Citation
Discovery of Novel Factors Affecting CsrB SRNA Expression in Escherichia Coli

Material Information

Title:
Discovery of Novel Factors Affecting CsrB SRNA Expression in Escherichia Coli
Creator:
Cortes Selva, Diana M
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (91 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
ROMEO,TONY
Committee Co-Chair:
RICE,KELLY C
Committee Members:
KEYHANI,NEMATOLLAH
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
ATP binding cassette transporters ( jstor )
Boxes ( jstor )
DNA ( jstor )
Escherichia coli ( jstor )
Genes ( jstor )
Microbiology ( jstor )
Plasmids ( jstor )
Proteins ( jstor )
RNA ( jstor )
Sensors ( jstor )
Microbiology and Cell Science -- Dissertations, Academic -- UF
csra -- csrb -- helicase -- rna
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Microbiology and Cell Science thesis, M.S.

Notes

Abstract:
The carbon storage regulatory system Csr controls a large number of bacterial processes. At the center of the Csr system, CsrA, an RNA-binding protein, activates or represses gene expression at the post-transcriptional level. Simultanously, two non-coding small RNAs, CsrB and CsrC sequester and antagonize CsrA activity. While CsrB plays the major role in regulation of CsrA activity, only a few factors controlling its expression have been elucidated. As a result, a very important part of CsrA regulation remains not fully understood. To address this issue, a plasmid screen looking for repressors and activators of CsrB in E. coli was implemented. Increased expression of csrB-lacZ transcriptional fusion and increased CsrB RNA levels in the activator screen confirmed the initial phenotypes. Similarly, decreased CsrB RNA levels in the repressor plasmid screening confirmed downregulation of CsrB expression. The screening identified a wide variety of genes encoding proteins for a wide array of pathways as well as sRNAs. Even though the screening did not discern from factors regulating CsrB directly or indirectly, this study provided a step forward into the identification of unknown factors affecting the activity of the global regulator CsrA. Further characterization of the identified genes will be necessary to establish their mechanism of action. This should help to achieve a better understanding of this complex, widespread and very important regulatory system. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2014.
Local:
Adviser: ROMEO,TONY.
Local:
Co-adviser: RICE,KELLY C.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Diana M Cortes Selva.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Resource Identifier:
968131539 ( OCLC )
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

Referenc e style follows APA ( American Psychological Association ) format style according to the 6th edition, second printing of the APA manual . Thank you very much.



PAGE 1

DISCOVERY OF NOVEL FACTORS AFFECTING CsrB SRNA EXPRESSION IN ESCHERICHIA COLI By DIANA MARGARITA CORTES SELVA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMEN TS FOR TH E DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Diana Margarita Cortes Selva

PAGE 3

my family, who has been my greatest support and motivation

PAGE 4

4 ACKNOWLEDGMENTS I thank first and foremost my two mentors along the road, my Professor, Dr. Tony Romeo, who with his great advice and neverending knowledge has guided me along the way these past two years. My second mentor in the Lab, our Post Doctoral Fellow, Dr. Christopher Vakulskas w hose patience, ability and brilliance serve as a daily role model of what a good scientist and worthy person should be. He definitely has set the standards very high. I thank my Laboratory members, who made the work in the Lab one of the most enjoyable lea rning experiences. I would like to thank specially Jianing Song, who stood by me in the good and the bad moments and was my greatest supporter, my confident and best of friends. Furthermore , I would like to thank my Committee members, Dr. Kelly Rice and Dr . Nemat Keyhani for their sound advice, their knowledgeable comments and their continuous help. They have been a key factor in the completion of this whole project.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 7 LIST OF FIGURES ................................ ................................ ................................ ......................... 8 ABSTRACT ................................ ................................ ................................ ................................ ..... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .................. 11 CsrA As a Post transcriptional Global Regulator ................................ ................................ ... 11 CsrA Structure and Function ................................ ................................ ................................ .. 13 sRNAs CsrB and CsrC Act as Antagonizers of CsrA ................................ ............................ 15 Regulation of sRNAs CsrB and CsrC ................................ ................................ ..................... 17 The BarA/UvrY Two Component Signal Transductio n System of E.coli ............................. 21 BarA, the Sensor Kinase ................................ ................................ ................................ ......... 22 UvrY, the Cognate Response Regulator of BarA Sensor Kinase ................................ ........... 23 The Role of BarA/UvrY in the Carbon Storage Regulator System ................................ ........ 25 Effect of pH on the Activation of BarA/UvrY TCS ................................ ............................... 25 The Stimulus for the BarA Sensor Kinase ................................ ................................ .............. 26 RNA Helicases: Introduction ................................ ................................ ................................ . 27 The DEAD box Helicas es ................................ ................................ ................................ ...... 28 2 MATERIALS AND METHODS ................................ ................................ ........................... 33 Bacterial Strains and Culture Conditions ................................ ................................ ............... 33 Plasmid Screening ................................ ................................ ................................ .................. 33 Library Construction ................................ ................................ ................................ ....... 33 Screening Procedure ................................ ................................ ................................ ........ 33 Construction of E. coli Gene Deletions ................................ ................................ .................. 34 galactosidase Assays ................................ ................................ ................................ ........... 34 Western Blotting ................................ ................................ ................................ ..................... 35 Quantitative RT PCR ................................ ................................ ................................ .............. 35 3 RESULTS ................................ ................................ ................................ ............................... 40 Screening For Novel Factors Activating CsrB sRNA Expression (I) ................................ .... 40 Genes Expressed in Multicopy Plasmids Stron gly Activate csrB lacZ Transcriptional Fusion ................................ ................................ ................................ . 40 Twelve of The csrB lacZ Activators Clones Influence UvrY FLAG Levels ...................... 41 Gene Del etions from Plasmid Clones Modestly Affect csrB lacZ Levels in Mid Logarithmic Phase ................................ ................................ ................................ ....... 43

PAGE 6

6 The Majority of Plasmid Clones Highly Activating csrB lacZ Also Increase CsrB RNA Levels ................................ ................................ ................................ ................. 44 Screening For Novel Factors Repressing CsrB sRNA Expression (II) ................................ .. 45 Plasmid Screening For Repressors of csrB lacZ Fusion ................................ ................. 45 Most of The Plasmid Clones Repress csrB lacZ Without Alteration of UvrY Protein Levels ................................ ................................ ................................ .............. 46 Effects of The Inhibitory Clones in CsrB RNA Levels ................................ ................... 48 4 DISCUSSION ................................ ................................ ................................ ......................... 7 6 APPENDIX LIST OF REFERENCES ................................ ................................ ................................ ............... 82 BIOGRAPHICAL SKE TCH ................................ ................................ ................................ ......... 91

PAGE 7

7 LIST OF TABLES Table page 2 1 Strains and Plasmid used in this study ................................ ................................ .............. 37 2 2 List of primers used in this study ................................ ................................ ...................... 38 3 1 Gene identities of plasmid clones activating csrB lacZ fusion ................................ ......... 50 3 2 Effects of pl asmid clones activating csrB lacZ in UvrY FLAG and CsrB RNA levels ....... 57 3 3 Gene identities from clone plasmids repressing csrB lacZ fusion ................................ .... 61 3 4 Effects of plasmid clones repressing csrB lacZ in UvrY FLAG and CsrB RNA levels ....... 70

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Regulatory cir cuitry of CsrB sRNA expression. ................................ ............................... 31 1 2 Schematic representation of a membrane bound tripartite sensor kinase and its cognate response regulator. ................................ ................................ ................................ 32 1 3 Schematic representation of a DEAD box RNA helicase depicting its conserved motifs ................................ ................................ ................................ ................................ . 32 2 1 Diagram of the screening procedure for screening of activators and repressors of csrB lacZ fusion ................................ ................................ ................................ ................. 39 3 1 Effects of plasmid clones activating csrB lacZ in UvrY FLAG levels. ................................ 54 3 2 Single gene mutations modes tly affect CsrB levels at the transcriptional level. ............ 56 3 3 Regulatory circuitry of the Csr system depicting feedback loop.. ................................ .... 67 3 4 Effects of individual repressor plasmid clones on UvrY FLAG protein levels.. .................. 68

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requireme nts for the Degree of Master of Science DISCOVERY OF NOVEL FACTORS AFFECTING CsrB SRNA EXPRESSION IN ESCHERICHIA COLI By Diana Margarita Cortes Selva August 2014 Chair: Tony Romeo Major: Microbiology and Cell Science The carbon storage regulatory syst controls a large number of bacterial processes. At the center of the Csr system, CsrA, an RNA binding protein, activates or represses gene expression at the post transcriptional level. Simultanously, two non coding small RNAs, CsrB and CsrC seques ter and antagonize CsrA activity. While CsrB plays the major r ole in regulation of CsrA activity, only a few factors controlling its expression have been elucidated. As a result, a very important part of CsrA regulation remains not fully understood. To ad dress this issue, a plasmid screen looking for repressors and activators of CsrB in E. coli was implemented. Increased expression of csrB lacZ transcriptional fusion and increased CsrB RNA levels in th e activator screen confirmed the initial phenotypes. Si milarly, decreased CsrB RNA levels in the repressor plasmid screening confirmed downregulation of CsrB expression. The screening identified a wide variety of genes encoding proteins for a wide array of pathways as well as sRNAs. Even though the screening d id not discern from factors regulating CsrB directly or indire ctly, this study provided a step forward in to the identification of unknown factors affecting the activity of the global regulator CsrA.

PAGE 10

10 Further characterization of the identified genes will be necessary to establish their mechanism of action. This should help to achieve a better understanding of this complex, widespread and very important regulatory system.

PAGE 11

11 CHAPTER 1 INTRODUCTION CsrA As a Post transcriptional Global Regulator Bacteria utili ze a number of strategies to cope with rapid changes in environmental conditions . One of these strategies is the regulation of gene expression at the posttranscriptional level. CsrA ( c arbon s torage r egulator A) is a well studied post transcriptional regula tor , which is highly conserved th proteobacteria ( White, Hart & Romeo , 1996). CsrA is a small RNA binding protein (61 amino acids) that was first identified as a regulator of glycogen biosynthesis in Escherichia coli K 12 ( Romeo , Gong , Liu & Brun Zinkernagel , 1993 ). CsrA cop urifies with a large, diverse repertoire of cellular transcripts (more than 700 different targets) ( Edwards et al., 2011 ) and its function includes both the activation and repression of gene expression. To date, CsrA has been found to be a regulator of man y bacterial processes including (but not limited to) biofilm formation (Jackson et al., 2002), motility (Wei et al., 2001), glycolysis, a nd gluconeogenesis (Sabnis , Yang and Romeo, 1995) and quorum sensing (Yakhnin et al. , 2011, Heurlier et al., 2004) in Escherichia coli and other Enterobacteria. Additionally, in Pseudomas aeruginosa , RsmA (CsrA homolog) shows to be influencing many virulence related processes such as biosynthesis of hydrogen cyanide, N acyl homoserine lactone and rhamnolipid bi osynthe sis. ( & ) By transcriptome profiling analyses, it was evidenced that RsmA impacts the expression of a wide variety of genes. When compared to the wild type of strain P. aeruginosa PAO1, up to a 9% of the genes p resent in the transcriptome array were altered in the rsmA mutant. ( Burrowes et al., 2005 ). The global nature of CsrA was also evidenced in a study by Brencic & Lory in 2009. This study shows that RsmA affects the expression of more than 500 genes in the P seudomonas aeruginosa PAK strain. It includes effects caused by indirect regulation as well as direct effects.

PAGE 12

12 Furthermore, direct regulation was observed for 40 different genes encoded in 6 different large operons. Among the direct targets of RsmA were ge nes related to type VI secretion system and genes predicted to be related to fatty acid and phosp holipid biosynthesis. (Brencic & Lory , 2009) A similar experimental approach in Salmonella enterica serovar Typhimurium also revealed the central role of CsrA. By DNA microarray analyses it was shown that CsrA affects expression of a wide number of genes. These include genes required for invasion, motility, ethanolamine metabolism, synthesis of vitamin B12, transport of maltose, aerotaxis and che motaxis, among o thers. (Lawhon et al ., 2003). In an attempt to identify direct targets of CsrA using timed transcript array studies in E. coli , Jonas et al . (2008) demonstrated that several genes encoding GGDEF, GGDEF EAL and one EAL protein were regulated by CsrA. Two of the proteins with the GGDEF domain (YdcT and YdeH) are directly regulated by CsrA. CsrA binds with high affinity to the mRNA of both proteins and appears to regulate the stabil ity of the transcripts (Jonas et al., 2008) Moreover, CsrA homologs have also b een identified as central regulators of many physiological processes in up to 176 different species of eubacteria including Pseudomonas sp., Pectobacterium sp. , Legionella pneumophila , Salmonella enterica , Proteus species, Helicobacter pylori, and Vibrio c holera, among others (Luchetti Miganeh, Burrowes, Baysse, & Ermel , 2008). Moreover, orthologs of CsrA are also present in Actinobacteria, Thermotogae, Planctomycetes, Spirochaetes, and Firmicutes (Mercante , Suzuki, Cheng, Babitzke , & Romeo , 2006, Bateman e t al., 2004) although how such a wide distribution is achieved is not clear. Altogether, these findings demonstrate the global role of this regulator among many bacteria and in a wide variety of processes .

PAGE 13

13 CsrA Structure and Function CsrA is a homodimer i n solution, and each polypeptide consists of five antiparallel strands, a small helix and a non structured C terminus. Two polypeptides are woven together to form a CsrA dimer. (Gutierrez et al. , 2005). Almost simultaneously, crystallography analyses of CsrA in P. putida showed an almost identical crystal structu re composed of two polypeptides each containing five antiparallel strands and 1 he lix assembled as a dimer (Rife et al., 2005). Furthermore, comprehensive alanine scanning mutagenesis studies revealed critical amino acids that are necessary for the RNA binding activity of CsrA. These residues are located at opposite ends of the homodimer, and are located primarily on the first and the last strands of CsrA. For example, R44 seems to be of the utmost importance, since a substitution to this amino acid t o alanine decreases the affinity of CsrA for RN A by over 150 fold. (Mercante, Edwards, Dubey, Babizke & Romeo, 2009) This substitution proved to be of importance for the biological function of CsrA. Regulation in motility, biofilm formation and glycogen ac cumulation were all affected by the susbtituions in the critical amino acids. Moreover, CsrA is capable of binding two sites of the same target with high affinity (Mercante et al., 2006). In addition, CsrA also can simultaneously bind two different RNA tar gets since it possesses independent binding surfaces. ( Schubert et al., 2007) Interestingly, the distance between RNA binding sequences in the target has been demonstrated to be pivotal for the formation of a stable RNA RNA binding protein complex. Even th ough CsrA is capable of binding simultaneously sequences that are in a distance of 10 63 nucleotides of each other, a distance of approximately 18 nucleotides or more between the binding sites was deter mined to be optimal. (Mercante et al., 2009)

PAGE 14

14 The RNA b inding sequence of CsrA has been determined to be a GGA motif that is surrounded by a semi conserved sequence region, often localized in a single stranded loop of sho rt RNA hairpins. (Dubey , Baker, Romeo & Babitzke, 2005) In general, CsrA represses gene tr anslation by binding to the mRNA target in a sequence overlapping or proximal to the Shine Dalgarno sequence, thus competing with the ribosome 30S subunit and preventing translation (eg. nhaR in E. coli by Pannuri et al., 2012, nag in Bacillus subtilis by Yakhnin et al., 2007). CsrA activates gene expression by stabilizing mRNA transcript (eg. fhlDC in E. coli by Wei et al., 2001). Furthermore, CsrA also represses gene expression by increasing RNA decay (eg. glgC in E. coli by Liu et al., 1997 ). More recent ly, another mechanism by which CsrA is capable of repressing gene expression has been described by Figueroa Bossi et al . (2014). CsrA is involved in transcription termination dependent by Rho factor. In this example, CsrA acts by unfolding an RNA secondar y structure and exposing an entry site for factor Rho, thus facilitating transcriptio n termination. (Figueroa Bossi et al., 2014) An example of CsrA repression of gene translation in E. coli is evidenced in the glycogen biosynthesis gene, glgC. In this ca se, CsrA binds to four different sites in th e glgCAP transcript. One of CsrA binding sites overlaps the glgC SD sequence, which blocks ribosome access, inhibits the translation of the transcript and also causes destabilization of the glgC transcript. (B ake r et al., 2002, Romeo , 1998, Liu et al., 1997) Other examples of translation repression by CsrA in E. coli include pgaA , which is related to the production of polysaccharide adhesin poly 1, 6 N acetyl D glucosamine ( Jackson et al., 2002) and nhaR , which encodes for a LysR family transcriptional regulator contolling the response t o sodium ions and pH. (Pannuri et al., 2012).

PAGE 15

15 Despite most of the times CsrA is found to be repressing, an example of translation activation is exemplified in in gene encoding for the molybdenum cofactor biosynthesis, moaA. CsrA is capable of binding to untranslated leader, activating t ranslation (Patterson Fortin , Vakulskas, Yakhnin, Babitzke , & Romeo, 2013) In general , CsrA represses genes needed for stationary phase of g rowth and activates genes required for processes that are needed dur ing exponential growth. (Romeo , 1998, Romeo , Vakulskas , & Babitzke , 2013) sRNAs CsrB and CsrC A ct as Antagonizers of CsrA Studies conducted with a recombinant CsrA (CsrA His 6 ) protein reve aled that CsrA copurified with a sRNA of approximately 360 nucleotides in lenght. This protein RNA complex consisted of approximately 18 CrsA subunits bound to a single RNA molecule that lacked an obv ious open reading frame. (Liu et al., 1997). This RNA, c alled CsrB, is transcribed from a single gene in the chromosome of the E. coli K 12 genome. Given that the sequence of the csrB CAGGA(U, C, A)G suggested that these repeats might con stitute the b inding sequence for CsrA. (Liu et al., 1997) When CsrB was overexpressed from a plasmid, the phenotype shown was similar to that of a CsrA mutant. This result suggested that instead of being a factor needed for CsrA dependent regulation, CsrB in fact antagonizes CsrA activity and constituted another regulatory component of the Csr system. CsrB regulatory function by in vitro transcription translation experiment s showed that the CsrA CsrB complex did not repress glycogen expression as efficie ntl y as a CsrA alone did. (Liu et al., 1997) Following the discovery of CsrB, another non coding small RNA CsrC was found in a genetic screen for factors that affected glycogen synthesis (Weilbacher et al. , 2003). Much like CsrB, CsrC contained numerous CsrA binding sites and appeared to bind multiple CsrA

PAGE 16

16 homodimers (Weilbacher et al. , 2003). CsrC possesses 13 predicted CrsA binding sites present in the single stranded region of stem loop structures. Affinity binding experiments indicated that CsrA binds to C srB with higher affinity than CsrC, and genetic experiments confirmed that CsrB is a more effective CsrA antagonist (Weilbacher et al. , 2003). Deletion of csrC has little effect on downstream CsrA targets, and its phenotypes are most dramatic in the contex t of plasmid overexpression, or when csrC is deleted in a strain that lacks csrB . In fact, E. coli is able to partially compensate for the lack of either csrB or csrC by the presence of a feedback loop where CsrA indirectly activates the expression of its sRNA antagonists. In strains the lack csrB, steady state CsrC levels are elevated, and vice versa. Similarly, in Salmonella enterica s erovar Typhimurium CsrB and CsrC play redundant roles in the control of invasion to epithelial cells ( Fortune, Suyemoto, & Altier, 2006). In Salmonella , both CsrB and CsrC are positively regulated by the BarA/SirA two component s ystem. Moreover, both sRNAs are regulated by other components of the Csr system. Even though the reason of the presence of partially redundant sRNAs in bacteria is not well understood, it has been suggested that they might be required for fine tuning of different bacterial processes . (Weilbacher et al., 2003) In addition to CsrB and CsrC sRNAs, another sRNA, McaS, whi ch also binds to the chaperone H fq , was shown to bind to and inactivate CsrA. When overexpressed, McaS activates PGA biosynthesis and biofilm formation. Therefore, it was concluded that the effects of McaS on the pgaABCD operon and the flhD gene were mediated through CsrA. ( Jørgensen , Tomas on, Havelun, Valentin Hansen & Storz , 2013) In addition to the findings by Liu et al . and Weilbacher et al. in E. coli , other sRNAs that antagonize CsrA homologs have been found in other proteobacteria. For example, in Salmonella enterica serovar Typhinuri um the Csr system consists in the regulatory CsrA antagonized by the

PAGE 17

17 sRNA CsrB and CsrC (Fortune et al. , 2006) . In P. aeruginosa RsmZ and RsmY sRNAs antagonize the CsrA homolog in this org anism, called RsmA (Valverde, Heeb, Keel, & Haas , 2003). Interestin gly, RsmY and RsmZ bare little sequence identity to CsrB and CsrC from E. coli, contain fewer CsrA/RsmA binding sites, and overall have markedly greater stabilities (Sonnleitner & Haas , 2011). Legionella pneumophila disease, expresses two CsrA inhibitory sRNAs called RsmY and RsmZ. CsrA in this organism controls the switch between replication and transmiss ion phenotypes. (Faucher & Schuman , 2011) . Other known mechanisms of regulation by RNAs exist in bacteria; among t he most studied example is the use of cis encoded sites such as in riboswitches and antisense transcripts. by binding to a small molecule ligand (Garst, Edwards , & Batey, 2011). Antisense RNA binds their target RNA with perfect complementary (Brantl, 2007, Faner & Feig , 2013). A second example of small regulatory RNAs to control gene expression includes the trans encoded RNAs. Transcribed from a different locus in the genome, the trans encoded RNA does not present perfect base complementary. Trans encoded RNAs may regulat e by blocking the Shine Dalgarn o sequence or affecting RNA decay. Most commonly, trans encoded RNAs depend on the chaperone molecule H fq to fac ilitate base pairing between the sRNA and its mRNA target. ( Sonnleitner et al., 2004, Hoe , Raabe, Rohzdestvensky , & Tang, 2013) Regulation of sRNAs CsrB and CsrC The sRNAs CsrB and CsrC appear to be the principle regulators of CsrA activity, and thus the levels of these sRNAs determines regulation of the Csr system. Given their importance, it is perhaps no surprise that the expression of these sRNAs is tightly controlled at levels of both synthesis and turnover. (Suzuki et al., 2002) The BarA/UvrY (BarA/S irA in Salmonella ,

PAGE 18

18 GacA/GacS in Pseudomonas ) two component signal transduction system (TCS) is the most important known regulator of csrB and csrC expression, and this TCS is widely distributed proteobacteria. (Mercante et al., 2009) There fore, this regulation seems to be almost universall y present among the Csr system containing bacteria. Other factors appear to control the expression of csrB / csrC , and many of these pathways likely involve the BarA/UvrY TCS. (Guadapaty, Suzuki, Wang, Babit zke, & Romeo, 2001) CsrA strongly activates the expression of csrB and csrC , and this regulation appears to occur indirectly through unknown factors. It is interesting to note that a similar regulatory mechanism occurs in Pseudomonas sp. where RsmA strongl y activates the expression of rsmY and rsmZ (Marden et al., 2013 ). This regulation however, seems to be through the GacS/GacA two component signal transduction system (which will be discussed in more detail in following sections) . Recently, Vakulskas et al . (2014) used a transposon mutagenesis screen to discover that the DEAD box RNA helicases DeaD and SrmB activate csrB expression. DeaD indirectly activates csrB expression by directly activating translation of the respo nse regulator UvrY (Vakulskas et al., 2014). In contrast, SrmB activates csrB expression through a pathway that depends on U vrY , but does not affect its levels or phosphorylation state. The mechanism by which SrmB is affecting expression of csrB remains to be elucidated, but it is most likely an indirect effect that requires additional factors. (Vakulskas et al. , 2014) More detailed information about DEAD box helicases and their effects on the Csr system will be discussed in following sections. Bacteria have evolved several mechanisms to cope with poor nutrient availability including the stringent response, which is known to control gene expression in response to amino

PAGE 19

19 acid starvation and is triggered by the alarmone guanosine 5 diphosphate diphosphate (ppGpp). In addition, ppGpp has bee n recognized as an important regulator of gene expression in E. coli , by directing the expression of genes needed for survival over the ones needed for proliferation. (Magnussson, Farewell & Nyström, 2005). ppGpp exerts its function by binding to the RNA p olymerase and altering the rate of transcription. (Zuo, Wang, & Steitz, 2013) ppGpp synthesis depends primarily on the ribosome associated RelA pr otein and it is potentiated by DksA (Paul et al., 2004). DksA is required for ribosomal RNA modulation . (Paul et al., 2004) Both ppGpp and the protein DksA have been shown to affect CsrB levels. By Northern Blotting analyses, it was determined that ppGpp positively regulates the transcription of both sRNAs CsrB and CsrC. (Edwa rds et al., 2011) CsrA binds to relA mRNA and has modest effects on relA gene expression and on protein levels (Edwards A et al., 2011). Likewise, dksA (dnaK suppressor) is involved in the activation of transcription of CsrB and CsrC in E. coli , but the mechanism by which DksA is regulating t he sRNAs expressi on is still unclear. (Edwards et al., 2011). Recently, it has been documented in Salmonella studies that integration host factor (IHF) binds to the csrB promoter region and positively regulates its expression. Interestingly, IHF does not a ffect csrC expression (Martinez et al, 2014). IHF is a global regulatory protein that helps to stabilize duplex and affects DNA supercoiling in the cell. IHF has been implicated in DNA binding, DNA bending, DNA replication and thus acts as an accessory fac tor for the expre ssion of many genes (Freundlich, Ramani, Mathew, Sirko & Tsui , 1992, Goosen & van de Putte , 1995 ) Hfq is a chaperone protein that promotes the interactions between sRNAs and mRNAs, many trans encoded RNAs need of this protein to facilitate their pairing to their target (Sonnleitner et al., 2004). In E. coli , H fq seems to be affecting steady state levels of CrsB but not

PAGE 20

20 turnover. When hfq was mutated, the half life of CsrB was not affected. (Suzuki , Kushner, Babitzke, & Romeo, 2006) In compa rison, in P. aeruginosa , RsmY seems to be bound by the chaperone, Hfq in association with RsmA (CsrA). Both Hfq and RsmA bind RsmY in overlapp ing sites. It is not clear how H fq binding to RsmY is exerting a functio n, but the authors hypothesize H fq binding affects RsmY sRNA st ability. (Sorger Domenigg , Sonnleitner, Kaberdin , & Blasi , 2007 ). Additionally, studies to further understand the conditions in which the Csr system is regula ted were carried by Jonas and Melefors (2009 ). They described that nutrients limitation induces CsrB and CsrC expression. The levels of both sRNAs were reduced when tryptone, casamino acids or a purified mix of amino acids were add ed to the media (Jonas & Melefors, 2007 ). The degradation of CsrB and CsrC RNAs requires the protein CsrD (formerly YhdA) (Suzuki et al., 2002). In a CsrD knockout, the stability of CrsB and CsrC transcript was incre ased. A complementation experiment where CsrD was cloned into pBR322, restored RNA csrD strain phenotype. The effect of CsrD on C srB/CsrC turnover required two enzymes : R Nase E and PNPase. Other proteins such as Hfq, which has been suggested to form a complex with RNase E and mediate pairing of antisense RNAs to its targets, did not participate in the degradation of CsrB/CsrC. Even though it is still not clear how CsrD acts, it does not appear to f unction as a nuclease. (Suzuki et al. , 2006). CsrD is part of the superfamily of protein containing GGDEF and EAL domains. The GGDEF is named for the conserved motif GG[DE]EF present in many proteins with the domain. The EAL domain is named for its conserved residues. The GGDEAF domain acts as a cycla se for production of the nucleotide signal c di GMP. The EAL domain acts

PAGE 21

21 hydrolyzing c di GMP (Simm, Morr, Kader, Nimtz & Römling , 2004). Despite that CsrD is a member of this family of proteins, it does not synthesize c di GMP, which was suggested by the low sequence conservation CsrD possess. It contains a HRSDF motif instead of the expected cyclase was obtained when site directed mutagenesis was used to alter residues that should be required for c di GMP synthesis or turnover and none of the residues were found to be needed for CsrD to regulate CsrB levels. (Suzuki et al. , 2006). A recombinant CsrD protein binds with high affinity (approximately 25nM) to both CsrB and C srC, but the specifity of the binding is low. Even though the mechanism by which CsrD triggers RNA degradation has not been defined, these experiments might shed light in how CsrD might function. It has been hypothesized by Suzuki et al . (2006) that CsrD m ight bind to CsrB/CsrC and modify their structure so that they become a substrate of RNase E degradation. (Figure1 1) The BarA/UvrY Two C omponent Signal Transduction S ystem of E.coli Two componen t systems are ATPases characterized by the use of energy obta ined from the hydrolysis of the highly energetic ATP molecule to effect responses depending on ever changing environmental condi tions ( Stock, Surette, Levit , & Park, 1995). Usually, such a system is composed of a sensor kinase and its cognate response regu lator. The sensor kinases often function as membrane bound receptor s containing a sensory domain at the external surface of the membrane and a cytoplasmic domain located in the C terminus . Commonly, u pon the detection of a signal, the sensor kinase stimul ates an ATP dependent autophosphorylation reaction at a conserved histidine residue (Stock et al., 1995 ) . Once phosphorylated, the sensor kinase catalyzes a transphosphorylation of the response regulator at a conserved aspartate residue. Th e phosphorylatio n causes a conformational change that leads to the response regulator becoming

PAGE 22

22 functional. The conformational change allows the response regulator to either activate or repress gene expression (Stock et al ., 1995). A critical step in two component signal t ransduction is the interaction between the histidine kinase and the response regulator. Kinases are regu lated by diverse signals from the environment, and the response regulators are the phosphoryl group receivers that are controlled by the sensors. The hi stidine kinase often controls both phosphorylation and dephosphory lation rates of the response regulators ( Stock et al ., 1995). The phosphorylation reaction can be regulated by kinases in two ways, i) the rate of histidine phosphorylation controls the ava ilability of a phosphodonor ii) the protein protein interactions between the histidine kinase and their regulators determine the specificity of regulator phosphorylation ( Stock et al., 1995). BarA, the Sensor K inase To date, members of the two component sy stems have been described in many different bacterial species, suggesting a role in adaptive responses of bacteria to environmental stimuli ( Parkinson , 1993). Furthermore, some have also been discovered in eukaryotes, including protozoa, fungi and plants ( Ishige, Nagasawa, Tokishita & Mizuno, 1994). Sequencing of the E. coli genome has identified 32 response regulators and 23 senso r kinases . I n addition, some complex sensor kinases have been identified (Mizuno , 1997) . The simple sensor kinases consist of on ly sensing and kinase domain s, while the most complex sensor kinases have a sensing domain, a kinase domain, a REC domain and often also a C terminal histidine phosphoransferase (HPT) (He et al., 2006) In E. coli , four of the sensor proteins, ArcB, EvgS, T orS, and BarA, s how a complex organization. The more complex organization is defined as tripartite because they have two extra domains (D1 and H2) in addition to the single H transmitter domain. Following the initial autophosphorylation of the histidine re sidue in the H1 domain, the p hosphoryl group is

PAGE 23

23 transferred to a histidine residue in the H2 domain of the sensor protein via an aspartate residue in the D1 domain, before being relayed to the regulator protein in a His3 Asp3 His3 fashion ( Tomenius et al ., 2006). (Figure 1 2) The tr ipartite sensor BarA ( bacterial adaptive response ) was initially discovered by its ability to control the OmpR response regulator in vivo , but the crosstalk between the two could not be demonstrated in vitro . ( Nagasawa , Tokishit a, Aiba , & Mizuno , 1992 ). Many BarA homologs have been identified in other bacteria such as Salmonella spp (BarA/SirA syste m) (Altier , Suyemoto, Ruiz, Burnham , & Maurer, 2000), Pseudomonas spp (GacA/GacS system) ( Corbell & Loper , 1995 ) and Legionella pneum ophila (LetS/LetA) (Hammer , Tateda , & Swanson, 2002). The total length of BarA protein is 918 amino acids. The nucleotide sequence of barA encodes a 102 ins have been found to undergo in vitro phosphorylation by the characteristic three step procedure of tripartite his tidine kinases (Ishige , 1994). The barA gene has been reported by Zhang and Normark (1996) to be activated in uropathogenic E. coli upon pye lonephritis pili attachment to the carbohydrate receptor on eukaryotic cells and has been reported to play a role in the attachment and colonization of the bacteria to the urinary tract epithelia during infection. Additionally, BarA has been proposed to fu nction as an activator of the siderophore system (Zhang & Normark, 1996) . UvrY, the Cognate Response R egulator of BarA Sensor Kinase The discovery of U vrY as the B arA cognate response regulator was stablished by biochemical experiments. Purified B arA (His 6 tagged, deprived of the transmembrane segment) protein becomes autophosphorylated when 32 ATP , this suggests that BarA is ATP dependant . To demonstrate that UvrY is the res ponse regulator, Pesternig, Melefors and Georgellis (2001) added UvrY (purified and His 6 tagged) to BarA P. UvrY became rapidly

PAGE 24

24 phosphorylated, while BarA P lost the P label. BarA and not ATP or the non cognate sensor ArcB P acts as a phosphoryl group donor to UvrY, suggesting that there are no intermediates involved in the signal transduction (Pesternig , Melefors , & Georgellis 2001) . UvrY is a 23 KDa (218 a mino acid) protein that has an N terminal phosphor acceptor domain with a conserved aspartic acid residue at position 54 followed by a helix turn helix DNA binding domain in the C terminal region (Pesternig et al. , 2001). The u vrY gene is composed of 615 b ase pairs . uvrY Pseudomonas ( gacA ), Erwinia ( expA ), Escherichia ( uvrY ), Vibrio ( varA ), and Salmonella ( sirA ) ( Mizuno , 1997; Goodier & Ahmer , 2001) . The role of U vrY has been studie d in P. luminicens . Through a series of transcript profiling studies on an UvrY deficient strain, 276 genes were found to be altere d. ( Krin et al., 2008 ). Further experiments showed that UvrY was associated with the increased expression of proteases (PrtA, Prt1 and PLU4291) in P. luminicens . UvrY also was associated with increased iron uptake during mid exponential growt h. O n the contrary, it was suggested that UvrY reduces the uptake of iron by lowering th e synthesis of sidorophores and haemin ABC transpor t system. UvrY also regulates genes that are related to flagella, repressing the synthesis of flagella. Moreover, Krin et al . (2008) found that many proteins related to oxidative stress were upregulated in th e presence of uvrY : AhpC (alkyl hydroperoxide re ductase), Gor (glutathione reductase), L uxS (S rybosylhomocysteine lyase) . Genes like adhE ( alcohol dehydrogenase) , katE ( catalase HPII) and cyoD ( Cytochrome o oxidase subunit IV ) were also altered. A s a consequence of the alterations of proteins and genes related to oxidative stress , when challenged agains t H 2 O 2 , the strain lacking UvrY proved to be more sensitive to oxidative stress.

PAGE 25

25 The R ole of BarA/UvrY in the Carbon Storage Regulator S ystem The BarA/U vrY TCS system positively controls th e expression o f the C srB RNA . BarA/U vrY system was found by Suzuki et al . (2002) to alter CsrB expression, but not C srA expression. The a lteration of the expression of c srB was demonstrated by csrB lacZ assays, where results showed that this alteration was dependent bot h on U vrY and BarA . Nevertheless, C srB expression was more dependent on UvrY and to a lesser extent, to B arA (Suzuki et al ., 2002). By transcriptional and translational fusion assays, Suzuki et al . (2002) showed that C srA and U vrY have a modest stimulation of BarA and that neither CsrA nor BarA has a substantial effect on the expression of UvrY . At the same time, experiments show that C srA influences C srB in a B arA independent and dependent fashion, where as the activation of CsrB is dependent on U vrY. (Suzu ki et al. , 2002) Both CsrA and UvrY have been shown to activate CsrC. Ectopic expression of UvrY restored C srC expression in a csrA mutant, but CsrA could not restore the expression in when only uvrY was mutated. Bar A/UvrY is suggested to provide a set po int adjustment mechanism , a Chavez et al., 2010) . CsrA activity controls central and secondary carbon meta bolism and thus deletions of barA or uvrY may affect these processes (Gonzalez Chavez et al ., 2010) Effect o f pH o n the Activation of BarA/U vrY TCS Bacterial metabolism can shift external pH. Growth on sugar, when oxygen becomes limited, produces organic acid that when excreted lowers external pH. Growth on amino acids generates ammonium , which produces a contrar y effect. The activity of BarA/UvrY tested on a range of pH from 5.0 to 9.0 has shown that the system is active at pH 6, 7, 8 and 9, since a csrB lacZ shows that CsrB is expressed at those pHs. CsrB is not expressed at a pH 5, even when the culture reached an optical density greater than one (at 600 nm). In order to determine if pH

PAGE 26

26 regulation was BarA/U vrY dependent, the expression of non coding RNA, C srC was tested through a csrC lacZ assay. Similarly, no expression of the sRNA was ob ser ved in the culture at pH 5, but the CsrC sRNA was expressed at pH 7, suggesting that the lack of expression at pH 5 could be due to: i) the lack of BarA stimulating signal ii) The formation of a BarA inhibiting signal iii) Repression of expression of barA and/or uvrY (Mondragón et al., 2006 ). Low pH (pH =5) does not affect expression of uvrY or barA , which suggests that effect of pH on the two component system could be by affecting the phosphorylation state of the sensor kinase (Mondragón et al ., 2006) . Mond ragón et al . (2006) also determined that the environmental pH threshold for the activation of the BarA/uvrY two compo nent system was 5.5. This inhibit ion of the two component system by pH lower that 5.5 seems not to be widespread into other two component s ystems (such as ArcA/ArcB system) (Mondragón et al . , 2006). The Stimulus for the BarA Sensor K inase It has been reported by Mondragon et al . (2006) that under low pH (lower than 5.5) ther e is no activation of the BarA/U vrY two component system; neverthele ss, activation has been demonstrated by further experiments when glucose was added to the m edium at that pH ( González Chávez et al., 2010). The activation was not immediate though, which suggests that glucose per se is not the activating signal, but a prod uct of the catabolism of glucose might be the activator stimulus for the system ( González Chávez et al. , 2010). Further experiments have shown that aliphatic carboxylic acids such as formate, acetate and propionate funct ion as stimuli for the Ba rA sensor k inase, since they cause an immediate activation of csrB lacZ expression; in contrast, et hanol, succinate or lactate do not affect the system . More specifically, it was discovered that formate acts through the BarA sensor kinase, whereas acetate can act thr ough UvrY (González Chávez et al. , 2010). This reasoning was confirmed when the expression of csrB lacZ uvrY barA double mutant.

PAGE 27

27 When formate was added into the medium it could not activate the expression of csrB in either a uvrY or a barA mutant, in contrast to acetate, which activated the csrB lacZ expression in th e barA uvrY (González Chávez et al. , 2010). Glucose effects via UvrY seems to require acetyl phosphate, (acetyl P), a highly energetic molecule th at can be used by a wide number of response regulators (including SirA) to autophoshorylate. (Wolfe , 2005) This was reasoned when in an experiment testing for the effects of glucose o n csrB lacZ reporter, a strain with deletions of acka and pta , (genes req uired for acetate synthesis ) and poxB ( required for the conversion of pyruvate to acetate ) failed to activate the csrB lacZ reporter fusion. (Gonzalez Chavez et al., 2010) Moreover, through a series of experiments in which molecules with structures similar to that of formate or acetate were added to the media it was found that the carboxylate group shared by formate, acetate, and other short chain fatty acids is needed to activate the BarA/U vrY system. Deletion of barA determined that the activation of the system by these compounds was through BarA sensor kinase, noting that the level of the activation was inversely proportional with t he length of the aliphatic tail (González Chávez et al., 2010) . RNA Helicases : Introduction Initially identified as pivotal elements of protein synthesis initiation in eukaryotes in the 1980s, RNA helicases were later identified to have RNA dependent ATPase activity, to bind nucleic acids and modify RNAs in an ATP dependent manner. Evidence that RNA helicases can unwind small duplexes, and that ATP is required for this function was provided by Ray et al. (1985). Thereafter, several discoveries of proteins with similar function have been found in many other organisms, some of these included the mammalian eIF4AI and II , SrmB in E . coli and eIF4A in ye ast, among others. (Linder, 1989) Consequently, more studies of related proteins

PAGE 28

28 ensued, showing the almost ubiquitous distribution of these prote ins in nature. (Jankowski, Guenther , & Jankoswski, 2011) Since RNA helicases share some conserved amino acid sequence, structure and function similarity, a general classification dividing them into six superfamili es has been adopted (Singleton, Dillingham , & Wigley , 2007). Superfamily (SF) 1 and 2 do not form oligomeric rings. A conserved cor e with distinct sequence motif at defined positions characterizes them. Within each respective superfamily, the sequence conservation is high, but it is fairly limited across families. Commonly, the core is surrounded by a C and N terminal region that migh t function as RNA binding domains or protein interaction domains. Therefore, surrounding C and N terminal regions appear to be highly important and influential for the helicase activity since they determine many of the interaction between the protein and i ts substrates. ( Fairman Williams , Guenther , & Jankowski, 2010) (Figure 1 3) The DEAD box Helicases DEAD box helicases comprise most of the bacterial RNA helicases. They are characterized by having nine different conserved motifs. The name DEAD is based on its amino acid sequence conservation, D E A D (Asp Glu Ala Asp) found in the Walker B motif or motif II. (Steimer & Klostermeier , 2012, Byrd & Raney, 2012). Their role in Eukaryotes is very widespread. DEAD box helicase protein function almost in all of t he RNA processes, ranging from transcription, RNA stability, RNA turnover, translation, ribosome biogenesis and others. (Cordin, Banroques, Tanner , & Linder, 2006, Silverman , Edwalds Gilbert , & Lin, 2003). Even though they have been linked to a wide array of functions, the mechanistic details on how they are exerting these many functions is just beginning to appear.

PAGE 29

29 Studies have been performed to describe the specific motifs required for ATP and DNA binding. These studies show that a closed conformation of the cleft between both domains is required in order for the helicase to exert its activity. (Theissen , Karow , Köhler, Gubaev , & Klostermeier, 2008, Linder & Jankowski , 2011, Hilbert, Karrow , & Klostermeier, 2009). In bacteria, helicases from SF2 and SF5 p lay important roles in gene regulation. SF5 includes transcription factor Rho and SF2 includes DEAD box and DEAH box helicases. (Kaberdin & Blasi, 2013). E. coli possesses five DEAD box helicases: DeaD/CsdA, RhlB, RhlE, DbpA and SrmB . DeaD/CsdA have been l inked to ribosome biogenesis at low temperature. In cells deficient of DeaD helicase, ribosome 50S subuni t fails to assemble (Peil , Virumae , & Remme, 2008). RhlB is a component of the degradosome multi enzyme complex in conjunction with PNPase, the endorib onuclease RNase E and enolase. It is suggested that RhlB is fundamental for RNA turnover by acting as a RNA unwinding factor (Py , Higgins, Krisch , & Carpousis, 1996). RhlE also seems to be associated with the degradosome. DbpA shows high specificity for t he RNA hairpin of the S23 of ribosomal RNA (rRNAs) (Tsu, Kossen , & Uhlenbeck , 2001), but its function remai ns so far unknown (Iost & Dreyfus , 2006). Finally, SrmB has been shown to be involved in the early steps of ribosome biogenesis. Additionaly, cells l acking SrmB show growth defect at low temperature. (Charollais , Pflieger , Vinh , Dreyfus , & Iost 2003) The DEAD box helicase is mostly known in E. coli ( Iost I et al., 2006). While most of them have been related in ribosome biogenesis processes, their parti cipation in RNA processing and decay has been documented (Iost & Dreyfus, 2013, Khemici , Poljak , Toesca , & Carpousis 2005, Iost & Dreyfus, 1994). Furthermore, it has been reported that low temperature influences the function of these proteins. DeaD has pre viously been reported to affect the expression of

PAGE 30

3 0 genes under low temperature conditions (Iost & Dreyfus , 2006 , Resch , , & Bläsi , 2010) . Nevertheless, new studies reveal DeaD and SrmB helicase to be affecting gene expression over a broad range of temperature (30°C, 37°C, 42°C). (Vakulskas et al., 2014) Studies by Vakulskas et al . (2014) have demonstrated th at DeaD helicase affects expression of a broad diversity of genes in a wide ran ge of temperatures. (Vakulskas et al., 2014). By crossli nking immunoprecipitation a pool of 39 mRNAs were identified to be affected by DeaD. The identified proteins that were FL AG tagged and tested for regulation by DeaD include: UvrY, SdiA, MntR, IaaA and IbpA, among others. UvrY, SdiA and MntR showed to be regulated by DeaD over a broad range of temperatures (30°C to 42°C), whereas expression of other proteins like IaaA and Ibp A where mostly affected at high temperatures (42°C ). Therefore, this study provided evidence that helicase activity is not limited to low temperatures, which suggests that the regulatory role of thes e proteins is much more extensive than previously expecte d and may include many processes in post transcriptional regulation at physiological relevant temperatures. (Vakulskas et al., 2014).

PAGE 31

31 Figure 1 1. Regulatory circuitry of CsrB sRNA expression . Solid lines represent known regulatory mechanism while broken lines depict unknown regulatory mechanism. CsrB is activated indir ectly by CsrA through the BarA/ UvrY TCS. CsrB sRNA is acti vated by the chaperone protein H fq as well by the stringent response (Dksa + ppGpp). Ihf binds to csrB promoter region and activate s its expression. Two DeaD box RNA helicases activate expression of CsrB and CsrC . DeaD affects CsrB by affecting UvrY translation. SrmB helicase regulates CsrB transcription by a yet unknown mechanism. Mor eover, CsrB /C RNAs are degraded by CsrD, PNPase an d RNase E

PAGE 32

32 Figure 1 2 . Schematic representation of a membrane bound tripartite sensor kinase and its cognate response regulator . The sensor kinase probes the stimulus from the environment, upon the detection of a signal, the sensor kinase stimulates an AT P dependent autophosphorylation reaction at a conserved histidine residue . T he sensor kinase catalyzes a transphosphorylation of the response regulator at a conserved aspartate residue. The phosphorylation causes a conformational change that leads to the r esponse regulator to become functional. The conformational change allows the response regulator to either activate or repress gene expression Figure 1 3. Schematic representation of a DEAD box RNA helicase depicting its conserved motifs . Sequence alignm ent of the DeaD box RNA helicases has shown n in e conserved motifs with distinct funtions. A typical DeaD box helicase possesses a helicase core consisting of domain 1 and domain 2, surrounded by an N and a C terminus that might function as RNA binding doma ins or protein interaction domains

PAGE 33

33 CHAPTER 2 MATERIALS AND METHODS Bacterial Strains and Culture Conditions A list of the bacterial strains along with the plasmids used is detailed in Table 2 1. All of the experiments were carried out in Luria Broth medi um (5gr. yeast extract, 10gr. Tryptone, and 10gr. NaCl in one liter ddH 2 O), pH 7.4 unless otherwise noted. Cells were grown at 37°C with shaking (250 RPM). Cells were collected at mid log phase (OD 600 0.4) unless otherwise mentioned. When necessary, antibi otics were added to the medium in the following concentrations: Kanamycin, 1 ml 1 ; Chloramphenicol, ml 1 and Tetracycline ml 1 . Plasmid Screening Library Construction E. coli chromosomal DNA was digested with Sau3A I at different times points to create varying fragments of DNA ranging from 2K to 8Kb ( with an average of 4Kb ) . The fragments were gel purified, extracted and ligated into the BamHI site of a pBR322 derivative (pBR322 cam R ). Screening Procedure In order to look for activators of CsrB that might be working through the SrmB DEAD box helicase pathway, a KSB837 strain cointaining the csrB lacZ transcriptional fusion at the ) was transformed with the pBR322 containing fragments . On the other hand, to look for repressors of csrB lacZ transcriptional fusion, a CR 1 93 strain containing the csrB lacZ transcriptional reporter was employed. For both activators and repressors screens, the

PAGE 34

34 containing the ligated DNA fragments. After to electroporation, cells were recovered for 2 hours in SOB medium (0.5% yeast extract, 2% tryptone, 10mM NaCl, 2.5 KCl, 10mM MgCl 2 , 10nM MgSO 4 ) and plated on LB plates containing chloramphenicol and and 5 bromo 4 chloro 3 indolyl D galactopyranoside (X gal, 40 ml 1 ). Colonies carrying the up phenotype (dark blue colored colonies) or the down phenotype (white colonies) were picked and re streaked. For the activators screening, 14,000 CFU were screened and for the repressor screening, a total of 150,00 0 CFU were screened. For both screenings, a coverage of >99% was achieved. The calculation of screening coverage was calculated based on t he formula described by Zilsel, Ma , and Beatty . (1992) Construction of E. coli Gene Deletions Chromosomal genes w ere d isrupted by using P1 vir bacteriophage transduction. When available, gene disruptions from the Keio collection ( Baba et al., 2006) were transduced into the desired background strain. Other chromosomal deletions not available in the Keio collection were cons tructed using the Red re combinase method, as described by Datsenko and Wanner ( 2000 ) . The primers used to construct the single gene deletions are described in Table 2 2. galactosidase A ssays galactosidase assays were conducted as previously described (Romeo , Black , & Preiss, 1990). Some minor modifications were included as described by Edwards et al . ( 2011 ) . Reactions were terminated with 0.5 ml of 1 M Na 2 CO 3 . Total protein was measured by the bicinchoninic acid (BCA) assay with bovine serum albumin as the protein standard (Pierce Biotechnology, Rockford, IL). The values correspond to duplicates or triplicates of independent experiments. The error bars indicate the standard errors from the means.

PAGE 35

35 Western Blotting Cultures for Western blot were grown u ntil mid exponential phase (OD600 0.4). Cells were concentrated by centrifugation, mixed with 2x Laemmli sample buffer ( 62.5 mM Tris HCl, pH 6.8 , 25% glycerol , 2% SDS , 0.01% Bromophenol Blue ), sonicated and boiled for 5 minutes at 95°C. Samples (10ug) were loaded to 15% SDS polyacrylamide gels and transferred to 0.2 m polyvinylidene di uoride (PVDF) membranes by electroblotting using the GENIE®electrophoretic transfer apparatus (Idea Scienti c Company) following the FLAG epitope protein was detected with the anti FLAG ® M2 monoclonal antibody from Sigma. The subun it of bacterial RNA polymerase (RpoB) was detected with anti RpoB monoclonal antibody from Neoclone. Finally, the membranes were developed using horseradish peroxidase linked secondary antibody and the Su perSignal West Femto Chemiluminescent substrate from Pierce. Quantitative RT PCR Quantitative RT PCR (q RT PCR) was performed using the iScript One Step RT PCR with SYBR Green from BioRad, according to the instructions. For this assay, a concentration o f SYBR® Green RT PCR Reaction Mix and 300nM of forward and reverse primers. Primers used for this assay are described in Table 2 2. The conditions were set as follows: A re verse transcription reaction for 10 mins at 50°C, Polymerase Activation and DNA Denaturation for 1 min at 95 C, denaturation for 10 seconds at 95°C, annealing at 60°C for 30 seconds. A total of 40 cycles were configured. The melt curve analysis was done at 60°C 95°C, with 0.5°C of increments. The products were analyzed using iCy cler iQ optical system software version 3.1 (Bio Rad). For the calculations, the standard curve method was utilized. Standards of cDNA at known concentration were used to produce th e standard curve. Technical duplicates were tested to calculate the mean

PAGE 36

36 and SD values. The mean values of the each sample clone was compared to the mean value of a wild type controls and ratios were calculated by dividing RNA levels of sample clones by RN A levels of wild type. The ratios were introduced into tables.

PAGE 37

37 Table 2 1. Strains and Plasmid used in th is study Name Description Reference MG1655 E.coli K 12 Michael Cashel CF7789 Michael Cashel KSB837 lacZ Amp r Gudapaty et al., 2001 CR1 93 KSB837 csrB ::PlacUV5 csrB Amp r Vakulskas et al., 2014 KSB837 csrB lacZ wit h unmarked deaD and srmB deletions Vakulskas et al., 2014 KSB837 uvrY FLAG KSB837 with in frame, CTD 3X FLAG tag at native uvrY locus Kan r Vakulskas et al., 2014 uvrY FLAG uvrY FLAG allele introduced by transduction using P1vir Kan r Vakulskas et al., 2014 pBR322 Ectopic expression of proteins Amp r Tet r Bolivar et al., 1977 pBR322 cam R Derivative pBR322 with the chloramphenicol gene cloned in the BAMHI restriction site Vakulskas et al., 2014 pDEAD pBR322 derivative w ith cloned deaD gene (native promoter) Vakulskas et al., 2014 p srmB pBR322 derivative with cloned srmB gene (native promoter) Vakulskas et al., 2014 pKD13 Construction of Kan resistant deletions Kanr Amp r Datsenko and Wanner, 2000 pCP20 Removal of antibiotic marker from pKD13 chromosomal replacements Amp r Cam r Datsenko and Wanner, 2000

PAGE 38

38 Table 2 2. List of primers used in this study Primers Forward/Reverse Sequence csrB q RT PCR Forward Reverse AGGATGGTGTTTCAGGGAAAG GAATCATCCTG ACCGGTTCTC 16S rRNA qRT PCR Forward Reverse AGTGATAAACTGGAGGAAGGTGGG CCACGATTACTAGCGATTCCGACT yneM knockout Forward Reverse AAACACACCACACCATAAACGGAGGC A ATAATGCTGGGTGTGTAGGCTGGAGCTG CTTC GGCCGGTTAGGTGAGGGATTATCTCCGT TCATTAGTCATCATTCCGGGGATCCGTC GACC symE knockout Forward Reverse TCACAATCACTATTCCTGGAGAATAGCA GTTATGACTGACGTGTAGGCTGGAGCTG CTTC GCTCCCGGTGGTTAACCGGGAGTAAACG CTGTTACGCGACATTCCGGGGATCCGTC GACC ryhB knockout Forward Reverse AAGTGCGAATGAGAATGATTATTATTGT CTCGCGATCAGGGTGTAGGCTGGAGCTG CTTC C GTGGATAA ATTGAGAACGAAAGATCA AAAAAAAAGCCAG ATTCCGGGGATCCG TCGACC

PAGE 39

39 Figure 2 1. Diagram of the screening procedure for activators and repressors of csrB lacZ fusion . Following DNA library construction, the background strain was transformed with the fragment containing plasmid. Up and down regulation of csrB lacZ phenotype were picked for confirmation with galactosidase assays, re transformed and sent for sequencing to obtain fragment limits. Sequencing and gene fragment mapping Isolate plasmid and re transform background strain with isolated plasmids Confirm original phenotype by liquid B galactosidase assay Re streak picked colonies Pick for dark blue/white phenotype colonies Plate on X gal containing plates Transform background strainwith plasmid containing genomic insert

PAGE 40

40 CHAPTER 3 RESULTS Screening For Novel Factors Activating CsrB s RNA Expression (I) Genes Expressed in Multicopy Plasmids Strongly A ctivate csrB lacZ Transcriptional F usion Our lab has previously developed many other screening studies successfully (Romeo et al., 1993, Suzuki et al., 2006, Vakulskas et al., 2014). Recen tly, a transposon mutagenesis screening was employed to identify factors activating CsrB expression (Vakulskas et al, 2014). Among several genes identified, 2 genes encoding for 2 DEAD box RNA helicases (DeaD and SrmB) were found. DeaD was demonstrated to affect UvrY translation and to modulate the secondary structure of UvrY response regulator. On the other hand, SrmB affects CsrB expression without regulating any of the already known factors affecting CsrB (eg. CsrA, BarA, UvrY). At the same time it has b een shown (Vakulskas et al. , 2014) that SrmB is not affecting the UvrY response regulator phosphorylation levels. Since SrmB is working independent ly of phosphorylation and is not regulating protein levels, it has been reasoned that the mechanism of regula tion might involve a more complex system, and that a connecting factor(s) might be still missing. This study was conceived by the interest this question poses. For this reason, a plasmid screening was designed. Some of the advantages of a plasmid screen in clude the ability to screen for small factors, s uch as sRNAs and small proteins. I t can also identify essential genes. Moreover, plasmid screens allow to one achieve a good coverage of the whole genome. Since the initial interest of this study was to fin d a missing connector in the SrmB and CsrB regulation pathway, a strain containing a csrB lacZ transcriptional fusion with deletion of srmB and deaD genes was employed. A DNA library was constructed by fractionating the whole E. coli genome into small frag ments. The small fragments were ligated to a vector (pBR322 cam r ). The screening strain was transformed with pBR322 cam r containing fragments and plated

PAGE 41

41 into X gal and chloramphenicol containing plates. (As described in Materials and Methods section) From this initial assay, a total of 14,000 clones were screened. From these , a total of 41 clones were picked, restreaked and isolated. Furthermore, in order to ensure that the screening was effective, other additional factors known to be affecting the csrB lac Z fusion were identified (Uv rY, SrmB, DeaD). Moreover, several of the identified genes showed to be r edundant in many of the clones, suggesting that the screen was a least partially saturated. To ensure the plasmid clones were regulating the c srB lacZ fus ion, a quantitative galactosidase assay was performed as described in Material and Methods. From this result, only the clones that showed a fold effect higher than 2 fold were saved. Among these, three plasmid clones containing intact genes cpdA ( cAMP ph osphodiesterase ) and yqiB (protein of unknown function, DUF1249) showed high levels of regulation for the csrB lacZ fusion. In addition, plasmids containing the xanthine transporter ( xanQ ) and guanine deaminase ( guaD ) showed higher than 10 fold regulation of the fusion. Intact genes such as sulfite reductase subunit ( cysJ ) in conjunction with the 6 c arboxy 5, 6, 7 , 8 tetrahydropterin s ynthase ( queD ) were identified to be strongly regulating csrB lacZ fusion with effects of (Table 3 1 and Table 3 2) Twelve o f T he c srB lacZ Activators Clones I nfluence UvrY FLAG L evels In order to determine if the plasmid clones affect the csrB lacZ fusion by altering protein levels of UvrY, western blots analyses were performed for each of the isolated clones. In addition, a kn own positive control and negative control were included. For a positive regulator of UvrY FLAG , a plasmid overexpressing DeaD was used. For a negative control, a plasmid overexpressing SrmB was included. Levels of each of the clones were compared to a pBR32 2cam r (empty vector) and the ratio for each clone was calculated after being corrected by RpoB (loading control). Interestingly, we found many clones positively regulating the levels of

PAGE 42

42 UvrY (Figure 3 1). A plasmid containing intact fryB and fryC was iden tified to positively regulate UvrY leves. Both of these genes have been annotated as members of the Phosphotransferase system (PTS), f ryB as EIIB enzyme for fructose PTS and fryC as the putative EIIC enzyme. A plasmid including intact genes xanQ and guaD and disrupted genes xdhD and ygfQ activated expression of UvrY FLAG by approximately 3 fold. As previously mentioned, xanQ and guaD have been identified to encode for part of the NCS2 (Nucleobase Cation Symport 2) family of transporters, and the ATZ/TRZ fam ily , respectively. It is likely that the effects of any of these genes in this clone might be indirectly mediated in response to a metabolic factor/condition that is caused or altered when either of these genes is overexpressed. Additionally, the clone co ntaining the blue light anti repressor ( bluF ) and the small YcgZ, YmgA, AriR (YmgB) and YmgC connector proteins was also activating UvrY FLAG protein levels with an effect higher than 3 fold. More detailed information of these genes will be covered in the D iscussion section. Interestingly, we also found plasmid clones that were modestly down regulating the levels of UvrY (2.5 fold). These include a plasmid containing mlrA and yohO , which encode a csgD regulator of the MerR family of proteins and a predicted protein of unknown function respectively. It is possible that even though these clones are down regulating UvrY protein levels, they might be also up regulating some other factor not tested in this pro ject and exerting their effect on csrB lacZ in a very c omplex mechanism. In summary, these analyses show that the effects of the clones on csrB lacZ fusion are both dependent and independent on the effects of UvrY. Moreover, it is still not clear how these

PAGE 43

43 genes, when overexpressed, activate UvrY protein level s. More studies on each individual gene is necessary to understand their function. Gene D elet ions from Plasmid Clones Modestly A ffect c srB lacZ Levels in Mid Logarithmic P hase Chromosomal gene deletions corresponding to the intact genes contained in the pl asmids were transduced by P1 vir to the strain background (MG1655 contaning csrB lacZ site) using genes mutations from the Keio collection, when available. When the desired mutant red system were constructed. (Table 2 2) After confirmation of the gene mutations by PCR (data not shown), liquid galactosidase assays were conducted as described in the Methods section. For these assays, a KSB837 strain was used as wild type and a srmB deletion in the KSB837 background were used as controls. (A deletion in srmB decreases the expressi on levels of csrB lacZ ). Since the main focus of this study was to find a connection for srmB and it is already known that srmB is not affecting UvrY protein levels, only those clones shown not to be affecting the response regulator where tested. From thes e assays, single deletions of the identified genes only showed a modest effect (<2 fold) to c srB lacZ transcriptional fusion (Figure 3 2). Interestingly and despite the fact that this screening was designed to identify factors activating CsrB, when single gene deletions of nuoI and nuoH were tested, they showed to modestly increase the levels of CsrB expression, meaning that they might be acting as repressor instead. Both nuoI and nuoH are members of the NADH : ubiquinone oxidoreductase complex. They are en coded in the same operon and compress the subunit I, and H, respectively. For this assay, single deletions of mgrR , cca , plsC could not be tested. These have been listed as essential genes. In addition, tRNA ileX and symR were not tested. Eventhough these have not been listed

PAGE 44

44 as essential in E. coli , mutations of these genes by insertion with a Kanamycin marker failed to give us the expected mutation. The Majority of Plasmid Clones Highly A ctivating c srB lacZ A lso Increase CsrB RNA L evels Since CsrB sRNA l evels are not only dependent on transcription, we tested the RNA levels of CsrB in each plasmid clone on a wild type background containing the CsrB transcriptional fusion (KSB837). For this, all of the purified plasmids were chemically transformed into the WT background. Once transformed, a colony was picked to streak for isolated colonies. A single pure colony was picked and an overnight in liquid LB was started to create a stock strains and isolate and extract RNA. The RNA was extracted as described in Me thods. As previously mentioned, q RT PCR was used to measure the CsrB RNA levels at exponential ph ase and each RNA sample was tested in duplicates. For each of the samples, a mean value was obtained and was compared to the average value of a wild type stra in to calculate the ratio of CsrB RNA. The information of the ratio (CsrB RNA clone/ CsrB RNA WT) was introduced into table and analyzed. (Table 3 2) As suggested by the transcriptional fusion, the plasmid containing the disrupted genes yqiA and nudF and the complete open reading frames of yqiB and cpdA also positively influenced the RNA levels of CsrB. (Table 3 2) While yqiA and yqiB function is still unknown, cpdA has been identified as as cAMP phosphodiesterease and NudF is a member of the ubiquitously distributed NudiX superfamily of hydrolases characterized by the Nudix motif, which is a unique loop helix loop binding motif. (Moreno Bruna et al . , 2001). Studies by Barth et al. (2009) showed that overexpression of cpdA leads to decreased levels of cAM P and to the partial inactivation of CRP (cAMP receptor protein). Moreover, studies by Pannuri and Romeo, unpublished, show that CRP decreases the expression of CsrB

PAGE 45

45 and CsrC sRNA. Accordingly, when CRP is inactivated, the levels of CsrB increases, which i s in agreement with our results in a clone where cpdA is expressed in multicopy. Similarly, a clone comprising the symE and symR genes involved in the toxin antitoxin system of E. coli and a mcrB endonuclease activates both the fusion (7 fold) and the RNA levels of CsrB sRNA (4 fold) independently of UvrY, though more assays are required in order to be able to establish a possible mechanism of action and determine which gene comprised in the clone might be affecting CsrB expression. In addition, effects on csrB lacZ fusion (14 fold) and CsrB RNA levels (7 fold) of the genes xanQ (xanthine permease) and guaD (guanine deaminase) co ntained in the plasmid pCR150 seem to be mediated through the UvrY response regulator, since this clone was positively affecting Uv rY protein levels (3.3 fold). Some of the clones reported to be activating the csrB lacZ fusion and the expression of UvrY in strain KSB837 , did not have an effect on the RNA levels in a wild type background strai n. These differences in the effects to CsrB expression in a strain with deletion of deaD and srmB , compared to a wild type strain could be possibly due to a compensatory e ffect of the helicases DeaD and SrmB , which are present in the wild type strain. It is possible that when the two helicases are present, they compensate for the effects on the expression of CsrB sRNA. Screening For Novel Factors Repressing CsrB sRNA Expres sion (II) Plasmid Screening for R epressors of csrB lacZ F usion In a fashion similar to the screening for activators of csrB lacZ , a screen to identify repressors of CsrB sRNA was developed. The CsrA protein regulates expression of many target mRNAs. At the same time, the two non coding RNAs antagonize CsrA activity. In a negative feedback loop, the small RNAs require CsrA for their transcription, since they are directly activated by the TCS BarA/UvrY. In order to ameliorate the effects of the feedback loop on the

PAGE 46

46 expression of CsrB, the screening strain was changed to a CR1 93. This strain offers the advantage of having the CsrB promoter sequence replaced by a constitutive lac UV 5 promoter. In this way, any mutation affecting the levels of CsrB in the BarA/ U vrY pathway will not have an effect in the expression levels of CsrB sRNA . (Figure 3 3) A total of three sets of screenings were performed. In each set, 50,000 clones were screened. The colonies that met the requirement of our screen (a white phenotype fr om the repression of the csrB lacZ fusion) were picked and re streaked for isolation to confirm the desired phenotype. These colonies were grown in LB medium, the plasmid was purified and sequenced to determine the limits of the cloned fragments. A total o f 55 clones fulfilling the requirements were saved for further analyses. (Table 3 3) One difficulty of the repressor screen was that not ma n y factor s that repress CsrB expression have been identified, as a consequence, only a few controls could be include d in the assay. Amongst the known controls, a plasmid clone including the csrC gene was isolated. Moreover, 5 clones containig mcaS were identified too. In this screening we were able to achieve an e stimated coverage of > 99% coverage of the E. coli genom e. In summary, this screening identified identified 55 clones, with an average of three genes comprised in each clone. These clones are directly or indirectly affecting csrB lacZ expression when ectopically expressed from a multicopy plasmid. Additional st udies are required in order to identify the specific gene responsible for the repression in csrB lacZ fusion and to determine a pathway and mechanism of action. Most of T he Plasmid Clones R epress csrB lacZ Without Alteration of UvrY Protein L evels Since th e expression of CsrB is highly dependent on the BarA/UvrY pathway and it has been determined SrmB helicase is not affecting the expression of the sRNA through alteration of

PAGE 47

47 UvrY protein levels or UvrY phosphorylation state, we also tested the effects of ea ch of the clones identified as repressors of the csrB lacZ fusion. We determined that most of the clones are affecting CsrB independent ly of effects o n UvrY protein levels. Of the 55 clones identified in the repressor screening, 10 of them (18%) showed to be influencing the protein levels of the response regulator, either by increasing the protein concentration (3 clones) or decreasing its levels (7 clones). (Figure 3 4) The plasmids were transformed to a CR1 93 uvrY::uvrY FLAG background. Strains were gr own in LB with antibiotic until mid logarithmic phase and Western blots were performed as described in the Methods to detect the UvrY FLAG protein levels. Among the isolated clones, we identified a plasmid clone that decreased the levels of UvrY by 10 fold. This one included the essential genes rpmC, rplP and rpsC, ribosomal subunit proteins that are essential for growth. RplP encodes for an assembly component with RNA chaperone activity, RpmC is protein L29 and component of the 50S Ribosomal subunit while r psC is protein S3 of the 30S ribosomal subunit and appears to have mRNA helicase activity. A decrease of UvrY protein levels of approximately 3.3 fold was observed in the clone comprising the intact recX gene. RecX is a small protein that interacts with R ecA and inhibits RecA ATPase activity. Overexpression of recX leads to UV sensitivity and it is induced under DNA damage (Stohl , 2003). Simi larly, a decrease of around 2.5 fold was noticed in a yigA overexpression plasmid. YigA is a predicted protein belon ging to a DUF484 family protein . The ygiA gene is located downstream to dapF ( d iaminopimelate epimerase) and upstream of xerC ( t yrosine recombinase) but no association has been made yet. (Figure 3 3) Similar to our first screening, we also identified a per mease protein that activates UvrY protein levels in our second screening. The gene gsiC is encoding for a component for the

PAGE 48

48 Glutathione ABC transport. It is predicted to be located in the inner membrane. Previous overexpression of membrane proteins ( YidC, YedZ, and LepI) in E. coli BL21 caused a reduction in the respiratory chain complexes, down regulation of the tricarboxilic acid cycle (TC A) and induction of the acetate kinase/ phospho transacetylase pathway. (Wagner et al., 2007) Effects of T he Inhibitory Clones in CsrB RNA L evels It is known that CsrB sRNA levels are affected by transcription and by degradation of this RNA by RNAse E, PNPase and a recently discovered factor, CsrD. (Suzuki et al., 2006) With this in mind, we also tested the RNA levels of th e CsrB sRNA by q RT PCR. The repressor plasmid clones were transformed to a wild type background (KSB837), after incubation at 37 ° C, one colony was picked, re streaked for isolation and saved for stock strains and collection of RNA. As previously mentioned RNA was collected at mid exponential phase (OD 600 =0.4). Each sample was done in duplicates, and the mean value was compared to the mean value of the control strain (wild type strain) to calculate ratio and insert into table (Table 3 4) Among the identifie d clones, the strongest inhibitory csrB lacZ effects were identified in clones with genes responsive to stress. For example, one of the plasmids that showed repression of the levels of CsrB RNA superior to 20 fold corresponded to a clone that included gene s gadY , gadX . These genes are part of the acid stress response system. The gene gadY encodes for a small non coding RNA that regulates GadX. The expression of gadX is activated in stationary phase and is dependent on sigma factor, S (Opdyke , Kang , & Stor z, 2004) . The gene gadX encodes for the transcriptional regulator of gadAB . Gad is one of the most important systems for the defense against acid stress in E. coli and comprises GadA and GadB, which are required to catalyze glutamate to aminobutyric acid , a process that consumes an intracellular proton . The system also requires the antiporter GadC that transports glutamate inside the cell to reg enerate its pool. (Homola & Dekker , 1967).

PAGE 49

49 Similarly, another clone repressing CsrB RNA levels and csrB lacZ fus ion with a 20 fold comprises the genes soxR and soxS , which participate in the reponse to oxidative stress. The gene soxR is the transcriptional activator of soxS . SoxR responds to redox cycling elements (that elevate cytosolic superoxide levels) and to ni tric acid. In most enterics, SoxR senses the intracellular redox signals and induces expression of soxS. Once its expression is induced, soxS induces a wide array of genes that co nstitute the soxRS regulon (Li & Demple , 1994). SoxS belongs to the AraC fami ly of transcriptional regulators and possesses two helix turm helix motifs for DNA binding (Griffith & Wolfe , 2002). Additionally, the clone pQ2 showed high (>20 fold) regulation of CsrB RNA levels. This clone comprises the genes ybaM , which belongs to the DUF454 family, the gene mscK , that is a putative mechanosensitive channel protein and has been shown to consistently co purify with the degradosome and the gene acrR , which encodes for the transcriptional repressor of a crAB and is part of the TolC efflux pump family. TolC proteins are involved in the export of diverse compounds that range from large compounds such as hemolysin to other smaller toxic drugs. Because of their biological importance in the physiology of the bacteria, these clones related to stress responses are of high interest for follow up studies. The Csr system has already been correlated to stress responses, such as the relationship between the stringent response and CsrA (Edwards et al., 2011). Further studies of these clones may allow to determine further connection of other relevant stress responses and the Csr system.

PAGE 50

50 Table 3 1 . Gene identities of plasmid clones activating csrB lacZ fusion Clone name Genes Brief Description pCR54 yehU* Stationary phase sensor kinase yohO Memb rane protein of unknowun function mlrA DNA binding transcriptional activator yehW* Putative ABC transporter permease pCR82 eamA* Efflux pump for cysteine and O acetyl L serine ydeE Putative arabinose efflux transporter yneM Expressed protein, me mbrane associated, function unknown mgrR sRNA affecting sensitivity to antimicrobial peptides ydeH* Diguanylate cyclase pCR84 glk* Glucokinase fryB Predicted enzyme IIB component of PTS ypdF Metalloenzyme with aminopeptidase activity fryC* Putat ive fructose like PTS system Enzyme IIC pCR87 ygfK* Iron sulfur flavoprotein ssnA Survival stationary phase ygfM* Putative FAD binding subunit pCR94 hsdS* Specificity factor for DNA methyltransferases symR sRNA destabilizing divergent and overlappi ng symE mRNA symE Toxin like protein of the SOS response mcrB McrBC restriction endonuclease; requires GTP, inhibited by ATP mcrC* McrBC restriction endonuclease pCR95 yraI* Predicted pilus chaperone of unknown function yraJ Predicted outer membra ne export usher protein yraK* FimA homolog of unknown function pCR103 fepD* Ferric enterobactin ABC transporter membrane subunit fepG Ferrienterobactin ABC transporter permease fepC Ferrienterobactin ABC transporter ATPase fepE* Component of th e ferric enterobactin transport system pCR104 gntR* D gluconate transcriptional repressor yhhW Quercetinase activity, in vitro; physiological role unknown yhhX predicted oxidoreductase with NAD(P) binding ryhB sRNA mediating Fur Regulon re sponse yhhY Predicted acetyltransferase yhhZ* Predicted colicin like DNase/tRNase activity pCR110 rpoD* RNA polymerase subunit, sigma 70 ygjF Xanthine DNA glycosylase

PAGE 51

51 Table 3 1. C ontinued Clone name Genes Brief Description ileX Isoleucine tRNA( CAU) 2 yqjH Putative tRNA synthetase ygjI DNA binding transcriptional repressor ygjG Putrescine:2 oxoglutaric acid aminotransferase pCR112 yqiA* Acyl CoA esterase in vitro cpdA cAMP phosphodiesterase yqiB DUF1249 family protein nudF* ADP sugar pyrophosphatase ygjH* Ferric reductase, NADPH dependent pCR115 nuoG* NADH:ubiquinone oxidoreductase subunit G nuoH NADH:ubiquinone oxidoreductase, membrane subunit H nuoI NADH:ubiquinone oxidoreductase, chain I nuoJ NADH:ubiquinone oxidoreductase , membrane subunit J nuoK NADH quinone oxidoreductase subunit K nuoL* NADH quinone oxidoreductase subunit L pCR116 plsY* Probable glycerol 3 phosphate acyltransferase ttdR Transcriptional activator of ttdAB ttdA L tartrate dehydratase, alpha subun it ttdB L tartrate dehydratase, beta subunit ttdT* Tartrate:succinate antiporter pCR121 rpe* D ribulose 5 phosphate 3 epimerase dam DNA adenine methyltransferase damX Cell division protein aroB 3 dehydroquinate synthase pCR143 hyfC* Hydrogenase 4, component C hyfD* Hydrogenase 4, component D pCR145 parC* Topoisomerase IV, subunit A, ATP dependent, type II ygiS* Putative ABC transporter permease pCR150 xdhD* Probable hypoxanthine oxidase xanQ Xanthine:H+ symporter guaD guanine deaminase ygfQ* Guanine/hypoxanthine permease pCR155 hycF* Formate hydrogenlyase complex hycE Hydrogenase 3, large subunit hycD Hydrogenase 3, membrane subunit hycC* Formate hydrogenlyase complex inner membrane protein pCR156 agaB* Putative PTS system N a cetylgalactosamine specific enzyme IIB agaC N acetylgalactosamine specific enzyme IIC agaD N acetylgalactosamine specific enzyme IID agaI Predicted galactosamine 6 phosphate isomerase

PAGE 52

52 Table 3 1. C ontinued Clone name Genes Brief Description yraH* FimA homolog of unknown function pCR157 gcvA* Glycine cleavage A ygbJ* Uncharacterized oxidoreductase pCR160 bluR* Repressor of blue light responsive genes bluF blue light responsive regulator of BluR ycgZ Connector protein for RcsB regulation, Blu RF regulon ymgB Connector protein for RcsB regulation, BluRF regulon ymgA Connector protein for RcsB regulation, BluRF regulon ymgC* BluRF(YcgEF) and RpoS regulon pCR161 glnE* Protein adenylyltransferase ygiF Inorganic triphosphatase ygiM Predic ted signal transduction protein cca tRNA nucleotidyltransferase bacA* Undecaprenyl pyrophosphate phosphatase BacA pCR162 yqiA* Acyl CoA esterase in vitro cpdA cAMP phosphodiesterase yqiB DUF1249 family protein nudF* ADP sugar pyrophosphatase pC R163 yqiA* Acyl CoA esterase in vitro cpdA cAMP phosphodiesterase yqiB DUF1249 family protein nudF* ADP sugar pyrophosphatase pCR169 yfcI* Transposase_31 family protein of unknown function yfcH Predicted NAD dependent nucleotide sugar epimerase folX dihydroneopterin triphosphate 2' epimerase monomer yfcG* GSH dependent disulfide bond oxidoreductase pCR166 qseC* Quorum sensing two component sensor kinase ygiZ* Inner membrane protein of unknown function pCR164 ygiQ* SAM superfamily protein of unknown function ftsP cell division protein required during stress conditions plsC 1 Acyl n glycerol 3 phosphate acyltransferase parC* Partial cobalamin biosynthesis pCR36 cobU* Partial cobalamin biosynthesis cobS Cobalamin synthase cobT* Phosp horibosyltransferase activity pCR33 bcr* Major facilitator superfamily yejG* Function unknown pCR4 bcr multidrug efflux transporter pCR47 bssR* Repressor of biofilm formation by indole transport regulation

PAGE 53

53 Table 3 1 . Continued Clone name Genes Brief Description yliI* Soluble aldose sugar dehydrogenase pCR38 mppA* Periplasmic binding component of the murein tripeptide ABC transporter ynaI Mechanosensitive channel protein pCR69 bicA* Efflux transporter for bicyclomycin rsuA* 16S rRNA pseudourid ine(516) synthase cpdA cAMP phosphodiesterase yqiB DUF1249 family protein nudF* ADP sugar pyrophosphatase pCR148 cysI* Sulfite reductase [NADPH] hemoprotein beta componen cysJ sulfite reductase, flavoprotein subunit queD queuosine biosynthesis ygcN* Predicted oxidoreductase with FAD/NAD(P) binding domain pCR154 yggC* Predicted PanK family P loop kinase, function unknown yggD* Predicted transcriptional regulator, function unknown yggF fructose 1,6 bisphosphatase yggP predicted dehydrogen ase cmtA* Subunit of mannitol PTS permease pCR77 eamA* Efflux pump for cysteine and O acetyl L serine pCR167 plsB* Glycerol 3 phosphate acyltransferase dusA* Subunit of mannitol PTS permease pCR107 fryC* Putative fructose like PTS system Enzyme II C fryB Putative fructose like PTS system Enzyme IIB glk Glucokinase yfeO* Predicted proton ion exchange transporter of function unknown pCR49 eamA* Efflux pump for cysteine and O acetyl L serine ydeE Putative arabinose efflux transporter yneM E xpressed protein, membrane associated, function unknown mgrR sRNA affecting sensitivity to antimicrobial peptides ydeH* Zinc sensing diguanylate cyclase pCR74 ptrA* Protease III * Denotes a truncated gene.

PAGE 54

54 Figure 3 1 . Effects of plasmid clones activating csrB lacZ in UvrY FLAG levels. Western Blots of each individual plasmid on UvrY FLAG (A, B and C). Cells were grown to mid logarithmic phase (OD 600 =0.4), collected and sonicated. Samples were run on SDS polyacrilamide gels and transferred to a PVDF membrane. Membranes were incubated with monoclonal Anti Flag antibody and anti RpoB as loading control. Panel D shows the legend for each lane in the gel .

PAGE 55

55 Figure 3 1. Continued

PAGE 56

56 Figure 3 2 . Single gene mutations modestly affect CsrB l evels at the transcriptional level. Each single gene deletion was tested in a wild type background with a csrB lacZ transcriptional fusion (KSB837). Each strain was grown in LB pH 7.4 at 37 °C. Cell were collected at mid logarithmic phase and Galactosidase assays was carried on as described in methods. Each experiment was done at least twice and the graph shows the mean value with the Standard Deviation (SD).

PAGE 57

57 Table 3 2 . Effects of plasmid clones activating c srB lacZ in UvrY FLAG and CsrB RNA levels Clone name Genes csrB lacZ fold effects Fold effects on UvrY FLAG RNA levels clone/RNA levels WT pCR54 yehU* 2.8 0.4 1.3 yohO mlrA yehW* pCR82 eamA* 4.7 1.7 0.04 ydeE yneM mgrR ydeH* pCR84 glk* 5.5 2.9 ND f ryB ypdF fryC* pCR87 ygfK* 5 1.3 0.4 ssnA ygfM* pCR94 hsdS* 7 1.3 4 symR symE mcrB mcrC* pCR95 yraI* 6 1.5 0.3 yraJ yraK* pCR103 fepD* 3.5 1.5 ND fepG fepC fepE* pCR104 gntR* 3.8 1.4 2.5 yhhW yhhX ryhB yhhY yhhZ* pCR110 rpoD* 6.7 1.6 0.6 ygjF ileX yqjH

PAGE 58

58 Table 3 2 . Continued Clone name Genes csrB lacZ fold effects Fold effects on UvrY FLAG RNA levels clone/RNA levels WT ygjI yqjJ ygj G pCR112 yqiA* 4.4 1.6 ND cpdA yqiB nudF* ygjH* pCR115 nuoG* 3.7 1.5 ND nuoH nuoI nuoJ nuoK nuoL* pCR116 plsY* 5.7 1.6 1.3 ttdR ttdA ttdB ttdT* pCR121 rpe* 5.6 2.8 0.05 dam damX aroB pCR143 hyfC* 8.3 2.4 ND hyfD* pCR145 parC* 9.6 1.6 ND ygiS* pCR150 xdhD* 14 3.3 7.1 xanQ guaD ygfQ* pCR155 hycF* 11.2 1.4 ND hycE hycD hycC* pCR156 agaB* 9.2 1.4 1.9

PAGE 59

59 Table 3 2.Continued Clone n ame Genes csrB lacZ fold effects Fold effects on UvrY FLAG RNA levels clone/RNA levels WT agaC agaD agaI yraH pCR157 gcvA* 9.4 1.3 ND ygbJ* pCR160 bluR* 10.3 3.4 0.2 bluF ycgZ ymgB ymgA ymgC* pCR161 glnE* 10.4 2.4 0.1 ygiF ygiM cca bacA* pCR162 yqiA* 15.2 1.3 ND cpdA yqiB nudF* pCR163 yqiA* 20 1.6 22.4 cpdA yqiB nudF* pCR169 yfcI* 8.4 2.3 2.5 yfcH folX yfcG* pCR166 qseC* 10.8 1.4 3.6 ygiZ* pCR164 ygiQ* 10.8 0.4 0.4 ftsP plsC parC* pCR36 cobU* 15 0.8 2.7 cobS cobT* pCR33 bcr* 2.3 1.1 ND

PAGE 60

60 Table 3 2. Continued Clone name Genes csrB lacZ fold effects Fold effects on UvrY FLAG RNA levels clone/RNA levels WT pCR4 bcr 2.1 0.8 N D pCR47 bssR* 3.6 0.7 ND yliI* pCR38 mppA* 3 0.9 ND ynaI pCR69 bicA* 4.1 0.4 ND rsuA* tdcE* pCR111 rpoD* 6 1.4 ND patA yhjH* pCR112 yqiA* 4.4 1.6 ND cpdA yqiB nudF* pCR148 cysI* 13 1.4 3.4 cysJ que D ygcN* pCR154 yggC* 11.4 1.1 0.6 yggD* yggF yggP cmtA* pCR77 eamA* 6.8 1.3 ND pCR167 plsB* 11.6 1.9 ND dusA* pCR107 fryC* 4.5 1.9 ND fryB glk yfeO* pCR49 eamA* 6.4 1.1 ND ydeE yneM mgrR ydeH* pCR74 ptrA* 2.1 0.4 ND

PAGE 61

61 Table 3 3 . Gene identities from clone plasmids repressing csrB lacZ fusion Clone name Genes Brief Description pA1 adhP* Alcohol/acetaldehyde dehydrogenase yddM Predicted transcriptional regulator fdnI* Formate dehy drogenase N pA5 potI* Putrescine ABC transporter permease ybjO DUF2593 family, function unknown rlmC dTDP 4 dehydrorhamnose 3,5 epimerase artJ Arginine ABC transporter periplasmic binding protein artM* Arginine ABC transporter permease pA7 recE* RecET recombinase, exonuclease VIII recT RecET recombinase, annealing protein ralR Restriction alleviation gene in Rac prophage rcbA Double strand break reduction protein ydaQ Putative exisionase intR* Integrase gene pA8 adeP* Adenine permease chrR Chromate reductase yieE Phosphopantetheinyl transferase superfamily of unknown function yidZ* Nitric oxide resistance, LysR family transcriptional regulator pA10 ydiZ* Function unknown yniA Fructosamine kinase family protein yniB Predicted i nner membrane protein of unknown function yniC* sugar phosphatase of haloacid dehalogenase (HAD)superfamily pA13 glmU* Enzyme with uridylyltransferase and acetyltransferase activity atpC ATP synthase subunit epsilon atpD ATP synthase subunit beta atpG* ATP synthase subunit gamma pB1 dcm* DNA cytosine methyltransferase yedJ Predicted HD superfamily phosphohydrolase of unknown function yedR Inner membrane protein of unknown function rseX sRNA regulating ompA and ompC translation, with Hfq gs iD* Glutathione ABC transporter permease pB3 rcsD* histidine protein kinase rcsB Positive regulatory gene for capsule synthesis rcsC* Negative regulatory gene for capsule synthesis pC1 dsrB* Function unknown rcsA Posit ive regulatory gene for capsul e (colanic acid) synthesis

PAGE 62

62 Table 3 3 . Continued Clone name Genes Brief Description fliR Flagellin export apparatus fliQ Flagellin export apparatus fliP* Flagellin export apparatus pC3 ruvA* Holliday junction recognition factor yobI Expressed prote in of unknown function yebB DUF830 family protein ruvC RuvC endonuclease yebC Expressed protein of unknown function aspS* Aspartate -tRNA ligase pC5 insF4* IS3 transposase B insE4 IS3 transposase A ymdE' Pseudogene ycdU Predicted inner memb rane protein of unknown function serX Serine tRNA ghrA* Glyoxylate/hydroxypyruvate reductase A pC6 rusA* Endonuclease ylcG Expressed protein of unknown function quuD Q like transcriptional regulator nmpC'* Pseudogene related to OM porin pD1 yce D* DUF177 family protein rpmF 50S ribosomal subunit protein L32 plsX Probable phosphate acyltransferase fabH* Beta ketoacyl ACP synthase III pD3 miaA* Dimethylallyl diphosphate:tRNA dimethylallyltransferase hfq Global regulator of sRNA function hflX* GTPase, stimulated by 50S subunit binding pD4 mhpB* 3 (2,3 Dihydroxyphenyl)propionate dioxygenase mhpC Dihydroxyphenylpropionate ring fission product hydrolase mhpD* 2 hydroxypentadienoate hydratase pE1 sgcR* Putative sgc cluster transcriptiona l regulator sgcE Predicted pentose 5 phosphate 3 epimerase sgcA Predicted phosphotransferase enzyme IIA ryjB Novel sRNA sgcQ Putative gene in sgc gene cluste sgcC* Predicted PTS system EIIC permease component pE2 pka* L ysine acetyltransferase pssA Phosphatidylserine synthase yfiM* Uncharacterized protein related to motility and phage growth

PAGE 63

63 Table 3 3 . Continued Clone name Genes Brief Description flhB Flagellin export apparatus cheZ CheY P phosphatase pE3 flhA* Flagellar export pore pr otein cheY Response regulator for chemotactic signal transduction cheB Chemotaxis MCP protein glutamate methylesterase cheR* Chemotaxis MCP protein methyltransferase pE4 intR* Integrase gene ydaQ Putative exisionase rcbA Double strand break redu ction protein ralR Restriction alleviation recT* RecET homologous recombinase pF5 ghoS* Antitoxin of GhoTS toxin antitoxin pair ghoT Toxin of GhoTS toxin antitoxin pair lysU Lysine tRNA ligase dtpC* Dipeptide and tripeptide permease C pG1 pka* Protein lysine acetyltransferase pssA Phosphatidylserine synthase yfiM Uncharacterized protein related to motility and phage growth kgtP* Alpha ketoglutarate permease pH3 pgk* Phosphoglycerate kinase epd Erythrose 4 P dehydrogenase yggC Predicte d PanK family P loop kinase of unknown function yggD Predicted transcriptional regulator of unknown function yggF Fructose 1,6 bisphosphatase activity yggP* Predicted Zn binding dehydrogenase of unknown function pI3 alaS* Alanine -tRNA ligase rec X Blocks RecA filament extension; inhibitor of RecA ATPas recA* Multifunctional DNA recombination and repair protein pJ5 yaeH* Member of UPF0325 family of unknown function yaeI Predicted Phosphodiesterase of unknown function dapD 2,3,4,5 tetrahydrop yridine 2 carboxylate N succinyltransferase glnD* Bifunctional uridylyltransferase/uridylyl removing enzyme pL1 gadW* Transcriptional activator of gadA and gadBC gadY sRNA regulator of gadAB transcriptional activator GadX mRNA gadX Transcriptional a ctivator for gadA and gadBC gadA* Glutamate decarboxylase A

PAGE 64

64 Table 3 3 . Continued Clone name Genes Brief Description pL2 abgB* B subunit of p Aminobenzoyl glutamate hydrolase abgA p Aminobenzoyl glutamate hydrolase abgR Predicted regulator of the abgABT operon mcaS Motility and biofilm regulator smrA* DNA endonuclease pL4 fimA* Fimbrin type 1 rhaM* L rhamnose mutarotase pN1 insL1* IS186 transposase dnaK Hsp70 molecular chaperone, dnaJ* DnaK co chaperone; DNA binding protein pN2 yggF* Fructose 1,6 bisphosphatase activity yggE Protein of DUF541 family related to oxidative stress defense gshB* Glutathione synthase pO3 recO* Conjugational recombination and repair pdxJ Pyridoxine 5' phosphate synthase prpD* Pyridoxine 5' phosphate (PNP) synthase pO4 yjcC* Predicted membrane anchored cyclic di GMP phosphodiesterase soxS Global transcription regulator for superoxide response soxR Redox sensitive transcriptional activator for soxS ryjA Novel sRNA ghxP* Guanine/hypoxanthine pe rmease pP2 pyrG* CTP synthase ygcG Member of UPF0603 family of unknown function eno* Enolase pQ2 priC* Primosomal component ybaN I nner membrane protein mscK Mechanosensitive channel protein acrR Transcriptional repressor for acrAB acrA* AcrAB TolC multidrug efflux pum pQ3 yjjX* Non canonical purine NTP phosphatase ytjC Predicted phosphatase of unknown function rob oriC binding transcriptional activator creA* Predicted periplasmic protein of unknown function pR2 uspf* Nucleotide binding protein. Class II universal stress protein family ttcC Pseudogene, prophage Rac integration site ynaE* Cold shock gene of unknown function pS2 mnmE* GTPase required for tRNA U34 modification

PAGE 65

65 Table 3 3. Continued Clone name Genes Brief Description srmB* ATP dependent RNA helicase pS3 adeP* Adenine permease chrR Chromate reductase mdtL* Multidrug resistance efflux protein pV3 nhaR* Positive regulator of nhaA insB1 IS1 transposase B insA* IS1 transposase A pX1 rpoB* Beta subunit RNA polym erase rpoC* Beta' subunit of RNA polymerase pX6 trmN* tRNA1 methyltransferase srmB* ATP dependent RNA helicase pY1 def* Peptide deformylase fmt Methionyl tRNA formyltransferase rsmB* 6S rRNA methyltransferase pZ3 tyrS* Tyrosine -tRNA ligase pd xH Pyridoxine/pyridoxamine phosphate oxidase mlic Inhibitor of c type lysozyme anmK* Anhydro N acetylmuramic acid kinase pAA3 dapF* Diaminopimelate epimerase yigA DUF484 family protein of unkown function xerC Tyrosine recombinase XerCD pBB2 sgcR* Putative sgc cluster transcriptional regulator sgcE Predicted pentose 5 phosphate 3 epimerase sgcA Predicted phosphotransferase enzyme IIA ryjB Novel sRNA of unknown function sgcQ* Putative gene of sgccluster of unknown function pBB5 ygcN* Predic ted oxidoreductase ygcO Ferredoxin like protein ygcP Predicted antiterminator regulatory protein ygcQ Putative electron transfer flavoprotein ygcR Cell death gene of unknown function ygcS* Uncharacterized member of the major facilitator superfami ly pCC3 modE* Repressor of the modABC operon acrZ Stabilizing factor for acrABTolC efflux pump modA* Molybdate ABC transporter pCC4 gsiB* Glutathione ABC transporter periplasmic binding protein gsiC Glutathione ABC transporter permease gsiD* Gl utathione ABC transporter permease pCC5 dacB* D alanine carboxypeptidase

PAGE 66

66 Table 3 3. Continued Clone name Genes Brief Description obgE DNA binding GTPase yhbE* EamA family predicted transporter fadB* Alpha subunit of the multifunctional fatty aci d oxidation complex pDD2 rpsQ* 30S ribosomal subunit protein S17 rpmC 50S ribosomal subunit protein L29 rplP 50S ribosomal subunit protein L16 rpsC 30S ribosomal subunit protein S3 rplV* 50S ribosomal subunit protein L22 pDD5 der* GTPase associa ted with the large subunit of the ribosome bamB* Beta propeller lipoprotein in OM biogenesis pEE2 entE* Enterochelin synthase entB Isochorismatase entA 2,3 Dihydro 2,3 dihydroxybenzoate dehydrogenase entH* Enterobactin synthesis pEE3 rplA* 50S ri bosomal subunit protein L1 rplJ 50S ribosomal subunit protein L10 rplL 50S ribosomal subunit protein L7/L12 rpoB* Beta subunit RNA polymerase pEE6 mnmE* GTPase required for tRNA U34 modification ascB* Phospho beta glucosidase * Denotes a truncate d gene.

PAGE 67

67 Figure 3 3. Regulatory circuitry of the Csr system depicting feedback loop. CsrA is antagonized by CsrB and CsrC (not shown). CsrB requires CsrA for its transcription activation through the TCS BarA/UvrY. CsrA indirecrly represses CsrD and indi rectly represses its own activity by stabilizing CsrB/CsrC transcripts. Modification to the wild type strain is depicted in red. The csrB promoter was modified to a constitutive lac UV5 promoter, and effects of the TCS on CsrB RNA levels were eliminated.

PAGE 68

68 Figure 3 4. Effects of individual repressor plasmid clones on UvrY FLAG protein levels. Western Blot (A, B, C and D). Cells were grown to mid logarithmic phase (OD 600 =0.4), collected and sonicated. Samples were run on SDS polyacrilamide gels and transferr ed to a PVDF membrane. Membranes were incubated with monoclonal Anti Flag antibody and anti RpoB as loading control. Panel E shows the legend for the position of each clone in the gel.

PAGE 69

69 Figure 3 4. Continued

PAGE 70

70 Ta ble 3 4 . Effects of plasmid clones rep ressing c srB lacZ in UvrY FLAG and CsrB RNA levels Clone name Genes Effects on UvrY FLAG RNA levels clone/RNA levels WT pA1 adhP* 0.8 0.68 yddM fdnI* pA5 potI* 0.8 1.22 ybjO rlmC artJ artM* pA7 recE* 1.0 0.60 recT ralR rc bA ydaQ intR* pA8 adeP* 0.8 0.60 chrR yieE yidZ* pA10 ydiZ* 0.9 729.78 yniA yniB yniC* pA13 glmU* 0.7 0.32 atpC atpD atpG* pB1 dcm* 0.7 0.37 yedJ yedR rseX gsiD* pB3 rcsD* rcsB 0.8 0.46 rcsC* pC1 dsrB* 0.8 0.87 rcsA fliR fliQ

PAGE 71

71 Table 3 4 . Continued Clone name Genes Effects on UvrY FLAG RNA levels clone/RNA levels WT fliP* pC3 ruvA* 0.9 0.24 yobI yebB ruvC yebC aspS* pC5 insF4* 0.6 0.19 insE4 ymdE' ycdU serX ghrA* pC6 rusA* 0.6 0.30 ylcG quuD nmpC'* pD1 yceD* 1.0 0.83 rpmF plsX fabH* pD3 miaA* 0.6 1.06 hfq hflX* pD4 mhpB* 1.4 1.48 mhpC mhpD* pE1 sgcR* 1.0 1.03 sgcE sgcA ryjB sgcQ sgcC* pE2 pka* 1.1 0.79 pssA yfiM* pE3 flhA* 1.0 0.36

PAGE 72

72 Table 3 4 . Continued Clone name Genes Effects on UvrY FLAG RNA levels clone/RNA levels WT flhB cheZ cheY cheB cheR* pE4 intR* 2.0 0.23 ydaQ r cbA ralR recT* pF5 ghoS* 0.6 0.94 ghoT lysU dtpC* pG1 pka* 2.5 5.31 pssA yfiM kgtP* pH3 pgk* 1.0 0.32 epd yggC yggD yggF yggP* pI3 alaS* 0.3 0.76 recX recA* pJ5 yaeH* 0.9 0.00 yaeI d apD glnD* pL1 gadW* 0.6 0.06 gadY gadX gadA* pL2 abgB* 0.9 0.37 abgA abgR mcaS

PAGE 73

73 Table 3 4 . Continued Clone name Genes Effects on UvrY FLAG RNA levels clone/RNA levels WT smrA* pL4 fimA* 0.7 0.16 fimI fimC fimD * pM3 yjcC* 1.1 0.30 rhaM* pN1 insL1* 0.6 0.22 dnaK dnaJ* pN2 yggF* 0.6 0.55 yggE gshB* pO3 recO* 0.6 1.77 pdxJ prpD* pO4 yjcC* 1.6 0.04 soxS soxR ryjA ghxP* pP2 pyrG* 0.7 0.14 ygcG eno* pQ2 priC * 0.9 0.02 ybaN mscK acrR acrA* pQ3 yjjX* 0.6 0.42 ytjC rob creA* pR2 uspf* 1 1.58 ttcC ynaE* pS2 mnmE* 0.9 0.10 srmB*

PAGE 74

74 Table 3 4 . Continued Clone name Genes Effects on UvrY FLAG RNA levels clone/RNA levels WT p S3 adeP* 1.4 0.16 chrR yieE yidZ mdtL* pV3 nhaR* 0.6 0.33 insB1 insA* pX1 rpoB* 1.1 0.24 rpoC* pX6 trmN* 0.5 0.45 srmB* pY1 def* 0.5 0.81 fmt rsmB* pZ3 tyrS* 0.5 0.18 pdxH mlic anmK* pAA3 dapF* 0.4 0.43 yigA xerC pBB2 sgcR* 0.5 0.12 sgcE sgcA ryjB sgcQ* pBB5 ygcN* 0.5 0.28 ygcO ygcP ygcQ ygcR ygcS* pCC3 modE* 1.2 0.51 acrZ modA* pCC4 gsiB* 2.3 0.55 gsiC

PAGE 75

75 Table 3 4 . Continued Clone name Gen es Effects on UvrY FLAG RNA levels clone/RNA levels WT gsiD* pCC5 dacB* 1.1 0.19 obgE yhbE* pDD1 fadA* 1.2 2.49 fadB* pDD2 rpsQ* 0.1 0.16 rpmC rplP rpsC rplV* pDD5 der* 1.1 0.09 bamB* pEE2 entE* 0.8 0.18 entB e ntA entH* pEE3 rplA* 1.8 0.55 rplJ rplL rpoB* pEE6 mnmE* 1.8 0.18 ascB* * Denotes a truncated gene.

PAGE 76

76 CHAPTER 4 DISCUSSION Bacterial gene regulation is an extremely intricate and organized process in which many players interact. O ne of the most intricate and widespread systems involved in regulation of gene expression is the Csr system. The Csr system plays a global and central role in the post transcriptional regulation of a wide array of bacterial functions (Romeo , 1998, Romeo et al., 2013, Luchetti Miganeh et al., 2008). Because of its global nature, the Csr system has been, since the report of its discovery in 1993, one of the most widely studied systems among bacteria. (Romeo et al., 1998, Martinez & Vadyvaloo, 2014, Sabnis et al., 1995 , Romeo et al., 2013 ). Despite our knowledge of the system, there are st ill several aspects of it that need to be unraveled. This study focuses on the identification of unknown factors that are regulating CsrB sRNA expression. It has been shown th at CsrB sRNA plays a major role in the regulation of CsrA by antagonizing its activity in E. coli (Liu et al., 1997). Even though a few factors have already been mentioned to be affecting the expression of CsrB, their mechanisms of action is still unclear in most cases. Therefore, we suspected that many more factors may be yet unidentified in this complex system. Following this reasoning, a genetic screening was implemented to identify the factors regulating CsrB sRNA, the major RNA antagonizing the activit y of the CsrA protein. Genetic screens have been in many cases the means of discovering intermediates genes of metabolic systems and deciphering in terconnec ting pathways (Shuman & Silhav y , 2003). Genetic screens offer the advantage of detecting a wide rang e of activities. It can detect upregulation as well as down regulation of gene activity. Since the original goal of this study was to find a connection between the SrmB helicase and its effect on CsrB expression, and taking into consideration that this kin d of element might consist of a protein, a regulatory RNA or possibly a transcription

PAGE 77

77 factor, we reasoned that an efficient experimental approach in order to identify the potential element of interest was a plasmid screening. Plasmid screenings are advanta geous for the identification of small genes and also all others essential genes related to bacterial growth. Small RNAs are poor targets of mutagenesis because of their smaller size, with the majority of them comprising transcripts of just 70 to 250 nucleo tides (Eddy , 2001). Moreover, many of the sRNAs are only expressed under specialized conditions (Eddy , 2001). Essential genes, being critical for bacterial survival, are also problematic targets for transposon mutagenesis screening, making the plasmid over expression screen a more efficient approach for their discovery. The plasmid screening facilitated the identification of many genes that are up regulating the csrB lacZ fusion. The genes identitified from this screening included a wide variety of families with different functions that varied from carbon metabolism to energy production and conversion to transcriptional regulators. A high upregulation of csrB lacZ transcriptional fusion was observed in the plasmid clone containing the complete coding sequen ce of yqiB and cpdA . The gene yqiB encodes for a protein of the DUF1249 family. The gene cpdA encodes for cAMP phosphodiesterase. When cpdA is overexpressed, lower levels of cAMP are detected in the cell. (Barth et al., 2009). cAMP is bound by CRP (cAMP re ceptor protein). When bound to cAMP, CRP acts as a regulatory protein by binding to specific sequences of the promoter of diverse genes and modu lates their transcription (Won, Lee, Lee & Lee , 2009). Studies by Pannuri and Romeo (unpublished) have shown tha t CRP represses the expression and RNA levels of CsrB and CsrC sRNAs. In consequence, a mutation of crp increases the levels of CsrB and CsrB in early logarithmic phase. It is likely that when cpdA is expressed in a multicopy plasmid the levels of CsrB are increased due to decrease in the levels of cAMP and inactivation of CRP protein.

PAGE 78

78 Similar effects on CsrB expression (increase in the csrB lacZ fusion and increased CsrB RNA levels) were observed in a plasmid containing the genes involved in cobalamine syn thesis and in a plasmid co ntaining the essential gene plsC . Nevertheless, in order to determine or establish a potential mechanism more experiments are required to be able to determine which gene or genes are affecting the csrB lacZ fusion. For this object ive, subcloning of small regions of the identified plamids could prove to be an efficient experimental approach, especially in cases in which essential genes make it really difficult to test a knockout product. In order to identify the specific genes affe cting the csrB lacZ fusion independently of UvrY, we tested the chromosomal single gene mutations from the identified clones. Surprisingly, the single deletions only showed a very modest ef fect on the fusion (less than 2 fold) or no effect at all. Even t h o ugh it is possible that since the screening was conducted using a low medium likely that in some instances gene redundancy may cause a single mutation not t o affect the expression of the csrB lacZ and that a double or even triple mutant might be necessary. Moreover, it is well known that from the complete E. coli genome, many of the functions of gene products have not been determined exper imentally (Maillet et al., 2007) It is also possible that certain plasmid s contain totally unknown gene s that have not been annotated or recognized. Another plausible explanation of why none of our knockouts showed a high effect on CsrB regulation might be that many of them might have not been grown under the specific conditions needed for the genes to be expressed. As previously mentioned, the initial objective of this study was to find a connecting element between SrmB helicase and CsrB sRNA, and to be able to propose a m echanistic pathway. Nevertheless, we recognize the relevance of identifying other novel factors to

PAGE 79

79 understand the Csr system. Through the screening experiments of this project we have identified genes that are affect the UvrY response regulator at the prot ein levels. Despite its role in the control of carbon metabolism through the Csr system and its role on biofilm formation, motility and virulence in uropathogenic E. coli ( Mitra , Palaniyandi , Herren , Zhu & Mukhopadhyay , 2013) few factors that regulate thi s system are known. As for now, the only factor known to regulate the expression of UvrY is sdiA , a mem ber of the LuxR family (Suzuki et al., 2002) In this study we have identified a clone containing a bluF gene and four connector proteins for RcsB regulat ion (ycgZ, ymgA, ymgB, ymgC) that increases the levels of UvrY FLAG . BluF protein has been described as a cold inducible and blue light dependent protein involved in the regulation of repressor the merR like protein BluR (Tschwori, Linderberg , & Hengge, 200 9), which regulates biofilm formation. Although many additional studies are needed in order to elucidate how these proteins are affecting the protein levels in UvrY, the physiological relevance between the connection of blue light and the regulation of thi s two component system could be of high interest. In addition, in both sets of screening, different gene s encoding for permeases have been identified. Although it is probable that these effects could be secondary to variations in the concentration of dif ferent metabolites within the cell, or indirect effects, as long as our understanding of the genes effects in CsrB and UvrY regulation develops, we may be able to establish more connections and even establish possible functions of genes whose function rema in unknown. Interestingly, our repressor screening identified a plasmid (containing genes ydiZ, yniA, yniB and yniC) that is repressing the csrB lacZ transcriptional fusion but at the same time, it is increasing the RNA levels of CsrB. Since the levels of CsrB are not only mediated through

PAGE 80

80 effects in transcription, but also effects in its turnover, we are inclined to hypothesize that this plasmid is playing an important factor in stabilizing the CsrB transcript. CsrB expression and CsrB RNA levels can be r eg ulated in opposite f ashion via the regulatory feedback loop. The CsrB RNA levels depend on the synthesis and turnover of the sRNA. CsrB RNA antagonize s CsrA activity, and CsrA modulates the synthesis of CsrB by indirect effects on the BarAUvrY TCS. CsrA also stabilizes CsrB transcripts by indirectly decreasing CsrD and preventing degradation of CsrB. It could be possible that the increased levels of CsrB RNA is result of CsrB transcript stabilization mediated by the CsrD protein, which is recognized as a especifity factor involved in the degradation of csrB and csrC (Suzuki et al., 2006). The elevated CsrB RNA levels could also be mediated by the interaction with any other factor that is part of the CsrB degration process, e.g. RNAse E or PNPase. Although the initial steps to follow would be to identify the specific gene or genes of the clone that are involved in regulation, the possible steps to follow could be to test the effects of this gene (or genes) on the other known factors that affect CsrB (such as CsrA or BarA). Moreover, analysis of the decay rate of CsrB as well as studies to determine the effects on the bulk levels of RNAse E should ensue. We also found that plasmids containing genes such as yaeI (encodes for a phosphodiesterase of function unkn own) and dapD ( encoding for a succinyltransferase) as well as a plamid with genes yba M (unknown function), acrR (transcriptional repressor of acrAB) and mscK ( encoing for a channel preotein) show striking effects on the CsrB RNA levels. It is possible that any of these genes may be acting in conjunction with other factors involved in the degradation of CsrB. This might be the case for MscK, which despite being predicted to be a lipoprotein, it has been reported that it consistently co purifies with the degr adosome (Regonesi et al., 2006).

PAGE 81

81 Although this study is missing mechanistic pathways, it sheds light on many factors that could be potentially interest and important for the regulation of the Csr system. Furthermore, many of the genes identified are still of unknown function and do not possess a known homolog. This study might lea d to future work to determine the function of many of these genes. The subsequent analyses of these genes should contribute into the understanding of many processes in bacteria; t herefore this study has l aid the framework for future studies connecting global regulatory networks to the control of CsrA activity .

PAGE 82

82 LIST OF REFERENCES Altier, C., Suyemoto, M., Ruiz, A., Burnham, K., & Maurer, R. (2000) Characterization of two novel re gulatory genes affecting Salmonella invasion gene expression. Molecular Microbiology , 35, 635 646. Mori H. (2006) Construction of Escherichia coli K 12 in frame, single gene knockout muta nts: the Keio collection. Molecular System Biology , 2, 2006 0008. Baker, C., Morozov, I ., Suzuki, K ., Romeo, T ., & Babitzke, P . (2002). CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli. Molecular Microbiology , 44, 1599 1610. Barth, E., Gora, K., Gebendorfer, K., Settele, F., Jakob, U., & Winter, J. (2009). Interplay of cellular cAMP levels, {sigma}S activity and oxidative stress resistance in Escherichia coli. Microbiology , 155, 1680 1689. Bateman, A., Coin, L., Durbin, R., Finn, R.D., Hollich, V., Griffiths Jones, S ., dy, S. (2004) The Pfam protein families database. Nucleic Acids Research 32 : 138 141. Brantl, S. (2007). Regulatory mechanisms employed by cis encoded antisense RNAs. Current Opinion in Microbiology , 10, 102 109. Brencic, A., & Lory, S. (2009). Determinati on of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA. Molecular microbiology , 7 2, 612 632. Burrowes, E., Abb as, A ., O'Neill, A ., Adams, C ., & O'Gara, F . (2005). Characterisation of the regulatory RNA RsmB from Pseudomonas aeruginosa PAO1. Research in Microbiology , 156, 7 16. Byrd , A., & Raney, K. (2012). Superfamily 2 helicases. Front Biosciences , 17, 2070 2088. Charollais, J., Pflieger, D., Vinh, J., Dreyfus M., & Iost, I. (2003). The DEAD box RNA helicase SrmB is involved in the assembly of 50S ribosomal subunits in Escherichia c oli. Molecular Microbiology , 48, 1253 1265. Corbell, N., & Loper, J. (1995) A global regulator of secondary metabolite production in Pseudomonas fluorescens Pf 5. Journal of Bacteriology , 177,6230 6236. Cordin, O., Banroques, J., Tanner N., & Linder, P . (2 006). The DEAD box protein family of RNA helicases. Gene , 367, 17 37. Datsenko, K., & Wanner, B (2000). One step inactivation of chromosomal genes in Escherichia coli K 12 using PCR products. Proceedings of the National Academy of Sciences of the United St ates of America , 97, 6640 6645.

PAGE 83

83 Dubey, A., Baker, C., Romeo, T., & Babitzke, P. (2005). RNA sequence and secondary structure participate in high affinity CsrA RNA interaction. RNA , 11, 1579 1587 Eddy, S. (2001). Non coding rna genes and the modern rna world . Nature Review Genetics , 2, 919 929. Edwards, A., Patterson Fortin, L., Vakulskas, C. , Mercante, J. , Potrykus, K ., Vinella D ., & Romeo, T. (2011). Circuitry linking the Csr and stri ngent response global regulatory systems. Molecular Microbiology , 80, 1561 1580. Fairman Williams, M., Guenther, U., & Jankowski, E. (2010). SF1 and SF2 helicases: family matters. Current Opinion in Sructural Biology , 20, 313 324. Faner, M., & Feig, A. (201 3). Identifying and characterizing Hfq RNA interactions. Methods , 63, 144 159. Faucher, S., & Shuman, H. (2011). Small Regulatory RNA and Legionella pneumophila. Frontiers in Microbiology , 2, 98 Figueroa Bossi, N., Schwartz, A ., Guillemardet, B ., D'Heygère, F ., Bossi L ., & Boudvillain, M . (2014). RNA remodeling by bacterial global regulator CsrA promotes Rho dependent transcription termination. Genes and Development , 28, 1239 1245. Fort une, D., Suyemoto, M., & Altier, C. (2006). Identification of CsrC and characterization of its role in epithelial cell invasion in Salmonella enterica serovar Typhimurium. Infection and Immunity , 74, 331 339. Freundlich, M., Ramani, N., Mathew, E., Sirko, A., & Tsui, P. (1992). The role of integration host factor in gene expression in Escherichia coli. Molecular Microbiology, 6, 2557 2563. Garst, A., Edwards, A., & Batey R. (2011). Riboswitches: structures and mechanisms. Cold Spring Harbor perspectives in biology . 3, 6. Gonzalez Chavez, R., Alvarez, A., Romeo, T., & Georgellis, D. (2010). The Physiological Stim ulus for the BarA Sensor Kinase . Journal of Bacteriology . 192, 2009 2012 Goodier, R., & Ahmer, B. (2001). SirA orthologs affect both motility and vi rulence. Journal of Bateriology , 183, 2249 2258. Goosen, N., & van de Putte, P. (1995). The regulation of transcription initiation by integration host factor. Molecular Microbiology 16, 1 7. Griffith, K., & Wolf, R. (2002). A comprehensive alanine scanning mutagenesis of the Escherichia coli transcriptional activator SoxS: identifying amino acids important for DNA binding and transcription activation. Journal of Molecular Biology , 322, 237 257.

PAGE 84

84 Gudapaty, S., Suzuki, K ., Wang, X., Babitzke, P ., & Romeo, T . (2001). Regulatory interactions of Csr components: the RNA binding protein CsrA activates csrB transcription in Escherichia coli. Journal of Bacteriology , 183, 6017 6027. Gu tierrez, P., Li, Y., Osborne, M.J., Pomerantseva, E., Liu, Q., & Gehring, K. (2005). Solution structure of the carbon storage regulator protein CsrA from Escherichia coli. Journal of Bacteriology , 187, 496 501. Hammer, B., Tateda, E., & Swanson, M. (2002). A two component regulator induces the transmission phenotype of stationary phase Legionella pneumophila. Molecular Microbiology , 44(1), 107 118. He, Y., Wang, C., Zhou, L., Song, H., Dow, J., & Zhang, L. (2006). Dual Signaling Functions of the Hybrid Sens or Kinase RpfC of Xanthomonas campestris Involve Either Phosphorelay or Receiver Domain Protein Interaction. Journal of Biological Chemistry , 281, 33414 33421. Heurlier, K., Williams, F ., Heeb, S ., Dormond, C ., Pessi, G ., Singer, D .,... Haas, D. (2004). Positive control of swarming, rhamnolipid synthesis, and lipase production by the posttranscriptional RsmA/RsmZ system in Pseudomonas aeruginosa PAO1. Journal of Bacteriology , 186, 2936 2945. Hilbert, M. K arrow, A., & Klostermeier, D. (2009). The mechanism of ATP dependent RNA unwinding by DEAD box proteins. Biological chemistry , 390, 1237 1250. Hoe, C Raabe, C. , Rozhdestvensky, T. , & Tang, T. (2013). Bacterial sRNAs: regulation in stress. Internal Journal of Medical Microbiolo gy , 303, 217 29. Homola, A., & Dekker, E. (1967) Decarboxylation of gamma hydroxyglutamate by glutamate decarboxylase of Escherichia coli (ATCC 11246). Biochemistry , 6, 2626 2634. Iost, I., & Dreyfus, M. (1994). mRNAs can be stabilized by DEAD box proteins . Nature, 372, 193 196. Iost, I., & Dreyfus, M. (2006). DEAD box RNA helicases in Escherichia coli. Nucleic Acids Research, 34, 4189 4197. Ishige, K., Nagasawa, S., Tokishita, S., & Mizuno, T. (1994). A novel device of bacterial signal transducers. The EMB O Journal , 13, 5195 5202. Jackson, D., Suzuki, K., Oakford, L., Simecka, J., Hart, M., & Romeo, T. (2002). Biofilm formation and dispersal under the influence of the global regulator CsrA of Escherichia coli. Journal of Bacteriology , 184, 290 301. Jankows ki, A., Guenther, U., & Jankowski, E. (2011). The RNA helicase database. Nucleic Acids Research , 39, 338 341.

PAGE 85

85 Jonas, K., & Melefors, O. (2009). The Escherichia coli CsrB and CsrC small RNAs are strongly induced during growth in nutrient poor medium. FEMS M icrobiology Letters , 297, 80 86. Jonas, K., Edwards, A., Simm, R., Romeo, T., Römling, U., & Melefors O. (2008). The RNA binding protein CsrA controls cyclic di GMP metabolism by directly regulating the expression of GGDEF proteins. Molecular Microbiology , 70, 236 257. Jørgensen, M., Thomason, M., Havelund, J., Valentin Hansen, P., & Storz, G. (2013). Dual function of the McaS small RNA in controlling biofilm formation. Genes and Development , 27, 1132 1145. Kaberdin, V., & Blassi, U. (2013). Bacterial helic ases in post transcriptional control. Biochimica et Byophisica Acta , 1829, 878 883. Khemici, V., Poljak, L., Toesca, I., & Carpousis, A. (2005). Evidence in vivo that the DEAD box RNA helicase RhlB facilitates the degradation of ribosome free mRNA by RNas e E. Proceedings of the National Academy of Sciences of the United States of America , 102, 6913 6918. Krin, E., Derzelle, S., Bedard, K., Adib (2008). Regulatory role of UvrY in adaptation of Photorhabdu s luminescens growth inside the insect. Environmental Microbiology, 10, 1118 1134. Lawhon, S., Frye, J., Suyemoto, M., Porwollik, S., McClelland, M., & Altier, C. (2003). Global regulation by CsrA in Salmonella typhimurium. Molecular Microbiology , 48, 1633 1645. Li, Z., & Demple, B. (1994). SoxS, an activator of superoxide stress genes in Escherichia coli. Purification and interaction with DNA. The Journal of Biological Chemistry , 269, 18371 18377. Linder, P. (1989). Birth of the DEAD box. Nature , 337, 121 122. Linder, P., & Jankowski, E. (2011). From unwinding to clamping the DEAD box RNA helicase family. Nature reviews. Molecular cell biology , 12, 505 516. The RNA molecu le CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli. Journal of Biological Chemistry , 272, 17502 17510. Luchetti Miganeh, C., Burrowes, E., Baysse, C., & Ermel, G. (2008). The post transcriptional regulator CsrA plays a central role in the adaptation of bacterial pathogens to different stages of infection in animal hosts. Microbiology , 154, 16 29. Magnusson, L., Farewell, A., & Nyström, T . (2005) ppGpp: a global regulator in Escherichia coli. Trends in Microbiology , 13, 236 242.

PAGE 86

86 From the genome seq uence to the proteome and back: evaluation of E. coli genome annotation with a 2 D gel based proteomics approach. Proteomics , 7, 1097 1106. Marden, J., Diaz, M. , Walton, W. , G ode, C. , Betts, L ., Urbano wski, M. , & Wolfgang, M., (2013). An unusual CsrA family member operates in series with RsmA to amplify posttranscriptional responses in Pseudomonas aeruginosa. Proceedings of the National Academy of Sciences of the United States of America , 110, 15055 15 060. Martinez, L., Martínez Flores I ., Salgado, H ., Fernández Mora, M ., Medina Rivera, A ., Puente, J. , Collado Vides, J ., & Bustamante, V . (2014). In silico identification and experimen tal characterization of regulatory elements controlling the expression of the Salmonella csrB and csrC genes. Journal of Bacteriology , 196, 325 336. Mercante, J., Edwards, A ., Dubey, A. , Babitzke, P ., & Romeo, T . (2009). Molecular geometry of CsrA (RsmA) binding to RNA and its implications for regulated expressi on. Journal of Molecular Biology, 392, 511 528. Mercante, J., Suzuki, K., Cheng, X., Babitzke, P., & Romeo T. (2006). Comprehensive alanine scanning mutagenesis of Escherichia coli CsrA defines two subdomains of critical functional importance. Journal of B iological Chemistry , 281, 31832 31842. Mitra, A., Palaniyandi, S., Herren, C., Zhu, X., & Mukhopadhyay, S. (2013). Pleiotropic roles of uvrY on biofilm formation, motility and virulence in uropathogenic Escherichia coli CFT073. PLoS One , 8, e55492. Mizuno, T. ( 1997). Compilation of all genes encoding two component phosphotransfer signal transducers in the genome of Escherichia coli. DNA Research , 4, 161 168. Mondragón, V., Franco, B., Jonas, K., Suzuki, K., Romeo T, Melefors, O., & Georgellis, D. (2006). pH Dependent Activation of the BarA UvrY Two Component System in Escherichia coli . Journal of Bacteriology , 188, 8303 8306 Moolenar, G., van Sluis, C., Backenfort, C., & van de Putte, P. (1987) Regulation of the Escherichia coli excision repair gene uvrC. O verlap between the uvrC structural gene and the region coding for a 24 kD protein. Nucleic Acids Research . 15, 4273 4289 Nagasawa , S , Tokishita, S., Aiba, H., & Mizuno, T . (1992). A novel sensor regulator protein that belongs to the family of signal transd uction proteins involved in adaptive responses in Escherichia coli . Mol ecular Microbiology , 6 , 799 807 Opdyke, J., Kang, J., & Storz G. (2004). GadY, a small RNA regulator of acid response genes in Escherichia coli. Journal of Bacteriology, 186, 6698 67 05. Pannuri, A., Yakhnin, H ., Vakulskas, C. , Edwards, A. , Babitzke, P ., & Romeo, T . (2012). Translational repression of NhaR, a novel pathway for multi tier regulation of biofilm circuitry by CsrA. Journal of Bacteriology , 194, 79 89.

PAGE 87

87 Parkinson, J. (1993) Signal transduction schemes of bacteria. Cell, 73, 857 871. Patterson Fortin, L., Vakulskas, C., Yakhnin, H., Babitzke, P., & Romeo, T. (2013). Dual posttranscriptional regulation via a cofactor responsive mRNA leader. Journal of Molecular Biology , 425, 3662 3677. Paul, B., Barker, M., Ross, W., Schneider, D., Webb, C., Foster, J., & Gourse, R. ( 2004) DksA: A Critical Component of the Transcription Initiation Machinery that Potentiates the Regulation of rRNA Promoters by ppGpp and the Initiating NTP. Cell , 118, 311 322. Peil, L., Virumae, K., & Remme, J. (2008). Ribosome assembly in Escherichia co li strains lacking the RNA helicase DeaD/CsdA or DbpA. The FEBS Journal , 275, 3772 3782. Pernestig, A., Melefors, O., & Georgellis, D. (2001) Identification of UvrY as the Cognate Response Regulator for the BarA Sensor Kinase in Escherichia coli. The jour nal of biological chemistry , 276, 225 231. Py, B., Higgins, C., Krisch, H., & Carpousis, A. (1996). A DEAD box RNA helicase in the Escherichia coli RNA degradosome . Nature , 381, 169 172. Ray, B., Lawson, T., Kramer, J., Cladaras, M., Grifo, J., Abramson, R ATP dependent unwinding of messenger RNA structure by eukaryotic initiation factors. Journal Biological Chemistry, 260, 7651 7658. Regonesi, M., Del Favero, M., Basilico, F., Briani, F., Benazzi, L., Tortora, P., Mauri, P., & Dehò, G. (2006). Analysis of the Escherichia coli RNA degradosome composition by a proteomic approach. Biochimie , 88, 151 161 & Bläsi U. (2010). Requirement of the CsdA DEAD box helicase for low temperature riboregulation of rp oS mRNA. RNA Biology , 7, 796 802. Rife, C., I. (2005). Crystal structure of the global regulatory protein CsrA from Pseudomonas putida at 2.05 A resolution reveals a new fold . Proteins , 61, 449 453. Romeo, T., Gong, M., Liu, M., & Brun Zinkernagel, A. (1993). Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surfac e properties. Journal of Bacteriology , 175,4744 4755. Romeo, T. (1998). Global regulation by the small RNA binding protein CsrA and the non coding RNA molecule CsrB. Molecular Microbiology , 29, 1321 1330. Romeo, T., Black, J., & Preiss, J. (1990) Genetic r egulation of glycogen biosynthesis in Escherichia coli: in vivo effects of the catabolite repression and stringent response systems in glg gene expression. Current Microbiology , 21, 131 137.

PAGE 88

88 Romeo, T., Vakulskas, C., & Babitzke, P. (2013). Post transcripti onal regulation on a global scale: form and function of Csr/Rsm systems. Environmental Microbiology , 15, 313 324. Sabnis, N., Yang, H., & Romeo, T. (1995). Pleiotropic regulation of central carbohydrate metabolism in Escherichia coli via the gene csrA. Jou rnal of Biological Chemistry , 270, 29096 29104. Shuman, H., & Silhavy, T. (2003). The art and design of genetic screens: Escherichia coli. Nature Reviews Genetics 4 , 419 431. Silverman, E., Edwalds Gilbert, G., & Lin, R. (2003). DExD/H box proteins and the ir partners: helping RNA helicases unwind. Gene , 312, 1 16. Simm, R., Morr, M., Kader, A., Nimtz, M. & Römling, U. (2004). GGDEF and EAL domains inversely regulate cyclic di GMP levels and transition from sessility to motility. Molecular Microbiology , 53, 1123 1134. Singleton, M., Dillingham, M., & Wigley, D. (2007). Structure and mechanism of helicases and nucleic acid translocases. Annual review of biochemistry , 76, 23 50. Sonnleitner, E., & Haas, D. (2011). Small RNAs as regulators of primary and second ary metabolism in Pseudomonas species. Applied Microbiology and Biotechnology , 91, 63 79. Sonnleitner, E., Napetschnig, J., Afonyushkin, T., Ecker, K., Vecerek, B., Moll, I., & Bläsi, U. (2004). Functional effects of variants of the RNA chaperone Hfq. Bioc hemical and biophysical research communications , 323, 1017 1023. Sorger Domenigg, T,, Sonnleitner, E., Kaberdin, V., & Bläsi, U. (2007). Distinct and overlapping binding sites of Pseudomonas aeruginosa Hfq and RsmA proteins on the non coding RNA RsmY. Bio chemical and Biophysical Research Communications , 352, 769 773. Steimer, L., & Klostermeier, D.(2012). RNA helicases in infection and disease. RNA Biology , 9, 751 771. Stock, J., Surette, M., Levit, M. & Park, P. (1995). Two component signal transduction s ystems: structure function relationships and mechanisms of catalysis in Two component signal transduction. eds Hoch J. A., Silhavy T. J. (ASM Press, Washington, D.C), p 25 51. Stohl, E. (2003). Escherichia coli RecX inhibits RecA recombinase and coprotease activities in vitro and in vivo. Th e Journal of Biochemical Chemistry , 278, 2278 2285. Suzuki, K., Babitzke, P., Kushner, S., & Romeo, T. (2006). Identification of a novel regulatory protein (CsrD) that targets the global regulatory RNAs CsrB and CsrC for degradation by RNase E. Genes and Development , 20, 2605 2617.

PAGE 89

89 Suzuki, K., Wang, X., Weilbacher, T., Pernestig, A., Melefors, O., Georgellis, D., ...Romeo, T (2002). Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. Journal o f Bacteriology , 184, 5130 5140. Theissen, B., Karow, A., Köhler, J., Gubaev, A., & Klostermeier D. (2008). Cooperative binding of ATP and RNA induces a closed conformation in a DEAD box RNA helicase. Proceedings of the National Academy of Sciences of the U nited States of America , 105, 548 553. Tomenius, H., Pernestig, A., Jonas, K., Georgellis, D., Möllby, R., Normark, S., & Melefors, O. (2006) The Escherichia coli BarA UvrY two component system is a virulence determinant in the urinary tract. BMC Microbiol ogy , 10, 6 27. Tschwori, N., Lindenberg, S., & Hengge, R. (2012). Molecular function and potential evolution of the biofilm modulating blue light signalling pathway of Escherichia coli. Molecular Microbiology , 85, 893 906. Tsu, C., Kossen, K., & Uhlenbeck, O. (2001). The Escherichia coli DEAD protein DbpA recognizes a small RNA hairpin in 23S rRNA. RNA , 7, 702 709. Vakulskas, C., Pannuri, A ., Cortés Selva, D ., Zere, T. , Ahmer, B. , Babitzke, P ., & Romeo, T . (2014). Global effects of the DEAD box RNA helicase DeaD (CsdA) on gene expression over a broad range of temperatures. Molecular microbiology , 92, 945 958. Valverde, C., Heeb, S., Keel, C., & Haas, D. (2003). RsmY, a small regulatory RNA, is required in concert with RsmZ for GacA dependent expression of biocontrol traits in Pseudomonas fluorescens CHA0. Molecular Microbiology , 50, 1 361 1379. Wagner, S. (2007). Consequences of membrane protein overexpression in Escherichia coli. Molecular and cellular proteomics , 6, 1527 1550. Wei, B., Brun Zinkernagel, A., Simecka. J. , Prüss. B. , Babitzke P ., & Romeo, T . (2001). Positive regulation of motility and flhDC expression by the RNA binding protein CsrA of Escherichia coli. Molecular Microbiology , 40, 245 56. Weilbacher, T., Suzuki, K., Dubey, A., Wang, X., Gudapaty, S., (2003). A novel sRNA component of the carbon storage regulatory system of Escherichia coli. Molecular Microbiology , 48, 657 670. White, D., Hart, M., & Romeo, T. (1996). Phylogenetic distribution of the global regulatory gene csrA a mong eubacteria. Gene ,182, 221 223. Wolfe, A. (2005). The acetate switch. Microbiology and Molecular Biology Review , 69 , 12 50. Won, H., Lee, Y., Lee, S. & Lee, B. (2009). Structural overview on the allosteric activation of cyclic AMP receptor protein. Bio chemica et Biophysica acta, 1794, 1299 1308.

PAGE 90

90 Yakhnin, H., Baker, C., Berezin, I., Evangelista, M., Rassin, A., Romeo, T., & Babitzke, P. (2011). CsrA represses translation of sdiA, which encodes the N acylhomoserine L lactone receptor of Escherichia coli, by binding exclusively within the coding region of sdiA mRNA. Journal of Bacteriology , 1 93, 6162 6170. Yakhnin, H., Pandit, P., Petty, T., Baker, C., Romeo, T., & Babitzke, P. (2007). CsrA of Bacillus subtilis regulates translation initiation of the gene encoding the flagellin protein (hag) by blocking ribosome binding. Molecular Microbiology , 64, 1605 1620. Zhang, J., & Normark, S. ( 1996). Induction of gene expression in Escherichia coli after pilus mediated adherence. Science , 273, 1234 1236. Zilsel, J. , Ma, P., & Beatty, J. (1992). Derivation of a mathematical expression useful for the construction of complete genomic libraries. Gene , 120, 89 92.

PAGE 91

91 BIOGRAPHICAL SKETCH Diana Margarita Cortés Selva was born and raised in Leon, Nicaragua. She graduated from Pureza de Maria High School. She attended her undergraduate at Universidad Nacional Autonoma de Nicaragua, Campus Leon. In her last year of college she attended a short Academic Exchange Program at Utrecht Universiteit. After graduation, she applied to the degree at the University of Florida. After graduation, she continued her doctoral studies at Purdu e University in West Lafayette, Indiana.