Citation
Cathepsin L Targeting in Metastatic Disease

Material Information

Title:
Cathepsin L Targeting in Metastatic Disease
Creator:
Sudhan, Dhivya Raja
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (13 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Physiology and Pharmacology (IDP)
Committee Chair:
SIEMANN,DIETMAR W
Committee Co-Chair:
ROWE,THOMAS C
Committee Members:
SAYESKI,PETER PAUL
WOOD,CHARLES E
BUBB,MICHAEL RAYMOND
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Angiogenesis ( jstor )
Bones ( jstor )
Breast cancer ( jstor )
Cancer ( jstor )
Hypoxia ( jstor )
Metastasis ( jstor )
Osteoclasts ( jstor )
Prostate ( jstor )
Secretion ( jstor )
Tumors ( jstor )
Physiology and Pharmacology (IDP) -- Dissertations, Academic -- UF
breast-cancer -- cathepsin-l -- kgp94 -- metastasis -- prostate-cancer
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Medical Sciences thesis, Ph.D.

Notes

Abstract:
Metastasis, the spread of tumor cells from the primary site to distant organs is the primary cause of treatment failure and mortality in cancer patients. Thus, the identification of key metastasis promoting targets and the development of effective anti-metastatic agents have gained increased attention in the past few decades. Recognition of proteases, in particular, matrix metalloproteases (MMPs) as key players in tumor progression and metastasis led to extensive pre-clinical research and development of several broad spectrum MMP inhibitors. However, numerous MMP inhibitor clinical trials had to be discontinued due to adverse side effects and/or lack of clinical benefit. Subsequent pre-clinical investigations exploring other proteolytic targets have shown that if selective inhibitors of pericellular proteolysis can be developed, such agents would have the potential of significant application in preventing tumor progression and metastasis. The presented research focuses on one such protease, namely, Cathepsin L and evaluates the anti-metastatic efficacy of KGP94, a small molecule CTSL inhibitor.in metastatic prostate and breast cancer. We observed a strong association between CTSL upregulation and metastatic characteristics of prostate and breast cancer cells. The tumor microenvironment heavily influences metastatic aggressiveness but the impact of hypoxia and acidosis on CTSL activity remains less explored. We showed that CTSL plays a key role in microenvironment triggered metastatic capacities of prostate and breast cancer cells and that KGP94 treatment led to a significant suppression of these features. In addition to promoting tumor cell invasiveness, CTSL also plays a key role in tumor angiogenesis. Since a majority of prostate cancer patients develop skeletal metastases, in-vivo evaluation of the anti-metastatic efficacy of KGP94 was performed in a bone metastasis model. KGP94 treatment led to a significant reduction in metastatic incidence, bone metastases burden and a marked improvement in the overall survival. The reduction in metastatic tumor burden was associated with a striking decrease in tumor angiogenesis and bone resorption. The present work sheds light on the role of CTSL in various aspects of metastatic progression and evaluates the anti-metastatic efficacy of KGP94. The therapeutic implications and future considerations for such CTSL intervention strategies are also discussed. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: SIEMANN,DIETMAR W.
Local:
Co-adviser: ROWE,THOMAS C.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31
Statement of Responsibility:
by Dhivya Raja Sudhan.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

2014;74:2962-2973. Published OnlineFirst March 17, 2014. Cancer Res Eun-Jin Yeo, Luca Cassetta, Bin-Zhi Qian, et al. Breast Cancer Myeloid WNT7b Mediates the Angiogenic Switch and Metastasis in Updated version 10.1158/0008-5472.CAN-13-2421 doi: Access the most recent version of this article at: Material Supplementary http://cancerres.aacrjournals.org/content/suppl/2014/03/17/0008-5472.CAN-13-2421.DC1.html Access the most recent supplemental material at: Cited Articles http://cancerres.aacrjournals.org/content/74/11/2962.full.html#ref-list-1 This article cites by 59 articles, 22 of which you can access for free at: E-mail alerts related to this article or journal. Sign up to receive free email-alerts Subscriptions Reprints and . pubs@aacr.org To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Permissions . permissions@aacr.org To request permission to re-use all or part of this article, contact the AACR Publications Department at on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 2

MicroenvironmentandImmunologyMyeloidWNT7bMediatestheAngiogenicSwitchand MetastasisinBreastCancerEun-JinYeo1,3,LucaCassetta4,Bin-ZhiQian4,IanLewkowich2,Jiu-fengLi4,JamesA.StefaterIII1,3, AprilN.Smith1,3,LisaS.Wiechmann5,YihongWang6,JeffreyW.Pollard7,andRichardA.Lang1,3AbstractOncogenictargetsactinginbothtumorcellsandtumorstromalcellsmayofferspecialtherapeuticappeal. InterrogationoftheOncominedatabaserevealedthat52of53humanbreastcarcinomasshowedsubstantial upregulationofWNTfamilyligandWNT7B.Immunolabelingofhumanmammarycarcinomashowedthat WNT7Bimmunoreactivitywasassociatedwithbothtumorcellsandwithtumor-associatedmacrophages.Inthe MMTV-PymTmousemodelofmammarycarcinoma,wefoundtumorprogressionrelieduponWNT7Bproduced bymyeloidcellsinthemicroenvironment. Wnt7b deletioninmyeloidcellsreducedthemassandvolumeof tumorsduetoafailureintheangiogenicswitch.Inthetumoroverall,therewasnochangeinexpressionof Wnt/ b -cateninpathwaytargetgenes,butinvascularendothelialcells(VEC),expressionofthesegeneswas reduced,suggestingthatVECsrespondtoWnt/ b -cateninsignaling.Mechanisticinvestigationsrevealedthat failureoftheangiogenicswitchcouldbeattributedtoreduced Vegfa mRNAandproteinexpressioninVECs,a sourceofVEGFAmRNAinthetumorthatwaslimitingintheabsenceofmyeloidWNT7B.Wealsonoteda dramaticreductioninlungmetastasisassociatedwithdecreasedmacrophage-mediatedtumorcellinvasion. Together,theseresultsillustratedthecriticalroleofmyeloidWNT7Bintumorprogression,actingatthelevelsof angiogenesis,invasion,andmetastasis.WesuggestthattherapeuticsuppressionofWNT7Bsignalingmightbe advantageousduetotargetingmultipleaspectsoftumorprogression. CancerRes;74(11);2962 – 73. 2014AACR.IntroductionEmergingevidencehasshownthatinmammarycarcinoma, hematopoieticcellsrecruitedtothetumorstromacontribute totumorprogressionandmetastasis(1,2).Ofthesecells, extensiveevidenceshowsthattumor-associatedmacrophages (TAM)contributetotumorprogressionandmalignancy(3). TheseTAMactionsaremultifactorialwithindividualpopulationshavingprotumoralproperties,includingremodeling extracellularmatrix,stimulatingangiogenesis,andpromoting tumorcellintravasationandextravasationaswellaspersistent growthatthemetastaticsite(4 –6).Intheprimarytumor, TAMspromotethedramaticincreaseinvasculardensity knownastheangiogenicswitchthatisarate-limitingstep forthetransitionofbenigntumorstoinvasivecarcinomas.The TAMpopulationexpressesTie2anditsablationresultsin inhibitionofangiogenesisinawiderangeofcancermodels(7, 8).ThereisalsoadynamicinterplayofTAMswithcellsofthe acquiredimmunesystem(9).Inmammarytumors,these TAMsareregulatedbyCD4Tcellsthroughtheirsynthesis ofinterleukin(IL)-4orIL-17(10,11).Thiscytokinesignaling enhancestheirpromotionoftumorcellinvasionandmetastasisbutnottheirproangiogenicproperties(10). TheWNT/ b -cateninpathwayhasacriticalroleinnormal developmentandtumorigenesis(12).Stabilizingexon3mutationsin CTNNB1 ,low-membrane b -cateninexpression,orits nuclearlocalizationaresigni cantlyassociatedwithpoor cancerprognosis(13,14).Abnormalexpressionofadenomatouspolyposiscoli(APC),anegativeregulatorof b -catenin,is alsoamajorcauseofcoloncancer(15,16).Furthermore,the geneforaxin,anothernegativeregulatoroftheWNT/ b -catenin pathway,isdeletedinmanytypesofcancer(17,18).The suggestionthatWNTligandsmaybeinvolvedinmammary tumorprogressioncomesfrommousemammarytumorvirus (MMTV)insertionalactivationofthe Wnt1 gene(19),the observationthattheligandsareexpressedinhumancancers (20,21)andthedemonstrationthatWntcoreceptorLrp5de cientmiceareresistanttoWnt1-inducedmammary tumors(22).Recently,ithasbeenreportedthatinvasiveTAMs Authors'Af liations:1TheVisualSystemsGroup,DivisionsofPediatric OphthalmologyandDevelopmentalBiology;2DivisionofImmunobiology, CincinnatiChildren'sHospitalMedicalCenter;3DepartmentofOphthalmology,UniversityofCincinnati,Cincinnati,Ohio;4DepartmentsofDevelopmentalandMolecularBiology,5Surgery,6Pathology,and7MRCCentre forReproductiveHealth,UniversityofEdinburgh,UK Note: SupplementarydataforthisarticleareavailableatCancerResearch Online(http://cancerres.aacrjournals.org/). E.-J.Yeo,L.Cassetta,andB.-Z.Qiancontributedequallytothiswork. CorrespondingAuthors: RichardA.Lang,CincinnatiChildren'sHospital MedicalCenter,3333BurnetAvenue,Cincinnati,OH45229.Phone:513636-2700;Fax:513-636-4317;E-mail:Richard.Lang@cchmc.org;and JeffreyW.Pollard,DepartmentofDevelopmentalandMolecularBiology, AlbertEinsteinCancerCenter,AlbertEinsteinCollegeofMedicine,1300 MorrisParkAvenue,Bronx,NY10461.Phone:718-430-2090;Fax:718430-8972;E-mail:jeffrey.pollard@einstein.yu.edu;andMRCCenterfor ReproductiveHealth,Queen'sMedicalResearchInstitute,47LittleFrance Crescent,EdinburghEH164TJ,UK.E-mail:jeff.pollard@ed.ac.uk doi: 10.1158/0008-5472.CAN-13-2421 2014AmericanAssociationforCancerResearch. Cancer Research CancerRes;74(11)June1,2014 2962 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 3

fromthemousemodelofbreastcancercausedbymammary expressionofthePolyomaMiddleToncoprotein(MMTVPyMT)expressseveralWntgenes,especially Wnt5b and Wnt7b (23).WNT7bhasbeenimplicatedinprostatecancer(24)in modulationofvascularityduringdevelopment(25,26)andis signi cantlyupregulatedintumor-promotingTAMs(23,27). ToassessthefunctionofthisWntligandinTAMsofthe MMTV-PyMTmodel,weconditionallydeleted Wnt7b using the Csf1r-icre mouselineinwhichcrerecombinaseis expressedfromthepromoterforthecolony-stimulating factor1receptor(28).Thisconditionalablationshowed thatinin ltratingmyeloidcells,Wnt7bisrequiredforthe angiogenicswitch,tumorprog ression,tumorcellinvasion, andmetastasis.MaterialsandMethodsMousestrainsandgenotyping AllexperimentswereconductedinaccordancewithguidelinesofInstitutionalAnimalCareandUseCommittee.Mouse linesusedinthisstudyincludethe Wnt7btm2Amc(29), MMTVPyMT (30),and Tg(Csf1.icre)jwp (28)linesandweregenotyped accordingtopublishedprotocols. Flowcytometry Human. Humanestrogenreceptor –positive(ER)breast cancersweretakenfromtheclinicandminced nelywith scissorsanddigestedwithenzymesolution[2mg/mLcollagenaseAin40mLDulbecco'sModi edEagleMedium 80 m L DNase(50U/mL)]for1hourat37Cand lteredthrougha 70m mnylonstrainer.Singlecellswerestainedforlive/dead cells,regained,andthenincubatedwithantibodiesasappropriateinthedark(SupplementaryFig.S1).HumanTAMswere isolatedby owcytometryusinglabelingforanti-CD45,antiCD11b,anti-CD14,andanti-CD163.Analysisofhumansamples receivedapprovalbytheInstitutionalReviewBoardofAlbert EinsteinCollegeofMedicine. Mouse. Tumorsdissectedfrominguinalmammaryglands freeofthelymphnodewereminced,digestedinLiberase (Sigma),andDNAse1reducedtosinglecellsuspensionsas described(31).Flowcytometrywasperformedusinganti – CD3-PE(Clone17A2),anti –B220-APC(CloneRA3-6B2),antimouseCD45-PE-Cy7(Clone30-F11),anti-F4/80-APC-eFluor 780(CloneBM8),CD45microbeads,anti-mouseCD31-APC (Clone390),andanti-mouseCD105-PE(CloneMJ7/18).Macrophageswerealsolabeledwith uorescentdextranviaphagocyticuptakeaspreviouslydescribed(32).Flowcytometric sortingofendothelialcellwithFACSAriaII(BD)wasperformedusinganti –CD45-APC(clone30-F11)andanti –CD31PE-Cy7(clone390).Cellswerecollectedin1.5mLtubes, centrifugedfor10minutesat450rcf,andthepelletresuspendedincelllysisbuffer.RNAextractionwasperformedusing theQiagenMicroKitandretrotranscriptionperformedwitha SuperscriptVilocDNASynthesisKit(Invitrogen). Assessmentof Wnt7b expressionand Wnt7btm2Amcdeletioninsortedcells Flow-sorted,tumor-associatedF4/80-positivemacrophages,Tcells,Bcells,andVECswereusedforisolationof mRNAandgenomicDNA.Theprimersusedtoassessexpressionof Wnt7b mRNAbyreversetranscriptase(RT)-PCRwere forward:50-ACGTGTTTCTCTGCTTTGGC-30,reverse:50-CCAGGCCAGGAATCTTGTT-30.Controlactinprimerswereforward50-CGGTGCTAAGAAGGCTGTTC-30,reverse50-CTTCTCCATGTCGTCCCAGT-30.Assessmentof Wnt7btm2Amcdeletion wasperformedaswiththeD3forwardandC3reverseprimers (33). Histologicanalysisandvolumequanti cationof mammarytumors Tissuewas xedin4%paraformaldehyde,processed,and sectionedaccordingtoestablishedprocedures.Forimmunostaining,sectionswererehydratedandlabeledusingtheTSA Detectionkit(Invitrogen)andgoatanti-PECAMantibodyat1: 100dilution(M-20;SantaCruz)orrabbitmonoclonalKi67at 1:1000(Neomarkers;RM-9106-S0).Functionalbloodvessels wereidenti edusinginjectedTexasred-conjugateddextran accordingtoestablishedprocedures(34).Glandvolumewas calculatedasdescribed(35). RNAisolationandquantitativePCR RNAwasextractedwithTRIzol(Invitrogen)andusedfor quantitativePCR(qPCR)accordingtoestablishedprocedures. Theprimersusedwere: b -actin,forward:50TTCTTTGCAGCTCCTTCGTT,reverse: 50ATGGAGGGGAATACAGCCC; Wnt7b ,forward:50AGCTCGGAGCATTGTCATCC,reverse: 50TCACAATGATGGCATCGGGT; Dll4 ,forward:GGCATGCCTGGGAAGTATCC,reverse: 50GGCTTCTCACTGTGTAACCGA; Hey1 ,forward:CGAGACCATCGAGGTGGAAA,reverse: 50CTCGATGATGCCTCTCCGTC; Vegfa ,forward:50GGAGATCCTTCGAGGAGCACTT,reverse: 50GGCGATTTAGCAGCAGATATAAGAA; Vegfr1 ,forward:50GGCATCCCTCGGCCAACAATC,reverse: 50AGTTGCTGCTGGGATCCAGG; Vegfr2 ,forward:50CGTTAAGCGGGCCAATGAAG,reverse: 50CTAGTTTCAGCCGGTCCCTG; Vegfr3 ,forward:50CCGCAAGTGCATTCACAGAG,reverse: 50TCGGACATAGTCGGGGTCTT AssessmentofthepulmonarymetastaticburdenwasperformedusingqPCRforthePyMTtranscript.Lungswere removedbeforeremovingmammaryglandstoavoidcross contamination. ThePyMTprimersusedwereforward,50-CTCCAACAGATACACCCGCACATACT-30andreverse,50-GCTGGTCTTGGTCGCTTTCTGGATAC-30. Immunoblotting Immunoblottingusing50 m goftumorcelllysatewascarried outusingstandardmethods.Theantibodiesusedwererabbit anti-VEGF(A-20;SantaCruz)andrabbitanti –b -tubulin (ab6046;Abcam). MyeloidCellWnt7bMediatesAngiogenicSwitchandMetastasis www.aacrjournals.org CancerRes;74(11)June1,2014 2963 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 4

CD68 CD163 CD163 EG F I J K M NF G HI J K LM NWNT7B nuclei CD163+, CD14+WNT7B GAPDH T CNested RTPCR NormalTumor N orma l T umo r .0 .5 0.0 0.5 1.0 1.5 2.0MeanWNT7B expression log2 median-centered ratioP = 1.9x10-13 P = 1.7x10-6NormalTumor.0 .5 0.0 0.5 1.0 1.5 2.0WNT7B expression log2 median-centered ratioRaw dataA D C B Median rank P valueGene 1000.00.007 123456 WNT7B 11 55 10 10 2525 Not measured %Legend1. Invasive Breast Carcinoma vs. Normal 2. Invasive Breast Carcinoma vs. Normal 3. Invasive Ductal and Lobular Carcinoma vs. Normal 4. Invasive Ductal Breast Carcinoma vs. Normal 5. Invasive Lobular Breast Carcinoma vs. Normal 6. Ductal Breast Carcinoma Type: Ductal Breast Carcinoma in Situ Gluck Breast, Breast Cancer Res Treat, 2011 TCGA Breast, No Associated Paper, 2011 TCGA Breast, No Associated Paper, 2011 TCGA Breast 2, No Associated Paper, 2011 TCGA Breast , No Associated Paper, 2011 TCGA Breast , No Associated Paper, 2011 Yeoetal. CancerRes;74(11)June1,2014 CancerResearch 2964 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 5

Invivo invasionassay Cellcollectionintoneedlesplacedintheprimarytumorof anesthetizedmicewascarriedoutasdescribedpreviously(36). Statisticalanalysis AllstatisticalanalyseswereperformedusingSPSSforWindowsversion18.0.TheStudent t test,Mann –Whitney U test, and,forthefrequencyoftumorstage,theFisherexacttestwere used.A P valuelessthanorequalto0.05wasconsidered statisticallysigni cant.ResultsTodeterminewhetherWNT7Bexpressionwasassociated withbreastcancerinhumans,weinterrogatedtheTissue CancerGenomeAtlasandOncominedatabase(37).In theFinakandcolleaguesdataset(38)thatindependently performedexpressionanalysisontumorstroma,outof53 mammarycarcinomas,52showedsigni cantlyenhanced expressionof WNT7B inthestromaandthiswashighly signi cantcomparedwithnormalbreast(Fig.1AandB). Furthermore,inameta-analysisofrecentgeneexpression pro ling,increased WNT7B expressionwassigni cantlyassociatedwithbreastcarcinomacomparedwithnormal(Fig.1C). TodeterminedirectlywhetherTAMsfromhumanbreast cancersexpressed WNT7B,we owsortedmacrophagesfrom ERbreastcancersusingCD45,CD11b,CD14,andCD163(SupplementaryFig.S1A –S1C)andperformedRT-PCRfor WNT7B (Fig.1D).Thisanalysisshowedampli cationproducts for WNT7B consistentwiththeirsigni cantoverexpressionin thestromaofbreastcancer,whereasadjacentnormalmammarytissueandthatderivedfromreductionmammoplasty showedlessexpression.ToassessthedistributionofWNT7B proteininhumanbreastcancers,weperformedimmunolabeling.ColabelingwithantibodiestoWNT7BandfortheTAM markersCD68andCD163showedthatTAMscolocalizedwith WNT7Bimmunoreactivity(Fig.1E –N).Themostintense WNT7Bimmunoreactivitywasintumorcells(Fig.1E).However,whenregionsofCD68(Fig.1E –G)andCD163(Fig.1H –N) labelingweremagni edandthelabelingchannelsseparated,it wasclearthatWNT7Bimmunoreactivitywasalsofoundin TAMs.Mostoften,WNT7Bimmunoreactivitywasassociated withCD68orCD163-labeledstructureswiththefeaturesof macrophageprocesses(Fig.1F,G,I – K,M,andN).Onaverage, 61%ofcellswithinthetumorwereWNT7Bimmunoreactive. Fifteenpercentofthetotalcellswithinthetumorwereboth myeloid(accordingtoCD163labeling)andimmunoreactive forWNT7B.Combined,thisdatamininganddirectexpression assessmentinhumanmammarytumorssuggestedthat WNT7BproducedbyTAMsinthetumorstromacouldplay aroleintumorprogression. Toanalyzetheroleofmacrophage-derivedWNT7bexperimentally invivo ,wegeneratedconditionalloss-of-function miceusingthe Wnt7btm2Amcallele(29)andthe Csf1r-icre transgene(28)intheMMTV-PyMTmodelofmammarycarcinoma(30).Thistumorhasmostofthefeaturesofhuman mammarycarcinoma,includingERpositivityandprogression throughequivalentstages(30).ThistumoralsoshowsexpressionofWnt7binTAMs,particularlythoseTAMsthatpromote tumorcellinvasion(23).Consistentwiththesedata,RT-PCR on ow-sortedF4/80,dextranTAMsshowedthatthesecells express Wnt7b incontrol Wnt7btm2Amc / mice(Fig.2A).As expected,thisexpressionisundetectableinTAMsfrom theconditionalmutant, Wnt7b /tm2Amc; Csf1r-icre (Fig.2A). Ef cientdeletionoftheconditional Wnt7b allelewasconrmedbyDNAgenotyping(Fig.2B)of ow-sortedTAMs. qPCRanalysisalsorevealedthatinthenormalprogression fromhyperplasia/adenomatoearlyandlatecarcinomainthe MMTV-PyMTmodel,theexpressionlevelof Wnt7b transcripts increases(Fig.2C,graybars).Bycontrast,tumorsfrom Wnt7b /tm2Amc; Csf1r-icre miceshowalevelof Wnt7b expressionthatdoesnotincreasesigni cantlywithtumorprogression(Fig.2C,bluebars).Deletionof Wnt7b fromTAMsdidnot resultinanystatisticallysigni cantdifferenceinthepopulationsofrecruitedF4/80macrophages(Fig.2D),CD3Tcells (Fig.2D),andB220Bcells(Fig.2D). Inseveralmousemodelsofcancer,TAMsregulateangiogenesis.Forexample,inthePyMTmodel,theyhavebeen showntoregulatetheestablishmentofahigh-densityvasculature(34) — theso-calledangiogenicswitch — thatisanimportantcomponentoftumorprogression(39).Todetermine whethertherewasanyindicationofchangedvasculardensity in Wnt7b mutanttumors,weuseda owcytometryprotocolto countCD31,CD105VECs.Thisshowedthatat22weeks, therewerereducednumbersofVECsinmutanttumors(Fig. 3A).Toassessthedensityoffunctionalvessels,weperfused tumor-bearingmicewithTexas-redconjugated,lysinexable dextran(Fig.3B,ahighlyreliablemethodforassessingvascular densityasdescribedpreviously;ref.34)andcomparedvessels per eld(Fig.3C)orbranchpointsper eld(Fig.3D)instagematchedtumors.Atpremalignanttumorstages,bothcontrol andmutanttumorsdisplayedthelowvasculardensitytypical oftumorsthathavenotundergonetheangiogenicswitch(Fig. 3B –D).Inearlyandlatecarcinomasofcontrolmice,the vasculardensitywasgreatlyincreased(Fig.3B –D)indicative oftheangiogenicswitch.Bycontrast, Wnt7bdeletedmutant miceshowednosigni cantchangeinthevasculardensityeven Figure1. WNT7B expressioninhumanmammarytumors. WNT7B expression(aslog2median-centeredratio)formammarygland,normalandtumorstroma, showneitherasrawdata(A)orasthemean(B).Inthechartshowingthemean,thedotsindicatetheextremedatavalues.Signi canceaslabeled.C,metaanalysisofrecentgeneexpressionpro lingfor WNT7B wherethecoloredsquaresindicatethemedianrankforWNT7Bacrosseachanalysis.WNT7B ranksinthetop5%to10%inall6analyses.D,endpointRT-PCRforWNT7Bin ow-sortedCD45,CD11b,CD163,CD14TAMsfromhumanmammary carcinoma(T)andadjacentnormaltissue(C).E – N,immunoreactivityincryosectionsofhumanmammarycarcinomaforWNT7B(red)andtheTAM markersCD68(green)orCD163(green)aslabeled.Imagesat 600magni cation(E,H,andL)showboxedregions(F,G,I – K,M,andN)thataredigitally magni edintheadjacentplots.Magni edplotsareinsetsthatshowallthecolorchannelsorjusttheTAMmarker(green)withnuclei(blue)orWNT7B (red)withnuclei(blue).Inthemagni edplots,adashedlineorawhitearrowindicatesthegreen-labeledregionidentifyingaTAM.Thesesameregionsare indicatedintheadjacentimageswhereonlytheWNT7blabelling(red)isshown.Inallcases,WNT7BimmunoreactivityisassociatedwithTAMsand theirprocesses.ThetumorcellsarealsostronglyimmunoreactivewiththeWNT7Bantibody.Whitescalebars,10 m m. MyeloidCellWnt7bMediatesAngiogenicSwitchandMetastasis www.aacrjournals.org CancerRes;74(11)June1,2014 2965 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 6

thoughsometumorshadprogressedtoearlyandlatecarcinomas(Fig.3B –D).Toassessvascularchangesusinganother marker,weperformedlabelingwithCD31in22-weekcontrol andmutanttumors.Quanti cationofCD31area(Fig.3E)and CD31vessels(Fig.3F)showedthatbythesemeasurestoo, mutanttumorsshowedreducedvasculardensity.Thesedata showthatTAMWnt7bisrequiredfortheangiogenicswitch. VEGFAisakeystimulatorofangiogenesisandatargetgene oftheWnt/b -cateninpathwayinsomehumantumors(40,41). Weassessedwhetherthefailureoftheangiogenicswitchin MMTV-PyMT tumorsmightbeassociatedwithchangesin Vegfa expression.Inaccordancewiththishypothesis,thelevel ofthe Vegfa mRNAwassigni cantlyreducedinWnt7b-de cienttumorsatboththeearlyandlatecarcinomastages (Fig.4A).Moreover,thiswasmirroredbyareducedlevelof Vegfaproteinaccordingtoimmunoblots(Fig.4A,inset).When theVEGFA/actinopticaldensityratioofthecontrolwas normalizedto1.0 0.22(n 3),mutanttumorsshoweda valueof0.65 0.07(n 3, P 0.02).WhenCD31VECswere owsortedfromcontrolandmutanttumors(Supplementary Fig.S2A –S2C)andqPCRperformedfor Vegfa transcript,the mutanttumorsshowedreducedexpression(Supplementary Fig.S2D).Thisidenti estumorVECsasalikelysourceof VEGFAthatisregulatedbyTAMWnt7b.Thisalsoraisesthe possibilitythatVEGFA"privateloop"signalingcouldfunction inthetumorcontextasitdoesinvascularsystemmaintenance (42)andvasculardevelopment(43). Flt1(VEGFR1)isanaturallyoccurringinhibitorofVegfa activityregulatedinsomecontextsbyWntsignaling(44)andit waspossiblethatincreasedexpressioncouldpartlyaccountfor theangiogenicswitchfailurein Wnt7b mutanttumors.However,qPCRassessmentof Flt1 transcriptlevelsincontroland mutanttumorsofallstagesdidnotrevealanysigni cant changes(Fig.4B).VEGFR2isthemajorVegfasignalingreceptor(45).Insomesettings,ithasbeenshownthatVEGFR3can driveangiogenesisinabsenceofbothVegfaandVegfr2(46).To assesstheexpressionofVEGFR2andVEGFR3intumorVECs, weperformedqPCRforthesetranscriptson ow-sortedcells fromcontrolandmutanttumors.Thisshowed(Supplementary Fig.S2D)thatthetranscriptsforbothreceptorsweresignificantlyupregulatedalthoughtheincreaseforVegfr2was,in absoluteterms,modest.Thesedataraisethepossibilitythat Figure2. Wnt7b expressionand deletionintheMMTV-PyMT model.A,endpointRT-PCRfor Wnt7bin ow-sorteddextran, F4/80mousemacrophagesfrom Wnt7btm2Amc / (control,C)and Wnt7btm2Amc / ; Csf1r-icre (mutant, M)MMTV-PyMTtumors.B, genotypingPCRonperitonealcells (PC)orin ow-sorteddextran, F4/80macrophagesfromMMTVPyMTtumorsoftheindicated genotypes.ThePCRprimersused donotamplifyaproductfromthe recombined Wnt7btm2Amcallele.C, relative Wnt7b mRNAexpressionin controlandmutant MMTV-PyMT mammarytumorsatpremalignant (hyperplasiaandadenoma,H/A),or malignant(earlycarcinoma,EC andlatecarcinoma,LC)stages. Errorbars,SEM.D,percentageof marker-positivecellsincontrol ( MMTV PyMT;Wnt7btm2Amc / ,C) andmutant( MMTV-PyMT; Wnt7btm2Amc / ; Csf1r-iCre ,M) tumorscombinedfromthe20-to 22-weekrange.Errorbars,SEM. NS,nonsigni cant. Yeoetal. CancerRes;74(11)June1,2014 CancerResearch 2966 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 7

VEGFreceptorupregulationmightpartlycompensatefor reducedVegfaligandlevelsintheWnt7bmutanttumor. ThoughithasbeenshowntheNotchsignalinginVECscan suppressexpressionofVEGFR2andVEGFR3(46),anassessmentofthetranscriptsforthe Hey1 and Dll4 genesthatarethe Notchpathwayresponsive(46)indicatednochange(SupplementaryFig.S2D).Thesedataindicatethatmyeloid Wnt7b deletionresultsinmodulationofseveralcomponentsofthe VEGFAsignalingpathwaywiththenetresultthatangiogenic switchingisde cient. VECsareknowntoexpresstheresponsemachineryforthe WNT/ b -cateninpathway(25,47,48)andsoitwaspossiblethat WNT7B-dependenttumorprogressionwasinpartmediated byadirecteffect.ToassessthestatusoftheWNT/ b -catenin pathwayintumorVECs,weperformedrapid owsortingof CD31,CD105cellsfrom22-weektumorsandperformed qPCRfor Axin2, c-myc ,and CyclinD1 ,threeestablishedWNT/ b -cateninpathwaytargetgenes.Asacontrol,weperformedthe sameqPCRbutfromthewholetumor.Thisshowedthatwhile wholecontrolandmutanttumorsshowednosigni cant change(Fig.4C),thethreeWNT/ b -cateninpathwaytarget geneswereallsigni cantlyreducedinVECs(Fig.4D).These dataidentifyVECsfromtheMMTV-PyMTtumorasWNT/ b -cateninresponsive.Thesedataalsoraisethepossibilitythat VECsresponddirectlytoWnt7bderivedfromTAMs. TodeterminewhetherTAMWNT7bin uencedtumor growth,werecordedglandvolumesoverthe6-to22-week progression(Fig.5A).Plottingthesedataonalogscaleshowed thatthoughtherewerestatisticallysigni cantdifferencesat sometimepointsbetween6and18weeks,inabsoluteterms, thedifferencesweresmallandthegrowthcurvesnearly coincident(Fig.5A).Bycontrast,therewasamajordivergence startingat18weeksinwhichcontroltumorsincreasedin volumeexponentially(Fig.5A,graytrace),whereasthe Wnt7b de cienttumorsplateauedinsize(Fig.5A,bluetrace).Inthe controlgroup,thetumorvolumeat22weekswas650%ofthe 16-weektumorvolume.Inthemutantgroup,22-weektumor volumewas170%ofthe16-weektumorvolume.Tumorsfrom theinguinalmammaryglandswereremovedat16and22 weeksandweighed.Thisshowedthatatbothtimepoints, Figure3. TheangiogenicswitchissuppressedintheabsenceofTAM Wnt7b .A,percentageofCD31,CD105VECsincontrolandmutanttumorscombined fromthe20-to22-weekrange.B,representativeimagesofTexasreddextranperfusedbloodvesselsinPyMTmammarytumorsatpremalignant(hyperplas ia andadenoma,H/A),ormalignant(earlycarcinoma,ECandlatecarcinoma,LC)stages.ThescalebarinB,H/A,controlis100 m mandappliestoall plots.CandD,quanti cationofdextran-labeledvesselsforagiventumorstageusingeithervesselsper eld(C)orbranchpointsper eld(D).Eand F,quanti cationofCD31labelingincontrol(C)andmutant(M)latecarcinomasshowneitherasCD31area(E)orCD31vessels(F).ForAandC – F,sample numberisshownatbaseofhistogrambar.Errorbars,SEM.NS,nonsigni cant. MyeloidCellWnt7bMediatesAngiogenicSwitchandMetastasis www.aacrjournals.org CancerRes;74(11)June1,2014 2967 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 8

tumormassinthemutantmicewassigni cantlyreduced comparedwithcontrols(Fig.5BandC).At22weeks,tumor weightinthemutantmicewas30%oftumorweightinthe controlmice.AnassessmentofproliferationusingaMKI67 labelingindex(Fig.5D)showedthatcontrolandmutant earlycarcinomasshowedindistinguishablelevelsofproliferation.Inlatecarcinomas,controltumorsshowedaMKI67 labelingindexthathadnearlydoubled(Fig.5D).Incontrast, mutantlatecarcinomasdidnotshowelevatedMKI67labelingandremainedatthelevelobservedinearlycarcinomas (Fig.5D).Thesedatasuggestthatthesizeplateauobserved inmutanttumorsisatleastpartlyexplainedbyafailureof theproliferationratetoelevateatlatetumorstages.Combined,thesedataindicatethatTAMWNT7bpromotes tumorgrowth. Promptedbythechangesintumorgrowthintheconditional mutant,wedeterminedwhetherthestageoftumorprogressionwasaffectedbyTAM Wnt7b deletion.Weassessedhistologictumorprogressiononthebasisofrepresentativesections from4planesineachinguinalmammaryglandat16and22 weeks.Thisanalysiswasperformedblindusingcriteria describedpreviously(30).At16weeks,controlandmutant tumorsshowedasimilardistributionofstages(Fig.5E).Forty fourpercentofcontrolandmutanttumorswerehyperplasiaor adenoma,whereas33%ofcontroland44%ofmutantwere earlycarcinomas.Only22%and11%ofcontrolandmutant tumorshadprogressedtolatecarcinomasatthistimepoint.At 22weeks,about90%ofthecontroltumorswerecarcinomas andofthese,theearly–latecarcinomadistributionwas30% and60%.Bycontrast,myeloid Wnt7b deletionresultedinonly 40%carcinomaswithanequaldistributionofearlyandlate stages.Similarly,12%ofcontroltumorswerehyperplasiasor adenomas,but56%ofmutanttumorswereatthesamestage. TheFisherexacttestshowedthatalthoughthecontroltumors showedsigni canttumorprogressionbetween16and22 weeks( P 0.05),themutanttumorsdidnot.Despitethese observeddelaysintumorprogressioninthe Wnt7b -de cient mice,therewerenonoticeabledifferencesingrosshistologyin stage-matchedtumors,includingthepresenceofnecrotic regions,whenconditionalmutantandcontroltumorswere compared.TheseresultsshowthatTAMWNT7bpromotes malignanttumorprogression. Figure4. TheexpressionofVEGFAis reducedbythedeletionoftumor stromacellWnt7b.A,relative Vegfa mRNAexpressionincontrol(C)and mutant(M)MMTV-PyMTtumorsat hyperplasiaandadenoma(H/A),early carcinoma(EC),andlatecarcinoma (LC)stages.Inset,immunoblottingfor VEGFAandactincontrolandmutant MMTV-PyMTtumorlysates.B, relative sFlt-1 mRNAlevelincontrol andmutantMMTV-PyMTtumorsat hyperplasiaandadenoma(H/A),early carcinoma(EC),andlatecarcinoma (LC)stages.CandD,relative expressionof Axin2 , c-Myc ,and CyclinD1 incontrolandmutantwhole tumor(C)andCD31,CD105blood VECs(D).Samplenumberisshownat thebaseofeachhistogrambar.Error bars,SEM.NS,nonsigni cant. Yeoetal. CancerRes;74(11)June1,2014 CancerResearch 2968 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 9

ThefavoredsitesofmetastasisintheMMTV-PyMTtumor modelarelungandlymphnode(30).Lungsfromtumorbearing22-week-oldcontrolm iceshowedmetastasesovera rangeofseverity;typicalexamplesofcontrolandmutant lungsinwholemount(Fig.6AandB)orsection(Fig.6Cand D)areshown.Toquantifytherateofmetastasisinthe controland Wnt7b conditionalmutant,weisolatedthelungs of22-week-oldmiceandweighedthem.Thelungsofnon – tumor-bearingmiceservedasanegativecontrol.Control, MMTV-PyMT;Wnt7b /tm2Amclungswerephysicallylarger andweighedsigni cantlymore(Fig.6E)thantheircontrol counterparts.Conditionaldeletionof Wnt7b preventedthe increaseinlungweight(Fig.6E).UsingqPCRampli cation ofthe MMTV-PyMT transcriptasanalternativemeasureof lungmetastaticloadalsoshowedthatmutantmicehad reducedmetastasis(Fig.6F).Ametastaticindexcalculated accordingtoestablishedandrigorousstereologicalmethods (4)showed,likelungweightandPyMTtranscript,thatloss of Wnt7b fromTAMsreducedthelevelofmetastasis (Fig.6G). PreviousanalysishasshownthatintheMMTV-PyMT model,tumorcellsandTAMscomigrateoutoftheprimary tumor(5).Thiscomigrationincludesintravasationandis drivenbyaparacrinefeedbackloopofTAMEGFandtumor cellCSF1(5).Thisconclusionwasbasedonseverallinesof evidence,includingintravitalimagingoftumorcellsand TAMsandan invivo invasionassayinwhichwequantifythe numberoftumorcellsandmacrophagesthatmigrateintoa CSF1orEGF-loadedmicroneedleinsertedintothetumor (49).Weusedthis invivo invasionassaytodeterminethe in uenceofTAMWNT7bontumorcellinvasion.Whenthe needlesdidnotcontainEGF,thenumberofcellsentering themicroneedleswassmall,aspreviouslyshown(Fig.6H). However,whenEGFwasprovid edasachemoattractant, manycellsmigratedinboththecontrolandtheWnt7b conditionalmutant(Fig.6H).TheabsenceofTAMWnt7b, however,reducedthenumberofmigratingcellsbyabout2fold(Fig.6H).Thesedatashow,usingseveralindependent methods,thatTAMWNT7bhasanimportantroleinpromotingmetastasis. Asameansofevaluatingthe ndingsinthemouseMMTVPyMTmodelusinghumandata,wereturnedtotheFinakand colleaguesdataset(38)thatassessedgeneexpressioninmammarycarcinomastroma,andperformedgeneexpressioncorrelationanalysiswithWNT7B.Thishasshownalimitedbut interestingsetofcorrelationsbetweenstromalWNT7Band somecellmarkersaswellaschemokinesandtheirreceptors (Table1).Asmightbeexpected,therewasasigni cantpositive correlationbetween WNT7B andthemyeloidsignalingfactor CSF1andbetween WNT7B andthemyeloidmarkerCD209. ConsistentwithWNT7b-dependentangiogenicswitchingin themousemodel,therewasalsoasigni cantpositivecorrelationbetweenWNT7BandthevascularmarkerCD31.Human stromalWNT7Bisalsosigni cantlycorrelatedwithCCL3, CCL13,andCCR2.Thesecorrelationsareconsistentwith existinganalysis(50,51)andmaysuggestthatWNT7Bshares aregulatoryrelationshipwithchemokinesthatin uence tumorprogression. Figure5. TAM Wnt7b deletion suppressestumorvolume,mass, andprogression.A,controland mutantinguinalglandvolumefrom 6to22weeks.BandC,inguinal glandmassat16(B)and22(C) weeks.ForBandC,sample numberisshownatthebaseofthe chart.Errorbars,SEM.D,MKI67labeledcellsper eldforcontrol ( MMTV PyMT;Wnt7btm2Amc / ,C) andmutant( MMTV-PyMT; Wnt7btm2Amc / ; Csf1r-iCre ,M) earlycarcinomas(EC)andlate carcinomas(LC). P valuesas labeled;errorbarsareSEM.NS, nonsigni cant.E,distributionofthe stageofprogressionforcontrol andmutantMMTV-PyMT mammarytumorsat16weeks(for C, n 18;forM, n 18)and22 weeks(forC, n 17;forM, n 9). Hyperplasiaandadenoma,H/A. MyeloidCellWnt7bMediatesAngiogenicSwitchandMetastasis www.aacrjournals.org CancerRes;74(11)June1,2014 2969 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 10

DiscussionInthecurrentstudy,wehaveshownthathumanmammary carcinomaisstronglyassociatedwithoverexpressionofthe WNTfamilyligandWNT7Binthetumorstromaandthat isolatedhumanbreastcarcinomaTAMsexpressWNT7B. Usingexperimentalmice,wehavealsoshownthatWNT7b hasakeyroleinmalignantprogressionoftheMMTV-PyMT modelofluminalbreastcancerbecauseitregulatestheangiogenicswitch,tumorprogression,tumorgrowth,tumorcell invasion,andmetastasis.Usingconditionalinactivationofthe Wnt7b genewiththemyeloid-restricted Csf1r-icre driver(28), weshowthatacriticalsourceofWnt7bistheTAM. Thesedataareconsistentwithpriorworkshowingthat TAMscanpromoteangiogenicswitching(34)andthatWNT7b canregulateangiogenesisandvascularremodelinginother settings,includingthedevelopingneuroepithelium(26),the lung(33),andviamacrophages,intheeye(25).TAMsinthe PyMTmodelexpressTIE2(SupplementaryFig.S1D –S1I)andit hasalsobeenshownthatTIE2TAMspromoteangiogenesis inmodelsofspontaneousandorthotopicpancreatictumors (7,52).Importantly,TIE2expressionontheTAMisrequiredfor thesecellstoadheretovessels,includinginthePyMTmodel, andintheabsenceofTIE2,angiogenesisisinhibited(8).The observationthatconditional Wnt7b inactivationresultsin reducedexpressionofseveralcanonicalWNTpathwaytarget genesinVECssuggeststhatWNT7bdirectlystimulatesthe vasculature.BecauseWNT7Bhasashortrangeofaction(25),it islikelythatsignalingisviacell –cellcontact,apossibility consistentwiththedistributionofTIE2TAMsontheabluminalsurfacesoftumorvasculature(30,32,49). VEGFAisanestablishedmediatoroftumorangiogenesis (53).Thecurrentanalysisshowsthathigh Vegfa transcriptand proteinlevelsintheMMTV-PyMTtumoraredependenton Wnt7b.Furthermore,weshow,using ow-sortedcells,that tumorVECsareasourceof Vegfa transcriptandthatmyeloid Wnt7bnormallyupregulatesthistranscript.Thesedataare consistentwiththesuggestionthattumorVECscanrespond directlytomyeloidWNT7b.In ow-sortedtumorVECs,wealso observedanupregulationofthetranscriptsforVegfr2and Vegfr3when Wnt7b wasdeletedfrommyeloidcells.Wespeculatethatthischangemaypartlycompensateforthereduced levelofVEGFAligand.Though Vegfr2 and Vegfr3 transcripts canbesuppressedbyNotchsignalinginsomesettings(46),the absenceofanychangeinexpressionoftheNotch-responsive genes Dll4 and Hey1 (46)suggestedthatthiswasnotthecasein theVECsoftheMMTV-PyMTtumor. Vegfagain-of-functioninthePyMTmodelresultedinacceleratedangiogenicswitchingandacceleratedtumorprogressiontomalignancyinmacrophage-de cientmice(31).However,surprisingly,deletionof Vegfa frommyeloidcellsusing LysM-cre resultedinincreasedtumorsizeandaggressiveness eventhoughangiogenicswitchingwasinhibited(54).In LysMcre;Vegfa / mice,Vegfalevelswerenotchangedoverallbut therewasreducedVegfaresponsiveness.Thiscontrastswith thecurrent ndingsinwhichconditional Wnt7b inactivation resultedinreducedtumorsizeandgrowth,aslowerrateof tumorprogression,agloballyreducedlevelof Vegfa expression, Figure6. Metastasisisreducedinthe absenceoftumorstromacell WNT7B.A – D,representativeimagesofmetastasizedlungincontrol (AandC)andmutant(BandD)miceinwholemount(AandB)andin section(CandD)at22weeks.ScalebarsinA – D,180 m m.AandB, obvioussurfacemetastasesinwholemountlungsaremarkedwith yellowdots.CandD,inlungsections,metastasesseemasdense purpleregions.E,quanti cationoftotallungweightincontroland mutant,tumor-free,andtumor-bearingmiceat22weeks.NS, nonsigni cant.F,relativePyMTmRNA expressionincontroland mutantlungat22weeks.G,thelungmetastasisindexforcontroland mutantmiceat22weeks.Samplenumberisshownatthebaseofeach histogrambarinE – G.H,quanti cationofthenumberofcellsthat migrateintomicroneedlesplacedineithercontrol( MMTVPyMT; Wnt7btm2Amc / ,C)ormutant( MMTV-PyMT;Wnt7btm2Amc / ; Csf1riCre ,M)tumors.Themicroneedleswereloadedwitheithervehicle( ) orEGF( )aslabeled.ThesedatashowthattheabsenceofTAM Wnt7bsigni cantlyreducedthenumberofcellsthatmigrateintothe needleunderthein uenceofEGF.Errorbarsforallcharts,SEM. Yeoetal. CancerRes;74(11)June1,2014 CancerResearch 2970 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 11

andalossofangiogenicswitching.Thesedifferencesprobably re ectafunctionforWNT7bindirectlyelicitingresponsesfrom cellswithinthetumorandthelikelihoodthatWNT7b-induced VEGFAexpressionisjustoneoftheseresponses.Indeed, studiesusingthe invivo tumorcell – macrophageinvasionassay showthatintheabsenceofWnt7bTAMsarelessef cientat promotingtumorcellinvasion.Furthermore,ofgreatinterest, giventhestrongcorrelationsbetweenWNT7Bexpressionand thoseofthechemokinesignalinggenesinstromafromhuman mammarycarcinoma(Table1),isthepossibilitythatWNT7B regulateschemokineligandandreceptorexpressionandthat theseactasadditionaleffectorsofWNT7b-dependenttumor progression(50,51,55 – 57).Itisnotablethatthemajoreffectof conditionaldeletionof Wnt7b onMMTV-PyMTtumorprogressionisverysimilartothatobservedwhenmacrophagesare depletedorablated(4,31,34,58),suggestingthatWNT7bis requiredfortheexpressionofmanymyeloidactivitiesthat promotetumorprogression. ThelossofTAMsfromthePyMTmodelresultedinaslowing intherateoftumorprogressionparticularlytomalignancy(59). Thisismostlikelyduetotheinhibitionoftheangiogenicswitch asaccelerationofthisswitchusingagain-of-functionofCSF1or VEGFeitherinwild-typeormacrophage-de cientmiceacceleratedtumorprogression(31,34,58).Inthisstudy,thelossof myeloidWnt7bcausedasimilarphenotypetotheablationof TAMswithfewtumorsprogressingtomalignancy.Onthe geneticbackgroundusedinthepresentstudies,thistransition tomalignancywasalittlelaterthanthe8to12weeksreported fortheoriginalstrainbackground(30)asevensomewild-type tumorshadnotprogressedtomalignancyby16weeks.Nevertheless,oncetheangiogenicswitchwasestablishedandtumors progressedtomalignancy,thewild-typetumorsacceleratedin theirgrowthasshownbyadramaticincreaseinmassaccompaniedbyrapidproliferationasindicatedbyKi67staining.In contrast,thegrowthofWNT7b-de cienttumorsplateauedwith areducedrateofproliferation(Ki67-positivecells)after16 weeksofagepresumablyduetonutrientde ciencyanddeprivationofoxygencausedbyaninsuf cientvascularnetwork. Akey ndingofthisstudyisthat Wnt7b inactivationin myeloidcellsreducedpulmonarymetastasisinthePyMT model.Inthismodel,metastasisdependsontumorcells becomingmalignantandescapingfromtheprimarytumor intothehematogenouscirculation.Thisescapeisacombinationofenhancedinvasivenessoftumorcellsaswellas theincreasednumberofvasculartargets.Lossof Wnt7b reduces thevasculardensityandhasadirecteffectontheabilityof macrophagestopromotetumorcellinvasion invivo .We suggestthatthiscombinationofchangesreducesmetastasis. Csf1r-icre activitydoes,however,resultinsomedeletionin cellsoftheacquiredimmunesystem(28)andcon rmedinthis study(datanotshown).Nevertheless,inotherstudies,the completeabsenceofBcellsintheMMTV-PyMTtumordoes notchangetherateofpulmonarymetastasis(10),suggesting thatthechangesweobservearenotlikelytoresultfromthe inactivationof Wnt7b inBcells.Ithasrecentlybeenshownthat CD4Tcellspromotepulmonarymetastasis.Thiseffectwas throughT-cellIL-4polarizingthefunctionofTAMstobecome prometastaticthroughtheirabilitytoinducetumorcellmigrationandinvasion(10).However,inthisstudyfromCoussens' andcoworkers,followingdepletionofTcells,angiogenesiswas unimpaired.ThisindicatesthatWNT7BderivedfromTcellsis unimportantforangiogenesis.Furthermore,usingtheinvasion assay,weshowdirectlythat Wnt7b -de cientmacrophagesare lessabletostimulatetumorcellinvasion invivo .Consistent withthese ndings,ourrecentbioinformaticsstudyshowed thattheTAMsthatdirecttumorcellintravasationandextravasationrepresentauniquesubpopulationasde nedbytheir geneexpressionsignaturewith Wnt7b transcriptsbeinghighly representedinthissignature(23).ThesedatasuggestasignalingrelationshipbetweentheWnt/ b -cateninandIL-4pathwaysor,alternatively,thateachpathwayindependentlysupportsaresponserequiredforpulmonarymetastasis,perhapsat differentstagesoftheprocess. WNT7bexpressionalsocorrelateswithmarkersofpoor prognosissuchaslymphnodepositivityinhumanbreast cancer(23)andthroughanalysisoftheTissueCancerGenome Atlasdatasetsitishighlyupregulatedinbreast(Fig.1A)and lungcancer(datanotshown).Consistentwiththesedata, Wnt7b expressionupregulationisafeatureofthepopulationof TAMsthatpromoteangiogenesisandmetastasis.TheexpressionofWNT7BbyTAMsfromhumantumorsfurthersuggests thattherapeutictargetingofWNT7Bresponsesmightbe bene cialinthetreatmentofsomesolidtumors.Because WNT7Bresponsespromotemanydifferentaspectsoftumor progressionatmultiplelevels,includingthreeofthesixrecognizedcancerhallmarks(39),WNT7Bactivitysuppressionis auniquelypromisingtherapeutictargetlikelytoaffecttherate oftumormetastasis,akeyfactorinpatientsurvival. DisclosureofPotentialCon ictsofInterestJ.W.Pollardhasownershipinterestinapatent.R.A.Langhasownership interestinMuregen.Nopotentialcon ictsofinterestweredisclosedbytheother authors.Authors'ContributionsConceptionanddesign: E.-J.Yeo,I.Lewkowich,J.W.Pollard,R.A.Lang Developmentofmethodology: E.-J.Yeo,I.Lewkowich,L.S.Wiechmann, J.W.Pollard,R.A.Lang Acquisitionofdata(providedanimals,acquiredandmanagedpatients, providedfacilities,etc.): E.-J.Yeo,L.Cassetta,I.Lewkowich,J.-f.Li,J.A.Stefater III,A.N.Smith,L.S.Wiechmann,Y.Wang,J.W.Pollard,R.A.Lang Table1. ExpressioncorrelationswithWNT7Bin thestromaofhumanmammarycarcinomaMarker/chemokine Rfactor P CSF1 0.091 0.0311 CD209 0.211 0.0007 CD31 0.268 0.0001 CCL3 0.087 0.0353 CCL13 0.139 0.0070 CCR2 0.158 0.0039 NOTE:TheexpressionlevelofIL-4,IL-6,IL-10,TGF b ,CSF1R, CD14,CD11b,CD163,CCL2,CCL4,CCL5,CCL7,CCL8, CCL19,CXCL2,CXCL14,CXCL16,CCR1,andCCR5wasnot signi cantlycorrelatedwithexpressionlevelofWNT7B. MyeloidCellWnt7bMediatesAngiogenicSwitchandMetastasis www.aacrjournals.org CancerRes;74(11)June1,2014 2971 on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 12

Analysisandinterpretationofdata(e.g.,statisticalanalysis,biostatistics, computationalanalysis): E.-J.Yeo,L.Cassetta,B.-Z.Qian,I.Lewkowich, J.W.Pollard,R.A.Lang Writing,review,and/orrevisionofthemanuscript: E.-J.Yeo,J.W.Pollard, R.A.Lang Administrative,technical,ormaterialsupport(i.e.,reportingororganizingdata,constructingdatabases): J.-f.Li,J.A.StefaterIII,R.A.Lang Studysupervision: J.W.Pollard,R.A.LangAcknowledgmentsTheauthorsthankPaulSpeegforexcellenttechnicalassistanceandDr.Jeff Segall,AlbertEinsteinCollegeofMedicine,foradviceontheinvasionassay.GrantSupportThisstudywassupportedbygrantsfromtheNIH(PO1CA100324to J.W.Pollardand1R01CA131270toR.A.LangandJ.W.Pollard),the WellcomeTrust(J.W.Pollard),andtheAbrahamsonPediatricEyeInstitute EndowmentatChildren'sHospitalMed icalCenterofCincinnati(R.A.Lang). Thecostsofpublicationofthisarticleweredefrayedinpartbythe paymentofpagecharges.Thisarticlemustthereforebeherebymarked advertisement inaccordancewith18U.S.C.Section1734solelytoindicatethis fact. ReceivedAugust22,2013;revisedJanuary20,2014;acceptedFebruary9,2014; publishedOnlineFirstMarch17,2014.References1. deVisserKE,KoretsLV,CoussensLM.Denovocarcinogenesis promotedbychronicin ammationisBlymphocytedependent.CancerCell2005;7:411 – 23. 2. AndreuP,JohanssonM,AffaraNI,PucciF,TanT,JunankarS,etal. FcRgammaactivationregulatesin ammation-associatedsquamous carcinogenesis.CancerCell2010;17:121– 34. 3. LinEY,NguyenAV,RussellRG,PollardJW.Colony-stimulatingfactor 1promotesprogressionofmammarytumorstomalignancy.JExp Med2001;193:727 – 40. 4. QianB,DengY,ImJH,MuschelRJ,ZouY,LiJ,etal.Adistinct macrophagepopulationmediatesmetastaticbreastcancercell extravasation,establishmentandgrowth.PLoSONE2009;4:e6562. 5. CondeelisJ,PollardJW.Macrophages:obligatepartnersfortumorcell migration,invasion,andmetastasis.Cell2006;124:263– 6. 6. QianBZ,LiJ,ZhangH,KitamuraT,ZhangJ,CampionLR,etal.CCL2 recruitsin ammatorymonocytestofacilitatebreast-tumourmetastasis.Nature2011;475:222 – 5. 7. DePalmaM,VenneriMA,GalliR,SergiSergiL,PolitiLS,Sampaolesi M,etal.Tie2identi esahematopoieticlineageofproangiogenic monocytesrequiredfortumorvesselformationandamesenchymal populationofpericyteprogenitors.CancerCell2005;8:211 – 26. 8. CoffeltSB,ChenYY,MuthanaM,WelfordAF,TalAO,ScholzA,etal. Angiopoietin2stimulatesTIE2-expressingmonocytestosuppressT cellactivationandtopromoteregulatoryTcellexpansion.JImmunol 2011;186:4183 – 90. 9. RuffellB,AffaraNI,CoussensLM.Differentialmacrophageprogramminginthetumormicroenvironment.TrendsImmunol2012;33: 119 – 26. 10. DeNardoDG,BarretoJB,AndreuP,VasquezL,Taw kD,KolhatkarN, etal.CD4( )Tcellsregulatepulmonarymetastasisofmammary carcinomasbyenhancingprotumorpropertiesofmacrophages. CancerCell2009;16:91 – 102. 11. WangL,YiT,KortylewskiM,PardollDM,ZengD,YuH.IL-17can promotetumorgrowththroughanIL-6-Stat3signalingpathway.JExp Med2009;206:1457 – 64. 12. LoganCY,NusseR.TheWntsignalingpathwayindevelopmentand disease.AnnuRevCellDevBiol2004;20:781– 810. 13. Garcia-RostanG,CampRL,HerreroA,CarcangiuML,RimmDL,Tallini G.Beta-catenindysregulationinthyroidneoplasms:down-regulation, aberrantnuclearexpression,andCTNNB1exon3mutationsare markersforaggressivetumorphenotypesandpoorprognosis.Am JPathol2001;158:987 – 96. 14. PukkilaMJ,VirtaniemiJA,KumpulainenEJ,PirinenRT,JohanssonRT, ValtonenHJ,etal.Nuclearbetacateninexpressionisrelatedto unfavourableoutcomeinoropharyngealandhypopharyngealsquamouscellcarcinoma.JClinPathol2001;54:42 – 7. 15. KinzlerKW,VogelsteinB.Lessonsfromhereditarycolorectalcancer. Cell1996;87:159– 70. 16. KorinekV,BarkerN,MorinPJ,vanWichenD,deWegerR,Kinzler KW,etal.Constitutivetranscriptio nalactivationbyabeta-cateninTcfcomplexinAPC/ coloncarcinoma.Science1997;275: 1784– 7. 17. TaniguchiK,RobertsLR,AdercaIN,DongX,QianC,MurphyLM,etal. Mutationalspectrumofbeta-catenin,AXIN1,andAXIN2inhepatocellularcarcinomasandhepatoblastomas.Oncogene2002;21: 4863 – 71. 18. DahmenRP,KochA,DenkhausD,TonnJC,SorensenN,BertholdF, etal.DeletionsofAXIN1,acomponentoftheWNT/winglesspathway, insporadicmedulloblastomas.CancerRes2001;61:7039– 43. 19. NusseR,VarmusHE.Manytumorsinducedbythemousemammary tumorviruscontainaprovirusintegratedinthesameregionofthehost genome.Cell1982;31:99– 109. 20. HuguetEL,McMahonJA,McMahonAP,BicknellR,HarrisAL.DifferentialexpressionofhumanWntgenes2,3,4,and7Binhumanbreast celllinesandnormalanddiseasestatesofhumanbreasttissue. CancerRes1994;54:2615 – 21. 21. BuiTD,ZhangL,ReesMC,BicknellR,HarrisAL.Expressionand hormoneregulationofWnt2,3,4,5a,7a,7band10binnormalhuman endometriumandendometrialcarcinoma.BrJCancer1997;75: 1131 – 6. 22. LindvallC,BuW,WilliamsBO,LiY.Wntsignaling,stemcells,andthe cellularoriginofbreastcancer.StemCellRev2007;3:157 – 68. 23. OjalvoLS,WhittakerCA,CondeelisJS,PollardJW.Geneexpression analysisofmacrophagesthatfacilitatetumorinvasionsupportsarole forWnt-signalinginmediatingtheiractivityinprimarymammary tumors.JImmunol2010;184:702– 12. 24. ZhengD,DeckerKF,ZhouT,ChenJ,QiZ,JacobsK,etal.Roleof WNT7B-inducednoncanonicalpathwayinadvancedprostatecancer. MolCancerRes2013;11:482– 93. 25. LobovIB,RaoS,CarrollTJ,VallanceJE,ItoM,OndrJK,etal.WNT7b mediatesmacrophage-inducedprogrammedcelldeathinpatterning ofthevasculature.Nature2005;437:417 – 21. 26. StenmanJM,RajagopalJ,CarrollTJ,IshibashiM,McMahonJ, McMahonAP.CanonicalWntsignalingregulatesorgan-speci c assemblyanddifferentiationofCNSvasculature.Science2008; 322:1247– 50. 27. OjalvoLS,KingW,CoxD,PollardJW.High-densitygeneexpression analysisoftumor-associatedmacrophagesfrommousemammary tumors.AmJPathol2009;174:1048 – 64. 28. DengL,ZhouJF,SellersRS,LiJF,NguyenAV,WangY,etal.Anovel mousemodelofin ammatoryboweldiseaselinksmammaliantarget ofrapamycin-dependenthyperproliferationofcolonicepitheliumto in ammation-associatedtumorigenesis.AmJPathol2010;176: 952 – 67. 29. LinSL,LiB,RaoS,YeoEJ,HudsonTE,NowlinBT,etal.Macrophage Wnt7biscriticalforkidneyrepairandregeneration.ProcNatlAcadSci USA2010;107:4194 – 9. 30. LinEY,JonesJG,LiP,ZhuL,WhitneyKD,MullerWJ,etal.Progression tomalignancyinthepolyomamiddleToncoproteinmousebreast cancermodelprovidesareliablemodelforhumandiseases.AmJ Pathol2003;163:2113 – 26. 31. LinEY,LiJF,BricardG,WangW,DengY,SellersR,etal.Vascular endothelialgrowthfactorrestoresdelayedtumorprogressionin tumorsdepletedofmacrophages.MolOncol2007;1:288 – 302. 32. WyckoffJ,WangW,LinEY,WangY,PixleyF,StanleyER,etal.A paracrineloopbetweentumorcellsandmacrophagesisrequired fortumorcellmigrationinmammarytumors.CancerRes2004;64: 7022– 9. CancerRes;74(11)June1,2014 CancerResearch 2972 Yeoetal. on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421

PAGE 13

33. RajagopalJ,CarrollTJ,GusehJS,BoresSA,BlankLJ,AndersonWJ, etal.Wnt7bstimulatesembryoniclunggrowthbycoordinately increasingthereplicationofepitheliumandmesenchyme.Development2008;135:1625 – 34. 34. LinEY,LiJF,GnatovskiyL,DengY,ZhuL,GrzesikDA,etal.Macrophagesregulatetheangiogenicswitchinamousemodelofbreast cancer.CancerRes2006;66:11238 – 46. 35. YeoEJ,ChunYS,ChoYS,KimJ,LeeJC,KimMS,etal.YC-1:a potentialanticancerdrugtargetinghypoxia-induciblefactor1.JNatl CancerInst2003;95:516 – 25. 36. HernandezL,SmirnovaT,KedrinD,WyckoffJ,ZhuL,StanleyER,etal. TheEGF/CSF-1paracrineinvasionloopcanbetriggeredbyheregulin beta1andCXCL12.CancerRes2009;69:3221 – 7. 37. RhodesDR,Kalyana-SundaramS,MahavisnoV,VaramballyR,YuJ, BriggsBB,etal.Oncomine3.0:genes,pathways,andnetworksina collectionof18,000cancergeneexpressionpro les.Neoplasia 2007;9:166 – 80. 38. FinakG,BertosN,PepinF,SadekovaS,SouleimanovaM,ZhaoH, etal.Stromalgeneexpressionpredictsclinicaloutcomeinbreast cancer.NatMed2008;14:518 – 27. 39. HanahanD,WeinbergRA.Hallmarksofcancer:thenextgeneration. Cell2011;144:646 – 74. 40. ZhangX,GaspardJP,ChungDC.Regulationofvascularendothelial growthfactorbytheWntandK-raspathwaysincolonicneoplasia. CancerRes2001;61:6050 – 4. 41. ZhangB,AbreuJG,ZhouK,ChenY,HuY,ZhouT,etal.Blockingthe Wntpathway,aunifyingmechanismforanangiogenicinhibitorinthe serineproteinaseinhibitorfamily.ProcNatlAcadSciUSA 2010;107:6900 – 5. 42. LeeS,ChenTT,BarberCL,JordanMC,MurdockJ,DesaiS,etal. AutocrineVEGFsignalingisrequiredforvascularhomeostasis.Cell 2007;130:691 – 703. 43. FanJ,PonferradaVG,SatoT,VemarajuS,FruttigerM,GerhardtH, etal.Crim1maintainsretinalvascularstabilityduringdevelopmentby regulatingendothelialcellVegfaautocrinesignaling.Development 2014;141:448 – 59. 44. StefaterJA3rd,LewkowichI,RaoS,MariggiG,CarpenterAC,BurrAR, etal.Regulationofangiogenesisbyanon-canonicalWnt-Flt1pathway inmyeloidcells.Nature2011;474:511 – 5. 45. FerraraN.VEGF-A:acriticalregulatorofbloodvesselgrowth.Eur CytokineNetw2009;20:158 – 63. 46. BeneditoR,RochaSF,WoesteM,ZamykalM,RadtkeF,CasanovasO, etal.Notch-dependentVEGFR3upregulationallowsangiogenesis withoutVEGF-VEGFR2signalling.Nature2012;484:110 – 4. 47. GoodwinAM,D'AmorePA.Wntsignalinginthevasculature.Angiogenesis2002;5:1 – 9. 48. FrancoCA,LiebnerS,GerhardtH.Vascularmorphogenesis:aWntfor everyvessel?CurrOpinGenetDev2009;19:476– 83. 49. WyckoffJB,WangY,LinEY,LiJF,GoswamiS,StanleyER,etal.Direct visualizationofmacrophage-assistedtumorcellintravasationinmammarytumors.CancerRes2007;67:2649 – 56. 50. RenG,ZhaoX,WangY,ZhangX,ChenX,XuC,etal.CCR2-dependent recruitmentofmacrophagesbytumor-educatedmesenchymalstromalcellspromotestumordevelopmentandismimickedbyTNFalpha. CellStemCell2012;11:812 – 24. 51. FangWB,JokarI,ZouA,LambertD,DendukuriP,ChengN.CCL2/ CCR2chemokinesignalingcoordinatessurvivalandmotilityofbreast cancercellsthroughSmad3protein-andp42/44mitogen-activated proteinkinase(MAPK)-dependentmechanisms.JBiolChem2012; 287:36593 – 608. 52. DePalmaM,VenneriMA,RocaC,NaldiniL.Targetingexogenous genestotumorangiogenesisbytransplantationofgeneticallymodi edhematopoieticstemcells.NatMed2003;9:789 – 95. 53. FerraraN,HillanKJ,GerberHP,NovotnyW.Discoveryanddevelopmentofbevacizumab,ananti-VEGFantibodyfortreatingcancer.Nat RevDrugDiscov2004;3:391 – 400. 54. StockmannC,DoedensA,WeidemannA,ZhangN,TakedaN,GreenbergJI,etal.Deletionofvascularendothelialgrowthfactorinmyeloid cellsacceleratestumorigenesis.Nature2008;456:814 – 8. 55. StrieterRM,BelperioJA,BurdickMD,SharmaS,DubinettSM,Keane MP.CXCchemokines:angiogenesis,immunoangiostasis,andmetastasesinlungcancer.AnnNYAcadSci2004;1028:351 – 60. 56. KarnoubAE,WeinbergRA.Chemokinenetworksandbreastcancer metastasis.Breastdisease2006;26:75 – 85. 57. ZlotnikA,BurkhardtAM,HomeyB. Homeostaticchemokinereceptorsandorgan-speci cmetastasis.NatR evImmunol2011;11: 597 – 606. 58. LinEY,PollardJW.Tumor-associatedmacrophagespresstheangiogenicswitchinbreastcancer.CancerRes2007;67:5064 – 6. 59. LinEY,PollardJW.Macrophages:modulatorsofbreastcancer progression.Novartis FoundSymp2004;256:158 – 68;discussion 168 – 172,259– 169. www.aacrjournals.org CancerRes;74(11)June1,2014 2973 MyeloidCellWnt7bMediatesAngiogenicSwitchandMetastasis on June 10, 2014. 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 17, 2014; DOI: 10.1158/0008-5472.CAN-13-2421



PAGE 1

CATHEPSIN L TARGETING IN METASTATIC DISEASE By DHIVYA RAJA SUDHAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Dhivya Sudhan

PAGE 3

Dedicated to mummy, pa ppa, Anand and Sadhguru for their unconditional love and support !

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my parents for endowing me with the gift of education and above all for teaching me the importance of compassion and willingness to give and forgive . They stood by me through all highs and lows and placed more confidence in me than I ever could in myself! I would also like to thank my husba nd for being my rock and sharing my exhilarations and disappointments and for alwa ys placing my happiness and interests above his own ! Special thanks goes to my brother for teaching me to enjoy every moment of my life no matter what the external circumstances are! I would like to express my heartfelt gratitude to my mentor Dr. Dietmar S iemann for opening the doors of science to me . I owe every bit of my scientific expertise to him. He gave me the rare freedom to explore science and shape my project so that I develop an unremitting passion and love for what I do. He has touched and enrich ed my life in so many different ways by being a teacher, a role model, a friend and much much more ! I am deeply indebted to my committee members Drs. Peter Sayeski, Charles Wood, Thomas Rowe and Michael Bubb for their encouragemen t and invaluable suggestio ns. My special thank s to my lab mates for the ir love, encouragement and belief in me. I would not be here without the love and support of Dr. Niki Biel and Sharon Lepler. I consider myself very fortunate to have an amazing friend like Niki! Thanks to Veronica Hugh es, Dr. Jennifer Lee and Jennifer Wiggin s for being such wonderful labmates and sharing my frustrations and love for science. I am also indebted to Christine Pampo, Dr. Lori Rice and Dr. Yao Dai for their scientific insights and tec hnical expertise. They all have shaped m y project in so many ways and have enriched my journey of graduate studies with beautiful memories.

PAGE 5

5 Last but not the least; I would like to express my heartfelt gratitude to the Interdisciplinary program, College of medicine for believing in me and giving me this wonderful opportunity to pursue my dream of becoming a cancer researcher!

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 INTRODUCTI ON ................................ ................................ ................................ .... 13 Proteases as Targets in Cancer Treatment ................................ ............................ 14 The Biology of Cysteine Cathepsins ................................ ................................ ....... 15 Physiological Roles of Cysteine Cathepsins ................................ ........................... 16 Cathepsin L Upregulation in Human Cancers ................................ ......................... 17 CTSL Secretion by Tumor Cells ................................ ................................ ............. 19 Nuclear CTSL ................................ ................................ ................................ ......... 21 Role of CTSL in Tumor Metastasis ................................ ................................ ......... 22 Role of Cathepsin L in Bone Resorption ................................ ................................ . 25 Cathepsin L Targeting ................................ ................................ ............................. 29 Cathepsin L Inhibitor KGP94 ................................ ................................ .................. 31 Motivation and goal of research ................................ ................................ .............. 32 2 EFFECT OF CTSL TARGETING ON IN VITRO METASTASIS ASSOCIATED TUMOR CELL FUNCTIONS ................................ ................................ ................... 37 Backgrou nd ................................ ................................ ................................ ............. 37 Materials and Methods ................................ ................................ ............................ 39 Cell Culture ................................ ................................ ................................ ....... 39 Drug Preparation ................................ ................................ .............................. 40 Enzyme Linked Immunosorbent Assay ................................ ............................ 40 Clonogenic Cell Survival Assay ................................ ................................ ........ 40 CTSL Activity Measurement Assay ................................ ................................ .. 41 Cell Migration Assay ................................ ................................ ......................... 41 Cell Invasion Assay ................................ ................................ .......................... 42 Western Blotting ................................ ................................ ............................... 42 Results ................................ ................................ ................................ .................... 43 Highly Invasive Prostate and Breast Cancer Cells Secrete High Levels of Cathepsin L ................................ ................................ ................................ ... 43 KGP94 Leads to a Significant Suppression of CTSL Activity ........................... 44 KGP94 Treatm ent Significantly Attenuates Migration and Invasion of Prostate and breast Cancer Cells ................................ ................................ . 44 Discussion ................................ ................................ ................................ .............. 45

PAGE 7

7 3 KGP94 SUPPRESSES TUMOR MICROENVIRONMENT ENHANCED METASTASIS ASSOCIATED CELL FUNCTIONS OF PROSTATE AND BREAST CANCER CELLS ................................ ................................ ..................... 52 Background ................................ ................................ ................................ ............. 52 Materials and Methods ................................ ................................ ............................ 54 Cell culture ................................ ................................ ................................ ....... 54 Enzyme linked Immunosorbent Assay ................................ ............................. 54 Clonogenic cell survival assay ................................ ................................ .......... 55 CTSL activity measurement assay ................................ ................................ ... 55 Cell migration assay ................................ ................................ ......................... 56 Cell invasion assay ................................ ................................ ........................... 56 Hypoxia ................................ ................................ ................................ ............ 56 Low pH exposure ................................ ................................ ............................. 57 Western blotting ................................ ................................ ............................... 57 Immunofluorescence staining and microscopy ................................ ................. 57 Hexosaminidase assay ................................ ................................ ................. 58 Result s ................................ ................................ ................................ .................... 59 Acute hypoxia elevates extracellular CTSL levels ................................ ............ 59 Acute acidosis increases extracellular CTSL levels in both prostate and breast cancer cells ................................ ................................ ........................ 60 Acute hypoxia and acidosis increase tumor cell aggressiveness ..................... 61 KGP94 abrogates hypoxia and acidosis triggered invasiveness in prostate and breast cancer cells ................................ ................................ ................. 62 Discussion ................................ ................................ ................................ .............. 63 4 TUMOR ANGIOGENESIS: THE ROLE OF CATHEPSIN L AND ITS THERAPEUTIC INTERVENTION BY THE SMALL MOLECULE INHIBITOR KGP94 ................................ ................................ ................................ .................... 71 Background ................................ ................................ ................................ ............. 71 Methods ................................ ................................ ................................ .................. 73 Cell culture ................................ ................................ ................................ ....... 73 CTSL knockdown ................................ ................................ ............................. 73 Clinical data analysis ................................ ................................ ........................ 74 Drug p reparation ................................ ................................ .............................. 74 Migration assay ................................ ................................ ................................ 74 Invasion assay ................................ ................................ ................................ .. 75 Sprouting assay ................................ ................................ ................................ 75 Tube formation assay ................................ ................................ ....................... 75 Prolifer ations assays ................................ ................................ ........................ 76 Intradermal assay ................................ ................................ ............................. 76 Results ................................ ................................ ................................ .................... 77 CTSL expression level serves as a prognosticator of clinical outcome of breast cancer patients. ................................ ................................ .................. 77 CTSL promotes in vitro angiogenic properties of endothelial cells. .................. 77 CTSL ablation suppresses tumor angiogenesis in vivo ................................ .... 80

PAGE 8

8 Discussion ................................ ................................ ................................ .............. 80 5 PRE CLINICAL EVALUATION OF CATHEPSIN L INHIBITOR KGP94 IN A PROSTATE CANCER BONE METASTASIS MODEL ................................ ............ 90 Background ................................ ................................ ................................ ............. 90 Materials and meth ods ................................ ................................ ............................ 92 Cell culture ................................ ................................ ................................ ....... 92 CTSL Knockdown ................................ ................................ ............................. 93 Drug preparation ................................ ................................ .............................. 93 Bone metastasis assay ................................ ................................ ..................... 93 Histomorphometric analysis ................................ ................................ ............. 94 Intradermal assay ................................ ................................ ............................. 94 Osteoclast formation and TRAP staining ................................ .......................... 94 Pit formation assay ................................ ................................ ........................... 95 Viability assay ................................ ................................ ................................ ... 95 Results ................................ ................................ ................................ .................... 95 KGP94 treatment leads to a significant reduction in metastatic tumor burden and an overall improvement in survival ................................ ......................... 95 CTSL inhibition impairs the angiogenic capacity of prostate cancer cells ........ 96 KGP94 suppresses the bone resorptive capacity of osteoclasts ...................... 96 CTSL promotes osteoclast formation in a synergistic fashion .......................... 98 Discussion ................................ ................................ ................................ .............. 98 SUMMARY AND FUTURE DIRECTIONS ................................ ................................ ... 112 LIST OF REFERENCES ................................ ................................ ............................. 118 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 141

PAGE 9

9 LIST OF TABLES Table page 1 1 CTSL upregulation in human cancers ................................ ................................ 33 1 2 CTSL in cancer prognosis ................................ ................................ .................. 35

PAGE 10

10 LIST OF FIGURES Figure page 2 1 Cathepsin L secretion and activity positively correlates with invasive potential.. ................................ ................................ ................................ ............ 48 2 2 KGP94 inhibits secreted CTSL activity of prostate and breast cancer cells .. ..... 49 2 3 CTSL inhibition suppresses tumor cell migration. ................................ ............... 50 2 4 CTSL inhibition suppresses tumor cell invasion ................................ ................. 51 3 1 Acute exposure to hypoxia enhances CTSL secretion.. ................................ ..... 66 3 2 Acute exposure to an acidic extracellular environment enhances CTSL secretion. . ................................ ................................ ................................ ........... 67 3 3 Acute hy poxia and acidosis augments metastatic phenotype. ........................... 68 3 4 KGP94 suppresses acidosis and hypoxia triggered invasiveness. . .................... 70 4 1 CTSL upregulation in breast cancer. ................................ ................................ .. 8 4 4 2 CTSL promotes endothelial cell migration and invasion. ................................ .... 85 4 3 CTSL promotes endothelial sphere sprouting. ................................ .................... 86 4 4 CTSL enhances endothelial tube forming capac ity. ................................ ............ 87 4 5 CTSL promotes endothelial cell proliferation. ................................ ..................... 88 4 6 CTSL inhibition abrogates in vivo tumor angiogenesis. ................................ ...... 89 5 1 KGP94 reduces metastatic inciden ce and tumor burden in the bone ............... 104 5 2 CTSL inhibition impairs tumor angiogenesis. ................................ .................... 107 5 3 KGP94 suppresses bone resorptive capacity of osteoclasts ............................ 108 5 4 CTSL promotes osteoclast formation in a synergistic fashion. ......................... 111

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CATHEPSIN L TARGETING IN METASTATIC DISEASE By Dhivya Raja Sudhan Au gust 2014 Chair: Dietmar W. Siemann Major: Medical Sciences Physiology and Pharmacology Metastasis, the spread of tumor cells from the primary site to distant organs is the primary cause of treatment failure and mortality in cancer patients. Thus , the identification of key metastasis promoting target s and the development of effective anti metastatic agents have gained increased attention in the past few decades . Recogni tion of proteases, in particular, matrix metalloproteases (MMPs) as key players in tu mor progression and metastasis led to extensive pre clinical research and development of several broad spectrum MMP inhibitors. However, numerous MMP inhibitor clinical trials had to be discontinued due to adverse side effects and/or lack of clinical benefit . S ubsequent pre clinical investigations exploring other proteolytic targets have shown that if selective inhibitors of pericellular proteolysis can be developed, such agents c ould have the potential of significant application in preventing tumor pr ogression and metastasis . The presented research focuses on one such protease, namely, Cathepsin L and evaluates the anti metastatic efficacy of KGP94, a small molecule CTSL inhibit or in metastatic prostate and breast cancer. We observed a strong associati on between CTSL upregulation and metastatic characteristics of prostate and breast cancer cells.

PAGE 12

12 The tumor microenvironment heavily influences metastatic aggressiveness but the impact of hypoxia and acidosis on CTSL activity remains less explored. We showe d that CTSL plays a key role in microenvironment triggered metastatic capacities of prostate and breast cancer cells and that KGP94 treatment results in a significant suppression of tho se features. In addition to promoting tumor cell invasiveness, CTSL als o played a key role in tumor angiogenesis. Since a majority of prostate cancer patients develop skeletal metastases, in vivo evaluation of the anti metastatic efficacy of KGP94 was performed in a bone metastasis model. KGP94 treatment led to a significant reduction in metastatic incidence, bone metastases burden and a marked improvement in the overall survival. The reduction in metastatic tumor burden was associated with a striking decrease in tumor angiogenesis and bone resorption. The present work shed s l ight on the role of CTSL in various aspects of metastatic progression and evaluates the anti metastatic efficacy of KGP94. The therapeutic implications and future considerations for such CTSL intervention strategies are also discussed .

PAGE 13

13 CHAPTER 1 INTRODUCTION Prostate and breast cancer s are the most prevalent cancer s and the second leading cause of cancer related death s amongst men and women in the United States. It is estimated that in the year 2014 alone, about 233,000 and 232,670 new incidences of prostate and breast cancers will be diagnosed respectively; and about 29,480 men with prostate cancer and 40,000 breast cancer patients will die with the bulk of the tumor burden in the bone at the time of death ( 1 , 2 ) . Despite the advancement s in cancer diagnosis and improvements in localized therapies such as surgery and radiation , a significant proportion of patients fail treatm ent making cancer the second leading cause of death. The primary cause of treatment failure and patient mortality is tumor dissemination to distant sites. Metastasis is a complex multi step process during which tumor cells escape from the primary site to form new secondary lesions at distant sites ( 3 ) . A tumor cell first has to detach from the primary site through dissolution of its cell cell and cell extracellular matrix contacts. Then, the metastasizing tumor cell has to migrate thro ugh the dense extracellular matrix until it reaches a nearby blood vessel or lymphatic system. Whilst in the circulation, the tumor c ell has to resist anoikis, withstand hemodynamic shear stress and evade attack by the immune system. After being entrapped within the capillary network, the tumor cell has to invade through the vascular basement membrane to arrive at a new secondary site. Here, the tumor cell has to adapt to the local microenvironment and initiate angiogenesis in order to proliferate and thrive as a successful metastatic lesion. Out of the several thousands of tumor cells that are shed into the bloodstream only a few go on to form successful metastases. While surgery,

PAGE 14

14 radiation and chemotherapy are highly effective in treating patients with localized disease, the prognosis for patients with metastatic disease is abysmal. In fact, there is no known cure for metastatic disease and these patients are offered only palliative care. Hence, it is critical to identify key metastasis promoting targets and to develop effective anti metastatic agents against these targets to improve both survival and the quality of life of these prostat e and breast cancer patients. Proteases as Targets in Cancer Treatment Proteolytic enzymes play an indispensable role during several stages of malignant tumor progression ( 4 , 5 ) . Extracellular proteases can promote tumor growth and angiogenesis through proteolytic activat ion of latent growth factors and pro angiogenic factors ( 6 8 ) . Moreover, proteolytic enzymes operate at several steps of the metastatic cascade including, tumor cell detachment, degradation of extracellular and interstitial matrices , intravasa tion and extravasation across the capillary/lymphatic system ( 9 11 ) . Th us identification of key malignancy promoting proteases and development of intervention strategies gained increased attention in the past few decades ( 4 , 12 ) . Identification of matrix metalloproteases (MMPs) as key players in tumor progression and metastasis led to extensive pre clinical research and development of a broad range of MMP inhibitors ( 13 ) . However, numerous MMP inhibitor clinical trials had to be discontinued due to adverse side effects and/or lack of clinical benefit ( 14 16 ) . Failure of these early generation MMP inhibitors in patients may be ascribed to a variety of factors but perhaps the most critical reason was their lack of specificity ( 4 , 17 ) . Most inhibitors tested in the clinic exhibited a broad spectrum activity against many members of the lar ge MMP family which also includes anti tumoral proteases and proteases that are critical to normal tissue functioning. W ith the dismal

PAGE 15

15 failure of these MMP inhibitors in clinic, protease targeting as a means of inhibiting tumor progression largely fell out of favor. Nonetheless, subsequent pre clinical investigations exploring other proteolytic targets have shown that if selective inhibitors of pericellular proteolysis could be developed, such agents would have the potential of significant application in pr eventing tumor progression and metastasis ( 18 21 ) . Several cysteine cathepsins of the papain superf amily of cysteine proteases have been widely implicated as facilitators of neoplastic progression ( 4 , 22 24 ) . The g oal of my project was to study the role of one key member of the cysteine cathepsin family, namely Cathepsin L (CTSL) in metastatic disease and evaluate the anti metastatic efficacy of CTS L inhibition. The Biology of Cysteine Cathepsins Cysteine cathepsins belong to the papain superfamily of cysteine proteases. The human cysteine cathepsin family comprises of 11 members namely cathepsins B, C, F, G, H, K, L, O, S, V and X/Z ( 23 , 25 ) . These enzymes are composed of two relatively large globular domains , referred to as the L (left) and R (right) domain, with a V shaped active site cleft located along the domain interface. The active site is composed of a cysteine residu e at the 25 th position and a histidine residue at the 159 th position that collectively form a thiol imidazolium ion pair . The thiolate anion cleaves target proteins through a nucleophilic attack on the carbonyl carbon of the peptide bond . All members of th e cysteine cathepsin family share a common NQGCGS C WAFS active site motif. While the amino acid sequence is highly conserved amongst the active sites of all cysteine cathepsins, sub strate specificity is dictated by their unique substrate binding pockets nam that lie along the wall s of the cleft. The polypeptide substrate binds to the active site cleft in an extended conformation. While

PAGE 16

16 its amide backbone forms hydrogen interactions with highly conserved amino acid residues linin g the floor of the active site cleft, its side chains interact with the substrate binding sites on the L and R domains. on the R domain are main ly responsible for the substrate selectivity and inhibitor specif icity. Like other proteases, cysteine cathepsins are synthesized as inactive pro enzymes with an N terminal pro region that serves as an inhibitory domain. The pro region has an extended conformation that fits in the active site cleft in an inverse orienta tion and blocks it to prevent undesired proteolysis until the enzyme reaches its destined activity site. In addition, the pro region functions as a chaperone to enable correct folding of the enzyme. Under the acidic and reducing environment of the lysosome s, the pro region is cleaved to release mature and proteolytically active cathepsins that can participate in terminal degradation of intracellular and endocytosed proteins. Physiological Roles of Cysteine Cathepsins In addition to their widely recognized r ole as mediators of lysosomal protein turnover, cathepsins contribute to distinct physiological processes such as neuropept ide and hormone processing , antigen presentatio n, bone remodeling and epidermal homeostasis . For instance, Cathepsin K is predominantly expressed in the osteoclasts and is the principal mediator of normal bone remodeling ( 26 ) . The expression of Cathepsin S is restricted to spleen and antigen presenting cells such as macrophages, B lymphocytes and dendritic cells. Cathepsin S plays a key role in antigen presen tation by proteolytically activating immature class II major histocompatibility complex and by cleaving proteins to generate antigenic peptides ( 25 ) . On the other hand, cathepsin L is

PAGE 17

17 ubiquitously expressed and it participates in numerous activities critical to normal tis sue functioning. CTSL is responsible for activation of several key pituitary neuropeptides melanocyte stimulating hormone and adrenocorticotropic hormone present within zymogenic granules ( 27 29 ) . CTSL also plays a cardioprotective role through inhibition of apoptosis promoting Akt signaling pathway in cardiomyocytes ( 30 ) . The significance of CTSL in normal tissue functioning is reflected by numerous pathological conditions that stem from CTSL deficiency such as dilated cardiomyopathy, metabolic syndromes, brain atrophy, epithelial hyperplasia and hypotrichosis ( 31 35 ) . In addition, CTSL has been implicated in tumor progression and metastasis. Cathepsin L Upregulation in Human Cancers CTSL is a ubiquitously expressed lysosomal endopeptidase that is primarily involved in terminal degradation of intracellular and endocytosed proteins ( 36 , 37 ) . However, Gal et al., observed a strong association between CTSL synthesis and malignancy of Kirsten virus transformed NIH 3T3 cells ( 38 ) . Subsequent investigations performed in several different transformation models (different viral oncogenes and chemical carcinogens) reported consistent CTSL over expression irrespective of the mode of transformation ( 38 41 ) . In addition, tumor secreted cytokines that have been widely implicated in malignant progression including VEGF, FGF, PDGF, EGF, NGF, 6 have also been shown to signific antly enhance CTSL promoter activity and synthesis ( 42 49 ) . In consistence with these in vitro observations, CTSL upregulation has been reported in a wide range of human malignancies includi ng ovarian, breast, prostate, lung, gastric, pancreatic and colon cancers ( 50 ) (Table 1). In endometrial cancer patients, CTSL levels increased 50 fold and positively correlated

PAGE 18

18 with tumor grade, growth regulatory genes such as Ki 67, cyclin B1 and p21 and HER2 recept or status ( 51 ) . Importantly, Chauhan et al., observed significantly elevated CTSL levels in pancreatic adenocarcinomas compared to benign endocrine tumors and islet cells obtained from adjacent normal tissue thereby suggesting a strong association between CTSL expressio n levels and pancreatic cancer aggressiveness ( 50 ) . Likewise, numerous clinical studies have reported upregulated CTSL level and activity in colorectal cancer patients ( 52 54 ) . The concomitant upregulation of its downstream target urokinase plasminogen activator 1 in colorectal cancer tissues and the strong correlation with metastatic incidence and overall survival further substantiates the argument that CTSL upregulation is not a mere passenger effect but a key factor driving neoplastic progression ( 54 ) . Chronic myeloid leukemia (CML) patients both from chronic phase and blast crisis/accelerated phase of the disease exhibit significantly higher CTSL mRNA and enzymatic activity compared to healthy individuals ( 55 ) . CTSL promoter sequence analysis in CML patients r evealed that CTSL expression level is determined by the methylation status of a CpG island flanking the major transcription initiation site ( 56 , 57 ) . Bisulfite sequencing of CTSL prom oter revealed that promoter flanking CpG dinucleotides were significantly hypomethylated in CML patients compared to healthy individuals thus resulting in CTSL overexpression. Independent investigations performed in melanoma and glioblastoma multiforme dem onstrated that in addition to promoter hypomethylation, CTSL upregulation could also be achieved by other distinct mechanisms such as gene amplification and increased promoter activity ( 57 , 58 ) .

PAGE 19

19 Activity assessments show significantly higher CTSL proteolytic activity in neoplastic tissues compared to benign tumors or matched tumor adjacent normal tissues ( 59 , 60 ) . In addition to its expression status, CTSL function is tightly regulated by the concentration of its endogenous inhibitors ( 61 ) . In normal tissues, the extracellular matrix is safeguarded against undesirable proteolytic activities by endogenous cathepsin inhibitors such as cystatins and stefins. Studies in various tumor settings have shown a steep downregulation of these inhibitor s of CTSL with tumor progression ( 55 , 62 65 ) . Since CT SL upregulation is not paralleled by a commensurate increase in activity of endogenous inhibitors, CTSL evades regulation and could thereby engage in unrestrained activation of proteolytic cascades. CTSL Secretion by Tumor Cells Under normal physiological conditions, CTSL is sequestered within the lysosomes. However, in tumor cells, alterations in expression level and trafficking pathway result in secretion of CTSL into the extracellular milieu ( 38 40 , 66 , 67 ) . Comparative analysis of the secretome of transformed cells with that of non transformed cells revealed that the secretion of a glycoprotein was strikingly enhanced (~200 fold) in the conditioned me dia of transformed cells ( 68 ) . This upregulation occurred consistently irrespective of the means of transformation (oncogenic v ras, v src or v mos or chemical tumor promoters) and this mannose 6 phosphate containing glycoprotein was termed as the major excreted protein (MEP) of trans formed cells ( 38 40 ) . MEP was subsequently identified as cathepsin L by several indepen dent investigations based on cDNA characterization ( 6 9 , 70 ) , amino acid sequence homology ( 70 , 71 ) , immunolocalization and electron microscopy ( 67 ) , activity profile ( 72 , 73 ) , substrate specificity and cleavage pattern ( 72 ) .

PAGE 20

20 In agreement with these in vitro observations, elevated serum CTSL level has been reported in several cancers. Serum CTSL level in patients with lung, pancreatic and ovarian cancer is significantly elevated compared to healthy donors ( 74 79 ) . Unlike the clinically used CA 125 ovarian cancer bi omarker which also gets upregulated in patients with benign tumors yielding false positive results; the selective upregulation of CTSL in aggressive ovarian cancers compared to benign tumors makes it a better diagnostic marker ( 77 ) . Moreover, its tight correlati on with tumor grade and tumor invasion suggests that pre operative serum CTSL level could be utilized as an indicator of the extent of tumor invasion at the time of surgical resection ( 79 ) . Similarly urinary CTSL levels serve as prognosticators of metastatic spread and tumor recurrence in patients with bladder urothelial cell carcinoma ( 80 ) . Several studies have been undertaken to det ermine the mechanism responsible for altered trafficking of this lysosomal enzyme into the extracellular space. During the process of protein translocation, mannose 6 phosphate receptors present within transport vesicles are responsible for accurate and ef ficient sorting of lysosomal enzymes to the lysosomes. However, Dong et al., demonstrated that compared to other lysosomal enzymes, CTSL intrinsically exhibits a low affinity for the mannose 6 phosphate receptor ( 81 ) . Thus transformation dependent upregulation in CTSL synthesis combined with poor affinity for the lysosome targeting receptor ultimately results in d efault secretion of CTSL through the constitutive secretory pathway. Furthermore, Prence et al., reported that growth stimulation limits mannose 6 phosphate receptor concentrations within the golgi through receptor re distribution which causes the few rece ptors that are available to be occupied by high affinity

PAGE 21

21 lysosomal enzymes whereas, the low affinity CTSL, failing to bind to these receptors winds up being shunted into the secretory pathway ( 82 , 83 ) . Subsequently, Barbarin et al., demonstrated that Rab4a protein is the key regulator of CTSL secretion in melanoma cells ( 84 ) . Rab proteins are important regulators of vesicle transport between organelles of the endocytic and secretory system. Transfection of highly tumorigenic and metastatic melanoma cells with dominant negative Rab4a mutant, significantly hampered CTSL secretion from these cells and also dramatically impaired their tumorigenic and metastatic potential. Collectively these data suggest that upregulated CTSL secretion by tumor cells is achieve d through several different mechanisms depending on the tumor type. Nuclear CTSL In addition to the secreted form, numerous independent investigations have reported the presence of a truncated nuclear isoform of CTSL in oncogenic Ras and ErbB 2 transformed cells. Nuclear CTSL is translated from a downstream AUG translation initiation site and is consequently devoid of the endoplasmic reticulum targeting signal peptide ( 85 , 86 ) . However, it does contain a putative nuclear localization signal which might be responsible for its translocation to the nucleus ( 87 ) . Nuclear CTSL proteolytically processes and a ctivates the CCAAT displacement protein/cut homeobox (CDP/Cux) transcription factor which has been strongly associated with poor disease prognosis ( 86 , 88 , 89 ) . CTSL processed CDP/Cux exhibits enhanced DNA binding properties which in turn confers a replicative and metastatic advantage to tumor cells. CDP/Cux promotes tumor cell proliferation by acceler ating entry into the S phase of cell cycle, and also augments tumor invasion by stimulating hallmark epithelial to

PAGE 22

22 mesenchymal transition features such as snail and slug upregulation and E cadherin repression ( 90 ) . Nuclear CTSL has been documen ted to promote tumor progression through other CDP/Cux independent mechanisms as well. Nuclear CTSL gets frequently upregulated in triple negative breast can cer patients and patients with either a germline or somatic mutation in BRCA1 tumor suppressor gene ( 91 ) . In fact, increased nuclear CTSL level serves as a predictive biomarker for treatment response in this subset of breast cancer patients. DNA double strand breaks (DSBs) are repaired either by the error free homologous repa ir mechanism or through the substitute error prone non homologous end joining (NHEJ) pathway. In the absence of BRCA1, 53BP1 suppresses homologous repair and instead activates the erroneous NHEJ pathway which results in accumulation of unrepaired DNA DSBs, chromosomal translocations and consequently cell death and tumor suppression ( 92 94 ) . BRCA1 deficient cells overcome this genomic instability and growth arre st by overexpressing nuclear CTSL which in turn proteolytically degrades 53BP1 ( 91 , 95 ) . Thus nuclear CTSL not only confers a surviva l advantage on BRCA1 deficient tumor cells, but, by improving their DNA repair capacities it also renders them resistant to radiation and genotoxic chemotherapeutics such as cisplatin, PARP inhibitors and mitomycin C ( 91 ) . Role of CTSL in Tumor Metastasis In transformed cells extracellular CTSL level increases up to 200 fold and comprises up to 40% of total secreted proteins ( 68 ) . Transformation dependent CTSL secretion augments the invasive/metastatic potential of cancer cells through direct degradative proteolysis of severa l components of the extracellular matrix (ECM) and basement membrane ( 62 , 96 , 97 ) . In the presence of cell surface glycosaminoglycans,

PAGE 23

23 secreted CTSL d egrades ECM components such as laminin, Type I and IV collagen, fibronectin, elastin etc. ( 67 , 98 100 ) . Furthermore, it plays a major role in amplification of the proteolytic cascade by activating latent pro forms of other key metastasis associated proteases including urokinase plasminogen activator, pro heparanase, other cathepsins, as well as certain MMPs ( 101 105 ) . Cell adhesion protein E cadherin gets significantly reduced during tumor invasion and thus loss of E Cadherin is widely accepted as a marker of tumor invasiveness. CTSL proteolytically degrades the extracellular domain of E cadherin and abolishes its adhesive property ( 106 ) . In consistence with these observations, tumor progression studies in CTSL / RIP1 Tag2 pancreatic carcinogenesis model reveal that CTSL deficiency significantly hampers the progression of benign encapsulated tumors in to invasive carcinomas thus indicating that CTSL has a non redundant consequential role in the process of tumor invasion ( 106 ) . Likewise, numerous studies have reported that an increase in CTSL secretion is a key feature driving the switch of poorly tumorigenic and non metastatic human melanoma cells to a highly tumorigenic and aggressively metastatic phenotype ( 107 109 ) . In agreement, anti CTSL antibody was shown to significantly retard tumor growth and decrease the incidence of lung metastases ( 108 , 110 ) . Furthermore, CTSL was shown to promote melanoma cell survival and tumor growth by inhibiting complement mediated tumor cell death ( 108 , 111 ) . The well orchestrated modulation in CTSL expression as a metastatic tumor cell transitions through different phases of the metastatic cascade further highlights its significance in the metastatic dissemination process. Metastasizing tumor cells upregulate their CTSL expression level as they undergo epithelial to mesenchymal transition and then once they rea ch a distant site, they reduce CTSL

PAGE 24

24 expression as they revert back to their epithelial state to promote colonization in the newly found soil ( 90 , 112 ) . In contrast to the well oxygenated and near neutral pH conditions observed within most normal tissues, the t umor microenvironment is frequently marked by hypoxia and acidosis ( 113 , 114 ) . It is now a well recognized fact that these very aberrant microenvironmental conditions are responsi ble for aggressive tumor progression and metastatic occurrence which ultimately results in poor patient survival ( 114 116 ) . Studies includi ng our own observations have shown an upregulation in CTSL secretion by tumor cells in response to exposure to hypoxic and acidic conditions ( 117 , 118 ) . We observed that both hypoxia and acidosis augment CTSL secretion by eliciting two distinct mechanisms, namely, upregulated expression and lysosomal exocytosis. Ly sosomes are normally peri nuclear in localization. However in response to hypoxic and acidic exposures, the lysosomes redistributed and underwent anterograde trafficking where they fused with the plasma membrane and exocytosed their contents including CTSL into the extracellular milieu ( 117 ) . Since cathepsins exhibit optimal activity under acidic conditions, CTSL released in an acidic milieu would engage in heightened proteolysis of extracellular matrix components and promote invasiveness ( 98 ) . Hypoxia and acidosis triggered CTSL upregulatio n closely correlated with metastatic properties of tumor cells thereby suggesting that CTSL may be a key player in microenvironment triggered metastatic aggressiveness ( 117 ) . Supporting these observations made in experimental metastasis models, several clinical studies performed in different cancer types such as breast, pancreatic, colorectal and lung cancers show that tumor CTSL level is a strong prognosticator of patient

PAGE 25

25 outcome (Table 1 2). Grotsky et al., demonstrated that CTSL along with 53BP1 and vitamin D receptor constitutes a triple biomarker signature for therapeutic resistance to radiation, DNA damaging chemotherapeutics and PARP inhibitors among triple negative breast cancer patients and patients with BRCA1 mutation ( 91 ) . In breast cancer pati ents, CTSL level inversely correlates with steroid hormone receptor status and is a strong predictor of tumor relapse and poor overall survival ( 119 123 ) . In fact, Thomssen et al., reported that the prognostic impact of CTSL was comparabl e to that of axillary lymph node status and tumor histological grading; and could be utilized for identification of node negative patients that are at a high risk of metastatic relapse ( 119 , 120 ) . Role of Cathepsin L in Bone Resorption The involvement of CTSL in neoplastic bone diseases has been highlighted by numerous experimental and clinical reports of CTSL upregulation in primary and metastatic bone tumors. Several studies have reported elevated CTSL mRNA levels across various human osteosarcoma cell lines and tumor samples ( 124 127 ) . In comparison to normal tissue levels, CTSL levels were upregulated in ~50% of primary bone tumors, and in almost 100% of the bone metastases investigated ( 127 ) . In agreement with these observations Husmann et al., reported that highly metastatic SAOS 2 sublines LM5 and LM7 expressed significantly higher levels of CTSL mRNA compared to parental SAOS 2 osteosarcoma cells thereby highlighting the correlatio n between CTSL expression levels and metastatic aggressiveness of bone cancers ( 124 ) . A serendipitous observation made in CTSL antibody producing hybridoma cells provided one of the first inklings to the importance of CTSL in multiple myeloma. Highly tumorigenic and metastatic P3X63Ag8.653 murine myeloma cells secrete high levels of pro c athepsin L ( 128 ) . Intriguingly, Weber et al., observed that when these CTSL

PAGE 26

26 secreting myeloma cells were fused with spleen cells immunized with CTSL to generate CTSL antibody producing hybridoma cell s, their tumorigenic and metastatic capacity got remarkably diminished. Compared to the numerous peritoneal tumors and metastatic deposits observed in mice inoculated with either myeloma cells or control hybridoma cells, ~80% of the mice inoculated with CT SL antibody producing hybridoma cells failed to show any signs of pr imary or metastatic tumor . Consistent with these findings, Kirschke et al., reported that CTSL depletion significantly retarded the growth of SP and L myeloma tumors ( 129 ) . In addition to these primary bone neop lasias, several human cancers such as lung, prostate and breast adenocarcinomas exhibit a marked proclivity to metastasize to the bone ( 1 , 130 ) . Bone metastases are rarely indolent they usually inflict devastating skeletal morbidities such as intractable bone pain, pathological fractures, paralysis due to nerve compress ion and hypercalcemia ( 1 , 130 ) . These adverse skeletal complications are predominantly triggered by unrestrained osteoblastic and osteoclastic activities of bone metastases. Under normal physiological conditions, bone remodeling is tightly regulated through recipr ocal interactions between bone resorbing osteoclasts and bone forming osteoblastic cells ( 131 ) . However, both primary and metastatic bone lesions perturb this equilibrium through sustained activation of osteoclasts or osteoblasts which ultimately leads to excessive osteolysis or bone formation. While it is well recogni zed that osteolytic cancers perpetrate bone resorption through osteoclasts; even predominantly osteoblastic cancers such as prostate cancer, has been shown to depend on an initial osteoclastic trigger for subsequent osteoblastic events to occur ( 132 135 ) . Since inhibition of unrestrained osteoclastic activity can alleviate skeletal

PAGE 27

27 morbidities associated with both osteoclastic and osteoblastic metastases, enormous efforts have been focused towards development of osteoclast targeting agents such as bisphosphonates, denosumab, and Cathepsin K inhibitors ( 26 , 136 138 ) . Cat hepsin K (CTSK) is the predominant protease in osteoclasts and is the prime executor of resorption during both normal and pathological bone turnover . Nonetheless, studies in knockout mouse models have shown other proteases; in particular CTSL to closely pa rticipate in conjunction with CTSK in the process of pathological bone resorption ( 35 , 103 ) . Though osteoclastic CTSL leve ls are significantly lower compared to CTSK levels during normal bone remodeling, in the presence of bone resorption promoting inflammatory cytokines such as parathyroid hormone, IL 6, TNF etc. , osteoclastic CTSL activity increases several fold an d it plays a significant, non redundant role in the process of pathological bone resorption ( 139 143 ) . Using immunohistochemical procedures and electron microscopy, Goto et al., demonstrated that in contrast to the low intracellul ar levels of CTSL observed within osteoclasts, the protease shows a strong extracellular presence and heavily co localizes with collagen fibrils within resorption pits suggesting its involvement in degradation of the bone matrix ( 144 , 145 ) . CTSL has been widely implicated in the proteolytic degradation of bone and cartilage matrix components ( 142 , 146 149 ) . In fact, Lang et al., have demonstrated that compared to individuals with normal bone mineral density, serum CTSL levels in patients with low bone density conditions such as osteoporosis and osteopenia we re significantly elevated ( 150 ) . Recip rocally, treatment with anti resorptive agents such as bisphosphonates greatly restored the serum CTSL levels close to baseline amounts. The close association of CTSL with various bone disorders involving destructive bone

PAGE 28

28 loss such as rheumatoid arthritis ( 151 153 ) , osteoporosis ( 35 , 150 , 154 ) , osteoarthritis ( 155 , 156 ) and periodontal disease ( 141 , 157 ) further implicates the participation of CTSL in cancer associated bone resorption. In fact, Katunuma et al., showed that CTSL inhibition significantly mitigates osteolytic events an d hypercalcemia in mice with bone metastases and importantly, this protective effect was superior to that of bisphosphonate ( 154 , 158 ) . In addition to cancer induced osteolysis, bone loss is also inflicted by seve ral standard of care anti cancer agents a morbidity that severely affects the quality of life and life expectancy of cancer survivors ( 159 161 ) . Patients receiving chemotherapeutic agents such as methotrexate, cyclophospham ide, dexamethasone, prednisone and doxorubicin as post operative adjuvant therapy, have been shown to suffer from hypogonadism triggered osteoporosis ( 159 , 162 , 163 ) . Similarly, surgical or medical hormona l ablation in patients with hormone responsive cancers such as breast, ovarian or prostate cancer results in a drastic worsening of bone health ( 164 166 ) . Steroidal hormones such as estrogen have been shown to negatively regulate osteoclastic synthesis of CTSL and CTSK both directly by binding to osteoclastic estrogen receptor and indirectly by suppressing the expression of resorptive cytokines ( 140 ) . Thus ovariectomized mice exhibit a significant upregulation of both CTSK and CTSL, more so of CTSL. In fact, CTSL deficient mice showed a marked resistance to osteoporosis upon ovariectomy ( 35 ) . Thus CTSL intervention strategies would not only serve to impede the metastatic dissemination of tumor cells but would also alleviate both treatment induced and cancer associated osteolysis.

PAGE 29

29 Cathepsin L Targeting The role of CTSL in promoting tumor progression and metastatic aggressiveness, its contribution to cancer associated bone resorption and its strong association with disease relapse and patient mortality has stoked up significant inte rest in the development of CTSL intervention strategies. Since unrestrained CTSL activity stems from an imbalance between CTSL and endogenous inhibitor levels, numerous investigations have attempted to abolish CTSL proteolytic function through ectopic deli very/overexpression of endogenous inhibitors such as cystatins and stefins ( 167 169 ) . Notably, Gianotti et al., reported that the anti invasive property of cystatin over expression was mainly mediated through inactivation of extracellular but not intracellular CTSL; further validating the hypothesis that metastatic phenotype of tumor cells is primarily driven by secreted CTSL ( 168 ) . Likewise, CTSL downregulation through RNA interference in different tumor models including glioma, osteosarcoma, myeloma and melanoma resulted in consistent inhibition of tumorigen icity and invasiveness of neoplastic cells ( 126 , 129 , 170 , 1 71 ) . In addition to its anti invasive effect, Levica r et al., reported that CTSL suppression in glioblastoma also enhanced the sensitivity of tumor cells to apoptotic agents such as staurosporine. Studies performed in the RIP1 Tag2 pancreatic carcinogenesis model comparing the effect of various cathepsin de ficiencies on tumor progression showed that compared to other cathepsins, CTSL knockout led to the largest reduction in tumor burden and a significant impairment of the progression of benign encapsulated tumors to invasive carcinoma ( 106 ) . Although anti sense and genetic knockout strategies support the anti metastatic significance of CTSL abrogation, the development of specific inhibitors of CTSL has been limited by the high degree of structural homology between differ ent members of

PAGE 30

30 the cathepsin family ( 172 , 173 ) . Indeed most currently studied cathepsin inhibito rs have broad activity spectra ( 4 , 23 , 174 176 ) . While the anti tumor effects exhibited by pan specific cysteine cathepsin inhibitors look promising, one must be wary of the dismal outcomes of previous broad spectrum targeting approaches ( 4 , 13 ) . Since the proteolytic function of all cathepsins has not been deciphered yet, and given the critical normal tissue functions of some cathepsins, indiscrim inate inhibition of all members of the cathepsin family could potentially entail the same negative consequences as broad spectrum MMP inhibitors did ( 172 ) . One underlying factor behind the abysmal failure of MMP in hibitor clinical trials was their lack of specificity. These broad spectrum inhibitors indiscriminately inhibited several members of the vast MMP family which also includes anti cancer proteases and proteases that are crucial to normal tissue functioning ( 15 , 17 , 177 ) . For example, owing to their undesired inhibitory activity against the closely related ADAM proteases, several patients experienced severe musculoskeletal toxicity, which necessitated a reduction in dosage to suboptimal concentrations that were ineffective at inhibiting MMPs ( 13 , 14 , 16 , 178 ) . Despite the challenges imposed by the high degree of homology between the S2 substrate recognition domains of cysteine cathepsins, a few CTSL specific inhibitors have been developed and tested in preclinical models ( 158 , 179 182 ) . Katunuma et al., showed that epoxysuccinate based CTSL inhibitors of the CLIK series, namely CLIK 148 and CLIK 195 not only attenuated cancer associated bone resorption and hypercalcemia but also led to a significant reduction in metastatic burden ( 154 , 158 ) . Bone resorption not only provides room for the expansion of metastatic lesions but also leads to the release of several active growth factors from the bone matrix that supports

PAGE 31

31 aggressive neoplastic cell growth. Thus a 'vicious cycle' is created between the tumor and th e bone tumor secreted cytokines stimulate bone resorption by upregulating oste oclastic CTSL activity; and the resorbed bone in turn releases growth factors stimulating tumor cell proliferation and further cytokine release ( 1 , 149 ) . Conceivably, CTS L inactivation disengages this vicious cycle and thus not only alleviates bone resorption, but also decreases the tumor burden in the bone. Cathepsin L Inhibitor KGP94 Kumar et al , generated and screened a library of functionalized benzophenone, thiophene, pyridine, and fluorene thiosemicarbazone derivatives for potent inhibitors of CTSL ( 179 , 183 ) . 3 bromophenyl, 3 hydroxyphenyl ketone thiosemicarbazon e (KGP94) is the lead molecule of this library of small molecule CTSL inhibitors. It consists of a thiosemicarbazone scaffold which is an important func tional group for targeting cysteine proteases. The bromine group attached to the benzene ring at meta position is c ritical for the inhibitor activity. Molecular docking studies have shown that the conformation with the most favorable interaction energy pla ces the bromophenyl ring in the S2 substrate binding site and the thiosemicarbazone in close proximity to the active site cysteine residue ( 179 ) . The thiosemicarbazone moiety on KGP94 inactivates active cysteine by mimicking the hydrolytic cleavage of amide linkages in proteins. K GP94 has a molecular weight of 350.3 and an IC 50 value of 131.4 nM. Pharmacokinetic analysis of KGP94 revealed that KGP94 is well absorbed after intraperitoneal administration (at 20 mg/kg) with a relative bioavailability of 12 µM/hr compared to the 1.92 µM/hr achieved after oral administration. Th e estimated half life of KGP94 was ~1 hr. Pre clinical studies have shown that KGP94 significantly retards the growth of both recently implanted and established tumors.

PAGE 32

32 Motivation and goal of research Despite the advancements made in cancer diagnosis and r emarkable improvements in localized therapies such as surgery and radiation, a significant number of prostate and breast cancer patients fail treatment. Metastatic disease is the primary cause of treatment failure and death in prostate and breast cancer pa tients . Hence it is critical to develop effective anti metastatic agents to improve the survival and the quality of life of these patients. Cysteine protease CTSL has been widely correlated with metastatic aggressiveness and poor clinical outcomes in sever al cancer settings. The current research explores the role of cysteine protease CTSL in various aspects of metastatic progression and evaluates the therapeutic efficacy of a small molecule CTSL inhibitor KGP94 . Moreover, CTSL has been widely implicated in pathological bone resorption conditions such as osteoporosis. Since cancer associated osteolysis is a significant morbidity affecting both life expectancy and the quality of life of advanced prostate and breast cancer patients, we also focused on the anti resorptive function of KGP94

PAGE 33

33 Table 1 1. CTSL upregulation in human cancers Cancer Type Observations References Colorectal cancer Higher expression and activity in tumors, correlation with ras, association with uPA and PAI levels, CTSL levels could be of diagnostic significance ( 52 54 , 184 ) Breast cancer CTSL upregulation and increased activity in high grade tumors ( 65 ) Chronic myeloid leukemia Correlation with disease progression, metastatic incidence and overall survival, upregulation due to promoter hypomethylation ( 55 ) Pediatric acute myeloid leukemia CTSL upregulation, inverse correlation with endogenous inhibitor cystatin C, positive association with key AML angiogenesis factor VEGF ( 185 ) Melanoma Increased CTSL activity in melanocytic tumors compared to pigmented nevi and normal dermis ( 59 , 60 ) Gastrointestinal stromal tumors and gastric cancers Overexpression and positive correlation with c kit expression ( 186 188 ) Endometrial cancer CTSL u pregulation and correlation with growth regulatory genes and HER2 receptor status ( 51 ) Pancreatic cancer CTSL upregulation in tumor as well as tumor associated macrophages ( 189 191 ) Glioma Correlation with glioma progression with expression profile of low grade glioma < anaplastic astrocytoma < glioblastoma ( 192 )

PAGE 34

34 Table 1 1. Continued Cancer Type Observations References Lung cancer Higher CTSL activity in lung cancer compared to non malignant tissue, association with tumor grade, upregulated serum levels ( 76 ) Nasopharyngeal carcinoma Overexpression in primary tumor and cervical lymph node metastases ( 193 ) Oral squamous cell carcinoma Elevated CTSL expression correlated wi th lymph node metastasis and poor survival, CTSL overexpression increases the likelihood of progression of oral dysplastic lesions into carcinomas ( 194 , 195 )

PAGE 35

35 Table 1 2. CTSL in cancer prognosis Cancer Type Observations References Breast cancer Inverse correlation with steroid hormone receptor status and disease free survival and overall survival, prognostic impact comparable to axillary lymph node status and tumor grading, biomarker for identification of node negative patients at a high risk of metastatic relapse, CTSL could predict response to surgical resection and adjuvant systemic therapy in patients with operable tumors. ( 119 , 121 123 , 196 , 197 ) Gastric cancer Upregu lation in tumors locally invading the muscularis propria and tumors with venous invasion, upregulation in chronic atrophic gastritis with intestinal metaplasia and gastric tumors, may participate in gastritis to cancer progression ( 188 , 198 ) Urothelial carcinoma of the bladder Positive correlation with tumor stage and grade, local and metastatic recurrence and poor survival ( 199 ) Pancreatic cancer Association with tumor stage, lymph node invasion, disease recurrence and overall survival, predictor of disea se relapse in patients undergoing curative resection ( 189 , 191 ) Glioma correlation with glioma progression in the order of low grade glioma < anaplastic astrocytoma < glioblastoma ( 192 ) Colorectal cancer Higher expression and activity in tumors compared to matched normal mucosa, correlation with tumor progression, metastatic incidence and overall survival, high CTSL expression in patients with curative disease is a predictor of disease relapse and poor survival ( 54 , 184 )

PAGE 36

36 Table 1 2. Continued Cancer Type Observations References Pediatric acute myeloid leukemia CTSL upregulation exhibited inverse correlation with event free survival and overall survival ( 185 ) Oral squamous cell carcinoma Elevated CTSL expression correlated with lymph node metastasis and poor survival, expression of headpin endogenous inhibitor to CTSL inversely correlated with tumor g rade ( 194 ) Nasopharynge al carcinoma Upregulation correlates with lymph node metastases and distant metastases, tumor stage and overall survival ( 193 )

PAGE 37

37 CHAPTER 2 EFFECT OF CTSL TARGETING ON IN VITRO M ETASTASIS ASSOCIATED TUMOR CELL FUNCTIONS CTSL has been reported to promote tumor cell metastasis through degradative proteolysis of extracellular matrix and basement membrane. This chapter investigates the correlation between CTSL activity and the invasive capacities of prostate and breast cancer cells. Further, we explored the impact of CTSL inhibitor KGP94 on the activity of secreted CTSL and metastatic properties of highly invasive prostate cancer PC 3ML and breast cancer MDA MB 231 cells. Background Prostate and breast cancers are the most com monly diagnosed cancers in the United States and second only to lung cancer as the leading cause of cancer death in men and women respectively ( 200 ) . Current treatments include radica l prostatectomy/mastectomy or radiation therapy. Although these treatments are highly effective initially, nearly a quarter of patients ultimately develop progressive disease either locally or at dis tant sites . It is estimated that ~90% of patients with ad vanced prostate and ~ 70% of breast cancer patients develop distant metastases which poses a great clinical challenge as they are often recalcitrant to currently available therapies. The development of novel therapeutic strategies that impair the metastati c process is therefore critical to improving breast and prostate cancer patient survival. Cathepsin L (CTSL) is a lysosomal endopeptidase of the papain super family of cysteine protease. Its primary function involves lysosomal proteolytic turnover of both intracel lular and endocytosed proteins. Tumor cells have devised various mechanisms to secrete CTSL into the extracellular milieu by altering its trafficking pathway ( 38 , 82 , 83 ) . In transformed cells extracellular CTSL level increases up to 200 fold and

PAGE 38

38 comprises up to 40% of total secreted proteins ( 68 ) . CTSL is up regulated in a wide range of human cancers including breast and prostate cancer ( 50 ) . Transformation dependent CTSL secretion augments the invasive/metastatic potential of cancer cells through direct degradative proteolysis of several components of the extracellular matrix (ECM) and basement membrane. In the presence of surface glycosamin oglycans, secreted CTSL degrades ECM components such as laminin, type I and IV collagen, fibronectin elastin etc. ( 98 , 99 ) . Furthermore, CTSL amplifies the proteolytic cascade by activating latent pro forms of other key metastasis associated proteases such as proheparanase, urokinase plasminogen activator, cathepsin D, and members of the matrix metalloprotein ase family ( 201 ) . Cell adhesion protein E cadherin gets significantly reduced during tumor invasion and thus loss of E Cadherin is widely accepted as a marker of metastatic aggressiveness. CTSL proteolytically degrades the extrac ellular domain of E cadherin and abolishes its adhesive property ( 106 ) . Supporting in vitro observations, tumor progression studies in CTSL / RIP1 Tag2 pancreatic carcinogenesis model reveal that CTSL knockout significantly hampered the progression of benign encapsulated tumors to invasive carcinoma thu s indicating that CTSL plays a significant non redundant role in the process of tumor invasion ( 106 ) . Conversely, CTSL overexpression studies have reported that CTSL upregulation results in a switch from poorly invasive to a highly metastatic phenotype ( 107 ) . Supporting these observations made in experimental metastatic models, several clinical studies show that tumor CTSL level is strongly correlative of the clin ical outcome ( 119 , 121 ) . The strong prognostic value of CTSL level in predicting relapse free survival and overall

PAGE 39

39 survival and its significant role in the process of tumor invasion and metastasis provide a strong rationale for the development of CTSL inhibition ap proaches. Although anti sense and genetic knockout strategies support the anti metastatic significance of CTSL inhibition ( 106 , 126 ) , the development of specific inhibitors of CTSL has been limited by the high deg ree of structural homology between different members of the cathepsin family. Indeed most currently studied cathepsin inhibitors have broad activity spectrums; a potential concern given the critical normal tissue functions of some cathepsins ( 25 , 26 ) . KGP94 (3 bromop henyl 3 hydroxyphenyl ketone thiosemicarbazone) is a CTSL specific small molecule inhibitor that abolishes CTSL function by targeting its active site ( 179 ) . The present study evaluates the effect of KGP94 mediated CTSL inhibition on metastatic properties of p rostate and breast cancer cells. Materials and Methods Cell Culture RWPE 1, PC 3, MCF 7, SKBR 3, T47D and MDA MB 231 cells were purchased from American Type Culture Collection. PC 3ML and PC 3N cells were gifts from Dr. Alessandro Fatatis (Drexel Universit y). PC 3ML and PC 3N are highly and poorly metastatic sublines isolated from PC 3 cells ( 202 ) . MDA MB 435 cells were received from Dr. Jianrong Lu (University of Florida). Although there has been controversy that the MDA MB 435 cell line may have been derived from M14 melanoma ( 203 ) , a subsequent review by Chambers et al, ( 204 ) concluded that rather than both lines being of M 14 melanoma origin, evidence is consistent with both cell lines being of MDA MB 435 breast cancer origin. M 4A4 and NM 2C5 are highly and poorly invasive sublines isolated from MDA MB 435 cells ( 205 ) provided by Dr. Steve Goodison (MD

PAGE 40

40 Anderson Cancer Center). All cell lines were cultured in appropriate media (RWPE 1 in Keratinocyte serum free medium supplemented with 0.05 mg/ mL bovine pituitary extract and 5 ng/ mL epidermal growth factor; PC 3 and PC nutrient mixture; MCF 7, SKBR 3,T47D, MDA MB435, M 4A4, NM 2C5 and MDA MB 231 in DMEM media) supplemented with 10 % FBS at 37 0 C in a humidified atmosphere of 5 % CO 2 in air. Drug Preparation KGP94 was dissolved in sterile DMSO to obtain 10 and 25 mM stock solutions. For treatment, stocks were diluted 1000 fold in cell culture media to achieve final concentrations of 10 and 25 µM respectively. Enzyme Linked Immunosorbent Assay Prostate and breast cell lines were cultured in 100 mm dishes. When the cells reached ~60 70 % confluency, media were replaced and collected 24 h r later. Cell conditioned media were centrifuged (1,000 rpm, 10 min) and stored at 80 0 C until further analysis. Cells from each sample were trypsinized and counted for normalization of secreted levels with total cell number. Cathepsin L ELISA was performed using a instructions. Cystatin C ELISA was performed usin g a Quantikine human Cystatin C Immunoassay kit (DSCTC0) from R&D systems. Conditioned media from each sample were evaluated in triplicate and secreted levels of CTSL and cystatin C were normalized to 10 6 cells. Clonogenic Cell Survival Assay Cells were tr eated with desired concentration of KGP94 for 24 h r . Subsequently, cells were harvested and seeded into 60mm dishes (200, 100 or 50 cells / dish) and

PAGE 41

41 incubated for 14 days. 2 weeks later, cells were stained with crystal violet and the number of colonies (> 50 cells) were counted. Plating efficiency was calculated from the ratio of the number of colonies formed divided by the number of cells seeded. CTSL Activity Measurement Assay Cathepsin L activity assay was performed using InnoZyme Cathepsin L Activity Ki µL activation buffer (provided with the kit) was added to each well of a 96 well plate. To this, 50 µL of conditioned media was added and incubated for 15 min at room temperature with gentle shakin g. Subsequently, 50 µL of either 10 µM or 25 µM KGP94 was added to designated wells. The plate was incubated at RT for 15 min with gentle shaking. After the addition of 50 µL of fluorogenic substrate Z Phe Arg 7 amido 4 methylcoumarin, the plate was again incubated for 2 h r at 37 0 C. The fluorescence was measured at an excitation wavelength of 360 380 nm and emission wavelength of 460 480 nm using the Spectramax M5 (Molecular Devices) fluorescence plate reader. CTSL activity was represented as relative fluo rescence units. Cell Migration Assay Transwell migration assays were performed using BD falcon cell culture inserts ( 353097). The bottom of the insert is a polyethylene terephthalate membrane with 8 µm pores. Cells are seeded into the inserts and incubated for 24 h r to allow them to migrate through 8 µm pores, to the other side of the membrane. 24 h r later, non migrated cells on the upper surface of the membrane are scraped off using a cotton swab. Migrated cells are stained with crystal violet and counted under a microscope. For wound healing assays, cells were allowed to grow to confluence before ~1 mm wide scratches were made in the cell monolayers using sterilized 200 µL pipette

PAGE 42

42 tips. 24 h r later, the plates were photographed and cell migration into the denuded areas was determined. Cell Invasion Assay Invasion assays were performed using M atrigel coated invasion inserts from BD Biosciences ( 354480). Cells suspended in serum free media were seeded into the inserts. Media supplemented with 10 % FBS was added to the bottom chamber. The cells were incubated under desired conditions and 24 h r later, cells that invaded to the underside of the membrane were stained and counted under a microscope. Western Blotting Cells were lysed using radioimmunoprecipitatio n assay lysis buffer (50 mM Tris HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% NP 40, 0.25% Sodium deoxycholate and 1 mM EDTA) supplemented with protease inhibitor cocktail (Sigma), 1 mM NaF and 1 mM Na 3 VO 4 . Protein concentration was estimated by Bradford method. 35 µg of whole cell lysates were fractioned on a 12 % SDS PAGE gel. Subsequently, the proteins were electroblotted onto a nitrocellulose membrane. The membranes were blocked with 5 % non fat dry milk for 1 hr at RT. The membranes were incubated with mouse human CTSL antibody (Abcam Ab6314) overnight at 4 0 C. Subsequently, the membranes were incubated with horseradish peroxidase conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA), and detected with an enhanced chemiluminescence substrat e (Amersham, Piscataway, NJ).

PAGE 43

43 Re sults Highly Invasive Prostate and Breast Cancer Cells Secrete High Levels of Cathepsin L Both experimental and clinical investigations have implicated cathepsin L as an important factor in the metastatic process ( 5 , 149 ) . Since invasiveness is a critical attribute of metastatic cells, we compared the cellular CTSL levels in prostate and breast cancer cells of varying invasive capacities ( Figure 2 1 A and B) but found no strong correlation between the intracellular expression of CTSL and the invasive capacities of these cell lines. In addition to intracellular CTSL (mainly present within the lysosomes where it is committed to housekeeping functions s uch as proteolytic turnover of intracellular and endocytosed extracellular proteins ( 206 ) tumor cells secrete CTSL to facilitate invasion. This is achieved by over expressing CTSL and altering its trafficking mechanism ( 38 , 82 , 83 ) . Highly metastatic PC 3ML and MDA MB 231 cells were found to secrete significantly hi gher levels of CTSL compared to non invasive and poorly invasive prostate and breast cancer cells respectively ( Figure 2 1 C and D) suggesting metastatic aggressiveness ref lects an imbalance between CTSL and its endogenous inhibitors, we also explored the balance between secreted CTSL and extracellular cystatin C levels in the various prostate and breast cancer cell lines. CTSL/cystatin C ratios are shown as relative levels, with RWPE 1 and MCF 7 being the respective reference cell lines ( Figure 2 1 E and F). The results showed the ratio of CTSL to cystatin C to increase with increasing invasive potential indicating that an imbalance between the extracellular CTSL and cystatin C level might be a key attribute of aggressively metastatic pros tate and breast cancer cells.

PAGE 44

44 KGP94 Leads to a Significant Suppression of CTSL Activity Since CTSL is involved not only in unregulated proteolysis of extracellular matrix and basement membrane components but also the activation of other key metastasis associated proteases ( 98 , 99 , 102 , 103 , 201 ) , specifically abolishing CTSL activity using synthetic inhibitors should impair the metastatic phenotype. T he impact of one such inhibitor, KGP94 ( 179 ) , on CTSL activity of prostate and breast cancer cell s is shown in Figure 3 2. We first tested the effect of various concentration of KGP94 on growt h and clonogenic properties ( Figure 2 2 A). In order to separate anti tumorigenic from anti metastatic effects, we used non cytotoxic doses of 10 and 25 µM for further evaluations. CTSL activity in PC 3ML and MDA MB 231 conditioned media was significantly reduced (by 94 and 92 % respectively (p<0.0001)) in the presence of 25 µM KGP94 ( Figure 2 2 B). KGP94 Treatment Significantly Attenuates Migration and Invasion of Prostate and breast Cancer Cells Treatment with 10 and 25 µM KGP94 decreased the migratory po tential of prostate cancer cells by 38 and 74 % respectively ( Figure 2 3 A) in a manner comparable to what could be achieved by CTSL knockdown. Similarly, migratory capacity of MDA MB 231 cells was reduced by 22 and 40 % upon treatment with 10 and 25 µM KGP94 respectively ( Figure 2 3 B). Furthermore, treatment with KGP94 significantly impaired the invasive capacities of both prostate and breast cancer cells by 44 and 72 % at 10 µM and 53 and 88 % at 25 µM KGP94 respectively ( Figure 2 4 A and B).

PAGE 45

45 Discuss ion The extracellular matrix (ECM) is an extremely dense network and poses physical barrier to cell movement. Tumor cells rely on secreted extracellular proteases to facilitate invasion through the encumbering extracellular matrix ( 81 , 207 ) . One such enzyme, cathepsin L (CTSL) has been strongly implicated in the metastatic spread of tumor cells ( 22 , 106 ) . The association of CTSL with metastasis, disease relapse, and skeletal adversities, provides a compelling rationale for targeting this proteolytic enzyme to improve treatment outcomes and quality of life of advanced prostate and breast cancer patients ( 5 , 149 ) . Although our studies suggest a strong correlation between secreted CTSL levels and invasive capacities of prostate and breast cancer cells ( Figure 2A and B), it should be noted that the extracellular matrix is safeguarded against the proteolytic activity of cathepsins by endogenous inhibitors of the cystatin superfamily comprised of the intracellular stefins and kininogens and extracellular cystatins. Studies that correlate metastatic aggressiveness to an imbalance between CTSL and its endogenous inhibitors have either measured the expression levels of stefins and kininogens, which are the intracellular inhibitors of cathepsins, or have measured intracellular levels of cystatins ( 63 , 64 ) . We show that highly invasive cells exhibit a striking imbalance between their extracellular CTSL and cystatin C level when compared to poorly invasive prostate and breast cancer cells ( Figure 1); a finding consistent with the previously reported correlation between secreted CTSL to cathepsin inhibitor ratio and experimental metastatic potential in Ras transfected NIH 3T3 cells ( 62 ) . While clinical reports have documented either CTSL level alone or serum cystatin C level alone as important prognosticators of disease outcome ( 119 , 121 , 208 ) , there are discrepancies

PAGE 46

46 as to whether cystatin C is positively or inversely correlated with disease outcome ( 208 210 ) . To this point, we observed that highly invasiv e cells secreted somewhat more cystatin C compared to their non or poorly invasive counterparts, but the ratio of secreted CTSL to cystatin C increased with increasing invasiveness. Taken together these findings suggest that the CTSL/cystatin C ratio may serve as a better prognosticator of disease outcome than absolute levels of CTSL or cystatin C. The significance of CTSL in tumor aggression and the metastatic process is further supporte d by studies seeking to inhibit this enzyme by gene deletion, anti s ense RNA or cystatin C over expression ( 106 , 129 , 211 ) . The strategy pursued in the present investigation was to inactive CTSL using the selective small molecule inhibitor of CTSL KGP94 ( 179 ) . The results showed that CTSL inhibition by non cytotoxic doses o f KGP94 could significantly impair the invasive and migratory ability of the highly metastatic prostate (PC3 ML) and breast (MDA MB 231) cell lines ( Figure 2). These findings are consistent with a recent overview of the KGP94 molecule ( 21 ) . Given its impact on proteolytic enzymes, the mechanism responsible for KGP94 suppression of tumor cell invasion is readily apparent. How CTSL inhibition affects tumor cell migration is not nearly as clear. As was the case in our investigations, studies examining the effect of CTSL abrogation by RNA interference also have shown that CTSL inhibition can affect tumor cell migration ( 171 , 212 ) . Although the mechanism by which CTSL promotes tumor cell migration has not been delineated, Reiser et al. ( 213 ) ; have shown that in nephrotic syndromes such as glomerular proteinuria, CTSL can enhance podocyte migration by promoting cell detachment and remodeling of extracellular matrix components while migration of normal podocytes was found to be

PAGE 47

47 independent of CT SL activity. Similarly, in a recent study on gene therapy for ischemic diseases Chung et al. ( 214 ) showed that exogenous CTSL can promote endothelial cell migration through activation of the JNK pathway. Taken together, the ability of KGP94 to attenuate the metastatic phenotype of tumor c ells lends further credence to the pursuit of CTSL targeting strategies as means to impede the dissemination of tumor cells. Although clearly encouraging, the in vitro findings reported here await in vivo validation studies of KGP94 for the advancement of CTSL intervention strategies to the treatment of metastatic prostate and breast cancers.

PAGE 48

48 Figure 2 1. Cathepsin L secretion and activity positively correlates with invasive potential. A and B ) Intracellular CTSL levels in prostate and breast cancer cells were determined by performing western blots on whole cell lysates. C and D) CTSL secretion levels of prostate and breast cancer cells were determined by performing ELISA on cell conditioned medi a. Means and standard errors of three independent experiments are shown. E and F ) Ratios of secreted CTSL to cystatin C levels for prostate and breast cancer cells were determined by performing ELISA on cell conditioned media. Ratios shown are relative lev els normalized to least invasive prostate and breast cancer cell lines, respectively.

PAGE 49

49 Figure 2 2. KGP94 inhibits secreted CTSL activity of prostate and breast cancer cells . A ) Clonogenic assay testing the effect of pre exposure to various concentrations of KGP94 on the clonogenic capacity of PC 3 cells (*) P<0.01. B ) Growth curves of PC 3 cells treated with indicated doses of KGP94. C ) The effect of KGP94 treatment on the activity of CTSL secreted by PC 3ML and MDA MB 231 cells was assessed by incubating cell conditioned media with a fluorogenic CTSL substrate Z Phe Arg AMC in the absence (black bars) or presence (grey bars) of 25 µM KGP94. Activity is expressed as relative fluorescence units and results of three independent expe riments are shown. (***) P<0.0001.

PAGE 50

50 Figure 2 3. CTSL inhibition suppresses tumor cell migration. A and B ) PC 3, MDA MB 231 and CTSL knock down PC 3 cells were seeded into transwell migration chambers in the presence or absence of KGP94 and the number of migrated cells was enumerated 24 h later. Mean and standard error values of three independent experiments a re shown. (*) P<0.05, (***) P<0.0005. C ) Representative images from PC 3 wound healing assay demonstrating the effect of KGP94 treatment on PC 3 migration.

PAGE 51

51 Figure 2 4. CTSL inhibition suppresses tumor cell invasion . A and B ) The impact of KGP94 treatment on PC 3ML and MDA MB 231 cell transwell invasion is shown. Results are mean and standard error values of three independent experiments. (**) P<0.01, (***) P<0.001

PAGE 52

52 C HAPTER 3 KGP94 SUPPRESSES TUMOR MICROENVIRONMENT ENHAN CED METASTASIS ASSOCIATED CELL FUNCTIONS OF PROSTATE AND BREAST CANCER CELLS P athophysiological tumor microenvironmental conditions such as hypoxia and acidosis have been strongly linked to increased metast atic occurrences. Hence it was postulated that an anti metastatic agent such as KGP94 might prove particularly efficacious if it could attenuate the hypoxia and acidosis potentiated metastatic capacity of tumor cells. This chapter explores the contribution of CTSL to hypoxia and acidosis triggered invasiv eness, the various mechanisms through which upregulated secretion of CTSL is achieved and the impact of KGP94 on tumor microenvironment elicited metastatic characteristics of prostate and breast cancer cells. Background Prostate and breast cancer are the leading causes of cancer related death in men and women and metastasis is the primary factor underlying the high mortality rates ( 200 ) . Proteolytic enzymes that promote metastasis such as the lysosomal cysteine protease cathepsin L (CTSL) may offer a promising therapeutic target ( 22 , 215 , 216 ) . Exp ression of CTSL is up regulated in a wide range of human cancers including glioma, melanoma, pancreatic, breast and prostate carcinoma ( 50 ) . Under normal physiological conditions, CTSL is sequestered within the lysosomes. However, in tumors, alteration s in expression level a nd translocation pathway result in secretion of CTSL ( 38 , 82 , 83 ) . Secreted CTSL enhances the metastatic potential of cancer cells through direct degradative proteolysis of several components of the extracellular matrix, basement membrane and E Cadherin. In the pre sence of surface glycosaminoglycans, secreted CTSL degrades extracellular matr ix components such as laminin, t ype I and IV collagen, fibronectin, elastin, etc. ( 9 8 , 99 ) . In addition, secreted CTSL plays a critical

PAGE 53

53 role in the amplification of the proteolytic cascade by activating latent pro forms of other key metastasis associated proteases such as proheparan ase, urokinase plasminogen activator, cathepsin D and members of the matrix metalloproteinase family ( 102 , 103 , 201 ) . Though numerous clinical observations have associated CTSL upregulation with metastatic aggressiveness, very few have investigated its activity and function under physiological con ditions pertinent to the tumor microenvironment. The tumor microenvironment is acidic and hypoxic in nature ( 113 , 114 ) . Tumor hypoxia can be broadly classified into chronic and a cute hypoxia ( 217 ) .Chronic hypoxia occurs in regions that are beyond the diffusion limit of oxygen from the existing vasculature. Acute hypoxia can result from transient collapse of blood vessels leading to tumor cells that consequently experience periods of hypoxia and reoxygenation. Increased tumor hypoxia and acidosis correlate with i ncreased metastatic occurrence ( 114 , 115 , 218 ) . Studies in experimental metastatic models suggest that the correlation between tumor hypoxia and metastatic incidence is primarily attributable to acute rather than chronic hypoxia in the primary tumor ( 219 , 220 ) . Elevated CTSL secretion is not accompanied by corresponding increases in the levels of its endogenous inhibitors. Secreted CTSL thereby engages in unregulated activation of migratory and invasive cascades ( 63 , 117 ) . Thus, molecules capable of inactivating CTSL could potentially serve as effective anti metastatic treatments. Recently, the reversibly binding small molecule CTSL inhibitor KGP94 (3 bromophenyl 3 hydroxyphenyl ketone thiosemicarbazone) was shown to aboli sh CTSL function by blocking its active site ( 179 ) . In this study, we investigated the ability of KGP94 to inhibit

PAGE 54

54 CTSL activity and decrease prostate and breast cancer cell migration and invasion under normal as well as hypoxic and acidic microenvironmental c onditions. Materials and Methods Cell culture RWPE 1, PC 3, MCF 7, SKBR 3, T47D andMDA MB 231 were purchased from American Type Culture Collection. PC 3ML and PC 3N cells were gifts from Dr. Alessandro Fatatis (Drexel University). PC 3ML and PC 3N are high ly and poorly metastatic sublines isolated from PC 3 cells ( 202 ) . MDA MB 435 cells were received from Dr. Jianrong Lu (University of Florida). Although there has been controversy that the MDA MB435 cell line may have been derived from M14 melanoma ( 203 ) , a subsequent review by Chambers ( 204 ) concluded that rather than both lines being of M14 melanoma origin, evidence is consistent with both cell lines being of MDA MB 435 breast cancer origin. M 4A4 and NM 2C5 are highly and poorly invasive sublines isolated from MDA MB 435 cells ( 205 ) provided by Dr. Steve Goodison (MD Anderson Cancer Center). All cell lines were cultured in appropriate media (RWPE 1 in Keratinocyte serum free medium supplemented with 0.05 mg/ mL bovine pituitary extract and 5 ng/ mL epidermal growth factor; PC 3 and PC nutrient mixture; MCF 7, SKBR 3, T47D, MDA MB435, M 4A4, NM 2C5 and MDA MB 231 in DMEM media) supplemented with 10 %FBS at 37 0 C in a humidified atmosphere of 5 % CO 2 in air. Enzyme linked Immunosorbent Assay Prostate and breast cell lines were cultured i n 100 mm dishes. When the cells reached ~60 70 % confluency, media were replaced and collected 24 h r later. Cell conditioned media were centrifuged (1,000 rpm, 10 min) and stored at 80 0 C until

PAGE 55

55 further analysis. Cells from each sample were trypsinized and counted for normalization of secreted levels with total cell number. Cathepsin L ELISA was performed using a instructions. Cystatin C ELISA was performed using a Quantikine human Cystatin C Immunoassay kit (DSCTC0) from R&D systems. Conditioned media from each sample were evaluated in triplicate and secreted levels of CTSL and cystatin C were normalized to 10 6 cells. Clonogenic cell survival assay Cells were treated with desired concentration of KGP94 for 24 h r . Subsequently, cells were harvested and seeded into 60 mm dishes (200, 100 or 50 cells / dish) and incubated for 14 days. 2 weeks later, cells were stained with crystal violet and the number of colonies (>50 c ells) were counted. Plating efficiency was calculated by dividing the n umber of colonies formed by the number of cells seeded. CTSL activity measurement assay Cathepsin L activity assay was performed using InnoZyme Cathepsin L Activity Kit (CBA023) as per µL activation buffer (provided with the kit) was added to each well of a 96 well plate. To this, 50 µL of conditioned media was added and incubated for 15 min at room temperature with gentle shaking. Subsequently, 5 0 µL of either 10 µM or 25 µM KGP94 was added to designated wells. The plate was incubated at RT for 15 min with gentle shaking. After the addition of 50 µL of fluorogenic substrate Z Phe Arg 7 amido 4 methylcoumarin, the plate was again incubated for 2 h r at 37 0 C. The fluorescence was measured at an excitation wavelength of 360 380 nm and emission wavelength of 460 480 nm using the

PAGE 56

56 Spectramax M5 (Molecular Devices) fluorescence plate reader. CTSL activity was represented as relative fluorescence units. Ce ll migration assay Transwell migration assays were performed using BD falcon cell culture inserts ( 353097). The bottom of the insert is a polyethylene terephthalate membrane with 8 µm pores. Cells are seeded into the inserts and incubated for 24 h r to allo w them to migrate through 8 µm pores, to the other side of the membrane. 24 h r later, non migrated cells on the upper surface of the membrane are scraped off using a cotton swab. Migrated cells are stained with crystal violet and counted under a microscope . For wound healing assays, cells were allowed to grow to confluence before ~1 mm wide scratches were made in the cell monolayers using sterilized 200 µL pipette tips. 24 h r later, the plates were photographed and cell migration into the denuded areas was determined. Cell invasion assay Invasion assays were performed using matrigel coated invasion inserts from BD Biosciences ( 354480). Cells suspended in serum free media were seeded into the inserts. Media supplemented with 10 % FBS was added to the bottom chamber. The cells were incubated under desired conditions and 24 h r later, cells that invaded to the underside of the membrane were stained and counted under a microscope. Hypoxia Cells were plated in notched glass dishes to facilitate easy gas exchange. To induce hypoxia, cells were incubated in special aluminum chamber designed by Dr. Cameron Koch (University of Pennsylvania). These chambers were flushed with a gas mixtur e containing 1 % O 2 , 5 % CO 2 and the remainder balanced with N 2 and incubated

PAGE 57

57 at 37 o C for the desired duration. For reoxygenation, cells were removed from hypoxia chambers and placed back in incubator gassed with 5 %CO 2 and air. Low pH exposure Acidic HA NaHCO 3 with 25 mM HEPES and 25 mM MES. The pH was set to 6.8 using 10 N NaOH solution. Cells were plated under neutral pH conditions in 60 mm dishes. When the cells became ~60 % confluent, the DMEM depending on the cell line. Western blotting Cells were lysed using radioimmunoprecipitation assay lysis buffer (50 mM Tris HCl, pH 8.0, 150 mM NaCl, 0.1 % SDS, 1 % NP 40, 0.25 % Sodium deoxycholate and 1 mM EDT A) supplemented with protease inhibitor cocktail (Sigma), 1 mM NaF and 1mM Na 3 VO 4 . Protein concentration was estimated by Bradford method. 35 µg of whole cell lysates were fractioned on a 12 % SDS PAGE gel. Subsequently, the proteins were electroblotted on to a nitrocellulose membrane. The membranes were blocked with 5 % non fat dry milk for 1 h r human CTSL antibody (Abcam Ab6314 , 1:1000 dilution ) overnight at 4 o C. Subsequently, the membranes were washed and incubated with horseradish peroxidase conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA), and detected with an enhanced chemiluminescence substrate (Amersham, Piscataway, NJ). Immunofluorescence staining and microscopy Cells were grown to 60 70 % confluency on coverslips housed within 60 mm tissue culture dishes (BD Falcon) and were then incubated under appropriate conditions [normoxia and pH 7.4 (control) or 1 % O 2 or pH 6.8] for desired durations. Following

PAGE 58

58 incubation, the cells were r insed with PBS and fixed with 4 % (w/v) paraformaldehyde (Fisher Scientific) in PBS for 20 minutes at RT. Cells were then washed on a rocker for 20 min with ice cold PBS, replacing the PBS every 5 min. The fixed cells were incubated with permeabilization b uffer (0.2 % Triton X 100 and 50 mM NH 4 Cl in PBS) for 15 min at RT. Following permeabilization, cells were washed on a rocker for 20 min with ice cold PBST (0.05 % Triton X 100 in PBS), replacing the PBST every 5 min. Cells were blocked with 10 % (v/v) go at serum in PBS for 1 h r at RT and were then washed with PBST as described above. Following the washes, the cells were incubated with H4A3 monoclonal antibody (1:200 dilution; Developmental Studies Hybridoma Bank) diluted in blocking solution for 2 h r at R T. Incubation in primary antibody was followed by four washes with PBST. Cells were then incubated with Alexa Fluor 594 secondary antibody (1:800 dilution; Invitrogen, Molecular probes) diluted in blocking solution for 1 hr in dark at room temperature. Fi nally, cells were washed with PBS for 20 min, allowed to air dry, and mounted with Vectashield mounting medium containing DAPI (Vector laboratories). Cells were visualized and photographed using a Zeiss Axiophot microscope (Carl Zeiss Meditec, Dublin, CA) . Hexosaminidase assay Because Hexosaminidase is present within the endosomal lysosomal compartment, exocytosis of lysosomal contents can be determined by measuring glucosaminidase activity in the conditioned media. Conditioned media were harvested from cells exposed to hypoxia or acidic pH for desir ed duration. 500 µL sodium citrate buffer ( 100 mM sodium citrate, 0.2 % BSA, 0.2 % Triton X 100, 0.04 % NaN3, pH 4.5) with 10 mM p nitrophenyl N acetyl b D glucosaminide was added to 200 µL of conditioned media. The reaction mixture was incubated at 37 0 C for 1 h r . Subsequently,

PAGE 59

59 the reaction was stopped by adding 400 µL of stop solution ( 0.4 M Glycine at pH 10.7) . Absorbance was measured at 405 nm using the Spectramax M5 (Molecular Devices) spectrophotometer. 1 unit Hexosaminidase corresponds to the amoun t of enzyme that can hydrolyze 1 µmole of 4 Nitrophenyl N acetyl D glucosaminide per hour at 37 o C. Results Acute hypoxia elevates extracellular CTSL levels To examine the effect of hypoxic exposures on CTSL secretion PC 3ML and MDA MB 231 cells were e xposed to1 % O 2 for 1 24 h r followed by reoxygenation for the remaining time such that the total length of the cycle was 24 h. Compared to normoxic control, CTSL secretion in response to hypoxia peaked at about 4 h in both PC 3ML and MDA MB 231 cells and t hen tapered off to near normoxic levels after about 18 h of hypoxia ( Figure 3 1 A and B). CTSL secretion in cells chronically exposed to hypoxia (24 h) was significantly lower. To elucidate whether increased CTSL synthesis was the mechanism through which h ypoxia upregulated CTSL secretion, intracellular levels of CTSL were determined following exposure to hypoxia. In MDA MB 231 cells, intracellular CTSL levels increased in response to brief exposures to hypoxia followed by reoxygenation ( Figure 3 1 D). The close association between the synthesis and CTSL secretion patterns observed suggests that in these cells the increase in secreted CTSL could be due to increased synthesis. However, in contrast, PC 3ML cells showed no increase in intracellular CTSL levels in response to hypoxic exposures ( Figure 3 1 C). In fact, upon chronic (24 h) hypoxic exposure, intracellular CTSL levels were found to be lower than those observed under normoxic conditions. The increase in CTSL secretion by PC 3ML cells which occurred in the absence of an increase in de novo CTSL synthesis, suggested that hypoxia prompted the

PAGE 60

60 release of pre synthesized CTSL from their repositories. Studies in hepatic and myocardial ischemia reperfusion models have reported that hypoxia reoxygenation can trigger the lysosomes to undergo exocytosis ( 221 ) . We therefore determined whether hypoxia affects the subcellular location of lysosomes in PC 3ML and MDA MB 231 cells using the endosomal / lysosomal marker protein LAMP 1. The results ( Figure 3 1 E) showed that in cont rast to their mainly peri nuclear localization observed in normoxic cells, lysosomes in cells exposed to 1 % O 2 , trafficked towards the plasma membrane. These observations suggest that hypoxia activates the lysosomes to redistribute, fuse with the plasma m embrane, and release their content (including CTSL) into the extracellular milieu. To biochemically validate the release of lysosomal content in response to hypoxia reoxygenation exposure, we measured the activity of lysosomal hexosaminidase in me dia of cells exposed to hypoxia for 1 18 h r and reoxygenated for 24 h (black bars) ( Figure 3 1 F). The results showed that exposure to hypoxia followed by reoxygenation led to a significant and time dependent increase in hexosaminidase enzyme release. In concert with CTSL secretion pattern, lysosomal exocytosis peaked in cells exposed to hypoxia for 4 h and reoxygenated for 24 h (~3 fold). Cells that were chronically (24 h) exposed to hypoxia and not reoxygenated (grey bar) showed a significant drop in l ysosomal exocytosis despite lysosomal re distribution. Acute acidosis increases extracellular CTSL levels in both prostate and breast cancer cells Since cells in solid tumors commonly experience an acidic extracellular condition, we also evaluated the imp act of acidic culture medium (pH 6.8) on CTSL secretion in PC 3ML and MDA MB 231 cells. In comparison to cells maintained at pH 7.4, tumor cells exposed acutely to an acidic extracellular environment, secreted incr eased

PAGE 61

61 amounts of CTSL ( Figure 3 2 A and B) . This increase peaked at 4h, dropped to control cell levels at 18 h r exposure, and fell below control levels in cells chronically exposed to acidosis (24 h). Mechanistically, Western blot analysis revealed that in response to acute exposures to pH 6.8, i ntracellular CTSL levels increased in MDA MB 231 cells ( Figure 3 2 D). Furthermore, the close association between CTSL secretion and synthesis patterns in MDA MB 231 cells suggested that the observed increase in secreted levels could at least in part be du e to increased synthesis. Acidosis did not however upregulate CTSL synthesis in PC 3ML cells. Like hypoxia, acidosis also triggered the lysosomal redistribution and trafficking toward the cell periphery ( Figure 3 2 E). PC 3ML and MDA MB 231 cells that wer e acutely exposed to acidic conditions and then restored to neutral pH, showed a hexosaminidase enzyme ( Figure 3 2 F and G) while cells that were chronically exposed to acidic conditions, showed decreased exocytosis. Consistent with CTSL secretion results, lysosomal exocytosis peaked in cells acutely exposed to acidic pH for 4 h and re incubated under neutral conditions for 24 h (2.9 fold increase). Acute hypoxia and acidosis increase tumor cell aggressiv eness To assess whether the enhanced secretion of CTSL in response to acute exposures to hypoxia and acidic environments affects metastatic phenotype, their impact on PC 3ML and MDA MB 231 cell migration and invasion was determined. Acute hypoxic exposures of 1 to 6 h significantly increased the migratory potential of PC 3ML cells ( Figure 3 3 A); peaking at 4 h r (~3 fold increase). Similarly, MDA MB 231 cells that were acutely exposed to hypoxia also showed a significantly enhanced migratory capacity (~3 fo ld). Longer exposures to hypoxia reduced the migratory

PAGE 62

62 potential in both cell lines. Similar results were obtained using a wound healing assay to assess migration of cells into a denuded area ( Figure 3 5 B). Short term hypoxic exposures (2 6 h r ) also signi ficantly enhanced (1.9 and 2.5 fold, respectively at 4 h r ) the invasive capacities of PC 3ML and MDA MB 231 cells ( Figure 3 3 C and D). In terms of acidic extracellular microenvironments, both transwell and wound healing assays ( Figure 3 3 E and F) showed the migratory capacities of PC 3ML and MDA MB 231 cells to be significantly enhanced by acute (4 h r ) acidic exposure and hampered by prolonged (24 h r ) acidic exposures. Consistent with the cell migration results, acute exposure to pH 6.8, specifically 4 h r , enhanced the invasive potential of PC 3ML and MDA MB 231 cells 1.8 and 4 fold respectively. KGP94 abrogates hypoxia and acidosis triggered invasiveness in prostate and breast cancer cells To determine whether KGP94 treatment could impair the enhanced t umor cell aggressiveness conferred by acute hypoxic and acidic exposures, the impact of this agent on the invasive capacity of PC 3ML and MDA MB 231 cells pre exposed to 1 % O 2 or pH 6.8 was determined ( Figure 3 4 ). The results showed that in the presence of KGP94, the enhanced invasiveness of both PC 3ML and MDA MB 231 cells was reduced below basal invasion levels observed under normoxic conditions (PC 3ML, 50 % reduction at 10 µM; 63 % reduction at 25 µM; MDA MB 231, 80 % reduction at 10 µM; 92 % reducti on at 25 µM). Similarly the enhanced invasive potential of tumor cells exposed to an acidic environment was significantly attenuated in the presence of KGP94 (PC 3ML, 20 % reduction at 10 µM and 50 % reduction at 25 µM; MDA MB 231, 47% reduction at 10 µM and 72 % reduction at 25 µM).

PAGE 63

63 Discussion Tumor cells rely primarily on secreted extracellular proteases to facilitate invasion through extracellular matrix ( 81 , 207 ) . One such enzyme, cathepsin L (CTSL) has been strongly implicated in the metastatic spread of tumor cells ( 22 , 106 ) . It is overexpressed in a wide range of human cancers including carcinomas of the pancreas, brain, skin, bre ast and prostate ( 50 ) and has prognostic value in predicting relapse free and overall survival ( 119 , 121 ) . CTSL also has been linked with skeletal morbidities of bone metastases; common occurrences in both prostate and breast cancer patients ( 149 ) . The association of CTSL with metastasis, disease relapse, and skeletal adversities, provides a compelling rationale for targe ting this proteolytic enzyme to improve treatment outcomes and quality of life of advanced prostate and breast cancer patients ( 5 , 149 ) . Unlike the well oxygenated and near neutral pH conditions maintained in cell culture systems, the microenvironment within most solid tumors is hypoxic and acidic in nature ( 113 , 114 ) . These very aberrant physiological conditions have been known to confer and further augment the metastatic capacities of tumor cells ( 114 , 115 , 218 ) . In light of the possible role of CTSL in the metastatic process, we investigated whether hypoxic an d acidic microenvironmental conditions might influence CTSL function in prostate and breast cancer cells. The results showed that CTSL secretion is significantly upregulated by acute but not chronic exposures to hypoxia and acidosis ( Figure 3 1 and 3 2 ). In concert with the enhanced CTSL secretion, brief exposures to hypoxia or acidosis also led to significant enhancement of the metastatic attributes such as migration and invasion ( Figure 3 3 and 3 4 ). The relative importance of acute versus chronic hypoxi c effects on the metastatic phenotype noted here is consistent with

PAGE 64

64 observations made in experimental metastasis models which showed transient exposures to hypoxia or acidosis to promote metastasis to a greater extent than chronic exposures ( 219 , 220 , 222 ) . Mechanistically we postulated that in response to hypoxia and acidosis , lysosomes undergo exocytosis and release their contents, including CTSL, into the extracellular space. Indeed, prior studies had shown that tumor cell lysosomes undergo exocytosis during acidic exposure ( 223 ) . In our investigations we observed that hypoxic and acidic exposures led to anterograde tra fficking of lysosomes, but this alone did not result in a remarkable increase in the release of lysosomal content. It was the restoration of normoxia or neutral pH that triggered lysosomal exocytosis. Moreover, while the migratory and invasive capacities o f PC 3ML and MDA MB 231 cells were significantly hampered under hypoxic or acidic conditions, restoration of normoxic or neutral pH conditions dramatically increased their metastatic phenotype. These findings concur with prior studies of Cuvier et al. ( 118 ) who reported that rodent KHT LP1 and SSC VII tumor cells showed increased CTS L+B activity and increased invasiveness only upon reoxygenation and no enhanced invasiveness when exposed to prolonged (24 h) acidosis. Furthermore, studies in hepatic ischemia reperfusion models reported that while brief hypoxia followed by reoxygenation confers cytoprotection by inducing lysosomal exocytosis in hepatocytes, hepatocy tes subjected to prolonged hypoxia without reoxygenation lost viability because their lysosomes failed to exocytose ( 221 ) . The close association between CTSL secretion patterns and invasive and migratory tumor cell behavior noted in t he present investigations ( Figure 3 3 ) suggests that CTSL may be a key player in hypoxia and acido sis triggered enhanced metastatic

PAGE 65

65 aggressiveness. Selective targeting with the small molecule CTSL inhibitor KGP94 effectively impaired the hypoxia and acidosis potentiated pro metastasis behavior in both breast and prostate cancer cells ( Figure 3 4 ). Take n together, the ability of KGP94 to attenuate the metastatic phenotype of tumor cells experiencing normal physiological or aberrant microenvironmental conditions lends further credence to the pursuit of CTSL targeting strategies as means to impede the diss emination of tumor cells. Although clearly encouraging, the in vitro findings reported here await in vivo validation studies of KGP94 for the advancement of CTSL intervention strategies to the treatment of metastatic prostate and breast cancers.

PAGE 66

66 Figur e 3 1. Acute exposure to hypoxia enhances CTSL secretion. A and B ) CTSL secreted levels in PC 3ML and MDA MB 231 cells exposed to hypoxic conditions (1% O 2 ) for the indicated durations followed by reoxygenation for a total time of 24h. Secreted CTSL levels were determined by ELISA on cell conditioned media and normalized to cell numbers. Shown are mean and standard error values calculated from three independ ent experiments. (*) p<0.05, (**) p<0.005, (***) p<0.001 C and D ) Western blot analysis of PC 3ML and MDA MB 231 cells exposed to hypoxia for various durations. E ) Lysosomal localization in response to exposure to hypoxia was determined by immunostaining f or lysosomal marker protein LAMP 1. F ) The effect of hypoxia and reoxygenation on exocytosis of lysosomal content was Hexosaminidase activity in the media. Results from three independent experiments a re shown. (*) p<0.05, (**) p<0.01.

PAGE 67

67 Figure 3 2. Acute exposure to an acidic extracellular environment enhances CTSL secretion. A and B ) CTSL secretion levels in PC 3ML and MDA MB 231 cells pre exposed to acidic conditions for the indicated durations fol lowed by incubation under neutral pH conditions for 24h. Secreted CTSL levels were determined by performing ELISA on cell conditioned media and normalized to cell numbers. Results from three independent experiments are shown. (*) p<0.05, (**) p<0.01. C an d D ) Western blot analysis of PC 3ML and MDA MB 231 cells exposed to 6.8pH for various durations. E ) Effect of acidic exposure on lysosomal localization in response to acidic extracellular condition was determined by immunostaining for lysosomal marker pro tein LAMP 1. F ) Hexosaminidase activity in conditioned media. Results are mean and standard errors from three independent experiments. (*) p<0.05, (**) p<0.01.

PAGE 68

68 Figure 3 3. Acute hypoxia a nd acidosis augments metastatic phenotype. A ) PC 3ML and MDA MB 231 cells were exposed to 1% O 2 for indicated durations and then allowed to migrated under normoxic conditions. The number of migrated cells was quantified 24h later. Mean and standard error from three independent experiments are shown. (***) p<0.0001. B ) PC 3ML monolayers were exposed to hypoxic conditions following which a scratch was made on the monolayers. Cells were incu bated under normoxic conditions and imaged 24h later. C and D ) PC 3ML and MDA MB 231 cells were seeded into invasion inserts and exposed to hypoxia for indicated durations. 24h later, invaded cells were stained and counted. Mean and standard error are show n. (*) p<0.05, (**) p<0.005, (***) p<0.001. E ) PC 3ML and MDA MB 231 cells were briefly exposed to 6.8pH, maintained under neutral conditions for 24h and the number of migrated cells was quantified. Mean and standard errors for three independent experime nts are shown. (**) p<0.005, (***), p<0.0001. F ) Wound healing in response to acidic extracellular condition was assessed as mentioned in 5B. G and H ) PC 3ML and MDA MB 231 cells were exposed to pH 6.8 for indicated durations and seeded into invasion inser ts. 24h later, invaded cells were stained and counted. Mean and standard error are shown. (*) p<0.05, (***) p<0.001.

PAGE 69

69

PAGE 70

70 Figure 3 4. KGP94 suppresse s acidosis and hypoxia triggered invasiveness. A and B ) PC 3ML and MDA MB 231 cells were exposed to hypoxi c conditions for 4h. Cells were seeded into invasion inserts and allowed to invade for 24h in the presence of indicated doses of KGP94. Results from three independent experiments are shown. (***) p<0.0001. C and D ) PC 3ML and MDA MB 231 cells were exposed to pH 6.8 for 4h, seeded into invasion inserts and allowed to invade for 24h in the presence of indicated doses of KGP94. (*) p<0.05, (**) p< 0.01.

PAGE 71

71 CHAPTER 4 TUMOR ANGIOGENESIS: THE ROLE OF CATHEPSIN L AND ITS THERAPEUTIC INTERVENTION BY THE SMALL M OLECULE INHIBITOR KGP94 A significant proportion of breast cancer patients harbor clinically undetectable micrometastases at the time of diagnosis. If left untreated, the se micro metastases may lead to disease relapse and possibly death. Like primary tumor, the growth of metastases is al so driven by angiogenesis. This chapter explores the contribution of CTSL to breast cancer angiogenesis and further evaluates the anti angiogenic efficacy of KGP94 . Background Breast cancer is the most prevalent cancer and the second leading cause of cancer deaths in women ( 2 ) . Metastatic disease continues to be the primary cause of treatment failu re, high mortality and poor quality of life in breast cancer patients. This realization has stoked an unprecedented interest in the development of agents that impair m etastatic sp read of tumor cells . While it is critical to disrupt tumor cell dissemination, it is equally important to retard the expansion of established micro metastases in order to achieve a durable inhibition of metastatic progression. Angiogenesis, the process of forming new blood vessels from pre existing vasculature is an important hallmark of tumor progression ( 224 ) . To grow beyond a certain critical size, both primary tumors as well dista nt metastases have to induce new vascular supply in order to meet their growing oxygen and nutrient demands. Tumor vasculature is immature and highly permeable due to inefficient mural cell coverage, discontinuous endothelial cell lining and the lack of a durable basement membrane ( 225 ) . These vascular anomalies thus provide an easy exit route to metastatic tumor cells attempting to escape from the prima ry tumor. In fact, Weidner et al, have

PAGE 72

72 demonstrated that tumor microvessel density strongly correlates with metastatic incidence in breast cancer patients ( 226 ) . Thus an effective anti angiogenic agent would not only retard the growth of the primary tumor but could also exert significant anti metastatic activity by impairing tumor ce ll dissemination and growth of metastatic lesions. Recognition of the dependence of angiogenesis on proteolytic enzymes has raised significant interest in evaluation of proteases as potential targets to disrupt tumor angiogenesis ( 227 , 228 ) . While the role of cysteine proteases in tumor metastasis is well understood, their contribution to tumor angiogenesis remains less explored. Cysteine cathepsins, in particular cathepsin L (CTSL) gets upregulated in a wide range of human cancers ( 50 ) . In most normal cells, CTSL is mainly present within the lysosomes where it participates in degradative proteolysis of intracellular and endocytosed proteins ( 25 ) . However , transformation dependent CTSL overexpression and alterations in trafficking mechanism shunt this lysosomal protease into the secretory pathway ( 38 , 40 , 69 ) . Secreted CTSL promotes tumor metastasis by degrading several components of the basement membrane and extracellular matrix and further amplifies the proteolytic cascade by activating latent pro forms of key metastasi s promoting proteases ( 98 , 99 , 101 103 ) . In fact, CTSL overexpression has been shown to switch poorly tumorigenic and non metastatic human melanoma cells to a highly tumorigenic and aggressively metastatic phenotype ( 107 ) . Conversely, tumor progression studies in CTSL / mice revealed that CTSL deficiency significantly hampered the progression of beni gn encapsulated pancreatic tumors into highly invasive carcinomas ( 106 ) . Our previous findings have reported that CTSL inhibition significantly impairs invasive

PAGE 73

73 capacities of human breast cancer cells ( 21 , 117 ) . While these studies are clea rly indicative of the importance of CTSL in metastatic progression, they shed little light on the involvement of CTSL in the angiogenic process. Thus, the goal of the present studies was to assess the contribution of CTSL to breast cancer angiogenesis and to evaluate the anti angiogenic efficacy of KGP94, a specific inhibitor of CTSL.KGP94 is a thiosemicarbazone based small molecule inhibitor that reversibly and specifically disrupts CTSL activity by blocking its active site ( 183 ) . Methods Cell culture Human lung microvascular endothelial cells (HMVEC L) were cultured in EGM2 MV media supplied by Lonza (CC 3202). MDA MB 231 breast cancer cells were enriched medium supplemented with 10 % fetal bovine serum. All cells were maintained at 37 0 C in a humidified atmosphere of 5 % CO 2 in air. CTSL knockdown 6.25 x 10 5 MDA MB 231 cells were seeded in a 6 well dish. When the cells became 70 80 % confluent, they were transfected with CTSL shRNA plasmids ( Origene TG305172 instructions. Transfect ed clones were selected in the presence of puromycin and expanded . CTSL knockdown efficiency was tested by performing western blot on whole cell lysates and E LISA on cell culture supernatants. Clones exhibiting >80 % knockdown efficiency were used for in vivo and in vitro studies.

PAGE 74

74 Clinical data analysis For survival analyse s on clinical datasets, we used the KM plotter database which integrates gene expression information from TCGA, EGA and GEO microarray databases with clinical outcome ( 229 ) . For progression free, distant metastases free and overall survival analyses, patients were stratified into below median and above median expression groups and tested for statistical significance using log rank test. Drug preparation F or in vitro assays, KGP94 was dissolved in sterile DMSO to obtain a stock concentration of 25 mM and stored at 20 0 C. For treatment, the stock was further diluted in cell culture media to achieve a working concentration of 25 µM. For in vivo assays, KGP94 was sonicated in 10 % tween 80 solution for 30 mins and then diluted in 1 M HEPES b uffer to desired concentrations . The drug was then filter sterilized and stored at 4 0 C. Migration assay Migration assays were performed using BD falcon cell culture inser ts ( 353097).The bottom of these inserts is a polyethylene terephthalate membrane with 8 µm pores. 1 x 10 3 HMVEC L cells were seeded into these cell culture inserts placed within a 24 well plate. Cells were seeded in the presence of desired concentrations of purified human CTSL (Calbiochem 219402) and allowed to migrate through the pores in the membrane. 24h later, non migrated cells in the top chamber were scraped off using cotton swabs. Cells that had migrated to the other side of the membrane were stained with crystal violet and quantified under a light microscope.

PAGE 75

75 Invasion assay For invasion assays, BD falcon cell culture inserts ( 353097 ) were coated with 5 x 10 3 HMVEC L cells in serum free media. Cells were incubated in the presence of indicated concentrations of purified CTSL or KGP94 or tumor conditioned media. 24 hr later, no n invaded cells were scraped off; invaded cells were stained with crystal violet and counted. Sprouting assay 750 HMVEC L cells suspended in 4.2 % methylcelluose solution (Sigma, viscosity 4000 cP) were seeded per well of a 96 well plate to form endothelia l spheres. 24 hr later the spheres were harvested using a wide bore pipette and centrifuged at 1300 rpm for 3 mins. Approximately 48 spheres were suspended in a 2 mg/ mL collagen solution and added to each well of a 24 well plate pre coated with 4.2 % meth ylcellulose and 2 mg/ mL collagen mixture. The spheres were incubated at 37 0 C for 30 min to solidify and embed the spheres within the collagen methyl cellulose matrix. 30 mins later, 200 µL media containing desired concentrations of purified CTSL or KGP94 or tumor conditioned media was added. The spheres were visualized an imaged 8 h r later using a Zeiss Axioplan 2 microscope. Tube formation assay 200 µL matrigel was added to each well of a 24 well plate and solidified at 37 0 C for 30 mins . 4 x 10 4 HMVEC L cells were seeded on solidified matrigel and in the presence of desired concentrations of purified CTSL or KGP94 or tumor conditioned media and incubated at 37 0 C for 8 h r. Endothelial tubes were quantified and imaged using Zeiss Axioplan 2 micros cope

PAGE 76

76 Proliferations assays 2.5 x 10 3 HMVEC L cells were seeded in a 24 well dish . 48 h r later, the cells were treated with desir ed concentrations of purified CTSL or KGP94. At each time point, cell culture media was replaced with WST 1 reagent (Dojindo) in phenol red free media. 4 hr later viability was determined by measuring the amount of formazan dye formation at 450 nm using the Spectramax M5 (Molecular Devices) spectrophotometer BrdU incorporation assay was performed using BrdU cell proliferation ass ay kit 3 HMVEC L cells were seeded in a 96 well plate. 48 h r later, the cells were treated with desired concentrations of purified CTSL and 1X BrdU. 24 h r later, the cells were fixed , incubated with detection antibody for 1 hr, washed followed by incubation with HRP conjugate d secondary antibody for 1 hr. Tetramethylbenzidine substrate was added and the amount of BrdU incorporation was measured spectrophotometrically at 450 nm using a Spectramax M5 plate reader. Intradermal assay Induction of angiogenesis by breast cancer MDA MB 231 cells and the ability of KGP94 to inhibit tumor angiogenesis in vivo was measured by performing intradermal assay as described previously ( 230 ) . 5 x 10 5 parental or CTSL knockdown MDA MB 231 cells were injected intradermally on the ventral surface of athymic NCR fe male nu/nu mice at four sites. To facilitate easy location of the site of tumor cell inoculation, one drop of trypan blue solution was added to impart a light blue color to the cell suspension. 10 or 20 mg/kg KGP94 was administered intra peritoneally on a daily basis. 3 days later, the mice were euthanized and their skin flap s were removed. Tumor angiogenesis was evaluated by counting the number of blood vessels growing into the

PAGE 77

77 tumor nodule using a Zeiss Stemi SV 6 dissecting microscope. Tumor nodule images were captured using a Leica MZ 16 F camera and Leica Application Suit e software Results CTSL expression level serves as a prognosticator of clinical outcome of breast cancer patients. In order to determine the significance of CTSL upregulation in disease progression and survival of breast cancer patients, we examined CTSL e xpression profiles in a microarray compend ium of the primary tumor of 1809 breast cancer patients with known clinical outcome ( 229 ) . We observed that p atients that expressed high levels of CTSL were at a significantly higher risk of relapse, developing metastatic disease and death ( Figure 1 A C) . CTSL upregulation results in an increase in its secretion as demonstrated by the increased serum and urinary CTSL level in various cancer settings ( 74 , 75 , 77 , 80 ) . In order to examine the role of CTSL in tumor angiogenes is, we therefore tested whether endothelial cells can secrete CTSL. We observed that compared to the large amount of CTSL secreted by MDA MB 231 breast cancer cells, human microvascular endothelial cells (HMVEC L) barely secreted any CTSL ( Figure 1D) . CTSL promotes in vitro angiogenic properties of endothelial cells . Even though endothelial cells did not seem to secrete any CTSL, they are exposed to large amounts of tumor secreted CTSL within the tumor microenvironment. In order to elucidate whether tumor s ecreted CTSL can act upon endothelial cells in a paracrine manner to elicit an angiogenic response, we tested the effect of purified CTSL on various angiogenesis associated endothelial cel l function. Since endothelial cells depend on proteases to degrade t he basement membrane and extracellular matrix as

PAGE 78

78 they migrate and invade through the interstitium, we assessed whether CTSL can promote the migratory and invasive capacity of endothelial cells. We observed that in the presence of CTSL, endothelial cells ex hibited a dose dependent increase in their ability to migrate and invade through matrigel ( Figure 2A and B). While KGP94 had no apparent effect on the invasive capacity of naïve endothelial cells, it reduced CTSL stimulated invasiveness closer to baseline levels. In an attempt to closely mimic the tumor microenvironmental conditions, we assessed endothelial cell invasion in the presence of tumor conditioned media. While conditioned media harvested from parental MDA MB 231 cells led a marked increase in endo thelial cell invasion, endothelial cells that were incubated either with KGP94 or with conditioned media derived from CTSL knockdown MDA MB 231 cells showed a significant reduction in their invasive capacity. These results collectively indicate that tumor derived CTSL could significantly enhance endothelial cell migratory and invasive capacities. Quiescent endothelial cells are held together through tight homotypic vascular E cadherin interactions However, in the presence of proan giogenic factors, endotheli al cells dissolve their VE cadherin contacts to form new vascular sprouts in the direction of the pro angiogenic stimulus ( 231 ) . Certain proteases have been shown to facilit ate sprouting by degrading the obstructive extracellular matrix as these sprouts penetrate into the interstitium to form new vessels ( 232 ) . Hence, we tested the effect of CTSL on the sprouting of endothelial spheres embedded within a collagen matrix. Both purified CTSL and tumor conditioned media led to a dramatic increase in endothelial sphere sprouting in a dose dependent fashion ( Figure 3A and B). In order to tease out the contribution of CTSL to tumor conditioned media stimulated sprouting, we incubated

PAGE 79

79 endothelial spheres in presence of conditioned media harvested from CTSL knockdown MDA MB 231 cells. Both CTSL deficiency and KGP94 led to a significant reduction in tumor conditioned media or purified CTSL stimulated endothelial sprouting. The newly formed vascular sprouts elongate, branch out and connect with neighboring sprouts to form an extensive capillary network. This step of the a ngiogenesis process can be evaluated in vitro using the tubule forming assay ( 233 ) . In the presence of extr acellular matrix such as M artigel, endothelial cells orient themselves to form a capillary like network that resembles the capillary bed in vivo ( Figure 4A and B) . Endothelial cells that were incubated with either purified CTSL or tumor conditioned media s howed a striking increase in their tube forming capacity. Both pharmacological and genetic ablation of CTSL led to a dramatic decrease in extent of tube formation Next, we tested the effect of CTSL on endothelial cell proliferation which comprises an impo rtant endothelial cell pro angiogenic response. Endothelial cells were exposed to various concentrations of purified CTSL and their proliferation was as sessed over a period of 96 hr ( Figure 5A). Compared to the control group, endothelial cells that were in cubated in the presence of CTSL showed a marked increase in viability in a dose dependent fashion. In order to confirm that the increase in viability was indeed due to increased cell proliferation, we quantified the extent of DNA synthesis. Endothelial cel ls incubated in the presence of CTSL showed a significant increase in bromo deoxyuridine uptake indicating an increase in DNA synthesis and thus, cell proliferation. These results collectively suggest that CTSL facilitates various aspects of the angiogenic process including endothelial cell sprouting, migration and invasion through extracellular matrix, capillary like tube formation and proliferation.

PAGE 80

80 CTSL ablation suppresses tumor angiogenesis in vivo Encouraged by these in vitro findings, we next tested t he contribution of CTSL to tumor angiogenesis in vivo. Parental as well as CTSL knockdown MDA MB 231 breast cancer cells were intradermally inoculated into the ventral skin flaps of female nude mice. Compared to untreated mice, tumor nodules in mice that w ere treated with 10 or 20 mg/kg KGP94 showed a significant reduction in their vessel count. Similarly, compared to the empty vector control, tumor nodules formed using CTSL knock down tumor cells showed a significant decrease in their angiogenic capacity t hus suggesting that CTSL is a major player in breast tumor angiogenesis Discussion During the course of tumor progression, expression profiles of several genes get significantly altered. While some of these alterations are key to malignant progression, a majority of them represent by stander effect and thus do not contribute to tumorigenicity. Hence we first evaluated the relationship between CTSL expression status and the survival and metastatic incidence in breast cancer patients. The strong association b etween CTSL upregulation and disease relapse and metastatic incidence suggested that CTSL over expression is not a mere passenger effect but a key factor driving breast cancer progression and metastatic aggressiveness. While several genetic and pharmacolog ical CTSL intervention approaches have proven beyond doubt that CTSL targeting holds significant anti metastatic potential, it remains unknown whether CTSL targeting would also yield anti tumor effects in a breast cancer setting . Alt hough the role of CTSL in tumor angiogenesis remains less explored , several clinical and experimental findings are strongly suggestive of its involvement in the angiogenic process. In patients with coronary heart diseases, the formation of

PAGE 81

81 collateral coronary vessels as an alter native source of blood supply aids the recovery of the heart from ischemic insult. In these patients, plasma CTSL level serves as an important biomarker for rich collateral vessel formation ( 234 ) . CTSL is also highly expressed in human abdominal aortic aneurysm lesions and gene knockout studies have revealed that CTSL plays an important role in aneurysm develo pment by promoting pathological angiogenesis, inflammatory cells recruitment, and aortic wall matrix degradation ( 235 ) . Key proangiogenic factors such as vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) have been shown to induce CTSL expression. Keerthivasan et al. identified a 47 base pair VEGF responsive element in CTSL promote r region and demonstrated that VEGF serves as a transcriptional activator of CTSL in glioblastoma cells ( 42 ) . A strong positive correlation between VEGF and CTSL expression status has been reported in adult chronic myeloid leukemia and pediatric acute myeloid leukemia p atients ( 55 , 185 ) . In fact, CTSL upregulation was associated with inferior event free and overall survival of these AML patients ( 185 ) . Similarly, bFGF has been reported to promote cysteine cathepsin expression in various pathological conditions involving angiogen esis such as intraocular angiogenesis and ischemic diseases ( 214 , 236 ) . Development and progression of glom erulosclerosis is characterized by podocyte detachment from the glomerular basement membrane. Both bFGF and PDGF have been shown to promote podocyte secretion of CTSL to facilitate degradation of glomerular basement membrane ( 43 ) . Angiogenesis is a complex and dynamic process that progresses through a multitude of tightly controlled events including vascular sprouting, endothelial cell migration and invasion through the extracellular matrix, tube formation and proliferation .

PAGE 82

82 We observed that both purified and tumor derived CTSL led to a significant enhancement of these angiogenesis associated endothelial cell functions. Conversely, CTSL ablation using KGP94 or knockdown approach resulted in a significant impairment of tumor an giogenesis. These results are in agreement with previous observations made in melanoma stu dies . Intra tumoral gene delivery of single chain variable f ragment CTSL neutralizing antibody resulted in a marked reduction in tumorigenicity , growth and angiogenes is of human melanoma xenografts ( 110 ) . In addition to angiogenesis, CTSL has also been implicated to participate in alternative mechanisms of vascular ization such as vasculogenesis. During the process of vasculogenesis, bone marrow derived endothelial progenitor cells are recruited to the hypoxic tissue to form de novo blood vessels. Gene expression analysis of endothelial progenitor cells in ischemic d isease models revealed that their pro angiogenic effects are primarily mediated by CTSL ( 237 ) . CTSL was critical for the integration of circulating endothelial progenitor cells in to hypoxic tissues and both pharmacological and genetic ablation of CTSL impaired neovascularization of ischemic tissues. Previous studies with CTSL and MMP inhibitors have shown that inactivation o f CTSL and MMP proteolytic function severely impair s the e xtracellular matrix degradative capacity of e ndothelial cells ( 238 , 239 ) . CTSL mediated augmentation of endothelial cell sprouting, tube formation and invasion th rough collagen or matrigel may therefore be attributed to its proteoly tic effects on extracellular matrix components. However, the mechanism behind CTSL stimulated endothelial cell proliferation remains obscure. A recent study in ischemic disease model may perhaps shed some light on this unanticipated CTSL function. Proteomi c analysis identified CTSL to be the most

PAGE 83

83 significant mediator of bFGF stimulated angiogenesis ( 214 ) . bFGF over expression in skeletal muscle cells enhanced CTSL secretion which in turn triggered endothelial ce ll migratio n by activating JNK signaling pathway . MMPs have also been reported to signaling to promote tumor angiogenesis ( 240 , 241 ) . CTSL stimulated endothelial cell proliferation could thus potent ially be a downstream effect of activation of cell signaling pathways. In conclusion, CTSL upregulation is associated with poor clinical outcomes of breast cancer patients. O ur study has demonstrated that CTSL plays a key role in tumor angiogenesis by acti vating various angiogenesis associated endothelial cell functions such as migration, invasion, sprouting, tube formation and proliferation. KGP94 treatment led to a significant suppression of CTSL stimulated angiogenic properties of endothelial cells and a lso inhibited tumor angiogenesis in vivo. These findings warrant gene expression analysis to determine the mechanism behind CTSL stimulated activation of endothelial cell proliferation. The anti invasive property of KGP94 combined with its anti angiog enic function could be of significant benefit in the treatment of breast cancer patients.

PAGE 84

84 Figure 4 1. CTSL upregulation in breast cancer. A C) Kaplan Meier plots of overall, relapse free and distant metastases free survival using the KM plotter meta analysis database. B reast cancer patients were stratified on the basis of CTSL expression level. Statistical significance was determined using log rank test. D) Quantification of CTSL secretion by ELISA on 24 h conditioned media. Overall survival probability Relapse free survival probability Distant metastases free survival probability

PAGE 85

85 Figure 4 2. CTSL promotes endothelial cell migration and invasion. A and B ) Human microvascular endothelial cell (HMVEC L) transwell migration and invasion assays in presence of indicated doses of purified human CTSL. C ) CTSL or tumor conditioned media stimulated HMVEC L invasion assay with or without KGP94.

PAGE 86

86 Figure 4 3. CTSL promotes endothelial sphere sprouting. A) Schematic of endothelial sphere sprouting assay. B) Representative images of endothelial sphere sprouts upon incubation with indicated doses of purified CTSL or tumor conditioned media in the presence or absence of KGP94. CTSL 10 ng/ml 100 ng/ml 25 uM KGP94 231 CM CTSL KD CM Parental CM Endothelial cell sphere formed in methylcellulose media 24h later Spheres are embedded in a collagen matrix ± CTSL 8h later

PAGE 87

87 Figure 4 4. CTSL enhances endothelial tube forming capacity. A) Quantification of total number of tubes formed by CTSL or tumor conditioned media stimulated endothelial cells treated with or without KGP94. B ) Representative images of tubes from each experimental grou p.

PAGE 88

88 Figure 4 5. CTSL promotes endothelial cell proliferation. A) Measurement of proliferation of endothelial cells exposed to increasing concentrations of purified CTSL using WST 1 dye. B) Representative cell density images of endothelial cells stimulated with indicated concentrations of CTSL taken 24 h after initial e xposure. C ) Quantification of DNA synthesis upon 24 h exposure to various concentrations of purified CTSL based on extent of BrdU incorporation. D) Measurement of the effect of KGP94 on CTSL stimulated endothelial cell proliferation. Control 10ng/ml CTSL 100ng/ml CTSL

PAGE 89

89 Figure 4 6 . CTSL inhibition abrogates in vivo tumor angiogenesis. A ) Intradermal assay testing the effect of CTSL abrogation through KGP94 treatment or knockdown on MDA MB 23 1 tumor angiogenesis. n = 16. B) Representative images of tumor nodules. Empty vector CTSL KD 231

PAGE 90

90 CHAPTER 5 PRE CLINICAL EVALUATION OF CATHEPSIN L INHIBITOR KGP94 IN A PROSTATE CANCER BONE METASTASIS MODEL Approximately 90% of advanced prostate cancer patients suffer from bone metastases. This chapter evaluates the in vivo anti metastatic effects of KGP94 in a prostate cancer bone metastasis model. Background Prostate c ancer is the most prevalent cancer and the second leading cause of cancer related death amongst men in the United States. It is estimated that in the year 2014 alone, about 233,000 new cases will be diagnosed and 29,480 men will die of prostate cancer with the bulk of tumor burden in the bone at the time of death ( 2 ) . While the prognosis for patients with localized disease is highly favorable, the 1 and 5 year survival rates of prostate cancer patients with metastatic bone disease drops to 47% and 3% respectively ( 242 ) . Indeed , the extent of metastatic disease in the bone serves as a strong predictor of diseas e outcome ( 243 ) . Once the primary tumor cells have disseminated to the bones, the patient is no longer considered for a curative therapy and receives only palliative treatment. In addition to their deleterious effects on survival, bone metastases severely impinge on the quality of life of these advanced prostate cancer patients. Ske letal metastases inflict de bilitating complications including intractable bone pain, pat hological fractures due to bone deformities, nerve compression syndromes including paralysis and paresis due to impingement of spinal nerves and anemia due to bone marrow ablation ( 244 , 245 ) . Thus treatments aimed at inhibiting bone metastasis and delay ing the onset of skeletal complications are critical to improving the survival and quality of life of prostate cancer patients.

PAGE 91

91 Tumor secreted proteases play significant role in many stages of the tumor cell dissemination process including detachment from the primary site, degradation of interstitial matrices and basement membrane, intravasation and extravasation across the capillary/lymphatic system and activation of latent growth factors to promote colonization at the secondary site ( 4 , 5 ) . One such protease c athepsin L (CTSL), a key member of the cathepsin family of c ysteine proteases has emerged as a promising target in strategies seeking to impede the metastatic process ( 5 ) . CTSL upregulation has been reported in a wide range of human cancers including prostate carcinoma ( 50 ) . In most normal cells CTSL is primari ly present within the lysosomes where it is committed to housekeeping functions such as termin al degradation of intracellular and endocytosed proteins ( 36 , 37 ) . H owever, tumor cells possess the ability to to shunt this lysosomal enzyme into the secretory pathway via a variety of different mechanisms ( 56 58 , 67 , 68 , 81 83 ) . Transformation dependent CTSL secretion has been shown to aid metastatic diss emination of tumor cells through dissolution of cell adhesion molecules and proteolytic degradation of extracellular matrix and basement membrane barriers ( 62 , 67 , 97 , 106 , 246 , 247 ) . This enzyme further fuels the proteolytic cascade by activating latent pro forms of other key metastasis promoting proteases such as matrix metalloprotease, pro heparanase, urokinase plasminogen activator and other members of the cathepsin family ( 101 103 ) . Studi es including our own have also shown that tumor secreted CTSL plays a pivotal role in hy poxia and acidosis triggered metastatic aggressiveness of tumor cells ( 117 , 118 ) . The significance of CTSL upregulation in malignant progression is further supported by a number of clinical studies reporting a

PAGE 92

92 strong correlation between tumor CTSL levels and metastatic incidence, disease relapse and overall surviv al ( 119 121 , 193 , 194 , 197 ) . In addition to promoting tumor cell dissemination, CTSL may also contribute to the subsequent development of metastasis asso ciated skeletal morbidities. Alt hough osteoclastic CTSL levels are typicall y low during normal bone remodeling, in the presence of tumor cell secreted cytokines osteoclastic CTSL activit y increases several fold and the enzyme begins to play a significant, non redundant role in the process of pathological bone resorption ( 125 , 139 143 , 151 , 157 , 248 ) . Bone resorption no t only provides room for the expan sion of the neoplastic cell mass but also leads to the release of active growth factors from the bone matrix that support aggressive growth of metastases ( 130 , 249 ) . Conceivably, inhibition of CTSL function will disengage this vicious cycle and cause not only alleviation of bone resorption, but will also decrease the tumor burden in the bone. Our previous findings have shown that the small molecule CTSL inhibitor 3 bromophenyl 3 hydroxyphenyl ketone thiosemicarbazone (KGP94) significant ly impedes metastasis associated tumor cell attributes such as migration and invasion ( 117 ) . Thus, the goal of present studies was to evaluate the anti metastatic and anti bone resorptive efficacy of KGP94 in a prostate cancer bone metastasis model. Materials and methods Cell culture PC 3ML is a highly metastatic subline isolated from prostate cancer PC 3 cells through serial in vivo selection of bone metastases ( 202 ) . PC 3ML and mouse pre

PAGE 93

93 media respectively supplemented with 10 % FBS . Cells were maintained at 37 o C in a humidified atmosphere of 5 % CO 2 in air. CTSL Knockdown 1.25 x 10 5 PC 3ML cells were seeded in a 6 well dish. 48 h r later the cells were transfected with CTSL shRNA plasmids (Origene TG305172) using Lipofectiamine LTX isolated through puromycin selection and expanded. CTSL knockdown e fficiency was tested by performing western blot on whole cell lysates and ELISA on cell culture supernatants. Clones exhibiting >80% knockdown efficiency were used for in vivo and in vitro studies. Drug preparation For in vitro assays, KGP94 w as dissolved in sterile DMSO to obtain a stock concentration of 25 mM and stored at 20 0 C. For treatment, the stock was further diluted in cell culture media to achieve a working concentration of 25 µM. For in vivo assa ys, KGP94 was sonicated in a 10% T ween 80 solutio n in 1 M HEPES buffer until completely dissolved. The drug was then filter sterilized and stored at 4 0 C. Bone metastasis assay All in vivo experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Florida. 1x10 5 luciferase and GFP labeled PC 3ML cells were inoculated into the left ventricle of the heart of anesthetized athymic NCR nu/nu male mice. Mice received daily treatment of 20mg/kg KGP94 (at 10 µL per gram of mouse) via intraperitoneal (IP) injections. Bone metastasis was monitored on a weekly basis using the Xenogen IVIS imaging system by measuring photon flux 30 min after intra peritoneal administration of D Luciferin.

PAGE 94

94 Histomorphometric analysis Mice were euthanized and bones were harvested, and fixe d in 10 % neutral buffered formalin solution for 24 hr. The bones were then washed with phosphate buffered saline (PBS) and decalcified in 10 % EDTA solution for a week at 4 0 C. After complete decalcification, the bones were kept in a 30 % sucrose solution overnight followed by OCT embedding. For quantifying tumor burden, GFP positive areas on consecutive bone sections were imaged using a Leica MZ 16 F camera. Tumor area was then quantified by outlining the region of interest using ImageJ software. Intrade rmal assay Induction of angiogenesis by PC 3ML cells and the ability of KGP94 to inhibit tumor angiogenesis were measured by performing the intradermal angiogenesis assay as described previously ( 230 ) . 1 x 10 5 PC 3ML cells were injecte d intradermally at four sites on the ventral surface of athymic NCR nu/nu male mice. One drop of trypan blue solution was added to impart a light blue color t o the cell suspension and thus allow easy location of the site of tumor cell inoculation. 10 or 20 mg/kg KGP94 was administered IP on a daily basis. 3 days later, the mice were euthanized and their skin flaps were removed. Tumor angiogenesis was evaluated by counting the number of blood vessels growing into the tumor nodule using a Zeiss Stemi SV 6 dissecting microscope. Tumor nodu le images were captured using a Leica MZ 16 F camera and Lei ca Application Suite software. Osteoclast formation and TRAP staini ng 2.85 x 10 5 RAW 264.7 cells were seeded in a 24 well plate in the presence of indicated concentrations of RANKL (R&D systems) and KGP94 or purified CTSL (Calbiochem). 4 days later, the cells were fixed and stained for tartarate resist ant acid

PAGE 95

95 phosphatase using the a cid phosphatase, leukocyte kit (Sigma Aldrich) as per under a Zeiuss Stemi SV 6 dissecting microscope and imaged using a Leica DMI 4000 B microscope . Pit for mation assay 100 µm thick slices of bovine cortical bone were sterilized with 70% ethanol, rinsed with sterile deionized water followed by overnight equilibration in DMEM media. Bone slices were then overlaid with 2.85x10 5 RAW 264.7 cells in the presence of 35 ng/ mL RANKL and 25 µM KGP94. 4 days later, the osteoclasts were scraped off the bone slices using a cotton swab. Bone slices were then rinsed in PBS and resorption pits were stained using 1% toluidine blue solution in 0.5% tetraborate. Resorption pits were imaged using a Zeiss Axioplane 2 imaging system and pit area was quantified by outlining the area of interest using the ImageJ software. Viability assay 4.8 x 10 4 RAW264.7 cells were seeded in a 96 well dish in the presence or absence of various concentrations of KGP94 or purified CTSL. 3 days later, cell culture medium was replaced with WST 1 reagent (D ojindo) in phenol red free medium . 4 hr later viability was determined by measuring the amount of formazan dye form ation at 450 nm using the Spectramax M5 (Molecular Devices) spectrophotometer . Results KGP94 treatment leads to a significant reduction in metastatic tumor burden and an overall improvement in survival Following intracardiac injection of l uciferase and GFP labeled prostate cancer PC 3ML cells , the mice were treated daily with 20 mg/kg KGP94 and m etastatic

PAGE 96

96 progression was monitored by weekly bioluminescence imaging using the firefly luciferase reporter system. The results showed that KGP94 treatment led to a significant reduction (65%) in metastatic tumor burd en and an improvement in the overall survival of metastases bearing mice ( Figure 1A C). Histological assessments based on GFP imaging and hematoxylin and eosin staining confirmed that the reduction in bioluminescence signal in KGP94 treated mice was attributable to a decrease in tumor burden ( Figure 1D and E) . Further q uantification of bone lesions revealed a significant decrease in the number of metastatic foci in KGP94 treated mice mediated reduction in metastatic burden was at least in part due to a significant decrease in the number of m etastatic foci ( Figure 1F and G). CTSL inhibition impairs the angiogenic capacity of prostate cancer cells To test whether suppression of angiogenesis could have contributed to the reduction in tumor burden resulting from KGP94 treatment, PC 3ML cells were inoculated intradermally and the effect of KGP94 exposure on tumor induced blood vessel formation was dete rmined ( Figure 2). The results showed that compared to untreated control s , mice that w ere treated with either 10 or 20 mg/kg KGP94 showed a significant reduction in tumor angiogenesis as demonstrated by a dose dependent decrease in the number of tumor indu ced blood vessels ( 31 and 58 % decrease respectively). For comparison, CTSL knockdown PC 3ML cells induced 72 % fewer blood vessels than PC3 ML cells transfected with an empty vector. KGP94 suppresses the bone resorptive capacity of osteoclasts Progressive growth of bone metastases is strongly dependent on reciprocal interactions between tumor cells and bone resorbing osteoclas ts and bone forming osteoblasts ( 131 ) . Both osteolytic and osteoblastic metastases secrete osteoclast

PAGE 97

97 activating cytokines leading to unrestrained bone resorption and release of growth factors from the bone matrix. These growth factors in turn stimulate tumor cell proliferation and further cytokine release. Thus disengagement of osteoclastic function would not only alleviate skeletal complications but would make bone a less favorable niche for metas tatic expansion. Moreover, CTSL has been widely implicated to participate in pathological bone resorption. To test whether KGP94 treatment could disrupt osteoclast mediated bone resorption by interfering with either osteoclast formation or, the osteolytic function of mature osteoclasts w e tested the impact of KGP94 in murine pre osteoclastic RAW264.7 cells . Tumor secreted cytokines promote osteoblastic secretion of Receptor activator of nuclear kappa B ligand (RANKL) ; an essential mediator of osteoclast for mation and activity. Upon exposure to RANKL RAW264.7 cells under go fusion and differentiation to form multinucleate, tartarate resistant acid phosphatase (TRAP) positive osteoclasts ( Figure 3A and B). However, in the presence of KGP94, the number of mature osteoclasts was significantly reduced and g ene expression analysis of osteoclast marker genes confirmed a significant inhibition of osteoclast formation ( Figure 3C). Viability assay reveal ed that the reduction was not due to a cytotoxic effect of KGP94 (Figure 3D). Next, we investigated the effect of CTSL inhibition on the bone resorptive function of mature osteoclast. Compared to the RANKL alone controls , RAW264.7 cells stimulated with RAN KL in the presence of KGP94 showed a significant reduction in their bone pit forming capacity as demonstrated by a decrease in to luidine staining intensity (Figure 3E and F). These data collectively suggest that KGP94 affects bone resorption by inhibiting both osteoclast formation and the osteolytic activity of mature osteoclasts.

PAGE 98

98 CTSL promotes osteoclast formation in a synergistic fashion While the role of CTSL in pathological osteoclastic activity is well documented, its involvement in the osteoclast form ation process remains less explored. Thus, in order to validate our observations on osteoclast formation in the presence of KGP94, we tested the effect of purified CTSL on osteoclastogenesis. While CTSL alone had no impact on RAW264.7 cell proliferation or differentiation, combined treatment of CTSL with sub optimal concentrations of RANKL led to a striking increase in osteoclastogenesis approaching that seen by treatment with 35ng/ mL of RANKL ( Figure . 4B and C). Discussion First line treatme nt for prostate cancer consists of radical prostatectomy or radiation coupled with androgen deprivation therapy. Although these treatments are highly effective initially, nearly one third patients eventually suffer from local or metastatic recurrence ( 250 , 251 ) . Approximately 90% of these advanced prostate cancer patients develop bone metastases at which point the disease is considered highly incurable ( 252 ) . While the new generation anti resorptive agents such as bisphosphonates , RANKL quenchers and cathepsin K inhibitors provide effective palliative care and reduced morbidity , they exhibit little if any anti metastatic efficacy ( 253 257 ) . Thus novel therapeutic agents that can serve both as effective anti metastatic agent s and active anti resorptive therapy are highly desired . The ability of CTSL to influence several critical aspects of malignant tumor progression such as metastatic aggressivene ss, drug resistance, disease relapse and skeletal morbidities makes it an ideal candidate for therapeutic intervention ( 106 , 121 , 149 , 258 ) . Promising outcomes of various CTSL targeting approaches ranging from gene knockout to ectopic expression of endogenous inhibitors or antisense, at curbing tumor progression and

PAGE 99

99 metastatic disease place further emphasis on the importance of development and pre clinical evaluation of effective CTSL targeting agen t s ( 106 , 129 , 167 169 , 171 ) . To date, the development of CTSL specific inhibitors has been hampered by the high degree of structural homology between different members of the cathepsin fa mily ( 172 , 173 ) . The present study investigates the anti metastatic efficacy of a thiose micarbazone based CTSL specific inhibitor KGP94, which selectively impairs CTSL proteolytic function by targeting its active site ( 179 , 183 ) . CTSL knockout studies in a spontaneous pancreatic carcinogenesis model reported that CTSL deficiency retards tumor growth and significantly hampers the progression of benign encapsulated tumors into invasive carcinomas thus indicating that CTSL plays a key role in the process of tumor invasion and metastasis ( 106 ) . Further, KGP94 mediated CTSL inhibition has been shown to result in a substantial inhibition of tumor microenvironment potentiated me tastatic capacity of tumor cells ( 117 ) . In agreement with these findings, our present study shows that CTSL inactivation resulted in a significant reduction in metastatic burden in the bone ( Figure 1). This decrease in tumor burden was associated with a significant decline in metast atic incidence and an improvement in the overall survival of KGP94 treated mice. Since successful establishment of metastases is contingent on effective execution of several different processes such as invasion through the interstitium to arrive at the se condary site, initiation of angiogenesis to support the growth of the newly formed metastatic lesion and establishment of a constru ctive interaction with the new microenvironment; disruption of any of these processes could result in a similar decline in me tastatic burden. Hence we explored the various mechanisms through which

PAGE 100

100 KGP94 c ould possibly impair the metastatic process. Since formation of new blood vessels is critical to support the nutritional and oxygen demands of metastases , we tested whether KGP9 4 treatment could mediate its anti metastatic effect through inhibition of tumor angiogene sis. Both pharmacological and genetic ablation of CTSL were found to le a d to a significant reduction in PC 3ML tumor cell induced vasculature ( Figure 2). Although the role of CTSL in tumor angiogenesis remains poorly understood, observations made in other pathological disorders are strongly suggestive of its proangiogenic function ( 214 , 237 , 239 , 259 ) . Rebbaa et al. have demonstrated that CTSL inhibition signi ficantly suppressed angiogenesis by repressing endothelial cell extracellular matrix digestive capacity ( 239 ) . Furthermore , highly potent pro angiogenic factors such as VEGF and bFGF have been shown to induce CTSL expression and secretion to stimulate mitogen activated protein kinase pathways in endothelial cells in a paracrine fa shion ( 214 ) . Importantly, the contribution of CTSL to bFGF stimulated angiogenesis in ischemic disease model s was far greater than that noted for other well recognized proteases such as matrix metallo protease 1 and plasminogen activator inhibitor 1. Thus, CTSL could contribute to the process of tumor angiogenesis by extracellular matrix digestion to assist endothelial cell invasion through the interstitium or through more complex mechanism s involving activation of pro angiogenic signaling pathways. I t has been observed that in prostate cancer patients with skeletal metastases , tumor cells alter the local cytokine milieu lead ing to unrestrained activation of osteoclasts as demonstrated by a significant elevation in bio markers of bone resorption ( 260 262 ) . These cytokines have been shown to selecti vely upregulate osteoclastic

PAGE 101

101 CTSL synthesis in order to promote active resorption of bone matrix components including type I collagen ( 140 , 149 , 248 ) . Such osteolytic events in turn release several active growth factors stored within the bone matrix to support aggressive growth of metastases ( 263 ) . In the present investigation we demonstrated that KGP94 treatment actively interferes with osteoclastic bone resorption. In the presence of KGP94, RANKL stimulated osteoclasts exhibited a striking reduction in their p it forming capacity ( Figure 3). These f indings are in agreement with observations made in other pathological conditions involving CTSL. For example, s teroidal hormones such as estrogens protect bone health by negatively regulating osteoclastic synthesis of CTSL ( 140 ) . Thus CTSL knockout mice displayed a marked resist ance to osteoporosis upon ovariectomy ( 35 ) . Pharmacological intervention of CTSL also yielded similar suppression of bone resorption in osteoporotic mice ( 264 ) . In addition to the anticipated decline in bone resorption, KGP94 also led to a drastic impairment of the osteoclast formation process ( Figure 3) . While of role of CTSL in osteoclastic function is we ll documented, the mechanism through which CTSL inhibition affects osteoclast formation is not nearly as clear. In addition to their anti collagenolytic function, administration of CTSL specific inhibitor to ovariectomized mice also inhibited calcium relea se from the bone ( 265 ) . During osteoclastic bone resorption, acidification of the resorption lacuna dissolves the mineral component of the bone which exposes the collagen rich organic matrix for digestion by cathepsins and other proteases. Since dissolution of the mineral component of the bone is independent of the proteolytic function of osteoclasts, this decline in calcium level implicates of a decrease in osteoc last formation. Antisense targeting of a closely related protease namely, Cathepsin K which is also the

PAGE 102

102 predominant osteoclastic protease led to a similar reduction in osteoclast formation suggesting of a shared underlying role for cathepsins in the osteoc last differentiation process ( 266 ) . In order to validate our observations on osteoclast formation in the presence of KGP94, we tested the effect of purified CTSL on osteoclastogenesis. While CTSL alone had no impact on RAW264.7 cell proliferation or differentiation, combined trea tment of CTSL with sub optimal concentrations of RANKL led to a striking increase in osteoclastogenesis approaching that seen by treatment with 35ng/ mL of RANKL ( Figure 4B and C). The ability of purified CTSL to augment RANKL stimulated osteoclastogenesis thus further underscores the involvement of CTSL in the differentiation process perhaps in a catalytic capacity Even though skeletal metastases in prostate cancer patients are predominantly osteoblastic, this abnormal bone formation is mostly preceded by osteolytic events thus indicating that bone resorption might be a prerequisite for abnormal osteoblastic activity ( 132 , 267 ) . In addition to cancer induced osteolysis, standard of care cytotoxic, glucocorticoid and androgen deprivation therapies have been proven to accelerate bone loss ( 162 , 268 , 269 ) . Hence, numerous anti resorptive agents are actively being used in the clinic as palliative treatment for prostate cancer p atients with bone metastases. Thus the anti resorptive function of KGP94 coupled with its anti metastatic activity would not only decrease metastatic incidence and patient mortality but could also improve the quality of life of these patients by averting s keletal morbidities. In summary, KGP94 mediated CTSL inactivation resulted in a significant reduction in metastatic incidence, tumor burden and an improvement in overall survival. Mechanistically, this could be the consequence of anti invasive, anti angiog enic and

PAGE 103

103 anti resorptive effects of KGP94. Thus, selective CTSL inhibition by the small molecule agent KGP94 has the potential to significantly alleviate metastatic disease progression and associated skeletal morbidities in prostate cancer patients.

PAGE 104

104 Fig ure 5 1 . KGP94 reduces metastatic incidence and tumor burden in the bone. A) Bioluminescence images of mice inoculated with luciferase labeled PC 3ML prostate cancer cells. Representative images of median mice from control and KGP94 treated group . B ) Bon e metastases burden in control and KGP94 treated mice measured based on bioluminescence. n = 10 mice. C) Kaplan Meier survival curve of bone metastases bearing mice treated with or without 20 mg/kg KGP94. D ) Metastatic tumor burden in median mice from cont rol and KGP94 treated group based on GFP imaging. E) Representative GFP and H&E images of bone metastases from each experimental group. F and G) Total number of metastases in mice treated with or without KGP94

PAGE 105

105 Control KGP94 (20mg/kg) Day 0 Day 21 Day 42

PAGE 106

106

PAGE 107

107 Fig ure 5 2 . CTSL inhibition impairs tumor angiogenesis. A ) Intradermal assay testing the effect of KGP94 treatment on PC B ) Representative images of tumor nodules KGP94 10mg/kg 20mg/kg Empty vector CTSL knockdown

PAGE 108

108 Figure 5 3. KGP94 suppresses bone resorptive capacity of osteoclasts A ) Quantification of TRAP+ multinucleate osteoclasts 4 days after stimulation with 35 ng/ mL RANKL in the presence or absence of KGP94. B) Representative images from each experimental group. C) Relative expression of osteoclastogenesis marker genes in the presence of KGP94. D) Effect of KGP94 on osteoclast precursor cell viability . E) Percent area of bone resorbed by RANKL stimulated osteoclasts treated with or without KGP94. F) Representative i mages of bone slices stained with O toluidine for evaluating the extent of pit formation by osteoclasts under indicated conditions.

PAGE 109

109 RANK Nfatc 1 KGP94 (25 µ M) RANKL (35ng/ml)

PAGE 110

110

PAGE 111

111 Figure 5 4. CTSL promotes osteoclast formation in a synergistic fashion. A) Effect of various concentrations of purified CTSL on osteoclast percursor cell proliferation.B) Quantification of TRAP+ multinucleate osteoclasts 4 days after stimulation with ind icated concentrations of purified CTSL and RANKL . C ) Representative images from each experimental group 5ng RANKL 5ng RANKL +10ng CTSL 100ng CTSL 35ng RANKL 5ng RANKL +100ng CTSL

PAGE 112

112 CHAPTER 6 SUMMARY AND FUTURE DIRECTIONS The research presented here explored the involve ment of c ysteine protease CTSL in various aspects of me tastatic progression and evaluated the therape utic efficacy of a small molecule CTSL inhibitor KGP94. Our observation of a strong association between secreted CTSL level and invasive capacity of prostate and breast cancer cells and the suppressed metastati c capacity of CTSL deficient cells implicated the significance of CTSL in tumor cell dissemination process. The striking imbalance between secreted CTSL and endogenous inhibitor cystatin C levels provided a compelling rationale for the use of synthetic CTS L inhibitor as a means to curb metastatic capacity of tumor cells. Our results showed that treatment with small molecule CTSL inhibitor KGP94 led to a significant decrease in secreted CTSL activity paralleled by inhibition of two critical attributes of a m etastatic tumor cell namely, migration and invasion. Although CTSL upregulation has been widely associated with metastatic aggressiveness, its activity and function under conditions prevalent within the tumor microenvironment remained unexplored. Hence, w e evaluated the effect of hypoxia and acidosis on CTSL level and metastasis associated functions. We observed a significant upregulation of CTSL secretion in response to both hypoxia as well as acidosis; particularly in response to acute rather than prolon ged exposures. This upregulation was achieved either through increased intracellular levels or exocytosis of lysosomal contents including CTSL into the extracellular milieu or, a combination of both mechanisms depending on the tumor type. Elevated CTSL sec retion was also paralleled by an increase in migratory and invasive capacities of tumor cells. These

PAGE 113

113 findings were consistent with the observations made in experimental metastatic models that a transient exposure to hypoxia or acidosis promotes metastasis to a greater extent than chronic exposures. The ability of KGP94 to suppress tumor microenvironment potentiated metastatic capacities of prostate and breast cancer cells further validated the therapeutic value of KGP94 as an anti metastatic agent. A significant proportion of prostate and brea st cancer patients harbor overt metastases and clinically undetectable micrometastases at the time of diagnosis . If left untreated, these micro metastases may lead to disease relapse and possibly death. Therefore , in addition to inhibiting tumor cell dissemination, an effective anti metastatic agent should also be able to suppr ess the growth of these pre established micro metastases. Since the growth of both primary tumor as well as distant metastases is dependent on the formation of oxygen and nutrient supplying blood vessels, we tested whether CTSL participates in tumor angiogenesis. We observed that both purified and conditioned media derived CTSL stimulated in vitro angiogenic functions such as endothelial cell sprouting, migration, invasion, tube formation and proliferation. KGP94 treatment resulted in a significant suppression of CTSL stimulated angiogenic properties. Similarly, both pharmacological and genetic intervention of CTSL led to significant suppressi on of in vivo tumor angiogenesis across both prostate and breast cancer models. While CTSL mediated augmentation of endothelial cell sprouting, tube formation and invasion through collagen or matrigel could be attributed to its proteolytic effects on extra cellular matrix components, its role in endothelial cell proliferation remains obscure. Some gene expression and signaling pathway analyses are currently

PAGE 114

114 underway to unravel the mechanism through which CTSL stimulates endothelial cell proliferation. Bone m etastases are frequently associated with debilitating morbidities such as unbearable bone pain, pathological fractures and nerve compression syndromes which severely impinge on the survival and quality of life. Since these skeletal complications are trigge red by unrestrained bone resorption and because CTSL has been implicated in other bone related pathologies, we tested whether KGP94 can inhibit bone resorption. In vitro assessment revealed that KGP94 mediated its anti resorptive effects by inhibiting b oth osteoclast formation and bone resorptive function of mature osteoclasts. These encouraging in vitro findings await in vivo validation of the anti resorptive effect of KGP94 in an intra tibial bone metastases model. Encouraged by the promising outcomes of KGP94 treatment on metastatic properties of tumor cells under normal as well as aberrant microenvironmental conditions, tumor angiogenesis and bone resorption we tested the in vivo effects of KGP94 on tumor metastasis. Since bone metastases are the primary cause of mortality and morbidity in advanced prostate cancer patients, we evaluated the anti metastatic efficacy of KGP94 in a bone metastasis model. KGP94 treatment resulted in a significant decrease in metastatic incidence, tumor burden and a significan t improvement in the overall survival of tumor bearing mice. These effects on metastatic burden were attributable at least in part, to the anti angiogenic and anti bone resorptive functions of KGP94. In addition to participating in bulk protein turnover w ithin the lysosomes, CTSL is involved in numerous other activities critical to normal tissue functioning. CTSL is

PAGE 115

115 endorphin, melanocyte stimulating hormone and adre nocorticotropic hormone present within zymogenic granules ( 27 29 ) . CTSL also plays a cardioprotective role through inhibition of apoptosis promoting Akt signaling pathway in cardiomyocytes ( 30 ) . The significance of CTSL in normal tissue functioning is reflecte d by numerous pathological conditions that stem from CTSL deficiency such as dilated cardiomyopathy, metabolic syndromes, brain atrophy, epithelial hyperplasia and hypotrichosis ( 31 35 ) . While most of these normal tissue functions are furnished by intracellular CTSL, metastasis associated functions are mainly mediated through extracellular CTSL. Selective targeting of extracellular CTSL could therefore broaden the therapeu tic window of CTSL inhibition strategies by obviating any toxicity resulting from inhibition of intracellular functions. In fact, the cell impermeable JPM OEt inhibitor was able to achieve a significant inhibition of tumor growth, angiogenesis and invasio n without exerting any overt normal tissue toxicity ( 173 ) . Long term administration of selective inhibitors of CTSL poses a potential risk of therapeutic resistance through compensation by other members of the cathepsin family. Thus simultaneous inhibition of CTSL and other critical tumor promoting cathepsins could potentially yi eld a better outcome. Since CTSB has also been shown to promote tumor metastasis , it might be valuable to test th e efficacy of CTS L+B dual targeting agents . Thus such protease inhibition approaches require careful deliberation supported by studies in conditional knockout models in order to achieve maximum anti tumor effects while obviating normal tissue toxicity. Studies have shown that CTSL inhibition improves the therapeutic window of various chemotherapeutic agents by lowering the

PAGE 116

116 effective concentrations at which they mediate cytotoxic effects ( 258 , 270 ) . Zheng et al., demonstrated that CTSL inhibition not only prevents the emergence of a drug resistant phenotype but also effectively reverses resis tance to various cytotoxic and targeted agents including doxorubicin, etoposide, imatinib, trichostatin A and tamoxifen. While administration of highest tolerable dose of doxorubicin had no impact on the growth of doxorubicin resistant tumors, CTSL inhibit or iCL alone yielded a 40% reduction in tumor growth, and combined treatment with iCL and doxorubin restored the sensitivity to doxorubicin and led to a 90% reduction in tumor growth. Majority of cancer related deaths can be attributed to either inherent o r acquired resistance to chemotherapeutic or targeted agents. Conceivably, if drug sensitivity restoration by CTSL inhibition could be successfully translated to the clinic it might have a significant impact on patient outcome. Thus it might be of interest to te st the impact of CTSL inhibitors on drug resistance. Despite the promising results of CTSL inhibition in preclinical models, it has a long way to go before it gets ready for being tested in clinical trials. Numerous questions on protease targeting ra ised by the unanticipated outcome of MMP clinical trials need to be resolved. One such issue is the development of reliable tools for the identification of patients who might serve as candidates for anti CTSL therapy. While methodologies such as CTSL immun ohistochemistry of tumor tissue and measurement of CTSL level/activity in serum samples have been proposed, it is critical to evaluate the reliability of these techniques towards successful identification of patients with increased CTSL activity. Recently, activity based probes (ABPs) have been developed as a non invasive imaging tool that not only lends itself to patient identification but could also be

PAGE 117

117 used for monitoring treatment response ( 271 , 272 ) . ABPs are comprised of three distinct elements namely (i) a reactive warhead that covalently links to the active site of target enzyme based on its activity status, (ii) a target recognition motif that confers specificity to wards its target enzyme and (iii) a reporter tag that enables direct visualization of probe labeled proteins. In contrast to the passive measurement of protein abundance offered by widely used proteomic tools that depend on antibody labeling, ABPs provide a direct readout of the activity status of its target enzyme both in vivo and ex vivo. These features of ABPs allow longitudinal in vivo assessment of response to enzyme inhibitors using non invasive imaging techniques ( 272 , 273 ) . However, most ABPs that have been developed for the assessment of cysteine proteinases were designed based on broad spectrum inhibitor warheads and are thus not amenab le for detection of CTSL alone ( 271 , 272 ) . Like CT SL inhibitors, the development of CTSL specific ABP has been hindered by the high degree of similarity between the substrate recognition pockets of different members of the cathepsin family. However, Torkar et al., recently developed a novel non cell perme able CTSL specific photo affinity based probe that could be utilized for the measurement of secreted CTSL activity ex vivo ( 182 ) . Although preclinical findings on the role of CTSL inhibition in tumor progres sion look promising, various issues such as comparison of effectiveness of intracellular versus extracellular CTSL targeting, patient identification and therapeutic response assessment need to be addressed before embarking on clinical trials.

PAGE 118

118 LIST OF REFERENCES 1. Mundy GR. Metastasis to bone: causes, consequences and therapeutic opportunities. Nat Rev Cancer. 2002;2:584 93. 2. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014;64:9 29. 3. Steeg PS. Tumor metastasis: mechanistic insights and clinical challenges. Nat Med. 2006;12:895 904. 4. Palermo C, Joyce JA. Cysteine cathepsin proteases as pharmacological targets in cancer. Trends Pharmacol Sci. 2008;29:22 8. 5. Lankelma JM, Voorend DM, Barwa ri T, Koetsveld J, Van der Spek AH, De Porto AP, et al. Cathepsin L, target in cancer treatment? Life Sci. 2010;86:225 33. 6. Bogenrieder T, Herlyn M. Cell surface proteolysis, growth factor activation and intercellular communication in the progression of melanoma. Crit Rev Oncol Hematol. 2002;44:1 15. 7. DeClerck YA, Mercurio AM, Stack MS, Chapman HA, Zutter MM, Muschel RJ, et al. Proteases, extracellular matrix, and cancer: a workshop of the path B study section. Am J Pathol. 2004;164:1131 9. 8. Mason SD, Joyce JA. Proteolytic networks in cancer. Trends Cell Biol. 2011;21:228 37. 9. Gupta GP, Massague J. Cancer metastasis: building a framework. Cell. 2006;127:679 95. 10. Joyce JA, Pollard JW. Microenvironmental regulation of metastasis. Nat Rev Cancer . 2009;9:239 52. 11. Tan GJ, Peng ZK, Lu JP, Tang FQ. Cathepsins mediate tumor metastasis. World J Biol Chem. 2013;4:91 101. 12. Lah TT, Duran Alonso MB, Van Noorden CJ. Antiprotease therapy in cancer: hot or not? Expert Opin Biol Ther. 2006;6:257 79. 1 3. Turk B. Targeting proteases: successes, failures and future prospects. Nat Rev Drug Discov. 2006;5:785 99. 14. Zucker S, Cao J, Chen WT. Critical appraisal of the use of matrix metalloproteinase inhibitors in cancer treatment. Oncogene. 2000;19:6642 50 .

PAGE 119

119 15. Overall CM, Lopez Otin C. Strategies for MMP inhibition in cancer: innovations for the post trial era. Nat Rev Cancer. 2002;2:657 72. 16. Fingleton B. Matrix metalloproteinases as valid clinical targets. Curr Pharm Des. 2007;13:333 46. 17. Kruger A, Kates RE, Edwards DR. Avoiding spam in the proteolytic internet: future strategies for anti metastatic MMP inhibition. Biochim Biophys Acta. 2010;1803:95 102. 18. Fisher JF, Mobashery S. Recent advances in MMP inhibitor design. Cancer Metastasis Rev. 2 006;25:115 36. 19. Tomoo K. Development of cathepsin inhibitors and structure based design of cathepsin B specific inhibitor. Curr Top Med Chem. 2010;10:696 707. 20. Zucker S, Cao J. Selective matrix metalloproteinase (MMP) inhibitors in cancer therapy: ready for prime time? Cancer Biol Ther. 2009;8:2371 3. 21. Chavarria GE, Horsman MR, Arispe WM, Kumar GD, Chen SE, Strecker TE, et al. Initial evaluation of the antitumour activity of KGP94, a functionalized benzophenone thiosemicarbazone inhibitor of cat hepsin L. Eur J Med Chem. 2012;58:568 72. 22. Gocheva V, Joyce JA. Cysteine cathepsins and the cutting edge of cancer invasion. Cell Cycle. 2007;6:60 4. 23. Joyce JA, Baruch A, Chehade K, Meyer Morse N, Giraudo E, Tsai FY, et al. Cathepsin cysteine prote ases are effectors of invasive growth and angiogenesis during multistage tumorigenesis. Cancer Cell. 2004;5:443 53. 24. Mohamed MM, Sloane BF. Cysteine cathepsins: multifunctional enzymes in cancer. Nat Rev Cancer. 2006;6:764 75. 25. Chapman HA, Riese RJ , Shi GP. Emerging roles for cysteine proteases in human biology. Annu Rev Physiol. 1997;59:63 88. 26. Onishi T, Hayashi N, Theriault RL, Hortobagyi GN, Ueno NT. Future directions of bone targeted therapy for metastatic breast cancer. Nat Rev Clin Oncol. 2010;7:641 51. 27. Yasothornsrikul S, Greenbaum D, Medzihradszky KF, Toneff T, Bundey R, Miller R, et al. Cathepsin L in secretory vesicles functions as a prohormone processing enzyme for production of the enkephalin peptide neurotransmitter. Proc Natl Ac ad Sci U S A. 2003;100:9590 5.

PAGE 120

120 28. Hwang SR, Garza C, Mosier C, Toneff T, Wunderlich E, Goldsmith P, et al. Cathepsin L expression is directed to secretory vesicles for enkephalin neuropeptide biosynthesis and secretion. J Biol Chem. 2007;282:9556 63. 29 . Funkelstein L, Toneff T, Mosier C, Hwang SR, Beuschlein F, Lichtenauer UD, et al. Major role of cathepsin L for producing the peptide hormones ACTH, beta endorphin, and alpha MSH, illustrated by protease gene knockout and expression. J Biol Chem. 2008;28 3:35652 9. 30. Tang Q, Cai J, Shen D, Bian Z, Yan L, Wang YX, et al. Lysosomal cysteine peptidase cathepsin L protects against cardiac hypertrophy through blocking AKT/GSK3beta signaling. J Mol Med (Berl). 2009;87:249 60. 31. Stypmann J, Glaser K, Roth W, Tobin DJ, Petermann I, Matthias R, et al. Dilated cardiomyopathy in mice deficient for the lysosomal cysteine peptidase cathepsin L. Proc Natl Acad Sci U S A. 2002;99:6234 9. 32. Huang X, Vaag A, Carlsson E, Hansson M, Ahren B, Groop L. Impaired cathep sin L gene expression in skeletal muscle is associated with type 2 diabetes. Diabetes. 2003;52:2411 8. 33. Petermann I, Mayer C, Stypmann J, Biniossek ML, Tobin DJ, Engelen MA, et al. Lysosomal, cytoskeletal, and metabolic alterations in cardiomyopathy of cathepsin L knockout mice. FASEB J. 2006;20:1266 8. 34. Felbor U, Kessler B, Mothes W, Goebel HH, Ploegh HL, Bronson RT, et al. Neuronal loss and brain atrophy in mice lacking cathepsins B and L. Proc Natl Acad Sci U S A. 2002;99:7883 8. 35. Potts W, Bo wyer J, Jones H, Tucker D, Freemont AJ, Millest A, et al. Cathepsin L deficient mice exhibit abnormal skin and bone development and show increased resistance to osteoporosis following ovariectomy. Int J Exp Pathol. 2004;85:85 96. 36. Dennemarker J, Lohmul ler T, Muller S, Aguilar SV, Tobin DJ, Peters C, et al. Impaired turnover of autophagolysosomes in cathepsin L deficiency. Biol Chem. 2010;391:913 22. 37. Barrett AJ, Kirschke H. Cathepsin B, Cathepsin H, and cathepsin L. Methods Enzymol. 1981;80 Pt C:535 61. 38. Gottesman MM, Sobel ME. Tumor promoters and Kirsten sarcoma virus increase synthesis of a secreted glycoprotein by regulating levels of translatable mRNA. Cell. 1980;19:449 55.

PAGE 121

121 39. Doherty PJ, Hua L, Liau G, Gal S, Graham DE, Sobel M, et al. Mal ignant transformation and tumor promoter treatment increase levels of a transcript for a secreted glycoprotein. Mol Cell Biol. 1985;5:466 73. 40. Rabin MS, Doherty PJ, Gottesman MM. The tumor promoter phorbol 12 myristate 13 acetate induces a program of a ltered gene expression similar to that induced by platelet derived growth factor and transforming oncogenes. Proc Natl Acad Sci U S A. 1986;83:357 60. 41. Lah TT, Calaf G, Kalman E, Shinde BG, Somers R, Estrada S, et al. Cathepsins D, B, and L in transfor med human breast epithelial cells. Breast Cancer Res Treat. 1996;39:221 33. 42. Keerthivasan S, Keerthivasan G, Mittal S, Chauhan SS. Transcriptional upregulation of human cathepsin L by VEGF in glioblastoma cells. Gene. 2007;399:129 36. 43. Asanuma K, S hirato I, Ishidoh K, Kominami E, Tomino Y. Selective modulation of the secretion of proteinases and their inhibitors by growth factors in cultured differentiated podocytes. Kidney Int. 2002;62:822 31. 44. Frick KK, Doherty PJ, Gottesman MM, Scher CD. Regu lation of the transcript for a lysosomal protein: evidence for a gene program modified by platelet derived growth factor. Mol Cell Biol. 1985;5:2582 9. 45. Nilsen Hamilton M, Hamilton RT, Allen WR, Massoglia SL. Stimulation of the release of two glycoproteins from mouse 3T3 cells by growth factors and by agents that increase intralysosomal pH. Biochem Biophys Res Commun. 1981;101:411 7. 46. Lah TT, Hawley M, Rock KL, Goldberg AL. Gamma interferon causes a selective induction of the lysosomal prot eases, cathepsins B and L, in macrophages. FEBS Lett. 1995;363:85 9. 47. Scher CD, Dick RL, Whipple AP, Locatell KL. Identification of a BALB/c 3T3 cell protein modulated by platelet derived growth factor. Mol Cell Biol. 1983;3:70 81. 48. Gallardo E, de Andres I, Illa I. Cathepsins are upregulated by IFN gamma/STAT1 in human muscle culture: a possible active factor in dermatomyositis. J Neuropathol Exp Neurol. 2001;60:847 55. 49. Gerber A, Wille A, Welte T, Ansorge S, Buhling F. Interleukin 6 and transfo rming growth factor beta 1 control expression of cathepsins B and L in human lung epithelial cells. J Interferon Cytokine Res. 2001;21:11 9. 50. Chauhan SS, Goldstein LJ, Gottesman MM. Expression of cathepsin L in human tumors. Cancer Res. 1991;51:1478 81 .

PAGE 122

122 51. Skrzypczak M, Springwald A, Lattrich C, Haring J, Schuler S, Ortmann O, et al. Expression of cysteine protease cathepsin L is increased in endometrial cancer and correlates with expression of growth regulatory genes. Cancer Invest. 2012;30:398 403. 52. Adenis A, Huet G, Zerimech F, Hecquet B, Balduyck M, Peyrat JP. Cathepsin B, L, and D activities in colorectal carcinomas: relationship with clinico pathological parameters. Cancer Lett. 1995;96:267 75. 53. Sheahan K, Shuja S, Murnane MJ. Cysteine protease activities and tumor development in human colorectal carcinoma. Cancer Res. 1989;49:3809 14. 54. Herszenyi L, Plebani M, Carraro P, De Paoli M, Roveroni G, Cardin R, et al. The role of cysteine and serine proteases in colorectal carcinoma. Cancer . 1999;86:1135 42. 55. Samaiya M, Bakhshi S, Shukla AA, Kumar L, Chauhan SS. Epigenetic regulation of cathepsin L expression in chronic myeloid leukaemia. J Cell Mol Med. 2011;15:2189 99. 56. Jean D, Guillaume N, Frade R. Characterization of human cathep sin L promoter and identification of binding sites for NF Y, Sp1 and Sp3 that are essential for its activity. Biochem J. 2002;361:173 84. 57. Jean D, Rousselet N, Frade R. Expression of cathepsin L in human tumor cells is under the control of distinct reg ulatory mechanisms. Oncogene. 2006;25:1474 84. 58. Mao X, Hamoudi RA. Molecular and cytogenetic analysis of glioblastoma multiforme. Cancer Genet Cytogenet. 2000;122:87 92. 59. Kageshita T, Yoshii A, Kimura T, Maruo K, Ono T, Himeno M, et al. Biochemical and immunohistochemical analysis of cathepsins B, H, L and D in human melanocytic tumours. Arch Dermatol Res. 1995;287:266 72. \ 60. Frohlich E, Schlagenhauff B, Mohrle M, Weber E, Klessen C, Rassner G. Activity, expression, and transcription rate of the cathepsins B, D, H, and L in cutaneous malignant melanoma. Cancer. 2001;91:972 82. 61. Turk V, Brzin J, Kotnik M, Lenarcic B, Popovic T, Ritonja A, et al. Human cysteine proteinases and their protein inhibitors stefins, cystatins and kininogens. Biomed Bi ochim Acta. 1986;45:1375 84. 62. Chambers AF, Colella R, Denhardt DT, Wilson SM. Increased expression of cathepsins L and B and decreased activity of their inhibitors in metastatic, ras transformed NIH 3T3 cells. Mol Carcinog. 1992;5:238 45.

PAGE 123

123 63. Zajc I, S ever N, Bervar A, Lah TT. Expression of cysteine peptidase cathepsin L and its inhibitors stefins A and B in relation to tumorigenicity of breast cancer cell lines. Cancer Lett. 2002;187:185 90. 64. Friedrich B, Jung K, Lein M, Turk I, Rudolph B, Hampel G , et al. Cathepsins B, H, L and cysteine protease inhibitors in malignant prostate cell lines, primary cultured prostatic cells and prostatic tissue. Eur J Cancer. 1999;35:138 44. 65. Lah TT, Kos J, Blejec A, Frkovic Georgio S, Golouh R, Vrhovec II, et al . The Expression of Lysosomal Proteinases and Their Inhibitors in Breast Cancer: Possible Relationship to Prognosis of the Disease. Pathol Oncol Res. 1997;3:89 99. 66. Denhardt DT, Greenberg AH, Egan SE, Hamilton RT, Wright JA. Cysteine proteinase catheps in L expression correlates closely with the metastatic potential of H ras transformed murine fibroblasts. Oncogene. 1987;2:55 9. 67. Gal S, Willingham MC, Gottesman MM. Processing and lysosomal localization of a glycoprotein whose secretion is transformat ion stimulated. J Cell Biol. 1985;100:535 44. 68. Gottesman MM. Transformation dependent secretion of a low molecular weight protein by murine fibroblasts. Proc Natl Acad Sci U S A. 1978;75:2767 71. 69. Denhardt DT, Hamilton RT, Parfett CL, Edwards DR, S t Pierre R, Waterhouse P, et al. Close relationship of the major excreted protein of transformed murine fibroblasts to thiol dependent cathepsins. Cancer Res. 1986;46:4590 3. 70. Troen BR, Gal S, Gottesman MM. Sequence and expression of the cDNA for MEP ( major excreted protein), a transformation regulated secreted cathepsin. Biochem J. 1987;246:731 5. 71. Gal S, Gottesman MM. Isolation and sequence of a cDNA for human pro (cathepsin L). Biochem J. 1988;253:303 6. 72. Gal S, Gottesman MM. The major excreted protein of transformed fibroblasts is an activable acid protease. J Biol Chem. 1986;261:1760 5. 73. Mason RW, Gal S, Gottesman MM. The identification of the major excreted protein (MEP) from a transformed mouse fibroblast cell line as a catalytically acti ve precursor form of cathepsin L. Biochem J. 1987;248:449 54. 74. Tumminello FM, Leto G, Pizzolanti G, Candiloro V, Crescimanno M, Crosta L, et al. Cathepsin D, B and L circulating levels as prognostic markers of malignant progression. Anticancer Res. 1996 ;16:2315 9.

PAGE 124

124 75. Siewinski M, Saleh Y, Gryboc M, Murawski M, Ekonjo GB, Ziolkowski P, et al. Determination of cysteine peptidases like activity and their inhibitors in the serum of patients with ovarian cancer treated by conventional chemotherapy and vitamin E. J Exp Ther Oncol. 2004;4:189 93. 76. Chen Q, Fei J, Wu L, Jiang Z, Wu Y, Zheng Y, et al. Detection of cathepsin B, cathepsin L, cystatin C, urokinase plasminogen activator and urokinase plasminogen activator receptor in the sera of lung cancer p atients. Oncol Lett. 2011;2:693 9. 77. Nishida Y, Kohno K, Kawamata T, Morimitsu K, Kuwano M, Miyakawa I. Increased cathepsin L levels in serum in some patients with ovarian cancer: comparison with CA125 and CA72 4. Gynecol Oncol. 1995;56:357 61. 78. Leto G, Tumminello FM, Pizzolanti G, Montalto G, Soresi M, Carroccio A, et al. Lysosomal aspartic and cysteine proteinases serum levels in patients with pancreatic cancer or pancreatitis. Pancreas. 1997;14:22 7. 79. Zhang W, Yang HC, Wang Q, Yang ZJ, Chen H, Wa ng SM, et al. Clinical value of combined detection of serum matrix metalloproteinase 9, heparanase, and cathepsin for determining ovarian cancer invasion and metastasis. Anticancer Res. 2011;31:3423 8. 80. Svatek RS, Karam J, Karakiewicz PI, Gallina A, Cas ella R, Roehrborn CG, et al. Role of urinary cathepsin B and L in the detection of bladder urothelial cell carcinoma. J Urol. 2008;179:478 84; discussion 84. 81. Dong JM, Prence EM, Sahagian GG. Mechanism for selective secretion of a lysosomal protease by transformed mouse fibroblasts. J Biol Chem. 1989;264:7377 83. 82. Prence EM, Dong JM, Sahagian GG. Modulation of the transport of a lysosomal enzyme by PDGF. J Cell Biol. 1990;110:319 26. 83. Stearns NA, Dong JM, Pan JX, Brenner DA, Sahagian GG. Comparison of cathepsin L synthesized by normal and transformed cells at the gene, message, protein, and oligosaccharide levels. Arch Biochem Biophys. 1990;283:447 57. 84. Barbarin A, Frade R. Procathepsin L secretion, which triggers tumour progression, is regulated by Rab4a in human melanoma cells. Biochem J. 2011;437:97 107. 85. Goulet B, Baruch A, Moon NS, Poirier M, Sansregret LL, Erickson A, et al. A cathepsin L isoform that is devoid of a signal peptide localizes to the nucleus in S phase and processes the CDP/ Cux transcription factor. Mol Cell. 2004;14:207 19. 86. Goulet B, Sansregret L, Leduy L, Bogyo M, Weber E, Chauhan SS, et al. Increased expression and activity of nuclear cathepsin L in cancer cells suggests a novel mechanism of cell transformation. Mol Ca ncer Res. 2007;5:899 907.

PAGE 125

125 87. Hiwasa T, Sakiyama S. Nuclear localization of procathepsin L/MEP in ras transformed mouse fibroblasts. Cancer Lett. 1996;99:87 91. 88. Moon NS, Rong Zeng W, Premdas P, Santaguida M, Berube G, Nepveu A. Expression of N terminal ly truncated isoforms of CDP/CUX is increased in human uterine leiomyomas. Int J Cancer. 2002;100:429 32. 89. Goulet B, Truscott M, Nepveu A. A novel proteolytically processed CDP/Cux isoform of 90 kDa is generated by cathepsin L. Biol Chem. 2006;387:1285 93. 90. Kedinger V, Sansregret L, Harada R, Vadnais C, Cadieux C, Fathers K, et al. p110 CUX1 homeodomain protein stimulates cell migration and invasion in part through a regulatory cascade culminating in the repression of E cadherin and occludin. J Biol C hem. 2009;284:27701 11. 91. Grotsky DA, Gonzalez Suarez I, Novell A, Neumann MA, Yaddanapudi SC, Croke M, et al. BRCA1 loss activates cathepsin L mediated degradation of 53BP1 in breast cancer cells. J Cell Biol. 2013;200:187 202. 92. Snouwaert JN, Gowen L C, Latour AM, Mohn AR, Xiao A, DiBiase L, et al. BRCA1 deficient embryonic stem cells display a decreased homologous recombination frequency and an increased frequency of non homologous recombination that is corrected by expression of a brca1 transgene. On cogene. 1999;18:7900 7. 93. Bouwman P, Aly A, Escandell JM, Pieterse M, Bartkova J, van der Gulden H, et al. 53BP1 loss rescues BRCA1 deficiency and is associated with triple negative and BRCA mutated breast cancers. Nat Struct Mol Biol. 2010;17:688 95. 94 . Ward IM, Minn K, van Deursen J, Chen J. p53 Binding protein 53BP1 is required for DNA damage responses and tumor suppression in mice. Mol Cell Biol. 2003;23:2556 63. 95. Gonzalez Suarez I, Redwood AB, Grotsky DA, Neumann MA, Cheng EH, Stewart CL, et al. A new pathway that regulates 53BP1 stability implicates cathepsin L and vitamin D in DNA repair. EMBO J. 2011;30:3383 96. 96. Colella R, Jackson T, Goodwyn E. Matrigel invasion by the prostate cancer cell lines, PC3 and DU145, and cathepsin L+B activity. B iotech Histochem. 2004;79:121 7. 97. Baricos WH, Zhou Y, Mason RW, Barrett AJ. Human kidney cathepsins B and L. Characterization and potential role in degradation of glomerular basement membrane. Biochem J. 1988;252:301 4. 98. Ishidoh K, Kominami E. Procat hepsin L degrades extracellular matrix proteins in the presence of glycosaminoglycans in vitro. Biochem Biophys Res Commun. 1995;217:624 31.

PAGE 126

126 99. Mason RW, Johnson DA, Barrett AJ, Chapman HA. Elastinolytic activity of human cathepsin L. Biochem J. 1986;233: 925 7. 100. Novinec M, Grass RN, Stark WJ, Turk V, Baici A, Lenarcic B. Interaction between human cathepsins K, L, and S and elastins: mechanism of elastinolysis and inhibition by macromolecular inhibitors. J Biol Chem. 2007;282:7893 902. 101. Goretzki L, Schmitt M, Mann K, Calvete J, Chucholowski N, Kramer M, et al. Effective activation of the proenzyme form of the urokinase type plasminogen activator (pro uPA) by the cysteine protease cathepsin L. FEBS Lett. 1992;297:112 8. 102. Laurent Matha V, Derocq D, Prebois C, Katunuma N, Liaudet Coopman E. Processing of human cathepsin D is independent of its catalytic function and auto activation: involvement of cathepsins L and B. J Biochem. 2006;139:363 71. 103. Everts V, Korper W, Hoeben KA, Jansen ID, Bromme D, Cleutjens KB, et al. Osteoclastic bone degradation and the role of different cysteine proteinases and matrix metalloproteinases: differences between calvaria and long bone. J Bone Miner Res. 2006;21:1399 408. 104. Goretzki L, Schmitt M, Mann K, Calvete J, Chucholowski N, Kramer M, et al. Effective activation of the proenzyme form of the urokinase type plasminogen activator (pro uPA) by the cysteine protease cathepsin L. FEBS Lett. 1992;297:112 8. 105. Everts V, Korper W, Hoeben KA, Jansen ID, Bromme D, Cle utjens KB, et al. Osteoclastic bone degradation and the role of different cysteine proteinases and matrix metalloproteinases: differences between calvaria and long bone. J Bone Miner Res. 2006;21:1399 408. 106. Gocheva V, Zeng W, Ke D, Klimstra D, Reinheckel T, Peters C, et al. Distinct roles for cysteine cathepsin genes in multistage tumorigenesis. Genes Dev. 2006;20:543 56. 107. Frade R, Rodrigues Lima F, Huang S, Xie K, Guillaume N, Bar Eli M. Procathepsin L, a proteinase that cleaves human C3 (t he third component of complement), confers high tumorigenic and metastatic properties to human melanoma cells. Cancer Res. 1998;58:2733 6. 108. Jean D, Bar Eli M, Huang S, Xie K, Rodrigues Lima F, Hermann J, et al. A cysteine proteinase, which cleaves huma n C3, the third component of complement, is involved in tumorigenicity and metastasis of human melanoma. Cancer Res. 1996;56:254 8. 109. Rozhin J, Wade RL, Honn KV, Sloane BF. Membrane associated cathepsin L: a role in metastasis of melanomas. Biochem Biop hys Res Commun. 1989;164:556 61.

PAGE 127

127 110. Frade R, Rousselet N, Jean D. Intratumoral gene delivery of anti cathepsin L single chain variable fragment by lentiviral vector inhibits tumor progression induced by human melanoma cells. Cancer Gene Ther. 2008;15:591 604. 111. Jean D, Hermann J, Rodrigues Lima F, Barel M, Balbo M, Frade R. Identification on melanoma cells of p39, a cysteine proteinase that cleaves C3, the third component of complement: amino acid sequence identities with procathepsin L. Biochem J. 199 5;312 ( Pt 3):961 9. 112. Chen Q, Chen L, Zhao R, Yang XD, Imran K, Xing CG. Microarray analyses reveal liver metastasis related genes in metastatic colorectal cancer cell model. J Cancer Res Clin Oncol. 2013;139:1169 78. 113. Gillies RJ, Schornack PA, Sec omb TW, Raghunand N. Causes and effects of heterogeneous perfusion in tumors. Neoplasia. 1999;1:197 207. 114. Lunt SJ, Chaudary N, Hill RP. The tumor microenvironment and metastatic disease. Clin Exp Metastasis. 2009;26:19 34. 115. Schwickert G, Walenta S, Sundfor K, Rofstad EK, Mueller Klieser W. Correlation of high lactate levels in human cervical cancer with incidence of metastasis. Cancer Res. 1995;55:4757 9. 116. Walenta S, Wetterling M, Lehrke M, Schwickert G, Sundfor K, Rofstad EK, et al. High lactat e levels predict likelihood of metastases, tumor recurrence, and restricted patient survival in human cervical cancers. Cancer Res. 2000;60:916 21. 117. Sudhan DR, Siemann DW. Cathepsin L inhibition by the small molecule KGP94 suppresses tumor microenviron ment enhanced metastasis associated cell functions of prostate and breast cancer cells. Clin Exp Metastasis. 2013;30:891 902. 118. Cuvier C, Jang A, Hill RP. Exposure to hypoxia, glucose starvation and acidosis: effect on invasive capacity of murine tumor cells and correlation with cathepsin (L + B) secretion. Clin Exp Metastasis. 1997;15:19 25. 119. Thomssen C, Schmitt M, Goretzki L, Oppelt P, Pache L, Dettmar P, et al. Prognostic value of the cysteine proteases cathepsins B and cathepsin L in human breast cancer. Clin Cancer Res. 1995;1:741 6. 120. Thomssen C, Oppelt P, Janicke F, Ulm K, Harbeck N, Hofler H, et al. Identification of low risk node negative breast cancer patients by tumor biological factors PAI 1 and cathepsin L. Anticancer Res. 1998;18:2173 80. 121. Foekens JA, Kos J, Peters HA, Krasovec M, Look MP, Cimerman N, et al. Prognostic significance of cathepsins B and L in primary human breast cancer. J Clin Oncol. 1998;16:1013 21.

PAGE 128

128 122. Lah TT, Cercek M, Blejec A, Kos J, Gorodetsky E, Somers R, et al. Cathepsin B, a prognostic indicator in lymph node negative breast carcinoma patients: comparison with cathepsin D, cathepsin L, and other clinical indicators. Clin Cancer Res. 2000;6:578 84. 123. Lah TT, Kalman E, Najjar D, Gorodetsky E, Brennan P, Som ers R, et al. Cells producing cathepsins D, B, and L in human breast carcinoma and their association with prognosis. Hum Pathol. 2000;31:149 60. 124. Husmann K, Muff R, Bolander ME, Sarkar G, Born W, Fuchs B. Cathepsins and osteosarcoma: Expression analysi s identifies cathepsin K as an indicator of metastasis. Mol Carcinog. 2008;47:66 73. 125. Damiens C, Grimaud E, Rousselle AV, Charrier C, Fortun Y, Heymann D, et al. Cysteine protease production by human osteosarcoma cells (MG63, SAOS2) and its modulation by soluble factors. Cytokine. 2000;12:539 42. 126. Krueger S, Kellner U, Buehling F, Roessner A. Cathepsin L antisense oligonucleotides in a human osteosarcoma cell line: effects on the invasive phenotype. Cancer Gene Ther. 2001;8:522 8. 127. Park IC, Lee SY, Jeon DG, Lee JS, Hwang CS, Hwang BG, et al. Enhanced expression of cathepsin L in metastatic bone tumors. J Korean Med Sci. 1996;11:144 8. 128. Weber E, Gunther D, Laube F, Wiederanders B, Kirschke H. Hybridoma cells producing antibodies to cathepsin L have greatly reduced potential for tumour growth. J Cancer Res Clin Oncol. 1994;120:564 7. 129. Kirschke H, Eerola R, Hopsu Havu VK, Bromme D, Vuorio E. Antisense RNA inhibition of cathepsin L expression reduces tumorigenicity of malignant cells. Eur J Ca ncer. 2000;36:787 95. 130. Roodman GD. Mechanisms of bone metastasis. N Engl J Med. 2004;350:1655 64. 131. Raggatt LJ, Partridge NC. Cellular and molecular mechanisms of bone remodeling. J Biol Chem. 2010;285:25103 8. 132. Keller ET, Brown J. Prostate canc er bone metastases promote both osteolytic and osteoblastic activity. J Cell Biochem. 2004;91:718 29. 133. Zhang J, Dai J, Yao Z, Lu Y, Dougall W, Keller ET. Soluble receptor activator of nuclear factor kappaB Fc diminishes prostate cancer progression in b one. Cancer Res. 2003;63:7883 90. 134. Inoue H, Nishimura K, Oka D, Nakai Y, Shiba M, Tokizane T, et al. Prostate cancer mediates osteoclastogenesis through two different pathways. Cancer Lett. 2005;223:121 8.

PAGE 129

129 135. Roato I, D'Amelio P, Gorassini E, Grimaldi A, Bonello L, Fiori C, et al. Osteoclasts are active in bone forming metastases of prostate cancer patients. PLoS One. 2008;3:e3627. 136. Neville Webbe HL, Coleman RE. Bisphosphonates and RANK ligand inhibitors for the treatment and prevention of metastatic bone disease. Eur J Cancer. 2010;46:1211 22. 137. Clezardin P. Therapeutic targets for bone metastases in breast cancer. Breast Cancer Res. 2011;13:207. 138. Rachner TD, Hadji P, Hofbauer LC. Novel therapies in benign and malignant bone diseases . Pharmacol Ther. 2012;134:338 44. 139. Furuyama N, Fujisawa Y. Regulation of collagenolytic protease secretion through c Src in osteoclasts. Biochem Biophys Res Commun. 2000;272:116 24. 140. Furuyama N, Fujisawa Y. Regulation of collagenolytic cysteine pr otease synthesis by estrogen in osteoclasts. Steroids. 2000;65:371 8. 141. Cox SW, Eley BM, Kiili M, Asikainen A, Tervahartiala T, Sorsa T. Collagen degradation by interleukin 1beta stimulated gingival fibroblasts is accompanied by release and activation o f multiple matrix metalloproteinases and cysteine proteinases. Oral Dis. 2006;12:34 40. 142. Kakegawa H, Tagami K, Ohba Y, Sumitani K, Kawata T, Katunuma N. Secretion and processing mechanisms of procathepsin L in bone resorption. FEBS Lett. 1995;370:78 82 . 143. Tagami K, Kakegawa H, Kamioka H, Sumitani K, Kawata T, Lenarcic B, et al. The mechanisms and regulation of procathepsin L secretion from osteoclasts in bone resorption. FEBS Lett. 1994;342:308 12. 144. Goto T, Kiyoshima T, Moroi R, Tsukuba T, Nishim ura Y, Himeno M, et al. Localization of cathepsins B, D, and L in the rat osteoclast by immuno light and electron microscopy. Histochemistry. 1994;101:33 40. 145. Goto T, Tsukuba T, Kiyoshima T, Nishimura Y, Kato K, Yamamoto K, et al. Immunohistochemical localization of cathepsins B, D and L in the rat osteoclast. Histochemistry. 1993;99:411 4. 146. Kirschke H, Kembhavi AA, Bohley P, Barrett AJ. Action of rat liver cathepsin L on collagen and other substrates. Biochem J. 1982;201:367 72. 147. Maciewicz RA, Wotton SF, Etherington DJ, Duance VC. Susceptibility of the cartilage collagens types II, IX and XI to degradation by the cysteine proteinases, cathepsins B and L. FEBS Lett. 1990;269:189 93.

PAGE 130

130 148. Nakase T, Kaneko M, Tomita T, Myoui A, Ariga K, Sugamoto K , et al. Immunohistochemical detection of cathepsin D, K, and L in the process of endochondral ossification in the human. Histochem Cell Biol. 2000;114:21 7. 149. Leto G, Sepporta MV, Crescimanno M, Flandina C, Tumminello FM. Cathepsin L in metastatic bone disease: therapeutic implications. Biol Chem. 2010;391:655 64. 150. Lang TH, Willinger U, Holzer G. Soluble cathepsin L: a marker of bone resorption and bone density? J Lab Clin Med. 2004;144:163 6. 151. Lemaire R, Huet G, Zerimech F, Grard G, Fontaine C, Duquesnoy B, et al. Selective induction of the secretion of cathepsins B and L by cytokines in synovial fibroblast like cells. Br J Rheumatol. 1997;36:735 43. 152. Schedel J, Seemayer CA, Pap T, Neidhart M, Kuchen S, Michel BA, et al. Targeting cathepsin L (CL) by specific ribozymes decreases CL protein synthesis and cartilage destruction in rheumatoid arthritis. Gene Ther. 2004;11:1040 7. 153. Devauchelle V, Marion S, Cagnard N, Mistou S, Falgarone G, Breban M, et al. DNA microarray allows molecular profi ling of rheumatoid arthritis and identification of pathophysiological targets. Genes Immun. 2004;5:597 608. 154. Katunuma N, Tsuge H, Nukatsuka M, Fukushima M. Structure based development of cathepsin L inhibitors and therapeutic applications for preventio n of cancer metastasis and cancer induced osteoporosis. Adv Enzyme Regul. 2002;42:159 72. 155. Solau Gervais E, Zerimech F, Lemaire R, Fontaine C, Huet G, Flipo RM. Cysteine and serine proteases of synovial tissue in rheumatoid arthritis and osteoarthritis . Scand J Rheumatol. 2007;36:373 7. 156. Cawston TE, Young DA. Proteinases involved in matrix turnover during cartilage and bone breakdown. Cell Tissue Res. 2010;339:221 35. 157. Yamaguchi T, Naruishi K, Arai H, Nishimura F, Takashiba S. IL 6/sIL 6R enhanc es cathepsin B and L production via caveolin 1 mediated JNK AP 1 pathway in human gingival fibroblasts. J Cell Physiol. 2008;217:423 32. 158. Katunuma N, Tsuge H, Nukatsuka M, Asao T, Fukushima M. Structure based design of specific cathepsin inhibitors and their application to protection of bone metastases of cancer cells. Arch Biochem Biophys. 2002;397:305 11. 159. VanderWalde A, Hurria A. Aging and osteoporosis in breast and prostate cancer. CA Cancer J Clin. 2011;61:139 56. 160. Khan MN, Khan AA. Cancer treatment related bone loss: a review and synthesis of the literature. Curr Oncol. 2008;15:S30 40.

PAGE 131

131 161. Holroyd C, Cooper C, Dennison E. Epidemiology of osteoporosis. Best Pract Res Clin Endocrinol Metab. 2008;22:671 85. 162. Pfeilschifter J, Diel IJ. Oste oporosis due to cancer treatment: pathogenesis and management. J Clin Oncol. 2000;18:1570 93. 163. Reid IR. Glucocorticoid osteoporosis -mechanisms and management. Eur J Endocrinol. 1997;137:209 17. 164. Fogelman I, Blake GM, Blamey R, Palmer M, Sauerbrei W, Schumacher M, et al. Bone mineral density in premenopausal women treated for node positive early breast cancer with 2 years of goserelin or 6 months of cyclophosphamide, methotrexate and 5 fluorouracil (CMF). Osteoporos Int. 2003;14:1001 6. 165. Mincey BA, Duh MS, Thomas SK, Moyneur E, Marynchencko M, Boyce SP, et al. Risk of cancer treatment associated bone loss and fractures among women with breast cancer receiving aromatase inhibitors. Clin Breast Cancer. 2006;7:127 32. 166. Hadji P, Aapro MS, Body JJ , Bundred NJ, Brufsky A, Coleman RE, et al. Management of aromatase inhibitor associated bone loss in postmenopausal women with breast cancer: practical guidance for prevention and treatment. Ann Oncol. 2011;22:2546 55. 167. Saleh Y, Siewinski M, Kielan W, Ziolkowski P, Grybos M, Rybka J. Regulation of cathepsin B and L expression in vitro in gastric cancer tissues by egg cystatin. J Exp Ther Oncol. 2003;3:319 24. 168. Gianotti A, Sommer CA, Carmona AK, Henrique Silva F. Inhibitory effect of the sugarcane cystatin CaneCPI 4 on cathepsins B and L and human breast cancer cell invasion. Biol Chem. 2008;389:447 53. 169. Shridhar R, Zhang J, Song J, Booth BA, Kevil CG, Sotiropoulou G, et al. Cystatin M suppresses the malignant phenotype of human MDA MB 435S cell s. Oncogene. 2004;23:2206 15. 170. Levicar N, Dewey RA, Daley E, Bates TE, Davies D, Kos J, et al. Selective suppression of cathepsin L by antisense cDNA impairs human brain tumor cell invasion in vitro and promotes apoptosis. Cancer Gene Ther. 2003;10:141 51. 171. Yang Z, Cox JL. Cathepsin L increases invasion and migration of B16 melanoma. Cancer Cell Int. 2007;7:8. 172. Turk V, Turk B, Turk D. Lysosomal cysteine proteases: facts and opportunities. EMBO J. 2001;20:4629 33. 173. Sadaghiani AM, Verhelst SH, Gocheva V, Hill K, Majerova E, Stinson S, et al. Design, synthesis, and evaluation of in vivo potency and selectivity of epoxysuccinyl based inhibitors of papain family cysteine proteases. Chem Biol. 2007;14:499 511.

PAGE 132

132 174. Navab R, Mort JS, Brodt P. Inhibi tion of carcinoma cell invasion and liver metastases formation by the cysteine proteinase inhibitor E 64. Clin Exp Metastasis. 1997;15:121 9. 175. Elie BT, Gocheva V, Shree T, Dalrymple SA, Holsinger LJ, Joyce JA. Identification and pre clinical testing of a reversible cathepsin protease inhibitor reveals anti tumor efficacy in a pancreatic cancer model. Biochimie. 2010;92:1618 24. 176. Bell McGuinn KM, Garfall AL, Bogyo M, Hanahan D, Joyce JA. Inhibition of cysteine cathepsin protease activity enhances che motherapy regimens by decreasing tumor growth and invasiveness in a mouse model of multistage cancer. Cancer Res. 2007;67:7378 85. 177. Lopez Otin C, Matrisian LM. Emerging roles of proteases in tumour suppression. Nat Rev Cancer. 2007;7:800 8. 178. Cousse ns LM, Fingleton B, Matrisian LM. Matrix metalloproteinase inhibitors and cancer: trials and tribulations. Science. 2002;295:2387 92. 179. Kishore Kumar GD, Chavarria GE, Charlton Sevcik AK, Arispe WM, Macdonough MT, Strecker TE, et al. Design, synthesis, and biological evaluation of potent thiosemicarbazone based cathepsin L inhibitors. Bioorg Med Chem Lett. 2010;20:1415 9. 180. Katunuma N. Structure based development of specific inhibitors for individual cathepsins and their medical applications. Proc Jpn Acad Ser B Phys Biol Sci. 2011;87:29 39. 181. Song J, Jones LM, Chavarria GE, Charlton Sevcik AK, Jantz A, Johansen A, et al. Small molecule inhibitors of cathepsin L incorporating functionalized ring fused molecular frameworks. Bioorg Med Chem Lett. 2013 ;23:2801 7. 182. Torkar A, Lenarcic B, Lah T, Dive V, Devel L. Identification of new peptide amides as selective cathepsin L inhibitors: the first step towards selective irreversible inhibitors? Bioorg Med Chem Lett. 2013;23:2968 73. 183. Kumar GD, Chavarr ia GE, Charlton Sevcik AK, Yoo GK, Song J, Strecker TE, et al. Functionalized benzophenone, thiophene, pyridine, and fluorene thiosemicarbazone derivatives as inhibitors of cathepsin L. Bioorg Med Chem Lett. 2010;20:6610 5. 184. Troy AM, Sheahan K, Mulcahy HE, Duffy MJ, Hyland JM, O'Donoghue DP. Expression of Cathepsin B and L antigen and activity is associated with early colorectal cancer progression. Eur J Cancer. 2004;40:1610 6. 185. Jain M, Bakhshi S, Shukla AA, Chauhan SS. Cathepsins B and L in periphe ral blood mononuclear cells of pediatric acute myeloid leukemia: potential poor prognostic markers. Ann Hematol. 2010;89:1223 32.

PAGE 133

133 186. Miyamoto K, Iwadate M, Yanagisawa Y, Ito E, Imai J, Yamamoto M, et al. Cathepsin L is highly expressed in gastrointestina l stromal tumors. Int J Oncol. 2011;39:1109 15. 187. Watanabe M, Higashi T, Watanabe A, Osawa T, Sato Y, Kimura Y, et al. Cathepsin B and L activities in gastric cancer tissue: correlation with histological findings. Biochem Med Metab Biol. 1989;42:21 9. 1 88. Dohchin A, Suzuki JI, Seki H, Masutani M, Shiroto H, Kawakami Y. Immunostained cathepsins B and L correlate with depth of invasion and different metastatic pathways in early stage gastric carcinoma. Cancer. 2000;89:482 7. 189. Niedergethmann M, Wostbro ck B, Sturm JW, Willeke F, Post S, Hildenbrand R. Prognostic impact of cysteine proteases cathepsin B and cathepsin L in pancreatic adenocarcinoma. Pancreas. 2004;29:204 11. 190. Sulpizio S, Franceschini N, Piattelli A, Di Sebastiano P, Innocenti P, Selvag gi F. Cathepsins and pancreatic cancer: the 2012 update. Pancreatology. 2012;12:395 401. 191. Singh N, Das P, Datta Gupta S, Sahni P, Pandey RM, Gupta S, et al. Prognostic significance of extracellular matrix degrading enzymes cathepsin L and matrix metall oproteases 2 [MMP 2] in human pancreatic cancer. Cancer Invest. 2013;31:461 71. 192. Sivaparvathi M, Yamamoto M, Nicolson GL, Gokaslan ZL, Fuller GN, Liotta LA, et al. Expression and immunohistochemical localization of cathepsin L during the progression of human gliomas. Clin Exp Metastasis. 1996;14:27 34. 193. Xu X, Yuan G, Liu W, Zhang Y, Chen W. Expression of cathepsin L in nasopharyngeal carcinoma and its clinical significance. Exp Oncol. 2009;31:102 5. 194. Nakashima T, Yasumatsu R, Masuda M, Clayman GL, Komune S. Prognostic value of cathepsin L and its inhibitor headpin in oral squamous cell carcinoma. J Laryngol Otol. 2012;126:1134 7. 195. Macabeo Ong M, Shiboski CH, Silverman S, Ginzinger DG, Dekker N, Wong DT, et al. Quantitative analysis of cathep sin L mRNA and protein expression during oral cancer progression. Oral Oncol. 2003;39:638 47. 196. Harbeck N, Alt U, Berger U, Kruger A, Thomssen C, Janicke F, et al. Prognostic impact of proteolytic factors (urokinase type plasminogen activator, plasminog en activator inhibitor 1, and cathepsins B, D, and L) in primary breast cancer reflects effects of adjuvant systemic therapy. Clin Cancer Res. 2001;7:2757 64. 197. Jagodic M, Vrhovec I, Borstnar S, Cufer T. Prognostic and predictive value of cathepsins D a nd L in operable breast cancer patients. Neoplasma. 2005;52:1 9.

PAGE 134

134 198. Farinati F, Herszenyi L, Plebani M, Carraro P, De Paoli M, Cardin R, et al. Increased levels of cathepsin B and L, urokinase type plasminogen activator and its inhibitor type 1 as an ear ly event in gastric carcinogenesis. Carcinogenesis. 1996;17:2581 7. 199. Yan JA, Xiao H, Ji HX, Shen WH, Zhou ZS, Song B, et al. Cathepsin L is associated with proliferation and clinical outcome of urothelial carcinoma of the bladder. J Int Med Res. 2010;3 8:1913 22. 200. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin. 2010;60:277 300. 201. Abboud Jarrous G, Atzmon R, Peretz T, Palermo C, Gadea BB, Joyce JA, et al. Cathepsin L is responsible for processing and activation of prohep aranase through multiple cleavages of a linker segment. J Biol Chem. 2008;283:18167 76. 202. Wang M, Stearns ME. Isolation and characterization of PC 3 human prostatic tumor sublines which preferentially metastasize to select organs in S.C.I.D. mice. Diffe rentiation; research in biological diversity. 1991;48:115 25. 203. Rae JM, Creighton CJ, Meck JM, Haddad BR, Johnson MD. MDA MB 435 cells are derived from M14 melanoma cells -a loss for breast cancer, but a boon for melanoma research. Breast Cancer Res Tre at. 2007;104:13 9. 204. Chambers AF. MDA MB 435 and M14 cell lines: identical but not M14 melanoma? Cancer Res. 2009;69:5292 3. 205. Urquidi V, Sloan D, Kawai K, Agarwal D, Woodman AC, Tarin D, et al. Contrasting expression of thrombospondin 1 and osteopon tin correlates with absence or presence of metastatic phenotype in an isogenic model of spontaneous human breast cancer metastasis. Clin Cancer Res. 2002;8:61 74. 206. Turk B, Turk D, Turk V. Lysosomal cysteine proteases: more than scavengers. Biochim Biop hys Acta. 2000;1477:98 111. 207. Lee M, Fridman R, Mobashery S. Extracellular proteases as targets for treatment of cancer metastases. Chemical Society reviews. 2004;33:401 9. 208. Kos J, Krasovec M, Cimerman N, Nielsen HJ, Christensen IJ, Brunner N. Cyste ine proteinase inhibitors stefin A, stefin B, and cystatin C in sera from patients with colorectal cancer: relation to prognosis. Clin Cancer Res. 2000;6:505 11. 209. Strojan P, Oblak I, Svetic B, Smid L, Kos J. Cysteine proteinase inhibitor cystatin C in squamous cell carcinoma of the head and neck: relation to prognosis. British journal of cancer. 2004;90:1961 8.

PAGE 135

135 210. Kolwijck E, Massuger LF, Thomas CM, Span PN, Krasovec M, Kos J, et al. Cathepsins B, L and cystatin C in cyst fluid of ovarian tumors. J Ca ncer Res Clin Oncol. 2010;136:771 8. 211. Ervin H, Cox JL. Late stage inhibition of hematogenous melanoma metastasis by cystatin C over expression. Cancer Cell Int. 2005;5:14. 212. Fortenberry YM, Brandal S, Bialas RC, Church FC. Protein C inhibitor regula tes both cathepsin L activity and cell mediated tumor cell migration. Biochim Biophys Acta. 2010;1800:580 90. 213. Reiser J, Oh J, Shirato I, Asanuma K, Hug A, Mundel TM, et al. Podocyte migration during nephrotic syndrome requires a coordinated interplay between cathepsin L and alpha3 integrin. J Biol Chem. 2004;279:34827 32. 214. Chung JH, Im EK, Jin TW, Lee SM, Kim SH, Choi EY, et al. Cathepsin L derived from skeletal muscle cells transfected with bFGF promotes endothelial cell migration. Experimental & molecular medicine. 2011;43:179 88. 215. Duffy MJ. The role of proteolytic enzymes in cancer invasion and metastasis. Clin Exp Metastasis. 1992;10:145 55. 216. Laufs S, Schumacher J, Allgayer H. Urokinase receptor (u PAR): an essential player in multiple games of cancer: a review on its role in tumor progression, invasion, metastasis, proliferation/dormancy, clinical outcome and minimal residual disease. Cell Cycle. 2006;5:1760 71. 217. Chaudary N, Hill RP. Hypoxia and metastasis. Clin Cancer Res. 2007;13: 1947 9. 218. Walenta S, Salameh A, Lyng H, Evensen JF, Mitze M, Rofstad EK, et al. Correlation of high lactate levels in head and neck tumors with incidence of metastasis. Am J Pathol. 1997;150:409 15. 219. Cairns RA, Kalliomaki T, Hill RP. Acute (cyclic) hypoxia enhances spontaneous metastasis of KHT murine tumors. Cancer Res. 2001;61:8903 8. 220. Rofstad EK, Galappathi K, Mathiesen B, Ruud EB. Fluctuating and diffusion limited hypoxia in hypoxia induced metastasis. Clin Cancer Res. 2007;13:1971 8. 221. Ca rini R, Castino R, De Cesaris MG, Splendore R, Demoz M, Albano E, et al. Preconditioning induced cytoprotection in hepatocytes requires Ca(2+) dependent exocytosis of lysosomes. J Cell Sci. 2004;117:1065 77. 222. Schlappack OK, Zimmermann A, Hill RP. Glucose starvation and acidosis: effect on experimental metastatic potential, DNA content and MTX resistance of murine tumour cells. British journal of cancer. 1991;64:663 70.

PAGE 136

136 223. Steffan JJ, Snider JL, Skalli O, Welbourne T, Cardelli JA. Na+/H+ exchanger s and RhoA regulate acidic extracellular pH induced lysosome trafficking in prostate cancer cells. Traffic (Copenhagen, Denmark). 2009;10:737 53. 224. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646 74. 225. Siemann DW. The unique characteristics of tumor vasculature and preclinical evidence for its selective disruption by Tumor Vascular Disrupting Agents. Cancer Treat Rev. 2011;37:63 74. 226. Weidner N, Semple JP, Welch WR, Folkman J. Tumor angiogenesis and metastasis -correlation in invasive breast carcinoma. N Engl J Med. 1991;324:1 8. 227. Burden RE, Gormley JA, Jaquin TJ, Small DM, Quinn DJ, Hegarty SM, et al. Antibody mediated inhibition of cathepsin S blocks colorectal tumor invasion and angiogenesis. Clin Cancer R es. 2009;15:6042 51. 228. Lakka SS, Gondi CS, Yanamandra N, Olivero WC, Dinh DH, Gujrati M, et al. Inhibition of cathepsin B and MMP 9 gene expression in glioblastoma cell line via RNA interference reduces tumor cell invasion, tumor growth and angiogenesis . Oncogene. 2004;23:4681 9. 229. Gyorffy B, Lanczky A, Eklund AC, Denkert C, Budczies J, Li Q, et al. An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients. Breast C ancer Res Treat. 2010;123:725 31. 230. Siemann DW, Norris CM, Ryan A, Shi W. Impact of tumor cell VEGF expression on the in vivo efficacy of vandetanib (ZACTIMA; ZD6474). Anticancer Res. 2009;29:1987 92. 231. Eilken HM, Adams RH. Dynamics of endothelial ce ll behavior in sprouting angiogenesis. Curr Opin Cell Biol. 2010;22:617 25. 232. van Hinsbergh VW, Koolwijk P. Endothelial sprouting and angiogenesis: matrix metalloproteinases in the lead. Cardiovasc Res. 2008;78:203 12. 233. Arnaoutova I, Kleinman HK. In vitro angiogenesis: endothelial cell tube formation on gelled basement membrane extract. Nat Protoc. 2010;5:628 35. 234. Zhang J, Wang P, Huang YB, Li J, Zhu J, Luo X, et al. Plasma cathepsin L and its related pro/antiangiogenic factors play useful roles in predicting rich coronary collaterals in patients with coronary heart disease. J Int Med Res. 2010;38:1389 403. 235. Sun J, Sukhova GK, Zhang J, Chen H, Sjoberg S, Libby P, et al. Cathepsin L activity is essential to elastase perfusion induced abdominal aortic aneurysms in mice. Arterioscler Thromb Vasc Biol. 2011;31:2500 8.

PAGE 137

137 236. Tamada Y, Fukiage C, Boyle DL, Azuma M, Shearer TR. Involvement of cysteine proteases in bFGF induced angiogenesis in guinea pig and rat cornea. J Ocul Pharmacol Ther. 2000;16:27 1 83. 237. Urbich C, Heeschen C, Aicher A, Sasaki K, Bruhl T, Farhadi MR, et al. Cathepsin L is required for endothelial progenitor cell induced neovascularization. Nat Med. 2005;11:206 13. 238. Handsley MM, Edwards DR. Metalloproteinases and their inhibit ors in tumor angiogenesis. Int J Cancer. 2005;115:849 60. 239. Rebbaa A, Chu F, Sudha T, Gallati C, Dier U, Dyskin E, et al. The anti angiogenic activity of NSITC, a specific cathepsin L inhibitor. Anticancer Res. 2009;29:4473 81. 240. Yu Q, Stamenkovic I. Cell surface localized matrix metalloproteinase 9 proteolytically activates TGF beta and promotes tumor invasion and angiogenesis. Genes Dev. 2000;14:163 76. 241. Yu WH, Woessner JF, Jr., McNeish JD, Stamenkovic I. CD44 anchors the assembly of matrilysin/ MMP 7 with heparin binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling. Genes Dev. 2002;16:307 23. 242. Norgaard M, Jensen AO, Jacobsen JB, Cetin K, Fryzek JP, Sorensen HT. Skeletal related events, bone me tastasis and survival of prostate cancer: a population based cohort study in Denmark (1999 to 2007). J Urol. 2010;184:162 7. 243. Soloway MS, Hardeman SW, Hickey D, Raymond J, Todd B, Soloway S, et al. Stratification of patients with metastatic prostate ca ncer based on extent of disease on initial bone scan. Cancer. 1988;61:195 202. 244. Msaouel P, Pissimissis N, Halapas A, Koutsilieris M. Mechanisms of bone metastasis in prostate cancer: clinical implications. Best Pract Res Clin Endocrinol Metab. 2008;22: 341 55. 245. Carlin BI, Andriole GL. The natural history, skeletal complications, and management of bone metastases in patients with prostate carcinoma. Cancer. 2000;88:2989 94. 246. Colella R, Casey SF. Decreased activity of cathepsins L + B and decreased invasive ability of PC3 prostate cancer cells. Biotech Histochem. 2003;78:101 8. 247. Nomura T, Katunuma N. Involvement of cathepsins in the invasion, metastasis and proliferation of cancer cells. J Med Invest. 2005;52:1 9. 248. Kakegawa H, Nikawa T, Taga mi K, Kamioka H, Sumitani K, Kawata T, et al. Participation of cathepsin L on bone resorption. FEBS Lett. 1993;321:247 50.

PAGE 138

138 249. Mundy GR. Mechanisms of bone metastasis. Cancer. 1997;80:1546 56. 250. Leventis AK, Shariat SF, Kattan MW, Butler EB, Wheeler TM , Slawin KM. Prediction of response to salvage radiation therapy in patients with prostate cancer recurrence after radical prostatectomy. J Clin Oncol. 2001;19:1030 9. 251. Chen BT, Wood DP, Jr. Salvage prostatectomy in patients who have failed radiation therapy or cryotherapy as primary treatment for prostate cancer. Urology. 2003;62 Suppl 1:69 78. 252. Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, et al. Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients. Hum Patho l. 2000;31:578 83. 253. Le Gall C, Bellahcene A, Bonnelye E, Gasser JA, Castronovo V, Green J, et al. A cathepsin K inhibitor reduces breast cancer induced osteolysis and skeletal tumor burden. Cancer Res. 2007;67:9894 902. 254. Fizazi K, Bosserman L, Gao G, Skacel T, Markus R. Denosumab treatment of prostate cancer with bone metastases and increased urine N telopeptide levels after therapy with intravenous bisphosphonates: results of a randomized phase II trial. J Urol. 2013;189:S51 7; discussion S7 8. 255 . Fizazi K, Carducci M, Smith M, Damiao R, Brown J, Karsh L, et al. Denosumab versus zoledronic acid for treatment of bone metastases in men with castration resistant prostate cancer: a randomised, double blind study. Lancet. 2011;377:813 22. 256. Fournier PG, Stresing V, Ebetino FH, Clezardin P. How do bisphosphonates inhibit bone metastasis in vivo? Neoplasia. 2010;12:571 8. 257. Smith MR, McGovern FJ, Zietman AL, Fallon MA, Hayden DL, Schoenfeld DA, et al. Pamidronate to prevent bone loss during androgen deprivation therapy for prostate cancer. N Engl J Med. 2001;345:948 55. 258. Zheng X, Chu F, Chou PM, Gallati C, Dier U, Mirkin BL, et al. Cathepsin L inhibition suppresses drug resistance in vitro and in vivo: a putative mechanism. Am J Physiol Cell Phys iol. 2009;296:C65 74. 259. Shimada N, Ohno Matsui K, Iseki S, Koike M, Uchiyama Y, Wang J, et al. Cathepsin L in bone marrow derived cells is required for retinal and choroidal neovascularization. Am J Pathol. 2010;176:2571 80. 260. Fizazi K, Yang J, Peleg S, Sikes CR, Kreimann EL, Daliani D, et al. Prostate cancer cells osteoblast interaction shifts expression of growth/survival related genes in prostate cancer and reduces expression of osteoprotegerin in osteoblasts. Clin Cancer Res. 2003;9:2587 97.

PAGE 139

139 261. Berruti A, Dogliotti L, Bitossi R, Fasolis G, Gorzegno G, Bellina M, et al. Incidence of skeletal complications in patients with bone metastatic prostate cancer and hormone refractory disease: predictive role of bone resorption and formation markers evalu ated at baseline. J Urol. 2000;164:1248 53. 262. Coleman RE, Major P, Lipton A, Brown JE, Lee KA, Smith M, et al. Predictive value of bone resorption and formation markers in cancer patients with bone metastases receiving the bisphosphonate zoledronic aci d. J Clin Oncol. 2005;23:4925 35. 263. Yoneda T, Hiraga T. Crosstalk between cancer cells and bone microenvironment in bone metastasis. Biochem Biophys Res Commun. 2005;328:679 87. 264. Woo JT, Yamaguchi K, Hayama T, Kobori T, Sigeizumi S, Sugimoto K, et al. Suppressive effect of N (benzyloxycarbonyl) L phenylalanyl L tyrosinal on bone resorption in vitro and in vivo. Eur J Pharmacol. 1996;300:131 5. 265. Yasuma T, Oi S, Choh N, Nomura T, Furuyama N, Nishimura A, et al. Synthesis of peptide aldehyde deri vatives as selective inhibitors of human cathepsin L and their inhibitory effect on bone resorption. J Med Chem. 1998;41:4301 8. 266. Ishikawa T, Kamiyama M, Tani Ishii N, Suzuki H, Ichikawa Y, Hamaguchi Y, et al. Inhibition of osteoclast differentiation and bone resorption by cathepsin K antisense oligonucleotides. Mol Carcinog. 2001;32:84 91. 267. Zhang J, Dai J, Qi Y, Lin DL, Smith P, Strayhorn C, et al. Osteoprotegerin inhibits prostate cancer induced osteoclastogenesis and prevents prostate tumor gro wth in the bone. J Clin Invest. 2001;107:1235 44. 268. Shahinian VB, Kuo YF, Freeman JL, Goodwin JS. Risk of fracture after androgen deprivation for prostate cancer. N Engl J Med. 2005;352:154 64. 269. Sharifi N, Gulley JL, Dahut WL. Androgen deprivation therapy for prostate cancer. JAMA. 2005;294:238 44. 270. Zheng X, Chou PM, Mirkin BL, Rebbaa A. Senescence initiated reversal of drug resistance: specific role of cathepsin L. Cancer Res. 2004;64:1773 80. 271. Blum G, von Degenfeld G, Merchant MJ, Blau HM, Bogyo M. Noninvasive optical imaging of cysteine protease activity using fluorescently quenched activity based probes. Nat Chem Biol. 2007;3:668 77. 272. Paulick MG, Bogyo M. Application of activity based probes to the study of enzymes involved in can cer progression. Curr Opin Genet Dev. 2008;18:97 106.

PAGE 140

140 273. Verdoes M, Oresic Bender K, Segal E, van der Linden WA, Syed S, Withana NP, et al. Improved quenched fluorescent probe for imaging of cysteine cathepsin activity. J Am Chem Soc. 2013;135:147 26 30.

PAGE 141

141 BIOGRAPHICAL SKETCH Dhivya Raja Sudhan obtained her Bachelor and Master of Science degrees in Biotechnology from Mumbai University, India. During the course of her baccalaureate and post baccalaureate studies she underwent several summer training programs and internships to deepen her understanding of life sciences and cancer biology. Ms. Sudhan joined the interdisciplinary program offered by the college of medicine, University of Florida in 2009 and obtained her Ph.D. in Medical sciences in 2014. Under the mentorship of Dr. Dietmar W. Siemann, she has presented her work at several national and international meetings such as the American association for cancer research, Molecular targets and cancer therapeutics meeting, Tumor invasion and metastasi s meeting and has also actively participated in the annual College of medicine research day, Shands cancer center poster day and Graduate student research day. Her hard work and dedication to cancer research has been recognized in the form of several honor s and awards such as Grinter fellowship, O utstanding academic achievement award, M edical guild research incentive award, B est pre doctoral poster award at the Shands cancer center research day, J unior investigator award at the Tumor microenvironment meeting, B est poster award at the graduate student research day and Madelyn Lockhart fellowship and emerging scholar finalist award. To instill her passion for research amongst highly motivated future scientists, she has been actively school students as a part of the Student science training program offered by the University of Florida.