Citation
Identification and Characterization of New Components of the Salicylic Acid Signaling Pathway in Arabidopsis

Material Information

Title:
Identification and Characterization of New Components of the Salicylic Acid Signaling Pathway in Arabidopsis
Creator:
Ding, Yezhang
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (160 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
MOU,ZHONGLIN
Committee Co-Chair:
GURLEY,WILLIAM B
Committee Members:
LARKIN,JOSEPH,III
KANG,BYUNG-HO
ROLLINS,JEFFREY A
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Biosynthesis ( jstor )
Disease resistance ( jstor )
Genes ( jstor )
Infections ( jstor )
Leaves ( jstor )
Pathogens ( jstor )
Plant cells ( jstor )
Plant immunity ( jstor )
Plants ( jstor )
Signals ( jstor )
Microbiology and Cell Science -- Dissertations, Academic -- UF
aba -- arabidopsis -- immunity -- npr1 -- sa -- sar
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Microbiology and Cell Science thesis, Ph.D.

Notes

Abstract:
Plants have evolved inducible immune systems to prevent pathogen infection. Salicylic acid (SA) is an important plant defense signal molecule produced after pathogen infection to induce systemic acquired resistance (SAR), which confers immunity to a broad-spectrum of pathogens. However, where and how SA is synthesized in plant cells still remains elusive. Identification of new components involved in pathogen-induced SA accumulation would help understand the SA biology. In this study, a total of 35,000 M2 plants in the npr1-3 mutant background were individually tested for pathogen-induced SA accumulation using a biosensor-based SA quantification method. Among the mutants identified, 17 accumulated lower levels of SA than npr1-3 (lsn) and two produced higher levels of SA than npr1-3 (hsn) during pathogen infection. Complementation tests indicated that seven of the lsn mutants are new alleles of eds5/sid1, two are eds16/sid2 alleles, and one is allelic to pad4. The remaining are likely new lsn and hsn mutants. Through map-based cloning, HSN2 was shown to encode ABA3. Characterization of aba3 npr1 double mutants revealed that abscisic acid (ABA) is a negative regulator of SA biosynthesis. Plants with elevated levels of ABA exhibit compromised defense responses, whereas disruption of ABA signaling constitutively activates basal resistance. Interestingly, disruption of ABA signaling also compromises further induction of defense responses. Thus, ABA appears to play both positive and negative functions in plant immunity. This study further showed that ABA regulates plant immunity by controlling the stability of NPR1 protein. In un-induced cells, basal ABA and SA antagonistically determine the basal level of NPR1. Upon SAR induction, pathogen-induced SA attenuates NPR1 degradation, leading to NPR1 accumulation, whereas ABA-mediated NPR1 degradation may promote defense gene transcription. When SA concentrations decrease, ABA drives NPR1 disappearance, which in turn shuts off defense gene transcription. Shifting either ABA or SA signaling perturbs the biphasic changes of NPR1 concentrations, consequently altering the dynamic pattern of defense gene transcription. Our data demonstrate that SA and ABA cooperate to regulate SAR by controlling the homeostasis of the key SAR regulator NPR1. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: MOU,ZHONGLIN.
Local:
Co-adviser: GURLEY,WILLIAM B.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Yezhang Ding.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Resource Identifier:
968131543 ( OCLC )
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 IDENTIFICATION AND CHARACTERIZATION OF NEW COMPONENTS OF THE SA LICYLIC ACID SIGNALING PATHWAY IN ARABIDOPSIS By YEZHANG DING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2 © 2014 Yezhang Ding

PAGE 3

3 To my wife, Dongyan Chen, and my daughter, Rebecca Ding, for their unconditional love and support

PAGE 4

4 ACKNOWLEDGMENTS First , I would like to express my deepest gratitude to my advisor, Dr. Zhonglin Mou, for his inspiration, guidance, patience, and support during the past four and a half years. He is always available for questions and discussions. His logi c, precision, and insight greatly influenced me. I would also like to thank the members of my committee: Drs. William Gurley, Joseph Larkin III, Byung Ho Kang, and Jeffrey Rollins for their advice, attention, and time. I want to thank Mrs. Xudong Zhang for her help with my experiments during these years . I would like to lab for creating a friendly and pleasant environment: D r s . Yongsheng Wang, Chuanfu A n, Chenggang Wang, Minqi Zh ou, and Christopher Defraia. I am very grateful to Dr. Yongsheng Wang for his valuable help. Special thank s go to Danjela Shaholli, Calli Breil, and Deepak Sathyanarayan for their help during the mutant screen. I thank my colleagues in the Department of Mi crobiology and Cell Science for technical help, use of equipment, and helpful discussions. I appreciate Dr. Sixue Chen for letting me use the HPLC equipment. I want to thank all my friends accompanying me in Gainesville. The love and support of my famil y have been instrumental towards my success in graduate school. My father, brother, and sister have given me their everlasting support. Although my mother has passed, I still feel her presence and dedicate my work to her . M ost importantly , I thank my wife, Dongyan Chen, for helping me through all the good and bad times. Her love, support and constant patience have taught me so much. I would like to thank my three year old daughter, Rebecca Ding, for her understanding. their fathers , and never bothers me when I am working . I owe her too much.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 ABSTRACT ................................ ................................ ................................ ................... 11 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 13 Plant Immune System ................................ ................................ ............................. 13 The Arabidopsis thaliana / Pseudomonas syringae Pathosystem ...................... 14 Pathogenesis Mechanisms of P. syringae ................................ ........................ 14 Plant Disease Resistance Mechanisms ................................ ............................ 16 PAMP triggered Immunity ................................ ................................ ................ 17 Effector triggered Immunity ................................ ................................ .............. 18 Hypersensitive Response ................................ ................................ ................. 19 Systemic Acquired Resistance ................................ ................................ ......... 20 Salicylic Acid and Its Function in Plant Immunity ................................ .................... 25 SA Acts as an Important Signal Molecule in Plant Defense Responses .......... 25 SA Biosynthesis in Plants ................................ ................................ ................. 26 SA Metabolism ................................ ................................ ................................ . 29 Regulation of SA Accumulation ................................ ................................ ........ 32 The NPR1 Protein ................................ ................................ ................................ ... 37 Proteosome mediated NPR1 Protein Degradation ................................ ........... 39 SA Receptors ................................ ................................ ................................ ... 40 NPR1 interacting Proteins ................................ ................................ ................ 43 Th e Role of ABA in Plant Immunity ................................ ................................ ......... 44 Biosynthesis and Catabolism of ABA in Plants ................................ ................. 45 ABA Signal Transduction ................................ ................................ .................. 46 The Negative Role of ABA in Plant Defense ................................ .................... 46 The Positive Role of ABA in Plant Defense ................................ ...................... 48 Antagonistic Interactions between SA and ABA ................................ ............... 49 Goals and Objectives of This Study ................................ ................................ ........ 51 2 A FORWARD GENETIC SCREEN FOR MUTANTS WITH ALTERED SA LEVELS DURING PATHOGEN INFECTION IN ARABIDOPSIS ............................ 52 Background Information ................................ ................................ .......................... 52 Results ................................ ................................ ................................ .................... 54 Genetic Screen for SA Accumulation Mutants ................................ .................. 54 Confirmation of the SA Accumulation Mutants Using HPLC ............................. 55

PAGE 6

6 Pathogen Resistance Test for the SA Accumulation Mutants .......................... 55 Allelism Test ................................ ................................ ................................ ..... 56 Discussion ................................ ................................ ................................ .............. 56 Materials and Methods ................................ ................................ ............................ 58 Plant Materials and Growth Conditions ................................ ............................ 58 Bacterial Strains and Pathogen Infection ................................ .......................... 58 Measurement of SA Using the Biosensor based Method ................................ . 59 Measurement of SA with the HPLC Method ................................ ..................... 59 3 ABA IS A KEY REGULATOR OF PLANT IMMUNITY ................................ ............ 64 Results ................................ ................................ ................................ .................... 64 Isolation and Characterization of hsn2 npr1 3 ................................ .................. 64 HSN2 Encodes ABA3 ................................ ................................ ....................... 65 Disruption of ABA Signaling Confers NPR1 Dependent Resistance ................ 67 SA is Essential for aba3 Mediated Resistance to Psm ES4326 ....................... 68 High ABA Compromises Defense Responses in Arabidopsis .......................... 69 ABA Has a Positive Function in Full Induction of Defense Reponses .............. 70 Discussion ................................ ................................ ................................ .............. 71 Materials and Methods ................................ ................................ ............................ 74 Plant Materials and Growth Conditions ................................ ............................ 74 Map based Cloning ................................ ................................ .......................... 74 SA Measure ment ................................ ................................ .............................. 75 ABA Treatment ................................ ................................ ................................ . 75 ABA Measurement ................................ ................................ ........................... 75 Bacterial Strains and Pathogen Infection ................................ .......................... 76 RNA Extraction and Real Time PCR ................................ ................................ 76 Stat istics ................................ ................................ ................................ ........... 77 Accession Numbers ................................ ................................ ......................... 78 4 ABA AND SA COOPERATE TO REGULATE THE HOMEOSTASIS OF THE TRANSCRIPTION COACTIVATOR NPR1 IN PLANT IMMUNITY ......................... 89 Background Information ................................ ................................ .......................... 89 Results ................................ ................................ ................................ .................... 91 ABA Negatively Regulates NPR1 Protein Accumulation ................................ .. 91 ABA Triggers NPR1 Degradation via the 26S Proteasome Pathway ............... 93 SA Decelerates ABA Promoted NPR1 Degradation ................................ ......... 95 ABA Induced NPR1 Degradation Dampens Defense Responses after Pathogen Infection Subsides ................................ ................................ ......... 97 SA Suppresses ABA Signaling P ossibly through Phosphorylation of NPR1 .. 100 Discussion ................................ ................................ ................................ ............ 101 Materials and Methods ................................ ................................ .......................... 106 Plant Materials and Growth Conditions ................................ .......................... 106 Pathogen Infection ................................ ................................ ......................... 107 Chemical Treatment ................................ ................................ ....................... 107 SA and ABA Measurement ................................ ................................ ............. 108

PAGE 7

7 Prot ein Analysis ................................ ................................ .............................. 108 RNA Extraction and Real Time PCR ................................ .............................. 109 Seed Germination and Seedling Establishment Assays ................................ . 109 Statistics ................................ ................................ ................................ ......... 109 Accession Numbers ................................ ................................ ....................... 109 5 SUMMARY AND CONCLUSIONS ................................ ................................ ........ 132 APPENDIX : TABLES ................................ ................................ ................................ .. 136 REFERENCES ................................ ................................ ................................ ............ 138 BIOGRAPHICAL SKE TCH ................................ ................................ .......................... 160

PAGE 8

8 LIST OF TABLES Table page 2 1 Mutants identified in this screen ................................ ................................ ......... 63 A 1 Primers used for fine mapping. ................................ ................................ ......... 136 A 2 Primers used for mutant genotyping. ................................ ................................ 136 A 3 Primers used for qPCR in this study. ................................ ................................ 137 A 4 Primers for identification of the splicing site change in aba3 21 . ...................... 137 A 5 Primers for identification of homozygousT DNA insertion lines. ....................... 137

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Free SA levels of SA mutants.. ................................ ................................ ........... 61 2 2 Pathogen growth in the SA mutants. ................................ ................................ .. 62 3 1 Isolation of the hsn2 npr1 3 mutant. ................................ ................................ ... 79 3 2 Defense phenotypes of the hsn2 npr1 3 mutant. ................................ ................ 80 3 3 Map based cloning of hsn2 . ................................ ................................ ............... 81 3 4 Disruption of ABA signaling confers NPR1 dependent defense responses. ....... 84 3 5 SA is required for ABA deficiency mediated disease resistance. ....................... 85 3 6 High ABA suppresses defense responses in Arabidopsis. ................................ . 86 3 7 ABA signaling is required for the full Induction of NPR1 target genes. ............... 87 4 1 Real time PCR analysis of RAB18 (A) and NPR1 (B) expression in wild type plants treated by ABA. ................................ ................................ ...................... 110 4 2 ABA promotes NPR1 degradation in Arabidopsis. ................................ ............ 111 4 3 NPR1 protein levels in wild type (WT) and aba3 plants. ................................ ... 113 4 4 ABA promotes NPR1 degradation via the 26S proteasome pathway. .............. 114 4 5 ABA promoted NPR1 degradation requires a CUL3 based E3 ligase. ............. 115 4 6 ABA promotes deg radation of NPR1 monomer in the nucleus. ........................ 116 4 7 ABA and SA affect nuclear localization of NPR1. ................................ ............. 117 4 8 ABA negatively affects NPR1 protein accumulation in the presence of SA. ..... 118 4 9 Endogenous ABA promotes NPR1 degradation in the presence of SA. ........... 119 4 10 SA de celerates ABA promoted NPR1 degradation. ................................ ......... 120 4 11 Phosphorylation decelerates ABA triggered NPR1 turnover. ........................... 121 4 12 Quantification of ABA and SA levels in systemic tissues of wild type and aba3 21 plants during Psm ES4326 infection. ................................ .................. 122

PAGE 10

10 4 13 NPR1 protein accumulation and PR1 gene expression in systemic tissues of wild type and aba3 21 plants during Psm ES4326 infection. . ........................... 123 4 14 SA and ABA regulates NPR1 protein accumulation and PR1 gene expression (mimic experiment). ................................ ................................ .......................... 124 4 15 Phosphorylation stabilizes NPR1 during SAR induction. ................................ .. 125 4 16 Perturbation of either SA or ABA signaling during pathogen induction affects SAR. ................................ ................................ ................................ ................. 126 4 17 Phosphorylated NPR1 negatively regulates ABA responses. ........................... 128 4 18 The effect of basal SA and ABA levels on the accumulation of the Myc NPR1 protein. ................................ ................................ ................................ ............. 130 4 19 Working model for the regulation of SAR through NPR1 by different levels of SA and ABA. ................................ ................................ ................................ ..... 131

PAGE 11

11 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IDENTIFICATION AND CHARACTERIZATION OF NEW COMPONENTS OF THE SA LICYLIC ACID SIGNALING PATHWAY IN ARABIDOPSIS By Yezhang Ding A u gust 2014 Chair: Zhonglin Mou Major: Microbiology and Cell Science Plants have evolved inducible immune system s to prevent pathogen infection. Salicylic acid (SA) is an important plant defense signal molecule produced after pathogen infection to induce s ystemic acquired resistance (SAR), which confers immunity to a broad spectrum of pathogens. However, where and how SA is synthesized in plant cells still remain s elusive. Identification of new components involved in pathogen induced SA accumulation would h elp understand the SA biology . In this study, a total of 35,000 M2 plants in the npr1 3 mutant background were individually tested for pathogen induced SA accumulation using a biosensor based SA quantification method. Among the mutants identified, 17 accumulate d lower levels of SA than npr1 3 ( lsn ) and two produce d higher levels of SA than n pr1 3 ( hsn ) during pathogen infection. Complementation tests indicated that seven of the lsn mutants are new alleles of eds5 / sid1 , two are eds16 / sid2 alleles, and one is allelic to pad4 . The remaining are likely new lsn and hsn mutants. Through map based cloning, HSN2 was shown to encode ABA3. Characterization of aba3 npr1 double mutant s revealed that abscisic acid (ABA) is a

PAGE 12

12 negative regulator of SA biosynthesis. Plants with elevated levels of ABA exhibit compromised defense responses, whereas disruption of ABA signaling constitutively activates basal resistance. Interestingly, disruption of ABA signaling also compromises further induction of defense responses. Thus, ABA appears to play both positive and negative functions in plant immunity. Th is study further showed that ABA regulates plant immunity by controlling the stability of NPR1 protein . In un induced cells, basal ABA and SA antagonistically determine the basal level of NPR1. Upon SAR induction, pathogen induced SA attenuates NPR1 degrad ation, leading to NPR1 accumulation, whereas ABA mediated NPR1 degradation may promote defense gene transcription. When SA concentrations decrease, ABA drives NPR1 disappearance, which in turn shuts off defense gene transcription. Shifting either ABA or SA signaling perturbs the biphasic changes of NPR1 concentrations, consequently altering the dynamic pattern of defense gene transcription. Our data demonstrate that SA and ABA cooperate to regulate SAR by controlling the homeostasis of the key SAR regulator NPR1.

PAGE 13

13 CHAPTER 1 LITERATURE REVIEW Plant Immune System Although science has significantly improved human life, there are still more than 800 million people in the world lacking access to sufficient food. Plants supply most of the food. However, more than 10% of food production is lost due to plant disease, whi ch is one of the major limiting factors for plant based food production (Richard and Peter, 2005). In addition, disease also results in lower food quality. As a result, farmers rely on all kinds of chemicals that could negatively influence both the economi cs of farming and the global environment. Moreover , pathogens could rapidly develop resistance to these chemicals. Therefore, one of the eco friendly ways to fight crop diseases is to employ Plants are sessile organi sms under constant attack from microbes, such as bacteria, fungi, oomycetes, and viruses ( Agrios, 1997 ). Most microbes fail to infect plants to cause disease since their entry is prevented by preformed and constitutive defenses such as the waxy cuticle on the surface, the cell wall, the plasma membrane, and a wide variety of chemical barriers. However, pathogens have developed different strategies to gain entry by destroying these preformed and constitutive defenses. Generally, plant pathogens can be classi fied into biotrophs, necrotrophs and hemibiotrophs based on their nutrient acquisition strategies (Glazebrook, 2005). Biotrophic pathogens persist and multiply in living plant host tissues, while necrotrophic pathogens derive nutrients by killing host cell s using toxic molecules and lytic enzymes. Hemibiotrophs behave both as biotroph s and necrotrophs depending on the stage of their life cycles and living conditions (Glazebrook, 2005).

PAGE 14

14 The Arabidopsis thaliana / Pseudomonas syringae Pathosystem This pathosystem has emerged as a model for the study of plant/bacterial pathogen interactions (Katagiri et al., 2002). P. syringae , a hemibiotrophic bacterial pathogen, causes economically important diseases in a wide variety of crops. It infects mainly a erial portions of plants within a few millimeters of the initial infection sites and does not spread to other parts of the plant. In nature, P. s yringae strains generally go through two phases: an initial epiphytic phase upon arrival on the plant surface a nd an endophytic phase in the apoplastic space after entering the plant through natural openings and/or wounds. As a hemibiotroph, P. syringae behaves as a biotroph in the early stage of infection but as a necrotroph at the late stage of infection (Glazebr ook, 2005). Infected leaves show water soaked patches, which eventually become necrotic. Due to economic importance and amenability to genetic manipulation, P. syringae has been extensively studied. More importantly, many strains of P. syringae pv. tomato (Pst) and the closely related pathogen P . syringae pv. maculicola (Psm) can infect the model plant A. thaliana , and certain strains exhibit race cultivar specificity on this host. Thus, the A. thaliana / P. syringae pathosystem has become a model system cont ributing to the understanding of the mechanisms underlying plant recognition of pathogens, signal transduction pathways controlling plant defense responses, host susceptibility, and pathogen virulence and avirulence determinants. Pathogenesis Mechanisms of P. syringae The exact arsenal of P. syringae virulence factors has not been fully understood, but two systems have been known to play important roles in P. syringae pathogenicity: the type III secretion system (T3SS) and the toxin coronatine (Preston, 2000). The T3SS, encoded by hrp ( hypersensitive response and pathogenicity ) and hrc ( hrp

PAGE 15

15 conserved ) genes, is a needle like structure across the bacterial envelope and is a crucial virulence factor in P. syringae and many other gram negative bacterial pathogens of plants and animals (Galan and Collmer, 1999). This system delivers a battery of bacterial avirulence and virulence proteins (type III effectors, T3Es) into the host cells (Preston, 2000) . Pathogens with an impaired T3SS fail to colonize susceptible plants since these pathogens can induce faster and stronger defense responses in plants than the wild type P. syringae strains (Tsuda et al., 2007). Increasing evidence shows that T3Es contribute to pathogenesis mainly through targeting the plant immune system, including sabotaging signaling components of defense pathways, interfering with immunity related gene transcripts, disrupting immunity associated vesicle trafficking, and so on (Xin and He, 2013). For example, HopZ1a, a T3E from P.syringae has been shown to be able to suppress pathogen induced expression of pathogenesis related ( PR ) genes and the development of systemic acquired resistance (SAR) induced either by the virulent pathogen Pst DC3000 or the avirulent pathogen Pst DC3000/ avrRpt2 (Macho et al., 2010). EDS1 (enhanced disease susceptibility 1), a key regulatory component of basal and induced resistance, is also targeted by bacterial effectors, such as AvrRps4 and HopA1 from Pst DC3000, which disrupt the interaction between EDS1 and resistance (R) proteins through binding to EDS1, consequently preventing the activation of defense responses (Bhattacharjee et al., 2011; Heidrich et al., 2011). In addition to T3 Es , some P. s yringae strains (for example , Pst DC3000 and Psm ES4326) also produce the toxin coronatine, which plays an important role in pathogenicity (Bender et al., 1999). Coronatine deficient bacterial mutants cause

PAGE 16

16 weak er disease symptoms compared to wild type bac teria (Mittal and Davis, 1995). However, unlike bacterial mutants with an impaired T3SS, coronatine deficient bacterial mutants still can multiply in susceptible Arabidopsis plants (Mittal and Davis, 1995). Structurally and functionally similar to the jasm onate isoleucine (JA Ile), coronatine acts as a molecular mimic of methyl JA (MeJA). Previous studies have shown that coronatine is required for P. syringae to enter into the plant apoplast through stomata by counteracting ABA induced stomatal defense (Melotto et al., 2006). Very recently, it has signaling cascade that represses S A accumulation (Zheng et al., 2012). Plant Disease Resistance Mechanisms Under constant attack from various microbes, p lants have developed multilayered and cooperative defense mechanisms to protect themselves (Jones and Dangl, 2006). This highly complica ted defense system, similar to the animal innate immunity, can recognize nonself molecules or signals from their own injured cells resulting in the activati on of an effective immune response (Jones and Dangl, 2006). Unlike mammals, plants lack a circulator y system and specialized mobile cells to carry out immune functions. However, plant cells undergo reprogramming to prioritize defense over their normal cellular functions when attacked by a pathogen. It has been proposed that plants are capable of establis hing responses using a two layered innate immune system ( Jones and Dangl, 2006). The first layer recognizes and responds to molecules common to many classes of microbes, including non pathogens. The second responds to pathogen virulence factors, either dir ectly or through their effects on host cellular targets.

PAGE 17

17 PAMP triggered Immunity On the external surface of the plant cell, conserved microbial elicitors called pathogen associated molecular patterns (PAMPs) or microorganism associated molecular patterns (MAMPs) can be recognized by pattern recognition receptors (PRRs) (Boller and Felix, 2009). PAMPs or MAMPs , such as flagellin, elongation factor Tu (EF Tu), chitin, glycoproteins, and lipopolysaccharides, are typically essential structures that are conserv ed throughout whole classes of pathogens. Plants also respond to damage associated molecular patterns (DAMPs) , which are endogenous molecules released by pathogen invasion. Recognition of these molecular patterns by PRRs leads to PAMP triggered immunity (PTI), including reactive oxygen species (ROS) production, callose deposition, generation of secondary messenger s, and defense gene expression (Ausubel, 2005; Jones and Dangl, 2006). The plant PRR family includes plasma membrane localized receptor like kinases (RLKs) or receptor like proteins (RLPs) with modular functional domains. In Arabidopsis, there are approxi mately 610 predicted RLKs and 56 predicted RLPs, but only a few have been functionally characterized (Altenbach and Robatzek, 2007). To date, ten plant PRRs have been identified with known PAMP or MAMP ligands, seven of which are from the model plant A. th aliana (Robatzek and Wirthmüller, 2013). Flg22:FLS2 and EF Tu:EFR are two of the best exemplified PAMP/PRR recognitions. FLS2 can directly interact with flg22, a 22 amino acid synthesized peptide derived from the N terminus of flagellin (Gómez Gómez and Bo ller, 2000; Chinchilla et al., 2006). Likewise, EF R can recognize elf18, an eighteen amino acid peptide from the N terminus of the EF Tu, to initiate defense responses (Kunze et al., 2004).

PAGE 18

18 Effector triggered Immunity To achieve successful colonization, ad apted pathogens can deliver effector molecules directly into the plant cells to suppress PTI, resulting in effector triggered susceptibility (ETS) (Jones and Dangl, 2006). Among bacterial secretory systems, the T3SS appears to be the most important for eff ector delivery. Some T3 Es have been shown to suppress primary defense responses of plants (Alfano and Collmer, 2004). For example, P. syringae T3Es, such as AvrPto, AvrPtoB, HopF2 and HopAI1, can suppress PTI mediated by FLS2 through directly targeting dif ferent components of the Flg22:FLS2 signaling cascade (Zhang et al., 2007; Rosebrock et al., 2007; Xiang et al., 2008; Göhre et al., 2008; Wang et al., 2010a). Through co evolution with pathogens, plants have developed R proteins to detect the presence of certain pathogen effector molecules. Most of the characterized plant R proteins belong to the nucleotide binding leucine ric h repeat class (NB LRR), which can be separated into two categories according to whether the N terminus contains a toll interleukin 1 receptor (TIR) domain or a coiled coil (CC) domain (Collier and Moffett, 2009; Lukasik and Takken, 2009; Knepper and Day, 2010). Both types of NB LRRs act as intracellular immune sentinels. Recognition of bacterial effectors by R proteins can activate ef fector triggered immunity (ETI) or R gene mediated resistance , which is an accelerated and amplified PTI response often accompanied by hypersensitive response (HR) mediated cell death at the infection site (Dangl and Jones, 2001; Jones and Dangl, 2006). The recognized effector is termed an avirulence (Avr) protein. Unlike PTI, which is a general response to a number of conserved PAMPs, ETI is specific for particular pathogen strains.

PAGE 19

19 The recognition of pathogen Avr proteins by plant R proteins can be dire ct or indirect (Jones and Dangl, 2006). In the gene for gene model, each plant R gene matches with a pathogen effector coding gene ( van der Biezen and Jones, 1998 ). But this model could not explain the broad immune capacity of plants with a limit ed number of R proteins to deal with the virtually unlimited number of pathogen effectors . Therefore, t he guard model was put forward, which states that pathogen effectors can be indirectly recognized by R proteins through monitoring the perturbations of host cellul ar targets ( Dangl and Jones, 2001; Jones and Dangl, 2006 ). An example of R protein guarded cellular target is the A. thaliana protein RIN4 (RPM1 interacting protein4), which is not only targeted by three pathogen effectors from P. syringae (AvrRpm1, AvrB and AvrRpt2), but also monitored by two plant R proteins ( RPM1 and RPS2 ) (Mackey et al., 2002; Kim et al., 2005). Hypersensitive R esponse The specific recognition of pathogen Avr proteins by R proteins in plants often leads to the HR, a form of programm ed cell death (PCD). Typically, HR does not extend beyond the site of attempted infection . It may limit pathogen growth in some interactions, but this is not always the case. HR is characterized by rapid death of cells with cytoplasmic shrinkage, chromatin condensation, mitochondrial swelling, vacuolization and chloroplast disruption (Coll et al ., 2010). It has been shown that HR is not required for ETI since cell death is abolished but R protein mediated pathogen resistance is not affected in some mutant p lants (such as dnd1 ) as well as in transgenic plant cell lines (Coll et al., 2010; Yu et al., 1998). However, HR may be adaptive for the generation of long range signals, mediated by ROS and SA, which further induce SAR against secondary infections (Durran t and Dong, 2004).

PAGE 20

20 Plant (hemi)biotrophic pathogens feed on living cells. They have evolved mechanisms to evade host detection and death of the invaded plant cells using specific effectors. Several effectors from Pst DC3000 have been shown to be capable o f suppressing HR in tobacco and Arabidopsis ( Jamir et al., 2004; Guo et al., 2009 ). In contrast, some necrotrophs use the plant HR machinery as a strategy to promote virulence. PCD results in a loss of host cell membrane integrity, which causes a flood of previously unobtainable nutrients into the apoplast where most fungi reside (Hammond Kosack and Rudd, 2008). In Arabidopsis, lesion mimic mutants (LMM) exhibits HR like phenotypes. These mutants may have roles in dissecting PCD and defense pathways in pla nts (Moeder and Yoshioka, 2008). In the majority of these mutants, SA signaling and defense gene expression are constitutively activated, suggesting that the lesions formed mimic the HR (Lorrain et al., 2003). However, draw conclusions should be drawn care fully since some LMM mutants could result from mutations affecting plant cell physiology that might be unrelated to plant immune responses. Systemic A cquired R esistance Upon recognition of a pathogen, plants often develop HR at the infect ion site, resulti ng in an enhanced resistance to further pathogen attacks in unin fect ed tissue s. This spread of enhanced resistance throughout the plant is referred to as SAR and has been shown to be effective in many plant species (Durrant and Dong, 2004). SAR is long lasting and effective against a broad spectrum of pathogens, including bacteria, viruses, fungi and oomycetes (Ryals et al., 1996; Sticher et al., 1997). The PR genes have been regarded as useful molecular markers for the onset of SAR , although their functions remain unclear (Durrant and Dong, 2004).

PAGE 21

21 How does local infection lead to SAR? Early grafting experiments demonstrated that a singal(s) generated at the primary infection site could be rapidly translocated to the uninfected parts to induce SAR (Jenns and Kuc, 1979; Dean and Kuc, 1986). The identity of the systemic signal(s) has been a controversial subject for many years. SA and MeSA. T he phytohormone SA was for many years thought to serve as a mobile signal for SAR. SA increases in both local and systemic tissues which correlate with the expression of PR genes during SAR induction. Exogenous application of SA or the SA analogues 2, 6 dichloroisonicotinic acid (INA) and benzothiadiazole S methyl ester (BTH) could induce the expression of PR genes and disease resistance (Durrant and Dong, 2004). The Arabido psis ics1 (isochorishmate synthase 1) mutant, which is deficient in SA synthesis, lacks SAR (Wildermuth et al., 2001). In addition, transgenic plants carrying the bacterial nahG gene (encoding a bacterial SA hydroxylase that converts SA to inactive catecho l) fail to accumulate SA, fail to express PR genes, and fail to develop SAR (Gaffney et al., 1993; Delaney et al., 1994; Lawton et al., 1995). However, a number of experiments showed that SA is not the mobile signal for SAR. D evelopment of SAR could not b e blocked even when infected leaves were detached before the accumulation of SA in the petioles (Rasmussen et al., 1991). Grafting experiments in tobacco demonstrated that nahG transgenic tobacco rootstocks were capable of producing a SAR signal (Vernooij et al., 1994). Conversely, SAR was not activated in n ahG transgenic scions grafted on wild type rootstocks, thus suggesting that SA is required to activate systemic defenses, but it is not the long distance signal in SAR (Vernooij et al., 1994).

PAGE 22

22 Recently , methyl salicylate (MeSA), which is synthesized from SA, has been suggested to be a mobile signal for SAR (Park et al., 2007; Dempsey and Klessig, 2012). MeSA accumulates during SAR and can induce defense via its conversion to SA by MeSA esterase, such as SABP2 in tobacco (Seskar et al., 1998; Kumar and Klessig, 2003). Moreover, plants with impaired MeSA synthesis or MeSA cleavage are defective in SAR development (reviewed by Dempsey and Klessig, 2012). It is volatile, so it may function as an airborne sig nal to activate disease resistance and induce expression of PR genes in neighbouring plants and/or in the distal parts of the infected plant (Dempsey and Klessig, 2012). However, there has been some controversy regarding the role of MeSA in SAR. Arabidops is bsmt1 (benzoic acid/salicylic acid carboxyl methytransferase 1) mutant plants were shown to be able to initiate SAR, suggesting that MeSA is not required for SAR (Attaran et al., 2009). During pathogen infection, the induction of MeSA was shown to be de pendent on the JA pathway, which antagonizes SA mediated defense pathway (Attaran et al., 2009). Thus, MeSA does not appear to be a mobile signal for SAR. Jasmonic acid. Previously, JA had been proposed as the systemic signal for SAR (Truman et al., 2007). The compelling evidence for this came from the facts that JA accumulates to a high level in petiole exudates from leaves infected with SAR inducing bacteria, and that e xogenous application of JA can induce SAR. However, studies on mutants defective in either JA response or JA biosynthesis resulted in controversial results (reviewed by Dempsey and Klessig, 2012 ) . Furthermore, JA did not co purify from petiole exudates wit h the SAR inducing ability (Chaturvedi et al., 2008). Therefore, JA does not seem to be the critical mobile signal for SAR.

PAGE 23

23 Lipid based molecules. Previous studies also suggested that a lipid based molecule might serve as the mobile signal for SAR. DIR1 (d efective in induced resistance 1) encodes a protein with sequence similarity to lipid transfer proteins. dir1 mutant plants show wild type local response to pathogens while they are not capable of developing SAR (Maldonado et al., 2002). In addition, the p hloem sap from dir1 mutant plants was not able to induce SAR on wild type plants, suggesting that dir1 mutant plants are defective in the production of an essential mobile signal from the local infected leaf. Two other lipase like proteins, PAD4 (phytoalex in deficient 4) and EDS1, have also been shown to be required for SAR (Truman et al., 2007). Taken together, these results support that lipid signaling contributes to SAR. Azelaic acid, glycerol 3 phosphate and dihydroabetinal. Recent studies also showed t hat azelaic acid (AzA), glycerol 3 phosphate (G3P), and dihydroabetinal (DA) serve as SAR inducers dependent on DIR1 and SA (Jung et al., 2009; Chanda et al., 2011; Chaturvedi et al., 2012). Jung et al. reported that AzA, a C9 dicarboxylic acid, accumulate s in petiole exudates after pathogen infection. It can move to the distal tissues to induce SAR following a local application ( Jung et al., 2009 ). However, SA levels do not change in AzA treated plants, indicating that AzA can prime the plants with pathoge n responsive SA biosynthesis. The azi1 ( azelaic acid insensitive 1 ) mutant plants exhibit impaired SAR but have normal local response to infection. In addition, the function of AzA as a SAR inducer requires DIR1 and SA. Thus, it was proposed that AzA might be involved in the regulation of a mobile SAR signal (Jung et al., 2009; Fu and Dong, 2013). R ecently, it has also been reported that G3P, together with DIR1, can induce even stronger SAR than does it alone ( Chanda et al., 2011 ). Infiltration of DIR1

PAGE 24

24 prot ein could not induce SAR in the gly1gli1 double mutant plants, which are defective in G3P synthesis and have impaired SAR. Thus, G3P and DIR1 are interdependent for SAR induction. Like AzA, G3P does not induce SA accumulation. Thus, G3P appears to be a nec essary but not a sufficient mobile signal for SAR. Unlike AzA and G3P, DA does not increase after pathogen infection. It can move to the systemic tissues to induce SAR when applied locally (Chaturvedi et al., 2012; Fu and Dong, 2013). Furthermore , DA induc ed SAR depends on NPR1 (nonexpressor of pathogenesis related proteins 1), DIR1, and FMO1 (flavin dependent monooxygenase 1). T hus, it was suggested that DA might activate SAR through inducing SA accumulation (Kachroo and Robin, 2013). Pipecolic acid . accumulates in petiole exudates of leaves inoculated with the SAR inducing pathogen Psm , while its accumulation is severely impaired in the distal noninoculated leaves of several SAR deficient mutants, such as fmo1, ics1 , npr1 , and pad4 . Exogenous application of Pip can induce disease resistance of wild type plants and restore SAR in the pipecolate deficient ald1 m In addition, other factors are involved in modulating SAR, such as the plant cuticle as well as light (Xia et al., 2009; Griebel and Zeier, 2008). Increasing evidence suggests that many diverse signals are involved in regulating SAR. However, SA signaling is required for SAR.

PAGE 25

25 Salicylic Acid and Its Function in Plant Immunity Salicylic acid (2 hydroxyl benzoic acid , SA ) is one of an extremely diverse group of phenolic compounds produced by many prokaryotic and eukaryotic organisms including plants. T he name of SA and its derivatives was derived from the Salix helix (willow) tre e. In 1897, Bayer Company produced the world first synthetic drug, aspirin (acetylsalicylic acid) as an anti inflammatory agent, which mimics the action of the ancient medicine from the willow tree (Weissman, 1991). However, the functions of SA in plants were initially recognized in 1970s when application of aspirin was shown to be effective against a plant virus (White, 1979). Since then, SA has also been shown to have other regulatory roles in plants, including seed germination, stomatal closure, senesc ence, thermogenesis, growth and development, and responses to abiotic stresses (Raskin, 1992a, 1992b; Vlot et al., 2009). SA Acts as an Important Signal Molecule in Plant Defense Responses Since the first suggestion that SA functions as a signal for plant disease resistance (White, 1979; Antoniw and White, 1980), the role of SA in plant immunity has been extensively studied. It has been shown that exogenous application of SA or its analogs can induce PR gene expression and enhance resistance in many plant s pecies, and elevated levels of endogenous SA correlate with the induction of local and/or systemic defense responses (Raskin, 1992; Klessig and Malamy, 1994; Vlot et al., 2009). Moreover, SA deficient mutants or n ahG transgenic plants exhibit increased susceptibility to virulent and avirulent pathogens, and resistance can be restored in SA deficient mutants by treatment with SA or its analogs (Gaffney et al., 1993; Delaney et al., 1994; Mauch et al., 2001; Dewdney et al., 2000). In addition to local responses, SAR development and systemic PR gene expression are suppressed in SA deficient

PAGE 26

26 plants (Gaffney et al., 1993; Delaney et al., 1994; Vernooij et al., 1994; Nawrath and Métraux., 1999). Therefore, SA is widely accep ted as a key player in multi ple layers of plant disease resistance, including PTI, ETI, and SAR. SA Biosynthesis in Plants Since SA plays critical roles in plant immunity and a diverse range of physiological processes, elucidating how it is synthesized ha s been a central pursuit in SA biology. Research has revealed that plants mainly utilize two distinct enzymatic pathways to synthesize SA, the phenylalanine ammonia lyase (PAL) pathway and the isochorismate (IC) pathway. Both pathways require the primary m etabolite chorismate, which is derived from the shikimate pathway. However, neither pathway ha s been fully defined so far. The phenylalanine ammonia lyase (PAL) pathway. Earlier studies using isotope feeding suggested that SA is synthesized from phenylala nine via trans cinnamic acid ( t CA), which is then converted to SA via two possible routes: (i) Decarboxylation of the side chain of t CA to form benzoic acid (BA) followed by hydroxylation at the C 2 position; (ii) Hydroxylation of t CA to generate o coumaric acid which is then carboxylated to form SA (Klämbt, 1962; El Basyouni et al., 1964; Chadha and Brown, 1974). However, SA mainly comes from phenylalanine through benzoic acid (BA) in some plant species, such as tobacco, cucumber, rice, and potato (reviewed by Dempsey et al., 2011). 14 C label SA can be detected in phloem after 14 C labeled BA is injected into cucumber plants (Mölders et al., 1996). During the process of converting benzoic acid to SA, the hydroxylation step is catalyzed by benzoic aci d 2 hydroxylase (BA2H). The activity of a partial purified tobacco BA2H was reported in 1995 , but there

PAGE 27

27 has been no further res earch progress on this enzyme (L eon et al., 1995). Up to date, other enzymes involved in these two routes from t CA to SA have no t been fully defined. Production of t CA from phenylalanine is catalyzed by phenylalanine ammonia lyase (PAL), which is the first enzyme of the phenylpropanoid pathway (Raes et al., 2003; Rohde et al., 2004). A role for PAL in SA biosynthesis has been wid ely accepted since plants increase PAL gene expression and SA levels during pathogen infection, and reduce SA accumulation when PAL activity is lost (Pellegrini et al., 1994; Mauch Mani and Slusarenko, 1996; Dempsey et al., 1999). In Arabidopsis, there are four PAL genes ( PAL1 4 ). Quadruple mutant ( pal1 pal2 pal3 pal4 ) exhibits a ~ 75% and a ~ 50% reduction in the basal and pathogen induced SA levels, respectively (Huang et al., 2010). In addition, plants treated with the PAL inhibitor 2 aminoindane 2 phosp honic acid (AIP) also accumulate reduced pathogen induced SA levels (Mauch Mani and Slu sarenko, 1996). Consistent with SA reduction, both quadruple mutant plants and plants treated with PAL inhibitor display enhanced susceptibility to pathogens (Mauch Man i and Slu sarenko, 1996). The isochorismate pathway. Some bacteria also synthesize SA from chorismate. The reactions are catalyzed by isochorismate synthase (ICS) and isochorismate pyruvate lyase (IPL) or by a bifunctional enzyme SA synthase (SAS) (Verber ne et al., 1999; Pelludat et al., 2003). ICS and SAS have very similar structure s and contain conserved active sites (Harrison et al., 2006; Kerbarh et al., 2006; Kolappan et al., 2007). Since plants can synthesize chorismate in the plastid (Poulsen and Ve rpoorte, 1991) and many plastid localized biochemical pathways share similarities with prokaryotes, plants may synthesize SA through the isochorismate

PAGE 28

28 pathway. Indeed, overexpression of the bacterial ICS and IPL targeted to chloroplasts increases endogenou s SA levels in plants (Serino et al., 1995). The first plant ICS isolated from Catharanthus roseus has a high level of homology to bacterial ICS isozymes (van Tegelen et al., 1999). The most convincing evidence supporting the existence of the isochorismate pathway in plants was generated by characterization of Arabidopsis mutants. Wildermuth et al. (2001) identified two Arabidopsis ICS genes, ICS1 and ICS2 , which share high identities at the amino acid level with the ICS of C . roseus . They found that expression of ICS1 , but not ICS2 , can be induced by pathogens and the induction is correlated with SA accumulation and PR1 expression. Moreover, they showed that the sid2/eds16 mutant plants, which lack the functional ICS1 gene, accumulat e only 5 10% of the SA levels detected in wild type plants during pathogen infection (Wildermuth et al., 2001). ICS1 can also be induced by a variety of other stresses, including ultraviolet (UV) light, ozone, and a series of chemicals (review by Dempsey e t al., 2011). ICS1 possesses a putative plastid transit sequence and a cleavage site, indicating that ICS1 functions in chloroplasts utilizing chorismate to synthesize SA (Wildermuth et al., 2001). All these results confirm the presence of a similar bacter ial SA biosynthesis pathway in plants. However, biochemical studies showed that ICS1 is a unifunctional enzyme since recombinant ICS1 converts chorismate to isochorismate, not to SA (Strawn et al., 2007). Up to now, no plant genes encoding IPL have been id entified. ICS homologs have been identified in other plant species. Some plants, such as rice, crabgrass, barley and soybean, constitutively accumulate high levels of SA

PAGE 29

29 (approximately 1 mg/g fresh mass). However, not all plants synthesize SA at detectable levels (Raskin et al., 1990). As mentioned above, the Arabidopsis genome contains two isochorismate synthase genes, ICS1 and ICS2 . Disruption of ICS1 results in ~93% reduction in basal SA levels and ~92% in pathogen induced SA levels (Garcion et al., 2008 ), suggesting that ICS1 plays a major role in SA biosynthesis. In ics2 mutant plants, both basal and UV induced SA levels are similar to those in wild type plants. However, ICS2 was shown to be a functional and chloroplast localized ICS (Gracion et al., 20 08). Double mutant ics1 ics2 plants accumulate even lower levels of SA than do ics1 plants, indicating that ICS2 is responsible for only a marginal level of SA synthesis and an ICS independent SA biosynthesis pathway is also present in plants (Gracion et a l., 2008). Several lines of evidence suggest that the residual SA is synthesized by the PAL pathway. Based on the basal and induced SA levels in the quadruple pal mutant plants ( pal1 pal2 pal3 pal4 ) (a ~ 75% and a ~ 50% reduction in the basal and pathogen induced SA levels, respectively) and the ics1 mutant plants (a ~ 93% and a ~ 92% reduction in the basal level and pathogen induced SA levels, respectively), it has been concluded that the isochorismate pathway is the predominant route for synthesis of both basal and induced SA in Arabidopsis (Mauch Mani and Slu sarenko, 1996; Garcion et al., 2008). SA Metabolism Once SA is synthesized inside plant cells, it may be modified through glucosylation, methylation, and amino acid conjugation. Most modifications are regulatory processes for SA accumulation, function and/or mobility.

PAGE 30

30 SA glucosylation. SA can be glucosylated to form SA sugar conjugates SA 2 O D glucoside (SAG) or SA glucose ester (SGE). Among them, SAG is the main form in most plants (Dean and Mills, 2004). During TMV infection on tobacco leaves, SAG increases in parallel with the acc umulation of free SA, suggesting that the majority of SA is like ly glucosylated when an excess of SA is present inside plant cells (Enyedi et al., 1992; Malamy et al., 1992). In plants, SA glucosylation is performed by a pathogen inducible UDPglucosyltrans ferase (UGT) (also known as SA glucosyltransferase(SAGT)) (Vlot et al ., 2009; Loake and Grant, 2007). Cytosol ic SAG is then transported to the vacuole as a readily available hydrolysable source of SA (Loake and Grant, 2007). It was reported that in tobacco plants SAG is converted back glucosidase (SAGase) possibly occurring in the extracellular spaces (Henning et al., 1993; Seo et al., 1995). However, whether SAG is excreted from the vacuole to the apoplast for hydrolysis remains obscure. Arabidopsis contains two SAGT genes, SAGT1 and SAGT2 . SAGT1 only converts SA to SA 2 O beta D glucose (SAG), while SAGT2 forms both SAG and SGE ( Dean and Delaney, 2008 ). Consistent with total SA accumulation during abiotic and biotic stres ses, both SAGT1 and SAGT2 expression are induced by these stresses (Dempsey et al., 2011). SA methylation. SA can also be methylated to form MeSA, a volatile ester, which is rarely present in plants. SA methylation can be significantly induced during patho gen infection (Seskar et al., 1998). The synthesis of MeSA is catalyzed by SA carboxyl methytransferase (SAMT), which uses the S adenosyl 1 methionine as a methyl donor and carboxylic acid containing substrates (Loake and Grant, 2007). SAMTs have been iden tified in several plant species (Negre et al., 2002). Transgenic

PAGE 31

31 Arabidopsis overexpressing OsBSMT1 or AtBSMT produce s higher levels of MeSA and fail s to accumulate SA and SAG, resulting in increased susceptibility to pathogens ( Koo et al., 2007; Liu et al ., 2010 ). Interestingly, MeSA was also shown to function as an airborne signal for plant to plant communication ( Koo et al., 2007 ). In tobacco, Arabidopsis, and potato, MeSA was suggested to be able to travel through the phloem to distal leaves where it ca n be converted by the activity of methyl esterase to SA, which further triggers SAR (Park et al., 2007). Recently, the tobacco SA binding protein 2 (SABP2) was found to have MeSA esterase activity. SABP2 silenced tobacco plants exhibit compromised SAR (Kum ar and Klessig, 2003; Forouhar et al., 2005). Thus, it has been proposed that MeSA functions as a mobile molecule to induce defense responses in systemic tissues and/or nearby plants (Dempsey and Klessig, 2012). SA amino acid conjugation. SA is also known to conjugate with certain amino acids. Acyl adenylate/thioester forming enzyme (GH3.5) is able to conjugate amino acids to SA and indole 3 acetic acid ( Park et al., 2007 ). Interestingly, overexpression of GH3.5 increases SA accumulation a nd disease resistance ( Park et al., 2007 ). Another research reported that overexpression of GH3.5 results in compromised ETI though elevated SA accumulation (Zhang et al., 2007). However, GH3.5 is thought to be a positive regulator of the SA mediated signa ling pathway since its loss of function mutant plants show partially compromised SAR (Park et al., 2007). Another enzyme, GH3.12, was recently shown to conjugate amino acids to 4 substitute benzoates but not to SA ( Okrent et al., 2009 ). Arabidopsis GH3.12 loss of function mutant plants ( pbs3/gdg1/win3 ) accumulate lower levels of SA and exhibit compromised pathogen resistance ( Jagadeeswaran et al., 2007; Lee et al., 2007; Nobuta et al., 2007 ).

PAGE 32

32 Compromised defense phenotypes of these mutants can be rescued b y exogenous application of SA or its derivative BTH. Therefore, it has been suggested that SA amino acid conjugates may act as bioactive inducers in plant defense responses. Regulation of SA Accumulation Genetic studies have uncovered a complex regulatory network that affects SA accumulation. This includes upstream SA signaling components (such as R proteins, EDS1, EDS5, PAD4, NDR1, and so on), downstream SA signaling component s (such as NPR1), transcription factors, metabolic enzymes (as discussed above), and positive and negative feedback loops. Plant R proteins are believed to function upstream of SA. Most of the characterized plant R proteins belong to the NB LRR class, which can be separated into two categories, TIR type R proteins and CC type R protein s (Collier and Moffett, 2009; Lukasik and Takken, 2009; Knepper and Day, 2010). Constitutively activated R proteins result in SA accumulation and disease resistance. For example, a point mutation in the R protein SNC1 creates an autoactivated receptor, whi ch results in constitutively elevated SA levels, PR gene expression, and disease resistance (Zhang et al., 2003). Genetic studies have shown that defense signals from TIR type R proteins (TIR NB LRR) are mediated by EDS1, while CC type R proteins (CC NB L RR) signal through NDR1 (non specific disease resistance1) (Aarts et al., 1998). EDS1, a lipase like protein, interacts with two other proteins, PAD4 and SAG101 (senescence associated gene101), to regulate both basal immunity and ETI (Falk et al., 1999; Vo lt et al., 2009). eds1 and pad4 mutants are defective in pathogen induced SA accumulation, suggesting that both EDS1 and PAD4 regulate SA accumulation during pathogen infection and function upstream of SA (Feys et al., 2001). Exogenous application of SA

PAGE 33

33 ca n rescue defense gene induction in the eds1 and pad4 mutants and up regulate expression of EDS1 and PAD4 in wild type plants, indicating that both genes are positively feedback regulated by SA (Falk et al., 1999; Feys et al., 2001; Zhou et al., 1998). Signaling downstream from CC type R proteins is generally regulated by NDR1, which is a glycophosphatidyl inositol anchored plasma membrane protein (Coppinger et al., 2004). It has been shown that ndr1 mutant plants are defective in PTI, ETI, and SAR due t o their reduced ability to accumulate SA upon pathogen infection ( Aarts et al., 1998; Shapiro and Zhang, 2001 ). Research also showed that BTH is able to rescue the SAR deficient phenotype of ndr1 mutant plants, suggesting that NDR1 acts upstream of SA ( Sha piro and Zhang, 2001; Vlot et al., 2009 ). EDS5 (enhanced disease susceptibility 5) encodes a protein with homology to transporters of the MATE (multidrug and toxic compound extrusion) family (Nawrath et al., 2002). Mutations in this gene result in reduced levels of free and conjugated SA after pathogen infection or ozone treatment and compromised plant defense responses (Rogers and Ausubel, 1997; Volko et al., 1998; and Nawrath and Métraux, 1999). Also, exogenously supplied SA or SA analogs can induce simil ar levels of PR1 expression in eds5 and wild type plants (Volko et al., 1998; Nawrath and Métraux, 1999), indicating that EDS5 functions upstream of SA to regulate SA accumulation. Additionally, SA treatment can induce EDS5 expression, suggesting that EDS5 is feedforward regulated by SA. EDS5 is located in the chloroplast envelope and might regulate SA levels through transporting SA from the chloroplast to the cytoplasm (Serrano et al., 2013). It has been proposed that the lack of SA synthesis in eds5 mutan t plants might result from

PAGE 34

34 a possible feedback inhibition of SA biosynthesis in the chloroplast (Serrano et al., 2013). In addition to components upstream of SA accumulation, the downstream component, NPR1 ( nonexpressor of PR genes 1 ), also known as NIM1 (noninducible immunity 1) or SAI1 (SA insensitive 1), also regulates SA levels. NPR1 has been shown to be an important regulator of defense responses downstream of SA (Cao et al., 1994; Delaney et al., 1995). It was first identified th rough genetic screen for mutants that fail to express PR genes after SAR induction (Cao et al., 1994). Mutations in NPR1 cause compromised basal resistance, defective SAR, and insensitivity to inducers activating SA signaling (Dong, 2004). In addition, npr 1 mutant plants accumulate higher levels of SA than wild type plants during pathogen infection, suggesting that NPR1 is a feedback inhibitor of SA accumulation. Consistent with this result, NPR1 was also shown to act upstream of SA to suppress the expressi on of ICS1 , thus inhibiting SA biosynthesis (Zhang et al., 2010). Nuclear localization of NPR1 was reported to be required for suppression of ICS1 expression (Wildermuth et al., 2001; Zhang et al., 2010). In the absence of SA or pathogen challenges , the NP R1 protein is present as an oligomer in the cytosol. Upon induction, the NPR1 oligomer is reduced to form a monomer, which is then imported into the nucleus (Mou et al., 2003) . Since NPR1 lacks a canonical DNA binding domain, it is thought to regulate defe nse gene expression through interaction with other transcription factors ( Zhang et al., 1999; Després et al., 2000; Kinkema et al., 2000; Fan and Dong, 2002; Després et al., 2003; Johnson et al., 2003). However, the mechanism through which NPR1 suppresses SA accumulation has not been fully elucidated .

PAGE 35

35 Previous studies also showed that several transcription factors (TFs) are involved in the regulation of SA accumulation. The transcription factors EIN3 (ethylene insensitive 3) and EIL1 (EIN3 like 1) are positive regulators of ethylene dependent responses. Recently, the ein3 1 eil1 1 double mutant plants were shown to constitutively accumulate elevated levels of free and total SA, resulting in constitutively activated defense responses (Chen et al., 2009). In addition, overexpression of EIN3 enhances disease susceptibility to bacterial pathogens. Therefore, EIN3 and EIL1 are thought to be negative regulators of SA mediated defense responses. Moreover, EIN3 was shown to bind to the ICS1 promoter and i nhibit the expression of ICS1 gene to reduce SA synthesis (Chen et al., 2009). T wo o ther transcription factors, CBP60g (Calmodulin Binding Protein 60 like g) and SARD1 (SAR Deficient 1), were recently shown to be positive transcriptional activators of ICS1 . Double cbp60g sard1 mutants accumulate very low levels of SA in response to avirulent or virulent pathogens, and are defective in PTI, ETI, and SAR (Zhang et al., 2010; Wang et al., 2011). Overexpression of SARD1 results in high levels of constitutive fr ee and total SA and enhanced disease resistance (Zhang et al., 2010). Moreover, CBP60g and SARD1 were found to be able to bind to the ICS1 promoter to facilitate the transcription of this gene. Taken together, CBP60g and SARD1 are positive regulators of SA accumulation and plant defenses. WRKY transcription factors have been shown to be involved in plant defense responses (Eulgem and Somssich, 2007). This family of proteins can bind to the W box, which is overrepresented in the promoter regions of some SAR related genes, including ICS1 ( Maleck et al. 2000 ). WRKY28 was recently shown to be able to bind two W box

PAGE 36

36 core motifs in the ICS1 promoter (van Verk et al., 2011). Overexpression of WRKY28 in Arabidopsis protoplast s activates expression of pICS1::GUS while mutations of these two W boxes result in reduced expression of the reporter gene. Thus, WRKY28 may positively regulate SA accumulation through directly controlling ICS1 expression. Additionally, WRKY54 and WRKY70 were shown to be suppressors of SA b iosynthesis, since wrky54 wrky70 double mutant plants accumulate much higher levels of SA than wild type plants. Due to the observations that npr1 mutant plants also accumulate higher levels of SA and WRKY54 and WRKY70 are target genes of NPR1, NPR1 is tho ught to negatively regulate SA biosynthesis through these two WRKY TFs (Wang et al., 2006). Metabolic enzymes also impact SA accumulation in plants. In addition to those enzymes involved in SA modification, some other enzymes also regulate SA accumulation. For example, EPS1 (enhanced pseudomonas susceptibility 1), which is a member of the BAHD acyltransferase superfamily, was shown to have a critical role in pathogen induced SA accumulation (Zheng et al., 2009). The BAHD family of acyltransferases functions in catalyzing the transfer of an acyl moiety from acyl activated coenzyme A (CoA) to O or N atoms in various secondary metabolites induced SA accumulation through formation of an est er conjugate from intermediates synthesized from the ICS and PAL pathways. Alternatively, EPS1 may promote SA biosynthesis by catalyzing synthesis of an unknown regulatory molecule for SA biosynthesis (Chen et al., 2009). However, the exact role of EPS1 in regulating SA accumulation needs to be further investigated.

PAGE 37

37 Recently, PAP5 (purple acid phosphatase 5) was shown to regulate SA accumulation and plant defense (Ravichandran et al., 2013). PAP5 encodes a member of purple acid phosphatases which function in regulation of Pi uptake and other biological functions, such as peroxidation, ascorbate recycling, and regulation of cell wall carbohydrate biosynthesis (Ravichandran et al., 2013). In pap5 pl ants, expression of defense related genes including ICS1 and PR1 is much lower than in wild type plants after pathogen infection. In addition, application of BTH can restore PR1 expression in pap5 mutant plants. Therefore, it was proposed that PAP5 acts up stream of SA accumulation to regulate the expression of other defense responsive genes (Ravichandran et al., 2013). Biochemical studies showed that SA can be converted to 2, 3 and 2, 5 dihydroxybenzoic acid (2,3 DHBA and 2,5 DHBA) in diverse plant species (Ibrahim and Towers, 1956). Recently, SA 3 hydroxylase (S3H) responsible for the conversion of SA to 2,3 DHBA sugar conjugates, has been shown to play a pivotal role in SA catabolism and homeos tasis (Zhang et al., 2013). The s3h knockout mutants accumulate very high levels of SA and its sugar conjugates and fail to produce 2, 3 DHBA sugar conjugates. In addition, overexpression of S3H results in high levels of 2, 3 DHBA sugar conjugates and extr emely low levels of SA and its sugar conjugates (Zhang et al., 2013). Therefore, plants may regulate SA levels by converting it to 2, 3 DHBA to prevent SA over accumulation in plant cells. The NPR1 Protein In the last two decades, several genetic analyses identified the key SAR component NPR1/NIM1/SAI1 (Cao et al., 1994; Delaneyet al., 1995; Glazebrook et al.,

PAGE 38

38 1996; Shah et al., 1997). Plants lacking functional NPR1 are defective in SA and pathogen induced PR gene expression, susceptible to a wide range of pathogens, and show impaired SAR (Cao et al., 1994; Delaneyet al., 1995; Glazebrook et al., 1996; Shah et al., 1997). In contrast, overexpression of NPR1 in Arabidopsis increases disease resistance, which is associated with a faster or stronger response of the trans genic plants to pathogen attack and SAR induction (Cao et al. 1998). Homologs of the Arabidopsis NPR1 (AtNPR1) have now been identified in many plant species, such as tobacco, tomato, mustard, sugar beet, rice, apple, banana, cotton, and grapevin e (Durrant and Dong, 2004; Meur et al., 2006; Malnoy et al., 2007, Endah et al., 2008; Zhang et al., 2008, Le Henanff et al., 2009). Overexpression of AtNPR1 or its homologs also confers disease resistance to various pathogens (Lin et al., 2004; Chern et a l., 2005; Makandar et al., 2006; Malnoy et al., 2007; Potlakayala et al., 2007, Zhang et al., 2010). Therefore, NPR1 functions as a key positive regulator of plant immunity downstream of SA. NPR1 is expressed throughout the plant at low levels. Its express ion seems to be regulated by WRKY transcription factors. In the promoter region of NPR1 , there are several W boxes, which are known as the WRKY binding sites. Mutations of these WRKY binding sites abolish NPR1 expression, resulting in loss of both SA induc ed PR gene expression and disease resistance (Yu et al., 2001). Thus, WRKY transcription factors appear to function upstream of NPR1 . However, the identity of the WRKY transcription factors that are directly involved in regulating the NPR1 gene needs to be further investigated. In addition, levels of NPR1 transcripts only increase two to three fold after pathogen infection or SA treatment, suggesting that NPR1 is likely regulated at

PAGE 39

39 the protein level (Ryals et al., 1997; Cao et al., 1997; Dong, 2004). Moreover, the NPR1 overexpressing lines do not constitutively express PR genes, indicating that the NPR1 protein must be activated to be functional (Durrant and Dong, 2004). Proteosome mediated NPR1 Protein Degradation NPR1 encodes a protein c ontaining four ankyrin repeats and a BTB (Broad Complex, Tramtrack and Bric a brac) domain, both of which are involved in protein protein interactions (Cao et al., 1997; Ryals et al., 1997). Also, NPR1 shares structural homology with I B transcription cofa ctor, which regulates the mammalian innate immune responses (Ryals et al., 1997). The NPR1 protein resides both in the cytosol and in the nucleus (Kinkema et al., 2000). In the absence of SA or pathogen challenges, an NPR1 oligomer forms through intermolec ular disulfide bonds in the cytosol (Mou et al., 2003). Upon SAR induction by chemical treatments or bacterial pathogens, the reductive redox potential in the cytosol triggers NPR1 oligomer to monomer transition through reduction of disulfide bonds. Then m onomeric NPR1 protein carrying an intact nuclear localization sequence is translocated into the nucleus, where it acts as a cofactor for transcription factors, such as TGAs, to induce PR genes (Kinkema et al., 2000; Mou et al., 2003). In support of this, t wo NPR1 mutant variants, npr1C82A and npr1C216A, which are constitutively localized in the nucleus, are capable of activating PR1 gene expression in the absence of an SAR inducer (Mou et al., 2003). The cysteine residue 156 has been shown to be important for NPR1 oligomer formation through S nitrosylation by S nitrosoglutathione. Upon SAR induction, cytoplasmic thioredoxins, TRX h3 and TRX h5, catalyze the reduction of cysteine 156, disrupting intermo lecular disulfide bonds and promoting NPR1 monomerization and nuclear localization (Tada et al., 2008). At the biological level, formation of the oligomer

PAGE 40

40 in the cytoplasm not only prevents spurious activation of SAR but also maintains NPR1 protein homeost asis during SAR. The BTB domain is a general structure of adaptor proteins for the Cullin 3 E3 ligase. Unexpectedly, NPR1 does not directly interact with CUL3. However, experimental evidence showed that NPR1 can be polyubiquitinylated by the Cullin 3 E3 li gase and degraded by the 26S proteasome possibly mediated by other BTB domain containing adaptor proteins (Spoel et al., 2009; Zhang et al., 2006). This event can attenuate basal defense gene expression to prevent untimely activation of SAR, thereby avoidi ng the fitness cost in the absence of infection. Interestingly, SAR activation promotes phosphorylation of NPR1, resulting in NPR1 degradation by the 26S proteasome. In addition, phosphorylation mediated NPR1 turnover is necessary for the activation of SAR (Spoel et al., 2009). Thus, it has been proposed that proteasome mediated NPR1 degradation plays dual functions in plant immunity (Spoel et al., 2009). SA Receptors It is well known that SA plays a prominent role in plant immunity. However, the identity o f the SA receptor remained elusive until recently . Previously, several SA binding proteins were identified biochemically, such as a catalase, an ascorbate peroxidase, a carbonic anhydrase and a methyl salicylate esterase (Vlot et al., 2009). There is littl e genetic support for their function as potential SA receptors. Thus, identification of SA receptors in plants became central to understanding its function in plant immunity NPR3 and NPR4. Recently, NPR1 paralogs, NPR3 and NPR4, have been shown to be able to mediate NPR1 degradation through the 26S proteasome in a SA concentration dependent manner and act as SA receptors (Fu et al., 2012). Like NPR1,

PAGE 41

41 NPR3 and NPR4 contain a BTB protein protein interaction domain, making them potential adaptor proteins for mediating NPR1 degradation. Biochemical evidence showed that both NPR3 and NPR4 can interact with CUL3 ubiquitin ligase and NPR1 and act as CUL3 adaptors for NPR1 degradation. SA disrupts the interaction between NPR1 and NPR4, making NPR1 less susceptible to degradation, while SA facilitates the interaction between NPR1 and NPR3, promoting NPR1 degradation. More importantly, NPR3 and NPR4 were shown to be able to bind SA with different binding affinities, while NPR1 had very lower SA binding activity (Fu et al., 2012). In addition to biochemical evidence, several lines of genetic evidence also support the regulation of NPR1 protein by NPR3 and NPR4. The npr3 npr4 double mutant exhibits enhanced disease resistance and this enhanced basal resistance is NPR1 de pendent. Also, the npr3npr4 double mutant lacks further SAR induction due to the increased accumulation of NPR1 protein. Moreover, this double mutant is defective in mounting the HR and ETI (Fu et al., 2012). This is consistent with the previous result tha t NPR1 is an inhibitor of ETI triggered cell death (Rate and Greenberg, 2001). Therefore, the authors proposed the following model: in the absence of SAR induction, NPR1 is constantly degraded by 26S proteasome mediated by NPR4 to prevent untimely activati on of defense; upon pathogen challenge, locally high SA levels allow NPR3 mediated NPR1 degradation, resulting in the onset of HR and ETI; in the neighboring cells, intermediate SA levels do not allow NPR3 NPR1 interaction, but can disrupt NPR4 NPR1 intera ction, leading to the accumulation of NPR1 in the adjacent cells to induce SAR (Fu et al., 2012). Therefore, the interplay between NPR1, NPR3/4, and SA finely regulates NPR1 protein homeostasis and helps initiate different types of defense responses. Howev er, it is still

PAGE 42

42 translocation of NPR1 and/or to promote NPR1 phosphorylation, and how SA influences the ability of NPR3 and NPR4 to interact with NPR1. Crystal structure ana lyses of NPR3 and NPR4 would be the next crucial step to further address the question of how SA is sensed by these receptors. NPR1. Another study showed that NPR1 binds SA directly and acts as a bona fide SA receptor (Wu et al., 2012). Using a method of eq uilibrium dialysis, it was shown that SA can bind to the C terminal transactivation (TA) domain of NPR1 through two cysteine residues Cys521 and Cys529 and the transition metal copper. Mutation of both cysteines to serines or metal chelation abolished SA b inding activity of NPR1. In the absence of SA, the TA domain of NPR1 is inhibited by the N terminal autoinhibitory BTB/POZ domain and therefore is unable to activate defense. Upon SA binding, NPR1 undergoes a conformational change, resulting in the release of the C terminal TA domain from the N terminal autoinhibitory BTB/POZ domain. The authors also indicated that the transition of NPR1 oligomer to monomer might not be through the reductive redox potential, but rather through direct interaction between SA and Cys521/529 of NPR1 (Mou et al., 2003; Wu et al., 2012). However, Cys521 and Cys529 of NPR1 are not conserved across plant species. This raises the question of how SA is perceived in o the r plant species. Also, It will be interesting to determine the biological significance of NPR1 functionin g as an SA receptor during different types of plant defense responses, such as ETI and SAR. The seemingly conflicting results discussed above could be a ttributed to the differing experimental approaches used for detecting the direct binding of SA to NPR1

PAGE 43

43 (Fu et al., 2012; Wu et al., 2012). However, it is possible that both NPR1 and NPR3/NPR4 act as SA receptors, similar to the multireceptor sensing of ABA (Cutler et al., 2010). Increasing evidence also indicates the existence of SA dependent, NPR1 independent defense responses, suggesting that there are additional mechanisms of SA perception. In addition to its role in plant immunity, SA also functions as an important regulator in other biological processes , such as plant growth, development, germination, and responses to abiotic stresses (Volt et al., 2009). It would be interesting to explore whether these SA receptors are also involved in these processes. NPR1 interacting Proteins Since NPR1 lacks an obvious DNA binding domain and contains protein protein interaction domains, identification of NPR1 interacting proteins are important for explor ing how NPR1 functions in plant immunity. Three small structura lly similar proteins (named NIMIN1, NIMIN2, and NIMIN3) were identified in a yeast two hybrid screen. NIMIN1 and NIMIN2 were shown to interact with the C terminus of NPR1, while NIMIN3 interacts with the N terminus (Weigel et al., 2001). However, the biolo gical activity of NIMINs is undefined. Protein protein interaction assays also reveal ed that NPR1 interacts with several members of the TGA family of basic leucine zipper transcription factors, including TGA2, TGA3, TGA5, TGA6, and TGA7 (Zhang et al., 1999 ; Després et al., 2000; Johnson et al., 2003). TGA1 and TGA4 were later shown to be able to interact with NPR1 in vivo in the presence of SA (Després et al., 2003). T hese results indicate that TGA factors may be responsible for NPR1 mediated PR gene expres sion. Indeed, TGA factors are capable of binding to the activation sequence 1 ( as 1 ) of the PR1 promoter in vivo in an SA and NPR1 dependent manner (Johnson et al., 2003). In Arabidopsis, there are ten TGA genes. Mutational analysis of

PAGE 44

44 TGA genes indicated that they have functional redundancy in SA signaling (Zhang et al., 2003). Single knockout mutants of TGA2 and TGA3 do not show an obvious defense phenotype (Durrant and Dong 2004). However, the tga2 tga5 tga6 triple knockout mutant is impaired in SA indu ced PR gene expression and SAR, suggesting that TGA2, TGA5, and TGA6 play redundant functions in the induction of SAR. Interestingly, the tga2 tga5 tga6 triple mutant ha s normal local resistance, indicating that other TGA factors may function in basal resistance (Zhang et al., 2003). The Role of ABA in Plant Immunity Plants, as sessile organisms, face various types of environmental stresses including biotic and abiotic stresses. Defense against biotic threats is largely mediat ed by S A and JA/ethylene (ET) signaling pathways, while abiotic stress responses are mainly controlled by the phytohormone abscisic acid (ABA) (Kunkel and Brooks, 2002). In addition, ABA also regulates developmental processes, such as seed development, dormancy, and desiccation (W asilewska et al., 2008). Recent studies also revealed a novel role of ABA in plant immunity, which is dependent on the lifestyle of pathogen and on the time scale of infection (Asselbergh et al., 2008; Yasuda et al., 2008; Ton et al., 2009; Cao et al., 201 1; Grant and Jones, 2009). Int eractions among ABA, JA, and SA signaling appear to coordinate to determine combined adaptive responses when plants are exposed to both biotic and abiotic stresses simultaneously (Asselbergh et al., 2008; Yasuda et al., 2008; Ton et al., 2009; Cao et al., 2011; Kim, 2012). In addition, increasing evidence suggests that ABA may be an essential component in integrating and fine tuning biotic and abiotic stress response signaling networks.

PAGE 45

45 Biosynthesis and Catabolism of ABA in Plants The biosynthesis of ABA h as been identified in all known plants as well as different types of fungi, such as B. cinerea ( Grant and Jones, 2009; Kim, 2012). In carotene in the plastid and the last several steps that convert xanthoxin to ABA occur in the cytosol (Seo and Koshiba , 2002). During abiotic stresses, such as salinity and drought, plant cells synthesize more ABA which enables plants to survive. It has also been demonstrated that ABA concentration changes during pathogen infection in many plants (Whenham et al., 1986; Fa n et al., 2009; Choi and Hwang, 2011). For example, tobacco plants infected with TMV show increased ABA levels (Whenham et al., 1986). Similarly, Arabidopsis plants challenged with P. syringae accumulate higher levels of ABA (de Torres Zabala et al., 2007; Fan et al., 2009). Interestingly, expression of the bacterial type III effector AvrPtoB in Arabidopsis elevates foliar ABA levels (deTorres Zabala et al., 2007). Moreover, genome wide expression analyses revealed that there is a high similarity (42%) betw een the expression of genes induced by ABA and bacterial type III effectors in Arabidopsis (de Torres Zabala et al., 2007). These results indicate that pathogens might have evolved abilities to hijack the host ABA signaling pathway to suppress plant defens e. Currently, there is no direct evidence as to whether pathogen infected cells themselves synthesize ABA and/or ABA is transported to the infected cells (Robert Seilaniantz et al., 2011). ABA mobility through ABA transporters represents another potential regulatory level (Kuromori et al., 2010). ABA can be converted into an inactive hydroxylases , which in Arabidopsis are encoded by the CYP707A gene family ( CYP707A1 4 ) (Zhou et al., 2004). This process has an important role in regulating ABA levels during abiotic stresses (Zhou et al., 2004; Saito et al., 2004).

PAGE 46

46 However, it might be a potential host target for pathogen virulence. ABA can also be conjugated to form the inactive ABA glucosyl ester (ABA GE), which is a storage form or transport form of ABA (Lim et al., 2005). ABA Signal Transduction Recent discoveries revealed that PYR (pyrabactin resistant), PYLs (PYR like) or RCARs (regulatory component of ABA receptor) form a family of cytosolic ABA receptors (PYR1 and PYL1 PYL12). The ABA signaling pathway starts with ABA binding to these receptors follow ed by a conformational change that stabilizes the complex with one of the clade A protein phosphatase 2Cs (PP2Cs; neg ative regulators of ABA signaling), resulting in inactivation of the PP2C and activation of SNF1 related kinases (SnRKs), which are required for activat ing transcriptional factors, ion channels, and other mediators involved in ABA responses (reviewed by Cu tler et al., 2010). The Negative Role of ABA in Plant Defense Treatment with ABA promotes disease susceptibility to many pathogens, such as P. syringae and Fusarium oxysporum in Arabidopsis (Fan et al., 2009; Torres Zabala et al., 2007; Mohr and Cahill, 20 03; Anderson et al., 2004), Magnaporthe grisea in rice (Koga et al., 2004), and B. cinerea and Erwinia chrysanthemi in tomato (Audenaert et al., 2002; Asselbergh et al., 2008). In line with the effect of exogenous ABA, plants with higher levels of endogeno us ABA show compromised plant defense (Fan et al., 2009; Torres Zabala et al ., 2007). It has also been shown that ABA deficient mutants exhibit high er levels of disease resistance than wild type . For example, the Arabidopsis ABA biosynthetic mutant s aba1 , aba2 , aba3 , and aao3 show enhanced resistance to both biotrophic and necrotrophic pathogens (Mang et al., 2012; Fan et al., 2009; Torres Zabala et al., 2007; Adie et al., 2007; Sanchez Vallet et al., 2012). In tomato, the ABA

PAGE 47

47 deficient mutant sitiens exhib it s enhanced resistance against B. cinerea (Adie et al., 2007). Similarly, the Arabidopsis ABA signal mutants, ABA insensitive 1 1 ( abi1 1 ), ABA insensitive 2 1 ( abi2 1 ) and the quadruple pyr / pyl mutant ( pyr1 pyl1 pyl2 pyl4 ) are more resistant whereas the ABA hypersensitive plants ( abi1 1 sup5 and abi1 1 sup7 ) are more susceptible (de Torres Zabala et al., 2007; Sanchez Vallet et al., 2012). Therefore, ABA levels and ABA s ensitivity negatively correlate with plant resistance to biotrophic and necrotrophic p athogens, suggesting that ABA has a negative role in plant immunity. Increasing evidence suggests that ABA acts as a negative regulator of disease resistance by interfering with defense signaling at multiple levels. It was reported that ABA has a negative impact on phenylalanine ammonia lyase (PAL) activities, which are important for formation of antimicrobial secondary metabolites, such as phytoalexins, and accumulation of the key plant defense hormone SA (Audenaert et al., 2002). In addition to negatively regulating phenylpropanoid biosynthesis, ABA appears to induce the biosynthesis of JA , which is known to play an antagonistic role against SA mediated signaling (Adie et al., 2007). Moreover, ABA was shown to have a negative role in regulating ROS accumul ation, which is well known for its importance in plant defense (Asselbergh et al., 2008). Recently, it was also reported that ABA influences plant immunity by directly regulating R protein activity. ABA and expos ure of plants to high temperature inhibit th e nuclear accumulation of the R proteins SNC1 (suppressor of npr1 1 , constitutive 1) and RPS4 (resistant to P. syringae 4), resulting in compromised resistance to P.syringae (Mang et al., 2012).

PAGE 48

48 The Positive Role of ABA in Plant Defense Although most studies support a negative role for ABA in plant defense, ABA has also been shown to impose positive effect s on plant defense (Asselbergh et al., 2008; Ton et al., 2009). De Vleesschauwer et al . (2010) reported that exogenous ABA reduces spre ading of the virulent necrotroph Cochliobolus miyabeanus in rice through suppression of C. miyabeanus triggered activation of ethylene signaling (De Vleesschauwer et al., 2010). Similarly , exogenous application of ABA promotes resistance against the necrot rophic fungal pathogens Alternaria brassicicola and Plectosphaerella cucumerina in Arabidopsis (Ton and Mauch Mani, 20 04). The positive role of ABA in plant immunity is also supported by the evidence that the ABA defective mutants ( aba2 12 , aao3 2 and abi4 1 ) are more susceptible to P ythium irregulare and A. brassicicola (Adie et al., 2007). Moreover, Adie et al. (2007) showed that ABA is required for JA accumulation and JA responsive gene expression after P. irregular e infection , suggesting that ABA promotes disease resistance against these necrotrophic pathogens by contributing to JA biosynthesis and signaling . Additionally, it was reported that MYB96 mediated ABA signal ing confer s plant resistance against the bacterial pathogen Pst DC3000 by inducing SA biosynthesis (Seo and Park, 2010). ABA signaling also has a positive function in stomatal immunity. Melotto et al. reported that ABA induced stomatal closure is a defensive strategy of plants to prevent microbial invasion through open stomata (Melotto et al., 2006). During pathogen infection, ABA induced stomatal closure requires SA, indicating that ABA and SA have synergistic functions in stomatal immunity. Moreover, it was demonstrated that coronatine, a virulence factor produced by several P. syringae strains, counteracts PAMP induced stomatal closure, which is mediated by ABA signaling. Another positive

PAGE 49

49 effect of ABA on pathogen defense is its ability to stimulate the deposition of callose, which reinforces the cell wall to prev ent pathogen invasion (Ton and Mauch Mani, 2004). In addition, ABA has been shown to be a key hormone in Arabidopsis response to R. solanacearum infection (Hu et al., 2008). Pretreatment of Arabidopsis with an avirulent strain of R. solanacearum increases plant resistance to the virulent isolates of this bacterium, and this resistance correlates well with the enhanced expression of ABA related genes, which might create a hostile environment for secondary infection (Feng et al., 2012). Antagonistic Interacti ons between SA and ABA Recently, Yasuda et al. (2008) reported that there is an antagonistic interaction between SA and ABA signaling in Arabidopsis. ABA pre treatment can suppress both BIT (1, 2 benzisothiazol 3(2H) one1, 1 dioxide) and BTH induced PR gen es and resistance against virulent Pst DC3000. In addition, ABA can suppress BIT induced SA accumulation in wild type plants and BTH induced PR1 expression in SA deficient mutant sid2 1 and eds5 1 , indicating that ABA inhibits SA signaling both upstream an d downstream of SA biosynthesis. Likewise, pretreatment of NaCl suppress es BIT induced SA synthesis and BIT/BTH induced defense responses against Pst DC3000. Moreover, over hydroxylase CYP707A3 suppresses the effect of NaCl pretreatmen t on BIT or BTH induced PR gene expression, SA accumulation and disease resistance (Yasuda et al., 2008). Therefore, ABA appears to have an antagonistic effect on the SA signaling pathway. However, effects of whole plant chemical treatments on pathogen growth and/or defense gene expression are not appropriate ways to measure biological SAR (Kachroo and Robin, 2013). Also, whether

PAGE 50

50 localized application of ABA inhibits th e onset of SAR in response to primary pathogen infection has yet to be further investigated. The antagonistic effects of SA and ABA have also been demonstrated in the lesion mimic mutants, cpr22 and ssi4 , which constitutively accumulate high levels of SA ( Mosher et al., 2010). After moving these mutants from high humidity to low humidity, both SA and ABA levels increased. However, SA accumulation is capable of suppressing ABA signaling in these mutants. In addition, both mutants display partial ABA insensit ive phenotypes with respect to germination, water loss, and stomatal opening, which are attributable to elevated SA levels in these mutants ( Mosher et al., 2010). Therefore, it was proposed that SA has a role in antagonizing the ABA signaling pathway. Conv ersely , Torres Zabala et al. demonstrated a role for pathogen induced ABA in suppressing plant defenses mediated by SA (Torres Zabala et al., 2009). They examined the dynamics, inter relationship and impact of three key phytohormones, SA, ABA and JA during pathogen infection in Arabidopsis. It was shown that changes of endogenous hormone levels can profoundly influence the outcome of a plant pathogen interaction, and pathogen induced ABA suppresses plant basal defense by down regulating SA biosynthesis and SA mediated signaling (Torres Zabala et al., 2009). Thus, hormone ratios appear to play a crucial role in plant immunity, and subtle changes may result in the perturbation of plant defense responses. However, the exact molecular mechanism through which ABA SA antagonism balances the downstream defense responses remains unclear. Dissecting key factors involved in the cross talk

PAGE 51

51 between these two hormone signaling pathways would shed more light on how biotic and abiotic stresses influence the combined adaptiv e plant defense responses. Goals and Objectives of This Study SA is an essential signal molecule in plant defense against numerous biotrophic and hemi biotrophic pathogens (Dong, 2004). However, where and how SA is synthesized in plant cells remains unclea r. The goals of this study are to identify new components involved in SA biosynthesis and/or SA mediated signaling and to characterize the underlying regulatory mechanisms. The objectives are to (1) perform a forward genetic screen for mutants with altered pathogen induced SA accumulation in Arabidopsis; (2) characterize the newly identified mutants; and (3) clone one or more genes and characterize the underlying regulatory mechanism(s).

PAGE 52

52 CHAPTER 2 A FORWARD GENETIC SCREEN FOR MUTANTS WITH ALTERED SA LEVELS DURING PATHOGEN INFECTION IN ARABIDOPSIS Background Information Plants have evolved innate immune systems against pathogens. SA is an important plant defense signal produced after pathogen infection to induce SAR, which confers immunity towards a broad spectrum of pathogens (Dong, 2004). Mutants that have impaired SA b iosynthesis during infection show compromised plant defense. Conversely, exogenous application of SA or its analogues induces PR gene expression and disease resistance (Dong, 2004). Therefore, understanding the mechanisms underlying SA accumulation is crit ical in the study of plant immunity . H owever , it is still unclear where and how SA is synthesized in plant cells. Identification of new components involved in pathogen induced SA accumulation would help understand how SA is synthesized and how SA mediates disease resistance in plants. Previously, a forward genetic screen was performed in Arabidopsis for mutants with altered levels of total SA after infection with P. syringae pv tomato DC3000 carrying the avirulence gene avrRpm1 . Two mutants, sid1 and sid2 , were identified, which did not accumulate SA during the infection (Nawrath and Métraux, 1999). sid1 and sid2 w ere shown to be allelic to eds5 and eds16 , respectively, which w ere identified in another genetic screen for enhanced disease susceptibility (Nawr ath and Métraux, 1999; Rogerset al., 1997). SID1 / EDS5 was later shown to encode a chloroplast MATE (multidrug and toxin extrusion) transporter (Nawrath et al., 2002). SID2 / EDS16 encodes an SA biosynthetic enzyme ICS1 (isochorismate synthase 1 ) (Wildermuth et al., 2001). In this screen, an HPLC based method was used to quantify the SA levels in pathogen infected leaf tissues from about 4,500 individual M2 plants. Obviously, the screen did

PAGE 53

53 not reach saturation. Therefore, in order to identify more valuable g enetic components involved in SA biosynthesis or signaling, the population for a mutant screen needs to be enlarged. The HPLC based method used for the mutant screen is not practical since it is extremely costly and time consuming. Recently, an SA biosenso r, named Acinetobacter sp. ADPWH_ lux , was developed (Huang et al., 2005). This bacterial strain is derived from Acinetobacter sp. ADP1 and contains a chromosomal integration of a salicylate inducible lux CDABE operon, which encodes a luciferase ( LuxA and L uxB ) and the enzymes that produce its substrate ( LuxC, LuxD and LuxE ). In the presence of SA, MeSA and acetylsalicylic acid, the operon is activated, resulting in emission of 490 nm light (Huang et al., 2005). Measurement of SA from TMV infected tobacco le aves with the biosensor and GC/MS yielded similar results, demonstrating that this strain is suitable for quantification of SA in crude plant extracts (Huang et al., 2006). DeFraia et al. developed an improved methodology for Acinetobacter sp. ADPWH_ lux ba sed SA quantification for both free SA and SAG in crude plant extracts (DeFraia et al., 2008). Based on this, Marek et al. (2010) reported a further simplified protocol for the estimation of free SA levels in crude plant extracts in a high throughput forma t (Marek et al., 2010). The efficacy and effectiveness of the newly develop ed SA biosensor based method were confirmed by HPLC and verified in a small scale mutant screen. To better understand SA biology, we performed a large scale forward genetic screen f or mutants with altered SA accumulation after pathogen infection . We expected that mutants with significantly altered SA levels during pathogen infection will help study how SA is synthesized in plant cells and/or uncover important regulators of plant

PAGE 54

54 immunity. In this study, we identified seven new mutants that accumulate lower levels of SA and two new mutants that produce higher levels of SA than the parental line npr1 3 after pathogen infection. The seven likely new lsn mutants ( l ower S A than n pr1 3 ) are more susceptible, while both hsn ( h igher S A than n pr1 3 ) mutants are more resistant than npr1 3 . Results Genetic Screen for SA Accumulation Mutants The npr1 mutant was used as the starting material for the mutant screen, since this mutant accumulates significantly higher levels of SA than wild type during pathogen infection (Figure 2 1 A and B; Cao et al., 1997; Shah et al., 1997; Ryals et al., 1997). One leaf on each M2 plant of an EMS (ethyl methanesulfonate) mutagenized population was syringe infilt rated with a virulent bacterial strain Psm ES4326 suspension (OD 600 =0.001). After 24 hr, a disc from each infiltrated leaf was collected using a hole punch and the SA levels in the leaf disc were determined using the SA biosensor based method ( Marek et al. , 2010 ). Plants that accumulated significantly higher or lower levels of SA than npr1 3 were kept as putative SA accumulation mutants. About 350 such mutants were identified from a total of 35,000 M2 plants in this genetic screen. To confirm the putative S A accumulation mutants, eight plants of each mutant were tested for Psm ES4326 induced SA accumulation using the SA biosensor based method ( Marek et al., 2010) . Nineteen mutants, 17 lsn mutants and two hsn mutants, were confirmed (Figure 2 1A, Table 2 1). As the parental npr1 3 mutant carries a fuhl 2 allele, which lacks sinapoyl malate in the leaf epidermis and appears red, rather than blue, under UV light (Chapple et al., 1992) , contamination from other mutants in the lab was excluded by checking the mut ant plants under UV illumination. Furthermore, the

PAGE 55

55 presence of the npr1 3 mutation in the identified mutants was confirmed with a derived cleaved amplification polymorphism sequence (dCAPS) marker (Table A 2). Confirmation of the SA Accumulation Mutants Us ing HPLC To further confirm these SA mutants, we measured free SA levels after pathogen infection in the mutants using HPLC. As shown in Figure 2 1B, compared with the parental npr 3 mutant, all 17 lsn mutants accumulated extremely low levels of free SA, w hereas the two hsn mutants produced higher levels of free SA after Psm ES4326 infection. Therefore, the 19 mutants we identified may contain mutations modifying SA accumulation in the npr1 3 genetic background during pathogen infection. Pathogen Resistance Test for the SA Accumulation Mutants SA has been shown to play an important role in plant defense (Dong, 2004). Most mutants with altered SA levels have changed defense phenotypes. To investigate whether the 19 putative mutants we isolated also have alter ed disease resistance, we inoculated 4 week old plants with the bacterial pathogen Psm ES4326 (OD 600 =0.0001). Interestingly, all lsn mutants developed enhanced disease symptoms (data not shown) and supported more bacterial growth (2 to 7 fold) in comparis on with the parent npr1 3 (Figure 2 2). This is consistent with the conclusion that mutants with impaired SA accumulation have compromised defense capacity (Dempsey et al., 1999). In contrast to the lsn mutants, the hsn mutants supported less bacterial gro wth than npr1 3 , although the bacteria still grew to a slightly higher titer in hsn mutants than in wild type plants (Figures 2 2). This result indicates that the increased levels of SA in the hsn mutants activate NPR1 independent disease resistance.

PAGE 56

56 Allel ism Test Analysis of the F 1 plants from crosses between the 19 SA accumulation mutants and their parent npr1 3 indicated that the lsn and hsn mutations are recessive. Several recessive mutants including sid1 / eds5, sid2 / eds16, pad4, eds1, eps1, and pbs3 have been shown to accumulate less SA than the wild type upon pathogen infection. The lsn mutants are unlikely alleles of eds1 , eps1 , and pbs3 , since no difference in pathogen induced free SA accumulation was detected between eps1 or pbs3 and the wild typ e using the SA biosensor (data not shown), and two EDS1 isoforms are present in the Arabidopsis ecotype Col 0 (Feys et al., 2005). We therefore tested for allelism of the lsn mutants to sid1 / eds5 , sid2 / eds16, and pad4 . lsn mutants that almost do not accumu late SA after pathogen infection were crossed with eds5 1 npr1 3 or sid2 1 npr1 3 to test whether they are new alleles of sid1 / eds5 or sid2 / eds16 . Those accumulating SA after infection but with levels significantly lower than th ose in the wild type were cr ossed with pad4 1 npr1 3 to test whether they are allelic to pad4 . SA levels in all F 1 plants were measured using the SA biosensor and compared with those in their parents. The results of these allelism tests revealed that seven lsn mutants are alleles of eds5 / sid1 , two are eds16 / sid2 alleles, and one is allelic to pad4 . The remaining seven lsn mutants and the two hsn mutants are likely new SA accumulation mutants isolat ed in this genetic screen (Table 2 1). Discussion In this study, we performed a forward genetic screen for Arabidopsis mutants with altered SA levels during pathogen infection using the newly developed SA biosensor method (Marek et al., 2010). Compared to the commonly used high performance liquid chromatography (HPLC) and gas chromatography/m ass

PAGE 57

57 spectroscopy (GC/MS) methods, the SA biosensor method is much faster and less expensive (Malamy and Klessig, 1992; Verberne et al., 2002; Marek et al., 2010 ). On the other hand, unlike HPLC and GC/MS, the SA biosensor is intended to estimate SA levels in leaf crude extracts, not to accurately determine the SA concentration (Marek et al., 2010) . Using this method, we were able to screen a large population (35,000) of M2 plants in a short period of time. About 350 putative SA accumulation mutants were ide ntified in the primary screen, among which 19 were confirmed using both the SA biosensor and HPLC methods (Figure 2 1A and 2 1B). Among the 19 SA accumulation mutants, 17 are lsn mutants, producing much lower SA levels than npr1 3 after pathogen infection, and two are hsn mutants, accumulating higher SA levels than npr1 3 . Based on allelism tests, 10 out of the 17 lsn mutants are new alleles of previously identified genes involved in SA biosynthesis or SA signaling, and the remaining seven lsn mutants are m ost likely new SA biosynthesis or signaling mutants. A lthough this is a large scale genetic screen, we only identified one allele of pad4 , two alleles of sid2 , and two hsn mutants, indicating that the genetic screen may not have been saturated. The eds5 1 npr1 3 , sid2 1 npr1 3 , and pad4 1 npr1 3 double mutants accumulate much less SA and are more susceptible to Psm ES4326 than the corresponding single mutants (Figure 2 1 and 2 2). The seven new lsn mutants exhibit similar SA and defense phenotypes as these double mutants, suggesting that the LSN genes may encode SA signaling components or SA biosynthetic enzymes. The two hsn mutants accumulate higher free SA levels than npr1 3 and are less susceptib le to the virulent pathogen Psm ES4326, suggesting that increased SA accumulation may activate

PAGE 58

58 NPR1 inde p endent defense responses in the hsn mutants. It is expected that the HSN genes may encode important components suppressing pathogen induced SA accumula tion. Cloning and characterization of the LSN and HSN genes will certainly shed new light on the mechanisms underlying pathogen induced SA accumulation and/or SA mediated defense signaling. Materials and Methods Plant Materials and Growth Conditions The wild type used was the Arabidopsis thaliana (L.) Heynh. Columbia (Col 0) ecotype, and the mutant alleles used were npr1 3 (Glazebrook et al., 1996) , eds5 1 (Nawrath et al., 2002) , sid2 1 ( Nawrath and Metraux, 1999; Wildermuth et al., 2001 ) , pad4 1 ( Gla zebrook et al., 1996 ) , eps1 1 ( Zheng et al., 2009 ) , and pbs3 1 ( Nobuta et al., 2007 ) . The double mutants were created by crossing npr1 3 with eds5 1 , sid2 1 or pad4 1 . EMS mutagenesis was carried out as described previously (Weigel and Glazebrook, 2002). Briefly, ~ 1 gram of npr1 3 seeds were treated in 25 mL of 0.2% (v/v) EMS (Sigma) in a 50 mL Falcon tube and incubated on a rocking platform for 15 hr. After washing with water eight times, the seeds were suspended in 0.1% agarose and sown on soil (Metromix 200) with a pasteur pipette. The M1 plants were allowed to self fertilize to produce M2 seeds, which were collected in 96 independent pools. The M2 seeds were vernalized at 4 °C for 3 days before placement in a growth environment (16 hr light/8 hr dark ph otoperiods at 22 °C). After two weeks, seedlings were transplanted into 96 plot trays and grown for an additional two weeks. Bacterial Strains and Pathogen Infection The virulent bacterial leaf pathogen Psm ES4326 was grown overnight in liquid ium. Bacterial cells were collected by centrifugation and diluted in 10 mM

PAGE 59

59 MgCl 2 . Inoculation of plants with Psm ES4326 was performed by pressure infiltration with a 1 ml needleless syringe (Clarke et al., 1998). For SA measurement with the biosensor based method, one leaf on each plant was infiltrated with a Psm ES4326 suspension (OD 600 = 0.001). The susceptibility phenotype was tested using a low titer (OD 600 =0.0001) of Psm ES4326. In planta growth of Psm ES4326 was assayed three days after infection as previously described ( Clarke et al., 1998 ) . Measurement of SA Using the Biosensor based Method For mutant screening, free SA levels were measured using the SA biosensor as described by Marek et al. (2010). Briefly, 24 hr after Psm ES4326 infection, a l eaf disc was collected from the infected leaf of each plant using a hole punch and placed in 200 L of LB in a corresponding well of a 96 well PCR plate. The plate was then boiled at 95 °C for 30 min and cooled down to room temperature in a thermocycler (Ma rek et al ., 2010). An overnight culture of Acinetobacter sp. ADPWH_ lux was diluted with LB (1:10) and incubated at 37°C for ~2 hr until the OD 600 reached 0.4. Using a multipipette, 50 L of this bacterial culture was added to each well in a 96 well black cell culture plate, and then 50 L of the boiled leaf extract was added to each well and mixed by pipette action. The plate was incubated at 37°C for 1 hr without shaking before luminesce nce CA). Measurement of SA with the HPLC Method Two leaves of each plant were infiltrated with a Psm ES4326 suspension (OD 600 =0.001) 24 hr before leaf tissue collection. Le af tissues (0.1 g) were ground twice in liquid nitrogen and extracted with 1 mL of 90% HPLC grade methanol. After

PAGE 60

60 centrifugation at 14,000 g for 10 min, the supernatant was transferred to a 1.5 mL microcentrifuge tube. The pellet was re extracted with 0.5 mL of 100% methanol and the supernatant was transferred to the same tube. The total supernatant was equally split into two microcentrifuge tubes [one for free SA and another for glucose conjugated SA (salicylic acid 2 O D glucoside or SAG)], which were d ried in a speed vacuum to final volume of ~50 L. The residue was resuspended in 250 L hydrolysis buffer (0.1 M glucosidase and incubated a t 37 °C for 1.5 hr. An equal volume of 10% t richloroacetic acid ( TCA ) was then added to both the free SA and SAG tubes. After centrifugation at 14,000 g for 10 min, the supernatant was transferred to a new tube. SA was then extracted into an organic phase containing a 1:1 mixture of ethyl acet ate and cyclopentane. The organic solvent was dried in a speed vacuum and SA was dissolved in 0.25 mL 0.2 M sodium acetate buffer (pH 5.5). Pure SA samples were included in the same procedure to account for recovery rate. SA levels were quantified on an HP LC system with excitation at 301 nm and emission at 412 nm (Verberne et al., 2002). Each data point was derived from three independently collected samples.

PAGE 61

61 Figure 2 1. Free SA levels in SA accumulation mutants. A) Luminescence from Psm ES4326 infected Col 0, npr1 3, pad4 1 npr1 3, eds5 69 npr1 3, sid2 1 npr1 3 , and 19 putative mutants measured by the SA biosensor based method. B) Free SA levels in Psm ES4326 infected Col 0, npr1 3, pad4 1 npr1 3, eds5 69 npr1 3 , sid2 1 npr1 3 , and 19 putative mutants detected by the HPLC based method. Values are the mean of eight samples (A), three samples read in triplicate (B) with standard deviation (SD). Expe riments were repeated with similar results.

PAGE 62

62 Figure 2 2. Pathogen growth in the SA mutants. Leaves of 4 week old plants were inoculated with Psm ES4326 (OD 600 = 0.0001). The in planta bacterial titers were determined 3 days postinoculation. Cfu, colony forming units. Data represent the mean of eight independent samples with SD. This experiment was repeated with similar results.

PAGE 63

63 Table 2 1. Mutants identified in this screen EDS5 SID2 PAD4 Putative lsn Putative hsn 82 200 , 85 11 , 91 2, 91 2 7 , 91 89 , 93 19, 93 181 91 14 , 91 56 91 99 43 28, 54 25, 82 18, 91 133, 93 5, 93 6, 93 80 92 26, 90 82

PAGE 64

64 CHAPTER 3 ABA IS A KEY REGULATOR OF PLANT IMMUNITY Results Isolation and Characterization of hsn2 npr1 3 In Arabidopsis, NPR1 is a positive regulator of plant immunity downstream of SA (Dong, 2004). Mutations in NPR1 result in compromised defense responses and SA hyper accumulation during pathogen infection (Dong, 2004 ), indicating that NPR1 is a feedback inhibitor of SA accumulation (Wildermuth et al., 2001; Zhang et al., 2010). In our forward genetic screen for SA accumulation mutants in the npr1 3 background, a mutant design ate d hsn2 npr1 3 was found to accumulate higher SA levels than the parental line npr1 3 during infection (Figure 3 1A, 3 1B, and 3 1C). To assess whether the hsn2 npr1 3 mutant has enhanced pathogen resistance, we performed pathogen infection assays with the compatible bacterial pathogen Psm ES4326. As shown in Figure 3 2A and 3 2B, hsn 2 npr1 3 supported less bacterial growth than did npr1 3 , although the bacteria still grew to a slightly higher titer in hsn2 npr1 3 than in the wild type, suggesting that the hsn2 mutation confers NPR1 independent disease resistance. However, hsn2 npr1 3 plants did not show enhanced disease resistance compared to npr1 3 when challenged with a high bacterial inoculum (OD 600 =0.001) (Figure 3 2C). Moreover, blocking the SA pathway, as seen in n ahG hsn2 npr1 3 or sid2 1 hsn2 npr1 3 triple mutants restored the basal susceptibility (Figure 3 2D and E). Together, these results indicate that the hsn2 mutation regulates SA dependent disease resistance in the npr1 3 mutant background. hsn2 npr1 3 plants exhibit dark green and dwarf phenotype s (Figure 3 1D). When backcrossed to npr1 3 , wild type like morphology was observed in all F 1 progeny

PAGE 65

65 (data not shown), suggesting that the hsn2 m utation is recessive. To determine the co segregation of the higher SA accumulation during pathogen infection and hsn2 morphology, SA levels of individual F 2 plants from the cross between hsn2 npr1 3 and npr1 3 were examined using the SA biosensor based method (Mark et al., 2010). Progeny ( approximately 70 plants) with hsn2 like morphology accumulated a higher level of free SA during pathogen infection, indicating that higher SA level during pathogen infection a nd hsn2 morphology co segregate and are caused by the same mutation or two closely linked mutations. HSN2 Encodes ABA3 To map the hsn2 mutation, hsn2 npr1 3 (in the Col 0 ecotype) was crossed with the polymorphic ecotype Landsberg erecta (L er ) to generate a F 2 segregating population. Crude mapping using 48 plants with an hsn2 like morphology placed the hsn2 mutation on the north arm of chromosome 1 between markers F21M12 and CIW12. Further fine mapping using 1586 F 2 mutant plants located the hsn2 mutation between markers M1 and M5, an interval of approximately 149 kb (Figure 3 3A). This region contains 41 genes. We checked all the genes for known functions and found that mutations in the ABA3 gene (At1g16540) cause similar morphology as observed i n hsn2 npr1 3 . Therefore, the coding region of ABA3 was amplified from hsn2 npr1 3 and sequenced. A single G to A mutation in the ABA3 gene was detected in the splicing site between the third intron and the fourth exon. A cleaved amplified polymorphic sequ ence (CAPS) was developed to genetically distinguish the hsn2 mutant from the wild type (Figure 3 3B ). To confirm that the hsn2 mutation affects mRNA splicing of ABA3 , RT PCR analysis was carried out using a pair of primers spanning the mutation site (Tabl e A 3). As expected, multiple bands were amplified from the hsn2 npr1 3 cDNA, whereas

PAGE 66

66 only one was detected from the wild type cDNA ( Figure 3 3C ), supporting that hsn2 mutation causes missplicing of the ABA3 gene . To further confirm that the mutation in ABA3 actually causes the hsn2 phenotype, a double mutant between another ABA3 allele, aba3 1 , and nrp1 3 was generated. We analyzed free SA level s during pathogen infection using the SA biosensor based method ( Marek et al., 2010 ), and found that the aba3 1 npr1 3 double mutant also accumulated higher levels of free SA, which was similar to that observed in hsn2 npr1 3 (Figure 3 3D). Then, we performed disease resistance test. As shown in Figure 3 3E , the aba3 1 npr1 3 double mutant showed less bacterial gro wth than the npr1 3 mutant . We also made a cross between hsn2 npr1 3 and aba3 1 npr1 3 , and found that all F 1 plants had higher free SA level s during pathogen infection, enhanced disease resistance, and dark green phenotype s (Figure 3 3D, E, and F). ABA3 encodes the cytosolic enzyme molybdenum cofactor sulfurase (Moco S), which plays a pivotal role in ABA biosynthesis (Xiong et al., 2001). To further confirm that the hsn2 mutation results in a nonfunctional ABA3 , we analyzed the ABA level in hsn2 . As the aba3 1 mutant ( Léon Kloosterziel et al., 1996 ), hsn2 exhibited a lower basal level of ABA than the wild type ( Figure 3 3G). We further verified that the dark green phenotype of hsn2 npr1 3 is due to ABA deficiency by exogenously applying ABA to the mutant plants. After 6 days, spraying 10 M ABA rescued the growth defects in the hsn2 npr1 3 mutant plants (Figure 3 3H). Spraying ABA also restored disease susceptibility (Figure 3 3I), indicating that ABA deficiency is responsible for the enhanced disease resistance in the hsn2 npr1 3 double mutant. Taken together, these data demonstrate that HSN2 is ABA3. Therefore, hsn2 was renamed aba3 21 .

PAGE 67

67 Disruption of ABA Signaling Confers NPR1 Depe ndent Resistance Previously, it was shown that defects in ABA3 confer disease resistance against the virulent pathogen Pst DC3000 (Melotto et al., 2006; Fan et al., 2009). To examine whether the new ABA3 mutant allele, aba3 21 , also has enhanced disease resistance, we inoculated aba3 single mutants, aba3 npr1 double mutants, npr1 , and wild type with the virulent bacterial pathogen Psm ES4326 (OD 600 =0.001) and monitored the pathogen growth two and half days later. As shown in Fi gure 3 4A, Psm ES4326 grew significantly less in both aba3 single mutants than in the wild type, whereas there were no significant differences among the wild type, npr1 mutant, and the two aba3 npr1 double mutants, indicating that defects in ABA3 confer NP R1 depedent disease resistance when challenged with a high bacterial inoculum (OD 600 =0.001). To determine whether basal PR gene expression was altered in the aba3 single mutants, four to five week old soil grown plants were assayed for PR1 gene expression by real time q PCR. As shown in Figure 3 5B, both aba3 single mutants displayed significantly elevat ed basal PR1 gene expression, whereas PR1 expression in the aba3 npr1 double mutants was comparable to that in the wild type. Together, these data indicate that mutations in ABA3 confer NPR1 depedent disease resistance and PR1 gene expression. W e next investigat ed whether other mutations in ABA biosynthesis or signaling also confer NPR1 depedent defense responses. In Arabidopsis, ABA1 encodes a zeaxanthin epoxidase, which catalyses the epoxidation of zeaxanthin to antheraxanthin and violaxanthin in the ABA biosynthesis pathway, and mutations in this gene cause ABA deficiency (Léon Kloosterziel et al., 1996; Barrero et al., 2005). ABI1 ( ABA insensitive 1) encodes a member of the 2C class of protein phosphatases (PP2C), and the dominant mutant abi1 1 significantly blocks ABA responsiveness (Leung et al.,

PAGE 68

68 1994). We constructed double mutants between aba1 5 and npr1 3 and between abi1 1 and npr1 L through genetic crosses. Similar to aba3 , both aba1 and abi1 mutants conferr ed NPR1 depedent disease resistance and PR1 gene expression (Figure 5A and 5B). Moreover, the ABA receptor sextuple mutant pyr1 pyl1 pyl2 pyl4 pyl5 pyl8 (112458) showed enhanced disease resistance and basal PR1 gene expression compared with the wild type Col 0 (Figrue 5A and 5B). Collectively, these data strongly support a negative function for ABA in the regulation of Arabidopsis basal resistance against the bacterial p athogen Psm ES4326 , and demonstrate that disruption of ABA signaling activates NPR1 depedent defense responses. SA is Essential for aba3 Mediated Resistance to Psm ES4326 To examine whether the resistan ce phenotype of aba3 21 depend s on SA, we introduced t he n ahG transgene, which encodes a SA degrading enzyme (Vernooij et al., 1994), into the aba3 21 mutant. As shown in Figure 3 5A, basal resistance was abolished in aba3 21 n ahG plants similarly as in n ahG plants at 3 days post inoculation. We also generate d a sid2 1 aba3 21 double mutant, which showed the combined developmental phenotypes of their parents (data not shown). Susceptibility of the double mutant to Psm ES4326 was evaluated with a low bacterial inoculum (OD 600 =0.0001). Bacterial growth was significantly higher in the aba3 21 sid2 1 double mutant than in the aba3 21 single mutant (Figure 3 5B), indicating that SA is required for the enhanced resistance observed in aba3 21 . Notably, the double mutant was not as s usceptible as the sid2 1 single mutant (Figure 3 5B), indicating that ABA deficiency may also confer sid2 independent disease resistance. Overall , these results suggest that SA is essential for ABA deficien cy conferred disease resistance (Figure 3 5A and 3 5B).

PAGE 69

69 High ABA Compromises Defense Responses in Arabidopsis Since disruption of ABA signaling results in enhanced defense responses, we postulated that enhancing ABA signaling might compromise defense responses . To test this, w e infiltrated wild type pla nts with mock (0.1% ethanol) or 80 M ABA ( in 0.1% ethanol) . After 12 h, the treated leaves were inoculated with Psm ES4326 (OD 600 =0.0001). As shown in Figure 3 6A, the growth of Psm ES4326 in the ABA treated plants was significantly higher than in the mock treated plants. Interestingly, the growth of Psm ES4326 in the ABA treated plants was comparable to that observed in the npr1 mutant plants. The expression of PR1 was also analyzed . The ABA treated p lants showed significantly decreased PR1 gene expression, similar to that observe d in the npr1 mutant plants (Figure 3 6B). These results indicate that ABA treatment has the similar effect on defense responses as the npr1 mutation . We ne xt examined the effect of elevated levels of endogenous ABA on plant defense responses. In agreement with the previous report (Fan et al., 2009), cds2D , which constitutively accumulates high levels of endogenous ABA, exhibited enhanced susceptibility to Ps m ES4326 (Figure 3 6C), a phenotype reminiscent of the npr1 mutant (Cao et al., 1994; Delaneyet al., 1995; Glazebrook et al., 1996; Shah et al., 1997), indicating that elevated levels of endogenous ABA ha ve the similar effect on disease resistance as the npr1 mutation . Together with the result that disruption of ABA signaling confers NPR1 depedent defense responses, these data suggest that ABA controls plant immunity likely by regulating NPR1 either at the mRNA level or at the protein level.

PAGE 70

70 ABA Has a Positive Function in Full Induction of Defense Reponses Previously, it was shown that ABA is an important regulator of defense gene expression during the infection of the damping off oomycete pathogen P. irregular ( Adie et al., 2007 ) . To examine whether ABA is also required for the induction of defense genes during the infection of a bacterial pathogen, we analyzed the expression of PR1 , WRKY18 , WRKY38 , and WRKY62 in aba3 21 and wild type Col 0 plants during the infection of Psm ES4326. The background ex pression level of PR1 was higher in aba3 21 than in the wild type, whereas after Psm ES4326 infection, PR1 was induced to a higher level in the wild type than in aba3 21 mutant (Figure 3 7A). Compared with the wild type, aba3 21 also showed decreased induction of two WRKY genes, WRKY18 and WRKY 38 during Psm ES4326 infection, but there was no significant difference in the induction of WRKY62 between aba3 21 and the wild type. Similarly, the induction of PR1 , WRKY18 , and WRKY38 du ring Psm ES4326 infection was also partially compromised in the ABA receptor sextuple mutant 112458, as shown in Figure 3 7A. Consistently, SA induced expression of PR1 , WRKY38 , and WRKY62 was significantly decreased in aba3 21 and 112458 compared with tha t in the wild type (Figures 3 7B). To further demonstrate that ABA is required for the induction of defense genes, we pretreated the aba3 21 mutant plants with 10 M ABA (in 0. 01 % ethanol ) or mock (0. 01 % ethanol) 2 hr before inoculation of Psm ES4326. As shown in Figure 3 7C, plants pretreated with ABA showed significantly increased induction of defense genes, including PR1 , WRKY18 , WRKY38 , and WRKY62 , during Psm ES4326 infection. Therefore, ABA is required for full induction of plant defense g enes during the infection of Psm ES4326.

PAGE 71

71 Since disruption of ABA signaling compromises the induction of defense genes, we hypothesized that ABA signaling may play a crucial role in SAR induction. To test this hypothesis, we examined biological induction of SAR in aba mutants . Three lower leaves on each plant were syringe infiltrated with either 10 mM MgCl 2 or Psm ES4326. After 2 days, we challenge inoculated the upper, untreated systemic leaves with Psm ES4326. As control, pre inoculation of wild type plant s with Psm ES4326 protected the plants against the secondary infection (Figure 3 7D). By contrast, ABA biosynthetic mutant aba3 21 and ABA receptor sextuple mutant 112458 failed to further induce resistance (Figure 3 7D), indicating that ABA signaling is required for the induction of SAR. These results demonstrate that ABA functions as a positive regulator in the induction of plant defense responses. Together with th e negative effect of ABA on plant defense responses, our data clearly support that the phytohormone ABA plays both positive and negative functions in regulating plant innate immunity. Discussion It is well documented that SA acts as an important signal molecule in plant defense responses ( Vlot et al., 2009; Dempsey et al., 2011). T o date, it is still unclear how SA is synthesized and regulated inside plant cells. To identify new components regulating SA levels, we performed a forward genetic screen in A rabidopsis for mutants with altered levels of SA during pathogen infection. We identified the phytohormone ABA as a negative regulator of SA accumulation during Psm ES4326 infection. Previously, ABA had been shown to have multiple and diverse functions in plants, including the regulation of developmental processes, abiotic and biotic stress responses (Fujita et al., 2005; Wasilewska et al., 2008). During plant pathogen interactions, both positive and negative functions have been described for ABA (Mauch Man i and Mauch,

PAGE 72

72 2005; Ton et al., 2009). In this study, we show ed that ABA plays both positive and negative regulatory functions in plant defense responses against a virulent bacterial pathogen Psm ES4326. Mutations in ABA3 conferred enhanced basal resistance in an NPR1 dependent and independent manner (Figure 3 2B and Figure3 4A), whereas the enhanced resistance was largely dependent on the SID2 mediated SA biosynthesis (Figure 3 2D and 3 2E). However, when challenged with a higher bacterial inoculum, plants with impaired ABA signaling mainly exhibited NPR1 dependent disease resistance (Figure 3 3C). By contrast, application of ABA at physiologically relevant concentrations promoted disease susceptibility of wild type plants to Psm ES4326 and suppressed SAR i nduction (Yasuda et al., 2008). In addition, treatment of the aba3 21 npr1 3 double mutant plants with exogenous ABA (10 M) for several days restored the basal susceptibility to a level similar to that observed in the npr1 mutant plants (Figure 3 3H). Taken together, the data presented here are consistent with the negative regulatory role of ABA in plant immunity (Audenaert et al., 2002; Anderson et al., 2004; de Torres Zabala et al., 2007; Asselbergh et al., 2008; Yasuda e Mang et al., 2012; Sanchez Vallet et al., 2012). It has been reported that the application of exogenous ABA could suppress SAR by inhibiting signal transduction both upstream and downstream of SA (Yas uda et al., 2008). In this study, we found that the aba3 npr1 double mutant plants accumulated higher SA levels than the npr1 single mutant after infection (Figure 3 1A, 3 1B, and 3 1C), indicating that ABA is a negative regulator of SA biosynthesis during pathogen infection. However, SA levels were not higher in the aba3 single mutant relative to the

PAGE 73

73 wild type after infection (Fan et al., 2009; data not shown), indicating that the functional NPR1 in aba3 likely suppres s es SA hyper accumulation during patho gen infec tion. This is consistent with previous studies that NPR1 is a feedback inhibitor of SA accumulation ( Wildermuth et al., 2001; Zhang et al., 2010). Thus, our data support that ABA acts as a negative regulator of SA biosynthesis during pathogen infe ction. NPR1 is a key regulator of SAR signaling downstream of SA. It is possible that ABA regulates plant immunity by controlling NPR1 either at the gene expression level or at the protein level. T he compromised defense phenotype in ABA treated plants or mutant plants with constitutively high ABA levels was reminiscent of the npr1 mutant (Figure 3 6A, 3 6B, and 3 6C), indicating that ABA compromises plant defense possibly through in activating NPR1 e ither at the mRNA level or at the protein level. Moreover, disruption of ABA signaling activated NPR1 depedent disease resistance (Figure 3 4). However, whether ABA impacts plant defense responses by regulating NPR1 needs to be further investigated. ABA has been shown also to play a positive regu latory role in plant immunity (r eviewed by Ton et al., 2009). We show ed here that the aba3 21 mutant and the sextuple pyr / pyl mutant (112458) were impaired in defense gene induction (Figure 3 7A and 3 7B). In addi tion, exogenous application of a low concentration of ABA increased the induction of defense genes during pathogen infection in aba3 (Figure 3 7C). Consistently, compromised defense gene induction caused by disruption of ABA signaling led to impaired biolo gical SAR induction in these mutants (Figure 3 7D). Our data clearly demonstrate that ABA signaling is essential for the induction of plant defense responses.

PAGE 74

74 Previous studies also reported that ABA has a multifaceted role in disease resistance depending on the layer of defense involved and/or the specific plant pathogen interactions analyzed (Ton et al., 2009; Cao et al.,2011). In addition to ABA biosynthesis, we demonstrate d here that ABA signaling also plays diverse roles even during infection of the sa me pathogen Psm ES4326. First, we show e d that ABA is a negative regulator of SA accumulation during infection. Second, we found that ABA signaling play s a negative role in basal resistance against Psm ES4326 . Thirdly, ABA signaling is essential for the full induction of defense genes. Finally, we show ed that ABA signaling plays a positive function in biological induction of SAR. Taken together, our data strongly support that ABA signaling plays both positive and negative regulatory functions in plant def ense against Psm ES4326 infection. Materials and Methods Plant Materials and Growth Conditions Arabidopsis thaliana Columbia (Col 0), Landsberg erecta and different mutants were used: sid2 1 (Wildermuth et al., 2001), aba1 5 (Léon Kloosterziel et al., 19 96), aba3 1 (Léon Kloosterziel et al., 1996), npr1 3 ( Glazebrook et al., 1996 ), abi1 1 (Kornneet et al., 1984), pyr1 pyl1 pyl2 pyl4 pyl5 pyl8 (112458) (Gonzalez Guzman et al., 2012), cds2D (Fan et al., 2009), npr1 L ( GT_5_89558 ). The n ahG transgenic line was obtained from Xinnian Dong. P lant growth condition s w ere used in this study as previously described in Chapter 2. Map based Cloning The hsn2 npr1 3 double mutant in the Columbia ecotype (Col 0) was crossed to the wild type Landsberg e recta , and F 2 progenies were scored for dark green phenotype. Rough mapping was first performed on 48 mutant plants to place hsn2 on

PAGE 75

75 the north arm of chromosome 1 between markers F21M12 and CIW12. Further markers were identified using The Arabidopsis Infor mation Resource website (http://arabidopsis.org/servlets/Search?action=new_search&type=marker), and a total of 1586 mutant plants were used for fine mapping. Markers generated in this study are listed in Table A 1. The hsn2 mutation was confirmed with deri ved CAPS markers (Table A 2) in the original mutant plant and in 150 independent F 2 mutant plants from the mapping populations. SA Measurement SA measurement was performed as described in Chapter 2. ABA Treatment ABA [(±) isomer; Acros Organics], was solubilized in ethanol. The ABA solution (diluted in water) was syringe infiltrated into 4 5 week old Arabidopsis leaves using a 1 mL needleless syringe. Control plants (mock) were treated identically with a solution o f 0.1% ethanol. For determination of PR gene expression, infiltrated leaves were collected for RNA extraction 24 hr after treatment. For the disease susceptibility test, infiltrated leaves were inoculated with a bacterial pathogen suspension 12 hr after AB A treatment or at the same time as ABA treatment . ABA Measurement ABA measurement was performed as previously reported with slight modifications (Cheng et al., 2013). Briefly, 0.1 g tissues were ground twice in liquid nitrogen and extracted for 24 hr at 4 °C on a rotary shaker with 1 mL of 80% acetone with 0.2% (v/v) acetic acid. A total of 500 L of the supernatant was dried under vacuum and then resuspended in 1 mL of 50% ethanol (v/v) containing 0.1 M NH 4 H 2 PO 4 by vo r texing. ABA was further cleaned up usi ng Sep Pak C 18 cartridges (Waters). After

PAGE 76

76 washing with 2 mL of 20% methanol containing 2% acetic acid, ABA was eluted with 4 mL of 60% methanol containing 2% acetic acid. 1mL was vaccum dried, resuspended in 250 L Tris buffered saline (TBS) buffer, and qu antified using the Phytodetek ABA ELISA kit (Agdia) following the manufacture s instructions. ABA was extracted from three independent samples and the data shown represent the mean ABA content of three replicates. Bacterial Strains and Pathogen Infection The virulent bacterial pathogen Psm ES4326 was grown at 28 °C overnight in mM MgCl 2 . Challenge inoculation was performed by pressure infiltration with a 1 mL needles s syringe as described previously (Clarke et al ., 1998). For SA measurement, two leaves on each four week old plant were infiltrated with Psm ES4326 bacterial suspension (OD 600 = 0.001). For the disease susceptibility test, OD 600 =0.0001 Psm ES4326 was used for inoculation, and in planta bacterial growth was assayed three days after infection. For the disease resistance test, OD 600 =0.001 Psm ES4326 was inoculated and in planta growth of Psm ES4326 was determined two and half days or three da ys after inoculation. For SAR evaluation, three lower leaves were inoculated with Psm ES4326 (OD 600 = 0.002) (+SAR) or 10 mM MgCl 2 (Mock, SAR) two days before secondary infection of one upper leaf with the Psm ES4326 (OD 600 = 0.001). The in planta bacteri al titers were assayed 3 days after secondary challenge inoculation. RNA Extraction and Real Time PCR RNA extraction was carried out as described previously (Cao et al., 1997). In brief, 0.1 g tissue was ground to a fine powder in liquid nitrogen and extra cted with warm water saturated phenol and RAPD buffer. The aqueous phase obtained was re -

PAGE 77

77 extracted with 24:1 chloroform isoamyl alcohol, and RNA was precipitated with ethanol by incubating at 80 °C for 1 hr. RNA was centrifuged for 15 min at 14000 rpm and washed once with 75% ethanol, dried at room temperature for 15 min, and dissolved in 40 L nuclease free water. For reverse transcription (RT), ~10 g of total RNA was trea ted with DNase I (Ambion) at 37 °C for 30 min for digestion of contaminating DNA. After inactivation of the DNase, ~2 g of total RNA was used as a template for first strand cDNA synthesis using the M MLV Reverse Transcriptase first strand synthesis system (Promega). The resulting cDNA p roducts were diluted 20 fold with autoclaved ddH 2 o, and 2.5 L used for quantitative PCR. Quantitative PCR was performed in an Mx3005P qPCR system (Stratagene). All PCR reactions were performed with a 12.5 L reaction volume using the SYBR Green protocol u nder the following condi tions: denaturation program (95 °C for 10 min), amplification and quantification program repeated for 40 cycles (95°C for 30 sec, 55°C for 1 min, 72 °C for 1 min), and melting curve program (95°C for 1 min, 55°C for 30 sec, and 95 °C f or 30 sec). Statistics One way analysis of variance (ANOVA) was used to determine statistical significance among genotypes or treatments at P<0.05. In addition, two way analysis of variance was used to examine the effects of genotypes, treatments, and th e interaction of these two factors on disease resistance. Post hoc comparison was performed using letters. Alternatively, statistical analyses were performed using St t test for

PAGE 78

78 comparison of two data sets. A * indicates a statistically significant difference at the level of at least 95% confidence. Accession Numbers The locus numbers for the genes discussed in this study are as follows: ABA1 (At5g67030), ABA2 (At1g52340), ABA3 (At1g16540), ABI1 (At4g26080), NPR1 (AT1G64280), UBQ5 (At3g62250), PR1 (At2g14610), WRKY18 (At4g31800), WRKY38 (At5g22570), WRKY62 (At5g01900).

PAGE 79

79 Figure 3 1. Isolation of the hsn2 npr1 3 mutant. A) Luminescence from Psm ES4326 infected Col 0, npr1 3 , and hsn2 npr1 3 plants detected by the SA biosensor based method. Four to five week old soil grown plants were inoculated with Psm ES4326 (OD 600 =0.001). The infected leaves were collected 24 hr post inoculation (hpi) for S A measurement. Data represent the mean of eight independent samples with SD. B) and C) Free B) and total (C) SA levels in Psm ES4326 infected WT, npr1 3 , and hsn2 npr1 3 plants detected by the HPLC based method. Plants were treated as in (A). Data represen t the mean of three independent samples with SD. FW, fresh weight; SAG, SA 2 O D glucoside. D) Morphology of hsn2 np r 1 3 . Plants were grown under long day conditions at 22°C. Photos were taken 22 days after germination. Different letters above the bars i n (A), (B), and (C) indicate significant differences (P < 0.05, tested by one way ANOVA). All experiments were repeated with similar results.

PAGE 80

80 Figure 3 2. Defense phenotypes of the hsn2 npr1 3 mutant. A) Visual phenotype of Psm ES4326 infected Col 0, npr1 3 , and hsn2 npr1 3 leaves. Four to five week old soil grown plants were inoculated with Psm ES4326 (OD 600 = 0.0001). Photos were taken 3 days after inoculation. B) Growth of Psm ES4326 in Col 0, npr1 3 , and hsn2 npr1 3 plants. Four to five week old soil grown plants were inoculated with Psm ES4326 (OD 600 = 0.0001). The in planta bacterial titers were determined immediately and at 3 dpi. Data represent the mean of eight independent samples with SD. C) Growth of Psm ES4326 in Co l 0, npr1 3 , and hsn2 npr1 3 plants. Four to five week old soil grown plants were inoculated with Psm ES4326 (OD 600 = 0.001). The in planta bacterial titers were determined two and half day s post inoculation. Data represent the mean of eight independent s amples with SD. D) Growth of Psm ES4326 in wild type Col 0 , npr1 3 , hsn2 npr1 3, hsn2 npr1 3 n ahG, and n ahG plants. Four to five week old soil grown plants were inoculated with Psm ES4326 (OD 600 = 0.0001). The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. E) Growth of Psm ES4326 in wild type Col 0 , npr1 3, sid2 1, hsn2 npr1 3, and hsn2 sid2 1 npr1 3 plants. Four to five week old soil grown plants were inoculated with Psm ES4326 (OD 600 = 0.0001). The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Different letters above the bars in (B), (C), (D), and (E) indicate significant differences (P < 0.05, tested by one way ANOVA). All the experiments were repeated with similar results. cfu, colony forming units.

PAGE 81

81 Figure 3 3. Map based cloning of hsn2 . A) A schematic diagram of the map based cloning process. A total of 48 F 2 progeny homozygous for hsn2 were used to determine the approximate position of the hsn2 mutation using bulked segregant analysis. hsn2 was linked to the markers F21M12 and CIW12 on the north arm of chromosome 1. Out of a total mapping population of 1586 mutant plants, two were heter ozygous at M1, and four were heterozygous at M5. The heterozygotes found by these two markers were mutually exclusive. No heterozygotes were found at M2, M3, and M4. Novel markers used in this process are listed in Table A 1. cM, cen timorgan; Rec., recombi nation. B) DNA polymorphism between hsn2 and wild type Col 0. A new CAPS marker was generated based on the hsn2 mutation (Table A 2). The PCR products amplified from hsn2 npr1 3 and Col 0 genomic DNA were digested with Mse I an d separated on an agarose gel . C) The hsn2 mutation causes alternative splicing of the ABA3 gene. A pair of primers (Table A 4) spanning the mutated splicing site were used. One band was amplified from wild type Col 0 cDNA, whereas multiple fragments were amplified from hsn2 npr1 3 cD NA. D) Free Psm ES4326 induced SA levels. Luminescence from Psm ES4326 infected Col 0, npr1 3 , hsn2 npr1 3 , F1, and aba3 1npr1 3 detected by the SA biosensor based method. Values are the mean of eigh t independent samples with SD. E) Growth of Psm ES4326 in Col 0, npr1 3 , hsn2 npr1 3 , F1, and aba3 1npr1 3 plants. The plants were infiltrated with a bacterial suspension of OD 600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent means with standard deviation (SD) of eight independent samples. F) The plants were grown on soil for 25 days before the photos were taken. G) Quantification of ABA levels in aba3 1 , hsn2 and Col 0. Leaf samples were collected from four to five week old soil grown plants for ABA measurement. Data a re means with SD (n = 3) from three biologi cal repeats. FW, fresh weight. H) Growth of Psm ES4326 in npr1 3 , water treated hsn2 npr1 3 , and ABA treated (10 M) hsn2 npr1 3 plants. The plants were infiltrated with a bacterial suspension of OD 600 = 0.0001. T he in planta bacterial titers were determined 3 dpi. Data represent means with standard deviation (SD) of eight independent samples. I) The phenotypes of hsn2 npr1 3 were rescued by spraying with ABA. Shown are npr1 3 , water treated hsn2 npr1 3 , and ABA tr eated (10 M) hsn2 npr1 3 plants. All experiments were repeated with similar results. Different letters above the bars in (D), (E), (G), and (I) indicate statistically significant differences (p<0.05, tested by one way ANOVA). Cfu, colony forming units. A

PAGE 82

82 Figure 3 3. Continued B C D E F

PAGE 83

83 Figure 3 3. Continued +ABA G I H +ABA

PAGE 84

84 Figure 3 4. Disruption of ABA signaling confers NPR 1 dependent defense responses. A) Growth of Psm ES4326 in Col 0, npr1 3 , aba3 1 , aba3 21 , aba1 5 , aba3 1 npr1 3 , aba3 21 npr1 3 , aba1 5 npr1 3 , 112458, L er 2 2 , npr1 L, abi1 1 , and abi1 1 npr1 L plants. The plants were infiltrated with a bacterial suspension of OD 600 = 0.001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Cfu, colony forming units. B) Total RNA was extracted from similar size untreated Col 0, npr1 3 , aba3 1 , aba3 21 , aba1 5 , aba3 1 npr1 3 , aba3 21 npr1 3 , aba1 5 npr1 3 , 112458, L er 2 2, npr1 L, abi1 1 , and abi1 1 npr1 L plants. The expression of PR1 was analyzed by qPCR and normalized against constitutively expressed UBQ5 . Data represent the mean of three independent samples with SD. Differe nt letters above the bars in (A ) indicate significant differences (P <0.05, tested by one way ANOVA), and an asterisk t test). All experiments were repeated three times with similar results. A B

PAGE 85

85 Figure 3 5. SA is req u ired for ABA deficienc y mediated dis ease resistance. A) Growth of Psm ES4326 in Col 0, aba3 21 , n ahG, and aba3 21 n ahG plants . The plants were infiltrated with a bacterial suspension of OD 600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eigh t independent samples with SD. B) Growth of Psm ES4326 in Col 0, sid2 1 , aba3 21 , and aba3 21 sid2 1 plants. The plants were infiltrated with a bacterial suspension of OD 600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. Different letters above the bars in (A) and (B) indicate significant differences (P<0.05, tested by one way ANOVA). The experiment was repeated with similar results. Cfu, colony forming units. A B

PAGE 86

86 Figure 3 6. High ABA suppresses defense responses in Arabidopsis. A) Growth of Psm ES4326 in wild type plants treated with or without ABA, and npr1 3 mutant plants. Four week old soil grown plants were infiltrated with ABA solution (80 M in 0.1% ethanol) or water (0.1% e thanol). After 12 hr, the infiltrated leaves were inoculated with the bacterial pathogen Psm ES4326 (OD 600 =0.0001). Eight leaves were collected 3 days post inoculation to examine the growth of the pathogen. Data represent the mean of eigh t independent sam ples with SD. B) Expression of PR1 gene in wild type plants treated with or without ABA, and npr1 3 mutant plants. Two leaves of four week old soil grown plants were infiltrated with ABA solution (80 M in 0.1% ethanol) or water (0.1% ethanol). Total RNA w as extracted from leaf tissues collected 24 hr later and subjected to qPCR analysis. PR1 transcript levels were normalized to the expression of UBQ5 in the same samples. Data represent the mean of thre e independent samples with SD. C) Growth of Psm ES4326 in Col 0, npr1 3 , cds2D , and cds2D npr1 3 double mutant plants. The plants were infiltrated with a bacterial suspension of OD 600 = 0.0001. The in planta bacterial titers were determined 3 dpi. Data represent the mean of eight independent samples with SD. D ifferent letters above the bars in (A), (B), and (C) indicate statistically significant differences (p<0.05, tested by one way ANOVA). The experiment was repeated three times with similar results. Cfu, colony forming units.

PAGE 87

87 Figure 3 7. ABA signaling is required for the full I nduction of NPR1 target genes. A) Psm ES4326 induced expression of PR1 , WRKY18 , WRKY38 , and WRKY62 in Col 0, aba3 21 , and pyr1 pyl1 pyl2 pyl4 pyl5 pyl8 (112458) plants. Four to five week old soil grown plants were inocu lated with Psm ES4326 (OD 600 = 0.001). Total RNA was extracted from the inoculated leaves collected at the indicated time points and analyzed for the expression of indicated genes using qPCR. Expression was normalized against constitutively expressed UBQ5 . Data represent the mean of three independent samples with SD. The comparison was made separately among Col 0, aba3 21 , a nd 112458 for each time point. B) SA induced expression of PR1 , WRKY18 , WRKY38 , and WRKY62 in Col 0, aba3 21 , and 112458 plants. Four to five week old soil grown plants were treated with soil drenches plus foliar sprays of 0.5 mM of SA solution or water. After 24 hr, leaf tissues were collected and subjected to total RNA extraction and qPCR analysis. Data represent the mean of three inde pendent samples with SD. The comparison was made separately among Col 0, aba3 21 , a nd 112458 for each time point. C) Psm ES4326 induced expression of PR1 , WRKY18 , WRKY38 , and WRKY62 in aba3 21 treated with or without 10 M ABA. Five week old aba3 21 plants were pretreated with 10 M ABA ( in 0. 0 1 % ethanol ) or mock (0. 0 1 % ethanol) two hr before inoculation of Psm ES4326. Total RNA was extracted from the inoculated leaves collected 24 hr later and analyzed for the expression of indicated genes using qPC R. Expression was normalized against constitutively expressed UBQ5 . Data represent the mean of thre e independent samples with SD. D) Induction of SAR against Psm ES4326 in Col 0, 112458, and aba3 21 plants. Three lower leaves on each plant were inoculated with Psm ES4326 (OD 600 = 0.002) (+SAR) or 10 mM of MgCl 2 ( SAR). After 2 d, one upper uninfected/untreated leaf was challenge inoculated with Psm ES4326 (OD 600 = 0.001). The in planta bacterial titers were determined 3 d after challenge inoculation. Data r epresent the mean of eight independent samples with SD. Cfu, colony forming units. Asterisks indicate statistically significant differences compared with uninduced WT plants (Tukey Kramer ANOVA test; a = 0.05, n = 8). Different letters above the bars in (A ), (B), and (C) indicate statistically significant differences (p<0.05, tested by one way ANOVA). All experiments were repeated three times with similar results. A

PAGE 88

88 Figure 3 7. Continued B C D

PAGE 89

89 CHAPTER 4 ABA AND SA COOPERATE TO REGULATE THE HOMEOSTASIS OF THE TRANSCRIPTION COACTIVATOR NPR1 IN PLANT IMMUNITY Background Information Plants, as sessile organisms, often encounter environmental stresses, including biotic and abiotic stresses, during their life cycl e. In addition to constitutive physical and chemical strategies, plants have developed an effective inducible defense system against a variety of stresses (Glazebrook, 2005; Jones and Dangl, 2006; S antner and Estelle, 2009). P lant hormones have been shown to play central roles in modulating diverse plant defense responses. Defense against biotic threats is largely contributed by SA and JA/ET mediated signaling pathways, while abiotic stress responses are mainly controlled by ABA (Kunkel and Brooks, 2002). SA is a positive regulator of defense responses against biotrophic and hemibiotrophic pathogens (Dong, 2004). In the last two decades, another key player of plant immunity, NPR1, has been shown to function downstream of SA (Fu and Dong, 2013). The NPR1 gene is constitutively expressed throughout the plant, and the levels of NPR1 transcript only increase two to three fold after pathogen infection or SA treatment, suggesting that NPR1 is mainly regulated at the protein level (Ryals et al., 1997; Cao et a l., 1997; Dong, 2004). Moreover, the NPR1 overexpressing lines do not constitutively express PR genes, indicating that NPR1 protein must be activated to be functional (Durrant and Dong, 2004). In the absence of induction, NPR1 oligomer forms through interm olecular disulfide bonds in the cytosol (Mou et al., 2003). Upon induction, these disulfide bonds are reduced, triggering movement of NPR1 monomer into the nucleus, where it acts as a coactivator for transcription factors, such as TGAs, to induce PR genes (Kinkema et al., 2000; Mou et al., 2003). Cysteine residue 156 has been

PAGE 90

90 shown to be important for NPR1 oligomer formation through S nitrosylation by S nitrosoglutathione (Tada et al., 2008). Recent studies revealed that NPR1 could be polyubiquitinyla ted by the Cullin 3 E3 ligase and consequently degraded by the 26S proteasome (Spoel et al., 2009; Fu et al., 2012). SAR activation can promote phosphorylation of NPR1, resulting in its degradation (Spoel et al., 2009). Thus, it has been proposed that prot easome mediated NPR1 degradation plays dual functions in plant immunity (Spoel et al., 2009). Fu et al. (2012) reported that NPR3 and NPR4 mediate NPR1 degradation in a SA concentration dependent manner and serve as SA receptors. SA disrupts the interactio n between NPR1 and NPR4, rendering NPR1 less susceptible to degradation, whereas SA facilitates the interaction between NPR1 and NPR3, promoting NPR1 degradation (Fu et al., 2012). While ABA is w ell known for its role in mediating tolerance to abiotic stre sses, recent studies also revealed that ABA has a crucial role in regulating responses to biotic stresses (Ton et al., 2009; Cao et al., 2011 ). It has been reported that ABA negatively regulates plant disease resistance against (hemi)biotrophic pathogens b y antagonizing the SA signaling pathway (Yasuda et al., 2008; Fan et al., 2009; Cao et al., 2011; Xu et al., 2013). Nevertheless, how ABA regulates plant disease resistance is not yet fully understood. In this study, we investigated the underlying mechani sm of the effect of ABA on plant immunity. Our findings revealed a novel mechanism that integrates SA signaling and ABA signaling to coordinate biotic and abiotic stresses.

PAGE 91

91 Results ABA Negatively Regulates NPR1 Protein Accumulation Based on genetic analysi s, we reasoned that ABA might regulate plant disease resistance through NPR1 either at the transcriptional level or at the posttranscriptional level or both. To examine the effect of ABA on NPR1 gene expression, a meta analysis of public microarray data wa s performed using Genevestigator (Zimmermann et al., 2004). We found that NPR1 mRNA levels are not significantly affected by ABA treatments in adult plants (data not shown). To further investigate whether ABA regulate s NPR1 gene expression, we performed a real time PCR analysis. Treatment with ABA induced the ABA responsive gene RAB18 in a dose dependent manner (Figure 4 1A), whereas ABA did not have a substantial effect on the expression of NPR1 (Figure 4 1B). On the basis of this result, we postulated that the effect of ABA on NPR1 might be post transcriptional. To test this possibility, we treate d plants expressing Myc NPR1 driven by its endogenous promoter with ABA (Zhang et al., 2012). Strikingly, ABA treatment led to a significant decrease in Myc NPR1 protein levels (Figure 4 2A). To confirm that ABA is capable of reducing the abundance of NPR1 protein, we used the previously characterized 35S::NPR1 GFP (in npr1 1 ) transgenic plants (Kinkema et al., 2000). After ABA tre atment, we observed a decrease in NPR1 GFP protein levels (Figure 4 2B), though to a lesser extent than in Myc NPR1 levels (Figure 4 2A). The effect of ABA on NPR1 GFP protein was probably post transcriptional because ABA did not reduce transcript levels o f NPR1 GFP (Figure 4 2C). To verify that high levels of ABA reduce the abundance of NPR1 protein, we crossed NPR1::Myc NPR1 and 35S::NPR1 GFP into the cds2D mutant, which constitutively accumulates elevated levels of ABA (Fan et al., 2009). As shown in Fig ure 4 2D, Myc NPR1 and

PAGE 92

92 NPR1 GFP in the cds2D mutant were significantly decreased. Since plants with high levels of ABA exhibit compromised defense responses (Figure 4 2E; de Torres Zabala et al., 2007; Yasuda et al., 2008; Fan et al., 20 09), these findings su ggest that ABA may negatively regulate plant defense responses by modul ating the abundance of NPR1. ABA might interfere with the production or stability of the NPR1 protein, leading to its concentration decrease. To investigate this, 4 week old NPR1: :Myc NPR1 plants were treated with the protein synthesis inhibitor cycloheximide (CHX) followed by treatment with or without 80 M ABA. As shown in Figure 4 2F, the amount of NPR1 protein was reduced after CHX treatment, and decreased more rapidly in the p resence of both CHX and ABA , indicating that ABA likely impacts NPR1 protein stability rather than NPR1 protein production. To confirm that ABA modulates NPR1 protein stability , we examined the accumulation of NPR1 in the aba3 21 mutant. We introduced the NPR1::Myc NPR1 and 35S::NPR1 GFP transgenes into the aba3 21 mutant background through genetic crosses. As shown in Figure 4 3A, NPR1 protein levels were significantly higher in the aba3 21 mutant than in the wild type. The increased accumulation of NPR1 p rotein in aba3 may explain why the aba3 mutant plants show elevated levels of the NPR1 target gene PR1 and basal resistance (Figure 3 4; de Torres Zabala et al., 2007; Fan et al., 2009; Sanchez Vallet et al., 2012). Notably, the defense phenotype in the ab a mutant is reminiscent of both cul3a cul3b and npr3 npr4 double mutants (Spoel et al., 2009; Fu et al., 2012), further corroborating that ABA negatively regulates NPR1 protein accumulation .

PAGE 93

93 ABA Triggers NPR1 Monomer Degradation via the 26S Proteasome Pathway Since NPR1 protein turnover is mediated by the 26S proteasome during SAR (Spoel et al., 2009), we next investigated whether ABA promoted degradation of NPR1 speci fic ally requires proteasome activity. The NPR1::Myc NPR1 transgenic plants were treat ed with the 26S proteasome inhibitor MG115 before addition of ABA. As reported previously (Spoel et al., 2009), inhibition of proteasome activity markedly increased the accumulation of Myc NPR1 protein (Figure 4 4A). ABA induced degradation of Myc NPR1 was clearly attenuated by MG115 (Figure 4 4A), suggesting that ABA triggered NPR1 degradation is dependent on the 26S proteasome pathway. To further confirm that ABA promoted NPR1 turnover depends on the 26S proteasome activity, we treated the 35S::NPR1 GFP transgenic plants with ABA in the presence of MG115. As observed previously (Mou et al., 2003; Spoel et al., 2009), MG115 treatment substantially enhanced the abundance of NPR1 GFP in the nucleus (Figure 4 4B). P lants treated with both MG115 and ABA still showed detectable GFP fluorescence in the nuclei, albeit at a level lower than that observed in the MG115 treated plants (Figure 4 4B). Consistently , western blot analysis showed that treatment with the proteasome inhibitor MG115 significantly enhanced NPR 1 GFP protein accumulation and blocked the ABA induced degradation (Figure 4 4C). Taken together, these results indicate that ABA promotes proteasomal degradation of NPR1 protein. Previous studies have shown that NPR1 can be polyubiquitinylated by a Cullin 3 E3 ligase, leading to its proteasomal degradation (Spoel et al., 2009; Fu et al., 2012). Therefore, we examined if Cullin 3 E3 ligase is required for ABA promoted NPR1 degradation. Four week old wild type and cul3a cul3b plants carrying 35S::NPR1 GFP co nstruct were treated with ABA. As shown in Figure 4 5A, ABA treatment led to a

PAGE 94

94 significant decrease of NPR1 GFP protein in the wild type, whereas ABA induced NPR1 GFP degradation was partially blocked in the cul3a cul3b mutant plants. This could be due to incomplete knockout of Cullin 3 E3 ligase or existence of other E3 ligase mediated NPR1 turnover in the presence of ABA. Next, we tested whether Cullin 3 E3 ligase is required for ABA promoted NPR1 degradation in SA induced plants. As shown in Figure 4 5B, ABA reduced NPR1 accumulation even in the presence of SA, whereas NPR1 protein levels remained unchanged in the cul3a cul3b mutant, suggesting that Cullin 3 E3 ligase is required for ABA induced NPR1 degradation in the presence of SA. To demonstrate furth er that ABA induced NPR1 degradation requires the CUL3 E3 ligase, we tested whether ABA promotes the interaction between them. A co immunoprecipitation assay was performed using transgenic plants expressing Myc NPR1 in the wild type and aba3 21 mutant plants. We found that the amount of the endogenous CUL3 protein pulled down by Myc NPR1 was markedly less in the aba3 21 mutant than in the wild type (Figure 4 5C), suggesting that the Myc NPR1 interaction with CUL3 requires ABA. Taken together, th ese data indicate that ABA promoted NPR1 proteolysis requires the CUL3 E3 ligase. NPR1 monomer has been shown to be degraded in the nucleus (Spoel et al., 2009). To investigate whether ABA induced NPR1 degradation also occur s in the nucleus, we examined th e in vivo stability of NPR1 GFP and the nuclear localization sequence mutant npr1 nls GFP by treating plants with ABA. After ABA treatment, the amount of NPR1 GFP decreased, whereas the levels of npr1 nls GFP remained almost unchanged (Figure 4 6A), indica ting that ABA induced NPR1 degradation may occur in the nucleus. We then investigated if NPR1 oligomers and monomers are equally

PAGE 95

95 sensitive to ABA promoted proteasomal degradation by testing the in vivo stability of NPR1C156A GFP and NPR1 GFP in the presenc e of ABA. Upon ABA treatment, NPR1C156A GFP protein decreased much faster than the NPR1 GFP protein (Figure 4 6B). In agreement with the observed rapid degradation rate of NPR1C156A GFP protein, treatment with ABA resulted in more susceptibility of 35S::NP R1C156A GFP plants to Psm ES4326 (Figure 4 6C). Taken together, these results indicate that ABA promoted NPR1 proteolysis may occur in the nucleus and NPR1 m onomer is more sensitive to ABA promoted degradation . SA Decelerates ABA Promoted NPR1 Degradation SA has been shown to be able to trigger NPR1 oligomer to monomer transition and monomeric NPR1 is then translocated into the nucleus, where NPR1 acts as a transcriptional co activator to induce PR genes (Kinkema et al., 2000; Mou et al., 2003; Spoel et al ., 2009). To examine whether ABA has an effect on the SA induced NPR1 nuclear translocation, we pretreated the 35S::NPR1 GFP transgenic plants with ABA 12 hr before addition of SA. As reported previously, SA treatment led to accumulation of NPR1 GFP monome r in the nucleus (Figure 4 7A and C). Strikingly, SA induced monomer was completely absent in the presence of ABA, as shown in Figure 4 7D. Accordingly, western blot analysis demonstrated that SA treatment did not rescue NPR1 GFP from degradation triggered by ABA (Figure 4 8A). Similar results were obtained for Myc NPR1 protein (Figure 4 8B). Consequently, SA induced expression of NPR1 dependent defense gene PR1 was strongly suppressed in the ABA pretreated plants (Figure 4 8C), which is consistent with a p revious report that ABA treatment suppresses BIT and BTH induced PR1 expression (Yasuda et al., 2008). Next, we examined whether a high endogenous ABA level is also able to reduce NPR1 protein

PAGE 96

96 accumulation in the presence of SA. As shown in Figure 4 9A an d 4 9B, SA treatment was not able to rescue NPR1 GFP protein and Myc NPR1 protein in the cds2D mutant plants. Collectively, these data demonstrate that ABA promotes the degradation of NPR1 protein even in the presence of SA, which provide s an explanation f or the compromised SAR in plants with high levels of ABA (Figure 4 8D; Yasuda et al., 2008; Fan et al., 2009). Accumulating evidence supports an antagonistic relationship between SA and ABA in plant defense responses (Flors et al., 2008; Yasuda et al., 200 8; de Torres Zabala et al., 2009). This prompted us to investigate whether SA pretreatment can counteract the effect of ABA on the stability of NPR1 protein. We pretreated the 35S::NPR1 GFP transgenic plants with SA 24 hr before addition of ABA. Interestin gly, ABA treatment barely inhibited SA induced nuclear translocation of NPR1 GFP (Figure 4 7F), and resulted in a slight decrease in total NPR1 protein (Figure 4 10A). However, compared with pretreatment with ABA, SA pretreatment appeared to be able to cou nteract the effect of ABA on the abundance of NPR1 protein (Figure 4 7D and 4 7F, Figure 4 8B, Figure 4 10A). Moreover, when SA and ABA were applied at the same time, SA seemed to be less effective in protect ing NPR1 protein than pretreatment (Figure 4 10C and 4 10D). Taken together, these data suggest that SA is able to decelerate ABA induced NPR1 degradation. Previously, SA was shown to be able to promote NPR1 phosphorylation (Spoel et al., 2009). Taking advantage of the previously generated 35S: :npr1S11 / 15D GFP (in npr1 2 ) transgenic plants (Spoel et al., 2009), we tested whether SA decelerates ABA induced NPR1 degradation through promoting its phosphorylation. We first examined

PAGE 97

97 the in vivo stability of NPR1 GFP and npr1S11/15D GFP in the presenc e of ABA, and found that npr1S11/15D GFP exhibited a decreased degradation rate compared to NPR1 GFP (Figure 4 11A), indicating that phosphorylated NPR1 is more stable in the presence of ABA. Based on this, we hypothesized that 35S::npr1S11 / 15D GFP plants may be insensitive to ABA induced disease susceptibility. To test this hypothesis, we pretreated 35S::NPR1 GFP and 35S::npr1S11 / 15D GFP plants with ABA or Mock. After 12 hr, the treated leaves were inoculated with Psm ES4326. The growth of the bacterial pa thogen in the leaves was determined 3 days post inoculation. As shown in Figure 4 11B, the growth of Psm ES4326 was significantly higher in the ABA treated 35S::NPR1 GFP plants than in the mock treated 35S::NPR1 GFP plants, whereas there was no significant difference between ABA treated and mock treated 35S::npr1S11 / 15D GFP plants. However, in two of five experiments, we did not detect the significantly negative effect of ABA on NPR1 GFP protein accumulation and disease resistance, indicating that NPR1 GFP protein can be modified or the effect of ABA on NPR1 GFP protein can be modulated by unidentified environmental conditions. Overall, these data indicate that SA decelerates ABA promoted NPR1 degradation likely through promoting NPR1 phosphorylation. ABA I nduced NPR1 Degradation Dampens Defense Responses after Pathogen Infection Subsides Interplay between SA and ABA has been indicated to be crucial for plant immune responses, including SAR ( Yasuda et al., 2008 ; de Torres Zabala et al., 2009; Fan et al., 200 9; Choi and Hwang, 2011). To examine the effect of endogenous SA and ABA on SAR, we analyzed both SA and ABA levels in systemic tissues of wild type Col 0 and aba3 21 mutant plants infected with the virulent bacterial pathogen Psm ES4326.

PAGE 98

98 As shown in Figur e 4 12A and 4 12B, the SA level peaked at 24 hpi in wild type systemic leaves and then decreased to basal levels by the end of the experiment, whereas the ABA level reached the highest level at 48 h r , and then decreased . In contrast, although the dynamic p attern of systemic SA accumulation in aba3 was similar to that in the wild type, ABA remained unchanged (Figure 4 12A and 4 12B). Together with the finding that the aba3 21 mutant is defective in SAR induction, these results support that endogenous ABA and SA cooperate to regulate SAR. Since NPR1 is regulated by both SA and ABA, we hypothesized that SA and ABA may cooperate to control SAR through NPR1. To test this, we first examined the accumulation kinetics of the Myc NPR1 protein in systemic tissues of w ild type and aba3 21 plants during the time course of SAR development. As shown in the western blot in Figure 4 13A, the Myc NPR1 protein showed a significant increase at 36 hr after infection, and then decreased to basal levels . In contrast, the dynamic c hanges of Myc NPR1 protein levels in aba3 21 were significantly diminished (Figure 4 13A). We also analyzed the transcription profiles of the SAR marker gene PR1 in the systemic tissues. Consistent with the notion that PR1 is one of the NPR1 target gene s , the expression pattern of PR1 coincided well with that of the Myc NPR1 protein (Figure 4 13B). To eliminate the effect of transcriptional regulation on NPR1 protein level, we also examined the 35S::NPR1 GFP transgenic plants, which constitutively express t he transgene independent of SA (Spoel et al., 2009). As shown in Figure 4 15, NPR1 GFP protein concentration exhibited a similar dynamic pattern as the Myc NPR1 protein during biological induction of SAR. Together with the accumulation kinetics of SA and A BA during SAR induction (Figure 4 12A and 4 12B), these data suggest that both SA

PAGE 99

99 and ABA appears to be required for the accumulation and/or activation of NPR1, whereas the inactivation of SAR may be attributed to the reduction and/or deactivation of NPR1 due not only to the decreased SA concentration s but also to the elevated levels of ABA . To further demonstrate the role of ABA and SA in the inactivation of SAR, we performed a n experiment to mimic the dynamic changes of SA and ABA during pathogen infectio n . Since SA accumulation precedes ABA accumulation during biological induction of SAR, we first activated plant defense responses by treating the NPR1::Myc NPR1 transgenic plants with SA. After 24 hr, SA was removed. At the same time, plants were treated w ith ABA or a mock solution . As shown in Figure 4 14A and 4 14B, NPR1 protein and its target gene PR1 in the mock treated NPR1::Myc NPR1 plants decreased after removing SA, indicating that SA has an important role in maintaining NPR1 protein level and activ ating SAR. However, treatment with ABA resulted in a rapid reduction of NPR1 protein, leading to a quick decrease of PR1 gene expression, suggesting that ABA has a crucial role in inactivating SAR. Moreover, NPR1 protein and its target gene PR1 in aba3 21 mutant plants showed a relatively slow decrease rate after removing SA (Figure 4 14A and 4 14B), further supporting that ABA is involved in inactivation of SAR. Taken together, these data support that the inactivation of SAR is attributed to the reduction of NPR1 protein not only due to the decreased SA level s but also due to the elevated ABA level s when pathogen infection subsides. To dissect the individual role of ABA signaling and SA signaling in maintaining SAR, we tested the effect of shifting either SA or ABA signaling on the accumulation

PAGE 100

100 kinetics of NPR1 protein. We first infected the NPR1::Myc NPR1 transgenic plants with the bacterial pathogen Psm ES4326. After 24 hr, systemic tissues of infected plants were then treated with SA or DFPM, which is an inhibitor of ABA signaling (Kim et al., 2011). As shown in Figure 4 16A, 4 16B, and 4 16C, either enhancement of SA signaling or inhibition of ABA signaling was capable of stabilizing NPR1 protein, consequently maintaining PR1 gene expression at high leve ls. Since SA accumulation precedes ABA accumulation during biological induction of SAR (Figure 4 12), we ne xt examined the effect of pre activation of ABA signaling on SAR. As shown in Figure 4 16D, pre activation of ABA signaling blocked the accumulation of NPR1 protein (Figure 4 16D), leading to a significant suppression of PR1 gene expression (Figure 4 16E). Taken together, these data support that ABA and SA cooperate to regulate SAR by controlling the homeostasis of NPR1. SA Suppresses ABA Signaling possibly through Phosphorylation of NPR1 In many biological processes of plants , such as responses to abiotic and biotic stresses, the proteasome either degrades activators to suppress gene expression or degrades repressors to activate transcription (Small e and Vierstra, 2004). Previously, Yasuda et al. (2008) reported that NPR1 might be involved in the suppressive effect of SAR signaling on ABA signaling. Therefore, the observ ation of ABA promoted proteasome mediated degradation of NPR1 led us to investiga te whether NPR1 is a suppressor of ABA signaling. Since ABA promotes seed dormancy and inhibits seed germination ( Wasilewska et al., 2008 ), we hypothesized that NPR1 may be involved in regulating these processes. In our ABA response assays, the wild type and three npr1 mutant alleles, npr1 1 , npr1 2 , and npr1 3 , were equally sensitive to the inhibitory effect of ABA during seed germination (Figure 4 17A ). We reasoned that the presence of ABA

PAGE 101

101 likely promotes NPR1 degradatio n, making the wild type resembling npr1 mutants. If this were true, we expected that overexpression of the npr1S11/15D GFP protein, which is less sensitive to ABA promoted degradation, would reduce the sensitivity to ABA. Indeed, 35S::npr1S11 / 15D GFP seedling was less sensitive to the inhibitory effect of ABA than the 35S::NPR1 GFP seedling during postgerminative growth (Figure 4 17B and 4 17C). Consistent with this, the exp ression of ABA responsive genes, including RAB18 , RD22 , COR15A , RD29A , and RD29B , was significantly decreased in 35S::npr1S11 / 15D GFP seedlings compared with that in 35S::NPR1 GFP seedlings after ABA treatment (Figure 4 17). Together with the fact that SA promotes NPR1 phosphorylation, these results indicate that SA suppresses ABA signaling likely by promoting NPR1 phosphorylation. Discussion Proteasome mediated protein degradatio n has been directly or indirectly implicated in the action of plant hormones, including auxin, gibberellins, ABA, JA, SA, and ethylene (Hellmann and Estelle, 2002; Smalle and Vierstra, 2004; Dreher and Callis, 2007; Stone and Callis, 2007; Spoel et al., 20 09). Hormone signaling often leads to a secondary modification of transcriptional activators or repressors, resulting in either their degradation or stabili zation . In this study, we show ed that ABA negatively affects the stability of NPR1 to regulate plant immunity, and that NPR1 takes part in the suppressive effect of SA signaling on ABA mediated signaling, providing an important mechanism that integrates SA signaling and ABA signaling to coordinate biotic and abiotic stresses. Several reports have shown t hat exogenous application of ABA increases plant susceptibility to pathogen infections that activate SA mediated defense signaling. Mohr

PAGE 102

102 and Cahill (2003) reported that ABA treatment increased the susceptibility of Arabidopsis plants to the biotrophic oomy cete pathogen Peronospora parasitica and the avirulent bacterial pathogen Pst 1065 but not to the virulent pathogen Pst DC3000. However, other studies showed that the activation of ABA signaling actually could enhance the bacterial virulence of Pst DC3000 by either ABA treatment or the bacterial T3E or abiotic stress (de Torres Zabala et al., 2007 ; Fan et al., 2009). In our study, exogenous application of ABA was able to promote the susceptibility of Arabidopsis plants to Psm ES4326 in a dose dependent mann er (Figure 4 2E). This is consistent with a previous report that the ABA level is directly correlated with the growth of virulent bacterial pathogens in Arabidopsis (de Torres Zabala et al., 2009). ABA has been shown to suppress inducible defense response s by inhibiting the pathway both upstream and downstream of SA ( Yasuda et al., 2008; de Torres Zabala et al., 2009). In the last chapter, we showed that endogenous ABA is able to suppress the accumulation of SA during pathogen infection. Here, we successfu lly demonstrate that ABA regulates plant immunity through affecting the stability of NPR1 protein, which is a key regulator of plant immunity downstream of SA. We used both genetic and biochemical approaches to show that ABA promotes the proteasome mediate d degradation of NPR1 protein, which plays both positive and negative functions in regulating plant immune responses. NPR1 contains a BTB domain, which is the general structure of an adaptor protein for the Cullin 3 E3 ligase. Spoel et al. (2009) demonstrated that NPR1 associates with CUL3 and is degraded by the 26S proteasome possibly mediated by other BTB domain contain ing adaptor proteins. Very recently, NPR1 paralogs, NPR3

PAGE 103

103 and NPR4, have been shown to be these adaptor proteins mediating NPR1 degradation and act as SA receptors (Fu et al., 2012). NPR1 stability is enhanced in both cul3a cul3b and npr3 npr4 double mutant plants, which exhibit enhanced disease resistance (Spoel et al., 2009; Fu et al., 2012). In our study, we found that aba mutants also accumulate high level of NPR1 protein and show elevated defense response (Figure 4 3), a phenotype reminiscent of both cu l3a cul3b and npr3 npr4 double mutants, further supporting that ABA has a role in affecting NPR1 protein stability. To our surprise, disruption of ABA signaling compromises the induction of several NPR1 target genes activated by either SA or the bacterial pathogen Psm ES4326. In aba3 mutant, addition of ABA decreased the accumulation of NPR1 protein and restored the activation of NPR1 target genes by the bacterial pathogen Psm ES4326, indicating that NPR1 turnover is required for stimulating transcription of these NPR1 target genes. This result is consistent with a previous report that proteasome mediated degradation of NPR1 plays an important function in activating defense gene expression during plant immune responses (Spoel et al., 2009). In this study, we measured the dynamic accumulation of both endogenous SA and ABA levels in systemic tissues of the wild type and aba3 during the progression of Psm ES4326 infection in Arabidopsis plants (Figure 4 12). We found that the dynamic pattern of PR1 gene expres sion correlates well with that of NPR1 protein, which is controlled by both endogenous SA and ABA during infection (Figure 4 13). Shifting the pattern of either SA or ABA signaling during infection affects the stability of NPR1 protein, resulting in the pe rturbation of the transcription profile of PR1 gene (Figure 4 16). Collectively, our data support that the induction of SAR results from the elevation of

PAGE 104

104 both SA and ABA levels, and that the inactivation of SAR may be attributed to the disappearance of the key SAR regulator NPR1, which is caused not only by the decrease of cellular SA concentrations but also by the elevat ion of ABA level s . Accumulating evidence supports an antagonistic relationship between SA and ABA in plant defense responses (Flors et al. , 2008; Yasuda et al., 2008; de Torres Zabala et al., 2009). In this study, our data demonstrate d that SA and ABA have an antagonistic effect on the stability of NPR1, which is a master regulator of plant immune responses (Dong, 2004). ABA pretreatment lea ds to the degradation of NPR1 (Figure 4 8), whereas SA pretreatment can counteract the effect of ABA on NPR1 protein stability (Figure 4 10), indicating that SA can protect NPR1 protein from degradation triggered by ABA. Previously, SA was shown to be able to promote phosphorylation of NPR1 (Spoel et al., 2009). In this study , we found that SA triggered phosphorylation of Ser11 and Ser15 in the phosphodegron motif of NPR1 can suppress the effect of ABA on the stability of NPR1 (Figure 4 11), suggesting that SA protects NPR1 protein from the proteasome mediated degradation promoted by ABA likely through phosphorylation. This was further supported by the result that in the presence of SA, ABA triggered NPR1 protein degradation is completely abolished in plants with impaired Cullin 3 E3 ligase (Figure 4 5), which preferentially targets phosphorylated NPR1 for degradation (Spoel et al., 2009). SA signaling transduction in rice has been shown to be partially different from that in Arabidopsis (reviewed by De Vlees schauwer et al., 2013). Healthy rice leaves have high basal levels of SA with no significant local or systemic changes upon pathogen attack, whereas Arabidopsis plants have low basal levels of SA with an

PAGE 105

105 induction of two orders of magnitude after pathogen infection. Most SA in rice is present as the free acid form (Silverman et al., 1995), which is active in promoting NPR1 phosphorylation and activity (Spoel et al., 2009). Moreover, the SA pathway in rice branches into OsWRKY45 dependent and OsNPR1 dependent sub pathways (Shimono et al., 2007). Furthermore, overexpression of OsNPR1 in rice confers high levels of resistance associated with constitutive accumulation of PR genes (Chern et al., 2005). By contra st, the Arabidopsis NPR1 overexpressing lines do not constitutively express PR genes (Durrant and Dong, 2004). In addition, unlike AtNPR1, OsNPR1 is barely regulated by the ubiquitin proteasome system (Spoel et al., 2009; Matsushita et al., 2013). Togethe r, these reflect different regulatory mechanisms associated with SA signaling transduction between rice and Arabidopsis. E vidence has shown that ABA also has the immune suppressive effect in rice possibly through inhibiting expression of several defense ge nes, including OsWRKY45 and OsNPR1 (Jiang et al., 2010; Xu et al., 2013). In this study, we showed that in Arabidopsis, ABA promotes NPR1 proteolysis rather than affects NPR1 gene expression (Figure 4 3; 4 1). In addition, overexpression of OsNPR1 in rice largely abolishes the negative impact of ABA on rice disease resistance (Jiang et al., 2010; Xu et al., 2013), whereas overexpression of AtNPR1 in Arabidopsis barely attenuates the immune suppressive effect of ABA (Figure 4 6C and 4 2E). The difference in ABA immunosuppressive effect between rice and Arabidopsis could be explained by the high levels of free SA in rice, which possibly protect NPR1 protein by triggering NPR1 phosphorylation from ABA triggered proteasomal degradation (Figure 4 11).

PAGE 106

106 On the ba sis of our findings, we present a working model for the regulation of SAR through NPR1 in response to different levels of SA and ABA (Figure 4 19) . In un induced cells, basal ABA is required to trigger the proteasome mediated degradation of NPR1 to prevent spurious activation of resistance, and basal SA is also required to stabilize and activate NPR1 to maintain the basal resistance. This is crucial because plants deficient in both SA and ABA biosynthesis are compromised in basal defense even though these p lants accumulate higher levels of steady state NPR1 protein (Figure 3 5; Figure 4 18). During the induction of SAR, SA accumulation in systemic cells increases and activates NPR1 to induce the expression of defense genes . When pathogen infection subsides, the inactivation of SAR is attributed to the destabilization and/or deactivation of NPR1 not only due to the decreased SA concentrations but also due to the elevated ABA level s . In natural environments, plants are facing diverse levels of stresses includin g abiotic stresses and biotic pathogen attacks. Our findings provide a mechanism by which biotic and abiotic stresses influence the combined adaptive plant defense responses. This knowledge will aid in devising strategies for developing new crop varieties with both improved disease resistance and abiotic stress tolerance. Materials and Method s Plant Materials and Growth Conditions Arabidopsis thaliana Columbia ( Col 0 ) and different mutants were used: cds2D (Fan et al., 2009), aba3 21 (this study) , eds5 1 ( Nawrath et al., 2002 ) , and npr1 3 (Glazebrook et al., 1996) . NPR1::Myc NPR1 transgene (Zh ang et al., 2012) was introduced into cds2D npr1 3, aba3 21 npr1 3 , and eds5 1 npr1 3 background, and 35S::NPR1 GFP transgene was introduced into the cds2D npr1 1 and aba3 21 npr1 1 background through genetic crosses. Homozygous plants were chosen by genotyping.

PAGE 107

107 35S::NPR1 GFP (in npr1 1 ), 35S::npr1 nls GFP (in npr1 1 ) , 35S::npr1C156A GFP (in npr1 1 ) , 35S::NPR1 GFP in cul3a cul3b, 35S::NPR1 GFP ( in npr1 2 ) , and 35S::npr1S11 / 15D GFP ( in npr1 2 ) were kindly provided by X. Dong (Spoel et al., 2009). The plant growth condition was used as previously described in Chapter 2. Pathogen Infection The virulent bacterial pathogen Psm ES4326 was grown at 28°C overnight in mM MgCl 2 . Challenge inoculation was performed by pressure infiltration with a 1 mL needless syringe as described previously (C larke et al., 1998). For SA, ABA, NPR1 protein, and mRNA analysis in systemic tissue, half leaves were infiltrated with Psm ES4326 (OD 600 =0.002) before the other halves were collected and frozen in liquid nitrogen until analysis. For ABA induced disease su sceptibility test, OD 600 =0.0001 Psm ES4326 was used for inoculation, and in planta bacterial growth was assayed two and a half or three days after infection. Chemical Treatment SA, MG115 (Sigma), and cycloheximide (Sigma) treatments were performed as prev iously described (Spoel et al., 2009). ABA treatment was done as described in Chapter 3. Alternatively, two week old MS grown seedlings were submerged in ½ MS liquid medium containing 10 M ABA and/or 1 mM SA. 50 M DFPM (ChemBridge, San Diego) was syring e infiltrated into 4 5 week old Arabidopsis leaves using a 1 mL needleless syringe. Control plants were treated identically with a solution of 0.1% DMSO (mock).

PAGE 108

108 SA and ABA Measurement SA and ABA measurement was done as described in Chapter 2 and Chapter 3 , respectively. Protein Analysis Protein extraction was performed as described by Mou et al. (2003). Briefly, leaf tissue was homogenized in protein extraction buffer (50 mM Tris HCl, pH 7.5, 150 mM NaCl, 10 mM MgCl 2 , 5 mM EDTA, 10% Glycerol, and protease inhibitors: 50 g/mL TPCK, 50 g/mL TLCK, and 0.6 mM PMSF). The extract was then centrifuged at 14,000 rpm for 5 min at 4 °C . For immunoprecipitation, protein extracts were centrifuged twice and precleared with prote in G agarose beads for 30 min. 1 l Anti GFP antibody (Santa Cruz) was added to the extracts and incubated at 4°C for 1 hr. The antibody bound protein was precipitated by adding protein G agarose beads to the extracts, followed by incubation at 4°C with ge ntle rocking for another 1 hr. The beads were then washed 3 times with the extraction buffer. The proteins were eluted by heating the beads in the SDS loading buffer containing 100 mM dithiothreitol (DTT) at 95 °C for 10 min. For Western blot analysis, SDS sample buffer was added to the protein extracts from a 2 × stock solution containing 100 mM DTT. Protein samples were heated at 70 °C for 10 min, separated on 8% SDS PAGE gels, and then transferred to nitrocellulose membrane. The Myc NPR1, NPR1 GFP, an d CUL3 proteins were detected by western blotting using an anti Myc antibody (Santa Cruz), an anti GFP antibody (Santa Cruz), and an anti CUL3 antibody (Enzo), respectively.

PAGE 109

109 RNA Extraction and Real Time PCR RNA extraction and real time PCR were carried out as described in Chapter 3. Seed Germination and Seedling Establishment Assays After surface sterilization of the seeds harvested at the same time, around 100 seeds of each genotype were sowed on ½ MS plates supplemented with different ABA concentration. Then stratification was conducted in the dark at 4°C for 3 days. Seedling establishment was scored as the percentage of seeds that developed green expanded cotyledons at indicated times. Statistics One way analysis of variance (ANOVA) was used to determi ne statistical significance among genotypes or treatments at P<0.05. In addition, two way analysis of variance was used to examine the effects of genotypes, treatments, and the interaction of these two factors on disease resistance. Post hoc comparison was performed using Alternatively, statistical t test for comparison of two data sets. A * indicates a statistically significant difference at the level of at least 95% confidence. Accession Numbers The locus numbers for the genes discussed in this chapter are as follows: ABA1 (At5g67030), ABA3 (At1g16540), NPR1 (AT1G64280), UBQ5 (At3g62250), PR1 (At2g14610), RAB18 (At5g66400), RD22 (At5G25610), COR15A (At2g 42540), RD29A (At5g52310), RD29B (At5g52300).

PAGE 110

110 Figure 4 1. Real time PCR analysis of RAB18 (A) and NPR1 (B) expression in wild type plants treated by ABA. Four week old soil grown plants were treated with 0, 40, or 80 M ABA by pressure infiltration with a 1 mL needleless syringe. After 24 hr, inoculated leaves were collected and total RNA was extracted for analyzing the expression of indicated genes using real time PCR. Expression was normalized against constitutively e xpressed UBQ5 . Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one way ANOVA). A B

PAGE 111

111 Figure 4 2. ABA promotes NPR1 degradation in Arabidopsis. A) Four week old NPR1: :Myc NPR1 (in npr1 3 ) plants were treated with various concentrations of ABA by pressure infiltration with a 1 mL needleless syringe. After 24 hr, total protein was analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) Four week old 35S::NPR1 GFP (in npr1 1 ) plants were treated with 80 M ABA ( in 0.1% ethanol ) or mock (0.1% ethanol) by pressure infiltration with a 1 mL needleless syringe. After 2 4 hr, total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). C) Expression level of NPR1 in 35S::NPR1 GFP plants treated with or without ABA. Four week old plants were treated as in (B). After 24hr, inoculated leaves were collected and total RNA was extracted for analyzing the expression of NPR1 using real time PCR. Expression was normalized against constitutively expressed UBQ5 . Er ror bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one way ANOVA). D) NPR1 protein levels in WT and cds2D plants. Total protein was analyzed by reducing SDS PAGE and immunoblot ting using an anti Myc antibody or an anti GFP antibody (top panel). Non specific band confirmed equal loading (bottom panel). E) Growth of Psm ES4326 in wild type plants treated with various concentrations of ABA. Four week old wild type plants were infil trated with various concentrations of ABA with a 1 mL needleless syringe. After 12 hr, the infiltrated leaves were inoculated with the bacterial pathogen Psm ES4326 (OD 600 = 0.0001). Eight leaves were collected 3 days post inoculation to examine the growt h of the pathogen. Data are the mean of eight samples with SD. Different letters above the bars indicate significant differences (P < 0.05, tested by one way ANOVA). F) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated with 100 M cycloheximide (CHX) followed by treatment with or without 80 M ABA for indicated amounts of time. The levels of Myc NPR1 at each time point were determined by immunoblot with an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bo ttom panel). All experiments were repeated with similar results. A B

PAGE 112

112 Figure 4 2. Continued C D E F

PAGE 113

113 Figure 4 3. NPR1 protein levels in wild type (WT) and aba3 plants. A) Total protein was analyzed by reducing SDS PAGE and immunoblotting using an anti Myc antibody or an anti GFP antibody (top panel). Non specific band confirmed equal loading (bottom panel). B) Expression levels of NPR1 . Total RNA was extracted f rom similar size untreated Col 0, npr1 3 , and aba3 21 plants. The expression of NPR1 was analyzed by qPCR and normalized against constitutively expressed UBQ5 . Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one way ANOVA). All experiments were repeated with similar results. A B

PAGE 114

114 Figure 4 4. ABA promotes NPR1 degradation via the 26S proteasome pathway. A) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated with (+) or without ( ) 80 M ABA and 40 M MG115 for 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) F our week old 35S::NPR1 GFP (in npr1 1 ) plants were treated as in (A). Leaf tissue was examined by fluorescence microscopy. C) 35S::NPR1 GFP (in npr1 1 ) plants were treated as in (A). Total protein was analyzed by reducing SDS PAGE and western blotting usin g an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). All experiments were repeated with similar results. A B C

PAGE 115

115 Figure 4 5. ABA promoted NPR1 degradation requires a CUL3 based E3 ligase. A) Wild type (WT) and cul3a cul3b plants in the presence of the 35S::NPR1 GFP transgene were treated with (+) or without ( ) 80 M ABA for 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GF P antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) Wild type (WT) and cul3a cul3b plants in the presence of the 35S::NPR1 GFP transgene were treated with (+) or without ( ) 80 M ABA in the presence of SA fo r 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). C) Co immunoprecipitation of Myc NPR1 and CUL3 in WT and aba3 pla nts. A B C

PAGE 116

116 Figure 4 6. ABA promotes degradation of NPR1 monomer in the nucleus. A) 35S::NPR1 GFP (in npr1 1) and 35S::npr1 nls GFP (in npr1 1 ) plants were treated various concentrations of ABA for 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) 35S::NPR1 GFP (in npr1 1) and 35S::npr1C156A GFP (in npr1 1 ) plants were treated various concentrations of ABA fo r 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). C) Growth of Psm ES4326 in 35S::NPR1 GFP and 35S::npr1C156A GFP p lants. Four week old plants were inoculated with the bacterial pathogen Psm ES4326 (OD 600 = 0.0001) supplemented with or without 80 M ABA. Eight leaves were collected 3 days post inoculation to examine the growth of the pathogen. Data are the mean of eigh t samples with SD. Asterisks indicate statistically significant differences (Regular two way ANOVA test; a = 0.05, n = 8). All experiments were repeated with similar results. A B C

PAGE 117

1 17 Figure 4 7. ABA and SA affect nuclear localization of NPR1. A) Nuclear localization of NPR1 in four week old 35S::NPR1 GFP (in npr1 1 ) plants treated with mock. B) Nuclear localization of NPR1 in four week old 35S::NPR1 GFP (in npr1 1 ) plants treated with 80 M ABA for 24 hr. C) SA induced nuclear localization of NPR1 in four week old 35S::NPR1 GFP (in npr1 1 ) plants treated with 1 mM SA for 24 hr. D) Nuclear localization of NPR1 in four week old 35S::NPR1 GFP (in npr1 1 ) plants pretreated with 80 M ABA 12 hr before addition of SA. Leaf tissue was examined using fluorescence microscopy 24 hr after SA treatment. E) Nuclear localization of NPR1 in four week old 35S::NPR1 GFP (in npr1 1 ) plants treated with 1mM SA and 80 M ABA for 24 hr. F) Nuclear localizati on of NPR1 in four week old 35S::NPR1 GFP (in npr1 1 ) plants pretreated with 1 mM SA 24 hr before addition of 80 M ABA. Leaf tissue was examined using fluorescence microscopy 24 hr after ABA treatment. B A C E D F

PAGE 118

118 Figure 4 8. ABA negatively affects NPR1 protein accumulation in the presence of SA. A) Four week old 35S::NPR1 GFP (in npr1 1 ) plants were treated with mock (0.1% ethanol) or 80 M ABA ( in 0.1% ethanol) 12 hr prior to treatment with 1mM SA. Leaves were collected 24 hr after SA treatment. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bot tom panel). B) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated as in (A). Total protein was analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bo ttom panel). C) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated as in (A). L eaves were collected and total RNA was extracted for analyzing the expression of PR1 using real time PCR. Expression was normalized against constitutively expressed UB Q5 . Error bars represent SD (n = 3). D) Growth of Psm ES4326 in Arabidopsis leaf tissues. Four week old NPR1::Myc NPR1 plants were pretreated with mock (0.1% ethanol) or 80 M ABA ( in 0.1% ethanol) . After 12 hr, plants were treated with 1 mM SA by soil dre nching and inoculated with Psm ES4326 (OD 600 =0.0001). Eight leaves were collected 3 days post inoculation to examine the growth of the pathogen. Data are the means of eight samples with SD. Different letters above the bars indicate statistically significan t differences (p<0.05, tested by one way ANOVA). All experiments were repeated with similar results. A B D C

PAGE 119

119 Figure 4 9. Endogenous ABA promotes NPR1 degradation in the presence of SA. A) Wild type (WT) and cds2D plants in the presence of the 35S::NPR1 GFP transgene were treated with (+) or without ( ) 1 mM SA for 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel) . Detection of a non specific band confirmed equal loading (bottom pa nel) . B) Wild type (WT) and cds2D plants in the presence of the NPR1::Myc NPR1 transgene were treated as in (A). Total protein was analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel) . Detection of a non specific band c onfirmed equal loading (bottom panel). A B

PAGE 120

120 Figure 4 10. SA decelerates ABA promoted NPR1 degradation. A) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated with mock or 1 mM SA 24 hr prior to treatment with 80 M ABA. Leaves were collected 24 h after ABA treatment. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) Four week old NP R1::Myc NPR1 (in npr1 3 ) plants were treated as in (A). Treat ed leaves were collected and total RNA was extracted for analyzing the expression of PR1 using real time PCR. Expression was normalized against constitutively expressed UBQ5 . Error bars represent SD (n = 3). C) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated with a combination of 1 mM SA and 80 M ABA for 24 hr. Total protein was extracted from treated leaves and analyzed by reducing SDS PAGE and western blotting using an anti Myc ant ibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). D) Four week old NPR1::Myc NPR1 (in npr1 3 ) plants were treated as in (C). Treat ed leaves were collected and total RNA was extracted for analyzing the expression of PR1 using real time PCR. Expression was normalized against constitutively expressed UBQ5 . Error bars represent SD (n = 3). All experiments were repeated with similar results. A B C D

PAGE 121

121 Figure 4 11. Phosphorylation decelerates ABA triggered NPR1 turnover. A) 35S::NPR1 GFP and 35S::npr1S11 / 15D GFP plants were treated with mock (0.1% ethanol) or 80 M ABA ( in 0.1% ethanol) for 24 hr. Total protein was analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) Growth of Psm ES4326 in Arabidopsis leaf tissues. Four week old 35S::NPR1 GFP and 35S::npr1S11 / 15D GFP plants were pretreated with mock (0.1% ethanol) or 80 M ABA ( in 0.1% ethanol) . After 12 hr, treated plants were inoculated with Psm ES4326 (OD 600 =0.0001). Eight leaves were collected 3 days post inoculation to ex amine the growth of the pathogen. Data are the means of eight samples with SD. Different letters above the bars t test). All experiments were repeated with similar results. A B

PAGE 122

122 Figure 4 12. Quantification of ABA and SA levels in systemic tissues of wild type and aba3 21 plants during Psm ES4326 infection. The leaf halves of wild type and aba3 21 plants were inoculated with the virulent pathogen Psm ES4326 (OD 600 =0.002). At the in dicated time points, the uninoculated leaf haves were collected for measurement of free SA (A) and ABA (B). Data represent the mean of three biological replicates with SD. FW, fresh weight. A B

PAGE 123

123 Figure 4 13. NPR1 protein accumulation and PR1 gene expression in systemic tissues of wild type and aba3 21 plants during Psm ES4326 infection. A) The leaf halves of NPR1::Myc NPR1 and NPR1::Myc NPR1 aba3 21 plants were treated as in Figure 4 12. At the indicated time points, total protein was extract ed from the uninoculated leaf halves and subjected to reducing SDS PAGE and western blot using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). B) NPR1::Myc NPR1 and NPR1::Myc NPR1 aba3 21 plants we re treated as in (A). Total RNA was extracted for analyzing the expression of PR1 using real time PCR. Expression was normalized against constitutively expressed UBQ5 . Error bars represent SD (n = 3). All experiments were repeated with similar results. A B

PAGE 124

124 Figure 4 14. SA and ABA regulates NPR1 protein accumulation and PR1 gene expression (mimic experiment). A) NPR1::Myc NPR1 in WT and aba3 21 plants were placed in 6 well plates containing 0.5 mM SA. After 24 hr, plants were transferred to new 6 wel l plants containing fresh water and treated with mock (0.1% ethanol) or 80 M ABA (in 0.1% ethanol ) . Total protein was extracted at the indicated time points and analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Det ection of a non specific band confirmed equal loading (bottom panel). B) Plants were treated as in (A). Total RNA was extracted and analyzed for the expression for PR1 using real time PCR. Numbers on the black bars represent fold induction values at 24 hr relative to 0 hr (white bars). Data represent the mean of three independent samples with SD. The experiment was repeated three times with similar results. A B

PAGE 125

125 Figure 4 15. Phosphorylation stabilizes NPR1 during SAR induction. The leaf haves of 35S::NPR1 GF P (in npr1 2 ) and 35S::npr1S11 / 15D GFP (in npr1 2 ) plants inoculated with the virulent pathogen Psm ES4326 (OD 600 =0.002). At the indicated time points, total protein was extracted from the uninoculated leaf haves and analyzed by reducing SDS PAGE and western blotting using an anti GFP antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel).

PAGE 126

126 Figure 4 16. Perturbation of either SA or ABA signaling during pathogen induction affects SAR. A) The leaf haves of NPR1::Myc NPR1 plants were inoculated with the virulent pathogen Psm ES4326 (OD 600 =0.002). After 24 hr, plants were treated with water or 1 mM SA by soil drenching. Total protein was extracted at the indicated time points after pathogen inoculation and analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loa ding ( bottom panel). B) The leaf haves of NPR1::Myc NPR1 plants were inoculated with the virulent pathogen Psm ES4326 (OD 600 =0.002). After 24 hr, plants were treated with mock (0.1% DMSO) or 50 M DFPM. Total protein was extracted at the indicated time poi nts after pathogen inoculation and analyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). C) NPR1::Myc NPR1 plants were treated as in (A) or in (B) , respectively. Total RNA was extracted for analyzing the expression of PR1 using real time PCR. Expression was normalized against constitutively expressed UBQ5 . Error bars represent SD (n = 3). D) The leaf haves of NPR1::Myc NPR1 plants were inoculated with Psm ES4326 (OD 600 =0.002), and another leaf haves were treated with mock (0.1% ethanol) or 80 M ABA (0.1% ethanol) . Total protein was extracted from the treated leaf haves at the indicated time points after ABA treatment and an alyzed by reducing SDS PAGE and western blotting using an anti Myc antibody (top panel). Detection of a non specific band confirmed equal loading (bottom panel). E) NPR1::Myc NPR1 plants were treated as in (D). Total RNA was extracted for analyzing the exp ression of PR1 using real time PCR. Expression was normalized against constitutively expressed UBQ5 . Error bars represent SD (n = 3). All experiments were repeated with similar results. A B

PAGE 127

127 Figure 4 16. Continued C D E

PAGE 128

128 Figure 4 17. Phosphorylated NPR1 negatively regulates ABA responses. A) Seven day old seedlings of the wild type (WT, Col 0), npr1 1 , npr1 2 , and npr1 3 mutants were germinated and grown on ½ MS medium supplemented with 1 M ABA. B) Cotyledon greening per centage of 35S::NPR1 GFP and 35S::npr1S11 / 15D GFP grown on ½ MS medium supplemented with various concentrations of ABA was recorded at 10 days after the end of stratification. Data shown are means of three replicates with SD. About 100 seeds per genotype w ere measured in each replicate. Different letters above the bars indicate statistically significant differences (p<0.05, student's t test). C) Photographs showing the ABA sensitivity of 35S::NPR1 GFP and 35S::npr1S11 / 15D GFP in early seedling growth. Seven day old seedlings 35S::NPR1 GFP and 35S::npr1S11 / 15D GFP were germinated and grown on ½ MS medium supplemented with or without 1 M ABA, and photos were taken 7 days after stratification. C) to G) Real time PCR analysis of the ABA responsive genes RAB18 , RD22 , COR15A , RD29A , and RD29B . 10 day old seedlings were treated with or without 10 M ABA for 3 hr. Total RNA was extracted for analyzing the expression of ABA responsive genes using real time PCR. Expression was normalized against constitutively express ed UBQ5 . Error bars represent SD (n = 3). Different letters above the bars indicate statistically significant differences (p<0.05, tested by one way ANOVA). All experiments were repeated with similar results. B C A

PAGE 129

129 Figure 4 17. Continued D E F G H

PAGE 130

130 Figure 4 18. The effect of basal SA and ABA levels on the accumulation of the Myc NPR1 protein. A) and B) Free (A) and total (B) SA levels in untreated Col 0, eds5 , and aba31 eds5 ( a3e5 ) plants detected by the HPLC based method. Data represent the mean of three independent samples with SD. FW, fresh weight; SAG, SA 2 O D glucoside. Different letters above the bars indicate statistically significant differences (p<0.05, tested by one way ANOVA). C) The Myc NPR1 protein in untreated WT , eds5 , aba3 , and aba3 eds 5 ( a3e5 ) plants by western blotting. Myc NPR1 was detected by western blotting using an anti Myc antibody (Top panel). Detection of a non specific band confirmed equal loading (bottom panel). All experiments were repeated with sim ilar results. A B C

PAGE 131

131 Figure 4 19. Working model for the regulation of SAR through NPR1 by different levels of SA and ABA. In uninduced cells (left panel), a small amount of NPR1 monomers constitutively translocate into the nucleus where they are degraded by ABA promoted proteasome mediated pathway. This event prevents spurious activation of NPR1 target genes. During SAR acti vation (middle panel), the elevated levels of SA promote NPR1 phosphorylation, which protects NPR1 from ABA triggered degradation. Thus, phosphorylated NPR1 accumulates and interacts with transcription factors (TF) to initiate defense gene transcription. A t this stage, ABA mediated NPR1 turnover plays a positive function possibly by either degrading unphosphorylated NPR1 to 1 to reinitiate the transcription cycle. After pathogen infection subsides (right panel), decreased SA levels slow down the process of NPR1 phosphorylation, resulting in NPR1 more sensitive to ABA triggered proteasomal degradation. Meanwhile, elevated ABA levels accelerate NPR1 turnover, leading to the reduction of NPR1 concentrations, which further inactivate SAR.

PAGE 132

132 CHAPTER 5 SUMMARY AND CONCLUSIONS Like animals, plants have evolved effective inducible defense systems. SA is an important plant defense signal produced after pathogen infection to induce SAR, which confers immunity towards a broad spectrum of pathogens. However, where and how SA is synthesized in plant cells remains unclear. Identification of new components involved in pathogen induced SA accumulation would help understand how SA mediates disease resistance in plants. In this study, we performed a forward genetic screen for Arabidopsis mutants with altered SA accumulation using a biosensor based SA quantification method. A total of 35,000 M2 plants in the npr1 3 mutant background were individually tested. Among the mutants identified, 17 accumulate lower levels of SA than npr1 3 ( lsn ) and two produce higher levels of SA than npr1 3 ( hsn ). Complementation tests indicated that seven of the lsn mutants are new alleles of eds5 / sid1 , two are eds16 / sid2 alleles, and one is allelic to pad4 . The remaining are likely new lsn and hsn mutants . These mutants will likely help dissect the molecular mechanisms underlying pathogen induced SA accumulation in plants. Through map based cloning, HSN2 was shown to encode ABA3 , which is involved in ABA biosynthesis. Characterization of aba3 npr1 double mutant s showed that ABA is a negative regulator of SA biosynthesis. However, the aba3 single mutant plants do not accumulate higher levels of SA than the wild type plants after pathogen infection, suggesting that the NPR1 protein in aba3 likely inhibit s SA accumulation. In addition, pathogen growth assays showed that mutations in ABA3 conf er enhanced basal resistance in both an NPR1 dependent and independent manner, whereas the enhanced resistance depends on SA. Interestingly, plants impaired in ABA signaling

PAGE 133

133 mainly exhibit NPR1 dependent disease resistance when challenged with a higher ba cterial inoculum. By contrast, high levels of ABA contribute to compromised basa l resistance and impaired SAR, phenotype s reminiscent of the npr1 mutant. Thus, these data suggest that ABA promotes pathogenesis likely by in activating NPR1. On the other hand, a positive regulatory function of ABA in plant immunity was also observed. The aba3 21 mutant and the sextuple pyr / pyl mutant (112458) were defective in the full induction of defense genes by Psm ES4326 or SA. In addition, exogenous appl ication of a low concentration of ABA in aba3 was able to increase the induction of defense genes during pathogen infection. Moreover, compromised defense gene induction caused by disruption of ABA signaling led to impaired biological SAR induction in aba3 and 112458 mutants. Thus, ABA signaling appears to be required for plant immunity. Taken together, our data support that ABA signaling plays both positive and negative functions in plant defense. The mechanism of how ABA regulates plant immune responses was further investigated. This study demonstrated that ABA regulates plant immunity by controlling the abundance of NPR1 protein, which is a key regulator of plant immunity downstream of SA. Both genetic and biochemical approaches were employed to demonstr ate that ABA promotes proteasomal degradation of NPR1 in the nucleus, which plays both positive and negative regulatory functions in plant innate immunity. Accumulating evidence supports an antagonistic relationship between SA and ABA in plant immunity (Flors et al., 2008; Yasuda et al., 2008; de Torres Zabala et al., 2009). In this study, our data demonstrate that SA and ABA have an antagonistic effect on the stability of NPR1 protein. ABA pretreatment leads to the degradation of NPR1,

PAGE 134

134 whereas SA pretreatment can counteract the effect of ABA on NPR1 protein stability. In addition, phosphorylated NPR1 was found to be less sensitive to ABA treatment and have a suppressive effect on the ABA signaling pathway. Together with the fact that SA promotes NPR1 phosphorylation (Spoel et al., 2009), these results suggest that SA antagonizes ABA signaling likely through promoting NPR1 phosphorylation. Thus, NPR1 appears to be the regu latory node through which SA and ABA antagonize each other. In this study, the dynamic accumulation of both endogenous SA and ABA levels in systemic tissues of the wild type and aba3 was measured during the progression of Psm ES4326 infection. The dynamic pattern of PR1 gene expression correlates well with that of the NPR1 protein, which appears to be controlled by both endogenous SA and ABA during infection. Shifting either SA or ABA signaling during infection perturbs the biphasic changes of NPR1 concentr ations, consequently altering the transcription profile of the PR1 gene, which is a molecular marker of SAR. Therefore, our data suggest that SA and ABA cooperate to regulate SAR through controlling the key SAR regulator NPR1. On the basis of our findings, we provide a working model for the regulation of SAR by SA and ABA through NPR1 . In un induced cells, basal ABA is required to trigger the proteasome mediated degradation of NPR1 to prevent spurious activation of resistance, and basal S A is also required to stabilize/ activate NPR1 to maintain the basal resistance. Upon SAR induction, SA accumulation in systemic cells increases NPR1 concentrations to induce the expression of defense genes, whereas at this stage ABA mediated degradation of NPR1 may be requir ed for the full induction of these

PAGE 135

135 defense genes. When pathogen infection subsides, the inactivation of SAR is attributed to the reduction of NPR1 concentrations due to the decreased levels of SA and the elevated level s of ABA . In the natural environments, plants are facing diverse stresses including abiotic stresses and biotic pathogen attacks. Our findings suggest a mechanism by which biotic and abiotic stresses influence the combined adaptive plant defense responses.

PAGE 136

136 APPENDIX TABLES Table A 1 Primers used for fine mapping. Marker Restriction enzyme Col 0 (bp) L er (bp) At1g16500 (M1) CTCGTCATCATCGTC TCATC GTCATCTTCAGGAGA TTGGC Tsp509 I 272, 59 331 At1g16540 (M2) TACTTGGAGGTGGAG AAGC CACTGACGACGGTTC CATTC Mse I 532, 170 396, 170, 136 At1G16660 (M3) ACCTTCGTCAAGGCT CTATG AAGCAGGCTGTAACT GAGAG SfaN I 699 453, 246 At1G16860 (M4) AGGAACTGCACAATC AGGTC AGTGACCTTCACGTG TTGAC Hph I 628 310, 318 At1G16920 (M5) CAGCTTCATGTTAAG CTCCC GGTACAGAGTGGAAG ATGAC Nla III 337, 283 620 Table A 2. Primers used for mutant genotyping. Marker Restriction enzyme WT (bp) Mutant (bp) aba3 21 GTGATATCAGTTCGGCC ACC CTGTAATCTTCAGG AGATGC Mse I 164, 24 147, 24, 17 npr1 3 (dCAPS) GGCCGACTATGTGTAGA AATACTAGCG TGAGACGGTCAGG CTCGAGG HhaI 319, 27 346 eds5 1 CTTGGTCTAATCTGATT CTTGATATGTTTGCCG GAGACTTATTCAGC TGCTTGCTTCTC HpaII 142 171

PAGE 137

137 Table A 3. Primers used for qPCR in this study. Gene PR1 CTCATACACTCTGGTGGG ATTGCACGTGTTCGCAGC NPR1 AGCATTCTCTCAAAGGCCGAC TGAGACGGTCAGGCTCGAGG WRKY18 TTAGATGCTCGTTTGCACCG CCAAAGTCACTGTGCTTGAC WRKY38 CGTCGTAGTAAATCGGATCC CCAGAAACCGAAGATGATCAG WRKY62 GTATTTCCTCCAGAGGAAGC ACCACCAAGACGATCAATCC RAB18 CCGTTAAGCTTCGAACAATCG CAACACACATCGCAGGACGTA RD22 ATTGTGCGACGTCTTTGGAGT TGCGTTCTTCTTAGCCACCTC COR15A GAGGCATTAGCAGATGGTGAGA ACATACGCCGCAGCTTTCT RD29A GTTACTGATCCCACCAAAGAAGA GGAGACTCATCAGTCACTTCCA RD29B GCAAGCAGAAGAACCAATCA CTTTGGATGCTCCCTTCTCA UBQ5 TCTCCGTGGTGGTGCTAAG GAACCTTTCCAGATCCATCG Table A 4. Primers for identification of the splicing site change in aba3 21 . CTTGGATCATGCTGGTTCTAC CATCAACTTCACCAGATCTAG Table A 5. Primers for identification of homozygousT DNA insertion lines. Forward SALK_072361 TTCTATTGGAAATGCATTGCC CCATGTCTGCATGTTTCTGTG

PAGE 138

138 REFERENCES Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998). Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene mediated signaling pathways in Arabidopsis . Proc. Natl. Acad. Sci. USA 95: 10306 10311. Adie, B.A.T., P erez Perez, J., Perez Perez, M.M., Godoy, M., Sanchez Serrano, J.J., Schemelz, E.A., and Solano, R. (2007). ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defences in Arabidopsis . Plant Cell 19: 1665 1681. Agrios, G.N. (1997). Plant Pathol. 4 th edition. San Diego : Academic Press. Alfano, J.R., and Collmer, A. (2004). Type III secretion system effector proteins: Double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42: 385 414. Altenbach, D., and Robatzek, S. (2007). Pattern recognition receptors: from the cell surface to intracellular dynamics. Mol. Plant Microbe Interact. 20: 1031 1039. Anderson, J.P., Badruzsaufari, E., Schenk, P.M., Manners, J.M., Desmond, O.J., Ehlert, C ., Maclean, D.J ., Ebert, P.R ., and Kazan, K . (2004). Anta gonistic interaction between abscisic acid and jasmonate ethylene signaling pathways modulates defense gene expression and disease resistance in Arabidopsis . Plant Cell 16: 3460 3479. Antoniw, J.F., and White, R.F. (1980). The effects of aspirin and polyac rylic acid on soluble leaf proteins and resistance to virus infection in five cultivars of tobacco. J. of Phytopathol. 98: 331 341. Asselbergh, B., De Vleesschauwer, D., and Höfte, M. (2008). Global switches and finetuning ABA modulates plant pathogen defe nse. Mol. Plant Microbe Interact. 21: 709 719. Attaran, E., Zeier, T.E., Griebel, T., and Zeier, J. (2009). Methyl salicylate production and jasmonate signaling are not essential for systemic acquired resistance in Arabidopsis . Plant Cell 21: 954 971. Audenaert, K., De Meyer, G.B., and Höfte, M. (2002). Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic acid dependent signaling mechanisms. Plant Physiol. 128: 491 501. Ausubel, F. (2005). Are innate immune signaling pathways in plants and animals conserved? Nat. Immunol. 6: 973 979.

PAGE 139

139 Barrero, J.M., Piqueras, P., Gonzalez Guzman, M., Serrano, R., Rodriguez, P.L., Ponce, M.R. and Micol, J.L. (2005). A mutational analysis of the ABA1 gene of Arabidopsis thaliana highlights the involvement of ABA in vegetative development. J. Exp. Bot. 56: 2071 2083. Bender, C.L., Alarcon Chaidez, F., and Gross, D.C. (1999). Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol. Mol. Biol. Rev. 63: 266 292. Bender, C.L., Stone, H.E., Sims, J.J., and Cooksey, D.A. (1987). Reduced pathogen fitness of Pseudomonas syringae pv. Tomato Tn5 mutants defective in coronatine production. Phys iol. Mol. Plant Pathol. 30: 273 283. Bhattacharjee, S., Halane, M.K., Kim, S.H., and Gassmann, W. (2011). Pathogen effectors target Arabidopsis EDS1 and alter its interactions with immune regulators. Science 334: 1405 1408. Boller, T., and Felix, G. (2009) . A renaissance of elicitors: perception of microbe associated molecular patterns and danger signals by pattern recognition receptors. Annu. Rev. Plant Biol. 60: 379 406. Cao, F., Yoshioka, K., and Desveaux, D. (2011). The roles of ABA in plant pathogen in teractions. J. Plant Res. 124: 489 499. Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6: 1583 1592. Cao, H., Glazebrook, J., Clark, J.D., Volko, S., and Dong, X. (1997). The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88: 57 63. Cao, H., Li, X., and Dong, X. (1998). Generation of broad spectrum disease resistance by overexpression of an essential regulatory gene in systemic acquired resistance . Proc. Natl. Acad. Sci. USA 95: 6531 6536. Chadha, K.C., and Brown, S.A. (1974). Biosynthe sis of phenolic acids in tomato plants infected with Agrobacterium tumefaciens . Can J. Bot. 52: 2041 2047. Chanda, B., Xia, Y., Mandal, M.K., Yu, K., Sekine, K.T., Gao, Q.M., Selote, D., Hu, Y., Stromberg, A., Navarre, D., Kachroo, A., and Kachroo, P. (201 1). Glycerol 3 phosphate is a critical mobile inducer of systemic immunity in plants. Nat. Genet. 43: 421 427. Chapple, C.C., Vogt, T., Ellis, B.E., and Somerville, C.R. (1992). An Arabidopsis mut ant defective in the general phenylpropanoid pathway. Plant Cell 4: 1413 1424.

PAGE 140

140 Chaturvedi, R., Krothapalli, K., Makandar, R., Nandi, A., Sparks, A.A., Roth, M.R., Welti, R., and Shah, J. (2008). Plastid omega3 fatty acid desaturase dependent accumulation o f a systemic acquired resistance inducing activity in petiole exudates of Arabidopsis thaliana is independent of jasmonic acid. Plant J. 54: 106 117. Chaturvedi, R., Venables, B., Petros, R.A., Nalam, V., Li, M., Wang, X., Takemoto, L.J., and Shah, J. (201 2). An abietane diterpenoid is a potent activator of systemic acquired resistance. Plant J. 71: 161 172. Chen, Z. (2010). Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Phys iol. 153: 1526 1538. Chen, Z., Zheng, Z., Huang, J., Lai, Z., and Fan, B. (2009). Biosynthesis of salicylic acid in plants. Plant Signal Behav. 4: 493 496. Cheng, M.C., Liao, P.M., Kuo, W.W., and Lin, T.P. (2013) The Arabidopsis ETHYLENE RESPONSE FACTOR1 regulates abiotic stress responsive gene expression by binding to different cis acting elements in response to different stress signals. Plant Physiol. 162: 1566 1582 Chern, M., Fitzgerald, H.A., Canlas, P.E., Navarre, D.A., and Ronald, P.C. (2005). Overexpression of a rice NPR1 homolog leads to constitutive activation of defense response and hypersensitivity to light. Mol. Plant Microbe Interact. 18: 511 520. Chinchilla, D., Bauer, Z., Regenass, M ., Boller, T., and Felix, G. (2006). The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 18: 465 476. Choi, D.S. and Hwang, B.K. (20 11). Proteomics and functional analyses of pepper abscisic acid responsive 1 ( ABR1 ), which is involved in cell death and defense signaling. Plant Cell 23: 823 842. Clarke, J.D., Liu, Y., Klessig, D.F., and Dong, X. (1998). Uncoupling PR gene expression fro m NPR1 and bacterial resistance: Characterization of the dominant Arabidopsis cpr6 1 mutant. Plant Cell 10: 557 569. Coll, N.S., Vercammen, D., Smidler, A., Clover, C., Van Breusegem, F., Dangl, J., and Epple, P. (2010). Arabidopsis type I metacaspases con trol cell death. Science 330: 1393 1397. Collier, S.M ., and Moffett, P . (2009). NB LRRs work a "bait and switch" on pathogens. Trends Plant Sci. 14: 521 529.

PAGE 141

141 Coppinger, P., Repetti, P.P., Day , B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J. (2004). Overexpression of the plasma membrane localized NDR1 protein results in enhanced bacterial disease resistance in Arabidopsis thaliana . Plant J. 40: 225 237. Cunnac, S., Lindeberg, M., and Collmer, A. (2009). Pseudomonas syringae type III secretion system effectors: repertoires in search of functions. Curr. Opin. Microbiol. 12: 53 60 Cutler, S.R., Rodriguez, P.L., Finkelstein, R.R., and Abrams, S.R. (2010). Abscisic acid: Emergence of a core signaling network. Ann. Rev. Plant Biol. 61: 651 679. Dangl, J.L., and Jones, J.D.G. (2001). Plant pathogens and integrated defence responses to infection. Nature 411: 826 833. D'Auria, J.C . (2006). Acyltransferases in plants: a good time to be BAHD. Curr Opin Plant Biol. 9: 331 340. de Torres Zabala, M., Bennett, M.H., Truman, W.H., and Grant, M.R. (2009). Antagonism between salicylic and abscisic acid reflects early h ost pathogen conflict and moulds plant defence responses. Plant J. 59: 375 386. de Torres Zabala, M., Truman, W., Bennett, M.H., Lafforgue, G., Mansfield, J.W., Rodriguez Egea, P ., Bögre, L ., and Grant, M . (2007). Pseudomonas syringae pv. tomato hijacks the Arabidopsis abscisic acid signalling pathway to cause disease. EMBO J. 26: 1434 1443. De Vleesschauwer, D ., Gheysen, G ., and Höfte, M . (2013). Hormone defense networking in rice: tales from a different world. Trends Plant Sci. 18: 555 565. De Vleesschauwer, D., Yang, Y.N., Cruz, C.V., and Höfte, M. (2010). Abscisic acidinduced resistance against the brown spot pathogen Cochliobolus miyabeanus in rice invol ves MAP kinase mediated repression of ethylene signaling. Plant Physiol. 152: 2036 2052. Dean, J.V., and Delaney, S.P. (2008). Metabolism of salicylic acid in wild type, ugt74f1 and ugt74f2 glucosyltransferase mutants of Arabidopsis thaliana . Physiol. Plan t. 132: 417 425. Dean, J.V ., and Mills, J.D . (2004). Uptake of salicylic acid 2 O D glucose into soybean tonoplast vesicles by an ATP binding cassette transporter type mechanism. Physi ol Plant. 120: 603 612. Dean, R.A., and Kuc, J. (1986). Induced systemic protection in cucumbers: the source 28: 227 233. Defraia, C.T., Schmelz, E.A., and Mou, Z. (2008). A rapid biosensor based method for quantification of free and glucose conjugated salicylic acid. Plant Methods. 4: 28.

PAGE 142

142 Delaney, T.P., Friedrich, L., and Ryals, J.A. (1995). Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc. Nati. Acad. Sci. USA 92: 6602 6606. Delaney, T.P., Uknes, S., Vernooij, B., Friedrich, L., Weymann, K., Negrotto, D., Gaffney, T., Gut Rella, M., Kessman n, H., Ward, E., and Ryals, J. (1994). Central role of salicylic acid in plant disease resistance. Science 266: 1247 1250. Dempsey, D.A., and Klessig, D.F. (2012). SOS too many signals for systemic acquired resistance? Trends Plant Sci. 17: 538 545. Dempse y, D.A., Shah, J. and Klessig, D.F. (1999). Salicylic acid and disease resistance in plants. Crit. Rev. Plant Sci. 18: 547 575. Després, C., Chubak, C., Rochon, A., Clark, R., Bethune, T., Desveaux, D., and Fobert, P.R. (2003). The Arabidopsis NPR1 disease resistance protein is a novel cofactor that confers redox regulation of DNA binding activity to the basic domain/leucine zipper transcription factor TGA1. Plant Cell 15: 2181 2191. Després, C., D eLong, C., Glaze, S., Liu, E., and Fobert, P.R. (2000). The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors. Plant Cell 12: 279 290. Dewdney, J., Reuber, T.L., Wildermuth, M.C., Devoto, A., Cui, J., Stutius, L.M., Drummond, E.P., and Ausubel, F.M. (2000). Three unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J. 24: 205 218. Dong, X. (2004). NPR1, all things considered. Curr. Opin. Plant Biol. 7: 547 752. Dreher, K ., and Callis, J . (2007). Ubiquitin, hormones and biotic stress in plants. Ann Bot. 99: 787 822. Durrant, W.E ., and Dong, X . (2004). Systemic acquired resistance. Annu. Rev. Phytopathol. 42: 185 209. El Basyouni, S.Z., Chen, D., Ibrahim, R.K., Neis h, A.C., and Towers, G.H.N. (1964). The biosynthesis of hydroxybenzoic acids in higher plants. Phytochem. 3: 485 492. Endah, R., Beyene, G., Kiggundu, A., Berg, N., Schluter, U., Kunert, K., and Chikwamba, R. (2008). Elicitor and Fusarium induced expressio n of NPR1 like genes in banana. Plant Physiol. Biochem. 46: 1007 1014. Enyedi, A.J., Yalpani, N., Silverman, P., and Raskin, I. (1992). Localization, conjugation, and function of salicylic acid in tobacco during the hypersensitive reaction to tobacco mosai c virus. Proc. Natl. Acad. Sci. USA 89: 2480 2484.

PAGE 143

143 Eulgem, T ., and Somssich, I.E . (2007). Networks of WRKY transcription factors in defense signaling. Curr. Opin. Pl ant Biol. 10: 366 371. Falk, A ., Feys, B.J ., Frost, L.N ., Jones, J.D ., Daniels, M.J ., and Parker, J.E . (1999). EDS1, an essential component of R gene mediated disease resistance in Arabidopsis has homology to eukaryotic lipases. Proc. Natl. Acad. Sci. USA 96: 3292 3297. Fan, J., Hill, L., Crooks, C., Doerner, P., and Lamb, C. (2009). Abscisic acid has a key role in modulating diverse plant pathogen interactions. Plant Physiol. 150: 1750 1761. Fan, W., and Dong, X. (2002). In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid mediated gene activation in Arabidopsis . Plant Cell 14: 1377 13 89. Feng, D.X., Tasset, C., Hanemian, M., Barlet, X., Hu, J., Trémousaygue, D., Deslandes, L., and Marco, Y. (2012). Biological control of bacterial wilt in Arabidopsis thaliana involves abscissic acid signalling. New Phytol. 194: 1035 1045. Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J. 20: 5400 5411. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina Escobar, N., Neu, C ., Cabral, A ., and Parker, J.E . (2 005). Arabidopsis SENESCENCE ASSOCIATED GENE101 stablizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant Cell 17: 2601 2613. Flors, V., Ton, J., Van Doorn, R., Jakab, G., García Agustín, P., and Mauch Mani, B. (2008). Interplay between JA, SA and ABA signalling during basal and induced resistance against Pseudomonas syringae and Alternaria brassicicola . Plant J. 54: 81 92. Forouhar, F., Yang, Y., Kumar, D., Chen, Y., Fridman, E., Park, S.W., Chiang, Y., Acton , T.B., Montelione, G.T., Pichersky, E., Klessig, D.F., and Tong, L. (2005). Structural and biochemical studies identify tobacco SABP2 as a methyl salicylate esterase and implicate it in plant innate immunity. Proc. Natl. Acad. Sci. USA 102: 1773 1778. Fu, Z.Q., and Dong, X. (2013). Systemic acquired resistance: turning local infection into global defense. Annu. Rev. Plant Biol. 64: 839 863. Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N ., Mohan, R., Spoel S.H., Tada, Y., Zheng, N., and Dong, X. (2012). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486: 228 232.

PAGE 144

144 Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi Shinozaki, K., and Shinozaki, K. (2006). Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9: 436 442. Fujita, Y., Fujita, M., Satoh, R., Maruyama, K., Parvez, M .M., Seki, M., Hiratsu, K., Ohme Takagi, M., Shinozaki, K., and Yamaguchi Shinozaki, K. (2005). AREB1 is a transcription activator of novel ABRE dependent ABA signaling that enhances drought stres s tolerance in Arabidopsis . Plant Cell 17: 3470 3488. Gaffney, T., Friedrich, L., Vernooij, B., Negrotto, D., Nye, G., Uknes, S., Ward, E., Kessman, H., and Ryals, J. (1993). Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261: 754 756. Galan, J.E., and Collmer, A. (1999). Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284: 1322 1328. Garcion, C ., Lohmann, A ., Lamodière, E ., Catinot, J ., Buchala, A ., Doermann, P ., and Métraux, J.P . (2008). Characterization and biological function of the ISOCHORISMATE SYNTHASE2 gene of Arabidopsis . Plant Physiol. 147: 1279 1287. Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. of Phytopathol. 43: 205 227. Glazebrook, J., Rogers, E.E., and Ausubel, F.M. (1996). Isolation of Arabidopsis mutants with enhanced disease susceptibility by direct screening. Genetics 143: 973 982. Gohre, V., Spallek, T., Haweker, H., Mersmann, S., Mentzel, T., Boller, T ., de Torres, M ., Mansfield, J.W ., and Robatzek, S . (2008 ). Plant pattern recognition receptor FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. Curr. Biol. 18: 1824 1832. Gómez Gómez, L ., and Boller, T . (2000). FLS2: an LRR receptor like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis . Mol. cell 5: 1003 1011. Gonzalez Guzma n, M., Pizzio, G.A., Antoni, R., Vera Sirera, F., Merilo, E., Bassel, G.W., Fernández, M.A., Holdsworth, M.J., Perez Amador, M.A., Kollist, H., and Rodriguez, P.L. (2012). Arabidopsis PYR/PYL/RCAR receptors play a major role in quantitative regulation of s tomatal aperture and transcriptional response to abscisic acid. Plant Cell 24: 2483 2496. Grant, S.R., Fisher, E.J., Chang, J.H., Mole, B.M., and Dangl, J.L. (2006). Subterfuge and manipulation: type III effector proteins of phytopathogenic bacteria. Annu. Rev. Microbiol. 60: 425 449.

PAGE 145

145 Grant, M.R ., Jones, J.D . (2009). Hormone (dis)harmony moulds plant health and disease. Science 324: 750 752. Grieb el, T., and Zeier, J. (2008). Light regulation and daytime dependency of inducible plant defenses in Arabidopsis : phytochrome signaling controls systemic acquired resistance rather than local defense. Plant Physiol. 147: 790 801. Guo, M., Tian, F., Wambold t, Y., and Alfano, J.R. (2009). The majority of the type III effector inventory of Pseudomonas syringae pv. tomato DC3000 can suppress plant immunity. Mol. Plant Microbe Interact. 22: 1069 1080. Hammond Kosack, K.E ., and Rudd, J.J . (2008). Plant resistance signalling hijacked by a necrotrophic fungal pathogen. Plant Signal Behav. 3: 993 995. Harrison, A.J., Yu, M., GÃ¥rdenborg, T., Middleditch, M., Ramsay, R.J., Baker, E.N., and Lott, J.S. (2006). The structure of MbtI from Mycobacterium tuberculosis , the first enzyme in the biosynthesis of the siderophore mycobactin, reveals it to be a salicylate synthase. J. Bacteriol. 188: 6081 6091. Heidel, A.J., Clarke J.D., Antonovics, J., and Dong, X. (2004). Fitness costs of mutations affecting the systemic acquired resistance pathway in Arabidopsis thaliana . Genetics 168: 2197 2206. Heidrich, K., Wirthmueller, L., Tasset, C., Pouzet, C., Deslandes, L., and Parker, J.E. (2011). Arabidopsis EDS1 connects pathogen effector recognition to cell compartment specific immune responses. Science 334: 1401 1404. Hellmann, H., and Estelle, M. (2002). Plant development: regulation by protein degradation. Science. 297: 793 797. Hennig, J., Malamy, J., Grynkiewicz, G., Indulski, J., and Klessig, D. F. (1993). Interconversion of the salicylic acid signal and its glucoside in plants. Plant J. 4: 593 600. Hu, J., Barlet, X., Deslandes, L., Hirsch, J., Feng, D.X., Somssich, I., and Marco, Y. (2008). Transcriptional responses of Arabidopsis th aliana during wilt disease caused by the soil borne phytopathogenic bacterium, Ralstonia solanacearum . PLoS ONE 3: e2589. Huang, J., Gu, M., Lai, Z., Fan, B., Shi, K., Zhou, Y.H., Yu, J.Q., and Chen, Z. (2010). Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 153: 1526 1538. Huang, W.E., Huang, L., Preston, G.M., Martin, N., Carr, J.P., Li, Y.H., Singer, A.C., Whiteley, A.S., and Hui, W. (2006). Quantitative in situ assay of salicylic acid in tobacco leaves using a genetically modified biosensor strain of Acinetobacter sp. ADP1 . Plant J. 46: 1073 1083.

PAGE 146

146 Huang, W.E., Wang, H., Zheng, H., Huang, L., Singer, A.C., Thompson, I., and Whiteley, A.S. (2005). Chromosomally located gene fusions constructed in Acinetobacter sp. ADP1 for the detection of salicylate. Environ. Microbiol. 7: 1339 1348. Ibrahim, R.K., and Towers, G. (1959). Nature 184: 1803.H. Jagadeeswaran, G., Raina, S., Acharya, B.R., Maq bool, S.B., Mosher, S.L., Appel, H.M., Schultz, J.C., and Klessig, D.F. (2007). Arabidopsis GH3 LIKE DEFENSE GENE 1 is required for accumulation of salicylic acid, activation of defense responses and resistance to Pseudomonas syringae . Plant J. 51: 234 246 . Jamir, Y., Guo, M., Oh, H.S., Petnicki Ocwieja, T., Chen, S., Tang, X., Dickman, M.B., Collmer, A., and Alfano, J.R. (2004). Identification of Pseudomonas syringae type III effectors that can su ppress programmed cell death in plants and yeast. Plant J. 37: 554 565. Jenns, A.E., and Kuc, J. (1979). Graft transmission of systemic resistance of cucumber to anthracnose induced by Colletotrichum lagenarium and tobacco necrosis virus. Phytopathol. 7: 7 53 756. Jiang, C.J., Shimono, M., Sugano, S., Kojima, M., Yazawa, K., Yoshida, R ., Inoue, H ., Hayashi, N ., Sakakibara, H ., and Takatsuji, H . (2010) Abscisic acid interacts antagonistically with s alicylic acid signaling pathway in rice Magnaporthe grisea interaction. Mol. Plant Microbe Interact. 23: 791 798. Johnson, C., Boden, E., and Arias, J. (2003). Salicylic acid and NPR1 induce the recruitment of trans activating TGA factors to a defense gene promoter in Arabidopsis . Plant Cell 15: 1846 1858. Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature 444: 323 329. Jung, H.W., Tschaplinski, T.J., Wang, L., Glazebrook, J., Greenberg, J.T. (2009). Priming in systemic plant immunity. Science 324: 89 91. Kachroo, A., and Robin, G.P. (2013). Systemic signaling during plant defense. Curr. Opin. Plant Biol. 16: 527 533. Katagiri, F., Thilmony, R., and He, S.Y. (2002). The Arabidopsis Book: The Arabidopsis thaliana Pseudomonas syringae interaction. Kerbarh, O., Chirgadze, D.Y., Blundell, T.L., and Abell, C. (2006). Crystal structures of Yersinia enterocolitica salicylate synthase and its complex with the reaction products salicylate and pyruvate. J. Mol. Biol. 357: 524 534.

PAGE 147

147 Kim, H.S., and Delaney, T.P. (2002). Over expression of TGA5 , which encodes a bZIP transcription factor that interacts with NIM1/NPR1, confers SAR independent resistance in Arabidopsis thaliana to Peronospora parasitica . Plant J. 32: 151 163. Kim, M.G., da Cunha, .L, McFall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J.L ., and Mackey, D . (2005). Two Pseudomonas syringae type III effectors inhibit RIN4 regulated basal defense in Arabidopsis. Cell 121: 749 759. Kim, T.H. (2012). Plant stress surveillance monitore d by ABA and disease signaling interactions. Mol. Cells 33: 1 7. Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear localization of NPR1 is required for activation of PR gene expression. Plant Cell 12: 2339 2350. Klämbt, H.D. ( 1962). Conversion in plants d glucoside. Nature 196: 491. Klessig, D.F ., and Malamy, J . (1994). The salicylic acid signal in plants. Plant Mol. Biol. 26: 1439 1458. Klick, S., and He rrmann, K. (1988). Glucosides and glucose esters of hydroxybenzoic acids in plants. Phytochem. 27: 2127 2180. Knepper, C., and Day, B. (2010). From perception to activation: the molecular genetic and biochemical landscape of disease resistance signaling in plants. Arabidopsis Book. 8: e012. Koga, H., Dohi, K., and Mori, M. (2004). Abscisic acid and low temperatures suppress the whole plant specific resistance reaction of rice plants to the infecti on of Magnaporthe grisea . Physiol. Mol. Plant Pathol. 65: 3 9. Kolappan, S., Zwahlen, J., Zhou, R., Truglio, J.J., Tonge, P.J., and Kisker, C. (2007). Lysine 190 is the catalytic base in MenF, the menaquinone specific isochorismate synthase from Escherichi a coli : Implications for an enzyme family. Biochem. 46: 946 953. Koo, Y.J., Kim, M.A., Kim, E.H., Song, J.T., Jung, C., Moon, J.K ., Kim, J.H ., Seo, H.S ., Song, S.I ., Kim, J.K ., Lee, J.S ., Cheong, J.J ., and Choi, Y.D . (2007). Overexpression of salicylic acid carboxyl methyltransferase reduces salicylic acid mediated pathogen resistance in Arabidopsis thaliana . Pl ant Mol. Biol. 64: 1 15. Kornneef, M., Reuling, G., and Karssen, C.M. (1984). The isolation and characterization of abscisic acid insensitive mutants of Arabidopsis thaliana . Plant Physiol. 61: 377 383.

PAGE 148

148 Kumar, D., and Klessig, D.F. (2003). High affinity s alicylic acid binding protein2 is required for plant innate immunity and has salicylic acid stimulated lipase activity. Proc. Natl. Acad. Sci. USA 100: 16101 16106. Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004). The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 16: 3496 3507. Kuromori, T., Miyaji, T., Yabuuchi, H., Shimizu, H., Sugimoto, E., Kamiya, A., Moriyama, Y., and Shinozaki, K. (2010). ABC transporter At ABCG25 is involved in abscisic acid transport and responses. Proc. Natl. Acad. Sci. USA 107: 2361 2366. Lawton, K. A., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S., and Ryals, J. (1995). Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol. Plant Microbe Interact. 8: 863 870. Le Henanff, G., Heitz, T., Mestre, P., Mutterer, J., Walter, B., and Chong, J. (2009). Characterization of Vitis vinifera NPR1 homologs involved in the regulation of pathogenesis related gene expression. BMC Plant Biol. 9: 54. Lee, M.W., Lu, H., Jung, H.W., and Greenberg, J.T. (2007). A key role for the Arabidopsis WIN3 protein in disease resistance triggered by Pseudomonas syringae that secrete AvrRpt2. Mol. Plant Microbe Interact. 20: 1192 1200. Leon, J., Lawton, M.A., and Raskin, I. (1995). Hydrogen peroxide stimulates salicylic acid biosynthesis in tobacco. Plant Physiol. 108: 1673 1678. Léon Kloosterziel, K.M., Gil, M.A., R uijs, G.J., Jacobsen, S.E., Olszewski, N.E., Schwartz, S.H., Zeevaart, J.A., and Koornneef, M. (1996). Isolation and characterization of abscisic acid deficient Arabidopsis mutants at two new loci. Plant J. 10: 655 661. Leung, J., Bouvier Durand, M., Morri s, P.C., Guerrier, D., Chefdor, F., and Giraudat, J. (1994). Arabidopsis ABA response gene ABI1: Features of a calcium modulated protein phosphatase. Science 264: 1448 1452. L'Haridon, F ., Besson Bard, A ., Binda, M ., Serrano, M ., Abou Mansour, E ., Balet, F ., Schoonbeek, H.J ., Hess, S ., Mir, R ., Léon, J ., Lamotte, O ., and Métraux, J.P . (2011). A permeable cuticle is associated with the release of reactive oxygen species and induction of innate immunity. PLoS Pathog. 7: e1002148. Lim, E.K., Doucet, C.J., Hou , B., Jackson, R.G., Abrams, S.R., and Bowles, D.J. (2005). Resolution of (+) abscisic acid using an Arabidopsi s glycosyltransferase. Tetrahedron: Asymmetry 16: 143 147. Lin, W.C., Lu, C.F., Wu, J.W., Cheng, M.L., Lin, Y.M., Yang, N.S., Black, L ., Green, S.K ., Wang, J.F ., and Cheng, C.P . (2004). Transgenic tomato pla nts expressing

PAGE 149

149 the Arabidopsis NPR1 gene display enhanced resistance to a spectrum of fungal and bacterial diseases. Transgenic Res. 13: 567 581. Liu, P., Yang, Y., Pichersky, E., and Klessig, D.F. (2010). Altering expression of Benzoic acid/Salicylic acid carboxyl Methyltransferase 1 compromises systemic acquired resistance and PAMP triggered immunity in Arabidopsis . Mol. Plant Microbe Interact. 23: 82 90. Loake, G., and Grant, M. (2007). Salicylic acid in plant defence the players and protagonists. Curr. Opin. Plant Biol. 10: 466 472. Lorrain, S., Vailleau, F., Balagué, C., and Roby, D. (2003). Lesion mimic mutants: keys for deciphering cell death and defense pathways in plants? Trends Plant Sci. 8: 263 271. Lukasik, E ., and Takken, F.L . (2009). STANDing strong, resistance proteins instigators of plant defence. Curr. Opin. Plant Biol. 12: 427 436. Macho, A.P., Guevara, C.M., Tornero, P., Ruiz Albert, J., and Beuzón, C.R. (2010). The Pseudomonas syringae effector protein HopZ1a suppresses effector triggered immunity. New Phytol. 187: 1018 1033. Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L . (2002). RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1 mediated resistance in Arabidopsis . Cell 108: 743 754. Makandar, R., Essig, J.S., Schap augh, M.A., Trick, H.N., and Shah, J. (2006). Genetically engineered resistance to Fusarium head blight in wheat by expression of Arabidopsis NPR1 . Mol. Plant Microbe Interact. 19: 123 129. Malamy, J., Hennig, J., and Klessig, D. F. (1992). Temperature dep endent induction of salicylic acid and its conjugates during the resistance response to tobacco mosaic virus infection. Plant Cell 4: 359 366. Maldonado, A.M., Doerner, P., Dixon, R.A., Lamb, C.J., and Cameron, R.K. (2002). A putative lipid transfer protei n involved in systemic resistance signalling in Arabidopsis . Nature 419: 399 403. Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J., Lawton, K.A ., Dangl, J.L ., and Dietrich, R.A . (2000). The transcriptome of Arabidopsis thaliana during systemic acquired resistance. Nat. Genet. 26: 403 410. Malnoy, M., Jin, Q., Borejsza Wysocka, E.E., He, S.Y., and Aldwinckle, H.S. (2007). Overexpression of the apple MpNPR1 gene c onfers increased disease resistance in Malus x domestica . Mol. Plant Microbe Interact. 20: 1568 1580. Mang, H.G., Qian, W., Zhu, Y., Qian, J., Kang, H.G., Klessig, D., and Hua, J. (2012). Abscisic acid deficiency antagonizes high temperature inhibition of disease

PAGE 150

150 resistance through enhancing nuclear accumulation of Resistance proteins SNC1 and RPS4 in Arabidopsis . Plant Cell 24: 1 14. Marek, G., Carver, R., Ding, Y., Sathyanarayan, D., Zhang, X., and Mou, Z. (2010). A high throughput method for isolation of salicylic acid metabolic mutants. Plant Methods. 6: 21. Matsushita, A., Inoue, H., Goto, S., Nakayama, A., Sugano, S., Hayashi, N., and Takatsuji, H. (2013) The nuclear ubiquitin proteasome degradation affects WRKY45 function in the rice defense program. Plant J. 73: 302 313. Mauch, F., Mauch Mani, B., Gaille, C., Kull, B., Haas, D., and Reimmann, C. (2001). Manipulati on of salicylate content in Arabidopsis thaliana by the expression of an engineered bacterial salicylate synthase. Plant J. 25: 67 77. Mauch Mani, B., and Slusarenko, A.J. (1996). Production of salicylic acid precursors is a major function of phenylalanine ammonia lyase in the resistance of Arabidopsis to Peronospora parasitica . Plant Cell 8: 203 212. Meighen, E.A. (1993). Bacterial bioluminescence: organization, regulation, and application of the lux genes. FASEB J. 7: 1016 1022. Melotto, M., Underwood, W. , Koczan, J., Nomura, K., and He, S.Y. (2006). Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969 980. Meur, G., Budatha, M., Gupta, A.D., Prakash, S., and Kirti, P.B. (2006). Differential induction of NPR1 during defense r esponses in Brassica juncea . Physiol. Mol. Plant Pathol. 68: 128 137. Mittal, S., and Davis, K.R. (1995). Role of the phytotoxin coronatine in the infection of Arabidopsis thaliana by Pseudomonas syringae pv. tomato . Mol. Plant Microbe Interact. 8: 165 171 . Moeder, W., and Yoshioka, K. (2008). Lesion mimic mutants: A classical, yet still fundamental approach to study programmed cell death. Plant Signal Behav. 3: 764 767. Mohr, P.C.D. (2003). Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica . Funct. Plant Biol. 30: 461 469. Mohr, P.G., and Cahill, D.M. (2003). Abscisic acid influences the susceptibility of Arabidopsis thaliana to Pseudomonas syringae pv. tomato and Peronospora parasitica . Func. Plant Bio. 30: 461 469. Molders, W ., Buchala, A ., and Metraux, J.P . (1996). Tra nsport of salicylic acid in tobacco necrosis virus infected cucumber plants. Plant Physiol. 112: 787 792.

PAGE 151

151 Mosher, S., Moeder, W., Nishimura, N., Jikumaru, Y., J oo, S.H., Urquhart, W., Klessig, D.F ., Kim, S.K ., Nambara, E ., and Yoshioka, K . (2010). The lesion mimic mutant cpr22 shows alterations in abscisic acid signaling and abscisic acid insensitivity in a salicylic acid dependent manner. Plant Physiol. 152: 1901 1913. Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell 113: 935 944. (2012). Pipecolic acid, a n endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity. Plant Cell 24: Nawrath, C., and Métraux, J.P. (1999). Salicylic acid induction deficient mutants of Arabidopsis express PR 2 and PR 5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 11: 1393 1404. Nawrath, C., Heck, S., Parinthawong, N., and Métraux, J.P. (2002). EDS5, an essential component of salicylic acid dependent signaling for disease resistance in Arabidopsis , is a member of the MATE transporter family. Plant Cell 14: 275 286. Negre, F ., Kolosova, N ., Knoll, J ., Kish, C.M ., and Dudareva, N . (2002). Novel S adenosyl L methionine:salicylic acid car boxyl methyltransferase, an enzyme responsible for biosynthesis of methyl salicylate and methyl benzoate, is not involved in floral scent production in snapdragon flowers. Arch Biochem. Biophys. 406: 261 270. Nobuta, K., Okrent, R.A., Stoutemyer, M., Rodibaugh, N., Kempema, L., Wildermuth, M.C ., and Innes, R.W . (2007). The GH3 acyl adenylase family member PBS3 regulates salicylic acid dependent defense responses in Arabidopsis . Plant Physiol. 144: 1144 1156. Okrent, R.A., Brooks, M.D., and Wildermuth, M.C . (2009). Arabidopsis GH3.12 (PBS3) conjugates amino acids to 4 substituted benzoates and is inhibited by salicylate. J. Biol. Chem. 284: 9742 9754 . Park, J.E., Park, J.Y., Kim, Y.S., Staswick, P.E., Jeon, J., Yun, J ., Kim, S.Y ., Kim, J ., Lee, Y.H ., and Park, C.M . (2007). GH3 mediated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis . J. Biol. Chem. 282: 10036 10046. Park, S.W., Kaimoyo, E., Kumar, D., Mosher, S., and Klessig, D.F. (2007). Methyl salicylate is a critical mobile signal for plant systemic acquired resistance. Science 318: 113 116. Pellegrini, L., Rohfritsch, O., Fritig, B., and Legrand, M. (1994). Phenylalanine ammonia lyase in tobacco. Molecular cloning and gene expression during the

PAGE 152

152 hypersensitive reaction to Tobacco M osaic Virus and the response to a fungal elicitor. Plant Physiol. 106: 877 886. Pelludat, C., Brem, D., and Heesemann, J. (2003). Irp9, encoded by the high pathogenicity island of Yersinia enterocolitica , is able to convert chorismate into salicylate, the precursor of the siderophore yersiniabactin. J. Bacteriol. 185: 5648 5653. Potlakayala, S.D., DeLong, C., Sharpe, A., and Robert, P.R. (2007). Conservation of non expressor of pathogenesis related genes 1 function between Arabidopsis thaliana and Brassica napus . Physiol. and Mol. Plant Pathol. 71: 174 183. Poulsen, C., and Verpoorte, R. (1991). Roles of chorismate mutase, isochorismate synthase and anthranalate synthase in plants. Phytochem. 30: 377 386. Preston, G. (2000). Pseudomonas syringae pv. tomato : the right pathogen, of the right plant, at the right time. Mol. Plant Pathol. 1: 263 275. Raes, J., Rhode, A., Christensen, J.H., Van de Peer, Y., and Boerjan, W. (2003). Genome wide characterization of the lignification toolbox in Arabidopsis . Plant Physi ol. 133: 1051 1071. Rai, V.K., Sharma, S.S., and Sharma, S. (1986). Reversal of ABA induced stomatal closure by phenolic compounds. J. Exp. Bot. 37: 129 134. Raskin, I. (1992a). Role of salicylic acid in plants. Annu. Rev. Plant Physiol. 43: 438 463. Raskin, I. (1992b). Salicylate, a new plant hormone. Plant Physiol. 99: 799 803. Rasmussen, J.B., Hammerschmidt, R., and Zook, M.N. (1991). Systemic induction of salicylic acid accumulation in cucumber after inoculation with Pseudomonas syringae pv. syring ae . Plant Physiol. 97: 1342 1347. Rate, D.N., and Greenberg, J.T. (2001). The Arabidopsis aberrant growth and death2 mutant shows resistance to Pseudomonas syringae and reveals a role for NPR1 in suppressing hypersensitive cell death. Plant J. 27: 203 211 . Ravichandran, S ., Ston e, S.L ., Benkel, B ., and Prithiviraj, B . (2013). Purple Acid Phosphatase5 is required for maintaining basal resistance against Pseudomonas syringae in Arabidopsis . BMC Plant Bio l. 13: 107. Richard, N.S., and Peter, R.S. (2005). Plant disease: a threat to global food security. Annu. Rev. Phytopathol. 43: 83 116. Robatzek, S., and Wirthmüller, L. (2013). Mapping FLS2 function to structure: LRRs, kinase and its working bits. Protopl asma 250: 671 81.

PAGE 153

153 Robert Seilaniantz, A., Grant, M., and Jones, J.D. (2011). Hormone crosstalk in plant disease and defense: more than just jasmonate salicylate antagonism. Annu. Rev. Phytopathol . 49: 317 343. Rogers, E.E., and Ausubel, F.M. (1997). Arabidopsis enhanced disease susceptibility mutants exhibit enhanced susceptibility to several bacterial pathogens and alterations in PR 1 gene expression. Plant Cell 9: 305 316. Rohde, A., Morreel, K ., Ralph, J., Goeminne, G., Hostyn, V., De Rycke, R., Kushnir, S., Van Doorsselaere, J., Joseleau, J.P., Vuylsteke, M., Van Driessche, G., Van Beeumen, J., Messens, E., and Boerjan, W. (2004). Molecular phenotyping of the pal1 and pal2 mutants of Arabidop sis thaliana reveals far reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. Plant Cell 16: 2749 2771. Rosebrock, T.R., Zeng, L., Brady, J.J., Abramovitch, R.B., Xiao, F., and Martin, G.B. (2007). A bacterial E3 ubiquitin lig ase targets a host protein kinase to disrupt plant immunity. Nature 448: 370 374. Ryals, J., Weymann, K., Lawton, K., Friedrich, L., Ellis, D., Steiner, H.Y., Johnson, J., Delaney, T.P., Jesse, T., Vos, P., and Uknes, S. (1997). The Arabidopsis NIM1 protei n shows homology to the mammalian transcription factor inhibitor I k B. Plant Cell 9: 425 439. Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H.Y., and Hunt, M.D. (1996). Systemic acquired resistance. Plant Cell 8: 1809 1819. Saito, S., Hirai, N., Matsumoto, C., Ohigashi, H., Ohta, D., Sakata, K ., and Mizutani, M . (2004). Arabidopsis CYP707As encode (+) hydroxylase, a key enzyme in the oxidative catabolism of abscisic acid. Plant Physiol. 134: 1439 1449. Sanchez Vallet, A., Lopez, G., Ra mos, B., Delgado Cerezo, M., Riviere, M.P., Llorente, F., Fernandez, P.V., Miedes, E., Estevez, J.M., Grant, M. and Molina, A. (2012). Disruption of abscisic acid signaling constitutively activates Arabidopsis resistance to the necrotrophic fungus Plectos phaerella cucumerina . Plant Physiol. 160: 2109 2124. Santner, A., and Estelle, M. (2009). Recent advances and emerging trends in plant hormone signalling. Nature 459: 1071 1078. Seo, M., and Koshiba, T . (2002). Complex regulation of ABA biosynthesis in plants. Trends Plant Sci. 7: 41 48. Seo, P.J. and Park, C.M. (2010). MYB96 mediated abscisic acid signals induce pathogen resistance response by promoting salicylic acid biosynthesis in Arabidopsis . New Phytol. 186: 471 483.

PAGE 154

154 Seo, S., Ichizawa, K., and Ohashi, Y. (1995). Induction of salicylic acid glucosidase in tobacco leaves by exogenous salicylic acid. Plant Cell Physiol. 36: 447 453. Serino, L., Reimmann, C., Baur, H., Beyeler, M., Visca, P., and Haas, D. (1995). Structural genes for salicylate biosynthesis from chorismate in Pseudomonas aeruginosa . Mol. Gen. Genet. 249: 217 228. Serrano, M., Wang, B., Aryal, B., Garcion, C., Abou Mansour, E., Heck, S., Geisler, M., Mauch, F., Nawrath, C., and Métraux, J.P. (2013). Export of salicylic acid from the chloroplast requires the multidrug and toxin extrusion like transporter EDS5. Plant Physiol. 162: 1815 1821. Seskar, M. Shulaev, V., and Raskin, I. (1998). Endogenous methyl salicylate in pathogen inoculated tobacco plants. Plant Physiol. 116: 387 392. Shah, J., Tsui, F., and Klessig, D.F. (1997). Characterization of a sal icylic acid insensitive mutant ( sai1 ) of Arabidopsis thaliana , identified in a selective screen utilizing the SA inducible expression of the tms2 gene. Mol. Plant Microbe Interact. 10: 69 78. Shapiro, A.D., and Zhang, C. (2001). The role of NDR1 in avirulence gene directed signaling and control of programmed cell death in Arabidopsis . Plant Physiol. 127: 1089 1101. Shimono, M., Sugano, S., Nakayama, A., Jiang, C.J., Ono, K., Toki, S., and Takatsuji , H. (2007). Rice WRKY45 plays a crucial role in benzothiadiazole inducible blast resistance. Plant Cell 19: 2064 2076. Shulaev, V. Silverman, P., and Raskin, I. (1997). Airborne signalling by met hyl salicylate in plant pathogen resistance. Nature 385: 718 721. Silverman, P., Seskar, M., Kanter, D., Schweizer, P., Métraux, J.P., and Raskin, I. (1995) Salicylic acid in rice, biosynthesis, conjugation, and possible role. Plant Physiol. 108: 633 639. Smalle, J., and Vierstra, R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant Biol. 55: 555 590. Spoel, S.H., Mou, Z., Tada, Y., Spivey, N.W., Genschik, P., and Dong, X . (2009). Proteasome mediated turnover of the transcription coactivator NPR1 plays dual roles in regulating plant immunity. Cell 137: 860 872. Sticher, L., Mauch Mani, B., and Métraux, J.P. (1997). Systemic acquired resistance. Annu. Rev. Phytopathol. 35: 235 270. Stone, S.L ., and Callis, J . (200 7). Ubiquitin ligases mediate growth and development by promoting protein death. Curr. Opin. Plant Biol. 10: 624 632.

PAGE 155

155 Strawn, M.A., Marr, S.K. , Inoue, K., Inada, N., Zubieta, C., and Wildermuth, M.C. (2007). Arabidopsis isochorismate synthase functional in pathogen induced salicylate biosynthesis exhibits properties consistent with a role in diverse stress responses. J. Biol. Chem. 282: 5919 593 3. Tada, Y., Spoel, S.H., Pajerowska Mukhtar, K., Mou, Z., Song, J., Wang, C., Zuo, J., and Dong, X. (2008). Plant immunity requires conformational changes of NPR1 via S nitrosylation and thioredoxins. Science 321: 952 956. Ton, J., and Mauch Mani, B. (200 Aminobutyric acid induced resistance against necrotrophic pathogens is based on ABA dependent priming for callose. Plant J. 38: 119 130. Ton, J., Flors, V., and Mauch Mani, B. (2009). The multifaceted role of ABA in disease resistance. Trends Plant S ci. 14: 310 317. Truman, W., Bennett, M.H., Kubigsteltig, I., Turnbull, C., and Grant, M. (2007). Arabidopsis systemic immunity uses conserved defense signaling pathways and is mediated by jasmonates. Proc. Natl. Acad. Sci. USA 104: 1075 1080. Tsuda, K., S ato, M., and Katagiri, F. (2007). Expression profile analysis of Arabidopsis defense responses elicited by the Pseudomonas syringae hrcC mutant. Plant and Cell Physiol. 48: S49 S49. van der Biezen, E.A., and Jones, J.D.G. (1998). Plant disease resistance p roteins and the gene for gene concept. Trends Biochem. Sci. 23: 454 456. van Tegelen, L.J ., Moreno, P.R ., Croes, A.F ., Verpoorte, R ., Wullems, G.J . (1999). Purification and cDNA cloning of isochorismate synthase from elicited cell cultures of Catharanthus roseus . Plant Physiol. 119: 705 712. Van Verk, M.C. , Bol, J.F., and Linthorst, H.J. (2011). WRKY transcription factors involved in activation of SA biosynthesis genes. BMC Plant Biol. 11: 89. Verberne, M.C., Brouwer, N., Delbianco, F., Linthorst, H.J., Bol, J.F., and Verpoorte, R. (2002). Method for the ex traction of the volatile compound salicylic acid from tobacco leaf material. Phytochem. Anal. 13: 45 50. Verberne, M.C., Budi Muljono, R.A., and Verpoorte, R. (1999). Salicylic acid biosynthesis. In: Biochemistry and Molecular Biology of Plant Hormones. 33 : 295 314. Vernooij, B., Friedrich, L., Morse, A., Reist, R., Kolditz Jawhar, R., Ward, E., Uknes, S., Kessmann, H., and Ryals, J. (1994). Salicylic acid is not the translocated signal responsible for inducing systemic acquired resistance but is required in signal transduction. Plant Cell 6: 959 965.

PAGE 156

156 Vlot, A.C., Dempsey, D.A. and Klessig, D.F. (2009) Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 47: 177 206. Volko, S.M ., Boller, T ., and Ausubel, F.M . (1998). Isolation of new Arabidopsis mutants with enhanced disease susceptibility to Pseudomonas syringae by direct screening. Genetics 149: 537 548. Wang, D., Amornsiripanitch, N., and Dong, X. (2006). A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathog. 2: e123. Wang, L ., Tsuda, K ., Truman, W ., Sato, M ., Nguyen le, V ., Katagiri, F ., and Glazebrook, J . (2011). CBP60g and SARD1 play partially redundant critical roles in salicylic acid signaling. Plant J. 67: 1029 1041. Wang, Y., Li, J., Hou, S., Wang, X., Li, Y., Ren, D., Chen, S., Tang, X., and Zhou, J.M. (2010). A Pseudomonas syringae ADP ribosyltransferase in hibits Arabidopsis mitogen activated protein kinase kinases. Plant Cell 22: 2033 2044. Wasilewska, A., Vlad, F., Sirichandra, C., Redko, Y., Jammes, F., Valon, C., Frei dit Frey, N., and Leung, J. (2008). An update on abscisic acid signaling in plants and more... Mol. Plant 1: 198 217. Weigel, D., and Glazebrook, J. (2002). Arabidopsis : A Laboratory Manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Weigel, R.R., B¨auscher, C., Pfitzner, A.J.P., and Pfitzner, U.M. (2001). NIMIN 1, NIMIN 2 and NIMIN 3, members of a novel family of proteins from Arabidopsis that interact with NPR1/NIM1, a key regulator of systemic acquired resistance in plants. Plant Mol. Biol. 46: 143 160. We issman, G. (1991). Aspirin. Scient. Amer. 264: 84 90. Whenham, R.J., Fraser, R.S.S., Brown, L.P., and Payne, J.A. (1986). Tobacco Mosaic Virus induced increase in abscisic acid concentration in tobacco leaves intracellular location in light and dark green areas, and relationship to symptom development. Planta 168: 592 598. White, R.F. (1979). Acetylsalicylic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 99: 410 412. Wildermuth, M.C., Dewdney, J., Wu, G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414: 562 565. Wu, Y., Zhang, D., Chu, J.Y., Boyle, P., Wang, Y., Brindle, I.D., De Luca, V ., and Després, C . (2012). The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell Rep. 1: 639 647.

PAGE 157

157 Xia, Y., Gao, Q.M., Yu, K., Lapch yk, L., Navarre, D., Hildebrand, D., Kachroo, A., and Kachroo, P. (2009). An intact cuticle in distal tissues is essential for the induction of systemic acquired resistance in plants. Cell Host Microbe 5: 151 165. Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhan g, J., Xing, W ., Li, Y ., Tang, X ., Zhu, L ., Chai, J ., and Zhou, J.M . (2008). Pseudomonas syringae effect or AvrPto blocks innate immunity by targeting receptor kinases. Curr. Biol. 18: 74 80. Xin, X.F., and He, S.Y. (2013). Pseudomonas syringae pv. tomato DC3000: A model pathogen for probing disease susceptibility and hormone signaling in plants. Annu. Rev. P hytopathol. 51: 473 498. Xiong, L.M., Ishitani, M., Lee, H., and Zhu, J.K. (2001). The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress and osmotic stress responsive gene expression. Plant Cell 13: 2063 2083. Xu, J., Audenaert, K., Hofte, M., and De Vleesschauwer, D. (2013). Correction: Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv oryzae by suppressing salicylic acid mediated defenses. PLoS ONE 8: 10.1371 Yasuda, M., Ishikawa, A., Jikumaru, Y., Seki, M., Umezawa, T., Asami, T ., Maruyama Nakashita, A ., Kudo, T ., Shinozaki, K ., Yoshida, S ., and Nakashita, H . (2008). Antagonistic interaction between systemic acquired resistance and the abscisic acid mediated abiotic stress response in Arabidopsis . Plant Cell 20: 1678 1692. Yu, D., Chen, C., and Chen, Z. (2001). Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression. Plant Cell 13: 1527 1540. Yu, I.C ., Parker, J ., and Be nt, A.F . (1998). Gene for gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. USA 95: 7819 7824. Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H ., Zou, Y ., Long, C ., Lan, L ., Chai, J ., Chen, S ., Tang, X ., and Zhou, J.M . (2007). A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP induced immunity in plants. Cell Host Microbe 1: 175 185. Zhang, K., Halitschke, R., Yin, C., Liu, C.J ., and Gan, S.S. (2013). Salicylic acid 3 hydroxylase regulates Arabidopsis leaf longevity by mediating salicylic acid catabolism. Proc. Natl. Acad. Sci. USA 110: 14807 14812. , and Mou, Z. (2010) Over expression of the Arabidopsis NPR1 gene in citrus increases resistance to citrus canker. Eur. J Plant Pathol. 128: 91 100.

PAGE 158

158 Zhang, X ., Wang, C ., Zhang, Y ., Sun, Y ., and Mou, Z . (2012). The Arabidopsis Mediator Complex Subunit16 positively regulates salicylate mediated systemic acquired resistance and jasmonate/ethylene induced defense pathways. Plan t Cell 24: 4294 4309. Zhang, Y ., Cheng, Y.T ., Qu, N ., Zhao, Q ., Bi, D ., and Li, X . (2006). Negative regul ation of defense responses in Arabidopsi s by two NPR1 paralogs. Plant J. 48: 647 656. Zhang, Y., Fan, W., Kinkema, M., Li, X., and Dong, X. (1999). Interaction of NPR1 with basic leucine zipper protein transcription factors that bind sequences required for salicylic acid induction of the PR 1 gene. Proc. Natl. Acad. Sci. USA 96: 6523 6528. Zhang, Y., Goritschnig, S., Dong, X., an d Li, X. (2003). A gain of function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1 1 , constitutive 1. Plant Cell 15: 2636 2646. Zhang, Y., Tessaro, M.J., Lassner , M., and Li, X. (2003). Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell 15: 2647 2753. Zhang, Y., Wang, X., Cheng, C., Gao, Q., Liu, J., an d Guo, X. (2008). Molecular cloning and characterization of GhNPR1 , a gene implicated in pathogen responses from cotton ( Gossypium hirsutum L.). Biosci. Rep. 28: 7 14. Zhang, Y ., Xu, S ., Ding, P ., Wang, D ., Cheng, Y.T ., He, J ., Gao, M ., Xu, F ., Li, Y ., Zhu, Z ., Li, X ., and Zhang, Y . (2010). Control of salicylic acid synthesis and systemic acquired resistance by two members of a p lant specific family of transcription factors. Proc. Natl. Acad. Sci. USA 107: 18220 18225. Z hang, Z., Li, Q., Li, Z., Staswick, P.E., Wang, M., Zhu, Y ., and He, Z . (2007). Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis Pseudomonas syringae interaction. Plant Physiol. 145: 450 464. Zheng, X.Y., Spivey, N.W., Zeng, W., Liu, P.P., Fu, Z.Q., Klessig, D.F., He, S.Y. and Dong, X. (2012). Coronatine promotes Pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumulation. Cell Host Microbe 11: 587 596. Zheng, Z., Qualley, A., Fan, B., Dudareva, N., and Chen, Z. (2009). An important role of a BAHD acyl transferase like protein in plant innate immunity. Plant J. 57: 1040 1053. Zhou, J.M., Trifa, Y., Silva, H., Pontier, D., Lam, E., Shah, J., and Klessig, D.F. (2000). NPR1 differentially interacts with members of the TGA/OBF family of

PAGE 159

159 transcription factors that bind an element of the PR 1 gene required for induction by salicylic acid. Mol. Plant Microbe Interact. 13: 191 202. Zhou, N ., Tootle, T.L ., Tsui, F ., Klessig, D.F ., and Glazebrook, J . (1998). PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis . Plant Cell 10: 1021 1 030. Zhou, R., Cutler, A.J., Ambrose, S.J., Galka, M.M., Nelson, K.M., Squires, T.M., Loewen, M.K., Jadhav, A.S., Ross, A.R.S., Taylor, D.C., and Abrams, S.R. (2004). A new abscisic acid catabolic pathway. Plant Physiol. 134: 361 369. Zimmermann, P., Hirsch Hoffmann, M., Hennig, L., and Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol. 136: 2621 2632.

PAGE 160

160 BIOGRAPHICAL SKETCH 1979. He obtained his bachelor degree at Nanjing Agricultural University in 2002. H e continued his stud ies for his master degree in the Plant Breeding program at the same university. He conducted research on understanding the molecular mechanisms of co tton fiber degree in 2005. Subsequently , he became a teacher a t Nanjing Agricultural University and taught as a research assistant on cotton breeding and took charge of the field management in was married to Dongyan Chen in 2005. In 2009, he moved to Texas Tech University and worked as a research assistant on oil crop breeding with Dr. Dick Auld . In January, 2010, he joined the Ph.D program in the Department of Microbiology and Cell Science at the University of Florida. He began working with Dr. Zhonglin Mou and focused on the understanding of the SA signaling pathway in plant innate immunity.