Citation
Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Latency-Associated Genes, v-FLIP and v-Cyclin Down-Regulate TGF-beta Signaling by Inducing the Cellular MicroRNA Cluster miR-17-92

Material Information

Title:
Kaposi's Sarcoma-Associated Herpesvirus (KSHV) Latency-Associated Genes, v-FLIP and v-Cyclin Down-Regulate TGF-beta Signaling by Inducing the Cellular MicroRNA Cluster miR-17-92
Creator:
Choi, Hong Seok
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (102 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Immunology and Microbiology (IDP)
Committee Chair:
RENNE,ROLF FRIEDRICH
Committee Co-Chair:
BLOOM,DAVID C
Committee Members:
WU,LIZI
BUNGERT,JORG
Graduation Date:
12/19/2014

Subjects

Subjects / Keywords:
B lymphocytes ( jstor )
Cyclins ( jstor )
Genes ( jstor )
Human herpesvirus 8 ( jstor )
Infections ( jstor )
Kaposi sarcoma ( jstor )
Lymphoma ( jstor )
MicroRNAs ( jstor )
Open reading frames ( jstor )
Tumors ( jstor )
Immunology and Microbiology (IDP) -- Dissertations, Academic -- UF
gammaherpesevirus -- kshv -- mir-17-92 -- tgf-beta
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Medical Sciences thesis, Ph.D.

Notes

Abstract:
KSHV belongs to the gammaherpesvirinae, which has two unique phases of life cycle, latency and lytic replication. In latency, KSHV expresses a few genes to maintain the viral episome and to maintain persistent infection with the reduced production of viral particles. The lytic reactivation is the phase of the viral infection that produces viral particles that spread to other cells or tissues or to individuals. The lytic and latent phases are tightly regulated and both are associated with KSHV pathogenesis. Array-based miRNA profiling revealed that the miR-17-92 cluster are up-regulated in KSHV infected endothelial cells. Among latent genes, vFLIP and vCyclin were shown to activate the miR-17-92 promoter. We demonstrate that vFLIP and vCyclin induce the expression of the miR-17-92 to strongly inhibit TGF-beta by down-regulating SMAD2, which expression was restored when miR-17-92 antagomirs was treated. In addition, we utilized viral genetics and produced vFLIP or vCyclin knock-out viruses and infected endothelial cells. While single-knockout mutants showed a reduction of expression of SMAD2, TIVE cells infected by a double-knockout mutant virus fully restored SMAD2 expression, compared to non-infected TIVE cells. In summary, these data demonstrate that vFLIP and vCyclin induce the miR-17-92 cluster in endothelial cells to inhibit TGF-beta signaling pathway for KSHV pathogenesis. Dr. Herbert Virgin at University of Washington in St. Louis suggested us to collaborate whether KSHV is reactivated by IL-4 treatment. Among three KSHV infected cell lines with IL-4 treatment, PEL showed significant induction of RTA, lytic switch gene in KSHV at 3 and 5 days. Moreover, the expression of KSHV lytic genes, immediate early, early, and late genes, was increased. The induction of lytic reactivation by IL-4 was confirmed by qPCR method. These results indicated that IL-4 induced by other types of infection can activate KSHV from latency. Also, the results imply that gammaherpesvirus have evolved to sense host immune responses to transition from the latent to the lytic phase. Our data indicate that KSHV modulates the host miRNA expression to disturb the pro-apoptotic TGF-beta signaling pathway and senses the host immune modulatory protein to switch its phase of life cycle into the lytic reactivation. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: RENNE,ROLF FRIEDRICH.
Local:
Co-adviser: BLOOM,DAVID C.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-06-30
Statement of Responsibility:
by Hong Seok Choi.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Choi, Hong Seok. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
6/30/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

ASSOCIAT ED HERPESVIRUS (KSHV) LATENCY ASSOCIATED GENES, V FLIP AND V CYCLIN DOWN R E G U LATE TGF SIGNALING BY INDUCING THE CELLULAR MICRORNA CLUSTER MIR 17 92 By HONG SEOK CHOI A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Hong Seok Choi

PAGE 3

To Dr. Rolf Renne who patiently support s and guide s me all the time and my family who encourage and pray for me everyday

PAGE 4

4 ACKNOWLEDGMENTS It would never have been possible for me to accomplish my research achievement without many people who supported me. Firstly, I would like to appreciate my mentor, Dr. Rolf Renne who gave me a great opportunity to work with a wonderful project in his labor atory. He has always believed in me with patience until I broke through, when I faced obstacles that are hard for me to handle during my doctoral course. Moreover, he has encouraged, motivated, and guided me to accomplish all my research. His advice always inspired me to get through all of the difficulties that I have been through. It was a great honor for me to work in his laboratory under his supervision. I cannot show my respect and gratitude to him with just several sentences. Secondly, I would like to members, Drs. Jianhong Hu, Soo Jin Han, Irina Haecker, Brian Krueger, Isaac Boss, and Karlie Plaisance Bonstaff, helped and were supportive to make me feel comfortable like a family as well as to give me scient ific advice, when I joined in the lab. Also, I appreciate present lab members, Lauren Gay, Vaibhav Jain, Sunantha Sethuraman, and Jacquelyn Serfecz. They all are so brilliant and enthusiastic to science, which inspires me. They gave me ideas to develop and improve my experiments. In addition, Jacquelyn helped me to finish my project and VJ spent a lot of time with me to discuss work and life. Moreover, I deeply thank Peter Christopher Turner. He helped me to finish and polish my dissertation, and gave me a sincere and thoughtful advice that I was encouraged to do my work. Next, I would like to acknowledge all of my committee members, Drs. David Bloom, Jorg Bungert, and Lizi Wu. My research would not have been productive without their outstanding suggestions and advice. Whenever I discussed my work with them, I

PAGE 5

5 was so inspired to do the research. I also want to show my gratitude to Drs. Herbert W. Virgin and Tiffany Reese (Washington University at St. Louis) to give us an opportunity to collaborate with them. In addition, I appreciate Yun Jong Park, Dr. Dae In Kim (Sanford Burnham Institute) and their family who treated me as like family and gave me advice and suggestions in my life as well as in science. I also give my appreciation to friends in the IDP progr am, Kyungah Maeng, and Mehmet Kara. And I sincerely appreciate Dr. Steve Oden. He is my best friend, best English teacher, and best counselor. He was always beside me and encourage me to get through the hurdles whenever I have been through hard time. Last ly, I would like give my special thanks to my parents. Without their support, I would never have decided and been motivated to have a great chance to study in this wonderful environment. They have always been my driving force and fully supportive to achiev e what I want. And I also thank my brother, sister in law and niece (who have not seen yet since she was born). I am happy to have a chance to show my appreciation.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURE S ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 10 CHAPTER 1 BACKGROUND ................................ ................................ ................................ ...... 12 KSHV ................................ ................................ ................................ ...................... 12 General Information ................................ ................................ .......................... 12 Epidemiology and Pathogenesis ................................ ................................ ...... 13 Co factors of KSHV life cycle control ................................ ................................ 14 Latency and Latent Genes ................................ ................................ ............... 15 Kaposin ................................ ................................ ................................ ...... 16 LANA ................................ ................................ ................................ ......... 16 KSHV encoded miRNAs ................................ ................................ ............ 18 vCyclin ................................ ................................ ................................ ....... 19 vFLIP ................................ ................................ ................................ ......... 19 Lytic Replication and Oncogene ................................ ................................ ....... 20 ORF K1 ................................ ................................ ................................ ...... 20 vIL 6 ................................ ................................ ................................ ........... 20 vIRF 1 ................................ ................................ ................................ ........ 21 vGPCR ................................ ................................ ................................ ....... 21 miRNA ................................ ................................ ................................ .................... 22 miRNA Biogenesis ................................ ................................ ........................... 22 Roles of miRNAs ................................ ................................ .............................. 23 miRNAs as tumor suppressors ................................ ................................ .. 24 miRNAs as oncogenes (oncomirs) ................................ ............................. 25 TGF ................................ ................................ ................................ ...... 26 Signaling Pathway of TGF ................................ ................................ ............ 26 TGF ................................ ................................ .............. 28 2 LATENT GENES DOWN REGULATE TGF HUMAN MICRORNA ................................ ................................ .............................. 36 Introduction ................................ ................................ ................................ ............. 36 Experimental Procedures ................................ ................................ ........................ 39 Cell lines ................................ ................................ ................................ ........... 39 MiRNA expression profiling ................................ ................................ .............. 39 Plasmids ................................ ................................ ................................ ........... 41

PAGE 7

7 Transfection and Luc iferase reporter assays ................................ .................... 41 Western blot analysis ................................ ................................ ....................... 42 Quantitative reverse transcription PCR (RT qPCR) analysis ........................... 42 Generation of BAC16 derived recombinant KSHV bacmids in E. coli .............. 43 Recovery of infectious recombinant KSHV in iSLK cells ................................ .. 43 Results ................................ ................................ ................................ .................... 44 The oncogenic miR 17 92 cluster is up regulated in KSHV latently infected cells. ................................ ................................ ................................ .............. 44 The miR 17 92 cluster is transcriptionally up regulated by vFLIP and vCyclin. ................................ ................................ ................................ .......... 45 TGF regulated by vFLIP and vCyclin via increased expression of the miR 17 92 cluster ................................ .............................. 46 SMAD2 inhibition was reduced in cells infected with KSHV mutants lacking vFLIP or vCyclin ................................ ................................ ............................ 47 Discussion ................................ ................................ ................................ .............. 50 3 HUMAN IL 4, INDUCED BY PARASITE INFECTION, INDUCES LYTIC REACTIVATION IN K SHV ................................ ................................ ...................... 62 Introduction ................................ ................................ ................................ ............. 62 Materials and Methods ................................ ................................ ............................ 63 KSHV G ene Expression ................................ ................................ ................... 63 KSHV Isolation and Quantitation ................................ ................................ ...... 63 Results and Discussion ................................ ................................ ........................... 64 4 GATEWAY CLONING SYSTEM FOR KSHV ORFS ................................ ............... 69 Gateway Cloning ................................ ................................ ................................ .... 69 Overview ................................ ................................ ................................ .......... 69 Materials and Methods ................................ ................................ ..................... 70 Primer Design and PCR ................................ ................................ ............. 70 The strains of E. coli ................................ ................................ .................. 71 Result s and Future Goals ................................ ................................ ................. 71 5 OVERALL CONCLUSION ................................ ................................ ...................... 78 LIST OF REFERENCES ................................ ................................ ............................... 85 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 102

PAGE 8

8 LIST OF TABLES Table page 2 1 Primer sequences ................................ ................................ ............................... 53 2 2 Expression of miRNAs in uninfected and KSHV infected SLK and TIVE cells ... 54 3 1 Sequences of primers used for qRT PCR ................................ .......................... 66 4 1 Genes cloned into pDONR vector, time of expression, and function .................. 73

PAGE 9

9 LIST OF FIGURES Figure page 1 1 KSHV genome. Each box represents an open reading frame (ORF) ................. 30 1 2 KSHV latency associated region (KLAR) ................................ ............................ 31 1 3 miRNA biogenesis. Pri miRNAs are transcribed by polymerase II or polymerase III ................................ ................................ ................................ ..... 32 1 4 miRNAs a s tumor suppressor and oncogene ................................ ..................... 33 1 5 Canonical pathway of TGF ................................ ............................... 34 1 6 miR 17 92 cluster and homologues ................................ ................................ .... 35 2 1 Quantitative RT PCR analysis of miRNAs in latently KSHV infected SLK and TIVE cells ................................ ................................ ................................ ........... 55 2 2 KSHV infection increases expression from the miR 17 92 cluster promoter via vFLIP and vCyclin. ................................ ................................ ........................ 56 2 3 vFLIP and vCyclin decrease SMAD2 protein expression and desensitize TGF ................................ ................................ ................................ .. 57 2 4 SMAD2 expression and the response to TGF against the miR 17, 18a, and 20 ................................ ................................ ......... 58 2 5 vFLIP or vCyclin deletion mutant virus recovered the SMAD2 expression in SLK or TIVE cells ................................ ................................ ............................... 59 2 6 SLK cells do not express cellular Myc ................................ ................................ 60 2 7 The miR 17 92 cluster expression by vFLIP and vCyclin is independent of NF signaling pathway ................................ ................................ .................... 61 3 1 RTA expression in various concentration of IL 4 treatment ................................ 67 3 2 IL 4 induces KSHV reactivation ................................ ................................ .......... 68 4 1 Schematic diagram o f the Gateway Cloning procedure ................................ ...... 76 4 2 Vector map of donor vecto r (A) and expression vector (B) ................................ . 77 5 1 Schematic diagram of the KSHV life cycle ................................ ......................... 83 5 2 In silico prediction of transcription factor binding sites in th e promoter of miR 17 92 cluster ................................ ................................ ................................ ....... 84

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ASSOCIAT ED HERPESVIRUS (KSHV) LATENCY ASSOCIATED GENES, V FLIP AND V CYCLIN DOWN RE GU LATE TGF SIGNALING BY INDUCING THE CELLULAR MICRORNA CLUSTER MIR 17 92 By Hong Seok Choi December 2014 Chair: Rolf Renne Major: Medical Science s : Immunology and Microbiology KSHV belong s to the ga mmaherpesvirinae , which has two unique phases of life cycle, latency and lytic replication. In latency, KSHV expresses a few genes to maintain the viral episome and to maintain persistent infection with the reduced production of viral particles. The lytic reactivation is the phase of the viral infection that produce s viral particles t hat spread to other cells or tissues or to individuals. The lytic and latent phases are tightly regulated and both are associated with KSHV pathogenesis. Array based miRNA profiling revealed that the miR 17 92 cluster are up regulated in KSHV infected endothelial cells. Among l atent genes, vFLIP and vCyclin were shown to activate the miR 17 92 promoter . We demonstrate that vFLIP and vCyclin induce the expression of the miR 17 92 to strongly inhibit TGF by down regulating SMAD2 , which expression was restored when miR 17 92 antagomirs was treated . In addition, we utilized viral genetics and produced vFLIP or vCyclin knock out viruses and infected endoth elial cells. While single knockout mutants showed a reduction of expression of SMAD2, TIVE cells infected by a double knockout mutant

PAGE 11

11 virus fully restored SMAD2 expression, compared to non infected TIVE cell s . In summary, these data demonstrate that vFLIP and vCyclin induce the miR 17 92 cluster in end othelial cells to inhibit TGF . Dr. Herbert Virgin at Washington University in St. Louis suggested us to collaborate whether KSHV is reactivated by IL 4 treatment. Amon g three KSHV infected cell lines with IL 4 treatment, PEL showed significant induction of RTA, lytic switch gene in KSHV at 3 and 5 days. Moreover, the expression of KSHV lytic genes, immediate early, early, and late genes, was increased. The induction of lytic reactivation by IL 4 was confirmed by qPCR metho d. These results indicated that IL 4 induced by other types of infection can activate KSHV from latency. Also, the result s imply that gammaherpesvirus have evolve d to sense host immune responses to tran sition from the latent to the lytic phase. O ur data indicate that KSHV modulates the host miRNA expression to disturb the pro apoptotic TGF signaling pathway and senses the host immune modulatory protein to switch its phase of life cycle into the lytic reactivation.

PAGE 12

12 CHAPTER 1 BACKGROUND KSHV General I nformation associated herpesvirus (KSHV), also known as Human Herpesvirus 8 (HHV 8), is categorized as a herpesvirus. KSHV is associated with ) ( Chang et al., 1994 ) . associated herpesvirus) belongs to herpesvirinae subfamily, together with EBV ( Epstein Barr virus), HVS (herpesvirus samiri), and MHV68 (murine gamma herpesvirus 68). The viruses in this family are unique since they cause several types of cancers. KSHV is associated with PEL (primary effusion name indicates. The effort to find the etiologic al agent of KS was not intense until the 1980s when the AIDS epidemic gave high incidence of KS , a common symptom among AIDS patients. It was not until 1994 that KSHV was first discovered in KS skin lesions of AIDS KS patients by Chang et al. using represe ntational difference analysis (RDA) ( Chang et al., 1994 ) . RDA is a technique used to compare two DNA samples by PCR amplification and analyze differences using subtractive DNA hybridization ( Schutte et al., 1995 ) . Sequencing analysis of KSHV placed the virus in the gamma herpesvirus family along with Epstein Barr virus ( Neipel et al., 1997b ; Russo et al., 1996 ) . KSHV is most related to a primate herpesvirus, herpesvirus saimiri (HVS), thus placing it in the rhadinovirus subfamily ( Desrosiers et al., 1997 ) .

PAGE 13

13 Epidemiology and P athogenesis Hungarian dermatologist, Dr. Moritz Kaposi, first described the KS as ( Kaposi, 1872 ) . The typical characteristics of KS are the red or brown skin lesions in pigmentation, which are found in mucosal area s in the oral cavity as well as cutaneous ly . KSHV infected endothelial cells show a spindle shape d morphology and proliferate very aggressively. KS is categorized into four clinical subtypes, depending on epidemiology and clinical features; classic, endemic, AIDS associated and iatrogenic. Patients of classic KS are typically Mediterranean and eastern European men ov er 50s. The other types of cancers, like lymphomas, may develope in these patients ( Friedman Birnbaum et al., 1990 ; Iscovich et al., 1999 ) . Endemic KS is found in sub Saharan African countries. Unlike the form of classic KS, endemic KS has more lymph node involvement and found occurs in children resulting in a high rate of high fatality ( Amir et al., 200 1 ) . Because the diagnosis of KS was also increased when AIDS incidence peaked in the 1980s, KS became a marker for AIDS ( Mbulaiteye et al., 2003 ) . AIDS associated KS was decreased after the introduction of highly active antiretroviral therapy (HAART) in the 1990s . However, KS is still the most common AIDS associated malignancy in developing countries ( Casper and Wald, 2007 ; Tam et al ., 2002 ) . The last form of KS is iatrogenic, due to long term immunosuppressive therapy after organ transplantation. Although this subtype of KS is more aggressive than classical KS, reduction or withdrawal of immunosuppressive therapy is effective to resolve iatro genic KS ( Wen and Damania, 2010 ) . KS is not the only malignancy associate d with KSHV. T here are two other types of cancers caused by KSHV; primary effusion lymphoma (PEL), and multicentric Castleman disease (MCD). PEL is a type of non

PAGE 14

14 commonly found in immunocompromised AIDS patients who have no acce ss to antiretroviral therapy ( Cesarman et al., 1995 ) . PEL is also known as body cavity based lymphoma (BCBL) and derived from aggressively prolife rative and clonally expanded B cell . PEL is aggressive and highly fatal, showing 2 6 months of mean survival time in PEL patients. PEL cells contain high copy number of KSHV genome, and are often co infected with Epstein Barr virus (EBV) ( Cesarman et al., 1995 ; Renne et al., 1996 ; Staudt et al., 2004 ) . MCD, also associated with KSHV, is a reactive lymphadenopathy. Histological features of MCD are germinal center expansion and vascular endothelial proliferation in lymph nodes. KSHV genomes are detected from HIV positive MCD patients and about 50% of HIV n egative MCD patoents ( Grandadam et al., 1997 ) . Like KS and PEL, MCD is also aggress ive and highly fatal. However, KSHV showed more lytic replication in MCD than latency, compared to KSHV in KS and PEL ( St askus et al., 1999 ) . Co factors of KSHV life cycle control Well controlled regulation of latency and lytic replication during the KSHV life cycle is very important to preserve its own genome inside the host cells during latency and to transmit the progeny viruses to other cells or individuals after reactivation . Yet, the factors to reactivate KSHV have not been well elucidated. It is known that immune suppression by transplantation or human immunodeficiency virus (HIV) infection causes a high risk of KS and high viral particle load in KSHV infected individuals ( Merat et al., 2002 ) ( Laney et al., 2007 ) ( Bagni and Whitby, 2009 ) . However , the relationship between KSHV seropositivity and KS incidence in HIV non infected individuals is complicate d to solve , especially in sub Saharan Africa. Generally, KSHV seropositivity is directly correlated with the extent of KS incidence. However, in Ga mbi a and Botswana,

PAGE 15

15 although 65% and 80% of people respectively are KSHV seropositive, KS is rare in these countries ( Pfeiffer et al., 2010 ) . Progession to KS might be influen ced by geographical differences. E nvironmental co factors to reactivate KSHV have been s u ggested, such as volcanic soils and limestone , al though not all studies supported this finding ( Montesu et al., 1995 ) ( Ziegler, 1993 ) . Secondly, plants that are carcinogenic or reactivate KSHV in vitro can also be co factors to promote KS ( Whitby et al., 2007 ) . In addition in that blood sucking arthropod s were associated with KS incidence and KSHV transmissio n ( Ascoli et al., 2009 ) . While these hypotheses are difficult to investigate and inconclusive, it has been reported that certain parasites in contaminated water , such as malaria, filariasis, and helminths, are associated with KS risk and KSHV transmission ( Mbulaiteye et al., 2005 ) . Parasites influence the host immune system , which might affect the host against KSHV. In fact, it has been reported that malaria increases reactivat i on and EBV loads by modulation of the immune response to EBV. ( Moormann et al., 2005 ; Moormann et al., 2007 ; Piriou et al., 2009 ) . Wakeham et al. has reported etiological evidence that parasites influence KSHV reactivation, which increases KSHV prevalence and KS incidence ( Wakeham et al., 2011 ) . These finding s led us to further investigation of the relation ship between helminth infection and KSHV reactivation in Chapter 3. Latency and Latent Genes KSHV encodes more than 90 genes in its 180 k b (Fig. 1 1). L ike other herpesvi ruses, KSHV has two distinct phase s , lytic replication and latency. Latency is the default phase of KSHV infection, in which a small subset of genes are expressed, the so called latent genes, encoded in the KSHV late n cy associated region (KLAR). 4

PAGE 16

16 genes, kaposin (K12), viral FLICE inhibitory protein ( vFLIP, K13), viral cyclin (ORF72), and latency associated nuclear antigen (LANA, ORF73), and 12 miRNAs are encoded in this region. The characteristics of individual latency genes are described below (Fig 1 2) . Kaposin The unique feature of kaposi ns, which consists of 3 isoforms (kaposin A, B, and C) by translating alternative open reading frames, is to have non AUG start codons as well as the typical start codon (AUG), which is located in ORF K12 . Kaposin A is translated by a AUG start codon, whil e Kaposin B and C are translated from a CUG codon transcribed upstream of ORF K12 at direct repeats, DR1 and DR2. Kaposin B is abundant in BCBL 1 cells, whereas not detectable in the primary endothelial cells, in which Kaposin A and C are expressed ( Sadler et al., 1999 ) . Kaposin A and B are known to contribut e to the development of neoplasia. Kaposin A recruits the ARF GTPase activating guanine nucleot i de exchange factor (GEF) cytohesin 1 to induce signaling, so that Kaposin A induces cell transformation in Rat3 cells ( Kliche et al., 2001 ) . Kaposin B increase s cytokine expression by stabilization of cytokine mRNAs, such as IL 6 and GM CSF. MK2 kinase stabilizes mRNAs with AU rich element in cytokine mRNAs by binding Kaposin B via direct repeats ( McCormick and Ganem, 2005 ) . LANA LANA is a multi functional protein that play s a major role in establishing and maintaining latency. The N or C terminal regions of LANA are divided by a large repetitive region of acidic and glutamine rich repeats. Amino acids 5 1 3 in N terminus of LANA contain a chromosome binding motif to bind hi stones H2A/H2B ( Barbera et al., 2006 ) . The C terminal region encodes a DNA binding domain that recognizes and binds

PAGE 17

17 two specific sequence s in the terminal repeat s of KSHV genome ( Garber et al., 2002 ; Hu et al., 2002 ) . These binding activities of LANA to the host chromosome and TR region of KSHV genome contribute to tethering the viral episome to the chromosome, which is critical for maintaining the KSHV genome by allowing its segregation into daughter cells ( Ballestas and Kaye, 2001 ; Komatsu et al., 2004 ) . In addition, viral DNA replication is necessary to maintain the episome. It is found that proteins, involved in DNA replication, like ORC2, ORC3, and MCM, are located at the TR region by the recruitment through LANA ( Stedman et al., 2004 ; Verma et al., 2006 ) . Moreover, LANA is associated with a member of the FACT complex, SSRP1, which is involved in replication as well as transcription and DNA repair. LANA also interacts with histone modifying enzy mes and chromatin remodeling proteins ( Hu et al., 2009 ) . Furthermore, L ANA activates its own promoter and repress es ORF50 (RTA) expression, KSHV lytic transactivator, thereby contribute ing to the maintanence of latency ( Lan et al., 2004 ) . Along with the role in establishing and maintaining latency, LANA contributes to tumorigenesis. LANA associates with p53 to inhibit apoptosis and inactivate s retinoblastoma (Rb) allowing progress ion of the cell cycle by releasing E2F transactivator ( Radkov et al., 2000 ) . Sequestration of glycogen synthase kinase (GSK) catenin in nucleus forms a complex with the lymphoid enhancing factor (LEF) and T cell factor (TCF), which act ivate CCND1 and Myc to promote cell cycle and tumorigenesis ( Boshoff, 2003 ; Fujimuro and Hayward, 2003 ) . Overexpressed LANA can immortalize human umbilical vein endothelial cells (HUVEC) by induction of human telomerase reverse tra n scriptase (hTERT) ( Watanabe et al., 2003 ) .

PAGE 18

18 KSHV encoded miRNAs Since the initial discover y that five miRNAs were encoded in EBV infected Burkit t lymphoma ( Pfeffer et al., 2004 ) , more than 200 miRNAs have been identified in herp esviruses to date ( Zhu et al., 2013 ) . In 2005, several groups, including the Renne l ab, found that 12 miRNAs are encoded in the KSHV genome. All miRNAs are located in latency associated region; 10 are in the intragenic region and 2 are in open re ading frame of K12 (kaposin) ( Cai et al., 2005 ; Pfeffer et al., 2005 ; Samols et al., 2005 ) . Recent studies identified many targets of KSHV encoded miRNAs in PEL cells, using photoactivatable ribonucleoside enhanced crossli n king immunoprecipitation (PAR CLIP) and high throughput sequenci ng crossli n king immunoprecipitation (HITS CLIP) techniques ( Gottwein et al., 2011 ; Haecker et al., 2012 ) . The roles of KSHV miRNAs are not only to target viral genes to control latency and lytic replication, but also to down regulate host gene expression for KSHV path o genesis. Samols et al . found that multiple miRNAs targeted a tumor suppressor and anti angiogenic factor, thrombospondin 1 (THBS1) ( Samols, 2007 ) . Bcl 2 associated factor (BCLAF1), a pro apoptotic protein, was also identified as a ta r get of multiple KSHV miRNAs (miR K5, miR K9, and miR K10a/b). In addition to target the genes related to apoptosis , miR proliferation ( Gottwein and Cullen, 2010 ; Ziegelbauer et al., 2009 ) . Furthermore , data from Renne and Cullen lab oratories demonstrate that miR K11 is an orthologue of host miRNA miR 155 with 100% seed sequence homology. miR 155 has been i dentifed as an oncomir, highly up regulated in a number of B cell lymphomas ( Gottwein et al., 2007 ; Skalsky et al., 2007 )

PAGE 19

19 KSHV also encodes homologues of cellular genes , which pirate the function of the host genes. Among 14 KSHV genes that have cellular homologues, two latent gen es (vFLIP and vCyclin) and four lytic gen es (ORF K1, vIL 6, vIRF 1 , and vGPCR), which may contribute to oncogenesis, are described below. vCyclin The viral cyclin (vCyclin) is a homologue of cellular cyclin D, which activates cyclin dependent kinase 6 (cdk6) and promotes G1 S phase transition ( La man et al., 2001 ) . Although vCyclin is also associated with cdk2 and cdk4, these kinases a re not significantly activated. The mechanism of vCyclin in promoting cell proliferation is similar to its cellular homologue. Cdk6 binding to vCyclin phosphorylates RB protein and induces S phase entry . Unlike its cellular equivalent cyclin D , vCyclin is resistant to cdk inhibitors, which are phosphorylated and inactivated by the vCyclin cdk6 complex ( Sarek et al., 2006 ) . Since it was reported that vCyclin can induce p53 dependent cell cycle arrest, it appears that inactivation of p53 by LANA is need ed for vCyclin to show oncogenic potential ( Verschuren EW, 2002 ) . vFLIP The viral FLICE (Fas asso ciated death domain IL 1 converting enzyme) inhibitory protein, vFLIP, plays a role in inhibiting apoptosis, like cellular FLIPs. vFLIP blocks the apoptotic signal by disrupting the interaction from Fas associated death domain (FADD) to caspase 8 ( Bélanger C, 2001 ) . In addition, vFLIP strongly induce s NF si gnaling by activating the IKK comp lex and the heat shock protein 90 (hsp90) ( Field et al., 2003 ; Liu et al., 2002 ) . NF s ignaling, activated by vFLIP, is capable of transform ing Rat 1 fibrobl asts and to induce tumor in nude mice ( Sun et al., 2003 ) . Moreover, vFLIP inhibits the AP 1 signaling pathway through activation of NF , which

PAGE 20

20 prevents latently inf ected cells from viral reactivation ( Ye et al., 2008 ) . These data indicate that vFLIP can directly activate the NF naling pathway to contribute to oncogenesis, as well as inhibit the other signaling pathway through the activation of NF to inhibit apoptosis. Lytic Replication and Oncogene Lytic genes of KSHV are categorized as immediate early (IE), early (E), and lat e genes (L), depending on the order of expression and the functions. IE genes are critical to turn on the lytic replication, when stimulated. RTA (ORF50) is the lytic switch to initiate lytic replication by trans activating IE and E gene expression. KSHV l ytic replication also contributes to its oncogenesis by spreading viruses to adjacent uninfected cells or tissues, thus maintaining the population of latently infected cells. Furthermore, there are a number of lytic genes that have oncogenic properties in overexpression assay . ORF K1 K1 is a membrane glycoprotein and homologue of the B cell receptor , containing an immuno receptor tyrosine based activation motif (ITAM), which is important for lymphocyte activation ( Lagunoff and Ganem, 1997 ; Lee et al., 1998 ) . K1 is constitutively active and activates PI3K/Akt pathway to keep death recept or mediated apoptosis in B cells by inhibition of the PTEN. Moreover, K1 induce s NFAT and NF for cell survival ( Lagunoff et al ., 1999 ; Tomlinson and Damania, 2004 ) . K1 activates VEGF and PI3K/Akt signaling pathway to immortalize HUVEC ( Wang et al., 2004 ) . vIL 6 Viral interleukin 6 (vIL 6) is a homologue of cellular IL 6, detected in KS, PEL, and MCD ( Yoshizaki et al., 1989 ) , e ven though the homology of amino acid sequence to

PAGE 21

21 cIL 6 is less than 25% ( Moore et al., 1996 ; Neipel et al., 1997a ) . vIL 6 induces VEGF expression through the activation of JAK/STAT pathway . However, u nlike its cellular homologue, vIL 6 directly interacts with gp130 to activate signaling pathway without gp80 in athymic mice inoculated with vIL 6 expressing NIH3T3 cells, VEGF secretion leads to high ly vascularized tumors ( Aoki et al., 1999 ; Molden et al., 1997 ) . vIRF 1 Viral interferon regulatory fa ctor 1 (vIRF 1) is expressed at a very low level during latency in PEL , although vIRF 1 is highly induced in lytic replication ( Pozharskaya et al., 2004 ) . vIRF 1 suppresses host anti viral responses by competing with cellular I RF3 to bind to CBP and p300 ( Burysek et al., 1999 ; Lin et al., 2001 ) . Moreover, vIRF 1 inh ibits apoptosis by binding to p53 and associating with tumor ( Burysek et al., 1999 ; Seo et al., 2001 ) . In addition, i t is observed that the proto oncogene Myc is induced in vIRF 1 expressing NIH3T3 cells ( Jayachandra et al., 1999 ) . vGPCR Viral G protein coupled receptor (vGPCR, ORF74) is early lytic gene, which is homologue of the cellular GPCR. However, vGPCR is constitutively activated without ligand binding ( Cesarman et al., 1996 ; Rosenkilde et al., 1999 ) . vGPCR can activate s everal signaling pathway s , such as mitogen activated kinase (MAPKs), PLA, PI3K, and Akt ( Bais et al., 2003 ; Montaner et al., 2001 ; Sodhi et al., 2000 ) . Its oncogenic characteristic is eviden t by its ability to induce transformation of NIH3T3 cells and tumor production in nude mice ( Bais et al., 1998 ) . It was demostrated that vGPCR contribute s to activation of the ORF50 promoter by a positive feedback loop ( Bottero et al., 2009 ) . A small population of KSHV associated tumors expressed vGPCR and secreted VEGF ,

PAGE 22

22 which might be i nfluenced by the cells undergoing spontaneous lytic reactivation and provide paracrine signaling to neighboring latently infected cells ( Guo et al., 2003 ; Wen and Damani a, 2010 ) . miRNA The first miRNA, lin 4, was dis covered in 1993 from C. elegans which regulate s the timing of development by repress ing the expression of lin 14. The gene of lin 4 was not translated to produce the protein, but generat e short RNA fragments that bind to UTR of lin 14 to inhibit its expression ( Lee et al., 1993 ) . The major function of miRNAs is to down regulate gene expression by translational silencing and degradation of mRNA. Although the primary mechanism regulation by miRNA i nvolve s miRNA bind ing the at there are various alternative mechanism s for down regulation, such as inhibition of translational initiation or elongation, premature termination, and transcriptional inhibition by chromatin remodeling ( Esquela Kerscher and Slack, 2006 ; Morozova e t al., 2012 ; Pillai et al., 2007 ) . Currently, over 1800 miRNAs in human have been discovered and listed ( http://www.miRbase.org ). miRNA Biogene sis The miRNAs are transcribed into primary miRNA (pri miRNA) having several hundred nucleotides of RNA mostly by RNA polymerase II. The pri miRNA is capped at the and polyadenylated at the like messenger RNAs (mRNA). The pri miRNA forms a stem loop with imperfect hairpin bulge. Pri miRNA is processed into pre miRNA (premature miRNA) by RNase III, Drosha, which is recruited by dsRNA binding protein, DGCR8, recognizing the boarder between single stranded and double stranded region of pri miR NA. Binding of DGCR8 to this region of pri miRNA is critical for Drosha

PAGE 23

23 activity to cleave proper position in pri miRNA ( Han et al., 2006 ) . The 60 80 nucleotides of the pre miRNA is rapidly exported to cytoplasm by exportin 5, and further processed into dsRNA duplex by dicer. Dicer is also an RNase III endonuclease , which contains nuclease domain and dsRNA binding domain. The RNA binding domain of Dicer binds overhang in dsRNA region, and catalytic domain of Dicer cleaves hairpin of pre miRNA to generate 20 22 bases dsRNA duplex. The distance between the se two domains decides the length of RNA duplex ( Macrae et al., 2006 ) . One of the strands of dsRNA duplex is incorporated into the RNA induced silencing complex (RISC) to function in silencing gene expression. The selection of the strand from RNA duplex is based on the thermodynamic instability of each end , which is dictated by the GC content ( Khvorova et al., 2003 ; Schwarz et al., 2003 ) . Roles of miRNAs The bi ological roles of the miRNAs identified to date are not completely researched yet. The first described miRNAs, lin 4 and let 7 control the process of cell differentiation and proliferation in C. elegans, so that mutations of the miRNAs cause abnormal cell cycle exit and terminal differentiation, which are also found in cancer cells. In fact, proliferation in human cell line s is regulated by the huma n homologues of lin 4 and let 7 ( Lee et al., 2005 ; Takamizawa et al., 2004 ) . It has been shown that miRNA s may be critical for developing and promoting cancer, because the location s where about 50% of annotated miRNAs are encoded is withi n cancer associated region s , so called fragile site. For example, miR 125b 1 , the human homologue of lin 4 , is located in C11q24, deletion of which is found in patients with breast, lung, ovarian and cervical cancers ( Calin et al., 2004 ) . Even though the aberrant miRNA expression in cancers may not be the main cause for cancer development due to the specificity of

PAGE 24

24 miRNA in cell types and differentiation status, it is obvious that up or down regulation of miRNAs contribute s to tumorigenesis. The aberrant expression of miRNAs by dysregulation and amplification or deletion of miRNA genes w as foun d in many different types of cancers. Moreover, the biochemical results support the idea that miRNAs regulate gene expression and function as tumor suppressors and oncogenes , thereby affecting tumorigenesis (Fig 1 4) ( Kent and Mendell, 2006 ) . miRNAs as tumor suppressor s miR 15a and miR16 1 were first identified as tumor suppressive miRNAs in patients diagnosed with B cell chronic lymphocytic leukemia (CLL) ( Calin et al., 2002 ) . Deletion in the 13q14 locus was observed in more than 65% of CLL cases. Anti apoptotic BCL2, over expressed in leukemias and lymphomas, is t he one of the targets of miR 15 and miR 16. Development of leukemias and lymphomas is caused by over expression of BCL2 resulting from deletion or dow n regulation of these miRNAs ( Cimmino et al., 2005 ) . The second identified miRNA in C. elegans , let 7 , was thought to be encoded only in nematodes. However, it was found that twelve let 7 homologs in humans are encoded as eight distinct clusters and four of those are in the fragile site of the human genome, the deletion of which often occurs in many human cancers ( Calin et al., 2004 ) . Johnson et al. showed that the members of let 7 in the human genome directly regulate Ras expression, which is a type of guanosine triphos phatase having an oncogenic activity ( Johnson et al., 2005 ) . The down regulation of miR 145 is commo nly found in breast cancer ( Iorio et al., 2005 ) . And the reduced expression of miR 143 and miR 145 was observed in colorectal cancer. Although the detailed mechanisms and role s in tumorigenesis of these miRNAs

PAGE 25

25 has not been elucidated, it has been revealed that these miRNAs are not properly processed by Dicer, based on the observation of normal level of pre miRNAs in colon cancer ( Michael et al., 2003 ) . miRNAs as oncogene s (oncomir s ) The B cell integration cluster (BIC) noncoding RNA, inducing Myc mediated lymphomagenesis in chicken model, was revealed to contain the pri miRNA of miR 155 . It has been reported that elevation of miR 155 expression was observed in many types of lymphomas as well as other types of cancers ( Eis et al., 2005 ; He et al., 2005a ; Volinia et al., 2006 ) . Increased miR 155 levels seem to be sufficient to develop a polyclonal B cell malignancy, evidenced by transgenic mice that over exp ress miR 155 ( Costinean et al., 2006 ) . Moreover, up regulation of miR 155, led by EBV infection, targets many tran scriptional regulatory genes as well as pathway for its tumorigenesis ( Jiang et al ., 2006 ; Lu et al., 2008 ; Yin et al., 2008 ) . In addition to EBV case, our lab found that miR K12 11 of KSHV is the orthologue of miR 155 and both target the transcription repressor, BACH1 ( Gottwein et al., 20 07 ; Skalsky et al., 2007 ) . The miR 17 92 cluster consists of 6 miRNAs, miR 17, miR 18a, miR 19a, miR 20a, miR 19b 1 and miR 92, transcribed as a single poly cistronic RNA . The amplification of the 13q31 locus, where miR 17 92 cluster is encoded, is often observed in many types of B cell lymphomas ( Ota et al., 2004 ) . The paralogs of the miR 17 92 cluster, miR 106a 363 and miR 106b 25, were discovered in Chromosome 7 and the X chromosome. These miRNAs are categorized into three families according to their seed sequence s , miR 17 family, miR 19 family, and miR 92 family ( Fig 1 6 ). Even though it is

PAGE 26

26 unclear that these paralogs share the functional properties, the sequence of each miRNA famil y is highly conserved among three paralogs ( Olive et al., 2010 ) . One of the tumor suppressor proteins, phosphatase and tensin homolog (PTEN), is found as potential target of miR 19 by genome wide miRNA target prediction , and confirmed Myc mouse model of B cell lymphoma. Moreover, miR 19 activates the Akt mTOR pathway to prevent cells from apoptosis by antagonizing PTEN ( Lewis et al., 2003 ; Olive et al., 2009 ) . In addition, Mestdagh et al. reported that miR 17 92 cluster down regulates TGF signaling pathway to block the apoptosis in neuroblastoma by targeting T II, SMAD2, and SMAD4 ( Mestdagh et al., 2010 ) . E2F1 is also targeted by the miR 17 92 cluster. Even though E2F1 functions to promote cell cycle from G1 to S phase, it has bee n reported that excessive expression of E2F1 results in apoptosis ( Matsumura et al., 2003 ) . The oncogene Myc is known to up regulate the expression of the miR 17 92 cluster and E2F1. Thus, He et al. proposed that the miR 17 92 cluster blocks excessive E2F1 expression to inhibit apoptosis and stimulates Myc mediated proliferation ( He et al., 2005b ) . More than 5 100 fold higher expression of miR 21 was shown in glioblastoma than in normal tissue. Knock down of miR 21 using antisense against the miRNA i nduced apoptotic cell death by activating caspases, e ven though the mechanism to cause tumorigenesis need s to be studied ( Chan et al., 2005 ) . TGF Signaling Signaling P athway of TGF Transforming growth factor TGF ) is a multifunctional cytokine that controls many cellular activities, such as development, differentiation, and proliferation. Various types of cells express and secrete TGF , which exists a s 3 isoforms, TFG TGF 2,

PAGE 27

27 and TGF 3. These 3 isofroms initiate a signaling cascade by binding TGF and the TGF known as a tumor suppressor by inducing apoptosis ( Blobe et al., 2000 ; Galliher et al., 2006 ) . The TGF signaling pathway operate s through SMAD proteins. The signaling is initiated from binding TGF ligand to TGF receptor s . There are 3 types of TGF receptors, T I, T II, and T R III. TGF ligands bind to T II except TGF 2, which needs T III to bind T II. T II is associated with T I to convey the signaling to intracellular components. Both T I and T II contain the activity of Ser/Thr kinase in cytoplasmic domains. T II transphosphorylate s T I to activate its kinase activity ( Wrana et al., 1994 ) . Then, T I, with the association with adaptor/anchoring proteins, phosphorylate Smad2 and Smad3 at the C terminal SXS motif. These Smads are called the receptor regulated Smads (R Smads), together with Smad1, Smad5, and Smad8/9, which are involved in the signaling transfer of other TGF superfamily, bone morphogenetic proteins (BMP). The phosphorylated Smad2 and Smad3 change their conformation to associate with common Smad (co Smad), Smad4. Smads2/3 and Smad4 hetero complex is translocated into the nucleus, and interact s with other transcriptional co activators or repressors to regulate the expression of TGF responsive genes ( Massague and Gomis, 2006 ; Moustakas and Heldin, 2009 ) . There is one more type of Smads, called inhibitory Smads (I Smads), Smad6 and Smad7. Smad7 physically binds to T I to prevent the interaction with Smad2/3 from phosphorylation , and recruit s the E3 ligase to ubiquitinate and degrade the TGF receptors (Fig 1 5) ( Massague et al., 2005 ) .

PAGE 28

28 There is also a non canonical pathway mechanism to transfer the TGF signaling pathway independent of Smad proteins (canonical pathw ay). TGF also stimulates MAP kinases, PI3K/Akt/mTOR pathway, and GTP binding proteins ( Massague, 2008 ; Tian et al., 2011 ) . However, the mech anism by which TGF activates non canonical components is not well understood yet. TGF M ediated C ytostasis TGF is involved in suppressing autonomous cell growth in epithelial, endothelial, and hematopoietic cells. TGF is capable of suppression of pr emalignant progression, so that the loss of this ability is the hallmark of cancer development. TGF inhibits cell cycle progression in G1 phase by expression of cdk inhibitor and inhibition of MYC expression. The expression of cdk inhibitor, p15INK4b and p21CIP1, is induced by TGF through the formation of SP1:Smad3:Miz1 and SP1:Smad2/3:FoxO complexes respectively, which prevent cell cycle progression. While p15 targets CDK4/6 to inactivate, p21 block cyclinE/CDk2 complexes ( Gomis et al., 2006 ; Seoane et al., 2004 ) . Furthermore, TGF down regulates the expression of c Myc and Id1 3, transcription factor to induce cell growth. Smad3 is associated with E2F4/5, p107, and C/EBP beta to repress c Myc expression, up regulates the expression of ATF3 for the inhibition of Id1. TGF also induces Mad2 and Mad 4, the antagonists of c Myc, to repress the Id2 expression. C/EBP bet a, the repressor of c Myc expression, is required for activation of c dk inhibitor, p15 . Due to its multiple functions and activities, TGF dysregulation is associated with uncontrolled cell growth in many human malignancies ( Siegel and Massague, 2003 ; Siegel et al., 2003 ) . Beca use of these cytostatic properties of TGF signaling pathway for its pathogenesis. Bartolo et al. has reported that LANA down -

PAGE 29

29 regulate s T II by epigenetic modification in PEL cells . M ethylation and acetylation of H4 at the T II promoter occur in LANA expressing BJAB cells. Our lab also showed that multiple KSHV encoded miRNA s target thrombospodin1 (THBS1) to prevent TGF from activating the latent form. Moreover, Lei et al. has re cently reported that miR K12 10 directly targets and down regulates the T II expression to block TGF signaling pathway ( Lei et al., 2012 ; Liu et al., 2012 ; Samols, 2007 ) . In Chapter 2 , a n ovel mechanism for down regulation of the TGF signaling pathway is described. H ost miRNA s , induced by KSHV latent gene s , vFLIP and vCyclin repress the expression of Smad2 for KSHV pa thogenesis and tumorigenesis.

PAGE 30

30 Figure 1 1. KSHV genome . Each box represen ts an open reading frame (ORF). The colors indicate the expression patterns of genes , with black indicating transcription during latency , and red, green and blue indicating immediate early, early, and late expression, respectively, during lytic replication .

PAGE 31

31 Figure 1 2. KSHV latency associated region ( KLAR ). Four genes and 12 KSHV miRNAs are encoded in this region. Orange arrows represent the latent genes kaposin, vFLIP, vCyclin, and LANA, and show the direction of transcript ion . Black arrows indicate the latent promoters. 10 miRNAs are encoded in a non coding region (miRNA cluster) and 2 miRNAs are in the K12 ORF ( Samols et al., 2005 ) .

PAGE 32

32 Figure 1 3. miRNA biogenesis . Pri miRNAs are transcribed by polymerase II or polymerase III. Drosha cleaves pri miRNAs into pre miRNAs containing ~80 bp stem loop. Pre miRNAs are exported into cytoplasm by Exportin5/RAN GTPase , and processed into RNA duplex by D icer. The miRNAs are i sequence of the miRNAs. The binding of miRNAs to the target mRNAs leads to either translational silencing or degradation of mRNAs, depending on the degree of ( Plaisance Bonstaff and Renne, 2011 ) .

PAGE 33

33 Figure 1 4. miRNAs as tumor suppressor and oncogene . In normal condition, miRNAs down regulate their target gene expression by translational silencing or degradation of transcripts. When tumor suppressive miRNAs are down regulated or mutated, oncogenes, targeted by the miRNAs, are expressed to cause cancers. In the case of oncogenic miRNAs, tumor suppressor genes are down regulated by the miRNAs that are over expressed. The figure is modified from the review paper ( Esquela Kerscher and Slack, 2006 ) . Tumor suppressive Oncogenic Normal

PAGE 34

34 Figure 1 5. Canonical pathway of TGF signaling . TGF super family consists of TGF and BMP signaling. The signal is initiated by binding the ligands to the receptors . The receptors are phosphorylated in the C terminus and the signal is conveyed to SMADs by phosphorylation. Phosphorylated SMADs are translocated into nucleus and function a s transcription factor s to express the target genes ( ten Dijke and Arthur, 2007 ) .

PAGE 35

35 Figure 1 6. miR 17 92 cluster and homologues. Each colored box represent miRNA families. miRNAs are divided into four different families, miR 17 family, miR 18 family, miR 19 family, and miR 92 family, based on the similarity of the seed matching sequences ( Olive et al., 2010 ) .

PAGE 36

36 CHAPTER 2 LATENT GENES DOWN REGULATE TGF MICRORNA Introduction associated herpes virus (KSHV) is a member of the gamma ( Cesarman et al., 1995 ; Chang et al., 1994 ; Soulier et al., 1995 ) . KSHV has two distinct latent and lytic phases of infection. During latency, a small subset of KSHV genes is expressed from the KSHV latency associated region (KLAR). Latent gene products including kaposin, viral Fas associated death domain IL converting enzyme inhibitory protein (vFLIP), viral cyclin (vCyc), latency associated nuclear antigen (LANA), and viral micro RNAs (miRNAs), contribute to the survival and proliferation of KSHV infected tum or cells. Viral FLIP is a homolog of cellular FLIP, which can protect cells from Fas mediated apoptosis. Furthermore, vFLIP does not just block the extrinsic signal but also induces NF ( Guasparri et al., 2004 ) . Rat 1 cells expressing vFLIP promote the tumor format ion in nude mouse, which is associated with NF ( Sun et al., 200 3 ) . The viral cyclin (vCyc) is a homolog of cellular cyclin D, which functions at the G1/S cell cycle transition by activation of cyclin dependent kinase 6 (cdk6). Unlike cellular cyclin D, vCyc is resistant to p27 c dk inhibitor ( Chang et al., 1996b ; Swanton et al., 1997 ) . D espite resistance to cdk inhibitors, the activity of KSHV cyclin is blocked by p53. However, it is reported that vCyc is sufficient to promote proliferation of latently infected

PAGE 37

37 cells thereby potentially contributing to cell transformation and tumorigenesi s in the presence of p53 inhibiting factors, such as LANA ( Verschuren et al., 2002 ) . MicroRNAs are short (21~25 nucleotides) noncoding RNAs that down regulate gene expression post transcri UTR) of target messenger RNA (mRNA) with partial complementarity ( Bartel, 2004 ) . miRNAs play a central role in central biological processes, such as development, di fferentiation, apoptosis, and proliferation ( Ambros, 2004 ) . Dysregulation of miRNAs is not only a hall mark of many human malignancies but is also involved in the development and progression of cancer. MiRNAs either target tumor suppressor genes or by itself can have oncomir or tumor promoting activit y ( for review see ( Calin et al., 2004 ) ) . The miR 17 92 cluster is one of the well characterized oncogenic miRNA cluster s , for which aberrant expression was found in various types of cancers and which has been shown to play a cr itical role in development. miR 17, 18a, 19a, 20a, 19b 1, and 92a 1, the members of the miR 17 92 cluster, are derived from a single polycistronic transcript located at chromosome 13q31. Amplification of this region is found in several types of lymphomas a nd lung cancer and overexpression in transgenic mice causes B cell lymphomas ( Ota et al., 2004 ; Tagawa and Seto, 2005 ) . The miR 17 92 cluster is regulated by the transcription factor, c Myc, that is frequently hyperactive in many types of cancers. With respect to cell cycle control, the miR 17 92 cluster miRNAs target the E2F transcription factor family but are also activated by E2F, the reby establishing a negative feedback loop ( O'Donnell et al., 2005 ; Sylvestre et al., 2007 ; Woods et al., 2007 ) . In neuroblastoma cells, miR 17 92 has been shown to target components of the TGF signaling pathway . TGF receptor 2 is targeted by miR 17

PAGE 38

38 and miR 20, and SMAD2 and SMAD4 are inhibited by miR 18a ( Mestdagh et al., 2010 ) . In addition, two homologous clusters, miR106a 363 and miR10 6b 25, are located at the X and chromosome 7, respectively. The 15 miRNAs expressed from these three clusters represent 4 different seed sequence families which are mir 17, 18, 19, and 92 ( Olive et al., 2010 ) . The TGF signaling pathway is involved in many cellular events, but in the context of KSHV pathogenesis , the most relevant functions of TGF are suppression of cell growth and promotion of apoptosis ( Tian et al., 2011 ) . The importance of TGF during latent KSHV infection is supported by the fact that KSHV negatively modulates TGF signaling by different mechanisms. Multiple KSHV miRNAs inhibit TGF maturation by targeting thrombospondin1 (THBS1) ( Samols, 2007 ) . KSHV LANA targets the TGF pathway by reducing the expression of TGF receptor type 2 (TGBR2) ( Di Bartolo et al., 2008 ) . TGF signaling in developing or progressing cancers is highly context dependent, since TGF signaling has b oth pro apoptotic and proliferative properties ( Bierie and Moses, 2006 ) . It is widely thought that inhibition of TGF signaling is important during the early stages of tumorigenesis, even though the pathway i s subsequently reactivated in the later stages of cancers associated with metastasis. TGF can also block cell cycle progression by inducing the expression of cdk inhibitors ( Gomis et al., 2006 ; Seoane et al., 2004 ) . We performed miRNA profiling and observed increased expression of the tumorigenic miR 17 92 cluster in KSHV latently infected cells. Testing of KSHV latency associated genes for their ability to up regulate the miR 17 92 cluster revealed that

PAGE 39

39 vFLIP and v Cyclin augment transcription from the miR 17 92 promoter which in turn strongly down regulates TGF signaling. Experimental Procedures Cell lines 293T, SLK, and iSLK cells, and TIVE LTC (TIVE long term infected cells) were cultured in DMEM with 10% FBS and 1% penicillin and streptomycin. TIVE cells ( An et al., 2006 ) were cul of endothelial cell growth supp lement (Sigma), 20% FBS and 1% penicillin and streptomycin. iSLK or TIVE cells, infected with KSHV BAC16 ( Brulois et al., 2012 ) wild type or mutant viruses, were L Hygromycin for maintaining latently infected cells. TGF ligand was purchased from AbCam ( Cat#ab50036) . MiRNA expression profiling Total RNA was extracted from cells using RNA Bee reagent (Tel Test, Inc. TX), and quality and yields analyzed using Agilen t Bioanalyzer and Nanodrop. RNAs were ends of the total RNA were enzymatically labeled with the Hy3 fluorescent dye (Exiqon) using T4 RNA ligase. Labeled RNA was hybridized to the LM T_miRNA_v2 microarray, which was designed using the Sanger miR9.0 database ( http://microrna.sanger.ac.uk ) and custom manufactured by Agilent Technologies as 8 x 15k microarrays. 1667 unique mature miRNA sequences across all species were incorporated into 6 0 mer surface. The Agilent linker sequence has minimal homology to any GenBank sequence. Each mature miRNA is represented by + and (reverse complement) strand sequ ences, and each probe has 4 replicates within each microarray, giving 8 probes per

PAGE 40

40 unique mature miRNA. 10 sets of random 22mer sequences served as negative controls. Positive (normalization) controls were designed using U1, U2, U4, U5 and U6 sequences. RNAs were incorporated into 60 mer probes (a total of 8 x 5 x 2 x 2 = 160 probes). Additional controls such as probes to Actin, GAPDH, HSP70 and Line elements are present on the microarra y. In total 3556 unique LMT seq ids (miRNA, positive and negative controls, +/ strand) were on the microarray. A 2x Hybridization Buffer and 10x blocking buffer (Agilent) were added to the fluorescently labeled miRNAs. The samples were heated to 99°C for 3 minutes and snap cooled before being added to the microarray printed on glass slides and hybridized for 16 h at 47°C. The glass slides were washed with the Agilent wash buffer 1 (room temperature) and 2 (at 37°C), dried with the Agilent stabilization an d drying solution, and scanned using the Agilent scanner (model G2505B). The Agilent Scan Control software (version A.7.0.3) was used to produce a high resolution tif image file. The Agilent Feature Extraction Program (FEP), version 9.5.3.1, was used to id entify feature spots and extract signal intensity values. Two types of signal intensity data were used in subsequent analysis: the raw mean signal intensity of the green channel pixels in each feature spot (gMeanSignal) and the average local background sig nal intensity of the pixels relative to the feature spot (gBGMeanSignal). To compensate for artifacts introduced by outlier background signal intensity values due to the features position on the array, a perl script calculated the average gBGSignal for all features on the chip at the same position on the array (eight arrays per chip). The script then subtracted the average gBGSignal from each replicate feature spot signal intensity

PAGE 41

41 (gMeanSignal) and then calculated the average of all background subtracted r eplicate features per array. Plasmids The expression constructs for LANA (pcDNA3.1/LANA) and KSHV cluster miRNAs (pcDNA3.1/cluster) were described in previous reports ( Hu et al., 2002 ; Samols, 2007 ) . For construction of vFLIP and vCyclin expression vectors, Gateway Cloning method was used. After ORFs of vFLIP and vCyclin were amplified by PCR and cloned into entry vector (pDONR222, invitrogen) using BP recombination, ORFs were cloned into pLenti6/V5 DEST ( Invitrogen) using LR recombination following the containing the promoter of miR 17 92 cluster upstream of luciferase vector was kindly provided from Dr. De Guire ( Sylvestre et al., 2007 ) . pGL3 SBE4 (Promega) contains four SMAD binding elements upstream of luciferase gene, activated by TGF ligand. pCMV Renilla (Promega), expressing renilla lu ciferase, was used for normalization of firefly luciferase activity. Transfection and Luciferase reporter assays For transfection of latently infected SLK cells, electroporation (Nucleofactor ® II, tocol. 10 6 of SLK or KSHV infected SLK cells were used for each transfection. Antagomirs of miRNAs, miR 17, 18a, and 20, (Dharmacon , CO ) were co transfected with plasmids using the same methods. For luciferase assays and Western blot analysis, SLK cells we re seeded 24 hours prior to transfection and transfected using TransIT 293 reagent (Mirus , WI ) at 2.5 x 10 5 cells per well for 6 well plates or 0.5 x 10 5 cells per well for 24 well plates, ty was quantified using

PAGE 42

42 the Dual Luciferase Reporter kit (Promega , WI 17 92 and pGL3 SBE4) were co transfected with expression vectors of latent genes (LANA, KSHV miRNA, vFLIP and vCyclin), and harvested 48 hrs after transfection. Antagomirs were transfected together with reporter vectors and expression vectors. 2 ng/m L of TGF ligand was added at 24 hours post transfection and the cells were harvested at 72 hours post transfection. 2 ng of the pCMV Renilla (Promega , WI ) was used for luciferase analysis. FLUOstar OPTIMA reader (BMG Labtech) was utilized for measuring firefly luciferase activity, which was normalized to Renilla luciferase activity. All assays were pe rformed as three independent experiments and standard deviation was calculated for triplicates and displayed as error bars. Western blot analysis Cells were harvested 48 hours after transfection or treatment with TGF ligand and lysed in lysis buffer (2 0mM HEPES, 100mM KCl, 0.2mM EDTA, 0.5mM DTT, 2.5% Glycerol, and protease inhibitor(Roche)). 5 lane of 10% SDS PAGE gels and transferred to PVDF membranes. Anti V5 HRP antibody (Invitrogen, CA, 46 0708) was utilized to detect and confirm V5 tagged vFLIP and vCyclin expression from plasmid constructs. Primary antibody for detecting SMAD2 was purchased from Cell Signaling Technology Inc. ( Beverly, MA, Cat #3103). Quantitative reverse transcription PCR (RT qPCR) analys is RNA Bee (Tel Test , TX ) was utilized to extract RNAs from TIVE cells according , CA ) was used to PCR (qRT PCR) analy sis was carried out using an ABI StepOne Plus system (Applied

PAGE 43

43 Biosystems, CA). GAPDH was used as internal control to normalize the expression of all genes. Student t tests were performed for statistical significance compared to non infected cells. Generat ion of BAC16 derived recombinant KSHV bacmids in E. coli Mutants were constructed as described by Brulois et al . using the BAC16 backbone ( Brulois et al., 2012 ) . In brief, the individual start codon ATG was mutated to TCG for vCyclin and vF LIP , whereas in the double muta nt both start codons were changed to TCG by using two step red recombineering. The Kan/I sceI cassette was generated by using primers containing flanking regions and Kan/I sceI amplification primers. The gel purified linear cassette was electroporated into freshly red activated (42°C) electrocompetent E.coli GS1783 cells harboring BAC16 to carry out intermolecular recombination. The transformants were grown on Kan containing LB media overnight at 30°C. After the verification of Kan insert and bacmid integri ty using colony PCR and PFGE respectively, the second Red intramolecular recombination was carried out by activating arabinose inducible SceI system and temperature sensitive Red recombination system. The marker less mutants were verified for bacmid integr ity using PFGE and were sequenced using Sanger sequencing for the confirmation of replacements in all three mutants. Recovery of infectious recombinant KSHV in iSLK cells After quality control , wt and mutant bacmids were initially transfected into 293T cells and selected with hygromycin. Two weeks later 293T cells were induced with TPA and co cultured with iSLK cells that contain the RTA transcactivator as an inducible transgene ( Myoung and Ganem, 2011b ) . After 72 hours co cultures were treated with puromycin and hygromycin to s elect KSHV infected iSLK cells and to kill off residual

PAGE 44

44 293T cells. Two weeks after cultivation iSLK cells were 100% GFP positive. Subsequently, iSLK cells infected with wild type or delta vFLIP, vCyc or double mutant and 1 mM NaB for 72 hours. The media 100,000 x g for 1 hour. The number of virus particles was quantified by qPCR assay after viral DNA extraction using DNAzol (Molecular R esearch Center, Inc.). Serially diluted LANA expression plasmid was used as standard curve. Resulting virus was used to infect TIVE cells using 100 genome equivalents per cell, which yields 100% GFP positive cells 48 hrs post infection. Results The oncogen ic miR 17 92 cluster is up regulated in KSHV latently infected cells. KSHV encodes 12 miRNA genes and in latently infected cells viral miRNAs can represent a significant percentage of all miRNAs within active RISCs ( Haecker, 2012 ) . Additionally, previous reports have analyzed host cellular miRNA expression patterns in KSHV infected tumor cells ( O'Hara et al., 2009 ) . Hence, we hypothesized that infection with KSHV not only modulates host cellular gene expression through viral miRN A targeting but also by directly perturbing cellular miRNA expression. To test this hypothesis, we performed microarray based miRNA profiling of host miRNAs in mock or stably KSHV infected SLK and long term infected TIVE LTC cells. A custom made array was designed that contained probes for a total of 1667 human miRNAs and several control genes for normalization (for details see Materials and Methods). In KSHV infected SLK cells, which are of epithelial origin, 80 miRNAs were up regulated 2 fold or more, com pared to mock. Among the highest induced were the oncomir miR 155, miR 27, and several members of the let 7 family (data not shown) . Comparison of TIVE to

PAGE 45

45 TIVE/LTC, which are of endothelial origin, revealed 103 miRNAs that were up regulated 2 fold or more and 8 miRNAs that were down regulated including miR 125 and miR 100. The top eight induced host miRNAs represented members of the oncogenic miR17 92 cluster and its orthologs. Comparison of both data sets revealed 59 miRNAs including the miR17 92 cluster t hat were commonly up regulated in both KSHV infected TIVE and SLK cells. Additional miRNAs that are known to be aberrantly expressed in various cancers and were induced in both cell lines included the let 7 family, miR 16, miR 21, and miR 34 ( data not show n ). Since the miR 17 92 cluster has known oncomir activity and like the miR 155 pathway is targeted in many human malignancies, we focused on the regulation of these miRNAs ( Fig. 2 1 and Table 2 2 ). We note that in TIVE cells, the mIR 17 92 cluster miRNAs are not detectable, while they are highly expressed in TIVE LTC. To confirm the array analysis the expression levels of seven miRNAs were analyzed by stem loop qRT PCR as says. As shown in Figure 2 1 and Table 2 2 , up regulation of three miR17 92 cluster miRNAs (mir 17 5p, mir 19b, and miR 92) were confirmed for both KSHV infected SLK and TIVE cells. The miR 17 92 cluster is transcriptionally up regulated by vFLIP and vCyclin. To determine whether the observed up regulation of the miR 17 92 cluster is due to transcriptional regulation a reporter assay was performed. A vector , containing the promoter of the miR 17 92 cluster upstream of the luciferase gene, was transfected into mock or latently KSHV infected SLK cells. The miR 17 92 promoter showed approxim ately 4 fold increased activity in KSHV infected SLK cells compared to uninfected cells (Fig. 2 2 A). Since KSHV infected SLK cells express only a limited subset of genes during latency these results suggested that latent KSHV genes

PAGE 46

46 contribute to augmenting expression of the miR 17 92 cluster. Thus, we investigated which latent genes are responsible for increasing miR 17 92 expression by testing LANA, the miRNA cluster, vFLIP and vCyclin. LANA and the KSHV miRNA cluster expression plasmids have previously be en described ( Hu et al., 2002 ; Samols, 2007 ) . Tagged vFLIP and vCyclin were cloned into the Gateway vector pLenti6 V5 (pLent i6/vFLIP and pLenti6/vCyc) and expression was confirmed by Western blot analysis (Fig . 2 2 A). Next, expression vectors were co transfected with the miR 17 92 promoter luciferase reporter. While LANA and viral miRNA expression did not affect luciferase expr ession from the miR 17 92 promoter (Fig. 2 2 B), vFLIP and vCyclin each increased luciferase expression by a factor of 8 (Fig. 2 2 D ). Hence, these data show that two latency associated genes vFLIP and vCyclin are responsible for the up regulation of the miR 17 92 cluster. Next we investigated the consequences of up regulation of the miR 17 92 cluster. TGF signaling is down regulated by vFLIP and vCyclin via increased expression of the miR 17 92 cluster It was previously demonstrated that three miRNAs of t he miR 17 92 cluster target SMAD2 in neuroblastoma cells. TGF is a cytokine with anti proliferative and pro apoptotic effects, and this important pathway is known to be targeted by KSHV miRNAs and LANA ( Di Bartolo et al., 2008 ; Samols, 2007 ) . Thus, we asked if the miR 17 92 cluster up regulated by vFLIP and vCyclin caused decreased SMAD2 expression. We performed Western blot assay with lysates of SLK cells ectopically expressing vFLIP or vCyclin. Surprisingly, the express ion of SMAD2 protein, which is readily detectable in SLK cells, was completely abolished by expression of either vFLIP or vCyclin (Fig. 2 3 A). In order to check if TGF signaling via SMAD2 is disrupted by

PAGE 47

47 vFLIP or vCyclin expression, we performed a lucife rase reporter assay with a plasmid containing 4 SMAD binding elements upstream from luciferase. Luciferase activity was induced more than 10 fold in the presence of TGF ligand, demonstrating that SLK cells are sensitive to TGF treatment (Fig. 2 3 BC). However, transfection of vFLIP or vCyclin diminished the response to the TGF measured by luciferase activity (Fig. 2 3 BC). Although TGF signaling is disrupted by vFLIP and vCyclin expression, it was unclear if vFLIP and vCyclin down regulate SMAD2 by s timulating miR 17 92 expression. To address this question we co transfected vFLIP or vCyc expression vectors with sequence specific antagomirs against miR 17 5p, 18a, and 20 to inhibit the miR 17 92 function, and performed a SMAD2 Western blot. In Figure 2 4A, SMAD2 expression inhibited by vFLIP and vCyclin was restored in the presence of miR17 92 antagomirs. Moreover, the responsiveness to TGF ligand was restored as measured by the SMAD responsive luciferase assay (Fig . 2 4 BC). Together, these results ar e consistent with reduction of SMAD2 protein levels by vFLIP and vCyclin being mediated via increased expression of miRNAs in the miR 17 92 cluster. SMAD2 inhibition was reduced in cells infected with KSHV mutants lacking vFLIP or vCyclin We utilized mutant viruses, which do not express either vFLIP or vCyclin, in order to study the contribution of vFLIP or vCyclin to SMAD2 regulation in the context of a latent virus infection. To generate single or double knock out mutant viruses of vFLIP or vCyclin, KSHV BAC16 was used ( Brulois et al., 2012 ) . LANA, vFLIP, vCyclin and viral miRNAs are all express ed from a single promoter , which gives rise to polycistronic multiply spliced mRNAs. To mutate vFLIP or vCyclin without affecting the complex RNA expression pattern in this locus, we mutated start codons rather than deleting open

PAGE 48

48 reading frames . After muta nt bacmids were confirmed by sequencing, recombinant virus was recovered by first transfecting bacmid DNA into 293 cells followed by co cultivation with iSLK cells. Next we monitored SMAD2 expression in mock, vFLIP and vCyc single knockout, and WT infecte d iSLK cells (Fig. 2 5 A). As previously seen in SLK cells, a high level of SMAD2 protein was detected in mock infected iSLK cells, but was not detectable in WT detectable bu t significantly lower expression level of SMAD2. In contrast, infection with uninfected iSLK cells. This indicates that in iSLK cells inhibition of SMAD2 by vCyclin is stronger than by vFLIP. Since it is was recently demonstrated that SLK cells, long thought to be of endothelial origin, are actually are derived from an adenocarcinoma of epithelial origin ( Sturzl et al., 2013 ) , we also wanted to test vFLIP and vCyc dependent regulation of SMAD2 in TIVE cells, an endothelial cell model in which to study KSHV pathogenesis ( An et al., 2006 ) . Wt or mutant virus infected iSLK cell s, which express the RTA gene as an inducible transgene ( Myoung and Ganem, 2011b ) , wer e used to generate high titer virus that after quantification was used to stably infect TIVE cells. Cells were infected with 200 genome equivalents per cell and, complete infection was confirmed by monitoring GFP expression, and subsequently, lysates and t otal RNA was collected for Western blot and RT qPCR to monitor SMAD2 expression. While the expression of SMAD2 in TIVE cells is lower than in SLK cells, WT KSHV infection decreased SMAD2 levels as observed in SLK cells. However, infection

PAGE 49

49 suggesting differences by which both proteins contribute to the up regulation of the miR17 knock out mutant was generated as described above. Infection of TIVE cells with the uninfected TIVE cells (Fig. 2 5B) . Together, these data confirm that both KSHV vFLIP and vCyc regulate SMAD2 in the context of viral infection in cells of epithelial and endothelial origin, albeit at different efficiencies. While vFLIP or vCyclin expression alone is sufficient for down regulation of SMAD2 in TIVE cells, both genes are required for inhibition of SMAD 2 expression in SLK cells where base level SMAD expression is higher. Most miRNAs modulate protein levels ( Baek et al., 2008 ; Selbach et al., 2008 ) . However, the observed down regulation of SMAD2 by the miR 17 92 cluster was surprisingly strong. To test the effects of miR17 92 dependent targeting of SMAD2 mRNA turnover, real time PCR was performed. Stea dy state SMAD2 mRNA levels were not significantly changed in KSHV infected TIVE cells, compared to mock infected cells (Fig. 2 5C ). We observed a slight increase in SMAD2 mRNA in cells infected with single knock out mutant. However, overall the significa nt decrease in SMAD2 protein, as detected by Western blotting, cannot be attributed to increased mRNA turnover . This indicates that the miR 17 92 cluster led to down regulation of SMAD2 by mainly inhibiting translation. In summary, vFLIP and vCyclin contri bute to inhibition of TGF signaling by transcriptionally activating the miR 17 92 cluster, which results in decreased translation of SMAD2 mRNA.

PAGE 50

50 Discussion Previously, it has been reported that KSHV latent genes modulate the TGF signaling pathway. Firstly, KSHV encoded miRNAs modulate directly or indirectly TGF signaling by targeting TGF receptor and SMAD5 or THBS 1 ( Lei et al., 2012 ; Liu et al., 2012 ; Samols, 2007 ) . Secondly, LANA dire ctly down regulate s the TGF receptor ( Di Bartolo et al., 2008 ) . Now, we suggest a third way to down regulate TGF signaling by inducing host miRNA expression. vFLIP and vCyc promote increased expression of the miR 17 92 cluster, which down regulates SMAD2 protein levels drastically. Complete loss of SMAD2 was not only shown in SLK cells over expressing vFLIP and vCyc by transfection, but also in WT KSHV infected SLK and TIVE cells. In SLK cells, vCyc mutant virus recovered SMAD2 expression more than vFLIP mutant. In addition, the resc ued response to TGF was lower when antagomir was treated together with vCyc expression, compared to vFLIP. Whereas SLK cell was from biopsy of KS patient, TIVE cell was derived from HUVEC cell ( An et al., 200 6 ) . SLK cells are different physiol ogical properties from TIVE cells, even though these are originated from KS biopsy ( Herndier et al., 1994 ) . This may the reason why SMAD2 restoration by mutant virus infection showed differently in two cell types. According to many reports, it was prevalent that TGF signaling is h ighly activated in fully developed cancer, while down regulation of TGF is important for early stage of cancer ( Bierie and Moses, 2010 ; Derynck et al., 2001 ) . Thus, SMAD2 may be highly expressed and activated in SLK cell than in TIVE cell, as shown in Western blots. vFLIP and vCyc clearly up regulate the miR 17 92 cluster, but how these viral genes induce the miR 17 92 expression still needs to be solved. It w as reported that overexpression of the miR 17 92 cluster in a Myc transgenic mouse model accelerated

PAGE 51

51 malignant lymphoma growth ( He et al., 2005b ) . In addition, c Myc, a gene dys regulated in many cancers, activates transcription of the miR 17 92 cluster ( He et al., 2005b ; O'Donnel l et al., 2005 ) . However, c Myc was not detectable in SLK cells by Western blot analysis, which indicated that c Myc cannot be involved in expre ssion of miR 17 92 in SLK cells ( F ig . 2 6 ). Sylvestre et al. published that E2F is the activator of the miR 17 92 cluster. Furthermore, mi R 20a, a member of the miR 17 92 cluster, transcriptionally down regulated E2F2 and E2F3 ( Sylvestre et al., 2007 ) . Therefore, it is possible that vCyc can stably activa ted the miR 17 92 expression out of its auto regulatory feedback loop, since vCyc acts like cellular cyclinD, which activate the E2F family transcription factors ( Chang et al., 1996a ; Swanton et al., 1997 ) . Since the putative signaling pathway, which is known to be activated by vFLIP or vCyclin, did not involve in up regulation of the miR 17 92 cluster, that deletion promoter analysis is needed to narrow down or to elucidate candidate of the putat ive transcription factors. It was published that most of the putative transcription factors found in the promoter region, including E2F family, showed moderate effect in B cell malignancies by reporter assay using site specific mutagenesis in the promoter ( Ji et al., 2011 ) . vF LIP is a potent activator of NF signaling ( Guasparri et al., 2004 ) . Moreover, Punj et al. reported that vFLIP down regu lated CXCR4 by miR 146a in a NF dependent manner ( Punj et al., 2010 ) . Epstein Barr virus (EBV), a gammaherpesvirus, induces several host miRNAs by LMP1 in a NF ( Cameron et al., 2008 ; Forte et al., 2012 ; Gatto et al., 2008 ; Lu et al., 2008 ; Motsch et al., 2007 ) . Moreo ver, it was also reported that NF kB, induced by vFLIP, increases the expression

PAGE 52

52 of the miR 146a, the up regulation of which was shown in EBV. Thus, we tested if the activation of the miR 17 92 cluster by vFLIP was dependent on NF kB. Even though NF kB sig naling was blocked by the inhibitor, Bay 11, the expression of the miR 17 92 cluster was still increased by vFLIP ( Fig. 2 7 ) . This indicates that there is another transcription factor inducing the miR 17 92 expression. As described, the down regulation of TGF signaling may be important for tumorigenesis upon KSHV infection. It was revealed in previous studies that KSHV encoded genes directly targeted the key players in TGF signaling pathway ( Di Bartolo et al., 2008 ; Liu et al., 2012 ; Samols, 2007 ) . Not only with these, we observed that latent genes of KSHV indirectly manipulated second messenger in TGF signaling by inducing ho st miRNA expression. Even though it was reported that KSVH vFLIP induced host miRNA in NF dependent manner likewise LMP1 in EBV ( Motsch et al., 2007 ) , we found that vCyclin as well as vFLIP are also able to induce the miR 17 92 clus ter in NF . Although it is still remained to elucidate how viral latent genes regulate the miR 17 92 expression, our finding provides the information that viral genes manipulate the host miRNA expression for tumorigenesis.

PAGE 53

53 Table 2 1. Primer sequences Primer name Sequence vFLIP Forward vFLIP Reverse vCyclin Forward vCyclin Reverse miR 17 92 F miR 17 92 R SMAD2 F SMAD2 R GM82 GM81 GAPDH F GAPDH R

PAGE 54

54 Table 2 2. Expression of miRNAs in uninfected and KSHV infected SLK and TIVE cells miR SLK SLK KS Fold increase SLK KS/SLK TIVE TIVE LTC Fold increase TIVE LTC/TIVE 17 1979 6761 3.4 169* 15443 IND 1 18a 635 1545 2.4 82* 5155 IND 1 19a 1581 6555 4.1 124* 23760 IND 1 20a 1642 5369 3.3 117* 14502 IND 1 19b 2 2436 12798 5.3 252* 32731 IND 1 92 3 311 1158 3.7 159* 1615 IND 1 106a 1833 6475 3.5 139* 14959 IND 1 18b 481 1221 2.5 61* 4038 IND 1 20b 918 3365 3.7 85* 9043 IND 1 363 91* 489 IND 1 374 1795 4.7 106b 334 1612 4.8 181* 3140 IND 1 93 134* 915 IND 1 131* 1548 IND 1 25 177* 641 IND 1 208* 1180 IND 1 155 146* 1833 IND 1 600 2509 4.2 *below the detection threshold 1 IND: induced but fold increase cannot be calculated as expression level in uninfected cells is below the detection threshold 2 Probes for miR 19b detect mature products (miR 19b 3p) of both miR 19b 1 (chr 13) and mi R 19b 2 (Chr X). 3 Probes for miR 92 detect mature products (miR 92a 3p) of both miR 92a 1 (chr 13) and miR 92a 2 (Chr X).

PAGE 55

55 Figure 2 1. Quantitative RT PCR analysis of miRNAs in latently KSHV infected SLK and TIVE cells. The expression differences of miRNAs in KSHV infected SLK (A) and TIVE cells (B) from non infected SLK and TIVE cells. U6 expression was used as internal control for normalization.

PAGE 56

56 Fig ure 2 2 . KSHV infection increases expression from the miR 17 92 cluster promoter via vFLIP and v Cyclin . A) Uninfected SLK cells and SLK cells latently infected with KSHV were electroporated with reporter vector (pGL3 PmiR 17 92) containing the promoter of the miR 17 92 cluster upstream of luciferase gene ( Sylvestre et al., 2007 ) . The firefly luciferase activity was measured then set at 1 for uninfected SLK cells. Error bars show standard deviation for triplicate experiments. B) Co transfection of pGL3 PmiR 17 92 with plasmids expressing LANA or the KSHV miRNA cluster. pGL3 PmiR 17 92 was co transfected with empty vector or with pcDNA3/LANA or pcDNA3.1/cluster into SLK cells using Mirus293IT transfection reagent. F irefly and Renilla luciferase activities were measured, and firefly luciferase activity was normalized to control Renilla luciferase activity. Activity was set at 1 for cells transfected with empty vector. C) Confirmation of expression of V5 tagged vFLIP a nd vCyclin by Western blotting. Extracts of cells transfected with pLenti6/vFLIP or pLenti6/vCyc were probed with anti V5 mAb. D ) Co transfection of pGL3 PmiR 17 92 with plasmids expressing vFLIP or vCyclin. pLenti6/vFLIP or pLenti6/vCyc were co transfecte d with reporter vector into SLK cells and firefly luciferase activity measured and normalized as above.

PAGE 57

57 Fig ure 2 3 . vFLIP and vCyclin decrease SMAD2 protein expression and desensitize TGF signaling. A) SMAD2 expression was drastically decreased upon th e expression of vFLIP or vCyclin in SLK cells. Western blot for SMAD2 was performed with SLK cells transfected with empty vector or with vFLIP and vCyclin expression vectors. Actin was detected as internal control. B and C) vFLIP (B) and vCyclin(C) diminis hed the response of SLK cells to TGF ligand. Luciferase reporter analysis was carried out with pGL3 SBE4, which contains 4 SMAD binding elements, co transfected with empty vector or with vectors expressing vFLIP or vCyclin in the absence or presence of T GF ligand. TGF ligand was added 24 hrs after transfection and the cells were harvested 72 hrs after transfection. The luciferase activities in the presence of TGF were normalized with the activities in the absence of TGF .

PAGE 58

5 8 Fig ure 2 4 . SMAD2 expres sion and the response to TGF were restored by antagomir against the miR 17, 18a, and 20 . A) Western blot for SMAD2 after blocking miR 17 92 cluster. Empty vector or vFLIP or vCyclin expression vectors were transfected into SLK cells with or without 100 n M of antagomirs against miR17, 18a, and 20. Actin was used as internal control. B and C) Reporter vector (pGL3 SBE4) was co transfected into SLK cells with vFLIP (B) or vCyclin (C) expression vectors in the absence or presence of antagomirs at 100 nM or 20 0 nM as indicated. TGF ligand was added and the cells were harvested as described in Figure 2 3. Luciferase activity was measured and set at 1 for cells without TGF . * and ** indicate p < 0.05 and p<0.01, respectively, in comparison with cells not trea ted with antagomir.

PAGE 59

59 Fig ure 2 5 . vFLIP or vCyclin deletion mutant virus recovered the SMAD2 expression in SLK or TIVE cells . A and B) Western blot for SMAD2 in iSLK or TIVE cells infected with wild type KSHV or with mutant KSHV lacking vFLIP, vCyclin, o r both. The infected cells were selected at least 4 weeks and harvested to detect SMAD2 expression. Actin was used as internal control. C) qRT PCR for SMAD2 and miR 17 92 from TIVE cells infected with wild type KSHV or with mutant KSVH lacking vFLIP, vCycl in and both. RNAs were harvested from latently infected TIVE cells and qRT PCR was performed. The expression of non infected TIVE cell set at 1. GAPDH was used as internal control for normalization.

PAGE 60

60 Fig ure 2 6 . SLK cells do not express cellular Myc. Western blot for c Myc was performed with SLK cells transfected with empty vector or with vFLIP or vCyclin expressing vectors. Cells were harvested 48 hour post transfection. The positive control is the lysate of T lymphoblastic leukemia cell, KOPT K1 cell. Actin was used as internal control .

PAGE 61

61 Fig ure 2 7 . The miR 17 92 cluster expression by vFLIP and vCyclin is independent of NF signaling pathway. (A) and (B) Luciferase reporter analysis was performed with re porter vector containing the promoter of the miR 17 92 cluster, co transfected with empty vector or with vectors expressing vFLIP or vCyclin in the presence of various concentration of Bay 11. The cells were harvested 48 hours after transfection. Firefly a nd renilla luciferase activities were measured, and firefly luciferase activity was normalized to control renilla luciferase activity.

PAGE 62

62 CHAPTER 3 HUMAN IL 4, INDUCED BY PARASITE INFECTION, INDUCES LYTIC REACTIVATION IN KSHV Introduction Like the human gammaherpesvirus KSHV, murine gammaherpesvirus 68 (MHV68) establishes latency. MHV68 is a model to study host defense mechanisms against gammaherpesviruses ( Simas and Efstathiou, 1998 ) . The reactivation of MHV68 is inhibited by anti viral cytokine, interferon IFN ) ( Goodwin et al., 2010 ; Steed et al., 2007 ) . Helminths are intestinal parasites that can infect and live inside animals, including humans. Intestinal helminths are one of the most common infections in developing countries, an d spread by use of contaminated water. Co infection of herpesvirus with intestinal helminths is not rare in these countries ( Dedicoat and Newton, 2003 ) ( Wakeham et al., 2011 ) . Upon the infection of the pathogens, host immune system is activated to clear the pathogens. Helper T cells are one of the immune responses to influence a various type s of immune cells by secreting cytoki nes. Th1 immune responses occur against i ntracellular pathogens, such as viruses. IFN secreted by Th1 cells, which activates macrophages. This immune response also lead s to activation of cytotoxic T lymphocyte s to result in killing the infected cells. On the other hand, Th2 immune response s are stimulated by extracellular bacteria or parasites. IL 4 is released from activated CD4+ Th2 cells to activate B cells for antibody production. Therefore, the Th2 immune pathway is activated by intestinal helminths and induces strong cytokine responses , which are thought to have an opposite effect to IFN ( Zhu et al., 2010 ) . Although it has been reported that parasitic worms affect the course of infection by other pathogens, the mechanisms are not well elucidated. Tiffany Reese and Herbert Virgin, at Washin gton University in St. Louis, have found that the nematode

PAGE 63

63 parasite ( Heligomosomoides polygyrus ( H. polygyrus )) or trematode eggs ( Schistosomiasis mansoni ( Sm )), which induces a Th2 immune response, can reactivate lytic replication of MHV68 via the express ion of IL 4. With further studies in the mouse model, IL4 was shown to stimulate Stat6 to reactivate MHV68 by binding to the N4/N5 promoter of the lytic switch, ORF50, transactivator to initiate lytic reactivation ( Reese et al., 2014b ) . Then, they questioned if KSHV can be reactivated by IL 4. Dr. Renne was contacted to collaborat e to tackle these experiment s . Our role in the project was to determine whether KSHV is reactivated in the presence of exogenous IL 4. Materials and M ethods KSHV Gene Expression KSHV infected SLK and TIVE cells were cultured in DMEM with 10% FBS and 1% penicillin and streptomycin. BCBL 1 cells were cultured in RMPI with 10% FBS and 1% penicillin and streptomycin . At indicated times post IL 4 ( Peprotech Inc. ) or 12 O tetradecanoylphorbol 13 acetate (TPA) treatment, total RNA was extracted using RNA Bee (Tel Test) accordin suggestions. Quantitative PCR (qPCR) analysis was carried out using an ABI StepOne Plus system along with ABI Fast SYBR r eagent (Applied Biosystems, Carlsbad, CA). Expression of all genes was normalized to GAPDH expression. Primers for qRT PCR are listed in Table 3 1 . KSHV Isolation and Quantitation Virus particles were harvested from PEL cells at indicated times post IL 4 treatment. After removing cellular debris, media supernatant was passed through a centrifugation using a

PAGE 64

64 Beckman SW 40 rotor at 100,000 x g for 1 hr. Virus pellets were resuspended and DNA was extracted using DNAzole (Molecular Research Center, Inc.). Viral genome copy number was determined by qPCR assay for LANA N terminus (Sequences in Table 3 1), using a serially diluted LANA expression plasmid to generate a standard curve. Results and Disc ussion Various concentration s of IL 4 were tested in KSHV infected SLK, TIVE and BCBL1 cells in order to determine whether IL 4 induced reactivation, and if so what the optimal condition s were for IL 4 induced reactivation. KSHV infected SLK, TIVE, and BCB L1 cells were seeded and treated with differen t concentration of IL 4, 1 ng/mL , 10 ng/m L , and 100 ng/m L . W e harvested cells 48 hours post treatment of IL 4 to extract RNA and perform ed qRT PCR with RTA primers. As shown in Figure 3 1, w hile SLK and TIVE cells were not shown significant change in more than 10 ng/m L of IL 4 treatment, BCBL1 cells showed around 1.3 fold increase of RTA expression. Therefore, we decided to use 10 ng/m L of IL 4 to treat BCBL1 cells for further investigation. Then the expressio n levels of four KSHV lytic genes were determined by RT qPCR . The expression level s of RTA, ORF45 (immediate early genes) , ORF57 (early gene) , and ORF19 (late gene) were all increased following IL 4 treatment , similar to the level to induction by 12 O tetr adecanoylphorbol 13 acetate (TPA) (Fig. 3 2 A ) . To confirm that increased KSHV lytic gene expression resulted in genome replication , the media from IL 4 treated BCBL1 cells w as harvested at 3 and 5 days post treatment, and KSHV genomes were extracted to de termine virus titer. As in Figure 3 2 B , the result s showed that IL 4 induced lytic reactivation to produce progeny virus , similar to TPA induction. Therefore, our results show that human IL 4 is also able to reactivate the human

PAGE 65

65 gamma herpesvirus, KSHV, dem onstrating that the previous finding on MHV68 is shown in human gamma herpesvirus es . Herpesvirus es avoid and hide from host immune surveillance by expressing very few genes , in order to maintain its genome inside the host cells. And the lytic r eactivation is important phase for virus to spread to new hosts (new cells or new organisms). Therefore, these two phases must be controlled very precisely when the time comes for virus to spread out without being cleared by host defense mechanisms . The vi rus may have evolved to sense the changes of host immune responses to other infections, in order to be reactivated without being cleared by host immune system. Helminth infection lead s the immune cells to activate CD4+ T helper 2 (Th2) to secrete IL 4, by which B cells produce and secrete immunoglobulin E (IgE) to fight against helminth infection. On the other hand, most viral infection stimulate s the Th1 response that leads to IFN production. IFN and IL 4 function antagonistically. Therefore, the induc tion of IL 4 with any reason make s the best environment for virus to be reactivated. This implicates that gammaherpesvirus es may have evolve d to sense the environment changes by co infection with other pathogens, in order to produce progeny virus with avoidance from host immune response. This work is part of the Reactivates Latent Gamma herpesvirus via Cytokine Competition at a Viral ( Reese et al., 2014a ) .

PAGE 66

66 Table 3 1. Sequences of primers used for qRT PCR Genes Primer sequences RTA FWD CACAAAAATGGCGCAAGATGA REV TGGTAGAGTTGGGCCTTCAGTT ORF57 FWD ACGAATCGAGGGACGACG REV CGGGTTCGGACAATTGCT ORF45 FWD GCTTTGCGGCTTAAGTTTGG REV CGCCTCCTCTGGTAGCGA ORF19 FWD GGCGAAAAAGTCAGCGGTGGT REV CGGCGCGTCTTCCCTAAAGA LANA FWD GCGCCCTTAACGAGAGGAAGTT REV TTCCTTCGCGGTTGTAGATG GAPDH FWD CCCCTGGCCAAGGTCATCCA REV ACAGCCTTGGCAGCGCCAGT

PAGE 67

67 Figure 3 1 . RTA expression in various concentration of IL 4 treatment. qRT PCR for RTA from BCBL1, KSHV infected SLK and TIVE cells. RNAs were harvested 48 hours after IL 4 treatment and qRT PCR was performed. The expression of each cells without IL 4 treatment was set at 1. GAPDH was used as internal contr ol for normalization. 0 0.5 1 1.5 2 2.5 3 Mock 1 ng/ml 10 ng/ml 100 ng/ml RTA BCBL1 SLK TIVE Relative expression

PAGE 68

68 Figure 3 2 . IL 4 induces KSHV reactivation. (A) qRT PCR for 4 lytic genes from BCBL1 cell was performed . RNAs were harvested 3 and 5 days after IL 4 treatment. The BCBL1 cells with the TPA treatment were harvested 3 days post treatment and used as positive control. Indicated value in the graph is the relative to t he expression from the cells without induction by IL 4 or TPA . GAPDH was used as internal control for normalization. (B) Virus particles were harvested from the media where BCBL1 cells were grown. DNA was extracted from the viruses and qPCR assay was performed to determine viral genome copies, using serially diluted LANA expression plasmids as a standard curve. A B

PAGE 69

69 CHAPTER 4 GATEWAY CLONING SYSTEM FOR KSHV ORFS Ga teway Cloning Overview The individual KSHV ORF need ed to be cloned into the expression vectors for functional studies, in order for deletion mutant viruses of specific genes to be generated. To investig at e the roles of individual KSHV genes in the cells, we decided to generate a library containing all KSHV ORFs using the Gateway cloning system. Compared to conventional cloning method s , the Gateway cloning system has fewer step s and higher efficiency. Once the donor vector library i s generated, the genes in donor vectors are easily transferred into the various types of expression vectors according to the experimental requirements . The Gateway cloning system was invented by Life Technologies Inc. (Invitrogen). This cloning method is d ifferent from conventional cloning using restriction enzymes and ligases. Instead, the Gateway cloning system utilizes the recombination sequences to transfer the DNA fragments into the other vectors. Integrase of phage lambda was used for the site specifi c recombination, which is conservative and highly specific ( Landy, 1989 ) The bacteriophage lambda integrates its genome into the E. coli chromosome and facilitates the switch between the lytic and lysogenic pathways ( Ptashne, 2011 ) . Specific attachment (att) sites are needed for recombination. This recombination process is conservative, meaning that there are no nucleotides added or lost in the sequences. After the recombination, att sites are switch ed, such that attB (bacterial) and attP (phage) sites are recombined to generate attL and attR sites. The att sites are the binding sites of recombination proteins ( Weisberg et al., 1983 ) . There a re two

PAGE 70

70 recombination reactions to clone the genes of interest into donor or destination vectors ( Fig. 4 1) . BP recombination between attB and attP sites is facilitated by the bacteriophage lambda Integrase (Int) and E. coli Inte g ration Host Factor (IHF) proteins, called BP Clonase, while LR recombination between the attL and attR sites is catalyzed by three enzymes, Int, IHF, and Excisionase (Xis), called LR Clonase. The donor and destination vectors, where the genes of interest are cloned into, contains suicide gene cassette, the ccdB gene. The ccdB gene targets DNA gy r ase to block bacterial growth. Thus, DB3.1 was used to amplify the vectors without the genes of int erest, which strain contains and expresses the ccdA gene that are resistant to ccdB . Since ccdB gene in the vectors is flanked by att site, the genes of interest replace the suicidal gene after BP and LR recombination. With this technique, we made the libr ary of entry clones containing KSHV ORFs. In addition, vFLIP and vCyclin genes were shuttled into retroviral vector for the experiments in Chapter 2. Materials and Methods Primer Design and PCR Two steps of PCR were performed to amplify KSHV ORFs with attB recombination sites. First PCR steps were to amplify ORFs with partial attB sites and second PCR steps were to produce intact sequences of attB sites. All primers for amplification of first PCR were designed as no less 15 nucleotides, no longer than 40 nu cleotides, less than 60 degree centigrade of Tm values as possible. A unique primer pair was used for each ORF in Table 4 1. GM81 and GM82 (Table 2 1) were used for second PCR reaction. KSHV genome purified from BCBL1 cells was used as template and Masterc ycler gradient from Eppendorf was used for amplification. KSHV genes amplified by PCR were cloned into donor vector, pDONR222 (Fig. 4 2A), by BP

PAGE 71

71 recombination. pLenti6/V5 DEST (Fig. 4 2B) was used as the destination vector to express selected KSHV genes after transfer of the genes from the pDONR222 vector via LR recombination. The strains of E. coli Three strains of competent E. coli were used for transformation. The empty vector was amplified in DB3.1 competent cell s . E. coli strain s were used for amplification of vectors after BP recombination and LR recombination, respectively. Stbl3 competent E. coli is used for amplification of pLenti6/V5 DEST vector by reduc ing the frequency of the homologous recombination between LTRs in the vector. The vectors were mixed with 50 ul of competent E. coli and chilled on ice for 30 minutes. Heat shock was performed in 42 degree centigrade for 1.5 minutes. 150 mL of LB broth wit hout the antibiotics was added and transformed cells were incubated in shaking incubator for 1 hour. The transformed E. coli were plated in LB plates containing the antibiotics, kanamycin for pDONR222 clones or ampicillin for pLenti6/V5 DEST clones . Results and Future Goals 70 genes out of 87 KSHV genes were successfully amplified by two steps of PCR, cloned into pDONR222 vector , and confirmed by Sanger sequencing. The cloned genes are listed in Table 4 1 , and the function of each gene come s from the paper titled Associated Herpesvirus Genome Using Next Generation Sequencing Reveals Novel Genomic and Functional Features ( Arias et al., 2014 ) . These genes in pDONR vector can be used for other research to investigate functio nal analysis of the genes. The advantage of the

PAGE 72

72 Gateway Cloning method is that the genes in donor vector are easily transferred into various Gateway expression vector s containing the different promoters. Among the cloned KSHV genes, vFLIP and vCyclin were cloned into pLenti6/V5 DEST vector by LR recombination for further experiments in Chapter 2. As described in the introduction of this chapter, since the donor vectors with KSHV ORFs can be easily transferred into any type of expressi on vectors that contain LR recomb in ation sites , the appropriate vectors can be chosen for specific assay . Thus, this library of KSHV ORFs provide s a valuable resource that will aid studies in KSHV biology. Furthermore , m any functional assay s will not requi re the generation of antibodies, since all Gateway clones in the expression vector were tagged at its C terminus with a V5 epitope tag.

PAGE 73

73 Table 4 1. Genes cloned into pDONR vector , time of expression, and function KSHV genes Kinetic C lass Functions ORF K1 Early Glycoprotein ORF 04 Early Complement binding protein ORF 06 Early ssDNA binding protein ORF 07 Early Virion protein ORF 08 Late Glycoprotein B ORF 09 Early DNA polymerase ORF 10 Early Regulator of Interferon function ORF K2 Early Viral Interleukine 6 homolog ORF 2 Early Dihydrofolate reductase ORFK3 Immediate Early Immune modulator ORF 70 Early Thymidylate synthase ORF K4 Early vMIP II ORF K4.1 Early N/D ORF K4.2 Immediate Early N/D ORF K6 Early vMIP I ORF K7 Early Small mitochondrial membrane protein ORF 16 Early BCL 2 homolog ORF 17 Late Protease ORF 18 Late Late gene regulation ORF 20 Late N/D ORF 21 Late Thymidine Kinase ORF 22 Late Glycoprotein H ORF 23 Late Glycoprotein (predicted) ORF 26 Late Minor capsid protein ORF 27 Late Glycoprotein ORF 28 Late BDLF3 EBV homolog ORF 30 Late Late gene regulation ORF 31 Immediate Early Nuclear and cytoplasmic ORF 32 Late Tegument protein

PAGE 74

74 Table 4 1. Continued KSHV genes Kinetic Class Functions ORF 33 Late Tegument protein ORF 34 Late N/D ORF 35 Late N/D ORF 36 Early Serine protein kinase ORF 37 Early Sox ORF 38 Late Myristylated protein ORF 39 Late Glycoprotein M ORF 40 Early Helicase Primase ORF 41 Early Helicase Primase ORF 42 Late Tegument pretein ORF 43 Late Portal protein (capsid) ORF 45 Immediate early RSK activator ORF 46 Early Uracil deglycosylase ORF 47 Late Glycoprotein L ORF 48 Immediate Early N/D ORF 49 Early Activates JNK/p38 ORF K8 Immediate Early bZIP ORF K8.1 Late Glycoprotein ORF 52 Late Tegument protein ORF 53 Late Glycoprotein N ORF 54 Early dUTPase/Immune modulator ORF 55 Late Tegument protein ORF 56 Early DNA replication ORF K9 Early vIRF1 ORF K10 Early vIRF4 ORF K10.5 Latent vIRF3 ORF K11 Early vIRF2 ORF 58 Late N/D ORF 59 Early Processivity factor

PAGE 75

75 Table 4 1. Continued KSHV genes Kinetic Class Functions ORF 60 Early Ribonucleoprotein reductase ORF 61 Early Ribonucleoprotein reductase ORF 62 Late N/D ORF 65 Late Capsid ORF 67 Late Nuclear egress complex ORF 67.5 Late N/D ORF 68 Late Glycoprotein ORF 69 Early BRLF2 Nuclear egress ORF K13 Latent vFLIP ORF 72 Latent vCyclin ORF K14 Early vOX2 ORF 74 Early vGPCR N/D : not determined in silico or by manual annotation.

PAGE 76

76 Figure 4 1 . Schematic diagram of the Gateway Cloning procedure . The genes of interest, flanked by attB on each side, are amplified by PCR and cloned into donor vector containing attP sites by BP recombination. The donor vector containing the genes of interest mixed with destination vector , which mostly contains promot er to express the genes of interest. Dono r vecto r Destinati on vector Destinati on vector Dono r vecto r Gene of interest

PAGE 77

77 Figure 4 2. Vector map of donor vector (A) and expression vector (B). Both vectors contains ccdB gene, flanked by att sites, where recombination o ccurs. Whereas pDONR TM 222 vector does not have promoters, pLenti6/V5 DEST contains CMV promoter upstream of attR1 site to express cloned gene. A B pDONR TM 222 4718 bp

PAGE 78

78 CHAPTER 5 OVERALL CONCLUSION KSHV has two distinct phase s in its life cycle, a s described in previous chapters. E ach phase is well controlled such that specific subsets of KSHV genes are express ed during laten t and lytic infections . KSHV infect s not only B cell s but also various types of cells, like dendritic cells, macrophage s , T cells, epithelial and endothelial cells. It is known that tonsil l ar B cells are the primary infection sites, in which KSHV show s a high rate of spontaneous lytic reactivation, wher e as KSHV infected tonsillar T cells d o not produce infectious virus. It has been reported that CD4 positive T cell s prevent KSHV in B cell s from undergoing lytic reactivation, which may promote the establishment of latency ( Myoung and Ganem, 2011a ) . Among the KSHV infected B cell population, CD40 positive B cells selectively translocate into germinal center s and gain the survival signal s to differentiate into long lived memory B cells ( Flano et al., 2002 ; Lazzi et al., 2006 ) . KSHV may take an advantage of long lived memory B cell s to propagate its own genome by clonal expansion after acquiring access to the germinal center. Futhermore, latent genes have oncogenic potential due to their functional roles to make the infected cells grow rapidly, which help s the virus to propagate its genome without producing progeny viruses. LANA plays multiple roles in cell proliferation by associati ng with other host proteins, involved in host replication machinery, tumor su ppressor, and transcription factors ( Ballestas and Kaye, 2011 ) . vFLIP is known as a activator of NF signaling pathway as well as a inhibitor of apoptotic signal ( Field et al., 2003 ; Liu et al., 2002 ) . Moreover, vCyclin is a homolog of cellular cyclinD to promote cell growth ( La man et al., 2001 ) . It has been revealed that vCyclin keeps cells from G1

PAGE 79

79 arrest led by NF hyperactivation, which vFLIP results in ( Z hi et al., 2014 ) . Thus KSHV may have evolved to express vFLIP and vCyclin in a bicistronic mRNA so that the two proteins are always co expressed . The pro apoptotic cytokine, TGF , is one of the targets that KSHV genes down regulate. The down regulatio n of TGF by KSHV latent genes was observed in B cell s as well as endothelial cells. LANA is not the only latent gene to blunt TGF signaling pathway by inhibiting the expression of TGF receptor , but also KSHV encoded miRNAs are active in targeting components of the TGF signaling pathway by down regulating TGF THBS1 expression to play a role in process ing the precursor of TGF into the secreted from ( Di Bartolo et al., 2008 ; Lei et al., 2012 ; Samols, 2007 ) . In addition to previous finding s that latent genes in KSHV promote tumorigenesis , our data in Chapter 2 suggest that host miRNAs, induced by vFLIP and vCyclin, also contribute to down regulation of the TGF signaling pathway for KSHV pathogenesis. Lytic reactivation is a critical process for KSHV to augment the number of infected cells or to be tra n smit ted into other types of cells. I mmunosuppression is thought to induce the lytic reactivation and to all pro ductive infection and pathogenesis to occur . Even though the immunosuppression may be the main cause of the lytic reactivation, it may not be sufficient to trigger the switch to lytic reactivation in immunosuppressed individuals . Other physiological factor s have been revealed to reactivate KSHV from latency, such as hypoxia, oxidative stress, and inflammation ( Ye et al., 2011 ) . These stimuli are crucial for cell surviv al to allow KSHV to sprea d to cells that are receptive for additional rounds of replication . Lytic replication provides more rapid spread of KSHV into other cells or other individuals in the presence of appropriate

PAGE 80

80 stimuli, such as hypoxia, oxidative stress and inflammation, which may lead KSHV to abandon the cells and to infect other cells, in or der to maintain its own genome. Also, other types of infection have been reported to reactivate KSHV from latency. Epidemiological studies elucidated that KSHV can be reactivate d by HIV that causes immune deficiency in infected individuals, as well as by extracellular pathogens leading different types of immune response from viral infection ( Pfeiffer et al., 2010 ; Wakeham et al., 2011 ) . Immune modulation by HIV or parasite infection may provide the environment for KSHV to propagate without immune surveillance by host. Here, we demonstrated that IL 4 induced RTA and other lytic genes for KSHV reactivation and increased progeny virus production . Intracellular pathogens, such as viruses, stimulate cytotoxic T lymphocyte or Th1 immune respons e . In contrast , extracellula r pathogens, such as parasites , trigger Th2 immune response that produces IL4 ( Zhu et al., 2010 ) . CTL and Th1 immune responses are stimulated by KSHV infection, and express IFN that keeps KSHV in latency ( Goo dwin et al., 2010 ; Steed et al., 2007 ) . However, h elm inth co infection in MHV68 infected mice induced IL 4 expression through Th2 immune response, which reactivates the virus by induction of gene50 expression through N4/N5 promoter. Moreover, human gammaherpesvirus, KSHV , is also reactivated by IL 4 treatment in vitro . These finding s correspond to the previous epidemiology research in that parasite infection may lead to a higher chance of KSHV reactivation ( Pfeiffer et al., 2010 ; Reese et al., 2014b ; Wakeham et al., 2011 ) . These results implicate that KSHV has evolved to sense the alte ration of immune response for appropriate environment to stay in dormant stage or to produce progeny virus without

PAGE 81

81 being detected by immune syst em, in order to infect into uninfected B cells or other types of cells, such as endothelial cells , where KSHV also establishes latency . Our results in Chapter 2 and 3 enhance our understa n ding of how KSHV contributes to tumorigenesis in latency by the dow n regulation of tumor suppressive TGF via vFLIP and vCyclin . This down regulation occurs through indirect modulati on of the host miR 17 92 cluster expression as well as via KSHV latent genes directly targeting TGF signaling pathway. Additionally , we pe rformed transcription factor prediction in silico to determine putative transcription factor binding sites that mediate v Cyclin and vFLIP transcriptional activation (Fig. 5 2 ). We identified a number of E2F 1 and STAT4/5 binding site s within the 17/92 promoter . E2F family transcription factors are known to promote the miR 17 92 cluster in a manner of negative feedback loop. Since vCyclin is a homolog of type D cellular cyclin, vCyclin activates E2F transcription factors ( Chang et al., 1996a ; Swanton et al., 1997 ) ( Sylvestre et al., 2007 ) . Moreover, it is known that STAT1 is activated by vFLIP for spindle cell formati on in endothelial cells ( Alkharsah et al., 2011 ) . Even though STAT1 sites were not predicted, we found STAT4 and STAT5 sites that may be able to activate t he promoter of miR 17 92 cluter. Our data indicate that during latency, although few genes and miRNAs are expressed, the products of the KLAR region play an active role in maintaining latency and in promoting an environment where KSHV is able to avoid host immune responses and KSHV infected cells continue to proliferate, thus maintaining a KSHV reservoir. Furthermore , our finding s in the IL 4 experiments indicates that KSHV sense s the alteration of host immune response by parasite infection , enabling reactivation and lead ing to infection of

PAGE 82

82 more ce lls . The transition from latency to reactivation is clearly a tightly controlled process, and is sensitive to many more factors than was initially thought.

PAGE 83

83 Figure 5 1. Schematic diagram of the KSHV life cycle. Lytic replication is the phase that produce s KSHV progeny for de novo infection of cells. On the other hand, latency is a dormant phase where only a few genes are expressed.

PAGE 84

84 Figure 5 2. In silico prediction of transcription factor binding sites in the promoter of miR 17 92 cluster. The promoter sequence of the miR 17 92 cluster was analysed using web base program PROMO, which predicts the transcription factor to bind the promoter region based on the TRANSFAC database ( Farre et al., 2003 ; Messeguer et al., 2002 ) . (http://alggen.l si.upc.es/cgibin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3)

PAGE 85

85 LIST OF REFERENCES Alkharsah, K.R., Singh, V.V., Bosco, R., Santag, S., Grundhoff, A., Konrad, A., Sturzl, M., Wirth, D., Dittrich Breiholz, O., Kracht, M. , et al. (2011). Deletion of Kaposi's sarcoma associated herpesvirus FLICE inhibitory protein, vFLIP, from the viral genome compromises the activation of STAT1 responsive cellular genes and spindle cell formation in endothelial cells. Journal of V irology 85 , 10375 10388. Ambros, V. (2004). The functions of animal microRNAs. Nature 431 , 350 355. Amir, H., Kaaya, E.E., Manji, K.P., Kwesigabo, G., and Biberfeld, P. (2001). Kaposi's sarcoma before and during a human immunodeficiency virus epidemic in Tanzanian children . Pediatr Infect Dis J 20 , 518 521. An, F.Q., Folarin, H.M., Compitello, N., Roth, J., Gerson, S.L., McCrae, K.R., Fakhari, F.D., Dittmer, D.P., and Renne, R. (2006). Long term infected telomerase immortalized endothelial cells: a model for Kaposi's sarcom a associated herpesvirus latency in vitro and in vivo. Journal of V irology 80 , 4833 4846. Aoki, Y., Jaffe, E.S., Chang, Y., Jones, K., Teruya Feldstein, J., Moore, P.S., and Tosato, G. (1999). Angiogenesis and hematopoiesis induced by Kaposi's sarcoma asso ciated herpesvirus encoded interleukin 6. Blood 93 , 4034 4043. Arias, C., Weisburd, B., Stern Ginossar, N., Mercier, A., Madrid, A.S., Bellare, P., Holdorf, M., Weissman, J.S., and Ganem, D. (2014). KSHV 2.0: a comprehensive annotation of the Kaposi's sarc oma associated herpesvirus genome using next generation sequencing reveals novel genomic and functional features. PLoS Pathog 10 , e1003847. Ascoli, V., Senis, G., Zucchetto, A., Valerio, L., Facchinelli, L., Budroni, M., Dal Maso, L., and Coluzzi, M. (2009 ). Distribution of 'promoter' sandflies associated with incidence of classic Kaposi's sarcoma. Med Vet Entomol 23 , 217 225. Baek, D., Villen, J., Shin, C., Camargo, F.D., Gygi, S.P., and Bartel, D.P. (2008). The impact of microRNAs on protein output. Natur e 455 , 64 71. Bagni, R., and Whitby, D. (2009). Kaposi's sarcoma associated herpesvirus transmission and primary infection. Curr Opin HIV AIDS 4 , 22 26. Bais, C., Santomasso, B., Coso, O., Arvanitakis, L., Raaka, E.G., Gutkind, J.S., Asch, A.S., Cesarman, E., Gershengorn, M.C., Mesri, E.A. , et al. (1998). G protein coupled receptor of Kaposi's sarcoma associated herpesvirus is a viral oncogene and angiogenesis activator. Nature 391 , 86 89. Bais, C., Van Geelen, A., Eroles, P., Mutlu, A., Chiozzini, C., Dias , S., Silverstein, R.L., Rafii, S., and Mesri, E.A. (2003). Kaposi's sarcoma associated herpesvirus G protein coupled receptor immortalizes human endothelial cells by activation of the VEGF receptor 2/ KDR. Cancer Cell 3 , 131 143.

PAGE 86

86 Ballestas, M.E., and Kaye , K.M. (2001). Kaposi's sarcoma associated herpesvirus latency associated nuclear antigen 1 mediates episome persistence through cis acting terminal repeat (TR) sequence and specifi cally binds TR DNA. Journal of V irology 75 , 3250 3258. Ballestas, M.E., and Kaye, K.M. (2011). The latency associated nuclear antigen, a multifunctional protein central to Kaposi's sarcoma associated herpesvirus latency. Future Microbiol 6 , 1399 1413. Barbera, A.J., Chodaparambil, J.V., Kelley Clarke, B., Joukov, V., Walter, J.C. , Luger, K., and Kaye, K.M. (2006). The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA. Science 311 , 856 861. Bartel, D.P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116 , 281 297. Bélanger C, G.A. , Tomoiu A, Janelle ME, Gosselin J, Tremblay MJ, Flamand L. (2001). Human herpesvirus 8 viral FLICE inhibitory protein inhibits Fas mediated apoptosis through binding and prevention of procaspase 8 maturation. J Hum Virol 4 , 62 73. Bierie, B., and Moses, H .L. (2006). Tumour microenvironment: TGFbeta: the molecular Jekyll and Hyde of cancer. Nat Rev Cancer 6 , 506 520. Bierie, B., and Moses, H.L. (2010). Transforming growth factor beta (TGF beta) and inflammation in cancer. Cytokine Growth Factor Rev 21 , 49 5 9. Blobe, G.C., Schiemann, W.P., and Lodish, H.F. (2000). Role of transforming growth factor beta in human disease. The New Eng land J ournal of M edicine 342 , 1350 1358. Boshoff, C. (2003). Kaposi virus scores cancer coup. Nat Med 9 , 261 262. Bottero, V., Sharma Walia, N., Kerur, N., Paul, A.G., Sadagopan, S., Cannon, M., and Chandran, B. (2009). Kaposi sarcoma associated herpes virus (KSHV) G protein coupled receptor (vGPCR) activates the ORF50 lytic switch promoter: a potential positive feedback loop for sustained ORF50 gene expression. Virology 392 , 34 51. Brulois, K.F., Chang, H., Lee, A.S., Ensser, A., Wong, L.Y., Toth, Z., Lee, S.H., Lee, H.R., Myoung, J., Ganem, D. , et al. (2012). Construction and manipulation of a new Kaposi's sarcoma associated herp esvirus bacterial artificia l chromosome clone. Journal of V irology 86 , 9708 9720. Burysek, L., Yeow, W.S., Lubyova, B., Kellum, M., Schafer, S.L., Huang, Y.Q., and Pitha, P.M. (1999). Functional analysis of human herpesvirus 8 encoded viral interferon regu latory factor 1 and its association with cellular interferon regulator y factors and p300. Journal of V irology 73 , 7334 7342.

PAGE 87

87 Cai, X., Lu, S., Zhang, Z., Gonzalez, C.M., Damania, B., and Cullen, B.R. (2005). Kaposi's sarcoma associated herpesvirus expresse s an array of viral microRNAs in latently infected cells. Proc Natl Acad Sci U S A 102 , 5570 5575. Calin, G.A., Dumitru, C.D., Shimizu, M., Bichi, R., Zupo, S., Noch, E., Aldler, H., Rattan, S., Keating, M., Rai, K. , et al. (2002). Frequent deletions and d own regulation of micro RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 99 , 15524 15529. Calin, G.A., Sevignani, C., Dumitru, C.D., Hyslop, T., Noch, E., Yendamuri, S., Shimizu, M., Rattan, S., Bullrich, F., Ne grini, M. , et al. (2004). Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A 101 , 2999 3004. Cameron, J.E., Fewell, C., Yin, Q., McBride, J., Wang, X., Lin, Z., and Flemington, E.K . (2008). Epstein Barr virus growth/latency III program alters cellular microRNA expression. Virology 382 , 257 266. Casper, C., and Wald, A. (2007). The use of antiviral drugs in the prevention and treatment of Kaposi sarcoma, multicentric Castleman diseas e and prim ary effusion lymphoma. Current Topics in Microbiology and I mmunology 312 , 289 307. Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., and Knowles, D.M. (1995). Kaposi's sarcoma associated herpesvirus like DNA sequences in AIDS related body cavity based lymphomas. The New England Journal of M edicine 332 , 1186 1191. Cesarman, E., Nador, R.G., Bai, F., Bohenzky, R.A., Russo, J.J., Moore, P.S., Chang, Y., and Knowles, D.M. (1996). Kaposi's sarcoma associated herpesvirus contains G protein coupled recep tor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma. Journal of V irology 70 , 8218 8223. Chan, J.A., Krichevsky, A.M., and Kosik, K.S. (2005). MicroRNA 21 is an antiapoptotic factor in hu man glioblastoma cells. Cancer R e search 65 , 6029 6033. Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and Moore, P.S. (1994). Identification of herpesvirus like DNA sequences in AIDS associated Kaposi's sarcoma. Science 266 , 1865 1869. Chang, Y., Moore, P.S. , Talbot, S.J., Boshoff, C.H., Zarkowska, T., Godden, K., Paterson, H., Weiss, R.A., and Mittnacht, S. (1996a). Cyclin encoded by KS herpesvirus. Nature 382 , 410. Chang, Y., Ziegler, J., Wabinga, H., Katangole Mbidde, E., Boshoff, C., Schulz, T., Whitby, D ., Maddalena, D., Jaffe, H.W., Weiss, R.A. , et al. (1996b). Kaposi's sarcoma associated herpesvirus and Kaposi's sarcoma in Africa. Uganda Kaposi's Sarcoma Study Group. Arch Intern Med 156 , 202 204.

PAGE 88

88 Cimmino, A., Calin, G.A., Fabbri, M., Iorio, M.V., Ferracin, M., Shimizu, M., Wojcik, S.E., Aqeilan, R.I., Zupo, S., Dono, M. , et al. (2005). miR 15 and miR 16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A 102 , 13944 13949. Costinean, S., Zanesi, N., Pekarsky, Y., Tili, E., Volinia, S., Heer ema, N., and Croce, C.M. (2006). Pre B cell proliferation and lymphoblastic leukemia/high grade lymphoma in E(mu) miR155 transgenic mice. Proc Natl Acad Sci U S A 103 , 7024 7029. Dedicoat, M., and Newton, R. (2003). Review of the distribution of Kaposi's s arcoma associated herpesvirus (KSHV) in Africa in relation to the incidence of Kaposi's sarcoma. Br J Cancer 88 , 1 3. Derynck, R., Akhurst, R.J., and Balmain, A. (2001). TGF beta signaling in tumor suppression and cancer progression. Nat Genet 29 , 117 129. Desrosiers, R.C., Sasseville, V.G., Czajak, S.C., Zhang, X., Mansfield, K.G., Kaur, A., Johnson, R.P., Lackner, A.A., and Jung, J.U. (1997). A herpesvirus of rhesus monkeys related to the human Kaposi's sarcoma asso ciated herpesvirus. Journal of V irology 71 , 9764 9769. Di Bartolo, D.L., Cannon, M., Liu, Y.F., Renne, R., Chadburn, A., Boshoff, C., and Cesarman, E. (2008). KSHV LANA inhibits TGF beta signaling through epigenetic silencing of the TGF beta type II receptor. Blood 111 , 4731 4740. Eis, P.S., Tam , W., Sun, L., Chadburn, A., Li, Z., Gomez, M.F., Lund, E., and Dahlberg, J.E. (2005). Accumulation of miR 155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A 102 , 3627 3632. Esquela Kerscher, A., and Slack, F.J. (2006). Oncomirs microRNA s with a role in cancer. Nat Rev Cancer 6 , 259 269. Farre, D., Roset, R., Huerta, M., Adsuara, J.E., Rosello, L., Alba, M.M., and Messeguer, X. (2003). Identification of patterns in biological sequences at the ALGGEN ser ver: PROMO and MALGEN. Nucleic A cids R esearch 31 , 3651 3653. Field, N., Low, W., Daniels, M., Howell, S., Daviet, L., Boshoff, C., and Collins, M. (2003). KSHV vFLIP binds to IKK gam ma to activate IKK. Journal of Cell S cience 116 , 3721 3728. Flano, E., Kim, I.J., Woodland, D.L., and Blackman , M.A. (2002). Gamma herpesvirus latency is preferentially maintained in splenic germinal center and memory B cells. J Exp Med 196 , 1363 1372. Forte, E., Salinas, R.E., Chang, C., Zhou, T., Linnstaedt, S.D., Gottwein, E., Jacobs, C., Jima, D., Li, Q.J., Dave, S.S. , et al. (2012). The Epstein Barr virus (EBV) induced tumor suppressor microRNA MiR 34a is growth promoting in EB V infected B cells. Journal of V irology 86 , 6889 6898.

PAGE 89

89 Friedman Birnbaum, R., Weltfriend, S., and Katz, I. (1990). Kaposi's sarcoma: retrospective study of 67 cases with the classical form. Dermatologica 180 , 13 17. Fujimuro, M., and Hayward, S.D. (2003). The latency associated nuclear antigen of Kaposi's sarcoma associated herpesvirus manipulates the activity of glycogen synthase kinas e 3beta. Journal of V irology 77 , 8019 8030. Galliher, A.J., Neil, J.R., and Schiemann, W.P. (2006). Role of transforming growth factor beta in cancer progression. Future Oncol 2 , 743 763. Garber, A.C., Hu, J., and Renne, R. (2002). Latency associated nucle ar antigen (LANA) cooperatively binds to two sites within the terminal repeat, and both sites contribute to the ability of LANA to suppress transcription and to facilitate D NA replication. The Journal of Biological C hemistry 277 , 27401 27411. Gatto, G., Rossi, A., Rossi, D., Kroening, S., Bonatti, S., and Mallardo, M. (2008). Epstein Barr virus latent membrane protein 1 trans activates miR 155 transcription through the NF kappaB pathway. Nucleic Acids R esearch 36 , 6608 6619. Gomis, R.R., Alarco n, C., Nadal, C., Van Poznak, C., and Massague, J. (2006). C/EBPbeta at the core of the TGFbeta cytostatic response and its evasion in metastatic breast cancer cells. Cancer Cell 10 , 203 214. Goodwin, M.M., Canny, S., Steed, A., and Virgin, H.W. (2010). Mu rine gammaherpesvirus 68 has evolved gamma interferon and stat1 repressible promoters for the ly tic switch gene 50. Journal of V irology 84 , 3711 3717. Gottwein, E., Corcoran, D.L., Mukherjee, N., Skalsky, R.L., Hafner, M., Nusbaum, J.D., Shamulailatpam, P. , Love, C.L., Dave, S.S., Tuschl, T. , et al. (2011). Viral microRNA targetome of KSHV infected primary effusion lymphoma cell lines. Cell Host Microbe 10 , 515 526. Gottwein, E., and Cullen, B.R. (2010). A human herpesvirus microRNA inhibits p21 expression and attenuates p21 mediated cell cycle arrest. Journal of V irology 84 , 5229 5237. Gottwein, E., Mukherjee, N., Sachse, C., Frenzel, C., Majoros, W.H., Chi, J.T., Braich, R., Manoharan, M., Soutschek, J., Ohler, U. , et al. (2007). A viral microRNA functions as an orthologue of cellular miR 155. Nature 450 , 1096 1099. Grandadam, M., Dupin, N., Calvez, V., Gorin, I., Blum, L., Kernbaum, S., Sicard, D., Buisson, Y., Agut, H., Escande, J.P. , et al. (1997). Exacerbations of clinical symptoms in human immunodefici ency virus type 1 infected patients with multicentric Castleman's disease are associated with a high increase in Kaposi's sarcoma herpesvirus DNA load in peripheral blood mononuclear cells. The Journal of Infectious D iseases 175 , 1198 1201.

PAGE 90

90 Guasparri, I., Keller, S.A., and Cesarman, E. (2004). KSHV vFLIP is essential for the survival of infected lymphoma cells. J Exp Med 199 , 993 1003. Guo, H.G., Sadowska, M., Reid, W., Tschachler, E., Hayward, G., and Reitz, M. (2003). Kaposi's sarcoma like tumors in a hum an herpesvirus 8 ORF74 transgeni c mouse. Journal of V irology 77 , 2631 2639. Haecker, I., Gay, L.A., Yang, Y., Hu, J., Morse, A.M., McIntyre, L.M., and Renne, R. (2012). Ago HITS CLIP expands understanding of Kaposi's sarcoma associated herpesvirus miRNA fu nction in primary effusion lymphomas. PLoS Pathog 8 , e1002884. Haecker, I., L.A. Gay, Y. Yang, J. Hu, A.M. Morse, L. McIntyre, and R. Renne (2012). Ago HITS associated Herpesvirus miRNA Function in Primary Eff usion Lymphomas. PLoS Pathog 8 , e1002884. Han, J., Lee, Y., Yeom, K.H., Nam, J.W., Heo, I., Rhee, J.K., Sohn, S.Y., Cho, Y., Zhang, B.T., and Kim, V.N. (2006). Molecular basis for the recognition of primary microRNAs by the Drosha DGCR8 complex. Cell 125 , 887 901. He, H., Jazdzewski, K., Li, W., Liyanarachchi, S., Nagy, R., Volinia, S., Calin, G.A., Liu, C.G., Franssila, K., Suster, S. , et al. (2005a). The role of microRNA genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A 102 , 19075 19080. He, L., Thomson, J.M., Hemann, M.T., Hernando Monge, E., Mu, D., Goodson, S., Powers, S., Cordon Cardo, C., Lowe, S.W., Hannon, G.J. , et al. (2005b). A microRNA polycistron as a potential human oncogene. Nature 435 , 828 833. Herndier, B.G., Werner, A., Arnstei n, P., Abbey, N.W., Demartis, F., Cohen, R.L., Shuman, M.A., and Levy, J.A. (1994). Characterization of a human Kaposi's sarcoma cell line that induces angiogenic tumors in animals. AIDS 8 , 575 581. Hu, J., Garber, A.C., and Renne, R. (2002). The latency a ssociated nuclear antigen of Kaposi's sarcoma associated herpesvirus supports latent DNA replication in dividing cells. Journal of V irology 76 , 11677 11687. Hu, J., Liu, E., and Renne, R. (2009). Involvement of SSRP1 in latent replication of Kaposi's sarcoma associated herpesvirus. Journ al of V irology 83 , 11051 11063. Iorio, M.V., Ferracin, M., Liu, C.G., Veronese, A., Spizzo, R., Sabbioni, S., Magri, E., Pedriali, M., Fabbri, M., Campiglio, M. , et al. (2005). MicroRNA gene expression deregulation in h uman breast cancer. Cancer R esearch 65 , 7065 7070. Iscovich, J., Boffetta, P., and Brennan, P. (1999). Classic Kaposi's sarcoma as a first primary neoplasm. Int J Cancer 80 , 173 177.

PAGE 91

91 Jayachandra, S., Low, K.G., Thlick, A.E., Yu, J., Ling, P.D., Chang, Y., and Moore, P.S. (1999). Three unrelated viral transforming proteins (vIRF, EBNA2, and E1A) induce the MYC oncogene through the interferon responsive PRF element by using different transcription coadaptors. Proc Natl Acad Sci U S A 96 , 11566 11571. Ji, M., Rao, E., Ramachandrareddy, H., Shen, Y., Jiang, C., Chen, J., Hu, Y., Rizzino, A., Chan, W.C., Fu, K. , et al. (2011). The miR 17 92 microRNA cluster is regulated by multiple mechanisms in B cell malignancies. The American Journal of P athology 179 , 1645 16 56. Jiang, J., Lee, E.J., and Schmittgen, T.D. (2006). Increased expression of microRNA 155 in Epstein Barr virus transformed lymphoblastoid cell lines. Genes Chromosomes Cancer 45 , 103 106. Johnson, S.M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A., Labourier, E., Reinert, K.L., Brown, D., and Slack, F.J. (2005). RAS is regulated by the let 7 microRNA family. Cell 120 , 635 647. Kaposi, M. (1872). Idiopathic multiple pigmented sarcoma of the skin. Arch Dertmatol Syphil 4 , 265 273. Kent, O.A., and Mendell, J.T. (2006). A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. Oncogene 25 , 6188 6196. Khvorova, A., Reynolds, A., and Jayasena, S.D. (2003). Functional siRNAs and miRNAs exhibit strand bias. Cell 115 , 209 216. Kliche, S., Nagel, W., Kremmer, E., Atzler, C., Ege, A., Knorr, T., Koszinowski, U., Kolanus, W., and Haas, J. (2001). Signaling by human herpesvirus 8 kaposin A through direct membrane recruitment of cytohesin 1. Mol Cell 7 , 833 843. Komatsu, T., Ba llestas, M.E., Barbera, A.J., Kelley Clarke, B., and Kaye, K.M. (2004). KSHV LANA1 binds DNA as an oligomer and residues N terminal to the oligomerization domain are essential for DNA binding, replication, and episome persistence. Virology 319 , 225 236. La gunoff, M., and Ganem, D. (1997). The structure and coding organization of the genomic termini of Kaposi's sarcoma associated herpesvirus. Virology 236 , 147 154. Lagunoff, M., Majeti, R., Weiss, A., and Ganem, D. (1999). Deregulated signal transduction by the K1 gene product of Kaposi's sarcoma associated herpesvirus. Proc Natl Acad Sci U S A 96 , 5704 5709. Laman, H., Coverley, D., Krude, T., Laskey, R., and Jones, N. (2001). Viral cyclin cyclin dependent kinase 6 complexes initiate nuclear DNA replication. Molecular and Cellular Biology 21 , 624 635.

PAGE 92

92 Lan, K., Kuppers, D.A., Verma, S.C., and Robertson, E.S. (2004). Kaposi's sarcoma associated herpesvirus encoded latency associated nuclear antigen inhibits lytic replication by targeting Rta: a potential mechan ism for virus mediated control of latency. Journal of V irology 78 , 6585 6594. Landy, A. (1989). Dynamic, structural, and regulatory aspects of lambda site specific recombination. Annu Rev Biochem 58 , 913 949. Laney, A.S., Cannon, M.J., Jaffe, H.W., Offermann, M.K., Ou, C.Y., Radford, K.W., Patel, M.M., Spira, T.J., Gunthel, C.J., Pellett, P.E. , et al. (2007). Human herpesvirus 8 presence and viral load are associated with the progression of AIDS associated Kaposi's sarcoma. A IDS 21 , 1541 1545. Lazzi, S., Bellan, C., Amato, T., Palummo, N., Cardone, C., D'Amuri, A., De Luca, F., Beyanga, M., Facchetti, F., Tosi, P. , et al. (2006). Kaposi's sarcoma associated herpesvirus/human herpesvirus 8 infection in reactive lymphoid tissues: a model for KSHV/ HHV 8 related lymphomas? Human P athology 37 , 23 31. Lee, H., Guo, J., Li, M., Choi, J.K., DeMaria, M., Rosenzweig, M., and Jung, J.U. (1998). Identification of an immunoreceptor tyrosine based activation motif of K1 transforming protein of Kaposi's sarcoma assoc ia ted herpesvirus. Molecular and Cellular B iology 18 , 5219 5228. Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin 4 encodes small RNAs with antisense complementarity to lin 14. Cell 75 , 843 854. Lee, Y.S., Kim, H.K., Chung, S., Kim, K.S., and Dutta, A. (2005). Depletion of human micro RNA miR 125b reveals that it is critical for the proliferation of differentiated cells but not for the down regulation of putative targets during d ifferentiation. The Journal of Biologica l C hemistry 280 , 16635 16641. Lei, X., Zhu, Y., Jones, T., Bai, Z., Huang, Y., and Gao, S.J. (2012). A Kaposi's sarcoma associated herpesvirus microRNA and its variants target the transforming growth factor beta pathway to promote cell survival. Jo urnal of V irology 86 , 11698 11711. Lewis, B.P., Shih, I.H., Jones Rhoades, M.W., Bartel, D.P., and Burge, C.B. (2003). Prediction of mammalian microRNA targets. Cell 115 , 787 798. Lin, R., Genin, P., Mamane, Y., Sgarbanti, M., Battistini, A., Harrington, W.J., Jr. , Barber, G.N., and Hiscott, J. (2001). HHV 8 encoded vIRF 1 represses the interferon antiviral response by blocking IRF 3 recruitment of the CBP/p300 coactivators. Oncogene 20 , 800 811. Liu, L., Eby, M.T., Rathore, N., Sinha, S.K., Kumar, A., and Chaudhar y, P.M. (2002). The human herpes virus 8 encoded viral FLICE inhibitory protein physically associates with and persistently activates the Ikappa B kinase complex. The Journal of Biological C hemistry 277 , 13745 13751.

PAGE 93

93 Liu, Y., Sun, R., Lin, X., Liang, D., D eng, Q., and Lan, K. (2012). Kaposi's sarcoma associated herpesvirus encoded microRNA miR K12 11 attenuates transforming growth factor beta signaling through suppression of SMAD5. Journal of V irology 86 , 1372 1381. Lu, F., Weidmer, A., Liu, C.G., Volinia, S., Croce, C.M., and Lieberman, P.M. (2008). Epstein Barr virus induced miR 155 attenuates NF kappaB signaling and stabilizes latent virus persistence. Journal of V irology 82 , 10436 10443. Macrae, I.J., Zhou, K., Li, F., Repic, A., Brooks, A.N., Cande, W.Z ., Adams, P.D., and Doudna, J.A. (2006). Structural basis for double stranded RNA processing by Dicer. Science 311 , 195 198. Massague, J. (2008). TGFbeta in Cancer. Cell 134 , 215 230. Massague, J., and Gomis, R.R. (2006). The logic of TGFbeta signaling. FE BS Lett 580 , 2811 2820. Massague, J., Seoane, J., and Wotton, D. (2005). Smad transcription factors. Genes Dev 19 , 2783 2810. Matsumura, I., Tanaka, H., and Kanakura, Y. (2003). E2F1 and c Myc in cell growth and death. Cell C ycle 2 , 333 338. Mbulaiteye, S.M., Biggar, R.J., Goedert, J.J., and Engels, E.A. (2003). Immune deficiency and risk for malignancy among persons with AIDS. J Acquir Immune Defic Syndr 32 , 527 533. Mbulaiteye, S.M., Biggar, R.J., Pfeiffer, R.M., Bakaki, P.M., Gamache, C., Owor, A.M., Katongole Mbidde, E., Ndugwa, C.M., Goedert, J.J., Whitby, D. , et al. (2005). Water, socioeconomic factors, and human herpesvirus 8 infection in Ugandan children and their mothers. J Acquir Immune Defic Syndr 38 , 474 479. McCormick, C., and Ganem, D. (2005 ). The kaposin B protein of KSHV activates the p38/MK2 pathway and stabilizes cytokine mRNAs. Science 307 , 739 741. Merat, R., Amara, A., Lebbe, C., de The, H., Morel, P., and Saib, A. (2002). HIV 1 infection of primary effusion lymphoma cell line triggers Kaposi's sarcoma associated herpesvirus (KSHV) reactivation. Int J Cancer 97 , 791 795. Messeguer, X., Escudero, R., Farre, D., Nunez, O., Martinez, J., and Alba, M.M. (2002). PROMO: detection of known transcription regulatory elements using species tailor ed searches. Bioinformatics 18 , 333 334. Mestdagh, P., Bostrom, A.K., Impens, F., Fredlund, E., Van Peer, G., De Antonellis, P., von Stedingk, K., Ghesquiere, B., Schulte, S., Dews, M. , et al. (2010). The miR 17 92 microRNA cluster regulates multiple compo nents of the TGF beta pathway in neuroblastoma. Mol Cell 40 , 762 773.

PAGE 94

94 Michael, M.Z., SM, O.C., van Holst Pellekaan, N.G., Young, G.P., and James, R.J. (2003). Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol Cancer Res 1 , 882 891. Mo lden, J., Chang, Y., You, Y., Moore, P.S., and Goldsmith, M.A. (1997). A Kaposi's sarcoma associated herpesvirus encoded cytokine homolog (vIL 6) activates signaling through the shared gp130 receptor subuni t. The Journal of Biological C hemistry 272 , 19625 19631. Montaner, S., Sodhi, A., Pece, S., Mesri, E.A., and Gutkind, J.S. (2001). The Kaposi's sarcoma associated herpesvirus G protein coupled receptor promotes endothelial cell survival through the activation o f Akt/protein kinase B. Cancer R esearch 61 , 2 641 2648. Montesu, M.A., De Marco, R., and Cottoni, F. (1995). Soil silicates and Kaposi's sarcoma in Sardinia. Lancet 346 , 1436 1437. Moore, P.S., Boshoff, C., Weiss, R.A., and Chang, Y. (1996). Molecular mimicry of human cytokine and cytokine response pa thway genes by KSHV. Science 274 , 1739 1744. Moormann, A.M., Chelimo, K., Sumba, O.P., Lutzke, M.L., Ploutz Snyder, R., Newton, D., Kazura, J., and Rochford, R. (2005). Exposure to holoendemic malaria results in elevated Epstein Barr virus loads in childre n. The Journal of I nfectious D iseases 191 , 1233 1238. Moormann, A.M., Chelimo, K., Sumba, P.O., Tisch, D.J., Rochford, R., and Kazura, J.W. (2007). Exposure to holoendemic malaria results in suppression of Epstein Barr virus specific T cell immunosurveilla nce in Kenyan children. The Journal of Infectious D iseases 195 , 799 808. Morozova, N., Zinovyev, A., Nonne, N., Pritchard, L.L., Gorban, A.N., and Harel Bellan, A. (2012). Kinetic signatures of microRNA modes of action. R NA 18 , 1635 1655. Motsch, N., Pfuhl , T., Mrazek, J., Barth, S., and Grasser, F.A. (2007). Epstein Barr virus encoded latent membrane protein 1 (LMP1) induces the expression of the cellular microRNA miR 146a. RNA Biology 4 , 131 137. Moustakas, A., and Heldin, C.H. (2009). The regulation of T GFbeta signal transduction. Development 136 , 3699 3714. Myoung, J., and Ganem, D. (2011a). Active lytic infection of human primary tonsillar B cells by KSHV and its noncytolytic control by activated CD4+ T cells. The Journal of C linical I nvestigation 121 , 1130 1140. Myoung, J., and Ganem, D. (2011b). Generation of a doxycycline inducible KSHV producer cell line of endothelial origin: Maintenance of tight latency with efficient reactivation upon induction. J Virol Methods 174 , 12 21.

PAGE 95

95 Neipel, F., Albrecht, J. C., Ensser, A., Huang, Y.Q., Li, J.J., Friedman Kien, A.E., and Fleckenstein, B. (1997a). Human herpesvirus 8 encodes a homolo g of interleukin 6. Journal of V irology 71 , 839 842. Neipel, F., Albrecht, J.C., and Fleckenstein, B. (1997b). Cell homologous gen es in the Kaposi's sarcoma associated rhadinovirus human herpesvirus 8: determinants of its pathogenicity? Journal of V irology 71 , 4187 4192. O'Donnell, K.A., Wentzel, E.A., Zeller, K.I., Dang, C.V., and Mendell, J.T. (2005). c Myc regulated microRNAs modu late E2F1 expression. Nature 435 , 839 843. O'Hara, A.J., Chugh, P., Wang, L., Netto, E.M., Luz, E., Harrington, W.J., Dezube, B.J., Damania, B., and Dittmer, D.P. (2009). Pre micro RNA signatures delineate stages of endothelial cell transformation in Kapos i sarcoma. PLoS Pathog 5 , e1000389. Olive, V., Bennett, M.J., Walker, J.C., Ma, C., Jiang, I., Cordon Cardo, C., Li, Q.J., Lowe, S.W., Hannon, G.J., and He, L. (2009). miR 19 is a key oncogenic component of mir 17 92. Genes Dev 23 , 2839 2849. Olive, V., Ji ang, I., and He, L. (2010). mir 17 92, a cluster of miRNAs in the midst of the cancer network. The I nternational J ournal of Biochemistry & Cell B iology 42 , 1348 1354. Ota, A., Tagawa, H., Karnan, S., Tsuzuki, S., Karpas, A., Kira, S., Yoshida, Y., and Seto , M. (2004). Identification and characterization of a novel gene, C13orf25, as a target for 13q31 q32 amplification in malignant lymphoma. Cancer R esearch 64 , 3087 3095. Pfeffer, S., Sewer, A., Lagos Quintana, M., Sheridan, R., Sander, C., Grasser, F.A., v an Dyk, L.F., Ho, C.K., Shuman, S., Chien, M. , et al. (2005). Identification of microRNAs of the herpesvirus family. Nature M ethods 2 , 269 276. Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John, B., Enright, A.J., Marks, D., San der, C. , et al. (2004). Identification of virus encoded microRNAs. Science 304 , 734 736. Pfeiffer, R.M., Wheeler, W.A., Mbisa, G., Whitby, D., Goedert, J.J., de The, G., and Mbulaiteye, S.M. (2010). Geographic heterogeneity of prevalence of the human herpe svirus 8 in sub Saharan Africa: clues about etiology. Ann Epidemiol 20 , 958 963. Pillai, R.S., Bhattacharyya, S.N., and Filipowicz, W. (2007). Repression of protein synthesis by miRNAs: how many mechanisms? Trends Cell Biol 17 , 118 126. Piriou, E., Kimmel, R., Chelimo, K., Middeldorp, J.M., Odada, P.S., Ploutz Snyder, R., Moormann, A.M., and Rochford, R. (2009). Serological evidence for long term Epstein Barr virus reactivation in children living in a holoendemic malaria region of Kenya. J Med Virol 81 , 108 8 1093.

PAGE 96

96 Plaisance Bonstaff, K., and Renne, R. (2011). Viral miRNAs. Methods Mol Biol 721 , 43 66. Pozharskaya, V.P., Weakland, L.L., Zimring, J.C., Krug, L.T., Unger, E.R., Neisch, A., Joshi, H., Inoue, N., and Offermann, M.K. (2004). Short duration of elev ated vIRF 1 expression during lytic replication of human herpesvirus 8 limits its ability to block antiviral responses induced by alpha interfer on in BCBL 1 cells. Journal of V irology 78 , 6621 6635. Ptashne, M. (2011). Principles of a switch. Nat Chem Biol 7 , 484 487. Punj, V., Matta, H., Schamus, S., Tamewitz, A., Anyang, B., and Chaudhary, P.M. (2010). Kaposi's sarcoma associated herpesvirus encoded viral FLICE inhibitory protein (vFLIP) K13 suppresses CXCR4 expression by upregulating miR 146a. Oncogene 2 9 , 1835 1844. Radkov, S.A., Kellam, P., and Boshoff, C. (2000). The latent nuclear antigen of Kaposi sarcoma associated herpesvirus targets the retinoblastoma E2F pathway and with the oncogene Hras transforms primary rat cells. Nat Med 6 , 1121 1127. Reese, T.A., Wakeman, B.S., Choi, H.S., Hufford, M.M., Huang, S.C., Zhang, X., Buck, M.D., Jezewski, A., Kambal, A., Liu, C.Y. , et al. (2014a). Coinfection. Helminth infection reactivates latent gamma herpesvirus via cytokine competition at a viral promoter. Sci ence 345 , 573 577. Reese, T.A., Wakeman, B.S., Choi, H.S., Hufford, M.M., Huang, S.C., Zhang, X., Buck, M.D., Jezewski, A., Kambal, A., Liu, C.Y. , et al. (2014b). Helminth infection reactivates latent gamma herpesvirus via cytokine competition at a viral p romoter. Science 345 , 573 577. Renne, R., Lagunoff, M., Zhong, W., and Ganem, D. (1996). The size and conformation of Kaposi's sarcoma associated herpesvirus (human herpesvirus 8) DNA in infected cells and virions. Journal of V irology 70 , 8151 8154. Rosenk ilde, M.M., Kledal, T.N., Brauner Osborne, H., and Schwartz, T.W. (1999). Agonists and inverse agonists for the herpesvirus 8 encoded constitutively active seven transmembrane oncogene product , ORF 74. The Journal of Biological C hemistry 274 , 956 961. Russ o, J.J., Bohenzky, R.A., Chien, M.C., Chen, J., Yan, M., Maddalena, D., Parry, J.P., Peruzzi, D., Edelman, I.S., Chang, Y. , et al. (1996). Nucleotide sequence of the Kaposi sarcoma associated herpesvirus (HHV8). Proc Natl Acad Sci U S A 93 , 14862 14867. Sa dler, R., Wu, L., Forghani, B., Renne, R., Zhong, W., Herndier, B., and Ganem, D. (1999). A complex translational program generates multiple novel proteins from the latently expressed kaposin (K12) locus of Kaposi's sarcoma associated herpesvirus. Journal of V irology 73 , 5722 5730.

PAGE 97

97 Samols, M.A., Hu, J., Skalsky, R.L., and Renne, R. (2005). Cloning and identification of a microRNA cluster within the latency associated region of Kaposi's sarcoma as sociated herpesvirus. Journal of V irology 79 , 9301 9305. Samo ls, M.A.H., J.; Skalsky, R.L.; Maldonado, A.M.; Riva, A.; Lopez, M.C.; Baker, H.V.; and R. Renne (2007). Identification of cellular genes targeted by KSHV encoded microRNAs. PLoS Pathog. Sarek, G., Jarviluoma, A., and Ojala, P.M. (2006). KSHV viral cyclin inactivates p27KIP1 through Ser10 and Thr187 phosphorylation in proliferating primary effusion lymphomas. Blood 107 , 725 732. Schutte, M., da Costa, L.T., Hahn, S.A., Moskaluk, C., Hoque, A.T., Rozenblum, E., Weinstein, C.L., Bittner, M., Meltzer, P.S., Tr ent, J.M. , et al. (1995). Identification by representational difference analysis of a homozygous deletion in pancreatic carcinoma that lies within the BRCA2 region. Proc Natl Acad Sci U S A 92 , 5950 5954. Schwarz, D.S., Hutvagner, G., Du, T., Xu, Z., Aroni n, N., and Zamore, P.D. (2003). Asymmetry in the assembly of the RNAi enzyme complex. Cell 115 , 199 208. Selbach, M., Schwanhausser, B., Thierfelder, N., Fang, Z., Khanin, R., and Rajewsky, N. (2008). Widespread changes in protein synthesis induced by micr oRNAs. Nature 455 , 58 63. Seo, T., Park, J., Lee, D., Hwang, S.G., and Choe, J. (2001). Viral interferon regulatory factor 1 of Kaposi's sarcoma associated herpesvirus binds to p53 and represses p53 dependent transcrip tion and apoptosis. Journal of V irolog y 75 , 6193 6198. Seoane, J., Le, H.V., Shen, L., Anderson, S.A., and Massague, J. (2004). Integration of Smad and forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation. Cell 117 , 211 223. Siegel, P.M., and Massague, J. (20 03). Cytostatic and apoptotic actions of TGF beta in homeostasis and cancer. Nat Rev Cancer 3 , 807 821. Siegel, P.M., Shu, W., and Massague, J. (2003). Mad upregulation and Id2 repression accompany transforming growth factor (TGF) beta mediated epithelial cell grow th suppression. The Journal of Biological C hemistry 278 , 35444 35450. Simas, J.P., and Efstathiou, S. (1998). Murine gammaherpesvirus 68: a model for the study of gammaherpesvirus pathogenesis. Trends Microbiol 6 , 276 282. Skalsky, R.L., Samols, M .A., Plaisance, K.B., Boss, I.W., Riva, A., Lopez, M.C., Baker, H.V., and Renne, R. (2007). Kaposi's sarcoma associated herpesvirus encodes an ortholog of miR 155. Journal of V irology 81 , 12836 12845.

PAGE 98

98 Sodhi, A., Montaner, S., Patel, V., Zohar, M., Bais, C. , Mesri, E.A., and Gutkind, J.S. (2000). The Kaposi's sarcoma associated herpes virus G protein coupled receptor up regulates vascular endothelial growth factor expression and secretion through mitogen activated protein kinase and p38 pathways acting on hy poxia inducible factor 1alpha. Cancer R esearch 60 , 4873 4880. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals Hatem, D., Babinet, P., d'Agay, M.F., Clauvel, J.P., Raphael, M., Degos, L. , et al. (1995). Kaposi's sarcoma associated herpesvirus like DNA sequences in multicentric Castleman's disease. Blood 86 , 1276 1280. Staskus, K.A., Sun, R., Miller, G., Racz, P., Jaslowski, A., Metroka, C., Brett Smith, H., and Haase, A.T. (1999). Cellular tropism and viral interleukin 6 expression distinguish human herpesvirus 8 involvement in Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Journal of V irology 73 , 4181 4187. Staudt, M.R., Kanan, Y., Jeong, J.H., Papin, J.F., Hines Boykin, R., and Dittmer, D.P. (2004). The tum or microenvironment controls primary effusion lymphoma growth in vivo. Cancer R esearch 64 , 4790 4799. Stedman, W., Deng, Z., Lu, F., and Lieberman, P.M. (2004). ORC, MCM, and histone hyperacetylation at the Kaposi's sarcoma associated herpesvirus latent replication origin. Journal of V irology 78 , 12566 12575. Steed, A., Buch, T., Waisman, A., and Virgin, H .W.t. (2007). Gamma interferon blocks gammaherpesvirus reactivation from latency in a cell type specific manner. Journal of V irology 81 , 6134 6140. Sturzl, M., Gaus, D., Dirks, W.G., Ganem, D., and Jochmann, R. (2013). Kaposi's sarcoma derived cell line SL K is not of endothelial origin, but is a contaminant from a known renal carcinoma cell line. Int J Cancer 132 , 1954 1958. Sun, Q., Zachariah, S., and Chaudhary, P.M. (2003). The human herpes virus 8 encoded viral FLICE inhibitory protein induces cellular t ransformation via NF kappaB activation. The Journal of B iological C hemistry 278 , 52437 52445. Swanton, C., Mann, D.J., Fleckenstein, B., Neipel, F., Peters, G., and Jones, N. (1997). Herpes viral cyclin/Cdk6 complexes evade inhibition by CDK inhibitor prot eins. Nature 390 , 184 187. Sylvestre, Y., De Guire, V., Querido, E., Mukhopadhyay, U.K., Bourdeau, V., Major, F., Ferbeyre, G., and Chartrand, P. (2007). An E2F/miR 20a autoregulatory feedback loop. The Journal of B iological C hemistry 282 , 2135 2143.

PAGE 99

99 Tagaw a, H., and Seto, M. (2005). A microRNA cluster as a target of genomic amplification in malignant lymphoma. Leukemia 19 , 2013 2016. Takamizawa, J., Konishi, H., Yanagisawa, K., Tomida, S., Osada, H., Endoh, H., Harano, T., Yatabe, Y., Nagino, M., Nimura, Y . , et al. (2004). Reduced expression of the let 7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer R esearch 64 , 3753 3756. Tam, H.K., Zhang, Z.F., Jacobson, L.P., Margolick, J.B., Chmiel, J.S., Rinaldo, C., and Detels, R. (2002). Effect of highly active antiretroviral therapy on survival among HIV infected men with Kaposi sarcoma or non Hodgkin lymphoma. Int J Cancer 98 , 916 922. ten Dijke, P., and Arthur, H.M. (2007). Extracellular control of TGFbeta signalling in vascular development and disease. Nat Rev Mol Cell Biol 8 , 857 869. Tian, M., Neil, J.R., and Schiemann, W.P. (2011). Transforming growth factor beta and the hallmarks of cancer. Cell Signal 23 , 951 962. Tomlinson, C.C., and Damania, B. (2004). The K1 p rotein of Kaposi's sarcoma associated herpesvirus activates the Akt signaling pathway. Journal of V irology 78 , 1918 1927. Verma, S.C., Choudhuri, T., Kaul, R., and Robertson, E.S. (2006). Latency associated nuclear antigen (LANA) of Kaposi's sarcoma associ ated herpesvirus interacts with origin recognition complexes at the LANA binding sequence within the terminal repeats. Journal of V irology 80 , 2243 2256. Verschuren EW, K.J., Evan GI, Jones N. (2002). The oncogenic potential of Kaposi's sarcoma associated herpesvirus cyclin is exposed by p53 loss in vitro and in vivo. Cacer C ell 2 , 229 241. Verschuren, E.W., Klefstrom, J., Evan, G.I., and Jones, N. (2002). The oncogenic potential of Kaposi's sarcoma associated herpesvirus cyclin is exposed by p53 loss in vi tro and in vivo. Cancer Cell 2 , 229 241. Volinia, S., Calin, G.A., Liu, C.G., Ambs, S., Cimmino, A., Petrocca, F., Visone, R., Iorio, M., Roldo, C., Ferracin, M. , et al. (2006). A microRNA expression signature of human solid tumors defines cancer gene targ ets. Proc Natl Acad Sci U S A 103 , 2257 2261. Wakeham, K., Webb, E.L., Sebina, I., Muhangi, L., Miley, W., Johnson, W.T., Ndibazza, J., Elliott, A.M., Whitby, D., and Newton, R. (2011). Parasite infection is associated with Kaposi's sarcoma associated herp esvirus (KSHV ) in Ugandan women. Infectious A gents and C ancer 6 , 15.

PAGE 100

100 Wang, L., Wakisaka, N., Tomlinson, C.C., DeWire, S.M., Krall, S., Pagano, J.S., and Damania, B. (2004). The Kaposi's sarcoma associated herpesvirus (KSHV/HHV 8) K1 protein induces express ion of angiogenic and invasion factors. Cancer R esearch 64 , 2774 2781. Watanabe, T., Sugaya, M., Atkins, A.M., Aquilino, E.A., Yang, A., Borris, D.L., Brady, J., and Blauvelt, A. (2003). Kaposi's sarcoma associated herpesvirus latency associated nuclear an tigen prolongs the life span of primary human umbilical vein endothelial cells. Journal of V irology 77 , 6188 6196. Weisberg, R.A., Enquist, L.W., Foeller, C., and Landy, A. (1983). Role for DNA homology in site specific recombination. The isolation and cha racterization of a site affinity mutant of coliphage lambda. Journal of M olecular B iology 170 , 319 342. Wen, K.W., and Damania, B. (2010). Kaposi sarcoma associated herpesvirus (KSHV): molecular biology and oncogenesis. Cancer Lett 289 , 140 150. Whitby, D. , Marshall, V.A., Bagni, R.K., Miley, W.J., McCloud, T.G., Hines Boykin, R., Goedert, J.J., Conde, B.A., Nagashima, K., Mikovits, J. , et al. (2007). Reactivation of Kaposi's sarcoma associated herpesvirus by natural products from Kaposi's sarcoma endemic r egions. Int J Cancer 120 , 321 328. Woods, K., Thomson, J.M., and Hammond, S.M. (2007). Direct regulation of an oncogenic micro RNA cluster by E2F transcription factors. The Journal of B iological C hemistry 282 , 2130 2134. Wrana, J.L., Attisano, L., Wieser, R., Ventura, F., and Massague, J. (1994). Mechanism of activation of the TGF beta receptor. Nature 370 , 341 347. Ye, F., Lei, X., and Gao, S.J. (2011). Mechanisms of Kaposi's Sarcoma Associated Herpesvirus Latency and Reactivation. Adv Virol 2011 . Ye, F.C. , Zhou, F.C., Xie, J.P., Kang, T., Greene, W., Kuhne, K., Lei, X.F., Li, Q.H., and Gao, S.J. (2008). Kaposi's sarcoma associated herpesvirus latent gene vFLIP inhibits viral lytic replication through NF kappaB mediated suppression of the AP 1 pathway: a no vel mechanism of virus control of latency. Journal of V irology 82 , 4235 4249. Yin, Q., McBride, J., Fewell, C., Lacey, M., Wang, X., Lin, Z., Cameron, J., and Flemington, E.K. (2008). MicroRNA 155 is an Epstein Barr virus induced gene that modulates Epstei n Barr virus regulated gene expression pathways. Journal of V irology 82 , 5295 5306. Yoshizaki, K., Matsuda, T., Nishimoto, N., Kuritani, T., Taeho, L., Aozasa, K., Nakahata, T., Kawai, H., Tagoh, H., Komori, T. , et al. (1989). Pathogenic significance of interleukin 6 (IL 6/BSF 2) in Castleman's disease. Blood 74 , 1360 1367.

PAGE 101

101 Zhi, H., Zahoor, M.A., Shudofsky, A.M., and Giam, C.Z. (2014). KSHV vCyclin counters the senescence/G1 arrest response triggered by NF kappaB hypera ctivation. Oncogene. Zhu, J., Yamane, H., and Paul, W.E. (2010). Differentiation of effector CD4 T cell populations (*). Annu Rev Immunol 28 , 445 489. Zhu, Y., Haecker, I., Yang, Y., Gao, S. Herpesvirus encoded miRNAs and their roles in viral biology and pathogenesis. Curr Opin Virol 3 , 266 275. Ziegelbauer, J.M., Sullivan, C.S., and Ganem, D. (2009). Tandem array based expression screens identify host mRNA targets of virus encoded microRNAs. Nat Genet 41 , 130 134. Ziegler, J.L. (1993). Endemic Kaposi's sarcoma in Africa and local volcanic soils. Lancet 342 , 1348 1351.

PAGE 102

102 BIOGRAPHICAL SKETCH Hong Seok Choi was born i n Seoul, South Kore a in December 1978. After being educated at Myoungduk High School, he enrolled at Sogang University in Seoul, South Korea from March, 1997. In April 1999, he was temporarily absent for 2 years to volunteer and serve in Republic of Korea Marine Corp. He majored in Life Science and earned a Bachelor of Science degree in 2004. In the same year, h e started to pursue a Master of Science in Life Science at Sogang University. He joined Dr. laboratory and studied gene delivery mechanism of arginine poly peptide and DNA vaccine against Bacillus anthracis . He contributed to publishing th ree research papers (including one first author paper ). He also co laboratory in Department of Chemical and Biological Engineering at Sogang University. After he earned a Master of Science degree in February 2006, he worked at Division of AIDS and tumor virus, Korean National Institute of Health (KNIH). He analyzed the genes of HIV strains for patients to get appropriate therapeutic drugs and investigate the mutation in HIV strains to evolutionary change HIV nef gene , in ord er to contribute to development of HIV drugs. In December 2006, he applied to University of Florida for Doctoral degree, and moved to Gainesville in 2007 to start his Ph. D. program in Interdisciplinary Program (IDP) in College of Medicine. He joined Dr. Molecular Genetics and Microbiology and investigated viral genes regulating host miRNA expression to promote viral pathogenesis and tumorigenesis. He received his Ph. D. from the University of Florida in the fal l of 2014.