Citation
Complex Effects of Glucose on Biofilm Formation and PGA Synthesis in Escherichia Coli

Material Information

Title:
Complex Effects of Glucose on Biofilm Formation and PGA Synthesis in Escherichia Coli
Creator:
Hsieh, Hsin
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (49 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
ROMEO,TONY
Committee Co-Chair:
MAUPIN,JULIE A
Committee Members:
RICE,KELLY C
Graduation Date:
5/2/2015

Subjects

Subjects / Keywords:
Bacteria ( jstor )
Biofilms ( jstor )
Escherichia coli ( jstor )
Microbiology ( jstor )
Mops ( jstor )
Operon ( jstor )
pH ( jstor )
Polysaccharides ( jstor )
Repression ( jstor )
RNA ( jstor )
Microbiology and Cell Science -- Dissertations, Academic -- UF
biofilm -- c-di-gmp -- crp -- glucose -- mcas -- nhar -- pga -- pgaabcd
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Microbiology and Cell Science thesis, M.S.

Notes

Abstract:
PGA serves as an adhesin that stabilizes biofilms of E. coli and other bacteria. The pgaABCD operon encodes proteins that are needed for the synthesis and export of the PGA polymer. Previous studies have shown that glucose inhibits biofilm formation of E. coli and that the effect of glucose was mediated at least in part by cyclic AMP (cAMP) cAMP receptor protein (CRP). We show that addition of glucose leads to a decrease in levels of cell bound PGA. The effect of glucose was not dependent on ydeH yhjH (gene products that synthesize or degrade c di GMP, respectively) or on mcaS, which encodes an sRNA known to regulate pgaA expression. Glucose was found to inhibit pgaABCD expression, since addition of glucose led to a decrease in the expression of pgaA lacZ translational and pgaA lacZ transcriptional fusions. Previous study showed that the expression of pgaA lacZ translational fusion was induced by alkaline pH in an nhaR dependent fashion. We show that the inhibitory effect of glucose on biofilm formation, PGA accumulation and the expression of pgaA lacZ translational fusion requires acidicfication of the growth medium resulting from glucose metabolism, which decreases NhaR activity and expression of pgaABCD operon. This work further supports the fact that NhaR is a stress response regulator of substantial importance. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2015.
Local:
Adviser: ROMEO,TONY.
Local:
Co-adviser: MAUPIN,JULIE A.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2017-05-31
Statement of Responsibility:
by Hsin Hsieh.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
5/31/2017
Classification:
LD1780 2015 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

COMPLEX EFFECTS OF GLUCOSE ON BIOFILM FORMATION AND PGA SYNTHESIS IN ESCHERICHIA COLI By HSIN HSIEH A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR TH E DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2015

PAGE 2

2015 Hsin Hsieh

PAGE 3

3 ACKNOWLEDGMENTS I thank first and foremost my two mentors along the road, my Professor, Dr. Tony Romeo, who with his great advice and never ending knowledge has guided me along the way these past two yea rs. I thank our Post Doctoral Fellow, Dr. Archana Pannuri who helped me with my work. I thank my Labor atory members, who made the work in the Lab one of the most enjoyable learning experiences. Finally, I would like to thank my Committee members, Dr. Kelly Rice and Dr. Julie Maupin Furlow for their sound advice, their knowledgeable comments and their cont inuous help. They have been a key factor in the completion of this whole project.

PAGE 4

4 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 3 LIST OF FIGURES ................................ ................................ ................................ ......................... 6 ABSTRACT ................................ ................................ ................................ ................................ ..... 7 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .................... 9 1.1 Bi ofilm Formation by E. coli ................................ ................................ .............................. 9 1.2 Poly 1,6 GlcNAc (PGA) as the Adhesin of E. coli Biofilm Formation ........................ 10 1.3 Carbon Storage Regulatory (Csr) System ................................ ................................ ......... 12 1.4 NhaR Activates pgaABCD Transcription in Response to Alkaline pH ............................ 15 2 MATERIALS AND METHODS ................................ ................................ ........................... 18 2.1 Bacterial Strains and Culture Conditions ................................ ................................ ......... 18 2.2 Construction of E. coli Gene Deletions ................................ ................................ ............ 18 galactosidase Assays ................................ ................................ ................................ ..... 18 2.4 Quantitative Biofilm Assay ................................ ................................ .............................. 18 2.5 Detection of PGA ................................ ................................ ................................ ............. 19 3 RESULTS ................................ ................................ ................................ ............................... 23 3.1 Addition of Glucose Leads to a Decrease in Biofilm Formation and Cell Bound PGA. ................................ ................................ ................................ ................................ .... 23 3.2 Glucose Effect on Biofilm Formation in E. coli Does Not Require ydeH and yhjH or the sRNA McaS. ................................ ................................ ................................ ................. 23 3.3 Addition of Glucose Leads to a Decrease in pgaA Expression. ................................ ....... 24 3.4 Addition of Glucose Leads to a Drop in pH of the Medium. ................................ ........... 25 3.5 Is Glucose Effect on Biofilm F ormation in E. coli Mediated Through CRP? .................. 26 4 DISCUSSION ................................ ................................ ................................ ......................... 37 LIST OF REFERENCES ................................ ................................ ................................ ............... 41 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ......... 49

PAGE 5

5 LIST OF TABLES Table page 2 1 Strains and Bacteriophage used in this study ................................ ................................ ..... 21 2 2 List of primers used in this study ................................ ................................ ....................... 22

PAGE 6

6 LIST OF FIGURES Figure page 1 1 Regulatory Circuitry of pgaABCD Operon ................................ ................................ ....... 17 3 1 Effect of Glucose on the Biofilm Formation and PGA Accumulation of E. coli K 12 St rain MG1655 and its Isogenic csrA::kan Mutant (TRMG) in LB medium ................... 28 3 2 Effect of Glucose on Accumulation of PGA. ................................ ................................ .... 28 3 3 Effects of Glucose on Bio film Formation of TRMG and its Isogenic ydeH and yhjH Mutants, mcaS Mutants of MG1655 and TRMG. ................................ .............................. 29 3 4 Effects of Glucose on the Expression of pgaA lacZ Translational Fusion and pgaA lacZ Transcriptional Fusion in MG1655 ................................ ................................ ........... 30 3 5 Growth and Changes in pH of Spent Medium of Cultures of MG1655 Grown in Four Different Media. ................................ ................................ ................................ ................. 31 3 6 Effects of 0.1M MOPS on the Expression of pgaA lacZ Translational Fusion of MG1655 in LB with and without Glucose. ................................ ................................ ........ 32 3 7 Effect of Glucose on the Biofilm Formation of E. coli K 12 Strain MG1655 and its Isogenic csrA::kan Mutant (TRMG) in LB Medium and LB Medium Buffered with MOPS. ................................ ................................ ................................ ................................ 33 3 8 Effect of Glucose on Accumulation of PGA in MG 1655 and TRMG1 655 in LB Medium and LB Medium Buffered with MOPS. ................................ .............................. 34 3 9 Effects of crp on Specific Biofilm Formation by MG1655 in LB Medium with and without 0.2% Glucose. ................................ ................................ ................................ ....... 35 3 10 Effects of crp on PGA Accumulation in MG1655 and TRMG in LB Medium and LB Medium with 0.2% Glucose. ................................ ................................ ............................. 35 3 11 Effects of crp on the Expression of pgaA lacZ Translational Fusion .............................. 36

PAGE 7

7 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requir ements for the Degree of Master of Science COMPLEX EFFECTS OF GLUCOSE ON BIOFILM FORMATION AND PGA SYNTHESIS IN ESCHERICHIA COLI By Hsin Hsieh May 201 5 Chair: Tony Romeo Major: Microbiology and Cell Science Poly 1,6 N acetyl D glucosamine (PGA) serves as an adhesin that stabilizes biofilms of E. coli and other bacteria. The pgaABCD operon encodes proteins that are needed for the synthesis and export of the PGA polymer. Previous studies have shown that glucose inhibi ts biofilm formation of E. coli and that the effect of glucose was mediated at least in part by cyclic AMP (cAMP) cAMP receptor protein (CRP). We show that addition of glucose leads to a decrease in levels of cell bound PGA. The e ffect of glucose was not dependent on ydeH / yhjH (gene products that synthesize or degrade c di GMP, respectively) or on mcaS which encodes a n sRNA known to regulate pgaA expressio n. Glucose was found to inhibit pgaABCD expression, since addition of glucose led to a decrease in the expression of pgaA lacZ translational and pgaA lacZ transcriptional fusions. Previous study showed that the expression of pgaA lacZ translational fusion was induced by alkaline pH in an nhaR dependent fashion. We show that the inhibitory effect of glucose on biofilm formation, PGA accumulation and the expression of pgaA lacZ translational fusion requires acidic fication of the growth medium resulting from glucose metabolism, which

PAGE 8

8 decreases NhaR activity and expression of pgaABCD operon. This work further supports the fact that NhaR is a stress response regulator of substantial importance.

PAGE 9

9 CHAPTER 1 INTRODUCTION 1.1 Biofilm F ormation by E. coli In the natural environment, bacteria predomina ntly exist in matrix enclosed, sessile communities referred to as biofilms (Costerton et al., 1995). Biofilms protect cells from deleterious conditions, such as attack by the mammalian immune system (Costerton et al., 1999). When biofilms form inside our b odies or on medical devices they may cause a wide range of health problems due to their resistance towards conventional antimicrobial agents. Understanding the physiology of biofilms is crucial for the development of strategies to control them. Biofilms are complex assemblages of cells which exhibit channels and pillars that are thought to permit the exchange o f nutrients and wastes. A model for biofilm development proposes that it is initiated by the attachment of individual cells to a surface, followed by their migration and replication to form microcolonies that eventually produce the mature biofilm In various strains of E. coli attachment and microcolony formation are facilitated by proteinaceous adhesins a nd polysaccharides such as cellulose and poly 1,6 N acetyl D glucosamine (PGA) (Da Re et al., 2006; Pratt et al ., 1998; Prigent Combaret et al., 2000; Reisner et al., 2003; Vidal et al., 1998; Wang et al., 2004; Zogaj et al., 2001). The latter polymer i s involved in both cell cell adhesion and attachment to certain abiotic surfaces by E. coli K 12, and it also stabilizes biofilm structures of other gram negative bacteria and staphylococci ( Itoh et al., 2005 ). Its production in E. coli depends upon the pg aABCD operon, which encodes a GT 2 family vectoral glycosyltransferase (PgaC) that synthesizes this polymer as well as other proteins involved in PGA synthesis, localization and export

PAGE 10

10 Eventually, planktonic cells are released from the biofilm, completin g the developmental cycle and leadi ). Thus, biofilm formation may be viewed as a flexible or dynamic developmental process involving sequential gene expression patterns that are influenced by environmental cues (Beloin et al., 2005; Ghigo et al., 2003; 1.2 P oly 1,6 GlcNAc (PGA) as the A dhesi n of E. coli Biofilm F ormation Poly 1,6 GlcNAc (PGA) is a homopolymer th at was originally described in Staphylococcus epidermidis and is ref ere d to as polysacchari d e intracellular adhesion (PIA) (Fischer et al., 1996). Besides mediating cell to cell and cell to surface adhesion in biofilms, PGA is essential for the formation of the nonrandom or periodic cellular architecture of the E. coli biofil m microstructure and for conversion from temporary polar cell surface attachment to permanent lateral attachment during the initial stages of biofilm development (Agladze et al., 2003; Agladze et al., 2005). PGA was subsequently isolated from E. coli and s hown to depend on the pgaABCD operon for its production (Wang et al., 2004). The operon is present in diverse gram negative bacterial species and appears to be part of a horizontally transferred locus (Wang et al., 2004). Other gram negative species produc e this polysaccharide, based on the presence of pgaABCD homologous locus in the genome, isolation and nuclear magnetic resonance analysis of the polymer, immunore activity of cell extracts with staphylococcal PIA, and / or the sensitivity of 1,6 glycosidic linkages of PGA (Itoh et al., 2005; Izano et al., 2007; Parise et al., 2007). The synthesis of PGA requires the pgaABCD and icaADBC operons of E. coli and S. epidermidis respectively (G tz et al., 2002; Wang et al., 2004). PgaC and IcaA are homologous cytoplasmic membrane proteins of glycosyltransferase family 2 (GT 2) that are necessary for polymerization. In S. epidermidis

PAGE 11

11 bacteria, optimal PGA production also requires the IcaC and IcaD proteins (Gerke et al., 1998), which are not related in sequence to the E. coli Pga proteins. PgaB and IcaB contain polysaccharide N deacetylase domains belonging to carbohydrate esterase family 4. IcaB of S. epid ermidis is a secreted, cell wall associated protein that introduceces the 15 to 20% deacetylated (glucosamine) residues found in the mature polymer (Vuong et al., 2004). PgaB of E. coli is predicted to be an outer membrane lipoprotein (Wang et al., 2004), and its orthologs in gram negative species are larger than IcaB and possess an additional domain of unknown function, which is predicted to be a PGA binding domain ( Little et al., 2014 ) PgaA was not found by BLAST analyses to be closely related to any pro tein of defined function (Wang et al., 2004). It is predicted to form an N terminal superhelical domain that is related to mitochondrial importin, human O linked GlcNAc transferase and other eukaryotic transporter proteins, and a C barrel pori n for PGA secretion (Itoh et al., 2008). A csrA mutant of E. coli overproduces PGA and displays a dramatic increase in biofilm formation (Jackson et al., 2002; Wang et al., 2005 ., Itoh et al., 2008 ). The CsrA protein posttranscriptionally represses PGA pr oduction by binding to six sites within the untranslated leader and proximal coding region of pgaA mRNA (Wang et al., 2005). This blocks ribosome access to the pgaA Shine Dal garno sequence and destabilizes the pgaABCD transcript. PGA synthesis in E. coli b acteria also requires the LysR family DNA binding protein NhaR, which activates pgaABCD transcription in response to high pH and high concentrations of sodi um ions (Goller et al., 2006) (F ig ure 1 1).

PAGE 12

12 1.3 Carbon Storage Regulatory (Csr) S ystem Bacteria utilize a number of strategies to cope with rapid changes in environmental conditions One of these strategies is the regulation of gene expression at the posttranscriptional level. CsrA ( c arbon s torage r egulator A) is a well studied post transcriptional r egulator which is proteobacteria and other bacterial families ( White, Hart & Romeo, 1996 ). CsrA is a small RNA binding protein (61 amino acids) that was first identified as a regulator of glycogen biosynthesis in E. coli K 12 ( Romeo, Gong Liu & Brun Zinkernagel 1993 ). CsrA copurifies with a large, diverse repertoire of cellular transcripts (more than 700 different targets) ( Edwards et al., 2011 ) and its function includes both the activation and repression of gene express ion. To date, CsrA has been found to be a regulator of many bacterial processes including (but not limited to) biofilm formation ( Jackson et al., 2002 ), motility ( Wei B et al., 2001 ; Yakhnin et al., 2011 ), glycolysis, and gluconeogenesis (Sabnis, Yang and Romeo, 1995) and quorum sensing (Yakhnin et al., 2011, Heurlier K et al., 2004). CsrA is a homodimer in solution, and each polypeptide consists of five antiparallel strands, a small helix and a non structured C terminus. T he t wo polypeptides are woven t ogether to form a CsrA dimer ( Gutierrez et al., 2005 ) The RNA binding sequence of CsrA has been determined to be a GGA motif that is surrounded by a semi conserved sequence region, often localized in a single stran ded loop of short RNA hairpins (Dubey, B aker, Romeo & Babitzke, 2005) In general, CsrA represses gene translation by binding to the mRNA target in a sequence overlapping or proximal to the Shine Dalgarno sequence, thus competing with the ribosome 30S subu nit and preventing translation eg. nhaR in E. coli ( Pannuri et al., 2012 ) nag in Bacillus subtilis ( Yakhnin et al., 2007). Furthermore, CsrA also represses gene expr ession by increasing RNA decay eg. glgC in E. coli ( Liu et al., 1997). Another mec hanism by which CsrA represses gene expression h as been described by Figueroa Bossi et al. (2014). CsrA mediates Rho

PAGE 13

13 dependent transcription termination. In this example, which applies to the pgaA transcript, CsrA acts by unfolding an RNA secondary structure which exposes an entry site for Rho, thus fac ilita ting transcription termination (Figueroa Bossi et al., 2014) Examples of translation repression by CsrA in E. coli include pgaA which is related to the production of polysaccharide adhesin poly 1, 6 N acetyl D glucosamine (Jackson et al., 2002) and nhaR, which encodes for a LysR family transcriptional regulator that induces pgaABCD transcription in response to hi gh sodium ions and alkaline pH ( Goller et al., 2006 ). CsrA also represses genes involved in the synthesis of cyclic di GMP (c di GMP) (Jonas et al., 2008, 2010), a secondary messenger that stimulates biofilm formation and PGA synthesis (Bobrov et al., 2008, Suzuki et al. 2006) (Figure 1 1) Studies conducted with a recombinant CsrA (CsrA His 6 ) protein revealed that CsrA copurified with a sRNA of approxi mately 360 nucleotides in length This protein RNA complex consisted of approximately 18 CrsA subunits bound to a single RNA molecule that lacked an obvious open reading frame. (Liu et al.,1997). This RNA, called CsrB, is transcribed from a single gene in the chromosome of the E. coli K 12 genome. Given that the sequence of the csrB CAGGA(U, C, A)G eats in the loops of predicted hairpins, it was suggested that these repeats might constitute the binding sequence for CsrA. (Liu et al., 1997) When CsrB was overexpressed from a plasmid, the phenotype shown was similar to that of a CsrA mutant. This resul t suggested that CsrB antagonizes CsrA activity and constituted another regulatory component of the Csr system. CsrB regulatory function by in vitro transcription translation experiments showed that the CsrA CsrB complex did not repress glycogen expression as e fficiently as a CsrA alone did (Liu et al., 1997)

PAGE 14

14 Following the discovery of CsrB, another non coding small RNA CsrC was found in a genetic screen for factors that activated glycogen synthesis (Weilbacher et al., 2003). Much like CsrB, CsrC contained numerous CsrA binding sites and appeared to bind multiple CsrA homodimers (Weilbacher et al., 2003). CsrC possesses about 13 predicted CrsA binding sites present in the single st randed region of stem loop structures. Electrophoretic gel mobility shift experiments indicated that CsrA binds to CsrB with higher affinity than CsrC, and genetic experiments confirmed that CsrB is a more effective CsrA antagonist (Weilbacher et al., 20 03). Deletion of csrC has little effect on downstream CsrA targets, and its phenotype is most dramatic in the context of plasmid overexpression, or when csrC is deleted in a strain that lacks csrB In fact, E. coli is able to partially compensate for the l ack of either csrB or csrC by the presence of a feedback loop where CsrA indirectly activates the expression of its sRNA antagonist s. In strains that lack csrB steady state CsrC levels are elevated, and vice versa. In addition to CsrB and CsrC sRNAs, ano ther sRNA, McaS, which also binds to the chaperone Hfq, was shown to bind to and antagonize CsrA. When overexpressed, McaS activates PGA biosynthesis and biofilm formation. Therefore, it was concluded that the effects of McaS on the pgaABCD operon were med iated through CsrA (Jrgensen, T h omason, Havelun, Valentin Hansen & Storz, 2013) (Figure 1 1). However, we should note that McaS has little or no effects in the deletion experiments. The nucleotide c di GMP is a widespread bacterial secondary messenger th at activates the production of surface adhesins and biofilm formation, and inhibits motility by binding to and regulating transcription factors, glycosyltransferases and/or riboswitches (Rmling et al., 2005; Hengge, 2009). Biofilm formation and synthesis of PGA by E. coli is also act ivated by c di GMP (Suzuki et al., 2006; Boehm et al., 2009; Tagliabue et al., 2010) A recent study demonstrate d

PAGE 15

15 that c di GMP allosterically regulate s PgaC and PgaD by binding directly to both proteins and stimulating their glycosyltransferase activity ( S t einer et al., 2013 ). At low c di GMP concentrations, PgaD fails to interact with PgaC and is rapidly degraded. Thus, when cells experience a c di GMP trough, PgaD turnover facilitates the irreversible inactivation of the Pga machinery, thereby temporarily uncoupling it from c di GMP signalling. CsrA regulates the expression of several genes involved in c di GMP synthesis or turnover, repressing genes fo r c di GMP synthesis and reducing the intracellular concentration of c di GMP (Jonas et al., 2008; 2010) (Figure 1 1) Thus, CsrA represses biofilm formation and PGA synthesis at multiple levels by (i) binding to the pgaABCD leader, inhibiting pgaA transl ation and causing pgaABCD mRNA destabilization, (ii) repressing c di GMP production, (iii) repressing translation of nhaR an activator of pgaABCD transcription and (iv) promoting the Rho dependent transcription termination (v) and by allosterically acti vation of PGA synthesis by the P gaC/D glycosyltransferase. 1.4 NhaR A ctivates pgaABCD Transcription in Response to A lkaline pH Living cells not only respond to changing osmotic conditions but must also maintain an externally directed sodium gradient and a relative ly constant intracellular pH (Padan et al., 1981 ). Na + /H + antiporters, membrane proteins that exchange Na + (or Li + ) for H + play important roles in these processes. In E. coli NhaA is the key antiporter that protects against sodium stress, and it is essential for optimal growth in the presence of high sodium concentrations, while NhaB becomes essential only in the absence of N haA (Padan et al., 1994, 2001 ). The nhaA gene is located in a two gene operon, nhaAR which is induced by the presence of mo novalent cations. The gene nhaR of this operon encodes an autoregulatory protein that activates nhaAR

PAGE 16

16 transcription and is homologous to the LysR OxyR family of prokaryotic transcriptional r egulators ( Maddocks et al., 2008 ). LysR type transcriptional regu lators (LTTRs) respond to low molecular weight coinducer molecules, although coinducer binding often has been indirectly inferred by isolating mutants that fail to respond to, or have altered sp ecificity for, the coinducer ( Maddocks et al., 2008 ) Coinducers typically do not increase promoter affinity but instead activate transcription via a conformational ch ange in the LTTR DNA complex (Chen et al., 2 005; Hryniewicz et al., 1991 ; Muraoka et al., 2003; Schell et al., 1993 ). While NhaR activates gene expression in vivo in response to Na + K + or Li + this cation response has not been reconstituted in vitro (Carmel et al., 1997; Dover et al., 1996 ). Goller et al (2006) establish ed that NhaR stimulates pga transcription in vivo and thus biofilm formati on, in response to monovalent cations and alkaline conditions (Figure 1 1) They propose d that this represents a novel means by which NhaR promotes survival of E. coli in response to environmental conditions. Pannuri et al (2012) define d a novel circuit t hrough which CsrA acts to control PGA synthesis. It binds to the upstream noncoding RNA of nhaR and blocks the translation of the transcriptional activator protein NhaR of the pgaABCD operon (Figure 1 1) They propose d that CsrA regulates the NhaR mediated response to elevated [Na + ] and high pH and that multi tier regulation of pgaABCD expression tightens the control of PGA production by CsrA. This multi tier regulation suggests that strong selective pressure exists to govern biofilm formation in concert with multiple CsrA responsive genes and pathways (Babitzke et al., 2 007; Edwards et al., 2011; Romeo et al., 2013 ).

PAGE 17

17 Figure 1 1 Regulatory C ircuitry of pgaABCD O peron (1) CsrA is antagonized by two sRNAs, CsrB a nd C srC, which bind and sequester CsrA. (2) CsrA binds to the pgaABCD leader, inhibiting pgaA translation and causing pgaABCD mRNA destabilization and promotes the Rho dependent transcription termination. (3) CsrA binds to the upstream noncoding RNA of nhaR and blocks the translation of the transcriptional activator protein NhaR of the pgaABCD operon .(4) and (5) NhaR stimulates pga transcription in vivo and thus biofilm formation, in response to alkaline pH .(6) CsrA binds to the mRNA leader of ydeH and bloc ks the translation. (7) and (8) The ydeH and yhjH genes encode for proteins that synthesize or degrade c di GMP (9) c di GMP allosterically regulate PgaC and PgaD by binding directly to both proteins and stimulating their glycosyltransferase activity. (10) M caS binds to and antagonizes CsrA.

PAGE 18

18 CHAPTER 2 MATERIALS AND METHODS 2.1 Bacterial Strains and Culture Conditions The bacterial strains and the plasmids used in this study are listed in Table 2 1. All of the experiments were carried out in Luria Broth medi um (5g/L. yeast extract, 10g/L. Tryptone, and 10g/L. NaCl, pH 7.4) with or without glucose (0.2% wt / vol). Cells were routinely grown at 37C and 250 rpm. When necessary, antibiotics were added to the medium to the following final concentrations: Kanamyci 1 1 1 1 2.2 Construction of E. coli Gene Deletions Single gene deletion strains from strains of the Keio collection (Baba et al., 2006) were used to transduce mutations into MG1655 using P1 vir bacteriophage. Other chromosomal method, as described by Datsenko and Wanner (2000). The primers used to construct the single gene deletions are described in Table 2 2. galactosidase Assays galactosidase assays were conducted as previously described (Romeo, Black, & Preiss, 1990). Some minor modifications were included as described by Edwards et al. (2011). Total protein was measured by the bicinchoninic acid (BCA) assay with bovine serum albumin as the protein standard (Pierce Biotechnology, Rockford, IL). 2.4 Quantitative Biofilm Assay diluted culture was transferred to a 96 well polystyrene microtiter plate (Costar) and incubated at 26C without shaking for 24 h. Planktonic growth was determined by measuring OD600 using a

PAGE 19

19 BioTek Synergy H4 Microplate Reader. The plates were washed thre e times with deionized water to remove the planktonic cells. Bacterial cells retained in the biofilm were stained with 250 to remove unbound and excess dye. The plate was allowed to dry for 20 min at 37C. The crystal violet was solubilized with 200ul of 33% acetic acid, and the dye intensity was quantified by measuring the OD630. 2.5 Detection of PGA Overnight cultures were diluted 1:100 into fresh LB. Cultures were incubated for 24 h at solution containing 50 mM Tris incubation at room temperature for 30 min, a solution (300 amylase, and 40 mM MgCl 2 was added. The mixture was incubated at room temperature for 1 h with occasional mixing before being heated to 37C for 2 h. The resulting cell lysate was then extracted once with 50 mM Tris (pH 8.0) saturated phenol and once with chloroform. The aqueous phase (1 ml from 10 ml of culture) was collected, and residual chloroform was allowed to evaporate overnight at room temperature. The samples were concentrated using a YM 3 membra ne (Amicon, Houston, TX; molecular mass cutoff, 3,000 Da). For cell a nitrocellulose membrane and allowed to air dry overnight at room temperature. The membrane was blocked f or 1 h in 5% nonfat dry milk in PBS T (1.47 mM NaH2PO4, 8.09 mM Na2HPO4, 0.145 mM NaCl, and 0.5% Tween 20). A primary anti PGA monoclonal IgM antibody from mice (Itoh et al., 2008) was used at a dilution of 1:5,000 in 1% bovine serum albumin PBS T for 1 h. After the membrane was washed twice for 5 min and twice for 10 min with PBS T, the

PAGE 20

20 secondary horseradish peroxidase conjugated antibody (1:10,000; Sigma Aldrich) was applied for 1 h. The membrane was then washed, and the signal was detected by chemilumine scence, as recommended by the manufacturer (Western Lightning Plus protocol; Perkin Elmer). Membranes were photographed using a Bio Rad ChemiDoc system.

PAGE 21

21 Table 2 1. Strains and Bacteriophage used in this study Name Description Reference MG1655 E.coli K 12 Michael Cashel CF7789 MG1655 Z (MluI) Michael Cashel TRMG MG1655 csrA::kan Romeo et al., 1993 TRCF7789 CF7789 csrA::kan Suzuki et al., 2002 XWZ4 CF7789 pgaA lacZ Wang et al., 2005 TRXWZ4 CF7789 pgaA lacZ csrA::kan Wang et al., 2005 XWZ4 crp CF7789 pgaA lacZ crp::cam This work TRXWZ4 crp CF7789 pgaA lacZ csrA::kan crp::cam This work AP 24 CF7789 pLFXpgaA lacZ Panurri et al., 2012 AP 28 CF7789 pLFXpgaA lacZ csrA::kan Panurri et al., 2012 MG mcaS MG1655 mcaS::kan Storz et al., 2013 TR mcaS TRMG mcaS::kan Storz et al., 2013 MG crp MG1655 crp::cam Jackson et al., 2002 TR crp TRMG crp::cam Jackson et al., 2002 MG ydeH MG1655 ydeH::kan This work TR ydeH TRMG ydeH::kan This work MG yhjH MG1655 yhjH::kan This work TR yhjH TRMG yhjH::kan This work MGpgaC ::3X FLAG MG1655 pgaC ::3X FLAG Manish Kumar (unpublished results) TRpgaC ::3X FLAG TRMG pgaC::3X FLAG Manish Kumar (unpublis hed results) MG crp pgaC MG1655 crp::cam pgaC::3X FLAG This work TR crp pgaC TRMG crp::cam pgaC::3X FLAG This work Bacteriophage P 1vir Strictly lytic P1 Carol Gross, University of California, San Francisco

PAGE 22

22 Table 2 2. List of primers used in this study Gene Forward/Reverse Sequence c rp Forward Reverse TATTTCGGCAATCCAGAGACAGCG CCGATGTGGCGCAGACTGATTTAT m caS Forward Reverse TCACGTCGCCAGTGCGATAAT GAAACTATCCGCGTAAGCGTGGC ydeH Forward Reverse TCTCTCGTTAGAATAGCGCGCACA AGTAAACCGGCGGTGAATGCT yhjH Forward Reverse TCATGCATTCGCCAATCACGGC CGCGTGGCAAATGCACCATCG

PAGE 23

23 CHAPTER 3 RESULTS 3.1 Addition of Glucose Leads to a D ecrease in Biofilm Formation and C ell B ound PGA Earlier studies revealed that g lucose inhibits biofilm formation of E. coli K 12 strains (including MG1655) and some strains of Enterobacteriaceae (Jackson et al., 2002). We repeated the exper iment to test if the effect of g lucose was reproducible under our experimental conditions (Fig ure 3 1). Glucose was found to inhibit biofil m formation of MG1655 or its isogenic csrA::kan mutant (TRMG1655). T he inhibitory effect was greater in TRMG1655. This result is in agreement with the earlier study. To examine if the inhibitory effect of glucose on biofilm formation was due to a decrease in PGA accumulation, relative levels of cell bound PGA were compared by immunoblot analysis of extracts obtained from MG1655 and TRMG grown in LB with or without glucose (0.2% wt / vol) as described in Material and Methods. MG1655 grown in LB without gluc ose prod uced more (12 fold) anti PG A reacting material than in LB medium with glucose (Fig ure 3 2). A similar resu lt was also obtained with TRMG where 4 5 fold more anti PG A reacting material w as found in LB without g lucose (Fig ure 3 2). Thus, a ddition of glucose decrease s biofilm formation and cell bound PGA 3.2 Glucose Effect on Biofilm F ormation in E. coli D oes N ot R equire ydeH and yhjH or the sRNA McaS. Gene products of the pgaABCD operon are needed for PGA polymer synthesis and secretion. The express ion of pgaABCD operon and activity of Pga proteins determine the level of PGA. The nucleotide signaling molecule, c di GMP has positive effects on PGA dependent biofilm formation (K. Jonas et al., 2008 Boehm et al., 2009, Steiner et al., 2013 ) through its effect on the PgaC and PgaD proteins (Steiner et al., 2013) The ydeH and yhjH gene s encode for proteins that synthesize or degrade c di GMP (Sommerfeldt et al., 2009) respectively and were

PAGE 24

24 shown to have significant effects on biofilm formati on and PG A accumulation of MG1655 (Pannuri et al., unpublished results). In order to test if the inhibitory effect of glucose on biofilm formation was mediated through ydeH or yhjH we looked at glucose effects on biofilm formation in ydeH and yhjH mutants of TRMG Deletion of ydeH or yhjH respectively, resulted in a decrease or increase in biofilm formation of TRMG in LB medium as observed earlier (Fig ure 3 3 A) (Goller et al.,). The effect of ydeH and yhjH deletions on biofilm formation of TRMG in LB wi th glucose was similar to that observed in LB without glucose. Addition of glucose to LB resulted in a decrease in biofilm formation of both ydeH / yhjH mutants of TRMG in comparison to its isogenic wild type strain (Fig ure 3 3 A). Therefore, ydeH / yhjH are not required in glucose repression effect on biofilm formation. To determine whether the glucose effect on biofilm formation was mediated through mcaS a n sRNA which is known to indirectly regulate pgaA expression (Thomason et al., 2012), we test ed the glucose effect on biofilm formation in mcaS deletion strains of MG1655 (Fig ure 3 3 B) and TRMG (Fig ure 3 3 C) Deletion of mcaS did not affect biofilm formation of MG1655 / TRMG either in LB or LB with 0 .2% glucose. Therefore, the e ffect of glucose on bio film formation was not dependent on mcaS 3.3 Addition of Glucose Leads to a D ecrease in pgaA E xpression To determine if glucose had an effect on the expression of the pgaABCD operon, we monitored the activities of chromosomally encoded pgaA lacZ translational fusion containing the upstream noncoding region through the initiation codon of pgaA (Wang et al., 2005) and a pgaA lacZ transcriptional fusion which contained the pgaA promoter region (nt 586 to 233 relative to the initiation codon) ( Pann uri et al., 2011 ) in LB medium with or without glucose

PAGE 25

25 (0.2% wt/vol) Expression of pgaA lacZ translational fusion in strains grown in LB medium without glucose was 2.5 3 fold higher than t hose grown in LB medium with glucose (Fig ure 3 4 A). E xpression of pgaA lacZ transcriptional fusion in strains grown in LB medium without glucose was 1.4 2.3 fold higher than th ose grown in LB medium with glucose (Fig ure 3 4 B). Thus, glucose not only decreases the biofilm formation, PGA polymer but also pgaA expression 3.4 Addition of Glucose Leads to a Drop in pH of the M edium. I t is known that when E.coli is grown in a medium with glucose, the acidic end products of glucose metabolism lead to a decrease in the pH of the medium (Difco & BBL Manual., 2009). O n the other hand, when E.coli is grown in LB without glucose, it mainly utilizes the amino acid s provided by tryptone leaving ammonium ions that lead to an elevation of pH during late stationary phase (Difco & BBL Manual., 2009). Goller et al (2006) ha ve shown that the expression of pgaA lacZ translational fusion was induced by alkaline pH in an nhaR dependent fashion. Since expression of pgaA reporter fusions were lower in medium with glucose, we hypothesize d that the inhibitory effect of glucose on biofilm formation may be mediated through change in pH of medium consequently affecting activity of N haR the transcriptional activator of pgaABCD operon. To further test our hypothesis were true, we monitored th e pH of spent medium of cultures grown in LB wit h or without glucose (Fig ure 3 5) The time points chosen for monitoring the pH were the same as when the cultures were harvested for monitoring pgaA reporter fusions (Fig ure 3 4 and 3 5 ). pH of LB withou t gl ucose remained constant most of the times but modestly elevated at the late time point The pH of LB medium with glucose remained constant until 8h and thereafter showed a drop to a pH of 5 between 10 15h of growth. It should

PAGE 26

26 be noted that the effects of g lucose on pgaA reporter fusion become apparent at the same time as the changes in pH of LB medium with glucose. If the change in pH of the medium with glucose is the cause for the observed effects on the pgaA reporter fusions then buffering the medium should eliminate the pH effect. W e u sed 0.1M MOPS as the buffer ing agent and it was observed that inclu sion of MOPS in LB medium with g lucose did not result in significant change in pH i n comparison to LB medium with g lucose (Fig ure 3 5). We then looked at effect of glucose on the expression of pgaA lacZ fusion in LB medium buffered with MOPS. W e no longer observed a decrease in the activity of pgaA lacZ translational fusion in LB MOPS medium with glucose ( Fig ure 3 6) in comp arison to LB MOPS medium without glucose In fact, the expression of pgaA lacZ translational fusion was modestly higher in the presence of glucose To test if the loss of inhibitory effect of glucose on pgaA lacZ expression in LB MOPS medium was consistent with biofilm formation and PGA accumulation we tested for glucose effects on biofilm formation and PGA accumulation in LB MOPS medium. W e no longer observe d the inhibitory effect of glucose on biofilm formation of MG1655 ( Fig ure 3 7 A ) or TRMG ( Fig ure 3 7 B ) Also, i n LB buffered with 0.1M MOPS the addition of glucose d id not have an effect on PGA accumulation in MG1655 and TRMG (Fig ure 3 8). 3.5 Is Glucose Effect on Biofilm F ormation in E. coli Mediated T hrough CRP? Jackson et al have shown that mutating crp in MG1655 and TRMG leads to a decrease in specific biofilm formation. They also concluded that the glucose repression of biofilm formation is at least partly due to crp and cyaA We found that specific biof ilm formation of MG1655 crp ::cam muta nt was lower (2.7 fold) in LB (Fig ure 3 9), which agrees with the result of Jackson et al., (Alt hough the crp mutants exhibited substant ial growth defects in LB medium, biofilm

PAGE 27

27 formation was corrected for total cell protein and expressed as specific biofilm formation to account for growth defects of crp mutant ) The decrease in specific biofilm formation in the crp::cam mutant correlated with decrease in PGA accumulation (Fig ure 3 10). Surprisingly, expression of pga A lacZ fusion was higher in a crp::cam mutant when compared to its wild type in LB medium (Fig ure 3 11 A). The effect of crp::cam mutation on expression of pgaA lacZ fusion was also similar in LB medium with 0.2% Glucose (Fig ure 3 11 B). These effects of crp::cam mutation on pgaA lacZ expression were opposite to the effects of crp::cam mutation on biofilm formation and PGA accumulation. It is possible that cAMP CRP could be influencing PGA accumulation at more than one level, in opposite ways, in the pathway from pgaABCD expression to PGA synthesis. The CRP effects that are downstream of pgaA expression may be stronger than the CRP effects on pgaA expression. Further investigation is needed to resolve these conflicting results.

PAGE 28

28 Figure 3 1 Effect of G lucose on the Biofilm Formation and PGA A ccumulation of E. coli K 12 S train MG1655 and its I sogenic csrA::kan M utant (TRMG) in LB medium This experiment was repeated in entirety three times, with essentially identical results. A representative is shown. Figure 3 2 Effect of Glucose on A ccumulation of PGA. Cell extracts were analyzed by immunoblotting for PGA polymer with a murine anti PGA IgM MAb as described in Material & Methods. This experiment was repeated in e ntirety three times, with essentially identical results. A representative blot is shown. The PGA levels were 12 fold and 4 5 fold greater in the absence of glucose for MG1655 and TRMG, respectively. 0 0.05 0.1 0.15 0.2 0.25 MG1655 0 0.5 1 1.5 2 2.5 3 TRMG -glucose +glucose

PAGE 29

29 Figure 3 3 Effects of Glucose on Biofilm F ormation of TRMG and A) its I sogenic ydeH and yhjH M utants and B) mcaS M utants of MG1655 and C) TRMG A) TRMG1655 and its ydeH yhjH mutants in LB with and without 0.2% glucose B ) MG1655 and its McaS mutant in LB with and without 0.2% glucose C) TRMG1655 and its McaS mutant in LB with and without 0.2% glucose No significant changes in planktonic growth were observed in medium with/without glucose was observed. 0 1 2 3 4 5 TRMG TRMG ydeH mutant TRMG yhjH mutant Crystal Violet Staining(OD 630 ) -glucose +glucose 0 0.05 0.1 0.15 0.2 0.25 MG1655 mcaS mutant Crystal Volet Staining(OD 630 ) 0 0.5 1 1.5 2 2.5 3 TRMG1655 TRMG mcaS mutant Crystal Violet Staining(OD 630 )

PAGE 30

30 Figure 3 4 Effects of Glucose on the E xpression of pgaA lacZ Translational F usion and pgaA lacZ Transcriptional F usion in MG1655 G a lactosidase specific activity (OD 420 /mg protein) and growth (OD 600 ) are shown by closed and open symbols, respectively. A) CF7789 pgaA lacZ translational fusion in LB with (grey) and without (black) 0.2% glucose B) CF7789 pgaA lacZ transcriptional fusion in LB with (grey) and without (black) 0.2% glucose 0.01 0.1 1 10 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 0 5 10 15 20 25 OD 600 galactosidase Activity (OD 420 /mg protein) Time (hr) 0.01 0.1 1 10 0 10000 20000 30000 40000 50000 60000 70000 80000 90000 0 5 10 15 20 25 OD 600 galactosidase Activity (OD 420 /mg protein) Time (hr)

PAGE 31

31 Figure 3 5 Growth and Changes in pH of Spent Medium of C ultures of MG 1655 G rown in F our Different M edia. pH and growth (OD 6 00 ) are shown by closed and open symbols, respectively. 0.01 0.1 1 10 0 2 4 6 8 10 12 0 5 10 15 20 25 OD 600 pH Time (hr) LB LB+glc. LB+MOPS LB+MOPS+glc.

PAGE 32

32 Figure 3 6 Effects of 0.1M MOPS on the E xpression of pgaA lacZ Translational F usion of MG1655 in LB with and without G lucose g a lactosidase specific activity (OD 420 /mg protein) and growth (OD 600 ) are shown by closed and open symbols, respectively. CF7789 pgaA lacZ translational fusion in LB buffered by 0.1M MOPS with (grey) and without (black) the addition of 0.2% glucose 0.01 0.1 1 10 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 0 5 10 15 20 25 OD 600 galactosidase Activity (OD 420 /mg protein) Time (hr) pgaA'-'lacZ LB with 0.1M MOPS pgaA'-'lacZ LB with 0.1M MOPS and 0.2% glc. LB+MOPS LB+MOPS+glc.

PAGE 33

33 Figure 3 7 Effect of G lucose on the Biofilm F ormation of E. coli K 12 S train A) MG1655 and B) its I sogenic csrA::kan Mutant (TRMG) in LB M edium and LB Medium B uffered with MOPS 0 0.05 0.1 0.15 0.2 0.25 0.3 LB LB buffered by 0.1M MOPS Crystal Violet Staining (OD630) glucose + glucose 0 1 2 3 4 LB LB buffered by 0.1M MOPS Crystall Violet Staining (OD630) glucose + glucose

PAGE 34

34 Figure 3 8 Effect of Glucose on A ccumulation of PGA in MG1655 and TRMG1655 in LB Medium / LB Medium B uffered with MOPS Cell extracts were analyzed for PGA by immunoblotting with a murine anti PGA IgM MAb. This experiment was repeated in entirety three times, with essentially identical results. A representative blot is shown.

PAGE 35

35 Figure 3 9 Effects of crp on Specific Biofilm F ormation by MG1655 in LB Medium with and without 0.2% G lucose Cultures of wild type or isogenic crp::cam mutant strains were grown for 24 h in LB medium with and without 0.2% glucose and biofilm was determined after 24 h at 26C. Figure 3 10 Effects of crp on PGA A ccumulation in MG1655 and TRMG in LB M edium and LB Medium with 0.2% G lucose Cell extracts were an alyzed for PGA by immunoblotting with a murine anti PGA IgM MAb. 0 1 2 3 4 5 6 7 MG1655 MG1655 crp::cam Specific Biofilm Formation (OD 630 /mg protein)

PAGE 36

36 Figure 3 11. Effects of crp on the E xpression of pgaA lacZ Translational F usion in A) LB M edium and B) LB medium with 0.2% glucse g a lactosidase specific activity (OD 420 /mg protein) and growth (OD 600 ) are shown by closed and open symbols, respectively. 0.01 0.1 1 10 0 20 40 60 80 100 120 0 5 10 15 20 25 30 OD 600 galactosidase Activity (OD 420 /mg protein) Time (hr) 0.01 0.1 1 10 0 20 40 60 80 100 120 0 5 10 15 20 25 30 OD 600 galactosidase Activity (OD 420 /mg protein) Time (hr)

PAGE 37

37 CHAPTER 4 DISCUSSION Jackson et al (2002) revealed that b iofilm formation was repressed by glucose in several species of Enterobacteriaceae They reasoned that in E coli the repression effect of glucose was mediated at least in part by cyclic AMP (cAMP) cAMP receptor protein. T he effects of glucose and mutations in genes that code for catabolite repression functions have a range of effects on biofilm formation in gram negative bacteria The first evidence that a catabolite repression gene could contribute to biofilm formation was f ound in Pseudomonas aeruginosa where mutation of the ca tabolite repression control ( crc ) gene led to a severe reduction in biofilm formation due to a reduction in type IV pilus production ( et al. 2000). Serratia marcescens (Kalivoda et al., 2008) and P. aeruginosa both control surface attachment through C arbon C atabolite R epression (CCR). H owever, CCR genes of S. marcescens are shown to negatively regulate type 1 fimbria production (Kalivoda et al., 2008) whereas Crc appears to be a positive regul ator of surface adhesins in P. aeruginosa Salmonella enterica serovar Enteritidis biofilm formation and virulence potential are positively regulated by growth in glucose rich medium, suggesting that lower levels of cAMP could influe nce these phenotypes (Bonafonte et al 2000). More studies show that PTS components play a role in biofilm formation. Mutations in PTS component IIB (glucose specific) and enzyme IIC (cellobiose specific), but not enzyme IIA, of Klebsiella pneumoniae were isolated in a signature tagged mutagenesis screen for genes required for attachment to extracellula r matrix components (Boddicker et al. 2006). In Vibrio cholerae PTS enzyme I is important in regulation of biofilm formation, while the mutation of enzyme IIA Glc had no effect on biofilm (Houot et al 2008). FruI a multicomponent, f ructose specific PTS component has been found to positively regulate Streptococcus gordonii biofilm formation ( Loo et al. 2003 ).

PAGE 38

38 Herein we investigated the regulatory mechanis m of the repression effect of glucose on biofilm formation by studying the dominant componen t of the biofilm (PGA) and showing that its accumulation is repressed by glucose. We reasoned that the genes ( pgaABCD operon) encoding the proteins needed for synth esis and secretion of PGA may be the target of the repression effect by glucose. After showing that addition of glucose to cultures decreased the expression of both pgaA lacZ translational fusion and pgaA lacZ transcriptional fusion, we studied known reg ulators that directly / indirectly affect the expression of pgaABCD operon and / or PGA synthesis and disrupted their genes to determine whether the glucose effect depends on those regulators or not. Biofilm induction involves upregulation of PGA synthesis and two components of the PGA biosynthesis machinery, PgaC and PgaD. Maximal induction of PgaD and PGA synthesis requires the production of c di GMP by the dedicated diguanylate cyclase YdeH (Boehm et al., 2009). YhjH on the other hand possess c di GMP phosphodiesterase (PDE A) activity through which it repress es biofilm formation (Simm et al. 2004). Herein, w e provide the evidence that effect of glucose was not dependent on ydeH / yhjH by showing the glucose repression effect on biofilm formatio n in ydeH / yhjH deletion mutants. McaS is a small regulatory RNA that was previously shown to regulate pgaABCD operon and to be expressed via CRP in response to nutrient limitation and coordinates the regulation of motility and biofilm formation (Thomason et al., 2012). While Thomas on et al (2012) spectulate that the reduced biofilm formation observed in the presence of glucose and in a CR P mutant strain (Jackson et al. 2002) might be the indirect result of decreased McaS activation of flhD and pgaA we provide evidence that the repression of glucose on biofilm formation is not

PAGE 39

39 dependent on McaS by showing the repression effect of glucose in mcaS deletion mutants of MG1655 and TRMG. Jackson et al (2002) showed that biofilm formation was reduced in c rp and cyaA mutant strains and deduced that the repression of glucose on biofilm is at least partly mediated through the carbon catabolite repression. The present study further supports the work of Jackson et al by showing that mutation of the crp gene no t only leads to a decrease in biofilm formation but also lead to decrease in the accumulation of PGA. Subsequently we found that biofilm formation, PGA accumulation and the expression of pgaA lacZ translational fusions are no longer repressed by glucose in a crp mutant. However, expression of pgaA lacZ translational fusion was higher in a crp mutant in comparison to its isogenic wild type. This result is opposite to the effect of crp mutation on biofilm formation and PGA accumulation. We plan to monitor for PgaC::3X FLAG protein in crp mutant to test if the effect of crp mutation on pgaA expression leads to an increase in Pga proteins. Unpublished studies by Archana Pannuri in our group recently showed that CRP represses csrB / C expression and increases C srB RNA decay. In other words expression of the crp CsrA activity by sequestering CsrA molecules, CsrA activity would be predictably lower in a crp mutant. The increas e in expression of pgaA lacZ translation fusion observed in a crp mutant would be consistent with the effect of crp mediated through CsrB / CsrC and CsrA activity. However, we need to test this hypothesis with csrB csrC double mutant and / or csrA mutant. Goller et al (2006) demonstrated that the LysR type transcriptional regulator NhaR is necessary and sufficient to activate transcription from the pgaABCD promotor of E.coli K 12 and consequently activates PGA production and biofilm formation. The y also showed that NhaR

PAGE 40

40 activates expression of pgaABCD operon in response to elevated Na + and/or alkaline pH. It is known that E. coli utilizes glucose and produces acidic metabolites (eg. actate, lactate) which lead to a decrease of in the pH ( Difco & B BL Manual., 2009 ). We suspect that the decrease in pH due to glucose metabolism can lead to decrease in NhaR activity and prevent the binding of NhaR to the promoter of pgaABCD operon. This could be the reason that glucose indirectly represses the expressi on of pgaABCD operon, PGA accumulation and biofilm formation. To confirm this spectulation, we buffered the pH with MOPS to 7.4 and again tested for the effect of glucose son biofilm formation, PGA accumulation and pgaA expression. As predicted, glucose no longer repressed biofilm formation, PGA accumulation and the expression of pgaA lacZ translational fusion. This implies that the effect of glucose on pgaA expression and biofilm formation is mediated through changes in pH that alters NhaR activity. This could be further tested by monitoring PgaC::3X FLAG protein. The effects of environmental carbon sources and carbon utilization regulatory proteins on biof ilm formation have been documented for diverse bacterial species Carbon source and availability have a large impact on the way bacteria interact with their environment. NhaR is required for survival under high concentrations of NaCl, high pH, and certain oxidative stresses (Padan et al., 1994; Toesca et al., 2001). While the full ramifications of our findings remain to be determined, the regulatory role of glucose and NhaR in adhesion and biofilm formation is consistent with the idea that biofilm formation itself provides protection against a variety of biological and chemical stresses ( Costerton et al., 1995, 1999, 2001; Davies et al., 2003; Donlan et al., 2002 ) and further suggests that NhaR is a stress response regulator of substantial importance.

PAGE 41

41 LIS T OF REFERENCES Agladze, K., D. Jackson, and T. Romeo. 2003. Periodicity of cell attachment patterns during Escherichia coli biofilm development. J. Bacteriol 185:5632 5638. Agladze, K., X. Wang, and T. Romeo. 2005. Spatial periodicity of Escherichia col i K 12 biofilm microstructure initiates during a reversible, polar attachment phase of development and requires the polysaccharide adhesin PGA. J. Bacteriol 187:8237 8246. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Mori H. (2006) Construction of Escherichia coli K 12 in frame, single gene knockout mutants: the Keio collection. Molecular System Biology 2, 2006 0008. B (2011) Insight into bacterial phosphotransferase system mediated signaling by interspecies transplantation of a transcriptional regulator. J Bacteriol 193:2013 2026 Beloin, C., and J. M. Ghigo. 2005. Finding gene expression patterns in bacterial biofilm s. Trends Microbiol 13:16 19. Babitzke P, Romeo T. 2007. CsrB sRNA family: sequestration of RNA binding regulatory proteins. Curr. Opin. Microbiol 10:156 163. Bobrov A, Kirillina GO, Forman S, Mack D, Perry RD. 2008. Insights into Yersinia pestis biofil m development: topology and co interaction of Hms inner membrane proteins involved in exopolysaccharide production. Environ. Microbiol 10:1419 1432. source an d autoregulatory limitation of sugar utilization. FEMS Microbiol Lett 209:141 148 Carmel, O., O. Rahav Manor, N. Dover, B. Shaanan, and E. Padan. 1997. The Na + specific interaction between the LysR type regulator, NhaR, and the nhaA gene encoding the Na + /H + antiporter of Escherichia coli EMBO J 16:5922 5929. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial biofilms: a common cause of persistent infections. Science 284:1318 1322. Costerton, J. W., Z. Lewandowski, D. E. Caldwell, D. R. Korber, and H. M. Lappin Scott. 1995. Microbial biofilms. Annu. Rev. Microbiol 49:711 745. Costerton, J. W., and P. S. Stewart. 2001. Battling biofilms. Sci. Am 285: 74 81. Chen, X. C., J. Feng, B. H. Hou, F. Q. Li, Q. Li, and G. F. Hong. 2005. Modulating DNA bending affects NodD mediated transcriptional control in Rhizobium leguminosarum Nucleic Acids Res. 33:2540 2548. Structure 5:1017 1032.

PAGE 42

42 Danese, P., L. A. Pratt, and R. Kolter. 2000. Exopolysaccharide production is required for development of Escherichia coli K 12 biofilm architecture. J. Bacteriol 182:3593 3596. Danese, P., L. A. Pratt, S. L. Dove, and R. Kolter. 2000. The outer membrane protein, antigen 43, mediates cell to cell interactions within Escherichia coli biofilms. Mol. Microbiol 37:424 432. Da Re, S., and J. M. Ghigo. 2006. A CsgD independent pathway for cellulose production and biofilm formation in Escherichia coli J. Bacter iol 188:3073 3087. Domka, J., J. Lee, and T. K. Wood. 2006. YliH (BssR) and YceP (BssS) regulate Escherichia coli K 12 biofilm formation by influencing cell signaling. Appl. Environ. Microbiol 72:2449 2459. Dover, N., C. F. Higgins, O. Carmel, A. Rimon, E. Pinner, and E. Padan. 1996. Na + induced transcription of nhaA which encodes an Na + /H + antiporter in Escherichia coli is positively regulated by nhaR and affected by hns J. Bacteriol. 178:6508 6517. Davies, D. 2003. Understanding biofilm resistance t o antibacterial agents. Nat. Rev. Drug Discov 2:114 122. Donlan, R. M., and J. W. Costerton. 2002. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin. Microbiol. Rev. 15:167 193. Datsenko, K., & Wanner, B (2000). One step inactivati on of chromosomal genes in Escherichia coli K 12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America 97, 6640 6645. Dubey, A., Baker, C., Romeo, T., & Babitzke, P. (2005). RNA sequence and secondary structure participate in high affinity CsrA RNA interaction. RNA 11,1579 1587 Edwards, A., Patterson For tin, L., Vakulskas, C. Mercante, J. Potrykus, K ., Vinella D ., & Romeo, T. (2011). Circuitry linking the Csr and stringent response global regulatory systems. Molecular Microbiology 80,1561 1580. Escalante A, Salinas Cervantes A, Gos set G, Bolivar F (2012) Current knowledge of the Escherichia coli phosp hoenolpyruvatecarbohydrate phosphotransferase system: peculiarities of regulation and impact on growth and product formation. Appl Microbiol Biotechnol 94:1483 1494 Flores S, Gosset G, Flores N, de Graaf AA, Bolvar F (2002) Analysis of carbon metabolism in Escherichia coli strains with an inactive phosphotransferase systemby 13C labeling and NMR spectroscopy. Metab Eng 4:124 137 Flores N, Flores S, Escalante A, de An da R, Leal L, Malpica R, Georgelis D, Gosset G, Bolvar F (2005a) Adaptation for fast growth on glucose by differential expression of central carbon metabolism and gal regulon in an Escherichia coli strain lacking the phophoenolpyruvate:carbohydrate phosph otransferase system. Metab Eng 7:70 87

PAGE 43

43 Flores S, Flores N, de Anda R, Gonzlez A, Escalante A, Sigala JC, Gosset G, Bolvar F (2005b) Nutrient scavenging stress response in an Escherichia coli strain lacking the phophpenolpyruvate: carbohydrate phosphotransferase system, as explored by gene exp ression profile analysis. J Mol Microbiol Biotechnol 10:51 63 Ferenci T (2001) Hungry bacteria: definition and properties of a nutritional state. Environ Microbiol 3:605 611 Figueroa Bossi, N., Schwartz, A ., Guillemardet, B ., D'Heygre, F ., Bossi L ., & Boudvillain, M (2014). RNA remodeling by bacterial global regulator CsrA promotes Rho dependent transcription termination. Genes and Development 28, 1239 1245. Gonzalez Barrios, A. F., R. Zuo, Y. Hashimoto, L. Yang, W. E. Bentley, and T. K. Wood. 2006. Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum sensing regulator (MqsR, B3022). J. Bacteriol 188:305 316. Ghigo, J. M. 2003. Are there biofilm specific physiological pathways beyond a reasonable doubt? Res. Microbiol 154:1 8. Gerke, C., A. Kraft, R. Sussmuth, O. Schweitzer, and F. G tz. 1998. Characterization of the N acetylglucosaminyltransferase activity in volved in the biosynthesis of the Staphylococcus epidermidis polysaccharide intercellular adhesin. J. Biol. Chem 273:18586 18593. Goller, C., X. Wang, Y. Itoh, and T. Romeo. 2006. The cation responsive protein NhaR of Escherichia coli activates pgaABCD tr anscription, required for production of the biofilm adhesin poly 1,6 N acetyl D glucosamine. J. Bacteriol. 188:8022 8032. G tz, F. 2002. Staphylococcus and biofilms. Mol. Microbiol. 43:1367 1378. Gosset G (2005) Improvement of Escherichia coli productio n strains by modification of the phosphoenolpyruvate:sugar phosphotransferase system. Microb Cell Fact 4:14 Gosset G (2009) Production of aromatic compounds in bacteria. Curr Opin Biotechnol 20:651 658 in bacteria: many ways to make themost out of nutrients. Nat Rev Microbiol 6:613 624 Gutierrez, P., Li, Y., Osborne, M.J., Pomerantseva, E., Liu, Q., & Gehring, K. (2005). Solution structure of the carbon storage regulator protein CsrA from Escherichia co li. Journal of Bacteriology 187, 496 501. Hryniewicz, M. M., and N. M. Kredich. 1991. The cysP promoter of Salmonella typhimurium : characterization of two binding sites for CysB protein, studies of in vivo transcription initiation, and demonstration of th e antiinducer effects of thiosulfate. J. Bacteriol. 173:5876 5886.

PAGE 44

44 Heurlier, K., Williams, F ., Heeb, S ., Dormond, C ., Pessi, G ., Singer, D .,Haas, D. (2004). Po sitive control of swarming, rhamnolipid synthesis, and lipase production by the posttranscriptional RsmA/RsmZ system in Pseudomonas aeruginosa PAO1. Journal of Bacteriology 186, 2936 2945. Itoh, Y., X. Wang, B. J. Hinnebusch, J. F. Preston III, and T. Rom eo. 2005. Depolymerization of 1,6 N acetyl D glucosamine disrupts the integrity of diverse bacterial biofilms. J. Bacteriol 187:382 387. Itoh Y, et al 2008. Roles of pgaABCD genes in synthesis, modification and Escherichia coli promotes the synthesis o f a polysaccharide adhesin required for biofilm formation. J. Bacteriol. 186:2724 2734. Izano, E. A., I. Sadovskaya, E. Vinogradov, M. H. Mulks, K. Velliyagounder, C. Ragunath, W. B. Kher, N. Ramasubbu, S. Jabbouri, M. B. Perry, and J. B. Kaplan. 2007. Po ly N acetylglucosamine mediates biofilm formation and antibiotic resistance in Actinobacillus pleuropneumoniae Microb. Pathog 43:1 9. Jackson, D. W., J. W. Simecka, and T. Romeo. 2002. Catabolite repression of Escherichia coli biofilm formation. J. Bacte riol. 184:3406 3410. Jackson, D. W., K. Suzushi, L. Oakford, J. W. Simecka, M. E. Hart, and T. Romeo. 2002. Biofilm formation and dispersal under the influence of the global regulator CsrA of Escherichia coli J. Bacteriol. 184:290 301. Jonas K, et al 2008. The RNA binding protein CsrA controls cyclic di GMP metabolism by directly regulating the expression of GGDEF proteins. Mol. Microbiol. 70:236 257. Jonas, K., & Melefors, O. (2009). The Escherichia coli CsrB and CsrC small RNAs are strongly induced during growth in nutrient poor medium. FEMS Microbiology Letters 297, 80 86. Jonas K, et al 2010. Complex regulatory network encompassing the Csr, c di GMP and motility systems of Salmonella Typhimurium Envi ron. Microbiol 12:524 540. Jrgensen, M., Thomason, M., Havelund, J., Valentin Hansen, P., & Storz, G. (2013). Dual function of the McaS small RNA in controlling biofilm formation. Genes and Development 27, 1132 1145. Liu, M., Gui, G., Wei, B., Preston, J., Oakford, L., Yksel, U., Romeo, T. (1997). The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli Journal of Biological Chemistry 272, 17502 17510. Little, Dustin J., et al. "Structural Bas is for the De N acetylation of Poly 1, 6 N acetyl d glucosamine in Gram positive Bacteria." Journal of Biological Chemistry 289.52 (2014): 35907 35917. Muraoka, S., R. Okumura, N. Ogawa, T. Nonaka, K. Miyashita, and T. Senda. 2003. Crystal structure of a full length LysR type transcriptional regulator, CbnR: unusual combination

PAGE 45

45 of two subunit forms and molecular bases for causing and changing DNA bend. J. Mol. Biol. 328:555 566. Mack, D., W. Fischer, A. Krokotsch, K. Leopold, R. Hartmann, H. Egge, and R. Laufs. 1996. The intercellular adhesin involved in biofilm accumulation of Staphylococcus epidermidis 1,6 linked glucosaminoglycan: purification and structural analysis. J. Bacteriol. 178:175 183. Maddocks, Sarah E., and Petra CF Oyston. "Str ucture and function of the LysR type transcriptional regulator (LTTR) family proteins." Microbiology 154.12 (2008): 3609 3623. Pseudomonas aeruginosa biofilm developmen t. Mol. Microbiol. 30:295 304. Annu. Rev. Microbiol. 54:49 79. Pannuri, A., Yakhnin, H., Vakulskas, C.A., Edwards, A.N., Babitzke, P., and Romeo, T. 18 (2012) Translational Repression of NhaR, a Novel Pathway for Multi Tier Regulation of 19 Biofilm Circuitry by CsrA. J Bacteriol 194: 79 89. Padan, E., and S. Schuldine r. 1994. Molecular physiology of the Na + /H + antiporter in Escherichia coli J. Exp. Biol. 196:443 456. Padan, E., M. Venturi, Y. Gerchman, and N. Dover. 2001. Na + /H + antiporters. Biochim. Biophys. Acta 1505:144 157. Padan, E., D. Zilberstein, and S. Schuld iner. 1981. pH homeostasis in bacteria. Biochim. Biophys. Acta 650:151 166. Pratt, L. A., and R. Kolter. 1999. Genetic analyses of bacterial biofilm formation. Curr. Opin. Microbiol. 2:598 603. Pratt, L. A., and R. Kolter. 1998. Genetic analysis of Escheri chia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol. 30:285 293. Prigent Combaret, C., G. Prensier, T. T. Le Thi, O. Vidal, P. Lejeune, and C. Dorel. 2000. Developmental pathway for biofilm formation in curl i producing Escherichia coli strains: role of flagella, curli and colanic acid. Environ. Microbiol. 2:450 464. Parsek, M. R., and E. P. Greenberg. 2005. Sociomicrobiology: the connections between quorum sensing and biofilms. Trends Microbiol. 13:27 33. Par ise, G., M. Mishra, Y. Itoh, T. Romeo, and R. Deora. 2007. Role of a putative polysaccharide locus in Bordetella biofilm development. J. Bacteriol. 189:750 760.

PAGE 46

46 Park Y H, Lee BR, Seok Y J, Peterkofsky A (2006) In vitro reconstitution of catabolite repression in Escherichia coli J Biol Chem 281:6448 6454 Rahav Manor, O., O. Carmel, R. Karpel, D. Taglicht, G. Glaser, S. Schuldiner, and E. Padan. 1992. NhaR, a protein homologous to a family of bacterial regulatory protein s (LysR), regulates nhaA the sodium proton antiporter gene in Escherichia coli J. Biol. Chem. 267:10433 10438. Reisner, A., J. A. Haagensen, M. A. Schembri, E. L. Zechner, and S. Molin. 2003. Development and maturation of Escherichia coli K 12 biofilms. Mol. Microbiol. 48:933 946. Postma PW, Lengeler JW, Jacobson GR (1996) Phosphoenolpyruvate: Carbohydrate phosphotransferase systems. In: Neidhart FC (ed) Escherichia coli and Salmonella Cellular and molecular biology. ASM Press Washington, D. C., pp 1149 1174 Romeo, T. 1998. Global regulation by the small RNA binding protein CsrA and the non coding RNA molecule CsrB. Mol. Microbiol. 29:1321 1330. Romeo, T., M. Gong, M. Y. Liu, and A. M. Brun Zinkernagel. 1993. Identification and molecular characterization of csrA a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bact eriol 175:4744 4755. Romeo, T., J. Black, and J. Preiss. 1990. Genetic regulation of glycogen biosynthesis in Escherichia coli : in vitro effects of catabolite repression and stringent response systems in glg gene expression. Curr. Microbiol. 21:131 137. Schell, M. A. 1993. Molecular biology of the LysR family of transcriptional regulators. Annu. Rev. Microbiol. 47:597 626. Suzuki, K., X. Wang, T. Weilbacher, A. K. Pernestig, O. Melefors, D. Georgellis, P. Babitzke, and T. Romeo. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli J. Bacteriol. 184: 5130 5140. Suzuki K, Babitzke P, Kushner S, Romeo T. 2006. Identification of a novel regulatory protein (CsrD) that targets global regulatory RNAs CsrB and CsrC for degradation by RNase E. Genes Dev. 20:2605 2617. Simm, R., Morr, M., Kader, A., Nimtz, M., and Rmling, U. 2004. GGDEF and EAL domains inversely regulate cyclic di GMP levels and transition from sessility to motility. Mol. Microbiol. 53: 1123 1134. Smith, P. K., R. I Krohn, G. T. Hermanson, A. K. Mallia, F. H. Gartner, M. D. Provenzano, E. K. Fujimoto, N. M. Goeke, B. J. Olson, and D. C. Klenk. 1985. Measurement of protein using bicinchoninic acid. Anal. Biochem. 150:76 85. Steiner S, Lori C, Boehm A, Jenal U. 2013. Allosteric activation of exopolysaccharide synthesis through cyclic di GMP stimulated protein protein interaction. EMBO J. 32:354 368.

PAGE 47

4 7 Saier MH Jr, Ramseier TM, Reizer J (1996) Regulation of carbon utilization. In: Neidhart FC (ed) Escherichia coli and Sa lmonella Cellular and molecular biology. ASM Press, Washington, D. C., pp 1325 1343 Sabnis, N., Yang, H., & Romeo, T. (1995). Pleiotropic regulation of central carbohydrate metabolism in Escherichia coli via the gene csrA Journal of Biological Chemistry 270, 29096 29104. Sommerfeldt, N. 2009 Gene expression patterns and differential input into curli fimbriae regulation of all GGDEF/EAL domain proteins in Escherichia coli Microbiology 155, 1318 1331 Toesca, I., C. Perard, J. Bouvier, C. Gutierrez, and A. Conter. 2001. The transcriptional activator NhaR is responsible for the osmotic induction of osmC(p1), a promoter of the stress inducible gene osmC in Escherichia coli Microbiology 147:2795 2803. Tyr rell, R., K. H. V rschueren, E. J. Dodson, G. N. Murshudov, C. Addy, and A. J. Wilkinson. 1997. The structure of the cofactor binding fragment of the LysR family member, CysB: a familiar fold with a surprising subunit arrangement. Vidal, O., R. Longin, C. P rigent Combaret, C. Dorel, M. Hooreman, and P. Lejeune. 1998. Isolation of an Escherichia coli K 12 mutant strain able to form biofilms on inert surfaces: involvement of a new ompR allele that increases curli expression. J. Bacteriol. 180:2442 2449. Vuong, C., S. Kocianova, J. M. Voyich, Y. Yao, E. R. Fischer, F. R. DeLeo, and M. Otto. 2004. A crucial role for exopolysaccharide modification in bacterial biofilm formation, immune evasion, and virulence. J. Biol. Chem. 279:54881 54886. Wang, X., J. F. Preston III, and T. Romeo. 2004. The pgaABCD locus of Escherichia coli promotes the synthesis of a polysaccharide adhesin required for biofilm formation. J. Bacteriol. 186:2724 2734. Wang, X., A. K. Dubey, K. Suzuki, C. S. Baker, P. Babitzke, and T. Romeo. 2005. CsrA post transcriptionally represses pgaABCD responsible for synthesis of a biofilm polysaccharide adhesin of Escherichia coli Mol. Microbiol. 56:1648 1663. Wang, L., and S. C. Winans. 1995. The sixty nucleotide OccR operator contains a subsite essentia l and sufficient for OccR binding and a second subsite required for ligand responsive DNA bending. J. Mol. Biol. 253:691 702. Wei, B., Brun Zinkernagel, A., Simecka. J. Prss. B. Babitzke P ., & Romeo, T (2001). Positive regulation of motility and flhDC expression by the RNA binding protein CsrA of Escherichia coli Molecular Microbiol ogy 40, 245 56. (2003). A novel sRNA component of the carbon storage regulatory system of Escherichia coli Molecular Microbiology 48, 657 670.

PAGE 48

48 White, D., Hart, M., & Romeo, T. (1996). Phylogenetic distribution of the global regulatory gene csrA among eubacteria. Gene ,182, 221 223. Yakhnin, H., Baker, C., Berezin, I., Evangelista, M., Rassin, A., Romeo, T., & Babitzke, P. (2011). CsrA represses translation of sdiA, whic h encodes the N acylhomoserine L lactone receptor of Escherichia coli by binding exclusively within the coding region of sdiA mRNA. Journal of Bacteriology 1 93, 6162 6170. Yakhnin, H., Pandit, P., Petty, T., Baker, C., Romeo, T., & Babitzke, P. (2007). C srA of Bacillus subtilis regulates translation initiation of the gene encoding the flagellin protein (hag) by blocking ribosome binding. Molecular Microbiology 64, 1605 1620. Zogaj, X., M. Nimtz, M. Rohde, W. Bokranz, and U. Romling. 2001. The multicellul ar morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39:1452 1463.

PAGE 49

49 BIOGRAPHICAL SKETCH Hsieh Hsin was born and raised in Taipei, Taiwan and earned her Bachelor of Science degree in agricultural c hemistry in National Taiwan University in July 2012. She then attended the University of Florida where she pursued a Master of Science in microbiology and cell s cience, which she completed in Spring 20 15. After graduation, she plans to pursue her doctoral studies.