Citation
Adenoviruses in Pinnipeds California Sea Lion Adenovirus 1 in California Sea Lions (Zalophus Californianus) and the Diversity of Adenoviruses in Otarid Seals

Material Information

Title:
Adenoviruses in Pinnipeds California Sea Lion Adenovirus 1 in California Sea Lions (Zalophus Californianus) and the Diversity of Adenoviruses in Otarid Seals
Creator:
Cortes, Galaxia Andrea
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (180 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Veterinary Medical Sciences
Veterinary Medicine
Committee Chair:
WELLEHAN,JAMES F,JR
Committee Co-Chair:
HEARD,DARRYL J
Committee Members:
WISELY,SAMANTHA M
WALTZEK,THOMAS B
SALEMI,MARCO
Graduation Date:
12/19/2014

Subjects

Subjects / Keywords:
Adenoviruses ( jstor )
Diseases ( jstor )
Euthanasia ( jstor )
Lions ( jstor )
Phylogenetics ( jstor )
Polymerase chain reaction ( jstor )
Pups ( jstor )
Seals ( jstor )
Seas ( jstor )
Viruses ( jstor )
Veterinary Medicine -- Dissertations, Academic -- UF
adenovirus -- phylogeny -- pinnipeds
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Veterinary Medical Sciences thesis, Ph.D.

Notes

Abstract:
Adenoviruses are found across a diversity of vertebrates, with a high level of host fidelity. In general, significant disease due to intranuclear DNA viruses is associated with host jumps. To date, members of the genus Mastadenovirus are only known to infect mammals, and the genus Aviadenovirus has primarily been found to infect birds. However, there has been a large investigative bias towards human adenoviruses, leading to a poor understanding of greater adenoviral diversity and ecology. Only two adenoviral species have been described in Carnivora, Canine mastadenovirus (CAdVs) and California sea lion adenovirus 1 (CSLAdV-1). Canine adenovirus may represent a host jump from a bat adenovirus. Little is understood about cospeciation of adenoviruses in the Carnivora lineage. The second and third chapters of this dissertation are focused on obtaining the complete genome of CSLAdV-1 and developing a qPCR assay for the diagnosis of this virus. We found that CSLAdV-1 could also be a product of a host jump from an unknown mammalian host, and that this virus has a low prevalence among wild managed CSL populations. The fourth chapter presents a clinical report of CSLAdV-1 and a novel polyomavirus in the critically endangered Hawaiian monk seal (HMS, Neomonachus schauinslandi). This is the first report of viral co-infection in a HMS; however, the clinical significance in this case remains unclear. In the fifth and last chapter, we investigated the diversity of adenoviruses in breeding colonies of South American fur seals (SAFS, Arctophoca australis) from two populations, one in Peru (Punta San Juan Marine Protected) and the other in Chile. Screens using nested pan-adenoviral primers have identified five mastadenoviruses and four aviadenoviruses. Concurrent investigation of adenoviruses in Humboldt penguins (HP, Spheniscus humboldti) at the same Peruvian site identified three mastadenoviruses, two aviadenoviruses, and three siadenoviruses. One aviadenovirus has been detected in both HP and SAFS. This is the first report of aviadenoviruses in a marine mammal or mastadenoviruses in marine birds, and suggests that further viral diversity studies in sites with high density mixed species populations are warranted. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: WELLEHAN,JAMES F,JR.
Local:
Co-adviser: HEARD,DARRYL J.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-06-30
Statement of Responsibility:
by Galaxia Andrea Cortes.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Cortes, Galaxia Andrea. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
6/30/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

ADENOVIRUSES IN PINNIPEDS: CALIFORNIA SEA LION ADENOVIRUS 1 IN CALIFORNIA SEA LIONS ( Zalophus californianus ) AND THE DIVERSITY OF ADENOVIRUSES IN OTARID SEALS By GALAXIA ANDREA CORTÉS HINOJOSA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Galaxia Andrea Cortés Hinojosa

PAGE 3

To my family; Luis Soto, Gabriel Soto Cortés, Maximilian Soto Cortés, my mother Elvira Estrella Hinojosa and my grandfather Gerardo Hinojosa

PAGE 4

4 ACKNOWLEDGMENTS First of all, I want to thank my family for supporting me throughout my PhD . I want to thank my mother, g randfather, husband and son for encouraging me to follow my dreams . I also would like thank my advisor, James Wellehan, for his support throughout my d issertation. I am additional ly grat eful to the members of my committee: Thomas Waltzek, Marco Salemi, Darryl Heard and Samantha Wisely for their invaluable support and advice. I want to thank Darryl Heard for the personal support in my application to UF. A lso, I want to thank Thomas Waltzek for his constan t support during this process. I am also thankful to t he members of the Wild life and Aquatic V eterinary Diseases Laboratory (WAVDL) , including Linda Archer, J ason Ferrante, Natalie Steckler and Abigail Cla rk, for their personal and academic support. I am also indebted to The Marine Mammal Center (TMMC), National Marine Mammal Foundation, Chicago Zoological Society and Universidad Austral for providing samples during my dissertation. Finally, I wou l d like to thank the Comision Nacional de Ciencia and Tecnologia (CONICYT Chile) for financial support throughout my dissertation.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBREVIATIONS ................................ ................................ ........................... 13 ABSTRACT ................................ ................................ ................................ ................... 17 CHAPTER 1 MARINE MAMMAL VIRUSES IN THE MARINE ENVIRONMENT ......................... 19 Viru ses and their Evolution in the Sea ................................ ................................ .... 19 Viruses in Marine Mammals ................................ ................................ .................... 21 Sy stematic Review of Viruses in Pinnipeds ................................ ............................ 22 RNA Viruses ................................ ................................ ................................ ..... 22 DNA Viruses ................................ ................................ ................................ ..... 32 2 CSLADV 1 GENOME AND PHYLOGENETIC ANALYSIS ................................ ..... 42 Introduction ................................ ................................ ................................ ............. 42 Specific Aims ................................ ................................ ................................ .......... 45 Materials and Methods ................................ ................................ ............................ 46 Samples ................................ ................................ ................................ ........... 46 Genome Sequence ................................ ................................ .......................... 46 PCR Conditions ................................ ................................ ................................ 46 Genomic and Protein Sequence Annotation ................................ ..................... 47 Phylogenetic Reconstruction ................................ ................................ ............ 47 Alignment ................................ ................................ ................................ ... 47 Recombination analysis ................................ ................................ ............. 48 Model selection ................................ ................................ .......................... 48 Analysis of phylogenetic signal ................................ ................................ .. 48 Phylogenetic relations ................................ ................................ ................ 49 Result s ................................ ................................ ................................ .................... 50 Genome ................................ ................................ ................................ ............ 50 Phylogenetic Analysis ................................ ................................ ...................... 51 Recombination ................................ ................................ ........................... 51 Analysis of phylogenetic signal ................................ ................................ .. 51 Model selection ................................ ................................ .......................... 51 Phylogenetic relationships ................................ ................................ ......... 51 Discussion ................................ ................................ ................................ .............. 52

PAGE 6

6 3 CSLADV 1 QPCR AS SAY IN WILD AND MANAGED POPULATIONS OF CALIFORNIA SEA LIONS ( Zalophus californianus) ................................ ............... 85 Introduction ................................ ................................ ................................ ............. 85 Specific Aims ................................ ................................ ................................ .......... 86 Materials an d Methods ................................ ................................ ............................ 87 Sample Size Calculation ................................ ................................ ................... 87 Sample Management ................................ ................................ ....................... 87 Primer Design ................................ ................................ ................................ ... 88 Standard Curve ................................ ................................ ................................ 88 qPCR Assay ................................ ................................ ................................ ..... 88 Assay Optimization ................................ ................................ ........................... 89 Assay Validation ................................ ................................ ............................... 89 Analytic specificity ................................ ................................ ...................... 89 Analytical sensitivity ................................ ................................ ................... 90 Diagnostic specificity and sensitivity ................................ .......................... 90 CSLAdV 1 Prevalence in CSL ................................ ................................ .......... 91 Results ................................ ................................ ................................ .................... 91 Assay Optimization ................................ ................................ ........................... 91 Analytic Specificity. ................................ ................................ ........................... 92 Analytical Sensitivity ................................ ................................ ......................... 92 Diagnostic Sensitivity and Specificity ................................ ............................... 92 CSLAdV 1 Prevalence in CSL ................................ ................................ .......... 92 Discussion ................................ ................................ ................................ .............. 93 4 CSLAdV 1 IN A HAWAIIAN MONK SEAL ( Neomonachus schauinslandi ) ........... 101 Introduction ................................ ................................ ................................ ........... 101 Specific A ims ................................ ................................ ................................ ........ 103 Materials and Methods ................................ ................................ .......................... 104 Clinical History ................................ ................................ ................................ 104 Histology ................................ ................................ ................................ ......... 104 Transmission Electron Microscopy (TEM) ................................ ...................... 104 PCR and Sequencing ................................ ................................ ..................... 105 Cell Culture ................................ ................................ ................................ ..... 106 Phylogenetic A nalyses ................................ ................................ ................... 106 qPCR Assay ................................ ................................ ................................ ... 108 Results ................................ ................................ ................................ .................. 109 Histopathology ................................ ................................ ................................ 109 PCR and Sequencing ................................ ................................ ..................... 109 Cell Culture ................................ ................................ ................................ ..... 109 Phylogenetic Analyses ................................ ................................ ................... 110 Discussion ................................ ................................ ................................ ............ 111 5 DIVERSITY OF A DENOVIRUSES IN OTARID SEALS (CALIFORNIA SEA LIONS AND SOUTH AMERICAN FUR SEALS) AND SPECIES IN HIGH CONTACT (HUMBOLDT PENGUINS) ................................ ................................ . 122

PAGE 7

7 Introduction ................................ ................................ ................................ ........... 122 Specific Aims ................................ ................................ ................................ ........ 126 Materials and Methods ................................ ................................ .......................... 126 Sample Size for South American Fur Seals ................................ ................... 126 Sample Collection ................................ ................................ .......................... 126 Sample Management ................................ ................................ ..................... 127 PCR Conditions ................................ ................................ .............................. 128 Analysis ................................ ................................ ................................ .......... 128 Phylogenetic Reconstruction ................................ ................................ .......... 128 qPCR Assay ................................ ................................ ................................ ... 129 Results ................................ ................................ ................................ .................. 130 Discussion ................................ ................................ ................................ ............ 132 6 CONCLUSIONS ................................ ................................ ................................ ... 145 APPENDIX A: SUPPLEMENTARY DATA FOR CHAPTER 3 ................................ ........................ 147 B: SUPPLEMENTARY DATA FOR CHAPTER 5 ................................ ........................ 151 LIST OF REFERENCES ................................ ................................ ............................. 158 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 180

PAGE 8

8 LIST OF TABLES Table page 1 1 Viruses in vertebrates and their exist ence in selected marine mammals ........... 41 2 1 Consensus primers used to generate new CSLAdV 1 sequences ..................... 56 2 2 Specific primers used to close gaps betw een novel sequences of CSLAdV 1 ... 57 2 3 List of aden oviruses used for phylogenetic analysis with accession numbers an d endemic host species ................................ ................................ .................. 61 2 4 Comparison of genomic composition and number of amino acids of different mastadenoviruses w ith CSLAdV 1 ................................ ................................ ..... 62 2 5 Recombination analysis results ................................ ................................ .......... 63 2 6 Result of likelihood mapping in Tree Puzzle ................................ ...................... 64 2 7 ProtTest results to select the best model of protein evolution ............................ 64 2 8 Tracer report of effective sample size (ESS) ................................ ...................... 64 2 9 Bayes factor calc ulation for individual proteins ................................ ................... 65 2 10 Comparative table of GC content as pe rcentage amo ng mastadenoviruses ...... 66 3 1 Sample size requirements fo r 5 different prevalence values .............................. 96 3 2 Primers and pro bes for the CSLAdV 1 qPCR assay ................................ .......... 96 3 3 List of samples used for assay optimization with qPCR and PCR (specific and consensus primers) for CSLAdV 1. ................................ ............................. 97 4 1 Primers used to amplify CSLAdV 1 genes ................................ ....................... 115 4 2 Maximum identity matrix based on 272 bp fragment s of the DNA polymerase 116 4 3 Maximum identity matrix based o n 255 bp fragments of the hexon .................. 116 4 4 Results from substitut ion saturation test using DAMBE ................................ .... 116 4 5 Results of the CSLAdV 1 qPCR and PCR and HMSPyV 1 PCR ...................... 117 5 1 Sample size required per virus detected in each population of South American fur seal (SAFS) ................................ ................................ ................. 138

PAGE 9

9 5 2 Primers used for host barcoding ................................ ................................ ....... 138 5 3 Chi Square 2x2 table for adenovirus co mparisons between 2009 and 2010 .... 138 5 4 Primers and probes used in the qPCR assays and generation of template for the qPCR assays ................................ ................................ .............................. 138 5 5 Results of host barcoding ................................ ................................ ................. 139 5 6 Number of positive samples for each adenoviru s found in the two sample sites ................................ ................................ ................................ .................. 139 5 7 Novel C ali fornia sea lion adenoviruses ................................ ............................. 140 5 8 Chi square result for ade noviruses in SFS pups from Perú .............................. 140 5 9 qPCR r esults for SAFS Aviadenovirus 2 ................................ .......................... 141 5 10 GC% content in the partial polymerase seque nces of marine mastadenoviruses ................................ ................................ ............................ 142 A 1 Epidemiological data for stranded California sea lions ................................ ..... 148 B 1 Epidemiological data and results of the South Amerinca fur seal and Humboldt penguins adenovirus screening ................................ ........................ 152

PAGE 10

10 LIST OF FIGURES Figure page 2 1 California sea lion adenovirus type 1 (CSLAdV 1) genome organization; lines mark every 2000 bp ................................ ................................ ............................ 67 2 2 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the DNA polymerase gene .................. 68 2 3 Bayesian analysis phylogram de picting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequ ences of the DNA polymerase gen e. ................................ 69 2 4 Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the pTP gene ................................ ....... 70 2 5 Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviru ses based on the deduced amino acid (AA) sequences of the pTP gene ................................ ..................... 71 2 6 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the penton gene. ................................ . 72 2 7 Bayesian analysis phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the full length penton gene. ................................ 73 2 8 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the hexon gene ................................ ... 74 2 9 Bayesian analysis phylogram depicting the relationship of the California sea lion adenov irus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the full length hexon gene ................................ .. 75 2 10 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences of the p100K gene ................................ ... 76 2 11 Bayesian analysis phylogram depicting the relationship of the California sea lion a denovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequence s of the full length p100K gene ................................ . 77

PAGE 11

11 2 12 Bayesian analysis phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences for concatenated of five proteins data set with RtREV+G+I+F as the model of protein evolution ................................ ................ 78 2 13 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to kno wn adenoviruses based on the deduced amino acid (AA) sequences for concate nated of five proteins data set with LG+G+I+F as the model of protein evolution. ................................ ........ 79 2 14 Bayesian analysis phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences for concatenated of five proteins data set with WAG+G+I+F as the model of protein evolution. ................................ ................. 80 2 15 Bayesian analysis phylogram depicting the relationship of the California se a lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences for concatenated of five proteins data set with Mixed+G+I+F as the model of protein evolution ................................ ................. 81 2 16 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences for concate nated of five proteins data set with WAG+G+I+F as the model of protein evolution. ................................ .... 82 2 17 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to known adenoviruses based on the deduced amino acid (AA) sequences for concatenated of five proteins data set with RtREV+G+I+F as the model of protein evolution ................................ ... 83 2 18 Tanglegram of mastadenoviruses and th e corresponding mammalian hosts ..... 84 3 1 Position of primers and probe in alignment of mastadenoviruses polymerase gene ................................ ................................ ................................ ................. 100 4 1 Maximum Likelihood phylogram depicting the relationship of the California sea lion adenovirus 1 (CSLAdV 1) from Hawaiian monk seal (HMS) with other CSLs based on the deduced nucleotide (nt) sequences of the partial DNA polymerase gene ................................ ................................ ..................... 118 4 2 Bayesian analysis phylogram depicting the relationship of the California sea lion adenovirus 1 (CSLAdV 1) from Hawiian monk seal (HMS) with other CSLs based on the deduced nucleotide (nt) sequences of the partial DNA polymerase gene ................................ ................................ .............................. 119 4 3 Maximum Likelihood phylogram depicting the relationship of the Hawaiian monk seal polyomavirus 1 (HMSPyV 1) based on the deduced amino acid (AA) sequences of the partial VP1 gene ................................ ........................... 120

PAGE 12

12 4 4 Bayesian analysis phylogram depicting the relationship of the Hawaiian monk seal polyomavirus 1 (HMSPyV 1) based on the deduced amino acid (AA) sequences of the partial VP1 gene ................................ ................................ ... 121 5 1 Bayesian analysis phylogram of predicted amino acid sequences fo r the partial adenoviral DNA dependent DNA polymerase ................................ ........ 1 43 5 2 Maximum Likelihood phylogram of predicted amino acid sequences for t he partial adenoviral DNA dependent DNA polymerase ................................ ........ 144

PAGE 13

13 LIST OF ABBREVIATIONS aa amino acid AICc Akaike information criterion correction BAdV 3 Bovine adenovirus 3 BD AdV 1 Bottlenose dolphin adenovirus 1 BHQ black hole quencher dye Bp base pairs CAdV Canine a denovirus CSL California sea lion CSLAdV 1 California sea lion adenovirus 1 CSLAdV 2 California sea lion adenovirus 2 CSLAdV 3 California sea lion adenovirus 3 CSLAdV 4 California sea lion adenovirus 4 CSLAdV 5 California sea lion adenovirus 5 CSLAdV 6 California sea lion adenovirus 6 CSLPyV 1 C alifornia sea lion polyomavirus 1 C T Threshold cycle DNA D eoxyribonucleic acid DPI days post infection Ds double stranded FAM fluorescein amidite dye

PAGE 14

14 HMS Hawaiian monk seal HMSPyV 1 Hawaiian monk seal polyomavirus 1 HP Humboldt penguin HPAvia AdV Humboldt penguin aviadenovirus HPAvia AdV 1 Humboldt penguin aviadenovirus 1 HPAvia AdV 2 Humboldt penguin aviadenovirus 2 HPAvia AdV 3 Humboldt penguin aviadenovirus 3 HPAvia AdV 4 Humboldt penguin aviadenovirus 4 HPMasta AdV Humboldt penguin mastadenovirus HPMastaAdV 1 Humboldt penguin mastadenovirus 1 HPMastaAdV 2 Humboldt penguin mastadenovirus 2 HPMastaAdV 3 Humboldt penguin mastadenovirus 3 HPSia AdV Humboldt penguin siadenovirus HPSia AdV 1 Humboldt penguin siadenovirus 1 HPSia AdV 2 Humboldt penguin siadenovirus 2 HPSia AdV 3 Humboldt penguin siadenovirus 3 HPyV 6 Huma n polyomavirus 6 Kb kilobase MAdV 2 Murine adenovirus 2 Mb millions of bases pairs MCC maximum clade credibility

PAGE 15

15 MGB minor groover binder DNA probe ML Maximum L ikelihood MPTV murine pneumotropic virus N EM negative staining electron microscopy nt nucleotide ORF open reading f rame PAdV 3 Porcine adenovirus 3 PAdV 5 Porcine adenovirus 5 PCR polymerase chain reaction PhAdV 1 Phocid adenovirus 1 PhAdV 2 Phocid adenovirus 2 qPCR q uantitative polymerase chain reaction RNA Ribonucleic acid SAFS South American fur seal SAFSAvia South American fur seal aviadenovirus SAFSAviaAdV 1 South American fur seal aviadenovirus 1 SAFSAviaAdV 2 South American fur seal aviadenovirus 2 SAFSAviaAdV 3 South American fur seal aviadenovirus 3 SAFSAvia AdV 4 South American fur seal aviadenovirus 4 S A FSMasta AdV South American fur seal mastadenovirus SAFSMastaAdV 1 South American fur seal mastadenovirus 1

PAGE 16

16 SAFSMastaAdV 2 South American fur seal mastadenovirus 2 SAFSMastaAdV 3 South American fur seal mastadenovirus 3 SAFSMastaAdV 4 South American fur seal mastadenovirus 4 SAFSMastaAdV 5 South American fur seal mastadenovirus 5 SS single st randed SSL South American sea lion TEM Transmission electron microscopy TMAdV 1 Titi monkey adenovirus 1 TS AdV 1 Tree shrew adenovirus 1 m icroliter µM micromolar

PAGE 17

17 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for the Degree of Doctor of Philosophy ADENOVIRUSES IN PINNIPEDS: CALIFORNIA SEA LION ADENOVIRUS 1 IN CALIFORNIA SEA LIONS ( Zalophus californianus ) AND THE DIVERSITY OF ADENOVIRUSES IN OTARID SEALS By Galaxia Andrea Cortés Hinojosa December 2014 Chair: James Wellehan Major: Veterinary Medi cal Sciences Adenoviruses are found across a diversity of vertebrates, with a high level of host fidelity. In general, significant disease due to intranuclear DNA viruses is associated with host jumps. To date, members of the genus Mastadenovirus are only known to infect mammal s, and the genus Aviadenovirus has primar il y been found to infect birds. However , t here has been a large investigative bias towards human adenoviruses, leading to a poor understanding of greater adenovir al diversity and ecology. Only two adenoviral species have been described in Carnivora , Canine masta denovirus (CAdVs) and California sea l ion adenovirus 1 ( CSLAdV 1). Canine adenovirus may represent a host jump from a bat adenovirus. Little is understood about cospeciation of adenoviru ses in the Carnivora lineage. The second and third chapter s of this dissertation are focused on obtaining the complete genome of CSLAdV 1 and developing a qPCR assay for the diagnosis of this virus. We found that CSLAdV 1 could also be a product of a host jump from an unknown mammalian host, and that this virus has a low prevalence among wild managed CSL populations . The fourth chapter presents a clinical report of CSLAdV 1 and a novel polyomavirus in the critically

PAGE 18

18 endangered Haw a iian mon k s eal (HMS, Neomonachus schauinslandi ) . This is the first report of viral co infection in a HMS; however, the clinical significance in this case remains unclear . In the fifth and last chapter, we investigated the diversity of adenoviruses in breeding colo nies of South American fur seals (SAFS, Arctophoca australis ) fro m two populations, one in Perú (Punta San Juan Marine Protected Area, using nested pan adenoviral primers ha ve ident ified five mastadenoviruses and four a viadenoviruses. Concurrent investigation of adenoviruses in Humboldt penguins (HP, Spheniscus humboldti ) at the same Peruvian site identified three m astadeno viruses, two a viadenoviruses, and three siadenoviruse s. One a viadenovirus has been detected in both HP and SAFS . This is the first report of a viaden oviruses in a marine mammal or m astadenoviruses in marine bird s , and suggests that further viral diversity studies in sites with high density mixed species popul ations are warranted.

PAGE 19

19 CHAPTER 1 MARINE MAMMAL VIRUSES IN THE MARINE ENVIRONMENT Viruses and their Evolution in the Sea Life is thought to have first evolved in the marine environment, and this is likely the site of the origin of viruses (Villarreal 2005) . The three domains of life ( Archea , Bacteria and Eukaryota ) diverged in the oceans four billion years ago, and all have distinct and characteristic viruses (Villarreal 2005) . All currently known phyla are thought to have originated in the sea during the Cambrian explosion, and there was likely a concomitant increase in viral diversity. Currently, all extant phyla have representatives in the sea, but only some of them have terrestrial representatives. The abundance and diversity of microorganisms in the sea is greater than th at on land. In the sea, the total abundance of bacterial and archeal cells has been estimated to range between 10 28 10 29 (Whitman et al. 1998) . For viruses, the total abundance has been estimated at 10 30 virions, and they a re considered the most abundant replicati ng entiti e s/agents in the oceans. I t is estimated that 10 23 viral infections occur per second (Suttle 2005;2007) . Viruses represent over 90% of the numerical abundance of pro karyotes, protists, and viruses , but due to their small size viruses only represent 5% of the marine biomass (Suttle 2007) . Viral infections cause a 20% loss of marine biomass per day (Suttle 2007) , making viruses a major force on biogeochemical cycles. All these studies emphasize the enormous diversit y of viruses in marine environments and open the discussion on how much we have to learn about viruses in the marine environment and how these viruses can affect larger marine organisms, such as marine mammals. Viruses likely evolved from viral ancestor s ; the hypothesis of a cellular ancestor is currently in disfavor (Villarreal 2005) . It is believed that viruses originated

PAGE 20

20 independently several times and n ot all from a single common ancestor (Villarreal 2005) . In general, viruses are divided into two major groups, RNA viruses and DNA viruses. RNA viruses ar e typically smaller in genome content and virion size. Their genome size ranges between 1.7 3 5 kb, mostly in the 5 15 kb range. RNA viruses can be enveloped or non enveloped, with linear or circular genomes. The majority are single stranded (King et al. 2011) . For replication, they use a viral RNA dependent polymerase, with error rates that may be 10,000 times higher than vertebrate DNA dependent DNA polymerases. Because of error rates, RNA viruses rapidly incorporate new mutations in th eir genomes, facilitating rapid adaptation when jumping between hosts. Additionally, the high error rates limit the genome size of RNA viruses to approximately 30 Kb (Ball 2007) . DNA viruses tend to be larger in genome content and size, from 20 to 700 nm in virion diameter, with larger genomes up to 2.5 Mb in Pandoravirus (Philippe et al. 2013) . DNA viruses can be double stranded or single stranded, linear or circular. DNA viruses can use viral or host DNA dependent DNA polymerase s . This polymerase needs to have sufficient proofreading to accurately re plicate larger viruses. This is one of the properties of DNA viruses making them less able to evolve rapidly, as is typically needed for host jumping. In general, DNA viruses replicate inside the nucleus of the host cell, with the exceptions in vertebrates of poxviruse s, iridoviruses, and African swine fever virus (Ball 2007) . The site in the host cell where replication occurs has been r ecently considered one of the more important predictors of the ability of viruses to

PAGE 21

21 cross species boundaries; viruses with cytoplasmic replication are more likely to jump between hosts (Pulliam and Dushoff 2009) . As mentioned previously, viruses may or may not have a lipid envelope. This envelope, when present, is often needed for infecting cells and is relatively easy to destroy, so non enveloped viruses, such as adenoviruses or caliciviruses, are much more stable in the environment and can persist in aquatic environments for days or even months. Viruses in Marine Mammals Marine mammals live in intimate contact with the ocean, and therefore a vast diversity of viruses. Contact may be direct with viral particles that are floating in the sea as well as indirect, through the consumption of prey and other interspecies interactions (aggression, mutualism, etc). Of the 13 families of DNA viruses found in vertebrat es, 10 have been found in mammals. All ten have been found in marine mammals, eight of these in pinnipeds (Table 1 1). Of the 22 families/unassigned genera of RNA viruses found in vertebrates, 20 have been found in mammals. Of these 20, 11 have been found in marine mammals to date, all of them with representatives in pinnipeds (Table 1 1). New molecular techniques have been implemented in the diagnosis of viral diseases in marine mammals populations. These tools have rapid ly increase d our knowledge of vir al diversity in marine mammals over the last decade (Dierauf et al. 1981, Burek et al. 2005b, Nollens et al. 2008b, Atkins et al. 2009, Ng et al. 2009, Nollens et al. 2009, Nollens et al. 2010a, Rivera et al. 2010, Wellehan et al. 2010, Goldstein et al. 2011, Li et al. 2011, Maness et al. 2011, Ng et al. 2011, Wellehan et al. 2011a, Rivera et al. 2012, Robles Sikisaka et al. 2012) .

PAGE 22

22 The significance of new viruses only can be understood with knowledge of their presence in natural or managed populations. Therefore, information obtained from health assessments of wild and managed populations is of vital importance. Add itionally, when the importance of the viroplankton and the presence of viruses in other vertebrates that have not yet been found in marine mammals is considered , an extraordinary diversity of viruses likely remains to be discovered. Systematic Review of Vi ruses in Pinnipeds RNA Viruses Astroviridae : Astroviruses are small (28 30 nm), spherical, non enveloped, positive sense single stranded viruses, with intracytoplasmic replication. The family Astroviridae has two recognized genera; Avastrovirus is found in birds and Mamastrovirus is found in mammals. Astroviruses were first described in humans in 1975 (Madeley and Cosgrove 1975) from cases of diarrhea. Astroviruses cause diarrhea and have a high prevalence in children, most children over 5 years have ant ibodies to human astroviruses. The seroprevalence in humans is in the range of 90% to 100% depending on the study (Kriston et al. 1996, Koopmans et al. 1998) . In the order Carnivora , astroviruses have been associated with diarrhea i n mink, domestic dogs, cheetahs, and domestic cats (Atkins et al. 2009) . In marine mammals, astroviruses have been reported in bottlenose dolphins ( Tursiops truncatus ) (Rivera et al. 2010) , Steller sea lions ( Eumetopias jubatus ) (Rivera et al. 2010) , minke whales ( Balaen optera acutorostrata ), and California sea lions ( Zalophus californianus ) (Rivera et al. 2010, Li et al. 2011) . In Rivera et al. 2010, the authors found five different astroviruses; one in bottlenose dolphins, one in Steller sea lions , and three in California sea lions. In a 2011 study by Li et al., the authors used second generation sequencing

PAGE 23

23 to identify a total of 8 additional astroviruses in California sea lions (Li et al. 2011) . This study was done using fecal swabs of animals i n rehabilitation facilities, and found an astrovirus prevalence of 51% (Li et al. 2011) . All astroviruses found in pinnipeds to date are in the genus Mamastrovirus . The clinical significa nce of astroviruses in pinnipeds is not clear, but is likely that these viruses cause diarrhea in young animals as they do in other species. Caliciviridae : Calici viruses are small (30 38 nm) ic osahedrical, non enveloped, positive sense single stranded viru ses with intracytoplasmic replication. The family Caliciviridae has six genera: Lagovirus, Nebovirus, Norovirus, Lagovirus, Sapovirus , and Vesivirus . San Miguel Sea lion virus (SMSV) , a member of the genera Vesivirus , was first reported in marine mammals i n 1972 . This virus is genetically indistinguishable from Vesicular exanthema of swine virus (VESV), a reportable foreign animal disease that has officially been considered eradicated in the USA since 1956. SMSV has zoonotic potential, causing an influenza like syndrome followed by blisters on the hands and feet (Smith et al. 1998) . SMSV has also been associated with hepatitis in humans (Smith et al. 2006, Lee et al. 2012) . Perhaps most concerningly, related vesiviruses have bee n found to rapidly evolve higher virulence where there are high host population densities (Schorr Evans et al. 2003) . Serological studies suggest exposure to vesiviruses in cetaceans and pinnipeds (Akers et al. 1974) . In pinnipeds, SMSV causes vesicular lesions on the flippers and the mouth (Schaffer and Soergel 1973) , and has also been related with gastroenteritis in California sea lions ( Zalophus californianus ) (Schmitt et al. 2009)

PAGE 24

24 Coronaviridae : Coronaviruses are large (120 160 nm ), round, toroidal, or bacilliform, enveloped, positive sense, single stranded viruses with intracytoplasmic replication. The family Coronaviridae has 2 subfamilies, Coronavirinae and Torovirinae . The subfamily Coronaviri nae has 4 genera, Alphacoronavirus , Betacoronavirus , Deltacoronavirus , and Gammacoronavirus (De Groot et al. 2012) . The genus Alphacoronavirus contains a subclade of viruses of Carnivora and Suidae , including Feline enteric coronavirus and Feline Infectious Peritonitis (FIP) from domestic cats and canine coronavirus in dogs (Vennema et al. 1998, Buonavoglia et al. 2006) . Betacoronaviruses are perhaps best known for containing severe acute respi ratory syndrome (SARS) virus (Ksiazek et al. 2003) . Gammacoronaviruses often infect avian hosts (De Gro ot et al. 2012) . Finally, the recently discovered Deltacoronaviruses primarily infect avian hosts (Woo et al. 2012) . In m arine mammals, g ammacoronaviruses have been characterized in a beluga whale (Mihindukulasuriya et al. 2008) and bottlenose dolphins (Woo et al. 2014) . In pinnipeds, the only coronavirus published to date is an Alphacoronavirus in the carnivora /suid clade. This virus was identified in an epizootic of pneumonia in harbor seals. Only formalin fixed paraffin embedded tissues were available for testing, and only one of the 5 animals tested was positive for this new coronavirus, so the clinical significance of this finding is unclear (Nollens et al. 2010b) . Flaviviridae : Flaviviruses are medium size d ( 40 60 nm ) , icosahedral, enveloped, positive sense single stranded viruses with intracytoplasmic replication. In the family Flaviviridae , there are 4 genera: Flavivirus , Pestivirus , Pegivirus , and Hepacivirus . The genus Flavivirus are arthropod borne diseases, many of them transmitted by mosquitos.

PAGE 25

25 In this genus are important human pathogens: yellow fever, dengue virus, Japanese encephalitis, West Nile virus , and tick born encephalitis (Simmonds et al. 2012 ) . West Nile virus (WNV) was introduced into the USA in 1999, and has since spread across North America. This virus causes non specific clinical signs of malaise that can progress into an acu te aseptic encephalitis and an terior myelitis in less than 15 % of cases (Wilkins and Piero 2004) . The virus is transmitted predominantly by mosquitoes from the genus Culex, but birds play an important role as reservoirs in the in the life cycle, since many birds can have long term WNV viremia (Wilkins and Piero 2004) . WNV has been reported in one harbor seal ( Phoca vitulina ) from an aquarium in 2006 (Del Piero et al. 2006) . WNV serum neutralization was negative four months prior to clinical presentation. This seal presented with anorexia, depression, diarrhea, vomiting, and respiratory distress followed by neuromuscular signs of head tremors and muscular stiffness. The patient was anemic with a leukopenia and ultimate ly died. Reverse transcription polymerase chain reaction (RT PCR) amplified a 248 bp WNV fragment, and antigen was identified by in direct peroxidase immunostaining (Del Piero et al. 2006) . Serological evidence of another case of non fatal WNV was found in a seal with signs of neurological dysfunction in a different facility, but this data was not published (Del Piero et al. 2006) Orthomyxoviridae : Orthomyxovirus es are medium size ( 80 120 nm ) , segmented genome, pleomorphic, enveloped, negative sense single stranded viruses with intranuclear and intracy toplasm ic replication. The family Orthomyxoviridae has 5 genera: Influenzavirus A , Influenzavirus B , Influenzavirus C , Thogotovirus , and Isavirus (McCauley et al. 20 12) . An interesting feature of segmented viruses is the possibility of

PAGE 26

26 reassortment (antigenic shift) between homologous segments of different viruses that co infect a particular host. This ability, in combination with mutations on specific genes used a s antibody binding sites for the host ( antigenic drift ) , helps these viruses to jump between hosts and avoid immunosurveillance. The three influenza viruses can cause respiratory diseases in humans and other tetrapods. Influenza C is the least reported of the 3 influenza virus genera. Influenza A is well known to cause pandemic outbreaks in the human population since 1918/1919. In marine mammals, Influenza A and B have been diagnosed in wild populations of cetaceans and pinnipeds since late 1970s (Lang et al. 1981, Webster et al. 1981b, Geraci et al. 1982, Hinshaw et al. 1984, Osterhaus et al. 2000, Ohishi et al. 2002, Ohishi et al. 2004, Blanc et al. 2009, Anthony et al. 2012, Ramis et al. 2012) . In pinnipeds, Influenza A has been the cause of massive mortalities due to pneumonia, in harbor seals ( Phoca vitulina ) from A/Seal/Mass/1/80/( H7N7) (Geraci et al. 1982) . In this event, workers helping with necropsies were infected directly from sick animals, causing conjunctivitis in humans (Webster et al. 1981a) . Another mortality event in 1982 1983, also causing pneumonia, was diagnosed in harbor seals from A/Seal/Mass/133/82 (H4N5) (Hinshaw et al. 1984) . In 2011, A/harbor seal/Massachusetts/1/2011 (H3N8), related to a strain circulating in North American waterfowl since 2002 , caused an epizootic of fatal pneumonia in harbor seals (Anthony et al. 2012) . In this outbreak, of 162 deceased animals found, tissue from 5 animals was submitted for molecular diagnosis; those 5 animals were Influenza A positive, and this wa s confirmed with immunohistochemi stry .

PAGE 27

27 In 2010, pandemic H1N1 was found in Northern Elephant seals, ( Mirounga angustirostris ). This strain had been circulating in humans (Goldstein, 2013). Additional species have been found to be sero positive to Influenza A: South American fur seals ( Ar c tophoca australis ) (Blanc et al. 2009) , Caspian seals ( Pusa caspica ) (Ohishi et al. 2002) , Baikal seals ( Phoca sibirica ) and ringed seals ( Phoca hispida ) (Ohishi et al. 2004) . Influenza B has been linked to respiratory disease in marine mammals; it has been found in stranded harbor seals in 1999 (B/Seal/Netherl ands/1/99) (Osterhaus et al. 2000) , and 2 harbor seals admitted to a rehabilitation facil ity (Fouchier et al. 2001) . Serological evidence supports the presence of different strains of influenz a B among harbor seals and suggests that this species is a reservoir of influenza B (Bodewes et al. 2013) . Serological evidence of Influenza B has also been found in Grey seals ( Halichoerus grypus) , South American fur seals ( Arctophoca australis ) and Caspian seals ( Pusa caspica ) (Fouchier et al. 2001, Ohishi et al . 2002, Blanc et al. 2009) . Picobirnavirida e : Picobirnaviruses are small ( 35 40 nm ) , segmented, icosahedral, non enveloped double stranded viruses with intracytoplasmic replication. The family Picobirnaviridae has one genus: Picobirnavirus . Picornaviruses infect vertebrates, including mammals, birds, and squamates. They are poorly inves tigated in comparison with other RNA viruses reviewed. They are considered possible pathogens that have been found in cases of diarrhea (Knowles et al. 2012) . In pinnipeds, picornaviruses have been found in 5/47 fecal swabs from California sea lions ( Zalophus californianus ) (Li et al. 2011) .

PAGE 28

28 Picornaviridae : Picornaviruses are small ( 28 30 nm ) , icosahedral, non enveloped, positive sense single stranded viruses with intracytoplasmic replication. The family Picornaviridae , and related Caliciviridae are in the orde r Picornavirales . The family Picornaviridae has 17 genera: Enterovirus , Cardiovirus , Aphthovirus , Hepatovirus , Parechovirus , Erbovirus , Kobuvirus , Teschovirus , Sapelovirus , Senecavirus , Tremovirus , Avihepatovirus, Aquamavirus, Cosavirus, Dicipivirus, Megri virus, and Salivirus (Knowles et al. 2012, Lauber and Gorbalenya 2012) . The genera Orthoturdivirus , Paraturdivirus , Pasivirus , and Hungarovirus have been proposed (Woo et al. 2010, Reuter et al. 2012, Sauvage et al. 2012, Phelps et al. 2014) . The order Picornavirales are highly stable in and well adapted for marine environments (Lang et al. 2009) . In mammals, Picornaviruses cause many important diseases, including encephalomyocarditis, poliomyelitis, hepatitis A, and foot and mouth disease (Knowles et al. 2012) . In pinnipeds, Aquamavirus A in the genus Aquamavirus has been found in nasal swabs from apparently healthy ringed seals ( Phoca hispida ) (Kapoor et al. 2008) . In 2011, Li et al. found 2 different picornaviruses in the genus Sapelovirus in fecal swabs from California sea lions ( Z alophus californianus ), provisionally called Califor nia sea lion sapelovirus 1 (Csl SapV1) and California sea lion sapelovirus 2 (Csl SapV2) (Li et al. 2011) . The clinical significance of p icornaviruses in pinnipeds remains to be determined. Paramyxoviridae : Paramyxoviruses are large ( 150 300 nm ) , pleomorphic , enveloped, negative sense single stranded viruses with intracytoplasmic and intranuclear replication. The family Paramyxoviridae is i n the order Mononegavirales (King et al. 2012 ) . This family has 2 subfamilies: Paramyxovirinae and Pneumovirinae .

PAGE 29

29 The subfamily Paramyxovirinae has 7 genera: Aquaparamyxovirus , Ferlavirus , Rubulavirus , Avulavirus , Respirovirus , Henipavirus , and Morbillivirus . The subfamily Pneumovirinae has 2 genera, Pneumovirus and Metapneumovirus . Sunshine virus, a paramyxovirus of snakes, does not cluster within either subfamily and may represent a novel subfamily; phylogenetic analyses includ ing this virus suggests that Paramyxovirinae and Pneumovirinae may not be monophyletic (Hyndman et al. 2012) . This family causes important respiratory, neurologic , and multisystemic diseases in mammals (Wang et al. 2012) . In marine mamma ls, large mortality events have been caused by viruses in the genus Morbillivirus (Di Guardo et al. 2005) . Canine Distemper Virus (CDV), a Morbillivirus , causes multisystemic respiratory, neurologic, enteric, and cutaneous disease (Murphy et al. 1999) . CDV has been reported in Canidae (wolf, fox, coyote, etc) as well as other members of the Carnivora, including Phocidae, Otariidae, Ailuridae, Mustelidae, Mephitiidae, Hyaeni dae, Ursidae, Procyonidae, Viverridae, Herpestidae, and Felidae (Fix et al. 1989, Appel et al. 1994, Van Moll et al. 1995, Cunningham et al. 2009) . It has also been seen outside the Carnivora, including an outbreak in old world primates (Sakai et al. 2013) . In marine mammals, 6 morbilliviruses have be en described: CDV, Phocine distemper virus (PDV), Porpoise Morbillivirus (PMV), Dolphin Morbilliirus (DMV), Pilot Whale Morbillivirus (PWMV), and Longm beaked whale Morbillivirus (LBWMV) (McCullough et al. 1991, Taubenberger et al. 2000, Di Guardo et al. 2005, West et al. 2013) . In pinnipeds, there have b een reported cases of PDV, DMV and CDV (Di Guardo et al. 2005) . In general, most morbillivirus clinical signs are similar to CDV, with ocul ar/nasal discharge, respiratory signs, diarrhea, and abortions. At necropsy, severe pneumonia is frequently found. The first

PAGE 30

30 mass mortality event reported to be caused by a morbillivirus occurred in the late , harbor seals ( Phoca vitulina ) a nd gray seals ( Halichoerus grypus) from Europe were affected, causing the d eath of 18,000 23,000 animals. In thi s case, the cause was the new P D V (Osterhaus et al. 1990, Di Guardo et al. 2005, Härkönen et al. 2006) . In 1987 88, another massive CDV mortality event killed thousands of B aikal seals ( Phoca sibirica ) in Siberia (Osterhaus et al. 1989) . In 2000, 10,000 Caspian seal ( Phoca caspica ) deaths were found to be due to CDV (Kennedy et al. 2000, Kuiken et al. 2006) . In 1997, a morbillvirus was isolated from several animals in a massive mortality event that affected the critically endangered Mediter ranean monk seal ( Neomonachus schauinslandi ). This event wiped out 50 % of the largest colony of this species in Mauritania, Africa (Osterhaus et al. 1997, Van de Bildt et al. 1999) . This virus is closely related to DMV; cases of DMV we re reported in dolphins from that are a before this massive mortality event (Osterhaus et al. 1997) . Further analysis of these cases indicated that the cause of this massive mortality event may have been algal toxins rather than morbillivirus (Harwood 1998, Hernández et al. 1998) . In 200 2, another m assive mortality event due to PD V occurred in harbor seals in Europe, with 30,000 deaths (Härkönen et al. 2006) . Rhabdoviridae : Rhabdoviruses are large (180 x 75 nm), bullet shape d , e n veloped, negative sense single stranded viruses with intra cytoplasmic replication in the order Monogenavirales (King et al. 201 2 ) . The family Rhabdoviridae has 8 genera : Vesiculovirus , Lyssavirus , Ephemerovirus , Cytorhabdovirus , Novirhabdovirus , Nucleorhabdovirus , Perhabdovirus , and Tibrovirus (Dietzgen et al. 2012) . In the genus Lyssavirus , one of the most importan t viruses is rabies virus. This virus affects diverse

PAGE 31

31 mammals and is an impor tant zoonosis. In marine mammals, rabies has been reported in one ringed seal ( Pusa hispida ) during an epidemic that affected three reindeer ( Rangifer tarandus platyrhynchus ) and several arctic fox ( Vulpes lagopus ) (Odegaard and Krogsrud 1981) . Reoviridae : Reoviruses are medium sized (60 80 nm), icosahedral shaped, non enveloped , double stranded viruses with intra cytoplasmic replication. The family Reoviridae has 2 subfamilies and 14 genera. The subfamily Spinareovirinae has 8 genera: Orthoreovirus , Aquareovirus , Oryzavirus , Fijivirus , Mycoreovirus , Cypovirus , Dinovernavirus , and Coltivirus . The subfamily Sedoreovirinae has 6 genera: Orbivirus , Rotavirus , Seadornavirus , Phytoreovirus , Cardoreovirus , and Min oreovirus . The f amily Reoviridae has a wide range of hosts, from plants to vertebrates. Reoviruses can be transmitted by arthropod vectors or by oral fecal route (Attoui et al. 201 2 ) . In domestic animals, reoviruses cause a wide range of diseases, including enteritis, bluetongue, abortion, encephalitis, an d epizootic hemorrhagic disease (Murphy et al. 1999) . In marine mammals onl y one reovirus has been found, an orthoreovirus from an aborted Steller sea lion ( Eumetopias jubatus ). This virus was tentatively named Steller sea lion reovirus (SSRV) (Palacios et al. 2011) . Retroviridae : are medium sized (80 100 nm) spherical or ple omorphic enveloped viruses with a unique replication strategy involving reverse transcription genome. The family Retroviridae has two subfamilies: Orthoretrovirinae and Spumaretrovirinae . The subfamily Orthoretrovirinae has 6 genera: Alpharetrovirus, Betaretrovirus, Gammaretrovirus, Del taretrovirus, Epsilonretrovirus , and Lentivirus. The subfamily Spumaretrovirinae has 1 genus: Spumavirus. Retroviruses are widely

PAGE 32

32 dispersed among vertebrates, and can constitute up to 10% of genomic DNA (King et al. 2012) . Some r etroviruses can cause lethal diseases. The most recognized retroviruses are in the genus Lentivirus , including Human immunodeficiency viruses 1 and 2, Maedi/Visna, Feline immunodeficiency virus , and others. Another genus important for small animal practitioners is Gammaretrovirus . This genus contains Feline leukemia virus. In marine mammals, gammaretroviruses have been reported in killer whales (Orcinus orca) (LaMere et al. 2009) and Bottlenose dolphins (Tursiops truncatus) (LaMere e t al. 2009) . Viruses of the subfamily Spumaretrovirinae have not been associated with clinical disease. A foamy virus has been reported in a male California sea lion (Zalophus californianus) (Kennedy Stoskopf et al. 1986) with a skin lesion and a concomitant herpes virus infection in lung tissue. The final cause of death was attributed to P asteurella multocida pericarditis and septicemia. The authors suggested that the persistent infect ion with the foamy virus could have led to an immunosuppression and subsequent infection with Pasteurella multocida (Kennedy Stoskopf et al. 1986) . DNA Viruses Adenoviridae : Adenoviruses are medium si zed (70 90 nm) icosahedral, non enveloped, d ouble stranded DNA viruses with intranuclear replication (Harrach et al. 2011) . The family Adenoviridae is composed of 5 genera; Mastadenovirus , Aviadenovirus , Atadenovirus , Siadenovirus , and Ichtadenovirus (Harrach et al. 2011) . Recently, a sixth genus has been proposed for the adenoviruse s of testudinoid turtles: Testadenovirus (Doszpoly et al. 2013) . Adenoviruses infect a wide range of vertebrates, sh owing relatively high host specificity at the genus level: Ichtadenovirus infect s a single actinopterygian fish, Mastadenovirus infect s mammals, and Aviadenovirus infect s birds.

PAGE 33

33 In humans, mastadenoviruses have been associated with outbreaks of respiratory disease in military barracks (Gray et al. 2000, McNeill et al. 2000, Ecker et al. 2005) , conjunctivitis (Jawetz 1959) , and infantile gastroenteritis (Yolken et al. 1982) . In immunocompromised patients, mastadenoviruses have been related to fulminant hepatitis, pneumonia, and encephalitis (Krilov 2005) . Different species of mastadenoviruses cause respirato ry diseases in several domestic animals (Almes et al. 2010, Giles et al. 2010, Roshtkhari et al. 2012) (Murphy et al. 1999) . Canine adenovirus 1 (CAdV 1) causes v iral hepatitis in dogs (Murphy et al. 1999) . In wildlife, mastadenoviruses have been reported in bats (Li et al. 2010, Kohl et al. 2012, Raut et al. 2012) and squirrels (Eve rest et al. 2009, Everest et al. 2010, Peters et al. 2011, Everest et al. 2012) . Canine adenovirus 1 has been reported in several carnivore species: bears (Pursell et al. 1983) , river otters (Park et al. 2007) , and different species of foxes around the world (Gerhold et al. 2007, Thompson et al. 2010, Balboni et al. 2012) . In marine mammals, adenoviruses have been reported in cetaceans (Smith and Skilling 1979, Smith et al. 1987) , polar bears (Woods et al. 2001) , and pinnipeds (Dierauf et al. 1981, Goldstein et al. 2011, Inoshima et al. 2013) . Adenoviruses have only been genetically confirmed in pinnipeds (Goldstein et al. 2011) . This virus has been implicated as a cause of v iral hepatitis in wild California sea lions (Zalophus californianus (Britt Jr et al. 1979, Dierauf et al. 1981, Goldstein et al. 2011) , but recent studies have also found this virus in association with viral hepatitis in other otariid species in an aquarium in Japan: a South American sea lion ( Otaria flavescens ) and a South African fur seal ( Arctocephalus pusillus ) (Inoshima et al. 201 3) .

PAGE 34

34 Anelloviridae : Anelloviruses are small (30 n m ), icosahedral, non enveloped, single stranded viruses with intranuclear replication. The family Anelloviridae has 9 genera: Alphatorquevirus, Betatorquevirus, Gammatorquevirus, Deltatorquevirus, Epsilontorquevirus, Zetatorquevirus, Etatorquevirus, Thetatorquevirus , and Iotatorquevirus. Anelloviruses have been associated with respiratory and liver diseases, hematological disorders, and cancer. In veterinary medicine, anelloviruses have been found i n several animals . Some genera have been found in humans, and others in domestic and wild animals (Biagini et al. 2012 ) . The gen us Iotatorquevirus contains swine anellovirus and a California sea lion anellovirus. In marine mammals, anelloviruses have been found in pinnipeds (Ng et al. 2009, Ng et al. 2011) and cetaceans (Wellehan, personal communication). In pinnipeds, anelloviruses were detected during a respiratory outbreak in a zoological facility. An anellovirus was isolated from lung tissue from California sea lions ( Zalophus californianus ) that died in the outbreak. This virus was name d Zalophus californianus anellovirus (ZcAV). This virus was not isolated from animals from the same facility that died from other reasons. In the same study, the author also found a low prevalence of the virus in lung tissue (11%) from wild California sea lions (Ng et al. 2009) . A second anellovirus was found in Pacific harbor seals ( Phoca vitulina richardsii ). This virus was named seal anellovirus (SealAv), SealAv was found in lung tissue from dead animals, from two mortality events, but not in all animals tested. More study is necessary to understand the clinical significance of anelloviruses in wild marine mammal populations (Ng et al. 2011) Asfarviridae : Asfarviruses are large ( 175 215 nm ) icosehedral, enveloped, double stranded DNA viruses with intra cytoplasm ic replication . The family Asfarviridae

PAGE 35

35 has just one genus, Asfivirus , containing one species, African swine fever virus . This tick borne virus causes African swine fever and is found in wild and domestic suids. In marine mammals, an asf ar like sequence was found in pinnipeds using second generation sequencing in 1/47 animals analy z ed (Li et al. 2011) Herpesviridae : Herpesviruses are large (160 300 nm), icosahedral, enve loped, double stranded viruses with intranuclear replication. The order Herpesvirales has 3 families: Alloherpesviridae , Herpesviridae , and Malacoherpesviridae . Alloherpesviruses infect fish and amphibians, and m alacoherpesviruses infect molluscs. The family Herpesviridae infects tetrapods. This family has 3 subfamilie s and 13 genera. The subfamily Alphaherpesvirinae has 5 genera: Iltovirus, Mardivirus, Simplexvirus, Varicellovirus, and Scutavirus. The subfamily B etaherpesvirin ae has 4 genera : Cytomegalovirus, Muromegalovirus, Proboscivirus , and Roseolovirus , and the subfamily Gammaherpesvirin ae also has 4 genera: Lymphocryptovirus, Macavirus, Percavirus , and Rhadinovirus (Pellett et al. 2012 ) . In general, herpesviruses are considered to be host specific, but some cases of host jumping have been reported (Pellett et al. 2012 ) . Herpesviruses can be latent in different sites, with certain subfamily tendencies; alphaherpesviruses have been found establish in latency in neurons, betaherpesviruses in monocytes, and gammaherpesviruses in lymphocytes (Pellett et al. 2012 ) . Herpesviruses infect a wide range of vertebrates (Pellett et al. 2012 ) . In wildlife, herpesvirus in elephants have recently received attention. There have been more than 6 herpesviruses described in eleph ants (Atkins et al. 2013, Zachariah et al. 2013) (Wellehan et al. 2008) . The first reported is a betaherpesvirus in the genus Proboscivirus (EEHV1) causing lethal and acute disease in young Asian elephants

PAGE 36

36 ( Elephas maximus) (Ossent et al. 1990) . Recent work has shown that probosciviruses are present in wild population s , arguing ag ainst the original hypothesis of an transmission from African elephants ( Loxodonta africana ) to Asian elephants (Zachariah et al. 2013) . In marine mammals, more than 19 herpesvirus have been reported (Maness et al. 2011) ; one in manatees (TrHV 1) (Wellehan et al. 2008) , 11 in cetaceans (Maness et al. 2011) , 8 in pinnipeds (Maness et al. 2 011, Venn Watson et al. 2012) , and one in polar bears, a host jump of Equine herpes virus 9 ( EHV 9) (Donovan et al. 2009) . In pinnipeds, herpesvirus es have been found in Harbor seals ( Phoca vitulina ), grey seals ( Halichoerus grypus ), harp seals ( Phoca groenlandica ), Hawaiian monk seals ( Neomonachus schauinslandi ), Northern elephant seals ( Mirounga angustirostris ), California sea lions ( Zalophus californianus ), and South American fur seals ( Arctocephalus australis ) (Stenvers et al. 1992, Lipscomb et al. 2000, King et al. 2002, Goldstein et al. 2003, Goldstein et al. 2004, Aguirre et al. 2007a) (Osterhaus et al. 1985, Goldstein et al. 2006a, Goldstein et al. 2006b, Maness et al. 2011) . One of the most clinically significant is Phocid herpes virus 1 (PhHV 1) which was associated with a massive mo rtality event in harbor seals. Animals di ed of pneumonia and hepatitis. In many of those animals, virus was isolated from affected tissue (Osterhaus et al. 1985) . In California sea lions (CSL), the most important he rpesvirus is Otarid Herpesvirus 1 (OtHV 1). This virus is associated with urogenital carcinoma in CSL (Lipscomb et al. 2000, King et al. 2002) , and is considered an important cause of death in wild populations (Colegrove et al. 2009) . OtHV 1 appear s capable o f jumping into other pinnipeds (South American fur seal, A rctocephalus australis ), also causing urogenital carcinoma in a zoo in the UK (Dagleish et al. 2012) . Two other herpesviruses may have

PAGE 37

37 some degree of clinical significance in CSL; OtHV 2 was associated with conjunctivitis, and OtHV 3, which was first identified in an animal with lymphoma, but then was found to have a high prevalence (30.7 %) in healthy CSL (Maness et al. 2011, Venn Watson et al. 2012) . Parvoviridae : Parvoviruses are small (21 26 nm), icosahedral, non enveloped, single stranded viruses with intranuclear replication. The family Parvoviridae has 2 subfamilies and 9 genera. The subfamily Parvovirinae has 5 genera: Parvovirus , Erythrovirus , Dependovirus , Amdovirus , and Bocavirus . The subfamily Densovirinae has 5 genera: Ambidenosvirus , Iteravirus , Brevidensovirus , Densovirus , and Penstyldensovirus . Viruses from the subfamily Densovirinae infect invertebrates. Viruses in the subfamily Parvoviridae infect vertebrates, and in some cases need other viruses such as adenoviruses to complete their replication . Parvoviruses affect a wide range of tetrapods, causing enteritis, panleukopenia, repro ductive problems, respiratory disease, hepatitis, and myocarditis (Murphy et a l. 1999) . In marine mammals, members of the subfamily Parvovirinae have been reported in pinnipeds, using second generation sequencing from fecal swabs of CSL. The authors found Parvovirus in 3/47, and four novel bocaviruses, named California sea lion b ocavirus (Csl BoV1 to Csl BoV4), in 18/47 animals (Li et al. 2011) . The clinical significance of these viruses in pinnipeds remains unclear. Papillomaviridae : Papillomaviruses are small ( 55 nm) icosahedral, non enveloped, double stranded viruses with intranuclear replication. The family Papillomaviridae has 29 genera , named after the Greek alphabet, then appending the (Bernard et al. 2010) . Papillomaviruses

PAGE 38

38 are found in squamous epithelium, where they can cause proliferative lesions. Some papillomavirus lesions have the potential to progress to malignancy, as is the case with some human papillomaviruses (HPV 5, HPV 8, HPV 16, HPV 18, and others). In marine ma mmals, papillomaviruses have been found in manatees (Bossart et al. 2002, Rector et al. 2004, Halvorsen and Keith 2008, Ghim et al. 2014) , cetac eans (De Guise et al. 1994, Van Bressem et al. 1 999a, Van Bressem et al. 1999b, Rehtanz et al. 2006, Robles Sikisaka et al. 2012) , and pinnipeds (Rivera et al. 2012) . In pinnipeds, th e first report was from CSL (Rivera et al. 2012) . Aut hors reported two cases of cutaneous papillomatosis with no signs of systemic disease and lesions that resolved with supportive care. A novel papilloma virus called Zalophus californianus papillomavirus 1 (ZcPV1) was fully sequence d and is considered a member of the genus Dyonupapillomavirus (Rivera et al. 2012) . Polyomaviridae : Polyomaviruses are sma ll (40 45 nm), icosahedral, non envelop e d , double stranded viruses with intranuclear replication. The family Polyomaviridae has three genera: Avipolyomavirus , Orthopolyomavirus , and Wukipol yomavirus. Polyomaviruses may e stablish latent infections in various tissues , such as tonsils, bone marrow or lymph nodes. Some polyomaviruses are significant pathogens, such as murine pneumotropic polyomavirus (MPtV), which cau ses mortalities in newborn m ice (King et al. 2012) . There is a report of a relation between b rain tumors and a polyomavirus in raccoons (Cruz Jr et al . 2013) . Polyomaviruses have been found in pinnipeds (Colegrov e et al. 2010, Wellehan et al. 2011b) . The first report was of a female CSL ( Zalophus californianus ) that was found stranded. The animal presented with advanced renal disease, intestinal lymphoma, and a glossal

PAGE 39

39 mass. Polyomavirus was found only in the glossal mass and was interpreted as unlikely to be the cause o f the death of this animal. Reactivation o f latent virus due to the immunocompromise d state of the female CSL was considered likely (Colegrove et al. 2010) . A follow up stu dy obtained the complete genome of the virus and it was named California sea lion polyomavirus 1 (CSLPyV 1) (Wellehan et al. 2011b) . A qPCR assay found a prevalence of 24% in stranded animals and 0% in animals from an open managed collection, consistent with the hypothesis of reactivation in weakened animals. Poxvirida e : Po xviruses are large (140 260x220 450 nm), brick or ovoid shaped, enveloped double stranded viruses with intracytoplasmic replication. The family Poxviridae has 2 subfamilies and 12 genera. The subfamily Chordopoxvirinae includes viruses that infect chordate s , and currently has 9 genera: Avipoxvirus, Capripoxvirus, Cervidpoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus, and Yatapoxvirus . The subfamily Entomopoxvirinae includes viruses t hat infect invertebrates, and currently has 3 genera: Alphaentomopoxvirus, Betaentomopoxvirus , and Gammaentomopoxvirus (Skinner et al. 2012) . Viruses in the subfamily Chordopoxvirinae can be transmitted directly, indirectly and by vectors. In general, viruses in this subfamily cause proliferative skin disease in vertebrates. Poxviruses in the genera Orthopoxvirus and Parapoxvirus have known zoonotic potential. In marine mammals, chordopoxviruses have been found in cetaceans (Smith and Skilling 1979, Van Bressem et al. 1999b, Bracht et al. 2006) , pinnipeds (Burek et al. 2005a, Bracht et al. 2006, Nollens et al. 2008a) , and sea otters (Tuo mi et al . 2014). Zoonotic infections from pinnipeds has been reported (Waltzek et al. 2012) . In CSL, poxviruses cause nodular or villonodular lesions in the skin, primarily

PAGE 40

40 around the head and neck. In general, this disease is self limit ing with debilitated or young animals affected (Nollens et al. 2006a, Nollens et al. 2006b) .

PAGE 41

41 Table 1 1 . Viruses in vertebrates and their existence in selected marine mammals . Virus Envelop e Shape Virion diameter (nm) Segment ed Intracellular replication site Size (Kb) Mammals Marine mammals Cetaceans Pinniped s DNA DS Adenoviridae N o icosahedral 70 90 N o N 26 48 x x x x DS Asfarviridae Y es icosahedral 200 250 N o N/C 170 190 x x x Herpesvirales* DS Alloherpesviridae * Y es Icosahedral 125 295 N o N 125 300 DS Herpesvirida e * Y es Icosahedral 125 240 N o N 125 300 x x x x DS Iridoviridae Y es/ N o icosahedral 120 350 N o C 140 303 DS Papillomaviridae N o icosahedral 55 N o N 5 8 x x x x DS Polyomaviridae N o icosahedral 40 45 N o N 5 8 x x x SS Anelloviridae N o icosahedral 30 N o N x x x x DS Poxviridae Yes pleomorphic 140 260x220 450 No C 130 375 x x x x SS Circoviridae N o icosahedral 17 2 4 N o N 1.7 2.3 x SS Parvoviridae N o icosahedral 21 26 N o N 4 6.3 x x x ds RT Hepadnaviridae Y es spherical 42 50 N o N 3 4 x x x RNA ss Arena viridae Y es helical 100 300 2 C 10 14 x ss Bunyaviridae Yes helical 80 120 3 C 11 21 x ss Deltaviridae Y es circular 36 43 N o N 1.7 x ss Orthomyxoviridae Y es helical 80 120 6 8 N 10 13.6 x x x Mononegavirales* ss+/ Bornaviridae* Y es icosahedral 50 60 N o N 8.9 x ss+/ Filoviridae* Y es helical 790 970x80 N o C 19.1 x ss+/ Paramyxoviridae* Y es helical 150 300 N o C 15 16 x x x ss+/ Rhabdoviridae* Y es helical 180x75 N o C 13 16 x x x x Nidovirales * N o ss+ Arteriviridae* Y es icosahedral 50 70 N o C 15 x ss+ Coronaviridae* Yes spherical 120 160 No C 27 32 x x x x ss+ Astroviridae N o icosahedral 28 30 No C 7.2 7.9 x x x x ss+ Caliciviridae N o icosahedral 30 38 No C 7.4 7.7 x x x ss+ Flaviviridae Y es icosahedral 45 60 No C 9.5 12.5 x x x* x ss+ Hepevir idae N o spherical 32 34 No C 7.2 x ss+ Nodaviridae N o icosahedral 30 2 C 3. 1 and 1.4 ss+ Picornaviridae N o spherical 30 No C 7.1 8.9 x x x ss+ Togaviridae Y es icosahedral 70 No C 9.7 11.8 x ds Birnaviridae N o icosahedral 60 2 C 7 ds Picobirnaviridae N o icosahedral 35 40 2 C 1.7 2.5 x x x ds Reoviridae N o icosahedral 60 80 10 12 C 16 27 x x x ss RT Retroviridae Y es spherical/ pleo morphic 80 100 2 (identical) N/C 7 11 kb x x x x N: nuclear replication C: cy toplasmatic replication * viruses member in the same order

PAGE 42

42 CHAPTER 2 CSLADV 1 GENOME AND PHYLOGENETIC ANALYSIS Introduction The family Adenoviridae are non enveloped , double stranded DNA viruses with a medium sized genome of 26 45 kbp. They replicate inside the host nucleus and form icosahedral virions with a diameter of approximately 70 90 nm . The family Adenoviridae is divided into five genera: Mastadenovirus , Aviadenovirus , Atadenovirus , Siadenovirus and Ichtadenovirus (Harrach et al. 2011) . Recently, a sixth genus, Testadenovirus , has been proposed for the adenoviruses of testudinoid turtles (Doszpoly et al. 2013) . Adenoviruses are often considered to be host specific viruses that co evolved along with their hosts (Harrach et al. 2011) . There is support for segregation between adenoviruses of mammals in the superorders Laurasiatheria and Euarchontoglires (Hall et al. 2012) . Two genera in particular are considered to be specific to host taxa: Mastadenoviruses have o nly been found in mammalian species and Aviadenoviruses have only been found in avian hosts. White sturgeon adenovirus is currently the sole known member of Ichtadenovirus (Harrach et al. 2011) . However, reported crossover between related hosts was demonstrated with titi monkey adenovirus 1 (TMAdV 1) in a research facility. TMAdV 1 caused severe respiratory disease in titi monkeys, with monkey to hu man transmission (Chen et al. 2011) , providing strong evidence that host species jumping is possible for adenoviruses. Within the family Adenovir idae , the taxonomy and demarcation of species in the genus Mastadenovirus is currently based on DNA polymerase amino acid sequences with the inclusion of other criteria if needed (Harrach et al. 2011) . Sequence differences greater than 15% are considered to be a new species, and lower than 5% are

PAGE 43

43 considered to be a new type within a species (Harrach et al. 2011, Kohl et al. 2012) . Mastadenoviruses affect a wide range of mammalian species, including human and non human primates, domestic and wild animals. I n humans, seven species with 67 different mastadenovirus types have been identified (Harrach et al. 2011, Matsushima et al. 2013) . Human mastadenoviruses have been associated with outbreaks of respiratory disease in military barracks (Gray et al. 2000, McNeill et al. 2000, Ecker et al. 2005) , conjunctivitis (Jawetz 1959) , and infantile gastroenteritis (Yolken et al. 1982, Matsushima et al. 2013) . Mastadenoviruses have also been associat ed with fulminant hepatitis, pneumonia, and encephalitis in immunocompromised patients (Krilov 2005) . In domestic animals, some mastadenoviruses can cause respiratory disease in horses (Giles et al. 2010, Cavanagh et al. 2012) , cattle (Roshtkhari et al. 2012) , pigs, sheep, and goats (Murphy et al. 1999) . In canids, c anine adenovirus 2 (CAdV 2, in the species Canine mastadenovirus A ) causes respira tory disease and c anine adenovirus 1 (CAdV 1, also in the species Canine mastadenovirus A ) causes viral hepatitis (Murphy et al. 1999) . In wildlife, novel mastadenoviruses have also been reported in bats (Li et al. 2010, Kohl et al. 201 2, Raut et al. 2012) , rodent s (Everest et al. 2009, Everest et al. 2010, Peters et al. 2011, Phan et al. 2011, Everest et al. 2012) , tree shrews (Schoeb and DaRi f 1984) , and non human primates (Wevers et al. 2011, Hall et al. 2012) . Adenovirus seropositivity has also been reported in several species in the order Carnivora , mostly reacting to CAdV 1 (Dunbar et al. 1998, Woods et al. 2001) . One hypothesis for the seropositivity to non endemic adenoviruses is cross reactivity of antibodies to unknown closely related adenoviruses. However, rece nt publications with sequence based identification support the presence of CAdV 1 in red fox ( Vulpes

PAGE 44

44 vulpes ), gray fox ( Urocyon cinereoargenteus ), and Eurasian river otter ( Lutra lutra ) (Gerhold et al. 2007, Thompson et al. 2010, Balboni et al. 2012) . CAdV 2 has also been detected in the same red fox population (Balboni et al. 2012) . The presence of CAdVs in several carnivoran species also goes against the general assumptions of host specificity of adenoviruses. A recent report suggest s that CAdV 1 and CAdV 2 may have originated from a host jump of an adenovirus from a bat host (Kohl et al. 2012) . In general, larger intranuclear DNA viruses cause less significant clinical disease in endemic hosts; the h ypothesis of CAdVs jumping from a bat host could explain the high pathogenicity of canine adenoviruses in their apparent endemic host, and the reports of seropositive animals in diverse carnivores (Kohl et al. 2012) . In m arine mammals, adenoviruses have been detected in cetaceans and California sea lions (Woods et al. 2001, Goldstein et al. 2011) . Serological surveys performed on serum from several pinniped species showed evidence of antibodies binding CAdV 1 or CAdV 2 in Steller sea lions ( Eumetopias jubatus ) and walrus ( Odobenus rosmarus ) (Philippa et al. 2004, Burek et al. 2005b) . As with terrestrial carnivorans , this could be due to cross reactivity or an actual jump. Adenoviral disease in California sea lions ( Zalophus californianus ) was first reported in the late 1970s, without genetic identification of the virus (Britt Jr et al. 1979) . Due to similarities in virus morphology and clinical presentation, CAdV 1 has been suggested as the possibl e etiologic agent of viral hepatitis in California sea lions . In 2011, however, viral sequences obtained from two stranded California sea lions with viral hepatitis and infection of endothelium of several blood vessel in different organs, showed that they were different from CAdV 1 and represented a new member of the genus

PAGE 45

45 Mastadenovirus (Goldstein et al. 2011) . The virus was named California sea lion adenovirus 1 ( CSLAdV 1). CSLAdV 1 was also detected in California sea lions in 2011 from two an imals from an open water managed collection, with clinical signs of viral hepatitis that resolved under supportive care. Recent work has found that CSLAdV 1 has the ability to jump hosts into other pinniped species housed in the same aquarium, but in diffe rent pools (Inoshima et al. 2013) . In the following work, we present the complete genome of CSLAdV 1, its phylogenetic characterization, and discuss the implications of our findings. Specific Aims CSLAdV 1 has been placed in the genus Mastadenoviru s . The o riginal phylogenetic analysis found CSLAdV 1 from California sea lions (Superorder: Laurasiatheria ) to be the sister taxa group to TsAdV 1 from tree shrews (Superorder: Euarchontoglires ) (Goldstein et al. 2011) . If we take into consider ation the co evolutionary hypothesis, this relationship is suggestive of a host jump . This work will present a complete phylogenetic analysis to identify the most likely origin and evolutionary history of CSLAdV 1. Also, a comparative analysis of the genome of this adenovirus comparing common genes with other related adenoviruses was conducted . Following this, we calculate the GC% to determine whether a host jump is supported by this approach. It has been found that recent host jumps are associated with lowe r GC% compared to viruses that have a coevolved tightly with their host. Specific Aim 1: Determine phylogenetic relationships between CSLAdV 1 and other adenoviruses Hypothesis 1: CSLAdV 1 phylogeny will follow a co diversification pattern Hypothesis 2: CS LAdV 1 phylogeny will be con sistent among data sets and analyses

PAGE 46

46 Specific Aim 2: Compare the complete genome of CSLAdV 1 with other adenoviruses of the same genus Hypothesis 3: CSLAdV 1 will present high conservation in the core proteins with other mastadenoviruses, with greater differences at the end s of the genome Hypothesis 4: CSLAdV 1 will present a high GC% content suggesting a long term co evolution with it host Hypothesis 5: Evidence of recombi nation events will not be found Materials and Methods Samples The fecal sample used for genomic sequencing was from a California sea lion in an open water managed collection. This animal presented wi th diarrhea and anorexia; and frozen fecal material was submitted for viral diagnosis in 2011. DNA was extracted using a commercial kit (DNeasy Blood and Tissue Kit, Qiagen Inc., Valencia, CA , USA ). The initial PCR identification was done using consensus adenovirus primers that target a conserved region of the DNA polymerase gene (Wellehan et al. 2004) . Genome Sequence The genome of CSLAdV 1 was sequenced using a primer walking approach. We designed consensus primers based on other mastadenoviruses using laurasiatherian hosts to obtain new sequences (Table 2 1) and specific primers to fill gaps between known sequences. More than 150 specific primers were designed (Table 2 2). To determine whether a sequence corresponds to an adenovirus sequence, we used BLASTX, this tool allow s the nucleotide sequence translated into the 6 open reading frames to be compare d to a non redundant protein database (Altschul et al. 1990) . PCR Conditions The conditions of the PCR were modified for each primer set according to the melting temperature of each set of primers and the amplicon size. For fragments

PAGE 47

47 expected to be over 1000 bp, we used Takara Ex Taq TM (Hot Start Version, Takara Bio Inc., Otsu, Japan ) for PCR. For fragments expected to be smaller than 1000 base pairs, we used Platinum Taq ® D NA Polymerase ( Platinum Taq DNA polymerase, Invitrogen, Carlsbad, CA, USA). of denaturation at 95 C for 1 min, annealing at 6 C below the manufacturer predicted melting temperature of the se t of primers for 30 s, and extension at 72 C for a time determined by the length of the expected sequences, followed by a final elongation step at 72 C fo r 7 min. PCR products were run o n a 1% agarose gel. Fragments of the expected size were cut and extrac ted using QIAquick Gel extraction kits (Cat No 28706, QIAGEN, Valencia, CA, USA ). The gel extracted PCR products were sequenced in both directions using ABI 3130 DNA sequencers (Life Technologies, Carlsbad, CA ). Genomic and Protein Sequence Annotation Se quence assembly was done by hand and confirmed using the program CLC Genomics Workbench 4 (CLC Bio, Aarhus, Denmark) . Open reading frames were predicted using CLC Genomics Workbench and then re confirmed in the program Geneious (Biomatters Ltd., Auckland, New Zealand) using Glimmer . H omologies to other known proteins were determined using BLASTP (Altschul et al. 1990) . Splicing sites for proteins for which splicing has been previously shown were estimated based on homologous adenoviral sequences and the use of NNSPLICE (Reese et al. 1997) . Phylogenetic Reconstruction Al ignment Five conserved proteins in the core area of the CSLAdV 1 genome were chosen; 3 non structural proteins (polymerase, pTP and p100K) and two structural proteins

PAGE 48

48 (penton and hexon). Thirty five fully sequenced adenoviruse s were selected from GenBank; 22 mastadenoviruses, five aviadenoviruses, four atadenoviruses, four siadenoviruses, and CSLAdV 1 (Table 2 3). Inclusion criteria were based on availability of the selected proteins for all taxa, and selection of taxa which had previous phylogenetic analys es incorporated in publications (Cavanagh et al. 2012, Kohl et al. 2012) . Homologous amino acid sequences of each independent protein were aligned using MAFFT using default settings (Katoh and Toh 2008) . Recombination analysis For the recombination analyses , the cor e regions of 11 fully sequenced mastadenoviruses were aligned in SeaView version 4 (Gouy et al . 2010) using the Muscle algorithm (Edgar 2004) . SeaView aligned genomic nucleotide sequences from selected mastadenoviruses were examined to look for evidence of recombination using RDP4 Beta 4.33 (Martin et al. 2010) . Recombination events detected by four or more methods were considered significant. As an additional approach to recombination detection, we conducted a PHI test for recombination using a network approach (Huson and Bryant 200 6 ) . Fo r this analysis we used the SeaView nucleotide sequence alignment as well as the final concatenated amino acid MAFFT alignment. Model selection Models of evolution were evaluated using a corrected Aikake informati on criteria (AICc) in ProtTest 3.2 to determine the best amino acid substitution model (Darriba et al. 2011) . Analysis of phylogenetic signal As a additional analysis to evaluate the presence of phylogenetic signal; all proteins were tested independently using li kelihood mapping in Tree Puzzle 5.2

PAGE 49

49 (Schmidt et al. 2002) . This test selects randomly for sequences from the pool of taxa and estimates which one of the three possible un rooted tree topologies is most likely using Maximum Likelihood. The result draws a triangle in whi ch each corner represents an un rooted topology and the center represents the lack of resolut ion in the topology. If the topology is not resolved, then it is considered a lack of phylogenetic signal when the percentage in the center of the triangle is higher than 33 34%; this analysis additionally provides information about the percentage of infor mative sites in the sequence. Phylogenetic relations The best model of evolution available was implemented in the Bayesian analyses of the amino acid alignments, performed using MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003) on the CIPRES server (Miller et al. 2011) . For the Bayesian analyses, four chains were run; each one for 1,000,000 generations; three hot chains and one cold chain with the default heating parameter (temperature = 0.2) . Convergence among different run s was evaluated by calculating the average split deviation using a threshold of 0.02 %. Chains were sampled every 100 generations and the first 20% of MCMC samples was discarded as a burn in. To determine whether this number of generations was adequate and calculate whether we had effective sample sizes (ESS) we used the program TRACER 1.5 (Rambaut and Drummond 2013) . To evaluate whether different tree topologies generated with different proteins were statistically different, Bayes factors were examined. Because the trees o f individual proteins showed no significant differences in topology, we used a concatenated analysis. Poorly aligned sequences were removed from the concatenated data using Gblocks in the Gblocks server (Talavera and Castresana 2007) . Final concatenated sequences were also tested for phylogenetic signal using likelihood mapping in Tree -

PAGE 50

50 Puzzle 5.2 (Schmidt et al. 2002) . Bayesian analysis was performed on the concatenated data with the best model of evolution available, fo llowing the same protocol mentioned above. The final tree was a maximum clade credibility tree obtained in Tree Annotator (Rambaut and Drummond 2007) . Maximum Likelihood analysis was run in PhyML 3.0 (Gui ndon et al. 2010) with the best model of evolution according to AICc, using 1000 bootstrap replicates to test the strength of the tree topology (Felsenstein 1985) . Trees were edited using FigTree v1.3.1. (Rambaut 2010) Results Genome The genome of CSLAdV 1 (Gene Bank: KJ 563221) has 31,709 base pairs (bp) plu s regions corresponding to the I TR primers that are expected to be 23 bp on each end (Figure 2 1). CSLAdV 1 has a GC content of 36% and the core region is similar to several mastadenoviruses including CAdV 2, BtAdV 1, BadV B , and HAdV 2 (Table 2 4). The predicted hexon has an additional 97 amino acids (aa) in hypervariable region seven. The predic ted p rotein V , a structural protein, has a 113 aa region at the amino terminal end that appears to be a duplication not seen in other adenoviruses; it shares 49.55% amino acid identity with the next 125 aa . Unfamiliar proteins were found at the inc luding a dUTPase that is more related to dUTPases of baculoviruses, poxviruses, polydnaviruses, and eukaryotes than those of adenoviruses, and 3 unknown ORFs: a predicted 37.9 kDa E3 protein with weak homology to bacterial arylsulfatase s , a predicted 10kDa E3 protein, and a predicted 15kDa E4 protein. In addition, the predicted fiber protein has a divergent C terminal end with homology to adhesive molecules found in Trypanosoma cruzi and Staphylococcus pneumoniae .

PAGE 51

51 Phylogenetic Analysis Recombination Recombi nation analysis using RPD4 beta 4.33 did not show evidence of recombination in the CSLAdV 1 genome supported by 4 or more recombination algorithms. The result was confirmed with the P HI test, that also does not support the hypothesis of recombination for t his data set (p=1.0). Analysis of phylogenetic signal None of the analyses of the individual proteins or the concatenated data set show evidence of lack of phylogenetic signal . N one of them had star like signal higher than 33 34%; this result indicate s that in most of the subsets of four taxa produced a resolved un rooted topology occurred , and in a low percentage of the cases an un resolved topology or star like signal was generated (Table 2 6). Other important information obtained from this analysis is the presence of a high percentage of informative sites along the sequence, as demonstrated by a low percentage of constant sites (Table 2 6). Model selection The final tree was done with a total length of 2 377 predicted amino acids. For this final analysis , we used the best model available in Mr. Bayes (RtREV+G+I+F), since the LG model is not implemented; for the ML analysis we used LG+G+I+F (Table 2 7). Phylogenetic relations hips In order to evaluate whether topology differences between trees are significa nt , we used Bayes factor estimations from all five individual proteins. For each protein we first used a non stop rule , then verified using ESS to evaluate whether the chain had run long enough (F igure 2 8). Results of this analysis did not support th e s e t opology

PAGE 52

52 differences, with Bayes factors lower than 3 (Table 2 9, Figures 2 3, 2 5, 2 7, 2 9, 2 11). T he t opology of Bayesian and Maximum Likelihood trees w ere consistent in the position of CSLAdV 1 (Figures 2 2 to 2 11). In order to obtain a close approxim ation of the genomic level phylogenetic tree that may reflect the true phylogenetic relationship for the taxa of interest, we used a concatenated analysis that incorporated the 5 proteins previously analyzed. This analysis is possible because we did not find evidence of recombination, and individual topologi es are not statistically different, as mentioned above. Since elimination of gaps reduced the signal for substitution saturation (data not shown) we eliminated all gaps from the concatenated data set using Gblocks. The Bayesian Maximum clade credibility (M CC) tree and ML present similar topologies (Figures 2 12 and 2 13 ) for the best models of evolution , and are consistent with other publications (Cavanagh et al. 2012, Hall et al. 2012, Kohl et al. 2012) . The p hylogram shows BAdV 3 is basal in the clade infecting Laurasiatheria and the sis ter taxa of CSLAdV 1 with good node support (98%), this topology it is found in all Bayesian trees using different m odel of evolution (F igures 2 14 and 2 15 ). However, most of the ML trees have the same topology, but low support of the node (25%) for LG+I+ G+F model of evolution (Figure 2 13 ) and 55% for WAG+I+G+F model of evolution (Figure 2 16 ) . In the case of the RtREV+I+G+F model of evolution, CSLAdV 1 is in the root of the Laurasiatheria as in previous analysis with a low support (44%) , but CSLAdV 1 do es not appear to be a sister taxa of BAdV 3 ( Figure 2 17). Discussion Here we present the first complete coding sequence for a marine mammal adenovirus, CSLAdV 1. This virus shows an unusually low GC content (36%) for a mastadenovirus (Table 2 10). The car boxy terminal end of the predicted fiber c ontains

PAGE 53

53 seven amino acid repeat While the carboxy terminal end of the predicted fiber does not show any homology to other adenoviral proteins, it shows 57% similarity to the carboxy terminus of a trans sialidase of T. cruzi and 45% similarity to choline binding protein A (CbpA) of S. pneumoniae . Those proteins are important virulence factors for these pathogens and are involved in adhesion t o host cells and immune evasion (Buscaglia et al. 1999, Hammerschmidt et al. 2007) . Whether the CSLAdV 1 fiber gene plays a similar role remains to be determined. This repeated motif also has similarities to that f ound in the latency associated nuclear antigen (LANA) of gammaherpesviruses, especially that of retroperitoneal fibromatosis herpesvirus of macaques (RFHVMn) (Burnside et al. 2006) . It has been found that intracellular protozoal parasites have higher repetitive content in their proteomes than protozoa that do not invade cells, and that their proteins with repetitive motifs tended to be associated with cell invasion (Mendes et al. 2013) . D UTPases are present in a wide diversity of organisms including archaea, eubacteria, eukaryotes, and viruses. The presence of this protein in viruses has been primarily explained by horizontal gene transfer (Baldo and McClure 1999) . D UTPase s hydrolyze dUTP into dUMP, a substrate for synthesis of dTTP. This keeps the dUTP:dTTP ratio low, preventing misincorporation of uracil into DNA. In some viruses, dUTPases have an important role en abling virus replication in non dividing cells (Pyles et al. 1992, Oliveros et al. 1999) . Viral dUTPases have mostly been studie d in poxviruses, herpesviruses and retroviruses (Chen et al. 2002) , but are also found in other adenoviruses, where they have been associated with oncogenic potential (Weiss et al.

PAGE 54

54 1997, Baldo and McClure 1999) . The predicted CSLAdV 1 dUTPase is more closely related to non adenoviral dUTPases than those of other adenoviruses. Phylogenetic analysis found it was fairly distantly related to dUTPases of other mastadenovi ruses, although dUTPases of aviadenoviruses were som ewhat closer (data not shown). This is most consistent with an independent horizontal gene transfer event. In our phylogenetic analysis, CSLAdV 1 is basal in a clade utilizing Laurasiatheria as hosts, and is a sister taxa to BAdV 3 . This is not consistent with the codiversification hypothesis for adenoviruses. Our phylogenetic analys e s do not show a consistent position of CSLAdV 1 among protein s , but our concatenated analysis does situate CLSAdV 1 in th e root of the laurasiatherian adenovirus tree; this topology is supported with different models of evolution and phylo genetic algorithms (Figures 2 12 to 2 17 ). This finding could be related to insufficient taxon sampling in this clade. However, a tanglegr am of host and virus phylogeny (Figure 2 18 ) illustrates the phylogenetic incongruence of this adenovirus with its host. The low genomic GC content of CSLAdV 1 also supports the host jump hypothesis. Low GC content has been related to recent host jumping e vents in diverse viruses (Wellehan et al. 2004, Poss et al. 2006, V an Hemert et al. 2007) . In addition, the genus Atadenovirus acquired its name because of the low GC content in the first members identified from ruminants, marsupials, and birds (32.35% to 47.43% GC content). Later work found a balanced GC content (43.75 to 58.09%) in squamates, as well as a broader and more basal phylogenetic distribution in the genus, indicating that squamates are more likely the original hosts and th at low GC content was associated with host jumping (Wellehan et al. 2004) . Rapid evolution associated with host jumps has been suggested to generate

PAGE 55

55 an AT bias in the genome of adenoviruses (Wellehan et al. 2004) . This could be a way to avoid the innate immunity of the new h ost through toll like receptors that recognize unmethylated CG dinucleotides (Aderem and Hume 2000) . All this information is consistent with the hypothesis that CSLAdV 1 may have recently jumped to California sea lions from an unknown mammalian endemic host. Further investigation of mastadenoviruses in diverse hosts is needed to better understand the origins of CSLAdV 1.

PAGE 56

56 Table 2 1. Consensus primers used to gene rate new CSLAdV 1 sequences . Primers Sequence ITRf CATCATCAATAATATACIGIRCA E1Ar TCRAANGCNAVNCKNARRTGNCKCAT IVa2Fa TAYGGNCCNACNGGNWSNGGIAA IVa2Fb GAYATGATHCCNCCNCARGA IVa2Rb YTCYTGNGGNGGDATCATRTC IVa2Fc GCNTGGGARRCNCARATHTGYGARGG IVa2Rc TTNCCYTCRCADATYTGNGYYTCCCA IVa2Fd AARTTYTTYCAYGCNTTYCC IVa2Rd ARYTTNSWNGGRAANGCRTGRAARAA 52KFa GGNYTNATGCAYYTNTGGGAYTT 52KFb GARAARGTNGCNGCNATHAAYTA 52KRb TARTTDATNGCNGCNACYTTYTC PolFa ACNTGGYTNGTNGARTGYGARAC PolRa GTYTCRCAYTCNACNARCCAIGT PolFb AARYTNMGNGCNAARGGNCAYGCIAC PolRb TTNGCNCKNARYTTNCCYTTNCCIAC IIIaRa ARNACYTTYTCRTGNGTIGG HexFa AAYAARTTYMGNAAYCCNACNGTIGC HexFb GNYTNCARYTNMGNTTYGTNCCIGT HexRc GCRTANSWNCCRTARCAIGG HexFd AAYGCNGTNGTNGAYYTNCARGA HexRd CKRTCYTGNARRTCNACNACIGC HexFe TTYCAYATHCARGTNCCNCARAA HexRe AAYTTYTGNGGNACYTGNATRTGRAA HexFf AAYTGGGCNGSNTTYMGNGGNTGG HexRf CCANCCNCKRAANSCNGCCCARTT HexFg GGNCAYCCNTAYCCNGCNAAYTGGCC HexRg GGCCARTTNGCNGGRTANGGRTG HexRh ACNCCNCKRTGNGGYTGRTG p100K1204F CAYGARAAYMGNBTIGGICA p100k1312F ACNGSNATGGGNRTNTGGCARCA p100K1318 F ATGGGNRTNTGGCARCARTKYYTIGA p100K1343R TCNARRMAYTGYTGCCANAYICCCAT p100K1559R TCNARRMAYTGYTGCCANAYICCCAT pVIII13F ATHCCNACNCCNTAYRTITGG pVIII76F GAYTAYWSNACNMRNATNAAYTGG pVIII433R CCNCCNSCNARYTGRAANABICCRTC pVIII598R ATRAAYTSRTCNGGRWANGTNYCIGGIGG

PAGE 57

57 Table 2 2. Specific primers used to close gap s between novel sequences of CSLAdV 1 . Primer Sequence OtAdVITSR TGATGCTCCAAATCCAACAA OtITSF1 TTGTTGGAGATGGTGGCTAA OtIVa2R1 TATAACCAAGGGCCAGAAGG OtITSF2 AATTGTCTGCCTGAGGATGC OtIVa2R2 TTATGATGTTTCCCACCCAAA OtIVa2F1 TTTGCAGCTGAGGCAAAAAT OtpolR1 AATGTGGTCATGTCGGAAAA OtIVa2F2 TTATTTGGGTGGGAAACATCA OtpolR2 GTCATGTCGGAAAAGGCAAA OtpolpolF CTTTTCCGACATGACCACATT OtpolpolR AAGCGGAAGATTATGCTGGA OtpolF1 GCGTGAACAAAAAGGTGGTAA Otp52kR1 AACCATTTACTTTCCGGCTCA OtpolF2 GGGGTGGCATCAATTGTAAA Otp52kR2 AAATCCCATCATCTCTACAATGG Otp52kF1 CCATTGTAGAGATGATGGGATTT OthexR1 ATCCAAGACGCGGTTATCTC Otp52kF2 CTGAGCCGGAAAGTAAATGG OthexR2 GAAACCGCACTTTGTAAGCA OthexhexFA GGTTGGAGATGGTGGAGATG OthexhexRA TTCGCACATCAGGGTCATAA OthexhexFB GAAGTCCCAGACAACCCAAA OthexhexRB GCACCATCCACCCTTAAATC OtIVa2polgap1 ATGGTCTAATGCCCGAAGTG OtIVa2polgap2 TTTGTAACCAGCAGGCACAG Otpol52kgap1 GCAATTTTAATACCAATTCTGCACT Otpol52kgap2 CCCTAAATTATTGCGCCTTAGA Otpol52kgap3 CTGGCCTTGTTATGGCCTAC Otpol52kgap4 AAAATGTGGCGGCGGTAG Otp52khexgap1 GTTGCCGCCATTAATTTTTC Otp52khexgap2 CGCGAATCTTCACTTAAAATCA Otp52khexgap3 TCCTATGACTCGCCCTCATC Otp52khexgap4 GGCTTAGGTGGCATAACTGG Otp52khexgap5 CGCTTTGAGGCTATTTTGGA Otp52khexgap6 AGCATTTACAATCGCCAACA Otp52khexgap7 TTTCGTGATGCTTGAATTGC Otp52khexgap8 AGAGGAAAACGCAGAAGCAA OtAdVpVIIIF1 TCAATTTGCTGGAGGTAGCC OtAdVpVIIIF2 TTGGAAAAGGCATTCAGCTT OtAdVhexF1 CTTTATGCTAATGCGGCACA

PAGE 58

58 Table 2 2 . Continued Primer Sequence OtAdVpVIIIR1 CATTTCTGGGTGTGCGAAAT OtAdVhexF2 CACATGCTTTGGACATGGTT OtAdVpVIIIR2 CTGCTTCGCGTGACAAAAT OtAdVpolF3 TGCCTGCTGGTTACAAAGC OtAdVpolR3 TTGTTTTTGATCCAGATAATCCAA OtpIIIaF1 GGCTTATATGCAGGCTCGTC OtpIIIaF2 GAAAAGGTGTTGGCGATTGT OtpXR TTGCTTCTGCGTTTTCCTCT OtAdV1polF TTCTTCGAGGATTTGGATGG OtAdV1polR CATGACACTTCGGGCATTAG OtAdV1hexF GCTTTTTCCAATTCCAGCAA OtAdV1hexR CCCTAAATCCAGCCCAGTTT ITR IVa2gap3 ATGACCAGCTGGAACCTTTG ITR IVa2gap4 TTAGACTGGCATGCTCAACG ITR IVa2gap5 AAAACCGACATTCAGCATCA ITR IVa2gap6 GCCGGGGATCAGGATTAAA OtAdvpolp52kgapG1F TTCTTGTAATTTTAATACCAATTCTGC OtAdvpolp52kgapG1R TAAGGCCTTTACGGGGTTTT OtAdvpolp52kgapG2F AGCTTCTATGGGCATTGGTG p52k hexgapFHT GGGGGTTAAGGCACCTAGACTTTCA p52k hexgapRHT TGGCATAATTGAGTTAGCAGGACCA p52k hexgapF2HT TGGTCCTGCTAACTCAATTATGCCAAA p52k hexgapR2HT GCCTTTGAAAGTCTAGGTGCCTTAACC Otpol52kgap1a GCAATTTTAATACCAATTCTGCAGT Ot_PVIIIF3 CAACATTTTGTCACGCGAAG Ot_PVIIIR3 AAGCTGAATGCCTTTTCCAA OtAdVHexR3 AAGGGTGGGTTCATCTATTGG ITR_IVa2gapF7 GCATGAGGTTGTGGAATGG ITR_IVa2gapR8 ACCGGGTTCAACAAAATGAG ITR_IVa2gapF9 AAAAAGATGAGAGCGTGTGC ITR_IVa2gapR10 ATTCCACATAAGGATTTGGAACTT OtAdV pVIIIF4 GCTACTCTTGAAACCTCCCAGAC OtAdV PVIIIR4 TTACCAGTCTGGGAGGTTTCA OtAdvpolp52kgpG3F TCACCACATCTGGGCATAAA OtAdvpolp52kgpG2R ATGCCCAGATGTGGTGAAAT OtAdvpolp52kgpG4F CCGCTGTCCTTCATTTTCTT OtAdvpolp52kgpG3R TCAGAAGAAAATGAAGGACAGC Otpolp52kgap_G5F AAAGGGTTTGGCAAAGAAAAA Otpolp52kgap_G4R TTGGCTAGATGGGTTTTTGG OtHexF4 TGAACCCACCCTTCTCTACA

PAGE 59

59 Table 2 2 . Continued Primer Sequence OtHexF3 TCTTGTGTGATAGAACTATGTGGAGA OtpVIIIR5 AAGCTGAATGCCTTTTCCAA p52k hexgapG1F AAGATCATTTGATGAAGTAATGACTGA p52k hexgapG1R TGAATCAGTCATTACTTCATCAAATG ITR IVa2gapF11 AGGTTGTGGAATGGGAGGAT ITR IVa2gapR12 CAACTTCGCTGACCAAAACA pTP_F TTTGCACCATTTCTCCTCGT pTP_R ACGAGGAGAAATGGTGCAAA p52KSgapR CAGAGCGCAAATCCAAAAT Ot_ProteasaR GTGGGAACCAACCTAAAGCA Ot_ProteasaF TAGGTTGGTTCCCACCAAAA PVIIIR6 AAAGGTGCGATTCCTGATTG PVIIIF5 CCATTTTCTGGACCACCTGA Ot_ProtPVIIIGapF1 CCGCTTGTGGTTTATTTTGC Ot Protease_R2 GCGCTATTTGGCCCTTGTAT Ot Otpol52kGF2 CGAGAACTATTTCATCAAATCCA Ot_pTP_R2 CTGGTCAGGGAGAAATGGAA Ot PIIIaF2 b TGCTTTTAGTGGCTCCATTT pVR2 CGCTTTCCATAAGCAAATTCA OT_ITR_F CAACTCATGGGACAAAATGG OT_ITR_R2 GCCATTTTGTCCCATGAGTT ot_pIIIa 3F CCCTTCATCTGCTTTGGATTT ot_pIIIaR CCCTCTGGTGGTAACCAATG Ot_pVF1 AAGTACCTTTTTGCTAAATCACAGC Ot_pVR3 TGGGCAATGGGGAATAAAT Ot DBP F1 TCTTCCAAATACAGGATTACAGCA Ot DBP R1 CGGTCTTAATGTGGACATAAATCT Ot PVIIIF6 CGCTATAAACGGGCAATCAT Ot PVIIIR7 CCGTTTATAGCGCCTCCAT Ot PVIIIF7 TTTGCACCAGCTTACTATGGA Ot PVIIIR8 TCCATAGTAAGCTGGTGCAAA Ot predUTPaseF1 ACCCTCGAGATGTTTCAGGT Ot predUTPaseR1 CCTGTGAAGAAGGGAGATCG Ot posdUTPaseF1 AAAAACTCACCGTGGACAGG Ot posdUTPase R1 GTTGGGGATTAGGGAGTGGT Outside_Hex_F ATTGTGGGGATGGGTGTAAG Outside_Hex_R AAACCCAGGAAATCTTTTATCAT Ot_pIIIa F4 TGCGGACATACCATCTCTCA Ot_pIIIa R2 CCAGCCTCCAAAGGAGTAAA Ot_pVF2 CGCAGAACGTGTCCTTACG Ot_pVR4 AGGTTGAATTACTCCCAGAGC

PAGE 60

60 Table 2 2 . Continued Primer Sequence Ot_DBP_F2 TGAAACATTCCAAAGTTCCAGA Ot_DBP_R2 CAGATTCTGGAACTTTGGAATG Ot_22KF AAAAAGCGCGGGAAAAAT Ot_22KR CCTCTCCTGTTTGTGGGTCA Ot PVIIIF8 CACTTTGGAACTGTTACTTTTAATGG Ot PVIIIR9 TTGACCATTAAAAGTAACAGTTCCA Ot predUTPaseF2 CCACTCCAGAAGAATCATCCA Ot PredUTPaseR2 TGAAATGTATGGCGAAAGTCC Ot_ITR_R3 TTGAGCACTAGATGGCGTTG Ot_altITRR TGACGTACCGTGGGAATTTT DBP_F3 GTCTTCGTCTTCGGCTTCAC p100KR AATGCTTCGCTCATCAAACC Conf_pentonF CCGGAATGTGCAATTGATTT Conf_pentonR GCAGCTGATTTCCCATAAGC p100KF TTGGACTGGGTTTGATGAGC DBP_R3 GTGAAGCCGAAGACGAAGAC pVIIIF9 GGAAATTGGAAATTGCAACTATACTAC pE434K_R ACGGCGATGTTTAGGAGTTG pVIIIR10 CAGCTTTTAGAAGTGGTGATATTTGA pE434K_F CAAAAAGCGCATTGCCATA p100KFConf TCCCAAAATATTTGAAGGGTTG p100KRConf TGCTGGATATGCAAAATGTGA E314.7KF TGGAAGCAGCGTGTGAAATA E314.7KR TATTTCACACGCTGCTTCCA pE434K_F2 GCATAATTTGCTTTAACAAGAGAA pE434K_R2 TTTTGGtATGGGGATATTGTTTC Ot_post33KF GCCGAAACTTATACTTTATGGGATT Ot_E314.7KF2 GATGGTTTCAACCCCGTTTA Ot_predUTPase_R3 TTGGAATTTAATTTGTAGACTTTGGA Ot_E314.7KR2 TGGAAGTAAGGCTCCAGCTAA Ot_FiberF AACACTTAAATTGGGGGATGG Ot_FiberR AAAATTCAAAGAAGGAGGGAAAA Ot_Out_FiberF TGTTAAAGCGAAGTCTTTTAGATTCA Ot_Out_FiberR TGTTAAGTTGTATTAAAGCATTTTCAG Ot_PreGapFiberF ACAACACCAGACCCCAACAC Ot_PreGapFiberR TTTCCAATCCCTCTCCATAA Ot_PostGapFiberF TGCAGAAAATGAAAGCGAAG Ot_PostGapFiberR CGCTTTCATTTTCTGCATCA Fiber_ConfF ATTGGGGCTATTGTGATTGG Fiber_ConfR GCAGTTTTCCATATGCATCAAA Out_FiberR2 TCAGAGGAATTGGAAGAAAAAGA

PAGE 61

61 Table 2 3. List of adenoviruses used for phylogenetic analysis with accession number s and endemic host species . Adenovirus Abbreviation Accession No in GenBank Nucleotide Gen us Species Common name California Sea lion adenovirus 1 CSLAdV 1 KJ563221 Zalophus californianus California sea lion Bat adenovirus 2 BtAdV 2 JN252129.1 Pipistrellus pipistrellus B at Bat adenovirus TJM BtAdV TJM NC_016895.1 Myotis ricketti B at Bovine adenovirus 1 BAdV 1 AC_000191.1 Bos taurus taurus C attle Bovine adenovirus 3 BAdV 3 AC_000002.1 Bos taurus taurus C attle Canine adenovirus 1 CAdV 1 Y07760.1 Canis lupus familiaris domestic dog Canine adenovirus 2 CAdV 2 U77082.1 Canis lupus familiaris domestic dog Equine adenovirus 1 EAdV 1 JN418926 Homo sapiens H umans Human adenovirus 1 HAdV 1 AC_000017.1 Homo sapiens H umans Human adenovirus 35 HAdV 35 AC_000019 Homo sapiens H umans Human adenovirus 7 HAdV 7 AC_000018.1 Homo sapiens H umans Human adenovirus 12 HAdV 12 X73487.1 Homo sapiens H umans Human adenovirus 40 HAdV 40 L19443 Homo sapiens H umans Murine adenovirus 2 MAdV 2 NC_014899.1 Mus musculus house mouse Murine adenovirus 3 MAdV 3 NC_012584.1 Apodemus agrarius striped field mouse Murine adenovirus 1 MAdV 1 NC_000942 Mus musculus house mice Bovine adenovirus 2 BAdv_2 AC_000001.1 Bos taurus taurus C attle Porcine adenovirus 3 PAdV 3 AF083132 Sus scrofa P ig Porcine adenovirus 5 PAdV 5 AF289262.1 Sus scrofa P ig Simian adenovirus 1 SAdV 1 NC_006879.1 Macaca fascicularis cynomolgus monkey Simian adenovirus 3 SAdV 3 NC_006144.1 Macaca mulatta rhesus monkey Simian adenovirus 25 SAdV 25 AC_000011.1 Macaca mulatta rhesus monkey Tree shrew adenovirus 1 TSAd 1 AF258784.1 Tupaia spp t ree shrew Bovine adenovirus 4 BAdV 4 AF036092 Bos taurus taurus C attle Duck adenovirus 1 DAdV 1 AC_000004.1 anseriform birds, chicken and quail Ovine adenovirus 7 OAdV 7 U40839 Ovis aries S heep Snake adenovirus 1 SnAdV 1 NC_009989.1 Pantherophis guttatus corn snake Fowl adenovirus 1 FAdV 1 NC_001720.1 multiple avian species Fowl adenovirus 4 FAdV 4 NC_015323 multiple avian species Fowl adenovirus 9 FAdV 9 AF083975 multiple avian species Fowl adenovirus 8 FAdV 8 NC_014969.1 multiple avian species Turkey adenovirus 1 TAdV 1 NC_014564 Meleagris gallopavo T urkey Frog adenovirus 1 F r AdV 1 AF224336 Rana pipien s leopard frog Raptor adenovirus 1 RAdV 1 NC_015455 R aptors Turkey adenovirus 3 TAdV 3 NC_001958 turkey, pheasant and chicken South polar skua adenovirus 1 SPSAdV 1 HM585353.1 Stercorarius maccormicki s outh polar skua

PAGE 62

62 Table 2 4. Comparison of genomic composition and number of amino acid s of different mastadenoviruses with CSLAdV 1 . Name CSLAdV 1 CAdV 2 BtAdV 1 BAdV B HAdV 2 E1A 197 230 217 211 289 E1A 96 E1B 19 kDa 147 169 182 175 E1B55K 418 444 459 420 495 pIX 191 103 106 140 IVa2 368 446 442 448 449 Polymerase 1029 1,149 1,142 1163 1198 pTP 587 608 609 663 671 p52K 383 389 438 331 415 pIIIa 533 563 574 568 585 Penton base 537 477 525 482 571 pVII 188 170 134 171 198 V 431 238 273 410 369 pX 65 80 80 pVI 238 206 206 263 250 Hexon 991 454 472 902 968 Protease 204 689 682 204 204 DBP 495 454 472 432 529 100K 686 689 682 850 805 22K exon 1 83 128 164 274 195 33K 180 149 155 279 228 22K exon2 123 pVIII 217 224 222 215 227 UNK ORF 1 320 216 UNK ORF 2 88 ORF4 E314.7K 118 121 U exon 55 55 55 54 Fiber 610 543 555 976 582 E4ORF6/7 77 86 96 150 E434 247 265 260 294 UNK ORF 3 132 dUTPase 142 142

PAGE 63

63 Table 2 5. Recombination analysis results . Numbers represent P values. Breakpoint Positions Detection Methods Begin End GENECONV Bootscan Maxchi Chimaera SiSscan PhylPro LARD 3Seq 2618 2751 NS NS 0.008542 NS NS NS NS NS 4139 4992 NS NS NS NS 1.88E 05 NS NS NS 4763 4866 NS NS NS 0.031715 NS NS NS NS 7170 10202 NS NS NS NS 1.35E 11 NS NS NS 9586 9966 NS 0.00306 NS NS 1.59E 05 NS NS NS 10337 10846 NS NS 0.0457 0.006475 NS NS NS NS 12361 12442 NS NS NS 0.02833 NS NS NS NS 13851 13865 0.01334 NS NS NS NS NS NS NS 17581 17991 NS 0.000168 NS NS NS NS NS NS 26252 26266 0.01387 NS NS NS NS NS NS NS

PAGE 64

64 Table 2 6. Result of likelihood mapping in Tree Puzzle. Percentage of constant sites and star like signal as an indicator of phylogenetic signal . Constant sites Start like signal Protein WAG VT WAG VT Polymerase 9.80% 9.80% 1.20% 1.30% pTP 431.00% 4.30% 3.60% 3.80% Penton 11.60% 11.60% 0.70% 0.80% Hexon 17.00% 17.00% 0.70% 1.20% p100K 3.80% 3.80% 3.90% 3.90% Concatenated_Nogaps 21.50% 21.50% 0.10% 0.00% Concatenated_gaps 9.20% 9.20% 0.40% 0.30% Table 2 7. ProtTest results to select the best model of protein evolution . Protein Best Model of evolution Best model of evolution for Bayesian analysis lnL best model Delta AIC for Bayesian analysis Polymerase LG+I+G+F RtREV+I+G+F 52524.05 248.29 Penton LG+G WAG+I+G 17788.18 80.47 pTP LG+I+G+F WAG+I+G+F 27453.51 173.39 Hexon LG+G+F RtREV+G+F 29842.59 230.59 p100K LG+I+G+F RtREV+I+G+F 39807.6 236.15 Concatenated LG+I+G+F RtREV+I+G+F 67493.19 748.58 Table 2 8. Tracer report of effective sample size (ESS) . V alues over 200 are considered acceptable. Protein Model C ombine Ln Effective Sample Size (ESS) Polymerase RtREV+I+G+F 51119.946 2145.122 Penton WAG+I+G 17469.409 953.782 pTP WAG+I+G+F 27196.754 1101.756 Hexon RtREV+G+F 30232.604 1018.538 p100K RtREV+I+G+F 39292.787 1118.965 Concatenated RtREV+I+G+F 67990.74 1085.437

PAGE 65

65 Table 2 9. Bayes factor calculation for individual proteins . Proteins Model of evolution used Polymerase Hexon pTP p100K Penton WAG+I+G 2.97 1.66 1.56 2.25 Polymerase RtREV+I+G+F 0.56 0.52 0.76 Hexon RtREV+G+F 0.94 1.36 pTP WAG+I+G+F 1.44 p100K RtREV+I+G+F

PAGE 66

66 Table 2 10. Comparative table of GC content as percentage among mastadenoviruses . Genome GC% California Sea Lion adenovirus 1 36 Bovine adenovirus 2 43.6 Human adenovirus 12 46.5 Canine adenovirus 1 47 Murine adenovirus 3 47.2 Murine adenovirus 1 47.8 Bovine adenovirus 1 48.8 Human adenovirus 35 48.9 Tree shrew adenovi r us 1 50 Canine adenovirus 2 50.3 Porcine adenovirus 5 50.5 Human adenovirus 40 51.2 Human adenovirus 7 51.3 Bat adenovirus 2 53.5 Bovine adenovirus 3 54 Simian adenovirus 1 55.2 Human adenovirus 1 55.3 Bat adenovirus TJM 56.8 Simian adenovirus 25 58.9 Equine adenovirus 1 59.9 Murine adenovirus 2 63.4 Porcine adenovirus 3 63.6

PAGE 67

67 Figure 2 1. California sea lion adenovirus type 1 ( CSLAdV 1) genome organization; lines mark every 2000 bp. Predicted ORFs are assigned with arrows, and exons of spliced genes are connected by lines.

PAGE 68

68 Figure 2 2. Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus ( CSLAdV 1 ) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced a mino acid (AA) sequences of the DNA polymerase gene (1645 AA characters including gaps). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengt hs are based on the number of inferred substitutions, as indicated by the scale.

PAGE 69

69 Figure 2 3. Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced am ino acid (AA) sequences of the DNA polymerase gene (1645 AA characters including gaps). Numbers at each node represent the posterior probability values as percentages in the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 70

70 Figure 2 4 . Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus ( CSLAdV 1 ) to representatives f rom each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the pTP gene (1008 AA characters including gaps). Numbers at each node represent the bootstrap values of the Maximum Likelihood ana lysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 71

71 Figure 2 5 . Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the pTP gene (1008 AA characters including gaps). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 72

72 Figure 2 6 . Maximum Likelihood p hylogram de picting the relationship of the California sea lion adenovirus ( CSLAdV 1 ) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the penton gene (698 AA characters in cluding gaps). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale .

PAGE 73

73 Figure 2 7 . Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the full length penton gene (698 AA characters i ncluding gaps). Numbers at each node represent the posterior probability values as percentages in the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 74

74 Figure 2 8 . Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the hexon gene (1162 AA c haracters including gaps). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale .

PAGE 75

75 Fig ure 2 9 . Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the full length hexon gene (1162 AA characters including gaps). Numbers at each node represent the posterior probability values as percentages in the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 76

76 Figure 2 10 . Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences o f the p100K gene (1250 AA characters including gaps). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 77

77 Figure 2 11 . Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences of the ful l length p100K gene (1250 AA characters including gaps). Numbers at each node represent the posterior probability values as percentages in the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 78

78 Figure 2 12. Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid ( AA) sequences for concatenated of five proteins data set (2377 AA characters excluding gaps and poorly aligned sequence) with RtREV+G+I+F as the model of protein evolution. Numbers at each node represent the posterior probability values as percentages in t he Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 79

79 Figure 2 13. Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to represe ntatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences for concatenated of five proteins data set (2377 AA characters excluding gaps and poorly aligned sequence) with LG+G+I+F as the model of protein evolution . Numbers at each node represent the bootstrap values as percentage s in the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale .

PAGE 80

80 Figure 2 14 . Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus ( CSLAdV 1 ) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences for concatenated of five proteins data set (2377 AA characters excluding gaps and poorly aligned sequence) with WAG+G+I+F as the model of protein evolution. Numbers at each node represent the posterior proba bility values as percentages in the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 81

81 Figure 2 15 . Bayesian analysis p hylogram depicting the relationship of the California sea lion aden ovirus ( CSLAdV 1 ) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences for concatenated of five proteins data set (2377 AA characters excluding gaps and poor ly aligned sequence) with Mixed +G+I+F as the model of protein evolution . Numbers at each node represent the posterior probability values in percentage of the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the sca le.

PAGE 82

82 Figure 2 16 . Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus (CSLAdV 1) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences for concatenated of five proteins data set (2377 AA characters excluding gaps and poorly aligned sequence) with WAG+G+I+F as the model of protein evolution . Numbers at each node represent the bootstrap value s as percentages in the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale .

PAGE 83

83 Figure 2 17 . Maximum Likelihood p hylogram depicting the relationship of the California sea lion ad enovirus ( CSLAdV 1 ) to representatives from each of the genera (except Ichtadenovirus ) in the family Adenoviridae , based on the deduced amino acid (AA) sequences for concatenated of five proteins data set (2377 AA characters excluding gaps and poorly align ed sequence) with RtREV+G+I+F as the model of protein evolution . Numbers at each node represent the bootstrap values as percentages in the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale. .

PAGE 84

84 Figure 2 18 . Tanglegram of mastadenoviruses and the corresponding mammalian host s . Atadenoviruses served as an outgroup for the mastadenovirus phylogenetic tree.

PAGE 85

85 CHAPTER 3 CSLADV 1 QPCR ASSAY IN WILD AND MANAGED POPULATIONS OF CALIFORNI A SEA LIONS ( Zalophus californianus) Introduction Adenoviruses have been detected in wild populations of California sea lions (Britt Jr et al. 1979, Dierauf et al. 1981) . Due to similarities in virus morphology and clinical pre sentation, it was thought that canine a denovirus 1 (CAdV 1) may be the etiology of adenoviral hepatitis in CSL. In 2011, an agent of viral hepatitis in California sea l ions ( CSLAdV 1) was isolated from 2 wild animals (Goldstein et al. 2011) and two animals from an open water managed col lection ( Chapter 2 ). However, although this virus has been found in wild a nd managed populations, its prevalence remains un determined. To understand the ecology and importance of this virus at the population level , information on the prevalence is needed. One potential tool to explore the prevalence of CSLAdV 1 is a quantitati ve polymerase chain reaction assay (qPCR). Since CSLAdV 1 may be the product of a host jump from an unknown mammalian endemic host ( Chapter 2 ), and evidence exists of jumping between different otarid (Inoshima et al. 2013) and phocid species ( Chapte r 4 ), the importance of developing a diagnostic tool that facilitates fast and specific diagnosis of this virus is vital. qPCR has several advantages in comparison to conventional PCR as a diagnostic tool. First, qPCR provides epidemiologically useful quan titative information about viral loads. Further, probe hydrolysis qPCR can have high specificity, because two primers and a probe, all designed specifically for the pathogen of interest must hybridize in order to obtain amplification and signal. In additio n, qPCR assays have high analytic sensitivity, and limits of detection of 10 virus particles per

PAGE 86

86 reaction are possible. Finally, as a diagnostic tool, qPCR assays are less expensive and less time consuming. We can obtain results with high confidence in les s tha n 24 hours after samples arrive in the laboratory. The objective of this study is to develop a diagnostic tool for CSLAdV 1 with high sensitivity and specificity that allows quantitative diagnosis of this virus in California sea lions and other pinnip eds. Specific Aims Information on the prevalence of CSLAdV 1 in managed or wild populations of California sea lions has not yet been published. To understand the importance of this virus in these populations, we must improve our knowledge of virus prevale nce. By using qPCR assays, we can facilitate an easy and fast diagnosis of this virus with high specificity and sensitivity. We can also determine viral load in individuals in these populations, and compare loads between different populations. Specific Aim 1: Develop a qPCR assay to diagnose CSLAdV 1 in California sea lions and determine the specificity and sensitivity of the assay Specific Aim 2: Compare the sensitivity of qPCR with the gold standard for diagnosis of adenoviruses Specific Aim 3: Compare the prevalence of CSLAdV 1 in managed and wild populations of California sea lions Hypothesis 1: The p revalence of CSLAdV 1 will be the same in wild and captive populations Specific Aim 4: Compare viral loads as determined by qPCR w ith clinical pathology and necropsy finding Hypothesis 2 : There will be a correlation between CSLAdV 1 viral loads and clinical pathology findings, in particular with hepatic enzymes such as AST and ALT Hypothesis 3 : There will be a correlation between CSL AdV 1 viral loads and necropsy findings

PAGE 87

87 Materials and Methods Sample Size Calculation To estimate the sample size needed for disease detection, we used a formula that maximizes the probability of detection if a herd is free of disease (Cannon, 2001). To o btain an estimate of the prevalence, we used the prevalence of CSLAdV 1 obtained from 39 animals from wild and managed populations surveyed in 2009 using conventional consensus PCR and sequencing (Wellehan et al. 2004) , we found 2.5% of animals were positive . With that prevalence , we need ed 119 samples from wild animals and 70 to 103 animals from managed collections for a population between 100 to 400 animals . Sample Management Fecal samples and fecal swabs were used. For fecal samples, 50 g of solid material or up to 400 l of liquid material was used. For swabs, 300 l of RNAlater or PBS was used, acc ording to the preservation method. If the swab was a dry swab, 500 l of PBS buffer was added and 300 l was used for the extraction. Additional frozen liver samples were requested from some of stranded qPCR positives animals. For tissue samples we used up to 50 g of sample. DNA extractions were done using a Maxwell 16 automated extractor (Promega, Madison, WI, USA) f ollowing the DNA concentrations were measured using a NanoDrop 8000 spectrophot ometer (ThermoScientific). Samples were diluted to 25 ng/ l to be run with the CSLAdV 1 qPCR. Results are presented as adenovirus copy number/ well . Six additional known CSLAdV 1 positive samples from clinical cases were used for assay validation.

PAGE 88

88 Primer D esign Primers qPCR PolF3 , qPCR PolR3 and probe Pol3 , were designed to target a conserved area in the DNA dependent DNA polymerase gene. Primers and probes were designed in the program Primer express ® version 3.0 (Applied Biosystems, Foster City, CA, USA). The probe was designed with MGB as a quencher and FAM as a reporter dye (Table 3 1). Standard Curve To obtain template for standard curves, the CSLAdV 1 DNA dependent DNA polymerase was amplified from positive samples using a previously published consensus PC R (Wellehan et al, 2004). This segment is 552 bp, and includes the sites for binding of the qPCR primers and probe. Dilutions were made with TE buffer and ranged from 10 7 to 10 0 qPCR Assay Each sample was run in triplicate for the CSLAdV 1 diagnostic with one additional well run using universal eukaryote 18s rRNA (VIC Probe, Applied Biosystems, Foster City, CA, USA) as an internal control. The master mix consisted of the mix (TaqMan ® Fast Universal PCR Master Mix 2X, Applied Biosystems, Foster City, CA, USA), 1 of primers and probe at the concentrations of primers and probe found to be optimal after assay optimization , and . All reactions were run in a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA, USA) under a standard fast protocol.

PAGE 89

89 Samples that did not show amplifica tion of 18S rRNA were discarded. The amplification conditions were standard; 20 seconds of initial denaturation at 95 C , followed by 45 cycles of 95 C for 3 seconds and 60 C for 30 seconds. The slope and R 2 were calculated with the 7500 Fast Real Time PCR System software (Applied Biosystems, Foster City, CA, USA). Assay Optimization Primer concentrations were optimized ac cording to a protocol established for qPCR assay optimization (Green and Sambro ok 2012) . The standard initial concentration of primers was 18 uM and for the probe 5 u M. For the optimization w e used 4 primer concentrations; 3, 6, 9 and 18 uM, for a total of 16 primer combinations; for this assay we maintained the same probe concentration of 5 uM. The primer set with the lowest C T value was considered optimal. Following primer optimization, we optimized the probe, using probe concentrations of 2.5, 5 and 7.5 uM per reaction. Again, the combination with lower C T was considered best. Finally, we compared the analytical sensitivity of the optimal primer and probe concentrations with the standard concentrations (18 uM of primers and 5 uM of probe ) . Assay Validation Analytic specificity We used two approaches to determine the analytic specificity of the assay, in silico and empirical. In silico, all pinniped adenoviruses were aligned to assess homology with the primers and probe using the program SEAVIEW (Figure 3 1). For the empirical as say, we ran the CSLAdV 1 qPCR using other mastadenovirus samples

PAGE 90

90 available in our laboratory, including California sea lion adenovirus 2 and other novel mastadenoviruses ( CSLAdV 3 to CSLAdV 6, SAFSAdVs, BDAdV 1) (Table 3 3 ). Analytical sensitivity To evalu ate this we used standard dilutions (10 7 to 10 0 copies) of CSLAdV 1. Additionally, we analyzed the previously available assay for diagnosis of CSLAdV 1 and other adenoviruses, gold standard consensus nested PCR/sequencing assay (Wellehan et al. 2004) , considered here as a gold standard. To obtain the analytical sensitivity of the gold standard, we ran the gold standard assay with the same standards used for the qPCR. Diagnostic specificity and sensitivity To estimate diagnostic specificity and sensitivity, we compared the qPCR assay results to the gold standard consensus nested PCR/sequencing assay used for diagnos is of adenoviruses in several species (Wellehan et al. 2004) . This nested consensus PCR is considered the best diagnostic tool for the identification of previously unknown adenoviruses. This is not a CSLAdV 1 specific assay , and its objective is to facilitate the discovery of novel adenoviruses. This manuscript is the first attempt that we are aware of to evaluate its analytic sensitivity for a specific virus. In order to calculate diagnostic sensitivity and specificity , a subset of negative samples and all qPCR positive samples (including positive samples from other pinniped species) were re r un with the gold standard . As a secondary approach to evaluate the result obtained with the gold standard consensus nested PCR/sequencing assay , we used hexon conventional PCR to amplify a conserved region of the hexon protein as a secondary gene using spe cific primers or a combination of consensus with specific primers (Table 3 2). For this assay we used Platinum Taq ® DNA Polymerase ( Platinum

PAGE 91

91 Taq DNA polymerase, Invitrogen, Carlsbad, CA, USA). The initial denaturation was 5 es of denaturation at 95 C for 1 min, annealing at primer 45 C for 30 s, and extension at 72 C for 1 min, followed by a final elongation step at 72 C for 7 min. PCR products were run in a 1% agarose gel. Fragments of the expected size were cut and extracted using QIAquick Gel extraction kits (Cat No 28706, QIAGEN, Valencia, CA, USA ). The gel extracted PCR products were sequenced in both directions using ABI 3130 DNA sequencers (Life Technologies, Carlsbad, CA, USA ). We used a chi square table and c alculated the diagnostic sensitivity and and open water managed populations. CSLAdV 1 Prevalence in CSL qPCR positive animals with confirmation gold standard consens us nested PCR/sequencing assay were considered as true positive animals to calculate the prevalence of CSLAdV 1 among populations. Liver samples were analyzed using the qPCR assay and gold standard consensus nested PCR/sequencing assay Results Assay Optimi zation We compare d the assay with standard conce ntration vs the optimized one. B oth assay had a better efficiency and lower C T value. The optimal primer and probe concentrations w of probe .

PAGE 92

92 Analytic Specificity. No mammalian adenoviruses other than CSLAdV 1 amplified with this assay (Table 3 3 ) . Analytical Sensitivity gold standard ( consensus PCR and sequencing assay ) was able to detect as few as 75 copies/3 uL using pure PCR product. Based on the limits of detection of the test, samples we re considered below the l imit of detection if th ey we re lower than 10 copies/ well . Diagnostic Sensitivity and Specificity The diagnostic sensitivity was calculated with a subset of samples that included 19 qPCR positive samples from an extended data set that included other known positive pinniped adenovirus samples and 44 qPCR negative samples, for a total of 63 samples (Table 3 3 ) . With the consensus PCR/sequencing assay as a gold standard, t he sensitivity of this assay is 100% and the spec ificity is 86.5 %. CSLAdV 1 Prevalence i n CSL A total of 191 fecal samples were analyzed; 29 animals from open water manage d collections and 162 from a rehabilitation center. From a subset of wild animals we obtain ed epidemiological data , including age classes , sex and cause of death (Table A 1) . The standard curve generated represents a linear regression , with an average slope of 3.228, average efficiency of 105.07%, and average R 2 of 0.996. Thirteen CSL qPCR positive animals were identified; three animals from an open water managed collection and ten from wild populations (Table 3 3). From those 13 animals, six were confirmed by the gold standard consensus nested PCR/sequencing assay (two from the

PAGE 93

93 open managed population and four from wild populations) and two additional animal s were positive using hexon conventional PCR (Table 3 3). In open water managed collections (adults plus juveniles), a prevalence of 7.41% was found versus 2.53% i n wild populations (adults, juveniles, and pups) . The difference in prevalence between populat ions w as None of the liver samples were qPCR or PCR positive for CSLAdV 1 (Table 3 4 ). No correlation between qPCR positive animals and necropsy or clinical pathology data was detected in wild animals from this study. Discussion There was no significant difference in prevalence between wild and managed populations ( 2.53% and 7.41% respectively ). This prevalence is similar to a study o f CAdVs in red fox where 1 of 32 animals had a CAdV 1 pos itive fecal sample ( 3.13 %) (Balboni et al. 2012) ; in addition, one animal was positive in liver and kidney, but not feces. This set of samples w as also screened for CAd V 2 , with one animal positive in feces, but not in liver or kidney. In the current study, we requested liver samples from animals found to be CSLAdV 1 positive in feces ; none of them were positive for CSLAdV 1 (Table 3 4 ) . This raises the possibility that for those animals, the virus had not colonized the liver yet. We found two samples with a novel CSLAdV 4 virus in liver, one of which was confirmed be CSLAdV 1 positive on feces by hexon conventional PCR , showing evidence o f co infection with multiple adenoviruses. Additional samples with evidence of possible co infection were observed, a co infection of CSLAdV 1 and CSLAdV 6 was identified , and co infection with CSLAdV 2 and CSLAdV 6 in feces was discovered (Table 3 3 ). The e vidence do es not support a cross reaction of CSLAdV 6 and CSLAdV 1 in the qPCR assay, since three tissue samples were CSLAdV 6 positive

PAGE 94

94 but negative on the CSLAdV 1 qPCR (Table 3 3 , samples Zc13149, Zc13150, Zc13171) . One limitation is the fact that while we can detect whether an animal is actively shedding CSLAdV 1, we cannot detect prior exposure. All wild animals positive for CSLAdV 1 were animals involved in an ongoing unusual mortality event or stranded animals. The presence of CSLAdV 1 in these animals is probably related to poor health status. Adenoviruses have been demo nstrated to be more virulent in immunocompromised patients and in high density/high stress situations (Gray et al. 2000, Krilov 200 5) . In managed settings, animals can reach older ages. In a previous report of an CSLAdV 1 outbreak in an aquarium in Japan , a ll infected animals were older than 20 years (Inoshima et al. 2013) . Further investigation of the role of aging and immu ne compromise on CSLAdV 1 infection is indicated. Rapid diagnosis of this path ogen is important in zoological facilities, especially in growing geriatric collections . The qPCR a ssay has 100% sensitivity and 86.5 % specificity as compared to the gold standar d conventional PCR . These results show that this assay could have false positives, especially in samples with low virus load, but not false negatives. However, when the qPCR assay wa s compared to the additional hexon PCR, two additional qPCR positive sampl e s were identified ; virus in tho se samples w as not detect ed by the gold standard assay. This suggests that the reason for the low specificity of the qPCR assay may actually be due to higher limit of d etection of the gold standard. Additionally, the standar d curve dilution of the qPCR assay showed a greater analytic sensitivity (10 copies/ well ) compared to the gold standard assay (75 copies/well), supporting the

PAGE 95

95 hypothesis of a lower analytic sensitivity that would affect the diagnostic sensitivity result. F urther evaluation of analytic sensitivity of the gold standard could include the use of known negative samples spike d with a know n amount of virus particles to evaluate the effect of possible inhibitors in the fecal samples that could affect the analytic sensitivity of the adenovirus gold standard diagnostic assay.

PAGE 96

96 Table 3 1. Sample size requirements for 5 different prevalence values. Prevalence/population size 238,000 * 100 200 300 400 2.5 119 70 90 98 103 3.5 85 57 69 74 76 4.5 66 48 56 59 61 5.5 53 42 57 49 50 6.5 45 36 40 42 43 * Wild animal population size Table 3 2. Primer s and probes for the CSLAdV 1 qPCR assay . Primer name Sequence Function Expected size qPCR PolF3 TCCACGCAGCGGTTCATT qPCR 60 qPCR PolR3 CCACCTTTTTGTTCACGCAAA qPCR ProbePol3 CCAGCATAATCTTCCG qPCR OthexhexFB GAAGTCCCAGACAACCCAAA Specific PCR 341 OthexhexRB GCACCATCCACCCTTAAATC Specific PCR HexFg GGNCAYCCNTAYCCNGCNAAYTGGCC Consensus PCR R1 290 HexRh ACNCCNCKRTGNGGYTGRTG Consensus PCR R1 OtHexF4 TGAACCCACCCTTCTCTACA Specific PCR R2 231 OtAdVHexR3 AAGGGTGGGTTCATCTATTGG Specific PCR R2

PAGE 97

97 Table 3 3 . List of samples used for assay optimization with qPCR and PCR (specific and consensus primers) for CSLAdV 1. Samples qPCR []/DNA qPCR []/well PCR Consensus PCR HexHexB PCR HexFg/Rh PCR HexR3/Hex4 CSL09049 6.13 66.22 CSLAdV 1 CLSAdV 1 CLSAdV 1 Negative CSL09083 34024.07 2121740.83 CSLAdV 1 ND CLSAdV 1 Negative CSL09086 0.95 245.7148 Negative CLSAdV 1 Negative Negative CSL10008 Negative Negative NA NA NA CSL10009 Negative Negative NA NA NA CSL10010 Negative Negative NA NA NA CSL10011 Negative Negative NA NA NA CSL10012 Negative Negative NA NA NA CSL10013 Negative Negative NA NA NA CSL10014 Negative Negative NA NA NA CSL10015 Negative Negative NA NA NA CSL10016 Negative Negative NA NA NA CSL10017 Negative Negative NA NA NA CSL10018 Negative Negative NA NA NA CSL11030 ND 4228388352 CSLAdV 1 CLSAdV 1 CLSAdV 1 Fail CSL11041 ND 55349888.0 CSLAdV 1 ND ND ND CSL11061 ND 1405910 CSLAdV 1 ND ND ND MS12001 ND 225081360 CSLAdV 1 ND ND CLSAdV 1 MS13011 Negative Negative NA NA NA MS13012 Negative Negative NA NA NA MS13013 1 2 ,967.6 1 12967 6 0.88 CSLAdV 1 ND fail CSLAdV 1 MS13014 1,121.93 112192.72 CSLAdV 1 ND ND ND MS13015 Negative Negative NA NA NA MS13016 Negative Negative NA NA NA MS13017 Negative Negative NA NA NA PV13001 Negative Negative NA NA NA ZC12019 0.12 97.47 Negative ND Negative Negative ZC12020 0.02 2.08 Negative ND Negative Negative ZC12096 16.36 682.83 CSLAdV 1 ND Negative CSLAdV 1 ZC12098 17.78 852.62 CSLAdV 1 ND Negative CSLAdV 1 ZC13030 Negative Negative CSLAdV 2/CSLAdV 6 Negative Negative Negative ZC13036 Negative Negative Negative Negative Negative Negative ZC13038 2.89 1225.11 Negative Negative Negative CSLAdV 1 ZC13043 6.55 108.87 Negative Negative Negative Negative ZC13047 Negative Negative NA NA NA

PAGE 98

98 Table 3 3 . Continued Samples qPCR []/DNA qPCR []/well PCR Consensus PCR HexHexB PCR HexFg/Rh PCR HexR3/Hex 4 ZC13048 Negative Negative NA NA NA ZC13049 Negative Negative NA NA NA ZC13050 Negative Negative NA NA NA ZC13051 Negative Negative NA NA NA ZC13052 Negative Negative NA NA NA ZC13053 Negative Negative NA NA NA ZC13054 Negative Negative NA NA NA ZC13061 Negative CSLAdV 3 NA NA NA ZC13084 Negative CSLAdV 2 NA NA NA ZC13091 5.49 549.89 CSLAdV 1 ND ND Negative ZC13096 Negative CSLAdV 4 NA NA NA ZC13098 Negative CSLAdV 5 NA NA NA ZC13101 Negative CSLAdV 6 NA NA NA ZC13110 5.1 3 512.74 CSLAdV 6 ND ND ND ZC13130 Negative CSLAdV 5 NA NA NA ZC13132 Negative CSLAdV 4 NA NA NA ZC13133 Negative CSLAdV 4 NA NA NA ZC13136 Negative CSLAdV 2 NA NA NA ZC13149 Negative CSLAdV 6 NA NA NA ZC13150 Negative CSLAdV 6 NA NA NA ZC13151 Negative CSLAdV 4 NA NA NA ZC13152 Negative CSLAdV 4 NA NA NA ZC13171 Negative CSLAdV 6 NA NA NA Zc13248 Negative Negative ND Negative Negative Zc13250 0.62 15.51 Negative Negative Negative Negative Zc13254 12.96 342.04 Negative Negative Negative Negative Zc14004 Negative CSLAdV 4 NA NA NA Zc14005 Negative CSLAdV 4 NA NA NA Aau11019 Negative SAFSMasta 1 NA NA NA Aau12187 Negative SAFSMasta 2 NA NA NA Aau11023 Negative SAFSMasta 3 NA NA NA Aau11056 Negative SAFSMasta 3 NA NA NA Aau12186 Negative SAFSMasta 4 NA NA NA Aau11057 Negative SAFSMasta mix ed NA NA NA NA: not applicable; ND: Not done

PAGE 99

99 Table 3 4 . Tissue samples from animals positive for CSLAdV 1 in feces . Sample ID Released Liver s ample ID Feces qPCR results Golden standard PCR in feces Tissue qPCR results Golden standard PCR in liver Euthanasia Reason Necropsy Clinical pathology ZC12019 No ZC14002 BLD Negative Negative Negative abdominal mass Mestastasis ALT/AST WNL ZC12020 No ZC14001 Positive Negative Negative Negative paralysis Mestastasis No collection ZC13038 No ZC14004 Positive Negative Negative CSLAdV 4 renal amyloidosis; no treatment ALT/AST WNL ZC13043 No ZC14005 Positive Negative Negative CSLAdV 4 chronic domoic acid Domoic acid ALT/AST WNL ZC13110 Y es NA Positive CSLAdV 6 NA NA NA NA ALT/AST WNL ZC13150 No ZC14006 Positive Negative Negative Negative seizure ND No collection ND: Not done; NA: Not applicable; WNL: within normal limits

PAGE 100

100 Figure 3 1. Position of primers and probe in alignment of mastadenoviruses polymerase gene. The character X represents mismatch es with the primers and probes. Primer region s are distinguished by a blue underline and probe region by a red underline.

PAGE 101

101 CHAPTER 4 CSLAdV 1 IN A HAWAIIAN MONK SEAL ( Neomonachus schauinslandi ) Introduction The Hawaiian monk seal ( HMS, Neomonachus schauinslandi ) is a critically endangered phocid with a total estimated population of 1012 individuals . T he population is declining dramatically at a rate of 4.1 % per year (Lowry and Aguilar 2013) . Viral diseases have been reported to cause mortalities in wild populations of pinnipeds (Osterhaus 1989, Bostock et al. 1990, Osterhau s et al. 1990, Osterhaus et al. 1997, Anthony et al. 2012) . Mortality events hav e occurred in Mediterranean monk seals ( Monachus monachus ), where morbillivirus was initially suspected, but later studies indicated that the most likely cause was a harmful algal bloom (Osterhaus et al. 1997, Hernández et al. 1998, Van de Bildt et al. 1999) . Disease surveillance studies have been done in Hawaiian monk seals (Goldstein et al. 2006a, Littnan et al. 2006, Aguirre et al. 2007b) . Aguirre et al . (2007) found serologic evidence for exposure to agents antigenically related to p hocine herpesvirus 1 and H uman herpesvirus 2 , as well as an unpublished adenovirus isolate from a walrus for which there is no available sequence data. They did not find sero logic evidence for exposure to influenza A, vesiviruses, morbilliviruses, c anine adenovirus 1 , and other viruses. Adenoviruses are 70 90 nm, icosahedral, non enveloped , double stranded DNA viruses with intranuclear replication (Harrach et al. 2011) . The family Adenoviridae has 5 accepted genera; Mastadenovirus , Aviadenovirus , Atadenovirus , Siadenovirus , and Ichtadenovirus , as well as the recently p roposed genus Testadenovirus (Harrach et al. 2011, Doszpoly et al. 2013) . Adenoviruses infect a wide range of vertebrates and show relatively high host specificity. Mastadenoviruses have been found only in m ammals. In

PAGE 102

102 humans, they have been associated with outbreaks of respiratory disease (Gray et al. 2000, McNeill et al. 2000, Ecker et al. 2005) , conjunctivitis (Jawetz 1959) and infantile gastroenteriti s (Yolken et al. 1982) . In immunocompromised human patients, mastadenoviruses have been associated with fulminant hepatitis, pneumonia, and encephalitis (Krilov 2005) . In marine mammals, adenoviruses have only been genetically identified in California sea lions (CSL, Zalophus californianus ) (Go ldstein et al. 2011) . Adenoviral (Britt Jr et al. 1979, Dierauf et al. 1981, Goldstein et al. 2011) . In open managed collection clinical signs include anorexia, diarrhea as well elevated hepatic enzymes (Inoshima et al. 2013) . California sea lion adenovirus 1 ( CSLAdV 1) is a new member of the genus Mastadenovirus (Goldstein et al. 2011) . Displaying low host fidelity for a mast adenovirus, this virus has the ability to jump into other otariid species, causing fatal viral hepatitis in a California sea lion ( Zalophus californianus ) , as well as a South Ameri can sea lion ( Otaria flavescens ) and a South African fur seal ( Arctocephalus pusillus ) housed in an aquarium in Japan. The three affected animals were kept in different enclosures and had no contact (Inoshima et al. 2013) . In addition, partial hexon protein sequence of CSLAdV 1 was submitted to Gene Bank as Otaria flavescens adenovirus 1 ( accession no. HM776944.1 ). This provides additional evidence that CSLAdV 1 can infect multiple species of pinnipeds. Polyomaviruses are 40 45 nm, icosahedral, non enveloped , circular, double stranded DNA viruses with intranuclear replication. The family Polyomaviridae has recently been split into three genera; two genera utilizing mammalian hosts,

PAGE 103

103 Orthopolyomavirus and Wukipolyomavirus , and one genus found in birds, Avipolyomavirus (Johne et al. 2011) . In mammals, polyomaviruses typically cause minimal clinical disease in their immunocompetent endemic hosts, followed by latent infection. However, exceptions exist , as murine pneumotropic polyomavirus ( MPtV) causes significant m ortalities in newborn mice (Johne et al. 2011) . An association has been reported between brain tumors and a new raccoon polyomavirus in raccoons from California (Cruz Jr et al. 2013) . Polyomaviruses have been found in pinnipeds and cetaceans (Colegrove et al. 2010, Wellehan et al. 2011b, A nthony et al. 2013b) . In pinnipeds, the complete genome of California se a lion polyomavirus 1 (CSLPyV 1) has been sequenced and a qPCR survey found a prevalence of 24% in stranded animals and 0% in animals from an open water managed collection (Wellehan et al. 2011b) . A novel polyomavirus has also been found in the placenta of a Northern fur seal; the virus was not found in 29 additional N orthern fur seal placentas (Duncan et al. 2013) . We present an expans ion of the host range of CSLAdV 1 from the family Otariidae into the family Phocidae. We also present data on co infection with a novel polyomavirus, designated Hawaiian monk seal polyomaviru s 1 (HMSPyV 1). Phylogenetic analysis is presented, and the implications for virus ecology are discussed. Specific A ims The specific aim of this chapter was the application of molecular techniques , specifically qPCR used in chapte r 3 , to diagnosis of CSLAdV 1 in a clinical case presented in a Hawaiian monk seal (HMS, Neomonachus schauinslandi ) .

PAGE 104

104 Materials and Methods Clinical History A 26 year old male Hawaiian monk seal was housed long term in a public display facility after being rescued as a malnouri shed pup from French Frigate Shoals in the northwestern Hawaiian Islands. He had an unremarkable medical history until he began to show episodes of waxing and waning appetite and subsequent weight loss over a per iod of approximately 6 months. Blood work du ring this time was fairly unremarkable aside from a persistent mild anem ia and hypergammaglobulinemia. A stress leukogram and very mild azotemia were intermittently observed during periods of low dietary intake, but resolved when his appetite returned. Following a two day bout of reduced appetite, the seal acutely became comp letely anorexic and lethargic. Blood work revealed a more pronounced anemia, a stress leukogram, severe azotemia, and mild hyp ernatremia and hyperchloremia. In spite of aggressive fluid therapy and an initial positive response to treatment, the anemia and profound azotemia, hypernatremia , and h yperchloremia progressed. Post mortem diagnostics suggest this animal developed diabetes insipidus secondary to chronic renal failure. Hepati c indices remained within normal limits until the time of his death . Histology Tissues were routinely processed, embedded in paraffin, sectioned at 4 5 microns and stained with hematoxylin and eosin. Transmission Electron M icroscopy (T EM) A formalin fixed p araffin embedded block of liver w as sele cted for T EM evaluation at the University of Illinois .

PAGE 105

105 PCR and Sequencing For the initial diagnostic testing, DNA from liver and all samples (fec es and tissue s ) were extracted using a tissue DNA purification kit with a Maxwell automated extractor (Promega, Madison, WI, USA) (Maxwell 16 DNA Purification kits) . This sample w as tested for herpesviruses using a consensus nested PCR protocol targeti ng the herpesviral DNA dependent DNA polymerase gene (VanDevanter et al. 1996) , for adenovirus using a consensus nested protocol targeting the adenoviral DNA dependent DNA polymerase gene (pol) (Wellehan et al. 2004) , and for polyomavirus using a consensus nested protocol targeting the VP1 gene (Fagrouch et al. 20 12) . For other genes of CSLAdV 1 , we used CSLAdV 1 specific primers ( E1 B 19k, hexon and fiber; Table 4 1) or primers designed from the sequence obtained ( hexon and fiber; T able 4 1). PCR conditions were modified according to the predicted melting temper ature of the set of primers used and expected fragment length. For reactions with expected amplicon size s over 1000 bp, we used TAKARA Ex Taq TM (Hot Start Version, TAKARA BIO INC., Otsu, Japan). For amplicons expected to be smaller than 1000 base pairs, we used Platinum Taq ® DNA Polymerase (Platinum Taq DNA polymerase, Invitrogen, Carlsbad, CA, USA). The initial llowed by 45 cycles of denaturation at 95 C for 1 min, annealing of primer s at 6 C below the manufacturer predicted melting temperature of the set of primers for 30 s, and extension at 72 C for a time determined by the length of the expected sequences, fol lowed by a final elongation step at 72 C for 10 min. PCR products were run in a 1% agarose gel. Products of the expected size were cut and extracted using QIAquick Gel extraction kits (QIAGEN, Valencia, CA, USA). The gel

PAGE 106

106 extracted PCR products were sequenc ed in both directions using ABI 3130 DNA sequencers. Cell Culture Cell lines A549 (CCL 185) and MDCK (CCL 34) were obtained from the American Type Culture Collection (Manassas, VA) . They were propagated as monolayers at 37°C and 5% CO 2 in Advanced Dulbecco 's Modified Eagle's Medium (Invitrogen Corp., Carlsbad, CA) that was supplemented with 2 mM L Alanyl L , /v) low IgG, heat inactivated gamma irradiated fetal bovine serum (HyClone, Logan, UT). Liver tissue was homogenized to form a 10% w/v suspension using a sterile tissue grinder, and the c ell lines (at 80% confluency) inoculated with aliquots of the homogen ates. Non infected cells were maintained in parallel. The cell growth m edia was changed every 3 days. Cell s were inspected every 24 hrs for cytopat h ic effect (CPE) . Nucleic acids extracted from the spent growth media were analyzed by qPCR assay s to detect viral genomic DNA. Phylogenetic Analyses The sequences were compared to known sequences in GenBank (National Center for Biotechnology Information, Bethesda, MD, USA), EMBL (Cambridge, United Kingdom), and DNA Data Bank of Japan (Mishima, Shizuoka, Japan) databases using BLASTX (Altschu l et al, 1997). To estimate the sequence similarity of different proteins sequenced for the HMS CSLAdV 1 , we compared th e obtained sequence s to a CS L CSLAdV 1 using BLASTN and BLASTP .

PAGE 107

107 An addition , t o compare the sequence simi larity of the HMS CSLAdV 1 with other available homologous adenovirus sequence s, two approaches were used . First, a nucleotide sequence distance matrix was calculate d for the partial polymerase and hexon nucleic acid sequences using Geneious 5.6.5 (Kearse et al. 2012) . Second, Bayesian and Maximum L ikelihood phylogenetic analys e s were done . Since there are more polymerase sequences available for comparison (Table 4 2 vs . Table 4 3), nucleotide sequence s from partial polymerase genes were aligned using MAFFT with default setting s (Katoh and Toh 2008) . Sequence s w ere test ed for phylogenet ic noise using alignments with and without gaps in the program DAMBE5 (Xia 2013) . Samples were tested for phylogenetic signal using l ikelihood m apping in TreePuzzle 5.2 (Schmidt et al. 2002) . The n ucleotide substitution model was selected using JModelTest 0.1.1. (Posada 200 9 ) . Human adenovirus 1 (HAdV 1, GenBank accession no. X14112) was designated as the outgro up. Bayesian analys e s w ere performed using MrBayes 3.2.2 (Ronquist et al. 2012) on the CIPR ES server (Miller et al. 2011) . For the Bayesian analyses, four chains were run; each one for 1,000,000 generations; three hot chains a nd one cold chain with the default heating parameter (temperature = 0.2). Convergence among different runs was evaluated by calculating the average split deviation using a threshold of 0.02 %. Chains were sampled every 100 generations and the first 20% were discarded as a burn in. To determine whether this number of generations was adequate and calculate whether we had effective sample sizes , we used the program TRACER 1.5 (Rambaut and Drummond 2013) . Maximum L ikelihood (ML) analysis of the alignment was performed using Phy ML 3.0 on the ATGC, South of France bioinformatics platform server (Guindon et al. 2010) . Bootstrap analysis was

PAGE 108

108 used to test the strength of the ML tree topology (100) (Felsenstein 1985) . Figures were edited in FigTree v1.3.1 (Rambaut 2010) . For the polyomavirus analysis , homologous amino acid sequences were aligned with MAFFT (Katoh and Toh 2008) using default setting s . Samples w ere tested for phylogenetic signal in using l ikelihood m ap p ing in TreePuzzle (Schmidt et al. 2002) . The a mino acid substitution model was chose n using ProtTest 3.2 (Abascal et al. 2005, Darriba et al. 2011) . Bayesian analysis of the amino acid alignment was performed using MrBayes 3.2.2 (Ronquist et al. 2012) on the CIPRES server (Miller et al. 20 11) using the best model of evolution available. ML analysis of the alignment was performed using PhyML 3.0 in in ATGC South of France bioinformatics platform server (Guindon et al. 2010) using the best mod el of evolution. Human polyomavirus 6 (HPyV6, GenBank accession no. NC014406) was designated as the outgroup . qPCR Assay The optimized and specific CSLAdV 1 qPCR assay (Chapter 3) was used to determine viral load s in the samples and to evaluate whether oth er animals in the collection had evidence of active adenoviral infection . qPCR was performed o n fecal samples of eight CS Ls and one HMS managed by the same zookeepers , as well as one harbor seal ( Phoca vitulina ) and one additional HMS that that shared the same pool with the suspected positive animals . Additional tissue s from the suspected positive animal ( l ung and k idney) and from one additional HMS ( l iver, l ung and k idn e y) were also analyzed.

PAGE 109

109 Results Histopatho logy Histologic findings included chronic hepatic passive congestion and pulmonary edema indicative of biventricular heart failure, chronic interstitial nephritis, membranous glomerulonephritis, renal afferent arteriolar arteriosclerosis, coronary arterial and aortic arteriosclerosis and c hronic gastroesophageal ulcer. Additionally, most hepatocytes displayed a 2 6 micron eosinophilic to amphophilic intranuclear inclu sion and marginated chromatin. Few, random, individu al hepatocytes were necrotic. In liver assessed via transmission electron microscopy ( T EM ) , many hepatocyte nuclei had few 80 90 nm icosahedral, non enveloped virions characteristic of adenovirus es . PCR and Sequencing PCR and sequencing identified an adenovirus (liver, kidney and lung) and a po lyomavirus (liver and lung) from the original suspected positive animals . For the adenovirus, the 339 nt PCR amplicon corresponding to the pol ymerase gene fragment w as 100% homologous to CSLAdV 1 , and the complete E1 B 19k gene w as 99.32 % homologous to CSLAdV 1. Sequence s of genes encoding antigenic proteins, as in the case of hexon and fiber , ha d lower similarities (95.8 4 % for the complete hexon and 95.8 3 % for the complete fiber ). The predicted amino acid sequence of the 231 nt polyomavirus VP1 fragment subgenomic sequence was 83% homologous to that of California sea lion polyomavirus 1 (CSLPyV 1) . The pan herpesviral PCR assay did not amplify any herpesvirus sequences . Cell Culture In culture, A549 cells inoculated with CSLAdV 1 showed CPE compatible with adenoviral infection within 3 days post infection (DPI), and were more evident 7 DPI .

PAGE 110

110 like clusters, and finally, detachment of the swollen cells from the growing surface. MDCK cells inoculated with CSLAdV 1 showed no significant changes. qPCR results we re consistent with these results, with viral genomic equivalent count s of 56,667 for A54 9 and below the limit of detection for MDCK cell s. To confirm that infectious progeny was formed, spent growth media from the 7 day old A549 cell culture was used to inoculate another flask of A549 cells, which then displayed signs of adenovirus induced CP E at 3 DPI, leading to total destruction of the cell monolayer by 20 DPI. Phylogenetic Analyses In order to evaluate whether the nucleoti de sequence from CSLAdV 1 present ed evidence of phylogenetic noise , we used the program DAMBE, which ind icated that al igned sequences w ere no t useful for phylogenetic analysis. Poor ly aligned regions were removed using Gblock s to obtain a total of 202 characters . After gaps were removed, the aligned sequence present ed signal of substitution saturation, but c ould be use d for phylogenetic analysis (Table 4 4 ) . In addition, likelihood mapping analysis indicate d that the aligned sequence s present ed phylogenetic signal (with and without poorly aligned sections ). Using JModelTest , a GTR+G model of evolution was selected and im plemented on the phylogenetic analys e s using Maximum Likelihood (ML) and Bayesian analysis approach . The topology of the tree was consistent in both analys e s . P hylogenetic analys e s show ed that all CSLAdV 1 form ed a well support ed cl a d e (Figure s 4 1 and 4 2 ) ; this result is consistent with the result of the m aximum identity matrix (Table 4 2).

PAGE 111

111 Phylogenetic analysis for the polyomavirus was performed in Mr Bayes using the top scoring model available (RtREV+G) and in ML with the best model (LG+G+I+F). The topology of the tree was consistent in both analys e s and indicate d that H MSPyV 1 is the sister group to the California sea lion polyomavirus , with 100% posterior probability in the Ba yesian analysis and 100% bootstrap support in the ML analysis (Figures 4 3 and 4 4 ). None of the fecal samples from the 11 pinniped s tested were positive for CSLAdV 1 or polyomavirus (Table 4 5 ) . CSLAdV 1 was found in all tissues of the original positive animal ; polyomavirus was found only in liver and lung from the original case. None of the tissue s of the second HMS w ere positive for CSLAdV 1 or polyomavirus (Table 4 5 ) Discussion The cause of death of this patient was determined to be multifactorial, wi th heart failure and severe renal failure as t he major contributing factors. Evidence of clinical disease typically associated with adenovirus or polyomavirus infection was not observed ant e or post mortem in this seal. Therefore, the significance of the viral infections in this case remains inconclusive. This is the first case of confirmed adenoviral infection in a Hawaiian m onk seal ; CSLAdV 1 is a cause of viral hepatitis in California sea lions and can cause hepatitis in other otariids as cases reported in Japan (Inoshima et al. 2013) . In addition, a sequence from Spain was submitted to Gene Bank as Otaria flavescens adenovirus 1 ( accession no. HM776944.1 ) . T his show s the ability of this virus to infect multiple species in differ e nt part s of the world . In the family Adenoviridae , similarit y greater than 95% at the amino acid level in the DNA dependent DNA polymerase protein can be considered a s

PAGE 112

112 the same virus type (Harrach et al. 2011) . The adenovirus found in this case is 100% similar to the section of partial polymerase used for adenovirus identification . T his represents an expansion of the host range of CSLAdV 1 in to phocids. The predicted E1 B 19k protein is also 99.32 % similar, but the complete predicted h exon protein ha d only 95.8 4 % similarity. The h exon is one of the most important antigen s of adenovirus es ; hypervariable regions of the hexon are largely responsible for antigentic type determination (Lu and Erdman 2006, Roberts et al. 2006) . In the comparison between a CSLAdV 1 from a CSL and the Hawaiian mo nk seal CSLAdV 1 , most of the difference s between strains occur red in these hypervariable region s . Changes i n this protein could represent an adaptation for infecting the new host. In the fiber, nucleotide similarity between both CSLAdV 1 was very similar to that seen in the hexon ( 95 . 8 3 % ), and also present ed localized areas of mismatch with the CSLAdV 1 found in CSL. T hose areas include d acidic repeat reg ion s that have been found to be homologous to proteins involved with adhesion in Trypanozoma cruz i , and Staphylococcus pneumonia , and to a latency associated nuclear antigen (LANA) of retroperitoneal fibromatosis herpesvirus of macaques ( Chapter 2 ) . Similar r epeat regions in pathogens mentioned above have been found to vary in number, and variations in repeat number may enable rapid evolution (Buscaglia et al. 1999) . This findin g provides evidence that fiber and hexon may be under selecti ve pressure and could have functional role s in the ability of CSLAdV 1 to jump into different specie s . Adenovirus es are non envelope d , provid ing them great er resistan ce to environmental conditio ns . S ome human adenoviruses can survive up to 384 days in ground water under experimental conditions (Ogorzaly et al. 2010) . Other studies found

PAGE 113

113 that human enteric adenoviruses can survive between 77 85 days in sea water at 15 C (Enr iquez et al. 1995) . Human adenoviruses are common in s ewage contaminated co a stal water s and have been found in outbreak s of gastroenteric disease associated with swimming pools (Foy et al. 1968, Pina et al. 1998, Li et al. 2011) . In this case, none of the animals that share d the sam e pool or w ere manage d by the same group of keeper s tested positive for CSLAdV 1, although past infection cannot be ruled out . It is also possible that these animals were resistant to infection or were not shedding CSLAdV 1 at the time the samples were tak en. This is also the first polyomavirus found in Hawaiian monk seals. In pinnipeds, polyomaviruses have been found in debilitated animals and placental tissues, with no clear clinical significance (Colegrove et al. 2010, Wellehan et al. 2011b, Duncan et al. 2013) . Recently , a novel polyomavirus was found in a stranded common dolphin calf with respiratory disease (Anthony et al. 2013b) . Co infection s can occur in debilitated animals. Cases of viral confection are not widely reported in the marine mammal literature ; a co infection of dolphin morbillivirus and T oxoplasma gondii infecting a Mediterranean fin whale has rece ntly been reported (Mazzariol et al. 2012) . Although infectious disease is often studied as a single agent causing disease, this reductionist view has limited real world application; infecti on with multiple agents is often synergistic in causing disease (Sinha et al. 2013) . Disease investigations should not cease at the identi fication of a single agent. Adenoviruses should be considered as a differential for hepatitis and diarrhea in any pinniped, especially in elderly or immunosuppressed animals, and in multi species

PAGE 114

114 exhibits that incorporate California sea lion s in the same pool or institution. The significanc e of the novel polyoma virus in pinniped s remain s unclear.

PAGE 115

115 Table 4 1. Primer s used to amplify CSLAdV 1 genes Primer name Sequence Gene Expected size ITR_IVa2gapR8 ACCGGGTTCAACAAAATGAG E1B 19K 700 bp ITR IVa2gap3 ATGACCAGCTGGAACCTTTG E1B 19K OtOutf iberF TGTTAAAGCGAAGTCTTTTAGATTCA Fiber CSLAdV 1 OtOutf iberR TGTTAAGTTGTATTAAAGCATTTTCAG Fiber CSLAdV 1 400 bp OtOutf iberR2 TCAGAGGAATTGGAAGAAAAAGA Fiber CSLAdV 1 2000 bp Ms_f iber_F1 TGGAGAGGGATTGGAAATAAAA Fiber HMS specific 1000 bp Ms_f iber R1 GCTCTGGCTCCATATCCTCA Fiber HMS specific Outside_Hex_F ATTGTGGGGATGGGTGTAAG Hexon CSLAdV 1 3000 bp Outside_Hex_R AAACCCAGGAAATCTTTTATCAT Hexon CSLAdV 1 Ms_hexon_F1 GCTTCTTTTCCTGGAGGAAGTT Hexon HMS specific 1500 bp Ms_hexon R1 AGCAACATTGTAACCATCTCCA Hexon HMS specific Ms h exon_F3 GCTGTAGACAGTTATGACCCTGA Hexon HMS specific 700 bp Ms hexon_ R3 TTTGCGGCACTTGAATATGA Hexon HMS specific

PAGE 116

116 Table 4 2. Maximum identity matrix based on 272 bp fragments of the DNA polymerase . CSLAdV 1_MS12001 CSLAdV 1_UF CSLAdV 1_MJ12 CSLAdV 1_GU979536.1 CSLAdV 1_MS12001 100 100 100 100 CSLAdV 1_UF 100 100 100 100 CSLAdV 1_MJ12 100 100 100 100 CSLAdV 1_2011.GU979536.1 100 100 100 100 Table 4 3. Maxi mum identity matrix based on 255 bp fragments of the h exon . Spain_ Otaria f lavescens _HM776944.1 UF_ CSLA dV 1 UF_MS CSLAdV 1 Spain_ Otaria flavescens _HM776944.1 100 99 99.4 UF_ CSLAdV 1 99 100 99.6 UF_MS CSLAdV 1 99.4 99.6 100 Table 4 4. Results from subs titution saturation test using DAMB E . Parameters with p oorly aligned regions without p oorly aligned regions Iss 1.1603 0.5818 Iss.c 0.7321 0.7154 Prob 0 0 Results Useless sequence Low level saturation

PAGE 117

117 Table 4 5 . Results of the CSLAdV 1 qPCR and PCR and HMSPyV 1 PCR . Species Patient Sample type qPCR CSLAdV 1 (copies detected) Adenovirus Consensus PCR Polyomavirus PCR Hawaiian monk seal HMS 1 Liver 225081360 CSLAdV 1 Positive Hawaiian monk seal HMS 1 Lung 129670.88 CSLAdV 1 Positive Hawaiian monk seal HMS 1 Kidney 112192.72 CSLAdV 1 Negative California sea lion CSL 1 Feces Negative Negative Negative Hawaiian monk seal HMS 2 Feces Negative Negative Negative California sea lion CSL 2 Feces Negative Negative Negative California sea lion CSL 3 Feces Negative Negative Negative California sea lion CSL 4 Feces Negative Negative Negative California sea lion CSL 5 Feces Negative Negative Negative California sea lion CSL 6 Feces Negative Negative Negative Hawaiian monk seal HMS 3 Feces Negative Negative Negative Hawaiian monk seal HMS 3 Liver Negative Negative Negative Hawaiian monk seal HMS 3 Lung Negative Negative Negative Hawaiian monk seal HMS 3 Kidney Negative Negative Negative California sea lion CSL 7 Feces Negative Negative Negative California sea lion CSL 8 Feces Negative Negative Negative Harbor seal HS 1 Feces Negative Negative Negative

PAGE 118

118 Figure 4 1. Maximum Likelihood p hylogram depicting the relationship of the California sea lion adenovirus 1 ( CSLAdV 1 ) from Hawaiian monk seal (HMS , in red ) with other CSLs based on the deduced nucleotide (nt) sequences of the partial DNA polymerase gene (202 nt characters excluding gaps and poorly aligned sequence ). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 119

119 Figure 4 2 . Bayesian analysis p hylogram depicting the relationship of the California sea lion adenovirus 1 ( CSLAdV 1 ) from Hawiian monk seal (HMS , in red ) with other CSLs based on the deduced nucleotide (nt) sequences of the partial DNA polymerase gene (202 nt characters excluding gaps and poorly aligned sequence). Numbers at each node represent the posterior probability as percentage s f rom the Bayesian analysis. Branch len gths are based on the number of inferred substitutions, as indicated by the scale.

PAGE 120

120 Figure 4 3 . Maximum Likelihood p hylogram depicting the relationship of the Hawaiian monk seal polyomavirus 1 ( HMS PyV 1 , in red ) based on the deduced amino acid (A A) sequences of the partial VP1 gene (604 AA characters including gaps and poorly aligned sequence). Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, a s indicated by the scale.

PAGE 121

121 Figure 4 4. Bayesian analysis p hylogram depicting the relationship of the Hawaiian monk seal polyomavirus 1 ( HMS PyV 1 , in red ) based on the deduced amino acid (AA) sequences of the partial VP1 gene (604 AA characters including gaps and poorly aligned sequence) . Numbers at each node represent the posterior probabilities as percentage s from the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the sca le.

PAGE 122

122 CHAPTER 5 DIVERSITY OF ADENOVIRUSES IN OTARID SEALS (CALIFORNIA SEA LIONS AND SOUTH AMERICAN FUR SEALS) AND SPECIES IN HIGH CONTACT (HUMBOLDT PENGUINS) Introduction The family Adenoviridae is composed of 5 genera; Mastadenovirus, Aviadenovirus , Atadenovirus , Siadenovirus , and Ichtadenovirus . Three of them have been found only in specific vertebrate classes: Ichtadenovirus has been found only in bony fish (white sturgeon; Acipenser transmontanus ) , Mastadenovirus has been found only in mammalian hosts, and Aviadenovirus has been found mainly in avian hosts (Davison et al. 2003, Anthony et al. 2013a) . Recently, a sixth genus has been proposed for the adenoviruses of testudinoid turtles: Testadenovirus (Doszpoly et al. 2013) . Within each adenovirus gen us there are two additional taxonomic divisions, species and type. One criterion used to assign an adenovirus to taxonomic levels is the phylogenetic distance of t he DNA polymerase amino acid sequence. When the distance is greater than 15%, the mast adenovirus can be considered to be a new species, and distances between 5 15% could be considered distinct type within a species (Harrach et al. 2011) . Adenoviruses are found in diverse vertebrate species, but the current understanding of their richness has an apparent research bias. A greater number of adenoviruse s (67 types in seven species) have been identified in humans than any other species (Harrach et al. 2011, Matsushima et al. 2013) . In domestic animals, the number drops dramatically, with the identification of 10 bovine adenoviruses, seven ovine adenoviruses, five porcine adenoviruses, two equine adenoviruses, two canine adenoviruses , and none in feline s . In wildlife, the most studied animals are non human primates, due to zoonotic concerns, and more than 48 types have been discovered in

PAGE 123

123 four adenovirus species (Harrach et al. 2011) . Several adenovirus studies from Chiroptera have also been published (Maeda et al. 2008, Li et al. 2010, Kohl et al. 2012, Raut et al. 2012, Anthony et al. 2013a) . The order Chiroptera , the bats, have over 1,100 species , making up more than 20% of extant mammals (Teeling et al. 2005) . I n addition to constituting such a large portion of mammalian biodiversity, the gregarious social characteristics of many bat species is anoth er characteristic with which diverse associated microbiomes are expected (Phillips et al. 2012) . Recognition of this h as led to a recent investigative bias toward bat species (Maeda et al. 2008, Li et al. 2010, Kohl et al. 2012, Raut et al. 2012, Wu et al. 2013) . Only three adenovirus types have been described in the mammalian order Carnivora ; the two canine adenoviruses and the California sea lion adenovirus 1 ( CSLAdV 1). Both canine adenoviruses may have originated from a host jump from a bat adenovirus (Kohl et al. 2012) . CSLAdV 1 could have originated from an unknown laurasiatherian host (Chapter 2). It is not clear whether any known adenovirus from a host in the order Carnivora has cospeciated with the lineage. Placental mammals are divided into four main superorders: two less speci ose clades, Afrotheria (including elephants/aardvarks/sea cows/tenrecs/hyraxes) and Xenarthra (armadillos/sloths/anteaters), an d two larger clades, Laurasiatheria (including species of greatest veterinary significance [horses, ruminants, suids, and the order Carnivora ] and others such as pangolins and chiropterans) and Euarchontoglires (primates/rabbits/rodents) (Murphy et al. 2001) . Within the genus Mastadenovirus , phylogenetic analyses have found a general trend for the viruses using hosts in the superorder Euarchontoglires and those found in hosts from the superor der

PAGE 124

124 Laurasiatheria to segregate (Hall et al. 2012) . This is consistent with the expected high host fidelity of mast adenoviruses. South American fur seals (SAFS, Arctocephalus aus tralis ) have a large range of distribution along the Pacific and Atlantic coasts of South America. On the Pacific side, populations are found in Perú and Chile, and on the Atlantic coast, populations have been reported from Argentina to Brazil, with the la rgest population in Uruguay ( King 19 83) . For SAFS populations, most studies consider there to be more than one isolated population or even subpopulation . De Oliveira et al. ( 2008 ) consider the Peruvian population a s an independent evolutionary unit. Other studies suggest that the Peruvian population should be considered a subpopulation of SAFS (Berta and Churchill 2012) . Samples were obtained from a Peruvian and a C hilean population. Those two independent populations inhabit habitats that differ in productivity patterns. Punta San Juan, Perú, is an area recognized for having high populations of marine mammals and marine birds supported by the high productivity of the Humboldt upwelling. This high productivity system also supports commercial fisheries, causing a reduction in the resources available for the animals. In addition, El Niño events can occur in any year , with an expected cycle every 4 to 7 years. This event causes a reduction in the primary productivity and generates devastating mortalities, especially of young wild marine animals. The Humboldt upwelling does not influence Guafo Island, in the south of Chile. The productivity in this area depends on the const ant nutrient flow from multiple rivers generating a more stable productive system (Hennicke and Culik 2005) . California sea lions, Zalophus californianus, range in the North Pacific, from British Columbia, Canada to central Mexico including the Gulf of California ( King, 1983).

PAGE 125

12 5 The global population is approximately 350,000 ani mals, mainly in California (Carretta et al . 2007). Using mitochondrial DNA data, researchers have proposed five distinct populations, two in the Pacific Ocean and three inside the Gulf of California (Schramm et al . 2009) . Humboldt penguins (HP, Spheniscus humboldti ) have a range of distribution from Isla Foca in P erú to Isla Puñihuil in Chile. Their population is estimated to be between 3,300 to 12,000 animals (BirdLife 2013) ; more optimistic studies consider that the colony in Isla Chañaral, Chile, represent s the most important colony for this species with 22,000 adults (Mattern et al. 2004) . Microsatellite data obtained from 5 loci suggests that Humboldt penguin s should be considered as one metapopulation, and life history and dispers al data suggest that no distinct populations exist (Schlosser et al. 2009) . In general, adenoviruses hav e been demonstrated to be more pathogenic when there is high host density or when the host is immunosuppressed (Krilov 2005) . These conditions could also facilitate host jumping. An adenoviral host jump event from one primate into different primate species has been documente d in a research facility. This jump from a natural reservoir caused respiratory signs with high mortality in Titi monkeys, clinical respiratory illness in one person from the directly exposed population, and seropositive humans in the indirectly exposed po pulation (Chen et al. 2011) . In systems with high resource variability and high population densities of breeding animals of different species, like Punta San Juan, it is an ideal situation to evaluate adenoviral diversity and ability to jump hosts in a natural system. This drove us to examine HP and SAFS from this site.

PAGE 126

126 This study surveyed adenoviral diversity in pinn i peds (SAFS and CSL); we searched for evidence of host jump events and environmental conditions that could impact the occurrence of host jumps. Finally, we wanted to obtain more data regarding possible adenoviral/host evolutionary history in the Carnivora l ineage to understand the evolutionary history of CSLAdV 1, examined in chapter 2 . Specific Aims Specific Aim 1: Explore the diversity of adenoviruses in Zalophus californianus and Arctocephalus australis Specific Aim 2: Determine the diversity of adenoviru ses in two populations of Arctocephalus australis using molecular techniques Hypothesis 1: Adenoviral diversity will be similar between years and populations Specific Aim 3: Obtain a second gene for all new adenoviruses found, especially those that could r epresent a host jump Specific Aim 4: Evaluate a possible aviadenovirus host jump found in Arctocephalus australis Hypothesis 2: We will find an identical or closely related aviadenovirus in birds from Punta San Juan, Perú Materials and Methods Sample Size for South American Fur Seals To estimate the sample size for disease detection we used the prevalence obtained from pilot data with SAFS respiratory samples from 2009, 2010 (Per ú), and 2012 (Chile) (Table 5 1) . Sample Collection S amples came from healthy SAFS of diverse ages, f rom pups to adults (Table B 1 ). The fir s t set of samples were f rozen nasal dry swab samples were obtained in health surveys done in pups in Perú (2009 2010) . The second set of samples were n asal and fecal swabs obtained during healt h assessments done by collaborators in Perú (2012)

PAGE 127

127 and Chile (2011) , and were saved in RNAlater or PBS. In Perú, sympatric HP w ere also surveyed for adenoviral diversity. A total of 60 nasal swabs in South American fur seal (SAFS, Arctocephalus australis ) pups from Perú were collected in 2009 2010; 35 paired nasal and fecal swabs from SAFS pups from Chile in 2012, and 23 paired nasal and fecal swabs from adult SAFS from P erú from 2012 were used (Table B 1 ). Additional Peruvian samples were obtained ; 48 se ts of conjunctival choanal cloacal samples from Humboldt penguins (HP, Spheniscus humboldti ) in 2011 and 33 paired choanal and cloacal swabs from 2012. Finally, seven paired nasal and fecal swabs from adult South America sea lion s (SASL, Otaria flavescens ) in Perú in 2012 were analyzed (Table B 1 ). In the case of the CSL, the samples came from an Unusual Mortality Event (UME) that occur red in California during 2013. We received 42 oral/nasal individual swabs and 10 respiratory tissue samples from 5 animals . Sample Management Fecal and respiratory swabs were received; historical samples were dry swabs, and samples collected during 2011 2013 were saved in RNAlater or PBS. The samples were maintained in RNAl ater or PBS at l of R NAlater or PBS (according to the preservation method) were used. If the swab was a dry swab, 500 l of PBS buffer was added and 300 l were used for the extraction. Sample extractions were done using a Maxwell 16 automated extractor (Promega, Madison, WI, USA). Sample concentrations were measured by spectrophotometry in a NanoDrop 8000 spectrophotometer (ThermoScientific). For tissue samples , the same protocol was followed but up to 50 mg of tissue w as used.

PAGE 128

128 PCR Conditions For the nested protocol , a pan ad enoviral protocol was used as previously described (Wellehan et al. 2004) . For host verification we u sed barcoding , a 655 bp segment of the mitochondrial cytochrome oxidase subunit I (cox 1) gene was sequenced as previously described (Ward et al. 2005) using two set s of primers (Table 5 2). PCR was done using Platinum Taq ® DNA Polymerase ( Platinum Taq DNA polymerase, Invitrogen, Carlsbad, CA, USA). For host identification , the PCR conditions were initial denaturation at 95 C for 5 min, followed by 45 cycles of denaturation at 95 C for 1 min, annealing at 6 degrees below the predicted primer melting temperature for 30 s, and extension at 72 C for a time dependent on the length o f the expected sequence (1 min/ 1 Kbp), followed by a final elongation step at 72 C for 7 min. PCR products were run in a 1% agarose gel . Fragments of the expected size were cut and gel extracted using a QIAquick ® Gel extraction kit (Cat No 28706, Qiagen) following the . The ge l extracted PCR products were sequenced in both directions using ABI 3130 DNA sequencers (Life Technologies, Carlsbad, CA, USA ). Analysis A Chi Square test was used to determine differences in adenovirus prevalence found in SAFS pups from 2009 vs. 2010. Data was analyzed as presence or absence of virus in 2009 vs . 2010 (Table 5 3 ) . Phylogenetic Reconstruction P artial DNA dependent DNA polymerase protein sequence s were used for the phylogenetic analysis. Forty adenoviruses were obtained from GenBank: 26 m astadenoviruses, five aviadenoviruses, four atadenoviruses, fou r siadenoviruses, and

PAGE 129

129 one ichta denovirus (sturgeon adenovirus 1, Gen Bank accession no . AAL89791 ). Amino acid sequences homologous to the predicted amino acid sequence s of these proteins were al igned using MAFFT ( Katoh and Toh 2008). To choose an amino acid substituti on model, ProtTest 3.2 was used. S turgeon a denovirus 1 was designated as the outgroup. Bayesian analysis of the amino acid alignments with the best model of evolution available was p erformed using MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003) on the CIPRES server (Miller et al. 2011) . Bayesian analysis was run with 4 chains, 3 hot chains and 1 cold chain with the default heating parameter (temperatur e = 0.2). The analysis was run for a maximum of 1,000,000 generations . The chains were sampled every 100 generations, and the first 20% of MCMC samples was discarded as burn in. To determinate whether this number of generations was adequate to reach stabil ity and calculate whether we obtained an ESS (Effective sample size), we used the program TRACER 1.5. (Rambaut and Drummond 2013) . Maximum L ikelihood (ML) analysis of the alignment using the best model of evolution was performed using PhyML (Guindon et al. 2010) . One hundred bootstrap replicates were used to test the strength of the tree topology (Fel senstein 1985) . Figures were edited in FigTree v1.3.1 (Rambaut 2010) . qPCR Assay Primers and probes were designed for t he aviadenoviruses found in SAFS and HP (SAFS Aviadenovirus 2, SAFSAviaAdV 2), targeting the region of the polymerase gene discussed above. Primers and probes were designed using the program Primer express ® version 3.0 (Applied Bios ystems, Foster City, CA, USA). The probe, qPCR

PAGE 130

130 Avia2SH SAFS_Probe, was designed with a FAM reporter dye and black hole quencher (Table 5 4 ). Each sample was run in triplicate for adenovirus and one additional well was run with 18S rRNA gene as an internal control. The master mix consisted of 20 uL per reaction, with ® Fast Universal PCR Master Mix 2X, Applied Biosystems, Foster City, CA, USA), 1 of primers and probe ( to a concentration of 18 M for e ach primer, 5 M for the probe ) , L of water , and 4 L of DNA extract. All reactions were run in a 7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA, USA) under a standard fast protocol (denaturation at 95 C for 20 s; 45 cycles of 95 C for 3s followed by 60 C for 30s). Fo r standard curves, specific primers (Avia2SH SAFS_FTP and Avia2SH SA FS_RTP) were designed (Table 5 4 ). These primers were used to generate an amplicon to be use d in the qPCR standard curve. Dilutions were made with TE buffer ranging from 10 7 to 10 1 copies per 4 L . The slope and R 2 were estimated with the ABI 7500 software. This program also calculates the threshold of detection. Results F ive mastadenoviruses, four aviadenoviruses and one siadenovirus were identified in SAFS , with all samples verif ied using host DNA sequence as SAFS (Table 5 5 ) . In the case of the mastadenoviruses , one was common to both populations, three were found only in the Peruvian population, and one mastadenovirus was present only in the Chilean population. All aviadenoviruses were f ound in the pups from the Peruvian population in the 2009 sampling season . In HP, three mastadenoviruses, two aviadenoviruses, and three siadenoviruses were identified . One aviadenovirus and one

PAGE 131

131 siadenovirus were detected in both HP and SAFS. This is one o f the first reports we are aware of regarding aviadenoviruses in mammals, the first report of siadenovirus in a mammalian host , and the first report of mast adenoviruses in birds (Table 5 6 , Figures 5 1 and 5 2). In CSL, four novel mastadeno viruses were det ected (Table 5 7 ). Several set s of primers were used to attempt obtain a second gene in the novel adenoviruses; none of the combination s of primers result ed in successfully sequencing a second gene (data no t shown) . Chi square analysis revealed a statisti cally significant differe nce for aviadenoviruses (p=0.018 ) but not for mastadenoviruses (p=0.67 ) in SAFS pups from 2009 vs. 2010 (Table 5 8) . Aviadenoviruses were present in pup samples from 2009, but not in pup samples f rom 2010. Phylogenetic analyse s wer e performed using partial DNA polymerase; using LG+G as the model of evolution for the Maxim um L ikelihood (ML) analysis and RtRev+G for the Bayesian analysis . A pinniped clade that contain ed four novel SAFS adenoviruses, two novel HP adenoviruses and three novel CSL adenoviruses (Figure 5 1) w as identified . Maximum Likelihood analysis reveal ed poor support of the node for this clade . However, i n the Bayesian analysis , better node support was foun d. In addition, both phylogenetic reconstructions identif ied one penguin mastadenovirus in the canine bat equine clade, and o ne CSL and one SAFS mastadenovirus form ed an independent clade . In the case of the Bayesian analysis, this clade is found at th e root of the mastadenoviruses with high node support (Figure 5 2). The qPCR assay for SAFS Aviadenovirus 2 (SAFSAviaAdV 2) shows that South American fur seals have a low concentration of virus particles in comparison with the

PAGE 132

132 Humboldt penguins (Table 5 9 ). This assay was not found to be specific for SAFS Avia AdV 2 and amplified all novel aviadenoviruses f o und in SAFS and HP (Table 5 9 ) . Discussion Adenoviruses often do not induce significant disease in their endemic host s . A high diversity of adenoviruses can be found in humans, with up to 67 different types (Matsushima et al. 2013) . Wild animals are understudied, with the exception s of bats and primates, which have been examined because of public health concerns. Fur seals, sea lions , and penguins are colonial species. This characteristic facilitates increased contact between animals and consequently transmission of viruses. In addi tion, some adenoviruses can persist under some environmental condition s , including sea water at 15 C for up to 85 days (Enriquez et al. 1995, Ogorzaly et al. 2010) . This environmental stability in combination with a high concentration of animals favors viral diversity. Environmental stressors may lead to clinical disease, as has been seen in military settings, where adenovirus is an important cause of respiratory disease (Gray et al. 2000, McNeill et al. 2000) . This has also been seen in domestic dogs, where c anine adenovirus 2 is part of the kennel cough complex. This could be particularly important in the studied Perúvian site, since the Humboldt upwelling that supports all primary productivity of the system is affected by the El Niño Event. Adenoviruses have a recognized predisposition to coevolve with their hosts. This is more evident at the genus level, where mastadenoviruses have never been reported in avian hosts, and siadenoviruses and avidaenoviruses h ave not been reported in mammalian hosts with the exception of an aviadenovirus in a bat ( PgAdV 2) (Anthony et al. 2013a) . In the phylogenetic analysis, adenoviruses of pinnipeds were not found to

PAGE 133

133 follow the evolutionary history of their hosts. In this analysis, CSLAdV 1 has a basal position in what is here called a pinniped clade, further providing support to the hypothesis that CSLAdV 1 came from a host jump. The pinniped clade includes most of th e pinniped mastadenoviruses except for SAFSMa s ta 4 and CSLAdV 4, that appear to be sister taxa. E xcluding CSLAdV 1 and TSAdV 1 , the pinniped clade generally has good support in the Bayesian analysis ( Figure 5 1 ). This could indicate that most of the pinnip ed adenoviruses could be derive d from a host jump that probably occurred after they adopted an aquatic life. Further analys e s including molecular clock calibration could help to understand the time of infection of adenoviruses in pinnipeds , which could the n be correlated with divergence times in the carnivore linage. It is important to take into consideration that this analysis is just a partial analysis of one particular gene; partial polymerase has been shown not to provide a well resolved phylogeny in so me taxa (Chapter 2). However, this analysis is consistent in placing pinniped adenoviruses outside of the canine bat equine clade , as was also seen with a more complete data set in the second chapter of this dissertation after exhaustive phylogenetic analys is es . Finally, some findings that could affect the phylogenetic analysis should be taken into consideration, including the general tendency of marine mammal adenoviruses to have a relatively low GC% content (Table 5 10 ). It is possible that the marine envi ronment where these mammals live may play a role yet to be determined in their AT bias. Finally, f ull genome analys e s sh ould help provide a better understanding of the phylogeny of pinniped adenoviruses. We found four aviadenoviruses in SAFS, which would not be expected in a mammalian host and has only been previous ly reported in one bat ( PgAdV 2) (Anthony

PAGE 134

134 et al. 2013a) . All aviadenovirus positive SAFS pup samples were from 2009. One of these novel aviadenoviruses wa s also found in HP, the most likely original host. This aviadenovirus was detected in only three samples from the first year (2009) of sampl ing SAFS nasal swabs , and was found in 22 HP samples (13 from 2010 and 9 from 2 009). The SAFS origin of th e s e samples w as confirmed for a subset of samples using the c ytochrome oxidase subunit I gene (Table 5 5 ) . Predation of pinnipeds on penguins has been reported and this could be one explanation for this finding. Another possibili ty is contact with fecal material of penguins. The qPCR assay revealed relatively lower viral count s in the SAFS samples in comparison with HP viral counts . The other SAFS aviadenoviruses were found only in SAFS, but we did not receive samples from the oth er bird species from the same area, which could be endemic hosts for these viruses. Finally, one siadenovirus was detected in a fecal sample of SAFS, this virus was also found in HP. The presence of a siadenovirus in this SAFS could be explained by predati on of a siadenovirus positive penguin . A Chi square test found significant statistical difference in aviadenovirus presence in SAFS pups between 2009 and 2010, where aviadenoviruses were only found on 2009. No differences between years were found for mastadenoviruses. 2009 was an El Niño year, which may be related to th e presence of aviadenoviruses. In El Niño years, the primary productivity of the system is reduced. Young animals are most affected by this event, with increased mortalities due to starv ation, predation, and probably disease. It is known that adenoviruses can more easily infect immunosuppressed hosts (Krilov 2005) , and pups under unfavorable climatic conditions in highly populated areas where multiple species cohabit is an ideal environment for host jumps.

PAGE 135

135 We detected five novel mastadenoviruses in SAFS. The most common mastadenovirus was foun d in both populations of SAFS (SFSMastaAdV 2). Less common viruses were not found in both populations (SFSMastaAdV 1,3, and 5 were found only in Perú and SFSMastaAdV 4 only in Chile). This could be related to the isolation of these populations of SAFS. Some authors propose that these populations represent two different evolutionary units of SAFS (de Oliveira et al. 2008) . This hypothesis is argued against by our findings , since we found the same virus in both populations instead of a cospeciation pattern. However, we also found some viruses unique to each pop ulation, which coul d favor an ongoing speciation. The polymerase region is highly conserved, and as we saw with CSL and HMS adenoviruses , may not be as useful for differentiating less recently diverged adenoviruses. Future analysis of more variable regions of adenoviruses, particularly of the adenoviruses found in both populations , may help to understand the evolutionary history of South American fur seal adenoviruses . No adenoviruses were detected in South American sea lions, but the sample size was quite reduced in comparison with the other two pinniped species, and samples originated from healthy adults. In HP we found several novel viruses, including three mastadenoviruses. This is the first report of mastadenoviruses in birds. Two of them were in the pinniped clade and could possibly be explained by habitat sharing between HP and SAFS in Punta San Juan. One was in the canine horse bat clade. Attacks by bats on HP chicks have been reported (Luna Jorquera and Culik 1995) , and it is possible that this novel virus may represe nt a host jump from a mammalian host into a bird and with an apparent adaptation to penguins, since it has been detected in two sampling years in a total of

PAGE 136

136 three animals in cloac al swabs or mix ed samples . As an alternative hypothesis this finding could re present a contamination with mammalian fecal material with ingestion or inhalation by Humboldt penguins. Finally, we detected four novel mastadenoviruses in CSL. Three of them are in the same clade with other known pinniped adenoviruses; California s ea l ion adenovirus 1, Phocid adenovirus 1 and 2 ( CSLAdV 2, PhAdV 1 and PhAdV 2). Most of the CSL mastadenoviruses were found in lung s and lymph node s, with some samples coming from nasal swabs and fecal swabs (Table 5 7). We found several possible host jumps, based on the most likely hosts for these adenoviruses. As previously mentioned, this is the first report of a siadenovirus and one of the first reports of an aviadenovirus in a mammalian host, and the first report of a mastadenovirus in an avian host. How ever, the types of samples do not allow confirmation of this as true infection . Molecular techniques were used to investigate the sources of the samples and to confirm that most of the genomic material of those positive animals came from the host where the y were collected. It is not possible to definitively confirm or reject a contamination of those samples with traces of fecal material of other hosts, even though samples were taken deeply in the nasal cavity or choana, avoiding contact with external nares. Fecal and cloacal samples could be more related with prey items, but for all samples analy zed, DNA corresponding to the species from which the sample were extracted was found . Further samples of tissues of infected animals could help to determine whether those viruses are invading deeper tissues and determine whether there are pathological changes related to viral infection. On the other hand, the low viral loads found could indicate that the infection was not successful

PAGE 137

137 enough to generate pathological cha nges. The ability of a pathogen to infect a given host, and the ability of the host immune system to prevent infection merits further study.

PAGE 138

138 Table 5 1. Sample size required per virus detected in each population of South American fur seal (SAFS), per population . Virus \ Population Perú (11,000)* Chile (30,000)** SAFS Masta denovirus 1 average 1.5% 197 SAFS Masta denovirus 2 average 3%* & 17 % ** (resp and fecal) 98* 14** SAFS Masta denovirus 3 average 3% 98 SAFS Masta denovirus 4 average 2.8% 106 SAFS Masta denovirus 5 average 4.4% 67 SAFS Avia denovirus 1 average 6.5% 45 SAFS Avia denovirus 2 average 5% 59 SAFS Avia denovirus 3 average 1.5% 197 SAFS Avia denovirus 4 average 1.5% 197 Table 5 2. Primer s used for host bar coding . Primer name Sequence FishF1 TCAACCAACCACAAAGACATTGGCAC FishR1 TAGACTTCTGGGTGGCCAAAGAATCA FishF2 TCGACTAATCATAAAGATATCGGCAC FishR2 TAGACTTCTGGGTGGCCAAAGAATCA Table 5 3. Chi Square 2x2 table for adenovirus comparisons between 2009 and 2010. All adenoviruses Year 2009 2010 Positive animals YES 12 4 16 NO 18 26 44 30 30 60 Table 5 4 . Primers and probes used in the qPCR assay s and generation of template for the qPCR assay s . Primer name Sequence qPCR Avia2SH SAFS_F TCCGCCAGACATCCGAAAT qPCR Avia2SH SAFS_R CGACCCCCGCGTTTG qPCR Avia2SH SAFS_Probe GATCCGTTGCCTCCCATCTGC Avia2SH SAFS_FTP TCACTGCCGATCACGTAGAG Avia2SH SAFS_RTP AAAGCCTTTCGTTTGTCCAC

PAGE 139

139 Table 5 5 . Results of host barcoding. Sample number Type of sample Adenovirus Barcoding Aau11001 Nasal swab SFSAvia AdV 1 Arctocephalus australis Aau11002 Nasal swab SFSAvia AdV 2 Arctocephalus australis Aau11003 Nasal swab Negative Arctocephalus australis Aau11008 Nasal swab Negative Arctocephalus australis Aau13092 Rectal swab HPSia AdV 2 Arctocephalus australis Table 5 6 . Number of positive samples for each adenovirus found in the two sample sites. Viruses (sample type) Perú 2009 (SAFS:30) Perú 2010 (SAFS:30) Perú 2011 (HP:48) Chile 2011 (SAFS:35) Perú 2012 (SAFS: 23; SSL: 7; HP: 33) SAFSMastaAdV 1 (resp) 1 0 0 0 1 SAFS SAFSMastaAdV 2 (resp and fecal) 0 2 0 9 0 SAFSMastaAdV 3 (resp) 1 2 0 0 1 SAFS SAFSMastaAdV 4 (resp) 0 0 0 1 0 SAFSMastaAdV 5 (fecal) 0 0 0 0 1 SAFS SAFSAviaAdV 1 (resp) 5 0 0 0 0 SAFS Avia AdV 2 (resp)/HPAviaAdV 1 ( mixed ) 3 0 13 0 9 HP SAFSAviaAdV 3 (resp) 1 0 0 0 0 SAFSAviaAdV 4 (resp) 1 0 0 0 0 HPMastaAdV 1 ( mixed ) --1 -2 HP HPMastaAdV 2 ( mixed ) --1 -0 HPMastaAdV 3 ( mixed ) --2 -0 HP Avia AdV 2 ( mixed ) --1 -2 HP HP AviaAdV 3 (fecal) --0 -3 HP HP AviaAdV 4 (fecal) --0 -1 HP HPSiaAdV 1 ( mixed ) --1 -2 HP HP SiaAdV 2 ( mixed ) --3 -6 HP, 1 SAFS HPSiaAdV 3 ( mixed ) --1 -0

PAGE 140

140 Table 5 7 . Novel California sea lion adenoviruses . Sample ID Sample Type Virus ZC13061 Nasal Swabs CSLAdV 3 ZC13084 Nasal Swabs CSLAdV 2 ZC13091 Oral Swab CSLAdV 1 ZC13096 Oral Swab CSLAdV 4 ZC13098 Oral Swab CSLAdV 5 ZC13101 Pulmonary lymph node CSLAdV 6 ZC13130 Lung CSLAdV 5 ZC13132 Lung CSLAdV 4 ZC13133 P ulmonary lymph node CSLAdV 4 ZC13136 Lung CSLAdV 2 ZC13149 Lung CSLAdV 6 ZC13150 Lymph Node CSLAdV 6 ZC13151 Lung CSLAdV 4 ZC13152 Lymph Node CSLAdV 4 ZC13171 Pulmonary lymph node CSLAdV 6 ZC13110 Fecal CSLAdV 6 ZC13030 Fecal CSLAdV 2/ CSLAdV 6 Table 5 8 . Chi squ a re result for adenoviruses in SFS pups fr o m Per ú. Virus p value Result All adenoviruses 0.049 Significa n t differences between year s Mastadenovi r u s es 0.663 No significa n t differences between year s Aviadenoviruses 0.018 Significa n t differences between year s

PAGE 141

141 Table 5 9 . qPCR results for SAFS Aviadenovirus 2 . Sample 18S (CT) Copies detected /well Consensus PCR Sh12013 25.06 220.85 SAFSAviaAdV 2 Sh12016 30.04 611.22 SAFSAviaAdV 2 Sh12018 25.04 29866.92 SAFSAviaAdV 2 Sh12020 24.98 33.02 SAFSAviaAdV 2 Sh12021 26.34 4.42 SAFSAviaAdV 2 Sh12026 22.21 295.32 SAFSAviaAdV 2 Sh12028 21.98 1522.03 SAFSAviaAdV 2 Sh12029 23.42 384.76 SAFSAviaAdV 2 Sh12036 21.9 391.5 SAFSAviaAdV 2 Sh12038 27.47 651.11 SAFSAviaAdV 2 Sh12040 20.86 149.48 SAFSAviaAdV 2 Sh12045 18.1 156.09 SAFSAviaAdV 2 Sh12046 32.91 1412.93 SAFSAviaAdV 2 Sh13006 27.53 34.34 SAFSAviaAdV 2 Sh13019 27.84 915.15 SAFSAviaAdV 2 Sh13099 26.75 3117.43 SAFSAviaAdV 2 Aau11002 27.96 9.36 SAFSAviaAdV 2 Aau11004 30.89 1389.96 SAFSAviaAdV 2 Aau11009 26.29 104.3 SAFSAviaAdV 2

PAGE 142

142 Table 5 10 . GC % content in the partial polymerase sequence s of marine mastadenoviruses . Partial polymerase GC% CSLAdV 1 37.1 CSLAdV 2 41.5 CSLAdV 3 42.9 CSLAdV 4 39.7 CSLAdV 5 44.5 CSLAdV 6 46.8 HPMastaAdV 2 41.2 HPMastaAdV 3 42.6 HPMastaAdV 1 56.6 PhAdV 1 34.2 PhAdV 2 34.2 SAFSMastaAdV 3 42.6 SAFSMastaAdV 4 41.2 SAFS MastaAdV 1 50.5 SAFSMastaAdV 2 45.8 BDAdV 1 39.5

PAGE 143

143 Figure 5 1 . Bayesian analysis p hylogram of predicted amino acid sequences for the partial adenoviral DNA dependent DNA polymerase (102 AA characters including gaps ). Line colors represent different adenovirus genera, in green: Mastadenovirus , red: Atadenovirus , purple: Aviadenovirus , brown: Siadenovirus blue: Testadenovirus , and orange: Ichtadenovirus . In the mastadenovirus clade it is possible identify a pinniped s ubclade with no vel mastadenoviruses in color; SAFS MastaAdVs 1 to 3 in purple, CSLAdVs 3 to 6 in brown, and HP MastaAdVs 2 and 3 in dark blue; CSLAdV 1 in red. In the bat canine equine subclade we can see HPMastaAdV 1 in light green. CSLAdV 4 and SAFSMasta AdV 4 form an independent group at the root of the mastadenovirus clade (blue arrow). In the aviadenovirus clade, novel aviadenoviruses SAFSAviAdV 1 to 4 are marked in clear blue and HPAviaAdV 2 to 4 are in brown. In the siadenovirus clade, HPSiaAdV 1 to 3 are in orange. Numbers at each node represent the posterior probabilities in percentage of the Bayesian analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale . Canine Bat Equine clade Pinniped clade

PAGE 144

144 Figure 5 2 . Ma x imum Likelihood p hylogram of predicted amino acid sequences for the partial adenoviral DNA dependent DNA polymerase (102 characteres including gaps). Line colors represent different adenovirus genera, in green: Mastadenovirus , red: Atadenovirus , purple: Aviadenovirus , brown: Siadenovirus blue: Testadenovirus , and orange: I chtadenovirus . In the pinniped mastadenovirus subclade, it is possible to see new mastadenoviruses (CSLAdV 3 to 6, SAFSMastaAdVs 1 to 3 and HPMAstaAdVs 2 and 3). In the bat canine equine clade we can see in green HPMastaAdV 1. Additionally, in red we ca n see CSLAdV 1. In the primate subclade we can see in dark brown CSLAdV 4, and in dark blue SAFSMastaAdV 4. New siadenoviruses are in orange, new aviadenoviruses are in blue for S A F S and brown for HP, and new mastadenoviruses are in dark blue for SAFS, dar k brown for CSL and purple for HP. Numbers at each node represent the bootstrap values of the Maximum Likelihood analysis. Branch lengths are based on the number of inferred substitutions, as indicated by the scale . Pinniped subclade Bat Canine Equine subclade

PAGE 145

145 CHAPT ER 6 CONCLUSIONS This study is focused on California sea lion adenovirus 1. The phylogenetic analysis found that this virus does not fit with the co evolutionary theory that has been proposed for adenoviruses in general, instead indicating a complex evoluti onary history that placed this virus at the root of adenoviruses infecting laurasiatheria n mammals . In addition, there is evidence of host jumping, causing fulminant hepatitis among eared seals, and in this dissertation we found that this virus infected a critical ly endangered species, the Hawaiian monk seal. In this clinical case, we identified a co infection of CSLAdV 1 with a novel polyomavirus, here named Hawaiian monk seal polyomavirus 1 ( HMSPyV 1 ) . In contrast to the clinical cases published in eared seals, this case did not present with clear hepatic disease. Comparison of different genes of CSLAdV 1 showed how fiber and hexon gene s present differences between CSLAdV 1 strains and could be used in the future to study possible differences in pathogenesis among strains. We developed a qPCR assay that proved to be an effective tool for diagnosis of clinical cases of CSLAdV 1. This assay was used to determine the prevalence of this virus in wild and op en managed collections, finding a low prevalence. This is an effective tool for monitoring the presence of CSLAdV 1 in pinniped collections , particularly for screening of mixed collections that include CSL and have elderly animals or a high percentage of i mmuno compromised animals Finally, we explored the diversity of adenoviruses in three species of pinnipeds; South American fur seals, California sea lions, and South American sea lions. Greater diversity was found in South American fur seals, with five nove l mastadenoviruses, four novel aviadenoviruses , and one novel siadenovirus. Four novel mastadenoviruses were

PAGE 146

146 found in California sea lions. No adenoviruses were detected in South American sea lions. One of the novel aviadenoviruses was also found in Humbol d t penguins. In HP we also found three novel aviadenoviruses , three novel mastadenoviruses , and three novel siadenoviruses . One of the sia denoviruses was also detected in a fecal sample of a South American fur seal. This is the first report of mastadenov i ruses in a non mammalian host and one of the first report s of aviadenovirus in a mammalian host , in addition to the first report of a siadenovirus in a mammal. This high diversity of adenoviruses among colonial animal s expand s the knowledge on adenoviral r ichness as well as the possibility of host jump s in the natural environment and should be further explored.

PAGE 147

147 APPENDIX A A: SUPPLEMENTARY DATA FOR CHAPTER 3

PAGE 148

148 Table A 1. E pidemiological data for stranded California sea lion s . Lab # Sex Age c lass Disposition Necropsied Cause of death Disposition SLength Disposition w eight Euthanasia r eason ZC12015 Female Adult e uthanasia Y es euthanasia, carcinoma 159 60 c arcinoma ZC12018 Male Juvenile e uthanasia Y es euthanasia, carcinoma, septicemia, gunshot 157 68 prolapse, seizure ZC12012 Male Subadult e uthanasia Y es domoic acid toxicity (chronic) 161 84 ZC12013 Female Adult euthanasia Y es renal failure, leptospirosis 160.5 64 non responsive prognosis ZC13025 Female Yearling released No 119 26 ZC12017 Female Adult died in treatment Y es c arcinoma 149 58.5 ZC12020 Male Subadult euthanasia Y es euthanasia, carcinoma 204 137 p aralysis ZC13026 Female Yearling released No 107 30 ZC12019 Female Adult euthanasia Y es euthanasia, carcinoma 179 61 abdominal mass ZC12014 Male Subadult died in treatment Y es l eptospirosis 190 116.5 ZC12011 Female Yearling euthanasia Y es euthanasia, leptospirosis, trauma 110 25 sharkbite/ exposed bone ZC13027 Male Juvenile released No 138 67 ZC12016 Female Subadult released No 121 28.5 ZC13028 Male Yearling placed research/enhancement No 112 27 ZC13029 Male Subadult euthanasia Y es euthanasia, pneumonia, osteomyelitis 171 50 emaciated, obtunded ZC13030 Female Adult released No 169 83 ZC13031 Male Juvenile released No 122 32.5 ZC13032 Male Subadult euthanasia Y es euthanasia, sharkbite 167 79 severe necrotic wounds ZC13033 Female Adult died in treatment Y es pneumonia, septicemia, anesthesia, carcinoma 159 73.5 ZC13034 Female Adult euthanasia Y es enteritis, pneumonia, euthanasia, carcinoma 160 68.5 geriatric, probable carcinoma, pneumonia ZC13035 Female Pup placed research/enhancement No 83 18 ZC13036 Female Adult euthanasia Y es euthanasia, carcinoma 153 59 poor prognosis, no improvement overnight ZC13037 Female Adult released No 159 78.5 ZC13038 Female Adult euthanasia Y es euthanasia, amyloidosis 157 56 renal amyloidosis; no treatment ZC13039 Female Adult euthanasia Y es euthanasia, prolapse 159 61.5 prolapse, poor prognosis ZC13040 Female Adult died in treatment Y es pneumonia, domoic acid toxicity (chronic), carcinoma 156 72 ZC13041 Female Adult died in treatment Y es C arcinoma 150 58 ZC13042 Female Adult euthanasia Y es euthanasia, pneumonia, encephalitis (protozoal) 165 80.5 doing poorly and suspect heart failure ZC13043 Female Adult euthanasia Y es euthanasia, domoic acid toxicity (chronic) 158 71 chronic domoic acid ZC13044 Female Adult euthanasia Y es euthanasia, domoic acid toxicity (chronic) 148 65 domoic acid (chronic) ZC13045 Female Adult euthanasia Y es euthanasia domoic acid toxicity (chronic), blind 166 78.5 blind,dragging hind end

PAGE 149

149 A 1. Continued Lab # Sex Age c lass Disposition Necropsied Cause of death Disposition SLength Disposition w eight Euthanasia r eason ZC13108 Female Pup released No 106 25 ZC13109 Male Yearling died in treatment Y es malnutrition, pneumonia 93 17 ZC13110 Female Pup released No 106 31.5 ZC13107 Female Adult euthanasia Y es euthanasia, domoic acid toxicity (chronic), encephalitis (protozoal) 149 52.5 domoic acid intoxication ZC13103 Female Adult died in treatment Y es septicemia 152 71 ZC13112 Female Adult euthanasia Y es euthanasia, carcinoma 163 61 suspect carcinoma ZC13225 Male Pup died in treatment Y es malnutrition, maternal separation 81.5 9 ZC13231 Female Adult euthanasia Y es euthanasia, carcinoma 163 72 carcinoma ZC13245 Male Juvenile euthanasia Y es euthanasia, sharkbite, osteomyelitis 133 53.5 Osteomyelitis ZC13244 Male Juvenile euthanasia Y es euthanasia, obstruction, malnutrition 136 33 poor prognosis ZC13235 Male Pup euthanasia Y es euthanasia, anesthesia, malnutrition 103 17.5 neurologic disease ZC13240 Male Pup released No 98 23 ZC13233 Male Pup released No 104 22 ZC13228 Male Pup released No ZC13248 Male Juvenile euthanasia Y es euthanasia, cardiomyopathy, encephalitis (protozoal) 140 42.5 heart disease ZC13230 Female Pup released No 98 23.5 ZC13226 Male Yearling released No 93 26.5 ZC13229 Male Yearling released No 110 28.5 ZC13243 Male Yearling died in treatment yes endocarditis 121 35.5 ZC13227 Male Yearling released No 83 22.5 ZC13237 Female Adult released No 173 73.5 ZC13236 Male Juvenile died in treatment Y es open awaiting histology 154 51 ZC13247 Male Yearling released No 128 43 ZC13238 Female Adult euthanasia Y es euthanasia, carcinoma 168 68.5 suspect urogenital carcinoma ZC13239 Female Adult euthanasia Y es euthanasia, carcinoma 175 85 poor prognosis, likely neoplasia ZC13234 Female Adult euthanasia Y es euthanasia, endocarditis, anesthesia 174 73.5 cardiac arrest under anesthesia ZC13232 Male Juvenile euthanasia Y es septicemia 151 59 poor prognosis ZC13249 Male Yearling released No 99 38 ZC13241 Female Yearling released No 95 19.5 ZC13246 Female Adult euthanasia Y es euthanasia, carcinoma 147 55.5 seizure ZC13250 Female Subadult euthanasia Y es neoplasia 155 57.5 perineal/vulvar mass; paralysis of hind flippers ZC13242 Female Adult euthanasia Y es euthanasia, urogenital carcinoma 145 50 suspect cancer ZC13251 Female Adult released No 132 69 ZC13252 Female Yearling released No ZC13253 Male Yearling released No

PAGE 150

150 A 1 . Continued Lab # Sex Age c lass Disposition Necropsied Cause of death Disposition SLength Disposition weight Euthanasia r eason ZC13247 Male Yearling released No 128 43 ZC13238 Female Adult euthanasia Y es euthanasia, carcinoma 168 68.5 suspect urogenital carcinoma ZC13239 Female Adult euthanasia Y es euthanasia, carcinoma 175 85 poor prognosis, likely neoplasia ZC13234 Female Adult euthanasia Y es euthanasia, endocarditis, anesthesia 174 73.5 cardiac arrest under anesthesia ZC13232 Male Juvenile euthanasia yes septicemia 151 59 poor prognosis ZC13249 Male Yearling released No 99 38 ZC13241 Female Yearling released No 95 19.5 ZC13246 Female Adult euthanasia Y es euthanasia, carcinoma 147 55.5 seizure ZC13250 Female Subadult euthanasia Y es neoplasia 155 57.5 perineal/vulvar mass; paralysis of hind flippers ZC13242 Female Adult euthanasia Y es euthanasia, urogenital carcinoma 145 50 suspect cancer ZC13251 Female Adult released No 132 69 ZC13252 Female Yearling released No ZC13253 Male Yearling released No ZC13254 Female Subadult euthanasia Y es euthanasia, peritonitis, coccidioidomycosis ZC13255 Female Subadult released No ZC13256 Female Subadult euthanasia Y es euthanasia, entanglement entanglement ZC13257 Female Adult died in treatment Y es anesthesia, domoic acid toxicity (chronic), cardiomyopathy 155 76 ZC13258 Female Adult died in treatment Y es domoic acid toxicity (chronic) 169 101 ZC13259 Female Adult euthanasia Y es euthanasia, domoic acid toxicity (acute) seizures uncontrollable ZC13260 Female Adult euthanasia Y es euthanasia, domoic acid toxicity (acute) anorexic, postictal/domoic acid toxicity ZC13261 Female Adult died in treatment Y es domoic acid toxicity (acute) 168 101 ZC13262 Female Subadult died in treatment Y es domoic acid toxicity (acute) ZC13263 Male Subadult euthanasia Y es euthanasia, pleuritis, peritonitis abdominal mass ZC13264 Male Juvenile released No ZC13265 Female Adult euthanasia Y es euthanasia, sharkbite sharkbite ZC13267 Male Adult died in treatment Y es congestive heart failure, anesthesia, abscess ZC13268 Male Juvenile euthanasia Y es euthanasia, abscess, pyothorax pyothorax ZC13269 Male Subadult released No

PAGE 151

151 APPENDIX B B: SUPPLEMENTARY DATA FOR CHAPTER 5

PAGE 152

152 Table B 1 . Epidemiological data and result s of the South Amerinca fur seal and Humboldt penguins adenovirus scr eening . Sampling year Sample site Sample ID Lab Number Gender Age class Respiratory samples Fecal samples Mixed (conjuntival choanal cloacal) samples 2009 Perú AA002 Aau11001 M pup SAFSAviaAdV 1 NA NA 2009 Perú AA004 Aau11002 M pup SAFSAviaAdV 2 NA NA 2009 Perú AA006 Aau11003 M pup PCR neg NA NA 2009 Perú AA008 Aau11004 M pup SAFSAviaAdV 2 NA NA 2009 Perú AA010 Aau11005 F pup PCR neg NA NA 2009 Perú AA012 Aau11006 M pup PCR neg NA NA 2009 Perú AA014 Aau11007 F pup PCR neg NA NA 2009 Perú AA016 Aau11008 F pup PCR neg NA NA 2009 Perú AA018 Aau11009 M pup SAFSAviaAdV 2 NA NA 2009 Perú AA020 Aau11010 M pup SAFSAviaAdV 1 NA NA 2009 Perú AA022 Aau11011 M pup PCR neg NA NA 2009 Perú AA024 Aau11012 F pup PCR neg NA NA 2009 Perú AA026 Aau11013 M pup PCR neg NA NA 2009 Perú AA028 Aau11014 M pup PCR neg NA NA 2009 Perú AA030 Aau11015 F pup SAFSAviaAdV 1 NA NA 2009 Perú AA0031 Aau11016 M pup PCR neg NA NA 2009 Perú AA0032 Aau11017 M pup SAFSAviaAdV 4 NA NA 2009 Perú AA0033 Aau11018 M pup PCR neg NA NA 2009 Perú AA0034 Aau11019 M pup SAFS Masta AdV 1 NA NA 2009 Perú AA0035 Aau11020 M pup SAFSAviaAdV 3 NA NA 2009 Perú AA0036 Aau11021 M pup PCR neg NA NA 2009 Perú AA0037 Aau11022 M pup SAFSAviaAdV 1 NA NA 2009 Perú AA0038 Aau11023 F pup SAFSMastaAdV 3 NA NA 2009 Perú AA0039 Aau11024 M pup SAFSAviaAdV 1 NA NA 2009 Perú AA0040 Aau11025 F pup PCR neg NA NA 2009 Perú AA0041 Aau11026 M pup PCR neg NA NA 2009 Perú AA0042 Aau11027 F pup PCR neg NA NA 2009 Perú AA0043 Aau11028 M pup PCR neg NA NA 2009 Perú AA0044 Aau11029 M pup PCR neg NA NA 2009 Perú AA0045 Aau11030 M pup PCR neg NA NA 2010 Perú AA1001 Aau11031 M pup PCR neg NA NA 2010 Perú AA1004 Aau11032 M pup PCR neg NA NA 2010 Perú AA1005 Aau11033 M pup PCR neg NA NA 2010 Perú AA1007 Aau11034 M pup PCR neg NA NA 2010 Perú AA1011 Aau11036 M pup PCR neg NA NA 2010 Perú AA1009 Aau11035 F pup PCR neg NA NA

PAGE 153

153 Table B 1. Continued Sampling year Sample site Sample ID Lab Number Gender Age class Respiratory samples Fecal samples Mixed (conjuntival choanal cloacal) samples 2010 Perú AA1013 Aau11037 M pup PCR neg NA NA 2010 Perú AA1015 Aau11038 M pup PCR neg NA NA 2010 Perú AA1017 Aau11039 F pup PCR neg NA NA 2010 Perú AA1019 Aau11040 M pup PCR neg NA NA 2010 Perú AA1021 Aau11041 M pup PCR neg NA NA 2010 Perú AA1023 Aau11042 M pup PCR neg NA NA 2010 Perú AA1025 Aau11043 M pup PCR neg NA NA 2010 Perú AA1027 Aau11044 F pup PCR neg NA NA 2010 Perú AA1029 Aau11045 F pup PCR neg NA NA 2010 Perú AA1031 Aau11046 F pup PCR neg NA NA 2010 Perú AA1033 Aau11047 F pup SAFSMastaAdV 3 NA NA 2010 Perú AA1035 Aau11048 M pup SAFSMastaAdV 2 NA NA 2010 Perú AA1037 Aau11049 F pup PCR neg NA NA 2010 Perú AA1039 Aau11050 M pup PCR neg NA NA 2010 Perú AA1041 Aau11051 M pup SAFSMastaAdV 2 NA NA 2010 Perú AA1043 Aau11052 F pup PCR neg NA NA 2010 Perú AA1045 Aau11053 F pup PCR neg NA NA 2010 Perú AA1047 Aau11054 F pup PCR neg NA NA 2010 Perú AA1049 Aau11055 F pup PCR neg NA NA 2010 Perú AA1051 Aau11056 M pup SAFSMastaAdV 3 NA NA 2010 Perú AA1053 Aau11057 F pup Mixed Mastadenoviruses NA NA 2010 Perú AA1055 Aau11058 F pup PCR neg NA NA 2010 Perú AA1057 Aau11059 M pup PCR neg NA NA 2012 Perú AA1201 AAU13001/AAU13070 M adult PCR neg PCR neg NA 2012 Perú AA1202 AAU13002/AAU13071 M adult PCR neg PCR neg NA 2012 Perú AA1203 AAU13003/AAU13072 M adult PCR neg PCR neg NA 2012 Perú AA1204 AAU13004/AAU13073 M adult PCR neg PCR neg NA 2012 Perú AA1205 AAU13005/AAU13074 M adult PCR neg PCR neg NA 2012 Perú AA1206 AAU13006/AAU13075 F adult PCR neg PCR neg NA 2012 Perú AA1208 AAU13007/AAU13076 F adult PCR neg PCR neg NA 2012 Perú AA1210 AAU13008/AAU13077 F adult PCR neg PCR neg NA 2012 Perú AA1212 AAU13009/AAU13078 F adult PCR neg PCR neg NA 2012 Perú AA1214 AAU13010/AAU13079 F adult PCR neg PCR neg NA 2012 Perú AA1216 AAU13011/AAU13080 F adult PCR neg SAFSMastaAdV 1 NA 2012 Perú AA1218 AAU13012/AAU13081 F adult PCR neg PCR neg NA 2012 Perú AA1220 AAU13013/AAU13082 F adult PCR neg PCR neg NA 2012 Perú AA1222 AAU13014/AAU13083 F adult PCR neg PCR neg NA 2012 Perú AA1224 AAU13015/AAU13084 F adult PCR neg PCR neg NA 2012 Perú AA1226 AAU13016/AAU13085 F adult PCR neg PCR neg NA 2012 Perú AA1228 AAU13017/AAU13086 F adult PCR neg PCR neg NA

PAGE 154

154 Table B 1. Continued Sampling year Sample site Sample ID Lab Number Gender Age class Respiratory samples Fecal samples Mixed (conjuntival choanal cloacal) samples 2012 Perú AA1230 AAU13018/AAU13087 F adult PCR neg SAFSMastaAdV 5 NA 2012 Perú AA1232 AAU13019/AAU13088 F adult PCR neg PCR neg NA 2012 Perú AA1234 AAU13020/AAU13089 F adult PCR neg PCR neg NA 2012 Perú AA1236 AAU13021/AAU13090 F adult PCR neg PCR neg NA 2012 Perú AA1238 AAU13022/AAU13091 F adult SAFSMastaAdV 3 PCR neg NA 2012 Perú AA1240 AAU13023/AAU13092 F adult PCR neg HPSiaAdV 2 NA 2012 Perú OF1201 OF13001/OF13030 M adult PCR neg PCR neg NA 2012 Perú OF1202 OF13002/OF13031 M adult PCR neg PCR neg NA 2012 Perú OF1203 OF13003/OF13032 M adult PCR neg PCR neg NA 2012 Perú OF1204 OF13004/OF13033 M adult PCR neg PCR neg NA 2012 Perú OF1205 OF13005/OF13034 M adult PCR neg PCR neg NA 2012 Perú OF1206 OF13006/OF13035 M adult PCR neg PCR neg NA 2012 Perú OF1207 OF13007/OF13036 M adult PCR neg PCR neg NA 2011 Perú SH670 SH12006 M adult NA NA PCR neg 2011 Perú SH47 SH12027 F adult NA NA Mixed Aviadenoviruses 2011 Perú SH657 SH12041 M adult NA NA HPSiaAdV 1 2011 Perú SH319 SH12047 M adult NA NA Mixed Mastadenoviruses 2011 Perú SH659 SH12013 M adult NA NA PCR neg 2011 Perú SH018 SH12026 F adult NA NA PCR neg 2011 Perú SH523 SH12030 F adult NA NA PCR neg 2011 Perú SH652 SH12004 M adult NA NA HPSiaAdV 2 2011 Perú SH332 SH12009 M adult NA NA HPSiaAdV 3 2011 Perú SH645 SH12021 F adult NA NA PCR neg 2011 Perú SH641 SH12024 F adult NA NA PCR neg 2011 Perú SH573 SH12036 M adult NA NA PCR neg 2011 Perú SH234 SH12002 M adult NA NA SAFSAviaAdV 2 2011 Perú SH649 SH12040 F adult NA NA PCR neg 2011 Perú SH655 SH12038 M adult NA NA HPMastaAdV 2 2011 Perú SH526 SH12045 M adult NA NA SAFSAviaAdV 2 2011 Perú SH643 SH12007 M adult NA NA HPMastaAdV 3 2011 Perú SH601 SH12016 F adult NA NA SAFSAviaAdV 2 2011 Perú SH647 SH12012 F adult NA NA HPSiaAdV 1 2011 Perú SH638 SH12018 M adult NA NA SAFSAviaAdV 2 2011 Perú SH340 SH12020 F adult NA NA SAFSAviaAdV 2 2011 Perú SH650 SH12042 M adult NA NA Mixed Aviadenoviruses 2011 Perú SH640 SH12023 F adult NA NA PCR neg 2011 Perú SH342 SH12011 M adult NA NA PCR neg 2011 Perú SH87 SH12035 F adult NA NA PCR neg 2011 Perú SH239 SH12017 F adult NA NA SAFSAviaAdV 2 2011 Perú SH048 SH12046 F adult NA NA Mixed Mastadenoviruses

PAGE 155

155 Table B 1. Continued Sampling year Sample site Sample ID Lab Number Gender Age class Respiratory samples Fecal samples Mixed (conjuntival choanal cloacal) samples 2011 Perú SH668 SH12033 M adult NA NA SAFSAviaAdV 2 2011 Perú SHC35 SH12010 F adult NA NA SAFSAviaAdV 2 2011 Perú SH257 SH12031 F adult NA NA Mixed Aviadenoviruses 2011 Perú SH646 SH12019 F adult NA NA PCR neg 2011 Perú SH666 SH12044 F adult NA NA PCR neg 2011 Perú SH644 SH12014 M adult NA NA Mixed Aviadenoviruses 2011 Perú SH658 SH12022 F adult NA NA HPSiaAdV 2 2011 Perú SH642 SH12037 M adult NA NA Mixed Aviadenoviruses 2011 Perú SH344 SH12008 M adult NA NA SAFSAviaAdV 2 2011 Perú SH651 SH12039 F adult NA NA HPMastaAdV 1 2011 Perú SH517 SH12015 M adult NA NA SAFSAviaAdV 2 2011 Perú SH654 SH12048 F adult NA NA PCR neg 2011 Perú SH470 SH12003 M adult NA NA SAFSAviaAdV 2 2011 Perú SH090 SH12034 M adult NA NA PCR neg 2011 Perú SH639 SH12005 M adult NA NA Mixed Aviadenoviruses 2011 Perú SH669 SH12032 F adult NA NA PCR neg 2011 Perú SH648 SH12028 M adult NA NA HPAviaAdV 2 2011 Perú SH519 SH12043 F adult NA NA SAFSAviaAdV 2 2011 Perú SH643 SH12001 M adult NA NA SAFSAviaAdV 2 2011 Perú SH101 SH12025 F adult NA NA PCR neg 2011 Perú SH656 SH12029 F chick NA NA HPMastaAdV 3 2012 Perú SH1201 SH13001/SH13096 NI NI PCR neg PCR neg NA 2012 Perú SH1202 SH13002/SH13097 NI NI PCR neg HPAviaAdV 4 NA 2012 Perú SH1203 SH13003/SH13098 NI NI PCR neg PCR neg NA 2012 Perú SH1204 SH13004/SH13099 NI NI PCR neg SAFSAviaAdV 2 NA 2012 Perú SH1205 SH13005/SH13100 NI NI PCR neg SAFSAviaAdV 2 NA 2012 Perú SH1206 SH13006/SH13101 NI NI SAFSAviaAdV 2 PCR neg NA 2012 Perú SH1208 SH13007/SH13102 NI NI PCR neg PCR neg NA 2012 Perú SH1209 SH13008/SH13103 NI NI PCR neg PCR neg NA 2012 Perú SH1210 SH13009/SH13104 NI NI PCR neg SAFSAviaAdV 2 NA 2012 Perú SH1211 SH13010/SH13105 NI NI PCR neg PCR neg NA 2012 Perú SH1212 SH13011/SH13106 NI NI PCR neg PCR neg NA 2012 Perú SH1213 SH13012/SH13107 NI NI PCR neg PCR neg NA 2012 Perú SH1214 SH13013/SH13108 NI NI PCR neg PCR neg NA 2012 Perú SH1215 SH13014/SH13109 NI NI PCR neg PCR neg NA 2012 Perú SH1216 SH13015/SH13110 NI NI PCR neg SAFSAviaAdV 2 NA 2012 Perú SH1217 SH13016/SH13111 NI NI PCR neg HPAviaAdV 2 NA 2012 Perú SH1218 SH13017/SH13112 NI NI HPAviaAdV 2 mix ed sia denovirus /avia denovirus NA 2012 Perú SH1219 SH13018/SH13113 NI NI PCR neg HPSiaAdV 2 NA 2012 Perú SH1220 SH13019/SH13114 NI NI SAFSAviaAdV 2 SAFSAviaAdV 2 NA

PAGE 156

156 Table B 1. Continued Sampling year Sample site Sample ID Lab Number Gender Age class Respiratory samples Fecal samples Mixed (conjuntival choanal cloacal) samples 2012 Perú SH1221 SH13020/SH13115 NI NI PCR neg SAFSAviaAdV 2 NA 2012 Perú SH1222 SH13021/SH13116 NI NI PCR neg HPSiaAdV 2 NA 2012 Perú SH1223 SH13022/SH13117 NI NI PCR neg HPSiaAdV 2 NA 2012 Perú SH1224 SH13023/SH13118 NI NI PCR neg HPSiaAdV 2 NA 2012 Perú SH1225 SH13024/SH13119 NI NI PCR neg HPSiaAdV 1 NA 2012 Perú SH1226 SH13025/SH13120 NI NI PCR neg PCR neg NA 2012 Perú SH1227 SH13026/SH13121 NI NI PCR neg HP Avia AdV 3 NA 2012 Perú SH1228 SH13027/SH13122 NI NI PCR neg HPSiaAdV 2 NA 2012 Perú SH1229 SH13028/SH13123 NI NI PCR neg HPSiaAdV 2 NA 2012 Perú SH1230 SH13029/SH13124 NI NI PCR neg PCR neg NA 2012 Perú SH1231 SH13030/SH13125 NI NI PCR neg HPMastaAdV 1 NA 2012 Perú SH1232 SH13031/SH13126 NI NI PCR neg SAFSAviaAdV 2/ HPAviaAdV 3 NA 2012 Perú SH1233 SH13032/SH13127 NI NI PCR neg HPSiaAdV 1 NA 2012 Perú SH1234 SH13033/SH13128 NI NI PCR neg HPMastaAdV 1 NA 2012 Chile 1 AAU12059 F pup PCR neg PCR neg NA 2012 Chile 2 AAU12060/AAU12061 M pup PCR neg Mix mastadenovirus NA 2012 Chile 3 AAU12062/AAU12063 M pup PCR neg PCR neg NA 2012 Chile 4 AAU12064/AAU12065 M pup PCR neg PCR neg NA 2012 Chile 5 AAU12066/AAU12067 M pup PCR neg PCR neg NA 2012 Chile 6 AAU12068/AAU12069 F pup PCR neg PCR neg NA 2012 Chile 7 AAU12070 M pup PCR neg PCR neg NA 2012 Chile 9 AAU12001/AAU12002 M pup PCR neg PCR neg NA 2012 Chile 19 AAU12093/AAU12094 F pup PCR neg PCR neg NA 2012 Chile 63 AAU12006/AAU12007 M pup PCR neg PCR neg NA 2012 Chile 64 AAU12008/AAU12009 M pup PCR neg PCR neg NA 2012 Chile 65 AAU12010/AAU12011 F pup PCR neg PCR neg NA 2012 Chile 66 AAU12012/AAU12013 M pup PCR neg PCR neg NA 2012 Chile 67 AAU12014/AAU12015 M pup PCR neg PCR neg NA 2012 Chile 68 AAU12016/AAU12017 F pup PCR neg PCR neg NA 2012 Chile 70 AAU12018/AAU12019 M pup PCR neg PCR neg NA 2012 Chile 71 AAU12020/AAU12021 F pup PCR neg PCR neg NA 2012 Chile 72 AAU12023/AAU12022 M pup PCR neg PCR neg NA 2012 Chile 73 AAU12024/AAU12025 M pup PCR neg PCR neg NA 2012 Chile 74 AAU12026/AAU12027 F pup PCR neg PCR neg NA 2012 Chile 75 AAU12028/AAU12029 F pup SAFSMastaAdV 2 SAFSMastaAdV 2 NA 2012 Chile 76 AAU12030/AAU12031 M pup PCR neg PCR neg NA 2012 Chile 81 AAU12181/AAU12182 M pup SAFSMastaAdV 2 PCR neg NA 2012 Chile 92 AAU12035/AAU12036 F pup SAFSMastaAdV 2 PCR neg NA 2012 Chile 82 AAU12183/AAU12184 M pup PCR neg PCR neg NA 2012 Chile 83 AAU12185/AAU12186 M pup SAFSMastaAdV 4 SAFSMastaAdV 2 NA

PAGE 157

157 Table B 1. Continued Sampling year Sample site Sample ID Lab Number Gender Age class Respiratory samples Fecal samples Mixed (conjuntival choanal cloacal) samples 2012 Chile 84 AAU12187/AAU12188 M pup PCR neg SAFSMastaAdV 2 NA 2012 Chile 86 AAU12191/AAU12192 M pup PCR neg PCR neg NA 2012 Chile 87 AAU12037/AAU12038 M pup PCR neg PCR neg NA 2012 Chile 88 AAU12039/AAU12040 M pup SAFSMastaAdV 2 PCR neg NA 2012 Chile 90 AAU12043/AAU12044 F pup Mix ed mastadenovirus es SAFSMastaAdV 2 NA 2012 Chile 93 AAU12047/AAU12048 F pup PCR neg PCR neg NA 2012 Chile 94 AAU12049/AAU12050 M pup PCR neg PCR neg NA 2012 Chile 96 AAU12053/AAU12054 M pup SAFSMastaAdV 2 SAFSMastaAdV 2 NA 2012 Chile 99 AAU12055/AAU12056 M pup PCR neg PCR neg NA M: male; F: female; NA: Not applicable; NI: No information

PAGE 158

158 LIST OF REFERENCES Abascal, F., R. Zardoya, and D. Posada. 2005. ProtTest: selection of best fit models of protein evolution. Bioinformatics 21:2104 2105. Aderem, A., and D. A. Hume. 2000. How do you see CG? Cell 103:993 996. Aguirre, A., T. Keefe, J. Reif, L. Kashinsky, P. Yochem, J. Saliki, J. Stott, T. Goldstein, J. Dubey, R. Braun, and G. Antonelis. 2007a. Infectious disease monitoring of the endangered Hawaiian monk seal. Journal of Wildlife Diseases 43:229 241. Aguirre, A. A., T. J. Keefe, J. S. Reif, L. Kashinsky, P. K. Yochem, J. T. Saliki, J. L. St ott, T. Goldstein, J. Dubey, and R. Braun. 2007b. Infectious disease monitoring of the endangered Hawaiian monk seal. Journal of Wildlife Diseases 43:229 241. Akers, T., A. Smith, A. Latham, and H. Watkins. 1974. Calicivirus antibodies in California gray w hales ( Eschrichtius robustus ) and Steller sea lions ( Eumetopias jupatus ). Archives of Virology 46:175 177. Almes, K. M., K. S. Janardhan, J. Anderson, R. A. Hesse, and K. M. Patton. 2010. Fatal canine adenoviral pneumonia in two litters of bulldogs. Journa l of Veterinary Diagnostic Investigation 22:780 784. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology 215:403 410. Anthony, S. J., J. H. Epstein, K. A. Murray, I. Nava rrete Macias, C. M. Zambrana Torrelio, A. Solovyov, R. Ojeda Flores, N. C. Arrigo, A. Islam, and S. A. Khan. 2013a. A strategy to estimate unknown viral diversity in mammals. MBio 4(5) < http://mbio .asm.org/content/4/5/e00598 13 >. Accesed 26 Nov 2014 Anthony, S. J., J. A. S. Leger, I. Navarrete Macias, E. Nilson, M. Sanchez Leon, E. Liang, T. Seimon, K. Jain, W. Karesh, and P. Daszak. 2013b. Identification of a Novel Cetacean Polyomavirus from a Comm on Dolphin ( Delphinus delphis ) with Tracheobronchitis. PloS ONE 8(7) . < http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.006 8239 #pone 0068239 g004 >. Accesed 26 Nov 2014 Anthony, S. J., J. A. St Leger, K. Pugliares, H. S. Ip, J. M. Chan, Z. W. Carpenter, I. Navarrete Macias, M. Sanchez Leon, J. T. Saliki, J. Pedersen, W. Karesh, P. Daszak, R. Rabadan, T. Rowles, and W. I. Lipkin . 2012. Emergence of fatal avian influenza in New England harbor seals. MBio 3(4). < http://mbio.asm.org/content/3/4/e00166 12 >. Accesed 26 Nov 2014 Appel, M. J., R. A. Yates, G. L. Foley, J. J. Ber nstein, S. Santinelli, L. H. Spelman, L. D. Miller, L. H. Arp, M. Anderson, and M. Barr. 1994. Canine distemper epizootic in lions, tigers, and leopards in North America. Journal of Veterinary Diagnostic Investigation 6:277 288.

PAGE 159

159 Atkins, A., J. Wellehan, A. Childress, L. Archer, W. Fraser, and S. Citino. 2009. Characterization of an outbreak of astroviral diarrhea in a group of cheetahs ( Acinonyx jubatus ). Veterinary Microbiology 136:160 165. Atkins, L., J. C. Zong, J. Tan, A. Mejia, S. Y. Heaggans, S. A. No fs, J. J. Stanton, J. P. Flanagan, L. Howard, and E. Latimer. 2013. Elephant endotheliotropic Herpesvirus 5, a newly recognized elephant herpesvirus associated with clinical and subclinical infections in captive asian elephants ( Elephas maximus ). Journal o f Zoo and Wildlife Medicine 44:136 143. Attoui, H., P. Mertens, J. Becnel, S. Belaganahalli, M. Bergoin, C. Brussaard, J. Chappell, M. Ciarlet, M. del Vas, and T. Dermody. 2011. Reoviridae. Pages 806 828 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. Balboni, A., R. Verin, F. Morandi, A. Poli, S. Prosperi, and M. Battilani. 2012. Molecular epidemiology of canine adenovirus type 1 and typ e 2 in free ranging red foxes ( Vulpes vulpes ) in Italy. Veterinary Microbiology 162 : 551 557. Baldo, A. M., and M. A. McClure. 1999. Evolution and horizontal transfer of dUTPase encoding genes in virus es and their hosts. Journal of V irology 73:7710 7721. Ball, L. A. 2007. Virus replication strategies. Pages 119 140 in D. M. Knipe & P. M. Howley editors. Fields Virology. Lippincott Williams & Wilkins. Philadelphia, Pennsylvania , USA . Bernard, H. U., R. D. Burk, Z. Chen, K. van Doorsl aer, H. z. Hausen, and E. M. de Villiers. 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxon omic amendments. Virology 401:70 79. Berta, A., and M. Churchill. 2012. Pinniped taxonomy: review of currently recognized species and subspecies, and evidence used for their description. Mammal Review 42:207 234 . Biagini, P., M. Bendinelli, S. Hino, L. Kakkola, A. Mankertz, C. Niel, H. Okamoto, S. Radial, C. Teo, and D. Todd. 2012. Family Anelloviridae. Pages 331 341 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. BirdLife. 2013. Spheniscus humboldti . The IUCN Red List of Threatened Species. V ersion 2014.3. < www.iucnredlist.or g >. Accessed July 25 2014. Blanc, A., D. Ruchansky, M. Clara, F. Achaval, A. Le Bas, and J. Arbiza. 2009. Serologic Evidence of Influenza A and B Viruses in South American Fur Se als ( Arctocephalus australis ). Journal of Wildlife Diseases 45:519 521.

PAGE 160

160 Bodewes, R., D. Morick, G. de Mutsert, N. Osinga, T. Bestebroer, S. van der Vliet, S. L. Smits, T. Kuiken, G. F. Rimmelzwaan, and R. A. Fouchier. 2013. Recurring influenza B virus infe ctions in seals. Emerging Infectious D iseases 19:511 512 . Bossart, G. D., R. Y. Ewing, M. Lowe, M. Sweat, S. J. Decker, C. J. Walsh, S. j. Ghim, and A. B. Jenson. 2002. Viral Papillomatosis in Florida Manatees ( Trichechus manatus latirostris ). Experimental and M olec ular P athology 72:37 48. Bostock, C., T. Barrett, and J. Crowther. 1990. Characterisation of the European seal morbillivirus. Veterinary M icrobiology 23:351 360. Bracht, A., R. Brudek, R. Ewing, C. Manire, K. Burek, C. Rosa, K. Beckmen, J. Maruniak, and C. Romero. 2006. Genetic identification of novel poxviruses of cetaceans and pinnipeds. Archives of Virology 151:423 438. Britt Jr, J., A. Nagy, and E. Howard. 1979. Acute viral hepatitis in California sea lions. Journal of the American Veter inary Medical Association 175:921 923 . Buonavoglia, C., N. Decaro, V. Martella, G. Elia, M. Campolo, C. Desario, M. Castagnaro, and M. Tempesta. 2006. Canine coronavirus highly pathogenic for dogs. Emerging Infectious D iseases 12:492 494 . Burek, K., K. Bec kmen, T. Gelatt, W. Fraser, A. Bracht, K. Smolarek, and C. Romero. 2005a. Poxvirus infection of Steller sea lions ( Eumetopias jubatus ) in Alaska. Journal of Wildlife Diseases 41:745 752. Burek, K., F. Gulland, G. Sheffield, K. Beckmen, E. Keyes, T. Spraker , A. Smith, D. Skilling, J. Evermann, J. Stott, J. Saliki, and A. Trites. 2005b. Infectious disease and the decline of Steller sea lions ( Eumetopias jubatus ) in Alaska, USA: Insights from serologic data. Journal of Wildlife Diseases 41:512 524. Burnside, K . L., J. T. Ryan, H. Bielefeldt Ohmann, A. Gregory Bruce, M. E. Thouless, C. C. Tsai, and T. M. Rose. 2006. RFHVMn ORF73 is structurally related to the KSHV ORF73 latency associated nuclear antigen (LANA) and is expressed in retroperitoneal fibromatosis (R F) tumor cells. Virology 354:103 115. Buscaglia, C. A., J. Alfonso, O. Campetella, and A. C. Frasch. 1999. Tandem amino acid repeats from Trypanosoma cruzi shed antigens increase the half life of proteins in blood. Blood 93:2025 2032. Cavanagh, H., T. Maho ny, and T. Vanniasinkam. 2012. Genetic characterization of equine adenovirus type 1. Veterinary Microbiology 155:33 37.

PAGE 161

161 Chen, E., S. Yagi, K. Kelly, S. Mendoza, N. Maninger, A. Rosenthal, A. Spinner, K. Bales, D. Schnurr, N. Lerche, and C. Chiu. 2011. Cr oss Species Transmission of a Novel Adenovirus Associated with a Fulminant Pneumonia Outbreak in a New World Monkey Colony. PloS Pathogens 7(7) . < http://www.p lospathogens.org/article/info%3Adoi%2F10.1371%2Fjournal.ppat.10 02155 >. Accesed 26 Nov 2014 Chen, R., H. Wang, and L. M. Mansky. 2002. Roles of uracil DNA glycosylase and dUTPase in virus replication. Journal of General V irology 83:2339 2345. Colegrove, K., F. Gullanda, D. Naydan, and L. Lowenstine. 2009. Tumor Morphology and Immunohistochemical Expression of Estrogen Receptor, Progesterone Receptor, p53, and Ki67 in Urogenital Carcinomas of California Sea Lions ( Zalophus californianus ). Veterinary Pathology Online 46:642 655. Colegrove, K. M., J. F. Wellehan, R. Rivera, P. F. Moore, F. M. Gulland, L. J. Lowenstine, R. W. Nordhausen, and H. H. Nollens. 2010. Polyomavirus infection in a free ranging California sea lion ( Zalophus californianus ) with intestinal T cell lymphoma. Journal of Veterinary Diagnostic Investigation 22:628 632. Cruz Jr, F. N. D., F. Giannitti, L. Li, L. W. Woods, L. Del Valle, E. Delwart, and P. A. Pesavento. 2013. Novel polyomavirus associated with brain tumors in free ranging Raccoons, W estern United States. Emerging Infectious D iseases 19:77 84 . Cunningham, M., D. Shindle, A. Allison, S. Terrell, D. Mead, and M. Owen. 2009. Canine distemper epizootic in Everglades mink. Journal of Wildlife D iseases 45:1150 1157. Dagleish, M., M. Barrows , M. Maley, R. Killick, J. Finlayson, R. Goodchild, A. Valentine, R. Saunders, K . Willoughby, and K. Smith. 2013 . The First Report of Otarine Herpesvirus 1 Associated Urogenital Carcinoma in a South American Fur Seal ( Arctocephalus australis ). Journal of C omparative P athology 149: 119 125. Darriba, D., G. L. Taboada, R. Doallo, and D. Posada. 2011. ProtTest 3: fast selection of best fit models of protein evolution. Bioinformatics 27:1164 1165. Davison, A. J., M. Benko, and B. Harrach. 2003. Genetic content and evolution of adenoviruses. Journal of General Virology 84:2895 2908. De Groot, R., S. Baker, R. Baric, L. Enjuanes, A. Gorbalenya, K. Holmes, S. Perlman, L. Poon, P. Rottier, and P. Talbot . 2012. Family Coronaviridae. Pages 542 637 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA .

PAGE 162

162 De Guise, S., A. Lagacé, and P. Béland. 1994. Gastric papillomas in eight St. Lawrence beluga whales ( Delphinapterus leucas ). Journal of Veterinary Diagnostic Investigation 6:385 388. de Oliveira, L. R., J. I. Hoffman, E. Hingst Zaher, P. Majluf, M. M. Muelbert, J. S. Morgante, and W . Amos. 2008. Morphological and genetic evidence for two evolutionarily significant units (ESUs) in the South American fur seal, Arctocephalus gazella . Conservation Genetics 9:1451 1466. Del Piero, F., D. Stremme, P. Habecker, and C. Cantile. 2006. West Ni le flavivirus polioencephalomyelitis in a harbor seal ( Phoca vitulina ). Veterinary Pathology Online 43:58 61. Di Guardo, G., G. Marruchella, U. Agrimi, and S. Kennedy. 2005. Morbillivirus infections in aquatic mammals: A brief overview. Journal of Veterinary Medicine Series a Physiology Pathology Clinical Medicine 52:88 93. Dierauf, L., L. Lowenstine, and C. Jerome. 1981. Viral hepatitis (adenovirus) in a California sea lion. Journal of the American Veterinary Medical Association 179:1194 1197 . Die tzgen, R. G., C. H. Calisher, G. Kurath, I. V. Kuzmin, L. L. Rodriguez, D. M. Stone, R. B. Tesh, N. Tordo, P. J. Walker, T. Wetzel, and A. E. Whitfield. 2012. Family Rhabdoviridae. Pages 686 713 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkow itz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. Donovan, T., M. Schrenzel, T. Tucker, A. Pessier, B. Bicknese, M. Busch, A. Wise, R. Maes, M. Kiupel, and C. McKnight. 2009. Meningoe ncephalitis in a polar bear caused by equine herpesvirus 9 (EHV 9). Veterinary Pathology Online 46:1138 1143. Doszpoly, A., J. F. Wellehan, A. L. Childress, Z. L. Tarján, E. R. Kovács, B. Harrach, virus lineage discovered in testudinoid turtles. Infection, Genetics and Evolution 17C:106 112. Dunbar, M., M. Cunningham, and J. Roof. 1998. Seroprevalence of selected disease agents from free ranging black bears in Florida. Journal of Wildlife Diseases 3 4:612 619. Duncan, C., T. Goldstein, C. Hearne, T. Gelatt, and T. Spraker. 2013. Novel Polyomaviral Infection in the Placenta of a Northern Fur Seal ( Callorhinus ursinus ) on the Pribilof Is lands, Alaska, USA. Journal of Wildlife D iseases 49:163 167.

PAGE 163

163 Ecker , D. J., R. Sampath, L. B. Blyn, M. W. Eshoo, C. Ivy, J. A. Ecker, B. Libby, V. Samant, K. A. Sannes Lowery, R. E. Melton, K. Russell, N. Freed, C. Barrozo, J. Wu, K. Rudnick, A. Desai, E. Moradi, D. J. Knize, D. W. Robbins, J. C. Hannis, P. M. Harrell, C. Massire, T. A. Hall, Y. Jiang, R. Ranken, J. J. Drader, N. White, J. A. McNeil, S. T. Crooke, and S. A. Hofstadler. 2005. Rapid identification and strain typing of respiratory pathogens for epidemic surveillance. Proceedings of the National Academy of Sci ences 102:8012 8017. Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids R esearch 32:1792 1797. Enriquez, C. E., C. J. Hurst, and C. P. Gerba. 1995. Survival of the enteric adenoviruses 40 and 41 in tap, sea, and waste water. Water Research 29:2548 2553. Everest, D., S. Grierson, A. Meredith, and E. Milne. 2010. Adenovirus in a red squirrel ( Sciurus vulgaris ) from Scotland. Veterinary Record 167:184 184. Everest, D., S. Grierson, M. Stidworthy, and C. Shuttleworth. 2009. PCR detection of adenovirus in grey squirrels on Anglesey. Veterinary Record 165:482 482. Everest, D., J. Griffin, N. Warnock, L. Collins, J. Dick, N. Reid, M. Scantlebury, N. Marks, and I. Montgomery. 2012. Adenovirus particles from a wild red squirrel ( Sciurus vulgaris ) from Northern Ireland. Veterinary Record 170:188 188. Fagrouch, Z., R. Sarwari, A. Lavergne, M. Delaval, B. De Thoisy, V. Lacoste, and E. J. Verschoor. 2012. Novel polyomaviruses in South American bats and their relati onship to other members of the family Polyomaviridae. Journal of General Virology 93:2652 2657. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 783 791. Fix, A. S., D. P. Riordan, H. T. Hill, M. A. Gill, a nd M. B. Evans. 1989. Feline panleukopenia virus and subsequent canine distemper virus infection in two snow leopards ( Panthera uncia ). Journal of Zoo and W ildlif e Medicine 273 281. Fouchier, R., T. Bestebroer, B. Martina, G. Rimmelzwaan, and A. Osterhaus. 2001. Infection of grey seals and harbour seals with influenza B virus. International Congress Series 1219: 225 23 Foy, H. M., M. K. Cooney, and J. B. Hatlen. 1968. Adenovirus type 3 epidemic associated with intermittent chlorination of a swimming pool. Ar chives of Environmental Health: An International Journa l 17:795 802. Geraci, J. R., D. J. St Aubin, I. K. Barker, R. G. Webster, V. S. Hinshaw, W. J. Bean, H. L. Ruhnke, J. H. Prescott, G. Early, A. S. Baker, S. Madoff, and R. T. Schooley. 1982. Mass morta lity of harbor seals: pneumonia associated with influenza A virus. Science 215:1129 1131.

PAGE 164

164 Gerhold, R. W., A. B. Allison, D. L. Temple, M. J. Chamberlain, K. R. Strait, and M. K. Keel. 2007. Infectious canine hepatitis in a gray fox ( Urocyon cinereoargenteu s ). Journal of Wildlife D iseases 43:734 736. Ghim, S. j., J. Joh, A. A. Mignucci Giannoni, A. L. Rivera Guzmán, L. Falcón Matos, M. M. Alsina Guerrero, M. Rodríguez Villanueva, A. B. Jenson, and G. D. Bossart. 2014. Genital Papillomatosis Associated with T wo Novel Mucosotropic Papillomaviruses from a Florida Manatee ( Trichechus manatus latirostris ). Aquatic Mammals 40:195 200. Giles, C., H. Cavanagh, G. Noble, and T. Vanniasinkam. 2010. Prevalence of equine adenovirus antibodies in horses in New South Wales , Australia. Veterinary Microbiology 143:401 404. Goldstein, T., K. Colegrove, M. Hanson, and F. Gulland. 2011. Isolation of a novel adenovirus from California sea lions Zalophus californianus . Diseases of Aquatic Organisms 94:243 248. Goldstein, T., F. Gulland, B. M. Aldridge, J. T. Harvey, T. Rowles, D. M. Lambourn, S. J. Jeffries, P. K. Yochem, B. S. Stewart, and R. J. Small. 2003. Antibodies to phocine herpesvirus 1 are common in North American harbor seals ( Phoca vitulina ). Journal of Wildlife D iseases 39:487 494. Goldstein, T., F. Gulland, R. C. Braun, G. A. Antonelis, L. Kashinsky, T. K. Rowles, J. Mazet, L. M. Dalton, B. M. Aldridge, and J. L. Stott. 2006a. Molecular identification of a novel gamma herpesvirus in the endangered Hawaiian monk s eal ( M onachus schauinslandi ). Marine Mammal S cience 22:465 471 . Goldstein, T., L. J. Lowenstine, T. P. Lipscomb, J. A. Mazet, J. Novak, J. L. Stott, and F. M. Gulland. 2006b. Infection with a novel gammaherpesvirus in Northern elephant seals ( Mirounga angu stirostris ). Journal of Wildlife D iseases 42:830 835. Goldstein, T., J. A. Mazet, F. Gulland, T. Rowles, J. T. Harvey, S. G. Allen, D. P. King, B. M. Aldridge, and J. L. Stott. 2004. The transmission of phocine herpesvirus 1 in rehabilitating and free rang ing Pacific harbor seals ( Phoca vitulina ) in California. Veterinary M icrobiology 103:131 141. Gouy, M., S. Guindon, and O. Gascuel. 2010. SeaView version 4: a multiplatform graphical user interface for sequence alignment and phyloge netic tree building. Mol ecular Biology and E volution 27:221 224. Gray, G. C., P. R. Goswami, M. D. Malasig, A. W. Hawksworth, D. H. Trump, M. A. Ryan, and D. P. Schnurr. 2000. Adult adenovirus infections: loss of orphaned vaccines precipitates military respiratory disease epidemi cs. Clinical Infectious Diseases 31:663 670.

PAGE 165

165 Green, M. R., and J. Sambrook. 2012. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press New York. Guindon, S., J. F. Dufayard, V. Lefort, M. Anisimova, W. Hordijk, and O. Gascuel. 2010. New algorithms and methods to estimate maximum likelihood phylogenies: assessing the perfor mance of PhyML 3.0. Systematic B iology 59:307 321. Hall, N., L. Archer, A. Childress, and J. Wellehan. 2012. Identification of a novel adenovirus in a cotton top tam arin ( Saguinus oedipu s ). Journal of Veterinary Diagnostic Investigation 24:359 363. Halvorsen, K. M., and E. O. Keith. 2008. Immunosuppression cascade in the Florida manatee ( Trichechus manatus latirostris ). Aquatic Mammals 34:412 419. Hammerschmidt, S., V . Agarwal, A. Kunert, S. Haelbich, C. Skerka, and P. F. Zipfel. 2007. The host immune regulator factor H interacts via two contact sites with the PspC protein of Streptococcus pneumoniae and mediates adhesion to host epithelial cells. The Journal of Immuno logy 178:5848 5858. Harrach, B., M. Benko, G. Both, M. Brown, A. Davison, A. King, E. Carstens, M. Adams, and E. Lefkowitz. 2011. Family Adenoviridae. Pages 125 141 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. Harwood, J. 1998. Conservation biology: What killed the monk seals? Nature 393:17 18. Hennicke, J., and B. Culik. 2005. Foraging performance and reproductive success of Humboldt penguins in relatio n to prey availability. Marine Ecology Progress S eries 296:173 181. Hernández, M., I. Robinson, A. Aguilar, L. M. González, L. F. Lóp ez Jurado, M. I. Reyero, E. Cacho, J. Franco, V. López Rodas, and E. Costas. 1998. Did algal toxins cause monk seal mortality? Nature 393:28 29. Hinshaw, V. S., W. J. Bean, R. G. Webster, J. E. Rehg, P. Fiorelli, G. Early, J. R. Geraci, and D. J. St Aubin. 1984. Are seals frequently infected with avian influenza viruses? J ournal of Virol ogy 51:863 865. Huson, D. H., and D. Bryant. 2006. Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23.2: 254 267. Hyndman, T. H ., R. E. Marschang, J. F. Wellehan Jr, and P. K. Nicholls. 2012. Isolation and molecular identification of Sunshine virus, a novel paramyxovirus found in Australian snakes. Infection, Genetics and Evolution 12:1436 1446.

PAGE 166

166 Härkönen, T., R. Dietz, P. Reijnder s, J. Teilmann, K. Harding, A. Hall, S. Brasseur, U. Siebert, S. J. Goodman, and P. D. Jepson. 2006. The 1988 and 2002 phocine distemper virus epidemics in Europ ean harbour seals. Diseases of Aquatic O rganisms 68:115 130. Inoshima, Y., T. Murakami, N. Ishi guro, K. Hasegawa, and M. Kasamatsu. 2013. An outbreak of lethal adenovirus infection among different otariid species. Veterinary M icrobiology 165: 455 459. Jawetz, E. 1959 . The story of shipyard eye. British Medical J ournal 1:873 876. Johne, R., C. B. Bu ck, T. Allander, W. J. Atwood, R. L. Garcea, M. J. Imperiale, E. O. Major, T. Ramqvist, and L. C. Norkin. 2011. Taxonomical developments in the fami ly Polyomaviridae. Archives of V irology 156:1627 1634. Kapoor, A., J. Victoria, P. Simmonds, C. Wang, R. Sha fer, R. Nims, O. Nielsen, and E. Delwart. 2008. A highly divergent picornavirus in a marine mammal. Journal of V irology 82:311 320. Katoh, K., and H. Toh. 2008. Recent developments in the MAFFT multiple sequence alignment program. Briefings in B ioinformati cs 9:286 298. Kennedy, S., T. Kuiken, P. D. Jepson, R. Deaville, M. Forsyth, T. Barrett, M. Van de Bildt, A. Osterhaus, T. Eybatov, and C. Duck. 2000. Mass die off of Caspian seals caused by canine distemper virus. Emerging Infectious Diseases 6:637 639 . Kennedy Stoskopf, S., M. K. Stoskopf, M. A. Eckhaus, and J. D. Strandberg. 1986. Isolation of a retrovirus and a herpesvirus from a captive C alifornia sea lion. Journal of Wildlife D iseases 22:156 164. King, A. M., M. J. Adams, E. J. Lefkowitz, and E. B. C arstens editors. 2012. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA King, D., M. Hure, T. Goldstein, B. Aldridge, and F. Gulland. 2002. Otarine herpesvirus 1: a novel gammaherpesvirus associat ed with urogenital carcinoma in California sea lions ( Zalophus californianus ). Veterinary Microbiology 86:131 137. King, J. 1983. Seals of the world. British Museum of Nat ural History. in London, and Oxford University Press, Oxford. Knowles Kohl, C., M. Vidovszky, K. Muhldorfer, P. Dabrowski, A. Radonic, A. Nitsche, G. Wibbelt, A. Kurth , and B. Harrach. 2012. Genome a nalysis of bat a denovirus 2: i ndications of interspecies t ransmission . Journal of Virology 86:1888 1892.

PAGE 167

167 Koopmans, M., M. Bijen, S. Monroe, and J. Vinje. 1998. Age stratified seroprevalence of neutralizing antibodies to astrovirus types 1 to 7 in humans in The Nether lands. Clinical and Diagnostic Laboratory I mmunology 5:33 37. Krilov, L. R. 2005. Adenovirus infections in the immunoc ompromised host. The Pediatric Infectious Disease J ournal 24:555 556 . Kriston, S., M. Willcocks, M. Carter, and W. Cubitt. 1996. Seroprevalence of astrovirus types 1 and 6 in London, determined using recombinant virus antigen. Epidemiology and I nfection 117:159 164. Ksiazek, T. G., D. Erdman, C. Goldsmith, S. R. Zaki, T. Peret, S. Emery, S. Tong, C. Urbani, J. A. Comer, W. Lim, P. E. Rollin, K. H. Nghiem, S. Dowell, A. E. Ling, C. Humphrey, W. J. Shieh, J. Guarner, C. D. Paddock, P. Rota, B. Fields, J. DeRisi, J. Y. Y ang, N. Cox, J. Hughes, J. W. LeDuc, W. J. Bellini, and L. J. Anderson. 2003. A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome. New England Journal of Medicine 348: 1953 1966. Kuiken, T., S. Kennedy, T. Barrett, M. Van de Bildt, F. Bor gsteede, S. Brew, G. Codd, C. Duck, R. Deaville, and T. Eybatov. 2006. The 2000 canine distemper epidemic in Caspian seals ( Phoca caspica ): Pathology and analysis of contributory factors. Veterinary Pathology Online 43:321 338. LaMere, S. A., J. A. S. Lege r, M. D. Schrenzel, S. J. Anthony, B. A. Rideout, and D. R. Salomon. 2009. Molecular characterization of a novel gammaretrovirus in killer whales ( Orcinus orca ). Journal of V irology 83:12956 12967. Lang, A. S., M. L. Rise, A. I. Culley, and G. F. Steward. 2009. RNA viruses in the sea. FEMS Microbiology R eviews 33:295 323. Lang, G., A. Gagnon, and J. R. Geraci. 1981. Isolation of an influenza A virus from seals. Archives of Virology 68:189 195. Lauber, C., and A. E. Gorbalenya. 2012. Partitioning the genetic diversity of a virus family: approach and evaluation through a case study of picornaviruses. Journal of V irology 86:3890 3904. Lee, H., Y. H. Cho, J. S. Park, E. C. Kim, A. W. Smith, and G. Ko. 2012. Elevated post transfusion serum transaminase values ass ociated with a highly significant trend for increasing prevalence of anti Vesivirus antibody in Korean patients. Journal of Medical V irology 84:1943 1952. Li, L., T. Shan, C. Wang, C. Cote, J. Kolman, D. Onions, F. Gull and, and E. Delwart. 2011. The fcal v iral flora of california sea l ions. Journal of Virology 85:9909 9917. Li, Y., X. Ge, H. Zhang, P. Zhou, Y. Zhu, Y. Zhang, J. Yuan, L . Wang, and Z. Shi. 2010. Host range, prevalence, and genetic diversity of adenoviruses in b ats. Journal of Virology 84:3889 3897.

PAGE 168

168 Lipscomb, T., D. Scott, R. Garber, A. Krafft, M. Tsai, J. Lichy, J. Taubenberger, F. Schulman, and F. Gulland. 2000. Common metastatic carcinoma of California sea lions ( Zalophus californianus ): Evidence of genital origin and association with novel gammaherpesvirus. Veterinary Pathology 37:609 617. Littnan, C. L., B. S. Stewart, P. K. Yochem, and R. Braun. 2006. Survey for selected pathogens and evaluation of disease risk factors for endangered Hawaiian monk seals in the main Hawaiian Islands. EcoHea lth 3:232 244. Lowry, L., and A. Aguilar. 2008. Neomonachus schauinslandi . The IUCN Red List of Threatened Species. Version 2014.3. < http://www.iucnredlist.org >. Accessed 25 July 2014. Lu, X., and D. Erdman. 2006. Molecular typing of human adenoviruses by PCR and sequencing of a partial region of the hexon gene. Archives of V irology 151:1587 1602. Luna Jorquera, G., and B. M. Culik. 1995. Peng uins bled by vampires. Journal f ür Ornitholog ie 136:471 472. Madeley, C., and B. Cosgrove. 1975. 28 nm particles in faeces in infantile gastroenteritis. The Lancet 306:451 452. Maeda, K., E. Hondo, J. Terakawa, Y. Kiso, N. Nakailchi, D. Endoh, K. Sakai, S. Morikamfa, and T. Mizutani. 2008. Isolation of novel adenovirus from fruit bat ( Pteropus dasymallus yayeyamae ). Emerging Infectious Diseases 14:347 349. Maness, H., H. Nollens, E. Jensen, T. Goldstein, S. LaMere, A. Childress, J. Sykes, J. St Leger, G. Lacave, F. Latson, and J. Wellehan. 2011. Phylo genetic analysis of marine mammal herpesviruses. Veterinary Microbiology 149:23 29. Martin, D., P. Lemey, M. Lott, V. Moulton, D. Posada, and P. Lefeuvre. 2010. RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics 26:2462 2463. Matsushima, Y., H. Shimizu, A. Kano, E. Nakajima, Y. Ishimaru, S. K. Dey, Y. Watanabe, F. Adachi, K. Mitani, and T. Fujimoto. 2013. Genome sequence of a novel virus of the species human adenovirus d associated with acute gastroenteritis. Genome A nnou ncements 1 (1). < http://genomea.asm.org/content/1/1/e00068 12.full >. Accesed 26 Nov 2014 Mattern, T., U. Ellenberg, G. Luna Jorquera, a nd L. S. Davis. 2004. Humboldt penguin c ensus on Isla C haña ral, Chile: Recent increase or past underestimate of penguin n umbers? Waterbirds 27:368 376.

PAGE 169

169 Mazzariol, S., F. Marcer, W. Mignone, L. Serracca, M. Goria, L. Marsili, G. Di Guardo, and C. Casalone. 2012. Dolphin Morbillivirus and Toxoplasma gondii coin fection in a Mediterranean fin whale ( Balaenoptera physalus ). BMC Veterinary R esearch 8:20. McCauley, J., S. Hongo, N. Kaverin, G. Kochs, R. Lamb, M. Matrosovich, D. Perez, P. Palese, R. Presti, and E. Rimstad. 2012. Family Orthomyxoviridae. Pages 749 761 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. McCullough, S., F. McNeilly, G. Allan, S. Kennedy, J. Smyth, S. Cosby, S. McQuaid, and B. Rima. 1991. Isolation and characterisation of a porpoise m orbillivirus. Archives of V irology 118:247 252. McNeill, K., J. Gaydos, B. Watts, M. Goldenbaum, and R. Poropatich. Clinical presentations of otherwise healthy young soldiers with reemergent adenovirus type 4 associated acute respiratory disease, in Conference Clinical presentations of otherwise health y young soldiers with reemergent adenovirus type 4 associated acute respiratory disease. July 16 19, 2000. Mendes, T., F. Lobo, T. Rodrigues, G. Luiz Rodrigues, W. Rocha, R. Fujiwara, S. Teixeira, and D. Bartholomeu. 2013. Repeat enriched proteins are related to host cell invasion and immune evasion in parasitic protozoa. Molecular Biology and E volution 30: 951 963 . Mihindukulasuriya, K. A., G. Wu, J. St Leger, R. W. Nordhausen, and D. Wang. 2008. Identification of a novel coronavirus from a beluga whale by using a panviral microarray. J Virol 82:5084 5088. Miller, M. A., W. Pfeiffer, and T. Schwartz. The CIPRES science gateway: a community resource for phylogenetic analyses. ACM, 2011. Murphy, F. A., E. P. J. Gibbs, M. C. Horzinek, and M. J. Studdert. 1999. Veterinary Virology. Academic P ress , San Diego, USA . Murphy, W. J., E. Eizirik, S. J. O'Brien, O. Madsen, M. Scally, C. J. Douady, E. Teeling, O. A. Ryder, M. J. Stanhope, and W. W. de Jong. 2001. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science 294:2348 2351. Ng, T., W. Suedmeyer, E. Wheeler, F. Gulland, and M. Breitbar tt. 2009. Novel anellovirus discovered from a mortality event of captive California sea lions. Journal of General Virology 90:1256 1261.

PAGE 170

170 Ng, T., E. Wheeler, D. Greig, T. Waltzek, F. Gulland, and M. Breitbart. 2011. Metagenomic identification of a novel ane llovirus in Pacific harbor seal ( Phoca vitulina richardsii ) lung samples and its detection in samples from multiple years. Journal of General Virology 92:1318 1323. Nollens, H., F. Gulland, E. Jacobson, J. Hernandez, P. Klein, M. Walsh, and R. Condit. 2008 a. In vitro susceptibility of sea lion poxvirus to cidofovir. Antiviral Research 80:77 80. Nollens, H., R. Rivera, G. Palacios, J. Wellehan, J. Saliki, S. Caseltine, C. Smith, E. Jensen, J. Hui, W. Lipkin, P. Yochem, R. Wells, J. St Leger, and S. Venn Wats on. 2009. New recognition of Enterovirus infections in bottlenose dolphins ( Tursiops truncatus ). Veterinary Microbiology 139:170 175. Nollens, H., J. Wellehan, L. Archer, L. Lowenstine, and F. Gulland. 2010a. Detection of a respiratory coronavirus from tis sues archived during a pneumonia epizootic in free ranging Pacific harbor seals Phoca vitulina richardsii . Diseases of Aquatic Organisms 90:113 120. Nollens, H. H., F. M. Gulland, J. A. Hernandez, R. C. Condit, P. A. Klein, M. T. Walsh, and E. R. Jacobson. 2006a. Seroepidemiology of parapoxvirus infections in captive and free ranging California sea lions Zalop hus californianus . Diseases of Aquatic O rganisms 69:153 161 . Nollens, H. H., E. R. Jacobson, F. M. Gulland, D. O. Beusse, G. D. Bossart, J. A. Hernand ez, P. A. Klein, and R. C. Condit. 2006b. Pathology and preliminary characterization of a parapoxvirus isolated from a California sea lion ( Zalophus californianus ). Journal of Wildlife D iseases 42:23 32. Nollens, H. H., J. F. Wellehan, L. Archer, L. J. Lowenstine, and F. M. Gulland. 2010b. Detection of a respiratory coronavirus from tissues archived during a pneumonia epizootic in free ranging Pacific harbor seals Phoca vitulina richardsii . Diseases of Aqu atic Organisms 90:113 120. Nollens, H. H., J. F. X. Wellehan, J. T. Saliki, S. L. Caseltine, E. D. Jensen, W. Van Bonn, and S. Venn Watson. 2008b. Characterization of a parainfluenza virus isolated from a bottlenose dolphin ( Tursiops truncatus ). Veterinary Microbiology 128:231 242. Odegaard, O., and J. Krogsrud. 1981. Rabies in Svalbard: infection diagnosed in arctic fox, reindeer and seal. Veterinary Record 109:141 142. Ogorzaly, L., I. Bertrand, M. Paris, A. Maul, and C. Gantzer. 2010. Occurrence, surviva l, and persistence of human adenoviruses and F specific RNA phages in raw groundwater. Applied and Environmental M icrobiology 76:8019 8025.

PAGE 171

171 Ohishi, K., N. Kishida, A. Ninomiya, H. Kida, Y. Takada, N. Miyazaki, A. N. Boltunov, and T. Maruyama. 2004. Antibod ies to human related H3 influenza A virus in Baikal seals ( Phoca sibirica ) and ringed seals ( Phoca hispida ) in Russia. Microbiol ogy and Immunol ogy 48:905 909. Ohishi, K., A. Ninomiya, H. Kida, C. H. Park, T. Maruyama, T. Arai, E. Katsumata, T. Tobayama, A. N. Boltunov, L. S. Khuraskin, and N. Miyazaki. 2002. Serological evidence of transmission of human influenza A and B viruses to Caspian seals ( Phoca caspica ). Microbiology and Immunology 46:639 644. Oliveros, M., R. García Escudero, A. Alejo, E. Viñuela, M. L. Salas, and J. Salas. 1999. African swine fever virus dUTPase is a highly specific enzyme required for efficient replication in swine macrophages. Journal of V irology 73:8934 8943. Ossent, P., F. Guscetti, A. Metzler, E. Lang, A. Rübel, and B. Hauser. 1990. Acute and fatal herpesvirus infection in a young Asian elephant ( Elephas maximus ). Veterinary Pathology Online 27:131 133. Osterhaus, A. 1989. A morbillivirus causing mass mortality in seals. Vaccine 7:483 484. Osterhaus, A., J. Groen, H. Niesters, M. van de Bildt, B. Martina, L. Vedder, J. Vos, H. van Egmond, B. A. Sidi, and M. E. O. Barham. 1997. Morbillivirus in monk seal mass mortality. Nature 388:838 839. Osterhaus, A., J. Groen, H. Spijkers, H. Broeders, F. UytdeHaag, P. De Vries, J. Teppema, I . Visser, M. Van de Bildt, and E. Vedder. 1990. Mass mortality in seals caused by a newly discovered virus like morbillivirus. Veterinary M icrobiology 23:343 350. Osterhaus, A., J. Groen, F. UytdeHaag, I. Visser, M. Bildt, A. Bergman, and B. Klingeborn. 19 89. Distemper virus in Baikal seals. Nature 338: 209 2010 Osterhaus, A., H. Yang, H. Spijkers, J. Groen, J. Teppema, and G. Van Steenis. 1985. The isolation and partial characterization of a highly pathogenic herpesvirus from the harbor seal ( Phoca vitulina ). Archives of Virology 86:239 251. Osterhaus, A. D., G. F. Rimmelzwaan, B. E. Martina, T. M. Bestebroer, and R. A. Fouchier. 2000. Influenza B virus in seals. Science 288:1051 1053. Palacios, G., J. Wellehan, S. Raverty, A. Bussetti, J. Hui, N. Savji, H. Nollens, D. Lambourn, C. Celone, S. Hutchison, C. Calisher, O. Nielsen, and W. Lipkin. 2011. Discovery of an orthoreovirus in the aborted fetus of a Steller sea lion ( Eumetopias jubatus ). Journal of General Virology 92:2558 2565. Park, N., M. Lee, N. Kurku re, and H. Cho. 2007. Canine adenovirus type 1 infection of a Eurasian river otter ( Lutra lutra ). Veterinary Pathology 44:536 539.

PAGE 172

172 Pellett, P., A. Davison, R. Eberle, B. Ehlers, G. Hayward, V. Lacoste, A. Minson, J. Nicholas, B. Roizman, and M. Studdert. 2 012. Order Herpesvirales. Pages 99 123 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. Peters, M., M. Vidovszky, B. Harrach, S. Fischer, P. Wohlsein, and J. Kilwinski. 2011. Squirrel adenovirus type 1 in red squirrels ( Sciurus vulgaris ) in Germany. Veterinary Record 169:182 184 . Phan, T. G., B. Kapusinszky, C. Wang, R. K. Rose, H. L. Lipton, and E. L. Delwart. 2011. The fecal vir al flora of wild rodents. PLoS P athogens 7(9). < http://www.plospathogens.org/article/info%3Adoi%2F10.1371%2Fjournal.ppat.10 02218 >. Accesed 26 Nov 20 14 Phelps, N. B., S. K. Mor, A. G. Armien, W. Batts, A. E. Goodwin, L. Hopper, R. McCann, T. F. F. Ng, C. Puzach, and T. B. Waltzek. 2014. Isolation and Molecular Characterization of a Novel Picornavirus from Baitfish in the USA. PloS ONE 9(2). < http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.008759 3 >. Accesed 26 Nov 2014 Philippa, J., F. Leighton, P. Daoust, O. Nielsen, M. Pagliarulo, H. Schwantje, T. Shury, R. Van Herwijnen, B. Martina, I. Kuiken, M. Van De Bildt, and A. Osterhaus. 2004. Antibodies to selected pathogens in free ranging terrestrial carnivores and marine mammals in Can ada. Veterinary Record 155:135 140 . Philippe, N., M. Legendre, G. Doutre, Y. Couté, O. Poirot, M. Lescot, D. Arslan, V. Seltzer, L. Bertaux, and C. Bruley. 2013. Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes. Science 341:281 286. Phillips, C. D., G. Phelan, S. E. Dowd, M. M. Mcdonough, A. W. Ferguson, J. Delton Hanson, L. Siles, N. Ordóñez Garza, M. San Francisco, and R. J. Baker. 2012. Microbiome analysis among bats describes influences of host phylogeny, life history, physiology and geography. Molecular Ecology 21:2617 2627. Pina, S., M. Puig, F. Lucena, J. Jofre, and R. Girones. 1998. Viral pollution in the environment and in shellfish: human adenovirus detection by PCR as an index of human viruses. Applied and Environmental Microbiology 64:3376 3382. Posada D . Selection of models of DNA evolution with jModelTest . 2009 . Methods Molecular Biology 537 : 93 112 . Poss, M., H. A. Ross, S. L. Painter, D. C. Holley, J. A. Terwee, S. VandeWoude, and A. Rodrigo. 2006. Feline lentivirus evolution in cross species infection reveals extensive G to A mutation and selection on key residues in th e viral polymerase. Journal of V irology 80:2728 2737.

PAGE 173

173 Pulliam, J. R., and J. Dushoff. 2009. Ability to replicate in the cytoplasm predicts zoonotic transmission of livestock viruses. Jour nal of Infectious Diseases 199:565 568. Pursell, A., B. Stuart, E. Styer, and J. Case. 1983. Isolation of an adenovirus from black bear cubs. Journal of Wildlife Diseases 19:269 271. Pyles, R. B., N. Sawtell, and R. L. Thompson. 1992. Herpes simplex virus type 1 dUTPase mutants are attenuated for neurovirulence, neuroinvasiveness, and reactiv ation from latency. Journal of V irology 66:6706 6713. Rambaut, A. 2010. FigTree: tree figure drawing tool (V ersion 1.3.2 ) [Sofware]. Available from http://tree.bio.ed.ac.uk/software/figtree/ Rambaut, A., and A. Drummond. 2007. Treeannotator (Version 1. 4.8 ) [Sofware]. Available from http:// beast.bio.ed.ac.uk/TreeAnnotator _____. 2013 . Tracer (V ersion 1.5 ) [Sofware]. Available from http://beast.bio.ed.ac.uk/Tracer Ramis, A. J., D. van Riel, M. W. van de Bildt, A. Osterhaus, and T. Kuiken. 2012. Influenza A and B virus attachment to respiratory tract in marine mammals. Emerging Infectious Diseases 18:817 820. Raut, C., P. Yadav, J. Towner, B. Amman, B. Erickson, D. Cannon, A. Sivaram, A. Basu, S. Nichol, A. Mishra, and D . Mourya. 2012. Isolation of a novel a denovirus from Rousettus leschenaultii b ats from India. Intervirology 55:488 490. Rector, A., G. D. Bossart, S. J. Ghim, J. P. Sundberg, A. B. Jenson, and M. Van Ranst. 2004. Characterization of a novel close to root papillomavirus from a Flori da manatee by using multiply primed rolling circle amplification: Trichechus manatus latirostris pap illomavirus type 1. Journal of V irology 78:12698 12702. Reese, M. G., F. H. Eeckman, D. Kulp, and D. Haussler. 1997. Improved splice site detection in Genie . Journal of Computational B iology 4:311 323. Rehtanz, M., S. j. Ghim, A. Rector, M. Van Ranst, P. A. Fair, G. D. Bossart, and A. B. Jenson. 2006. Isolation and characterization of the first American bottlenose dolphin papillomavirus: Tursiops truncatus pa p illomavirus type 2. Journal of General V irology 87:3559 3565. Reuter, G., P. Pankovics, N. J. Knowles, and Á. Boros. 2012. Two closely related novel picornaviruses in cattle and sheep in Hungary from 2008 to 2009, proposed as members of a new genus in the fam ily Picornaviridae. Journal of V irology 86:13295 13302.

PAGE 174

174 Rigotto, C., K. Hanley, P. Rochelle, R. De Leon, C. Barardi, and M. Yates. 2011. Survival of adenovirus types 2 and 41 in surface and ground waters measured by a plaque assay. Environmental S cienc e and T echnology 45:4145 4150. Rivera, R., H. Nollens, S. Venn Watson, F. Gulland, and J. Wellehan. 2010. Characterization of phylogenetically diverse astroviruses of marine mammals. Journal of General Virology 91:166 173. Rivera, R., R. Robles Sikisaka, E . Hoffman, B. Stacy, E. Jensen, H. Nollens, and J. Wellehan. 2012. Characterization of a novel papillomavirus species (ZcPV1) from two California sea lions ( Zalophus californianus ). Veterinary Microbiology 155:257 266. Roberts, D. M., A. Nanda, M. J. Haven ga, P. Abbink, D. M. Lynch, B. A. Ewald, J. Liu, A. R. Thorner, P. E. Swanson, and D. A. Gorgone. 2006. Hexon chimaeric adenovirus serotype 5 vectors circumvent pre existing anti vector immunity. Nature 441:239 243. Robles Sikisaka, R., R. Rivera, H. Nolle ns, J. Leger, W. Durden, M. Stolen, J. Burchell, and J. Wellehan. 2012. Evidence of recombination and positive selection in cetacean papillomaviruses. Virology 427:189 197. Ronquist, F., and J. P. Huelsenbeck. 2003. MrBayes 3: Bayesian phylogenetic inferen ce under mixed models. Bioinformatics 19:1572 1574. Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A. Darling, S. Höhna, B. Larget, L. Liu, M. A. Suchard, and J. P. Huelsenbeck. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst ematic Biol ogy 61:539 542. Roshtkhari, F., G. Mohammadi, and A. Mayameei. 2012. Serological evaluation of relationship between viral pathogens (BHV 1, BVDV, BRSV, PI 3V, and Adeno3) and dairy calf pneumonia by i ndirect ELISA. Tropical Animal Health and Production 44:1105 1110. Sakai, K., N. Nagata, Y. Ami, F. Seki, Y. Suzaki, N. Iwata Yoshikawa, T. Suzuki, S. Fukushi, T. Mizutani, and T. Yoshikawa. 2013. Lethal canine distemper virus outbreak in cynomolgus monkey s in Japan in 2008. Journal of V irology 87:1105 1114. Sauvage, V., M. A. Gouilh, J. Cheval, E. Muth, K. Pariente, A. Burguiere, V. Caro, J. C. Manuguerra, and M. Eloit. 2012. A member of a new Picornaviridae genus is shed in pig feces. Journal of V irology 86:10036 10046. Schaffer, F. L., and M. E. Soergel. 1973. Biochemical and biophysical characterization of calicivirus isolates from pinnipeds. Intervirology 1:210 219.

PAGE 175

175 Schlosser, J. A., J. M. Dubach, T. W. Garner, B. Araya, M. Bernal, A. Simeone, K. A. Smi th, and R. S. Wallace. 2009. Evidence for gene flow differs from observed dispersal patterns in the Humboldt penguin, Spheniscus humboldti . Conservation G enetics 10:839 849. Schmidt, H. A., K. Strimmer, M. Vingron, and A. von Haeseler. 2002. TREE PUZZLE: m aximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18:502 504 Schmitt, T. L., T. H. Reidarson, J. St. Leger, R. Rivera, and H. H. Nollens. Novel presentation of San Miguel sea lion virus (Calicivirus) epizootic in adult captive sea lions, Zalophus californianus . 2009. Page 160 in Conference Proceding. of International Association for Aquatic Animal Medicine San Antonio, Texas, USA. Schoeb, T., and C. DaRif. 1984. Adenoviral infection in infant tree shrews. Journal of the American Veterinary Medical Association 185:1363 1366. Schorr Evans, E., A. Poland, W. Johnson, and N. Pedersen. 2003. An epizootic of highly virulent feline calicivirus disease in a hospital setting in New England. Journal of Feline Medicine and Su rgery 5:217 226. Schramm, Y., S. Mesnick, J. De la Rosa, D. Palacios, M. Lowry, D. Aurioles Gamboa, H. Snell, and S. Escorza Trevino. 2009. Phylogeography of California and Galápagos sea lions and population structure within the California sea lion. Marine B iology 156:1375 1387. Simmonds, P., P. Becher, M. Collett, E. Gould, F. Heinz, G. Meyers, A. Monath, A. Pletnev, C. Rice, and K. Siasny. 2011. Family Flaviviridae. Pages 1003 1020 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. Sinha, A., S. Sengupta, S. Guin, S. Dutta, S. Ghosh, P. Mukherjee, A. Mukhopadhyay, T. Ramamurthy, Y. Takeda, and T. Kurakawa. 2013. Culture indep endent real time PCR reveals extensive polymicrobial infections in hospitalized diarrhoea cases in Kolkata, India. Clinical Microbiology and Infection 19:173 180. Skinner, M. A., R. M. Buller, I. K. Damon, E. J. Lefkowitz, G. McFadden, C. J. McInnes, A. A. Mercer, R. W. Moyer, and C. Upton. 2012. Family Poxviridae. Pages 291 309 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, US A . Smith, A. W., P. L. Iversen, D. E. Skilling, D. A. Stein, K. Bok, and D. O. Matson. 2006. Vesivirus viremia and seropr evalence in humans. Journal of Medical V irology 78:693 701.

PAGE 176

176 Smith, A. W., and D. E. Skilling. 1979. Viruses and virus diseases of marin e mammals. J ournal of Am erican Vet erinarian Med ical Assoc iation 175:918 920. Smith, A. W., D. E. Skilling, K. Benirschke, T. F. Albert, and J. E. Barlough. 1987. Serology and virology of the bowhead whale ( Balaena mysticetus l ). Journal of Wildlife Diseases 23:92 98. Smith, A. W., D. E. Skilling, N. Cherry, J. H. Mead, and D. O. Matson. 1998. Calicivirus emergence from ocean reservoirs: zoonotic and interspecies movements. Emerging Infectious Diseases 4: 13 20 . Stenvers, O., J. Plötz, and H. Ludwig. 1 992. Antarctic seals carry antibodies against seal herpesvirus. Archives of V irology 123:421 424. Suttle, C. A. 2005. Viruses in the sea. Nature 437:356 361. _____. 2007. Marine viruses major players in the global ecosystem. Nature Reviews Microbiology 5: 801 812. Talavera, G., and J. Castresana. 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic biology 56:564 577. Taubenberger, J. K., M. M. Tsai, T. J. Atkin, T. G. Fanning, A. E. Krafft, R. Moeller, S. Kodsi, M. Mense, and T. P. Lipscomb. 2000. Molecular genetic evidence of a novel morbillivirus in a long finned pilot whale ( Globicephalus melas ). Emerging Infectious D iseases 6:42 45 . Teeling, E. C., M. S. Springer, O. Madsen , P. Bates, S. J. O'Brien, and W. J. Murphy. 2005. A molecular phylogeny for bats illuminates biogeography and the fossil record. Science 307:580 584. Thompson, H., A. O'Keeffe, J. Lewis, L. Stocker, M. Laurenson, and A. Philbey. 2010. Infectious canine he patitis in red foxes ( Vulpes vulpes ) in the United Kingdom. Veterinary Record 166:111 114. Van Bressem, M., R. Kastelein, P. Flamant, and G. Orth. 1999a. Cutaneous papillomavirus infection in a harbour porpoise ( Phocoena phocoena ) from the North Sea. Veter inary record 144:592 593. Van Bressem, M., K. Van Waerebeek, and J. Raga. 1999b. A review of virus infections of cetaceans and the potential impact of morbilliviruses, poxviruses and papillomaviruses on host population dynamics. Diseases of Aquatic Organis ms 38:53 65. Van de Bildt, M., E. Vedder, B. Martina, B. A. Sidi, A. B. Jiddou, M. E. Ould Barham, E. Androukaki, A. Komnenou, H. Niesters, and A. Osterhaus. 1999. Morbilliviruses in Mediterranean monk seals. Veterinary M icrobiology 69:19 21.

PAGE 177

177 V an Hemert, F . J., B. Berkhout, and V. V. Lukashov. 2007. Host related nucleotide composition and codon usage as driving forces in the recent evolution of the Astroviridae . Virology 361:447 454. Van Moll, P., S. Alldinger, W. Baumgärtner, and M. Adami. 1995. Distemper in wild carnivores: an epidemiological, histological and immunocytochemical study. Veterinary Microbiology 44:193 199. VanDevanter, D. R., P. Warrener, L. Bennett, E. R. Schultz, S. Coulter, R. L. Garber, and T. M. Rose. 1996. Detection and analysis of div erse herpesviral species by consensus primer PCR. Journal of Clinical Microbiology 34:1666 1671. Venn Watson, S., C. Benham, F. M. Gulland, C. R. Smith, J. St Leger, P. Yochem, H. Nollens, U. Blas Machado, J. Saliki, and K. Colegrove. 2012. Clinical releva nce of novel Otarine herpesvirus 3 in California sea lions ( Zalophus californianus ): lymphoma, esophageal ulce rs, and strandings. Veterinary R esearch 43:1 9. Vennema, H., A. Poland, J. Foley, and N. C. Pedersen. 1998. Feline infectious peritonitis viruses arise by mutation from endemic feline enteric coronaviruses. Virology 243:150 157. Villarreal, L. P. 2005. Viruses and the evolution of life. ASM press , Washington, D . C . , USA. Waltzek, T., G. Corté s Hinojosa, J. Wellehan, and G. Gray. 2012. Marine Mammal Zoonoses: A Review of Disease Manifestations. Zoonoses and Public Health 59:521 535. Wang, L., P. Collins, R. Fouchier, G. Kurath, R. Lamb, R. Randall, and B. Rima. 2012. Family Paramyxoviridae. Pages 672 685 in King, A. M., M. J. Adams, E. B. Carstens and E. J. Lefkowitz editors. Virus taxonomy. Ninth report of the international committee on taxonomy of viruses, Elsevier, San Diego, USA. Ward, R. D., T. S. Zemlak, B. H. Innes, P. R. Last, and P. D. Hebert. 2005. DNA barcoding Australia's fish species. Phi losophical Transactions of the Royal Society B: Biological Sciences 360:1847 1857. Webster, R. G., J. Geraci, G. Petursson, and K. Skirnisson. 1981a. Conjunctivitis in human beings caused by influenza A virus of seals. The New England Journal of M edicine 3 04:911. Webster, R. G., V. S. Hinshaw, W. J. Bean, K. L. Van Wyke, J. R. Geraci, D. J. St Aubin, and G. Petursson. 1981b. Characterization of an influenza A virus from seals. Virology 113:712 724.

PAGE 178

178 Weiss, R. S., S. S. Lee, B. Prasad, and R. T. Javier. 1997. Human adenovirus early region 4 open reading frame 1 genes encode growth transforming proteins that may be distantly related to dUTP pyrop hosphatase enzymes. Journal of V irology 71:1857 1870. Wellehan, J., A. Johnson, B. Harrach, M. Benko, A. Pessier, C. Johnson, M. Garner, A. Childress, and E. Jacobson. 2004. Detection and analysis of six lizard adenoviruses by consensus primer PCR provides further evidence of a reptilian origin for the atadenoviruses. Journal of Virology 78:13366 13369. Wellehan, J., R. Rivera, L. Archer, C. Benham, J. Muller, K. Colegrove, F. Gulland, J. Leger, S. Venn Watson, and H. Nollens. 2011a. Characterization of California sea lion polyomavirus 1: Expansion of the known host range of the Polyomaviridae to Carnivora. Infection Gen etics and Evolution 11:987 996. Wellehan, J., F. Yu, S. Venn Watson, E. Jensen, C. Smith, W. Farmerie, and H. Nollens. 2010. Characterization of San Miguel Sea Lion Virus populations using pyrosequencing based methods. Infection Genetics and Evolution 10:2 54 260. Wellehan, J. F., A. J. Johnson, A. L. Childress, K. E. Harr, and R. Isaza. 2008. Six novel gammaherpesviruses of Afrotheria provide insight into the early divergence of the Gammaherpesvirinae. Veterinary M icrobiology 127:249 257. Wellehan, J. F., R . Rivera, L. L. Archer, C. Benham, J. K. Muller, K. M. Colegrove, F. Gulland, J. A. St Leger, S. K. Venn Watson, and H. H. Nollens. 2011b. Characterization of California sea lion polyomavirus 1: expansion of the known host range of the Polyomaviridae to Ca rnivora. Infection, Genetics and Evolution 11:987 996. West, K. L., S. Sanchez, D. Rotstein, K. M. Robertson, S. Dennison, G. Levine, N. Davis, D. Schofield, C. W. Potter, and B. Jensen. 2013. A Longman's beaked whale ( Indopacetus pacificus ) strands in Mau i, Hawaii, with first case of morbillivirus in the central Pacific. Marine Mammal Science 29:767 776. Wevers, D., S. Metzger, F. Babweteera, M. Bieberbach, C. Boesch, K. Cameron, E. Couacy Hymann, M. Cranfield, M. Gray, and L. A. Harris. 2011. Novel adenov iruses in wild primates: a high level of genetic diversity and evidence of zoonotic transmissions. Journal of V irology 85:10774 10784. Whitman, W. B., D. C. Coleman, and W. J. Wiebe. 1998. Prokaryotes: the unseen majority. Proceedings of the National Acade my of Sciences 95:6578 6583. Wilkins, P. A., and F. D. Piero. 2004. West Nile virus: Lessons from the 21st century. Journal of Veterinary Emergency and Critical Care 14:2 14.

PAGE 179

179 Woo, P. C., S. K. Lau, Y. Huang, C. S. Lam, R. W. Poon, H. W. Tsoi, P. Lee, H. Ts e, A. S. Chan, and G. Luk. 2010. Comparative analysis of six genome sequences of three novel picornaviruses, turdiviruses 1, 2 and 3, in dead wild birds, and proposal of two novel genera, Orthoturdivirus and Paraturdivirus, in the family Picornaviridae. Jo urnal of General Virology 91:2433 2448. Woo, P. C., S. K. Lau, C. S. Lam, C. C. Lau, A. K. Tsang, J. H. Lau, R. Bai, J. L. Teng, C. C. Tsang, and M. Wang. 2012. Discovery of seven novel mammalian and avian coronaviruses in the genus Deltacoronavirus suppo rts bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. Journal of V irology 86:3995 4008. Woo, P. C., S. K. Lau, C. S. Lam, A. K. Tsang, S. W. Hui , R. Y. Fan, P. Martelli, and K. Y. Yuen. 2014. Discovery of a novel bottlenose dolphin coronavirus reveals a distinct species of marine mammal coronavirus i n Gammacoronavirus. Journal of V irology 88:1318 1331. Woods, L. W., E. Williams, and I. Barker. 2001. Adenoviral diseases. Pages 202 211 In , E. S. and I. K. Barker. Infectious Diseases of Wild Mammals. Iowa States University Press, Ames, Iowa, USA. Wu, L., P. Zhou, X. Ge, L. Wang, M. Baker, a nd Z. Shi. 2013. Deep RNA sequencing reveals complex transcriptional landscape of a bat a denovirus. Journal of Virology 87:503 511. Xia, X. 2013. DAMBE5: a comprehensive software package for data analysis in molecular bi ology and evolution. Molecular B iolo gy an d E volution 30:1720 1728. Yolken, R. H., F. Lawrence, F. Leister, H. E. Takiff, and S. E. Strauss. 1982. Gastroenteritis associated with enteric type adenovirus in hospitalized infants. The Journal of P ediatrics 101:21 26. Zachariah, A., J. C. Zong, S. Y. Long, E. M. Latimer, S. Y. Heaggans, L. K. Richman, and G. S. Hayward. 2013. Fatal herpesvirus hemorrhagic disease in wild and orphan Asian elephants in southern India. Journal of W ildlife D iseases 49:381 393.

PAGE 180

180 BIOGRAP HICAL SKETCH Galaxi a Andrea Cortés Hinojosa obtained her V eterinary M edicine degree at the Universidad de Chile, Santiago in 2006. While completing her studies she completed an externship at the Africam Safari Zoo in Puebla, Mexico. She then obtained degree in marine science at the Universidad Catolica del Note, Chile in 2009 with a focus in Humboldt penguin population dynamics. While working on her MS she also worked as a teaching assistant in statistics, zoology and evolution for marine bi ology students . Also during this time she work ed as an exotic and small animal clinician. Since 2010 she has been working on her PhD with a full scholarship from the Chilean Government at the University of Florida, Gainesville in the Aquatic Animal H ealth P rogram with an emphasis in m arine mammal viral discovery. Her dissertation focused on the development of molecular diagnostics for the detection of California sea lion adenovirus 1 and the discovery and genetic characterization of novel pinniped adenovir us es .