, 1966; Pacifici, 2005). In addition, steroid sulfatase activity was found to be particularly high in fetal placenta (Miki et al., 2002). While steroid sulfates may be eliminated and detected in urine, sulfonation generally modifies protein binding to influence transportability (Strott, 1996). Steroids that have undergone sulfoconjugation circulate at concentrations several fold higher than their unconjugated forms due to the binding of sulfates to serum proteins, which increases their carriage capacit y in plasma and reduces their rate of clearance (Puche and Nes, 1962; Wang et al., 1967(a); Wang et al. , 1967(b); Nieschlag et al ., 1973; Nishikawa and Strott, 1983). This high concentration of circulating steroid sulfates can be readily transported in the blood around the body and serves as intracellular stores from which free, unconjugated/active steroids can be produced via sulfatase enzymes (Pion et al., 1966; Vagnoni et al., 1998; Kester et al., 2000). The sulfonation of 17 estradiol is well documented in a number of studies involving human liver (Hern ndez et al., 1992), human cell lines (Falany and Falany, 44

PAGE 45

1996; Kotov et al., 1999), recombinant SULTs (Falany et al., 1994; 1995; Wang and James, 2005; Zhang et al., 1998), and channel catfish liver (Wang and James, 2007). In the liver, estradiol can undergo conjugation to either the sulfate or glucuronide metabolites. Due to the two hydroxyl groups in its molecular structure, estradiol can produce sulfates at both, the 3 and 17 position (Wang and James, 2005). In human liver, SULT1E1 transfers the sulfuryl group from PAPS onto the 3hydroxyl of 17 estradiol thereby forming only estradiol 3 sulfate (Wang and James, 2005). SULT1E1 is the primary isoform responsible for the biotransformation of estradiol into its 3sulfate (Wang and James, 2005). SULT2A1, on the other hand, can form the 3, 17 and 3, 17 sulfates (Wang and James, 2005). Figure 1 1 0 depicts the enzymat ic activity of estrogen sulfotransferase towards estradiol. Although estrogen sulfates can cross the cell membrane via a transporter dependent mechanism (Hobkirk, 1985; Qian et al., 2001), the conjugation of estrogens with the negatively charged sulfogroup drastically alters or completely abolishes the binding of the steroid to its specific receptor (Wang and James, 2006). The estrogen sulfates are thus considered inactive because they do not show any hormonal activity or relevant affinity to steroid receptors (Hhnel et al., 1973). However, hydrolytic cleavage of the sulfo group from estradiol sulfate by sulfatases regenerates the “receptor active form” of the steroid (Iwamori, 2005; Ghosh, 2007; Sun and Leyh, 2010). Sheep studies have demonstrated that placental estradiol 3 sulfate, for example, is taken up by the fetal brain, and desulfonated by steroid sulfatases to estradiol where it serves as a stimulator of fetal adrenocorticotropin (ACTH) secretion (Wood, 2005). 45

PAGE 46

Estrogens, pregnancy, and fetal development Estrogens produced by the placenta are key factors in implantation and embryo development. During pregnancy, for example, estrogens are involved in the initiation and maintenance of pregnancy, and can modulate several critical processes surrounding fetal growth and development (Magness et al., 1993; 2005; Vagnoni et al. , 1998). Placental estrogen is involved in the regulation of progesterone biosynthesis (Petraglia et al., 1995) and helps maintain a high uterine blood flow, which is necessary for the delivery of oxygen and nutrients to the developing fetus (Magness et al., 1993; 2005; Vagnoni et al. , 1998; Honkisz et al., 2012). During late pregnancy, the placenta, known to highly express the estrogen sulfotransferase enzyme (Hoffmann et al., 2001; Stanley et al., 2001), provides most of the estrogen that circulates in fetal blood, where it is mostly in its sulfoconjugated form (Honkisz et al., 2012). The sulfoconjugated estrogens serv e as reservoirs of precursor estrogens, which are then made available in target tissues by the action of steroid sulfatase (Falany et al., 1994; Purinton et al., 1999). During pregnancy, the placenta forms a vital interface between the developing fetus and its mother. As pregnant women are the guardians of their unborn baby’s development and future health, any external influences on the baby predominantly come from the mothers. During pregnancy, the developing fetus is exposed to potentially toxic xenobioti cs, which are transferred from the mother to the fetus via the placenta (Myllynen et al., 2005; Dawson, 2011). The maternal fetal unit contains sulfotransferases that are positioned to control transplacental drug detoxication and hormone metabolism in the developing fetus. Unsurprisingly, placental thrombosis and mid gestation fetal loss in mice has been associated with loss of the placental estrogen 46

PAGE 47

sulfotransferase gene (Tong et al., 2005; Dawson, 2011). Disruption of the mouse SULT1E gene also resulted in structural lesions in the adult male testis and a significant decrease in fertility in fem ale mice (Qian and Song, 1999). Sulfotransferase activity and the hydrolytic activity of sulfatase have been shown to occur in the human fetus (Wengle, 1966; Richard et al., 2001; Pacifici, 2005). Because UGTs are not readily detected in the fetus (Strassburg et al., 2002), it is believed that liver sulfotransferases are the primary detoxification enzymes that play a vital role in modulating hormone homeostasis duri ng embryogenesis. In this way, inhibition of sulfotransferase or sulfatase enzymes may have important implications for human health (Wang and James, 2006). Possible d isruption of normal fetal d evelopment by i nhibitors Although the incidence of recurrent pr egnancy loss (defined as 3 consecutive losses prior to 20 weeks from the last menstrual cycle) is approximately 12% in healthy fertile women (B ricker and Farquharson, 2002), spontaneous pregnancy loss is a common occurrence. Pregnancy failure accounts for approximately 15% of all clinically recognized pregnancies, and it is suspected that many more fail prior to being clinically recognized (Ford and Schust, 2009). T he cause of pregnancy loss for more than 40% of all cases remains unidentifiable ( Ford and S chust, 2009; Jaslow et al., 2010). More recently, however, Honkisz et al. (2012) noted that “disturbances in placental hormone secretion are the most frequent cause of abortion or preterm birth.” It has been documented that hormones play vital roles in the initiation and maintenance of pregnancy through complex regulatory pathways, and endocrine and immune transactions (Stanley et al., 2001; Kumar and Magon, 2012). Furthermore, disruptions in 47

PAGE 48

hormone metabolism may lead to severe and persistent developmental issues and may contribute to pregnancy loss. The inhibition of SULT activity can be caused when a molecule occupies the PAPS binding region, substrate binding region, or both (Wang and James, 2006). Different inhibitors can exhibit different types of SUL T inhibition (competitive, noncompetitive, or mixed) in different tissues. Competitive inhibitors occupy one or both of the binding sites for the PAPS cofactor or for the SULT substrate, whereas noncompetitive inhibitors do not occupy the binding region of the substrate (Wang and James, 2006). Mixed inhibition can occur when the inhibitor can bind to the enzyme whether or not the substrate has already bound, but the inhibitor has a greater affinity for one state (bound or unbound by substrate) over the ot her. In cases where the inhibitor prefers to bind the free enzyme, the inhibition is referred to as competitive/noncompetitive. With this type, substrate binding to the enzyme decreases the affinity of the enzyme for the inhibitor (Wang and James, 2006). T he opposite is true when the inhibition i s uncompetitive/noncompetitive. Sulfotransferases exist as dimers and studies of the catalytic mechanism of human estrogen sulfotransferase have suggested that the enzyme contains two binding sites; one being the ca talytic site, while the other is an allosteric site that regulates enzyme turnover rate (Zhang et al., 1998). At high substrate concentrations, substrate inhibition is commonly observed in sulfate conjugation, especially with estrogen sulfotransferase. The estrogen sulfotransferase enzyme is composed of a dimer of identical subunits and was found to be only half site reactive, where only one of the dimer subunits binds the substrate and produces product during a given catalytic cycle 48

PAGE 49

(Sun and Leyh, 2010). S tudies utilizing human recombinant SULT1E1 illustrated that maximum sulfonation of estradiol was observed at 20 nM, but with increasing concentrations, substrate inhibition was observed (Falany et al., 1995). Further analysis using substrate inhibition mod els demonstrated that at high concentrations, estradiol inhibits SULT1E1 (via two substrate inhibition) by binding to the enzyme after formation of the product (Falany et al., 1995; Zhang et al., 1998; Sun and Leyh, 2010). Under saturating conditions of PA PS, the ability of two estradiol molecules to independently bind to the SULT1E1 suggested that the binding site consisted of a catalytic and allost eric site (Zhang et al., 1998). Various hydroxylated polychlorinated biphenyls (OH PCBs) and polyhalogenated aromatic hydrocarbons (PHAHs) serve as potent inhibitors of human SULT1E1 at subnanomolar conc entrations (Kester et al., 2000; 2002). Polychlorinated biphenyls (PCBs) are persistent environmental pollutants whose phase I metabolites, OH PCBs, are extremely potent inhibitors of human (and fish (Wang and James, 2007)) estrogen sulfotransferase and have been shown to exert a variety of toxic effects, including impaired sexual development and reproductive function (Kester et al., 2000). In animals, prenatal exposure to PCBs resulted in significant teratogenic and developmental toxicities, and transplacental exposure in humans caused severe adverse effects as well (Guo et al., 1995). By inhibiting the formation of inactive estrogen sulfates, OH PCBs can increase the concentration of active estrogen in target tissues and indirectly exert estrogenic effects (Kester et al., 2000). From these studies, Kester et al. (2000) suggested that PCB metabolites are noncompetitive inhibitors and act by binding to the second, al losteric site o n the sulfotransnferase enzyme. 49

PAGE 50

However, structural similarities of OH PCBs to estrogens led to the discovery that some of these metabolites can mimic the action of estrogen. Acting as competitive inhibitors, the OH PCBs were able to bind to various receptors (Shevtsov et al., 2003) and cause the estrogen receptor to translocate to the nucleus and bind to estrogen response elements in vitro (Connor et al., 1997; Garner et al., 1999). Triclosan’s similar structure to hydroxy PCBs initially sug gested that triclosan may also act as a sulfotransferase inhibitor. Indeed, triclosan has since been shown to act as both a substrate and inhibitor of the sulfonation and glucuronidation detoxification pathways (Wang et al., 2004; Jackson et al., 2013). Mo re specifically, triclosan is recognized as a potent inhibitor of estradiol and estrone sulfonat ion in sheep placenta (James et al., 2010). The IC50 value for estrone sulfonation was 0.6 0.06 nM, and the inhibition of estradiol was shown to be mixed/uncompetitive, with a Kic of 0.09 0.01 nM and a Kiu of 5.2 2.9 nM (James et al. , 2010). Although studies have reported that triclosan can be sulfonated by sheep placental cytosol, the rates of triclosan sulfonation were negligible at the low nanomolar conc entrations at which triclosan inhibited estrogen sulfonation (James et al., 2010). As SULTs significantly contribute to the metabolism of endogenous and exogenous compounds, the inhibition of individual sulfotransferase isoforms can lead to the accumulation of xenobiotics and other toxi ca n t s in the body. Wang et al. (2004), for example, demonstrated that triclosan acted as a noncompetitive inhibitor of the sulfonation of 3OH BaP, which could lead to its prolonged exposure and perhaps more extensive metabolism to more toxic metabolites. Low micromolar concentrations of triclosan also inhibited the human hepatic cytosolic sulfonation of bisphenol A, 50

PAGE 51

acetaminophen, and other compounds (Wang et al., 2004). In addition, nonsteroidal anti inflammatory drugs, salicylic acid and mefenamic acid, inhibit both human adult and fetal liver sulfotransferase (Vietri et al., 2000; Pacifici, 2005). With respect to human pregnancy, the effect of triclosan on women’s fecundity was assessed using time to pregnancy (TTP) as the epidemiologic metric (Vlez et al., 2015). The analyses were conducted in nearly 1,700 women during their first trimester of pregnancy. Not only was triclosan detected in maternal urine, but the study also suggested that high triclosan exposure might be associated with diminished fecundity (Vlez et al., 2015). However, as this study is recognized as the first to demonstrate an impact of triclosan exposure on time to pregnancy, the authors acknowledge that additional studies are required to elucidate the potential influence of triclosan on human pregnancy and fetal development. Sulfatases The sulfatase enzyme family plays a vital role in maintaining homeostasis of sulfo conjugates and regulating the sulfonation states that determine the function of a wide variety of substrates. They are responsible for hydrolyzing the sulfate ester (or sulfamate) bonds from small, sulfoconjugated steroids to large and complex sulfated carbohydrates (Hanson et al., 2004; Ghosh, 2007). Sulfatases are generally regarded as ar ylsulfatases because many eukaryotic sulfatases were initially discovered using small aryl substrates, such as pnitrophenol sulfate or 4methylumbelliferone sulfate (Hanson et al., 2004; Ghosh, 2007). Human sulfatases can be found in the lysosome, Golgi apparatus, cell surface, or in the endoplasmic reticulum. Arylsulfatases A (ARSA) and B (ARSB) are lysosomal enzymes and represent the water soluble forms of the enzyme, while steroid sulfatase 51

PAGE 52

(also know n as arylsulfatase C , or STS) and arylsulfatases D G a re microsomal enzyme s that reside in the endoplasmic reticulum and are membrane bound (Hanson et al., 2004; Ghosh, 2007). The steroid sulfatase has been located in a number of human tissues including the placenta, skin fibroblasts, breasts, and fallopian tubes (Burns, 1983; Nol et al., 1983; v an der Loos et al., 1984; Dibbelt and Kuss, 1986; Vaccaro et al., 1987; Stein et al., 1989; Suzuki et al., 1992; 2003; Purohit et al., 1998; Hernandez Guzman et al., 2001; Yanaihara et al. , 2001) and is responsible f or hydrolyzing several aryl and steroidal substrates efficiently. The presence of human sulfotransferases and sulfatases is very important for biological processes, including the biosynthesis of hormones in the endoplasmic reticulum (Hanson et al., 2004). In fact, the estrogen receptor and steroid sulfatase enzymes are coexpressed in many estrogenresponsive tissues (Purinton et al., 1999). Defects in several human sulfatases have been associated with disruptions in fetal bone development (Dawson, 2011). T o date, 17 human sulfatases have been identified, which share considerable similarities in sequence homology and tertiary fold (Ghosh, 2007). The catalytically active amino acid residues at the N terminus of the polypeptide chain are highly conserved and s uggest that there is a common mechanism by which the family of sulfatases carries out hydrolysis (Ghosh, 2007). However, STS is structurally unique from the lysosomal sulfatases in that it has a membranespanning domain that borders the lipid bilayer and c ontributes to the architecture of its active site. T he refore, the observed variation in substrate specificity for the individual sulfatases is likely due to subtle differences in the amino acid sequences at the C terminal region that compose the substratebinding pocket (Hanson et al., 2004; Ghosh, 2007). The substratebinding 52

PAGE 53

pocket contains a divalent cation, often calcium, and a catalytically important cysteine residue. Cysteine, in particular, is conserved in both, prokaryotic and eukaryotic, sulfatases and is post translationally modified into formylglycine (FG) (Schmidt et al., 1995). The formylglycine must be converted into its active form, hydroxyformylglycine (HFG), by a water molecule for sulfatase activity to occur (Schmidt et al., 1995; Recksiek et al., 1998). One proposed mechanism for sulfatase activity suggests that the sulfur atom of the sulfate undergoes nucleophilic attack by one of the hydroxyl groups of HFG, resulting in the release of the unconjugated substrate ( Figure 111; Hanson et al. , 2004; Ghosh, 2007). Meanwhile, the other hydroxyl group on HFG is deprotonated by a neighboring histidine residue and reacts to release the HSO4 moiety and reform FG (Hanson et al., 2004; Ghosh, 2007). Significance and Specific Aims There is evidence th at pregnant women are commonly exposed to triclosan (in hand soap, toothpaste, and other products), and that triclosan can cross the human placenta into the fetal circulation where it may concentrate in the fetus (Woodruff et al., 2011). At the same time, intrauterine growth retardation is a relatively common and growing problem in our society. E pidemiologic studies have found an association between prenatal exposure to chemicals and various adverse reproductive and developmental outcomes, including pregnancy loss, pret erm birth, childhood morbidity (Wigle et al., 2008) and reduced fecundity (Vlez et al., 2015) . These findings may have significant relevance to human pregnancy considering that environmental chemicals, like triclosan, can inhibit estrogen sul fotransferase enzyme activities. These studies, however, report associations and do not infer causality, so there are still uncertainties regarding the relationship between chemical exposure and fetal risks. Due to the rising 53

PAGE 54

concern regarding the risk of adverse reproductive health effects during fetal development from exposure to toxicants, the following specific aims are geared to provide insight into the possible adverse effects that an environmental chemical, like triclosan, can pose to human pregnancy . This research focuses on triclosan due to the widespread human exposure, emerging importance and increasing concern of triclosan use and safety. Specific Aim 1: Triclosan Glucuronidation Although it is understood that triclosan undergoes glucuronidation in the human liver, this aim addresses the hypothesis that triclosan elimination, via the glucuronidation detox i fi cation pathway, varies between individuals . T he expression of different UGT isoforms involved in triclosan metabolism can vary significantly i n human population, which may cause considerable differences in the observed biotransformation and excretion of triclosan from the body. G enetic mutations in the coding regions and/or promoters of UGTs may also influence glucuronidation variability by a particular UGT isoform, and result in altered rates of triclosan metabolism. Since preliminary studies with expressed recombinant UGTs in the James lab implicated UGT1A1 as a major contributor to triclosan glucuronidation, this aim also sought to test the hy pothesis that variability in UGT1A1, due to known polymorphisms, will affect triclosan glucuronidation. Specific Aims 2 and 3: E ffect of Triclosan on Formation and Hydrolysis of Estrogen Sulfates As the placenta serves as an essential source of estrogens to a developing fetus due to its high expression of SULT1E1, inhibition of placental estrogen sulfotransferase by triclosan is likely to affect the delivery of estrogens from the placenta to the 54

PAGE 55

developing fetus (James et al., 2010). Additionally, the inhi bition of sulfatase enzymes can interrupt the formation and action of unconjugated, active estrogens in target tissues. The two specific aims pres ented here are of significance because one focus es on the effect of in vivo triclosan treatment on estrogen sulfonation in physiologically relevant tissues, the placenta and liver , and the other examines the inhibitory effect of triclosan in a human cell line. Specific a im 2 Specific aim 2 consists of two parts. Part (a) is t o test the hypothesis that triclosan tr eatment of sheep results in lower estrogen sulfonation activity in sheep placental cytosol samples. The physiological functions of the placenta in providing estrogen to the developing fetus have been examined in previous studies using the pregnant sheep animal model (James et al., 2010). Results have suggested the possibility that triclosan exposure to pregnant sheep, and by analogy pregnant women, may endanger pregnancy by reducing total placental estrogen secretion and disrupt subsequent estrogen action i n target tissues (James et al., 2010). The experiments in this project utilized samples isolated from placental cotyledon (fetal placental tissue) of pregnant ewes treated with triclosan to test the hypothesis that exposure to triclosan will decrease the a bility to form sulfoconjugated estrogen. In addition, results from previous studies have suggested that triclosan acts as an uncompetitive inhibitor of sheep placental steroid sulfatase activity and is a competitive inhibitor of arylsulfatase in sheep liver microsomes (James et al., 2010). Therefore, part (b) of this aim sought to test the hypothesis that triclosan and triclosansu l fate inhibit sulfatase activity in sheep placental and human liver microsomal samples. 55

PAGE 56

Specific a im 3 To test the hypothesis that triclosan inhibits the formation and secretion of estrogen sulfates in a human cell line . This project tested the hypothesis that triclosan will decrease secretion of sulfoconjugated estrogen by inhibiting estrogen sulfotransferase. 56

PAGE 57

Figure 11. Structure and chemical properties of t riclosan. O O H C l C l C l O O C l C l C l S O H O2C H O H O H O O C l O C l C l O O H O T r i c l os a n T r i c l os a n G l u c ur o n i d e T r i c l os a n S u l f a t e S U L T s U G T s Fi gure 12. Biotransformation of t riclosan by UDP glucuronosyltransferases (UGTs) and sulfotransferases (SULTs). Chemical Identification: Mol ecular Formula: C12H7Cl3O2 Molecular Weight: 289.54 g/mol pKa: 7.9 log Kow: 4.76 Water Solubility: 0.01 g/L O O H C l C l C l Triclosan 57

PAGE 58

O HO HO OH O HO O P O P O OH O OH O NHN O O HO OH HOP O P O OH O OH O NHN O O HO OH XH RX= O, N, or S+Uridine diphospho glucuronic acid (UDPGA)CosubstrateNucleophilic aglycone substrate O HO HO OH O HO O P O P O O OH O NHN O O HO OH X R H UDP glucuronosyltransferaseSN2 ReactionOH Transition StateO HO HO OH HO O X R +Glucuronide ConjugateUridine Diphosphate (UDP)H H H Figure 13. Glucuronidation r eaction scheme. Figure m odified from (Rowland et al. , 2013). 58

PAGE 59

Figure 14 . Dissection diagram of a representative microsomal UDP glucuronosyltransferase allele name. The UGT allele name contains superfamily, family, subfamily, isoform, and allele designations. 59

PAGE 60

F igure 15 . mRNA expression values for several human glucuronosyltransferases involved in the biotransformation of xenobiotics. All numbers are percentages of total UGTs expressed within the respective tissue. Kidney expression is not illustra ted because there are conflicting reports on renal expression of numerous UGTs. Numerical d ata was obtained from (Rowland et al. , 2013) and represent s the combined average from (Ohno and Nakajin, 2009) and (Court et al., 2012). 60

PAGE 61

ERCytosol Charged UDPGALumen UPTAKE TRANSPORTEREFFLUX TRANSPORTER UGT Substrate GlucuronideConjugate Figure 1 6 . Hypothetical topology model for human UGT, with UDPGA and glucuronide transporters across the membrane escorting UDPGA into the lumen and glucuronides out into the cytosol, respectively. Figure modified from (Rowland et al. , 2013). 61

PAGE 62

N N N N NH2 O OH O H H H H P O OO OP O S -O O O O OPAPSN N N N NH2 O OH O H H H H P O OO OP -O O OPAP + R-OH or R-NH2SulfotransferaseS O O OO R S O O OH N R or + Sulfoconjugate Substrate Figure 17 . Sulfonation reaction s cheme. 62

PAGE 63

Figure 18 . The formation of sulfate esters by s ulfotransferases and subsequent hydrolysis by sulfatase enzymes . Permission to reuse figure obtained from (S trott, 2002). 63

PAGE 64

Figure 19. The e xpression of five h uman sulfotransferase enzymes in four different tissues. All numbers are percentages of total SULTs in respective tissues. The h igh est expression of total SULTs was observed in the liver (2,3007,900 ng/mg cytosol protein) and intestin e (190015,900 ng/mg cytosol protein) compared to the kidney (240730 ng/mg cytosol protein) and lung (100 370 ng/mg cytosol protein) . Permission to reuse figure obtained from ( Riches et al., 2009) . 64

PAGE 65

H O O H H O3S O O H 1 7 e s t r a d i o l1 7 e s t r a d i o l 3 s u l f a t e S U L T 1 E 1 P A P S P A P Figure 110. Estradiol sulfonation by SULT1E1. Using PAP S as a sulfate donor, estrogen sulfotransferase catalyzes the sul foconjugation of the 3hydroxyl group of estradiol. 65

PAGE 66

Enzyme O H Formylglycine (FG) Ca2+ H2OEnzyme O HO H Hydroxyformylglycine (HFG) HSO4 -H Ca2+H3 +N NH N His 136 Lys 134 S O O O O R HN N 290 His +H2N 368 Lys Enzyme O O H S HFG sulfateNucleophilic Attack R OH Hydrolyzed SubstrateSulfate ConjugateH OH O O Activation Ca2+Step 1 Step 2 Step 3Nucleophilic AttackStep 4Release and Regeneration of FG Figure 111. Proposed mechanism for sulfatase reaction. 66

PAGE 67

Table 11. US triclosan production data (pounds per year) by reporting year from the US EPA, 2012. Dat a obtained from Nazaroff et al. (2012) illustrating the increased production of triclosancontaini n g products over time. Year Triclosan Production 1986 0.01 0.5 M 1990 0.01 0.5 M 1994 0.5 1 M 1998 1 10 M 2002 Not reported 2006 Not reported 67

PAGE 68

Table 12. Reported concentrations of triclosan in human samples . Reference Type of Sample Range of Concentrations (

PAGE 69

C HAPTER 2 INDIVI DUAL VARIABILITY IN TRICLOSAN GLUCURONIDATION Introduction The antibacterial substance triclosan is used in many consumer products resulting in widespread human exposure. Some of the many unanticipated biological effects of triclosan include its ability to act as an endocrine disrupter and interact with drug metabolizing enzymes ( Calafat et al . , 2008; Gee et al . , 2008; Stoker et al., 2010; Veldhoen et al . , 2006; Zorrilla et al., 2009; Wang et al., 2004). However, t riclosan’s toxicity can be reduced by conjugation via phase II detoxification pathways, forming glucuronide and sulfate conjugates, which are excreted in urine. At high triclosan concentrations, the glucuronidation pathway is expected to predominate ( Wang et al., 2004). Given that the primary exposure routes of triclosan are ingestion and dermal absorption, it is fitting to study major hepatic and intestinal UGTs. Of the 19 functional human UGTs, only 7 of the various hepatically expressed enzymes appear to play a substantial role in drug and xenobiotic metabolism and elimination: UGTs 1A1, 1A3, 1A4, 1A6, 1A9, 2B7, and 2B15 (Kiang et al., 2005; Miners et al., 2010). While it is understood that triclosan does undergo glucuronidation in the human liver and probably in the intestine and skin, knowledg e of the isoforms most efficient at glucuronidating triclosan is important for predicting the fate of triclosan in the body among different individuals with varying UGT expression. Previous s tudies in the James lab with expressed UGT isozymes showed that all selected intestinal and hepatic UGTs could catalyze triclosan glucuronidation, but the rate of triclosan metabolism was isoform selective (Table 21) . Enzyme kinetic studies , shown in Table 22 , seemed to show that 69

PAGE 70

UGT1A1 was the most active UGT isoform involved, followed by UGT1A7 and UGT1A9 ( Figure 21 ) . It was of great interest to find that UGT1A1 appeared to be most efficient. A normal UGT1A1 gene is characterized by the presence of six TA repeats in the promoter region of the TATAA box, designated ( TA)6. A UGT1A1 deficiency can lead to the accumulation of unconjugated bilirubin resulting in Gilbert’s syndrome, where individuals have a TA insertion, and the presence of seven TA repeats instead of the wildtype number of six, results in reduced UGT1A ex pression and activity (Hsieh et al., 2007; Innocenti et al., 2004; Yamamoto et al., 1998; Udomuksorn et al., 2007; Rowland et al., 2013). Numerous studies have associated this genetic polymorphism with reduced elimination and possible toxicity of certain drugs, including acetaminophen, SN 38 (the active metabolite of irinotecan), and l orazepam (Herman et al., 1994; Esteban and P rez Mateo, 1999; Ando et al., 2000) . Among these and various other drugs, irinotecanassociated toxicity illustrates the strongest correlation between the UGT1A1*28 genotype and toxicity (Marsh and McLeod, 2004) . As consumer demand for antimicrobial products increases, the prevalence of triclosan in personal care products is likely to grow, resulting in greater human and environmental exposure. Therefore, understanding the rate at which triclosan is efficiently metabolized and eliminated from human tissues and any isoforms involved in its metabolism will be important in predicting individual risk of exposure. This study examined tricl osan glucuronidation in individual human liver microsomes and utilized quantitative proteomic analysis to determine expression of UGT isoforms in human liver. A significant correlation between UGT2B4 and triclosan metabolism w as observed, 70

PAGE 71

therefore e nzyme kinetics of UGT2B4 were more closely examined. As UGT1A1 was implicated in triclosan glucuronidation and shows variability in people, a dditional studies analyzed the glucuronidation capacity of genotyped human liver samples toward triclosan . Materials and M ethods Chemicals Triclosan was purchased from Fluka and shown to be >97% pure by HPLC analysis. For use in the assays, 14C Uridine 5’ disphophoglucuronic acid (UDPGA), 180 mCi/mmol was purchased from PerkinElmer Life and Analytical Sciences , Inc. (Boston, MA). The 14C UDPGA was diluted with unlabeled UDPGA (SigmaAldrich , St. Louis, MO ) to make a 5 mM solution containing 2 Ci/m L . All water utilized in these experiments was purified by Milli Q water system to 18 All other buffer chemicals and solvents were obtained from SigmaAldrich or Fisher Scientific (Fair Lawn, NJ ). Tissue S amples SupersomesTM expressing U GT isoform UGT2B4 were purchased from BD Biosciences ( Woburn, MA ). SupersomesTM are a membrane preparation similar to microsomes derived from i nsect cells ( BT I TN 5814) that have been infected with baculovirus ( Autographa californica) carrying the cDNA of the human UGT isoform. The level of expression of UGT in SupersomesTM varies with isoform. H uman l iver microsome s were prepared from liver sam ples received from liver banks (Wang et al., 2004; Li et al., 2012) and were exempt by the Institutional Review Board (IRB) at the University of Florida. Of the 47 liver samples studied, 28 were from male and 18 were from female donors; gender information was unavailable for one sample. The microsomes were resuspended in a 0.1 M K phosphate buffer, pH 7.4, and stored at 80 71

PAGE 72

C until use in these experiments. The protein content was determined by the bicinchoninic acid (BCA) method with bovine serum albumin (BSA) as standard. A ssay Triclosan glucuronidation assays were performed at two triclosan concentrations, 0.01 mM and 1 mM, using a radiochemical ion pair extraction method as described previously (Wang et al., 2004). Duplicate tubes were prepared for each sample. The incubation mixture consisted of 0.1 M K phosphate (pH 7.4), 5 mM MgCl2, 1.25 g of Brij 58, human hepatic microsomal protein, 10 M or 1 mM triclosan, water, and 1 mM of 14C UDPGA in a total reaction volume of 0.1 mL. The microsomes were diluted with Brij 58, 0.25 mg Brij 58 per mg microsomal protein, and the amount of microsomal p rotein added and the incubation times were such that less than 30% of the triclosan was utilized in the assay. At the 10 M triclosan concentration, microsomes were diluted to 0.5 mg/m L and 5 g of human hepatic microsomal protein was used in the 5 min inc ubation assay. At the 1 mM triclosan concentration, microsomes were diluted to 5 mg/m L with 50 g of human hepatic microsomal protein used in the assay, and the incubation time was 10 min. Methanol solutions of triclosan were added to each tube and the solvent was dried under nitrogen for approximately 10 min. The diluted microsomal protein and K phosphate buffer were added to the tubes and were vortex mixed. The tubes were left on ice for 20 min before MgCl2 and water were added, bringing the volume to 0. 08 mL. The tubes were vortex mixed again to mix contents, then centrifuged for 2 min at 3,500 rpm (full speed) to bring the contents to the bottom of the tube. The mixture was preincubated for 1 min at 37 C in a water bath, and 14C UDPGA was added to all incubated tubes at timed intervals to initiate the reaction. After 72

PAGE 73

incubating at 37 C with shaking, 0.1 mL of 0.25 M tetrabutylammonium phosphate /2.5% acetic acid (1:1 mixture by volume), 0.3 mL water, and 2 mL water saturated ethyl acetate were added t o the tubes (at the same timed interval the UDPGA was added) and vortex mixed to stop the reaction. The tubes were then centrifuged at 3,500 rpm for 10 min to separate the phases. The ethyl acetate phase (top layer) was transferred to a scintillation vial. The tubes were extracted twice more with 1 mL water saturated ethyl acetate and the extracts were combined. For each tube, the ethyl acetate phase, 0.4 mL, was evaporated under a stream of air, scintillation cocktail was added, and the samples were counted for quantification of the glucuronide conjugate. Subsequently, the r esults of the duplicate tubes were averaged. The glucuronidation assays included a set of blank tubes without triclosan, but with microsomes, which were incubated for 20 min. This was necessary because the microsomes likely contained endogenous compounds or drugs that were substrates for glucuronidation. The incubation mixtures were the same as described above with the ex ception to the following : blank tubes contained 250 g of microsomal protein (microsomes diluted with Brij 58, 0.25 mg Brij per mg microsomal protein to 5 mg/mL ), and 0.1 M Tris Cl (pH 7.6) was used as buffer. UGT2B4 Kinetics A ssay Enzyme kinetic studies utilizing expressed human UGT2B4 were conducted over a range of tricl osan concentrations (0.001 mM 1 mM). The supersomes were diluted with Brij 58, 0.5 mg Brij 58 per mg protein, and 15 g of supersomes was added to the incubation mixture as described above. The incubation time for these studies was 15 min. 73

PAGE 74

Genotyping DNA from selected liver samples was prepared and the TATA genotypes were determined using polymerase chain reaction (PCR) followed by pyrosequenci ng ( Langaee and Ronaghi, 2005). Pyrosequencing is a commonly used genotyping technique implemented to determine nucleic acid sequence. The PCR and sequencing primers were designed using Pyrosequencing Primer Design Software (Qiagen, Valencia, CA) and all pyrosequencing reactions were carried out using the Pyrosequencing PSQ HS 96 system. Proteomics To quantify UGT protein expression, a target ed quantitative proteomics approach was employed. By measuring UGT isoform expression in the human samples, the catalytic activity towards triclosan will be more appropriately described in terms of units of activity per picomole of UGT isoform. This approach can also help to more accurately identify which UGT isoforms are involved in the glucuroni dation of triclosan. The method used a combination of nanoliquid chromatography tandem mass spectrometry and multiple reaction monitoring to quantify a total of 10 UGT1As and UGT2Bs in human liver samples (Fallon et al., 2013( a ) ; Fallon et al., 2013( b ) ) . A sta ble isotope dilution technique that involved the (13C, 15N) labeling of two or more proteotypic peptides per protein was used. Labeled synthetic proteotypic tryptic peptides that closely resembled the analytes of interest were used as standards for ta rgeted quantification. Data Analysis Results are presented as mean values with standard deviation. E nzyme kinetic parameters (Km, Vmax) were calculated from the Michaelis Menten equation using Prism software (version 6.0; GraphPad Software, Inc., San Diego , CA). Means and standard 74

PAGE 75

deviations were calculated using Excel software (Microsoft, Redmond, WA) or Prism software. S tatistical comparisons between genotypes were performed using Kruskal Wallis nonparametric test . Correlation analysis and statistical com parisons between individual UGT isoform expression and triclosan glucuronidation activity were determined using Pearson’s correlation, followed by stepwise regression. Results Triclosan Glucuronidation In the absence of triclosan substrate, but in the pres ence of 1 mM UDPGA (incubated substrate blank), components in the microsomes were glucuronidated at a rate of 0.23 + 0.13 nmol/min/mg protein (mean + S.D., n = 47 samples). Each tube was performed in duplicate. For each individual human liver microsomes sa mple, the rate of glucuronidation of endogenous components was subtracted from glucuronidation rates in the presence of both triclosan concentrations. The data illustrated that various human liver microsomes can readily glucuronidate triclosan at studied c oncentrations of 0.01 and 1 mM (Table 23) . More than 7fold v ariability in specific activity was found in the HLM samples, irrespective of age and gender, at both triclosan concentrations. Data for specific activity at the 0.01 mM and 1 mM triclosan concentration s are illustrated in Figure 2 2 and Figure 23 , respectively . These results suggest that clearance of triclosan by glucuronidation may be expected to vary considerably between individuals. Genotyped HLMs To evaluate whether individuals expressing the UGT1A1*28 polymorphism, identified by having seven TA repeats in the TATA box , exhibited a slower rate of triclo san metabolism, twenty two (n = 22) of the HLMs were genotyped and further 75

PAGE 76

examined (Table 24) . The studies compared average triclosan gluc uronidation activity between the homozygous wildtypes to the homozygous and heterozygous mutants and indicated that there was no significant difference (p > 0.05, using one way ANOVA) between the three genotypes (Table 25 ). These results suggested that a deficient UGT1A1 may not equate to reduced clearance of the substrate, and individuals with Gilbert’s syndrome may not have a slower clearance rate of triclosan than individuals with a fully functioning isozyme. The protein analysis confirmed that on average, individuals with heterozygous or homozygous TA7 genotypes expressed significantly less (p < 0.01, using Kruskal Wa l lis test ) UGT1A1 per mg of protein than t he homozygous wildtypes . W ide variability of genotype expression was observed among the 22 genot yped samples, 12 of which were female and 10 male (Table 24) . Sample ages ranged from 20 years to 84 years of age. S even samples (4 males, 3 females) expressed the TA6 wildtype genotype and four samples (2 males, 2 females) were homozygous mutants. The ma jority of the samples analyzed (11) were genotyped as heterozygous mutants (TA7/TA6). Collectively, there appeared to be no direct correlation between genotype expression and age or gender. To identify a correlation between expression of specific UGT isoforms and triclosan glucuronidation activity, various UGT isoforms were quantified in each of the HLMs studied. Using Pearson’s correlation coefficients and statistical p values , the linear relationship between individual UGT isoforms and triclosan glucuroni dation activity were analyzed. A coefficient value of 1 demonstrates total positive correlation, 0 is no correlation, and 1 is total negative correlation. Of the UGTs studied, UGT2B4 76

PAGE 77

demonstrated the greatest coefficient, 0.663, and the most significant c orrelation (p < 0.0001). Table 26 and Figure 24 illustrate these findings. Further analysis using stepwise regression confirmed the contribution of UGT2B4, by demonstrating that it was the single most significant predictor of triclosan glucuronidation ac tivity. This isoform alone accounted for 44% of the observed variation in glucuronosyltransferase activity towards triclosan. After adjusting for UGT2B4, UGT1A4 stood out among the other nine isoforms as the most significant, accounting for 15.2% of the variation . Together, these two isoforms explained 59.2% of the variation in triclosan glucuronidation activity. T here was no significant correlation observed between expression of UGT1A1 and triclosan glucuronidation activity (p > 0.05, using linear regressi on analysis and runs test for randomness ) . Enzyme Kinetics Enz yme kinetic studies illustrated that triclosan glucuronidation with UGT2B4 follow ed Michaelis Menten kinetics up to 100 M triclosan . Addition of triclosan above 100 M resulted in substrate inhibition (Figure 2 5 ) . The apparent Km and Vmax values are given in Table 27 . Discussion Triclosan is found in numerous products of everyday use, so some exposure may be unavoidabl e. Although triclosan has been shown to undergo sulfonation and glucuronidation in human liver (Wang et al., 2004), it is unlikely that 100% of an internalized dose of triclosan will be conjugated after one pass through the liver. As a result of this wides pread exposure, it proves beneficial to understand the rate at which triclosan is efficiently metabolized and excreted from the body. Enzymes of the UDP 77

PAGE 78

glucuronosyltransferase (UGT) superfamily are responsible for the metabolism of many endogenous compoun ds, drugs, and environmental chemicals, including triclosan. Because one of the main exposure routes is oral ingest ion, UGTs in the liver and intestine are of most importance. In this study, f orty seven different human liver microsomes were used as the source of UGT(s) to examine triclosan glucuronidation. These results illustrated that triclosan is efficiently glucuronidated by UGTs expressed in human liver and further suggested that the rate at which triclosan is glucuronidated varies greatly between indi viduals. Irrespective of age and gender, glucuronosyltransferase activity toward 0.01 mM and 1 mM triclosan varied over 7 fold and nearly 17fold, respecti vely, between samples. The presence of genetic polymorphisms can cause individuals possessing allelic variants to exhibit enhanced or reduced glucuronidation activity, which can greatly contribute to interindividual variability of glucuronidation capacity observed across a population (Row land et al., 2013; Tam, 1993). Studies with genotyped HLMs revealed that a deficient UGT1A1, as seen in individuals with Gilbert’s syndrome ( TA7/TA7), reduces expression of the isoform, but does not hinder clearance of triclosan. These results suggested that other UGT isoforms can efficiently metabolize triclosan when UGT1 A1 is not functioning properly. As a result of the partial overlaps of UGT substrate specificity and the various levels of expression and activity in microsomes, it was not surprising to find that triclosan could still be readily glucuronidated in individuals with an illfunctioning UGT1A1. Despite previous findings implicating UGT1A1 as a major contributing isoform in the biotransformation of triclosan to its glucuronide conjugate, analysis from this study 78

PAGE 79

demonstrated that there was no significant correlation (p > 0.05) between UGT1A1 and triclosan glucuronidation activity observed in the panel of HLMs studied. Instead, expressions of UGT2B4 (p < 0.0001) and UGT1A4 (p < 0.001) per mg of protein and triclosan glucuronidation activity displayed the most si gn ificant correlations . These results support previous findings by Kiang et al. (2005) and Miners et al. (2010) that hepatically expressed UGT1A4 is of great significance to drug and xenobiotic metabolism. In addition, Ohno and Nakajin ( 2009) and Court et al . ( 2012) previously reported that UGT2B4 mRNA was the most abundant isoform expressed in the human liver. With this, it is not surprising to find that our studies indicated that this isoform played a substantial role in the metabolism of tric losan in human liver samples. Previous studies from the James lab with human UGT expressing supersomes showed that UGT1A1 metabolized triclosan at the greatest rate, with an efficiency of more than 1000 l/min/mg protein. However, the UGT protein content of the recombinant enzymes was unknown. The refore, the observed efficiency of glucuronidation for the UGT1A1 isoform may be ascribed to differences in protein expression between supersomes. Variation in the actual amount of UGT enzyme in a supersomes preparation can vary from approximately 5% to 15% of total protein content (Fallon et al., 2013(a); Fallon et al., 2013(b) ). It has also been shown that not all of the expressed UGT is active. Therefore, if the supersome sample expressing UGT1A1 contained greater UGT content than the other UGT expressing supersomes, then its corresponding high specific activity and kinetic parameters can produce results that incorrectly predict glucuronidation activity in actual human tissue samples. 79

PAGE 80

As well as being a substrate for glucuronid ation, kinetic studies with UGT2B4 confirmed findings by Wang et al. (2004) that triclosan can also ac t to inhibit its own metabolism , and possibly disrupt the metabolism of other drugs . Since glucuronidation is an important detoxific ation pathway for numerous drugs, the identification and subsequent management of drug drug interactions is an important aspect of patient care. UGT2B4 has been shown to be a major contributor to th e glucuronidation of carvedilol and codeine (Ohno et al., 2004; Raungrut et al., 2010; Gelston et al., 2012) . T he inhibition of this isoform by triclosan or other known inhibitors , such as fluconazole, ketoconazole, and methadone, could then affect the pharmacokinetic parameters of other drugs metabolized by the enzyme. Methadone, for example, selectively inhibited UGT2B4 catalyzed glucuronidation of codeine, which could alter codeine’s intensity and duration of pharmacological response (Raungrut et al., 2010). Conclusion In summary, triclosan can be efficiently glucuronidated by the U GTs mainly expressed in human liver and intestine. The wide variability observed for the rates of triclosan glucuronidation in the human samples suggests that metabolism of the substrate via the glucuronidation detoxification pathway is likely to vary significantly between individuals, irrespective of age and gender. Although different UGT isoforms can catalyze the glucuronidation of triclosan, previous data insisted that the rate of triclosan metabolism was isoform selective. Based on prior studies with ex pressed enzymes, UGT1A1 was the most efficient at catalyzing the glucuronidation of triclosan . T he statistical data of these studies with human liver microsomes, however, demonstrated that UGT2B4 exhibited the most significant correlation between isoform e xpression and triclosan glucuronidation activity . UGT2B4 kinetic studies illustrated that 80

PAGE 81

Michaelis Menten kinetics are followed up to 100 M triclosan, after which substrate inhibition is observed. Although i ndividuals who display a homozygous TA7 genotyp e are expected to exhibit deficient UGT1A1 enzyme activity and expression, these studies showed that despite expressing significantly less UGT1A1 than homozygous wildtypes, the homozygous mutants did not exhibit reduced glucuronidat ion activity towards tri closan. 81

PAGE 82

Figure 21. UGT1A1, 1A7, and 1A9 catalyzed glucuronidation of triclosan. 82

PAGE 83

Activity nmol/min/mg protein Figure 22. Graph illustrating more than 7fold variability in rates of glucuronidation of 10 M triclosan in HLMs from male and female donors. 83

PAGE 84

Activity nmol/min/mg protein Figure 23. Graph illustrating more than 16fold variability in rates of glucuronidation of 1 m M triclosan in HLMs from male and female donors. 84

PAGE 85

UGT2B4 pmol/mg protein Figure 24 . Graph showing a significant correlatio n between UGT2B4 expression and triclosan glucuronidation activity in the HLMs. 85

PAGE 86

v (pmol/min/mg) Figure 25 . Triclosan glucuronidation kinetics with UGT2B4. Substrate inhibition of glucuronosyltrans ferase activities of triclosan was observed above 100 M. Data represents the mean of duplicate measurements. 86

PAGE 87

Table 21. Triclosan glucuronidation by individual UGT isoforms. UGT Isoform Specific Activity (pmol/min/mg protein) 10

PAGE 88

Table 23 . Triclosan g lucuronidation activity (nmol/min/mg protein) and UGT expression (pmol of isoform/mg protein) in HLMs. Sample Triclosan Glucuronidation Activity UGT Expression ID Age Sex 10

PAGE 89

Table 2 3. Continued. Sample Triclosan Glucuronidation Activity UGT Expression ID Age Sex 10

PAGE 90

Table 2 3. Continued. Sample Triclosan Glucuronidation Activity UGT Expression ID Age Sex 10

PAGE 91

Table 24 . Genoty ped human liver microsomes. Sample Genotype ID Age Sex UGT1A1*1 (TA6) or UGT1A1*28 (TA7) AL1 20 F TA6/TA6 AL2 47 M TA6/TA6 AL17 72 M TA6/TA6 AL19 74 F TA6/TA6 AL20 74 M TA6/TA6 AL22 76 M TA6/TA6 AL10 82 F TA6/TA6 AL3 54 F TA7/TA6 AL13 56 F TA7/TA6 AL14 58 F TA7/TA6 AL5 59 M TA7/TA6 AL8 61 M TA7/TA6 AL15 69 F TA7/TA6 AL16 71 M TA7/TA6 AL18 73 F T A7/TA6 AL9 75 F TA7/TA6 AL21 75 M TA7/TA6 AL11 84 F TA7/TA6 AL12 54 F TA7/TA7 AL4 57 M TA7/TA7 AL6 60 M TA7/TA7 AL7 60 F TA7/TA7 Table 25 . UGT1A1 expression does not predict triclosan glucuronidation activity . Rates of triclosan glucuronidation in liver microsomes did not vary with the level of expression of UGT1A1 (p = 0.99), however UGT1A1 expression was significantly lower (p = 0.003) in samples with the UGT1A1*28 polymorphism. Genotype n Specific Activity Expression TA6/TA6 7 7.05 + 1.60 2 1.9 + 11.6 TA7/TA6 11 7 .93 + 4.07 16.0 + 8.2 TA7/TA7 4 7 .45 + 1.00 5.4 0 + 3.2 * Activity values are expressed as averages of n samples in nmol/min/mg protein + S.D., and expression is representative of the average of n samples in pmol of UGT1A1/mg protei n + S.D . 91

PAGE 92

Table 26. Pearson’s correlation coefficients between individual UGTs and triclosan glucuronidation activity. UGT Isoform Correlation Coefficient Correlation Significance (p value) 1A1 0.3296 0.0236 1A3 0.0836 0.5762 1A4 0.2484 0.0922 1A6 0. 0897 0.5488 1A9 0.3986 0.0055 2B4 0.6632 <0.0001 2B7 0.3602 0.0129 2B10 0.3224 0.0271 2B15 0.5158 0.0002 2B17 0.3485 0.0164 Table 27 . Apparent kinetic constants for triclosan glucuronidation catalyzed by UGT2B4. K m V max

PAGE 93

CHAPTER 3 EFFECT OF TRICLOSAN ON ESTRADIOL SULF ATE FORMATION IN SHEEP Introduction The steroid sex hormone, estradiol (E2 or 17 estradiol) is one of the three main estrogens naturally produced in the body. Abbrevi ated E2, estradiol has two hydroxyl groups in its molecular structure, while estrone has one (E1) and estriol has three (E3). S ulf on ation is recognized as a major pathway in humans for the biotransformation of estrogens (Hern ndez et al., 1992) and previous studies have shown that triclosan is an especially pot ent inhibitor of ovine placental estrogen sulfotransferase, with Kic of 0.1 nM. As the placenta is the main organ responsible for estrogen synthesis in pregnant women and the liver is a major site of estrogen biotransformation, this study sought to add to existing evidence that triclosan exhibits inhibitory effects on sulfotransferase activity. In this project, the effects of triclosan on fetal ovine hepatic and placental estrogen sulfotransferase activity towards estradiol were assessed. T o measure sulfotr ansferase activity, cytosolic samples prepared from the fetal tissues of pregnant ewes treated with saline or triclosan were incubated with 1 nM [3H] 17 estradiol, and conversion to the [3H] 17 estradiol 3 sulfate was measured using a radiochemical det ec tion method. Materials and Methods Chemicals [3H] 17 estradiol (E2 or estradiol , >97% pure, 60 Ci/mmol) was purchased from PerkinElmer Life and Analytical Sciences, Inc. (Boston, MA). The triclosan (shown to be >99.8% pure by HPLC analysis) used for sheep dosing was received from TCI America (Portland, Oregon). The ultrapure Tris(hydroxymethyl)aminomethane ( Tris ) base was 93

PAGE 94

obtained from ICN Biomedicals, Inc., dithiothreitol (DTT) from BioRad Laboraties , and phenylmethylsulfonyl fluoride (PMSF) from Fluka. W ater utilized in these experiments was purified by MilliQ water system to 18 the highest grade available and obtained from SigmaAldrich (St. Louis, MO) or Fisher Scientific (Fair Lawn, NJ). Tissue Samples Experiments were approved by the University of Florida Institutional Animal Care a nd Use Committee (IACUC) and performed in accordance with the American Physiological Society’s Guiding Principles for Research Involving Animals and Human Beings. Hepatic and placental tissues were harvested from late gestation fetuses (between 120130 day s) of time dated pregnant ewes after direct or indirect exposure to low doses of triclosan (0.1 mg/kg/day) for 2 days. For direct exposure, chronically catheterized fetal sheep were intravenously infused with vehicle (saline) or triclosan, whereas indirect fetal exposure was achieved through intravenous infusion of vehicle or triclosan into the maternal circulation. After infusion, the pregnant ewes and fetuses were humanely euthanized with an overdose of sodium phenobarbital. Upon confirmation of cardiac arrest, f eta l tissues were rapidly removed and snap frozen in liquid nitrogen. Tissues were stored at 80 C until used in these experiments. Subsamples of liver and placental cotyledon from individual sheep were homogenized in 0.25 M sucrose, 0.05 M Tris b ase, pH 7.4, 5 mM ethylenediaminetetraacetic acid (EDTA), 1 mM DTT, and 0.2 mM PMSF. Cytosolic fractions were isolated from the homogenate after centrifugation and the protein content was determined by the BCA method with BSA as standard. 94

PAGE 95

LC MS/MS Analysis of Triclosan in Tissues LC MS/MS analyses were performed using Shimadzu LC system coupled with an AB Sciex 3200QTRAP (Foster City, CA) mass spectrometer using electrospray ionization (ESI) operated in negativeion mode. The c hromatographic separation of 10 L tissue extractions was achieved with a Luna 5 C8 (50 mm x 4.6 mm) column (Phenomenex , Torrance, CA ) with 80:20 methanol:water gradient method using a flowrate of 0.25 mL/min. The gradient conditions consis ted of holding 80% for 5 min; linear gradient to 100% for 20 mi n; holding at 100% for 4 min before returning to initial conditions. The gases for the mass spectrophotometer were delivered using Parker Balston gas generator. The curtain gas was maintained at 20 psi; nebulizer gas at 50 psi and the tur bo gas at 40 psi, which was maintained at 400 C . The negativeion mode spray voltage was set at 4500 V. Triclosan was quantified in multiple reaction monitoring (MRM) scan mode, monitoring the fragmentation transition of Cl from the parent compound (286 contains three chloride atom s, 4' OH CB18 ( 2,2',5' trichlorobiphenyl 4 ol ) was used as an internal standard. The fragmentation monitored for the internal standard was 270.8 m/z (M H) z (M H Cl). Triclosan eluted from the LC at 9.6 min and the internal standard eluted at 7.9 min. The ESI compound parameters were optimized to achieve maximum sensitivity for each ion pair. Calibration standard curves were analyzed using a range of triclo san concentrations of 0 2 pmoles with 4' OH C B18 at a fixed concentration of 0.15 pmoles in an injection volume of 10 L . Unknown concentrations were calculated from a standard curve that was analyzed along with each set of extracted tissue samples. The LC MS/MS system was controlled by Analyst 95

PAGE 96

1.4.2 software and the spectr a were integrated using the IntelliQuan algorithm in the software. Assay The individual sheep tissues were tested for the effect of triclosan on estradiol sulfonation in reaction mixtures consisting of 0.1 M Tris Cl, pH 7.4, 10 mM MgCl2, 0.5 g of cytosolic protein, 1 nM [3 H ] 17 estradiol in ethanol, w ater, and 20 M 3’ phosphoadenosine5’ phosphosulfate ( PAPS ) in a total reaction volume of 0.5 mL . The amount of cytosolic protein added was such that less than 20% of the substrate was consumed in the assay, and the calculated specific enzyme activity was corrected for using nonincubated blanks. After a 5 min incubation at 37 C, 0.2 m L of an ice cold solution of trichloroacetic acid ( TCA ), 3% w/v, was added to the samples (at the same timed interval the protein was added) to stop the reaction. Water sa tur ated methylene chloride, 1 mL, was added to each tube and the tubes were vortex mixed prior to a 5 min centrifugation to separate the phases. The methylene chloride (lower phase) was discarded and the extract ion was repeated twice more to remove unreacted estrogen. Scintillation cocktail was added to a 0.2 m L aliquot of the upper aqueous phase and was counted by liquid scintillation for quantificati on of the sulfate conjugate. Data Analysis From the scintillation counter, t he total dpm per assay tube was calculated and converted to pmol es of estradiol 3 sulfate produced/min/mg cytosolic protein , using the radioactivity of [3H] estradiol . Means, standard deviations and statistical significance were calculated and analyzed by Excel software (Microsoft, Redmond, WA) or GraphPad software (version 6.0; GraphPad Software, Inc., San Diego, CA) . 96

PAGE 97

Results and Discussion Studies examining t he effect of triclosan on sulfotransferase activities toward estradiol were conducted using fetal sheep liver and placental cytosol. As expected, the results demonstrated that triclosan can inhibit estrogen sulfotransferase activity . In both tissues, the specific activity (pmol/min/mg protein) for the triclosan treated samples was significantly lower than the saline controls (Table 31 ). T he greatest activity observed in the control liver samples, for instance, was approximately 20 pmol/min/mg protein, whereas activity among the triclosantreated samples was more than 50% less (9.55 pmol/min/mg protein) . Although greater activity was generally observed in the placental tissues versus the hepatic tissues, the same inhibitory effect of triclosan was observed. Maximal activity among the placental saline controls was approximately 40 pmol/min/mg protein, while the sample with the largest det ectable level of triclosan (about 330 pmol triclosan/g tissue) exhibited a rate of approximately 20 pmol/min/mg protein. Using LC MS , the tissue concentrations of triclosan (pmol/g tissue) in each sample was also measured. Triclosan was detected in the fet al liver and cotyledon cytosol s at concentrations ranging from 3123 pmol/g tissue and 1 330 pmol/g tissue, respectively. The detection of triclosan in fetal tissues upon indirect exposure (via the pregnant ewe) also confirms that triclosan can cross the placental barrier and be taken up by fetal tissues. As expected, the fetal tissues with the greatest concentrations of detectable triclosan were generally those that were directly infused with triclosan, compared to the samples exposed via the placenta from the mother’s exposure to triclosan. In addition, when tissue concentrations of triclosan in the placenta were plotted against measured sulfotransferase activity, a clear negative correlation was observed (Figure 31). Samples with the highest tissue concentrations of triclosan 97

PAGE 98

exhibited significantly less (p < 0.05, using linear regression analysis) sulfotransferase activity than samples with less detectable levels of triclosan. This negative correlation was not significant (p > 0.05) in sheep liver tissues, perhaps bec ause the sample size was small. These results support existing evidence that fetal tissues not only express sulfotransferases, but these enzymes are also active in the biotransformation of estradiol. Whether through direct or indirect exposur e to triclosan, these studies demonstrate that triclosan can inhibit fetal metabolism of a vital hormone during pregnancy. Conclusion Due to the widespread use and stability of triclosan, some human exposure may be unavoidable. Therefore, it proves benefic ial to understand the effect(s) that triclosan ma y exert on detoxification pathways, like sulfonation, in the body. The results of the study revealed that triclosan can alter estradiol sulfate conjugation. In both tissues, the rate of sulfoconjugation was significantly greater in the saline controls than in the triclosan treated samples, confirming that sulfotransferase activity can be inhibited by triclosan in bot h, the fetal liver and placenta. 98

PAGE 99

Table 31. Effect of triclosan treatment on e strogen sulfonation in fetal sheep directly infused with vehicle (saline) or triclosan. Specific Activity (pmol/min/mg protein) Sheep Cytosol Saline Control Triclosan Treated n Liver 6 14.5 + 3.67 6.45 + 2.13 Placenta 4 32.5 + 4.36 21.2 + 2.00 * Significant differences between average specific activities for saline control and triclosan treated samples were detected in the liver (p < 0.001) and placenta (p < 0.005). Values shown are mean + S.D. pmol Triclosan/g tissue Figure 31. Graph illustrating a significant effect of t riclosan treatment on estrogen sulfonation in all sheep placenta. Circles represent individual sheep samples that were directly and indirectly infused with triclosan. Each point represents the mean of duplicate measurements. 99

PAGE 100

CHAPTER 4 EFFECT OF TRICLOSAN AND TRICLOSANSULFATE ON SULFATE HYDROLYSIS Introduction Sulfotransferase and sulfatase enzyme families catalyze the forward and reverse steps of the important biotransformation reaction, sulfonation. Membranebound sulfatases hydrolyze sulfate compounds t hereby reversing the action of sulfotransferases in tissues. Many sulfatases carry the generic name aryl sulfatase (ARS) because the discovery of physiological substrates for these enzymes was initially discovered using small aryl substrates (Hanson et al. , 2004). Steroid sulfates circulate at higher concentrations than the unconjugated forms and can be readily transported in the blood around the body , serving as a reservoir of precursors for eventual conversion (in target tissues) to unconjugated, biologic ally active steroids via sulfatase enzymes (Pion et al., 1966; Vagnoni et al., 1998; Kester et al., 2000). Previous lab studies have shown that triclosan can inhibit sulfatase activity in sheep placental samples (James, unpublished). Triclosan was an uncom petitive inhibitor of sheep placental sulfatase with 4MeUS as substrate, with Kiu of 9.7 + 1.0 mM (mean + S.D., n = 3) and a competitive inhibitor of arylsulfatase in sheep liver microsomes, with Kic of 39.6 + 6.1 mM (mean + S.D., n = 3). In addition, sinc e triclosan sulfate is a reported metabolite of triclosan (Moss et a l., 2000; Provencher et al., 201 4; Wang et al., 2004; Fang et al., 2014) , it too may act as a competitive inhibitor of sulfatase activity. The aim of this study was to further investigat e the inhibitory effect of triclosan and triclosansulfate on sulfatase activity. Using human liver and sheep placental microsomes as the enzyme source, arylsulfatase activity was measured by incubating microsomes with 4 methylumbelliferyl sulfate (4MeUS), a nonsteroidal substrate, and 100

PAGE 101

measuring formation of the fluorescent product, 4methylumbelliferone ( 4MeU ) . To measure steroid sulfatase activity, microsomes prepared from human livers were incubated with [ 3 H] estrone3 sulfate (E1S) and conversion to [ 3 H] estrone (E1) was analyzed by a reversephase HPLC system with radiochemical detection. Materials and Methods Chemicals Triclosan ( >97% pure) was purchased from Fluka and triclosan sulfate sodium salt was obtained from Toronto Research Chemicals (Toronto, Canada). [ 3 H] estrone3 sulf at e ammonium salt ( [ 3 H] E1S, >97% pure, 45.6 Ci/mmol) was obtained from PerkinElmer Life and Analytical Sciences, Inc. (Boston, MA). 4methylumbelliferyl sulfate potassium salt (4MeUS) and 4methylumbelliferone sodium salt (4M eU) were purchased from Sigma Aldrich (St. Louis, MO). T etrabutylammonium hydrogen sulfate (PICA) was purchased from Waters Corporation (Milford, MA), and t he ultrapure Tris base was obtained from ICN Biomedicals, Inc . All w ater utilized in these experiments was purified by MilliQ water system to 18 All other compounds, chemicals and solvents were of the highest grade available and obtained from SigmaAldrich (St. Louis, MO) or Fisher Scientific (Fair Lawn, NJ). Tissue Samples Liver microsomes were prepared from six individual human liver samples (3 males, ages 4549; 3 females, ages 2027) obtained from liver banks ( Li et al., 2012). Three individual sheep placenta microsomal samples were prepared for use in these assays (James et al., 2010). The ovine microsomes were stored in a resuspension buf fer consisting of 0.25 M sucrose, 0.1 mM EDTA, and 0.05 M Tris Cl, pH 7.4 . The 101

PAGE 102

protein content from the human livers and sheep placental microsomes were determined by the B CA method with BSA as standard. Inhibition of Arylsulfatase Activity Assay A fluores cent method was used for this assay because cleavage of the sulfat e from 4MeUS by sulfatase enzymes causes an emission of blue fluorescence at 450 nm with excitation 360 nm. Duplicate tubes and control blanks (tubes without triclosan or triclosan sulfate) were prepared for each substrate concentration. All tubes were incubated. Nonincubated blanks were also examined at each concentration to account for any fluorescent background that may result from components in the assay mixture. The incubation mixture c onsisted of 0.020.8 mM 4MeUS, 0.05 M Tris Cl, pH 7.0, 5 g of human hepatic (or sheep placental) microsomal protein, triclosan (0 100 M) or triclosan sulfate (0 50 M ), and water in a total reaction volume of 0.5 mL . Human microsomal samples were diluted with resuspension buffer to 0.2 mg/mL (sheep placenta microsomes were diluted to 0.5 mg/mL ) and were put on ice. The 4MeUS, Tris Cl buffer, triclosan (or triclosansulfate), and water were added to the tubes and were vortex mixed. The tubes were placed in a water bath at 37 C and the diluted microsomes were added to all incubated tubes at timed intervals (e.g. 20 secs) to initiate the reaction. After incubating for 15 min (or 5 min with sheep samples), the reaction was stopped by adding 2 mL methanol to t he tubes and the tubes were vortex mixed. The protein in each reaction was allowed to flocculate on ice for 10 min before centr ifuging the tubes for 10 min at 3,500 rpm (full speed) . The supernatant (~2 mL) from each tube was transferred to clean tubes and was analyzed for fluorescence 102

PAGE 103

immediately after adding 0.5 mL 1N Tris base. A standard curve was obtained by using aqueous solutions of 4MeU with concentrations ranging from 0 to 2000 pmoles. Inhibition of Steroid Sulfatase Activity Assay Duplicate tubes were prepared for each substrate concentration and all tubes were incubated. Nonincubated blanks were also examined at each substrate concentrati on to account for total estronesulfate present in the incubation mixture before hydrolysis took place. The incubation mixture consisted of an aqueous solution of 0.2 or 2 M [ 3 H] estrone3 sulf at e ( [ 3 H] E1S ) , 0.05 M Tris Cl, pH 7.0, 50 g (for triclosan inhibition) or 25 g (for triclosan sulfate inhibition) of human hepatic microsomal protein, 01 mM concentrations of tric losan or triclosansulfate , and water in a total reaction volume of 0.1 mL. The human liver microsomes (HLMs) were diluted with resuspension buffer to 1 mg/m L and were put on ice. To examine inhibition, differe nt concentrations of triclosan or triclosan sulfate, buffer, diluted microsomes, and water were added to the tubes to a volume of 0.08 mL and were vortex mixed. The tubes were placed in a water bath at 37 C and [ 3 H] estrone3 sulfate was added to all incubated tubes at timed intervals (e.g. 20 secs) to initiate the reaction. After incubating for 10 m in (triclosan sulfate inhibition) or 15 min (triclosan inhibition), the reaction was stopped by adding 0.3 mL methanol to the tubes, vortex mixing, a nd placing on ice for 20 min. Non incubated blanks were stopped immediately after adding the substrate. The protein in each tube was precipitated by centrifugation for 10 min at 3,500 rpm. HPLC Analysis The supernatant , 0.2 mL, was filtered through a 0.22 or 0.45 micron filter before analyzing by HPLC. Each supernatant was mixed with 7 L PICA , and 200 L of 103

PAGE 104

sample was injected into a 0.2 mL sample loop for HPLC analysis. HPLC analysis was conducted on a Beckman Gold Nouveau HPLC system equipped with ultraviolet ( UV ) ram IN/US Systems Inc., Tampa, Florida). A C18 reverse phase column (4.6 mm x 25 cm) with a C18 precolumn (Discovery system, Supelco, Bellefonte, PA) was used. The mobile phase consisted of 60% methanol with 0.005 M PICA at a constant flow r ate of 1 mL /min . Data Analysis Fluorescent readings were converted to concentrations, in pmoles, by a standard curve. For each sample, apparent Km and Vmax values were determined in the presence of triclos a n or triclosansulfate. This data was analyzed to determine if inhi bition was competitive or uncompetitive using GraphPad software (version 6.0; GraphPad Software, Inc., San Diego, CA) . The effects of triclosan on SULT activities were examined by plotting apparent Km/Vmax data or 1/Vmax data for each sample against the co ncentration of triclosan or triclosansulfate. The percent peak of estrone was retrieved from the HPLC chromatograph and the specific radioactivity of the substrate (E1S) were used to calculate the rate of formation in pmol of estrone/min/mg protein. E1 and E1S were identified by the retention times of 15 min and 8 min, respectively. Results These studies illustrated that triclosan concentrations ranging from 0 100 M could inhibit 4MeUS hydrolysis in human liver microsomes . The Michaelis Menten curves demo nstrating this inhibitory effect in one of the male samples is shown in Figure 4 1 . For each of the six individual samples tested, triclosan acted as a competitive, moderately potent inhibitor of arylsulfatase activity. Activity was inhibited by triclosan in 104

PAGE 105

male samples with Kic 18.8 + 4. 1 M (mean + S.D., n = 3 ; Figure 42 ), and in female samples with Kic 28.5 + 4.7 M (mean + S.D., n = 3 ; Figure 43 ). However, triclosan proved to be a weak inhibitor of steroid sulfatase in all HLMs , exhibiting no significant effect on the hydrolysis of 2 M estr one sulfate up to 0.2 mM triclosan. Data from the individual male and female samples are presented in Table 4 1 . Triclosan sulfate (concentrations <50 M) competitively inhi bited arylsulfatase activity in microsomes from sheep placenta and female human liver microso mes with moderate potency. Past studies illustrated th at the most potent inhibition by triclosan, Ki 9.7 + 1.0 M (mean + S.D., n = 3), was o f sheep placental arylsulfatase and the mechanism of inhibition was uncompetitive. In present stud ies, however, triclosansulfate was a less potent competitive inhibitor of sheep placental arylsulfatase than triclosan , with a Kic of 23.2 + 3.0 M (mean + S.D., n = 3; Figure 44 ). Triclosan sulfate also competitively inhibited arylsulfatase, Kic 27.1 + 1.7 M (mean + S.D., n = 3), in all three female human liver microsome samples (Figure 45 ) with nearly the same moderate potency as triclosan (Kic ~28 M, refer to Figure 43). In two of the female HLMs, s teroid sulfatase was measured with two concentrati ons, 0.2 and 2 M, with estrone sulfate as the substrate. Sulfatase activity at 0.2 M estrone sulfate was potently inhibite d by triclosansulfate (Figure 46 ; Table 42 ). Since triclosan sulfate is expected to act as a competitive inhibitor, kinetics were not investigated. A t the 2 M E1S concentration, steroid sulfatase was much less potently inhibited by triclosansulfate (Table 43) . Hydrolysis of estrone sul fate was inhibited only by high (0.5 mM and 1 mM) concentrations of the triclosan sulfate, simil ar to that observed with triclosan as an inhibitor. 105

PAGE 106

Discussion Earlier studies have utilized the pregnant sheep animal model to examine sheep placental estrogen sulfotransferase activity of 17 estradiol in the presence of triclosan (James et al., 2010). R esults have suggested the possibility that exposure of pregnant sheep, and by analogy pregnant women, to triclosan could reduce estrogen sulfate formation and subsequently endanger pregnancy by reducing est rogen action in target tissues. P revious findings have illustrated that triclosan can serve as a potent noncompetitive inhibitor of sulfatase toward 4 methylumbelliferyl sulfate ( 4MeUS ) in sheep placental microsomes (IC50 values from 7.5 to 18.6 M) and can inhibit steroid sulfatase activity toward estrone sulfate at high (>100) micromolar concentrations. Compared to these previous studies in sheep placenta, current studies demonstrated that triclosan was more potent as an uncompetitive inhibitor of arylsulfatase than triclosansulfate, a competitive inhibitor. This suggests that perhaps triclosan binds to the sheep placental enzyme at a site other than the active site, whereas triclosansulfate competes with 4MeUS for occupying the active site. Th e results also demonstrate that human liver microsomes contain an active sulfatase enzyme(s) whose activity can be inhibited in the presence of triclosan and triclosan sulfate through competitive inhibition. These results are particularly interesting because unsulfonated triclosan is not a substrate for the sulfatase enzyme. It is worth noting that the potential inhibitory effect of triclosansulfate on individual male liver samples was not examined because we were more interested in assessing the potential 106

PAGE 107

effects of triclosan and its sulfate metabolite on steroid metabolism during pregnancy, which can be better evaluated using samples from women of childbearing age. Although triclosan and triclosansulfate inhibited both arylsulfatase and steroid sulfatase activity, the effect was of low potency when compared with the ability of triclosan to inhibit estrogen sulfotransferase, Kic 0.1 nM (James et al., 2010). Tissue concentrations of triclosan in people following exposure through pers onal care products are i n the nanomolar range, considerably lower than the concentrations shown in t his study to inhibit sulfatase. Conclusion Placental microsomes from 3 sheep , and human hepatic microsomes from 3 males and 3 females were used as the source of sulfatase in the ex periments to test the inhibitory effect of triclosan and triclosansulfate on E1S and 4MeUS hydrolysis . Overall, triclosan and triclosansulfate inhibited sulfatase activity with both substrates, with varying potencies. T riclosan and triclosansulfate both acted as competitive inhibitors of human arylsulfatase in all human liver samples , although t riclosan was a more potent inhibitor of arylsulfatase than steroid sulfatase, with Ki values in the low micromolar range. Triclosan was a very weak inhibitor of s teroid sulfatase, with IC50 values in all microsomal samples >100 M, concentrations not likely to be attained from environmental exposure. Triclosan sulfate (concentrations <50 M) competitively inhibited arylsulfatase activity in sheep placental microsom es, but was less potent than triclosan itself. Triclosan sulfate was a more potent inhibitor of steroid sulfatase in female human liver microsomes than triclosan, with IC50 values < 100 M . 107

PAGE 108

The results illustrate that triclosan has several unanticipated bi ological effects and further suggests that triclosan and its sulfoconjugate may pose a threat to human health by inhibiting other sulfatases involved in steroid metabolism and homeostasis. 108

PAGE 109

nmol 4MeU/min/mg Figure 41. Michaelis Menten curve illustrating 4MeUS kinetics i n male human liver microsomes. Triclosan co ncentrations ranging from 0 100 M inhibited a rylsulfatase activity towards 4MeUS . Shown are replicate assay points from an individual male HLM sample. Two other male HLM samples showed similar curves. 109

PAGE 110

Km/Vmax Figure 42. Inhibition plots for the effect of triclosan on 4MeUS hydrolysis in male human liver microsomes. Triclosan was a competitive inhibitor of arylsulfatase, with Kic of 18. 8 + 4.1 M (mean + S.D., n = 3). 110

PAGE 111

Km/Vmax Figure 4 3 . Inhibition plots for the effect of triclosan on 4MeUS hydrolysis in female human liver microsomes. Triclo san w as a competitive inhibitor of arylsulfatase, with Kic of 28.5 + 4.7 M (mean + S.D., n = 3). 111

PAGE 112

Km/Vmax F igure 44 . Inhibition plots for the effect of triclosansulfate on 4MeUS hydrolysis in sheep placental microsomes. Triclo san sulfate was a competitive inhibitor of arylsulfatase, with Kic of 23.2 + 3.0 M (mean + S.D., n = 3). 112

PAGE 113

Km/Vmax Figure 4 5. Inhibition plots for the effect of triclo san sulfate on 4MeUS hydrolysis in female human liver microsomes. Triclo san sulfate was a competitive inhibitor of arylsulfatase, wi th Kic of 27.1 + 1.7 M (mean + S.D., n = 3). 113

PAGE 114

Figure 46. Concentrationresponse curve showing the effect of triclosansulfate on 0.2 M estrone sulfate hydrolysis in one female human liver sample. Uninhibited activity in liver microsomes was 22.0 6. 21 pmol estrone/ min/mg protein, mean S.D., n = 2 . 114

PAGE 115

Table 41. The inhibitory effect of triclosan concentrations up to 1 mM on steroid sulfatase activity toward 2 M estrone3 sulfate in male and female human liver microsome s. Sulfatase activity is expr essed as pmol estrone/min/mg protein and values are means + S.D., where n = 3 . Table 42. The i nhibitory effect of triclosansulfate concentrations up to 0.1 mM on steroid sulfatase activity toward 0. 2 M estrone3 sulfate in female human liver microsomes. Sulfatase activity is expressed as pmol estrone/min/mg protein and values are means of duplicate measurements . Triclosan (mM) Average Steroid Sulfatase Activity Male Female 0 53.9 + 10.0 115 + 31.1 0.5 38.3 + 11.8 123 + 25.9 1.0 22.7 + 8.00 71.9 + 14.9 Triclosan Sulfate (mM) Average Steroid Sulfatase Activity HLM 1 HLM 2 0 16.8 27.3 0.02 12.6 14. 5 0.05 8.70 8. 34 0.1 7.70 1.48 115

PAGE 116

Table 43 . The inhibitory effect of triclosansulfate conc entrations up to 1 mM on steroid sulfatase activity toward 2 M estrone3 sulfate in female human liver microsomes. Sulfatase activity is exp ressed as pmol estrone/min/mg protein and values are means of duplicate measurements . Triclosan Sulfate (mM) Average Steroid Sulfatase Activity HLM 1 HLM 2 0 133 163 0.5 22.7 23.5 1 12.5 10.5 116

PAGE 117

CHAPTER 5 EFFECT OF TRICLOSAN ON ESTRADIOL SULFONATION AND SULFATE SECRETION IN HUMAN SAMPLES Introduction Triclosan is a widely used antibacterial agent that has gained much attention and scrutiny due to its biological actions that span beyond its antibacterial functions. Triclosan inhibition or interference with sulfotransferase enzymes involved in steroid homeostasis may have detrimental effects on human health, especially during pregnancy when hormone balance is essential for the normal growth and development of the fetus. Sheep models indicate that placent al estrogen sulfotransferase (SULT1E1) is inhibited by low nanomolar concentrations of triclosan (James et al., 2010). Chapter 3 of this work describes results demonstrating reduction of estradiol sulfonation following treatment with triclosan in sheep placenta and liver cytosol. The reduction is most likely due to inhibition. In addition, sulfonation and glucuronidation reactions have both been inhibited by triclosan in human liver cytosol and microsomes, respectively (Wang et al., 2004; Wang and James, 20 06). Other studies with human SULT1E1 have shown that the IC50 value for triclosan inhibition toward 1 nM estradiol was in the low nanomolar range (~20 nM) (RohnGlowacki et al., 2014). The aims of this study were two fold; one objective was to investigate the effect of varying estradiol and PAPS concentrations on sulfotransferase activity in expressed human SULT1E1, and the other was designed to examine the effect of triclosan on estradiol sulfate forma tion in live human cells. As t he human placenta is res ponsible for the synthesis of numerous hormones like estrogen, necessary for the maintenance of pregnancy , we sought to examine whether triclosan exhibits the same inhibitory effects toward estrogen sulfotransferase 117

PAGE 118

in live human cells as is observed in ot her in vitro studies. T he human choriocarcinomaderived placental JEG 3 cell line is the preferred cell line to examine this effect because it is well established as an ideal model to study placental function (Chou, 1982; Matsuo and Strauss, 1994; Tremblay et al., 1999; Blanchon et al., 2002; Honkisz et al., 2012) . JEG 3 cells display many functional features of synctiotrophoblasts, which are cells that compose the outermost fetal component of the placenta and are found in the placenta of human embryos (Mat suo and Strauss, 1994; Honkisz et al., 2012). These cells not only maintain hormonal functions during cultivation, but they also produce steroids and enzymes involved in steroidogenesis (Chou, 1982; Tremblay et al., 1999). Although human embryonic kidney ( HEK) 293T cells are not ideal for examining triclosan’s effect on placental function, as emb ryonic kidney derived cells they are suitable for testing the effect of triclosan since they can be transfected with SULT1E1 . The HEK 293 cell line is a transformed cell line derived from human fetal kidney tissue and is the parental line for 293T. The “T” signifies that the cells stably express the SV40 large T antigen, which can bind to SV40 enhancers to increase protein production. As a result, these cells typical ly have a rapid growth rate and high expression vector transfection efficiency, and are often used to examine various physiological processes. In this study, 293T and JEG 3 cells were transiently transfected with SULT1E1GFP and exposed to [3H] 17 estradiol to investigate whether triclosan could inhibit [3H] estradiol 3 sulfate formation. Materials and Methods Chemicals and Cells The human choriocarcinomaderived placental JEG 3 cell line and Eagle’s Minimum Essential Medium (EMEM) with phenol red was purchased from the American 118

PAGE 119

Type Cell Culture (ATCC; Rockville, MD). Human embryonic kidney (HEK) 293T cells were generously donated by Dr . Brian Law ( University of Florida , Gainesville, FL ) and the pcDNA3.1/NT GFP/SULT1E1 vector used for transfection was a gift from Dr. Jonathan Sheng (Wadsworth Center, Albany, NY). The expressed recombinant human SULT1E1 enzyme was received from Dr. Charles N. Falany (University of Alabama, Birmingham, A L ). Triclosan ( >97% pure) was purchased from Fluka and [ 3 H ] 17 estradiol (E2 or estradiol , >97% pure, 60 Ci/mmol) was obtained from PerkinElmer Life and Analytical Sciences, Inc. (Boston, MA). Dulbecco’s Modified Eagle’s Medium (DMEM) with phenol red, heat activated fetal bovine serum (FBS ), and trypsin were obtained from HyClone Laboratories (Logan, UT ). T etrabutylammonium hydrogen sulfate (PICA) was purchased from Waters Corporation (Milford, MA) and l ipofectamine 2000 transfection r eagent from Invitrogen (Life Technologies, Grand Island, NY) . For enzyme kinetic s tudies with human SULT1E1, a lysate buffer consisting of 10 mM triethanolamine (TEA) pH 7.4, 1.5 mM DTT, 10% glycerol and PMSF was used to dilute the human sample. All other chemicals and solvents were of the highest grade available and obtained from SigmaAldrich (St. Louis, MO) or Fis her Scientific (Fair Lawn, NJ). Estradiol Sulfonation Kinetics Assay A radiochemical extraction method was used to examine estradiol sulfonation kinetics with expressed human SULT1E1. Duplicate tubes and nonincubated blanks were prepared for each sample, and product formation did not exceed 20% of the substrate in the reaction. The incubation mixture consisted of 0.1 M Tris Cl (pH 7.4), 10 mM MgCl2, 1.9 g of human SULT1E1 lysate, varying nanomolar concentrations of 119

PAGE 120

[ 3 H ] 17 estradiol in ethanol (0.520 nM final ), water, and micromolar ranges of PAPS concentrations (0.55 M final ) in a total reaction volume of 0.5 m L . The reaction volume for the sample u tilizing 0.5 nM of [ 3 H ] 17 estradiol was 1 mL. The lysate was diluted with lysate buffer to 0.076 mg/mL and was kept on ice. [ 3 H ] 17 estradiol in ethanol was added to each tube and the solvent was dried under nitrogen for approximately 10 min. Tris Cl, M gCl2, water, and the enzyme solution were added to the tubes. The tubes were vortex mixed again to mix contents, then centrifuged for 2 min at 2,000 rpm (full speed) to bring the contents to the bottom of the tube. The tubes were prei ncubated at 37 C for 1 min . PAPS was added to all incubated tubes at timed intervals (e.g. 20 secs) to initiate the reaction. Icecold TCA (0.2 mL) was added to the blank tubes before adding the enzyme solution and PAPS. After incubating at 37 C for 5 min, 0.2 mL icecold TC A was added to the samples (at the same timed interval the PAPS was added) to stop the reaction. Water sa turated methylene chloride, 1 mL, was added to each tube and the tubes were vortex mixed for 30 sec s. The tubes were then centrifuged at 2000 rpm for 5 min to separate the phases. The methylene chloride (lower phase) was discarded and the extraction was repeated twice more. An aliquot of the upper aqueous phase, 0.2 mL, was counted for quantification of the sulfate conj ugate(s). Cell Culture JEG 3 cells were cultured in recommended culture media, ATCC formulated EMEM with out phenol red, and 10% FBS in 75 cm2 flasks in a humidified atmosphere with 5% CO2 at 37 C. Media was changed every two days and cells were subcultured upon confluency. One milliliter s tock solutions of passaged cells were prepared in dimethyl sulfoxide (DMSO) and stored in liquid nitrogen. 120

PAGE 121

The human embryonic kidney (HEK) 293T cells were cultured in DMEM with phenol red , supplemented with 10% FBS in 150 c m2 flasks in a humidified atmosphere with 5% CO2 at 37 C. RNA Extraction and cDNA Synthesis Total RNA was carefully extracted from the JEG 3 cells using the Qiagen RNeasy Mini Kit. The Promega reverse transcriptase kit was used in the synthesis of cDNA. The settings for the PCR thermal profile used in this study were as described previously (Suzuki et al., 2003). The primer sequences used are as follows [NM005420]; FWD 5’ AGAGGAGCTTGTGGACAGGA 3’ and REV 5’ GGCGACAATTTCTGGTTCAT 3’ (Suzuki et al., 2003). The traditional method for assessin g RNA concentration and purity is UV spectroscopy. An A260/A280 absorbance ratio of 1.8 – 2.1 indicates highly purified RNA. However, because virtually all RNA samples have trace amounts of contaminating DNA, the RNA samples were treated with RNase free DNas e to remove contaminating DNA. (Generally DNase digestion is not required since the RNeasy silicagel membrane technology efficiently removes most of the DNA without DNase treatment). The kit used in this experiment contained a buffer and DNase I mix that was applied directly to the RNeasy silicagel membrane, and after a series of washing and centrifuging, RNA was eluted. Spectrophotometric analysis was conducted once more to determine the purity of the RNA solution. An A260/A280 ratio of the DNase treated RNA is usually between 1.81.9, and the results indicated that the RNA purified from the JEG 3 samples was pure and of high quality. After 30 to 40 rounds of synthesis of cDNA, the reaction product was analyzed for purity by agarose gel electrophoresis. T hree JEG 3 samples were placed into wells on the agarose gel and after electrophoresis the gel was viewed on a UV transilluminator. The product was 121

PAGE 122

abundant enough to be detected with an ethidium bromide stain. mRNA expression for estrogen sulfotransferase was detected as a specific single band (114 bp) in the JEG 3 cells ( Figure 51 ) . Expression of SULT1E1 GFP The SULT1E1 plasmid was purified using a Qiagen Maxiprep kit and the resulting purified plasmid DNA was quantified and sequenced by the University of Florida’s Interdisciplinary Center for Biotechnology Research (ICBR). Sequencing was necessary to verify that the plasmid correctly encoded the SULT1E1 DNA . For transfection, the cells were seeded in 60 mm petri dishes ( Corning, Corning, NY ) at a density of approximately 1 x 106 and were left to attach overnight. The culture media was aspirated from each dish and exchanged for 2 mL serum free media containing transfection solution. Preliminary transfection studies with JEG 3 and HEK 293T cells were conduc ted in a 24well plate. C ells were plated at various densities (25,0001,000,000 cells/plate) and transfected for 6 hours with a range of SULT1E1 DNA concentrations ( 0 2 g) using lipofectamine 2000. A wide range of incubation times (024 hours) was also considered. Based on the results of these preliminary experiments, final transfection and experimental conditions were determined. For results illustrated in this dissertation, the pcDNA3.1/NT GFP/SULT1E1 vector was transfected into HEK 293T cells using lipofectamine. The vector was constructed as previousl y described (Kapoor et al., 2007) and encoded a green fluorescent protein (GFP) tagged SULT1E1 fusion protein. A pproximately 0.025 g of SULT1E1 DNA was transfected into the cells, and a fter 6 hours, the transfection solution was removed and 122

PAGE 123

the cells were refed normal culture media and incubated overnight in a humidified atmosphere with 5% CO2 at 37 C. The success of the transfecti on was visually analyzed using fluorescent microscopy. Treatment For cell exposure, the medium was changed to DMEM supplemented with 50 nM [3H] 17 estradiol in the presence of triclosan (0 nM, 500 nM, 1 M, 5 M, and 10 M). Stock solutions of [3H] 17 es tradiol and triclosan were made in ethanol and stored at 4 C . The final concentration of ethanol exposure to the cells was approximately 1% by volume. At these concentrations, ethanol had no effect on steroid sulfate secretion and cell viability. The viab ility of the cells was found to be > 95% before seeding, as determined by the trypan blue exclusion test . After incubating for 1 hour with the complete range of triclosan concentrations, the medium was collected in individual test tubes and the cells were r eleased from the petri dish using trypsin. Methanol, 2 mL, was used to rinse the dishes and added to the test tubes of collected cell media to stop the reaction. The tubes were frozen at 20 C for 2 hours prior to centrifugation at 1,000 rpm for 5 min to precipi tate protein and cell debris. The supernatant was analyzed by HPLC for identification of the [3H] 17 estradiol 3 sulfate and the unconjugated substrate, [3H] 17 estradiol . HPLC Analysis Samples of the supernatant, 0.2 mL, were centrifugefiltered, and injected into the HPLC column. HPLC analysis of the media samples was conducted on a Beckman Gold Nouv eau HPLC system equipped with ultraviolet ( UV ) and fluorescence detectors ram IN/US Systems Inc., Tampa, Florida). A 123

PAGE 124

C18 reverse phase column (4.6 mm x 25 cm) with a C18 precolumn (Discovery system, Supelco, Bellefonte, PA) was used. The isocratic mobile phase consisted of 55% methanol with 0.005 M PICA at a constant flow rate of 1 mL/min. Data Analysis To examine enzyme kinetics, the counts retrieved from the liquid scintillation counter were converted to pmol estr adiol 3 sulfate/min/mg protein. The SULT1E1 vector used for the transient transfection of the HEK 293T cells h as a GFP tag that is linked at the N terminus of the SULT1E1 sequence. This GFP tag assisted in evaluating transfection efficiency and was observed using a fluorescent microscope with a GFP filter. Radioactivity from the cell supernatant of each sample was measured by scintillation counting. Estradiol and estradiol 3 sulfate were identified by the retention times of 18 min and 10 min, respectively. The percentages of the estradiol 3 sulfate peaks obtained from HPLC were converted to pmoles of estradiol sulfate produced/hour, using the radioactivity of [3H] estradiol. Means and statistical significance were calculated and analyzed by Excel software (M icrosoft, Redmond, WA) or GraphPad software (version 6.0; GraphPad Software, Inc., San Diego, CA) . Results One aim of this study was to use a radiochemical extraction method to investigate the effect of a series of nanomolar estradiol concentrations and va rious micromolar PAPS concentration s on human SULT1E1 lysate activities. Results demonstra ted that both PAPS concentration and substrate concentration influence estradiol sulfonation (Figure 52 ). The highest concentration of E2 used in the assay (20 nM) p roduced maximal activity ( Table 51 ). The data for the human lysate kinetics 124

PAGE 125

demonstrat ed that PAPS concentration has a direct effect on estradiol sulfonation. As the PAPS concentration decreased the observed conjugation of estradiol also decreased. The enzyme kinetic constants for 5 M PAPS are also shown in Table 5 1. Both cell lines were successfully transiently transfected with GFP tagged SULT1E1 and the expression of SULT1E1 was visually analyzed. Figure 5 3 illustrates the green fluorescence observed in live HEK 293T and JEG 3 c ells that had been transiently transfected with the GFP SULT1E1 fusion protein. The fluorescence is representative of estrogen sulfotrans ferase expression in the cells. T he transfection observed in the JEG 3 cell line was not as efficient as the transfecti on in the 293T cells . Despite the detection of estrogen sulfotransferase mRNA in the JEG 3 cell line ( Figure 51 ), little to no activity was observed in the nontransfected cells. The percent of estradiol conversion to the sulfate was practically the same between the non transfected and transfected JEG 3 cells (Table 5 2). As a result , to examine the effect of triclosan on estrogen sulfotransferase activity , the 293T cells were used. 293T cells that were not transfected did not demonstrate any observed fluo rescence and exhibited significantly less (p < 0.0001) sulfotransferase activity than the transfected cells (Figure 5 4 ). The nontransfected cells showed no significant difference (p > 0.05) in estradiol 3 sulfate secretion between the estradiol and estra diol/triclosan treated cells. The opposite was true for the transfected cells; there was a significant difference (p < 0.05) in sulfate formation between the cells exposed to triclosan and thos e treated with estradiol alone. Using transfected HEK 293T cell s, we found that triclosan is capable of disrupting steroid metabolism by decreasing the secretion of estrogen sulfates. The 125

PAGE 126

results presented here illustrate the inhibitory effect of micromolar concentrations of triclosan on estradiol 3 sulfate formation and secretion into media (Tabl e 53 ). Micromolar concentrations of triclosan treatment after 1 hour led to less sulfonation of [3H] 17 estradiol , whereas the lowest nanomolar concentration of triclosan (500 nM) illustrated little effect on [3H] 17 estradiol 3 sulfate formation. At the highest 10 M triclosan concentration, estradiol conjugation was inhibited by nearly 4 0%. This data suggests that estrogen sulfotransferase activity in live human cells may be less sensitive to the inhibitory effects of low nanomolar concentrations of triclosan or possibly that triclosan is not re aching the enzyme. Discussion As mentioned earlier, the quantification of mRNA expression can sometimes lack correlation to protein expression. This could explain the discrepancy bet ween the detection of SULT1E1 mRNA in the JEG 3 cell line and the lack of observed enzyme activity toward estradiol. While sulfotransferase activity toward estradiol is detected in the nontransfected cells, the low activity level may suggest that protein expression of estrogen sulfotransferase is not at a maximal level. Future studies should consider transfecting more SULT1E1 into these cells in order to analyze an e ffect of triclosan on activity. Perhaps the reason for the lower potency of triclosan inhibition observed in this experiment is due to the high concentration of estradiol that was used. At high substrate concentrations, substrate inhibition is a commonly observed phenomenon in sulfate conjugation , especially with SULT1E1. Human SULT1E1 is capabl e of binding two molecules of estradiol, with the binding of the second molecule causing enzyme 126

PAGE 127

inhibition (Zhang et al., 1998) . At the 50 nM concentration of estradiol used in this experiment, it is possible that a second molecule of estradiol was competi ng with triclosan as an inhibitor. This, in turn, could have caused inhibition by triclosan to only be observed at a relatively high concentration, compared with results from the expressed enzyme which showed an IC50 of 20 nM (RohnGlowacki et al., 2014). Conclusion To evaluate the effect of triclosan on E2 sulfonation, HEK 293T cells were cultured alone or transfected with estrogen sulfotransferase and exposed to estradiol or estradiol and triclosan for 1 hour. Increasing concentrations of triclosan in the culture of HEK 293T cells decreased estradiol sulfate secretion. During pregnancy, the human fetus develops in a “hyper estrogenic environment,” where estrogen sulfotransferase plays a vital role in maintaining steroid homeostasis (Kapoor et al., 2007). T herefore, any disturbance to this environment could impair the normal growth and natural development of the fetus. These findings provide insight into the intracellular role of human SULT1E1 in estrogen metaboli sm and highlight the possibility that continu ous exposure to triclosan might impair the ability of the fetus to efficiently metabolism estrogen, which is vital during the developmental stages of life. 127

PAGE 128

Figure 51. Estrogen sulfotransferase mRNA expression in JEG 3 cells. This is the image of an a ga rose gel after ethidium bromide staining illustrating SULT1E1 mRNA (114 b ase p airs ) in JEG 3 samples. Lane 1 is the DNA ladder; lanes 2, 3, and 4 are JEG 3 samples; lane 5 is the control (no cells). v (nmol/min/mg) Fig ure 52 . Michaelis Men ten curve illustrating the effect of [PAPS] and [E2] on human SULT1E1 activity. 128

PAGE 129

Figure 53 . Illustration of transfection success using fluorescent microscopy to observe SULT1E1 GFP. A ) Snapshot of live cells under an optic microscope, where light is used to visualize the cells; B ) snapshot of cells expressing SULT1E1GFP under the fluorescent m icroscope using a GFP fliter; C) Image A superimposed on image B illustrating live cells expressing SULT1E1 GFP. A) C) B) 293T JEG 3 129

PAGE 130

% Product Formation Figure 5 4 . SULT1E1 activity towards estradiol in transfected and nontransfected HEK 293T cells in the presence and absence of 10 M triclosan (TRC). The graph confirms the successful transfection and expression of SULT1E1 in the transfected cells. The asterisk denotes a signifi cant difference at p < 0.05 between the percentage of product (E23 SO4) formed after exposure to estradiol alone versus exposure to estradiol and triclosan. Table 51. Apparent kinetic constants for 5 M PAPS observed at different E2 concentrations with human SULT1E1. 0.5 nM E2 1 nM E2 2 nM E2 5 nM E2 10 nM E2 20 nM E2 K m 2.48 2.80 3.71 1.38 4.20 1.37 V m ax 7.53 18.1 33.9 42.9 117.4 123.7 *Data shown are the apparent Km and Vmax values for PAPS. Table 52. Estradiol conversion to estradiol 3 sulfate in transfected and nontransfected JEG 3 cells. %E2 %E2 3 SO4 Activity (pmol/hr ) Non Transfected 95. 16 4.84 5.60 Transfected 93.68 6.32 7.31 130

PAGE 131

Table 53 . The inhibitory effect of triclosan on SULT1E1 activity towards 50 nM estradiol in transfected HEK 293T cells. Triclosan M n % E2 % E2 3 SO 4 Mean Activity (pmol/hr) 0 4 26.99 73.01 88.12 0.5 2 31.84 67.39 81.39 1 2 34.31 65.70 79.35 5 2 44.00 56.01 67.59 10 2 55.27 44.73 54.10 *Activity is expressed as pmol of estradiol 3 sulfate per hour and values represent the mean of n samples. 131

PAGE 132

CHAPTER 6 CONCLUSIONS Xenobiotics are foreign, typically lipid soluble, compounds that enter the body and must undergo biotransformation, via phase I and II enzymes, to enable elimination. Phase II conjugation reactions are often, but not always, preceded by phase I metabolic reactions and are responsible for the conversion of lipophilic molecules to water soluble, more re adily excreted metabolites. UDP glucuronosyltransferases and sulfotransferases are the primary phase II enzyme s responsible for the metabolism of most of the pharmaceuticals on the market, during which hydrophilic moieties are converted to glucuronide or sulfate conjugates, respectively. As these enzymes exhibit overlapping substrate specificities, they may compet e for the conjugation of the same (or different) group(s) in the same molecule, as obs erved in the case of triclosan. Triclosan is a commonly used antibacterial agent that is present in a number of antibacterial personal care products including hand soaps, toothpastes, and mouthwashes. As a result, the primary routes of human exposure are ingestion and dermal absorption (Bagley and Lin, 2000; Lin , 2000). After continuous consumer use and exposure, triclosan has not only been detected in the environment, but there is increasing evidence documenting the presence of triclosan in human samples (refer to Table 12) . Due to the negative unanticipated biological effects that triclosan has been shown to possess, such as endrocrine disruption and inhibition of metabolizing enzymes, it is imperative to more closely examine the interaction of this compound with biological enzymes, which dictate its ready metabolism and excretion from the human body (Hanioka et al., 1996; Jinno et al., 1997; Luo et al., 2002; Wang et al. , 2004; Jacobs et al., 2005; Veldhoen et al., 2006; Wang and James, 2006; Crofton et al., 2007; 132

PAGE 133

Gee et al., 2008; Zorrilla et al., 2009; James et al., 2010; Paul et al., 2010; Stoker et al., 2010; Manservisi et al., 2014; Zhang et al., 2015). The primary f ocus of this dissertation was to study the interaction of triclosan with human and sheep phase II enzymes. In order to achieve this, numerous studies using human liver microsomes were designed to investigate triclosan metabolism and the effect of a common polymorphism, UGT1A1*28, on its conjugation. In addition, s heep liver and placenta cytosols were used to examine the inhibitory effect of triclosan on sulfotransferase activity. Other studies tested the activity of triclosan on sulfatase enzymes, which are responsible for the hydr olysis of sulfonated compounds. The studies of triclosan glucuronidation were designed to address the hypothesis that triclosan glucuronidation varies between individuals. These results suggested that there exists wide variability in a human population, i rrespective of age and gender. Furthermore, among 10 different UGT isoforms studied for their ability to catalyze triclosan glucuronidation, previous lab studies indicated that UGT1A1 was most efficient. As a result, this study soug ht to further examine triclosan glucuronidation in human liver microsome samples that had been genotyped for the common UGT1A1*28 polymorphism, which is known to reduce UGT1A1 expression and decrease enzyme activity. We found that despite the reduction in UGT1A1 expression, individuals with the polymorphism did not exhibit less UGT catalyzed activity towards triclosan. In fact, statistical analysis on all studied UGTs demonstrated that UGT2B4, followed by UGT1A4, contributed most to triclosan glucuronidatio n. Kinetic studies with UGT2B4 illustrated that Michaelis Menten kinetics were followed up to a 100 M triclosan concentration. Above this concentration, kinetics showed a trend for substrate inhibition. 133

PAGE 134

Pharmacokinetic drug drug interactions may take plac e at any point during the absorption, distribution, metabolism and elimination process, however, when predicting these interactions, phase I enzymes are most often considered. While this is justifiable since approximately 50% of pharmaceuticals are metabol ized via phase I enzymes, like CYP450s, drug interactions with phase II enzymes should also be considered. The inhibition of UGT2B4 by triclosan or other compounds, such as methadone, can alter the pharmacokinetic properties of other drugs and possibly cause undesired adverse effects. Additional studies sought to investigate triclosan inhibition of sulfotransferase and sulfatase enzymes, which is necessary to fully ass ess the potential role of this environmental substrate on human health. In assessing tricl osan’s effect on 17 estradiol sulfonation in fetal tissues of pregnant ewes treated with triclosan, our studies showed a significant decrease in estradiol sulfoconjugation in the triclosan treated hepatic (p < 0.001) and placental (p < 0.005) cytosols versus the salinetrea ted controls. Linear regression analysis demonstrated a negative correlation between triclosan tissue concentration (pmol/g placental tissue) and sulfotransferase activity (pmol/min/mg protein) towards estradiol. These findings along with other studies by Wang and James (2006) demonstrated that triclosan exhibits inhibitory actions toward sulfonation reactions. Other research showed that triclosan inhibit ed human SULT1E1 with an IC50 of 20 nM (Rohn Glowacki et al., 2014). Additional studies presented in thi s dissertation were therefore designed to examine sulfotransferase kinetics with varying estradiol and PAPS concentrations in expressed human SULT1E1. Maximal enzyme activity was 134

PAGE 135

observed at the 20 nM estradiol substrate concentration, and PAPS concentrati on was directly proportional to estradiol sulfoconjugation, confirming the importance of this cosubstrate in sulfotransferase activity. T o investigate the effect of triclosan on 17 estradiol sulfate secretion in live human cells, transient transfections with SULT1E1 were attempted in both JEG 3 placental cells and HEK 293T cells . U nder the current transfection conditions , adequate transfection efficiency was only observed in the em bryonic kidney cells. Studies revealed that increasing concentrations of triclosan reduced estradiol 3 sulfate formation and secretion, and 10 M triclosan inhibited estradiol conjugation by approximately 40% compared to transfected cells exposed to estrad iol alone . Although triclosan was a considerably less potent inhibitor of sulfatase activity compared with sulfotransferase activity, sulfatase activity towards E1S and 4MeUS was inhibited by triclosan with varying potencies. While triclosan and triclosansulfate served as competitive inhibitors of human arylsulfatase, triclosan was a better inhibitor of general arylsulfatase than steroid sulfatase. Triclosansulfate proved to be a competitive inhibitor of arylsulfatase in sheep placental and human liver samples, but only in human samples did it appear to be more potent than triclosan. Collectively, these findings provide insight into UGT isoforms that are most associated with triclosan metabolism as well as the inhibitory role of triclosan regarding human S ULT1E1 and estrogen metabolism. More importantly, these studies highlight the possibility that continuous exposure of people, in particular pregnant women, to triclosan through the use of personal care products may disrupt steroid homeostasis 135

PAGE 136

and impair the fetus’s ability to efficiently metabolism estrogen, which is vital during the developmental stages of life. 136

PAGE 137

LIST OF REFERENCES Adolfsson Erici M, Pettersson M, Parkkonen J, and Sturve J (2002) Triclosan, a commonly used bactericide found in human milk and in the aquatic environment in Sweden. Chemosphere 46: 14851489. Ahn KC, Zhao B, Chen J, Cherednichenko G, Sanmarti E, Denison MS, Lasley B, Pessah IN, Kltz D, Chang DP, Gee SJ, and Hammock BD (2008) In vitro biologic activities of the antimicrobials tr iclocarban, its analogs, and triclosan in bioassay screens: receptor based bioassay screens. Environ Health Perspect 116: 12031210. Allmyr M, AdolfssonErici M, McLachlan MS, and SandborghEnglund G (2006) Triclosan in plasma and milk from Swedish nursing mothers and their exposure via personal care products. Sci Total Environ 372: 87 93. Alnouti Y and Klaassen CD (2006) Tissue distribution and ontogeny of sulfotransferase enzymes in mice. Toxicol Sci 93: 242 255. Ando Y, Saka H, Ando M, Sawa T, Muro K, Ueoka H, Yokoyama A, Saitoh S, Shimokata K, and Hasegawa Y (2000) Polymorphisms of UDP glucuronosyltransferase gene and irinotecan toxicity: a pharmacogenetic analysis. Cancer Res 60: 69216926. Arbuckle TE, Marro L, Davis K, Fisher M, Ayotte P, Blanger P, Dumas P, LeBlanc A, Brub R, Gaudreau , Provencher G, Faustman EM, Vigoren E, Ettinger AS, Dellarco M, MacPherson S, and Fraser WD (2015a) Exposure to Free and Conjugated Forms of Bisphenol A and Triclosan among Pregnant Women in the MIREC Cohort. Environ He alth Perspect 123: 277284. Arbuckle TE, Weiss L, Fisher M, Hauser R, Dumas P, Brub R, Neisa A, LeBlanc A, Lang C, Ayotte P, Walker M, Feeley M, Koniecki D, and Tawagi G (2015b) Maternal and infant exposure to environmental phenols as measured in multiple biological matrices. Sci Total Environ 508: 575584. Argikar UA and Remmel RP (2009) Effect of aging on glucuronidation of valproic acid in human liver microsomes and the role of UDP glucuronosyltransferase UGT1A4, UGT1A8, and UGT1A10. Drug Metab Dispos 37 : 229 236. Baenziger JU (1996) Glycosylation: to what end for the glycoprotein hormones? Endocrinology 137: 15201522. Bagley DM and Lin YJ (2000) Clinical evidence for the lack of triclosan accumulation from daily use in dentifrices. Am J Dent 13: 148 152. 137

PAGE 138

B ailey MJ and Dickinson RG (1999) Limitations of hepatocytes and liver homogenates in modelling in vivo formation of acyl glucuronidederived drug protein adducts. J Pharmacol Toxicol Methods 41: 27 32. Bailey MJ and Dickinson RG (2003) Acyl glucuronide reac tivity in perspective: biological consequences. Chem Biol Interact 145: 117 137. Balmer ME, Poiger T, Droz C, Romanin K, Bergqvist PA, Mller MD, and Buser HR (2004) Occurrence of methyl triclosan, a transformation product of the bactericide triclosan, in f ish from various lakes in Switzerland. Environ Sci Technol 38: 390395. Barker EV, Hume R, Hallas A, and Coughtrie WH (1994) Dehydroepiandrosterone sulfotransferase in the developing human fetus: quantitative biochemical and immunological characterization o f the hepatic, renal, and adrenal enzymes. Endocrinology 134: 982 989. Barnhart WE, Hiller LK, Leonard GJ, and Michaels SE (1974) Dentifrice usage and ingestion among four age groups. J Dent Res 53: 13171322. Baxter PM (1980) Toothpaste ingestion during toothbrushing by school children. Br Dent J 148: 125 128. Bedoux G, Roig B, Thomas O, Dupont V, and Le Bot B (2012) Occurrence and toxicity of antimicrobial triclosan and by products in the environment. Environ Sci Pollut Res Int 19: 10441065. Bester K (2003) Triclosan in a sewage treatment process --balances and monitoring data. Water Res 37: 3891 3896. Beutler E, Gelbart T, and Demina A (1998) Racial variability in the UDP glucuronosyltransferase 1 (UGT1A1) promoter: a balanced polymorphism for regulation of bi lirubin metabolism? Proc Natl Acad Sci U S A 95: 81708174. Biondi ML, Turri O, Dilillo D, Stival G, and Guagnellini E (1999) Contribution of the TATA box genotype (Gilbert syndrome) to serum bilirubin concentrations in the Italian population. Clin Chem 45: 897 898. Black JG, Howes D, and Rutherford T (1975) Percutaneous absorption and metabolism of Irgasan DP300. Toxicology 3: 3347. Blanchard RL, Freimuth RR, Buck J, Weinshilboum RM, and Coughtrie MW (2004) A proposed nomenclature system for the cytosolic sulfotransferase (SULT) superfamily. Pharmacogenetics 14: 199211. 138

PAGE 139

Blanchon L, Sauvant P, Bavik C, Gallot D, Charbonne F, AlexandreGouabau MC, Lemery D, Jacquetin B, Dastugue B, Ward S, and Sapin V (2002) Human choriocarcinoma cell line JEG 3 produces and secretes active retinoids from retinol. Mol Hum Reprod 8: 485 493. Borlak J, Thum T, Landt O, Erb K, and Hermann R (2000) Molecular diagnosis of a familial nonhemolytic hyperbilirubinemia (Gilbert's syndrome) in healthy subjects. Hepatology 32: 792 795. Bosma PJ, Chowdhury JR, Bakker C, Gantla S, de Boer A, Oostra BA, Lindhout D, Tytgat GN, Jansen PL, and Oude Elferink RP (1995) The genetic basis of the reduced expression of bilirubin UDP glucuronosyltransferase 1 in Gilbert's syndrome. N Engl J Med 333: 117111 75. Bossuyt X and Blanckaert N (2001) Differential regulation of UDP GlcUA transport in endoplasmic reticulum and in Golgi membranes. J Hepatol 34: 210 214. Bowalgaha K and Miners JO (2001) The glucuronidation of mycophenolic acid by human liver, kidney and jejunum microsomes. Br J Clin Pharmacol 52: 605 609. Bradman A, Barr DB, Claus Henn BG, Drumheller T, Curry C, and Eskenazi B (2003) Measurement of pesticides and other toxicants in amniotic fluid as a potential biomarker of prenatal exposure: a validation study. Environ Health Perspect 111: 17791782. Braoudaki M and Hilton AC (2004) Low level of cross resistance between triclosan and antibiotics in Escherichia coli K 12 and E. coli O55 compared to E. coli O157. FEMS Microbiol Lett 235: 305 309. Bricker L an d Farquharson RG (2002) Types of pregnancy loss in recurrent miscarriage: implications for research and clinical practice. Hum Reprod 17: 1345 1350. Burchell B and Coughtrie MW (1989) UDP glucuronosyltransferases. Pharmacol Ther 43: 261 289. Burns GR (1983) Purification and partial characterization of arylsulphatase C from human placental microsomes. Biochim Biophys Acta 759: 199204. Calafat AM, Weuve J, Ye X, Jia LT, Hu H, Ringer S, Huttner K, and Hauser R (2009) Exposure to bisphenol A and other phenols in neonatal intensive care unit premature infants. Environ Health Perspect 117: 639 644. Calafat AM, Ye X, Wong LY, Reidy JA, and Needham LL (2008) Urinary concentrations of triclosan in the U.S. population: 20032004. Environ Health Perspect 116: 303 307. 139

PAGE 140

Cappiello M, Franchi M, Giuliani L, and Pacifici GM (1989) Distribution of 2naphthol sulphotransferase and its endogenous substrate adenosine 3' phosphate 5' phosphosulphate in human tissues. Eur J Clin Pharmacol 37: 317 320. Cappiello M, Franchi M, Rane A, and Pacifici GM (1990) Sulphotransferase and its substrate: adenosine3' phosphate5' phosphosulphate in human fetal liver and placenta. Dev Pharmacol Ther 14: 6265. Cappiello M, Giuliani L, and Pacifici GM (1991) Distribution of UDP glucuronosyltransferase and its endogenous substrate uridine 5' diphosphoglucuronic acid in human tissues. Eur J Clin Pharmacol 41: 345 350. Carnegie JA and Robertson HA (1978) Conjugated and unconjugated estrogens in fetal and maternal fluids of the pregnant ewe: a possible role for estrone sulfate during early pregnancy. Biol Reprod 19: 202 211. Chen XY, Zhao LM, and Zhong DF (2003) A novel metabolic pathway of morphine: formation of morphine glucosides in cancer patients. Br J Clin Pharmacol 55: 570 578. Chou JY (1982) Effects of retinoic acid on differentiation of choriocarcinoma cells in vitro. J Clin Endocrinol Metab 54: 11741180. Christrup LL (1997) Morphine metabolites. Acta Anaesthesiol Scand 41: 116 122. Cole DE, Baldwin LS, and Stirk LJ (1984) Increased inorganic sulfate in mother and fetus at parturition: evidence for a fetal to maternal gradient. Am J Obstet Gynecol 148: 596599. Cole DE, Baldwin LS, and Stirk LJ (1985) Increased serum sulfate in pregnancy: relationship to gestational age. Clin Chem 31: 866867. Connor K, Ram amoorthy K, Moore M, Mustain M, Chen I, Safe S, Zacharewski T, Gillesby B, Joyeux A, and Balaguer P (1997) Hydroxylated polychlorinated biphenyls (PCBs) as estrogens and antiestrogens: structureactivity relationships. Toxicol Appl Pharmacol 145: 111123. C oughtrie MW (1996) Sulphation catalysed by the human cytosolic sulphotransferases -chemical defence or molecular terrorism? Hum Exp Toxicol 15: 547 555. Court MH (2010) Interindividual variability in hepatic drug glucuronidation: studies into the role of ag e, sex, enzyme inducers, and genetic polymorphism using the human liver bank as a model system. Drug Metab Rev 42: 209 224. 140

PAGE 141

Court MH, Zhang X, Ding X, Yee KK, Hesse LM, and Finel M (2012) Quantitative distribution of mRNAs encoding the 19 human UDP glucuronosyltransferase enzymes in 26 adult and 3 fetal tissues. Xenobiotica 42: 266 277. Crofton KM, Paul KB, Devito MJ, and Hedge JM (2007) Short term in vivo exposure to the water contaminant triclosan: Evidence for disruption of thyroxine. Environ Toxicol Pharm acol 24: 194197. Daidoji T, Gozu K, Iwano H, Inoue H, and Yokota H (2005) UDP glucuronosyltransferase isoforms catalyzing glucuronidation of hydroxy polychlorinated biphenyls in rat. Drug Metab Dispos 33: 1466 1476. Dann AB and Hontela A (2011) Triclosan: environmental exposure, toxicity and mechanisms of action. J Appl Toxicol 31: 285311. Dawson PA (2011) Sulfate in fetal development. Semin Cell Dev Biol 22: 653 659. DeSalva SJ, Kong BM, and Lin YJ (1989) Triclosan: a safety profile. Am J Dent 2 Spec No: 185 196. Dibbelt L and Kuss E (1986) Human placental steryl sulfatase. Enzyme purification, production of antisera, and immunoblotting reactions with normal and sulfatasedeficient placentas. Biol Chem Hoppe Seyler 367: 1223 1229. Duanmu Z, Weckle A, Koukouritaki SB, Hines RN, Falany JL, Falany CN, Kocarek TA, and RungeMorris M (2006) Developmental expression of aryl, estrogen, and hydroxysteroid sulfotransferases in preand postnatal human liver. J Pharmacol Exp Ther 316: 13101317. Esteban A and Prez Mateo M (1999) Heterogeneity of paracetamol metabolism in Gilbert's syndrome. Eur J Drug Metab Pharmacokinet 24: 9 13. Fair PA, Lee HB, Adams J, Darling C, Pacepavicius G, Alaee M, Bossart GD, Henry N, and Muir D (2009) Occurrence of triclosan in plasma of wild At lantic bottlenose dolphins (Tursiops truncatus) and in their environment. Environ Pollut 157: 22482254. Falany CN, Krasnykh V, and Falany JL (1995) Bacterial expression and characterization of a cDNA for human liver estrogen sulfotransferase. J Steroid Biochem Mol Biol 52: 529 539. Falany CN, Wheeler J, Oh TS, and Falany JL (1994) Steroid sulfation by expressed human cytosolic sulfotransferases. J Steroid Biochem Mol Biol 48: 369 375. Falany JL and Falany CN (1996) Expression of cytosolic sulfotransferases in normal mammary epithelial cells and breast cancer cell lines. Cancer Res 56: 1551 1555. 141

PAGE 142

Fallon JK, Neubert H, Goosen TC, and Smith PC (2013a) Targeted precise quantification of 12 human recombinant uridinediphosphate glucuronosyl transferase 1A and 2B isoforms using nanoultra high performance liquid chromatography/tandem mass spectrometry with selected reaction monitoring. Drug Metab Dispos 41: 20762080. Fallon JK, Neubert H, Hyland R, Goosen TC, and Smith PC (2013b) Targeted quantitative proteomics for t he analysis of 14 UGT1As and 2Bs in human liver using NanoUPLC MS/MS with selected reaction monitoring. J Proteome Res 12: 44024413. Fang JL, Vanlandingham M, da Costa GG, and Beland FA (2014) Absorption and metabolism of triclosan after application to the skin of B6C3F1 mice. Environ Toxicol . Farheen S, Sengupta S, Santra A, Pal S, Dhali GK, Chakravorty M, Majumder PP, and Chowdhury A (2006) Gilbert's syndrome: High frequency of the (TA)7 TAA allele in India and its interaction with a novel CAT insertion in promoter of the gene for bilirubin UDP glucuronosyltransferase 1 gene. World J Gastroenterol 12: 22692275. Fisher MB, Vandenbranden M, Findlay K, Burchell B, Thummel KE, Hall SD, and Wrighton SA (2000) Tissue distribution and interindividual variation i n human UDP glucuronosyltransferase activity: relationship between UGT1A1 promoter genotype and variability in a liver bank. Pharmacogenetics 10: 727 739. Fiss EM, Rule KL, and Vikesland PJ (2007) Formation of chloroform and other chlorinated byproducts by chlorination of triclosancontaining antibacterial products. Environ Sci Technol 41: 23872394. Ford HB and Schust DJ (2009) Recurrent pregnancy loss: etiology, diagnosis, and therapy. Rev Obstet Gynecol 2: 7683. Fuchsman P, Lyndall J, Bock M, Lauren D, Bar ber T, Leigh K, Perruchon E, and Capdevielle M (2010) Terrestrial ecological risk evaluation for triclosan in landapplied biosolids. Integr Environ Assess Manag 6: 405 418. Gaganis P, Miners JO, Brennan JS, Thomas A, and Knights KM (2007) Human renal corti cal and medullary UDP glucuronosyltransferases (UGTs): immunohistochemical localization of UGT2B7 and UGT1A enzymes and kinetic characterization of S naproxen glucuronidation. J Pharmacol Exp Ther 323: 422430. Gamage N, Barnett A, Hempel N, Duggleby RG, Wi ndmill KF, Martin JL, and McManus ME (2006) Human sulfotransferases and their role in chemical metabolism. Toxicol Sci 90: 5 22. 142

PAGE 143

Gamage NU, Tsvetanov S, Duggleby RG, McManus ME, and Martin JL (2005) The structure of human SULT1A1 crystallized with estradiol . An insight into active site plasticity and substrate inhibition with multi ring substrates. J Biol Chem 280: 41482 41486. Garner CE, Jefferson WN, Burka LT, Matthews HB, and Newbold RR (1999) In vitro estrogenicity of the catechol metabolites of selected polychlorinated biphenyls. Toxicol Appl Pharmacol 154: 188197. Gee RH, Charles A, Taylor N, and Darbre PD (2008) Oestrogenic and androgenic activity of triclosan in breast cancer cells. J Appl Toxicol 28: 7891. Geens T, Neels H, and Covaci A (2012) Distribution of bisphenol A, triclosan and nnonylphenol in human adipose tissue, liver and brain. Chemosphere 87: 796 802. Gelston EA, Coller JK, Lopatko OV, James HM, Schmidt H, White JM, and Somogyi AA (2012) Methadone inhibits CYP2D6 and UGT2B7/2B4 in vivo: a study using codeine in methadoneand buprenorphinemaintained subjects. Br J Clin Pharmacol 73: 786 794. Ghosh D (2007) Human sulfatases: a structural perspective to catalysis. Cell Mol Life Sci 64: 20132022. Glatt H, Boeing H, Engelke CE, Ma L, Kuhlow A, Pabel U, Pomplun D, Teubner W, and Meinl W (2001) Human cytosolic sulphotransferases: genetics, characteristics, toxicological aspects. Mutat Res 482: 2740. Goon D and Klaassen CD (1992) Effects of microsomal enzyme inducers upon UDP glucuronic acid concen tration and UDP glucuronosyltransferase activity in the rat intestine and liver. Toxicol Appl Pharmacol 115: 253 260. Guo YL, Lambert GH, and Hsu CC (1995) Growth abnormalities in the population exposed in utero and early postnatally to polychlorinated biphenyls and dibenzofurans. Environ Health Perspect 103 Suppl 6: 117 122. Hanioka N, Omae E, Nishimura T, Jinno H, Onodera S, Yoda R, and Ando M (1996) Interaction of 2,4,4' trichloro 2' hydroxydiphenyl ether with microsomal cytochrome P450dependent monooxygenases in rat liver. Chemosphere 33: 265 276. Hanson SR, Best MD, and Wong CH (2004) Sulfatases: structure, mechanism, biological activity, inhibition, and synthetic utility. Angew Chem Int Ed Engl 43: 57365763. 143

PAGE 144

Harris RM, Waring RH, Kirk CJ, and Hughes PJ ( 2000) Sulfation of "estrogenic" alkylphenols and 17betaestradiol by human platelet phenol sulfotransferases. J Biol Chem 275: 159 166. Herman RJ, Chaudhary A, and Szakacs CB (1994) Disposition of lorazepam in Gilbert's syndrome: effects of fasting, feeding , and enterohepatic circulation. J Clin Pharmacol 34: 978 984. Hernandez Guzman FG, Higashiyama T, Osawa Y, and Ghosh D (2001) Purification, characterization and crystallization of human placental estrone/dehydroepiandrosterone sulfatase, a membranebound e nzyme of the endoplasmic reticulum. J Steroid Biochem Mol Biol 78: 441 450. Hernndez JS, Watson RW, Wood TC, and Weinshilboum RM (1992) Sulfation of estrone and 17 betaestradiol in human liver. Catalysis by thermostable phenol sulfotransferase and by dehy droepiandrosterone sulfotransferase. Drug Metab Dispos 20: 413 422. Hines RN and McCarver DG (2002) The ontogeny of human drug metabolizing enzymes: phase I oxidative enzymes. J Pharmacol Exp Ther 300: 355 360. Hobkirk R (1985) Steroid sulfotransferases and steroid sulfate sulfatases: characteristics and biological roles. Can J Biochem Cell Biol 63: 1127 1144. Hobkirk R, Cardy CA, Saidi F, Kennedy TG, and Girard LR (1983) Development and characteristics of an oestrogen sulphotransferase in placenta and uterus of the pregnant mouse. Comparison between mouse and rat. Biochem J 216: 451 457. Hobkirk R, Girard LR, Durham NJ, and Khalil MW (1985) Behavior of mouse placental and uterine estrogen sulfotransferase during chromatography and other procedures. Biochim Biophys Acta 828: 123 129. Hochman Y and Zakim D (1984) Studies of the catalytic mechanism of microsomal UDP glucuronyltransferase. Alphaglucuronidase activity and its stimulation by phospholipids. J Biol Chem 259: 55215525. Hoffmann B, Falter K, Vielemeier A, Failing K, and Schuler G (2001) Investigations on the activity of bovine placental oestrogen sulfotransferase and sulfatase from midgestation to parturition. Exp Clin Endocrinol Diabetes 109: 294 301. Honkisz E, ZiebaPrzybylska D, and Wojtowicz AK (2012) The effect of triclosan on hormone secretion and viability of human choriocarcinoma JEG 3 cells. Reprod Toxicol 34: 385 392. Hooper LV, Manzella SM, and Baenziger JU (1996) From legumes to leukocytes: biological roles for sulfated carbohydrates. FASEB J 10 : 1137 1146. 144

PAGE 145

Hsieh TY, Shiu TY, Huang SM, Lin HH, Lee TC, Chen PJ, Chu HC, Chang WK, Jeng KS, Lai MM, and Chao YC (2007) Molecular pathogenesis of Gilbert's syndrome: decreased TATA binding protein binding affinity of UGT1A1 gene promoter. Pharmacogenet Gen omics 17: 229236. Hua W, Bennett ER, and Letcher RJ (2005) Triclosan in waste and surface waters from the upper Detroit River by liquid chromatography electrospray tandem quadrupole mass spectrometry. Environ Int 31: 621 630. Hume R, Barker EV, and Coughtri e MW (1996) Differential expression and immunohistochemical localisation of the phenol and hydroxysteroid sulphotransferase enzyme families in the developing lung. Histochem Cell Biol 105: 147 152. Hume R and Coughtrie MW (1994) Phenolsulphotransferase: loc alization in kidney during human embryonic and fetal development. Histochem J 26: 850 855. Huttner WB (1988) Tyrosine sulfation and the secretory pathway. Annu Rev Physiol 50: 363 376. Hhnel R, Twaddle E, and Ratajczak T (1973) The specificity of the estrog en receptor of human uterus. J Steroid Biochem 4: 2131. Hnninen O and Alanen K (1966) The competitive inhibition of pnitrophenyl betaD glucopyranosiduronic acid synthesis by aliphatic alcohols in vitro. Biochem Pharmacol 15: 14651467. Innocenti F, Undev ia SD, Iyer L, Chen PX, Das S, Kocherginsky M, Karrison T, Janisch L, Ramrez J, Rudin CM, Vokes EE, and Ratain MJ (2004) Genetic variants in the UDP glucuronosyltransferase 1A1 gene predict the risk of severe neutropenia of irinotecan. J Clin Oncol 22: 138 2 1388. Iwamori M (2005) Estrogen sulfatase. Methods Enzymol 400: 293302. Izukawa T, Nakajima M, Fujiwara R, Yamanaka H, Fukami T, Takamiya M, Aoki Y, Ikushiro S, Sakaki T, and Yokoi T (2009) Quantitative analysis of UDP glucuronosyltransferase (UGT) 1A and UGT2B expression levels in human livers. Drug Metab Dispos 37: 17591768. Jackson EN, Schneider J, RowlandFaux L, and James MO (2013) Isoform selective glucuronidation of triclosan, pp 892.811, 2013, FASEB Journal: Boston, MA, in Experimental Biology 2013. Jacobs MN, Nolan GT, and Hood SR (2005) Lignans, bacteriocides and organochlorine compounds activate the human pregnane X receptor (PXR). Toxicol Appl Pharmacol 209: 123 133. 145

PAGE 146

James MO, Li W, Summerlot DP, RowlandFaux L, and Wood CE (2010) Triclosan is a potent inhibitor of estradiol and estrone sulfonation in sheep placenta. Environ Int 36: 942 949. Jaslow CR, Carney JL, and Kutteh WH (2010) Diagnostic factors identified in 1020 women with two versus three or more recurrent pregnancy losses. Fertil Steril 93: 12341243. Jinno H, Hanioka N, Onodera S, Nishimura T, and Ando M (1997) Irgasan DP 300 (5chloro2 (2,4 dichlorophenoxy) phenol) induces cytochrome P450s and inhibits haem biosynthesis in rat hepatocytes cultured on Matrigel. Xenobiotica 27: 681 692. Jones RD, Jampani HB, Newman JL, and Lee AS (2000) Triclosan: a review of effectiveness and safety in health care settings. Am J Infect Control 28: 184 196. Kanetoshi A, Katsura E, Ogawa H, Ohyama T, Kaneshima H, and Miura T (1992) Acute toxicity, percutaneo us absorption and effects on hepatic mixed function oxidase activities of 2,4,4' trichloro 2' hydroxydiphenyl ether (Irgasan DP300) and its chlorinated derivatives. Arch Environ Contam Toxicol 23: 91 98. Kapoor R, Nimmagadda D, and Sheng JJ (2007) Cellular localization studies on human estrogen sulfotransferase SULT1E1 in human embryonic kidney 293 cells. Drug Metab Dispos 35: 1720. Kauffman FC (2004) Sulfonation in pharmacology and toxicology. Drug Metab Rev 36: 823 843. Kawade N and Onishi S (1981) The pren atal and postnatal development of UDP glucuronyltransferase activity towards bilirubin and the effect of premature birth on this activity in the human liver. Biochem J 196: 257 260. Kester MH, Bulduk S, Tibboel D, Meinl W, Glatt H, Falany CN, Coughtrie MW, Bergman A, Safe SH, Kuiper GG, Schuur AG, Brouwer A, and Visser TJ (2000) Potent inhibition of estrogen sulfotransferase by hydroxylated PCB metabolites: a novel pathway explaining the estrogenic activity of PCBs. Endocrinology 141: 18971900. Kester MH, Bu lduk S, van Toor H, Tibboel D, Meinl W, Glatt H, Falany CN, Coughtrie MW, Schuur AG, Brouwer A, and Visser TJ (2002) Potent inhibition of estrogen sulfotransferase by hydroxylated metabolites of polyhalogenated aromatic hydrocarbons reveals alternative mec hanism for estrogenic activity of endocrine disrupters. J Clin Endocrinol Metab 87: 11421150. Kiang TK, Ensom MH, and Chang TK (2005) UDP glucuronosyltransferases and clinical drug drug interactions. Pharmacol Ther 106: 97 132. 146

PAGE 147

Klaassen CD and Boles JW (1997) Sulfation and sulfotransferases 5: the importance of 3' phosphoadenosine 5' phosphosulfate (PAPS) in the regulation of sulfation. FASEB J 11: 404 418. Knights KM and Miners JO (2010) Renal UDP glucuronosyltransferases and the glucuronidation of xenobioti cs and endogenous mediators. Drug Metab Rev 42: 6373. Kolpin DW, Furlong ET, Meyer MT, Thurman EM, Zaugg SD, Barber LB, and Buxton HT (2002) Pharmaceuticals, hormones, and other organic wastewater contaminants in U.S. streams, 1999 2000: a national reconnaissance. Environ Sci Technol 36: 12021211. Kotov A, Falany JL, Wang J, and Falany CN (1999) Regulation of estrogen activity by sulfation in human Ishikawa endometrial adenocarcinoma cells. J Steroid Biochem Mol Biol 68: 137 144. Kumar P and Magon N (2012) H ormones in pregnancy. Niger Med J 53: 179 183. Lampe JW, Bigler J, Horner NK, and Potter JD (1999) UDP glucuronosyltransferase (UGT1A1*28 and UGT1A6*2) polymorphisms in Caucasians and Asians: relationships to serum bilirubin concentrations. Pharmacogenetics 9: 341349. Lan Z, Hyung Kim T, Shun Bi K, Hui Chen X, and Sik Kim H (2015) Triclosan exhibits a tendency to accumulate in the epididymis and shows sperm toxicity in male SpragueDawley rats. Environ Toxicol 30: 83 91. Langaee T and Ronaghi M (2005) Genetic variation analyses by Pyrosequencing. Mutat Res 573: 96102. Levy CW, Roujeinikova A, Sedelnikova S, Baker PJ, Stuitje AR, Slabas AR, Rice DW, and Rafferty JB (1999) Molecular basis of triclosan activity. Nature 398: 383 384. Levy SB (2000) Antibiotic and antiseptic resistance: impact on public health. Pediatr Infect Dis J 19: S120122. Levy SB (2001) Antibacterial household products: cause for concern. Emerg Infect Dis 7: 512 515. Li W, Gu Y, James MO, Hines RN, Simpson P, Langaee T, and Stacpoole PW (2012) P and the roles of haplotype and subject age in determining activity with dichloroacetate. Drug Metab Dispos 40: 232239. Lin YJ (2000) Buccal absorption of triclosan following topical mouthrinse application. Am J Dent 13: 215 217. 147

PAGE 148

Lindstrm A, Buerge IJ, Poiger T, Bergqvist PA, Mller MD, and Buser HR (2002) Occurrence and environmental behavior of the bactericide triclosan and its methyl derivative in surface waters and in wastewat er. Environ Sci Technol 36: 23222329. Liu L, Xia T, Zhang X, Barr DB, Alamdar A, Zhang J, Tian M, Huang Q, and Shen H (2014) Biomonitoring of infant exposure to phenolic endocrine disruptors using urine expressed from disposable gel diapers. Anal Bioanal C hem 406: 5049 5054. Lores M, Llompart M, Sanchez Prado L, GarciaJares C, and Cela R (2005) Confirmation of the formation of dichlorodibenzop dioxin in the photodegradation of triclosan by photoSPME. Anal Bioanal Chem 381: 12941298. Luo G, Cunningham M, K im S, Burn T, Lin J, Sinz M, Hamilton G, Rizzo C, Jolley S, Gilbert D, Downey A, Mudra D, Graham R, Carroll K, Xie J, Madan A, Parkinson A, Christ D, Selling B, LeCluyse E, and Gan LS (2002) CYP3A4 induction by drugs: correlation between a pregnane X receptor reporter gene assay and CYP3A4 expression in human hepatocytes. Drug Metab Dispos 30: 795 804. Mackenzie P, Little JM, and RadominskaPandya A (2003) Glucosidation of hyodeoxycholic acid by UDP glucuronosyltransferase 2B7. Biochem Pharmacol 65: 417 421. Mackenzie PI (1990) Expression of chimeric cDNAs in cell culture defines a region of UDP glucuronosyltransferase involved in substrate selection. J Biol Chem 265: 34323435. Mackenzie PI, Bock KW, Burchell B, Guillemette C, Ikushiro S, Iyanagi T, Miners JO, Owens IS, and Nebert DW (2005) Nomenclature update for the mammalian UDP glycosyltransferase (UGT) gene superfamily. Pharmacogenet Genomics 15: 677685. Mackenzie PI, Owens IS, Burchell B, Bock KW, Bairoch A, Blanger A, Fournel Gigleux S, Green M, Hum DW, Iyanagi T, Lancet D, Louisot P, Magdalou J, Chowdhury JR, Ritter JK, Schachter H, Tephly TR, Tipton KF, and Nebert DW (1997) The UDP glycosyltransferase gene superfamily: recommended nomenclature update based on evolutionary divergence. Pharmacogenetics 7 : 255 269. MacKenzie PI, Rogers A, Elliot DJ, Chau N, Hulin JA, Miners JO, and Meech R (2011) The novel UDP glycosyltransferase 3A2: cloning, catalytic properties, and tissue distribution. Mol Pharmacol 79: 472478. Magness RR, Parker CR, and Rosenfeld CR (1993) Systemic and uterine responses to chronic infusion of estradiol 17 beta. Am J Physiol 265: E690698. 148

PAGE 149

Magness RR, Phernetton TM, Gibson TC, and Chen DB (2005) Uterine blood flow responses to ICI 182 780 in ovariectomized oestradiol 17betatreated, intac t follicular and pregnant sheep. J Physiol 565: 71 83. Manevski N, Moreolo PS, Yli Kauhaluoma J, and Finel M (2011) Bovine serum albumin decreases Km values of human UDP glucuronosyltransferases 1A9 and 2B7 and increases Vmax values of UGT1A9. Drug Metab Di spos 39: 21172129. Manservisi F, Gopalakrishnan K, Tibaldi E, Hysi A, Iezzi M, Lambertini L, Teitelbaum S, Chen J, and Belpoggi F (2014) Effect of maternal exposure to endocrine disrupting chemicals on reproduction and mammary gland development in female S pragueDawley rats. Reprod Toxicol . Marsh S and McLeod HL (2004) Pharmacogenetics of irinotecan toxicity. Pharmacogenomics 5: 835843. Matsuo H and Strauss JF (1994) Peroxisome proliferators and retinoids affect JEG 3 choriocarcinoma cell function. Endocrinology 135: 11351145. McAvoy DC, Schatowitz B, Jacob M, Hauk A, and Eckhoff WS (2002) Measurement of triclosan in wastewater treatment systems. Environ Toxicol Chem 21: 13231329. McCarver DG and Hines RN (2002) The ontogeny of human drug metabolizing enzyme s: phase II conjugation enzymes and regulatory mechanisms. J Pharmacol Exp Ther 300: 361 366. McMurry LM, Oethinger M, and Levy SB (1998) Triclosan targets lipid synthesis. Nature 394: 531 532. Meech R and Mackenzie PI (1997) Structure and function of uridine diphosphate glucuronosyltransferases. Clin Exp Pharmacol Physiol 24: 907915. Meech R and Mackenzie PI (1998) Determinants of UDP glucuronosyltransferase membrane association and residency in the endoplasmic reticulum. Arch Biochem Biophys 356: 7785. Miki Y, Nakata T, Suzuki T, Darnel AD, Moriya T, Kaneko C, Hidaka K, Shiotsu Y, Kusaka H, and Sasano H (2002) Systemic distribution of steroid sulfatase and estrogen sulfotransferase in human adult and fetal tissues. J Clin Endocrinol Metab 87: 57605768. Miner s JO and Mackenzie PI (1991) Drug glucuronidation in humans. Pharmacol Ther 51: 347 369. 149

PAGE 150

Miners JO, Mackenzie PI, and Knights KM (2010) The prediction of drug glucuronidation parameters in humans: UDP glucuronosyltransferase enzymeselective substrate and i nhibitor probes for reaction phenotyping and in vitroin vivo extrapolation of drug clearance and drug drug interaction potential. Drug Metab Rev 42: 196 208. Miners JO, Penhall R, Robson RA, and Birkett DJ (1988) Comparison of paracetamol metabolism in young adult and elderly males. Eur J Clin Pharmacol 35: 157 160. Miyagi SJ and Collier AC (2007) Pediatric development of glucuronidation: the ontogeny of hepatic UGT1A4. Drug Metab Dispos 35: 15871592. Miyagi SJ and Collier AC (2011) The development of UDP gl ucuronosyltransferases 1A1 and 1A6 in the pediatric liver. Drug Metab Dispos 39: 912 919. Miyagi SJ, Milne AM, Coughtrie MW, and Collier AC (2012) Neonatal development of hepatic UGT1A9: implications of pediatric pharmacokinetics. Drug Metab Dispos 40: 13211327. Monaghan G, Ryan M, Seddon R, Hume R, and Burchell B (1996) Genetic variation in bilirubin UPDglucuronosyltransferase gene promoter and Gilbert's syndrome. Lancet 347: 578 581. M orato T, L emus AE, and G ual C (1965) E fficiency of dehydroepiandrosterone sulphate as an estrogen precursor . Steroids 58: S uppl 1:59 74. Morrall D, McAvoy D, Schatowitz B, Inauen J, Jacob M, Hauk A, and Eckhoff W (2004) A field study of triclosan loss rates in river water (Cibolo Creek, TX). Chemosphere 54: 653 660. Morris ME an d Levy G (1983) Serum concentration and renal excretion by normal adults of inorganic sulfate after acetaminophen, ascorbic acid, or sodium sulfate. Clin Pharmacol Ther 33: 529 536. Mortola JF and Yen SS (1990) The effects of oral dehydroepiandrosterone on endocrinemetabolic parameters in postmenopausal women. J Clin Endocrinol Metab 71: 696 704. Moss T, Howes D, and Williams FM (2000) Percutaneous penetration and dermal metabolism of triclosan (2,4, 4' trichloro 2' hydroxydiphenyl ether). Food Chem Toxicol 38: 361 370. Myllynen P, Pasanen M, and Pelkonen O (2005) Human placenta: a human organ for developmental toxicology research and biomonitoring. Placenta 26: 361 371. 150

PAGE 151

Nazaroff W, Weschler CJ, Little JC, and Hubal EA (2012) Intake to production ratio: a measure of exposure intimacy for manufactured chemicals. Environ Health Perspect 120: 16781683. Negishi M, Pedersen LG, Petrotchenko E, Shevtsov S, Gorokhov A, Kakuta Y, and Pedersen LC (2001) Structure and function of sulfotransferases. Arch Biochem Biophys 39 0: 149157. Niehrs C, Beisswanger R, and Huttner WB (1994) Protein tyrosine sulfation, 1993--an update. Chem Biol Interact 92: 257 271. Nieschlag E, Loriaux DL, Ruder HJ, Zucker IR, Kirschner MA, and Lipsett MB (1973) The secretion of dehydroepiandrosterone and dehydroepiandrosterone sulphate in man. J Endocrinol 57: 123 134. Nishikawa T and Strott CA (1983) Unconjugated and sulfoconjugated steroids in plasma and zones of the adrenal cortex of the guinea pig. Steroids 41: 105 119. Noort D, Coughtrie MW, Burchel l B, van der Marel GA, van Boom JH, van der Gen A, and Mulder GJ (1990) Inhibition of UDP glucuronosyltransferase activity by possible transitionstate analogues in rat liver microsomes. Eur J Biochem 188: 309 312. Nol H, Plante L, Bleau G, Chapdelaine A, and Roberts KD (1983) Human placental steroid sulfatase: purification and properties. J Steroid Biochem 19: 15911598. O'Dwyer PJ and Catalano RB (2006) Uridine diphosphate glucuronosyltransferase (UGT) 1A1 and irinotecan: practical pharmacogenomics arrives in cancer therapy. J Clin Oncol 24: 4534 4538. Ohno A, Saito Y, Hanioka N, Jinno H, Saeki M, Ando M, Ozawa S, and Sawada J (2004) Involvement of human hepatic UGT1A1, UGT2B4, and UGT2B7 in the glucuronidation of carvedilol. Drug Metab Dispos 32: 235 239. Oh no S and Nakajin S (2009) Determination of mRNA expression of human UDP glucuronosyltransferases and application for localization in various human tissues by real time reverse transcriptasepolymerase chain reaction. Drug Metab Dispos 37: 3240. Ouzzine M, Barr L, Netter P, Magdalou J, and Fournel Gigleux S (2003) The human UDP glucuronosyltransferases: structural aspects and drug glucuronidation. Drug Metab Rev 35: 287 303. Pacifici GM (2005) Sulfation of drugs and hormones in midgestation human fetus. Ear ly Hum Dev 81: 573 581. 151

PAGE 152

Pacifici GM, Kubrich M, Giuliani L, de Vries M, and Rane A (1993) Sulphation and glucuronidation of ritodrine in human foetal and adult tissues. Eur J Clin Pharmacol 44: 259 264. Padhye LP, Yao H, Kung'u FT, and Huang CH (2014) Year l ong evaluation on the occurrence and fate of pharmaceuticals, personal care products, and endocrine disrupting chemicals in an urban drinking water treatment plant. Water Res 51: 266 276. Paul KB, Hedge JM, DeVito MJ, and Crofton KM (2010) Short term exposure to triclosan decreases thyroxine in vivo via upregulation of hepatic catabolism in Young Long Evans rats. Toxicol Sci 113: 367 379. Pedersen LC, Petrotchenko E, Shevtsov S, and Negishi M (2002) Crystal structure of the human estrogen sulfotransferasePAP S complex: evidence for catalytic role of Ser137 in the sulfuryl transfer reaction. J Biol Chem 277: 1792817932. Petraglia F, de Micheroux AA, Florio P, Salvatori M, Gallinelli A, Cela V, Palumbo MA, and Genazzani AR (1995) Steroidprotein interaction in human placenta. J Steroid Biochem Mol Biol 53: 227 231. Philippat C, Wolff MS, Calafat AM, Ye X, Bausell R, Meadows M, Stone J, Slama R, and Engel SM (2013) Prenatal Exposure to Environmental Phenols: Concentrations in Amniotic Fluid and Variability in Urinary Concentrations during Pregnancy. Environ Health Perspect . Pion RJ, Conrad SH, and Wolf BJ (1966) Pregnenolone sulfatean efficient precursor for the placental production of progesterone. J Clin Endocrinol Metab 26: 225 226. Provencher G, Brub R, Dumas P, Bienvenu JF, Gaudreau E, Blanger P, and Ayotte P (2014) Determination of bisphenol A, triclosan and their metabolites in human urine using isotopedilution liquid chromatography tandem mass spectrometry. J Chromatogr A 1348: 97104. P uche RC and Nes WR (1962) Binding of dehydroepiandrosterone sulfate to serum albumin. Endocrinology 70: 857 863. Purinton SC, Newman H, Castro MI, and Wood CE (1999) Ontogeny of estrogen sulfatase activity in ovine fetal hypothalamus, hippocampus, and brain stem. Am J Physiol 276: R16471652. Purohit A, Potter BV, Parker MG, and Reed MJ (1998) Steroid sulphatase: expression, isolation and inhibition for activesite identification studies. Chem Biol Interact 109: 183 193. 152

PAGE 153

Qian Y and Song WC (1999) Correlation between PAP dependent steroid binding activity and substrate specificity of mouse and human estrogen sulfotransferases. J Steroid Biochem Mol Biol 71: 123 131. Qian YM, Song WC, Cui H, Cole SP, and Deeley RG (2001) Glutathione stimulates sulfated estrogen transport by multidrug resistance protein 1. J Biol Chem 276: 64046411. Queckenberg C, Meins J, Wachall B, Doroshyenko O, Tomalik Scharte D, Bastian B, Abdel Tawab M, and Fuhr U (2010) Absorption, pharmacokinetics, and safety of triclosan after dermal administration. Antimicro b Agents Chemother 54: 570 572. Radominska A, Little J, Pyrek JS, Drake RR, Igari Y, Fournel Gigleux S, Magdalou J, Burchell B, Elbein AD, and Siest G (1993) A novel UDP Glc specific glucosyltransferase catalyzing the biosynthesis of 6O glucosides of bile acids in human liver microsomes. J Biol Chem 268: 15127 15135. RadominskaPandya A, Czernik PJ, Little JM, Battaglia E, and Mackenzie PI (1999) Structural and functional studies of UDP glucuronosyltransferases. Drug Metab Rev 31: 817 899. Raftogianis RB, Woo d TC, Otterness DM, Van Loon JA, and Weinshilboum RM (1997) Phenol sulfotransferase pharmacogenetics in humans: association of common SULT1A1 alleles with TS PST phenotype. Biochem Biophys Res Commun 239: 298 304. Raijmakers MT, Jansen PL, Steegers EA, and Peters WH (2000) Association of human liver bilirubin UDP glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene. J Hepatol 33: 348 351. Raungrut P, Uchaipichat V, Elliot DJ, Janchawee B, Somogyi AA, and Miners JO (2010) In vitro in vivo extrapolation predicts drug drug interactions arising from inhibition of codeine glucuronidation by dextropropoxyphene, fluconazole, ketoconazole, and methadone in humans. J Pharmacol Exp Ther 334: 609 618. Recksiek M, Selmer T, Dierks T, Schmidt B, and von Figura K (1998) Sulfatases, trapping of the sulfated enzyme intermediate by substituting the active site formylglycine. J Biol Chem 273: 60966103. Reiss R, Mackay N, Habig C, and Griffin J (2002) An ecological risk assessment for triclo san in lotic systems following discharge from wastewater treatment plants in the United States. Environ Toxicol Chem 21: 24832492. 153

PAGE 154

Richard K, Hume R, Kaptein E, Stanley EL, Visser TJ, and Coughtrie MW (2001) Sulfation of thyroid hormone and dopamine during human development: ontogeny of phenol sulfotransferases and arylsulfatase in liver, lung, and brain. J Clin Endocrinol Metab 86: 27342742. Riches Z, Stanley EL, Bloomer JC, and Coughtrie MW (2009) Quantitative evaluation of the expression and activity of five major sulfotransferases (SULTs) in human tissues: the SULT "pie". Drug Metab Dispos 37: 2255 2261. Rohn KJ, Cook IT, Leyh TS, Kadlubar SA, and Falany CN (2012) Potent inhibition of ethinylestradiol: role of 3' phosphoadenosine 5' phosphosulfate binding and structural rearrangements in regulating inhibition and activity. Drug Metab Dispos 40: 15881595. RohnGlowacki KJ, James MO, and Falany CN (2014) P otent inhibition of human sult1e1 by triclosan. Drug Metabolism Reviews 45: 128 129. Rowland A, Knights KM, Mackenzie PI, and Miners JO (2008) The "albumin effect" and drug g lucuronidation: bovine serum albumin and fatty acidfree human serum albumin enhance the glucuronidation of UDP glucuronosyltransferase (UGT) 1A9 substrates but not UGT1A1 and UGT1A6 activities. Drug Metab Dispos 36: 10561062. Rowland A, Miners JO, and Mac kenzie PI (2013) The UDP glucuronosyltransferases: their role in drug metabolism and detoxification. Int J Biochem Cell Biol 45: 11211132. Sabaliunas D, Webb SF, Hauk A, Jacob M, and Eckhoff WS (2003) Environmental fate of Triclosan in the River Aire Basin , UK. Water Res 37: 31453154. Sacco JC and James MO (2005) Sulfonation of environmental chemicals and their metabolites in the polar bear (Ursus maritimus). Drug Metab Dispos 33: 13411348. Sacco JC, Lehmler HJ, Robertson LW, Li W, and James MO (2008) Glucuronidation of polychlorinated biphenylols and UDP glucuronic acid concentrations in channel catfish liver and intestine. Drug Metab Dispos 36: 623 630. SandborghEnglund G, AdolfssonErici M, Odham G, and Ekstrand J (2006) Pharmacokinetics of triclosan foll owing oral ingestion in humans. J Toxicol Environ Health A 69: 18611873. Schmidt B, Selmer T, Ingendoh A, and von Figura K (1995) A novel amino acid modification in sulfatases that is defective in multiple sulfatase deficiency. Cell 82: 271 278. 154

PAGE 155

Schweizer H P (2001) Triclosan: a widely used biocide and its link to antibiotics. FEMS Microbiol Lett 202: 1 7. Senafi SB, Clarke DJ, and Burchell B (1994) Investigation of the substrate specificity of a cloned expressed human bilirubin UDP glucuronosyltransferase: UD P sugar specificity and involvement in steroid and xenobiotic glucuronidation. Biochem J 303 ( Pt 1): 233240. Shevtsov S, Petrotchenko EV, Pedersen LC, and Negishi M (2003) Crystallographic analysis of a hydroxylated polychlorinated biphenyl (OH PCB) bound to the catalytic estrogen binding site of human estrogen sulfotransferase. Environ Health Perspect 111: 884 888. Singer H, Mller S, Tixier C, and Pillonel L (2002) Triclosan: occurrence and fate of a widely used biocide in the aquatic environment: field m easurements in wastewater treatment plants, surface waters, and lake sediments. Environ Sci Technol 36: 49985004. Stanley EL, Hume R, and Coughtrie MW (2005) Expression profiling of human fetal cytosolic sulfotransferases involved in steroid and thyroid hormone metabolism and in detoxification. Mol Cell Endocrinol 240: 3242. Stanley EL, Hume R, Visser TJ, and Coughtrie MW (2001) Differential expression of sulfotransferase enzymes involved in thyroid hormone metabolism during human placental development. J C lin Endocrinol Metab 86: 59445955. Stein C, Hille A, Seidel J, Rijnbout S, Waheed A, Schmidt B, Geuze H, and von Figura K (1989) Cloning and expression of human steroidsulfatase. Membrane topology, glycosylation, and subcellular distribution in BHK 21 cel ls. J Biol Chem 264: 13865 13872. Stoker TE, Gibson EK, and Zorrilla LM (2010) Triclosan exposure modulates estrogendependent responses in the female wistar rat. Toxicol Sci 117: 45 53. Strassburg CP, Strassburg A, Kneip S, Barut A, Tukey RH, Rodeck B, and Manns MP (2002) Developmental aspects of human hepatic drug glucuronidation in young children and adults. Gut 50: 259265. Strott CA (1996) Steroid sulfotransferases. Endocr Rev 17: 670 697. Strott CA (2002) Sulfonation and molecular action. Endocr Rev 23: 70 3 732. Sun M and Leyh TS (2010) The human estrogen sulfotransferase: a half site reactive enzyme. Biochemistry 49: 47794785. 155

PAGE 156

Suzuki T, Hirato K, Yanaihara T, Kadofuku T, Sato T, Hoshino M, and Yanaihara N (1992) Purification and properties of steroid sulfatase from human placenta. Endocrinol Jpn 39: 93 101. Suzuki T, Nakata T, Miki Y, Kaneko C, Moriya T, Ishida T, Akinaga S, Hirakawa H, Kimura M, and Sasano H (2003) Estrogen sulfotransferase and steroid sulfatase in human breast carcinoma. Cancer Res 63: 27622770. Tallgren LG (1980) Inorganic sulphates in relation to the serum thyroxine level and in renal failure. Acta Med Scand Suppl 640: 1 100. Tam YK (1993) Individual variation in first pass metabolism. Clin Pharmacokinet 25: 300 328. Tang BK (1990) Drug glu cosidation. Pharmacol Ther 46: 5356. Temellini A, Franchi M, Giuliani L, and Pacifici GM (1991) Human liver sulphotransferase and UDP glucuronosyltransferase: structureactivity relationship for phenolic substrates. Xenobiotica 21: 171 177. Tong MH, Jiang H , Liu P, Lawson JA, Brass LF, and Song WC (2005) Spontaneous fetal loss caused by placental thrombosis in estrogen sulfotransferasedeficient mice. Nat Med 11: 153 159. Tremblay J, Hardy DB, Pereira LE, and Yang K (1999) Retinoic acid stimulates the express ion of 11betahydroxysteroid dehydrogenase type 2 in human choriocarcinoma JEG 3 cells. Biol Reprod 60: 541 545. Tsang CP (1974) Changes in plasma levels of estrone sulfate and estrone in the pregnant ewe around parturition. Steroids 23: 855 868. Tukey RH and Strassburg CP (2000) Human UDP glucuronosyltransferases: metabolism, expression, and disease. Annu Rev Pharmacol Toxicol 40: 581 616. Udomuksorn W, Elliot DJ, Lewis BC, Mackenzie PI, Yoovathaworn K, and Miners JO (2007) Influence of mutations associated w ith Gilbert and Crigler Najjar type II syndromes on the glucuronidation kinetics of bilirubin and other UDP glucuronosyltransferase 1A substrates. Pharmacogenet Genomics 17: 10171029. Unsworth CD, Hughes J, and Morely JS (1982) O sulphated Leuenkephalin i n brain. Nature 295: 519 522. Vaccaro AM, Salvioli R, Muscillo M, and Renola L (1987) Purification and properties of arylsulfatase C from human placenta. Enzyme 37: 115 126. 156

PAGE 157

Vagnoni KE, Shaw CE, Phernetton TM, Meglin BM, Bird IM, and Magness RR (1998) Endothelial vasodilator production by uterine and systemic arteries. III. Ovarian and estrogen effects on NO synthase. Am J Physiol 275: H18451856. Valters K, Li H, Alaee M, D'Sa I, Marsh G, Bergman A, and Letcher RJ (2005) Polybrominated diphenyl ethers and hydroxylated and methoxylated brominated and chlorinated analogues in the plasma of fish from the Detroit River. Environ Sci Technol 39: 56125619. van der Loos CM, van Breda AJ, van den Berg FM, Walboomers JM, and Jbsis AC (1984) Human placental steroid sulphatase--purification and monospecific antibody production in rabbits. J Inherit Metab Dis 7: 97 103. Veldhoen N, Skirrow RC, Osachoff H, Wigmore H, Clapson DJ, Gunderson MP, Van Aggelen G, and Helbing CC (2006) The bactericidal agent triclosan modulates thy roid hormoneassociated gene expression and disrupts postembryonic anuran development. Aquat Toxicol 80: 217 227. Verbeeck RK, Wallace SM, and Loewen GR (1984) Reduced elimination of ketoprofen in the elderly is not necessarily due to impaired glucuronidati on. Br J Clin Pharmacol 17: 783 784. Vietri M, De Santi C, Pietrabissa A, Mosca F, and Pacifici GM (2000) Inhibition of human liver phenol sulfotransferase by nonsteroidal anti inflammatory drugs. Eur J Clin Pharmacol 56: 81 87. von der Ohe PC, Schmitt Jansen M, Slobodnik J, and Brack W (2012) Triclosan--the forgotten priority substance? Environ Sci Pollut Res Int 19: 585 591. Vlez MP, Arbuckle TE, and Fraser WD (2015) Female exposure to phenols and phthalates and time to pregnancy: the Maternal Infant Resear ch on Environmental Chemicals (MIREC) Study. Fertil Steril 103: 10111020.e1012. Wang DY, Bulbrook RD, Ellis F, and Coombs MM (1967a) Metabolic clearance rates of pregnenolone, 17acetoxypregnenolone and their sulphate esters in man and in rabbit. J Endocri nol 39: 395 403. Wang DY, Bulbrook RD, Sneddon A, and Hamilton T (1967b) The metabolic clearance rates of dehydroepiandrosterone, testosterone and their sulphate esters in man, rat and rabbit. J Endocrinol 38: 307 318. Wang LQ, Falany CN, and James MO (2004) Triclosan as a substrate and inhibitor of 3' phosphoadenosine 5' phosphosulfatesulfotransferase and UDP glucuronosyl transferase in human liver fractions. Drug Metab Dispos 32: 11621169. 157

PAGE 158

Wang LQ and James MO (2005) Sulfotransferase 2A1 forms estradiol 17sulfate and celecoxib switches the dominant product from estradiol 3 sulfate to estradiol 17sulfate. J Steroid Biochem Mol Biol 96: 367374. Wang LQ and James MO (2006) Inhibition of sulfotransferases by xenobiotics. Curr Drug Metab 7: 83 104. Wang LQ and James MO (2007) Sulfonation of 17betaestradiol and inhibition of sulfotransferase activity by polychlorobiphenylols and celecoxib in channel catfish, Ictalurus punctatus. Aquat Toxicol 81: 286292. Wengle B (1966) Distribution of some steroid sulphokinases in foetal human tissues. Acta Endocrinol (Copenh) 52: 607618. Wigle DT, Arbuckle TE, Turner MC, Brub A, Yang Q, Liu S, and Krewski D (2008) Epidemiologic evidence of relationships between reproductive and child health outcomes and environmental chemical contaminants. J Toxicol Environ Health B Crit Rev 11: 373 517. Wlcek K, Hofstetter L, and Stieger B (2014) Transport of estradiol glucuronide, estrone3 sulfate and taurocholate across the endoplasmic reticulum membrane: evidence for different transport systems. Biochem Pharmacol 88: 106 118. Wood CE (2005) Estrogen/hypothalamus pituitary adrenal axis interactions in the fetus: The interplay between placenta and fetal brain. J Soc Gynecol Investig 12: 67 76. Wood CE, Gridley KE, and Keller Wood M (2003) Biological activity of 17betaestradiol 3 sulfate in ovine fetal plasma and uptake in fetal brain. Endocrinology 144: 599 6 04. Woodruff TJ, Zota AR, and Schwartz JM (2011) Environmental chemicals in pregnant women in the United States: NHANES 20032004. Environ Health Perspect 119: 878 885. Wu C, Huang X, Lin J, and Liu J (2015) Occurrence and fate of selected endocrinedisrupt ing chemicals in water and sediment from an urban lake. Arch Environ Contam Toxicol 68: 225 236. Xue J, Wu Q, Sakthivel S, Pavithran PV, Vasukutty JR, and Kannan K (2015) Urinary levels of endocrinedisrupting chemicals, including bisphenols, bisphenol A di glycidyl ethers, benzophenones, parabens, and triclosan in obese and nonobese Indian children. Environ Res 137: 120128. 158

PAGE 159

Yamamoto K, Sato H, Fujiyama Y, Doida Y, and Bamba T (1998) Contribution of two missense mutations (G71R and Y486D) of the bilirubin UD P glycosyltransferase (UGT1A1) gene to phenotypes of Gilbert's syndrome and Crigler Najjar syndrome type II. Biochim Biophys Acta 1406: 267 273. Yamamura N, ImuraMiyoshi K, and Naganuma H (2000) Panipenum, a carbapenem antibiotic, increases the level of hepatic UDP glucuronic acid in rats. Drug Metab Dispos 28: 1484 1486. Yanaihara A, Yanaihara T, Toma Y, Shimizu Y, Saito H, Okai T, Higashiyama T, and Osawa Y (2001) Localization and expression of steroid sulfatase in human fallopian tubes. Steroids 66: 8791. Yoshinari K, Petrotchenko EV, Pedersen LC, and Negishi M (2001) Crystal structurebased studies of cytosolic sulfotransferase. J Biochem Mol Toxicol 15: 67 75. Young TA, Heidler J, Matos Prez CR, Sapkota A, Toler T, Gibson KE, Schwab KJ, and Halden RU (20 08) Ab initio and in situ comparison of caffeine, triclosan, and triclocarban as indicators of sewagederived microbes in surface waters. Environ Sci Technol 42: 33353340. Zaya MJ, Hines RN, and Stevens JC (2006) Epirubicin glucuronidation and UGT2B7 devel opmental expression. Drug Metab Dispos 34: 2097 2101. Zhang H, Varlamova O, Vargas FM, Falany CN, Leyh TS, and Varmalova O (1998) Sulfuryl transfer: the catalytic mechanism of human estrogen sulfotransferase. J Biol Chem 273: 10888 10892. Zhang N, Wang W, Li W, Liu C, Chen Y, Yang Q, Wang Y, and Sun K (2015) Inhibition HSD2 Expression by Triclosan via Induction of Apoptosis in Human Placental Syncytiotrophoblasts. J Clin Endocrinol Metab 100: E542 549. Zhivkov V, Tosheva R, and Zhivkova Y (1975) Concent ration of uridine diphosphate sugars in various tissues of vertebrates. Comp Biochem Physiol B 51: 421 424. Zorrilla LM, Gibson EK, Jeffay SC, Crofton KM, Setzer WR, Cooper RL, and Stoker TE (2009) The effects of triclosan on puberty and thyroid hormones in male Wistar rats. Toxicol Sci 107: 56 64. 159

PAGE 160

BIOGRAPHICAL SKETCH Erin Nikesha Jackson is the younger of two daughters from Charlene Burr Jackson. Upon deciding to pursue an undergraduate degree away from her home in south Florida, Erin graduated from Howard University in May 2010 with a bachelor’s degree in chemistry and a minor in allied health sciences. In the fall of 2010, she entered a doctoral program in the department of medicinal chemistry at the University of Florida. Under the mentorship of Dr. Margaret O. James, she received her doctorate in pharmaceutical sciences from the College of Pharmacy in August 2015. 160