Citation
Regulation of Antigen Presenting Cell Phenotype and Function by Suppressor of Cytokine Signaling-1

Material Information

Title:
Regulation of Antigen Presenting Cell Phenotype and Function by Suppressor of Cytokine Signaling-1
Creator:
Bedoya, Simone Kennedy
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (65 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
LARKIN,JOSEPH,III
Committee Co-Chair:
JOHNSON,HOWARD M
Committee Members:
KANG,BYUNG-HO
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Antigens ( jstor )
Cells ( jstor )
Cytokines ( jstor )
Diseases ( jstor )
Immunity ( jstor )
Integrins ( jstor )
Lymph nodes ( jstor )
Macrophages ( jstor )
Mice ( jstor )
Proteins ( jstor )
Microbiology and Cell Science -- Dissertations, Academic -- UF
autoimmunity -- cytokines -- mimetics -- socs1
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Microbiology and Cell Science thesis, M.S.

Notes

Abstract:
Suppressor of cytokine signaling-1 (SOCS1) is an intracellular protein involved in regulating immune homeostasis. As our previous studies have shown that SOCS1 is required for T cell phenotype integrity, we have investigated additional roles which SOCS1 plays in policing the activity of antigen presenting cells (APCs). Our data shows that APCs from SOCS1+/- mice produce higher levels of inflammatory cytokines IL-12 and IL-6, while unable to sustain production of anti-inflammatory IL-10. Upon further examination, it was found that SOCS1+/- mice express reduced surface levels of CD11b integrins, however SOCS1+/- mice also express elevated levels of the co-stimulatory protein, CD40. Additionally in SOCS1+/- mice, CD11b+ leukocytes possessed increased expression of MHC Class II. It is evident that deficiencies in SOCS1 negatively influence APCs, so we utilized a SOCS1 mimetic peptide, SOCS1-KIR to determine whether this deregulation could be amended. SOCS1-KIR reduced levels of inflammatory cytokine production, and enhanced levels of IL-10. While SOCS1-KIR could enhance CD11b and decrease CD40 expression, it had no effect on MHC Class II expression. In order to evaluate the tissue localization of SOCS1-KIR and pJAK2 (SOCS1 antagonist), we injected fluorochrome-labeled peptides into C57BL/6 mice. SOCS1-KIR and pJAK2 both localized to the brain, liver, lymph nodes, peritoneal cells, spleen, and kidneys. Upon cellular examination, peptides were present within CD4+ and CD8+ T cells, and to an increased extent B220+ B cells, and CD11b+ macrophages. These results indicate that SOCS1 plays an indispensable role in regulating APC function, and that SOCS1-KIR presents a possible target for therapeutic development. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2014.
Local:
Adviser: LARKIN,JOSEPH,III.
Local:
Co-adviser: JOHNSON,HOWARD M.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Simone Kennedy Bedoya.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

REGULATION OF ANTIGEN PRESENTING CELL PHENOTYPE AND FUNCTI ON BY SUPPRESSOR OF CYTOKINE SIGNAL ING 1 By SIMONE KENNEDY BEDOYA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Simone Kennedy Bedoya

PAGE 3

To all my family and loved ones especially Andres Bedoya and Annie, Nolan, Marissa, Gisele, and Rylan Kennedy. Forever and always.

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mentor Dr. Joseph Larkin III for giving me a spot in his lab, and continuing to help shape my view of the scientific world, and for our continuing conversation on the wonders of the immune system. Also my busy and understanding committee members, Dr. Howard M. Johnson and Dr. Byung Ho Kang. It is not without their understanding and patience that I would be able to complete this degree. There have been many people who have impacted my journey throughout this process, and I would like to begin by saying a thanks to my fellow lab members both present and past: Brandon, Tenisha, Dr. Sukka, Antia, Cristina, Zaynab, and Teresa. Tenisha has been such a mentor and teacher, who always led with a strong example, and without her I would not possess the scientific techniques I have today. Brandon and Cristina are remarkable students to say the least; our continued collaboration and discussions has certainly contributed to my succes s today. To Dr. Sukka, Antia, Zaynab, and Teresa: I would not have made it to this point without having all of you to laugh with these past couple of month. Outside of the lab, I would like to thank all of the other students, faculty and staff in our dep artment who have touched my life in some way or another. To Dr. Monika Oli, you have been an incredible mentor who has shaped my love of teaching, and has always provided a fresh outlook on life. Thanks to Richard for always having something to laugh about at the end of a hard day. Special thanks to Lisa, Artemis, and our continuing email chain; I will always miss our life discussions over our pre class bagels and coffee. I would also like to offer a special thanks to Dr. Ashby Bodine who was the

PAGE 5

5 first to h elp me realize my love of science and research; He is currently fighting a very difficult battle with cancer, and I wish him and his family all the strength in the world. Finally but certainly not least, I would like to thank all my family members. To And res, you are such an amazing husband and I could not have done this without all of your support, love, and patience. To my parents, Annie and Nolan Kennedy, for always wanting the best for me, and giving me the opportunities and tools needed to succeed in life. To my siblings, Marissa and Rylan, you guys are the best and I love every minute we get to laugh and spend together.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 10 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 The JAK/STAT Pathway ................................ ................................ ......................... 15 Suppressor of Cytokine Signaling (SOCS) Family ................................ .................. 15 Suppressor of Cytokine Signaling 1 ................................ ................................ ........ 17 SOCS1 and Immune Regulation ................................ ................................ ............. 18 The Role of SOCS1 in Autoimmune Dise ases ................................ ........................ 20 Systemic Lupus Erythematosus ................................ ................................ ....... 21 Diabetes ................................ ................................ ................................ ........... 22 Multiple Sclero sis ................................ ................................ ............................. 22 Rheumatoid Arthritis ................................ ................................ ......................... 23 Asthma ................................ ................................ ................................ ............. 24 SOCS1 Mimetics ................................ ................................ .............................. 24 2 ASSESS CYTOKINE PRODUCTION IN SOCS1 +/ MICE AND THE POTENTIAL OF A SOCS1 MIMETIC TO REDIRECT ABERRANT CYTOKINE PRODUCTION ................................ ................................ ................................ ........ 27 Higher Prod uction of inflammatory Cytokines IL 12 and IL 6 Found in Response to Stimuli in SOCS1 +/ Mice ................................ ................................ .................. 27 SOCS1 Mimetic, SOCS1 KIR, Ameliorates Increased Levels of Inflammatory Cytokine Production ................................ ................................ ............................. 28 SOCS1 +/ Mice Fail to Produce Sufficient Levels of Anti Inflammatory Cytokine IL 10 in Response to Stimulation, which is increased through Addition of SOCS1 KIR. ................................ ................................ ................................ ........ 29 3 INVESTIGATION OF SOCS1 DEFICIENT ANTIGEN PRESENTING CELL PHENOTYPES ................................ ................................ ................................ ....... 34 Regulation of CD11b Expression by the Kinase Inhibitory Region of SOCS1 ........ 34 Heightened expression of MHC Class II on CD11b+ cells is unaffected by SOCS1 KIR. ................................ ................................ ................................ ........ 35

PAGE 7

7 The KIR region of SOCS1 limits CD40 expression. ................................ ................ 36 4 EVALUATING THE THERAPEUTIC POTENTIAL OF CELL PENETRATING PEPTIDES THAT MODULATE SOCS1 SIGNALING: TISSUE AND CELLULAR LOCALIZATION OF CELL PENETRATING SOCS MIMETIC AND ANTAGONIST PEPTIDES ................................ ................................ ...................... 40 5 DISCUSSION ................................ ................................ ................................ ......... 45 6 MATERIALS AND METHODS ................................ ................................ ................ 51 LIST OF REFERENCES ................................ ................................ ............................... 55 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 65

PAGE 8

8 LIST OF TABLES Table page 6 1 Primers used and/or discussed in this stu dy. ................................ ...................... 54 6 2 Peptides used and/or discussed in this study. ................................ .................... 54

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Aberrant production of I L 12 and IL 6 in SOCS1 +/ mice. ................................ .... 31 2 2 SOCS1 mimetic SOCS1 KIR ameliorates elevated levels of IL 12 and IL 6 production in SOCS1 +/ mice. ................................ ................................ ............. 32 2 3 SOCS1 +/ cells are unable to sustain production of anti inflammatory IL 10; inclusion of SOCS1 KIR increases insufficient IL 10 levels. ............................... 33 3 1 The k inase inhibitory region of SOCS1 regulates CD11b expression. ................ 37 3 2 SOCS1 +/ mice express elevated frequencies of CD11b+ MHC Class II+ cells, which is not mediated by SOCS1 KIR. ................................ ...................... 38 3 3 SOCS1 regulates expression of co stimulatory protein CD40. ........................... 39 4 1 Localization of cell penetrating peptides SOCS1 KIR and pJAK2 ...................... 43 4 2 Localization of SOCS1 KIR and pJAK2 peptides to immune tissues. ................. 44

PAGE 10

10 LIST OF ABBREVIATIONS APC Btk CD CIA CIS Cr3 DC EAE ELISA EPO ESS FAK G CSF HT IBD ICAM 1 INF INFGR 1 IL I.P. JAK JNK KIR LIF Antigen Presenting Cell Cl uster of Differentiation Collage n Induced Arthritis Cytokine Inducible SH2 Containing protein Complement receptor 3 Dendritic Cell Experimental Allergic Encephalomyelitis Enzyme Linked Immunosorbent Assay Erythropoietin Extended SH2 domain Focal Adhesion Kinase Granulocyte Colony Stimul ating Factor Heterozygous Irritable Bowel Disease Intracellular Adhesion Molecule 1 Interferon Interferon Gamma Receptor 1 Interleukin Intraperitoneal Janus Kinase c Jun N Terminal Kinase Kinase Inhibitory Region Leukemia Inhibitory Factor

PAGE 11

11 LPS MCP 1 MHC MS NFK NZB/NZW F1 PD 1 PGE2 PI3K PLP RA RR MS SH2 SLE SNP SOCS SOCS1 STAT TGF Th1 Th17 Tkip TNF TLR Treg Lipopolysacchari de Monocyte Chemoattractant P rotein 1 Major Histocompatibility Complex Multiple Sclerosis Nuclear Factor Kappa Beta New Zealand Black/New Zealand White F1 Programmed Death 1 Prostaglandin E2 Phosphoinositide 3 Kinase Proteolipid Protein Rheumatoid Arthrit is Relapse Remitting Multiple Sclerosis Src Homology 2 Systemic Lupus Erythematosus Single Nucleotide Polymorphism Suppressor of Cytokine Signaling Suppressor of Cytokine Signaling 1 Signal Transducer and Activator of Transcription Transforming Growth Fact or Beta T helper 1 T helper 17 Tyrosine kinase inhibitor peptide Tumor Necrosis Factor Toll l ike Receptor Regulatory T Cell

PAGE 12

12 VEGF C VEGFR 3 WT Vascular Endothelia l Growth Factor C Vasc ular Endothelial Growth Factor Receptor 3 Wildtype

PAGE 13

13 Abstract of Thesis Presented t o the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science REGULATION OF ANTIGEN PRESENTING CELL PHENOTYPE AND FUNCTION BY SUPPRESSOR O F CYTOKINE SIGN AL ING 1 By Simone Kennedy Bedoya August 2014 Chair: Joseph Larkin, III Major: Microbiology and Cell Science Suppressor of cytokine signaling 1 (SOCS1) is an intracellular protein involved in regulating immune homeostasis. As our previous studies have shown that SOCS1 is required for T cell phenotype integrity, we have investigated additional roles which SOCS1 plays in policing the activity of antigen presenting cells (APCs). Our data shows that APCs from SOCS1 +/ mice produce higher levels of inflammatory cytokines IL 12 and IL 6, while unable to sustain production of anti inflammatory IL 10. Upon further examination, it was found that SOCS1 +/ mice express reduced surface levels of CD11b integrins, however SOCS1 +/ mice also express elevated levels of the co stimulatory p rotein, CD40. Additionally in SOCS1 +/ mice, CD11b+ leukocytes possessed increased expression of MHC Class II. It is evident that deficiencies in SOCS1 negatively influence APCs, so we utilized a SOCS1 mimetic peptide, SOCS1 KIR to determine whether this d ysregulation could be amended. SOCS1 KIR reduced levels of inflammatory cytokine production, and enhanced levels of IL 10. While SOCS1 KIR could enhance CD11b and decrease CD40 expression, it had no effect on MHC Class II expression. In order to evaluate t he tissue localization of SOCS1 KIR and pJAK2 (SOCS1 antagonist), we injected fluorochrome labeled peptides into C57BL/6 mice. SOCS1 KIR and pJAK2 both

PAGE 14

14 localized to the brain, liver, lymph nodes, peritoneal cells, spleen, and kidneys. Upon cellular examina tion, peptides were present within CD4+ and CD8+ T cells, and to an increased extent B220+ B cells, and CD11b+ macrophages. These resu lts indicate that SOCS1 plays a role in regulating APC function, and that SOCS1 KIR presents a possible target for therape utic development.

PAGE 15

15 CHAPTER 1 INTRODUCTION The JAK/STAT Pathway In order to maintain a state of immune homeostasis, a delicate balance of magnitude and duration of an immune response must be maintained. The body directs this balance through a multitude of cascade signaling responses which include regulation of the essential JAK/STAT pathway. Cytokine interaction with receptors of the JAK/STAT pathway results in autophosphorylation of the Janus Kinases (JAKs), and phosphorylation of the receptor (1) . This results in subsequent recruitment, tyrosine phosphorylation, and activation of Signal Transducer and Activators of Transcription (STAT) molecules. STAT pr oteins dimerize and relocate to the nucleus where they increase transcription of responsive genes, including those which correlate to a number of inflammatory cytokines as well as that of Suppressor of Cytokine Signaling (SOCS) family members (2) . Suppressor of Cytokine Signaling (SOCS) Family SOCS proteins play an important role in immune system regulation. The S OCS family includes eight members, SOCS1 SOCS7, and th e cytokine inducible Src homology 2 ( SH2 ) containing protein (CIS). SOCS proteins have three main regions which are involved in exerting regulatory functions. Each member co ntains a central SH2 domai n and a conserved carboxy terminal domain, referred to as the SOCS box (3) . SOCS1 and SOCS3 are unique in the aspect that they each contain an additional domain in their amino terminal motif known as the Kinase Inhibitory Region (KIR) (3) . Each domain of these SOCS proteins is responsible for a unique function. The SH2 domain aids in docking to the phosphotyrosine residues of a target protein, and

PAGE 16

16 helps in determining the specificity of which proteins the SOCS molecule will bind to (4) . There is also data to suggest that the SH2 domain may also provide additional stability to the protein, especially in SOCS3 (4, 5) . Recently it was described that another shared feature between the SOCS family members is a short alpha helical extension, referred to as the extended SH2 domain (ESS), which may contribute to substrate binding (6, 7) . The carboxy terminal domain, or the SOCS box, is a 40 amin o acid long motif also conserve d throughout members of the SOCS family. The SOCS box recruits and interacts with several different components ultimately allowing scaffold formation of an E3 ubiquitin ligase (4) . This allows the SOCS box the capability to ubiquitinate target proteins, and mark them for proteosomal degradation (4) . Thirdly, the KIR is an amino terminal motif found downstream of the SH2 domain in SOCS1 and SOCS3 family members only. It is 12 amino acids long, and has been shown to be complementary in sequence to that of the JAK protein family activation loops (4) . The kinase inhibitory region of SOCS 1 restricts autophosphorylated JAK proteins from phosphorylating and activating the STAT molecules, causing conformational changes in the catalytic site of the JAKS and inducing ATP hydrolysis without the t ransfer of the phosphate group to the tyrosine residues of the substrate (8) . As a family, SOCS proteins generally act as class ical negative feedback inhibitors, and they do so through three basic mechanisms. SOCS proteins can bind to the signaling receptor or the JAK activation loop, thereby inhibiting further JAK activity. Even within a similar inhibition method, these SOCS prot eins display unique methods of action as SOCS3 prefers interaction with the signaling receptor, whereas SOCS1 highly prefers the phosphorylated activation loop of JAK2 (4) . SOCS proteins can also regulate

PAGE 17

17 cytokine signaling via substrate competition, for example CIS competes with the tyrosine residues of the receptors which allow STAT5 to dock, thereby inhibi ting further STAT5 signaling (9) . Lastly SOCS molecules target specific proteins for proteosomal degradation through ubiquit ination from their SOCS Box (4) . In addition to regulating the JAK/STAT pathway, SOCS protein members ha ve also been shown to have roles in regulating the phosphoinositide 3 kinase (PI3K) Akt pathway (10) and the nuclear factor (NF ) pathw ay (11) . Although the SOCS family of proteins have been shown to have similar routes of synthesis, they more than likely possess versatile roles in different cell types (12) . Suppressor of Cytokine Signaling 1 Of special interests to our studies is the intracellular protein SOCS1. Produced as a downstream result of the JAK/STAT signaling pathway, SOCS1 travels back up to act as a n egative feedback loop, thereby restricting any further pathway signaling and cytokine production. SOCS1 has continuously been shown to be a critical factor in the correct immune response. SOCS1 can be induced through, and subsequently inhibit, a number of cytokines which include interleukin 2 (IL 2) (13) , IL 4 (14, 15) , IL 6 (16) , IL 13 (17) , IFN / (18, 19) , (20) , erythropoietin (EPO) (16, 20) , Granulocyte Colony Stimulating Factor (G CSF) (14) , Leukemia Inhibitory Facto r (LIF) (14) , growth hormones (21) , and TNF (22) . SOCS1 can also be induced in response to Toll like receptor (TLR) ligands including lipopolysaccharides (LPS), and CpG DNA (23 25) . Of note, it has recently come to light that the TNF induced microRNA 155 (miR 155) may target SOCS1; Foxp3+ regulatory T cells (Tregs) additionally negatively regulate miR -

PAGE 18

18 155, thereby helping to maintain correct SOCS1 expression (26) . This relationship between miRNA, SOCS1, and Tregs may pose strong implications for disease targets. SOCS1 and Immune Regulation Mice devoid of SOCS1 (SOCS / ) die by three weeks of age due to a perinatal lethal inflammatory disease characterized by severe leukocytic organ infiltration and increased production and responsiveness to the inflammatory cytokine IFN (27, 28) . Complete lack of SOCS1 also results in T cell hyperactivation and proliferation, fatty degeneration of the liver, reduced thymic size, and progressive loss of maturing B cells (27 29) . SOCS1 / IFN / mice retai n a much higher life expectancy, which further highlights the important role SOCS1 has in maintaining correct levels of cytokine production (30) . The influence of SOCS1 reaches into the arms of both the adaptive and innate features of protection, it has become an important point to understand the role that SOCS1 plays in its function. Macrophages are generally classified into two subsets: M1 macrophages which are classically activated, aid in the elimination of pathogens, but are capable of also causing tissue damage, and M2 macrophages, which are alternatively activat ed and tend to promote tissue healing and repair. It has been reported that SOCS1 can reduce macrophage responses to IFN , and that the majority of infiltrating M1 macrophages involved in kidney nephritis express high levels of SOCS3, but not SOCS1 (31) . SOCS1 is highly upregulated, however, in the alternatively activated M2 macrophages. This upregulation of SOCS1 helps to retain the M2 anti inflammatory and T cell suppressive characteristics (31) . Furthermore when

PAGE 19

19 SOCS1 expression levels are reduced in M1 macrophages, an incr ease in MHC Class II expression and levels of IL 12, IL 6, and interestingly IL 10 production occurs (31) . Several of the initial studies investigating the relationship between SOCS1 and macrophages expose d that SOCS1 regulates macrophage responses to LPS, whereby SOCS1 is strongly upregulated in response to LPS stimulation, and subsequently inhibits LPS induced NFK and STAT1 activation (24) . In agreement with these results, Kinjyo et al. in 2002 also showed that SOCS1 +/ and SOCS1 / IFN / mice are much more sensitive to LPS induced lethal effects (23) . When SOCS / macrophages were stimulated with LPS there was an upregulation of I K and p38 phosphorylation and activ ation, and NFK activation was inhibited by SOCS1 expression (32) . These studies opened up work for examining the inhibitory role which SOCS1 exerts on toll like receptor (TLR) signaling through the degradation of a key component in the TLR and NFK pathway, Mal (33) . In the absence of SOCS1, Mal potentiates the phosphorylation of p65 and continued transactivation of NFK , which leads to prolonged production of inflammatory cytokine s (33) . Mal undergoes tyrosine phosphorylation by ), which allows for recognition by SOCS1, and is then polyubiquitinated and degraded, suggesting that the SOCS box plays a critical role in this negative regulation (33) . Taken together these studies suggest a crucial role of SOCS1 in regulating the innate immune response, and in protection against endotoxin induced fatal shock. These discussions have focused on a direct role for SOCS1 in influencing ce llular processes, but an important area of focus should also be placed on the influence SOCS1 exerts through cross talk with other anti inflammatory mediators of the

PAGE 20

20 immune response. For example, SOCS1 may play a role in regulating activation and ligation of the vascular endothelial growth factor receptor 3 (VEGFR 3) and its ligand VEGF C, which in turn attenuates proinflammatory cytokine production through inhibition of TLR4 NFK signaling (34) . SOCS1 and Programmed Death 1 (PD 1) are upreg ulated during Hepatitis C infection, effectively blocking production of IL 12, suggesting that PD 1 and SOCS1 may com municate to further regularly mediate inflammation (35) . The suppressive function of prostaglandin E2 is dependent on SOCS1, indicating that these act together as an alternative intestinal tolerance mechanism distinct from Treg s (36) . SOCS1 / Rag2 / mice develop a severe colitis, which can be reversed with the transfer of IL 10 sufficient Tregs (36) . In the absence of SOCS1, Tregs begin to produce inflammatory cytokines IFN and IL 17a, and have deficient peripheral Treg numbers (28, 37) . As a whole, these studies demonstrate the potent anti inflammatory and regulatory role that SOCS1, in concert with other mediators, plays in the immune response. The Role of SOCS1 in Autoimmune Diseases Excessive immune signaling results in an aberrant and chronic inflammatory environment that can ultimately lead to development of autoimmunity. By acting as a negative feedback loop for many inflammatory factors, SOCS1 plays a critical role in the progression and on set of many autoimmune disorders. These disorders include, but are not limited to, systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), diabetes, multiple sclerosis (MS), and even asthma. Briefly, SOCS1 has also been found to play a role in both the prevention of and augmentation of cancer development. It seems as though incorrect function or reduced expression of SOCS1 plays an important role in the development of cancers such as myeloma, leukemia, and prostate cancer among

PAGE 21

21 others (38 40) . However silencing SOCS1 can also increase the inflammatory environment, and initiate more potent antitumor activity. Silencing of SOCS1 in macrophages enhances the tumor killing activity of these cells, and silencing of SOCS1 in dendritic cells improves DC antigen presentation and antigen specific antitumor immunity, such as increased IL 12 production (32, 41) . Systemic Lupus E rythematosus Our own studies have begun to correlate a decreased level of SOCS1 to an increase in disease severity ( unpublished observations ), and i n a classical murin e model of lupus nephritis, NZB/ NZW F1 mice were found to have decreased SOCS1 expression (42) . NZB/ NZW F1 mice were treated with a tolerogenic peptide shown to possess efficacy in ameliorating SLE symptoms, hCDR1, and the results indicated that one method of hCDR1 function may be through the upregulation of SOCS1 and subsequent down regulation of phosph orylated STAT1 (42) . hCDR1 was further found to increase levels of Tregs, which further emphasizes the link between SOCS1 and Tregs in mediating an inflammatory environmen t (42). The levels of SOCS1 mRNA have also been negatively correlated with levels of dsDNA antibodies in SLE patients (44) . E µ SOCS1 / mice (mice which express SOCS1 in lymphoid cells) used as a model for SLE, have self reactive CD4+ T cells which are capable of interacting with B cells, and suppressing Treg function (45) . This hyperactivation of B cells leads to excessive for mation of immune complexes and autoantibody production, while also increasing the incidence of glomerulonephritis (45) . Patients with SLE have also been described as having defects in SOCS1 production

PAGE 22

22 which are associated with hyper sensitivity to Type I interferons, and increased activation of the JAK/STAT pathway (46) . It has also been suggested from three different models of murine lupus, that miR 155, as well as miR 19a a nd miR 19b, may play a role in SOCS1 regulation, indicating a possible role for SLE regulation through the mRNA level (47) . Diabetes In a model of hepatic insulin resistance, a common marker for Type II diabetes, the deletion of macrophage specific S OCS1 was found to increase sensitivity to LPS as well as to palmitic acid (a saturated fatty acid able to induce an immune response in macrophages through TLR4 signaling) (48) . Obesity is associated with an increa se in inflammatory cytokines produced primarily by macrophages found in the adipose tissue , and this elevated inflammatory environment can lead to insulin resistance and fatty acid metabolic defects (49) . Sachithanandan and colleagues demonstrated that with a lack of SOCS1, macrophages had an increased propensity to produce inflammatory cytokines including TNF , IL 6, and monocyte chemoattractant protein (MCP) when stimulated by either LPS or palmitic acid (48) . SOCS 1 has also been shown to inhibit caspase 3, 8, and 9, and by doing so SOCS1 protects pan cre atic cells from inflammatory cytokine induced apoptosis (50) .These studies led to the conclusion that SOCS1 is critical in regulating inflammation and hepatic insulin sensitivity, possibly providing a role for it in the development of di abetes. Multiple Sclerosis Multiple sclerosis (MS) is a devastating neurological disorder whose murine model of Experimental Allergic Encephalomyelitis (EAE) has allowed indispensable insight onto disease pathology. Both human and mice studies have shown promising

PAGE 23

23 results into the examination of the role of SOCS1 in disease development. Balabanov and colleagues demonstrated in PLP/SOCS1 (Proteolipid Protein) transgenic mice that expression of SOCS1 protected oligodendrocytes against the deleterious effects of IFN on disease progression (51) . In Berard et al. SOCS1 was described as being the determining factor of whether mice developed chronic or relapse remitting EAE (52) . As of recent, it has been found the single nucleotide polymorphisms (SNPs) within or nearby genes coding for SOCS1 provide a novel risk factor for MS, and it is possible that these functional polymorphisms are altering transcriptional activity of the SOCS1 gene (53) . Another SNPs related study found that SOCS1 was decreased in thymic sampl es from patients carrying at least one CLEC16A risk allele indicating a probable role in immune regulation for MS associated CLEC16A SNPs (54) . From a different perspective, the use of Simvastatin, which is widely used to lower cholesterol, was studied in conjunction with dendritic cells from Remitting Relapsing MS (RR MS) patients (55) . Simvastatin inhibited the production of IL 1 , IL 23, TGF , IL 21, IL 12p70 and activation of STAT1, STAT2, and ERK1/2, which ultimately reduced Th1 and Th17 polarizing environments (55) . Simvastatin was also found capable of decreasing antigen presentation through the decrease of MHC Cla ss I, CD80, and CD40 . These disea se affecting differences were found to be mediated through induction of SOCS1, SOCS3, and also SOCS7 (55) . Rheumatoid Arthritis Rheumatoid arthritis is a disease characterized by joint inflammation. Tsao et al. stated that SOCS1 tra nscript levels are varied in those patients with not only RA, but also patients with SLE compared to healthy controls (43) . Recently it was shown that in a collagen induced arthritis (CIA) model, mice that had their IL 10 gene placed under

PAGE 24

24 control of an inflammation dependent promoter exhibited reduced severity of disease symptoms compared to controls (56) . This increase in IL 10 production led to induction of SOCS1 expression levels, and a decrease in IL 6 production (56) . Asthma Although the role of SOCS1 is not as well established in asthma as some of the aforementioned disorders, researchers are beginning to look into the potential role that SOCS1 may play in regulating this disease. One group compared the levels of Th2 related cytokines IL 4, IL 13, and IL 5 in OVA challenged SOCS1 / IFN / mice versus IFN / mice and C57BL/6 mice (57) . Levels of the above mentioned cytokines were significantly el evated in the OVA challenged SOCS1 / IFN / mice, as was levels of IgE and infiltrating eosinophils (57) . In an alternative model of allergic airway disease, an airway response, which included activation o f STAT6, was induced in response to challenge with IL 13. Induced SOCS1 expression was able to then inhibit the IL 13 dependent STAT6 activation, and ultimately airway inflammation. In OVA challenged mice during this same study, SOCS1 expression was upregu lated after allergen exposure, which led to a lessened allergic airway disease (58) . Of note, airway smooth muscle cells from asthma patients were described as being incapable of fully upregulating SOCS1 in response to IL 13 (58) . Therefore SOCS1 may play a role in regulating key factors of the allergic airway response. SOCS1 Mimetics SOCS1 presents a promising target for therapeutics as the protein has such a potent role in maintaining a state of tolerance and regulating a correct inflammatory response in the immune system. In 2004 a small 12mer peptide coined Tkip (Tyrosine kinase inhibitor peptide) ( WLVFFVIFYFFR ) was developed by the lab of H.M. Johnson

PAGE 25

25 (59) . Tkip is able to bind to the autophosphorylation loop of JAK2, although it prefers the tyrosine p hosphorylated residue of JAK2 Y1007, and prevents JAK2 autophosphorylation and phosphorylation of the IFN receptor subunit IFNGR 1 (59) . Similar to SOCS1 function, Tkip successfully inhibits IFN from mounting an inflammatory response, and inhibits further JAK/STAT signaling (59) . Subsequently it was shown that Tkip was also able to regulate cancer cells, as it decreased cellular proliferatio n and inhibited IL 6 induced activation of STAT3 in a human prostate cancer cell line (38 ) . In 2007 another small tyrosine kinase inhibitor SOCS1 KIR ( 53 DTHFRTFRSHSDYRRI 68 ) was developed (60) . SOCS1 KIR is able to bind to the autop hosphorylation site of JAK2, as Tkip does, and can inhibit STAT activation however SOCS1 KIR is unable to block JAK2 autophosphorylation (60) . F urther studies using SOCS1 KIR established that this mimetic peptide is able to abolish aberrant cytokine signaling. In a murine model of EAE, a classical model for MS, treatment with SOCS1 KIR resulted in a reduction and minimal display of EAE related sym ptoms, mediated through a reduction in Th17 differentiating related factors (61) . SOCS1 KIR in conjunction with CD4+ T cells was also capable of rescuing SOCS1 / mice from the inflammatory cytokine mediated perinatal lethality disease (28) . An additional peptide which mimics the KIR of biological SOCS1 named PS 5, developed by Madonna and colleagues, was seen capable of reducing pathologies associated with type 1 immune mediated skin disorders (62) . As SOCS1 acts as a negative feedback loop for ongoing inflammation, it also poses an interesting target for increasing for increasing the instance of correct and

PAGE 26

26 timely pathogen clearance. It has become established that many p athogenic microbial organisms target SOCS1 to cause a dampened immune response (2) . Expression of SOCS1 blocked the antiviral response to influenza (63) , and in a model of tuberculosis infection, high levels of infection severity were correlated with decreased expression of SOCS1 (64) . Toxoplasma gondii and Mycobacterium bovis have both been shown to specifically target an increase in SOCS1 expression to impede inflammatory cytokine production and STAT activation (65, 66) . As such evidence suggests a strong positive correlation between increased SOCS1 induction and an increased infection level, SOCS1 does provide a potential target to enhance a dampened antiviral response. As such, a small peptide corresponding to the sequence of the activation loop of JAK2 1001 ( LPQDKEYYKVKEP ) was developed to investigate this possibility. pJAK2 binds to the KIR of biological SOCS1, thereby preventing JAK/STAT pathway inhibition (67) . pJAK2 inhibited re plication of the vaccinia and encephalomyocarditis virus in vitro , and protected mice from a lethal dosage of vaccinia virus in vivo, possibly through induction of increased IFN production (67) . This peptide enhances not only innate immunity, but the adaptive imm une response as well, as mice that were rechallenged with vaccinia virus all survived (67) .

PAGE 27

27 CHAPTER 2 ASSESS CYTOKINE PRODUCTION IN SOCS1 +/ MICE AND THE POTENTIAL OF A SOCS1 MIMETIC TO REDIRECT ABERRANT CYTOKINE PRODUCTION Higher P roductio n of inflammatory C yt okines IL 12 and IL 6 Found in R espo nse to Stimuli in SOCS1 +/ Mice IL 12 is an important cytokine in APC activity, and also in directing T cells t owards a Th1 bias . IL 12 is commonly produced by dendritic cells, macrophages, and B cells in response to for eign microbial invaders, and activates the JAK/STAT pathway through Tyk2 or JAK2 (68, 69) . In order to determine how a partial SOCS1 deficiency affects the ability of APCs to produce IL 12, we began by assessing c ytokine production between wildtype mice (SOCS1 +/+ ) and SOCS1 heterozygous mice (SOCS +/ ), which possess only a single SOCS1 allele. Cells were pooled from axillary, brachial, cervical, inguinal, and mesenteric lymph nodes, and were cultured for 24 and 48 hours under the following conditions: unstimulated cells, LPS at 1000ng/mL, LPS at 5000ng/mL, antiCD3 and LPS at 1000ng/mL, and antiCD3 and LPS at 5000ng/mL. The use of LPS alone and the combination of LPS and antiCD3 was used in order to gain insight into any effects which may be dependent on or augmented by APC T cell interactions. Figure 2 1A shows that supernatants taken from cell cultures of SOCS1 +/ at the 24 hour time point contained elevated levels of IL 12 compared to SOCS1 +/+ mice. IL 12 producti on was similar under LPS and antiCD3/LPS culture conditions suggesting that SOCS1 regulation of IL 12 may not be augmented by or dependent on T cell activation at this time point (Figure 2 1A). Differences in IL 12 production was however indiscriminate at 48 hours (Figure 2 1A).

PAGE 28

28 Lymph node cells from SOCS1 +/ mice at 24 hours were also found to have increased levels of IL 6 (Figure 2 1B). IL 6 is produced by a wide variety of cells including, but not limited to, macrophages, dendritic cells, mast cells, B c ells, and several types of non leukocytic cells (70) . Interaction between IL 6, the IL 6 receptor and associated protein gp130 results in activation of JAK1, JAK2, and Tyk2 (70) . Hig h levels of IL 6 production have been linked to many autoimmune disorders including RA and Inflammatory Bowel Diseases (IBD) among others (70) . Contrary to IL 12 production, IL 6 production does appear to be enhanced in a dose dependent manner with a combination treatment of both LPS and antiCD3 (Figure 2 1B). This suggests a critical importance in APC T cell interactions on IL 6 production. An increased production of IL 6 in SOCS1 +/ cells versus SOCS1 +/ + cells is conti nued into the 48 hour timepoint (Figure 2 1B). SOCS1 Mimetic, SOCS1 KIR, Ameliorates Increased Levels of I nflammat ory Cytokine Production As it appears that a deficiency in SOCS1 signaling leads to aberrant production of APC related inflammatory cytokines, we pos tulated that a SOCS1 mimetic, SOCS1 KIR, may have the ability to restore proper cytokine balance. SOCS1 KIR ( 53 DTHFRTFRSHSDYRRI 68 ) mimics the kinase inhibitory region of SOCS1, and is able to bind to the activation loop of phosphorylated JAK2 (60) . Previous studies have shown SOCS1 KIR peptides capable of aiding in increased longevity of SOCS1 / mice, and decreased disease scores and amelioration of symptoms in murine EAE models (28, 61) . To perform these assays, SOCS1 KIR was added into culture at time zero, and supernatants were assessed for IL 12 and IL 6 levels of production again at 24 and 48

PAGE 29

29 hours . F igure 2 2A indicates that SOCS1 significantly decreases the level of IL 12 being produced by the various immune cells. Although it appears to decrease IL 12 production in both set of culture conditions, the decrease seems to be augmented with the addition of antiCD3. The efficacy of SOCS1 KIR on elevated levels of IL 12 however diminishes at the 48 hour time point (Figure 2 2C). Figure 2 2 B shows that SOCS1 KIR has a significant result in aiding the decrease of proinflammatory cytokine IL 6. Similar to what we see with the changes in IL 12 production, the addition of antiCD3 appears to augment the SOCS1 KIR mediated decrease in IL 6. The activity of SOCS1 KIR appears to remain intact at the 48 hour time point in regards to reducing the excessive IL 6 producti on (Figure 2 2D). These to redirect an inflammatory environment back to a more homeostatic state. SOCS1 +/ M ice F ail to P roduce S ufficient L evels of A nti I nflammatory C ytok ine IL 10 in Response to Stimulation , which is increased through A ddition of SOCS1 KIR. We have established that when stimulated with LPS or a combination of LPS and antiCD3, APCs from SOCS1 +/ mice are unable to regulate production of several inflam matory cytokines including IL 12 and IL 6. In addition to inflammatory proteins, we also investigated the function of SOCS1 in regulating production of an anti inflammatory cytokine, IL 10. IL 10 is produced by cells of both the adaptive and innate immune systems such as B cells, macrophages, dendritic cells, NK cells, neutrophils, eosinophils, mast cells, and even T cells (71) . IL 10 is a multifunctional immune regulator capable of regulating inflammation through a variety of methods.

PAGE 30

30 Briefly using SO CS1 +/ and SOCS1 +/+ mice, pooled lymph node cells were cultured for 24 and 48 hours. Pooled cells were cultured under grading amounts of LPS in the absence or presence of antiCD3. Supernatants were collected at the above mentioned time points, and assessed for levels of IL 10 production. Cells from SOCS1 +/ mice produced lower amount s of IL 10 to their SOCS1 +/+ counterparts. As shown in Figure 2 3A, it is evident that supernatants from both SOCS1 +/ and SOCS1 +/+ cultured cells contain nominal amounts of IL 1 0 at the initial 24 hour time point. However at 48 hours, the SOCS1 +/+ mice had produced much higher levels of IL 10 than is seen in SOCS1 +/ mice (Figure 2 3A). We were also interested in determining whether the SOCS1 mimetic peptide SOCS1 KIR could posi tively modulate IL 10 in the SOCS1 +/ mice. Again we added SOCS1 KIR to cell culture at time zero, and assessed IL 10 cytokine levels at 24 and 48 hours. There were slight increases in IL 10 production at 24 hours, especially under the conditions of LPS 1000ng/mL, LPS 5000ng/mL, and antiCD3 and LPS 5000ng/mL in samples from SOCS1 +/ mice (Figure 2 3B). However more dramatic changes in IL 10 production are seen at 48 hours, when SOCS1 KIR induces an upregulation in SOCS1 +/ samples to levels that excee ded IL 10 production seen in the SOCS1 +/+ mice. (Figure 2 3B).

PAGE 31

31 Figure 2 1. Aberrant production of IL 12 and IL 6 in SOCS1 +/ mice. Supernatants were collected and assessed 24 and 48 hours after culture with graded amounts of LPS (ng/mL) in the prese nce of abs ence of antiCD3 from SOCS1 +/+ or SOCS1 +/ mice. A) IL 12 production at 24 and 48 hours. B) IL 6 production at 24 and 48 hours. IL 12 data is an average of 4 independent experiments. IL 6 data is an average of 6 independent experiments.

PAGE 32

32 Figure 2 2. SOCS1 mimetic SOCS1 KIR ameliorates elevated levels of IL 12 and IL 6 production in SOCS1 +/ mice. SOCS1 KIR peptide was added into culture at time zero, and supernatants were collected and assessed 24 and 48 hours after culture with graded a mounts of LPS (ng/mL) in the presence of abs ence of antiCD3 from SOCS1 +/+ or SOCS1 +/ mice. A) Levels of IL 12 at 24 hours. B) Levels of IL 6 at 24 hours. C) Data showing levels of IL 12 at 48 hours. D) Data showing levels o f IL 6 at 48 hours. Data is an average of 4 experiments.

PAGE 33

33 Figure 2 3. SOCS1 +/ cells are unable to sustain production of anti inflammatory IL 10; inclusion of SOCS1 KIR increases insufficient IL 10 levels. Supernatants were collected and assessed 24 and 48 hours after culture wit h LPS (ng/mL) in the presence or absence of antiCD3 from SOCS1 +/+ or SOCS1 +/ mice. A) Data showing the levels of IL 10 at 24 and 48 hours under either LPS or an antiCD3 LPS combination. B) SOCS1 KIR peptide was added into culture at time zero, and superna tants were collected and assessed for IL 10 24 and 48 hours from wildtype or SOCS1 +/ mice. N of 4.

PAGE 34

34 CHAPTER 3 INVESTIGATION OF SOCS1 DEFICIENT ANTIGEN PRESENTING CELL PHENOTYPES Regulation of CD11b E xpression by the Kinase I nhibitory R egion of SOCS1 Int egrins are an integral functioning unit of the innate immune system involved in cellular adhesion and signaling cascades which regulate survival, proliferation, and differentiation. Mac 1/CD11b CD18 is commonly expressed on macrophages, dendritic cells, an d neutrophils, and encompasses a wide variety of functions including but not limited to phagocytosis of iC3b coated molecules and assisting in leukocyte trafficking to inflammatory tissue sites (72) . We sought to determine wh ether there was a relationship between SOCS1 expression and expression of the alpha unit of Mac 1, CD11b. Cervical, axillary, brachial, inguinal, and mesenteric lymph nodes were pooled from SOCS1 +/ and SOCS1 +/+ mice, and cultured for 24 and 48 hours under graded doses of LPS in the presence or absence of antiCD3 (Figure 3 1) followed by flow analysis for CD11b expression. Samples from SOCS1 +/ mice showed a marked decrease in the frequency of cells expressing CD11b under both unstimulated and stimulated c onditions compared to levels seen in SOCS1 +/+ littermates (Figure 3 1A and 3 1B). There were not significant differences between samples cultured with LPS alone or those cultured with a LPS in the presence of antiCD3, indicating an APC specific response (F igure 3 1A and 3 1B). Results were similar for LPS concentrations of 1000ng/mL and 5000ng/mL (Figure 3 1 and data not shown). Although disparities in CD11b frequency are visible at 24 hours,

PAGE 35

35 more pronounced differences in frequencies between SOCS1 +/ mice versus controls are visible at 48 hours (Figures 3 1B). As SOCS1 expression is positively correlated to Mac 1, we next interrogated the role of the kinase inhibitory region (KIR) of SOCS1 in this process. We treated whole lymph node cells, isolated from SOCS1 +/ and SOCS1 +/+ littermates, with a peptide (SOCS1 KIR) shown to mimic the KIR region of SOCS1 (60) , followed by analysis of CD11b expression t hrough flow cytometry 24 and 48 hours later. Figure 3 1C and 3 1D show that the addition of SOCS1 KIR mediated an increase in CD11b+ cells. Interestingly, although the addition of antiCD3 did not appear to affect CD11b frequency in lymph node cells isolate d from SOCS1 +/+ mice compared to SOCS1 +/ mice, the addition of antiCD3 did increase CD11b expression in cultures receiving SOCS1 KIR treatment. Together these data suggests that the KIR region of SOCS1 contributes to the cell surface expression of CD11b. Heightened expression of MHC Class II on CD11b+ cells is unaffected by SOCS1 KIR. APCs from SOCS1 +/ mice exhibit deregulated cytokine production and surface expression of integrins compared to wildtype littermates. We next determined whether co stimulato ry proteins were also affected by the intrinsic defect in SOCS1. Using SOCS1 +/ and SOCS1 +/+ mice, cells were pooled from the cervical, axillary, brachial, inguinal, and mesenteric lymph nodes and cultured for 24 and 48 hours. Pooled cells were cultured u nder grading amounts of LPS in the absence or presence of antiCD3; samples were analyzed by flow cytometry for CD11b and MHC Class II expression.

PAGE 36

36 Although no significant differences in MHC Class II frequency were observed in whole lymph node cells isolated from SOCS1 +/ and SOCS1 +/+ littermates, CD11b+ lymph node cells from SOCS1 +/ mice possessed significantly higher levels of MHC Class II expression (Figure 3 2A and 3 2B). The enhanced frequency of CD11b+ MHC Class II+ cells occurred similarly through LPS stimulation in the presence or absence of antiCD3, and was maximally observed at 48 hours (Figure 3 2A and 3 2B). Notably the addition of SOCS1 KIR had no apparent effect on MHC Class II at 24 (Figure 3 2C) or 48 hours (Figure 3 2D). The KIR region of SO CS1 limits CD40 expression. Whole lymph node cells isolated from SOCS1 +/ mice expressed a modest, but consistently higher level of CD40 subsequent to stimulation with LPS in the presence or absence of antiCD3 (Figure 3 3A). The increased CD40 expression, in comparison to SOCS1 +/+ counterparts was maximally observed at 48 hours (Figure 3 3B). LPS mediated CD40 upregulation is enhanced with the addition of antiCD3 (Figure 3 3A and 3 3B), which is consistent with previous reports showing an amplification loo p mediated by CD40 CD40L interactions (Figure 3 3A and 3 3B). Significantly, treatment with SOCS1 KIR reduced expression of CD40 in both SOCS1 +/ and SOCS1 +/+ lymph node cells (Figure 3 3C). Together these data suggest a critical role of the kinase inhibit ory region of SOCS1 in the regulation of the co stimulatory molecule CD40.

PAGE 37

37 Figure 3 1. The kinase inhibitory region of SOCS1 regulates CD11b expression. Samples from SOCS1 +/ or SOCS1 +/+ mice were cultured for 24 and 48 hours with LPS (ng/mL) in the absence or presence of antiCD3. Samples were analyzed through flow cytometry for CD11b expression. A) Differences in CD11b expression cultured with only LPS (ng/mL) for 24 and 48 hours. B) Differences in CD11b expression from samples cultured with LPS (ng/ mL) and antiCD3 for 24 and 48 hours. C) The effect of adding SOCS1 KIR to cells cultured with LPS or LPS and antiCD3 for 24 hours. D) The effect of SOCS1 KIR on cells cultured with LPS or LPS and antiCD3 at 48 hours. N of 4 .

PAGE 38

38 Figure 3 2. SOCS1 +/ mice express elevated frequencies of CD11b+ MHC Class II+ cells, which is not mediated by SOCS1 KIR. Lymph node samples from SOCS1 +/ (HT) or SOCS1 +/+ (WT) mice from were cultured for 24 and 48 hours with LPS (ng/mL) in the pres ence or absence of antiCD3. Samples were analyzed for CD11b and MHC Class II through flow cytometry. A) Data shows frequency of CD11b+ MHC Class II+ cells at 24 hours. B) Data shows the frequency of CD11b+ MHC Class II+ cells at 48 hours. For C) and D) SOC S1 KIR was added into culture at time zero. C) CD11b+ MHC Class II+ cell frequencies at 24 hours. D) CD11b+ MHC Class II+ cell frequen cies at 48 hours. An average of 4 independent experiments.

PAGE 39

39 Figure 3 3. SOCS1 regulates expression of co stimulator y protein CD40. Samples from SOCS1 +/ (HT) and SOCS1 +/+ (WT) mice were cultured for 24 and 48 hours with LPS (ng/mL) in the presence or absence antiCD3. Samples were analyzed through flow cytometry for expression of CD40. A) Flow cytometry dot plots of FSC vs CD40. Frequency of CD40+ cells at 24 hours. B) Frequency of CD40+ cells at 48 hours. C) Data shows effect of SOCS1 KIR on the frequency of CD40+ cells at 48 hours. N of 5 .

PAGE 40

40 CHAPTER 4 EVALUATI NG THE T HERAPEUTIC PO TENTIAL OF CELL PENETRATING PEPTIDES THAT M ODULATE SOCS1 S IGNALING: TISSUE AND C ELLULAR L OCALIZATION OF C ELL PENETRATING SOCS M IMETIC AND ANTAGONIST PEPTIDES As data surrounding SOCS1 signal regulating peptides suggest a potential future therapeutic use of these peptides for regulation of autoimmune or antiviral responses, we wanted assess the tissue and cellular localization of I.P . (Intraperitoneal) injected, cell penetrating peptides, SOCS1 KIR and pJAK2. SOCS1 KIR and pJAK2 peptides were labeled with an Alexa 647 fluorochrome, and injected into CD57BL/6 mice. Control mice received injections of unconjugated Alexa 647 fluorochrome, or no injections at all. Two hours after injections the mice were sacrificed , and spleen, lymph nodes, heart, brain, liver, p eritoneal cells, lungs, and kidneys were removed. Detection of the fluorescently labeled peptides was first accomplished by using the Xenogen IVIS fluorescent imager to capture whole organ images of the brain, liver, spleen, heart, lungs, and kidneys, foll owed by infrastructural analysis of sectioned tissue. Lymph node and spleen isolates were converted to single cell suspensions followed by cellular analysis through flow cytometry , as were the peritoneal cells. Through an IVIS fluorescent imager, it can b e readily seen that SOCS1 KIR and pJAK2 peptides localized into the brain, kidneys, liver, and spleen (Figure 4 1 and 4 2). Figure 4 1A shows localization of SOCS1 KIR and pJAK2 into the entire brain through IVIS fluorescent imaging. Tissue analysis of the brain, using an Olympus Spinning Confocal microscope, shows that SOCS1 KIR localized into general nervous tissue, while we also observed pJAK2 able to localize into neurons. Although SOCS1 KIR and pJAK2 both localized to the kidney, as can be clearly seen in Figure 4 1B, the intensity of pJAK2 within the kidney was much higher.

PAGE 41

41 Infrastructure analysis through tissue sections shows that SOCS1 KIR and pJAK2 internalized into the kidney tubules (Figure 4 1B). Similar to that observed from whole organ imaging of the kidneys, pJAK2 was visualized at a higher intensity within the liver than SOCS1 KIR (Figure 4 1C). Whereas SOCS1 KIR was present within the liver sinuses, it appears that pJAK2 internalized into the hepatocytes during the two hour time period (Figur e 4 1C). Additionally pJAK2 was selectively present in the thymus and heart as well (data not shown). Peptide labeling specificity was confirmed through significantly diminished fluorescence in the tissue samples isolated from C57BL/6 mice receiving the un conjugated Alexa 647 peptide injections (Figure 4). As most of the current research using mimetic peptides has focused on immunological processes, we also interrogated immune tissues and cells for the presence of the cell penetrating peptides. As can be s een from Figure 4 2A, signal from SOCS1 KIR and pJAK2 peptides, but not controls, are clearly evident in the spleen. Figure 4 2B shows the results from the flow cytometry analysis of splenic cells. Both SOCS1 and pJAK2 were able to localize with specific i mmune cells including CD4+ T cells, CD8+ T cells, B220+ B cells, and CD11b+ macrophages. In Figure 4 2C the peptides are seen to localize with immune cells in pooled lymph nodes which included axillary, brachial, cervical, and inguinal lymph nodes. Again e ach peptide was able to localize with specific immune cells, albeit pJAK2 to a slightly increased instance (Figure 4 2C). It is interesting to note that in both lymph nodal and splenic cells, the antigen presenting cell types took up the peptides much more readily than did either T cell phenotype (Figure 4 2B and 4 2C). We also observed similar results in the mesenteric lymph nodes as we did in the pooled lymph node samples (data not shown).

PAGE 42

42 Samples from the peritoneal cell population were also analyzed usi ng flow cytometry (Figure 4 2D). It is evident that both the peptides localized with each immune cell type much more strongly than in either the splenic or lymph nodal cell populations (Figure 4 2D). This is likely because the peritoneal cavity was the loc ation of the initial injection.

PAGE 43

43 Figure 4 1 . Localization of cell penetrating peptides SOCS1 KIR and pJAK2. Peptides were injected into CD57BL/6 mice, and mice were sacrificed after two hours. Controls included injections of unconjugated fluorochrome (FC Control) and mice which received no injections at all. A) Whole organ imaging using a Xenogen IVIS fluorescence imager and tissue sections viewed with an Olympus Spinning Confocal microscope of murine brains. B) Whole organ imaging and tissue sections of murine kidneys. C) Whole organ imaging and tissue sections of murine livers. Data representative of 2 mice in each group, and 2 independent experiments.

PAGE 44

44 Figure 4 2. Localization of SOCS1 KIR and pJAK2 peptides to immune tissues. Peptides were inject ed into CD57BL/6 mice, and mice were sacrificed after two hours. Controls included injections of unconjugated fluorochrome (FC Control) and mice which received no injections at all. A) Whole organ imaging using a Xenogen IVIS fluorescence imager and tissue sections viewed with an Olympus Spinning Confocal microscope of murine spleens. B) Histogram overlay of flow cytometric analysis of spleen samples. C) Flow cytometric analysis of pooled lymph node cells. D) Flow analysis of peritoneal cells. Data represen tative of 2 mice in each group, and 2 independent experiments.

PAGE 45

45 CHAPTER 5 DISCUSSION The immune system is a complex network of positive and negative feedback mechanisms which work in concert to prevent infections while simultaneously restricting the dev elopment of autoimmunity. There are a wide array of proteins and pathways which work in concert to orchestrate these events. The role of SOCS1 has been well studied in these events, and known to be crucial as SOCS1 / mice die within three weeks from letha l inflammation, and SOCS1 +/ mice develop a lupus like phenotype (27, 28) . In this project we began to examine the relationship between SOCS1 and the function and phenotype of antigen presenting cells. Our data sho ws that antigen presenting cells from SOCS1 +/ mice produce excessive levels of the inflammatory cytokines IL 12 and IL 6 in response to LPS compared to SOCS1 +/+ mice ( Figure 2 1). We next examined the capacity of cells from SOCS1 +/ mice to produce the an ti inflammatory cytokine IL 10. SOCS1 +/ mice appeared however incapable of producing comparable amounts of IL 10 to those levels seen in SOCS1 +/+ mice (Figure 2 3). This is important as IL 10 has been shown to mediate the inflammatory response through a v ariety of mechanisms, such as through the inhibition of IL 12 (73, 74) . In a murine model of collagen induced arthritis (CIA), mice that produced higher levels of IL 10, induced higher expressions of SOCS1, resulti ng in reduced disease severity (56) . SOCS / Rag2 / mice develop a severe form of colitis which is ameliorated by the transfer of IL 10+ Tregs, and of note SOC1 / mice are deficient in peripheral Tregs (28, 36) . These studies further highlight the important relationship and crosstalk which exists between the different inflammatory mediators of the immune system such as SOCS1,

PAGE 46

46 IL 10, and Tregs. Our results suggest that immune cells from SOCS1 +/ mice are unab le to maintain a balanced relationship between SOCS1 and anti inflammatory mediators, especially IL 10. Previous studies characterizing the loss of SOCS1 and the resulting massive cellular infiltration of cells which included macrophages, T cells, eosino phils, etc. was attributed to excessive IFN signaling (27, 28) . While this may hold true, an interesting study by Stevenson et al. in 2010 exhibited a novel role for SOCS1 and SOCS3 in regulating cell adhesion and migration (75) . By stabilizing the expression of Focal Adhesion Kinase (FAK), SOCS1 and SOCS3 increased RhoA activation, which in turn increased the instance of cell adhesion and decreased cellular migration towards attractant chemokines (75) . I ntegrins are a crucial aspect of the innate immune response, as individuals with Leukocyte Adhesion Deficiency (LAD) have low or absent integrin expression and struggle to clear bacterial infections because of impaired cell recruitment abilities (76, 77) . There have been 24 different i ntegrins characterized to date, with Mac 1/CD11b CD18/Cr3 (Complement receptor 3 ) as a part of the 2 integrin family. Mac 1 was described as having the capacity to restrict TLR signaling, and by restricting the macrophage inflammatory response through generation of SOCS3 and IL 10 production (78) . Others have reported that 2 integrin deficient (Itgb2 / ) mice have a hyperactive response to TLR ligation, with Itfb2 / DCs and macrophages producing higher levels IL 12 and IL 6, concluding that 2 integrins are able to regulate TLR signaling through inhibition of the NFK path way (79) . Additional studies have noted that lupus progression is aggravated and worsened in Mac1 / mice (80) . An arginine to h istidine

PAGE 47

47 substitution in an ITGAM (which codes for CD11b) variant results in a reduced ability to regulate cell trafficking and adhesion to ligands which include ICAM 1 and iC3b (81, 82) ; reduced ability to recogni ze iC3b also results in reduced phagocytic activity (83) . Genetic variations in ITGAM also result in the failure of Mac 1 to regulate proinflammatory cytokine production, including IL 6 production, in macrophages (81, 82) . It has been suggested that a genetic variation in ITGAM which reduces phagocytosis, thereby disallows antigen presenting cel ls to effectively clear apoptotic material or immune complexes, and could be a major contributing factor to SLE development (83) . The se data taken together support integrins as acting as mediators for cellular adhesion and migration, so we sought to determine whether there existed a relationship between SOCS1 and integrin expression. We exposed that SOCS1 +/ mice have a decreased abilit y to upregulate the alpha unit of Mac 1. CD11b was found in decreased frequencies not only in response to LPS, but also in the resting state of unstimulated cells ( Figu re 3 1). Taken together, these data suggests a unique role for SOCS1 in regulating inflammation . SOCS1 +/ mice upon further examination were also found to have increased frequency of CD11b+ leukocytes which express high levels of MHC Class II (Figure 3 2). Reports on the relationship between SOCS1 and MHC Class II are varied; it was reported that t hat embryonic fibroblasts from SOCS / mice are inefficient at upregulating MHC Class II expression in response to IFN , however additional studies described SOCS1 as negatively regulating MHC Class II expression (8 4, 85) . Previous studies have shown that SOCS1 has the capacity to downregulate MHC Class II expression, however as our data suggests the KIR of SOCS1 may not be suff icient enough to do so

PAGE 48

48 (Figure 3 2 ). Downregulation of MHC Class II may require the addit ion of either the SH2 domain or SOCS box or all three domains. These differences may be due to a variety of factors including the use of different cell lines, however our data using primary cells supports the negative role that SOCS1 plays in regulating MHC Class II. We also found SOCS1 +/ mice to possess a higher frequency of CD40+ cells (Figure 3 3), a co stimulatory protein important in mediating APC T cell interactions (86) . CD40 signaling is important in humoral as well as cellular immunity, as we now know that patients with X li nked hyper immunoglobulin M syndrome have mutations in the CD40L gene (87) , and CD40 CD40L generates a protective Th1 response and macrophage activation in Leishmania major infections (88) . However CD40 CD40L pathogenic features are also found in many autoimmune disorders including diabetes, graft rejection, atherosclerosis, cancer, and the murine models of EAE, CIA, uveitis, and IBD (89) . Previous literature supports the inhibitory effect of SOCS1 on CD40 that we have observed in the SOCS1 +/ mice (90, 91) . In summary our data indicates that a deficiency in SOCS1 results in deregulated cytokine production, insufficient CD11b upregulation, and enhanced frequencies of MHC Class II + and CD40+ cells. Because these defects were due to a partial lack of SOCS1, we next inquired whether a SOCS1 mimetic peptide, SOCS1 KIR was able to amend these defects. Our results suggest that SOCS1 KIR was capable of reducing elevated IL 12 and IL 6 production, while increasing IL 10 production. Addition of SOCS1 KIR also upregulated the integrin CD11b, and reduced the increase d frequency of CD40+ cells in the SOCS1 +/ mice. However the mimetic peptide was incapable of reducing the elevated frequency of CD11b+ MHC Class II+ cells. This implies that the

PAGE 49

49 kinase inhibitory re gion may not be sufficient enough, more of or the entire SOCS1 protein may be required to regulate MHC Class II expression. These data taken together suggests that SOCS1 KIR effectively redirects an excessive immune response back to a more homeostatic stat e. This and previous studies supporting the anti inflammatory capabilities of SOCS1 KIR activity suggests that targeting SOCS1 may pose a potential target for therapeutic developments (28, 60, 61) . As is such we have begun to assess the translational potential of SOCS1 KIR. We were also interested in evaluating the translational potential for another peptide, pJAK2. pJAK2 acts as an antagonist to SOCS1, thereby allowing continued activation of the JAK/STAT pathway , and increased production of inflammatory cytokines; pJAK2 has been shown to have potent antiviral capabilities (67) . To begin assessing the translational potential for these peptides, the peptides were fluorescently tagged with an Alexa 647 fluorochrome, and inj ected into C57BL/6 m ice. We evaluated th e tissues and cells which these peptides were capable of interacting with. Both peptides were found to localize in organs including the brain, kidneys, liver, lymph nodes, and spleen. These peptides were able to inte ract with CD4+ T cells, CD8+ T cells, B220+ B cells, and CD11b+ macrophages. Of note both peptides localized with antigen presenting cells more readily than T cells, and much more readily with cells localized to the injection sites. SOCS1 continues to pro vide different insights into the mechanisms of immune regulation. Recent studies have begun to implicate an association between the role of microRNAs and SOCS1 in disease. miR 221 and miR 155 were seen to regulate human dendritic cell development, IL 12 pr oduction, and apoptosis through the targeting

PAGE 50

50 of SOCS1 (92) . Mice with dendritic cell specific deletions of BLIMP1 ex hibit a lupus like phenotype, and it was seen that let 7c inhibited BLIMP1 and SOCS1 expression leading to a proinflammatory environment (93) . Zhou and colleagues also described that upregulation of miR 150 leads to reduced SOCS1 expression, and patients with high levels of miR 150 also received a high chronicity score for lupus nephritis (94) . miR 155 targets and inhibits SOCS1, and patients with rheumatoid arthritis have increased expression of miR 155 (95) . Lastly Davis et al. exposed that methylprednisolone induces an inhibition of miR 155 expression, which increased the expression of SOCS1 (96) . Our studies have focused on revealing novel mechanisms behind the role that SOCS1 plays in regulating the phenotype and functions of antigen presenting cells. With continued insight into the importance of SOCS1 in immune regulation, additional information can be gained int o the role that SOCS1 plays in disease onset and progression. With future translational studies, we can continue to work towards developing therapeutics which target SOCS1 expression, and better regulate disease progression.

PAGE 51

51 C HAPTER 6 MATERIALS AND MET HODS Mice. SOCS1 +/ and SOCS1 +/+ mice were generated as previously described in Collins et al. 2011 (28) . Briefly, SOCS1 +/ mic e, on a C56BL/6 genetic background, were purchased from the St. Jude animal facility (Memphis, TN). SOCS1 +/ mice were mated, generating SOCS +/+ , SOCS1 +/ , an d SOCS1 / mice. SOCS1 +/ and SOCS +/+ litter mate control s were chosen for experiments. Mice were mated and maintained in sterile microisolators, under specific pathogen free conditions at the University of Florida Cancer and Genetics Animal Care Facility. Genotyping. Mouse genotyping was performed similar to Collins et al . 2011 (28) . In brief, tail clips (1mm in length) were isolated from SOCS1 +/+ or SOCS1 +/ mice prior to weaning. The DNAeasy Blood and Tissue Kit (Quiagen, V alecia, CA) was used to extract DNA from degraded tails and quantitative PCR (qPCR) was then performed to assess the presence of SOCS1. iQ TM SYBR Green Supermix (BioRad, Hercules, CA) GACACTCACTTCCGCACCTT erse: GAAGCAGTTCCGTTGGCGACT CCACAGCACTGTAGGGTTTA (200 nM) were used to amplify and quantify relative amounts of DNA on a PTC 200 Peltier Thermal Cycler with a CHROMO 4 Continuous Flu orescence Detector (BioRad, Hercules, CA). Mouse phenotype was determined by relative expression of SOCS1. Peptide Synthesis . The peptides SOCS1 KIR ( 53 DTHFRTFRSHSDYRRI 68 ) and pJAK2 ( 1001 LPQDKEYYKVKEP ) were synthesized using conventional

PAGE 52

52 fluorenylmethylcarbonyl chemistry, as previ ously described (97) using an Applied Biosystems 431A automated peptide synthesizer (Applied Bio systems, Carlsbad, CA). For cell penetration, us ing a semiautomated prot ocol (98) , a lipophilic group (palmitoyl lysine) was added to the amino terminus as a final step. The peptide was characterized using mass spectrometry and purified by HPLC. Once synthesized, SOCS1 KIR peptide was re suspended in DMSO (Sigma Aldrich, St. Louis, MO) and used for in vitro cell culture experiments. In vitro cell culture . Cells were pooled from axillary, brachial, cervical, inguinal, and mesenteric lymph nodes, and cultured in triplicates (2x10^5/well ) at 37 degrees Celsius in RPMI 164 (Cellgro 10 040 CV) containing 10% FBS ( InvitrogenTM Gibco®) , 1% antibiotic/antimycotic (Herndon, VA), and ME (MP Biomedicals, Solon, OH). Cells were stimulated with bound anti CD3 mAb (BD Pharmingen; clone:145 2C11) , and/or LPS (Sigma Aldrich, St. Louis, MO) at a concentration of either 1000 ng/mL or 5000 ng/mL. For a ssays which included SOCS1 KIR mimetic peptide, KIR peptide was added in culture at time zero in conjunction with LPS. Cells were incubated for 24 and 48 hours, then collected and assessed for antigen presenting cell related markers. Flow Cytometry . To assess antigen presenting cell populations, samples from in vitro cell cultures taken at 24 and 48 hours were stained with mono clonal antibodies including anti CD3 (500 A2 BD Pharm ingen, San Diego, CA ) anti CD11b (M1/70; eBioscience), anti MHC class II ( M5/114.15.2 ; eBioscience), and anti CD40 (3/23; BD Pharmingen). After staining , a total of 50,000 live events were collected on a n LSRII (BD Pharmingen) and analyzed using FlowJo software (Tree Star, San Carlos, CA).

PAGE 53

53 ELISA Assays . In vitro cell culture supernatants were obtained as described in Bedoya et al. in 2013 and Lau et al. in 2011 at 24 and 48 hours and evaluated in duplicates for IL 12p 70, IL 6, and IL 10 levels using OptiELISA kits (BD Pharmingen) (99, 100) . SOCS1 Mimetic Peptide Injections . Peptides were labeled with Alexa 647 as a rogen, Grand Island, NY Cat. A 20173 ). C57BL/6 mice were injected I.P. with 100 µ L of SOCS1 mimetic (SOCS1 KIR), SOCS1 antagonist (pJAK2), or 50 µ L of fluorochrome controls (FC) which contained only Alexa 647 fluorochrome; a third set of c ontrols received no injections. Two hours after injections occurred, mice were sacrificed via C0 2 asphyxiation and subsequent cervical dislocation. Whole organs were ultimately preserved in 20% sucrose in PBS, and imaged using a Xenogen IVIS Fluorescence I mager. Organs were then cryoembedded for sectioning, and viewed using an Olympus DSU IX81 Spinning Disc Microscope. Single cell suspensions were obtained from pooled lymph nodes (brachial, axillary, cervical, and inguinal), mesenteric lymph nodes, peritone al cells, and the spleen, and were stained with anti CD4 ( RM4 5; BD PharMingen, San Diego, CA ), anti CD8a ( 53 6.7; BD PharMingen ), anti CD11b (M1/70, eBioscience ), and anti B220 ( RA3 6B2; BD Pharmingen). After staining , a total of 50,000 live events were c ollected on an LSRII (BD Pharmingen) and analyzed using FlowJo software (Tree Star, San Carlos, CA). Statistical analysis. Graph Pad Prism® software was used to calculate students t test with a red significant and is indicated within the figures.

PAGE 54

54 T able 6 1. Primers used and/or discussed in this study. P rimer Sequence Temperature (°C) mus Actin F: 5' CCTTCCTTCTTGGGTATGCA 55 R: 5' GGAGGAGCAATGATCTTG AT 3' 55 mus SOCS1 F: 5' GACACTCACTTCCGCACCTT R: 5' GAAGCAGTTCCGTTGGCGACT Table 6 2 Peptide s used and/or discussed in this study. Peptide name Sequence SOCS1 KIR 53 DTHFRTFRSHSDYRR I 68 pJAK2 1001 LPQDKEYYKVKEP

PAGE 55

55 LIST OF REFERENCES 1 . O'Shea, J. J., and R. Plenge. 2012. JAK and STAT signaling molecules in immunoregulation and immune mediated disease. Immunity 36: 542 550. 2. Trengove, M. C., and A. C. Ward. 2013. SOCS proteins in development and disease. Am J Clin Exp I mmunol 2: 1 29. 3. Alexander, W. S., and D. J. Hilton. 2004. The role of suppressors of cytokine signaling (SOCS) proteins in regulation of the immune response. Annu Rev Immunol 22: 503 529. 4. Liang, Y., W. D. Xu, H. Peng, H. F. Pan, and D. Q. Ye. 2014. S OCS signaling in autoimmune diseases: molecular mechanisms and therapeutic implications. Eur J Immunol 44: 1265 1275. 5. Babon, J. J., S. Yao, D. P. DeSouza, C. F. Harrison, L. J. Fabri, E. Liepinsh, S. D. Scrofani, M. Baca, and R. S. Norton. 2005. Seconda ry structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain. FEBS J 272: 6120 6130. 6. Bullock, A. N., J. E. Debreczeni, A. M. Edwards, M. Sundström, and S. Knapp. 2006. Crystal str ucture of the SOCS2 elongin C elongin B complex defines a prototypical SOCS box ubiquitin ligase. Proc Natl Acad Sci U S A 103: 7637 7642. 7. Bergamin, E., J. Wu, and S. R. Hubbard. 2006. Structural basis for phosphotyrosine recognition by suppressor of cy tokine signaling 3. Structure 14: 1285 1292. 8. Babon, J. J., N. J. Kershaw, J. M. Murphy, L. N. Varghese, A. Laktyushin, S. N. Young, I. S. Lucet, R. S. Norton, and N. A. Nicola. 2012. Suppression of cytokine signaling by SOCS3: characterization of the mo de of inhibition and the basis of its specificity. Immunity 36: 239 250. 9. Yang, X. O., H. Zhang, B. S. Kim, X. Niu, J. Peng, Y. Chen, R. Kerketta, Y. H. Lee, S. H. Chang, D. B. Corry, D. Wang, S. S. Watowich, and C. Dong. 2013. The signaling suppressor C IS controls proallergic T cell development and allergic airway inflammation. Nat Immunol 14: 732 740. 10. Madonna, S., C. Scarponi, S. Pallotta, A. Cavani, and C. Albanesi. 2012. Anti apoptotic effects of suppressor of cytokine signaling 3 and 1 in psorias is. Cell Death Dis 3: e334. 11. Park, S. H., K. E. Kim, H. Y. Hwang, and T. Y. Kim. 2003. Regulatory effect of SOCS on NF kappaB activity in murine monocytes/macrophages. DNA Cell Biol 22: 131 139.

PAGE 56

56 12. Kubo, M., T. Hanada, and A. Yoshimura. 2003. Suppresso rs of cytokine signaling and immunity. Nat Immunol 4: 1169 1176. 13. Sporri, B., P. E. Kovanen, A. Sasaki, A. Yoshimura, and W. J. Leonard. 2001. JAB/SOCS1/SSI 1 is an interleukin 2 induced inhibitor of IL 2 signaling. Blood 97: 221 226. 14. Naka, T., M. N arazaki, M. Hirata, T. Matsumoto, S. Minamoto, A. Aono, N. Nishimoto, T. Kajita, T. Taga, K. Yoshizaki, S. Akira, and T. Kishimoto. 1997. Structure and function of a new STAT induced STAT inhibitor. Nature 387: 924 929. 15. Losman, J. A., X. P. Chen, D. Hi lton, and P. Rothman. 1999. Cutting edge: SOCS 1 is a potent inhibitor of IL 4 signal transduction. J Immunol 162: 3770 3774. 16. Endo, T. A., M. Masuhara, M. Yokouchi, R. Suzuki, H. Sakamoto, K. Mitsui, A. Matsumoto, S. Tanimura, M. Ohtsubo, H. Misawa, T. Miyazaki, N. Leonor, T. Taniguchi, T. Fujita, Y. Kanakura, S. Komiya, and A. Yoshimura. 1997. A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387: 921 924. 17. Hebenstreit, D., P. Luft, A. Schmiedlechner, G. Regl, A. M. Frischauf, F. Aberger, A. Duschl, and J. Horejs Hoeck. 2003. IL 4 and IL 13 induce SOCS 1 gene expression in A549 cells by three functional STAT6 binding motifs located upstream of the transcription initiation site. J Immunol 171: 5901 5907. 18. Crespo, A., M. B. Fi lla, S. W. Russell, and W. J. Murphy. 2000. Indirect induction of suppressor of cytokine signalling 1 in macrophages stimulated with bacterial lipopolysaccharide: partial role of autocrine/paracrine interferon alpha/beta. Biochem J 349: 99 104. 19. Wang, Q ., Y. Miyakawa, N. Fox, and K. Kaushansky. 2000. Interferon alpha directly represses megakaryopoiesis by inhibiting thrombopoietin induced signaling through induction of SOCS 1. Blood 96: 2093 2099. 20. Starr, R., T. A. Willson, E. M. Viney, L. J. Murray, J. R. Rayner, B. J. Jenkins, T. J. Gonda, W. S. Alexander, D. Metcalf, N. A. Nicola, and D. J. Hilton. 1997. A family of cytokine inducible inhibitors of signalling. Nature 387: 917 921. 21. Adams, T. E., J. A. Hansen, R. Starr, N. A. Nicola, D. J. Hilton, and N. Billestrup. 1998. Growth hormone preferentially induces the rapid, transient expression of SOCS 3, a novel inhibitor of cytokine receptor signaling. J Biol Chem 273: 1285 1287. 22. Morita, Y., T. Naka, Y. Kawazoe, M. Fujimoto, M. Narazaki, R. Nakag awa, H. Fukuyama, S. Nagata, and T. Kishimoto. 2000. Signals transducers and activators of transcription (STAT) induced STAT inhibitor 1 (SSI 1)/suppressor of

PAGE 57

57 cytokine signaling 1 (SOCS 1) suppresses tumor necrosis factor alpha induced cell death in fibrob lasts. Proc Natl Acad Sci U S A 97: 5405 5410. 23. Kinjyo, I., T. Hanada, K. Inagaki Ohara, H. Mori, D. Aki, M. Ohishi, H. Yoshida, M. Kubo, and A. Yoshimura. 2002. SOCS1/JAB is a negative regulator of LPS induced macrophage activation. Immunity 17: 583 59 1. 24. Nakagawa, R., T. Naka, H. Tsutsui, M. Fujimoto, A. Kimura, T. Abe, E. Seki, S. Sato, O. Takeuchi, K. Takeda, S. Akira, K. Yamanishi, I. Kawase, K. Nakanishi, and T. Kishimoto. 2002. SOCS 1 participates in negative regulation of LPS responses. Immuni ty 17: 677 687. 25. Dalpke, A. H., S. Opper, S. Zimmermann, and K. Heeg. 2001. Suppressors of cytokine signaling (SOCS) 1 and SOCS 3 are induced by CpG DNA and modulate cytokine responses in APCs. J Immunol 166: 7082 7089. 26. Lu, L. F., T. H. Thai, D. P. Calado, A. Chaudhry, M. Kubo, K. Tanaka, G. B. Loeb, H. Lee, A. Yoshimura, K. Rajewsky, and A. Y. Rudensky. 2009. Foxp3 dependent microRNA155 confers competitive fitness to regulatory T cells by targeting SOCS1 protein. Immunity 30: 80 91. 27. Marine, J. C ., D. J. Topham, C. McKay, D. Wang, E. Parganas, D. Stravopodis, A. Yoshimura, and J. N. Ihle. 1999. SOCS1 deficiency causes a lymphocyte dependent perinatal lethality. Cell 98: 609 616. 28. Collins, E. L., L. D. Jager, R. Dabelic, P. Benitez, K. Holdstein , K. Lau, M. I. Haider, H. M. Johnson, and J. Larkin. 2011. Inhibition of SOCS1 / lethal autoinflammatory disease correlated to enhanced peripheral Foxp3+ regulatory T cell homeostasis. J Immunol 187: 2666 2676. 29. Starr, R., D. Metcalf, A. G. Elefanty, M. Brysha, T. A. Willson, N. A. Nicola, D. J. Hilton, and W. S. Alexander. 1998. Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling 1. Proc Natl Acad Sci U S A 95: 14395 14399. 30. Larkin, J., C. M. Ahmed, T. D. W ilson, and H. M. Johnson. 2013. Regulation of interferon gamma signaling by suppressors of cytokine signaling and regulatory T cells. Front Immunol 4: 469. 31. Whyte, C. S., E. T. Bishop, D. Rückerl, S. Gaspar Pereira, R. N. Barker, J. E. Allen, A. J. Rees , and H. M. Wilson. 2011. Suppressor of cytokine signaling (SOCS)1 is a key determinant of differential macrophage activation and function. J Leukoc Biol 90: 845 854. 32. Hashimoto, M., T. Ayada, I. Kinjyo, K. Hiwatashi, H. Yoshida, Y. Okada, T. Kobayashi, and A. Yoshimura. 2009. Silencing of SOCS1 in macrophages suppresses tumor development by enhancing antitumor inflammation. Cancer Sci 100: 730 736.

PAGE 58

58 33. Mansell, A., R. Smith, S. L. Doyle, P. Gray, J. E. Fenner, P. J. Crack, S. E. Nicholson, D. J. Hilton, L. A. O'Neill, and P. J. Hertzog. 2006. Suppressor of cytokine signaling 1 negatively regulates Toll like receptor signaling by mediating Mal degradation. Nat Immunol 7: 148 155. 34. Zhang, Y., Y. Lu, L. Ma, X. Cao, J. Xiao, J. Chen, S. Jiao, Y. Gao, C. L iu, Z. Duan, D. Li, Y. He, B. Wei, and H. Wang. 2014. Activation of vascular endothelial growth factor receptor 3 in macrophages restrains TLR4 NF protects against endotoxin shock. Immunity 40: 501 514. 35. Zhang, Y., C. J. Ma, L. Ni, C. L . Zhang, X. Y. Wu, U. Kumaraguru, C. F. Li, J. P. Moorman, and Z. Q. Yao. 2011. Cross talk between programmed death 1 and suppressor of cytokine signaling 1 in inhibition of IL 12 production by monocytes/macrophages in hepatitis C virus infection. J Immuno l 186: 3093 3103. 36. Chinen, T., K. Komai, G. Muto, R. Morita, N. Inoue, H. Yoshida, T. Sekiya, R. Yoshida, K. Nakamura, R. Takayanagi, and A. Yoshimura. 2011. Prostaglandin E2 and SOCS1 have a role in intestinal immune tolerance. Nat Commun 2: 190. 37. T akahashi, R., S. Nishimoto, G. Muto, T. Sekiya, T. Tamiya, A. Kimura, R. Morita, M. Asakawa, T. Chinen, and A. Yoshimura. 2011. SOCS1 is essential for regulatory T cell functions by preventing loss of Foxp3 expression as well as IFN {gamma} and IL 17A prod uction. J Exp Med 208: 2055 2067. 38. Flowers, L. O., P. S. Subramaniam, and H. M. Johnson. 2005. A SOCS 1 peptide mimetic inhibits both constitutive and IL 6 induced activation of STAT3 in prostate cancer cells. Oncogene 24: 2114 2120. 39. Chim, C. S., A. S. Wong, and Y. L. Kwong. 2004. Epigenetic dysregulation of the Jak/STAT pathway by frequent aberrant methylation of SHP1 but not SOCS1 in acute leukaemias. Ann Hematol 83: 527 532. 40. Chim, C. S., T. K. Fung, W. C. Cheung, R. Liang, and Y. L. Kwong. 200 4. SOCS1 and SHP1 hypermethylation in multiple myeloma: implications for epigenetic activation of the Jak/STAT pathway. Blood 103: 4630 4635. 41. Evel Kabler, K., X. T. Song, M. Aldrich, X. F. Huang, and S. Y. Chen. 2006. SOCS1 restricts dendritic cells' a bility to break self tolerance and induce antitumor immunity by regulating IL 12 production and signaling. J Clin Invest 116: 90 100. 42. Sharabi, A., Z. M. Sthoeger, K. Mahlab, S. Lapter, H. Zinger, and E. Mozes. 2009. A tolerogenic peptide that induces s uppressor of cytokine signaling (SOCS) 1 restores the aberrant control of IFN gamma signaling in lupus affected (NZB x NZW)F1 mice. Clin Immunol 133: 61 68.

PAGE 59

59 43. Tsao, J. T., C. C. Kuo, and S. C. Lin. 2008. The analysis of CIS, SOCS1, SOSC2 and SOCS3 transc ript levels in peripheral blood mononuclear cells of systemic lupus erythematosus and rheumatoid arthritis patients. Clin Exp Med 8: 179 185. 44. Komatsuda, A., H. Wakui, K. Iwamoto, and K. Sawada. 2009. Up regulated expression of suppressor of cytokine si gnalling (SOCS) proteins mRNAs in peripheral blood mononuclear cells from patients with systemic lupus erythematosus. Clin Exp Rheumatol 27: 1060. 45. Fujimoto, M., H. Tsutsui, O. Xinshou, M. Tokumoto, D. Watanabe, Y. Shima, T. Yoshimoto, H. Hirakata, I. K awase, K. Nakanishi, T. Kishimoto, and T. Naka. 2004. Inadequate induction of suppressor of cytokine signaling 1 causes systemic autoimmune diseases. Int Immunol 16: 303 314. 46. Ramírez Vélez, G., F. Medina, L. Ramírez Montaño, A. Zarazúa Lozada, R. Herná ndez, L. Llorente, and J. Moreno. 2012. Constitutive phosphorylation of interferon receptor A associated signaling proteins in systemic lupus erythematosus. PLoS One 7: e41414. 47. Dai, R., Y. Zhang, D. Khan, B. Heid, D. Caudell, O. Crasta, and S. A. Ahmed . 2010. Identification of a common lupus disease associated microRNA expression pattern in three different murine models of lupus. PLoS One 5: e14302. 48. Sachithanandan, N., K. L. Graham, S. Galic, J. E. Honeyman, S. L. Fynch, K. A. Hewitt, G. R. Steinber g, and T. W. Kay. 2011. Macrophage deletion of SOCS1 increases sensitivity to LPS and palmitic acid and results in systemic inflammation and hepatic insulin resistance. Diabetes 60: 2023 2031. 49. Weisberg, S. P., D. McCann, M. Desai, M. Rosenbaum, R. L. Leibel, and A. W. Ferrante. 2003. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112: 1796 1808. 50. Zaitseva, I. I., M. Hultcrantz, V. Sharoyko, M. Flodström Tu llberg, S. V. Zaitsev, and P. O. Berggren. 2009. Suppressor of cytokine signaling 1 inhibits caspase activation and protects from cytokine induced beta cell death. Cell Mol Life Sci 66: 3787 3795. 51. Balabanov, R., K. Strand, A. Kemper, J. Y. Lee, and B. Popko. 2006. Suppressor of cytokine signaling 1 expression protects oligodendrocytes from the deleterious effects of interferon gamma. J Neurosci 26: 5143 5152. 52. Berard, J. L., B. J. Kerr, H. M. Johnson, and S. David. 2010. Differential expression of SO CS1 in macrophages in relapsing remitting and chronic EAE and its role in disease severity. Glia 58: 1816 1826. 53. Vandenbroeck, K., J. Alvarez, B. Swaminathan, I. Alloza, F. Matesanz, E. Urcelay, M. Comabella, A. Alcina, M. Fedetz, M. A. Ortiz, G. Izquie rdo, O. Fernandez, N. Rodriguez Ezpeleta, C. Matute, S. Caillier, R. Arroyo, X.

PAGE 60

60 Montalban, J. R. Oksenberg, A. Antigüedad, and A. Aransay. 2012. A cytokine gene screen uncovers SOCS1 as genetic risk factor for multiple sclerosis. Genes Immun 13: 21 28. 54. Leikfoss, I. S., I. L. Mero, M. K. Dahle, B. A. Lie, H. F. Harbo, A. Spurkland, and T. Berge. 2013. Multiple sclerosis associated single nucleotide polymorphisms in CLEC16A correlate with reduced SOCS1 and DEXI expression in the thymus. Genes Immun 14: 62 66. 55. Zhang, X., Y. Tao, J. Wang, R. Garcia Mata, and S. Markovic Plese. 2013. Simvastatin inhibits secretion of Th17 polarizing cytokines and antigen presentation by DCs in patients with relapsing remitting multiple sclerosis. Eur J Immunol 43: 281 289 . 56. Henningsson, L., T. Eneljung, P. Jirholt, S. Tengvall, U. Lidberg, W. B. van den Berg, F. A. van de Loo, and I. Gjertsson. 2012. Disease dependent local IL 10 production ameliorates collagen induced arthritis in mice. PLoS One 7: e49731. 57. Lee, C., T. B. Kolesnik, I. Caminschi, A. Chakravorty, W. Carter, W. S. Alexander, J. Jones, G. P. Anderson, and S. E. Nicholson. 2009. Suppressor of cytokine signalling 1 (SOCS1) is a physiological regulator of the asthma response. Clin Exp Allergy 39: 897 907. 5 8. Fukuyama, S., T. Nakano, T. Matsumoto, B. G. Oliver, J. K. Burgess, A. Moriwaki, K. Tanaka, M. Kubo, T. Hoshino, H. Tanaka, A. N. McKenzie, K. Matsumoto, H. Aizawa, Y. Nakanishi, A. Yoshimura, J. L. Black, and H. Inoue. 2009. Pulmonary suppressor of cyt okine signaling 1 induced by IL 13 regulates allergic asthma phenotype. Am J Respir Crit Care Med 179: 992 998. 59. Flowers, L. O., H. M. Johnson, M. G. Mujtaba, M. R. Ellis, S. M. Haider, and P. S. Subramaniam. 2004. Characterization of a peptide inhibito r of Janus kinase 2 that mimics suppressor of cytokine signaling 1 function. J Immunol 172: 7510 7518. 60. Waiboci, L. W., C. M. Ahmed, M. G. Mujtaba, L. O. Flowers, J. P. Martin, M. I. Haider, and H. M. Johnson. 2007. Both the suppressor of cytokine signa ling 1 (SOCS 1) kinase inhibitory region and SOCS 1 mimetic bind to JAK2 autophosphorylation site: implications for the development of a SOCS 1 antagonist. J Immunol 178: 5058 5068. 61. Jager, L. D., R. Dabelic, L. W. Waiboci, K. Lau, M. S. Haider, C. M. A hmed, J. Larkin, S. David, and H. M. Johnson. 2011. The kinase inhibitory region of SOCS 1 is sufficient to inhibit T helper 17 and other immune functions in experimental allergic encephalomyelitis. J Neuroimmunol 232: 108 118. 62. Madonna, S., C. Scarponi , N. Doti, T. Carbone, A. Cavani, P. L. Scognamiglio, D. Marasco, and C. Albanesi. 2013. Therapeutical potential of a peptide mimicking

PAGE 61

61 the SOCS1 kinase inhibitory region in skin immune responses. Eur J Immunol 43: 1883 1895. 63. Pothlichet, J., M. Chignar d, and M. Si Tahar. 2008. Cutting edge: innate immune response triggered by influenza A virus is negatively regulated by SOCS1 and SOCS3 through a RIG I/IFNAR1 dependent pathway. J Immunol 180: 2034 2038. 64. Masood, K. I., M. E. Rottenberg, B. Carow, N. R ao, M. Ashraf, R. Hussain, and Z. Hasan. 2012. SOCS1 gene expression is increased in severe pulmonary tuberculosis. Scand J Immunol 76: 398 404. 65. Zimmermann, S., P. J. Murray, K. Heeg, and A. H. Dalpke. 2006. Induction of suppressor of cytokine signalin g 1 by Toxoplasma gondii contributes to immune evasion in macrophages by blocking IFN gamma signaling. J Immunol 176: 1840 1847. 66. Imai, K., T. Kurita Ochiai, and K. Ochiai. 2003. Mycobacterium bovis bacillus Calmette Guérin infection promotes SOCS induc tion and inhibits IFN gamma stimulated JAK/STAT signaling in J774 macrophages. FEMS Immunol Med Microbiol 39: 173 180. 67. Ahmed, C. M., R. Dabelic, J. P. Martin, L. D. Jager, S. M. Haider, and H. M. Johnson. 2010. Enhancement of antiviral immunity by smal l molecule antagonist of suppressor of cytokine signaling. J Immunol 185: 1103 1113. 68. Vignali, D. A., and V. K. Kuchroo. 2012. IL 12 family cytokines: immunological playmakers. Nat Immunol 13: 722 728. 69. Bacon, C. M., D. W. McVicar, J. R. Ortaldo, R. C. Rees, J. J. O'Shea, and J. A. Johnston. 1995. Interleukin 12 (IL 12) induces tyrosine phosphorylation of JAK2 and TYK2: differential use of Janus family tyrosine kinases by IL 2 and IL 12. J Exp Med 181: 399 404. 70. Rincon, M. 2012. Interleukin 6: from an inflammatory marker to a target for inflammatory diseases. Trends Immunol 33: 571 577. 71. Saraiva, M., and A. O'Garra. 2010. The regulation of IL 10 production by immune cells. Nat Rev Immunol 10: 170 181. 72. Zhang, Y., and H. Wang. 2012. Integrin si gnalling and function in immune cells. Immunology 135: 268 275. 73. Takenaka, H., S. Maruo, N. Yamamoto, M. Wysocka, S. Ono, M. Kobayashi, H. Yagita, K. Okumura, T. Hamaoka, G. Trinchieri, and H. Fujiwara. 1997. Regulation of T cell dependent and independ ent IL 12 production by the three Th2 type cytokines IL 10, IL 6, and IL 4. J Leukoc Biol 61: 80 87.

PAGE 62

62 74. D'Andrea, A., M. Aste Amezaga, N. M. Valiante, X. Ma, M. Kubin, and G. Trinchieri. 1993. Interleukin 10 (IL 10) inhibits human lymphocyte interferon ga mma production by suppressing natural killer cell stimulatory factor/IL 12 synthesis in accessory cells. J Exp Med 178: 1041 1048. 75. Stevenson, N. J., C. McFarlane, S. T. Ong, K. Nahlik, A. Kelvin, M. R. Addley, A. Long, D. R. Greaves, C. O'Farrelly, and J. A. Johnston. 2010. Suppressor of cytokine signalling (SOCS) 1 and 3 enhance cell adhesion and inhibit migration towards the chemokine eotaxin/CCL11. FEBS Lett 584: 4469 4474. 76. Bunting, M., E. S. Harris, T. M. McIntyre, S. M. Prescott, and G. A. Zimm erman. 2002. Leukocyte adhesion deficiency syndromes: adhesion and tethering defects involving beta 2 integrins and selectin ligands. Curr Opin Hematol 9: 30 35. 77. Fagerholm, S. C., M. MacPherson, M. J. James, C. Sevier Guy, and C. S. Lau. 2013. The CD11 b integrin (ITGAM) and systemic lupus erythematosus. Lupus 22: 657 663. 78. Wang, L., R. A. Gordon, L. Huynh, X. Su, K. H. Park Min, J. Han, J. S. Arthur, G. D. Kalliolias, and L. B. Ivashkiv. 2010. Indirect inhibition of Toll like receptor and type I inte rferon responses by ITAM coupled receptors and integrins. Immunity 32: 518 530. 79. regulating NF Eur J Immunol 43: 779 792. 80. Kevil, C. G., M. J. Hicks, X. He, J. Zhang, C. M. Ballantyne, C. Raman, T. R. Schoeb, and D. C. Bullard. 2004. Loss of LFA 1, but not Mac 1, protects MRL/MpJ Fas(lpr) mice from autoimmune disease. Am J Pathol 165: 609 616. 81. MacPherson, M., H. S. Lek, A. Prescott, an d S. C. Fagerholm. 2011. A systemic lupus erythematosus associated R77H substitution in the CD11b chain of the Mac 1 integrin compromises leukocyte adhesion and phagocytosis. J Biol Chem 286: 17303 17310. 82. Rhodes, B., B. G. Fürnrohr, A. L. Roberts, G. T zircotis, G. Schett, T. D. Spector, and T. J. Vyse. 2012. The rs1143679 (R77H) lupus associated variant of ITGAM (CD11b) impairs complement receptor 3 mediated functions in human monocytes. Ann Rheum Dis 71: 2028 2034. 83. Fossati Jimack, L., G. S. Ling, A . Cortini, M. Szajna, T. H. Malik, J. U. McDonald, M. C. Pickering, H. T. Cook, P. R. Taylor, and M. Botto. 2013. Phagocytosis is the main CR3 mediated function affected by the lupus associated variant of CD11b in human myeloid cells. PLoS One 8: e57082. 8 4. Baker, B. J., L. N. Akhtar, and E. N. Benveniste. 2009. SOCS1 and SOCS3 in the control of CNS immunity. Trends Immunol 30: 392 400.

PAGE 63

63 85. O'Keefe, G. M., V. T. Nguyen, L. L. Ping Tang, and E. N. Benveniste. 2001. IFN gamma regulation of class II transacti vator promoter IV in macrophages and microglia: involvement of the suppressors of cytokine signaling 1 protein. J Immunol 166: 2260 2269. 86. Elgueta, R., M. J. Benson, V. C. de Vries, A. Wasiuk, Y. Guo, and R. J. Noelle. 2009. Molecular mechanism and func tion of CD40/CD40L engagement in the immune system. Immunol Rev 229: 152 172. 87. Kawabe, T., T. Naka, K. Yoshida, T. Tanaka, H. Fujiwara, S. Suematsu, N. Yoshida, T. Kishimoto, and H. Kikutani. 1994. The immune responses in CD40 deficient mice: impaired i mmunoglobulin class switching and germinal center formation. Immunity 1: 167 178. 88. Kamanaka, M., P. Yu, T. Yasui, K. Yoshida, T. Kawabe, T. Horii, T. Kishimoto, and H. Kikutani. 1996. Protective role of CD40 in Leishmania major infection at two distinct phases of cell mediated immunity. Immunity 4: 275 281. 89. Kawabe, T., M. Matsushima, N. Hashimoto, K. Imaizumi, and Y. Hasegawa. 2011. CD40/CD40 ligand interactions in immune responses and pulmonary immunity. Nagoya J Med Sci 73: 69 78. 90. Wesemann, D. R., Y. Dong, G. M. O'Keefe, V. T. Nguyen, and E. N. Benveniste. 2002. Suppressor of cytokine signaling 1 inhibits cytokine induction of CD40 expression in macrophages. J Immunol 169: 2354 2360. 91. Qin, H., C. A. Wilson, S. J. Lee, and E. N. Benveniste. 20 06. IFN beta induced SOCS 1 negatively regulates CD40 gene expression in macrophages and microglia. FASEB J 20: 985 987. 92. Lu, C., X. Huang, X. Zhang, K. Roensch, Q. Cao, K. I. Nakayama, B. R. Blazar, Y. Zeng, and X. Zhou. 2011. miR 221 and miR 155 regul ate human dendritic cell development, apoptosis, and IL 12 production through targeting of p27kip1, KPC1, and SOCS 1. Blood 117: 4293 4303. 93. Kim, S. J., P. K. Gregersen, and B. Diamond. 2013. Regulation of dendritic cell activation by microRNA let 7c an d BLIMP1. J Clin Invest 123: 823 833. 94. Zhou, H., S. A. Hasni, P. Perez, M. Tandon, S. I. Jang, C. Zheng, J. B. Kopp, H. Austin, J. E. Balow, I. Alevizos, and G. G. Illei. 2013. miR 150 promotes renal fibrosis in lupus nephritis by downregulating SOCS1. J Am Soc Nephrol 24: 1073 1087. 95. Li, X., F. Tian, and F. Wang. 2013. Rheumatoid arthritis associated microRNA 155 targets SOCS1 and upregulates TNF Int J Mol Sci 14: 23910 23921.

PAGE 64

64 96. Davis, T. E., K. Kis Toth, and G. C. Tsokos. 2014. A114: Methylprednisolone Induced Inhibition of miR 155 Expression Increases SOCS1 Driven Suppression of Cytokine Signaling . Arthritis Rheumatol 66 Suppl 11: S151. 97. Szente, B. E., J. M. Soos, and H. W. Johnson. 1994. The C terminus of IFN gamma is sufficient for intracellular function. Biochem Biophys Res Commun 203: 1645 1654. 98. Thiam, K., E. Loing, C. Verwaerde, C. Auri ault, and H. Gras Masse. 1999. IFN gamma derived lipopeptides: influence of lipid modification on the conformation and the ability to induce MHC class II expression on murine and human cells. J Med Chem 42: 3732 3736. 99. Bedoya, S. K., Wilson, T.D., Colli ns, E.L., Lau, K., Larkin III, J. 2013. Isolation and Differentiation of Th17 Naive CD4 T Lymphocytes. J. Vis. Exp. e50765. 100. Lau, K., P. Benitez, A. Ardissone, T. D. Wilson, E. L. Collins, G. Lorca, N. Li, D. Sankar, C. Wasserfall, J. Neu, M. A. Atkins on, D. Shatz, E. W. Triplett, and J. Larkin, 3rd. 2011. Inhibition of type 1 diabetes correlated to a Lactobacillus johnsonii N6.2 mediated Th17 bias. J Immunol 186: 3538 3546.

PAGE 65

65 BIOGRAPHICAL SKETCH Simone Kennedy Bedoya was born on Sheppard Air Force Base, Texas in 1988, and moved to San Antonio, Texas several years later. Following graduation from Antonian College Preparatory High School, Simone attended Clemson University where she earned her Bachelor of Science in animal and veterinary sciences with a minor in S panish during the summer of 2011. In the summer of 2014, Simone earned her Master of Science in microbiology and cell science from the University of Florida focusing on the relationship between SOCS1 and immunity.