Citation
Cellular Responses to Threonylcarbamoyladenosine (t6A) Deficiency in Saccharomyces cerevisiae

Material Information

Title:
Cellular Responses to Threonylcarbamoyladenosine (t6A) Deficiency in Saccharomyces cerevisiae
Creator:
Thiaville, Patrick
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (4 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Genetics and Genomics
Committee Chair:
DE CRECY,VALERIE ANNE
Committee Co-Chair:
CHASE,CHRISTINE D
Committee Members:
SWANSON,MAURICE S
ARIS,JOHN PHILLIP
NAMY,OLIVIER
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Biosynthesis ( jstor )
Cell membranes ( jstor )
Codons ( jstor )
Mitochondria ( jstor )
Open reading frames ( jstor )
Proteins ( jstor )
Ribosomes ( jstor )
RNA ( jstor )
Transfer RNA ( jstor )
Yeasts ( jstor )
Genetics and Genomics -- Dissertations, Academic -- UF
comparative-genomics -- translation -- trna -- trna-modification
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Genetics and Genomics thesis, Ph.D.

Notes

Abstract:
The modification of tRNA has a rich literature of biochemical analysis going back more than 40 years; however, the genes responsible for the modifications have only been recently identified. Comparative genomic analysis has allowed for the identification of the genes in bacteria, and subsequent characterization of the enzymes, responsible for the modification N6-threonylcarbamoyladenosine (t6A) located at position 37, adjacent to the anticodon of tRNAs. While the modification is present in all domains of life, only two of the four enzymes responsible for biosynthesis machinery are conserved. In Eukaryotes, both cytoplasmic and mitochondrial tRNAs are modified with t6A, and previously only the two universally conserved members of the cytoplasmic t6A synthesis pathway, TsaC/Sua5 and TsaD/KaeI/Qri7 were known. Recent progress on deciphering the t6A synthesis pathways has revealed that different solutions have been adopted in different kingdoms, species, and organelles, and these variant pathways are still being characterized. This investigation identified the other four proteins required for cytoplasmic synthesis (Bud32, Pcc1, Cgi121, Gon7), and determined that only Sua5 and Qri7 are required for mitochondrial synthesis of t6A in yeast. The same enzyme, Sua5, performs the first step of t6A synthesis in both the cytoplasm and the mitochondria. It is targeted to both the cytoplasm and the mitochondria through the use of alternative, in-frame AUG translational start sites. This study showed that a minimum synthesis machinery is responsible for mitochondrial t6A, implicating a core set of enzymes from the LUCA. The roles of this complex modification in vivo also seem to vary. For example, t6A is essential in prokaryotes, but not in yeast. The causes of the observed pleiotropic phenotypes triggered by the reduction or absence of t6A synthesis enzymes are not yet fully understood. This work used ribosome profiling to map all translation errors occurring when t6A was absent. By examining ribosomal occupancy of every codon, this work indicates that t6A is helping rare tRNAs compete with high copy tRNAs. The complexity and diversity of the t6A pathway combined with the functional and evolutionary importance of this modification have made t6A a particularly fascinating decoration of tRNA to study. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: DE CRECY,VALERIE ANNE.
Local:
Co-adviser: CHASE,CHRISTINE D.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Patrick Thiaville.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 CELLULAR RESPONSES TO THREONYLCARBAMOYLADENOSINE ( t 6 A ) DEFIC IEN CY IN Saccharomyces cerevisiae By PATRICK CHARLES THIAVILLE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2 © 2014 Patrick C. Thiaville

PAGE 3

3 To my first successful cloning, my daughter Olivia Grayce Thiaville

PAGE 4

4 ACKNOWLEDGMENTS I thank Valérie de Crécy Lagard for her time, patience, continuing support and commitment to my success. I am also thankful to my graduate committee John Aris, Chris Chase, Maury Swanson, and Olivier Namy, without whom this work would not have been possible. For her constant encouragement and excellent editing over these last few years, I thank my wife Jennifer Thiaville. I thank Bret Boyd, Justin Fear, and Oleksander Moskalenko for the numerous times they answered my questions on scripts a nd operation of HiPerGator. I would like to thank the entire de Crécy laboratory, especially Basma El Yacoubi for stimulating discussion. I thank my collaborators Dirk Iwata Reuyl and Tamara Basta. I am especially grateful for the warm reception from every one at IGM at University of Paris Sud, es pecially Isabelle Hatin, and Agn ès Baudin Baillieu. I thank Rachel Legendre for bioinfomatic support, without whom this work would not have been possible. I am grateful for having the opportunity to work with and di scuss science with Henri Grosjean, whose knowledge of nucleic acid modification is only surpassed by his exquisite cooking! I would like to thank Annick Werner of the French Embassy for her tireless help navigating French bureaucracy. For their support and help navigating graduate school in Florida, I thank Marta Wayne, Wilfred Vermeris, Connie Mulligan, Jorg Bungert, Patrick Concannon, and Hope Parmeter, and for help in France, I thank Muriel Decraene. Finally, I thank the State of Florida Board of Educati on, National Science Foundation, National Institute of Health, and the University of Florida Genetics In stitute for support of my work. This work was supported in part by a Chateaubriand Fellowship from the French Embassy to the United States.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 Eukary otic Translation: A Summary ................................ ................................ ........ 15 Controlling Translation Error Rates ................................ ................................ ......... 16 tRNA Maturation and Decoding ................................ ................................ .............. 16 tRNA Maturation ................................ ................................ ............................... 16 Decoding the Genome ................................ ................................ ..................... 17 Controlling Errors in Initiation ................................ ................................ ........... 18 Accurate Decoding and Elongation ................................ ................................ .. 18 Modifications at Position 34 ................................ ................................ .............. 19 Modifications at Position 37 ................................ ................................ .............. 20 The t 6 A Modification at Position 37 ................................ ................................ ... 20 Derivatives of t 6 A ................................ ................................ .............................. 21 Biosynthesis of t 6 A in Bacteria ................................ ................................ ................ 23 Project Rationale, Design, and Objectives ................................ .............................. 26 2 MATERIALS AND METHODS ................................ ................................ ................ 35 Strains and Growth Conditions ................................ ................................ ............... 35 PCR Methods ................................ ................................ ................................ ......... 36 Plasmid Construc tion for Yeast in vivo Assays ................................ ....................... 36 Microscopy ................................ ................................ ................................ .............. 37 Yeast Growth Assays ................................ ................................ .............................. 37 Bioinformatics Analysis ................................ ................................ ........................... 38 Taxo nomic Distribution of Genes ................................ ................................ ..... 38 Manipulation of Datasets ................................ ................................ .................. 38 Annotation of Genomes ................................ ................................ .................... 39 Codon Analysis ................................ ................................ ................................ 39 Preparation of Bulk tRNA and Detection of t 6 A ................................ ....................... 40 Extraction of Bulk tRNAs ................................ ................................ .................. 40 Analysis of tRNA by Denaturing 8 M Urea PAGE. ................................ ............ 42 Bulk tRNA Digestion for LC MS/MS Analysis ................................ ................... 43 HPLC and LC MS/MS Analysis ................................ ................................ ........ 43

PAGE 6

6 Ri bosome Profiling ................................ ................................ ................................ .. 44 Preparation of Polysomes ................................ ................................ ................ 44 Purification of Monosomes ................................ ................................ ............... 45 Purification of RNA With Phenol ................................ ................................ ....... 45 Selection of Fragments of 28 Nucleotides by PAGE ................................ ........ 46 Gel Extraction of RNA ................................ ................................ ...................... 47 Depletion of rRNA Contamination ................................ ................................ .... 47 Library Preparation and Sequencing ................................ ................................ 48 Functional Classification of Genes ................................ ................................ .......... 48 3 DIVERSITY IN THE BIOSYNTHESIS PATHWAY FOR t 6 A ................................ .... 59 Background ................................ ................................ ................................ ............. 59 Synthesis of t 6 a Varies With Domain of Life ................................ ............................ 59 Results ................................ ................................ ................................ .................... 60 Analysis of KEOPS Mutants in the Archaeon Haloferax volcanii for t 6 A ........... 60 Analysis of KEOPS Mutants in Saccharomyces cerevisiae for t 6 A ................... 60 Yeast Mitochondria Possess a Minimum Biosynthesis Mechanism for Formation of t 6 A ................................ ................................ ............................ 61 Distribution of the t 6 A Synthesis Genes Varies in Different Organisms ............ 63 Discussion ................................ ................................ ................................ .............. 66 Synthesis of t 6 A in Archaea and Eukaryotes is Dependent on the KEOPS Complex ................................ ................................ ................................ ........ 66 Qri7p and Sua5p are Responsible for Synthesis of t 6 A in the Mitochondria ..... 67 Despite the Diversity of t 6 A Machinery, There is a Common Core ................... 69 Broad Implications of the Discovery of t 6 A Synthesis Genes ............................ 69 Naming Convention ................................ ................................ .......................... 70 4 LIFE WITHOUT THE ESSENTIAL MODIFICATION t 6 A ................................ ......... 84 Background ................................ ................................ ................................ ............. 84 Understanding Esse ntiality of t 6 A in Bacteria ................................ .......................... 84 Results ................................ ................................ ................................ .................... 85 t 6 A is Essential in Whole Genome Mutagenesis Surveys of Prokaryotes ......... 85 Life Without t 6 A ................................ ................................ ................................ . 86 Analysis of t 6 A Content in Deinococcus radiodurans ................................ . 86 Analysis of t 6 A Content in Synechocystis PCC 6308 and Streptococcus mutans ................................ ................................ ................................ .... 88 Discussion ................................ ................................ ................................ .............. 88 5 CELLULAR ROLES OF t 6 A ................................ ................................ .................. 100 Background ................................ ................................ ................................ ........... 100 Results ................................ ................................ ................................ .................. 103 TC AMP Produced in t he Cytoplasm is not Sufficient for Mitochondrial Function ................................ ................................ ................................ ...... 103 Tcs2p Must be Targeted to the Mitochondria for Growth on Glycerol ............ 104

PAGE 7

7 Relationship of mcm 5 s 2 U 34 and t 6 A 37 ................................ .............................. 105 Overexpression of tRNAs for Elongation or TC do not Suppress the Growth Defect of tcs2 ................................ ................................ ............................ 106 Ribosome Profiling of tsc2 ................................ ................................ ............ 107 Polysome phenotype ................................ ................................ ............... 108 Sequencing, quality control, and read mapping ................................ ....... 108 RPFs differentially expressed in tcs2 ................................ ..................... 109 Analysis of frame shifts in BY4742 a nd tcs2 ................................ .......... 110 Analysis of upstream open reading frames (uORFs) ............................... 111 Analysis of stop codon read through ................................ ........................ 112 Analysis of potential initiation at upstream non AUG start sites ............... 112 Codon occupancy at the ribosome A, P, and E sites. .............................. 114 Comparison of RPFs Differentially Expressed in tcs2 Expression Data ................................ ................................ .......................... 115 Differentially expressed genes in tcs2 .............. 115 Differentially expressed RPFs in tcs2 ncs6 ................................ ... 116 Genes increased in tcs2 GCN4 ............................ 117 Discussion ................................ ................................ ................................ ............ 117 Mitochondria Req uire Tcs2p for Function ................................ ....................... 118 No Parallel Between t 6 A and mcm 5 s 2 U ................................ .......................... 118 Depletion of t 6 A Induces Starvation Response ................................ ............... 119 t 6 A Depletion Leads to Translation Ambiguities ................................ .............. 119 Effect of t 6 A Varies Depending on Codon: Anticodon Pairing ......................... 119 t 6 A as a Sensor of Nutrient Levels to Fine Tune Translation .......................... 120 6 DETECTION OF THE MODIFIED NUCLEOSIDE t 6 A. ................................ .......... 149 Background ................................ ................................ ................................ ........... 149 Nucleases Cleave the Anticodon of tRNAs ................................ .................... 149 The Anticodon Nuclease PrrC ................................ ................................ ........ 150 Results ................................ ................................ ................................ .................. 151 The Anticodon Nuclea se PrrC Uses t 6 A as a Determinant ............................. 151 Positive Hybridization in the Absence of t 6 A, the PHAt6 Assay ...................... 152 Discussion ................................ ................................ ................................ ............ 152 7 DISCUSSION ................................ ................................ ................................ ....... 159 Phenotypes in Microbes as Prognosticator of Human Disease ............................ 159 Controlling Free TC AMP ................................ ................................ ............... 159 Errors in Translation can Increase the Statistical Proteome ........................... 160 Model for Cellular Response to Reduction of t 6 A ................................ .................. 160 t 6 A and Human Disease ................................ ................................ ........................ 162 APPENDIX GENE NAMES AND FUNCTION REFERENCED IN THIS WORK ...... 16 5 LIST OF REFERENCES ................................ ................................ ............................. 221

PAGE 8

8 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 240

PAGE 9

9 LIST OF TABLES Table page 2 1 Strains used in this study. ................................ ................................ ................... 49 2 2 Plasmids used in this study. ................................ ................................ ............... 50 2 3 Oligonucleotides used in this study. ................................ ................................ ... 53 2 4 HPLC gradient for nucleoside analysis ................................ ............................... 58 3 1 Homologs of t 6 A synthesis genes in Bacteria. ................................ .................... 72 3 2 Homologs of t 6 A synthesis genes in Archaea and Eukaryotes. .......................... 73 3 3 Proposed names and functional roles for t 6 A synthesis genes. .......................... 74 4 1 Survey of bacterial whole genome gene deletion libraries for mutations in t 6 A biosynthetic genes. ................................ ................................ ............................. 90 4 2 Survey of Archaeal and Eukaryotic gene deletion studies for mutations in t 6 A biosynthetic genes. ................................ ................................ ............................. 91 4 3 Single gene deletions in t 6 A biosynthesis in bacteria. ................................ ......... 92 4 4 Genes in D. radiodurans with two or more AUA codons. ................................ .... 93 5 1 Phenotypes associated with disruption of t 6 A enzymes ................................ .... 122 5 2 Gene Ontology Enrichment for Genes Increased in RPFs in tcs2 .................. 123 5 3 Genes increased in expression common to tcs2 tcs3 18 ........................ 124 5 4 Genes increased in expression common to tcs2 tcs6 4 .......................... 125 5 5 Genes increased in expression common to tcs2 tcs8 ts1 ........................ 126 5 6 Genes increased in expression common to tcs2 tcs 18 , tcs6 4 , and tcs8 ts1 ................................ ................................ ................................ ............. 127 5 7 Genes with increased RPFs in both tcs2 ncs6 ................................ ...... 128 5 8 Genes with decreased RPFs in both tcs2 ncs6 ................................ ..... 129 5 9 Genes with increased RPFs in tcs2 GCN4 regulation .......................... 130 6 1 Resistance to killing by the PrrC toxin. ................................ ............................. 154

PAGE 10

10 7 1 Gene ontology enrichment for genes using only AGA/AGG codons to encode arginine. ................................ ................................ ................................ ............ 163 A 1 Genes increased in RPFs in tcs2 ................................ ................................ ... 165 A 2 Genes reduced in RPFs in sua5 ................................ ................................ ..... 171 A 3 ORFs in BY4742 with potential fr ame shifts. ................................ .................... 175 A 4 ORFs in sua5 shifts ................................ ........................ 178 A 5 Genes with evidence of read through BY4742 ................................ ................. 186 A 6 Genes with evidence of read through in tcs2 ................................ ................ 189 A 7 Initiation at upstream UUG in BY4742 ................................ .............................. 193 A 8 Initiation at upstream UUG codons in tcs2 ................................ ..................... 197 A 9 Initiation at upstream ACG in BY4742 ................................ .............................. 205 A 10 Initiation at upstream ACG in tcs2 ................................ ................................ .. 208 A 11 Initiation at upstream GUG in BY4742 ................................ .............................. 214 A 12 Initiation at upstream GUG codons in tcs2 ................................ ..................... 217

PAGE 11

11 LIST OF FIGURES Figure page 1 1 Eukaryotic translation. ................................ ................................ ........................ 28 1 2 Hypermodified bases located at position 34 and 37 throughout life. ................... 29 1 3 RNA codon table. ................................ ................................ ............................... 30 1 4 Modified bases of tRNA . ................................ ................................ ..................... 31 1 5 Additional modifications to t 6 A. ................................ ................................ ........... 32 1 6 Taxonomic distribution of the TsaC/Sua5 and TsaD/Kae1/Qri7 protein families. ................................ ................................ ................................ .............. 33 1 7 Taxonomic distribution of TsaB, TsaE, TsaC, and TsaD.. ................................ .. 34 3 1 HPLC nucleoside analysis of H. volcanii H133 (wt) and pcc1 . ......................... 75 3 2 HPLC nucleoside analysis of wild type S. cerevisiae and mutants. .................... 76 3 3 Potential dual transl ational starts of SUA5 . ................................ ........................ 77 3 4 Fluorescence microscopy of Kae1 GFP, Qri7 GFP, and Sua5 GFP chromosomal fusions. ................................ ................................ ......................... 78 3 5 Localization of Sua5 GFP in trans in wild type BY4741 ................................ .... 79 3 6 Localization of Sua5 GFP in trans in sua5 . ................................ ..................... 80 3 7 Distribution of genes for biosynthesis of t 6 A and derivatives . ............................. 81 3 8 Diversity in the synthesis of the universal tRNA modification t 6 A. ....................... 82 3 9 Alignment of the TsaC domain from representative eukaryotes. ........................ 83 4 1 HPLC analysis of digested nucleotides from tRNAs harvested from D. radiodurans wild type and mutants. ................................ ............................... 95 4 2 Phylogenetic tree o f IleRS. ................................ ................................ ................. 96 4 3 Whole genome codon usage of A) D. radiodurans , B) E. coli , C) S. mutans , and D) H. volcanii . ................................ ................................ .............................. 97 4 4 HPLC analysis of digested tRNAs from Synechocystis tsaD . ... 98 4 5 HPLC analysis of digested tRNAs from S. mutans tsaE . ........................... 99

PAGE 12

12 5 1 TC AMP produced in the cytoplasm does not support mitochondrial function.. 131 5 2 Growth curves of tcs2 complementation. ................................ ....................... 132 5 3 HPLC analysis examining the relationship between mcm 5 s 2 U and t 6 A ............. 133 5 4 Expression of tRNAs or Ternary Complex does not suppress slow growth of mutations in t 6 A. ................................ ................................ ............................... 134 5 5 Summary of the purification of ribosome protected fragments. ........................ 135 5 6 Polysome profiles. ................................ ................................ ............................ 136 5 7 Ribosome profiling fragments map to open reading frames. ............................ 137 5 8 Arginine metabolism. ................................ ................................ ........................ 138 5 9 Determining ribosome frame. ................................ ................................ ........... 139 5 10 Detection of +1 frame shifting in TRM140 using ribosome profiling. ................ 140 5 11 Detection of 1 frame shifting in BDP1 in tcs2 ........ 141 5 12 Global analysis of frame shifts. ................................ ................................ ......... 142 5 13 uORFs of GCN4 . ................................ ................................ .............................. 143 5 14 Detection of upstream non AUG starts. ................................ ............................ 144 5 15 Change in bulk codon occupancy in the ribosome A , P , and E sites of tcs2 ................................ ................................ ................................ ................ 145 5 16 Decoding of ANN codons in S. cerevisiae . ................................ ....................... 146 5 17 Venn diagram of genes with increased expre ssion in mutants of tsc2 eTCTC. ................................ ................................ ................................ ............. 147 5 18 Gcn4p regulated genes identified by ChIP Chip differentially expressed in ................................ ................................ ................................ ................ 148 6 1 Anticodon nuclease that cleave tRNAs. ................................ ............................ 155 6 2 PrrC cleaves tRNA Lys between positions 34 and 35. ................................ ..... 156 6 3 The t 6 A deficient tcs4 ................................ ............. 157 6 4 Positive hybridization of a DNA probe to tRNAs in the absence of t 6 A. ............ 158 7 1 Model for cellular response to alterations in t 6 A levels. ................................ .... 164

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CELLULAR RESPONSES TO THREONYLCARBAMOYLADENOSINE (t 6 A) DEFICIENCY IN Saccharomyces cerevisiae By Patrick Charles Thiaville August 2014 Chair: Valérie de Crécy Lagard Major: Genetics and Genomics The modification of tRNA has a rich literature of biochemical analysis going back more than 40 years; however, the genes responsible for the modifications have only been recently identified. Comparative genomic analysis has allowed for the identification of the genes in bacteria, and subsequent characterization of the enzymes, responsible for the modification N6 threonylcarbamoyladenosine (t 6 A) located at position 37, adja cent to the anticodon of tRNAs. While the modification is present in all domains of life, only two of the four enzymes responsible for biosynthesis machinery are conserved. In e ukaryotes , both cytoplasmic and mitochondrial tRNAs are modified with t 6 A , and previously only the two universally conserved members of the cytoplasmic t 6 A synthesis pathway, TsaC/Sua5 and TsaD/ Kae1 /Qri7 were known. Recent progress on deciphering the t 6 A synthesis pathways has revealed that different solutions have been adopted in different kingdoms, species, and organelles, and these variant pathways are still being characterized. This investigation identified the other four proteins required for cytoplasmic synthesis (Bud32, Pcc1, Cgi121, Gon7), and determined that only Sua5 a nd Qri7 are

PAGE 14

14 required for mitochondrial synthesis of t 6 A in Saccharomyces cerevisiae . The same enzyme, Sua5, performs the first step of t 6 A synthesis in both the cytoplasm and the mitochondria. It is targeted to both the cytoplasm and the mitochondria throu gh the use of alternative, in frame AUG translational start sites. This study showed that a minimum synthesis machinery is responsible for mitochondrial t 6 A , implicating a core set of enzymes from the last universal common ancestor, LUCA. The roles of this complex modification in vivo also seem to vary. For example, t 6 A is essential in prokaryotes, but not in yeast. The causes of the observed pleiotropic phenotypes triggered by the reduction or absence of t 6 A synthesis enzymes are not yet fully understood. This work used ribosome profiling to map all translation errors occurring when t 6 A was absent. By examining ribosomal occupancy of every codon, this work indicates that t 6 A is helping rare tRNAs compete with high copy tRNAs. The complexity and diversity of the t 6 A pathway combined with the functional and evolutionary importance of this modification have made t 6 A a particularly fascinating

PAGE 15

15 CHAPTER 1 INTRODUCTION tRNAs are central adaptors in the cell, converting a nucleic acid code to an amino acid chain. As such, tRNAs lie in the heart of the translation apparatus, and the proper positioning of the tRNA anticodon ste p loop (ASL) is required for accurate and efficient translation. In all domains of life, t ranslation is a complicated, multi step process involving a plethora of proteins and RNAs taking place in three main stages: initiation, elongation, and termination. Eukaryotic T ranslation: A S ummary Eukaryotic cap dependent initiation of translation begins by forming the 80S ribosome with the initiator tRNA (Met tRNA iMet ) in the ribosomal P site base paired with the codon AUG. 1,2 This process occurs with the assista nce of a multitude of proteins diagramed in Figure 1 1 . This process begins with the binding of the 43S preinitiation complex (PIC, 40S ribosome preloaded with the ternary complex, Met tRNA iMet , and eIF2 bound with GTP) to the m 7 G cap of the mRNA and eIF4 . The 43 S ribosome then scans the 5 to the anticodon of Met tRNA iMet , Figure 1 1 . After binding of Met tRNA iMet to the AUG codon and 48S complex formation, eIF5 and eIF5b trigger the hydrolysis of eIF2 bound GTP and P i release, promoting the displacement of additional eIFs, and stimulat ing the joining of the 60S ribosomal subunit for final assembly of the 80S ribos ome. 1,2 GTP hydrolysis by of eIF5b promotes release of the 80S ribosome and initiates translation. 1,2 The ribo some is now positioned to begin elongation by accepting an amino acylated tRNA (aa tRNA), delivered by elongation factor eEF1 , into the A site . 3 After the aminoacyl tRNA is in the A site, peptide bond formation occurs rapidly with the P site

PAGE 16

16 peptidyl tRNA. 3 Following peptide bond form ation, the ribosome ratchets forward by one codon, moving the two tRNAs into the E and P sites, vacating the A site and allowing for delivery of the next aa tRNA by eEF1 1 . 3 Elongation continues until a stop codon (UAA, UGA, or UAG) enters the A site and tran slation terminates. The termination of translation is catalyzed by eRF1 and eRF3. 3 eRF1, which is functionally analogous to a tRNA, enters the A site, promotes hydrolysis of the peptidyl tRNA, release of the newly synthesized protein from the ribosome, and dissociation o f the ribosomes, tRNA, and mRNA , Figure 1 1. 3 Controlling T ranslation E rror R ates Being such a complex, multi step process, t ranslation of mRNA into protein is many times more error prone than the process of DNA replication, meaning that proteins are continually being synthesized incorrectly . 4 The errors i n these incorrect proteins arise from a variety of sources: mis acylated tRNAs, missense decoding , frame shifts, stop codon read through, and ribosome stalling. 4 The translation machinery has evolved to reduce reading frame errors an order of magnitude lower than missense errors. 5 Due to the vital role tRNAs play in translation initiation and elongati on, proper maturation of and modifications on the tRNAs are fundamental to ensuring the accuracy and efficiency of translation. tRNA M aturation and D ecoding tRNA M aturation The eventual pairing of mRNA and aa tRNA by the ribosome determines where an amino acid is inserted in a peptide chain. The cell uses several quality control steps to ensure these two substrates are correct. tRNAs are transcribed in the nucleus and

PAGE 17

17 editi ng, deamination, nucleotide additions, and nucleotide modification) prior to involvement in translation. 6 The steps in tRNA maturation introduce ma ny places where errors could occur, and the cell needs a quality control mechanism to ensure only fully mature tRNAs are used in translation. The first level of quality control for the maturation of tRNA is performed by the processing enzymes, which requir e the correct three dimensional structure of the tRNA. 6 In Eukaryotes, many of the maturation steps occur in the nucleus and are required prior to tRNA export to the cytoplasm, where introns are removed. The tRNAs undergo retrograde import back to the nucleus for final modification prior to re export to the cytoplasm for charging. 7 9 Additional quality control steps are performed by aminoacyl tRNA synthetase s (aaRS), which make extensive contact over the entire tRNA, ensuring the correct tRNA is selected and that the tRNA is mature and ready for use in translation. 10 Decoding the G enome The existence of tRNAs was 11 One would expect that a unique tRNA would decode each of the 61 possible codons. However, U, I U, I C, and I A (I for inosine) pairing is allowed between position 34 (the wobble base) of the tRNA and the third base of the codon, only 31 differe nt tRNAs are required to decode all possible codons. 11 Indeed, it was recently shown that Mycoplasm genitalium has a minimum translation apparatus with only 33 different tRNAs. 12 subsequent experiment s questioned how these simple rules could explain translation accuracy. 13 It soon became clear that modifications of tRNA were important for accurate decoding, as tRNAs harbor numerous post transcriptional modifications that fine tune

PAGE 18

18 their function. Cur rently, there are more than 90 known tRNA modifications 14 and most organisms devote more g enetic information to modifying tRNAs than to the tRNAs themselves. 15 Modification s of tRNAs have been shown to affect different aspects of th eir metabolism and interactions with the rest of the translation apparatus, 16 18 and these modifications play a key role in reducing error rates during translation. Three major steps at which tRNA modifications control error rate are: formation of ternary complex (TC), identification of AUG start sites, and elonga tion decoding efficiency, noted by red stars in Figure 1 1. Controlling Errors in I nitiation Ternary complex is composed of Met tRNA iMet and eIF2 bound with GTP . Modification of tRNA iMet has been show to increase the efficiency of formation of TC. In yeast , mutation of GCD10 eliminated the modification m 1 A 58 (methylation of the adenosine base) from tRNA iMet . Absence of m 1 A 58 reduced the levels of tRNA iMet and the efficiency of TC formation, which led to poor growth due to reduced levels of 80S ribosome. 19 Absence of m 1 A 58 also led to a defect in start site recognition. 1,2,20 The first 21 The sequence immediately surrounding the AUG helps enhance the pairing of Met tRNA iMet and the AUG codon. 22,23 Absence of m 1 A 58 increased the frequency of the PIC bypassing the first AUG. 19,20 Accurate Decoding and E longation M ost modifications occurring in the anticodon stem loop (ASL) of the tRNA are required for ac curate decoding. 24,25 In almost every tRNA, regardless of organism, , 25 and thes e two p osition s house the largest number of modifications on tRNAs , Figure 1 2 . 26

PAGE 19

19 Modifications at P osition 34 Modifications of position 34 in yeast include pseudouridine ( uridine formed by Pus1 ), inosine (I, deamination of adenosine by the Tad2/Tad3 complex), m 5 C (methylation of the C 5 carbon of the cytosine base by Trm4), G m and C m ( 2' O methylation of the ribose of guanosine and cytosine by Trm7), and t he xcm 5 U derivatives ( complex modification s of uridine requiring more than 20 proteins), 14 Figure 1 4. tRNA modifications at this position can increase efficiency and accuracy of reading frame decoding during elongation. The modification m 1 C at position 34 increases the efficiency of reading stretches of TTG codons. 27 Mutation of TRM4 , eliminates m 1 C 34 and decreases the rate of r eading of TTG stretches 10 fold. 27 Mo dification is not limited to cytosines, as some of the most complex modifications occur w hen position 34 of tRNAs contain s a U. U 34 is almost universally modified. 28 U 34 containing tRNAs decoding split codon boxes (which code for more than one amino acid, Figure 1 3) are modified to 5 methoxycarbonylmethyl (mcm 5 ) by the Elongator complex (Elp1 6) and can be further modified with a 2 thio derivative by Ncs2 and Ncs6 to form mcm 5 s 2 U in yeast. 29,30 This complex modification is essential for discrimination between His/Gln, Asn/Lys, and Asp/Glu codons . 29 Mutations in yeast of the mcm 5 subunit or the s 2 subunit show numerous pleiot ropic phenotypes, including slow growth and telomere shortening, both of which are suppressed by overexpressing of tRNA Lys UUU . 29 31 Deletion of both subunits is only viable with tRNA Lys UUU expressed in trans . 29 Recently, ribosome profiling revealed that absence of the s 2 subunit results in a non canonical activation of stress response, specifically activation of the general nutritional response activator GCN4 in a GCN2 independent ma nne r. 32

PAGE 20

20 Modifications at P osition 37 Nearly al l tRNAs contain a purine at position 37, and that purine is nearly always modified. 26,28 Modifications that can occur in yeast at position 37 include: 1 methylinosine (m 1 I, deamination of adenosine by Tad1 followed by methylation by Trm5), 1 methylguanosine (m 1 G, methylation of gua nosine by Trm5), wybutosin e (yWy , a tricyclic derivative of m 1 G formed by Tyw1 4), N6 isopentenyladenosine (i 6 A, modification of adenosine formed by Mod5), and N6 threonylcarbamoyladenosine (t 6 A , modification of adenosine), 14 Figure 1 4. Methylation of guanosine at position 37 to m 1 G is performed by Trm5. 33 Deletion of TRM5 in yeast leads to slow growth and increased +1 fram e shifts. 33,34 Presence of m 1 G is required for subsequent modification to yWy on tRNA Phe by Tyw1 4. 33,35 Absence of yWy also increases +1 frame shifts. 34,35 In yeast, the modification m 1 I at position 37 is only present on tRNA Ala . 14 Deletion of TAD1 , which deaminates adenosine to inosine, is viable and does not show a growth defec t. 36 Modification to i 6 A 37 by Mod5 increases the specific activity of the modified tRNA for its codon by 4 fold. 37 The t 6 A Modification at P osition 37 t 6 A, and its derivatives , is a complex modification of adenosine found in the ASL, next to the anticodon (t 6 A 37 , Figure 1 4 ), and is one of the few univ ersal modifi cations of the ASL . 26 The hypermodified base t 6 A is present in nearly all ANN decoding tRNAs and has been studied in vitro and in vivo for more than 40 years. 38 44 Since the first discovery of the modificatio n by Schweizer, et al. in 1969 , 43 sporadic studies laid the groundwork on the synthesis and function of this universal modification , but fell short of elucidating the biosynthetic route. Initial studies suggested that the biosynthetic pathway for t 6 A would require ATP, threonine , and carbonate. 40,42,45 47 Then, using Xenopus

PAGE 21

21 laevis oocytes, it was shown that native E. coli tRNA fMet (harboring an unmodified A 37 ) and yeast tRNA iMet transcripts are converted to t 6 A 37 , indicating the formation of t 6 A not only occurred in the cytoplasm , but used a conserved machinery. 38,39 These studies also demonstrated that A 37 and U 36 were strict determinants for t 6 A formation, and that A 38 enhances the modification efficiency. 38 Finally, structural studies showed that t 6 A enhances anticodon codon base pai ring by cross strand base stacking of the t 6 A base with the first position of the codon, 48 and influences the structure of the ASL by preventing across the loop base pairing between U33 A37, as well as stacking of bases A 37 and A 38 . 48 52 Derivatives of t 6 A Currently, there are three known derivatives of t 6 A: ct 6 A (cyclic t 6 A), m 6 t 6 A ( N 6 methyl N 6 threonycarbamoyladenosine), and ms 2 t 6 A (2 methylthio N 6 threonycarbamoyladenosine), Figure 1 5 . 14 A new twist in the t 6 A field is the recent identification of cyclic form of t 6 A or ct 6 A, a cyclized active ester of t 6 A with an oxazolone ring. 53 TcdA (previously CsdL in E. coli ) catalyzes an ATP dependent dehydration of t 6 A to ct 6 A; this reaction is performed by Tcd1 (YHR003c) and by Tcd2 (YKL027w) in yeast. 53 The harsh treatment for preparing tRNAs for LC MS/MS analysis had masked the presence of the true arrangement of t 6 A, an d ct 6 A appears to help tRNA Lys decode the noncognate codons AGA and UAG. 53 At least for E. coli , ct 6 A appears to occur on all t 6 A modified tRNAs. 53 Unlike TsaB, C, D, and E that are required to create the t 6 A modification , TcdA is not essential for E. coli ( mutation results in a minor growth defect), and is not universally conserved in bacteria. 53 Whether this represents the final functional form of t 6 A, or if this a species specific solution for a particular problem has not been addressed. Additionally, Tcd1

PAGE 22

22 and Tcd2 of S. cerevisiae localize to the outer membrane , not to the surface , of yeast mitochondria, 54 and mutations in either render cells mitochondrial deficient. 53 How yeast cytoplasmic tRNAs would be converted to ct 6 A is currently unknown. Also, neither ct 6 A, nor homologs of TcdA have been found in Archaea, and ct 6 A does not occur in humans . The second known derivative of t 6 A, m 6 t 6 A, was initially thought to only occur in E. coli on the two tRNA Thr (GGU) species that decode ACC and ACU. 55 This limited distribution of m 6 t 6 A is co nfounded by the small number of organisms for which tRNAs have been sequenced. 25 m 6 t 6 A is formed by TsaA , which tran sfer s a methyl group from S adenosylmethionine (AdoMet) to tRNA Thr (GGU) containing t 6 A. 55 E. coli YaeB was recently identified as the gene responsible for TsaA activity and renamed TrmO . 56 TrmO has a unique single sheeted barrel structure and does not belong to any known class of methyltransferases , therefore it represents a novel category of AdoMet dependent methyltransferase (Class VIII). Interestingly, t 6 A is required for the formation of the m 6 moiety at position 37 of tRNA Thr (GGU) , and in trmO , tRNA Thr (GGU) A 37 will be modified to ct 6 A, suggesting that t 6 A is a common precursor to both m 6 t 6 A and ct 6 A. 56 m 6 t 6 A does slightly improve translational efficiency at ACY codon s . 55,56 TrmO is widely distributed throughout life and cross kingdom functional analysis was performed to s how the ac tivity was conserved . The third known derivative of t 6 A, ms 2 t 6 A, is found only on tRNA Lys UUU in a subset of organisms. 14 Particularly, ms 2 t 6 A is found in B. subtilis , some Archaea, and in human s , but not in E. coli . YqeV (MtaB) in B. subtilis and Cdkal1 in human s are responsible for the insertion of the sulfur moiety and methylation at position 2 of the adenosine containing t 6 A. 57 59 MtaB has been shown to increase the accuracy of

PAGE 23

23 decoding lysine codons. 58,59 Loss of the Cdkal1 homolog in mi ce is correlated to an increase in Type 2 diabetes. 59,60 It is not clear if ct 6 A is the base to form ms 2 t 6 A, or like m 6 t 6 A, it is formed from t 6 A. Biosynthesis of t 6 A in Bacteria The first enzyme of the t 6 A pathway was discovered in 2009 when it was found that a universal protein fami ly, YrdC/Sua5 (COG009), was involved in forming the t 6 A modification. 61 This work used comparative genomic analysis to focus on universally conserved protein families of unknown function based on the assumption that as t 6 A was universally conserved, the t 6 A synthesis enzymes would also be universally conserved. At the time of this study, nine universally conserved protein families were of unknown function. The YrdC/Sua5 family was the most likely candidate due not only to universal conservation, but also to: 1) similarity to HypF which catalyzes a carbamoylation reaction, 62 which would be similar to the mechanism of t 6 A synthesis proposed in 1974 by both Elkins and K eller 40 and Körner and Söll; 42 2) mutations in the yeast yrdC ortholog SUA5 led to transla tion defects (initiation at non AUG codons); 21 and, 3) YrdC of E. coli was found to bind RNA and tRNA. 63 This prediction was experimentally validated using E. coli and S. cerevisiae . In E. coli , yrdC is essential, but SUA5 ( yrdC homolog) could be deleted from S. cerevisiae , although the growth of the muta nt is greatly affected. tRNAs analyzed from this mutant were devoid of t 6 A. The levels of t 6 A could be restored through complementation with SUA5 Sc , yrdC Ec , ywlC Bs ( B . subtilis homolog of SUA5 Sc ), and yrdC Mm ( Methanococcus maripaludis , an archaeal yrdC hom olog). These same genes could also complement the essentiality phenotype of yrdC in E. coli . 61 Analysis of tRNAs in the complemented strains confirmed the presence of t 6 A. This initial work identified

PAGE 24

24 the first gene family involved in t 6 A synthesis, established th at its function was universally conserved, and that members of the fa mily could bind ATP. A s purified YrdC alone was not sufficient to incorporate threonine into tRNA transcripts in vitro , this meant that additional enzymes were needed for t 6 A synthesis or that the role of YrdC/Sua5 fam ily was indirect. A second universally conserved family , YgjD/Kae1/Qri7 (COG0533) , involved with t 6 A synthesis, was discovered in 2011. 64 Like YrdC/Sua5, the YgjD/Kae1/Qri7 family of p roteins is universally conserved, and shar es similarity to with HypF, which harbors a fusion of YrdC like and YgjD like domains. Kae1 had first been described as a member of the KEOPS complex (Kinase, putative Endopeptidase and Other Proteins of Small size ) , 65 also known as EKC (Endopeptidase like Kinase Chromatin associated complex). 66 In parallel, a phylogeny of this family revealed that yeast harbor two members of the family. 67 The first, Kae1 , has homologs in other Eukaryotes and Archaea and the second, Qri7 , is targeted to the mitochondri a and is part of the bacterial YgjD clade, indicating that this gene is of bacteria origin and was acquired during secondary endosymbiosis. 67 The hypothesis that the YgjD/Kae1/Qri7 family was involved in t 6 A synthesis, was confirmed by extracting tRNAs from S. cerevisiae kae1 and showing they were devoid of t 6 A . t 6 A levels co uld be restored in kae1 through complementation with ygjD Ec and with a cytoplasmic targeting version of QRI7 Sc , indicating that members of the YgjD/Kae1/Qri7 family were functional homologs for t 6 A synthesis, at least in yeast. To test if YgjD/Kae1/Qri7 w ere functional homologs in E. coli , a P TET :: ygjD strain was constructed ( ygjD is only expressed when anhydrotetracycline, aTc, is added). Only the

PAGE 25

25 expression of the ygjD from E. coli in trans allowed complementation of the essentiality phenotype in the absence of aTc. In contrast to the YrdC/Sua5 complementation results, expression of the KAE1 Sc and QRI7 Sc genes from yeast, of the PRPK Mm from Methanococcus maripaludis (PRPK is a fusion of Kae1 Bud32 in Archaea) , and the B. subtilis ygjD Bs did not complement the essentiality phenotype of the absence of ygjD in E. coli . In s ummary, the protein families Y rdC/Sua5 and Kae1/Qri7/YgjD were found to be strictly required for the biosynthesis of t 6 A, a nd a homolog of at least one member of each family w as found in all domains of life, Figure 1 6 . 61,64 However, YrdC and YgjD failed to synthesize t 6 A in vitro on transcript or on t 6 A tRNA purified from yeast sua5 , 64 indicating that still more enzymes were required for t 6 A synthesis. The observation that the YrdC/Sua5 family members were functionally interchangeable between domains , 61 while YgjD/Kae1/Qri7 were not , 64 lead to a model in which t 6 A biosynthesis occurred in two steps with kingdom, species, and organelle specific partners for the second step. The identity of the remaining enzymes in bacterial t 6 A synthesis was predicted from three pieces of evidence. First, YgjD was shown to form an association network with YeaZ (a paralog of YgjD) and YjeE, based on physical interaction between the proteins and physical clustering of the genes; 64,68 second, like YrdC and YgjD, YeaZ and YjeE were essential in E. coli; 69 and third, complementation of the E. coli yjgD essentiality phenotype required expression of both B. subtilis ygjD and yeaZ homologs , suggesting that a YgjD/YeaZ interaction was necessary for t 6 A synthesis. 64 YgjD pairs from closely related organisms form complexes in vitro . 70 The final evidence that YeaZ and YjeE were the

PAGE 26

26 missing proteins in t 6 A bac terial synthesis was provided by in vitro reconstitution experiments, 71 which demonstrat ed that recombinant YrdC, YgjD, YeaZ, and YjeE proteins from E.coli 71 were collectively both necessary and sufficient to generate t 6 A in reactions with threonine, bicarbonate, ATP, and either E. coli tRNA Thr or tRNA Lys transcripts, or unfractionated tRNA from yeast sua5 . Notably, t 6 A formation was not observed when a tRNA transcript correspo nding to tRNA Gln from Methanothermaobacter thermautotrophicus , which does not naturally contain t 6 A, or a 17 mer corresponding to an unmodified ASL of E. coli tRNA Lys were used as a substrates. 71 While the former was consistent with natural lack of t 6 A in this tRNA, the latter was surprising since this ASL had previously been show to bind specifically to E. coli YrdC. 71 The t 6 A synthesis pathway was subsequently reconstituted using the B. subtilis enzymes YwlC (an ortholog of yeast Sua5), and YdiBCE (orthologs of E. coli YjeE, YeaZ, and YgjD, respectively), 72 demonstrating the universality of these enzymes in bacteria. With the newly established enzymatic role for YeaZ, YrdC, YgjD, and YjeE (and their orthologs) in the biosynthesis of t hreonylcarbamoyl 6 a denosine (t 6 A), these enzymes were renamed TsaB, TsaC, TsaD, and TsaE, respectively. 71 Project R ational e , Design, and O bjectives T he TsaE and TsaB proteins that are required for t 6 A synthesis in Bacteria have no hom ologs in Eukarya or Archaea, Figure 1 7 . The prediction of the t 6 A missing genes in these last two kingdoms came from the fact that Kae1 was part of the KEOPS /EKC complex. 65,66 We test ed if the other subunits of the KEOPS /EKC complex (Bud32, Cgi121, Pcc1, plus the fungal specific Gon7) were involved in t 6 A synthesis in the yeast cytoplasm and the model Archa ea Haloferax volcanii (Chapter 3). Additionally, we established the yeast mitochondrial t 6 A synthesis pathway (Chapter 3). With the

PAGE 27

27 biosynthetic pathway for Eukaryotes and Archaea solved, we set out to understand the function of t 6 A: first, by mapping and reannotating the genes across more than 10,000 sequenced genomes (Chapter 3), which led us to identify bacteria with the ability to live without t 6 A (Chapter 4) ; and second, performing ribosome profiling in a yeast strain devoid of t 6 A to map all translational ambiguities (Chapter 5). Finally, we attempted to improve the current methods of detection for t 6 A, so that in the future, we can begin to study t 6 A in non microbes (Chapter 6).

PAGE 28

28 Figure 1 1. Eukaryotic translation . Red star indicates experimental evidence of a tRNA modification controlling error rate . Adapted from 73 .

PAGE 29

29 Figure 1 2. Hypermodified bases located at position 34 and 37 throughout life. Position 34 listed in the top panel, position 37 in th e lower panel. Abbreviations used in the figure are consistent with modomics.genesilico.pl .

PAGE 30

30 Figure 1 3. RNA codon table. Boxes shaded in blue are decoded by N6 threonylcarbam oyladenosine (t 6 A) modified tRNAs in S. cerevisiae . Red bold indicates the split box Ser/Arg , where the two arginine codons are each decoded by a tRNA modified with t 6 A 37 . T he single AGY serine decoding tRNA is modified with N6 isopentenyladenosine (i 6 A 37 ) and decodes both Ser codons .

PAGE 31

31 Figure 1 4 . Modified bases of tRNA. A) Black circles indicate a base that could be modified in any tRNA. Red circles indicate the anticodon. The inset lists the possible modifications at positions 34 and 37 in yeast cytoplasmic and mitochondrial tRNAs. The proteins that form the modifications are also listed. B) Structure of N6 threonylcarbamoyladenosine (t 6 the anticodon.

PAGE 32

32 Figure 1 5 . Additional modifications to t 6 A.

PAGE 33

33 Figure 1 6 . Taxonomic distribution of the TsaC/Sua5 and TsaD/Kae1/Qri7 protein families. Filled circles indicate presence of the gene . Variation in distribution of TsaC and Sua5 is noted in blue for proteobacteria and in yellow for proteobacteria

PAGE 34

34 Figure 1 7 . Taxonomic distribution of TsaB, TsaE, TsaC, and TsaD. Filled circles indicate presence of the gene .

PAGE 35

35 CHAPTER 2 MATERIALS AND METHODS Strains and Growth C onditions A list of all organisms used in this study can be found in Table 2 1. Yeast strains were grown on YPD (DIFCO Laboratories) at 30 C. Synthetic minimal media, with or without agar, with or without dropout supplements ( uracil, ura; leucine, leu; histidine, his) were purchased from Clontech (Palo Alto, CA) and prepared as reco mmended by the manufacturer. Glucose (Glu, 2% w/v), Glycerol (Gly, 4% w/v), 5 fluoro orotic acid (5 FOA, 0.1% w/v) and G418 (300 g/ mL ) were used when appropriate. Yeast transformations were carried out using frozen competent cells as described by 74 with plating onto the appropriate media. The S. cerevisiae sua5 :: KanMX4 strain , VDC9100 , was created by first PC R amplifying the sua5 :: KanMX4 locus from the S. cerevisiae sua5 :: KanMX4 / SUA5 diploid , obtained from Euroscarf , with oligonucleotides flanking the allele. The PCR product was then transformed via electroporation into wild type BY4742 containing pBN204 ( SU A5 on an URA3 plasmid) . 61 Transformants were selected on SD ura plates containing G418. After passaging on uracil containing media, the strain was cured of pBN204 by counter selection with 5 FOA. Disruption of SUA5 was confirmed by PCR using oligonucleotides annealing inside and o utside of the locus, as well as inside of KanMX4 . VDC9100 was confirmed as being devoid of t 6 A using the HPLC and LC MS/MS analysis listed below.

PAGE 36

36 E. coli strains were grown in LB (1% tryptone w/v, 0.5% yeast extract w/v, and 1% salt w/v; 1.5% agar w/v wa s added for plates) at 37 °C , unless otherwise ampicillin (Ap, transformed into E. coli via electroporation. H. volcani i H133 strains were grown at 45 °C in YPC medium (per liter: 144 g NaCl 2 , 21 g MgSO 4 2 O, 18 g MgCl 2 2 O, 4.2 g KCl , and 10 mM Tris HCl (pH 7.5), 0.5% yeast extract, 0.1% peptone w/v , and 0 .1% casamino acids w/v). D . radiodurans strains were grown in TG Y media (0.5% tryptone, 0.1% yeast extract, 0.3% glucose (all % as wt/vol)), at 30 . PCR Methods For general PCRs, using either E. coli genomic DNA or plasmid DNA as a template, OneTaq polymerase (New England Biolabs, Ipswich, MA) was used according to the instructions. Yeast colony PCR was performed with LongAmp Taq polymerase (New England Biolabs). One small colony was pi cked and suspended in 1 mg/mL Zymolyase 100T. This was incubated at room temperature while preparing the PCR mix according to the instructions. 5 µL of the Zymolyase treated yeast was added to the PCR reaction. Plasmid Construction for Y east in vivo A ssays The yeast mitochondrial targeting GFP plasmid, pYX122 mtGFP , 75 was used as the backbone for p lasmid construction for microscopy . pYX122 mtGFP was digested with Eco RI and Bam HI (NEB) to remove t he preSu9 mitochondrial targeting sequence. SUA5 from BY4742 was PCR amplified using oli gonucleotides listed in Table 2 2 to create the various forms of Sua5 GFP.

PAGE 37

37 PCR products were digested with Eco RI and Bam HI and ligated into the similarly digested pYX12 2 mtGFP using T4 DNA ligase (NEB). Plasmids for complementation assays , listed in Table 2 3, were created by subcloning components from previously described plasmids. Microscopy To determine localization of Sua5 GFP, yeast were co transformed with the mit ochondrial marker pYX142 RFP and one of the Sua5 GFP constructs, and transformants were selected on SD his leu plates. For microscopy, cells were grown to mid log phase in drop out media ( his leu ) containing 1% glucose and 3 % glycerol. Cells were washed o nce with water prior to analysis at 100 x magnifications on a Leica DM IRE2 confocal microscope using MetaMorph® Microscopy Automation & Image Analysis Software (Molecular Devices, Sunnyvale, CA). Deconvolution and pseudo coloring of images was performed using MetaMorph, and final figures were constructed using Photoshop® CS6 (Adobe). Yeast Growth A ssays Growth curves were performed using a Bioscreen C MBR (Oy Growth Curves AB Ltd, Finland) at 30 C and at maximum shaking. A 250 l culture was used in each well, and 5 biological replicates were used for each condition. Yeast cultures were grown in SD his to saturation, normalized to an OD 6 00 of 1, and diluted 200 times in SD his before loading on the Bioscreen. The growth curves presented are averages of 5 biological replicates. Signi ficance was determined using a 2

PAGE 38

38 Bioinformatics A nalysis Taxonomic Distribution of G enes The taxonomic distribution of t 6 A biosynthesis genes was produced using the I nteractive T ree o f L ife (iToL, itol.embl.de). 76,77 All information for NCBI TaxIDs and presence or absence of genes was exported from the SEED subsystems : . A text file containing the NCBI TaxIDs of representative organisms was u containing the TaxID and 1 for presence or 0 for absence of the gene were uploaded to the project, bi containing the data for presence or absence of the genes was generated. Manipulation of D atasets Manipulation of large datasets was performed using UNIX commands via the Terminal application on Mac OS X. To intersect two lists to find information in common and extract additional information from the subject file, the grep command was used with the following flags. grep F f file1.txt file2.txt > outfile.txt Where, file1 is the query and file2 is the subjec t file. The result is redirected to a text file. The implementation requires that the terms in common to both files are located in the first column, and are sorted alphabetically. Conversion from fasta to tabular format and from tabular to fasta was perf ormed using the awk command.

PAGE 39

39 The following command will take a tabular file and convert it to fasta format. awk '{print ">"$1" \ n"$2}' filename.txt > filename.fa The following command will convert a fasta file to tabular. awk 'BEGIN{RS=">"}NR>1{sub(" \ n"," \ t"); gsub(" \ n",""); print RS$0}' infile.fasta > outfile.txt Annotation of G enomes Subsystems were built using the SEED 78 database to analyze the distribution of t 6 A synthesis genes. Subsystems can be accessed at open.theseed.org . On the left side of the screen, click on the pull down also be access ed through the following links: ( http://tinyurl.com/t6A Arc Euk ) and ( http://tinyurl.com/t6A bacteria ). These subsystems were also used to propagate the functional annotation for t 6 A synthesis genes to the correct gene in each genome. Codon A nalysis To examine the codon usage of whole genomes, a Java script located at bioinformatics.org/sms was modified. This modified script ta kes a fasta file containing the CDS for a whole genome and returns, for each CDS, counts of each codon and frequency per 1000 codons. Tabulation of counts and figures were performed using Excel. To find specific codons or runs of specific codons, an in hou se Perl script based on a previously published C + program was used. 61 T his program takes a fasta file and returns two results. One result is the location of any codon

PAGE 40

40 requested in the submitted fasta file. The second output returns runs of codons for each CDS, including length of the codon run and the number of occurrences of each run. Preparation of Bulk tRNA and D etection of t 6 A Extraction of B ulk tRNAs Bulk tRNA was extracted from y east cells grown in YPD to late log phase from starter cultures. Cells were pelleted by centrifugation of cultures at 5000 x g for 10 min utes at 4 °C, and then washed two times with a solution of 50 mM sodium acetate , pH 5.8. The final pellet was suspended in 50 mM sodium acetate , pH 5.8 at 3 mL of buffer per gram of cells, and transferred into 50 mL Falcon tubes (20 mL per tube ). An equal volum e of a cid buffer ed phenol ( p henol saturated with 50 mM sodium acetate , pH 5.8) was added to each cell solution and shaken at 1 00 rpm overnight at room temp erature (RT) . The following day , the phenol extractions were centrifuged at 5000 x g for 20 minutes at RT . The aqueous layer was transferred to a clean tube and an equivalent volume of acid buffer ed phenol was added, mixed for 2 minutes at RT , and centrifuge d for 20 min utes at 5000 x g at RT . The supernatant was transferred to a clean tube and an equal v olume of chloroform was added , mixed for 2 minutes at RT , and centrifuge d for 20 minutes at 5000 x g at RT. The supernatant was removed to a clean tube , and sodium chloride was added to a final concentration of 1M and 0.2 volumes of isopropanol were added. The sample was mixed well, incubate d at 20 °C for one hour to allow for selective precipitation of genomic DNA and long RNA s , and centrifuged for 20 minutes at 8000 x g at 4 °C. The supernatant was transferred to a new tube and 0.6 volume s of isopropanol was added to it and

PAGE 41

41 incubated at 20 °C for overnight. The sample was c entrifuge d for 20 minutes at 8000 x g at 4 °C, the supernatant was discarded , and the pellet was washed with 20 mL of 80% ethanol. The sample was c entrifuged for 10 minutes at 8000 x g at 4°C, the supernatant was discarded , and the pellet was dried in a CentriVap Concentrator (Labconco, Kansas City, MO) for 30 minutes at 40 °C. The pellets were suspended into 100 µ L to 1 mL TE (1 mM Tris HCL, pH8, 0.5 mM EDTA, pH 8). H. volcanii H133 a pcc1 were grown in 4 L YPC medium (4 L) at 45 °C and 180 rpm until the OD 600 reached 0.8. (Halohandbook Mike Dyall Smith, 2004 page 15 ( http://www.haloarchaea.com/resources/halo handbook/ ). Bulk tRNA was prepared by double phenol/chloroform extraction described above. 79 D . radiodurans was subcultured 1:100 from a starter cult ure into 1 L TGY media and grown at until the culture reached late log at an OD 600 of 2.5. The cells were harvested by centrifugation at 8000 x The weight of the cell pellet was determined, and the cells were suspended in 0.1 volumes of 95% ethanol to remove the S layer. The cells were then harvested by centrifugation, as before and the pellets were s uspend ed in 50 mM sodium acetate , pH 5.5 at 3 mL/g of cell weight . Zymolyase was added to a final concentration of 10 µg /mL and the samples were incubated at 37 for 30 minutes . Following the incubation, volume of acidic buffered phenol (pH 5.5) , equal to the amount of 50 mM sodium acetate added previously , was added and the sample was incubate d at 70 The s ample was then cooled to room temperature prior to centrifugation at 4000 x g for 10 minutes at RT . The

PAGE 42

42 aqueous layer was transferred to a new tube, and an equal volume of 25:24:1 acidic buffered phenol (pH 5.5):chloroform:isoamyl alcohol was added , mix ed , and the sample was centrifuged again at 4000 g for 10 minutes at RT. T he aqueous phase was transferred to a new tube, and to it, an equal volume of chloroform was added, mixed, and the sample was centrifuged again . The aqueous phase was transferred again, and to it, sodium chloride was added to a final concentration of 1 M and 0.2 volumes of isopropanol were added. The sample was mixed well, incubate d at , and c entrifuge d at 8 000 x g for 20 minutes at 4 The supernatant was transferred t o a new tube, and 0.6 volume of isopropanol was added to the supernatant, and the sample was incubated overnight at 20 , the samples were allowed to warm on ice for 10 minutes prior to centrifugation at 8 000 x g for 20 minutes at 4 The pellet was washed with 20 mL of 80% v/v ethanol, and centrifuge d at 8000 x g, before drying the pellet in a CentriVap Concentrator (Labconco, Kansas City, MO) for 30 minutes at 40 °C . The final pellets were suspended in 200 µL TE and stored at 20 All tRNA extractions were performed in triplicate from independent cultures. Analysis of tRNA by Denaturing 8 M U rea PAGE. Conc entrations of tRNA preparations were determined with Nanodrop, and quality of the tRNA preparations was analyzed with denaturing polyacrylamide gel electrophoresis (PAGE). 400 µg of tRNA was mixed with loading buffer ( 95% f ormamide ; 1mM Na 2 EDTA; 0.025% bromophenol and xylene cyanol) and the tRNA was resolved on 12 % acrylamide gel s contain ing 8

PAGE 43

43 M urea . The running buffer was TBE (89 mM Tris; 89 mM Boric Acid; 2.5 mM Na 2 EDTA) . The gel s were stained with toluidine blue ( 1 g/L toluidine blue, 40% methanol v/v, and 1% acetic acid v/v) and d e stained with water. Bulk tRNA Digestion for LC MS/MS A nalysis Nucleoside preparations were prepared by incubating 100 µg of linearized bulk tRNA with 10 units of Nuclease P1 (Sigma) in 10 mM ammonium acetate (pH 5.3) overnight at 37°C. The next day, 0.1 volume of 1 M ammonium bicarbonate (pH 7.0) was added to give a final conc entration of 100 mM ammonium bicarbonate . 0.01 units of p hosphodiesterase I (Sigma) and 3 µL E. coli alkaline phosphatase (Sigma) were added, and the samples were incubated for an additional 2 hours at 37 °C. The hydrolyzed nucleosides were further purified by filtering through a 5 kD M W CO filter (Millipore) (to remove enzymes), dried in a CentriVap Concentrator , and suspended in 20 µL of water prior to analysis by HPLC or LC MS/MS. HPLC and LC MS/MS Analy sis t 6 A was detected by HPLC as described by 80 using a Waters 1525 HPLC with Empower 2 software and detected with a Water 2487 UV vis spectrophotometer at 254 nm or 313 nm for thio derivatives. Separation was performed on an Ace C acetate (B uffer A) and 40% acetonitrile (Buffer B) run at 1 mL/min. 100 µg of nucleosides were injected and separated using a isocratic complex step gradient, Table 2 4. Levels of t 6 A were measured by integrating the peak area from the extraction ion chromatograms. The modified base/m 2 2 G was used to

PAGE 44

44 normalize for tRNA concentration across samples. Levels for mutant strains were expressed relative to wild type levels. Results were confirmed by LC MS/MS at the Donald Danforth Plant Science Center , St. Louis MO, as described in 61 . The MS/MS fragmentation data , as well as a t 6 A standard provided by D. Davis (University of Utah) were also used to confirm the presence of t 6 A. Ribosome P rofiling P reparation of P olysome s Two biological replicates of the parental BY4742 strain and sua5 were grown by diluting 1:50 from a preculture into 500 mL YPD in an Erlenmeyer flask. Once each culture reached an OD 600 0.6, the flask was placed on ice, and cyclohexamide was added to a final concentration of 50 µg/mL. The cyclohexamide treated cultures were incubated on ice for 10 to 15 minutes to immobilize the ribosomes in their place on the mRNA. The cells were then harvested by centrifugation at 4,000 x g for 5 minutes at 4 ° C. The supernatants were discarded, and each pellet was suspended in 14 mL of cold lysis buffer (1X Lysis buf fer prepared from 10X solution of 1 mM Tris HCl , pH 7.4 , 100 mM NaCl 2 , 30 mM MgCl 2 , and 50 µg / mL cycloheximide ) and transferred to a 15 mL conical tube. The samples were centrifuged at 4,000 x g at 4 °C for 5 minutes, the supernatants discarded, and the pellets suspe nded in 2X volume per gram pellet of cold lysis buffer . The lysis solution was transferred to 15 mL tubes, with 3 mL in each tube. One equivalent volume of glass beads was added to each tube, and the samples were vortexed 10 times for 15 seconds each, with a 15 second interval on ice between each vortex round. The samples were centrifuged at 4,000 x g at 4 °C for 5 minutes, the supernatants were transferred to new

PAGE 45

45 tubes, and these were centrifuged at 10,000 x g at 4 °C for 10 minutes) . The supernatant s were transferred into new tubes, and the A 260 was measured. The polysomes were aliquoted at approximately 40 50 OD 260 units per tube and rapidly frozen in liquid nitrogen and stored at 80 ° C . Purification of M onosomes Polysome extracts were digested for 1 ho ur at room temperature with 15 units RNaseI (Ambion) per OD unit. The digested polysomes were purified on sucrose gradients prepared by casting the sucrose gradients ( 31% sucrose , 50 mM Tris acetate pH 7.6, 50 mM NH 4 Cl , 12 mM MgCl 2 , and 1 mM DTT ) with three freeze thaw cycles. The samples were loaded on the gradients and centrifuged in a Beckman SW41 rotor at 39,000 rpm at 4 ° C for 3 hours. Monosome fractions were collected using an ISCO (Teledyne, Lincoln, NE) instrument at a 0.5 mL/min flow rate. Th e chromatography profile of the monosomes should have a major peak first, corresponding to cellular debris, followed by two small peaks for the 40S and 60S units, a large peak corresponding to the monosomes and small peaks representing the disomes, trisome s, etc. The fractions containing the monosomes were collected in 2 mL tubes and stored at 20 ° C . Purification of RNA With P henol The monosome fractions were thawed and two fractions for each sample were pooled to give a volume of 900 in a 1.5 mL tube. One equivalent volume of acid phenol (unbuffered) was added to each tube, and the samples were shaken vigorously for 1 hour at 65° C. The phenol treated samples were centrifuged at 13,000 x g for 10 minutes at room temperature. T he aqueous

PAGE 46

46 phase (the lower phase) was collected and an equal volume of chloroform was added, vortexed for 1 minute, and centrifuged again at 13,000 x g for 10 minutes. The aqueous phase (top layer) was collected and pooled for each sample into a 15 mL tube (no more than 3 mL per tub e). 300 (0.1 volumes ) of 1 M sodiu m acetate, pH 5.5 was added along with 3 volumes of 100% ethanol . The samples were mixed and precipitated overnight at 20 °C. In this way , proteins and rib osomes were removed with phenol/chloroform, and the RNA was p ur ified by precipitation by the treatment of alc ohol and acetate . The RNA samples were centrifuged at 4 °C at 10,0 00 x g, the supernatants were removed, and the samples were re centrifuge , and the residual supernatants were removed again. The RNA pellet was dried, and the dried pellets were s uspended in 75 with 5% v/v Superase IN (Ambion) . The samples were pooled and the concentration was measured by Nanodrop. The RNA was stored at 20 ° C . Selection of Fragments of 28 N ucleotides by PAGE The 28 nucleotide RNA fragments were selected on 15% acrylamide gels containing 7 M urea. A 28 nt RNA oligonucleotide (oNTI 199 5' AUGUACACGGAGUCGACCCGCAACGCGA 3') was used as a marker for the correct size. To prepare the samples for the gel, 15 µg of each RNA pool was diluted in 1X volume of RNA sample buffer (2X stock, 95% formamide, 0.025% SDS, 0.025% bromophenol blue, 0.025% xylene cyanol, 0.5 mM EDTA). The RNA was denatured by heating at 70 ° C for 3 minutes, followed by placing the tubes immediately on ice . The RNA was loaded on the gel and migrated at 200V . After migration, gels were incubated for 30 min utes in a 10 % solution of SYBR Gold (Life Technologies) (For 100 mL of solution , 10 luted SYBR Gold in

PAGE 47

47 100 mL TAE) . The gel was placed on a U V lamp at 300 nm , and the strip corresponding to the 28 nt fragment was excised. In patterns obtained by extraction of RNA from yeast, an intense band of rRNA above and below the 28 nt mark are observed, and the band is cut from between the rRNA bands . Th e excised gel fragments were placed in a 1.5 mL tube and rapidly frozen at 20 ° C. G el E xtraction of RNA The bottom of a 1.5 mL tube was pierced with a 20G syringe needle , and the tube was placed into a 2 mL tube . The excised g el pieces were loaded into t he pierced 1.5 mL tubes, and centrifuged for 1 minute at 16,000 x g to collect the gel and the RNA in the 2 mL tubes. The samples were suspended in 250 µL extraction buffer (300 mM NaOAc, pH 5.5, 1 mM EDTA), and the tubes were rotated on a tube rotator ove rnight at 4°C. The samples were transferred to Spin X Centrifuge Tube Filters (Costar), and centrifuged for 1 minute at 16,000 x g. quid was typically recovered . If more than 300 µL was recovered, the sample was split i nto two 1.5 mL tubes. 1 glycogen and 2.5 volume s of 100% ethanol were added to each tube . The RNA was precipitated overnight at 20 °C . The precipitated R NA was centrifuged at 16,000 x g for 30 minutes at 4 °C, and the supernatant was discarded. The RNA pellet was dried and suspended in 20 µL of water with 5% Superase IN. The 28 nt fragments of RNA were stored at 20 ° C. Depletion of rRNA C ontamination Ri bosome protected fragments (RPFs) were depleted of major rRNA contamination by subtractive hybridization. 15 µg of RNA was mixed with 250 pmol of biotinylated oligonucleotides (Table 2

PAGE 48

48 slowly cool to room temperature. Th e biotinylated oligonucleotides were recovered by reacting with 1 mg MageneShere Paramagnetic streptavidin particles (Promega). The supernatants containing the RPFs were recovered and the RNA was precipitated, as described above. RNA size and quality was c hecked with a Small RNA Chip on a Bioanalyzer 2100 (Agilent). Library P reparation and S equencing Sequencing libraries were prepared by IMAGIF (Centre de Recherche de Gif www.imagif.cnrs.fr) Gif sur Yvette, France. Directional RNA Seq library preparation was carried out with the TruSeq Small RNA Sample Prep Kit (Illumina) and the v1.5 sRNA 3' Adaptor (Illumina) according to the (Agilent). Sequencing was performed at the Microarra y and Genomic Analysis Core Facility at the University of Utah Huntsman Cancer Institute. An equimolar amount of each library ( 2 replicates for BY4742 and sua5 ) was loaded on a single lane of an Illumina HiSeq 1500 and subjected to a 50 cycle run. Post se quencing analysis to identify differential expression, frame shifts, read through, and non AUG starts was performed by Rachel Legendre at Institut de Génétique et Microbiologie, Université of Paris Sud, Orsay, France . Functional Classification of Genes Li sts of genes produced from the above analysis were analyzed using Yeastmine 81 , an interactive database for querying the Saccharomyces Genome Database (SGD, www.yeastgenome.org ) to produce Gene Ontology enrichments and pathway enrichments. Blast 2Go 82 was used to assess Bacteria classification of gene function.

PAGE 49

49 Table 2 1. Strains used in this study Strain Name Relevant Characteristics Reference Saccharomyces cerevisiae BY4741 MATa his3 leu2 met15 ura3 Euroscarf BY4742 leu2 lys2 ura3 Euroscarf BY4743 his3 leu2 lys2 met15 ura3 Euroscarf YDL104c GFP BY4741 QRI7 GFP Invitrogen YGL169w GFP BY4741 SUA5 GFP Invitrogen YKR038c GFP BY4741 KAE1 GFP Invitrogen Y24536 BY4743 :kanMX4/SUA5 Euroscarf Y03801 BY4741 qri7 Euroscarf VDC5563 BY4741 kae1 64 Y06725 BY4741 kae1 Euroscarf Y07104 BY4741 ::kanMX4 Euroscarf Y07017 BY4741 gon7 Euroscarf 15914 BY4741 bud32 OpenBio VDC9100 BY4742 ::kanMX4 This Study 2742 BY4741 elp3 OpenBio 4610 BY4741 tad1 OpenBio 559 BY4741 trm9 OpenBio 7242 BY4741 ncs2 OpenBio 4577 BY4741 ncs6 OpenBio Haloferax volcanii VDC9113 / H133 83 VDC9114 pcc1 :: trpA 84 VDC9115 H133 pcc1 :: trpA 84 Streptococcus mutans UA159 Wild type 85 JB409 brpB ; Km r 85 JB409c brpB (pDL278: brpB ); Km r , Spc r 85 Escherichia coli F gyrA 462 endA recA ) mcrB mrr hsdS 20(rB , mB ) supE 44 ara 14 galK 2 lacY 1 proA 2 rpsL 20(SmR) xyl leu mtl 1 Invitrogen Deinococcus radiodurans R1 Wild type (ATCC13939) 86 XYD ygjD :: aph ; Km r 86 XYZ yeaZ :: aad ; Spc r 86 WDZ ygjD :: aph yeaZ :: aad ;Km r , Spc r 86

PAGE 50

50 Table 2 2. Plasmids used in this study Plasmid Description Source or Reference tM(CAU)O2 tRNA overexpression vector; Ap r , LEU2 Gift from S. Leidel tK(CUU)G1 tRNA overexpression vector; Ap r , LEU2 Gift from S. Leidel tN(GUU)C tRNA overexpression vector; Ap r , LEU2 Gift from S. Leidel tE(UUC)U tRNA overexpression vector; Ap r , LEU2 Gift from S. Leidel tK(UUU)L tRNA overexpression vector; Ap r , LEU2 Gift from S. Leidel tI(AAU)G tRNA overexpression vector; Ap r , LEU2 Gift from S. Leidel pRS425 yeast shuttle vector; Ap r , LEU2 87 pYX142 mtRFP mitochondrial targeting RFP driven by TPI; Ap r , LEU2 Gift from Delhodde pYC EcoPrrC E. coli prrC cloned in pYC vector; Ap r , LEU2 88 pPCT006 pYX122 mtGFP digested with EcoR I/ BamH I to drop out FoATPase mitochondria targeting sequence and clone a 5' truncated sua5; fuses Sua5p with GFP; Ap r , HIS3 This Study pSD64 tRNA Thr(IGU) cloned with the 5' and 3' regulatory sequences of tRNA His(GUG) in a LEU2 2u plasmid (MAB13); Ap r , LEU2 89 pEKD9021 Native tRNA with UCU anticodon cloned into LEU2 2u plasmid (AVA577); Ap r , LEU2 89 pABY525 pRS425; Ap r , LEU2 90 pABY1604 tRNA Lys UUU cloned into pRS425; Ap r , LEU2 90 YC plac111 Control plasmid for prrC study; Ap r ; LEU2 88 pRS415::Gamma toxin K. lactis Gamma toxin cloned into pRS415; Ap r , LEU2 88 pYC EcoK46A E. coli prrC cloned into pYC; K46A substitution rendering non toxic; Ap r ; LEU2 88 pPCT007 reverse PCR of pTetrHASUA5 from H. True using oligos 153 and 154, religated at ClaI site and restores Bam HI and Not I. For expression by TetR. Use Dox to repress expression; Ap r ; TRP1 This Study pPCT037 pPCT007 with prrC Ec K46A (non functional PrrC) fused with HIS3 for insertion into TRP1 locus. prrC expressed under control of P TET ; Ap r , HIS3 , TRP1 This Study pPCT038 prrC Ec HIS3 fusion cloned into Bam HI/ Not I site of pPCT007. For insertion into TRP1 locus; prrC expressed under control of P TET. Two mutations: S220P, S252G (Non toxic in yeast); Ap r , HIS3 , TRP1 This Study

PAGE 51

51 Table 2 2. Continued pPCT039 prrC Ec HIS3 fusion cloned into Bam HI/ Not I site of pPCT007. For insertion into TRP1 locus; prrC expressed under control of P TET. Two mutations: P109S, E303G; HIS3 truncated (non functional) Ap r , TRP1 This Study pPCT040 prrC Ec HIS3 fusion cloned into Bam HI/ Not I site of pPCT007. For insertion into TRP1 locus; prrC expressed under control of P TET. One mutations: N289S; HIS3 truncated (non functional); Ap r , TRP1 This Study pRS415::PaT Pichia acaciae toxin in pRS415; Ap r , LEU2 88 pPCT004 First 70 bp of SUA5 cloned into Eco RI/ Bam HI sites of pYX122 mtGFP to create a Sua5 GFP fusion protein; Ap r , HIS3 This Study pPCT060 HIS3 from pYX122 cloned into Nae I/ Eco RI sites of pPCT007; Ap r , HIS3 This Study pPCT030 SUA5 ATG1 subcloned from pPCT019 into Eco RI/ Bam HI sites of pYX122 mtGFP to create of Sua5 M1 GFP fusion protein; Ap r , HIS3 This Study pPCT025 SUA5 subcloned from pPCT017 with Eco RI/ Bam HI into pYX122 mtGFP to create a Sua5 GFP fusion protein; Ap r , HIS3 This St udy pPCT036 First 70 bp of SUA5 with second ATG altered to CTG to create Sua5 (M10L) GFP fusion; Ap r , HIS3 This Study pBN204 SUA5 in pYES; SUA5 is expressed under control of P GAL ; Ap r , URA3 61 pPCT066 Short SUA5 from pPCT006 cloned into Eco RI / Eco RV sites of pRS313; Ap r , HIS3 This Study pPCT070 GAL promoter from pBY137(pYES) ligated into XbaI/SmaI sites of pPCT066; Low copy yeast plasmids with short SUA5 behind the GAL promoter; Ap r , HIS3 This Study pPCT076 Site directed mutagenesis of pBY176 ( SUA5 +200up in pRS313) to mutate first AUG of SUA5 to CU G to create Sua5 M1L ; Ap r , HIS3 This Study pPCT078 Site directed mutagenesis of pBY176 ( SUA5 +200up in pRS313) to mutate the second AUG of SUA5 to create Sua5 M10L ; Ap r , HIS3 This Study pUC19 E. coli cloning vector; Ap r 91 pRS313 Yeast shuttle vector; HIS3 87 pYX122 mtGFP Mitochondrial targeting GFP plasmid; Ap r , HIS3 75

PAGE 52

52 Table 2 2. Continued pPCT004 pYX122 mtGFP:: first 70bp of SUA5 cloned as Eco RI/ Bam HI fragment This study pPCT006 pYX122 mtGFP:: 5' truncated SUA5 cloned as Eco RI/ Bam HI fragment This study pPCT017 pUC19:: SUA5 cloned as Eco RV fragment This study pPCT019 pUC19:: SUA5 (M10L) cloned as Eco RV fragment This study pPCT025 pYX122 mtGFP:: SUA5 subcloned from pPCT017 as Eco RI/ Bam HI fragment This study pPCT030 pYX122 mtGFP:: SUA5 (M10L) subcloned from pPCT019 as Eco RI/ Bam HI fragment This study pPCT036 pYX122 mtGFP:: first 70 bp of SUA5 (M10L) cloned as Eco RI/ Bam HI fragment This study pPCT066 Sua5 (10 426) subcloned from pPCT006 as Eco RI/ Sma I fragment into pRS313 treated with Eco RI/ Eco RV This study pPCT074 GAL :: tsaC subcloned from pBY135 as Spe I/ Pme I fragment into pRS313 digested with Spe I and Eco RV This study pPCT075 GAL :: ywlC subcloned from pBY137 as Spe I/ Pme I fragment into pRS313 digested with Spe I and Eco RV This study

PAGE 53

53 Table 2 3. Oligonucleotides used in this study rRNA depletions oligonucleotides 25SLNA* 5BioTEG/GACPCCTZATTLGTETCLATC rRNA 1 5BioTEG/TGATGCCCCCGACCGTCCCTATTAATCATTAC GACCAAGTTTGTCCAAATTCTCCGCTCTGAGA rRNA 2 5BioTEG/GCTAGCCTGCTATGGTTCAGCGACGCCACAA CTGATCAAATGCCCTTCCCTTTCAACAATTTCACG rRNA 3 5BioTEG/TTCCAGCTCCGCTTCATTGAATAAGTAAAGAA CTATTTTGCCGACTTCCCTTATCTACATTATTCTA rRNA 4 5BioTEG/ATGTCTTCAACCCGGATCAGCCCCGAAGACTT ACGTCGCAGTCCTCAGTCCCAGCTGGCAGTATTCCCAC AG rRNA 5 5BioTEG/ATTCTATTATTCCATGCTAATATATTCGAGCAA GCGGTTATCAGTACGACCTGGCATGAAAAC rRNA 6 5Bi oTEG/AGCTGCATTCCCAAACAACTCGACTCTTCCCC CACTTCAGTCTTCAAAGTTCTCATTTTTATTCTACACCCT CTATGTCTCTTCACA Probes for Northern Blots >Sc_cyto_Ile_IAU_ACL CCCCGCGTTATTAGCAC >Sc_cyto_Ile_IAU_ACL CCCCGCGTTATTAGCAC >Sc_cyto_Ile_IAU_TPC GCGGGATCGAACCGC > Sc_cyto_Ile_IAU_TPC GCGGGATCGAACCGC >Sc_cyto_Ser IGA_ACL AAAGATTTCTAATCTTTCGCC >Sc_cyto_Ser IGA_TPC GCAGGATTTGAACCTGC >Sc_mito_Ile GAU_ACL TTTGTACCTTATCAAAATAC >Sc_mito_Ile GAU_TPC CTAACAGGGATTGAACCTA Oligonucleotides for PCR > Bud32_5' deletion check GGCCAATGCCACTTTCTTCC >Bud32_5'+RBS GTAGTGATGAGTTGTTGAGCTTTC >Bud32_inside 3' CTGAGCCCAGACCGAAATCA >Bud32_inside 5' CGGAGGGCACGGTTTTAGTA >Bud32_outside 3' CAATAACTCGGACACGCTTTGATGG >Bud32_outside 5' GCGCATCACCAACTTGAAGG > Bud32 dn45 KanMx4 TATTATGTGCAGCGATATACAGGCAGTACGCTAGCATTT ATATCGATGAATTCGAGCTCG >Bud32 up45 KanMx4 TGATGAATACGACAGCGGAAAAGGTTATACGCTTTGCT CATTCGTACGCTGCAGGTCGAC >Cgi121_5'+RBS CCATTTGCATAGGTGAATGAAAC >Cgi121_inside 3' TGTGTTTCTGGTGAGGCTGT >Cgi121_inside 5' GACCCCCGGTTAGTCTGTTC >Cgi121_outside 3' ACACTGACTTCACGGAGAACA >Cgi121_outside 5' CATGTTTAATCTTTTGCGCGAA >D rad_TsaB_in 3' CCTCATAGACCGCGCTATACAC

PAGE 54

54 Table 2 3. Continued >D rad_TsaB_in 5' CCCTCTTTCTGTGACCCTCG >D rad_TsaB_out 3' CAAGATTTCGTTCGGTGAAGGTG >D rad_TsaB_out 5' TTTGGCAATGTTCGACATAGTGAG >D rad_TsaD_in 3' GTAAGGTGCTTGCAACTGCTC >D rad_TsaD_in 5' TCCTGGTCGCAGACGTTCAC >D rad_TsaD_out 3' CTACCAGGACTTCAACACCCAG >D rad_TsaD_out 5' GCGAGATCAGCGAGATTATCTTTG >Dr_tRNA1 met_fwd ATTCAAGCAAATCTGGGGTAAAGC >Dr_tRNA1 met_rev ACCCAGAAGAAAGTGGTGGTTC >Dr_tRNA11 ile_fwd TAAGGGGTCAAGGCGAAACTTAG >Dr_tRNA11 ile_rev GACGGAGTGGAAGACAGCTC >Dr_tRNA31 met_fwd GATATTGATGAACGTGCCGGACAG >Dr_tRNA31 met_rev GAAACCTACCGCGAGGTCAT > Dr_tRNA41 met_fwd CAAGCTGATGGACGGCTAAAAAG >Dr_tRNA41 met_rev GAACGTCCTGAGTCTGGCTTTG >Gon7_5'+RBS GCTCCTTGTCGACATTCGTAAG >Gon7_inside 3' AACAGCATCTTCGTCACCGT >Gon7_inside 5' CGCGATGACCCTCGATACAT >Gon7_outside 3' CCGGCAGGATGATTCCAAGT >Gon7_outside 5' AGTGTTACGGCCTTGTCAGG >His_pRS423_3' ACTG GCGGCCGC CGTATGCTGCAGCTTTAAATAATCG >His_pRS423_5' GTTGAAGAGTCGACTCTAGAGGTATGCCTCGGTAATGA TTTTCAT >Hvo_0652_Ext_rev CCTTCTCTTCGAGGTCGTCTTT >Hvo_0652_Ext fwd CTCGACGCTTTACATCTTCACAAT >Hvo_0652_int fwd CGAGGAAGGCGAGATAGACGAC >Hvo_0652_int rev CTACGAGGCGTATCCACGAGTTC >Kae1 ext fwd TCCATTTTGAGGATTCCTATGTGCTCG >Kae1 ext rev GCTTGCCTTGTTGCTTGCTCCC >Kae1 int fwd GCCTCGAGACACGGCAAGGC >Kae1 int rev TGTAGCCAGGCGAGGGCTCA >KanMx GCGGCCGCTTAGAAAAACTCATCGAG CATCAAATG >KanMx GCGGCCGCATGGGTAAGGAAAAGACTCACGTTTC >Pcc1_5'+RBS GGAGATAGTAAAAACAAGGGATC >Pcc1_inside 3' TCTTGTGGCTTCAAAATCGGG >Pcc1_inside 5' ATGACAAGCAAACGGGAAAAGT >Pcc1_outside 3' ATTTACACGCAACCCCAGGA >Pcc1_outside 5' TCCGATCTCTGTTCCACCCA > pCM184_inverse_1 CTATCGATACGGATCCCCCGAATTGATCCGGTAATTTA G >pCM184_inverse_2 TCATCGATACGCGGCCGCGGCCGCTAGGGCCCTGCAG GAG

PAGE 55

55 Table 2 3. Continued >PrrC_3' XbaI ATGAAAATCATTACCGAGGCATACCTCTAGAGTCGACT CTTCAAC >PrrC_5'_BamHI TACCCGGATCCCATATGGGCAAGACAC > PrrC 3' EcoRI CTATACGAATTCTCAACCATTTTTTTGTTCCT >PrrC 3' SacI CTATACGAGCTCTCAACCATTTTTTTGTTCCT >PrrC mito KpnI CTATACGGTACCGTGGGCAAGACACTCTCGGA >PrrC Start EcoRI CTATACGAATTCATGGGCAAGACACTCTCGGA >pYX Flank 3' GCGAATTGGAGCTAGACAAAGAC >pYX seq1 GGATGGTGCGCTTGCTGACC >pYX seq2 GAGAGACCACATGGTCCTTC >pYX seq3 CTCTTGGAAACTGGCGACTCTG >pYX seq4 CGCTTACAATTTCCTGATGCGG >pYX TPI_flank 5' CCTTTGGCTCGGCTGCTGTAAC >Qri7_dn 3' GACTAGGAGCTCCGAAGAAGGAATAATGACCAAGTTG >Qri7_dn 5' GACTAGGAATTCAGCGGCCGCCTGTACATATTATATGC AGCGCTC >Qri7_up 3' GACTAGGAGCTCAGCGGCCGCGTTTCTATCCTTTCTTC TACTCTAC >Qri7_up 5' GACTAGGAATTCCGGTCCTGGTTCTAAGAACGATAATC >Qri7 ext fwd TGGTTGGAAGATGCAGGCGCT >Qri7 ext rev AAGGCGTCGTGCCGCTCATC >Qri7 int fwd GGCAGAGGCG TGCATTCAAC >Qri7 int rev CAATTCCTTCTCTCGCATTG >SUA5_3' HindIII GCAATAAAGCTTTTAAAACTGTATACAATTATTTGCAGC >Sua5_5'+RBS CACAAGTGTAAACCATATGAATGGG >SUA5_ATG 1_5' EcoRI GCAATAGAATTAATGTACCTTGGACGACATTTTTTGGCA CTG >SUA5_ATG 2_5' EcoRI GCAATAGAATTAATGACATCGAAAGCACTGTTTG >SUA5_ATG 3_5' EcoRI GCAATAGAATTAATGAAGTATAGACACTATTCCCC >Sua5_BamHI CGTAAGGGATCCAAACTGTATACAATTATTTGCAGC >Sua5_long EcoRI GACTTCGAATTCATGTACCTTGGACGACATTTTTTG >Sua5_M10L_3' CCTTGGACGACATTTTTTGGCACTGACATCGAAAGCAC >Sua5_M10L_5' GTGCTTTCGATGTCAGTGCCAAAAAATGTCGTCCAAGG >Sua5_M1L_3' GTCCTGTTTATTATTCCATTTTTAGAATTGTCTGTACCTT GGACGACA >Sua5_M1L_5' TGTCGTCCAAGGTACAGACAATTCTAAAAATGGAATAAT AAACAGGAC >SUA5_mito GATCCTGGGTTAACTTTTAAGA TCTTGGTATCAAACAGT GCTTTCGATGTCAGTGCCAAAAAATGTCGTCCAAGGTA CATG >Sua5_mito target GATCCTGGGTTAACTTTTAAGATCTTGGTATCAAACAGT GCTTTCGATGTCATTGCCAAAAAATGTCGTCCAAGGTAC ATG >Sua5_short EcoRI GACTTCGAATTCTTGGCAATGACATCGAAAGCACT

PAGE 56

56 Table 2 3. Continued > Sua5_start GTATGTACCTTGGACGACATT >SUA5_wt_5' EcoRI GCAATAGAATTAATGTACCTTGGACGACATTTTTTG >Sua5 ext rev GACGCCCAACCCTATTGAG >Sua5 Int fwd GCAGCGCTAGTTGAAGCGGC >Sua5 int rev ACCTTGCACGCTCCGCCATC >SUA5 mito AATTCATGTACCTTGGACGACATTTTTTGGCACTGACAT CGAAAGCACTGTTTGATACCAAGATCTTAAAAGTTAACC CAG >SUA5 mito target AATTCATGTACCTTGGACGACATTTTTTGGCAATGACAT CGAAAGCACTGTTTGATACCAAGATCTTAAAAGTTAACC CAG >Sua5 Reversion 3' TATAAAATCTCCGTAATCAGTGGTTATGATTTTCAAAAGT TAATCACAGTTTTATTTAAAACTGTATACAATTAT >Sua5 Reversion AACCTGTTTCCATTTTTAATGGTAGTCCTGTTTATTATTC CATTTTTAGAATTGTATGTACCTTGGACGACATTT >Sua5 Reversion cyto AACCTGTTTCCATTTTTAATGGTAGTCCTGTTTATTATTC CATTTTTAGAATTGTATGA CATCGAAAGCACTGTT >Sua5 test_3' CCTCCAAGACCATAAACAGTTTCG >Sua5 test_5' CCAGAAGATAGTAACCTCATCGCA >Ura3_5'_up150 GCGGCCGCCGGTAATCTCCGAACAGAAG >Ura3 GCGGCCGCTTAGTTTTGCTGGCCGCATCTTCTC >Ura3 GCGGCCGCATGTCGAAAGCTACATATAAGGAAC >VNG_2045G C ACTGCTGGATCC CTACGCCGTCTCGGGGTCGTC >VNG_2045G N CGTTGACATATGCGGGAGGCGATCCCCGCAG >VNG_2312C_C ACTGCTGGATCCTCAGGCGTGCTCGGCCAGCCAC >VNG_2312C_N CGTTGACATATGAGTACGGACGACGCCCTG KanMx GCGGCCGCTTAGAAAAACTCATCGAGCATCAAATG KanMx GCGGCCGCATGGGTAAGGAAAAGACTCACGTTTC Sua5_BamHI CGTAAGGGATCCAAACTGTATACAATTATTTGCAGC Sua5_long EcoRI GACTTCGAATTCATGTACCTTGGACGACATTTTTTG Sua5_mito target GATCCTGGGTTAACTTTTAAGATCTTGGTATCAAACAGT GCTTTCGATGTCATTGCCAAAAAATGTCGTCCAAGGTAC ATG Sua5_start GTATGTACCTTGGACGACATT SUA5_wt_5' EcoRI GCAATAGAATTAATGTACCTTGGACGACATTTTTTG Sua5 ext rev GACGCCCAACCCTATTGAG Sua5 Int fwd GCAGCGCTAGTTGAAGCGGC Sua5 int rev ACCTTGCACGCTCCGCCATC SUA5 mito target AATTCATGTACCTTGGACGACATTTTTTGGCAATGACAT CGAAAGCACTGTTTGATACCAAGATCTTAAAAGTTAACC CAG Sua5(10 424) EcoRI GACTTCGAATTCTTGGCAATGACATCGAAAGCACT SUA5(M10L)_5' EcoRI GCAATAGAATTAATGTACCTTGGACGACATTTTTTGGCA CTG

PAGE 57

57 Table 2 3. Continued SUA5(M10L) mito GATCCTGGGTTAACTTTTAAGATCTTGGTATCAAACAGT GCTTTCGATGTCAGTGCCAAAAAATGTCGTCCAAGGTA CATG SUA5(M10L) mito AATTCATGTACCTTGGACGACATTTTTTGGCACTGACAT CGAAAGCACTGTTTGATACCAAGATCTTAAAAGTTAACC CAG

PAGE 58

58 Table 2 4. HPLC gradient for nucleoside analysis Time (min) Flow Rate (mL/min) %A %B 0 1 100 0 3 1 100 0 4.4 1 99.8 0.2 5.8 1 99.2 0.8 7.2 1 98.2 1.8 8.6 1 96.8 3.2 10 1 95 5 25 1 75 25 35 1 0 100 40 1 100 0 50 1 100 0

PAGE 59

59 CHAPTER 3 DIVERSITY IN THE BIO SYNTHESIS PATHWAY FOR t 6 A Background The protein families TsaC /Sua5 and Kae1/Qri7/ TsaD were found to be strictly required for the biosynthesis of t 6 A in yeast, and a homolog of at least one member of each family is found in all domains of life, Figure 1 3 . 61,64 However, TsaC and TsaD failed to synthesize t 6 A in vitro on transcript or on t 6 A tRNA purified from yeast sua5 , 64 indicating that more enzymes were required for t 6 A synthesis. These enzymes have been identified in bacteria , but the eukary otic/a rchaeal, and the mitochondrial syntheses of t 6 A were still to be deciphered. Synthesis of t 6 a Varies With Domain of L ife Since the TsaC /Sua5 family members were functionally interchangeable between domains , 61 and TsaD /Kae1/Qri7 were not interchangeable and required species specific partners, 64 this le d to a model where t 6 A synthesis occurred in two steps with kingdom, species, and organelle specific partners for the second step. Indeed, TsaC/Sua5 produces the intermediate TC AMP (L threonylcarbamoyl AMP) , which is processed by TsaD, and the bacterial specific TsaB and TsaE to form t 6 A , Figure 3 8 . 72 T he Tsa E and TsaB proteins that are required for t 6 A synthesis in Bacteria have no homologs in Eukarya or Archaea. The prediction of the t 6 A missing genes in these last two kingdoms came from the fact that Kae1 is part of the KEOPS/EKC complex. 65,66 We test ed if the other subunits of the KEOPS/EKC complex (Bud32, Cgi121, Pcc1, plus the fungal specific Gon7) were involved in

PAGE 60

60 t 6 A synthesis in the yeast cytoplasm and the model Archaea Haloferax volcanii . Additionally, we set out to establish the yeast mitochondrial t 6 A synthesis pathway. Results Analysis of KEOPS M utants in the Archaeon Haloferax volcanii for t 6 A We used the halophilic Haloferax volcanii as a model organism to study t 6 A in a rchaea . M utatio ns were attempted in a homolog of yrdC and were unsuccessful . Prior attempts to delete yrdC were only successful when yrdC was provided in trans , indicating yrdC may be essential in H. volcanii . 79 The same deletion strategy was employed for the KEOPS genes prpk ( kae1 bud32 fusion), cgi121 , and pcc1 . A ll KEOPS genes , except for pcc1 , were found to be essential. 84 pcc1 on t 6 A synthesis, tRNAs from wild type H. volcanii pcc1 were purified, digested to nucleosides , and analyzed by HPLC. As seen in Figure 3 1, deletion of pcc1 had only a small decrease (~16%) in total t 6 A content. 84 These results are similar to results seen in a yeast PCC1 4 point mutant, 92 suggest ing that Pcc1 is no t required for t 6 A formation in H . volcanii , but does increase the efficiency of the reaction. Analysis of KEOPS M utants in Saccharomyces cerevisiae for t 6 A To determine the contribution of each of the KEOPS member s in the biosynthesis of t 6 A, an isogeneic set of deletion mutants, where the Ka nMX4 marker replaced the open reading frame from start to stop, in S. cerevisiae BY4741 haploid was assemble d from stock collections, Table 2 1 . Each mutant was confirmed by PCR us ing oligonucleotides, Table 2 2, targe ting inside and outside the ORF and to the KanMX4 marker. Total bulk tRNAs were purified ,

PAGE 61

61 digested to nucleosides , and examined by HPLC for each of the five KEOPS mutant s , sua5 , qri7 (the mitochondrial targeting homolog of KAE1 ), and the parent BY4741. As shown in Figure 3 2 , and kae1 were devoid of t 6 A, and qri7 contained approximately the same amount of t 6 A at the parental strain, as previously published. 61,64 Additionally, and gon7 did not contain detectable t 6 A, while pcc1 and cgi121 were reduced ~30% and 60%, respectively (Figure 3 2). These results indicate Cgi121p and Pcc1p are not required for t 6 A formation and Bud32p and Gon7p are strictly essential. Yeast Mitochondria Possess a M inimum Biosynthesis Mechanism for Form ation of t 6 A Yeast mitochondrial tRNAs contain t 6 A, 93 and the Kae1p homolog Qri7p has been found to be targeted to the mitochondria in yeast, 67,94 Caenorhabditis elegans , 67 human, 95 rat, 95 and Arabidopsis thaliana . 95 N one of the other subunits of the KEOPS/EKC complex nor Sua5p have paralogs reported as targeting to the mitochondria , 94,96 leaving an open question of how t 6 A is formed in the mitochondria. Close examination of the SUA5 ORF revealed two in frame AUG codons located in the first 28 nucleotides (Figure 3 3), and it was postulated that, in vivo, Sua5p was functional in both the cytoplasm and mitochondria , as no SUA5 homolog is encoded by the mtDNA. The mitochondrial targetin g prediction software iPSort 97 predicted a mitochondrial targeting sequence only for the isoform that started at the first AUG (henceforth referred to as M 1 , for methionine at positio n 1) and did not predict a mitochondrial targeting sequence for the second AUG (M 10 , methionine at position 10 of Sua5 p ). This suggested that a long form of Sua5p translated from the first AUG would be a mitochondrial -

PAGE 62

62 targeted protein, whereas a short Sua5 p, translated from the second AUG, would remain cytoplasmic. These predictions were tested using fluorescent microscopy of a nuclear encoded Sua5 GFP fusion. Because of the low abundance of Sua5p (estimated at less than 600 molecules per cell 96 ), the signal was too w eak to produce reliable images, Figure 3 4 . The well characterized Qri7p appeared to also target to the cytoplasm, but this is an artifact du e t o overexposure of the image, Figure 3 4 . The exposure needed to see Sua5p also led to poor resolution, but gave tantalizing evidence of mitochondrial localization, Figure 3 4 . To increase the level of Sua5p in the cell, Sua5 GFP fusions were constructed un der the control of the constitutive TPI promoter in the high copy 2 vector pYX122 mtGFP . 75 The subunit 9 mitochondrial ATPase (Su9) from Neurospora crassa in pYX122 mtGFP was replaced with SUA5 lacking a stop codon to create a Sua5 GFP fusion , yielding plasmid pPCT025. Wild type S. cerevisiae BY4741 was co transformed with pPCT025 and pYX142 mtRFP (to specifically label mitochondria with red fluorescent protein (a gift from Agnès Delhodde ), and transformants we re examined by 100X confocal microscopy. The experiment revealed uniform distribution of GFP in the cytoplasm, but also foci of GFP in the mitochondria co localizing with mitochond rial targeted RFP, Figure 3 5 2 . Next, a ined by cloning SUA5 (10 426) into pYX122 mtGFP, giving pPCT006. Sua5p starting at the second Met (M 10 ) localized exclusively to the cytoplasm, Figure 3 5 3 . Additionally, a point mutation in SUA5 was created altering the second AUG to CUG (M10L), and SUA5 (M10L) was

PAGE 63

63 cloned into pYX122 mtGFP, creating pPCT030. As seen in Figure 3 5 4, the M10L substitution of Sua5p only localizes to the mitochondria, eliminating Sua5 GFP in the cytoplasm. To confirm that the N terminus of Sua5p was responsible for targeting GFP to the mitochondria, the first 70 nucleotides of SUA5 and SUA5 (M10L) were cloned into pYX122 mtGFP , creating pPCT004 and pPCT036, respectively. As seen in Figure 3 5 5 and 6, the first 70 nucleotides of SUA5 dual localized GFP to the cytoplasm and the mitochondria, but when the second AUG was mutated to CUG, GFP only localized to the mitochondria, supporting the conclusion that Sua5p can target to the mitochondria. The localization and function of Sua5 GFP was confirmed by co transforming VDC9100 ( sua 5 ) with pYX142 RFP and each of the Sua5 GFP plasmids. The targeting of Sua5 GFP in sua5 mimics the results seen in wild type BY4741. Full length Sua5 GFP targeted to both the cytoplasm and mitochondria. Sua5 (10 426) GFP targeted exclusively to the cytopl asm, while Sua5 (M10L) GFP targeted e xclusively to the mitochondria, Figure 3 6 . Overall, these results demonstrated that the nuclear encoded Sua5p could localize to the cytoplasm and mitochondria to produce the TC AMP for t 6 A synthesis. Distribution of th e t 6 A Synthesis Genes V aries in D iff erent O rganisms With the knowledge of the essential members of t 6 A biosynthesis throughout life, the distribution of these proteins was analyzed. Annotation for the first enzyme of t 6 A synthesis is complicated by the fact that two forms are found (the TsaC or Sua5) and that 50% of the genomes analyzed harbor a TsaC

PAGE 64

64 paralog , YciO , that does not have the same function and does not contain the conserved KRSN tetrad. 61,98 We reannotated all members of the TsaC/Sua5/YciO COG0009 family in 9176 bacterial genomes and all contained a tsaC or a SUA5 : 6745 contain tsaC (73%), 2846 contain sua5 (31%), and 859 (9%) contain both. In addition, 54% contain yciO , Figure 3 8, and http://tinyurl.com/t6A bacteria . N o clear pattern (phylogenetic or lifestyle) has emerged in terms of presence of tsaC or sua5 in any given bacterial genome , and the functional differences between the two enzymes are not understood. Most bacteria contain both tsaB and tsaE . But tsaE can be lost in symbiotic or intracellular bacteria , as is the case in Wolbachia and Mycoplasmas , such as M. genitalium and M. pneumoniae . O nly two bacteria, M. haemofelis and M. suis strain Illinois are missing both tsaB and tsaE 12 (Figure 3 7 and Table 3 1). It seems these organisms harbor a mitochondrial like minimal t 6 A synthesis system (unless another unidentified protein is recruited). Like Bacteri a, all e ukaryotes and a rchaea contain a homolog of either tsaC or sua5 . We have found one eukaryote that has both, the fung us Pseudocercospora fijiensis CIRAD86 , also known as Mycosphaerella fijiensis CIRAD86 (NCBI Taxonomic ID: 383855). As with bacteria, there is not a clear phylogenetic inheritance between organisms with tsaC or sua5 in Archaea or Eukaryotes, but a taxonomic relationship does exist in Eukaryotes. Fungi exclusively contain SUA5 (with P. fijiensis as an exception), while all Plants (including Chlamydomonas reinhardtii ) and all Metazoans exclusively contain TSAC . Of the 53 Archaea analyzed , 25 contain tsaC and 28 contain sua5 . The

PAGE 65

65 only taxonomic relationship found is in the order Halobacteriales tha t exclusively contain tsaC , Figure 3 7 , Table 3 2, and http://tinyurl.com/t6A Arc Euk . All Archaea contain a single kae1 homolog, while Eukaryotes also contain a single KAE1 homolog and also have a QRI7 homol og (evolutionarily related to the bacterial tsaD ), which will function in the organelles. In all genomes analyzed, both KAE1 and QRI7 were found in the nuclear genome and not in the organelle. For example , the human nuclear genome contains KAE1 (OSGEPL) fo r cytoplasmic t 6 A synthesis and QRI7 (OSGEPL1) was shown to target to the mitochondria. 95 As an exampl e for plants, A. thaliana contains nuclear encoded KAE1 and QRI7 . While QRI7 At contains a predicted chloroplast targeting signal, it has only been detected in the mitochondria. 95 The human pathogen Plasmodium falciparum (causative agent of malaria) presents an interesting case for t 6 A synthesis, h as both a mitochondria and an apicoplast, originating from s econdary endosymbiosis of an algae . 99 The mitochondria utilize fully modified cytoplasmic tRNAs for mitochondrial translation ( the requirement for t 6 A machinery is unknown) . Also, P. falciparum contains two nuclear encoded homologs of KAE1 (Table 3 2): a KAE1 that is similar to the yeast KAE1 ; and, a KAE1b that targets to the apicoplast (Mallari and Goldberg, personal communication). Kae1 interacts with both Bud32 and Cgi121, and Kae1b interacts with multiple proteins associated with the apicoplast ribosome (Mallari and Goldberg, personal comm unication). Sua5 p has not been detected in the apicoplast, and it is currently unknown how the first step in t 6 A synthesis occurs in this organelle (Mallari and Goldberg, personal communication).

PAGE 66

66 The conservation for the remaining KEOPS members varies . BUD32 is found in all Eukaryotes and Archaea sequenced to date, and in the 53 Archaea analyzed, bud32 and kae1 are adjacent ORFs in 13 genomes and are fused in 25 genomes, demonstrating a strong functional linkage between the proteins of these genes. PCC1 and CGI121 are found in nearly all Archaea and Eukarya. Notable exceptions are the absence of PCC1 in P. falciparum and the absence of CGI121 in Drosophila melanogaster . GON7 is a fungal specific protein. Gon7 p is required for t 6 A formation in yeast, but t he function of Gon7 p is currently unknown. Discussion Synthesis of t 6 A in Archaea and Eukaryotes is Dependent on the KEOPS C omplex The bacterial TsaB and TsaE have no homologs in Eukaryotes and Archaea, however the TsaD homolog, Kae1 was found to be esse ntial for t 6 A formation in yeast. Kae1 is a member of the KEOPS complex in e ukaryotes and a rchaea , and mutation of the other KEOPS genes resulted in either loss or reduction of t 6 A. In a rchaea , all of the KEOPS genes, except for pcc1, are essential, and m utation of pcc1 results in lower levels of t 6 A being produced. As these studies were underway, another study was published supporting our conclusion for role of KEOPS in t 6 A formation. A mutation of PCC1 and BUD32 , but not CGI121, in yeast eliminated t 6 A on tRNA Ile detected by primer extension assay (absence of t 6 A in bud32 was confirmed on bulk tRNA by LC MS/MS). 100 Similar to our analysis of pcc1 , analysis of bulk tRNA from a pcc1 4 allele found t 6 A was reduced 30%. 92 Additionally, the genetic results presented

PAGE 67

67 above were confirmed by in vitro reconstitution experiments of the whole KEOPS/EKC complex in t 6 A formation. The KEOPS/EKC compl ex from the Archaeon Pyrococcus abyssi (Kae1, Bud32, Pcc1, and Cgi121), reconstituted from the individual genes expressed in E. coli , as well as the S. cerevisiae KEOPS complex (Kae1p, Bud32p, Pcc1p, Cgi121p, and Gon7p) expressed in E. coli from a syntheti c operon, 101 can form t 6 A in vitro , when combined with purified yeast Sua5p or archaeal Sua5. 102 Additionally, TC AMP produced by TsaC or Sua5 from bacterial, eukaryotic, or archaeal origin can be converted to t 6 A modified tRNA by the E. coli TsaDEB enzymes, 72 the S. cerevisiae KEOPS complex, or the P. abyssi KEOPS complex. 102 Qri 7p and Sua5p are Responsible for S ynthesis of t 6 A in the M itochondria While this work was in progress, an in vitro study of Qri7p and Sua5p showed production of t 6 A wi thout any additional proteins. t 6 A was formed even when the two proteins were separated by a 2 kD molecular weight cut off membrane, although noticeably more t 6 A was produced when Qri7p and Sua5p ar e not separated (the precise increase is difficult to determine from Figure 3A of Wan et al . ). 103 The Sua5p localization data presented here, in combination with the previous in vitro data 103 , firmly establish that, in yeast, Sua5p and Qri7 p co localize to the mitochondria and are the only proteins required to introduce t 6 A modifications to mitochondrial tRNAs. In e ukaryotes , tRNA modification enzymes targeted to cytoplasm and organelles are often encoded from a single nuclear gene. The dual targeting of the modification enzymes has been observed for several universally conserved tRNA modifications. Six of the eight yeast pseudouridylation enzymes, as well as

PAGE 68

68 Mod5p, the enzyme responsible for the insertion of N6 isopentenylasenosine (i 6 A 37 ), are targeted to both the cytoplasm and the mitochondria. 104,105 Similarly, Trm5p, a tRNA (guanine N1 ) methyltransferase that methylates guanosin e at position 37 (m 1 G 37 ) of cytoplasmic and mitochondrial tRNA, has a dual localization, with a long form found exclusively in the mitochondria, and a N terminal truncated form (translated from a second internal, in frame AUG start site) found exclusively in the cytoplasm. 106 The Sua5p GFP data presented here strongly suggests a similar scenar io for Sua5p, where the nuclear encoded Sua5p c an localize both to the cytoplasm and to the mitochondria though the use of alternative translation initiation at two in frame AUG sites. Translation from the first AUG encodes a mitochondrial signal peptide, and Sua5 is localized to the mitochondria, wher eas Sua5 translated from the second AUG remains in the cytoplasm. The nucleotide context surrounding the first AUG is a non optimum Kozak sequence, with a U at both 3 and +4 (in yeast, a U at 3 reduces expression 2 fold) 107 , while there is a stronger Kozak sequence for the second AUG with G at 3 and A at +4, Figure 3 9 . The presence of two in frame AUGs at the N terminus of the TsaC/Sua5 proteins is conserved in Arabidopsis thaliana , Homo sapiens, and in all other eukaryotic genomes sequenced to date (Figure 3 9), suggesting this dual targeting mechanism may be conserved. In plants, TsaC must be targeted to both mitochondria and chloroplasts in addition to being localized to the cytoplasm, as only one copy of TsaC, located in the nuclea r genome, is found in all plant genomes analyzed. This prediction has yet to be experimentally validated.

PAGE 69

69 Despite the D iversity of t 6 A M achinery , T here is a Common C ore In summary, the same enz yme family in all organisms and organelles, TsaC/Sua5, catalyzes the formation of the intermediate TC AMP, but for the transfer of threonylcarbamoyl (TC) to tRNA, Bacteria require TsaBDE, while Archaea and Eukaryotes use the KEOPS complex, and the yeast mi tochondria simply require Qri7p. Interestingly, although TsaBDE and KEOPS are functional analogues, only the TsaD/Kae1 proteins are shared between the two systems (Figure 3 8). This fact and the evidence for a minimal t 6 A synthesis in mitochondria, suggest ed that TsaD/Kae1/Qri7 and Sua5 were part of the ancestral t 6 A synthesis core present in the LUCA 67 Broad Implications of the D iscovery of t 6 A Synthesis G enes The biosynthesis of t 6 m odifications in the genomic era that has allowed for the discovery of globally unknown genes for e nzyme reactions that were discovered more than 40 years earlier. In Bacteria, the four genes involved in t 6 A biosynthesis, due to their prokaryotic specific essentiality and because tsaB and tsaE are found only in bacteria, had been identified as potential antibacterial targets prior to the discovery of their role in t 6 A synthesis was even established. 68,108 111 The unique Kae1b found in P. falciparum also presents itself as an attractive anti malarial target. For these proteins to be viable targets, it is critical to understand their distribution profile and potential range of action, as well as the mechanisms underlying the essentiality phenotypes to predict resistance mechanisms. Clearly, one should use caution in designing drugs targeting TsaB and TsaE in Mycoplasmas spp., as these organisms have lost either one or both genes.

PAGE 70

70 Caution would also be needed for drugs targeting TsaC, due to the possibil ity cross reactivity in humans. Sua5 and TsaD may be more viable options, but any antibiotic targeting these two enzymes would be broad spectrum. The discovery of the t 6 A pathways now allows us to systematically address the causes of the pleiotropic phe notypes caused by the absence of t 6 A synthesis enzymes. Are these phenotypes due to mistranslation of target proteins, to roles of t 6 A as determinants for other components of the translation apparatus, or to roles of t 6 A or of these proteins in processes o ther than translation? The recent discovery of a molecule similar to t 6 A nucleoside in dauer signaling in nematodes 112 opens an unforeseen role fo r t 6 A derivatives in biology. Naming C onvention The literature is plagued with a variety of names for each t 6 A synthesis protein and even for the complexes. With the defined enzymatic and biological function now established, it is appropriate to unify the t 6 A nomenclature. For all b acteria , we recommend the following suggestions, in agreement with Ken Rudd (Curator of EcoGene, U. of Miami) and published in Deutsch et al. : 71 TsaB, TsaC, TsaD, and TsaE to replace YeaZ, YrdC, YgjD, and YjeE, respectively. Additionally, Sua5 in bacteria should be renamed TsaC2. TsaC2 is defined as a protein conta ining both a TsaC and the additional C terminal Sua5 domain. For e ukaryotes and a rchaea , the use of Tcs ( t hreonyl c arbamoyl s ynthesis) is recommended ( TSA1 and TSA2 are in use in yeast for thioredoxin). We recommend the following nomenclature: Tcs1 (YrdC), Tcs2 (Sua5), Tcs3 (Kae1), Tcs4 (Qri7), Tcs5 (Bud32), Tcs6 (Pcc1), Tcs7 (Cgi121), and Tcs8 (Gon7). A summary of new and old names, as well as recommended functional descriptions

PAGE 71

71 can be found in Table 3 3. Additionally, renaming the bacterial TsaBDE complex as well as the a rcheal / e ukaryotic KEOPS/EKC complex to T hreonyl c arbamoyl T ransferase C omplex (TCTC) is recommended, which will be staying in line with nomenclature of other members of the carbamoyl transferase family. The TCTC family can be further subdivided into bacterial (bTCTC), archaeal (aTCTC), and eukaryal (eTCTC).

PAGE 72

72 Table 3 1 . Homologs of t 6 A synthesis genes in Bacteria. Organism TsaC TsaC2 (Sua5) TsaB TsaD TsaE E. coli K12 b3282 b1807 b3064 b4168 Vibrio cholerae O1 El Tor VC0054 VC1079 VC1989 VC0521 VC0343 Caulobacter crescentus NA1000 CCNA_03501 CCNA_00057 CCNA_00069 CCNA_03648 Mycoplasm gentialium G37 MG259* MG208 MG046 N.P. Mycoplasm pulmonis MYPU_6130 # MYPU_1190 MYPU_1180 MYPU_1200 Bacillus subtilis subsp. subtilis str. 168 BSU36950 BSU05920 BSU05940 BSU05910 Haemophilus influenzae Rd HI0656 HI0388 HI0530 HI0065 Acinetobacter baylyi APD1 ACIAD0208 ACIAD0677 ACIAD1332 ACIAD2376 Salmonella Typhii TY2 STY4395 STY1950 STY3387 STY4714 Francisella novisida U112 FTN_0158 FTN_1148 FTN_1565 FTN_0274 Pseudomonas aeruginosa PA01 PA0022 PA3685 PA0580 PA4948 Burkholderia thailandensis E264 BTH_I0669 BTH_I2001 BTH_II0616 BTH_I0723 Stapholcoccus aureus subsp. aureus MW2 MW0860 MW2040 MW1975 MW1973 MW1976 * M. gentialium MG259 is a TsaC/HemK fusion. # M. pulmonis TsaC (MYPU_6130) and HemK (MYPU_1060) N.P. : Not Present

PAGE 73

73 Table 3 2 . Homologs of t 6 A synthesis genes in Archaea and Eukaryotes. Organism Tcs1 (YrdC) Tcs2 (Sua5) Tcs3 (Kae1) Tcs4 (Qri7) Tcs5 (Bud32) Tcs6 (Pcc1) Tcs7 (Cgi121) Tcs8 (Gon7) Haloferax volcanii DS2 HVO_0253 HVO_1895 + HVO_1895 + HVO_0652 HVO_0013 Homo sapiens 1p34.3 14q11.2 2q32.2 20q13.2 Xq28 2p24.3 p24.1 Drosophila melanogaster CG10438 CG4933 CG14231 CG10673 CG42498 N.P. Plasmodium falciparum PFL0175c PF3D7_1030 600 PF3D7_040 8900.1 MAL7P1.26 N.P. PFE0580w Saccharomyces cerevisiae S228C YGL169w YKR038c YDL104c YGR262c YKR095w A YML036w YJL184w Schizosaccharomyces pombe SPCC895. 03c SPBC16D10. 03 SPCC1259. 10 SPAP27G11. 07c SPAC4H3.1 3 SPCC24B10. 12 SPAC6B1 2.18 Arabidopsis thaliana AT5G60590 AT4G22720 AT2G45270 AT5G26110 AT5G53045 AT4G34412 + H. volcanii Tcs3 and Tcs5 occur as a gene fusion (HVO_1895). P. falciparum PF3D7_0408900.1 targets to the apicoplast and is similar to Tcs3 but phylogenetically distinct from Tcs3, Tcs4 and TsaD Ec . N.P. Not Present

PAGE 74

74 Table 3 3 . Proposed names and functional roles for t 6 A synthesis genes. New Name Old Names Function Bacteria TsaB YeaZ / YdiC tRNA adenosine(37) threonylcarbamoyltransferase complex, dimerization subunit type 1 TsaC YrdC L threonylcarbamoyladenylate synthase (EC 2.7.7.87) type 1 TsaC2 Sua5 / YwlC L threonylcarbamoyladenylate synthase (EC 2.7.7.87) type 2 TsaD YgjD / YdiE tRNA adenosine(37) threonylcarbamoyltransferase complex, transferase subunit TsaE YgjE / YdiB tRNA adenosine(37) threonylcarbamoyltransferase complex, ATPase subunit type 1 Archaea / Eukaryotes Tcs1 YrdC L threonylcarbamoyladenylate synthase (EC 2.7.7.87) type 1 Tcs2 Sua5 L threonylcarbamoyladenylate synthase (EC 2.7.7.87) type 2 Tcs3 Kae1 / gcp / OSGEPL tRNA adenosine(37) threonylcarbamoyltransferase complex, transferase subunit Tcs4 Qri7 / OSGEPL1 tRNA adenosine(37) threonylcarbamoyltransferase, mitochondrial Tcs5 Bud32 tRNA adenosine(37) threonylcarbamoyltransferase complex, ATPase subunit type 2 Tcs6 Pcc1 tRNA adenosine(37) threonylcarbamoyltransferase complex, dimerization subunit type 2 Tcs7 Cgi121 tRNA adenosine(37) threonylcarbamoyltransferase complex, regulator subunit Tcs8 Gon7 tRNA adenosine(37) threonylcarbamoyltransferase complex, fungal specific subunit

PAGE 75

75 Figure 3 1. HPLC n ucleoside analysis of H. volcanii H133 (wt) and pcc1 . P urified tRNAs of wild type and pcc1 were digested to nucleosides, subjected to HPLC, and t 6 A was detected at 254 nm . t 6 A standard was synthesized by Darrel Davis (U. of Utah). Peak area of t 6 A in pcc1 is reduced 1 6 versus H133.

PAGE 76

76 Figure 3 2. HPLC nucleoside analysis of wild type S. cerevisiae and mutants. P urified tRNAs of wild type and kae1 , , bud32 , , qri7 cgi121 pcc1 were digested to nucleosides, subjected to HPLC, and t 6 A was detected at 254 nm.

PAGE 77

77 Figure 3 3. Potential dual translational starts of SUA5 . The SUA5 ORF contains two, in frame AUG codons located in the first 28 nucleotides. iPSort 97 predicts Sua5p translated from first AUG would target to the mitochondria. TsaC like domain and Sua5 domain are indicated to scale.

PAGE 78

78 Figure 3 4. Fluorescence microscopy of Kae1 GFP, Qri7 GFP, and Sua5 GFP chromosomal fusions. C onfocal microscopy at 100 x. Mitochondrial target ing RFP was used to mark mitochondria.

PAGE 79

79 Figure 3 5. Localization of Sua5 GFP in trans in wild type BY4741. Sua5 GFP localization was detected using confocal microscopy at 100x. Wild type yeast BY4741 containing compatible plas mids expressing RFP targeting to the mitochondria or Sua5 GFP fusions. (1) Control. RFP fused to F o ATPase mitochondrial targeting sequence. (2) Full length, wild type Sua5 GFP indicates cytoplasmic and mitochondrial targeting of Sua5p. Co localization of RFP and GFP in mitochondria is indicated as yellow in the merged image. (3) Residues 10 426 of Sua5 fused to GFP (Sua5 (10 426) GFP) only targets to the cytoplasm. (4) Substitution of M10L in full length Sua5 p (Sua5 M10L GFP) only targets to the mitochondri a. (5) The first 25 residues of Sua5p (Sua5 (1 25) ) is sufficient for dual targeting. GFP is located in both the cytoplasm and mitochondria. (6) Sua5 M10L (1 25) GFP only targets to the mitochondria.

PAGE 80

80 Figure 3 6. Localization of Sua5 GFP in trans in sua5 . Sua5 GFP localization was detected using confocal microscopy at 100x. (1) Control. pYX mtRFP and pYX mtGFP. (2) Full length, wild type Sua5::GFP. Co localization of RFP and GFP in mitochondria is indicated as yellow in the merged image. (3) Residues 10 426 of Sua5 fused to GFP (Sua5 (10 426) ::GFP) only targets to the cytoplasm. (4) Substitution of M10L in full length Sua5 (Sua5 M10L::GFP) only targets to the mitochondria.

PAGE 81

81 Figure 3 7. Distribution of genes for biosynthesis of t 6 A and derivatives. Representative organisms from each domain of life were used to build a taxonomic tree in iToL (http://itol.embl.de). 76,77 Fil l ed circles indicate presence of gene.

PAGE 82

82 Figure 3 8. Diversity in the synthesis of the universal tRNA modification t 6 A. The formation of TC AMP, is catalyzed by the same enzyme family in all organisms (TsaC/TsaC2). Tsa C2/Tcs2 contains a TsaC domain plus an additional C terminal domain called Sua5 that is yet to be characterized. To transfer threonylcarbamoyl (TC) to tRNA, Bacteria requir e TsaBDE, while Archaea and Eukarya use the TCTC complex composed of Tcs3, Tcs5, Tcs6 and Tcs7 proteins, Tcs8 is found exclusively in f ungi . Interestingly, although TsaBDE, TCTC and Tcs4 are functional analogues, only the TsaD/ Tcs3 / Tcs4 proteins are conser ved, suggesting this protein family was part of the ancestral t 6 A synthesis core.

PAGE 83

83 Figure 3 9 Alignment of the TsaC domain from representative e ukaryotes . Potential translation start sites indicated in red. Each organism contains two methionines suggesting potential dual localization, as seen in S. cerevisiae . The KRSN catalytic tetrad is highlighted in green . Analysis using iPSORT predicts translation fro m the first AUG will include organelle localization signal, while translation from the second AUG will be cytoplasmic.

PAGE 84

84 CHAPTER 4 LIFE WITHOUT THE ESSENTIAL MODIFICATION t 6 A Background At the onset of this study, all four t 6 A biosynthetic genes were deter mined to be essential in E. coli , 61,64,71 but none of the biosynthetic genes are essential in yeast (discussed in Chapter 3), while only tcs6 ( pcc1 ) was dispensable in H. volcanii (discussed in Chapter 3). U nderstand ing E ssentiality of t 6 A in B acteria A potential explanation for the essentiality of t 6 A i n prokaryotes and not in e ukaryotes is the differences in the translation machinery. In E. coli , Isoleucyl tRNA synthetase (IleRS) will only charge native (fully modified) tRNA and not tRNA transcript (which is not modified) . 113 In contrast, the IleRS of yeast will charge transcript. 113 If t 6 A is required for bacteria, but not e ukaryotic IleRS charging, this would explain the essentiality in bacteria. However, a rchaea also harbor a eukaryotic type IleRS, 114 so additional reasons for essentiality must occur. Another reason for prokaryote specific essentiality of t 6 A might reside in the decoding of the AUA codon for isoleucine. Eukaryotes u se tRNA UAU to decode AUA, 25 but prokaryotes convert C 34 of tRNA CAU to lysidine (k 2 C) with TilS in B acteria, or to agmatidine (agm 2 C) with TiaS in a rchaea . 115 117 As tilS and tiaS are essential, 79,115 the essentiality of t 6 A could be due to an indirect role in k 2 C and agm 2 C synthesis. These questions led us to explore if t 6 A was truly essential in all b acteria. A complication to this endeavor was the inconsistent nomenclature of genes involved in t 6 A synthesis, which we resolved in Chapter 3. We searched the literature on whoIe genome mutagenesis screens, as well as directed mutagenesis experiments , and found

PAGE 85

85 three bacteria in which t 6 A synthetic genes were disrupted. We set out to determine if these organism s were devoid of t 6 A, and how they can live without the t 6 A modification. Results t 6 A is Essential i n W hole Genome Mutagenesis Surveys of Prokaryotes As discussed previously, all four t 6 A biosynthetic genes are essential in E. coli , and in a rchaea , only one aTCTC (KEOPS) member , tcs6 ( pcc1 ) , was able to be deleted from H. volcanii (attempted by two different groups). 79,84 We examined 18 published studies ( 1 4 in B acteria, two in Archaea, and two in f ungi ) describing saturating whole genome mutagenesis screens and whole genome gene deletion libra ries to identify incidences of mutations in t 6 A biosynthesis genes, Table 4 1 and Table 4 2. A transposon mutagenesis analysis of the arch a eon Methanococcus maripaludis found that all t 6 A synthesis genes were essential , Table 4 2. 118 Unlike H. volcanii , tcs6 ( pcc1 ) appears to be essential in this strain. None of the 14 saturating mutagenesis studies or whole genome single gene deleti on libraries in bacteria identified mutations in tsaB , tsaD , or tsaE , Table 4 1. A follow up study on the B. subtilis whole genome deletion study found ywlC (Sua5/TsaC2 homolog) and ydiB ( tsaE ) were not essential, 119 but the genetic constructs are not clear (it is likely that a gene duplication occurred) and the mutations have not been confirmed (t he authors did not provide PCR results and have not responded to inquires). In the literature, there are only two occurrences of chromosomal knockouts of tsaC or tsaC 2, and both are in Vibrio cholerae , Table 4 1. 120,121 Saturating transposon mutagenesis was performed on two isolates of V. cholera e O1 El Tor by two laboratories with the same result. The V. cholera e genome contains both a tsaC and a tsaC 2 homolog, and either gene alone is sufficient fo r growth. 120,121 Mutation of tsaC 2

PAGE 86

86 came with a cost, as the strain was less fit in transition from an animal host to pond water or from LB to pond water. 121 It is not known if a double tsaC/tsaC 2 mutant is viable. Life W ithout t 6 A In addition to the whole genome deletion collections, we surveyed the literature for occurrences of dir ected mutations in t 6 A biosynthesis genes in bacteria. Three bacterial species ( Deinococcus radiodurans , Synechocystis sp. PCC 6308, and Streptococcus mutans ) have single gene mutations in a t 6 A biosynthetic gene , Table 4 3. 122 12 4 In D. radiodurans, a double mutant of tsaB and tsaD was constructed. 122 The t 6 A content in these strains has not been published , and we sought to determine the levels of t 6 A in these organisms. Analysis of t 6 A C ontent in Deinoco ccus radiodurans Mutant strains of tsaB , tsaD , and a double mutant of tsaB / tsaD were viable in Deinococcus radiodurans . 122 The single and double mutations did not have an e ffect on growth rate in microtiter plates , but did increase se nsitivity to DNA damaging agents. 122 We acquired D. radiodurans strains R1 (wild type), XYD ( tsaD ), XYZ ( tsaB ), and WDZ ( tsaD / tsaB ) created in Onodera et al . We confirmed the mutations via PCR using oligonucleotides annealing outside and inside of each ORF and to the antibiotic cassettes. All PCRs confirmed the strains genotype s . To determine if the mutant strains contained t 6 A, we purified tRNAs from each strain , digested them, and su bjected t he digested tRNAs to HPLC analysis. As seen in Figure 4 1, tsaD , tsaB , and tsaD / tsaB were devoid of t 6 A.

PAGE 87

87 Intrigued by these results, we examined how D. radiodurans could live (and grow as well as wild type) without t 6 A. As discussed previousl y, t 6 A is required for two different essential processes in E. coli : charging of tRNA Ile , and lysinidlyation by TilS of tRNA Ile CUA to decode AUA. To avoid the first essentially of t 6 A, D. radiodurans possess a eukaryotic type IleRS , Figure 4 2 , that does n ot use the anti codon as a determinant for charging tRNA Ile , 125 thus avoiding the first essentiality . Their ability to overcome the second essentiality is not as clear . D. radiodurans possess a tilS homolog , therefore must be able to convert tRNA Ile CUA to tRNA Ile LUA to decode AUA codons. We examined if a point mutation in the anti codon in on e of the tRNA Ile genes could be decoding AUA, as seen in the loss of tilS essentiality in B. subtilis . 126 We PCR amplified and sequenced the two major tRNA Ile genes, the minor tRNA Ile gene (the t arget of TilS, and incorrectly annotated as tRNA Met ), and the tRNA Met genes for wild type and each of the mutants. The sequences of the tRNA Ile and tRNA Met for each of the mutants were identical to the wild type (R1) sequence, indicating that D. radioduran s has not avoided the essentiality of TilS following the same mechanism of B. subtilis . tilS Dr is a gene fusion of t ilS and cytidine deaminase domain. This architecture is only found in the Deinococcacae/Thermo clade and adds an additional C terminus domai n to TilS. The cytidine deaminase domain has high similarity with cytidine deaminases found in single ORFs in a variety of organisms. How this domain affects the function of TilS has not been determined. Analysis of the D. radiodurans genome revealed a lo w use of AUA codons (0.09% of all codons) as compared to E. coli (0.42%), Streptococcus mutans (0.79% ), and Haloferax volcanii (0.22% ) , Figure 4 3. In fact, D. radiodurans rarely use an A or U

PAGE 88

88 in the third position of a codon, Figure 4 3 A. Genes with the highest use of AUAs do not belong to essential processes, Table 4 4. This implies that D. radiodurans could have evolved a method to overcome the essentiality of t 6 A. Further experimentation is required to determine if any detrimental effect s on t ranslation fidelity exists due to mutations in the t 6 A synthesis genes. Analysis of t 6 A C ontent in Synechocystis PCC 6308 and Streptococcus mutans A m utation in tsaD (gcp) has been described in Synechocystis PCC 6308, 123 and in tsaB ( brpB ) S. mutans . 124 C ell paste of Synec h ocystis wild tsaD were provided by Martin Haggeman, University of Rostok . S. mutans wild tsaB , and tsaB (p tsaB ) strains were provided by Tom Wen, Louisiana State University . Analysis of the tRNA content revealed that the mutants of Synec hocys tis and S. mutans were devoid of t 6 A , Figure 4 4 and Figure 4 5. The t 6 A levels in S. mutans tsaB could be fully restored to wild type levels by expression of tsaB in trans (Figure 4 5). The ability of Synechocystis and S. mutans to live without t 6 A is extrem ely perplexing. Unlike D. radiodurans , both Synechocystis and S. mutans have a bacterial type IleRS (Figure 4 2), which should require t 6 A for charging of tRNA Ile . AUA codon usage for Synechocystis and S. mutans of 0.44% and 0.78% respectively, are similar to E. coli (Figure 4 3 ) . Unlike D. radiodurans , the dispensability of t 6 A cannot be explained by rarity of the codon. The reason s for D. radiodurans , Synechocystis and S. mutans ability to lose t 6 A while t 6 A is essential in E . coli is unresolved. Discussion The t 6 A synthesis genes are essential in E. coli and were presumed to be essential in nearly all bacteria. Indeed, a survey of 14 published whole genome gene mutagenesis collections in different bacteria revealed that the mutations in tsaB , tsaC ,

PAGE 89

89 tsaC 2, tsaD , and tsaE , were almost never obtained. The rare occurrence of mutations can be explained by either the presence of two genes to carry out the same function ( V. cholerae encodes both tsaC and tsaC2 ), or the validity of the mutations are questi oned ( tsaC 2 and tsaD in B. subtilis was unable to be confirmed). There are three bacteria for which it has been confirmed t 6 A is not essential. Mutations made in tsaB and tsaD in D. radiodurans , tsaD in Synechocystis , and tsaB in S. mutans were reported in the literature, and our analysis of these strains revealed all of the mutants were devoid of t 6 A. There could be many reasons for the essentiality of t 6 A in bacteria ; however, the most promising explanations are the requirement of t 6 A fo r the bacterial IleRS charging, and the requirement of t 6 A modification of tRNA CAU for TilS to convert the C 34 to lysidine. D. radiodurans possess a eukaryotic like IleRS, eluding first t 6 A requirement, however Synechocystis and S. mutans each possess a ba cterial type IleRS, leaving a question of how they can subvert this essentiality. All three possess TilS, which would still need t 6 A to form lysidine on the tRNA CAU to decode AUA. Codon usage analysis revealed that AUA codons are rarely used by D. radiodur ans compared to E. coli and H. volcanii , which could explain the avoidance of this reason for essentiality. Synechocystis and S. mutans AUA codon usage is not all that different from E. coli , again defying another explanation of why these bacteria can live without t 6 A.

PAGE 90

90 Table 4 1. Survey of bacterial whole genome gene deletion libraries for mutations in t 6 A biosynthetic genes Organism TsaC TsaC2 TsaB TsaD TsaE Type Reference E. coli K12 E / b3282 E / b1807 E / b3064 E / b4168 Whole Genome, single gene knockout, non polar 69,127 Vibrio cholerae O1 El Tor E7946 and C6706 non / VC0054 non / VC1079 E / VC1989 E / VC0521 E / VC0343 Saturating transposon mutagenesis 120,121 Caulobacter cresc entus NA1000 E / CCNA_03501 E / CCNA_00057 E / CCNA_00069 E / CCNA_03648 Saturating transposon mutagenesis 128 Mycoplasm gentialium G37 E / MG259* E / MG208 E / MG046 N.P. Saturating transposon mutagenesis 129 Mycoplasm pulmonis E / MYPU_6130 # E / MYPU_1190 E / MYPU_1180 E / MYPU_1200 Saturating transposon mutagenesis 130,131 Bacillus subtilis subsp. subtilis str. 168 E / BSU36950 E / BSU05920 E / BSU05940 E/ BSU05910 Whole Genome, single gene knockout, non polar 132 Haemophilus influenzae Rd E / HI0656 nd / HI0388 non 1 / HI0530 nd / HI0065 mariner based minitransposon 133 Acinetobacter baylyi APD1 E / ACIAD0208 E 2 / ACIAD0677 E 2 / ACIAD1332 E / ACIAD2376 Whole Genome, single gene knockout 3 134 Salmonella Typhii TY2 E / STY4395 E / STY1950 E / STY3387 E / STY4714 Saturating transposon mutagenesis 135 Francisella novisida U112 E / FTN_0158 E / FTN_1148 E / FTN_1565 E / FTN_0274 Saturating transposon mutagenesis 136 Pseudomonas aeruginosa PA01 E / PA0022 E / PA3685 E / PA0580 E / PA4948 Saturating transposon mutagenesis 137 Burkholderia thailan densis E264 E / BTH_I0669 E / BTH_I2001 E / BTH_II0616 E / BTH_I0723 Saturating transposon mutagenesis 138 Stapholcoccus aureus subsp. aureus MW2 nd / MW0860 E / MW2040 E / MW1975 E / MW1973 E / MW1976 Saturating transposon mutagenesis 139 E Essential gene non Non essential gene N.P. Gene not present in genome nd Not Determined * M. gentialium MG259 is a TsaC/HemK fusion. # M. pulmonis TsaC (MYPU_6130) is essential, while HemK (MYPU_1060) is not essential. 131 1 Genomic map for TsaD (HI0530) mutation is not available and mutation is not confirmed. 2 Mutation corresponds with genomic duplication of the target gene. 3 Library was selected on minimal media.

PAGE 91

91 Table 4 2. Survey of Archaeal and Eukaryotic gene deletion studies for mutations in t 6 A biosynthetic genes Organism Tcs1 Tcs2 Tcs3 Tcs4 Tcs5 Tcs6 Tcs7 Tcs8 Type Reference Haloferax volcanii DS2 E / HVO_025 3 E / HVO_1895 1 E / HVO_1895 1 non / HVO_0652 E / HVO_0013 Single gene knockout 79,84 Methanococcus maripaludis E / MMP0186 E / MMP0415 # E / MMP0415 # E / MMP0246 E / MMP0967 Transposo n mutagenes is 118 Saccharomyces cerevisiae S228C non / YGL169 w non / YKR038c non / YDL104c non / YGR262c non / YKR095w A non / YML036w non / YJL184w Single gene knockout in haploid 61,140 Schizosaccharomy ces pombe E / SPCC89 5.03c non / SPBC16D1 0.03 non / SPCC1259 .10 E / SPAP27G1 1.07c non / SPAC4H3. 13 non / SPCC24B1 0.12 nd / SPAC6B 12.18 Single gene knockout 141,142 E Essential gene non Non essential gene nd Not Determined 1 H. volcanii tcs3 and tcs5 occur as a gene fusion (HVO_1895).

PAGE 92

92 Table 4 3. Single gene deletions in t 6 A biosynthesis in bacteria Organism TsaC TsaC2 TsaB TsaD TsaE Type Referenc e Deinococcus radiodurans R1 nd / DR_1862 non / DR_0756 non / DR_0382 nd / DR_2351 Single gene knockout 122 Synechocystis sp. PCC 6308 nd / slr1866 nd / sll1063 non / slr0807 nd / sll0257 Single gene knockout 123 Streptococcus mutans UA159 nd / SMU.1083c nd / SMU.38 5 nd / SMU.387 non / SMU.409 Single gene knockout 124 E Essential gene non Non essential gene nd Not Determined Shaded boxes gene was able to be deleted

PAGE 93

93 Table 4 4 . Genes in D. radiodurans with two or more AUA codons Gene Description DR_0001 DNA polymerase III beta subunit (EC 2.7.7.7) DR_0072 FIG00578444: hypothetical protein DR_0159 Uridine kinase (EC 2.7.1.48) DR_0167 protein of unknown function DUF955 DR_0370 Menaquinone via futalosine step 1 DR_0379 outer membrane protein DR_0470 Histidinol phosphatase (EC 3.1.3.15) DR_0474 ABC transporter, permease protein DR_0553 putative membrane protein DR_0554 hypothetical protein DR_0636 rRNA small subunit methyltransferase I DR_0661 Programmed cell death antitoxin YdcD DR_0670 Glyoxalase/Bleomycin resistance protein/dioxygenase domain DR_0739 FIG00577704: hypothetical protein DR_0771 Competence protein PilN DR_0888 FIG00788844: hypothetical protein DR_0889 hypothetical protein DR_0927 ABC transporter, ATP binding protein DR_0942 Tryptophan synthase alpha chain (EC 4.2.1.20) DR_0974 putative exported protein of unknown function DR_1002 Hemoglobin like protein HbO DR_1147 Prephenate dehydratase (EC 4.2.1.51) DR_1219 Ferrous iron transport protein B DR_1236 Cobalt zinc c admium resistance protein DR_1238 Homocitrate synthase (EC 2.3.3.14) DR_1257 L sorbosone dehydrogenase DR_1441 putative membrane protein DR_1448 hypothetical protein DR_1486 hypothetical Cytosolic Protein DR_1501 NADH ubiquinone oxidoreductase chain E (EC 1.6.5.3) DR_1574 Phosphatidylserine decarboxylase (EC 4.1.1.65) DR_1677 hypothetical protein DR_1867 Cell division protein FtsL DR_1948 Cell division trigger factor (EC 5.2.1.8) DR_1961 ankyrin related protein DR_1981 FIG00577911: hypothetical protein DR_2016 hypothetical protein DR_2034 aminoglycoside N3` acetyltransferase, type IV DR_2062 WD repeat family protein DR_2064 hypothetical protein

PAGE 94

94 Table 4 4 continued DR_2083 hypothetical protein DR_2150 Protein YidD DR_2173 molybdate metabolism regulator related protein DR_2196 hypothetical protein DR_2320 hypothetical protein DR_2321 Phenylacetic acid degradation protein PaaD, thioesterase DR_2353 L asparaginase (EC 3.5.1.1) DR_2471 Acetyl coenzyme A synthetase (EC 6.2.1.1) DR_2578 tRNA guanine transglycosylase (EC 2.4.2.29) DR_2620 Cytochrome c oxidase polypeptide I (EC 1.9.3.1) / Cytochrome c oxidase polypeptide III (EC 1.9.3.1) DR_A0009 sensor histidine kinase DR_A0012 ribosomal protein S2 related protein DR_A0048 Mannose 6 phosphate isomerase (EC 5.3.1.8) DR_A0072 hypothetical protein DR_A0186 cytochrome P450, putative DR_A0196 Isovaleryl CoA dehydrogenase (EC 1.3.99.10) DR_A0221 glucan synthase 1 related protein DR_A0224 homoprotocatechuate 2,3 dioxygenase DR_A0283 serine protease, subtilase family DR_A0317 HupE UreJ family metal transporter DR_A0344 SOS response repressor and protease LexA (EC 3.4.21.88) DR_A0345 hypothetical protein DR_A0366 hypothetical protein DR_B0017 iron chelator utilization protein DR_B0100 hypothetical protein DR_B0137 Possible restriction /modification enzyme

PAGE 95

95 Figure 4 1. HPLC analysis of digested nucleotides from tRNAs harvested from D. radiodurans wild type and mutants . Mutation of tsaB or tsaD eliminate t 6 A.

PAGE 96

96 Figure 4 2 Phylogenetic tree of IleRS. The phylogenetic tree was constructed using phylogeney.fr ( www.phylogeny.fr/ ) using the default settings.

PAGE 97

97 Figure 4 3. Whole genome codon usage of A) D. radiodurans , B) E. coli , C) S. mutans , and D) H. volcanii . Codon usage was determined using a custom Java script modified from.bioinfomatics.org/sms. Final graphics were produced in Excel. AUA codon is indicated by red arrow.

PAGE 98

98 Figure 4 4. HPLC analysis of digeste d tRNAs from Synechocystis PCC6801 and tsaD . tsaD does not contain t 6 A.

PAGE 99

99 Figure 4 5. HPLC analysis o f digested tRNAs from S. mutans and tsaE . tsaE does not contain t 6 A, and can be restored by complementation to wild type levels.

PAGE 100

100 CHAPTER 5 CELLULAR ROLES OF t 6 A Background The TsaC/Tcs2 and TsaD/Tcs3/Tcs4 families had been at the top of a list of 10 conserved hypothetical proteins to functionally characterize. 143 In yeast, TCS2 (previously referred to as SUA5 ) was discovered as a suppressor of a translational initiation defect in the cyc1 1019 allele. 21 cyc1 1019 contains an aberrant upstream and out of frame AUG resulting in ~2% of the normal Cyc1 protein. Suppressors would bypass the out of frame AUG and initiate at the correct downstream AUG, increasing the amount of Cyc1p. 21 The suppressor phenotype was mapped to TCS2 , and a mutation conferred several pleiotropic phenotypes, including suppression of cyc1 1019 , slow growth, and the inability to grow on non fermentable carbon sources. 21,144 Interestingly, the suppression was not at the transcriptional level, and the biochemical function of Tcs2p remained unsolved. 21 The function of the TsaD/ Tcs3 / Tcs4 family was equally as enigmatic as the TsaC/Tcs2 family. The bact erial member was wrongly annotated as an O sialoglycoprotein endopeptidase, 145,146 but this function could not be confirmed. 147 Disruption of TCS3 or TCS4 in yeast led to slow growth, shortened telomeres, loss of mi tochondrial DNA integrity, and the inability to grow on non fermentable carbon sources. 65 68 Many more phenotypes h ave been associated with genetic disruptions of these two protein families, listed in Table 5 1, until the function for these protein families were linked to t 6 A.

PAGE 101

101 The first indication of the cellular role of t 6 A was presented in the original identification in yeast of the role of Tcs2 and Tcs3 in t 6 A formation, where the deletion of the genes results in an increase in +1 and 1 frame shifts and mis initiation at CUG. 61,64 Further studies in yeast linked loss of TCS2 with increases in leak y scanning bypassing start codons, +1 frame shifts (using the well characterize d EST3 +1 frame shift sequence CUU AGU), read through of UAG, CAG, UGA, and CGA stop codons, and an increase in internal ribosome entry site translation (IRES dependent initiati on of translation). 148 Polysome profiles of TCS2 depletion (P TET :: TCS2 , this strain requires doxycycline for expression of TCS2 ) revealed abnormalities with ribosome assembly, but this phenotype was not suppressed by over expression of the ternary complex (TC, eIF2 and Met tRNA iMet ). 148 Additionally, over expression of TC or initiator tRNA Met ( IMT4 ) did not rescue the slow growth phenotype. 148 TCS2 depletion had increased levels of the transcriptional activator GCN4 (Gcd phenotype), but in a non canonical manner. 148 GCN4 is a positive regulator of ge nes expressed during amino acid starvation, and is dependent on eIF2 phosphorylation by GCN2 , which monitors uncharged tRNAs. 149,150 Over expression of tRNA iMet or d eletion of GCN2 did not reduce the higher levels of GCN4 in an TCS2 depletion background. 148 Paridoxially , GCN4 induction in the TCS2 depletion strain was independent of GCN2 phosphorylation, and independent of uncharged tRNAs. 148 GCN4 is also regulated at the translational level by four upstre am open reading frames (uORFs), where the scanning ribosome initiates translation at the first AUG in the uORF leading to bypass of initiation at the AUG of the downstream

PAGE 102

10 2 ORF. 151 TCS2 d epletion leads to increased translation of the main ORF ( GCN4 ) by bypassing the regulatory uORFs. 148 Over expression of TC or tRNA iMet did not reduce the leaky scanning seen in TCS2 depletion. 148 In an interesting parallel, mutation of Tcs3, Tcs5, and Tcs8 of eTCTC in yeast also increased GCN4 . 92 These data led to a model where hypo modified tRNAs pair less efficiently A Arg ACU is rare) causing ribosome stalling leading to +1 frame shifts, and hypo modified tRNAs pair less efficiently with AUG, failing to pause the 43S scanning ribosome to trigger 80S ribosome assembly. Additional evidence supporting frame shifting by hy po modified tRNA was recently reported. In yeast, three of the tRNAs containing U 34 are modifi ed by Trm9 and Elp1 6 to form 5 methoxycarbonylmethyl (mcm 5 ) and by Ncs2/Ncs6 to 2 thio (s 2 ). 15 The mcm 5 s 2 U modified tRNAs include tRNA Lys UUU , tRNA Gln UUG , and tRNA Glu UUC . 14 Mutation in the biosynthesis of mcm 5 s 2 U leads to slow growth, inability to grow on non fermentable carbon sources, and telomere shortening, 29 31,34,152,153 phenotypes similar to those seen in t 6 A biosynthesis mutations. Over expression of a single tRNA, tRNA Lys UUU , suppresses all of these phenotypes, and additional data suggest that mcm 5 s 2 U acts as a regulator of translation by aiding programmed +1 frame shifts. 90,154 The reasons for the similarity of the phenotypes seen for disruption of mcm 5 s 2 U and t 6 A are unknown. One possibility is modification of A 3 7 to t 6 A is required for the formation of the mcm 5 s 2 U, or vice versa.

PAGE 103

103 We sought to understand the diversity of phenotypes of t 6 A and the relationship between mcm 5 s 2 U and t 6 A. First, we examined if TC AMP produced in the cytoplasm would function in the mitochondria . Next we examined if over expression of tRNAs suppressed t 6 A phenotypes, and examined the relationship of mcm 5 s 2 U and t 6 A. Finally, we employed genome wide ribosome profiling to catalog all translational ambiguities in tcs2 . Results TC AMP P roduced in the C ytoplas m is not Sufficient for Mitochondrial F unction The cellular concentration of Tcs2p is low , with less than an estimated 600 molecules per cell . 96 As discussed in Chapter 3, Tcs2p of S. cerevisiae is targeted to both the cytoplasm and the mitochondria through the use of two AUG translational starts. Translation beginning at the first AUG contains the mitochondria targeting sequence directi ng Tcs2p to the mitochondria. Translation beginning at the second AUG retains Tcs2p in the cytoplasm. To test if TC AMP could be shuttled from the cytoplasm to the mitochondria, a series of plasmids was constructed using a cytoplasmic targeted Tcs2p , TsaC from E. coli , and TsaC2 from B. subtilis . T o mimic the naturally low expression of TCS2 , the genes were expressed under the control of the galactose inducible promoter ( P GAL ) in the low copy CEN/ARS plasmid pRS313. P GAL is known to be leaky, even in the presence of glucose . 155 The cytoplasmic targeting Tcs2p (10 426) was therefore sub cloned , along with P GAL , from pYesDEST52 into pRS313 (creating pPCT070) to allow low level expression of Tcs2 (10 426) in the absence of th e galactose inducer. This also eliminates possible interfering growth on galactose when

PAGE 104

104 testing growth with glycerol as the carbon source. P GAL :: tsaC Ec (pPCT074), P GAL :: ywlC Bs (pPCT075), and P GAL :: TCS2 Sc (pBY176) were constructed using the same pRS313 as t he backbone. Yeast strains with mutations in TCS2 show slow growth in glucose containing media and cannot utilize the non fermentable sugar alcohol glycerol as a sole carbon source . 61,148 Supplying P GAL :: TCS2 (10 426) , P GAL :: tsaC Ec , P GAL :: tsaC2 Bs , or P GAL :: TCS2 Sc in trans suppressed the growth defect of tcs2 strain using glucose as a carbon source , implying the corresponding proteins were functi onal in the cytoplasm Figure 5 1 A . However, only P GAL :: TCS2 Sc restored growth on glycerol, albe it with a longer lag phase, Figure 5 1 B. These results suggest that these proteins produced ample amount of TC AMP in the cytoplasm for growth on glucose and that TC AMP was not being shuttled to the mitochondria, as seen by the inability of P GAL :: TCS2 (10 426) , P GAL :: tsaC Ec , or P GAL :: tsaC2 Bs to grow on glycerol. This indicates that i mp ort of Tcs2p in to the mitochondria is required for this organelle to be functional. Tcs2p M ust be T argeted to the M itochondr ia for Grow th on G lycerol To directly test if mitochondrial targeting Tcs2p was required for mitochondrial function, a series of pla smids was prepared that use the native TCS2 promoter to drive constructs targeting Tcs2p to the cytoplasm, mitochondria, or both. Site directed mutagenesis was performed on pBY176 61 ( TCS2 plus 200 nt upstream cloned into the low copy plasmid pRS313) to mutate the first methionine to leucine (M1L), creating pPCT076 (cytoplas mic only), or the second methionine to leucine (M10L), creating pPCT078 (mitochondrial only). All

PAGE 105

105 three TCS2 containing plasmids, as well as the parental pRS313, were transformed in BY4742 and tcs2 with selection on SD his agar. Mitochondrial function wa s assayed by growth on the non fermentable carbon source glycerol. As expected, expression of any of the TCS2 constructs did not have an effect on the growth of BY4742 using glucose or glycerol as a carbon source, Figure 5 2 A and B. Expression of cytoplas mic targeting TCS2 (M1L) or mitochondrial targeting TCS2 (M1 0 L) complemented tcs2 to the same levels as complementation using wild type TCS2 when glucose was used as a carbon source, Figure 5 2 A. When glycerol was used as a carbon source, only wild type TC S2 and mitochondrial targeting TCS2 (M1 0 L) could complement tcs2 , Figure 5 2 B. This complementation assay corroborates the GFP localization data presented in Chapter 3. Tcs2p is dual targeted to both the cytoplasm and the mitochondria through the use of alternative translational starts. Translation from the first AUG is required for the protein to contain the mitochondrial targeting sequence for subsequent localization to the mitochondria to produce TC AMP in the organelle. Relationship of mcm 5 s 2 U 34 and t 6 A 37 Mutation in any of biosynthesis genes involved in the formation of mcm 5 s 2 U 34 and t 6 A 37 give similar phenotypes. One possibility for the similar phenotypes is one of the modifications is required for the formation of the other. To test this hypothesis, tRNAs were purified from elp3 (part of the Elongator complex responsible for the cm 5 subunit), trm9 (methylates cm 5 to mcm 5 ), ncs2 , and ncs 6 (Ncs2p and Ncs6p form a complex to create the s 2 subunit).

PAGE 106

106 HPLC analysis with detection at 254 nm revealed each of these mutants contained the same amount of t 6 A (peak at 23.57 minutes) as the parental BY474 1 strain, Figure 5 3 A. To analyze the t 6 A synthesis mutants for mcm 5 s 2 U , the retention time for mcm 5 s 2 U first needed to be established. HPLC analysis with detection at 313 nm (for detection of thio moieties) of nucleosides of tRNAs purified from elp3 , tr m9 , ncs2 , and ncs 6 revealed the mcm 5 s 2 U peak at 24.35 minutes, which was unique to BY4741 but absent in all the mutants, Figure 5 3 B. Also, a peak at 14.20 minutes appeared only in elp3 , which corresponds to s 2 U, Figure 5 3 B. The chromatographic patt erns match previously published reports. 30 Analysis with detection at 313 nm of nucleosides of tRNAs purified from mutants in t 6 A biosynthesis revealed all strains possessed the peak at 24.35 minutes corresponding to mcm 5 s 2 U , Figure 5 3 C. Interestingly, all mutants in t 6 A synthesis had higher levels of mcm 5 s 2 U as compared to BY4741, with tcs7 the highest, Figure 5 3 C. None of the mutants in t 6 A synthesis h ad the peak at 14.20 minutes corresponding to s 2 U that is unique to elp3 , Figure 5 3 C. These results indicate that mcm 5 s 2 U 34 and t 6 A 37 do not require one another for formation. Overexpression of tRNAs for E lo ngation or TC do not Suppress the Growth D efec t of tcs2 Disruption of genes involved in the modification of mcm 5 s 2 U 34 and t 6 A 37 have several phenotypes in common. Expression of tRNA Lys UUU is sufficient to suppress all the phenotypes seen in mutation of mcm 5 s 2 U synthesis. 90 Prior results expressing tRNA iMet or TC failed to suppress the growth defect of tcs2 depletion . 148 To assess if tRNAs used during tr anslation elongation could

PAGE 107

107 suppress the slow growth rate seen in mutant of t 6 A synthesis, an expression plasmid containing tRNA Lys UUU and empty vector were transformed into BY4741, tcs2 , tcs3 , tcs5 , and tcs8 . Unlike mcm 5 s 2 U , expressing tRNA Lys UUU did n ot suppress the growth defect of mutants in t 6 A synthesis, Figure 5 4 A. Additionally, tRNA Ile AAU , tRNA eMet CAU , tRNA Asp GUU , tRNA Lys CUU , and tRNA Glu UUC (does not contain t 6 A and decodes GUU, which is the most frequently used codon in S. cerevisiae ) were tes ted in tcs2 . None, of the tRNAs tested suppressed the growth defect of tcs2 , Figure 5 4 B. To confirm the results of TCS2 depletion used in Lin et al ., plasmids over expressing tRNA iMet , eIF2 , or TC were transformed into BY4741 and tcs2 . In agreement w ith the previous results, tRNA iMet , eIF2 , nor TC suppressed the slow growth of tcs2 , Figure 5 4 C. The results thus far indicate t 6 A is required for accurate translation. The effect of the loss of t 6 A appears to be more complicated than loss of mcm 5 s 2 U 34 , since overexpressing any of the single tRNAs do not suppress the growth defect, and over expressing TC does not suppress defect in initiation. 148 To examine genome wide translation defects, we employed ribosome profiling presented below. Ribosome Profiling of tsc2 Ribosom e profiling provides genome wide information on protein synthesis. The basis of the analysis is high throughput sequencing of mRNA fragments protected by the ribosome during translation. This technique allows for high resolution of ribosome density on an i ndividual mRNA with nucleotide resolution for the position of the ribosome. In addition to positional information,

PAGE 108

108 ribosome profiling can measure differential gene expression at the level of translation, translation outside of annotated open reading frames (ORFs), ribosomal pausing, frame shifting, and read through of stop codons. A detailed description of purification of the ribosome protected fragments (RPFs) and sequencing can be found in Chapter 2 and is summarized in Figure 5 5. Polysome phenotype An essential step in ribosome profiling is ensuring high quality polysomes are prepared. Polysome quality is checked by sucrose gradient sedimentation and subsequent analysis with a fraction analyzer, detailed in Chapter 2. Polysomes prepared from tcs2 exhib represented by a shoulder after the 80S peak on the chromatograph, blue arrow in Figure 5 6 B. Half mers indicate excess 40S ribosome and incomplete assembly of the 80S particle, which may lead to problems with initiatio n. 19 The half mer phenotype of tcs2 was not seen in a prior publication examining a TCS2 depletion strain . 148 These results may differ due to strain genotypes or technical differences in the preparation of the polysomes. Sequencing, quality control, and read mapping Four sequencing libraries were prepared from the 28 mer ribosome protected fragments (RPFs) purified from two biological replicates of BY4742 and tcs2 . Each library was sequenced on a single lane of Illumina HiSeq 2000 with 50 cycle single end reads to maximize the numbers of reads for each small RNA library. Approximately 2 x 10 9 reads were obtained for each sample. Quality was assessed using FastQC ( http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ), and adaptors were

PAGE 109

109 removed using CutAdapt. 156 To remove contaminating reads corresponding to rRNA, reads were mapped against an rRNA index from the Saccharomyces Genome Database (SGD) using Bowtie2 with the default settings. 157 Reads not mapping to rRNA were mapping against the SacCer3 index (SGD) using Bowtie2. Approximately, 1.3 x 10 8 reads from each sample were mapped to the S. cerevisiae genome. Differential expression between samples w ere determined using a custom R script (from Rachel Legendre, U. Paris Sud) to implement DESeq, with multiple testing correction using Benjamini and Hochberg. 158 160 Significant differences between wild type and mutant were declared at an adjusted alpha of 0.05. Precision of the biological replicates was very high with R = 0.9881 and R = 0.9959 for BY4742 and tcs2 , respectively. RPFs differentially expressed in tcs2 Analysis of RPFs differentially expressed in tcs2 revealed 196 genes were increased and 111 genes were decreased versus wild type, a complete list of genes and functional roles are provided in the Appendix as Table A 1 and Table A 2. To determine if any functional relationship existed between these differentially expressed genes, gene ontology (GO) enrichment was performed using YeastMine ( http://yeastmine.yeastgenome.o rg ). 81 The 196 genes increased in RPFs were grouped into 15 GO terms, Table 5 2, centered on core metabolic processes. In fact, the pathway for arginine biosynthesis was enriched, P = 0.049, with five genes, ARG5,6, CPA2, ARG7, ARG1, and CPA1 , identified, Figure 5 8. Of the 111 genes de creased in RPFs, 5 matched the GO term polyphosphate metabolic process, P = 0.003, and no pathway enrichment was identified.

PAGE 110

110 Analysis of frame shifts in BY4742 and tcs2 A unique aspect of decoding of mRNA by the ribosome is how the ribosome moves along the mRNA. The ribosome does not move forward smoothly base by base, but rather ratchets forward 3 bases at a time in a mechanism called triplet periodicity. 161 To take advantage of triplet periodicity, the size of the ribosome RNA footprint must be known in order to predict which codon is in the P or A sites. For yeast, the RPF is 28 nucleotides. 162 To analyze t he frame of each ribosome, only 28 mers that aligned uniquely to the genome and did not contain mismatches were used. 6.5 x 10 6 reads in wild type and 5.8 x 10 6 reads in tcs2 matched these strict criteria. For each read, the nucleotide at position +12, wh ich corresponds to the ribosomal P site, was determined and the identity of this nucleotide determined the frame of the read, hence the frame of the ribosome, Figure 5 9. Each ORF was divided into windows of approximately 300 nucleotides (minimum of 3 wind ows per ORF to a maximum of 9), and reads inside of each window were assessed and counted. There are four well documented examples of +1 frame shifts occurring in S. cerevisiae . One known +1 frame shift, TRM140 (an A doMet dependent tRNA methyltransferase ) , was detected in both BY4742 and tcs2 and is illustrated in Figure 5 10 A and B. For translation of full length Trm140p, the ribosome must undergo a +1 frame shift at nucleotide 832. As seen in Figure 5 10 A and B, nearly 100% of the reads begin in Frame 0, then after base 832, nearly 100% of the reads are in the +1 frame. Other than transposable elements, there are no well documented examples of 1 frame shifts occurring in S. cerevisiae . In tcs2 , potential 1

PAGE 111

111 frame shifts were detected, and as an examp le of a potential 1 frame shift occurring in tcs2 is BDP1 (a subunit of RNA polymerase III), Figure 5 11. Nearly 100% of the reads begin in frame 0, but after nucleotide 1200, more than 50% of the reads are in the 1 frame. The frame shift analysis revea led 87 ORFs with potential frame shifts in BY4742, and 213 ORFs with potential frame shifts in tcs2 , Table A 3 and Table A 4. GO term enrichment of genes with frame shifts revealed a single biological process, cytoplasmic translation, was enriched in both strains, with 16 genes in BY4742 ( P = 4 x 10 6 ) and 35 genes in tsc2 ( P = 3 x 10 11 ). 53 ORFs were found to have frame shifts in both BY4742 and tsc2 , Table A 3, grey boxes, 10 of which had GO terms relating to cytoplasmic translation ( P = 0.007). Out o f the 213 genes with frame shifts unique to tcs , 25 had GO terms relating to cytoplasmic translation ( P = 4 x 10 6 ). Interestingly, global analysis of frame shifts, by summing all reads used to determine frame, indicates that 80% of all reads from the ri bosome profiling are in the correct, annotated frame (Frame 0). There is not a significant difference in frame shifting between wild type and mutant, Figure 5 12. The data indicate that loss of t 6 A is causing frame shifts at discrete sequences, or codons, and that loss of t 6 A is not causing a global, cataclysmic alteration of reading frame. Analysis of upstream open reading frames (uORFs) Upstream open reading frames (uORFs) provide translational regulation of a downstream ORF . GCN4 , a transcriptional activator o f amino acid biosynthetic genes, is the best example of an ORF with regulatory uORFs. There are four uORFs providing translational regulation of the main GCN4 . 151 Recently, a fifth

PAGE 112

112 uORF, with a non AUG start, was identified by ribosome profiling, 163 but uORF 5 does not provide translation regul ation of GCN4 . 164 Figur e 5 13 demonstrates the ability of ribosome profiling to detect uORFs, using GCN4 as an example . Unfortunately, there are many p roblems with detecting uORFs . First, the locational c oordinates of uORFs are not annotated the reference genome , even for GCN4 . Very few uORFs have been functionally characterized . And finally, confusion lies in what defines a uORF. As little as one codon has been described as regulatory. 165 All of these issues combine to prevent genome wide automated detection and statistical analysis of uORFs. Analysis of stop codon read through To determine if a ribosome is reading through a stop codon, a strict set of definit ions is used, as previously defined by Dunn et al . 166 For a gene to be called as having read though, the following qualifications must be met: 1) it is covered by more than 128 read s; 2) there are reads after an annotated stop codon ; 3) there are reads overlappin g the next in frame stop codon; 4) there is not an AUG codon in the next five codons downstream of the official stop codon; 5) there is homogeneous coverage in the extension . Using these rules, 59 genes in BY4742 and 78 genes in tcs2 were defined as having a stop codon read through, Table A 5 and Table A 6. Of the 78 in tcs2 , 50 were in common with BY4742, Table A 6, shaded grey. Neither sets of genes contained any GO enric hment terms. Analysis of potential initiation at upstream non AUG start sites The previous literature examining a mutation in TCS2 noted problems with recognition of the correct AUG for initiation. 148 To catalog initiation of translation at any non conical codons, a strict set of parameters was defined to parse the

PAGE 113

113 profiling data. First, a GUG, UUG, or GUC codons (the most frequently used non AUG initiation codons in yeast) 167 171 must be within 100 nt upstream of an ORF. The non AUG codon must be in frame of a downstream AUG with no stop codons between the non AUG and downstream AUG. Finally, a minimum of 128 reads was required to c over the non AUG site. In yeast, there are two well characterized occurrences of non AUG initiation occurring upstream of the annotated AUG start site. ALA1 encodes both the c ytoplasmic and mitochondrial alanyl tRNA synthetase . The cytoplasmic form of Ala1 p is translated from the annotated AUG, and the mitochondrial form is translated from a double ACG ACG codon located at 25 and 24 in relation to AUG. 172 GRS1 encodes the c ytoplasmic and mitochondrial glycyl tRNA synthase . The cytoplasmic form of Grs1p is translated from the annotated AUG, and the mitochondrial form is translated from a UUG codon located at 26, relative to the AUG. 171 In both BY4742 and tcs2 , initiation at the upstream non AUG codons can be detected for ALA1 and GRS1 , Fi gure 5 14 A and Figure 5 14 B. The analysis of non AUG initiation was expanded to the entire profiling dataset. For the three codons analyzed, tcs2 contain nearly twice as many non AUG starts as BY4742. For initiation at UUG, BY4742 contained 140 genes, Table A 7, and tcs2 contained 260, Table A 8. For initiation at ACG, BY4742 contained 98 genes, Table A 9, and tcs2 contained 169, Table A 10. For initiation at GUG, BY4742 contained 62 genes, Table A 11, and tcs2 contained 134, Table A 12. None of thes e sets of genes contained any GO enrichment

PAGE 114

114 terms. Currently, the functional implication of these observations is not understood. Codon occupancy at the ribosome A, P, and E sites. Having established the ability to detect differences in translation based o n the detection of codons, codon occupancy at each site in the ribosome was analyzed. Using the previously established method to identify frame shifts using codon occupy the P site, a list of every codon occupying the ribosomal A (acceptor), P (peptidyl tr ansfer), and E (exit) sites was compiled. Comparing the Log 2 fold change of codon occupancy in the A, P, and E sites of tcs2 and BY4742 produced a global summary of decoding in the absence of t 6 A, Figure 5 15. The ribosomal A site for tcs2 was increase d in occupancy for the following codons: AUA, ACG, AGG, AGU, AUG, ACA, AAA, and AAU. Codons decreased in occupancy of the A site included: AUU, AAC, AUC, AGA, AGC, ACU, ACC, and AAG. All the codons with increased occupancy in the A site fell into two categor ies: the codons are decoded by rare tRNAs (only 1 4 copies of tRNAs genes are encoded in the chromosome) or they are decoded by a G 34 :U 3 wobble, as for AAU (decoded by tRNA Asn (GU U) ). The codons decreased in A site occupancy also fall into two categories: t he genome contains a higher number of copies of these tRNAs genes (4 13 genes) or the codons are decoded by an I 34 :C 3 wobble, as for AUC (decoded by tRNA Ile ( IAU) ) and ACC (decoded by tRNA Thr (IGU) ). Figure 5 16 presents a graphic explaining the tRNAs availa ble for decoding each codon and number of genes, and colors used in Figure 5 16 matches those used in Figure 5 15.

PAGE 115

115 The pattern found for A site occupancy, also holds true for P site and E site occupancies. Codons that are decoded either by tRNAs with low g ene count or codons that require G:U wobble are increased in ribosomal occupancy. Codons that are decoded by tRNA with high gene counts or I:U wobble or reduced in occupancy , indicating these codons may be decoded faster . Comparison of RPFs Differentially E xpressed in tcs2 Expression D ata Prior to the identification of the link of eTCTC (eukaryotic t hreonyl c arbamoyl transferase complex) proteins to t 6 A synthesis, microarray analysis was performed on mutations in the complex. 92 The results of the microarray experiments implicated eTCTC in transcriptional activation due to an upregulation in genes regulated by G cn4 p. 92 Additionally, a recent publication using ribosome profiling examines mutations of the mcm 5 s 2 U 34 modification also found a link to upregulation of GCN4 . 32 RPFs mapping to GCN4 was increased 6 fold in tcs2 versus BY4742, which could explain the upregulation of genes by Gcn4p. Serendipitously, both of the prior studies were performed in the same haploid parent of yeast grown in YPD media , allowing for easy comparison of differentially expressed genes. Differentially expressed genes in tcs2 Microarray analyses using point mutants in tcs3 18 , tcs6 4, and a temperature sensitive allele of tcs8 ts1 revealed disruption of eTCTC caused an upregulation of genes involved in arginine and histidine biosynthesis pathways. 92 The genes increased in each analysis were compared to the ribosome profiling results of tcs2 . Of the 196 genes with increased RPFs in tcs2 , 29 were also

PAGE 116

116 increased in tcs3 18 , 30 were also in creased in tcs6 4 , and 12 were also increased in tcs18 ts1 , summarized in Figure 5 17, with genes listed in Tables 5 3, 5 4, and 5 5. There are 12 increased genes common to all four datasets, Table 5 6. As seen in Tables 5 3 through 5 6, mutation of TCS2 or eTCTC members increa sed expression of genes involved with amino acid biosynthesis. Interesting, eTCTC mutations increased genes regulated by Gcn4p, but GCN4 itself was not increased in the microarray analysis. In contrast, GCN4 expression was increased in tcs2 RPFs. This dif ference may be due to an upregulation of translation detected by the increased levels of RPFs in tcs2 , and transcription, as measured by the microarrays, is not changed. Differentially expressed RPFs in tcs2 ncs6 As described earlier, NCS6 forms a dimer with NCS2 to place a sulfur moiety into tRNAs to create mcm 5 s 2 U. Deletion of NCS6 abolishes the s 2 moiety and leads to many of the same phenotypes seen in t 6 A depletion. Ribosome profiling of ncs2 revealed genes with increased translation were centered around amino acid metabolism, and there was a significant 1.1 Log 10 fold change increase in GCN4 . 32 Comparison of genes increased in tcs2 and ncs6 revealed 19 in common, Table 5 7. Increased genes include GCN4 and several members of the arginine biosynthesis pathway, Table 5 7. Twelve genes are decreased in both tcs2 and ncs6 , including two ribosomal protein subunits and two phosphatases, Table 5 8.

PAGE 117

117 Genes increased in tcs2 GCN4 The number of genes proposed to be regulated by Gcn4p vary greatly, from less than 500 genes (microarrays measuring gene expression during histidine starvation) 149 to greater than 2500 genes (predicted computationally by SGD). T he most conservative estimate of Gcn4p induced genes was produced from a ChIP Chip assay, which found 128 genes bound during immunoprecipitation of Gcn4p. 173 Comparison of the RPFs differentially expressed in tcs2 with the 128 well defined Gcn4 regulated genes reveals 15 genes increased in tcs2 are regulated by Gcn4p, while no genes decreased in tcs2 are regulate d by Gcn4p, Figure 5 18. The 15 Gcn4p regulated genes increased in tcs2 are involved in amino acid synthesis, with six in the arginine synthesis pathway, Table 5 9. Only 8% of RPFs increased in tcs2 are in common with the Gcn4p ChIP data. Discussion Man y pleiotropic phenotypes in eukaryotes have been associated with disruptions in t 6 A biosynthesis, Table 5 1. The first indication of the cellular role of t 6 A was presented in the original identification of the role of Tcs2p in t 6 A formation in S. cerevisiae . Deletion of TCS2 resulted in an increase in +1 and 1 frame shifts and mis initiation at CUG. 61,64 Subsequent work linked loss of TCS2 with increases in leaky scanning bypassing start codons, read through of UAG, CAG, UGA, an d CGA stop codons, and an increase in IRES initiation of translation. 148

PAGE 118

118 Mitochondria R equire Tcs 2 p for F unction C ells producing only a cytopl asmic version of Tcs2p present a mitochondrial defect, as evidenced by the inability of these cells to grow on the non fermentable c arbon source glycerol. The same phenotype was observed for tcs4 S. cerevisiae , 67 indicating that t 6 A modification is required for the normal functioning of mitochondria. Our data also indicate s that TC AMP produced in the cytoplasm is not transported (in sufficient amounts) to the mitochondrial matrix, which is in line with the unstable nature of this intermediate. Tcs2p must be targeted to the mitochondria where TC AMP is produced for use in the organelle. No P arallel B etween t 6 A and mcm 5 s 2 U Mutation in any of the biosynthesis genes involved in the formation of mcm 5 s 2 U 34 and t 6 A 37 give similar phenotypes. One possibility for the similar phenotypes is one of the modifications is required for the formation of the other. HPLC analysis demonstrated mutation in mcm 5 s 2 U 34 does not alter t 6 A content, and strains mutated for t 6 A contain mcm 5 s 2 U 34 , implying that one modification does not require the other. Overexpressing tRNA Lys UUU suppresses the slow growth phenotype of a mutation in mcm 5 s 2 U. 90 This was not the case for t 6 A. Additionally, overexpressing several different t 6 A modified tRNAs did not suppress the growth defect. Also, overexpressing ternary complex ha d no effect, leading to the conclusion that the loss of t 6 A appears to be more complex than loss of mcm 5 s 2 U 34 .

PAGE 119

119 Depletion of t 6 A Induces Starvation R esponse Ribosome profiling provides genome wide information on protein synthesis. The 196 genes that were increased in RPFs grouped into 15 GO terms, Table 5 2, and centered on core metabolic processes, with the pathway for arginine biosynthesis enriched. GCN4 , th e master regulator for amino acid synthesis, is increased 6 fold in tcs2 . Interestingly, the increase in GCN4 is not coupled with an increase in its regulator GCN2 , which monitors pools of uncharged tRNAs. Two previous reports examining t 6 A reported simil ar results, and ruled out pools of uncharged tRNAs and Gcn2p as activating GCN4 leading to the Gcd phenotype (translational depression of GCN4 not caused by Gcn2) . 92,148 One explanation for the Gcd phenotype is bypass of the regulatory uORFs caused by t 6 A defecentcy leading to activation of the downstream GCN4 open reading frame. t 6 A Depletion Leads to Translation A mbiguities Analyses des igned to document to translational defects caused by absence of t 6 A revealed increases in errors at every step of translation. In the tcs2 occurrence of initiations at upstream non AUG starts were doubled, read through was increased 50%, and frame shifts were increased 2.5 times compared to wild type. Even though the occurrences of frame shifts are increased, the vast majority, approximately 80%, were in the correct annotated frame. Effect of t 6 A Varies Depending on Codon: Anticodon P airing The codon occ upancy data indicate t 6 A can both help and hurts tRNAs in decoding. The codons increased in occupancy in tcs2 low number tRNA

PAGE 120

120 genes (rare) or G 3 4 :U 3 wobble, the ones decreased are higher number genes or I 34 :C 3 wobble. The work from Farabaugh showed the tRNA modification queuosine (Q 34 ) has opposite effects depending on identity of the 3 rd base of the codon; 174 similarly, t 6 A helps rare tRNAs and G:U mismatches compete with Watson: Crick decoding tRNAs. Codons increased in oc cupancy correspond to codons spending more time in the ribosome; hence, the tRNAs are decoding slower and are less competitive. tRNAs that are slow to decode, like tRNA Arg CCU decoding AGG, are linked to ribosomal pausing and +1 frame shifting. 174 176 Codons with lower occupancy are decoded faster and t 6 A could hinder or slow decoding of high abundance tRNAs and tRNAs using the wobble U:C base pairings, possibly to control the rate or accuracy of translation. 177 t 6 A as a Sensor of Nutrient Levels to Fine Tune T ranslation In y east, decoding of the a rg inine/s er ine split box is interesting. The 4 box decoding a rg inine and s er ine do not use t 6 A modified tRNAs. The 2 box s er ine is decoded by a single i 6 A 37 modified tRNA. The 2 box arginine is decoded by two t 6 A modified tRNAs , and decoding by these tRNAs are slower in tcs2 than wild type, Figure 5 15 . Analysis of iso acceptor usage patterns for genes that only use the 2 box arginine reveals approximately 300 genes. The vast majority of these are involved with energy production, with genes in the TCA cycle enriched , Table 7 1 . This would imply that as nutr itional supplies limit tRNA modification (low threonine reduces t 6 A) 178 , the cell is fine tuning energetically demanding processes or possibly reducing processes that produce reactive oxygen. A lso, unmodified tRNA Arg CCU is less competitive at decoding the AGG codon than the

PAGE 121

121 near cognate tRNA Lys UUU causing ribosome pausing leading to +1 frame shifts and mis sense mutations . 174

PAGE 122

122 Table 5 1. Phenotypes ass ociated with disruption of t 6 A enzymes TsaD ( TsaD / Tcs3 / Tcs4 ) Reference TsaC (Sua5/YrdC/YwlC) Reference Glycoprotease ( Pasteurella haemolytica ) 145,146 Translation factor 148 Respiration deficiency (yeast) 67 Suppressor of RF Ts mutation 179 Abnormal mitochondrial morpholo gy (yeast) 67 Ribosomal maturation factor AND Essential ( E. coli ) 180 Associate and inactivate Bud32 kinase (Yeast) 181 Nucleic acid b inding 63,182 Required for transcription regulation of essential genes as part of the EKC complex (yeast) 66 Telomere recombination 183 Required for genome maintenance ( E. coli and mitochondria of Yeast) 67,184 Telomeric DNA binding (and Telomere maintenance) 185 Abnormal cell shape en envelope defects ( E. coli ) 67,186 Respiration deficiency (yeast) 148 Atypical DNA binding protein ( P. abyssi ) AND Apurinic endonuclease ( P. abyssi ) 187 Prevents accumulation of AMP in ( E. coli ) 188

PAGE 123

123 Table 5 2. Gene Ontology Enrichment for Genes Increased in RPFs in tcs2 GO Term P value Number of Matches small molecule metabolic process 6.04E 06 57 single organism metabolic process 5.96E 05 99 cellular carbohydrate metabolic process 2.45E 04 23 carbohydrate metabolic process 2.62E 04 31 single organism process 2.99E 04 142 organonitrogen compound metabolic process 3.01E 04 47 single organism carbohydrate metabolic process 6.81E 04 28 carboxylic acid metabolic process 8.46E 04 32 arginine metabolic process 1.90E 03 7 oxoacid metabolic process 2.06E 03 32 organic acid metabolic process 2.17E 03 32 oxidation reduction process 2.59E 03 33 arginine biosynthetic process 3.97E 03 6 single organism catabolic process 2.31E 02 34 single organism carbohydrate catabolic process 2.72E 02 14

PAGE 124

124 Table 5 3 . Genes increased in expression common to tcs2 tcs3 18 Systematic Name Standard Name Description YBL043W ECM13 Non essential protein of unknown function YBR043C QDR3 Multidrug transporter of the major facilitator YBR054W YRO2 Protein of unknown function with similarity to archaeal rhodopsins YBR105C VID24 GID Complex regulatory subunit YBR147W RTC2 Putative vacuolar membrane transporter for cationic amino acids YB R256C RIB5 Riboflavin synthase YDR019C GCV1 T subunit of the mitochondrial glycine decarboxylase complex YER069W ARG5,6 Acetylglutamate kinase and N acetyl gamma glutamyl phosphate reductase YER175C TMT1 Trans aconitate methyltransferase YFL014W HSP12 Plasma membrane protein involved in maintaining membrane organization YGL117W Putative protein of unknown function YGL125W MET13 Major isozyme of methylenetetrahydrofolate reductase YGR088W CTT1 Cytosolic catalase T YJL079C PRY1 Sterol binding protein involved in the export of acetylated sterols YJR025C BNA1 3 hydroxyanthranilic acid dioxygenase YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YKR093W PTR2 Integral membrane peptide transporter YML116W ATR1 Multidrug efflux pum p of the major facilitator YMR062C ARG7 Mitochondrial ornithine acetyltransferase YMR095C SNO1 Protein of unconfirmed function YMR096W SNZ1 Protein involved in vitamin B6 biosynthesis YMR189W GCV2 P subunit of the mitochondrial glycine decarboxylase complex YNL036W NCE103 Carbonic anhydrase YNL104C LEU4 Alpha isopropylmalate synthase (2 isopropylmalate synthase) YNR069C BSC5 Protein of unknown function YOL058W ARG1 Arginosuccinate synthetase YOL119C MCH4 Protein with similarity to mammalian monocarboxylate permeases YOR130C ORT1 Ornithine transporter of the mitochondrial inner membrane YOR303W CPA1 Small subunit of carbamoyl phosphate synthetase

PAGE 125

125 Table 5 4 . Genes increased in expression common to tcs2 tcs6 4 Systematic Name Standard Name Description YBL043W ECM13 Non essential protein of unknown function YBR043C QDR3 Multidrug transporter of the major facilitator superfamily YBR054W YRO2 Protein of unknown function with similarity to archaeal rhodopsins YBR072W HSP26 Small heat shock protein (sHSP) with chaperone activity YBR256C RIB5 Riboflavin synthase YDR019C GCV1 T subunit of the mitochondrial glycine decarboxylase complex YER069W ARG5,6 Acetylglutamate kinase and N acetyl gamma glutamyl phosphate reductase YER175C TMT1 Trans aconitate methyltransferase YFL014W HSP12 Plasma membrane protein involved in maintaining membrane organization YGL117W Putative protein of unknown function YGR043C NQM1 Transaldolase of unknown function YGR088W CTT1 Cytosolic catalase T YGR248W SOL4 6 phosphogluconolactonase YJL079C PRY1 Sterol binding protein involved in the export of acetylated sterols YJR025C BNA1 3 hydroxyanthranilic acid dioxygenase YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YKR093W PTR2 Integral membrane peptide transporter YLR327C TMA10 Protein of unknown function that associates with ribosomes YML116W ATR1 Multidrug efflux pump of the major facilitator superfamily YML128C MSC1 Protein of unknown function YMR062C ARG7 Mitochondrial ornithine acetyltransferase YMR095C SNO1 Protein of unconfirmed function YMR096W SNZ1 Protein involved in vitamin B6 biosynthesis YNL036W NCE103 Carbonic anhydrase YNL104C LEU4 Alpha isopropylmalate synthase (2 isopropylmalate synthase) YNL160W YGP1 Cell wall related secretory glycoprotein YOL058W ARG1 Arginosuccinate synthetase YOL119C MCH4 Protein with similarity to mammalian monocarboxylate permeases YOR130C ORT1 Ornithine transporter of the mitochondrial inner membrane YOR303W CPA1 Small subunit of carbamoyl phosphate synthetase

PAGE 126

126 Table 5 5 . Genes increased in expression common to tcs2 tcs8 ts1 Systematic Name Standard Name Description YER069W ARG5,6 Acetylglutamate kinase and N acetyl gamma glutamyl phosphate reductase YER175C TMT1 Trans aconitate methyltransferase YGL117W Putative protein of unknown function YJL079C PRY1 Sterol binding protein involved in the export of acetylated sterols YJR025C BNA1 3 hydroxyanthranilic acid dioxygenase YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YMR062C ARG7 Mitochondrial ornithine acetyltransferase YMR095C SNO1 Protein of unconfirmed function YMR096W SNZ1 Protein involved in vitamin B6 biosynthesis YNL104C LEU4 Alpha isopropylmalate synthase (2 isopropylmalate synthase) YOL058W ARG1 Arginosuccinate synthetase YOR130C ORT1 Ornithine transporter of the mitochondrial inner membrane

PAGE 127

127 Table 5 6 . Genes increased in expression common to tcs2 tcs 18 , tcs6 4 , and tcs8 ts1 Systematic Name Standard Name Description YER069W ARG5,6 Acetylglutamate kinase and N acetyl gamma glutamyl phosphate reductase YER175C TMT1 Trans aconitate methyltransferase YGL117W Putative protein of unknown function YJL079C PRY1 Sterol binding protein involved in the export of acetylated sterols YJR025C BNA1 3 hydroxyanthranilic acid dioxygenase YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YMR062C ARG7 Mitochondrial ornithine acetyltransferase YMR095C SNO1 Protein of unconfirmed function YMR096W SNZ1 Protein involved in vitamin B6 biosynthesis YNL104C LEU4 Alpha isopropylmalate synthase (2 isopropylmalate synthase) YOL058W ARG1 Arginosuccinate synthetase YOR130C ORT1 Ornithine transporter of the mitochondrial inner membrane

PAGE 128

128 Table 5 7. Genes with increased RPFs in both tcs2 ncs6 Systematic Name Standard Name Description YAL061W BDH2 Putative medium chain alcohol dehydrogenase with similarity to BDH1 YDL174C DLD1 D lactate dehydrogenase YDR216W ADR1 Carbon source responsive zinc finger transcription factor YEL009C GCN4 bZIP transcriptional activator of amino acid biosynthetic genes YEL011W GLC3 Glycogen branching enzyme, involved in glycogen accumulation YFL014W HSP12 Plasma membrane protein involved in m aintaining membrane organization YGR043C NQM1 Transaldolase of unknown function YGR088W CTT1 Cytosolic catalase T YGR248W SOL4 6 phosphogluconolactonase YIR031C DAL7 Malate synthase YIR039C YPS6 Putative GPI anchored aspartic protease YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YKL161C KDX1 Protein kinase YKR039W GAP1 General amino acid permease YML128C MSC1 Protein of unknown function YMR062C ARG7 Mitochondrial ornithine acetyltransferase YNL036W NCE103 Carbonic anhydrase YNR001C CIT1 Citrate synthase YOR374W ALD4 Mitochondrial aldehyde dehydrogenase

PAGE 129

129 Table 5 8. Genes with decreased RPFs in both tcs2 ncs6 Systematic Name Standard Name Description YBR093C PHO5 Repressible acid phosphatase YER011W TIR1 Cell wall mannoprotein YFL034C A RPL22B Ribosomal 60S subunit protein L22B YGL089C MF(ALPHA)2 Mating pheromone alpha factor, made by alpha cells YGL255W ZRT1 High affinity zinc transporter of the plasma membrane YHR215W PHO12 One of three repressible acid phosph atases YIL011W TIR3 Cell wall mannoprotein YJR047C ANB1 Translation elongation factor eIF 5A YLL052C AQY2 Water channel that mediates water transport across cell membranes YML058W A HUG1 Protein involved in the Mec1p mediated checkpoint pathway YMR006C PLB2 Phospholipase B (lysophospholipase) involved in lipid metabolism YPL081W RPS9A Protein component of the small (40S) ribosomal subunit

PAGE 130

130 Table 5 9. Genes with increased RPFs in tcs2 GCN4 regulation Systematic Name Standard Name Description YBR043C QDR3 Multidrug transporter of the major facilitator superfamily YBR256C RIB5 Riboflavin synthase YER069W ARG5,6 Acetylglutamate kinase and N acetyl gamma glutamyl phosphate reductase YGL125W MET13 Major isozyme of methylenetetrahydrofolate reductase YGL184C STR3 Peroxisomal cystathionine beta lyase YJR025C BNA1 3 hydroxyanthranilic acid dioxygenase YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YMR062C ARG7 Mitochondrial ornithine acetyltransferase YMR095C SNO1 Protein of unconfirmed function YMR096W SNZ1 Protein involved in vitamin B6 biosynthesis YNL104C LEU4 Alpha isopropylmalate synthase (2 isopropylmalate synthase) YOL058W ARG1 Arginosuccinate synthetase YOL119C MCH4 Protein with similarity to mammalian monocarboxylate permeases YOR130C ORT1 Ornithine transporter of the mitochondrial inner membrane YOR303W CPA1 Small subunit of carbamoyl phosphate synthetase

PAGE 131

131 Figure 5 1. TC AMP produced in the cytoplasm does not support mitochondrial function . Points represent the average of five biological replicates. Error bars represent standard deviation. (A) Complementation of tcs2 grown on 2% glucose. Growth implies the corresponding proteins were functional in the cytoplasm. (B) Complementation of tcs2 grown on 2% glycerol. Only P GAL ::Tcs2 Sc restores growth , suggesting that import of Tcs2 p into the mitochondria is required for this orga nelle to be functional and that TC AMP produced in the cytoplasm is not transported into the mitochondria in sufficient amounts.

PAGE 132

132 Figure 5 2. Growth curves of tcs2 complementation . A) Growth in YNB his media with 2% glucose. B) Growth in YNB his media w ith 2% glycerol. Tsc2 must be targeted to the mitochondria for growth on glycerol. pPCT076 contains Tcs2 (M1L) ; pPCT078 contains Tcs2 (M1 0 L) .

PAGE 133

133 Figure 5 3. HPLC analysis examining the relationship between mcm 5 s 2 U and t 6 A. A) Analysis of mutations in mcm 5 s 2 U synthesis for t 6 A with detection at 254 nm. Black line = BY 4741 ; Red = trm9 ; Blue = elp3 ; Teal = ncs2 ; Yellow = ncs6 . B) Analysis of mutations in mcm 5 s 2 U synthesis with detection at 313 nm. Color scheme is the same as part A. C) Analysis of mutations in t 6 A synthesis for mcm 5 s 2 U with detection at 313 nm. Black = BY 4741 ; Green = tcs2 ; D a rk blue = tcs3 ; Teal = tcs4 ; Royal blue = tcs5 ; Brown = tcs6 ; Pink = tcs7 ; Green = tcs8 .

PAGE 134

134 Figure 5 4. Expression of tRNAs or Ternary Complex does not suppress slow growth of mutations in t 6 A. BY4742 and tsc2 expressing (A) tRNA Lys UUU ; (B)tRNA Ile AAU , tRNA eMet CAU , tRNA Asp GUU , tRNA Lys CUU , or tRNA Glu UUC ; (C) tRNA iMet , eIF2 , or TC .Data points are the average of 8 biologic al replicates. (A) and 5 biological replicates for (B) and (C). Error bars represent standard error of the mean (SEM).

PAGE 135

135 Figure 5 5. Summary of the purification of ribosome protected fragments.

PAGE 136

136 Figure 5 6. Polysome profiles. A) BY4742. B) tcs2 f mer phenotype indicated by blue arrow s .

PAGE 137

137 Figure 5 7. Ribosome profiling fragments map to open reading frames. The RPFs are mapped to a composite transcript extending 50 bases on either side of the start (AUG) and stop (UAA) codons.

PAGE 138

138 Figure 5 8. Arginine metabolism. Genes circled in blue are increased in RPFs in tcs2

PAGE 139

139 Figure 5 9. Determining ribosome frame. Identity of the 12 th nucleotide in the 28 mer determines the frame of the read and, consequently, the frame of the ribosome.

PAGE 140

140 Figure 5 10. Detection of +1 frame shifting in TRM140 using ribosome profiling. Frame shift must occur at nucleotide 832. Inset graphs indicate the percentage of reads in each frame for that analysis window. Frame 0 = Blue, Frame +1 = red, Frame 1 = Green. Depicted on the bottom of each image is the location of start codons (short, green bars) and stop codons (long red bars). A) BY4742. B) tcs2

PAGE 141

141 Figure 5 11. Detection of 1 frame shifting in BDP1 in tcs2 using ribosome profiling. Insets graph i ndicate the percentage of reads in each frame for that analysis window. Frame 0 = Blue, Frame +1 = red, Frame 1 = Green. Depicted on the bottom of each image is the location of start codons (short, green bars) and stop codons (long red bars).

PAGE 142

142 Figure 5 12. Global analysis of frame shifts. Left panel, BY4742; Right panel, tcs2 Summing all reads used to determine frame indicates that 80% of all reads from ribosome profiling are in the correct, annotated frame. There is no significant difference betwee n wild type and mutant.

PAGE 143

143 Figure 5 13. uORFs of GCN4 . GCN4 is under translation regulation by uORF 1 4. uORF 5 has only recently been identified and does not provide translational regulation of GCN4 .

PAGE 144

144 Figure 5 14. Detection of upstream non AUG starts . A) ALA1 B) GRS1. For both images, BY4742 is plotted in red, and tcs2 upstream the annotated AUG start.

PAGE 145

145 Figure 5 15. Change in bulk codon occupancy in the ribosome A , P , and E sites of tcs2

PAGE 146

146 Figure 5 16. Decoding of ANN codons in S. cerevisiae . In parenthesis is the anti codon and number of genomic copies of that tRNA. Filled circles indicate a codon de coded by that tRNA. Colors match Figure 5 15 . Wobble G:U decoding is in red lettering. Modification symbols are from Modomics. pseudouridine, & ncm 5 U, I inosine,3 mcm 5 s 2 U, 1 mcm 5 U

PAGE 147

147 Figure 5 17. Venn diagram of genes with increased expression in mutants of tsc2 eTCTC.

PAGE 148

148 Figure 5 18. Gcn4p regulated genes identified by ChIP Chip differentially expressed in

PAGE 149

149 CHAPTER 6 DETECT ION OF THE MODIFIED NUCLEOSIDE t 6 A. Background As discussed in the prior chapters, yeast cells devoid of t 6 A have increased errors in translation that lead to a multitude of phenotypes. Currently, the only method to identify the presence of t 6 A is by HPLC, requiring a week or longer to prepare and hundreds of micrograms of purified tRNAs. Depending on the organ ism, up to six liters of cells are harvested for nucleic acid extraction with phenol/chlorof o r m. The extraction is enriched for small RNAs of which tRNAs encompass 80 90%, the remainder includes miRNAs and small ribosomal subunits. The small RNAs are hydro lyzed with a combination of phosphodiesterase and nuclease P1 before treatment with alkaline phosphatase. The nucleosides can then be separated using a complex step gradient with a C18 column by rp HPLC with mass spectroscopy for confirmation of molecular w eight. 189,190 The large sample size currently limits the study of t 6 A to microbes, and t he current method prohibits any clinical correlations of t 6 A and human disease. An ideal option w ould be to exploit naturally occurring enzymes that target t 6 A modified tRNAs. Nucleases Cleave the A nticodon of tRNAs To ensure accurate translation, tRNAs are heavily modified, with several of the ASL modifications essential for cell survival. The depen dency on modification creates a target for blocking translation. One way of blocking translation is through the use of nucleases that specifically cleave tRNAs. tRNA ribotoxins (or anticodon nucleases, ACNase) cleave tRNAs in the anticodon and block transl ation. 191 As shown in Figure 6 1, different types of ACNase have been characterized . Colicin E5 targeting Tyr, His, Asn, and Asp tRNAs and colicin D targeting tRNA Arg are expressed by E. coli . 192 PaT

PAGE 150

150 toxin from Pichia acacia targets the methyl group of mcm 5 s 2 U 34 containing tRNA Gln UUG , as yeast trm9 harboring ncm 5 s 2 U 34 are resistant. 193 The toxin from Kluyveromyces lactis recognize the wobble modification mcm 5 U of tRNA Glu UUC . 194 The first ex ample of tRNA restriction endonuclease identified was E. coli PrrC , but as discussed below many aspects of PrrC function were still unclear . 195 The Anticodon N uclease PrrC E. coli expresses the anticodon nuclease PrrC after infection with bacteriophage T4 and prevent s the phage from spreading throughout the population. 196 PrrC cleaves the anticodon of tRNA Lys (Figure 6 2) , leading to translation inhibition and ultimately cell death. This altruistic measure thwarts the tempt to commandeer the cells transcription and translation machinery. By cleaving tRNA Lys , the cell prohibits translation of late T4 proteins, and contains the infection. 197 As PrrC cleaves native tRNA Lys in vitro but does not cleave transcript, 197 it was proposed that a post transcripti onal modification of tRNA Lys was a required for PrrC activity. 198 Two complex post transcriptional modifications are found in the ASL of tRNA Lys in both E . coli and S . cerevisiae. First, the U at position 34 is modified to 5­met hylaminomethyl 2 thiouridine ( mnm 5 s 2 U ) in E. coli and to 5­methoxycarbonylmethyluridine (mcm 5 U) in S. cerevisiae . Second, the A at position 37 is modified to t 6 A in both organisms. It was rec ently shown that PrrC expressed in S. cerevisiae elp3 and trm9 (eliminating the mcm 5 U 34 modification) was still toxic , unlike the toxin from K. lactis , which does recognize the wobble modification . 88 T oxic ity of PrrC in S . cerevisiae is through the same tRNA cleaving mechanism as seen

PAGE 151

151 in E. coli . 88 Currently, it is unknown if tRNA Lys is the only tar get, as over expression of tRNA L ys did not con fer resistance as was shown for toxin . 88 The determinant s for the recognition of tRNA by PrrC are still unknown . The reasons are three fold: first, t 6 A is essential in E. coli preventing the creation of a t 6 A deficient mutant to establish if PrrC would still be toxic ; second, the in vi tro synthesis of t 6 A on an in vitro transcribed tRNA has only recently been demonstrated by our lab oratory; 71 and finally, expression of PrrC is extremely toxic to E . coli preventing purification of the wild type enzyme for in vitro analysis . Only hypomorphic alleles have been studied. 88 Result s The Anticodon Nuclease PrrC U ses t 6 A as a D eterminant To examine if t 6 A is the determ inant of the anticodon nuclease PrrC, A galactose inducible PrrC plasmid (a gift from S. Shuman) was tested in yeast mutants harboring deletions in genes for the t 6 A machinery. The hypothesis is, if t 6 A is the determinant for PrrC, then mutants deficient in t 6 A should be resistant to PrrC and grow when it is expressed. W ild type BY4741 carrying PrrC on a plasmid did not grow in the presence of galactose, but could grow with empty vector , Figure 6 3 . tcs4 contains cytoplasmic t 6 A, was also killed by PrrC, while tcs3 , which does not contain detectable t 6 A, is resistant to PrrC, Figure 6 1 . To assay if additional strains devoid of t 6 A are resistant to PrrC, a tran sformation assay was performed. Competent cells were prepared for BY4741, of tcs2 tcs3 tcs8 were split and transformed with 1 µg of PrrC or empty vector and each transformation was plated with or without in duction of the P GAL ::PrrC cassette. The three mutants, who lack detectable of t 6 A, were resistant to expression of PrrC, while PrrC killed BY4741 on gala ctose containing plates, Table 6 1. tcs2 glucose carbon

PAGE 152

152 sources, which led to very low number of colonies for empty vector or PrrC. It is difficult to conclude if tcs2 did not grow on the test media, Table 6 1. Positive Hybridizatio n in the Absence of t 6 A, the PHAt6 A ssay Using the assay recently developed for the detection of i 6 A by Northern blot (PHA6), 199 a Northern blot assay was developed for the detection of t 6 A. The premise of the assay is based on the bulky t 6 group interfering with the binding of an ACL probe spanning posi tio n 37, Figure 6 4 B. Hybridization would be greater for tRNA with reduced levels of t 6 A. A probe spanning the T loop of the tRNA will act as an internal control for presence of the tRNA. For this assay, purified tRNAs were spotted and cross linked onto ne utral nylon membranes and detected with probes (listed in Table 2 labeled HRP. Hybridization, washing, and detection were performed using North2South (Pierce) and exposed to film. 100 ng of tRNAs fr om BY4741, tcs tcs tcs membranes. One membrane was treated with a biotinylated probe annealing to the T , and a second membrane was treated with the ACL probe. tRNAs from all strains were detected by the T probe, Fig ure 6 4 A top. Only the tRNAs that did not have detectable t 6 A by HPLC, bound the ACL probe, while tRNAs from BY4741 and tcs4 did not bind the probe, Figure 6 4 A bottom. Discussion With the extreme effect of t 6 A deficiency in yeast, any defect of t 6 A in humans developed to detect t 6 A. 200 Patients with metastatic breast cancer had higher concentrations of t 6 A in urine samples than patients with benign breast cancer. 201 Two

PAGE 153

153 hybridomas were stored at ATCC as HB 10167 and HB 10168 . Two separate attempts to revive these hybridoma s failed. It appears that the anti t 6 A antibody is lost. Any rapid detection method requiring only microgram quantities of tRNA would allow for study of t 6 A biology in non microbes. The determinant for the ACNase PrrC was only active in strains harboring t 6 A. Combined with the prior results that PrrC was toxic to strains missing the mcm 5 U 34 modification, 88 PrrC must be using t 6 A as a determinant. Attempts to purify PrrC to us e as an in vivo probe have failed. PrrC is extremely toxic, and kills wild type yeast strains even without inducing the galactose promoter. Yeast strains lacking t 6 A are resistant to PrrC, but grow poorly and have a short life span. With the recent identif ication of strains of D. radiodurans deficient of t 6 A, future work with the PrrC toxin will be attempted in this background. D. radiodurans is genetically tractable and expression plasmids exist. If D. radiodurans is resistant, this will allow for the first large scale studies of the toxin. Positive hybridization in the absence of t 6 A assay (PHAt6 assay) was able to detect the presence of t 6 A at levels much lower than previously possible. As little as 10 ng of tRNA can be detected, representing a 10,000 fold increase in sensitivity. In fact, this assay has already been used to monitor t 6 A variations in TCS3 mutants in Drosophila melanogaster ( Diego Rojas Benítez and Álvaro Glavic, personal communication), making thi s the first study of t 6 A in a non microbe. Using the PHAt6 assay, our future work will seek to understand t 6 A biology in human disease.

PAGE 154

154 Table 6 1. Resistance to killing by the PrrC toxin. Numbers represent the number of colony forming units. Strain Gal/R af leu SD leu BY4741(GAL) 2096 2215 BY4741(PrrC) 3 2180 tcs2 14 597 tcs2 6 122 tcs3 146 545 tcs3 94 521 tcs8 463 205 tcs8 511 591

PAGE 155

155 Figure 6 1. Anticodon nuclease that cleave tRNAs.

PAGE 156

156 Figure 6 2. PrrC cleaves tRNA Lys between positions 34 and 35.

PAGE 157

157 Figure 6 3. The t 6 A deficient tcs4 galactose. B) Growth on glucose repressing PrrC.

PAGE 158

158 Figure 6 4. Positive hybridization of a DNA probe to tRNAs in the absence of t 6 A. A.

PAGE 159

159 CHAPTER 7 DISCUSSION The discovery of the genes responsible for the biosynthesis of t 6 A opened the door for the possibility the that the numerous phenotypes observed for yeast strains with altered Tcs2p levels were pleiotropic effects due to the loss of translation fidelity. This hypothesis was confirmed using in vivo reporter assays to show an increase in +1 and 1 frame shifts and an increase in initiation at GUG codons in both tcs2 ( sua5 ) and tcs3 ( kae1 ). 64 These results indicate the transla tional errors were due to absence of t 6 A and not due to Tcs2 or Tcs3 direct involvement with translation. The ribosome profiling results presented in this work (Chapter 5) confirmed the reporter assays and mapped many more translation errors cause by absen ce of t 6 A in yeast. Phenotypes in Microbes as Prognosticator of Human D isease Reduced levels of t 6 A in H. volcanii tcs6 pcc1 ) led to an increased level of AGEs (Advanced Gylcation End products). 84 AGEs are implicated in human degenerative diseases and are believed to be caused by free reactive carbonyl species. 202 In H. volcanii tcs6 would reduce the activity of aTCTC and could allow free TC AMP to increase leading to the increases seen in AGEs. This raises two roles for mis regulation of t 6 A in human disease: first, failure to control the reactive molecule TC AMP can to lead to c ellular damage; second, reduction of t 6 A can lead to errors in translation, which would cause an increase in the statistical proteome. Controlling F ree TC AMP The reversibility of the reaction creating TC AMP , the short half life of TC AMP, and the possibility that TC AMP may be channeled in the similar mechanism as HypF and TobZ , indicate s that free TC AMP could be detrimental to the cell. This could

PAGE 160

160 ultimately be the cause of some of the many pleiotropic phe notypes seen in t 6 A mutants, and raises the question of whether the cell has additional mechanisms to prevent free TC AMP from accumulating. Interestingly, the structure of the E. coli YciO indicates a tighter binding pocket for TC AMP as compared to TsaC, but YciO lacks the conserved catalytic residues seen in TsaC (Alexey Murzin, personal communication). Whether YciO can bind free TC AMP is unknown. Also, humans do not possess an YciO homolog (Figure 3 7), so it is unknown how humans could control free TC AMP. Errors in Translation can I ncrease the Statistical P roteome Chapter 5 detailed the increase in errors seen in in t 6 A deficiency occurred in proteome. As describe each gene there corresponds a group of proteins w hose primary structures are re lated to some theore 203 Translation does not occur perfectly and continuously, but produces a range of peptides and proteins from a single gene. The cell has mechanisms in place to control the statistical proteome from each gene, but the con sequences of the loss of t 6 A increase translation errors and increase the statistical proteome to a point where the cell can no longer cope. 204,205 To exacerbate this, the mechanisms designed to control the statistical proteome are also not being translated accurately, and the cell is now left without a means to control translational error s. 204,205 This mechanism is in se by Orgel in 1963. 205 The end result is an accumulation of aggregated proteins. Model for Cellular Response to R eduction of t 6 A A model for the cellular response to altering levels of the t 6 A modification is presented in Figure 7 1. The model proposes that t 6 A acts in two ways. First, levels of

PAGE 161

161 t 6 A are used as a sensor of nutritional levels and fine tune translati on. Second, reduction of t 6 A leads to translational errors and may provide translational regulation of proteins with codon usage biased towards decoding with t 6 A tRNAs. Reduction of t 6 A levels during threonine limitation has been previously described, 178 and could repress Tor1, part of the target of rapamycin complex (TORC). 206 Tor1 is a nutrient sensor and central controller of cell growth and aging. 207 Although the precise mechanism for the action is unclear, Tor1 translocates to the nucleus during n utritional limitation and blocks Pol I and Pol III, through activation of Maf1. 208 Maf1 al so represses the RTD (Rapid tRNA Degradation pathway) to prevent degradation of hypo modified tRNAs. 209 Reduction in Tor1 also induces pathways for catabolism of poor nitrogen sources (proline and arginine degradation). 210 With Tor1 now in the nucleus, it is unable to associate with eIF4G to recruit 40S rRNA to the m 7 cap to initiate translation. 210 The efficiency of 40S ribosomes that are already bound to the m 7 cap to initiate after Tor1 translocates to the nucleus is unknown. Reduction of t 6 A can have four possible effects on translation. Three of these effects can be grouped under expansion of the statistical proteome by increased errors in translation. First, errors in translation can lead to new pr oteins, which may be non functional or toxic. 211 Second, out of frame decoding can increase peptides. 211 And, third mis folded proteins can lead to the activation of the unfolded protein response (UPR). 206 Activation of the UPR is documented to cause a Gcd phenotype (translational de repression of GCN4 ), and Gcn4 and Hac1 are coactiva tors of more than 400 genes containing UPRE2 (UPR element 2), which leads to the activation of catabolic pathways. 212,213 The fourth effect, decreased t 6 A may have is reduced

PAGE 162

162 translation of specific proteins due to codon usage. Yeast contain 318 genes that exclusively use AGG and AGA (requiring t 6 A modified tR NAs) to code for arginine and do not use CGN. The GO terms that these genes group into are significantly enriched for m any essential processes, Table 7 1. In particular, the respiration pathway is significantly enriched, P = 9.2 x 10 4 . From the ribosome p rofiling data presented in Chapter 5, AGR codons spend more time in the A site, and pausing at these codons have been linked to +1 frameshifts. 174,176 This in dicates the cell may be using rare codons to regulate individual process at the level of translation in response to nutrient availability. t 6 A and Human D isease With a functional link established between t 6 A and many of the phenotypes seen in the absence of t 6 A, is it possible to use variation of t 6 A as a predictor of human health and disease? In fact, a recent publication examining the modification i 6 A 37 on tRNA Ser UCN described a correlation between the reduction of the modification and mitochondrial resp iratory chain defects in humans. 214 Additionally, the ms 2 t 6 A has been linked with Type 2 diabetes. 59 With the new, more sensitive assay for t 6 A developed in this work, we can, for the first time, beg in to establish if a correlation exists between t 6 A alterations and human disease.

PAGE 163

163 Table 7 1. Gene ontology enrichment for genes using only AGA/AGG codons to encode arginine GO Term P Value Number of Genes hydrogen ion transmembrane transport 8.99E 11 21 respiratory electron transport chain 1.02E 10 16 oxidative phosphorylation 2.02E 10 16 electron transport chain 2.02E 10 16 proton transport 3.36E 10 22 hydrogen transport 4.77E 10 22 ATP synthesis coupled electron transport 6.24E 10 15 mitochondrial ATP synthesis coupled electron transport 6.24E 10 15 monovalent inorganic cation transport 1.56E 07 22 mitochondrial electron transport, cytochrome c to oxygen 7.38E 07 9 cell redox homeostasis 1.88E 04 11 mitochondrial electron transport, ubiquinol to cytochrome c 5.26E 04 7 ion transmembrane transport 1.93E 03 22 cation transport 2.64E 03 25 cellular respiration 6.63E 03 18 generation of precursor metabolites and energy 6.69E 03 25 cytoplasmic translation 9.85E 03 23 oxidation reduction process 1.55E 02 43 energy coupled proton transport, down electrochemical gradient 2.43E 02 7 ATP synthesis coupled proton transport 2.43E 02 7

PAGE 164

164 Figure 7 1. Model for cellular response to alterations in t 6 A levels.

PAGE 165

165 APPENDIX GENE NAMES AND FUNCTION REFERENCED IN THIS WORK Table A 1. Genes increased in RPFs in tcs2 Systematic Name Standard Name Description YAL026C DRS2 Trans golgi network aminophospholipid translocase (flippase) YAL037W Putative protein of unknown function YAL061W BDH2 Putative medium chain alcohol dehydrogenase with similarity to BDH1 YBL017C PEP1 Type I transmembrane sorting receptor for multiple vacuolar hydrolases YBL042C FUI1 High affinity uridine permease, localizes to the plasma membrane YBL043W ECM13 Non essential protein of unknown function YBL049W MOH1 Protein of unknown function YBL066C SEF1 Putative transcription factor YBL075C SSA3 ATPase involved in protein folding and the response to stress YBL078C ATG8 Component of autophagosomes and Cvt vesicles YBL088C TEL1 Protein kinase primarily involved in telomere length regulation YBL107C MIX23 Mitochondrial intermembrane space protein of unknown function YBR006W UGA2 Succinate semialdehyde dehydrogenase YBR015C MNN2 Alpha 1,2 mannosyltransferase YBR033W EDS1 Putative zinc cluster protein, predicted to be a transcription factor YBR036C CSG2 Endoplasmic reticulum membrane protein YBR041W FAT1 Very long chain fatty acyl CoA synthetase and fatty acid transporter YBR043C QDR3 Multidrug transporter of the major facilitator superfamily YBR054W YRO2 Protein of unknown function with similarity to archaeal rhodopsins YBR072W HSP26 Small heat shock protein (sHSP) with chaperone activity YBR097W VPS15 Serine/threonine protein kinase involved in vacuolar protein sorting YBR105C VID24 GID Complex regulatory subunit YBR139W Putative serine type carboxypeptidase YBR147W RTC2 Putative vacuolar membrane transporter for cationic amino acids YBR157C ICS2 Protein of unknown function YBR168W PEX32 Peroxisomal integral membrane protein YBR169C SSE2 Member of the heat shock protein 70 (HSP70) family

PAGE 166

166 Table A 1. Continued YBR199W KTR4 Putative mannosyltransferase involved in protein glycosylation YBR207W FTH1 Putative high affinity iron transporter YBR208C DUR1,2 Urea amidolyase YBR214W SDS24 Protein involved in cell separation during budding YBR229C ROT2 Glucosidase II catalytic subunit YBR241C Putative transporter, member of the sugar porter family YBR256C RIB5 Riboflavin synthase YBR270C BIT2 Subunit of TORC2 membrane associated complex YBR284W Putative metallo dependent hydrolase superfamily protein YBR293W VBA2 Permease of basic amino acids in the vacuolar membrane YBR299W MAL32 Maltase (alpha D glucosidase) YCR011C ADP1 Putative ATP dependent permease of the ABC transporter family YCR017C CWH43 Putative sensor/transporter protein involved in cell wall biogenesis YCR023C Vacuolar membrane protein of unknown function YCR061W Protein of unknown function YDL072C YET3 Protein of unknown function YDL174C DLD1 D lactate dehydrogenase YDL204W RTN2 Reticulon protein YDR019C GCV1 T subunit of the mitochondrial glycine decarboxylase complex YDR070C FMP16 Protein of unknown function YDR082W STN1 Telomere end binding and capping protein YDR135C YCF1 Vacuolar glutathione S conjugate transporter YDR216W ADR1 Carbon source responsive zinc finger transcription factor YDR242W AMD2 Putative amidase YDR294C DPL1 Dihydrosphingosine phosphate lyase YDR342C HXT7 High affinity glucose transporter YDR343C HXT6 High affinity glucose transporter YDR344C Dubious open reading frame YEL009C GCN4 bZIP transcriptional activator of amino acid biosynthetic genes YEL011W GLC3 Glycogen branching enzyme, involved in glycogen accumulation YEL045C Dubious open reading frame YEL065W SIT1 Ferrioxamine B transporter YER067W RGI1 Protein of unknown function YER069W ARG5,6 Acetylglutamate kinase and N acetyl gamma glutamyl phosphate reductase YER103W SSA4 Heat shock protein that is highly induced upon stress YER121W Putative protein of unknown function

PAGE 167

167 Table A 1. Continued YER150W SPI1 GPI anchored cell wall protein involved in weak acid resistance YER166W DNF1 Aminophospholipid translocase (flippase) YER175C TMT1 Trans aconitate methyltransferase YFL014W HSP12 Plasma membrane protein involved in maintaining membrane organization YFR053C HXK1 Hexokinase isoenzyme 1 YGL022W STT3 Subunit of the oligosaccharyltransferase complex of the ER lumen YGL062W PYC1 Pyruvate carboxylase isoform YGL114W Putative protein of unknown function YGL117W Putative protein of unknown function YGL121C GPG1 Proposed gamma subunit of the heterotrimeric G protein YGL125W MET13 Major isozyme of methylenetetrahydrofolate reductase YGL156W AMS1 Vacuolar alpha mannosidase YGL184C STR3 Peroxisomal cystathionine beta lyase YGR032W GSC2 Catalytic subunit of 1,3 beta glucan synthase YGR043C NQM1 Transaldolase of unknown function YGR088W CTT1 Cytosolic catalase T YGR154C GTO1 Omega class glutathione transferase YGR244C LSC2 Beta subunit of succinyl CoA ligase YGR248W SOL4 6 phosphogluconolactonase YGR281W YOR1 Plasma membrane ATP binding cassette (ABC) transporter YGR287C IMA1 Major isomaltase (alpha 1,6 glucosidase/alpha methylglucosidase) YHL040C ARN1 ARN family transporter for siderophore iron chelates YHR045W Putative protein of unknown function YHR117W TOM71 Mitochondrial outer membrane protein YHR210C Putative aldose 1 epimerase superfamily protein YIL017C VID28 GID Complex subunit, serves as adaptor for regulatory subunit Vid24p YIL029C Putative protein of unknown function YIL030C SSM4 Ubiquitin protein ligase involved in ER associated protein degradation YIL073C SPO22 Meiosis specific protein essential for chromosome synapsis YIL101C XBP1 Transcriptional repressor YIL111W COX5B Subunit Vb of cytochrome c oxidase YIL117C PRM5 Pheromone regulated protein, predicted to have 1 transmembrane segment YIL125W KGD1 Subunit of the mitochondrial alpha ketoglutarate dehydrogenase complex

PAGE 168

168 Table A 1. Continued YIL129C TAO3 Component of the RAM signaling network YIL136W OM45 Mitochondrial outer membrane protein of unknown function YIL155C GUT2 Mitochondrial glycerol 3 phosphate dehydrogenase YIL164C NIT1 Nitrilase YIR016W Putative protein of unknown function YIR029W DAL2 Allantoicase YIR031C DAL7 Malate synthase YIR032C DAL3 Ureidoglycolate lyase YIR036C IRC24 Putative benzil reductase YIR038C GTT1 ER associated glutathione S transferase capable of homodimerization YIR039C YPS6 Putative GPI anchored aspartic protease YIR042C Putative protein of unknown function YJL079C PRY1 Sterol binding protein involved in the export of acetylated sterols YJL093C TOK1 Outward rectifier potassium channel of the plasma membrane YJL116C NCA3 Protein involved in mitochondrion organization YJL172W CPS1 Vacuolar carboxypeptidase S YJR025C BNA1 3 hydroxyanthranilic acid dioxygenase YJR109C CPA2 Large subunit of carbamoyl phosphate synthetase YJR130C STR2 Cystathionine gamma synthase, converts cysteine into cystathionine YJR154W Putative protein of unknown function YKL071W Putative protein of unknown function YKL100C Putative protein of unknown function YKL161C KDX1 Protein kinase YKL187C FAT3 Protein required for fatty acid uptake YKL220C FRE2 Ferric reductase and cupric reductase YKR022C NTR2 Essential protein that forms a dimer with Ntr1p YKR039W GAP1 General amino acid permease YKR067W GPT2 Glycerol 3 phosphate/dihydroxyacetone phosphate sn 1 acyltransferase YKR076W ECM4 Omega class glutathione transferase YKR091W SRL3 GTB motif (G1/S transcription factor binding) containing protein YKR093W PTR2 Integral membrane peptide transporter YLL015W BPT1 ABC type transmembrane transporter of MRP/CFTR family YLL019C KNS1 Protein kinase involved in negative regulation of PolIII transcription YLL048C YBT1 Transporter of the ATP binding cassette (ABC) family

PAGE 169

169 Table A 1. Continued YLL060C GTT2 Glutathione S transferase capable of homodimerization YLR125W Putative protein of unknown function YLR136C TIS11 mRNA binding protein expressed during iron starvation YLR149C Protein of unknown function YLR178C TFS1 Protein that interacts with and inhibits carboxypeptidase Y and Ira2p YLR251W SYM1 Protein required for ethanol metabolism YLR258W GSY2 Glycogen synthase YLR327C TMA10 Protein of unknown function that associates with ribosomes YLR383W SMC6 Component of the SMC5 SMC6 complex YLR454W FMP27 Putative protein of unknown function YML023C NSE5 Component of the SMC5 SMC6 complex YML091C RPM2 Protein subunit of mitochondrial RNase P YML100W TSL1 Large subunit of trehalose 6 phosphate synthase/phosphatase complex YML116W ATR1 Multidrug efflux pump of the major facilitator superfamily YML128C MSC1 Protein of unknown function YMR008C PLB1 Phospholipase B (lysophospholipase) involved in lipid metabolism YMR062C ARG7 Mitochondrial ornithine acetyltransferase YMR095C SNO1 Protein of unconfirmed function YMR096W SNZ1 Protein involved in vitamin B6 biosynthesis YMR105C PGM2 Phosphoglucomutase YMR135C GID8 Subunit of GID Complex, binds strongly to central component Vid30p YMR136W GAT2 Protein containing GATA family zinc finger motifs YMR189W GCV2 P subunit of the mitochondrial glycine decarboxylase complex YMR196W Putative protein of unknown function YMR323W ERR3 Enolase, a phosphopyruvate hydratase YNL018C Putative protein of unknown function YNL034W Putative protein of unknown function YNL036W NCE103 Carbonic anhydrase YNL104C LEU4 Alpha isopropylmalate synthase (2 isopropylmalate synthase) YNL142W MEP2 Ammonium permease involved in regulation of pseudohyphal growth YNL160W YGP1 Cell wall related secretory glycoprotein YNL200C NADHX epimerase YNL202W SPS19 Peroxisomal 2,4 dienoyl CoA reductase YNL237W YTP1 Probable type III integral membrane protein of unknown function

PAGE 170

170 Table A 1. Continued YNL332W THI12 Protein involved in synthesis of the thiamine precursor HMP YNR001C CIT1 Citrate synthase YNR002C ATO2 Putative transmembrane protein involved in export of ammonia YNR034W A Putative protein of unknown function YNR067C DSE4 Daughter cell specific secreted protein with similarity to glucanases YNR069C BSC5 Protein of unknown function YOL058W ARG1 Arginosuccinate synthetase YOL119C MCH4 Protein with similarity to mammalian monocarboxylate permeases YOL126C MDH2 Cytoplasmic malate dehydrogenase YOR120W GCY1 Glycerol dehydrogenase YOR130C ORT1 Ornithine transporter of the mitochondrial inner membrane YOR173W DCS2 m(7)GpppX pyrophosphatase regulator YOR185C GSP2 GTP binding protein (mammalian Ranp homolog) YOR289W Putative protein of unknown function YOR303W CPA1 Small subunit of carbamoyl phosphate synthetase YOR374W ALD4 Mitochondrial aldehyde dehydrogenase YOR393W ERR1 Protein of unknown function YPL006W NCR1 Vacuolar membrane protein YPL022W RAD1 Single stranded DNA endonuclease (with Rad10p) YPL036W PMA2 Plasma membrane H+ ATPase YPL148C PPT2 Phosphopantetheine:protein transferase (PPTase) YPL154C PEP4 Vacuolar aspartyl protease (proteinase A) YPL167C REV3 Catalytic subunit of DNA polymerase zeta YPL186C UIP4 Protein that interacts with Ulp1p YPL214C THI6 Thiamine phosphate diphosphorylase and hydroxyethylthiazole kinase YPL230W USV1 Putative transcription factor containing a C2H2 zinc finger YPL281C ERR2 Enolase, a phosphopyruvate hydratase YPR002W PDH1 Mitochondrial protein that participates in respiration YPR085C ASA1 Subunit of the ASTRA complex, involved in chromatin remodeling YPR091C NVJ2 Lipid binding ER protein, enriched at nucleus vacuolar junctions (NVJ) YPR160W GPH1 Glycogen phosphorylase required for the mobilization of glycogen YPR184W GDB1 Glycogen debranching enzyme

PAGE 171

171 Table A 2 . Genes reduced in RPFs in sua5 Systematic Name Standard Name Description YAR066W Putative GPI protein YAR070C Dubious open reading frame YAR071W PHO11 One of three repressible acid phosphatases YBR093C PHO5 Repressible acid phosphatase YBR296C PHO89 Plasma membrane Na+/Pi cotransporter YCL063W VAC17 Phosphoprotein involved in vacuole inheritance YCL064C CHA1 Catabolic L serine (L threonine) deaminase YCL066W HMLALPHA1 Silenced copy of ALPHA1 at HML YCR013C Dubious open reading frame YCR040W MATALPHA1 Transcriptional co activator that regulates mating type specific genes YDL022W GPD1 NAD dependent glycerol 3 phosphate dehydrogenase YDL042C SIR2 Conserved NAD+ dependent histone deacetylase of the Sirtuin family YDL227C HO Site specific endonuclease YDR111C ALT2 Catalytically inactive alanine transaminase YDR140W MTQ2 S adenosylmethionine dependent methyltransferase YDR184C ATC1 Nuclear protein YDR281C PHM6 Protein of unknown function YDR354C A Dubious open reading frame YDR365C ESF1 Nucleolar protein involved in pre rRNA processing YDR445C Dubious open reading frame YER011W TIR1 Cell wall mannoprotein YER072W VTC1 Subunit of the vacuolar transporter chaperone (VTC) complex YFL002C SPB4 Putative ATP dependent RNA helicase YFL004W VTC2 Subunit of vacuolar transporter chaperone (VTC) complex YFL005W SEC4 Rab family GTPase YFL017C GNA1 Glucosamine 6 phosphate acetyltransferase YFL017W A SMX2 Core Sm protein Sm G YFL022C FRS2 Alpha subunit of cytoplasmic phenylalanyl tRNA synthetase YFL026W STE2 Receptor for alpha factor pheromone YFL034C A RPL22B Ribosomal 60S subunit protein L22B YFL045C SEC53 Phosphomannomutase YFR001W LOC1 Nuclear protein involved in asymmetric localization of ASH1 mRNA YFR005C SAD1 Conserved zinc finger domain protein involved in pre mRNA splicing

PAGE 172

172 Table A 2. Continued YFR016C Putative protein of unknown function YFR032C RRT5 Putative protein of unknown function YFR032C A RPL29 Ribosomal 60S subunit protein L29 YFR032C B Putative protein of unknown function YFR033C QCR6 Subunit 6 of the ubiquinol cytochrome c reductase complex YFR034C PHO4 Basic helix loop helix (bHLH) transcription factor of the myc family YFR036W CDC26 Subunit of the Anaphase Promoting Complex/Cyclosome (APC/C) YGL014W PUF4 Member of the PUF protein family YGL089C MF(ALPHA)2 Mating pheromone alpha factor, made by alpha cells YGL169W SUA5 Protein involved in threonylcarbamoyl adenosine biosynthesis YGL255W ZRT1 High affinity zinc transporter of the plasma membrane YGR035C Putative protein of unknown function, potential Cdc28p substrate YGR111W Putative protein of unknown function YGR146C ECL1 Protein of unknown function YGR177C ATF2 Alcohol acetyltransferase YGR210C Putative protein of unknown function YGR233C PHO81 Cyclin dependent kinase (CDK) inhibitor YGR234W YHB1 Nitric oxide oxidoreductase YHR136C SPL2 Protein with similarity to cyclin dependent kinase inhibitors YHR148W IMP3 Component of the SSU processome YHR163W SOL3 6 phosphogluconolactonase YHR180W A Dubious open reading frame YHR193C A Dubious open reading frame YHR214C E Putative protein of unknown function YHR214W Putative protein of unknown function YHR215W PHO12 One of three repressible acid phosphatases YIL011W TIR3 Cell wall mannoprotein YIL068W A Dubious open reading frame YJL012C VTC4 Vacuolar membrane polyphosphate polymerase YJL056C ZAP1 Zinc regulated transcription factor YJL127C SPT10 Putative histone acetylase with a role in transcriptional silencing YJL191W RPS14B Protein component of the small (40S) ribosomal subunit YJR004C SAG1 Alpha agglutinin of alpha cells YJR047C ANB1 Translation elongation factor eIF 5A YJR147W HMS2 Protein with similarity to heat shock transcription factors

PAGE 173

173 Table A 2. Continued YKL024C URA6 Uridylate kinase YKL084W HOT13 Zinc binding mitochondrial intermembrane space (IMS) protein YKL096W CWP1 Cell wall mannoprotein that localizes to birth scars of daughter cells YKR025W RPC37 RNA polymerase III subunit C37 YLL042C ATG10 Conserved E2 like conjugating enzyme YLL052C AQY2 Water channel that mediates water transport across cell membranes YLR121C YPS3 Aspartic protease YLR333C RPS25B Protein component of the small (40S) ribosomal subunit YLR346C Putative protein of unknown function found in mitochondria YLR367W RPS22B Protein component of the small (40S) ribosomal subunit YLR452C SST2 GTPase activating protein for Gp a1p YML017W PSP2 Asn rich cytoplasmic protein that contains RGG motifs YML058W A HUG1 Protein involved in the Mec1p mediated checkpoint pathway YML123C PHO84 High affinity inorganic phosphate (Pi) transporter YMR006C PLB2 Phospholipase B (lysophospholipase) involved in lipid metabolism YMR141C Dubious open reading frame YMR319C FET4 Low affinity Fe(II) transporter of the plasma membrane YNL111C CYB5 Cytochrome b5 YNL141W AAH1 Adenine deaminase (adenine aminohydrolase) YNR044W AGA1 Anchorage subunit of a agglutinin of a cells YOL013W B Dubious open reading frame YOL068C HST1 NAD(+) dependent histone deacetylase YOL109W ZEO1 Peripheral membrane protein of the plasma membrane YOR009W TIR4 Cell wall mannoprotein YOR091W TMA46 Protein of unknown function that associates with translating ribosomes YOR095C RKI1 Ribose 5 phosphate ketol isomerase YOR238W Putative protein of unknown function YOR253W NAT5 Subunit of protein N terminal acetyltransferase NatA YOR299W BUD7 Member o f the ChAPs family (Chs5p Arf1p binding proteins) YOR346W REV1 Deoxycytidyl transferase YOR377W ATF1 Alcohol acetyltransferase YOR378W AMF1 Putative paralog of ATR1 YPL019C VTC3 Subunit of vacuolar transporter chaperone (VTC) complex

PAGE 174

174 Table A 2. Continued YPL067C Putative protein of unknown function YPL081W RPS9A Protein component of the small (40S) ribosomal subunit YPL165C SET6 SET domain protein of unknown function YPL199C Putative protein of unknown function YPL245W Putative protein of unknown function YPL263C KEL3 Cytoplasmic protein of unknown function YPR013C CMR3 Putative zinc finger protein YPR108W A Putative protein of unknown function YPR119W CLB2 B type cyclin involved in cell cycle progression

PAGE 175

175 Table A 3. ORFs in BY4742 with potential frame shifts. Gene names shaded grey also have potential frame shifts in sua5 Systematic Name Standard Name Description YBL003C HTA2 Histone H2A YBL051C PIN4 Protein involved in G2/M phase progression and response to DNA damage YBL087C RPL23A Ribosomal 60S subunit protein L23A YBR017C KAP104 Transportin or cytosolic karyopherin beta 2 YBR031W RPL4A Ribosomal 60S subunit protein L4A YBR057C MUM2 Protein essential for meiotic DNA replication and sporulati on YBR058C UBP14 Ubiquitin specific protease YBR084C A RPL19A Ribosomal 60S subunit protein L19A YBR090C Putative protein of unknown function YBR118W TEF2 Translational elongation factor EF 1 alpha YBR126W B Dubious open reading frame YBR279W PAF1 Component of the Paf1p complex involved in transcription elongation YCL005W A VMA9 Vacuolar H+ ATPase subunit e of the V ATPase V0 subcomplex YCR005C CIT2 Citrate synthase YCR024C A PMP1 Regulatory subunit for the plasma membrane H(+) ATPase Pma1p YCR034W FEN1 Fatty acid elongase, involved in sphingolipid biosynthesis YCR065W HCM1 Forkhead transcription factor YDL140C RPO21 RNA polymerase II largest subunit B220 YDL184C RPL41A Ribosomal 60S subunit protein L41A YDL191W RPL35A Ribosomal 60S subunit protein L35A YDL195W SEC31 Component of the Sec13p Sec31p complex of the COPII vesicle coat YDL232W OST4 Subunit of the oligosaccharyltransferase complex of the ER lumen YDR074W TPS2 Phosphatase subunit of the trehalose 6 P synthase/phosphatase complex YDR119W VBA4 Protein of unknown function YDR154C Dubious open reading frame YDR172W SUP35 Translation termination factor eRF3 YDR320C A DAD4 Essential subunit of the Dam1 complex (aka DASH complex) YDR433W Dubious open reading frame YDR508C GNP1 High affinity glutamine permease YDR510W SMT3 Ubiquitin like protein of the SUMO family YEL027W VMA3 Proteolipid subunit c of the V0 domain of vacuolar H(+) ATPase

PAGE 176

176 Table A 3. Continued YER074W RPS24A Protein component of the small (40S) ribosomal subunit YER151C UBP3 Ubiquitin specific protease involved in transport and osmotic response YGL088W Dubious open reading frame YGL207W SPT16 Subunit of the heterodimeric FACT complex (Spt16p Pob3p) YGL225W VRG4 Golgi GDP mannose transporter YGR001C AML1 Putative protein of unknown function YGR119C NUP57 FG nucleoporin component of central core of the nuclear pore complex YGR148C RPL24B Ribosomal 60S subunit protein L24B YGR229C SMI1 Protein involved in the regulation of cell wall synthesis YHL007C STE20 Cdc42p activated signal transducing kinase YHR066W SSF1 Constituent of 66S pre ribosomal particles YHR136C SPL2 Protein with similarity to cyclin dependent kinase inhibitors YHR152W SPO12 Nucleolar protein of unknown function YHR203C RPS4B Protein component of the small (40S) ribosomal subunit YJL081C ARP4 Nuclear actin related protein involved in chromatin remodeling YJL098W SAP185 Protein that forms a complex with the Sit4p protein phosphatase YJL136C RPS21B Protein component of the small (40S) ribosomal subunit YJR001W AVT1 Vacuolar transporter YJR094W A RPL43B Ribosomal 60S subunit protein L43B YKL006W RPL14A Ribosomal 60S subunit protein L14A YKL029C MAE1 Mitochondrial malic enzyme YKL054C DEF1 RNAPII degradation factor YKL145W RPT1 ATPase of the 19S regulatory particle of the 26S proteasome YKL160W ELF1 Transcription elongation factor with a conserved zinc finger domain YKL179C COY1 Golgi membrane protein with similarity to mammalian CASP YKR059W TIF1 Translation initiation factor eIF4A YKR093W PTR2 Integral membrane peptide transporter YLR095C IOC2 Subunit of the Isw1b complex YLR216C CPR6 Peptidyl prolyl cis trans isomerase (cyclophilin) YLR262C YPT6 Rab family GTPase YLR287C Putative protein of unknown function YLR287C A RPS30A Protein component of the small (40S) ribosomal subunit YLR333C RPS25B Protein component of the small (40S) ribosomal subunit YLR372W SUR4 Elongase YLR409C UTP21 Subunit of U3 containing 90S preribosome and SSU

PAGE 177

177 Table A 3. Continued YMR093W UTP15 Nucleolar protein YMR145C NDE1 Mitochondrial external NADH dehydrogenase YNL037C IDH1 Subunit of mitochondrial NAD(+) dependent isocitrate dehydrogenase YNL066W SUN4 Cell wall protein related to glucanases YNL068C FKH2 Forkhead family transcription factor YNL162W RPL42A Ribosomal 60S subunit protein L42A YNL244C SUI1 Translation initiation factor eIF1 YNL327W EGT2 Glycosylphosphatidylinositol (GPI) anchored cell wall endoglucanase YOL101C IZH4 Membrane protein involved in zinc ion homeostasis YOR057W SGT1 Cochaperone protein YOR182C RPS30B Protein component of the small (40S) ribosomal subunit YOR202W HIS3 Imidazoleglycerol phosphate dehydratase YOR239W ABP140 AdoMet dependent tRNA methyltransferase and actin binding protein YOR309C Dubious open reading frame YOR312C RPL20B Ribosomal 60S subunit protein L20B YPL082C MOT1 Essential protein involved in regulation of transcription YPL183C RTT10 WD40 domain containing protein involved in endosomal recycling YPL256C CLN2 G1 cyclin involved in regulation of the cell cycle YPR053C Dubious open reading frame YPR080W TEF1 Translational elongation factor EF 1 alpha YPR189W SKI3 Ski complex component and TPR protein

PAGE 178

178 Table A 4. ORFs in sua5 frame shifts Systematic Name Standard Name Description YAL005C SSA1 ATPase involved in protein folding and NLS directed nuclear transport YAL042W ERV46 Protein localized to COPII coated vesicles YAL044C GCV3 H subunit of the mitochondrial glycine decarboxylase complex YAR028W Putative integral membrane protein YBL002W HTB2 Histone H2B YBL003C HTA2 Histone H2A YBL028C Protein of unknown function that may interact with ribosomes YBL031W SHE1 Mitotic spindle protein YBL051C PIN4 Protein involved in G2/M phase progression and response to DNA damage YBL079W NUP170 Subunit of the inner ring of the nuclear pore complex (NPC) YBL087C RPL23A Ribosomal 60S subunit protein L23A YBL107C MIX23 Mitochondrial intermembrane space protein of unknown function YBR010W HHT1 Histone H3 YBR017C KAP104 Transportin or cytosolic karyopherin beta 2 YBR031W RPL4A Ribosomal 60S subunit protein L4A YBR038W CHS2 Chitin synthase II YBR048W RPS11B Protein component of the small (40S) ribosomal subunit YBR055C PRP6 Splicing factor YBR084C A RPL19A Ribosomal 60S subunit protein L19A YBR086C IST2 Cortical ER protein involved in ER plasma membrane tethering YBR090C Putative protein of unknown function YBR102C EXO84 Exocyst subunit with dual roles in exocytosis and spliceosome assembly YBR111W A SUS1 Component of both the SAGA histone acetylase and TREX 2 complexes YBR112C CYC8 General transcriptional co repressor YBR118W TEF2 Translational elongation factor EF 1 alpha YBR126C TPS1 Synthase subunit of trehalose 6 P synthase/phosphatase complex YBR126W B Dubious open reading frame YBR146W MRPS9 Mitochondrial ribosomal protein of the small subunit YBR155W CNS1 TPR containing co chaperone YBR158W AMN1 Protein required for daughter cell separation

PAGE 179

179 Table A 4. Continued YBR160W CDC28 Cyclin dependent kinase (CDK) catalytic subunit YBR172C SMY2 GYF domain protein YBR177C EHT1 Acyl coenzymeA:ethanol O acyltransferase YBR207W FTH1 Putative high affinity iron transporter YBR263W SHM1 Mitochondrial serine hydroxymethyltransferase YBR268W MRPL37 Mitochondrial ribosomal protein of the large subunit YBR289W SNF5 Subunit of the SWI/SNF chromatin remodeling complex YCL005W A VMA9 Vacuolar H+ ATPase subunit e of the V ATPase V0 subcomplex YCL008C STP22 Component of the ESCRT I complex YCL042W Putative protein of unknown function YCR002C CDC10 Component of the septin ring, required for cytokinesis YCR005C CIT2 Citrate synthase YCR034W FEN1 Fatty acid elongase, involved in sphingolipid biosynthesis YCR082W AHC2 Component of the ADA histone acetyltransferase complex YDL053C PBP4 Pbp1p binding protein YDL067C COX9 Subunit VIIa of cytochrome c oxidase (Complex IV) YDL092W SRP14 Signal recognition particle (SRP) subunit YDL125C HNT1 Adenosine 5' monophosphoramidase YDL132W CDC53 Cullin YDL173W PAR32 Putative protein of unknown function YDL191W RPL35A Ribosomal 60S subunit protein L35A YDL195W SEC31 Component of the Sec13p Sec31p complex of the COPII vesicle coat YDL198C GGC1 Mitochondrial GTP/GDP transporter YDL229W SSB1 Cytoplasmic ATPase that is a ribosome associated molecular chaperone YDL232W OST4 Subunit of the oligosaccharyltransferase complex of the ER lumen YDR025W RPS11A Protein component of the small (40S) ribosomal subunit YDR046C BAP3 Amino acid permease YDR074W TPS2 Phosphatase subunit of the trehalose 6 P synthase/phosphatase complex YDR119W VBA4 Protein of unknown function YDR120C TRM1 tRNA methyltransferase YDR128W MTC5 Subunit of the SEA (Seh1 associated) complex YDR135C YCF1 Vacuolar glutathione S conjugate transporter YDR141C DOP1 Golgi localized, leucine zipper domain containing protein YDR154C Dubious open reading frame YDR172W SUP35 Translation termination factor eRF3 YDR208W MSS4 Phosphatidylinositol 4 phosphate 5 kinase YDR276C PMP3 Small plasma membrane protein

PAGE 180

180 Table A 4. Continued YDR309C GIC2 Redundant rho like GTPase Cdc42p effector YDR372C VPS74 Golgi phosphatidylinositol 4 kinase effector and PtdIns4P sensor YDR505C PSP1 Asn and gln rich protein of unknown function YDR510W SMT3 Ubiquitin like protein of the SUMO family YDR516C EMI2 Non essential protein of unknown function YEL017W GTT3 Protein of unknown function may be involved in glutathione metabolism YEL027W VMA3 Proteolipid subunit c of the V0 domain of vacuolar H(+) ATPase YEL046C GLY1 Threonine aldolase YER056C A RPL34A Ribosomal 60S subunit protein L34A YER089C PTC2 Type 2C protein phosphatase (PP2C) YER102W RPS8B Protein component of the small (40S) ribosomal subunit YER127W LCP5 Essential protein involved in maturation of 18S rRNA YER131W RPS26B Protein component of the small (40S) ribosomal subunit YER151C UBP3 Ubiquitin specific protease involved in transport and osmotic response YER166W DNF1 Aminophospholipid translocase (flippase) YFL004W VTC2 Subunit of vacuolar transporter chaperone (VTC) complex YFL010C WWM1 WW domain containing protein of unknown function YFR030W MET10 Subunit alpha of assimilatory sulfite reductase YFR044C DUG1 Cys Gly metallo di peptidase YFR050C PRE4 Beta 7 subunit of the 20S proteasome YGL031C RPL24A Ribosomal 60S subunit protein L24A YGL062W PYC1 Pyruvate carboxylase isoform YGL088W Dubious open reading frame YGL120C PRP43 RNA helicase in the DEAH box family YGL130W CEG1 Guanylyltransferase involved in mRNA 5' capping YGL137W SEC27 Essential beta' coat protein of the COPI coatomer YGL141W HUL5 Multiubiquitin chain assembly factor (E4) YGL189C RPS26A Protein component of the small (40S) ribosomal subunit YGL207W SPT16 Subunit of the heterodimeric FACT complex (Spt16p Pob3p) YGL225W VRG4 Golgi GDP mannose transporter YGL245W GUS1 Glutamyl tRNA synthetase (GluRS) YGR001C AML1 Putative protein of unknown function YGR054W Eukaryotic initiation factor (eIF) 2A YGR092W DBF2 Ser/Thr kinase involved in transcription and stress response YGR094W VAS1 Mitochondrial and cytoplasmic valyl tRNA synthetase YGR118W RPS23A Ribosomal protein 28 (rp28) of the small (40S) ribosomal subunit

PAGE 181

181 Table A 4. Continued YGR119C NUP57 FG nucleoporin component of central core of the nuclear pore complex YGR148C RPL24B Ribosomal 60S subunit protein L24B YGR183C QCR9 Subunit 9 of ubiquinol cytochrome c reductase (Complex III) YGR197C SNG1 Protein involved in resistance to nitrosoguanidine and 6 azauracil YGR200C ELP2 Subunit of Elongator complex YGR229C SMI1 Protein involved in the regulation of cell wall synthesis YGR234W YHB1 Nitric oxide oxidoreductase YGR235C MIC26 Component of the MICOS complex YHL001W RPL14B Ribosomal 60S subunit protein L14B YHR005C A TIM10 Essential protein of the mitochondrial intermembrane space YHR010W RPL27A Ribosomal 60S subunit protein L27A YHR016C YSC84 Actin binding protein YHR042W NCP1 NADP cytochrome P450 reductase YHR047C AAP1 Arginine/alanine amino peptidase YHR066W SSF1 Constituent of 66S pre ribosomal particles YHR077C NMD2 Protein involved in the nonsense mediated mRNA decay (NMD) pathway YHR113W APE4 Cytoplasmic aspartyl aminopeptidase with possible vacuole function YHR143W DSE2 Daughter cell specific secreted protein with similarity to glucanases YHR143W A RPC10 RNA polymerase subunit ABC10 alpha, found in RNA pol I, II, and III YHR152W SPO12 Nucleolar protein of unknown function YHR174W ENO2 Enolase II, a phosphopyruvate hydratase YIL009C A EST3 Component of the telomerase holoenzyme YIL018W RPL2B Ribosomal 60S subunit protein L2B YIL035C CKA1 Alpha catalytic subunit of casein kinase 2 (CK2) YIL038C NOT3 Subunit of CCR4 NOT global transcriptional regulator YIL050W PCL7 Pho85p cyclin of the Pho80p subfamily YIL125W KGD1 Subunit of the mitochondrial alpha ketoglutarate dehydrogenase complex YIL135C VHS2 Regulator of septin dynamics YIL148W RPL40A Ubiquitin ribosomal 60S sub unit protein L40A fusion protein YIR001C SGN1 Cytoplasmic RNA binding protein YIR015W RPR2 Subunit of nuclear RNase P YIR036C IRC24 Putative benzil reductase YJL012C VTC4 Vacuolar membrane polyphosphate polymerase YJL078C PRY3 Cell wall associated protein involved in export of acetylated sterols

PAGE 182

182 Table A 4. Continued YJL080C SCP160 Essential RNA binding G protein effector of mating response pathway YJL136C RPS21B Protein component of the small (40S) ribosomal subunit YJL143W TIM17 Essential component of the TIM23 complex YJL173C RFA3 Subunit of heterotrimeric Replication Protein A (RPA) YJL176C SWI3 Subunit of the SWI/SNF chromatin remodeling complex YJL177W RPL17B Ribosomal 60S subunit protein L17B YJR001W AVT1 Vacuolar transporter YJR005W APL1 Beta adaptin YJR076C CDC11 Component of the septin ring that is required for cytokinesis YJR094W A RPL43B Ribosomal 60S subunit protein L43B YJR145C RPS4A Protein component of the small (40S) ribosomal subunit YKL014C URB1 Protein required for the normal accumulation of 25S and 5.8S rRNAs YKL054C DEF1 RNAPII degradation factor YKL085W MDH1 Mitochondrial malate dehydrogenase YKL141W SDH3 Subunit of succinate dehydrogenase and of TIM22 translocase YKL145W RPT1 ATPase of the 19S regulatory particle of the 26S proteasome YKL152C GPM1 Tetrameric phosphoglycerate mutase YKL179C COY1 Golgi membrane protein with similarity to mammalian CASP YKL184W SPE1 Ornithine decarboxylase YKL213C DOA1 WD repeat protein required for ubiquitin mediated protein degradation YKL216W URA1 Dihydroorotate dehydrogenase YKR077W MSA2 Putative transcriptional activator YKR089C TGL4 Multifunctional lipase/hydrolase/phospholipase YKR094C RPL40B Ubiquitin ribosomal 60S subunit protein L40B fusion protein YLR003C CMS1 Putative subunit of the 90S preribosome processome complex YLR017W MEU1 Methylthioadenosine phosphorylase (MTAP) YLR027C AAT2 Cytosolic aspartate aminotransferase involved in nitrogen metabolism YLR052W IES3 Subunit of the INO80 chromatin remodeling complex YLR058C SHM2 Cytosolic serine hydroxymethyltransferase YLR095C IOC2 Subunit of the Isw1b complex YLR209C PNP1 Purine nucleoside phosphorylase YLR216C CPR6 Peptidyl prolyl cis trans isomerase (cyclophilin) YLR256W HAP1 Zinc finger transcription factor YLR259C HSP60 Tetradecameric mitochondrial chaperonin YLR262C YPT6 Rab family GTPase

PAGE 183

183 Table A 4. Continued YLR274W MCM5 Component of the Mcm2 7 hexameric helicase complex YLR286C CTS1 Endochitinase YLR388W RPS29A Protein component of the small (40S) ribosomal subunit YLR389C STE23 Metalloprotease YLR432W IMD3 Inosine monophosphate dehydrogenase YML024W RPS17A Ribosomal protein 51 (rp51) of the small (40s) subunit YML048W GSF2 Endoplasmic reticulum (ER) localized integral membrane protein YML086C ALO1 D Arabinono 1,4 lactone oxidase YMR033W ARP9 Component of both the SWI/SNF and RSC chromatin remodeling complexes YMR061W RNA14 Component of the cleavage and polyadenylation factor I (CF I) YMR093W UTP15 Nucleolar protein YMR122W A Protein of unknown function YMR136W GAT2 Protein containing GATA family zinc finger motifs YMR149W SWP1 Delta subunit of the oligosaccharyl transferase glycoprotein complex YMR186W HSC82 Cytoplasmic chaperone of the Hsp90 family YMR194W RPL36A Ribosomal 60S subunit protein L36A YMR247C RKR1 RING domain E3 ubiquitin ligase YMR261C TPS3 Regulatory subunit of trehalose 6 phosphate synthase/phosphatase YNL039W BDP1 Essential subunit of RNA polymerase III transcription factor (TFIIIB) YNL049C SFB2 Component of the Sec23p Sfb2p heterodimer of the COPII vesicle coat YNL055C POR1 Mitochondrial porin (voltage dependent anion channel) YNL065W AQR1 Plasma membrane transporter of the major facilitator superfamily YNL066W SUN4 Cell wall protein related to glucanases YNL068C FKH2 Forkhead family transcription factor YNL074C MLF3 Serine rich protein of unknown function YNL085W MKT1 Protein that forms a complex with Pbp1p YNL098C RAS2 GTP binding protein YNL103W MET4 Leucine zipper transcriptional activator YNL110C NOP15 Constituent of 66S pre ribosomal particles YNL118C DCP2 Catalytic subunit of the Dcp1p Dcp2p decapping enzyme complex YNL124W NAF1 RNA binding protein required for the assembly of box H/ACA snoRNPs YNL162W RPL42A Ribosomal 60S subunit protein L42A YNL183C NPR1 Protein kinase

PAGE 184

184 Table A 4. Continued YNL190W Hydrophilin essential in desiccation rehydration process YNL197C WHI3 RNA binding protein that sequesters CLN3 mRNA in cytoplasmic foci YNL209W SSB2 Cytoplasmic ATPase that is a ribosome associated molecular chaperone YNL231C PDR16 Phosphatidylinositol transfer protein (PITP) YNL233W BNI4 Targeting subunit for Glc7p protein phosphatase YNL244C SUI1 Translation initiation factor eIF1 YNL300W TOS6 Glycosylphosphatidylinositol dependent cell wall protein YNL307C MCK1 Dual specificity ser/thr and tyrosine protein kinase YNL313C EMW1 Essential conserved protein with a role in cell wall integrity YNL327W EGT2 Glycosylphosphatidylinositol (GPI) anchored cell wall endoglucanase YNR034W SOL1 Protein with a possible role in tRNA export YNR035C ARC35 Subunit of the ARP2/3 complex YNR047W FPK1 Ser/Thr protein kinase YNR052C POP2 RNase of the DEDD superfamily YOL010W RCL1 Endonuclease that cleaves pre rRNA at site A2 for 18S rRNA biogenesis YOL076W MDM20 Non catalytic subunit of the NatB N terminal acetyltransferase YOL121C RPS19A Protein component of the small (40S) ribosomal subunit YOR014W RTS1 B type regulatory subunit of protein phosphatase 2A (PP2A) YOR048C RAT1 Nuclear 5' to 3' single stranded RNA exonuclease YOR057W SGT1 Cochaperone protein YOR061W CKA2 Alpha' catalytic subunit of casein kinase 2 (CK2) YOR069W VPS5 Nexin 1 homolog YOR075W UFE1 t SNARE protein required for retrograde vesicular traffic YOR141C ARP8 Nuclear actin related protein involved in chromatin remodeling YOR182C RPS30B Protein component of the small (40S) ribosomal subunit YOR189W IES4 Component of the INO80 chromatiin remodeling complex YOR195W SLK19 Kinetochore associated protein YOR202W HIS3 Imidazoleglycerol phosphate dehydratase YOR234C RPL33B Ribosomal 60S subunit protein L33B YOR239W ABP140 AdoMet dependent tRNA methyltransferase and actin binding protein YOR241W MET7 Folylpolyglutamate synthetase YOR247W SRL1 Mannoprotein that exhibits a tight association with the cell wall YOR309C Dubious open reading frame YOR312C RPL20B Ribosomal 60S subunit protein L20B

PAGE 185

185 Table A 4. Continued YOR332W VMA4 Subunit E of the V1 domain of the vacuolar H+ ATPase (V ATPase) YPL058C PDR12 Plasma membrane ATP binding cassette (ABC) transporter YPL061W ALD6 Cytosolic aldehyde dehydrogenase YPL105C SYH1 Protein of unknown function that influences nuclear pore distribution YPL126W NAN1 U3 snoRNP protein YPL143W RPL33A Ribosomal 60S subunit protein L33A YPL184C MRN1 RNA binding protein that may be involved in translational regulation YPL195W APL5 Delta adaptin like subunit of the clathrin associated protein complex YPL204W HRR25 Protein kinase YPL249C A RPL36B Ribosomal 60S subunit protein L36B YPL256C CLN2 G1 cyclin involved in regulation of the cell cycle YPR019W MCM4 Essential helicase component of heterohexameric MCM2 7 complexes YPR036W A Protein of unknown function YPR051W MAK3 Catalytic subunit of the NatC type N terminal acetyltransferase YPR053C Dubious open reading frame YPR062W FCY1 Cytosine deaminase YPR063C ER localized protein of unknown function YPR069C SPE3 Spermidine synthase YPR072W NOT5 Subunit of CCR4 NOT global transcriptional regulator YPR080W TEF1 Translational elongation factor EF 1 alpha YPR086W SUA7 Transcription factor TFIIB YPR103W PRE2 Beta 5 subunit of the 20S proteasome YPR129W SCD6 Repressor of translation initiation YPR132W RPS23B Ribosomal protein 28 (rp28) of the small (40S) ribosomal subunit YPR149W NCE102 Protein of unknown function YPR163C TIF3 Translation initiation factor eIF 4B YPR170W B Putative protein of unknown function YPR173C VPS4 AAA ATPase involved in multivesicular body (MVB) protein sorting YPR187W RPO26 RNA polymerase subunit ABC23

PAGE 186

186 Table A 5. Genes with evidence of read through BY4742 Standard Name Name Brief Description ACP1 Acyl Carrier Protein Mitochondrial matrix acyl carrier protein ADE13 ADEnine requiring Adenylosuccinate lyase ATG16 AuTophaGy related Conserved protein involved in autophagy CCS1 Copper Chaperone for SOD1 Copper chaperone for superoxide dismutase Sod1p CDC19 Cell Division Cycle Pyruvate kinase CDC40 Cell Division Cycle Pre mRNA splicing factor CIS3 CIk1 Suppressing Mannose containing glycoprotein constituent of the cell wall CPR1 Cyclosporin A sensitive Proline Rotamase Cytoplasmic peptidyl prolyl cis trans isomerase (cyclophilin) DED1 DEaD box protein ATP dependent DEAD (Asp Glu Ala Asp) box RNA helicase EMP24 EndoMembrane Protein Component of the p24 complex FPR1 Fk 506 sensitive Proline Rotamase Peptidyl prolyl cis trans isomerase (PPIase) GLY1 GLYcine requiring Threonine aldolase GSP1 Genetic Suppressor of Prp20 1 Ran GTPase HAS1 Helicase Associated with Set1 ATP dependent RNA helicase HIS4 HIStidine requiring Multifunctional enzyme containing phosphoribosyl ATP pyrophosphatase HSP82 Heat Shock Protein Hsp90 chaperone HTA1 Histone h Two A Histone H2A ISC1 Inositol phosphoSphingolipid phospholipase C Inositol phosphosphingolipid phospholipase C ISY1 Interactor of SYf1p Member of the NineTeen Complex (NTC) MBF1 Multiprotein Bridging Factor Transcriptional coactivator MF(ALPHA)1 Mating Factor ALPHA Mating pheromone alpha factor, made by alpha cells NTC20 Prp19p (NineTeen) associated Complex Member of the NineTeen Complex (NTC) NUP57 NUclear Pore FG nucleoporin component of central core of the nuclear pore complex PAC 10 Perish in the Absence of Cin8p Part of the heteromeric co chaperone GimC/prefoldin complex PFD1 PreFolDin Subunit of heterohexameric prefoldin PGK1 3 PhosphoGlycerate Kinase 3 phosphoglycerate kinase

PAGE 187

187 Table A 5. Continued PHO4 PHOsphate metabolism Basic helix loop helix (bHLH) transcription factor of the myc family RAD23 RADiation sensitive Protein with ubiquitin like N terminus RAD6 RADiation sensitive Ubiquitin conjugating enzyme (E2) RCF1 Respiratory superComplex Factor Cytochrome c oxidase subunit RNR4 RiboNucleotide Reductase Ribonucleotide diphosphate reductase (RNR) small subunit RPB8 RNA Polymerase B RNA polymerase subunit ABC14.5 RPL20A Ribosomal Protein of the Large subunit Ribosomal 60S subunit protein L20A RPL39 Ribosomal Protein of the Large subunit Ribosomal 60S subunit protein L39 RPL41A Ribosomal Protein of the Large subunit Ribosomal 60S subunit protein L41A RPO26 RNA POlymerase RNA polymerase subunit ABC23 RPP1A Ribosomal Protein P1 Alpha Ribosomal stalk protein P1 alpha RPS10A Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit RPS11A Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit RPS21A Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit RPS24B Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit RPS6B Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit SBH1 Sec61 beta homolog 1 Beta subunit of Sec61p ER translocation complex (Sec61p Sss1p Sbh1p) SEC4 SECretory Rab family GTPase SEC62 SECretory Essential subunit of Sec63 complex SFK1 Suppressor of Four Kinase Plasma membrane protein that may act to generate normal levels of PI4P SGT2 Small Glutamine rich Tetratricopeptide repeat containing protein Glutamine rich cytoplasmic cochaperone SOP4 Suppressor Of Pma1 7 ER membrane protein SRP21 Signal Recognition Particle Subunit of the signal recognition particle (SRP) TDH3 Triose phosphate DeHydrogenase Glyceraldehyde 3 phosphate dehydrogenase (GAPDH), isozyme 3 TIM13 Translocase of the Inner Mitochondrial membrane Mitochondrial intermembrane space protein TPM1 TroPoMyosin Major isoform of tropomyosin

PAGE 188

188 Table A 5. Continued TSA1 Thiol Specific Antioxidant Thioredoxin peroxidase URA1 URAcil requiring Dihydroorotate dehydrogenase VCX1 VaCuolar H+/Ca2+ eXchanger Vacuolar membrane antiporter with Ca2+/H+ and K+/H+ exchange activity WWM1 WW domain containing protein interacting with Metacaspase WW domain containing protein of unknown function YAR1 Yeast Ankyrin Repeat Ankyrin repeat containing, nucleocytoplasmic shuttling chaperone ZWF1 ZWischenFerment Glucose 6 phosphate dehydrogenase (G6PD)

PAGE 189

189 Table A 6. Genes with evidence of read through in tcs2 found in common between BY4742 and tcs2 Standard Name Name Description ACP1 Acyl Carrier Protein Mitochondrial matrix acyl carrier protein ADE12 ADEnine requiring Adenylosuccinate synthase ADE13 ADEnine requiring Adenylosuccinate lyase ADH6 Alcohol DeHydrogenase NADPH dependent medium chain alcohol dehydrogenase ARC19 ARp2/3 Complex subunit Subunit of the ARP2/3 complex ASN2 ASparagiNe requiring Asparagine synthetase ATG16 AuTophaGy related Conserved protein involved in autophagy ATP14 ATP synthase Subunit h of the F0 sector of mitochondrial F1F0 ATP synthase ATP16 ATP synthase Delta subunit of the central stalk of mitochondrial F1F0 ATP synthase BBP1 Bfr1 Binding Protein Protein required for the spindle pole body (SPB) duplication BUR6 Bypass UAS Requirement Subunit of a heterodimeric NC2 transcription regulator complex CCS1 Copper Chaperone for SOD1 Copper chaperone for superoxide dismutase Sod1p CDC19 Cell Division Cycle Pyruvate kinase CDC40 Cell Division Cycle Pre mRNA splicing factor CIS3 CIk1 Suppressing Mannose containing glycoprotein constituent of the cell wall CMD1 CalMoDulin Calmodulin COX14 Cytochrome c OXidase Mitochondrial membrane protein COX5A Cytochrome c OXidase Subunit Va of cytochrome c oxidase COX9 Cytochrome c OXidase Subunit VIIa of cytochrome c oxidase (Complex IV) CUE4 Coupling of Ubiquitin conjugation to ER degradation Protein of unknown function DBP3 Dead Box Protein RNA Dependent ATPase, member of DExD/H box family ERV25 ER Vesicle Member of the p24 family involved in ER to Golgi transport FMP37 Found in Mitochondrial Proteome Highly conserved subunit of the mitochondrial pyruvate carrier FP R1 Fk 506 sensitive Proline Rotamase Peptidyl prolyl cis trans isomerase (PPIase) FPR3 Fk 506 sensitive Proline Rotamase Nucleolar peptidyl prolyl cis trans isomerase (PPIase)

PAGE 190

190 Table A 6. Continued GCV3 GlyCine cleaVage H subunit of the mitochondrial glycine decarboxylase complex GIS2 GIg Suppressor Translational activator for mRNAs with internal ribosome entry sites HAS1 Helicase Associated with Set1 ATP dependent RNA helicase HIS4 HIStidine requiring Multifunctional enzyme containing phosphoribosyl ATP pyrophosphatase HSP82 Heat Shock Protein Hsp90 chaperone HTA1 Histone h Two A Histone H2A HXT3 HeXose Transporter Low affinity glucose transporter of the major facilitator superfamily IPP1 Inorganic PyroPhosphatase Cytoplasmic inorganic pyrophosphatase (PPase) IRC22 Increased Recombination Centers Putative protein of unknown function LSM2 Like SM Lsm (Like Sm) protein MF(ALPHA)1 Mating Factor ALPHA Mating pheromone alpha factor, made by alpha cells MMF1 Mitochondrial Matrix Factor Mitochondrial protein required for transamination of isoleucine NAB6 Nucleic Acid Binding protein Putative RNA binding protein NCE102 NonClassical Export Protein of unknown function NTC20 Prp19p (NineTeen) associated Complex Member of the NineTee n Complex (NTC) OST5 OligoSaccharylTransferase Zeta subunit of the oligosaccharyltransferase complex of the ER lumen PAC10 Perish in the Absence of Cin8p Part of the heteromeric co chaperone GimC/prefoldin complex PGK1 3 PhosphoGlycerate Kinase 3 phosphoglycerate kinase RAD23 RADiation sensitive Protein with ubiquitin like N terminus RAD6 RADiation sensitive Ubiquitin conjugating enzyme (E2) RCF1 Respiratory superComplex Factor Cytochrome c oxidase subunit REG1 REsistance to Glucose repression Regulatory subunit of type 1 protein phosphatase Glc7p RHB1 RHeB homolog Putative Rheb related GTPase RPB8 RNA Polymerase B RNA polymerase subunit ABC14.5 RPL20A Ribosomal Protein of the Large subunit Ribosomal 60S subunit protein L20A RPL39 Ribosomal Protein of the Large subunit Ribosomal 60S subunit protein L39

PAGE 191

191 Table A 6. Continued RPL40B Ribosomal Protein of the Large subunit Ubiquitin ribosomal 60S subunit protein L40B fusion protein RPL41A Ribosomal Protein of the Large subunit Ribosomal 60S subunit protein L41A RPN13 Regulatory Particle Non ATPase Subunit of the 19S regulatory particle of the 26S proteasome lid RPN2 Regulatory Particle Non ATPase Subunit of the 26S proteasome RPO26 RNA POlymerase RNA polymerase subunit ABC23 RPP1A Ribosomal Protein P1 Alpha Ribosomal stalk protein P1 alpha RPS21A Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit RPS6B Ribosomal Protein of the Small subunit Protein component of the small (40S) ribosomal subunit RUB1 Related to UBiquitin Ubiquitin like protein with similarity to mammalian NEDD8 SBH1 Sec61 beta homolog 1 Beta subunit of Sec61p ER translocation complex (Sec61p Sss1p Sbh1p) SEC26 SECretory Essential beta coat protein of the COPI coatomer SEC4 SECretory Rab family GTPase SEC62 SECretory Essential subunit of Sec63 complex SGT2 Small Glutamine rich Tetratricopeptide repeat containing protein Glutamine rich cytoplasmic cochaperone SNT309 Synthetic lethal to prp NineTeen mutation Member of the NineTeen Complex (NTC) SRP21 Signal Recognition Particle Subunit of the signal recognition particle (SRP) SSA1 Stress Seventy subfamily A ATPase involved in protein folding and NLS directed nuclear transport SWD2 Set1c, WD40 repeat protein Subunit of the COMPASS (Set1C) histone H3K4 methyltransferase complex TDH1 Triose phosphate DeHydrogenase Glyceraldehyde 3 phosphate dehydrogenase (GAPDH), isozyme 1 TDH3 Triose phosphate DeHydrogenase Glyceraldehyde 3 phosphate dehydrogenase (GAPDH), isozyme 3 TIF5 Translation Initiation Factor Translation initiation factor eIF5 TIM10 Translocase of the Inner Membrane Essential protein of the mitochondrial intermembrane space TIM13 Translocase of the Inner Mitochondrial membrane Mitochondrial interm embrane space protein

PAGE 192

192 Table A 6. Continued TIM22 Translocase of the Inner Mitochondrial membrane Essential core component of the mitochondrial TIM22 complex URA1 URAcil requiring Dihydroorotate dehydrogenase VMA2 Vacuolar Membrane Atpase Subunit B of V1 peripheral membrane domain of vacuolar H+ ATPase ZWF1 ZWischenFerment Glucose 6 phosphate dehydrogenase (G6PD)

PAGE 193

193 Table A 7. Initiation at upstream UUG in BY4742 Systematic Name Standard Name Description YAL012W CYS3 Cystathionine gamma lyase YBL029C A Protein of unknown function YBL039C URA7 Major CTP synthase isozyme (see also URA8) YBL060W YEL1 Guanine nucleotide exchange factor specific for Arf3p YBR028C YPK3 AGC kinase YBR121C GRS1 Cytoplasmic and mitochondrial glycyl tRNA synthase YBR121C A Dubious open reading frame YBR168W PEX32 Peroxisomal integral membrane protein YBR193C MED8 Subunit of the RNA polymerase II mediator complex YBR212W NGR1 RNA binding protein that negatively regulates growth rate YBR221C PDB1 E1 beta subunit of the pyruvate dehydrogenase (PDH) complex YCR096C HMRA2 Silenced copy of a2 at HMR YDL003W MCD1 Essential alpha kleisin subunit of the cohesin complex YDL025C RTK1 Putative protein kinase, potentially phosphorylated by Cdc28p YDL028C MPS1 Dual specificity kinase YDL063C SYO1 Transport adaptor or symportin YDL129W Protein of unknown function YDL177C Putative protein of unknown function YDL208W NHP2 Protein related to mammalian high mobility group (HMG) proteins YDR037W KRS1 Lysyl tRNA synthetase YDR043C NRG1 Transcriptional repressor YDR086C SSS1 Subunit of the Sec61p translocation complex (Sec61p Sss1p Sbh1p) YDR159W SAC3 mRNA export factor YDR189W SLY1 Hydrophilic protein involved in ER/Golgi vesicle trafficking YDR319C YFT2 Protein required for normal ER membrane biosynthesis YDR347W MRP1 Mitochondrial ribosomal protein of the small subunit YDR377W ATP17 Subunit f of the F0 sector of mitochondrial F1F0 ATP synthase YDR433W Dubious open reading frame YDR473C PRP3 Splicing factor YDR514C Protein of unknown function that localizes to mitochondria YDR530C APA2 Diadenosine 5',5''' P1,P4 tetraphosphate phosphorylase II YEL063C CAN1 Plasma membrane arginine permease YEL072W RMD6 Protein required for sporulation YER059W PCL6 Pho85p cyclin of the Pho80p subfamily YER090W TRP2 Anthranilate synthase YER169W RPH1 JmjC domain containing histone demethylase

PAGE 194

194 Table A 7. Continued YFL007W BLM10 Proteasome activator YFR014C CMK1 Calmodulin dependent protein kinase YFR049W YMR31 Mitochondrial ribosomal protein of the small subunit YGL037C PNC1 Nicotinamidase that converts nicotinamide to nicotinic acid YGL144C ROG1 Protein with putative serine active lipase domain YGL179C TOS3 Protein kinase YGR026W Putative protein of unknown function YGR028W MSP1 Mitochondrial protein involved in mitochondrial protein sorting YGR091W PRP31 Splicing factor YGR155W CYS4 Cystathionine beta synthase YGR166W TRS65 Component of transport protein particle (TRAPP) complex II YGR177C ATF2 Alcohol acetyltransferase YGR188C BUB1 Protein kinase involved in the cell cycle checkpoint into anaphase YGR244C LSC2 Beta subunit of succinyl CoA ligase YGR260W TNA1 High affinity nicotinic acid plasma membrane permease YGR267C FOL2 GTP cyclohydrolase I YHL010C ETP1 Putative protein of unknown function required for growth on ethanol YHL032C GUT1 Glycerol kinase YHR039C MSC7 Protein of unknown function YHR072W A NOP10 Subunit of box H/ACA snoRNP complex YHR084W STE12 Transcription factor that is activated by a MAPK signaling cascade YHR131C Putative protein of unknown function YHR172W SPC97 Component of the microtubule nucleating Tub4p (gamma tubulin) complex YHR186C KOG1 Subunit of TORC1 YHR206W SKN7 Nuclear response regulator and transcription factor YIL016W SNL1 Ribosome associated protein YIL103W DPH1 Protein required for synthesis of diphthamide YIL133C RPL16A Ribosomal 60S subunit protein L16A YJL016W Putative protein of unknown function YJL046W AIM22 Putative lipoate protein ligase YJL130C URA2 Bifunctional carbamoylphosphate synthetase/aspartate transcarbamylase YJL146W IDS2 Protein involved in modulation of Ime2p activity during meiosis YJR034W PET191 Protein required for assembly of cytochrome c oxidase YJR054W KCH1 Potassium transporter that mediates K+ influx YKL004W AUR1 Phosphatidylinositol:ceramide phosphoinositol transferase

PAGE 195

195 Table A 7. Continued YKL076C PSY1 Dubious open reading frame YKL092C BUD2 GTPase activating factor for Rsr1p/Bud1p YKL119C VPH2 Integral membrane protein required for V ATPase function YKL125W RRN3 Protein required for transcription of rDNA by RNA polymerase I YKL138C A HSK3 Essential subunit of the Dam1 complex (aka DASH complex) YKL166C TPK3 cAMP depe ndent protein kinase catalytic subunit YKL184W SPE1 Ornithine decarboxylase YKL215C OXP1 5 oxoprolinase YKR079C TRZ1 tRNA 3' end processing endonuclease tRNase Z YKR089C TGL4 Multifunctional lipase/hydrolase/phospholipase YLL013C PUF3 Protein of the mitochondrial outer surface YLL048C YBT1 Transporter of the ATP binding cassette (ABC) family YLR084C RAX2 N glycosylated protein YLR135W SLX4 Endonuclease involved in processing DNA YLR219W MSC3 Protein of unknown function YLR332W MID2 O glycosylated plasma membrane protein YLR378C SEC61 Conserved ER protein translocation channel YLR451W LEU3 Zinc knuckle transcription factor, repressor and activator YML023C NSE5 Component of the SMC5 SMC6 complex YML038C YMD8 Putative nucleotide sugar transporter YML055W SPC2 Subunit of signal peptidase complex YML056C IMD4 Inosine monophosphate dehydrogenase YML071C COG8 Component of the conserved oligomeric Golgi complex YML108W Protein of unknown function YML117W NAB6 Putative RNA binding protein YMR033W ARP9 Component of both the SWI/SNF and RSC chromatin remodeling complexes YMR173W A Dubious open reading frame YMR200W ROT1 Molecular chaperone involved in protein folding in ER YMR226C NADP(+) dependent serine dehydrogenase and carbonyl reductase YNL024C A KSH1 Essential protein suggested to function early in the secretory pathway YNL094W APP1 Phosphatidate phosphatase, converts phosphatidate to diacylglycerol YNL147W LSM7 Lsm (Like Sm) protein YNL149C PGA2 Essential protein required for maturation of Gas1p and Pho8p YNL189W SRP1 Karyopherin alpha homolog YNL199C GCR2 Transcriptional activator of genes involved in glycolysis YNL233W BNI4 Targeting subunit for Glc7p protein phosphatase

PAGE 196

196 Table A 7. Continued YNL239W LAP3 Cysteine aminopeptidase with homocysteine thiolactonase activity YNL286W CUS2 Putative checkpoint factor in transcription YNR017W TIM23 Essential component of the TIM23 complex YOL004W SIN3 Component of both the Rpd3S and Rpd3L histone deacetylase complexes YOL042W NGL1 Putative endonuclease YOL136C PFK27 6 phosphofructo 2 kinase YOR065W CYT1 Cytochrome c1 YOR083W WHI5 Repressor of G1 transcription YOR113W AZF1 Zinc finger transcription factor YOR142W LSC1 Alpha subunit of succinyl CoA ligase YOR193W PEX27 Peripheral peroxisomal membrane protein YOR209C NPT1 Nicotinate phosphoribosyltransferase YOR232W MGE1 Mitochondrial matrix cochaperone YOR303W CPA1 Small subunit of carbamoyl phosphate synthetase YOR307C SLY41 Protein involved in ER to Golgi transport YOR312C RPL20B Ribosomal 60S subunit protein L20B YOR335C ALA1 Cytoplasmic and mitochondrial alanyl tRNA synthetase YOR342C Protein of unknown function YOR359W VTS1 Flap structured DNA binding and RNA binding protein YOR369C RPS12 Protein component of the small (40S) ribosomal subunit YPL004C LSP1 Primary component of eisosomes YPL012W RRP12 Protein required for export of the ribosomal subunits YPL019C VTC3 Subunit of vacuolar transporter chaperone (VTC) complex YPL032C SVL3 Protein of unknown function YPL083C SEN54 Subunit of the tRNA splicing endonuclease YPL092W SSU1 Plasma membrane sulfite pump involved in sulfite metabolism YPL118W MRP51 Mitochondrial ribosomal protein of the small subunit YPL203W TPK2 cAMP dependent protein kinase catalytic subunit YPL236C ENV7 Vacuolar membrane protein kinase YPR018W RLF2 Largest subunit (p90) of the Chromatin Assembly Complex (CAF 1) YPR072W NOT5 Subunit of CCR4 NOT global transcriptional regulator YPR124W CTR1 High affinity copper transporter of the plasma membrane YPR179C HDA3 Subunit of the HDA1 histone deacetylase complex

PAGE 197

197 Table A 8. Initiation at upstream UUG codons in tcs2 Systematic Name Standard Name Description YAL012W CYS3 Cystathionine gamma lyase YAL026C A Dubious open reading frame YAR033W MST28 Putative integral membrane protein, involved in vesicle formation YAR075W Non functional protein with homology IMP dehydrogenase YBL029C A Protein of unknown function YBL039C URA7 Major CTP synthase isozyme (see also URA8) YBL060W YEL1 Guanine nucleotide exchange factor specific for Arf3p YBL079W NUP170 Subunit of the inner ring of the nuclear pore complex (NPC) YBL101C ECM21 Protein involved in regulating endocytosis of plasma membrane proteins YBR011C IPP1 Cytoplasmic inorganic pyrophosphatase (PPase) YBR028C YPK3 AGC kinase YBR057C MUM2 Protein essential for meiotic DNA replication and sporulation YBR060C ORC2 Subunit of the origin recognition complex (ORC) YBR097W VPS15 Serine/threonine protein kinase involved in vacuolar protein sorting YBR121C GRS1 Cytoplasmic and mitochondrial glycyl tRNA synthase YBR121C A Dubious open reading frame YBR125C PTC4 Cytoplasmic type 2C protein phosphatase (PP2C) YBR129C OPY1 Protein of unknown function YBR146W MRPS9 Mitochondrial ribosomal protein of the small subunit YBR148W YSW1 Protein required for normal prospore membrane formation YBR166C TYR1 Prephenate dehydrogenase involved in tyrosine biosynthesis YBR167C POP7 Subunit of both RNase MRP and nuclear RNase P YBR168W PEX32 Peroxisomal integral membrane protein YBR172C SMY2 GYF domain protein YBR188C NTC20 Member of the NineTeen Complex (NTC) YBR193C MED8 Subunit of the RNA polymerase II mediator complex YBR204C LDH1 Serine hydrolase YBR212W NGR1 RNA binding protein that negatively regulates growth rate YBR221C PDB1 E1 beta subunit of the pyruvate dehydrogenase (PDH) complex YBR238C Mitochondrial membrane protein YBR275C RIF1 Protein that binds to the Rap1p C terminus YCL014W BUD3 Protein involved in bud site selection YCR091W KIN82 Putative serine/threonine protein kinase YCR094W CDC50 Endosomal protein that interacts with phospholipid flippase Drs2p YCR096C HMRA2 Silenced copy of a2 at HMR

PAGE 198

198 Table A 8. Continued YDL003W MCD1 Essential alpha kleisin subunit of the cohesin complex YDL017W CDC7 DDK (Dbf4 dependent kinase) catalytic subunit YDL025C RTK1 Putative protein kinase, potentially phosphorylated by Cdc28p YDL028C MPS1 Dual specificity kinase YDL056W MBP1 Transcription factor YDL063C SYO1 Transport adaptor or symportin YDL129W Protein of unknown function YDL177C Putative protein of unknown function YDL208W NHP2 Protein related to mammalian high mobility group (HMG) proteins YDL211C Protein of unknown function YDL235C YPD1 Phosphorelay intermediate protein YDR037W KRS1 Lysyl tRNA synthetase YDR043C NRG1 Transcriptional repressor YDR086C SSS1 Subunit of the Sec61p translocation complex (Sec61p Sss1p Sbh1p) YDR142C PEX7 Peroxisomal signal receptor for peroxisomal matrix proteins YDR144C MKC7 GPI anchored aspartyl protease YDR155C CPR1 Cytoplasmic peptidyl prolyl cis trans isomerase (cyclophilin) YDR159W SAC3 mRNA export factor YDR172W SUP35 Translation termination factor eRF3 YDR189W SLY1 Hydrophilic protein involved in ER/Golgi vesicle trafficking YDR267C CIA1 Component of cytosolic iron sulfur protein assembly (CIA) machinery YDR292C SRP101 Signal recognition particle (SRP) receptor alpha subunit YDR319C YFT2 Protein required for normal ER membrane biosyn thesis YDR347W MRP1 Mitochondrial ribosomal protein of the small subunit YDR357C CNL1 Subunit of the BLOC 1 complex involved in endosomal maturation YDR377W ATP17 Subunit f of the F0 sector of mitochondrial F1F0 ATP synthase YDR433W Dubious open reading frame YDR453C TSA2 Stress inducible cytoplasmic thioredoxin peroxidase YDR473C PRP3 Splicing factor YDR490C PKH1 Serine/threonine protein kinase YDR510W SMT3 Ubiquitin like protein of the SUMO family YDR514C Protein of unknown function that localizes to mitochondria YDR530C APA2 Diadenosine 5',5''' P1,P4 tetraphosphate phosphorylase II YDR541C Putative dihydrokaempferol 4 reductase YEL009C GCN4 bZIP transcriptional activator of amino acid biosynthetic genes YEL024W RIP1 Ubiquinol cytochrome c reductase

PAGE 199

199 Table A 8. Continued YEL053C MAK10 Non catalytic subunit of N terminal acetyltransferase of the NatC type YEL063C CAN1 Plasma membrane arginine permease YEL072W RMD6 Protein required for sporulation YER014W HEM14 Protoporphyrinogen oxidase YER047C SAP1 Putative ATPase of the AAA family YER057C HMF1 Member of the p14.5 protein family YER059W PCL6 Pho85p cyclin of the Pho80p subfamily YER063W THO1 Conserved nuclear RNA binding protein YER090W TRP2 Anthranilate synthase YER142C MAG1 3 methyl adenine DNA glycosylase YER147C SCC4 Subunit of cohesin loading factor (Scc2p Scc4p) YER156C Putative protein of unknown function YER169W RPH1 JmjC domain containing histone demethylase YER190W YRF1 2 Helicase encoded by the Y' element of subtelomeric regions YFL007W BLM10 Proteasome activator YFL066C Helicase like protein encoded within the telomeric Y' element YFR027W ECO1 Acetyltransferase YFR049W YMR31 Mitochondrial ribosomal protein of the small subunit YFR055W IRC7 Beta lyase involved in the production of thiols YGL003C CDH1 Activator of anaphase promoting complex/cyclosome (APC/C) YGL013C PDR1 Transcription factor that regulates the pleiotropic drug response YGL014W PUF4 Member of the PUF protein family YGL037C PNC1 Nicotinamidase that converts nicotinamide to nicotinic acid YGL039W Oxidoreductase shown to reduce carbonyl compounds to chiral alcohols YGL061C DUO1 Essential subunit of the Dam1 complex (aka DASH complex) YGL160W AIM14 NADPH oxidase localized to the perinuclear ER YGL179C TOS3 Protein kinase YGR026W Putative protein of unknown function YGR085C RPL11B Ribosomal 60S subunit protein L11B YGR091W PRP31 Splicing factor YGR155W CYS4 Cystathionine beta synthase YGR166W TRS65 Component of transport protein particle (TRAPP) complex II YGR177C ATF2 Alcohol acetyltransferase YGR188C BUB1 Protein kinase involved in the cell cycle checkpoint into anaphase YGR209C TRX2 Cytoplasmic thioredoxin isoenzyme YGR244C LSC2 Beta subunit of succinyl CoA ligase YGR260W TNA1 High affinity nicotinic acid plasma membrane permease

PAGE 200

200 Table A 8. Continued YGR264C MES1 Methionyl tRNA synthetase YGR267C FOL2 GTP cyclohydrolase I YGR281W YOR1 Plasma membrane ATP binding cassette (ABC) transporter YHL002W HSE1 Subunit of the endosomal Vps27p Hse1p complex YHL008C Putative protein of unknown function YHL010C ETP1 Putative protein of unknown function required for growth on ethanol YHL032C GUT1 Glycerol kinase YHR032W ERC1 Member of the multi drug and toxin extrusion (MATE) family YHR036W BRL1 Essential nuclear envelope integral membrane protein YHR039C MSC7 Protein of unknown function YHR072W A NOP10 Subunit of box H/ACA snoRNP complex YHR084W STE12 Transcription factor that is activated by a MAPK signaling cascade YHR087W RTC3 Protein of unknown function involved in RNA metabolism YHR121W LSM12 Protein of unknown function that may function in RNA processing YHR131C Putative protein of unknown function YHR158C KEL1 Protein required for proper cell fusion and cell morphology YHR170W NMD3 Protein involved in nuclear export of the large ribosomal subunit YHR172W SPC97 Component of the microtubule nucleating Tub4p (gamma tubulin) complex YHR186C KOG1 Subunit of TORC1 YIL016W SNL1 Ribosome associated protein YIL022W TIM44 Essential component of the TIM23 complex YIL103W DPH1 Protein required for synthesis of diphthamide YIL124W AYR1 Bifunctional triacylglycerol lipase and 1 acyl DHAP reductase YIL133C RPL16A Ribosomal 60S subunit protein L16A YIR029W DAL2 Allantoicase YJL026W RNR2 Ribonucleotide diphosphate reductase (RNR), small subunit YJL046W AIM22 Putative lipoate protein ligase YJL130C URA2 Bifunctional carbamoylphosphate synthetase/aspartate transcarbamylase YJL146W IDS2 Protein involved in modulation of Ime2p activity during meiosis YJL164C TPK1 cAMP dependent protein kinase catalytic subunit YJL168C SET2 Histone methyltransferase with a role in transcriptional elongation YJL183W MNN11 Subunit of a Golgi mannosyltransferase complex YJL196C ELO1 Elongase I, medium chain acyl elongase YJL209W CBP1 Mitochondrial protein, regulator of COB mRNA stability

PAGE 201

201 Table A 8. Continued YJR034W PET191 Protein required for assembly of cytochrome c oxidase YJR054W KCH1 Potassium transporter that mediates K+ influx YJR131W MNS1 Alpha 1,2 mannosidase YKL004W AUR1 Phosphatidylinositol:ceramide phosphoinositol transferase YKL038W RGT1 Glucose responsive transcription factor YKL076C PSY1 Dubious open reading frame YKL092C BUD2 GTPase activating factor for Rsr1p/Bud1p YKL098W MTC2 Protein of unknown function YKL119C VPH2 Integral membrane protein required for V ATPase function YKL125W RRN3 Protein required for transcription of rDNA by RNA polymeras e I YKL138C A HSK3 Essential subunit of the Dam1 complex (aka DASH complex) YKL166C TPK3 cAMP dependent protein kinase catalytic subunit YKL175W ZRT3 Vacuolar membrane zinc transporter YKL184W SPE1 Ornithine decarboxylase YKL196C YKT6 Vesicle membrane protein (v SNARE) with acyltransferase activity YKL215C OXP1 5 oxoprolinase YKR027W BCH2 Member of the ChAPs (Chs5p Arf1p binding proteins) family YKR058W GLG1 Glycogenin glucosyltransferase YKR079C TRZ1 tRNA 3' end processing endonuclease tRNase Z YKR089C TGL4 Multifunctional lipase/hydrolase/phospholipase YLL013C PUF3 Protein of the mitochondrial outer surface YLL048C YBT1 Transporter of the ATP binding cassette (ABC) family YLR008C PAM18 Subunit of the import motor (PAM complex) YLR084C RAX2 N glycosylated protein YLR135W SLX4 Endonuclease involved in processing DNA YLR202C Dubious open reading frame YLR219W MSC3 Protein of unknown function YLR224W F box protein and component of SCF ubiquitin ligase complexes YLR241W Putative protein of unknown function YLR287C Putative protein of unknown function YLR326W Putative protein of unknown function YLR332W MID2 O glycosylated plasma membrane protein YLR378C SEC61 Conserved ER protein translocation channel YLR451W LEU3 Zinc knuckle transcription factor, repressor and activator YLR455W Nuclear protein of unknown function YML020W Putative protein of unknown function YML023C NSE5 Component of the SMC5 SMC6 complex YML032C RAD52 Protein that stimulates strand exchange YML037C Putative protein of unknown function

PAGE 202

202 Table A 8. Continued YML038C YMD8 Putative nucleotide sugar transporter YML052W SUR7 Plasma membrane protein of unknown function involved with endocytosis YML055W SPC2 Subunit of signal peptidase complex YML056C IMD4 Inosine monophosphate dehydrogenase YML071C COG8 Component of the conserved oligomeric Golgi complex YML108W Protein of unknown function YML117W NAB6 Putative RNA binding protein YMR033W ARP9 Component of both the SWI/SNF and RSC chromatin remodeling complexes YMR059W SEN15 Subunit of the tRNA splicing endonuclease YMR080C NAM7 ATP dependent RNA helicase of the SFI superfamily YMR134W ERG29 Protein of unknown function involved in ergosterol biosynthesis YMR173W A Dubious open reading fra me YMR200W ROT1 Molecular chaperone involved in protein folding in ER YMR226C NADP(+) dependent serine dehydrogenase and carbonyl reductase YMR234W RNH1 Ribonuclease H1 YMR300C ADE4 Phosphoribosylpyrophosphate amidotransferase (PRPPAT) YNL018C Putative protein of unknown function YNL031C HHT2 Histone H3 YNL094W APP1 Phosphatidate phosphatase, converts phosphatidate to diacylglycerol YNL139C THO2 Subunit of the THO complex YNL147W LSM7 Lsm (Like Sm) protein YNL149C PGA2 Essential protein required for maturation of Gas1p and Pho8p YNL152W INN1 Essential protein that associates with contractile actomyosin ring YNL189W SRP1 Karyopherin alpha homolog YNL199C GCR2 Transcriptional activator of genes involved in glycolysis YNL233W BNI4 Targeting subunit for Glc7p protein phosphatase YNL234W Protein of unknown function with similarity to globins YNL239W LAP3 Cysteine aminopeptidase with homocysteine thiolactonase activity YNL255C GIS2 Translational activator for mRNAs with internal ribosome entry sites YNL280C ERG24 C 14 sterol reductase YNL286W CUS2 Putative checkpoint factor in transcription YNR017W TIM23 Essential component of the TIM23 complex YNR047W FPK1 Ser/Thr protein kinase YNR053C NOG2 Putative GTPase

PAGE 203

203 Table A 8. Continued YOL004W SIN3 Component of both the Rpd3S and Rpd3L histone deacetylase complexes YOL028C YAP7 Putative basic leucine zipper (bZIP) transcription factor YOL042W NGL1 Putative endonuclease YOL061W PRS5 5 phospho ribosyl 1(alpha) pyrophosphate synthetase YOL063C CRT10 Protein involved in transcriptional regulation of RNR2 and RNR3 YOL098C Putative metalloprotease YOL136C PFK27 6 phosphofructo 2 kinase YOL155C HPF1 Haze protective mannoprotein YOR062C Protein of unknown function YOR065W CYT1 Cytochrome c1 YOR083W WHI5 Repressor of G1 transcription YOR086C TCB1 Lipid binding ER protein involved in ER plasma membrane tethering YOR113W AZF1 Zinc finger transcription factor YOR142W LSC1 Alpha subunit of succinyl CoA ligase YOR188W MSB1 Protein of unknown function YOR193W PEX27 Peripheral peroxisomal membrane protein YOR209C NPT1 Nicotinate phosphoribosyltransferase YOR228C MCP1 Mitochondrial protein of unknown function involved in lipid homeostas YOR232W MGE1 Mitochondrial matrix coc haperone YOR260W GCD1 Gamma subunit of the translation initiation factor eIF2B YOR303W CPA1 Small subunit of carbamoyl phosphate synthetase YOR304W ISW2 ATP dependent DNA translocase involved in chromatin remodeling YOR307C SLY41 Protein involved in ER to Golgi transport YOR335C ALA1 Cytoplasmic and mitochondrial alanyl tRNA synthetase YOR347C PYK2 Pyruvate kinase YOR359W VTS1 Flap structured DNA binding and RNA binding protein YOR369C RPS12 Protein component of the small (40S) ribosomal subunit YPL004C LSP1 Primary component of eisosomes YPL012W RRP12 Protein required for export of the ribosomal subunits YPL019C VTC3 Subunit of vacuolar transporter chaperone (VTC) complex YPL032C SVL3 Protein of unknown function YPL083C SEN54 Subunit of the tRNA splicing endonuclease YPL092W SSU1 Plasma membrane sulfite pump involved in sulfite metabolism YPL118W MRP51 Mitochondrial ribosomal protein of the small subunit YPL132W COX11 Protein required for delivery of copper to Cox1p YPL203W TPK2 cAMP dependent protein kinase catalytic subunit YPL236C ENV7 Vacuolar membrane protein kinase

PAGE 204

204 Table A 8. Continued YPR018W RLF2 Largest subunit (p90) of the Chromatin Assembly Complex (CAF 1) YPR070W MED1 Subunit of the RNA polymerase II mediator complex YPR072W NOT5 Subunit of CCR4 NOT global transcriptional regulator YPR124W CTR1 High affinity copper transporter of the plasma membrane YPR131C NAT3 Catalytic subunit of the NatB N terminal acetyltransferase YPR143W RRP15 Nucleolar protein YPR179C HDA3 Subunit of the HDA1 histone deacetylase complex YPR204W DNA helicase encoded within the telomeric Y' element

PAGE 205

205 Table A 9. Initiation at upstream ACG in BY4742 Systematic Name Standard Name Description YAL014C SYN8 Endosomal SNARE related to mammalian syntaxin 8 YAR008W SEN34 Subunit of the tRNA splicing endonuclease YAR015W ADE1 N succinyl 5 aminoimidazole 4 carboxamide ribotide synthetase YBL093C ROX3 Subunit of the RNA polymerase II mediator complex YBR007C DSF2 Deletion suppressor of mpt5 mutation YBR135W CKS1 Cyclin dependent protein kinase regulatory subunit and adaptor YBR193C MED8 Subunit of the RNA polymerase II mediator complex YCR023C Vacuolar membrane protein of unknown function YCR027C RHB1 Putative Rheb related GTPase YDL003W MCD1 Essential alpha kleisin subunit of the cohesin complex YDL076C RXT3 Component of the Rpd3L histone deacetylase complex YDL077C VAM6 Vacuolar protein involved in vacuolar membrane fusion tethering YDL112W TRM3 2' O ribose methyltransferase YDL136W RPL35B Ribosomal 60S subunit protein L35B YDL160C DHH1 Cytoplasmic DExD/H box helicase, stimulates mRNA decapping YDL179W PCL9 Cyclin YDL208W NHP2 Protein related to mammalian high mobility group (HMG) proteins YDL224C WHI4 Putative RNA binding protein YDR133C Dubious open reading frame YDR154C Dubious open reading frame YDR210W Predicted tail anchored plasma membrane protein YDR237W MRPL7 Mitochondrial ribosomal protein of the large subunit YDR281C PHM6 Protein of unknown function YDR284C DPP1 Diacylglycerol pyrophosphate (DGPP) phosphatase YDR309C GIC2 Redundant rho like GTPase Cdc42p effector YDR545W YRF1 1 Helicase encoded by the Y' element of subtelomeric regions YER071C TDA2 Protein of unknown function YER072W VTC1 Subunit of the vacuolar transporter chaperone (VTC) complex YER088C A Dubious open reading frame YER110C KAP123 Karyopherin beta YER118C SHO1 Transmembrane osmosensor for filamentous growth and HOG pathways YER159C BUR6 Subunit of a heterodimeric NC2 transcription regulator complex

PAGE 206

206 Table A 9. Continued YGL071W AFT1 Transcription factor involved in iron utilization and homeostasis YGR017W Putative protein of unknown function YGR026W Putative protein of unknown function YGR137W Dubious open reading frame YGR156W PTI1 Essential component of CPF (cleavage and polyadenylation factor) YGR170W PSD2 Phosphatidylserine decarboxylase of the Golgi and vacuolar membranes YHL026C Putative protein of unknown function YHL034C SBP1 Protein that binds eIF4G and has a role in repression of translation YHR007C ERG11 Lanosterol 14 alpha demethylase YHR162W MPC2 Highly conserved subunit of the mitochondrial pyruvate carrier YIL087C AIM19 Putative protein of unknown function YIL133C RPL16A Ribosomal 60S subunit protein L16A YIL153W RRD1 Peptidyl prolyl cis/trans isomerase YIL177C Putative Y' element ATP dependent helicase YJL016W Putative protein of unknown function YJL046W AIM22 Putative lipoate protein ligase YJL154C VPS35 Endosomal subunit of membrane associated retromer complex YJL166W QCR8 Subunit 8 of ubiquinol cytochrome c reductase (Complex III) YJL225C Putative Y' element ATP dependent helicase YKL032C IXR1 Transcriptional repressor that regulates hypoxic genes during normoxia YKL138C A HSK3 Essential subunit of the Dam1 complex (aka DASH complex) YKL148C SDH1 Flavoprotein subunit of succinate dehydrogenase YKL183W LOT5 Protein of unknown function YKL198C PTK1 Putative serine/threonine protein kinase YKR001C VPS1 Dynamin like GTPase required for vacuolar sorting YKR079C TRZ1 tRNA 3' end processing endonuclease tRNase Z YLL021W SPA2 Component of the polarisome YLL048C YBT1 Transporter of the ATP binding cassette (ABC) family YLR026C SED5 cis Golgi t SNARE syntaxin YLR042C Protein of unknown function YLR084C RAX2 N glycosylated protein YLR221C RSA3 Protein with a likely role in ribosomal maturation YLR254C NDL1 Homolog of nuclear distribution factor NudE YLR340W RPP0 Conserved ribosomal protein P0 of the ribosomal stalk YLR467W YRF1 5 Helicase encoded by the Y' element of subtelomeric regions YML020W Putative protein of unknown function

PAGE 207

207 Table A 9. Continued YML055W SPC2 Subunit of signal peptidase complex YML108W Protein of unknown function YML116W A Putative protein of unknown function YML133C Putative Y' element ATP dependent helicase YMR043W MCM1 Transcription factor YMR102C Protein of unknown function YMR176W ECM5 Subunit of the Snt2C complex YMR304C A Dubious open reading frame YNL021W HDA1 Putative catalytic subunit of a class II histone deacetylase complex YNL156C NSG2 Protein involved in regulation of sterol biosynthesis YNL199C GCR2 Transcriptional activator of genes involved in glycolysis YNL233W BNI4 Targeting subunit for Glc7p protein phosphatase YNL239W LAP3 Cysteine aminopeptidase with homocysteine thiolactonase activity YNL282W POP3 Subunit of both RNase MRP and nuclear RNase P YNR010W CSE2 Subunit of the RNA polymerase II mediator complex YNR044W AGA1 Anchorage subunit of a agglutinin of a cells YOL113W SKM1 Member of the PAK family of serine/threonine protein kinases YOR014W RTS1 B type regulatory subunit of protein phosphatase 2A (PP2A) YOR307C SLY41 Protein involved in ER to Golgi transport YOR335C ALA1 Cytoplasmic and mitochondrial alanyl tRNA synthetase YOR396W YRF1 8 One of several telomeric Y' element encoded DNA helicases YPL070W MUK1 Guanine nucleotide exchange factor (GEF) YPL082C MOT1 Essential protein involved in regulation of transcription Y PL092W SSU1 Plasma membrane sulfite pump involved in sulfite metabolism YPL144W POC4 Component of a heterodimeric Poc4p Irc25p chaperone YPL183W A RTC6 Protein involved in translation YPL221W FLC1 Putative FAD transporter YPR073C LTP1 Protein phosphotyrosine phosphatase of unknown cellular role YPR128C ANT1 Peroxisomal adenine nucleotide transporter YPR170W A Dubious open reading frame

PAGE 208

208 Table A 10 Initiation at upstream ACG in tcs2 Systematic Name Standard Name Description YAL014C SYN8 Endosomal SNARE related to mammalian syntaxin 8 YAL039C CYC3 Cytochrome c heme lyase (holocytochrome c synthase) YAR008W SEN34 Subunit of the tRNA splicing endonuclease YAR015W ADE1 N succinyl 5 aminoimidazole 4 carboxamide ribotide synthetase YAR075W Non functional protein with homology IMP dehydrogenase YBL084C CDC27 Subunit of the Anaphase Promoting Complex/Cyclosome (APC/C) YBL093C ROX3 Subunit of the RNA polymerase II mediator complex YBL111C Helicase like protein encoded within the telomeric Y' element YBR007C DSF2 Deletion suppressor of mpt5 mutation YBR065C ECM2 Pre mRNA splicing factor YBR112C CYC8 General transcriptional co repressor YBR131W CCZ1 Protein involved in vacuolar assembly YBR135W CKS1 Cyclin dependent protein kinase regulatory subunit and adaptor YBR148W YSW1 Protein required for normal prospore membrane formation YBR188C NTC20 Member of the NineTeen Complex (NTC) YBR193C MED8 Subunit of the RNA polymerase II mediator complex YBR206W Dubious open reading frame YBR257W POP4 Subunit of both RNase MRP and nuclear RNase P YBR262C MIC12 Component of the MICOS complex YCR023C Vacuolar membrane protein of unknown function YCR027C RHB1 Putative Rheb related GTPase YDL003W MCD1 Essential alpha kleisin subunit of the cohesin complex YDL013W SLX5 Subunit of the Slx5 Slx8 SUMO targeted ubiquitin ligase complex YDL076C RXT3 Component of the Rpd3L histone deacetylase complex YDL077C VAM6 Vacuolar protein involved in vacuolar membrane fusion tethering YDL095W PMT1 Protein O mannosyltransferase of the ER membrane YDL097C RPN6 Essential, non ATPase regulatory subunit of the 26S proteasome lid YDL112W TRM3 2' O ribose methyltransferase YDL136W RPL35B Ribosomal 60S subunit protein L35B YDL160C DHH1 Cytoplasmic DExD/H box helicase, stimulates mRNA decapping YDL179W PCL9 Cyclin

PAGE 209

209 Table A 10. Continued YDL208W NHP2 Protein related to mammalian high mobility group (HMG) proteins YDL224C WHI4 Putative RNA binding protein YDL235C YPD1 Phosphorelay intermediate protein YDR118W APC4 Subunit of the Anaphase Promoting Complex/Cyclosome (APC/C) YDR133C Dubious open reading frame YDR144C MKC7 GPI anchored aspartyl protease YDR154C Dubious open reading frame YDR192C NUP42 FG nucleoporin component of central core of the nuclear pore complex YDR210W Predicted tail anchored plasma membrane protein YDR237W MRPL7 Mitochondrial ribosomal protein of the large subunit YDR284C DPP1 Diacylglycerol pyrophosphate (DGPP) phosphatase YDR309C GIC2 Redundant rho like GTPase Cdc42p effector YDR335W MSN5 Karyopherin YDR421W ARO80 Zinc finger transcriptional activator of the Zn2Cys6 family YDR490C PKH1 Serine/threonine protein kinase YDR528W HLR1 Protein involved in regulation of cell wall composition and integrity YDR545W YRF1 1 Helicase encoded by the Y' element of subtelomeric regions YEL053C MAK10 Non catalytic subunit of N terminal acetyltransferase of the NatC type YEL075C Putative protein of unknown function YER014W HEM14 Protoporphyrinogen oxidase YER072W VTC1 Subunit of the vacuolar transporter chaperone (VTC) complex YER088C A Dubious open reading frame YER110C KAP123 Karyopherin beta YER118C SHO1 Transmembrane osmosensor for filamentous growth and HOG pathways YER159C BUR6 Subunit of a heterodimeric NC2 transcription regulator complex YER190W YRF1 2 Helicase encoded by the Y' element of subtelomeric regions YFL064C Putative protein of unknown function YGL071W AFT1 Transcription factor involved in iron utilization and homeostasis YGL073W HSF1 Trimeric heat shock transcription factor YGL137W SEC27 Essential beta' coat protein of the COPI coatomer YGR017W Putative protein of unknown function YGR026W Putative protein of unknown function

PAGE 210

210 Table A 10. Continued YGR137W Dubious open reading frame YGR156W PTI1 Essential component of CPF (cleavage and polyadenylation factor) YGR170W PSD2 Phosphatidylserine decarboxylase of the Golgi and vacuolar membranes YGR209C TRX2 Cytoplasmic thioredoxin isoenzyme YGR281W YOR1 Plasma membrane ATP binding cassette (ABC) transporter YHL026C Putative protein of unknown function YHL034C SBP1 Protein that binds eIF4G and has a role in repression of translation YHL039W EFM1 Lysine methyltransferase YHL049C Putative protein of unknown function YHR007C ERG11 Lanosterol 14 alpha demethylase YHR036W BRL1 Essential nuclear envelope integral membrane protein YHR102W KIC1 Protein kinase of the PAK/Ste20 family, required for cell integrity YHR162W MPC2 Highly conserved subunit of the mitochondrial pyruvate carrier YHR218W Helicase like protein encoded within the telomeric Y' element YIL001W Putative protein of unknown function YIL031W ULP2 Peptidase that deconjugates Smt3/SUMO 1 peptides from proteins YIL055C Putative protein of unknown function YIL087C AIM19 Putative protein of unknown function YIL101C XBP1 Transcriptional repressor YIL133C RPL16A Ribosomal 60S subunit protein L16A YIL134W FLX1 Protein required for transport of flavin adenine dinucleotide (FAD) YIL153W RRD1 Peptidyl prolyl cis/trans isomerase YIL177C Putative Y' element ATP dependent helicase YJL001W PRE3 Beta 1 subunit of the 20S proteasome YJL016W Putative protein of unknown function YJL046W AIM22 Putative lipoate protein ligase YJL078C PRY3 Cell wall associated protein involved in export of acetylated sterols YJL083W TAX4 EH domain containing protein YJL110C GZF3 GATA zinc finger protein YJL154C VPS35 Endosomal subunit of membrane associated retromer complex YJL166W QCR8 Subunit 8 of ubiquinol cytochrome c reductase (Complex III) YJL225C Putative Y' element ATP dependent helicase

PAGE 211

211 Table A 10. Continued YKL015W PUT3 Transcriptional activator YKL032C IXR1 Transcriptional repressor that regulates hypoxic genes during normoxia YKL055C OAR1 Mitochondrial 3 oxoacyl [acyl carrier protein] reductase YKL113C RAD27 5' to 3' exonuclease, 5' flap endonuclease YKL138C MRPL31 Mitochondrial ribosomal protein of the large subunit YKL138C A HSK3 Essential subunit of the Dam1 complex (aka DASH complex) YKL148C SDH1 Flavoprotein subunit of succinate dehydrogenase YKL175W ZRT3 Vacuolar membrane zinc transporter YKL183W LOT5 Protein of unknown function YKR079C TRZ1 tRNA 3' end processing endonuclease tRNase Z YLL013C PUF3 Protein of the mitochondrial outer surface YLL021W SPA2 Component of the polarisome YLL048C YBT1 Transporter of the ATP binding cassette (ABC) family YLR008C PAM18 Subunit of the import motor (PAM complex) YLR026C SED5 cis Golgi t SNARE syntaxin YLR042C Protein of unknown function YLR079W SIC1 Cyclin dependent kinase inhibitor (CKI) YLR084C RAX2 N glycosylated protein YLR164W SHH4 Mitochondrial inner membrane protein of unknown function YLR178C TFS1 Protein that interacts with and inhibits carboxypeptidase Y and Ira2p YLR221C RSA3 Protein with a likely role in ribosomal maturation YLR254C NDL1 Homolog of nuclear distribution factor NudE YLR325C RPL38 Ribosomal 60S subunit protein L38 YLR382C NAM2 Mitochondrial leucyl tRNA synthetase YLR438C A LSM3 Lsm (Like Sm) protein YLR462W Putative protein of unknown function with similarity to helicases YLR467W YRF1 5 Helicase encoded by the Y' element of subtelomeric regions YML020W Putative protein of unknown function YML055W SPC2 Subunit of signal peptidase complex YML108W Protein of unknown function YML116W A Putative protein of unknown function YML133C Putative Y' element ATP dependent helicase YMR043W MCM1 Transcription factor YMR059W SEN15 Subunit of the tRNA splicing endonuclease YMR080C NAM7 ATP dependent RNA helicase of the SFI superfamily YMR102C Protein of unknown function YMR173W DDR48 DNA damage responsive protein

PAGE 212

212 Table A 10. Continued YMR176W ECM5 Subunit of the Snt2C complex YMR234W RNH1 Ribonuclease H1 YMR238W DFG5 Putative mannosidase YMR281W GPI12 ER membrane protein involved in the second step of GPI anchor assembly YMR304C A Dubious open reading frame YNL021W HDA1 Putative catalytic subunit of a class II histone deacetylase complex YNL044W YIP3 Protein localized to COPII vesicles YNL152W INN1 Essential protein that associates with contractile actomyosin ring YNL156C NSG2 Protein involved in regulation of sterol biosynthesis YNL199C GCR2 Transcriptional activator of genes involved in glycolysis YNL233W BNI4 Targeting subunit for Glc7p protein phosphatase YNL239W LAP3 Cysteine aminopeptidase with homocysteine thiolactonase activity YNL255C GIS2 Translational activator for mRNAs with internal ribosome entry sites YNL282W POP3 Subunit of both RNase MRP and nuclear RNase P YNR010W CSE2 Subunit of the RNA polymerase II mediator complex YNR044W AGA1 Anchorage subunit of a agglutinin of a cells YOL077C BRX1 Nucleolar protein YOL098C Putative metalloprotease YOL113W SKM1 Member of the PAK family of serine/threonine protein kinases YOR014W RTS1 B type regulatory subunit of protein phosphatase 2A (PP2A) YOR030W DFG16 Probable multiple transmembrane protein YOR191W ULS1 Swi2/Snf2 related translocase, SUMO Targeted Ubiquitin Ligase (STUbL) YOR208W PTP2 Phosphotyrosine specific protein phosph atase YOR236W DFR1 Dihydrofolate reductase involved in tetrahydrofolate biosynthesis YOR307C SLY41 Protein involved in ER to Golgi transport YOR335C ALA1 Cytoplasmic and mitochondrial alanyl tRNA synthetase YOR396W YRF1 8 One of several telomeric Y' element encoded DNA helicases YPL045W VPS16 Subunit of the HOPS and the CORVET complexes YPL082C MOT1 Essential protein involved in regulation of transcription YPL092W SSU1 Plasma membrane sulfite pump involved in sulfite metabolism YPL144W POC4 Component of a heterodimeric Poc4p Irc25p chaperone YPR010C A Putative protein of unknown function

PAGE 213

213 Table A 10. Continued YPR073C LTP1 Protein phosphotyrosine phosphatase of unknown cellular role YPR128C ANT1 Peroxisomal adenine nucleotide transporter YPR144C NOC4 Nucleolar protein YPR170W A Dubious open reading frame YPR191W QCR2 Subunit 2 of ubiquinol cytochrome c reductase (Complex III)

PAGE 214

214 Table A 11. Initiation at upstream GUG in BY4742 Systematic Name Standard Name Description YBL029C A Protein of unknown function YBL039C A Dubious open reading frame YBL068W PRS4 5 phospho ribosyl 1(alpha) pyrophosphate synthetase, synthesizes PRPP YBL093C ROX3 Subunit of the RNA polymerase II mediator complex YBR071W Protein of unknown function found in the cytoplasm and bud neck YBR102C EXO84 Exocyst subunit with dual roles in exocytosis and spliceosome assembly YBR168W PEX32 Peroxisomal integral membrane protein YBR211C AME1 Essential kinetochore protein associated with microtubules and SPBs YCL037C SRO9 Cytoplasmic RNA binding protein YCR019W MAK32 Protein necessary for stability of L A dsRNA containing particles YDR016C DAD1 Essential subunit of the Dam1 complex (aka DASH complex) YDR133C Dubious open reading frame YDR142C PEX7 Peroxisomal signal receptor for peroxisomal matrix proteins YDR154C Dubious open reading frame YDR157W Dubious open reading frame YDR170C SEC7 Guanine nucleotide exchange factor (GEF) for ADP ribosylation factors YDR379W RGA2 GTPase activating protein for polarity establishment protein Cdc42p YDR399W HPT1 Dimeric hypoxanthine guanine phosphoribosyltransferase YDR441C APT2 Potential adenine phosphoribosyltransferase YDR460W TFB3 Subunit of TFIIH and nucleotide excision repair factor 3 complexes YDR531W CAB1 Pantothenate kinase, ATP:D pantothenate 4' phosphotransferase YER071C TDA2 Protein of unknown function YGL006W PMC1 Vacuolar Ca2+ ATPase involved in depleting cytosol of Ca2+ ions YGR017W Putative protein of unknown function YGR135W PRE9 Alpha 3 subunit of the 20S proteasome YGR137W Dubious open reading frame YGR157W CHO2 Phosphatidylethanolamine methyltransferase (PEMT)

PAGE 215

215 Table A 11. Continued YGR267C FOL2 GTP cyclohydrolase I YHL004W MRP4 Mitochondrial ribosomal protein of the small subunit YHR115C DMA1 Ubiquitin protein ligase (E3) YHR135C YCK1 Palmitoylated plasma membrane bo und casein kinase I YHR168W MTG2 Putative GTPase YHR216W IMD2 Inosine monophosphate dehydrogenase YIL016W SNL1 Ribosome associated protein YIL030C SSM4 Ubiquitin protein ligase involved in ER associated protein degradation YJL138C TIF2 Translation initiation factor eIF4A YJL154C VPS35 Endosomal subunit of membrane associated retromer complex YJR007W SUI2 Alpha subunit of the trans lation initiation factor eIF2 YKL019W RAM2 Alpha subunit of farnesyltransferase and geranylgeranyltransferase I YLL040C VPS13 Protein involved in prospore membrane morphogenesis YLR220W CCC1 Putative vacuolar Fe2+/Mn2+ transporter YLR224W F box protein and component of SCF ubiquitin ligase YLR284C ECI1 Peroxisomal delta3,delta2 enoyl CoA isomerase YLR432W IMD3 Inosine monophosphate dehydrogenase YML038C YMD8 Putative nucleotide sugar transporter YML080W DUS1 Dihydrouridine synthase YMR043W MCM1 Transcription factor YMR176W ECM5 Subunit of the Snt2C complex YMR308C PSE1 Karyopherin/importin that interacts with the nuclear pore complex YOL032W OPI10 Protein with a possible role in phospholipid biosynthesis YOL158C ENB1 Endosomal ferric enterobactin transporter YOR157C PUP1 Beta 2 subunit of the 20S proteasome YOR162C YRR1 Zn2 Cys6 zinc finger transcription factor YOR211C MGM1 Mitochondrial GTPase, present in complex with Ugo1p and Fzo1p YOR279C RFM1 Component of the Sum1p Rfm1p Hst1p complex YOR294W RRS1 Essential protein that binds ribosomal protein L11 YOR307C SLY41 Protein involved in ER to Golgi transport YPL024W RMI1 Subunit of the RecQ (Sgs1p) Topo III (Top3p)

PAGE 216

216 Table A 11. Continued YPL144W POC4 Component of a heterodimeric Poc4p Irc25p chaperone YPL226W NEW1 ATP binding cassette protein YPR085C ASA1 Subunit of the ASTRA complex, involved in chromatin remodeling YPR097W Protein that contains a PX domain and binds phosphoinositides

PAGE 217

217 Table A 12. Initiation at upstream GUG codons in tcs2 Systematic Name Standard Name Description YAL026C A Dubious open reading frame YAR075W Non functional protein with homology IMP dehydrogenase YBL029C A Protein of unknown function YBL039C A Dubious open reading frame YBL068W PRS4 5 phospho ribosyl 1(alpha) pyrophosphate synthetase, synthesizes PRPP YBL093C ROX3 Subunit of the RNA polymerase II mediator complex YBR054W YRO2 Protein of unknown function with similarity to archaeal rhodopsins YBR071W Protein of unknown function found in the cytoplasm and bud neck YBR102C EXO84 Exocyst subunit with dual roles in exocytosis and spliceosome assembly YBR168W PEX32 Peroxisomal integral membrane protein YBR206W Dubious open reading frame YBR211C AME1 Essential kinetochore protein associated with microtubules and SPBs YBR238C Mitochondrial membrane protein YCL024W KCC4 Protein kinase of the bud neck involved in the septin checkpoint YCL037C SRO9 Cytoplasmic RNA binding protein YCR019W MAK32 Protein necessary for stability of L A dsRNA containing particles YCR091W KIN82 Putative serine/threonine protein kinase YDL056W MBP1 Transcription factor YDL127W PCL2 Cyclin, interacts with cyclin dependent kinase Pho85p YDL197C ASF2 Anti silencing protein YDL223C HBT1 Shmoo tip protein, substrate of Hub1p ubiquitin like protein YDR016C DAD1 Essential subunit of the Dam1 complex (aka DASH complex) YDR047W HEM12 Uroporphyrinogen decarboxylase YDR075W PPH3 Catalytic subunit of protein phosphatase PP4 complex YDR078C SHU2 Component of the Shu complex, which promotes error free DNA repair YDR133C Dubious open reading frame YDR142C PEX7 Peroxisomal signal receptor for peroxisomal matrix proteins YDR154C Dubious open reading f rame YDR157W Dubious open reading frame YDR170C SEC7 Guanine nucleotide exchange factor (GEF) for ADP ribosylation factors YDR307W PMT7 Putative protein mannosyltransferase similar to Pmt1p

PAGE 218

218 Table A 12. Continued YDR362C TFC6 Subunit of RNA polymerase III transcription initiation factor complex YDR379W RGA2 GTPase activating protein for polarity establishment protein Cdc42p YDR399W HPT1 Dimeric hypoxanthine guanine phosphoribosyltransferase YDR407C TRS120 Component of transport protein particle (TRAPP) complex II YDR439W LRS4 Nucleolar protein that forms a complex with Csm1p YDR441C APT2 Potential adenine phosphoribosyltransferase YDR460W TFB3 Subunit of TFIIH and nucleotide excision repair factor 3 complexes YDR490C PKH1 Serine/threonine protein kinase YDR497C ITR1 Myo inositol transporter YDR516C EMI2 Non essential protein of unknown function YDR528W HLR1 Protein involved in regulation of cell wall composition and integrity YDR531W CAB1 Pantothenate kinase, ATP:D pantothenate 4' phosphotransferase YEL071W DLD3 D lactate dehydrogenase YER014W HEM14 Protoporphyrinogen oxidase YER019C A SBH2 Ssh1p Sss1p Sbh2p complex component YER062C GPP2 DL glycerol 3 phosphate phosphatase involved in glycerol biosynthesis YER119C AVT6 Vacuolar aspartate and glutamate exporter YER156C Putative protein of unknown function YFR055W IRC7 Beta lyase involved in the production of thiols YGL006W PMC1 Vacuolar Ca2+ ATPase involved in depleting cytosol of Ca2+ ions YGL073W HSF1 Trimeric heat shock transcription factor YGL157W ARI1 NADPH dependent aldehyde reductase YGL160W AIM14 NADPH oxidase localized to the perinuclear ER YGR017W Putative protein of unknown function YGR135W PRE9 Alpha 3 subunit of the 20S proteasome YGR137W Dubious open reading frame YGR157W CHO2 Phosphatidylethanolamine methyltransferase (PEMT) YGR231C PHB2 Subunit of the prohibitin complex (Phb1p Phb2p) YGR267C FOL2 GTP cyclohydrolase I YHL004W MRP4 Mitochondrial ribosomal protein of the small subunit YHR078W High osmolarity regulated gene of unknown function YHR115C DMA1 Ubiquitin protein ligase (E3) YHR135C YCK1 Palmitoylated plasma membrane bound casein kinase I (CK1) isoform YHR168W MTG2 Putative GTPase YHR210C Putative aldose 1 epimerase superfamily protein

PAGE 219

219 Table A 12. Continued YHR216W IMD2 Inosine monophosphate dehydrogenase YHR218W Helicase like protein encoded within the telomeric Y' element YIL016W SNL1 Ribosome associated protein YIL030C SSM4 Ubiquitin protein ligase involved in ER associated protein degradation YIL042C PKP1 Mitochondrial protein kinase YIL144W NDC80 Component of the kinetochore associated Ndc80 complex YIR021W MRS1 Splicing protein YJL081C ARP4 Nuclear actin related protein involved in chromatin remodeling YJL110C GZF3 GATA zinc finger protein YJL138C TIF2 Translation initiation factor eIF4A YJL142C IRC9 Dubious open reading frame YJL154C VPS35 Endosomal subunit of membrane associated retromer complex YJL183W MNN11 Subunit of a Golgi mannosyltransferase complex YJR007W SUI2 Alpha subunit of the translation initiation factor eIF2 YJR030C Putative protein of unknown function YKL015W PUT3 Transcriptional activator YKL019W RAM2 Alpha subunit of farnesyltransferase and geranylgeranyltransferase I YKL134C 1 Oct Mitochondrial intermediate peptidase YKL175W ZRT3 Vacuolar membrane zinc transporter YKR027W BCH2 Member of the ChAPs (Chs5p Arf1p binding proteins) family YKR058W GLG1 Glycogenin glucosyltransferase YLL040C VPS13 Protein involved in prospore membrane morphogenesis YLL062C MHT1 S methylmethionine homocysteine methyltransferase YLR164W SHH4 Mitochondrial inner membrane protein of unknown function YLR220W CCC1 Putative vacuolar Fe2+/Mn2+ transporter YLR224W F box protein and component of SCF ubiquitin ligase complexes YLR284C ECI1 Peroxisomal delta3,delta2 enoyl CoA isomerase YLR352W Putative protein of unknown function with similarity to F box proteins YLR382C NAM2 Mitochondrial leucyl tRNA synthetase YLR432W IMD3 Inosine monophosphate dehydrogenase YLR455W Nuclear protein of unknown function YML012W ERV25 Member of the p24 family involved in ER to Golgi transport YML020W Putative protein of unknown function YML032C RAD52 Protein that stimulates strand exchange YML038C YMD8 Putative nucleotide sugar transporter

PAGE 220

220 Table A 12. Continued YML080W DUS1 Dihydrouridine synthase YMR043W MCM1 Transcription factor YMR134W ERG29 Protein of unknown function involved in ergosterol biosynthesis YMR176W ECM5 Subunit of the Snt2C complex YMR234W RNH1 Ribonuclease H1 YMR281W GPI12 ER membrane protein involved in the second step of GPI anchor assembly YMR308C PSE1 Karyopherin/importin that interacts with the nuclear pore complex YNL031C HHT2 Histone H3 YNL139C THO2 Subunit of the THO complex YNL272C SEC2 Guanyl nucleotide exchange factor for the small G protein Sec4p YNL330C RPD3 Histone deacetylase, component of both the Rpd3S and Rpd3L complexes YOL032W OPI10 Protein with a possible role in phospholipid biosynthesis YOL098C Putative metalloprotease YOL139C CDC33 mRNA cap binding protein and translation initiation factor eIF4E YOL158C ENB1 Endosomal ferric enterobactin transporter YOR021C SFM1 SPOUT methyltransferase YOR062C Protein of unknown function YOR157C PUP1 Beta 2 subunit of the 20S proteasome YOR162C YRR1 Zn2 Cys6 zinc finger transcription factor YOR180C DCI1 Peroxisomal protein YOR208W PTP2 Phosphotyrosine specific protein phosphatase YOR211C MGM1 Mitochondrial GTPase, present in complex with Ugo1p and Fzo1p YOR231W MKK1 MAPKK involved in the protein kinase C signaling pathway YOR279C RFM1 Component of the Sum1p Rfm1p Hst1p complex YOR307C SLY41 Protein involved in ER to Golgi transport YPL066W RGL1 Regulator of Rho1p signaling, cofactor of Tus1p YPL085W SEC16 COPII vesicle coat protein required for ER transport vesicle budding YPL144W POC4 Component of a heterodimeric Poc4p Irc25p chaperone YPL150W Protein kinase of unknown cellular role YPL153C RAD53 DNA damage response protein kinase YPL212C PUS1 tRNA:pseudouridine synthase YPR085C ASA1 Subunit of the ASTRA complex, involved in chromatin remodeling YPR097W Protein that contains a PX domain and binds phosphoinositides

PAGE 221

221 LIST OF REFERENCES 1. Hinnebusch AG. The Scanning Mechanism of Eukaryotic Translation Initiation. Annu Rev Biochem 2014; :1 34. 2. Jackson RJ, Hellen CUT, Pestova T V. The mechanism of eukaryotic translation initiation and principles of its regulation. 2010; 10. 3. Dever TE , Green R. The elongation, termination, and recycling phases of translation in eukaryotes. Cold Spring Harb Perspect Biol 2012; 4:a013706. 4. Drummond DA, Wilke CO. The evolutionary consequences of erroneous protein synthesis. Nat Rev Genet 2009; 10:715 24. 5. Kurland CG, Ehrenberg M. Optimization of translation accuracy. Prog Nucleic Acid Res Mol Biol 1984; 31:191 219. 6. Grosjean H, Benne R, editors. Modification and Editing of RNA. Washington, DC: ASM Press; 1998. 7. Murthi A, Shaheen HH, Huang H , Preston MA, Lai T, Phizicky EM, Hopper AK. Regulation of tRNA bidirectional nuclear cytoplasmic trafficking in Saccharomyces cerevisiae . Mol Biol Cell 2010; 21:639 49. 8. Ohira T, Suzuki T. Retrograde nuclear import of tRNA precursors is required for modified base biogenesis in yeast. Proc Natl Acad Sci U S A 2011; 2011:1 6. 9. Szweykowska Kulinska Z, Senger B, Keith G, Fasiolo F, Grosjean H. Intron dependent formation of pseudouridines in the anticodon of Saccharomyces cerevisiae minor tRNA(Ile). EMBO J 1994; 13:4636 44. 10. Ling J, Reynolds N, Ibba M. Aminoacyl tRNA synthesis and translational quality control. Annu Rev Microbiol 2009; 63:61 78. 11. Crick FHC. Codon a nticodon pairing: The wobble hypothesis. J Mol Biol 1966; 19:548 55. 12. Grosjean H, Breton M, Sirand Pugnet P, Tardy F, Thiaucourt F, Citti C, Barré A, Yoshizawa S, Fourmy D, de Crécy Lagard V, et al. Predicting the Minimal Translation Apparatus: Lesson s from the Reductive Evolution of Mollicutes. PLoS Genet 2014; 10:e1004363. 13. Kono T, Tanemura S, Yourno J. Reversion of the frameshift hisD3018 of Salmonella typhimurium. J Bacteriol 1970; 102:655 60.

PAGE 222

222 14. Machnicka M a, Milanowska K, Osman Oglou O, Purta E, Kurkowska M, Olchowik A, Januszewski W, Kalinowski S, Dunin Horkawicz S, Rother KM, et al. MODOMICS: a database of RNA modification pathways -2013 update. Nucleic Acids Res 2013; 41:D262 7. 15. Björk G R. Biosynthesis and Function of Modified Nucleosides. In: Soll D, Rajbhandary UL, editors. tRNA: Structure, Biosynthesis, and Function. ASM Press, Wahsington, DC; 1995. page 165 205. 16. Yarian C, Townsend H, Czestkowski W, Sochacka E, Malkiewicz AJ, Guen ther R, Miskiewicz A, Agris PF. Accurate translation of the genetic code depends on tRNA modified nucleosides. J Biol Chem 2002; 277:16391 5. 17. Urbonavicius J, Qian Q, Durand JM, Hagervall TG, Björk GR. Improvement of reading frame maintenance is a com mon function for several tRNA modifications. EMBO J 2001; 20:4863 73. 18. Krüger MK, Pedersen S, Hagervall TG, Sørensen MA. The modification of the wobble base of tRNAGlu modulates the translation rate of glutamic acid codons in vivo. J Mol Biol 1998; 28 4:621 31. 19. Anderson J, Phan L, Cuesta R, Carlson BA, Pak M, Asano K, Björk GR, Tamame M, Hinnebusch AG. The essential Gcd10p Gcd14p nuclear complex is required for 1 methyladenosine modification and maturation of initiator methionyl tRNA. Genes Dev 19 98; 12:3650 62. 20. Dever TE, Yang W, Aström S, Byström AS, Hinnebusch AG. Modulation of tRNA(iMet), eIF 2, and eIF 2B expression shows that GCN4 translation is inversely coupled to the level of eIF 2.GTP.Met tRNA(iMet) ternary complexes. Mol Cell Biol 1 995; 15:6351 63. 21. Hampsey M, Na JG, Pinto I, Ware DE, Berroteran RW. Extragenic suppressors of a translation initiation defect in the cyc1 gene of Saccharomyces cerevisiae . Biochimie 1991; 73:1445 55. 22. Kozak M. Pushing the limits of the scanning mechanism for initiation of translation. Gene 2002; 299:1 34. 23. Kozak M. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 1986; 44:283 92. 24. Agris PF, Vendeix F a P, Graham 40 years of modification. J Mol Biol 2007; 366:1 13.

PAGE 223

223 25. Jühling F, Mörl M, Hartmann RK, Sprinzl M, Stadler PF, Pütz J. tRNAdb 2009: compilation of tRNA sequences and tRNA genes. Nucleic Acids Res 2009; 37:D159 6 2. 26. Grosjean H. Nucleic Acids Are Not Boring Long Polymers of Only Four Types of Enzymes: Strucutre, Mechanism, Function and Evolution. Austin: Landes Bioscience; 2009. page 1 18. 27. Chan CTY, Pang YLJ, Deng W, Babu IR, Dyavaiah M, Begley TJ, Dedon PC. Reprogramming of tRNA modifications controls the oxidative stress response by codon biased translation of proteins. Nat Commun 2012; 3:937. 28. Grosjean H, Sprinzl M, Stein berg S. Posttranscriptionally modified nucleosides in transfer RNA: their locations and frequencies. Biochimie 1995; 77:139 41. 29. Björk GR, Huang B, Persson OP, Byström AS. A conserved modified wobble nucleoside (mcm5s2U) in lysyl tRNA is required for viability in yeast. RNA 2007; 13:1245 55. 30. Huang B, Johansson MJO, Byström AS. An early step in wobble uridine tRNA modification requires the Elongator complex. RNA 2005; 11:424 36. 31. Johansson MJO, Esberg A, Huang B, Björk GR, Byström AS. Eukaryo tic wobble uridine modifications promote a functionally redundant decoding system. Mol Cell Biol 2008; 28:3301 12. 32. Zinshteyn B, Gilbert W V. Loss of a Conserved tRNA Anticodon Modification Perturbs Cellular Signaling. PLoS Genet 2013; 9:e1003675. 33 . Björk GR, Jacobsson K, Nilsson K, Johansson MJ, Byström AS, Persson OP. A primordial tRNA modification required for the evolution of life? EMBO J 2001; 20:231 9. 34. Urbonavicius J, Stahl G, Durand JMB, Ben Salem SN, Qian Q, Farabaugh PJ, Björk GR. Tr ansfer RNA modifications that alter +1 frameshifting in general fail to affect 1 frameshifting. RNA 2003; 9:760 8. 35. Noma A, Kirino Y, Ikeuchi Y, Suzuki T. Biosynthesis of wybutosine, a hyper modified nucleoside in eukaryotic phenylalanine tRNA. EMBO J 2006; 25:2142 54. 36. Gerber a. P. An Adenosine Deaminase that Generates Inosine at the Wobble Position of tRNAs. Science (80 ) 1999; 286:1146 9.

PAGE 224

224 37. Lamichhane TN, Blewett NH, Crawford AK, Cherkasova V a, Iben JR, Begley TJ, Farabaugh PJ, Maraia RJ . Lack of tRNA Modification Isopentenyl A37 Alters mRNA Decoding and Causes Metabolic Deficiencies in Fission Yeast. Mol Cell Biol 2013; 33:2918 29. 38. Morin A, Auxilien S, Senger B, Tewari R, Grosjean H. Structural requirements for enzymatic formation of threonylcarbamoyladenosine (t 6 A) in tRNA: an in vivo study with Xenopus laevis oocytes. RNA 1998; 4:24 37. 39. Grosjean H, De Henau S, Doi T, Yamane A, Ohtsuka E, Ikehara M, Beauchemin N, Nicoghosian K, Cedergren R. The in vivo stability, maturation a nd aminoacylation of anticodon substituted Escherichia coli initiator methionine tRNAs. Eur J Biochem 1987; 166:325 32. 40. Elkins BN, Keller EB. The enzymatic synthesis of N (purin 6 ylcarbamoyl)threonine, an anticodon adjacent base in transfer ribonucl eic acid. Biochemistry 1974; 13:4622 8. 41. Sibler AP, Dirheimer G, Martin RP. Yeast mitochondrial tRNAIle and tRNAMetm: nucleotide sequence and codon recognition patterns. Nucleic Acids Res 1985; 13:1341 5. 42. Körner a, Söll D. N (purin 6 ylcarbamoyl)threonine: biosynthesis in vitro in transfer RNA by an enzyme purified from Escherichia coli . FEBS Lett 1974; 39:301 6. 43. Schweizer MP, Chheda GB, Baczynskyj L, Hall RH. Aminoacyl nucleosides. VII. N (Purin 6 yl carbamoyl)threonine. A new component of transfer ribonucleic acid. Biochemistry 1969; 8:3283 9. 44. Ishikura H, Yamada Y, Murao K, Saneyoshi M, Nishimura S. The presence of N [9 (beta D ribofuranosyl)purin 6 ylcarbamoyl]threonine in serine, methionine an d 37:990 5. 45. Chheda GB, Hong CI, Piskorz CF, Harmon GA. Biosynthesis of N (purin 6 ylcarbamoyl) L threonine riboside. Incorporation of L threonine in vivo into modified nucl eoside of transfer ribonucleic acid. Biochem J 1972; 127:515 9. 46. Powers DM, Peterkofsky A. Biosynthesis and specific labeling of N (purin 6 ylcarbamoyl)threonine of Escherichia coli transfer RNA. Biochem Biophys Res Commun 1972; 46:831 8. 47. Powers DM, Peterkofsky A. The presence of N (purin 6 ylcarbamoyl)threonine in transfer ribonucleic acid species whose codons begin with adenine. J Biol Chem 1972; 247:6394 401.

PAGE 225

225 48. Murphy F V, Ramakrishnan V, Malkiewicz A, Agris PF. The role of modifications i n codon discrimination by tRNA(Lys)UUU. Nat Struct Mol Biol 2004; 11:1186 91. 49. Weissenbach J, Grosjean H. Effect of threonylcarbamoyl modification (t 6 A) in yeast tRNA Arg III on codon anticodon and anticodon anticodon interactions. A thermodynamic and kinetic evaluation. Eur J Biochem 1981; 116:207 13. 50. Stuart JW, Gdaniec Z, Guenther R, Marszalek M, Sochacka E, Malkiewicz A, Agris PF. Functional anticodon architecture of human tRNALys3 includes disruption of intraloop hydrogen bonding by the natur ally occurring amino acid modification, t 6 A. Biochemistry 2000; 39:13396 404. 51. Durant PC, Bajji AC, Sundaram M, Kumar RK, Davis DR. Structural effects of hypermodified nucleosides in the Escherichia coli and human tRNALys anticodon loop: the effect of nucleosides s2U, mcm5U, mcm 5 s 2 U, mnm 5 s 2 U, t 6 A, and ms 2 t 6 A. Biochemistry 2005; 44:8078 89. 52. Lescrinier E, Nauwelaerts K, Zanier K, Poesen K, Sattler M, Herdewijn P. The naturally occurring N6 threonyl adenine in anticodon loop of Schizosaccharomyces p ombe tRNAi causes formation of a unique U turn motif. Nucleic Acids Res 2006; 34:2878 86. 53. Miyauchi K, Kimura S, Suzuki T. A cyclic form of N6 threonylcarbamoyladenosine as a widely distributed tRNA hypermodification. Nat Chem Biol 2013; 9:105 11. 54 . Zahedi RP, Sickmann A, Boehm AM, Winkler C, Zufall N, Schönfisch B, Guiard B, Pfanner N, Meisinger C. Proteomic analysis of the yeast mitochondrial outer membrane reveals accumulation of a subclass of preproteins. Mol Biol Cell 2006; 17:1436 50. 55. Q ian Q, Curran JF, Björk GR. The methyl group of the N6 methyl N6 threonylcarbamoyladenosine in tRNA of Escherichia coli modestly improves the efficiency of the tRNA. J Bacteriol 1998; 180:1808 13. 56. Kimura S, Miyauchi K, Ikeuchi Y, Thiaville PC, de Cré cy Lagard V, Suzuki T. Discovery of the beta barrel type RNA methyltransferase. Nucleic Acids Res 2014; 57. Anton BP, Russell SP, Vertrees J, Kasif S, Raleigh E a, Limbach P a, Roberts RJ. Functional characterization of the YmcB and YqeV tRNA methylthiot ransferases of Bacillus subtilis. Nucleic Acids Res 2010; 38:6195 205. 58. Arragain S, Handelman SK, Forouhar F, Wei F Y, Tomizawa K, Hunt JF, Douki T, Fontecave M, Mulliez E, Atta M. Identification of eukaryotic and prokaryotic methylthiotransferase for biosynthesis of 2 methylthio N6 threonylcarbamoyladenosine in tRNA. J Biol Chem 2010; 285:28425 33.

PAGE 226

226 59. Wei F, Suzuki T, Watanabe S, Kimura S, Kaitsuka T, Fujimura A, Matsui H, Atta M, Michiue H, Fontecave M, et al. Deficit of tRNA(Lys) modification by Cdkal1 causes the development of type 2 diabetes in mice. J Clin Invest 2011; 121:3598 608. 60. Wei F Y, Tomizawa K. Functional loss of Cdkal1, a novel tRNA modification enzyme, causes the development of type 2 diabetes. Endocr J 2011; 58:819 25. 61. E l Yacoubi B, Lyons B, Cruz Y, Reddy R, Nordin B, Agnelli F, Williamson JR, Schimmel P, Swairjo M a, de Crécy Lagard V. The universal YrdC/Sua5 family is required for the formation of threonylcarbamoyladenosine in tRNA. Nucleic Acids Res 2009; 37:2894 909. 62. Rosano C, Zuccotti S, Stefani M, Bucciantini M, Ramponi G, Bolognesi M. Crystallization and preliminary X ray characterization of the acylphosphatase like domain from the Escherichia coli hydrogenase maturation factor HypF. Acta Crystallogr D Biol Cr ystallogr 2002; 58:524 5. 63. Teplova M, Tereshko V, Sanishvili R, Joachimiak A, Bushueva T, Anderson WF, Egli M. The structure of the yrdC gene product from Escherichia coli reveals a new fold and suggests a role in RNA binding. Protein Sci 2000; 9:2557 66. 64. El Yacoubi B, Hatin I, Deutsch C, Kahveci T, Rousset J P, Iwata Reuyl D, Murzin AG, de Crécy Lagard V. A role for the universal Kae1/Qri7/YgjD (COG0533) family in tRNA modification. EMBO J 2011; 30:882 93. 65. Downey M, Houlsworth R, Maringele L, Rollie A, Brehme M, Galicia S, Guillard S, Partington M, Zubko MK, Krogan NJ, et al. A genome wide screen identifies the evolutionarily conserved KEOPS complex as a telomere regulator. Cell 2006; 124:1155 68. 66. Kiss eleva Romanova E, Lopreiato R, Baudin Baillieu A, Rousselle J C, Ilan L, Hofmann K, Namane A, Mann C, Libri D. Yeast homolog of a cancer testis antigen defines a new transcription complex. EMBO J 2006; 25:3576 85. 67. Oberto J, Breuil N, Hecker A, Farina F, Brochier Armanet C, Culetto E, Forterre P. Qri7/OSGEPL, the mitochondrial version of the universal Kae1/YgjD protein, is essential for mitochondrial genome maintenance. Nucleic Acids Res 2009; 37:5343 52. 68. Handford JI, Ize B, Buchanan G, Butland G P, Greenblatt J, Emili A, Palmer T. Conserved network of proteins essential for bacterial viability. J Bacteriol 2009; 191:4732 49.

PAGE 227

227 69. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko K a, Tomita M, Wanner BL, Mori H. Construction of Escherichia coli K 12 in frame, single gene knockout mutants: the Keio collection. Mol Syst Biol 2006; 2:2006.0008. 70. Rajagopala S V, Yamamoto N, Zweifel AE, Nakamichi T, Huang H K, Mendez Rios JD, Franca Koh J, Boorgula MP, Fujita K, Suzuki K, et al. The Escherichia coli K 12 ORFeome: a resource for comparative molecular microbiology. BMC Genomics 2010; 11:470. 71. Deutsch C, El Yacoubi B, de Crécy Lagard V, Iwata Reuyl D. Biosynthesis of threonylcarbamoyl adenosine (t 6 A), a universal tRNA nucleoside . J Biol Chem 2012; 287:13666 73. 72. Lauhon CT. Mechanism of N6 threonylcarbamoyladenonsine (t(6)A) biosynthesis: isolation and characterization of the intermediate threonylcarbamoyl AMP. Biochemistry 2012; 51:8950 63. 73. Melnikov S, Ben Shem A, Garr eau de Loubresse N, Jenner L, Yusupova G, Yusupov M. One core, two shells: bacterial and eukaryotic ribosomes. Nat Struct Mol Biol 2012; 19:560 7. 74. Gietz RD, Schiestl RH. Frozen competent yeast cells that can be transformed with high efficiency using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2007; 2:1 4. 75. Westermann B, Neupert W. Mitochondria targeted green fluorescent proteins: convenient tools for the study of organelle biogenesis in Saccharomyces cerevisiae . Yeast 2000; 16:1421 7. 76. Le tunic I, Bork P. Interactive Tree Of Life (iTOL): an online tool for phylogenetic tree display and annotation. Bioinformatics 2007; 23:127 8. 77. Letunic I, Bork P. Interactive Tree Of Life v2: online annotation and display of phylogenetic trees made eas y. Nucleic Acids Res 2011; 39:W475 8. 78. Overbeek R, Begley T, Butler RM, Choudhuri J V, Chuang H Y, Cohoon M, de Crécy Lagard V, Diaz N, Disz T, Edwards R, et al. The subsystems approach to genome annotation and its use in the project to annotate 1000 genomes. Nucleic Acids Res 2005; 33:5691 702. 79. Blaby IK, Phillips G, Blaby Haas CE, Gulig KS, El Yacoubi B, de Crécy Lagard V. Towards a systems approach in the genetic analysis of archaea: Accelerating mutant construction and phenotypic analysis in H aloferax volcanii . Archaea 2010; 2010:426239.

PAGE 228

228 80. Pomerantz SC, McCloskey JA. Analysis of RNA hydrolyzates by liquid chromatography mass spectrometry. Methods Enzymol 1990; 193:796 824. 81. Balakrishnan R, Park J, Karra K, Hitz BC, Binkley G, Hong EL, Sullivan J, Micklem G, Cherry JM. YeastMine -an integrated data warehouse for Saccharomyces cerevisiae data as a multipurpose tool kit. Database J Biol Databases C uration 2012; 2012:bar062. 82. Conesa A, Götz S, García Gómez JM, Terol J, Talón M, Roble s M. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005; 21:3674 6. 83. Hartman AL, Norais C, Badger JH, Delmas S, Haldenby S, Madupu R, Robinson J, Khouri H, Ren Q, Lowe TM, et al. The complete genome sequence of Haloferax volcanii DS2, a model archaeon. PLoS One 2010; 5:e9605. 84. Naor A, Thiaville PC, Altman Price N, Cohen Or I, Allers T, de Crécy Lagard V, Gophna U. A Genetic Investigation of the KEOPS Complex in Halophilic Arch aea. PLoS One 2012; 7:e43013. 85. Bitoun JP, Liao S, Xie GG, Beatty WL, Wen ZT. Deficiency of BrpB causes major defects in cell division, stress responses and biofilm formation by Streptococcus mutans . Microbiology 2014; 160:67 78. 86. Onodera T, Satoh K, Ohta T, Narumi I. Deinococcus radiodurans YgjD and YeaZ are involved in the repair of DNA cross links. Extremophiles 2013; 17:171 9. 87. Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae . Genetics 1989; 122:19 27. 88. Meineke B, Schwer B, Schaffrath R, Shuman S. Determinants of eukaryal cell killing by the bacterial ribotoxin PrrC. Nucleic Acids Res 2011; 39:687 700. 89. Chernyakov I, Baker MA, Grayhack EJ, Phizicky EM. Identification and Analysis of tRNAs That Are Degraded in Saccharomyces cerevisiae Due To Lack of Modifications. 1st ed. Elsevier Inc.; 2008. 90. Esberg A, Huang B, Johansson MJO, Byström AS. Elevated lev els of two tRNA species bypass the requirement for elongator complex in transcription and exocytosis. Mol Cell 2006; 24:139 48. 91. Vieira J, Messing J. The pUC plasmids, an M13mp7 derived system for insertion mutagenesis and sequencing with synthetic un iversal primers. Gene 1982; 19:259 68.

PAGE 229

229 92. Daugeron M C, Lenstra TL, Frizzarin M, El Yacoubi B, Liu X, Baudin Baillieu A, Lijnzaad P, Decourty L, Saveanu C, Jacquier A, et al. Gcn4 misregulation reveals a direct role for the evolutionary conserved EKC/KE OPS in the t 6 A modification of tRNAs. Nucleic Acids Res 2011; 39:6148 60. 93. Sibler AP, Dirheimer G, Martin RP. Codon reading patterns in Saccharomyces cerevisiae mitochondria based on sequences of mitochondrial tRNAs. FEBS Lett 1986; 194:131 8. 94. H uh W EK. Global analysis of protein localization in budding yeast. Nature 2003; 425:686 91. 95. Haussuehl K, Huesgen PF, Meier M, Dessi P, Glaser E, Adamski J, Adamska I. Eukaryotic GCP1 is a conserved mitochondrial protein required for progression of embryo development beyond the globular stage in Arabidopsis thaliana . Biochem J 2009; 423:333 41. 96. Ghaemmaghami S, Huh W K, Bower K, Howson RW, Belle A, Dephoure N, 2003; 425:737 41. 97. Bannai H, Tamada Y, Maruyama O, Nakai K, Miyano S. Extensive feature detection of N ter minal protein sorting signals. Bioinformatics 2002; 18:298 305. 98. Gerdes S, El Yacoubi B, Bailly M, Blaby IK, Blaby Haas CE, Jeanguenin L, Lara Núñez A, Pribat A, Waller JC, Wilke A, et al. Synergistic use of plant prokaryote comparative genomics for f unctional annotations. BMC Genomics 2011; 12 Suppl 1:S2. 99. Lim L, McFadden GI. The evolution, metabolism and functions of the apicoplast. Philos Trans R Soc Lond B Biol Sci 2010; 365:749 63. 100. Srinivasan M, Mehta P, Yu Y, Prugar E, Koonin E V, Kar zai AW, Sternglanz R. The highly conserved KEOPS/EKC complex is essential for a universal tRNA modification, t6A. EMBO J 2011; 30:873 81. 101. Collinet B, Friberg A, Brooks M a, van den Elzen T, Henriot V, Dziembowski A, Graille M, Durand D, Leulliot N, Saint André C, et al. Strategies for the structural analysis of multi protein complexes: lessons from the 3D Repertoire project. J Struct Biol 2011; 175:147 58. 102. Perrochia L, Crozat E, Hecker A, Zhang W, Bareille J, Collinet B, van Tilbeurgh H, Forte rre P, Basta T. In vitro biosynthesis of a universal t6A tRNA modification in Archaea and Eukarya. Nucleic Acids Res 2013; 41:1953 64.

PAGE 230

230 103. Wan LCK, Mao DYL, Neculai D, Strecker J, Chiovitti D, Kurinov I, Poda G, Thevakumaran N, Yuan F, Szilard RK, et al . Reconstitution and characterization of eukaryotic N6 threonylcarbamoylation of tRNA using a minimal enzyme system. Nucleic Acids Res 2013; 41:6332 46. 104. Gillman EC, Slusher LB, Martin NC, Hopper AK. MOD5 translation initiation sites determine N6 iso pentenyladenosine modification of mitochondrial and cytoplasmic tRNA. Mol Cell Biol 1991; 11:2382 90. 105. Behm Ansmant I, Grosjean H, Massenet S, Motorin Y, Branlant C. Pseudouridylation at position 32 of mitochondrial and cytoplasmic tRNAs requires two distinct enzymes in Saccharomyces cerevisiae. J Biol Chem 2004; 279:52998 3006. 106. Lee C, Kramer G, Graham DE, Appling DR. Yeast mitochondrial initiator tRNA is methylated at guanosine 37 by the Trm5 encoded tRNA (guanine N1 ) methyltransferase. J Bio l Chem 2007; 282:27744 53. 107. Romanos M a, Scorer C a, Clare JJ. Foreign gene expression in yeast: a review. Yeast 1992; 8:423 88. 108. Arigoni F, Talabot F, Peitsch M, Edgerton MD, Meldrum E, Allet E, Fish R, Jamotte T, Curchod ML, Loferer H. A geno me based approach for the identification of essential bacterial genes. Nat Biotechnol 1998; 16:851 6. 109. Freiberg C, Wieland B, Spaltmann F, Ehlert K, Brötz H, Labischinski H. Identification of novel essential Escherichia coli genes conserved among pat hogenic bacteria. J Mol Microbiol Biotechnol 2001; 3:483 9. 110. Allali Hassani A, Campbell TL, Ho A, Schertzer JW, Brown ED. Probing the active site of YjeE: a vital Escherichia coli protein of unknown function. Biochem J 2004; 384:577 84. 111. Lerner CG, Hajduk PJ, Wagner R, Wagenaar FL, Woodall C, Gu Y G, Searle XB, Florjancic AS, Zhang T, Clark RF, et al. From bacterial genomes to novel antibacterial agents: discovery, characterization, and antibacterial activity of compounds that bind to HI0065 (Yj eE) from Haemophilus influenzae . Chem Biol Drug Des 2007; 69:395 404. 112. Bose N, Ogawa A, von Reuss SH, Yim JJ, Ragsdale EJ, Sommer RJ, Schroeder FC. Complex small molecule architectures regulate phenotypic plasticity in a nematode. Angew Chemie 2012; 51:12438 43. 113. Giegé R, Lapointe J. Transfer RNA Aminoacylation and Modified Nucleosides. In: Grosjean H, editor. DNA and RNA Modification Enzymes: Strucutre, Mechanism, Function and Evolution. 2009. page 478 92.

PAGE 231

231 114. Woese CR, Olsen GJ, Ibba M, Söll D. Aminoacyl tRNA synthetases, the genetic code, and the evolutionary process. Microbiol Mol Biol Rev 2000; 64:202 36. 115. Soma A, Ikeuchi Y, Kanemasa S, Kobayashi K, Ogasawara N, Ote T, Kato J, Watanabe K, Sekine Y, Suzuki T. An RNA modifying enzyme t hat governs both the codon and amino acid specificities of isoleucine tRNA. Mol Cell 2003; 12:689 98. 116. Ikeuchi Y, Kimura S, Numata T, Nakamura D, Yokogawa T, Ogata T, Wada T, Suzuki T, Suzuki T. Agmatine conjugated cytidine in a tRNA anticodon is ess ential for AUA decoding in archaea. Nat Chem Biol 2010; 6:277 82. 117. Mandal D, Köhrer C, Su D, Russell SP, Krivos K, Castleberry CM, Blum P, Limbach P a, Söll D, RajBhandary UL. Agmatidine, a modified cytidine in the anticodon of archaeal tRNA(Ile), ba se pairs with adenosine but not with guanosine. Proc Natl Acad Sci U S A 2010; 107:2872 7. 118. Sarmiento F, Mrázek J, Whitman WB. Genome scale analysis of gene function in the hydrogenotrophic methanogenic archaeon Methanococcus maripaludis . Proc Natl A cad Sci U S A 2013; 110:4726 31. 119. Hunt A, Rawlins JP, Thomaides HB, Errington J. Functional analysis of 11 putative essential genes in Bacillus subtilis. Microbiology 2006; 152:2895 907. 120. Chao MC, Pritchard JR, Zhang YJ, Rubin EJ, Livny J, Davis BM, Waldor MK. High resolution definition of the Vibrio cholerae essential gene set with hidden Markov model based analyses of transposon insertion sequencing data. Nucleic Acids Res 2013; 41:9033 4 8. 121. Kamp HD, Patimalla Dipali B, Lazinski DW, Wallace Gadsden F, Camilli A. Gene fitness landscapes of Vibrio cholerae at important stages of its life cycle. PLoS Pathog 2013; 9:e1003800. 122. Onodera T, Satoh K, Ohta T, Narumi I. Deinococcus radio durans YgjD and YeaZ are involved in the repair of DNA cross links. Extremophiles 2013; 17:171 9. 123. Zuther E, Schubert H, Hagemann M. Mutation of a gene encoding a putative glycoprotease leads to reduced salt tolerance, altered pigmentation, and cyano phycin accumulation in the cyanobacterium Synechocystis sp. strain PCC 6803. J Bacteriol 1998; 180:1715 22. 124. Bitoun JP, Liao S, Xie GG, Beatty WL, Wen ZT. Deficiency of BrpB causes major defects in cell division, stress responses and biofilm formation by Streptococcus mutans . Microbiology 2014; 160:67 78.

PAGE 232

232 125. Woese CR, Olsen GJ, Ibba M, Söll D. Aminoacyl tRNA synthetases, the genetic code, and the evolutionary process. Microbiol Mol Biol Rev 2000; 64:202 36. 126. Fabret C, Dervyn E, Dalmais B, Guillot A, Marck C, Grosjean H, Noirot P. Life without the essential bacterial tRNA Ile2 lysidine synthetase TilS: a case of tRNA gene recruitment in Bacillus subtilis . Mol Microbiol 2011; 80:1062 74. 127. Kitagawa M, Ara T, Arifuzzaman M, Ioka Nakamichi T, Inamoto E, Toyonaga H, Mori H. Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K 12 ORF archive): unique resources for biological research. DNA Res 2005; 12:291 9. 128. Christen B, Abeliuk E, Collier JM, Kalogeraki VS, Passarelli B, Coller JA, Fero MJ, McAdams HH, Shapiro L. The essential genome of a bacterium. Mol Syst Biol 2 011; 7:528. 129. Glass JI, Assad Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M, Hutchison C a, Smith HO, Venter JC. Essential genes of a minimal bacterium. Proc Natl Acad Sci U S A 2006; 103:425 30. 130. French CT, Lao P, Loraine AE, Matthews BT , Yu H, Dybvig K. Large scale transposon mutagenesis of Mycoplasma pulmonis . Mol Microbiol 2008; 69:67 76. 131. Dybvig K, Lao P, Jordan DS, Simmons WL. Fewer essential genes in mycoplasmas than previous studies suggest. FEMS Microbiol Lett 2010; 311:51 5 . 132. Kobayashi K, Ehrlich SD, Albertini a, Amati G, Andersen KK, Arnaud M, Asai K, Ashikaga S, Aymerich S, Bessieres P, et al. Essential Bacillus subtilis genes. Proc Natl Acad Sci U S A 2003; 100:4678 83. 133. Akerley BJ, Rubin EJ, Novick VL, Amaya K, Judson N, Mekalanos JJ. A genome scale analysis for identification of genes required for growth or survival of Haemophilus influenzae . Proc Natl Acad Sci U S A 2002; 99:966 71. 134. De Berardinis V, Vallenet D, Castelli V, Besnard M, Pinet A, Cruaud C , Samair S, Lechaplais C, Gyapay G, Richez C, et al. A complete collection of single gene deletion mutants of Acinetobacter baylyi ADP1. Mol Syst Biol 2008; 4:174. 135. Langridge GC, Phan M D, Turner DJ, Perkins TT, Parts L, Haase J, Charles I, Maskell D J, Peters SE, Dougan G, et al. Simultaneous assay of every Salmonella Typhi gene using one million transposon mutants. Genome Res 2009; 19:2308 16.

PAGE 233

233 136. Gallagher L a, Ramage E, Jacobs M a, Kaul R, Brittnacher M, Manoil C. A comprehensive transposon muta nt library of Francisella novicida, a bioweapon surrogate. Proc Natl Acad Sci U S A 2007; 104:1009 14. 137. Jacobs M a, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, Will O, Kaul R, Raymond C, Levy R, et al. Comprehensive transposon mutant li brary of Pseudomonas aeruginosa . Proc Natl Acad Sci U S A 2003; 100:14339 44. 138. Gallagher L a, Ramage E, Patrapuvich R, Weiss E, Brittnacher M, Manoil C. Sequence defined transposon mutant library of Burkholderia thailandensis . MBio 2013; 4:e00604 13. 139. Chaudhuri RR, Allen AG, Owen PJ, Shalom G, Stone K, Harrison M, Burgis T a, Lockyer M, Garcia Lara J, Foster SJ, et al. Comprehensive identification of essential Staphylococcus aureus genes using Transposon Mediated Differential Hybridisation (TMDH ). BMC Genomics 2009; 10:291. 140. Winzeler E a., Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, Bangham R, Benito R, Boeke JD, Bussey H, et al. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Sci ence 1999; 285:901 6. 141. Spirek M, Benko Z, Carnecka M, Rumpf C, Cipak L, Batova M, Marova I, Nam M, Kim D U, Park H O, et al. S. pombe genome deletion project: an update. Cell Cycle 2010; 9:2399 402. 142. Kim D U, Hayles J, Kim D, Wood V, Park H O, Won M, Yoo H S, Duhig T, Nam M, Palmer G, et al. Analysis of a genome wide set of gene deletions in the fission yeast Schizosaccharomyces pombe . Nat Biotechnol 2010; 28:617 23. 143. targets for experimental study. Nucleic Acids Res 2004; 32:5452 63. 144. Na JG, Pinto I, Hampsey M. Isolation and characterization of SUA5, a novel gene required for normal gro wth in Saccharomyces cerevisiae . Genetics 1992; 131:791 801. 145. Abdullah KM, Lo RY, Mellors A. Cloning, nucleotide sequence, and expression of the Pasteurella haemolytica A1 glycoprotease gene. J Bacteriol 1991; 173:5597 603. 146. Abdullah KM, Udoh E a, Shewen PE, Mellors a. A neutral glycoprotease of Pasteurella haemolytica A1 specifically cleaves O sialoglycoproteins. Infect Immun 1992; 60:56 62.

PAGE 234

234 147. Hecker A, Leulliot N, Gadelle D, Graille M, Justome A, Dorlet P, Brochier C, Quevillon Cheruel S, Le Cam E, van Tilbeurgh H, et al. An archaeal orthologue of the universal protein Kae1 is an iron metalloprotein which exhibits atypical DNA binding properties and apurinic endonuclease activity in vitro. Nucleic Acids Res 2007; 35:6042 51. 148. Lin C a , Ellis SR, True HL. The Sua5 protein is essential for normal translational regulation in yeast. Mol Cell Biol 2010; 30:354 63. 149. Natarajan K, Meyer MR, Jackson BM, Slade D, Roberts C, Hinnebusch AG, Marton MJ. Transcriptional profiling shows that Gcn 4p is a master regulator of gene expression during amino acid starvation in yeast. Mol Cell Biol 2001; 21:4347 68. 150. Foiani M, Cigan AM, Paddon CJ, Harashima S, Hinnebusch AG. GCD2, a translational repressor of the GCN4 gene, has a general function in the initiation of protein synthesis in Saccharomyces cerevisiae . Mol Cell Biol 1991; 11:3203 16. 151. Hinnebusch AG. Translational regulation of GCN4 and the general amino acid control of yeast. Annu Rev Microbiol 2005; 59:407 50. 152. Jäger G, Nilsson K, Björk GR. The phenotype of many independently isolated +1 frameshift suppressor mutants supports a pivotal role of the P site in reading frame maintenance. PLoS One 2013; 8:e60246. 153. Chen C, Huang B, Eliasson M, Rydén P, Byström AS . Elongator Complex Influences Telomeric Gene Silencing and DNA Damage Response by Its Role in Wobble Uridine tRNA Modification. PLoS Genet 2011; 7:e1002258. 154. Bauer F, Hermand D. A coordinated codon dependent regulation of translation by Elongator. C ell Cycle 2012; 11:4524 9. 155. Kristoffersen P, Jensen GB, Gerdes K, Piskur J. Bacterial toxin antitoxin gene system as containment control in yeast cells. Appl Environ Microbiol 2000; 66:5524 6. 156. Martin M. Cutadapt removes adapter sequences from high throughput sequencing reads. EMBnet.journal 2011; 17. 157. Langmead B, Salzberg SL. Fast gapped read alignment with Bowtie 2. Nat Methods 2012; 9:357 9. 158. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol 2010; 11:R106.

PAGE 235

235 159. Anders S. Analysing RNA Seq data with the DESeq package. 2012; :1 28. 160. Benjamini Y, Hochberg Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J R Stat Soc Ser B 1995; 57:289 300. 1 61. Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 2010; 466:835 40. 162. Wolin SL, Walter P. Ribosome pausing and stacking during translation of a eukaryotic mRNA. EMBO J 1988; 7: 3559 69. 163. Ingolia NT, Ghaemmaghami S, Newman JRS, Weissman JS. Genome wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 2009; 324:218 23. 164. Zhang F, Hinnebusch AG. An upstream ORF with non AUG star t codon is translated in vivo but dispensable for translational control of GCN4 mRNA. Nucleic Acids Res 2011; :1 13. 165. Kuersten S, Radek A, Vogel C, Penalva LOF. Translation regulation gets its 166. Du nn JG, Foo CK, Belletier NG, Gavis ER, Weissman JS. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster. Elife 2013; 2:e01179. 167. Pearson CE. Repeat associated non ATG translation initiation: one DNA, tw o transcripts, seven reading frames, potentially nine toxic entities! PLoS Genet 2011; 7:e1002018. 168. Chen S J, Lin G, Chang K J, Yeh L S, Wang C C. Translational efficiency of a non AUG initiation codon is significantly affected by its sequence contex t in yeast. J Biol Chem 2008; 283:3173 80. 169. Clements JM, Laz TM, Sherman F. Efficiency of translation initiation by non AUG codons in Saccharomyces cerevisiae . Mol Cell Biol 1988; 8:4533 6. 170. Chang C P, Chen S J, Lin C H, Wang T L, Wang C C. A s ingle sequence context cannot satisfy all non AUG initiator codons in yeast. BMC Microbiol 2010; 10:188. 171. Chang K J, Wang C C. Translation initiation from a naturally occurring non AUG codon in Saccharomyces cerevisiae . J Biol Chem 2004; 279:13778 85 . 172. Tang H L, Yeh L S, Chen N K, Ripmaster T, Schimmel P, Wang C C. Translation of a yeast mitochondrial tRNA synthetase initiated at redundant non AUG codons. J Biol Chem 2004; 279:49656 63.

PAGE 236

236 173. Harbison CT, Gordon DB, Lee TI, Rinaldi NJ, Macisaac KD, Danford TW, Hannett NM, Tagne J, Reynolds DB, Yoo J, et al. Transcriptional regulatory code of a eukaryotic genome. Nature 2004; 431:99 104. 174. Manickam N, Nag N, Abbasi A, Patel K, Farabaugh PJ. Studies of translational misreading in vivo show th at the ribosome very efficiently discriminates against most potential errors. RNA 2014; 20:9 15. 175. Farabaugh PJ, Björk GR. How translational accuracy influences reading frame maintenance. EMBO J 1999; 18:1427 34. 176. Kawakami K, Pande S, Faiola B, Moore DP, Boeke JD, Farabaugh PJ, Strathern JN, Nakamura Y, Garfinkel DJ. A rare tRNA Arg(CCU) that regulates Ty1 element ribosomal frameshifting is essential for Ty1 retrotransposition in Saccharomyces cerevisiae. Genetics 1993; 135:309 20. 177. Kramer EB, Farabaugh PJ. The frequency of translational misreading errors in E . coli is largely determined by tRNA competition. RNA 2007; 13:87 96. 178. Miller JP, Hussain Z, Schweizer MP. The involvement of the anticodon adjacent modified nucleoside N (9 (BETA D ribofuranosyl) purine 6 ylcarbamoyl) threonine in the biological function of E. coli tRNAile. Nucleic Acids Res 1976; 3:1185 201. 179. Kaczanow ska M, Rydén Aulin M. Temperature sensitivity caused by mutant release factor 1 is suppressed by mutations that affect 16S rRNA maturation. J Bacteriol 2004; 186:3046 55. 180. Kaczanowska M, Rydén Aulin M. The YrdC protein -a putative ribosome maturation factor. Biochim Biophys Acta 2005; 1727:87 96. 181. Hecker A, Lopreiato R, Graille M, Collinet B, Forterre P, Libri D, van Tilbeurgh H. Structure of the archaeal Kae1/Bud32 fu sion protein MJ1130: a model for the eukaryotic EKC/KEOPS subcomplex. EMBO J 2008; 27:2340 51. 182. Kuratani M, Kasai T, Akasaka R, Higashijima K, Terada T, Kigawa T, Shinkai A, Bessho Y, Yokoyama S. Crystal structure of Sulfolobus tokodaii Sua5 complexe d with L threonine and AMPPNP. Proteins 2011; 79:2065 75. 183. Meng F L, Chen X F, Hu Y, Tang H B, Dang W, Zhou J Q. Sua5p is required for telomere recombination in Saccharomyces cerevisiae . Cell Res 2010; 20:495 8. 184. Hecker A, Graille M, Madec E, G adelle D, Le Cam E, van Tilbergh H, Forterre P. The universal Kae1 protein and the associated Bud32 kinase (PRPK), a mysterious protein couple probably essential for genome maintenance in Archaea and Eukarya. Biochem Soc Trans 2009; 37:29 35.

PAGE 237

237 185. Meng F L, Hu Y, Shen N, Tong X J, Wang J, Ding J, Zhou J Q. Sua5p a single stranded telomeric DNA binding protein facilitates telomere replication. EMBO J 2009; 28:1466 78. 186. Bergmiller T, Peña Miller R, Boehm A, Ackermann M. Single cell time lapse analysis of depletion of the universally conserved essential protein YgjD. BMC Microbiol 2011; 11:118. 187. Hecker A, Leulliot N, Gadelle D, Graille M, Justome A, Dorlet P, Brochier C, Quevillon cheruel S, Le Cam E, van Tilbeurgh H, et al. An archaeal orthologue of the universal protein Kae1 is an iron metalloprotein which exhibits atypical DNA binding properties and apurinic endonuclease activity in vitro. Nucleic Acids Res 2007; 35:6042 51. 188. Katz C, Cohen Or I, Gophna U, Ron EZ. The ubiquitous conserved g lycopeptidase Gcp prevents accumulation of toxic glycated proteins. MBio 2010; 1:1 10. 189. Crain PF. Preparation and enzymatic hydrolysis of DNA and RNA for mass spectrometry. Methods Enzymol 1990; 193:782 90. 190. Pomerantz SC, McCloskey JA. Analysis of RNA hydrolyzates by liquid chromatography mass spectrometry. Methods Enzymol 1990; 193:796 824. 191. Kaufmann G. Anticodon nucleases. Trends Biochem Sci 2000; 25:70 4. 192. Tomita K, Ogawa T, Uozumi T, Watanabe K, Masaki H. A cytotoxic ribonuclease which specifically cleaves four isoaccepting arginine tRNAs at their anticodon loops. Proc Natl Acad Sci U S A 2000; 97:8278 83. 193. Klassen R, Paluszynski JP, Wemhoff S, Pfeiffer A, Fricke J, Meinhardt F. The primary target of the killer toxin from Pi chia acaciae is tRNA(Gln). Mol Microbiol 2008; 69:681 97. 194. Lu J, Huang B, Esberg A, Johansson MJO, Byström AS. The Kluyveromyces lactis gamma toxin targets tRNA anticodons. RNA 2005; 11:1648 54. 195. Kaufmann G, David M, Borasio GD, Teichmann a, Pa z a, Amitsur M. Phage and host genetic determinants of the specific anticodon loop cleavages in bacteriophage T4 infected Escherichia coli CTr5X. J Mol Biol 1986; 188:15 22. 196. Kaufmann G, David M, Borasio GD, Teichmann A, Paz A, Amitsur M. Phage and h ost genetic determinants of the specific anticodon loop cleavages in bacteriophage T4 infected Escherichia coli CTr5X. J Mol Biol 1986; 188:15 22.

PAGE 238

238 197. Jiang Y, Meidler R, Amitsur M, Kaufmann G. Specific interaction between anticodon nuclease and the tRN A(Lys) wobble base. J Mol Biol 2001; 305:377 88. 198. Jiang Y, Blanga S, Amitsur M, Meidler R, Krivosheyev E, Sundaram M, Bajji AC, Davis DR, Kaufmann G. Structural features of tRNALys favored by anticodon nuclease as inferred from reactivities of antico don stem and loop substrate analogs. J Biol Chem 2002; 277:3836 41. 199. Lamichhane TN, Blewett NH, Maraia RJ. Plasticity and diversity of tRNA anticodon determinants of substrate recognition by eukaryotic A37 isopentenyltransferases. RNA 2011; 17:1846 5 7. 200. Vold BS. Radioimmunoassays for the modified nucleosides N[9 (beta D ribofuranosyl)purin 6 ylcarbamoyl] L threonine and 2 methylthioadenosine. Nucleic Acids Res 1979; 7:193 204. 201. Vold BS, Kraus LE, Rimer VG, Void S, Coombes RC. Use of a mono clonal antibody to detect elevated levels of a modified nucleoside, N [9 (beta D ribofuranosyl)purin 6 ylcarbamoyl] L threonine, in the urine of breast cancer patients. Cancer Res 1986; 46:3164 7. 202. Baynes JW, Thorpe SR. Glycoxidation and lipoxidation in atherogenesis. Free Radic Biol Med 2000; 28:1708 16. 203. Woese CR. On the evolution of the genetic code. Proc Natl Acad Sci U S A 1965; 54:1546 52. 204. Goel NS, Ycas M. The error catastrophe hypothesis and aging. J Math Biol 1976; 3:121 47. 205. ORGEL LE. The maintenance of the accuracy of protein synthesis and its relevance to ageing. Proc Natl Acad Sci U S A 1963; 49:517 21. 206. Rojas Benítez D, Ibar C, Glavic Á. The Drosophila EKC/KEOPS complex: roles in protein synthesis homeostasis and a nimal growth. Fly (Austin) 2013; 7:168 72. 207. Loewith R, Hall MN. Target of rapamycin (TOR) in nutrient signaling and growth control. Genetics 2011; 189:1177 201. 208. Rohde JR, Bastidas R, Puria R, Cardenas ME. Nutritional control via Tor signaling in Saccharomyces cerevisiae. Curr Opin Microbiol 2008; 11:153 60. 209. Turowski TW, Karkusiewicz I, Kowal J, Boguta M. Maf1 mediated repression of RNA polymerase III transc ription inhibits tRNA degradation via RTD pathway. RNA 2012; 18:1823 32.

PAGE 239

239 210. Cardenas ME, Cutler NS, Lorenz MC, Di Como CJ, Heitman J. The TOR signaling cascade regulates gene expression in response to nutrients. Genes Dev 1999; 13:3271 9. 211. Powers ET, Balch WE. Costly mistakes: translational infidelity and protein homeostasis. Cell 2008; 134:204 6. 212. Patil CK, Li H, Walter P. Gcn4p and novel upstream activating sequences regulate targets of the unfolded protein response. PLoS Biol 2004; 2:E246 . 213. Herzog B, Popova B, Jakobshagen A, Shahpasandzadeh H, Braus GH. Mutual cross talk between the regulators Hac1 of the unfolded protein response and Gcn4 of the general amino acid control of Saccharomyces cerevisiae . Eukaryot Cell 2013; 12:1142 54. 214. Yarham JW, Lamichhane TN, Pyle A, Mattijssen S, Baruffini E, Bruni F, Donnini C, Vassilev A, He L, Blakely EL, et al. Defective i 6 A 37 Modification of Mitochondrial and Cytosolic tRNAs Results from Pathogenic Mutations in TRIT1 and Its Substrate tRNA. PLoS Genet 2014; 10:e1004424.

PAGE 240

240 BIOGRAPHICAL SKETCH Patrick C. Thiaville began studying bacteria l genetics as an undergraduate at Southeastern Universit y, where he received a Bachelor of Science in 2000, with a major in microbiology and minor in chemistry. After graduation he began working for Crescent Technologies and Central Analytical Laboratories in Belle Chasse, Louisiana, beginning as an analytical chemist and later transitioning to microbiologist and quality control coordinator. In 2003, Patrick relocated to Gainesville, Florida to begin working with Dr. Paul Gulig at the University of Florida to study to the human pathogen Vibrio vulnificus . During his time with Dr. Gulig, Patrick published four papers including one as a primary author correlating the genotype of V. vulnificus with virulence in a mouse model of infection. In 2009, he received a pre doctoral fellowship for the Florida Board of Education and enrolled in the Genetics and Genomics Graduate Program, University o f Florida, Genetics Institute. Under the supervision of Dr. Valérie de Crécy Lagard his doctoral research focused on underst anding the formation and function of a universally conserved modification of tRNAs using a combination of classical microbial genetics and high throughput sequencing. In 2012, Patrick was the recipient of the Chateaubriand Fellowship issued by the Embassy of France to the United States. With this fellowship, Patrick worked with Dr. Olivier Namy at the University of Paris Sud in Orsay, France and will receive a second Doctor of Philosophy in 2014, to coincide with the one from the University of Florida. Duri ng his graduate studies, Patrick was the recipient of several travel awards to present his research at both national and international scientific meetings, including a Conference Fellowship Award to present at the XXIV tRNA Conference in Olumé, Chile , and he won best poster award at the 97 th

PAGE 241

241 Annual Meeting , Southeastern Branch of the American Society for Microbiology , and was given the opportunity to give a talk at Barcelona Biomed 2013 in Barcelona, Spain.



PAGE 1

RNA Biology 7:3, 272-275; May/June 2010; 2010 Landes Bioscience POI þnN T OF VIEW272 þ RNA Biology þV V olume 7 þI I ssue 3Key words: bacterial RNAP, NusA, transcription regulation Abbreviations: AR, auto-inhibitory; CH, coiled-helix; EC, elongation complex; RNAP, RNA polymerase; UBS, upstream binding sites Submitted: 02/18/10 Revised: 04/06/10 Accepted: 04/07/10 Previously published online: www.landesbioscience.com/journals/ rnabiology/article/12021*Correspondence to: Peter J. Lewis; Email: Peter.Lewis@newcastle.edu.auThe synthesis of RNA is highly regu lated at all stages by transcription factors. As an essential transcription elongation factor, NusA has been stud ied biochemically for more than 30 years. However, until now no struc tural information has been available on NusA-RNAP complexes and the NusA interaction site on RNAP was a point of speculation. Determination of the structure of RNA polymerase in com plex with NusA is helping us understand how NusA regulates transcription. The resulting model of RNA polymerase in complex with NusA has shed light on the transition from the initiation to elon gation stages of transcription, and how NusA functions in promoting regulatory pausing and termination. The synthesis of RNA from its template DNA is carried out by a DNA-dependent RNA polymerase (RNAP), and the cata lytically competent core enzyme is evolu tionarily conserved in function, primary sequence and overall architecture in all living organisms.1 Bacterial RNAP exists in two forms: core and holoenzyme. The 400 kDa RNAP core enzyme consists of ve subunits: two large subunits and ’, two subunits and an accessory subunit . Although RNAP core is capable of cat alyzing transcription, an additional factor , which interacts with RNAP to form a holoenzyme, is required for specic tran scription initiation.2 Most bacteria have one primary factor for the transcrip tion of the housekeeping genes and one or more alternative factors for transcription of specic subsets of genes in response to environmental stimuli.3 Bacterial RNAP The interaction between RNA polymerase and the elongation factor NusAXiao Yang and Peter J. Lewis*School of Environmental and Life Sciences; University of Newcastle; Callaghan, NSW Australiahas an overall “crab claw” structure with the active channel formed by the cleft between the and ’ subunits that is able to accommodate double stranded DNA and the DNA/RNA hybrid.4 The newly synthesized RNA transcript is released through a so-called RNA exit channel formed by the -ap and the rest of the enzyme ( Fig. 1 and green).4 A solvent exposed coiled-helix (CH) region of the RNAP ’ subunit ( Fig. 1 and cyan) repre sents the major site for (region 2) inter action although the -ap also forms weak contacts with region 4 of the factor.5Transcription can be carried out in vitro under permissive pH, temperature and buffer conditions using only RNAP holoenzyme, a DNA template and NTP substrates. However, in vivo RNAP activ ity is highly regulated by factors that interact with DNA, RNA or RNAP at all stages of the transcription cycle. These factors are collectively called transcription factors. NusA, an essential transcription elongation factor, is present in all of the microbial genomes sequenced so far. As the best-characterized Nus (N utilizing substance) factor, NusA was rst identi ed as the host factor involved in phage N-protein mediated antitermination.6 NusA also plays an essential role in the formation of the antitermination com plex in host cell rRNA synthesis, which ensures the large ribosomal RNA oper ons (typically >5 kb) get transcribed completely and rapidly in order to cope with rRNA requirement at high-growth rates.7 Conversely, NusA has been shown to stimulate regulatory pausing of RNAP, slowing the overall rate of transcription elongation.8 This activity is important in

PAGE 2

www.landesbioscience.com þ RNA Biology þ 273 POI þnN T OF VIEWPOI þnN TOFVIEWstudies to produce a model for RNAP in complex with NusA, where EM structures were resolved for both negatively stained RNAP core enzyme and a NusA-RNAP complex.22 This represented the rst structure of RNAP in complex with an essential transcription elongation factor. The resultant model ( Fig. 1 ) is consistent with the biochemical binding data,22 and that of other previous biochemical obser vations (see discussion below), enabling rened hypotheses on how NusA plays its various regulatory roles in the transcrip tion cycle. In the experimentally determined NusA-RNAP complex model, the N-terminal domain of NusA binds spe cically to the -ap tip of RNAP, while the C-terminal domains are placed adja cent to the RNA exit channel ( Fig. 1 ).22 This conformation of NusA is highly bent in comparison to the crystal structures of NusA, but would be permitted by the inherent exibility in the 23 amino acid linker between the Nand C-terminal domains.12,13,18,22 This placement of NusA indicated that any mutually exclusive model for NusAbinding could not be accounted for by the two proteins com peting for the region 2 binding site on the CH region of the ’ subunit. However, since region 4 of also makes weak con tacts with the -ap tip of RNAP,5 it could compete with NusA for binding to that region of RNAP. It has been proposed that during tran sition from initiation to elongation, the weak interaction between region 4 and the -ap is the rst to be broken.5,23,24 This would allow NusA to bind resulting in a transition complex comprising both factors,23 consistent with data derived from in vitro experiments.19 Binding of NusA is likely to induce structural changes in RNAP, which in turn could further reduce the afnity of interaction to RNAP. Our model is consistent with the ndings that through NusA competi tion, the binding afnity dropped dra matically between initiating RNAP core and the elongation complex (from Kd 10-10 to 10-6 M),25 and that NusA is incorpo rated into the elongation complexes before is fully dissociated.21In the elongation phase, NusA pro motes pausing and termination, and domain of (region 2).17 Based on this observation, a highly attractive model of a NusA-RNAP complex was proposed by docking NusA onto RNAP using the shared region of homology with and its binding site on RNAP as an anchor.18 The resultant model accounted for the mutu ally exclusive binding of the two proteins and the C-terminal domains of NusA were also ideally situated around the -ap region to interact with the emerging RNA for transcription regulation.19 However, several other studies have indicated that transcription complexes can contain both and NusA in certain circumstances,20,21 suggesting that alternative conformations of and NusA may be adopted permitting their simultaneous interaction with RNAP and that this working model would require some modication to account for all the experimental observations. The NusA binding site on RNAP was determined using biochemical mapping approaches to help us better understand the role of NusA in the transcription cycle.22 To our surprise, NusA was found to bind to a completely different region on RNAP to the major interaction site (the CH region of the ' subunit).5,23 Instead, NusA was shown to bind to the -ap. This interaction occurs speci cally between the N-terminal domain of NusA and the -ap tip helix, while the C-terminal domain contributes to the stability of the complex through non-specic interactions with RNAP.22 This unex pected result led us to undertake structural ensuring efcient termination at intrin sic terminators.9 The bi-functional role of NusA has been shown to result from a change in the stoichiometry of NusA to RNAP from 1:1 during mRNA tran scription, to 2:1 in the antitermination complexes.9,10 Acting together with other factors, NusA has also been shown to sup press the toxic activity of foreign genes in Escherichia coli.11Structurally, NusA is a highly elongated molecule with multiple linearly arranged discrete domains. The N-terminal domain (NTD) proposed to mediate the interaction with RNAP, is joined by a exible linker to the C-terminal S1/KH RNA binding domains.12,13 E. coli NusA also contains C-terminal auto-inhibitory (AR) domains which prevent the binding of RNA to S1/KH domains of NusA, and the inhibition is released after interaction of the AR domains with the subunit C-terminal domain of RNAP.14Traditionally, there has always been a clear distinction between transcription ini tiation and elongation complexes. During the transition from initiation to elongation, the factor dissociates from RNAP fol lowed by the association of NusA to regu late elongation and termination.15 From sedimentation studies it was concluded that binding of NusA and to RNAP was mutually exclusive, probably because they compete for the same binding site on RNAP.16 The N-terminal domain of NusA has also been shown to share structural homology with the major RNAP binding Figure 1. A model of B. subtilis RNA þPP in complex with the transcription elongation factor NusA. RNA þPP , i n grey, is shown from the upstream side (left) and face view (right) with the location of the major subunits indicated. þT T h e NusA N-terminal domain is in yellow and the C-terminal domain in red. NusA and factor binding sites are in green and cyan, respectively. See main text for more details.

PAGE 3

274 þ RNA Biology þV V olume 7 þI I ssue 3 be tested. Further studies are currently underway in our lab to extend our knowl edge on the interaction between RNAP and NusA, and to how NusA exerts its regulatory effects.AcknowledgementsWork in the lab of P.L. is supported by funding from the ARC and NHMRC. X.Y. was supported by an APA from the Australian Government. In summary, the structure of B. sub tilis RNA polymerase was resolved in complex with the essential transcription elongation factor NusA. This structure, together with results from biochemical binding assays, allowed the identica tion of the NusA binding site on RNAP and as a result, a new model for NusA in complex with RNAP was proposed. This model enables informed hypotheses on how NusA plays its various roles in the transcription cycle, which remains to multiple studies have placed NusA close to the RNA exit channel to play its regula tory roles ( Fig. 2A ).9,26 A model of NusA function in regulating intrinsic termination has been proposed ( Fig. 2A )9 and could be rened based on the new NusA-RNAP structure ( Fig. 2B ). As the RNA transcript emerges from the exit channel, a number of weak interactions are formed between the upstream portion of the hairpin and the so-called upstream binding sites (UBS) of RNAP (pink, Fig. 2B ).9 These contacts with RNA impede hairpin nucleation by competing for the upstream portion of the hairpin ( Fig. 2A ).9 It has been suggested that NusA enhances termination by bind ing to the UBS of RNAP and inhibits its interaction with the emerging RNA tran script.9,18 The new NusA-RNAP complex structure suggests there is no overlap between the NusA interaction site and the UBS (green and pink, respectively, Fig. 2B ).22 On the other hand, the C-terminal RNA binding sub-domains (S1, KH1 and KH2) of NusA are placed close to the RNA exit channel.22 This allows the interaction between the upstream arm of the hairpin and the NusA C-terminal domain, which could compete with the UBS for RNA binding. By interacting with the upstream portion of the hairpin, the NusA C-terminal domain could serve a chaperone role in promoting the forma tion of a RNA pause hairpin ( Fig. 2B ), the irreversible phase of termination.27NusA N-terminal domain interaction with the -ap tip of RNAP ( Figs. 1 and 2 )22 is consistent with the ndings that RNAP with a -ap tip helix knockout is completely insensitive to NusA mediated transcription pausing.28 The -ap tip has been shown to be involved in pause hairpin inhibition of catalytic activity of RNAP (but not for hairpin formation),28 and by binding to the -ap tip, NusA could be involved in strengthening the ap tip-hairpin interaction. Through interaction with the exible region of the -ap, NusA would also be able to modulate the width of the exit channel in order to enhance RNA hairpin inva sion of the active center and transcription termination ( Fig. 2B , right). Figure 2. A model for the transcription termination control mechanism by NusA. (A) Cartoon representations of the paused and the (termination) trapped elongation complex ( þEE C ) adapted from Gusarov and Nudler (2001). (B) þT T r anscription þE E C m odels (grey surface) without (left) or in complex with NusA (right). By interacting with the -ap region (green ribbon), the NusA N-terminal domain (yellow) is able to modulate the width of the RNA exit channel and the NusA C-terminal domain (red) is in the appropriate position to compete with the UBS (pink) for RNA (blue) binding. þTT h e blue arrows indicate the possible path of emerging transcript in the two forms of paused elongation complex. See main text for detailed discussion.

PAGE 4

www.landesbioscience.com þ RNA Biology þ 275 20. þ Kapanidis AN, Margeat E, Laurence TA, Doose S, Ho SO, Mukhopadhyay J, et al. Retention of tran scription initiation factor sigma70 in transcription elongation: single-molecule analysis. Mol Cell 2005; 20:347-56. 21. þ M ooney RA, Davis SE, Peters JM, Rowland JL, Ansari AZ, Landick R. Regulator trafficking on bacterial transcription units in vivo. Mol Cell 2009; 33:97-108. 22. þ Y ang X, Molimau S, Doherty GP, Johnston EB, Marles-Wright J, Rothnagel R, et al. The structure of bacterial RNA polymerase in complex with the essen tial transcription elongation factor NusA. EMBO Rep 2009; 10:997-1002. 23. þ K uznedelov K, Korzheva N, Mustaev A, Severinov K. Structure-based analysis of RNA polymerase func tion: the largest subunit’s rudder contributes critically to elongation complex stability and is not involved in the maintenance of RNA-DNA hybrid length. EMBO J 2002; 21:1369-78. 24. þ M urakami KS, Darst SA. Bacterial RNA polymeras es: the wholo story. Curr Opin Struct Biol 2003; 13:31-9. 25. þ G ill SC, Weitzel SE, von Hippel PH. Escherichia coli sigma 70 and NusA proteins I. Binding interactions with core RNA polymerase in solution and within the transcription complex. J Mol Biol 1991; 220:307-24. 26. þ T oulokhonov I, Artsimovitch I, Landick R. Allosteric control of RNA polymerase by a site that contacts nascent RNA hairpins. Science 2001; 292:730-3. 27. þ E pshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E. An allosteric path to transcription termi nation. Mol Cell 2007; 28:991-1001. 28. þ T oulokhonov I, Landick R. The flap domain is required for pause RNA hairpin inhibition of cataly sis by RNA polymerase and can modulate intrinsic termination. Mol Cell 2003; 12:1125-36. 11. þ C ardinale CJ, Washburn RS, Tadigotla VR, Brown LM, Gottesman ME, Nudler E. Termination factor Rho and its cofactors NusA and NusG silence foreign DNA in E. coli . Science 2008; 320:935-8. 12. þ G opal B, Haire LF, Gamblin SJ, Dodson EJ, Lane AN, Papavinasasundaram KG, et al. Crystal struc ture of the transcription elongation/anti-termination factor NusA from Mycobacterium tuberculosis at 1.7 resolution. J Mol Biol 2001; 314:1087-95. 13. þ W orbs M, Bourenkov GP, Bartunik HD, Huber R, Wahl MC. An extended RNA binding surface through arrayed S1 and KH domains in transcription factor NusA. Mol Cell 2001; 7:1177-89. 14. þ M ah TF, Kuznedelov K, Mushegian A, Severinov K, Greenblatt J. The alpha subunit of E. coli RNA polymerase activates RNA binding by NusA. Genes Dev 2000; 14:2664-75. 15. þ M ooney RA, Artsimovitch I, Landick R. Information processing by RNA polymerase: recognition of reg ulatory signals during RNA chain elongation. J Bacteriol 1998; 180:3265-75. 16. þ T raviglia SL, Datwyler SA, Yan D, Ishihama A, Meares CF. Targeted protein footprinting: where dif ferent transcription factors bind to RNA polymerase. Biochemistry 1999; 38:15774-8. 17. þ S hin DH, Nguyen HH, Jancarik J, Yokota H, Kim R, Kim SH. Crystal structure of NusA from Thermotoga maritima and functional implication of the N-terminal domain. Biochemistry 2003; 42:13429-37. 18. þ B orukhov S, Lee J, Laptenko O. Bacterial transcrip tion elongation factors: new insights into molecu lar mechanism of action. Mol Microbiol 2005; 55:1315-24. 19. þ B ar-Nahum G, Nudler E. Isolation and character ization of sigma(70)-retaining transcription elon gation complexes from Escherichia coli . Cell 2001; 106:443-51.References1. þ Werner F. Structural evolution of multisubunit RNA polymerases. Trends Microbiol 2008; 16:247-50. 2. þ B orukhov S, Nudler E. RNA polymerase holoen zyme: structure, function and biological implica tions. Curr Opin Microbiol 2003; 6:93-100. 3. þ G ourse RL, Ross W, Rutherford ST. General path way for turning on promoters transcribed by RNA polymerases containing alternative sigma factors. J Bacteriol 2006; 188:4589-91. 4. þ Z hang G, Campbell EA, Minakhin L, Richter C, Severinov K, Darst SA. Crystal structure of Thermus aquaticus core RNA polymerase at 3.3 resolution. Cell 1999; 98:811-24. 5. þ N ickels BE, Garrity SJ, Mekler V, Minakhin L, Severinov K, Ebright RH, et al. The interaction between sigma70 and the beta-flap of Escherichia coli RNA polymerase inhibits extension of nascent RNA during early elongation. Proc Natl Acad Sci USA 2005; 102:4488-93. 6. þ F riedman DI, Baron LS. Genetic characterization of a bacterial locus involved in the activity of the N function of phage lambda. Virol 1974; 58:141-8. 7. þ G ourse RL, Gaal T, Bartlett MS, Appleman JA, Ross W. rRNA transcription and growth rate-dependent regulation of ribosome synthesis in Escherichia coli . Annu Rev Microbiol 1996; 50:645-77. 8. þ R ichardson JP, Greenblatt J. Control of RNA chain elongation and termination. In: Neidhardt FC, Curtiss R III, Ingraham JL, Lin ECC, Low KB, Magasanik B, ed. Escherichia coli and Salmonella : Cellular and Molecular Biology. Washington, DC: American Society for Microbiology Press 1996; 822-48. 9. þ G usarov I, Nudler E. Control of intrinsic transcrip tion termination by N and NusA: the basic mecha nisms. Cell 2001; 107:437-49. 10. þ D avies KM, Dedman AJ, van Horck S, Lewis PJ. The NusA:RNA polymerase ratio is increased at sites of rRNA synthesis in Bacillus subtilis. Mol Microbiol 2005; 57:366-79.