Citation
Diagnostic and Disease Management Strategies for Bacterial Spot and Bacterial Wilt of Tomato

Material Information

Title:
Diagnostic and Disease Management Strategies for Bacterial Spot and Bacterial Wilt of Tomato
Creator:
Strayer, Amanda L
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (112 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
PARET,MATHEWS
Committee Co-Chair:
DUFAULT,NICHOLAS S
Committee Members:
JONES,JEFFREY B
OLSON,STEPHEN M
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Diseases ( jstor )
DNA ( jstor )
In vitro fertilization ( jstor )
Pathogens ( jstor )
Peppers ( jstor )
Polymerase chain reaction ( jstor )
Soil science ( jstor )
Species ( jstor )
Tomatoes ( jstor )
Xanthomonas ( jstor )
Plant Pathology -- Dissertations, Academic -- UF
bacterial -- spot -- tomato -- wilt
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Plant Pathology thesis, M.S.

Notes

Abstract:
The aim of this project was to evaluate new diagnostic and disease management strategies for bacterial spot and bacterial wilt of tomato. Bacterial spot of tomato is caused by four species of Xanthomonas; current identification methods do not allow for the rapid and simultaneous detection of all four species. To improve the identification of the four pathogens, a multiplex qPCR assay was developed based on the hrpB2 gene, which is required for pathogenicity. The optimized and validated assay is an improvement over current techniques because it is fast, reliable, and highly specific. In addition to identifying bacterial spot, managing the disease is difficult due to the emergence of copper tolerant strains in Florida. A silver-based nanomaterial (Ag-dsDNA-GO) was evaluated as an alternative to the ineffective applications of copper. At low concentrations, this composite showed high antibacterial activity in vitro and significantly reduced bacterial spot severity when compared to copper-mancozeb. Ag-dsDNA-GO could be used in tomato transplant production as a potential alternative to copper-mancozeb. Currently, most bacterial wilt management strategies are largely ineffective. We assessed soil applications of three different formulations of the oxidizer peracetic acid to manage bacterial wilt. All formulations had immense antibacterial activity in vitro and showed promise in micro-soil experiments. However, it was difficult to apply via drip system and was unable to reduce bacterial wilt incidence in the field. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2014.
Local:
Adviser: PARET,MATHEWS.
Local:
Co-adviser: DUFAULT,NICHOLAS S.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-02-28
Statement of Responsibility:
by Amanda L Strayer.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Strayer, Amanda L. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
2/28/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

DIAGNOSTIC AND DISEASE MANAGEMENT STRATEGIES FOR BACTERIAL SPOT AND BACTERIAL WILT OF TOMATO By AMANDA LYNNE STRAYER A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2 014

PAGE 2

© 2014 Amanda Lynne Strayer

PAGE 3

To my family for their unconditional love and support

PAGE 4

4 ACKNOWLEDGMENTS I would like to take this opportunity to thank my advisor, Dr. Mathews L. Pare t, and my co advisor, Dr. Jeffre y B. Jones, for their guidance, creative input, and support throughout my degree program. It was a great experience and I look forward to working with them during my Ph D. program. I would also like to thank my committee members, Drs. Nicholas S. Dufault and Steve M. Olson, for their constructive criticism and support throughout my research and writing process. I would also like to express my gratitude to the other wonderful people that have helped me along the way . I would like to thank Dr. Ismail soy and Dr. ab group fo r producing the silver nanomaterials that were a critical component to my research. I also need to thank Dr. Ayyamperumal Jeyaprakash , Debra Jones, Dr. Xiaoan Sun, and everyone in the plant pathology department at the Division of Plant Industry for their help and guidance through the development of my qPCR assay for b acterial spot of tomato. In addition, I would like to express my appre ciation for Jerry Minsavage advice and help in testing my qPCR . I w ould also like to thank Sujan Timilsina for providing s ome of the hrpB sequences used in this study and his assistance along the way . Furthermore, I am also grateful for Laura Ritchie and Sanju Kunwar help and work they put in to make my field trial possible . I would also like to take this time to show my appreciation for my fiancé, parents, brother, f amily , and friends who have helped me through out this project by providing continuous encouragement, love, and support. I would like to especially recognize my mot her who has always supported and believed in me , but is no longer with us.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ........................... 7 LIST OF FIGURES ................................ ................................ ................................ ......................... 8 ABSTRACT ................................ ................................ ................................ ................................ ... 10 C H A P T E R 1 LITERATURE REVIEW ................................ ................................ ................................ ....... 12 Introduction ................................ ................................ ................................ ............................. 12 Bacterial Spot of Tomato ................................ ................................ ................................ ........ 13 History ................................ ................................ ................................ ............................. 13 Symptoms ................................ ................................ ................................ ........................ 15 Epidemiology ................................ ................................ ................................ .................. 16 Disease Management ................................ ................................ ................................ ....... 17 Identification Techniques ................................ ................................ ................................ 22 Bacterial Wilt of Tomato ................................ ................................ ................................ ........ 2 6 History ................................ ................................ ................................ ............................. 26 Symptoms ................................ ................................ ................................ ........................ 28 Epidemiology ................................ ................................ ................................ .................. 29 Disease management ................................ ................................ ................................ ....... 31 Hypotheses and Objectives ................................ ................................ ................................ ..... 35 2 MULTIPLEX QPCR ASSAY FOR DETECTING THE FOUR CAUSAL AGENTS OF BACTERIAL SPOT OF TOMATO ................................ ................................ ....................... 36 Introduction ................................ ................................ ................................ ............................. 36 Materials and Methods ................................ ................................ ................................ ........... 40 Isolation and Storage of Bacterial Strains ................................ ................................ ....... 40 Bacterial DNA Extraction from Pure Cultures and Infected Leaf Tissue ....................... 40 PCR Assay, Sequencing and Phylogenetic Analysis ................................ ...................... 41 qPCR Probe and Primer Design ................................ ................................ ...................... 42 Multiplex qPCR Assay Development and Optimization ................................ ................. 42 Results ................................ ................................ ................................ ................................ ..... 43 HrpB2 PCR, Sequencing, and Phylogenetic Analy sis ................................ .................... 43 qPCR Probe and Primer Design ................................ ................................ ...................... 44 Multiplex qPCR Assay Development, Optimization, and Validation ............................. 45 Evaluation of the Two Group Specific Probes for X. vesicatoria ................................ ... 49 Discussion ................................ ................................ ................................ ............................... 50

PAGE 6

6 3 A SILVER BASED NANOMATERIAL FOR THE MANAGEMENT OF BACTERIAL SPOT OF TOMATO CAUSED BY XANTHOMONAS PERFORANS .......... 65 Introduction ................................ ................................ ................................ ............................. 65 Materials and Methods ................................ ................................ ................................ ........... 69 Bacterial Strains and Storage ................................ ................................ ........................... 69 Synthesis of DNA ................................ ................................ ................................ ............ 69 Synthesis of Ag dsDNA GO ................................ ................................ ........................... 69 Instrumentation and Characterization ................................ ................................ .............. 70 In Vitro Assays ................................ ................................ ................................ ................ 70 Greenhouse Experiments ................................ ................................ ................................ . 71 Leaf Sample Preparation for SEM ................................ ................................ .................. 72 Statistics ................................ ................................ ................................ ........................... 73 Results ................................ ................................ ................................ ................................ ..... 73 The Effect of Ag dsDNA GO on the Growth of X. perforans In Vitro .......................... 73 The Effect of Ag dsDNA GO on Bacterial Spot Disease Severity under Greenhouse Conditions ................................ ................................ ................................ 74 SEM Analysis ................................ ................................ ................................ .................. 75 Discussion ................................ ................................ ................................ ............................... 75 4 PERACETIC ACID FOR THE MANAGEMENT OF BACTERIAL WILT OF TOMATO CAUSED BY RALSTONIA SOLANACEARUM ................................ .................. 83 Introduction ................................ ................................ ................................ ............................. 83 Materials and Methods ................................ ................................ ................................ ........... 86 Bacterial Strain and Storage ................................ ................................ ............................ 86 In Vitro Assays ................................ ................................ ................................ ................ 86 Micro soil Experiments ................................ ................................ ................................ ... 87 Field Trial ................................ ................................ ................................ ........................ 88 Statistics ................................ ................................ ................................ ........................... 89 Results ................................ ................................ ................................ ................................ ..... 89 The Effect of Peracetic Acid on the Growth of R. solanacearum and Its Stability Overtime In Vitro ................................ ................................ ................................ ......... 89 The Effect of Peracetic Acid on R. solanacearum Populations in the Soil ..................... 90 The Effect of Peracetic Acid on Bacterial Wilt Incidence in Susceptible and Grafted Resistant Tomato Seedlings ................................ ................................ ......................... 91 Discussion ................................ ................................ ................................ ............................... 91 5 SUMMARY AND CONCLUSIONS ................................ ................................ ................... 100 LIST OF REFERENCES ................................ ................................ ................................ ............. 103 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 112

PAGE 7

7 LIST OF TABLES Table page 2 1 Bacterial strains used in this study for the phylogenetic analysis, validation of the multiplex qPCR assay, or both ................................ ................................ ........................... 55 2 2 qPCR probes and primers used in this study ................................ ................................ ..... 56 2 3 Multiplex qPCR results for DNA extracted from infected plant tissue ............................. 57

PAGE 8

8 LIST OF FIGURES Figure page 2 1 Condensed maximum likelihood phylogenetic tree with bootstrap values based on the hrpB2 . ................................ ................................ ................................ ........................... 58 2 2 FAM graphs representing the optimization process of the X. euvesicatoria and X. perforans specific probes and their corresponding primers using DNA extracted from pure cultures. ................................ ................................ ................................ ............. 59 2 3 FAM and TET graphs representing the observed increase in spec ificity when the X . euvesicatoria and X . perforans specific probes and their corresponding primers were put into the same master mix and the DNA was extracted from pure cultures ......... 60 2 4 FAM graphs representing the optimization of the X. gardneri and X. vesicatoria specific probes and their corresponding primers at the 800 nM concentration using DNA extracted from pure cultures ................................ ................................ ..................... 61 2 5 qPCR graph outputs showing amplified DNA from pure cultures representing the four causal agents of bacterial spot using the optimized multiplex qPCR assay master ................................ ..................... 62 2 6 DNA extracted from infected peppe r and tomato tissue detected by the multiplex qPCR assay using DNA from pure cultures of ea ch species as positive controls ............. 63 2 7 The observed FAM graphs for the group specific X. vesicatoria probes amplifying DNA extracted from pure cultures from both groups of X. vesicatoria . ........................... 64 3 1 In vitro results of Ag dsDNA (Blue=15 min, Red=1 hr, Green=4 hr, and Purple=24 hr) ................................ ................. 79 3 2 Disease severity of bacterial spot of tomato under greenhouse conditions represented as AUDPC. ................................ ................................ ................................ ......................... 80 3 3 Photograph of how Ag dsDNA GO deposits and appears on the leaf surface. ................. 81 3 4 SEM images showing the deposition of 500 ppm concentration of Ag dsDNA GO on the surface of Bonnie Best tomato leaves (A D) ................................ ............................... 82 4 1 The effect of diffe rent peracetic acid (PAA) formulations on R. growth over time (blue=15 min, red=1 hr, green=4 hr, and purple=24 hr ) ....................... 96 4 2 The stability of peracetic acid (PAA) alone or in combination with various concentrations of EDTA and potassium silicate measured in parts per million (ppm) at time zero, 15 mi n, 1 hr, 4 hr, 24 hr, and 72 hr ................................ ............................... 97

PAGE 9

9 4 3 The effect of one application of standard peracetic acid (AN 77V2), AN 77V2 18/18, AN 77V2 10/25 , EDTA, potassium silicate, and sterile tap water on the R. solanacearum population in the soil expressed in log CFU/g of soil ................................ 98 4 4 The effect of one (1x) versus two (2x) applications of peracetic acid (AN 77V2) at various concentrations (1.8, 3.6, 7.2, and 10.8 g/L) and sterile tap water on the R. solanacearum population in the soil expressed in log CFU/g of soil ................................ 98 4 5 The effect of applying peracetic acid mixed with 18 % of EDTA and potassium silicate (AN 77V2 18/18) on bacterial wilt inci dence in a susceptible tomato variety, BHN602, and BHN602 grafted onto a resistant rootstock ................................ ................ 99

PAGE 10

10 Abstract of Dissertation Presented to the Graduate School of t he University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science DIAGNOSTIC AND DISEASE MANAGEMENT STRATEGIES FOR BACTERIAL SPOT AND BACTERIAL WILT OF TOMATO By Amanda Lynne Strayer August 2014 Chair: Mathews L. Paret Major: Plant Pathology The aim of this project was to evaluate new diagnostic and disease management strategies for bacterial spot and bacterial wilt of tomato. Bacterial spot of tomato is caused by four species of Xanthomonas ; current identification methods do not allow for the rapid and simultaneous detection of all four species . To improve the identification of the four pathogens, a multiplex qPCR assay was developed based on the hrpB2 gene, which is required for pathogenicity. The optimized and validated assay is an improveme nt over current techniques because it is fast, reliable, and highly specific. In addition to identifying bacterial spot, managing the disease is difficult due to t he emergence of copper tolerant strains in F lorida. A silver based nanomaterial (Ag dsDNA GO) was evaluated as an alternative to the ineffective applications of copper. At low concentrations, this composite showed high antibacterial activity in vitro and s ignificantly reduced bacterial spot severity when compared to copper mancozeb . Ag dsDNA GO could be used in tomato transplant production as a potential alternative to copper mancozeb. Currently, most bacterial wilt management strategies are largely ineffec tive. We assessed soil application s of three different formulations of the oxidizer peracetic acid to ma nage bacterial wilt. All formulations had immense antibacterial activity in vitro and showed promise in micro -

PAGE 11

11 soil experiments. However, i t was difficul t to apply via drip system and was unable to reduce bacterial wilt incidence in the field.

PAGE 12

12 CHAPTER 1 LITERATURE REVIEW Introduction Bacterial spot caused by Xanthomonas spp . and bacterial wilt caused by Ralstonia solanacearum are two of the most detrimen tal diseases of tomato (Ritchie 2000 ; Champoiseau et al. 2009). Bacterial spot is caused by four species of Xanthomonas (Jones et al. 2004). The disease occurs worldwide and is estimated to cause yield losses of up to 50% (Ritchie 2000 ; Vallad et al. 2010) . Disease results in leaf and fruit lesions, defoliation, and yield loss of marketable fruit (Louws et al. 2001). As of 2006, X. perforans is the dominant species in Florida tomato fields and all of the strains are copper tolerant. Regrettably, finding al ternative control measures to copper based bactericides for bacterial spot has been difficu lt (Vallad et al. 2010). Additionally, successful bacterial wilt management strategies have been difficult to find or implement. Bacterial wilt affects many plant species worldwide and disease severity can vary according to climate, cropping practices, soil type, and geog raphic location (Thoquet et al. 1996). Bacterial wilt may result in stunted or completely wilted plants , which results in poor fruit quality and pla nt death . This disease can significantly impact crop yield and can result in a complete loss of commercial tomato crops under favorable disease conditions (Momol et al. 2005 ; Mt 2010). In 2013, Florida harvested 34 , 0 00 total acres of fre sh tomatoes making it the lea ding fresh market tomato producer in the United States (USDA 2014). Therefore, it is critical to find effective methods to control both of these disease s of tomato and to create an efficient identification method for the four causal agents of bac terial spot.

PAGE 13

13 Bacterial Spot of Tomato History Bacterial spot of tomato ( Solanum l ycoper sicum ) was first discovered in South Africa in 1914 and described as Bacterium vesicatorium by Doidge ( 192 0 ) . Around the same time, the disease was also discovered by G ardner and Kendrick (1921) of In diana and they named it B. exitiosum . These two organisms were believed to be the same and priority was given to B. vesicatorium . However, the two pathogens varied in their amylolytic activity (starch degrading capability). B. vesicatorium was described as weakly amylolytic and B. exitiosum was strongly amylolytic (Jones et al. 2004). Additionally, Gardner and Kendrick (1923) discovered that B. vesicatorium was able to cause a leaf spot of pepper ( Capsicum a nnuum ). However, H iggens (1922) was the first to fully describe the disease in detail (Stall et al. 2009). Both organisms were still treated as one when they were reclassified as Pseudomonas vesicatoria , Phytomonas vesicatoria , and Xanthomonas campestris pv . vesicatoria ( Xcv ) (G arton 2009 ; Jones et al. 1998 ; Stevens 1925). Stall et al. (1994) determined that Xcv consisted of two genetically and phenotypically distinct groups (group A and B). Group A strains were consistently negative for starch hydrolysis, pectolytic activity, and ca use d a HR in tomato plants of the Hawaii 7998 breeding line. In contrast, group B strains were strongly amylolytic and pectolytic. The two groups also varied in carbon utilization assays , serology, fatty acid profiles, SDS PAGE protein banding patterns, and DNA restriction enzyme digestion profiles. Additionally, strains belonging to the same group had a DNA homology value of >74%, but the levels of DNA homology between the two groups were <46%. These results justified the c onclusion that there are two distinct groups with diverse genetic backgrounds. Vauterin et al. (1995) proposed that the two groups be reclassified as X. axonopodis pv . vesicatoria (A) and X. vesicatoria (B). According to Jones et al.

PAGE 14

14 (2004), two more xanthomonads have been isolated from tomato. Pseudomonas gardneri was discovered in Yugoslavia in 1957 by Sutic (1957) and it was eventually determined to be synonymous with X. vesicatoria . A second pathogen was i solated from a Florida tomato in the X. campestris pv. vesicatoria (Jones et al. 1995). These two strains were later characterized as two additional groups D and C respectively (Jones et al. 2000). Jones et al . (2004) determined that there are 4 distinct species of Xanthomonas that cause bacterial spot of tomato and/or pepper. Based on DNA DNA hybridization results, a new taxonomy and nomenclature was proposed using a 70% DNA relatedness standard. The four grou ps were reclassified as Xanthomonas euvesicatoria (A) , X. vesicatoria (B) , X. perforans (C), and X. gardneri (D). Similar to all other plant pathogenic xanthomonads , bacter ial spot pathogens utilize the type III secretion s ystem (T3SS) to deliver bact eria l effector proteins into host plant s (Alfano and Collmer 2004 ). T3SS delivered effectors a re directly responsible for pathogenicity and alteration of gene expression of the host. These effectors can trigger either a compatible or an incompatible reaction. A compatible reaction results in disease while an incompatible reaction triggers plant resistance. In a compatible rea ction, T3SS effectors down regulate defense responses . However, a hallmark of an incompatible reaction is the hypersensitive response ( HR ) or programmed cell ( a vr Collmer 2004). This interaction between avr and R genes follows the gene for gene theory. This gene for gene interaction has also been used as a classification too l for the four bacterial spot pathogens. Stall et al. (2009) describes that there are four R genes involved in the HR of tomato and five in pepper. Their corresponding avr genes have also been characterized

PAGE 15

15 and cloned. These a vr genes are used to further c ategorize the bacterial spot of tomato pathogens into four different types. The first type is designated as race T1 ( X. euvesicatoria ) , which has avrRxv and will give an HR on Hawaii 7998 (H7998) that contains the corresponding resistance genes ( rx1 , rx2 , and rx3 ). However, strains belonging to race T2 ( X. vesicatoria ) do not elicit an HR on H7998 and are genetically distinct from T1 strains. Another race , T3 ( X. perforans ) was found in 1991 in Florida, race T3 does not elicit an HR on H7998. However, it d id elicit an HR on several accessions of S. pimpinellifolium and one S. lycopersicum line with a single inherited resistance gene Hawaii H7981. A near isogeneic line, FL216, with the resistance gen e, Xv3 , was developed and can be easily used in combination with H7998 for race determination. The corresponding avirulence gene was designated as avrXv3 and it has been shown to elicit an HR in pepper plants. Moreover, there are Florida strains that are pathogen ic on tomatoes carrying Xv3 and these were designated as race T4 ( X. perforans ). T4 strains contain avrXv4 which corresponds to the resistance gene Xv4 (Robbins et al. 2009 ; Stall et al. 2009). Additionally, there are four resistance genes in pepper that a llow bacterial spot pathogens of pepper to be characterized into 11 races. These four genes were designated as Bs1 , Bs2 , Bs3 , and Bs4 . Their corresponding avirulence genes are avrBs1 , avrBs2 , avrBs3 , and avrBs4 (Stall et al. 2009). Symptoms B acterial spo t pathogens infect the foliage, stems, and fruits of susceptible tomato plants. L eaf symptoms are the most prominent, but can vary based upon environmental conditions (Ritchie 2000). Lesions usually appear on the lower leaves first and are most visible on the underside of the leaves. Young infected leaves typically have lesions that begin as small, yellow g reen areas that become deformed and can expand rapidly. As they enlarge, lesions will become tan to brownish red with an angular shape defined by leaf ve ins. The center of lesions will eventually dry out and tear, but they rarely develop to more than 3mm in diameter. However,

PAGE 16

16 lesions on the older foliage appear initially as dark, water soaked, and greasy areas instead of a yellow green. X . perforans lesion s typically have a shot hole appearance which is reflected in its name. In contrast, fruit lesions begin as pale green spots with water soaked boarders that will become raised, brown, and warty in appearance. Fruit lesions can provide an entry point for ot her fungal and bacterial secondary invaders that can cause fruit rots. Although spots do not penetrate deeply into fruit tissue, they can lower fruit quality and marketability (Jones et al. 2004 ; Miller et al. 2013 ; Momol et al. 2008 ; Ritchie and Averre 1996 ; Ritchie 2000 ; Sun et al. 2002 ). Epidemiology Bacterial spot of tomato can be present wherever to matoes are grown , but it is most severe in Florida and the southeastern US where environmental conditions are conducive for disease development througho ut the year. Characteristic weather conditions for bacterial spot include high temperatures ( 24 30 °C) , high humidit y, and heavy rain (Momol et al. 2008). According to Ritchie (2000), extended periods of high relative humidity normally favor infection and disease development. Symptom development can be delayed or eliminated if relative humidity remains low for several days after infection. However, the disease can still develop in dry irrigated regions and overhead irrigation is highly efficient in facil ita ting disease spread (Ritchie 2000). In terms of survival, t he bacterium may overwinter on contaminated seeds, in infected plant debris in the soil, or o n weeds and other hosts (Agrios 2005 ; Bashan 1986). The bacteria only survive for a short period of time (from days to weeks) in soil and their survival is typically associated with infested plant debris. The pathogen s are reported to persist epiphytically on a few weed species that appear to play a minor role in survival (Stall et al. 2009). Volunteer tomat o plants are potential sources of inoculum, bu t in colder growing regions the vegetative material is killed resulting in poor survival of the bacteria. As a result, in these areas reintroduction is the result of contaminated seed or infected transpla nts (R itchie 20 00).

PAGE 17

17 Additionally, even a low frequency of s eed contamination can lead to high amounts of disease in the field. This is due to the resulting epiphytic growth and distribution of pathogens in the tomato phyllo sphere (Louws et al. 2001). The bacterium typically spreads via rain, wind, overhead irrigation, some cultural practices, or direct contact. It penetrates leaves and fruits through wounds, stomata and hydathodes (Agrios 2005 ; Momol et al. 2008; Ritchie 2000). A 2006 characte rization survey revealed that X . perforans is the dominant species in Florida tomato fields and all of the strains are copper tolerant (Vallad et al. 2010). Th is survey revealed that approximately 77% of the strains were T4, 23% were T3, and no T1 strains were isolated. Originally, race T1 had been the sole bacterial spot of tomato pathogen in Florida for at least 30 years until T3 was discovered in 1991. Over time, T1 strains were completely replaced by T3 strains in Florida. These results are not surprisi ng because it is thought that T3 s trains produced a bacteriocin that is antagonistic to T1 strains. As of 2009, T2 strains have never been found in Florida but they are abundant in Brazil, common in Argentina and Asia, and have been isolated in the Midwest ern United States (Stall et al. 2009). Disease M anagement Due to environmental conditions, bacterial spot can be extremely difficult to control in Florida. Many chemical, biological control agents, and resistant cultivars have been tested to control bacte rial spot, but their efficacy has been limited (Flaherty et al. 2000 ; Ji et al. 2006). Disease control of bacterial spot partially depends on the cultural practices of the grower such as the use of bacteria free seed an d seedlings, resistant cultivars , cro p rotations to avoid carry over on volunteers, reducing the handling of wet plants, eliminating solanaceaous weeds, and not establishing cull piles near field operations (Momol et al. 2008). In combination with cultural practices, growers currently use cop per based bactericides mixed mancozeb or maneb (ethylene bis dithiocarbamates) which can manage the disease under reasonably dry conditions (Abbasi et

PAGE 18

18 al. 2002 ; Agrios 2005). Bacterial spot management has relied heavily on copper because of its low cost a nd it has a relatively low toxicity to humans and other mammals when compared to other various chemicals or antibiotics (Marco and Stall 1983). Additionally, copper became the bacteri cide of choice due to the emergence of streptomycin resistant Xanthomonads in the they were not described until 1 983 by Marco and Stall (Cooksey 1990). Copper tolerance has led to the heavy use of copper mancozeb combinati ons which did reduce the epiphytic bacterial a bility to release more soluble copper than a copper suspension alone (Conover and G erhold 1981 ; Marco and Stall 1983). Unfortunately, it has been reported that copper mancozeb will not adequately control bacterial spot when copper tolerant strains are present in optimal disease conditions (Jones and Jones 1985 ; Obradovic et al. 2004a). The development of copper tol erant strains has caused researchers to look into the genetic cause of copper resistance. C opper resistant Xcv strains were examined and determined to contain large plasmids with homology to pXcCu first identified and descr ibed in Florida by Stall et al. ( 1896 ) . pXvCu is a self transmissible plasmid that plays a key role in copper resistance. The plasmid can vary in size dependi ng on the isolate, but is usually 200 kb or larger. Some of the pXvCu plasmids (pXvCu1) can also carry an avirulence locus ( avrBs1 ) which determines race specificity on different pepper cultivars. Xcv has a second type of copper resistance plasmid that was first discovered in a strain from California. However, this plasmid does not have strong homology with the copper resistance genes from pXvCu plasmids. It does have homology with the copper resistance genes from Pseudomonas syringae pv. tomato ( Pst ). It is about 100 kb and is not self transmissible. This has lead to the conclusion that there are t w o independent lines of

PAGE 19

19 evolution of copper resistance in the bacterial spot pathogens (Cooksey 1990). As of 2006, all of the X. perforans strains in Florida are tolerant to copper (Vall ad et al. 2010). Therefore, the heavy use of copper based bactericides has resulted in a high selection pre ssure for copper resistance. Many different alternatives to copper based bactericides have been considered including bacteriophages, acibenzolar S m ethyl (ASM) or Actigard 50W® (Syngenta Crop Protection, Greensboro, NC), molecular additives (2 amin oimidaz ole), resistant cultivars , and nanoparticles. Flaherty et al. (2000) evaluated the use and effectiveness of foliar applications of bacteriophages. They found that applications of bacteriophages consistently reduced incidence and severity of bacterial spot caused by Xcv . Additionally, bacteriophage treated plants were healthier, more vigorous with higher yields when compared to copper mancozeb treated plants. Although bacteriophages have shown promise, their efficacy can be limited in the field due to their specific envi ronmental requirements for their multiplication and viability. Another chemical that has been evaluated for management of bacterial spot is ASM which is a systemic acquired resistance (SAR) inducer. It activates plant defense response by increasing the tra nscription of stress related genes and increased tomato resistance to bacterial spot compared to untreated controls (Obradovic et al. 2005). Researchers have also explored the possibility of using bacteriophages in combination with ASM. This combination ha s resulted in significant increases in disease control compared to standard bacteriophage and copper mancozeb treatments (Momol et al. 2008; Obradovic et al. 2005). Worthington et al. (2012) evaluated the use of 2 aminoimidazole (2AI), a small molecule add itive, that is an analogue of the marine sponge natural product oroidin. When 2AI was combined with copper, it was shown to suppress resistance of X. euvesicatoria to copper and decrease biofilm formation in vitro . In field experiments, this

PAGE 20

20 combination r esulted in decreased bacterial spot disease and increased fruit yields of bell pepper plants. In addition to biological control and chemical opt ions, resistant tomato cultivars have been explored as a possible method to manage bacterial spot. The durabil ity of the resistan ce genes that are present in tomato and pepper depends on the stability of the avr gene in the pathogen. Many avr genes associated with bacterial spot pathogens are contained on self transmissible plasmids that are not necessarily requir ed for pathogenicity and can easily be lost. This phenomenon occurs frequently and is associated with the selection of strains by resistant plants that do not have an avr associated plasmid. There are other mechanisms that bacteria use to inactivate an avr gene including the addition of an insertion element or insertion of base pairs into the avr gene sequence, deletion of base pairs and single base pair changes (Stall et al. 2009). According to Ritchie (2000), resistant cultivars are available and were wid ely planted. However, it is appare nt that there are strains of bacterial spot that are able to overcome all of the currently known major resistance genes. Therefore, durable resistance genes have not been easy to find or to use commercially in Florida. I n the past, researchers have explored the use of metal ions (Zn 2+ , Cu 2+ , and Ag + ) for disease management. However, these metal ion based chemicals tend to have low antibacterial activity. Researchers have developed several types of nanomaterials (Ag, Cu, C uO , ZnO, and TiO 2 ) and combining them with carbon based nanoparti cles such as g raphene oxide (GO) to increase their antibacterial activity (Ocsoy et al. 2013 b). More recently, nanoparticle based chem icals such as TiO 2 and Ag have been evaluated for disease management of bacterial spot. Paret et al. (2013) evaluated the use of a nanoscale version of the light activated TiO 2 for controlling X. perforans . TiO 2 chemically generates reactive oxygen species (ROS) in the

PAGE 21

21 presence of light which gives it the ability to destroy organic molecular structures that are crucial for pathogen survival. This study evaluated the use of nanoscale TiO 2 alone, and TiO 2 doped with either Ag or Zn against X. perforans . In vitro , TiO 2 /Ag and Ti O 2 /Zn caused a significant reduction in bacterial populations within 10 min of light exposure (3x10 4 lux). Greenhouse and field trials revealed that plants treated with TiO 2 /Zn significantly reduced disease incidence when compared with copper based bacte ricides. However, TiO 2 /Zn has no antibacterial effect in the absence of light and this could be a potential limitatio n in using it on a large scale. Unlike TiO 2 /Zn, a silv er based nanomaterial called Ag dsDNA GO is active wi th or without light and was eval uated by Ocsoy et al. (2013b) for management of bacterial spot caused by X. perforans . AgNPs (silver nanoparticles) are thought to interact with thiol, carboxyl, hydroxyl, amino, phosphate, and imidazole groups in bacterial membrane surface proteins and en zymes. This interaction is thought to lead to structural deformation of the cell membrane and the uptake of free Ag ions which can inactivate enzymes, inhibit cell replication and respiration, and cell death. Unfortunately, bare AgNPs tend to aggregate whe n in contact with bacteria and cause a reduction in the antibacterial activity due to the reduced surface area. This aggregation problem led to the addition of AgNPs to graphene oxide (GO). GO is composed of a single layer of carbon atoms with active surfa ce hydroxyl, epoxy, and carboxyl groups. Ocsoy et al. (2013b) used dsDNA as a template for growing the AgNPs on GO which allows better control of AgNP size, aggregation, and incr easing the adhesive force of Ag GO composite a nd bacterial cell membranes. Ag dsDNA GO composites were found to effectively decrease X. perforans cell viability. In vitro , Ag dsDNA GO at 16 ppm was highly effective and had improved stability, enhanced antibacterial activity, and stronger absorption properties whe n compared to bare AgNPs and Ag GO alone. A greenhouse study revealed t hat 100 ppm of Ag dsDNA GO treated

PAGE 22

22 tomato plants had significantly reduced disease severity when compared to untreated plants and gave similar control when compared to copper mancozeb. This study illustrates that there is great promise in the use of silver based nanomaterials in ma naging bacterial spot of tomato. However, these results need to be further evaluated with more in vitro and greenhouse studies using different AgNP and GO sizes, and varying composite concentrations. Identification Techniques There are multiple methods f or characterization and diagnosis of plant pathogenic xanthomonads. Some of these methods are based on host pathogen interactions including host range and the interaction between resistance and avirulence genes. In particular, resistance and avirulence gen es have been incredibly helpful in race determination involving the bacterial spot pathogens. This interaction typically results in a HR which can be visualized on infiltrated tomato and pepper leaves. This has lead to the identification of 4 tomato and 1 1 pepper races. Even though race determination has been widely used over the years, race results may not necessarily be stable overtime because avr genes are subject to mutation or loss. Many of them are also located on self transmissible plasmids which ca n be gained by conjugation (Jones et al. 1998 ; Stall et al. 2009). Phenotypic variation in terms of amylolytic activity, carbon utilization, protein profiles, fatty acid analysis, serological analysis, and bacteriophages have been evaluated for determining the species for the bacterial spot pathogens. However, these are not the most reliable means of determining which of the four bacterial spot species are present in a plant sample. For instance, carbon substra te utilization analysis is not the most useful technique in differentiating between taxonomic groups of xanthomonads and it is only reliable on a genus level for identification (Jones et al. 1998). More recently, researchers have focused more on genotypic variation and molecular analysis to elucidate the relationships of pathogenic xanthomonads. One of these methods

PAGE 23

23 includes DNA DNA hybridization which led to the validation that there are four distinct bacterial spot species (Jones et al. 2004 ; Vauterin et al. 1995). It has been widely used to define b acterial species and 70% DNA DNA homology values are considered to be the species limit (Rademaker et al. 2000). However, this method is impractical when analyzing large collections of isolates , because it cannot be used to construct a central database and it is not eas ily implemented (Cho and Tiedje 2001 ; Rademaker et al. 2000). Another bacterial identification method that was widely used is 16S rRNA sequencing. It is a reliable method for the identification of many diverse bacteria and a powerful tool fo r determining phylogenetic relationships among bacteria. However, it is too conservative to provide a good resolution at species and subspecies levels (Cho and Tiedje 2001). Therefore, researchers are continually evaluating how to more readily separate the four bacterial spot species. Various gene components of the T3SS could be promising candidates for developing a molecular based method for bacterial spot species identification. The T3SS delivers effector proteins into the host plant cell and is regulate d by hrpG and hrpX which also control the hrp (hypersensitive response and pathogenicity) gene cluster. The hrp gene cluster is 23kb, contains six operons ( hrpA to hrpF ), and encodes for more than 20 proteins. Nine of these proteins are highly conserved in plant and animal pathogens. The genes that encode these nine proteins were renamed hrc ( hrp conserved) and form the core of the T3SS (Bogdanove et al. 1996 ; Noël et al. 2002). The hrpB operon encodes for eight proteins and three of which are conserved in T3SS. The hrpB1 , hrpB2 , hrpB4 , and hrpB5 are not well conserved amongst plant and animal pathogens. Non polar deletions of these genes proved that they were required for secretion and a re true hrp genes. More specifically, protein localization studies found that hrpB2 was secreted into a culture medium in a hrp dependent manner. Furthermore, the hrpB2 is essential for type

PAGE 24

24 III protein secretion and pathogenicity (Rossier et al. 2002). Th ese results would indicate that the hrpB could be highly conserved amongst different species of Xanthomonas and could be used to develop a tool to detect the four causal agents of bacterial spot. Leite et al. (1994) created three pairs of oligonucleotide primers that were specific to different regions of the Xanth omon as campestris pv. vesicatoria ( Xcv ) hrp gene cluster. DNA was successfully amplified using these three primers from 28 X. campestris pathovars and X. frag a riae . However, these primers were not able to amplify DNA from a few X. campestris pathovars, X. albilineans , nonpathogenic species of Xanthomonas , or other genera of plant pathogens such as Acidovorax and Pseudomonas . When the PCR products were digested with various restriction enzymes, uniq ue and distinctive banding patterns were observed for different Xanthomonas strains. Leite et al. (1995) used PCR primers that were specific for the hrp gene cluster and restriction enzyme analysis (REA) to detect strains of Xcv associated with pepper and tomato seeds. The hrp fragments were amplified f rom DNA obtained by washing infested seeds with a buffer solution containing sodium ascorbate and insoluble polyvinylpolypyrrolidone. The hrp fragment corresponding to Xcv was obtained by restriction enzyme analysis. Therefore, this method suggested that components of the hrp gene cluster could be used to identify and detect plant pathogenic xanthomonads on plant material. Furthermore, Obradovic et al. (2004 b ) PCR amplified 39 total representative strains from the four groups of the bacterial spot pathogens using hrpB based primers. The 840 bp PCR products were sequenced in order to develop primers that would amplify a 420 bp fragment from all pathogenic xanthomonads. No PCR products were obtained from saprophytic or opportunistic xanthomonads. Using the new primer set, the amplified PCR products from the four groups were digested with restriction enzymes Cfo I, Taq I, and Hae III. The resulting banding patterns enabled the dif ferentiation of the four groups. Thus,

PAGE 25

25 the hrpB2 appears to be a potential region to develop species specific PCR primers or qPCR species specific probes for a more rapid bacterial spot diagnostic technique. Real time, quantitative PCR (qPCR) is similar to conventional PCR which has become an essential tool in many plant pathology diagnostic and research laboratories for detecting nucleic and easily reproducible. Carry over contamination is also reduce d (Mackay et al. 2002 ; Li et al. 2006). The main difference between the two methods is that qPCR use allows for the detection of the accumulating amplicon in real time. This feature is made p ossible by using target specific probes labeled with a fluorogenic molecule. They are chemically modified to contain a fluorescent fluorescence of the reporter dye is prevented by the close proximity of the quencher. If the target is present, then the probe will specifically anneal between the designed forward and reverse primers. The Taq polymerase will move along the template and cleave the annealed probe between the reporter and the quencher dye. This allows the reporter dye to emit fluorescence when it is excited by a light source and its fluorescence intensity is directly related to the amount of target that is present in the sample. Each reporter dye emits energy at a specified wav elength that is detected by the PCR instrument in real time (Mackay et al. 2006 ; Pongers Willemse et al. 1998 ; Schaad and Frederick 2002). Additionally, several qPCR assays have been developed to detect several bacterial plant pathogens including Clavibact er michiganensis subsp. sepedonicus , Ralstonia solanacearum , Agrobacterium strains, Xylella fastidiosa , Candidatus Liberibacter asiaticus , and Xanthomonas citri pv. citri (Golmohammadi et al. 2007; Li et al. 2006 ; Schaad and Frederick 2002). These qPCR ass ays were designed to detect a single species or subspecies in a given sample. However, bacterial spot of tomato is caused by four distinct species of Xanthomonas . Multiplex qPCRs can

PAGE 26

26 be developed to simultaneously detect up to four separate species (target s) as long as the reporter dyes do not have overlapping wavelengths. For example, a multiplex qPCR has been developed to detect four pathogenic species of Phytophthora . Specific primers and probes labeled with FAM ( P. ramorum ), Yakima Yellow ( P. kernoviae ), ROX ( P. citricola ), and Cy5 ( P. quercina ) were created based on different regions of the ras related protein ( Ypt ) gene (Schena et al. 2006). This assay proved to be a reliable, sensitive, and cost effective method because multiple pathogens were detect ed using one reaction mixture. This type of qPCR assay could easily be completed for the four causal agents of bacterial spot of tomato using the hrpB2 to create species specific probes. Bacterial Wilt of Tomato History Bacterial wilt is caused by Ralstonia solanacearum and it is an important pathogen affecting tomato crops in Florida. Bacterial wilt of potato, tomato, and eggplant was first described by EF Smith in 1986 and was named Bacillus solanacearum . In 1914, Smith transferred it to the genus Pseudomonas even though it was non fluorescent (Yabuuchi et al. 1995) . Yabuuchi et al. (1992) transferred it and other pathogens to the genus Burkholderia based on rRNA homology. A few years later, it was finally transferred to the genus Ralstonia based o n 16S rRNA, rRNA DNA hybridization, fatty acid analysis, and other phenotypic differences ( Yabuuchi et al. 1995). Bacterial wilt affects many species worldwide and disease severity can vary according to climate, cropping practices, soil type, and geographi c location (Thoquet et al. 1996). Throughout cucumber, bean, peanut, pepper, and cantaloupe crops f rom all over the world (Kelman 1953 ; Yabuuchi et al. 1992). It first garnered attention in the United States in 1903 because of

PAGE 27

27 substantial tobacco crop losses ranging from 25 to 100% in fields in North Carolina (Kelman 1953) . Infected tomato plants may be stunted or completely wilted which can result in poor fruit quality , significant yield loss , and plant death . Strains of this pathogen are reported to cause disease in plants from over 50 families including solanaceaous and leguminous plants, a few monocotyledons, several trees and shrubs, and the model plant Arabidopsis thaliana (Genin and Boucher 2002 ; Kelman 1953 ; Vallad et al. 2004) . R. solanacearum is described as an aerobic, Gram negative rod which is motile by 1 4 polar flagella. It produces smooth, shiny, opalescent colonies on nutrient agar that are non fluorescent, catalase and oxidase positive, and can form nitrite from nitrates (Hong 2012 ; McCarter 1991). However, R. solanacearum strains do vary quite considerably in terms of host range, optimal temperature for pathogenicity, and uti lization of car bohydrates (Hong 2012). Therefore, R. solanacearum is a multifaceted taxonomic unit with extensive phenotypic and genetic diversity ( Ahmed et al. 2013) . Historically, R. solanacearum strains have been divided into five races based on host range difference species were initially divided into five races based on the differences observed in host range. Race 1, 3, and 4 are all considered to be pathogenic on tomato. These five rac es were then further classified into six biovars based on biochemical properties such as their ability to oxidize three hexose alcohols and three disaccharides. However, there was still some confusion in terms of classification because these two schemes on ly overlapped in terms of the fact that most biovar 2 strains belong to race 3 (Ahmed et al. 2013 ; Hong 2011 ; Genin and Boucher 2002). Cook et al. (1989) decided to classify these strains based on restriction fragment length polymorphism (RFLP) analysis. T his placed R. solanacearum strains into two major divisions. Division 1 contains all members of race 1 biovars 3, 4, and 5 and division II contains all members of race 1

PAGE 28

28 biovar 1, race 2, and race 3. These strains also fall into three different groups base d on origin (Asian, Americas, or African origin). The most prominent R. solanacearum race associated with bacterial wilt of tomato in the southeastern United Stat es is race 1 (Genin and Boucher 2002 ; Kelman 1953 ; Vallad et al. 2004). Additionally, race 3 b iovar 2 is on the United States Department of Agriculture Select Agent list because of its tolerance to cooler temperatures and high patho genicity on potato (Gabriel et al. 2006). Due to the complexity of this pathogen and its ability to survive for long p eriods of time in the soil, it has been difficult to find a successful disease management strategy. This is especially true for Florida where th e disease is suspected to it occurs commonly in field grown tomatoes throughout the state (Kelman 1953 ; Ji et al. 2005). Symptoms Ralstonia solanacearum is a soil borne vascular pathogen. The bacteria survive in the soil, attack tomato roots, and then multiply in the xylem which is the primary cause of plant wilting. After infection, the first visible symptoms on mature plants under natural conditions are on the pla nt foliage which consists of wilting of the you ngest leaves at the ends of branches. W ilting occurs on hot days and p lants may seem to recover at night or early hours of the morning wh en temperatures are cooler. W ilted leaves may maintain their green color and may not fall as the disease progresses. Eventually, the entire plant may wilt quickly and dry out which leads to yellowing of foliage and plant death. Plants may also become stunted in the field or visually healthy plants may wilt suddenly when fruits are expanding rapidly ( Champoiseau et al. 2009 ; Vallad et al. 2004) . Under favorable or optimal disease conditions, a rapid and complete wilt can follow those initial disease symptoms within 2 to 3 days (McCarter 1991). In terms of other symptoms and signs of the disease or pathogen, dark brown discoloration of the wilted plants vascular tissues can occur. This diseas e symptom results from

PAGE 29

29 the heavy colonization of the vascular tissue by the bacterium and can be used to diagnose the disease. If a cross section of the stem is taken and placed in clear water, then a white, milky strand of bacterial cells will ooze from t he tissue. This is a distinguishing characteristic of bacterial wilt from other fungal pathogens such as Fusarium wilt that can also infect tomato (Vallad et al. 2004). Additionally, adventitious roots may appear on infected plant stems which are most pro nounced when the disease develops slowly under unfavorable conditions. In this situation, the primary root is short lived and replaced by many adventitious roots that grow from the base towards the apex along the main stem. Factors that are conducive to ad ventitious root formation are low temperature, low strain virulence, and resistant tomato cultivars (Lui et al. 2005 ; McCarter 1991). B elow ground bacterial wilt symptoms can also include various degrees of root decay depending on the stage of disease deve lopment. At first only one or a few roots may show brown rot, but as the plant becomes permanently wilted the entire root system can demonstrate brown rot (McCarter 1991). In terms of disease development in Florida, bacterial wilt symptoms are most commonl y reported during summer tomato production rather than d uring the spring (Hong 2012). Epidemiology Ralstonia solanacearum is a highly efficient pathogen that attacks more than 200 cultivated plant and weed species in 50 different plant families. Some of t he most economically important hosts are in the family Solanaceae which includes tomato, potato, tobacco, and eggplants (McCarter 1991). The primary inoculum source is infested soil, but other sources include irrigation water, weeds, tomato stakes, farming equipment and operators, and diseased plant material ( Champoiseau et al. 2009 ; Hong et al. 2008). In the field, the pathogen is usually concentrated in lower areas with wa ter accumulation (Vallad et al. 2004). It gains entry into the host via wounds cause d by nematodes, insects, cultivation, transplanting, or normal plant growth

PAGE 30

30 where secondary roots e merge (Denny 2006; McCarter 1991). The bacterium then colonizes the xylem tissue by multiplying rapidly (10 8 to 10 10 CFU /g of tissue) and filling it with bacteria cells and slime. The rate at which disease symptoms occur depends on host susceptibility, strain virulenc e, and temperature. This pathogen favors high moisture, moderate pH, and temperatures greater than 20°C. As the disease progresses, the pathog en will invade parenchyma cells in the pith and cortex. Masses of bacteria will form in pockets near the vascular bundles and will continue to move through the cortex. Bacteria will then exude on the surface of stems and will be released back into the soil from infected roots and decaying plant material (Denny 2006; McCarter 1991 ; Vallad et al. 2004). Therefore, soil factors can also strongly influence the survival of the bacterium in addition to disease severity. Soil characteristics that can a ffect path ogen survival are soil depth, organic matter, host plant debris, moisture, and the type, temperature, and pH of the soil. The pathogen h as been shown to survive in soil with suitable temperature and moisture without a host for up to two years. The optimal temperatu re for pathogen survival in soil ranges from 30 to 37°C. Additionally, the bacterium is reported to survive in pure water at 20 to 25°C for more than 40 years (Denny 2006 ; McCarter 1991 ; Vallad et al. 2004). It is well adapted for surviving in irr igation water and European waterways in close association wit h aquatic weeds. S urvival in irrigation water has been well documented in Florida. In Spain, it has been reported that race 3 phylotype II is able to enter a viable but not culturable state in lo w nutrient environments. It was also still able to infect and colonize hosts even after being in prolonged oligotrophic conditions for four years. Furthermore, irrigation water and waterways have been associated with outbreaks of the disease in the United States and in Europe (Álvarez et al. 2008 ; Hong et al. 2008). It is

PAGE 31

31 evident that R. solanacearum has diverse mechanisms for dissemination and survival in the field. Once a tomato field becomes infested with bacterial wilt, it is extremely difficult to cont rol. Disease management Bacterial wilt of tomato is difficult to control because of its wide host range, high genotypic and phenotypic variation, and vast survival and dissemination mechanisms. Despite these challenges, researchers continue to evaluate a nd develop new disease management strategies (Ji et al. 2005). One disease management approach that has been explored for bacterial wilt is the use of resistant or tolerant cultivars . According to Champoiseau et al. (2009), moderate horizontal resistance o r tolerance to R. solanacearum strains have been reported in potato and tomato. Researchers have identified or bred several tomato cultivars that are resistant to R. solanacearum because the resistance in these lines is not very stable. The level of bacterial wilt resistance of a cultivar can vary depending on the temperature variation and the strains present in a location (Wang et al. 1998). As indicated, the use and effectiveness of the commercially available resistant tomato cultivars , such as FL7514, is limited to certain geographic locations (McCarter 1991 ; Vallad et al. 2004). Additionally, the vast strain diversity of R. solanacearum presents a huge problem in terms of disease management and makes breeding for universally resistant plant varieties nearly impossible (Genin and Boucher 2002). More recently, the grafting of susceptible cultivars with high fruit quality onto resistant root stocks is effective in controlling the disease. Although it has not been test ed for the use against race 3 b i o var 2, it is used on a commercial scale in Japan, Bangladesh, and the Philippines (Champoiseau et al. 2009 ; Freeman et al. 2011 ; Nakaho et al. 200 0). Under certain conditions, cultural practices are moderately effective for reducing crop losses caused by bacterial wilt. These practices may include using pathogen free seedlings, crop

PAGE 32

32 rotation with non host plants, intercropping, eliminate alternativ e weed hosts, reducing root knot nematode populations, planting in non infested soil, removal of crop residue and volunteers, plant when temperatures are cooler, deep plowing of crop residues, efficient soil drainage, phytosanitation, and proper irrigation management (Champoiseau et al. 2009; Pradhanang et al. 2005 ; Vallad et al. 2004). One of the most essential cultural practices revolves around the R. solanacearum survive s particularly well in pond and irrigation water for ma ny years with or with out a suitable aquatic weed host. This phenomenon has been well demonstrated in pond water in North Florida and in European waterways. Moreover, heavily irrigated fields provide excess soil moisture , which allows the pathogen to thrive and increases disease spread and severity. Proper irrigation practices can significantly reduce the spread and buildup of the disease (Alvarez et al. 2008 ; Hong et al. 2008 ; Pradhanang et al. 2005 ; Val lad et al. 2004). There are several problems with rely ing solely on cultural practices for bacterial wilt control. For example, rotating tomato crops with a non susceptible host can be difficult to implement because of the pathogens substant ially wide host range (McCarter 1991). As a result, researchers conti nue to evaluate other methods for bacterial wilt control that can be implemented and used with the current standard cultural practices. Over the years, researchers have evaluated the use of various soil additives and foliar or drip/drench of different che micals for bacterial wilt management. General purpose fumigants such as methyl bromide and/or chloropicrin were used to manage several soilborne fungi, bacteria, nematodes, and weeds (Denny 2006 ; Ji et al. 2005; Santos et al. 2006 ; Thoquet et al. 1996). En finger et al. (1979) revealed that soil fumigation with methyl bromide (490 kg/ha) was shown to give good disease control up until the midseason in which at least 50% of the plants had wilted. Chloropicrin was also tested in this study as an alternative t o methyl bromide and it

PAGE 33

33 was more effective. Chloropicrin (326 L/ha) did provide significant full season control of R. solanacearum . Methyl bromide has been phased out because it is an ozone depleting molecule (Santos et al. 2006). Additionally, Chloropicr in is highly regulated by the United States Environmental Protection Agency (EPA) because the atmospheric emission of the chemical is highly volatile and toxic, and may become a source of air pollution (Gan et al. 2000). One potential alternative to these fumigants is a plant derived volatile essential oil called thymol. Thymol is a biofumigant that is an antibacterial agent produced by thyme ( Thymus spp.). It has been widely used as a general antiseptic, an oral antibiotic, and a cosmetic or food additive. In agriculture, it appears to have broad spectrum activities against fungi, nematodes, and insects. In terms of bacterial wilt, it has shown to be effective against R. solanacearum in greenhouse experiments and a couple of field trials (Ji et al. 2005). However, further field evaluation is essential for determining the practicality of using thymol to control bacterial wilt. A cibenzolar S methyl (ASM) or Actigard 50W® (Syngenta C rop Protection, Greensboro, NC) is a nother chemical that has be en evaluated f or bacterial wilt management. It is a chemical elicitor of systemic acquired resistance (SAR) system in plants. Foliar and/or soil applications of ASM reduced bacterial wilt incidence significantly only on moderately resistant tomato varietie s. Unfortunately, it did not provide effective protection on commercially acceptable tomato cultivars in soils with high inoculum pressure (Ji et al. 2005 ; Pradhanang et al. 2005). Even though thymol and ASM applications have shown potential in bacterial wilt management, there are a several items to be considered before growers can activ ely utilize them. There are some possible drawbacks that may include environmental damage, cost, and high labor inputs. Therefore, these treatments need to be further vali dated on a commercial scale prior to being implemented in an integrated pest management (IP M) strategy (Champoiseau et al. 2009).

PAGE 34

34 One potential chemical control method for bacterial wilt of tomato is an organic hydroperoxide called peracetic acid (peroxya cetic acid or PAA). It is a colorless liquid that produces a pungent odor similar to acetic acid. It is produced industrially by the autoxidation of acetaldehyde (O 2 + CH 3 3 CO 3 H) (Ullmann 2003). The EPA first registered PAA as an antimicrobial pesti cide in 1985 and it has been approved for indoor use on hard, non porous surfaces. PAA is often mixed with hydrogen peroxide and has been used as a disinfectant and sanitizer. Previous sanitation uses have included agricultural facilities, food establishme nts, medical facilities, home bathrooms, dairy/cheese processing plants, food processing equipment, and pasteurizers in breweries, wineries, and beverage plants (U.S. Environmental Protection Agency 2012). This antimicrobial peroxide is similar to other ox idizers because it denatures proteins, disrupts cell wall permeability, and oxidizes sulfhydral and sulfur bonds in proteins, enzymes, and othe r metabolites (Rutala and Weber 2008). In terms of plant disease control, PAA has been evaluated for the control of Acidovorax avenae subsp. citrulli and Didymella bryoniae that cause bacterial fruit blotch and gummy stem blight of watermelon, respectively. Both are foliar diseases that are transmitted by contaminated seed. Treating contaminated seed with PAA at 1600 sterilization (Hopkins et al. 2003). The effect of different concentrations of PAA has also been tested on germinating conidia of Monilinia laxa that causes brown rot of st one fruit. On p lums, conidia that were treated with 1000 significantly reduced by 50%. When conidia were dipped in 250 for 5 or 20 min, they were completel y inhibited and no brown rot was observed (Mari et al. 1999). Dagher and Cassandra (2011) evaluated a formulation of PAA containing the SAR inducer, potassium silicate, for the control of bacterial spot of tomato caused by Xanthomonas perforans . This

PAGE 35

35 formu lation had enhanced antimicrobial activity against X. perforans compared to PAA alone. Thus, different formulations of PAA have shown promise in plant disease control and could potentially be applied to the soil to reduce R. solanacearum populations. Howev er, the use of PAA on soil borne pathogens, such as R. solanacearum , has not been studied. Hypotheses and Objectives The aim of this project is to evaluate new diagnostic and disease management strategies for bacterial spot and bacterial wilt of tomato. We hypothesized that the hrpB region should be conserved amongst strains within the same Xanthomonas species and can be used to develop a PCR or qPCR to readily separate the four causal agents of bacterial spot. Additionally, silver based nanomaterials are known to have antibacterial properties a nd may help to control copper tolerant strains of X. perforans that cause bacterial spot in Florida. Furthermore, peracetic acid could potentially reduce Ralstonia solanacearum populations in the field when it is app lied to the soil via the drip system before and after planting tomato seedlings. In this study, the three objectives were to : I) e valuate the use of the hrpB region to readily separate the four species of Xanthomonas that cause bacterial spot of tomato; I I) e valuate the effect of silver nanoparticles bound to DNA on graphene sheets (Ag dsDNA GO) o n the growth of copper tolerant and sensitive Xanthomonas perforans strains in vitro and in greenhouse conditions; and III) e valuate the effect of p eracetic acid on the growth of Ralstonia solanacearum in vitro , in micro soil experiments, and in the field .

PAGE 36

36 CHAPTER 2 MULTIPLEX QPCR ASSAY FOR DETECTING THE FOUR CAUSAL AGENTS OF BACTERIAL SPOT OF TOMATO Introduction Bacterial spot is one of the most detrimental diseases of tomato in Florida and it is estimated to cause yield los ses of up to 50% (Vallad et al. 2010). The disease occurs worldwide, but is most prevalent in warm and moist tomato growing regions. Infection can result in leaf and fruit lesions, defolia tion, and yield loss of marketable fruit (Louws et al. 2001). The pathogen was first discovered in South Africa in 1914 and was named Bacterium vesicatorium . Since its discovery, it has undergone several name changes including Pseudomonas vesicatoria , Phyt omonas vesicatoria , and Xanthomonas campestris pv. vesicatoria ( Xcv ) (Garton 2009 ; Jones et al. 2004 ; Stevens 1925). Vauterin et al. ( 1995 ) determined that there were two distinct groups of Xcv that caused bacterial spot and renamed them as X. axonopodis p v . vesicatoria and X. vesicatoria . Two additional xanthomonads have been isolated from tomato. One was isolated in (Jones et al. 1995). Each group has since been elevated to its own distinct species and they were reclassified as X. euvesicatoria ( Xe ) , X. vesicatoria ( Xv ) , X. gardneri ( Xg ), and X. perforans ( Xp ) (respectively) (Jones et al. 2004) . Over the years, various methods have been evaluated for the characte rization of plant pathogenic xanthomonads. Phenotypic variation tests, such as amylolytic activity and carbon utilization assays, protein profiles, fatty acid analysis, and serological analysis, were routinely used to differentiate Xanthomonas sp p . However , these methods, such as carbon utilization, are not very useful for accurately identifying xantho monads to species (Jones et al. 1998). Therefore, recent diagnostic methods, such as 16s rRNA and DNA DNA hybridization, have been more focused on exploiting genetic variation. However, 16s rRNA is too conservative to provide a

PAGE 37

37 good resolution to species and subspecies levels (Cho and Tiedje 2001). Even thoug h DNA DNA hybridization was used to characterize the four bacterial spot species , it is impractical to use for analyzing large strain collections because it is time consuming, difficult to implement, and impossible to create a central database (Cho and Tiedje 2001 ; Jones et al. 2004 ; Rademaker et al. 2000 ; Vauterin et al. 1995). More specifically, the bacterial spot pathogens have been divided into four tomato and eleven pepper races based the on presence or absence of particular avirulence ( avr ) genes (Stall et al. 2009). These avr genes are recognized by their corresponding resistanc e genes, which are present in different tomato genotypes. This recognition results in a hypersensitive reaction (HR) that appears within 24 to 48 hr and is used for deter mination of races (Jones et al. 1998 ; Stall et al. 2009). Bacterial spot of tomato pa thogens deliver bact erial effector proteins into host plants via the type III secretion system (T3SS). A functional T3SS is essential for pathogenicity because it delivers proteins which can down regulate defense responses. Most plant pathogenic xanthomon ads have a T3SS and it is regulated by two genes, hrpG and hrpX , which also control the hrp (hypersensitive response and pathogenicity) gene cluster (Alfano and Collmer 2004 ; Bonas et al. 1991 ; Cornelis 2006 ; Noël et al. 2002). The hrp gene cluster is 23kb, contains six operons ( hrpA to hrpF ), and encode s for more than 20 protei ns. Nine of these proteins form the core of the T3SS and are highly conserved in plant and animal pathogens . They are designated as hrc ( hrp conserved) (Bogdanove et al. 1996 ; Noël et al. 2002). This study will focus on a specific gene component ( hrpB2 ) of the hrpB operon, which encodes for eight proteins. Four of these, the hrpB1 , hrpB2 , hrpB4 , and hrpB5, are not well conserved amongst plant and animal pathogens. However, non polar deletions of these genes proved that they were required for secretion and are

PAGE 38

38 true hrp genes. Furthermore, the hrpB2 is essential for type III protein secretion and pathogenicity (Rossier et al. 2002). Leite et al. (1994) created three pairs of olig onucleotide PCR primers that were speci fic to different regions of the Xcv hrp gene cluster. PCR products were obtained from 28 different X. campestris pathovars and digested with various restriction enzymes. This digestion resulted in unique and distincti ve banding patterns for different strains of Xanthomonas . Additional experiments further evaluated the use of hrp based PCR primers and restriction enzyme analysis (REA) to detect strains of Xcv associated with pepper and tomato seeds (Leite et al. 1995). Therefore, a diagnostic method using components of the hrp gene cluster can be developed to identify various plant pathogenic xanthomonads including the bacterial spot pathogens. Obradovic et al. (2004 b ) used PCR to amplify 39 representative strains from t he four groups of the bacterial spot pathogens using hrpB based primers developed to amplify a 420 bp fragment of the hrpB2 from all plant pathogenic xanthomonads (excluding saprophytic or opportunistic Xanthomonas species). The PCR products were digested with restriction enzymes Cfo I, Taq I, and Hae III. The res ulting banding patterns clearly differentiat ed the four groups. Thus, the hrpB2 appears to be a potential region to develop species specific PCR primers or qPCR species specific probes for a more rap id diagnostic technique. Real time PCR (qPCR) is similar to conventional PCR , which has become an essential tool in research laboratories for detecting specific nucleic acid sequences . However, qPCR is gaining interest over PCR over contamination is also reduced (Mackay et al. 2002 ; Li et al. 2006). qPCR is unique because it allows for the detection of the accumulating amplicon in real time and uses target specific p robes labeled with a fluorogenic molecule. Probes are chemically modified to contain a fluorescent

PAGE 39

39 fluorescence of the reporter dye until the Taq polymerase clea ves the annealed probe in between the reporter and quencher dye. Each reporter dye emits energy at a specified wa velength that is detected by a PCR instrument in real time (Mackay et al. 2006 ; Pongers Willemse et al. 1998 ; Schaad and Fred erick 2002). Seve ral qPCR assays have been developed to detect a single bacterial plant pathogenic species or subspecies including Clavibacter michiganensis subsp. sepedonicus , R. solanacearum , Agrobacterium strains, Xylella fastidiosa , Candidatus liberibacter asiaticus , a nd X. citri pv. citri (Golmohammadi et al. 2007 ; Li et al. 2006; Schaad and Frede rick 2002). Additionally, multiplex qPCRs can be developed to simultaneously detect up to four separate species (targets) as long as the reporter dyes do not have overlapping wavelengths. For example, a multiplex qPCR has been developed to detect four pathogenic species of Phytophthora . Specific primers and probes labeled with FAM ( P. ramorum ), Yakima Yellow ( P. kernoviae ), ROX ( P. citricola ), and Cy5 ( P. quercina ) were create d based on different regions of the ras related protein ( Ypt ) gene (Schena et al. 2006). This assay proved to be a reliable, sensitive, and cost effective method because multiple pathogens were detected using one reaction mixture. The objective of this pr oject was to evaluate the use of the hrpB2 region to more readily and accurately separate the four bacterial spot of tomato pathogens. It was hypothesized that the hrpB2 region would be conserved amongst species of xanthomonads and that it could be used to develop a PCR or qPCR to readily separate the casual agents of bacterial spot. The sequencing and phylogenetic analysis of strains representing the four bacterial spot pathogens and other pathogenic xanthomonads revealed that hrpB2 was highly conserved amongst strains of the same

PAGE 40

40 species. Two of the species only varied by two single nucleotide polymorphisms (SNPs) which lead us to develop a qPCR assay instead of conventi onal PCR due to its sensitivity. Materials and Methods Isolation and Storage of Bacterial Strains All the bacterial strains used in this study can be found in T able 2 1. Bacteria were grown on nutrient agar (NA) medium (BBL, Bect on Dickinson and Co., Cockeysville, MD) at 28°C and transferred every 24 to 48 hr. For long term storage, purified cultures were stored in sterile 30% glycerol solution at 80°C. The following protocol was implemented to isolate bacteria from symptomatic p lant tissue for qPCR testing. Individual lesions were aseptically cut from young of sterile tap water in a Petri dish where it was macerated using a sterile sc alpel. A small amount of this suspension was transferred to NA using a sterile inoculating loop and quadrant streak was preform ed to isolate the bacteria. S treaked NA plates were placed in an incubator at 28 °C for 48 to 72 h r. Suspect colonies resembling X anthomonas ( yellow, mucoid colonies) were transferred to fresh NA and place d back in the incubator for 48 h r. This step was repeated until a pure culture could be obtained. To confirm pathogenicity, the isolated colonies were then infiltrated into tomato leaves and observed for development of an HR or disease development. Bacterial DNA Extraction from Pure Cultures and Infected Leaf Tissue Bacterial DNA was extracted from pure cultures using either the CTAB method as previously described ( Wilson 1987) or by boiling fresh bacterial cells. Using the end of a sterile toothpick a small amount of b acterial cells were removed from a pure culture and transferred to a be containing the bacterial suspension was then placed in rapidly boiling water for 20 min, transferred to ice for 5 min to cool, and then centrifuged at max speed (15,000 rpm) for 5 min. A

PAGE 41

41 modified boiling protocol was used for extracting DNA from infecte d leaf tissue. Using a sterilized scalpel, three to four lesions were cut from artificially or naturally infected tomato or pepper leaves. The lesions were then rinsed with sterile tap water to remove any pesticide residues that may be present on the leaf surface . The rinsed lesions were transferred to sterile 1.5 mL capped eppendorf tubes containing 500 sterilized pestle . In order to separate bacteri al cells from plant debris, plant debris was allowed to se ttle to the bottom of the tube for 1 hr. Without disturbing any plant debris, approximately 300 capped eppendorf tube. The tube containing the bacterial suspensio n was then placed in rapidly boiling water for 20 min, transferred to ice for 5 min to cool, and then centrifuged at max speed (15,000 rpm) for 5 min. PCR Assay, Sequencing and Phylogenetic Analysis As described in Obradavic et al. (2004 b ), h rpB GTCGTCGTTACGGCAAGGTGGTCG TCGCCCAGCGTCATCAGGCCATC were used to amplify a 420 bp fragment of genomic DNA from strains of the four bacterial spot species (78 strains in total) ( Tabl e 2 1 ). The following protocol was used to amplify the extracted DNA; i. 95.0°C for 5 min (1x), ii. 95.0°C for 30 sec, 63.0°C for 30 sec, 72.0°C for 45 sec (29x), and iii. 72.0°C for 5 Amplified PCR products were submitted to the Interdi sciplinary Center for Biotechnology Research (ICBR) at the University of Florida (Gainesville, FL, USA) for Sanger sequencing. Additional hrpB2 gene sequences representing multiple plant pathogenic Xanthomonas species were obtained from the National Center of Biotechnology Information (NCBI) database. All sequences were aligned and trimmed using the ClustualW feature in MEGA6 (Tamura et al.

PAGE 42

42 2013). The maximum likelihood tree feature in MEGA6 was used for the phylogenetic analysis of the hrpB2 aligned sequen ces. qPCR Probe and Primer Design The hrpB2 sequences that were obtained from ICBR and the NCBI database were used to create probes and primers for each of the four bacterial spot species and any groups that were within spec ies. Species specific and group specific probes were developed using the following guidelines: GC content was kept in the 20 to 80% range, runs of identical nucleotides were kept at 69°C for pote ntial multiplexing. The forward and reverse primers were designed last and were developed using the following guidelines: primers were designed as close as possible to the probe without overlapping the sequences, GC content was kept in the 20 80% range, r uns of identical n ucleotides were avoided, and the Tm for ea ch primer was kept at 59°C. P rimer sets were designed with the intent to amplify more than one bacterial spot species and to minimize the amount of reagents in the reaction mixture. The following equation was used to calculate a designed qPCR probe and primer sets were ordered from Integrated DNA Technologies, Inc (IDT©) (Coralville, IA). Each probe was initia lly ordered with the 56 optimization. In order to create a multiplex qPCR, each species specific probe was then given a Multiplex qPCR Assay Development and Optimization During the development phase, DNA from strain Xv 141 and 144, Xe 157, Xp 1484, and Xg GA2 was extracted using the CTAB method and measured via a nanodrop for the DNA concentration value and quality. Each DNA sample was then adjusted to 80 ng. These five strains served as positive controls for the duration of this study. Each probe and primer stock

PAGE 43

43 solution was adjusted to contain 100 mM of the probe or primer. Depending on the probe and primer set, different working solutions of 100, 200, 400, 800, and 1 200 nM were created. C ycling protocols with varying Tms ranging from 57 to 69°C were created in a Cepheid SmartCycler ® ( Cepheid, Sunnyvale, CA) . The qPCR cycling protocol was as follows: Stage 1) 95°C, 30 sec, Optics off, Stage 2) i] 95°C, 3 sec, Optics of f, ii] Tm°C, 30 sec, Optics on, and iii] 72°C, 30 sec, Optics off. For master mix optimization, different volumes of water, MgCl, 10x PCR buffer, dNTPs, primers, and probes were evaluated to find the best working master mix solution. Additionally, we evalu ated a master mix containing Premix Ex Taq (Takara Bio Company, Japan), which contains all of the components except the probes and primers. Twenty of each DNA sa mple was added to their assigned tube. After each probe and their corresponding primer set were optimized separately, three species specific probes were then given the XN ( Xg probe), 5Cy5 ( Xv probe), and 5TET ( Xe probe). The results from the individual optimization studies were used to determine the cycling protocol and master mix component concentrations for the multiplex qPCR assay. Once the protocol and master mix components were finalized, pure cultures from each speci es (72 strains in total) were tested to verify the specificity of the multiplex q PCR assay. After validation, DNA was extracted from various tomato and pepper leaf and fruit lesions and tested to further explore the multiplex Results Hr pB2 PCR, S equencing, and Phylogenetic A nalysis Amplified PCR products were successfully obtained from all strains listed in T able 2 1 using the two hrpB2 specific primers RST65 and RST69. The PCR products were sent to ICBR for San ger sequencing. Additional hrpB2 sequences from type strains representing different

PAGE 44

44 species of Xanthomonas ( X. euvesicatoria _8510, X. gardneri , X. perforans _91 118, X. vesicatoria , X. axononopodis pv. citrumelo _F1, X. oryzae pv. oryzae , X. oryzae pv. oryzicola , X. axonopodis pv. syngonii , X. axonopodis pv. glycines , X. fuscans subsp. fuscans , and X. campestris pv. campestris ) were obtained from the online NCBI database. The compiled sequences were then aligned using the ClustualW feature in MEGA6 (Tamu ra et al. 2013). The sequence alignment revealed that the hrpB2 gene is highly conserved amongst strains of the same species. No variation was seen amongst strains belonging to Xe, Xg, or Xp . However, there was one single nucleotide polymorphism (SNP) diff erence present at position 331 in different strains of Xv . Therefore, from this point on they will be referred to as Xv group 1 (ETH1, 2, & 4, UF3 & 6, 141, and 1111) and Xv group 2 (ETH3, 17, 18, & 20, UF 1 and 7, 56, and 144). Additionally, Xe and Xp str ains only varied by 2 SNPs at position s 257 and 260 in the hrpB2 sequence. The obtained ClustualW alignment was used to create a maximum likelihood tree with bootstrap values using MEGA 6 (Tamura et al. 2013). A condensed phylogenetic tree of the hrpB2 gen e from the previously mentioned xanthomonads can be seen in Figure 2 1 . qPCR Probe and Primer Design The results from the previous section were used to determine that a qPCR assay using species specific probes would be more obta inable and efficient than creating species specific PCR primers. The aligned hrpB2 sequences were used to create four species specific probes and two corresponding primer sets for detection of the four bacterial spot pathogens. Two additional Xv probes and one primer set were also created to detect the two groups. The full list of the final sequences for the qPCR probes and primers that were developed and used for the remainder of this study can be seen in T able 2 2. The target sequence of the hrpB2 gene for the Xe and Xp specific probes could only be developed around the 2 SNPs previously described. The Xv and Xg specific probes were also designed around 2 SNPs at positions 59 and 62 in the resulting

PAGE 45

45 ClustualW alig nment. The two Xv group specific probes had to be designed around the SNP at position 331. For the species specific probes, each probe is either 21 or 22 nucleotides in length and has G+C content of either 68.1 or 76.2%. In terms of the group specific probes for Xv , each probe is 22 or 24 nucleotides in length and has G+C content of either 54.1 or 68.1%. A primer set was created to complement the two species specific probes for Xe and Xp while another primer set was created to complement the two species spec ific probes for Xv and Xg . The Xv group specific probes also have a corresponding primer set. Each probe and primer set was designed with 9 to 16 nucleotide spacer sequence in between the start or end of a primer and a probe. Each primer is between 18 to 2 0 nucleotides in length, and with G+C content of 66.1 to 77.7%. Multiplex qPCR Assay Development, Optimization, and Validation Due to the close relatedness of Xe and Xp in the hrpB2 gene, their species specific probes and primers were evaluated first. Wo rking solutions of the Xp probe and its primer set were made at 100, 200, 400, and 800 nM concentrations. Different concentrations of the Xp specific probe and its primer set were tested in two different master mix solutions. One master mix contained the P remix Ex Taq and the other master mix contained 8.2 water, 2.5 2 , 0.6 Taq per each sample. An initial Tm of 59°C was selected to be evaluated with the previously described qPCR protocol. Unfortunately, there was no amplification of the target sequence using the Premix Ex Taq in combination with any of the probe and primer concen trations. However, there was amplification of the Xp target sequence with the second master mix ( Figure 2 2 A ). The strongest amplification of DNA from Xp strain 1484 occurred with the 800 nM concentration of the probe and prime r set ( Figure 2 2 A and B ). The 400 and 200 nM concentrations did amplify the target, but the Ct values were higher and not

PAGE 46

46 ideal. The 100 nM concentration did not amplify the target ( Figure 2 2 A ). Ho wever, there was also amplification of the DNA from the Xe strain 157 ( Figure 2 2 B ). The DNA from Xp strain 1484 crossed the threshold about 1 cycle before the DNA from Xe strain 157. In an attempt to increase the spe cificity, T ms of 61 and 63°C were tested in the qPCR protocol using the Xp probe. Increasing the Tm did not appear to increase the specificity ( Figure 2 2 E ). Additionally, a 1200 nM concentration of the Xp probe and primer set was also mad e in order to increase the specificity and/or cause lower Ct values. Increasing the probe and primer concentration had no effect on the specificity or the Ct values ( Figure 2 2 C ). In all of the tested cases above, the Xp strain always had a lower Ct value by at least one cycle than the Xe strain. The Xe specific probe and primer set was tested next in order to determine if there would be a similar result as to what was seen with the Xp specific probe and primer set. The second master mix mentioned in the previous paragraph was used for testing the Xe specific probe and primer set. Working solutions of 400, 800, and 1200 nM were evaluated for the Xe specific probe and primer set. The qPC R protocol using a Tm of 59°C was used for this experiment. Similar to the results seen using the Xp specific probe, the Xe specific probe and primer set consistently caused the amplified the DNA from 157 to cross at least one cycle before the DNA from 148 4. This would occur regardless of the Xe specific probe and primer set concentrations ( Figure 2 2 C ). However, the working solutions containing the 800 nM concentrations caused the greatest difference in Ct values (5.36) ( Figure 2 2 D ). Therefore, the next step was to evaluate the use of two species specific probes with different reporter dyes (FAM and TET) and add them to the same master mix. The hypothesis was that it would cause the two probes to comp ete with one another for their sequence specific target and increase their specificity. The same master mix and qPCR protocol were used with this test. The Xp probe and the Xe probe still picked up both

PAGE 47

47 Xe strain 157 and Xp strain 1484. However, there was an increase in the difference between the Ct values for both probes. The Xp probe picked up Xp strain 1484 4.23 cycles before the Xe strain 157 ( Figure 2 3 A ) and the Xe probe picked up Xe strain 157 10.33 cycles before the Xp strain 1484 ( Figure 2 3 B ). These results were encouraging and led to the testing of the Xg and Xv specific probes and primer set. Based on the previous optimization results for Xe and Xp specific probes and primer set s , the X g specific probe and primer set w ere first tested usi ng the master mix containing 800 nM probe and primer concentration at a Tm of 59°C. However, this combination did not yield similar results. There was no amplification of the target DNA of GA2 or any of the other samples ( Figure 2 4 A ). Therefore, different protocols were tested with different Tms of 57, 62, 63, 65, 67, and 69°C. Target amplification was not observed until the Tm reached 6 7 °C, but the curves and Ct values were t he most optimal at 69°C ( Figure 2 4 A and B ). Additionally, the Xg specific probe only amplified GA2 DNA and not the other control strains. Other Xg strains were tested to confirm this trend; UF1 through UF9 were used in the next two experiments in addition to the five control strains. The boiling method was used to extract DNA from the UF strain s. The same master mix and qPCR protocol containing a Tm of 69°C were used. Once again the Xg specific probe and primer set, only amplified the Xg strains UF5, UF9, and GA2 ( Figure 2 4 C ). Since the Xv specific probe shares its primer set with the Xg specific probe, it was assumed that it would amplify well at 69°C. The s ame parameters were used as previously described using the UF strains 1 through 9, and the control strains. The Xv specific probe and primer set only amplified both groups belonging to Xv ( Figure 2 4 D ). Since these two probes re quire a Tm of 69°C, the Xp and Xe specific probes with the FAM and TET dye set, respectively, and their primer set were tested with the Tm of 69°C. This increase in Tm caused the Xe and Xp specific probes to

PAGE 48

48 only amplify DNA from Xp strain 1484 and Xe st rain 157, respectively ( Figure 2 3 C and D ). For the multiplex optimization, the probes listed in T able 2 2 were used for the remainder of the study. Based on the previous results, the qPCR protocol wi th a Tm of 69°C was used. Therefore, the final optimized qPCR cyc ling protocol is as fo llows: Stage 1) 95°C, 30 sec, Optics off, Stage 2) i] 95°C, 3 sec, Optics off, ii] 69°C, 30 sec, Optics on, and iii] 72°C, 30 sec, Optics off. Since the Tm is close to the extension temperature of 72°C, the extension step (iii) was eliminated from the protocol as it should not affect the results of the multiplex assay. It will simply shorten the reaction time. Three different master mix solutions were made by varying the probe and primer concentrations (1 , while maintaining 1 to 2 ratio s . The volumes of each master mix are 2 Taq lues and curves for all tested samples. The multiplex results with this cycling protocol and master mix can be seen in Figure 2 5 in which DNA from 2 Xv (MME and 1111), 6 Xe (11, 1520, 9060, Xv881, NG21, and NG70), 3 Xg (Xg51, 44 4, and 452), and 2 Xp (NG4 and NG68) strains was amplified only by their corresponding probes and primers. The previously described qPCR cycling protocol and finalized master mix were used for validation of the mult iplex assay in which DNA from 72 pure cu ltures of different Xanthomonas strains were tested. All 72 strains gave the expected results and the multiplex assay functioned properly ( Table 2 1 ).

PAGE 49

49 Since the multiplex assay efficiently and accurately amplifies DNA from pure c ultures of the four bacterial spot species, the next step was to test DNA extracted from lesions from tomato and pepper leaves and fruit if possible. Infected tissue was collected from various field or greenhouse locations in Fl orida. DNA was extracted fro m lesions from approximately 30 symptomatic tomato and pepper leaves and 2 tomato fruits. The extracted DNA products were then tested using the multiplex bacterial spot qPCR assay. For a majority of the samples, the Ct values for the DNA extracted from lea f lesions were similar to the Ct values for DNA extracted from their corresponding pure cultures. However, some of the DNA extracted from older tomato leaf lesions from the field did not amplify with this qPCR assay. The Xp specific probes were able to amp lify DNA extracted from pure cultures isolated from the same lesions. These results can be seen in F igure 2 6 , which represents DNA extracted from all tissue types. The pepper leaves were positive for X e and the tomato leaves and fruit were positive for X p ( Table 2 3 ). Evaluation of the Two Group Specific Probes for X. vesicatoria The two group specific Xv probe s and a corresponding primer set were tested separately from the multiplex qPCR a ssay described above. 141, 144, 157, 1484, and GA2 were used as controls in this part of the study. Working solutions consisting of 800 and 400 nM concentrations were created for each probe and primer. The master mix used is as follows: 8.2 nM MgCl 2 Taq per each sample. The following qPCR cycling protocol was used: Stage 1) 95°C, 30 sec, Optics off, Stage 2 ) i] 95°C, 3 sec, Optics off, ii] 59°C, 30 sec, Optics on, and iii] 72°C, 30 sec, Optics off. The 800 nM working concentration appeared to be the best based on the observed Ct values and curves for both probes ( Figure 2 7 ). A sim ilar result was observed with the group specific Xv probes as the Xe and Xp specific probes. However, the Xv group1 specfic probe resulted in a greater difference in Ct

PAGE 50

50 values (6.48) between the two groups ( Figure 2 7 A ). This greater difference was not seen with the Xv group 2 specific probe ( Figure 2 7 B ). Ten additional Xv strains were tested and the same phenomenon was observed for each one. Discussion As predicted, the hrpB2 gene is high ly conserved amongst strains from the same species of Xanthomonas and is an ideal candidate for creating identification or diagnostic assays. All of the tested strains from X p , X e , and X g were 100% identical within their given species. Xp and Xe were the t wo most closely related species based on the hrpB2 in which they only varied by 2 SNPS. This fact resulted in the development of qPCR species specific probes rather tha n species specific PCR primers because qPCR is highly sensitive and many qPCR assays are able to differentiate target sequences that differ by only one nucleotide. There is a slight variation amongst the strains of Xv in terms of only one nucleotide at position 331. However, the significance of this variation is unclear at this time. It does not appear to follow a distinct pattern in terms of geographical location because different strains from various locations fall into both groups. For example, Xv strains from Ethiop ia fall into both groups. Therefore, two group specific probes were also c reated, but are not necessary for the multiplex assay. Additionally, the four bacterial spot species are clearly separated from the other species that were evaluated which can be seen clearly in F igure 2 1 . Initially, each speci es specific probe and their corresponding primer set were tested separately from one another before being tested together as part of a multiplex qPCR assay. This revealed that individually the probes are not very specific because we were getting false posi tives with closely related species. For example, the Xp specific probe gave positive results for strains belonging to both Xp and Xe . This could be due to the fact that the Xp and the Xe specific probes can form a secondary structure , which can affect the purified yield, purity measurements,

PAGE 51

51 and/or their use in certain applications. The simplest solution would have been to design new probes in another region of the hrpB2 . However, this was not possible for the Xp and the Xe specific p robes or the two group specific probes for Xv because they only varied by two or one SNPs , respectively. It was assumed that developing a master mix that contained both probes (with different reporter dyes) would increase the specificity of the probes by c ausing them to compete with one another for their targets ( F igure 2 3 A and B ) . Additionally, in creasing the Tm can overcome a probes ability to form a secondary structure. Individually, the increase in Tm did not appear to incre ase the specificity of the Xp and the Xe specific probes ( F igure 2 2 E ). However, when both approaches were combined, there was a greater increase in specificity ( Figure 2 3 C and D ). Similar to the o ther two species specific probes, the Xg and the Xv specific probes do form secondary structures. However, only the secondary structure for Xg specific probe has the potential to affect the purified yield, purity measurements, and/or their use in certain applications. This could be the reason that the higher Tm o f 69°C is required for the Xg specific probe to successfully amplify the target DNA from Xg strains. Another factor that may affect the yield is the location of the target SNP in the probe sequence. All of the probes were designed with the target SNP in the center of the sequence except for the Xv group1 specific probe. All of the probe sequence targets are highlighted in red in T able 2 2. In order to design all of the probes with a calculated Tm of 69°C, the target SNP for Xv group2 specific probe ars to account for the greater difference in Ct values observed between the two Xv groups with the Xv group1 specific probe ( Figure 2 7 A ). This needs to be further validated by testing the Xp and the Xe specific probes with the necessary for this study since the increase in Tm and the multiplex master mix resolved the

PAGE 52

52 problem. After successful optimization, this multiplex qPCR assay has proven to be highly specif ic to the four causal agents of bacterial spot ( Figure 2 5 ). qPCR has gained popularity in plant disease diagnostics because it is a rapid, highly sensitive, and easily reproducible technique that also reduces carry over contamin ation. As previously, mentioned qPCR assays have been developed to detect several plant pathogens including C. michiganensis subsp. sepedonicus , R. solanacearum , Agrobacterium strains, Xylella fastidiosa , Candidatus liberibacter asiaticus , and X. citri pv. citri (Golmohammadi et al. 2007 ; Li et al. 2 006 ; Schaad and Frede rick 2002). However, the full potential has not been recognized for this technology in plant pathology. To our knowledge, only one multiplex qPCR has been developed to simultaneously detect four different pathogenic species at one time. Schena et al. ( 2006 ) developed a multiplex qPCR assay designed to detected four pathogenic species of Phytophthora ( P. ramorum , P. kernoviae , P. citricola , and P. quercina ). Their results indicated that multiplex qPCR assay can be a reliable and sensitive tool to detect mult iple pathogens at once. However, there are some obvious advantages and disadvantages to using this type of detection method for bacterial spot of tomato pathogens or any other plant pathogen. In terms of the disadvantages, the initial set up for a lab not already using qPCR can be rather expensive. A thermal cycler for qPCR detection can cost up to 30 thousand dollars depending on the make and model of the machine. This cost does not include the master mix components or the probes and primers required for the assay. The probes and primers for this multiplex bacterial spo t assay will cost around 12 hundred dollars in total. However, these probes and primers will last for hundreds of samples. Therefore, if a lab is already running qPCR assays then the cost wi ll go down substantially. As indicated, any qPCR assay will require time, money, and persistence to

PAGE 53

53 properly develop. However, this multiplex qPCR assay for bacterial spot has already been developed and validated. Therefore, it will not require any extra w ork for other researchers who will be using this assay as long as they follow the optimized protocol presented in this study. The main limitation to this assay is that it will not be able to detect a new species or strains of Xanthomonas associated with ba cterial spot of tomato or pepper. In general, there are more advantages to using this multiplex qPCR assay for the four causal agents of bacterial spot than the other commonly used methods. The most common method for distinguishing plant pathogenic xanth omonads is PCR. This can include any method that utilizes PCR primers to amplify a target, such as 16s rRNA, housekeeping genes, or hrpB , that will be sequenced or digested with restriction enzymes. Including the time required for obtaining a pure culture, these assays can take at least 2 weeks to complete and obtain results. In comparison, our multiplex assay can identify a bacterial spot species within a day if you are able to successfully extract DNA from fresh lesions. As previously mentioned, some of t he DNA extracted from older field tomato leaf lesions did not amplify with this qPCR assay. The lack of amplification appeared to be associated with the condition of that particular sample. These samples were already in a state of decay or the leaf lesions were old and disintegrating. The lack of target amplification could be due to the abundance of inhibitors that are typically present in these older leaf samples. Occasionally, performing a one to ten dilution could overcome the presence of inhibitors in t he sample. Although these samples were qPCR negative, typical Xanthomonas colonies were isolated, purified, and subsequently tested positive for X p . Therefore, the leaf extraction protocol works best on intact samples with young or newly emerged lesions. E ven if DNA extraction from bacterial lesions is not possible and a purified culture is required, the whole assay can be finished within 8 to 10 days in most cases. When

PAGE 54

54 compared to race determination via avr genes, this assay does not require the time and materials needed for the seeding and maintaining of different tomato varieties required for identification. In general, this assay has shown to be much more time efficient than the current identification methods for the four bacterial spot pathogens. Mor eover, if the outlined protocol is followed, this multiplex qPCR for bacterial spot of tomato should be easily reproducible by any diagnostic or research lab. Furthermore, this novel method for detecting the four causal agents of bacterial spot can be beneficial to a wide variety of researchers. Epidemiologists will be able to monitor changes in the bacterial spot population overtime and in different areas or regions with ease and accuracy. Additionally, researchers will be able to compare results with one another beca use this identification assay can be easily replicated. In terms of diagnostic laboratories, technicians will be able to quickly identify which Xanthomonas field. Moreover, breeders could use the information collected by epidemiologists and diagnostic labs in order to specifically target a bacterial spot species present in a field. For example, the use of a re sistant tomato cultivar that is specific to one species would be much more efficient than having to target all four. In general, the outlined multiplex qPCR assay for the four causal agents of bacterial spot is rapid, accurate, and easily reproducible. The refore, this multiplex assay has the potential to benefit many plant pathologists and is vast improvement over the current identification techniques for these four pathogens.

PAGE 55

55 Table 2 1. Bacterial s trains used in this study for the phylogenetic analysis , validation of the multiplex qPCR assay, or both Species Strain Origin hrpB2 sequenced qPCR c X. perforans 621 Florida N Y 938 Florida Y Y 1220 Thailand/seed Y Y 1484 Mexico Y Y 1712 Florida N Y 2010 Florida pepper Y Y GEV839 a , 872, 893, 904, 909, 915, 917, 936, 940, 968, 993, 1001, 1026, 1044, 1054, & 1063 Florida Y N ETH5 a , 11, 13, 14, 19, 21, 22, 25, 26, 28, 29, 31, 32, & 33 Ethiopia Y Y NG4 a & 68 Nigeria Y Y X. euvesicatoria 11 China N Y 153 & 155 Florida Y Y 157 Australia Y Y 330, 338, & 9060 Barbados Y Y 1085 Mexico Y Y 1520 Sudan N Y 1605 Ohio Y Y IP Vietnam pepper N Y NG21 a & 70 Nigeria Y Y XV881 Spain N Y X. vesicatoria 56 Brazil Y Y 141 New Zealand Y Y 144 Argentina Y Y 1111 New Zealand/Type strain Y Y ETH1 a , 2, 3 a , 4, 17 ,18, & 20 Ethiopia Y Y MME Ohio N Y UF1 California Y Y UF2 California N Y UF3 Italy Y Y UF4 California N Y UF6 California Y Y UF7 Brazil Y Y UF8 Brazil N Y X. gardneri 444 &451 Costa Rica Y Y 1782 & 1783 Brazil Y N OOT12B Ohio Y N ETH7 a , 8, 9, 10, 15, 16, 23, 24, & 30 Ethiopia Y Y FURMAN 3 Pennsylvania Y N

PAGE 56

56 Table 2 1. Continued. Species Strain Origin hrpB2 sequenced qPCR c X. gardneri GA2 Hungry Type strain Y Y UF5 Canada Y Y UF9 Brazil Y Y Xg51 Canada N Y the hrpB2 then the hrpB2 sequence was not obtained for that strain. and confirmed positive for one of the four causal agents of bacterial spot using the multiplex qPCR. tested using the Multiplex qPCR assay for the four causal agents of bacterial spot. Table 2 2. qPCR p robes and p rimers used in this study X. perforans Probe ( Xp probe) FAM/CGGGCAAGGAGC C ATCGCCTGT/31ABkFQ/ X. euvesicatoria Probe ( Xe probe) C GCAATCGCCTGT/3BHQ_2/ X. perforans and X. euvesicatoria Primer Set (FP1 and FP2) CGTCGACGGCCTGGGCGA CCGGTGCCTGCGCCTGGA X. gardneri Probe ( Xg probe) /5TexRd XN/TGCGCCAGCG T GACGGCACGC/3IAbRQSp/ X. vesicatoria Probe1 (Xv probe1) /5Cy5/TGCGCCAGCG C GATGGCACGC/3IAbRQSp/ X. gardneri and X. vesicatoria Primer Set (FP2 and RP2) AGGTCAGCCTGGGCGAGGT TGAAGCCCACCACCTCGGC X. vesicatoria Probe 2 ( Xv probe2) (Group1) FAM/CGAACA G CCCATGCCAACCGGC/31ABkFQ/ X. vesicatoria Probe 3 ( Xv probe3) (Group2 ) A CCCATGCCAACC/3BHQ_2/ X. vesicatoria Group 1 and 2 Primer Set (FP3 and RP3) AGGCGCCCGACCCCATGC 3 CGTCATCAGGCCATCGACGA Note: The letters in red font are the target SNPs for that specific probe.

PAGE 57

57 Table 2 3. Multiplex qPCR results for DNA extracted from infected plant tissue Species Sample Name Tissue Type Source/ Mode of Infection qPCR Lesion Result qPCR Culture Result X. perforans T1 Tomato leaves Field/ Natural Negative Positive T2 Tomato leaves Field/ Natural Positive Positive T3 Tomato leaves Field/ Natural Negative Positive T4 Tomato leaves Field/ Natural Negative Negative T5 Tomato leaves Field/ Natural Negative Positive T6 Tomato leaves Field/ Natural Negative Positive T7 Tomato leaves Field/ Natural Negative Positive T8 Tomato leaves Field/ Natural Negative Positive T9 Tomato leaves Field/ Natural Negative Positive T10 Tomato leaves Field/ Natural Negative Positive F1 Tomato fruit Field/ Natural Positive Positive F2 Tomato fruit Field/ Natural Positive Positive 3220 Tomato leaves Field/ Natural Negative Positive 9595 Tomato leaves Field/ Natural Positive Positive S3027 Tomato leaves Field/ Natural Positive Positive S3066 Tomato leaves Field/ Natural Positive Positive RPR863 Tomato leaves Field/ Natural Positive Positive RPR1483 Tomato leaves Field/ Natural Positive Positive GH1 Tomato leaves GH/ Artificial Positive Positive GH2 Tomato leaves GH/ Artificial Positive Positive GH3 Tomato leaves GH/ Artificial Positive Positive GH4 Tomato leaves GH/ Artificial Positive Positive GH5 Tomato leaves GH/ Artificial Positive Positive GH6 Tomato leaves GH/ Artificial Positive Positive GH7 Tomato leaves GH/ Artificial Positive Positive GH8 Tomato leaves GH/ Artificial Positive Positive GH9 Tomato leaves GH/ Artificial Positive Positive GH10 Tomato leaves GH/ Artificial Positive Positive GH11 Tomato leaves GH/ Artificial Positive Positive GH12 Tomato leaves GH/ Artificial Positive Positive GH13 Tomato leaves GH/ Artificial Positive Positive GH14 Tomato leaves GH/ Artificial Positive Positive GH15 Tomato leaves GH/ Artificial Positive Positive GH16 Tomato leaves GH/ Artificial Positive Positive X. euvesicatoria P1 Pepper leaves Field/ Natural Positive Positive P2 Pepper leaves Field/ Natural Positive Positive P3 Pepper leaves Field/ Natural Positive Positive P4 Pepper leaves Field/ Natural Positive Positive P5 Pepper leaves Field/ Natural Positive Positive Note: GH=greenhouse

PAGE 58

58 Figure 2 1. Condensed maximum likelihood phylogenetic tree with bootstrap values based on the hrpB2 . X. euvesicatoria X. perforans X. vesicatoria group 1 X. vesicatoria group 2 X. gardneri

PAGE 59

59 A B C D E Figure 2 2. FAM graphs representing the optimization process of the X. euvesicatoria and X. perforans specific probes and their corresponding primers using DNA extracted from pure cultures. A) amplification of 157 and 1484 with individual master mixes with either 100 (green & orange), 200 (black & pink), 400 (red & brown), or 800 (blue & navy) nM of Xp probe, FP1, and RP1, B) the optimal individualized master mix containing 800 nM of Xp probe, FP1, and RP1 amplifying DNA from 157 (navy) and 1484 (blue), C) amplified DN A from 157 and 1484 using either 1200 nM (blue & navy) concentration of Xp probe or 400 (dark blue & green), 800 (black & pink),or 1200 (red & brown) nM concentrations of Xe probe, FP1, and RP 1 , D) the optimal individualized master mix containing 800 nM of Xe probe, FP1, and RP1 amplifying DNA from 157 (black) and 1484 (pink), E) amplified DNA of 157 and 1484 using the optimized individual master mix for Xp probe, FP1, and RP1 with three different Tms of 59 (blue & navy), 61 (red & brown), and 63°C (black & pink).

PAGE 60

60 A B C D Figure 2 3. FAM and TET graphs representing the observed increase in specificity when the X . euvesicatoria and X . perforans specific probes and their corresponding primers were put into the same master mix and the DNA was extracted from pure cultures. A) FAM graph showing the Xp probe amplifying both DNA from 157 (red) and 1484 (brown) with a difference of 4.23 in Ct values at Tm of 59°C, B) TET graph showing the Xe probe amplifying DNA from both 157 (red) and 1484 (brown) with a d i fference of 10.33 in Ct values at Tm of 59°C, C) FAM graph showing Xp probe only amplifying DNA from 1484 (blue) at Tm of 69°C, D) TET graph showing Xe probe only amplifying DNA from 157 (navy) at Tm of 69°C .

PAGE 61

61 A B C D Figure 2 4. FAM graphs representing the optimization of the X. gardneri and X. vesicatoria specific probes and their corresponding primers at the 800 nM concentration using DNA extracted from pure cultures. A) No amplification of the target GA2 with a master mix cont aining Xg probe, F P2, and RP2 using a Tm of 57, 59 , 62, or 63°C, B) Tm gradient of 65, 67, and 69°C and target (GA2) amplification occurred only at 67 ( grey ), and 69°C (orange ) with a master mix containing Xg probe, FP 2, and RP2, C) Validation test of Xg p robe, F P2, and RP2 using DNA extracted from pure cultures of UF5 (blue), UF9 (red), and GA2 (yellow) D) Validation test of Xv probe1, F P2, and RP2 using UF1 (black), UF2 (grey), UF3 (purple), UF4 (navy), UF6 (Teal), UF7 (light blue), UF8 (orange), 141 (gol d), and 144 (brown).

PAGE 62

62 A B C D Figure 2 5. qPCR graph outputs showing amplified DNA from pure cultures representing the four causal agents of bacterial spot using the optimized multiplex qPCR assay master mix with 3 with the Xp probe amplifying DNA from 2 Xp strains, NG4 (black) and NG68 (pink), B) TET graph associated with the Xe probe amplifying DNA from 6 Xe strains, 11 (orange), 1520 (light blue), 9060 (gold), Xv88 1 (green), NG21 (teal), and NG70(sky blue), C) Cy5 graph associated with the Xv probe 1 amplifying DNA from 2 Xv strains, MME (grey) and 1111 (blue), D) TxR graph associated with the Xg probe amplifying DNA from 3 Xg strains ,Xg51 (brown), 444 (fuchsia), a nd 451 (purple).

PAGE 63

63 A B C D Figure 2 6. DNA extracted from infected pepper and tomato tissue detected by the multiplex qPCR assay using DNA from pure cultures of each species as positive controls. A) FAM graph associated with the Xp probe amplifying DNA from artificially (grey, orange, green, gold, brown, red, lime green, & light blue) and naturally infected tomato leaf lesions (teal), naturally infected fruit lesions (navy & blue), and the positive control from the pure culture of 14 84 (teal), B) TET graph associated with the Xe probe amplifying DNA from naturally infected pepper leaf lesions (light pink, black, grey, fuchsia, & purple) and the positive control from the pure culture of 157 (pink), C) Cy5 graph associated with the Xv p robe 1 only amplifying DNA from a pure culture of 141 (a positive control), D) TxR graph associated with the Xg probe only amplifying DNA from a pure culture of the positive control, GA2 (grey).

PAGE 64

64 A B C D Figure 2 7. The observed FAM graphs for the group specific X. vesicatoria probes amplifying DNA extracted from pure cultures from both groups of X. vesicatoria . A) 800 nM Xv Probe2, FP3, and RP3 concentrations amplifying DNA from pure cultures of 141 (navy) & 144 (grey), B) 400 nM Xv Probe2, FP3, and RP3 concentrations amplifying DNA from pure cultures of 141 (red) & 144 (green), C) 800 nM Xv Probe3, FP3, and RP3 concentrations amplifying DNA from pure cultures of 141 (grey) & 144 (purple), D) 400 nM Xv Probe3, FP3, and RP3 concentrations ampl ifying DNA from pure cultures of 141 (orange) & 144 (green).

PAGE 65

65 CHAPTER 3 A SILVER BASED NANOMATERIAL FOR THE MANAGEMENT OF BACTERIAL SPOT OF TOMATO CAUSED BY XANTHOMONAS PERFORANS Introduction Bacterial spot of tomato is caused by four species of Xanthomonas ( X. euvesicatoria , X. gardneri , X. perforans, and X. vesicatoria ) (Jones et al. 2004). As of 2006, the dominant bacterial spot species of tomato in Florida is X. perforans (Vallad et al. 2010). It is one of the most detrimental diseases of toma to that occurs worldwide, having a high impact on yield on tomatoes grown in warm, moist areas such as Florida. If weather conditions are optimal, bacterial spot is estimated to cause yield losses of up to 50% (Louws et al. 2001 ; Vallad et al. 2010). Succe ssful infection by any of the four pathogens typically results in leaf and fruit lesions, defoliation, and yield loss of marketable fruit (Louws et al. 2001 ; Ritchie 2000). Although spots do not deeply penetrate into fruit tissue, fruit lesions can signifi cantly impact fruit quality and marketability (Jones et al. 2004 ; Miller et al. 2013 ; Mo mol et al. 2008 ; Ritchie and Averre 1996 ; Ritchie 2000). In 2013, Florida harvested 34 , 0 00 total acres of fre sh tomatoes making it the leading fresh market producer in the United States (USD A 2014). Bacterial spot of tomato can be difficult to manage and a successful disease management strategy is crucial for maintaining the tomato industry in the state of Florida. Unfortunately, many strategies such as use of the antibiotic streptomycin and copper based bactericides have dominant method for bacterial spot management. However, it did not take long for the pathogens to develop resistance to the antibiotic and streptomycin lost efficacy even when applied at high rates such as 400 ppm in Florida field trials (Thayer and Stall 1962). After the emergence of streptomycin resistance, copper based bactericides became the chemi cal of choice for disease management. Due to multiple applications and continuous use, copper resistance emerged in the

PAGE 66

66 bis dithiocarbamates such as mancozeb to copper based bactericides . Initially, the addition of mancozeb to copper resulted in improved disease control and it became the grower standard. a coppe r suspension alone (Conover and Gerhold 1981 ; Marco and Stall 1983). Unfortunately, it has been reported that copper mancozeb will not adequately control bacterial spot when copper tolerant strains are present in optimal disease conditions (Jones and Jones ; 1985 ; Obradovic et al. 2004a). In Florida, all X. perforans strains are copper tolerant and copper based management strategies are no t very effective (Vallad et al. 2010). Currently, copper mancozeb is used in combination with several different cultural practices to reduce yield loss due to bacterial spot such as using disease free seedlings. However, the difficult part is maintaining disease free transplants during production due to streptomycin and copper resistance (Cooksey 1990 ; Gitaitis et al. 1992 ; Thayer and Stall 1962). However, exclusion of the pathogen from transplant production areas is the main control strategy. This strategy is rather impractical because it is difficult to intercept all the possible inoculum sources such dissemination from nea rby infested fields, workers, and equipment (Gitaitis et al. 1992). Thus effective antibacterial compounds are currently not available for use in tomato transplant production, which is a major drawback. Researchers have continued to evaluate other options for managing bacterial spot of tomato such as systemic acquired resistance (SAR) inducers, biofilm inhibitors, and light activated nanomaterials. Applications of s ynthetic SAR inducers, such as a cibenzolar S methyl (ASM; Actigard 50W®, Syngenta Crop Protec tion, Greensboro, NC) have also been tested for bacterial spot management. ASM triggers the plants natural defense response and has been shown to increase resistance to bacterial spot in tomato plants when compared to untreated

PAGE 67

67 controls (Obradovic et al. 2 005). Worthington et al. (2012) evaluated a small molecule additive that is an analogue of the marine sponge natural product oroidin called 2 aminoimidazole (2AI). 2AI in combination with copper has been shown to suppress copper resistance and decrease bio film formation of X. euvesicatoria in vitro . Additionally, b ell pepper plants treated with 2AI and copper decreased bacterial spot disease severity and increased fruit yields. Recently, light activated titanium dioxide (TiO 2 ) based nanomaterials have been evaluated for managing bacterial spot caused by X. perforans . In the presence of light, TiO 2 chemically generates reactive oxygen species (ROS) which are toxic to the pathogen. Paret et al. (2013) evaluated the use of nanoscale TiO 2 alone, and TiO 2 dop ed with either Ag or Zn against X. perforans . Greenhouse and field trials revealed that TiO 2 /Zn significantly reduced disease incidence on treated plants when compared with copper based bactericides. However, TiO 2 /Zn has no antibacterial effect in the abs ence of light and tomato plants exhibited phytotoxicity starting at the 6 th application of the material at ~500 ppm in field trials conducted in Florida. This is a limiting factor in the current commercialization of this technology Recently, silver based nanomaterials have been evaluated for managing bacterial spot of tomato and could be a potential alternative to copper based bactericides in tomato transplant production. The exact mode of action is not well studied for silver nanoparticles (AgNPs), but th ey are thought to interact with thiol, carboxyl, hydroxyl, amino, phosphate, and imidazole groups in bacterial membrane surface proteins. This interaction causes structural deformation of the cell membrane. In general, deformed cells then can uptake free Ag ions that can inactivate enzymes, inhibit cell replication and respiration, and cause cell death (Ocsoy et al. 2013b ; Pan . 2006) . Unfortunately, AgNPs have the tendency to aggregate, which can reduce their antibacterial activity due to the reduction in covered s urface area. Ocsoy et al. (2013 b )

PAGE 68

68 designed an Ag based nanomaterial termed Ag dsDNA GO in order to alleviate this problem observed with bare AgNPs. AgNPs are grown on dsDNA in order to control AgNP size and aggregation. The ds DNA also serves as a bridge between the Ag NPs and graphene oxide (GO). GO increases the adhesive force between the Ag GO composite and bacterial cell membranes. GO is a carbon based sheet that is composed of a single layer of carbon atoms with active s urface hydroxyl, epoxy, and carboxyl groups. This sheet increases the antibacterial effect of AgNPs by causing an even distribution of the AgNPs and larger total surface area coverage. The resulting Ag dsDNA GO composite was found to effectively decrease X . perforans cell viability in vitro and in planta . In vitro , a 16 ppm concentration of Ag dsDNA GO was highly effective in inhibiting bacterial growth. Additionally, this composite had improved stability and enhanced antibacterial activity when compared to bare AgNPs and Ag GO NPs alone. Also, a preliminary greenhouse study indicated that tomato plants treated with a 100 ppm concentration of Ag dsDNA GO significantly reduced disease severity when compared to untreated plants and gave similar control to copp er mancozeb. Ag dsDNA GO has pronounced bactericidal effects and at 100 ppm was able to control bacterial spot at levels comparable to copper mancozeb in a single greenhouse trial. It was hypothesized that this silver based nanocomposite would be able to effectively manage bacterial spot in tomato transplant production. Therefore, the effect of the Ag dsDNA GO on the growth of copper tolerant and copper sensitive X. perforans strains was evaluated in two in vitro assays. Additionally, t he effect of Ag dsDN A GO on bacterial spot disease severity caused by a copper tolerant X. perforans strain was evaluated in three separate greenhouse experiments.

PAGE 69

69 Materials and Methods Bacterial Strains and Storage Two X. perforans strains were used in this study, GEV485 (copper tolerant) and 91 118 (copper sensitive). Both of these strains were isolated from Florida tomatoes. For short term storage, bacteria were grown on nutrient agar (NA) medium (BBL, Becton Dickinson and Co., Cockeysville , MD) at 28°C a nd transferred e very 24 to 48 h r. For long term storage, purified cultures were stored in a sterile 30% glycerol solution at 80°C. Synthesis of DNA The nucleotides and CPG were provided by Glen Research (Sterling, VA). DNA Oligonucleotides, DNA 1: 5' AAT GTG CTC CCC CAG CGCGCTT FITC 3' and DNA 2: 3' TTA CAC GAG GGG GT 5', were synthesized on an ABI 3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA). After deprotection of DNA1 and DNA2, they are purified with reversed phase HPLC, (ProStar, Varian, Walnut Cre ek, CA) by using a C18 column (Econosil, 5 µm, 250 4.6 mm) from Alltech (Deerfield, IL). After purification, DNA solutions were allowed to dry in the centriVap centrifugal vacuum concentrators (Labconco, Kansas City, MO), and then concentration of each DNA solution was calculated using absorbance value of DNA from UV Vis spectrum and extinction coefficient of DNA obtained from Integrated DNA Technologies, Inc (IDT©) (Coralville, IA). Synthesis of Ag dsDNA GO The c oncentration and size of the single layer graphene oxide (GO) are 5 g/L and 0.5 µm 3 µm respectively and were purchased from the Graphene Supermarket (Ronkonkoma, NY). Silver nitrate, 99% (AgNO 3 ), sodium borohydride (NaBH 4 ) 98%, and 4 (2 hydroxyethyl) piperazine 1 ethanesulfonic acid (HEPES) were purchased from Sigma Aldrich. Sodium nitrate (NaNO 3 ) was obtained from Alfa

PAGE 70

70 water was used in the all experiments (Millipore Co., Billerica, MA, USA). The same concentrations of DNA 1: 5' AAT GTG CTC CCC CA GCGCGCTT FITC 3' and DNA 2: 5' TGG GGG AGC ACA TT 3' were hybridized by mixing together in HEPES buffer (pH 7.5) for 30 min. The hybridized DNA1 and DNA2 solution was added to 50 µg/mL of GO solution for 30 min in order to adsorb hybridized double stranded DNA (dsDNA) on the surf ace of GO . AgNO 3 solution was added to mixture of dsDNA adsorbed GO solution to achieve a final concentration of 100 µM Ag + ions. After stirring the mixture for 10 min, freshly prepared NaBH 4 was deposited into the mixture drop by drop with final concentra tion of NaBH 4 of 500 µM. The resulting mixture was stirred for 1 hr. After stirring, the final mixture was centrifuged to stop the reaction. The precipitate was dispersed with HEPES buffer, and centrifuged at 12,000 rpm for 15 min. The washing process was repeated three times. Instrumentation and Characterization A few drops of Ag dsDNA GO composite suspended in water were deposited onto carbon film coated copper grids and allowed to dry for overnight. Transmission electron microscopy (TEM) images were generated using a Hitachi H 7000 wit h 100 kV voltages (Ocsoy et al. 2013a). The absorbance spectrum of Ag dsDNA GO composite was obtained with an 1800 UV Vis (Shimadzu Scientific Instruments, Columbia, MD) as previously described (Ocsoy et al., 2013b). In Vitro Assays Two X. perforans strains, GEV485 (copper tolerant) and 91 118 (copper sensitive), were used in the in vitro assays. The bacterial s trains were retrieved from long term storage, aseptically transferred to nutrient agar (NA) plates, and incubate d for 24 hr at 28 °C. The bacterial strains were then transferred to NA plates containing 20 ppm of copper in the form of c opper (II) sulfate pentahydrate ( CuSO 4 ·5H 2 O ) (Sigma Aldrich ® , St. Louis, MO ) and incubated

PAGE 71

71 for 24 hr at 28 °C. Bacterial suspensions we re prepared for each strain and adjusted to an A 600 =0.3 at 600 nm ( ~5 x10 8 CFU/mL). The bacterial suspensions were then diluted to 10 3 CFU/mL. For each strain, 20 mL of each of the following treatments in a sterile glass tube: Ag dsDNA GO at 10, 25, and 50 ppm; and copper prepared from (0.167 g/L) . metallic copper in the form of c opp er hydroxide ( Cu(OH) 2 ) . 1 ppm of copper. Each treatment was prepared in triplicate for each strain. Additionally, for each strain, one sterilized glass tube containing 2 mL of sterilized tap water and 20 bacterial working suspension served as a control. The tubes were placed on a shaker in an incubator held at 28°C. Any changes in the bacterial populations overtime were measured by sampling 50 min, 1 hr, 4 hr, and 24 hr. The sample s were plated on NA and incubated for 48 hr at 28°C. The number of colonies formed on each plate was counted in order to calculate the colony forming units (CFU)/mL for each time period. Each treatment consisted of three replicates and e ach in vitro assay was repeated two times. Greenhouse Experiments Two hundred milliliters of the following treatments were prepared in sterile tap water for the first experiment: 100, 200, and 500 ppm of Ag dsDNA Kocide® 3000 (2.1 g/L) and Pennc ozeb® 75DF (1.2 g/L); and sterile tap water. A 75 ppm concentration of Ag dsDNA GO was substituted for the 500 ppm concentration of Ag dsDNA GO for the second and third greenhouse replications. There were four plants per treatment in each experiment replic ation. The chemical suspensions were then applied as foliar sprays onto both the underside and upper side of three to four week old Bonnie Best tomato leaves until run off. Four pla nts were sprayed with sterile tap water , which served as the untreated cont rol. The

PAGE 72

72 chemicals were allowed to dry thoroughly before bacterial inoculation, which usually took between 2 to 5 hr. The copper tolerant X. perforans strain GEV485, was used in the greenhouse experiments. GEV485 was retrieved from long term storage, aseptically transferred to NA plates, and incu bated for 24 h r at 28 °C. A bacterial suspension was prepared and adjusted to 5 x10 8 CFU/mL. This suspension was then sprayed onto both sides of the tomato leaves. The inoculated seedlings were then placed in p lastic bags tightened around the base of the pot with a rubber band and placed in a growth chamber at 28 °C for 48 hr. The bags were then carefully removed and the plants remained in the growth chamber for 5 additional days before transferring them to the g reenhouse. The plants were rated using the Horsfall Barratt disease severity scale every other day beginning at 10 days and with the last rating at 17 days post inoculation. The area under disease progress curve (AUDPC) was then calculated using the midpoi nt values outlined in Bock et al. (2009). Leaf Sample Preparation for SEM A fter the chemicals were allowed to dry, leaf samples were taken from the 500 ppm Ag dsDNA GO treated tomato plants. These leaf samples were then fixed with Trumps fixative (McDowell and Trump 1976) and stored overnight at 4 ° C. Fixed leaves were processed with the aid of a Pelco BioWave laboratory microwave (Ted Pella, Redding, CA, USA). Samples were washed in 1X PBS, pH 7.24, post fixed with 2% buffered osmium tetroxide, water washe d, dehydrated in a graded ethanol series 25%, 50%, 60%, 75%, 95%, 100% and critical point dried (Tousimis, Rockville, MD USA). Dried samples were mounted on double sided adhesive tabs on aluminum specimen mount, Au/Pd sputter coated (DeskV, Denton Vacuum , Moorestown, NJ USA) examined and high resolution digital micrographs acquired with field emission scanning electron microscope (SEM)(S 4000, Hitachi High Technologies America, Inc. Schaumburg, IL USA).

PAGE 73

73 Statistics T he data collected from the in vitro a ssays and the greenhouse experiments were evaluated for statistical significance using either the Least Significant Difference (LSD) or the Student Newman Keuls (SNK) method , respectively, in IBM ® SPSS ® Statistics Version 22 and a p value of 0.05 were used to evaluate the data. Results The Effect of Ag dsDNA GO on the Growth of X. perforans In Vitro Both X. perforans strains were subjected to the same treatments in t w o separate in vitro assays. The data from both assays were essentially the same and combined into one graph for each strain. Ag dsDNA GO had high antimicrobial activity regardless of the concentration against the copper tolerant strain , GEV485 ( Figure 3 1 A ). All of the concentrations of Ag dsDNA GO (10, 25, and 50 ppm) completely inhibited bacterial growth within 15 min. In contrast, none of the copper concentrations (10, 25, and 50 ppm) were able to significantly reduce the bacterial population when compared t o th e untreated control (sterile tap water). This phenomenon was observed at all time points in the experiment. As expected, all three of the copper concentrations (10, 25, and 50 ppm) had more adverse affects on growth of the copper sensitive strain, 91 118, than they did on GEV485 ( Figure 3 1 B ). The 50 ppm concentration of copper had completely eliminated recovery of the bacterium after 1 hr. However, the 10 and 25 ppm concentrations of copper required exposure for 24 hr to complet ely inhibit all bacterial growth. All of the copper concentrations significantly inhibited bacterial growth by the 15 min time point when compared to the untreated contr ol. Additionally, Ag dsDNA GO had the same effect on 91 118 as it did on GEV485 . All t hree concentrations (10, 25, and 50 ppm) of Ag dsDNA GO inhibited all bacterial growth within 15 min. Therefore, Ag dsDNA GO had the

PAGE 74

74 greatest antibact erial activity on both a copper sensitive and a copper tolerant strain when compared to copper based bacte ricides. The Effect of Ag dsDNA GO on Bacterial Spot Disease Severity under Greenhouse Conditions In the first greenhouse experiment ( Figure 3 2 A ), all three concentrations (100, 200, and 500 ppm) of Ag dsDNA GO provided significantly better bacterial spot control when compared to the grower standard (copper mancozeb) and the untreated control. No adverse effects to the plant tissues were observed with the 100 ppm concentration of Ag dsDNA GO. However, strong phytotoxicity was observed with the 500 ppm concentration of Ag dsDNA GO , while the 200 ppm concentration only showed slight phytotoxicity ( Figure 3 3 D F ). Therefore, the 500 ppm concentration was eliminated for future e xperiments. The combination of copper mancozeb significantly reduced bacterial spot disease severity when compared to the untreated control. In the second greenhouse experiment ( Figure 3 2 B ), only the disease severity ratings fo r the lower leaves from all of the treatments were used for the data analysis. After inoculation, some Ag dsDNA GO composite had vi sibly washed off of the upper l eaves resulting in less disease control. This was due to the use of a different stock solution of Ag dsDNA GO i n the last two greenhouse experime nts that required almost 6 hr to fully dry on the leaf surface before the bacteria could be inoculat ed. Similar to the first experiment, all three concentrations (75, 100, and 200 ppm) of Ag dsDNA GO provi ded significantly better control of bacterial spot of tomato when compared to the grower standard and the untreated control. The 75 ppm concentration of Ag dsDNA GO provided better disease control than the grower standard, but it was slightly less effectiv e than the 100 and 200 ppm concentrations of Ag dsDNA GO. When comparing the disease severity, the AUDPC for the 75 ppm treatment was almost double in comparison to the 100 and 200 ppm treatments. In general, the two controls exhibited less disease when co mpared

PAGE 75

75 to the other two greenhouse experiments. No phytotoxicity was observed for any of the treatments in this experiment. In the third greenhouse experiment ( Figure 3 2 C ), disease severity on plants treated with any of the three concentrations (75, 100, and 200 ppm) of Ag dsDNA G O was significantly lower in comparison to the grower standard and the untreated control. Of the three Ag dsDNA GO treatments, the 75 ppm concent ration of Ag dsDNA GO had the highest disease severity. The calculated AUDPC for the lowest rate of Ag dsDNA GO was about 2 times higher than the calculated values for the 100 and 200 ppm treatments; however, bacterial spot severity was significantly less than copper mancozeb . In general, the third greenhouse experiment had the highest bacterial spot disease severity on the control treatments. Additionally, no phytotoxicity was observed for any of the treatments in this experiment. SEM Analysis The SEM imag es ( Figure 3 4 ) reveal that the dried 500 ppm concentration of Ag dsDNA GO forms a thick sheet over the leaf surface. However, it does not evenly cover the entire leaf surface. This finding is corroborated by the photographs take n 2 hr after the chemical had dried ( Figure 3 3 A ). Each Ag dsDNA GO treatment w as sprayed using a conventional spray bottle and formed droplets sporadically covering the leaf surface ( Figure 3 3 A C ). Discussion In this study , Ag dsDNA GO show ed great potent ial as an alternative to copper based bactericides in tomato transplant production to manage bacterial spot. In vitro assays revealed the pronounced bactericidal effects of Ag dsDNA GO at concentra tions as low as 10 ppm. All of the concentrations of the composite successfully inhibited bacterial growth within 15 min of treatment. In order to make a direct comparison of the two metal ions, it should be noted that 50 ppm of the Ag dsDNA GO contains ap proximately 8 ppm of silver. The lowest concentration of

PAGE 76

76 the Ag dsDNA GO contains less than 2 ppm of silver and it was still able to inhibit completely bacterial growth within 15 min. In comparison, none of the copper concentrations completely inhibited ba cterial growth of the copper tolerant strain even afte r exposure for 24 hr. All copper concentrations inhibited bacterial growth of the copper sensitive strain, but required at least 1 hr or more to do so. Thus, the in vitro assays indicated that Ag dsDNA GO is not affected by the copper resistance possessed by the X. perforans strains in Florida A ll Ag dsDNA GO concentrations were able to significantly reduce bacterial spot disease severity when compared to copper mancozeb. However, in the first greenhouse study sli ght and strong phytotoxicity were observed for the 200 and 500 ppm concentrations of Ag dsDNA GO , respectively ( Figure 3 3 D F ). It should be noted that no adverse effects were observed i n the two other greenhouse experiments containing the 200 ppm concentration. T he 100 ppm concentration of the silver based nanocomposite consistently performed the best in all three greenhouse experiments. The main advantage of using the 100 ppm concentrat ion is that the actual amount of silver in the composite is very low at approximately 16 ppm. In terms of copper mancozeb , the level of copper that is currently sprayed to control bacterial spot in tomato fields is roughly 540 ppm. That is about 30 times h igher than the amount of silver present in this composite which could potentially reduce the amount of heavy metals accumulating in the soil. In general, the composite tends to distribute on the leaf surface in heavy, thick droplets which varies in color d epending on the concentration used ( Figures 3 3 and 3 4 ). By far the 500 ppm concentration created the darkest and thickest droplets which may be correlated to the observed phytotoxicity. The 75 and 100 ppm concentrations resulted in light and slightly thinner droplets which did not cause any adverse effects to the tomato plants in any of the experiments. The greenhouse experiments corroborated the results seen in the in vitro assays that the Ag dsDNA -

PAGE 77

77 GO is able t o overcome the copper tole rance commonly seen in all of the Florida isolated X. perforans strains. According to Vallad et al. (2010), all of the X. perforans strains present in Florida are bacterial spot extremely difficult to control with copper based bactericides. Therefore, researchers continue to look for alternatives to c opper and have had some success with ASM , 2AI, and light activated nanomaterials (Obradovic et al. 2005 ; Paret et al. 2013 ; Worthington et al. 2012). Moreover, Ag dsDNA GO appears to be the most promising alternative to copper based on this study. However, more research is needed before Ag dsDNA GO can be used to manage bacterial spot in the field. Unfortunately, this composite is not available for mass distribution and would need funding or interest from chemical company to be produced commercially for gro wers. Currently, this silver based nanomaterial can take a couple of weeks to make small amounts and be costly. If the composite is produced commercially then it would reduce the cost substantially. Additionally, the fate of Ag dsDNA GO in the environment still needs to be evaluated. It is unknown how long the composite would persist in soil or on plant tissue and how it would affect tomato fruit. When compared to copper which is applied at a rate of 540 ppm, applying Ag dsDNA GO at 100 ppm would reduce th e amount of heavy metals deposited in the soil by about 30 times. Due to these limitations and uncertainties, Ag dsDNA GO would be much more suited for application in transplant production. Transplant production would require a smaller amount of applicatio ns of the composite than compared to using it for managing bacterial spot in both transplant and field production. Limiting the use to transplant production would reduce the potential cost of using the composite for managing bacterial spot. It would also m ake the goal of using disease free transplants much more attainable if this

PAGE 78

78 composite is substituted for copper. Thus, it would reduce one of the potential inoculum sources that can cause bacterial spot infestations in the field. Although, once tomatoes ar e transplanted into a field, the growers would still have to treat their tomato plants with disease management strategies that include copper based bactericides. It could also potentially reduce the impact of the composite on the environment, because it wo uld not be sprayed on field tomatoes and could reduce the potential leaching into the soil. Based on this study, the 100 ppm concentration of Ag dsDNA GO would be a good choice for managing bacterial spot in transplant production.

PAGE 79

79 A B Figure 3 1. In vitro results of Ag dsDNA (Blue=15 min, Red=1 hr, Green=4 hr, and Purple=24 hr ) . The treatments were as follows: Ag dsDNA GO at 10, 25, and 50 ppm; copper prepared from Kocide® 3000 at 10 (0.033 g/L), 25 (0.0667 g/L), and 50 ppm (0.167 g/L) . A) GEV485 (Cu tolerant X. perforans strain ), B) (91 11 8 (Cu s ensitive X. perforans strain ). Error bars= S tandard D eviation . A p value of 0.05 was used in the IBM ® SPSS ® LSD (L east S ignificant D ifference) sta tistical analysis.

PAGE 80

80 A B C Figure 3 2. Disease severity of bacterial spot of tomato under greenhouse conditions represented as AUDPC. A) First trial completed in mid spring 2014 evaluated the following treatments: 100, 200, and 500 ppm of Ag dsDNA Kocide® 3000 (2.1 g/L) and Penncozeb® 75DF (1.2 g/L) (Cu Mancozeb) ; and sterile tap water. B) Second trial completed in late spring 2014 evaluated the following treatments: 200, 100, and 75 ppm Ag dsDNA GO; a combinati Kocide® 3000 (2.1 g/L) and Penncozeb® 75DF (1.2 g/L) (Cu Mancozeb); and sterilized tap water as a control and C) Third trial completed in early summer 2014 evaluated the following treatments: 200, 100, and 75 ppm Ag dsDNA GO; a combination of (2.1 g/L) and Penncozeb® 75DF (1.2 g/L) (Cu Mancozeb); and sterilized tap water as a control. Error bars= S tandard D eviation . P value of 0.05 was used in the IBM® SPSS® SNK (Student Newman Keuls) statistical analysis.

PAGE 81

81 A B C D E F Figure 3 3. Photograph of how Ag dsDNA GO deposits and appears on the leaf surface. A) 500 ppm 2 hr after treatment, B) 200 ppm 2 hr after treatment, C) 100 ppm 2hrs after treatment, D) Slight Phytotoxicity with 200 ppm 14 days after treatment, E) Strong phytotoxicity observed with 500 ppm 14 days after treatment, F) Strong phytotoxicity observed with 500 ppm 14 days after treatment.

PAGE 82

82 A B C D Figure 3 4. SEM images showing the deposition of 500 ppm concentration of Ag dsDNA GO on the surface of Bonnie Best tomato leaves (A D).

PAGE 83

83 CHAPTER 4 PERACETIC ACID FOR THE MANAGEMENT OF BACTERIAL WILT OF TOMATO CAUSED BY RALSTONIA SOLANACEARUM Introduction Bacterial wilt is one of the most detrimental diseases of tomato , Solanum l ycopersicum , and it is incited by the soil borne, vascular pathogen, Ralstonia solanacearum . This bacterium has a wide host range and has been reported to cause disease in over 200 cultivated plant and weed species in 50 different families ( Kelman 1953; McCarter 1991 ; Vallad et al. 2004 ; Yabuuchi et al. 1992). In general, the pathogen invades through injured tomato roots and will eventually colonize xylem tissue. Ex tensive colonization will cause wilting and plant death ( Champoiseau et al. 2009 ; Vallad et al. 2004) . Th is process can be very rapid or plants may appear healthy for a period of time and then wilt suddenly (McCarter 1991). Infested soil is t he primary inoculum source, but the pathogen has been reported to survive in or on irrigation water, weeds, tomato stak es, farming equipment and operators, and diseased plant material ( Champoiseau et al. 2009 ; Hong et al. 2008). It is also able to survive in irrigation water in close association with aquatic weeds (Denny 2006; Hong et al. 2008 ; McCarter 1991 ; Vallad et al. 2004). Therefore, bacterial wilt is extremely difficult to control once field soil becomes infested. Bacterial wilt management strategies utilizing cultural practices are moderately effective. These practices may include the following: path ogen free seedlings, eliminate alternative weed hosts, reducing root knot nematode populations, removal of crop residue and volunteers, efficient soil drainage, and proper irrigation management (Champoiseau et al. 2009 ; Pradhanang et al. 2005 ; Vallad et al . 2004). However, these methods are not always effective and researchers have continued t o evaluate other alternatives for managing bacterial wilt. For instance, moderate horizontal resistance or tolerance to strains of R. solanacearum has been reported in certain potato and tomato cultivars (Champoiseau et al. 2009). Unfortunately, this is not a universal

PAGE 84

84 solution because this type of management strategy is highly dependent upon temperature and strain variation that may overcome the resistance. Therefore, the effectiveness of the commercially available resistant tomato cultivars can vary depending on the geographic location (McCarter 1991 ; Wang et al. 1998 ; Vallad et al. 2004). More recently, the grafting of susceptible cultivars with high fruit quality ont o resistant rootstocks has proven to be effective in controlling the disease. Currently, this strategy is used on a commercial scale in Japan, Bangladesh, and the Philippines (Champoiseau et al. 2009 ; Freeman et al. 2011 ; Nakaho et al. 2000). Over the yea rs, researchers have evaluated the use of various soil additives and foliar or drip/drench applications of different chemicals for bac terial wilt management. General purpose fumigants such as methyl bromide and/or chloropicrin were used to manage several s oilborne fungi, bacter ia, nematodes, and weeds (Denny 2006 ; Ji et al. 2005 ; Santos et al. 2006 ; Thoquet et al. 1996). Both fumigants were shown to reduce bacterial wilt disease incidence, but they did not offer season long control on plants grown for fruit production ( Enfinger et al. 1979 ; McCarter 1991) . However, methyl bromide has fallen out of favor due to its negative impact on the environment . Additionally, chloropicrin is highly regulated by the EPA because its a tmospheric emission is highly volatile and toxic (Gan et al. 2000 ; Santos et al. 2006). Ji et al. (2005) evaluated the use of a plant derived, volatile essential oil called thymol to control bacterial wilt. This biofumigant significantly reduced bacterial wilt incidence in greenhouse and field trials when compared to untreated plants. However, further evaluation of thymol is necessary before it can be considered for regular use. Additionally, a systemic acquired resistance (SAR) induc er called acibenzolar S methyl ( ASM; Actigard 50W® (Syngenta C rop Protection, Greensboro, NC)) has been evaluated for bacterial wilt management. Foliar and/o r soil applications of ASM were able to reduce bacterial wilt incidence in moder ately resistant tomato cultivars , but not in

PAGE 85

85 commercially acceptable tomato cult ivars in soils with hi gh inoculum pressure (Ji et al. 2005 ; Pradhanang et al. 2005). One potential chemical that should be evaluated to manage bacterial wilt is peracetic acid (PAA). This antimicrobial peroxide is similar to other oxidizers because it denatures proteins, disrupts cell wall permeability, and oxidizes sulfh ydr y l and sulfur b onds in proteins, enzymes, and other metabolites (Rutala and Weber 2008). PAA was first registered as an antimicrobial pesticide in 1985 and has been used as a sanitizer in agricultural facilities, food establishments, medical facilities, dairy/cheese proc essing plants, food processing equipment, and pasteurizers in breweries, wineries, and beverage plants (U.S. Environmental Protection Agency 2012). PAA is also commonly used as a disinfectant for fruits, vegetables, meat, and eggs ( Dagher and Cassandra 201 1). fungal plant pathogens. Hopkins et al. (2003) used PAA to treat Acidovorax avenae subsp. citrulli and Didymella bryoniae contaminated seeds , which result in bacterial frui t blotch and gummy stem blight of watermelon, respectively. Treating contaminated seed with at least 1600 . Mari et al. (1999) evaluated the effect of PAA on germinat ing conidia of Monilinia laxa , which causes brown rot of stone fruit. Conidia that were treated with 1000 were significantly reduced by 50% in the ability to cause decay in plums. Dagher and Cassandra (2011) evaluated a formulati on of PAA containing the SAR inducer, potassium silicate, for the control of bacterial spot of tomato caused by Xanthomonas perforans . This formulation had enhanced antimicrobial activity against X. perforans compared to PAA alone. Thus, different formulat ions of PAA have shown promise in plant disease control and could potentially be

PAGE 86

86 applied to the soil to reduce R. solanacearum populations. However, the use of PAA on soil borne pathogens, such as R. solanacearum , has not been studied. It was hypothesized that PAA could potentially reduce R. solanacearum populations when it is applied to the soil via the drip system before and after planting tomato seedlings . The objectives of this project are 1) to evaluate new PAA formulations for managing bacterial wilt in vitro and in micro soil experiments, and 2) to integrate the application of this new PAA formulation with resistant grafted tomato plants to mange bacterial wilt in the field. Two of these formulation s contain the SAR inducer, potassium silicat e , and t he chelating agent, EDTA ( ethylene diamine tetracetic acid ) (Dagher and Cassandra 2011 ; Epelde et al. 2008 ; Menzies et al. 1992 ; Rodrigues et al. 2009). The effect of PAA (AN 77V2) on R. solanacearum was evaluated alone and in formulations containing diffe rent concentrations of potassium silicate and antimicrobial activity . Materials and Methods Bacterial Strain and Storage R. solanacearum strain, RS5, isolated from tomato in Florida, was used in this study. RS5 was previously characterized as biovar 1, phyl otype II (Hong 2012). For short term storage, bacteria were grown on nutrient agar (NA) medium (BBL, Becton Dickinson and Co., Cockeysville, MD) at 28°C and transferred every 24 to 48 hr . For long term storage, the purified culture was stored in a sterile 30% glycerol solution at 80°C. In V itro Assays RS5 was retrieved from long term storage and aseptically transferred to NA plates, and incubated for 24 h r at 28 °C. A bacterial suspens ion was prepared and adjusted to an A 600 =0.3 ( ~5 x10 8 CFU/mL). The suspension w as then diluted to 10 3 CFU/mL for the final working bacterial concentration. Next, 20

PAGE 87

87 following treatments which were prepared in triplicate in sterile glass tubes: 3.6 g/L of AN 77V2, 3.6 g/L of AN 77V2 18/18, and 3.6 g/L of AN 77V2 10/25. By weight, AN 77V2 18/18 consists of EDTA at 18% and potassium silicate at 18% , while AN 77V2 10/25 consists of EDTA at 10% and potassium silicate at 25% in addition to PAA. Additionally, three sterilized glass tubes containing 2 mL of sterile served as controls. The tubes were placed on a shaker in an incubator held at 28°C. Any changes min, 1 hr, 4 hr, and 24 hr. The samples were plated on NA and incubated for 48 hr at 28°C. The colonies on each plate were c ounted in order to determine the colony forming units (CFU)/mL at each time point. Each treatment consisted of three replicates. The bacterial counts were the average of three replicates. inst R. solanacearum, the stability of AN 77V2, AN 77V2 18/18, and AN 77V2 10/25 overtime was determined by using QUANTOFIX ® Peracetic acid test strips (M acherey Nagel GmbH & Co. KG, Germany) which measures the concentration of PAA in the solution. Each PA A treatment with or without the addition of RS5 was sampled at time zero, 15 min, 1 hr, 4 hr, and 24 hr. The test strip values were recorded and the data are presented in parts per million (ppm). Micro soil E xperiments RS 5 was retrieved from long term storage and aseptically transferred to NA plates, and incubated for 24 hr at 28 °C. A bacterial suspension was prepared and adjusted to ~5 x10 8 CFU/mL. T he bacterial suspension was diluted to 10 6 CFU/mL for the working bacter ial suspension. Fifty milliliters of the bacterial suspension was added to a re sealable plastic bag containing 200 mL of Fafard ® Super Fine Germination Mix ( Sun Gro Horticulture Canada Ltd, Agawam, MA ) and mixed thoroughly. For th e first micro soil experi ment, 75 mL of each of the

PAGE 88

88 following treatments were poured into the bag and mixed thoroughly 30 min after inoculation: 3.6 g/L of AN 77V2, 1.8 g/L of AN 77V2, 3.6 g/L of AN 77V2 18/18, 1.8 g/L of AN 77V2 18/18, 3.6 g/L of AN 77V2 10/25, 1.8 g/L of AN 77 V2 10/25, 0.648 g/L of EDTA, 0.36 g/L of EDTA, 0.648 g/L of p otassium silicate, 0.9 g/L of potassium silicate, and sterile tap water. After 30 min, 1 g of soil from each treated soil sample was transferred to a sterile tube containing 10 mL of sterile tap water. Each tube was vortexed and then placed on a lab bench for 45 min to allow the soil to settle. The supernatant was transferred to a clean sterile tube and used for a dilution series from 10 1 to 10 7 . Fifty milliliters of each dilution was plated on modified SMSA (a selective medium for R. solanacearum ) and incubated for 48 hr at 28°C. Only white colonies with a red center were counted and used to calculate the average CFU/g of soil. Each treatment was repeated in triplicate. For the second micro soil experiment, the previously described protocol was slightly modified to include 2 applications of the following treatments: AN 77V2 at 1.8, 3.6, 7.2, and 10.8 g/L; sterile tap water. Each concentration was applied 30 min and then 24 hr after the soil w as infested. Soil samples were taken 30 min after each application of each treatment. The rest of the previously described protocol was followed in order to determine the effect of the two treatments on growth of R. solanacearum. Each treatment was tested in triplicate and the average CFU/g of soil was calculated. Field T rial A field trial was conducted in the fall of 2013 in Quincy, FL to evaluate the ability of PAA to control bacterial wilt under natural conditions. The field was prepared and treated wi th methyl bromide prior to inoculation. Even though the field had been inoculated for bacterial wilt trials since 1998, each hole in the soil for each tomato transplant was inoculated with 50 mL of a R. solanacearum suspension at 10 5 CFU/mL. There were two main treatments in this study. The

PAGE 89

89 first one consisted of applying AN 77V2 18/18 at 10.8 g/L the soil via the drip system three times before planting. The second field treatment included applying AN 77V2 18/18 at 10.8 g/L three times before and after pla nting via the dr ip system. A commercial cultivar that is susceptible to bacterial wilt, BHN602, was used alone in addition to it being grafted onto the resistant rootstock, BHN998 (i.e. Rootstock BHN998/S cion BHN602). The PAA and the grafted plant were considered to be a potential integrated pest management (IPM) approach. Three to four week old tomato seedlings were transplanted 15 days after inoculation. The plants were rated for the occurrence of bacterial wilt 6 different times beginning approximately 22 days after planting. Statistics All the data collected from the in vitro assays, the micro soil experiments, and the field trial were evaluated for statistical significance using the Student Newman Keuls (SNK) method in I BM ® SPSS ® Statistics V ersion 22 and a p value of 0.05 was used to evaluate the data. Results The Effect of Peracetic Acid on the Growth of R. solanacearum and Its Stability Overtime In Vitro All three PAA treatments (AN 77V2, AN 77V2 18/18, and AN 77V2 10/ 25) completely inhibited R. solanacearum growth following exposure for 15 min ( Figure 4 1 ). R. solanacearum populations were recovered at approximately 6x10 2 CFU/mL from the untreated control. The stability of PAA with and without the bacterial cells in the suspension was determined over time by using QUANTOFIX ® Peracetic acid test strips ( Figure 4 2 ). In general , each PAA solution had the same trend in stability whether the bacteria present or not . Therefore, the data was combined into one graph. The solution that only contained PAA (AN 77V2) had the highest initial reading at 300 ppm. The activity or stability of PAA did not begin to decrease until 24 hr.

PAGE 90

90 The amount of active PAA in the solution d ecreased from 300 to 20 ppm in 24 hr. There was no traceable amount of PAA after 72 hr . When compared to the other two PAA treatments, AN 77V2 10/25 was not as stable over time. It had an initial activity of 200 ppm and had no traceable amount of PAA by 24 hr. Moreover, AN 77V2 18/18 had the lowest initial active amount of PAA, but it was the most stable overtime. AN 77V2 18/18 was able to maintain the active form of PAA throughout all time points. The active amount of PAA decreased over a 72 hr period from 200 to 10 ppm. The Effect of Peracetic Acid on R. solanacearum Populations in the Soil In the first micro soil experiment , EDTA at 0.36 or 0.648 g/L and potassium silicate at 0.648 or 0.9 g/L had no effect on the R. solanacearum population in the soil compared to the water treated control ( Figure 4 3 ). Additionally, the PAA treatments containing the different concentrations of EDTA and potassium silicate (AN 77V2 18/18 and 10/25) appeared to have no effect on the bacterial pop ulation w hen compared to the water treated control . However, both concentrations of PAA acid without the additives (AN 77V2 at 1.8 and 3.6 g/L) were able to cause a significant reduction by at least one log unit in the soil population of R. solanacearum . T he 3.6 g/L concentration of PAA reduced the bacterial wilt population by two log units i.e. 10 6 to 10 4 CFU/g of soil. Additionally, the 1.8 g/L concentration of PAA was able to reduce the R. solanacearum soil population by one log unit i.e. 10 6 to 10 5 . It appeared that there was a direct correlation between the concentration of PAA and its antibacterial activity. The second micro soil experiment focused on treating the soil with two applications of the same concentration of AN 77V2 (1.8, 3.6, 7.2, or 10 .8 g /L). As expected, all concentrations of PAA were able to significantly reduce the bacterial wilt population in the soil ( Figure 4 4 ). PAA when applied at 1.8 and 3.6 g/L reduced R. solanacearum populations in the soil by one or t wo log units, respectively. Overall, the 7.2 and 10.8 g/L concentrations of PAA caused the

PAGE 91

91 greates t reduction in the R. solanacearum population. Both concentrations reduced the R. solanacearum population by three log units i.e. 10 6 to 10 3 CFU/g of soil. As observed above, general, treating the soil with a second application of PAA did not cause an additional reduction in the bacteri al population . The Effect of Peracetic Acid on Bacterial Wilt Incidence in Susceptible and Grafted Resistant Tomato Seedlings The next step was to evaluate the effect of a formulation of PAA containing the additives EDTA and potassium silicate (AN 77V2 18/18) on bacterial wilt incidence in a susceptible to mato cultivar , BHN602, and BHN602 grafted onto a resistant rootstock, BHN998 ( Figure 4 5 ). In general, the amount of bacterial wilt disease in this field trial was low. Howeve r, in terms of the s usceptible cultivar , it is clear that AN 77V2 18/18 did not reduce the incidence of bacterial wilt when compared to the untreated BHN602. When PAA was added to the soil before and after planting, there were approximately twice as many wilted plants than in t he untreated susceptible cultivar . The grafted plants appeared to fair the best against bacterial wilt disease in this particular field trial. There was no incidence of bacterial wilt in the untreated grafted control and the grafted treated with 10.8 g/ L of AN 77V2 18/18 only before planting. As with the susceptible cultivar , there was an increase in the number of wilted grafted plants when they were treated with 10.8 g/L of AN 77V2 18/18 before and after planting. None of the values representing the per centage of wilted plants for each of the treatments were statistically different from one another. Discussion In the initial experiments, PAA appeared to have potential in managing bacterial wilt of tomato. In vitro all three of the PAA based treatments killed all of the bacteria present in the

PAGE 92

92 suspension within 15 min. In addition to its high bactericidal activity in vitro , one beneficial characteristic of PAA is that it was no longer active after 72 hr. Standard AN 77V2 had the highest reading of activ e PAA at 300 ppm and dissipated within 24 h r . In comparison, AN 77V2 18/18 in which EDTA and potassium silicate each account for 18% of its composition had the lowest initial reading of active PAA at 100 ppm, but it was the most stable over time. This indi cates that this compound would not persist in the soil for periods of time longer than 72 hr and would minimize its environmental impact. Since R. solanacearum primarily resides in the soil, the next step was to test PAA antibacterial activity in artificia lly infested soil. In the first micro soil experiment, each treatment of AN 77V2 was applied at rates of 1.8 and 3.6 g/L. The most effective treatment of PAA was the standard AN 77V2 at 3.6 g/L as it was able to reduce the bacterial wilt population by two log units. The remaining PAA treatments did not appear to have much of an impact on the bacterial population present in the soil. The AN 77V2 treatments mixed with EDTA and potassium silicate had no apparent effect on the R. solanacearum population in the soil. This could be due to the fact that these two treatments contained a smaller amount of active PAA at 100 and 200 ppm. The difference in the antibacterial activity of each treatment could be due to their difference in the initial active amount of PAA. The strong antibacterial effect that was observed for the 3.6 g/L concentration could be due to a more powerful, initial oxidative burst that happens when the amount of active PAA is at lea st 300 ppm. The general trend was that as the concentration of PAA was initially higher, the bactericidal activity was also higher. Therefore, the second micro soil experiment primarily focused on increasing the concentration of the standard AN 77V2 and evaluating its effect on the R. solanacearum soil population at high er rates. Increasing the PAA concentration further increased the effect of its antibacterial activity. However, this increased antibacterial

PAGE 93

93 activity would plateau when concentrations exceeded 7.2 g/L , which roughly corresponded to 600 ppm of active PAA . T he 7.2 and 10.8 g/L concentrations of the standard PAA were able to further decrease the bacterial wilt soil population by one log unit more than the 3.6 g/L concentration. The addition of a second application of each concentration was also explored. Howe ver, treating the soil with a second application of the same concentration had no further effect on the R. solanacearum population. The ineffectiveness of the second application might have been due to the fact that even after 24 hr the soil was still highl y moist from the first treatment , which could have diluted the concentration of PAA added in the second application. Assuming that all of the PAA from the first application of AN 77V2 at 3.6 g/L had degraded, the second application would have only containe d approximately 0.7714 g/L of PAA (C 2 = (75 mL x 3.6 g/L)/ 350 mL)). This would have reduced the amount of active PAA available for that initial oxidative burst by approximately 46.7%. Therefore, it was hypothesized that the applications would need to be f urther apart in order to allow the soil to dry in order for multiple PAA applications to be effective . Although the standard AN 77V2 reduce d the bacterial population to a level of 10 3 CFU/g of soil , R. solanacearum would still be able to cause bacterial wilt at this level . Thus, it was assumed that PAA would need to be used in combination with resistant grafted tomato cultivars in order to effectively manage bacterial wilt in field conditions. ability to manage bacterial wilt of tomato was tested with and without the use of grafted tomato cultivars in Florida field conditions. AN 77V2 18/18 was selected for the field trial because it was the most stable overtime. As indicated, it was hypothesized that AN 77V2 18/18 did not have an effect on the population because the original tested concentration only contained 100 ppm of PAA. It was thought that AN 77V2 18/18 would have an effect on the incidence of bacterial wilt in

PAGE 94

94 susceptible and re sistant grafted tomato cultivars if the concentration wa s increased to 10.8 g/L (~300 ppm). It was theorized that this concentration of AN 77V2 18/18 would be able to reduce the bacterial wilt population to around 10 4 CFU/g of soil and reduce the incidence of bacterial wilt. However, AN 77V2 18/18 did not reduc e the incidence of bacterial wi lt in either cultivar , but appeared to increase disease incidence when it was applied to the soil after the planting of susceptible or resistant grafted tomatoes. The exact cause for this increase in bacterial wilt incidence is unknown and needs to be evaluated further. In addition to AN 77V2 18/18 inability to manage bacterial wilt, it was also difficult to apply to the soil via the drip system. As it was added to the system, it would continuously clog the system and not be delivered . These results may indicate that this particular formulation of PAA does not appear to be the most viable option for managing bacterial wilt. The addition of EDTA and potassium silicate did stabilize PAA , but they have also reduced its efficacy in the micro soil experiments and in the field. In the micro soil experiments, the standard PAA formulation (AN 77V2) at 7.2 and 10.8 g/L significantly reduce d the R. solanacearum soil population by three log units. Therefore, these two concentrations of AN 77V2 would be the best formulation to test in future greenhouse experiments and field trials. One potential issue with this formulation of PAA is that it is not stable overtime because the concentration of active PAA is reduced from 300 to 10 ppm in 24 hr in vitro . Microencapsulation could improve the stability of AN 77V2 because it would protect PAA from moisture which can cause degradation . The microencapsulation process will allow for the creation of a slow release formulation of PAA that wo uld be stable in water , which could prevent it from effervescing during application (Hattori et al. 1985). Additionally, it will also prevent PAA from potentially leaching away f rom the target zone due to rain fall in moderately coarse textured soils or soi ls low in organic matter content (Luteri 1999). Therefore, AN 77V2

PAGE 95

95 could potentially be microencapsulated to create a slow release formulation that would stabilize the chemical without reducing its efficacy. Further research on PAA is needed in order to e valuate these hypotheses.

PAGE 96

96 Figure 4 1 . The effect of different peracetic acid (PAA) formulations on R solanacearum growth over time (blue=15 min, red=1 hr, green=4 hr, and purple=24 hr). The treatments were the following: AN 77V2 (standard PAA), AN 77 V2 18/18 (PAA + EDTA at 18% and potassium silicate at 18%, by weight), and AN 77V2 10/25 (PAA + EDTA at 10% and potassium silicate at 25%, by weight). Error bars= S tandard D eviation . A p value of 0.05 was used in the IBM ® SPSS ® Student Newman Keuls (SNK ) statistical analysis.

PAGE 97

97 Figure 4 2. The st ability of peracetic acid (PAA) alone or in combination with various concentrations of EDTA and p otassium silicate measured in parts per m illion (ppm) at time zero , 15 min , 1 hr, 4 hr , 24 hr , and 72 h r. The form ulations were the following: AN 77V2 (standard PAA) (blue diamonds) , AN 77V2 18/18 (PAA + EDTA at 18% and potassium silicate at 18%, by weight) (red squares) , and AN 77V2 10/25 (PAA + EDTA at 10% and potassium silicate at 25%, by weight) (green triangles) . Since there was no difference in stability, t his graph represents the combined stability data of the formulations with and without a R. solanacearum suspension (~ 10 3 CFU/mL) added to each tube containing a PAA formulation .

PAGE 98

98 Figure 4 3. The effect of one application of standard peracetic acid ( PAA, AN 77V2), AN 77V2 18/18 (PAA + EDTA at 18% and potassium silicate at 1 8%, by weight), AN 77V2 10/25 (PAA + EDTA at 10% and potassium silicate at 25%, by weight), EDTA , potassium silicate , and sterile tap water on the R. solanacearum population in the soil expressed in log CFU/g of soil. Error bars= S tandard D eviation . A p value of 0.05 was used in the IBM ® SPSS ® Student Newman Keuls (SNK) statistical analysis. Figure 4 4. The effect of one (1x) versus two (2x) applications of peracetic acid (AN 77V2) at various concentrations (1.8, 3.6, 7.2, and 10.8 g/L) and sterile tap water on the R. solanacearum population in the soil expressed in log CFU/g of soil. The blue bars repres ent the log CFU of R. solanacearum /g of soil after one application of each tre atment and the purple bars represent the log CFU of R. solanacearum /g of soil after two applications of each treatment. Error bars= S tandard D eviation . A p value of 0.05 was used in the IBM ® SPSS ® Student Newman Keuls (SNK) statistical analysis.

PAGE 99

99 Figure 4 5 . The effect of applying peracetic acid mixed with 18 % of EDTA and potassium silicate (AN 77V2 18/18 ) on bacterial wilt incidence in a susceptible tomato variety, BHN602, and BHN602 grafted onto a resistant rootstock. BHN9 98. BHN602 or Grafted+18/18 indi cates that AN 77V2 18/18 was only added through the drip to the soil three times to the soil before planti ng. BHN602 or Grafted+18/18, drip indicates that AN 77V2 18/18 was added through the drip to the soil three times before and after planting. Error bars= SD. A p value of 0.05 was used in the IBM ® SPSS ® Student Newman Keuls (SNK) statistical analysis.

PAGE 100

100 CHAPTER 5 SUMMARY AND CONCLUSIONS Bacterial spot caused by Xanthomonas spp . and bacterial wilt caused by Ralstonia solanacearum are two of the most detrimental diseases of tomato (Ritch ie 2000; Champoiseau et al. 2009). Bacterial spot of tomato is caused by four distinct species of Xanthomonas ( X. euvesicatoria ( Xe ), X. gardneri ( Xg ), X. perforans ( Xp ), and X. vesicatoria ( Xv )) (Jones et al. 2004). Researchers have developed a variety of identification methods based on the phenotypic and genotypic differen ces of plant pathogenic xanthomonads. However, ma n y of these methods are either too conservative to provide a good resolution to species or subspecies levels or can be difficult to use for analyzing large collections (Cho and Tiedje 2001 ) . Therefore, a multiplex qPCR assay was created based on regions of the hrpB2 gene to readily detect the four species of Xanthomonas that cause bacterial spot. The hrpB2 region was determined to be conservative as was demonstrated in a study by Obradovic et al. (2004b) in which PCR primers were designed to amplify a 420 bp fragment of the hrpB2 from most plant pathogenic xanthomonads . Phylogenetic analysis revealed that the hrpB2 is highly conserved amongst strains of the same species, but varie s between spe cies. F our qPCR species specific probes and two primer sets were designed to detect the four species because strains from Xp and Xe only varied by 2 nucleotides. Additionally, two Xv group specific probes and one primer set were developed to target two gro ups of Xv that varied by only one nucleotide. The four species specific probes and their two corresponding primer sets were used to create the optimized multiplex qPCR assay for the four bacterial spot pathogens. The finalized qPCR cycling protocol contain s an optimal Tm of 69 °C and a master mix containing concentrations of each primer at 6 pure cultures of different Xanthomonas strains was tested and gave the expected positive results . T he outlined

PAGE 101

101 multiplex qPCR assay for the four causal agents of bacterial spot is rapid, accurate, and easily reproducible. Even though the initial set up is costly, this assay is a vast improvement over current identification techniques because it is able to rapidly a nd simultaneously detect all four of the bacterial spot pathogens in real time . The current grower standard for managing bacterial spot of tomato in transplant and field production is copper mancozeb. Copper tolerance was first detected in Florida for s trains applications of copper (Marco and Stall 1983). Mancozeb ( eythylene bis dithiocarbamates ) was added to copper based bactericides because it was more effective than copper alone (Conover and Gerhold 1981; Marco and Stall 1983) . Unfortunately, copper mancozeb cannot adequately control bacterial spot in Florida because all of the strains are copper tolerant (Jones and Jones 1985 ; Obradovic et al. 2004a ; Vallad et al. 2010 ). Therefore, we evaluat ed the use of a silver based nanomaterial (Ag dsDNA GO) as a potential alternative to copper mancozeb. Silver nanoparticles (AgNPs) are thought to cause structural deformation of the cell membrane, inactivate enzymes, inhibit cell replication and respirati on, and cause cell de ath . AgNPs tend to aggregate which has led them to be attached to dsDNA tethered to graphene oxide (GO) (Ocsoy et al. 2013b ) . Ag dsDNA GO was able to kill all of the copper tolerant and sensitive bacteria within 15 min in vitro at conc entrations as low as 10 ppm. The composite at 100 ppm (~16 ppm of Ag + ) significantly reduced bacterial spot disease severity compared to copper mancozeb under greenhouse conditions. However, this composite can be costly because it is not commercially avai lable. Also, its fate in the environment is unknown. Therefore, the 100 ppm concentration of Ag dsDNA GO would be much more suited for application in tr ansplant production.

PAGE 102

102 The soil borne, vascular pathogen R. solanacearum that causes bacterial wilt of to mato is also difficult to cont rol in Florida. It is able to survive for years in soil and irrigation water, and is a multifaceted taxonomic unit with extensive phenotypic and genetic diversity with a wide host range (Denny 2006 ; Hong et al. 2008 ; McCarter 1991). Researchers have evaluated several management strategies, such as thymol, grafted resistant cultivars, and acibenzolar S methyl (ASM) ( Champoiseau et al. 2009 ; Ji et al. 2005; Pradhanang et al. 2005 ). However, further research must be completed be fore any of these can be used commercially. We assessed the soil application of three different formulations of the oxidizer , peracetic acid (PAA) , to ma nage bacterial wilt. Two formulations (AN 77V2 18/18 and 10/25) were developed to contain different am ounts of a SAR inducer ( potassium silicate ) , a chelating agent ( EDTA , ethylene diamine tetracetic acid ) , and PAA (Dagher and Cassandra 2011 ; Epelde et al. 2008 ). PAA is reported to have high antimicrobial activity by denatur ing proteins and disrupt ing cell wall permeability . All of the formulations of PAA had immense antibacterial activity in vitro . The PAA formulation , AN 77V2 18/18 , c ontaining the two additives was the most stable over time, but it contained a lower concentration of PAA compared to t he standard formulation. However, the standard PAA formulation at 7.2 g/L caused the greatest reduction in the R. solanacearum population in the micro soil experiments. Because of it stability, AN 77V2 18/18 was selected for use in the field. Unfortunately , it was difficult to apply via the drip system and was unable to reduce bacterial wilt incidence in the field. It is hypothesized that the stabilizers inhibited the efficacy of PAA in these experiments and that the standard formulation should be further e valuated. Additionally, a slow release microencapsulated formulation of PAA could potentially enhance its activity in the field.

PAGE 103

103 LIST OF REFERENCES Agrios, G. N. 2005. Bacterial spots and blights. Plant Pathology. Fifth Edition. Elsevier Academia Pr ess : 627 638. Abbasi, P. A. , Soltani, N., Cuppels, D. A., and Lazarovits, G. 2002 . Reduction of bacterial spot disease severity on tomato and pepper plants with foliar applications of ammonium lignosulfonate and potassium phosphate. Plant D is . 86 : 1232 1236 . Ahmed, N. N., Islam, M. , Hossain, M. A., Meah, M. B., and Hossain, M. M. 2013. Determination of r aces and b iovars of Ralstonia solanacearum c ausing b acterial wilt d isease of p otato. J . Agr . S ci. 5 : 1916 9752 Alfano, J. R., and Collmer, A. 2004. Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42 : 385 414. Álvarez, B., López, M. M., and Biosca, E. G. 2008. Survival strategies and pathogenicity of Ralstonia solanacearum phylotype II subjected to prolonged starvation in environmental water microcosms. Microbiology 154 : 3590 3598. Bashan, Y. 1986. Field dispersal of Pseudomonas syringae pv. tomato , Xanthomonas campestris pv. vesicatoria , and Alternaria macrospora by animals, people, bir ds, insects, mites, agricultural tools, aircraft, soil particles, and water sources. Can . J . B ot . 64 : 276 281 . Balogh, B., Jones, J. B., Momol, M. T., Olson, S . M., Obradovic, A., King, P., and Jackson, L. E. 2003. Improved efficacy of newly formulated bacteriophages for management of bacterial spot on tomato. Plant D is. 87 : 949 954. Bock, C. H., Gottwald, T. R., Parker, P. E., Cook, A. Z. , Ferrandino, F., Parnell, S., and van den Bosch, F. 2009. The Horsfall Barratt scale and severity estimates of citru s canker. Eur . J . P lant P athol . 125 : 23 38. Bogdanove, A. J., Beer, S. V., Bonas, U., Boucher, C. A., Collmer, A., Coplin, D. L., Cornelis, G. R., Huang, H. C., Hutchens on, S. W., Panopoulos, N. J., and Van Gijsegem, F. 1996. Unified nomenclature for broa dly conserved hrp genes of phytopathogenic bacteria. Mol . M icro biol. 20 : 681 683. Bonas, U., Schulte, R., Fenselau, S., Minsav age, G. V., Staskawicz, B. J., and Stall, R. E. 1991. Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant Microbe Interact . 4 : 81 88. Bouzar, H., Jones, J. B., Stall, R. E., Hodge, N. C., Minsavage, G. V., Benedict, A. A., and Alvarez, A. M. 1994. Physiological, che mical, serological, and pathogenic analyses of a worldwide collection of Xanthomonas campestris pv. vesicatoria strains. Phytopathology 84 : 663 671.

PAGE 104

104 Cha mpoiseau, P. G., Jones, J. B., and Allen, C. 2009. Ralstonia solanacearum race 3 biovar 2 causes tropical losses and temperate anxieties. Plant Health Prog. doi , 10 . Cho, J. C., and Tiedje, J. M. 2001. Bacterial species determination from DNA DNA hybridization by using genome fragments and DNA microarrays. App . Environ . M icrobiol . 67 : 3677 3682. Conover, R. A., and Gerhold, N. R. 1981 . Mixtures of copper and maneb or mancozeb for control of bacterial spot of tomato and their compatibility for control of fungus diseases [ Phytophthora infestans , Stemphylium solani, Xanthomonas campestris pv. vesicatoria , Florida]. In Proceedings of the... annual meeting of the Florida State Horticultural Society . 94. Cook, D., Barlow, E., and Sequeira, L. 1989. Genetic diversity of Pseudomonas solanacearum : detection of restriction fragment length polymo rphisms with DNA probes that specify virulence and the hypersensitive response. Mol. Plant Microbe In . 1 : 113 121. Cooksey, D. A. 1990. Genetics of bactericide resistance in plant pathogenic bacteria. Annu. R ev . Phytopathol . 28 : 201 219 . Cornelis, G. R. 2006. The type III secretion injectisome. Nat. Rev . Microbiol . 4 : 811 825. Dagher, F., and Cassandra, M. 2011. U.S. Patent Application 13/880,887 . Denny, T. 2006. Plant pathogenic Ralstonia species. Plant associated bacteria. Springer Ne therlands : 573 644. Doidge, E. M. 192 0 . A tomato canker. Ann. Appl. Biol. 7 : 407 430. Enfinger, J. M., McCarter, S. M., and Jaworski, C. A. 1979. Evaluation of chemicals and application methods for control of bacterial wilt of tomato transplants. Phytopathology 69 : 640. Epelde, L., Hernández Allica, J., Becerril, J. M., Blanco, F., and Garbisu, C. 2008. Effects of chelates on plants and soil microbial community: comparison of EDTA and EDDS for lead phytoextraction. Sci. Total E nviron . 401 : 21 28. Flaherty, J. E., Somodi, G. C., Jones, J. B., Harbaugh, B. K., and Jackson, L. E. 2000 . Control of bacterial spot on tomato in the greenhouse and field with h mutant bacteriophages. HortScience 35 : 882 884. Freeman, J., McAvoy, T., Rideo ut, S., Paret, M., and Olson, S. 2010. Utilization of Grafted Tomato Seedlings for Bacterial Wilt Resistance i n Open Field Production. In III International Symposium on Tomato Diseases 914 : 337 339.

PAGE 105

105 Gabriel, D. W., Allen, C., Schell, M., Denny, T. P., Greenberg, J. T., Duan, Y. P., Flores Cruz , Z . , Huang , Q . , Clifford , J. M . , Presting, G., González , E. T., Reddy, J., Elphinstone , J., Swanson, J., Yao, J., Mulholland, V., Liu, L., Farmerie , W., Patnaikuni , M., Balogh, B., Norman, D., Alvarez, A., Castillo, J. A., Jones, J. B., Saddler, G., Walunas, T., Zhukov, A., and Mikhailova, N. 2006. Identification of open reading frames unique to a select agent: Ralstonia solanacearum race 3 biovar 2. Mol. Plant Microbe In . 19: 69 79. Gan, J ., Yates, S. R., Ernst, F. F., and Jury, W. A. 2 000. Degradation and volatilization of the fumigant chloropicrin after soil treatment. J . E nviron . Q ual . 29 : 1391 1397. Gardner, M. W., and Kendrick, J. B. 1921. Bacterial spot of tomato. J. Agr. Res. 21 : 123 156 . Gardner, M. W., and Kendrick, J. B. 1923. Bacterial spot of Tomato and Pepper. Phytopathology 13 : 307 315. Garton Jr, J. E. 2009. Evaluation of race and copper tolerant strains of Xanthomonas axonopodis pv. vesicatoria, causal agent of bacterial leaf spot of bell pepper in Georgia (Doctoral dissertation, uga). Genin, S., and Boucher, C. 2002. Ralstonia solanacearum : secrets of a major pathogen unveiled by analysis of its genome. Mol . Plant P athol . 3 : 111 118. Gitaitis, R., McCarter, S., and Jones, J. 1992. Disease control in tomat o transplants produced in Georgia and Florida. Plant Dis . 76 : 651 656. Golmohammadi, M., Cubero, J., Peñalver, J., Quesada, J. M., López, M. M., and Llop, P. 2007. Diagnosis of Xanthomonas axonopodis pv. citri , causal agent of citrus canker, in commercial fruits by isolation and PCR based methods. J . A ppl . M icrobiol . 103 : 2309 2315. Hattori, Y., Igarashi, Y., and Takahashi, M. 1985. U.S. Patent No. 4,557,755 . Washington, DC: U.S. Patent and Trademark Office. Higgins , B . B. 1922. The bacterial spot of pepper. Phytopathology 12:501 17 Hong, J. C. 2012. Diversity and control of Ralstonia solanacearum in the southeastern United States . University of Florida. Hong, J. C., Momol, M. T., Jones, J. B., Ji, P., Olson, S. M., Allen, C., Perez, A., Pradhanang, P., and Guven, K. 2008. Detection of Ralstonia solanacearum in irrigation ponds and aquatic weeds associated with the ponds in North Florida. Plant Dis . 92: 1674 1682. Hopkins, D. L., Thompson, C. M., Hilgren, J., and Lovic, B. 2003. Wet seed treatment with peroxyacetic acid for the control of bacterial fruit blotch and other seedborne diseases of watermelon. Plant Dis. 87 : 1495 1499.

PAGE 106

106 Janse, J. D., Van den Beld, H. E., Elphinstone, J., Simpkins, S., Tjou Tam Sin, N. N. A., and Van Vaerenbergh, J. 2004. Introduction to Europe of Ralstonia solanacearum biovar 2, race 3 in Pelargonium zonale cuttings. J . Plant Pathol . 86 : 147 155. Ji, P., Momol, M. T., Olson, S. M., Pradhanang, P. M., and Jones, J. B. 2005. Evaluation of thymol as biof umigant for control of bacterial wilt of tomato under field conditions. Plant D is. 89 : 497 500. Ji, P., Campbell, H. L., Kloepper, J. W., Jones, J. B., Suslow, T. V., and Wilson, M. 2006. Integrated biological control of bacterial speck and spot of tomato under field conditions using foliar biological control agents and plant growth promoting rhizobacteria. Biol . C ontrol 36 : 358 367. Jones, J. B., and Jones, J. P. 1985. The effect of bactericides, tank mixing time and spray schedule on bacterial leaf spot of tomato. In Proc. Fla. State Hortic. Soc . 98: 244 247. Jones, J. B., Stall, R. E., Scott, J. W., Somodi, G. C., Bouzar, H., and Hodge, N. C. 1995. A third tomato race of Xanthomonas campestris pv. vesicatoria . Plant Dis . 79 : 395 398. Jones, J. B., Stall, R. E., and Bouzar, H. 1998. Diversity among xanthomonads pathogenic on pepper and tomato. Ann . R ev . Phytopathol . 36 : 41 58. Jones, J. B., Bouzar, H., Stall, R. E., Alm ira, E. C., Roberts, P. D., Bowen, B. W., Sudberry, J., Strickler, P., and Chun, J. 2000. Systematic analysis of xanthomonads ( Xanthomonas spp .) associated with pepper and tomato lesions. Int . J . Sys . Evol . Microbiol . 50 : 1211 1219. Jones, J. B., Lacy, G. H., Bouzar, H., Stall, R. E., and Schaad, N. W. 2004. Reclassification of the xanthomonads associated with bacterial spot disease of tomato and pepper. Sys . A ppl . M icrobiol . 27 : 755 762. Kanto, T., Miyosh i, A., Ogawa, T., Maekawa, K., and Aino, M. 2004. S uppressive effect of potassium silicate on powdery mildew of strawberry in hydroponics. J . Gen . Plant Pathol . 70 : 207 211. Kelman, A. 1953. The bacterial wilt caused by P seudomonas solanacearum : A literature review and bibliography . Raleigh, N.C.: North Carolina Agricultural Experiment Station. Lahaye, T., and Bonas, U. 2001. Molecular secrets of bacterial type III effector proteins. Trends Plant S ci . 6 : 479 485. Leite, R. P. , Minsavage, G. V., Bonas, U., and Stall, R. E. 1994. Dete ction and identification of phytopathogenic Xanthomonas strains by amplification of DNA sequences related to the hrp genes of Xanthomonas campestris pv. vesicatoria . Appl . Environ . Microbiol . 60 : 1068 1077.

PAGE 107

107 Leite Jr, R. P., Jones, J. B., So modi, G. C., Min savage, G. V., and Stall, R. E. 1995 . Detection of Xanthomonas campestris pv. vesicatoria associated with pepper and tomato seed by DNA amplification. Plant Dis . 79 : 917 922 . Leong, J. 1986. Siderophores: their biochemistry and possible role in the biocontrol of plant pathogens. Annu . Rev . P hytopathol . 24 : 187 209. Li, W., Hartung, J. S., and Levy, L. 2006. Quantitative real time PCR for detection and identification of< i> Candidatus Liberibacter species associated with citrus huanglongbing. J . M icrobiol . M ethod . 66 : 104 115. Liu, H., Wang, S., Yu, X., Yu, J., He, X., Zhang, S., Shou, H., and Wu, P. 2005. ARL1, a LOB domain protein required for adventitious root formation in rice. Plant J . 43 : 47 56. Louws, F. J., Wilson, M., Campbell, H. L., Cupp els, D. A., Jones, J. B., Shoemaker, P. B., Sahin, F., and Miller, S. A. 2001. Field control of bacterial spot and bacterial speck of tomato using a plant activator. Plant Dis . 85 : 481 488. Luteri, G. F. 1999 . U.S. Patent No. 5,883,046 . Washington, DC: U.S. Patent and Trademark Office. Mackay, I. M., Arden, K. E., and Nitsche, A. 2002. Real time PCR in virology. Nucleic A cids R es . 30 : 1292 1305. Marco, G. M., and Stall, R. E. 1983. Control of bacterial spot of pepper initiated by strains of Xanthomonas campestris pv. vesicatoria that differ in sensitivity to copper. Plant Dis . 67 : 779 781. McCarter, S. M. 1991. Bacterial wilt. Compendium of tomato diseases . Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A., eds. American Phytopathological Socie ty : 28 29. McDowell, E. M., and Trump, B. F. 1976. Histologic fixatives suitable for diagnostic light and electron microscopy. Arch . P athol . L ab . M ed . 100 : 405 414. Miller, S. A., Rowe, R. C., and Riedel. 1996. Bacterial Spot, Speck, and Canker of Tomatoes. The Ohio State University Extension. Retrieved March 15, 2013 from http://ohioline.osu.edu/hyg fact/3000/3120.html Menz ies, J., Bowen, P., Ehret, D., and Glass, A. D. 1992. Foliar applications of potassium silicate reduce severity of powdery mildew on cucumber, muskmelon, and zucchini squash. J . Am . Soc . Hortic . Sci . 117 : 902 905. Momol, T., Jones, J., Olson, S., Obradovic, A., Balogh, B., and King, P. 2008. Integrated management of bacterial spot on tomato in Florida. University of Florida. Retrieved May 2, 2013 from http://ufdc.ufl.edu/IR00003017/00001

PAGE 108

108 Mt, C. P. 2010. An overview of bacterial wilt disease of tomato in Nigeria. Agric . J . 5 : 242 247. Nakaho, K., Hibino, H., and Miyagawa, H. 2000. Possible mechanisms limiting movement of Ralstonia solanacearum in resistant tomato tissues. J . Phytopathol . 148 : 181 190. Noël, L., T hieme, F., Nennstiel, D., and Bonas, U. 2002. Two novel type III secreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J . B acteriol . 184 : 1340 1348. Obradovic, A., Jones, J. B., Momol, M. T., Balogh, B., and Olson, S. M. 2004 a . Management of tomato bacterial spot in the field by foliar applications of bacteriophages and SAR inducers. Plant Dis . 88 : 736 740. Obradovic, A., Mavridis, A., Rudolph, K., Jan se, J. D., Arsenijevic, M., Jones, J. B., Minsavage, G. V., and Wang, J. F. 2004 b . Characterization and PCR based typing of Xanthomonas campestris pv. vesicatoria from peppers and tomatoes in Serbia. Eur. J . P lant P athol . 110 : 285 292. Obradovic, A., Jones , J. B., Momol, M. T., Olson, S. M., Jackson, L. E., Balogh, B., Guven, K., and Iriarte, F. B. 2005. Integration of biological control agents and systemic acquired resistance inducers against bacterial spot on tomato. Plant D is . 89 : 712 716 . Ocsoy, I., Gulbakan, B., Chen, T., Zhu, G., Chen, Z., Sari, M. M., Peng, L., Xiong, X., Fang, X., and Tan, W. 2013 a . DNA Guided Metal Nanoparticle Formation on Graphene Oxide Surface. Adv . Mat er. 25 : 2319 2325. Ocsoy, I., Paret, M. L., Ocsoy, M. A., Kunwar, S., Chen, T., You, M., and Tan, W. 2013 b . Nanotechnology in Plant Disease Management: DNA Directed Silver Nanoparticles on Graphene Oxide as an Antibacterial against Xanthomonas perforans . ACS N ano 7: 8972 8980. , A., Kvitek, L., Prucek, R., Kolar, M., Vece ., and Zboril, R. 2006. Silver colloid nanoparticles: synthesis, characterization, and their antibacterial activity. J . Phys . Chem . B . 110 : 16248 16253. Paret, M. L., Vallad, G. E., Averett , D. R., Jones, J. B., and Olson, S. M. 2013. Photocatalysis: effect of light activated nanoscale formulations of TiO2 on Xanthomonas perforans and control of bacterial spot of tomato. Phytopathology 103 : 228 236. Pongers Willemse, M. J., Verhagen , O. J. H. M., Tibbe, G. J. M., Wijkhuijs, A. J. M., De Haas, V., Roo vers, E., Van Der Schoot C.E., and Van Dongen, J. J. M. 1998. Real time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia using junctional reg ion specific TaqMan probes. Leukemia . 12 .

PAGE 109

109 Pradhanang, P. M., Ji, P., Momol, M. T., Olson, S. M., Mayfield, J. L., and Jones, J. B. 2005. Application of acibenzolar S methyl enhances host resistance in tomato against Ralstonia solanacearum . Plant D is. 89 : 9 89 993. Rademaker, J. L., Hoste, B., Louws, F. J., Kersters, K., Swings, J ., Vauterin, L., Vauterin, P., and de Bruijn, F. J. 2000. Comparison of AFLP and rep PCR genomic fingerprinting with DNA DNA homology studies: Xanthomonas as a model system. Int . J . Sys . Evol . Micr . 50 : 665 677. Ritchie, D. F. 2000 . Bacterial spot of pepper and tomato. The Plant Health Instructor. Retrieved from American Phytopathology Society. Updated 2007. Retrieved December 20, 2013 from https://www.apsnet.org/edcenter/intropp/lessons/prokaryotes/Pages/Bacterialspot.aspx Ritchie, D. F., and Averre, C. W. 1996. Bacterial Spot of Pepper and Tom ato. Vegetable Disease Information Note 18. North Carolina State University. Last updated 2000. Retrieved December 21, 2014 from http://www.ces.ncsu.edu/depts/pp/notes/Veget able/vdin018/vdin018.htm Robbins, M. D., Darrigues, A. , Sim, S. C., Masud, M. A. T., and Francis, D. M. 2009. Characterization of hypersensitive resistance to bacterial spot race T3 ( Xanthomonas perforans ) from tomato accession PI 128216. Phytopathology 99 : 1037 1044. Rodrigues, F. A., Duarte, H. S. S., Domiciano, G. P., Souza, C. A., Korndörfer, G. H., and Zambolim, L. 2009. Foliar application of potassium silicate reduces the intensity of soybean rust. Australas . Plant Path . 38 : 366 372. Rossie r, O., Van den Ackerveken, G., and Bonas, U. 2000. HrpB2 and HrpF from Xanthomonas are type III secreted proteins and essential for pathogenicity and recognition by the host plant. Mol . M icrobiol . 38 : 828 838. Rutala, W. A., and Weber, D. J. 2008. Guidelin e for disinfection and sterilization in healthcare facilities . Retrieved November 3, 2013 from http://stacks.cdc.gov/view/cdc/11560/ Santos, B. M., Gilreath, J. P., Motis, T. N. , Noling, J. W., Jones, J. P., and Norton, J. A. 2006. Comparing methyl bromide alternatives for soilborne disease, nematode and weed management in fresh market tomato. Crop Prot . 25 : 690 695. Schaad, N. W., and Frederick, R. D. 2002. Real time PCR and its application for rapid plant disease diagnostics. Can . J . P lant P athol . 24 : 250 258. Schena, L., Hughes, K. J., and Cooke, D. E. 2006 . Detection and quantification of Phytophthora ramorum , P. kernoviae , P. citricola and P. quercina in symptomatic leaves by multiplex real time P CR. Mol . Plant Pathol . 7 : 365 379.

PAGE 110

110 Stall, R. E., Loschke, D. G., and loci on a self transmissible plasmid in Xanthomonas campestris pv. vesicatoria . Phytopathol ogy 76 : 240 243. Stall, R. E., Beaulieu, C., Egel, D., Hodge, N. C., Leite, R. P., Minsavage, G. V., Bouzar, H., Jones, J. B., Alvarez, A. M., and Benedict, A. A. 1994. Two genetically diverse groups of strains are included in Xanthomonas campestris pv. vesicatoria . Int . J . Sys . Bacteriol . 44 : 47 53. Stall, R. E., Jones, J. B., and Minsavage , G. V. 2009. Durability of resistance in tomato and pepper to xanthomonads causing bacterial spot. Annu . R ev . Phytopathol . 47 : 265 284. Stevens, F. L. 1925 . Plant Disease Fungi. Print . Sun, X., Nielsen, M. C., and Miller, J. W. 2002. Bacterial Spot of Tomato and Pepper. Fl. Dept. Agriculture and Cons. Svcs. Division of Plant Industry. Plant Pathology Circular. No. 129 (Revised). Retrieved January 3, 2014 from http://www.freshfromflorida.com/content/download/11136/143107/pp129rev.pdf Tamura, K., Stecher, G ., Peterson, D., Filipski, A., and Kumar, S. 2013. MEGA6: Molecular Ev olutionary Genetics Analysis Version 6.0. Mol . Biol . E vol . 30 : 2725 2729. Thayer, P. L., and Stall, R. E. 1961. A survey of Xanthomonas vesicatoria resistance to streptomycin. Proc. Fla. State Hort. Soc . 75: 163 165 . Thoquet, P., Olivier, J., Sperisen , C., Rogowsky, P., Prior, P., Anais, G., Mangin, B., Bazin, B., Nazer, R. and Grimsley, N. 1996. Polygenic resistance of tomato plants to bacterial wilt in the French West Indies. Mol. Plant Microbe In . 9 : 837 842. Ullmann, F. 2003. of Industrial Chemistry. Sixth Edition, completely rev. ed. Weinhiem: Wiley VCH. [USDA] US Depa rtment of Agriculture. 2014 . Vegetables: acreage, production and value. Retrieved June 7 , 2014 from http://www.nass.usda.gov/Quick_Stats/index.php U.S. Environment al Protection Agency. 2012 . Anthrax spore decontamination using hydrogen peroxide and peroxyacetic acid. Retrieved January 27 2014 from http://www.epa.gov/pesticides/factsheets/chemicals/hydrogenperoxide_peroxyaceticacid_ factsheet.htm Vallad, G., Pernezny, K., and Momol, T. 2004. A series on diseases in the Florida vegetable garden: tomato. University of Florida Plant Pathology Department and IFAS Fact Sheet. PP 200. Retrieved March 3 , 2014 from http://ed is.ifas.ufl.edu/pp121#FOOTNOTE_1

PAGE 111

111 VanSickl e, J., Smith, S., and McAvoy, E. 2009. Production Budget for Tomatoes in Southwest Florida. Crop Statistics. USDA/NASS. Retrieved January 7 , 2014 from http://ufdc. ufl.edu/IR00003786/00001 Vauterin, L., Swings, J., Kersters, K., Gillis, M., Mew, T. W., Schroth, M. N., Palleroni, N. J., Hildebrand, D. C., Stead, D. E., Civerolo, E. L., Hayward, A. C., Stall, R. E., and Bradbury, J. F. 1990. Towards an improved taxon omy of Xanthomonas . Int . J . Sys . Bacteriol . 40 : 312 316. Vauterin , L., Hoste, B., Kersters, K., and Swings, J. 1995. Reclassification of xanthomonas . Int . J . S ys . B acteriol . 45 : 472 489. Wang, J. F., Hanson, P., and Barnes, J. A. 1998. Worldwide evaluation of an international set of resistance sources to bacterial wilt in tomato. In Bacterial Wilt Disease . Springer Berlin Heidelberg : 269 275. Wilson, K. 1987. Preparation of genomic DNA from bacteria. Current Protocols in M olecular B iol ogy : 2 4. Worthington, R. J., Rogers, S. A., Huigens III, R. W., Melander, C., and Ritchie, D. F. 2012 . Foliar Applied Small Molecule that Suppresses Biofilm Formation and Enhances Control of Copper Resistant Xanthomonas euvesicatoria on Pepper. Plant Dis . 96 : 1638 1644. Yabuuchi, E., Kosako, Y., Oyaizu, H., Yano, I., Hotta, H., Hashimoto, Y., Ezaki, T., and Arakawa, M. 1992. Proposal of Burkholderia gen. nov. and transfer of seven species of the genus Pseudomonas homology group II to the new genus, with th e type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiol . I mmun. 36 : 251 1275. Yabuuchi, E., Kosako , Y., Yano, I., Hotta, H., and Nishiuchi, Y. 1995. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia Gen. Nov. Microbiol . I mmun . 39 : 897 904.

PAGE 112

112 BIOGRAPHICAL SKETCH Amanda Lynne Strayer was born in Boulder, Colorado, in 1987, and lived in Lafayette, Colorado until the age of seven. Her family relocated to Gainesville, Fl orida due to a promising employment opportunity for her father . She remained in Gainesville for the rest of her adolescen ce . She graduated in the top 10% of high school class and went to Santa Fe Community College where she ob tained her Associate of Arts d eg ree in December of 2007. She then transferred to the University of Florida and graduated in May of 2010 with a Bachelor of Science degree in m icrobiology in c ell s cience. After graduation, she became employed in the Plant Pathology Department at the Divisi on of Plant Industr y in December of 2010 . At DPI, s he was able to expand her knowledge on plant pathogens and publish a disease note on a bacterial pathogen of the popular sweetener Stevia rebaudiana. She discovered that she had a sincere interest in wor king with plant pathogens and decided to a pply to graduate school . She attended the graduate program of the University of Florida, College of Agricultural and Life Sciences, Department of Plant Pathology, from August 2012 to August 2014. She conducted thre e separate research projects on two bacterial diseases of tomato with the guidance of Drs. Mathews L. Paret, Jeff r e y B. Jones, Nicholas S. Dufault, and Steve M. Olson . The first project consisted of developing a fast and reliable diagnostic method for the four causal agents of bacterial spot of tomato. The second project involved evaluating the use of a silver based nanomaterial for managing bacterial spot of tomato caused by Xanthomonas perforans . The third and final project involved evaluating the use of peracetic acid for managing bacterial wilt of tomato caused by Ralstonia solanacearum .