Citation
Neuropeptidergic Modulation in the Stomatogastric Nervous System

Material Information

Title:
Neuropeptidergic Modulation in the Stomatogastric Nervous System Cloning, Expression and Physiological Characterization of the Crustacean Cardioactive Peptide Receptor
Creator:
Garcia, Veronica J
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (192 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Neuroscience (IDP)
Committee Chair:
BUCHER,DIRK MARTIN
Committee Co-Chair:
BATTELLE,BARBARA ANNE M
Committee Members:
NOTTERPEK,LUCIA
JULIAN,DAVID
SCHULZ,DAVID
Graduation Date:
12/19/2014

Subjects

Subjects / Keywords:
Antibodies ( jstor )
Crustaceans ( jstor )
Electric potential ( jstor )
Ganglia ( jstor )
Modulators ( jstor )
Neurons ( jstor )
Neuropeptides ( jstor )
Neuroscience ( jstor )
Receptors ( jstor )
Synapses ( jstor )
Neuroscience (IDP) -- Dissertations, Academic -- UF
cpg -- crustacea -- neuromodulation
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Medical Sciences thesis, Ph.D.

Notes

Abstract:
Neural networks are anatomically hard-wired in the adult animal, but are capable of extensive plasticity and flexibility, while still maintaining functional integrity. The source of this flexible network activity arises from neuromodulators and the expression of their cognate receptors. Both vertebrate and invertebrate neural systems use neuromodulators, such as monoamines and neuropeptides, to modify intrinsic properties and synapses of a network to create a diverse repertoire of behaviors. The stomatogastric ganglion is an ideal system for investigating peptide modulation due to its accessible, individually identifiable neurons, and modulatory effects on rhythm generation. Despite the 100+ peptides that have been identified in the system, no receptors have been described, and the theory of peptide modulation in the network rests at a binary, differential distribution of receptors, all of which converge to activate the same ionic current. In this thesis, I identify the first crustacean neuropeptide receptor and describe distribution and physiology of the receptor with respect to individual neurons and network perturbation in the STG. The Cancer borealis crustacean cardioactive peptide receptor (CbCCAPr) is expressed in all nervous tissues in the animal and one muscle tissue examined. In the STG, the CbCCAPr transcript is present in each neuron that responds to the receptor ligand, and is expressed at significantly different levels. In two identified cell-types, different transcript levels correspond to differences in the maximal conductance and EC50 of the modulator-activated inward current, IMI. CbCCAPr is also expressed in a single neuron that does not respond to CCAP with the activation of IMI, but instead shows effects on synaptic currents. Perturbation of the network results in changes in expression of the receptor in an identified neuron which correspond to changes in IMI activation. Phylogenetic analysis of the receptor sequence strongly supports receptor identity according to the relationship to insect homologues and related mammalian neuropeptide receptors. The results presented in this thesis expand the understanding of GPCR-mediated circuit modulation by showing that even in local circuits there are cell type-specific quantitative differences in receptor expression and physiological responsiveness. In addition, these results strongly suggest the presence of activity-dependent regulation of GPCR-mediated neuromodulation. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: BUCHER,DIRK MARTIN.
Local:
Co-adviser: BATTELLE,BARBARA ANNE M.
Statement of Responsibility:
by Veronica J Garcia.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Garcia, Veronica J. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

NEUROPEPTIDERGIC MODULATION IN THE STOMATOGASTRIC NERVOUS SYSTEM: CLONING, EXPRESSION AND PHYSIOLOGICAL CHARACTERIZATION OF THE CRUSTACEAN CARDIOACTIVE PEPTIDE RECEPTOR By VERONICA JEAN GARCIA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Veronica Jean Garcia

PAGE 3

To my Mom, my Dad, and both of my sisters , and to Alex

PAGE 4

4 ACKNOWLEDGMENTS I thank everyone who have taught me, guided me and helped me to learn how to be a scientist and a greater person. I especially want to thank those that have been there for the long hours, many questions and epic memories.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 12 ABSTRACT ................................ ................................ ................................ ................... 1 6 C H A P T E R 1 PEPTIDES, NEURONS AND CRUSTACEANS ................................ ...................... 18 Neuromodulation of Circuits ................................ ................................ .................... 18 Neuropeptides: Ubiquitous Transmitters for Every Behavior ............................ 20 G Protein Coupled Receptors ................................ ................................ .......... 22 Subfamily A6 of the Rhodopsin Like Family of GPCRs ................................ .... 25 Central Pattern Generators for Understanding Circuit Neuromodulation .......... 29 The Stomatogastric Nervous System: an Ideal Model of Neuromodulation ............ 31 Amine and Peptide Modulation in the STG ................................ ............................. 35 Crustacean Cardioactive Peptide and its Receptor ................................ ................ 40 CCAP in the STNS ................................ ................................ ........................... 43 Preliminary Evidence of CCAPr in C. borealis ................................ .................. 45 2 CELL TYPE SPECIFIC NEUROPEPTIDE RECEPTOR TRANSCRIPT NUMBERS CORRELATE WITH PHYSIOLOGICAL RESPONSE THRESHOLD ... 55 Overview ................................ ................................ ................................ ................. 55 Introduction ................................ ................................ ................................ ............. 56 Material and Methods ................................ ................................ ............................. 58 Animals ................................ ................................ ................................ ............. 58 RNA Isolation and cDNA Construction ................................ ............................. 58 Cloning the Receptor Transcript ................................ ................................ ....... 59 Sequence Alignment and Comparison ................................ ............................. 60 Tissue Distribution of Cb CCAPr Transcript ................................ ...................... 60 Cb CCAPr mRNA Copy Number Quantification of Individual STG Neurons ..... 61 Electrophysiological Recordings ................................ ................................ ....... 61 Current Measurements ................................ ................................ ..................... 62 Statistical Analysis ................................ ................................ ............................ 63 Results ................................ ................................ ................................ .................... 64

PAGE 6

6 The Putative Cancer borealis Crustacean Cardioactive Peptide Receptor ( Cb CCAPr) Belongs to Subfamily A6 within Rhodopsin like GPCRs and is Most Closely Related to Other CCAP and Neuropeptide S Receptors ......... 64 Cb CCAPr mRNA is Expressed in Nervous Tissues and the Gastric Mill 4 Muscle ................................ ................................ ................................ ........... 66 Cb CCAPr mRNA is Expressed at Varying Levels Across Neuron Types in the STG ................................ ................................ ................................ ......... 67 CCAP Acts on the LG to VD Synapse ................................ .............................. 69 Maximal Amplitude and Concentration Dependence of CCAP Elicited I MI Differ Between LP and IC ................................ ................................ .............. 72 Saturating Concentrations of CCAP Activate I MI Maximally in LP, but Not IC ... 74 Discussion ................................ ................................ ................................ .............. 76 Cb CCAPr Codes for a GPCR that has Strong Se quence Similarity to Mammalian Neuropeptide Receptors ................................ ............................ 76 CCAP Targets the LG to VD Synapse ................................ .............................. 78 Cb CCAPr mRNA Transcript Levels Correspond with I MI CCAP Responses ........ 79 Highly Flexible, yet Stable, Circuits with Differential Distribution and Expression of Modulatory Receptors ................................ ............................ 79 3 LONG TERM CHANGES IN EXPRESSION OF CB CCAPR IN THE STOMATOGASTRIC GANLGION ................................ ................................ .......... 94 Introduction ................................ ................................ ................................ ............. 94 Methods ................................ ................................ ................................ .................. 97 Animals ................................ ................................ ................................ ............. 97 Perturbation Paradigms ................................ ................................ .................... 98 mRNA Quantification ................................ ................................ ........................ 98 Electrophysiology ................................ ................................ ............................. 99 LP Excitability Assay ................................ ................................ ........................ 99 I MI CCAP Concentration Response ................................ ................................ .... 100 Circuit Effects of Pe rturbation ................................ ................................ ......... 100 Results ................................ ................................ ................................ .................. 101 CCAP Paradigm LPs Have Significantly Lower Levels of Cb CCAPr Transcript Compared to LTB ................................ ................................ ....... 101 Intrinsic Excitability in LTB Resemble Changes Seen in 24hr Ctl ................... 102 I MI CCAP is Greater in LTB Preparations than in CCAP inc. Prepa rations ......... 103 Evaluation of Paradigms on Network Response to CCAP ............................. 104 Discussion ................................ ................................ ................................ ............ 106 4 GENERAL DISCUSSION AND FUTURE STUDIES ................................ ............. 117 Expanding the STG Connectome: CCAP Modulation in the STG ......................... 117 Cb CCAPr is Differentially Expressed in Neurons of the STG ......................... 117 CCAP Modulate s the Central LG to VD Synapse ................................ ........... 120 Future Localization of Cb CCAPr May Reveal Functional Distribution of the Receptor ................................ ................................ ................................ ...... 121 Cb CCAPr is a GPCR that is Related to Mammalian Peptide Receptors .............. 122

PAGE 7

7 Cb CCAPr is Closely Related to Neuropeptide S and Vasopressin Receptors 122 Cb CCAPr Activates an Inward Current in STG Mo tor Neurons that has Some Similarities with Mammalian and Molluscan Currents ....................... 123 Decentralization Modifies Cb CCAPr Expression in L P ................................ ......... 124 A P P E N D I X A PARTIAL CHARACTERIZATION OF ANTIBODIES GENERATED AGAINST THE C. BOREALIS CRUSTACEAN CARDIOACTIVE PEPTIDE RECEPTOR ..... 127 B IN SITU HYBRIDIZATION IN THE C. BOREALIS STOMATOGASTRIC NERVOUS SYSTEM ................................ ................................ ............................ 146 LIST OF REFERENCES ................................ ................................ ............................. 172 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 192

PAGE 8

8 LIST OF TABLES Table page 2 1 Primers used for synthesis of cDNA. ................................ ................................ ... 81 2 2 Primers used for synthesis of cDNA libraries compatible for RACE .................... 81 2 3 Primers used to describe tissue localized expression of Cb CCAPr. ................... 81 2 4 Primers used for quantification of Cb CCAPr expression in neurons of the STG using qRT PCR. ................................ ................................ ......................... 81 2 5 Accession numbers of select mammalian and arthropod Rhodopsin like receptors, used in multiple alignment. ................................ ................................ 81 2 6 Amino acid percent identity shared between Cb CCAPr and select human receptors, with and without transmembrane domain regions. ............................ 82 2 7 Accession numbers of the 61 protein sequences used in phylogenetic analysis. ................................ ................................ ................................ ............. 82

PAGE 9

9 LIST OF FIGURES Figure page 1 1 The stomatogastric nervous system innervates the stomach of decapod crustaceans ................................ ................................ ................................ ........ 47 1 2 The stomatogastric nervous system, including ganglia, c onnective and peripheral nerves . ................................ ................................ ............................... 49 1 3 The stomatogastric ganglion. ................................ ................................ .............. 50 1 4 The STG connectome produces pyloric and gastric mill rhythms. ...................... 51 1 5 Modulators of the STG arrive through the opthalmic artery or from descending projections of AG neurons. ................................ .............................. 52 1 6 Six neurons in the STG respond to crustacean cardioactive peptide (CCAP). ... 53 1 7 Preliminary single cell PCR reveals putative crustacean cardioactive peptide receptor in STG neurons that respond to CCAP ................................ ................. 54 2 1 Cb CCAPr shares conserved residues and transmembrane domain loci with other vasopressin like receptors.. ................................ ................................ ....... 85 2 2 Within the Rhodopsin like family of GPCRs, Cb CCAPr is most closely related to CCAPr of other arthropods, and mammalian Neuropeptide S receptors ........ 86 2 3 Cb CCAPr is distributed throughout the nervous system and found on some muscles. ................................ ................................ ................................ ............. 87 2 4 Single cell qRT PCR shows that Cb CCAPr is expressed in a subset of STG neurons, and at varying levels between cell types ................................ .............. 88 2 5 CCAP modulates strength and dynamics of the LG to VD graded chemical synapse ................................ ................................ ................................ .............. 89 2 6 CCAP reduces the current response to glutamate application in the VD neuron. ................................ ................................ ................................ ............... 90 2 7 CCAP elicited I MI in LP and IC differs in amplitude and concentration dependence to the maximal current fit value in each experiment ....................... 91 2 8 Addition of proctolin to I MI CCAP reveals cell specific difference in I MI amplitudes. ................................ ................................ ................................ ......... 92 3 1 CCAPr mRNA transcript copy numbers in LP, after four treatments ................ 110

PAGE 10

10 3 2 Intrinsic excitability changes in LP, across paradigms and in response to concentrations of crustacean cardioactive peptide ................................ ........... 111 3 3 I MI CCAP is significantly greater in amplitude in LTB preparations than in CCAP inc. preparations, reflecting changes observed in Cb CCAPr expression. ......... 112 3 4 Current response values normalized to maximum I MI CCAP ............................... 113 3 5 Average number of spikes per 5 min p eriod of pyloric neurons following each perturbation ................................ ................................ ................................ ...... 114 3 6 Pyloric neurons have a substantial decrease in number of spikes after 24hours in physiological saline ................................ ................................ ......... 115 3 7 ed to mean 24hr Ctl measurement ................................ ................................ ................................ .... 116 A 1 Peptide loci within Cb CCAPr amino acid sequence. ................................ ........ 137 A 2 Preliminary studies describing localization of dopamine receptors in STG of H. americanus . ................................ ................................ ................................ . 138 A 3 Pre Immune screen show rabbits 8806 and 8808 as best candidates for inoculation ................................ ................................ ................................ ........ 139 A 4 Dot blot test of sera specificity from rabbits 8806 and 8808, in test bleed #2 ... 140 A 5 Western blot analysis of test bleed #5 sera on STNS protein extract ............... 142 A 6 Immunohistochemical analysis of test bleed #5 in STGs. ................................ . 142 A 7 Negative control stainin g with secondary antibody in cardiac ganglion and STG. ................................ ................................ ................................ ................. 143 A 8 Dilution series of purified antibodies GPCR 1 and GPCR 2 on cardiac and stomatogastric ganglia. ................................ ................................ ..................... 145 A 9 Split blots of purified antibodies on STNS protein extract. ................................ 145 B 1 Probe synthesis and orientation ................................ ................................ ....... 165 B 2 Lateral posterior gastric (LPG) neurons express orcokinin transcripts in the C. borealis STG ................................ ................................ ................................ 166 B 3 Neuropeptide localization in C. borealis brains ................................ ................. 168 B 4 Final trial of the first in situ method fails to detect Cb CCAPr in the STG and cardiac ganglion. ................................ ................................ .............................. 168

PAGE 11

11 B 5 Fluorescent in situ hybridization localizes Orco transcripts to cytoplasm of both LPG neurons in the S TG ................................ ................................ .......... 169 B 6 Orco transcripts expressed by neurons in the commissural ganglia ................. 170 B 7 Orco transcripts expressed by two neurons in the esophageal ganglion. ......... 170 B 8 Final in situ hybridization trial using long term method shows preliminary and promising results ................................ ................................ .............................. 171

PAGE 12

12 LIST OF ABBREVIATIONS 5HT 5 hydroxytryptamine, also known as serotonin AB Anterior burster neuron ACh Acetylcholine AM Anterior median neuron AVP Arginine vasopressin BSA Bovine serum albumin cAMP Cyclic adenosine monophosphate Cb CCAPr Cancer borealis crustacean cardioactive peptide receptor Cb C. borealis beta tubulin CCAP Crustacean cardioactive peptide CCK Cholecystokinin CCKr Cholecystokinin receptor CdCl 2 Cadmium chloride cDNA Complimentary deoxyribonucleic acid CNS Central nervous system CG Cardiac ganglion CoG Commisural ganglion; CoGs plural CPG Central pattern generator DA Dopamine DAr Dopamine receptor DG Dorsal gastric neuron DIG Digoxigenin EC 50 Effective concentration/dose for 50% activation of a response EcR Ecdysteroid receptor

PAGE 13

13 ELH Egg laying hormone ER Endoplasmic reticulum EtOH Ethanol EZ enzyme FisH Fluorescent in situ hybridization FMRFa Peptide: phenylalanine methionine arginine phenylalanine NH 2 GABA Aminobutyric acid Glu Glutamate GM Gastric mill neuron GMR Gastric mill rhythm GNRHr Gonadotropin releasing hormone receptor GPCR G protein coupled receptor GRAFS GPCR classification: Glutamate, Rhodopsin, Adhesion, Frizzled, and Secretin H 2 O 2 Hydrogen peroxide I A Transient p otassium current IC Inferior cardiac neuron I Ca . Calcium current ICC Immunocytochemistry I h Hyperpolarization activated inward current IHC Immunohistochemistry I Kd D elayed rectifier potassium current Ile Amino acid, isoleucine I MI Modulator activated inward current I MI CCAP Modulator activated inward current, activated by CCAP

PAGE 14

14 I MI Proc Modulator activated inward current, activated by proctolin Int1 Interneuron 1 K D Dissociation constant of a ligand LG Lateral gastric neuron LP Lateral pyloric neuron LPG Lateral posterior gastric neuron MG Medial gastric neuron NGS Normal goat serum NMJ Neuromuscular junction NPS Neuropeptide S NPSr Neuropeptide S receptor; isoforms A and B OG Oesophageal ganglion ORX Orexin; isoforms A and B ORXr Orexin receptor; subtypes 1 and 2 OXT Oxytocin OXTr Oxytocin receptor PBS Phosphate buffered saline PCR Polymerase chain reaction PD Pyloric dilator neuron Phe Amino acid, phenylalanine Pro Amino acid, proline Proc Proctolin PTW 1X PBS, 0.1% Tween 20 PTX Picrotoxin PY Pyloric neuron

PAGE 15

15 qRT PCR Quantitative Real time Polymerase chain reaction RACE Rapid amplification of cDNA ends RPCH Red pigment concentrating hormone, also known as the crustacean erythrophore concentrating hormone STG Stomatogastric ganglion s tn Stomatogastric nerve STNS Stomatogastric nervous system TEA Tetraethylamonium TG Thoracic ganglion TMD Transmembrane domain TSA Tyramide signal amplification TTX Tetrodotoxin V1Ar Vasopressin 1A receptor V1Br Vasopressin 1B receptor V2r Vasopressin 2 receptor VD Ventral dilator neuron

PAGE 16

16 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NEUROPEPTIDERGIC MODULATION IN THE STOMATOGASTRIC NERVOUS SYSTEM: CLONING, EXPRESSION AND PHYSIOLOGICAL CHARACTERIZATION OF THE CRUSTACEAN CARDIOACTIVE PEPTIDE RECEPTOR By Veronica Jean Garcia December 2014 Chair: Dirk Martin Bucher Major: Medical Sciences Neuroscience Neural networks are anatomically hard wired in the adult animal, but are capable of extensive plasticity and flexibility, while still maintaining functional integrity. The source of this flexible network activity arises from neuromodulators and the expression of their cognate receptors. Both vertebrate and invertebrate neural systems use neuromodulators, such as monoamines and neuropeptides, to modify intrinsic properties and synapses of a network to create a diverse repertoire of behaviors. The stomatogastric ganglion is an ideal system for investig ating peptide modulation due to its accessible, individually identifiable neurons, and modulatory effects on rhythm generation. Despite the 100+ peptide s that have been identified in the system, no receptors have been described, and the theory of peptide modulation in the network rests at a binary, differential distribution of receptors, all of which converge to activate the same ionic current. In this th esis, I identify the first crustacean neuropeptide receptor and describe distribution and physiology of the receptor with respect to individual neurons and network perturbation in the STG.

PAGE 17

17 The Cancer borealis crustacean cardioactive peptide receptor ( Cb CC APr) is expressed in all nervous tissues in the animal and one muscle tissue examined. In the STG, the Cb CCAPr transcript is present in each neuron that responds to the receptor ligand, and is expressed at significantly different levels. In two identified cell types, different transcript levels correspond to differences in the maximal conductance and EC 50 of the modulator activated inward current, I MI . Cb CCAPr is also expressed in a single neuron that does not respond to CCAP with the activation of I MI , but instead shows effects on synaptic currents . Perturbation of the network results in changes in expression of the receptor in an identified neuron which correspond to changes in I MI activation . Phylogenetic analysis of the receptor sequence strongly su pports receptor identity according to the relationship to insect homologues and related mammalian neuropeptide receptors. The results presented in this thesis expand the understanding of GPCR mediated circuit modulation by showing that even in local circuits there are cell type specific quantitative differences in receptor expression and physiological responsiveness. In addition, these results strongly sugg est the presence of activity dependent regulation of GPCR mediate d neuromodulation.

PAGE 18

18 CHAPTER 1 PEPTIDES, NEURONS AND CRUSTACEANS Neuromodulation of Circuits The survival of every animal depends upon its nervous system. From the simple neural nets of the cnidarians to the complex tripartite brain of vertebrates, intricate systems for interaction with its environment. Nervous systems grow and change throughout development of the animal ( Marder, 2002 ; Kiehn and Butt, 2003 ) , but by the adult stage, neurons are formed into relatively anatomically hard wired networks with connectivity to efferent and afferent neurons to fulfill specific functional roles. Even though the anatomy of healthy adult nervous systems no longer undergoes major changes, the animal is still able to adapt and conform to novel stimuli or challenges, demonstrating great flexibility in the networks while conserving their functional integrity ( Marder, 2012 ) . The flexibility of n ervous systems is derived from the intrinsic neuronal dynamics, synaptic plasticity, and neuromodulation ( Marder and Bucher, 2007 ; Marder, 2012 ; Nadim and Bucher, 2014 ) . Extrinsic influences from environmental stimuli, in the form of neuronal input or neuromodulators, can cause changes in any of these three components to result in adaptation or new behaviors. Likewise, intrinsic modulators arising from int ernal cues are able to initiate network responses for behaviors such as feeding or arousal ( Chemelli et al., 1999 ; Sakurai, 1999 ) . These changes in networks can be generated over two different time scales: short term (milliseconds to a few minutes) such as those seen in synaptic modulat ion, or long term (minutes to months) through the induction of gene expression and protein translation in the target neurons .

PAGE 19

19 Neuromodulation also elicits a multitude of behaviors from hard wired circuits by way of modulator release, including diffuse and hormonal pathways. Diffuse release occurs when modulators are synthesized in neurons that send projecting neurites to several nervous tissues or nuclei. An example in the mammalian central nervous system (CNS) would be the dopaminergic modulation of rewar d, cognition and motor behaviors ( Arias Carrion et al., 2010 ) . Dopamine (DA) that is synthesized in neurons of the ventral tegmental area in the midbrain is transport ed to release sites at the nucleus accumbens, which primarily functions in reward motivation ( Salamone and Correa, 2002 ) and the prefrontal cortex, a primary center for higher level cognitive tasks ( Miller and Cohen, 2001 ) . The hypothalamus of the vertebrate CNS is a key proponent in hormonal modulation and releases molecules into the circulating cerebral spinal fluid and blood stream. Neurons with somata located in the hypothalamus send projections to the p ituitary gland and release various hormones, including vasopressin, oxytocin, cholecystokinin, gonadotropin releasing hormone and transmitters such as DA, among others ( Beinfeld et al., 1980 ; Mezey et al., 1 986 ; Caldwell et al., 1987 ; Nambu et al., 1999 ) . Several of these hormones are not only co expressed in the hypothalamo neurohypophysial system but are also coreleased with other peptides or neurotransmitters ( Jirikowski et al., 1991 ; Jirikowski et al., 2005 ) . Simultaneous diffuse and hormonal signaling to several areas of the body and nervous system allows the recruitment of multiple behaviors ( Bondy et al., 1989 ) . Studies of neuromodulation in invertebrate systems like the crustacean stomatogastric nervous system have revealed some general principles of circuit modulation which apply to vertebrate systems as well ( Marder and Thirumalai, 2002 ;

PAGE 20

20 Nadim and Bucher, 2014 ) . First, in any given system, one modulator may activate only one type or population of neurons and is inert on surrounding neurons. The selectivity of a neuron is caused by the expression of receptors for the particular ligand, and the response generated can be influenced by the intrinsic properties that are present (e.g. ion channels and calcium stores). Second, the same modulator can act ivate a response signal conduction cascades activated upon ligand binding. Third, a single neuronal population or cell type can respond to several, different modulators. The promiscuity of the neuron arises from the expression of multiple receptors, and allows the recruitment of a particular network to several behaviors. And fourth, neu romodulators do not just convey simple increases or decreases in excitability and synaptic strength but can induce qualitative changes in neuronal activity and synaptic plasticity. Therefore, in order to understand neuromodulatory activation of neural cir cuits, a quantitative understanding of multiple, neuron specific converging and diverging effects is needed. Neuropeptides: Ubiquitous Transmitters for Every Behavior Found throughout the animal kingdom are one of the most common classes of transmitters used by neurons and tissues: neuropeptides. These modulators are larger than classical and small molecule transmitters, such as single amino acids or monoamines, and are made up of 3 to 100 amino acid residues ( Salio et al., 2006 ) . Neuropeptides begin as freshly translated preprohormones that are then post translat ionally modified into prohormones and passed into the lumen of the endoplasmic

PAGE 21

21 reticulum. Enzymes then cleave a signal peptide from the prohormone, creating an active prohormone that is then directed to the Gogli apparatus for packaging. Once in vesicles, the prohormone undergoes cleavage that can result in a single active peptide, multiple copies of the same peptide, different peptide isoforms, or different peptides entirely. Vesicles containing neuropeptides are distinguished by their morphology in electr on microscopy and aptly called dense core vesicles ( Salio et al., 2006 ) . The mature peptides will remain in the vesicle until release into the extracellular space by exocytosis. In the case of neuropeptides, release is catalyzed by high intracellular levels of calcium that r esult from excitation at the terminal. There is much information about the physiology of neuropeptides with respect to nervous systems. Compared to small molecule transmitters, neuropeptides are much larger and contain several more binding motifs, makin g receptors of neuropeptides significantly more selective and capable of higher binding affinities ( Salio et al., 200 6 ) . Neuropeptides also diffuse more slowly than their small transmitter counterparts, and target surrounding neurons almost exclusively through paracrine signaling ( Salio et al., 2006 ; Merighi et al., 2011 ) . The method of peptide removal in the extracellular space is through degradation by peptidases, versus the reuptake mechanisms common for small molecules. Interestingly, neuropeptides are also most often released in tandem w ith small molecule transmitters ( Merighi, 2002 ; Merighi et al., 2011 ) , providing a slower, longer lasting modulatory tone while small molecule transmitters are associated with either faster or slow signaling. This modulatory tone set by neuropepti des also adjusts dependent reaction to additional modulators ( Dickinson et al., 1997 ; Taghert and Nitabach, 2012 ) . The

PAGE 22

22 prevalence of neuropeptide signa ling in the central nervous system has also encouraged several bouts of investigation into localization and description of these receptors and their functions ( Merighi et al., 2011 ; Salio et al., 2011 ) . Neuropeptides are involved in nearly all brain states and behaviors, ranging from hunger and arousal, to reproductive behaviors, depression and pain sensation ( Salio et al., 2006 ; Lesniak and Lipkowski, 2011 ) , and individual neuropeptides can have pleiotropic effects caused by the distribution and subtype of their cognate receptors, as well as promiscuity o f non selective receptors ( Ta ghert and Nitabach, 2012 ) . The myriad of networks, behaviors and targets associated with neuropeptides makes it unsurprising that many neuropeptides have been associated with diseases and disorders ( Harony and Wagner, 2010 ; Equihua et al., 2013 ; Yeoh et al., 2014 ) . It is well documented that neuropeptides commonly bind to G protein coupled receptors (GPCRs) located on the cellular membrane of target neurons ( Salio et al., 2006 ; Merighi et al., 2011 ) , and through signal transduction cascades cause changes in intracellular calcium or cyclic nucleotide levels, leading to a variety of changes in cell excitability or gene expression. However, even wit h advances of mRNA expression assays, transgenic knockdowns, or pharmacological manipulations ( Okaty et al., 2011 ) , the subcellular mechanisms leading to the network wide effects elicited b y peptides acting on individual neurons remains mostly unclear. G Protein Coupled Receptors G protein coupled receptors (GPCRs) are one of the largest protein super families and participate in the most diverse functions. They are inserted into the plasma membrane of a cell, or intracellular membranes ( Gobeil et al., 2006 ) , and cover such a

PAGE 23

23 broad array of functions and amino acid compositions that they seem to have only two unifying conventions: the general structure, and their diverse roles in signal transduction and modulation of tissues, including neurons. GPCRs are an a ncient tool utilized by organisms for sensing their internal and external environment and are present in all eukaryotes ( King et al., 2003 ) . The structure of a GPCR is the most identifiable characteristic when it comes to similarity in amino acid compos ition ( Bockaert and Pin, 1999 ) , regardless of the species. GPCRs are comprised of seven alpha helical transmembrane (TM) domains, with an external amino terminus and internal carboxyl terminus, connected by three loops on the intracellular and extracellular side of the membrane ( Wess, 1997 ) . Typically, a ligand or molecule binds to the extracellular portion of the receptor, near the amino terminus, and causes a conformational change in the seven helices of the core domain, result ing in a cascade of intracellular signaling molecules ( Wess, 1997 ; Wess et al., 1997 ) . The residues at the second intracellular loop and TM3 junction, D R Y, have been indi cated in particular to affect the activity of the receptor and are conserved across phyla and receptor type ( Wess, 1997 ; Clark et al., 2004 ) . Classification schemes for such diverse proteins as GPCRs have been crucial for comparison of receptors identified in different species and with different functional roles, and these schemes have evolved alongside the increasing discoveries of new receptors. Most recently, and the current model of classification, divides GPCRs into five families: Glutamate, Rhodopsin, Adhesion, Frizzled/Taste2 and Secretin (GRAFS) ( Schioth and Fredriksson, 2005 ) . This classification scheme is based up on human

PAGE 24

24 phylogenetic analysis, but is still applicable to other species, although expansions before mammalian lineages have been identified and some receptors remain outside of the scheme ( Bjarnadottir et al., 2006 ) . In fact, it is important to note that the human genome c ontains 1,265 GPCRs, while the genome of the tiny ecdysozoan C. elegans expresses 1,308 ( Insel, 2011 ) . The largest class of GPCRs, the Rhodopsin like family or class A, is further subdivided into 19 different families according to sequence homology, function and ligands ( Joost and Methner, 2002 ) . Of particular interest to this thesis is the receptor subclass A6, which includes peptide ligands and pleiotropic functions that will be reviewed later. GPCR activity can be measured in native tissue or heterologous expression systems through the use of concentration response experiments. When a population of receptors is exposed to increasing concentrations of a ligand, there will be a n associated degree of response that is activated in the case of agonists, or inhibited when using antagonists. The response can be several things, such as heart rate, fluorescent reporter proteins, or an ionic current. When plotted on a logarithmic scale, these measurements of response over concentration of the ligand generate a sigmoid If a ligand shifts the curve to the right, it is considered less potent because higher concentrations are required to achieve the same percent response, which could indicate fewer receptors. Additionally, if a ligand fails to plateau at the maximal response generated by the original ligand, then it has decreased efficacy. The effective dose for 50% of the tot al response (EC 50 ) is also taken from the response curve and is equivalent to the dissociation constant and receptor affinity for the ligand. The slope of the curve

PAGE 25

25 describes the percent change over a range of concentrations (i.e., the steeper the slope, t he smaller the range). Not surprisingly, due to their copious functional roles and distribution in nearly every tissue type, defects in the regulation and activity of many GPCRs have been implicated in a number of pathologies, ranging from cancer and hypertension, to auto immune diseases and psychiatric disorders ( Dorsam and Gutkind, 2007 ; Harris et al., 2008 ; Nickols and Conn, 2014 ) . In 2006, out of 20,000+ products approved by the Food and Drug Administration, at least 26.8% directly target Rhodopsin like GPCRs ( Overington et al., 2006 ) . Unbiased sequencing platforms coupled with quantitative analys is have allowed better identification of GPCRs for drug targets, and have also shed light on functional roles based upon their anatomical expression ( Regard et al., 2008 ; Snead and Insel, 2012 ) . However, pro cessing tissues and describing expression patterns of receptors can mute differential distribution and skew quantification of the actual expr ession ( Arriaga, 2009 ) , while additionally ignoring the physiological functions of a GPCR in the context of network activity. Subfamily A6 of the Rhodopsin Like Family of GPCRs Members of the Rhodopsin like family of GPCRs can be found in all eukaryotes ( Fredriksson and Schioth, 2005 ) . The Rhodopsin like family includes olfactory receptors and metabotropic receptors for most transmitters (acetylcholine, monoamines, neuropeptides, p urines, and endocannabinoids) . Depending on the analysis and data sets used, the Rhodopsin like family can be further divided into a number of subgroups. In one study, focusing primarily on human GPCRs, 19 subgroups were ident ified using combinations of ph ylogenetic analysis method s ( Joost and Methner, 2002 ) . Another study used genomes from protostomes, deuterostomes, plants and fungi which divided

PAGE 26

26 the class into 13 subgroups ( Fredriksson and Schioth, 2005 ) . Despite some differences between categorization methods, one subclass was apparent in both: the group A6 ( Joost and Methner, 2002 ) which contain s GPCRs whose ligands are neuropeptides ( Fredriksson et al., 2003 ) . Several of the receptors grouped in the subfamily A6 participate in social communication, anxiety , arousal or feeding behaviors. The very first neuropeptide identified , and whose receptor is classified in the A6 subgroup, is the hormone arginine vasopressin ( Oliver and Schafer, 1895 ) . Arginine vasopressin (AVP) was found to have an effect on blood pressure and osmoregulation, and it is a cyclic peptide made up of the nine amino acids that are joined by a disulfide bridge between the two cysteine residues ( Turner et al., 1951 ) . AVP is fo und in nearly all mammals, and is predominantly synthesized in the magnocellular cells of the paraventricular nuclei and h ypothalamic supraoptic nucleus. Neural projections to the posterior pituitary gland and throughout the CNS allow it to act hormonally as well as locally ( Brownstein et al., 1980 ) . In mice and h umans, a single copy of AVP is spliced from a prohormone transcribed from the avp gene ( Burbach et al., 2001 ) . In the central nervous system, AVP binds to two of its three receptors, the arginine vasopressin 1a (V1Ar) and arginine vasopressin 1b (V1Br) receptors. Through pharmacology and transgenic experiments, these receptors and AVP have been i mplicated in a series of behaviors including aggression ( Wersinger et al., 2007 ) and social recognition ( Caldwell et al., 2008 ) , and i n humans, anxiety and depressive disorders ( Inder et al., 1997 ; van Londen et al., 1997 ) . Similar in function to AVP is the peptide oxytocin (OXT). OXT is transcribed and spliced as a single copy from a gene lying on the same chromosome as AVP in human

PAGE 27

27 and mouse ( Caldwell et al., 2008 ) . OXT is a cyclical nonapeptide that differs from AVP by only two residues, and both li kely diverged from a common ancestor by gene duplication , with homologs present in s everal invertebrates and vertebrate species ( Van Kesteren et al., 1995 ; Caldwell et al., 2008 ; Stafflinger et al., 2008 ; Gruber, 2014 ) . OXT is synthesized and released by neurons located in the same hypothalamic nuclei as AVP, which send projections either to the post erior pituitary gland or throughout the brain. Only one oxytocin receptor (OXTr) has been identified, and it is expressed throughout the body and in highly species specific regions of the brain, such as mammillary nuclei, substantia nigra pars compacta , and basal nuclei ( Gimpl and Fahrenholz, 2001 ; Harony and Wagner, 2010 ) . In the CNS OXT is strongly involved with maternal bonding, social affiliation and sexual behaviors ( Lee et al., 2009a ; Ishak et al., 2011 ) . Due to the roles of OXT, AVP and their corresponding receptors in social behaviors, they have become a focus of research towards treatment of autism spectrum disorders (ASD ) ( Wassink et al., 2004 ; Yirmiya et al., 2006 ; Lee et al., 2009a ; Lee et al., 2009b ; Harony and Wagner, 2010 ; Lukas and Neumann, 2013 ) . Another peptide and receptor in the A6 subgroup that has been associated wi th neuropsychiatric disorders is neuropeptide S (NPS) ( Xu et al., 2004 ; Domschke et al., 2011 ; Tupak et al., 2013 ) . Much larger than OXT and AVP, NPS is composed of 20 am ino acids and is strongly conserved across vertebrate species with only one to three differences in residues ( Xu et al., 2004 ) . The receptor for NPS (NPSr) is transcribed from the gene npsr1 and undergoes splicing to result in multiple isoforms. Interestingly, initial findings described similarity betw een NPS receptors and AVP receptors, but more recent data have revealed that NPSr is more closely related to the cardioactive peptide

PAGE 28

28 receptors found in insects, than to vertebrate AVP receptors ( Li et al., 2011 ; Pitti and Manoj, 2012 ) . Since the discovery of NPS/r, roles in several areas of CNS modulation have been shown, including modulation of anxiety, arousal, fear, alcohol use disorders and consumption, feeding, and panic disorders ( Smith et al., 2006 ; Okamura and Reinscheid, 2007 ; Donner et al., 2010 ; Pape et al., 2010 ; Domschke et al., 2011 ; Tupak et al., 2013 ; Laas et al., 2014 ) . Similarly implicated in anxiety and sleep disorders are the orexin peptides. Also known as hypocretin, orexin (ORX) is present in two forms that share 49% sequence identity, ORX A and ORX B ( Sakurai et al., 1998 ; Sakurai et al., 1999 ) . T wo receptors for ORX have been identified, ORXr1 and ORXr2, which share 64% sequence identity and are expressed in distinct brain regions. ORXr1 bind s to both forms of ORX, but with significantly less affinity for ORX B, while ORXr2 is nonselective ( Sakurai et al., 1998 ) . The expression of ORX is confined to the hypothalamus and perifornical area, w hile projections from orexinergic neurons are diffuse throughout the brain ( Rui, 2013 ; Yeoh et al., 201 4 ) . ORX was originally identified as having a role in feeding behavior due to its loca lization in the brain ( Sakurai et al., 1998 ) , but it also has strong implications for modulating the transiti ons between sleep/wake cycles and promoting arousal, making it a target for treatment of narcolepsy and insomni a ( Chemelli et al., 1999 ; Herring et al., 2012 ; Equihua et al., 2013 ; Mignot, 2014 ; Yeoh et al., 2014 ) . Yet another peptide with functional roles in feeding, as well as neuropsychiatric disorders, is the peptide cholecystokinin (CCK). CCK is a family of neuropeptides encoded by a single gene, but post translationally splice d from a prohormone that result s in peptides of different lengths, with the most abundant forms in the CNS being

PAGE 29

29 the octapeptide (CCK8) , and the tetrapeptide ( CCK4 ) ( Zwanzger et al., 2012 ) . CCK binds to two receptors, CCKrA a nd CCKrB, with CCKrA binding to both the octa and tetrapeptide, but CCKrB is selective for CCK4. Populations of CCKergic neurons are found in the hippocampus, cortex, amygdala, striatum and hypothalamus ( Beinfeld et al., 1980 ; Zwanzger et al., 2012 ) . Originally identifie d as a hormone solely involved in digestion and nutrient storage, CCKergic projections are shown to overlap with neuroatomical regions implicated in fear response circuitry, owing its role in anxiety and panic disorders ( Bradwejn et al., 1990 ; Rotzinger et al., 2010 ; Zwanzger et al., 2012 ) . While each of the aforementioned neuropeptides influence specific behaviors, and are expressed in distinct tracts and areas of the brain, many of these individual roles are overlapping. In addition, several of tho se neuropeptides are released in close proximity to each other or act synergistically on target neurons ( Mezey et al., 1986 ; Bondy et al., 1989 ) . Redundancy in modulation of systems that are vital to the survival and reproduction of the organism may be part of a homeostatic mechanism that has evolve d successfully in both vertebrates and invertebrates. It therefore stands to reason that elucidating the characteristics of a receptor class in less complex systems could provide valuable information towards the function of homologs in other systems. Central Pattern Generators for Understanding Circuit Neuromodulation The extensive reach and pleiotropic effects of neuromodulators make their use in nervous systems incredibly efficient, but it also greatly confounds the ability to study their effects in vivo . M odulatory systems such as the mammalian dopaminergic or vasopressinergic pathways, which originate in specific areas of the brain but have diffuse projections ( Caldwell et al., 2008 ; Puig et al., 2014 ) , are difficult to study when focused on the mechanisms behind network and cellular involvement. Studies of these

PAGE 30

30 diffuse systems are often restricted to the endpoint behavior, but overlook the individual changes in the neurons or cell types oc curring at the network. R hythmic motor b ehaviors, such as respiration, locomotion or mastication, provide an excellent test bed for understanding the effects of neuromodulation at the cellular and network levels, provided an accessible model system . The b asic rhythmic activity underlying repetitive mot or behaviors are generated by neuronal circuits known as central pa ttern generators ( CPGs ). Isolated CPG circuits, when properly activated, generate rhythmic activity in the absence of timing information from sensory or descending inputs ( Marder and Buch er, 2001 ) . CPG activity can either depend on pacemaker neurons (i.e. neurons that are intrinsic oscillators) or arise purely from network interactions of non oscillatory neurons. In some cases, neuromodulators are required for even basic activation of C PGs, but in all cases the specific patterns produced depend on the tuning of synaptic and intrinsic neuronal properties by neuromodulators ( Marder and Bucher, 2007 ; Harris Warrick, 2011 ; Marder, 2012 ) . Consequently, neuromodulators may silence, initiate, adjust or coordinate the activities of one or multiple CPGs ( Weimann et al., 1997 ; Johnson et al., 2003 ; Kristan et al., 2005 ; Kirby and Nusbaum, 2007 ; Grashow et al., 2009 ) . Most often, CPG s are comprised of a network of interneurons that synapse onto each other and onto motor neu rons that execute the motor pattern and behavior through innervation of muscles ( Marder and Bucher, 2001 ) . Intrinsic properties of the neurons involved play an important role in rhythm generation, as these properties determine the response of a neuron to modulatory or synaptic input. Examples inclu de postinhibitory

PAGE 31

31 rebound, spike frequency adaptation and endogenous bursting ( Marder and Bucher, 2007 ; Goulding, 2009 ) . As su ch properties strongly depend on neuromodulators, disruption or removal of neuromodulatory input has severe consequences for network operation, for example in the context of spinal cord injury ( Thoby Brisson and Simmers, 1998 ; McClellan et al., 2008 ) . In spinal cord injury, although no serotonin is found below the lesion site, serotonin type 2 receptors can become constitutively active and can aid in the recovery of locomotion in rat models ( Fouad et al., 2010 ) . A better understanding of the cellular processes occurring in the orphaned network would provide insight towards optimal therapeutic strategies. The Stomatogastric Nervous System: an Ideal Model of Neuromodulation Invertebrate model systems are especially advantageous for studying network organization and circuits due to their relative numerical simplicity, individually identifiable n eurons, and experimental accessibility. The stomatogastric nervous system (STNS) of decapod crustaceans is one such example ( Nusbaum and Beenhakker, 2002 ; Marder and Bucher, 2007 ; Harris Warrick and Johnson, 2010 ; Harris Warrick, 2011 ; O'Leary and Marder, 2014 ) . Innervating skeletal muscles of the stomach, the STNS is responsible for the rhythmic movements associated with processing of food in (Fig. 1 1) ( Selverston AI, 1987 ) . The American lobster, ( Homarus americanus ), the California spiny lobster ( Panulirus interruptus ), and the Jonah crab ( Cancer borealis ) have been studied for decades to understand general principles of cellular and network dynamics and organization, with the goal of applying these findings to more complex nervous systems ( Selverston et al., 1976 ; Selverston AI, 1987 ) . While most features of the STNS are conserved across species, such as function and cellular

PAGE 32

32 identity, several differ ences do exist ( Fenelon et al., 2004 ) , particularly with respect to the effects of modulators. The STNS generates four rhythms of the foregut, including the esophageal, cardiac sac, gastric mill and pyloric rhythms ( Maynard DM, 1974 ; S elverston et al., 1976 ) . It is an extension of the CNS and is composed of four ganglia, their interconnecting nerves, and the nerves that innervat e muscles of the sto mach (Fig. 1 1). The esophageal ganglion (OG) is located dorsomedially and connect ed to the paired commissural ganglia (CoGs) on either side of the esophagus, all three of which are located anterior to the stomatogastric ganglion and wi ll be referred to as the anterior ganglia (AG ) (Fig. 1 2). Th e stomatogastric ganglion (STG) contains two interconnected CPGs that are responsible for generating the gastric mill and pyloric rhythms ( Selverston et al., 1983 ; Weimann et al., 1991 ) . Because the majority of the CPG neurons are also motor neurons, electrical activity of each neuron can be isolated at their respective nerve terminal without the use of invasive, intracellular re cordings. The STG comprises 24 to 32 neurons, a number that is variable dependent upon from 30 to 70 µm in diam eter (Fig. 1 3) ( Bucher et al., 2007 ) . All neurons of the STG have been individually identified by their biophysical properties, conne ctivity to other STG neurons, and by which muscles they innervate ( Selverston et al., 1998 ) . Two cell types, the anterior burster (AB) and inte rneuron 1 (Int1) are interneurons, as they do not innervate muscles and instead synapse centrally onto other STG neurons and send ascending axons to the commissural ganglia. Synapses between STG neurons are localized to fine processes of the neuropil, desc ribed by electron micro scopy ( Maynard,

PAGE 33

33 1972 ) , and also demonstrated by synaptotagmin staining in figure 1 3. T he primary neurotransmitters are glutamate (Glu) and acetylcholine (ACh), depending on the cell type, with majority of the neurons being glutamatergic (Fig. 1 4 ) ( Selverston AI, 1987 ; Selverston et al., 1998 ) . Neuromuscular transmitters are also either ACh or Glu, both of which are excitatory at the muscle, and are distributed in general with intrinsic muscl es receiving glutamatergic innervations and extrinsic muscles receiving cholinergic innervation ( Marder, 1974 ; Selverston AI, 1987 ) . Centrally, both glutamatergic and cholinergic connections are graded inhibitory synapses in the STG. Electrical coupling is also described between specific neurons of the STG, including the three pacemaker neurons and several others indicated in figure 1 4 ( Maynard, 1972 ; Selv erston, 1975 ) . Innexin proteins th at are responsible for gap junctions and homologous to the vertebrate connexins, have been cloned and described in STG neurons as well ( Ducret et al., 2006 ) . Six cell types form the pyloric network and are led by the pacemaker kernel composed of two copies of the pyloric dilator (PD) neurons and the AB neuro n (Fig. 1 4). Follower neurons burst in rebound from inhibition from the pacemaker kernel and also form electrical and inhibitory chemical synapses amongst each ot her, which gives rise to a triphasic rhythm. The pyloric rhythm is very regular and continuously active in the presence of modulatory input ( Maynard, 1972 ; Selverston et al., 1998 ; Hooper et al., 2009 ) . The pyloric rhythm has a cycle frequency of about 1 Hz but can vary across preparations, and yet the phase of activity is maintained across individuals and growth ( Bucher et al., 2005 ; Goaillard et al., 2009 ) , and is comparable to the phases and activ ity measured in vivo ( Clemens et al., 1998 ) . Seven cell types form the gastric mill

PAGE 34

34 network that drives the slower rhythm of the gastric mill ( Heinzel et al., 1993 ) . When dissected from the animal and placed in a petri dish, the pyloric rhythm remains constant whereas the gastric mill rhythm is only sometimes spontaneously active (Fig. 1 4) ( Selverston et al., 1976 ; Bucher et al., 2006 ) . These two rhythms are distinct but interact ( Bucher et al., 2006 ) ,. The re latively large soma size allows the measurement of molecular properties through single cell quantitative real time polymerase chain reaction (qRT PCR). Potassium channel transcripts shal (Kv4), shab (Kv2), shaker, shaw , and BK KCa (Kv3), the hyperpolariza tion activated cation current channel transcript IH , and the voltage gated sodium channel transcript para have been measured in P. interruptus and/or C. borealis ( Baro et al., 1996a ; Baro et al., 1996b ; Schulz et al., 2006 ; Schulz et al., 2007 ) , and linear relationships between the transcript levels and the magnitudes of the ionic conductances have been found for each ( Baro et al., 1997 ; Schulz et al., 2006 ) . Remarkably, despite very stereotyped electrical activity, the mRNA expression and conducta nce levels are highly variable in identified neurons across different individuals ( Schulz et al., 2006 ; Schulz et al., 2007 ) . By comparing multiple ion channel expression levels, cell type specific patterns of expression and cor relations between channels were described ( Schulz et al., 2007 ) . This cell type specific expression and correlation likely explains how similar network activity can be achieved, despite the high variability in underlying intrinsic and synaptic conductance parameters ( Prinz et al., 2004 ; Goaillard et al., 2009 ) . Interindividual variability is thought to arise from homeostatic long term regulation of synaptic and intrinsic conductances that can arise from both activity dependent and independent mechanisms ( Marder and Goaillard,

PAGE 35

35 2006 ; O'Leary et al., 2013 ) . F or example, overexpression of shal ( I A ) leads to a compensatory increase in I H , even when expressing a non functioning channel protein, which suggests that more than just activity coordinates ionic channel conductance and expression ( MacLean et al., 2003 ; MacLean et al., 2005 ) . In addition, there is good evidence that neuromodulato rs play a role in the expression of homeostatic regulation ( Mizrahi et al., 2001 ; Khorkova and Golowasch, 2007 ; Zhang et al., 2009 ; Zhang and Golowasch, 2011 ; Temporal et al., 2012 ) . Amine and Peptide Modulation in the STG The STG is modulated by a multitude of substances, including neuropeptides and amines, either from descending in put from the anterior ganglia, or by release into the hemolymph by the pericardial organs (POs) surrounding the heart (Fig. 1 1) . The POs are one of the primary neurosecretory structures in crustaceans and as a result the hemolymph and POs have been studied extensively as a source of modulators for the STNS using mass spectrometry and immunohist ochemistry ( Christie et al., 1995 ; Li et al., 2003 ; Chen et al., 2009 ; Ma et al., 2009 ; Hui et al., 2012 ) . Coupled with immuno reactivity observed in descending neurons of the AG and the neuropil of the STG, over 100 different modulators and isoforms have been desc ribed (Fig. 1 5) ( Marder et al., 1986 ; Goldber g et al., 1988 ; Skiebe et al., 1999 ; Skiebe et al., 2002 ; Skiebe et al., 2003 ; Billimoria et al., 2005 ; Marder, 2012 ) . Decentralization of the STG, by cutting or blocking the stn and removing descending modulatory inputs from the AG, disrupts the pyloric and gastric mill rhythms, and causes the neurons to fire tonically, or become silent ( Flamm and Harris Warrick, 1986 ; Selverston AI, 1987 ; Thoby Brisson and Simmers, 1998 ) . Subsequent application of many of the modulators to the quiescent preparation has led to the discovery that individual modulators elicit distinct versions of the pyloric

PAGE 36

36 and gas tric mill rhythms ( Hooper and Marder, 1984 , 1987 ; Weimann et al., 1993 ; Weimann et al., 1997 ; Swensen and Marder, 2001 ; Szabo et al., 2011 ) . The presence of so many modulators that cause distinct effects on the STG naturally raises the possibility of comodulation. At any point in time in vivo the STG will be exposed to several different modulators at once, and the network response would arise from the combinatio P. interruptus STG the peptide proctolin is unable to activate the cardiac rhythm in a silenced preparation, but when applied shortly after the perfusion of another peptide, red pigment concentration hormone (RPCH), it could activate the rhythm. This demonstrates state dependent activity, where a modulator adjusted the response of the network to another modulator ( Dickinson et al., 1997 ) . Cotransmission of proctolin with differential sets of small molecules by t hree projection neurons from the AG, with the addition of different target neurons, causes distinct network responses as well ( Blitz et al., 1999 ) . With the information gained from studies of network activity, it becomes clear that in a model system in which neurons are individually identifiable, examination of cellular modulator effects should reveal me chanisms underlying network responses. Towards describing individual effects of modulators on neurons in the STG, a pattern of modulation has emerged that is based upon the classification of the modulator itself, speci fically either being a mono amine or a neuropeptide. In general, monoamines appear to act on all cell types present and change both synaptic strengths and the gating properties of multiple intrinsic voltage gated ion channels in each cell ( Harris Warrick and Johnson, 2010 ) . The subset of ion channel targets, as well as the sign of the effect, is cell type specific. Therefore, aminergic modulation is convergent at

PAGE 37

37 the network level, but divergent at the level of individual neurons. The opposite is true for a number of neuropeptide effects studied in the STG ( Swensen and Marder, 2000 , 2001 ) . Each peptide acts on specific subset of neur ons in the network, but within each neuron type, all peptides appear to act on a single type of voltage gated current, the modulator activated inward current, I MI ( Golowasch and Marder, 1992 ) . Therefore, neuropeptide e ffects are divergent at the network level, but convergent at the level of single neurons. There are only a few cases described where peptides also act on synapses ( Thirumalai et al., 2006 ; Zhao et al., 2011 ) or other intrinsic currents ( Rodriguez et al., 2013 ) . Best understood are the effects of d opamine (DA) in the STG of P. interruptus . In preparations with an ongoing pyloric rhythm, DA enhance s the cycle frequency ( Flamm and Harris Warrick, 1986 ) . DA acts on every neuron in the STG, but with diverse functions. For some, such as PD and VD, dopamine has an inhibitory affect, while in LP it is excitatory ( Flamm and Harris Warrick, 1986 ) . These diverse effects are achieved through differ ential modulation causing changes in voltage dependence, and increasing or decr easing the conductance of several membrane curre nts in almost every neuron , including I A , I Kd , I h and calcium currents ( Peck et al., 2001 ; Johnson et al., 2003 ; Gruhn et al., 2005 ; Peck et al., 2006 ; Ballo and Bucher, 2009 ; Zhang et al., 2010 ) . Type one dopamine receptors (D1r) and type two dopamine receptors (D2r) have been cloned and character ized from the lobster P. interruptus , and their signaling modalities are similar to that in mammals, being increases in cAMP production by D1r activation, and inhibition of cAMP production by D2r ( Clark and Baro, 2006 , 2007 ) . The distribution of DARs characterized in the STG differ between species of lobster ( Clark et al., 2008 )

PAGE 38

38 (Garcia and Bucher, un published), and t he receptors are localized to the fine neural processes of STG neuro pil , specifically described in the PD neuron ( Oginsky et al., 2010 ) . The only other GPCR cloned from crustaceans is a serotonin receptor (5HTr) , also from P. interruptus , whos e signaling modality agrees with second messengers in vertebrate systems ( Clark et al., 2004 ) . Interestingly, the 5HTr also possess the evolut ionarily conserved D R Y motif mentioned earlier , that has mutated to D R F, which imparts ligand independent, constitutive activity of the receptor ( Clark et al., 2004 ) . Several amines are demonstrated to act on the central synapses of the STG ( Johnson et al., 1994 , 1995 ) . For example, DA affects both chemical and electrical synapses, as well as mixed chemic al electrical synapses, between STG neurons ( Johnson et al., 1993 ; Ayali et al., 1998 ) . DA also modulates short term plasticity of the PD to LP synapse ( Kvarta et al., 2012 ) . Additionally, the application of amine modulators can reveal prev iously silent synapses ( Johnson et al., 1993 ) . Only three peptides have been localized to cell bodies in the adult STG, including FLRFamide, allatostatins and orcokinin ( Skiebe, 2001 ; Li et al., 2002 ) . Orcokinin is expressed in the paired lateral posterior gastric (LPG) neurons of C. borealis (Garcia and Bucher, unpublish ed; Appendix B) as well as the anterior gastric receptor (AGR) and anterior median like (AM like) neurons in the crayfish ( Skiebe et al., 2002 ) , while the cell bodies expressing FLRFa and ASTs have not been identified. The remainder of peptides that modulate the STG have been localized to release si tes in the neuropil from descending, modulatory projections of neurons in the AG ( Nusbaum and Marder,

PAGE 39

39 1989b ; Skiebe et al., 1999 ; Skiebe et al., 2002 ; Ye et al., 2013 ) , or found in the hemolymph but demonstrated to act on STG neurons using physiological tests. Allatostatins e xert an inhibitory effect on the pyloric rhythm and neurons in the STG ( Szabo et al., 2011 ) . However, many peptides, including proctolin (proc), red pigment concentrating hormone (RPCH), crustacean cardioactive peptide (CCAP), FLRFamide like peptides, and CCK have excitatory effects and increase the pyloric or gastric mill rhythm frequencies, or activate either rhythm in a quiescent preparation ( Hooper and Marder, 1984 ; Marder et al., 1986 ; Hooper and Marder, 1987 ; Marder et al., 1987 ; Turrigiano and Selverston, 1989 , 1990 ; Weimann et al., 1993 ; Turrigiano et al., 1994 ; Weimann et al., 1997 ) . Many neurons excited by peptides exhibit increased spikes per bursts, extended burst duration and an increase in cycle frequency. The majority of the physiological analysis of neuropeptides has been at the network level, and only a few studies have been made to identify the mechanism behind the excitatory effects. Application of proctolin to pharmacologically isolated LP a nd IC neurons allowed the first description of the modulator activated inward current, I MI , originally called the proctolin current ( Golowasch and Marder, 1992 ) . I MI is a mixed cation current, mostly carried by sodium, is TTX insensitive, voltage dependent and has a strong outward rectification. I MI is thought to be responsible for the excitatory effect of peptides on STG neurons because the peak current conductance is near the threshold for spike initiation, and this h as been corroborated with injection of artificial current via dynamic clamp ( Swensen and Marder, 2001 ) . Since the identification of I MI , a handful of other peptides, including RPCH, CCAP and Cancer borealis tachykinin related peptide (CabTRP), and the muscarinic receptor agonist pilocarpine, were reported to activate the current

PAGE 40

40 ( Swensen and Marder, 2000 ; Nusbaum et al., 2001 ; DeLong et al., 2009 ) . While it is clear that several peptides in the STG excite neurons through activation of I MI , what remains unknown is the identity of the ion channel that carries the current, and whether or not it is a single ion channel or a variety that exists between neurons. Quantitative properties of I MI , including the peak amplitude and voltage, and qualit ative current voltage relationships vary between cell types, and within the same cell type ( Swensen and Marder, 2001 ; Goaillard et al., 2009 ) . However, experiments using a peptide present in the bath to occlude the response generated by focal application of a second peptide suggest that the response is generated by a single current ( Swensen and Marder, 2000 ) . In addition to activating I MI , two neuropeptides in the STG have been demonstrated to affect a central synapse. In H. americanus RPCH enhances the inhibitory LP to PD synapse when compared to control ( Thirumalai et al., 2006 ) . The increase in synaptic conductance also showed significant depression over time, and when exposed to RPCH f or more than 40min, all observed enhancement returned to control. In C. borealis , the peptide Proc also affects the LP to PD synapse ( Zhao et al., 2011 ) . Proc enhances synaptic strength and also affects short term synaptic dynamics according to the magnitude of presynaptic depolarization. Prior to this thesis, no neuropeptide activated GPCRhad been cloned from crustaceans. Here I describe work mostly based on the cloning of a GPCR from C. borealis and present evidence that it is the receptor for the neuropeptide crustacean cardioactive pept ide (CCAP). Crustacean Cardioactive Peptide and its Receptor C rustacean cardioactive peptide (CCAP) was originally identified as a substance isolated from the pericardial organs of the shore crab, Carcinus maen a s ( Stangier et al.,

PAGE 41

41 1987 ) . It is a nonapepti de with a disulfide bridge between the two cysteine residue s , making it cyclic. At the time of its discovery, the only other peptide of any similarity was AVP ( Stangier et al., 1987 ) . C rustacean cardioactive peptide receptors cloned from insects have all been grouped into the Rhodopsin like subfamily A6 of GPCRs, supported by phylogenetic analysis of sequence similarit y ( Li et al., 2011 ; Pitti and Manoj, 2012 ) . CCAP has been isolated from several insects, including Manduca sexta , Tribolium castaneum , Tenebrio molitor , Locusta migratoria , and Rhodinus prolixus ( Cheung et al., 1992 ; Furuya et al., 1993 ; Park et al., 2002 ; Lange and Patel, 2005 ; Lange and da Silva, 2007 ; Arakane et al., 2008 ; Lee et al., 2010 ) , and predicted through genome mining from more ( Belmont et al., 2006 ) . In addition to the shore crab C. maen a s , CCAP has been identified in the decapod crustaceans C. borealis , H. americanus , Callinectes sapidus , and Orconectes immunis ( Christie et al., 1995 ; Skiebe et al., 1999 ; Pulver an d Marder, 2002 ; Li et al., 2003 ; Chung et al., 2006 ; Chen et al., 2009 ; Ma et al., 2009 ) . In insects, the peptide is predominantly found in the ventral nerve co rd, perivisceral organs, brain, suboesophageal ganglion and frontal ganglion ( Tublitz and Truman, 1985 ; Lange and Patel, 2005 ) , and in crustaceans, it is localized to the pericardial organs, thoracic ganglion, n euronal processes in the STNS (CoGs and commissural connectives ) and brain ( Stangier et al., 1988 ; Christie et al., 1995 ; Skiebe et al., 1999 ; Li et al., 2003 ; Chung et al., 2006 ) . In both arthropods, CCAP functions both as a hormone an d a neurotransmitter. crustaceans and insects. In C. mean a s , both the PO extract and CCAP accelerated the heart beat frequency in a semi isolated heart preparation ( Stangier et al., 1987 ) , and the

PAGE 42

42 peptide alone has been shown to increase the contraction frequency and amplitude in various C. sapidus heart preparations as well ( Fort et al., 2007 ) . These effects appear to be at least partly neurogenic, as CC AP excites the cardiac ganglion, a neural system that innervates the heart ( Maynard, 1972 ; Cruz Bermudez and Marder, 2007 ) . In Drosophila , bath application of CCAP to the heart causes a latent activation of contractions that gradually increased in amplitude ( Dulcis, 2004 ) . Two isoforms of CCAP exist in M. sexta , CAP1 and CAP2, and both exhibit a dose dependent increase in beat rate, but have no effect on amplitude ( Tublitz et al., 1992a ) . In T. castaneum , a single isoform of CCAP exists, but two receptors have been identified Tc CCAPr1 and Tc CCAPr2, and yet Tc CCAPr2 has significantly greater binding affinity for CCAP. Knock down experiments us ing RNAi revealed little effect caused by the loss of Tc CCAPr1 compared to complete abolishment of cardiac activi ty from knock down of Tc CCAPr2 ( Li et al., 2011 ) . Tissues other than the heart also respond to CCAP in both insects and crustacean s. In larval M. sexta, the CAP2 isoform increased hindgut contraction amplitude and frequency to activate a behavior called gut emptying, without affecting the heart ( Tublitz et al., 1992b ) . Spontaneous contractions of the spermatheca in female L. migratoria is increased by CCAP, as are the amplitudes of contractions activated by neuronal input ( da Silva and Lange, 2006 ) . In C. borealis, CCAP was demonstrated to act on musculature of the forgegut, specificially the gastric muscle 4 (gm4) ( Jorge Rivera et al., 1998 ) . The roles of CCAP and receptor has also been extensively described in molting behaviors of both insec ts and crustaceans, indicating the peptide and receptor as regulating vital processes during the complex behavior ( Gammie and

PAGE 43

43 Truman, 1997 ; Phlippen et al., 2000 ; Park et al., 2003 ; Arakane et al., 2008 ; Ayali, 2009 ; Lee et al., 2013 ; Webster et al., 2013 ) . CCAP in the STNS In the STNS, CCAP is delivered by the hemolymph through release at the POs and acts solely as an extrinsic, hormonal modulator on the pyloric and gastric mill rhythm. In decentralized preparations of C. boreal is , CCAP activates a variant of the pyloric and gastric mill rhythms ( Weimann et al., 1991 ; Weimann et al., 1997 ) . During ongoing rhythm, CCAP increases the burst duration and spikes pe r burst in LP, and increases the strength of IC bursting while additionally activating LG in the gastric mill rhythm. The increase in spikes per burst in LP is concentration dependent, and more robust in LP neurons that are less active. In systems that exh ibit a slower pyloric frequency, CCAP enhances the frequency, where as it has little effect on rhythms with higher frequencies. CCAP also enhances the gain of the NMJ between the LP neuron and cardio pyloric valve 4 and 6 muscles when LP is less active, an d does so with a threshold of activation at hormonal concentrations (5x10 10 M). The effects of CCAP in the STG of H. americanus adult, juvenile and embryos includes activation of the pyloric rhythm when the STG is decentralized, but shows subtle differenc es between developmental stages with the AG intact ( Richards and Marder, 2000 ) . CCAP slows the rhythm frequency in adults, but increases it in the embryo and has no significant effect in juveniles. Authors of the study explain this difference in in hibition and excitation on the pyloric rhythm by attributing it to the I MI that is activated, and that inward currents may excite or inhibit, depending on the state of conductances in the neurons targeted ( Richards and Marder, 2000 ) .

PAGE 44

44 Six neu rons of the STG have been identified as responsive to CCA P (Fig. 1 6 ) . I MI activated by CCAP ( I MI CCAP ) was first described in the LP neuron of the pyloric circuit ( Swensen and Marder, 2000 ) , f ollowed soon after by description of peptide response ( Swensen and Marder, 2001 ) . In the gastric mill circuit, I MI CCAP has only been described in the LG neuron ( DeLong et al., 2009 ) , but studies conducted in current clamp show excitation of Int1 and anterior median (AM) neurons ( Kirby and Nusbaum, 2007 ) . Less straightforward were the excitatory responses found in the medial gastric (MG) and dorsal gastric (DG) neurons. Ele ctrical coupling between MG, IC and LG caused MG to appear slightly excited by CCAP, but when the IC and LG neurons were hyperpolarized the response in MG disappeared ( Kirby and Nusbaum, 2007 ) . I MI activation, combined with previous studies of amine and peptide modulation either activating or inhibiting specific sets of neurons has provided us with a general theory: Netwo rk activity in the STG arises from a differential distribution of receptors and functions throughout the neurons. Amines bind to receptors in nearly every neuron and cause divergent responses in each neuron, while peptides converge on activation of a singl e ionic current in every neuron they target. In terms of peptidergic modulation, it is likely the presence or absence of a receptor that is each recept or is determined by cell type. However, several areas of peptidergic transmission remain unclear, including the identity of the ion channel, or channels, that carry I MI , and whether or not peptide receptors activate similar or distinct signaling cascades within each neuron.

PAGE 45

45 Preliminary Evidence of CCAPr in C. borealis CCAP has cardiac, ecdysal and myotropic effects. In crustaceans it increases cardiac activity, is a primary signaling hormone for the initiation of molting behaviors, and it excites neurons of the STG as well as enhances the NMJ of at least three gastric muscles. These affects are supported by evidence from insects. As most neuropeptides exert their activities through binding and activation of a GPCR, it seemed likely that such a receptor would exist in C. boreal is . Through application of degenerate primers designed against known insect CCAP receptors, Dr. DJ Schulz at the University of Missouri Columbia cloned a fragment of a putative cardioactive peptide receptor. The identity of the fragment was established th rough NCBI BLAST, and held a 66% percent sequence identity with the T c CCAPr2. Information from physiological distribution of CCAP in the STG, and the identified CCAP responsive neurons, lead us to believe that the receptor would be present in a specific set of neurons. Dr. Schulz also conducted single cell PCR on several neurons using primers designed against the fragment and found it to be present in neurons we expected, and absent in neurons unresponsive to CCAP (Fig.1 7 ). The combination of published, physiological studies with the fragment identified as CCAPr like, as well as preliminary evidence of expression in neurons that respond to CCAP provided the incentive to focus my research in cloning and describing the CCAPr from C. borealis . My goals incl uded the description of the first neuropeptide receptor cloned from crustaceans, and its distribution in the STNS. Due to the various roles played by CCAP in crustaceans and insects, I also wanted to know the extent of receptor expression in other tissues of the animal.

PAGE 46

46 Most importantly, my research aims included using the receptor as a tool in deciphering the convergent modulation of neuropeptides in the STG. Do network responses from individual modulators truly arise from binary expression of the recepto rs? And if so, do signaling modalities differ between cell types towards activation of the I MI current? In the following chapters I describe the cell type specific differences in expression of Cb CCAPr transcripts and the correlation with physiological acti vity in I MI . In collaboration with the Schulz lab, I also contribute studies towards long term regulation of receptor expression when the STG network is faced with perturbation. And finally, I have included appendices describing attempts I have made at dev eloping antibodies and protocols for visualization of the receptor.

PAGE 47

47 Figure 1 1 . The stomatogastric nervous system innervates the stomach of decapod crustaceans. Cartoon depictions of the C. borealis stomatogastric nervous system (STNS) in the whole animal and stomach. (A) Lateral view of C. borealis displaying the heart and partial vasculature system (red), foregut (orange), hind gut (brown), and nervous system (yellow). The STG resides in the opthalmic artery, anterior from the heart. (B) Diagrammatic view of STNS located on the dorsal side of the stomach (muscles not shown) showing the three anterior ganglia, the STG, the CNS and principle nerves for recording STG neuronal activity. TG, thoracic ganglion; OG, esophageal ganglion; STG,

PAGE 48

48 stomatogastric ganglion; CNS, central nervous system; PO, pericardial organ; ivn , inferior ventricular nerve; stn , stomatogastric nerve; ion , inferior esophageal nerve, son , superior esophageal nerve; mvn , medial ventricular nerve; lvn , lateral ventricula r nerve; lgn , lateral gastric nerve; mg n , medial gastric nerve; pdn , pyloric dilator nerve; pyn , pyloric nerve.

PAGE 49

49 Figure 1 2 . The stomatogastric nervous system, including ganglia, connective and peripheral nerves. The anterior ganglia include the paired commissural ganglia (CoG) and esophageal ganglion (OG), while the stomatogastric ganglion (STG) lies posterior on the stomatogastric nerve, stn . Peripheral and connective nerves are labeled: ion , inferior esophageal nerve; son , superior esophageal nerve; dgn , dorsal gastric nerve; mvn , median ventricular nerve; dvn , dorsal ventricular nerve ; lgn , lateral gastric nerve ; mgn , medial gastric nerve; pyn , pyloric nerve; pdn , pyloric dilator nerve. Projecting neurons in the anterior ganglia with identified neurotransmitters are colored: modulatory commissural neuron 1 (MCN1; green), ( Nusbaum et al., 2001 ) ; L cell (blue) ( Kushner and Barker, 1983 ) ; modulatory proctolin neuron (MPN; pink), ( Marder et al., 1986 ) ; inferior ventricular neurons (IV; purple) ( Selverston, 1975 ) . HA, histamine; MS, myosuppressin; DA, dopamine; 5HT, serotonin; CabTRP, Cancer borealis tachykinin related peptide; Proc, proctolin; GABA, aminobutyric acid.

PAGE 50

50 Figure 1 3 . The stomatogastric ganglion. Confocal image of the stomatogastric ganglion (STG). Cell bodies were backfilled with neurobiotin and then stained with streptavidin (red; cell bodies and neurites) and anti synaptotagmin (green; synapses). Merge of the left and mi ddle panels show localization of synapses between neurons occurring in the neuropil. Scale bar: 100 µm

PAGE 51

51 Figure 1 4 . The STG connectome produces pyloric and gastric mill rhythms. (A) Individually identifiable neurons in the C. borealis STG. Neurons are colored according to pyloric (blue) or gastric (pink) mill rhythm generation. The lateral posterior gastric (LPG; purple) neuron swings between pyloric and gastric rhythms. Synapses are colored according to transmitter, either glutamatergic (Glu; turquois e) or cholinergic (ACh; tangerine). Resistor symbols denote electrical coupling between select neurons. (B) Extracellular traces of neurons participating in the triphasic pyloric rhythm (blue), or gastric mill rhythm (pink). The ventral dilator (VD) neuro n is silenced during lateral gastric (LG) neuron bursting, representing one form of interaction between the pyloric and gastric mill rhythms.

PAGE 52

52 Figure 1 5 . Modulators of the STG arrive through the opthalmic artery or from descending projections of AG n eurons. Over 100 different modulators arrive at the STG, either from the hemolymph or through release by descending projections from neurons in the anterior ganglia. Pericardial organs, located around the heart, are a primary neuroendocrine structure in de capod crustaceans ( Christie et al., 1995 ) and are responsible for secreting several monoamines and peptides that act as hormone s. Figure is taken from Marder ( 2012 ) .

PAGE 53

53 Figure 1 6 . Six neurons in the STG respond to crustacean cardioactive peptide (CCAP). All neurons in the STG have been examined for sensitivity to CCAP by either voltage clamp measurements of I MI clamp measurements of excitability through voltage responses (marked with whereas gray neurons are unresponsive. Numbers correlate to studies: 1 ( Swensen and Marder, 2000 ) , 2 ( Swensen an d Marder, 2001 ) , 3 ( Kirby and Nusbaum, 2007 ) , and 4 ( DeLong et al., 2009 ) .

PAGE 54

54 Figure 1 7 . Preliminary single cell PCR reveals putative crustacean cardioactive peptide receptor in STG neurons that respond to CCAP. Individual neurons were collected and processed for expression of CbCCAPr. Primers designed against the original fragment revealed expression in three of the six neurons that respond to CCAP (arrows). PD, pyloric dilator neuron; DG, dorsal gastric neuron; LG, lateral gastric neuron; VD, ventral dilator neuron; LP, lateral pyloric neuron; GM, gastric mill neuron; INT1, intern euron 1; IC, inferior cardiac neuron; PY, pyloric neuron; NTC, no template control. Image and preliminary study courtesy of D.J. Schulz.

PAGE 55

55 CHAPTER 2 CELL TYPE SPECIFIC NEUROPEPTIDE RECEPTOR TRANSCRIPT NUMBERS CORRELATE WITH PHYSIOLOGICAL RESPONSE THRESHOLD Overview In the following chapter, I conducted majority of the molecular biology and electrophysiology experiments, although a collaborator, Simone Temporal, contributed the qRT PCR measurements of CCAPr transcripts per STG neuron, and Dr. Nelly Daur of the Bucher laboratory completed the LG to VD synapse experiments as well as the CCAP and proct olin occlusion experiments. Neural networks are responsible for the expression of behavior in all animals, and these behaviors are stable in routine situ ations yet flexible enough to adapt to novel stimuli. Flexibility in the behaviors arise from neuromodulation of the networks, their neurons and synaptic connectivity. Neuropeptides, a class of neuromodulators, are especially prolific in behaviors in both vertebrates and invertebrate neural systems. The stomatogastric nervous system (STNS) of decapod crustaceans is a premier model system to study neuropeptide modulation as the central pattern generating circuits in the stomatogastric ganglion (STG) are modu lated by a multitude of substances, most of which are neuropeptides. Most peptides tested so far activate the same voltage gated cation current; however, the molecular identities of peptide receptors and target ion channels have not been determined. Here, we have cloned the first neuropeptide receptor in the STNS, the crustacean cardioactive peptide receptor (CCAPr) and Cb CCAPr is a G protein coupled receptor (GPCR), homologous to vasopre ssin and oxytocin receptors within the R hodopsin like GPCR superfamily. Quantitative reverse transcription PCR showed substantial variability in Cb CCAPr mRNA copy numbers both across different

PAGE 56

56 cell types and in the same cell type across individuals. Signif icant differences in expression levels were also found between two cell types and physiological analysis revealed a correlation between mRNA transcript number and properties of the peptide activ ated current. CCAP also enhances the synapse of a neuron that does not canonically respond to the peptide. These findings suggest a relationship between mRNA transcripts of GPCRs and physiological responses in neurons, as well as present a more complicated scheme of peptide modulation in the STG. Introduction Behind every behavi or is a neural network responsible for coordinated, stable activity, and yet it is able to integrate novel stimuli to adapt to changes in the internal or external environment. Networks achieve these changes through innate flexibility found in the intrinsic properties of the neurons, their synaptic connections, the network architecture and the neuromodulators that target each ( Marder and Bucher, 2007 ) . Neuropeptides are a class of modulators that are largely released in a hormonal or paracrine fashion, allowing their involvement in a diverse repertoire of behaviors in both vertebrate and invertebrate animals ( Salio et al., 2006 ; Lesniak and Lipkowski, 2011 ; Merighi et al., 2011 ; Taghert and Nitabach, 2012 ) . In addition to prevalence, some neuropeptides posses tremendous therapeutic potential, such as oxytocin in the treatment of social communication defects observed in autism spectrum disorders ( Harony and Wagner, 2010 ) , or orexin in treatment of a multitude of neuropsychiatric diseases through m odulation of arousal ( Equihua et al., 2013 ; Yeoh et al., 2014 ) . Conversely, neuropeptides have recently been implicated in many disorders ( Donner et al., 2010 ; Domschke et al., 2011 ; Mika et al., 2011 ; Zwanzger et al., 2012 ; Lukas and Neumann, 2013 ) , initiating much research towards understanding peptide modulation,

PAGE 57

57 and revealing the deficit in our understanding of cellular functions behind neuropeptide signaling, particularly in neural networks. Invertebrate c entral pattern generating circuits (CPGs) offer an ideal foundation to study the intrinsic and network effects of neuropeptides ( Harris Warric k, 2011 ; Taghert and Nitabach, 2012 ) . The stomatogastric ganglion (STG) of decapod crustaceans is made up of individually identifiable neurons that comprise highly characterized, semi separate CPGs responsible for driving rhythmic movements of the foregut ( Selverston et al., 1983 ; Weimann et al., 1991 ) . It is also robustly modulated by neuropeptides ( Hooper and Marder, 1984 ; Katz, 1995 ; Billimoria et al., 2005 ) , been shown that all neuropeptides converge to activate the same ionic current, the modulator activated inward current (I MI ) ( Golowasch and Marder, 1992 ; Swensen and Marder, 2000 , 2001 ; DeLong et al., 2009 ) . This finding has lead to the theory that variability in the network responses to individual peptides arise from a differential distribution of the cognate receptors in subsets of neurons ( Weimann et al., 1997 ; Bucher and Marder, 2013 ) . Here we describe the first neuropeptide rece ptor cloned from crustaceans , the Cancer borealis crustacean cardioactive peptide receptor ( Cb CCAPr) and describe its role in the STG . Using qRT PCR, we evaluate differences in expression of the Cb CCAPr between cell types and find a relationship between mR NA copy numbers and the physiological properties of I MI as activated by CCAP ( I MI CCAP ). Additionally, we link in mRNA expression levels of a GPCR to the physiological e ffect in individual neurons.

PAGE 58

58 Material and Methods Animals All experiments were performed on wild caught, adult male Jonah crabs, Cancer borealis , purchased from the Fresh Lobster Company (Gloucester, MA). Crabs were kept in aquaria supplied with artificial sea water (Instant Ocean ), cooled to a temperature of 9 13°C. The animals were fed once a week until use. Before dissection, animals were anesthetized in ice for 30 minutes. For each experiment, individual tissues were dissected under chilled physiologi cal saline, composed of (in mM): 440 NaCl, 11 KCl, 13 CaCl 2 , 26 MgCl 2 (all from Fisher Scientific), and 10 HEPES (Sigma Aldrich). The pH was adjusted to 7.45. RNA I solation and cDNA C onstruction Total RNA was isolated from tissues specific for each cDNA li brary application. To obtain the coding sequence of Cb CCAPr, the brain and all four ganglia of the stomatogastric nervous system ( STNS ) , the two commissural ganglia (CoGs), the esophageal ganglion (OG), and the STG were pooled and used for RNA extraction. For analysis of Cb CCAPr distribution, tissues were collected individually, and included the brain, cardiac ganglion (CG), STG, OG, CoGs, thoracic ganglion (TG), the gastric mill muscle gm4, and the medial, dorsal muscle of the heart (HM). In both forms of RNA isolation, the TRI reagent protocol was used (Molecular Research Center). All tissues were placed directly into either 360 µl (STG, OG, CoGs, CG & gm4), 500 µl (STNS, brain, & HM), or 750 µl (TG & pooled STNS and brain) TRI Reagent homogenization buffe r. The tissue was completely homogenized and then stored overnight at 80°C. The following day, tissues were thawed and 250 µl TRI Reagent was mixed into the homogenized TG or pooled STNS and brain samples. Samples were then processed

PAGE 59

59 according to the manu BioLab). Final RNA was suspended in 22, 30 or 50 µl DEPC treated water, depending on tissue of origin. RNA concentration and quality were measured on a NanoDrop 2000c (Thermo Scientific). Two forms of cDNA libraries were constructed. To clone Cb CCAPr, the SMART method (Clontech) was used to develop cDNA compatible with rapid amplification of cDNA ends (RACE) . Primers are listed in Table 2 1. Briefly, total RNA was incubated with TempSwitch and TRsa(T 30 ) oligos and then reverse transcribed using SuperScript III RT (Life Technologies). PCR amplification of the cDNA library was then performed using SMART oligos and LA Taq polymerase reagents (Takara Bio). To evaluate the distribution of Cb CCAPr throughout individual tissues of the animal, the standard SuperScript III RT protocol was used, using random hexamers and Oligo d(T) 30 primers during reverse transcription. The amount of RNA used for reverse transcription was limited by the total RNA isol ated from the smallest nervous tissues, the OG and STG, resulting in only ~125 ng of RNA used from each tissue. Tissue specific libraries were not amplified after reverse transcription, and any residual RNA was digested using RNase H (New England BioLabs, Inc). Both forms of cDNA were stored in aliquots at 20°C. Cloning the Receptor T ranscript A fragment of the predicted CCAP receptor was cloned using degenerate primers (not shown). Gene specific primers designed against the fragment and RACE oligo seque nces (Table 2 1) were purchased from Integrated DNA Technologies. Touch down and nested, step out PCR reactions to expand the amino and carboxy termini of the fragment were performed using LA Taq polymerase reagents (Takara Bio), and

PAGE 60

60 products were cloned into pGEM T vectors (Promega). Positive clones were sent to SeqWright for sequencing. Sequences comprising CCAPr were confirmed using BlastX (NCBI) and assembled using Lasergene SeqMan and SeqBuilder software (DNAstar). The assembled, putative coding seuqu ence of Cb CCAPr contains an open reading frame of 1,005 bases, identified and translated into amino acids using the ExPASy translate tool (Swiss Institute of Bioinformatics). Sequence Alignment and C omparison Multiple sequence alignment of Cb CCAPr with other mammalian and arthropod Rhodopsin like receptors was performed using MUSCLE (EMBL EBI, Germany). Amino acid sequences were taken from the UniProtKB/Swiss Prot database (EMBL EBI), accession numbers are listed in Table 2 2. ExPASy BoxShade server (SIB) was used to indicate conserved residues. The TMpred program (SIB) ( Hofmann, 1993 ) was used to predict the transmembrane domains of Cb CCAPr. Published transmembrane domains in the UniProtKB/Swiss Prot databank were used for human and arthropod receptors. To evaluate the phylogenetic relationship of Cb CCAPr with other Rhodopsin like receptors, 61 protein sequences (accession numbers in Table 2 4) were aligned in MUSCLE, and then phylogenetic analysis wa s conducted using MEGA software (version 6.0, ImageMagick Studio) ( Tamura et al., 2 013 ) . A maximum likelihood consensus tree was inferred from 1,000 bootstrap replicates, with the initial trees obtained by applying Neighbor join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT model ( Jones et al., 1992 ) . Tissue D istribution of Cb CCAPr T ranscript To evaluate the quality of individual tissue cDNAs, primers were designed against Cancer borealis Tubulin ( Cb tub, GenBank accession number HM157288.1,

PAGE 61

61 Table 2 1) and employed using PCR. Bands of 250 base pairs (bp) were amplified (Fig. 2 3B) from 30 cycles of 30 s at 94°C, 30 s at 60°C and 1 min at 72°C. Primers designed to amplify a 458 bp fragment of Cb CCAPr (T able 2 1) were then employed for screening the expression of each tissue (Fig. 2 3B) using 40 cycles of 30 s at 94°C, 30 s at 57°C, and 1 min at 72°C. For both Cb Tub and Cb CCAPr PCR amplification, control libraries developed without reverse transcriptase (No RT) were run in parallel (data not shown), to exclude genomic DNA contamination and account for high cycle number. Products were visual ized on 1.5 1.8% ethidum bromide stained agarose gels. Bands of appropriate sizes were randomly excised and sequenc ed to confirm product identity. Cb CCAPr mRNA Copy Number Quantification of Individual STG N eurons Individual neurons were identified physiologically using established criteria ( Selverston, 1975 ) . Identified cells were then harvested and quantitative PCR performed as described in Schulz et al. (2006). Briefly, total RNA was isolated using the RNeasy extraction kit (Qiagen), reverse transcribed with SuperScript III, and then used as template for real time PCR with the fluorescent reporter SYBR green (SABiosciences). Primers (Table 2 1) were designed specifically for real time PCR detection of Cb CCAPr transcripts using Primer3 software (University of Massachusetts). Electrophysiological R ecordings For electrophysiology experiments, the STNS was dissected from the stomach and transferred to a transparent Sylgard lined (Dow Corning) dish in chilled physiological saline. A large petroleum jelly well was built around the STG for application of pharmacologic al agents. During all recordings, the preparation was continuously superfused with chilled saline (11 13° C). Intracellular recordings of neuron somata were obtained after desheathing the STG , using sharp glass microelectrodes

PAGE 62

62 filled with 0.6 M K 2 SO 4 and 20 mM KCl (resistance: 10 and voltage clamp were performed using Axoclamp 2B and 900A amplifiers (Molecular Devices). Electrode holders and headstages were mounted on mechanical (Leica) or motorized (Scientifica) micro manipulators. Traces were recorded using micro1401 mk2 digitizer boards (Cambridge Electronic Design, CED) and Spike2 acquisition software (CED, versions 7 and 8). Voltage and current traces were low pass filtered in Spike2 to reduce noise as needed. Care was taken that filtering did not change the time course or amplitude of the signals of interest. Neurons were identified according to characteristic waveforms and by matching spike patterns to extracellular recordings from specific motor nerves. Extracellu lar recordings were obtained with stainless steel wire electrodes from petroleum jelly wells around motor nerves. Signals were amplified and filtered using A M systems differential AC amplifiers (model 1700). All electrophysiological recordings were analyz ed using custom programs written in the Spike2 script language. Current M easurements Two electrode voltage clamp recordings were used to determine the effect of different concentrations of CCAP (Bachem) on synaptic currents and the modulator activated inwa rd current ( I MI ). The graded synaptic current in the ventral dilator (VD) neuron was recorded in response to 2 s depolarizing steps in the presynaptic lateral gastric (LG) neuron. Rhythmic activity and spiking was blocked by application of 100 nM tetrodoto xin (TTX, Sigma Aldrich). VD was held at 50 mV, and LG was stepped from a holding potential of 60 mV. Short term synaptic plasticity was tested with sets of five 0.5 s steps in LG, at a frequency of 1 Hz. To test for postsynaptic effects, outward current s in response to 0.5 s puffs of 10 mM glutamate (L glutamic acid monosodium

PAGE 63

63 salt, Sigma) onto the STG neuropil were measured in VD at a holding potential of 50 mV. Puffs were administered through a glass microelectrode with a broken tip, connected to a To ohey Spritzer (Toohey Company). I MI in the lateral pyloric (LP) and inferior cardiac (IC) neurons was measured in two different ways. In some experiments, IV curves were obtained from difference currents measured in response to voltage ramps (at 90 mV/s) i n control and CCAP ( Golowasch and Marder, 1992 ; Goaillard et al., 2009 ) . This was done in the presence of 100 nM TTX to block voltage in to block inhibitory glutamatergic synapses, 200 M CdCl 2 to block L type calcium currents, and 20 mM tetraethylammonium to block delayed rectifier and calcium dependent potassium currents. All blockers were purchased from Sigma Aldrich. I MI was obtained by subtracting the current response to the ramp in control saline from the response in CCAP, and current was subsequently plotted as a function of voltage. In order to test the concentration dependence of I MI , we held the membrane potential at 20 mV and was washed in for 6 min and washed out for 8 15 min. Blockers used in these experiments were the same as described for ramp protocols. Current amplitudes for each concentratio n were determined as the maximal difference to the holding current before CCAP application. In some experiments, the neuropeptide proctolin (Bachem) was applied in addition to CCAP to test for occlusion effects. Statistical A nalysis All statistical analyse s and data plots were generated in SigmaPlot (versions 11 and 12, Systat Software). Unless otherwise indicated, all data are presented as means

PAGE 64

64 ± standard error of means (SEM). Tests perfor med were t tests (paired or unpaired, as appropriate) and One W ay o r Two W ay A nalyses of V ariance (ANOVA) , for repeated measures when appropriate . Pairwise comparisons of normally distributed data following ANOVA were using the Holm Sidak method. For not normally distributed data, Kruskal Wallis ANOVA was performed on ranks, and pairwise comparisons were using and Tukey tests for equal group sizes . Statistical significance was assumed at p < 0.05 and is indicated in figures by asterisks (*p < 0 .05; **p < 0.01; ***p < 0.001). Postsynaptic current as a function of presynaptic voltage and I MI as a function of the log of the CCAP concentration were fit with a 3 parameter sigmoid function to yield values for the maximal current ( I max ), the voltage of half activation ( V 1/2 , synaptic currents) or the half maximal effective concentration ( EC 50 , I MI ), and the Hill slope (slope factor ). Final figure mounting and editing was done in Canvas (version 11, ACD Systems). Results The P utative Cancer borealis Crustacean Cardioactive P eptide R eceptor ( Cb CCAPr) Belongs to S ubfamily A6 within R hodopsin like GPCRs and is Most Closely Related to Other CCAP and Neuropeptide S R eceptors Using degenerate primers, we cloned a fragment of a predicted receptor from C. borealis that held 66% identity to the T. castaneum crustacean cardioactive peptide receptor 2 ( Tc CCAPr2) ( Park et al., 2008 ; Li et al., 2011 ) We then used cDNA libraries constructed from RNA isolated from the STNS and brain to extend and assemble the partial coding sequence. The putative Cb CCAPr (GenBank accession number: KM349850) comprises 332 amino acids, and a seven trans membrane domain region typical of GPCRs. Comparison of Cb CCAPr to known proteins using BlastX (NCBI)

PAGE 65

65 analysis showed sequence homology to members of the Rhodopsin like family of GPCRs, including other arthropod CCAP receptors and human vasopressin and neur opeptide S receptors. These findings are consistent with previous CCAPr protein homology studies conducted with insect receptors ( Park et al., 2002 ; Li et al., 2011 ) . Multiple alignment of Cb CCAPr with arthropod CCAP receptors and human vasopressin, oxytocin and neuropeptide S (NPS) receptors revealed several regions of conserved residues (Fig. 2 1). Conserved re sidues occupy not only the transmembrane domains (TMDs) but also intracellular and extracellular loops. Intracellular loop 3 showed the greatest diversity in residue compliment, aside from the carboxy and amino termini, which is likely due to specific res idue motifs for coupling to G proteins ( Wess, 1997 ) . Table 2 3 lists the percent identity of amino acid residues between Cb CCAPr and the full length human and T. castaneum receptor sequences shown in the alignment in Figure 2 1. Cb CCAPr is more similar to Hs NPSrA than to Hs V1Ar, with 41% sequence identity and 93% coverage compared to 33% and 89%, respectively, but most similar to the Tc CCAPr2 (63% sequence identity and 96% coverage). This sequence similarity is consistent with a recent study of the evolutionary relationships of NPS receptors in vertebrates and CCAP receptors in invertebrates ( Pitti and Manoj, 2012 ) . Because the highest degree of similarity between GPCRs exists in the TM c ore structure ( Bockaert and Pin, 1999 ) , we also evaluated the relationships between receptor sequences excluding TMDs. Without TMDs, sequence identities dropped by 3 9% but remained significant. To better support the identity of Cb CCAPr, we performed phylog enetic analysis. CCAP, vasopressin and NPS receptors belong to the subfamily A6 of rhodopsin like

PAGE 66

66 GPCRs ( Joost and Methner, 2002 ) , which additionally include gonadotropin releasing hormone receptors (GNRHr), cholecystokinin receptors (CCKr), orexin receptors (ORXr), neuropeptide FF receptors (NPFFr), and pyroglutamylated receptors (QRFPr). Sequences representing each A6 receptor subclass were chosen from both vertebrate and invertebrate species. Frizzled GPCRs from vertebrates and Drosophila were used as the o ut group. The maximum likelihood consensus tree in Figure 2 2 shows that Cb CCAPr clusters with NPS and CCAP receptors, and is most closely related to a hypothetical CCAPr predicted from the genome of the only other crustacean in the study, D. pulex . The mo st closely related receptor group to CCAP and NPS receptors consists of vasopressin and oxytocin receptors. The group of CCAP, NPS, vasopressin and oxytocin receptors is most closely related to GnRH receptors, consistent with a previous study ( Pitti and Manoj, 2012 ) v . All other receptors cluster according to the receptor groups within subfamily A6, while Frizzled receptors are separate. The location of the Cb CCAPr in the consensus tree strongly suggests the putative sequence encodes for a GPCR with high similarity to arthropod CCAP receptors. Cb CCAPr mRNA is Expressed in Nervous Tissues and the G astric M ill 4 M uscle Because of the widespread and diverse effects of CCAP on the nervous system and elsewhere, CCAPr would be expected to be present in a wide range of tissues. W e therefore investigated receptor mRNA expression throughout a range of different C. borealis tissues. Five animals were used to extract RNA from six nervous tissues and two muscles (Fig. 2 3A): the t horacic ganglion , brain, cardiac ganglion, STG, commissural ganglia (CoGs), esophageal ganglion, heart muscle, and the gastric mill muscle gm4 .

PAGE 67

67 Figure 2 3B shows expression of Cb CCAPr by each of the 6 nervous tissues, but at varying levels across individua l animals . Cb Tub is shown as a positive control. Libraries used as negative controls were generated in parallel and without reverse transcriptase ( not shown ) . The CoG sample in animal 1 was the only one not showing expression. Variability might be due to the fact that we used wild caught animals at different times during the year that were likely at different stages in the molt cycle. Figure 2 3C shows very weak or absent expression in the heart muscle, but robust expression in gm4 . Expression in gm4 is co nsistent with the finding that CCAP enhances gm4 contraction amplitude ( Jorge Rivera et al., 1998 ) . Absence of expression in the heart muscle is surprising, as CCAP was originally named for its effect on heart rate ( Stangier et al., 1987 ) . However, crustacean hearts are neurogenic and CCAP has been shown to have multiple targets in the regulation of heart contractions in Callinectes sapidus , including the cardiac ganglion ( Fort et al., 2007 ) . Our finding that Cb CCAPr is expressed by the cardiac gan glion but not the heart muscle may mean that CCAP mainly acts presynaptic to the muscle in C. borealis . Cb CCAPr mRNA is Expressed at Varying L evels Across Neuron T ypes in the STG Figure 2 3B shows that Cb CCAPr mRNA is expressed in the STG. We also determined the expression levels across different neuron types in the STG using single cell qRT PCR. In C. borealis , the STG contains 25 26 neurons, some of types that exist as a single copy, and some of types that have multiple copies ( Kilman and Marder, 1996 ) . The majority of these neurons are members of two interacting central pattern generating circuits controlling pyloric and gastric mill muscles of the stomach ( Marder and Bucher, 2007 ) . To varying degrees, most STG neurons take part in both the faster

PAGE 68

68 pyloric rhythm and the slower gastric mill rhythm ( Weimann et al., 1991 ; Bucher et al., 2006 ) , but for simplicity we separated the 13 neuron types into pyloric and gastric mill neurons, mostly based on the muscles that they control ( Weimann et al., 1991 ) . Figure 2 4 shows single measurements and means of mRNA copy numbers by cell type. There was substantial variability in expression levels within cell types (see coefficients of variation), and some cell types showed no expression at all. Among those that did show expression, mean levels were cell type dependent and ranged from a few hundred copies to more than 2000. Pair wise comparisons revealed differences between AM and DG, AM and IC, LG and DG, LG an d IC, LP and DG, and LP and IC. In three low expressing cell types, expression was not seen in all cells tested. IC did not show expression in 1 of 16, MG in 2 of 6, and DG in 6 of 8 samples. The effect of CCAP on intrinsic excitability has been tested for all STG neurons, in two different ways. Amo ng pyloric neurons, voltage clamp experiments revealed that CCAP activates I MI in LP and IC, but not in PD, PY, VD, and LPG ( Swensen and Marder, 2001 ) . I MI cannot be measured in voltage clamp from AB, likely due to insufficient space clamp in soma recordings. However, CCAP depolarizes synaptically isolated AB neurons in current clamp recordin gs ( Swensen and Marder, 2001 ) . Among gastric mill neurons, only LG has been shown to acti vate I MI in response to CCAP application ( DeLong et al., 2009 ) . However, all other gastric mill neur ons have been tested for depolarizing responses in current clamp ( Kirby and Nusbaum, 2007 ) . CCAP depolarized Int1 and AM, but not MG, DG, and GM. Cell types responsive to CCAP are shown in bold in Figure 2 4. Amo ng pyloric neurons, Cb CCAPr mRNA expression matches effects on intrinsic excitability, with the exception of VD, which expresses at

PAGE 69

69 relatively low levels but does not activate I MI in response to CCAP. Among gastric neurons, Cb CCAPr mRNA expression matches effects on intrinsic excitability unambiguously for AM, LG, and Int 1, which show relatively high expression levels and also show physiological responses to CCAP, and GM, which neither shows expression nor responses. DG does not show depolarizing responses to CCAP. We found Cb CCAPr mRNA expression in DG, but in only 2 of 8 samples. MG shows a somewhat ambiguous response to CCAP ( Kirby and Nusbaum, 2007 ) . A weak excitat ion is seen in low Ca 2+ saline but ceases when responses in neurons that are electrically coupled to MG are suppressed. We found Cb CCAPr mRNA expression in MG, but in only 4 of 6 samples. We conclude that there is some ambiguity in the cases of MG and DG, but that the only definitive mismatch between Cb CCAPr mRNA expression and previously published physiological responses to CCAP exists for the VD neuron. CC AP Acts on the LG to VD S ynapse The mismatch between expression of Cb CCAPr mRNA and lack of physiological responses to CCAP in the VD neuron may be due to the fact that previous studies were limited to effects on intrinsic excitability, and activation of I MI in particular. We therefore wanted to test if CCAP acts on synapti c connections involving VD. Neuropeptide effects on synapses in the STG have not been studied extensively, but two cases involving other neuropeptides have been described ( Thirumalai et al., 2006 ; Zhao et al., 2011 ) . VD has no known chemical output synapses within the STG, but receives graded inhibitory inputs from A B and LG through glutamatergic synapses ( Nusbaum, 2002 ) . We used dual two electrode volta ge clamp to measure the LG to VD connection in control, 100 nM CCAP, and after a minimum of 15 min wash (Fig. 2 5A). Depolarizing voltage steps in LG elicited graded outward current responses in VD, with a transient and a

PAGE 70

70 sustained component typical for ch emical synapses in the STG ( Graubard et al., 1980 ; Manor et al., 1997 ; Zh ao et al., 2011 ) . The example traces in Figure 2 5A show an increase in I syn in the presence of CCAP. We quantified the dependence of the peak synaptic current ( I syn peak) on presynaptic voltage. On average, CCAP increased I syn peak by about 30% (Fig. 2 5B) and shifted the dependence on presynaptic voltage (voltage of half activation, V 1/2 ) by about 5 mV (Fig. 2 5C). Figure 2 5D shows that the change in I syn peak was significant but did not wash. However, the shift in V 1/2 was also significant, and did w ash. The slope factor did not change. Even when only the change in V1/2 is considered (Fig. 2 5C), CCAP increased the synaptic current substantially at a given presynaptic voltage (25 95% increase between 10 and 30 mV). The effective strength of a synap se during repetitive activation depends critically on short term synaptic dynamics ( Nadim and Manor, 2000 ) , and the graded synapses in the STG usually show substantial depression ( Manor et al., 1997 ; Mamiya et al., 2 003 ) . We therefore also tested the effect of CCAP on synaptic dynamics. Figure 2 5E shows the VD current responses to repetitive stimulation at two different levels of LG depolarization in control, CCAP, and wash. We tested voltage steps of different amplitude because at STG synapses the sign of synaptic dynamics can depend on presynap tic voltage level ( Zhao et al., 2011 ) . For the range of LG voltages from 30 mV to 0 mV, the LG to VD synapse was always depressing (n=5, with 2 5 voltage values per experiment, data not shown). We therefore only report responses to LG depolarization to 10 mV. Figure 2 5F shows that CCAP increased the amount of synaptic depression moderately (< 10 %) over the whole course of repeated stimulation.

PAGE 71

71 These results show that CCAP alters the LG to VD synaptic connection. The combined effects of increased I max and lowered V 1/2 to increase synapt ic strength are unlikely to be overcome by the relatively moderate increase in synaptic depression. However, the more important question with regard to a potential contribution of Cb CCAPr expression in VD to this synaptic modulation is if the effects descr ibed have a postsynaptic component. We did not measure the AB to VD connection, the other synapse onto VD, but both LG ( Kirby and Nusbaum, 2007 ; DeLong et al., 2009 ) and AB ( Swensen and Marder, 2001 ) respond to CCAP in synaptic isolation, and both express Cb CCAPr mRNA (Fig. 2 4). Conseque ntly, the effects on synaptic strength and dynamics between LG and VD, and potentially AB and VD, could be solely due to presynaptic CCAP targets. Therefore, we also measured the currents in VD in response to glutamate. Figure 6A shows the multiple seconds long outward current responses to puffs of glutamate onto the STG neuropil in control, CCAP, and after washing for a minimum of 10 min. Surprisingly, CCAP reduced the amplitude of the response, on average by 24% (Fig. 2 6B). Therefore, postsynaptic effect s of CCAP oppose the overall strengthening of the LG to VD synapse. We continuously monitored the input resistance ( R in ) of VD in between glutamate puffs. The average R in conditions and was not affected by CCAP (one way ANOVA on Ranks, p = 0.823). This suggests that the CCAP effect was solely due to changes in the activation of ionotropic glutamate receptors. We conclude that Cb CCAPr expression in VD contributes to synaptic modulation, which resolves the mismatch between receptor expressio n and previously published lack of VD responses to CCAP.

PAGE 72

72 Maximal Amplitude and C o ncentration Dependence of CCAP E licited I MI Differ B etween LP and IC Despite substantial variability of Cb CCAPr mRNA expression within cell types, mean transcript levels betwe en some of the cell types were significantly different (Fig. 2 4). We therefore wanted to determine if differences in mRNA expression levels between cell types correlate with differences in physiological responses, specifically the magnitude of I MI evoked by CCAP application. Because the effect of a given amount of I MI conductances, we chose to do this comparison between LP and IC, neurons with very different expression level s but otherwise similar excitability. LP expresses Cb CCAPr mRNA at a significantly higher level than IC, but both are pyloric neurons that fire in rebound from pacemaker inhibition during the same phase in the pyloric rhythm. There is no a priori reason t o assume that the magnitude of I MI responses scale with mRNA expression level, because they are linked very indirectly. Protein and mRNA expression levels are not necessarily at the same ratio in each cell type, and for a given number of receptors activate d by CCAP there could be distinct quantitative differences in second messenger signaling and activation of target ion channels. There could also be threshold effects or other nonlinearities in the signaling pathway that cause the concentration dependence o f the current to be different between cell types, even if receptor affinities are similar. We therefore did not just compare maximal current responses but also tested different concentrations of CCAP. I MI is usually measured as the difference current obtai ned from imposing voltage ramps in control saline and in the presence of a neuromodulator ( Golowasch and Marder, 1992 ) . We found it easier to maintain stable voltage clamp recordings and

PAGE 73

73 monitor current for the > 2 h n eeded to apply different CCAP concentrations when a constant voltage was maintained. We held the cells at 20 mV and measured the current amplitude evoked by different CCAP concentrations. Across different individuals, CCAP evoked I MI can be quite variable , both with regard to maximal current amplitude and voltage dependence ( Goaillard et al., 2009 ) . We therefore performed voltage ramp measurements in LP at three different CCAP concentrations and compared the resulting IV curves. We found that within each experiment, only the maximal amplitude of I MI changed, but not the voltage dependence (n = 3, da ta not shown). Therefore, changes in current obtained at a single voltage at different concentrations should only reflect the amount of channel activation and not changes in gating properties. Figure 2 7A shows filtered current traces simultaneously obtain ed from LP and GM, the latter of which does not express Cb CCAPr. Most other voltage gated currents were blocked (see Methods). Application of CCAP at increasing concentrations interspersed with incomplete washes yielded increasing inward current responses in LP, but not in GM. Figure 2 7B shows mean I MI values in LP and IC as a function of CCAP concentration. Maximal current values were significantly larger in LP than in IC, matching the much higher Cb CCAPr expression levels shown in Figure 2 4. Figure 2 7C shows the same data normalized to maximal current in each experiment. LP and IC I MI measurements also differed in concentration dependence, as both the EC 50 and the Hill slope in LP were significantly lower than in IC. We therefore conclude that the highe r expression level of Cb CCAPr mRNA in LP is accompanied by stronger activation of I MI by CCAP, and a higher sensitivity to lower concentrations.

PAGE 74

74 Saturating Concentrations of CCAP A ctivate I MI M aximally i n LP, b ut N ot IC The larger I MI response at saturating CCAP concentrations in LP compared to IC could be solely due to a difference in the total number of available ion channels underlying I MI . In this case, saturation would occur in both cells because all available ion channels are act ivated, but at lower levels in IC because of a smaller number of ion channels present. Alternatively, saturation could occur because all receptors are activated at higher CCAP concentrations. The larger response in LP would then be due to a larger percenta ge of ion channels opened when all receptors are activated. In this case, LP would show a larger response even if the number of ion channels underlying I MI was similar in both cell types. We wanted to distinguish between these two cases by using occlusion experiments. A number of different neuromodulators, neuropeptides in particular, can activate I MI in a given cell type. This convergence was established by showing that each neuromodulator activated a current with very similar properties and that the effec ts of each neuromodulator occlude each other ( Swensen and Marder, 2000 , 2001 ) . In addition to CCAP, I MI is activated by the neuropeptide proctolin in both LP and IC ( Swensen and Marder, 2001 ) . In a subset of the experiments shown in Figure 2 the bath solution. Figure 2 8A shows the concentration dependence of I MI , normalized to the fit maximum for CCAP alone in each experiment. Dashed lines indicate the fractional increase in I MI Figure 2 proctolin. The fraction of I MI activated by a saturating concentration of CCAP alone was significantly s maller in IC than in LP.

PAGE 75

75 An important caveat in interpreting these data is that after the repeated CCAP applications in these experiments, non maximal I MI responses to saturating CCAP concentrations could be mostly due to receptor desensitization. The diff erence between LP and IC could thus reflect differences in desensitization rather than differences in the quantities of receptors or ion channels. We therefore performed separate occlusion experiments, with minimal numbers of repeated applications of only the saturating concentrations. In this case, we used voltage ramps and compared peak currents from IV curves. Figure 2 addition of proctolin had little effect on the IV curve in LP, but increased the peak current in IC. Figure 2 8C shows bar plots of the mean peak current amplitudes measured in these experiments. Current amplitudes in LP did not change between CCAP alone and CCAP +proctolin, while co application with proctolin increased the current amplitude in IC. We conclude that the complete occlusion of proctolin induced I MI activation by CCAP indicates that saturating CCAP concentrations in LP activate all available i on channels. In contrast, the incomplete occlusion of proctolin induced I MI activation by CCAP indicates that higher concentrations of CCAP saturate the available receptors, but not the ion channels. We also performed experiments in which proctolin was app lied alone first. Figure 2 8D shows that proctolin does not completely occlude the CCAP response in LP, while it does so in IC. Because complete occlusion occurred in both cell types, albeit in different directions, we conclude that co proctolin in both cell types yields the maximal possible I MI response. Because these maximum current responses are not different between LP and IC (LP: 2.82±0.76, IC:

PAGE 76

76 2.11±0.43 nA, SEM; p =0.44), we conclude that smaller CCAP responses in IC ar e most likely due to a smaller number of CCAP receptors, which matches the significantly lower Cb CCAPr mRNA expression shown in Figure 2 4. Discussion As attention to neuromodulation continues to grow, the mechanisms behind neuropeptides and their receptor s are only recently being elucidated. This is ironic, as neuropeptides have evolved to modulate highly diverse behaviors, and are found across all animal phyla, making them among the most ubiquitous transmitters in neuronal signaling. In this study we iden tify a neuropeptide receptor expressed within a modulated system, and to use it as a tool to evaluate subcellular activities in response to ligand activation. Cb CCAPr Codes for a GPCR that has Strong S equence Similarity to Mammalian Neuropeptide R eceptors Here, we have cloned the first crustacean neuropeptide GPCR from the STNS of C. borealis . While it comprises a receptor sequences comparable to insect receptors ( Belmont et al., 2006 ; Arakane et al., 2008 ; Lee et al., 2013 ) , the identity is still putative without confirmation through heter ologous expression and binding experiments. However, the identity of the receptors is well supported by the alignment of Cb CCAPr to arthropod and mammalian GPCRs, coupled with phylogenetic analysis. Seven TMDs have been predicted for Cb CCAPr, and conserved regions between the receptors are significant, both with and without the TMD s (Table 2 3). Not su rprisingly, Cb CCAPr shares the highest sequence similarity with other arthropod CCAP receptors, particularly the fully cloned and characterized Tc CCAPr2 ( Li et al., 2008 ) . Cb CCAPr also posses the conserved D R Y motif at the intracellular side of TMD 3, which is found

PAGE 77

77 in nearly every Rhodopsin like GPCR and contributes to receptor activity ( Wess, 1997 ; Bockaert and Pin, 1999 ; Clark et al., 2004 ) . In addition, phylogenetic analysis clusters the Cb CCAPr with arthropod CCAP receptors, vertebrate NPS, vasopressin, and oxytocin receptors, as well as invertebrate homologs, which is supported by other studies of cardioactive peptide receptors ( Li et al., 2011 ; Pitti and Manoj, 2012 ) . This phylogenetic relationship is particularly interesting due to studies of OXT and AVP activated currents in rodents. In VII f acial motor neurons in the rat brain stem, AVP activates an inward, voltage gated and TTX insensitive current that is partially carried by sodium and calcium ( Alberi et al., 1993 ; Wrobel, 2010 ) . OXT activates a current with similar properties in rat vagal nerves ( Raggenbass and Dreifu ss, 1992 ; Alberi et al., 1997 ) . These currents present properties that are similar to those seen for I MI ( Golowasch and Marder, 1992 ) , and together this may be the first evidence towards a motorneruon specific inward current used in circuits that is activated and modulated by peptides across phyla. The expression of Cb CCA Pr in neurons that are known to respond to CCAP also ( Swensen and Marder, 2000 , 2001 ; Kirby and Nusbaum, 2007 ; DeLong et al., 2009 ) . S ix neurons in the STG respond to CCAP and we have quantified expression of the receptor transcripts in each of those cells (Fig. 2 4) . Cb CCAPr is expressed at significantly different levels between cell types, with the greatest difference in expression fou nd between the LP and IC, and the AM and IC neurons. We also report a high degree of variability of receptor expression in the same cell type, across animals. This variability is also observed in the expression of ion channels within the STG ( Schulz et al., 2006 ) . Our analysis also revealed expression of

PAGE 78

78 the receptor in three neurons that do not respond to CCAP: the VD, MG and DG neurons. To explain the presence of Cb CCAPr in these cells, we investigated activity at the synapse. CCAP Targets the LG to VD S ynapse CCAP is the third neuropeptide identified to modulate a central synapse in the STG. RPCH and proctolin, both intrinsic neuromodulators of the STNS ( Nusbaum and Marder, 1989a , b ; Fenelon et al., 1999 ) , activate I MI in subsets of neurons in the STG, but also enhance the same synapse, LP to PD. In C. borealis , proctolin activates short term facilitation, where as RPCH, in H. americanus , causes short term depression ( Thirumalai et al., 2006 ; Zhao et al., 2011 ) . Both Proc and RPCH also activate I MI in LP neurons ( Swensen and Marder, 2001 ) , indicating a dual role for the receptor. In our results, Cb CCAPr is expressed in VD but acts at the post synaptic side of the LG to VD synapse. CCAP enhances the inhibitory component of LG input to VD, and shows significant depression during a multi step protocol (Fig. 2 8). To determine whether CCAP was acting post synaptically, we applied glutamate puffs to a pharmacologically isolated VD neuron. CCAP modulates the response of VD to glutamate by significantly depressing the synaptic current. In contrast to the actions of RPCH and Proc, CCAP modulates the synapse in VD, which does not canonically res pond to the peptide through activation of I MI DG neuron, this result suggests the possibility of other neurons in the STG behaving similarly, and explaining the presence of Cb CCAPr transcripts. F or example, CCAP has been shown to enhance the neuromuscular junction of gm4 by increasing the release probability of neuromuscular transmitters in DG ( Jorge Rivera et al., 1998 ) , but DG is not excited by CCAP in current clamp experiments ( Kirby and Nusbaum, 2007 ) .

PAGE 79

79 Cb CCAPr mRNA Transcript Levels C orrespond with I MI CCAP R esponses Quantitative expression of Cb CCAPr transcripts in neurons of the STG showed variability in receptor expression between cell types, with significant differences in expression between several pairs. We chose two neurons within the pyloric network that had a significant difference in expression, the LP and IC neurons, and evaluated the response of each neuron to concentrations of CCAP. The I M I CCAP in LP had a significantly greater maximum conductance than that observed in IC, as well as a significantly lower concentration for half activation (EC 50 ) (Fig. 2 7). While it was not intuitive that we would find such a relationship between GPCR tran scripts and the downstream response, our results suggest that the two are linked. Additionally, unlike the variability in expression and conductances of ion channels found in STG neurons ( Schulz et al., 2006 ; Schulz et al., 2007 ) , we observe a similar level of absolute I MI available in LP and IC during our occlusion experiments (Fig. 2 7 and 2 8). The identity of the ion channel that carries I MI remains unknown, but expression of the channel transcripts between neurons were also uniform like the conductance, it would present a novel mechanism in the STG for homeostatic regulation of modulatory tone. Highly Flexible, yet Stable, Circuits with Di fferential Distribution and E x pression of Modulatory R eceptors Our results suggest an addendum to the theory of peptide modulation within networks of the STG. The response of a set of neurons to any particular modulator is dependent upon the receptors expr essed ( Marder, 2012 ; Bucher and Marder, 2013 ) , but now we show neurons within the subset express differen tial amounts of transcript copies, and this corresponds to a different magnitudes of I MI response. Whether the differences in I MI expressed by each neuron has an effect on network a ctivity remains to

PAGE 80

80 be determined, but is not likely the case in vivo . The STG is exposed to hundreds of modulators while in the animal ( Li et al., 2003 ; Chen et al., 2009 ; Ma et al., 2009 ) , and as demo nstrated by LP and IC, it only takes two neuropeptides to be present for maximal activation of I MI . Still, it is possible that different combinations of neurons that express varying degrees of I MI in response to modulators might present a complex mechanism for stabilizing network activity. This study presents the first receptor for a ubiquitous transmitter class of modulators, and describes its distribution in a characterized model system. Principles of modulation, rhythm generation and network activity hav e been described in the STG and translated to more complex vertebrate networks ( Calabrese, 1998 ; Marder and Bucher, 2001 ; Harris Warrick, 2010 ; Se lverston, 2010 ) . The connection between Cb CCAPr transcript expression and I MI CCAP in LP and IC neurons suggests some validity behind surveying the central nervous system for GPCR transcripts ( Regard et al., 2008 ; Maurel et al., 2011 ) , and using the distribution and q uantification data to infer functional roles in normal and pathological states.

PAGE 81

81 Table 2 2. Primers used for synthesis of cDNA libraries compatible for RACE Primer name oligo sequence Lu4Cap CGACGTGGACTATCCATGAACGCAAAGCAGTGGTATCAACGCAGAGTA Lu4TRsa CGACGTGGACTATCCATGAACGCACGCAGTCGGTACT 30 NsLu4 TCGAGCGGCCGCCCGGGCAGGTCGACGTGGACTATCCATGAACGCA Cb CCAPr.5F CCTACGTCTTGGTGGCTCTC Cb CCAPr.8R TAATCTTGGCCTTTGGGATG Cb CCAPr.4rev AAGGGGAAGGTGATGACGGTCACT Cb CCAPr.7F ATCGATTTCCCGAAGTTGTG Table 2 1. Primers used for synthesis of cDNA. Primer name oligo sequence Template Switch (TS) AAGCAGTGGTATCAACGCAGA GTACGC r G r G r G TRsa(T) 30 CGCAGTCGGTAC T 30 CapPCR AAG CAG TGG TAT CAA CGC AGA GTA Table 2 3 . Primers used to describe tissue localized expression of Cb CCAPr. Primer name oligo sequence Cb CCAPr.5F CCTACGTCTTGGTGGCTCTC Cb CCAPr.8R TAATCTTGGCCTTTGGGATG Cb tub.1F TCTGTGCTGGATGTAGTCCG Cb tub.3R AGAGTGGCGTTGTATGGCTC Table 2 4. Primers used for quantification of Cb CCAPr expression in neurons of the STG using qRT PCR. Primer name oligo sequence Cb CCAPr.3for GGTGGCTCTGACTGTCTTCCTCTT Cb CCAPr.4rev AAGGGGAAGGTGATGACGGTCACT Table 2 5. Accession numbers of select mammalian and arthropod Rhodopsin like receptors, used in multiple alignment. Receptor Accession No. Apis mellifera CAPr XP_001122652.2 Nasonia vitripennis CAPr XP_001602277.1 Tribolium castaneum CAPr2 NP_001076795.1 Tribolium castaneum CAPr1 NP_001076796.1 Drosophila melanogaster CAPr NP_996297.3 Culex quinquefasciatus CAPr XP_001847670.1 Daphnia pulex CCAPr EFX81678.1 Homo sapiens NPSrA NP_997055.1 Homo sapiens NPSrB NP_997056.1 Homo sapiens AVPr1a NP_000697.1 Homo sapiens AVPr1b NP_000698.1

PAGE 82

82 Table 2 7. Accession numbers of the 61 protein sequences used in phylogenetic analysis. Receptor Accession No. Apis mellifera CCAPr XP_001122652.2 Bombyx mori NPr A26 BAG68425.1 Cancer borealis CCAPr KM349850 Daphnia pulex hypothetical CCAPr EFX81678.1 Drosophila melanogaster CCAPr CCAPR_DROME Tribolium castaneum CCAPr1 NP_001076796.1 Tribolium castaneum CCAPr2 NP_001076795.1 Anopheles gambiae NPSr like GPCR3 AAS77205.1 Bombyx mori NPr A30 NP_001127746.1 Homo sapiens NPSrA NP_997055.1 Homo sapiens NPSrB NP_997056.1 Mus m usculus NPSr NP_783609.1 Danio rerio OXTr NP_001186299.1 Danio rerio OXTr like NP_001186298.1 Danio rerio VasotocinRx2 XP_683692.1 Daphnia pulex AVP/OXTr E9HG37_DAPPU Homo sapiens OXTr Homo sapiens V1Ar NP_000907.2 NP_000697.1 Homo sapiens V1Br NP_000698.1 Homo sapiens V2r NP_000045.1 Mus musculus OXTr NP_001074616.1 Mus musculus V1Ar NP_058543.2 Mus musculus V1Br NP_036054.1 Mus musculus V2r NP_062277.1 Tribolium castaneum AVP/OXTr B1NWV5_TRICA Table 2 5. Continued Receptor Accession No. Homo sapiens OXTr NP_000907 Table 2 6 . Amino acid percent identity shared between Cb CCAPr and select human receptors, with and without transmembrane domain regions. Cb CCAPr Hs V1Ar Hs NPSrA Whole ( ) TMD Whole ( ) TMD Whole ( ) TMD ID e value ID e value ID e value ID e value ID e value ID e value Hs V1Ar 33 1e 52 30 3e 06 29 6e 46 27 7e 09 Hs V1Br 33 3e 57 28 9e 09 54 2e 129 47 3e 53 31 1e 46 27 2e 09 Hs OXTr 34 2e 52 28 1e 07 54 2e 118 47 1e 41 34 2e 46 30 8e 11 Hs NPSrA 41 4e 81 36 3e 17 29 6e 46 27 7e 09 Hs NPSrB 41 2e 80 36 3e 17 29 2e 45 26 1e 08 99 0.0 99 7e 150 Tc CCAPr2 63 1e 151 54 7e 55 33 2e 53 34 7e 05 41 9e 86 33 6e 19

PAGE 83

83 Table 2 7. Continued Receptor Accession No. Anopheles gambiae AKH/GNRHr Q27J45_ANOGA Danio rerio GNRHr2 NP_001138451.1 Danio rerio GNRHr4 NP_001091663.1 Drosophila melanogaster GNRHrA NP_477387.1 Drosophila melanogaster GNRHr2 A NP_648571.1 Homo sapiens GNRHr isoforms 1 NP_000397.1 Mus musculus GNRHr NP_034453.1 Tribolium castaneum AKH/GNRHr Q1W7L1_TRICA Anopheles gambiae CCKr like XP_001237203.1 Danio rerio CCKrA like XP_697493.2 Danio rerio CCKr likeX1 XP_002663361.2 Drosophila melanogaster CCKr like NP_001097021.1 Drosophila melanogaster CCKr like17D3 NP_001097023.1 Homo sapiens CCKrA NP_000721.1 Homo sapiens Gastrin/CCKrB NP_795344.1 Mus musculus CCKrA NP_033957.1 Mus musculus CCKrB NP_031653.1 Danio rerio ORXr2 NP_001073337.1 Harpegnathos saltator ORXr2 E2BMY8_HARSA Homo sapiens ORXr1 NP_001516.2 Mus musculus ORXr1 NP_001156499.1 Danio rerio QRFPr XP_001920042.3 Homo sapiens QRFPr NP_937822.2 Mus musculus QRFPr NP_937835.1 Acromyrmex echinatior NPFFr2 EGI57927.1 Danio rerio NPFFr1 NP_001082858.1 Danio rerio NPFFr like2 NP_001165168.1 Danio rerio NPFFr2 XP_690069.5 Drosophila melanogaster NPFFr like SIFr NP_001163674.1 Homo spapiens NPFFr1 NP_071429.1 Homo sapiens NPFFr2 isoform1 NP_004876.2 Mus musculus NPFFr1 NP_001170982.1 Mus musculus NPFFr2 NP_573455.2 Drosophila melanogaster FRZ FRIZ_DROME Homo sapiens FRZ1 NP_003496.1 Mus musculus FRZ1 NP_067432.2

PAGE 84

84

PAGE 85

85 Figure 2 1 . Cb CCAPr shares conserved residues and transmembrane domain loci with other vasopressin like receptors. Mu ltiple alignment of human vasopressin, oxytocin and neuropeptide S receptors and arthropod ( C. quinquefasciatus , T. castaneum , D. melanogaster , A. mellifera , N. vetripennis , and D. pulex ) crustacean cardioactive peptide receptors, including the putative Cb CCAPr (underlined) . Identical amino acid residues are shaded in black, and similar residues shaded in gray, using BoxShade. Transmembrane domains o f Cb CCAPr (underlined in cyan ) are identified using the TMpred program (Hofmann 1993). Transmembrane domains of human and T. castaneum receptors are indicated by cyan lines in the alignment, according to NCBI protein databank entries. Conserved transmembra ne domains are indicated by brackets.

PAGE 86

86 Figure 2 2 . Within the Rhodopsin like family of GPCRs, Cb CCAPr is most closely related to CCAPr of other arthropods, and mammalian Neuropeptide S receptors. Maximum likelihood consensus tree of Cb CCAPr and both vertebrate and ar thropod Rhodopsin like receptors. Sequences comprising the A6 subfamily (Joost 2002) used for analysis include: vasopressin receptors (V1Ar, V1Br, V2r), oxytocin receptors (OXTr), neuropeptide S receptors (NPSrA, NPSrB), gonadotropin rele asing hormone receptors (GNRHr), neuropeptide FF receptors (NPFFr), orexin receptors (ORXr), pyroglutamylated RFamide peptide receptors (QRFPr), and cholecystokinin receptors (CCKr). Frizzled receptors (FRZ) were used as the outgroup. Percent bootstrap va lues of 1,000 replicates are shown at the nodes; values below 50% are hidden. Clades are shaded according to receptor type.

PAGE 87

87 Figure 2 3 . Cb CCAPr is distributed throughout the nervous system and found on some muscles. Nervous tissues and muscles were examined in library sets developed from individual crabs . (A) Lateral view diagram of C. borealis depicts locations of each nervous tissue and muscle used: S, stomatogastric ganglion; O, oesophageal ganglion; Co, paired commissural ganglia; C, cardiac gang lion; T, thoracic ganglion; B, brain; H, heart muscle; G, gastric mill 4 muscle. PCR amplification of Cb CCAPr (top band; 485 bp) and Cb tubulin (bottom band; 250 bp) were conducted on libraries developed from nervous tissues (B) and muscles (C). Each ani mal examined and the corresponding negative images of ethidium bromide stained agarose gels are shown by number.

PAGE 88

88 Figure 2 4 . Single cell qRT PCR shows that Cb CCAPr is expressed in a subset of STG neurons, and at varying levels between cell types . For each cell type, mRNA copy numbers are plotted both for individual measurements (circles) and for means (squares). Cell types included all pyloric and gastric mill neurons (LP, lateral pyloric neuron; AB, anterior burster neuron; VD, ventral d ilator n euron; IC, inferior cardiac neuron; PD, pyloric dilator neuron; PY, pyloric constrictor neuron; LPG, later al posterior gastric neuron; AM, anterior medial neuron; Int1, interneuron 1 ; MG, medial gastric neuron; DG, dorsal gastric neuron; GM, gastric mill n euron). Cell types previously found to display physiological responses to CCAP are shown in bold. The solid line box around VD indicates a mismatch between expression and physiological responsiveness. The dashed boxes around MG and DG indicate ambiguity in expression and responsiveness. The number of individual cells measured for each cell type is given in the line beneath the cell type names. For IC, MG, and DG, the numbers in parentheses indicate number of cells showing no expression / number of cells sho wing expression. The coefficients of variance are given to indicate variability of expression levels. Mean expression levels were cell type dependent (one way ANOVA on ranks, p < 0.001). Pairwise d by solid lines on top of the plot ( p < 0.05 for each pair).

PAGE 89

89 Figure 2 5 . CCAP modulates strength and dynamics of the LG to VD graded chemical synapse. ( A) Dual two electrode voltage clamp measurements of synaptic current s in VD (holding potential: 50 mV) in response to voltage steps in LG. Traces were averaged from 3 5 repeats of the same stimulation protocol. ( B) Cross synaptic I V data for all three treatments from 6 experiments, normalized to I max obtained from sigmoid fits to the control values in each experiment. Overlaid sigmoid curves were obtained by averaging sigmoidal fit parameters across experiments. ( C) The same cross synaptic I V data as shown in B, but normalized to I max obtained from sigmoid fits to values fr om each separate treatment. ( D) Statistical comparison of the sigmoidal fit

PAGE 90

90 parameters. One Way Repeated Measures ANOVA showed significant differences across treatments for I max ( p < 0.05) and V 1/2 ( p < 0.05), but not the slope factor ( p = 0.69). Asterisks indicate results from Holm Sidak paired comparisons. ( E) VD neuron current responses to five 0.5 s steps at 1 Hz and two different depolarization levels in the LG neuron. The synaptic current shows depression at both levels. Traces were averaged from 4 5 repeats of the same stimulation protocol. ( F) Plot of the mean response amplitudes, normalized to the first of the five responses. Two Way Repeated Measures ANOVA showed a significant difference between treatments ( p <0.01), but no interaction between trea tment and stimulus number ( p = 0.37), meaning that the increase in depression was fairly uniform for stimulus 2 to 5. Holm Sidak paired comparisons showed a significant difference between control and CCAP (p < 0.01) and CCAP and wash ( p < 0.01), but not co ntrol and wash ( p = 0.77). Figure 2 6 . CCAP reduces the current response to glutamate application in the VD neuron. (A) VD current responses to 500 ms puff of 10 mM glutamate onto the STG neuropil in control saline, 100 nM CCAP, and after wash. Traces are averages from 4 8 repeats. ( B ) Mean responses ( ± SEM) from 6 experiments. Responses were significantly different betwee n control and CCAP, and CCAP and wash, but not between control and wash (One Way ANOVA for repeated measures, p < 0.01; Holm Sidak paired comparisons).

PAGE 91

91 Figure 2 7 . CCAP elicited I MI in LP and IC differs in amplitude and concentration dependence. ( A) Fil tered current traces from an LP and a GM neuron, in response to application of CCAP at different concentrations. ( B) Mean current values at different CCAP concentration from measurements in LP and IC. Sigmoid fits were generated from parameters averaged a cross individual experiments. Maximum current values obtained from fits were significantly larger in LP than in IC (LP: 3.51 nA ± 0.55 SEM; IC: 1.77 nA ± 0.37 SEM; unpaired t test: p < 0.05). ( C) Same data as in B, but normalized to the maximal current fi t value in each experiment. Values for EC 50 and the Hill slope were significantly smaller in LP than in IC (EC 50 LP: 2.07 nM ± 0.68 SEM; IC: 9.02 nM ± 0.50 SEM, unpaired t test: p < 0.01; Hill slope LP: 0.52 ± 0.04 SEM; IC : 0.86 ± 0.10 SEM; unpaired t test: p < 0.01)

PAGE 92

92 Figure 2 8 . Addition of proctolin to I MI CCAP reveals cell specific difference in I MI amplitudes . (A) Current responses in LP (black) and IC (white) to CCAP alone normalized to the response elicited by 1 M CCAP, with the occlusion st ep of 1 M proc + 1 M CCAP , ± SEM. (B) Current responses in (A), normalized to maximal response elicited by 1 M proc + 1 M CCAP. In the presence of 1

PAGE 93

93 M CCAP alone, I MI in LP is 8 7 % activated, versus 59% in IC. Dashed lines indicate the fractional increase in I MI . (C) Example current traces, measured using a voltage ramp protocol, of I MI currents elicited by each peptide separately (CCAP, black; proc, gray), in LP and IC . (D) Peak I MI amplitudes gathe red from voltage ramp measurements in LP (left) and IC (right ), in which the order of peptide application was first CCAP (black) or Proc (white), and then combined (gray) , ± SEM .

PAGE 94

94 CHAPTER 3 L ONG TERM CHANGES IN EXPRESSION OF C B CCAPR IN THE STOMATOGAS TRIC GANLGION This work was completed in collaboration with K. Lett and D.J. Schulz. The experimental concept and design belong to Lett and Schulz. My contribution includes the I MI CCAP concentration response curve measurements in the LP neuron and occlusi on experiments. I also mentored a summer student, A. Ro, in investigation of the circuit effects of Cb CCAPr regulation after perturbations. I oversaw all data analysis, and performed statistical tests, but results are preliminary and will not be included in the manuscript, which is being written by Lett and Schulz. qRT PCR measurements of Cb CCAPr and excit ability assay of LP were conducted by K. Lett. The format of this chapter is the reflection of my contribution and my interpretation of the results. Introduction The STNS, once removed from the animal, remains rhythmically active for extended periods of time while receiving modulatory input from the anterior ganglia (AG) ( Selverston et al., 1976 ; Flamm and Harris Warrick, 1986 ; Thoby Brisson and Simmers, 1998 ) . In physiological saline, supplemented with glucose and antibiotics, the STG is capable of pr oducing a viable pattern fo r ov er a week (Fig. 3 1) ( Thoby Brisson and Simmers, 1998 ) . Excision of the AG by cutting or blocking the stn , known as decentralization, results in a slower pyloric rhythm or silence of activity altogether, which is caused by the loss of n euromodulator release by descending neurons ( Thoby Brisson and Simmers, 1998 ) . However, in only a few hours to days after decentralization, the which the system produces several seconds of pyloric rhythm, followed by extended periods of tonic spiking, silence, or low frequency rhythm ( Luther et al., 2003 ) . To

PAGE 95

95 determine that eventual recovery and bouting was not a result of intermittent transmitter release from axotomized AG project ions in the neuropil, backfills and photoablation were used to inactivate the fibers ( Thoby Brisson and Simmers, 1998 ; Luther et al., 2003 ) . Results show that axonal remains had no effect on bouts of the pyloric rhythm, indicating th at recovery was achieved by excitability and synaptic changes intrinsic to the network. After one to four days, the pyloric rhythm returns through modification of intrinsic properties, specifically ionic conductances. These include the upregulation of a Ca 2+ current and downregulation of the high threshold potassium current, I HTK ( Haedo and Golowasch, 2006 ) . Studies of decentralization in PD neurons also described the loss in correlations between t he conductances of I HTK and both I h and I A after 24 hr, but the correlation between I A and I h were maintained which indicates a separate mechanism of correlation between these two currents ( MacLean et al., 2003 ; MacLean et al ., 2005 ; Khorkova and Golowasch, 2007 ) . Similar coreg ulation of ion channel conductances and mRNA transcripts were found in LP, however correlation between I HTK and both I A and I h were maintained in decentralized prepa rations ( Temporal et al., 2012 ) . This suggests cell type specific regulation of ion channels under different conditions, in addition to cell type specific expression profiles in control preparations ( Schulz et al., 2007 ) . Modification of membrane conductances towards regaining rhythmic activity also resulted in an altered network that, w hen descending modulation was returned, was no longer able to generate a pyloric rhythm ( Nahar et al., 2012 ) . Reversal of a sucrose block on the stn revealed significant deficiency in the pyloric rhythm being driven by descending inputs after 24 hours, and aft er 3 days virtually no pyloric rhythm was

PAGE 96

96 observed. Another study blocking gene transcription in preparations identified a critical time window of four hours post decentralization in which transcription and synthesis of new proteins was critical for rhythm recovery ( Thoby Brisson and Simmers, 2000 ) . Thus, the changes that occur in ion channe l conductance and correlation likely results The application of modulators, for instance proctolin (Proc), can preserve the coordinated current regulation between ion chan nels prior to decentralization, and can also maintain pyloric rhythm activity post decentralization ( Khorkova and Golowasch, 2007 ) . This is particular ly remarkable because under normal conditions Proc has no direct effect on these currents and yet Proc is able to indirectly preserve their coregulation. In decentralized preparations incubated without modulators, the current densities of each conductance is changed significantly from control preparations ( Khorkova and Golowasch, 2007 ) . Current research demonstrates an adjustment of ionic channel condu ctance and gene expression in neurons of the STG, occurring in response to decentralization. It is evident that long term, homeostatic mechanisms are employed by neurons to restore network activity to a viable rhythm. This also supports the presence of a s afeguard mechanism for restoring a vital behavior to the animal, suggesting also that the presence of over 100 neuromodulators, most of which elicit strong, excitatory effects on the CPGs of the STG, may contribute to this mechanism. What is not known, how ever, is whether or not the neurons adjust modulator signaling itself along with ion channels. It has been shown that peptides and amines both exert robust effects on pyloric and gastric mill rhythms that have a slow frequency or have been silenced, but it is not clear

PAGE 97

97 if this sensitivity arises from changes in neuronal excitability as results from modification to ion channel conductance, or if it is directly related to regulation of the receptor. To evaluate long term changes on neuromodulatory rec eptors, we investigated various decentralization paradigms on the expression of the Cancer borealis crustacean cardioactive peptide receptor ( Cb CCAPr). The Cb CCAPr is the first and only receptor cloned from the STNS and its distribution and cell type speci fic physiology in the STG is covered in detail in Chapter 2. Briefly, the lateral pyloric (LP) neuron both responds to crustacean cardioactive peptide (CCAP) in a concentration dependent manner and expresses ~2,000 transcript copies, making it one of the h igher Cb CCAPr expressing neurons in the STG (Fig. 2 4). Here , in collaboration with Lett and Schulz (in prep), the I MI CCAP in LP was measured over a concentration range of 0.1 nM to 1 µM, in four different paradigms: acute, 24 hour control, long term block and incubation with 0.1 µM CCAP. Separately, LP neurons were harvested after paradigm treatments and processed for Cb CCAP r mRNA copy number. Excitability was also evaluated in LP neurons after each paradigm. Once significant differences were identified, we probed the effects of receptor regulation in the context of network activity although results are preliminary. Data incl uding the mRNA expression, excitability and I MI CCAP measurements are in preparation for publication. Methods Animals Wild caught, adult male Jonah crabs ( C. borealis ) were purchased from The Fresh Lobster Company (Gloucester, MA). Animals were kept in re circulating aquaria with cooled seawater (Instant Ocean) at ~12°C. Animals were fed weekly until use, and anesthetized for 30 min on ice before dissection. Preparatio ns were dissected in cooled,

PAGE 98

98 physiological saline, composed of (in mM): 440 NaCl, 11 KCl, 13 CaCl 2 , 26 MgCl 2 (Fisher Scientific) and 10 HEPES (Sigma Aldrich). The pH was adjusted at room temperature to 7.45 using 10N NaOH (Fisher Scientific). Perturbation P aradigms For each investigation, four experimental groups were used for comparison. Descriptions of each paradigm are as follows: In acute preparations (Acute) analysis was conducted immediately after dissection, giving a control reference for measuremen ts assumed similar to those seen in vivo . Twenty four hour time control preparations (24hr Ctl) were left intact with the AG and the entire STNS was incubated for 24 hours at 11 12°C in normal, physiological saline, and were used as control values for natu ral changes occurring in the STNS over time when removed from the animal. Long term block preparations (LTB) were decentralized, with the stn cut and the AG removed from the dish, and the pyloric activity was monitored until the rhythm silenced, followed b y a 24hr incubation (from time of cut) with normal saline. Preparations incubated with 0.1 µM CCAP (CCAP inc.) were decentralized like LTB, but the preparation was then incubated for 24hr in physiological saline containing 0.1µM CCAP. mRNA Q uantification Quantitative real time PCR was performed as described previously ( Schulz et al., 2006 ) . Briefly, the LP neuron was identified in each preparation according to intracellular waveforms and alignment with extracellular recordings ( Selverston et al., 1976 ) , and pulled from the ganglia ( Schulz et al., 2006 ) . Total RNA was isolated using the RNeasy microcolumn kit (Qiagen) and reverse transcribed using Super Script III transcriptase, random hexamers and Oligo d(T) (Invitrogen). The cDNA was used as a template in real time PCR using SYBR green (S ABiosciences), and the following

PAGE 99

99 GGTGGCTCTGACTGTCTTCCTCTT AAGGGGAAGGTGATGACGGTCACT Electrophysiology Preparations were desheathed and pinned to Sylgard (Dow Corning) coated pet ri dishes, and continuously perfused with physiological saline chilled to ~12°C. Extracellular recordings were acquired using paired, stainless steel wire electrodes, placed on either side of a Vaseline well built around the nerve terminal, and recorded us ing A M systems differential AC amplifiers (model 1700). Intracellular recordings of LP were recorded using sharp glass microelectrodes filled with 0.6 M K 2 SO 4 and 20 mM KCl (resistance: 20 and voltage clamp were performed using Axoclamp 2B amplifiers (Molecular Devices). Electrode holders and headstages were mounted on mechanical (Leica) micromanipulators. Traces were recorded using micro1401 digitizer boards (Cambridge Electronic Design, CED) and Spike2 acquisiti on software (CED, version 7). Voltage and current traces were low pass filtered where needed, but care was taken that filtering did not change amplitude values. LP E x citability A ssay In LP neurons a series of 5 current steps, in increments of 1 nA, were injected into the soma, and spike frequency per burst was recorded. These current steps were conducted in control physiological saline, and also in the presence of increasing concentrations of CCAP, from 1 nM to 1 µM. Results are plotted as a change in spi ke frequency per burst, compared to the frequency observed during current steps in control saline.

PAGE 100

100 I MI CCAP Concentration R esponse Two electrode voltage clamp was used to measure the effect of different concentrations of CCAP (Bachem) on the modulator ac tivated inward current ( I MI CCAP ). This was done in the presence of 100 nM TTX to block I Na , 1 µM picrotoxin to block inhibitory glutamatergic synapses, 200 µM CdCl 2 to block non specific I Ca , and 20 mM tetraethylammonium to block I Kd . All blockers were purchased from Signal Aldrich, save TTX which was purchased from TOCRIS. LP was held at 20 mV and increasing concentrations of CCAP were applied to the bath, from 0.1 nM to 1 µM. Each concentration was washed in for 6 min and washed ou t for 8 15 min, with longer washes used during higher concentrations. Current amplitudes for each concentration were determined as the maximal difference to the holding current before CCAP application. At the end of each experiment, the neuropeptide Proc [ 1 µM] was added to the bath in addition to 1 µM CCAP to test for occlusion. Statistical analysis was performed using SigmaPlot software (Systat Software) where indicated. Circuit E ffects of P erturbation Extracellular recordings of pyloric neurons were us ed to monitor changes resulting from the four paradigms. For accurate comparison to changes observed in the above experiments, the STG was desheathed in each experiment, even though intracellular recordings were not performed. Neurons evaluated include the LP, pyloric dilator (PD), pyloric (PY), inferior cardiac (IC) and ventral dilator (VD) neurons. Where conducted using custom programs written in Spike2 script languag e. In many preparations, no pyloric rhythm was observed, and so spike counts were made across paradigms as the number of spikes observed over 5 minutes. Data are plotted as

PAGE 101

101 normalized to the value observed after decentralization, and also to the number of spikes observed in the 24hr Ctl paradigm when measured in control physiological saline. Results In the stomatogastric ganglion, six neurons respond to CCAP ( Swensen and Marder, 2001 ; Kirby and Nusbaum, 2007 ; DeLong et al., 2009 ) . Recent studies have confirmed expression of the Cb CCAPr in these neurons, and examined cell specific properties of the current activated by CCAP, the modulator activated inward current, I MI CCAP in the neurons LP and IC (Chapter 2; Garcia et al., in preparation). Decentralization of the STG results in changes in ionic channel co nductance and mRNA expression ( Haedo and G olowasch, 2006 ; Khorkova and Golowasch, 2007 ; Zhang et al., 2009 ; Temporal et al., 2012 ) , which leads to eventual recovery of the pyloric rhythm after at least 24 hours. Modulators of the STNS contributes to stabilizin g the pyloric rhythm ( Marder and Thirumalai, 2002 ; Thirumalai et al., 2006 ; Zhao et al., 2011 ) , and coregulation of the ion channels and conductances ( Khorkova and Golowasch, 2007 ; Zhang et al., 2009 ; Temporal et al., 2012 ) after decentralization. In this study, we examine modulation of Cb CCAPr expression and physiolog ical response after decentralization to determine if homeostatic mechanisms involved in recovery include receptor expression. CCAP P aradigm LPs Have Significantly Lower L evels of Cb CCAPr Transcript C ompared to LTB LP neurons were collected from preparations following each paradigm and processed for quantification of Cb CCAPr transcripts (Fig. 3 1). Acute le vels of mRNA expression are near levels reported earlier (Chapter 2, Garcia et al., in prep), with an

PAGE 102

102 average ex pression of ~3,500 transcript copies. The number of transcript copies seen after incubation overnight with AG in tact (24hr Ctl) does not appear significantly different from acute, with mean copy numbers around 4,000. We hypothesized the expression of Cb CC APr might increase after decentralization over the 24hr period, and indeed, LPs from LTB experiments had nearly a 2 fold increase in copy number, although it does not appear to be significant from either control. Another effect that we expected was that in cubation in the presence of the ligand CCAP would cause desensitization and possibly down regulate expression of the receptor. Cb CCAPr transcript copy numbers in the CCAP inc. preparations did show a significant decrease in receptor expression when compare d to LTB, but does not appear to be significantly less than variable expression levels seen in the Acute and 24hr Ctl preparations. This expression data shows that Cb CCAPr expression is modified as a result to decentralization, and that decentralization ca uses an increase in transcription, whereas incubation in 0.1 µM CCAP causes a decrease in expression. Intrinsic Excitability in LTB R e semble Changes S een in 24hr Ctl CCAP inc. and LTB appear to affect the expression of Cb CCAPr, and so we next investigat ed the physiological response of LP neurons when exposed to CCAP after incubations. Series injections of 5 steps, i n 1 nA increments , were injected into LP and the spike frequency was recorded. These series were conducted first in physiological saline, and then in increasing concentrations of CCAP , ranging from 1 nM to 1 µM. Spike frequencies of each current and concentration were then plotte d as a difference from the spike frequency recorded in control saline before beginning CCAP application (Fig. 3 2). F igure 3 2B shows the average of each current step plotted over increasing CCAP concentration and reveals small changes in frequency between each

PAGE 103

103 experimental paradigm. LTB demonstrates the strongest response to CCAP concentrations, suggesting a possible co rrelation between Cb CCAPr transcript numbers and physiological response. However, the changes in spike frequency in 24hr Ctl are similar to LTB, further suggesting that the overall change may be a result of intrinsic membrane properties in addition to modu lation of the Cb CCAPr signaling. To better understand the direct affect caused by altered Cb CCAPr transcripts, we decided to examine the current activated by the Cb CCAPr, the I MI CCAP . I MI CCAP is Greater in LTB P reparations than in CCAP inc. P reparations To distinguish between the effects of long term incubation on intrinsic membrane excitability and the effects caused by upregulation in Cb CCAPr transcription, we measured I MI CCAP in LP neurons following each paradigm. LP neurons were voltage clamped and h eld at 20 mV over the duration of the experiment, and the differences between the baseline holding cu rrent and deflections caused by each concentration were plotted and fit to a three parameter sigmoid (Fig. 3 3). Concentrati ons of CCAP were applied, incr easing from 0.1 nM to 1 µM, and separated by 8 to 15 min washes. At the end of each experiment, 1 µM Proc was added in addition to 1 µM CCAP and the change in current was plotted to evaluate occlusion. We found a significant difference in the maximum I MI C CAP generated in LTB preparations, in the presence of 1 µM CCAP, compared to CCAP inc. preparations (One way ANOVA, followed by post hoc Tukey test, p =0.011). Additionally, a significant difference was also found between the EC 50 of LTB and CCAP inc. prep a rations (Fig. 3 4; One way ANOVA o n ranks, post hoc Tukey test, p =0.027). No significant difference was found between the I MI CCAP generated in acute and 24hr Ctl preparations, nor when comparing either controls to LTB and CCAP inc. . These results indicat e a modification in I MI CCAP that may be caused by the

PAGE 104

104 significantly different expression levels of Cb CCAPr in LTB and CCAP inc. paradigms. Interestingly, occlusion experiments also revealed a modification on the maximal I MI available, and LTB and CCAP inc . had significantly different val ues (Fig. 3 3; One way ANOVA, po st hoc Tukey test, p =0.033). Our results suggest that not only is the I MI CCAP modified in accordance to a change in Cb CCAPr expression, but the ion channels carrying I MI are altered in respo nse to the different paradigms as well. Evaluation of Paradigms on Network R esponse to CCAP The experiments described thus far focus only on changes occurring in the LP neuron, but it is likely that the entire pyloric network in the STG changes as a result of decentralization. Prior studies have shown that decentralization causes changes in ion c hannel conductances in the pyloric dilator (PD) neuron, and studies have also shown the inability for restored input to drive normal rhythm after 48 hours ( Nahar et al., 2012 ; Temporal et al., 2012 ) , Our occlusio n analysis from the concentration response curves of each paradigm suggests adjustment of I MI in addition to Cb CCAPr expression levels, leading to the possibility that this is a global change of I MI in all neurons. To evaluate the network effects caused by the four paradigms, we monitored extracellular recordings of several pyloric neurons, including PD, LP, pyloric (PY), inferior cardiac (IC) and ventral dilator (VD). In several preparations, after decentralization (or 24 hour incubation in the 24hr Ctl gr oup) little to no bursting activity was recorded in a few of the neurons. To accommodate this, we use the number of spikes over a 5 min window as a parameter for measuring neural activity. Results are plotted by paradigm in figure 3 5 . In acute preparatio ns, the network response to increasing CCAP concentrations never reach spikes/5min recorded in control saline, even at the saturating concentration of 1 µM (Fig. 3 5). This is in consistent with the effects of CCAP on decentralized and

PAGE 105

105 slow rhythm preparati ons ( Weimann et al., 1997 ) . The LTB number of spikes/5min in LP also did not reflect changes observed earlier in the intrinsic excitab ility (Fig. 3 2) or I MI CCAP measurements (Fig. 3 3). These observations, in addition to the drop out of signals from cells th at are routinely recorded (i.e. IC responses to CCAP concentrations in LTB and CCAP inc., or VD activity in control saline of 24hr Ctl, LTB and CCAP inc.) lead us to suspect the viability of the preparations. These experiments were conducted during the sum mer months, and wild caught animals have occasionally suffered from heat during shipping in the past (Garcia, Bucher and Schulz observations). Pyloric rhythms of intact preparations normally do not change significantly between the day of dissection and aft er 24 hours ( Thoby Brisson and Simmers, 1998 ) , and so we compared spiking activity in acute and 24r Ctl preparations (Fig. 3 6). All four pyloric neurons showed a substantial decline in spiking activity after 24 hours in normal , physiological saline, with a significant change seen in LP activity (t test, p =0.034). This, in addition to several preparations that died during the 24hr period, leads us to believe that our experiments do not fully reflect the effects of the four parad igms on network activity. Further evidence is seen when we evaluate the effects of CCAP concentrations on the LTB and CCAP incubated preparations, normalized to control spike number per 5 min recorded in 24hr Ctl preparat ions (Fig. 3 7). Of the pyloric neu rons, LP responds most strongly to CCAP in both sets of experiments, with slightly more spikes observed in CCAP inc. prepa rations, which is inconsistent with analysis of intrinsic excitability and I MI CCAP measurements (Fig. 3 2, Fig. 3 3). I t is evident t hat these experiments must be repeated with healthier preparations in order to determine network effects caused by decentralization paradigms.

PAGE 106

106 Discussion Our results show a regulation of Cb CCAPr transcript expression in LP neurons, in response to decentralization (LTB) and incubation with 0.1 µM CCAP. Long term block preparations showed an increase in Cb CCAPr transcript copies over those seen in Acute and 24hr Ctl (LTB mean ~7,000 vs Acute ~ 3,500 and 24hr Ctl ~4,000 copy numbe rs) (Fig. 3 1). P reparations that were decentralized and then incubated overnight in saline containing 0.1 µM CCAP showed a large decrease in Cb CCAPr expression (~1,000 copy numbers). This decrease in Cb CCAPr transcripts was not surprising, as Cb CCAPr is a G protein coupled receptor (Chapter 2, Garcia et al., in prep) and desensitization of a receptor in the presence of the ligand has been well documented ( Zhang et al., 1999 ; Ferguson, 2001 ; Luttrell and Lefkowitz, 2002 ) . How ever, it was not inherently known if the neuron would respond by removing the receptor from the cell membrane, followed by degradation or storage of the receptor, or if it would also cause a decrease in transcript copies. Additionally, it remains unclear whether the decrease in Cb CCAPr transcripts were a result of fewer Cb CCAPr mRN A copies being transcribed, the digestion of mRNA transcripts already present in reserve pools in addition to receptor desensitization, or a combination of the two. Future studies should investigate these different scenarios. Measurement of the I MI CCAP across the four paradigms showed a reflection in maximal I MI CCAP to the transcript copy numbers seen in Cb CCAPr. LTB and CCAP inc. preparations had significantly di fferent maximal currents a ctivated (Fig. 3 3), wit h LTB also demonstrating the strongest response to concentrations of CCAP (LTB max: 3.84 ± 0.29 nA vs. CCAP inc. max: 1.64 ±0.40 nA; SEM), although it was not significant from

PAGE 107

107 controls (Acute max: 2.44 ± 0. 59 nA, 24hr Ctl max: 2.63 ± 0.34 nA; SEM). The EC 50 of LTB was also significantly greater than the EC 50 of CCAP inc. preparations, and this combined with maximal current support a correlation between expression of Cb CCAPr and I MI CCAP , and additionally tha t the receptor expression and physiological response is modulated when the pyloric rhythm is disrupted. Occlusion experiments with 1 µM Proc also revealed a modification in I MI current across the four paradigms. This modification of I MI can be best seen i n the occlusion response of CCAP inc. preparations (Fig.3 3). If Cb CCAPr expression was decreased due to overt stimulation of the receptor by incubat ion with the ligand CCAP, then the response to Proc, a novel peptide, would not be subdued and the current should reach a magnitude similar to that observed in controls. Likewise, in the absence of all modulators, as seen in LTB, the maximal I MI available would remain at control levels unless the current, or ion channels, were also modified. As the identity of the ion channel, or channels, carrying I MI remains unknown, conclusions drawn from I MI regulation stand as hypothetical. Studies in the ST NS demonstrate that ion channel transcripts are regulated and adjusted following perturbation to the system, and so it is possible that the ion channels carrying a current that is activated by modulators, a current that potentially acts as a safety mechani sm in response to injury, would be regulated as well. Analysis of the four paradigms on network activity shows inconclusive results. Preparations incubated overnight in 0.1 µM CCAP appear to have the greatest response to c oncentrations of CCAP when norma lized to 24hr Ctl activity measured in saline (Fig. 3 7) . This result is inconsistent with results from LP intrinsic excitability and

PAGE 108

108 I MI CCAP conductance. We also found that decentralized preparations that were not exposed to modulators (LTB) responded po orly to CCAP concentrations, except for LP. If this data is viable then this result is particularly interesting with reference to the IC neuron, which expresses the receptor and responds to CCAP. However, interpretation of the network response data is marr ed by the state of the preparations. Three factors lead us to believe that these were unhealthy animals: 1) No gastric mill rhythm was ever recorded, when, in healthy animals, a gastric mill rhythm is present at the beginning of the experiment in nearly 75 % of preparations, when the inferior ventral nerve is left intact with the esophageal ganglio n in the anterior ganglia (Garcia, unpublished observations). 2) Substantial decreases in spike number were observed between acute values, and spike counts after 2 4 hours in physiological saline (Fig. 3 7), w hich is inconsistent with other studies. And 3) Concentrations of CCAP, including saturation (1 µM), did not elicit a response similar to, or greater than, that seen in controls. This was true even in Acute prep arations, which is inconsistent with published findings. These defects in the preparations were not a result of improper dissection, and can only be attributed to the poor health of the animals, possibly due to the timing of experiments. In conclusion, we report that Cb CCAPr transcript levels are affected by decentralization, and these changes are mirrored in physiological responses. Transcript levels are significantly higher 24 hours after decentralization, and incubation with the uses levels to be significantly decreased. Measurements of I MI CCA P reflect changes in receptor transcript copies, but occlusion experiments suggest a shift in the current I MI as well. Intrinsic excitability in LP neurons was also increased after decentral ization, and decreased in CCAP incubation, which is at least partially due

PAGE 109

109 to changes in Cb CCAPr and I MI signaling. In mouse spinal cord, the regulation of serotonin receptors in interneurons following injury showed an increase in serotonin sensitivity but had no effect on membrane excitability ( Husch et al., 2012 ) , alluding to a complex balance between intrinsic properties and receptor activity. In the STG, where majority of neurons function as both inter and motor neurons, a mechanism may exist that coordinates both the modulator response and intrinsic conductances to enhance the recovery of target activity.

PAGE 110

110 Figure 3 1 . CCAPr mRNA transcript copy numbers in LP, after four treatments. LP neurons were individually processed in qRT PCR and absolute transcript copy numbers are show n. Acute (black) levels are similar to those reported previously (Garcia et al., in prep), while 24 hour control (grey) copy number does not appear significantly different. Long term block (LTB, red) has an increase in number of transcript copies, with abo ut a 2 fold change from decrease in copy numbers, which is also likely significantly lower than expression in LPB preps. (modified from Lett and Schulz)

PAGE 111

111 Figure 3 2 . Intrinsic excita bility changes in LP, across paradigms and in response to concentrations of crustacean cardioactive peptide. LP neurons were injected with current following each experimental paradigm. (A) Change in spike frequency from recordings in control saline, in re sponse to 5 steps (shown) of current injection in increments of 1 nA. Each set of current steps are repeated in 10 9 , 10 8 , 10 7 and 10 6 M CCAP. (B) Average of 5 steps from each paradigm plotted over increasing concentrations of CCAP. Open circles, acute; filled circles, 24hr Ctl; red squares, LTB; green triangles, 0.1 µM CCAP incubated. Concentrations of CCAP bath applied with physiological saline. ( Modified from Lett and Schulz)

PAGE 112

112 Figure 3 3 . I MI CCAP is significantly greater in amplitude in LTB preparations than in CCAP inc. preparations, reflecting changes observed in Cb CCAPr expression. Mean current values (n=5 in each) for concentration response curves of each experimental group. Arrows and colors indicate significance where appropriate. SEM error bars. Filled circles are maximum current amplitudes measured at each concentration of CCAP; open squares are combined 1 µM CCAP and 1 µM Proc. Dashed line indicates second arrow and significance is between occlusion steps of LTB (red) and CCAP inc. (green), not significant: Acute (black) and 24hr Ctl (gray). Significance by One way ANOVA and post hoc Tukey test: maximum I MI CCAP : (a) p =0.011; occlusion: (b) p =0.033.

PAGE 113

113 Figure 3 4 . Current response values n ormalized to maximum I MI CCAP . Same data as in Fig 3 3, but without occlusion step and normalized to maximum fit values of each experimental paradigm. EC 50 in LTB is significantly smaller than in CCAP inc. preparations (LTB: 8.50 ± 5.83 nM; CCAP inc. : 44.2 3 ±20.31 nM; SEM, Kruskal Wallis one way ANOVA on ranks, Tukey Test p <0.027). No significant difference found versus controls (Acute: 3.33 ± 0.98 nM; 24hr Ctl: 3.91 ±1.17 nM). Arrows and colors indicate significance. Acute (black), 24hr Ctl (gray), LTB (re d) and CCAP inc. (green). Sample size n=5 for each.

PAGE 114

114 Figure 3 5 . Average number of spikes per 5 min period of pyloric neurons following each perturbation. Line scatter plots of average number of spikes over 5 min for each paradigm, with sample size beneath paradigm label. Between five (acute) and three (24hr Clt) pyloric neurons were examined in each: PD

PAGE 115

115 (black), LP (red), PY (green), IC (yellow) and VD (bl ue). Spike number were counted before decentralization (or 24hr incubation for 24hr Ctl), and then in the presence of increasing concentrations of CCAP. Gray bar in 24hr Ctl, LTB and CCAP inc. indicate time of overnight incubation. Spike number was counted immediately after decentralization in Acute, LTB and CCAP inc. . 24hr Ctl instead shows spike number after incubation, prior to decentralization for CCAP concentrations. Sample sizes do not allow for statistical analysis. Note: color scheme no longer follo ws earlier figures. Figure 3 6 . Pyloric neurons have a substantial decrease in number of spikes after 24hours in physiological saline. Mean number of spikes/5 min are plotted for PD (black), LP (red), PY (green) and IC (yellow) neurons from Acute and 24hr Ctl preparations (recorded in physiological saline, before decentralization). The difference seen in LP spikes is significant (unpaired t test, p =0.034), but the rest are not significant.

PAGE 116

116 Figure 3 7 . zed to mean 24hr Ctl measurement. Mean spikes/5min from neurons of LTB (A) and CCAP inc. (B) preparations were normalized individually to the mean spikes/5min recorded in 24hr Ctl preparations while in physiological saline. PD (black), LP (red), PY (green) , and IC (yellow) were included in both LTB and CCAP sets, but no IC signal was recorded in 24hr Ctl preparations, thus IC is normalized to 0.

PAGE 117

117 CHAPTER 4 GENERAL DISCUSSION AND FUTURE STUDIES Expanding the STG C onnectome : CCAP M odulation in the STG Cb CCAPr is Differentially Expressed in N eurons of the STG The stomatogastric ganglion provides an ideal system to examine modulator effects and network activity. Several studies before this dissertation have shown that monoamines and neuropeptides act on neurons of the STG in distinct ways. Monoamines influence every one of the 14 cell types in the STG, but with divergent effects on both membrane and synaptic currents. In contrast, neuropeptides have specific patterns of neuronal targe ts, and in each target they activate the same inward current, I MI . Therefore, the distribution of receptors within the ganglion is what leads to peptide specific network responses in the absence of descending input; neurons either expressed the receptor to the patterned activity. My research measuring the expression of Cb CCAPr in neurons of the STG has shown that a simple, binary distribution of receptors is not the case. In fact, significant di fferences in the transcript copies were found between cell types, such as that seen in LP and IC. Additionally, a high degree in variability was seen in Cb CCAPr expression within the same cell type. Previous studies of ion channel expression between cell types in the STG revealed a high degree of variability between neurons, across animals, and even between identical cell types within the same animal ( Schulz et al., 2006 ) . As we began investigating the expression of Cb CCAPr in single cells we hypothesized that the transcripts of receptors might be less variable in expression than ion channels. If the recepto rs were truly expressed in a binary manner between cell types, then it made sense that they would be tightly regulated, where as ion channels are able to vary

PAGE 118

118 substantially in expression yet still achieve the same target activity. Indeed, variability in ex pression of the shal potassium channel demonstrated a 2 to 5 fold change between cell types, where as Cb CCAPr had a 2 to 3 fold change in expression across cells, at most. However, variability in Cb CCAPr expression is comparable to the fold change seen in shal , as well as BKKCa in most cell types, causing us to abandon our theory of tighter receptor regulation. Additionally, our current sample size in expression of Cb CCAPr between cell types is small, and it would be informative to sample more cells to bett er evaluate the variance in expression between cell types, for example in AB. It might be true that while variability between cell types is as great as that seen in ion channel studies, perhaps the variance expression level might depend on cell type. The n eurons that express the highest amount of Cb CCAPr transcripts, LP, AM, LG and Int1, all show the greatest degree in level variability. It would be informative to know if this pattern was related with I MI channel expression, I MI amplitude, or if it was also a pattern seen for other GPCRs. An obvious next step towards evaluating expression patterns of receptors would be to measure the expression of dopamine receptors in all STG neurons, not just PD ( Oginsky et al., 2010 ) . Cloning efforts should also continue towards the identification of more neuropeptide receptors, the next immediate candidate being proctolin. physiological response is currently an important area of research in mammalian systems. With the advent of next generation sequencing platforms, several groups have taken to measuring re ceptor transcripts across brain regions in the central nervous system ( Regard et al., 2008 ) , but results of their studies are limited in understanding the

PAGE 119

119 physiological distribution of the receptors. First, single cell analysis is vital in understanding a link between expression and physiology, as averaging cell populations in a tissue section or nuclei mutes actual differences within the tissue. Second, it was not until recently that indivi dual neurons from vertebrates were able to be processed for qRT PCR ( Yano et al., 2006 ; Subkhankulova et al., 2008 ) , but the minute volum e of transcripts must first be amplified before use as a template, which causes noise through mis amplification and interferes with results ( Arriaga, 2009 ) preceding chapters is the first link between differential expression of a receptor between cell types, and a relationship with the physiological activity of the neuron. Application of this principle to vertebrate systems would be especially informative when analyzing pathological loss of receptors caused by various diseases or developmental disorders . However, before such a leap can be made, more neurons of the STG should be examined, as well as other invertebrate systems with similar accessibility. Our expression and physiology studies were also conducted on separate pools of LP and IC neurons; measu ring the I MI CCAP in LP or IC, and then evaluating the expression in the same neuron would provide substantial foundation for the link between physiology and GPCR transcripts. Once the I MI gene has been identified, it would also be interesting to measure expression of the channel across cell types in the STG. We have shown with our occlusion experiments in IC and LP that the I MI amplitude is similar between the two cell types, albeit with d ifferences in activation between CCAP and proctolin (Proc). It would be interesting to see if expression of the ion channel correlated with the maximum conductance measured in each neuron (i.e., when measured in the presence of two or

PAGE 120

120 more peptides), and w hether or not the channel was expressed uniformly across cell types, reflecting the similar conductance. This finding would be especially surprising in light of the extreme variability in expression levels and conductances of ion channels reported in the STG ( Prinz et al., 2004 ; Schulz et al., 2006 ) . However, if uniform expression were the case, it would be enlightening in the context of homeostatic mechanisms and modulation in the STG. CCAP Modulates the Central LG to VD S ynapse The modulation of synapse by monoamines in the STG have been well described ( Johnson et al., 1995 ) , but only two neuropeptides besides CCAP have been identified to target synapses. Proc, studied in C. boreal is , and red pigment concentrating hormone (RPCH) studied in H. americanus , both effect the LP to PD synapse ( Thirumalai et al., 2006 ; Zhao et al., 2011 ) . We evaluated the effect of CCAP on the LG to VD synapse to determine the role of Cb CCAPr in VD. The V D neuron neither responds through activation of I MI ( Swensen and Marder, 2001 ) , or with a change in voltage to CCAP ( Kirby and Nusbaum, 2007 ) , and yet expresses the receptor. We show CCAP enhances the synapse and also shifts the voltage for half maximal activation to more hyperpolarized values. CCAP also dampens the synaptic response in VD to puffs of glutamate, the chemical transmitter of LG, which suggests that CCAP is causing this change through binding of the Cb CCAPr expressed in VD. In C . borealis , both RPCH and PD also activate I MI in LP, making VD the only example of an STG neuron expressing the receptor solely for modulation of synaptic properties. The neurons MG and DG were also found to express Cb CCAPr, granted not in each cell teste possible that the same might be true of these neurons. Studies have already demonstrated CCAP to enhance the neuromuscular junction of the gastric muscle gm4

PAGE 121

121 through a change in release probability in the presynaptic terminal ( Jorge Rivera et al., 1998 ) , and gm4 is innervated by DG ( Selverston AI, 1987 ) . More studies should be conducted to evaluate the effects of CCAP on synapses of the STG, with a primary focus on the DG and MG neurons first, and if possible, on properties of the neuromuscular junctions of each as well. Future L ocalization of Cb CCAPr May R eveal Functional D istribution of the R eceptor My original aims included the development of an in situ hybridization protocol and of antibodies generated against the Cb CCAPr. At the time, no in situ protocol was available for use in crustacean nervous tissues, and so we thought it would be a valuable method to develop for other groups, but we would also use it to describe the expression of Cb CCAPr transcripts in neurons besides those in the STG, where individual identification and harvest for qRT PCR would be challenging (e.g. the thoracic ganglion or brain). Our goal for developing antibodies was not only to describe the distribution of Cb CCAPr in tissues of C. borealis , but to evaluate the subcellular distribution of the receptor in labeled neurons of the STG. Earlier, we had been given dopamine receptor (DAr) antibodies that were developed i n P. interruptus by another STG group, which were characterized, specific, and had already been used to describe the localization of DA receptors in the fine neuropil processes of PD neurons ( Oginsky et al., 2010 ) . With a ntibodies generated against Cb CCAPr, we hoped to compare and contrast the subcellular localization of both receptors. Are receptors that bind hormonal modulators ( Cb CCAPr) distributed differently in the neuropil than receptors that bind locally released tr ansmitters? Is there a qualitative difference in the amount of receptors

PAGE 122

122 expressed or clustering? These were our primary questions, but characterization of the antibodies is incomplete. Appendix A describes the progress that was made, as well as preliminar y immunohistochemistry and western blot analysis of the receptor in the STG, but results are inconclusive. A collaborator of ours in the lab of Dr. Eve Marder has been given all materials associated with the antibodies and will continue their characterizat ion and studies. With regards to the development of an in situ protocol, we were also only able to detect the transcripts of a neuropeptide by adapting a protocol routinely used in molluscs ( Jezzini et al., 2005 ) . Probes for the neuropeptide orcokinin (Orco) were used as a proof of concept. Several isoforms of Orco had been identified in the hemolymph of C. borealis ( Li et al., 2003 ; Billimoria et al., 2005 ; Ma et al., 2009 ) , and immunohistochemistry studies found two neurons in the STG displayed Orco like reactivity. Using a combination of physiology and in situ hybridization, we identified Orco expression as belonging to the two lateral posterior gastric (LPG) neurons. Since then, we attempted fluorescent in situ hybridization and a protocol from another lab to detect Cb CCAPr transcripts, b ut with no luck. Appendix B describes the protocols, LPG identification, and preliminary results from the second, long term in situ method. Perhaps with some additional modifications to the second protocol, the Cb CCAPr transcripts could be visualized. Cb CCAPr is a GPCR that is Related to Mammalian Peptide R eceptors Cb CCAPr is Closely Related to Neuropeptide S and Vasopressin R eceptors Phylogenetic analysis of the CCAP receptor cloned from Cancer borealis describes the most similarly related receptor to be the neuropeptide S and vasopressin/oxytocin receptors. Cb CCAPr also clusters with high bootstrap support

PAGE 123

123 within the GPCR Rhodopsin like subfamily A6. Majority of the neuropeptides and receptors in the su bfamily A6 are related to neur o ps ychiatric disorders and metabolism. The functional roles of several neuropeptides and cognate receptors are conserved across animal classes ( Stafflinger et al., 2008 ; Pitti and Manoj, 2012 ) , and phylogenetic analysis of Cb CCAPr and receptor sequence s from animals of different phyla not impractical to t hink that CCAP action on the pyloric and gastric mill rhythms, which are directly related to feed ing, could ha ve translatable , mechanistic relations to the signaling of metabolic neuropeptides like cholecystokinin (CCK), orexin or oxytocin. All three of these neuropeptides are related to feeding, but the exact mechanism of subcellular action Sev eral isoforms of CCK, some of which are highly expressed in the CNS of mammals, have been identified in the STG and described to effect gastric neurons in P. interruptus through excitation ( Turrigiano and Selverston, 1989 , 1990 ; Turrigiano et al., 1994 ) . To my knowledge, CCK has not been evaluated in gastric neurons with respect to I MI activation. If CCK were to activate I MI in gastric neur ons, these results would provide further evidence in su pport of conserved peptide mechanisms within network modulation, in combination with motorneuron currents described in the next section. Cb CCAPr Activates an Inward Current in STG Motor Neurons that has Some S imilarit ies with Mammalian and Molluscan C urre nts Phylogenetic analysis is based upon the receptor sequence, but some functional relationships between the receptors might be assumed as well. Currents similar to I MI have been identified in mollusc and vertebrate motorneurons ( Kirk et al., 1988 ; Chiba et al., 1992 ; Alberi et al., 1993 ; Alberi et al., 1997 ; Wrobel, 2010 ) . A population of facial

PAGE 124

124 motor neurons in rat brainstems respond to arginine vasopressin through activation of a voltage gated inward current that is partially carried by sodium ( Alberi et al., 1993 ; Wrobel, 2010 ) . Oxytocin activates a similar inward current in rat vagal neurons that is slow, voltage gated and has no inactivation ( Raggenbass and Dreifuss, 1992 ) . In the motorneu ron B16 of Aplysia californica , the egg laying hormone activates a voltage gated inward current in that is also partially carried by sodium ( Kirk et al., 1988 ) . All three currents are facilitated by a decrease in extracellular calc ium, are insensitive to tetrodotoxin, potassium and calcium channel blockers, and have excitatory effects on their respective motor neurons, which is generally similar to I MI ( Golowasch and Marder, 1992 ) . Subtle differ ences between I MI and the peptide activated currents do exist, but could be attributed to differences in the subunit composition of the ion channel or intrinsic properties of the neurons. This comparison may suggest an excitatory current that is expressed in motorneurons f or modulation of tone and activity that is conserved across animal species. However, before more conclusions can be drawn between the relationships of these currents, the I MI channel gene must first be identified and then evaluated for expression in mammal s. Still, the accessibility of the STG and characterization of I MI would provide valuable, translatable information behind peptide modulation of motor circuits. Decentralization M odif ies Cb CCAPr E xpression in LP Expression of the Cb CCAPr transcripts in th e LP neuron changes after network perturbation and the changes correspond with physiology. Removal of descending modulation from anterior ganglia in the long term block (LTB) preparations caused an increase in Cb CCAPr transcript expression, and incubation in 0.1 µM CCAP caused a decrease in expression. Both the increase and decrease in expression were mirrored by

PAGE 125

125 a respective increase and decrease in maximal conductance and EC 50 of I MI CCAP by each paradigm. While the change in expression and I MI CCAP of LT B and CCAP incubated preparations were not significant from control values, they were significant when compared to each other. This research presents an adjustment of receptor expression that occurs in the absence of modulators and pyloric activity. We als o found a change in I MI conductance overall to be associated with LTB and CCAP incubation, demonstrating a modulation of the current. Nahar et al. ( 2012 ) demonstrated a functional change in the pyloric network when isolated from modulation, and after four da ys the restoration of input was unable to achieve normal pyloric rhythm. Additionally, after three days of decentralization, preparations showed a significant decrease in network response to application of Proc, an endogenous modulator of the STG, and pilo carpine, implicating a change in receptivity to modulators. Another study has demonstrated a change in ionic conductance that occurs within 24 hours after decentralization ( Temporal et al., 2012 ) . And so, while the intrinsic properties of STG neurons are affected by perturbation, so are the network responses to modulators. Our research explains that this change i n modulator response might be attributed to receptor expression levels, as opposed to intrinsic properties alone. To evaluate the influence of changes in expression after decentralization for the network, we measured changes in the pyloric rhythm following the four paradigms. However, results were inconclusive due to poor animal health. In the future, these studies should be revisited, as it is likely that Cb CCAPr expression is regulated in other cells besides LP, and shifts in expression may cause altered responses to modulation.

PAGE 126

126 The flexibility afforded to neural networks by modulators is essential for an organism to interact with its environment. But modulation also presents countless opportunities for pathologies to disrupt normal function and network a ctivities . Understanding the distribution of receptors for modulators, and the corresponding physiological effects within neurons of a circuit, is especially important when approaching the treatment of disease states or injuries. This thesis presents the v ery first neuropeptide cloned from a highly characterized nervous system, providing a tool to evaluate the mechanisms behind modulation of networks by neuropeptides, which may be translatable to vertebrate motor systems. This work also presents a clear rel ationship between cell physiological response to ligand binding.

PAGE 127

127 APPENDIX A PARTIAL CHARACTERIZATION OF ANTIBODIES GENERATED AGAINST THE C. BOREALIS CRUSTACEAN CARDIOACTIVE PEPTIDE RECEPTOR Earlier in this dissertation, I have reported the cloning of the first crustacean neuropeptide GPCR from the crab Cancer borealis, as well as the physiological differences in cell type responses, and the quantitati ve expression of Cb CCAPr significant difference in the high expression of mRNA transcripts found in LP ( 1,889.82 ± 733.28 [SD] copies per cell ), versus the lower expression found in IC ( 342.75 ± 186.30 copies per cell ) (see Figure 2 4 ) . This difference is then related to the magnitude of I MI CCAP elicited in each neuron, as shown through concentration response curves, in a manner that suggests a correlation between mRNA transcript s of the receptor and the target activated I MI current. However, one profound question still remains: what about the protein? Originally included as an aim, I planned to investigate the localization of the receptor protein itself. The goal would have been to address a more specific question about whether the method of delivery for a modulator influenced the physical distribution of the receptor within a neuron. For example, if locally released modulators, such as dopamine, had receptor targets located on larger neurites, or more proximal to the soma, than hormonal modulators whose receptors might be inserted into the membranes of fine, more distal neurites. Experiments designed for addressing this question would compare the localization of receptors for locally released modulators, such as dopamine, to that of the Cb CCAPr in neurons of the STG. Given to us as gifts from the Baro la b, we have antibodies generated against the P. interruptus isoforms of dopamine (DA) 1a, DA1b and DA2 receptors ( Clark and Baro, 2006 , 2007 ; Clark et al.,

PAGE 128

128 2008 ) . Preliminary experiments testing the an tibodies in STNS tissues from H. americanus have been run ( Figure A 2 ), but specificity of these antibodies in C. borealis remains to be determined. In an effort to describe the subcellular localization of the Cb CCAPr, we ordered the generation of rabbit a nti Cb CCAPr antibodies from the company 21 st Century Biochemicals. The peptide sequences chosen for development of polyclonal antibodies were predicted by 21 st Century Biochemicals. Company specific algorithms were used to identify the best peptide sequen ces for antigen production, with additional input regarding predicted transmembrane domains, which I determined as areas to avoid. Once the peptide sequences were chosen (GPCR1: Acetyl PMNFSGSWRRARRLVAGC amide ; GPCR2: Acetyl TSKTLGARNGEKKVTNPC amide ; see Figure A 1 ), each 17 amino acids in length, I compared each to all known proteins using NCBI BLASTx. GPCR 1 returned several hypothetical and putative crustacean cardioactive peptide receptors, with the most significant e value of 8e 07. GPCR 2 returned va dependent Cip protease ATP value: 19), and others from S. cerevisiae . Neither peptide sequence appeared to resemble GPCRs that might compete for specificity of Cb CCAPr during experiments. For inocula tion, keyhole limpet hemocyanin was avoided for conjugation to each peptide because of endogenous hem o cyanin in Malacost rac ans ( Terwilliger and Dumler, 2001 ) , and the peptides were conjugated to ovalbumin. To identify bands of the correct molecular weight during western blot analysis, the size of Cb CCAPr was calculated as approximately

PAGE 129

129 The remainder of this appendix includes the protocols for both western blot and immunohistochemical experiments towards characteri zing the antibodies. S ections include pre immune screening for selecting rabbits for inoculation, test bleeds during inoculations, and analysis of the final, purified antibodies. These results remain preliminary and the antibodies and peptides have been sent to collaborator Dr. Marie Goeritz, at the lab of Dr. Eve Ma rder, where further analysis and characterization will be conducted. Methods : Pre ab sorption of A nt ibodies for Us e in Western Blot or Immunohistochemistry For antibodies present in Test Bleeds: 1. Combine 60 µ l of Test Bleed (from each rabbit) with 100 µg of either peptide GPCR1 & GPCR 2 (aliquots [5 µg/µl] kept at 80°C). Total volume: 100 µl. 2. Incubate overnight on rocker at 4 ° C . 3. Centrifuge at 1 4K rpm for 5 min; carefully remove supernatant and use in protocols at 0.6 AB/µl. Note: Simultaneously prepare a control (Ctl) antibody with PA for each rabbit/test; for Ctl, add equal volume (40 µl) of peptide specific Mili Q (MQ) H 2 O, pH 5.7 . For final, purified antibodies (GPCR 1 and GPCR 2), calculations were made to accommodate the concentration of eac h antibody: GPCR 1 [ ]: 0.87 µg/µl GPCR 2 [ ]: 0.88 µg/µl GPCR 1 PA GPCR 1 Ctl GPCR 2 PA GPCR 2 Ctl 57.47 µL AB 52.53 µL AB 56.82 µL AB 53.18 µL AB 100 µg GPCR1 38.87 µL MQ H2O GPCR1 40.41 µL MQ H2O

PAGE 130

130 GPCR2 100 µg GPCR2 2 2 .53 µL MQ H2O 2 3.18 µL MQ H2O Methods : Western B lot (WB) P rotocol in Cancer borealis Day 1 1. Dissect nervous tissues for protein isolation. If dissecting more than one tissue, keep all tissues intact and in chilled saline until ready for isolation. 2. Homogenize in lysis buffer (0.5% SDS, 1% Triton X 100, 1 mM EDTA, 1X PBS) at 2 ml per 100 mg tissue, with Protease Inhibitor Cocktail 1 and Aprotinin 2 added at time of lysis at 1:100, each. Approximate volume for STNS: 200 µL. 3. Sonicate for 30 sec and then incubate on rocker f 4. Centrifuge at 12,000 rpm for 20 min; remove supernatant, aliquot and store at 20°C until use (no more than 1 week) Day 2 1. Mix 18 µl sample with 6 µl 4X NuPAGE LDS Sample buffer 3 . 2. Sonicate 15 sec then store on ice until ready to load gel . 3. Prepare pre cast, NuPAGE 4 12% Bis Tris protein gel 4 and SDS PAGE chamber. 4. Prepare running buffer (20ml 20X NuPAGE buffer 5 + 380ml MQ H2O) and fill chamber. a. Load gel; include molecular weight markers (i.e. Full Range Rainbow Molecular marker 6 ). 1 Sigma Aldrich Protease inhibitor cocktail, catalog number: P 8849 2 Sigma Aldrich Aprotinin bovine, catalog number: A6103 3 Life Technologies, NuPAGE LDS Sample Buffer (4X), catalog number: NP0007 4 Life Technologies, NuPAGE Novex 4 12% Bis Tris gel, catalog number: NP0321BOX 5 Life Technologies, NuPAGE MES SDS Running Bu ffer (20x), catalog number: NP0002 02

PAGE 131

131 5. Run gel for 50 min at 150 V, at RT 6. Transfer to nitrocellulose membrane at 100 V for 1hr, with ice pack and on stir plate. 7. Fix proteins: a. 5 min in Fast Green on shaker b. 5 8 min Coomasie Blue Destain (10% MeOH, 10% Acetic acid) cut membrane into appropriate pieces for incubation with primary antibodies. 8. min at room temp. 9. Blocking: 1 hr at room temp in 3% BSA/TBST. 10. Wash 3x in TBST, 15min each at room temp 11. Primary Antibody application in AB dilu tant (5% BSA, 2% NGS, TBST). Covered and incubated overnight at 4°C on rocker. Note: tested several range s of concentrations from 1:50 up to 1:10,000 D ay 3 1. Wash 3x in TBST, 15min each at room temp. 2. Secondary Antibody application in AB dilutant (5% BSA, 2% NGS, TBST): anti Rabbit::HRP at 1:30,000; incubate for 1hr at room temp on rocker. 3. Wash 3x in TBST, 15 min each 4. Wash in TBS (50 mM Tris, 150 mM NaCl) for 5 min. 6 GE Healthcare Life Sciences, Amersham ECL Rainbow Molecular Weight Marker, catalog number: RPN800E

PAGE 132

132 5. Development with Western Lighting Plus ECL 7 : Prepare working solution of 1:1 Enhanced Lumi nol Reagent and Oxidizing Reagent in tube protected from light. Pour solution over membrane and rock gently for 5 min; remove excess solution and immediately capture image using film or CCD camera. Methods: Immunohistochemistry (IHC) P rotocol in Cancer borealis Day 1 all steps carried out at 4°C after fixation. 1. Dissect nervous tissue and clean away any fatty or connective tissue thoroughly. If dissecting more than one tissue, keep all tissues intact and in chilled saline until ready for fixation. 2. Pin , OG and CG s after fixation to maintain structural integrity. 3. Rinse entire prep quickly with 1X PBS . 4. Pour on 4% Paraformaldehyde/1X PBS and fix for 1 2 hr s at 4°C, or O/N at 4 °C . 5. Rinse once with 1X PBS . In 1X PBS, cut out syglard blocks with tissues. Double check stability of pins. 6. Rinse at least 6x over 2 6 hr with PBS X ( 1X PBS, 0.3% Triton X 100 ) , on rotator. 7. Block: 5% NGS in PBS X for 8. Incubate overnight (at least 12 20 hrs) at 4°C with Primary AB in 10% Normal Goat Serum/PBS X, with gentle rotation. 7 PerkinElmer, Western Lightning Plus ECL, catalog n umber: NEL103001EA

PAGE 133

133 a. rabbit synaptotagmin at 1:1000 [used for earlier, descriptive experiments; not shown] b. rabbit Cb CCAPr ( used at several concentrations ) Day 2 1. Quick rinse with PBS X; then w ash prep 5x with PBS X, 10 20 min each 2. Wash prep 2x with 1X PBS, 10 20 min each 3. Incubate at 4°C with Secondary AB * in 10% NGS/PBS X overnight (6 12 hr at least) on rotator . a. Goat anti rabbit Alexa 488 (absorb max @ 495 n m, emits max @ 519 nm) 1:400 . b. Streptavidin Cy 5 (excited maximally at 649 nm and emits maximally at 670 nm) 1:400 . *Note: From this point on, fluorescence is in use and preps must be protected from light. D ay 3 1. Wash out with 1X PBS, 6x at one hour intervals, with shaking . 2. Dehydrate in EtOH/ 1X PBS series , 10 min each : 30, 50, 70, 90 and 100% . 3. Transfer to 1:1 EtOH & methyl s alic llow evaporation overnight . 4. Mount o n slides with me thyl s alicylate keep covered, monito r methyl salicylate level until imaging.

PAGE 134

134 Screening of Candidate R abbits Rabbits were chosen for inoculation and antibody production according to those that produced the least amount of background signal, especially in the somata and neuropil of the STG o r ganglia examined using IHC . Figure A 3 shows a collection of pre immune sera staining i n Co Gs [1:100], and STGs [1:5,000], to choose a rabbit most suitable for inoculation. Rabbits 8806 and 8808 caused the least amount of background signal in the neuropil and somata, and were chosen for antibody production . Analysis of Test B leeds Each rabbit was inoculated with GPCR1 and GPCR2 peptides a total of 5 times veloping antibodies examined using IHC and WB. Early test bleeds, including 1 through 3, showed little staining above background signals when examined using IHC. To ensure the specificity for the peptides GPCR1 and GPCR2 by each antibody, dot blots were ra n using several concentrations of GPCR1 and GPCR2. Figure A 4 shows that test bleed #2 from both rabbits recognize both peptides, with a slightly stronger signal generated against GPCR1. Once reactivity was confirmed, we continued with inoculations and scr eening the test bleeds using both WB and IHC. Test bleed #5 was the final bleed examined before purification of the antibodies. Protein extracts from STNS and bra in were used for split blots (western blots , with wells split down the middle, allowing direct comparison o f bands present and absent in pre absorbed versus control ). Results showed a promising band of approximately 36 kDa that disappeared upon absorption with GPCR1 and GPCR2 in rabbit 8808 (Figure A 5). PA and Ctl antibodies from test bleed #5 wer e also examined on STG whole mount

PAGE 135

135 tissues, shown in Figure A 6. U nfortunately, results in the IHC preparations were less informative than those seen in the western blots. After much consideration, Rabbit 8808 was chosen for the terminal bleed. Affinity c olumns were developed using GPCR1 and GPCR2 and antibodies were affinity purified by 21 st Century Biochemicals. Preliminary Analysis of Purified A ntibodies, GPCR 1 and GPCR 2 Before handing over the antibodi es to collaborators , one IHC and WB experiment w ere r un for both purified antibodies. Several dilutions of the antibodies were used in IHC analysis on both cardiac ganglia (CGs) and STGs. Figure A 8 shows each dilution, at low and high magnification, for each antibody. A negative control for IHC compari son was also run in parallel using only the secondary antibody Alexa 568 in one CG an d one STG (Fig. A 7). The confocal settings used for scanning preparations in figure A 8 are not consistent and were instead optimized for each antibody and corresponding dilution to achieve the best signal. GPCR 2 had the least amount of background noise, and staining in the neuropil that appeared significant compared to the negative control. Unfortunately, there were not enough preparations to run pre absorbed controls in parallel with each dilution and so specificity of the signal cannot be determined. For the moment, it appears that the optimum dilution for using the GPCR 2 in IHC is 1:1,000. Three dilutions of each antibody were also analyzed in protein extracts using split blots, and the dilutions with the strongest signals are shown in figure A 9. GPCR 2 reacted with a protein similar in molecular weight to that predicted for the Cb CCAPr (36 KDa) , and pre absorption removed most of the band . In GPCR 1, two bands of molecular weight in the same range of Cb CCAPr were visualized and also pre absorbed. However, the amount of background signals seen in the pre absorbed strips may be

PAGE 136

136 caused by an overload of antigen used for absorption of the antib ody, and background bands in the AB strips might be avoided by modifying the blot protocol. In conclusion of my attempts to characterize antibodies generated against the Cb CCAPr in Cancer borealis tissue, the results remain preliminary at best , but there is some evidence to suggest that GPCR 2 is a promising candidate.

PAGE 137

137 Figure A 1 . Peptide loci within Cb CCAPr amino acid sequence. Two peptides were used for development of Cb CCAPr antigens, GPCR1 and GPCR2 (shown in blue).

PAGE 138

138 Figure A 2 . Preliminary studies describing localization of dopamine receptors in STG of H. americanus . Multiple confocal scans were assembled to show length of

PAGE 139

139 STG and connecting nerve. Three antibodies were tested, and their specific antigens shown in parenthesis. Figure A 3 . Pre Immune screen show rabbits 8806 and 8808 as best candidates for inoculation. Top row: Commissural ganglia (CoGs), stained with pre immune sera at 1:100 in 10% NGS and PBS X. Bottom row: Stomatogastric ganglia (STGs), stained with pre im mune sera at 1:5,000 in 10% NGS and PBS X. Open stars denote rabbits with least amount of background signal in neuropil and somata of each ganglion. Confocal scans are maximum projections of z stacks, 1 µm each, imaged at 10x magnification. Alexa 568 2° an tibodies used at 1:400 for all preparations. Photon multiplier tube (PMT), gain, and acousto Optic tuning filter (AOTF) settings consistant across each sera concentration. Post imaging, maximum projection TIFs were adjusted for best contrast.

PAGE 140

140 Figure A 4 . Dot blot test of sera specificity from rabbits 8806 and 8808, in test bleed #2. Four strips used per rabbit: top rows sera was used at 1:200 in AB dilutant (see text), bottom rows sera was used at 1:1,000. First column are increasing concentrations of pure peptide GPCR1, applied to nitrocellulose membrane at 0.1 to 2 µ g. Second column is peptide GPCR2.

PAGE 141

141

PAGE 142

142 Figure A 5 . Western blot analysis of test bleed #5 sera on STNS protein extract. Test bleed #5 sera from rabbits 8806 and 8808 were incubated on st rips, either after being preabsorbed with peptide (PA), or without modification (Ctl). Pre Immune strips are sera from each rabbit before inoculation trials, used to peptides. Clo sed arrows show hypothetical CbCCAPr band that is present in Ctl strips but disappears when sera is preabsorbed with peptides GPCR1 and GPCR2. Open arrows indicate non specific bands that also disappear when preabsorbed, but that are not likely the CbCCAPr , according to estimated molecular weight of 36 kDa. Figure A 6 . Immunohistochemical analysis of test bleed #5 in STGs. Control (Ctl) versus preabsorbed (PA) sera from each rabbit. Top row: images taken at 10x magnification. Bottom row: images taken at 40x oil magnification.

PAGE 143

143 Figure A 7 . Negative control staining with secondary antibody in cardiac ganglion and STG. Both preparations were incubated with Alexa 568 hydrazide after fixation and imaged for analysis of background noise caused by the fluoro phore reactivity alone. Top row: 10x magnification. Bottom row: same prep at a higher magnification. Images are pseudocolored according to a bit range, with maximum intensity in blue.

PAGE 144

144

PAGE 145

145 Figure A 8 . Dilu tion series of purified antibodies GPCR 1 and GPCR 2 on cardiac and stomatogastric ganglia. Two sets of preparations, including cardiac ganglia (CG) and stomatogastric ganglia (STG), with each set used for purified antibodies (GPCR 1, top set; GPCR 2, bott om set). Within the sets are low (top row) and high (bottom row) magnification of the same preparation incubated with varying antibody dilutions (labeled across the top of each set). The second dilution of GPCR 2 (1:250) preparation was damaged during the experiment and not imaged. Figure A 9 . Split blots of purified antibodies on STNS protein extract. The strip blots shown had the best illuminescence and signal for each antibody, with a dilution of 1:250 for GPCR 1, and 1:500 for GPCR 2. Arrows indicate bands that are preabsorbed by GPCR1 & GPC R2 antigen incubation. AB, antibody; PA, preabsorbed.

PAGE 146

146 AP PENDIX B IN SITU HYBRIDIZATION IN THE C. BOREALIS STOMATOGASTRIC NERVOUS SYSTEM The expression of a protein can be measured in three ways: by physiological function, by detection through antibodies, and by analysis of mRNA transcripts. Physiology is , but also the functions of the protein. Physiology is also the best assay for monitoring any changes or mutations made to the protein. Detection by antibodies is especially useful because an image of information for physiological testing. To test the function of a protein, you must know where to look. The final method, through analysis o f mRNA transcripts, often needs to be accompanied by one of the other two methods, but can be both qualitatively and quantitatively informative. In situ hybridization is used to detect mRNA transcripts in fixed tissue. Probes constructed of complimentary R NA that are designed against the gene of interest are used to detect the endogenous transcripts, and after binding with the appropriate antibody, the signal can be developed using either a chromogenic or fluorescent reaction. In situ hybridizations provide a qualitative description of mRNA transcripts because they are only relatively quantifiable. On the other hand, quantitative real time PCR (qRT PCR) provides a quantitative measure of mRNA transcripts through use of an intercalating fluorescent dye, prime rs designed against the target transcript, and PCR with fluorescent detection. In Chapter 2, I have employed qRT PCR to detect and measure Cb CCAPr transcripts in every neuron of the STG. However, that analysis was completed only recently, and so origina lly it was a goal to develop an in situ hybridization protocol for use in crustacean nervous tissues, and for the detection of Cb CCAPr in the STG . To

PAGE 147

147 develop this protocol, we first needed a transcript that was differentially expressed in the STG. At the t ime, another group had successfully cloned the neuropeptide Orcokinin (Orco) from Cancer borealis . Orco is present in several crustaceans ( Stangier et al., 1992 ; Pulver and Marder, 2002 ; Skiebe et al., 2002 ; Billimoria et al., 2005 ; Dircksen et al., 2011 ) , is named after the species in which it was first discovered (the crayfish, Orconectes limosus ), and primarily functions in enhancing hind gut contractions ( Stangier et al., 1992 ) . The decis ion to use Orco as the transcript target for development of an in situ protocol came from previous immunohistochemistry studies. In the stomatogastric nervous system (STNS) of C. borealis , H. americanus and P. interruptus , Orco expression was found in ind ividual neurons ( Li et al., 2002 ) . Specifically, in C. borealis , it was expressed faintly in two, unidentified cell bodies of the STG, which we later identified as the lateral posterior gastric (LPG) neurons (Fig. B 2) , as well as two cell bodies in the es ophageal ganglion. And so, because neuropeptides are often expressed in high abundance, and the previous IHC evidence of differential distribution in the crab STG, we chose Orco. The first in situ protocol that we adapted for use in C. borealis came from a lab that routinely studied nervous tissue from the mollusc Aplysia californica ( Jezzini et al., 2005 ) . This protocol was developed in A. californica for the detection of neuropeptide s in whole mount nervous tissue, such as the CNS. Authors also claimed it to be sensitive enough for detection of less abundant transcripts, for example a putative ion channel gene, and so we thought it would be ideal for later detection of the Cb CCAPr. M ethods: Probe S ynthesis The first, and most critical, step in an in situ hybridization is the construction of mRNA probes. In order to make probes against a particular gene of interest, the gene

PAGE 148

148 should first be cloned into a plasmid. The plasmid and insert must then be sequenced to determine 1) accurate sequence of the insert, and 2) the orientation of the gene in the plasmid. This directionality determin es the combination of restriction enzymes and RNA polymerases to be used for each probe (Fig. B 1). Tw o probes are developed: The the sense probe is a control for non specific staining. The methods reported here begin after the target sequence has been inserted into the plasmid, and the directionality is known. 1. Linearization. To generate several thousand copies of the probe using an RNA polymerase, the probe must first be linearized by a restriction enzyme so the entire plasmid is not transcribed. Example reactions: Restriction enzyme, buffer and BSA from New England Biolabs. (in accordance with Fig. B 1) Antisense Probe Sense probe Plasmid 2 µl 2 µl Restriction EZ mix 2 µl NcoI 2 µl SpeI 10 X buffer 5 µl # 3 5 µl #2 100 X BSA 0.5 µl 0.5 µl MQ H 2 O 40.5 µl 40.5 µl *Note: these volumes were determined empirically. When using a new plasmid, first measure the concentration of the plasmid (nano drop, or similar), and use an appropriate ratio of volume to restriction enzyme units. Incubate at 37°C for 1 to 2 hr; Inactivate using temperature (specific to restriction EZ protocol), followed by 2.5 µl 0.5 M EDTA + 5 µl 3M NaAC + 100 µl 100% EtOH Incubate overnight at 20°C. 2. Centrifuge reactions for 15 min at 14K rpm at room temperature. Remove supernatant, c entrifuge another 5 min, and remove any remaining supernatant. Re suspend linearized plasmids in 20 µl Nuclease free H 2 O. These plasmids can now be

PAGE 149

149 stored at 20°C for up to a month, although a small aliquot should be run on a gel before use to ensure quali ty and that it remains linear. 3. Transcription reaction . During this reaction set up, and from this point forward, it is vital to remain RNase free and practice sterile technique. The probes that are transcribed off the insert will be composed of RNA nucl eotides, with digoxigenin (DIG) labled uracils. During the transcription reaction, the polymerase will insert a DIG labeled uracil every 20 to 25 bases (Roche Diagnostics), and this DIG molecule is used as the antigen for the antibodies used in detection. Example reactions: Polymerase, DIG labeling mix & buffer form ROCHE (in accordance with Fig. B 1) Antisense Probe Sense Probe Nuclease free H 2 O 11 µl 11 µl Linearized plasmid 3 µl 3 µl 10X RNA polymerase buffer 2 µl 2 µl 10X DIG labeling mix 2 µl 2 µl RNA polymerase 2 µl Sp6 2 µl T7 *Note: Volume of linearized plasmid is empirical and concentration should be measured and calculated to match appropriate concentrations for polymerase units. Incubate at 37°C for ~ 4 hours. 4. DNase treatment . This st ep is to degrade any remaining plasmid template from the reaction. It is important that this step is not skipped, as the purity of the probes will impact the hybridization step during the in situ . Be sure to choose a DNase enzyme mix that is also RNase fre e, such as DNase 1 from Thermo Scientific. Add 2 µl DNase 1 to the reaction and mix well by gentle pipetting. Incubate for 15 in at 37°C. Inactivate by centrifugation at maximum rpm for 5 minutes. 5. Lithium chloride precipitation . To isolate the RNA probe from the reaction mixture, add 1.5 volume s 4 M LiCl (sterile) and 2.5 volume s 100% EtOH (chilled). Pipette to mix, incubate overnight at 20°C. Incubation can be longer, such as over the weekend, or shorter, but at least 4 hours to allow maximum binding t o the LiCl.

PAGE 150

150 6. Probe wash and re suspension . After incubation with LiCl and EtOH, centrifuge the probes for 15 min, at 14K rpm, in a cooled centrifuge (4°C). A pellet should be visible and care must be taken to avoid disturbing it while removing the supernatant. Add 300 µl of chilled 70% EtOH and roll the tube to mix. Centrifuge another 5 min at high speed in the 4°C centrifuge. Remove supernatant, then wash with 300 µl of chilled 95% EtOH like before. Remove all liquid and allow drying before re susp ending the probes in 11 µl Nuclease free H 2 O. Run out 1 µl of each probe on a 1.5% agarose gel to confirm purity. Store these probes at 80°C until use. Methods : In situ Hybridization P rotocol Orcokinin with Fluorescent A dditions As mentioned earlier, this protocol was modified from a fellow lab and published ( Jezzini et al., 2005 ) . It is sufficient for localizing neuropeptide and ion channel transcripts in nervous tissu e from A. californica , and so we thought it would transfer well to C. borealis and lobster tissues. When we initially established this protocol in crab and lobster, we ran parallel sense probes with each antisense (not shown) and found no specific labeling . Detecting Orco using chromogenic development produced excellent results, but Cb CCAPr detection was unsuccessful. In efforts to boost the sensitivity of the assay, we also experimented with Fluorescent in situ hybridization (FisH), using Orco probes as co ntrol. The tyramide signal amplification (TSA) fluorescent kit was used (PerkinElmer) as an additional boost for enhancing the signal. The following is the final version of the combined protocols as used by the Bucher lab. Solutions : Once made, majority o f the solutions can be stored at 4°C for up to three months. This excludes the hybridization buffer and detection buffer, which must be prepared fresh each reaction. Although the remaining solutions are relatively stable if

PAGE 151

151 stored correctly, it is advised to make as small a volume as necessary so that fresh stocks can be made without much waste. move all tissues into each solution, so anywhere from 20 sec to 2 min. Day 1 All steps are carried out at room temperature and with gentle rocking, unless noted otherwise. 1. Pin CNS and ganglia onto Sylgard lined dish. Leave brain nerves long enough (and sheathed) 2. Desheath STG and brain. 3. F ix in 4% Paraformaldehyde / 1X phosphate buffer saline (PBS) at 4ºC for 2 to 4 hours with gentle rocking. Avoid longer fixations, but no less than 1 hour. 4. this helps to preserve their original form. 5. Cut out small Sylgard rectangles that the CoGs and STGs are pinned to. Insert a medium width minuten pin into the sylgard to use as a handle for transferring between washes. This is not necessary to do for the brain. 6. Transfer preps to a 24 well plate (Well Cell Cu lture Cluster). 7. Wash in PBS for 5 min, 3x. If EXTREME care is used while pipetting, it is possible to keep the preps in the same well while washing multiple times with the same solution throughout the protocol. However, this is very risky as the turbulence caused by forceful expulsion of the liquid into the well can tear the delicate tissues or dislodge cell bodies. 8. PTW (1X PBS, 0.1% Tween 20) for 10 min . 9. Dehydrate in PTW:MeOH series: 30, 50, 70, 90 % MeOH for 10 min each step.

PAGE 152

152 10. Store in 100% MeOH overnight , or until use . The prep will be stable for months at 20ºC but the MeOH will evaporate, and so fresh, chilled MeOH should be added as needed. D ay 2 All steps are carried out at room temperature and with gentle rocking, unless noted otherwise. 11. Rehydrate from 100% MeOH: 90, 70, 50, 30% MeOH/PTW for 10 min each step . 12. PTW for 10 min For Fluorescent preparations , do the following after PTW incubation : a. R oom temp incubation in H 2 O 2 for 20 30 min b. PTW for 5 min Continue chromogenic protocol... 13. 0.3% Triton X 100 / PBS for 10 min . 14. PTW for 5 min . 15. Proteinase K (Boehringer) / PTW (10 ug/ml) at room temp (0.58 ul ProtK / 1 ml PTW) No rocking! For the STG , OG and CoG, 3 min maximum; For the Brain, 10 min max. *From this stage one, be especially careful with co nnection nerves from the brain. If adequate sheath was not left on the nerves they may rip off. 16. Fix in 4% Paraformaldehyde / PBS on ice for 20 min with rocking. 17. Wash in Glycine / PTW (2 mg/ml), 2x. 18. Wash in PTW, 3x . 19. Wash in 0.1 M Triethanolamine hydrochloride, pH 8.0 (TEA HCl; adjust pH with 10 N NaOH), 2x .

PAGE 153

153 20. Place in 1 ml TEA HCl; add 2.5 µl acetic anhydride, stir and incubate for 5 min with rocking , then add another 2.5 µl acetic anhydride to the same well, stir and incubate another 5 min . 21. Wash in PTW, 4x . 22. Transfer preps to a new, sterile well plate. Place in Hybridization Buffer (50% formamide, 5mM EDTA, 5X SSC, 1X Denhardt Solution (0.02% ficoll, 0.02% polyvynilpirrolidon, 0.02% BSA), 0.1% Tween 20, 0.5 mg/ml yeast tRNA (GIBCO BRL ) and incubate a t 20ºC overnight . Day 3 All steps are carried out in incubators. When switching solutions and applying probes, be as quick as possible to avoid cooling the prep aration s. Additionally, solutions should be prewarmed before using. 23. Prehybridization: place preps (still in hybridization buffer from day before ) in 50ºC incubator for 6 8 hours . An incubator equipped with a rocking platform is ideal, for gentle rocking. 24. Hybridization: Apply DIG RNA probes in pre warmed hybridization buffer (~1 ug/ ml) at 50ºC and leave overnight (typically 1 . The amount of probes to be added must be determined empirically for each probe, even if they are different batches transcribed from the same gene/plasmid. Subtle differences in transcription proficiencies may affect the probe concentration, and different transcripts certainly require different probe concentration and development time. The probe volume suggested is a good starting point. The temperature for hybridization is also variable and dependent upon the probe it self. Increasing the

PAGE 154

154 temperature may reduce background signals by increasing the stringency of the probe. Day 4 A ll washes with gentle rocking (if possible). 25. 50% formamide/ 5X SSC/ 1% SDS at 60ºC for 30 min . 26. 50% formamide/ 2X SSC/ 1% SDS at 60ºC for 30 m in . 27. 0.2X SSC at 55ºC for 30 min, 2x . 28. Wash in PBT (1X PBS, 0.1% Triton X 100, 2 mg/ml BSA), 4x , at room temp. 29. 10% N ormal Goat Serum in PBT at 4ºC for 60 90 min . a. Fluorescent preps , alternative : TNB buffer (0.1 M Tris HCl pH 7.5, 0.15 M NaCl, 0.5% Blocking re agent (PerkinElmer)) incubation for 30 min at room temp in place of final NGS/PBT 30. Apply a nti DIG::A lkaline phosphatase antibodies (Boehringer) at 1:4000 1:1500 (typically 1:2500) in 1% goat serum /PBT and incubate at 4ºC overnight on stir plate . a. Fluorescent preps , alternative : Apply a nti DIG::H orseradish peroxidase antibodies (Perkin Elmer) a t 1:100 1:1000 in TNB buffer, then incubate at 4°C overnight on stir plate . Day 5 A ll steps performed at room temp, unless noted otherwise. 31. PBT for 20 min rocking , 5x . a. Fluorescent alternative : TNT (0.1 M Tris HCl pH 7.5, 0.15 M NaCl, 0.05% Tween 20) buffer for 3 10 min rocking , 5x . 32. Detection Buffer (DB; 100 mM NaCl, 50 mM MgCl 2 , 0.1% Tween 20, 1 mM levamisol, 100 mM TrisHCl, pH 9.5) for 5 min, 2x .

PAGE 155

155 Steps a h, fluorescent prep alternative : a. Place individual preps in empty well of a 6 well plate , stabilizing the Sylgard block to the clean, dry bottom. Do the following, one at a time (development can be quick and so need maximum control over stopping the rea ction) : i. Apply ~ 30 µl of TSA amplification fluorophore & reagent (diluted 1:50 , Perkin Elmer ) to tissue, after removing excess TNT buffer ii. Incubate preparatio n, covered, for 5 10 min at room temp. b. Stop development: w ash with TNT buffer 5 min, with rocking , 3x . At this point the preparations are fluorescent and must be protected from light sources. c. PBS 10 min, rocking at room temp. During this step, you may continue the other preparations through steps a and b , catching them up with a minimum of 10 min wash in PBS. d. Dehydration: 30%, 50%, 70%, 90% MeOH in 1X PBS, 5 min with rocking. e. 100% MeOH for 5 min with rocking. f. 100% EtOH for 5 10 min with rocking. g. 50/50 EtOH/Methyl Salicylate, incubate overnight in desiccation chamber, covered . h. Mount in Methyl Salicyl ate and image. 33. Place in 1 ml DB; Add 20 µl of NBT/BICP solution (from DIG Nucleic Acid Detection Kit, Boehringer) to detection buffer (20 µl /ml) . Incubate in the DARK at

PAGE 156

156 4ºC or on ice. Monitor development after first 5 min, and then check regularly every 15 min; development time varies with probe . 34. Stop development by placing in 1X PBS and then take photographs while in buffer. *Note: the reaction is slowed due the neutral solution, vs alkaline, however the activity is not entirely stopped and will continue until fixation. 35. Transfer to 4% Paraformadlehyde/PBS to fix development for ~15 min , at 4°C with gentle rocking. 36. Dehydrate to methanol in PBS:MeOH* series: 30, 50, 70, 90, 100% for 5 min each step *Note: MeOH dissolves background and eventually staining, allowing for maximum contrast between signal and background, but may ruin signal if left too long . 37. Transfer to 100% EtOH for 5 10 min . 38. For Mounting: transfer to 1:1 EtOH:Methyl salicylate and place in dry chamber and allow Et OH to evaporate (~2 hours or o vernight ) . 39. slide. After clearing and mounting, you can replace the methyl salicylate with Permount for long term storage. Methods : Long term in situ Hybridization P rotocol This method was attempted in the final weeks of my research, and was given to us by another lab at Whitney who routinely used the protocol for describing the spatiotemporal patterning of transcription factors in the embryos of the burrowing anemone Nematos tella vectensis ( Wolenski et al., 2013 ) . We believed that this method might be more suitable for detecting Cb CCAPr transcripts in the STG because of its higher sensitivity. Results are preliminary, but I feel confident that through some

PAGE 157

157 adjustments in incubation periods (pointed out in the protocol) this technique may produce accurate detection of the receptor, e specially if combined with the TSA amplification technique used in the above protocol. The methods below are adjusted slightly to accommodate for use on whole mount STGs. Details for some buffer compositions not listed can be found in the published protoco l ( Wolenski et al., 2013 ) . Also, see lab book pages 023_054 for probe synthesis, and 023_055 for actual protocol test. Probe synthesis : After final, re suspension step, measure the concentration of probe and dilute the probe in hybridization buffer (no salmon sperm DNA) to a concentration of 20°C, from which aliquots will be taken and diluted to ~1 ng/µl in hybridization buffer (with salmon sperm DNA). The se probes can then be reused up to 5 times, when stored at 20°C after each use. Solutions : all solutions are prepared fresh, the day of the protocol. The only solutions that may be kept long term as stocks are PBS, PTW, and PBT (all stored at 4°C). Day 1 A ll steps are carried out at room temperature with gentle rocking, unless noted seconds. 1. Prepare STG preparations exactly as described in Orco in situ : Pin to sylga rd and desheath; fix in 4% Paraformaldehyde/PBS at 4°C for 2 hr; Wash with PTW; Dehydrate in PTW:MeOH series and store at 20°C, or rehydrate after reaching 100% MeOH. 2. 1 quick wash in PTW, followed by a 5 min wash in PTW. 3. Proteinase K digestion (0.01 mg/m l PTW): STG = 3 min. No rocking!

PAGE 158

158 4. Stop digestion with 5 min wash in Glycine/PTW, 2x. 5. 5 min wash in 1% Triethanolamine 2x. 6. 5 min wash in 1% Triethanolamine + 3 µ l/ml acetic anhydride . 7. 5 min wash in 1% Triethanolamine + 6 µ l/ml acetic anhydride . 8. 2 quick washes PTW, followed by a 5 min wash in PTW. 9. Fix in 4% Paraformaldehyde/PTW for 1 hr. During this time, prepare hybridization buffer (with and without salmon sperm/tRNA). 10. Wash with PTW for 5min, 5x. 11. Transfer preps to a new, sterile well plate. Add hybridization buffer (with salmon sperm DNA) and incubate for 10 min at room temp. 12. Prehybridization: Transfer to fresh hybridization buffer (with salmon sperm DNA) and incubate for between 2 and 5 days at 63°C be sure to seal plate in Tupperware with a damp paper tow el to prevent evaporation, and monitor level of hybridization buffer each day. It is imperative that longer time is taken during prehybridization, as this decreases background noise that eventually develops during the extensive time it takes to develop the probe signal. Day 2 A ll steps are on rocking table in the incubator. 13. Dilute DIG labeled probe stock into hybridization buffer (with salmon sperm DNA) and heat in 90°C heat block for 10 min maximum. This will need to be done each time the diluted prob e is used. 14. Add enough diluted probe to cover tissue (0.5 1 ml) and place back in Tupperware with damp paper towel and hybridize over 2 3 days at 63°C. Day 3 A ll steps are on rocking table in the incubator or at room temperature.

PAGE 159

159 15. Prepare SSC solutions and warm to hybridization temperature (63°C). Transfer preps to warmed hybridization buffer (HB; no salmon sperm DNA), and replace probes in tubes and store at 20°C. Place preps, in fresh HB, back in incubator for 10 min. 16. Conduct the following washes: 30 min in 75% HB /25% 2X SSC at 63°C 30 min in 50% HB /50% 2X SSC at 63°C 30 min in 25% HB /75% 2X SSC at 63°C 30 min in 100% 2X SSC (pH 7.0) 63°C 2 x 20 min in 0.02X SSC at 63°C 1 x 20 min in 0.02X SSC at room temp 10 min in 75% 0.02X SSC/25% PTW at room temp 10 min in 50% 0.02X SSC /50% PTW at room temp 10 min in 25% 0.02X SSC /75% PTW at room temp 10 min in 100% PTW at room temp 17. Begin probe development: Wash for 10 min in PBT at room temp, 5x. During final wash, make exact volume of blocking buffer (Boehringer Mannheim, diluted to 1X in maleic acid buffer) for blocking. 18. Block preps over night at 4°C. Day 4 A ll steps are carried out with gentle rocking. 19. Prepare fresh blocking buffer. Dilute antibody (anti DIG::alkaline phosphatase) 1:5,000 in block ing buffer. Place in 4°C for at least 1 hour before use, with gentle rocking.

PAGE 160

160 20. Apply blocking buffer + antibodies to preparation. Incubate overnight at 4°C with gentle rocking. D ay 5 Development: This lasted up to 9 days for my first trial run, in which I allowed the preparations to develop at room temperature during the day and 4°C at night after the first two days. 21. Wash with PTX: 5x (2 quick washes, 1 20 min wash). Prepare alkaline phosphatase buffer (AP; 100 mM NaCl, 100 mM Tris pH 9.5, 0.5% Tween 20) during final wash, with and without MgCl 2 . 22. Wash 10 min in AP buffer without MgCl 2 . 23. Wash 10 min in AP buffer with MgCl 2 , 2x. During final wash, prepare AP substrate solution: AP buffer + 3.3 µl/ml NBT and BCIP (Roche Diagnostics). 24. Develop in just enough sol ution to cover tissue. Begin at room temp, and then move to 4°C overnight. Wrap the plate with foil to protect the reaction from the light. Monitor the reaction every 30 min, and replace solution with fresh substrate solution before it turns purple. **This step may last up to several months...*** 25. Stop development with 5 washes in PTW, followed by hybridization washes to remove background signals see publication for details ( Wolenski et al., 2013 ) . 26. Wash with PTW to completely remove hybridization buffer, and then follow dehydration and mounting protocol described in Orco i n situ . Results and D iscussion Orco transcripts were successfully detected in two cell bodies in the STG using the first in situ m ethod, adapted from a published protocol ( Jezzini et al. , 2005 ) . Only two neurons in the STG occur as two copies ( Selverston et al., 1976 ) , the pyloric dilator (PD) neurons, and the LPG neurons. Based on the primary function of Orco in crayfish

PAGE 161

161 being the enhancement of hind gut contractions, we suspected that it would be expressed by neurons that innervate gastric muscles. LPG is able to swing from the pyloric to the gastric mill rhythms, depending on sensory cues ( Bucher et al., 2006 ) , but LPG innervates the gastric mill muscle gm 3a. And so we hypothesized that the LPG neurons were the unidentified cell bodies that express orcokinin. Using standard electrophysiology techniques, both LPG neurons were identified and filled ionophoretically with the fluorescent dye Alexa 568 hydrazide (Life Technologies). The STG was then r emoved from the rig and fixed for 2 hr at 4°C, and then dehydrated according to the first in situ method. Antisense probes generated against a cloned fragment of the orcokinin gene (approximately 950 base pairs in length) were applied and upon development, darkly stained two neural cell bodies. Sense probes had no specific staining (not show n). Figure B 2 sh ows the fluorescent and bright field micrographs of the STG, and when merged it is clear that the neurons expressing Orco in C. borealis are the LPG neu rons. We also examined the localization of two other neuropeptides, the pigment dispersing hormone (PDH) and red pigment concentrating hormone (RPCH), in addition to Orco in the brain of C. borealis . All three neuropeptides dis played specific staining and distinct localization to neuronal cell groups within the brain (Fig. B 3). Br ief comparison to anatomical brain regions of the mud crab Scylla serrata ( Sandeman et al., 1992 ) suggest that these neuropeptides have function specific organization in C. borealis brain, but more work needs to be done to confirm and describe it further. Once we had the in situ protocol, we developed probes against cloned fragments of the Cb CCAPr, ranging in size from 450 to 780 base pairs in length. For earlier trials,

PAGE 162

162 sense probes were run in parallel as negative controls, and an Orco antisense probe as a positive control. Routinely, Orco probes would produce positive results, where as all Cb CCAPr generated probes would produce background noise and non sp ecific staining , including a sequestration of the probes in the nuclei of the neurons (Fig. B 4). At the time, it was thought that the transcript copy number in the six neurons in the STG might be too low for detection, and so we sought nervous tissues that might contain more transcripts. The cardiac ganglion (CG) of crustaceans responds to the peptide CCAP ( Fort et al., 2007 ) , and single cell PCR conducted by D. Schulz in the cardiac large cells revealed the presence of Cb CCAPr transcripts (not shown), so we tested the in situ protocol on CG preparations as well. Once again, Cb CCAPr was not detected in either the STG or CG using the first in situ protocol, even when the tissues were developed for up to 25 hour s (Fig. B 4). Fluorescent detection of signals provides a higher sens itivity than the use of chromogenic development, specifically with about a 4 fold increase in sensitivity (Bio Rad, detection methods documentation). To see if the detection method was the problem with low abundance Cb CCAPr during in situ development, we a pplied a fluorescent protocol to the first method. We also tried to increase the signal to noises by using the tyramide signal amplification system, which amplifies the fluorescent signal by using the horseradish peroxidase in the secondary antibody to cat alyze the attachment of a fluorophore to all adjacent tyrosine resid ues (Perkin Elmer). Again, we first tested the protocol using Orco probes as positive controls (Fig. B 5). Additionally, the localization of Orco expression was examined in both the esopha geal (OG; Fig. B 6) and commissural ganglia (CoG; Fig. B 7). High magnification of the in situ preparations

PAGE 163

163 revealed extensive staining in the cytoplasm of th e two neurons in the STG and OG, and several cell bodies were positive for staining in the CoG. Ho wever, Cb CCAPr in situ attempts using fluorescent detection failed (not shown). After a long pause in trial runs, we acquired a new protocol which had higher sensitivity and was developed over longer periods of time to detect low abundance transcripts ( Wolenski et al., 2013 ) . At this point, there was only enough time to run two trials, using Orco as a positive control in each, and two different probes generated against Cb CCAPr. Fi gure B 8 is ta ken from the fi rst trial, which shows the dark staining in two cell bodies, characteristic of Orco signals in the STG, as well as inconclusive, but promising, results in Cb CCAPr detection. We have confirmed through qRT PCR that Cb CCAPr is expressed consistently in 6 neur ons, and inconsistently in 3 others (Chapter 2). While the staining observed in the STG amounts to more than 9 cell bodies, and it is faintly similar to the nuclear sequestration observed in the first chromogenic in situ method, there are two cell bodies t hat appear significantly darker in staining than the rest. From qRT PCR analysis, we identified differential expressional levels by cell type in the STG, and so the difference in intensity may be attributed to expression. The second trial yielded no promis ing results and was filled with background noise which can be attributed to a significantly shorter pre hybridization time (overnight versus 3 days in trial one). The lack of results seen in both trials, as well as both in situ methods, may be related to t he probe design. Some templates, especially with higher GC content, are not (Roche DIG labeling methods). The probes used for Cb CCAPr detection had ~45 52%

PAGE 164

164 GC content, and di fficulties in transcribing such a high content probe may have contributed to poor detection. However, I suggest that the long term in situ protocol looks promising, and by increasing the pre hybridization and development times, in addition to adjusting hybridization temperatures and salt content in the SSC washes to gain higher stringency, that the protocol may prove successful in the future for detection of GPCR transcripts in crustaceans. For now, the first in situ hybridization protocol (associated with Orcokinin detection) is sufficient for detection of neuropeptides in whole mount, crustacean nervous tissues.

PAGE 165

165 Figure B 1 . Probe synthesis and orientation. Diagram with directionality used in the synthesis of antisense and sense probes from a target gene (orange). Target T plasmid (Promega). Dashed lines and red font i ndicate restriction enzymes and sites of cleavage. Blue font and green boxes are transcription promoter sites for RNA polymerase. In this example, the antisense probe would be linearized by NcoI digestion followed by transcription with the Sp6 RNA polymera se, while the sense probe would be linearized by SpeI followed by transcription with T7 RNA polymerase.

PAGE 166

166 Figure B 2 . Lateral posterior gastric (LPG) neurons express orcokinin transcripts in the C. borealis STG. Both LPG neurons were identified and fil led with Alexa 568 fluorescent dye (left panel). The preparation was then processed using the first in situ method protocol, adapted from Jezzeni et al. (2005) and dark staining of orcokinin (Orco) transcripts is detected in two cell bodies (middle panel). A merge of both images reveals colocalization of fluorescent labeling with in situ data, confirming the identity of the neurons expressing Orco as being the LPG neurons.

PAGE 167

167

PAGE 168

168 Figure B 3 . Neuropeptide localization in C. borealis brains. Orcokinin (Orco ; top ), pigment dispersing hormone (PDH ; middle ) and red pigment concentrating hormone (RPCH ; bottom ) are detected in distinct areas of individual brains from C. borealis . Figure B 4 . Final trial of the first in situ method fails to detect Cb CCAPr in the S TG and cardiac ganglion. In situ preparations developed for 25 hours show only non specific staining. (A) Cb CCAPr sense probe in whole STG as negative control. (B) Cb CCAPr antisense probe in whole STG has background and non specific staining. Sequestering of signal is observed in the nuclei of STG neurons. (C) Cb CCAPr antisense probe in medial trunk of CG. Arrows indicate cell bodies of two cardiac large cells. Total time of development for all three preparations: 25 hours.

PAGE 169

169 Figure B 5 . Fluorescent in si tu hybridization localizes Orco transcripts to cytoplasm of both LPG neurons in the STG. Whole mount STG processed through first in situ method usi ng fluorescent amplification in the detection of Orco transcripts. Structure of neurons and ganglion illumina ted using UV light and pseudo colored green. LPG cell bodies ( orange) labeled individ ually (a and b) with panels showing magnification of transcript localization in each. Scale bar: 100 µM.

PAGE 170

170 Figure B 6 . Orco transcripts expressed by neurons in the commissural ganglia. High (right) and low (left) magnifica tion of orco transcript expression (orange) in CoG neurons. Structure of ganglion illuminated using UV light and pseudo colored green. Scale bar: 100 µM. Figure B 7 . Orco transcripts expressed by two neurons in the esophageal ganglion. High (right) and low (left) magnification of orco transcripts in two OG neurons (orange) . Structure of ganglion illuminated using UV light and pseudo colored green. Scale bar: 100 µM.

PAGE 171

171 Figure B 8 . Final in situ hybridization trial using long term method shows preliminary and promising results. (A) Orco antisense probe used as a positive control shows typical staining in two cell bodies (arrows) in the STG. Dashed lines indicate outline of ganglia. (B) Developmen t of Cb CCAPr probe for 9 days reveals variable expression levels in neurons. Two neurons (arrows) appear to have stronger staining than the rest.

PAGE 172

172 LIST OF REFERENCES Alberi S, Dreifuss JJ, Raggenbass M (1997) The oxytocin induced inward current in vagal neurons of the rat is mediated by G protein activation but not by an increase in the intracellular calcium concentration. The European journal of neuroscience 9:2605 2612. Alberi S, Dubois Dauphin M, Dreifuss JJ, Raggenbass M (1993 ) Modulation by divalent cations of the current generated by vasopressin in facial motoneurons. Brain research 624:326 330. Arakane Y, Li B, Muthukrishnan S, Beeman RW, Kramer KJ, Park Y (2008) Functional analysis of four neuropeptides, EH, ETH, CCAP and b ursicon, and their receptors in adult ecdysis behavior of the red flour beetle, Tribolium castaneum. Mech Dev 125:984 995. Arias Carrion O, Stamelou M, Murillo Rodriguez E, Menendez Gonzalez M, Poppel E (2010) Dopaminergic reward system: a short integrativ e review. Int Arch Med 3:24. Arriaga EA (2009) Determining biological noise via single cell analysis. Anal Bioanal Chem 393:73 80. Ayali A (2009) The role of the arthropod stomatogastric nervous system in moulting behaviour and ecdysis. The Journal of expe rimental biology 212:453 459. Ayali A, Johnson BR, Harris Warrick RM (1998) Dopamine modulates graded and spike evoked synaptic inhibition independently at single synapses in pyloric network of lobster. Journal of neurophysiology 79:2063 2069. Ballo AW, Bucher D (2009) Complex intrinsic membrane properties and dopamine shape spiking activity in a motor axon. J Neurosci 29:5062 5074. Baro DJ, Cole CL, Harris Warrick RM (1996a) RT PCR analysis of shaker, shab, shaw, and shal gene expression in single neuron s and glial cells. Receptors Channels 4:149 159. Baro DJ, Coniglio LM, Cole CL, Rodriguez HE, Lubell JK, Kim MT, Harris Warrick RM (1996b) Lobster shal: comparison with Drosophila shal and native potassium currents in identified neurons. The Journal of neu roscience : the official journal of the Society for Neuroscience 16:1689 1701. Baro DJ, Levini RM, Kim MT, Willms AR, Lanning CC, Rodriguez HE, Harris Warrick RM (1997) Quantitative single cell reverse transcription PCR demonstrates that A current magnitud e varies as a linear function of shal gene expression in identified stomatogastric neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 17:6597 6610.

PAGE 173

173 Beinfeld MC, Meyer DK, Brownstein MJ (1980) Cholecystokinin octapep tide in the rat hypothalamo neurohypophysial system. Nature 288:376 378. Belmont M, Cazzamali G, Williamson M, Hauser F, Grimmelikhuijzen CJ (2006) Identification of four evolutionarily related G protein coupled receptors from the malaria mosquito Anophele s gambiae. Biochem Biophys Res Commun 344:160 165. Billimoria CP, Li L, Marder E (2005) Profiling of neuropeptides released at the stomatogastric ganglion of the crab, Cancer borealis with mass spectrometry. J Neurochem 95:191 199. Bjarnadottir TK, Gloriam DE, Hellstrand SH, Kristiansson H, Fredriksson R, Schioth HB (2006) Comprehensive repertoire and phylogenetic analysis of the G protein coupled receptors in human and mouse. Genomics 88:263 273. Blitz DM, Christie AE, Coleman MJ, Norris BJ, Marder E, Nusb aum MP (1999) Different proctolin neurons elicit distinct motor patterns from a multifunctional neuronal network. The Journal of neuroscience : the official journal of the Society for Neuroscience 19:5449 5463. Bockaert J, Pin JP (1999) Molecular tinkering of G protein coupled receptors: an evolutionary success. Embo J 18:1723 1729. Bondy CA, Whitnall MH, Brady LS, Gainer H (1989) Coexisting peptides in hypothalamic neuroendocrine systems: some functional implications. Cell Mol Neurobiol 9:427 446. Bradwejn J, Koszycki D, Meterissian G (1990) Cholecystokinin tetrapeptide induces panic attacks in patients with panic disorder. Can J Psychiatry 35:83 85. Brownstein MJ, Russell JT, Gainer H (1980) Synthesis, transport, and release of posterior pituitary hormones . Science 207:373 378. Bucher D, Marder E (2013) SnapShot: Neuromodulation. Cell 155:482 482 e481. Bucher D, Prinz AA, Marder E (2005) Animal to animal variability in motor pattern production in adults and during growth. The Journal of neuroscience : the o fficial journal of the Society for Neuroscience 25:1611 1619. Bucher D, Taylor AL, Marder E (2006) Central pattern generating neurons simultaneously express fast and slow rhythmic activities in the stomatogastric ganglion. J Neurophysiol 95:3617 3632. Buch er D, Johnson CD, Marder E (2007) Neuronal morphology and neuropil structure in the stomatogastric ganglion of the lobster, Homarus americanus. The Journal of comparative neurology 501:185 205.

PAGE 174

174 Burbach JP, Luckman SM, Murphy D, Gainer H (2001) Gene regulat ion in the magnocellular hypothalamo neurohypophysial system. Physiological reviews 81:1197 1267. Calabrese RL (1998) Cellular, synaptic, network, and modulatory mechanisms involved in rhythm generation. Current opinion in neurobiology 8:710 717. Caldwell HK, Lee HJ, Macbeth AH, Young WS, 3rd (2008) Vasopressin: behavioral roles of an "original" neuropeptide. Prog Neurobiol 84:1 24. Caldwell JD, Greer ER, Johnson MF, Prange AJ, Jr., Pedersen CA (1987) Oxytocin and vasopressin immunoreactivity in hypothalami c and extrahypothalamic sites in late pregnant and postpartum rats. Neuroendocrinology 46:39 47. Chemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, Richardson JA, Williams SC, Xiong Y, Kisanuki Y, Fitch TE, Nakazato M, Hammer RE, Saper CB, Yanagisawa M (1999) Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell 98:437 451. Chen R, Ma M, Hui L, Zhang J, Li L (2009) Measurement of neuropeptides in crustacean hemolymph via MALDI mass spectrometry. J Am Soc Mass Spect rom 20:708 718. Cheung CC, Loi PK, Sylwester AW, Lee TD, Tublitz NJ (1992) Primary structure of a cardioactive neuropeptide from the tobacco hawkmoth, Manduca sexta. FEBS Lett 313:165 168. Chiba O, Sasaki K, Higuchi H, Takashima K (1992) G protein mediatin g the slow depolarization induced by FMRFamide in the ganglion cells of Aplysia. Neurosci Res 15:255 264. Christie AE, Skiebe P, Marder E (1995) Matrix of neuromodulators in neurosecretory structures of the crab Cancer borealis. J Exp Biol 198:2431 2439. C hung JS, Wilcockson DC, Zmora N, Zohar Y, Dircksen H, Webster SG (2006) Identification and developmental expression of mRNAs encoding crustacean cardioactive peptide (CCAP) in decapod crustaceans. The Journal of experimental biology 209:3862 3872. Clark MC, Baro DJ (2006) Molecular cloning and characterization of crustacean type one dopamine receptors: D1alphaPan and D1betaPan. Comp Biochem Physiol B Biochem Mol Biol 143:294 301. Clark MC, Baro DJ (2007) Arthropod D2 receptors positively couple with cAMP through the Gi/o protein family. Comp Biochem Physiol B Biochem Mol Biol 146:9 19. Clark MC, Khan R, Baro DJ (2008) Crustacean dopamine receptors: localization and G protein coupling in the stomatogastric ganglion. J Neurochem 104:1006 1019.

PAGE 175

175 Clark MC, Deve r TE, Dever JJ, Xu P, Rehder V, Sosa MA, Baro DJ (2004) Arthropod 5 HT2 receptors: a neurohormonal receptor in decapod crustaceans that displays agonist independent activity resulting from an evolutionary alteration to the DRY motif. The Journal of neurosc ience : the official journal of the Society for Neuroscience 24:3421 3435. Clemens S, Combes D, Meyrand P, Simmers J (1998) Long term expression of two interacting motor pattern generating networks in the stomatogastric system of freely behaving lobster. J ournal of neurophysiology 79:1396 1408. Cruz Bermudez ND, Marder E (2007) Multiple modulators act on the cardiac ganglion of the crab, Cancer borealis. The Journal of experimental biology 210:2873 2884. da Silva R, Lange AB (2006) The association of crusta cean cardioactive peptide with the spermatheca of the African migratory locust, Locusta migratoria. J Insect Physiol 52:399 409. DeLong ND, Kirby MS, Blitz DM, Nusbaum MP (2009) Parallel regulation of a modulator activated current via distinct dynamics und erlies comodulation of motor circuit output. The Journal of neuroscience : the official journal of the Society for Neuroscience 29:12355 12367. Dickinson PS, Fairfield WP, Hetling JR, Hauptman J (1997) Neurotransmitter interactions in the stomatogastric sy stem of the spiny lobster: one peptide alters the response of a central pattern generator to a second peptide. Journal of neurophysiology 77:599 610. Dircksen H, Neupert S, Predel R, Verleyen P, Huybrechts J, Strauss J, Hauser F, Stafflinger E, Schneider M , Pauwels K, Schoofs L, Grimmelikhuijzen CJ (2011) Genomics, transcriptomics, and peptidomics of Daphnia pulex neuropeptides and protein hormones. J Proteome Res 10:4478 4504. Domschke K et al. (2011) Neuropeptide S receptor gene converging evidence for a role in panic disorder. Mol Psychiatry 16:938 948. Donner J et al. (2010) Assessment of the neuropeptide S system in anxiety disorders. Biol Psychiatry 68:474 483. Dorsam RT, Gutkind JS (2007) G protein coupled receptors and cancer. Nat Rev Cancer 7:79 94. Ducret E, Alexopoulos H, Le Feuvre Y, Davies JA, Meyrand P, Bacon JP, Fenelon VS (2006) Innexins in the lobster stomatogastric nervous system: cloning, phylogenetic analysis, developmental changes and expression within adult identified dye and ele ctrically coupled neurons. The European journal of neuroscience 24:3119 3133.

PAGE 176

176 Dulcis D, Richard B. Levine, John Ewer (2004) Role of the Neuropeptide CCAP in Drosophila Cardiac Function. Developmental Neurobiology 64:259 274. Equihua AC, De La Herran Arita AK, Drucker Colin R (2013) Orexin receptor antagonists as therapeutic agents for insomnia. Front Pharmacol 4:163. Fenelon VS, Le Feuvre Y, Meyrand P (2004) Phylogenetic, ontogenetic and adult adaptive plasticity of rhythmic neural networks: a common neurom odulatory mechanism? J Comp Physiol A Neuroethol Sens Neural Behav Physiol 190:691 705. Fenelon VS, Kilman V, Meyrand P, Marder E (1999) Sequential developmental acquisition of neuromodulatory inputs to a central pattern generating network. The Journal of comparative neurology 408:335 351. Ferguson SS (2001) Evolving concepts in G protein coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacological reviews 53:1 24. Flamm RE, Harris Warrick RM (1986) Aminergic modulation in lobster stomatogastric ganglion. II. Target neurons of dopamine, octopamine, and serotonin within the pyloric circuit. Journal of neurophysiology 55:866 881. Fort TJ, Garcia Crescioni K, Agricola HJ, Brezina V, Miller MW (2007) Regulation of the crab he artbeat by crustacean cardioactive peptide (CCAP): central and peripheral actions. J Neurophysiol 97:3407 3420. Fouad K, Rank MM, Vavrek R, Murray KC, Sanelli L, Bennett DJ (2010) Locomotion after spinal cord injury depends on constitutive activity in sero tonin receptors. Journal of neurophysiology 104:2975 2984. Fredriksson R, Schioth HB (2005) The repertoire of G protein coupled receptors in fully sequenced genomes. Mol Pharmacol 67:1414 1425. Fredriksson R, Lagerstrom MC, Lundin LG, Schioth HB (2003) The G protein coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol Pharmacol 63:1256 1272. Furuya K, Liao S, Reynolds SE, Ota RB, Hackett M, Schooley DA (1993) Isolation and identificati on of a cardioactive peptide from Tenebrio molitor and Spodoptera eridania. Biol Chem Hoppe Seyler 374:1065 1074. Gammie SC, Truman JW (1997) Neuropeptide hierarchies and the activation of sequential motor behaviors in the hawkmoth, Manduca sexta. The Jour nal of neuroscience : the official journal of the Society for Neuroscience 17:4389 4397. Gimpl G, Fahrenholz F (2001) The oxytocin receptor system: structure, function, and regulation. Physiological reviews 81:629 683.

PAGE 177

177 Goaillard JM, Taylor AL, Schulz DJ, Marder E (2009) Functional consequences of animal to animal variation in circuit parameters. Nat Neurosci 12:1424 1430. Gobeil F, Fortier A, Zhu T, Bossolasco M, Leduc M, Grandbois M, Heveker N, Bkaily G, Chemtob S, Barbaz D (2006) G protein coupled recept ors signalling at the cell nucleus: an emerging paradigm. Can J Physiol Pharmacol 84:287 297. Goldberg D, Nusbaum MP, Marder E (1988) Substance P like immunoreactivity in the stomatogastric nervous systems of the crab Cancer borealis and the lobsters Panul irus interruptus and Homarus americanus. Cell Tissue Res 252:515 522. Golowasch J, Marder E (1992) Proctolin activates an inward current whose voltage dependence is modified by extracellular Ca2+. J Neurosci 12:810 817. Goulding M (2009) Circuits controlli ng vertebrate locomotion: moving in a new direction. Nat Rev Neurosci 10:507 518. Grashow R, Brookings T, Marder E (2009) Reliable neuromodulation from circuits with variable underlying structure. Proc Natl Acad Sci U S A 106:11742 11746. Graubard K, Raper JA, Hartline DK (1980) Graded synaptic transmission between spiking neurons. Proceedings of the National Academy of Sciences of the United States of America 77:3733 3735. Gruber CW (2014) Physiology of invertebrate oxytocin and vasopressin neuropeptides. Exp Physiol 99:55 61. Gruhn M, Guckenheimer J, Land B, Harris Warrick RM (2005) Dopamine modulation of two delayed rectifier potassium currents in a small neural network. Journal of neurophysiology 94:2888 2900. Haedo RJ, Golowasch J (2006) Ionic mechanism underlying recovery of rhythmic activity in adult isolated neurons. Journal of neurophysiology 96:1860 1876. Harony H, Wagner S (2010) The contribution of oxytocin and vasopressin to mammalian social behavior: potential role in autism spectrum disorder. N eurosignals 18:82 97. Harris Warrick RM (2010) General principles of rhythmogenesis in central pattern generator networks. Progress in brain research 187:213 222. Harris Warrick RM (2011) Neuromodulation and flexibility in Central Pattern Generator network s. Current opinion in neurobiology 21:685 692. Harris Warrick RM, Johnson BR (2010) Checks and balances in neuromodulation. Frontiers in behavioral neuroscience 4.

PAGE 178

178 Harris DM, Cohn HI, Pesant S, Eckhart AD (2008) GPCR signalling in hypertension: role of GRK s. Clin Sci (Lond) 115:79 89. Heinzel HG, Weimann JM, Marder E (1993) The behavioral repertoire of the gastric mill in the crab, Cancer pagurus: an in situ endoscopic and electrophysiological examination. The Journal of neuroscience : the official journal of the Society for Neuroscience 13:1793 1803. Herring WJ, Snyder E, Budd K, Hutzelmann J, Snavely D, Liu K, Lines C, Roth T, Michelson D (2012) Orexin receptor antagonism for treatment of insomnia: a randomized clinical trial of suvorexant. Neurology 79:22 65 2274. Hofmann KS, W. (1993) TMbase A database of membrane spanning proteins segments. Biological Chemisty Hoppe Seyler 374. Hooper SL, Marder E (1984) Modulation of a central pattern generator by two neuropeptides, proctolin and FMRFamide. Brain resea rch 305:186 191. Hooper SL, Marder E (1987) Modulation of the lobster pyloric rhythm by the peptide proctolin. The Journal of neuroscience : the official journal of the Society for Neuroscience 7:2097 2112. Hooper SL, Buchman E, Weaver AL, Thuma JB, Hobbs KH (2009) Slow conductances could underlie intrinsic phase maintaining properties of isolated lobster (Panulirus interruptus) pyloric neurons. J Neurosci 29:1834 1845. Hui L, Xiang F, Zhang Y, Li L (2012) Mass spectrometric elucidation of the neuropeptidom e of a crustacean neuroendocrine organ. Peptides 36:230 239. Husch A, Van Patten GN, Hong DN, Scaperotti MM, Cramer N, Harris Warrick RM (2012) Spinal cord injury induces serotonin supersensitivity without increasing intrinsic excitability of mouse V2a int erneurons. The Journal of neuroscience : the official journal of the Society for Neuroscience 32:13145 13154. Inder WJ, Donald RA, Prickett TC, Frampton CM, Sullivan PF, Mulder RT, Joyce PR (1997) Arginine vasopressin is associated with hypercortisolemia a nd suicide attempts in depression. Biol Psychiatry 42:744 747. Insel PA, Snead A, Murray F, Zhang L, Yokouchi H, Katakia T, Kwon O, Dimucci D, and Wilderman A (2011) GPCR expression in tissues and cells: Are the optimal receptors being used as drug targets ? Br J Pharmacol 165:1613 1616. Ishak WW, Kahloon M, Fakhry H (2011) Oxytocin role in enhancing well being: a literature review. J Affect Disord 130:1 9. Jezzini SH, Bodnarova M, Moroz LL (2005) Two color in situ hybridization in the CNS of Aplysia califor nica. J Neurosci Methods 149:15 25.

PAGE 179

179 Jirikowski GF, Ramalho Ortigao FJ, Caldwell JD (1991) Transitory coexistence of oxytocin and vasopressin in the hypothalamo neurohypophysial system of parturient rats. Horm Metab Res 23:476 480. Jirikowski GF, Herbert Z, Petrusz P, Sendemir E, Caldwell JD (2005) Co expression of vasopressin and androgen binding protein in the rat hypothalamus. J Chem Neuroanat 29:233 237. Johnson BR, Peck JH, Harris Warrick RM (1993) Dopamine induces sign reversal at mixed chemical electr ical synapses. Brain research 625:159 164. Johnson BR, Peck JH, Harris Warrick RM (1994) Differential modulation of chemical and electrical components of mixed synapses in the lobster stomatogastric ganglion. J Comp Physiol A 175:233 249. Johnson BR, Peck JH, Harris Warrick RM (1995) Distributed amine modulation of graded chemical transmission in the pyloric network of the lobster stomatogastric ganglion. Journal of neurophysiology 74:437 452. Johnson BR, Kloppenburg P, Harris Warrick RM (2003) Dopamine modulation of calcium currents in pyloric neurons of the lobster stomatogastric ganglion. Journal of neurophysiology 90:631 643. Jones DT, Taylor WR, Thornton JM (1992) The rapid generation of mutation data matrices from protein sequences. Comput Appl Bios ci 8:275 282. Joost P, Methner A (2002) Phylogenetic analysis of 277 human G protein coupled receptors as a tool for the prediction of orphan receptor ligands. Genome Biol 3:RESEARCH0063. Jorge Rivera JC, Sen K, Birmingham JT, Abbott LF, Marder E (1998) Te mporal dynamics of convergent modulation at a crustacean neuromuscular junction. Journal of neurophysiology 80:2559 2570. Katz PS (1995) Intrinsic and extrinsic neuromodulation of motor circuits. Current opinion in neurobiology 5:799 808. Khorkova O, Golow asch J (2007) Neuromodulators, not activity, control coordinated expression of ionic currents. J Neurosci 27:8709 8718. Kiehn O, Butt SJ (2003) Physiological, anatomical and genetic identification of CPG neurons in the developing mammalian spinal cord. Pro g Neurobiol 70:347 361. Kilman VL, Marder E (1996) Ultrastructure of the stomatogastric ganglion neuropil of the crab, Cancer borealis. The Journal of comparative neurology 374:362 375. King N, Hittinger CT, Carroll SB (2003) Evolution of key cell signalin g and adhesion protein families predates animal origins. Science 301:361 363.

PAGE 180

180 Kirby MS, Nusbaum MP (2007) Peptide hormone modulation of a neuronally modulated motor circuit. J Neurophysiol 98:3206 3220. Kirk MD, Taussig R, Scheller RH (1988) Egg laying hor mone, serotonin, and cyclic nucleotide modulation of ionic currents in the identified motoneuron B16 of Aplysia. The Journal of neuroscience : the official journal of the Society for Neuroscience 8:1181 1193. Kristan WB, Jr., Calabrese RL, Friesen WO (2005 ) Neuronal control of leech behavior. Prog Neurobiol 76:279 327. Kushner PD, Barker DL (1983) A neurochemical description of the dopaminergic innervation of the stomatogastric ganglion of the spiny lobster. J Neurobiol 14:17 28. Kvarta MD, Harris Warrick R M, Johnson BR (2012) Neuromodulator evoked synaptic metaplasticity within a central pattern generator network. Journal of neurophysiology 108:2846 2856. Laas K, Reif A, Akkermann K, Kiive E, Domschke K, Lesch KP, Veidebaum T, Harro J (2014) Neuropeptide S receptor gene variant and environment: contribution to alcohol use disorders and alcohol consumption. Addict Biol. Lange AB, Patel K (2005) The presence and distribution of crustacean cardioactive peptide in the central and peripheral nervous system of the stick insect, Baculum extradentatum. Regul Pept 129:191 201. Lange AB, da Silva R (2007) Neural and hormonal control of muscular activity of the spermatheca in the locust, Locusta migratoria. Peptides 28:174 184. Lee D, Orchard I, Lange AB (2013) Evidence for a conserved CCAP signaling pathway controlling ecdysis in a hemimetabolous insect, Rhodnius prolixus. Front Neurosci 7:207. Lee DH, Paluzzi JP, Orchard I, Lange AB (2010) Isolation, cloning and expression of the Crustacean Cardioactive Peptide gene in the Chagas' disease vector, Rhodnius prolixus. Peptides. Lee HJ, Macbeth AH, Pagani JH, Young WS, 3rd (2009a) Oxytocin: the great facilitator of life. Prog Neurobiol 88:127 151. Lee R, Ferris C, Van de Kar LD, Coccaro EF (2009b) Cerebrospinal fluid oxytoc in, life history of aggression, and personality disorder. Psychoneuroendocrinology 34:1567 1573. Lesniak A, Lipkowski AW (2011) Opioid peptides in peripheral pain control. Acta Neurobiol Exp (Wars) 71:129 138.

PAGE 181

181 Li B, Beeman RW, Park Y (2011) Functions of duplicated genes encoding CCAP receptors in the red flour beetle, Tribolium castaneum. J Insect Physiol 57:1190 1197. Li B, Predel R, Neupert S, Hauser F, Tanaka Y, Cazzamali G, Williamson M, Arakane Y, Verleyen P, Schoofs L, Schachtner J, Grimmelikhuijzen CJ, Park Y (2008) Genomics, transcriptomics, and peptidomics of neuropeptides and protein hormones in the red flour beetle Tribolium castaneum. Genome Res 18:113 122. Li L, Pulver SR, Kelley WP, Thirumalai V, Sweedler JV, Marder E (2002) Orcokinin peptide s in developing and adult crustacean stomatogastric nervous systems and pericardial organs. The Journal of comparative neurology 444:227 244. Li L, Kelley WP, Billimoria CP, Christie AE, Pulver SR, Sweedler JV, Marder E (2003) Mass spectrometric investigat ion of the neuropeptide complement and release in the pericardial organs of the crab, Cancer borealis. J Neurochem 87:642 656. Lukas M, Neumann ID (2013) Oxytocin and vasopressin in rodent behaviors related to social dysfunctions in autism spectrum disorde rs. Behav Brain Res 251:85 94. Luther JA, Robie AA, Yarotsky J, Reina C, Marder E, Golowasch J (2003) Episodic bouts of activity accompany recovery of rhythmic output by a neuromodulator and activity deprived adult neural network. J Neurophysiol 90:2720 2 730. Luttrell LM, Lefkowitz RJ (2002) The role of beta arrestins in the termination and transduction of G protein coupled receptor signals. J Cell Sci 115:455 465. Ma M, Wang J, Chen R, Li L (2009) Expanding the Crustacean neuropeptidome using a multifacet ed mass spectrometric approach. J Proteome Res 8:2426 2437. MacLean JN, Zhang Y, Johnson BR, Harris Warrick RM (2003) Activity independent homeostasis in rhythmically active neurons. Neuron 37:109 120. MacLean JN, Zhang Y, Goeritz ML, Casey R, Oliva R, Guc kenheimer J, Harris Warrick RM (2005) Activity independent coregulation of IA and Ih in rhythmically active neurons. J Neurophysiol 94:3601 3617. Mamiya A, Manor Y, Nadim F (2003) Short term dynamics of a mixed chemical and electrical synapse in a rhythmic network. The Journal of neuroscience : the official journal of the Society for Neuroscience 23:9557 9564. Manor Y, Nadim F, Abbott LF, Marder E (1997) Temporal dynamics of graded synaptic transmission in the lobster stomatogastric ganglion. The Journal of neuroscience : the official journal of the Society for Neuroscience 17:5610 5621. Marder E (1974) Acetylcholine as an excitatory neuromuscular transmitter in the stomatogastric system of the lobster. Nature 251:730 731.

PAGE 182

182 Marder E (2002) Non mammalian model s for studying neural development and function. Nature 417:318 321. Marder E (2012) Neuromodulation of neuronal circuits: back to the future. Neuron 76:1 11. Marder E, Bucher D (2001) Central pattern generators and the control of rhythmic movements. Curr B iol 11:R986 996. Marder E, Thirumalai V (2002) Cellular, synaptic and network effects of neuromodulation. Neural Netw 15:479 493. Marder E, Goaillard JM (2006) Variability, compensation and homeostasis in neuron and network function. Nat Rev Neurosci 7:563 574. Marder E, Bucher D (2007) Understanding circuit dynamics using the stomatogastric nervous system of lobsters and crabs. Annual review of physiology 69:291 316. Marder E, Hooper SL, Siwicki KK (1986) Modulatory action and distribution of the neuropept ide proctolin in the crustacean stomatogastric nervous system. The Journal of comparative neurology 243:454 467. Marder E, Calabrese RL, Nusbaum MP, Trimmer B (1987) Distribution and partial characterization of FMRFamide like peptides in the stomatogastric nervous systems of the rock crab, Cancer borealis, and the spiny lobster, Panulirus interruptus. The Journal of comparative neurology 259:150 163. Maurel B, Le Digarcher A, Dantec C, Journot L (2011) Genome wide profiling of G protein coupled receptors in cerebellar granule neurons using high throughput, real time PCR. BMC Genomics 12:241. Maynard DM (1972) Simpler networks. Ann N Y Acad Sci 193:59 72. Maynard DM DM (1974) The structure of the stomatogastric neuromuscular system in Callinectes sapidus, Hom arus americanus and Panulirus argus (Decapoda Crustacea). Philos Trans R Soc Lond B Biol Sci 268:161 220. McClellan AD, Kovalenko MO, Benes JA, Schulz DJ (2008) Spinal cord injury induces changes in electrophysiological properties and ion channel expression of reticulospinal neurons in larval lamprey. J Neurosci 28:650 659. Merighi A (2002) Costorage and coexistence of neuropeptides in the mammalian CNS. Prog Neurobiol 66:161 190. Merighi A, Salio C, Ferrini F, Lossi L (2011) Neuromodulatory functi on of neuropeptides in the normal CNS. J Chem Neuroanat 42:276 287.

PAGE 183

183 Mezey E, Reisine TD, Skirboll L, Beinfeld M, Kiss JZ (1986) Role of cholecystokinin in corticotropin release: coexistence with vasopressin and corticotropin releasing factor in cells of the rat hypothalamic paraventricular nucleus. Proceedings of the National Academy of Sciences of the United States of America 83:3510 3512. Mignot EJ (2014) History of narcolepsy at Stanford University. Immunol Res 58:315 339. Mika J, Obara I, Przewlocka B (2011) The role of nociceptin and dynorphin in chronic pain: implications of neuro glial interaction. Neuropeptides 45:247 261. Miller EK, Cohen JD (2001) An integrative theory of prefrontal cortex function. Annu Rev Neurosci 24:167 202. Mizrahi A, Dickin son PS, Kloppenburg P, Fenelon V, Baro DJ, Harris Warrick RM, Meyrand P, Simmers J (2001) Long term maintenance of channel distribution in a central pattern generator neuron by neuromodulatory inputs revealed by decentralization in organ culture. The Journ al of neuroscience : the official journal of the Society for Neuroscience 21:7331 7339. Nadim F, Manor Y (2000) The role of short term synaptic dynamics in motor control. Current opinion in neurobiology 10:683 690. Nadim F, Bucher D (2014) Neuromodulation of neurons and synapses. Current opinion in neurobiology 29C:48 56. Nahar J, Lett KM, Schulz DJ (2012) Restoration of descending inputs fails to rescue activity following deafferentation of a motor network. Journal of neurophysiology. Nambu T, Sakurai T, M izukami K, Hosoya Y, Yanagisawa M, Goto K (1999) Distribution of orexin neurons in the adult rat brain. Brain research 827:243 260. Nickols HH, Conn PJ (2014) Development of allosteric modulators of GPCRs for treatment of CNS disorders. Neurobiol Dis 61:55 71. Nusbaum MP (2002) Regulating peptidergic modulation of rhythmically active neural circuits. Brain Behav Evol 60:378 387. Nusbaum MP, Marder E (1989a) A modulatory proctolin containing neuron (MPN). II. State dependent modulation of rhythmic motor acti vity. The Journal of neuroscience : the official journal of the Society for Neuroscience 9:1600 1607. Nusbaum MP, Marder E (1989b) A modulatory proctolin containing neuron (MPN). I. Identification and characterization. The Journal of neuroscience : the off icial journal of the Society for Neuroscience 9:1591 1599. Nusbaum MP, Beenhakker MP (2002) A small systems approach to motor pattern generation. Nature 417:343 350.

PAGE 184

184 Nusbaum MP, Blitz DM, Swensen AM, Wood D, Marder E (2001) The roles of co transmission in neural network modulation. Trends Neurosci 24:146 154. O'Leary T, Marder E (2014) Neuroscience. Mapping neural activation onto behavior in an entire animal. Science 344:372 373. O'Leary T, Williams AH, Caplan JS, Marder E (2013) Correlations in ion channel expression emerge from homeostatic tuning rules. Proceedings of the National Academy of Sciences of the United States of America 110:E2645 2654. Oginsky MF, Rodgers EW, Clark MC, Simmons R, Krenz WD, Baro DJ (2010) D(2) receptors receive paracrine neurotr ansmission and are consistently targeted to a subset of synaptic structures in an identified neuron of the crustacean stomatogastric nervous system. The Journal of comparative neurology 518:255 276. Okamura N, Reinscheid RK (2007) Neuropeptide S: a novel m odulator of stress and arousal. Stress 10:221 226. Okaty BW, Sugino K, Nelson SB (2011) A quantitative comparison of cell type specific microarray gene expression profiling methods in the mouse brain. PLoS One 6:e16493. Oliver G, Schafer EA (1895) On the P hysiological Action of Extracts of Pituitary Body and certain other Glandular Organs: Preliminary Communication. The Journal of physiology 18:277 279. Overington JP, Al Lazikani B, Hopkins AL (2006) How many drug targets are there? Nat Rev Drug Discov 5:99 3 996. Pape HC, Jungling K, Seidenbecher T, Lesting J, Reinscheid RK (2010) Neuropeptide S: a transmitter system in the brain regulating fear and anxiety. Neuropharmacology 58:29 34. Park JH, Schroeder AJ, Helfrich Forster C, Jackson FR, Ewer J (2003) Targ eted ablation of CCAP neuropeptide containing neurons of Drosophila causes specific defects in execution and circadian timing of ecdysis behavior. Development 130:2645 2656. Park Y, Kim YJ, Adams ME (2002) Identification of G protein coupled receptors for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand receptor coevolution. Proc Natl Acad Sci U S A 99:11423 11428. Park Y, Aikins J, Wang LJ, Beeman RW, Oppert B, Lord JC, Brown SJ, Lorenzen MD, Richards S, Weinstock GM, Gibb s RA (2008) Analysis of transcriptome data in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol 38:380 386.

PAGE 185

185 Peck JH, Nakanishi ST, Yaple R, Harris Warrick RM (2001) Amine modulation of the transient potassium current in identified cells of the lobster stomatogastric ganglion. Journal of neurophysiology 86:2957 2965. Peck JH, Gaier E, Stevens E, Repicky S, Harris Warrick RM (2006) Amine modulation of Ih in a small neural network. Journal of neurophysiology 96:2931 2940. Phlippen MK, Webster SG, Chung JS, Dircksen H (2000) Ecdysis of decapod crustaceans is associated with a dramatic release of crustacean cardioactive peptide into the haemolymph. The Journal of experimental biology 203:521 536. Pitti T, Manoj N (2012) Molecular evolution of the neuropeptide S receptor. PLoS One 7:e34046. Prinz AA, Bucher D, Marder E (2004) Similar network activity from disparate circuit parameters. Nature neuroscience 7:1345 1352. Puig MV, Antzoulatos EG, Miller EK (2014) Prefrontal dopamine in associative learn ing and memory. Neuroscience. Pulver SR, Marder E (2002) Neuromodulatory complement of the pericardial organs in the embryonic lobster, Homarus americanus. The Journal of comparative neurology 451:79 90. Raggenbass M, Dreifuss JJ (1992) Mechanism of action of oxytocin in rat vagal neurones: induction of a sustained sodium dependent current. The Journal of physiology 457:131 142. Regard JB, Sato IT, Coughlin SR (2008) Anatomical profiling of G protein coupled receptor expression. Cell 135:561 571. Richards K S, Marder E (2000) The actions of crustacean cardioactive peptide on adult and developing stomatogastric ganglion motor patterns. J Neurobiol 44:31 44. Rodriguez JC, Blitz DM, Nusbaum MP (2013) Convergent rhythm generation from divergent cellular mechanism s. The Journal of neuroscience : the official journal of the Society for Neuroscience 33:18047 18064. Rotzinger S, Lovejoy DA, Tan LA (2010) Behavioral effects of neuropeptides in rodent models of depression and anxiety. Peptides 31:736 756. Rui L (2013) B rain regulation of energy balance and body weight. Rev Endocr Metab Disord 14:387 407. Sakurai T (1999) Orexins and orexin receptors: implication in feeding behavior. Regul Pept 85:25 30.

PAGE 186

186 Sakurai T, Moriguchi T, Furuya K, Kajiwara N, Nakamura T, Yanagisawa M, Goto K (1999) Structure and function of human prepro orexin gene. The Journal of biological chemistry 274:17771 17776. Sakurai T et al. (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein coupled receptors that reg ulate feeding behavior. Cell 92:1 page following 696. Salamone JD, Correa M (2002) Motivational views of reinforcement: implications for understanding the behavioral functions of nucleus accumbens dopamine. Behav Brain Res 137:3 25. Salio C, Lossi L, Merig hi A (2011) Combined light and electron microscopic visualization of neuropeptides and their receptors in central neurons. Methods in molecular biology 789:57 71. Salio C, Lossi L, Ferrini F, Merighi A (2006) Neuropeptides as synaptic transmitters. Cell Tissue Res 326:583 598. Sandeman D, Sandeman R, Derby C, Schmidt M (1992) Morphology of the Brain of Crayfish, Crabs and Spiny Lobsters: A Common Nomenclature for Homologous Structures. Biological Bulletin Decapod Brain Morphology:304 326. Schioth HB, Fred riksson R (2005) The GRAFS classification system of G protein coupled receptors in comparative perspective. Gen Comp Endocrinol 142:94 101. Schulz DJ, Goaillard JM, Marder E (2006) Variable channel expression in identified single and electrically coupled n eurons in different animals. Nature neuroscience 9:356 362. Schulz DJ, Goaillard JM, Marder EE (2007) Quantitative expression profiling of identified neurons reveals cell specific constraints on highly variable levels of gene expression. Proceedings of the National Academy of Sciences of the United States of America 104:13187 13191. Selverston A, Elson R, Rabinovich M, Huerta R, Abarbanel H (1998) Basic principles for generating motor output in the stomatogastric ganglion. Ann N Y Acad Sci 860:35 50. Selver ston AI (2010) Invertebrate central pattern generator circuits. Philosophical transactions of the Royal Society of London Series B, Biological sciences 365:2329 2345. Selverston AI, Russell DF, Miller JP (1976) The stomatogastric nervous system: structure and function of a small neural network. Prog Neurobiol 7:215 290.

PAGE 187

187 Selverston AI, Miller JP, Wadepuhl M (1983) Cooperative mechanisms for the production of rhythmic movements. Symp Soc Exp Biol 37:55 87. Selverston AI MM (1987) The Crustacean Stomatogastric System: Berlin; Springer. Selverston MDA (1975) Organization of the stomatogastric ganglion of the spiny lobster. Parts I V. Journal of Comparative Physiology 91 100. Skiebe P (2001) Neuropeptides are ubiquitous chemical mediators: Using the stomatogastric nervous system as a model system. The Journal of experimental biology 204:2035 2048. Skiebe P, Dietel C, Schmidt M (1999) Immunocytochemical localization of FLRFamide , proctolin , and CCAP like peptides in the stomatogastric nervous system and neurohemal structures of the crayfish, Cherax destructor. The Journal of comparative neurology 414:511 532. Skiebe P, Dreger M, Meseke M, Evers JF, Hucho F (2002) Identification of orcokinins in single neurons in the stomatogastric nervous system of th e crayfish, Cherax destructor. The Journal of comparative neurology 444:245 259. Skiebe P, Dreger M, Borner J, Meseke M, Weckwerth W (2003) Immunocytochemical and molecular data guide peptide identification by mass spectrometry: orcokinin and orcomyotropin related peptides in the stomatogastric nervous system of several crustacean species. Cell Mol Biol (Noisy le grand) 49:851 871. Smith KL, Patterson M, Dhillo WS, Patel SR, Semjonous NM, Gardiner JV, Ghatei MA, Bloom SR (2006) Neuropeptide S stimulates the hypothalamo pituitary adrenal axis and inhibits food intake. Endocrinology 147:3510 3518. Snead AN, Insel PA (2012) Defining the cellular repertoire of GPCRs identifies a profibrotic role for the most highly expressed receptor, protease activated receptor 1, in cardiac fibroblasts. Faseb J 26:4540 4547. Stafflinger E, Hansen KK, Hauser F, Schneider M, Cazzamali G, Williamson M, Grimmelikhuijzen CJ (2008) Cloning and identification of an oxytocin/vasopressin like receptor and its ligand from insects. Procee dings of the National Academy of Sciences of the United States of America 105:3262 3267. Stangier J, Hilbich C, Beyreuther K, Keller R (1987) Unusual cardioactive peptide (CCAP) from pericardial organs of the shore crab Carcinus maenas. Proc Natl Acad Sci U S A 84:575 579. Stangier J, Hilbich C, Dircksen H, Keller R (1988) Distribution of a novel cardioactive neuropeptide (CCAP) in the nervous system of the shore crab Carcinus maenas. Peptides 9:795 800.

PAGE 188

188 Stangier J, Hilbich C, Burdzik S, Keller R (1992) Orc okinin: a novel myotropic peptide from the nervous system of the crayfish, Orconectes limosus. Peptides 13:859 864. Subkhankulova T, Gilchrist MJ, Livesey FJ (2008) Modelling and measuring single cell RNA expression levels find considerable transcriptional differences among phenotypically identical cells. BMC Genomics 9:268. Swensen AM, Marder E (2000) Multiple peptides converge to activate the same voltage dependent current in a central pattern generating circuit. The Journal of neuroscience : the official journal of the Society for Neuroscience 20:6752 6759. Swensen AM, Marder E (2001) Modulators with convergent cellular actions elicit distinct circuit outputs. J Neurosci 21:4050 4058. Szabo TM, Chen R, Goeritz ML, Maloney RT, Tang LS, Li L, Marder E (2011 ) Distribution and physiological effects of B type allatostatins (myoinhibitory peptides, MIPs) in the stomatogastric nervous system of the crab Cancer borealis. The Journal of comparative neurology 519:2658 2676. Taghert PH, Nitabach MN (2012) Peptide neu romodulation in invertebrate model systems. Neuron 76:82 97. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725 2729. Temporal S, Desai M, Khorkova O, Varghese G, D ai A, Schulz DJ, Golowasch J (2012) Neuromodulation independently determines correlated channel expression and conductance levels in motor neurons of the stomatogastric ganglion. Journal of neurophysiology 107:718 727. Terwilliger N, Dumler K (2001) Ontoge ny of decapod crustacean hemocyanin: effects of temperature and nutrition. The Journal of experimental biology 204:1013 1020. Thirumalai V, Prinz AA, Johnson CD, Marder E (2006) Red pigment concentrating hormone strongly enhances the strength of the feedba ck to the pyloric rhythm oscillator but has little effect on pyloric rhythm period. Journal of neurophysiology 95:1762 1770. Thoby Brisson M, Simmers J (1998) Neuromodulatory inputs maintain expression of a lobster motor pattern generating network in a mod ulation dependent state: evidence from long term decentralization in vitro. J Neurosci 18:2212 2225. Thoby Brisson M, Simmers J (2000) Transition to endogenous bursting after long term decentralization requires De novo transcription in a critical time wind ow. J Neurophysiol 84:596 599.

PAGE 189

189 Tublitz NJ, Truman JW (1985) Insect cardioactive peptides. I. Distribution and molecular characteristics of two cardioacceleratory peptides in the tobacco hawkmoth, Manduca sexta. The Journal of experimental biology 114:365 3 79. Tublitz NJ, Cheung CC, Edwards KK, Sylwester AW, Reynolds SE (1992a) Insect cardioactive peptides in Manduca sexta: a comparison of the biochemical and molecular characteristics of cardioactive peptides in larvae and adults. The Journal of experimental biology 165:265 272. Tublitz NJ, Allen AT, Cheung CC, Edwards KK, Kimble DP, Loi PK, Sylwester AW (1992b) Insect cardioactive peptides: regulation of hindgut activity by cardioacceleratory peptide 2 (CAP2) during wandering behaviour in Manduca sexta larva e. The Journal of experimental biology 165:241 264. Tupak SV, Reif A, Pauli P, Dresler T, Herrmann MJ, Domschke K, Jochum C, Haas E, Baumann C, Weber H, Fallgatter AJ, Deckert J, Ehlis AC (2013) Neuropeptide S receptor gene: Fear specific modulations of pr efrontal activation. Neuroimage 66C:353 360. Turner RA, Pierce JG, du VV (1951) The purification and the amino acid content of vasopressin preparations. The Journal of biological chemistry 191:21 28. Turrigiano GG, Selverston AI (1989) Cholecystokinin like peptide is a modulator of a crustacean central pattern generator. The Journal of neuroscience : the official journal of the Society for Neuroscience 9:2486 2501. Turrigiano GG, Selverston AI (1990) A cholecystokinin like hormone activates a feeding relate d neural circuit in lobster. Nature 344:866 868. Turrigiano GG, Van Wormhoudt A, Ogden L, Selverston AI (1994) Partial purification, tissue distribution and modulatory activity of a crustacean cholecystokinin like peptide. The Journal of experimental biolo gy 187:181 200. Van Kesteren RE, Smit AB, De Lange RP, Kits KS, Van Golen FA, Van Der Schors RC, De With ND, Burke JF, Geraerts WP (1995) Structural and functional evolution of the vasopressin/oxytocin superfamily: vasopressin related conopressin is the on ly member present in Lymnaea, and is involved in the control of sexual behavior. The Journal of neuroscience : the official journal of the Society for Neuroscience 15:5989 5998. van Londen L, Goekoop JG, van Kempen GM, Frankhuijzen Sierevogel AC, Wiegant V M, van der Velde EA, De Wied D (1997) Plasma levels of arginine vasopressin elevated in patients with major depression. Neuropsychopharmacology 17:284 292. Wassink TH, Piven J, Vieland VJ, Pietila J, Goedken RJ, Folstein SE, Sheffield VC (2004) Examination of AVPR1a as an autism susceptibility gene. Mol Psychiatry 9:968 972.

PAGE 190

190 Webster SG, Wilcockson DC, Mrinalini, Sharp JH (2013) Bursicon and neuropeptide cascades during the ecdysis program of the shore crab, Carcinus maenas. Gen Comp Endocrinol 182:54 64. We imann JM, Meyrand P, Marder E (1991) Neurons that form multiple pattern generators: identification and multiple activity patterns of gastric/pyloric neurons in the crab stomatogastric system. Journal of neurophysiology 65:111 122. Weimann JM, Marder E, Eva ns B, Calabrese RL (1993) The effects of SDRNFLRFamide and TNRNFLRFamide on the motor patterns of the stomatogastric ganglion of the crab Cancer borealis. The Journal of experimental biology 181:1 26. Weimann JM, Skiebe P, Heinzel HG, Soto C, Kopell N, Jorge Rivera JC, Marder E (1997) Modulation of oscillator interactions in the crab stomatogastric ganglion by crustacean cardioactive peptide. J Neurosci 17:1748 1760. Wersinger SR, Caldwell HK, Christiansen M, Young WS, 3rd (2007) Disruption of the vasopr essin 1b receptor gene impairs the attack component of aggressive behavior in mice. Genes Brain Behav 6:653 660. Wess J (1997) G protein coupled receptors: molecular mechanisms involved in receptor activation and selectivity of G protein recognition. Faseb J 11:346 354. Wess J, Liu J, Blin N, Yun J, Lerche C, Kostenis E (1997) Structural basis of receptor/G protein coupling selectivity studied with muscarinic receptors as model systems. Life Sci 60:1007 1014. Wolenski FS, Layden MJ, Martindale MQ, Gilmore T D, Finnerty JR (2013) Characterizing the spatiotemporal expression of RNAs and proteins in the starlet sea anemone, Nematostella vectensis. Nat Protoc 8:900 915. Wrobel LDAea (2010) Excitatory action of vasopressin in the brain of the rat: role of cAMP sig naling. Neuroscience. Xu YL, Reinscheid RK, Huitron Resendiz S, Clark SD, Wang Z, Lin SH, Brucher FA, Zeng J, Ly NK, Henriksen SJ, de Lecea L, Civelli O (2004) Neuropeptide S: a neuropeptide promoting arousal and anxiolytic like effects. Neuron 43:487 497. Yano K, Subkhankulova T, Livesey FJ, Robinson HP (2006) Electrophysiological and gene expression profiling of neuronal cell types in mammalian neocortex. The Journal of physiology 575:361 365. Ye H, Hui L, Kellersberger K, Li L (2013) Mapping of neuropept ides in the crustacean stomatogastric nervous system by imaging mass spectrometry. J Am Soc Mass Spectrom 24:134 147.

PAGE 191

191 Yeoh JW, Campbell EJ, James MH, Graham BA, Dayas CV (2014) Orexin antagonists for neuropsychiatric disease: progress and potential pitfall s. Front Neurosci 8:36. Yirmiya N, Rosenberg C, Levi S, Salomon S, Shulman C, Nemanov L, Dina C, Ebstein RP (2006) Association between the arginine vasopressin 1a receptor (AVPR1a) gene and autism in a family based study: mediation by socialization skills. Mol Psychiatry 11:488 494. Zhang H, Rodgers EW, Krenz WD, Clark MC, Baro DJ (2010) Cell specific dopamine modulation of the transient potassium current in the pyloric network by the canonical D1 receptor signal transduction cascade. J Neurophysiol 104:873 884. Zhang J, Barak LS, Anborgh PH, Laporte SA, Caron MG, Ferguson SS (1999) Cellular trafficking of G protein coupled receptor/beta arrestin endocytic complexes. The Journal of biological chemistry 274:10999 11006. Zhang Y, Golowasch J (2011) Recovery of rhythmic activity in a central pattern generator: analysis of the role of neuromodulator and activity dependent mechanisms. Journal of computational neuroscience 31:685 699. Zhang Y, Khorkova O, Rodriguez R, Golowasch J (2009) Activity and neuromodulatory input contribute to the recovery of rhythmic output after decentralization in a central pattern generator. J Neurophysiol 101:372 386. Zhao S, Sheibanie AF, Oh M, Rabbah P, Nadim F (2011) Peptide neuromodulation of synaptic dynamics in an oscillatory netw ork. The Journal of neuroscience : the official journal of the Society for Neuroscience 31:13991 14004. Zwanzger P, Domschke K, Bradwejn J (2012) Neuronal network of panic disorder: the role of the neuropeptide cholecystokinin. Depress Anxiety 29:762 774.

PAGE 192

192 BIOGRAPHICAL SKETCH Veronica Jean Garcia cultivated an interest in science while growing up in Hilo, Hawaii. She graduated from Guilford College, North Carolina in 2007 wi th a B.A. in f orensic biology and a concentration in c hemistry. She t hen spent two years as a laboratory technician working for Dr. Dirk Bucher at the Whitney Laboratory for Marine Bioscience, where she developed a curiosity for basic neuroscience as well as a deeper appreciation for marine model systems. Veronica entered t Graduate School in August 2009 to study neuroscience as part of the Interdisciplinary Program in Biomedical Sciences , and ch ose to continue research in the laboratory of Dr. Dirk Bucher. Her studies combined molecular biology and biochemical techniques with electrophysiological methods to examine basic mechanisms behind circuit modulation. In addition to her studies, she participated in several mentoring, outreach and teaching opportunities, as well as the conception and coordinat ion of the first graduate student and post doctoral fellow symposium hosted by the Whitney Laboratory. In December of 2014, Veronica completed her research, earning a Ph.D. in medical sciences, with a concentration in neuroscience. She is currently intent on pursuing a career in which she can combine her research techniques with marine bioscience and remain close to the ocean .