Citation
Mitofusin 2 Mediates Sirtuin 1 Induced Autophagy to Suppress Liver Ischemia/Reperfusion Injury

Material Information

Title:
Mitofusin 2 Mediates Sirtuin 1 Induced Autophagy to Suppress Liver Ischemia/Reperfusion Injury
Creator:
Biel, Thomas G
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (180 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Physiology and Pharmacology (IDP)
Committee Chair:
KIM,JAE SUNG
Committee Co-Chair:
BEHRNS,KEVIN E
Committee Members:
POWERS,SCOTTY K
KASAHARA,HIDEKO
DUNN,WILLIAM A,JR
Graduation Date:
12/19/2014

Subjects

Subjects / Keywords:
Acetylation ( jstor )
Cell death ( jstor )
Cytoprotection ( jstor )
Death ( jstor )
Hepatocytes ( jstor )
Ischemia ( jstor )
Liver ( jstor )
Mitochondria ( jstor )
Physical trauma ( jstor )
Reperfusion ( jstor )
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
autophagy -- hepatocytes -- ischemia -- liver -- mitofusin2 -- reperfusion -- resection -- sirtuin1
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Medical Sciences thesis, Ph.D.

Notes

Abstract:
Hepatic ischemia/reperfusion (I/R) injury causes organ damage that can lead to liver failure and mortality after resection and transplantation surgeries. Currently, there are no therapeutic approaches to circumvent liver I/R injury. Autophagy is a lysosomal dependent catabolic process that degrades long-lived proteins and dysfunctional organelles. Autophagy is an endogenous cytoprotective mechanism to suppress liver I/R injury. Sirtuin 1 (SIRT1) is a NAD+ dependent deacetylases that mediates autophagy, thus we investigate the role of SIRT1 during liver I/R injury. Human and mouse livers, and primary hepatocytes were subjected to I/R conditions to determine changes in SIRT1 expression. A dramatic reduction in SIRT1 was observed in both livers and hepatocytes subjected to I/R, which was partly dependent on both cathepsins and calpains. Modulation of SIRT1 using an adenovirus expressing SIRT1, or pharmacological activators, Resveratrol and SRT1720, suppressed liver I/R injury, while the loss of SIRT1 sensitized hepatocytes to I/R. Activation of SIRT1 enhanced autophagy before and after I/R, which was absent in SIRT1 deficient hepatocytes suggesting that SIRT1 induced autophagy suppresses liver I/R injury. To elude the mechanism of SIRT1 induced autophagy, we analyzed autophagy related protein expression, autophagy initiation signals, potential protein interactions and substrate acetylation status. Mitofusin 1 (MFN1) and Mitofusin 2 (MFN2) were identified as acetylated proteins that form a complex with SIRT1. Furthermore, overexpression SIRT1 led to MFN2 deacetylation. Next, we demonstrated that SIRT1 induced autophagy was impaired in MFN2 deficient hepatocytes prior to and after I/R. To validate the importance of MFN2 during I/R, livers and hepatocytes were subjected to I/R, which caused a significant reduction MFN2 in a manner partly dependent on cathepsins and calpains leading to hepatocyte death. Overexpression of SIRT1 suppressed the loss of MFN2 and enhanced autophagy flux during I/R, while MFN2 knockdown hepatocytes had an impaired autophagic flux and were hypersensitivity I/R. Collectively, these data suggest that MFN2 mediates SIRT1 induced autophagy to suppress liver I/R injury. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: KIM,JAE SUNG.
Local:
Co-adviser: BEHRNS,KEVIN E.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-06-30
Statement of Responsibility:
by Thomas G Biel.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
6/30/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text



PAGE 1

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 Jinping Zhang, 1 Sang-Myeong Lee, 1 Stephen Shannon, 2 Beixue Gao, 1 Weimin Chen, 1 An Chen, 1 Rohit Divekar, 3 Michael W. McBurney, 4 Helen Braley-Mullen, 3,5 Habib Zaghouani, 3,6,7 and Deyu Fang 1,3 1 Department of Otolaryngology — Head and Neck Surgery, 2 Department of Biological Sciences, 3 Department of Molecular Microbiology and Immunology, University of Missouri, Columbia, Missouri, USA. 4 Department of Cancer Therapeutics, Ottawa Health Research Institute, University of Ottawa, Ottawa, Ontario, Canada. 5 Department of Internal Medicine, 6 Department of Child Health, and 7 Center For Cellular and Molecular Immunology, University of Missouri, Columbia, Missouri, USA.Although many self-reactive T cells are eliminated by negative selection in the thymus, some of these cells escape into the periphery, where they must be controlled by additional mechanisms. However, the molecular mechanisms underlying peripheral T cell tolerance and its maintenance remain largely undefined. In this study, we report that sirtuin 1 (Sirt1), a type III histone deacetylase, negatively regulates T cell activation and plays a major role in clonal T cell anergy in mice. In vivo, we found that loss of Sirt1 function resulted in abnor mally increased T cell activation and a breakdown of CD4 + T cell tolerance. Conversely, upregulation of Sirt1 expression led to T cell anergy, in which the activity of the transcription factor AP-1 was substantially dimin ished. Furthermore, Sirt1 interacted with and deacetylated c-Jun, yielding an inactive AP-1 factor. In addi tion, Sirt1-deficient mice were unable to maintain T cell tolerance and developed severe experimental allergic encephalomyelitis as well as spontaneous autoimmunity. These findings provide insight into the molecular mechanisms of T cell activation and anergy, and we suggest that activators of Sirt1 may be useful as therapeutic agents for the treatment and/or prevention of autoimmune diseases. Many self-reactive T cells are eliminated by negative selection dur ing development in the thymus (central tolerance), but leaking of autoreactive T cells into the periphery can occur. One of the addi tional mechanisms to inactivate self-reactive T cells in the periph ery is clonal anergy (peripheral tolerance), which is induced by partial or suboptimal stimulation (1–3). A breakdown of periph eral tolerance is considered an important mechanism in autoim munity. Activation of T cells requires the cooperative interactions of several transcription factors, including AP-1, NFB, and NFAT. Among these transcription factors, AP-1 is selectively inhibited in peripheral T cell tolerance (4). However, the molecular mecha nisms by which AP-1 transcriptional activity is inhibited in toler ized autoreactive T cells remain largely unknown. Sirtuin 1 (Sirt1) is the human ortholog of the yeast Sir2 protein, which is the prototypic class III histone deacetylase (HDAC) (5). This protein contains one HDAC domain that has the deacetylation activity, one nuclear localization sequence, and a coiled-coil–like domain. Sirt1 is highly expressed in the heart, brain, and skeletal muscle and is expressed at very low levels in the kidney and lung (6). In vitro studies indicated that Sirt1 deacetylates a variety of proteins including histones H1, H3, and H4 and may mediate heterochroma tin formation (7). Several other proteins besides histones can serve as substrates for Sirt1 (8). Indeed, Sirt1 regulates the tumor suppressor proteins p53 and FOXO3 to suppress apoptosis and promote cell survival. Also, it plays a role in several biological processes includ ing stress resistance, metabolism, differentiation, and aging (5). Mice carrying 2 null alleles of the Sirt1 gene are significantly smaller than wild-type animals at birth and exhibit notable developmental defects of the retina and heart, and both sexes are sterile (9, 10). Sirt1 is expressed in all tissues but is abundant in the thymus, particularly in CD4 + CD8 + thymocytes, suggesting an involvement of Sirt1 in T cell development. CD4 + CD8 + thymocytes from Sirt1 –/– mice exhibit increased sensitivity to irradiation–induced apopto sis (10). Moreover, several studies suggest that Sirt1 may negatively regulate T cell activation. Indeed, treatment of T cells with resve ratrol, a Sirt1 activator, suppresses proliferation and cytokine pro duction in vitro (11). Resveratrol suppresses immune functions by inducing lymphocyte apoptosis (12, 13). Downregulation of APC functions is another possible mechanism for the immune-sup pressive functions of resveratrol (14). While the mechanisms of resveratrol action remain debatable, its interference with immune function is well established and provides a potential avenue for treatment of autoimmune diseases as well as allograft rejections. In the present study, we demonstrate that Sirt1 functions as an anergic factor in peripheral CD4 + T cell tolerance. Sirt1 –/– mice have elevated immune responses and fail to maintain periph eral tolerance to autoantigens, as exemplified by the presence of anti-nuclear antibodies, systemic lymphocyte infiltration, and increased susceptibility to experimental autoimmune encephalo myelitis (EAE). Sirt1 suppression of AP-1 transcriptional activity likely represents a central mechanism for control of T cell activa tion and induction of anergy. Indeed, we found that Sirt1 inhibits AP-1 transcriptional activity by deacetylating the AP-1 family tran scription factor c-Jun. This previously unrecognized observation Authorship note: Jinping Zhang and Sang-Myeong Lee contributed equally to this work. Conflict of interest: The authors have declared that no conflict of interest exists. Citation for this article: J. Clin. Invest. 119 :3048–3058 (2009). doi:10.1172/JCI38902.

PAGE 2

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 provides a molecular mechanism for modulation of T cell activa tion and manifestation of anergy. Sirt1 inhibits T cell activation . Sirt1 was highly expressed in lymphoid tissues including the thymus, bone marrow, lymph nodes, and spleen (Supplemental Figure 1; supplemental material available online with this article; doi:10.1172/JCI38902DS1). However, dis ruption of Sirt1 expression in mice appeared not to affect T cell development, because the cell surface expression of CD4 or CD8 in Sirt1 –/– thymocytes was comparable to that in heterozygous mice (Supplemental Figure 2A). Similarly, the percentage of CD4 + and CD8 + mature T cells did not change in peripheral lymphoid tissues such as the spleen. The ratios of B220 + B cells to CD3 + T cells in the spleens and lymph nodes were also comparable in Sirt1 +/– and Sirt1 –/– mice (Supplemental Figure 2A). After stimulation with anti-CD3 or anti-CD3 plus anti-CD28 antibodies, Sirt1 –/– T cells showed dramatically increased prolif eration and produced more IL-2 compared with Sirt1 +/– T cells (Figure 1, A–C), suggesting that Sirt1 suppresses T cell activation. Sirt1 appeared to inhibit IL-2 transcription without affecting Il2 mRNA stability in T cells because the Il2 mRNA level, but not its half-life, was increased in Sirt1 –/– T cells during activation (Figure 1D). The enhanced activation of Sirt1 –/– T cells was not due to preexisting activated T cells because the percentages of T cells bear ing the activation markers CD69, CD44, and CD25 were similar in heterozygous and mutant mice (Supplemental Figure 2B). Also, the enhanced activation was not due to a higher level of cell sur face TCR, as heterozygous and mutant mice displayed similar TCR expression (Supplemental Figure 2C). Thus, we determined that Sirt1 intrinsically inhibits T cell activation. Indeed, deletion of Sirt1 gene expression in vitro by tamoxifen treatment of CD4 + T cells from Sirt1 loxp/loxp ESR-Cre TG mice (Supplemental Methods) resulted in a dramatically increased CD4 + T cell proliferation (Supplemental Figure 3A), and ecotropic expression of Sirt1 inhibited both Sirt1 +/– and Sirt1 –/– T cell activation (Supplemental Figure 3B).

PAGE 3

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 It is likely that T cell hyperresponsiveness driven by Sirt1 defi ciency is due to signals downstream of the TCR. This hypothesis was drawn from the observation that upon stimulation with PMA plus ionomycin, Sirt1 –/– T cells exhibited a significant increase in proliferation and IL-2 production (Figure 1, A and B). Since PMA directly activates protein kinase (15) and ionomycin forms a lipidsoluble calcium complex to convey Ca 2+ across the hydrocarbon region of the cell membrane (16), Sirt1 likely targets signaling mol ecules or transcription factors downstream of the TCR. Further more, similar to Cbl-b –/– T cells (17), the Sirt1 –/– T cells exhibited a full-scale activation when stimulated with anti-CD3 antibody alone, whereas Sirt1 +/– T cells showed only minimal activation under the same stimulation conditions (Figure 1, A–C). These results suggest that TCR signaling without costimulation is suf ficient for activation of Sirt1 –/– T cells. Next, we analyzed the effect of Sirt1 on the production of both Th1 and Th2 cytokines by CD4 + T cells. When stimulated with anti-CD3 or anti-CD3 plus anti-CD28 in vitro, Sirt1 –/– CD4 + T cells produced more Th1 cytokine IFNand Th2 cytokine IL-5 than did Sirt1 +/– CD4 + T cells (Figure 1, E and F). The recall experi ments using lymphocytes from mice immunized with OVA indi cated substantial increases of both IFNand IL-5 production by Sirt1 –/– T cells compared with Sirt1 +/– T cells (Figure 2, C and D). These results suggest that Sirt1 inhibits the productions of both Th1 and Th2 cytokines by CD4 + T cells. Sirt1 suppresses T cell–dependent immunity in mice . To determine the effect of Sirt1 deficiency on T cell activation in vivo, 6to 8-weekold Sirt1 –/– mice and their heterozygous littermates were immu nized subcutaneously with chicken OVA protein emulsified in CFA, and their OVA-specific T cell responses were analyzed 7 days later. The results indicated that proliferation as well as IL-2 production by Sirt1 –/– T cells were dramatically increased compared with Sirt1 +/– T cells (Figure 2, A and B), suggesting that Sirt1 functions as a neg ative regulator of antigen-specific T cell activation in vivo. To determine the effects of Sirt1 on T cell–dependent humoral immune responses, OVA-specific antibodies were measured after the primary immunization with OVA plus CFA as well as after boosting with OVA plus incomplete Freund’s adjuvant (IFA). The results indicated that Sirt1 –/– mice had increased antigen-specific antibodies of both IgM and IgG isotypes in the primary and sec ondary responses, suggesting that Sirt1 deficiency sustained a more vigorous T cell–dependent humoral response (Figure 2, E and F). The elevated immune response of Sirt1 –/– T cells was not the consequence of altered APC function in Sirt1 –/– mice, because the proliferation of Sirt1 –/– T cells showed comparable levels when they were stimulated with Sirt1 +/– or Sirt1 –/– APCs (Supplemental Fig ure 4A). In addition, expression of costimulatory molecules such as CD80 and CD86 on APCs was not affected by Sirt1 deficiency (Supplemental Figure 4B). Overall, these findings suggest that Sirt1 is a negative regulator of T cell activation. Sirt1 is required for peripheral CD4 + T cell tolerance . TCR ligation in the absence of costimulation gives rise to a state of long-term func tional unresponsiveness known as anergy (1). Similar to Cbl-b –/– T cells (17), Sirt1 –/– T cells were fully activated when they were stim ulated with anti-CD3 alone without any costimulations (Figure 1, A–C). This suggests that loss of Sirt1 function overrides costimula tion, leading to breakdown of peripheral T cell tolerance. To test whether loss of Sirt1 leads to a breakdown of tolerance in vivo, we bred the Sirt1 +/– mice with OT-II TCR transgenic mice (18) and gen erated OT-II TCR Sirt1 +/– and OT-II TCR Sirt1 –/– mice. The animals (with 90% or higher TCR V chain expression) were then given OVA 323–339 peptide in PBS intravenously, and their splenic T cells were tested for antigen-induced proliferation and IL-2 production. The results showed that while Sirt1 +/– OT-II T cells were unrespon sive, the Sirt1 –/– OT-II cells had significant proliferative responses and increased IL-2 production (Figure 3, A and B, and Supple mental Figure 5, A and B). Similar results were obtained when purified CD4 + T cells from OVA 323–339 peptide–treated mice were cocultured with APC and OVA peptide (Supplemental Figure 6). Therefore, we concluded that Sirt1 deficiency causes a breakdown of CD4 + T-cell tolerance in vivo. Using an in vitro T cell anergy induction assay (19) we show that ionomycin treatment failed to induce anergy of Sirt1 –/– T cells. In contrast, proliferation and IL-2 production of Sirt1 +/– T cells

PAGE 4

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 were inhibited by ionomycin treatment, and this was reversible by adding exogenous IL-2 (Figure 3E and Supplemental Figure 5C). Ecotropic expression of Sirt1, as described in the Supplemental Methods, inhibited the activation and restored the anergic induc tion of Sirt1 –/– CD4 + T cells (Supplemental Figures 3B and 7A). In addition, in vitro deletion of Sirt1 from CD4 + T cells using an inducible Cre expression system resulted in the breakdown of T cell tolerance (Supplemental Figure 7B). Therefore, Sirt1 appears to regulate tolerance independent of its function in T cell devel opment. The resistance of Sirt1 –/– CD4 + T cells to tolerance was probably not the result of decreased cell death because annexin V staining revealed comparable percentages of apoptotic cells among Sirt1 +/– and Sirt1 –/– CD4 + T cells (Supplemental Figure 8). Together, these results indicate that Sirt1 is required for CD4 + T cell tolerance in vitro. To further assess the role Sirt1 deficiency plays in the breakdown of T cell tolerance, CD4 + T cells were isolated from Sirt1 –/– and Sirt1 +/– OT-II mice and adoptively transferred into T cell–null mice, and CD4 + T cell tolerance was analyzed. As shown in Figure 3, C and D, injection of OVA 323–339 peptide into the host mice inhib ited Sirt1 +/– but not Sirt1 –/– OT-II T cell activation. To determine whether this breakdown of Sirt1 –/– CD4 + T cell tolerance was due to increased homeostatic proliferation in the lymphopenic host, we adoptively transferred CFSE-labeled CD4 + T cells into T cell–null mice and analyzed cell division. The findings indi cate that homeostatic proliferation of Sirt1 +/– and Sirt1 –/– CD4 + T cells in the hosts was indistinguishable 7 days after transfer (Supplemental Figure 9). Increased Sirt1 expression in anergic CD4 + T cells . The fact that CD4 + T cells of Sirt1 –/– mice were unable to be tolerized suggests that Sirt1 could function as an anergic factor in T cells. Recent studies suggest that anergy induction requires upregulation of the expression of inhibitory proteins such as the E3 ligase Cbl-b (20). We therefore determined whether expression of Sirt1 changes in anergic T cells. Real-time PCR analysis revealed that expression of Sirt1 mRNA was increased 4to 5-fold in aner gic versus naive T cells but increased only slightly in activated T cells (Figure 3F). Western blotting analysis also showed a similar increase at the protein level (Figure 3G). Thus, Sirt1 is upregulated in anergic T cells. In support of this is the finding that TCR stimulation alone, which presumably induces tolerance in vivo, is sufficient for Sirt1 upregulation (data not shown). Previous studies have identified several genes that are upregulated in anergic CD4 + T cells when there is NFAT but not AP-1 transcriptional activation (20–27). We therefore determined whether Sirt1, as a HDAC, induces and/or maintains CD4 + T cell tolerance by altering the expression of these anergic genes. Realtime PCR analysis indicated that the expression levels of Cbl-b, DGK-a, EGR2, and EGR3 were comparable between Sirt1 +/– and Sirt1 –/– CD4 + T cells even when treated with ionomycin. Interest ingly, the transcription of Grail and IKAROS-1 in Sirt1 –/– T cells was reduced, suggesting a functional linkage of Sirt1 with Grail and IKAROS-1 in anergic T cells (Supplemental Figure 10). Sirt1 inhibits AP-1 transcriptional activity in T cells . The transcrip tion factor AP-1, usually made of c-Jun homodimers or c-Jun/Fos heterodimers, has been identified as a molecular target in T cell clonal anergy (4). However, the underlying molecular mechanism remains largely unknown. Sirt1 is a nuclear protein and has been found to suppress the transcriptional activity of several transcrip tion factors, such as p53. We thus asked whether Sirt1 induces anergy by suppressing AP-1 transcriptional activity in T cells.

PAGE 5

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 Indeed, using a luciferase AP-1 reporter system we demonstrated that overexpression of Sirt1 inhibited AP-1 transcriptional activ ity in a dose-dependent manner (Figure 4A). This suggests that Sirt1 can function as a suppressor of AP-1 transcription factor. To determine whether Sirt1 inhibits AP-1 transcriptional activity in primary T cells, we bred Sirt1 +/– mice with AP-1 luciferase transgen ic (AP-1luc TG ) mice (28) and used this specific reporter to evalu ate the effect of Sirt1 –/– on AP-1 transcriptional activity. As shown in Figure 4B, after stimulation with anti-CD3 or anti-CD3 plus anti-CD28 for 24 hours, AP-1 luciferase activities were increased in Sirt1 –/– AP-1luc TG T cells compared with Sirt1 +/– AP-1 TG cells. Also, gel shift experiments demonstrated a significant increase of AP-1 promoter DNA-binding activity in Sirt1 –/– T cells after TCR/CD28 stimulation (Figure 4C). This increased AP-1 transcriptional acti vation does not appear to result from the elevated activation of the upstream MAPK pathway because both JNK and Erk activation were indistin guishable between Sirt1 +/– and Sirt1 –/– T cells (Supplemental Figure 11). These results indicate that Sirt1 functions as a suppressor of AP-1 in T cells. Sirt1 inhibits c-Jun acetylation to sustain T cell anergy . Since Sirt1 functions as a deacetylase and c-Jun requires acetyla tion for its activity, it is possible that Sirt1 operates T cell anergy by suppress ing c-Jun acetylation. To test this prem ise, c-Jun acetylation was compared in activated versus anergic T cells. Indeed, c-Jun was highly acetylated in activated CD4 + T cells, while its acetylation was diminished in anergic T cells (in which anergy was induced either in vitro [Figure 5A] or in mice [Figure 5B]) to levels comparable to those of naive T cells. These results provide a direct link between the regulation of c-Jun acetylation and T cell anergy. The fact that Sirt1 expression is upregulated in anergic T cells implies that Sirt1 may be responsible for impaired c-Jun acetyla tion. If this hypothesis were correct, increased c-Jun acetylation would be observed in Sirt1 –/– compared with Sirt1 +/– CD4 + T cells. Indeed, acetylation of c-Jun was detected in Sirt1 +/– T cells under stimulation with anti-CD3 plus anti-CD28 but not with anti-CD3 alone. In contrast, c-Jun acetylation was increased in Sirt1 –/– T cells (Figure 5C). These results indicate that Sirt1 inhibits T cell acti vation by suppressing c-Jun acetylation. In particular, anti-CD3 stimulation is sufficient to induce c-Jun acetylation in Sirt1 –/– T cells, indicating that TCR-mediated c-Jun acetylation is inhib ited by Sirt1 (Figure 5C). To support this conclusion, we further demonstrated that expression of Sirt1 in T cells inhibited c-Jun acetylation (Figure 5D). TCR stimulation alone usually induces

PAGE 6

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 T cell tolerance, which is a state of anergy. Given the observation that Sirt1 expression is upregulated in anergic T cells and that the lack of Sirt1 function causes breakdown of T cell tolerance, these results suggest that Sirt1 maintains T cell tolerance by suppressing c-Jun acetylation. In support of this statement is the observation that overexpression of Sirt1 inhibited c-Jun acetylation in tran siently transfected HEK-293 cells (Figure 5E). Sirt1 interacts with c-Jun independently of JNK . To gain further insight into the interaction of Sirt1 with c-Jun in mouse primary T cells, we analyzed the binding of Sirt1 with c-Jun by coimmu noprecipitation. HEK-293 cells were transfected with Flag-tagged Sirt1 plasmid and/or c-Jun, and anti-flag immunoprecipitation was performed. The findings indicate that c-Jun protein was detect ed in anti-Flag immunoprecipitates when the cells were transfected with Sirt1 and c-Jun but not in cells transfected with c-Jun alone (Figure 6, A and B). This suggests that Sirt1 interacts with c-Jun. Furthermore, when mouse primary T cells were stimulated with anti-CD3 plus anti-CD28, Sirt1/c-Jun interaction was detectable (Figure 6C). However, Sirt1/c-Jun interaction could not be detected in naive unstimulated T cells. Consistent with this finding, colo calization of Sirt1 with c-Jun in the nuclei was observed in the activated but not naive T cells (Supplemental Figure 13). These results indicate that Sirt1 interacts with c-Jun both in transiently transfected HEK-293 cells and in mouse primary T cells. More interestingly, a constitutive and significantly increased interaction of Sirt1 with c-Jun was detected in anergic T cells (Figure 6D), indi cating that Sirt1 constitutively suppresses AP-1 transcription to maintain CD4 + T cell tolerance. To support this, immunostaining experiments revealed a brighter Sirt1 expression in anergic T cells (Supplemental Methods), and Sirt1 was well colocalized with c-Jun in the nuclei (Supplemental Figure 14). We determined that the C terminus of Sirt1 was responsible for its interaction with c-Jun because deletion of the C terminus completely abolished Sirt1/ c-Jun interaction as well as its ability to inhibit c-Jun acetylation, Clinical observation of immunized Sirt1 –/– and Sirt1 +/– miceMouse Incidence of EAE Clinical score Mean maximal disease severity A Day of disease onset Day of recovery Sirt1 +/– 55% (11 of 20) 9 5 3 3 1.12 1.17 12.7 0.97 35 Sirt1 –/– 87.5% (14 of 16) 2 1 6 7 2.43 1.06 10.5 1.16 53

PAGE 7

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 while deletion of the N terminus did not affect their interaction (Figure 6, A, E, and F), and the C terminus alone was sufficient for its interaction with c-Jun (data not shown). Since activation signals of T cells provided by TCR/CD28 pro mote c-Jun phosphorylation by JNK (29, 30), we then tested whether this phosphorylation event was responsible for c-Jun interac tion with Sirt1. Treatment of cells with a JNK-specific inhibitor, SP600125, which dramatically inhibited c-Jun phosphorylation, did not affect Sirt1/c-Jun interaction (Supplemental Figure 12A). In addition, deletion of the JNK-docking site or the domain of c-Jun, or mutation of the predominant phosphorylation serine and threonine within c-Jun, did not affect its interaction with Sirt1 (Supplemental Figure 12B). Immunostaining experiments revealed that c-Jun is mainly distributed in the cytoplasm of naive T cells and that TCR/CD28 stimulation relocated c-Jun into the nucleus (Supplemental Figure 13). In contrast, Sirt1 remained in both cytoplasm and nucleus in naive unstimulated T cells. There fore, TCR/CD28 stimulation might enhance c-Jun/Sirt1 interac tion by promoting c-Jun nuclear translocation. Interestingly, con sistent with our finding of increased Sirt1 expression in anergic T cells, a brighter Sirt1 staining that was well colocalized with c-Jun was observed in anergic T cells (Supplemental Figure 14). Based on these findings, we conclude that Sirt1 is a deacetylase of c-Jun, and Sirt1-mediated deacetylation of c-Jun inhibits AP-1 transcriptional activation. Sirt1 deficiency results in autoimmunity in mice . Breakdown of selftolerance in CD4 + T cells plays a major role in the development of EAE in mice as well as MS in humans (31). To further investi gate the role of Sirt1 in T cell tolerance, Sirt1 –/– and Sirt1 +/– mice were immunized with myelin oligodendrocyte glycoprotein 35–55 (MOG 35–55 ) peptide to induce EAE and the animals were moni tored for signs of paralysis. The findings indicated that Sirt1 –/– mice were more susceptible to EAE, as 87.5% (14 of 16) manifested clinical signs of disease after immunization (Table 1). In contrast, 55% (11 of 20) of the Sirt1 +/– mice showed signs of EAE. In addi tion, the onset of EAE in the Sirt1 –/– mice was 2 days earlier relative to the onset in Sirt1 +/– mice, and the average clinical score was sig nificantly higher than in control mice ( P < 0.005) (Figure 7A and Table 1). Histological analysis of the spinal cord sections revealed more lymphocyte infiltration in Sirt1 –/– mice (Figure 7B). Most of the infiltrating cells were T cells, as confirmed by immunostaining (Figure 7C). Thus, we concluded that Sirt1 deficiency promotes susceptibility to EAE. Next, we determined whether Sirt1-deficient CD4 + T cells are able to transfer EAE to normal animals. Sirt1 +/– and Sirt1 –/– mice were immunized with MOG peptide in CFA. CD4 + T cells were isolated

PAGE 8

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 and adoptively transferred into T cell–deficient mice. As shown in Figure 7D, mice recipients of Sirt1 –/– CD4 + T cells showed signs of EAE as early as 5 days after transfer. In contrast, disease development in mice that received Sirt1 +/– T cells was delayed by 3–4 days. In addi tion, a significantly increased average clinical score was observed in recipients of Sirt1 –/– versus Sirt1 +/– T cells. Furthermore, experiments using naive Sirt1 +/– and Sirt1 –/– T cells for the adoptive transfer dem onstrated that the clinical severity of EAE was also increased in mice that received Sirt1 –/– T cells (Figure 7E). Therefore, increased T cell activation and breakdown of T cell tolerance appear to be critical for the development of autoimmunity in Sirt1 –/– mice. We then asked whether aging Sirt1 –/– mice (11 months old or older) develop spontaneous autoimmune responses (Supple mental Methods). Sera from Sirt1 –/– mice had higher amounts of anti-nuclear antibodies than did sera from Sirt1 +/– (Supplemental Figure 15A). This was supported by the stronger fluorescence in the nuclei of NIH3T3 cells when the staining was made with the sera from Sirt1 –/– versus Sirt1 +/– mice (Supplemental Figure 15B), which is similar to findings from a recent study of Sirt1 –/– mice on a mixed genetic background (32). Next, we tested whether selfreactive antibodies deposit in the kidney glomerules. Kidney tis sue sections were prepared, frozen with OCT, fixed, saturated with normal goat IgM and IgG, and stained with fluorescence-labeled goat anti-mouse IgM or IgG. As shown in Supplemental Figure 17C, deposition of both IgM and IgG was evident in the kidney glomerules of Sirt1 –/– mice, while only background staining was observed in kidney sections of Sirt1 +/– mice. Lymphocyte infiltra tion was observed in the liver, lung, and kidney of all 5 Sirt1 –/– mice examined. In contrast, no obvious lymphocyte infiltration was observed in tissues from any Sirt1 +/– mice (Supplemental Figure 15D). These results indicate that Sirt1 deficiency results in the development of an autoimmune syndrome in mice. The CD4 + CD25 + FoxP3 + Tregs that suppress autoreactive T cells are critical for autoimmune suppression (33, 34), and in some instances TGFis essential for Treg function (35). Interestingly, Sirt1 has been shown to destabilize Smad7, a suppressive tran scription factor in the TGFpathway (36). Smad7 expression strongly affects in vitro Treg differentiation induced by TGF(37, 38). Therefore, loss of Sirt1 function might impair the devel opment and/or function of Tregs and consequently contribute to the autoimmune phenotype in Sirt1 –/– mice. To test this hypoth esis, we compared the percentages of Tregs between Sirt1 +/– and Sirt1 –/– mice. The percentages of CD4 + FoxP3 + populations, as well as their suppressive functions, were indistinguishable between the 2 strains (Supplemental Figure 16, A and B), indicating that Sirt1 deficiency does not affect Treg development and function. An alternative for Sirt1 –/– involvement in autoimmunity may be increased Th17 differentiation. To test this premise, we com pared the percentages of IL-17 + populations between heterozygous and Sirt1 –/– CD4 + T cells upon polarization with TGFand IL-6 (39). CD4 + T cells were purified from Sirt1 +/– and Sirt1 –/– mice and cultured with anti-CD3, anti-CD28, TGF, and IL-6 for 5 days. The production of IL-17 and IFNwas detected by intracellular staining with anti–IL-17–PE and anti–IFN–FITC, respectively. As shown in Supplemental Figure 18C, the percentages of IL-17 + cells were indistinguishable between Sirt1 +/– and Sirt1 –/– T cells, indicat ing that loss of Sirt1 function does not affect Th17 polarization in vitro. Collectively, our findings suggest that breakdown of CD4 + T cell tolerance due to the lack of Sirt1 functions is related to uncontrolled activation of autoreactive T cells. The findings presented in this report suggest that anergic signals induce upregulation of Sirt1 expression, which suppresses AP-1 transcriptional activity, leading to inhibition of T cell activation and maintenance of peripheral T cell tolerance. A lack of Sirt1 causes a breakdown of peripheral tolerance, and Sirt1 –/– mice are more susceptible to autoimmune diseases. Autoreactive T cells are generally eliminated by negative selec tion during thymic development (central tolerance). Self-reactive thymic escapees remain harmless due to the lack of costimulation when they detect antigen, a phenomenon known as peripheral tolerance (1–3). Although the molecular mechanisms underlying peripheral tolerance remain largely unknown, progress has been made that sheds light on how TCR stimulation without CD28 signaling induces unresponsiveness of autoimmune T cells (1, 2). This imbalanced stimulation of autoreactive T cells activates the transcription factor NFAT, possibly together with other unknown transcription factors, for the transcription of genes to induce and maintain peripheral T cell tolerance (19, 40). Recent stud ies reported that anergy induction is a process that upregulates expression of a cascade of inhibitory proteins including the E3 ubiquitin ligases Cbl-b, Itch, and Grail (20, 41). These upregulated E3 ubiquitin ligases selectively target T cell activators for ubiqui tination-mediated degradation and/or functional suppression. Our study here defines what we believe is a new anergic gene, Sirt1 , for peripheral T cell tolerance, because TCR-mediated signaling alone was sufficient for its transcription and Sirt1 suppressed T cell responses to TCR/CD28 stimuli. One interesting observation was that Sirt1 transcription was significantly higher in T cells with TCR stimulation alone than with both TCR and CD28 together, suggesting that CD28 stimulation may suppress Sirt1 expression to allow T cells to be activated. This CD28-mediated Sirt1 down regulation seems to depend on TCR signaling, because Sirt1 was not transcribed when naive T cells were stimulated with anti-CD28 in the absence of TCR stimulation (data not shown). Thus, it is likely that binding of the MHC/peptide complex to TCRs with out costimulation induces Sirt1 expression and the consequent T cell anergy, while ligation of the TCR and CD28 costimulatory molecule leads to downregulation of Sirt1, allowing for T cell acti vation. How the CD28-mediated signal blocks Sirt1 transcription remains to be defined. One signature of Sirt1 –/– T cells was that full-scale activation did not require costimulation, suggesting that a “short-cut” signal transduction pathway that links TCR to CD28 elements is put in place by the lack of Sirt1. This short-cut pathway likely plays a major role in the breakdown of T cell tolerance. Similar results have been observed in Cbl-b –/– T cells showing a vigorous T cell activation independent of CD28 stimulation (17). However, in Sirt1 –/– T cells, unlike Cbl-b –/– T cells, CD28 stimulation further enhances activation, suggesting that Sirt1 inhibits the signal transduction mediated by both TCR and CD28 in T cells. Signal transduction was inhibited at multiple stages when anergic T cells were stimulated by self-antigen and costimulators. For instance, altered expression of Fyn and Lck protein tyrosine kinases and altered patterns of early tyrosine phosphorylation have been cor related with deficient IL-2 production in anergic T cells (42–47). Initial interpretations suggested that the defect in IL-2 production of anergic T cells emanates from translational regulation because stimulation of anergic cells failed to induce Il2 mRNA (48). A mile stone in the understanding of how IL-2 transcription is silenced in

PAGE 9

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 anergic T cells transpired from the finding that anergic T cells dis play selective inhibition of AP-1 transcriptional activity (4). This is consistent with our recent report showing that AP-1 is a molecular target for FoxP3 to maintain the unresponsiveness of Tregs (49). AP-1 transcriptional activation, which is crucial for IL-2 transcrip tion, is triggered by both TCR and CD28 stimulation in T cells (50, 51). When self-reactive T cells see antigen in the absence of CD28 stimulation, Sirt1 expression is upregulated, which inhib its the TCR-mediated AP-1 transcriptional activity. However, costimulation through CD28 counters Sirt1 activity, leading to T cell activation. The study in this report elucidates the mecha nism underlying AP-1 inhibition and indicates that Sirt1-medi ated c-Jun acetylation leads to AP-1 inhibition in anergic T cells. Acetylation and deacetylation of transcription factors represent critical processes that dynamically regulate gene transcription (52). In the case of c-Jun, a recent study found that acetylation at lysines 268, 271, and 273 is required for c-Jun transcriptional activation, and mutations of these 3 lysines to arginine completely abolished c-Jun transcriptional activity (53). The finding that c-Jun acetyla tion is diminished in anergic T cells indicates that AP-1 transcrip tional activity is suppressed by c-Jun deacetylation. Sirt1 is solely responsible for the suppression of c-Jun acetylation during induc tion of T cell anergy because the lack of Sirt1 resulted in hyper acetylation of c-Jun and the breakdown of T cell tolerance. Also, it should be noted that TCR stimulation alone could not induce c-Jun acetylation in naive CD4 + T cells, possibly because TCRmediated signaling upregulates Sirt1 transcription. Indeed, when Sirt1 –/– T cells were stimulated with anti-CD3 antibody alone, c-Jun acetylation was highly detected. Given that TCR stimulation in the absence of costimulation induces T cell tolerance (2), the finding of Sirt1-mediated AP-1 deacetylation defines what we believe is a novel molecular mechanism underlying T cell tolerance. Recent studies have found that Sirt1 interacts with AP-1 in fibro blasts and epithelial cells (54, 55). We demonstrate here that Sirt1 interacts with c-Jun to form a protein complex that catalyzes c-Jun deacetylation in anergic T cells. Protein-protein interactions are specifically regulated by extracellular stimuli. Indeed, Sirt1/c-Jun interaction requires TCR/CD28 stimulation because their inter action is not detectable in naive T cells. It is surprising that Sirt1 interacts with c-Jun independent of JNK activation, because treat ment with a JNK-specific inhibitor or mutation of the phosphory lation sites within c-Jun did not affect the interaction, suggesting that TCR/CD28 signaling regulates Sirt1/c-Jun interaction by other mechanisms, which is interesting to further characterize. Therefore, TCR/CD28 signaling regulates T cell activation and tol erance not only by altering Sirt1 transcription but also by control ling its access to substrate proteins such as c-Jun. Our laboratory is currently investigating the precise mechanisms underlying the regulation of Sirt1/c-Jun interaction by activation and/or anergic signals in T cells. Overall, the findings that Sirt1 inhibits T cell activation and is required for T cell tolerance imply that activators of Sirt1 might be useful as therapeutic reagents for the treatment/prevention of autoimmune diseases such as MS, rheumatoid arthritis, and type 1 diabetes. Indeed, a Chinese herbal medicine, Huzhang ( polygonum cuspidatum ), which is one of the richest known sources of Sirt1 activator, resveratrol, has been widely used for the treatment of autoimmune diseases, particularly rheumatoid arthritis, in China. Resveratrol has been found to attenuate EAE development by sup pressing T cell activation in mice (56). Also, Sirt1 activators have been successfully used for treatment of type 2 diabetes (57). Finally, the findings that Sirt1 inhibits T cell activation and is required for T cell tolerance suggest that a Sirt1 activator may help in the treat ment of both autoimmune diseases and type 2 diabetes. Mice . Sirt1 +/– mice (9) were backcrossed for 5 or 6 generations onto the C57BL/6 genetic background. Consistent with previous reports (10, 58), further backcrossing reduced the survival of Sirt1 –/– mice. OT-II transgenic mice on the C57BL/6 background (DO11.10 TCR transgenic mice) were purchased from The Jackson Laboratory. Some Sirt1 +/– mice were bred with OT-II transgenic mice to generate Sirt1 +/– OTII and Sirt1 –/– OTII mice. AP-1 luciferase transgenic mice were purchased from The Jackson Laboratory and bred with Sirt1 +/– animals. T cell–null mice (both and ) (59) were purchased from the Jackson Laboratory. All mice used in this study were maintained and used at the University of Missouri mouse facility under pathogen-free conditions according to institutional guidelines. All animal study protocols were approved by the University of Missouri Institutional Animal Care and Use Committee. T cell proliferation and cytokine production . In vitro T cell proliferation and stimulation were performed as previously described (60). Briefly, purified CD4 + T cells were cultured with or without anti-CD3 or anti-CD3 plus anti-CD28 for 3 days. Cells treated with PMA (20 ng/ml) plus ionomycin (0.5 M) were used for control experiments. For proliferation analysis, cells were chased with 3 H-thymidine (0.5 Ci/well) for 16 hours, and 3 H-thymi dine incorporation was measured. For cytokine production, supernatants of stimulated cells were collected, and concentrations of IL-2, IFN, IL-4, and IL-5 were analyzed by ELISA. Animal immunization and analysis of T cell–mediated immune responses . Sirt1 +/– and Sirt1 –/– mice (8 weeks old) were immunized subcutaneously at the base of the tail with OVA protein (200 g/mouse) emulsified in 100 l CFA (Sigma-Aldrich). Total cells from draining lymph nodes were iso lated 7 days later and cultured with different doses of OVA protein. For the proliferation assay, cells were cultured for 3 days and then chased with 3 H-thymidine (0.5 Ci/well) for additional 16 hours, and 3 H-thymidine incorporation was analyzed. For T cell–mediated humoral immune responses, mice were immunized with OVA/CFA and boosted with OVA/IFA 10 days after the first immuniza tion. Sera were collected 4 days after the first immunization and 5 days after the second immunization. The concentrations of OVA-specific immuno globulins including IgG1, IgG2a, IgG3, and IgM were measured by ELISA. Induction of T cell anergy in mice and in vitro . For in vivo CD4 T cell anergy induction, Sirt1 +/– OTII or Sirt1 –/– OTII mice were treated with a single dose of OVA 323–339 peptide (200 g in 100 l PBS per mouse) by intravenous injection. Mice injected with 100 l of PBS were used as controls. Ten days after tolerization, total cells from draining lymph nodes were isolated and cultured with different amounts of OVA 323 peptide. CD4 + T cell prolif eration to OVA 323–339 peptide was analyzed by 3 H-thymidine incorporation. The in vitro CD4 + T cell anergy induction was performed as previously described (19). Briefly, CD4 + cells were purified using anti-CD4–coated magnetic beads (Miltenyi Biotec) and then stimulated with plate-bound anti-CD3 and anti-CD28 (0.5 g/ml) in the presence of IL-12 (10 ng/ml) and anti–IL-4 (10 g/ml). IL-2 (10 U/ml) was added at days 3 and 7, respec tively. Cells were washed with PBS and treated with 0.5 mM ionomycin for 16 hours. Cells were subsequently washed with PBS 3 times, rested for 2–4 hours, and restimulated with plate-bound anti-CD3 plus anti-CD28 or IL-2 to evaluate proliferation. Anti-nuclear antibody analysis . Sera from Sirt1 +/– and Sirt1 –/– mice were collected. Anti-nuclear antibody (ANA) concentrations were measured by ELISA using a commercial kit (Alpha Diagnostic International Inc.). To

PAGE 10

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 confirm the presence of ANA, pre-fixed NIH3T3 cells were stained with diluted (1:100) sera from these mice, followed by immunostaining with Alexa Fluor 488–conjugated anti-mouse Ig antibody. Cells were visualized under a fluorescence microscope. Induction and clinical assessment of EAE . EAE was induced as previously reported (61). Sixto 8-week-old Sirt1 +/– and Sirt1 –/– mice were immunized with MOG peptide (amino acid 35–55, MEVGWYRSPFSRVVHLYRNGK) emulsified with CFA (200 g per mouse). Mice were also given pertussis toxin (200 ng per mouse) on day 0 and day 2 via tail vein injection. All mice were weighed and examined for clinical symptoms and assigned scores on a scale of 0–5 as follows: 0, no overt signs of disease; 1, limp tail; 2, limp tail and partial hindlimb paralysis; 3, complete hindlimb paralysis; 4, complete hindlimb and partial forelimb paralysis; 5, moribund state or death. Some mice were euthanized at day 17 to 18, and brains and spinal cords were col lected for histological analysis. Dual luciferase assay . HEK-293 cells in 12-well plates were transfected with pRL-TK (Promega) and pAP-1 luciferase plasmids, along with vari ous expression plasmids, using the Lipofectamine transfection reagent (Invitrogen). The pRL-TK plasmid contains the Renilla reniformis (sea pansy) luciferase gene under the transcriptional control of the herpes virus thymidine kinase promoter and constitutively expresses low levels of renil lar luciferase. Therefore, it can be used as a control. Transfected cells were lysed, and the luciferase activity in cell lysates was analyzed using a Dual Luciferase Reporter assay kit (Promega). Luciferase activity was measured as relative light units using a luminometer (Turner BioSystems Inc.). Immunoprecipitation and Western blotting . Transiently transfected HEK-293 and mouse primary T cells were washed with ice-cold PBS, resuspended NP-40 lysis buffer with protease inhibitor, and incubated on ice for 15 minutes. Insoluble fractions were removed by centrifugation (15,000 g for 15 minutes). Supernatants were pre-cleaned with protein G–Sepharose at 4C for 15 minutes and then incubated with antibody (1 g/ml) for 1 hour, followed by incubation with protein G–Sepharose beads for additional 2 hours. The protein G–Sepharose beads were washed 4 times with lysis buffer, dissolved with 4 Laemmli’s buffer and boiled for 5 minutes. Supernatants were subjected to SDS-PAGE and transferred to nitrocellu lose membrane. After blocking with 5% (wt/vol) skim milk in Tris-buffered saline containing 0.1% Tween-20 (TBST), the membrane was incubated overnight at 4C with the indicated primary antibodies followed by HRPconjugated secondary antibody. Membranes were then washed and visual ized with ECL. When necessary, membranes were stripped using stripping buffer (Bio-Rad) and reprobed with various antibodies. EMSA . Nuclear protein extracts from unstimulated or stimulated CD4 cells with anti-CD3 or anti-CD3 and anti-CD28 were prepared using a nuclear extraction kit (Active Motif Inc.) according to the manufacturer’s instructions. Protein concentration was determined using the Bradford protein assay (Bio-Rad). Oligonucleotides for AP-1 were labeled with biotin-11 UTP using a Biotin 3 end DNA labeling kit (Pierce). Binding reactions were performed in a 25l volume. Each reaction contained 2 g nuclear extract, 2 g polydeoxinosinic-deoxycytidylic acid (dI:dC; SigmaAldrich), 50 mM NaCl, 10 mM Tris-HCl, 4% (vol/vol) glycerol, 0.5 mM DTT, 0.5 mM EDTA, 5 mM MgCl 2 , and 20 fmol biotin-labeled oligonucle otides. Reactions were incubated for 20 minutes at room temperature, then electrophoresed through a 5% or 7% polyacrylamide gel with 0.5 TBE run ning buffer. Gels were transferred onto Hybond N + membrane, followed by cross-linking at 120 mJ/cm 2 using a commercial UV light cross-linker Spectrolinker XL-1500UV cross-linker (Spectronics Inc.). Biotin-labeled AP-1 was detected by chemiluminescence using Phototope-Star detection kit (New England Biolab). Statistics . All data are expressed as mean SD. All in vitro experiments were performed in triplicate in at least 3 independent experiments. In vivo analyses were performed using 5 mice per group, unless otherwise speci fied. The Student’s unpaired 2-tailed t test was used to calculate statistical significance for differences between 2 groups. A P value less than 0.05 was considered significant. Note added in proof . Sirt1 may regulate T cell activation and aner gy by targeting other molecules besides c-Jun. Indeed, a recent study suggests that Sirt1 inhibits NFB transcriptional activa tion in T cells (62). We thank Eric Verdin (Gladstone Institute of Virology and Immu nology, University of California, San Francisco, California, USA) for Sirt1 expression plasmid and Fernando Macian (Albert Einstein College of Medicine, Bronx, New York, USA.) for providing the pro tocol of in vitro T cell anergy induction. This study was supported by NIH grants RO1AI079056 and DK083050 (“Type I Diabetes Pathfinder Award”) (to D. Fang) and 2RO1 NS37406 and 1RO1 NS057194 (to H. Zaghouani). S. Shannon was supported by a Fel lowship from University of Missouri College of Biological Science. Received for publication February 13, 2009, and accepted in revised form June 24, 2009. Address correspondence to: Deyu Fang, Department of Otolaryn gology — Head and Neck Surgery and Department of Molecular Microbiology and Immunology, University of Missouri School of Medicine, M616 Medical Sciences Bldg., Columbia, Missouri 65212, USA. Phone: (573) 882-4593; Fax: (573) 882-4287; E-mail: fangd@health.missouri.edu. Jinping Zhang’s present address is: Department of Microbiology, Columbia University College of Physicians and Surgeons, New York, New York, USA. Sang-Myeong Lee, Beixue Gao, Weimin Chen, and Deyu Fang’s present address is: Department of Pathology, Northwestern Uni versity Feinberg School of Medicine, Chicago, Illinois, USA. 1. Anasetti, C., Tan, P., Hansen, J.A., and Martin, P.J. 1990. Induction of specific nonresponsiveness in unprimed human T cells by anti-CD3 antibody and alloantigen. J. Exp. Med. 172 :1691. 2. Jenkins, M.K., and Schwartz, R.H. 1987. Antigen presentation by chemically modified splenocytes induces antigen-specific T cell unresponsiveness in vitro and in vivo. J. Exp. Med. 165 :302. 3. LaSalle, J.M., Tolentino, P.J., Freeman, G.J., Nadler, L.M., and Hafler, D.A. 1992. Early signaling defects in human T cells anergized by T cell presentation of autoantigen. J. Exp. Med. 176 :177. 4. Kang, S.M., et al. 1992. Transactivation by AP-1 is a molecular target of T cell clonal anergy. Science. 257 :1134. 5. Haigis, M.C., and Guarente, L.P. 2006. Mammalian sirtuins--emerging roles in physiology, aging, and calorie restriction. Genes Dev. 20 :2913. 6. Afshar, G., and Murnane, J.P. 1999. Characteriza tion of a human gene with sequence homology to Saccharomyces cerevisiae SIR2. Gene. 234 :161–168. 7. Vaquero, A., et al. 2004. Human SirT1 interacts with histone H1 and promotes formation of facul tative heterochromatin. Mol. Cell. 16 :93. 8. Bordone, L., and Guarente, L. 2005. Calorie restric tion, SIRT1 and metabolism: understanding lon gevity. Nat. Rev. Mol. Cell Biol. 6 :298. 9. McBurney, M.W., et al. 2003. The mammalian SIR 2alpha protein has a role in embryogenesis and gametogenesis. Mol. Cell. Biol. 23 :38. 10. Cheng, H.L., et al. 2003. Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1)-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 100 :10794–10799. 11. Gao, X., Xu, Y.X., Janakiraman, N., Chapman, R.A., and Gautam, S.C. 2001. Immunomodulatory activ ity of resveratrol: suppression of lymphocyte prolif eration, development of cell-mediated cytotoxicity, and cytokine production. Biochem. Pharmacol.

PAGE 11

The Journal of Clinical Investigation http://www.jci.org Volume 119 Number 10 October 2009 62 :1299. 12. Wu, S.L., et al. 2006. Apoptosis of lymphocytes in allograft in a rat liver transplantation model induced by resveratrol. Pharmacol. Res. 54 :19. 13. Falchetti, R., Fuggetta, M.P., Lanzilli, G., Tricarico, M., and Ravagnan, G. 2001. Effects of resveratrol on human immune cell function. Life Sci. 70 :81. 14. Feng, Y.H., et al. 2004. Differential regulation of resveratrol on lipopolysacchride-stimulated human macrophages with or without IFN-gamma pre-priming. Int. Immunopharmacol. 4 :713. 15. Kraft, A.S., and Anderson, W.B. 1983. Phorbol esters increase the amount of Ca2+, phospholipiddependent protein kinase associated with plasma membrane. Nature. 301 :621. 16. Bennett, J.P., Cockcroft, S., and Gomperts, B.D. 1979. Ionomycin stimulates mast cell histamine secretion by forming a lipid-soluble calcium com plex. Nature. 282 :851. 17. Chiang, Y.J., et al. 2000. Cbl-b regulates the CD28 dependence of T-cell activation. Nature. 403 :216–220. 18. Murphy, K.M., Heimberger, A.B., and Loh, D.Y. 1990. Induction by antigen of intrathymic apop tosis of CD4+CD8+TCRlo thymocytes in vivo. Sci ence. 250 :1720. 19. Macian, F., et al. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell. 109 :719–731. 20. Heissmeyer, V., et al. 2004. Calcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins. Nat. Immunol. 5 :255. 21. Anandasabapathy, N., et al. 2003. GRAIL: an E3 ubiquitin ligase that inhibits cytokine gene tran scription is expressed in anergic CD4+ T cells. Immunity. 18 :535. 22. Safford, M., et al. 2005. Egr-2 and Egr-3 are nega tive regulators of T cell activation. Nat. Immunol. 6 :472. 23. Olenchock, B.A., et al. 2006. Disruption of diacylg lycerol metabolism impairs the induction of T cell anergy. Nat. Immunol. 7 :1174. 24. Zha, Y., et al. 2006. T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-alpha. Nat. Immunol. 7 :1166. 25. Bandyopadhyay, S., et al. 2007. Interleukin 2 gene transcription is regulated by Ikaros-induced chang es in histone acetylation in anergic T cells. Blood. 109 :2878. 26. Thomas, R.M., et al. 2007. Ikaros enforces the costimulatory requirement for IL2 gene expression and is required for anergy induction in CD4+ T lymphocytes. J. Immunol. 179 :7305. 27. Wojcik, H., Griffiths, E., Staggs, S., Hagman, J., and Winandy, S. 2007. Expression of a non-DNAbinding Ikaros isoform exclusively in B cells leads to autoimmunity but not leukemogenesis. Eur. J. Immunol. 37 :1022. 28. Rincon, M., and Flavell, R.A. 1994. AP-1 transcrip tional activity requires both T-cell receptor-medi ated and co-stimulatory signals in primary T lym phocytes. EMBO J. 13 :4370. 29. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. 1993. Identification of an oncoproteinand UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev. 7 :2135. 30. Derijard, B., et al. 1994. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell. 76 :1025. 31. Lassmann, H., Brunner, C., Bradl, M., and Lin ington, C. 1988. Experimental allergic encephalo myelitis: the balance between encephalitogenic T lymphocytes and demyelinating antibodies deter mines size and structure of demyelinated lesions. Acta Neuropathol. 75 :566. 32. Sequeira, J., et al. 2008. sirt1-null mice develop an autoimmune-like condition. Exp. Cell Res. 314 :3069. 33. Fontenot, J.D., Gavin, M.A., and Rudensky, A.Y. 2003. Foxp3 programs the development and func tion of CD4+CD25+ regulatory T cells. Nat. Immu nol. 4 :330. 34. Khattri, R., Cox, T., Yasayko, S.A., and Ramsdell, F. 2003. An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol. 4 :337. 35. Chen, W., et al. 2003. Conversion of peripheral CD4+CD25– naive T cells to CD4+CD25+ regula tory T cells by TGF-beta induction of transcription factor Foxp3. J. Exp. Med. 198 :1875. 36. Kume, S., et al. 2007. SIRT1 inhibits transforming growth factor beta-induced apoptosis in glomeru lar mesangial cells via Smad7 deacetylation. J. Biol. Chem. 282 :151. 37. Fantini, M.C., et al. 2004. Cutting edge: TGF-beta induces a regulatory phenotype in CD4+CD25– T cells through Foxp3 induction and down-regula tion of Smad7. J. Immunol. 172 :5149. 38. Dominitzki, S., et al. 2007. Cutting edge: trans-sig naling via the soluble IL-6R abrogates the induc tion of FoxP3 in naive CD4+CD25 T cells. J. Immu nol. 179 :2041. 39. Jain, R., et al. 2008. Innocuous IFNgamma induced by adjuvant-free antigen restores normoglycemia in NOD mice through inhibition of IL-17 produc tion. J. Exp. Med. 205 :207. 40. Macian, F., Garcia-Rodriguez, C., and Rao, A. 2000. Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun. EMBO J. 19 :4783. 41. Liu, Y.C., Penninger, J., and Karin, M. 2005. Immu nity by ubiquitylation: a reversible process of modi fication. Nat. Rev. Immunol. 5 :941. 42. Gajewski, T.F., Qian, D., Fields, P., and Fitch, F.W. 1994. Anergic T-lymphocyte clones have altered ino sitol phosphate, calcium, and tyrosine kinase signal ing pathways. Proc. Natl. Acad. Sci. U. S. A. 91 :38–42. 43. Baier-Bitterlich, G., Baier, G., Gulbins, E., Cogge shall, K.M., and Altman, A. 1995. The role of p56lck in CD4-mediated suppression of CD3-induced early signaling events in T lymphocytes. Life Sci. 56 :1287. 44. Deckert, M., Tartare-Deckert, S., Hernandez, J., Rottapel, R., and Altman, A. 1998. Adaptor func tion for the Syk kinases-interacting protein 3BP2 in IL-2 gene activation. Immunity. 9 :595. 45. Boussiotis, V.A., Freeman, G.J., Berezovskaya, A., Barber, D.L., and Nadler, L.M. 1997. Maintenance of human T cell anergy: blocking of IL-2 gene tran scription by activated Rap1. Science. 278 :124. 46. Boussiotis, V.A., et al. 2000. p27kip1 functions as an anergy factor inhibiting interleukin 2 transcription and clonal expansion of alloreactive human and mouse helper T lymphocytes. Nat. Med. 6 :290–297. 47. Boussiotis, V.A., Lee, B.J., Freeman, G.J., Gribben, J.G., and Nadler, L.M. 1997. Induction of T cell clonal anergy results in resistance, whereas CD28mediated costimulation primes for susceptibility to Fasand Bax-mediated programmed cell death. J. Immunol. 159 :3156. 48. Go, C., and Miller, J. 1992. Differential induction of transcription factors that regulate the interleukin 2 gene during anergy induction and restimulation. J. Exp. Med. 175 :1327. 49. Lee, S., Gao, B., and Fang, D. 2008. FoxP3 main tains Treg unresponsiveness by selectively inhibit ing the promoter DNA-binding activity of AP-1. Blood. 111 :3599. 50. Muegge, K., et al. 1989. Interleukin-1 costimulatory activity on the interleukin-2 promoter via AP-1. Sci ence. 246 :249. 51. Serfling, E., et al. 1989. Ubiquitous and lympho cyte-specific factors are involved in the induction of the mouse interleukin 2 gene in T lymphocytes. EMBO J. 8 :465. 52. Glozak, M.A., Sengupta, N., Zhang, X., and Seto, E. 2005. Acetylation and deacetylation of non-histone proteins. Gene. 363 :15. 53. Wang, Y.N., Chen, Y.J., and Chang, W.C. 2006. Acti vation of extracellular signal-regulated kinase sig naling by epidermal growth factor mediates c-Jun activation and p300 recruitment in keratin 16 gene expression. Mol. Pharmacol. 69 :85. 54. Dey, S., et al. 2008. Interactions between SIRT1 and AP-1 reveal a mechanistic insight into the growth promoting properties of alumina (Al2O3) nanoparticles in mouse skin epithelial cells. Carci nogenesis. 29 :1920. 55. Gao, Z., and Ye, J. 2008. Inhibition of transcription al activity of c-JUN by SIRT1. Biochem. Biophys. Res. Commun. 376 :793. 56. Singh, N.P., Hegde, V.L., Hofseth, L.J., Nagarkatti, M., and Nagarkatti, P. 2007. Resveratrol (trans3,5,4 -trihydroxystilbene) ameliorates experimental allergic encephalomyelitis, primarily via induction of apoptosis in T cells involving activation of aryl hydrocarbon receptor and estrogen receptor. Mol. Pharmacol. 72 :1508. 57. Milne, J.C., et al. 2007. Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature. 450 :712. 58. Lee, I.H., et al. 2008. A role for the NAD-dependent deacetylase Sirt1 in the regulation of autophagy. Proc. Natl. Acad. Sci. U. S. A. 105 :3374. 59. Mombaerts, P., et al. 1992. Mutations in T-cell antigen receptor genes alpha and beta block thy mocyte development at different stages. Nature. 360 :225–231. 60. Gao, B., Lee, S.M., and Fang, D. 2006. The tyro sine kinase c-Abl protects c-Jun from ubiquitina tion-mediated degradation in T cells. J. Biol. Chem. 281 :29711. 61. Legge, K.L., et al. 2002. On the role of dendritic cells in peripheral T cell tolerance and modulation of autoimmunity. J. Exp. Med. 196 :217. 62. Kwon, H.S., et al. 2008. Human immunodeficiency virus type 1 Tat protein inhibits the SIRT1 deacety lase and induces T cell hyperactivation. Cell Host Microbe. 3 :158.



PAGE 1

1 MITOFUSIN 2 MEDIATES SIRTUIN 1 INDUCED AUTOPHAGY TO SUPPRESS LIVER ISCHEMIA/REPERFUSION INJURY By THOMAS G. BIEL A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2 © 2014 Thomas G. Biel

PAGE 3

3 To my mom and dad for their support, patience and love through my many endeavors

PAGE 4

4 ACKNOWLEDGMENTS I would like to take this opportunity to express my gratitude to ward my mentor s Dr. Kevin Behrns and Dr. Jae Sung Kim for their support, direction and belief in my abilities as a young investigator . I would like to thank my committee Dr. Scott Powers , Dr . William Dunn J r. and Dr. Hideko Kasahara for their advice and guidance throughout my entire training. I would like to express many thanks to Dr. Christiaan Lueewenburgh, Dr . Nasanith Sunny , Dr. Jeffery Harrison, and Dr. Brian Law for their career advice and sharing their experiences to guide me towards my own goals and objectives. Dr. Ivan Zende j a s for showing me the relevance of my research in his practice . Very special thanks to Debra Akins who taught me several experimental technique s , and so much more . I would like to thank all the post doctoral researchers and medical residences for their advice during my graduate studies, especially Jin Hee Wang and Min Ho Lee . I like to express my deep appreciation for my lab mate s Joseph Flores Toro, Richa Vijayvargiya and Jos eph Dean. I would have never made it to graduation without our long discussions, scientific conversations and hookah nights . I truly enjoyed teaching each one of you and watching the develop ment of your own knowledge and ab ilities in science. It will always be my most valued and cherished experience . All of you had a major role in navigating my decisions and future direction s for pursing my sc ientific goals . I can only hope that the time we spe nt together was helpful for your life endeavors. Finally, I would like to thank my family and friends for their support and advice . I love you all for keeping my spirits up , listening when I need it and the encouragement to keep pushing forward . We made it!

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 ABSTRACT ................................................................................................................... 12 CHAPTER 1 AUTOPHAGY SUPPRESSES LIVER ISCHEMIA/REPERFUSION INJURY AND THE THERAPEUTIC POTENTIAL FOR TARGETING SIRTUINS ......................... 14 Introduction ............................................................................................................. 14 The Liver ................................................................................................................. 14 Liver Surgery And I/R Injury .................................................................................... 16 Mechanisms Of Warm I/R Injury ....................................................................... 19 Mitochondrial dysfunction ........................................................................... 20 Mitochondrial Ca 2+ and the MPT onset ...................................................... 22 Proteases, lysosomes and I/R injury .......................................................... 23 Surgical And Pharmacological Strategies To Suppress Liver I/R Injury ........... 24 Autophagy ............................................................................................................... 26 Autophagy Initiation .......................................................................................... 27 Autophagosomal Membrane Elongation And Maturation ................................ . 30 Lysosomal Degradation .................................................................................... 31 Mitochondrial Autophagy (Mitophagy) .............................................................. 32 Autophagy Suppresses Liver I/R Injury ............................................................ 34 Sirtuins .................................................................................................................... 35 Sirtuin Enzymatic Activity ................................................................................. 36 Sirtuin Regulated Liver Functions ..................................................................... 37 Sirtuin 1 ...................................................................................................... 37 Sirtuin 3 and Sirtuin 5 ................................................................................. 38 Other sirtuins .............................................................................................. 39 Endogenous And Exogenous Sirtuin 1 Regulators ........................................... 40 Activation Of SIRT1 Induces Autophagy .......................................................... 42 SIRT1 And I/R Injury ........................................................................................ 44 Therapeutic Potential Of SIRT1 And Liver I/R Injury ........................................ 45 2 LIVER ISCHEMIA/REPERFUSION CAUSES THE DEPLETION OF SIRTUIN 1 AND HEPATOCELLULAR DEATH ......................................................................... 58 Introduction ............................................................................................................. 58 Background ............................................................................................................. 59 Materials And Methods ........................................................................................... 61

PAGE 6

6 Human Liver Tissue Collection ................................ ................................ ......... 61 Mouse Liver In Vivo I/R ................................ ................................ .................... 61 Tamoxifen Treatment For Inducible SIRT1 KO Mice ................................ ........ 61 Genotyping And RT PCR ................................ ................................ ................. 62 Hepatocyte Isolation And Culture ................................ ................................ ..... 63 Hepatocyte Simulated I/R ................................ ................................ ................. 63 Reagents And Drug Treatments ................................ ................................ ....... 64 Immunoblot ................................ ................................ ................................ ....... 64 Cytosolic And Nuclear Subfractionation ................................ ........................... 65 Cell Death Assay Using Propidium Iodide ................................ ........................ 65 Data Analysis ................................ ................................ ................................ ... 65 Results ................................ ................................ ................................ .................... 65 Ischemia Causes SIRT1 Depletion ................................ ................................ ... 65 SIRT1 Depletion Is Multifactorial ................................ ................................ ...... 67 Discussion ................................ ................................ ................................ .............. 68 3 SIRTUIN 1 ACTIVATION PREVENTS MITOCHONRIAL DYSFUNCTION AND PROMOTES AUTOPHAGY TO PROTECT AGAINST LIVER I/R INJURY ............ 79 Introduction ................................ ................................ ................................ ............. 79 Background ................................ ................................ ................................ ............. 80 Materials And Methods ................................ ................................ ........................... 82 Reagents And Drug Treatments ................................ ................................ ....... 82 In Vivo I/R And Adenoviral Injection ................................ ................................ . 82 Intravital Multiphoton Microscopy ................................ ................................ ..... 82 Hepatocyte Adenoviral Infection ................................ ................................ ....... 83 Electron Microscopy ................................ ................................ ......................... 83 Confocal Microscopy ................................ ................................ ........................ 84 Hepatocyte Isolation And Culture ................................ ................................ ..... 84 Hepatocyte Simulated I/R ................................ ................................ ................. 84 Immunoblotting ................................ ................................ ................................ . 85 Tamoxifen Treatment For Inducible SIRT1 KO Mice ................................ ........ 85 Cell Death Assay Using Propidium Iodide ................................ ........................ 85 Data Analysis ................................ ................................ ................................ ... 85 Results ................................ ................................ ................................ .................... 85 SIRT1 Suppresses The MPT Onset And Hepatocyte Death. ........................... 85 SIRT1 Induces Autophagy To Suppress I/R Injury ................................ ........... 86 SIRT1 KO Impaired Autophagy Sensitizes Hepatocytes To I/R Injury ............. 87 SIRT1 Induced Autophagy And Initiation Signals ................................ ............. 88 SIRT1 Overexpression Increases ATG7 Expression ................................ ........ 89 SIRT1 Overexpression Suppresses In Vivo I/R Injury ................................ ...... 89 Discussion ................................ ................................ ................................ .............. 90 4 SIRT1 CAN FORM A COMPLEX WITH MITOFUSINS AND SIRT1 INDUCED AUTOPHAGY IS MEDIATED THROUGH MFN2 ................................ .................. 104 Introduction ................................ ................................ ................................ ........... 104

PAGE 7

7 Background ................................ ................................ ................................ ........... 104 Materials And Methods ................................ ................................ ......................... 107 Human Liver Tissue Collection ................................ ................................ ....... 107 Human Tissue Cytosolic And Membrane Subfractionation ............................. 107 Hepatocyte Isolation And Culture ................................ ................................ ... 107 Hepatocyte Adenoviral Infection ................................ ................................ ..... 107 Hepatocyte Cytosolic And Membrane Subfractionation ................................ . 107 Immunoprecipitation ................................ ................................ ....................... 108 Immunoblotting ................................ ................................ ............................... 109 Tamoxifen Tr eatment For Inducible SIRT1 KO Mice ................................ ...... 109 Hepatocyte Adenoviral Infection ................................ ................................ ..... 109 Data Analysis ................................ ................................ ................................ . 109 Results ................................ ................................ ................................ .................. 110 Novel Mitofusin SIRT1 Complexes ................................ ................................ . 110 MFN2 Mediates SIRT1 Induced Cytoprotection Against Liver I/R Injury ........ 111 Discussion ................................ ................................ ................................ ............ 112 5 SIRT1 OVEREXPRESSION SUPPRESSES THE LOSS OF MFN2 DURING LIVER ISCHEMIA/REPERFUSION INJURY ................................ ........................ 122 Introduction ................................ ................................ ................................ ........... 122 Background ................................ ................................ ................................ ........... 123 Materials And Methods ................................ ................................ ......................... 125 Reagents And Drug Treatments ................................ ................................ ..... 125 Human Tissue Collection ................................ ................................ ................ 125 Mouse Liver In Vivo I/R And Adenoviral Injection ................................ ........... 125 RT PCR And Qualitative PCR ................................ ................................ ........ 125 Hepatocyte Isolation And Culture ................................ ................................ ... 126 Hepatocytes Simulated I/R Model ................................ ................................ .. 126 Adenoviral Infection ................................ ................................ ........................ 126 Tamoxifen Inducible SIRT1 KO Mice ................................ ............................. 126 Immunoblotting ................................ ................................ ............................... 126 Data Analysis ................................ ................................ ................................ . 126 Results ................................ ................................ ................................ .................. 126 Ischemia Depletes MFN2, And Reperfusion Sustains The Loss .................... 126 Overexpression Of SIRT1 Suppresses MFN2 Depletion ................................ 128 Discussion ................................ ................................ ................................ ............ 130 6 CONCLUSIONS AND FUTURE D IRECTIONS ................................ .................... 139 Summary ................................ ................................ ................................ .............. 139 Clinical Application Of SIRT1 Activation ................................ ............................... 143 Overall Conclusion ................................ ................................ ................................ 144 LIST OF REFERENCES ................................ ................................ ............................. 147 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 180

PAGE 8

8 LIST OF TABLES Table page 1 1 Liver composition by cell type ................................ ................................ ............. 55 1 2 Hepatic zones have structural and functional differences within a liver lobule. ... 56 1 3 Mammalian sirtuin isoforms and known activity, targets, and function ............... 57 6 1 SIRT1 agonists and clinical trials are controversial. ................................ ......... 146

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Liver anatomy divided into eight Couninaud segments. ................................ ..... 46 1 2 Liver lobules have hepatic zonal differences within the liver. ............................. 47 1 3 Mitochondrial permeability transition pore opening during reperfusion leads to mitochondrial rupture and hepatocyte death ................................ ...................... 48 1 4 Accumulation of calcium leads to the MPT onset during I/R. .............................. 49 1 5 The three different types of autophagy are chaperone mediated autophagy, microautophagy and macroautophagy. ................................ .............................. 50 1 6 Autophagy initiation can occur through mTOR inhibition and AMPK activation. ................................ ................................ ................................ ........... 51 1 7 The ATG8 and ATG12 ubiquitin like systems process ProLC3 to LC3 II for insertion into the autophagosomal membrane. ................................ ................... 52 1 8 SIRT1 requires NAD + as a substrate for enzymatic activity.. .............................. 53 1 9 SIRT1 regulation can occur through post translational modifications and endogenous protein interactions. ................................ ................................ ........ 54 2 1 SIRT1, SIRT3, and SIRT5 expression changes in human and mouse livers and primary hepatocytes subjected to I/R. ................................ ......................... 74 2 2 Prolonged ischemia depletes SIRT1 le ading to hepatocyte death during reperfusion. ................................ ................................ ................................ ......... 74 2 3 SIRT1 KO sensitizes hepatocytes to I/R injury. ................................ .................. 75 2 4 SIRT1 mRNA does not decrease during I/R and the protein is stable at 4 hours after protein synthesis inhibition using cycloheximide. ............................. 75 2 5 SIRT1 mediates ALLM induced cytoprotection against I/R injury. ...................... 76 2 6 Proteasome inhibition using MG 132 does not suppress the ischemic reduction of SIRT1. ................................ ................................ ............................. 76 2 7 Cathepsin inhibition using E64d suppresses the SIRT1 reduction after 2 hours of ischemia. ................................ ................................ .............................. 77 2 8 Cathepsin and calpain combined inhibition does not have an additive effect on suppressing the reduction of SIRT1 during I/R. ................................ ............. 77

PAGE 10

10 3 1 SIRT1 overexpression suppresses I/R injury. ................................ ..................... 97 3 2 Pharmacological activation of SIRT1 supp resses mitochondrial dysfunction and hepatocyte death. ................................ ................................ ........................ 98 3 3 SIRT1 overexpression induces autophagy to suppress I/R injury. ...................... 99 3 4 SIRT1 KO hepatocytes have an impaired autophagy leading to mitochondrial dysfunction and cell death. ................................ ................................ ............... 100 3 5 Expression of autophagy proteins involved in initiation, elongation, and fusion in hepatocytes overexpressing SIRT1. ................................ ............................. 101 3 6 Mice infected with AdSIRT1 prevent the MPT onset and induce autophagy during I/R. ................................ ................................ ................................ ......... 102 3 7 Activation of SIRT1 suppresses I/R injury. Graphical interpretation for SIRT1 activation suppressing liver I/R injury. ................................ .............................. 103 4 1 Acetylation changes in SIRT1 overexpressing hepatocytes. Hepatocytes were infected with 10 MOI AdGFP or AdSIRT1. ................................ ............... 117 4 2 PGC 1 , FOXO1 and FOXO3A localization and acetylation changes in isolated hepatocytes after SIRT1 overexpression. ................................ ........... 118 4 3 MFN2 is a substrate of SIRT1. Hepatocytes were infected with 10 MOI AdGFP or AdSIRT1 and subfractionated into the C and M fractions. ............... 118 4 4 SIRT1 induced autophagy is impaired by MFN2 knockdown. .......................... 119 4 5 MFN2 deficient hepatocytes are sensitive to I/R injury. ................................ .... 120 4 6 MFN2 mediates SIRT1 induced autophagy to suppress the MPT onset and hepatocyte death during I/R. ................................ ................................ ............ 121 5 1 MFN2 expression changes in human and mouse liver tissue and primary mouse hepatocytes during I/R. ................................ ................................ ......... 135 5 2 MFN2 protein stability and mRNA expression during I/R in primary hepatocytes. ................................ ................................ ................................ ..... 135 5 3 Inhibition of cysteine cathepsins suppresses the ischemi c reduction of MFN2 in primary hepatocytes during I/R. ................................ ................................ .... 136 5 4 SIRT1 modulation affects MFN2 degradation during I/R. ................................ . 137 5 5 Overexpression of SIRT1 suppresses the MFN2 depletion during liver I/R injury. ................................ ................................ ................................ ................ 138

PAGE 11

11 6 1 MFN2 mediates SIRT1 induced autophagy to suppress against liver I/R injury. ................................ ................................ ................................ ............... 145

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MITOFUSIN 2 MEDIATES SIRTUIN 1 INDUCED AUTOPHAGY TO SUPPRESS LIVER ISCHEMIA/REPERFUSION INJURY By Thomas G. Biel December 2014 Chair: Jae Sung Kim Co Chair: Kevin Behrns Major: Medical Sciences Physiology and Pharmacology Hepatic i schemia/reperfusion ( I/R ) injury cause s organ damage that can lead to liver failure and mortality after resection and trans plantation surgeries . Currently, there are no therapeutic approaches to circumvent li ver I/R injury. Autophagy is a lysosomal dependent catabolic process that degrades long lived proteins and dysfunctional organelles . Autophagy is an endogenous cytoprotect ive mechanism to suppress liver I/R injury. Sirtuin 1 (SIRT1) is a NAD + de pendent dea cetylase that mediates autophagy , t hus we investigate d the role of SIRT1 during liver I/R injury. Human and mouse livers, and primary hepatocytes were subjected to I/R conditions to determine changes in SIRT1 expression . A dramatic reduction in SIRT1 was observed in both livers and hepatocytes subjected to I/R , which was partly dependent on both cathepsins and calpains . Modula tion of SIRT1 using an adeno virus expressing SIRT1 , or pharmacological activators , Resveratrol and SRT1720 , suppressed liver I/R injury, while the loss of SIRT1 sensitized hepatocytes to I/R. Activation of SIRT1 enhanced autophagy before and af ter I/R, which was absent in SIRT1 deficient hepatocytes suggesting that SIRT1 induced autophagy suppress es liver I/R injury. To determine the

PAGE 13

13 mechanism s of SIRT1 induced autophagy, we analyzed autophagy related protein expression, autophagy initiation signals, potential protein interaction s and substrate acety lation . Mitofusin 1 ( MFN1 ) and Mitofusin 2 ( MFN2 ) were identified as acetylated proteins that form a complex with SIRT1 . Furthermore, overexpression SIRT1 led to MFN2 de acetylation . Next, we demo nstrated that SIRT1 induced autophagy was impaired in MFN2 deficient hepatocytes prior to and after I/R . To validate the importance of MFN2 during I/R, livers and hepatocytes were subjected to I/R , which caused a significant MFN2 reduction in a manner partly dependent on cathepsins and calpains leading to hepatocy te death . O verexpression of SIRT1 suppressed the loss of MFN2 and enhanced autophagy flux during I/R, while MFN2 knockdown hepatocytes had an impaired autophagic flux and were hypersensitive I/R. Collectively, t hese data suggest that MFN2 mediates SIRT1 in duced autophagy to suppress liver I/R injury.

PAGE 14

14 CHAPTER 1 AUTOPHAGY SUPPRESSES LIVER ISCHEMIA/REPERFUSION INJURY AND THE THERAPEUTIC POTENTIAL FOR TARGETING SIRTUINS Introduction Ische mia/r eper fusion (I/R) injury is a primary factor that causes liver failur e and patient mortality after liver resection and transplantation surgeries . Therapeutic a dvances against warm I/R injury have been disappointing, thus new strategies are required. Mitochondrial dysfunction is the causative mechanism lead ing to hepatocyte death and liver failure after warm I/R. Upon reperfusion, dysfunctional mitochondria accumulate leading to hepatocyte death and liver damage. Autopha gy is an endogenous mechanism that can degrade dys functional mitochondria, however I/R impairs a utophagy . A ctivation of autophagy during I/R leads to the removal of dysfunctional mitochondria to protect against liver damage . Sirtuin s are class III histone deacetylases that are dependent on nicotinamide adenine dinucleotide ( NAD + ) . There are seven sir tuin isoforms that localizes to different cellular compartments . Activation of Sirtuin 1 (SIRT1) enhances autophagy and mitochondrial biogenesi s , however the role of SIRT1 in autophagy and liver I/R injury is unclear or unknown . This chapter focuses on the background information for liver I/R injury, mitochondrial dysfunction , autophagy , and sirtuins . The Liver In humans, the l iver is the primary metabolic organ for coagulation factor synthesis, blood filtration, vitamin and mineral storage, production and secretion of bile , and toxic compound detoxification (1) . The gross anatomy of t he liver can be divided into 4 different lobes ( caudate, quadrate, right and left lobes ) or eight segments based on the venous, arterial, and biliary systems (Figure 1 1) (2) . The liver is composed of

PAGE 15

15 several different cell types including hepatoc ytes (parenchymal cells), endothelial cells, K upffer cells, Ito cells , b iliary epithelial cells , smooth muscle cells, PIT cells and nerve cells that function in unison to maintain liver function (Table 1 1) . L iver lobule s are the smallest functional units of the liver (1) . Structurally, l iver lobules are irregular shaped polygonal prisms that contain portal areas at the corners of ad jacent lobule s and a central vein (Figure 1 2 ). Portal areas are regions of connective tissue that cont ain the portal triad branches , which include the bile duct, portal vein and hepatic artery. Along the central axis of the liver lobule i s the central vei n for outgoing blood flow . Blood flows through the liver and is process ed by h epatocytes that are constructed into cords within each lobule (Figure 1 2 ). Hepatocytes are multifaceted p olarized epithelial cells with distinct bile canalicular or sinusoidal m embranes (3) . Lateral surfaces engage in cell cell contact, interact with basal lamina and face the endothelial cells, while the canalicular domains form at latera l cell cell contacts (1) . This unique structure allows for bile and protein trafficking between the blood and hepatic ducts leading to the gallbladder. Hepatic blood flow is approximately 1,200 ml/min in women and 1,800 ml/min in men, depending on physiol ogical conditions (1) . The liver has an extremely high proportion of blood volume that amounts to 10 15% of the total blood content. B lood that passes thr ough the intestines and spleen is delivered to the liver via the hepatic portal vein and accounts for a pproximately 70% of total blood inflow. Portal blood carries nutrients and contamina nts for the liver to fi lter , process and secrete back into the blood stream (1) . The hepatic artery supplie s approximately 30% of the total blood inflow , and is highly oxygenated compared to the portal blood supply (1) . The p ortal and arterial blood mix within hepatic sinusoids found with in the liver lob ule and exits via

PAGE 16

16 central vein that connects to hepatic vein and the inferior vena cava. As the blood passes through the lobule, P O 2 within the blood decrease s due to hepa tocyte metabolism , thus creating zonal differences in P O 2 and nutrien ts within the lobule ( Figure 1 2 ) (4) . These z onal differences alter hepatocyte metabolism (Table 1 2 ) . Functionally, z one 1 hepatocytes are located in the periportal region and are specialized for gluconeogenesis, oxidation of fatty acids and cholesterol synthesis, while zone 3 are located in the perivenous region and performs glycolysis, lipogenesis and drug detoxification (5;6) . Zone 1 contains the highest blood P O 2 and is the least sensi tive to ischemic stress, while z one 3 contains the least P O 2 and most vulnerable to ischemia (5;7;8) . Liver Surgery A nd I/R Injury The American Liver Foundation estimates that liver disease affects over 30 million Americans with 30,000 new cases every year. Liver resec tion, or hepatectomy, is described as the operative removal of the liver , which can be partial to remove a segment or complete . Liver resection and transplantation su rgeries are still the most effective interventions for patients with advanced liver diseas es and more patients continue to need these surgical treatments (9;10) . A partial hepatectomy can remove up to 7 0 % of the total liver by volume without leading to liver insufficiency post resection (11) . I ncreasing the reduction mass to 90% leads to portal hypert ension, microcirculatory ischemia and hepatocellular dysfunction (11) . A complete hepatectomy is performed during liver transplantation surgery prior to implantation of the donor li ver. Approximately 6,000 liver transplantations and 7,000 10,000 liver resections are

PAGE 17

17 performed annually in the Un ited States making these procedures common treatment s for liver disease (9;12 16) . The first liver resection was performed by W. Keen in 1899 to treat hepatic cancer (17) . Today, liver r esections are performed for living donor transplantation and a s a curative treatment for var ious types of liver diseases including cancer, benign tumors and cystic disease . Liver resection surgery has greatly improved operative mortality rate from <20% to <5% in the last three decades making liver resection a successful and safe way to treat patients with liver disease (18) . These improvements are due to a better understanding of live r anatomy, improved surgical techniques, more sophisticated equipment, and advances in perioperative care (19 22) . However, damage to the liver pare nchym al cells increases the incidence of post resection liver failure and patient mortality (22) . P ost resection liver failure can occur in as little as 48 hours after surgery and can be identified by deeping jaundice, worsening coagulopathy , encephalopathy, and hyperbilirubinemia , which ultimately leads to mortality (11) . Preoperatively, a liver can b e assessed for parenchymal function by assessing the Mod el for End Stage Liver Disease (MELD) score, which is based on the hepatic synthesis and secretion of bilirubin, creatinine and prothrombin (23 26) . Patients with high MELD score s indicate an impaired liver function due to hepatocyte damage , which causes an increase in the incidence of post resection liver failur e and mortality to <30% (27 29) . Liver I/R injury can also damage hepatocytes leading to l iver dysfunction and patient mortality. Ischemia is defined as the interruption of blood flow carrying oxygen and nutrients to the tissue, while reperfusion is the restoration of the blood flow .

PAGE 18

18 Ischemic t emper ature can change the causative factors lead ing to liver dysfunction. During liver transplantation, normothermic explant hepatectomy initially subjects the liver to warm ischemia, which is followed by cold ischemia in a hypothermic preservation medium . Prolonged cold ischemia leads to reperfusion induc ed endothelial cell dysfunction and Ku pffer cell activation, which are the primary factors contributing to liver graft dysfunction (30;31) . In contrast, a partial hepatectomy is performed under normothermic conditions and often utilizes vasculature clamping of the portal triad, known as the Pringle maneuver, to minimize blood loss. This creates hepatic inflow occlusion resulting in an inevitable warm I/R event (18) . Hepatocyte damage is the major cause of warm I/R injur y (32 34) . The liver is innatel y vulnerable to ischemia during inflow occlusion, especially in the zone 3 (perivenous regions ) (5;7;8) . P rolonging ischemia to one hour can furth er damage parenchymal cells leading to liver dysfunction (35) . Ischemia initially causes hepatocyte damage during inflow occlusion, but reinstitution of blood flow exacerbates hepatocyte damage from the restoration of physiological pH, the accumulation of toxins from intestinal venous congestion during inflow occl usion, and activation of Kupffer cell s (5;7;8) . Warm I/R injury diminishes adequate postoperative liver remnant function and can be a major cause of morbidity and mortality in patients after liver resection surgery (9;36;37) . The mechanisms underlying warm I/R injury to the hepatocytes are multifactorial, including Ca 2+ deregulation, mitochondria l dysfunction, generation of reactive oxygen and nitrogen species, loss of cellular antioxidants, and stimulation of catabolic enzymes (7;38;39) . Warm I/R injury is a primary factor leading to hepatocyte d eath , liver failure and patient mortality after liver resection surgery and the main focus of this study .

PAGE 19

19 Mechanisms O f Warm I/R I njury Vascula ture clamping causes hepatic inflow o cclusion leading to oxygen and nutrient depleti on in the liver. The lack of oxygen impairs mitochondrial oxidative phosphorylation and ATP generation . At this point, the g lycogen storage is utilized to support anaerobic glycolysis for ATP generation leading to an accumulation of lactic acid that in turn decreases the intracellular pH (5) , ultimately leading to tissue acidosis . Tissue a cidosis occurs by the accumulation of lactic acid, a buildup of hydrogen ions from the hydrolysis of ATP, and the disruption of hydr o gen ions from acidic organelles (5;40;41) . Intr acellular acidosis conveys cytoprotection against I/R injury in a cyclophilin D mediated manner (42) . Cyclophilin D is a peptidyl prolyl i somerase that becomes activated by the reinstitution of physiological pH, which in turn leads to mitochondrial rupture and cell death (42;43) . This hepatic reinstatement to physiological pH worsening hepatocyte damage and causing I/R injury is known as the pH paradox (5) . Warm I/R injury can be separated into different phases based on the mechanism for cell death. Necrotic cell death begins after 30 minutes of i schemia at pH 7.4 from ATP depletion, reactive oxygen species ( ROS ) production at the ischemia/normoxia border, and pr otease activation (5) . Reperfusion induced hepatocyte death increases at three different phases: early, intermediate and late. Early reperfusion injury damages hepatocytes from the first minute and up to 6 hours (44) . Necrotic cell death occur s within t he first hour of reperfusion from mitochondrial dysfunction and ROS production (7;38;39;45) . ROS activate Kupffer cells to promote even higher ROS production that further damage s hepatocytes and increase s cytokine production (44) . Next, t he intermediate pha se of hepatocyte damage is Kupffer cell mediated , which occurs after 6 hours of reperfusion . Kupffer cells release ROS, cytokines and chemokines to initiate

PAGE 20

20 neutrophil migration that further damage s the liver (5) . Lastl y, t he late phase is mediated by neutrophils and occurs up to 24 hours after ischemia . Neutrophils migrate and become activated to release ROS, cathepsins and elastases to damage and impair the liver (5) . Liver damage due to alterations in the metabolism of hepato cytes during the early phase of reperfusion is a facto r leading to the intermediate and late phases of w arm I/R injury (32 34;46) and the primary focus of this study . Mitochondrial d ysfunction Mitochondrial dysfunction is the causative mechanism contributing to hepatocyte death during early reperfusion injury. M itochondria l membranes are impermeable to solutes, therefore transport i n to the mitochondria requires specific carrier protein s . During reperfusion, the mitochondrial impermeability is lost due to the unregulated opening of mitochondri al permeability transition (MPT) pores . Unreg ulated opening of the MPT pores lead to an influx of solutes up to 1, 5 00 D a into the mitochondria l matrix. This causes mitochondrial swelling, depolarization, uncoupled oxidative phosphorylation, ATP depletion, mitochondrial membrane rupture, the release of pro apoptotic proteins, such as cytochrome c, t hat are normally sequestered in the inner membrane , and cell death (7;39;45;47) ( Figure 1 3 ) . The MPT pores are located at contact sites between the mitochondrial inner and outer membranes providing a mechanism for rapid changes with the mitochondria. The transient opening of the MPT pores under normal physiological conditions is suggested to regulate Ca 2+ and ROS within the mitochondria for altering cell ular metabolism (48;49) . However, t he unregulated opening of the MPT pores is a lethal event with in <1 hour after r eperfusion and termed as the MPT onset (7;38;39;47;50 53) .

PAGE 21

21 The protein composition of the MPT pore is still controversial, but is likely composed of several different proteins including adenine nucleotide translocator (ANT) located on the inner mitochondrial membrane, voltage dependent anion cha nnel (VDAC) located on the outer mitochondrial membrane, and cyclophilin D located in the mitochondrial matrix (7 ) (Figure 1 3) . Several other proteins have also been suggested to be i nvolved in the MPT pore including hexokinase and Bcl 2 family members (7) . The proapoptotic protein Bax can translocate to the mitochondrial outer membrane to promote the opening of the M PT pore (5) . Structural controversy was further enhanced in the finding that VDAC or ANT KO cells can still undergo the MPT onset (54;55) . Further stud ies are required to provide clarity into the structure and formation of MPT pore . Low pH and cyclosporine A , an immunosuppressive agent , suppress the MPT onset by inhibi ting cyclophilin D (5) . Cyclophilin D causes the conformation al change of ANT from the trans to cis form leading the MPT onset the during l iver I/ R injury (42;43;49;56) , thus suggesting that ANT is part the MPT pore leading to cell death during liver I/ R (Figure 1 3) . Mitochondrial dysfunction and ATP depletion is the causative mechanism leading to necrosis during I/R injury (37;57;58) . Ruptured mitochondria release cytochrome c that binds to apoptosis inducing factor 1 and pro caspase 9 to form a protein complex, known as the apoptosome, that is ATP dependent to signal for apoptosi s through caspase 3 (5;7;59;60) . Generation of ATP through glycolysis can play a factor in apoptotic signaling, however the mitochondrial ATPase activity is reversed lead ing to the depletion of ATP during reperfusion (5) . ATP depletion leads to necrosis, while the presence of low ATP induces apoptosis (7;38) . Necrotic cell death occurs in <2 h ours

PAGE 22

22 afte r reperfusion suggesting that these hepatocytes are the most sensitive for ATP depletion and mitochondrial dysfunction, which in turn leads to necrosis, Kupffer cell activation, and recruitment of neutrophil s for late r phases of reperfusion injury (5;7;38) . Mitochondrial Ca 2+ and the MPT o nset Intracellular Ca 2+ plays a major role in mitochondrial dysfunction, the MPT onset and cell death during liver I/R injury (5) (Figure 1 4) . Intracellular compartment s containing Ca 2+ include the cytosol, endoplasmic reticulum and the mitochondria. The depletion of ATP during ischemia i mpair and alter ion pumps that balance intracellular concentrations of Ca 2+ , Na + , and H + . During ischemia, the accumulation of H + leads to the activation of the Na + /H + exchanger in the p lasma membrane , while Na + /K + ATPase is impaired due to ATP depletion leading to an accumulation of Na + into the cytosol (61;62) . Na + , in turn, activates the Na + /Ca 2+ exchanger in the plasma membrane to accumulate Ca 2+ in the cytosol (62 64) . This process is accelerated upon reperfusion due to the removal of H + ions by the Na + /H + and Na + /Ca 2+ exchangers (61 65) . Furthermore, e ndoplasmic reticulum Ca 2+ storages are a lso a ffected during I/R by the inhibition of Ca 2+ reuptake, and the enhancement of Ca 2+ release through ryanodine receptor (61;62;65) . These alterations in ion balance lead to an accumulation of cytosolic Ca 2+ concentrations, but cytosolic Ca 2+ does not lead to hepatocyte I/R injury (5;39;45) . Mitochondrial Ca 2+ overload is the key factor that initiates the opening of the MPT pore , which is f ollowe d by gen eration of ROS (39;45) . The i ncreas ed cytosolic Ca 2+ is taken up into the mitochondria via the mitochondrial Ca 2+ uniporter, which requires polarized mitochondria to facilitate inflow. Mitochondria become repolarized within 5 m inutes of reperfusion, which drive the Ca 2+ influx. The excessive influx of Ca 2+ into the

PAGE 23

23 mitochond ria activates cyclophilin D leading to the MPT onset (42;43) . Mitochondrial Ca 2+ chelation suppresses hepatocyte necrosis and ROS production suggesting the mitochondrial Ca 2+ overload occurs prior to ROS gene ration (39;45) . Furthermore, pH dependent r eperfusion induced death occurs in the absence of oxygen suggest ing that Ca 2+ overload is independent of oxygen and mitochondrial ROS production leading to the MPT onset and cell death (5) . Proteases, l ysosomes and I/R i njury Calpains are a family of non lysosomal cysteine proteases that degrade intracellular protei ns in the cytosol, cytoskeleton, ER and mitochondria (50;53;66) . C alpains are expressed as two isoezymes that become activated through different concentrations of Ca 2+ as i ndicated by their nomenclature: 3 50 mol/L ( calpain ) and 400 800 mol/L (m calpain). Elevation in Ca 2+ concentration s during I/R lead s to the activation of c alpains (5 ;50;53) and the degradation of the endogenous calpain inhibitor calpastatin (62) . I nhibition of c alpains through pharmacological or genetic approaches prot ect against I/R injury to the brain, heart, liver, kidney and intestines (62;67 69) . Ca lpain activation can lead to the degrad ation of lysosomal membrane proteins leading to lysosomal membrane destabilization (70 72) . Calpain localize s to the lysosomal membrane after the onset of ischem ia, and subsequent spillage of c athepsins into the cytoplasm occurs (70;72) , however the mechanis m is poorly understood . cytoplasmic membrane bound vacuoles that degrade macromolecules. Lysosomes contain over 50 soluble hydrolytic enzymes including proteases, lipases, nucleases, glycosidase , phospholipases, p hosphatases and sulfatases that have a maximal activity

PAGE 24

24 at low pH within the vacuole that degrade proteins, lipids and organelles (71) . Cathepsins are a family of proteases with over 11 members that localized to the lumen of the lysosome (73) but recent reports have observed cathepsins in the cytosol during hepatic stressors such as I/R and acetaminophen toxicity (74;75) . Cathepsins are divided into three groups based on structu re and catalytic type: serine (cathepsins A and G), aspartyl (cathepsins D and E) and cysteine (c athepsin B, C, F, H, K, L, O, S, W and Z) (73) . Cathepsin activity is optimal under aci dic conditions (pH 5 5.5) within the lysosome, however cathepsins B and D are stable at physiological pH with cathepsins D protease s activity at 42% (76;77) . Lysosomal leakage and rupture ha s been proposed to release hydrolytic enzymes into the cytoplasm after oxidative stress and I/R (78 80) . During I/R, pharmacological inhibition of cathepsins reduces cerebral I/R injury (81 83) . During liver ischemia, hepatic lysosomal rupture is an event that proceeds the MPT onset (52) , which may be mediated by calpain activation and mitochond rial dysfunction. The mechanism for lysosomal destabilization during I/R remains unclear and controversial w ith proposed mechanisms being (A ) ROS induced lipid peroxidation (71) , (B ) increased cytosolic Ca 2+ concentrations that activate phospholipase A2, sphingomyelinase and phospholipase C to generate lipid metabolites (84) and (C ) calpain mediated cleavage of lysos omal associated membrane proteins that stabilize the membrane (72) . S everal studies have sho wn that cathepsins translocat e into the cytosol during I/R (71;73;76;83) , lending calpain mediated lys osomal membrane permeability an area of research that requires more investigation. Surgical A n d Pharmacological Strategies T o Suppress Liver I/R I njury During liver resection, inflow occlusion is often performed to minimized blood loss. Different methods of inflow occlusion include continuo us or intermittent Pringle

PAGE 25

25 m aneuver s , segmental clamping, and total hepatic vascular exclusion. Each method is u n iquely different, however the common factor is vasculature clam ping that exposes the liver to an I/R event. In addition, liver transplantation surgery requires explant hepatectomy prior to implant of the donor liver, which subjects the liver to warm ischemia that can damage hepatocytes, hence the importance to develop protective strategies against liver I/R injury (85) . Hypothermia has been used for decades to decrease I/R injury during liver transplantation, however the role of hypothermia in I/R injury during partial hepatectomy has not been well established (9;85) . The only str ategy to reduce hepatic I/R injury is ischemic preconditioning (IPC) and intermittent clamping, however it is only beneficial for limited duration of ischemia (9;37;46;85;86) . IPC is the short and repeated exposure to ischemia followed by reperfusio n. The first human tri al of IPC was performed by Clavie n and showed beneficial effects using 10 minute periods of ischemia followed by 10 minutes of reperfusion by a decrease in aspartate aminotransferase (AST) and alanine aminotransferase (ALT) but no sig nificant change in the morbidity and mortality rate s (87;88) . IPC is a promising approach in seve ral different organs and animal models preventing I/R injury (18;85) , but some studies contradict these finding s (89) . IPC provides protection in several different ways including increasing ATP levels , regulating pH, balancing Na + and Ca 2+ , suppressing Kupffer cell activation, enhancing autophagy , and promoting synthesis of multiple stress response proteins (5;90;91) . The disadvantages of IPC are repetitive clamping induced vasculature damage and stress to the target organ (92) . F urthermore, IPC is not recommended for older patients

PAGE 26

26 undergoing liver resection, and more importantly the IPC provided benefits only minimally protect against warm hepatic I/R injury (93) . T herapeutics strategies to suppress liver I/R injury have included antioxidant therapy, steroids, Ca 2+ channel blockers, immunosuppressants, and protease inhibitors but demonstrated no evidence of clinical benefit (9;94) . Antioxidant therapies include N acetylcysteine, post ischemic glutathione administration, Sevoflurane, S adeno sylmethionine, Vitamin E and Trimetazadine. Administration of these drugs is targeted toward reperfusion induced ROS production by increasing antioxidant enzymes and metabolites including Superoxide dismutase and glutathione levels (94) . Studies using these agents have either not made it to clinical trials or failed to provide protection against liver I/R injury (94) . Prednisolone, a glucocorticoid steroid, and immunosuppressants target the cytokin e response during the intermediate and late phases of I/R injury (94;95) . Ca 2+ channel blockers (CCB) is another strategy to reduced liver I/R injury by targeting the Ca 2+ imbalance that o ccurs during I/R. CCB has been studied i n experimental models but clinical data is absent (94;96;97) . Protease inhibition is focused on suppressing the activation of catalytic enzymes that are activated dur ing I/R such as cathepsins and c alpains (50;51;67 69) . Altogether, these cu rrent therapeutic strategies to prevent liver I/R injury remain ineffective. The multifactorial nature and complexity of liver I/R injury cr eates a significant therapeutic challenge for targeting a spe cific mechanism to convey protection , thus new strategies are required . Autophagy Autophagy is a conserved lysosome depend ent catabolic process that eliminates protein aggregates and damaged organelles (98) . Autophagy was first described in 1963 by Christian de Duve and is defined as a cell self eating mechanism (99) . There

PAGE 27

27 are 3 different types of autophagy: c haperone mediated autophagy, microautophagy and m acroautophagy (Figure 1 5). Chaperone mediated autophagy is the selection of soluble cy tosolic proteins that are targeted to the lysosome and directly translocate across the lysosomal membrane for degradation (100) . Microautophagy involves the direct engulfment of cytoplasmic cargo by the lysosom e (101) . Macroautophagy is the focus of this study and referred to as Autophagy hereafter . Autophagy is a sequentia l process that begins with the initiation and formation of an autophagosome, a double membrane vacuole, which sequesters cargo for transported to the lysosome for fusion and degradation (Figure 1 5) . Canonical autophagy relies on the recruitment of multiple autophagy related protein (ATG) complexes on to a cup shaped membrane asse mbly site termed the phagophore. N on canonical autophagy is poorly understood but involves the formation of autophagosome independent of some ATG proteins (102) . Autophagy ca n be a selective or non selective process for sequestering cargo . Selective a utophagy can include the removal of spe cific proteins and organelles: peroxisomes (p exophagy) (103) , mitochondria (m itophagy) (104) , ribosomes (r ibophagy) (105) , endoplasmic reticulum (reticulo phagy) (106) , and nucleus derived material (n ucleophagy) (107) , while the re is no current evidence for the golgi apparatus (g olgi phagy) (108) . Autophagy maintains cellular homeostasis and normal physiology the orchestration of several proteins at the different stages of autophagy : initiation, autop hagosomal maturation, and lysosomal fusion. Autophagy Initiation Autophagy occurs at a b asal rate in most cells to maintain homeostasis (109) , or can be stimulate d in pathological and physiological states including starvation (98) . A utophagy is tightly regulated to establish homeostasis during stress for surviva l , whi le

PAGE 28

28 impaired regulation and hyper activation can lead to cell death (47;110) . The most studied autophagy in itiation mechanism s are the m ammalian target of rapamycin (mTOR), and adenosine monophosphate activated protein kinase (AMPK) pathways, which are stimulated by nutrient availability and cyclic adenosine monophosphate (cAMP) levels , respectively (98) (Figure 1 6 ) . These pathways can initiate autophagy by up regula ting transcript of autophagic gene s and the recruitment of the autophagic machinery to the phagophore site for autophagosome generation (98;111 113) . Nutrient and amino acid deprivation promote autophagy in a variety of cell type s , while fasting and caloric restriction promotes in vivo autophagy (114) . Nutrient rich conditions promote cell growth and prolif e ration through the p ho s phoinositide 3 kinase (PI3K) class I/Akt pathway, which in turn actives mTOR , a serine/threonine protein kinase, leading to autophagy inhibition (112) . Deprivation of growth factors, insulin or amino acids converges at mTOR to initiate autophagy (114) . The upstream signals leading to mTOR inhibiti on and autophagy initiation is d ependent on method of deprivation (112) . Two different mTOR complexes (mTORC) are found in mammalian cells: mTORC 1 and mTORC2 (114 116) . Akt phosphorylation regulates mTORC1 and mTORC2 through raptor and rictor, respectively (11 2;114;116) . Inhibition of either mTORC can lead to enhanced autophagy . Inhibitio n of mTORC2 is involved in FOXO 3A transcription of autophagy gene s , while mTORC1 inhibition leads to a de phosphorylation of transcription factor EB (TFEB ) , UNC 51 like kinase (ULK1 /2 ) and ATG 13. mTOR C1 inhibition facilitates ( A ) nuclear localization of TFEB, a master regulator for lysosomal biogenesis and autophagy gene transcription (111) and (B ) ULK1/2 autophosphorylation, which in turn phosphorylates ATG13 and FIP200 (117) .

PAGE 29

29 Th e ULK ATG 13 FIP200 complex localizes on phagophores during the early nucleation process of the autophagosome (118) . The function and localization of ULK ATG13 FIP200 is suggested to be involved in the recruit ment of autophagic machinery for autophagosome generation , and to activate Beclin 1 PI3K class III (PI3KIII) complex es for phosphatidylinositol 3 phosphate (PI3P) insertion into th e autophagosomal membrane (112;119) . AMPK signals autophagy initiation in the presence of low ATP and high cAMP levels during nutrient deprivation and hypoxia (120) . AMPK can initiate autophagy through mTOR inhibition dependent and independent mechanisms. mTOR inhibition dependent mechanisms include AMPK mediated phosp horylation of A ) the raptor subunit at Ser 722 and Ser 792 leadi ng to mTORC1 binding to 14 3 3 , which in turn suppresses kinase activity , or B ) Tuberous Sclerosis Co mplex 2 ( TSC2 ) at Ser 1387 that inhibits Rheb, an upstream mTOR activator (121) . mTOR independent autophagy initiation occurs by AMPK mediated phosphorylat ion of ULK1 and Beclin 1 to promote autophagy (122;123) . The B eclin PI3KIII complex is another mechanism that can regulate autophagy . The PI3KIII complex contains the vacuolar protein sorting 34 ( VPS 34) protein , and p150 that anch ors the complex to membranes via a myris to y l ation on the N terminus (124) . VPS34 is a class III lipid kinase that catalyzes phosphatidylinositol (PI) to PI3P for vesicle trafficking (125) . PI 3 P insertion in the autophagosomal membrane leads to membrane curvature and recruitment of proteins containing a PI3P binding domain (126) . VPS 34 has a variety of cellular function s including retrograde trafficking from endosomes to the Golgi, and phagosome maturation (125) . Becl in 1, the mammalian

PAGE 30

30 homolog of ATG 6, can form a complex with VPS 34 and recruit additional autophagy proteins such as Rubicon, Ambra 1, ATG 14L, and UVRAG that le ad to the regulation of PI3P sy nthesis (123) . Furthermore, Bcl 2 can compete against VPS34 for the Beclin 1 binding site s to inhibit autophagy (127) . ATG 14L, named barkor, recruits the Beclin PI3KIII complex to the ER for au tophagy initiation (126) . UVRAG is another protein that stimulates the complex activation, but competes with ATG 14L for the coil coil domain of Beclin 1 (124;128) . UVRAG Beclin PI3KIII complexes function in both autophagosomal formation and maturation (124) . Ambra1 is activated by ULK phosphorylation and binds to the Beclin PI3KIII complex for d ynein motor complexes assembly for translocation to the ER duri ng autophagy initiation (129) . Rubicon inhibit s the production of PI3P by binding to UVRAG and VPS 34 to prevent PI3P synthesis (124;130) . Autophagosomal Membrane Elongation A nd M aturation Autophagosomes are double bilayer membrane vacuoles with a diameter of 300 900 nm that sequester cellular components (98) . The production of autophagosomes is through several different ATG proteins and the Beclin PI3KIII complex (98) . After autophagy initiation, autoph agosomal elongation proteins ( ATG 4B, ATG 7, ATG 3, ATG 10, ATG 12, ATG 5 , and ATG 16 ) are recruited to a phagophore assembly site (131) . Autophagosomal generation can occur at several sites including the ER, mitochondrial outer membrane, and Golgi apparatus (98) . M icrotubule associated protein 1 light chain 3 (LC3) has an essential role in autophagy for membrane elongation, recruitment of adaptor proteins, and fusion (109) . Among the 4 different isoforms , LC3A, LC3B, GATE 16 and GABARAP, LC3B is the most widely used for studying autophagy (132) . The a utophagy machinery is recruited to the phagopho re assembly site to process the cytosolic LC3 (pro LC3) into a membrane bound LC3 (LC3 II) , which is located on the

PAGE 31

31 inner and ou ter membrane s of the autophagosome (Figure 1 7) (109) . LC3 is found in 3 forms within a cell: pro LC3, LC3 I and LC3 II. In cells, LC3 II is bound to the me mbrane of maturing autophagic vacuoles through two ubiqu itin like systems, ATG 8 and ATG 12 (133) . In both systems , ATG 7 acts as the E1 like activating enzyme, while the E2 lik e conjugating enzyme s differs: ATG 3 for ATG 8 and ATG 10 for ATG 12. LC3 i s expresse d as a precursor and is clea ved by the cysteine protease ATG 4 B , which removes the C terminal arginine to expose a glycine residue prior to lipidation (134) . The glycine is primed by ATP hydrolysis and ATG 7 to form acyl adenylated LC3 known as LC3 I (134) . The acyl aden ylation is then attacked by a thiol group from an interna l cysteine residue of ATG 7 to establish a thioester bond between the glycine a nd cysteine residues (133;134) . In the ATG 12 system, the thioester bond is transferred to an internal cysteine residue in ATG 10 or ATG 3 in the ATG 8 system (135;136) . ATG 1 0 acts as the conjugating enzyme to target ATG 5. The final transfer of ATG 12 to ATG 5 establishes a n isopeptide bond be tween a glycine residue of ATG 12 and a n internal lysine residue on ATG 5 (133) . The ATG 12 ATG 5 conjugate associate s with ATG 16 thro ugh the N terminal domain of ATG 5 and acts as a n E3 like ligase for LC3 I and p hosphotidylethanolamine (PE) in the membrane t o generate the lipidated LC3 known as LC3 II (137) . Lysosomal Degr adation M ature autophagosomes fuse with lysosomes for degradation. The hydrolytic nature of the lysosome was previous ly described . To facilitate membrane tethering autophagosomes often utilize Rab proteins to mediate autophagosomal lysosomal fusion (138) . Rab s are Ras like GTPases th at localize on the m embrane of specific cellular compartments and are ideal candidates for the regulation of membrane fusion.

PAGE 32

32 Specifically, Rab7 has been shown to play a role in autophagosome lysosome fusion through to its ability to interact with the FYCO1, which contains a FYVE domain to bind PI3P to facilitate fusion (139) . Furthermore, UVRAG Beclin PI3KIII complex can interact with the class C vacuolar protein sorting complex and enhance Rab7 facilitated fusion ( 140) . Several studies are currently focused on the identification of Rab proteins in volved in autophagy; while a d etailed molecular mechanism remains unclear, thus intensive studies are required for fully understand ing the role of Rab proteins in membra ne fusion (139) . Vesicular membr ane tethering is mediated by soluble N ethylmaleimide sensitive fusion factors (SNARES) , which are transmembrane proteins that can assemble into high affinity trans complexes between two opposing membranes to drive the fusion process (140;141) . M embrane tethering occurs through the formation of a four helix bundle, which is composed of three Q SNARES and one R SNARE. Vesicular associated m embrane protein 7 (VAMP), VAMP8 and Vti1 are SNARE proteins that mediate d lysosomal fusion with autophagosomes (140) . Mitochondrial Autophagy (M itophagy) M itoc hondrial autophagy, known as mitophagy, is the only known mechanism to remove damaged o r dysfunctional mitochondria. Autophagy regulates mitochondrial turnover, which occurs every 15 to 25 days (142) . The impairment of mitophagy can re sult in the accumulation of abnormal or damaged mitochondria, which in turn causes uncontrolled ROS production (143) . Mitophagy can be divided into three different types: Type I, Type II and Type III (104) . The molecular and biochemical differences between these types require further investigations . Type I occur s at the phagophore assembly site and requires PI3KIII signaling, Type II requires mitochondrial depolarization followed by LC3 accumulation on the mitoc hondrial surface, and Type III is called

PAGE 33

33 micromitophagy which involves the formation of mitochondria derived vesicles (MDVs) enriched in oxidized mitochondrial proteins that bud off an d transit into multivesicular bodies (104) . Overall, Type I and Type II mitophagy can engulf an entire mitochondrion for removal, while Type III is a type of quality control mec hanism to selectively remove damaged and oxidized mitochondrial components (104) . S everal proteins have b een identified to induce mitochondrial autophagy. Two of the earliest mammalian molecules identified were PTEN induced putative kinase protein 1 ( PINK1 ) and PARKIN in neuronal cells in the substant i a nigra (144;145) . PINK1 translocates to the m itochondria and is cleaved by the mitochondrial serine protease presenilin associated rhomboid like protein (PARL) in polarized mitochondria (1 46) . The PA RL activity and the cleavage of PINK1 are impaired in depolarized mitochondria leading to full length PINK 1 translocation to the outer mitochondrial membrane. Full length PINK1 can bind to Becl in 1 and recruits Parkin , a n E3 u biquitin ligase, for outer mitochondrial membrane protein ubiquitination that facilitates selective mitochondrial autophagy (147;148) . Transcription factor p62 can act as a linker protein to bind autophagic cargo and autophagosomes through ubiquitin and LC3 binding domains , respectively (149) . Recently, p62 has been shown to recogniz e dysfunc ti onal mitochondria through Parkin induced VDAC ubiquitination on the outer mitochondrial membrane, however the role of p62 in mitochondrial autophagy is unclear (150;151) . M itochondrial receptor s BNIP3 / NIX or FUNDC1 may also be involved in mitochondrial autophagy (152) . Bcl 2/adenovirus E B 19 kDA interacting protein 3 ( BNIP3 ) and FUNDC1 induces autophagy by binding to LC3 through a WXXL motif to remove

PAGE 34

34 mitochondria (152 154) . Several more investigations are required to fully clarify the protein mechanisms and types of mitophagy within mammalian cells. Autophagy Suppresses Liver I/R I njury A novel approach to circumvent liver I/R injury is to en hance autophagy , which in turn remove s the damaged mitochondria that cause hepatocyte death and liver dysfunction (47) . Liver I/R leads to the accumulati on of dysfun ctional mitochondria undergoing the MPT onset , which cannot be remove d due to an impaired autophagic response (51 53) . Autophagy allows for the removal of the se damaged mitochondria , the repleni sh ment of amino acids into the cytosol and the suppression of mitochondrial ROS ge neration . The first study investigating autophagy and I/R injury occurred i n 1981 using rat livers subjected to sixty minutes of ischemia (155) . The description of an im paired autophagic response w as observed and described as ivers contain autophagolysosomes with discontinuous membranes and a decreased intravascular electron density (155) . In 1983, rats treat ed with leupeptin and pepstatin ( lysosome protease inhibitors) diminished the hepatic damaged caused by 20 minute of ischemi a providing evidence that lysosomal autophagy may have a role in I/R injury (156) . In 1992, the first I/R induced hepatic a utophagic response was proposed in a hepatocytes w as describes as vesicular bodies with unchanged cytoplasmic regions and organelles (157) , an autophagoso me . At this point , the detailed biochemical mechanisms causing autophagy were still limited with primary studies using imagining techniques. A slew o f autophagy papers detailing biochemical measures and molecules to regulated autophagy were published betwe en 1998 2004 (106;133;135;137;158) . In 2008, a utophagy was shown to suppress I/R inju r y leading to the first postulation that targeting autophagy could be used as a cytoprotective mechanism against warm liver I/R injury

PAGE 35

35 (47) . Since 2008, autophagy stimulation has been shown to be a cytoprotective mechanism to circumvent warm I/R injury through several different approaches : pharmacological ( cisplatin (159) , carbamazepine (50) , and lithium (160) ), surgical ( IPC (161 163) ), and nutritional (Fasting (164) ). Sirtuin s Histone deacetylases ( HDACs) are a class of enzymes that modify proteins by removing an acetyl group (O=C CH3) from a n N lysine residue . HDACs are sub divided into classes based on their sequence homology to the original yeast enzymes and domain organization: Class I, Class I I, Class III, and Class IV. Silent mating ty pe information regulation 2 ( SIR2 ) genes are the yeast homolog for the mammalian sirtuin proteins . Sirtuins are class III HDACs dependent on NAD + for enzymatic activity (165;166) . Sirtuin s are involved in regulating several cellular process es including transcription, mitochondrial biogenesis, oxidative phosphorylation, and autophagy (167;168) . There are seven different isoforms of sirtuin s (SIRT1 7) that localize to different subcellular compartments , but each contain a cons erved NAD + deacetylase domain; however not all sirtuin s perform prot ein deacetylation (Table 1 3 ). The highly divergent amino and carboxyl terminal sequences are involved in substrate recognition of each sirtuin isoform , and play a role in enzyme activity (168) . Sirtuin s are suggested to be metabolic sensor y enzymes that can regulate metabolism with their activation based on the NAD + levels (167 170) . Currently, s irtuin s are being studied for their therapeutic potential in sev eral differen t dise ases including cancer, neurodegeneration, cardiovascular disease, diabetes and obesity .

PAGE 36

36 Sirtuin Enzymatic Activity In 1984 , SIR2 genes were f irst identified in as genes involv ed in the regulation of mating types in budding yeast, Saccharomyces cerevisiae (171) . Over two decades pass ed until the enzymatic a ctivity of SIR2 proteins was demonstrated to catalyze a pyridine nucleotide transfer reaction in both bacteria and mammals by a report showing the transfer of 32 P from 32 P NAD to bovine serum albumin (165) . This proposed the first important role of SIR2 as a n ADP ribosyltransferase (165;172) . Next, SIR2 deacetylase activity was identified as evolutionar ily conversed and uniquely dependent on NAD + to establish chromatin silencing structures i n vivo by hi stone 4 deacetylation (173) . Early studies demonstrated that e xtra copies of SIR2 genes increased lifespan in simple organisms (174 176) , while d ecreasing SIR2 blocked the caloric restriction induced lifespan extensio n (176) . Today , mammalian sirtuin s are known to play a key role in regulat ing several mechanisms including autophagy, mitochondrial biogenesis, and oxidation during caloric restriction and aging (177;178) . Sirtuin s are unique among other HDACs enzymes due to their insensitivity to the potent HDAC inhibi tor , Trichostatin A, and requirement for NAD + as a cosubstrate (168;179;180) . The s irtuin c onserved catalyti c domain can contain up to 270 amino acid residues and form a reverse Rossmann fold , and zinc ribbon (181;182) . The Rossman n fold bi nds to the phosphate and two ribose groups of NAD + , while t he zinc ribbon utilizes a zinc atom to stabilize two cysteine residues within the conserved catalytic domain of the sirtuin (168) . To catalyze dea cetylation, sirtuin s require an acetylated lysine substrat e to bind within a cleft adjacent to the Rossmann fold , thus form ing a ternary complex to facilitate a conformational change that internalize the acetyl lysine residue

PAGE 37

37 and promotes NAD + binding (168) ( Figure 1 8) . Sirtuin s cleave a glycosidic bond to separate nicotinamide and the ribose mo ieties of NAD + to form nicotinamide and an enzyme ADP ribose intermediate (183) . Sirtuin s transfer the acetyl group to an ADP O acetyl ADP ribose and a deacetylated substrate (184) . Finally, O acetyl ADP ribose, and the deacetylated substrate are released. Sirtuin Regulated Liver Function s Sirtuin 1 SIRT1 , the most studied sirtuin , is localized to the cytosol and the nucleus for deacetylation of his tone and non histone substrates (185) ( Table 1 3 ) . SIRT1 is a pleotropic protein involved in regulating circadian rhythms (186 188) , autophagy (164;189 192) , gluconeogenesis (193;194) , fatty acid oxidation (193;195) , mitochondrial biogenesis (193;196;197) , cell proliferation (198;19 9) and antioxidant defense (190) . SIRT1 null and catalytic domain depleted transgenic mice were embryonic and post natal lethal demonstrating the essential nature of SIRT1 activity (200) . SIRT1 studies are rapidly accelerating as potential therapeutic s in muscle, liver, brain, kidney, heart, and lung disea ses , as well as aging, diabetes and cancer ( 194; 195 ) . SIRT1 substrate deacetylation and metabolic reg ulation is tissue specific, we are focusing on the SIRT1 mechanism s that regulate liver functions . In the liver, SIRT1 regulates gene transcription for g luconeogenes is and fatty acid oxidation through deacetylation of multiple transcription factors: peroxisome proliferator activated receptor coactivator 1 PGC 1 ) (194) , CREB regulated transcripti on coactivator 2 (CRTC2) (201) , Forkhead transcription factor s (FOX O ) (202) , fibroblast growth factor (FGF21) (203) and signal transducer and activator of transcription (STAT3) (204) . Cholesterol levels are positively regulated by SIRT1 by the

PAGE 38

38 liver X receptor (LXR a nuclear receptor, for lipid homeostasis (205) . Deacetylation of LXR activates gene transcription of ABCA1 that mediates high density lipoprotein ( HDL ) synthesis and HDL reverse cholesterol tra nsport (206) . D eacetylation of sterol regulatory element b inding protein (SREBP 1) leads to an increased lipid metabolism in mice exposed to ethanol (207) . SIRT1 regula tes several different cellular metabolic pathways, hence SIRT1 investigations for therapeutic potential in several liver diseases including alcoholic and nonalcoholic induced fatty liver diseases , hep atocellular carcinoma, cirrhosis, diabetes, and I/R inju ry. Sirtuin 3 and Sirtuin 5 SIRT3 is an NAD + dependent deacetylase that is localized to the mitochondria and nucleus (208;209) . SIRT3 is the key regulator for energy homeostasis through mitochondrial protein de acetylation that regulate s ATP production, and oxidation (208;210) . Circadian oscillations in mitochondrial NAD + regulate SIRT3 activity to modulate the mitochondrial oxidative enzymes and respiration (211) . SIRT3 plays a key role in mitochondrial ATP production by deacetylation of the NDUFA9 subunit of Complex 1 (212) . Furthermore, SIRT3 mediates hepatic mitochondrial ketone production by 3 hydroxy 3 methylglutraryl CoA 2 deacetylation, which is the rate limiting step in hydroxybutyrate synthesis, a ketone (213;214) . Pathological and physiological conditions can alter mitochondrial metabolism through SIRT3. Under basal conditions SIRT3 null mice do not appear phenotypically different, however fasting leads to an accumulation of triglycerides and fatty acid intermediates (215) . U nder these conditions , long chain acetyl coenzyme A dehydrogenase (LCAD) was identified a s a substrate of SIRT3 deacetylation (215) . Detoxification of acetaminophen metabolites occurs in the

PAGE 39

39 mitochondria through mitochondrial aldehyde dehydrogenase 2, which is a direct substrate of SIRT3 (216) . SIRT3 studies are rapidly accelerating and an exciting new area of research for potential therapeutics. SIRT5 is an NAD + dependent deacetylase that functions for protein deacetylation (217) , desuccinylation (218) , demalonylation (218) , and degluta r y lation (219) . SIRT5 is localized in the mitochondrial matrix (217) to regulate c arbamoyl phosphate synthase 1 (CPS1 ) activity (217 219) . CPS1 is the rate limiting enzyme for the urea cycle and ammonia clearance . Recently, a second function of SIRT5 has been proposed in the liver s , Urate oxidase (UOX) can bind to SIRT5 for deacetylation and activation to catalyze urate to allantoin during purine catabolism (220) . Several more studies are required to elaborate the role of SIRT5 in the liver mitochondrion. Other s irtuin s SIRT2, SIRT4, SIRT6 and SIRT7 are the least studied sirtuin s involv ing liver disea se s . SIRT2 is reported to be involved in tumor development for hepatocellular c arcinoma (HCC) . Up regulation of SIRT2 deacetylates glycogen synthase kinase 3 in HCC cell lines to advances tumor development , motility and invasiveness (221) . SIRT4 is up regulated in the li ver of rats fed a high fat diet and suggested to localize to the cytoplasm to lead to development of insulin resistance and fatty l iver disease (222) . I nterestingly, SIRT4 KO increases fatty acid oxidation through up regulating the function of SIRT1 suggesting SIRT4 is a negati ve endogenous regulator of SIRT1/PGC1 (223) . SIRT6 can down reg ulate glycolysis by interacting with the transcription factor hypoxia inducible factor 1 (HIF1 to suppress genes transcription (224) . SIRT6 de ficient mice develop hepatic steatosis and an increase in SIRT6 prevents liver

PAGE 40

40 dysfunction caused by hepatic s teatosis (225) . SIRT7 regulates lipid metabolism through toll like receptor 4 gene expression for fatty acid uptake (226) . Overexpression of SIRT7 promoters synthesis of ribosomal proteins by silencing gene expression and found to be involved in ER str e ss and fatty liver disease , however SIRT7 mechanistic data is unknown (227) . Endogenous A nd Exogenous Sirtuin 1 Regulators As SIRT1 is the most studied sirtuin , the regula tion mechanisms described here will focus on the investigations identifying the regulation of SIRT1 activity . SIRT1 binding affinity can be regulated by endogenous and exogenous factors (Figure 1 9) . Protein protein interactions, and post translational mod ifications are endogenous mechanism s that regulate SIRT1 activity. Active regulator of SIRT1 (AROS) is the only known SIRT1 activating protein to directly bind to SIRT1 between amino acids 114 217 for activation (228;229) , however the AROS SIRT1 enhanced deacetylation is controversial and may due to ex vivo conditions (230) . De leted in Breast Cancer 1 (DBC1) inhibits SIRT1 activity by binding to the catalytic domain (231) . Nutrient starvation leads to a decrease in DBC1 expression and elevated SIRT1 activity, whi le mice fed a high fat diet lead to elevations in DBC1 and impaired SIRT1 deace tylation leading to non alcoholic liver steatosis (232) . AMPK and PKA phosphorylate SIRT1 at Thr 344 to d issociate the DBC1 SIRT1 complex leading to SIRT1 activation and deacetylation of p53 without an elevation in NAD + levels (233 235) . SIRT1 phosphorylation regulates function (236) and several other kinases are involved in phosphorylation of SIRT1 besides AMPK (233) and PKA (233) . Phosphorylation on S er 27, 7 4 and T hr 530 by c Jun N terminal kinase 1 (JNK1) increases nuclear localization of SIRT1 and enzymatic activity (237) , while JNK2 phosphorylation

PAGE 41

41 on S er 47 lead s to protein degradation (238) suggesting that additiona l mechanisms may play a role in regulating JNK/SIRT1 pathway. Dual specificity tyrosine phosphorylated and regulated kinase ( DYRK ) phosphorylates T hr 522 to enhance the release of nicotinamide and the deacetylated substrate to increase enzymatic turnover (239) . Protein kinase CK2 phosp horylates Ser 659 an d Ser 661 , however no cellular alterations were reported (240;241) . Cyclin dependent kinases ( Cdk ) can phosphorylate Ser 540 and T hr 530 , which is linked to a r epressed SIRT1 a ctivity and inhibition of cell proliferation (236) . Other conserved phosphorylation sites shown with no mechanistic data are S er 173 , T hr 544 , T hr 719 and Thr 747 (236) . Sumoylation is a reversible post translational modification in proteins termed small ubiquitin related modifiers (SUMOs) and are covalently linked to lysine residues. Rat and h uman SIRT1 contains a s umolyatio n at Lys 734 , whic h is not conserved in mice (242) . Sumo SIRT1 occurs at Lys 379 and increases SIRT1 activity and nuclear localizat ion undergoing oxidative stress in mouse cardiac tissue (242;243) . Mouse liver studies ha ve not yet characterized a sumolyation site on SIRT1. Pharmacological activation of SIRT1 can be achieved through s mall allosteric ac tivators, which have been used in several different models (244 246) . The first SIRT1 activator discovered was Resveratrol (RSV) , a plant polyphe nol , found in red wine (247) . The direct effects of RSV with SIRT1 in vitro have been a controversial topic . S tudies show that RSV inhibits phosphodiesterases to provide changes in cellular metabolism i n addition to enhancing NADH dehyd rogenase (Complex I) activity to increase mitochondrial oxidative phosphorylation (248 250) . Since the discovery of RSV additional compounds have been synthesized to improve t he specificity for SIRT1 with

PAGE 42

42 lower K m and higher EC 50 for the SIRT1 substrates including SRT1720 (251) . A single amino acid residue Glu 230 located on the N terminal of SIRT1 is criti cal for all SIRT1 activating compounds (STACs) (251) . Sirt ino l is a general sirtuin inhibitor has a human SIRT1 IC 50 = 60 M, while human SIRT2 IC 50 = 48 M implicating that Sirtinol induced effects may not be exclusively related to SIRT1 (252) . Ex527 is a more specific sirtuin inhibitor with h uman SIRT1 IC 50 = 0.38 M and human SIRT2 at IC 50 = 32.6 M (253) . Furthermore, docking analysis predicts Sirtinol and Ex527 bind to the catalytic domain of SIRT1, but Sirtinol docks to both SIRT1 and SIRT2, while Ex527 binds to SIRT1 alone (253) . MicroRNAs hav e also been suggested to inhibit SIRT1 activity an d expression (254;255) . Activation O f SIRT 1 Induces Autophagy Early evidence supporting the role of sirtuin s in autophagy was the observa tion that SIR2 gene products tight ly regulated caloric res triction induced life extension (176;256) . In the following years, SIRT1 was proposed to regulate multiple steps in the autophagic process. SIRT1 induced autophagy was first proposed by Toren Finkel (18 9) by using S IRT1 null MEF cells demonstrating that SIRT1 was essential for autophagy under both basal and nutrient deprivation conditions to enhance autophagosome generation (189) . Next, caloric restricted mice displayed c ytoprotection against I/R injury in the heart and kidney, which were mediated by SIRT1 deacetylation of FOXO1 and FOXO3A to increase Rab7 (257 259) and Bnip3 expression (260) , respectively . To explore pharmacological avenues , HCT116 and PC3 II cell lines treated with RSV induced autophagy in an SIRT1 dependent manner through AMPK (261;262) . Taken together these initial studies, provided ample evidence to su pport the role of SIRT1 in

PAGE 43

43 autophagy, henceforth numerous cell lines and tissue types have shown SIRT 1 induce d autophagy, however the mechanism s remain unclear . The importance of SIRT1 and autophagy was noted by SIRT1 homozygote knock out mice bearing a r esemblance to ATG 5 knock out mice (263) , which is probably related to the prenatal mortality (200) . SIRT1 activity modulates autophagy by two proposed mechanism (A ) enhancing gene expression and (B ) directly interacting with components of the autophagy machinery. The nuclear/cytosolic localizat ion of SIRT1 can account for either mechanism to stimulate autophagy (185) . FOXO family transcription factors are the main focus for the SIRT1 ind uced autophagy th rough FOXO1 regulation of Rab7 (190) , and FOXO3A up regulation of ULK, Beclin1, VPS34, BNIP3, ATG 12, ATG 4B, and LC3 (264) . Another transcription factor target of SIRT1 is p53, which has dual roles in autophagy regulation based on localization: nuclear p53 activates autophagy and cytosolic p53 inhibits autophagy (265) . SIRT1 deacetylation of p53 block s nuclear translocation during oxidative stress (266) . ATG 7, ATG 8 and ATG 5 have been shown to be direct targets for deacetylation by SIRT1 that function in the cytosol (189) . Indeed, even a mutated SIRT1 restricted to the cytosol stimulated autophagy (261) . Acetylation is beginning to become a new area of research involved in canonical and non canonical autophagy regulation (267;268) . Specifically, mitochondrial acetylation is involved in the mitophagy mechanism (269) . Knock out of GCN5L , a mitochondrial acetyl transferase, diminishes mitochondrial protein acetylat ion and accumulates LC3 and p62 onto the mitochondria for canonical mitophagy independent of Parkin (269;270) . GCN5L KO cells are able to sustain mitochondrial contain through

PAGE 44

44 PGC 1 transcription, but enhance mitophagy by activating TFEB in a manner independent of mTOR (271) . While the involvement of SIRT1 within this pathway is unknown, several studies support that SIRT1 may have a role in regulating this pathway. SIRT1 regulates cellular mitochondrial content is at least in part due to the deacetylation of PGC 1 by increasing the transcription of genes involved in mitochondrial biogenesis (193;194;196;197) , and autophagy (190;272 274) . Additionally, w ithin th e nucleus, GCN5 counteracts SIRT1 deacetylation of PGC 1 in neurons (275;275) . While the role of GCN5L and SIRT1 induced mitophagy is unknown, it appears to be an exciting new area for future studies. Despite the extra mitochondrial localization of SIRT1, some reports have indica ted th at SIRT1 can localize with in the mitochondria (196;276) . Protein mitochondrial localization requires an N terminal mitochondrial targeting sequences (MTS) , and SIRT1 posses sing an MTS has not been shown . However, SIRT1 may localize to the mitochondria through protein protein interaction s on t he mitochondrial outer membrane. While role s of mit ochondrial SIRT1 remain unknown, SIRT3 has been shown to be the global regulation fo r mitochondrial acetylation (210) . However, SIRT3 is localized to the matrix and outer mitochondrial membrane proteins do not span across the inner and outer membranes suggesting that SIRT1 and other HDACs may regula te mitochondrial functions through outer membrane deacetylation events. SIRT1 A nd I/R I njury Multiple factors lead to I/R injury and targeting specific areas has been disappointing. The plei otropic nature of SIRT1 could have beneficial effects and be used as a therapeutic target to suppress I/R injury. Indeed, studies show that

PAGE 45

45 pharmacological, surgical and genetic approaches to stimulate SIRT1 mediate cytoprotection during I/R to the heart, lu ng, intestines, brain, and liver . As impaired autophagy is a maj or factor leading to I/R injury, o n e can speculate that SIRT1 may play a role in autophagy regulation during liver I/R injury. Indeed, t he enhancement of SIRT1 expression in transgenic mice was cytopro tective to myocardial I/R due to its up regulation of mit ochondrial antioxidants, and autophagy proteins (259) . SIRT1 overexpression als o enhanced autophagy by increasing lysosomal fusion, and formation of autophagosomes mediated by Rab7 expression (19 0) . In the kidney, caloric restriction increased mitochondrial autophagy through SIRT1 mediated Bnip3 expression (260;277) . In the liver, fasting enhance s SIRT1 induced autophagy to provide cytoprotection again st I/R injury (164) . Even the benefits of ischemic preconditioning are mediated through SIRT1 (278) . A utophagy plays an integral role in I/R injury, however how SIRT1 affects autophagy during liver I/R injury remains unknown . Therapeutic P o tential Of SIRT1 A nd Liver I/R I njury Liver I/R injury is a multifactorial phenomenon that contributes to mortality and morbidity of patients after liver resection surgery. SIRT1 is an appealing candidate, since been shown to regulate several cellular processes, such as the maintenance of energy homeostasis and cellular survival, which are also the main functions of autophagic degradation . Pharmacological activation of SIRT1 during liver resection surgery will provide a novel and unexplored avenue to treat I/R injury by up regulating endogenous protective me chanisms like autophagy.

PAGE 46

46 Figure 1 1 . Liver anatomy divide d into eight Couninaud segments . The eight different segments of the liver based on biliary, arterial and venous systems. Colorectal Cancer Association (2006) http://www.colorectal cancer.ca/en/treating cancer/treatment cancer/

PAGE 47

47 Figure 1 2 . Liver lobules have hepatic zonal differences within the liver. (A) Histological section of liver tissue to demonstrate the structure of liver lobules. (B) Animation s of a liver lobule and the zonal differences of a hepatic cord for a structural concept .

PAGE 48

48 Figure 1 3 . Mitochondrial permeability transition pore opening during reper fusion leads to mitochondria l rupture and hepatocyte death (A) T he main components of the mitochondrial permeability transition pore (VDAC, ANT and Cyclophilin D) localized in the mitochondria. (B) Upon reperfusion, an influx of calcium triggers the MPT on set and ROS generation leading to hepatocyte de ath. (C) Electron micrographs comparing mitochondria before and after I/R in hepatocytes, and an animation of the opening of the MPT pore leading to the swelling and rupturing of the mitochondria .

PAGE 49

49 Figure 1 4 . Accumulation of calcium leads to the MPT onset during I/R. (A) Sodium hydrogen exchanger (NHE) and sodium potassium ATPase (NKA) are two proteins involved in calcium homeostasis within the plasma membrane to maintain cytosolic ion balance . (B) Ischem ia leads to the accumulation of cytosolic calcium due to ATP depletion and inhibit ion of NKA leading to reversed activation of the sodium calcium exchanger ( NCE ) . (C) Reperfusion leads to mitochondrial repolarization that triggers the mitochondrial calcium accumulation through the calcium uniporter (CU) . (D) Calcium in the mitochondria activates cyclophilin D to open the MPT pore that in turn leads to infl ux of solutes into the matrix causing the mitochondria to depolarize, swell and rupture .

PAGE 50

50 Figure 1 5 . The three different types of autophag y are c haperone mediated autophagy, microautophagy and macroautophagy. (A) Chaperone mediated autophagy uses the HSC70 complex or HSP90 to recognize misfolded proteins using the KFERQ seque nce. The complex es local ize and translocate a misfolded protein into the lysosome for degradation. (B) Microautophagy is the invagination of the lys osomal membrane for degradation . (C) Macroautophagy is a sequential process that begins with the initiation sig nal that elongates th e phagophores membrane to form a mature autophagosome. Autophagosomes carrying cargo fuse with lysosomes to form an autolysosome that degr ades proteins, and organelles for metabolite release back into the cytosol.

PAGE 51

51 Figure 1 6 . Autophagy initiation can occur through mTOR inhibition and AMPK activation. Activation of mTOR from Akt phosphorylation inhibits the activation of the ULK1/2 complex and autophagy initiation . Nutrient and amino acid deprivation leads to mTOR inhibition and ULK1/2 activation that can (1) phosphorylate Beclin1 to release Bcl 2 family members which promote autophagy and insert phosphatidylinositol 3 phosphate (PI3P) into the autophagosome membrane , and (2) localize to the phagophore to recruit the autophagy el ongation protein machinery . F urthermore, inhibition of mTOR leads to the dephosphorylation of transcription factor EB for lysosomal and autophagy protein generation through gene expression. Another mechanism for autophagy ind uction is through a denosine mon ophosphate kinase (AMPK). AMPK senses changing ATP levels within the cell by monitoring cAMP levels. AMPK activation can lead to direct phosphorylation of Beclin 1, ULK1/2 complex, and mTOR to stimulate autophagy. Other factors that have been shown to play a role in autophagy are prote ins that can bind to the Beclin 1 PI3K III complex to drive or impair PI3P insertion into the autophagosomal membrane.

PAGE 52

52 Figure 1 7 . The ATG 8 and ATG 12 ubiquitin like systems process ProLC3 to LC3 II for insertion into the autophagosomal membrane. (A) The ATG 8 system begins with the cleavage of an arginine residue of ProLC3 to generate LC3 I , which binds to ATG 7 through a thioester bond that requires t he hydrolysis of ATP. ATG 7 is an E1 like ubiquitin activating enzymes in both the ATG 8 and ATG 12 systems. LC3 I is transferred to ATG 3 , which is the E2 ubiquitin like conjugating enzyme through another thioester bond. (B) The ATG 12 system utilizes ATG 10 as the E2 ubiquitin like conjugating enzyme through another thioester bond. Next, ATG 12 is bo u nd to ATG 5 through an isopeptide bon d to create the E3 ubiquitin like ligase for the insertion of LC I onto the autophagosomal membrane to create a n LC3 II protein that contains a phosphotidylethanolamine (PE) . ATG 16 oligomers bind with the ATG 5 ATG 12 complex to facilitate autophagosomal membrane ligation .

PAGE 53

53 Figure 1 8 . SIRT1 requires NAD + as a substrate for enzymatic activity. (A) Acetylated substrate is bound t o SIRT1 that induces a conformational change that facilitates NAD + binding. (B) SIRT1 catalyzes NAD + and an acetylated protein to produce nicotinamide, a deac e tylated protein , and O Acetyl ADP ribose (2`OAADPr) .

PAGE 54

54 Figure 1 9 . SIRT1 regulation can occur through post translational modification s and endogenous protein interactions . The SIRT1 amino acid sequence for SIRT1 includes two nuclear localization sequences (NLS), two nuclear export sequences (NES), and a conserved catalytic domain. Activator of SIR T1 (AROS) and Depletion in Breast Cancer 1 (DBC 1) are endo genous regulators of SIRT1 that can bind directly to the SIRT1 protein at the indicated sites. Post translation al modifications can regulate SIRT1 function and the individual amino acids involved i n both the human and mouse sequences are listed.

PAGE 55

55 Table 1 1. Liver composition by cell type Cell Type Volume (Percent) Cell number (Percent) Location Function Hepatocytes 80 60 65 Hepatic Cords Main metabolic cell Absorption and secretion Macromolecule synthesis Non Hepatocytes 6.3 30 40 Endothelial 2.8 15 20 Per sinusoidal Fluid and material exchange Kupffer 2.1 8 12 Sinus endothelium Phagocytosis, Discharge of signal substances, Clearance of toxins Ito 1.4 3 8 Space of Disse Synthesis extracellular matrix, Regulate microvascular tone, and s inus endothelium width PIT 0.4 0.1 Sinusoids and Space of Disse Remove foreign cells Biliary Epithelial 3.5 Biliary ducts Biligenesis

PAGE 56

56 Table 1 2. Hepatic zones have structural and functional differences within a liver lobule. Zone 1 Zone 3 Hepatocytes Hepatocytes Size Small Size Large Mitochondria Large Mitochondria Small Golgi membrane Golgi membrane Smooth ER Smooth ER Lysosomes Lysosomes Non Hepatocyte Non Hepatocyte Endothelial fenestration Endothelial fenestration Kupffer cell number Kupffer cell number Ito cell number Ito cell number PIT cells PIT cells Zonal Functions Gluconeogenesis Glycolysis Fatty acid oxidation Liponeogenesis Urea synthesis Glutamine synthesis Glutamine hydrolysis Glutamate transport Amino acid degradation Bile acid independent fraction Bile acid dependent fraction Glycogen synthesis from glucose Glycogen synthesis from lactate and amino acids Glycogen degradation from lactate Glycogen degradation Biotransformation Cholesterol synthesis Ketogenesis Citrate cycle Respiration chain reactions Pigment deposition Adapted from Kuntz, E. and Kuntz, H. D. 2006. Hepatology: Principles and Practice ( Chapter 3, page 33 ) Springer, Germany.

PAGE 57

57 Table 1 3 . Mammalian sirtuin isoforms and known activity, targets, and function Isoform Localization Activity Targets Functions SIRT1 Cytosol, Nucleus Deacetylation FOXO 1, FOXO3A, p53 , PGC 1 , ATG 7, ATG 12, ATG 8, SREBP 1c, CREB, Ku70,NF B ,LXR, and more Autophagy, Transcription, Mitochondrial Biogenesis, Cell cycle SIRT2 Cytosol Deacetylation FoxO1 , PEPCK, PAR3 Cell cy c le, Autophagy Tumorigenesis SIRT3 Cytosol , Nucleus , Mitochondria Deacetylation Cyclophilin D , LCAD, GDH, IDH2,Complex I, and more Bioenergetics Autophagy, MPT onset SIRT4 Mitochondria ADP R ibosyl ation GDH Insulin secretion SIRT5 Mitochondria Deacetylation, Demalonylation , Desuccinylation, Deglutylation CPS1 Urea cycle SIRT6 Nucle us Deacetyla tion , ADP ribosylation H3K9, H3K56 DNA repair SIRT7 Nucleus unknown U nknown rDNA transcription

PAGE 58

58 CHAPTER 2 LIVER ISCHEMIA/REPERFUSION CAUSES THE DEPLETION OF SIRTUIN 1 AND HEPATOCELLULAR DEATH Introduction Hepatectomy is the operative removal of the liver, which can be partial for a resection or more 90% for major liver surgery. Partial and major liver surgery often subjects the liver to ischemia/reperfusion (I/R) due to vasculature clamping. In addition, th e explant of the donor liver during transplantation encounters a severe I/R injury Liver I/R injury is a major factor leading to liver dysfunction and patient mortality after surgery. Current therapeutics and surgical approaches to circumvent I/R injury ar e finite or ineffective. Sirtuins are class III histone deacetylases with non histone targets. Sirtuin 1 (SIRT1) has been proposed to mediate cytoprotection against nonhepatic I/R injury in mice and rats, however the role of SIRT1 during liver I/R injury r emains unclear. We hypothesize that the loss of SIRT1 during liver I/R is a contributing factor leading to hepatocyte death. Human tissue was collected from the transection margin before and after 15 minutes of inflow occlusion during a partial hepatectomy . Immunoblot analysis was used to determine SIRT1 expression. SIRT1 significantly reduced in tissue that underwent inflow occlusion. Next, we confirmed these changes in mouse livers and hepatocytes subjected to I/R. Furthermore, prolonged ischemia leads to the loss of SIRT1, which correlated with I/R induced hepatocyte death. Attempting to suppress the reduction, we identified that SIRT1 is depleted in a multifactorial manner during I/R, which involves cathepsins and calpains. Interestingly, partial suppres sion of SIRT1 through calpain inhibition suppressed hepatocyte death. These data suggest that the depletion of SIRT1 leads to hepatocyte death and SIRT1 may provide cytoprotection against liver I/R injury.

PAGE 59

59 Background Liver resection, or partial hepatectomy , is described as t he operative removal of a segment of the liver. Liver resections are performed as a treatment for various liver diseases including cancer, benign tumors and cystic disease. In addition, liver transplant patients undergo a complete remova l of the liver prior to donor implantation. During liver surgeries, no flow ischemia is often utilized to minimize intraoperative blood loss , which exposes the liver to an inevitable I/R event . Although prolonged ischemia eventually causes tissue injury, s evere damage paradoxically does not occur until reinstitution of blood flow and return to normal physiological pH, an event called reperfusion injury (9;15;279;280) . Current therapeutic approaches to circumvent I/R injury remain ineffective, thus new strategies are urgently requir ed to suppress liver damage due to I/R injury. Hepatocytes are the parenchymal cells of the liver and make up about 80% of the total liver by volume . During liver resection surgery, w arm I/R is the causative factor leading to hepatocyte damage and post ope rative liver failure (32;34;281) . Parenchymal cell damage leads to increase d patient morbidity and mortality following liver surgery (27) . The mechanisms underlying I/R injury are multifactorial with mitochondrial dysfunction as the major contributor to tissue death after I/R (59) . Upon reperfusion, the u nregulated opening of the mitochondr ial permeability transition (MPT ) pores leads to mitochondrial dysfunction and hepatocyte death. Sirtuin s are class III histone deacetylases that play an integral role in energy homeostasis, cell survival, longevity, an d autophagy (189;190;259) . Sirtuin l ocalization and activity are specific for each of the seven different isoforms . Ischemic preconditioning and caloric restriction convey beneficial effects that are mediated

PAGE 60

60 through SIRT1 to protect against liver I/R injury (164;278) . SIRT1 is a pleiotropic protein that regulate s mitochondrial bi ogenesi s, oxidative phosphorylation , and autophagy (194;197) . SIRT3, a mitochondrial matrix protein, regulates mitochondrial oxidative phosphorylatio n and reactive oxygen species generation (216;282 289) . In myocytes, SIRT3 mediated cyto protection against I/R injury by deacetylating cyclophilin D to block the unregulat ed opening of the MPT pores and prevent s mitochondrial dysfunction (290) . SIRT5 is a mitochondrial matrix protein that regu lates the urea cycle through c arb amoyl phosphate synthase (CPS1) (217;291) . An accumulation of ammonia in the blood stream occurs during liver dysfunction leading to hepatic encephalopathy (292;293) ; however the role of SIRT5 during liver I/R injury remains to be elucidated . Sirtuin s ha ve b een proposed as therapeutic target s for treating liver steatosis, alcoholic live r disease, obesity, and diabetes (194;203;294 296) , however little information links sirtuin function with hepatic I/R injury. The goal of the present investigation was to determine if hepatic I/R aff ect s sirtuins. Sirtuin expression was altered in human liver tissue after inflow occlusion. Next, we established in vivo and in vitro model s of liver I/R in a mouse and simulated I/R in primary hepatocyte s that would mimic the changes in sirtuin expression observed in patients undergoing partial hepatectomy . SIRT1 was shown to decrease during ischemia leading to reperfusion induced hepatocyte death , thus we attempted to identify the reduction mechanism using inhibitors for the proteasome, cathepsins and cal pains. The ischemic reduction of SIRT1 occurred through multiple proteases, but only calpain inhibition prevented the depletion of SIRT1 and hepatocyte death after prolonged ischemia followed by reperfusion. Collectively, this study supports that SIRT1 pla ys a

PAGE 61

61 key role in liver I/R injury and the ischemic depletion of SIRT1 leads to hepatocyte death in a manner dependent on calpains. Materials A nd Methods Human Liver Tissue Collection All human tissue was collected, stored and treated according to protocols approved by the Institutional Review Board at the University of Florida. Liver tissue from the transection margin was collected before and after 15 minutes of inflow occlusions and immediately flash frozen in liquid nitrogen . Immediately, ti ssue was homogenized on ice in r adioimmunoprecipitation b uffer (RIPA) for immunoblot with protease and phosphatase inhibitors. Mouse Liver In Vivo I/R All a nimals received humane care according t o protocols approved by the Institutional Care and Use Committee of the University of Florida . H epatic inflow occlusion was performed by clamping the portal triad for 45 minutes. Reperfusion was initiated by removing a microvascular clamp (297) . Liver biopsies fr om the left lateral lobe were collected during I/R and homogenized in RIPA buffer in the presence of protease and phosphatase inhibitors. Tamoxifen T reatment F or Inducible SIRT1 KO M ice SIRT1 KO m ice have a C57 BL/6 background and harbor a Cre ERT2 fusion protein consisting of Cre recombinase fused to a triple mutant form of the human estrogen receptor ; tory at Harvard University (298) . To induce SIRT1 knockout, 3 4 month old male mice containing a Cre ERT2 fusion protein were injected int rap eri toneally with 100 µl of T amoxifen dissolved in a sterile corn oil (40 mg/ml) at Day 0 and Day 3.

PAGE 62

62 Genotyping A nd RT PCR For genotyping, a n ear punch or tail snip was digested in Buffer A (50 mM NaOH, 0.2 mM EDTA) for 30 60 minutes at 95 C followed by a brief vortex. The sample was incubated at room temperature for 5 minutes prior to the addition of 100 L of buffer B (1M Tris pH 8.0). Samples were then centrifuged at 15,000 x g for 2 minutes to collect the debris followed by extraction of 2 L of the supernatant for RT PCR. mRNA was extract ed from 1 x 10 6 hepatocytes using 500 l Trizol (Invitrogen, Carlsbad, CA) followed by isopropanol precipitation. mRNA concentration s and purity were measured using an Eon spectrophotometer (Biotek instruments, Winooski, VT) with a Take3 micro volume plate (Biotek instruments, Winooski, VT). cDNA was synthesized using 2 g mRNA using the Invitrogen SuperScript III First Strand (Carlsbad, CA cat# 18080 051) using the random hexamer option. For RT PCR, cDNA (2 L) was used with 1 L of 100 nM primers for SIR T1 GCCCATTAAAGCAGT ATG SIRT1 C ATG TAATCTCAACCTTGAG actin GTGGGCCGCTCTAGGCACCAA actin CTCTTTG ATG TCACGCACGATTTC PCR was carried out using New England Bio Labs One Taq DNA Polymerase system (Ipswich, MA) using the Eppendorf MasterCycler 5333 Version 2 ( Hamburg, Germany ). cDNA was denatured for at 95 C for 5 minutes followed by 32 cycles of 95 C for 30 seconds, 55 C for 30 seconds and 72 C for 1 minute.

PAGE 63

63 Hepatocyte Isola tion A nd Culture Hepatocytes were isolated from 3 month old male C57BL/6 mice by collagenase perfusion method. Mice were given an intraperitoneal inj ection of ketamine (100 200 mg/k g) and xylazine (10 20 mg/kg). The abdominal cavity was opened followed by inferior vena cava can n ulation. Next, the portal vein was cut to allow the liver to decompress during perfusion. Finally, the suprahepatic vena cava was clamped to prevent flow to the heart. The liver was perfused with Buffer A (25 mmol/L HEPES, 115 mmol/L NaCl, 5 mmol/L KCl, 1.2 mmol/L MgSO 4 , 1 mmol/L KH 2 PO 4 , 0.5 mmol/L EGTA, 2 mmol/L MgSO 4 ) for 5 minutes prior to Buffer B (25 mmol/L HEPES, 115 mmol/L NaCl, 5 mmol/L KCl, 1 mmol/L KH 2 PO 4 , 0.09 mg/ml collagenase ) perfusion for 6 8 minutes at a flow rate of 4 ml/min. The last 2 minutes of perfusion with Buffer B was ac companied by a gentle massage to the liver. The liver was removed and hepatocytes were extracted by a gentle agitation in Buffer C (25 mmol/L HEPES, 115 mmol/L NaCl, 5 mmol/L KCl, 1.2 mmol/L MgSO 4 , 1 mmol/L KH 2 PO 4 , 10% Bovine Serum Albumin). After sequential centrifugation for cell purification, hepatocytes were seeded on precoated dishes and/or plates with 0.1% type 1 rat tail collagen. Only hepatocytes with viability of greater than 90%, as judg ed by trypan blue exclusion after isolation were used. Isolated hepatocytes were cultured in Waymouth medium MB 752/1 containing 2 mmol/L l glutamine, 27 mmol/L NaHCO3, 10% fetal calf serum, 100 nmol/L insulin, and 100 nmol/L dexamethasone. After 4 hours, isolated hepatocyte media was changed to remove dead and non adhered hepatocytes. Hepatocyte Simulated I/R Hepatocytes were incubated at 37°C in Krebs Ringer HEPES (KRH) buffer (25 mmol/L HEPES, 115 mmol/L NaCl, 5 mmol/L KCl, 1.2 mmol/L MgSO 4 , 1 mmol/L

PAGE 64

64 KH 2 PO 4 ) at pH 6.2 in an anaerobic chamber (Coy Laboratory Products, Ann Arbor, MI). To simulate reoxygenation and return to physiologic pH during reperfusion, anaerobic KRH at pH 6.2 was replaced with aerobic KRH at pH 7.4 (50;297;299) . Reagents A nd Drug Treatments E64d was purchased from Enzolife (Farmdale, NY, BML PL107 ). MG 132 was purchased from Fischer Scientific (Waltham, MA), and Acetyl Leucine Leucine Methionine (ALLM) was purchased from Calbiochem (Darmstadt, Germany) . Cells were treated with E64d and MG 132 for 1 hour before hepatocytes underwent I/R, while ALLM treatment was 12 hour before I/R. All inhibitors were continuously present during I/R. All other c hem icals were of analytical grade and obtained from Sigma Aldrich (St Louis, MO) . Immunoblot Lysates of hepatocytes were obtained using RIPA buffer (25 mmol/L Tris, 150 mmol/L NaCl, 1% Trition X 100, 1% Deoxycholate, 5 mM EDTA, 0.1% SDS containing protease and phosphatase inhibitor cocktails (Sigma Aldrich, St. Louis, MO). Tissue and whole cell lysate were used to analyze protein expression unless indicated. Antibodies actin were purchased from Si gma Chemical Co (St Louis, MO). The SIRT1 antibody was purchased from Millipore (Temecula, CA). The SIRT3 antibody for human samples was purchased from Cell Signaling Te chnology (Danvers, MA), while the mouse SIRT3 antibody was purchased from Santa Cruz (Santa Cruz, CA). SIRT5 was purchased from Abcam (Cambridge, MA ). Changes in protein expression were determined using Image J software (National Institutes of Health, Bethesda, MD).

PAGE 65

65 Cy tosolic A nd Nuclear Subfractionation Primary hepatocytes were subfractionated using Thermo Scientific NE PER Nuclear and Cytoplasmic Extraction Reagents (Rockford, IL) as the manufacturer recommended . Cell Death Assay Using Propidium Iodide Hepatocytes were seed ed in a 24 well plate (Falcon, Lincoln Park, NJ) at 1.5 x 10 5 cells per well and in cubated overnight in Waymouth media. Cells were incubated with 30 µM propidium iodide (Sigma Aldrich, St Louis, MO, P4170) in KRH pH 7.4 for 5 minutes prior to I/R. Cells were then incubated in 30 µM propidium iodide in KRH pH 6.2 during ischemia followed by reperfusion in 30 µM propid ium iodide in KRH pH 7.4. C ell death was determined after 2 hours of reperfusion by the addition of 20 µM d igitonin (Sigma Aldrich, St Louis, MO, D5628) . Necrosis at 5, 60, and 120 minutes of reperfusion was de termined using p ropidium iodide (50;53;57) . Data Analysis Differences between groups were compared using analysis of variance and post hoc Bonferroni anal ysis (SigmaStat, Ashburn, VA). P <0.05 denotes statistical significance. Data are expre ssed as means ± SE. All experiments are representative of at least 3 different cell isolations or animals per group. Results Ischemia Causes SIRT1 Deplet ion To investigate the changes in sirtuin s after ischemia, human liver biopsies were collected before and after inflow o cclusion induced ischemia . Ischemia alone decreased SIRT1 levels to 28 ± 15% of the control, while mitochondrial SIRT3 and SIRT5 did not decrease in human liver tissue (Figure 2 1 A ). To confirm these changes , mouse livers

PAGE 66

66 were subjected to in vivo I/R . Similar to the human samples, i schemia led to a significant reduction in SIRT1 that was not res tored during reperfusion, SIRT3 remained constant and SIRT5 levels increased after I/R (Fig ure 2 1B ). To determine if these changes were occurring in the parenchymal cells of the liver, i solated hepatocytes were subjected to simulated I/R to analyze SIRT1, SIRT3 and SIRT5 expression . SIRT1 decreased progressively during ischemia and was un detectable after 4 hours , while SIRT3 and SIRT5 increased during reperfusion after 4 hours of ischemia (Figure 2 1C ). Propidium iodide fluorometry showed that substa ntial necrosis during reperfusion occurred only after prolonged ischemia ( Figure 2 2A). To correlate SIRT1 expression with cell death, SIRT1 expression was determined with various periods of ischemia. S horter ischemi c times followed by reperfusion show ed that ischemia reduced SIRT1 . However, similar levels of SIRT1 were observed after reperfusion and hepatocytes remained viabl e ( Figure 2 2B ). SIRT1 localizes to the cytosol and nucleus (185) , therefore we analyzed changes in SIRT1 expression in the cytosolic and nuclear fractions during I/R. After 2 hours of ischemia, cytosolic SIRT1 was rapidly d egraded, while nuclear SIRT1 did not decrease until 4 hours of ischemia (Figure 2 2 C ) . Taken together these results show that I/R depletes SIRT1 , but not mitochondrial SIRT3 or SIRT5 in livers and hepatocytes. To further clarify an integral role of SIRT1 i n I/R injury, hepatocytes were isolated from Tamoxifen inducible SIRT1 knockout mice (SIRT1 KO) (a generous gift from Dr. Sinclair) (298) and subj ected to different times of I/R . While the hepatocytes from wild type (WT) mice well t olerated 2 h ours of ischemia and reperfusion, the cells from SIRT1 KO mice displa yed a n increase in reperfusion injury (Figure 2 3 ), showing a heightened

PAGE 67

67 vulnerability of SIRT1 null cells to sublethal I/R conditions . This observation was, indeed, anticipat ed because WT cells after 4 h ours of ischemia were eventually devoid of SIRT1 . Taken together, these studies firmly support the hypothesis that the loss of SIRT1 contributes to hepatic I/R injury. SIRT 1 Depletion I s M ultifactorial To investigate the mechanisms underlying SIRT1 depletion after I/R, changes in SIRT1 mRNA were measured with PCR. As shown in F igure 2 4 A , I/R did not alter SIRT1 mRNA, suggesting that SIRT1 depletion is a post translational process. Using cyclohexi mide (CHX), a protein synt hesis inhibitor, we estimated the half life of SIRT1 to be about 14 hours (Figure 2 4B ) , which suggesting that SIRT1 depletion is likely to be associa ted with the ischemic stress . To identify the factor(s) involv ed in SIRT1 depletion, hepatocytes were trea ted with inhibitors for calpain , cathepsin , and the proteasome and analyzed by immunoblot . Calpain activation lead s to hepatic I/R injury (5 1;53) , Ac etyl Leu Leu Met (ALLM), a c alpain inhibitor, partially suppre ssed the loss of SIRT1 (Figure 2 5 A ) but prevented I/R injury ( Figure 2 5 B ) . These results suggested that c alpain activation during I/R is, at least in part, responsible for SIRT1 depletion. An integral role of SIRT 1 was confirmed by a loss in ALLM induced cytoprotection against I/R in SIRT1 KO hepatocytes ( Figure 2 5C ). MG 132, a proteasome inhibitor, did not suppress the depletion of SIRT1 or cell death after reperfusion (Figure 2 6 ). Cathepsin s have been reported to degrade SIRT1 in endothelial cells (300) . Cathepsins are a family of proteases found mostly within the lysosome, which have a role in the cleavage of SIRT1 (300;301) . Lysosomal leakage during oxidative stress and I/R can cause the releases of these hydr o lytic enzymes into the cytosol (78 80) . E 64 d , a pan cysteine protease c athepsin inhibitor, partly

PAGE 68

68 suppressed the SIRT1 reduction after 2 h ours of ischemia (Figure 2 7A). Neutralization of the lysosome using chloroquine indicates that cathepsin proteolysis of SIRT1 is independent of lysosomal degradation ( Figure 2 7B ). After 4 h ours of ischemia and reperfusion, c athep sin inhibition did no t affect the depletion of SIRT1 or cell death (Figure 2 7C) . Furthermore , the administration of both ALLM and E64d showed minor additive effects on SIRT1 depletion and necrosis ( Figure 2 8 ). Collectively, these data indicate that the depletion of SIRT1 during I/R is caused by multiple factors involving calpains and other proteases . Discussion Liver I/R injury remains a fundamental complication during surgery leading to liver failure and patient mortality (13) . The current ineffectiveness of therapeutics to ameliorate liver I/R injury prompts the investigation into new potential targets to provide protection against I/R injury. Here we demonstrate that (a) ischemia d ecreases SIRT1 in human and mouse livers, and primary hepatocytes, (b) the loss of SIRT1 sensitizes hepatocytes to reperfusion induced death , (c) calpain activation lead s to the depletion of SIRT1, and (d) calp ain inhibition prevents SIRT1 deplet ion and suppresses hepatic I/R injury (Figure 2 9) . Overall, this study shows that the loss of SIRT1 is associated with hepatocyte death during liver I/R injury . Sirtuin s are potential therapeutic targets for several different liver diseases. SI RT1 , the most studied sirtuin family member , is a pleiotropic protein involved in mitochondrial metabolism and autophagy (190;260;298;302;303) . S IRT3 is purposed to regulate energy metabolism thro ugh oxidative phosphorylation (216;282;284;289;304;305) , while SIRT5 is one of the least studied sirtuins and shown to have a critical role in the mitochondrial urea cycle (217;291) . SIRT1 and SIRT3 h ave

PAGE 69

69 a cytoprotective role against I/R injury in myocytes (259;290) , however little is known about role s of SIRT1, SIRT3 and SIRT5 during hepatic I/R injury . To our knowledge, we ar e the first to report SIRT1, SIRT3 and SIRT5 expression in human liver tissue after 15 minutes of inflow occlusion induced ischemia. In human tissue, ischemia caused the reduction of SIRT1 with no alteration to SIRT3, and a n elevation in SIRT5 (Figure 2 1) . Our mouse model for in vivo liver I/R responded in a similar manner that resembled the human inflow occlusion induced ischemia (Figure 2 1 ). Our primary hepatocyte model also resembled human and mouse liver I/R injury as indicated by a reduction in SIRT1 and an elevation in SIRT5, however SIRT3 became further elevated in this system. This unusual SIRT3 response requires further investigation but may be caused by the loss of temporal and spatial factors found in liver , which are absence in the isolated hep atocyte system. Ischemic preconditioning and caloric restriction convey SIRT1 mediated c ytoprotection against I/R injury to steatotic livers in rat s and mice (164;278) . Nutrient starvation activates SIRT1 (195) and suppresses reperfusion induced death after I/R in hepatocytes (47) . These studies su ggest a correlation with SIRT1 conveying cytoprotection against I/R injury. To further support this, hepatocytes undergoing prolonged ischemia lose SIRT1 and following reperfusion leads to cell death (Figure 2 2). Prolonged ischemia and hepatocyte death ar e causative factors leading to post liver resection failure (32 35) . Consistent with previous studies (39;50;58) , hepatocytes subjected to 4 hours of ischemia led to reperfusion induced death at 60 minutes, which occurred in cells that were depleted of SIRT1 . Reperfusion after i schemia for 1 and 2 hours maintained hepatocellular viability. Furthermore , a significant reduction of SIRT1

PAGE 70

70 during ischemia was sustained during reperfusion (Figure 2 2). After 4 hours of ischemia, SIRT1 was depleted and hepatocytes underwent repe rfusion indu ced death, while SIRT5 expression was heightened . An elevation in SIRT5 has been suggested to up regulate CPS1 and mitochondrial urea clearance (217;291) , however the role of SIRT5 during liver I/ R remains unclear. SIRT1 localizes to both the cytosol and nucleus, however only the nuclear SIRT1 was able to suppress oxidative stress (185) . I n hepatocytes, cytosolic SIRT1 is reduced during 1 and 2 hours ischemia while nuclear SIRT1 remained unchanged up to 2 hours of ischemia prior to depletion (Figure 2 2 ). The s e data suggest that cytosolic SIRT1 reduction precedes nuclear SIRT1 loss in hepatocytes before depletion. To establish that the loss of SIRT1 leads to hepatocyte death, SIRT1 KO hepatocytes were subjected to 2 hours of ischemia and reperfusion, which are sublethal I/R conditions. SIRT1 null hepatocytes were significantly more sen sitiv e to sublethal I/R, in comparison to wild type cells (Figure 2 3). Collectively, t hese studies firmly indicate that SIRT1 plays a n integral role in liver I/R injury. Mechanisms involving protein degradation and cleavage during I/R has been a controver sial topic for over 30 decades (62;306) . Ischemia leads to protein damage and degradation of a large number of intracellular prote ins (62) . Based on our finding, ischemia leads to the reduction of SIRT1 at the protein level without affecting mRNA express ion (Figure 2 4), which differ s from an in vivo heart model of I/R where SIRT1 mRNA levels decreased (259) . SIRT1 chemical stability and normoxic protein turnover could not account for the rapid deletion of SIRT1 during 4 hours of ischemia (Figure 2 4) , suggesting that ischemia leads to the degradation of SIRT1. SIRT1 contains several

PAGE 71

71 cysteine residues (Cys 67,68,482,490 ) that are sensitive to redox stress and its modification can lead to degradation through the proteasome (307) . The ubiquitin proteasomal system (UPS) is a non lysosomal dependent degradation mechanism to remove proteins using ubiquitin as a post translational signal for degradation. Degradation of SIRT1 in endothelial cells, chondrocytes and adipocytes occurs through the proteasome (300;301;308) . During I/R, a functional UPS response remains controversial , some studies showed that ATP depletion blocks ubiquitin protein ligase and proteasomal assembly, stability, and functions, while others demonstrate d an increase in protein ubiquitination and sustained proteasomal activity (309) . We found that inhibition of the proteasome did not suppress th e reduction of SIRT1 in hepatocytes during I/R (Figure 2 6). Prior to proteasomal degradation, cathepsins , a family of proteases found mostly within the lysosome , have been implicated in the cleavage of SIRT1 (300;301) . There are o ver a dozen different cathepsin member s that become activated by low pH, however the cysteine cathepsins B and D are stable and retain some activity under neutral pH (76;77) . In chondro cytes, c athepsin B cleaves SIRT1 after tumor necrosis factor alpha ( TNF treatment (301) . After 2 hours of ischemia, the pan cysteine cathepsin inhibitor suppressed the degradation of SIRT1, while lysosomal neutralization had no effect (Figure 2 7). The increase in SIRT1 expression by cathepsin inhibition but not lysoso mal neutralization may suggest that c athepsins are being translocated from lysosomes to the cytosol during ischemia, as proposed by previous reports (72;78 80;84) . Lysosomal ruptu re has been proposed as an event that precedes the MPT onset leading to cell death (47) and hepatocytes remain viable at 2 hours of ischem ia

PAGE 72

72 implicating that the lysosomes did not rupture but may be releasing cathepsins into the cytosol. Further investigations are required to characterize lysos omal instability during liver I/R injury. Pharmacological inhibition of cathepsins has been r epor t ed to reduce cer ebral I/R induced cell damage (67;82;83) , however c athepsin inhibition did not suppress hepatocyte death or the loss of SIRT1 after prolonged ischemia followed by reperfusion (Figure 2 7) indicating that SIRT1 degradation is multifactorial. Calpains are a family of non lysosomal cysteine proteases that degrade intracellular proteins. During I/R, calpains become active and play a crucial role in reperfusion induced cell death (51;53) Consist ent with our previous finding (51 53) , c alpain inhibition suppressed hepatocyte death during I/R (Figure 2 5 ). Calpain inhibition , however, did not suppress the reduction of SIRT1 during 2 hours of ischemia (Figure 2 5 ). Prolonging ischemia increases calpain activity (52) and at 4 hours of ischemia calpain inhibition prevented SIRT1 depletion suggesting calpains play a partial role in the loss of SIRT1 during ischemia . Furthermore, calpain inhibition induced cytoprote ction against I/R injury was mediated by SIRT1 as indicated by the loss of cytoprotection in SIRT1 KO hepatocytes (Fi gure 2 5 ) . As a note, inhibition of both calpain and cathepsin only slightly increased SIRT1 expression and hepatocyte survival suggesting other factors are still involved in the SIRT1 reduction mechanism (Fi gure 2 8). Other possible targets to suppress the reduction of SIRT1 during ischemia are (a) matrix metalloproteinase s (MMP s ), (b) aspartyl cathepsin proteases and (c) serine cathepsin proteases. MMP s have shown to cleave intr acellular substrates during I/R (310) . However the role of MMP s in SIRT1 degradation has yet to be explored.

PAGE 73

73 Furthermore, since a spartyl and serine proteases wou ld not have been inhibited by E64d , the potenti al roles of these proteases cannot be excluded. In conclusion, we show that SIRT1 may have a cytoprotective role during liver I/R injury and the loss of SIRT1 sensitizes hepatocytes to I/R injury. Ischemia leads to the proteolysis of SIRT1 in a multifacto rial manner . C athepsins can initially cleavage SIRT1 during short ischemic times but hepatocytes remain viable under this condition . Prolonging ischemia leads to activat ion of calpains that deplete s SIRT1 leading to reperfusion induced death.

PAGE 74

74 Figure 2 1 . SIRT1, SIRT3, and SIRT5 expression changes in human and mouse livers and primary hepatocytes subjected to I/R . (A) Immunoblot analysis of SIRT1, SIRT3 and SIRT5 expression in human liver tissue after 15 minutes of inflow occlusion induced ischemia . ( n=3) (B) Immunoblot analysis of SIRT1, SIRT3 and SIRT5 mouse livers during in vivo I/R at indicated times. (n=3). (C ) Immunoblot analysis of SIRT1 , SIRT3 and SIRT5 in mouse primary hepatocytes subjected to simulated I/R at indicated times. *, p<0.05, **, p <0.01 , and ***, p<0.001 Figure 2 2 . Prolonged ischemia depletes SIRT1 leading to hepatocyte death during reperfusion. (A) Hepatocyte death was measured using 30 M propidium iodide after 1, 2 and 4 hours of ischemia followed by reperfusion at the indica ted time s (n=5). (B ) Immunoblot an alysis of SIRT1 from hepatocytes undergoing various I/R conditions (n=3). (C) Immunoblot analysis of SIRT1 localization in the cytosolic (C) and nuclear (N) fractions during ischemia (n=3). *, p<0.05 **, p<0.01 , and ***, p< 0.001

PAGE 75

75 Figure 2 3 . SIRT1 KO sensitizes hepatocyte s to I/R injury. (A) Mouse tail snip and hepatocyte mRNA were analyze d to confirm SIRT1 KO. (B) Wild type (WT) a nd SIRT1 KO hepatocytes were subjected to various times of I/R to determine cell death using propidium iodide fluorometry (n=3) **, p<0.0 1 Figure 2 4 . SIRT1 mRNA does not decrease during I/R and the protein is stable at 4 hours after protein synthesis inhibition using cyclohexi mide. (A) Hepatocytes were subjected to I/R and mRNA was collec ted for gross analysis of SIRT1 mRNA using RT PCR. (n=3) (B) Hepatocytes treated with 35 M CHX were analyzed for changes SIRT1 expression at indicated times using immunoblot analysis. (n=3)

PAGE 76

76 Figure 2 5 . SIRT1 mediates ALLM induced cytoprotection against I/R injury . (A) Immunoblot analysis of SIRT1 expression from hepatocytes treated with ALLM for 12 hours prior to and continuously during I/R. (n=3). (B) WT and (C) SIRT1 KO hepatocytes treated with 10 M ALLM or DMSO for 16 hours be fore and continuously during I/R to measure reperfusion induced death after 4 hours of ischemia (n=3). *, p<0.05 and **, p<0.01 Figure 2 6 . Proteasome inhibition using MG 132 does not suppress the ischemic reduction of SIRT1. (A) Immunoblot analysis of SIRT1 expression from hepatocytes treated with MG 132 for 1 hour prior to and continuously during I/R. (n=3). (C) Hepatocytes treated with different doses of MG 132 for 1 hour before and continuously during I/R to measure reperfusion induced death after 4 hours of ischemia (n=3).

PAGE 77

77 Figure 2 7 . Cathepsin inhibition using E64d suppresses the SIRT1 reduction after 2 hours of ischemia. (A) Immunoblot analysis of SIRT1 expression from hepatocytes treated with E64d for 1 hour prior to and continuously during I/R. (n=3). (B ) Hepatocytes treated with 50 M E64d or 10 M CQ were subjected to various I/R conditions to analysis SIRT1 expression. Cells were treated with CQ for 1 hour prior to and continuously during I/R. (n=2) (C ) Hepatocytes treated with different doses of E64d for 1 hour before and continuously during I/R to measure reperfusion induced death after 4 hours of ischemia (n=3).*, p<0.05 Figure 2 8 . Cathepsin and c alpain combined inhibition does not have an additive effect on suppressing the reductio n of SIRT1 during I/R. (A) Immunoblot analysis of SIRT1 expression from hepatocytes treated with 10 M ALLM for 16 hours and 50 M E64d for 1 hour prior to and continuously during I/R. (n=3). (B ) Hepatocytes treated with ALLM and E64d were used to measure reperfusion induced death after 4 hours of ischemia (n=3).*, p<0.05 , and ** , p <0.01

PAGE 78

78 Figure 2 9 . The ischemic reduction of SIRT1 is multifactorial involving cathepsins, c alpains and other proteases . Graphical interpreta tion of the mechanism for SIRT1 depletion during I/R. C ysteine cathepsin proteases hydrolyze SIRT1 during short ischemic times, which does not lead to reperfusion induced death. P rolonging ischemia leads to calpain activation and SIRT1 depletion leading to reperfusion induced death .

PAGE 79

79 CHA PTER 3 SIRTUIN 1 ACTIVATION PREVENTS MITOCHONRIAL DYSFUNCTION AND PROMOTES AUTOPHAGY TO PROTECT AGAINST LIVER I/R INJURY Introduction Chapter 2 d escribed the ischemic reduction of Sirtuin 1 ( SIRT1 ) caused by multiple proteases leading to hepatocyte death during ischemia/reperfusion ( I/R ) injury . In this chapter, we investigate whether modulating SIRT1 expression and activity influences mitocho ndrial dysfunction , autophagy and cell death during I/ R. Autophagy is a cytoprotective mechanism to suppress hepato cyte damage during I/R injur y (51 53) . SIRT1 mediates autophagy through multiple different mechanisms. We hypothesize that e nhancing SIRT 1 can induce autophagy to confer cytoprotection against liver I/R injury. SIRT1 was genetically manipulated using an adenoviru s expressing SIRT1 (AdSIRT1) or Tamoxifen inducible SIRT1 knockout (SIRT1 KO) mice. Pharmacological activation of SIRT1 was performed using putative SIRT1 activators , Resveratrol ( RSV ) and SRT1720. SIRT1 overexpression and genetic ablation lead to autophagy induc ed cytoprotection and hy persensitization to I/R, respectively. Under nutrient rich conditions, SIRT1 induced autophagy was independent of mTOR inhibition and AMPK activation, but led to an increase the ATG 7 expression, which may play a role in the enhanced basal autophagic flux. Electron, confocal , and intravital mulitphoton microscopy were performed to confirm these finding by analyzing the m itochondrial ultrastructure, mitochondrial bioenergetics, the mitochondrial permeability transition ( MPT ) , autophagosome generation and auto phagic flux . These data all demonstrate that SIRT1 overexpression and activ ation enhance s autophagy to suppress mitochondrial dysfunction and liver I/R injury .

PAGE 80

80 Background Mitochondrial dysfunction is the causative mechanism leading to hepatocyte death du ring warm I/R injury (45;57;58;311) . Mitochondrial dysfunction occurs through the unregulated opening of the MPT pore s (38;39;59) . The MPT pore is a complex of several proteins located at contact site between inner and outer mitochondrial membranes (7) and reperfusion induced unregulated opening leads to the MPT onset, which is the lethal event. During reperfusion , t he MPT onset is due to the influx of solutes up to 1500 Da into the mitochondrial matrix , which in turn leads to mitochondria l depolarization, impaired ATP production and ROS generation . As a result of osmotic homeostasis , the mitochondria begin to swel l until the membrane rupture s and releas es mitochondrial pro apoptotic proteins into the cytosol leading to cell death (7;38;59;60) . Mitochondrial dysfunction and ATP depletion in hepatocytes is the causati ve mechanism leading to cell death during I/R injury (45;57;58;311) During reperfusion , mitochondrial Ca 2+ overload leads to the MPT onset followed by generation of reactive oxygen s pecies (ROS) to further permeabilize the mitochondrial membrane s (39) . Cyclosporine A, a cyclophilin D inhibitor, and mitochondrial Ca 2+ chelation suppress the MPT onset and liver I/R injury (58;59) . Clinically, these approaches are unfavorable du e to the nephrotoxic effects of Cyclosporine A (312) and adverse effects from calcium imbalance in the vasculature (313) . A novel strategy to circumvent the MPT onset is to eliminate signals triggering reperfusion injury by increasing mitochondrial turnover prior to I/R (47) . Within a cell, the mitochondrial population is heterozygous and a small group of mitochondria initially undergoing the MPT onset promote s a sequential chain reacti on to neighboring mitochondria causing the global MPT onset and depo larization (218) . Clearance of this

PAGE 81

81 discrete pool of the mitochondria may provide a novel approach to suppress liver I/R injury. Autophagy is a lysosomal dependent catabolic process to remove long lived and dysfunctional organelles. Macroautophagy, referred to as autophagy, is a sequential process that involves several different autophagy related proteins (ATG) to initiation and dev elop autophagosomes, which are double membrane vacuoles that fuse with lysosomes. Autophagy occurs at a basal rate in cells to maintain homeostasis or can be stimulated by different pathological and physiological conditions. Autophagy impairment is a facto r contributing to liver I/R injury, while the enhancement of autophagy is cytoprotective (51 53) . Autophagy leads to the sequ estration and degradation of damaged mitochondria after I/R (7;39;51 53) . Post translational modifica tions including acetylation play a key role in mitochondrial biogenesis, bioenergetics and autophagy (208;260;269;314 317) . SIRT1 is a class III histone deacetylase that targets the transcription factors FOX O 1 (190;202;274;318) , FOX O 3A (272;273;319) and PGC 1 (193;306;320) to regulate transcription of genes for mitochondrial biogene sis and mitochondrial autophagy. SIRT1 induc ed autophagy has been shown to suppress I/R injury in the heart (303;321;322) , kidney (277) , and brain (323;324) , however SIRT1 inducing autop hagy during liver I/R injury is unknown. Ischemic preconditioning and fasting are known approaches to induce cytoprotection against liver I/R injury and the protection is proposed to be mediated by SIRT1 (164;278) . However , the role of SIRT1 conveying cytoprotection against liver I/R injury remains unclear.

PAGE 82

82 The goal of this i nvestigation was to determine whether modulating SIRT1 through genetic and pharmacologic approaches could affect the MPT onset and autophagy to suppress liver I/R injury . SIRT1 overexpression and activation induced autophagy, blocked the MPT onset and suppressed liver I/R injury. SIRT1 overex pression did not lead to the activation of AMPK or inhibit ion of mTOR, but increased ATG7 expression during normoxia. A fter I/R , S IRT1 overexpression did not cause a change the expression of several ATG proteins or the autophagy initiation signals but re e stablish ed autophagic flux. Collectively, this study suggests that SIRT1 induced autophagy provides cytoprotection against liver I/R injury. Materials A nd Methods Reagents A nd Drug Treatments RSV was purchased from Sigma Aldrich (Cat number: R 5010) and SR T1720 was purchased from SelleckChem (Houston, TX). Cells were treated with RSV for 16 hours before hepatocytes underwent I/R, while SRT1720 treatment was for 1 hour before I/R. Both activators were continuously present during I/R. In Vivo I/R A nd Adenovir al I njection In vivo I/R injury was perfo rmed as described in Chapter 2. Intravital M ultiphoton M icroscopy To visualize autophagosomes and autophagic flux, livers were labeled with adenoviral GFP LC3 or mCherry GFP LC3. After 20 min utes of reperfusion in vivo, a 24 gauge catheter was inserted into the portal vein. Rhodamine 123 (50 ml of 10 sensitive fluorophore, was infused for 10 minutes. The liver was gently withdrawn from the abdominal cavity and placed over a glass coverslip on the stage of a Zeiss LSM510 equipped with a multiphoton microscope. Images of green

PAGE 83

83 fluorescing rhodamine 123 and GFP LC3 were collected with a 40× water immersion objective lens. Rhodamine 123 and GFP LC3 were excited with 800 nm from a Cham eleon Ultra Ti Sapphire pulsed laser (Coherent Inc., Santa Clara, CA) and images were collected through 500 550 nm band pass filter. For imaging of mCherry GFP LC3, tandem fluorophores were excited at 800 nm and emission was separated through 500 530 nm (G FP) and 565 615 nm (mCherry) band pass filters. Ten images were randomly collected per each liver. Hepatocyte Adenoviral Infection Adenovirus expressing SIRT1 (Ad SIRT1 ) was a kind gift from Dr. Junichi Sadoshima at The University of Medicine and Dentistry of New Jersey. Hepatocytes were infected with Ad SIRT1 for 4 hours in hormonally defined me dium (RPMI 1640 medium with no g lutamine at pH 7.4, 0.3 mmol/L selenium, 1 µg/ml apo transferrin, 100 nmol/L insulin, 1.5 µmol/L free fatty acids, 1% penicilli n/stre ptomycin). After 4 hours, the medium was replaced with Waymouth medium and hepatocytes were incubated overnight (10 12 hours). For in vivo studies, mice were injected with AdLacZ, AdSIRT1 , Ad GFP LC3 or Ad mCherry GFP LC3 ( 7x10 11 pfu/g) incubated for 2 day s . Electron Microscopy A monolayer of h epatocytes were fix ed using deoxygenated or oxygenated 2% paraformaldehyde and 2% glutaraldehyde, 125 mmol/L cacodylate, and 2.2 mmol/L CaCl at pH 6.2 for ischemia and pH 7.4 for reperfusion. Cells were fixed overnigh t (8 12 hours) then washed in a cacodylate buffer (100mmol/L cacodylate, 7% sucrose at pH 7.4) prior to staining with 1% osmium t etraoxide in the cacodylate buffer for 1 hour at room temperatur e. After staining, a Michaelis b uffer (0.1 M HCl, 25% sucrose, 2.8 mmol/L sodium acetate trihydrate, 2.8 m mol/L sodium b arbiturate) was used t o wash

PAGE 84

84 the cell prior to nuclear staining with a Kellenberger buffer (0.1 M HCl, 2.8 mmol/L sodium acetate trihydrate, 2.8 mmol/L sodium barbiturate, 2% u ranyl acetate). Hepatoc ytes were than dehydrated using a 70%, 90% and 100% ethanol gradient for 15 m inute intervals before en bloc . En b loc was performed using Embed 812, NADIC Methyl Anh ydride, DMP 30 and DDSA by manufactures direction. All chemicals were purchased from Electro n Microscopy Science (Hatfield, PA). Confocal Microscopy Confocal images were taken using an inverted Zeiss 510 lase r scanning confocal microscope using tetramethylrhodamine methyl ester (TMRM), calcein AM , and propidium iodide were collected with a gas tight chamber (Zeiss, Jena, Germany) (39;51;297;297) . Briefly, hepatocytes were seeded on glass bottom dishes overnight in W ay mouth media. Hepatocytes were subjected to I/R as described previously in Chapter 2 with the addition of tetramethylrhodamine methyl ester ( TMRM ) , Calcein AM and propidium iodide 30 minutes prior to and continuously during reperfusion. For autophagy analys is, hepa tocytes were infected with AdLacZ or AdSIRT1 and Ad GFP LC3 or Ad mCherry GFP LC3 seeded on glass bottom dishes (In Vitro Scientific, Sunnyvale CA) overnight in W aymouth media. Hepatocytes were subjected to I/R with the addition of TMRM 30 minutes prior to and continuously during reperfusion. Hepatocyte Isolation A nd Culture Hepatocytes were isolated as described in Chapter 2 . Hepatocyte Simulated I/R Simulated I/R was performed as reported in Chapter 2 .

PAGE 85

85 Immunoblotting Immunoblotting was performed as described in Chapter 2 . Tamoxifen T reatment F or Inducible SIRT1 KO M ice Tamoxifen treatment for SIRT1 KO was performed as described in Chapter 2 . Cell Death Assay Using Propidium Iodide Hepatocyte death was determined as previously reported in Chapter 2 . Data Analysis Statistics were performed as described in Chapter 2. Results SIRT1 Suppresses The MPT Onset A nd Hepatocyte Death. To investigate if SIRT1 is cytoprotective, hepatocytes were infected with AdSIRT1 and subjected to I/R . Hepatocy tes overexpressing SIRT1 suppressed hepatocyte death (Figure 3 1 A ) without influenc ing the endogenous reduction m echanism of SIRT1 (Figure 3 1B ) . The MPT onset causes hepatocyte death during warm I/R injury, thus we determined if SIRT1 overexpression preve nt ed the opening of the MPT pore . We performed confocal microscopy to investigate the MPT onset and polarization status of the mitochondria using Calcein and TMRM (47;51;53) ( Figure 3 1C ). Indeed, SI RT1 overexpression resulted in sustained mitochondrial polarization after reperfusion and blocked the influx of cal cein into the mitochondria, hence blocking the MPT onset. Electron microscopy was performed to evaluate the mitochondrial ultrastructure in h epatocytes overexpressing SIRT1. After 4 hours of ischemia, mitochondria remained circular morphology and maintain the integrity of inner and outer membranes during reperfusion in AdSIRT1 hepatocytes (Figure 3 1 D ). Collectively,

PAGE 86

86 these data suggest that ove rexpression of SIRT1 suppresses the MPT onset, hepatocyte death and I/R injury . To determine if pharmacological activation of SIRT1 could suppress I/R injury, we measured reperfusion induced cell death in hepatocytes treated with putative SIRT1 activators, RSV or SRT1720. Both RSV and SRT1720 suppressed hepatocyte death after I/ R (Figure 3 2A ) , but without preventing SIRT1 depletion (Figure 3 2 B) . Electron microscopy was performed to evaluate the mitochondrial ultrastructure in hepatocytes treat ed with RSV. After 4 hours of ischemia, mitochondria maintained the normal morphology as well as the integrity of inner and outer membranes in hepatocytes treated with RSV, while control hepatocyte mitochondria were aberrant in sh ape and size (Figure 3 2C ) . Upon reperfusion, only the mitochondria from RSV treated hepatocytes retained mitochondrial membrane structures providing further evidence for the cytoprotective role of SIRT1 during liver I/R injury. SIRT1 Induces Autophagy T o Suppress I/R Injury A utop hagy clears unnecessary or dysfunctional proteins and organelles in a lysosome dependent manner. Impaired autophagy contrib utes to liver I/R injury (51 53) . To test if SIRT1 mediated cytoprotection is linked to autophagy, hepatocytes were subjected to I/R with and without SIRT1 overexpression and autophagic flux was assessed by analyzing LC3 II expression in the pre sence and absence of chloroquine (CQ), a lysosomal inhibitor (Figure 3 3 A ). Briefly, LC3 II is localized on the autophagosomal membrane and fusion with the lysosome leads to the degradation of LC3 II . Accordingly, the comparison of LC3 II before and after blocking lysosomal degradation using CQ can estimate autophagic flux. In the control hepatocytes, autophagic flux after I/R was marginal, con sistent with previous data (51 53) . However,

PAGE 87

87 in the hepatocytes overexpressing SIRT1, the basal levels of LC3 II were significantly higher than the control cells and autophagic flux was also observed after I/R, suggesting that SIRT1 not on ly promotes basal autophagy but also prevents reperfusion induced decline in autophagy. Increased autophagy by SIRT1 was confirmed in both fluorescence and electron microscopy. Imaging analysis of LC3 distribution in GFP LC3 labelled hepatocytes showed tha t while control cells had few autophagosomes and diffused staining pattern, SIRT1 overexpressed cells encompassed numerous autophagosomes ( gree n puncta ) (Figure 3 3B ). Dual staining of autophagosomes and mitochondria revealed that red fluorescing mitochondria were in close proximity to green fluorescing autopha gosomes . Furthermore, electron micrographs showed that hepatocytes overexpressing SIRT1 had mult iple autophag ic vesicles (arrowheads ) and, more importantly, structurally intact mitochondria after I/R (Figure 3 3C ). Autophagic flux was also visualized in live cells with tandem mCherry GFP LC3 (53) . GFP loses its fluorescence in the acidic environment of autolysosomes, whereas the red fluorescence of mCherry remains . As a consequence, autophagosomes and autolysosomes emerge as yellow and red puncta, respect ively. Confo cal imaging showed vast numbers of red puncta in SIRT1 overexpressed cells after 2 h ours of reperfusion, implying a potent autolysosomal clearance by SIRT1 (Figure 3 3D ). Altogether , these results highlight an integral role of SIRT1 in hepatocellular autop hagy. SIRT1 KO Impaired Autophagy Sensitizes Hepatocytes T o I/R Injury The importance of SIRT1 and its correlation to autophagy was further substantiated in SIRT1 KO hepatocytes. In WT hepatocytes, either RSV or SRT1720 significantly increased the basal au tophagic flux (Figure 3 4 A ). However, neither activator was able to boost autophagy in SIRT1 KO cells. Similarly, SIRT1 KO

PAGE 88

88 hepatocytes failed to sustain autophagic flux during a short term I/R, a sub lethal stress that does not induce death in wild type hepatocytes (Figure 3 4 B ). Of note, the addition of CQ to SIRT1 null cells under the normoxic condition failed to increase LC3 II levels, entailing that SIRT1 is necessary to retain the basal autophagic flux. To confirm that depletion of SIRT 1 can sensitize hepatocytes to the MPT onset during reperfusion , we used the Tamoxifen inducible SIRT1 KO mice (298) . Confocal imaging analysis further showed a rapid onset of the MPT in SIRT1 KO hepatocytes (Figure 3 4 C ), firmly indicating that the loss of SIRT1 sensitizes hepatocytes to the MPT onset and I/R i njury. T hese results corroborate a pivotal role of SIRT1 in autophagy and ratify the necessity of SIRT1 in autophagy for hepatocyte survival during I/R. SIRT1 Induced Autophagy A nd Initiation Signals To explore the mechanism for SIRT1 induced autophagy, we investigated the mTOR and AMPK signaling pathwa y. Inhibition of mTOR and phosphorylation of AMPK are two canonical pathways to initiate autophagy (111;123) . The mechanism of SIRT1 mediated induction of autophagy through these pathways has been controversial, thus we explo red if SIRT1 overexpression can lead to mTOR inhibition or AMPK activation to initiate autophagy. SIRT1 overexpression did not decrease phosphorylation status of the downstream mTOR signaling protein p70 s6k or increase in the phosphorylation status of AMPK under normoxic conditions (Figure 3 5 A ). Furthermore , the total levels of p70 s6k and AMPK had significantly reduced during I/R, and SIRT1 overexpression did not change phosphorylation status of p70 s6k or AMPK . Interestingly, AMPK is phosphorylated and p70 s6k is dephosphorylated after 5 minutes of reperfusion. After 60 minutes of reperfusion, p70 s6k becomes phosphorylated suggesting mTOR activation and retention of AMPK activation. These data suggest th at during I/R hepatocytes are

PAGE 89

89 initiating autophagy and the SIRT1 induced cytoprotection is a downstream event independent of mTOR and AMPK signaling cascade. SIRT1 Overexpression I ncreases ATG 7 E xpression Autophagy is a sequential process with multiple specific autophagy proteins involved in autophagy initiati on, autophagosomal membrane elongation, autophagosome maturation, and lysosomal fusion for degradation of the constituents within an autophagosome. An increase in autophagy proteins is known to enhance autophagy (53) , thus we investigated if SIRT1 induced autophagy lead s to an increase in autophagic related proteins involved in these individual steps of autophagy. Overall, SIRT 1 overexpression did not increase or decrease the expression levels of several proteins (Figure 3 5 B ). However, o verexpression of SIRT1 did lead to a substantial increase in ATG 7 expression during normoxia , which was lost during I/R . Previously, we have shown that overexpr ession of ATG 7 enhances autophagy to suppress liver I/R injury. These studies suggest that SIRT1 induced autophagy may be mediated by increasing the expression of ATG 7 under basal conditions . SIRT1 Overexpression Suppresses In Vivo I/R I njury To determin e if SIRT1 induced could prevent liver I/R injury, we overexpressed SIRT1 in mice (Figure 3 6A). LC3 II immunoblot confirmed that a SIRT1 overexpression had affected aut ophagy before an d after I/R by elevating the LC3 II expression (Figure 3 6B) , which is consistent with our primary hepatocyte studies (Figure 3 3A ). I ntravital multiphoton images of Rhodamine 123 (Rd bioenergetics by SIRT1 ( Figure 3 6C ). While most Rd 123 fluorescence disappeared after reperfusion of the control livers, SIRT1 overexpressed livers displayed punctate, bright green fluorescence of Rd 123 in hepatocytes, indicative of polarized

PAGE 90

90 mitochondria . Finally, to determine if SIRT1 c an affect autophagy in vivo , we utilized the mCherry GFP LC3 adenovirus (Figure 3 6D) . Upon r eperfusion, liver tissue los t the mCherry GFP LC3 signal indicating a dysfunctional autophagy response, but overe xpression of SIRT1 in livers le d to the generation of autophagosomes (yellow) and autolysosomes (red) suggesting a functional autophagic response. This provides further evidence that SIRT1 convey s cytoprotection against liver I/R injury through autophagy. Discussion In these studies, we examined the rol e of SIRT1 during I/R injury in regards to mitochondrial dysfunction, the MPT onset and hepatocyte death. Here we demonstrate tha t SIRT1 overexpre ssi on and activation (a) suppressed the MPT onset and hepatocyte death; (b) increased autophagic flux before a nd after I/R ; and (c) SIRT1 induced autophagy was independent of mTOR inhibition and AMPK activation but increased ATG7 ex pression under basal conditions. O ur findings suggest that SIRT1 induced au tophagy suppress es the MPT onset and liver I/R injury (Figure 3 7 ) . Hepatocyte death is initiated by m itochondria l dysfunction and the MPT onset during reperfusion (38;39;45) . Reperfusion induced unregulated opening of th e MPT pores is a lethal event . Consistent with previous studies (39;50;58) , hepatocytes subj ected to 4 hours of ischemia le d to reperfusion induced death at 60 minutes , but overexpressing or activating SIRT1 suppressed reperfusion induced death (Figure 3 1 and Figure 3 2 ). In cardiomyoctes, SIRT1 increases mitochondrial antioxidants, Th ioredoxin and Man g anese superoxide, which m a y balance the ROS accumulation during rep erfusion (259) . However, hepatic mitochondrial ROS generation is a downstream event that proceeds the MPT onset in hepatocytes (39) . Hepatocytes overexpressi ng SIRT1 were resistant to the mitochondrial dysfunction and the MPT

PAGE 91

91 onse t during reperfusion (Figure 3 1 ). Briefly, c alcein labels both the nucleus and the cytosol when MPT pores are close d . However, the onset of the MPT redistributes c alcein into the mit ochondria while simultaneously releasing the TMRM , a mitochondrial membrane potential marker, into the cytosol. The mitochondria in the control cells underwent the MPT after I/R as indi cated by the redistribution of c alcein and TMRM, while mitochondria in SIRT1 overexpressing cells excluded c alcein and retained TMRM in the polarized mitochondria. Mitochondrial dysfunction and the MPT onset leads to the rupture of the mitochondrial membranes to release the inner mitochondria contents (59) . During reperfusion, electron micrographs clearly show ruptured mitochondria in control hepatocytes during reperfusion, but enhancing SIRT1 preserved intact mit ochondrial membranes (Figure 3 1 and Figure 3 2 ). These results clearly show SIRT1 overexpression and activation suppress es liver I/R injury . Autophagy allows for recycling and degradation of dysfunctional proteins and organelles through the lysosomal machinery, and conveys cy toprotection against liver I/R injury (51 53) . Numerous studies support the essential role of SIRT1 in the induction of auto phagy (164;189 192;260;317) . Furthermore, SIRT1 induced autophagy removes damaged mitochondrial and attenuates oxidative damage during I/R (191;192;303) . Consistent with these reports, we found overexpression or activation of SIRT1 induced autophagy by showing an accumulation of LC3 II in the presence and absence of chloroquine (CQ), a lysosome blocker ( Figure 3 3). LC3 II is a key marker for autophagy because it local izes on the autophagosome , which are degraded by the lysosome. Application of CQ blocks lysosomal degradation and leads to an accumulation of LC3 II th at can be measured by immunoblo t. A utophagic flux was sustained in these viab le

PAGE 92

92 hepatocytes after I/R injury . Using a GFP LC3 label we show that after I/R, hepatocytes are generating GFP labeled punctae (autophagosomes) in close proxi mity to mitochondria (Figure 3 3 ). The endoplasmic reticulum (ER) mitochondrial contact sites are main sites for the autophagosome formation (325) . These sites regulate the recruitment of au tophagic machinery and donate membrane for the formation of the autophagosom e (325) . Using electron micros copy, we found that autophagosomes (double membrane vacuoles) are being generated in close proximity to the mitochondria and the ER , but could never identify mitochondria within an autophagosome. This may suggest that SIRT1 overexpression might play a role in Type III mitochondrial autophagy named micromitophagy (104) . Autophagosomes sequester cargo, which is then transported to the lysosome fo r degradation. Autophagosomal lysosomal fusion gene rates an autolysosome, which are single membrane vacuoles that contain several catabolic enzymes to degrade the autophagosomal cargo to be released back into the cytosol . After I/R, viable hepatocytes re e stablish autophagic flu x during reperfusion (Figure 3 3 ). Using a mCherry GFP LC3 label, we found that viable hepatocytes overexpressing SIRT1 generate autolysosomes after reperfusion , while control hepatocytes lack autolysosomes. These studies support tha t overexpression of SIRT1 prevents dysfunctional autophagy after I/R and promotes autophagic flux . RSV and SRT170, agonists of SIRT1, enhance autophagy leading to cytoprotectio n against I/R injury (Figure 3 2 ) , which coincides with previous findings (36;326 329) . Interestingly, SIRT1 was depleted in these cells during I/R but cytoprotection agai nst I/R injury was still conveyed. This may suggest that the activation of SIRT1 prior to I/R leads to changes in cellular mechanisms that convey the

PAGE 93

93 cytoprotection against I/R injury, such as autophagy, even after I/R depletes SIRT1. SIRT1 mediating RSV i nduced autophagy has been controversial by recent evidence suggesting that RSV inhibits phosphodiesterases to increase cyclic AMP levels to simulate autophagy (250) . Consistent with other reports (262;298) , we found that RSV and SRT1720 induce d autophagy is mediated by SIRT1 (Figure 3 2 ). Furthermore, we show that SIRT1 KO have an impaired autophagic flux and after 2 hours of ischemia followed by repe rfusion autophagy remains dysfunctional (Figure 3 4) leading to hepatocytes death at a sublethal dose of I/R as shown in Figure 2 3 . Overall, these data show that RSV and SRT1720 require SIRT1 to induce autophagy, and the los s of SIRT1 impairs agonist induced autophagy conveying cytoprotection against I/R injury. Autophagy is a sequential process with an initiation followed by the recruitment of autophagic machinery for autophagosome gene ration . Mature autophagosomes then fuse with lysosomes to degrade autophagic cargo. Two well established auto phagy initiation signals are AMPK phosphorylation and mTOR inhibition (111;123) . Several studies report that RSV and SIRT1 overexpression increases AMPK phosphorylation (298;330) . W e found that SIRT1 overexpression does not enhance AMPK phosphorylation under n ormoxia or after I/R (Figure 3 5 ) . This difference may be caused by the ins ulin supplementation in our in vitro hepatocyte mode l. Administration of i nsulin down regulates AMPK phosphorylation and increases lipogenic gene expression (331) . While further studies are warra nted to investigate this discrepancy , the use of this mo de l provides mechanistic insights into SIRT1 induced autophagy independent of AMPK activation. Coinciding with previous studies (332;333) , mTOR was not inhibited in primary hepatocytes by SIRT1 overexpression as indicated by an increase in p70 s6k

PAGE 94

94 phosphorylation, a down stream target of mTOR (Figure 3 5 ) . SIRT1 overexpression increases mTOR p70 S6K interactions through deacetylation of the CTR region of p70 s6k to enhance mTOR phosphorylation of p70 s6k at thr 389 (332) . After I/R, overexpression of SIRT1 did not alter the phosphorylation status of AMPK or p70 s6k , which sug gests th at SIRT1 induced autophagy is independent of AMPK and mTOR autophagy initiation signals and a downstream target may be altered . As an important note, hepatocytes retain a strong autophagic initiation response through mTOR and AMPK upon reperfusion in hepat ocytes independent of SIRT1 . These studies suggest that overexpression of SIRT1 is enhancing basal autophagic flux without simulating mTOR or AMPK signaling cascades to activate autophagy. Autophagy can be modulated by protein expression of lysosomal fusion and autophagy related proteins (53;190) . Our evidence looking at sever al different autophagy and lysosomal proteins before and after I/R s uggest that SIRT1 does not increase or decrease the lysosomal proteins (Lamp 2A , Cathepsin D) or several different autophagy related proteins ( ATG 3, ATG 4B, ATG 12 5 complex, ATG 14 L, Beclin 1, RUBICON) (Figure 3 5 ). However, SIRT1 overexpression did lead to an elevation in ATG 7 expression under normoxic conditions and coincides with a previous finding (334) , which was subsequently lost during I/R. ATG 7 is an E1 ubiquitin like protein that facilitates LC3 II generation through ATP hydrolysis in both ubiquitin like pathways for LC3 II generation . Previously, we have shown that increasing ATG 7 protein expression leads to autophagy activation and cytoprotection against liver I/R injury (52) , thus suggesting that SIRT1 overexpression may be modulating b asal autophagy flux through ATG7 up regulation . ATG 5 , ATG 7 and ATG 8 are all proteins involved in the elongation

PAGE 95

95 of the autophagosomal membran e by gen erating the LC3 II , and are known substrates of SIRT1 for deacetylation (189) . This may provide another avenue for SIRT1 to induce autophagy , however further studies are required to determine their involvement with enhanced autophagy . Collectively, these in vitro studies demonstrate that SIRT1 overexpression enhances autophagy, blocks t he MPT onset and suppresses I/R injury. To translate these findings into an in vivo model of liver I/R injury, we injected mice with the AdSIRT1 virus (Figure 3 6) . Similar to the hepatocyte data, m ice injected with SIRT1 led to (A ) an increase in LC3 II e xpression before and after I/R injury implicating an altered autophagic response , (B ) m itochondria contain a bioenergetic charge after reperfusion as indicated using Rhodamine 123, which accumulates in polari ze mitochondria , and (C ) a re establish ed autoph agic flux after reperfusion as indicated by the formation of autophagosomes (yellow) and autolysosomes (red) using of the Ad mCherry GFP LC3 vector. These data further support that SIRT1 induced autophagy suppress es in vivo liver I/R injury. In summary, a ctivation and overexpression of SIRT1 enhances basal autophagy in an mTOR inhibition and AMPK activation independent manner. During I/R, overexpression of SIRT1 prevents the MPT onset and promotes autophagy to suppress hepatocyte d eath. SIRT1 overexpression s t imulates basal autophagy flux and increases ATG7 expression , which may play a role in the cytoprotection against I/R injury . H owever , SIRT1 overexpression did not affect autophagy initiation sign als or autophagosome maturation proteins aft er I/R . This may suggest that SIRT1 is involved in anothe r mechanism to sustain autophagic flux during reperfusion . Ultimately, this

PAGE 96

96 evidence supports the role of SIRT1 induced autophagy as a cytoprotective mechanism against liver I/R injury.

PAGE 97

97 Figure 3 1 . SIRT1 overexpression suppresses I/R injury . (A) Hepatocytes overexp ressing SIRT1 were analyzed by immunobl otting for SIRT1 expression. Hepa tocytes infected with 10 MOI AdGFP or AdSIRT1 were subjected to 4 hours of ischemia followed by reperfusion to m easure death using propidium iodide (n=5). (B) Representative immunoblot of SIRT1 expression in hepatocytes infected with AdSIRT1 during I/R. (C) Confocal images of hepatocytes infected with 10 MOI AdGFP or AdSIRT1 after 4 hours of ischemia and various reperfusion times in the presence of TMRM (Red polarized mitochondria) and Calcein (Green). (D) Electron micrographs of hepatocytes infected with 10 MOI AdGFP or AdSIRT1 during I/R. **, p<0.01

PAGE 98

98 Figure 3 2 . Pharmacological activation of SIRT1 suppresses mitochondrial dysfunction and hepatocyte death. (A) Hepatocytes treated with 0.1 M RSV for 16 hours or 0.1 M SRT1720 for 1 hour prior to being subjected to 4 hours of ischemia followed by reperfusion to measure cell death. Activators were cont inuously present during I/R. (n=3) (B) SIRT1 was immunoblotted in hepatocytes treated with SIRT1 activators to analyze expression changes (n=3). (C) Representative micrograph s of hepatocytes were treated with RSV and mitochondrial structure was analyzed be fore and after 4 hours of ischemia and 60 minutes of reperfusion.

PAGE 99

99 Figure 3 3 . SIRT1 overexpression induces autophagy to suppress I/R injury. (A) Hepatocytes infected with 10 MOI AdSIRT1 were subjected to I/R for LC3 immunoblot in the presence and ab sence of CQ. Hepatocytes were treated with 10 M CQ for 1 hour prior to and continuously during I/R. (n=4) (B) Confocal images of hepatocytes infected with AdSIRT1 and GFP LC3 after 4 hours of ischemia and 60 minutes of reperfusion. TMRM was used to indica te polarized mitochondria (Red). Autophagosomes (Green) (C) Electron micrographs of hepatocytes infected with AdGFP or AdSIRT1 before and after 4 hours of ischemia and 60 minutes of reperfusion. Arrow head s indicate autophagosomes. (D) Confocal images of h epatocytes infected with AdSIRT1 and AdmCherry GFP LC3 after 4 hours of ischemia and 2 hours of reperfusion. Autophagosomes (Yellow) and Autolysosomes (Red)

PAGE 100

100 Figure 3 4 . SIRT1 KO hepatocytes have an impaired autophagy leading to mitochondrial dysfunct ion and cell death. (A) WT and SIRT1 KO hepatocytes were treated with 0.1 M RSV for 16 hours or 0.1 M SRT1720 for 1 hour and autophagy flux was measured by LC3 immunoblot in the presence and absence of CQ. Hepatocytes were treated with 10 M CQ for 1 hour. (n=3) (B) WT and SIRT1 KO hepatocytes were subjected to 2 hours of ischemia followed by 60 minutes of reperfusion in the presence and absence of CQ for autophagy flux analysis using LC3 immunoblot. Hepatocytes were treated with 10 M CQ fo r 1 hour prior to and continuously during I/R. (C) Confocal images of hepatocytes treated with PI, TMRM and Calcein AM during reperfusion after 2 hours of ischemia. Arrows indicate PI stained nuclei and cell death.

PAGE 101

101 Figure 3 5 . Expression of autophag y proteins involved in initiation, elongat ion, and fusion in hepato cytes overexpressing SIRT1. Hepatocytes were infected with 10 MOI AdGFP or AdSIRT1 and subjected to I/R for analysis of autophagy proteins changes involved in (A) initiation (mTOR and AMPK) and (B) autophagosome maturation (ATG3, ATG4B, ATG7, ATG12 5, ATG14L, Beclin 1, RUBICON) and degradation (LAMP2A, Cathepsin D) . (n=3)

PAGE 102

102 Figure 3 6 . Mice infected with AdSIRT1 prevent the MPT onset and induce autophagy during I/R. Mice were injection of either AdLacZ or SIRT1 at 7x 10 11 . Liver tissue was collected before and after 45 minutes of ischemia and 20 minutes of reperfusion for immunoblot analyzes of (A) SIRT1 or (B) LC3 II. (n=4) Representative images of mouse livers infected with AdLacZ or A dSIRT1 after 45 minutes of ischemia and 20 minutes of reperfusion (C) in the presence of Rhodamine123 to label polarized mitochondria or (D) livers infected with AdmCherry GFP LC3. Autolysosome (Red) and Autophagosome (Yellow).

PAGE 103

103 Figure 3 7 . Ac tivation of SIRT1 suppresses I/R injury. Graphical interpretation for SIRT1 activation suppressing l iver I/R injury. SIRT1 enhances autophagy under normoxic conditions , but does not suppress the endogenous ischemic reduction mechanism. Upon reperfusion, au tophagy is initiated and the MPT onset is block to suppress hepatocyte death.

PAGE 104

104 CHAPTER 4 SIRT1 CAN FORM A COMPLEX WITH MITOFUSINS AND SIRT1 INDUCED AUTOPHAGY IS MEDIATED THROUGH MFN2 Introduction Chapters 3 d escribed S irtuin 1 ( SIRT1 ) induced autophagy as a cytoprotection mechanism against liver ischemia/reperfusion ( I/R ) injury, howe ver the mechanism of SIRT1 inducing autophagy during reperfusion remains unclear. In this chapter, we investigated potential targets of SIRT1 that may lead to th e sustaining a utophagy during reperfusion . Mitochondrial accumulation of SIRT1 has been proposed to mediate cytoprotection against I/R injury. Mitofusin 2 (MFN2) is an outer mitochondrial membrane protein that regulates autophagosomal lysosomal fusion. We hypothesize th at MFN2 plays a role in SIRT1 mitochondrial localization and enhanced autophagy. Using a combination of immunoprecipitation and immunoblot from an enhanced hepatocyte mitochondrial fraction , we have identified a novel SIRT1 mitofusin complex under nutrient rich conditions. Moreover, overexpression of SIRT1 led to the deacetylation of MFN2. The importance of MFN2 in SIRT1 induced autophagy and I/R injury was confirmed using an adenovirus expr essing short hairpin MFN2 (AdShMFN2). Genetic ablation of MFN2 led to attenuated autophagy and hypersensitivity to I/R, which SIRT1 overexpression could no t prevent . Th is study shows that MFN2 mediates SIRT1 induced autophagy to convey cytoprotection again st I/R injury . Background SIRT1 induced autophagy is a cytoprotective mechanism to suppress I/R in multiple different organs. Autophagy removes damaged and dysfunctio nal mitochondria to suppress tissue death during I/R (47;51;52) . SIRT1 is a lysine deacetylase that removes an acetyl group on a lysine residue to e xpose a positively charge amino

PAGE 105

105 group (335;336) . D eacetylation can change characteristics and function s of the target substrate in diverse ways that including protein protein interactions, protein stability, and enzymatic activity (189;332;337 339) . SIRT1 localizes to the nucleus and cytosol, nuclear SIRT1 deacetylates transcription factors to enhance protein expression involved in mitochon drial biogene sis and autophagy, while cytosolic SIRT1 interacts with autophagy proteins ATG 7, LC3, and the ATG 12 5 complex to enhance activity (189) . However, the mechanism for SIRT1 induced autophagy during liver I/R remains unclear. Recently, it has been proposed that a small fraction of SIRT1 localizes to the mitochondria (196;276) . Furthermore, ischemic preconditioning increases SIRT1 activity and localization to the mitochondria to protect against I/R injury (276) . However, the mechanism for SIRT1 localizing to the mitochondria and suppressing I/R injury remains unclear. Over one third o f all mitochondrial proteins are acetylated with the majority (53%) containing one or two acetylation sites (315) . Mitochondrial protein deacetylation plays a crucial role in the clearance of mitochondria through autophagy (269) . Mitofusins (MFNs) are large dynamin related GTPases with two isoforms , MFN1 and MFN2 . These mitofusins are over 80% homologou s (340) and localize on the outer mitochondrial membrane (340 343) . MFN1 is found exclusively on the mitochondria, while MFN2 has been found on mitochondria and endopl asmic reticulum (ER) at the ER m ito chondria contact sites (325;344) . These contact sites have been implicated in play a critical role in t he generation of autophagosomes (325) . MFN2 was originally identified as a mediator in mitochondrial fusion (345) , however recent evidence implicates MFN2 can play a role in several other processes

PAGE 106

106 including mitochondrial Ca 2+ homoeostasis, fission/fusion, mitochondrial autophagy, oxygen consumption, and energy production (340;344;346 348) . MFN2 is proposed to have a pivotal role in mito chondrial autophagy through two mechanism s . (A ) The PTEN induced putative kinase 1 (PINK1)/Parkin system alters MFN2 by post translat ional modifications that lead to mitophagy (349) . (B ) MFN2 recruitments the ATG14L Beclin PI3KIII complex to the ER mitochondria contact sit es for autophagosomal formation mediated by the Stx17, a Q SNARE, and facilities the insertion of Rab7, a fusion protein, o nto the autophago so mal membrane (325;348) , h owever the role of MFN2 in SIRT1 induced autophagy is unknown. The goal of this investi gation was to determine potential targets of SIRT1, the acetylation status of the substrate protein s , and their role in SIRT1 induced autophagy . Hepatocyte acetylation was determined using protein extracts and immunoblot with an Acetyl lysine (Acetyl K) antibody . SIRT1 immunopreciptation followed by immunoblot was performe d to determine SIRT1 interact s with MFN1 and MFN2. Acetylation of both MFN1 and MFN2 was confirmed in human liver tissue and hepatocytes by immunopreciptation and immunoblot. Overexpression of SIRT1 leads to deacetylation of MFN2, but not MFN1 . Next , we analyzed the role of MFN2 in SIRT1 induced autophagy and cytoprotection against I/R injury. MFN2 deficient hepatocytes impaired SIRT1 induced autophagy and lost cytoprotection against I/R injury . Furthermore, MFN2 deficiency alone leads to impaired autophagy and hypersensitivity to sublethal I/R conditions a s compared to control. Collectively, this study shows that MFN2 mediates SIRT1 induced autophagy.

PAGE 107

107 Materials A nd Methods Human Liver Tissue Collection Human liver tissue was collect as described in Chapter 2 . Human Tissue Cytosolic And Membrane Subfractionation Human tissue was homogenized in KRH containing protease and phosphatase inhibitors (1:1000) followed by two 1 minute centrifugations at 600 x g. The supernatant was collected and centrifuged at twice at 21,000 x g at 4 C for 15 minutes fo r the C fraction (supernatant) . The pellet was flash frozen in liquid nitrogen and thawed on ice. The pellet was suspended in 500 l hypotonic solution (10 mM Tris pH 7.6) followed by an additional homogenization to ensure plasma membrane disruption. The h omogenate was centrifuged at 600 x g at 4 C for 5 minutes to collect the supernatant, which was performed 3 times . The s upernatant was collected and centrifuged at 14,000 x g at 4 C for 10 minutes. The pellet was suspended in RIPA or cell lysis buffer fo r immunoblot or immunoprecipitation followed by an on ice incubation for 15 minutes. To collect the M fraction, the samples were centrifuged at 21x000 x g at 4 C for 15 minutes and the supernatant was collect. Hepatocyte Isolation A nd Culture Hepatocytes were isolated as described in Chapter 2 . Hepatocyte Adenoviral Infection Adenoviral infection was performed as described in Chapter 3 . Hepatocyte Cytosolic And Membrane Subfractionation Primary hepatocytes (3.5 x 10 6 ) were seeded in a 100 mm and incubated overnight in Waymouth media. Sub f ractionation was modified for isolated primary hepatocytes as described in fibroblast (350) . Briefly, hepat ocytes were scraped in KRH

PAGE 108

108 containing protease and phosphatase inhibitors (1:1000) followed by 1 minute centrifugation at 1,000 x g. The supernatant was collected and centrifuged at 21,000 x g at 4 C for 15 minutes to collect the supernatant as the solubl e fraction. The pellet was flash frozen in liquid nitrogen and thawed on ice. The pellet suspended in 500 l hypotonic solution (10 mM Tris pH 7.6) was followed by homogenization to ensure plasma membrane disruption. The homogenate was centrifuged at 600 x g at 4 C for 5 minutes. The s upernatant was collected and centrifuged at 14,000 x g at 4 C for 10 minutes. The pellet was suspended in RIPA or cell lysis buffer for immunoblot or immunoprecipitation followed by and ice incubation for 15 minutes , respect ively . To collect the M fraction, the samples were centrifuged at 21 , 000 x g at 4 C for 15 minutes and the supernatant was collect. Immunoprecipitation For immunoprecipitation, the lysates from the M fraction s were pooled together from 3 different mo use h epatocyte isolation using 6 0 x 10 6 hepatocytes per mouse for a total pr otein concentration between 25 0 350 µg. Using the pooled M fraction, 2 50 g of protein was incubated overnight with antibodies at 4° C overnight. For immunoprecipitation, Acetyl K antibody was purchased from ImmuneChem (Burnaby, British Colombia), while FOXO1and FOXO3A antibodies were purchased from Abcam (Cambridge, MA). All other antibodies were used to immunoprecipitation were the same antibodies used for immunoblot. Immunopreci pitates were incubated with Protein A/G Plus Agarose (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour at 4° C then eluted in 2x Laemmli buffer at 95°C. Samples were separated on polyacrylamide gels then electrophoretic ally transferred to nitrocellulos e membrane (Watman GmbH,

PAGE 109

109 Dassel, Germany). Rabbit and mouse immunoglobulin G purchased from Santa Cruz (Santa Cruz Biotechnology , Santa Cruz, CA) were used a s control for nonspecific binding. Immunoblotting Immunoblotting was performed as described in Chap ter 2 . F OX O1, MFN2 and MFN2 antibodies were purchased from Abcam (Cambridge, MA). VDAC, Cox IV, Lamin B, F OX O3A, and Acetylated Lysine (Acetyl K) were purchased from Cell Signaling (Danvers, MA). PGC 1 was purchase d from Novus Biologicals (Littleton, CO). Tamoxifen T reatment F or Inducible SIRT1 KO M ice Hepatocyte death was determined as previously reported in Chapter 2 . Hepatocyte Adenoviral Infection Adenoviral infection for AdGFP and AdSIRT1 was performed as described in Chapter 3 . For knockdown of MFN2, adenovirus harboring a small hairpin RNA targeting MFN2 (GCTACAGCTCATCATCAGTTA) was constructed (AdshMFN2) . AdshSCR and AdshMFN2 infection was performed following AdGFP and AdSIRT1 infection. Hepatocytes were infected with AdshSCR or AdshMFN2 for 16 hours in hormonally defined medium (RPMI 1640 medium with no g lutamine at pH 7.4, 0.3 mmol/L selenium, 1 µg/ml apo transferrin, 100 nmol/L insulin, 1.5 µmol/L free fatty acids, 1% penici llin/streptomycin) . Data Analysis Statistics were performed as descr ibed in Chapter 2.

PAGE 110

110 Results Novel Mitofusin SIRT1 Complex es SIRT1 is a class III histone deacetylase that targets multiple non histone targets. Protein a cetyla tion is a post translation modification that can regulate autophagy (189;190;269;351) . To determine the changes in acetylati on status, immunoblotting was performed with acetyl K antibody. Whole cell protein extracts did not detect noticeable changes in acetylation status upo n SIRT1 overexpression (Figure 4 1 A ) . Next, sub cellular fractionation suggested that SIRT1 accumulat es in the membrane fraction, especially with higher ti t ers of AdSIRT1 (Figure 4 1 B ). Immunoblotting with organelle specific markers and acetyl K antibody showed that the membrane fraction contained b oth the nucleu s and the mitochondria (Figure 4 1 C ) and SIRT1 overexpression deacetylated some proteins (arrow heads) (Figure 4 1D ). This suggests that proteins in the membrane fraction may be potential substrates for SIRT1 deacetylation . The localization a nd acetylation status of the known SIRT1 substrates FOX O1 (202;274;318) , F OX O3A (273;319) and PGC 1 (193;320) were determined (Figure 4 2 ). FOXO1 may have been deacetylate d, but the cytosolic localization would not lead to gene transcription. FOXO3A and PGC 1 were localized to the membrane f r action that contained the nucleus, but no detectable deacetylation event was observed . Thus, we focused on trying to ident ify potenti al new substrates for SIRT1 on the mitochondrial outer membrane . U sing the M fraction and SIRT1 immunoprecipitation , we successfully identified MFN1 and MFN2 protein complex with SIRT1 , but not with voltage dependent anion channel (VDAC) (Figure 4 3A). Next, we explore d if SIRT1 can deacetylate either MFN1 or MFN2, or both . SIRT1 overexpression substantially reduced the levels of

PAGE 111

111 acetylated MFN2, but not of MFN1 (Figure 4 3B ). MFN2 appears to be endogenously acetylated in both human livers and SIRT1 KO h epatocytes (Figure 4 3C and Figure 4 3D ). This suggest s that MFN2 is a SIRT1 substrate and endo genously acetylated independent of SIRT1 . MFN2 Mediates SIRT1 Induced Cytoprotection Against Liver I/R Injury MFN2 has recently been proposed to play a crucial role in autophagy (325;348) . SIRT1 induced autophagy provide s cytoprotection against I/R injury , thus we investigated if MFN2 is mediating SIRT1 induced cytoprotection . H epatoc ytes infected with AdshMFN2 significantly decreased MFN2 expression under basal condition s to approximately 64% compared to the control (Figure 4 4A ). Importantly, knockdown of MFN2 abrogated cytoprotection con ferred by SIRT1 overexpression demonstrating the crucial role of MFN2 i n SIRT1 dependent cytoprotection against I/R injury (Figure 4 4B) . As SIRT1 overexpression induces autophagy to p rotect against liver I/R injury, autophagic fl ux was assessed in hepatocytes with deficient MFN2 expre ssion after prolonged I/R . The autophagic flux sustained by SIRT1 overexpression after 2 h ours of reperfusion disappeared af ter silencing MFN2 (Figure 4 4C ). MFN2 deficient hepatocytes had LC3 II levels comparable to control cells. Moreover, we analyzed au tophagic flux in normoxic cells in the presence and absence of SIRT1 overexpression (Figure 4 4D). B asal autophagic flux prior to I/R was also markedly reduced by MFN2 knockdown, suggesting that MFN2 is required for basal autophagy. In agreement with our f indings, SIRT1 overexpression noticeably increased the levels of LC3 II both before and after the administration of CQ. However, silencing of MFN2 virtually abolished these increases, reinstating the importance of MFN2 in both basa l and SIRT1 mediated auto phagy.

PAGE 112

112 To further investigate M FN2 knock down impaired autophagy, some hepatocytes were subjected to 2 h ours of ischemia followed by reperfusion , which is a sublethal condition in control hepatocytes. C ell death after reperfusion was minimal in the hepatoc ytes treated with scrambled shRNA, but a significant increase in cell death was observed in MFN2 deficient cells (Figure 4 5A ). Furthermore, k nockdown of MFN2 did not affect the expression of SIRT1 and MFN1 during I/R (Figure 4 5 B ), but analysis of LC3 II demonstrated that silencing of MFN2 arrested autophagic flux (Figure 4 5 C ) and hepatocytes underwent reperfusion induced death. This evidence suggests that MFN2 mediates SIRT1 induced cytoprotection against liver I/R injury. Discussion In these studies, we investigated potential targets of SIRT1 . Based on our findings, we propose that (a) SIRT1 forms a complex with MFN1 and MFN2 , which are endogenously acetylated ; (b) MFN2 is a substrate for SIRT1 deacetylation; (c) SIRT1 induced autophagy and cytoprotection against I/R injury is mediated by MFN2 ; and (d) the loss of MFN2 sensitizes hepatocytes to I/R injury. Overall, we conclude that MFN2 plays an important role in autophagy regulation and that overexpression of SIRT1 deacetylates MFN2 , which may play a role in suppressing liver I/R injury (Figure 4 6) . Initially, we anticipated that overexpression of SIRT1 would deacetylate FOXO1, FOX O3A or PGC 1 because several studies suggest this occurrence under nutrient starvation, high fat diets, and oxidative stress (193;202;273;274;318 320) . However, we could not observe that overexpression of SIRT1 in primary hepatocytes deacetyla tes the endogenous levels of FOXO1, FOX O 3A or PGC 1 under nutrient rich conditions (Figure 4 2). Furthermore, SIRT1 overexpression did not increase the protein level of

PAGE 113

113 the transcription factor s target genes, which include ATG 4B (352) , ATG 3 (352) , Beclin 1 (113) and ATG 14L (353) as shown in Figure 3 5 . Hence , t his evidence suggests that SIRT1 overexpression did not alte r these transcription factors under these conditions . SIRT1 has an imperative role in mitoc hondrial metabolism and a small fraction of SIRT1 may localize with the mitochondria (196;276) . It is unknown if SIRT1 contain s a mitochondrial targeting sequence , which is required for transport into the mitochondrion . With recent studies suggesting SIRT1 localizes to the mitochondria , we set out to determine if SIRT1 could be interacting with the outer mitochondrial membrane proteins MFN2, MFN1, and VDAC (Figure 4 3) . Inte restingly, w e found that SIRT1 can form a complex with both mitofusins . MFN1 and MFN2 are k nown to form homodimers and heterodimers for mitochondria fusion and stabilize the mitochondria to the ER membrane (344) implicating that SIR T1 may localize to the ER m itochondrial contact sites to regulate autophagosome generation. Further investigations are required to determine the localization and possible linker proteins involved in this SIRT1 Mitofu sin complex . I n a proteomics study , using MV4 11 cells, a human myeloid leukemia cell line , MFN2 was discovered to be acetylated (354) . Using a combina tion of subfractionation, immunoprecipitation and immunoblot, we identified MFN2 and MFN1 as acetylated proteins (Fig ure 4 3). Overexpression of SIRT1 lead s to deacetylation of MFN2, but not MFN1 suggesting that MFN2 is a substrate for SIRT1. Deacetylation of MFN1 repress es ubiquitination and degradation (355) , but functional role s of MF N2 deacetylat ion is largely unknown. Mouse MFN2 contains forty one lysin e residues with four residues (Lys 37 , 215 , 355 , 654 ) located within the SIRT1 consensus sequence X 6 K(Ac) {Y,W,F} X 5 or

PAGE 114

114 X6 K(Ac) X5 {Y,W,F} (245) . Further studies are required to clarify the acetylation si tes of MFN2 . Furthermore, SIRT1 KO did not lead to an accumulation of acetylated MFN2 (Figure 4 3 ) suggesting that MFN2 acetylation is independent of SIRT1. Impaired mitochondrial autophagy leads to the accumulation of dysfunctional mitochondria and cell death during I/R (39;45;51;52) . Mitochondrial autophagy is a complex process with distinctive mechanisms. In neurons, mitochondrial depolarization lead s to mitophagy through the PINK 1 /Parkin system, which involv es ubiquitination and phosphorylation of MFN2 to stimulate autophagy (151;356) . In reticulocytes, NIX is used as the linker protein to eliminate mitochondria through autophagy in a manner independent of the PINK1/Parkin (154) with no known role for MFN2 . Recently , the mitochondrial acetyltransferase GCN5L has been proposed to play a role in mitochondrial autophagy (270) . GCN5L null cell s contain mitochondria that are globally deacetylated, which in turn led to the mitochondria accumulating LC3 II to facilit ate mitophagy implying that acetylation status i s an important regulatory mechanism for mitochondrial autophagy (270;271) . SIRT1 induced autophagy is cytoprotective again st liver I/R injury , but MFN2 deficient hepatocytes lose cytoprotection and autophagy flux (Figure 4 4) . This suggests that MFN2 has an important role in SIRT1 i nduced autophagy and cytoprotection against I/R injury . Coinciding with previous findings (325;357) , MFN2 deficiency caused an impair ed basal autophagy . Furthermore, MF N2 mediated SIRT1 induced autophagy under basal conditions and after I/R (Figure 4 4). Myocytes and MEF cell lines show that the depletion of MFN 2 decrease s mitochondrial membrane potential, altered Ca 2+ homeostasis, enh anced mitochondrial fission, and imp aired mitochondrial energetics (340;345;347;358;359) . This may suggest that an

PAGE 115

115 impaired autophagic response could be leading to the accumulation of dysfunctional mitochondria. I mpaired basal autophagy flux by MFN2 knock down also result ed in hypersensitivity to sublethal I/R conditions (Figure 4 5 ) , further supporting that impaired autophagy is a n imperative factor leading to I/R injury . MFN2 depleti on has been proposed to convey cytoprotective against I/R in cardiomyoctes by suppressing Ca 2+ influx and the MPT onset, however MFN2 depletion only delay s cell death , which occurs through an impairment in the fusion between autophagosome s and lysosome s at later stages (348) . This delay may be attributed to an impaired mitochondrial repolarization in MFN2 depleted cells that already have a defect in establishing mitochondrial membrane potential prior to I/R . Mitochondrial repolarization upon reperfusion leads to the mitochondrial Ca 2+ accumulation (45) . The calcium uniporter facilitatin g the Ca 2+ accumulation is dependent on mitochondrial membrane potential , which in turn leads to cell death (39) . Further studies are required to investigate the re establish ed mitochondrial membrane potential upon reperfusion in MFN2 KO cells. MFN2 dep leted cells causes several metabolic alteration s including l ower o xygen consumption rates, reducing substrate oxidation, decreasing mitochondrial oxidative phosphorylation , and increasing anaerobic glycolysis of glu cose but lower ing the rate s for glycogen synthesis (345;360) . In comparison, primary hepatocytes are highly dependent on aerobic respiration and utilize g lycogen driven anaerobic glycolysis to prevent ATP depletion (5) , and the inability to pr ocess glyco gen efficiently may be another factor l ead ing to the hepatocyte sensi tization to I/R injury. Further investigations to clarify the role of MFN2 during liver I/R injury are required.

PAGE 116

116 Overall, we conclude that MFN1 and MFN2 are endogenously acetylated in hu man livers and mouse hepatocytes . SIRT1 can form a complex with MFN 1 and MFN2, but only deacetylate the latter. Furthermore, MFN2 plays a critical role in basal and SIRT1 induced autophagy to convey cytoprotection against hepatic I/R injury.

PAGE 117

117 Figure 4 1. Acetylation changes in SIRT1 overexpressing hepatocytes . Hepatocytes were infected with 10 MOI AdGFP or AdSIRT1 . (A) Representative i mm unoblot of lysine acetylation from whole hepatocyte protein lysate s after adenoviral SIRT1 infection. (n=3) (B) Repr esentative immunoblot of hepatocyte subfractionation and localization of SIRT1 at different AdIRT1 MOIs. (C) Representative immunoblot for organelle identification in the cytosolic (C) and membrane (M) fractions after hepatocyte subfractionation using mark ers for the ER ( calnexin ) , nucleus (lamin B), m itochondria (MFN1, MFN2, COX IV, VDAC) and cytosol ( tubulin). (D) Representative i mmunoblot of a cetylated proteins in the cytosolic and membrane fract ions of SIRT1 overexpressing hepatocytes.

PAGE 118

11 8 Figu re 4 2 . PGC 1 , FOXO1 and FOXO3A localization and acetylation changes in isolated hepatocytes after SIRT1 overexpression. H epatocyte s were infected with 10 MOI AdGFP or AdSIRT1 followed by subfractionated into the C and M fractions . Using pooled M fraction s f rom three separate hepatocyte isolations, we obtained 250 g for immunoprecipitation using an Acetyl lysine antibody , which was followed by immunoblot for PGC1 , FOXO1 and FOXO3A. Figure 4 3 . MFN2 is a substrate of SIRT1. Hepatocytes were infected with 10 MOI AdGFP or AdSIRT1 and subfractionated into the C and M fractions. (A) Using pooled M fraction s from three separate hepatocyte isolations, we obtained 250 g for immunoprecipitation of SIRT1 , which was followed by immunoblot for MF N2, MFN1, and VDAC. (B) Using the 250 g of the M f raction, we immunoprecipitated a cetylated proteins or MFN2 followed by immunoblot analysis. (C) Using the M fraction from wild type (WT) and SIRT1 KO mice , acetylated proteins were immunoprecipitated and analyzed for MFN2 using immunoblot. (D) Human liver tissue was subfractionated and using the M fraction we performed immunoprecipitation and immunoblot as indicated.

PAGE 119

119 Figure 4 4 . SIRT1 induced autophagy is impaired by MFN2 k nockdown. (A) Hepatoc ytes were infected with different doses of AdShMFN2 to analyze protein expression using immunoblot. (n=3) (B) Hepa tocytes infected with 20 MOI AdshSCR or Ads hMFN2 and 10 MOI AdGFP or AdSIRT1 were subjected to 4 hours of ischemia followed by reperfusion to measure death. (n=3). (C) Autophagy flux was analyzed in hepa tocytes infected with 20 MOI AdshSCR or Ads hMFN2 and 10 MOI AdGFP or AdSIRT1 using LC3 immunoblot at 4 hours of ischemia and 120 minutes of reperfusion (n=3). Hepatocytes were treated with 10 M CQ for 1 hour prior to and continuously during I/R. (D) Hepatocyt es were infected with 20 MOI AdshSCR or Ads hMFN2 and 10 MOI AdGFP or AdSIRT1 for LC3 immunoblot in the presence and absence of CQ. Hepatocytes were treated with 10 M CQ for 1 hour. (n=3)

PAGE 120

120 Figure 4 5 . MFN2 de ficient hepatocytes are sensitiv e to I/R injury . Hepatocyt es were infected with 20 MOI AdshSCR or Ads hMFN2 and subjected to 2 hours of ischemia followed by reperfusion to measure (A) cell death and (B) protein expression of SIRT1, MF N1 and MFN2 using immunoblot . (n=3) (C) Hepatocyt es were infected with 20 MOI AdshSCR or Ads hMFN2 and subjected to 2 hour of ischemia followed by reperfusion for autophagy flux analysis using LC3 immunoblot in the presence and absence of CQ. Hepatocytes were treated with 10 M CQ for 1 hour prior to and continuously during I/R. (n=3)

PAGE 121

121 Figure 4 6 . MFN2 mediates SIRT1 induced autophagy to suppress the MPT onset and hepatocyte death during I/R. Graphical interpretation of the results i n C ha pters 4 . SIRT1 overexpression leads to the deacetylation of MFN2 which may facili tate SIRT1 induced autophagy leading to cytoprotection against I/R injury. Studies using MFN2 knock down hepatocytes have an impaired autophagic flux and lose SIRT1 induced cy toprotection against I/R injury .

PAGE 122

122 CHAPTER 5 SIRT1 OVEREXPRESSION SUPPRESSES THE LOSS OF MFN2 DURING LIVER ISCHEMIA/REPERFUSION INJURY Introduction Chapt er 4 d escribes Mitofusin 2 ( MFN2 ) m ediating Sirtuin 1 ( SIRT1 ) induced autophagy to convey cytoprotection against hepatic I/R injury . As shown in Chapter 3, autophagy initiation signals and autophagosome construction proteins were unaltered during reperfusion in SIRT1 overexpressing hepatocytes implicating an unidentified alteration was leading to sustained autophagic flux . Taken together, this would imply that MFN2 is critical for SIRT1 induced autophagy during reperfusion. In this chapter, we investigate the role of MFN2 in SIRT1 induced cytoprotection against liver I/R injury. We hypothesize that SIRT1 overexpression prevents the loss of MFN2 d uring I/R to sustain autophagic flux. Human live r tissue collected from the transection margin confirm ed the reduction of MFN2 d uring inflow occlusion induced ischemia . Using mouse liver I/R and primary hepatocyte simulated I/R models , we show that MFN2 is depleted in mouse liver tissue and primary hepatocytes after prolonged ischemia . Inhibitor studies were per formed in primary hepatocytes and determine d that c athepsins and calpains are involved in the d epletion of MFN2 . Hepatocytes overexpress ing SIRT1 and SIRT1 null hepatocytes were subject to I/R to identify changes in MFN2 expression . Overexpression of SIRT1 prevente d the loss of MFN2 during I/R, while SIRT1 knock out enhanced the reduction of MFN2 at shorter ischemic times . These data show s that MFN2 depletion is associated with reperfusion induced hepatocyte death and that SIRT1 overexpression prevents the loss of MFN2 , which may be a critical factor for the re establish ing autophagic flux and protection against liver I/R injury .

PAGE 123

123 Background Mitochondrial dysfunction is the causative mechanism underlying warm I/R injury wit hin the initial phase (<2hours) of reperfusion (38;39;52;59) . Upon reperfusion, the m itochondria undergo Ca 2+ overload leading to the unregulated opening of the mitochondrial permeability transition (MPT) pore , which in turn leads to the generation of reactive oxygen species (ROS) (39;45) . The a ccumulation of d ysfunctional mitochondri a generating reactive oxygen species further damages hepatocyte s leading to the intermediate and late phases of reperfusion injury (5;47) . Autophagy is the only k nown mechanism to sequester damaged and dysfunctional mitochondria for degradation . Autophagy impairment is a factor leading to the accumulation of dysfunctional mitochondrial and hepatocyte death (52) . M FN 2 is an outer mitochondrial membrane protein that play s a key role in bioenergetics, ER mitochondria membrane tethering , and mitochondrial autophagy (340;344;347;348;358) . MFN2 knock out studies provide evidence supporting a dual role for MFN2 during I/R by showing that the loss of MFN2 suppress es the initial mitochondrial Ca 2+ influx that would be letha l (359) , but inevitably these cells succumbed to death due to impaired autophagy (348) . Under basal conditions, t he loss of MFN2 increases the ex pression of glycolytic genes to up regulate anaerobic glycolysis, r epress es mitochondrial oxidative phosphorylation, and increase s the resistance to mitochondrial Ca 2+ overload (345 347;358;359) , which may lead to the initial protection agai nst early reperfusion injury in MFN2 KO cardiomyoctes . However , as reperfusion continues autophagy is required to remove aberrant proteins and damaged organelles to maintain homeostasis . T he loss of MFN2 impairs autophagosomal lysosomal fusion through inab ility to recruit RAB7, a membrane fusion

PAGE 124

124 protein, onto the autophagosomal membrane leading to the accumul ation of autophagosomes and cell death (348) . Liver I/R leads to the degradation of MFN2 in mous e livers (361) , however the mechanism for this reduction is unknown. The ubiquitin proteasomal system degrades MFN2 in a sequential mechanism that involves 1) phosphorylation , 2) ubiquitination and 3) membrane extraction by p97, an AAA+ ATPase (349;356) prior to proteasomal degradation . However, the involvement of the ubiquitin proteasomal system during I/R remains controversial (309) . Calpains are cysteine protease s that become activ at e d durin g I/R and cleavage cytosolic proteins leading to hepatocyte death (51;52;69) , while cathepsins have been suggeste d to translocate to the cytosol and cleavage proteins during I/R . However , the involvement of calpains and cathepsins in the degradation of MFN2 is unknown. The goal o f this in vestigation was to determine the changes in MFN2 expression during liver I/R injury, and identify whet her SIRT1 overexpression alters MFN2 levels upon reperfusion . Human and mouse livers subjected to inflow occlusion induced ischemia le d to the reduction of MFN2. Using the in vitro simulated I/R model, we show that prolonging ischemia led to the depletion of MFN2 and hepatocyte death. Furthermore, we investigated the reduction mechanism leading to the depletion of MFN2 in primary hepatoc yte s , which was shown to involve cysteine proteases . Finally, we modulated SIRT1 expression to determine whether SIRT1 could play a role in the reduction of MFN2 during liver I/R injury . Our data suggests that SIRT1 overe xpres sion sup presses MFN2 depletion during I/R , which may be a critical factor for to re establish ing autophagic flux and protection against liver I/R injury.

PAGE 125

125 Materials A nd Methods Reagents A nd Drug Treatments Reagents and drug treatments were per formed as described in Chapter 2 . Human Tis sue Collection Human liver tissue was collected as described in Chapter 2 . Mouse Liver In Vivo I/R A nd Adenoviral I njection Mouse livers were subjected to in vivo I/R as described in Chapter 3 . RT PCR And Qualitative PCR For RT PCR, cDNA (2 L) was used with 1 L of 100 nM primers for MFN2 CCTGCCTTTCTCCTTACCTTG 2 ACAGGAAACG ATG TGGGTCT actin GTGGGCCGCTCTAGGCACCAA actin CTCTTTG ATG TCACGCACGATTTC PCR was carried out usi ng New England Bio Labs One Taq DNA Polymerase system (Ipswich, MA) using the Eppendorf MasterCycler 5333 Version 2 ( Hamburg, Germany ). cDNA was denatured for at 95 C for 5 minutes followed by 32 cycles of 95 C for 30 seconds, 55 C for 30 seconds and 72 C for 1 minute. For qt PCR, cDNA was diluted 1 to 10 volumes with DNA/RNA free water from Fisher Scientific (Fair Lawn, New Jersey). SsoAdvaced SYBR Green Supermix was used as described by BioRad on a CFX 96 Real Time System C1000 Touch Thermo cycler (Hercu les, CA). qt PCR was performed using the primers listed above at 95 C for 5 minutes followed by 39 cycles of 95 C for 10 seconds, 55 C for 30 seconds

PAGE 126

126 and 65 C for 30 seconds followed by 5 cycles of 65 C for 30 seconds with 0.5 C increasing increments. Hepat oc yte Isolation A nd Culture Hepatocytes were isolated as described in Chapter 2 . Hepatocytes Simulated I/R Model Simulated I/R was performed as described in Chapter 2 . Adenoviral I nfection Adenoviral infection was performed as described in Chapters 3 an d 4 . Tamoxifen I nducible SIRT1 KO M ice SIRT1 KO was per formed as described in Chapter 2. Immunoblotting Immunoblotting was performed as described in Chapter 2 . Data Analysis Statistics were performed as described in Chapter 2. Results Ischemia Depletes MFN2 , And Reperfusion Sustains T he Loss To investigate the change in MFN2 during liver I/R, human liver tissue subjected to 15 minutes of inflow occlusion induced ischemia was analyzed for MFN2 expression using immunoblot. MFN2 significantly decrease d com pared to controls (Figur e 5 1A). Using our in vivo and in vitro mouse model s of I/R injury , we confirmed that the prolonged ischemia leads to the depletion of MFN2 and does not recover during reperfusion (Figure 5 1B and Figure 5 1C ). The loss of MFN2 was correlated with hepatocytes death as shown in Figure 2 2, and reperfusion after 2 hours of ischemia did

PAGE 127

127 not lead to a further reduction in MFN2 (Figure 5 4C) and hepatocytes remained viable. To determine if MFN2 depletion is due to chemical instability or normal protein turn over, we treated hepatocytes with cyclohexi mide, a protein synthesis inhibitor (Figure 5 2 A ). MFN 2 was stable up to 24 hours in W aymouth media suggesting that MFN2 is actively being degraded during I/R. Interestingly, the MFN2 mRNA was also targeted for degradation during I/R (Figure 5 2B), which furth er substantiated that preservation of the MFN2 protein during I/R may play an important role to I/R injury. To inves tigate the mechanism s involved in the reduction of MFN2 during ischemia , primary hepatocytes were treated with inhibitor s for the proteasome (MG 132), cathepsins (E64d) and calpains ( ALLM) . Although several studies ind icate that MFN2 is ubiquitinated and degraded by the proteasome, hepatocytes treated with MG 132 did not suppre ss the loss of MFN2 during ischemia (Figure 5 3A). To explore the role of cathepsins, we treated hepatocytes with E64d, a p an cysteine cathepsin inhibitor (Figure 5 3 B ). In the presence of E64d, the reduction of MFN2 was substantially suppressed at 2 hours of ischemia , but extension of the ischemic time to 4 hours le d to MFN2 depletion. As shown in Figures 2 7 and 3 4 , after 2 hours of isc hemia hepatocytes do not have autophagic flux , and MFN2 is still reduced . This could result from the lack of ATP during ischemia, which suppresses highly energy dependent autophagic process. Prolonging ischemia lead s to the activation of calpains (51 53) . I nhibition of calpains using Acetyl Leucine Leucine Methionine did not suppress the ischemic depletion of MFN2 (Figure 5 3C) , thus sug gesting that during prolonged ischemia MFN2 is depleted by an unknown protease ( s ) . Surprisingly, a combination of cathepsin and calpain during reperfusion after 4 hours of ischemia led to a gradual

PAGE 128

128 increase in MFN2 expression suggesting cysteine proteases are remaining active and degrading MFN2 during reperfusion (Figure 5 3D) . This increase may suggest that reperf usion leads to MFN2 translation but active cysteine proteases prevent an accumulation , which may impair autophagy . Further studies focusing on reperfusion and protein translation are required . It is important to note that inhibition of cathepsins and calpa ins lead to an increased MFN2 expression during reperfusion , bu t only calpain inhibition prevented the loss of SIRT1 and provided protection against hepatic I/R injury as shown in Figure s 2 5 and 2 7. This may suggest that preservation of MFN2 alone during reperfusion may not suppress I/R injury, and other proteins cleaved by calpains are required. Overexpression O f SIRT1 Suppresses MFN2 Depletion Previously , we have shown that SIRT1 induc es autophagy after I/R and MFN2 is required for a functional a utophagic flux . This would imply that during reperfusion MFN2 is required to establish autophagic flux in hepatocytes overexpressing SIRT1. Prior to I/R, Hepatocytes overexpressing SIRT1 did not have an significant elevation in M FN2 compared to the control under nutrient rich conditions (Figure 5 4A). During ischemia, the majority of MFN2 reduced in t he presence or absence of AdSIRT1 , but a small fract ion of MFN2 was resistant to prolonged ischemia and reperfusion in SIRT1 overexpressing hepatocytes (Figure 5 4B) . Furthermore, these cells did not accumulate MFN2 after 60 minutes of reperfusion suggesting that the active cysteine protease s may not target this MFN2 as a substrate . As shown in Figure 2 3, SIRT1 KO led to heightened sensitivity to sublethal conditions of I/R, thus we evaluated changes in MFN2 protein expression (Figure 5 4C ). Surprisingly, SIRT1 KO led to an increase in MFN2 expression under basal conditions, but a gr eater reduction in MFN2 occurred

PAGE 129

129 after 2 hours of ischemia , which did not recover during reperfusion . This may suggest that MFN2 in SIRT1 KO cells are more sensitive to proteolysis . Further investigations are required to identify potential proteases and ac tivity leading to this reduction and the mechanism causing elevations in MFN2 under basal conditions. Collectively, these data suggest that SIRT1 plays a role in the degradation of MFN2 during hepatic I/R injury. Autophagosom e lysosome fusion is mediated b y MFN2 through the recruitment of Rab7 to the autophagosomal membrane (348) . Hepa tocytes overexpressing SIRT1 repress MFN2 depletion during I/R and have f unctional autophagosome lysosome fusion indicated by the re establish ed autophagic flux during reperfusion. This sugge sts that inhibition of MFN2 loss by SIRT1 may lead to autophagy flux during reperfusion. SIRT1 overexpress ing hepatocytes sustained autophagy flux at 120 minutes of reperfusion, which is impaired in MFN2 deficient hepatocytes subjected to similar condition s as shown in F igure 4 4 . Under these conditions, MFN2 was sustained in hepatocytes infected with AdshSCR, but not in MFN2 deficient hepatocytes (Figure 5 4 D ), which further supports the notion that SIRT1 repressed MFN2 depletion leading to autophagosomal lysosomal fusion during reperfusion for the re establish ment of autophagic flux . To determine if SIRT1 overexpression could suppress MFN2 depletion in the liver , we infected mice with AdSIRT1 and subjected them to in vivo liver I/R injur y (Figure 5 4E ). MFN2 expression did not increase in liver prior to I/R, but MFN2 levels were significantly elevated upon reperfusion in livers overexpressing SIRT1 , which was similar to our hepatocyte model. Overall, these studies show that SIR T1 overexpr ession suppresses the loss of MFN2 during I/R and supports our hypothesis that MFN2 mediates SIRT1 induced autophagy to suppress liver I/R injury.

PAGE 130

130 Discussion In these studies, we investigated MFN2 expression during liver I/R injury. Based on our findings, we propose that (a) both MFN2 mRNA and protein levels decrease during ischemia and remain depleted during reperfusion through cysteine proteases ; (b ) SIRT1 overexpression suppresses the loss of MFN2 and (c ) MFN2 mediates SIRT1 induced autophagy during I/R injury . Overall, we conclude that multiple factors lead to the MFN2 depletion during I/ R and SIRT1 overexpression prevents MFN2 depletion , which may play a role in re establish ing autophagic flux during reperfusion (Figure 5 5 ). Mitochondrial dysfunction plays a central role leading to liver I/R injury. Studies have proposed that MFN 2 has a critical role in autophagy (325;348) and Ca 2+ regulation (344;347;359) , which are two factors leading to hepatocy te death during I/R (39;45;47;51) . An influx of Ca 2+ leads to the unregulated opening of the MPT pore ca using mitochondrial dysfunction (39) . Impaired autophagy results in the accumulation of dysfunctional mitochondria releasing proapoptotic factors and generating ROS leading to cell death (47) . MFN2 depletion studies show that dissociating the mitochondria from the ER can reduced Ca 2+ influx in cardio mycytes (344) , but also alters bioenerge tics by placing a higher demand on the glycolytic pathway for ATP production by increasing glycolytic gene expression and depressing mitochondrial oxidative phosphorylation (340;345;358) . MFN2 depleted myocytes block the MP T onset but only delay death , which is caused by impaired autophagosome lysosome fusion (348) . MFN2 has been shown to be involved with liver I/R injury, h owever the role of MFN2 remains unknown . M ouse livers subjec ted to liver I/R injury le d to a reduction in MFN2 , which coincides with a previous report (361) and resembles human livers that underw ent 15

PAGE 131

131 minutes of inflow occlusion induced ischemia (Figure 5 1). During warm I/R injury, damage to the parenchymal cell s i s the major factor leading to liver dysfunction and patient mortality (27;35;46) . Using isolated hepatocytes, we con firmed that prolonged ischemia leads to the depletion of MFN2 that does not recover during reperfusion (Figure 5 1) and hepatocytes u nderwent reperfusion induced death as shown in Figure 2 2. To f urther clarify the role of ische mia in the depletion MFN2, we analyzed the protein stability of MFN2 and mRNA levels during I/R (Figure 5 2). Hepatocytes treated with cycloheximide, a protein s ynthesis inhibitor , maintained MFN2 expression up to 24 hours suggesting that MFN2 depletion is likely caused by ischemi a . Furthermore, hepatocytes undergoing I/R have a significant reduction in MFN2 mRNA . This indicates that both the protein and mRNA are decreasing during ischemia leading to reperfusion induced hepatocyte death . Prolong ed ischemia and hepatocyte death are causative factors leading to post liver resection failure , however the role of MFN2 during liver I/R in unclear (32 35) . O verexpression of MFN2 in hepatocytes suppressed mitochondrial dy sfunction and cell death after I/R (361) . This may suggest that preventing MFN2 depletion may also protected against I/R injury, however the MFN2 reduction mechanism is unknown, thus i nitially we set forth to characterize the proteases involved in the depletion of MFN2 . MFN2 degradation occurs through post translational modifications that recruit AAA + ATPase for MFN2 membrane extraction and transport to the proteasome for degradation (151;356) . P roteasomal degradation is controversi al during ischemia (309) , thus we t reated hepatocytes with inhibitors for the proteas ome, cathepsins and calpains. Cathepsins are a family of lysosomal proteins the hydrolyze proteins but are

PAGE 132

132 proposed to translocate to the cytosol, and remain active (71;73;76;83;362) . Calpains are Ca 2+ dependent cysteine proteases that increase in activity du ring prolonged ischemia (51;66;68;69;72) . P roteasomal inhibition did not inhibit the loss of MFN2. Furthermore, we did not observe any mo tility shif t s in MFN2 that would indicate ubiquitination (149;151;356) . It is unknown whether cathepsins proteolyzes MFN2 , however c athepsin inhibition does reduce cellular damage during I/R (67;75;83) . Indeed, cysteine catheps in inhibition suppressed the reduction of MFN2 at 2 hours of ischemia (Figure 5 3). Furthe rmore, prolonging ischemia led to the depletion of M FN2 in a manner independent of c athe psins and hepatocytes underwent reperfusion induced death as in Figure 2 7 . Prolonging ischemia leads to heighten ed activity of calpains from the accumulation of intrac ellular Ca 2+ levels (51;52) . Inhibition of c alpains did not suppress the loss of MFN2 during ischemia , but hepatocytes remain ed viable during reperfusion as shown in Figu re 2 5 . Thus, if MFN2 is required for autophagy induced cytoprote ction , the levels should increase during reperfusion. Using the combination approach , we co nfirmed the re establish ment of MFN2 in the presence of cysteine protease inhibitors , E64 d and ALLM . Based on these studies, we propose that MFN2 is degraded in two phases: (A ) i schemic degradation occurs through the cysteine family of cathepsin s and an unknown protease( s) lead to depletion and (B ) activated cathepsins and calpains during reperfusion prevent the accumulation of MFN2 that may lead to the impair ment in autophagy lysosome fusion during reperfusion. Autophagy is a cytoprotective mechanism to suppress liver I/R injury (47) . As shown in previous chapters, SIRT1 induced autophagy is mediated by MFN2 to suppress liver I/R injury. This would imply that MFN2 mus t be expressed during liver I/R

PAGE 133

133 in order for functional autophagy to occur and protect against liver I/R injury. SIRT1 deacetylates PGC1 increase s MFN2 expression (363) . However, h epatocytes overexpressing SIRT1 did not have heightened MFN2 protein level , which further confi rmed t hat PGC1 is not deacetylated under nutrient rich conditions as shown in C hapter 4. The vast majority of MFN2 was depleted during ischemia, but a small fraction of MFN2 was resistant to degradation after 4 hours of ischemia. Hepatocytes overexpressi ng SIRT1 had approximately a 40% increase in MFN2 expression as compared to the control. Upon reperfusion, the sustained activation of cysteine proteases rapidly impair ed the accumulation of MFN2, however the levels of MFN2 did not fluctuate in SIRT1 overe xpressing hepatocytes . These data in combination with SIRT1 induced deacetylation of MFN2 as shown in Figure 4 3 may suggest that a small fraction of MFN2 is deac etylated to repress I/ R induced proteolysis, which in turn would allow for a functional autophagosomal lysosomal fusion and autophagy flux. This notion is supported by hepatocytes overexpressing SIRT1 sustain autophagic flux and repress MFN2 depletion after 4 hours of ischemia and 120 minutes reperfusion , which was impaired in MFN2 deficient hepatocytes . It would not be unusual for deacetylati on to repress degradation, based on the deacetylation of MFN1 repressing ubiquitination and degradation (355) . Further evidence to support that SIRT1 has a role in MFN2 proteolysis leading to dysfunctional autophagy and c ell death was demonstrated in SIRT1 null hepatocytes . In sublethal I/R conditions, SIRT1 null hepatocytes after 2 hours of ischemia had a significant reduction in MFN2 that did not recover and autophagy flux was impaired leading to reperfusion induced cell death . More studies are required to investigate whether SIRT1 targets other substrates during short ischemic

PAGE 134

134 times followed reperfusion . To translate these studies, we overexpressed SIRT1 in mice and confirmed that MFN 2 expression was greater after l iver I/R injury thus suggesting in vivo MFN2 depletion can be repressed by SIRT1 overexpression and that the repression of MFN2 may lead to functional autophagic flux during reperfusion. Overall, these studies provide evidence for a possible mechanism involved in SIRT1 induced autophagy providing a functional autophagic response during reperfusion . These data suggests that SIRT1 deac e tylation of MFN2 may repress the degradation and depletion of MFN2 during ischemia without impairing the endogenous degradation me chanisms , which in turn may lead to the function al a utophagosome lysosomal fusion and the degradation of dysfunctional mi tochondria to provide cytoprotection against liver I/R injury.

PAGE 135

135 Figure 5 1 . MFN2 expression changes in human and mouse liver tissue and primary m ouse hepatocytes during I/R . Immunoblot of MFN2 expression in (A) human liver tissue (n=3) , (B ) mouse liver tissue (n=3) and (C ) mouse primary hepatocytes (n=4) subjected to indicated times of I/R. **,p<0.01 an d ***,p<0.001. Figure 5 2. MFN2 protein stability and mRNA expression during I/R in primary hepatocytes. (A) Immunoblot of MFN2 expression in hepatocytes treated with 35 M cycloheximide (CHX) for various times. (n =3) (B ) mRNA analysis using RT PCR and qtPCR of MFN2 from primary hepatocy tes during various times of I/R. ( n =3). *** p<0.001

PAGE 136

136 Figure 5 3 . Inhibition of cysteine c athepsin s suppresses the ischemic reduction of MFN2 in primary hepatocytes during I/R. (A) Immunoblot analysis of MFN2 expressi on during ischemia in cells treated with various concentrations of MG 132, a proteasome inhibitor. Hepatocytes were treated with MG 132 for 1 hour prior to and continuously during ischemia. (n=4) (B) Immunoblot analysis of MFN2 expression during ischemia in cells treated with various concentrations of E64d, a pan cysteine cathepsin protease inhibitor . Hepatocytes were treated with E64d for 1 hour prior to and continuously during ischemia. (n=4) (C) Immunoblot analysis of MFN2 expression during ischemia in cells treated with various concentrations of ALLM, a calpain inhibitor. Hepatocytes were treated with ALLM for 16 hour prior to and continuously during ischemia. (n=3) (D ) Immunoblot analysis of MFN2 expression during ischemia in cells treated with 10 M A LLM and 10 M E64d. Hepatocytes were treated with ALLM for 16 hour and E64d for 1 hour prior to and continuously during ischemia. (n=3) *,p<0.05 and ** , p<0.01

PAGE 137

137 Figure 5 4 . SIRT1 modulation affects MFN2 degradation during I/R. (A) Hepatocytes infected with 10 MOI AdGFP or AdSIRT1 were subjected to ischemia for MFN2 analysis using 15 g of protein extract . (n=3) (B) Hepatocytes infected with 10 MOI AdGFP or AdSIRT1 were subjected to 4 hours of ischemia and 60 minutes of reperfusion for MFN2 analysis usin g 30 g of protein extract. (n=3) (C) Wild type ( WT ) and SIRT1 KO hepatocytes were subjected to 2 hours of ischemia and reperfusion to analyze MFN2 expression using immunoblot. (n=3) (D ) Hepatocytes infected with 10 MOI AdGFP or AdSIRT1 and 20 MOI AdshSCR or Ads hMFN2 were subjected to 4 hours of ischemia and 120 minutes of reperfusion for MFN2 analysis using 30 g of protein extract. (n=2) (E) Mice wer e injected with AdSIRT1 or AdLac Z followed by liver ischemia for 45 minutes and 20 minutes of reperfusion f or MFN2 immunoblot. (n=4) *,p<0.05 and ** p<0.01

PAGE 138

138 Figure 5 5 . Overexpression of SIRT1 suppresses the MFN2 depletion during liver I/R injury. Grap hical interpretation of SIRT1 overexpression leading to the preservati on of MFN2 protein levels to suppress liver I/R injury.

PAGE 139

139 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS Summary The research presented here explored the therapeutic potential for targeting SIRT1 to suppress liver I/R injury . At the time these studies began there were no investigatio ns into the role of SIRT1 during liver I/R injury. Since that time two studies have been published implicating the importance of SIRT1 for cytoprotection against liver I/R injury in mice that were fasted or rats that underwent ischemic p reconditioning . Thi s research evaluated SIRT1 in duced autophagy to suppress liver I/R injury . We are the first to report (A ) a protein complex containing SIRT1 and mitofusins, ( B ) an acetylated MFN2 as a substrate for SIRT1, (C ) MFN2 mediating SIRT1 induced autophagy, ( D ) calpain proteolysis of SIRT1 during I/R , (E ) the biphasic proteolysis of MFN2 involving cysteine proteases during I/R, and (F ) overexpression of SIRT1 leading to the repress ion of MFN2 proteolysis during I/R (Figure 6 1) . Collectively, t hese studies suppo rt the therapeutic potential for targeting SIRT1 during liver I/R injury . Autophagy is an endogenous cytoprotective mechanism against liver I/R injury. A utophagy stimulation may lead to remodeling of the heterogeneous mitochondrial population found within a cell to create a more resistant phenotype agai nst I/R. Furthermore, autophagy can also support the removal of damaged mitochondria after I/R. SIRT1 and MFN2 both have been proposed to play a role in autophagy and I/R injury , however there is no known comm on mechanistic link between SIRT1 and MFN2. Human livers subjected to 15 minutes of ischemia le d to the reduction of both SIRT1 and MFN2 . M ouse livers and isolated hepatocy tes exposed to prolonged ischemia le d to the depletion of SIRT1 and MFN2 , which provided the experimental models to

PAGE 140

140 explore the mechanism s involved in the protein reduction, autophagy, and potential interactions . This study provides evidence that SIRT1 and MFN2 have in integral role in I/R injury. Genetic ablation of either MFN2 or SIRT1 leads to heightene d sensitivity to a sublethal dose of I/R . Both MFN2 knock down and SIRT1 knock out hepatocytes had a substantia l amou n t of cell death during reperfusion after 2 hours of ischemia in comparison to control hepatocytes. Furthermore, SIRT1 and MFN2 protein levels are significantly reduced after 2 hours of ischemia but were sustained during reperfusion in hepatocytes, a nd these cells can r emain viable . Prolonging the ischemic time to 4 hours caused SIRT1 a nd MFN2 depletion , and reperfusion induced mitochondrial dysfunction lead to cell death. Adenoviral overexpression of SIRT1 was used in hepatocytes and mouse livers to show that SIRT1 overexpression repressed MFN2 proteolysis, blocked the MPT onset, re establish ed autophagic flux and suppressed I/R injury. These cytoprotective effects of SIRT1 overexpression were subsequently lost in MFN2 deficient hepatocytes sugge sting that MFN2 mediates SIRT1 induced cytoprotection against I/R injury (Figure 6 1) . The mechanisms involved in the proteolysis of SIRT1 and MFN2 further supported the important of maintaining these proteins during I/R . The reduction mechanism s involved in th e depletion of SIRT1 and MFN2 during liver I/R was an unexplored area, thus we set forth to provide some mechanistic insight (Figure 6 1) . To investigate potential mechanisms, hepatocytes were treated with inhibitors for the proteasome, cathepsins and calp ains followed by simulated I/R to evaluate the protein levels . For clarify, the degradation can be broken down into 3 different stages: 2 hours

PAGE 141

141 of ischemia (sublethal ischemia) , 4 hours of ischemia (prolonged ischemia), and 60 minutes of reperfusion (reperfusion) . The proteasome inhibitor , MG 132, failed to suppress the reduction of either SIRT1 or MFN2 at all stages. Sublethal ischemia leads to cathepsin proteolysis of SIRT1 and MFN2 , while calpain inhibition had no effect . This suggests that cathep sin activation and degradation of SIRT1 and MFN2 does not led to mitochondrial dysfunction and hepatocyte death . Prolonged ischemia leads to the depletion of SIRT1 and MFN2 . C alpain inhibition only partial ly preserved SIRT1 without affecting MFN2 levels . C athepsin inhibition had no affection on the depletion of SIRT1 and MFN2. This suggests that other protease s are being activated that lead s to the reduction of SIRT1 and depletion of MFN2 between 2 4 hours of ischemia. R eperfusion sustained the depletion of SIRT1 and MFN 2 . Calpain inhibition maintained the prolonged ischemia SIRT1 level , while increasing MFN2 expression. Cathepsin inhibition did not alter the depletion of SIRT1, while increasing MFN2 expression . This suggests that upon reperfusion MFN2 may b e translated but cysteine proteases prevent MFN2 accumulation leading to cell death. Moreover, cathepsin inhibition only suppress MFN2 leading to cell death, while calpain inhibition suppress ed the depletion of both SIRT1 and MFN2 in addition to suppressin g cell death , which clearly supports the importance of calpain activation leading to reperfusion induced cell death . To establish a link between SIRT1 and MFN2, a series of experiments were performed on isolated hepatocytes and human liver tissue to achieve an enriched mitochondrial fraction for immunopreciptation and immunoblotting. This study show s that SIRT1 can immunoprecipitate MFN2 and MFN1 suggesting a novel protein complex that is on the outer mitochondrial membrane or ER mitochondria conta ct site s .

PAGE 142

142 Furthermore, SIRT1 overexpression led to a decrease in the acetylated levels of MFN2 suggesting MFN2 is a substrate for SIRT1. MFN2 was endogenously acetylated in human liver tissue and hepatocytes from both wild type and SIRT1 KO mice suggesting that SIRT1 may not be involved in the acetylation process of MFN2. Further studies are warranted to identify the acetylation site(s) of MFN2 , the protein interactions, and complex location. Finally, this study shows that SIRT1 and MFN2 play a role in auto phagy and MFN2 mediates SIRT1 induced autophagy to provide cytoprotection against I/R injury. SIRT1 knock out and MFN2 knock d own impair ed the autophagic response under basal conditions . Furthermore, SIRT1 induced autophagy was impaired by MFN2 knock down under similar condition, thus suggesting that MFN2 mediates SIRT1 induced autophagy and supports the crucial role of MFN2 in autophagy . Sublethal I/R in SIRT1 knock out and MFN2 knock down hepatocytes lead to dysfunctional autophagy during reperfusion resu lting in hepatocyte death. Under nutrient rich conditions, SIRT1 overexpression le d to an increase in ATG 7 levels without alters autophagy initiation signaling suggestin g a possible mechanism for SIRT 1 induced autophagy that is dependent on MFN2 . H owever , after I/R, SIRT1 overexpression did not change the autophagy initiation signals or the expression of protein s involved in autophagosome construction . During reperfusion, SIRT1 overexpression did not the inhibition of mTOR and activation of AMPK , thus t he impairment may be downstream at the depletion of MFN 2 leading to impaired autophagosome lysosome fusion . SIRT1 overexpression repressed t he depletion of MFN2 and enabled the re establish ment of autophagic flux during reperfusion . Further investi gations are required to evaluate the role of MFN2 in the

PAGE 143

143 autophagy mechanism before and after I/R injury. Overall, these studies suggest (1) an important role of MFN2 in the autophagy mechanism and (2) MFN2 mediates SIRT1 induced autophagy to protect against liver I/ R injury . Clinical Application O f SIRT1 Activation Current approaches to suppress liver I/R injury are only beneficial for short ischemic times, ca use vascular damage and prolong the surgical time. Pharmacological agents to suppress liver I/R injury target specific area s of a multifactorial mechanism and remain disappointing . A novel approach to suppress liver I/R injury is through the up regulation of autophagy (47) , which is an endogenous mechanism to remove dysfunctional organelles and proteins. Impaired autophagy is a factor that contributes to liver I/R injury and enhancing a utophagy conveys cytoprotection (47;51;53) . SIRT1 is a pleiotr opic protein that induces autophagy and protects against liver I /R injury by enhancing autophagy and repressing the loss of MFN2 , thus targeting SIRT1 therapeutically may provide some clinical benefits. SIRT1 activators are being tested both experimentally and clinically for several different diseases . While the studies presented here focused mostly on overexpression of SIRT1, we have shown that RSV and SRT17 2 0 can suppress hepatocyte death and enhance autophagy. Further studies are required to test the saf ety and applicability of using these SIRT1 agonists as therapeutics to suppress I/R injury . Studies have shown that RSV is cytoprotective against live r I/R injury in mice , but have been no clinical studies addressing RSV induced cytoprotection against live r I/R injury (36;326) . Current ly, phase 1 clinical trials have been performed testing the effects of SIRT1 agonists in several different diseases (Table 6 1) , but no clinical study has investigated SIRT1 activation during liver I/R injury .

PAGE 144

144 SIRT1 activation using SRT2104 in a cl inical trial has a 2 4 hour T max and 16 18 hour half life and appears to be safe with only minor side effects (364) . However, some limitation s for SIRT1 activation still need to be address. First, SIRT1 activation may provide cytoprotection against liver I/R injury, but is suggested to re press liver regeneration after mouse liver resection surgeries (198) . Dose and tim e study optimiz ation s for the ad ministration of SIRT1 agonists need to be performed to address this potential limitation . Second, patients undergoing liver resection mostly have an underlying disease that may alter SIRT1 expression and activity to change cellular metabolism, and mitochondrial function . This may cause an adver se effect from SIRT1 activation during or after resection surgery , which can be address by using mouse liver disease models . Our study focuses on healthy livers undergoing prolonged ischemia and do es not address the underlying liver diseases. Third, pharma cological activators can always provide a degree of no n specific activation, which may cause adverse effects that were not observed in our model s using a n adenovirus expressing SIRT1 . While our studies suggest SIRT1 h as the potential to be a beneficial ther apeutic target , several more studies are required to demonstrate the safety and effi cacy of pharmacological activation of SIRT1 to suppress liver I/R injury. Overall Conclusion M itofusin 2 mediates Sirtuin 1 induced autophagy to suppress liver I/R injury.

PAGE 145

145 Figure 6 1. MFN2 mediates SIRT1 induced autophagy to suppress against liver I/R injury. (A) Normal hepatocyte response to I/R . During ischemia, SIRT1 and MFN2 are reduced by cathepsins. Prolonging ischemia activates calpains which may be the lethal event leading to reperfusion injury. Calpain activation depletes SIRT1, but other factors deplete MFN2. Upon reperfusion, SIRT1 rema ins depleted, while MFN2 expression increase but are subjected to removal through cysteine proteases. Autophagy is dysfunctional leading to the MPT onset and cell death. (B) Activation of SIRT1 enhances autophagy and increases ATG 7 expression. During ische mia, the endogenous reduction pathway remains activated but SIRT1 activation leads to heighted levels of MFN2 that are resistant to degradation during reperfusion. Autophagy is functional and the MPT onset is blocked leading to the re establishment of auto phagic flux to sustain viable hepatocytes. (C) Activation of SIRT1 in MFN2 deficient hepatocytes impairs basal autophagy flux leading to the depletion of MFN2 during reperfusion, the MPT onset and hepatocyte death. Collectively, these data show that SIRT1 induced autophagy can suppress liver I/R injury.

PAGE 146

146 Table 6 1. SIRT1 agonist s and clinical trials are controversial . Author year Participants Objective Agonist and Dose Duration Brief description of the o utcome Brasnyo 2011 (365) Type 2 d iabetics Insulin sensitivity and oxidative status 5 mg resveratrol Twice daily 28 days Decreased insulin and oxidative stress Timmers 2011 (366) Obese men Metabolic changes 75 mg resveratrol Twice daily 30 days Reduced glucose and insulin, reduced liver fat, improved muscle mitochondrial function Wong 2011 (367) Obese men and women with hypertension Flow mediated dilution 30 270 mg resveratrol Signal dose Increase flow mediated dilation De Groote 2012 (368) Healthy obese men and women Oxidative stress markers 150 mg resveratrol Daily 4 weeks Increase antioxidant activity by increase redox related genes Poulsen 2013 (369) Healthy obese men Metabolic effects 500 mg resveratrol Three times daily 4 weeks No effect on insulin sensitivity, blood pressure, lipid oxidation, and metabolic markers Yoshino 2012 (370) Non obese women Metabolic effects 75 mg resveratrol Daily 12 weeks No effect on i nsulin sensitiv ity t o skeletal muscle metabolism Libri 2012 (364) Healthy elderly men and women Metabolic effects 0.5 2 g SRT2104 Daily 28 days Decrease cholesterol, triglycerides, improved mitochondrial fun ction Vekatasubramanian 2013 (371) Healthy cigarette smokers Metabolic effects 2 g SRT2104 Daily 28 days No effect on cardiac rhythm, decreased cholesterol

PAGE 147

147 LIST OF REFERENCES 1. Kuntz,E., and Kuntz,H.D. 2008. Hepatology, Textbook and Atlas . Springer. Berlin. 32 76 pp. 2. Colorectal Cancer Ass ociation of Canada 2014. A guide to understanding colorectal cancer therapies . 3. Treyer,A ., and Musch,A. 2013. Hepatocyte polarity. Compr. Physiol 3 :243 287. 4. Gebhardt,R., and Matz Soja,M. 2014. Liver zonation: Novel aspects of its regulation and its impact on homeostasis. World J. Gastroenterol. 20 :8491 8504. 5. Lemasters,J.J. 2001. Hyp oxic, Ischemic, and Reperfusion injury to the liver . Lippincott Williams & Wilkins. 257 279 pp. 6. Schiff,E.R., Sorrell,M.F., and Madrey,W.C. 2006. Schiff's Diseases of the Liver . Lippincott William & Wilkins. Philadelphia. 7. Kim,J.S., He,L., and Lema sters,J.J. 2003. Mitochondrial permeability transition: a common pathway to necrosis and apoptosis. Biochem. Biophys. Res. Commun. 304 :463 470. 8. Broughan,T.A., Naukam,R., Tan,C., Van De Wiele,C.J., Refai,H., and Teague,T.K. 2008. Effects of hepatic zon al oxygen levels on hepatocyte stress responses. J. Surg. Res. 145 :150 160. 9. Gurusamy,K.S., Gonzalez,H.D., and Davidson,B.R. 2010. Current protective strategies in liver surgery. World J. Gastroenterol. 16 :6098 6103. 10. Chang,C.H., Chau,G.Y., Lui,W. Y., Tsay,S.H., King,K.L., and Wu,C.W. 2004. Long term results of hepatic resection for hepatocellular carcinoma originating from the noncirrhotic liver. Arch. Surg. 139 :320 325. 11. Helling,T.S. 2006. Liver failure following partial hepatectomy. HPB (Oxf ord) 8 :165 174. 12. Friedman,L.S. 2010. Surgery in the patient with liver disease. Trans. Am. Clin. Climatol. Assoc. 121 :192 204. 13. Hammond,J.S., Guha,I.N., Beckingham,I.J., and Lobo,D.N. 2011. Prediction, prevention and management of postresection l iver failure. Br. J. Surg. 98 :1188 1200.

PAGE 148

148 14. Shah,B.C., Ullrich,F., Smith,L., Leiphrakpam,P., Ly,Q., Sasson,A., and Are,C. 2011. National trends in discharge disposition after hepatic resection for malignancy. HPB (Oxford) 13 :96 102. 15. Weigand,K., Brost,S., Steinebrunner,N., Buchler,M., Schemmer,P., and Muller,M. 2012. Ischemia/Reperfusion injury in liver surgery and transplantation: pathophysiology. HPB Surg. 2012 :176723. 16. Crissien,A.M., and Frenette,C. 2014. Current management of hepatocellular carcinoma. Gastroenterol. Hepatol. (N. Y. ) 10 :153 161. 17. Keen,W.W. 1899. IV. Report of a Case of Resection of the Liver for the Removal of a Neoplasm, with a Table of Seventy six Cases of Resection of the Liver for Hepatic Tumors. Ann. Surg. 30 :267 283. 18. Richardson,A.J., Laurence,J.M., and Lam,V.W. 2012. Portal triad clamping versus other methods of vascular control in liver resection: a systematic review and meta analysis. HPB (Oxford) 14 :355 364. 19. Poon,R.T., Fan,S.T., Lo,C.M. , Liu,C.L., Lam,C.M., Yuen,W.K., Yeung,C., and Wong,J. 2004. Improving perioperative outcome expands the role of hepatectomy in management of benign and malignant hepatobiliary diseases: analysis of 1222 consecutive patients from a prospective database. An n. Surg. 240 :698 708. 20. Kennedy,P.A., and Madding,G.F. 1977. Surgical anatomy of the liver. Surg. Clin. North Am. 57 :233 244. 21. Jones,R.M., Moulton,C.E., and Hardy,K.J. 1998. Central venous pressure and its effect on blood loss during liver resecti on. Br. J. Surg. 85 :1058 1060. 22. Melendez,J.A., Arslan,V., Fischer,M.E., Wuest,D., Jarnagin,W.R., Fong,Y., and Blumgart,L.H. 1998. Perioperative outcomes of major hepatic resections under low central venous pressure anesthesia: blood loss, blood transf usion, and the risk of postoperative renal dysfunction. J. Am. Coll. Surg. 187 :620 625. 23. Cucchetti,A., Ercolani,G., Vivarelli,M., Cescon,M., Ravaioli,M., La,B.G., Zanello,M., Grazi,G.L., and Pinna,A.D. 2006. Impact of model for end stage liver disease (MELD) score on prognosis after hepatectomy for hepatocellular carcinoma on cirrhosis. Liver Transpl. 12 :966 971. 24. Teh,S.H., Christein,J., Donohue,J., Que,F., Kendrick,M., Farnell,M., Cha,S., Kamath,P., Kim,R., and Nagorney,D.M. 2005. Hepatic resection of hepatocellular carcinoma in patients with cirrhosis: Model of End Stage Liver Disease (MELD) score predicts periope rative mortality. J. Gastrointest. Surg. 9 :1207 1215.

PAGE 149

149 25. Schroeder,R.A., Marroquin,C.E., Bute,B.P., Khuri,S., Henderson,W.G., and Kuo,P.C. 2006. Predictive indices of morbidity and mortality after liver resection. Ann. Surg. 243 :373 379. 26. Kamath,P. S., and Kim,W.R. 2007. The model for end stage liver disease (MELD). Hepatology 45 :797 805. 27. Hsu,K.Y., Chau,G.Y., Lui,W.Y., Tsay,S.H., King,K.L., and Wu,C.W. 2009. Predicting morbidity and mortality after hepatic resection in patients with hepatocellu lar carcinoma: the role of Model for End Stage Liver Disease score. World J. Surg. 33 :2412 2419. 28. Teh,S.H., Sheppard,B.C., Schwartz,J., and Orloff,S.L. 2008. Model for End stage Liver Disease score fails to predict perioperative outcome after hepatic resection for hepatocellular carcinoma in patients without cirrhosis. Am. J. Surg. 195 :697 701. 29. Colle,I., Verhelst,X., Vanlander,A., Geerts,A., Van,V.H., Berrevoet,F., Rogiers,X., and Troisi,R.I. 2013. Pathophysiology and management of post resection liver failure. Acta Chir Belg. 113 :155 161. 30. Ellett,J.D., Atkinson,C., Evans,Z.P., Amani,Z., Bal ish,E., Schmidt,M.G., Schnellmann,R.G., and Chavin,K.D. 2011. Toll like receptor 4 knockout mice are protected from endothelial overactivation in the absence of Kupffer cells after total hepatic ischemia/reperfusion. Liver Transpl. 17 :1089 1098. 31. Elle tt,J.D., Atkinson,C., Evans,Z.P., Amani,Z., Balish,E., Schmidt,M.G., van,R.N., Schnellmann,R.G., and Chavin,K.D. 2010. Murine Kupffer cells are protective in total hepatic ischemia/reperfusion injury with bowel congestion through IL 10. J. Immunol. 184 :584 9 5858. 32. Schon,M.R., Kollmar,O., Wolf,S., Schrem,H., Matthes,M., Akkoc,N., Schnoy,N.C., and Neuhaus,P. 2001. Liver transplantation after organ preservation with normothermic extracorporeal perfusion. Ann. Surg. 233 :114 123. 33. Ikeda,T., Yanaga,K., Kishikawa,K., Kakizoe,S., Shimada,M., and Sugimachi,K. 1992. Ischemic injury in liver transplantation: difference in injury sites between warm and cold ischemia in rats. Hepatology 16 :454 461. 34. Caldwell Kenkel,J.C., Currin,R.T., Tanaka,Y., Thurman,R.G ., and Lemasters,J.J. 1989. Reperfusion injury to endothelial cells following cold ischemic storage of rat livers. Hepatology 10 :292 299. 35. Huguet,C., Gavelli,A., and Bona,S. 1994. Hepatic resection with ischemia of the liver exceeding one hour. J. Am. Coll. Surg. 178 :454 458.

PAGE 150

150 36. Gedik,E., Girgin,S., Ozturk,H., Obay,B.D., Ozturk,H., and Buyukbayram,H. 2008. Resveratrol attenuates oxidative stress and histological alterations induced by liver ischemia/reperfusion in rats. World J. Gastroenterol. 14 :71 01 7106. 37. Theodoraki,K., Tympa,A., Karmaniolou,I., Tsaroucha,A., Arkadopoulos,N., and Smyrniotis,V. 2011. Ischemia/reperfusion injury in liver resection: a review of preconditioning methods. Surg. Today 41 :620 629. 38. Kim,J.S., He,L., Qian,T., and Lemasters,J.J. 2003. Role of the mitochondrial permeability transition in apoptotic and necrotic death after ischemia/reperfusion injury to hepatocytes. Curr. Mol. Med. 3 :527 535. 39. Kim,J.S., Wang,J.H., and Lemasters,J.J. 2012. Mitochondrial permeabili ty transition in rat hepatocytes after anoxia/reoxygenation: role of Ca2+ dependent mitochondrial formation of reactive oxygen species. Am. J. Physiol Gastrointest. Liver Physiol 302 :G723 G731. 40. Bronk,S.F., and Gores,G.J. 1991. Efflux of protons from acidic vesicles contributes to cytosolic acidification of hepatocytes during ATP depletion. Hepatology 14 :626 633. 41. Gores,G.J., Nieminen,A.L., Fleishman,K.E., Dawson,T.L., Herman,B., and Lemasters,J.J. 1988. Extracellular acidosis delays onset of cell death in ATP depleted hepatocytes. Am. J. Physiol 255 :C315 C322. 42. Baines,C.P., Kaiser,R.A., Purcell,N.H., Blair,N.S., Osinska,H., Hambleton,M.A., Brunskill,E.W., Sayen,M.R., Gottlieb,R.A., Dorn,G.W. et al . 2005. Loss of cyclophilin D reveals a critic al role for mitochondrial permeability transition in cell death. Nature 434 :658 662. 43. Nakagawa,T., Shimizu,S., Watanabe,T., Yamaguchi,O., Otsu,K., Yamagata,H., Inohara,H., Kubo,T., and Tsujimoto,Y. 2005. Cyclophilin D dependent mitochondrial permeability transition regulates some necrotic but not apoptotic cell death. Nature 434 :652 658. 4 4. Nastos,C., Kalimeris,K., Papoutsidakis,N., Tasoulis,M.K., Lykoudis,P.M., Theodoraki,K., Nastou,D., Smyrniotis,V., and Arkadopoulos,N. 2014. Global consequences of liver ischemia/reperfusion injury. Oxid. Med. Cell Longev. 2014 :906965. 45. Kim,J.S., J in,Y., and Lemasters,J.J. 2006. Reactive oxygen species, but not Ca2+ overloading, trigger pH and mitochondrial permeability transition dependent death of adult rat myocytes after ischemia reperfusion. Am. J. Physiol Heart Circ. Physiol 290 :H2024 H2034. 46. Lentsch,A.B., Kato,A., Yoshidome,H., McMasters,K.M., and Edwards,M.J. 2000. Inflammatory mechanisms and therapeutic strategies for warm hepatic ischemia/reperfusion injury. Hepatology 32 :169 173.

PAGE 151

151 47. Kim,J.S., Nitta,T., Mohuczy,D., O'Malley,K.A., Mo ldawer,L.L., Dunn,W.A., Jr., and Behrns,K.E. 2008. Impaired autophagy: A mechanism of mitochondrial dysfunction in anoxic rat hepatocytes. Hepatology 47 :1725 1736. 48. Hunter,D.R., and Haworth,R.A. 1979. The Ca2+ induced membrane transition in mitochondr ia. III. Transitional Ca2+ release. Arch. Biochem. Biophys. 195 :468 477. 49. Hausenloy,D., Wynne,A., Duchen,M., and Yellon,D. 2004. Transient mitochondrial permeability transition pore opening mediates preconditioning induced protection. Circulation 109 : 1714 1717. 50. Kim,J.S., Wang,J.H., Biel,T.G., Kim,D.S., Flores Toro,J.A., Vijayvargiya,R., Zendejas,I., and Behrns,K.E. 2013. Carbamazepine suppresses calpain mediated autophagy impairment after ischemia/reperfusion in mouse livers. Toxicol. Appl. Pharm acol. 273 :600 610. 51. Kim,J.S., Wang,J.H., Biel,T.G., Kim,D.S., Flores Toro,J.A., Vijayvargiya,R., Zendejas,I., and Behrns,K.E. 2013. Carbamazepine suppresses calpain mediated autophagy impairment after ischemia/reperfusion in mouse livers. Toxicol. Appl. Pharmacol. 273 :600 610. 52. Kim,J.S., Nitta,T., Mohuczy,D., O'Malley,K.A., Moldawer,L.L., Dunn,W.A., Jr., and Behrns,K.E. 2008. Impaired autophagy: A mechanism of mitochondrial dysfunction in anoxic rat hepatocytes. Hepatology 47 :1725 1736. 53. W ang,J.H., Ahn,I.S., Fischer,T.D., Byeon,J.I., Dunn,W.A., Jr., Behrns,K.E., Leeuwenburgh,C., and Kim,J.S. 2011. Autophagy suppresses age dependent ischemia and reperfusion injury in livers of mice. Gastroenterology 141 :2188 2199. 54. Javadov,S., and Karma zyn,M. 2007. Mitochondrial permeability transition pore opening as an endpoint to initiate cell death and as a putative target for cardioprotection. Cell Physiol Biochem. 20 :1 22. 55. Kokoszka,J.E., Waymire,K.G., Levy,S.E., Sligh,J.E., Cai,J., Jones,D.P. , MacGregor,G.R., and Wallace,D.C. 2004. The ADP/ATP translocator is not essential for the mitochondrial permeability transition pore. Nature 427 :461 465. 56. Vianello,A., Casolo,V., Petrussa,E., Peresson,C., Patui,S., Bertolini,A., Passamonti,S., Braido t,E., and Zancani,M. 2012. The mitochondrial permeability transition pore (PTP) an example of multiple molecular exaptation? Biochim. Biophys. Acta 1817 :2072 2086. 57. Kim,J.S., Ohshima,S., Pediaditakis,P., and Lemasters,J.J. 2004. Nitric oxide: a signaling molecule against mitochondrial permeability transition and pH dependent cell death after reperfusion. Free Radic. Biol. Med. 37 :1943 1950.

PAGE 152

152 58. Qian,T., Nieminen,A. L., Herman,B., and Lemasters,J.J. 1997. Mitochondrial permeability transition in pH dependent reperfusion injury to rat hepatocytes. Am. J. Physiol 273 :C1783 C1792. 59. Lemasters,J.J., Qian,T., He,L., Kim,J.S., Elmore,S.P., Cascio,W.E., and Brenner,D.A. 2002. Role of mitochondrial inner membrane permeabilization in necrotic cell death, apoptosis, and autophagy. Antioxid. Redox. Signal. 4 :769 781. 60. Lemasters,J.J. 1999. V. Necrapoptosis and the mitochondrial permeability transition: shared pathways to necrosis and apoptosis. Am. J. Physiol 276 :G1 G6. 61. Sanada,S., Komuro,I., and Kitakaze,M. 2011. Pathophysiology of myocardial reperfusion injury: preconditioning, postconditioning, and translational aspects of protective measures. Am. J. Physiol Heart Circ. Physiol 301 :H1723 H1741. 62. Kalogeris,T., Baines,C.P., Krenz,M., and Korthuis,R.J. 2012. Cell biology of ischemia/reperfusion injury. Int. Rev. Cell Mol. Biol. 298 :229 317. 63. Baines,C.P. 2009. The molecular composition of the mitochondrial per meability transition pore. J. Mol. Cell Cardiol. 46 :850 857. 64. Baines,C.P. 2011. How and when do myocytes die during ischemia and reperfusion: the late phase. J. Cardiovasc. Pharmacol. Ther. 16 :239 243. 65. Murphy,E., and Steenbergen,C. 2008. Ion tra nsport and energetics during cell death and protection. Physiology. (Bethesda. ) 23 :115 123. 66. Croall,D.E., and Ersfeld,K. 2007. The calpains: modular designs and functional diversity. Genome Biol. 8 :218. 67. Tsubokawa,T., Solaroglu,I., Yatsushige,H. , Cahill,J., Yata,K., and Zhang,J.H. 2006. Cathepsin and calpain inhibitor E64d attenuates matrix metalloproteinase 9 activity after focal cerebral ischemia in rats. Stroke 37 :1888 1894. 68. Hernando,V., Inserte,J., Sartorio,C.L., Parra,V.M., Poncelas No zal,M., and Garcia Dorado,D. 2010. Calpain translocation and activation as pharmacological targets during myocardial ischemia/reperfusion. J. Mol. Cell Cardiol. 49 :271 279. 69. Kohli,V., Madden,J.F., Bentley,R.C., and Clavien,P.A. 1999. Calpain mediates ischemic injury of the liver through modulation of apoptosis and necrosis. Gastroenterology 116 :168 178. 70. Villalpando Rodriguez,G.E., and Torriglia,A. 2013. Calpain 1 induce lysosomal permeabilization by cleavage of lysosomal associated membrane prote in 2. Biochim. Biophys. Acta 1833 :2244 2253.

PAGE 153

153 71. Repnik,U., Hafner,C.M., and Turk,B. 2014. Lysosomal membrane permeabilization in cell death: Concepts and challenges. Mitochondrion. 72. Yamashima,T., Tonchev,A.B., Tsukada,T., Saido,T.C., Imajoh Ohmi,S., Momoi,T., and Kominami,E. 2003. Sustained calpain activation associated with lysosomal rupture executes necrosis of the postischemic CA1 neurons in primates. Hippocampus 13 :791 800. 73. Turk,V., Stoka,V., Vasiljeva,O., Renko,M., Sun,T., Turk,B., and Turk,D. 2012. Cysteine cathepsins: from structure, function and regulation to new frontiers. Biochim. Biophys. Acta 1824 :68 88. 74. Woolbright,B.L., Ramachandran,A., McGill,M.R., Yan,H.M., B ajt,M.L., Sharpe,M.R., Lemasters,J.J., and Jaeschke,H. 2012. Lysosomal instability and cathepsin B release during acetaminophen hepatotoxicity. Basic Clin. Pharmacol. Toxicol. 111 :417 425. 75. Baskin Bey,E.S., Canbay,A., Bronk,S.F., Werneburg,N., Guiccia rdi,M.E., Nyberg,S.L., and Gores,G.J. 2005. Cathepsin B inactivation attenuates hepatocyte apoptosis and liver damage in steatotic livers after cold ischemia warm reperfusion injury. Am. J. Physiol Gastrointest. Liver Physiol 288 :G396 G402. 76. Guicciard i,M.E., Leist,M., and Gores,G.J. 2004. Lysosomes in cell death. Oncogene 23 :2881 2890. 77. Werle,B., Julke,B., Lah,T., Spiess,E., and Ebert,W. 1997. Cathepsin B fraction active at physiological pH of 7.5 is of prognostic significance in squamous cell car cinoma of human lung. Br. J. Cancer 75 :1137 1143. 78. Wildenthal,K., and Decker,R.S. 1980. The role of lysosomes in the heart. Adv. Myocardiol. 2 :349 358. 79. Ollinger,K., and Brunk,U.T. 1995. Cellular injury induced by oxidative stress is mediated through lysosomal damage. Free Radic. Biol. Med. 19 :565 574. 80. Frederiks,W.M., and Marx,F. 1989. Changes in acid phosphatase activity in rat liver after ischemia. Histochemistry 93 :161 166. 81. Yamashima,T., Kohda,Y., Tsuchiya,K., Ueno,T., Yamashita,J., Yoshioka,T., and Kominami,E. 1998. Inhibition of ischaemic hippocampal neuronal death in primates with cathepsin B inhibitor CA 074: a novel strategy for neuropro tection based on 'calpain cathepsin hypothesis'. Eur. J. Neurosci. 10 :1723 1733. 82. Yang,D., Han,Y., Zhang,J., Ding,C., Anagli,J., and Seyfried,D.M. 2011. Improvement in recovery after experimental intracerebral hemorrhage using a selective cathepsin B and L inhibitor. J. Neurosurg. 114 :1110 1116.

PAGE 154

154 83. Xu,M., Yang,L., Rong,J.G., Ni,Y., Gu,W.W., Luo,Y., Ishidoh,K., Katunuma,N., Li,Z.S., and Zhang,H.L. 2014. Inhibition of cysteine cathepsin B and L activation in astrocytes contributes to neuroprotection a gainst cerebral ischemia via blocking the tBid mitochondrial apoptotic signaling pathway. Glia 62 :855 880. 84. Johansson,A.C., Appelqvist,H., Nilsson,C., Kagedal,K., Roberg,K., and Ollinger,K. 2010. Regulation of apoptosis associated lysosomal membrane p ermeabilization. Apoptosis. 15 :527 540. 85. Papadopoulos,D., Siempis,T., Theodorakou,E., and Tsoulfas,G. 2013. Hepatic ischemia and reperfusion injury and trauma: current concepts. Arch. Trauma Res. 2 :63 70. 86. Chouillard,E.K., Gumbs,A.A., and Cherqui,D. 2010. Vascular clamping in liver surgery: physiology, indications and techniques. Ann. Surg. Innov. Res. 4 :2. 87. Clavien,P.A., Yadav,S., Sindram,D., and Bentley,R.C. 2000. Protective effects of ischemic precon ditioning for liver resection performed under inflow occlusion in humans. Ann. Surg. 232 :155 162. 88. Clavien,P.A., Selzner,M., Rudiger,H.A., Graf,R., Kadry,Z., Rousson,V., and Jochum,W. 2003. A prospective randomized study in 100 consecutive patients un dergoing major liver resection with versus without ischemic preconditioning. Ann. Surg. 238 :843 850. 89. Jeon,J., Watkins,A., Wagener,G., Samstein,B., Guarrera,J., Goldstein,M., Meltzer,J., Kato,T., and Emond,J.C. 2013. Complex hepatectomy under total va scular exclusion of the liver: impact of ischemic preconditioning on clinical outcomes. World J. Surg. 37 :838 846. 90. Reimer,K.A., and Jennings,R.B. 1996. Ischemic preconditioning: a brief review. Basic Res. Cardiol. 91 :1 4. 91. Eisen,A., Fisman,E.Z., Rubenfire,M., Freimark,D., McKechnie,R., Tenenbaum,A., Motro,M., and Adler,Y. 2004. Ischemic preconditioning: nearly two decades of research. A comprehensive review. Atherosclerosis 172 :201 210. 92. Hausenloy,D.J., and Yellon,D.M. 2009. Preconditioning and postconditioning: underlying mechanisms and clinical application. Atherosclerosis 204 :334 341. 93. Bahde,R., and Spiegel,H.U. 2010. Hepatic ischaemia reperfusion injury from bench to bedside. Br. J. Surg. 97 :1461 1475. 94. Akhtar,M.Z., Henderson,T. , Sutherland,A., Vogel,T., and Friend,P.J. 2013. Novel approaches to preventing ischemia reperfusion injury during liver transplantation. Transplant. Proc. 45 :2083 2092.

PAGE 155

155 95. Yamashita,Y., Shimada,M., Hamatsu,T., Rikimaru,T., Tanaka,S., Shirabe,K., and Su gimachi,K. 2001. Effects of preoperative steroid administration on surgical stress in hepatic resection: prospective randomized trial. Arch. Surg. 136 :328 333. 96. Pan,L.J., Zhang,Z.C., Zhang,Z.Y., Wang,W.J., Xu,Y., and Zhang,Z.M. 2012. Effects and mecha nisms of store operated calcium channel blockade on hepatic ischemia reperfusion injury in rats. World J. Gastroenterol. 18 :356 367. 97. Uchida,M., Takemoto,Y., Nagasue,N., Dhar,D.K., Kohno,H., and Nakamura,T. 1994. Effect of verapamil on hepatic reperfu sion injury after prolonged ischemia in pigs. J. Hepatol. 21 :217 223. 98. Rubinsztein,D.C., Codogno,P., and Levine,B. 2012. Autophagy modulation as a potential therapeutic target for diverse diseases. Nat. Rev. Drug Discov. 11 :709 730. 99. 2010. Focus ing on autophagy. Nat. Cell Biol. 12 :813. 100. Kaushik,S., and Cuervo,A.M. 2012. Chaperone mediated autophagy: a unique way to enter the lysosome world. Trends Cell Biol. 22 :407 417. 101. Kunz,J.B., Schwarz,H., and Mayer,A. 2004. Determination of four sequential stages during microautophagy in vitro. J. Biol. Chem. 279 :9987 9996. 102. Codogno,P., Mehrpour,M., and Proikas Cezanne,T. 2012. Canonical and non canonical autophagy: variations o n a common theme of self eating? Nat. Rev. Mol. Cell Biol. 13 :7 12. 103. Dunn,W.A., Jr., Cregg,J.M., Kiel,J.A., van der Klei,I.J., Oku,M., Sakai,Y., Sibirny,A.A., Stasyk,O.V., and Veenhuis,M. 2005. Pexophagy: the selective autophagy of peroxisomes. Autop hagy. 1 :75 83. 104. Lemasters,J.J. 2014. Variants of mitochondrial autophagy: Types 1 and 2 mitophagy and micromitophagy (Type 3). Redox. Biol. 2 :749 754. 105. Kraft,C., Deplazes,A., Sohrmann,M., and Peter,M. 2008. Mature ribosomes are selectively degraded upon starvation by an autophagy pathway requiring the Ubp3p/Bre5p ubiquitin protease. Nat. Cell Biol. 10 :602 610. 106. Hamasaki,M., Noda,T., Baba,M., and Ohs umi,Y. 2005. Starvation triggers the delivery of the endoplasmic reticulum to the vacuole via autophagy in yeast. Traffic. 6 :56 65. 107. Mijaljica,D., and Devenish,R.J. 2013. Nucleophagy at a glance. J. Cell Sci. 126 :4325 4330.

PAGE 156

156 108. Okamoto,K. 2014. Or ganellophagy: Eliminating cellular building blocks via selective autophagy. J. Cell Biol. 205 :435 445. 109. Ravikumar,B., Sarkar,S., Davies,J.E., Futter,M., Garcia Arencibia,M., Green Thompson,Z.W., Jimenez Sanchez,M., Korolchuk,V.I., Lichtenberg,M., Luo ,S. et al . 2010. Regulation of mammalian autophagy in physiology and pathophysiology. Physiol Rev. 90 :1383 1435. 110. Dalby,K.N., Tekedereli,I., Lopez Berestein,G., and Ozpolat,B. 2010. Targeting the prodeath and prosurvival functions of autophagy as nov el therapeutic strategies in cancer. Autophagy. 6 :322 329. 111. Settembre,C., Di,M.C., Polito,V.A., Garcia,A.M., Vetrini,F., Erdin,S., Erdin,S.U., Huynh,T., Medina,D., Colella,P. et al . 2011. TFEB links autophagy to lysosomal biogenesis. Science 332 :1429 1433. 112. Jung,C.H., Ro,S.H., Cao,J., Otto,N.M., and Kim,D.H. 2010. mTOR regulation of autophagy. FEBS Lett. 584 :1287 1295. 113. Sanchez,A.M., Csibi,A., Raibon,A., Cornille,K., Gay,S., Bernardi,H., and Candau,R. 2012. AMPK promotes skeletal muscle au tophagy through activation of forkhead FoxO3a and interaction with Ulk1. J. Cell Biochem. 113 :695 710. 114. Kim,D.H., Sarbassov,D.D., Ali,S.M., King,J.E., Latek,R.R., Erdjument Bromage,H., Tempst,P., and Sabatini,D.M. 2002. mTOR interacts with raptor to form a nutrient sensitive complex that signals to the cell growth machinery. Cell 110 :163 175. 115. Guertin, D.A., Stevens,D.M., Thoreen,C.C., Burds,A.A., Kalaany,N.Y., Moffat,J., Brown,M., Fitzgerald,K.J., and Sabatini,D.M. 2006. Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt FOXO and PKCalp ha, but not S6K1. Dev. Cell 11 :859 871. 116. Sarbassov,D.D., Ali,S.M., Kim,D.H., Guertin,D.A., Latek,R.R., Erdjument Bromage,H., Tempst,P., and Sabatini,D.M. 2004. Rictor, a novel binding partner of mTOR, defines a rapamycin insensitive and raptor indepe ndent pathway that regulates the cytoskeleton. Curr. Biol. 14 :1296 1302. 117. Hosokawa,N., Hara,T., Kaizuka,T., Kishi,C., Takamura,A., Miura,Y., Iemura,S., Natsume,T., Takehana,K., Yamada,N. et al . 2009. Nutrient dependent mTORC1 association with the ULK 1 Atg13 FIP200 complex required for autophagy. Mol. Biol. Cell 20 :1981 1991. 118. Hara,T., Takamura,A., Kishi,C., Iemura,S., Natsume,T., Guan,J.L., and Mizushima,N. 2008. FIP200, a ULK interacting protein, is required for autophagosome formation in mamma lian cells. J. Cell Biol. 181 :497 510.

PAGE 157

157 119. Russell,R.C., Tian,Y., Yuan,H., Park,H.W., Chang,Y.Y., Kim,J., Kim,H., Neufeld,T.P., Dillin,A., and Guan,K.L. 2013. ULK1 induces autophagy by phosphorylating Beclin 1 and activating VPS34 lipid kinase. Nat. Cel l Biol. 15 :741 750. 120. Kahn,B.B., Alquier,T., Carling,D., and Hardie,D.G. 2005. AMP activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 1 :15 25. 121. Gwinn,D.M., Shackelford,D.B., Egan,D.F., Mihaylova,M.M., Mery,A., Vasquez,D.S., Turk,B.E., and Shaw,R.J. 2008. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol. Cell 30 :214 226. 122. He,C., Zhu,H., Li,H., Zou,M.H., and Xie,Z. 2013. Dissociation of Bcl 2 Beclin1 complex by ac tivated AMPK enhances cardiac autophagy and protects against cardiomyocyte apoptosis in diabetes. Diabetes 62 :1270 1281. 123. Kim,J., Kim,Y.C., Fang,C., Russell,R.C., Kim,J.H., Fan,W., Liu,R., Zhong,Q., and Guan,K.L. 2013. Differential regulation of dist inct Vps34 complexes by AMPK in nutrient stress and autophagy. Cell 152 :290 303. 124. Wirth,M., Joachim,J., and Tooze,S.A. 2013. Autophagosome formation -the role of ULK1 and Beclin1 PI3KC3 complexes in setting the stage. Semin. Cancer Biol. 23 :301 309. 125. Backer,J.M. 2008. The regulation and function of Class III PI3Ks: novel roles for Vps34. Biochem. J. 410 :1 17. 126. Obara,K., and Ohsumi,Y. 2011. Atg14: a key player in orchestrating autophagy. Int. J. Cell Biol. 2011 :713435. 127. Wei,Y., Pattin gre,S., Sinha,S., Bassik,M., and Levine,B. 2008. JNK1 mediated phosphorylation of Bcl 2 regulates starvation induced autophagy. Mol. Cell 30 :678 688. 128. Itakura,E., and Mizushima,N. 2009. Atg14 and UVRAG: mutually exclusive subunits of mammalian Beclin 1 PI3K complexes. Autophagy. 5 :534 536. 129. Fimia,G.M., Stoykova,A., Romagnoli,A., Giunta,L., Di,B.S., Nardacci,R., Corazzari,M., Fuoco,C., Ucar,A., Schw artz,P. et al . 2007. Ambra1 regulates autophagy and development of the nervous system. Nature 447 :1121 1125. 130. Matsunaga,K., Saitoh,T., Tabata,K., Omori,H., Satoh,T., Kurotori,N., Maejima,I., Shirahama Noda,K., Ichimura,T., Isobe,T. et al . 2009. Two B eclin 1 binding proteins, Atg14L and Rubicon, reciprocally regulate autophagy at different stages. Nat. Cell Biol. 11 :385 396.

PAGE 158

158 131. Mizushima,N., Yoshimori,T., and Ohsumi,Y. 2011. The role of Atg proteins in autophagosome formation. Annu. Rev. Cell Dev. Biol. 27 :107 132. 132. Mizushima,N., Yoshimori,T., and Levine,B. 2010. Methods in mammalian autophagy research. Cell 140 :313 326. 133. Mizushima,N., Sugita,H., Yoshimori,T., and Ohsumi,Y. 1998. A new protein conjugation system in human. The counterpart of the yeast Apg12p conjugation system essential for autophagy. J. Biol. Chem. 273 :33889 33892. 134. Tanida,I., Sou,Y.S., Ezaki,J., Mine matsu Ikeguchi,N., Ueno,T., and Kominami,E. 2004. HsAtg4B/HsApg4B/autophagin 1 cleaves the carboxyl termini of three human Atg8 homologues and delipidates microtubule associated protein light chain 3 and GABAA receptor associated protein phospholipid conj ugates. J. Biol. Chem. 279 :36268 36276. 135. Shintani,T., Mizushima,N., Ogawa,Y., Matsuura,A., Noda,T., and Ohsumi,Y. 1999. Apg10p, a novel protein conjugating enzyme essential for autophagy in yeast. EMBO J. 18 :5234 5241. 136. Noda,N.N., Satoo,K., Fuj ioka,Y., Kumeta,H., Ogura,K., Nakatogawa,H., Ohsumi,Y., and Inagaki,F. 2011. Structural basis of Atg8 activation by a homodimeric E1, Atg7. Mol. Cell 44 :462 475. 137. Kuma,A., Mizushima,N., Ishihara,N., and Ohsumi,Y. 2002. Formation of the approximately 350 kDa Apg12 Apg5.Apg16 multimeric complex, mediated by Apg16 oligomerization, is essential for autophagy in yeast. J. Biol. Chem. 277 :18619 18625. 138. Chua,C.E., Gan,B.Q., and Tang,B.L. 2011. Involvement of members of the Rab family and related small GTPases in autophagosome formation and maturation. Cell Mol. Life Sci. 68 :3349 3358. 139. Ao,X., Zou,L., and Wu,Y. 2014. Regulation of autophagy by the Rab GTPase network. Cell Death. Differ. 21 :348 358. 140. Moreau,K., Renna,M., and Rubinsztein,D.C. 2 013. Connections between SNAREs and autophagy. Trends Biochem. Sci. 38 :57 63. 141. Weber,T., Zemelman,B.V., McNew,J.A., Westermann,B., Gmachl,M., Parlati,F., Sollner,T.H., and Rothman,J.E. 1998. SNAREpins: minimal machinery for membrane fusion. Cell 92 :759 772. 142. Menzies,R.A., and Gold,P.H. 1971. The turnover of mitochondria in a variety of tissues of young adult and aged rats. J. Biol. Chem. 246 :2425 2429.

PAGE 159

159 143. Tolkovsky,A.M., Xue,L., Fletcher,G.C., and Borutaite,V. 2002. Mitochondrial disappear ance from cells: a clue to the role of autophagy in programmed cell death and disease? Biochimie 84 :233 240. 144. Cookson,M.R. 2005. The biochemistry of Parkinson's disease. Annu. Rev. Biochem. 74 :29 52. 145. Matsuda,S., Kitagishi,Y., and Kobayashi,M. 2013. Function and characteristics of PINK1 in mitochondria. Oxid. Med. Cell Longev. 2013 :601587. 146. Deas,E., Plun Favreau,H., Gandhi,S., Desmond,H., Kjaer,S., Loh,S.H., Renton,A.E., Harvey,R.J., Whitworth,A.J., Martins,L.M. et al . 2011. PINK1 cleavage at position A103 by the mitochondrial protease PARL. Hum. Mol. Genet. 20 :867 879. 147. Michiorri,S., Gelmetti,V., Giarda,E., Lombardi,F., Romano,F., Marongiu,R., Nerini Molteni,S., Sale,P., Vago,R., Arena,G. et al . 2010. The Parkinson associated protein PINK1 interacts with Beclin1 and promotes autophagy. Cell Death. Differ. 17 :962 974. 148. Okatsu,K., Oka,T., Iguchi,M., Imamura,K., Kosako,H., Tani,N., Kimura,M., Go,E., Koyano,F., Funayama,M. et al . 2012. PINK1 autophosphorylation upon membrane potenti al dissipation is essential for Parkin recruitment to damaged mitochondria. Nat. Commun. 3 :1016. 149. Kirkin,V., McEwan,D.G., Novak,I., and Dikic,I. 2009. A role for ubiquitin in selective autophagy. Mol. Cell 34 :259 269. 150. Huang,C., Andres,A.M., Ra tliff,E.P., Hernandez,G., Lee,P., and Gottlieb,R.A. 2011. Preconditioning involves selective mitophagy mediated by Parkin and p62/SQSTM1. PLoS. One. 6 :e20975. 151. Geisler,S., Holmstrom,K.M., Skujat,D., Fiesel,F.C., Rothfuss,O.C., Kahle,P.J., and Springe r,W. 2010. PINK1/Parkin mediated mitophagy is dependent on VDAC1 and p62/SQSTM1. Nat. Cell Biol. 12 :119 131. 152. Feng,D., Liu,L., Zhu,Y., and Chen,Q. 2013. Molecular signaling toward mitophagy and its physiological significance. Exp. Cell Res. 319 :1697 1705. 153. Chen,M., Sandoval,H., and Wang,J. 2008. Selective mitochondrial autophagy during erythroid maturation. Autophagy. 4 :926 928. 154. Sandoval,H., Thiagarajan,P., Dasgupta,S.K., Schumacher,A., Prchal,J.T., Chen,M., and Wang,J. 2008. Essential ro le for Nix in autophagic maturation of erythroid cells. Nature 454 :232 235.

PAGE 160

160 155. Marzella,L., and Glaumann,H. 1981. Effects of in vivo liver ischemia on microsomes and lysosomes. Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 36 :1 25. 156. Schneider,P.D., and Gorschboth,C.M. 1983. Limiting ischemic liver injury by interfering with lysosomal autophagy. J. Surg. Res. 34 :550 554. 157. David,H., Ellermann,J., and Uerlings,I. 1992. Primary phase of hepatocytic autophagocytosis under ischaemic c onditions. Exp. Toxicol. Pathol. 44 :74 80. 158. Klionsky,D.J., and Ohsumi,Y. 1999. Vacuolar import of proteins and organelles from the cytoplasm. Annu. Rev. Cell Dev. Biol. 15 :1 32. 159. Cardinal,J., Pan,P., and Tsung,A. 2009. Protective role of cisplatin in ischemic liver injury through induction of autophagy. Autophagy. 5 :1211 1212. 160. Liu,A., Fang,H., Dahmen,U., and Dirsch,O. 2013. Chronic lithium treatment protects against liver is chemia/reperfusion injury in rats. Liver Transpl. 19 :762 772. 161. Andreani,P., Hoti,E., de la Serna,S., degli,E.D., Sebagh,M., Lemoine,A., Ichai,P., Saliba,F., Castaing,D., and Azoulay,D. 2010. Ischaemic preconditioning of the graft in adult living rela ted right lobe liver transplantation: impact on ischaemia reperfusion injury and clinical relevance. HPB (Oxford) 12 :439 446. 162. degli,E.D., Sebagh,M., Pham,P., Reffas,M., Pous,C., Brenner,C., Azoulay,D., and Lemoine,A. 2011. Ischemic preconditioning i nduces autophagy and limits necrosis in human recipients of fatty liver grafts, decreasing the incidence of rejection episodes. Cell Death. Dis. 2 :e111. 163. Wang,Y., Shen,J., Xiong,X., Xu,Y., Zhang,H., Huang,C., Tian,Y., Jiao,C., Wang,X., and Li,X. 2014 . Remote ischemic preconditioning protects against liver ischemia reperfusion injury via heme oxygenase 1 induced autophagy. PLoS. One. 9 :e98834. 164. Rickenbacher,A., Jang,J.H., Limani,P., Ungethum,U., Lehmann,K., Oberkofler,C.E., Weber,A., Graf,R., Hum ar,B., and Clavien,P.A. 2014. Fasting protects liver from ischemic injury through Sirt1 mediated downregulation of circulating HMGB1 in mice. J. Hepatol. 61 :301 308. 165. Frye,R.A. 1999. Characterization of five human cDNAs with homology to the yeast SIR 2 gene: Sir2 like proteins (sirtuins) metabolize NAD and may have protein ADP ribosyltransferase activity. Biochem. Biophys. Res. Commun. 260 :273 279. 166. Vaziri,H., Dessain,S.K., Ng,E.E., Imai,S.I., Frye,R.A., Pandita,T.K., Guarente,L., and Weinberg,R. A. 2001. hSIR2(SIRT1) functions as an NAD dependent p53 deacetylase. Cell 107 :149 159.

PAGE 161

161 167. Lombard,D., Tishkoff,D., and Bao,J. 2011. Mitochondrial Sirtuins in the egulation of Mitochondrial Activity and Metabolic Adaptation. In Histone Deacetylases: the Biology and Clinical Implication . T. P.Yao, and Seto,E., editors. Springer. New York. 164 189. 168. Satoh,A., Stein,L., and Imai,S. 2011. The Role of Mammalian Sirtuins in the Regulation of Metabolism, Aging, and Longevity. In Histone Deacetylases: the Biology and Clinical Implication . T. P.Yao, and Edward,S., editors. Springer. New York. 126 163. 169. Houtkooper,R.H., Canto,C., Wanders,R.J., and Auwerx,J. 2010. The secret life of NAD+: an old metabolite controlling new metabolic signaling pathways. En docr. Rev. 31 :194 223. 170. Cerutti,R., Pirinen,E., Lamperti,C., Marchet,S., Sauve,A.A., Li,W., Leoni,V., Schon,E.A., Dantzer,F., Auwerx,J. et al 2014. NAD(+) dependent activation of Sirt1 corrects the phenotype in a mouse model of mitochondrial disease. Cell Metab 19 :1042 1049. 171 . Shore,D., Squire,M., and Nasmyth,K.A. 1984. Characterization of two genes required for the position effect control of yeast mating type genes. EMBO J. 3 :2817 2823. 172. Tanny,J.C., Dowd,G.J., Huang,J., Hilz,H., and Moazed,D. 1999. An enzymatic activit y in the yeast Sir2 protein that is essential for gene silencing. Cell 99 :735 745. 173. Imai,S., Johnson,F.B., Marciniak,R.A., McVey,M., Park,P.U., and Guarente,L. 2000. Sir2: an NAD dependent histone deacetylase that connects chromatin silencing, metabo lism, and aging. Cold Spring Harb. Symp. Quant. Biol. 65 :297 302. 174. Kaeberlein,M., McVey,M., and Guarente,L. 1999. The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev. 13 :2570 2580. 175. Tissenbaum,H.A., and Guarente,L. 2001. Increased dosage of a sir 2 gene extends lifespan in Caenorhabditis elegans. Nature 410 :227 230. 176. Rogina,B., and Helfand,S.L. 2004. Sir2 mediates longevity in the fly through a pathway related to calorie restriction. Proc. Natl. Acad. Sci. U. S. A 101 :15998 16003. 177. Guarente,L. 2013. Calorie restriction and sirtuins revisited. Genes Dev. 27 :2072 2085. 178. Guarente,L. 2013. Sirtuins and ageing -new findings. EMBO Rep. 14 :750.

PAGE 162

162 179. Imai,S., Armstro ng,C.M., Kaeberlein,M., and Guarente,L. 2000. Transcriptional silencing and longevity protein Sir2 is an NAD dependent histone deacetylase. Nature 403 :795 800. 180. Bereshchenko,O.R., Gu,W., and Dalla Favera,R. 2002. Acetylation inactivates the transcrip tional repressor BCL6. Nat. Genet. 32 :606 613. 181. Finnin,M.S., Donigian,J.R., and Pavletich,N.P. 2001. Structure of the histone deacetylase SIRT2. Nat. Struct. Biol. 8 :621 625. 182. Min,J., Landry,J., Sternglanz,R., and Xu,R.M. 2001. Crystal structur e of a SIR2 homolog NAD complex. Cell 105 :269 279. 183. Landry,J., Slama,J.T., and Sternglanz,R. 2000. Role of NAD(+) in the deacetylase activity of the SIR2 like proteins. Biochem. Biophys. Res. Commun. 278 :685 690. 184. Borra,M.T., Langer,M.R., Slama,J.T., and Denu,J.M. 2004. Substrate specificity and kinetic mechanism of the Sir2 family of NAD+ dependent histone/protein deacetylases. Biochemistry 43 :9877 9887. 185. Tanno,M., Sakamoto,J., Miura,T., Shimamoto,K., and Hor io,Y. 2007. Nucleocytoplasmic shuttling of the NAD+ dependent histone deacetylase SIRT1. J. Biol. Chem. 282 :6823 6832. 186. Asher,G., Gatfield,D., Stratmann,M., Reinke,H., Dibner,C., Kreppel,F., Mostoslavsky,R., Alt,F.W., and Schibler,U. 2008. SIRT1 regulates circadian clock gene expression through PER2 deacetylation. Cell 134 :317 328. 187. Belden,W.J., and Dunlap,J.C. 2008. SIRT1 is a circadian deacetylase for core clock components. Cell 134 :212 214. 188. Nakahata,Y., Kaluzova,M., Grimaldi,B., Sahar,S., Hirayama,J., Chen,D., Guarente,L.P., and Sassone Corsi,P. 2008. The NAD+ dependent deacetylase SIRT1 modulates CLOCK media ted chromatin remodeling and circadian control. Cell 134 :329 340. 189. Lee,I.H., Cao,L., Mostoslavsky,R., Lombard,D.B., Liu,J., Bruns,N.E., Tsokos,M., Alt,F.W., and Finkel,T. 2008. A role for the NAD dependent deacetylase Sirt1 in the regulation of autop hagy. Proc. Natl. Acad. Sci. U. S. A 105 :3374 3379. 190. Hariharan,N., Maejima,Y., Nakae,J., Paik,J., Depinho,R.A., and Sadoshima,J. 2010. Deacetylation of FoxO by Sirt1 Plays an Essential Role in Mediating Starvation Induced Autophagy in Cardiac Myocyte s. Circ. Res. 107 :1470 1482.

PAGE 163

163 191. Fang,E.F., Scheibye Knudsen,M., Brace,L.E., Kassahun,H., SenGupta,T., Nilsen,H., Mitchell,J.R., Croteau,D.L., and Bohr,V.A. 2014. Defective mitophagy in XPA via PARP 1 hyperactivation and NAD(+)/SIRT1 reduction. Cell 15 7 :882 896. 192. Jang,S.Y., Kang,H.T., and Hwang,E.S. 2012. Nicotinamide induced mitophagy: event mediated by high NAD+/NADH ratio and SIRT1 protein activation. J. Biol. Chem. 287 :19304 19314. 193. Gerhart Hines,Z., Rodgers,J.T., Bare,O., Lerin,C., Kim, S.H., Mostoslavsky,R., Alt,F.W., Wu,Z., and Puigserver,P. 2007. Metabolic control of muscle mitochondrial function and fatty acid oxidation through SIRT1/PGC 1alpha. EMBO J. 26 :1913 1923. 194. Rodgers,J.T., Lerin,C., Haas,W., Gygi,S.P., Spiegelman,B.M., and Puigserver,P. 2005. Nutrient control of glucose homeostasis through a complex of PGC 1alpha and SIRT1. Nature 434 :113 118. 195. Purushotham,A., Schug,T.T., Xu,Q., Surapureddi,S., Guo,X., and Li,X. 2009. Hepatocyte specific deletion of SIRT1 alters fa tty acid metabolism and results in hepatic steatosis and inflammation. Cell Metab 9 :327 338. 196. Aquilano,K., Vigilanza,P., Baldelli,S., Pagliei,B., Rotilio,G., and Ciriolo,M.R. 2010. Peroxisome proliferator activated receptor gamma co activator 1alpha (PGC 1alpha) and sirtuin 1 (SIRT1) reside in mitochondria: possible direct function in mitochondrial biogenesis. J. Biol. Chem. 285 :21590 21599. 197. Lagouge,M., Argmann,C., Gerhart Hines,Z., Meziane,H., Lerin,C., Daussin,F., Messadeq,N., Milne,J., Lambe rt,P., Elliott,P. et al . 2006. Resveratrol improves mitochondrial function and protects against metabolic disease by activating SIRT1 and PGC 1alpha. Cell 127 :1109 1122. 198. Garcia Rodriguez,J.L., Barbier Torres,L., Fernandez Alvarez,S., Gutierrez de,J., V, Monte,M.J., Halilbasic,E., Herranz,D., Alvarez,L., Aspichueta,P., Marin,J.J. et al . 2014. SIRT1 controls liver regeneration by regulating bile acid metabolism through farnesoid X receptor and mammalian target of rapamycin signaling. Hep atology 59 :1972 1983. 199. Kabra,N., Li,Z., Chen,L., Li,B., Zhang,X., Wang,C., Yeatman,T., Coppola,D., and Chen,J. 2009. SirT1 is an inhibitor of proliferation and tumor formation in colon cancer. J. Biol. Chem. 284 :18210 18217. 200. Cheng,H.L., Mostos lavsky,R., Saito,S., Manis,J.P., Gu,Y., Patel,P., Bronson,R., Appella,E., Alt,F.W., and Chua,K.F. 2003. Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1) deficient mice. Proc. Natl. Acad. Sci. U. S. A 100 :10794 10799.

PAGE 164

164 201. Liu,Y., De ntin,R., Chen,D., Hedrick,S., Ravnskjaer,K., Schenk,S., Milne,J., Meyers,D.J., Cole,P., Yates,J., III et al . 2008. A fasting inducible switch modulates gluconeogenesis via activator/coactivator exchange. Nature 456 :269 273. 202. Park,J.M., Kim,T.H., Bae, J.S., Kim,M.Y., Kim,K.S., and Ahn,Y.H. 2010. Role of resveratrol in FOXO1 mediated gluconeogenic gene expression in the liver. Biochem. Biophys. Res. Commun. 403 :329 334. 203. Li,Y., Wong,K., Giles,A., Jiang,J., Lee,J.W., Adams,A.C., Kharitonenkov,A., Ya ng,Q., Gao,B., Guarente,L. et al . 2014. Hepatic SIRT1 attenuates hepatic steatosis and controls energy balance in mice by inducing fibroblast growth factor 21. Gastroenterology 146 :539 549. 204. Nie,Y., Erion,D.M., Yuan,Z., Dietrich,M., Shulman,G.I., Hor vath,T.L., and Gao,Q. 2009. STAT3 inhibition of gluconeogenesis is downregulated by SirT1. Nat. Cell Biol. 11 :492 500. 205. Zelcer,N., and Tontonoz,P. 2006. Liver X receptors as integrators of metabolic and inflammatory signaling. J. Clin. Invest 116 :607 614. 206. Li,X., Zhang,S., Blander,G., Tse,J.G., Krieger,M., and Guarente,L. 2007. SIRT1 deacetylates and positively regulates the nuclear receptor LXR. Mol. Cell 28 :91 106. 207. You,M., Liang,X., Ajmo,J.M., and Ness,G.C. 2008. Involvement of mammalia n sirtuin 1 in the action of ethanol in the liver. Am. J. Physiol Gastrointest. Liver Physiol 294 :G892 G898. 208. Schwer,B., Eckersdorff,M., Li,Y., Silva,J.C., Fermin,D., Kurtev,M.V., Giallourakis,C., Comb,M.J., Alt,F.W., and Lombard,D.B. 2009. Calorie r estriction alters mitochondrial protein acetylation. Aging Cell 8 :604 606. 209. Scher,M.B., Vaquero,A., and Reinberg,D. 2007. SirT3 is a nuclear NAD+ dependent histone deacetylase that translocates to the mitochondria upon cellular stress. Genes Dev. 21 : 920 928. 210. Lombard,D.B., Alt,F.W., Cheng,H.L., Bunkenborg,J., Streeper,R.S., Mostoslavsky,R., Kim,J., Yancopoulos,G., Valenzuela,D., Murphy,A. et al . 2007. Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation. Mol. Cell Biol. 27 :8807 8814. 211. Peek,C.B., Affinati,A.H., Ramsey,K.M., Kuo,H.Y., Yu,W., Sena,L.A., Ilkayeva,O., Marcheva,B., Kobayashi,Y., Omura,C. et al . 2013. Circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice. Science 342 :1243417.

PAGE 165

165 212. Ahn,B.H., Kim,H.S., Song,S., Lee,I.H., Liu,J., Vassilopoulos,A., Deng,C.X., and Finkel,T. 2008. A role for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc. Natl. Acad. Sci. U. S. A 105 :14447 14452. 213. Shimazu,T., Hirschey,M. D., Hua,L., Dittenhafer Reed,K.E., Schwer,B., Lombard,D.B., Li,Y., Bunkenborg,J., Alt,F.W., Denu,J.M. et al . 2010. SIRT3 deacetylates mitochondrial 3 hydroxy 3 methylglutaryl CoA synthase 2 and regulates ketone body production. Cell Metab 12 :654 661. 214. Kendrick,A.A., Choudhury,M., Rahman,S.M., McCurdy,C.E., Friederich,M., Van Hove,J.L., Watson,P.A., Birdsey,N., Bao,J., Gius,D. et al . 2011. Fatty liver is associated with reduced SIRT3 activity and mitochondrial protein hyperacetylation. Biochem. J. 433 : 505 514. 215. Hirschey,M.D., Shimazu,T., Goetzman,E., Jing,E., Schwer,B., Lombard,D.B., Grueter,C.A., Harris,C., Biddinger,S., Ilkayeva,O.R. et al . 2010. SIRT3 regulates mitochondrial fatty acid oxidation by reversible enzyme deacetylation. Nature 464 :12 1 125. 216. Lu,Z., Bourdi,M., Li,J.H., Aponte,A.M., Chen,Y., Lombard,D.B., Gucek,M., Pohl,L.R., and Sack,M.N. 2011. SIRT3 dependent deacetylation exacerbates acetaminophen hepatotoxicity. EMBO Rep. 12 :840 846. 217. Nakagawa,T., Lomb,D.J., Haigis,M.C., and Guarente,L. 2009. SIRT5 Deacetylates carbamoyl phosphate synthetase 1 and regulates the urea cycle. Cell 137 :560 570. 218. Du,J., Zhou,Y., Su,X., Yu,J.J., Khan,S., Jiang,H., Kim,J., Woo,J., Kim,J.H., Choi,B.H. et al . 2011. Sirt5 is a NAD dependent pr otein lysine demalonylase and desuccinylase. Science 334 :806 809. 219. Tan,M., Peng,C., Anderson,K.A., Chhoy,P., Xie,Z., Dai,L., Park,J., Chen,Y., Huang,H., Zhang,Y. et al . 2014. Lysine glutarylation is a protein posttranslational modification regulated by SIRT5. Cell Metab 19 :605 617. 220. Nakamura,Y., Ogura,M., Ogura,K., Tanaka,D., and Inagaki,N. 2012. SIRT5 deacetylates and activates urate oxidase in liver mitochondria of mice. FEBS Lett. 586 :4076 4081. 221. Chen,J., Chan,A.W., To,K.F., Chen,W., Zh ang,Z., Ren,J., Song,C., Cheung,Y.S., Lai,P.B., Cheng,S.H. et al . 2013. SIRT2 overexpression in hepatocellular carcinoma mediates epithelial to mesenchymal transition by protein kinase B/glycogen synthase kinase 3beta/beta catenin signaling. Hepatology 57 :2287 2298. 222. Chen,Y.R., Fang,S.R., Fu,Y.C., Zhou,X.H., Xu,M.Y., and Xu,W.C. 2010. Calorie restriction on insulin resistance and expression of SIRT1 and SIRT4 in rats. Biochem. Cell Biol. 88 :715 722.

PAGE 166

166 223. Laurent,G., de Boer,V.C., Finley,L.W., Sween ey,M., Lu,H., Schug,T.T., Cen,Y., Jeong,S.M., Li,X., Sauve,A.A. et al . 2013. SIRT4 represses peroxisome proliferator activated receptor alpha activity to suppress hepatic fat oxidation. Mol. Cell Biol. 33 :4552 4561. 224. Zhong,L., D'Urso,A., Toiber,D., S ebastian,C., Henry,R.E., Vadysirisack,D.D., Guimaraes,A., Marinelli,B., Wikstrom,J.D., Nir,T. et al . 2010. The histone deacetylase Sirt6 regulates glucose homeostasis via Hif1alpha. Cell 140 :280 293. 225. Kim,H.S., Xiao,C., Wang,R.H., Lahusen,T., Xu,X., Vassilopoulos,A., Vazquez Ortiz,G., Jeong,W.I., Park,O., Ki,S.H. et al . 2010. Hepatic specific disruption of SIRT6 in mice results in fatty liver formation due to enhanced glycolysis and triglyceride synthesis. Cell Metab 12 :224 236. 226. Yoshizawa,T., K arim,M.F., Sato,Y., Senokuchi,T., Miyata,K., Fukuda,T., Go,C., Tasaki,M., Uchimura,K., Kadomatsu,T. et al . 2014. SIRT7 controls hepatic lipid metabolism by regulating the ubiquitin proteasome pathway. Cell Metab 19 :712 721. 227. Shin,J., He,M., Liu,Y., P aredes,S., Villanova,L., Brown,K., Qiu,X., Nabavi,N., Mohrin,M., Wojnoonski,K. et al . 2013. SIRT7 represses Myc activity to suppress ER stress and prevent fatty liver disease. Cell Rep. 5 :654 665. 228. Kim,E.J., Kho,J.H., Kang,M.R., and Um,S.J. 2007. Act ive regulator of SIRT1 cooperates with SIRT1 and facilitates suppression of p53 activity. Mol. Cell 28 :277 290. 229. Raynes,R., Pombier,K.M., Nguyen,K., Brunquell,J., Mendez,J.E., and Westerheide,S.D. 2013. The SIRT1 modulators AROS and DBC1 regulate HSF 1 activity and the heat shock response. PLoS. One. 8 :e54364. 230. Kokkola,T., Suuronen,T., Molnar,F., Maatta,J., Salminen,A., Jarho,E.M., and Lahtela Kakkonen,M. 2014. AROS has a context dependent effect on SIRT1. FEBS Lett. 588 :1523 1528. 231. Kim,J.E ., Chen,J., and Lou,Z. 2008. DBC1 is a negative regulator of SIRT1. Nature 451 :583 586. 232. Escande,C., Chini,C.C., Nin,V., Dykhouse,K.M., Novak,C.M., Levine,J., van,D.J., Gores,G.J., Chen,J., Lou,Z. et al . 2010. Deleted in breast cancer 1 regulates SIR T1 activity and contributes to high fat diet induced liver steatosis in mice. J. Clin. Invest 120 :545 558. 233. Nin,V., Escande,C., Chini,C.C., Giri,S., Camacho Pereira,J., Matalonga,J., Lou,Z., and Chini,E.N. 2012. Role of deleted in breast cancer 1 (DBC1) protein in SIRT1 deacetylase activation induced by protein kinase A and AMP activated protein kinase. J. Biol. Chem. 287 :23489 23501.

PAGE 167

167 234. Gerhart Hines,Z., Dominy,J.E., Jr., Blattler,S.M., Jedrychowski,M.P., Banks,A.S., Lim,J.H., Chim,H., Gygi,S.P., and Puigserver,P. 2011. The cAMP/PKA pathway rapidly activates SIRT1 to promote fatty acid oxidation independentl y of changes in NAD(+). Mol. Cell 44 :851 863. 235. Lau,A.W., Liu,P., Inuzuka,H., and Gao,D. 2014. SIRT1 phosphorylation by AMP activated protein kinase regulates p53 acetylation. Am. J. Cancer Res. 4 :245 255. 236. Sasaki,T., Maier,B., Koclega,K.D., Chr uszcz,M., Gluba,W., Stukenberg,P.T., Minor,W., and Scrable,H. 2008. Phosphorylation regulates SIRT1 function. PLoS. One. 3 :e4020. 237. Nasrin,N., Kaushik,V.K., Fortier,E., Wall,D., Pearson,K.J., de,C.R., and Bordone,L. 2009. JNK1 phosphorylates SIRT1 and promotes its enzymatic activity. PLoS. One. 4 :e8414. 238. Ford,J., Ahmed,S., Allison,S., Jiang,M., and Milner,J. 2008. JNK2 dependent regulation of SIRT1 protein stability. Cell Cycle 7 :3091 3097. 239. Guo,X., Williams,J.G., Schug,T.T., and Li,X. 2010. DYRK1A and DYRK3 promote cell survival through phosphorylation and activation of SIRT1. J. Biol. Chem. 285 :13223 13232. 240. Zschoernig,B., and Mahlknecht,U. 2009. Carboxy terminal phosphorylation of SIR T1 by protein kinase CK2. Biochem. Biophys. Res. Commun. 381 :372 377. 241. Kang,H., Jung,J.W., Kim,M.K., and Chung,J.H. 2009. CK2 is the regulator of SIRT1 substrate binding affinity, deacetylase activity and cellular response to DNA damage. PLoS. One. 4 :e6611. 242. Yang,Y., Fu,W., Chen,J., Olashaw,N., Zhang,X., Nicosia,S.V., Bhalla,K., and Bai,W. 2007. SIRT1 sumoylation regulates its deacetylase activity and cellular response to genotoxic stress. Nat. Cell Biol. 9 :1253 1262. 243. Nadtochiy,S.M., Redm an,E., Rahman,I., and Brookes,P.S. 2011. Lysine deacetylation in ischaemic preconditioning: the role of SIRT1. Cardiovasc. Res. 89 :643 649. 244. Haigis,M.C., and Sinclair,D.A. 2010. Mammalian sirtuins: biological insights and disease relevance. Annu. Rev . Pathol. 5 :253 295. 245. Hubbard,B.P., Gomes,A.P., Dai,H., Li,J., Case,A.W., Considine,T., Riera,T.V., Lee,J.E., SY,E., Lamming,D.W. et al . 2013. Evidence for a common mechanism of SIRT1 regulation by allosteric activators. Science 339 :1216 1219.

PAGE 168

168 246. Hubbard,B.P., and Sinclair,D.A. 2014. Small molecule SIRT1 activators for the treatment of aging and age related diseases. Trends Pharmacol. Sci. 35 :146 154. 247. Howitz,K.T., Bitterman,K.J., Cohen,H.Y., Lamming,D.W., Lavu,S., Wood,J.G., Zipkin,R.E., Chung,P., Kisielewski,A., Zhang,L.L. et al . 2003. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 425 :191 196. 248. Park,S.J., Ahmad,F., Philp,A., Baar,K., Williams,T., Luo,H., Ke,H., Rehmann,H., Taussig,R., Brown,A .L. et al . 2012. Resveratrol ameliorates aging related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell 148 :421 433. 249. Desquiret Dumas,V., Gueguen,N., Leman,G., Baron,S., Nivet Antoine,V., Chupin,S., Chevrollier,A., Vessieres,E., Ayer, A., Ferre,M. et al . 2013. Resveratrol induces a mitochondrial complex I dependent increase in NADH oxidation responsible for sirtuin activation in liver cells. J. Biol. Chem. 288 :36662 36675. 250. Park,S.J., Ahmad,F., Philp,A., Baar,K., Williams,T., Luo, H., Ke,H., Rehmann,H., Taussig,R., Brown,A.L. et al . 2012. Resveratrol ameliorates aging related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell 148 :421 433. 251. Milne,J.C., Lambert,P.D., Schenk,S., Carney,D.P., Smith,J.J., Gagne,D.J., Jin,L., Boss,O., Perni,R.B., Vu,C.B. et al . 2007. Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature 450 :712 716. 252. Mai,A., Massa,S., Lavu,S., Pezzi,R., Simeoni,S., Ragno,R., Mariotti,F.R., Chiani,F., Camil loni,G., and Sinclair,D.A. 2005. Design, synthesis, and biological evaluation of sirtinol analogues as class III histone/protein deacetylase (Sirtuin) inhibitors. J. Med. Chem. 48 :7789 7795. 253. Peck,B., Chen,C.Y., Ho,K.K., Di,F.P., Myatt,S.S., Coombes, R.C., Fuchter,M.J., Hsiao,C.D., and Lam,E.W. 2010. SIRT inhibitors induce cell death and p53 acetylation through targeting both SIRT1 and SIRT2. Mol. Cancer Ther. 9 :844 855. 254. Choi,S.E., and Kemper,J.K. 2013. Regulation of SIRT1 by microRNAs. Mol. Cel ls 36 :385 392. 255. Yin,H., Hu,M., Zhang,R., Shen,Z., Flatow,L., and You,M. 2012. MicroRNA 217 promotes ethanol induced fat accumulation in hepatocytes by down regulating SIRT1. J. Biol. Chem. 287 :9817 9826. 256. Salminen,A., and Kaarniranta,K. 2009. S IRT1: regulation of longevity via autophagy. Cell Signal. 21 :1356 1360.

PAGE 169

169 257. Hsu,C.P., Hariharan,N., Alcendor,R.R., Oka,S., and Sadoshima,J. 2009. Nicotinamide phosphoribosyltransferase regulates cell survival through autophagy in cardiomyocytes. Autopha gy. 5 :1229 1231. 258. Hsu,C.P., Oka,S., Shao,D., Hariharan,N., and Sadoshima,J. 2009. Nicotinamide phosphoribosyltransferase regulates cell survival through NAD+ synthesis in cardiac myocytes. Circ. Res. 105 :481 491. 259. Hsu,C.P., Zhai,P., Yamamoto,T. , Maejima,Y., Matsushima,S., Hariharan,N., Shao,D., Takagi,H., Oka,S., and Sadoshima,J. 2010. Silent information regulator 1 protects the heart from ischemia/reperfusion. Circulation 122 :2170 2182. 260. Kume,S., Uzu,T., Horiike,K., Chin Kanasaki,M., Isshiki,K., Araki,S., Sugimoto,T., Haneda,M., Kashiwagi,A., and Koya,D. 2010. Calorie restriction enhances cell adaptation to hypoxia through Sirt1 dependent mitochondrial autophagy in mouse aged kidney. J. Cl in. Invest 120 :1043 1055. 261. Morselli,E., Maiuri,M.C., Markaki,M., Megalou,E., Pasparaki,A., Palikaras,K., Criollo,A., Galluzzi,L., Malik,S.A., Vitale,I. et al . 2010. Caloric restriction and resveratrol promote longevity through the Sirtuin 1 dependent induction of autophagy. Cell Death. Dis. 1 :e10. 262. Wu,Y., Li,X., Zhu,J.X., Xie,W., Le,W., Fan,Z., Jankovic,J., and Pan,T. 2011. Resveratrol activated AMPK/SIRT1/autophagy in cellular models of Parkinson's disease. Neurosignals. 19 :163 174. 263. Nezi s,I.P., and Stenmark,H. 2012. p62 at the interface of autophagy, oxidative stress signaling, and cancer. Antioxid. Redox. Signal. 17 :786 793. 264. Kroemer,G., Marino,G., and Levine,B. 2010. Autophagy and the integrated stress response. Mol. Cell 40 :280 2 93. 265. Tasdemir,E., Chiara,M.M., Morselli,E., Criollo,A., D'Amelio,M., Djavaheri Mergny,M., Cecconi,F., Tavernarakis,N., and Kroemer,G. 2008. A dual role of p53 in the control of autophagy. Autophagy. 4 :810 814. 266. Han,M.K., Song,E.K., Guo,Y., Ou,X., Mantel,C., and Broxmeyer,H.E. 2008. SIRT1 regulates apoptosis and Nanog expression in mouse embryonic stem cells by controlling p53 subcellular localization. Cell Stem Cell 2 :241 251. 267. Yi,C., Ma,M., Ran,L., Zheng,J ., Tong,J., Zhu,J., Ma,C., Sun,Y., Zhang,S., Feng,W. et al . 2012. Function and molecular mechanism of acetylation in autophagy regulation. Science 336 :474 477. 268. Yi,C., and Yu,L. 2012. How does acetylation regulate autophagy? Autophagy. 8 :1529 1530.

PAGE 170

170 269. Webster,B.R., Scott,I., Han,K., Li,J.H., Lu,Z., Stevens,M.V., Malide,D., Chen,Y., Samsel,L., Connelly,P.S. et al . 2013. Restricted mitochondrial protein acetylation initiates mitochondrial autophagy. J. Cell Sci. 126 :4843 4849. 270. Scott,I., Webst er,B.R., Li,J.H., and Sack,M.N. 2012. Identification of a molecular component of the mitochondrial acetyltransferase programme: a novel role for GCN5L1. Biochem. J. 443 :655 661. 271. Scott,I., Webster,B.R., Chan,C.K., Okonkwo,J.U., Han,K., and Sack,M.N. 2014. GCN5 like protein 1 (GCN5L1) controls mitochondrial content through coordinated regulation of mitochondrial biogenesis and mitophagy. J. Biol. Chem. 289 :2864 2872. 272. Brunet,A., Sweeney,L.B., Sturgill,J.F., Chua,K.F., Greer,P.L., Lin,Y., Tran,H., Ross,S.E., Mostoslavsky,R., Cohen,H.Y. et al . 2004. Stress dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science 303 :2011 2015. 273. Kim,M.J., Ahn,K., Park,S.H., Kang,H.J., Jang,B.G., Oh,S.J., Oh,S.M., Jeong,Y.J., Heo,J.I., Suh,J.G. et al . 2009. SIRT1 regulates tyrosine hydroxylase expression and differentiation of neuroblastoma cells via FOXO3a. FEBS Lett. 583 :1183 1188. 274. Nakae,J., Cao,Y., Daitoku,H., Fukamizu,A., Ogawa,W., Yano,Y., and Hayashi,Y. 2006. The L XXLL motif of murine forkhead transcription factor FoxO1 mediates Sirt1 dependent transcriptional activity. J. Clin. Invest 116 :2473 2483. 275. Wareski,P., Vaarmann,A., Choubey,V., Safiulina,D., Liiv,J., Kuum,M., and Kaasik,A. 2009. PGC 1{alpha} and PGC 1{beta} regulate mitochondrial density in neurons. J. Biol. Chem. 284 :21379 21385. 276. Thompson,J.W., Dave,K.R., Saul,I., Narayanan,S.V., and Perez Pinzon,M.A. 2013. Epsilon PKC increases brain mitochondrial SIRT1 protein levels via heat shock protein 9 0 following ischemic preconditioning in rats. PLoS. One. 8 :e75753. 277. Fan,H., Yang,H.C., You,L., Wang,Y.Y., He,W.J., and Hao,C.M. 2013. The histone deacetylase, SIRT1, contributes to the resistance of young mice to ischemia/reperfusion induced acute ki dney injury. Kidney Int. 83 :404 413. 278. Pantazi,E., Zaouali,M.A., Bejaoui,M., Serafin,A., Folch Puy,E., Petegnief,V., De,V.N., Ben,A.H., Rimola,A., and Rosello Catafau,J. 2014. Silent information regulator 1 protects the liver against ischemia reperfus ion injury: implications in steatotic liver ischemic preconditioning. Transpl. Int. 27 :493 503. 279. Turrens,J.F., Beconi,M., Barilla,J., Chavez,U.B., and McCord,J.M. 1991. Mitochondrial generation of oxygen radicals during reoxygenation of ischemic tiss ues. Free Radic. Res. Commun. 12 13 Pt 2 :681 689.

PAGE 171

171 280. Nayler,W.G., Poole Wilson,P.A., and Williams,A. 1979. Hypoxia and calcium. J. Mol. Cell Cardiol. 11 :683 706. 281. Ikeda,T., Yanaga,K., Kishikawa,K., Kakizoe,S., Shimada,M., and Sugimachi,K. 1992. I schemic injury in liver transplantation: difference in injury sites between warm and cold ischemia in rats. Hepatology 16 :454 461. 282. Bause,A.S., Matsui,M.S., and Haigis,M.C. 2013. The protein deacetylase SIRT3 prevents oxidative stress induced keratin ocyte differentiation. J. Biol. Chem. 288 :36484 36491. 283. Cimen,H., Han,M.J., Yang,Y., Tong,Q., Koc,H., and Koc,E.C. 2010. Regulation of succinate dehydrogenase activity by SIRT3 in mammalian mitochondria. Biochemistry 49 :304 311. 284. Dai,S.H., Chen ,T., Wang,Y.H., Zhu,J., Luo,P., Rao,W., Yang,Y.F., Fei,Z., and Jiang,X.F. 2014. Sirt3 attenuates hydrogen peroxide induced oxidative stress through the preservation of mitochondrial function in HT22 cells. Int. J. Mol. Med. 285. Qiu,X., Brown,K., Hirsche y,M.D., Verdin,E., and Chen,D. 2010. Calorie restriction reduces oxidative stress by SIRT3 mediated SOD2 activation. Cell Metab 12 :662 667. 286. Rahman,M., Nirala,N.K., Singh,A., Zhu,L.J., Taguchi,K., Bamba,T., Fukusaki,E., Shaw,L.M., Lambright,D.G., Acharya,J.K. et al 2014. Drosophila Sirt2/mammalian SIRT3 deacetylates ATP synthase beta and regulates complex V activity. J. Cell Biol. 206 :289 305. 287. Scher,M.B., Vaquero,A., and Reinberg,D. 2007. SirT3 is a nuclear NAD+ dependent histone deacetylase that translocates to the mitochondria upon cellular stress. Genes Dev. 21 :920 928. 288. Tao,R., Coleman,M.C., Pennington,J.D., Ozden,O., Park,S.H., Jiang,H., Kim,H.S., Flynn,C.R., Hill,S., Hayes,M.W. et al . 2010. Sirt3 mediated deacetylation of evolutionarily conserved lysine 122 regulates MnSOD activity in response to stress. Mol. Cell 40 :893 904. 289. Vassilopoulos,A., Pennington,J.D., Andresson, T., Rees,D.M., Bosley,A.D., Fearnley,I.M., Ham,A., Flynn,C.R., Hill,S., Rose,K.L. et al . 2014. SIRT3 Deacetylates ATP Synthase F1 Complex Proteins in Response to Nutrient and Exercise Induced Stress. Antioxid. Redox. Signal. 21 :551 564. 290. Hafner,A.V. , Dai,J., Gomes,A.P., Xiao,C.Y., Palmeira,C.M., Rosenzweig,A., and Sinclair,D.A. 2010. Regulation of the mPTP by SIRT3 mediated deacetylation of CypD at lysine 166 suppresses age related cardiac hypertrophy. Aging (Albany. NY) 2 :914 923.

PAGE 172

172 291. Ogura,M., N akamura,Y., Tanaka,D., Zhuang,X., Fujita,Y., Obara,A., Hamasaki,A., Hosokawa,M., and Inagaki,N. 2010. Overexpression of SIRT5 confirms its involvement in deacetylation and activation of carbamoyl phosphate synthetase 1. Biochem. Biophys. Res. Commun. 393 :7 3 78. 292. Keynes,W.M. 1971. Body distribution of ammonium nitrogen in liver failure. Ann. Surg. 173 :604 612. 293. Zieve,L. 1987. Pathogenesis of hepatic encephalopathy. Metab Brain Dis. 2 :147 165. 294. Yin,H., Hu,M., Liang,X., Ajmo,J.M., Li,X., Bataller,R., Odena,G., Stevens,S.M., Jr., and You,M. 2014. Deletion of SIRT1 From Hepatocytes in Mice Disrupts Lipin 1 Signaling and Aggravates Alcoholic Fatty Liver. Gastroenterology 146 :801 811. 295. Chalkiada ki,A., and Guarente,L. 2012. High fat diet triggers inflammation induced cleavage of SIRT1 in adipose tissue to promote metabolic dysfunction. Cell Metab 16 :180 188. 296. Pfluger,P.T., Herranz,D., Velasco Miguel,S., Serrano,M., and Tschop,M.H. 2008. Sirt 1 protects against high fat diet induced metabolic damage. Proc. Natl. Acad. Sci. U. S. A 105 :9793 9798. 297. Wang,J.H., Ahn,I.S., Fischer,T.D., Byeon,J.I., Dunn,W.A., Jr., Behrns,K.E., Leeuwenburgh,C., and Kim,J.S. 2011. Autophagy suppresses age depende nt ischemia and reperfusion injury in livers of mice. Gastroenterology 141 :2188 2199. 298. Price,N.L., Gomes,A.P., Ling,A.J., Duarte,F.V., Martin Montalvo,A., North,B.J., Agarwal,B., Ye,L., Ramadori,G., Teodoro,J.S. et al . 2012. SIRT1 is required for AMP K activation and the beneficial effects of resveratrol on mitochondrial function. Cell Metab 15 :675 690. 299. Kim,J.S., Ohshima,S., Pediaditakis,P., and Lemasters,J.J. 2004. Nitric oxide: a signaling molecule against mitochondrial permeability transition and pH dependent cell death after reperfusion. Free Radic. Biol. Med. 37 :1943 1950. 300. Chen,J., Xavier,S., Moskowitz Kassai,E., Chen,R., Lu,C.Y., Sanduski,K., Spes,A., Turk,B., and Goligorsky,M.S. 2012. Cathepsin cleavage of sirtuin 1 in endothelial progenitor cells mediates stress induced premature senescence. Am. J. Pathol. 180 :973 983. 301. Dvir Ginzberg, M., Gagarina,V., Lee,E.J., Booth,R., Gabay,O., and Hall,D.J. 2011. Tumor necrosis factor alpha mediated cleavage and inactivation of SirT1 in human osteoarthritic chondrocytes. Arthritis Rheum. 63 :2363 2373.

PAGE 173

173 302. Khader,A., Yang,W.L., Kuncewitch,M., Jaco b,A., Prince,J.M., Asirvatham,J.R., Nicastro,J., Coppa,G.F., and Wang,P. 2014. Sirtuin 1 activation stimulates mitochondrial biogenesis and attenuates renal injury after ischemia reperfusion. Transplantation 98 :148 156. 303. Yang,Y., Duan,W., Lin,Y., Yi, W., Liang,Z., Yan,J., Wang,N., Deng,C., Zhang,S., Li,Y. et al . 2013. SIRT1 activation by curcumin pretreatment attenuates mitochondrial oxidative damage induced by myocardial ischemia reperfusion injury. Free Radic. Biol. Med. 65 :667 679. 304. Onyango,P. , Celic,I., McCaffery,J.M., Boeke,J.D., and Feinberg,A.P. 2002. SIRT3, a human SIR2 homologue, is an NAD dependent deacetylase localized to mitochondria. Proc. Natl. Acad. Sci. U. S. A 99 :13653 13658. 305. Someya,S., Yu,W., Hallows,W.C., Xu,J., Vann,J.M. , Leeuwenburgh,C., Tanokura,M., Denu,J.M., and Prolla,T.A. 2010. Sirt3 mediates reduction of oxidative damage and prevention of age related hearing loss under caloric restriction. Cell 143 :802 812. 306. Chua,B., Kao,R.L., Rannels,D.E., and Morgan,H.E. 19 79. Inhibition of protein degradation by anoxia and ischemia in perfused rat hearts. J. Biol. Chem. 254 :6617 6623. 307. Caito,S., Rajendrasozhan,S., Cook,S., Chung,S., Yao,H., Friedman,A.E., Brookes,P.S., and Rahman,I. 2010. SIRT1 is a redox sensitive de acetylase that is post translationally modified by oxidants and carbonyl stress. FASEB J. 24 :3145 3159. 308. Gao,Z., Zhang,J., Kheterpal,I., Kennedy,N., Davis,R.J., and Ye,J. 2011. Sirtuin 1 (SIRT1) protein degradation in response to persistent c Jun N t erminal kinase 1 (JNK1) activation contributes to hepatic steatosis in obesity. J. Biol. Chem. 286 :22227 22234. 309. Majetschak,M. 2013. Regulation of the proteasome by ATP: implications for ischemic myocardial injury and donor heart preservation. Am. J. Physiol Heart Circ. Physiol 305 :H267 H278. 310. Wang,W., Schulze,C.J., Suarez Pinzon,W.L., Dyck,J.R., Sawicki,G., and Schulz,R. 2002. Intracellular action of matrix metalloproteinase 2 accounts for acute myocardial ischemia and reperfusion injury. Circu lation 106 :1543 1549. 311. Theodoraki,K., Tympa,A., Karmaniolou,I., Tsaroucha,A., Arkadopoulos,N., and Smyrniotis,V. 2011. Ischemia/reperfusion injury in liver resection: a review of preconditioning methods. Surg. Today 41 :620 629. 312. Inman,S.R., Dav is,N.A., Olson,K.M., Lukaszek,V.A., McKinley,M.R., and Seminerio,J.L. 2003. Rapamycin preserves renal function compared with cyclosporine A after ischemia/reperfusion injury. Urology 62 :750 754.

PAGE 174

174 313. Silvestry,F.E., and Kimmel,S.E. 1996. Calcium channel blockers in ischemic heart disease. Curr. Opin. Cardiol. 11 :434 439. 314. Wagner,G.R., and Payne,R.M. 2011. Mitochondrial acetylation and diseases of aging. J. Aging Res. 2011 :234875. 315. Anderson, K.A., and Hirschey,M.D. 2012. Mitochondrial protein acetylation regulates metabolism. Essays Biochem. 52 :23 35. 316. Hirschey,M.D., Shimazu,T., Huang,J.Y., and Verdin,E. 2009. Acetylation of mitochondrial proteins. Methods Enzymol. 457 :137 147. 317. Ou ,X., Lee,M.R., Huang,X., Messina Graham,S., and Broxmeyer,H.E. 2014. SIRT1 positively regulates autophagy and mitochondria function in embryonic stem cells under oxidative stress. Stem Cells 32 :1183 1194. 318. Wei,D., Tao,R., Zhang,Y., White,M.F., and Do ng,X.C. 2011. Feedback regulation of hepatic gluconeogenesis through modulation of SHP/Nr0b2 gene expression by Sirt1 and FoxO1. Am. J. Physiol Endocrinol. Metab 300 :E312 E320. 319. Wang,F., Chan,C.H., Chen,K., Guan,X., Lin,H.K., and Tong,Q. 2012. Deacet ylation of FOXO3 by SIRT1 or SIRT2 leads to Skp2 mediated FOXO3 ubiquitination and degradation. Oncogene 31 :1546 1557. 320. Jeninga,E.H., Schoonjans,K., and Auwerx,J. 2010. Reversible acetylation of PGC 1: connecting energy sensors and effectors to guarantee metabolic flexibility. Oncogene 29 :4617 4624. 321. Yamamoto,T., and Sadoshima,J. 2011. Protection of the heart against ischemia/reperfusion by silent information regulator 1. Trends Cardiovasc. Med. 21 :27 32. 322. Yang,Y., Duan,W., Li,Y., Jin,Z., Yan,J., Yu,S., and Yi,D. 2013. Novel role of silent information regulator 1 in myocardial ischemia. Circulation 128 :2232 2240. 323. Wang,P., Xu,T.Y., Guan,Y.F., Tian,W.W., Viollet,B., Rui,Y.C., Zhai,Q.W., Su,D.F., and Miao,C.Y. 2011. Nicotinamide phosphoribosyltransferase protects against ischemic stroke through SIRT1 dependent adenosine monophosphate activated kinase pathway. Ann. Neurol. 69 :360 374. 324. Wang,P., Guan,Y.F., Du,H., Zhai,Q.W., Su,D.F., and Miao,C.Y. 2012. Induction of autophagy contributes to the neuroprotection of nicotinamide phosphoribosyltransferase in cerebral ischemia. Autophagy. 8 :77 87. 325. Hamasaki ,M., Furuta,N., Matsuda,A., Nezu,A., Yamamoto,A., Fujita,N., Oomori,H., Noda,T., Haraguchi,T., Hiraoka,Y. et al . 2013. Autophagosomes form at ER mitochondria contact sites. Nature 495 :389 393.

PAGE 175

175 326. Hassan Khabbar,S., Cottart,C.H., Wendum,D., Vibert,F., C lot,J.P., Savouret,J.F., Conti,M., and Nivet Antoine,V. 2008. Postischemic treatment by trans resveratrol in rat liver ischemia reperfusion: a possible strategy in liver surgery. Liver Transpl. 14 :451 459. 327. Huang,S.S., Tsai,M.C., Chih,C.L., Hung,L.M., and Tsai,S.K. 2001. Resveratrol reduction of infarct size in Long Evans rats subjected to focal cerebral ischemia. Life Sci. 69 :1057 1065. 328. Mokni,M., Limam,F., Elkahoui,S., Amri,M., and Aouani,E. 2007. Str ong cardioprotective effect of resveratrol, a red wine polyphenol, on isolated rat hearts after ischemia/reperfusion injury. Arch. Biochem. Biophys. 457 :1 6. 329. Ozkan,O.V., Yuzbasioglu,M.F., Ciralik,H., Kurutas,E.B., Yonden,Z., Aydin,M., Bulbuloglu,E., Semerci,E., Goksu,M., Atli,Y. et al . 2009. Resveratrol, a natural antioxidant, attenuates intestinal ischemia/reperfusion injury in rats. Tohoku J. Exp. Med. 218 :251 258. 330. Lan,F., Cacicedo,J.M., Ruderman,N., and Ido,Y. 2008. SIRT1 modulation of the acetylation status, cytosolic localization, and activity of LKB1. Possible role in AMP activated protein kinase activation. J. Biol. Chem. 283 :27628 27635. 331. Barazzoni,R., Zanetti,M., Sturnega,M., Stebel,M., Semolic,A., Pirulli,A., Vinci,P., Zentilin, L., Giacca,M., Cattin,L. et al . 2011. Insulin downregulates SIRT1 and AMPK activation and is associated with changes in liver fat, but not in inflammation and mitochondrial oxidative capacity, in streptozotocin diabetic rat. Clin. Nutr. 30 :384 390. 332. Hong,S., Zhao,B., Lombard,D.B., Fingar,D.C., and Inoki,K. 2014. Cross talk between sirtuin and mammalian target of rapamycin complex 1 (mTORC1) signaling in the regulation of S6 kinase 1 (S6K1) phosphorylation. J. Biol. Chem. 289 :13132 13141. 333. Armour ,S.M., Baur,J.A., Hsieh,S.N., Land Bracha,A., Thomas,S.M., and Sinclair,D.A. 2009. Inhibition of mammalian S6 kinase by resveratrol suppresses autophagy. Aging (Albany. NY) 1 :515 528. 334. Powell,M.J., Casimiro,M.C., Cordon Cardo,C., He,X., Yeow,W.S., Wa ng,C., McCue,P.A., McBurney,M.W., and Pestell,R.G. 2011. Disruption of a Sirt1 dependent autophagy checkpoint in the prostate results in prostatic intraepithelial neoplasia lesion formation. Cancer Res. 71 :964 975. 335. Jackson,M.D., Schmidt,M.T., Oppenh eimer,N.J., and Denu,J.M. 2003. Mechanism of nicotinamide inhibition and transglycosidation by Sir2 histone/protein deacetylases. J. Biol. Chem. 278 :50985 50998.

PAGE 176

176 336. Lopez Rodas,G., Brosch,G., Georgieva,E.I., Sendra,R., Franco,L., and Loidl,P. 1993. His tone deacetylase. A key enzyme for the binding of regulatory proteins to chromatin. FEBS Lett. 317 :175 180. 337. Yang,X.J. 2004. Lysine acetylation and the bromodomain: a new partnership for signaling. Bioessays 26 :1076 1087. 338. Yang,X.J., and Seto,E . 2008. Lysine acetylation: codified crosstalk with other posttranslational modifications. Mol. Cell 31 :449 461. 339. Kouzarides,T. 2000. Acetylation: a regulatory modification to rival phosphorylation? EMBO J. 19 :1176 1179. 340. Chen,H., Detmer,S.A., Ewald,A.J., Griffin,E.E., Fraser,S.E., and Chan,D.C. 2003. Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. J. Cell Biol. 160 :189 200. 341. Hales,K.G., and Fuller,M.T. 1997. Developmentally regulated mitochondrial fusion mediated by a conserved, novel, predicted GTPase. Cell 90 :121 129. 342. Hermann,G.J., Thatcher,J.W., Mills,J.P., Hales,K.G., Fuller,M.T., Nunnari,J., and Shaw,J.M. 1998. Mitochondrial fusion in yeast r equires the transmembrane GTPase Fzo1p. J. Cell Biol. 143 :359 373. 343. Chan,D.C. 2006. Mitochondrial fusion and fission in mammals. Annu. Rev. Cell Dev. Biol. 22 :79 99. 344. de Brito,O.M., and Scorrano,L. 2008. Mitofusin 2 tethers endoplasmic reticulu m to mitochondria. Nature 456 :605 610. 345. Bach,D., Pich,S., Soriano,F.X., Vega,N., Baumgartner,B., Oriola,J., Daugaard,J.R., Lloberas,J., Camps,M., Zierath,J.R. et al . 2003. Mitofusin 2 determines mitochondrial network architecture and mitochondrial me tabolism. A novel regulatory mechanism altered in obesity. J. Biol. Chem. 278 :17190 17197. 346. de Brito,O.M., and Scorrano,L. 2008. Mitofusin 2: a mitochondria shaping protein with signaling roles beyond fusion. Antioxid. Redox. Signal. 10 :621 633. 347. Singaravelu,K., Nelson,C., Bakowski,D., de Brito,O.M., Ng,S.W., Di,C.J., Powell,T., Scorrano,L., and Parekh,A.B. 2011. Mitofusin 2 regulates STIM1 migration from the Ca2+ store to the plasma membrane in cells with depolarized mitochondria. J. Biol. C hem. 286 :12189 12201. 348. Zhao,T., Huang,X., Han,L., Wang,X., Cheng,H., Zhao,Y., Chen,Q., Chen,J., Cheng,H., Xiao,R. et al 2012. Central role of mitofusin 2 in autophagosome lysosome fusion in cardiomyocytes. J. Biol. Chem. 287 :23615 23625.

PAGE 177

177 349. Chen, Y., and Dorn,G.W. 2013. PINK1 phosphorylated mitofusin 2 is a Parkin receptor for culling damaged mitochondria. Science 340 :471 475. 350. Spinazzi,M., Casarin,A., Pertegato,V., Salviati,L., and Angelini,C. 2012. Assessment of mitochondrial respiratory ch ain enzymatic activities on tissues and cultured cells. Nat. Protoc. 7 :1235 1246. 351. Takasaka,N., Araya,J., Hara,H., Ito,S., Kobayashi,K., Kurita,Y., Wakui,H., Yoshii,Y., Yumino,Y., Fujii,S. et al . 2014. Autophagy induction by SIRT6 through attenuation of insulin like growth factor signaling is involved in the regulation of human bronchial epithelial cell senescence. J. Immunol. 192 :958 968. 352. Warr,M.R., Binnewies,M., Flach,J., Reynaud,D., Garg,T., Malhotra,R., Debnath,J., and Passegue,E. 2013. FOX O3A directs a protective autophagy program in haematopoietic stem cells. Nature 494 :323 327. 353. Xiong,X., Tao,R., Depinho,R.A., and Dong,X.C. 2012. The autophagy related gene 14 (Atg14) is regulated by forkhead box O transcription factors and circadian rhythms and plays a critical role in hepatic autophagy and lipid metabolism. J. Biol. Chem. 287 :39107 39114. 354. Choudhary,C., Kumar,C., Gnad,F., Nielsen,M.L., Rehman,M., Walther,T.C., Olsen,J.V., and Mann,M. 2009. Lysine acetylation targets protein complexes and co regulates major cellular functions. Science 325 :834 840. 355. Park,Y.Y., Nguyen,O.T., Kang,H., and C ho,H. 2014. MARCH5 mediated quality control on acetylated Mfn1 facilitates mitochondrial homeostasis and cell survival. Cell Death. Dis. 5 :e1172. 356. Gegg,M.E., Cooper,J.M., Chau,K.Y., Rojo,M., Schapira,A.H., and Taanman,J.W. 2010. Mitofusin 1 and mitof usin 2 are ubiquitinated in a PINK1/parkin dependent manner upon induction of mitophagy. Hum. Mol. Genet. 19 :4861 4870. 357. Hailey,D.W., Rambold,A.S., Satpute Krishnan,P., Mitra,K., Sougrat,R., Kim,P.K., and Lippincott Schwartz,J. 2010. Mitochondria sup ply membranes for autophagosome biogenesis during starvation. Cell 141 :656 667. 358. Chen,Y., Csordas,G., Jowdy,C., Schneider,T.G., Csordas,N., Wang,W., Liu,Y., Kohlhaas,M., Meiser,M., Bergem,S. et al . 2012. Mitofusin 2 containing mitochondrial reticular microdomains direct rapid cardiomyocyte bioenergetic responses via interorganelle Ca(2+) crosstalk. Circ. Res. 111 :863 875. 359. Papanicolaou,K.N., Khairallah,R.J., Ngoh,G.A., Chikando,A., Luptak,I., O'Shea,K.M., Riley,D.D., Lugus,J.J., Colucci,W.S., Le derer,W.J. et al . 2011. Mitofusin 2 maintains mitochondrial structure and contributes to stress induced permeability transition in cardiac myocytes. Mol. Cell Biol. 31 :1309 1328.

PAGE 178

178 360. Pich,S., Bach,D., Briones,P., Liesa,M., Camps,M., Testar,X., Palacin,M ., and Zorzano,A. 2005. The Charcot Marie Tooth type 2A gene product, Mfn2, up regulates fuel oxidation through expression of OXPHOS system. Hum. Mol. Genet. 14 :1405 1415. 361. Li,J., Ke,W., Zhou,Q., Wu,Y., Luo,H., Zhou,H., Yang,B., Guo,Y., Zheng,Q., and Zhang,Y. 2014. Tumour necrosis factor alpha promotes liver ischaemia reperfusion injury through the PGC 1alpha/Mfn2 pathway. J. Cell Mol. Med. 362. Pokrovskii,A.A., Arachakov,A.I., and Alenicheva,T.V. 1968. [Changes in the activity of lysosome enzymes i n liver ischemia]. Tsitologiia 10 :1467 1472. 363. Soriano,F.X., Liesa,M., Bach,D., Chan,D.C., Palacin,M., and Zorzano,A. 2006. Evidence for a mitochondrial regulatory pathway defined by peroxisome proliferator activated receptor gamma coactivator 1 alpha , estrogen related receptor alpha, and mitofusin 2. Diabetes 55 :1783 1791. 364. Libri,V., Brown,A.P., Gambarota,G., Haddad,J., Shields,G.S., Dawes,H., Pinato,D.J., Hoffman,E., Elliot,P.J., Vlasuk,G.P. et al . 2012. A pilot randomized, placebo controlled, double blind phase I trial of the novel SIRT1 activator SRT2104 in elderly volunteers. PLoS. One. 7 :e51395. 365. Brasnyo,P., Molnar,G.A., Mohas,M., Marko,L., Laczy,B., Cseh,J., Mikolas,E., Szijarto,I.A., Merei,A., Halmai,R. et al . 2011. Resveratrol impro ves insulin sensitivity, reduces oxidative stress and activates the Akt pathway in type 2 diabetic patients. Br. J. Nutr. 106 :383 389. 366. Timmers,S., Konings,E., Bilet,L., Houtkooper,R.H., van de Weijer,T., Goossens,G.H., Hoeks,J., van der Krieken,S., Ryu,D., Kersten,S. et al . 2011. Calorie restriction like effects of 30 days of resveratrol supplementation on energy metabolism and metabolic profile in obese humans. Cell Metab 14 :612 622. 367. Wong,R.H., Howe,P.R., Buckley,J.D., Coates,A.M., Kunz,I., a nd Berry,N.M. 2011. Acute resveratrol supplementation improves flow mediated dilatation in overweight/obese individuals with mildly elevated blood pressure. Nutr. Metab Cardiovasc. Dis. 21 :851 856. 368. De,G.D., Van,B.K., Deviere,J., Van,B.W., Mukaneza,A ., and Amininejad,L. 2012. Effect of the intake of resveratrol, resveratrol phosphate, and catechin rich grape seed extract on markers of oxidative stress and gene expression in adult obese subjects. Ann. Nutr. Metab 61 :15 24. 369. Poulsen,M.M., Vesterga ard,P.F., Clasen,B.F., Radko,Y., Christensen,L.P., Stodkilde Jorgensen,H., Moller,N., Jessen,N., Pedersen,S.B., and Jorgensen,J.O. 2013. High dose resveratrol supplementation in obese men: an investigator initiated, randomized, placebo controlled clinical trial of substrate metabolism, insulin sensitivity, and body composition. Diabetes 62 :1186 1195.

PAGE 179

179 370. Yoshino,J., Conte,C., Fontana,L., Mittendorfer,B., Imai,S., Schechtman,K.B., Gu,C., Kunz,I., Rossi,F.F., Patterson,B.W. et al . 2012. Resveratrol supplem entation does not improve metabolic function in nonobese women with normal glucose tolerance. Cell Metab 16 :658 664. 371. Venkatasubramanian,S., Noh,R.M., Daga,S., Langrish,J.P., Joshi,N.V., Mills,N.L., Hoffmann,E., Jacobson,E.W., Vlasuk,G.P., Waterhouse,B.R. et al . 2013. Cardiovascular effects of a novel SIRT1 activator, SRT2104, in otherwise healthy cigarette smokers. J. Am. Heart Assoc. 2 :e000042.

PAGE 180

180 BIOGRAPHICAL SKETCH Thomas Biel obtained his Bachelor of Science degree in biology from K eystone College, Pennsylvania (2004 2009) and joined the Interdisciplinary Biomedical Sciences Program at the University Of Florida College o f Medicine in 2009. Under the mentorship of Dr. Jae Sung Kim and Dr. Kevin Behrns, Mr. Biel has presented his resea rch in several international conferences such as the American Association for the Study of Liver Disease (AASLD), Experimental Biology (EB), and Mitochondria and the Colleg e of Medicine Research Day. Throughout his training he has received honors and awards such as the AALSD posters of distinction and second place for research co mpletion of his P hD program in medical s ciences in December 2014, he aspires to remain in the area of mitochondrial therapeutics for medicinal treatments.