Citation
Investigations of Sting Nematode, Belonolaimus Longicaudatus - an Emerging Pathogen of Peanut in Florida

Material Information

Title:
Investigations of Sting Nematode, Belonolaimus Longicaudatus - an Emerging Pathogen of Peanut in Florida
Creator:
Kutsuwa, Kanan
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (4 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Entomology and Nematology
Committee Chair:
DICKSON,DONALD W
Committee Co-Chair:
CROW,WILLIAM T
Committee Members:
BRITO,JANETE A
GIBLIN-DAVIS,ROBIN MICHAEL
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Lesions ( jstor )
Nematology ( jstor )
Peanuts ( jstor )
Plant roots ( jstor )
Population density ( jstor )
Roundworms ( jstor )
Soils ( jstor )
Species ( jstor )
Strawberries ( jstor )
Symptomatology ( jstor )
Entomology and Nematology -- Dissertations, Academic -- UF
belonolaimus -- peanut
City of Gainesville ( local )
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Entomology and Nematology thesis, M.S.

Notes

Abstract:
Sting nematode (Belonolaimus longicaudatus) is an economically important ectoparasitic nematodes that is highly pathogenic on a wide range of agricultural crops in sandy soils of the southeastern United States. Although this nematode species is commonly found in Florida as a soilborne pathogen, it has not been reported infecting peanut in Florida. Previously infections of peanut by this nematode species is known only in North Carolina, Oklahoma and Virginia. In the summers of 2012 and 2013, sting nematode was found infecting three different peanut cultivars being grown on two separate peanut farms in Levy County, Florida. Sting nematode population density levels extracted from soil averaged 44/100 cm3 of soil on peanut cv. Tifguard, 39/100 cm3 of soil on peanut cv. Bailey in 2012, 2013, respectively; and 28/100 cm3 of soil on peanut cv. Georgia-06G on another farm in 2013. The damage consisted of large irregular patches of stunted plants at both farms. The root systems were severely abbreviated and there were numerous punctate-like isolated lesions observed on pegs and pods of infected plants. Peanut yield from one of these nematode-infested sites was 64% less than that observed in areas free from sting nematodes. The morphological characters of the nematode populations in these fields were congruous with those of the original and other published descriptions of B. longicaudatus. Moreover, the molecular characteristics based on the D2/D3 expansion fragments of 28S rRNA and ITS-1 RNA genes from the nematodes infecting peanut were found to be 99% identical to B. longicaudatus. The sequences were deposited in GenBank (Accession No. KF963097-KF963100). The results of the phylogenetic analysis using the sequences of these isolates from peanut and other isolates from other crops in Florida, suggests that the sting nematode from both peanut farms were genetically close to B. longicaudatus isolates from northern Florida. The peanut plants inoculated with both peanut isolates showed similar injuries as observed in the fields whereas those symptoms were not observed on control peanut plants. To our knowledge, this is the first report of large scale field damage caused by sting nematode infecting peanut grown under field conditions in Florida. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2014.
Local:
Adviser: DICKSON,DONALD W.
Local:
Co-adviser: CROW,WILLIAM T.
Statement of Responsibility:
by Kanan Kutsuwa.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Resource Identifier:
968131578 ( OCLC )
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

INVESTIGATION S OF STING NEMATODE, BELONOLAIMUS LONGICAUDATUS AN EMERGING PATHOGEN OF PEANUT IN FLORIDA By KANAN KUTSUWA A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Kanan Kutsuwa

PAGE 3

To my dearest parents, Youko Kutsuwa and Takayuki Kutsuwa, for their eternal love a nd support in pursuing my dream

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my major advisor, Dr. Donald W. Dickson, who has been guiding, advising and cheering me through my master degree study in Florida. I deeply appreciate and respect his philosophy and treatment of his students. He has been the best mentor , not only as a nematologist but also as a teacher of life. I thank my committee members, Dr s. Janete A. Brito, Robin M. Giblin Davis, and William T. Crow for their continuous guidance of my research. I extend special thanks to Dr. Janete A. Brito, who is the most wonderful and charm ing female scientist I have ever met and has kept me inspired and motivated. I am very fortunat e to have been supervised by the se professors. I also thank Dr. Ayyamperumal Jeyaprakash for his help, and guidance for my molecular analysis. He has kindly tau ght me every step for my DNA experiments and answered my many questions. I give special thanks to Mr. Anthony Drew, agricultur al extension agent in Levy Co. for w ithout his help and advice for field work, I could not have completed this study. I express m y gratitude to Mr. Jason Stanley for introducing me to the Science of Nematology. He and Dr. Renato Inserra are nematologists at the Division of Plant Industry where I received initial training under their supervision. Their unconditional support, encourag ement and friendship are greatly appreciated. Also, thanks go to my lab mates, Weimin Yuan , Silvia Vau and Courtney Jackson, and workers at the Nematology Unit supervised by Dr. Donald W. Dickson. They all helped me in many ways during my master study. F inally, I would like to thank my parents, Youko Kutsuwa, and Takayuki Kutsuwa, and my dear sister , Azumi Kutsuwa . From J apan, t hey have been beside me in thought

PAGE 5

5 to help, cheer, and criticize me anytime that I need ed it. I cannot find any precise word s to express my gratitude for thei r never ending love and support .

PAGE 6

6 page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 GENERAL INTRODUCTION ................................ ................................ .................. 13 2 REVIEW OF LITERATURE ................................ ................................ .................... 17 Taxono my ................................ ................................ ................................ ............... 17 Host Range ................................ ................................ ................................ ............. 18 Biology and Life Cycle ................................ ................................ ............................ 19 Geographical Distribution ................................ ................................ ........................ 21 Ecology ................................ ................................ ................................ ................... 22 Intraspecific Variations in Morphology ................................ ................................ .... 24 Intraspecific Variations in Ribosomal DNA ................................ .............................. 25 Previous Studies on Belonolaimus longicaudatus Infecting Peanut ........................ 26 Objectives ................................ ................................ ................................ ............... 27 3 MATERIALS AND METHODS ................................ ................................ ................ 28 Morphological Characterization ................................ ................................ .............. 28 Preparation of Nematode Specimens for Morphological Examination .............. 28 Examination and Measurements of Nematode Specimens .............................. 29 Molecular Characterization ................................ ................................ ..................... 2 9 Preparation of Nematode Sample ................................ ................................ .... 29 DNA Extraction ................................ ................................ ................................ . 29 PCR Amplification ................................ ................................ ............................ 30 Cloning and Sequencing ................................ ................................ .................. 31 Sequence Alignment and Phylogenetic Analysis ................................ .............. 32 Population Density Changes and Damage Estimation under Field Conditions ....... 33 Population Density Changes ................................ ................................ ............ 33 Estimation of Peanut Yie ld Suppression ................................ ........................... 34 Soil Analysis ................................ ................................ ................................ ..... 34 Infection of Belonolaimus longicaudatus on Peanut in a Greenhouse Environment ................................ ................................ ................................ ........ 34 Belonolaimus longicaudatus collected from peanut, Levy Co., Florida ............. 34 Belonola imus longicaudatus collected from strawberry, Hillsborough Co., Florida ................................ ................................ ................................ ........... 36 4 RESULTS ................................ ................................ ................................ ............... 37

PAGE 7

7 Morphological Char acterization ................................ ................................ .............. 37 Additional Characters of Female Morphology ................................ ................... 37 Male morphology ................................ ................................ .............................. 38 Molecular Characterization ................................ ................................ ..................... 38 Ch aracterization of the Sequence of ITS Region ................................ ............. 38 Characterization of the Sequence of D2/D3 Expansion Fragments of 28S rRNA ................................ ................................ ................................ ............. 38 Phylogenetic Analysis for ITS Region ................................ .............................. 39 Phylogenetic Analysis for D2/D3 Expansion Fragments of 28S rRNA ............. 39 Population Density Changes, and Damage Estimation under Field Conditions ...... 40 Population Density Changes ................................ ................................ ............ 40 Estimation of Peanut Yield Suppression ................................ ........................... 41 Soil Analysis ................................ ................................ ................................ ..... 41 Infection of Belonolaimus longicaudatus on Peanut in a Greenhouse Environment ................................ ................................ ................................ ........ 41 Belonolaimus longicaudatus collected from peanut, Levy Co., Florida ............. 41 Belonolaimus longicaudatus collected from strawberry, Hillsborough Co., Florida ................................ ................................ ................................ ........... 42 5 DISCUSSION ................................ ................................ ................................ ......... 64 Morphological Characterization ................................ ................................ .............. 64 Molecular Characterization ................................ ................................ ..................... 65 Symptoms, Population Density Changes and Damage Estimation Under Field Conditions ................................ ................................ ................................ ............ 66 Infection of Belonolaimus longicaudatus on Peanut in a Greenhouse Environment ................................ ................................ ................................ ........ 68 6 SUMMARY ................................ ................................ ................................ ............. 70 LIST OF REFERENCES ................................ ................................ ............................... 73 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 80

PAGE 8

8 LIS T OF TABLES Table page 4 1 Morphometrics a of selected characters of Belonolaimus longicaudatus females attained from soil collected around peanut roots from 35 Farms and Brown farm (n=20) and original descriptions of five species of Belonolaimus . ... 43 4 2 Measurements a of selected characters of Belonolaimus longicaudatus isolated from different crops and localities. ................................ ......................... 44 4 3 Morphometrics a of selected characters of Belonolaimus longicaudatus males isolated from soil collected from peanut roots from 35 Farms and Brown farm (n=20) and original descriptions of five species of Belonolaimus . ...................... 45 4 4 Regression of effect of increasing Belonolaimus longicaudatus densities, collected from strawberry in Hillsborough Co., Florida, on root length of peanut. ................................ ................................ ................................ ............... 46

PAGE 9

9 LIST OF FIGURES Figure page 4 1 Light microscope micrographs of Belonolaimus longicaudatus extracted from soil collecte d from peanut roots at 35 Farms . ................................ ..................... 47 4 2 Li ght microscope micrographs of Belonolaimus longicaudatus extracted from soil collected from peanut roots at Brown farm . ................................ .................. 48 4 3 Ma ximum Likelihood tree based on ITS sequence of Belonolaimus longicaudatus . ................................ ................................ ................................ .... 49 4 4 Neighbor Joining tree based on ITS sequence of Belonolaimus longicaudatus . ................................ ................................ ................................ .... 50 4 5 Maximum Likelihood tree based on D2/D3 expansion fragments of 28S rRNA from Belonolaimus longi caudatus . ................................ ................................ ...... 51 4 6 Neighbor Joining tree based on D2/D3 expansion fragments of 28S rRNA from Belonolaimus longicaudatus . ................................ ................................ ...... 52 4 7 An overall view of a sting nematode infested peanut field at 35 Farms . ............. 53 4 8 Severely damaged peanut cv.Georgia 06G field infested with the sting nematode at Brown farm, Levy Co., FL, summer 2013. ................................ ..... 54 4 9 A close up of the sting nematode infected peanut cv.Georgia 06G, showing leaf yellowing and stunted growth at Brown farm in summer 2013. .................... 54 4 10 Below ground symptoms induced by the sting nematode on peanut . . ............... 55 4 11 Symptoms induced by the sting nematode on peanut pod and peg of peanut cv. Tifguard found at 35 Farms in summer, 2012. ................................ .............. 55 4 12 Symptoms induced by sting nematodes on pods and pegs of peanut cv. Georgia 06G observed at Brown farm in summer, 2013 . ................................ ... 56 4 13 Belonolaimus longicaudatus population density changes on peanut cv. Georgia 06G from June to August, 2013 at Brown farm. ................................ .... 57 4 14 Belonolaimus longicaudatus population density changes on peanut cv. Bailey from June to September, 2013 at 35 Farms. ................................ ...................... 57 4 15 Peanut cv.Georgia 06G yield taken from non sting nematode infested plots compared with sting nematode infested plots . ................................ .................... 58 4 16 Pod and peg symptoms on peanut cv. Georgia 06G under greenhouse conditions induced by Belonolaimus longicaudatus from the 35 Farms. ............ 59

PAGE 10

10 4 17 Pod and peg symptoms induced on peanut cv. Georgia 06G under greenhouse conditions by Belonolaimus longicaudatus from the Brown farm . . .. 60 4 18 A close up of an abbreviated root systems of one of the two replicates of a peanut cv. Georgia 06G . ................................ ................................ .................... 61 4 19 Comparison of one of the two replicates of peanut cv. Georgia 06G . ................ 61 4 20 Discrete punctate like symptoms induced by Belonolaimus longicaudatus . ....... 62 4 21 A close up of some abbreviated root systems induced by Belonolaimus longicaudatus on peanut cv. Georgia 06G . ................................ ........................ 62 4 22 Comparison of peanut cv. Georgia 06G planted in Belonolaimus longicaudatus infested soil . ................................ ................................ ................ 63

PAGE 11

11 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requi rements for the Degree of Master of Science INVEST IGATION S OF STING NEMATODE, BELONOLAIMUS LONGICAUDATUS AN EMERGING PATHOGEN OF PEANUT IN FLORIDA By Kanan Kutsuwa August 2014 Chair: Don W. Dickson Major: Entomology and Nematology Sting nematode ( Belonolaimus longicaudatus ) is an economically important ectoparasitic nematode s that is highly pathogenic on a wide range of agricultural crops in sandy soils of the southeaste rn United States. Although this nematode species is commonly found in Flori da as a soilborne pathogen, it has not been reporte d infecting peanut in Florida. Previously infections of peanut by this nematode species is known only in North Carolina, Oklahoma and Virginia. In the summers of 2012 and 2013, sting nematode was found infecting three different peanut cultivars being grown on two separate peanut farms in Levy County, F lorida. Sting nematode population density levels extracted from soil averaged 44/100 cm 3 of soil on peanut cv. Tifg uard , 39/100 cm 3 of soil on peanut cv. Bailey in 2012, 2013 , respectively ; and 28/100 cm 3 of soil on peanut cv. Georgia 06 G on another farm in 2013. The damage consisted of large irregular patches of stunted plants at both farms. The root systems were severely abbreviated and there were numerous punctate like isolated lesions observed on pegs a nd pods of infected plants. Peanut yield from one of these nematode infested sites was 64 % less than that observed in areas free from sting nematodes. The

PAGE 12

12 morphological characters of the nematode populations in these fields were congruous with those of the original and other published descriptions of B . longicaudatus. Moreover, the molecular characteristics based on the D2/ D3 expansion fragments of 28S rRNA and ITS 1 RNA genes from the nematodes infecting peanut were found to be 99% identical to B . longicau datus . The sequences were deposited in GenBank (Accession No. KF963097 KF963100). The results of the phylogenetic analysis using the sequences o f these isolates from peanut and other isolates from other crops in Florida, suggests that the sting ne matode from both peanut farms were genetically close to B. longicaudatus isolates from northern Florida. The peanut plants inoculated with both peanut isolates showed similar injuries as observed in the fields whereas those symptoms were not observed on control p eanut plants. To our knowledge , this is the first report of large scale field damage caused by sting nematode infecting peanut grown under field conditions in Florida.

PAGE 13

13 CHAPTER 1 GENERAL INTRODUCTION Peanut, Arachis hypogaea L , is seen as one of the most important crop plants of the world. It is believed to have originated in South America. In the early 1900s, George Washington Carver, who was a botanist, encouraged using peanut in the southern United S tates as a rota tional crop for cotton production. He considered it as a food source for farmers who were not getting enough nutrition. This resulted in increasing acreage of peanut production. He also invented many recipes using peanut, and developed products that are ma de from peanut, such as cosmetics , dyes , paints , plastics , gasoline , and nitroglycerin . Today , peanut is mainly used for peanut butter, peanut oil, and roasted a nd salted peanuts (Higgins, 1951; Moss and Rao, 1995; Dickson, 1998 ). The top three countries that produce peanut are Argentina, the United States and China. In the United States, major peanut produ ction regions are the southeast (Alabama, Florida, Georgia, Mississippi, South Carolina), the southwest (New Mexico, Oklahoma, Texas), and Virginia and North Carolina (Crop Production, National Agricultural Statistics Service, USDA. 2011). The major types of peanut that are grown are Runner, Virginia, Spa nish and Valencia. In Florida, there has been a shift toward peanut cultivars with higher yielding and improved disease or nematode resistance such as cvs.Georgia 06G, Florida 07, and Tifguard (Prostko et a l., 2012) . These are all runner type cultivars. Tifguard , which is resistant to the peanut ( Meloidogyne arenaria ) and Javanese ( M. javanica ) root knot nematodes, was released by the USDA ARS and the Georgia Agricultural Experiment Statio n in 2007. It is believed that Tifguard produces signifi cantly higher yield s than other peanut cultivars in Florida because of its

PAGE 14

14 high level of resistance to both tomato spotted wilt tospovirus (TSWV) and root knot nematode s (Holbrook, et al., 2008) . Nem atode diseases of peanut are recognized as among the most important soilborne problems for peanut producers in Florida. Dickson (1985) reported three major nematode pathogens of peanut in Florida that include s the peanut root knot nematode, Meloidogyne are naria , lesion nematode, Pratylenchus brachyurus and ring nematode, Mesocriconema ornatum ). More recently, M. javanica was reported on peanut in Florida (Cetintas et al., 2003). Around the world, Aphelenchoides arachidis , Aphasmatylenchus straturatus , Belon olaimus longicaudatus , M. hapla, Scutellonema cavenessi , Tylenchorhynchus brevilineatus and Ditylenchus africanus are also known as nematode parasites of peanut (Dickson and De Waele, 2005). In Texas, Meloidogyne haplanaria was reported as a new root knot nematode speci es infecting peanut (Eisenback et al . , 2003). It has some morphological similarities to M. arenaria and M. hapla . The mitochondrial markers are almost the same size as in M. hapla, M. chitwoodi, M. fallax, and M. enterolobii. Among these nematode pathogens, sting nematode, B . longicaudatus , is perhaps the most virulent soilborne pathogen that threatens peanut production. The species is known to have a very wide host range. It causes serious damage on cerea l grain s , turfgrasses and forage grasses, fruit trees, several agronomic and horticultural vegetable crops (Crow and Brammer, 2011). The typical above ground symptom of sting nematode is stunted plants with chlorosis . Roots of infected plants are generally extremely abbreviated or stubby like. This species has been reported in the United States, Brazil, Costa Rica, Mexico, Puerto Rico and Bermuda. It prefers soils with a

PAGE 15

15 minimum of 80% sand and a maximum of 10% clay. Because of this soil preference, sting nematodes are usually f ound along the eastern seaboard of the United States (Smart and Nguyen, 1991). The first report of sting nematode damage on peanut was described in Virginia by Owens in 1951. He identified the nematode as B. gracilis , stating the nematode caused serious da mage to peanut. Holdeman (1955) surveyed the distribution of sting nematode in the United States and reported that B. gracilis had been observed affecting peanut in Virginia, North Carolina and South Carolina. So far, production losses of peanut by sting n ematode, B . longicaudatus, are reported in North Carolina (Sasser, 1961), Oklahoma (Russell, 1969) and Virginia (Owens, 1951). Sasser (1961) mentioned that the gre atest economic losses of peanut occurred where sting nematode appeared in peanut fields in N orth Carolina. Although sting nematode is commonly found in sandy soils in Florida, there have been no reports of this nematode infecting peanut. However, an isolate of sting nematode isolated from citrus was reported to infect peanut in greenhouse studies (Abu Gharbieh and Perry, 1969). During the summer of 2012, numerous large patches of peanut, cv. Tifguard were ob served to be severe stunted in one large peanut production farm in Levy County, FL . Root systems show ed severe stunting, a typical symptom induced by sting nematode on other agronomic and vegetable crops grown in Florida (Robbins and Barker, 1973; Smart and Nguyen, 1991; Dickson, pers. comm.). Nematode extraction from soil collected around stunted peanut roots revealed an average of 44 sting nematodes/100 cm 3 of soil. Pods and pegs showed distinctive symptoms of numerous small discrete brown lesions. Again, in 2013, large patches of

PAGE 16

16 stunted peanut, cv. Georgia 06 were observed in another large production f arm in Levy County. The above and below ground symptoms were similar to that observed in the previous year on the peanut cv. Tifguard. These two instances are the first large scale field damage observed on peanut caused by sting nematode in Florida.

PAGE 17

17 CHA PTER 2 REVIEW OF LITERATURE Taxonomy Steiner (1949) established the genus Belonolaimus with B. gracilis as the type species. He placed the genus in the family Tylenchidae . Chitwood (1950) assigned the new genus to the subfamily Dolichodorinae . According to the new classification proposed by De Ley (2002), the genus Belonolaimus belongs to the family Belonolaimidae , in the order Rhabditida. Other classifications by Siddiqi (2000) and Geraert (2011) consider Belonolaimus a representative of the subfamily Belo nolaminae Whitehead, 1960, in the family Dolichodoridae Chitwood , 1950 rather than in the family Belonolaimidae Whitehead, 1960. The type species of the genus Belonolaimus , B . gracilis was described from slash pine in the Ocala National Forest located in Marion County, Florida , and was considered to be the prevalent sting nematode in the United States until Rau (1958) described B. longicaudatus and reported it as the most common sting ne matode occurring in the sandy soils of the southeastern USA. Rau (1963) also described three new species, Belonolaimus euthychilus, B. maritimus , and B. nortoni. Two other species within the genus Belonolaimus, B. lineatus Roman, 1964 described in Puerto Rico, and B. lolli Siviour, 1978 described in Australia, were transferred by Monteiro and Lordello (1977) to Ibipora, a new genus that they e rected. Siviour and McLeod (1979 ) and Fortuner and Luc (1987) proposed that Ibipora should be considered a junior s ynonym of Belonolaimus , thus returning the two species to this genus . Because of this change, the type species, Ibipora jara Monteiro & Lor dello, 1977 and another species, I. anama Monteiro & Lordello,1977 w ere also moved to Belonolaimus by Fortuner and Lu c (1987). However, recent classifications by

PAGE 18

18 Siddiqi (2000) and Geraert (2011) maintained the validity of the genus Ibipora. In their taxonomical revisions, three genera Belonolaimus, Carphodorus Cobran, 1965 and Morulaimus Sauer, 1966 were included in the subfamily Belonolaiminae Whitehead, 1960 . Based on this new classification scheme (Geraert, 2011), Belonolaimus contains five species: B. gracilis Steiner , 1949 , B. euthychilus, B. longicaudatus, B. maritimus Rau, 1963 , and B. nortoni Rau , 1963 . Recently, Cid Del Prado Vera and Subbotin (2012) described a sixth species of Belonolaimus from Veracruz, Mexico and named it B. maluceroi. Host Range Information reported on the host range of sting nematodes are limited mainly to sp ecies of the genera Belonolaimus and Ibipora. Ibipola lolli is a damaging parasite of turf grasses in Australia (S tirling et al., 2013). B elonolaimus longicaudatus has a very wide host range including horticultural and agronomic crops, grasses, and forest trees. Owens (1951) was the first to report sting nematode as causing serious damage to peanut in Virginia. He also mentioned that this nematode affected the production of cotton, corn and soybean in Virginia. Holdeman (1955) reported that the sting nemat ode occurred wherever susceptible crops where grown in sandy soil s , and summarized the host of B . longicaudatus based on surveys from the south eastern United States. According to his survey, B. longicaudatus infected several grasses including bermudagrass, centipede grass and St. Augustine grass , and bean, lima bean, corn , cotton, millet, celery, onion, pepper, s trawberry, sweet potato, potato, cabbage, cauliflower, squash, lettuce, endive, and gladiolus , clover, lespedeza , cowpea and both slash and long leaf pine tree seedlings . He also reported citrus was susceptible to some isolates from

PAGE 19

19 Florida . Belonolaimus euthychilus Rau,1963 ha s been detected on citrus in Florida as well as B. gracilis (Esser and Simpson, 1984) . Crow et al. (2000 a ) reported the pathoge nicity of B. longicaudatus to cotton and potato grown in the peninsula of Florida, however Kinloch and Sprenkel (1994) found no sting nematodes affecting cotton grown in the panhandle region of Florida. Robbins and Barker (1973) investigated the host rang e of North Carolina and Georgia isolates of B . longicaudatus. According to their test, both populations could reproduce on a wi de range of weed hosts ( annual morning glory, crabgrass, johnsongrass, sorrel and wild carrot ) , turfgrass es (bentgrass, centipede grass) , forage crop s ( pearl millet, crimson clover , white clover ) , a nd many fruits and vegetables ( muscadine grape, peach, strawberry, carrot, potato, sweet corn ). Wa termelon, tobacco, asparagus, sandbur, and pokeweed were listed as non hosts. They indicated that there were physiological variant races among B. longicaudatus , e.g. t he Georgia isolate was able to reproduce on cucumber and dandelion but not on peanut, whereas the North Carolina isolate reproduced well on peanut, but not on cucumber and dandelion. Also , Abu Gharbieh and Perry (1969) reported that populations of B. longicaudatus from different Florida locations showed variable pathogenicity on citrus, peanut, strawberry , and tomato . Biology and Life C ycle Sting nematodes ( Belonolaimus and Ibipora species) are ectoparasitic in their feeding habit. They use their long stylet s to pierce plant cells deep within the root cortex to attain nourishment. Entire root systems or in some cases only a portion of parasitized roots become severely abbreviated, or stunted. The foliar part of plants are also often

PAGE 20

20 severely stunted because their roots cannot take up enough water and nutrition. Above ground , the symptoms of damage commonly occur in large patches. Their mode of reproduction is gonochoristic amphimixis. Huang and Becker (1997) observed feeding behavior of a California isolate of B. longicaudatus on excised corn roots grown in in vitro culture. Based on their studies, following embryogenesis, the first stage juveniles molted within the egg shell giving rise to second stage juveniles. Hatch occurred 5 days later. The third molt was confirmed within 29 days after egg deposition at 26 to 27°C. Sting nematodes preferred to feed at the region of rapid c ell division near the region of elongation. No molting or mating was confirmed during the feeding process. According to their study, mating occurred among adults shortly after the fourth molt and lasted 6 to 10 minutes, but no more than 20 minutes. Han (2 006 a ) observed the mating behavior of Florida, Georgia, and North Carolina isolates of B. longicaudatus, the process included rubbing, touching and twisting motions between males and females. Feeding started with sec ond stage juveniles and included all mot ile developmental stages. Discrete brown lesions appeared at the feeding sites 12 to 24 hours after B. longicaudatus initiated feeding, and typically roots became swollen. F eeding by B. longicaudatus seemed necessary for molting to occur. The life cycle of B. longicaudatus was completed in 18 to 25 days at 28°C , and an average of 529 B. longicaudatus were recovered 60 days after corn roots were inoculated with 60 females and 40 males . Smart and Nguyen (1991) also reported a similar length of the life cycle of B. longicaudatus under field conditions. Han (2006 a ) compared biological characteristics of three Florida iso lates of B. longicaudatus that included from potato , bermudagrass and citrus with a Georgia isolate

PAGE 21

21 from cotton and a North Carolina isolate from c orn. The investigations were carried out on excised corn roots grown in in vitro culture. She observed variations among their development times . The North Carolina isolate developed to a second stage juvenile from the egg in 4.6 days, which was the l ongest time observed among all isolates. The Georgia isolate took an average of 3.2 days to hatch to second stage juvenile s . Robbins and Barker (1973) also reported differences between the Georgia and the North Carolina isolate s in their ability to reprodu ce and their reproductive rate on different hosts . The reproduction rate of the Georgia isolate was significantly greater than that of the N orth Carolina isolate. Geographical Distribution Sting nematodes are commonly found along the coastal plains of the southeastern United States. In this region, they have been re ported in Florida (Steiner, 1942 ), Georgia (Holdeman, 1955), South Carolina (Graham, 1952), Nort h Carolina (Holdeman, 1955), Virginia (Owens, 1950,1951) , and New Jersey (Hutchinson and Reed, 1956 ; Myers, 1979) . Much of the c oastal plains and peninsular Florida provide an ideal habitat because of soil preference. S ting nematode s are also reported in Alabama (Christie, 195 9), Texas (Christie , 1959; Norton, 1959) and California ( Mundo Ocampo et al. , 1994). Cherry et al. (1997) hypothesized that the B. longicaudatus in California was introduced from Florida based on PCR RFLP analysis of ITS 1 . In addition to the distribution of sting nematodes along the eastern seaboard, they are reporte d in sandy soil sites in interior states, namely Arkansas (Riggs, 1961), Kansa s (Dickerson et al., 1972), Missouri (Perry and Rhoades, 1982), Oklahoma (Russell and Sturgeon, 1969), and Nebraska (Kerr and Wysong , 1979). All these populations of sting nematodes are reported as being B. longicaudatus except in

PAGE 22

22 Nebraska. The sting nematode in Nebraska was reported as B. nortoni (Kerr and Wysong, 1979). Sting nematodes have also been reported outside of the United St ates. They have been found from the Bahamas and Bermuda (Perry and Rhoades, 1982), Costa Rica (Lopez, 1978 ), Mexico (Smart and Nguyen, 1991), and Puerto Rico (Roman, 1964). Most of them were reported as B. longicaudatus, although one population fr om Mexico was identified as a new species, B. maluceroi ( Cid Del Prado Vera and Subbotin , 2012) . Sting nematodes have also been reported in Sao Paulo State, Brazil, and New South Wales, Australia, but these sting nematodes and some populations from Puerto Rico belo ng t o the genus Ibipora . Other sting nematodes of the genera Carphodorus and Morulaimus are reported from Australia (Stirling et al., 2013). Ecology Information obtained from Belonolaimus and Ibipora species indicate that they prefer sandy soils. Because o f the limited and specific distribution of Belonolaimus spp., Robbins and Barker (1974) suggested some ecological factors might be more specific for sting nematodes than other plant pathogenic nematodes. They reported that soil type, particle size, soil te mperature and soil moisture affected the development of populations and their reproduction rate. Sting nematodes can increase in population density in soil with a minimum of 80% sand and a maximum of 10% of clay (Robbins and Barker, 1974) . Brodie and Quatt lebaum (1970) reported that B. longicaudatus was only found in soil with 88% sand and 5% clay and in the top 30 cm of the soil profile . Miller (1972) also found that the nematode was found in sands or loamy sands with an A horizon that had 84 to 94% sand c ontent. He indicated that sand content and available water values were important factors as an index of survival of sting nematode in soil.

PAGE 23

23 Belonolaimus longicaudatus reproduces better between 25°C to 30°C , although the reproduction of the North Carolina population was reduced at 30°C (Robbins and Barker, 1974). Han et al. (2006 a ) studied the period from embryogenesis to hatch of second stage juveniles at different temperatures. Egg development of B. longicaudatus needed approximately 9 days at 18°C, 5 day s at 23°C and 3.7 days at 28°C. However, no eggs were laid at 33°C. Brodie and Quattlebaum (1970) found greater numbers of the nematode occurred from June through September when soil temperature of the top 30 cm of soil was over 20°C and also the soil mois ture average was 15 to 20% by volume. Boyd and Perry (1969) monitored average maximum temperatures at 2.5 cm below the soil surface every 2 weeks through April to October in Florida. They found that the nematode could cause severe injury at below 39 °C on m ost varieties of forage grasses grown in Florida, whereas soil temperatures above 39°C resulted in reduced nematode injury. They also observed a vertical movement of B. longicaudatus that suggest ed that th e nematode would be inhibited by death or downward migration when the av erage maximum temperature of 2.5 cm below the soil surface exceeded 39 °C. Bekal and Becker (2000) monitored a California sting nematode population to determine its density relative to monthly temperature changes . The population density began to increase in April and peaked in October with 1,000 sting nematodes being recovered from 100 cm 3 of soil, then decline d rapidly in December because of the lack of host plants. They also reported the nematode distribution was greater in the top 15 cm of soil, but during the hottest months in California, August and September, the population density was higher at the 15 to 30 cm depth of soil.

PAGE 24

24 Intraspecific Variations in Morphology Rau and Fassuliotis (1970) described morphologically variant populati ons using the equal frequency tolerance ellipse method. They concluded these variations were affected by genetic origin rather than environmental factors because v ariations observed among isolates collected from Georgia, Florida and Louisiana remained cons tant after being reared for 3 to 7 months under greenhouse conditions. Furthermore, some of the recently published morphological characters of B. longicaudatus (Robbins and Hirschmann, 1973; Gozel et al., 2006; Han et al., 2006b) do not fit that of the original and amended descriptions of B. longicaudatus published by Rau in 1958, 1961, and 1963 . In addition to tail and stylet length differences, morphological differences have been reported on degree of lip constriction, tail shap e, presence or absence of sclerotized vaginal pieces, stylet/ tail length ratio, a ratio, b ratio, and number of tail annules (Abu Gharbieh and Perry, 1970; Rau, 1958, 1961; Robbins and Hirschmann, 1974 ). Robbins and Hirschmann (1974) investigated the varia tions between a North Carolina and a Georgia population . According to their investigation, morphological variations were confirmed in stylet measurements, the c ratio, the distance of the excretory pore from the anterior end for both sexes, a ratio for fem ales, and the total body length and spicule length for males. Moreover, morphometric variations have been reported in body length and width, stylet morphology, and labial region for the second stage juvenile between the North Carolina and the Georgia popul ation (Han et al., 2006 b ). Morphological differences have been observed not only among the populations collected from different states, but also within a state (Abu Gharbieh and Perry, 1970; Robbins and Hirschmann, 1974; Gozel et al., 2006; Han et al., 200 6 b ). Abu Gharbieh and Perry (1970) compared morphological differences

PAGE 25

25 among three Florida populations of B. longicaudatus collected from different crop s grown near Gainesville, Fullers Crossing (Winter Garden), and Sanford . The Florida s Crossing, which was not pathogenic to pea nut under green house condition s , had a narrower body width at the vulva compared to the other two populations that were able to reproduce on peanut under greenhouse conditions , whereas the average total body lengt h and stylet length of females from the three populations were not significantly different. Intraspecific Variations in Ribosomal DNA M olecular methods have been introduced recently in support of the traditional taxonomic studies (Abebe et al., 2011; Adams et al., 1998, 2009). Because of the appreciable nucleotide polymorphism, the Internal Transcribed Spacer ( ITS ) region of the ribosomal RNA multiple copy gene array is often used for species level analysis (Cherry et al., 1997; Ferris et al., 1993; Adams et al., 2009). W ide intraspecific variation in the ITS 1 region located between 18S and 5.8S ribosomal DNA (rDNA) of the genera of Belonolaimus has been reported by several authors (Cherry et al., 1997; Gozel et al., 2006; Han et al., 2006 b ). Cherry et al . (1997) used polymerase chain reaction restriction fragment length polymorphism (PCR RFLP) to reveal variations among m idwestern populations of Belonolaimus based on the ITS region. Restriction patterns of the nematode suggested there were variations among the ITS region of B. longicaudatus population s, and it also varies within an individual nematode population . In a comparative analysis of the ITS 1 region, Han et al. (2006 b ) reported that intraspecific variation was clearly observed between an isolate fr om Texas and all other sting nematode isolates collected in Florida, Georgia, and North C arolina. Similarly, Gozel et al. (2006) reported variability both among and within populations of several Florida

PAGE 26

26 isolates of B. longicaudatus using the sequences attai ned from D2 D3 and ITS regions of rDNA , which supports previous observations suggesting B. longicaudatus to be a species complex (Robbins and Hirschmann, 1974; Duncan et al., 1996; Gozel et al., 2006; Han et al., 2006 b ). Previous Studies on Belonolaimus longicaudatus Infecting Peanut The pathogenicity of the sting nematode to peanut has been observed under field condition s in North Carolina (Sasser, 1961), Oklahoma (Russell and Sturgeon , 1 969) and Virginia (Owens, 1951). Based on peanut yield loss caused by B. longicaudatus , the nematode was suggested to be the second most important peanut pathogen in these three states ( Anonymous , 1987) . S ting nematodes restrict root growth during the early stage of peanut development, and i nfected roots become stunted, d iscolored and sparse, which suppress es the development of nod ules on peanut (Dickson, 1998). A dditionally, i solated necrotic lesions on pegs and pods have been observed (Abu Gharbieh and Perry, 1970 ). In a field trial carried out in a sting nematode infest ed site in North Carolina, Sasser et al., 1967 found that the growth of peanut and yield loss were highly c orrelated with the population density of sting nematode 55 days after peanut was planted . Although the sting nematode has been rarely observed in soi l samples collected in peanut field operations in Florida and Georgia ( Perry and Norden, 1963; Abu Gharbieh and Perry et al. , 1970 ; Timper and Hanna, 2005 ), no reports of damage on peanut under field situations has been made. However, two sting nematode populations each collected in Gainesville and Sanford, FL were pathogenic to peanut under green house condition s ( Abu Gharbieh and Perry, 1970).

PAGE 27

27 Objectives The objectives of this research project were to : i) elucidate the morphological and molecular charac teristics of the two sting nematode populations infecting peanut in Levy County, Florida , ii) determine the phylogenetic relationship between these two sting nematode populations infecting peanut with other Belonolaimus species and populations of B. longic audatus from different hosts and localities, iii) describe the symptoms they cause on peanut and estimate yield suppressio n, i v) describe changes in their population densities over the peanut crop season at both infested sites, v ) isolate the nematode and duplicate the symptoms they caused on peanut , v i ) evaluate soil t exture content of sand, silt, clay and organic matter, and vii) determine the capa bility of infecti on on peanut of an outlier isolate of sting nematode collected from a strawberry field in Dover, Hillsborough Co., Florida.

PAGE 28

28 CHAPTER 3 MATERIALS AND METHODS Morphological Characterization Preparation of Nematode Specimens for Morphological Examination Two isolates of sting nematodes were collected from peanut fields in Levy County, Florida. The first isolate was collected in 2012 from a farm designated as 35 Farms ; the second was collected in 2013 from a farm designated as Brown farm. Both peanut fields were large planting s of ca. 400 ha. The nematodes were extracted from soil samples by the modified Baermann method (Rodriguez Kabana and Pope, 1981) and an isolate of each population was reared on a diploid St. Augu stine grass ( Stenotaphrum secundatum (Walt.) Kuntze) (FX 313) in 15 cm diameter clay pots in a University of Florida greenhouse with an averag e daytime temperature of 28 ±5° C. Extracted f emales and males of both peanut isolates were arbitrarily chosen and hand picked from the water suspension with the aid of a stereomicroscope for morphological analysis. Specimens were processed using the method s of Seinhorst (1959, 1962, 1966 ) with slight modifications. They were killed in hot 4% formalin in sm all watchglasses, which were maintained in a petri dish covered with wet filter paper for 12 hours at room temperature. After 12 hours, excess formalin was removed from the watchglasses, and replaced with Seinhorst glycerol ethanol solution (96% ethanol 20 %: glycerin 1%) and kept in an alcohol chamber for 12 hours. Alcohol was removed from the watchglasses after the incubation period, and replaced with formalin glycerol fixative solution (96% ethanol 95%: glycerin 5%). Then the watchglasses were placed in a dry pe tri dish in an oven at 40 °C and the formalin glycerol fixative solution was added every 3 hours for a day and then every 12 hours for 3 days until the specimens were

PAGE 29

29 e mbedded in pure glycerin. The w atchglasses containing the fixed specimens were kep t in a dessicator until they were ready to be mounted on glass slides for measurements. Examination and Measurements of Nematode Specimens The configuration of the morphology of the fixed specimens was examined in detail for their classification at family and generic levels. These morphological characters evaluated included the body size, the length of the stylet, the shape of the cephalic region and tail, and the number of incisures in the lateral lines. Selected morphometric characters for 20 females and males of the two nematode populations also were examined and recorded (Geraert, 2011). The specimens were measured with an ocular micrometer using a Nikon compound microscope at ×1000 magnification with an oil immersion objective, except for total body len gth, which was measured at ×400. The characters measured included : total body length, stylet, stylet cone and stylet shaft lengths, head height, tail length, tail width , anterior end to excretory pore dis tance, posterior end to phasmid distance, body width , spicule and gubernaculum length. The following ratios a (body length/body width), b (body length/ pharynx length), c (body length/tail length), tail/body width, stylet/tail and percentage V (v ulva position as percentage of body length) were calculated. Mo lecular Characterization Preparation of Nematode Sample Two sting nematode isolates attained from 35 Farms and Brown farm were reared and extracted from soil as described above . DNA Extraction DNA was extracted with DNeasy® Blood & Tissue Kit (Qiagen , Valencia, CA) according to the manufacturer Single females from each of the nematode

PAGE 30

30 isolate s were hand picked, placed in to 1.5 ml microcentrifuge tubes containing 180 l of Buffer ATL. Twenty microliters of proteinase K was added and tho roughly mixed by vortexing, and the specimen was incubated at 56°C overnight to insure the tissue was completely lysed. After the incubation period , the tubes were vortexed for 15 seconds, 200 µl of ethanol (96 100%) w as added , and the sample was mixed tho roughly again by vortexing. The total sample was transferred to a DNeasy Mini Spin Column placed in a 2 ml colle ction tube, and centrifuged at 6,000 × g for 1 minute. The flow through was discarded with the collection tube, and replaced with a new collecti on tube. Five hundred microliters of Buffer AW1 was added into the spin column , and centrifuged at 6,000 × g for 1 minute. The flow through and the collection tube were discarded, and the spin column was s et onto a new collection tube. Five hundred microli ters of Buffer AW2 was added to the column, and centrifuged for 3.5 minutes at 20,000 × g , t he flow through was discarded with the collection tube , and t he spin colu mn w as transferred to a new 1.5 ml microcentrifuge tube. Fifty microliters of Buffer AE was added to the center of the spin column membrane to elute the DNA. After incubation for 1 minute at room temperature, it was centrifug ed for 1.5 minute at 6,000 × g . The extracted DNA was stored at 20°C for further use . PCR Amplification The extracted DNA was suspended in a 25 µl reaction volume containing 2.5 µl of 10 × Standar d Taq rea c tion buffer (100 mM Tris pH 8.3, 500 mM KCl, and15 mM MgCl 2 ), 2 µl of 10x dNTPs (200 mM each), 0.8 units of 1 µl Taq DNA polymerase (Takar a Bio Company, S higa Japan), 1 µl each of forward and reverse primers, 12.5 µl of HyClone water and 5 µl of DNA template. T wo sets of prime r s were chosen for this study : GTTTCCGTAGGTGAACCTGC

PAGE 31

31 ATATGCTTAAGTTCAGCGGGT amplifying the ITS 1 5.8 ITS 2 of the rRNA (Cid Del Prado Vera and Subbotin, 2012; Stirling, et al . , 2013 ), and ACAAGTACCGTGAGGGAAAGTTG TCGGAAGGAACCAGCTACTA amplifying the D2/D3 expansion fragments of 28S rRNA (Cid Del Prado Vera and S ubbotin, 2012; Stirling, et al . , 2013 ) . PCR cycling conditions for amplification were; 94 °C for 5 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds , annealing at 55° C for 30 seconds, extension at 72 °C for 1 minute, and a final step at 72 °C for 10 minutes. Gene Amp PCR System 9 700 (Applied Biosystems, Grand I sland, NY) was used for all PCR assays . PCR product s (10 µl) were resolved in a 2 % agarose gel (2 g of agarose, 100 ml of 100 ×TBE buffer ( 89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH : 8.3 ) at 120 V for 45 minutes and then stained with SYBR ® Green II RNA Gel Stain ( Lonza, Rockland, ME USA ). PCR products (15 µl) were purified using High Pure PCR Products Purification Kit (Roche Applied Science, Manheim, Germany) following the manufactur 20 °C for further use. Cloning and Sequencing PCR purified products (4 µl) were ligated into the plasmid pCR2.1 TOPO and used to transform Escherichia coli. The protocol that came with the plasmid pCR2.1 TOPO kit (InVitrogen Cor poration, Carlsbad, CA) was used for this process. The transformed E. coli was mixed with 100 µl SOC medium (2% Bacto tryptone, 0.5% Bacto yeast extract, 0.05% NaCl, 2 M MgCl2 20 mM glucose) , and cultured in Luria b ertani (LB) medium, 50 µg/ml of ampicilli n, X ga l and D 1 thiogalactopyranoside ( IPTG ) , and incubated at 37 °C for 15 hours. The transformed colonies were distinguished from wild type colonies by the white color and 16 colonies were randomly picked for the analysis. These chosen colonies were cultured in 10 ml

PAGE 32

32 LB medium containing 20 l of ampicillin and i ncubat ed at 37 °C for 15 hours. Plasmids were extracted using PureLinkTM Quick Plasmid Miniprep Kit (Invitrogen Corp., bacterial cells were harvested by the centrifugation at 6,000 × g for 5 minutes. After harvesting, 250 µl of r e suspension buffer (R3; 50 mM Tris HCl, pH 8.0; 10 mM EDTA) was added to the cell pellet, and re suspended until it was thoroughly homogeneous. Tw o hundred fifty microliters of l ysis b uffer (L7; 200 mM NaOH, 1 % w/v SDS) was added and mixed gently by shaking, and incubated at room temperatur e for 5 minutes. Precipitation b uffer (N4) was added and mixed by flipping over the tube several times. The lysate was centrifuged at 12,000 × g for 10 minutes. Th e supernatant was l oaded onto a Spin Column in a 2 ml wash tube. The column was centrifuged at 12,000 × g for 1 minute. The pellet from the last step was washed by two different wash buffers (W9, W10), and for each wash buffer, the pellet was centrifuged a t 12,000 × g for 1 minute. Seventy five microliters of HyClone water was added to elute the DNA. After incubation at room temperature for 1 minute, the column was centrifuged at 12,000 × g for 2 minutes. The purified plasmid DNA was stored at 20 °C. The e xtracted plasmids were digested with EcoRI , and the plasmid DNA obtained from each nematode isolate were sequenced at the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida, Gainesville, Florida. Sequence Alignment and Phylogenetic Analysis Amplified DNA sequences from both isolates of sting nematode infecting peanut w ere aligned with BioEdit (Hall, 2013) to default parameters, and improved with MEGA5.2 (Tamura et al., 2011), and aligned with CLUSTALX in MEGA5.2. Both Ma ximum Likelihood and Neighbor Joining trees were constructed using MEGA5.2.

PAGE 33

33 Phylogen etic analysis of the ITS and D2/ D3 expansion fragments regions were performed by comparing the sequences obtained from the cloned PCR products of both isolates of sting nem atodes with those deposited to GenBank (Gozel et al., 2006; Han et al., 2006 b ) of other species of Belonolaimus, including B. euthychilus and B. gracilis , and different Florida populations of B. longicaudatus found infecting several crops. Tylenchorhynchus leviterminalis and T. zeae were included as ou tgroup taxa for D2/D3 and ITS , respectively. Kimura 2 parameter model was applied for both ML and NJ . Bootstrap values had 1,000 replicates to ensure the reliability of the branch ing . Anything below 50% for Bo otstrap number was ignored for the analysis. All the unique sequences obtained from the two sting nematode populations infecting peanut were deposited to GenBank (Accession No s . KF963097, KF963098 for ITS, and KF963199, KF963100 for D2/D3 ). Population Den sity Changes a nd Damage Esti mation u nder Field Conditions Population Density Changes The experiments were conducted at 35 Farms and Brown farm, Levy Co. , Florida from June to September, 2013. The peanut cv. Bailey, which is a Virginia type (Isleib et al. , 2011), was seeded at 35 Farms at the end of April , and the runner type peanut cv. Georgia 06G (Branch, 1996) was seeded at Brown farm on 19 March , 2013 . Three plots (six beds, 22 m × 1.8 m each) were set up at 35 Farms after the peanut s were seeded, and five plots (five beds, 15 m × 1.8 m each) were set up at Brown farm after the sting nematode symptoms were clearly visible. Soil samples were collected every 2 weeks from June to Septem ber, 2013 at 35 Farms, and June to August, 2013 at Br own farm. At harvest, 10 peanut plants , showing the typical root symptoms induced by sting nematode from each replicate were collected along with the soil attained directly around

PAGE 34

34 the roots and placed into plastic bags. Nematodes were extracted by the cent rifugal flotation method (Jenkins, 1964) and the number of nematodes per 100 cm 3 of soil was co unted under a light microscope. Estimation of Peanut Yield Suppresion At the Brown farm, s ting nematode infested and non infested plots were delimited for estim ati ng yield suppression . Five plots, 6 m × 1.8 m each, were established from b oth sites . The peanuts were planted as twin rows spaced 91 cm on center . To ensure the non sting nematode infested site was free of sting nematodes, s oil samples were taken from each of the five plots and the nematode s extracted from 100 cm 3 of soil (Jenkins, 1964). At harvest, 23 August 2013, peanut from each site was dug. The peanut plants from each plot were collected by hand, placed in 6 m × 6 m tobacco sheets and dried to a m oisture level of 10%. Once dried the vines were removed from the sheets and thrashed by machine to remove the pods, which were collected and weighed. The mean pod weight from both sites were compared by a T test ( P . Soil Analysis Soil was taken from the A horizon from both peanut farms and the percentages of sand, silt, and clay , and organic matter were determined following the Bouyoucos hydrometer method (Bouyoucos, 1936) . Infection of Belonolaimus longicaudatus on Peanut in a Greenhouse Environment Belonolaimus longicaudatus collected from peanut, Levy Co., Florida The sting nematode isolates used were collected from 35 Farms and Brown farm, Levy, Co., Florida, and reared on St. Augustinegrass in 15 cm diameter clay pots in a greenhouse. The treatments included the two nematode isolates, one peanut cv.

PAGE 35

35 Georgia 06G, replicated three times for the 35 Farms isolate, and twice for the Brown farm isolate . Two replicates of non inoculated control were included for comparison. The soil that was used for this trial was collected from 35 Farm s , steam pasteurized, and approximately 700 cm 3 of soil w as added to each 15 cm diameter clay pot. Four peanut seeds were seeded 2.5 cm deep per pot. Plants were maintained with two replicates in a completely ra ndomized design in a greenhouse. The soil temperature at a depth of 4 cm was monitored and checked weekly using a TidbiT Data Logger (O nset HO BO Data Loggers, Bourne, MA ). After the seedlings reached three true leaves, they were thinned to one seedling per pot, then 100 sting nematodes (mixed life stages) extracted by modified Baermann method (Rodriguez Kabana and Pope, 1981) in a water suspension were pipetted into four 3 cm deep holes around the plant stems . Plants were fertilized weekly with Miracle Gro ( 24% nitrogen; 8% phosphate; 16% potassium ; and minor elements) (Scotts Miracle G ro Products, Marysville, OH) and Danitol (a.i. f enpropathrin), Kelthane (a.i. chlorophenyl) for mites, and Chloronil (a.i. c hlorothalonil) for early an d late leaf spots were sprayed as needed according to 90 days after inoculation, plants were removed from the soil , and nematode s extracted by centrifugal flotation from 100 cm 3 of soil from each replicate (Jenkins, 1964) . Harvest of o ne of the three replicates of the 35 Farms isolate was delayed 1 week to provide more time for the nematode to develop and reproduce. The nematodes were collected from the sample as described above. The reproductive factor (Rf) was calculated by th e formula: R f = final nematode density (Pf) /initial inoculum density (Pi).

PAGE 36

36 Belonolaimus longicaudatus collected from strawberry , Hillsborough Co., Florida Because o f the difficulty of attaining sufficient numbers of peanut sting nematodes for determining their reproduction rate and pathogenic effects on peanut grown under greenhouse conditions, evaluation of an outlier isolate of sting nematode obtained from a strawberry field at the Florida Strawberry Grower Association (FSGA) located in D over, Hillsborough Co., Florida was used . The strawberry isolate could be attained in large numbers from late season strawberry plants. Soil samples were collected from the severely stunted strawberry plants and the nematodes extracted by modified Baermann method (Rodriguez Kabana and Pope, 1981) . The pots were inoculated with 200, 300, 500, and 1,000 B. longicaudatus mixed life stages in 15 cm diameter clay pots containing 1,000 cm 3 of steam pasteurized soil collected from 35 Farms. Non inoculated peanut p lants were used as control. All treatments were replicated three times. Also , a peanut seedling was transplanted directly in to potted s oil collected from the strawberry naturally infested strawberry field soil . All tr eatments were maintained in a greenhouse, harvested 90 days after inoculation, and data collected and analyzed as described above . The root systems were prepared for scanning ( Pang et al., 2011) . The root lengths were measured and subjected to analysis with WinRHIZO (Regent Instrument s, Quebec, Canada) according to the instructions. Diameter ranges that were measured were, <0.25 mm, 0.26 to 0.5 mm, 0.51 to 1.0 mm, >1.0 mm, and all diameter ranges, and each measurement was regressed per the initial population densities of B. longicaudatus wit h Excel software (Microsoft, Re dmond, WA) .

PAGE 37

37 CHAPTER 4 RESULTS Morphological Characterization The large body size (> 1 mm long), long stylet (> 60 µ m), offset cephalic region and cylindroid tail indicate s that the specimens obtained from either peanut field were representatives of the subfamily Belonolaiminae. The presence of a single groove like incisure in the lateral fields provided evidence that they belonged to the genus Belonolaimus and not to the other genera in the su bfamily, which have late ral fields marked by more than two incisures. For the identification of the two populations at species level, the following diagnostic characters of the females were evaluated: t he c onfiguration of the lip region was constricted f ro m the body in both isolates and ranged in height of 10 12 and 9.6 13 µ m for 35 Farms and Brown farm isolates , respe ctively; the stylet length ranged from 114 128 and 116 143 µ m for t he 35 Farms and Brown farm isolates, respectively; and the average value o f stylet/tail ratio was less than 1 for both isolates ( 0.92 and 0.8 from 35 Farms and Brown farm is olates, respectively) (Table 4 1). On the basis of these morphological characters and following the key prepared by G eraert in 2011, both isolates were ident ified as representatives of the species Belonolaimus longicaudatus . Additional Characters of Female M orphology Sclerotized v ag inal pieces were observed in both isolates (Figures 4 1, 4 2). C omparison of the morphometrics of B. longicaudatus females from t he peanut isolates with those of the original descriptions of other known species of Belonolaimus including B. gracilis, and B. euthychilus, B. nortoni, and B. maluceroi, and also with published data of B. longicaudatus isolated from different hosts and sites in Florida, Georgia, and

PAGE 38

38 North Carolina are shown in Table s 4 1 and 4 2 . Females of both peanut isolates showed a similar range of morphometric values for each recorded character (Table 4 1 ) . Male morphology Ranges o f male morphometric values for the two isolates were similar to each other (Table 4 3) . Molecular Characterization Characterization of the Sequence of ITS Region DNA samples extracted from sting nematodes isolated from 35 Farms and Brown farm were identifi ed as Belonolaimus longicaudatus according to Basic Local Alignment Search Tool (BLAST) by National Center for Biotechnology Information (NCBI, GenBank searches). The total amplified DNA of the peanut isolates , which include partial sequence of 18S rRNA, c omplete sequences of ITS 1, 5.8S rRNA, and partial sequence of ITS 2, was 98 2 bp. There w as a 3 bp redundant confirmed in the total amplified DNA of B. longicaudatus from Brown farm isolate (985 bp) compared to that from 35 Farm s isolate . Both partial sequ ences of 18 S rRNA were 40 bp. The ITS 1 was 464 bp, whereas 5.8 S r RNA gene was 167 bp in both sting nematode isolate s. There were nine transitions between the two different isolates . Five tra nsitions occurred in ITS 1, and two transitions occurred in the 5.8 S rRNA gene and ITS 2. C to T and G to A transitions were observed in ITS 1 and ITS 2, and a G to C transition occurred in ITS 1. The most frequent ly observed transition was T to A (A to T) , which was recognized twice in ITS 1, once in the 5.8 S rRNA gen e, and once in ITS 2. Characterization of the Sequence of D2/D3 Expansion Fragments of 28 S rRNA The sequences of D2/D3 expansion fragments of 28 S rRNA from both sites showed a 99% identity match to B. longicaudatus a ccording to the BLAST search at the

PAGE 39

39 NC BI GenBank. The total length of amplified DNA was 787 bp for both isolates . There were only two tran C, and G A) occurring between the two sequences at 401 and 464 bp. Phylogenetic Analysis for ITS Region Two different algori thms of trees, Maximum Likelihood (ML) , and Neighbor Joining (NJ) were constructed (Figure s 4 3, 4 4 ). The clades of the constructed ML and NJ showed similar patterns. In both methods of analysis , the isolates of B elonolaimus longicaudatus from 35 Farms and Brown farm we re evolutiona r ily related, and in the same major clade including the Florida isolates previously reported. These closely related Flo rida isolates were from north central Florida, namely from Gilchrist, Al achua, Putnam, Marion, and St. Johns counties. All o f these occupy the same geographical regions as Levy Co. Florida isolates of sting nematodes attained from southern Florida, namely Palm Beach and Broward Counties , were in more distantl y related clades in both algorith ms . Belonolaimus longicaudatus on soy bean from Delaware, cotton from Georgia, corn from North Carolina were in the same main clade as the peanut isolates, but the South Carolina, Texas, and Nebraska isolates were located more distantly from the peanut isolates . Moreover, B. longicaudatus isol a ted from pine trees in Marion, Santa Rosa, and Alachua counties were closely related to each other, however these populations were differentiated from the peanut isolates in both algori th m s . Phylogenetic Analysis for D2/D3 Expansion Fragments of 28 S rRNA The same algorithm s of phylogenetic trees used for ITS regions ( ML and NJ ) were applied for D2/D3 expansion fragments of the 28 S rRNA gene (Figure s 4 5, 4 6 ). The branch patterns resulting from tree making programs showed similarities with slight

PAGE 40

40 differenc es in both algorithm s . The similar features among the trees based on the two different genes were that the Florida isolates from pine trees were separated fro m the peanut isolates , and the southern Florida isolates were located far f rom them as well. The C alifornia isolate collected from grass, which was hypothes ized as be ing introduced from Florida (Ch erry et al. 1997), was observed in the same main branch containing both peanut isolates as well as the Delaware isolate from soybean . Furthermore, the trees based on D2/D3 expansion fr agments revealed that the north Florida iso lates of B. longicaudatus were in the same clade as the peanut isolates. Population Density Changes , and Damage Estimation U nder Field Conditions Population Density Changes The damage induced by the sting nematode on peanut was seen as large irregular patches at both farms (Figures 4 7, 4 8 ). I nfected plants were heavily stunted and showed symptoms of nutrient deficiency (Figure 4 9 ). The root systems we re severely abbreviated (Figure 4 10 ), and numerous small, round punctate like necrotic lesions were observed on pods and pegs of th e infected pla nts at both peanut farms (Figures 4 11, 4 12 ). Though peanut plants were severely stunted during the first 6 weeks of growth, t he symptoms on p ods and pegs were most apparent in mid July at both farms, ca. 110 days and 80 days after planting at 35 Farms and Brown farm, respectively . At the Brown farm, sting nematode averaged 30 motile stages/100 cm 3 of soil from late June through late July, and i ncreased to over 50 specimens in late August (Figure 4 13 ) . A t the 35 Farms , t he number of sting nematode increased from mid June until early August and decreased after the nematode number s peaked at 86 specimens/ 100 cm 3 of soil during the first week of Au gust (Figure 4 14 ). Other plant parasitic nematodes found at both farms were root knot, lesion and ring nematodes.

PAGE 41

41 The population densities of these nematodes in the sting nematode infested sites remained low throughout this study (Figure 4 1 4 ) , except at the Brown farm root knot nematode second stage juveniles increased to over 425/100 cm 3 of soil at the last sampling date, 23 August . Estimation of Peanut Yield Suppression The average dried weight of peanut kernels was 2.7 kg from the sting nematode infes ted plots, and 7.4 kg from the control plots (Figure 4 15 ). Compared to the control, peanut yield suppression was estimated at 64 % ( P 0.0001). No sting nematode was detected from any of non sting infested sites, but other plant parasitic nematodes found were: 7 lesion, 42 root knot , and 22 ring nematodes/100 cm 3 of soil. Soil Analysis The soil from 35 Farms contained 97.3% of sand, 1 % of silt, 1.7% of clay and 2.2% of organic matter , whereas the Brown farm contained 94.7% of sand, 2 % o f silt, 3.3% of clay and 2.8 % of organic matter. The soil type was identified as Candler series (consists of very deep, excessively drained, rapidly permeable soil on uplands of Florida flat woods). Infection of Belonolaimus longicaudatus on Peanut in a Greenhous e Environment Belonolaimus longicaudatus collected from peanut, Levy Co., Florida Punctate like, isolated lesions were observed on pods and pegs of peanut plants inoculated with either peanut isolate (Figures 4 16 and 4 17 ), whereas sting nematode symptom s on root systems, such as root abbreviation and stunted plant growth, were much less severe as compared with that observed in the field . Only one plant inoculated with the Brown farm isolate showed a s everely abbreviated root system ( Figures 4 18 and 4 19 ). The final population density number was 95.2 sting nematode s/ pot ( 13.6

PAGE 42

42 sting nematodes /100 cm 3 of soil ) and 15.4 sting nematod es/ pot (2.2 sting nematodes /100 cm 3 of soil ) from 35 Farms and Brown farm isolates, respectively . Belonolaimus longicaudatus co llected from strawberry, Hillsborough Co., Florida No sting nematodes were extracted from the non inoculated control, 22 sting nematodes from treatments inoculated with 200 sting nematodes, 13 sting nematodes from treatments inoculated with 300 sting nemat odes, 21 sting nematodes from treatments inoculated with 500 sting nematodes and 53 sting nematodes from treatments inoculated with 1,000 sting nematodes, and 90 sting nematodes from pots with naturally infested soil (i nitial population density averaged 28 9/100 cm 3 ). Despite the low number of sting nematodes recovered from pots , symptoms on pods and pegs of most inoculated peanut plants appeared similar to that observed in the field isolated punctate like lesions (Figure 4 20 ). Abbreviated root systems we re also observed on some of the plants (Figure 4 21 ). Nonetheless, no clear differences were visually observed between above ground symptoms of inoculated peanut plants and controls, except were one of the peanut pla nt s showed an abbreviated root system (Figure 4 2 2 ). The root diameters as well as total root length were slightly increased as the initial population density o f B. longicaudatus increased ( Table 4 4).

PAGE 43

43 Table 4 1. Morphometric s a of selecte d characters of Belonolaimus longicaudatus fema les attained from soil collected around peanut roots from 35 Farms and Brown farm (n=20 ) and original descriptions of five speci es of Belonolaimu s . a Measurements in µ m except L in mm. b L =Total body length, a=Total body length /body width, b=Total body length /length of esophagus, c=Total body length /tail length, V%=distance from anterior end to vulva of female as a percentage of total body length.

PAGE 44

44 Table 4 2. Measurements a of selected characters of B elonolaimus longicaudatus isolated from different crops and localities . a Measurements in µ m except L in mm. b L=Total body length, a=Total body length / body width, b=Total body length / length of esophagus, c=Total body length / tail length, V%=distance from anterior end to vulva of female as a percentage of total body length. c Gozel et al., 2006. d Han et al., 2006 b .

PAGE 45

45 Table 4 3. Morphometrics a of selected characters of Belonolaimus longicaudatus males isolated from soil collected from peanut roots from 35 Farms and Brown far m (n=20) and original descriptions of five species of Belonolaimus . a Measurements in µ m except L in mm. b L =Total body length, a=Total body length per body width, b=Total body length per length of esophagus, c=Total body length per tail length.

PAGE 46

46 Table 4 4. Regression of effect of increasing Belonolaimus longicaudatus densities, collected from strawberry in Hillsborough Co., Florida, on root length of peanut.

PAGE 47

47 Figure 4 1. Light microscope micrographs of Belonolaimus longicaudatus extracted from soil collected from peanut roots at 35 Farms. A) Anterior body region showing the constricted lip region. B) Vulval region with vaginal pieces . Photo taken by author. A B

PAGE 48

48 Figure 4 2. Light microscope micrographs of Belonolaimus longicaudatus extracted from soil collected from peanut roots at Brown farm. A) Anterior body region showing the constricted lip region. B) Vulval region with vaginal pieces. Photo taken by author. A B

PAGE 49

49 Figure 4 3 . Maximum Likelihood tree based on ITS sequence of Belonolaimu s longicaudatus . The sequences other than PKK1(Brown farm isolate), and PKK8 ( 35 Farms isolate) were downloaded from GenBank .

PAGE 50

50 Figure 4 4 . Neighbor Joining tree based on ITS sequence of Belonolaimus longicaudatus . The sequences other than PKK1(Br own farm isolate), and PKK8 (35 F arm s isolate) were downloaded from GenBank.

PAGE 51

51 Figure 4 5 . Maximum Likelihood tree based on D2/D3 expansion fragments of 28 S rRNA from Belonolaimus longicaudatus . The sequences other than PKK5 (Brown farm isolate), and PKK12 ( 35 Farms isolate) were downloaded from GenBank.

PAGE 52

52 Figure 4 6 . Neighbor Joining tree based on D2/D3 e xpansion fragments of 28 S rRNA from Belonolaimus longicaudatus . The sequences other than PKK5 (Brown farm isolate), and PKK12 ( 35 Farms isolate) were downloaded from GenBank.

PAGE 53

53 Figure 4 7 . An overall view of a sting n ematode infested peanut field at 35 Farms , showing stunted peanut cv. Bailey in a patchy distribution , Levy Co., FL, summer 201 3 . Photo taken by author.

PAGE 54

54 Figure 4 8 . S everely damage d peanut cv.Georgia 06G field infested with the sting nematode at Bro wn farm, Levy Co., FL, summer 20 13. Photo taken by author. Figure 4 9 . A close up of the sting nematode infected peanut cv.Georgia 06G, showing leaf yellowing and stunted growth at Brown farm in summer 2013. Photo taken by author.

PAGE 55

55 Figure 4 10 . Below ground symptoms induced by the sting nematode on peanut. A) A close up of an abbreviated root system of peanut cv. Tifguard found at 35 Farms in summer, 2012, B) Abbreviated root system of an infected peanut cv. Georgia 06G found at the Brown farm in summer, 2013. Photo taken by author. Figure 4 11 . Symptoms induced by the sting nematode on peanut pod and peg of peanut cv. Tifguard found at 35 Farms in summer, 2012. A) Punctate like isolated lesions on affected pods, B) A close up of an infected peg. Photo taken by Janete A. Brito, Gainesville, FL. A B B A B

PAGE 56

56 Figure 4 12 . Symptoms induced by sting nematodes on pods and pegs of peanut cv. Georgia 06G observed at Brown fa rm in summer, 2013; A) Punctate like coalescent necrotic lesions on the pod and peg surface, B) Isolate d necrotic punctuation on the peg and pod surface . P hoto taken by author. A B

PAGE 57

57 Figure 4 13 . Belonolaimus longicaudatus p opulation density changes on peanut cv. Georgia 06G from June to August, 2013 at Brown farm. F igure 4 14 . Belonolaimus longicaudatus p opulation density changes on peanut cv. Bailey from June to September, 2013 at 35 Farms .

PAGE 58

58 Figure 4 1 5 . Peanut cv.Georgia 06G yield taken from non sting nematode infested plots compared with sting nematode infested plots at the Brown farm, su mmer 2013. a

PAGE 59

59 Figure 4 16 . P od and peg symptoms on peanut cv. Georgia 06G under greenhouse conditions induced by Belonolaimus longicaudatus from the 35 Farms , Levy Co., FL. A) Punctate like isolated lesions on pods. B) Discrete punctate like lesion s on peg s . Photo taken by Janete A. Brito, Gainesville, FL. B A

PAGE 60

60 Figure 4 17 . Pod and peg s ymptoms induced on peanut cv. Georgia 06G under greenhouse conditions by Belonolaimus longicaudatus from the Brown farm, Levy Co., FL. A) Punctate like lesions on peanut pegs. B) N ecrotic isolated lesions on a pod and peg . Photo taken by author. A B

PAGE 61

61 Figure 4 18 . A close up of an a bbreviated root systems of one of the two replicates of a peanut c v. Georgia 06G inoculated with 100 Belonolaimus longicaudatus mixed life stage s from the Brown farm under greenhouse conditions . The circles show stubby roots induced by the nematode. Photo taken by Janete A. Brito, Gainesville, FL . Figure 4 19 . Comparison of one of the two replicates of peanut cv. Georgia 06G inoculated with 100 Belonolaimus longicaudatus mixed life stages from the Brown farm (right) and a non inoculated control plant (left) under greenhouse conditions . Photo taken by Janete A. Brito, Gainesville, FL.

PAGE 62

62 Figure 4 20 . Discrete punctate like symptoms induced by Belonolaimus longicaudatus from the strawberry isolate on pods and pegs of peanut cv. Georgia 06G under greenhouse conditions . Phot o taken by author. Figure 4 21 . A close up of some abbreviated root systems induced by Belonolaimus longicaudatus on peanut cv. Georgia 06G planted in sting nematode infested soil obtained from a strawberry field in Hillsborough Co., Florida under greenhouse conditions . The circle shows stubby root induced by the nematode. Photo taken by Janete A. Brito, Gainesville, FL.

PAGE 63

63 Figure 4 22 . Comparison of peanut cv. Georg ia 06G planted in Belonolaimus longicaudatus infested soil obtained from a strawberry field in Hillsborough Co., Florida (left) versus the control (right) under greenhouse conditions . Photo taken by author.

PAGE 64

64 CHAPTER 5 DISCUSSION Morphological Charact erization The peanut isolates were similar in their morphome tric and morphology to each other . The range values of the morphometri c characters of both isolates were in agreement with those reported in the original description of Belonolaimus longicaudatus (Rau, 1958) . However, differences were observed in the values of the b ratio and height of the lip regions compared to those repor ted in the original description (Rau, 1958) . The ranges of the height of lip region of the peanut nematode isolates were smaller than those reported in th e original description (Rau, 1958) . Also, t he ranges of b ratio values of the peanut isolates were greater than that reported for B. longicaudatus paratypes. T hese variations in b ratio values and heights of the lip r egion among B. longicaudatus compared to those of the original description of B. longicaudatus (Rau, 1958) have been reported previously (Abu Gharbieh and Perry, 1970; Robbins and Hirsch m ann, 1973 ). F emales from the peanut isolates shared the presence of o pposed vaginal sclerotized pieces with other Florida ( Gainesville and Lake Alfred) and No rth Carolina (Scotland County) isolates from citrus and corn, respectively (Han et al., 2006 b ) and also a greenhouse population from Tifton, Georgia (Robbins and Hirsc hmann, 1973), whereas B. longicaudatus collected from a peanut field in Severn, North Carolina reported lacking opposed sclerotized vaginal pieces (Robbins and Hirschmann, 1973). Although, the range of the stylet length of 35 Farms population was shorter t han that of a population collected from citrus grown in a grove near Lake Alfred ( central Florida ) (Duncan et al., 1996), the ranges of the stylet length of both peanut isolates were in agreement with the values reported for this character in other Florida populations. More

PAGE 65

65 accentuated differences were observed in total body length, tail width, anterior end to excretory pore distance and body width between the peanut isolates and other isolate s observed from central Florida than other isolates from northern Florida. The similarity in the morphological values between the peanut isolates and other isolates from northern Florida may indicate that the isolates infect ing peanut may hav e originated from northern Fl orida isolates rather than from central Florida. The factors that cause these variations in morphological characteristics of B. longicaudatus are unknown. Molecular Characterization Han et al. (2006 b ) reported size variations i n ITS 1 that ranged from 427 bp to 468 bp of B. longicaudatus isolated from different hosts and different locations , whereas the peanut isolates included 464 bp. This number was close to that of other Florida, Georgia, and North Carolina isolates, whereas the Texas isolate collected from b ermudagrass and B. euthychilus collected from a Florida pine tree had 37 bp and 101 bp reductions , respectively , compared to the size of the ITS 1 region of the peanut isolates (Han et al., 2006b) . The ITS 1 of B. longicau datus on pine was reported to be 464 bp , which was the same as the ITS 1 from the peanut isolates, a lthough in their estimation of similarity they were located in different main branches in both phylogenetic trees. Although the bootstrap values on the main branch were high enough to support the inferred common ancestry of the isolates, the bootstrap values on the branch inside t he big clade to separate each Florida isolates were too low to support the inferred evolut ionarily relatio nships among the Florida isolates. Since B. longicaudatus is reported as a species complex and Florida appears be a putative center of origin , there might be more polymorphism in the ITS region and D2/D3 expansion fragments.

PAGE 66

66 Symptoms, Popul ation Density Changes a nd Damage Estimation Under Field Conditions Visual symptoms of sting nematode damage appeared at both peanut farms as large irregular patches of mostly severely stunted plants. The peanut stand was reduced, and infected plants were c hlorotic. Most plants bore few pegs and pods, with many bearing none. Because o f the severe stunting of peanut, it seems they were mostly in the early vegetative stages of growth when infected . These symptoms observed at both farms were similar to those re ported previously on peanut (Abu Gharbieh and Perry, 1970; Dickson, 1998; Dickson and D e Waele, 2005). Sting nematode population densities at both peanut farms reached their peaks on Augu st when the air temperature in Levy Co. averaged 28°C; this temperature is consistent with that reported as for sting nematode reproduction (Han et al., 2006a; Robbins and Barker, 1974 ). The numerous single punctate like lesions that appear ed on peanut pegs and pod s were assumed to be caused by the nematode feeding deep within the tissue with its long stylet. The small size of sting nematode induced lesions appeared unique. They could be easily distinguished from the much larger lesions caused by lesion nematode, Pratylenchus brachyurus . Although some ring, lesion a nd root knot nematodes were extracted from the sting nematode infested sites, they were present in relatively low numbers. It se emed that the sting nematode infection at the early stage of peanut development allowed the nematode to establish its niche befo re other plant pathogenic nematodes began to appear. Yield of pods was reduced by sting nematode by an estimated 64% in this study . Others have also reported s ignificant peanut yield reductions induced by sting nematode (Cooper et al., 1958; Sasser et al., 1960) . They reported inc reases in yields

PAGE 67

67 from soil treatment with the soil fumigant 1,2 dibromo 3 chloropropane of as much as 109 to 400% compared with non treated co ntrol plots . However, because damage induced by sting nematode was often distributed in scattered patches , these scientists suggested that overall suppression of peanut yields in large fields would be relatively low. Similarly, with the scattered patchiness of sting nematode damage at the 35 Farms and Brown farm overall yield s uppression also would be expected to be low. However, it should be pointed out that the grower at 35 Farms seeing the amount of sting nematode damage that occurred during 2012 chose to apply 1,3 D soil fumigant over the entire 202 ha field in 2013 . In the North Carolina trial, B. longicaudatus extracted from the nontreated control plots ranged from 10 to 43 nematodes/100 cm 3 of soil (Cooper et al., 1959; Sasser et al., 1960). These numbers are in agreement with those extracted from the Florida peanut fields. The percentages of sand, silt and clay from both farms were conducive for sting nematode development and were in agreement with that reported previously ( Robbins and Barker, 1974; Brodie and Quattlebaum, 1970). Although the initial population den sities of sting nematode at 35 Farms and Brown farm were similar, high er number s were found later in the season at 35 Farms, where the Virginia type peanut cv. Bailey was grown . Virginia type peanut was reported to be more susceptible to B. longicaudatus than R unner, Bunch, and Spanish type s (Miller, 1952; Holdeman and Graham, 1953). M ore investigations are needed to determine to better understand the host suitability of the differ ent types of peanut to sting nematode in Florida .

PAGE 68

68 Infection of Belonolaimu s longicaudatus on Peanut in a Greenhouse Environment Abu Gharb ier and Perry (1970) reported that peanut was unable to support large number s of sting nematodes 4 months after inoculation due to failure of the nematodes to reproduce on secondary roots after infection. The low number of sting nematode s extracted from potted Georgia 06G for both peanut isolates were in ag reement with this statement . R eproductive factor (Rf) for both 35 Farm s and Brown farm isolates were 0.95 and 0.15, respectively. Howev er, most developing po d s and peg s of peanut plants inoculated with both isolates showed sting nematode symp toms, and some root systems of peanut inoculated with the Brown farm isolate were clearly stunted . Timper and Hanna (2005) compared reproduction of B. longicaudatus isolated from Tift Co., Georgia on different hosts . They reported peanut as a poor host of the Georgia isolate , which had a low Rf value of 0.3. This low value of Rf is in agreement with that of the Brown farm isolate on peanut cv. Geor gia 06G . It was very difficult to have the peanut isolates increase on peanut under greenhouse conditions even when the same field soil as that occurring at the 35 Farms was used. T he symptoms observed on pods, pegs and root systems of inoculated peanut plant s provided evidence that the nematode s were feeding, h owever, there was little indication that the nematodes were reproducing. It is assumed that the greenhouse conditions were unsuitable for reproduction or there are other unknown conditions affecting the nematodes ability to reproduce. The economic damage threshold reported for most crops is at, or near t he detection level (Crow and Han, 2005). For instance, Crow et al. (2000b) reported that the economic threshold for sting nematode control on potato was two to three B.

PAGE 69

69 longicaudatus /130 cm 3 of soil. Dickson and De Waele (2005) reported the economic threshold level on peanut varied from two to five B. longicaudatus /130 cm 3 of soil. From th is point of view, it seems that only a small number of nematodes are needed to induc e damage on peanut . Because of the difficulty of collecting sufficient numbers of both peanut sting nematode isolates, only a few replicates were possible for evaluating the pathogenicity under greenhouse conditions. H owever, the results c onfirm ed B. longicaudatus as a pathogen of peanut by the duplication of symptoms on peanut grown under greenhouse conditions. Furthermore, the strawberry sting nematode isolate also caused symptoms on peanut under greenhouse conditions. Similarly, two isol ates of sting nematode collected from corn showed pathogenicity on peanut under greenhouse conditions ( Abu Charbieh and Perry, 1969). However, the reproductive capacity of sting nematode on peanut under greenhouse conditions remain unclear and still needs further investigations.

PAGE 70

70 CHAPTER 7 SUMMARY Sting nematode ( Be lon olaimus longicaudatus ) was c onfirmed infecting peanut at two different peanut farms , 35 Farms and Brown farm , both located in Levy Co., Florida in 2012 to 2014. Above ground symptoms were yellowing, and stunting of plants distributed in irregular patches. Root systems were severely abbreviated, and isolated necrotic lesions were observed on pods and pegs of infected plants. Both peanut isolates were identified as B . longicaudatus based on morphological and molecular characteristics. Both isolates showed more morpholog ical similarities to northern Florida isolates than south Florida isolates. T his is in agreement with patterns observed in phylogenetic trees constructed based on DNA sequence s from the I TS region of 18 S rRNA gene as well as D2/D3 expansion fragments of the 28 S rRNA gene . Because of the intraspecific variation , the existence of physiological races within B. longicaudatus has been suggested ( Robbins and Barker, 1973; Robbins and Hirschmann, 1974; Perry and Norden; 1963; Duncan et al., 1996; Cherry et al., 1997; Gozel et al., 2006; Han et al., 2006a,b) . However, no genetic marker s have been reported that make clear the existence of physiological races . From the field observations, B. longicaudatus has the potential to induce symptoms on peanut plants , and cause a significant impact on peanut yield even at low population densities . The answers to what factors or conditions are needed for B. longicaudatus to cause disea se on peanut are unknown. We were able to confirm and duplicate the sam e type of injuries caused by B. longicaudatus in pot cultures under greenhouse conditions. Beside the peanut isolates, B. longicaudatus isolated from a strawberry field also showed its capacity to induce

PAGE 71

71 symptoms on peanut. However, reproductive capacities on peanut of these three isolates remained unclear. Obviously there are many things we do not know about this pathogen, and there should be more invest igations about the biology of sting nematodes and their effects on peanut production in Florida.

PAGE 72

72 Permission to Reproduce Copyrighted Material Any candidate who intends to quote or reproduce material beyond the limits of "fair use" from a copyrighted sou rce must have written permission from the copyright holder. A copy of this written approval must be submitted to the Graduate School Editorial Office no later than the final submission date of the term the candidate graduates. The form below is intended to aid the candidate in fulfilling his or her responsibility. ______________________________________________________________________ _. PERMISSION TO QUOTE/REPRODUCE COPYRIGHTED MATERIAL I (We),_______________________________________, owners(s) of the copyright of the work known as _______________________________________________________ ______________________________________________________________________ __ ______________________________________________________________________ __ hereby authorize ____ _____________________________ to use the following material as part of his/her thesis/dissertation to be submitted to the University of Florida. Page Inclusive Line Numbers Passages to be Quoted/Reproduced The following should be added for doctoral students: I (We) further extend this authorization to ProQuest Information and Learning Company (PQIL), Ann Arbor, Michigan, for the purposes of reproducing and distributing microformed copies of the dissertation. _____________________________ __________ Signature of Copyright Holder _______________________________________ Date

PAGE 73

73 LIST OF REFERENCES Abebe, E., Mekete, T., and Thomas, W. K. 2011. A critique of current methods in nematode taxonomy. African Journal of Biotechnology 10:312 323. Abu Charbieh, W. I., and Perry, V. G. 1969. Host differences among Florida populations of Belonolaimus longicaudatus Rau. Journal of Nematology 2:3. Adams, B. J. 1998. Species concepts and the evolutionary paradigm in m odern nematology. Journal of Nematology 30:1 21. Adams, B. J., Dillman, A. R., and Finlinson, C. 2009. Molecular Taxonomy and Phylogeny. Pp . 119 135 in R. N. Perry, M. Moens, and J. L . Starr, eds. Root knot n ematodes. CABI International. Massachusetts, USA. Anonymous . 1987. Bibliography of estimated crop losses in the United States due to plant pathogenic nematodes. Annals of Applied Nematology 1: 6 12. Bekal, S., and Becker, J. O. 2000. Population dynamics of the sting nematode in California turfgrass. Plant Disease 84:1081 1084. Bouyoucos, G. J. 1936. Directions for making mechanical analyses of soils by the hydrometer method. Soil Science 42:225 229. Boyd, F. T., and Perry , V . G . 1969. Effect of sting nematodes on establishment, yield, and growth of forage grasses on Florida sandy soils. Proceedings of the Soil and Crop Science Society of Florida 29:288 300. Brodie, B. B., and Quattlebaum, B. H. 1970. Vertical distribution a nd population fluctuations of three nematode species as correlated with soil temperature, moisture, and texture. Phytopathology 60:1286 (Abstr.). Brooks, A. N., and Christie, J. R. 1950. A nematode attacking strawberry roots. Proceedings of the Florida St ate Horticultural Society 63:123 125. 06G Jo urnal of Plant Registrations 36:806. Cetintas, R., Lima, R. D., Mendes, M. L., Brito , J. A., and Dickson, D. W. 2003. Meloidogyne javanica on peanut in Florida. Journal of Nematology 35:433 436. Cherry, T., Szalanski, A. L. Todd, T. C., and Powers, T. O. 1997. The internal transcribed spacer region of Belonolaimus (Nemata: Belonolaimidae). Journal of Nematology 29:23 29.

PAGE 74

74 Christie, J. R. 19 59. The sting and awl nematode. Pp. 126 135 in J. R. Christie, ed. Plant nematodes, their bionomics and control. Gainesville, FL: University of Florida Press. Christie, J. R., Brooks, A. N., and Perry, V. G. 1952. The sting nematode, Belonolaimus gracilis , a parasite of major importance on strawberries, celery, and sweet corn in Florida. Phytopathology 42:173 176. Cid Del Prado Vera, I., and Subbotin, S. A. 2012. Belonolaimus maluceroi sp.n. from a tropical forest in Mexico and key to the species of Belon olaimus . Nematropica 42:201 210. Cooper, W. E., Wells, J. C., Sasser, J. N., and Bowery, T. G. 1959. The efficacy of preplant and postplant applications of 1,2 dibromo 3 chloropropane on control of the sting nematode, Belonolaimus longicaudatus. Plant Dis ease Reporter 43:903 908. Crow, W. T ., Dickson, D. W., Weingartner, D. P., McSorley, R., and Miller, G. L. 2000 a . Yield reduction and root damage to cotton induced by Belonolaimus longicaudatus . Journal of N ematology 32:205 209 . Crow, W. T., Weingarter, D. P., McSorley, R., and Dickson, D. W. 2000b . Damage function and economic threshold for Belonolaimus longicaudatus on potato. Journal of Nematology 32:318 322. Crow, W. T., and H. Han. 2005. Sting nematode. Plant Health Instructor, doi:10.1094/PHI I 200 5 1208 01. St. Paul, MN: The American Phytopath ological Society Press. Online. http://www.apsnet.org/edcenter/intropp/lessons/Nematodes/Pages/StingNematode .aspx (accessed on 11 February 2013 ). Crow, W. T., and Brammer, A. S. 2010 . Sting nematode Belonolaimus longicaudatus . ENY 239. Gainesville, FL. The Entomology and Nematology Department, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. De Ley, P., and Blaxter, M. 2002. Systematic position and phylogeny. Pp . 1 30 in D. L. Lee, ed. T he biol ogy of nematodes. New York: Taylor & Francis. Dickerson, O. J., Willis, W. G., Dainello, F. J., and Pair, J. C. 1972. The sting nematode, Belonolaimus longicaudatus , in Kansas. Plant Disease Reporter 56:957. Dickson, D. W., and De Waele, D. 2005 . Nematode parasites of peanut. Pp . 393 436 in M. Luc, R. A. Sikora, and J. Bridge, ed. Plant parasitic nematodes in subtropical and tropical agriculture, 2nd ed. E gham, UK:C ABI Bioscience.

PAGE 75

75 Dickson, D. W.1998. Peanut. Pp . 523 566 in K. R. Barker, and G. A. Pederson, ed. Plant and nematode intera ct ions. Madison, WI, U SA: American Society of Agronomy, Crop Science of America, Soil Science Society of America . Duncan, L. W., Noling, J. W., and Inserra, R. N. 1996. Spatial patterns of Belonolaimus spp. among and of Nematology 28:352 359. Eisenback, J. D., Bernard, E. C., Starr, J. L., Lee, T. A., and Tomaszewski, E. K. 2003. Meloidogyne haplanaria n. sp. (Nematoda :Meloidogynidae), a root knot nematode parasitizing peanut in Texas. Journal of Nematology 35 : 395 403. Esser, R. P., and Simps on, S. E. 1984. Sting nematode on citrus. Nematology Circular No. 106. Gainesville, FL: Department of Agriculture and Consumer Service, Division of Plant Industry. Fer ris, V. R., Ferris, J. M., and Faghihi, J. 1993. Variation in spacer ribosomal DNA in some cyst forming species of plant parasitic nematodes . Fundamental applied Nematology 16:177 184. Fortuner, R., and Luc, M. 1987. A reappraisal of tylenchina (nemata). 6. The family belonolaimidae Whitehead, 1960. Revue de Nematology 10: 183 202. Geraert, E. 2011. Subfamily Belonolaiminae. Pp. 9 25 in E. Geraert, ed. The Dol ichodoridae of the world. Gent: Academia Press. Good, J. M. 1968. Relation of plant parasitic nema todes to soil management practices. Pp. 113 138 in G. C. Smart, Jr. and V. G. Perry, eds. Tropical n ematology. Gainesville, FL: University of Florida Press. Gozel. U., Adams, B. J., Nguyen, K. B., Inserra, R. N., Giblin Davis, R. M., and Duncan, L. W. 200 6. A phylogeny of Belonolaimus populations in Florida inferred from DNA sequences. Nematropica 36: 155 171. Graham, T. W., and Hol deman, Q. L. 1953. The sting nematode Belonolaimus gracilis Steiner: A parasite on cotton and other crops in South Carolina. Phytopathology 43:434 439. Han, H R., Dickson, D. W., and Weingartner, D. P. 2006 a. Biological characterization of five isolates of Belonolaimus longicaudatus . Nematropica 36:25 35. Han, H R., Jeyaprakash, A., Weingartner, D.P., and Dickson, D.W. 2006 b . Morphological and molecular biological characterization of Belonolaimus longicaudatus . Nematropica 36: 37 52.

PAGE 76

76 Higgins, B. B. 1951. Origin and early history of the peanut. Pp . 18 27 in F. S. Arant , R. W. Bledsoe, W. E. Colwell, K. H. Garren, W. C. Gregory, H. C. Harris, B. B Higgins, B. W. Smith, D. G. Sturkie, J. T. Williamson, C. Wilson, and J. A. Yarbrough, eds. The peanut the unpredictable legume. Washington, D.C , ML :The national fertilizer a ssociation. Holbrook, C. C., Timper, P., Culbreath, A. K., and Kvien, C. K. 2008. Registration rnal of Plant Registrations 2 :92 94. Holdeman, Q. L., and Graham, T. W. 1953. The effect of different plant species on the population trends of the sting nematode. Plant Disease Reporter 37:497 500. Holdeman. Q. L. 1955. The present known dist ribution of the sting nematode, Belonolaimus gracilis, in the coastal pl ain of the southeastern United S tates. Plant D isease R e porter 39 : 5 8. Huang, X., and Becker, O. J. 1997. In vitro culture and feeding behavior of Belonolaimus longicaudatus. Journal of Nematology 29 : 411 415. Hutchinson, M. T., and J. P. Reed. 1956. The sting nematode Belonolaimus gracilis , found in New Jers ey. Plant Disease Reporter 40:1049. Isleib, T. G., Milla Lewis, S. R., Pattee, H. E., Copeland, S. C., Suleta, M. C., Shew, B. B., Hollowell, J. E., Sanders, T. H., Dean, L. O., and Hendrix, K. W. 2011. urnal of Plant Registrations 5: 27 39 J enkins, W. R. 1964. A rapid centrifugal flotation technique for separating nematodes from soil. Plant D isease Reporter 48: 692 Kerr, E. D., and Wysong, D. S. 1979. Sting nematode, Belonolaimus sp., in Nebras ka. Plant Disease Reporte r 63 :506 507. Kinloch, R. A., and Sprenkel, R. K. 1994. Plant parasitic nematodes associated with cotton in Florida . Supplement t o the Journal of Nematology 26: 749 752. Lopez, R. 1978. Belonolaimus , un Nuevo integrante de la nematofauna de Costa Rica. Agronomia Costarricense 2:83 85. Miller, L. I. 1972. The influence of soil texture on the survival of Belonolaimus longicaudatus . Phytopathology 62:670 671 (Abstr.). Miller, L. I. 1952. Control of the sting nematode on peanuts in Virginia. Phytopathology 42:470 (Abstr.). Monterio, A. R. , and Lordello, L. G. E. 1977. Dois novos nematóides encontrados associados á cana de acúcar. Revista de agricultura ( Piracicaba ) 52:5 11.

PAGE 77

77 Moss, P. J., and Rao, R. V. 1995. The peanut reproductive developm e nt to plant maturity. Pp. 1 13 in H. E. Pattee, and H. T. Stalker, eds. Advan ces in peanut science. American Peanut Research and Education Society. Stillwater, OK, USA. Mundo Ocampo, M., Becker, O. J ., and Baldwin, J. G. 1994. Occurrence of Belonolaimus longicaudatus on bermudagrass in the Coac hella valley. Plant Disease 78: 529. Myers, R. F. 1979. The sting nematode, Belonolaimus longicaudatus from New Jersey, USA. Plant Disease Reporter 63:756 757. Norton, D. C. 1959. Plant parasitic nematode in Texas. Bulletin 32: 1 10. College Station, TX. Texas Agricultural Experiment Station. Owens, J. V. 1951. The pathological effect of Belonolaimus gracilis on peanuts in Virginia. Phytopathology 41:29 (Abstr.). Pang, W., Crow, W. T., Luc, J. E., McSorley, R., Gib lin Davis, R. M., Kenworthy, K. E., and Kruse, J. K. 2011. Comparison of water displacement and WinRHIZO software for plant root parameter assessment. Plant Di sease 95:1308 1310. Perry, V. G., and Norden, A. J. 1963. Some effect of cropping sequence on po pulations of certain plant nematodes . Soil and Crop Science of Florida Proceedings 23:116 120. Perry, V. G., Smart, G. C. , Jr. , and Horn, G. C. 1970. Nematode problems of turfgrasses in Florida and their control. Florida State Hortic ultural Society Procee dings 83: 489 492. Perry, V. G., and Rhoades, H . 1982. The genus Belonolaimus . Pp. 144 149 in R. D. Riggs, ed. Nematology in the southern region of the United States. Southern Cooperative Series Bulletin 276. Fayetteville, AR: University of Arkansas Agricul tural Publications. Prostko, E. P., Kemerait, R. C., and Webster T. M. 2012. Georgia 06G, Florida 07, and Tifguard peanut cultivar response to chlorimuron. Weed Technology 26:429 431. Rau, G. J. 1958. A new species of sting nematode. Proceeding of the Helminthological Society of Washington 25: 95 98. Rau, G. J. 1961. Amended descriptions of Belonolaimus gracilis Steiner, 1949 and B. longicaudatus Rau, 1958 (Ne matoda: Tylenchida). Proceedings of the Helminthological Society 28:198 200.

PAGE 78

78 Rau, G. J. 1963. Three new species of Belonolaimus (Nematoda:Tylenchida) with additional data on B. longicaudatus and B. gracilis . Proceedings of the Helminthological Society 30:119 128. Rau, G. J. , and Fassuliot is, G. 1970. Equal frequency tolerance ellipses for population studies of Belonolaimus longicaudatus . Journal of Nematology 2: 84 92. Riggs, R. D. 1961. Sting nematode in Arkansas. Plant Disease Reporter 45:392. Robbins, R. T., and Barker, K. R. 1973. Com parisons of host range and reproduction among populations of Belonoliamus longicaudatus from North Carolina and Georgia. Plant Disease Reporter 57 : 750 754 . Robbins, R. T., and Barker, K. R. 1974. The effect of soil type, particle size, temperature, and moisture on reproduction of Belonolaimus longicaudatus . Journal of Nematology 6:1 6. Robbins, R. T., and Hirschmann, H. 1974. Variation among population of Belonolaimus longicaudatus . Journ al of Nematology 6 :87 94. Rodriguez Kabana, R., and Pope, M. H. 1981. A simple incubation method for the extraction of nemato des from soil. Nematropica 11: 175 185. Roman, J. 1964. Belonolaimus lineatus n. sp. (Nematoda: Tylenchida). Journal of Agricultur e of University of Puerto Rico 48:131 134. Russell, C. C., and S t u r geon, R. V. 1969. Occurrence of Belonolaimus l ongicaudatus and Ditylenchus dipsaci i n Oklahoma. Phytopathology 59: 118 (Abstr.). Sasser, J. N., Cooper, W. E., and Bowery, T. G. 1960. Rece nt developments in the control of sting nematode, Belonolaimus longicaudatus, on peanuts with 1,2 dibromo 3 chloropropane and EN 18133. Plant Disease Reporter 44:733 737. Sasser, J. N., and Cooper, W. E. 1961. Influence of sting nematode control with o,o diethyl 0 2 pyrazinyl phosphorothioate on yield and quality of peanut s. Plant Disease Reporter 45:173 175 . Sasser, J. N., Wells, J. C., and Nelson, L. A. 1967. Correlations between sting nematode populations at three sampling dates following nematicide treatments and t he growth and yield of peanuts. Nematologica 13:152 (Abstr.). Seinhorst, J. W. 1959. A rapid method for the transfer of nematodes from fixative to anhy drous glycerin. Nematologica 4: 67 69. Seinhorst, J. W. 1962. On the killing, fixation and transferring to glyceri n of nematodes. Nematologica 8: 29 32.

PAGE 79

79 Seinhorst, J. W. 1966. Killing nematodes for taxonomic study with hot f.a. 4:1. Nematologica 12:1 78 (Abstr.). Siddiqi, M. R. 2000. Super family Dolichodoridea. Pp. 429 508 in M. R. Siddiqi, ed. Tylenchida parasi tes of plants and insects , 2 nd ed. New York: CABI publishing. Sivour, T. R. 1978. Biology and control of Belonolaimus lolli n sp. Journal of the Australasian Plant Pathology Society 63:37 (Abstr.). Siviour, T. R., and McLeod, R. W. 1979. Redescription of Ibiopora lolli (Siviour, 1978) comb. N. (Nematoda; Belonolaimidae) with observations on its host range and pathogenicity. Nematologica 25:487 493. Smart, G. C. , and Nguyen, K. B. 1991.Sting and awl nematodes: Belonolaimus spp. and Dolichodorus spp. Pp. 627 668 in W.R. Nickle , ed. Manual of Agricultural Nematology. New York: Mar c el Dekker . Steiner, G. 1942. Plant nematodes the grower should know. Proceedings of the Soi l Science Society of Florida 4 :72 117 Stirling, G. R., Stir ling, A. M., Giblin Davis, R. M., Ye, W., Porazinska, D. L., Nobbs, J. M. , and Johnston, K. J. 2013. Distribution of southern sting nematode, Ibipora lolii (Nematoda: Belonolaimidae), on turfgrass in Australia and its taxonomic relationship to other belono laimids. Nematology 15:401 415. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. , and Ku mar, S. 2011. MEGA5: Molecular e volutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods . Mole cular Biology and Evolution 28: 2731 2739. Timper, P., and Hanna, W. W. 2005. Reproduction of Belonolaimus longicaudatus, Meloidogyne javanica, Paratrichodorus minor, and Pratylenchus brachyurus on Pearl Millet ( Pennisetum glaucum ). Journal of Nematology 37:214 219.

PAGE 80

80 BIOGRAPHICAL SKETCH Kanan Kutsuwa was born to Mrs. Youko Kutsuwa and Mr. Takayuki Kutsuwa in Japan. In 2008, she graduated from Funabashi Higashi High School in Chiba. Kanan began her undergraduate education in the Plant Clinical Science D epartment of Hosei University the same year, and receiv 2012. During her bache lor degree study, she did her internship with the Doctor of Plant Medicine Program at the University of Florida, and attended the Plant Nematology course taught by Dr. Donald W. Dickson. This unique experience inspired her to pursue a career in nematolog y. In January 2012, she started her graduate education in the Entomology and Nematology Department at the University of Florida under the supervision of Dr. Dickson. Her M aster of science project emphasizes the morphological and molecular characterization of a sting nematode ( Belonolaimus sp.) found infecting peanut in Florida.



PAGE 1

JournalofNematology45(1):17–20.2013. TheSocietyofNematologists2013.InteractionBetween Belonolaimuslongicaudatus and Helicotylenchus pseudorobustus onBermudagrassandSeashorePaspalumHostsWILLIAMT.CROW,1JOHNE.LUC,2NICHOLASS.SEKORA,3WENJINGPANG4Abstract:Belonolaimuslongicaudatus and Helicotylenchuspseudorobustus areamongthemostcommonnematodeparasitesofturfgrassesinFlorida.Bermudagrass( Cynodondactylon 3 C.transvaalensis )andseashorepaspalum( Paspalumvaginatum )arethetwo turfspeciesmostcommonlyusedonFloridagolfcourses.Thispaperexplorestheinteractionsbetween B.longicaudatus and H.pseudorobustus onbermudagrassandseashorepaspalumhosts.Datacollectedfromthousandsofnematodesamplessubmittedto theFloridaNematodeAssayLabovera8-yrperiodrevealedanegativerelationshipbetween B.longicaudatus and H.pseudorobustus on bermudagrass,butnotseashorepaspalum.Inamulti-yeareldplotexperimentusingmultiplecultivarsofbermudagrass,and seashorepaspalum B.longicaudatus and H.pseudorobustus werenegativelyrelatedonbothturfspecies.Greenhousetrialswhere multiplecultivarsofbothturfspecieswereinoculatedwithdifferentcombinationsof B.longicaudatus and H.pseudorobustus found thateachnematodespecieswasinhibitorytotheotheronbothhostspecies. Belonolaimuslongicaudatus and H.pseudorobustus clearly impacteachotheronturfgrasshosts,althoughthemechanismofthenematode-nematodeinteractionsisunknown. Keywords:Belonolaimuslongicaudatus ,bermudagrass, Cynodondactylon , Helicotylenchuspseudorobustus ,interaction, Paspalumvaginatum , seashorepaspalum,spiralnemat ode,stingnematode,turfgrass.Bermudagrass( Cynodondactylon 3 C.transvaalensis ) andseashorepaspalum( Paspalumvaginatum )arecommonwarmseasonturfgrassesusedongolfcourses, athleticelds,andlawnsinthesoutheasternUnited States.Stingnematode( Belonolaimuslongicaudatus )and spiralnematode( Helicotylenchuspseudorobustus )aretwo ofthemostcommonlyencounteredectoparasitesassociatedwithbermudagrassandseashorepaspalum inthisregion.Asurveyofseashorepaspalumgolf coursesandlawnsinFloridafoundthat50%ofthe golfcoursesand40%ofthelawnswereinfestedwith B.longicaudatus ,while88%ofthegolfcoursesand 85%ofthelawnswereinfestedwith Helicotylenchus spp.(HixsonandCrow,2004).Highnumbersof Helicotylenchus spp.(>500nematodes/100-cm3soil)were oftenfoundassociatedwithseashorepaspalumin Florida(HixsonandCrow,2004).AsurveyofbermudagrassgolfcoursesinFloridafound B.longicaudatus wasthemostcommonnematodepresentatnumbers consideredpotentiallydamagingaccordingtothe thresholdsusedbytheFloridaAgriculturalExtension Service(Crow,2005). Belonolaimuslongicaudatus was presenton84%ofgolfcourses,60%offairways,and 52%ofgreensfrombermudagrassgolfcoursessurveyedandatpotentiallydamagingnumberson60%, 25%,and21%ofthosesites,respectively(Crow, 2005).Bothbermudagrassandseashorepaspalumare damagedby B.longicaudatus and H.pseudorobustus (Hixsonetal.,2004;Pangetal.,2011a,2011b,2011c, 2011d),although B.longicaudatus isgenerallyconsidered themostvirulentofthetwo.Populationsofthesetwo nematodesoftenoccurconcomitantlyonturfgrassesin theeld. Previousstudieshaveobservedthatwhenmultiple plant-parasiticnematodespeciesarepresent,thenumbers ofanindividualspeciesareoftensuppressedascomparedwithwhenonlyasinglespeciesispresent.Onturf, inoculationwith B.longicaudatus , Mesocriconemaornatum , and Tylenchorhynchusannulatus singly,andincombinationondifferentbermudagrasscultivars,revealedthat nematodenumbersforindividualspeciesweregenerally lowerinthecombinationtreatmentsthaninthesingle speciestreatments(Johnson,1970).Similarly,presence of Tylenchorhynchusagri inhibitedreproductionof Meloidogynenaasi on Agrostispalustris (creepingbentgrass) (Sikoraetal.,1972).Themode-of-actionforthesetypes ofnematode-nematodeinteractionsmaybevariablewith thenematodespeciesandhostsinvolved.Theseeffects havebeenshowntobephysiologicallyrelatedthrough aninducedresistancemechanismwithsomesedentary endoparasiticspeciesoncotton(Aryaletal.,2011a, 2011b).However,effectsofectoparasitesonother nematodespeciesmightbebecauseofcompetitionfor feedingsitesorstructuralchangesinplantrootsresultingfromnematodeactivity.Themorevirulentspecies oftenhasthegreatereffect.Johnson(1970)notedthat effectsof B.longicaudatus ,themorevirulentspecies,on M.ornatum and T.annulatus weregreaterthantheeffectsof M.ornatum or T.annulatus on B.longicaudatus . Similarly,otherresearchnotedthat B.longicaudatus causedmorerootdamageandplantstuntingof Zeamays than Dolichodorusheterocephalus ,andhadgreaterimpact onPfof D.heterocephalus than D.heterocephalus didonPf of B.longicaudatus (Rhoades,1985). A2-yreldstudyconductedtoevaluatetheresponsesofeightbermudagrassandthreeseashorepaspalumcultivarsto B.longicaudatus and H.pseudorobustus revealedthatbermudagrasswasabetterhostto B.longicaudatus thanwasseashorepaspalum,andthatseashorepaspalumwasthebetterhostto H.pseudorobustus (Pangetal.,2011b).ItwasalsonotedthatamongbermudagrasscultivarsTifSportwasthepooresthostto B.longicaudatus andthebesthostto H.pseudorobustus . ReceivedforpublicationSeptember13,2012.1AssociateProfessor.2PostDoctoralResearchAssociate.3GraduateStudent.4formerGraduateStudent,EntomologyandNematologyDepartment,UniversityofFlorida,Gainesville,FL32611. Email:wtcr@u.edu ThispaperwaseditedbySallianaR.Stetina.17

PAGE 2

Theseobservationsindicatedthepossibilityofinteractionsbetween B.longicaudatus and H.pseudorobustus on turfgrasshosts.Theobjectiveofthisstudyistoquantify thenematode-nematodeinteractionsof B.longicaudatus and H.pseudorobustus onbermudagrassandseashore paspalum. MATERIALSANDMETHODSDatabase: TheFloridaNematodeAssayLab(NAL)is thenematodediagnosticfacilityoftheUniversityof FloridainGainesville,FL,thatspecializesindiagnosing nematodeproblemsonturfgrasses.SinceAugust2005, NALhasusedacustomNematodeAssayDatabasethat utilizesMicrosoftAccess(Microsoft,Redmond,WA)to manageitssampleinformation.Theinformationcontainedinthedatabasecanbesortedbasedonvarious parametersincludinghostplantandnematodegenera detected.ThecontentofthedatabasefromJuly2005 toApril2012wassortedtoidentifysamplescollectedin Floridawhere Belonolaimus spp.and/or Helicotylenchus spp.weredetectedonbermudagrass( n =10,484)and seashorepaspalum( n =3,436).Forsamplescontaining bothnematodes, Belonolaimus and Helicotylenchus /100cm3ofsoilwerecorrelatedandregressedusingSASsoftware(SASInstitute,Cary,NC)foreachofthetwohosts individuallyandcombined.Correlationwasusedto determinethedegreetowhichthetwonematodes affectedoneanother,regressionwasusedtodenethe relationshipbetweenthem.Whileeachgenuswasregressedontheother,theslopes, r2and P valueswere identical,onlythe X interceptsweredifferent.Therefore, onlytheregressionof Helicotylenchus on Belonolaimus was usedtoindicaterelationships. FieldStudy: Regressionanalysiswasappliedtothe nematodedatacollectedbyPangetal.(2011b)to quantifyinterrelationshipsbetween B.longicaudatus and H.pseudorobustus onbermudagrassandseashore paspalum.Eightbermudagrasscultivars(Champion, Floradwarf,Tifgreen,MiniVerde,TifEagle,Tifway,Celebration,andTifSport)andthreeseashorepaspalum cultivars(Aloha,SeaDwarf,andSeaIsle1)wereevaluated.Eachgrasscultivarwasgrownin2.25-m2plots inarandomizedcompleteblockdesignwithvereplicationsinaeldnaturallyinfestedwithbothnematode species.Nematodesampleswerecollectedfromthese plotsevery3monbytakingninesoilcores(2.5-cm-diam.) fromeachplotandextractingnematodesfroma100-cm3subsampleusingacentrifugalotationmethod(Jenkins, 1964).Theplotsweresampledninetimesthroughout the2-yreldtrial.Thenumberof H.pseudorobustus recoveredfromeachplotateachsamplingdatewasregressedonthenumberof B.longicaudatus recovered foreachcultivarindividually,eachspeciesofgrass individually,andallgrassescombined. GreenhouseStudy: Thisexperimentevaluatedthereproductionof B.longicaudatus and H.pseudorobustus individuallyandincombinationon‘Tifdwarf’,‘Celebration’,and‘TifSport’bermudagrass,andon‘Aloha’ and‘SeaDwarf’seashorepaspalum.Theexperimentwas repeatedinseparatetrials.Turfaerialsprigsforeach cultivarwerecollectedfromgreenhouseculturesand plantedintoUV-stabilizedRayLeach‘‘Cone-tainers’’ (SC10,Stuewe&Sons,Inc.,Tangent,OR;3.8-cmdiameter 3 21-cmdeep)lledwith100%UnitedStates GolfAssociationspecicationgreenssand(USGA,1993) asdescribedbyPangetal.(2011a,2011d).After6wk, thesprigshaddevelopedenoughrootsystemfornematodeinoculation.Nematodesforinoculumwerereared inpotcultureoncreepingbentgrass( Agrostisstolonifera ) andextractedusingadecantingandsievingtechnique (Flegg,1967).Theaveragenumberofnematodeswere countedfromve1-mlaliquotsandextrapolatedto thetotalvolumeofthestocksuspensionforeachof thetwonematodes.Aseriesof H.pseudorobustus and B.longicaudatus inoculationrates,designedtoreveal theeffectsofeachnematodeontheother,areshown inTable1.Theappropriatevolumeofeachstocksuspensionwasusedtoaddnematodesinthedesired quantitiesandcombinations.Inoculumsuspensions werepipettedintoa3-cm-deepholemadeinthe middleoftheCone-tainer.Theholeswerecovered withalightlayerofsandandmoistenedwithalight mist.Cone-tainerswerearrangedinarandomized completeblockdesignwithsixreplicationsofeach treatment.Experimentswereharvested90dafterinoculationwithnematodes.Nematodeswereextracted fromtheentiresoilvolumeofeachCone-tainerby usingacentrifugalotationtechnique(Jenkins,1964). ThePfwerecountedunderamicroscope.Regression analysiswasusedtoevaluatetheinteractionsbetween thetwonematodespecies.FromCone-tainersinoculated with15 B.longicaudatus ,thePfof B.longicaudatus was TABLE1.Inoculationrates(nematodes/Cone-tainer)for Helicotylenchuspseudorobustus and Belonolaimuslongicaudatus usedinthe greenhousestudy.Treatment H.pseudorobustusB.longicaudatus1150 2015 31515 41530 51560 63015 76015 TABLE2.Regressionof Helicotylenchus spp.on Belonolaimus spp. frombermudagrassandseashorepaspalumsamplesreceivedbythe FloridaNematodeAssayLabwherebothgeneraweredetected.Grass nYr2PPaspalum211-0.00771x+410.0040.34 Bermuda2,357-0.01679x+360.0020.02 Combined2,568-0.00875x+360.0010.0918 JournalofNematology,Volume45,No.1,March2013

PAGE 3

regressedonthePiof H.pseudorobustus (0,15,30, and60nematodes/Cone-tainer)andfromCone-tainers inoculatedwith15 H.pseudorobustus thePfof H.pseudorobustus wasregressedonthePiof B.longicaudatus (0,15,30,and60nematodes/Cone-tainer).Theseregressionswereperformedforeachgrasscultivar,each grassspecies,andallgrassescombined. RESULTSOfthe10,484bermudagrasssubmittedtotheNAL containingeither Belonolaimus or Helicotylenchus ,45% hadcontainedonly Belonolaimus ,33%containedonly Helicotylenchus ,and22%containedbothgenera.Out of3,436seashorepaspalumnematodeassaysthat containedeither Belonolaimus or Helicotylenchus ,34% containedonly Belonolaimus ,59%containedonly Helicotylenchus ,and6%containedbothgenera.From samplescontainingbothgenera,correlationsbetween Belonolaimus and Helicotylenchus revealedanegativerelationshiponbermudagrass(R=0.04; P =0.02)and onbothgrasses(R=0.03; P =0.09).However,therelationshipwasnotsignicantonseashorepaspalum (R=0.06; P =0.34)(Table2). Fromtheeldstudy, B.longicaudatus hadanegative relationshipto H.pseudorobustus onbermudagrass( P = 0.0002),seashorepaspalum( P <0.0001),andonall grassescombined( P <0.0001;Table3).Relationships weresignicantonallthreein dividualseashorepaspalum cultivarsevaluated( P # 0.002),andonthreeofthesix bermudagrasscultivarsevaluated( P # 0.06). Resultsfromthegreenhousestudyrevealedthat B.longicaudatus reducedthePfof H.pseudorobustus on bermudagrassinbothtrials( P <0.0001),butonseashorepaspaluminonlyonetrial( P =0.08;Table4). Helicotylenchuspseudorobustus reducedthePfof B.longicaudatus onseashorepaspalum( P # 0.02)andon bermudagrass( P # 0.002)inbothtrials(Table5). DISCUSSIONTheNALdatafound Belonolaimus spp.morefrequentlythan Helicotylenchus spp.onbermudagrass, 67%and55%,respectively.Onseashorepaspalum, Helicotylenchus spp.wasfoundmorefrequentlythan Belonolaimus spp.,65%and40%,respectively.This parallelsthendingsofPangetal.(2011b,2011d)that seashorepaspalumisabetterhostto H.pseudorobustus andpoorerhostto B.longicaudatus thanbermudagrass. Mixedpopulationsweremorefrequentlyfoundon bermudagrassthanonseashorepaspalum.However, theNALreliesonsamplessubmittedbyclientelewith varyingdegreesofprofessionalknowledgeandthe turfspeciesmaynothavebeencorrectlyidentiedin allcases.Inaddition,theresultsfromtheeldand greenhouseexperimentsindicatethatresultsvaryamong turfgrasscultivarswithinaspeciesandthecultivarinformationisoftennotincludedintheinformation TABLE3.Regressionof Helicotylenchuspseudorobustus on Belonolaimus longicaudatus fromeldplotsplantedwithdifferentbermudagrassand seashorepaspalumcultivars,replicatedvetimes,sampledninetimes overa2-yrperiod.Cultivar nYr2PSeashorepaspalum Aloha45-8.23644x+10440.370.0001 SeaDwarf45-4.45358x+6980.200.002 SeaIsle145-5.39539x+8160.320.0001 Combined135-5.72733x+8370.280.0001 Bermudagrass Celebration45-0.27900x+400.040.19 Champion45-0.03947x+400.010.54 Floradwarf45-0.07429x+130.030.25 MiniVerde45-0.05479x+220.080.06 TifEagle45-0.12659x+580.090.05 Tifgreen45-0.22017x+1100.060.12 TifSport45-2.74860x+3800.110.03 Tifway45-0.12749x+130.010.51 Combined360-0.25100x+910.040.0002 Bothgrasses Combined495-1.05723x+2900.080.0001 TABLE4.Regressionof Helicotylenchuspseudorobustus Pfafter90don Belonolaimuslongicaudatus Piingreenhousetrialsonmultiplecultivars ofseashorepaspalumandbermudagrass.Trial1Trial2 Cultivar Yr2PYr2PSeashorepaspalum Aloha-0.16710x+940.010.6251-1.04857x+1870.200.0272 SeaDwarf-0.76060x+1230.130.0824-0.44440x+1710.030.4399 Combined-0.48087x+1090.060.0830-0.30206x+1780.010.4259 Bermudagrass Tifdwarf-1.25240x+1380.150.0478-1.72920x+1800.400.0061 Celebration-1.60600x+1410.480.0002-1.04860x+1870.200.0272 TifSport-0.32950x+720.120.0932-0.89530x+1190.200.0305 Combined-1.16911x+1250.230.0001-1.70066x+1610.350.0001 Bothgrasses Combined-0.89219x+1190.160.0001-1.14423x+1680.140.0001Belonolaimus and Helicotylenchus interactions: Crowetal. 19

PAGE 4

providedtotheNAL.Therefore,therelationshipsbetween H.pseudorobustus and B.longicaudatus derived fromtheNALdataarenotasobviousasthoseobtained fromtheeldandgreenhouseexperiments. Itisnoteworthythatwhile B.longicaudatus isgenerallyconsideredmoredamagingtoturfgrassesthan H.pseudorobustus ,thegreenhouseexperimentdidnot indicatethat B.longicaudatus hadagreatereffecton H.pseudorobustus thanviceversa.Thisindicatesthat thesuppressionmechanismisnotsimplybecauseof rootreductionscausedbythemorevirulentspecies.It ispossiblethatthemechanismischemicalinnature. Aryaletal.(2011a)observedelevatedlevelsofcatalase andperoxidaseslinkedtoplantdefenseresponsesin cottoninfectedby R.reniformis or M.incognita .Another possibilitymaybedirectcompetitionforfeedingsites. Belonolaimuslongicaudatus typicallyfeedsonroottips ofturfgrasses(CrowandHan,2005).Althoughthe feedinghabitsof H.pseudorobustus onturfgrasseshas notbeenstudiedindetail,on Z.mays itfeedsasa semiendoparasiteoncorticalfoodcells(Vovlasand Inserra,1985),makingdirectcompetitionforfeeding sitesunlikely. Theresultsofthisstudystronglysupportthehypothesisthat B.longicaudatus and H.pseudorobustus aremutuallyinhibitoryonbermudagrassandseashore paspalumhosts.However,thedegreethatthesenematodesimpacteachothervarieswiththegrassspecies andcultivarinvolved.Themechanismofthisnematodenematodeinteractionremainstobeidentied.Further researchintothesetypesofmechanismscouldreveal phytochemicalsthatcouldbemanipulatedasamanagementtacticinthefuture. LITERATURECITEDAryal,S.K.,Davis,R.F.,Stevenson,K.L.,Timper,P.,andJi,P.2011a. Inuenceofinfectionofcottonby Rotylenchulusreniformis and Meloidogyneincognita ontheproductionofenzymesinvolvedinsystemic acquiredresistance.JournalofNematology43:152–159. Aryal,S.K.,Davis,R.F.,Stevenson,K.L.,Timper,P.,andJi,P.2011b. Inductionofsystemicacquiredresistanceby Rotylenchulusreniformis and Meloidogyneincognita incottonfollowingseparateandconcomitantinoculations.JournalofNematology43:160–165. Crow,W.T.2005.HowbadarenematodeproblemsonFlorida’s golfcourses?FloridaTurfDigest22:10–12. Crow,W.T.,andHan,H.2005.Stingnematode.PlantHealthInstructor.doi:10.1094/PHI-I-2005-1208-01.URL:http://www.apsnet. org/edcenter/intropp/lessons/Nematodes/Pages/StingNematode. aspx. Flegg,J.J.M.1967.Extractionof Xiphinema and Longidorus species fromsoilbyamodicationofCobb’sdecantingandsievingtechnique.AnnalsofAppliedBiology60:429–437. Hixson,A.C.,andCrow,W.T.2004.Firstreportofplant-parasitic nematodesonseashorepaspalum.PlantDisease88:680. Hixson,A.C.,Crow,W.T.,McSorley,R.,andTrenholm,L.T.2004. Hoststatusof‘SeaIsle1’seashorepaspalum( Paspalumvaginatum )to Belonolaimuslongicaudatus and Hoplolaimusgaleatus .JournalofNematology36:493–498. Jenkins,W.R.1964.Arapidcentrifugal-oatationtechniquefor separatingnematodesfromsoil.PlantDiseaseReporter48:692. Johnson,A.W.1970.Pathogenicityandinteractionofthreenematodespeciesonsixbermudagrasses.JournalofNematology2:36–41. Pang,W.,Luc,J.E.,Crow,W.T.,Kenworthy,K.E.,McSorley,R.,and Giblin-Davis,R.M.2011a.Screeningbermudagrassgermplasmaccessionsfortolerancetostingnematodes.HortScience46:1503–1506. Pang,W.,Luc,J.E.,Crow,W.T.,Kenworthy,K.E.,Giblin-Davis,R.M., McSorley,R.,andKruse,J.K.2011b.Fieldresponsesofbermudagrass andseashorepaspalumcultivarstostingandspiralnematodes.Journal ofNematology43:195–202. Pang,W.,Luc,J.E.,Crow,W.T.,Kenworthy,K.E.,Giblin-Davis,R.M., McSorley,R.,andKruse,J.K.2011c.Bermudagrasscultivarresponses tostingnematode.CropScience51:2199–2203. Pang,W.,Luc,J.E.,Crow,W.T.,Kenworthy,K.E.,McSorley,R., Kruse,J.K.,andGiblin-Davis,R.M.2011d.Responsesofseashore paspalumcultivarstostingandspiralnematodes.CropScience51: 2864–2867. Rhoades,H.L.1985.Effectsofseparateandconcomitantpopulationsof Belonolaimuslongicaudatus and Dolichodorusheterocephalus on Zeamays .Nematropica15:171–174. Sikora,R.A.,Taylor,D.P.,Malek,R.B.,andEdwards,D.I.1972.Interactionof Meloidogynenaasi,Pratylenchuspenetrans ,and Tyenchorhynchus agri oncreepingbentgrass.JournalofNematology4:162–165. USGA.1993.USGArecommendationforamethodofputting greenconstruction:The1993revision.USGAGreenSectionRecord 31:1–3. Vovlas,N.,andInserra,R.N.1985.Singlemodiedfoodcellinducedby Helicotylenchuspseudorobustus incornroots.Journalof Nematology17:371–373. TABLE5.Regressionof Belonolaimuslongicaudatus Pfafter90don Helicotylenchuspseudorobustus Piingreenhousetrialsonmultiplecultivars ofseashorepaspalumandbermudagrass.Trial1Trial2 Cultivar Yr2PYr2PSeashorePaspalum Aloha-0.30180x+410.340.0033-0.2467x+370.370.0016 SeaDwarf-0.19940x+440.050.2983-0.2603x+340.330.0063 Combined-0.25213x+430.110.0209-0.24990x+360.320.0001 Bermudagrass Tifdwarf-0.64890x+830.320.0039-0.83680x+910.600.0001 Celebration-0.32320x+820.200.02760.20790x+750.090.0682 TifSport-0.32950x+720.120.0932-0.52140x+750.230.0192 Combined-0.43386x+790.200.0001-0.37602x+800.140.002 Bothgrasses Combined-0.37098x+650.110.0003-0.3077x+610.060.00720 JournalofNematology,Volume45,No.1,March2013