Citation
Assessing Contribution of the Streptococcus Mutans Cid and Lrg Operons to Oxidative Stress Resistance and Competence

Material Information

Title:
Assessing Contribution of the Streptococcus Mutans Cid and Lrg Operons to Oxidative Stress Resistance and Competence
Creator:
Carney, O'Neshia Vanae
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (66 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
RICE,KELLY C
Committee Co-Chair:
ROMEO,TONY
Committee Members:
KEYHANI,NEMATOLLAH
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Bacteria ( jstor )
Bacteriology ( jstor )
Biofilms ( jstor )
Dental caries ( jstor )
DNA ( jstor )
Microbiology ( jstor )
Operon ( jstor )
Oxidative stress ( jstor )
Plasmids ( jstor )
Streptococcus mutans ( jstor )
Microbiology and Cell Science -- Dissertations, Academic -- UF
aerobic -- anaerobic -- biofilm -- caries -- cid -- cidab -- cidb -- competence -- csp -- dental -- edna -- h2o2 -- hydrogen -- lrg -- lrgab -- mutans -- operons -- oxidative -- peroxide -- plaque -- resistance -- streptococcus -- stress -- sucrose
City of Miami ( local )
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Microbiology and Cell Science thesis, M.S.

Notes

Abstract:
S. mutans is a common member of the oral cavity microbiota, but when this organism predominates in dental plaque biofilm, it can cause dental cavities (caries). Published and unpublished studies from our research lab have shown that components of the cid and lrg operons can affect S. mutans cell death and biofilm formation. These studies also demonstrated that components of the lrg operon affect S. mutans oxidative stress resistance as well as competence. Therefore, this research addresses the hypothesis that components of the Cid/Lrg system may represent previously unrecognized modulators of the S. mutans oxidative stress and competence systems. Hydrogen peroxide (H2O2) is produced by competing streptococcal species in dental plaque biofilm, and is also a common component of commercially-available mouthwash formulations. Therefore, the sensitivity of S. mutans and its panel of isogenic cid and lrg mutants to this biologically relevant oxidative stress were assessed by growth curve analysis. These studies revealed that the lrgAB, cidB and cidAB mutants displayed severe growth inhibition in the presence of 1.0 mM H2O2. Quantitative competence assays also revealed that the cidB mutant displayed decreased natural competence compared to the wild-type strain. However, competence of the cidB mutant could be restored to wild-type levels in the presence of exogenously-added competence stimulating peptide (CSP), a S. mutans quorum-sensing signal that controls expression of various competence genes. The addition of 0.25mM H2O2 did not show an effect on S. mutans biofilm formation. The cidB mutant exhibited less biofilm formation when grown in biofilm media (BM) supplemented with 18mM glucose/2mMsucrose, relative to the wild-type strain. When the carbohydrate content in BM changed to 11 mM/10mM sucrose, the cidB mutant biofilm phenotype changed from reduced biofilm to a more pronounced biofilm relative to the wild-type strain. Future research efforts will try to elucidate the mechanism behind the cidB mutant competence and biofilm phenotypes, assessing the impact of cid genes on eDNA release, and complementation of the cidB mutation. This research will contribute to our long-term overall goal of better understanding S. mutans virulence and survival in the oral cavity. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2014.
Local:
Adviser: RICE,KELLY C.
Local:
Co-adviser: ROMEO,TONY.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by O'Neshia Vanae Carney.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Resource Identifier:
968131536 ( OCLC )
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

ASSESSING CONTRIBUTI ON OF THE STREPTOCOCCUS MUTANS CID AND LRG OPERONS TO OXIDATIVE STRESS RESISTANCE AN D COMPETENCE By A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014

PAGE 3

To my beautiful family and in remembrance of my great grandmother

PAGE 4

4 ACKNOWLEDGMENTS First and foremost, I would like to express my deepest appreciation to my parents for always supporting me throughout my endeavors . Thank you to my brothers for always reminding me that I am their prestigious role model . I offer my sincerest gratitude to my thesis mentor , Dr . Kelly C. Rice , for supporting me throughout my research with patience and accepting me into her lab without hesitation. I attribute the level of my degr ee to her encouragement and effort . I simply could not have wish ed for a better or friendlier principal investigator. I thank my lab m ates April Sapp, Aus tin Mogen, Silvia Matzdorf, and Ieis ha Collins for the ir continuous guidance and assisting me with my adjustment to graduate school. In addition, many thanks to Dr . Sang Joon Ahn, Dept. Oral Biology, UF, for helpful discussions and for providing plasmid p GB E . Finally, I thank my committee members Drs Kelly Rice, Tony Romeo, Nematollah Keyhani and the Department of Microbiology and Cell Science at the University of Florida that have provided the support and equipment I have needed to produce and complete m y thesis .

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ........... 4 LIST OF TABLES ................................ ................................ ................................ ...................... 7 LIST OF FIGURES ................................ ................................ ................................ .................... 8 ABSTRACT ................................ ................................ ................................ ............................... 9 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ ............. 11 Streptococcus mutans Metabolism ................................ ................................ ...................... 11 Dental Plaque Biofilm and the Formation of Dental Caries ................................ ................. 12 Factors Affecting S. mutans Biofilm Formation (Summarized in Table 1 1) ....................... 15 Sucrose Independent Adhesion ................................ ................................ ................... 15 Sucrose Dependent Adhesion ................................ ................................ ...................... 15 The Competence (com) Sys tem ................................ ................................ ................... 17 Extracellular DNA (eDNA) ................................ ................................ ......................... 18 Environmental Effects on Biofilm Formation ................................ .............................. 19 Hydrogen Peroxide ................................ ................................ ................................ ...... 20 cidAB and lrgAB ................................ ................................ ................................ ................ 20 Hypothesis and Specific Aims ................................ ................................ ............................ 23 2 MATERIALS AND METHOD S ................................ ................................ ........................ 27 Bact erial Strains and Growth Conditions ................................ ................................ ............ 27 Competence Assays ................................ ................................ ................................ ........... 27 Hydrogen Peroxide (H 2 O 2 ) Challenge Assays ................................ ................................ .... 28 Biofilm Assay ................................ ................................ ................................ .................... 29 Complementatio n of cidB mutant ................................ ................................ ....................... 29 Transformation of S. mutans with pBG E and pBG cidAB ................................ ................. 30 3 RESULTS ................................ ................................ ................................ .......................... 33 Effect of cid Muta tions on Hydrogen Peroxide Resistance ................................ .................. 33 Effect of cid Mutations and H 2 O 2 on Competence ................................ .............................. 33 H 2 O 2 Pretreatment of CSP on Competence Assays ................................ ............................. 35 The Effects of Carbohydrates and H 2 O 2 on S.mutans Static Biofilm Formation .................. 36 Complementation Attempt of the cidB Mutant ................................ ................................ .... 37 4 DISCUSSION AND CONCLUSIONS ................................ ................................ ............... 50

PAGE 6

6 LIST OF REFERENCES ................................ ................................ ................................ .......... 54 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ..... 66

PAGE 7

7 LIST OF TABLES Table page 1 1 Factors influencing biofilm development in S.mutans ................................ .................... 24 2 1 Bacterial strains and plasmids used in this study ................................ ............................ 32 2 2 Primers and probes used in this study ................................ ................................ ............ 32

PAGE 8

8 LIST OF FIGURE S Figure page 1 1 Oral biofilm development model in S. mutans. ................................ ............................... 24 1 2 Model of S. mutans CSP dependent cell signaling in genetic competence.. ................... 25 1 3 The S. mutans cid and lrg operons. RNA transcripts and sizes (previously determined by northern blotting). ................................ ................................ ................................ ..... 26 3 1 Static growth of UA159 (wild type), lrgA, lrgB, lrgAB at 37 C (aerobic atmosphere) in BHI broth. ................................ ................................ ................................ ................. 38 3 2 Static growth of UA159B (wild type), cidA, cidB, cidAB at 37 C (aerobic atmosphere) in BHI broth. ................................ ................................ ............................. 39 3 3 Static growth of UA159 (wild type), lrgA, lrgB, lrgAB, cidA, cidB, cidAB challenged with 1mM H 2 O 2 ................................ ................................ ................................ ............. 40 3 4 Effect of cid mutations on S. mutans competence with and without CSP addition. ......... 41 3 5 Competence assay performed on cidB mutant grown to an OD 600 = 0.2 0.3. .................. 42 3 6 Competence Assay using unmethylated pOri23 DNA comparing UA159 (wild type) and cidB mutant in the presences and absences of CSP. ................................ ................. 43 3 7 Quantitative competence assays comparing the effects of CSP (0.5 µg/ml) and H 2 O 2 (0.5 mM) on S . mutans UA159 . . ................................ ................................ .................... 44 3 8 H 2 O 2 pretreatment of CSP effect on competence of UA159 (wild type).. ....................... 45 3 9 Effect of cid mutations on S.mutans biofilm grown in BM + 18 mM glucose/2 mM sucrose grown under CO 2 conditions. ................................ ................................ ............ 46 3 10 Effects of H 2 O 2 and cid mutations on S . mutans biofilm formation in BM + 11 mM glucose/10 mM sucrose grown under CO 2 conditions.. ................................ .................. 47 3 11 The effects of H 2 O 2 and cid mutations on S. mutans biofilm formation in BHI + 11 mM glucose/10 mM sucrose grown under CO 2 conditions. ................................ ............ 48 3 12 Verification of pBGE cidAB complement cloning by BsrGI digestion and agarose gel electrophoresis.. ................................ ................................ ................................ ....... 49

PAGE 9

9 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ASSESSING CONTRIBUTI ON OF THE STREPTOCOCCUS MUTANS CID AND LRG OPERONS TO OXIDATIVE STRESS RESISTANCE AN D COMPETENCE By August 2014 Chair: Kelly C. Rice Major: Microbiology and Cell Science S. mutans is a common member of the oral cavity microbiota, but when this organism predominates in dental plaque biofilm, it can cause dental cavities (caries). P ublished and unpublished studies from our research lab have shown that components of the cid and lrg o perons can affect S. mutans cell death and biofilm formation. These studies also demonstrated that components of the lrg operon affect S. mutans oxidative stress resistance as well as competence. Therefore, this research addresses the hypothesis that compo nents of the Cid/Lrg system may represent previously unrecognized modulators of the S. mutans oxidative stress and competence systems. Hydrogen peroxide (H 2 O 2 ) is produced by competing streptococcal species in dental plaque biofilm, and is also a common co mponent of commercially available mouthwash formulations. Therefore, the sensitivity of S. mutans and its panel of isogenic cid and lrg mutants to this biologically relevant oxidative stress w ere assessed by growth curve analysis. These studies revealed th at the lrgAB, cidB and cidAB mutants displayed severe growth inhibition in the presence of 1.0 mM H 2 O 2 . Quantitative competence assays also revealed that the cidB mutant displayed decreased natural competence compared to the wild type strain. However, comp etence of the cidB mutant could be restored to wild type levels in the presence of exogenously added competence stimulating peptide (CSP), a S. mutans quorum sensing signal

PAGE 10

10 that controls expression of various competence genes. The addition of 0.25 mM H 2 O 2 did not show an effect on S. mutans biofilm formation. T he cidB mutant exhibited less biofilm formation when grown in biofilm media ( BM ) supplemented with 18 mM glucose/2 mM sucrose , relative to the wild type strain. When the carbohydrate content in BM ch anged to 11 mM /10 mM sucrose, the cidB mutant biofilm phenotype changed from reduced biofilm to a more pronounced biofilm relative to the wild type strain . Future research efforts will try to elucidate the mechanism behind the cidB mutant competence and b iofilm phenotype s , assess ing the impact of cid genes on eDNA release , and complement ation of the cidB mutation. This research will contribute to our long term overa ll goal of better understanding S. mutans virulence and survival in the oral cavity.

PAGE 11

11 CHAPTER 1 INTRODUCTION Streptococcus mutans M etabolism Streptococcus mutans is a non motile, gram positive coccus that lives in the human oral cavity, and is considered to be the primary etiological agent in the formation of dental caries [ 1 , 2 ] . This facultative anaerobe prefers low oxygen conditions, however it can adapt to both aerobic and oxidative stress conditions, which is a critical component of its ability to colonize tooth surface and survive in plaque biofilm [ 3 ] . S. mutans does not contain an electron transport system, and possesses an incomplete tricarboxylic acid (TCA) cycle, the primary role of which is for synthesis of amino acid precursors [ 4 ] . S. mu tans metabolizes a variety of carbohydrates using glycolytic/fermentative pathways, and in fact, at the time that its genome was completely sequenced, its predicted modes of sugar metabolism suggest ed that S. mutans is able to metabolize a wider variety o f carbohydrates than any other Gram positive organism [ 4 ] . Oral streptococci such as S.mutans have developed multiple mechanisms by which to obtain sugar from the human diet [ 5 , 6 ] . Dietary intake of sugars includes but is not limited to glucose, fructose, and sucrose; however it has been reported that a high sucrose diet is associated with the virulenc e of S.mutans and development of dental caries [ 7 ] . In the absence of dietary sugar intake, S. mutans is also able to grow with various components of saliva as its primary carbon and nitrogen source [ 8 ] . The glycolytic pathway in S.mutans produces pyruvate that is then reduced by fermentation to products such as lactic acid, formate, ethanol, and acetate [ 4 ] . It has been reported that under strict anaerobic conditions S.mutans produces a significant amount of formate, acetate, and ethanol as well as lactate, even in the presence of excess glucose [ 9 ] . Conversely, when S. mutans is grown under microaerobic condition s the pyruvate formate lyase enzyme is inactivated and lactate is exclusively produced [ 10 ] . The ability of S. mutans to

PAGE 12

12 withstand the acidic conditions that are produced from carbohydrate fermentation is based , in large part, on the presence of a membran e bound, acid stable, proton trans locating F 0 F 1 ATPase that maintains the intracellular pH at 7.5 [ 11 ] . Dental Plaque Biofilm and the F ormation of Dental C aries A biofilm is an aggregation of microorganisms that attaches to a solid or liquid surface concealed by an exopolysaccharide (EPS) matrix [ 12 ] , usually composed of proteins and sugars. Dental caries is a classic form of biofilm disease , initiated by changes in the oral e nvironment that enhance the establishment of cariogenic bacteria, which are capable of converting carbohydrates to the organic acids that demineralize the tooth enamel [ 13 ] . Reports suggest that S. mutans isolates have a greater capacity to form biofilm than other streptococcal species that colonize the human oral cavity environment [ 1 ] . Plaque biofilm development is a dynamic multi species process that is initiated by a host pellicle located on the surface of the tooth enamel ( Figure 1 1 ) . Proteins, antibodies, and enzymes that normally reside in the saliva bind to the host pellicle. The next steps in oral biofilm development involve the multi species process that is initiated by early colonizers followed by the attachment of late colonize rs. There are approximately 260 oral bacterial species that have been cultivated from humans, but actual diversity is approximate d at 500 common species based upon sequence methods [ 14 , 15 ] . During plaque biofilm dev elopment both mutualistic and antagonistic interactions occur between different species of bacteria . It has been suggested, for example, that when pioneer colonizers such as Streptococcus gordonii and Streptococcus sanguinis are present at high amounts in the oral biofilm they can antagonize S. mutans [ 3 ] . This occurs by S. gordonii and S. sanguinis bind ing to amylase , an enzyme that cataly z es the hydrolysis of starch into sugars that is present in saliva components and produc ing growth inhibiting amounts of H 2 O 2 as a competitive measure against S. mutans during the initial aerobic growth of early plaque biofilm development

PAGE 13

13 [ 3 , 16 , 17 ] . Thus, it is hypothesized that S. gordonii and S. sanguinis exhibit antagonistic behavior by inhibiting S. mutans when grown aerobically [ 3 ] . Oral biofilm accumulation of S. mutans and certain other oral bacteria can lead to a number of diseases such as halitosis, periodontal disease, and dental caries. Various host factors , which promote the overgrowth of S. mutans and/or its ability to outcompete non cariogenic bacterial species in plaque biofilm , include teeth compositio n such as spacing and/or overcrowding , decreased saliva flow, poor oral hygiene habits , and a diet high in sugar [ 18 ] . Deficienc ies in fluorine, zinc, lead, and iron content of the enamel, teeth crowding and abnor mal spacing can increase the susceptibility to caries [ 19 , 20 ] . Saliva has a cleaning effect on teeth and reduced secretion (xerostomia) increases caries [ 21 , 22 ] . Poor oral hygiene practices (i.e. lack of dental cleanings, daily brushing and flossing) can promote the accumulation of m icroorganism s and dental plaque formation on the tooth surface [ 23 ] . Intake of refined carbohydrates such as sucrose, maltose, lacto se, glucose, fructose, and cooked sticky starch has also been associated with dental caries [ 24 ] . S. mutans is cariogenic because upon carbohydrate intake it can lower the pH in dental plaque rapidly to about pH 4 within a few minutes , due to the rapid metabolism of dietary sugars [ 25 ] . A cidogenic bacteria such as S. mutans are adept at surviving at low pH, and can become dominant in plaque microf l ora when there is an increase in acid ity of dental plaque, whereas the proportion of other non cariogenic bacteria such as S . sangui nu s tends to decrease [ 26 , 27 ] . Oral bacteria experience repeated cycles of acidification of their environment fo llowed by neutralization periods during growth in dental plaque [ 25 ] . These r epeated cycles of acidification not only promote demineralization of the tooth surface but c an also cause damage to the non cariogenic bacteria in dental plaque [ 25 ] . As men tioned above, S. mutans can tolerat e low pH by the proton pumping activity of its F ATPase [ 28 ] . The acids generated through the

PAGE 14

14 fermentation of sugar by microorganisms such as S. mutans in dental plaque lead to decalcif ication of the superficial laye rs of tooth enamel and this is what ultimately initiate s dental caries [ 10 ] . Acco rding to the World Health Organization (W.H.O), dental caries is a common infec tious disease affecting humans that remains untreated in many underdeveloped areas that may lead to suffering that is often relieved only by loss or extraction of the infected t ooth. Reports show that dental caries is less common and less severe in developing countries of Africa; however it is anticipated that the incidence of caries will increase in several countries of that continent, due to changing living conditions and dieta ry habits, and inadequate e xposure to [ 29 ] . Upon tooth eruption, bacterial colonization of human teeth begins [ 18 ] . Specifically, S. mutans is mostly transmitted to infant children from their mothers [ 30 ] . Poor diet and poor oral hygiene may result in the appearance of surface damage to the teeth as young as 6 12 months of age [ 31 ] . S. mutans is also associated with non oral infections, specifically sub acute bacterial endocarditis [ 32 ] . Dental scientists in the United States have been key players in developing ways to manage and control caries [ 33 ] . Treatment of dental caries consist s of removal of the decay ed regions of the tooth by operative procedures , and restoration with materials such as silver fillings, composite resin, and full metal or porcelain crowns [ 24 ] . Severe cases of dental caries involve the pulp of the tooth and endodontic treatment may be used such as root canals [ 24 ] . Sealants are another form of caries management that pr event food from collecting in molar pits and fissures and, therefore, prevent dental caries [ 34 36 ] . The W orld H ealth O rganization oral health reported that dental caries can be controlled by the joint action of co mmunities, professionals and individuals aimed at reducing the impact of sugar consumption administered through water fluoridation and

PAGE 15

15 use of fluoride toothpastes and mouth rinses . Fluoride prevents and controls dental caries by four ways: (1) inhibits the demineralization of sound enamel , (2) enhances the remineralization (i.e., recovery) of demineralized enamel [ 19 , 37 ] , ( 3 ) it inhibits the process by which cariogenic bacteria metabolize carbohydrates to produce acid and , (4) affects bacterial producti on of adhesive polysaccharides [ 38 ] . Factors A ffecting S. mutans Biofilm F ormation ( S ummarized in Table 1 1) Sucrose I ndependent A dhesion Mucins are a cidic glycoproteins that are normally found in the saliva , and form what is known as the acquired enamel pellicle (AEP) [ 39 43 ] . The AEP is a shapeless mem brane layer that is approximately 0.1 to 3 in depth , and contain s sulfate and carboxyl groups that increas e the net negative charge of the tooth surface [ 42 ] . S ucrose independent adhesion refer s to the ability of S. mutans to attach to specific components of the AEP and salivary agglutinins . This is mediated primarily by the S. mutans cell surface p rotein antigen I/II (also known as multifunctional P1 adhesin) , which is a n 185 kDa surface protein [ 18 ] encoded by the spaP gene [ 44 47 ] . The role of antigen I/II in adhesion is based on the study of S. mutans adhesion to saliva coated hydroxyapatite [ 48 50 ] . It has been reported that isogenic mutant s lacking P1 (antigen I/ II) di d not bind as well as the wild type to saliva coated hydroxyapatite, but bo und similarly well as the wild type to saliva coated hydroxyapatite that also contained in situ synthesized glucan polyme rs [ 51 ] . Sucrose Dependent A dhesion Sucrose dependent adhesion du ring S. mutans biofilm development is mediated primarily by its production of glycosyltransferase (GTF) enzymes and glucan binding proteins (GBPs) [ 52 ] . GTFs are responsible for synthesis of in soluble extracellular glucan polymers that promote biofilm adhesion . An in vitro biofilm formation experiment comparing sucrose -

PAGE 16

16 dependent adhesion of S. mutans wild type, GTF deficient mutants (GtfB, GtfC, and GtfD) , and recombinant GTFs (rGTFs) demonstra ted that the presence of three GTFs (G tf B, G tf C, and G tf D) are necessary for sucrose dependent adherence of S. mutans [ 53 ] . In many oral streptococci, the extracellular slime layer produced in the presence of sucrose is comprised of glucans, which aid in biofilm adhesion and formation of dental plaque biofilm [ 54 ] . Glucans are synthesized from sucrose by the enzymatic action of one or more GTF enzymes that can produce both water insoluble or soluble glucans [ 55 ] . In oral streptococci, the chemical structure of extracellular glucans is comprised of alpha 1,3 and alpha 1,6 glucosidic linkages [ 1 ] . Specifically, most S. mutans water insoluble glucans contain different degrees of branching and mostly alpha 1,3 linkages [ 1 ] . S. mutans GTFs are encoded by t hree different glucosyltransferase genes ( gtf B , gtfC , and gtfD ) and a single fructosyltransferase gene ( ftf ). The GtfB is responsible for synthesizing insoluble glucan in 1,3 linkages, whereas GtfC generates a mixture of soluble 1,6 linkages and insoluble glucans, and GtfD mostly produces soluble glucans [ 56 58 ] . In general, GtfC tends to be adsorbed in the enamel within the pellicle area , while GtfB binds strongly to the bacteria l surface wh ich promotes tight cell clustering while enhancing cohesion of plaque [ 59 ] . GtfD forms a soluble, readily metabolizable extracellular glucan polysaccharide and acts as an anchor for GtfB [ 59 ] . Specifically G tfB and not G tfC is involved in the production of water insoluble and adhesive glucan exopolysaccharides , the production of which are down regulated when S. mutans is grown aerobically [ 60 63 ] [ 59 ] [ 64 ] . F our cell surface proteins, GBPs have also been identified in S. mutans ( GbpA, GbpB, GbpC , and GbpD ), which also play a role in sucrose dependent adhesion by binding the extracellular glucan polymers produced by the GTFs [ 55 , 65 , 66 ] .

PAGE 17

17 The Competence (com) System Competence , also known as natural genetic transformation , is the ability of bacteria to take up exogenous free DNA from their environment [ 67 ] . The induction of genetic competence in S. mutans is mediated by quorum sensin g that depends on a competence stimulating peptide (CSP) signaling molecule [ 68 70 ] . Quorum sens ing is the ability of bacteria to regulate different physiolog ical processes in a cell density dependent manner [ 71 75 ] . In general, quorum sensing signal molecules have also been shown to facilitate the regulation of gene expression in bacterial biofilms [ 76 , 77 ] . Often bacteria secrete quorum sensing signals and sense them through receptors [ 78 ] . The receptors do not induce behavioral chan ges until the bacteria l cell density ha s increased , which allows the signal concentrations to exceed a critical threshold [ 79 , 80 ] . Bacteria respond by adopting communal behavior that can lead to community behaviors such as biofilm formation [ 62 ] . The S. mutans CSP is a pheromone that belongs to the class of double glyci ne type leader peptides [ 81 , 82 ] , and is encoded by the comC gene. CSP is sensed by a two component regulatory system (TCS) comprising the sensor histidine ki nase, ComD, and the response regulator, ComE [ 68 , 83 85 ] as outlin ed in F igure 1 2 (adapted from [ 86 ] ) . Binding of CSP to ComD induces a phosphorylation event that is transferred to ComE, which in turn activates expression of comX , a gene encoding an al ternative sigma factor specifically required for the synthesis of late competence proteins that are involved in DNA uptake and internalization [ 87 89 ] . Addition of synthetic CSP to non competent cells (with an intact ComDE system) facilitate s increased transformation frequencies of S. mutans , with approximately 1% of the total cell population transformed [ 81 ] . The comGB gene encodes a protein involved in DNA binding uptake and inactivation of comGB resulted in complete loss of transformability, both in the presence and in the absence of synthetic CSP [ 90 ] . Furthermore, mutants with inactivated com D ,

PAGE 18

18 comE , or comX genes formed biofilms with a reduced biomass [ 91 ] . Studies of other bacteria have shown that growth of bacteria in biofilms can facilitate horizontal gene transfer between bacterial species by conjugation or transformation by competence [ 92 94 ] , and it has been shown that S. mutans is more competent when grown as a biofilm relative to planktonic culture [ 91 ] . The competence signaling system in S. mutans can also be triggered by another pheromone, XIP (for sigX inducing peptide) , which is a small hydrophobic pept ide [ 81 , 82 , 95 , 96 ] . The comR and c omS genes encode a response regulator and XIP, respectively, and have directly linked to the expression of sigX [ 96 , 97 ] . In brief, ComR activates the expression of the peptide precursor ComS and ComS is secreted, processed, and internalized through the peptide transporter Opp [ 98 ] . This ComR and XIP then form a complex then functions as a transcriptional activator of sigX , facilitating development of competence in S. mutans [ 95 ] . Studies have shown that deleting the c omR gene completely inhibited S. mutans competence, which suggests that all regulatory systems in the presence or absence of CSP may be incorporated at the level of ComR [ 98 ] . Extracellular DNA (eDNA) Cell lysis and the release of eDNA have been shown to be a major structural component of biofilms produced by a number of bacteria [ 99 103 ] . In S. pneumonie , DNA release is triggered by competence induction , which involves cell lysis regulated by the autolytic amidase LytA [ 104 , 105 ] and the autolytic lysozyme LytC [ 104 ] . It has also been reported in S. pneumoniae that DNA release is activated by the CSP dependent quorum sensing system that is involved in competence development for natural transformation Thus, the autolysis induced by CSP may provide a source of DNA during competence development [ 105 , 106 ] . In a study conducted by Petersen et al . [ 90 ] addition of synthetic S. mutans CSP to S. mutans cultures induced biofilm formation and e DNA release in the wild type strain . Extracellular DNA is

PAGE 19

19 critical during biofilm formation in the presence of a functional DNA binding uptake system such as the com system [ 90 ] . However , experimental evidence showed that the comGB mutant ( deficient in DNA binding and uptake, but not in CSP signaling ) formed reduced biofilms , presumably due to its inability to bind and adhere to the eDNA [ 90 ] . Furthermore, increased eDNA dependent biofilm adherence was observed in a S. mutans cipI ( bacteriocin immunity protein) mutant, presumably due to increased susceptibility to bacteriocin mediated cell death and lysis [ 107 ] . Environmental Effects on Biofilm F ormation Oxygen has been reported to have profound effects on S. mutans biofilm composition [ 60 , 108 , 109 ] . Through a n RNA microarray analysis it was observed that 5% of all S. mutans genes are differentially expressed under aerobic versus anaerobic growth conditions , which also inhibits biofilm formation [ 60 ] . U p regulated genes in response to aerated growth in this study include d autolysis related genes such as atlA and genes that encode ba c teriocins, competence gen e s, the ClpB protease chaperone subunit [ 60 ] , and the bacteriocin immunity protein (BIP) which is also up regulated during biofilm formation [ 110 ] . S. mutans cells respond to oxygen by the VicK sensor kinase of a CovRS like two component system (TCS) , and also by the AtlA autolysin pathway, that play s a major role in modulating cell surface composition [ 60 ] . It has bee n reported that inactivation of the gene for AtlA or VicK restored the capacity of S. mutans to form biofilms in the presence of oxygen [ 60 ] . The ability of S. mutans to form sucrose dependent biofilms was also dramatically impaired wh en grown with aeration for 48 h, while an atlA mutant formed greater biomass of biofilms under this condition [ 61 ] . Similarly, under aerobic conditions a vicK mutant showed significantly increased sucrose dependent biofilm formation [ 61 ] .

PAGE 20

20 Hydrogen P eroxide Certain members of the oral streptococci have been shown to exhibit an antagonist , relationship in w hich they compete for adhesion binding sites on the tooth pellicle [ 111 ] . Some oral streptococci are able t o produce antimicrobial compounds such as bacteriocins and hydrogen peroxide (H 2 O 2 ), which inhibit the competing species in order to minimize their growth [ 3 , 112 ] . Furthermore, H 2 O 2 has been shown to be a potent stimulator of competence and eDN A release in species that produce H 2 O 2 , such as S. sanguinis , S. gordonii , and S. pneumoniae [ 3 , 113 ] . A erobic growth conditions were shown to stimulate the H 2 O 2 dependent release of heterologous DNA from mixed cultures of S. sanguinis and S. gordonii [ 114 ] . Currently, the direct effects , if any, of H 2 O 2 on S. mutans competence, cell lysis and eDNA release have not been elucidated. However , growth of S. mutans under aerobic conditions stimulates the expression of competence genes [ 90 ] . Unraveling the effects of H 2 O 2 on S. mutans biofilm formation and competence, in addition to its defenses against H 2 O 2 is crucial towards achieving a better understanding of its ability to surviv e in the oral cavity. Table 1 summarizes factors influencing biofilm development in S.mutans . cidAB and lrgAB The bacterial cidAB and lrgAB operons both encode predicted membrane proteins and have been found in many bacterial, archael, and even plant genomes [ 115 , 116 ] . The CidA and LrgA predicted secondary structures are similar to the bacteriophage lambda holin proteins [ 115 , 117 ] . Bacteriophage holins are small membrane prot eins that olig om erize in the cell membrane, where they regulate the timing and lysis of the host cell during lytic infection [ 118 ] . The lambda S holin protein functions to regulate cell death and lysis by forming large rafts that cause the cytosol to leak and also allow s the phage encoded murein hydrolase access to the cell wall of E. coli [ 118 120 ] . The bacterial Cid/Lrg system was first characterized in S. aureus and has been

PAGE 21

21 shown to affect cell death and murein hydrolase activity [ 121 , 122 ] , antibiotic tolerance [ 121 ] [ 122 ] , and biofilm development [ 103 ] in this organism . Specifically, i t was reported that mutations in both the cid and lrg operons of S. aureus led to altered biofilm development , cell death and eDNA release [ 99 , 103 ] . Expression of the S. aureus cid operon is positively regulated by CidR, a LysR type transcription factor encoded by the gene located directly upstream of cidA [ 123 ] , whereas the lrg operon is positively regulated by the LytSR tw o component system encoded by the genes located directly upstream of lrgA [ 124 ] . The expression of both cid and lrg is responsive to by product s of glucose metabolism in S. aureus , which was shown to be dependent on the accumulation of acetic acid within the supernatant as a result of glucose metabolism [ 125 ] . Moreover, cid expression was found to be upregulated during low oxygen growth and also in the tower structures of S. aureus biofilms [ 126 ] . Although the precise mechanism by which the Cid and Lrg proteins affect or regulate cell death and biofilm formation remains to be elucidated, a recent paper has confirm ed that S. aureus CidA and LrgA are membrane proteins that oligomerize in a cysteine dependent manner, similar to holin proteins [ 127 ] . The Cid/Lrg system has also been identified in Pseudomonas aeruginosa , where mutations in the cidAB and lrgAB operons were also shown to influence cell death and lysis during biofilm development [ 128 ] . Interestingly, the pathogen Bacillus anthracis contains four different operons with open reading frames homologous to cidAB and lrgAB of S. aureus [ 129 ] . In th is organism, some of these cid and lrg operons appear to affect sporulation [ 129 ] . As in S. aureus , t he B. anthracis LytSR two component regulatory system plays a positive role in regulating lrgAB expression but had no apparent effect on cidAB expression , and a gene homologous to S. aureus cidR was required for cidAB expression [ 129 , 130 ] . In plants, Cid/Lrg -

PAGE 22

22 like proteins have also been proposed to function as effectors of cell death [ 131 ] . For example, the Arabidopsis thaliana plant appears to require the chloroplast inner envelope membrane protein At LrgB (an apparent LrgA LrgB fusion protein) for proper chloroplast development, although the mol ecular mechanism is unclear [ 132 ] . Furthermore, it has also been demonstrated that a at lrg B mutation caused spontaneous chlorotic cell death in Arabidopsis thaliana when grown under continuous light which suggest s that AtLrgB may function against cell deat h in a man ner similar to that proposed for Lrg A/B in S. aureus [ 133 ] . Ultimately, Cid and Lrg appear to function in both plants and bacteria as mediators of cellular destruction [ 131 ] . Based on these collective observations , it has been proposed that the Cid/Lrg system may be part of a programmed cell death (PCD) pathway that regulates cell death and lysis in developmental processes in both prokaryotes and eukaryotes [ 134 ] . In S. mutans , lrgAB and cidAB are dic istronic operons (an mRNA tha t encodes two proteins that are transcribed as demonstrated in Figure 1 3 (adapted from [ 135 ] ) . Although direct regulators of S. mutans cidAB transcription have not been identified, expression of cidAB has been shown to be upregulated by metabolism of excess glucose [ 135 ] and during anaerobic growth [ 60 ] and downregulated by the carbon catabolite protein A (CcpA) [ 135 ] . Expression of the S. mutans lrgAB operon, conversely, is repressed by growth in media containing excess glucose [ 126 ] , and positively regulated by aerobic growth [ 61 , 136 ] and by the LytST two component system [ 135 ] , that is encoded by the genes located immediately upstream of lrgAB [ 126 , 136 ] . A recently published RNA m icroarray analysis of a S. mutans lytS mutant revealed a pleiotropic effect on global gene expression, includi ng genes involved in competence as well as oxidative stress tolerance [ 136 ] . These experiments also showed that lytS and lrgAB mutants were more sensitive to H 2 O 2 stress [ 136 ] . Competence assays published by Ahn et al . [ 136 ] have

PAGE 23

23 also revealed that the lrgA mutant i s less competent in both the absence and presence of CSP. Unlike previous results with S. aureus , m utation of cid and lrg had no apparent effect on S. mutans murein hydrolase activity under standard growth conditions [ 135 ] . It was also demonstrated that growth of S. mutans cidAB , lrgAB , and cidB mutants in an aerob ic incubator on BHI agar plates was completely inhibited [ 135 ] , suggesting that the Cid/ Lrg system is required for efficient aerobic growth of S. mutans . Therefore i t appears that although some aspects of Cid/Lrg are conserved among organisms, their function s may ha ve evolved specifically to benefit the physiology and particular niche of individual organisms . Hypothesis and Specific Aims As discussed above, b iofil m formation, oxidative stress resistance , and competence are highly inter related virulence properties of S. mutans that promote survival in the oral cavi ty. Given that c omponents of the cid and lrg operons have been shown to affect biofilm development in other organisms , and that components of the lrgAB operon have been previously shown to affect competence, oxidative stress and biofilm formation in S. mut ans , the Cid/ Lrg system may represent an attractive target for drug development for anti caries therapies due to the observed influences of these genes on all three phenotypes. Therefore, t his research project addresses the overall hypothesis that compone nts of the Cid/Lrg system are previously unrecognized modulators of S. mutans oxidative stress and competence . The specific research objectives of this project are: (1) to assess the effects of cid mutations on oxidative stress, competence , and biofilm formation, and (2) to investigate a role for H 2 O 2 in regulating S. mutans competence and biofilm formation.

PAGE 24

24 Table 1 1. Factors influencing biofilm development in S.mutans Variable Effect on S. mutans biofilm Reference (s) GTFs/ Gbps + Ahn et al . , 2007; Munro et al., 1991 Sucrose independent adhesions + Burne et al., 1997; Yoshida and Kuramitsu (2002) eDNA + Petersen et al., 2005 Competence (CSP) + Petersen et al., 2005; Li et al., 2001; Li et al., 2002 Aerobic Growth Ahn and Burne (2007); Ahn et al., 2007 Anaerobic Growth + Ahn and Burne (2007); Ahn et al., 2007 Hydrogen peroxide ? Unclear denotes denotes negative effect on biofilm formation S. mutans Figure 1 1 . Oral biofilm development model in S. mutans. Starting from left to right, t he first layer is showing the host pellicle that contains proteins from saliva. The second layer is where proteins, enzymes, antibodies adhere to host pellicle. The middle layer is showing the multi species with additional colonizers which generates the final dense layer of plaque. Lastly, the initial damage of tooth enamel is shown at the top left corner. http://www.studyblue.com/#flashcard/view/1418503

PAGE 25

25 Figure 1 2. Model of S. mutans CSP dependent cell signaling in genetic competence. When CSP reaches a critica l density, it is detected by neighboring cells via a sensor kinase, ComD, which then phosphorylates the response regulator ComE . This initiates transcription of an alternate sigma factor ( C omX ) which upregulates expression of genes required fo r DNA uptake and recombination. Then the transcription of comY is initiated which upregulates expression of genes required for DNA binding uptake machinery. The comCDE operon functions as autofeedback mechanism to induce compet ence. Adapted from Ahn et al . 2006 [ 86 ] .

PAGE 26

26 Figure 1 3 . The S. mutans cid and lrg operons. The direction of RNA transcription and sizes of the RNA transcripts (previously determined by northern blotting) are indicated by the arrows above the genes, and the predicted functions are indicated below each gene. The lytST dicistronic opero n encodes a two component system that positively regulates lrgAB expression. Figure provided by Dr. Kelly Rice, University of Florida. Adapted from Ahn et al. (2010 ) [ 135 ] .

PAGE 27

27 CHAPTER 2 MATERIALS AND METHOD S Ba cterial Strains and Growth Conditions The Streptococcus mutans strains and plasmids used for this study are listed in Table 2 1. For each experiment below, S . mutans UA159 and/or its isogenic lrgA lrgA :: NPSp r ), lrgB lrgB ::NPEm r ), lrgAB lrgAB r ), cidA cidA :: NPKm r ), :: NPKm r ), and cidAB cidA r ) mutants created in [ 135 ] were streaked from frozen glycerol stocks on Brain Heart Infusion (BHI), containing selective antibiotics: kanamycin (Km) 1000µg/ml, erythromycin (Em) 10µg/ml, spectionmycin (Sp) 1000 µg/ml, as appropriate. All plankt onic S. mutans cultures were grown at 37°C in 5% CO 2 conditions . Growth media used for culturing S. mutans were Brain Heart Infusion (BHI) or s emi defined biofilm medium (BM ) [ 137 ] , c ontaining either 18 mM glucose/ 2 mM sucrose or 11 mM glucose / 10 mM sucrose, as indicated for each experiment . E. coli was grown in aerobic conditions (37°C, 250 RPM) in Luria Bertani (LB) broth with erythromycin 300 µg/ml, or 500 µg/ml. Glycerol stock cultures were maintained at 80°C and were prepared by mixing equal volume of overnight with sterile 50% (vol/vol) glycerol in cryogenic tubes. Competence Assay s To compare the ability of UA159 and isogenic cidA, cidB , and cidAB muta nts to take up externally added plasmid DNA , a quantitative competence assay ( at least n = 3 independent experiments per strain) was performed using a previously published protocol [ 138 ] . The following modifications listed below were made to the protocol : S. mutans UA159 and isogenic cidA, cidB , and cidAB mutant strains were grown in BHI broth for 16 18 hours at 37°C in a 5% CO 2 incubator. Overnight cultures of each strain were diluted to an OD 600 = 0.02 in BHI, then grown in a 96 well plate to an OD 600 = 0.15 before the addition of 81 ng plasmid DNA

PAGE 28

28 (methylated or unmethylated pOri23 , as indicated in the results section ) , with or without addition of synthetic CSP to final concentration of 0.5 µg/ml per culture . When indicated, H 2 O 2 was also added to a final concentration of 0.5 mM. After 2.5 hours of further incubation at 37°C and 5% CO 2 , cultures were serially diluted and plated on BHI agar with and without selective antibiotic. The colony forming units per milliliter (CFU/ml) of each cultu re were enumerated after 48 hours of growth at 37°C in a 5% CO 2 incubator. The transformation efficiencies were calculated as the percentage of transformants (CFU/ml on BHI + selective antibiotic) among total viable cells (CFU/ml on BHI). To test the effe ct of pre treating CSP with H 2 O 2 on competence, the following modifications were made : 40µl of 250 µ g/ml CSP and H 2 O 2 w ere each added to sterile water to a final concentration of 2 00 µg/ml and 1 mM , respectively. After 15 minutes incubation, catalase was ad ded to a final concentration of 500 µg/ml. 1 µ l of this mixture was then added to 200 µ l of S. mutans culture to achieve a final concentration of 1 µ g/ml CSP , prior to the addition of plasmid DNA ( p Ori 23 ) to each culture . Hydrogen P eroxide (H 2 O 2 ) Challenge Assays To compare the ability of UA159, lrgA, lrgB, lrgAB, cidA, cidB , and cidAB mutants to grow in the presence of H 2 O 2 , a growth assay was performed on n= 3 independent experiments of each strain using a previously published protocol [ 136 ] . In brief, UA159 (wild type S. mutans ) and isogenic lrgA, lrgB, lrgAB, cidA, cidB , and cidAB mutant strains were grown in BHI broth for 16 18 ho urs at 37°C in a 5% CO 2 incubator. The overnight cultures were diluted 40 fold into fresh BHI media. Then, H 2 O 2 was added to each culture to a final concentration of 0.50 mM or 1 .0 mM. Aliquots of each culture were transferred to a 48 well tissue culture p late and incubated for 22 hours at 37°C . T he OD 600 was monitored every two hours in a Biotek Synergy HT microplate reader.

PAGE 29

29 Biofilm Assay Biofilm formation was assayed by the ability of cells to adhere to the wells of a 96 well, flat bottom microtiter pla te (Costar 3596; Corning, Inc, Corning, N.Y.) using a previously published protocol [ 22 ] . UA159 (wild type S. mutans ) and isogenic cidA, cidB, and cidAB mutant strains were grown in BHI broth for 16 18 hours at 37°C in a 5% CO 2 incubator. Overnight cultures of each strain were diluted to an OD 600 = 0.02 in media ± 0.25 mM of H 2 O 2 . A liquot s of 200µl each diluted culture was transferred in triplicate into a two 96 well plate, which was grown for 24 hours at 37°C in a 5% CO 2 incubator. After 24 hours of growth , the supernatant was removed, and biofilms were washed once with 1X PBS buffer followed by fixation for 2 minutes in 100% (vol/vol) ethanol. B iofilm s were then carefully stained with 1% (vol/vol) crystal violet for 2 minutes, and washed two times with 1X PBS (1X) . The absorbance of each well at 595nm was then measured. Complementation of cidB mutant To generate a complementation plasmid for the S. mutans cidB mutant, a c loning strategy was employed whereby the cidAB forward and cidAB reverse primers specified in Table 2 2 were designed to amplify a 1.7 kb PCR product spanning 562 bp upstream of the cidA start codon through 772 bp of the cidB stop cod on. The cidA and cidB open reading frames overlap by 4 nucleotides and as such, may be subject to translational coupling. Therefore, t he entire cidAB operon was used in this complementation strategy . A BsrG1 enzyme site was incorporated at the end of ea ch primer to facilitate eventual sub cloning into plasmid pBGE [ 54 ] , a plasmid that contains sequences targeting its recombination into the chromosomal gtfA gene of S. mutans . In order to PCR amplify and clone the cidAB gene into the pCR B lunt vector ( Life Technologies ) , Pfx proofreading polymerase ( Life Technologies) was used in this reaction . The cidAB PCR product was ligated into the pCR Blunt plasmid using the PCR Blunt cloning kit

PAGE 30

30 (Life Technologies) , according to shock trans formation of E. coli . The E.coli transformants were screened for the correct 1.7 kb cidAB insert vi a plasmid purification (Promega Wizard SV mini prep kit) and restriction enzyme digest ion with EcoR 1 , followed by agarose gel electrophoresis. P lasmid DNA clones which contained the 1.7 kb cidAB insert were submitted for Sanger sequencing at the UF ICBR genomics core facility . The retrieved sequences were checked by BLAST analysis to confirm that no sequence errors were introduced , and one clone was chosen to proceed with sub cloning into pBG E . To sub clone cidAB into pBG E , a restriction enzyme digestion of pCR cidAB and pBG E each with BsrG1 was performed. The pBG E vector was then dephosphorylated using Antarctic phosphatase ( New England BioLabs ), fol lowed by gel purifi cation each of the 1.7 kb cidAB fragment and the linearized and dephosphorylated pBG E vector using a gel cidAB and pBG E were then ligated and tra nsformed into E. coli by electroporation [ 139 ] . Clones containing pBG E with cidAB insert were confirmed via plasmid purification and restriction enzyme digestion with BsrGI, followed by agarose gel electrophoresis. Glycerol stocks of each clone that contained the cidAB insert were made and stored at 80°C. Transformation of S. mutans with pBG E and pBG cidA B Single colonies of S. mutans UA159 and cidB mutant were each inoculated in (BHI) broth containing 5% heat inactivated horse serum (HS) (Sigma Aldrich). After 16 h at 37 °C in 5% CO 2 without agitation, the overnight cultures was diluted 1:20 in fresh pre warmed BHI + HS, and then incubate d until the optical density at 600 nm (OD 600 ) reached about 0.2. A working stock of the S. mutans competence stimulating peptide (CSP) was made by di ssolving 250 µ g of peptide in 1 ml ddH 2 O, and 2.0 µl w as added to 1 ml aliquots of each culture to a final

PAGE 31

31 concentration of 500 ng/ml [ 81 ] . Transforming plasmid DNA (10µl for pBG E , 35 µl for pBG cidAB ) was added to each culture and incubation was continued for 90 minutes. At the end of incubation the cell density increased and cells were centrifuged and resuspend ed in 200 µl BHI . Aliquots (50µl) of each transformation reaction were plated on BHI Em agar plates. The p lates were incubated for 48 h at 37C in 5% CO 2 . Next, a rapid single colony PCR was performed after strains were restreaked to screen transformants for correct plasmid as follow s: A sterile loop was used to pick single colon ies of each strain ( UA159, UA159 pBGE, and cidB pBGE) from the plates . The colony was transferred to 100µl lysis buffer (25nM Tris HCl, pH 8.0, 50mM glucose, 150mM NaCl, 10mM EDTA ) containing 1 µl of 20,000 U mutanolysin . The mixture was then i ncubate d for 1 h our and 30 min utes at 37 ° C. 2 µl of 10% SDS (final concentration = 0.2% w/v)) was added and samples were heated at 95 °C for 10 min utes . E ach sam ple was used as template in 50 µl PCR reactions as follows : 5 µl of 10X PCR Buffer , 2 µl of 50 mM MgCl 2 , 1 µl of 50X dNTP mix , 1.5 µl of gtfA Forward primer (10µM stock) , 1.5 µl of gtfA Reverse primer (10µM stock) , 1 µl of template DNA , 1 µl of Taq DNA polymerase , and 37 µl of sterile H 2 0. The amplification protocol was as follows : 95 °C for 5 minutes (1 cycle); 30 cycles of: 95 °C for 15 seconds, 50 °C for 30 seconds, 68 °C for 2 minutes , 72 °C for 10 minutes and 4 °C infinite hold .

PAGE 32

32 Table 2 1 . Bacterial strains and plasmids used in this study Strain or plasmid Relevant Characteristic Source or Reference Escherichia coli DH5 Competent cells that provides a high efficiency of plasmid DNA Invitrogen JM110 Competent cells used for prepa ring plasmid DNA that lacks Dam and Dcm methylation Agilent T echnologies UA159 Wild type Page Caufield ( University of Alabama, Birmingham) lrgA lrgA :: NPSp r [ 135 ] lrgB lrgB ::NPEm r [ 135 ] lrgAB lrgAB r [ 135 ] cidA cidA :: NPKm r [ 135 ] cidB :: NPKm r [ 135 ] cidAB cidA r [ 135 ] Plasmids pOri23 E.coli derived shuttle vector containing Erm cassette; 6.0Kb [ 140 ] pBG E E.coli vector containing Erm cassette , and multiple cloning site flanked by region s of the S. mutans gtfA gene; 5.0Kb [ 99 ] pCR Blunt Vector Zero blunt pCR Cloning kit containing a Km cassette; 3.5Kb Invitrogen Table 2 2 . Primers and probes used in this study Primer/ Role Forward/ Reverse O cidAB Forward BsrG1 Reverse BsrG1 ccctgtacaTTTCGCAACTGTAGGTTTGCTG ccctgtacaAAAAAGATGAGACAAAAGTGTTCCCA gtfA Forward Hinc II TGCCCTGCCTATGGTGACGCTCTACA Reverse Hinc II CAAGGGTGGTGAACTGTTTCATCGGA

PAGE 33

33 CHAPTER 3 RESULTS Effect of cid Mutations on H ydrogen P eroxide R esistance To determine the effect of H 2 O 2 on growth of S. mutans UA159 (wild type), lrgA, lrgB, lrgAB, cidA, cidB, and cidAB mutants , growth curves were performed for 22 hours in the absence or presence of 0.5 mM H 2 O 2 or 1. 0 mM H 2 O 2 . As seen in Figure 3 1 (P anel s A and B ) , when comparing the growth of the wild type and l rg panel of mutants, there was not much difference in the untreate d condition versus 0.5 mM treatment with H 2 O 2 . Likewise , the cid panel of mutants did not show a difference between the untreated condition versus 0.5 mM treatment with H 2 O 2 (Figure 3 2 panel A and B ) . However, when the concentration of H 2 O 2 was increase d 1 mM ( biologically relevant to the amount of H 2 O 2 that other oral streptococci are thought to produce in the oral cavity [ 114 ] ), the lrgA and lrgB mutant strains displayed slightly increased oxidative stress resi stance compared to the wild type strain (Figure 3 3) . Furthermore , cidB, cidAB and lrgAB mutant strains displayed almost complete growth inhibition when tested with 1 mM concentration of H 2 O 2 (Figure 3 3 ). These results suggest that in order for S. mutans to growth during H 2 O 2 induced oxidative stress , components of both the cid and lrg operons are required. Effect of cid M utations and H 2 O 2 on C ompetence It has been previously demonstrated that many bacteria such as S. mutans are naturally competent for genetic transformation [ 141 ] . Typically natural competence occurs during early to mid exponential phase of growth in streptococci [ 126 , 127 ] . Although the effect of the lrg genes on competence had been previously assessed by our lab [131], the contribution of the cid genes to this phenot ype had not been tested. Thus, to compare the transformation efficiency of UA159 (wild type), cidA, cidB, and cidAB mutants, competence assays were performed in which strains

PAGE 34

34 were grown to early exponential growth phase in the presence and absence of the competence stimulating peptide (CSP) (Figure 3 4). These competence assays were performed using meth ylated pOri23 plasmid isolated from E. coli DH5 . As expected , the wild type was naturally competent in the absence of CSP , and the addition of exogenous CSP increase d competence [ 136 ] . Although the tr ansformation efficiencies of cidA and cidAB were comparable to the wild type strain either in the absence and presence of CSP, the cidB mutant transformation efficiency could not be calculated in the absence of CSP, due to lack of any antibiotic resistant colonies on the lowest possible dilution plate ( no colonies on 10 1 ) (Fig ure 3 4). However, competence was completely restored by the a ddition of CSP in t he cidB mutant. This competence assay was repeated on cultures that were grown to an OD 600 = 0.2 03 for the cidB mutant, in case the 5). Howeve r, this increased growth time did not restore competence to wild type levels in the absence of CSP addition. To increase the sensitivity of the competence assay, it was repeated for the wild type and cidB mutant strains using pOri23 plasmid DNA isolated from E. coli JM110, a strain that is deficient in Dam and Dcm methylation ( Agilent Technologies) . In this assay, the cidB mutant transformation efficiency was able to be calculated, but it still showed a statistically significant (p < 0.001, Student T test) 2 log decrease in competence relative to the wild type strain (Figure 3 6 ) . As was observed when transforming with methylated plasmid DNA , addition of CSP to the cidB transformation assay fully restored the transformation efficiency of this strain to wild type levels (Fig. 3 5). Overall, t hese results suggest that the cidB mutant is overall less competent in the absence of exogenous CSP addition .

PAGE 35

35 H 2 O 2 Pretreatment of CSP on Competence Assays The effects of CSP + H 2 O 2 , and H 2 O 2 alone on S. mutans wild type competence were initially performed to determine if H 2 O 2 has inhibitory effects on competence . In these initial experiments, t he transformation efficiency was not detectable when cultures were treated with both CSP (200 µ g/ml) and H 2 O 2 (1 mM) simultaneously , while H 2 O 2 treatment alone did not appear to affect competence compared to the untreated culture ( Figure 3 7 ). These results suggest ed that H 2 O 2 could be inhibiting CSP , possibly by oxidizing or damaging amino acid residues in the CSP peptide, particularly serine since it has a polar hydroxyl group that may be accessible to oxidizing free radicals [ 23 ] . To test this theory, a follow up experiment was performed to determine if H 2 O 2 pretreatment of CSP prior to its addition to S. mutans culture would also affect competence (Figure 3 8 ). To this end , CSP was pretreated with H 2 O 2 , followed by addition of purified catalase to remove any trace amounts of H 2 O 2 . When this pre treated CSP was added to S. mutans , the transformation efficiency wa s no different than that previously observed with CSP treatment alone (Figure 3 7 ) or with CSP pre treated with catalase (but not H 2 O 2 ; Figure 3 8 ). This suggests that the previously observed inhibitory effects of H 2 O 2 + CSP simultaneous addition on compet ence were not due to oxidative damage of the CSP peptide. Interestingly, t he simultaneous addition of both CSP and H 2 O 2 directly to the culture resulted in transformation efficienc ies similar to that of the untreated culture (Figure 3 8 ) , rather than complete inhibition of competence as was previously observed in Figure 3 7 . The difference in these two results is likely explained by the fact that the dilution range plated for the CSP + H 2 O 2 culture was too high in the Fig 3 7 experiment . In summary, al though H 2 O 2 alone does not appear to affect S. mutans competence, its presence somehow reverses or inhibits the ability of exogenous ly added CSP to stimulate competence.

PAGE 36

36 The E ffects of C arbohydrates and H 2 O 2 on S.mutans S tatic B iofilm F ormation Previously, biofilm assays perform ed by Ahn et al . [ 135 ] showe d that lrg mutations produce stronger biofilms when grown in biofilm media supplement ed with sucrose rather than glucose. The data from these biofilm assays also suggest ed that the sugar composition affected the biofilm phenotype of the lrgA and lrgB mutants [ 135 ] . To investigate the contribution of the cid gen es to biofilm development in S. mutans , 24 hour static biofilm growth was initially assessed in UA159, cidA, cidB, and cidAB mutants grown in BM media containing 18 mM glucose and 2 mM sucrose ( Figure 3 9 ) . This model of biofilm growth primarily measures b iofilm attachment by reading the OD 600 absorbance of crystal violet staining , which is proportional to the amount of biofilm biomass attached to the bottom of the well. As demonstrated in Figure 3 9 , the cidB muta nt exhibited a statistically significant decrease (p < 0.05, Tukey Test) in biofilm formation in biofilm media supplemented with 18mM of glucose and 2mM of sucrose , whereas the cidA and cidAB mutants behaved like the wild type strain. T he effect s of the various cid mutations on biofilm formation were also assessed using an 11 mM glucose/10 mM sucrose concentration , as well as different growth medi as (BM verses BHI). Surprisingly, the cidB mutant display ed a modest, but significant (p < 0.05, Tukey Test) increase in biofilm compared to the wild ty pe strain when grown in BM or BHI containing 11 mM glucose/10 mM sucrose (Fig s . 3 10 and 3 11 ) , although this phenotype was more pronounced in the BHI media (Fig. 3 11) . These results suggest that both the concentration of sugars as well as the growth medi a used both affect ed the biofilm phenotype of cidB . The cidA and cidAB mutants behaved like wild type under all tested biofilm conditions. To assess the effect of H 2 O 2 on biofilm formation, 0.25 mM H 2 O 2 (a level not inhibitory for S. mutans growth) was also added at time of inoculation to the wild type and cid mutant biofilms (Figs. 3 10 and 3 11). Although the addition of 0.25mM H 2 O 2 at the time of biofilm inoculation appeared to

PAGE 37

37 slightly decrease biofilm formation in both wild type and cid mutant cultures, these differences were not statistically significant. Complementation A ttempt of the cidB M utant Initially, a multi copy S. mutans plasmid expressing cidAB was used to try and complement the cidB mutant. Interestingly, the cidB mutant wa s not able to be transformed with this plasmid (n=3 experiments), even though this mutant strain was able to be transformed with the empty vector and also with the same vector expressing green fluorescent protein (GFP) (data not shown) . Therefore, a single copy integration vector (pBG E) was used to clone cidAB . The pBG cidAB complementation plasmid was successfully constructed (Figure. 3 12) and used to transform the S. mutans cidB mutant. However, initial testing of aerobic growth on BHI plates revealed t hat, unfortunately, integration of pBG cidAB into the gtfA gene of S. mutans failed to restore growth of the cidB mutant in this assay (data not shown). Therefore, alternative complementation strategies will need to be pursued in future studies of the cidB mutant.

PAGE 38

38 A B Figure 3 1. Static growth of UA159 (wild type), lrgA, lrgB, lrgAB at 37 C (aerobic atmosphere) in BHI broth . A) Untreated condition B) 0.5 mM H 2 O 2 Treatment. Data represents 3 independent experiments for each bacterial strain. Error bars = Standard Error of the Mean (SEM)

PAGE 39

39 A B Figure 3 2. Static growth of UA159B (wild type), cidA, cidB, cidAB at 37 C (aerobic atmosphere) in BHI broth . A) Untreated condition B) 0.5 mM H 2 O 2 Treatment. Data represents the average of three independent experiments for each bacterial strain. Error bars = SEM

PAGE 40

40 Figure 3 3 . Static growth of UA159 (wild type), lrgA, lrgB, lrgAB, cidA, cidB, cidAB challenged with 1 mM H 2 O 2 at 37 C (aerobic atmosphere) in BHI broth + 1mM H 2 O 2 . Data represents the average of three independent experiments for each bacterial strain. Error bars = SEM

PAGE 41

41 Figure 3 4. Effect of cid mutations on S. mutans competence with and without CSP addition . Results represent the average of four independent experiments for all st rains except cidAB , n=3 independent experiments. Error bars = SEM. *no colonies detectable on 10 1 dilution plate. Error bars = SEM

PAGE 42

42 Figure 3 5 . Competence assay performed on cidB mutant grown to an OD 600 = 0.2 0.3. Data represents the average of three independent experiments. Error bars = SEM ( *p = 0.0543, Student t test)

PAGE 43

43 Figure 3 6 . Competence Assay using unmethylated pOri23 DNA comparing UA159 (wild type) and cidB mutant in the presences and absences of CSP. Data represents the average of three independent experiments per strain. Error bars = SEM. * significantly different compared to untreated UA159 (p< 0.001, Student t test)

PAGE 44

44 Figure 3 7 . Quantitative competence assays comparing the effects of CSP ( 0.5 µg/ml ) and H 2 O 2 (0.5 mM) on S. mutans UA159 . Transformation efficiency was calculated by CFU/ml BHI + selective antibiotic divided by CFU/ml on BHI multiplied by 100. Data represents the average of n=4 independent exper iments , except CSP + H 2 O 2 = 3 independent experiments . Error bars = SEM. * no colonies detectable on 10 2 dilution plate .

PAGE 45

45 Figure 3 8 . H 2 O 2 pretreatment of CSP effect on competence of UA159 (wild type). H 2 O 2 + CSP (pre treatment), Cat represents the pretreatment of CSP with H 2 O 2 for 15 minutes followed by catalase addition, before it was added to the culture . CSP (pretreat), Cat 2 O 2 treatment) incubated for 15 minutes followed by catalase addition, before it was added to the culture . H 2 O 2 + CSP represe nts the simultaneous addition of H 2 O 2 and CSP directly to the culture. Transformation efficiency was calculated by CFU/ml BHI + selective antibiotic divided by CFU/ml on BHI multiplied by 100. Data represents the average of n=3 independent experiments for each test condition. Error bars = SEM.

PAGE 46

46 Figure 3 9 . Effect of cid mutations on S.mutans b iofilm grown in BM + 18 mM glucose/2 mM sucrose grown under CO 2 conditions. Data represents the average of n=3 independent experiments per bacterial strain. Error bars = SEM. *significantly different compared to untreated UA159 (p < 0.05, Tukey Test)

PAGE 47

47 Figure 3 10 . E ffects of H 2 O 2 and cid mutations on S. mutans biofilm formation in BM + 11 mM glucose/ 10 mM sucrose grown under CO 2 conditions. Data represents the average of n=3 independent experiments per bacterial strain. Error bars = SEM. *significantly different compared to untreated UA159 (p< 0.05, Tukey Test).

PAGE 48

48 Figure 3 1 1 . The effects of H 2 O 2 and cid mutations on S. mutans biofilm format ion in BHI + 11 mM glucose/10 mM sucrose grown under CO 2 conditions . Data represents the average of n=3 independent experiments per bacterial strain. Error bars = SEM. *significantly different compared to untreated UA159 (p < 0.05, Tukey Test)

PAGE 49

49 Figure 3 12 . Verification of pBGE cidAB c omplement cloning by BsrGI digestion and agarose gel electrophoresis . One representative experiment is depicted. For the agarose gel, Lane 1 = 2 Log ladder (New England Biolabs), Lane 2 = BsrGI digested pBG cidAB . The cid AB insert migrates at approximately 1.7 kb, and the vector backbone migrates at approximately 5 kb .

PAGE 50

50 C HAPTER 4 DISCUSSION AND CONCLUSION S Ahn et al . [ 135 ] had previously demonstrated that S. mutans lrgAB , cidB , and cidAB mutants displayed decreased oxidative stress resistance when challenged with 10 mM paraquat , a superoxide generator. The experiments presented in this thesis confirm the sensitivity of these mutants to oxidative stress, since their growth in the presence of 1 mM H 2 O 2 displayed almost complete growth inhibition relative to UA159. Although it is not known why only certain cid and lrg mutants display this sensitivity to oxidative stress, one possibility could be that functional redundancy exists between the A and B compon ents of each operon . For example, a lrgB mutant may not display decreased oxidative stress resistance if the presence of CidB can compensate for loss of LrgB. Certain o ral streptococcal species such as S. gordonii and S. sanguinis produce H 2 O 2 which has be en shown to serve as an antagonist against S. mutans in vitro [ 3 ] , determining whether the S. mutans Cid/Lrg system is involved in interspecies competition/ survival with these H 2 O 2 producing oral strep tococci would represent an important future experiment that may provide biological relevance to the Cid/Lrg system in S. mutans . Further evidence for a role of these proteins in oxidative stress resistance comes from a previous microarray analysis of the S . mutans LytST regulon [ 136 ] , which revealed that some of the genes whose expression were affected by the loss of L y t S were predicted to be involved in many cellular processe s , including oxidative stress resistance . Previous work in our lab had shown that a S. mutans lrgA mutant had a deficiency in its competence ability in both the presence and absence of CSP [ 136 ] . The effects of cid mutation s on competence ( presented in Figure s 3 4, 3 5, and 3 6 ) were therefore assessed in this present study. Although the cidA and cidAB mutants behaved similar to the wild type strain i n both the presence and absence of CSP , the transformation efficiency of the cidB mutant in the absence of

PAGE 51

51 CSP was not detectable with methylated DNA and was decreased by 2 logs with unmethylated DNA. It was observed while performing these assays that the cidB mutant sometimes took more growth time to reach an OD 600 = 0.15 (the OD at which competence was measured in these studies) compared to the other strains. To determine whether a prolonged incubation time would restore the transformation efficiency of this strain , the cidB mutant was allowed to reach an OD 600 = 0.2 0.3 prior to measuring competence (Figure 3 5). However, this modification did not restore competence to wild type levels . Intriguingly, the addition of CSP restored competence of the cidB mutant to wild type levels under all conditions tested, suggesting that this mutant may be defective in its ability to produce its own CSP. To test this theory, RNA was isolated from exponential phase BHI cultures of the wild type and cidB mutant strains, and quantitative real time PCR was attempted to measure expression of comC (the CSP encoding gene) and comX (sigma factor that induces expression of late competence genes). Although these experiments were unsuccessful due to various technical difficulties , it will be important to complete this work in the future to determine if lack of comC expression is responsible for the competence phenotype of the cidB mutant. As an alternative to this, the amount of CSP in culture supernatants of wild type and cidB mu tant cultures could be measured by mass spectrometry. Differential expression of cidB has not been detected in previous RNA microarray experiments examining the S. mutans com regulon [ 61 ] , suggesting that the decreased competence observed in the cidB mutant may possibly be due to an indirect effect on bacterial physiology. To determine if cid mutations affect S. mutans biofilm development , the wild type, cidA, cidB, and cidAB mutants were initially grown in BM supplemented with 18 mM glucose and 2 mM sucrose and were subsequently stained with crystal violet ( Figure 3 9) . Again, only the cidB mutant had a detectable phenotype in these assays, displaying significantly less biofilm

PAGE 52

52 formation than the wild type s train . A comparable level of glucose (2 0 mM) has been previously shown to stimulate high level expression of the cid operon in S. mutans [ 135 ] , thus it would expected that one or more of the cid mutants to display a pronounced phenotype in BM supplemented with 18 mM glucose . Interestingly , when the glucose concentration was reduced to 11 mM and the sucrose concentration was increased to 10 mM, the phenotype of the cidB mutant reversed, whereby it had significantly increased biofilm formation relative to the wild type strain. It is possible that mutation of cidB result of metabolizing higher levels of glucose) or some other aspect of glucose metabolism, which in turn may affect biofilm formation under these different growth conditions. Al ternatively, these different phenotypes could be a result of differential effects of the cidB mutation on sucrose independent and sucrose dependent biofilm mechanisms in S. mutans . Based on of the fact that aerobic growth negatively impacts S. mutans bio film formation , it would be predicted that the presence of H 2 O 2 would also decrease biofilm formation [ 3 ] . In line with this hypothesis, we did observe a trend whereby the presence of sub inhibitory levels of H 2 O 2 slightly reduced biofilm formation in the wild type and cid mutants. Although this observation was not statistically significant, it would still be of interest to study H 2 O 2 mediated eDNA release and biofilm formation of S. mutans in the context of dual s pecies biofilm growth. Likewise, s ince cid and lrg mutants have been shown to affect eDNA release in other bacteria , future work will also be done to determine if H 2 O 2 and/or cid mutations affect eDNA release in S. mutans . Interestingly, H 2 O 2 has already b een reported to stimulate competence and eDNA release phenotypes in S. sanguinis , S. gordonii , and S. pneumoniae [ 3 ] [ 113 ] , but the effect of H 2 O 2 on competence and eDNA release in S. mutans has not been previously published. A role for H 2 O 2 in affecting S. mutans competence seems likely , since H 2 O 2 has been reported to

PAGE 53

53 stimulate competence in other oral streptococci [ 3 ] [ 113 ] and it is possible that cross signaling could occur between H 2 O 2 producing streptococci and S. mutans . H 2 O 2 producing streptococci would most likely want to turn off S. mutans competence and possibly promote lysis and eDNA release, as this w ould potentially give the H 2 O 2 producing streptococci a source of transforming DNA and/or nutrient recycling. In line with this idea, we found that H 2 O 2 was able to reverse the positive effects of exogenously added CSP on S. mutans competence (Fig. 3 8), and this effect did not appear to be a result of oxidative damage to the CSP peptide itself. The mechanism behind this observation is currently unknown, but will be the subject of future investigation by our research lab. In summar y, S. mutans is a common member of the bacterial flora in the oral cavity, but when this organism predominates dental plaque biofilm, it can cause dental cavities (caries). The S. mutans cid and lrg operons encode predicted membrane proteins that are found in many bacterial, archael, and even plant genomes. The work presented in this thesis has elaborated on a contribution of components of the cid and lrg operons to important S. mutans virulence traits such as biofilm formation, oxidative stress resistance, and competence [ 135 , 136 ] . Although t he mechanism is unclear as to how S. mutans cid and lrg genes promote oxidative stress resistance, it seems likely that targeting components of the Cid/Lrg system may eventually be viable strategy in the development of oral healthcare products to prevent caries development , given the severe growth inhibition of the cidB , cidAB , and lrgAB mutants in the presence of H 2 O 2 . For example, potential drug target s against the CidB protein could be identified by screen ing a small molecule library for molecules that interact with CidB, followed by test ing the candidate molecules for their ability to inhibit S. mutans growth in the pre sence of 1 mM H 2 O 2 .

PAGE 54

54 LIST OF REFERENCES 1. Loesche WJ: Role of Streptococcus mutans in human dental decay . Microbiological reviews 1986, 50 (4):353 380. 2. Hamada S, Slade HD: Biology, immunology, and cariogenicity of Streptococcus mutans . Microbiological reviews 1980, 44 (2):331 384. 3. Kreth J, Zhang Y, Herzberg MC: Streptococcal antagonism in oral biofilms: Streptococcus sanguinis and Streptococcus gordonii interference with Streptococcus mutans . Journal of bacteriology 2008, 190 ( 13):4632 4640. 4. Ajdic D, McShan WM, McLaughlin RE, Savic G, Chang J, Carson MB, Primeaux C, Tian R, Kenton S, Jia H et al : Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen . Proceedings of the National Academy of Sciences of th e United States of America 2002, 99 (22):14434 14439. 5. Vadeboncoeur C, Pelletier M: The phosphoenolpyruvate:sugar phosphotransferase system of oral streptococci and its role in the control of sugar metabolism . FEMS microbiology reviews 1997, 19 (3):187 20 7. 6. Bowden GH, Hamilton IR: Survival of oral bacteria . Critical reviews in oral biology and medicine : an official publication of the American Association of Oral Biologists 1998, 9 (1):54 85. 7. Cvitkovitch DG, Gutierrez JA, Bleiweis AS: Role of the ci trate pathway in glutamate biosynthesis by Streptococcus mutans . Journal of bacteriology 1997, 179 (3):650 655. 8. De Jong MH, Van der Hoeven JS: The growth of oral bacteria on saliva . Journal of dental research 1987, 66 (2):498 505. 9. Abbe K, Takahashi S, Yamada T: Involvement of oxygen sensitive pyruvate formate lyase in mixed acid fermentation by Streptococcus mutans under strictly anaerobic conditions . J Bacteriol 1982, 152 (1):175 182. 10. Rosenbluh A, Rosenberg E: Role of autocide AMI in development of Myxococcus xanthus . Journal of bacteriology 1990, 172 (8):4307 4314. 11. Bender GR, Sutton SV, Marquis RE: Acid tolerance, proton permeabilities, and membrane ATPases of oral streptococci . Infection and immunity 1986, 53 (2):331 338. 12. Lemos JA, Quivey RG, Jr., Koo H, Abranches J: Streptococcus mutans: a new Gram positive paradigm? Microbiology 2013, 159 (Pt 3):436 445. 13. Lemos JA, Burne RA: A model of efficiency: stress tolerance by Streptococcus mutans . Microbiology 2008, 154 (Pt 11):3247 3255.

PAGE 55

55 14. Moore W, Moore LV: The bacteria of periodontal diseases . Periodontology 2000 1994, 5 (1):66 77. 15. Socransky SS, Haffajee AD: Evidence of bacterial etiology: a historical perspective . Periodontology 2000 1994, 5 (1):7 25. 16. Barnard JP, Stinson MW: Influence of environmental conditions on hydrogen peroxide formation by Streptococcus gordonii . Infection and immunity 1999, 67 (12):6558 6564. 17. Ryan C, Kleinberg I: Bacteria in human mouths involved in the production and utilization of hydrogen peroxide . Archives of oral biology 1995, 40 (8):753 763. 18. Banas JA: Virulence properties of Streptococcus mutans . Front Biosci 2004, 9 :1267 1277. 19. Koulourides T: Summary of session II: fluoride and the caries process . J Dent Res 1990, 69 :558. 20. Marcucci M, Bandettini M: Dental caries in the rat in relation to the chemical composition of the teeth and diet. Variations in the diet of the Ca/P ratio obtained by changes in the phosphorus content . Minerva stomatologica 1981, 30 ( 1):17. 21. Daniels T, Silverman Jr S, Michalski J, Greenspan J, Sylvester R, Talal N: The oral component of Sjögren's syndrome . Oral Surgery, Oral Medicine, Oral Pathology 1975, 39 (6):875 885. 22. Karmiol M, Walsh R: Dental caries after radiotherapy of t he oral regions . The Journal of the American Dental Association 1975, 91 (4):838 845. 23. Rauk A, Yu D, Armstrong D: Toward Site Specificity of Oxidative Damage in Proteins: CH and CC Bond Dissociation Energies and Reduction Potentials of the Radicals of A lanine, Serine, and Threonine Residues An ab Initio Study . Journal of the American Chemical Society 1997, 119 (1):208 217. 24. CARIES D: Oral and dental diseases: Causes, prevention and treatment strategies . Burden of Disease in India :275. 25. Takahashi N , Horiuchi M, Yamada T: Effects of acidification on growth and glycolysis of Streptococcus sanguis and Streptococcus mutans . Oral microbiology and immunology 1997, 12 (2):72 76. 26. Bowden G: Which bacteria are cariogenic in humans . Risk markers for Oral diseases 1991, 1 :266 286.

PAGE 56

56 27. Edwardsson S: Microorganisms associated with dental caries . THYLSTRUP, A; FEJERSKOV, E Textbook of Cariology Copenhagen: Munksgaard 1986:107 130. 28. Quivey RG, Kuhnert WL, Hahn K: Genetics of acid adap tation in oral streptococci . Crit Rev Oral Biol Med 2001, 12 (4):301 314. 29. Petersen PE, Lennon MA: Effective use of fluorides for the prevention of dental caries in the 21st century: the WHO approach . Community dentistry and oral epidemiology 2004, 32 (5):319 321. 30. Caufield P: Dental caries -a transmissible and infectious disease revisited: a position paper . Pediatric dentistry 1997, 19 (8):491. 31. Milgrom P, Riedy C, Weinstein P, Tanner A, Manibusan L, Bruss J: Dental caries and its relationship t o bacterial infection, hypoplasia, diet, and oral hygiene in 6 to 36 month old children . Community dentistry and oral epidemiology 2000, 28 (4):295 306. 32. Herzberg MC: Oral Streptococci in health and disease . Streptococcal Infections: Clinical Aspects, M icrobiology, and Molecular Pathogenesis 2000:333. 33. Zero DT, Fontana M, Martinez Mier EA, Ferreira Zandona A, Ando M, Gonzalez Cabezas C, Bayne S: The biology, prevention, diagnosis and treatment of dental caries: scientific advances in the United State s . J Am Dent Assoc 2009, 140 Suppl 1 :25S 34S. 34. Beauchamp J, Caufield PW, Crall JJ, Donly K, Feigal R, Gooch B, Ismail A, Kohn W, Siegal M, Simonsen R: Evidence based clinical recommendations for the use of pit and fissure sealants: a report of the American Dental Association Council on Scientific Affairs . J Am Dent Assoc 2008, 139 (3):257 268. 35. Hiiri A, Ahovuo Saloranta A, Nordblad A, Makela M: Pit and fissure sealants versus fluoride varnishes for preventing dental decay in children and adolesce nts . The Cochrane database of systematic reviews 2010(3):CD003067. 36. Griffin SO, Oong E, Kohn W, Vidakovic B, Gooch BF, Bader J, Clarkson J, Fontana MR, Meyer DM, Rozier RG et al : The effectiveness of sealants in managing caries lesions . J Dent Res 2008 , 87 (2):169 174. 37. Featherstone JD: Prevention and reversal of dental caries: role of low level fluoride . Community dentistry and oral epidemiology 1999, 27 (1):31 40. 38. Hamilton I: Biochemical effects of fluoride on oral bacteria . Journal of dental r esearch 1990, 69 :660 667; discussion 682 663.

PAGE 57

57 39. Gibbons R, Socransky S: Intracellular polysaccharide storage by organisms in dental plaques: its relation to dental caries and microbial ecology of the oral cavity . Archives of oral biology 1962, 7 (1):73 I N13. 40. Lie T: Early dental plaque morphogenesis . Journal of periodontal research 1977, 12 (2):73 89. 41. Newman BM, White P, Mohan SB, Cole JA: Effect of dextran and ammonium sulphate on the reaction catalysed by a glucosyltransferase complex from Strep tococcus mutans . Journal of general microbiology 1980, 118 (2):353 366. 42. Rogers AH: Bacteriocinogeny and the properties of some bacteriocins of Streptococcus mutans . Arch Oral Biol 1976, 21 (2):99 104. 43. Saxton CA: An electron microscope investigation of bacterial polysaccharide synthesis in human dental plaque . Arch Oral Biol 1969, 14 (11):1275 1284. 44. Ahn SJ, Wen ZT, Brady LJ, Burne RA: Characteristics of biofilm formation by Streptococcus mutans in the presence of saliva . Infection and immunity 20 08, 76 (9):4259 4268. 45. Khan AU, Islam B, Khan SN, Akram M: A proteomic approach for exploring biofilm in Streptococcus mutans . Bioinformation 2011, 5 (10):440 445. 46. Wen ZT, Yates D, Ahn SJ, Burne RA: Biofilm formation and virulence expression by Stre ptococcus mutans are altered when grown in dual species model . BMC microbiology 2010, 10 :111. 47. Brady LJ, Maddocks SE, Larson MR, Forsgren N, Persson K, Deivanayagam CC, Jenkinson HF: The changing faces of Streptococcus antigen I/II polypeptide family a dhesins . Molecular microbiology 2010, 77 (2):276 286. 48. Ohta H, Kato H, Okahashi N, Takahashi I, Hamada S, Koga T: Characterization of a cell surface protein antigen of hydrophilic Streptococcus mutans strain GS 5 . Journal of general microbiology 1989, 1 35 (4):981 988. 49. Lee SF, Progulske Fox A, Erdos GW, Piacentini DA, Ayakawa GY, Crowley PJ, Bleiweis AS: Construction and characterization of isogenic mutants of Streptococcus mutans deficient in major surface protein antigen P1 (I/II) . Infection and imm unity 1989, 57 (11):3306 3313. 50. Douglas C, Russell R: Effect of specific antisera on adherence properties of the oral bacterium< i> Streptococcus mutans . Archives of oral biology 1982, 27 (12):1039 1045.

PAGE 58

58 51. Bowen WH, Schilling K, Giertsen E, Pearson S, Lee SF, Bleiweis A, Beeman D: Role of a cell surface associated protein in adherence and dental caries . Infection and immunity 1991, 59 (12):4606 4609. 52. Krzysciak W, Jurczak A, Koscielniak D, Bystrowska B, Skalniak A: The virulence of Streptococcus mutans and the ability to form biofilms . European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 2014, 33 (4):499 515. 53. Ooshima T, Matsumura M, Hoshino T, Kawabata S, Sobue S, Fujiwara T: Contributions of three glucosyltransferases to sucrose dependent adherence of Streptococcus mutans . Journal of dental research 2001, 80 (7):1672 1677. 54. Zeng L, Burne RA: Transcriptional regulation of the cellobiose operon of Streptococcus mutans . Journal of bacteriology 2009, 191 (7):2153 2162. 55. Banas JA, Vickerman MM: Glucan binding proteins of the oral streptococci . Crit Rev Oral Biol Med 2003, 14 (2):89 99. 56. Aoki H, Shiroza T, Hayakawa M, Sato S, Kuramitsu HK: Cloning of a Strepto coccus mutans glucosyltransferase gene coding for insoluble glucan synthesis . Infection and immunity 1986, 53 (3):587 594. 57. Hanada N, Kuramitsu HK: Isolation and characterization of the Streptococcus mutans gtfC gene, coding for synthesis of both soluble and insoluble glucans . Infection and immunity 1988, 56 (8):1999 2005. 58. Hanada N, Kuramitsu HK: Isolation and characterization of the Streptococcus mutans gtfD gene, coding for primer dependent soluble glucan synthesis . Infection and immunity 198 9, 57 (7):2079 2085. 59. Bowen WH, Koo H: Biology of Streptococcus mutans derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms . Caries Res 2011, 45 (1):69 86. 60. Ahn SJ, Wen ZT, Burne RA: Effects of oxygen on virulen ce traits of Streptococcus mutans . J Bacteriol 2007, 189 (23):8519 8527. 61. Ahn SJ, Burne RA: Effects of oxygen on biofilm formation and the AtlA autolysin of Streptococcus mutans . Journal of bacteriology 2007, 189 (17):6293 6302. 62. Yoshida A, Kuramitsu HK: Multiple Streptococcus mutans Genes Are Involved in Biofilm Formation . Applied and environmental microbiology 2002, 68 (12):6283 6291. 63. Ueda S, Shiroza T, Kuramitsu HK: Sequence analysis of the< i> gtfC gene from< i> Strepto coccus mutans GS 5 . Gene 1988, 69 (1):101 109.

PAGE 59

59 64. Sadykov MR, Bayles KW: The control of death and lysis in staphylococcal biofilms: a coordination of physiological signals . Current opinion in microbiology 2012, 15 (2):211 215. 65. Guggenheim B: Extrace llular polysaccharides and microbial plaque . International dental journal 1970, 20 (4):657. 66. Russell RR: Glucan binding proteins of Streptococcus mutans serotype c . Journal of general microbiology 1979, 112 (1):197 201. 67. Lorenz MG, Wackernagel W: Bac terial gene transfer by natural genetic transformation in the environment . Microbiological reviews 1994, 58 (3):563 602. 68. Havarstein LS, Hakenbeck R, Gaustad P: Natural competence in the genus Streptococcus: evidence that streptococci can change pheroty pe by interspecies recombinational exchanges . Journal of bacteriology 1997, 179 (21):6589 6594. 69. Kleerebezem M, Quadri LE, Kuipers OP, de Vos WM: Quorum sensing by peptide pheromones and two component signal transduction systems in Gram positive bacteri a . Molecular microbiology 1997, 24 (5):895 904. 70. Lunsford RD, London J: Natural genetic transformation in Streptococcus gordonii: comX imparts spontaneous competence on strain wicky . Journal of bacteriology 1996, 178 (19):5831 5835. 71. Bassler BL: How bacteria talk to each other: regulation of gene expression by quorum sensing . Current opinion in microbiology 1999, 2 (6):582 587. 72. Costerton JW, Stewart PS, Greenberg EP: Bacterial biofilms: a common cause of persistent infections . Science 1999, 284 (5418):1318 1322. 73. Hassett DJ, Ma JF, Elkins JG, McDermott TR, Ochsner UA, West SE, Huang CT, Fredericks J, Burnett S, Stewart PS et al : Quorum sensing in Pseudomonas aeruginosa controls expression of catalase and superoxide dismutase genes and mediate s biofilm susceptibility to hydrogen peroxide . Molecular microbiology 1999, 34 (5):1082 1093. 74. Otto M, Sussmuth R, Vuong C, Jung G, Gotz F: Inhibition of virulence factor expression in Staphylococcus aureus by the Staphylococcus epidermidis agr pheromon e and derivatives . FEBS letters 1999, 450 (3):257 262. 75. Surette MG, Miller MB, Bassler BL: Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production . Proceedings of the N ational Academy of Sciences of the United States of America 1999, 96 (4):1639 1644.

PAGE 60

60 76. De Kievit TR, Gillis R, Marx S, Brown C, Iglewski BH: Quorum sensing genes in Pseudomonas aeruginosa biofilms: their role and expression patterns . Applied and environmen tal microbiology 2001, 67 (4):1865 1873. 77. Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton J, Greenberg E: The involvement of cell to cell signals in the development of a bacterial biofilm . Science 1998, 280 (5361):295 298. 78. Miller MB, Bassle r BL: Quorum sensing in bacteria . Annual review of microbiology 2001, 55 :165 199. 79. de Kievit TR, Iglewski BH: Bacterial quorum sensing in pathogenic relationships . Infection and immunity 2000, 68 (9):4839 4849. 80. Parsek MR, Greenberg EP: Acyl homoserine lactone quorum sensing in gram negative bacteria: a signaling mechanism involved in associations with higher organisms . Proceedings of the National Academy of Sciences of the United States of America 2000, 97 (16):8789 8793. 81. Li YH, Lau PC, Lee JH, Ellen RP, Cvitkovitch DG: Natural genetic transformation of Streptococcus mutans growing in biofilms . Journal of bacteriology 2001, 183 (3):897 908. 82. Petersen FC, Fimland G, Scheie AA: Purification and functional studies of a potent modified quorum sensing peptide and a two peptide bacteriocin in Streptococcus mutans . Molecular microbiology 2006, 61 (5):1322 1334. 83. Berge M, Moscoso M, Prudhomme M, Martin B, Claverys JP: Uptake of transforming DNA in Gram positive bacteria: a view from Strep tococcus pneumoniae . Molecular microbiology 2002, 45 (2):411 421. 84. Cheng Q, Campbell EA, Naughton AM, Johnson S, Masure HR: The com locus controls genetic transformation in Streptococcus pneumoniae . Molecular microbiology 1997, 23 (4):683 692. 85. Pesto va E, HÃ¥varstein L, Morrison D: Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto induced peptide pheromone and a two component regulatory system . Molecular microbiology 1996, 21 (4):853 862. 86. Ahn SJ, Wen ZT, Burne RA: Multilevel control of competence development and stress tolerance in Streptococcus mutans UA159 . Infection and immunity 2006, 74 (3):1631 1642. 87. Lee MS, Morrison DA: Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation . Journal of bacteriology 1999, 181 (16):5004 5016.

PAGE 61

61 88. Luo P, Li H, Morrison DA: ComX is a unique link between multiple quorum sensing outputs and competence in Streptococcus pneumoniae . Molec ular microbiology 2003, 50 (2):623 633. 89. Luo P, Morrison DA: Transient association of an alternative sigma factor, ComX, with RNA polymerase during the period of competence for genetic transformation in Streptococcus pneumoniae . Journal of bacteriology 2003, 185 (1):349 358. 90. Petersen FC, Tao L, Scheie AA: DNA binding uptake system: a link between cell to cell communication and biofilm formation . Journal of bacteriology 2005, 187 (13):4392 4400. 91. Li YH, Tang N, Aspiras MB, Lau PC, Lee JH, Ellen RP, Cvitkovitch DG: A quorum sensing signaling system essential for genetic competence in Streptococcus mutans is involved in biofilm formation . Journal of bacteriology 2002, 184 (10):2699 2708. 92. Christensen BB, Sternberg C, Andersen JB, Eberl L, Moller S, Givskov M, Molin S: Establishment of new genetic traits in a microbial biofilm community . Applied and environmental microbiology 1998, 64 (6):2247 2255. 93. Hausner M, Wuertz S: High rates of conjugation in bacterial biofilms as determined by quantitative in situ analysis . Applied and environmental microbiology 1999, 65 (8):3710 3713. 94. Williams HG, Day MJ, Fry JC, Stewart GJ: Natural transformation in river epilithon . Applied and environmental microbiology 1996, 62 (8):2994 2998. 95. Mashburn Warren L, Morrison DA, Federle MJ: A novel double tryptophan peptide pheromone controls competence in Streptococcus spp. via an Rgg regulator . Molecular microbiology 2010, 78 (3):589 606. 96. Sulavik MC, Tardif G, Clewell DB: Identification of a gene, rgg, which regulates expression of glucosyltransferase and influences the Spp phenotype of Streptococcus gordonii Challis . Journal of bacteriology 1992, 174 (11):3577 3586. 97. Fontaine L, Boutry C, de Frahan MH, Delplace B, Fremaux C, Horvath P, Boyaval P, Ho ls P: A novel pheromone quorum sensing system controls the development of natural competence in Streptococcus thermophilus and Streptococcus salivarius . Journal of bacteriology 2010, 192 (5):1444 1454. 98. Lemme A, Grobe L, Reck M, Tomasch J, Wagner Dobler I: Subpopulation specific transcriptome analysis of competence stimulating peptide induced Streptococcus mutans . Journal of bacteriology 2011, 193 (8):1863 1877.

PAGE 62

62 99. Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, Smeltzer MS, Bayles KW: The cidA murei n hydrolase regulator contributes to DNA release and biofilm development in Staphylococcus aureus . Proceedings of the National Academy of Sciences of the United States of America 2007, 104 (19):8113 8118. 100. Matsukawa M, Greenberg EP: Putative exopolysaccharide synthesis genes influence Pseudomonas aeruginosa biofilm development . J Bacteriol 2004, 186 (14):4449 4456. 101. van Schaik EJ, Giltner CL, Audette GF, Keizer DW, Bautista DL, Slupsky CM, Sykes BD, Irvin RT: DNA binding: a novel function of Pseudomonas aeruginosa type IV pili . J Bacteriol 2005, 187 (4):1455 1464. 102. Whitchurch CB, Tolker Nielsen T, Ragas PC, Mattick JS: Extracellular DNA required for bacterial biofilm formation . Science 2002, 295 (5559):1487 1487. 103. Mann EE, Rice KC, Boles BR, Endres JL, Ranjit D, Chandramohan L, Tsang LH, Smeltzer MS, Horswill AR, Bayles KW: Modulation of eDNA release and degradation affects Staphylococcus aureus biofilm maturation . PLoS One 2009, 4 (6):e5822. 104. Moscoso M, Clavery s JP: Release of DNA into the medium by competent Streptococcus pneumoniae: kinetics, mechanism and stability of the liberated DNA . Molecular microbiology 2004, 54 (3):783 794. 105. Steinmoen H, Teigen A, Havarstein LS: Competence induced cells of Streptoc occus pneumoniae lyse competence deficient cells of the same strain during cocultivation . Journal of bacteriology 2003, 185 (24):7176 7183. 106. Moscoso M, Claverys JP: Release of DNA into the medium by competent Streptococcus pneumoniae: kinetics, mechani sm and stability of the liberated DNA . Molecular microbiology 2004, 54 (3):783 794. 107. Perry JA, Cvitkovitch DG, Levesque CM: Cell death in Streptococcus mutans biofilms: a link between CSP and extracellular DNA . FEMS microbiology letters 2009, 299 (2):26 1 266. 108. Higuchi M, Shimada M, Yamamoto Y, Hayashi T, Koga T, Kamio Y: Identification of two distinct NADH oxidases corresponding to H2O2 forming oxidase and H2O forming oxidase induced in Streptococcus mutans . Journal of general microbiology 1993, 139 (10):2343 2351. 109. Marquis R: Oxygen metabolism, oxidative stress and acid base physiology of dental plaque biofilms . Journal of industrial microbiology 1995, 15 (3):198 207. 110. Matsumoto Nakano M, Kuramitsu HK: Role of bacteriocin immunity proteins i n the antimicrobial sensitivity of Streptococcus mutans . Journal of bacteriology 2006, 188 (23):8095 8102.

PAGE 63

63 111. Nobbs AH, Zhang Y, Khammanivong A, Herzberg MC: Streptococcus gordonii Hsa environmentally constrains competitive binding by Streptococcus sanguinis to saliva coated hydroxyapatite . Journal of bacteriology 2007, 189 (8):3106 3114. 112. Kreth J, Merritt J, Shi W, Qi F: Competition and coexistence between Streptococcus mutans and Streptococcus sanguinis in the dental biofilm . Journal of bacteri ology 2005, 187 (21):7193 7203. 113. Battig P, Muhlemann K: Influence of the spxB gene on competence in Streptococcus pneumoniae . J Bacteriol 2008, 190 (4):1184 1189. 114. Itzek A, Zheng L, Chen Z, Merritt J, Kreth J: Hydrogen peroxide dependent DNA release and transfer of antibiotic resistance genes in Streptococcus gordonii . Journal of bacteriology 2011, 193 (24):6912 6922. 115. Bayles KW: The biological role of death and lysis in biofilm development . Nature Reviews Microbiology 2007, 5 (9):721 726. 116. Bayles KW: Are the molecular strategies that control apoptosis conserved in bacteria? Trends in microbiology 2003, 11 (7):306 311. 117. Rice KC, Bayles KW: Molecular control of bacterial death and lysis . Microbiology and molecular biology reviews : M MBR 2008, 72 (1):85 109, table of contents. 118. Wang IN, Smith DL, Young R: Holins: the protein clocks of bacteriophage infections . Annual review of microbiology 2000, 54 :799 825. 119. White R, Chiba S, Pang T, Dewey JS, Savva CG, Holzenburg A, Pogliano K, Young R: Holin triggering in real time . Proceedings of the National Academy of Sciences of the United States of America 2011, 108 (2):798 803. 120. Savva CG, Dewey JS, Deaton J, White RL, Struck DK, Holzenburg A, Young R: The holin of bacteriophage lambda forms rings with large diameter . Molecular microbiology 2008, 69 (4):784 793. 121. Rice KC, Firek BA, Nelson JB, Yang SJ, Patton TG, Bayles KW: The Staphylococcus aureus cidAB operon: evaluation of its role in regulation of murein hydrolase activity and penicillin tolerance . Journal of bacteriology 2003, 185 (8):2635 2643. 122. Groicher KH, Firek BA, Fujimoto DF, Bayles KW: The Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and penicillin tolerance . Journal of bacteriology 200 0, 182 (7):1794 1801. 123. Yang SJ, Rice KC, Brown RJ, Patton TG, Liou LE, Park YH, Bayles KW: A LysR type regulator, CidR, is required for induction of the Staphylococcus aureus cidABC operon . Journal of bacteriology 2005, 187 (17):5893 5900.

PAGE 64

64 124. Brunskil l EW, Bayles KW: Identification of LytSR regulated genes from Staphylococcus aureus . Journal of bacteriology 1996, 178 (19):5810 5812. 125. Rice KC, Nelson JB, Patton TG, Yang SJ, Bayles KW: Acetic acid induces expression of the Staphylococcus aureus cidAB C and lrgAB murein hydrolase regulator operons . Journal of bacteriology 2005, 187 (3):813 821. 126. Moormeier DE, Endres JL, Mann EE, Sadykov MR, Horswill AR, Rice KC, Fey PD, Bayles KW: Use of microfluidic technology to analyze gene expression during Stap hylococcus aureus biofilm formation reveals distinct physiological niches . Applied and environmental microbiology 2013, 79 (11):3413 3424. 127. Ranjit DK, Endres JL, Bayles KW: Staphylococcus aureus CidA and LrgA proteins exhibit holin like properties . Jou rnal of bacteriology 2011, 193 (10):2468 2476. 128. Ma L, Conover M, Lu H, Parsek MR, Bayles K, Wozniak DJ: Assembly and development of the Pseudomonas aeruginosa biofilm matrix . PLoS pathogens 2009, 5 (3):e1000354. 129. Chandramohan L, Ahn J S, Weaver KE, Bayles KW: An overlap between the control of programmed cell death in Bacillus anthracis and sporulation . Journal of bacteriology 2009, 191 (13):4103 4110. 130. Ahn JS, Chandramohan L, Liou LE, Bayles KW: Characterizatio n of CidR mediated regulation in Bacillus anthracis reveals a previously undetected role of S layer proteins as murein hydrolases . Molecular microbiology 2006, 62 (4):1158 1169. 131. Wang J, Bayles KW: Programmed cell death in plants: lessons from bacteria ? Trends in plant science 2013, 18 (3):133 139. 132. Yang Y, Jin H, Chen Y, Lin W, Wang C, Chen Z, Han N, Bian H, Zhu M, Wang J: A chloroplast envelope membrane protein containing a putative LrgB domain related to the control of bacterial death and lysis i s required for chloroplast development in Arabidopsis thaliana . The New phytologist 2012, 193 (1):81 95. 133. Yamaguchi M, Takechi K, Myouga F, Imura S, Sato H, Takio S, Shinozaki K, Takano H: Loss of the plastid envelope protein AtLrgB causes spontaneous chlorotic cell death in Arabidopsis thaliana . Plant & cell physiology 2012, 53 (1):125 134. 134. Rice KC, Bayles KW: Death's toolbox: examining the molecular components of bacterial programmed cell death . Molecular microbiology 2003, 50 (3):729 738. 135. A hn SJ, Rice KC, Oleas J, Bayles KW, Burne RA: The Streptococcus mutans Cid and Lrg systems modulate virulence traits in response to multiple environmental signals . Microbiology 2010, 156 (Pt 10):3136 3147.

PAGE 65

65 136. Ahn SJ, Qu MD, Roberts E, Burne RA, Rice KC: I dentification of the Streptococcus mutans LytST two component regulon reveals its contribution to oxidative stress tolerance . BMC microbiology 2012, 12 :187. 137. Loo CY, Corliss DA, Ganeshkumar N: Streptococcus gordonii biofilm formation: identification o f genes that code for biofilm phenotypes . Journal of bacteriology 2000, 182 (5):1374 1382. 138. Haldi J, Wynn W, Bentley KD, Law ML: Dental caries in the albino rat in relation to the chemical composition of the teeth and of the diet. IV. Variations in the Ca/P ratio of the diet induced by changing the calcium content . The Journal of nutrition 1959, 67 (4):645. 139. Seidman CE, Struhl K, Sheen J, Jessen T: Introduction of plasmid DNA into cells . Current protocols in molecular biology 1997:1.8. 1 1.8. 10. 1 40. Keyes P: The infectious and transmissible nature of experimental dental caries: Findings and implications . Archives of oral biology 1960, 1 (4):304 IN304. 141. Sadykov MR, Thomas VC, Marshall DD, Wenstrom CJ, Moormeier DE, Widhelm TJ, Nuxoll AS, Powers R, Bayles KW: Inactivation of the Pta AckA pathway causes cell death in Staphylococcus aureus . Journal of bacteriology 2013, 195 (13):3035 3044.

PAGE 66

66 BIOGRAPHICAL SKETCH Carney is a Miami, Florida native who graduated cum lade from Miami Norland Senior High School in 2006. Upon graduation she attended Miami Dade College where she graduated in 2009 with a n Associate of Arts in b iology. After completing her AA degree she transferred to the University of Florida to p ursue a Bachelor of Science in b iology. She then attended University of Florida and in August 2014 graduat ed with a Master of Science in m icrobiology and cell science . After graduation work as a lab technician and prepare to gain acceptance into dental school.