Citation
Genetic Regulation of Oxalic Acid Metabolism and Pathogenesis in the Broad Host Range Necrotrophic Fungal Plant Pathogen Sclerotinia Sclerotiorum (Lib.) De Bary

Material Information

Title:
Genetic Regulation of Oxalic Acid Metabolism and Pathogenesis in the Broad Host Range Necrotrophic Fungal Plant Pathogen Sclerotinia Sclerotiorum (Lib.) De Bary
Creator:
Liang, Xiaofei
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (221 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
ROLLINS,JEFFREY A
Committee Co-Chair:
JONES,JEFFREY B
Committee Members:
CHUNG,KUANG REN
KEYHANI,NEMATOLLAH
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Appressoria ( jstor )
Ascomycota ( jstor )
Fungi ( jstor )
Hyphae ( jstor )
Infections ( jstor )
Inoculation ( jstor )
Lesions ( jstor )
Oxalates ( jstor )
pH ( jstor )
Virulence ( jstor )
Plant Pathology -- Dissertations, Academic -- UF
fungi -- metabolism -- necrotroph -- oxalate -- sclerotinia -- virulence
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Plant Pathology thesis, Ph.D.

Notes

Abstract:
Sclerotinia sclerotiorum (Lib.) de Bary is a devastating broad host range fungal phytopathogen that requires high levels of oxalic acid (OA) accumulation to successfully colonize its hosts. The overall goal of this research project is to better understand the molecular regulation of S. sclerotiorum pathogenesis, and the genetic regulation of oxalic acid (OA) metabolism. The S. sclerotiorum genome encodes one putative oxaloacetate acetylhydrolase (OAH, Ss-Oah1) related to OA biogenesis, and two putative oxalate decarboxylases (OxDCs, Ss-Odc1, Ss-Odc2) related to OA degradation. These three genes were characterized in the first part of the study. The Ss-oah1 knock out mutants did not accumulate OA either in culture or during plant infection, and induced very restricted lesions on many tested hosts. The Ss-oah1 knock out mutants were also defective in the development of compound appressorium and scleortium, and exhibited a severe radial growth defect on medium buffered at neutral pH. Neither low pH (3.0) nor exogenous OA (up to 40 mM at pH4.8) affected the transcript accumulation of Ss-odc1 and Ss-odc2 genes. Ss-odc2 transcript, but not Ss-odc1 transcript, showed strong induction during compound appressorium differentiation. No growth, morphogenesis, or virulence defect was observed for the Ss-odc1 knock out mutant while Ss-odc2 knock out mutants showed less-efficient compound appressorium differentiation, increased OA accumulation, and significantly reduced virulence on many host tissues. Wounding prior-to inoculation fully restored the virulence defect of the Ss-odc2 knock out mutants. To identify other components of S. sclerotiorum pathogenesis, a forward genetic approach utilizing Agrobacterium tumefaciens-mediated transformation (ATMT) was carried out. 16 virulence-defective mutants were identified based on virulence screening on celery and common bean hosts. T-DNA insertional disruption of a hypothetical protein with an AIM24 domain, presumably involved in mitochondrial biogenesis, caused severe defect in virulence, the development of compound appressorium (CA) and sclerotium, but a minor reduction in OA accumulation. These findings provide solid genetic evidence to support the long-standing hypothesis that OA accumulation is essential for host colonization of S. sclerotiorum. In addition, the infection process also involves a fine-tuned regulation of OA accumulation through OA biosynthetic as well as catabolic pathways. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: ROLLINS,JEFFREY A.
Local:
Co-adviser: JONES,JEFFREY B.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Xiaofei Liang.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 GENETIC REGULATION OF OXALIC ACID METABOLISM AND PATHOGENESIS IN THE BROAD HOST RANGE NECROTROPHIC FUNGAL PLANT PATHOGEN Sclerotinia sclerotiorum (Lib.) de Bary By XIAOFEI LIANG A DISSERTATION PRESENTED TO THE GRADUATE SCH OOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2 © 2014 Xiaofei Liang

PAGE 3

3 To my parents, Mr. Bangzi Liang and Ms. C hunlan Wang, and my grandmother, Ms. Guiying Wang, for their unconditional and unending love

PAGE 4

4 ACKNOWLEDGMENTS I would like to express my gratitude to all people offering me help to finish my Ph.D. research and study . I sincerely thank my supervisory c ommittee chair, Dr. Jeffrey A. Rollins . He is a kind person, an outstanding researcher, and a patient mentor. I learned a lot from his enduring enthusiasm for science , and his humble and optimistic attitude toward life. I deeply appreciate his invaluable e fforts in training m e the habit of critical thinking and independent judgment, and his guidance and encouragements throughout the years . I would also like to thank Drs. Jeffrey B. Jones, Kuang Ren Chung, and Nemat O. Keyhani for serving on my committee, an d for their helpful suggestions and critical evaluation of this dissertation. I would like to express my special thanks to Ms. Ulla Benny and Dr. Daniele Liberti for their technique guidance during my daily laboratory research , the high school student Tyle r Ritz for helping me characterizing the T DNA transformants, and Dr. Ellen Moomaw for her experimental suggestions . I would also like to thank other members of the Rollins lab and all the friends I have made in Gainesville for their warm supports in both work and personal life. Finally I deeply thank my family members back in China, and in particular my parents for the overwhelming efforts they have made to raise me up and to allow me to pursue a study abroad .

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 13 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 17 Biology, Disease Cycle and Management of Sclerotinia sclerotiorum (L ib.) de Bary ................................ ................................ ................................ ..................... 17 Biology and disease cycle ................................ ................................ ................ 17 Disease management ................................ ................................ ...................... 19 Virulence Factors of Necrotrophic Fungal Plant Pathogens ................................ .... 20 Phytotoxins ................................ ................................ ................................ ....... 20 Reactive oxygen species ................................ ................................ .................. 22 Cell wall degrading enzymes ................................ ................................ ............ 26 Plant Defense Responses to Necrotrophic Fungi ................................ ................... 29 Innate immune reactions ................................ ................................ .................. 29 Cell death control and reactive oxygen species ................................ ............... 32 Antifungal secondary metabolites ................................ ................................ ..... 33 Molecular Regulation of the S. sclerotiorum Infection Process ............................... 35 Project Goal and Research Overview ................................ ................................ ..... 41 2 OXALOACETATE ACETYLHYDROLASE GENE MUTANTS OF Sclerotinia sclerotiorum DO NOT ACCUMULATE OXALIC ACID BUT RETAIN THE CAPACITY TO FORM PRIMARY LESIONS IN HOST PLANTS ............................ 43 Introdu ction ................................ ................................ ................................ ............. 43 Materials and methods ................................ ................................ ............................ 45 Fungal strains and maintenance ................................ ................................ ...... 45 Treatments, sample collection and gene expression ................................ ........ 45 Radial growth and OA accumulation ................................ ................................ 46 Compound appressorium assay ................................ ................................ ....... 47 Pathogenicity assays ................................ ................................ ........................ 47 GFP labeled strains ................................ ................................ .......................... 48 Onion epidermal infe ction system ................................ ................................ .... 48 Tobacco leaf infiltration ................................ ................................ .................... 49 Staining and microscopic observation ................................ .............................. 49

PAGE 6

6 Results ................................ ................................ ................................ .................... 50 Sequence analysis and expression of Ss oah1 gene ................................ ....... 50 Confirmation of the Ss oah1 gene knock out m utants by Southern hybridization analysis ................................ ................................ .................... 51 Ss oah1 gene is critically required for OA accumulation in S. sclerotiorum ...... 51 ss o ah1 mutants differ from the UV responsive radial growth and development ................................ ................................ ..... 52 ss oah1 mutants and the UV attenuated virulenc e ................................ ................................ ...................... 53 ss oah1 and the UV defense reactions ................................ ................................ .......................... 55 Comparative cytology of the infecti ons of wild ss oah1 mutants on onion epidermal strips ................................ ................................ .............. 55 Discussion ................................ ................................ ................................ .............. 56 3 OXALATE DECARBOXYLASE IS REQUIRED FOR EFFICIE NT EARLY INFECTION ESTABLISHMENT IN Sclerotinia sclerotiorum ................................ ... 72 Introduction ................................ ................................ ................................ ............. 72 Material and Methods ................................ ................................ ............................. 74 Fungal cultures ................................ ................................ ................................ . 74 Sequence analysis, alignment and phylogram construction ............................. 75 Northern b lot, qRT PCR, RT PCR, tissue collection and treatments ................ 75 Gene replacement, complementation ................................ ............................... 78 Vectors for Ss odc2 promoter driv en GFP expression and Ss odc2 gene overexpression ................................ ................................ .............................. 80 Phenotype analysis ................................ ................................ .......................... 81 OA degrading activity assay ................................ ................................ ............. 84 Results ................................ ................................ ................................ .................... 85 Evolutionary features of fungal bicupin OxDC homologs ................................ . 85 Transcript accumul ation of Ss odc1 and Ss odc2 genes ................................ . 86 Gene replacement mutants of Ss odc1 and Ss odc2 ................................ ....... 87 ss odc2 mutants formed less complex compound appressoria ............... 88 ss odc2 mutants were inefficient in primary lesion establishment ........... 89 Inoculation with nutrient enriched mycelia plug restored the developmental ss odc2 mutants ................................ ........ 90 ss odc2 mutants hyperaccumulated OA ................................ ................. 90 Overexpression of Ss odc2 gene in S. sclerotiorum ................................ ......... 91 Discussion ................................ ................................ ................................ .............. 92 4 IDENT IFYING GENES REGULATING Sclerotinia sclerotiorum VIRULENCE AND DEVELOPMENTAL PROCESSES BY Agrobacterium tumefaciens MEDIATED T DNA INSERTIONAL MUTAGENESIS ................................ ............ 112 Introduction ................................ ................................ ................................ ........... 112 Materials and Methods ................................ ................................ .......................... 115 Strain maintenance and plant growth ................................ ............................. 115

PAGE 7

7 Phenotypic ass ays ................................ ................................ ......................... 116 Nucleic acid manipulations ................................ ................................ ............. 118 Data analysis ................................ ................................ ................................ .. 119 Results ................................ ................................ ................................ .................. 120 Preliminary CA formation assay and virulence screening on celery ............... 120 Virulence assay on common bean ................................ ................................ . 121 Mutants defective in compound appressorium (CA) development ................. 123 Mutants aberrant in sclerotium development or plate morphology ................. 124 TAIL PCR ................................ ................................ ................................ ....... 124 Discussion ................................ ................................ ................................ ............ 126 5 RESEARCH SUMMARY ................................ ................................ ....................... 140 APPENDIX A SUPPLEMENTAL DATA FOR CHAPTER 2 ................................ ......................... 143 B SUPPLEMENTAL DATA FOR CHAPTER 3 ................................ ......................... 157 C SUPPLE MENTAL DATA FOR CHAPTER 4 ................................ ......................... 169 LIST OF REFERENCES ................................ ................................ ............................. 198 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 221

PAGE 8

8 LIST OF TABLES T able page 4 1 Virulence, growth, and developments of the T DNA transformants exhibiting virulence defects. ................................ ................................ .............................. 132 4 2 Recovered genomic DNA sequences flanking T DNA insertions . .................... 133 A 1 Lesion development and oxalic acid accumulation. ................................ .......... 143 A 2 PacC binding sites (GCCARG) at the upstream intergenic regions of Ascomycota oah homologs. ................................ ................................ .............. 144 C 1 Summary of the celery stalk virulence assays . ................................ ................. 169 C 2 Phenotypic sum . ........................... 170

PAGE 9

9 LIST OF FIGURES Figure page 2 1 Northern hybridization analysis of Ss oah1 transcript accumulation . .................. 63 2 2 Generation and verification of Ss oah1 gene replacement mutants . .................. 64 2 3 Oxalic acid accumulation and pH kinetics in 0.5 M MOPS buffered YPSu shake culture (pH 7.0) ................................ ................................ ........................ 65 2 4 Radial growth kinetics on unbuffered PDA or PDA media buffered with citric acid sodium phosphate buffer at the indicated initial pH values ......................... 66 2 5 Colony morphology and compound appressorium formation phenotypes . ......... 67 2 6 Virulence assays on detached tomato leaflets (A), detached soybean leaflets (B), detached Arabidopsis leaflets (C) and intact Arabidopsis plants (D) . .......... 68 2 7 Exogenous oxalate (OA) treatment partially restored the virulence defect of ss oah1 mutants (KO1, KO2) . ................................ ................................ .... 69 2 8 Viability of infectious hyphae at the infection front during soybean leaflet infection . ................................ ................................ ................................ ............. 70 2 9 Host defense reactions elicited on d etached soybean leaflets. Soybean leaflets were wounded prior to inoculation . ................................ ......................... 71 3 1 Northern hybridization analysis of the transcript accumulation for Ss odc1 and Ss odc2 . ................................ ................................ ................................ ...... 99 3 2 Tissue specificity of Ss odc2 ge ne expression determined by promoter driven GFP expression . ................................ ................................ ............................... 100 3 3 Construction and verification of gene knock out mutants of Ss odc1 (A) and Ss odc2 (B) genes ................................ ................................ ............................ 101 3 4 ss odc2 mutants were less efficient in compound appressorium development ................................ ................................ ................................ ..... 102 3 5 ss odc2 and control strains . ................................ ............ 103 3 6 ss odc2 mutants were inefficient in primary lesion establishment . ................. 104 3 7 ss odc2 mutant ................................ ................................ ................................ ...... 105 3 8 Inoculum with elevated nutrients s odc2 compound appressoria formation . ................................ ................................ ................................ ......... 106

PAGE 10

10 3 9 ss odc2 penetration efficiency ................................ ................................ ................................ .......... 107 3 10 Inoculum with elevated nutrient improved compound appressoria formation s odc2 mutant ................................ ...................... 108 3 11 Quantification of oxalic acid accumulation in cultures . ................................ ...... 109 3 12 Quantification of oxalic acid accumulation in mycelia PDA plugs during compound appressorium development . ................................ ............................ 110 3 13 Ss odc2 gene overexpression in S. sclerotiorum . ................................ ............. 111 4 1 Celery stalk virulence assay . ................................ ................................ ............ 134 4 2 Compound appressoria (CA) formation assay . ................................ ................. 135 4 3 Relative growth rate a common bean ................................ ................................ ................................ ... 136 4 4 DNA sequence arrangements at recovered T DNA integration sites (LB: left border; RB: right border) ................................ ................................ ................... 137 4 5 Phenotypes of the AT67 transformant . ................................ ............................. 138 4 6 Phenotypes of the AT185 transformant ................................ ............................ 139 A 1 Phylogeny of OAH homologs from Ascomycota fungi . ................................ ..... 147 A 2 Medium acidification assay . ................................ ................................ .............. 148 A 3 Radial growth kinetics on unbuffered PDA or PDA media buffered with citric acid sodium phosphate buffer at the indicated initial pH values . ...................... 149 A 4 Infection assay on detached soybean leaves with or without prior wounding . .. 150 A 5 Close ss oah1 mutant (KO2) on detached soybean leaflets (A) and on detached canola leaflets (B) ................................ ................................ ................................ ........ 151 A 6 Lesion size developments of GFP labeled strains on detached soybean leaves . ................................ ................................ ................................ .............. 152 A 7 Cytological events related to the infection establishment of S. sclerotiorum on onion epidermal strip . ................................ ................................ ....................... 153 A 8 Common association between fungal subcuticular hyphae and alive onion epidermal cells observed with both the S. sclerotiorum wi ld type (WT) and ss oah1 mutant ( oah KO2) . ................................ ................................ ............ 154

PAGE 11

11 A 9 OA crystal accumulation dynamics during onion epidermal strip infection of S. sclerotiorum WT . ................................ ................................ .......................... 155 A 10 Elicitor activity of the 7 day old PDB culture fluids of the S. sclerotiorum wild t ss oah1 mutant (KO2) on tobacco plants . ................................ ....... 156 B 1 Protein domain stru cture and multiple sequence alignment . ............................ 157 B 2 Neighbor join ing phylogram of oxalate decarboxylase (OxDC) homologs ........ 158 B 3 The Ceriporiopsis subvermispora oxalate oxidase (OxO) is very similar to known oxalate decarboxylases OxDCs . ................................ ........................... 159 B 4 qRT PCR analys is of Ss odc2 transcript accumulation at different developmental stages and in response to OA treatment . ................................ . 160 B 5 Expression specificity of the Ss odc2 gene determined by endogen ous promoter driven GFP expression . ................................ ................................ ..... 161 B 6 ss odc1 s odc2 relative to WT on PDA medium . ................................ ................................ ................................ ............ 162 B 7 Colony morphology , sclerotium and apothecium of ss odc2 mutants ................................ ................................ ................................ ............. 163 B 8 Effect of Ss odc1 or Ss odc2 gene deletion on compound appressorium development and virulence ................................ ................................ ............... 164 B 9 ss odc2 mutants were inefficient in primary lesion establishment . ................. 165 B 10 Oxalic acid accumulation in mycelia plug during compound appressoria induction on parafilm . ................................ ................................ ....................... 166 B 11 Effect of Ss odc2 overexpression on in planta oxalic acid accumulation (A) and virulence (B) ................................ ................................ .............................. 167 B 12 Effect of Ss odc2 overexpression on stress tolerances . ................................ ... 168 C 1 T DNA copy number analysis by Southern hybridization . ................................ . 173 C 2 Scatterplots showing the correlation among bean virulence assays, and between virulence assays and growth rates . ................................ .................... 174 C 3 Scatterplots showing the correlation between celery virulence assay and radial growth, and between virulence assays on cele ry and on common bean 175 C 4 T DNA transformants exhibiting compound appressorium formation defects ... 176

PAGE 12

12 C 5 T DNA transformants with defects in sclerotium development or colony morphology . ................................ ................................ ................................ ...... 181 C 6 Hyphae growth pattern of AT913 at the colony front and colony middle on PDA medium. ................................ ................................ ................................ ... 185 C 7 T DNA insertion mutants inefficient in OA accumulation based on medium acidification assay . ................................ ................................ ........................... 186 C 8 Medium acidification dynamics of AT172 m and AT258 . ................................ .... 187 C 9 bean leaves (2 dpi). ................................ ................................ .......................... 188 C 10 dpi) . ................................ ................................ ................................ .................. 190 C 11 PDA colony morp .............. 193 C 12 Sequence annotation of the SS1G _10409 locus ................................ .............. 195 C 13 Oxalic acid accumulation in PDB shake culture of selected T DNA transformants . ................................ ................................ ................................ ... 196 C 14 Sensitivity of AT67 to osmotic and oxidative stresses . ................................ ..... 197

PAGE 13

13 LIST OF ABBREVIATIONS ATMT Agrobacterium tumefaciens mediated transformation BGL glucosidase BIK1 Botrytis induced kinase1 CA Compound appressoria CBH Cellobiohydrol ase Com Complementation strain CWDEs Cell wall degrading enzymes DAMPs Damage associated molecular patterns DHN Dihydroxynaphthalene DPI Diphenyleneiodonium Ect Ectopic strain EGL Endoglucanases ETH Ethylene FB1 Fumonisin B1 FDH Formate dehydrogenase GH Gl ycoside hydrolase HR Hypersensitive reaction HST Host selective toxin JA Jasmonic acid KO Knock out mutant LB/RB Left border/Right border MLO MILDEW RESISTANCE LOCUS O NEP Necrosis and ethylene inducing protein OA Oxalic acid

PAGE 14

14 OAH Oxaloacetate hydrolase OGs Oligogalacturonides OxC oxalyl CoA decarboxylase ORF Open reading frame OxDC Oxalate decarboxylase OxO Oxalate oxidase PAMPs Pathogen associated molecular patterns PCD Programmed cell death PDA P otato dextrose agar PG Polygalacturonase PGIP Polygalacturon ase inhibitor proteins PL Pectin lyase PME Pectin methylesterase PRRs Pattern recognition receptors REMI Restriction enzyme mediated integration ROS Reactive oxygen species RLK Receptor like kinase SA Salicyclic acid SM Secondary metabolite TCA cycle Trica rboxylic acid cycle TAIL PCR T hermal A symmetric I nterlaced PCR UTR Untranslated region WT Wild type 4MI3G 4 methoxyindol 3 ylmethylglucosinolate

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Par tial Fulfillment of the Requirements for the Degree of Doctor of Philosophy GENETIC REGULATION OF OXALIC ACID METABOLISM AND PATHOGENESIS IN THE BROAD HOST RANGE NECROTROPHIC FUNGAL PLANT PATHOGEN Sclerotinia sclerotiorum (Lib.) de Bary By Xiaofei Liang August 2014 Chair: Jeffrey A. Rollins Major: Plant Pathology Sclerotinia sclerotiorum (Lib.) de Bary is a devastating broad host range fungal phytopathogen that require s high levels of oxalic acid (OA) accumulation to successfully colonize its hosts . The overall goal of this research project is to better understand the molecular regulation of S. sclerotiorum pathogen esis , and the genetic regulation of oxalic acid (OA) metabolism . The S. sclerotiorum genome en codes one putative oxa loacetate acetylhydrolase (OAH, Ss Oah1) related to OA biogenesis, and two putative oxalate decarboxylases (OxDCs, Ss Odc1, Ss Odc2) related to OA degradation . T he se three genes were characterized in the first part of the study . The ss oah1 mutants did not accumulate OA either in culture or during plant infection , and induced very restricted lesions on many tested hosts . T ss oah1 mutants were also defective in the development of compound appressori um and scleorti um , and exhibited a severe radial growth defect o n medium buffere d at neutral pH . N either low pH (3.0) n or exogenous OA (up to 40 mM at pH4.8) affected the transcript a ccumulation of Ss odc1 and Ss odc2 genes . Ss odc2 transcript , but not Ss odc1 transcript , showed strong induction during compound appressorium differenti ation. No growth, morphogenesis, or

PAGE 16

16 virulence defect ss odc1 ss odc2 mutants showed less efficient compound appressorium differentiation, increased OA accumulation, and significantly reduced virulence on many host tissues . Wounding prior to inoculation fully restored t he ss odc2 mutants . To identify other components of S. sclerotiorum pathogenesis, a forward genetic approach utilizing Agrobacterium tumefaciens mediated transformation (ATMT) was carried out . 16 virulence defective mutants were ident ified based on virulence screening on celery and common bean hosts. T DNA insertional disruption of a hypothetical protein with an AIM24 domain , presumably involved in mitochondrial biogenesis, caused severe defect in virulence, the development of compound appressori um (CA) and scleroti um, but a minor reduction in OA accumulation. These findings provide solid genetic evidence to support the long standing hypothesis that OA accumulation is essential for host colonization of S. sclerotiorum . In addition, the infection process also involves a fine tuned regulation of OA accumulation through OA biosynthetic as well as catabolic pathways .

PAGE 17

17 CHAPTER 1 LITERATURE REVIEW Biology, Disease Cycle and Management of Sclerotinia sclerotiorum (Lib.) de Bary Biology and di sease cycle Sclerotinia sclerotiorum (Lib.) de Bary is the type phytopathogenic fungus of the Sclerotinia genus , which belong s to the phylum Ascomycota, the class Leotiomycetes, the order Helotiales, and the family Sclerotiniaceae. Besides S. sclerotiorum , the Sclerotinia genus contains three other agriculturally important phyto pathogen species, S. minor Jagger, S. trifoliorum Erikss, and the phylogenetically Sclerotinia ( Winton et al. , 2006 ) . Among them, S. sclerotiorum has the broadest host range, infecting over 400 plant species, including many economically important seed crops (e.g. dry beans, soybe an, sunflower, canola, peanut) and vegetables (e.g. lettuce, potato, carrot). Sclerotinia diseases account for enormous dollar annual losses in U.S. agriculture production ( Bolton et al. , 2006 ) . T he soybean sclerotia stem rot outbreak in 2009 alone , for instance, directly reduced harvest by approximately $560 million ( Peltier et al. , 2012 ) . S. sclerotiorum and other Sclerotiniaceae species produce sclerotia, macroscopic stromatic structures made up of compact masses of hyphae encompassed within a dark melanized rind layer. Sclerotia play a central role in the disease cycle of S. sclerotiorum . They can remain viable in soil for multiple years ( Abawi & Grogan, 1979 ) and germinate either carpogenically into apothecia, or myceliogenically into white flu ffy hyphae ( Bolton et al. , 2006 ) . The hyphae and apothecia mediate different infection processes. My celia usually directly infect basal plant leaves and stems, causing wilt or drop symptoms ( Huang & Dueck, 1980 ; Subbarao, 1998 ; Kora et al. , 2003 ) . Airborne

PAGE 18

18 ascospores released from apothecia, in contrast, go through a saprotrophic pre infection growth phase, typically on senescent or injured plant tissues befo re host colonization ( Abawi, 1975 ; Sutton & Deverall, 1983 ; H uang & Kokko, 1992 ; Jamaux et al. , 1995 ) . In the absence of exogenous nutrients, ascospores inoculated on green leaf tissue either fail to germinate ( Jamaux et al. , 1995 ) , or induce hypersensitive response (HR) like defense reactions , characterized by the browning and granulation of the cell cytoplasm of host epidermal cells , and the restriction of nascent invasive hyphae deve lopment ( Sutton & Deverall, 1983 ) . Low temperature and hi gh humidity are conductive to S. sclerotiorum disease epidemics, for favoring sclerotia carpogenic germination and ascospore survival ( Bolton et al. , 2006 ) . S. sclerotiorum is a homothallic fungus and can produce apothecia and ascospores from sclerotia without outcrossing. On one apothecium, tens of millions of asci can be produced and each sclerotium m ay produce multiple apotheci a; thus it is possible for half a billion ascospores to be discharged from a single sclerotium. A scospores are binucleate and formed within cylindrical asci, which lay within the concave apothecium surface and are aligned togeth er into a hymenial layer (2 10 mm diameter). Unlike ascospores, the S. sclerotiorum vegetative hyphae are multinucleate. The necrotrophic infection of S. sclerotiorum involves tightly regulated morphogenic events . On plant surface s , the fung al hyphae tips first differentiate appressori a structures ( Abawi , 1975 ; Sedun & Brown, 1987 ) , o ccur r ing through the serial recurrent events of growth retardation, swelling, and subsequent bifurcation. The appressorium structural complexity ranges from a single cell simple appressorium, a multicellular compound appressorium, to a millimeter ( Abawi,

PAGE 19

19 1975 ; Tariq & Jeffries, 1984 ) , the com plexity of which are positively correlated with substrate penetration resistance . Within a compound appressorium, hypha l tips are compactly ali gned perpendicular to the induc ive surface, with each tip having the pot ential to initiate independent penetration ( Lumsden & Wergin, 1980 ) . C ompound appressoria are dark, melanized and covered with mucilage. C ompound appressorium mediated cuticle penetration may involve both mechanical force and localized cutinolysis ( Lumsden & Wergin, 1980 ; Tariq & Jeffries, 1984 ; Tariq & Jeffries, 1986 ) . Besides plant surface, contact s with ma ny artificial solid surfaces (e.g. dialysis tube, cellophane, parafilm, plastics, glass) also induce appressorium formation . After cuticle penetration, S. sclerotiorum and intracellularly ( Lumsden & Dow, 197 2 ) spread out of the colonize d tissue and develop sclerotia , which rest for a long time and germinate under conductive conditions , initiat ing a new round of disease cycle. Disease management In the field, d iseases caused by S. sclerotiorum are challenging to control. So far no completely resistant cultivars are available . R esistan ce breeding is impeded by the difficulty in identifying and utilizing the quantitative and minor effect resistance genes ( Peltier et al. , 2012 ) . C ultur al practice s and fungicide application are two important disease management strategies ( Peltier et al. , 2012 ) . Crop rotation reduces the number of viable sclerotia in soil ( Workneh & Yang, 2000 ) ; however the effectiveness of such strategy can be affected by the long term survival of sclerotia and the broad host range of the pathogen ( Adams & Ayers, 1979 ) . Reduced tillage treatment reduce s sclerotia

PAGE 20

20 survival but promote s sclerotia germination , causing a var ied effect of tillage treatment on disease outcome among different conditions ( Kurle et al. , 2001 ; Mueller et al. , 2002 ) . Biological control is another promising disease management strategy. Coniothyrium minitans is an Ascomycota mycoparasite which can efficiently colonize the sclerotia of S. sclerotiorum , and has been commercialized as a biocontr ol product . T he potential effectiveness of Contans has been demonstrated for multiple crops in s everal field trails ( Budge & Whipps, 2001 ; Chitrampalam et al. , 2008 ; McQuilken & Chalton, 2009 ) . Unlike fungicide treatment which impedes pathogen infection, Contans reduce s the number of viab le sclerotia in soil, thus reduce the potential inoculum in the following season . A combined application of fungicides in the growing season and sclerotium targeti ng biocontrol agents in the off season is a promising strategy for sustainable disease contro l ( Chitrampalam et al. , 2011 ) . S. sclerotiorum pathogenesis relies on the accumulat e high concentrations of oxalic acid (OA) ( Godoy et al. , 1990 ) . Thus, engineering plants to express oxalate degrading enzymes such as oxalate decarboxylase (OxDC) or oxalate oxidase (OxO) has been implicated as an alternative disease management strategy. T ransgenic plants demonstrating improved disease resistance have been generated in soybean, sunflower, and tobacco ( Kesarwani et al. , 2000 ; Donaldson et al. , 2001 ; Burke & Rieseber g, 2003 ; Hu et al. , 2003b ; Cunha et al. , 2010 ) . Virulence Factors of Necrotrophic Fungal Plant Pathogens Phytotoxins S uccessful infection by necrotrophs relies largely on the ability to induce host cell death ( Govrin & Levine, 2000 ; Dickman et al. , 2 001 ; Mengiste, 2012 ) . N ecrotrophic fungi utilize small molecular weight or proteinaceous phytotoxins for this purpose .

PAGE 21

21 Phytotoxin triggered necrosis typically occurs from the very begi nning of infec tion and is likely critical for nutrient a c quisition and host colonization ( Weiergang et al. , 1996 ; Horba ch et al. , 2011 ; Liu et al. , 2012 ) . Phytotoxins can be classified into host selective toxins (HSTs) and non HSTs based on their activity spectrums. HSTs target specific host varieties or species while no n HSTs target structural or functional features conserved among a wide range of plant species ( Horbach et al. , 2011 ) . Currently, most identified HSTs are produced by Dothideomycetes fungi. HSTs can be either low molecular weight second ary metabolites (SMs) or high molecular weight proteinaceous factors. SM HSTs show dramatic diversity in their chemical structures, toxic effects and modes of action ( Laluk & Mengiste, 2010 ) . The SM HSTs produced by d ifferent pathotypes of Alternaria alternata , for instance, include ester derivatives of epoxy decatrienoic acid, cyclic tetrapeptides, sphinganine analogs, and polyketides and these toxins target distinctive cellular compartments including the plasma membr ane, chloroplast, mitochondria, endoplasmic reticulum, and Golgi ( Tsuge et al. , 2013 ) . Resistances against SM HST producing necrotrophs are generally conditioned by the lack of SM HST target or the presence of SM HST detoxification machinery within the plant hosts ( Meeley et al. , 1992 ; Ohtani et al. , 2002 ) . Besides SM HSTs, necrotrophs also produce proteinaceous HSTs. Different races of Pyrenophora tritici repentis and Stagonospora nodorum , for instance, secrete diffe rent proteinaceous toxins which confer disease susceptibility on wheat varieties determined in a reverse ( Friesen et al. , 2008 ) . HSTs are not the sole determinants of pathogenicity or host specificity. For instance, m any tobacco species are immune to the toxin producing A. alternata tomato

PAGE 22

22 pathotype d espi te a high sensitivity toward AAL toxin ( Brandwagt et al. , 2001 ) ; many Fumonisin B1 (FB1) producing Fusarium spp. could not infect FB1 sensitive tomato plants ( Tsuge et al. , 2013 ) ; Cochliobolus heterostrophus retained a low level virulence on T cms maize when T toxin production was abolished ( Stergiopoulos et al. , 2013 ) . Besides HSTs, fungal necrotrophs also produce non HSTs. These toxins are also biochemically diverse with polyketide and terpene derived compounds making up the major ity of the characterized classes. An example of the variation and ubiquity of certain chemical cla sses of toxins can be seen in the Dothideomycota spp. where over 20 species produce perylenequinones. Oxalic acid (OA) is a non HST that trigger s apoptotic programmed cell death (PCD) ( Errakhi et al. , 2008 ; Kim et al. , 2008b ) and is presumably important for the pathogenesis of a range of broad host range necrotrophs including S. sclerotiorum , B. cinerea , Rhizoctoni a solani , and Sclerotium rolfsii ( Dutton & Evans, 1996 ) . B otcinic acids and botrydia ls are polyketide and sesquiterpene related toxins induc ing chlorosis and cell collapse in leaves of many plant species . T hey contributes toward B. cinerea infection in a strain dependent manner ( Colmenares et al. , 2002 ; Reino et al. , 2004 ; Pinedo et al. , 2008 ; Dalmais et al. , 2011 ; Rossi et al. , 2011 ) . In B. cinerea , proteins such as the necrosis and ethylene inducing peptide 1 (Nep 1) ( Cuesta Arenas et al. , 2010 ) , the xylanase Xyn11A ( Noda et al. , 2010 ) , and the cerato plata nin BcSpl1 ( Frías et al. , 2013 ) can also trigger plant necrosis reactions in a non host specific manner. Reactive o xygen species Reactive oxygen species (ROS) play a central role in plant microbe interactions. As a messenger signal, ROS regulates pathogen infection related morphogenesis, host cell death and host defense reactions . To overcome oxidative stress associate d with

PAGE 23

23 ROS accumulation, many pathogens evolve to activate thei r anti oxidation machiner y during host colonization . While this is the general scene regarding the involvement of ROS in plant pathogen interactions, the specific interaction effects of ROS can be complicated, depend ing on the ROS source, the spatio temporal accumulation , and the specific host and pathogen involved. B oth pathogen and host derived ROS ha ve been documented during B. cinerea host colonization w ith ultrastructural staining ( Tenberge et al. , 2002 ) . Studies have linked these ROS accumul ations with either disease resistance or susceptibility to infection . R esistance to oxidants positively correlated with resistance . ROS antagonists induce d resistance against B. cinerea infection ( Elad, 1992 ; Tiedemann, 1997 ; Govrin & Levine, 2000 ; Hafez et al . , 2012 ) . Moreover, an elicitor was isolated from the intercellular fluid extract of infected Arabidopsis thaliana leaves, which induced ROS, PCD, and more importantly, increased disease susceptibility to B. cinerea ( Govrin et al. , 2006 ) . In contrast with the reports mentioned above, a positive correlation between increased ROS accumulation and enhanced resistance against B. cinerea infection w as observed under conditions including o hydroxyethylorutin treatment, leaf wounding, oxalate decarboxylase transgenic plants, cuticle biosynthesis ( bdg , lacs2.3 ) or abscisic acid deficient ( aba2 , aba3 , sitiens ) mutants ( ; Asselbergh et al. , 2007 ; Bessire et al. , 2007 ; Curvers et al. , 2010 ; L'Haridon et al. , 2011 ) . In some cases the resistance phenotype could be reverted by d iphenyleneiodonium or antioxidant treatments ( ; Asselbergh et al. , 2007 ; L'Haridon et al. , 2011 ) . In anoth er independent study, the infections of an aggressive B. cinerea

PAGE 24

2 4 isolate and a non aggressive isolate on tomato plants were compared ( Unger et al. , 2005 ) . T he non aggressive isolate induced a strong oxidative burst and a restricted HR like dark brown lesion whereas the aggressive isolate generated a rapidly spreading light brown lesion with limited ROS accumulation. The role of RO S in the interaction between S. sclerotiorum and its hosts is also complicated. S. sclerotiorum induces a reduced host redox status at the early stage s of infection for defense suppression, but induce s elevated host ROS accumulation for necrosis induction at late stages of infection ( Williams et al. , 2011 ) . T imely activation of ROS signaling l ikely confer enhanced resistance against S. sclerotiorum infection. Tr eating plants with antioxidants or diphenyleneiodonium (DPI, NADPH oxidase inhibitor) facilitates the early infection establishment ( Williams et al. , 2011 ) . T h e A . thaliana rboh D rboh F double mutant (defective in NADPH oxidase) was hypersusceptible to S. sclerotiorum infection ( Perchepied et al. , 2010 ; Zhou et al. , 2013 ) . T hiamine, which activates NADPH oxidase dependent ROS signaling, induces enhanced resistance in A . thaliana ( Zhou et al. , 2013 ) . During infection, necrotrophic fungi encounter significant oxidative stress and presumably they must activate their oxidative stress response systems for self protection. In fungi, the basic le ucine zipper domain activator protein1 (AP 1, Yap1p in Saccharomyces cerevisiae ) is a central regulator of oxidative stress response. In response to H 2 O 2 , AP 1 goes through conformation change and translocates into the nucleus where it activates the trans cription of genes related to oxidative stress tolerance including catalases, peroxidases, thioredoxins , and others ( Herrero e t al. , 2008 ) . AP 1 homolog s are critical for the pathogenic success of Ustilago maydis ( Molina &

PAGE 25

25 Kahmann, 2007 ) , Magnaporthe oryzae ( Guo et al. , 2011 ) , Candida albicans ( Jain et al. , 2013 ) and Alternaria alternata ( Lin et al. , 2009 ) , but dispensable for the full virulence of B. cinerea ( Temme & Tudzynski, 2009 ) , Cochliobolus heterostrophus ( Lev et al. , 2005 ) , and Aspergillus fumigatus ( Lessing et al. , 2007 ) . Thus the pathogenic importance of AP1 mediated oxidative stres s response varies among pathogens. In B. cinerea , the transcript accumulation of AP 1 dependent genes could be activated by exogenous H 2 O 2 treatment but not by plant infection, suggesting the lack of an obvious oxidative stress during host colonization ( Temme & Tudzynski, 2009 ) . T he contribution of th e AP 1 homolog toward S. sclerotiorum pathogenesis has not been hitherto determined . However, knock out of a Cu/Zn superoxide dismutase gene Ss sod1 caused reduced virulence and elevated in planta superoxide accumulation ( Veluchamy et al. , 2012 ; Xu & Chen, 2013 ) . Pathogen derived ROS can regulate fungal infection related morphogenesis ( Tenberge et al. , 2002 ; Shinogi et al. , 2003 ; Egan et al. , 2007 ) . In filamentou s fungi, NADPH oxidase (Nox) is best known for ROS generation ( Malagnac et al. , 2004 ; Egan et al. , 2007 ; Segmüller et al. , 2008 ) . Nox gene disruption affects cuticle penetration mediated by appressorium i n M. grisea , B. cinerea , A. alternata , and Claviceps purpurea ( Egan et al. , 2007 ; Giesbert et al. , 2008 ; Segmüller et al. , 2008 ; Morita et al. , 2013 ; Ryder et al. , 2013 ; Yang & Chung, 2013 ) , demonstrating the conservation of this regulatory machinery among fungal plant pathogens. Nox protein may contribute toward the penetration process through regulating cell polarity reestablishment and penetration peg differentiation ( Ryder et al. , 2013 ) . In S. sclerotiorum , the Ss nox1 gene knock -

PAGE 26

26 down mutant shows reduced virulence as well as reduced level of OA accumulation; however, its effect on infection structure fo rmation was not assayed ( Kim et al. , 2011 ) . Cell wall degrading enzymes The plant cell wall is a key plant pathogen interaction interface. I nvading microbes need to overcome the cell wall barrier for invasive growth and nutrient absorption; at the same time , the cell wall is also a key organelle where the plant hosts perceive the initial microbial infection and express defense reactions such as the accumulation of antimicrobial secondary metabolites, callose, and ROS ( Underwood, 2012 ) . In nature, cell wall degrading enzymes (CWDEs, cellulases, hemicellulases and pectinases) are ubiquitously s ecreted by plants and microbes, contributing toward both plant biomass degradation and microbial pathogenesis ( Brink & Vries, 2011 ) . While the CWDEs of microbial pathogens are not the key determining factors in host specificity, they are important virulence factors allowing for basic infection ( Walton, 1994 ) . With the aid of CWDEs, invaded pathogens can successfully obtain nutrients either directly from cell wall degradation, or indirectly from the disruption or colonization of plant cytosol; i n addition, CWDEs also cause tissue maceration and soft rot symptoms through hydrolysis and necrosis inducing effects . Fungal CWDEs have extremely high sequence diversity and functional redundancy. The glycoside hydrolyases, carbohydrate esterases, and pol ysaccharide lyases from representative fungal genomes, for instance, form at least 35, three, and six protein families respectively ( Brink & Vries, 2011 ) . The expression of CWDEs is tightly regulated by carbon source availabi lity , host ti ssue types and infection phases ( Walton, 1994 ; Reignault et al. , 2008 ) . The virulence contribution of i ndividual CWDE is difficult to demonstrate due to functional redundancy. The overall importance of CWDEs, however , could be demonstrated via either

PAGE 27

27 disrupting the up stream signal components or via the simultaneous silencing of multiple CWDEs. Pectinases a re a group of extracellular enzymes which can be classified into pectin methylesterase (PME), polygalacturonases (endo PG, exo PG), and pectate lyases (endo PL, exo PL) based on their modes of action and substrate specificities. The correlation extent betw een strain pectinase activity and disease severity varies among pathogens. In Sclerotinia fructigena , virulence was strongly L arabinofuranosidase activity, but not with PG or PL activity ( Howell, 1975 ) . In B. cinerea ( Reignault et al. , 2000 ) , Verticillium albo atrum ( Durrands & Cooper, 1988 ) and Didymella bryoniae ( Zhang et al. , 1999 ) , pectinase activity was correlated with disease symptom developm ent. Interestingly, in B. cinerea and V. albo atrum , pectinase deficient mutants exhibit defect s in symptom development but not in the extent of fungal colonization. The effect of pectinase gene disruption on pectinase activity and pathogenicity also varie s. Single or double gene disruption of PGs results in reduced virulence in B. cinerea ( Have et al. , 1998 ; Valette Collet et al. , 2003 ; Kars et al. , 2005 ) , Aspergillus flavus ( Shieh et al. , 1997 ) , and Alternaria citri ( Isshiki et al. , 2001 ) . D isruption of pel gene reduced virulence in Nectria haematococca ( Rogers et al. , 2000 ) , Colletotrich um gloeosporioides ( Yakoby et al. , 2001 ) , C. coccodes ( Ben Daniel et al. , 2012 ) , and C. lindemuthianum ( Cnossen Fassoni et al. , 2013 ) . In contrast , the double knock out mutant of pgx1 and pgn1 genes in Cochlioboblus carbonum showed less than 1% of the wild type PG activity , but showed normal virulence . O n medium with pectin as the sole carbon source, the double mutant grew similarly as the wild type ( Scott Craig et al. , 19 98 ) . The S. sclerotiorum genome encodes five endo PG s, which are differently

PAGE 28

28 regulated during infection and in response to pH and nutrient conditions ( Cotton et a l. , 2003 ; Kasza et al. , 2004 ; Li et al. , 2004 ; Bashi et al. , 2012 ) . None of the S. sclerotiorum endo PG , however, has been hitherto functionally characterized via gene disruption. Compared with pectinases, cellulases and hemicellulases are much less well characterized 1,4 endoglucanases (EGL), 1,4 endoglucanase in Cochliobolus carbonum ( Sposato et al. , 1995 ) and B. cinerea ( Espino et al. , 2005 ) did not affect virulen ce. However, simultaneous knock down of seven cellobiohydrolases in Magnaporthe oryzae caused virulence reduction ( Van Vu et al. , 2012 ) . Xylan is predominantly decomposed by endo 1,4 xylanase. Target disruption of individual endoxylanase gene did not affect virulence in Cochliobolus carbonum , Fusarium oxysporum , and M. grisea ( Beliën et al. , 2006 ) . However, simultaneous silencing of multiple endoxylanases in M. grisea caused dramatic virulence reducti on ( Nguyen et al. , 2011 ) xylosidase precursor was reported to reduce S. sclerotiorum virulence on canola, demonstrati ng the contribution of hemicellulose activity toward its necrotrophic infection ( Yajima et al. , 2009 ) . In addition to cell wall d hydrolysis , CWDEs (PG, PL, xylan ase) also elicit host necrosis, in a manner either dependent or independent of their hydrolytic activities ( Boudart et al. , 2003 ; Kars et al. , 2005 ; Ferrari et al. , 2008 ) . B. cinerea has five endo PGs, among which BcPG1 and BcPG2 showed the strongest necrosis triggering activities and contributed significantly toward virulence ( Have et al. , 1998 ; Kars et al. , 2005 ) . N ecrosis inducing activities of PGs from B. cinerea an d Colletotrichum lindemuthianum depend on their PG activities, likely through a hydrolyti c release of

PAGE 29

29 oligogalacturonide (OG) elicitor s ( Boudart et al. , 2003 ; Kars et al. , 2005 ) . I n S. sclerotiorum , n ecrosis inducing PGs have also been reported ( Boudart et al. , 2003 ; Zuppini et al. , 2005 ; Bashi et al. , 2013 ) . Ss PG3 and Ss PG6 induc e necrosis in a light dependent manner . Besides endo PGs, endoxylanases can also trigg er necrosis. Endoxylanases belong either to glycoside hydrolase family 10 (GH 10) or glycoside hydrolase family 11 (GH 11) . C urrently all necrosis in ducing endoxylanases are family 11 members ( Enkerli et al. , 1999 ) . The B. cinerea endoxylanase Xyn11A contributed moderately to the total xylanase activity , but contributed significantly toward virulence and induced necrosis ( Brito et al. , 2006 ) . Catalytically impaired Xyn11A protein variant maintained a full necrosis induc ing potential , and could fully complement the virulence defect of the xyn11A gene knock out m utant ( Noda et al. , 2010 ) . T hus Xyn11A contributes toward B. cinerea infection through inducing necrosis rather than cell wall hydrolysis . Plant Defense Responses to Necrotrophic Fungi Innate immune reactions Necrotrophic and biotrop hic fungi colonize plants with significantly different infection strategies, and elicit distinctive yet overlapping immune reactions. The hypersensitive reaction which effectively limits biotrophic infection does not limit and may actually facilitate necro trophic infection ( Govrin & Levine, 2000 ) . W hile resistance agai nst biotrophs mainly involves salicylic acid (SA) signaling pathway, resistance against necrotrophic fungi is more dependent on ethylene (ETH) and jasmonic acid (JA) signaling pathways. D amage associated molecular patterns (DAMPs) generally play a more imp ortant role for the innate perception of necrotrophs compared with pathogen associated molecular patterns (PAMPs). It is worthy to note that overlapping

PAGE 30

30 mechanisms can function in resistance against pathogens with different nutrient strategies, and pathoge ns with the same infection strategy may elicit different resistance responses . Polygalacturonase inhibitor proteins (PGIPs) are cell wall associated leucine rich proteins that inhibit the activity of PGs with high specificity. PGIPs can limit necrotrophi c infection directly by inhibiting PG mediated cell wall hydrolysis or indirectly by promoting the formation of longer o ligogalacturonides ( OGs ) with higher elicitor activity . PGIP transgenic plants w ere reported to show e nhanced disease resistance a gainst B. cinerea ( Powell et al. , 2000 ) , Fusarium graminearum ( Ferrari et al. , 2012 ) , Alternaria alternata and Colletotrichum nicotianae ( Wang et al. , 2013 ) . In a recent report, the Brassica napus PGIP2 partially inhibit ed the necrotic activity triggered by the S. sclerotiorum Ss PG3 and Ss PG 6 . M oreover the A . thaliana line expressing the BnPGIP2 gene showed elevated resistance against S. sclerotiorum infection ( Bashi et al. , 201 3 ) . Cell wall composition is another factor affecting necrotrophic resistance. A . thaliana mutants impaired in cellulose synthase (IRX/CESAs) showed enhanced resistance to Plectosphaerella cucumerina and B. cinerea ( Hernández Blanco et al. , 2007 ) . T he resistance was associated with elevat ed ABA responsive genes and genes related to the biosynthesis of antimicrobial metabolites. The A . thaliana ERECTA (ER) Receptor Like Kinase (RLK) mediate s resistance to P. cucumerina , and the resistance was associated with cell wall modifications such as altered callose and uronic acid contents ( Llorente et al. , 2005 ; Sánchez Rodríguez et al. , 2009 ) . The A . thaliana agb1 mutant showed enhanced susceptibility to P. cucumerina , B. cinerea and F. oxysporum

PAGE 31

31 f. sp. conglutinans , which was associated with altered cell wall functions but not hormone signaling ( Delgado Cerezo et al. , 2012 ) . P lant cuticle is an important physical barrier against pathogen invasion. Interestingly, A . thaliana mutants or transgenic A . thaliana lines with reduced cuticle content demonstrated enhanced rather than reduced resistance against necrotrophic infections ( Bessire et al. , 2007 ; Chassot et al. , 2007 ; Tang et al. , 2007 ) . A diffusion of fungitoxic activity was observed in these transgenic or mutant lines ( Bessire et al. , 2007 ; Chassot et al. , 2007 ) . L ikely a permeable cuticular layer enhances the diffusion of fungal elicitors and fungito xic compounds. The perception of P/DAMPs triggers innate immunity reactions. Oligogalacturonides (OGs), chitin fragments, cutin monomers, and some peptides are important P/DAMPs associated with necrotrophic infection. OGs are derived from pectin hydrolysi s and are perceived through the cell wall associated receptor kinase WAK1 ( Brutus et al. , 2010 ) . In A . thaliana , OG treatment and transgenic lines overproducing WAK1 induced enhanced resistance against B. cinerea infection ( Ferrari et al. , 2007 ; Mengiste, 2012 ) . Chitin fragments derived from fungal cell wall hydrolysis are percei ved by the plant receptor like kinases (RLKs) CEBiP and CERK1 . LYM2, a CEBiP homolog from A . thaliana , contribute d toward resistance against Alternaria brassicicola ( N arusaka et al. , 2013 ) . Whereas cutin monomers induce defense reactions against fungal pathogens ( Schweizer et al. , 1996 ; Fauth et al. , 1998 ) , the corresponding receptor is currently unknown. Pep1 is an endogenous peptide elicitor cleaved out of the precursor protein PROPEP1 upon cell damage, the peptide elicitor has been identified in both A . thaliana and m aize; in A . thaliana , Pep1 induced enhanced

PAGE 32

32 resistance against Pythium irregular and B. cinerea ( Huffaker & Ryan, 2007 ; Liu et al. , 2013 ) ; in maize, ZmPep1 induced enhanced resistance against Cochliobolis heterostrophus and Colletotrichum graminicola ( Huffaker et al. , 2011 ) . The signaling pathways of different P/DAMPs can converg e in the downstream signaling transduction , with one converging point being BIK1 ( Botrytis induced kinase 1), a receptor like cytoplasmic kinase which interacts with multiple pattern recognition rece ptors (PRRs) such as FLS2, EFR, and PEPR1/2 ( Liu et al. , 2013 ) . BIK1 contribut es significantly toward resistance against B. cinerea infection ( Veronese et al. , 2006 ) . Signaling transduction post P/DAMPs perception finally trigg ers hormone signaling pathways and gene transcription networks, which can be complex involving both synergistic and antagonistic interactions among different pathways, with the interaction outcome determined in a context dependent manner ( Mengis te, 2012 ) . Cell death control and reactive oxygen species Cell death control plays a central role in plant pathogen interaction . C ell death promoting f actors generally facilitate necrotrophic infections. A . thaliana HR deficient dnd1 mutant showed enha nced resistance against infections by S. sclerotiorum and B. cinerea ( Govrin & Levine, 2000 ) ; transgenic tobacco expressing the anti apoptotic gene Bcl xl or CED 9 showed enhanced resistance against infections by S. sclerotiorum , B. cinerea and Cercospora nicotianae ( Dickman et al. , 2001 ) ; A . thaliana autophagy mutants showing runway cell d eath symptom were more susceptible to Alternaria brassicicola ( Lenz et al. , 2011 ) , B. cinerea ( Lai et al. , 2011 ) , and S. sclerotiorum ( Kabbage et al. , 2013 ) ; the A . thaliana BOS1 (BOTRYTIS SUSCEPTIBLE1) is an R2R3MYB transcription factor critical for resistance against B. cinerea and Alternaria brassicicola through restricting spreading necrosis ( Mengiste et al. , 2003 ) .

PAGE 33

33 The effect of reactive oxygen species (ROS) toward necrotrophic resistance is not very straightforward. On the one hand, ROS triggers PCD and promotes susceptibility ( Govrin & Levine, 2000 ; Asai & Yoshioka, 2009 ) . On the other hand, timely ROS accumulation also leads toward defense reactions and necrotrophic resistance ( Kunz et al. , 2006 ; Asselbergh et al. , 2007 ; Curvers et al. , 2010 ) . Likely the timing and dynamic of ROS, rather than the production itself, is more relevent to resistance effectiveness. During infection, S. sclerotiorum requires a reduced host redox environment at its early infection phase ( Williams et al. , 2011 ) , correspondingly a timely oxidative burst triggered via thiamine treatment induces resistance against S. sclerotiorum infection ( Zhou et al. , 2013 ) . I n addition, earlier or elevated accumulation of H 2 O 2 has been associated with elevated resistance against S. sclerotioru m infection ( Perchepied et al. , 2010 ; Hu et al. , 2003a ; Walz et al. , 2008 ; Rietz et al. , 2012 ) . Antifungal secondary metab olites Upon pathogen or insect challenge, plants produce flavonoids, terpenoids, indoles, and other secondary metabolites ( Darvill & Albersheim, 1984 ) , among which camalexin and glu cosinolates are best known for their involvements in necrotrophic resistance. The A . thaliana cyp79B2 cyp79B3 double mutant, which is defective in producing tryptophan derived metabolites including camalexin and glucosinolates, showed increased susceptibil ity to both Phytophthora brassicae ( Schlaeppi et al. , 2010 ) and Plectosphaerella cucumerina ( Sanchez Vallet et al. , 2010 ) . T he production of tryptophan derived metabolites regulated by cyp79B2 and cyp79B3 is also required for MIL DEW RESISTANCE LOCUS O 2 ( MLO 2 ) conditioned antifungal activity against powdery mildew and B. cinerea ( Consonni et al. , 2010 ) .

PAGE 34

34 Camalexin (3 thiazol yl indole) is a sulfur containing tryptophan derived phytoalexin produced by cruciferous plants which exerts its microbial to xicity by disrupting membrane integrity ( Browne et al. , 1991 ; Tsuji et al. , 1992 ) . In A . thaliana , approxima tely one half of the quantitative trait loci controlling B. cinerea resistance are associated with camalexin biosynthesis ( Rowe & Kliebenstein, 2008 ) . A . thaliana mutants defective in camalexin accumulation showed increased susceptibility to B. cinerea and Alternaria brassicicola ( Zhou et al. , 1999 ; Ferrari et al. , 2003 ) . UPS1 and P AD3 , two A . thaliana genes critical for camalexin acc umulation, played central roles in elicitor (flagellin, oligogalacturonides) and wounding induced elevation of resistance against B. cinerea infection ( Ferrari et al. , 2007 ; Chassot et al. , 2008 ) . Glucosinolates are sulfur or nitrogen containing glucosides activated into bioactive antimicrobial derivatives upon cell damage . Glucosinolates are mainly produced by Brassicaceae plants and can be divided into aliphatic, aromatic, and indole classes based on the amino acid precurs or. Indole glucosinolates are the ones best known for their involvements in fungal d isease resistance ( Kim et al. , 2008a ; Bednarek et al. , 2009 ; Clay et al. , 2009 ) . The A . thaliana PEN2 encodes a myrosinase catalyzing the production of bioactive metabolites derived from the indole glucosinolate precursor 4 methoxyindol 3 ylmethylglucosinolate (4MI3G) ( Bednarek et al. , 2009 ) . PEN2 localizes to peroxisomes and shows an inductive accumulation at fungal penetration sites ( Lipka et al. , 2005 ) . PEN2 is a key genetic regulator of the A . thaliana nonhost resistance against powdery milde w ( Lipka et al. , 2005 ) , Colletotrichum spp. ( Hiruma et al. , 2010 ) , Phytophthora infestans ( Schlaeppi et al. , 2010 ) , and Magnaporthe oryzae ( Nakao et al. , 2011 ) . I n addition, it also contributes toward resistance against the

PAGE 35

35 adapted pathogens Pythium irregulare ( Adie et al. , 2007 ) and Plectosphaerella cucumerina ( Lipka et al. , 2005 ) . Thus the PEN2 derived indole glucosinolate metabolites is an important preinvasive resistance component against both bi otrophic and necrotrophic fungi. Recent study has shown that camalexin and indole glucosinolates also contributes toward resistance against S. sclerotiorum infection ( Stotz et al. , 2011 ) . S. sclerotiorum infection induced a strong up re gulation of genes related to camalexin and glucosinolate biosynthesis in A . thaliana . A . thaliana plants deficient in camalexin or glucosinolate accumulation showed hypersusceptibility toward S. sclerotiorum infection. Among them, 8 methylsulfinyloctyl iso thiocyanate, an aliphatic glucosinolate derived compound, was demonstrated to be highly toxic toward S. sclerotiorum . Molecular Regulation of the S. sclerotiorum Infection Process Compound appressoria are critical infection structures involved in cuticle p enetration and early infection establishment of S. sclerotiorum . Disruption of the S. sclerotiorum ggt1 , caf1 , and sac1 genes abolished compound appressorium development and correspondingly caused host penetration defects ( Jurick & Rollins, 2007 ; Li et al. , 2012 ; Xiao et al. , 2013 ) . Germinated ascospores need a nut rient conditioned saprophytic growth phase before differentiating compound appressoria, a likely reason that the ascospores of S. sclerotiorum c ould not directly infect healthy plant leaf and stem tissues ( Purdy, 1958 ; Abawi, 1975 ) . Besides nutrients, compound appress orium formation is also regulated by hard surface contact and cAMP signaling ( Purdy, 1958 ; Tariq & Jeffries, 19 84 ; Jurick & Rollins, 2007 ) . I t is unknown how S. sclerotiorum perceives surface signals for trigger ing the fo rmation of compound appressoria. A likely regulatory component would be Msb2, a transmembra ne mucin -

PAGE 36

36 type protein regulat ing surface sensing and infection structure development in Fusarium oxysporum ( Pérez Nadales & Di Pietro, 2011 ) , Ustilago maydis ( Lanver et al. , 2010 ) , and Magnaporthe oryzae ( Liu et al. , 2011 ) . In Colletotrichum spp. and Magnaporthe spp. , unicellular appressorium penetration is largely mediated by hydrostatic pressure associated physical force, the establishment and maintenance of which require s the formation of a me lanized cell wall layer ( Howard & Ferrari, 1989 ; Kubo et al. , 1996 ; Lin et al. , 2012 ) . Compound appressoria produced by S. sclerotiorum are also melanized, with the melanine being derived from dihydroxynaphthalene (DHN) ( Starratt et al. , 2002 ; Butler et al. , 2009 ) , same as in Colletotrichum and Magnaporthe spp. However, it is unknown whether appressorium melanization contributes significantly toward the S. sclerotior um penetration success. During cuticle penetration, the S. sclerotiorum compound appressoria form penetration pores through local cell wall alteration or degradation. The nascent penetration pegs were perceived to be wall less or to contain a very thin lay er of cell wall ( Tariq & Jeffries, 1985 ) ; these characteristics suggest cutinolysis as the major force for cuticle penetration. Similar observation has also been made in the closely related fungus B. cinera ( McKeen, 1973 ) . As cuticle disrup tion only occurs at the penetration sites but not above the spreading subcuticular infectious hyphae, cutinase activity must be finely regulated if it is penetration related ( Tariq & Jeffries, 1985 ) . S. sclerotiorum has four cutinase genes, one of which ( SsCutA ) has been characterized for its transcripts accumulation ( Bashi et al. , 2012 ) . SsCutA expression showed a sharp induction upon solid surface contact, indicating a thigmotrophic regulation; SsCutA expression also showed a steady increase at the early phases of infection (f rom 1 hpi to

PAGE 37

37 24 hpi). The contribution of SsCutA toward penetration is unclear, but knock out disruption of its ortholog in B. cinerea did not affect penetration or virulence ( van Kan et al. , 1997 ) . NADPH oxidases are critical for cuticle penet ration in many pathogenic fungi including B. cinerea ( Egan et al. , 2007 ; Giesbert et al. , 2008 ; Segmüller et al. , 2008 ; Morita et al. , 2013 ; Ryder et al. , 2013 ; Yang & Chung, 2013 ) . The S. sclerotiorum genome contains two Nox encoding genes, SsNox1 and SsNox2 . Gene silencing study indicated that SsNox1 but not SsNox2 contributed toward fungal virulence ( Kim et al. , 2011 ) . However the contribution of S sNox1 toward compound appressorium formation and compound appressorium mediated cuticle penetration were not assayed. Following cuticle penetration, the penetrati on pegs of S. sclerotiorum enlarge rapidly into a subcuticular vesicle, from which subcuticular infectious hyphae differentiate. In studies with B. cinerea , enzymatic disruption of the epidermal cell wall and the collapse of the epidermal cells were usuall y evident at the penetration sites ( McKeen, 1973 ; Mansfield & Richardson, 1981 ) , which may similarly oc cur during S. sclerotiorum infection. The B. cinerea they never come in contact with an intact plasmamembrane during infection ( Mansfield & Richardson, 1981 ) . During S. sclerotiorum infection, the sub cuticular infectious hyphae could transiently grow over living epidermal cells, suggesting the host cell death may not occur as rapidly as previously thought ( Kabbage et al. , 2013 ) . O xalic acid (OA) plays a central role in the pathogenic process of S. sclerotiorum . a range of plant hosts ( Godoy et al. , 1990 ) . Transgenic plants expressing OA degrading enzymes show ed enhanced resistance against S. sclerotiorum infection ( Donaldson et al. ,

PAGE 38

38 2001 ; Hu et al. , 2003a ; Livingstone et al. , 2005 ) . During pathogenesis, OA may play multip le virulence functions . Firstly it functions as a general non host specific toxin, inducing wilting and ROS dependent PCD ( Noyes & Hancock, 1981 ; Guimaraes & Stotz, 2004 ; Errakhi et al. , 2008 ; Kim et al. , 2008b ; Lampl et al. , 2013 ) ; s econdly OA is an important pH regulator, creating an acidic pH environment which favors endo PG gene expression and endo PG enzymatic activity ( Marciano et al. , 1983 ; Cotton et al. , 2003 ; Rollins, 2003 ; Favaron et al. , 2004 ) ; t hir dly, OA chelates metal ions including Ca 2+ , Cu 2+ and Mg 2+ , which facilitates pectin degradation, inhibit s polyphenol oxidase activity and disrupt s chloroplast integrity respectively ( Dutton & Evans, 1996 ) ; lastly OA also suppresses host defense reactions and regulates host cell death ( Cessna et al. , 2000 ; Williams et al. , 2011 ; Heller & Witt Geiges, 2013 ; Kabbage et al. , 2013 ) . Due to its pathogenic importance, OA metabolism in S. sclerotiorum has been studied for a long time. Both nutrient and pH conditions are important regulators of OA accumulation. S. sclerotiorum can take advantage of diverse simple and complex carbon sources for OA biosynthesis and the OA accumulation is strongly induced under alkaline pH condition ( Maxwell & Lumsden, 1970 ; Vega et al. , 1970 ; Marciano et al. , 1989 ; Rollins & Dickman, 2001 ; Culbertson et al. , 2007 ) . Disruption of the ambient pH response regulator Ss Pac1 abolished alkaline induced OA accumulation and caused virulence reduction ( Rollins, 2003 ) . OA accumulation in S. scle rotiorum most likely occurs through oxa l oacetate acetylhydrolase (Oah) mediated hydrolysis of the substrate oxaloacetate . T he oxaloacetate precursor can potentially derive from the mitochondria localized tricarboxylic acid cycle (TCA cycle), or the peroxis ome located glyoxylate cycle ( Liberti

PAGE 39

39 et al. , 2013 ) . Disruption of the S. sclerotiorum carnitine transferase gene Ss p th2 abolished the capacity to utilize 2 C carbon source and fatty acid for OA biogenesis ( Liberti et al. , 2013 ) . The OA accumulation level in S. sclerotiorum may not be solely de termined by its biosynthesis, but also by its degradation. Oxalate decarboxylase (OxDC), an enzyme involved in OA degradation, has been previously reported in S. sclerotiorum ( Magro et al. , 1988 ) . The S. sclerotiorum genome encodes two putative OxDC enzymes, but their contributions to OA accumulation and roles in virulence have not been determined. Recent studies have i ndicated a n OA accumulation dynamic during S. sclerotiorum infection. On sunflower cotyledon, OA accumulation increased dramatically after 40% of leaf tissue had been colonized ( Billon Grand et al. , 2012 ) . During the infection of Brassica napus , OA crystals were found after six days post inoculation ( Garg et al. , 2010 ) . In another study , OA crystals never deposited in proximity with subcuticular hyphae but deposited abundantly in old compound appressoria and fully macerated plant cells beneath them at late infection stage ( Heller & Witt Geiges, 2013 ) . Besi des OA, other necrosis inducing factors may also contribute to S. sclerotiorum infection. N ecrosis and ethylene inducing peptides (NEPs), and endo PG s from S. sclerotiorum have been demonstrated to induce necrosis ( Zuppini et al. , 2005 ; Dallal Bashi et al. , 2010 ; Bashi et al. , 2013 ) . I n addition, the S. sc lerotiorum genome encodes a cluster of genes involved in botcinic acid biosynthesis, which is a non host specific toxin contributing toward B. cinerea virulence in a strain specific manner ( Dalmais et al. , 2011 ) .

PAGE 40

40 Pathogenic fungi need to overcome or suppress plant immune reactions for infection success. While biotrophic and hemibiotrophic fungi produce effectors for such purpose, relatively little is known about t he effector strategies utilized by necrotrophic pathogens. Recently a phytoalexin detoxifying enzyme Ss BGT1 (brassinin glucosyltransferase 1) was identified from S. sclerotiorum ( Pedras & Hossain, 2006 ; Sexton et al. , 2009 ) . SsBGT1 gene expression was induced significantly during infection of Brassica napus leaves, and in response to phytoalexin treatments incl uding camalexin, cyclobrassinin, brassilexin. Given the contribution of tryptophan derived secondary metabolites toward antifungal activity against S. sclerotiorum , SsBGT1 could function in detoxification of plant defense molecules during S. sclerotiorum i nfection ( Stotz et al. , 2011 ) . The full virulence of S. sclerotiorum also requires a Cu/Zn superoxide dismutase Ss Sod1 ( Rolke et al. , 2004 ; Veluchamy et al. , 2012 ; Xu & Chen, 2013 ) ss sod1 mutants showed reduced virulence on detached leaves of pea, tobacco and tomato; in addition, the mutants also showed increased sensitivity toward oxidative stress and induced a hyperaccumulation of superoxide when infecting plant tissue. Thus S. sclerotiorum requires Ss Sod1 mediated ROS detoxification machinery for successful infection. Recently an integrin like protein SSITL was identified to suppress host defense reactions during S. sclerotiorum infection ( Zhu et al. , 2013 ) . The gene was highly up regulated during early phases of infection; gene silencing mutants showed reduced virulence, and caused elevated expression of host defense genes PDF1.2 and PR 1; express ion of Ss ITL in A . thaliana suppressed the expression of PDF1.2 and rendered the plants more susceptible to infections of S. sclerotiorum and B. cinerea . Thus SSITL plays an effector like function during the necrotrophic infection of

PAGE 41

41 S. sclerotiorum . Simi lar to SSITL, OA has also been implicated effector like functions ( Williams et al. , 2011 ; Kabbage et al. , 2 013 ) . The S. sclerotiorum infection involves an OA mediated host redox status regulation. OA induces a reduced redox environment at the early infection stage to suppress host defense reactions, but induces ROS accumulation at the late infection stage to induce host cell deaths ( Williams et al. , 2011 ) . In addition, OA also regulates host cell deaths, it manipulates the host cell death fate from a resistance rel ated autophagy to a susceptibility related apoptosis for successful infection ( Kabbage et al. , 2013 ) . Overall, the interaction between S. sclerotiorum and its hosts is more nuanced than previously expected. Project Goal and Research Overview The overall goal of this research project is to better understand the molecular regulation of the S. sclerotiorum pathogenesis. The first specific objective is to determine the metabolic source of OA biogenesis and to evaluate the importa nce of OA ss oah1 mutant previously generated in our laboratory in its growth, OA accumulation, virulence, and host defense reactions. This study demonstrated the critical contribut ion of OAH activity toward OA biogenesis and full virulence in S. sclerotiorum . In filamentous fungi, OA metabolism involves not merely OA biogenesis, but also OA degradation mediated by oxalate decarboxylase (OxDC) or oxalate oxidase (OxO). The S. sclero tiorum genome contains two putative OxDC encoding genes, Ss odc1 and Ss odc2 . Given the reports indicating the critical requirement of OA accumulation in S. sclerotiorum pathogenesis ( Godoy et al. , 1990 ) , and the reports indicating a dynamic regulation of OA accumulation during S. sclerotiorum infection ( Garg et al. , 2010 ; Heller & Witt Geiges, 2013 ) , it is critical to know whether the two putative OxDC genes

PAGE 42

42 contribute to S. sclerotiorum virulence. In Chapter 3, Ss odc1 and Ss odc2 wer e characterized in detail . T he expression of the Ss odc2 gene was infection stage specific and the gene was required toward efficient compound appressorium development and early infection. Thus S. sclerotioru m requires a stage specific down regulation of OA accumulation for its early infection establishment . On the other hand, Ss odc2 gene overexpression does not affect in planta OA accumulation or fungal virulence, indicating a minor role of OxDC activity in regulating OA accumulation at the post invasive infection stage. The second broad study objective was to identify pathogenesis related genes by screening a collection of random T DNA insertion mutants (Chapter 4). A high throughput celery stalk infection a ssay was developed to screen the T DNA mutants. Mutants defective in virulence, compound appressorium development, and scleroti um development were identified. A hypothetical protein with an AIM24 domain presumably involved in mitochondrial biogenesis, was identified to regulate virulence, and the development of compound appressori um and scleroti um .

PAGE 43

43 CHAPTER 2 OXALOACETATE ACETYLHYDROLASE GENE MUTANTS OF S clerotinia sclerotiorum DO NOT ACCUMULATE OXALIC ACID BUT RETAIN THE CAPACITY TO FORM PRIMARY LESIONS IN HOST PLANTS Introduction The Ascomycota fungus Sclerotinia sclerotiorum (Lib.) de Bary is one of plant species and accounts for an estimated $200 million in annual crop loss in the U.S. ( Bolton et al. , 2006 ) . During pathogenesis, S. sclerotiorum accumulates millim olar levels of oxalic acid (OA) which has been implicated as critical to its broad host range necrotrophic pathogenicity. The most compelling evidence for the importance of OA in pathogenesis comes from UV S. sclerotiorum reported to be non pathogenic on Phaseolus vulgaris ( Godoy et al. , 1990 ) and Arabidopsis thaliana ( Dickman & Mitra, 1992 ) . These mutants have since been shown to infect and produce limited lesions on various hosts ( Cessna et al. , 2000 ; Williams et al. , 2011 ) . Besides pathogenicity, OA accumulation may also affect the growth and developmental processes of S. sclerotiorum ( Godoy et al. , 1990 ) showed reduced grow th and aberrant development including fluffy hyphae and abolished sclerotium formation; whereas, in wild type (WT), low ambient pH promotes both sclerotium morphogenesis and vegetative growth ( Rollins & Dickman, 2001 ; Rollins, 2003 ) . These effects of OA may derive at least partially through its effect on ambient pH but also through its biochemical connections with primary metabolism. OA is a strong organic acid synthesized by a broad range of pathogenic and non pathogenic organisms including bacteria, fungi, plants and some mammals. In filamentous fungi, OA biogenesis has been demonstrated to occur through the

PAGE 44

44 hydrolysis of oxaloacetate, the oxidation of glyoxylate, or the oxidation of glycolaldehyde ( Dutton & Evans, 1996 ) . In S. sclerotiorum , neutral pH strongly induces OA accumulation and this induction requires the zinc finger ambient pH dependent transcriptional regulator Ss Pac1 ( Rollins & Dickman, 2001 ; Rollins, 2003 ) ; diverse carbon sources can support OA biogenesis which derives intermediates from the tricarboxylic acid (TCA) cycle, the gl yoxylate cycle, or both ( Liberti et al. , 2013 ) . Previous biochemical studies have indicated the critical contribution of oxaloacetate acetylhydrolas e activity (OAH, EC 3.7.1.1) to OA biogenesis in Ascomycota fungi including S. sclerotiorum ( Maxwell, 1973 ; Kubicek et al. , 1988 ; Ruijter et al. , 1999 ) . This enzymatic function has been further supported by abolishing OA accumulation through oah gene disruption in Aspergillus niger ( Pedersen et al. , 2000a ; Pedersen et al. , 2000b ) , Botrytis cinerea ( Han et al. , 2007 ) , Cryphonectria parasitica ( Chen et al. , 2010 ) and Penicillium chrysogenum ( Gombert et al., 2011 ) . OAH enzymes belong to the p hosp hoenolpyruvate mutase/isocitrate lyase ( PEPM/ ICL) protein superfamily which also includes isocitrate lyases, methylisocitrate lyases and OAH like proteins. These OAH like proteins show significant sequence identity (generally > 30%) with OAHs but have alt ernative (mostly unidentified) catalytic activities ( Joosten et al. , 2008 ) . Among Ascomycota species with characterized OAH enzymes, OAH is encoded by a single copy gene and all OAHs contain a conserved serine residue within the catalytic activity site ( Joosten et al. , 2008 ) . To dissect the metabolic source of OA accumulation in S. sclerotiorum and evaluate the requirement for OA accumulation in its pathogenesis, we isolated and performed gene deletion analysis of a putative OAH encoding gene Ss oah1 . We

PAGE 45

45 demonstrated that Ss oah1 is indispensable for OA accumulation and that it affects pH responsive growth, morphogenesis, and the full virulence of S. sclerotiorum on a variety of plant hosts. The observation that the Ss oah1 ss oah1 mutants) retain the ability to form primary lesions suggests that factors other than OA contribute significantly toward basic compatibility establishment. The microscopic infection features on onion epidermal peels suggest that S. sclerotiorum infection involves a dynamic regulation of OA accumulation. Mat erials and methods Fungal strains and maintenance S. sclerotiorum wild type (WT) isolate 1980 and the derived UV induced mutants (A1, A2, A3) ( Godoy et al. , 1990 ) were maintained on potato dextrose agar (PDA). The Ss oah1 gene cloning, deletion and phenotypic complementation have been done by previous members in the laboratory of Dr. Jeffrey Rollins ss oah1 strains (KO1, KO2) were maintained on PDA supplemented with 100 µg/mL hygromycin, the complement ation strain compl1 and compl2 were maintained on 10 µg/mL Bialaphols (Phyto Technology Laboratories, Overland Park, KS) and 200 µg/mL nourseothricin (Werner BioAgents, Jena, Germany) respectively. GFP labeled strains were maintained on PDA supplemented with 200 µg/mL nourseothricin. For long term storage, desiccated sclerotia or mycelia colonized filter papers were stored in pa per envelopes at 20 °C . Treatments, sample collection and gene expression OA treatments of vegetative hyphae were carried out in YPSu medium buffered at pH 4.8 with citric acid sodium phosphate solution. OA was added to the medium to a final concentratio n ranging from 0 to 40 mM and the medium pH values were readjusted

PAGE 46

46 to pH 4.8 after OA addition. Fresh mycelia (around 2 g) collected from actively growing YPSu cultures were pre treated in buffered YPSu medium (pH 4.8) for 4 hours before being divided into OA treatments. Following 4 h incubations, the mycelia were harvested by vacuum filtration and lyophilized for total RNA extraction and Northern Blot analysis. Analysis of transcript accumulation for Ss oah1 at different developmental stages was conducted with hyphae collected from stationary PDB culture 4 days post inoculation, compound appressoria induced by inoculating mycelia plugs on cellophane (catalog no. 165 1779, Bio Rad, CA) overlaid on PDA medium, infected tomato tissue collected 2 days post ino culation of detached leaves, sclerotia at developmental stage 3 4 ( Li & Rollins, 2009 ) and apothecia at developmental stage 4 5 ( Veluchamy & Rollins, 2008 ) . Radial growth and OA accumulation PDA r adial mycelia growth assays were carried out based on method s described previously ( Rollins, 2003 ; Kim et al. , 2007 ) . Citric acid sodium phosphate buffer was used to gene rate pH buffered PDA medium. Relative growth rate was determined by the slope of the linear region of the growth curve. For medium acidification assay, PDA medium was adjusted to pH 7.0 with NaOH, autoclaved, and supplemented with 50 mg/L bromophenol blue before being poured into 5 cm petri dish plates. For OA quantification in YPSu culture filtrates were sampled at each time point for OA quantification with an enzymatic assay kit (Trinity Biotech., Wicklow, Ireland). OA standards with de fined concentrations (0 to 90 mg/L) were used to generate the standard curve. Serial sample dilutions were carried out to get samples in the range of the standard curve. To quantify in planta OA

PAGE 47

47 accumulations, soybean, common bean and tomato leaves were ha rvested three days, two days and two days post inoculation respectively. Lesion sizes were quantified with Spot Advanced Software program (Diagnostic Instruments, Sterling Heights, MI) before the lesions were excised and collected into 2 mL eppendorf tubes . Tissues were lyophilized, broken into fine powder with a metal spatula, and suspended in 1 mL absorb leaf pigments. The tissue suspensions were left on the bench for 30 mi nutes and centrifuged at 12, 000 rpm for 10 minutes, the supernatants were then used for OA quantification. Compound appressorium assay PDA m ycelia plugs with growing hyphal tips were placed on parafilm and incubated in a moisture chamber for 2 days to ind uce compound appressorium development. For microscopic observation, PDA mycelia plugs were placed on top of cover slides and incubated for two days. Pathogenicity assays Tomato ( Lycopersicon solanum cv. Bonnie Best), common bean ( Phaseolus vulgaris cv. Bu sh Blue Lake 47), soybean ( Glycine max [L.] Merr. cv. Harosoy) and canola ( Brassica napus ) were grown in the greenhouse . Arabidopsis thaliana (ecotype Columbia), sunflower ( Helianthus annuus ), tobacco ( Nicotiana tabacum [cv. Glurk]) plants were grown in a growth chamber at 20°C with 16 h day and 8 h night cycle using 15 W GE cool white fluorescent bulbs (General Electric Co., Fairfield, CT). Mature, healthy and fully expanded leaves were excised from vigorously growing plants and immediately put inside mois t chamber for pathogen inoculation. For wounded inoculations, two 0.5 cm intersecting cuts were made through each leaf with a sharp

PAGE 48

48 scalpel blade and a mycelia plug was placed directly on the cross. For exogenous OA treatments, soybean petioles bearing tri foliate leaves were placed in small vials with ddH 2 O, 5 mM OA (adjusted to pH 5.8 with KOH) or 10 mM OA (adjusted to pH 5.8 with KOH) respectively, the trifoliate leaves were immediately wounded and inoculated with PDA mycelia plugs. The petioles dipped in the vials were kept inside moisture chamber to inhibit leaf wilting and to stimulate symptom development. GFP labeled strains The Bcgfp reporter gene, with its codon optimized for B. cinerea expression ( Leroch et al. , 2011 ) , w as used for generating GFP expression vector. Several digestion ligation steps were taken to obtain the GFP expression vector p Blunt NAT GFP. The pD NAT1 vector ( Kück & Hoff, 2006 ) was double digested with BamH I and Hind III to release the nourseothricin acetyltransferase gene ( nat1 ) expression cassette, which was ligated into the pCR ® Blunt (Invitrogen, NY) pBlunt PCR vect or to generate the pBlunt NAT1 construct. The pOPTGFP vector, containing the Bcgfp expression cassette and an incomplete hygromycin expression cassette, was Sal I digested and then self ligated to obtain the pOPTGFP SalI construct. The Aspergillus nidulans oliC promoter driven GFP expression cassette was released from the pOPTGFP SalI vector by Spe I and Xho I double digestion, which was then ligated into the pBlunt NAT1 construct to generate the final construct p Blunt NAT GFP. The p Blunt NAT GFP construc ss oah1 KOs and the A2 mutant to obtain constitutive GFP expressing strains. Onion epidermal infection system Yellow onion ( Allium cepa var. cepa ) bulbs were purchased from local grocery store. Thick, fleshy bulb scale leaves we re cut into 2 cm x 2 cm chunks, the inner

PAGE 49

49 epidermal strip was peeled off and placed on top of glass slide with the cuticle layer on top. Mycelia plugs with spreading hyphal tips were directly inoculated on the epidermal strip surface. The epidermal strips were kept inside moisture chamber for 12 to 24 h before mi ss oah1 mutant, a 0.5 cm cross was cut on the epidermal strip with scalpel before inoculation. The epidermal strips were placed in 0.75 M sucrose solution for 15 min to induce plasmolysis. Tobacco leaf infil tration Four mycelia plugs were inoculated into 25 mL PDB medium within a 10 cm wide glass petri dish. The petri dish was left on lab bench for seven days, the fungal mycelia mat was moved away and the culture fluids were sterilized by filtering through 0. 45 µm filter (EMD Millipore Corporation, Billerica, MA). The culture fluids were stored in freezer before used for the infiltration assay. Staining and microscopic observation Infected soybean plants were collected 2 days post inoculation to detect h ost diaminobenzidine (DAB, Sigma Aldrich, St. Louis, MO) was used for H 2 O 2 detection. DAB was dissolved in diluted HCl solution (pH 3.0) to make a final concentration of 1 mg/mL. The dissolved solution was supplemented with Na 2 HPO 4 to a final concentration of 10 mM to stabilize pH at approximately 9.0. For staining, infected soybean leaves were immersed in the DAB solution and shaken at 50 rmp for 6 h. The stained leaves were then fixed and cleared in the fixation solution (ethanol: acetic acid 3:1). Aniline blue and toluidine blue O were used to stain for callose and lignin, respectively. Aniline blue was dissolved in 0.1 M Na 2 HPO 4 to a final concentration of 0.05% and toluidine blue O was dissolved in 0.1 M phosphate buffer (pH 6.8 ) to a final concentration of 0.1%. After clearance, leaf tissues were stained with

PAGE 50

50 aniline blue overnight and then stained with toluidine blue O for two hours before light and fluorescent microscopy. Onion epidermal strips were either directly examined or stained with trypan blue solution for 5 hours (dissolved in ddH 2 O to a final concentration of 0.5%) or safranin O solution for 5 minutes (dissolved in 70% ethanol to a final concentration of 0.1%) before examination. Crossed polarized light filters were utilized to detect birefringent crystals within infected tissues ( Khan, 1995 ) . For plasmolysis, onion epidermal cells were placed within 0.75 M sucrose for 15 min before direct examination. Results Sequence analysis and expression of Ss oah1 gene Ss Oah1 exhibits 90.7% and 62.7% sequence identity with the OAH protein from B. cinerea and A. niger , respectively , and contains a conserved a ctive site serine residue (S 278 ) as seen in all other OAH proteins with demonstrated oxaloacetate acetylhydrolase activity ( Joosten et al. , 2008 ) . At an arbitrary pH 4.8, exogenous OA (up to 40mM) had no effect on Ss oah1 transcript accumulation (Fig. 2 1A). Ss oah1 transcript accumulat ed to a similar level among vegetative hyphae, compound appressoria, sclerotia and infected host, but, was not detecte d in developing apothecia (Fig. 2 1B). Effects of ambient pH on Ss oah1 transcript accumulation had been previously characterized in the laboratory, in which Ss oah1 transcript accumulation was strongly induced by neutral pH and requires Ss Pac1 (unpublish ed data) . Ss Pac1 is a transcriptional regulator at the terminal end of the ambient pH sensing signal transduction pathway. Consistent with a direct regulation by Ss Pac1, four PacC binding sites (5` GCCARG 3`) were identified in the Ss oah1 promoter regio n at 773, 1094,

PAGE 51

51 1108, and 1742 bp upstream of the predicted ATG translation start site. An active site serine residue and gene order synteny have been conservatively observed with known oah genes ( Joosten et al. , 2008 ) . We identified the Ascomycota orthologs of known oah genes based on th ese criteria and found that PacC binding sites were also enriched within the ir upstream intergenic regions (Table A 2, Fig. A 1). Confirmation of the Ss oah1 gene knock out mutants by Southern hybridization analysis To test whether Ss Oah1 is a functional OAH and whether it is required for OA accumulation in S. sclerotiorum , we generated Ss oah1 gene knock out mutants wi th the strategy illustrated in Fig. 2 2A . After protoplast transformation and hyphal tipping, ss oah1 KOs (KO1 and KO2), were obtained and further verified by Southern blot analysis (Fig. 2 2B). Hind III DNA digestion in combination with probe 1 hybridization (Fig. 2 2B left) produced a 4.0 kb band in the wild type (WT) but no band was detected in the KO mutants; probe 2 hybridization in combination with DNA double digestion with Hind III and Xba I (F ig. 2 2B right) produced a 2.4 kb band in the WT and a 5.0 kb band in the KO mutants. These band patterns are consistent with the expected homologous DNA integration event diagrammed in Figure 2 2A. Ss oah1 gene is critically required for OA accumulation in S. sclerotiorum The first evidence that Ss Oah1 is required for OA accumulation was an ss oah1 mutants. PDA medium supplemented with bromophenol blue (a pH indicator that is violet > pH 4.6 and yellow < pH 3. ss oah1 inoculated medium remained violet even after complete plate colonization (Fig. A -

PAGE 52

52 2). Introducing a genomic copy of Ss oah1 with endogenous regulatory sequence fully rescu ss oah1 mutant (Fig. A 2). The medium color of ( Godoy et al. , 1990 ) changed from violet to yellow at a slower rate and to a reduced extent compared with the WT (Fig. A 2). OA accumulation was quantified for strains growing in MOPS buffered YPSU medium (0.5 M MOPS, pH 7.0), a gro wth medium highly conducive for OA accumulation (Fig. 2 3A). While the WT and the complementation (Com) strain accumulated OA rapidly, reaching approximately 10 mg/mL (110 mM) by 48 h post inoculation, no OA ss oah1 mutant s over 192 hours. Under the same reaching approximately 6 mg/mL (67 mM) by 48 h post inoculation. The pH values of the media , in which the WT and the Com strain were gro wn , dropped rapidly and stabilized near 4.0 by 48 hpi ss oah1 mutants stayed above 6.0 (Fig. 2 3B). I n infected leaves of soybean, common bean, ss oah1 or 1). The ab ss oah1 mutants both in vitro and in planta demonstrated that Ss Oah1 is a functional OAH critically required for OA biogenesis in S. sclerotiorum . ss oah1 mutants differ from the UV responsive ra dial growth and development ss oah1 65% and 50%, of the WT respectively (growth rate determined by the slope of the linear region of the growth curve) (Fig. 2 4, Fig. A 3). Compared with the WT and the Com ss oah1 mutants showed severe growth reduction on PDA medium buffered

PAGE 53

53 at pH 6.6, no reduction on medium buffered at pH 3.0, and slight reduction on medium buffered at pH 5.0 (Fig. 2 duced radial growth on medium buffered at all tested pH values (Fig. A 3). On PDA ss oah1 mutants differentiated into loose, unmelanized stroma like structures rather than discrete, compact and melanized sclerotia (Fig. 2 form ss oah1 mutants but not the including petri dishes (data not shown), parafilm (Fig. 2 5B), and cover slides (Fig. 2 5C). The Com strain formed discrete sclerotia which failed to mature and did not form mutants produced spermatia abundantly (ca. 10 8 per plate) while the WT, the ss oah1 mutants and the Com strain produced them sporadically and at levels less than 10 3 per plate (data not shown). ss oah1 mutants and the UV attenuated virulence ss oah1 mutants and the Com strain cou ld not efficiently infect intact host leaves due to their defect in appressorium development (Fig. 2 5B, C, Fig. A 4), making it difficult to directly assess the role of OA with unwounded leaves . Instead, the role of OA in virulence independent of penetrat ion was assessed by performing wounding inoculation s . The tests were performed on a variety of hosts (soybean, common bean, tomato, canola, sunflower, A . thaliana ) . I n all cases ss oah1 mutants produced limited lesions (Table A 1, Fig. 2 6, data not shown) . T he lesions were often brown green and defined by a thin, dark border. In contrast, the WT and the Com strains produced uniform and light brown spreadi ng lesions (Fig. 2 6). Over time,

PAGE 54

54 ss oah1 necronissia s became yellow and senescent (Fig. 2 6, Fig. A 5). In detached soybean lea f inoculations, lesion s expanded more distantly in vascular tissues than in the mesophyll tissues , and these vascular colonizations were accompanied by strong host pigment in red color (presumably anthocyanin) accumulation (Fig. A 5). On A . thaliana , the i ss oah1 and spread across and killed the entire plant (Fig. 2 6). To determine if these virulence phenotypes were directly related to the accumulation of OA, soybean leaves were treated with OA prior to inoculation. In these inoculations OA partially restored the ss oah1 mutant (Fig. 2 7 ) ( data not ss oah1 mutants were more mutants, likely attributable to their different growth rates (Table. A 1, data not shown). To understand the fate of colonizing hyphae in more detail, we generated GFP ss oah1 examined their infections on detached soybean leaves (Fig. 2 8). GFP labeled strains generated lesions similar in appearance as their parental strains (data not show). Lesions generated by the GFP ss oah1 for up to three days and stopped thereafter (Fig. A 6). Leaflets were then sampled one, three and five days post inoculation. Under microscope observation, the WT hyphae at the infection front exhibited strong GFP fluorescence at all surveyed time points as shown in Fig. 2 8 ss oah1 mutants, however, showed strong GFP fluorescence early in the colonization process (Fig. 2 8, 1dpi ) but gradually

PAGE 55

55 faded and lost GFP fluorescence overtime (Fig. 2 8 , 3 and 5dpi ). The infectious hyphae of the A2 mutan ss oah1 mutants (data not shown). Coincident with the gradual loss of GFP fluorescence was an increase in host cell autofluoresence. The infectious hyphae of the mutants were generally more densely alig ned compared with the WT. ss oah1 and the UV elicited elevated host defense reactions Infected soybean leaflets were sampled two days post inoculation to examine the host defense reactions with a histological staining of H 2 O 2 , lig nin and callose (Fig. 2 9). diaminobenzidine (DAB), indicative of H 2 O 2 accumulation, was detected at the infection front in hyphae as well as the surrounding mesophyll cells, with the brown ss oah1 mutants relative to the WT and the Com strain (Fig. 2 9A). Toluidine blue O (TBO), which selectively stains lignin and acidic tissue components , strongly stained mesophyll cells within lesions colonized ss oah1 only infectious hyphae within lesions caused by the WT and the Com strain (Fig. 2 9B). Under fluorescent microscopy with ultraviolet excitation, diffusely distributed particles stained by aniline blue (indicating callose deposition) were observed at the infection fronts o f the WT and Com strains while dense and continuous layers of aniline blue staining were observed at the infection ss oah1 9C). Comparative cytology of the infections of wild ss oah1 mutants on onion epidermal strips Under laboratory conditions, S. sclerotiorum could efficiently colonize onion e pidermal strips (Fig. A 7). With wild type inoculation, compound appressoria mediated cuticle penetration and the differentiation of bulbous subcuticular hyphae occurred

PAGE 56

56 between 12 and 18 h post inoculation. After penetration, subcuticular bulbous hyphae d ifferentiated and spread as filamentous hyphae, which actively sensed and penetrated the anticlinal epidermal cell wall (Fig. A ss oah1 mutants could not penetrate the cuticle barrier when inoculated without wounding. When wound inoculated, they differentiated subcuticular hyphae similar in appearance to WT except that the hyphae ss oah1 mutants were frequently observed to be in transient association with alive epiderm al cells (typically two to three cell layers) (Fig. A 8). With wild type inoculation, OA crystals were rarely observed with runner hyphae on the cuticle surface or with compound appressoria before cuticle penetration. At the penetration stage, OA crystals were frequently observed at the penetration points (Fig. A 9A, B). At advanced infection stage , OA crystals accumulated abundantly within fully disrupted epidermal cells at the lesion center (Fig. A 9C, D); in contrast OA crystals were rarely observed sur rounding the spreading subcuticular hyphae except when fungal cells became stressed or dead (indicated by cell browning and the loss of GFP fluorescence). OA crystals could accumulate below viable epidermal cells in areas ahead of the colonization front, w hich became more abundant as colonization proceeded (Fig. A 9D, E). These crystals appear to be formed from OA diffusion from the spreading lesion. No OA crystal accumulation was observed with infections of the ss oah1 mutants (data not shown). Discussion OA is a dicarboxylic acid produced by a broad spectrum of fungal species using metabolic precursors including glycolate, glyoxylate, and oxaloacetate ( Dutton & Evans, 1996 ) . We demonstrate here that disruption of the Ss oah1 gene abolishes S.

PAGE 57

57 sclerotiorum OA accumulation both in vitro and in vivo . This inability to accumulate OA occurs even when mycelia are incubated in growth media strongly bu ffered at neutral pH, conditions previously reported to be highly conducive for OA accumulation ( Rollins, 2003 ) . Thus, OA biogenesis in S. sclerotiorum exclusively or at least predominantly relies on OAH mediated C C cleavage of oxaloacetate. This is consistent with previous detection of OAH enzyme activity but not glyoxylate dehydrogenase enzyme activity in S. sclerotiorum ( Maxwell, 1973 ) , and further, with the lack of a predicted glyox y late dehydrogenase encoding gene in the S. sclerotiorum genome (Amselem et al., 2011). Reports th at oah gene disruptions also abolish OA biogenesis in other Ascomycota species suggests a conservation of this pathway as the predominate pathway for OA production in Ascomycota fungi. This finding contrasts with what is known from Basidiomycota fungi wher e both OAH and glyoxylate dehydrogenase activities may contribute significantly to OA biogenesis ( Munir et al. , 2001 ) . While exogenous OA application, and develo pment stages (except apothecium development) have a minor influence on Ss oah1 transcript accumulation levels, neutral ambient pH strongly induces Ss oah1 transcript accumulation. In addition, this neutral pH indu ction requires Ss Pac1 (a PacC ortholog). P acC is a transcriptional regulator at the terminal end of the ambient pH sensing signal transduction pathway, which is activated by alkaline ambient pH and selectively enhances or represses downstream gene expression by recognizing and binding core promote GCCARG ( Peñalva & Arst, 2002 ) . The presence of four PacC consensus binding sites within the intergenic region upstream of the Ss oah1 coding region strongly supports that Ss Pac1 directly activates Ss oah1 transcription upon activation. Together with our previous

PAGE 58

58 report that neutral pH induc ed OA accumulation in S. sclerotiorum requires Ss Pac1 ( Rollins, 2003 ) , our wo rk demonstrated that PacC activated Oah gene transcription is the primary mechanism t hrough which S. sclerotiorum modula tes its ambient pH environment. This mechanism should contribute significantly toward the acid ity adaptation of S. sclerotiorum as low p H comple tely rescued the radial growth defect of ss oah1 mutants. We reason a conservation of this regulatory machinery among Ascomycota fungi based on reports that neutral pH strongly induces OA accumulation in A. niger (Kubicek et al., 1988; Ruijter et al., 1999), and our observation that PacC binding sites are enriched within the upstream intergenic regions of all known oah genes and their Ascomycota orthologs (Table A 2). The prevalence of this pH modulation strategy and its biological significance should be further investigated with comparative studies of the expression and function of oah genes from different Ascomycota lineages. Compared to the UV ss oah1 mutants generated in this study are genetically defined. We compared ss oah1 developments and virulence. ss oah1 ss oah1 mutants produce no OA under any tested condition le in planta; II) morphologically fluffy mycelia growth and produce abundant ss oah1 mutants; in contrast ss oah1 defect; III) acidic pH fully rescued the growth ss oah1 mutants but not the

PAGE 59

59 underlying the phenotypes ss oah1 ss oah1 mutants and mutants show striking similarity in virulence reduction and symptom development, confirming the critical requirement of OA accumulation for pathogenesis. Reintroduction of the wild type oah1 ss oah1 mutants partially restored sclerotium developm ent and did not restore compound appressorium development despite the full restoration of OA accumulation. Thus the involvement of OA metabolism in sclerotium and compound appressorium development is complex, which is also indicated by the fact that the sc ss oah1 mutants could not be restored by lowering the growth medium pH or by adding exogenous OA alone (data not shown). Possibly, S. sclerotiorum requires precise and dynamic regulation of OA metabolism to support these develo pmental events that is not fully achieved by ectopic complementation. Alternatively, epigenetic processes that attenuate these developmental stages in the absence of OA accumulation, may not be reversed upon genetic complementation. Under either scenario, we are unable to draw firm conclusions regarding the role of oah1 on the regulation of sclerotium and compound appressorium developmental processes in contrast to the unequivocal data for its role in the synthesis of OA and its role in virulence discussed below. OA plays multiple functions during S. sclerotiorum infection. It elicits apoptotic like programmed cell death (PCD) and wilting as a non host specific toxin ( Noyes & Hancock, 1981 ; Guimaraes & Stotz, 2004 ; Errakhi et al. , 2008 ; Kim et al. , 2008b ; Lampl et al. , 2013 ) , facilitates cell wall degradation by acting synergistically with

PAGE 60

60 polygalacturonases (PGs) ( Batem an & Beer, 1965 ; Rollins & Dickman, 2001 ; Cotton et al. , 2003 ) . In addition, OA also suppresses host defense reactions and regulates the nature of h ost cell death ( Dutton & Evans, 1996 ; Cessna et al. , 2000 ; Williams et al. , 2011 ; Heller & Witt Geiges, 2013 ; Kabbage et al. , 2013 ) . A spatial distribution pattern of OA crystals indicates a dynamic regul ation of OA accumulation during S. sclerotiorum infection. Moreover, the transient living cell interaction between subcuticular hyphae and epidermal cells strongly indicate s that S. sclerotiorum interacts with its hosts in a much more subtle manner rather than simply disrupting and consuming its hosts. This scenario is consistent with the recently reported observations concerning the growth of S. sclerotiorum infectious hyphae into living plant tissue ( Kabbage et al. , 2013 ) . Am ong phytopathogens in the Scleot iniaceae family, OA is produced by both host generalists (e.g. S. sclerotiorum , B. cinerea ) and host specialists (e.g. S. trifoliorum , S. cepivorum ) ( Andrew et al. , 2012 ) . Thus OA accumulation alone does not explain the pathogenicity or host specificity of S. sclerotiorum and related species. On ss oah1 primary lesions and the fungal hyphae stayed viable for a relatively long period. While these observations continue to strongly support that OA accumulation is functionally critical in promoting S. sclerotiorum colonization, they also suggest that S. sclerotiorum can establish limited compatibility with its hosts in the absence of OA. In support of this viewpoint we have observed incompatibility during attempted infection of onion epidermal peels by non adapted pathogens within the Sclerotiniaceae family despite h yper accumulation of OA crystals at the infection sites (data not shown).

PAGE 61

61 A basic compatibility establishment for necrotrophic fungi should require factors functioning in both defense suppression as well as toxicity toward host cells. Secreted proteins fu nctioning in defense suppression has been recently identified from S. sclerotiorum . Ss ITL contributes toward S. sclerotiorum virulence by suppressing defense reactions mediated by jasmonic/ethylene (JA/ETH) signal pathway ( Zhu et al. , 2013 ) ; Ss Cm1 is a protein likely being structurally and functionally similar to the Ustilago maydis effector protein Cmu1 ( Djamei et al. , 2011 ; Kabbage et al. , 2013 ) . In addition, the S. sclerotiorum genome also encodes proteins similar to characterized or putative effectors including those of LysM ef fectors and chitin deacetylase family members. Although the presence of effector like proteins and the observed transient association between fungal invasive hyphae and living epidermal cells do not e, they do indicate that the necrotrophic compatibility establishment of S. sclerotiorum is more subtle than generally recognized. Establishment of infection may involve an active suppression of host basal defense reactions and associated cell death at th e very early interaction stage similar to what has been described for hemibiotrophic pathogens. In addition to OA, the necrotrophic infection of S. sclerotiorum may also involve factors promoting host cell death. PCD triggering endopolygalacturonase s ha ve been identified from S. sclerotiorum ( Zuppini et al. , 2005 ; Bashi et al. , 2013 ) . In the closely related necr otroph B. cinerea , a range of necrosis inducing factors including xylanase ( Brito et al. , 2006 ; Noda et al. , 201 0 ) , polygalacturonases ( Noda et al. , 2010 ) , cerato platanin family protein ( Frías et al. , 2011 ) , botcinic acid and botrydial ( Frías et al. , 2011 ) , have been identified and demonst rated to contribute toward virulence. A gene cluster

PAGE 62

62 involved in botcinic acid biosynthesis ha s been identified from the S. sclerotiorum genome ( Dalmais et al. , 20 11 ) , and this gene cluster is up regulated during infectious development (unpublished data). It is reasonable to assume that the S. sclerotiorum infection relies on an arsenal of toxic necrotrophic factors including OA. In relation to this viewpoint, we have identified a necrosis inducing activity in the culture fluid from the ss oah1 mutant based on tobacco leaf infiltration assay (Fig. A 10 ). In summary, functional analysis of the Ss oah1 gene, has demonstrated the critical contribution of OAH activity toward S. sclerotiorum OA biogenesis and pathogenesis. The data supports the view that the interaction between S. sclerotiorum and its hosts involves a dynamic regulation of OA accumulation levels. In addition, factors other than OA may contribute signifi cantly toward S. sclerotiorum pathogenesis possibly via both defense avoidance and host cell disruption. Further research effort to identify and characterize OA independent virulence factors would provide a better understanding of S. sclerotiorum virulence , and thus, new targets for resistance to this broad host range necrotrophic pathogen.

PAGE 63

63 Figure 2 1. Northern hybridization analysis of Ss oah1 transcript accumulation. Ethidium bromide stain ed rRNA was used for a loading control. A) Effect of exoge nous oxalate (OA) . Mycelia harvested from YPSu starter culture were grown for 4h in YPSu buffered at pH 4.8 prior to treatments with indicated amounts of OA. B) Developmental stages. M: mycelia collected from stationary PDB culture, S: sclerotia at develop mental stage 3 4, A: apothecia at developmental stage 4 5, C ellophane induction: compound appressoria induction on cellophane, IT: infected tomato leaves (2 dpi), T: mock inoculated tomato leaves (2 dpi).

PAGE 64

64 Figure 2 2. Generati on and verif ication of S s oah1 gene replacement mutants. A ) Schematic representation of the Ss oah1 genomic locus and expected gene replacement event. B ) Southern blot analysis of the wild type (WT), knock out mutants (KO1, KO2) and the complementation strain (Com). Left panel, H ind III (H) digested total genomic DNA hybridized with probe 1. Right panel, Hind III (H) and Xba I (X) digested total genomic DNA hybridized with probe 2. N: Not I, A: Asc I, UTR: untranslated region.

PAGE 65

65 Figure 2 3. Oxalic acid accumulation and pH kin etics in 0.5 M MOPS buffered YPSu shak e culture (pH 7.0). For oxalic acid accumulation (A) , each point represents mean ± standard deviation based on measurements from three independent cultures. For pH kinetics (B) , each point represent s mean value based o n three independent cultures . T he standard deviations were all smaller than 0.2 and were not plotted . KO: Ss oah1 gene knock out mutants; A1, A2, A3: UV induced oxalic acid deficient mutants

PAGE 66

66 Fig ure 2 4. Radial growth kinetics on unbuffered PDA or PDA media buffered with citric acid sodium phosphate buffer at the indicated initial pH values. Data points represent the mean values from three independent colony replicates. The standard deviations for all data points did not exceed 0.3 and were not plo tted. Com: complementation strain.

PAGE 67

67 Figure 2 5. Colony morphology and compound appressorium formation phenotypes. A) PDA colony morphology (10 dpi) . B) Compound appressoria formed on parafilm (3 dpi). C, Microscopic assessment of compound appressorium development. The scale bars in C represent 50 µm.

PAGE 68

68 Figure 2 6. Virulence assay s on detached tomato leaflets (A), detached soybean leaflets (B), detached Arabidopsis leaflets (C) and intact Arabidopsis plants (D). Leaves were wounded prior to inocula tion, the leaflets in A, B, and C were taken two, seven and two days post inoculation respectively.

PAGE 69

69 Figure 2 7. Exogenous oxalate (OA) treatment partially restored the virulence defect of ss oah1 mutants (KO1, KO2). Following petiole immersion in OA (pH 5.8) or ddH2O, trifoliate leaves were wounded and inoculated with mycelia plugs. Leaves with petioles immersed within the treatment solutions were kept within a moisture chamber for three days to allow for lesion development .

PAGE 70

70 Figure 2 8. V iability of infectious hyphae at the infection front during soybean leaflet ss oah1 mutant (KO2) were used for inoculation. Images from left to right of the same panel show views of the same optical field from bri ght field (I), GFP fluorescence with autofluorescence background (II), and GFP fluorescence alone (III). The scale bars represent 100 µm.

PAGE 71

71 Figure 2 9. Host defense reactions elicited on detached soybean leaflets. Soybean leaflets were wounded prior to inoculation. Leaflets were sampled two days post inoculation. To visualize the deposition of H 2 O 2 , lignin and callose, leaf together with Aniline Blue (C) respectively. The sca le bars in A, B and C represent 1 mm, 100 µm and 100 µm respectively.

PAGE 72

72 CHAPTER 3 OXALATE DECARBOXYLASE IS REQUIRED FOR EFFICIENT EARLY INFECTION ESTABLISHMENT IN Sclerotinia sclerotiorum Introduction S clerotinia s c l erotiorum is a devastating necrotrophi c fungal phytopathogen which infects many important crops and vegetables , and causes multiple millions of dollars in economic loss each year ( Bolton et al. , 2006 ) . Studies have demonstrated that oxalic acid (OA), a simple organic acid produced by many pathogenic and nonpathogenic organisms, is pivotal for its pathogenesis on different plant hosts ( Godoy et al. , 1990 ) . OA plays multiple roles during pathogenesis . P lants engineere d to express OA degrading enzyme s including oxalate oxidase ( OxO ) and oxalate decarboxylase (OxDC) provide enhanced resistance against S. sclerotiorum infection ( Donaldson et al. , 2001 ; Hu et al. , 2003a ; Livingstone et al. , 2005 ) . Despite its functional importance, the detailed OA accumulation dynamics d uring S. sclerotiorum infection are poorly understood. Recent reports indicate that OA accumulation increases significantly at the late phas es of infection and OA crystals distribute unevenly within infected plant tissue ( Garg et al. , 2010 ; Billon Grand et al. , 2012 ; Heller & Witt Geiges, 2013 ) . In S. sclero tiorum , OA biogenesis occurs through o xaloacetate acetylhydrolase (Ss Oah1) mediated C C cleavage of o xaloacetate (Chapter 2). Depending on the growth substratum, the t ricarboxylic acid (TCA) cycle and the glyoxylate cycle may both provide substrates for g enerating the o xaloacetate precursor ( Liberti et al. , 2013 ) . Ss o ah1 transcript accumulate to a similar level within vegetative hyphae, compound app ressoria, and host colonizing hyphae ( Chapter 2 ) , indicating that OA biogenesis occurs throughout the infection process.

PAGE 73

73 Besides OA biogenesis, OA accumulation dynamics could also be regulated by OA degrading enzymes. Across phylogenetic lineages, three t ypes of OA degrading enzymes exist, specifically oxalate decarboxylase ( EC 4.1.1.2 , OxDC), oxalate oxidase (OxO, EC 1.2.3.4 ) and oxalyl CoA decarboxylase (OxC, EC4.1.1.8). OxDC catalyzes the production of formate and CO 2 from OA and the activity occurs wid ely among fungi and bacteria ( Mäkelä et al. , 2010 ) . OxO catalyzes the oxidation of OA into CO 2 and H 2 O 2 and the activity has been mostly reported within monocot plants , the OxO identified from the Basidiomycota fungus Ceriporiopsis subvermispora is hitherto the only example identified outside of the plant kingdom ( Escutia et al. , 2005 ) . OxC converts activated oxalyl CoA to formyl CoA and CO 2 with thiamin pyrophosphate as the cofactor. Currently this enzyme activity has been reported only in bacterial species ( Baetz & Allison, 1989 ) . In S. sclerotiorum , OxDC but not OxO activity has been reported ( Magro et al. , 1988 ) . The gene(s) responsible for OxDC activity has not been identified, and the potential involvement of OxDC activity in the regulation of OA accumulation dynamics has not been c haracterized. OxDCs belong to the bicupin subclass of the cupin protein superfamily ( Dunwell et al. , 2000 ; K huri et al. , 2001 ) . Each OxDC contains two cupin domains (a bicupin), and within each domain there is a conserved Mn 2+ binding site made up of one Glu and three His residues ( et al. , 2005 ) . Closely related to OxDCs are OxOs which also belong to the cupin protein superfamily. OxOs are either monocupin ( in planta ) or bicupin (the C . subvermispora OxO). An acidic Asp/Glu amino acid residue at a pres umed proton donor site (Glu 162 in the B. subtilis OxdC) is a strong diagnostic signature of OxDC activity ( Escutia et al. , 2005 ) . At this position, all experimen tally

PAGE 74

74 validated OxDC enzymes contain an Asp or Glu residue whereas the C . subvermispora OxO contains a Ser / Ala (dependent on isoform) ( Escutia et al. , 2005 ) . Ami no acid 162 site are sufficient to convert the B. subtilis OxdC activity to OxO activity with high specificity ( Just et al. , 2004 ; Burrell et al. , 2007 ) . The S. sclerotiorum genome encodes two predicted OxDCs (Broad Institute locus ID: SS1G_08814 [ Ss odc1 ] and SS1G_10796 [ Ss odc2 ]). In this study, we carried o ut gene expression and deletion analysis of them. We demonstrated that Ss odc2 is strongly induced during compound appressorium development; moreover, Ss odc2 contributes significantly toward early infection establishment through regulating appressorium de velopment as well as appressorium function. Ss odc2 overexpression does not down regulate in planta OA accumulation or reduce virulence, thus OxDC activity plays a minor role in regulating OA accumulation level during S. sclerotiorum pathogenesis. The like ly mechanisms through which OxDC activity regulates appressorium development and function are discussed. Material and Methods Fungal cultures The S. sclerotiorum on potato dextrose agar (PDA, Dif ss odc1 ss odc2 , Ss odc2 Ectopic) and the overexpression strain (oliC were maintained and propagated on PDA supplemented with 100 µg/mL hygromycin. ss odc2 complementation strain (Ss odc2 C om) and the Ss odc2 promoter GFP fusion strain (ProOdc2 GFP) were maintained on PDA supplemented with 200 µg/mL

PAGE 75

75 nourseothricin. Dry sclerotia and filter papers colonized by vegetative hyphae were kept in paper envelopes at 20 °C for long term storage. Sequ ence analysis, alignment and phylogram construction Protein domains and putative signal peptides were identified using Pfam ( http://pfam.sanger.ac.uk/search ) and the SignalP 4.1 platform ( http://www.cbs.dtu.dk/services/SignalP/ ) respectively. Proteins homo logous to Ss Odc1 and Ss Odc2 were retrieved from the Broad Institute genome database ( http://www.broadinstitute.org/ ), Joint Genome Institute (JGI) genome database ( http://genome.jgi.doe.gov/ ), Uniprot protein database ( http://www.uniprot.org/ ), or Genban k ( https://www.ncbi.nlm.nih.gov/genbank/ ). Sequence alignment of full length OxDC homologs was used for neighbor joining phylogram construction with the MEGA 5 .0 software ( Tamura et al. , 2011 ) . Protein pairwise alignment and the calculation of protein similarity and identity scores were carried out based on the Needleman Wunsch algorithm ( Needleman & Wunsch, 1970 ) on the EBI server ( https://www.ebi.ac.uk/Tools/psa/ ). Gene introns were manually mapped onto the protein sequence alignment output. Northern blot, qRT PCR, RT PCR, tissue collection and treatments For Northern blot hybridization , t otal RNA was isolated with Trizol reagent (Invitrogen, Carlsbad, CA) , separated by denaturing gel electrophoresis, and blotted onto positively charged nylon membrane (Roche Diagnostics, Indianapolis, IN) for hybridization. Partial DNA sequences of the Ss odc1 and Ss odc2 coding regions were used as hybridization probes by labeling with digoxigenin (DIG) using the DIG High Prime DNA Labeling and Detection St arter Kit II

PAGE 76

76 (Roche Diagnostics, Indianapolis, IN). Blotting, hybridi zation and ensuing detection were carried out according to a previously described protocol ( Solanas et al. , 2001 ) . For gene expression analysis via qRT PCR , total RNAs we re isolated with the RNeasy Mini Kit ( QIAGEN Sciences , Valencia , CA), treated with DNases ( QIAGEN Sciences , Valencia , CA) and reverse transcribed with (Bio Rad, Hercules, CA) according to . Random primers were used for cDNA synthesis. Five fold diluted cDNA products were used as templates TGACAATCCTCAGCCTATTCG CTTGCCCATCCTGATTTCTTG was used to amplify a 192 bp amplicon of Ss odc2 . The S. sclerotiorum histone H3 gene was used as the endogenous reference gene . T he primer pair H3 ATGGCTCGTACCAAGCAAAC AGAGCACCAATAGCGGAAGA used to amplify a 278 bp amplicon. T io Rad, Hercules, CA ) was used to set up the PCR mixes. T he PCR reactions were carried out on the Time PCR Detection System (Bio Rad, Hercules, CA ). The thermocycle program consisted of 30 s at 95 °C, 44 cycles of 10 s at 95°C, 10 s at 55° C, and 30 s at 60°C. The program was followed by a melting curve analysis with the temperature ranging between 65°C and 95 °C . D elta delta Ct method was used for calculating the relative transcripts accumulation level of different samples ( Livak & Schmittgen, 2001 ) . Two step RT PCR was carried out to validate Ss odc2 overexpressing strains. The S. sclerotiorum histone H3 gene was used as the endogenous reference gene . T he aforementioned primer pair H3 F1/ H3 R1 was used for RT PCR. T he primer pair

PAGE 77

77 TGACAATCCTCAGCCT ATTCG AAACTCACAGCCCTCATCCAG 448 bp DNA fragment within the coding region, was used to amplify the Ss odc2 gene . cDNA synthesis was done in the same way as aforementioned in the qRT PCR section. The PCR reaction mixtu re consisted of 0.3 µL 5 U/µL Taq DNA polymerase ( NEB, Ipswich , MA) , 2.5 µL10 X Mg 2+ free buffer, 2 µL 25 mM MgCl 2 , 0.5 µL 10 mM dNTPs, 0.5 µL 10 mM primer each, 1 µL cDNA and made up to a final volume of 25 µL with double distilled sterile water. The ther mocycle program consisted of 30 s at 95 °C, 35 cycles of 30 s at 94°C, 30 s at 55°C, and 30 s at 72°C ; the program was followed by a 10 min extension at 72°C . PCR products (5 µL) were analyzed by electrophoresis on a 1.5% agarose gel. Tissues representing different developmental stages include 4 day old vegetative hyphae growing in stationary PDB culture , compound appressoria induced by inoculating mycelia plugs on cellophane (catalog no. 165 1779, Bio Rad, CA) overlaid on PDA medium, detached tomato leaves collected 2 days post infection, sclerotia at developmental stage 3 4 ( Li & Rollins, 2009 ) and apot hecia at developmental stage 4 5 ( Veluchamy & Rollins, 2008 ) . As a control for infected tomato leaves, mock inoculated tomato leaves (2 dpi) with PDA plug wer e also sampled. pH and OA treatments were carried out in YPSu medium (containing, per liter, 4 g yeast extract [Difco, Sparks, MI], 15 g sucrose, 1 g K 2 HPO 4 , and 0.5 g MgSO 4 ) . Fresh, actively growing vegetative hyphae from 4 day shaking culture (100 rpm, r oom temperature) were washed with ddH 2 O, and harvested onto filter paper by vacuum filtration . Harvested hyphae were then cultured for 4 h in YPSu medium buffered at pH 7.0 ( with citric acid sodium phosphate buffer ) before being harvested again and divided

PAGE 78

78 among pH/OA treatment media (YPSu with the pH buffered between 3.1 to 6.8, with or without 25 mM exogenous OA). The vegetative hyphae were treated for 4 h before being collected for total RNA extraction . We also determined the effect of OA at a fixed pH. C ollected vegetative hyphae were first grown in YPSu medium buffered at pH 4.8 for 4 h and then divided among buffered YPSu (pH 4.8) supplemented with OA at different concentrations (0 to 40 mM) for 4 h treatments. The pH values of the buffered media were readjusted with NaOH to intended values after OA addition. For OA treatment of mycelia in the qRT PCR experiment, vegetative hyphae collected from four day old stationary PDB culture in the presence of 20 mM OA was used. Gene replacement, complementatio n Overlap PCR was used for generating the Ss odc1 and Ss odc2 gene replacement constructs ( de Hoogt et al. , 2000 ) fl anking sequences of the Ss odc1 gene were amplified with primer pair Odc1LF GTCCAAGCGAGTCCTCTACAT /Odc1LR GCTCCTTCAATATCATCTTCTGTCGAC GCTATTGAAACTGATGGG TGA and Odc1RF CGTTTACCCAGAATGCACAGGTACACT GTCTCAAGCATCATGCCA GTT /Odc1RR AGTACG GCGTGAAGAGTA AAG respectively . T flanking sequences of the Ss odc2 gene were amplified with primer pair Odc2LF TATGAAGACGGAGTTATCGGGAGA /Odc2LR GCTCCTTCAATATCATCTTCTGTCGAC AGCCATAGCTGAATTGCCCAC and Odc2RF CGTTTACCCAGAATGCAC AGGTACACT GGAATGGATATGGGTGGATTTCTG /Odc2RR ATGTCTTGGATAGCGGTGCTT respectively. F ragments of and 5 the primer pair

PAGE 79

79 GTCGACAGAAGATGATATTGAAGG AAATTGCCGTCA ACCAAGCTCTGATAG TTTCAGCTTCGATGTAGGAGGGCG AGTGTACCTGTGCATTCTGG respectively. The LR and RF primers were such designed that an overlapping 27 bp sequence (underlined) exists between the / fragment an truncated hygromycin fragment. P AGAGTTGGTCAAGACCAATGC Odc1LFNest CAACAGGTCTCGATTGGGTAAG Nest/ Odc2LFNest GTCATCACCATCAATCGCCTAACAT PCR fragments while prime CGATTCCGGAAGTGCTTGAC CTGGGTCTGGTGATGTGAATG Nest/Odc2RRNest ATATTCTGTCGCACCCTTTCAC PCR PCR fragments (approximately 1 µg/µL) fo r each gene were mixed in equal molar ratio and directly transformed into the 1980 protoplast s . Putative gene knock out mutants were identified by PCR and further verified by Southern hybridization . To complemen t the ss odc2 mutant, a 3.9 kb DNA sequence encompassing its genomic locus was PCR amplified with the primer pair Odc2ComSpeIF GG ACTAGT GGATTGGATTGCAAAGATACCCTC Odc2ComXhoIR CCG CTCGAG CGATCGATGATATGAAAGCTGGG and ligated into the pD NAT1 vector ( Kück & Hoff, 2006 ) by Spe I/ Xho I double digestion . The construct was directly transformed into the ss odc2 (KO1) protoplast and selected with 200 ng/µ L n ourseothricin .

PAGE 80

80 Vectors for Ss odc2 promoter driven GFP expression and Ss odc2 gene overexpression The vector po liC GFP ( Leroch et al. , 2011 ) , which harbors a gfp reporter g ene with the codon s optimized for expression in B. cinerea ( Bcgfp ) , was used to generat e GFP expression vector s. Several digestion/ ligation steps were performed to generate p Blunt NAT oliC GFP. p o liC GFP was Sal I digested and self ligated to eliminate th truncated hygromycin resistance cassette, resulting in p o liC GFP SalI . The n ourseothricin resistance cassette from pD NAT1 vector ( Kück & Hoff, 2006 ) was inserted into the pCR ® Blunt vector ( Zero Blunt ® PCR Cloning Kit , Invitrogen, Carlsbad, CA) to get pBlunt NAT1via BamH I/ Hind III double digestion. The Bcgfp expression cassette from poliC GFP SalI was then inserted int o pBlunt NAT1 to get pBlunt NAT OliC GFP via Spe I / Xho I double digestion. To generate the Ss odc2 promoter driven GFP expression vector pBlunt NAT Odc2 Ss o dc2 gene was PCR amplified from a genomic DNA template with th CG GGATCC G GATTGGATTGCAAAGATACCCTC GG ACTAGT GGAATGCATCATGAATGAATGAATG . BamH I and Spe I restriction PCR fragment w as cloned into pGEM T vector ( Promega , Madison, WI). BamH I/ Spe I double digestion was then used to replace the oliC promoter sequence within the pBlunt NAT oliC GFP vector with the Ss o dc2 To generate the oliC promoter driven Ss odc2 gen e overexpression vector pBlunt Hyg oliC odc2, the primer pair O dc2ORFNcoIS CG CCATGG TGCATTCCAAAACTTTCCTGCTC O dc2ORFEcoRIAs -

PAGE 81

81 GC GAATTC AGAAATCCACCCATATCCATTCC Ss odc2 open reading frame (ORF) from a cDNA template. Nc o I and EcoR I restriction PCR fragment was cloned into the pGem T vector (Promega, Madison, WI ) to obtain pGem T odc2. Nco I/ EcoR I double digestion was used to replace the Bcgfp coding sequence of the p o liC GFP SalI vector with the Ss odc2 ORF from pGem T odc2, resulting in polic odc2 SalI. The hygromycin phosphotransferase expression cassette was cut from the pSO1 vector ( Warwar et al. , 2000 ) and ligated into the pCR ® Blunt vector ( Z ero Blunt ® PCR Cloning Kit , Invitrogen, Carlsbad, CA) via BamH I digestion, resulting in the vector pBlunt Hyg. Spe I/ Xho I double digestion was then used to ligate the olic odc2 expression cassette from p o liC eGFP SalI into pBlunt Hyg, resulting in the fi nal vector pBlunt Hyg oliC odc2. Phenotype analysis The assay for c ompound appressori um development was carried out by inoculating a PDA mycelia agar plug onto parafilm or cellophane overlaid on PDA medium, or by spreading an ascospore suspension (10 5 per mL) on to cellophane over laid on to quarter strength PDA. To examine the effect of nutrients on appressoria formation, mycelia plugs from 2x PDA, PDA, and 1/2x PDA were used for parafilm inocula tion. To stain the appressoria , trypan blue (0.5% in ddH 2 O) was ad ded onto the parafilm surface after mycelia plug removal. Virulence assay s were carried out on detached leaves , petioles or stems of common bean ( Phaseolus vulgaris cv. Bush Blue Lake 47), soybean ( Glycine max [L.] Merr. cv. Harosoy) , tomato ( Lycopersicon solanum cv. Bonnie Best) and celery ( Apium graveolens ) . Bean, soybean and tomato plants were grown in the greenhouse under nature sunlight, with the temperature ranging between

PAGE 82

82 16 °C and 25 °C. Leaves and petioles excised from approximately one month old pla nts were used for inoculation. Cel ery stalks were purchased from a local grocery store and the stalks were washed with running water and cut into 3 5 cm pieces. For inoculation, m ycelia plugs containing actively growing hyphae tips were placed on top of pl ant tissues and the inoculated plants were placed inside a moisture chamber to allow for symptom development. For wounded inoculation s , a 0.5 cm cross cut was made through the leaf surface with a scalpel blade and the inoculum pl ug was placed on top of the cut. After incubation, lesion sizes were documented via photograph and quantified with Spot Advanced Software program (Diagnostic Instruments, Sterling Heights, MI) . To visualize fungal infection structures and host cell death s , infected plant tissues wer e cleared with 3:1 ethanol: acetic acid solution overnight and then stained with trypan blue (0.5% in ddH 2 O) for one day before microscopy. For PDA radial growth assay, m ycelia plugs containing actively growing hyphae tips were inoculated at the center of 9 cm PDA plate medium , radial diameters were recorded at 12h time intervals for data plotting. The induction of apothecia and the collection of ascospores were carried out as previously described ( Li & Rollins, 2010 ) . OA measurement was carried out with an enzymatic kit according to the Trinity Biotech , Wicklow, Ireland ) . OA standards with defined concentrations (0 to 90 mg/L) were used to generate the standard curve. Serial sample dilutions were performed to ensure samples were in the range of the standard curve. Fluids from the PDB stationary culture and PDB shaking culture were directly used for quantification. For PDB stationary culture , four mycelia plugs with spreading hyphal tips were inoculated into 25 mL PDB medium within a 9 cm petri dish. The

PAGE 83

83 dishes were left on the lab bench to allow for fungal growth, culture fluids were collected four and eight days post inoculation for OA quan tification. For PDB shaking culture, eight mycelia plugs with spreading hyphal tips were inoculated into a 200 mL flask containing 50 mL medium and shaken at 100 rpm, culture fluids were collected 1, 3, 5, and 7 days post inoculation. To measure OA in PDA cultures , 9 cm PDA plate media were inoculated with mycelia plugs covered with hyphae tips. Mycelia plugs were then collected at different time points (2 dpi, 4 dpi, 6 dpi, 8 dpi, 10 dpi) for OA quantification. For each time point, six 5 mm diameter mycel ia plugs located at even intervals between the inoculation site and the colony front were pooled as one sample and collected into 2 mL eppendorf centrifugation tube s; the collected plug s were weighted, lyophilized, and ground into fine powder with a metal spatula. 1 mL ddH 2 O wa s added to suspend the powder . After centrifugation (10,000 g, 5 min), the supernatant was used for OA measurement. The final OA concentrations were expressed as mg/g wet plug unit to al low for cross sample comparison. Similar methods were used for measuring OA accumulation in PDA mycelia plugs collected during compound appressori um induction on parafilm. To quantify in planta OA accumulation, detached soybean leaves were harvested two and four days post inoculation. Lesion sizes were quantified with Spot Advanced Software program before the lesions were excised and collected into 2 mL Eppendorf centrifugation tubes. Tissues were lyophilized, broken into fine powder, and re suspended in ddH 2 O. After centrifugation at 12,000 rpm for 5 mi n, 100 µL of the supernatant was transferred into a new 1.5 mL Eppendorf centrifugation tube. A 10 µL volume of activated charcoal was added into each tube to absorb leaf pigments . T he

PAGE 84

84 suspensions were left on the lab bench for 30 minutes and centrifuged a t 12,000 rpm for 10 min, the supernatants were then used for OA quantification. Measured OA concentrations were expressed in mg OA/cm 2 leaf tissue unit. OA degrading activity assay Eight mycelia plugs were inoculated into a 200 mL flask containing 50 mL PDB medium and shaken 4 d at 100 rpm. Mycelia were collected by vacuum filtration and washed 3 times with ddH 2 O before being collected again and re inoculated (approximately 0.5 g wet weight/50 mL medium) into buffered PDB medium (pH 3.0, buffered with citrate phosphate buffer). After two additional days of shaking culture, the culture fluid and vegetative hyphae were collected for protein extraction and OA degrading activity assay. For the OA degrading activity assay, the culture fluids were concentrate d for 500 folds with the Amicon UltraCentrifugal Filter Unit (Molecular weight cut off: 10 kDa, Millipore , Billerica, MA). The final protein concentration is around 1 mg/mL. The fungal hyphae were collected, washed with ddH 2 O and collected again via vacuum filtration, and lyophilized for crude protein extraction and OA degradation activity assay. Lyophilized fungal tissues were ground into a fine powder, 2 00 L ice cold citrate phosphate protein extraction buffer ( 0.1M, pH 3.0) was added into a 1.5 mL eppen dorf tube containing around 2 00 L of ground tissue. The slurry suspension was ice incubated for 30 min and directly used for the OA degrading activity assay. To determine whether the activity was located within the soluble or insoluble fraction, the slurr y suspension was centrifuged at 12,000 rpm for 5 min, the supernatant was collected and the pellet was re suspended in 2 00 L protein extraction buffer. OA degradation activity was compared between the supernatant and the resuspended fractions. To test OA degradation activity, exogenous OA (adjusted to pH 4.0) was

PAGE 85

85 L protein extraction suspension to a final concentration of 10 mM. The reactions were then incubated at 37 °C for 30 min before quen ching with 1 µL NaOH ( 10 M ) . OA concentrations w ere determined qualitatively based on an enzymatic kit ( Trinity Biotech , Wicklow, Ireland ). As a negative control, the reaction mix was directly quenched before incubation. Results Evolutionary features of fungal bicupin OxDC homologs The Ss Odc1 and Ss Od c2 proteins contain 455 and 504 amino acids and share 59.2% sequence identity. Ss Odc1 and Ss Odc2 share 44.3% and 47.7% sequence identity with the Dichomitus squalens OxDC ( Mäkelä et al. , 2009 ) respectively. Consistent with other OxDC enzymes, both proteins contain an N terminal secretion peptide signal, a bicupin protein domain, a conserved Mn 2+ binding site, and a Glu res idue at the putative proton donor site (corresponding to Glu 162 position of the B. subtilis OxdC) (Fig. B 1). The OxDC activit y of the Ss Odc1 and Ss Odc2 proteins w as further indicated by phylogenic analysis. OxDC protein homologs from selected fungal and bacteria l species formed three strongly supported clades on the neighbor joining phylogram (Fig. B 2). Clade I contained all functionally characterized fungal OxDCs, Ss Odc1, and Ss Odc2; clade III contained two bacterial OxDCs and several uncharacterized Ascomycota proteins; clade II contained proteins from both Ascomycota and Basidiomycota lineages, but none of them have been functionally characterized. All proteins within clade I and clade III contain an acidic Glu/Asp residue at the putative proton don or site except the C. subvermispora OxO, which contains a Ser residue. All proteins within clade II contained a neutral Ala residue or an alkaline Arg/Lys residue at this position.

PAGE 86

86 The C. subvermispora OxO belongs to clade I and is highly similar with Basi diomycota OxDCs in protein sequence and gene exon intron structure (Fig. B 3), indicating its recent evolutionary origin from an OxDC ancestor. Likely clade I and clade III represent OxDC clades while clade II proteins are either OxOs or enzymes with unkno wn activity as proposed before ( Escutia et al. , 2005 ) . Transcript accumulation of Ss odc1 and Ss odc2 genes Northern blot hybridization was used to determine the effects of ambient pH and exogenous OA on Ss odc1 and Ss odc2 transcript accumulations. Over a wide range of pH and OA treatment conditions, a hybridization band of similar signal intensity was observed for Ss odc1 and transcript accumulation of Ss odc2 w as never detected (Fig. 3 1A). Thus Ss odc1 and Ss odc2 expression was independent of pH and OA regulations. With Northern blot analysis, Ss odc1 transcript accumulation was detected across all life stages (Fig. 3 1B). Compared with vegetative hyphae, the accumulation level was lower in sclerotia, apothecia, and during late compound appressorium development (48 and 72 hours post induction). Ss odc2 transcript accumulation was not detected in vegetative hyphae, infected tomato leaflets sclerotia, or apothec ia, but was strongly induced during compound appressorium development (36, 48, and 72 hours post cellophane induction, Fig. 3 1B). qRT PCR analysis of Ss odc2 transcript accumulation (Fig. B 4) revealed a 6 fold increase in infected tomato leaflets, a 30 fold increase in sclerotia and ap othecia, and a greater than 980 fold increase during compound appressoria development (48 hours post cellophane induction) relative to vegetative hyphae. Exposure of vegetative hyphae to 20 mM exogenous OA resulted in

PAGE 87

87 a mod est (approximately 2 fold) increase in Ss odc2 transcript accumulation relative to untreated control. The tissue specificity of Ss odc2 gene expression was further character ized via promoter driven GFP expression. GFP protein was expressed under the contr ol of the native Ss odc2 promoter (1,675 bp sequence upstream of start codon). F luorescence was not observed in vegetative hyphae growing on solid PDA or in liquid PDB or in YPSu media, nor was the fluorescence induced by 4 h treatments with low pH (YPSu, pH 3.0), exogenous OA (YPSu, 20 mM KOA) or starvation (YPSu without sucrose, ddH 2 O, water agar) (data not shown). On cellophane overlaid PDA medium, strong GFP fluorescence was observed in compound appressoria and in the hyphae immediately supporting compo und appressoria formation, but not in other vegetative hyphae (Fig. 3 2). On PDA medium, GFP fluorescence was not observed in the vegetative hyphae growing at the colony front, but was observed in the aerial hyphae growing at the colony center and was weak ly observed in developing sclerotia (Fig. B 5). Gene replacement mutants of Ss odc1 and Ss odc2 The strategies for generating gene knock out mutants are shown in Figure 3 3 . Confirmed by Southern blot analysis, one and four independent genetically pure ge ne replacement mutants were obtained for Ss odc1 and Ss odc2 genes, respectively (Fig. 3 3A, B). In Southern blot analysis for the Ss odc1 gene, genomic DNAs were digested with EcoR V ; hybridization with probe 1 (the Ss odc1 partial ORF ) yielded a 1.2 kb b and for the WT but no band for the knock out (KO) mutant while hybridization with probe 2 ( t he Ss odc1 yielded a 2.6 kb band for the WT and a 5.4 kb band for the KO mutant. For Ss odc2 gene KO analysis , genomic DNAs were digested with EcoR I before being hybridized with probe 1 (the Ss odc2 partial ORF), which yielded a 2.7 kb

PAGE 88

88 band for the WT and Ect opic (Ect) strain but no band for the KO mutants . Genomic DNA was also digested with Pst I and Xho I and hybridized with probe 2 ( the Ss odc2 UTR ), w hich yielded a 5.4 kb band for the WT and a 3.2 kb band for the KO mutant; the Ect strain showed a band besides the 5.4 kb WT band, indicating a single ectopic integration event. The ss odc2 mutants formed less complex compound appressoria On PDA medium, the ss odc1 and the ss odc2 mutants grew similarly as the WT (Fig. B 6). They exhibited wild type morphology, normal development of sclerotia, apothecia, and ascospores (Fig. B 7). Both the ss odc1 mutant and the ss odc2 mutants showed wild type levels of sensitivity to OA stress (data not shown). The ss odc2 mutants, however, were in efficient in compound appressorium development (Fig. 3 4A, B, Fig. B 8A). Two days post parafilm i ss odc1 mutant formed cushion shaped appressoria abundantly, which merged together into continuous ring layer (Fig. B ss odc2 mutants, in contrast, formed sporadically and discretely distributed compound appressoria wh ich never merged into ring layer (Fig. 3 ss odc2 mutants were defective in early appressorium development, ascospores suspensions (10 5 per mL) were spread onto cellophane overlaid on quarter strength PDA medium. Two days post inoc ss odc2 mutants differentiated appressoria morphologically indistinguishable from the WT (Fig. 3 4C top). Over time, however, the WT and the Ect strains formed complex cushion ss odc2 mu tants (Fig. 3 4C ss odc2 mutants were not defective in compound appressorium initiation or early development, but wer e inefficient in forming highly complex and cushion shaped appressoria structures .

PAGE 89

89 ss odc2 mutants were inefficient in primary lesion establishment Pathogenicity was tested on a variety of plant hosts (tomato, common bean, ss odc1 mutant behaved indistinguishably from WT in all replications (Fig. B 8B and ss odc2 mutants, in contrast, exhibited a virulence reduction to varying degree dependent on the plant host and plant ss odc2 mutants showed no virulence defect on tomato leaves (Fig. 3 5A), a small virulence reduction on bean leaves (Fig. 3 5A) and dramatic virulence reduction on bean petioles (Fig. 3 5A), soybean leaves (Fig. 3 6, Fig. 3 7), and celery stalks (Fig. 3 5B). In all tests, w ounding prior to inoculation fully restored the virulence defect of the ss odc2 mutants (Fig. 3 7, data not shown) . ss odc2 mutant on soybean leaves was characterized in more detail. Following inoculation, the WT, Ect and Com strains initiated penetration rapidly, generating multiple independent infectio n sites at 14 hpi, which coalesced and formed primary lesion s by 24 hpi (Fig. B ss odc2 mutants, in contrast, rarely penetrated and induced necrotic lesions at these two time points (Fig. B 9, Fig. 3 6 A). Microscopic observation indicated that th e mutants differentiated appressoria as early as 14 hpi, but at a lower frequency compared with control strains (Fig. 3 6 A). Two days ss odc2 mutants was 53% (n=60) while frequencies for th e WT, Ect and Com strains were all 100% (n=15). ss odc2 mutants were sporadic infection sites (Fig. 3 6 B), and were much smaller compared to other strains (Fig. 3 7). Lesion expansion from ss odc2 mut ants typically caused delayed but complete leaf colonization (data not shown).

PAGE 90

90 Inoculation with nutrient enriched mycelia plug restored the developmental but ss odc2 mutants W e examined whether nutrient is related to the virulence defect of the ss odc2 mutants . Firstly, we examined whether nutrient affects compound appressoria development. The nutrient effect was examined with mycelia plugs cut from 2 x PDA, PDA and 1/2 x PDA medium conditions (Fig. 3 8). Two days post inocul ation, the WT developed compound appressoria efficiently when inoculating with plugs from 2 x PDA and PDA media , but not when inoculating with 1/2 x ss odc2 mutants rarely formed compound appressoria with PDA or 1/2 x PDA, but formed compound appressor ia efficiently with 2 x PDA. Thus, an elevated inoculum nutrient level partially ss odc2 mutants. We further tested whether this elevated nutrient level could restore the deficiency in primar ss odc2 mutant. Twenty four hours post inoculation, the WT had infection rates of 92% (n=37) and 97% (n=37) when mycelia plugs from 2 x PDA and ss odc2 mutant had infection rates of 25% (n=40) and 27% (n=41) under the corresponding medium conditions, respectively. Further examination indicated that inoculation from 2 x PDA mycelia l plugs dramatically increased compound appressorium frequency and complexity , but not cuticle penetration efficiency ss odc2 mutant (Fig. 3 9, Fig. 3 10). ss odc2 mutants hyperaccumulated OA In PDA culture, the WT accumulated OA to an approximate level of 0.5 mg/g fresh weight agar by 2 dpi. This level increased to approximately 1 mg/g fresh weight agar by 4 and 6 dpi and dropped slightly thereafter (8 dpi, 10 dpi) (Fig. 3 11 A). Similar

PAGE 91

91 OA accumulation kinetics were observed with the Ss odc2 Ect and Com strains (Fig. 3 11 A). In contrast, OA levels increased from 0.4 0.7 mg/g fresh weight agar (2 dpi) to 2.5 ss odc2 mutants (KO1, KO2), a ss odc1 mutant, OA levels were statistically higher than the WT at 2 dpi and 10 dpi, but were not significantly different from the WT at other time points. OA accumulation was further quantified from stationary and shaking PDB cultures (Fig. 3 11 B, Fig. 3 13C) and from mycelia colonized PDA plugs collected durin g appressoria induction (Fig. 3 12). In stationary PDB culture, the ss odc2 mutants accumulated approximately 1.5 times more OA than the WT. The ss odc1 mutant accumulated OA to a level slightly lower but not s ignificant ly different from the WT and other control strains. In mycelia PDA plugs incubated under conditions co nducive for appressorium development, the ss odc2 mutants accumulated OA to a concentration approximately three times higher than the WT. The ss odc1 mutant accumulated OA to a level similar to the WT. In shaking PDB culture, the ss odc2 mutant accumula ted OA to a level approximately 2 fold higher than the WT (Fig. 3 13 ss odc2 mutants hyperaccumulated OA among a variety of liquid and solid PDA media culture conditions. Overexpression of Ss odc2 gene in S. sclerotiorum Preliminary effo rts failed to detect OxDC activity in the WT strain. To determine if OxDC activity is indeed associated with Ss odc2 expression, and to further study its biological function, we overexpressed the Ss odc2 gene in S. sclerotiorum under the control of a const itutive promoter (Figure 3 13 A ). Out of over 20 transformants, o ne overexpression strain (designated as oliC odc2) was identified and validated via RT -

PAGE 92

92 PCR (Figure 3 13 B) , in vitro OA accumulation (Figure 3 13 C) , and OA degrading activity assay (Figure 3 13 D) . In concentrated protein extracts from culture filtrates, OA degrading activity was neither detected in the WT nor in the oliC odc2 strain. In mycelia protein extracts, strong OA degrading enzyme activity was detected in the oliC odc2 strain but not in the WT (Figure 3 13 D). Furthermore, most of the OA degrading activity was associated with the insoluble extract fract ion (Figure 3 13 D), suggesting its cell wall associated. The oliC odc2 strain showed normal radial growth, plate morphology, and com pound appressorium development (data not shown). On detached soybean leaflets, t he oliC odc2 strain exhibited WT virulence and OA accumulation (Figure B 11). The oliC odc2 strain showed WT sensitivity to stress conditions including OA (20 mM), cell wall an d membrane stress (200 µg/mL calcofluor white, 200 µg/mL congo red, 0.01% SDS), osmotic stress (1 M sorbitol, 1 M NaCl), and reactive oxygen stress (5 mM H 2 O 2 ; Figure B 12), suggesting a minor role of Ss Odc2 in conferring stress tolerance. In addition, bo th the WT and the oliC odc2 strain grew poorly on minimum medium supplemented with OA (50mM, pH 4.0) as the sole carbon source, indicating that Ss odc2 gene overexpression alone, is insufficient to allow the use of OA as a sole carbon source (data not show n). Discussion Since the first report ( Sh imazono, 1955 ) , OxDCs have been isolated from over 20 fungal and bacterial species and have been applied for a wide variety of biotechnological purposes ( Mäkelä et al. , 2010 ) . The in vivo biological functions of OxDCs, however, are still ambiguous. No phenotype has been observed with the OxDC gene knock out mutants generated in A. tumefaciens ( Shen et al. , 2008 ) or B. subtillus

PAGE 93

93 ( Costa et al. , 2004 ) , and no OxDC encoding gene has been functionally characterized in a filamentous fungus via gene disruption. In this study we chara cterized in detail the expression pattern of Ss odc1 and Ss odc2 , a nd the eff ect of their deletions on S. sclerotiorum growth, development and pathogenesis. Although an acid inductive OxDC activity has been reported in S. sclerotiorum ( Magro et al. , 1988 ) , we did not detect OxDC activity in our S. sclerotiorum WT strain. Such discrepancy might be caused by medium or strain related variations. The transcript accumulations of Ss odc1 and S s odc2 are not affected by ambient pH or OA ss odc2 mutant, but not ss odc1 mutant, showed elevated OA accumulation in various hyphae cultures. In contrast, the Ss odc1 transcript, but not the Ss odc2 transcript, accumulated to a significant level in vegetative hyphae. Such discrepancy might be related to the different catalytic efficiencies between Ss Odc1 and Ss Odc2, or different gene expression regulations at the post transcriptional or post translational levels. OxDC activity was initially thought to function in deregulating ambient OA accumulation. This viewpoint, however, was later challenged by the identification of OxDC enzymatic activity from brown rot fungi which accumulate high l evel OA ( Micales, 1995 ) . In this study, neither deletion nor overexpression of the Ss odc2 gene affects in pla nta OA accumulation or post invasive pathogenesis. It seems that OxDCs mainly degrade OA surrounding the producing hyphae but not OA accumulated in a macro environment, which is supported by the reported cell wall localization of OxDCs ( Micales, 1997 ; Azam et al. , 2001 ; Antelmann et al. , 2007 ) . Here, Ss Odc2 p rotein also

PAGE 94

94 seems to localize to the cell wall, suggesting a hyphae associated OA decarboxylation activity similar as in other filamentous fungi. In contrast with the lack of effect on in planta OA accumulation, Ss odc2 gene overexpression significantly d own regulates OA accumulated in PDB shaking culture. Such difference could be caused by different substrate availability under these two conditions. During plant infection, secreted OA diffuses to locations being spatially separated from the cell wall boun ded Ss Odc2; in contrast, in liquid shaking culture, OA secreted into the medium would come in repeat contact with the fungal cell wall. In addition, OA secreted in planta can form oxalate calcium crystal which may be inaccessible to the OxDC enzyme. We ch aracterized the gene deletion effects of Ss odc1 and Ss odc2 on S. sclerotiorum growth, development and pathogenesis. The s s odc1 mutant was indistinguishable from the wild type in all phenotypes assayed. In contrast, the four s s odc 2 mutants were uniformly inefficient in compound appressori um development. ss odc2 mutants were not defective in compound appr essori um initiation, but rather, were ineffi cient in differentiating highly complex compound appressoria with a macroscopic (up to a millimeter in diameter) cushion shaped appearance. In association with s uch developmental defect was a virulence defect whi ch could be fully bypassed by wounding prior to inoculation. Thus Ss Odc2 contributes toward S. sclerotiorum infection through a ffecting compound appressoria development. Compound appressoria are hyphal tip derived and multicellular infection structures w hich have convergently evolved in many necrotrophic fungal lineages

PAGE 95

95 including Sclerotinia spp., Botrytis spp ., Rhizoctonia spp. , and Fusarium spp . ( Tariq & Jeffries, 1984 ) . Compared with a sing le cellular appressorium, the compact organization and high structural complexity of a compound appressorium could be a mechanism allowing for an enriched accumulation of hydrolytic enzymes, toxins and defense suppressive factors at the penetration sites, which in turn facili t ates pathogen penetrations. S. sclerotiorum has been suggested to increase the developmental complexity of compound appressoria when encountering increased penetration resistance ( Tariq & Jeffries, 1984 ) . T he ss odc2 mutants showed no or minor virulence defect on tomato and common bean leaves, but showed significant virulence defect on soybean leaves, celery stalks , and common bean leaf petioles. Very likely, soybean leaves, celery stalks, and common bean leaf petioles represent plant tissues being more penetration recalcitrant relative to tomato and bean leaves. W e have characterized the previ ously s s ggt1 mutant which is defective in compound appressorium differentiation ( Li et al. , 2012 ) s s ggt1 mutant could succ essfully penetrate detached tomato and bean leaves , but could not penetrate soybean leaves, celery stalks, or common bean leaf petioles (unpublished data) , which is in accordance with the idea of a tissue dependent variation in penetration resistance menti oned above . While elevated nutrient enable abundant compound appressoria formation, it ss odc2 mutants. Thus, in addition ss odc2 mutants may also be defective in appressorium mediated penetration. Our experimental data, h owever, does not allow us to draw unequivocal conclusion s on the mechanism s by which OxDC activity regulates these processes. During compound appressoria formation, hyphal cells transit from a

PAGE 96

96 nutrient rich status (hyphae growing on senescent plant tissue, myceliogenically germinated sclerotia, hyphae on mycelia plugs) to a nutrient poor status (hyphae growing on plant and artificial hydrophobic surfaces). Proper nutrient regulation might thus be important for compound appressori um development al process . Po tentially, Ss Odc2 contributes to energy production by taking advantage of OA in proximity to the hyphal cell as a carbon source. However, our preliminary test indicates that neither the S. sclerotiorum WT strain nor the Ss odc2 gene overexpression strain could utilize OA as the sole carbon source. It is likely that such oxalotrophy related metabolic process (if exist) requires OxDC as well as additional factors. One likely component would be f ormate dehydrogenase (FDH, EC 1.2.1.2. ) as ha s been proposed by Watanave and others (2005) . FDH catalyzes reducing power generation from the oxidation of formate , a decarboxylation product of OxDC. The existence of such an OxDC FDH metabolic pathway for OA utilization, however, awaits experimental validation. FDH has b een reported to localize in the mitochondria in Fusarium oxysporum ( Uchimura et al. , 2002 ) or in the cytosol in Ceriporiopsis subvermispora ( Watanabe et al. , 2005 ) . The existence of the OxDC FDH coupled meta bolic pathway would require the intake of extracellular formate. The S. sclerotiorum genome encodes one putative formate transporter (Broad institute ID: SS1G_03654) and one putative FDH (SS1G_09038). EST data support the expression of both genes during pa thogenesis . Similarly, in the brown rot fungus Postia placenta ( Martinez et al. , 2009 ) , a putative OxDC encoding gene, a putative formate transporter, and thr ee formate dehydrogenases (FDH, EC 1.2.1.2. ), were cooperatively up regulated in cellulose medium relative to glucose. SS1G_09038 contains a putative

PAGE 97

97 mitochondria localization signal, indicating it s associa tion with the respirational chain similar as FDH i n F. oxysporum ( Uchimura et al. , 2002 ) . Besides a nutritional role, OxDC activity has also been suggested to function in OA detoxification and pH homeostasis regulation. This hypothesis is supported by the observa tion that acidic ambient pH generally favors OxDC expression or enzymatic activity ( Shimazono, 1955 ; Dutto n et al. , 1994 ; Micales, 1995 ; Azam et al. , 2002 ; MacLellan et al. , 2009 ; Mäkelä et al. , 2014 ) , as well as their cell wall localizations ( Micales, 1997 ; Azam et al. , 2001 ; Antelmann et al. , 2007 ) . During compound appressorium development, the Ss oah1 transcript accumulates to a level comparable to that in vegetative hyphae (Chapter 2), the dens e alignment of hyphal tips within compound appressoria would thus dramatically elevate local OA accumulation. While such elevation facilitates epidermal cell disruption and penetration, it may also cause cellular toxicity toward the fungal cells. Moreover, compound appressoria development and function might require a proper ambient pH environment, as is the case for the S. sclerotiorum pathogenesis and sclerotia development ( Rollins & Dickman, 2001 ; Rollins, 2003 ) . Under such a scenario, the strong induction of Ss odc2 gene expression during compound appressoria development would allow for defending against OA toxicity and maintaining a proper micro ambient pH. The role of OxDC activity in OA stress s s odc 1 s s odc 2 mutants, and the Ss odc2 gene overexpression strain all showed WT sensitivity toward OA stress. However, the possibility that Ss Odc2 regulates compound appressoria development and function through pH effect is to be tested in future studies.

PAGE 98

98 Elevated inoculum nutrient level significantly increases appressoria formation but not th s s odc 2 mutants, indicating a functional defect of t he s s odc 2 mutants. Although not validated , it is possible that this defect is related to elevated host defense reactions due to OA hyperaccumulat ion given the reported effect of OA treatment on eliciting immune reactions in A . thaliana plants ( Lehner et al. , 2008 ) . In sum, we demonstrated that Ss Odc2 mediated OxDC activity functions in early infection establishment of S. sclerotiorum . Although the detailed biological roles of OxDC activity are to be determined, the findings reported here demonstrate that OA accumulation is developmentally regulated through catabolism and this activity is required for penetration dependent infection on many hosts. Methods to quantitatively measure local OA accumulation and local ambient pH with high spatial resolution are necessary to further refine our understanding of the dynamics of these factors during host infection and colonization.

PAGE 99

99 Figure 3 1. Northern hybridization analysis of the transcript accumulation f or Ss odc1 and Ss odc2 . Ethidium bromide stain ed rRNA was used for a loading control, with the 28S rRNA b and shown below each blot. A ) pH/OA treatments. Treatments were carried out in YPSu medium and the fungal hyphae were incubated for 4h during treatment s. B ) Developmental stages. M: mycelia (4 day stat ionary PDB culture) , S: scler otia at developmental stage 3 4, A: apothecia at developmental stage 4 5 , CA induction: compound appressoria (CA) induction on cellophane overlaid on PDA, extensive CA formation starts to occur 36 hours post cellophane induction (C), IT: infected tomato leaves (2 dpi) , T: mock inoculated tomato leaves (2 dpi) .

PAGE 100

100 Figure 3 2. Tissue specificity of Ss odc2 gene expression determined by promoter driven GFP expression . Mycelia pl ugs were inoculated on cellophane overlaid PDA medium for compound appressorium induction. GFP expression driven by t he constitutive oliC promoter was used as a control. Red arrows indicate compound appressoria and the scale bars represent 200 µm.

PAGE 101

101 Fi gure 3 3. Construction and verification of gene k nock out mutants of Ss odc1 (A) and Ss odc2 (B) genes . For Southern blot analysis of Ss odc1 gene knock out transformants , genomic DNAs were digested with EcoR V before hybridization . For Southern blot anal ysis of Ss odc 2 gene knock out transformants, genomic DNAs were digested either with EcoR I before being hybridized with probe 1, or d ouble digested with Pst I and Xho I before being hybri dized with probe 2.

PAGE 102

102 Figure 3 4. ss odc2 mutants were less efficient in compound appressorium development. A) Compound appressoria formed on parafilm (3 dpi). B) Magnified view of appressoria. C) Compound appressoria formed on cellophane from germinated ascospores. Note the lack of highl y complex cushion ss odc2 mutants by 5dpi. The scale bars on strain, Com: complementation strain.

PAGE 103

103 Figure 3 5. ss odc2 and control str ains. A) Relative lesion sizes on detached tomato leaves (3 dpi), detached bean leaves (3 dpi), and detached bean petioles (2 dpi). The bar plots represent means + standard deviations based on 10, 8, and 8 independent inoculation replicates for tomato leaf , bean leaf and bean petiole respectively. Bars with different letters are statistically different (p<0.05) as determined by one way ANOVA (p<0.05) followed by a post hoc Tukey HSD analysis. B) Celery stalk inoculation (3 dpi). Ect: ectopic strain, Com: co mplementation strain.

PAGE 104

104 Figure 3 6. ss odc2 mutants were inefficient in primary lesion establishment. A) Appressoria and dead host cells were visualized by trypan blue staining. The mutant formed fewer appressoria compared with the WT and rarely initia ted penetration by 14 hpi. B) Typical primary lesions formed by the WT and the ss odc2 mutants by 2 dpi.

PAGE 105

105 Figure 3 7. ss o dc2 mutant. Detached soybean leaves were either dire ctly inoculated or wounded prior to inoculation. A) Typical lesion appearance (2 dpi). B) Lesion size quantification (2 dpi). Bars represent means + standard deviations for 15 unwounded and 7 wounded inoculation replicates respectively. Ect: ectopic strain , Com: complementation strain.

PAGE 106

106 Figure 3 8. Inoculum with elevated nutrients s o dc2 compound appressoria formation. Mycelia plugs from 2x PDA, PDA, and 1/2x PDA were inoculated on parafilm for appressorium induction. Photograph was taken two days post inoculation.

PAGE 107

107 Figure 3 9. Inoculum with elevated nutrients d ss odc2 penetration efficiency. Leaves were sampled at 24 hpi , cleared and stained with trypan blue for observation .

PAGE 108

108 Figure 3 10. Inocul um with elevated nutrient improved compound appressoria formation but not penetration of the s s o dc2 mutant . Leaves were sampled 24 hpi , cleared , and stained with trypan blue. A) WT, PDA mycelia plug. B) s s o dc2 s o dc2 , 2x PDA mycelia plug. Arrowheads point toward compound appressoria. Scale bars represent 1 mm.

PAGE 109

109 Figure 3 1 1 . Quantification of oxalic acid accumulation in cultures. A) PDA medium. Six 5 mm diameter plugs located at even space intervals between the inoculation site and the infection front were pooled together as one sample. B) Stationary PDB medium. For A and B, the bar plots represent means + standard deviations of three independent biological replicates. Bars with different letters are statistically different (p<0.05) as determined by one way ANOVA (p<0.05) followed by a post hoc Tukey HSD analysis. Ect: ectopic, Com: complementation.

PAGE 110

110 Figure 3 1 2 . Quantification of oxalic acid accumulation in mycelia PDA plugs during compound appressorium development. For each time point, six plugs were pooled together as one sample and the bar plots represent means + standard deviations based on three independent replicates. Bars with different letters are statistically different (p<0.05) as determined by one way ANOVA (p<0.05) followed by a post hoc Tukey HSD analysis.

PAGE 111

111 Figure 3 1 3 . Ss odc2 gen e overexpression in S. sclerotiorum . A) Schematic representation of the gene overexpression cassette. B) Accumulation of Ss odc2 transcripts in the vegetative hyphae of the WT and overexpression strain (oliC odc2) . C) Oxalic acid accumulation kinetics in P DB shake culture. The bar plots represent means + standard deviations based on three independent replicates. D) Oxalic acid degrading activity assay. O xalic acid was added to 100 µ L protein extract to a final concentration of 10 mM; after 30 min incubation , ox alic acid level was qualitatively indicated by the decrease in blue color extent (based on an enzymatic oxalic acid quantification kit). For quenched control, 1 µ L 10 M NaOH was added prior to incubation .

PAGE 112

112 CHAPTER 4 I DENTIFYING GENES REGULATING Sclero tinia sclerotiorum VIRULENCE AND DEVELOPMENT AL PROCESSES BY Agrobacterium tumefaciens MEDIATED T DNA INSERTIONAL MUTAGENESIS Introduction The Ascomycota fungus Sclerotinia sclerotiorum (Lib.) de Bary is a devastating and cosmopolitan necrotrophic fungal pl ant pathogen which caus es diseases defined by water soaked or dry lesions covered with white fluffy hyphae . It infects over 400 plant speci es, among which are many important crops (legumes, sunflowers, canola), vegetables and ornamentals; each year this pathogen generates an estimated economic loss of multi million dollars in the U.S. ( Bolton et al. , 2006 ) . Due to the quantitative nature of s clerotinia disease resistance, limited success has been achieved in breeding resistant cultivars, which further contributes to the economic damage s ( Peltier et al. , 2012 ) . A better unde rstanding of its pathogenic and development al processes is critical for designing novel and efficient disease management strategies. The infection of S. sclerotiorum invo lves the sequential differentiation of infection structures including compound appressoria, subcuticular infectious hyphae and ramifying hyphae which spread both inter and intra cellularly ( Lumsden & Dow, 1972 ) . S. sclerotiorum is a necrotrophic fungus, the infection of which has been implicated to largely depend on the secretion of oxalic acid (OA) ( Maxwell & Lumsden, 1970 ; Marciano et al. , 1983 ; Godoy et al. , 1990 ) and cell wall degrading enzymes (CWDEs) ( Marciano e t al. , 1982 ; Marciano et al. , 1983 ) . Recent studies, however, suggest that the successful infection of S. sclerotiorum requires an act ive suppression of host defense s, a regulation of host redox stat us and a regulation of host cell death

PAGE 113

113 ( Williams et al. , 2011 ; Kabbage et al. , 2013 ; Zhou et al. , 2013 ; Zhu et al. , 2013 ) . Thus S. sclerotiorum interacts with its hosts more nuancely than previously expected. Via gene disruption or gene silencing, genes involv ed in pH or cAMP dependent signaling pathways ( Rollins, 2003 ; Jurick & Rollins, 2007 ) , redox regulation and oxidative stress tolerance ( Kim et al. , 2011 ; Veluchamy et al. , 2012 ; Xu & Chen, 2013 ) , compound appressorium development ( Li et al. , 2012 ; Xiao et al. , 2013 ) , and xylan hydrolysis ( Yajima et al. , 2009 ) have been determined to contribute to S. sclerotiorum infection. Compound appressoria (CA) are hyphal tip derived multicellular penetration structures differentiated on the cuticle surface , through which S. sclerotiorum penetrates the cuticle and establishes early infection. CA are formed via the serial recurrent events of hyphal tip growth retardation, swelling, and subsequent bi furcation ( Abawi, 1975 ; Tariq & Jeffries, 1984 ) . CA are indeterminate structures and can have a very high s tructure complexity, reaching several millimeters in size and including within it thousands of aligned hyphal tips. Besides cuticle surface, CA formation can also be induced via contact with artificial hard and hydrophobic artificial surfaces (e.g. microsc ope cover slips, petri plates, parafilm). Nutrients ( Cruickshank & Wade, 1992 ) , surface h ardness ( Tariq & Jeffries, 1984 ) , cAMP signaling pathway and cellular redox status ( Jurick & Rollins , 2007 ; Li et al. , 2012 ) , and calcium signaling ( Xiao et al. , 2013 ) have been shown to regulate CA development. Sclerotia play a central role in the S. sclerotiorum disease cycles. These structures can remain viable in soil for multiple years and their carpogenic germination can release tens of millions of ascospores to serve as the primary inoculum source in most infections. OA, ambient pH, ox idative stress, cAMP and MAPK dependent

PAGE 114

114 signaling pathways can all regulate s cleroti um development ( Erental et al. , 2008 ) . Disruption of the ambient pH responsive transcription factor Ss Pac1 causes an aberrant scleroti um formation ( Rollins, 2003 ) ; disruption of a putative Ca 2+ binding protein Ss Caf1 causes the formation of looser and lar ger sclerotia which failed to produce apothecia ( Xiao et al. , 2013 ) ; silencing of the ERK type mitogen activates protein kinase Ss Smk1 blocked sclerotium maturation ( Chen et al. , 2004 ) . Insertional mutagenesis is a powerful forward genetic tool for fungal molecular genetic research es , with the commonly used approaches including r estriction enzyme mediat ed integration (REMI), transposon based methodologies, and Agrobacterium tumefaciens mediated transformation (ATMT). Among them, ATMT has been most widely used due to its high efficiency, versatility of transformable tissues, and relatively simple DNA inte gration pattern. ATMT has been successfully applied to the identification of pathogenicity related genes among Magnaporthe grisea ( Jeon et al. , 2008 ) , Botrytis cinerea ( Giesbert et al. , 2011 ) , Verticillium dahlia ( Maruthachalam et al. , 2011 ) , and many others phytopathogenic fungi . O ur laboratory has generated a T DNA insertion mutant library with the Agrobacterium strain AGL 1 harboring the binary vector pBHT1 ( Mullins et al. , 2001 ) . The library consists of 1134 transformant s and has been successfully utilized for the identification of genes regulating apothecia development. The objective of this study was to take advantage of this library to identify genes regulating the S. sclerotiorum pathogenesis , and its CA and sclerotium development . Using high throughput assays, we obtained a variety of transformants with virulence or developmental defect ; using TAIL PCR (Thermal Asymmetric Interlaced PC R), a hypothetical protein (SS1G_10409)

PAGE 115

115 conserved across filamentous fungi was identified to contribute toward virulence and the development of scleroti a and CA; in addition, a protein potentially involved in pre mRNA G_01691) was identified as a regulator of radial growth, OA accumulation, virulence , and the development of scleroti a and CA. Taken together, this study improved the understanding of the S. sclerotiorum pathogen ic process and identified a stock of inserti onal mutants which would aid further studies into the virulence and developmental processes of this devastating pathogen. Materials and Methods Strain maintenance and plant growth The S. sclerotiorum 1' was maintained and propag ated on potato dextrose agar (PDA) (Difco, Franklin Lakes, NJ) medium at room temperature. The T DNA insertion transformants were maintained and propagated on PDA medium supplemented with 100 µg/mL hygromycin. Desiccated sclerotia or mycelia colonized fil ter papers were established for all T DNA insertion transformants and placed in paper envelopes at 20 °C for long term storage. C ommon bean ( Phaseolus vulgaris cv. Bush Blue Lake 47) and soybean ( Glycine max [L.] Merr. cv. Harosoy) plants were grown in the greenhouse with natural sunlight and temperatures ranging between 15 °C and 26 °C . To activate the stored T DNA insertion mutants, sclerotia or filter paper stocks were inoculated in 2 mL eppendorf tubes containing 0.5 mL PDA medium supplemented with hygro mycin to a final concentration of 100 µg/mL. After one week, vegetative hyphae from most stocks would have spread across the entire tube; slices of PDA agar covered with vegetative hyphae were cut out of the eppendorf tube and inoculated onto PDA medium su pplemented with 100 µg/mL hygromycin. Mycelia agars cut from the

PAGE 116

116 expanding edge of fungal colonies were used for plant inoculations and developmental assays. Phenotypic assays Radial growth assay was carried out on PDA medium. Mycelia plugs were inoculate d on 9 cm wide PDA medium . Three independent replicates were carried out for each isolate. The radial diameters were recorded at 12 h time intervals. Diameter data collected between 0 h and 48 h were used to obtain the growth slope. The relative growth rat e s of the mutant s w ere calculated as the ratio of the growth slope relative to the WT. Colony morphology and sclerotium development phenotypes were observed after 10 days of vegetative growth on PDA plate. Compound appressoria ( CA ) formation assay was cond ucted by inoculating mycelia plugs obtained from the growing edge of colonies on parafilm and kept inside moisture chamber for two days at room temperature (Figure 4 2). Isolates defective or significantly reduced in CA development would be distinguished b y the lack of macroscopic ring layer structure s surrounding mycelia plugs . Celery stalks purchased from the local grocery store were used for the primary virulence assay. Firm, fresh and healthy celery stalks were washed with tap water and cut into 3 4 cm long sections; sections without mechanical wounding were selected for inoculation. The celery stalk sections were arranged in 9x12 arrays within individual moisture chambers (Figure 4 1). For each isolate, three inoculation replicates were done on neighb oring celery chunks so that each moisture chamber contained inoculations from 35 T DNA transformants and one WT isolate. To inoculate the celery, m yceli a plug s from the actively growing PDA culture edge s were carefully placed on the celery surface to avoid physical damage. Inoculated celery chunks were kept inside the

PAGE 117

117 moisture chamber at room temperature for three days before the disease lesions were photographed and scored. For disease scoring, disease lesions were designated as normal (N, lesion expands i ndistinguishably from the WT), slower (S, lesion expands at a slower rate compared with the WT), limited (L, lesion expands slightly but then stops), and very li mited (V, no visible lesion or small lesion). Isolates showing virulence defect in at least two out of three replicates were selected and further tested in two additional independent celery screening experiments with the same inoculation scheme. Isolates consistently showing virulence reduction among the three experiments (Table C 1) were selected a common bean. Three week old common bean plants w ere used for virulence assays . Inoculation was carried out on both detached primary leaves and detached leaf petioles. For leaf inoc ulation, leaves were directly inoculated (unwounded inoculation) or inoculated through a 0.5 cm incision made with scalpel just prior to inoculation (wounded inoculation). F or each isolate , t hree replicates were carried out for the unwounded inoculation an d two replicates were carried out for the wounded inoculation. For the leaf petiole inoculation, mycelia plugs were directly placed on top of the petioles in the midway. For each isolate, four independent replicates were carried out. For leaf and leaf peti ole inoculations, lesions were photographed two days post inoculation and the lesion areas or lesion lengths were determined with Spot Advanced Software program (Diagnostic Instruments, Sterling Heights, MI). Relative lesion sizes for leaf inoculations wer e square root transformed to allow for comparison with the relative growth rates and

PAGE 118

118 based on a consistency of virulence reduction (less than 80% of the WT) among a ssays combined with a ratio score of less than 1 for relative virulence over relative growth rate. OA accumulation was either directly measured with the enzymatic assay kit (Sigma, St. Louis, MO) or indirectly assayed by monitoring growth medium pH change . T he b romophenol blue pH indicator ( chang ing color from violet to yellow when pH drops from above 4.6 to below 3.0 ) was used to monitor the medium pH acidification, t ransformants were inoculated on PDA medium supplemented with 50 mg/L bromophenol blue wit h the initial pH adjusted to 7.0 with KOH. Mutants deficient in OA accumulation would be indicated by a blue medium color or a slower pace in blue to yellow transition . Nucleic acid manipulations T DNA insertion copy numbers were determined by Southern blo t analysis. Extracted genomic DNA was digested with Bgl II (a restriction enzyme not cutting the T DNA), separated by electrophoresis in agarose gel and blotted onto nylon membrane (Roche Diagnostics, Indianapolis, IN). H ybridization was carried out with a probe encompassing the hygromycin phosphotransferase ( hph ) coding region labeled with digoxigenin (DIG) using the DIG DNA Labeling and Detection Kit (Roche Diagnostics, Indianapolis, IN). A reported TAIL PCR protocol was followed for identifying the ge nomic DNA sequences flanking the T DNA border ( Liu & Chen, 2007 ) . Three rounds of PCR reactions were carried out, and the PCR reaction setu p and the thermal conditions were the same as reported ( Liu & Chen, 2007 ) . In the first round amplification, the arbitrary primer LAD1 2 [5

PAGE 119

119 times and used as template for a secondary round amplificat ion where primer pair AC1 ACGATGGACTCCAGAG RB2 ACGATGGACTCCAGAG Fix LB2 and Fix RB2 contained a pre fixed tag sequence identical t o AC1 (bold). With such primer design, short PCR products would be prone to form hairpin structures due to sequence complementation, which would selectively suppress their amplification. The second round PCR product was diluted 10 times and used as a templ ate for a third recovered with the Genclean ® kit (M P Biomedicals Corporate, Santa Ana, CA) and cloned into the pGem T vector (Promega, Madison, WI) for DNA sequencing. Recovered DNA sequences were compared with the S. sclerotiorum genome sequence (Broad institute, http://www.broadinstitute.org/annotation/g enome/sclerotinia_sclerotiorum/MultiHome.ht ml) to determine the T DNA integration sites. BLAST searches against the GenBank database were used to infer gene functions. Data analysis Li near regression w as used for calculating the coefficient of determinatio n ( R 2 ) values . Average values in relative growth rates and relative virulence were used. T he dise in celery infection were arbitrarily transformed into , the average values ov er the nine assays

PAGE 120

120 were used for subsequent correlation analysis . For correlation analysis involving celery , several mutants were excluded , either due to incomplete data ( AT18, AT267, AT529, AT891 and JAT190 ) or being an obvious outlier ( AT343 ) . Results P reliminary CA formation assay and virulence screening on celery Southern blot analysis indicated that single copy of T DNA integration occurred most commonly among the T DNA transformants, while double integration and no integration occurred infrequently (Figure C 1). The different sizes of the hybridized fragments indicated random T DNA integration events. 1111 out of 1134 T DNA transformants grew from stocks. 1103 transformants were screened preliminarily , among which 89 isolates showed either reduced l esion size (85 in total) or inefficient CA development (25 in total); 21 isolates showed defects in both phenotypes. These 89 isolates, together with 8 isolates not screened preliminarily , were further tested for their virulence and appressorium formation phenotypes in two independent rounds of experiments. Among the 97 isolates characterized, two isolates showed no virulence defect in two independent experiments ; 49 isolates showed virulence defects in one out of three or one out of two experiments; 18 iso lates showed virulence defect in two out of three experiments; 28 isolates showed virulence defects in three out of three or two out of two experiments. For the appressorium formation phenotype, 56 isolates showed no appressorium formation defect in any ex periment; 13 isolates showed appressorium formation defect s in one out of three or one out of two experiments; 10 isolates showed appressorium formation defect s in two out of three experiments; 18 isolates showed appressorium formation defect s in three out of three or two out of two experiments. Based on the preliminary

PAGE 121

121 screening, 53 isolates were selected as phenotypic assays (Table C 1). Virulence assay on common bean defective ca assayed on detached common bean leaves with both unwounded and wounded inoculations, and on bean petioles with unwounded inoculation (Table C 2) . Their radial growth rates on PDA medium were also measured to determine whether the reduction i n virulence could be simp ly attributed to a growth defect. In unwounded leaf inoculations, 20 isolates showed relative lesion diameters (calculated as square root of the lesion size) less than 60% of the WT, 22 isolates between 60% and 90%, and 11 isolates more than 90%. In wounded leaf inoculation, 18 isolates had lesion diameters less than 60% of the WT, 20 isolates between 60% and 90%, and 15 isolates more than 90%. In the petiole inoculation, 19 isolates had lesion lengths less than 60% of the WT, 18 isolates between 60% and 90% , and 16 isolates more than 90%. The relative virulence of the based on the three virulence assay s (bean leaf unwounded, bean leaf wounded, bean petiole) were strongly correlated , with the R 2 val ues around 0.8. T he correlation s between the relative radial growth and the relative virulence based on the three assay methods w ere moderate but significant (p<0.001) , with R 2 values between 0.4 and 0. 5 (Figure C 2). Virulence level correlation of the rulence between celery and common bean hosts w ere also moderate but significant (p<0.001), with R 2 values for bean leaf unwounded, bean leaf wounded, and bean petiole being 0.53, 0.56 and 0.63 , respectively (Figure C 3). Relative viru lence on celery and relative growth rate shows a low level correlation, with a R 2 value of 0.26 (Figure C 3).

PAGE 122

122 Sixteen showed significantly reduced virulence (80% or less than the WT among all assays on bean plants ) , and showed more severe virulence defect than radial growth defect (Figure 4 3). Among t he other 37 isolates , 9 isolates showed similar or greater growth reduc tion relative to virulence (AT120, AT229, AT345, AT450, AT512, AT573, AT785, JAT30, JAT96), 28 isolates exhibited a virulence reduction to a small extent (less than 20%) . virulence have pleiotropi c effects (Table 4 1) . Among the 16 isolates, AT78, AT81 and AT923 were the only isolates showing wild type like phenotypes for radial growth, sclerotia production, compound appressoria (CA) development, and oxalic acid (OA) accumulation. Six isolates (AT1 8, AT102, AT185, AT196, JAT203, JAT208) showed severe growth defects (relative growth rate less than 60% of the WT); 11 isolates (AT18, AT63, AT67, AT76, AT172, AT185, AT196, AT258, AT815, JAT121, JAT203) showed inefficient or no CA development in at least two independent assays (Figure C 4); three isolates (AT67, AT185, AT258) exhibited sclerotia differentiation defects (Figure C 5), two isolates (AT185, AT258) showed reduced medium acidification potential most likely due to decreased OA accumulation (Figu re C 7, C 8). In ensuing experiments, mitotic instability was observed for AT172 and AT185 (designed AT172 m and AT185 m ). While AT172 produced both OA (indicated by medium acidification assay) and sclerotia, AT172 m produced neither. AT185 was defective in b oth OA production and the development of CA and sclerotia while AT185 m reverted to wild type in all phenotypes .

PAGE 123

123 Mutants defective in compound appressori um (CA) development Four independent CA formation assays were carried out. Overall, 30 isolates showed a CA deficiency (being either inefficient or unable to differentiate CA) in at least two independent experiments (Figure C 4). Among them, 12 isolates (AT18, AT63, AT67, AT120, AT172, AT185, AT196, AT201, AT345, AT512, JAT190, JAT203) showed defects in al l assays. Seven isolates (AT267, AT529, AT545, AT815, AT831, AT891, JAT45) showed defects in two out of three or three out of four assays, AT815 showed wild type like phenotype in the first assay and showed a defective phenotype in all ensuing assays; the other six isolates showed defective phenotype in the first two or three assays, but showed wild type like phenotype in the last one. An additional 11 isolates (AT34, AT76, AT229, AT258, AT343, AT365, AT563, AT573, AT709, JAT96, JAT121) showed defects in tw o out of four assays. Among the 12 isolates showing appressoria formation defects in all assays, nine isolates (AT18, AT63, AT67, AT120, AT172, AT185, AT196, AT512, JAT203) showed significantly reduced virulence on common bean while AT345, AT201, and JAT1 90 did not (Table C 2). Microscopic examination indicated that all 12 isolates still differentiated CA at low efficiency on parafilm, and the appressoria appearance did not differ significantly from the WT (data not shown). On onion epidermal strips, CA me diated cuticle penetration was observed for all 12 mutants at low frequency, indicating the functionality of the appressoria structures they differentiated (data not shown). In subsequent experiments, AT512 and JAT190 showed mitotic instability in their ap pressoria formation phenotype, both of which switched back to appressoria production as efficiently as the wild type. Among the 12 isolates, AT67, AT120, AT185,

PAGE 124

124 and AT258 were also defective in sclerotia formation, indicating common genetic factors regulat ing these two developmental processes were disrupted in the mutants. Mutants aberrant in scleroti um development or plate morphology On PDA medium, 17 T DNA insertion mutants were aberrant in scleroti um development or plate morphology (Figure C 5). AT67, AT185, AT226, and AT258 could not differentiate sclerotia initials ; AT258, but not the other three isolates, showed very fluffy aerial hyphae at the plate edge. AT343 and AT365 differentiated sclerotia initials abundantly, however they could not mature fur ther; AT343 and AT365 also showed increased pigment deposition on the PDA medium. JAT165 could differentiate distinctive sclerotia structures, but many of them failed to mature and melanize. AT115, AT545, AT575, and JAT208 formed irregular and mis shaped s clerotia. AT913 produced sclerotia smaller in size, but produced them more abundantly; on PDA medium AT913 also differentiated minute melanized hyphal aggregates; microscopic observation indicated that these aggregates were formed by recurrent events of hy phal tip branching and growth reorientation (Figure C 6). AT213 differentiated sclerotia similar in appearance as the wild type, however the sclerotia attached firmly within PDA medium after sclerotium maturation. Mutants showing aberrant plate morphology (AT2 and AT196), increased (AT196, AT343, AT394, AT913) or decreased (AT201) pigment accumulation were also identified. TAIL PCR Seventeen TAIL PCR amplification products from 12 mutants (JAT208, AT18, AT185, AT63, AT172, AT67, AT815, JAT121, AT258, AT201 , AT365, JAT96) of different phenotype categories were cloned and sequenced, among which 1 0 corresponded to T DNA derived sequences, 7 corresponded to T DNA flanking genomic

PAGE 125

125 DNAs. The 1 0 T DNA derived sequences were all made up of left border (LB) and righ t border (RB) sequences joined head to tail, a T DNA arrangement pattern in accordance with multiple tandem T DNA integrations at the same locus. The 7 flanking genomic sequences included the LB and RB flanks of AT67 and AT258, and the LB flanks of AT18, J AT208 and AT185 (Figure 4 4; Table 4 2). The LB and RB insertion sites of AT67 were both within the coding region of SS1G_10409, separated by 30 bp, suggesting a small genomic DNA deletion event. This gene is predicted to encode a hypothetical protein cont aining an AIM24 domain presumably functioning in mitochondria biogenesis (Figure 4 5). The LB flank insertion site of AT185 was within the coding region of SS1G_01691, which encodes a subunit component of the mRNA cleavage and polyadenylation specificity f actor complex. The other four T DNA derived sequences located within the intergenic regions and the genes functionally affected could not be conclusively determined (Table 4 2). The LB and RB flanks of AT258 were in the middle regions of supercontig 7 and supercontig 10 respectively, indicating chromosome rearrangement in association with T DNA integration . AT67 did not form sclerotia, was inefficient in CA development, and sh o wed dramatically reduced virulence on celery, common bean and soybean hosts (Fig ure 4 5). In accordance with the observed sclerotia defective phenotype of AT67, SS1G_10409 transcripts accumulation was highly up regulated during sclerotial development as indicated by an enrichment of EST sequences (Broad Institute reference). In PDB sh ake culture, AT67 accumulated OA to a level slightly lower than the WT (1.5 to 2 fold lower, Figure A 13), suggesting the virulence defect may be partially attributed to an OA accumulation deficiency.

PAGE 126

126 The SS1G_01691 gene disrupted within the AT185 transfo rmant encodes a homolog of the Saccharomyces cerevisiae Pta1 protein. Pta1 is a subunit component of the cleavage/polyadenylation factor (CPF) 3' end processing complex. As a scaffold protein, Pta1 recruits other subunits to form the CPF complex which cont ributes toward pre mRN alternative splicing events ( Ghazy et al. , 2009 ; Seoane et al. , 2009 ) . Thus SS1G_0169 is an important component of the post transcriptional regulation network of S. sclerotiorum . Compared with AT67, AT185 exhibited a more dramatic defect o n radial growth, compound appre ss orium and sclerotium development, OA accumulation, and virulence (Figure 4 6). Discussion Agrobacterium mediated random insertional mutagenesis is a forward genetic approach widely used for identifying virulence factors among fungal plant pathogens. In this study, we applied this technique to the devastating broad host range necrotrophic pathogen S. sclerotiorum , with the aim of identifying fa ctors regulating its virulence and development al processes . To improve the screening efficiency for de fective based virulence assay system , which is advantageous for the immediate availability of plant materials, and the convenience of carrying out high throughput screening within a limited space. With this approach, w e screened over one thousand T DNA transformants in less than two months and identified 53 . Out of the 53 isolates, up to 20 isolates showed lesion diameter less than 60% of the WT on an independent h ost common bean, and up to 42 isolates showed lesion diameters less than 90% of the WT. Although the physiological status of the purchased celery stalks is

PAGE 127

127 intrin sic ally variable ( due to variations associated with growth, storage, transportation , mechanica l wounding and so forth), a relatively good correlation ( R 2 value larger than 0.5) was observed between virulence assay on celery and common bean hosts. Thus , the celery stalk infection assay developed in this study is a highly efficient and reliable appro ach for virulence screening . By combin ing with virulence assay on a secondary host, virulence defective mutants can be rapidly identified. In this study, SS1G_10409 and SS1G_01691 were identified as factors regulating S. sclerotiorum virulence and developm ent . SS1G_10409 is a hypothetical protein with an AIM24 domain, which has been associated with mitochondria biogenesis based on gene knock out analysis in yeast ( Hess et al. , 2009 ) . SS1G_10409 protein homologs can b e identified in both Ascomycota and Basidiomycota fungi, indicating a conserved biological function. In contrast , SS1G_10409 protein homolog was not found among plants and animals, indicating a possibility of fungicide development targeting at this protein . Although not experimentally tested, SS1G_10409 likely contributes toward the developments and virulence of S. sclerotiorum through regulating mitochondrial biogenesis or mitochondria associated activities. In filamentous fungi, mitochondrial activities h ave been shown to contribute significantly toward drug tolerance and virulence, and have been linked with the regulation of cell wall and cell membrane integrity, and the regulation of oxidative stress responses ( Shingu Vazquez & Traven, 2011 ) . In the phytopathogen Ustilago maydis , disruption of a hydroxyacyl coenzyme A dehydrogenase gene had1 oxidation and corresponding ly causes defects in yeast/filamentous growth transition and virulence ( Kretschmer et al. , 2012 ) . In S. sclerotiorum , the mitochondria localized tricarboxylic acid cycle (TCA) may

PAGE 128

128 contribute significantly toward the generation of oxaloacetat e, a metabolic precursor for OA biosynthesis ( Liberti et al. , 2013 ) . Compared with WT, AT67 showed a 1.5 to 2 fold reduction in in vitro OA accumula tion (Figure C 13), and showed enhanced sensitivity to osmotic stress and oxidative stress (Figure C 14). The relevance of these phenotypes with mitochondrial function is to be further determined via gene disruption analysis. E merging evidence ha s suggeste d that regulation at the RNA level represents a layer of fine tuned regulation contributing to ward plant pathogen interactions ( Staiger et al. , 2013 ) . In Magnaporthe oryzae , a fungus specific RNA binding protein RBP35 regulates both its devel opment and virulence ( Franceschetti et al. , 2011 ) . RBP35 is a co mponent of the protein complex contributing toward pre mRNA cleavage and polyadenylation machinery. Here, SS1G_01691, a protein involved in pre mRNA cleavage and polyadenylation, contributes significantly toward the radial growth, the development of sclero ti um and CA, the accumulation of OA, and the virulence of S. sclerotiorum . By comparing transcript accumulation levels of the coding sequence and shown to affect the pre mRNA 3 Rapamycin (TOR) signaling pathway, and secreted proteins with domains related to effector functions in M. oryzae . A similar experimental strategy could be employed for identifying genes under the post transcri ptional regulation of SS1G_01691. In accordance with the conclusion that OA is functionally critical in regulat ing S. sclerotiorum virulence and scleroti um development (Chapter 2), the OA deficient mutants AT185, AT208, and AT172 m were all defective in vir ulence and sclerotia formation; in addition, AT208 and AT172 m showed fluffy hyphae growth at the plate

PAGE 129

129 induced OA ( Godoy et al. , 1990 ) . AT208 and AT172 m produced restricted dark green lesions on detached soybean leaves, similar to those produced by the ss oah1 mutant induced OA requirement of OA accumulation for S. sclerotiorum pathogenic and developmental processes. In contrast , the identification of a variety of isolates showing sig nificant virulence reduction despite relatively normal OA accumulation indicate s that factors other than OA also contribute significantly toward S. sclerotiorum pathogenesis (Figure C 13). These isolates would be valuable experimental materials for further dissecting the virulence mechanisms of S. sclerotiorum . Mitotic instability and the low efficiency in recovering T DNA flank sequences are two technical challenges encountered in this study. One major factor underlying mitotic instability should be the h eterogenic status of the T DNA isolates. Germinating ascospores, bi nucleate in nature, were used as the starting material for ATMT. The ATMT transformants were directly used for phenotypic assays without being hyphal tipped for increased genetic purity. T hus, most transformants should harbor a mixture of transformed and untransformed nuclei. Although the transformants were always maintained on hygromycin selective PDA medium, transformed nuclei were still likely to loss during the mitotic division . During the experiment assays, phenotype reversion was observed with AT185 (CA, sclerotia, OA production), AT512 (CA), JAT190 (CA), AT545 (CA), AT831 (CA), JAT45 (CA), AT267 (CA), AT529 (CA) and AT891 (CA). The maintenance of hygromycin resistance of these isolate s demonstrated the preservation of transformed nuclei. Likely the mutant phenotype appearance requires a threshold

PAGE 130

130 ratio of transformed nuclei. In such circumstance, the heterogenic nature of these isolates should not affect the recovery of T DNA flanking sequences despite their phenotypic reversion, as being demonstrated with the AT185 transformant. Mitotic instability of some mutants, however, seems to be independent of phenotypic reversion. AT172, for instance, switched from a sclerotia and OA producing isolate to an isolate defective in producing either of them. Epigenetic regulation or chromosome rearrangement events may have caused the observed phenotypic change. However, such patterns of phenotype switching occurred at a low frequency as AT172 was th e only transformant observed with such behavior. The low efficiency in recovering T DNA flanking genomic sequences is another challenge faced in this study. Of the 18 flanking sequences recovered, over 60% were T DNA derived vector sequences. In all cases, T DNA sequence going out from one border joined together with T DNA sequence from the other border in a tandem repeat manner. Likely multiple T DNA copies were integrated at the same genomic locus. In the LB flank sequence recovered from AT185, the genomi c DNA separated from the LB T DNA sequence by a partial RB sequence (171 bp). In addition, incompatible LB and RB flanks were recovered from the AT258 transformant. In our independent experiment aimed at identifying factors regulating apothecia development with the same T DNA insertion library, a transformant was found to incorporate over 10 kb of vector DNA sequence outside of the T DNA region, which replaced an endogenous genomic DNA sequence of over 3 kb. Taken together, complex DNA rearrangement events at the T DNA integration sites occur commonly during Agrobacterium mediated transformation of S. sclerotiorum . Complicated T DNA integration patterns such as sequence deletion

PAGE 131

131 or refilling, chromosome translocation or recombination, and tandem or inverse r epeats of T DNA sequence at the integration site have been reported to occur at low frequency in other filamentous fungi such as B. cinerea ( Giesbert et al. , 2011 ) and M. oryzae ( Choi et al. , 2007 ; Li et al. , 2007 ) , and to occur at relatively higher frequency in plants ( Forsbach et al. , 2003 ; Clark & Krysan, 2010 ) . The genomic complexity associated with T DNA integration events in S. sclerotiorum indicates that it is important to use novel strategies for efficient recovery of T DNA flanking sequences. In sum, a variety of T DNA transformants showing defect in virulence, or the development of sclerotia or compound appressoria were identified in this study. These mutants would be valuable for understanding the molecular regulation of S. sclerotiorum pathogenesis and development. As the cost of genomic sequenci ng continues to drop, a sequencing based strategy will be a reasonable approach for more fully characterizing the basis of the mutant phenotypes described here.

PAGE 132

132 Table 4 1. Virulence, growth, and developments of the T DNA transformants exhibiting virulenc e defects. Isolate ID Virulence on celery a Virulence on bean leaf (unwounded) b Relative growth c CA formation d Scleroti um formation AT18 NA | VVV | VVV 0.12 ± 0.10 0.48 0/3 Normal AT63 SSS | VVV | VVL 0.23 ± 0.04 0.68 0/4 Normal AT67 LLV | LLL | SLL 0.52 ± 0.02 0.83 0/4 Not formed AT76 VVV | VVV | SLL 0.61 ± 0.05 1.16 2/4 Normal AT78 VVV | VVV | SSS 0.53 ± 0.03 1.08 4/4 Normal AT81 LLL | NNN | LLL 0.45 ± 0.08 0.92 4/4 Normal AT102 VVV | VVV | VVV 0.16 ± 0.02 0.44 4/4 Normal AT172 e LLV| SSL | SSS 0.38 ± 0.09 0.70 0/4 Normal AT185 f VVV| VVV | LLS 0.13 ± 0.09 0.43 0/4 Not formed AT196 VVV | VVV | LLL 0.28 ± 0.02 0.51 0/4 Normal AT258 VVV | LVV | SSS 0.54 ± 0.01 0.78 2/4 Not formed AT815 NLL | SSS | SSS 0.46 ± 0.02 0.74 1/3 Normal AT923 N LL | LLL | NNN 0.52 ± 0.01 0.90 4/4 Normal JAT121 SSL | NNN | VVV 0.43 ± 0.01 0.63 2/4 Normal JAT203 VVV | VVV | VVV 0.00 ± 0.00 0.25 0/4 Normal JAT208 VVV | VVV | LLL 0.23 ± 0.04 0.50 4/4 Aberrant a Celery stalk virulence assay. For each isolate, th ree independent experiments (separated by vertical bars) were carried out and each experiment includes three inoculation replicates with the lesion scores indicated by letters . The lesions were scored based on a disease index system with the following cate gories : Normal (N, lesion expands indistinguishablly from the WT), slow (S, lesion expands at a slower rate compared to WT), limited (L, lesion expands slightly and then stops), and very limited (V, no visible lesion or small lesion) . NA: not assayed. b Re lative lesion diameters. Data represent means ± standard deviations based on three independent inoculation replicates. c Relative growth on PDA medium. Data represent calculations from three independent replicates d The number of experiments where the mu tants show normal CA and the total number of experiments (separated by slash) are given. ef Isolates with mitotically unstable phenotypes. AT185 m reverted to OA production, sclerotia and CA developments; AT172 m lost the ability to differentiate sclerotia.

PAGE 133

133 Table 4 2. Recovered genomic DNA sequences flanking T DNA insertions. All transformants contained single T DNA copies as determined by Southern blot analysis. LB: left border, RB: right border, ND: not determined. Isolate ID Position of the integratio n point a (LB/RB) Genes relative to the integration point b Tagged gene BLAST hit AT18 Supercontig15 : 992203 (+)/ ND LB: SS1G_10438, Unknown AT67 Supercontig15 : 902518 ( )/ Supercontig15 : 902548 (+) LB: SS1G_10409, coding region/RB: SS1 G_10409, coding region SS1G_10409 an AIM24 domain containing protein presumably associated with mitochondria biogenesis AT185 Supercontig2: 1593845 (+)/ ND LB: SS1G_01691, coding region/RB: ND SS1G_01691 mRNA cleavage and polyadenylation specificity fa ctor complex subunit AT258 Supercontig7: 205256 (+)/ Supercontig10 : 283015 (+) LB: SS1G_05685, SS1G_07629, 356 SS1G_07630, 303 Unknown JAT208 Supercontig3: 46123 (+)/ ND LB: SS1G_02131, Unknown a Su percontig positions are from the Broad Institute Genome annotation (http://www.broadinstitute.org/annotation/genome/sclerotinia_sclerotiorum/MultiHome.ht ml).The relative direction of the T DNA (LB/RB) to the integration point was marked with DNA is b G ene annotation s in < 1,000 bp distance of the integration point ar e listed. Relative locations of the genes to the integration points are downst ream of the stop codon the start codon ).

PAGE 134

134 Figure 4 1. Celery stalk virulence assay. A) Typical celery chunk appearances before (left panel) and three days post inoculation (right panel). B) Lesion scoring index . Lesions were scored at 3 dpi . Normal (N, lesion expands indistinguishablly from the WT), slow (S, lesion expands at a slower rate compared to WT), limited (L, lesion expands slightly and then stops), and very limited (V, no visible lesion o r small lesion).

PAGE 135

135 Figure 4 2. Compound appressoria (CA) formation assay. Top) Schematic representation of the CA induction process . Mycelia plug was directly placed on parafilm surface, which would induce the differentiation of a ring layer of cushion shaped CA by 2 dpi . Bottom) Typical CA formation assay results. Numbers represent T DNA transformants and red color designates transformants deficient in CA formation.

PAGE 136

136 Figure 4 3. on common bean . Relative growth rate values were calculated based on slopes of the growth curves at the linear region. Virulence assay was carried out on unwounded bean leaves (n=3), wounded bean leaves (n=2), and on bean petioles (n=4). T he relative virulence values calculated from l esion lengths (bean petiole) and square root transformed lesion sizes (bean leaves, wounded bean leaves) are shown . Isolates are ranked based on their relative virulence in unwounded bean leaf inoculation .

PAGE 137

137 Figure 4 4 . DNA sequence arrangements at recovered T DNA integration sites (LB : left border; RB : right border ). T DNA derived sequences are in uppercase , genomic DNA sequences are in green lowercase , t he inverse repeat sequences at the T DNA borders are in red . O mi tted nucleotides are shown in numbers.

PAGE 138

138 Figure 4 5. Phenotypes of the AT67 transformant. A) plate morphology. B, C, D) compound appressori um development and virulence assays (celery, 3dpi; common bean, 2dpi; soybean, 3dpi) st nd rd th four independent compound appressoria assays . In the celery infection, the WT had fully coloniz ed the celery chunk (not shown) . E) T DNA integration event. W: wounded.

PAGE 139

139 Figure 4 6. Phenotypes of the AT185 transformant. A) PDA colony morphology. B, C) compound appressori um development and virulence assays (celery, 3dpi; common bean, 2dpi) nd rd th compound appressoria assays . In the c eler y infection, the WT had fully colonized the c elery chunk (not shown) . D) AT185 could not cause medium acidification (indicated by blue to yellow color change). E) T DNA integration event . W: wounded.

PAGE 140

140 CHAPTER 5 RESEARCH SUMMARY Sclerotinia sclerotiorum (Lib.) de Bary is a broad host range necrotro phic fun gal plant pathogen with a world wide distribution. It causes severe economic losses on a variety of important crops (legumes, sunflowers, canola), vegetables and ornamentals. In the field, diseases caused by this pathogen are challenging to control, which emphasizes the importance of an improved understanding of its pathogenic biology. The overall objective of this study was to characterize the genetic regulation of S. sclerotiorum pathogenesis, with a particular emphasis on factors regulating OA met abolism. While OA accumulation has been long implicated as critical for S. sclerotiorum pathogenesis ( Godoy et al. , 1990 ) , it is unequivocally demonstrated in this study via Ss oah1 gene mutagenesis. Ss oah1 gene deletion abolishes OA accumulation both in vitro and in vivo , and causes a severe virulence reduction on a range of p lant hosts. These defects could be completely restored via genetic complementation. Thus OA biogenesis in S. sclerotiorum is derived through OAH mediated hydrolytic cleavage of oxaloacetate , similar as in other Ascomycota fungi . I t is noteworthy , however, that the ss oah1 mutant retains a low level of virulence on different hosts, indicating that OA accumulation is not the sole determinator of pathogenicity or host specificity, and that facto rs independent of OA contribute to the establishment of basic hos t pathogen compatibility. Neutral pH induced OA accumulation has been reported in several fungal species including S. sclerotiorum ( Maxwell & Bateman, 1968 ; Kubicek et al. , 1988 ; Rollins & Dickman, 2001 ) . Ss oah1 has been shown to be induced by neutral pH through the ambient pH signaling regulator PacC. In terestingly, PacC binding sites are

PAGE 141

141 oahs including Ss oah1 , as well as many putative Ascomycota oah orthologs, suggesting the conservation of PacC mediated activation of oah transcription in amient pH regu lation . OxDC mediated OA degradation also contributes toward S. sclerotiorum pathogenesis. Ss odc2 gene expression was strongly induced during compound ss odc2 mutants showed inefficient compound appressori um development and early infection establishment. It is to be further determined, however, by which mechanism Ss Odc2 contributes toward early infection establishment. Prior to this study, we hypothesized that OxDC activity regulates OA accumulation dynamics during S. sclerotiorum infection. However, Ss odc2 gene overexpression affec ts neither virulence nor in plant a OA accumulation although it significantly reduces OA accumulation in in vitro PDB shak e culture. Very likely Ss Odc2 mediated OxDC activity regulates OA accumulation within a micro rather th an a macro environment. Ss Odc2 mediated OA degradation activity is localized within the insoluble fraction of hyphal protein extract s , strongly suggesting a cell wall localization, which would be in accordance with a self protective function. However, Ss odc2 gene expression is not subjected to regulation by either low pH or exogenous OA, nor was altered OA sensitivity observed with the Ss odc2 gene overexpression strain or the Ss odc2 gene deletion mutants. D eletion of the Ss odc1 gene, the expression of which is relatively higher in vegetative hyphae compared with Ss odc 2 , also d id not affect OA stress sensitivity . OxDC activity thus seems to play a minor role in regulating OA stress tolerance. Besides stress tolerance, OxDC activity may also regulate nutrient absorption or pH signaling, both likely important regulators o f

PAGE 142

142 compound appressorium development. In this study, inoculum with elevated nutrient allow ed for abundant compound appressoria formation by the ss odc2 mutants , but not efficient primary lesion establishment, indicating a penetration defect associated with appressoria formed by ss odc2 mutants. Besides functional characterization of individual genes, the genetic regulation of S. sclerotioru m pathogenesis was also addressed via Agrobacterium mediated T DNA insertional mutagenesis. A high throughput celery stalk virulence assay was developed to identify T DNA transformants with virulence defects. Combined with a virulence assay on a secondary host ( common bean ) , 16 virulence defective mutants were identified from a collection of 1 , 111 transformants. A T DNA insertion in a gene encoding mitochondrial biogenesis related protein, being conserved across Ascomycota and Basidiomycota fungi, was defe ctive in compound appressorium development, sclerotium development and virulence. A ddition al T DNA insertional mutants with compound appressorium or sclerotium developmental defect s were also identified. T ogether, the mutants identified in this study are v aluable resources for further stud ies on S. sclerotiorum pathogenic and developmental biology. The decline in genome sequencing cost make s high throughput genome sequencing a n alternative strategy for more efficiently identifying and characterizing T DNA i nsertion sites which has been technically challenging in the current study.

PAGE 143

143 APPENDIX A SUPPLEMENTAL DATA FOR CHAPTER 2 Table A 1. Lesion development and oxal ic acid accumulation. Lesion area (mm 2 ) y Oxalic acid (mg/cm 2 ) z Strain x Soybean Bean Tomato Soybean Bean Tomato WT 2727.3 ± 367.8 a 550.0 ± 199.9 a 1161.1 ± 240.3 a 0.137 ± 0.041 0.040 ± 0.004 0.045 ± 0.011 KO1 63.5 ± 30.7 c 202.8 ± 94.6 c 243.7 ± 184.1 c 0 ± 0 0 ± 0 0 ± 0 KO2 92.5 ± 72.2 c 226.3 ± 62.0 c 271.1 ± 229.7 c 0 ± 0 0 ± 0 0 ± 0 Com 1158.6 ± 186.9 b 394.4 ± 138.5 b 719.1 ± 184.7 b 0.148 ± 0.010 0.051 ± 0.016 0.041 ± 0.013 A1 20.6 ± 10.5 c 178.6 ± 46.5 c 238.1 ± 90.0 c 0 ± 0 0 ± 0 0 ± 0 A2 31.6 ± 11.0 c 178.5 ± 40.9 c 165.2 ± 53.2 c 0 ± 0 0 ± 0 0 ± 0 A3 27.0 ± 8.9 c 152.5 ± 30.2 c 183.1 ± 66.9 c 0 ± 0 0 ± 0 0 ± 0 x ss oah1 mutant; Com: complementation strain. y Measurement values represent mean s ± standard deviation s based on nine independent replicates. Within column mean values with different letters are statistically different (p<0.05) as dete rmined by one way ANOVA (p<0.05) followed by a post hoc Tukey HSD analysis. z Measurement values represent mean s ± standard deviation s based on two independent replicates.

PAGE 144

144 Table A 2. PacC binding sites (GCCARG) at the upstream intergenic regions of As comycota o ah homologs. OAH homolog ID a Species Taxo nomy b Characteri stic amino acid c (position) Synten y d (Y/N) Upstream intergenic DNA (bp) PacC binding sites Distance relative to the oah gb EJP64777.1 Beauveria bassiana Sor S (292) Y 1703 6 1 183,1142, 999, 738, 541, 476 gb EGX91576.1 Cordyceps militaris Sor S (303) Y 2124 7 1795, 1559, 1209, 905, 621, 599, 588 gb EFZ03383.1 Metarhizium anisopliae Sor S (290) Y 2208 9 2133, 1665, 1489, 782, 690, 582, 453, 410 jgi 77429 Daldinia eschscholzii Sor S (320) Y 3447 13 3353, 3252, 3064, 2813, 2799, 2435, 2433, 2201, 2192, 1739, 1577, 1154, 298 jgi 71135 Hypoxylon sp. Sor S (325) Y 3964 14 3848, 3710, 3195, 3039, 2724, 2722, 2643, 2519, 2510, 2200, 1870, 1827, 1072, 291 jgi 79289 Cryphonectria parasitica Sor S (308) Y 3059 14 2859, 2767, 2534, 1866, 1728, 1728, 1717, 1579, 1294, 635, 555, 497, 414, 262 XP_001557891.1 Botrytis cinerea Leo S (305) Y 1928 7 1638, 1383, 1094, 1089, 1080, 756, 585 XP_001590478.1 Sclerotinia sclerotiorum Leo S ( 278) Y 2241 4 1742, 1108, 1094, 773 XP_002566371.1 Penicillium chrysogenum Euro S (266) Y 2165 9 1941, 1769, 1727, 1610, 1550, 695, 663, 559, 237 XP_001402473.2 Aspergillus niger Euro S (281) Y 2799 10 2439, 2379, 2247, 1523, 1510, 1175, 1145, 996, 399 , 321

PAGE 145

145 Table A 2. Continued OAH homolog ID a Species Taxo nomy b Characteri stic amino acid c (position) Synten y d (Y/N) Upstream intergenic DNA (bp) PacC binding sites Distance relative to the oah XP_001823178.1 Aspergillus oryzae Euro S (276) Y 1499 9 1412, 1337, 1139, 1126, 875, 696, 573, 320, 246 XP_749190.1 Aspergillus fumigatus Euro S (266) Y 1094 5 991, 978, 482, 432, 278 gb EKG11254.1 Macrophomina phaseolina Dothi S (276) Y 4956 9 4198, 4129, 4017, 2696, 1587, 947, 864, 470, 341 jgi 58284 Xanthoria parietina Leca S (266) Unable to define >1558 4 1384, 1051, 686, 552 jgi 101448 Cladonia grayi Leca S (255) Unable to define >1419 6 841, 714, 532, 331, 124, 89 gb EKG16942.1 Macrophomina phaseolina Dothi S (326) N 1100 2 940, 910 g b EKG09828.1 Macrophomina phaseolina Dothi S (355) N 1846 3 1701, 1300, 908 jgi 7682 Botryosphaeria dothidea Dothi S (354) N 1324 1 874 jgi 1757 Botryosphaeria dothidea Dothi S (326) N 1525 0 Not present jgi 184476 Cladosporium fulvum Dothi S (285) N 234 1 91 jgi 31987 Baudoinia compniacensis Dothi S (246) N 1019 1 318 jgi 11523 Botryosphaeria dothidea Dothi P (240) N 407 0 Not present

PAGE 146

146 Table A 2. Continued OAH homolog ID a Species Taxo nomy b Characteri stic amino acid c (position) Sy nten y d (Y/N) Upstream intergenic DNA (bp) PacC binding sites Distance relative to the oah gb EFQ27707.1 Colletotrichum graminicola Sor P (247) N 2132 3 1907, 1217, 250 Uniprot J9N6J6 Fusarium oxysporum Sor P (255) N 538 0 Not present jgi 5714 3 Oidiodendron maius Leo P (246) N 894 1 678 Uniprot I1S2X9 Fusarium graminearum Sor P (297) N 1202 0 Not present gb CAP94734.1 Penicillium chrysogenum Euro P (240) N 730 1 418 gb ABD76556.1 Aspergillus niger Euro P (240) N 740 0 Not present a Sequ ences were retrieved from NCBI (gb, XP), Joint Genome Institute (jgi), and UniProt (Uniprot) databases. Experimentally validated O AH s are underlined. b Taxonomy of species. Sor: Sordariomycetes; Leo: Leotiomycetes; Leca: Lecanoromycetes; Dothi: Dothideomyc etes; Euro: Eurotiomycetes. c Amino acid residue at the position proposed to be diagnostic of activity specificity. The residue position within each protein is shown within parenthesis. S: serine; P: proline. d Synteny relationship with known oahs is deter previously reported ( Joosten et al. , 2008 ) . For genes from Xanthoria parietina and Cladonia grayi , the relationships were unable to define due to sequencing gaps.

PAGE 147

147 Figure A 1. Phylogeny of OAH homologs from Ascomycota fungi. The neighbor joining phylogram was constructed based on a full length protein sequence alignment and was tested with 1, 000 bootstrapping replicates; bootstrap values smaller than 80 are not shown. Filled diamond s and filled triangle represent known OAHs and 2,3 dimethylmalate lyase respectively. Colored branches indicate fungal lineages, dark blue: Sorda riomycetes; light blue: Dothideomycetes; green: Leotiomycetes; red: Eurotiomycetes; pink: Lecanoromycetes. Amino acids surrounding the activity specificity signature residue (colored in red or green, position shown within parenthesis) were listed. Synteny relationship with known oah s is determined based on the ( Joosten et al. , 2008 ) .

PAGE 148

148 Figure A 2. Medium acidifi cation assay. PDA medium was pH adjusted to 7.0 with NaOH and supplied with the pH indicator bromophenol blue to detect medium acidification (violet to yellow color change). Assays were carried out in 5 cm petri dish medi a .

PAGE 149

149 Figure A 3. Radial growth kinetics on unbuffered PDA or PDA media buffered with citric acid sodium phosphate buffer at the indicated initial pH values. Data points represent the mean values from three independent colony replicates. The standard de viations for all data points did not exceed 0.3 and were not plotted. Com: complementation strain.

PAGE 150

150 Figure A 4. Infection assay on detached soybean leaves with or without prior wounding. The photograph was taken three days post inoculation.

PAGE 151

151 Fig ure A 5. Close up ss oah1 mutant (KO2) on detached soybean leaflets (A) and on detached canola leaflets (B). Leaflets were wounded prior to inoculation and the leaflets in A were photographed five days post inoculatio n.

PAGE 152

152 Figure A 6. Lesion size developments of GFP labeled strains on detached soybean leaves. The barplot represented means + standard deviations and was based on measurements from six independent inoculation replicates.

PAGE 153

153 Figure A 7. Cytological events related to the infection establishment of S. sclerotiorum on onion epidermal strip. Inoculated onion epidermal strips were sampled between 12 and 24 hpi for observation. The samples were either observed directly under light (A) and fluorescence mic roscope (B), or stained with safranin O (C, D, E) or trypan blue (F) before light microscopy. A) C ompound appressorium mediated cuticle penetration, arrowhead indicates the differentiation of nascent subcuticular hyphae. B) P apilla deposition and cell wall autofluorescence surrounding th e penetration sites. C) Densely aligned subcuticular hyphae formed at initial penetration site, arrowhead indicates the sheath layer surrounding the subcuticular hyphae. D) A n established infection where the infectious hypha e had spread and killed epidermal cells over a large area whereas the epidermal cell remnants still preserved nuclei staining. E) A subcuticular hyphae coming in initial contact with plasmamembrane (arrowhead), note the loss of plasmolysis activity of the penetrated cell but not the two neighboring cells. F) S ubcuticular hyphae penetrating into the anticlinal cell wall (arrowheads). P: penetration sites, PM: plasmamembrane, SH: subcuticular hyphae. The scale bars represent 100 µ m.

PAGE 154

154 Figure A 8. Common a ssociation between fungal subcuticular hyphae and alive onion epidermal cells observed with both the S. sclerotiorum wild type (WT) and ss oah1 mutant ( oah KO2). The onion epidermal cells were plasmolyzed with 0.75 M sucrose for 15 minutes and directly ex amined with both light and fluorescent microscopies. Plasmolyzed onion epidermal cells in association with fungal subcuticular hyphae are marked with red dots. The scale bars represent 200 µm.

PAGE 155

155 Figure A 9 . OA crystal accumulation dynamics during onion epidermal strip infection of S. sclerotiorum WT. A and B) P enetration stage OA crystals. Crystals were rarely observed surrounding vegetative hyphae or compound appressoria on the cuticle surface , but were frequently observed at the penetration points. C) OA crystals at the early infection stages. Crystals did not accumulate around subcuticular hyphae but accumulated abundantly within old compound appressoria. D and E) Crystals a ccumulated heavily within fully disrupted epidermal cells at the lesion center but occurred sporadically at the infection front; some crystals could accumulate below viable epidermal cells (indicated by focal planes) in areas ahead of the colonization front, which became more abundant as colonization proceeded (E, dead epidermal cel ls are indicated by red dot) . CA: compound appressoria, P: penetration sites, SH: subcuticular hyphae, VH: vegetative hyphae. The scale bars represent 100 µm.

PAGE 156

156 Figure A 10. Elicitor activity of the 7 day old PDB culture fluids of the S. sclerotiorum wi ss oah1 mutant (KO2) on tobacco plants. Leaves were photographed two days post infiltration and representative pictures from six replications are shown.

PAGE 157

157 APPENDIX B SUPPLEMENTAL DATA FOR CHAPTER 3 Figure B 1. Protein domain structure a nd multiple sequence alignment . A) Protein domain structure. SP: signal peptide. B) Multiple sequence alignment . Sequences were retrieved from Genbank and the accession numbers are as follows: CAB15314.1 ( B . subtilis OxDC), AAQ67425.1 ( Trametes versicolor OxDC), CAV19809.1 ( Dichomitus squalens OxDC), CAG34243.2 ( Ceriporiopsis subvermispora OxO ) , AAA20245.1 ( Hordeum vulgaris OxO ). Proton donor sites ( corresponding to Glu 162 and Glu 333 in the Bacillus subtilis * ys: grey = 100% identity, red = Mn 2+ ion binding site, underline = ; number = omitted amino acids. OxDC: oxalate decarboxylase; OxO: oxalate oxidase.

PAGE 158

158 Figure B 2. N eighbor joining phylog ram of oxalate decarboxylase (OxDC) homologs. The phylo gram was based on a full length protein sequence alignment and was tested with 1, 000 bootstrapping replicates; b ootstrap values smaller than 80 are not shown. For each protein, amino acid residues surrounding the putative proton donor sites (colored resid ue, corresponding to the B . subtilis OxdC Glu 162 ) are displayed to the right of the branch label. E xperimentally characterized OxDCs and oxalate oxidase s ( OxO s) are colored in dark red and green respectively.

PAGE 159

159 Figure B 3. The Ceriporiopsis subvermispora oxalate oxidase ( OxO ) is very similar to known oxalate decarboxylases OxDCs . A) Protein s equence identity and similarity scores (separated by s lash ) were calculated based on global pairwise alignment. B) Gene exon intron structures. The relative positions of introns were mapped on the protein sequence alignment. Shaded amino acid(s) indicate(s) intron position(s), an intron interrupting a codon is shown by single amino acid shading while an intron not interrupting a codon is shown by double amino acid shad ing. N umber s indicate omitted amino acid s .

PAGE 160

160 Figure B 4. qRT PCR analysis of Ss odc2 transcript accumulation at different developmental stages and in response to OA treatment. Delta delta Ct method was used to obtain relative expression values and the expression fold changes relative to mycelia were plotted. Data represents mean + standard deviation from three independent experimental replicates. M: mycelia (4d stationary PDB culture), M+OA: mycelia with OA (4d stationary culture in PDB suppleme nted with 20 mM OA), CA: compound appressoria (48h post induction on cellophane), S: sclerotia at developmental stage 3 4, A: apothecia at developmental stage 4 5, IL: infected tomato leaves (2 dpi).

PAGE 161

161 Figure B 5. Expression specificity of the Ss odc 2 gene determined by endogenous promoter driven GFP expression. GFP expression driven by the constitutive oliC promoter was used as a control. The scale bars represent 200 µm. Blue arrows pointed toward aerial hyphae.

PAGE 162

162 Figure B 6. Radial growth rate o s s odc1 s o dc2 relative to WT on PDA medium . Each point represents the mean ± standard deviation from four colon y replicates.

PAGE 163

163 Figure B 7. Colony morphology , sclerotium and apothecium of ss odc2 mutants . PDA cultures were photog raphed 10 days post inoculation and apothecia were photographed following one month of sclerotia incubation at 15 °C.

PAGE 164

164 Figure B 8. Effect of Ss odc1 or Ss o dc2 gene deletion on compound appressorium development and virulence. A) Compound appressoria p roduced by mycelia plugs on parafilm (3 dpi). B) Infected soybean leaves (2 dpi).

PAGE 165

165 Figure B 9. ss odc2 mutants were inefficient in primary lesion establishment. Detached soybean leaves were collected 14 and 24 hours post inoculation. Leaves were cleared , and stained with trypan blue before examination.

PAGE 166

166 Figure B 10. Oxalic acid accumulation in mycelia plug during compound appressoria induction on parafilm. For each time point, six plugs were pooled together as one sample and the bar plots represent means + standard deviations based on three independent replicates. Bars with different letters are statistically different (p<0.05) as determined by one way ANOVA (p<0.05) followed by a post hoc Tukey HSD analysis. Ect: ectopic strain, Com: complementation strain.

PAGE 167

167 Figure B 11. Effect of Ss odc2 overexpression on in planta oxalic acid accumulatio n (A) and virulence (B). Soybean leaves were photographed three days post inoculation.

PAGE 168

168 Figure B 12. Effect of Ss odc2 overexpression on stress tolerances. The WT and Ss odc2 overexpression strain were grown in PDA medium or PDA medium supplemented wi th 200 µg/mL calcofluor white (CW), 200 µg/mL congo red, 20 mM oxalic acid (OA), 1 M sorbitol, 1 M NaCl, 0.01% SDS, or 5 mM H 2 O 2 . Plates were photographed six days post inoculation. The relative inoculation positions of the WT and Ss odc2 strains are shown in the bottom.

PAGE 169

169 APPENDIX C SUPPLEMENTAL DATA FOR CHAPTER 4 Table C 1. Summary of the celery stalk virulence assays. Three independent experiments were carried out to test both virulence and compound appressoria formation. Isolates were categorized bas ed on their phenotype reproducibility. Bolded isolates (53 in total) were ones determined as common bean. Category Isolate ID Virulence Defective in one experiment AT93, AT97, AT100, AT145, AT152, AT191, AT201, AT203, AT219, AT246, AT250, AT271, AT327, AT341, AT352, AT361, AT365 , AT375, AT394, AT458, AT474, AT519, AT563 , AT566 , AT575, AT613, AT657, AT676, AT687, AT696, AT705, AT709 , AT753, AT781, AT806 , AT816, AT854, AT905, A T913, AT924 , AT1206, JAT11, JAT33 , JAT34, JAT45 , JAT121 , JAT157, JAT166, JAT182, Defective in two experiments AT78 , AT81 , AT82 , AT158 , AT159, AT220 , AT233 , AT319 , AT345 , AT512 , AT545, AT785 , AT831 , AT861, AT923 , JAT4 , JAT25 , JAT30 , Defective in all experiments AT18 , AT34 , AT63 , AT67 , AT76 , AT102 , AT120 , AT162 , AT172 , AT185 , AT196 , AT200 , AT229 , AT257, AT258 , AT267 , AT343 , AT450 , AT529 , AT573 , AT627 , AT815 , AT891 , JAT96 , JAT160 , JAT190 , JAT203, JAT208 Compound appressoria Defective in one experi ment AT162 , AT250, AT327, AT365 , AT375, AT566, AT629, AT696, AT705, AT806 , AT815 , JAT33 , JAT100 Defective in two experiments AT34 , AT76 , AT229 , AT258 , AT343 , AT563 , AT573, AT709 , JAT96 , JAT121 Defective in all experiments AT18 , AT63 , AT67 , AT120 , AT172 , AT185 , AT196, AT201 , AT267 , AT345 , AT512 , AT529 , AT545 , AT831 , AT891 , JAT45 , JAT190 , JAT203

PAGE 170

170 Table C 2. virulences on bean leaves (unwound ed), the 16 virulence defective mutants were bolded. Isolate ID Relative growth a Celery stalk b Bean leaf unwounded c Bean leaf wounded Bean petiole Compound appressoria formation d Sclerotia formation JAT203 0.25 VVV | VVV | VVV 0.00 ± 0.00 0.12 ± 0.17 0.0 0 ± 0.00 0/4 Normal AT18 0.48 NA | VVV | VVV 0.12 ± 0.10 0.22 ± 0.01 0.04 ± 0.07 0/3 Normal AT185 0.43 VVV | VVV | LLS 0.13 ± 0.09 0.14 ± 0.20 0.00 ± 0.00 0/4 Not formed AT102 0.44 VVV | VVV | VVV 0.16 ± 0.02 0.18 ± 0.03 0.00 ± 0.00 4/4 Normal JAT208 0.50 VVV | VVV | LLL 0.23 ± 0.04 0.00 ± 0.00 0.00 ± 0.00 4/4 Aberrant AT63 0.68 SSS | VVV | VVL 0.23 ± 0.04 0.34 ± 0.004 0.29 ± 0.12 0/4 Normal AT196 0.51 VVV | VVV | LLL 0.28 ± 0.02 0.35 ± 0.03 0.34 ± 0.13 0/4 Normal AT120 0.30 VVV | VVV | VVV 0.28 ± 0.18 0.51 ± 0.01 0.00 ± 0.00 0/4 Normal JAT96 0.44 LLL | NSS | SSS 0.36 ± 0.01 0.41 ± 0.01 0.46 ± 0.10 2/4 Normal AT573 0.46 SLV | LLL | VVV 0.37 ± 0.01 0.46 ± 0.01 0.51 ± 0.09 2/4 Normal AT172 0.70 LLV | SSL | SSS 0.38 ± 0.09 0.48 ± 0.03 0.32 ± 0.02 0/ 4 Normal JAT121 0.63 SSL | NNN | VVV 0.43 ± 0.01 0.52 ± 0.01 0.48 ± 0.08 2/4 Normal AT81 0.92 LLL | NNN | LLL 0.45 ± 0.08 0.60 ± 00.03 0.24 ± 0.20 4/4 Normal AT815 0.74 NLL | SSS | SSS 0.46 ± 0.02 0.59 ± 0.03 0.45 ± 0.13 1/3 Normal AT450 0.30 VVV | VVV | VVV 0.49 ± 0.07 0.45 ± 0.02 0.45 ± 0.27 4/4 Normal AT923 0.90 NLL | LLL | NNN 0.52 ± 0.01 0.57 ± 0.04 0.69 ± 0.004 4/4 Normal AT67 0.83 LLV | LLL | SLL 0.52 ± 0.02 0.55 ± 0.007 0.41 ± 0.18 0/4 Not formed AT78 1.08 VVV | VVV | SSS 0.53 ± 0.03 0.76 ± 0 .03 0.78 ± 0.13 4/4 Normal AT512 0.57 NNN | SSS | SSS 0.54 ± 0.01 0.51 ± 0.03 0.53 ± 0.07 0/4 Normal AT258 0.78 VVV | LVV | SSS 0.54 ± 0.01 0.52 ± 0.04 0.37 ± 0.08 2/4 Not formed AT76 1.16 VVV | VVV | SLL 0.61 ± 0.05 0.72 ± 0.04 0.41 ± 0.17 2/4 Normal JAT190 0.89 NA | VVV | VVV 0.65 ± 0.02 0.72 ± 0.11 0.85 ± 0.12 0/3 Normal AT229 0.57 LVV | LLL | SSS 0.68 ± 0.06 0.69 ± 0.04 0.69 ± 0.08 2/4 Normal AT82 0.97 VVV | LLN | NNN 0.71 ± 0.04 0.89 ± 0.23 0.72 ± 0.31 4/4 Normal JAT30 0.78 SSL | NNN | VVV 0.7 3 ± 0.02 0.70 ± 0.14 0.64 ± 0.07 4/4 Normal AT627 0.51 SLL | SSS | LLL 0.74 ± 0.08 0.82 ± 0.04 0.90 ± 0.03 4/4 Normal AT345 0.88 SVV | LVV | NNN 0.78 ± 0.08 0.73 ± 0.04 0.66 ± 0.12 0/4 Normal

PAGE 171

171 Table C 2. Continued Isolate ID Relative growth a C elery stalk b Bean leaf unwounded c Bean leaf wounded Bean petiole Compound appressoria formation d Sclerotia formation AT785 0.54 LVV | NNN | SSL 0.79 ± 0.03 0.83 ± 0.01 0.88 ± 0.12 4/4 Normal AT806 1.04 VVV | NNN | NNN 0.79 ± 0.11 0.93 ± 0.07 0.86 ± 0.26 3/4 Normal AT545 1.00 SVV | NNN | LLL 0.80 ± 0.04 0.95 ± 0.02 0.95 ± 0.02 1/4 Aberrant AT365 1.08 SLL | NNN | NNN 0.80 ± 0.03 0.86 ± 0.03 0.97 ± 0.20 2/4 Initials only AT201 0.82 NNN | LLL | NNN 0.81 ± 0.14 0.96 ± 0.28 0.87 ± 0.13 0/3 Normal AT34 1.07 SSL | LLL | SSL 0.82 ± 0.07 0.83 ± 0.11 0.88 ± 0.30 2/4 Normal AT563 0.44 NNN | NNN | LLL 0.82 ± 0.05 0.93 ± 0.10 0.95 ± 0.05 2/4 Normal AT233 0.72 SSV | NNN | NSL 0.82 ± 0.08 0.85 ± 0.05 0.73 ± 0.05 3/4 Normal AT891 0.96 NA | VVV | VVV 0.83 ± 0.02 1. 02 ± 0.06 1.13 ± 0.03 1/3 Normal AT319 0.83 SSL | NLL | NNN 0.84 ± 0.10 0.78 ± 0.13 0.78 ± 0.04 4/4 Normal AT200 0.66 LLV | NSS | SSS 0.84 ± 0.04 0.71 ± 0.03 0.80 ± 0.06 4/4 Normal JAT33 0.77 LLV | NNN | NNN 0.85 ± 0.04 0.83 ± 0.01 1.03 ± 0.11 3/4 Norma l JAT160 0.94 LLL | LLL | SSS 0.86 ± 0.12 0.76 ± 0.06 0.87 ± 0.04 4/4 Normal AT924 0.97 NNN |NNN | VLV 0.86 ± 0.07 0.79 ± 0.07 1.02 ± 0.17 4/4 Normal AT831 0.94 SSS | SSS | NNN 0.89 ± 0.05 0.98 ± 0.07 1.02 ± 0.17 1/4 Normal AT220 0.67 SSS | NNN | VVV 0 .91 ± 0.05 0.91 ± 0.02 1.04 ± 0.08 4/4 Normal JAT45 0.97 NNL | NNN | NNN 0.93 ± 0.06 0.91 ± 0.03 1.07 ± 0.05 1/4 Normal AT267 1.04 NA | VVV | LNS 0.95 ± 0.03 0.97 ± 0.01 1.08 ± 0.04 1/3 Normal JAT4 0.99 SSS | NNN | SSS 0.96 ± 0.04 1.20 ± 0.30 1.19 ± 0.1 1 4/4 Normal AT343 0.89 LVV | VVV | SLL 0.96 ± 0.05 0.88 ± 0.04 0.88 ± 0.01 2/4 Initials only AT566 0.96 LVV | NNN | NNN 0.96 ± 0.04 1.06 ± 0.02 1.01 ± 0.07 3/4 Normal AT158 0.81 SLL | NNN | NSS 0.97 ± 0.04 1.12 ± 0.09 0.98 ± 0.07 4/4 Normal AT162 0.82 SLL | LLL | SLL 0.97 ± 0.04 0.75 ± 0.02 0.82 ± 0.06 4/4 Normal AT529 0.99 NA | VVV | LLV 0.98 ± 0.04 0.92 ± 0.05 0.99 ± 0.09 1/3 Normal JAT25 1.01 NVV | NNN | NLL 1.09 ± 0.05 1.00 ± 0.04 1.10 ± 0.06 4/4 Normal AT709 1.03 SLL | NNN | NNN 1.15 ± 0.06 0. 98 ± 0.09 1.06 ± 0.03 2/4 Normal a Relative growth on PDA medium. Values were calculated based on three independent replicates. b Celery stalk virulence assay. For each isolate, three independent experiments (separated by vertical bars) were carried out a nd each experiment includes three inoculation replicates. The lesions were scored based on a disease index system

PAGE 172

172 with the following categories: normal (N, lesion expands similarly as the WT), slow (S, lesion expands at a slower rate compared to WT), limit ed (L, lesion expands slightly and then stops), and very limited (V, no visible lesion or small lesion). NA: not assayed. c Common bean virulence assay. Infection assays were done with unwounded bean leaves (n=3), wounded bean leaves (n=2), and bean petiol es (n=4). Relative lesion diameter values are given for bean leaves and relative lesion length values are given for bean petioles. d Compound appressoria formation assay. The number of experiments where the mutants show normal compound appressoria and the total number of experiments (separated by slash) are given.

PAGE 173

173 Figure C 1. T DNA copy number analysis by Southern hybridization. A) The binary vector pBHT1 was used for generating the T DNA transformants; B) Southern hybridization results. Genomic DNA from 17 selected transformants was digested with Bgl II . Digoxigenin labeled hygromycin phosphotransferase (hph) coding sequence was used as the hybridization probe.

PAGE 174

174 Figure C 2. Scatterplots showing the correlation among bean virulence assays, and between virulence assays and growth rates. The relative lesion sizes (bean leaf unwounded, bean leaf wounded) were square root transformed for correlation analysis with the relative lesion lengths (bean petiole) and the relative growth rates (radial growth ). The R 2 values were calculated based on least square regression analysis.

PAGE 175

175 Figure C 3. Scatterplots showing the correlation between celery virulence assay and radial growth, and between virulence assays on celery and on common bean. The relative lesi on sizes (bean leaf unwounded, bean leaf wounded) were square root transformed for correlation analysis. Celery lesion scores were transformed into numerial values for the analysis. The R 2 values were calculated based on least square regression analysis.

PAGE 176

176 Figure C 4. T DNA transformants exhibiting compound appressori um formation defects. Three or four independent assays were conducted in total. Assays showing normal compound appressoria development over total compound appressoria assays (separated by s lash dashes) are indicated . 1 st , 2 nd , 3 rd , and 4 th represent four independent experiments.

PAGE 177

177 Figure C 4. (Continued)

PAGE 178

178 Figure C 4. (Continued)

PAGE 179

179 Figure C 4. (Continued)

PAGE 180

180 Figure C 4. (Continued)

PAGE 181

181 Figure C 5. T DNA transfor mants with defects in scleroti um development or colony morphology. Colonies were photographed following 10 days of growth on PDA medium. AT172 m and AT185 m represent mitotically derived strains from AT172 and AT185.

PAGE 182

182 Figure C 5. (Continued)

PAGE 183

183 Figure C 5. (Continued)

PAGE 184

184 Figure C 5. (Continued)

PAGE 185

185 Figure C 6. Hyphae growth pattern of AT913 at the colony front and colony middle on PDA medium.

PAGE 186

186 Figure C 7. T DNA insertion mutants inefficient in OA accumulation based on medium acidific ation assay. A) PDA medium was supplemented with bromophenol blue (violet > pH 4.6, yellow < pH 3.0). Colonies were photographed two days post inoculation. B) S oybean leaves seven days post infection . m : mitotically unstable.

PAGE 187

187 Figure C 8. Medium acid ification dynamics of AT172 m and AT258. PDA medium was supplemented with bromophenol blue (violet > pH 4.6, yellow < pH 3.0) to monitor pH changes . m : mitotically unstable.

PAGE 188

188 Figure C 9. d common bean leaves (2 dpi) .

PAGE 189

189 Figure C 9. (Continued)

PAGE 190

190 Figure C 10. (3 dpi) . For each isolate, the three independent assay outcomes are shown from top to bottom.

PAGE 191

191 Fig ure C 10. (Continued)

PAGE 192

192 Figure C 10. (Continued)

PAGE 193

193 Figure C 11. PDA colony (10 dpi) . Colony morphology phenotypes of AT67, AT185, AT196, AT258, and JAT208 are shown in Figure A 3.

PAGE 194

194 Figure C 11. (C ontinued)

PAGE 195

195 Figure C 12. Sequence annotation of the SS1G_10409 locus. Gray shading: untranslated region; lowercase: introns; green uppercase: coding region; red: sequence rep laced by integrated T DNA.

PAGE 196

196 Figure C 13. O xalic acid accumulation in PDB shak e culture of selected T DNA transformants. Data represent mean + standard deviation from two independent culture replicates.

PAGE 197

197 Figure C 14. Sensitivity of AT67 to os motic and oxidative stresses. Mycelia plugs with actively growing hyphal tips were inoculated on PDA medium , PDA medium supplemented with 1 M NaCl, or PDA medium supplemented with 5 mM H 2 O 2 respectively. Colonies were photographed 10 days post inoculation.

PAGE 198

198 LIST OF REFERENCES Abawi GS, 1975. Infection of bean by ascospores of Whetzelinia sclerotiorum . Phytopathology 65 , 673 9. Abawi GS, Grogan RG, 1979. Epidemiology of diseases caused by Sclerotinia species. Phytopathology 69 , 899 904 Adams PB, Ayers WA, 1979. Ecology of Sclerotinia species. Phytopathology 69 , 896 900. Adie BaT, Pérez Pérez J, Pérez Pérez MM , et al. , 2007. ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis . P lant Cell 19 , 1665 81. Andrew M, Barua R, Short SM, Kohn LM, 2012. Evidence for a common toolbox based on necrotrophy in a fungal lineage spanning necrotrophs, biotrophs, endophytes, host generalists and specialists. PLoS One 7 , doi:10.1371/journal.pone.00 29943. Antelmann H, Töwe S, Albrecht D, Hecker M, 2007. The phosphorus source phytate changes the composition of the cell Wall proteome in Bacillus subtilis . J Proteome Res 6 , 897 903. Asai S, Yoshioka H, 2009. Nitric oxide as a partner of reactive oxygen species participates in disease resistance to necrotrophic pathogen Botrytis cinerea in Nicotiana benthamiana . Molecular Plant Microbe Interactions 22 , 619 29. Asselbergh B, Curvers K, Franca SC , et al. , 2007. Resistance to Botrytis cinerea in sitiens, an abscisic acid deficient tomato mutant, involves timely production of hydrogen peroxide and cell wall modifications in the epidermis. Plant Physiol 144 , 1863 77. Azam M, Kesarwani M, Chakraborty S, Natarajan K, Datta A, 2002. Cloning and characterization of the 5' flanking region of the oxalate decarboxylase gene from Flammulina velutipes . Biochemical Journal 367 , 67 75. Azam M, Kesarwani M, Natarajan K, Datta A, 2001. A secretion signal is present in the Collybia velutipes oxalate decarboxylase gene. Bioche m Biophys Res Commun 289 , 807 12. Baetz AL, Allison MJ, 1989. Purification and characterization of oxalyl coenzyme A decarboxylase from Oxalobacter formigenes . J Bacteriol 171 , 2605 8. Bashi ZD, Rimmer SR, Khachatourians GG, Hegedus DD, 2012. Factors gover ning the regulation of Sclerotinia sclerotiorum cutinase A and polygalacturonase 1 during different stages of infection. Can J Microbiol 58 , 605 16.

PAGE 199

199 Bashi ZD, Rimmer SR, Khachatourians GG, Hegedus DD, 2013. Brassica napus polygalacturonase inhibitor protei ns inhibit Sclerotinia sclerotiorum polygalacturonase enzymatic and necrotizing activities and delay symptoms in transgenic plants. Can J Microbiol 59 , 79 86. Bateman DF, Beer SV, 1965. Simultaneous production and synergistic action of oxalic acid and poly galacturonase during pathogenesis by Sclerotium rolfsii . Phytopathology 55 , 204 11. , et al. , 2009. A glucosinolate metabolism pathway in living plant cells mediates broad spectrum antifungal defense. Science 323 , 101 6. Beliën T, Van Campenhout S, Robben J, Volckaert G, 2006. Microbial endoxylanases: effective weapons to breach the plant cell wall barrier or, rather, triggers of pant defense systems? Molecular Plant Microbe Interactions 19 , 1072 81. Ben Daniel B H, Bar Zvi D, Tsror L, 2012. Pectate lyase affects pathogenicity in natural isolates of Colletotrichum coccodes and in pelA gene disrupted and gene overexpressing mutant lines. Mol Plant Pathol 13 , 187 97. Bessire M, Chassot C, Jacquat AC , et al. , 2007. A pe rmeable cuticle in Arabidopsis leads to a strong resistance to Botrytis cinerea . The EMBO Journal 26 , 2158 68. Billon Grand G, Rascle C, Droux M, Rollins JA, Poussereau N, 2012. pH modulation differs during sunflower cotyledon colonization by the two close ly related necrotrophic fungi Botrytis cinerea and Sclerotinia sclerotiorum . Mol Plant Pathol 13 , 568 78. Bolton MD, Thomma BP, Nelson BD, 2006. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Mol Plant Pat hol 7 , 1 16. Boudart G, Charpentier M, Lafitte C , et al. , 2003. Elicitor activity of a fungal endopolygalacturonase in tobacco requires a functional catalytic site and cell wall localization. Plant Physiol 131 , 93 101. Brandwagt BF, Kneppers TJA, Van Der W eerden GM, Nijkamp HJJ, Hille J, 2001. Most AAL toxin sensitive Nicotiana species are resistant to the tomato fungal pathogen Alternaria alternata f. sp. lycopersici . Molecular Plant Microbe Interactions 14 , 460 70. Brink J, Vries R, 2011. Fungal enzyme se ts for plant polysaccharide degradation. Appl Microbiol Biotechnol 91 , 1477 92. Brito N, Espino JJ, González C, 2006. The endo 1,4 xylanase Xyn11A is required for virulence in Botrytis cinerea . Molecular Plant Microbe Interactions 19 , 25 32.

PAGE 200

200 Browne LM, C onn KL, Ayert WA, Tewari JP, 1991. The camalexins: new phytoalexins produced in the leaves of camelina sativa (cruciferae). Tetrahedron 47 , 3909 14. Brutus A, Sicilia F, Macone A, Cervone F, De Lorenzo G, 2010. A domain swap approach reveals a role of the plant wall associated kinase 1 (WAK1) as a receptor of oligogalacturonides. Proceedings of the National Academy of Sciences 107 , 9452 7. Budge SP, Whipps JM, 2001. Potential for integrated control of Sclerotinia sclerotiorum in glasshouse lettuce using Con iothyrium minitans and reduced fungicide application. Phytopathology 91 , 221 7. Burke JM, Rieseberg LH, 2003. Fitness effects of transgenic disease resistance in sunflowers. Science 300 , 1250. Burrell MR, Just VJ, Bowater L , et al. , 2007. Oxalate decarboxylase and oxalate by mutating an active site lid. Biochemistry 46 , 12327 36. Butler MJ, Gardiner RB, Day AW, 2009. Melanin synthesis by Sclerotinia sc lerotiorum . Mycologia 101 , 296 304. Cessna SG, Sears VE, Dickman MB, Low PS, 2000. Oxalic acid, a pathogenicity factor for Sclerotinia sclerotiorum , suppresses the oxidative burst of the host plant. Plant Cell 12 , 2191 200. Chassot C, Buchala A, Schoonbeek H J, Métraux J P, Lamotte O, 2008. Wounding of Arabidopsis leaves causes a powerful but transient protection against Botrytis infection. The Plant Journal 55 , 555 67. Chassot C, Nawrath C, Métraux J P, 2007. Cuticular defects lead to full immunity to a ma jor plant pathogen. The Plant Journal 49 , 972 80. Chen C, Harel A, Gorovoits R, Yarden O, Dickman MB, 2004. MAPK regulation of sclerotial development in Sclerotinia sclerotiorum is linked with pH and cAMP sensing. Molecular Plant Microbe Interactions 17 , 4 04 13. Chen C, Sun Q, Narayanan B, Nuss DL, Herzberg O, 2010. Structure of oxalacetate acetylhydrolase, a virulence factor of the chestnut blight fungus. J Biol Chem 285 , 26685 96. Chitrampalam P, Figuli PJ, Matheron ME, Subbarao KV, Pryor BM, 2008. Biocon trol of lettuce drop caused by Sclerotinia sclerotiorum and S. minor in desert agroecosystems. Plant Disease 92 , 1625 34. Chitrampalam P, Wu BM, Koike ST, Subbarao KV, 2011. Interactions between Coniothyrium minitans and Sclerotinia minor affect biocontrol efficacy of C. minitans . Phytopathology 101 , 358 66.

PAGE 201

201 Choi J, Park J, Jeon J , et al. , 2007. Genome wide analysis of T DNA integration into the chromosomes of Magnaporthe oryzae . Mol Microbiol 66 , 371 82. Clark KA, Krysan PJ, 2010. Chromosomal translocation s are a common phenomenon in Arabidopsis thaliana T DNA insertion lines. The Plant Journal 64 , 990 1001. Clay NK, Adio AM, Denoux C, Jander G, Ausubel FM, 2009. Glucosinolate metabolites required for an Arabidopsis innate immune response. Science 323 , 95 1 01. Cnossen Fassoni A, Bazzolli D, Brommonschenkel S, Fernandes De Araújo E, Queiroz M, 2013. The pectate lyase encoded by the pecCl1 gene is an important determinant for the aggressiveness of Colletotrichum lindemuthianum . Journal of Microbiology 51 , 461 70. Colmenares AJ, Aleu J, Durán Patrón R, Collado IG, Hernández Galán R, 2002. The putative role of botrydial and related metabolites in the infection mechanism of Botrytis cinerea . J Chem Ecol 28 , 997 1005. Consonni C, Bednarek P, Humphry M , et al. , 2010 . Tryptophan derived metabolites are required for antifungal defense in the Arabidopsis mlo2 mutant. Plant Physiol 152 , 1544 61. Costa T, Steil L, Martins LO, Völker U, Henriques AO, 2004. Assembly of an oxalate the Bacillus subtilis spore coat. J Bacteriol 186 , 1462 74. Cotton P, Kasza Z, Bruel C, Rascle C, Fevre M, 2003. Ambient pH controls the expression of endopolygalacturonase genes in the necrotrophic fungus Sclerotinia sclerotiorum . FEMS Microbiol Lett 227 , 163 9. Cruickshank RH, Wade GC, 1992. Production of appressoria by Monilinia fructicola . Mycol Res 96 , 425 8. Cuesta Arenas Y, Kalkman ERIC, Schouten A , et al. , 2010. Functional analysis and mode of action of phytotoxic Nep1 like proteins of Botrytis cin erea . Physiological and Molecular Plant Pathology 74 , 376 86. Culbertson BJ, Furumo NC, Daniel SL, 2007. Impact of nutritional supplements and monosaccharides on growth, oxalate accumulation, and culture pH by Sclerotinia sclerotiorum . FEMS Microbiol Lett 270 , 132 8. Cunha WG, Tinoco MLP, Pancoti HL, Ribeiro RE, Aragão FJL, 2010. High resistance to Sclerotinia sclerotiorum in transgenic soybean plants transformed to express an oxalate decarboxylase gene. Plant Pathology 59 , 654 60. Curvers K, Seifi H, Mouil le G , et al. , 2010. Abscisic acid deficiency causes changes in cuticle permeability and pectin composition that influence tomato resistance to Botrytis cinerea . Plant Physiol 154 , 847 60.

PAGE 202

202 Dallal Bashi Z, Hegedus DD, Buchwaldt L, Rimmer SR, Borhan MH, 2010. Expression and regulation of Sclerotinia sclerotiorum necrosis and ethylene inducing peptides (NEPs). Mol Plant Pathol 11 , 43 53. Dalmais B, Schumacher J, Moraga J , et al. , 2011. The Botrytis cinerea phytotoxin botcinic acid requires two polyketide syntha ses for production and has a redundant role in virulence with botrydial. Mol Plant Pathol 12 , 564 79. Darvill AG, Albersheim P, 1984. Phytoalexins and their elicitors a defense against microbial infection in plants. Annual Review of Plant Physiology 35 , 24 3 75. Daub ME, Herrero S, Chung K R, 2005. Photoactivated perylenequinone toxins in fungal pathogenesis of plants. FEMS Microbiol Lett 252 , 197 206. De Hoogt R, Luyten W, Contreras R, De Backer M, 2000. PCR and ligation mediated synthesis of split marker cassettes with long flanking homology regions for gene disruption in Candida albicans . Biotechniques 28 , 1112 6. Delgado Cerezo M, Sánchez Rodríguez C, Escudero V , et al. , 2012. Arabidopsis heterotrimeric G protein regulates cell Wall defense and resistanc e to necrotrophic fungi. Molecular Plant 5 , 98 114. Dickman MB, Mitra A, 1992. Arabidopsis thaliana as a model for studying Sclerotinia sclerotiorum pathogenesis. Physiological and Molecular Plant Pathology 41 , 255 63. Dickman MB, Park YK, Oltersdorf T, Li W, Clemente T, French R, 2001. Abrogation of disease development in plants expressing animal antiapoptotic genes. Proceedings of the National Academy of Sciences 98 , 6957 62. Djamei A, Schipper K, Rabe F , et al. , 2011. Metabolic priming by a secreted fung al effector. Nature 478 , 395 8. Donaldson PA, Anderson T, Lane BG, Davidson AL, Simmonds DH, 2001. Soybean plants expressing an active oligomeric oxalate oxidase from the wheat gf 2.8 (germin) gene are resistant to the oxalate secreting pathogen Sclerotina sclerotiorum . Physiological and Molecular Plant Pathology 59 , 297 307. Dunwell JM, Khuri S, Gane PJ, 2000. Microbial relatives of the seed storage proteins of higher plants: conservation of structure and diversification of function during evolution of the cupin superfamily. Microbiology and Molecular Biology Reviews 64 , 153 79. Durrands PK, Cooper RM, 1988. The role of pectinases in vascular wilt disease as determined by defined mutants of Verticillium albo atrum . Physiological and Molecular Plant Patholog y 32 , 363 71.

PAGE 203

203 Dutton MV, Evans CS, 1996. Oxalate production by fungi: its role in pathogenicity and ecology in the soil environment. Can J Microbiol 42 , 881 95. Dutton MV, Kathiara M, Gallagher IM, Evans CS, 1994. Purification and characterization of oxala te decarboxylase from Coriolus versicolor . FEMS Microbiol Lett 116 , 321 5. Egan MJ, Wang Z Y, Jones MA, Smirnoff N, Talbot NJ, 2007. Generation of reactive oxygen species by fungal NADPH oxidases is required for rice blast disease. Proceedings of the Natio nal Academy of Sciences 104 , 11772 7. Elad Y, 1992. The use of antioxidants (free radical scavengers) to control grey mould ( Botrytis cinerea ) and white mould ( Sclerotinia sclerotiomm ) in various crops. Plant Pathology 41 , 417 26. Enkerli J, Felix G, Bolle r T, 1999. The enzymatic activity of fungal Xylanase is not necessary for Its elicitor activity. Plant Physiol 121 , 391 8. Erental A, Dickman MB, Yarden O, 2008. Sclerotial development in Sclerotinia sclerotiorum Fungal Biology Reviews 22 , 6 16. Errakhi R, Meimoun P, Lehner A , et al. , 2008. Anion channel activity is necessary to induce ethylene synthesis and programmed cell death in response to oxalic acid. J Exp Bot 59 , 3121 9. Escutia MR, Bowater L, Edwards A , et al. , 2005. Cloning and sequencing of two Ceriporiopsis subvermispora bicupin oxalate oxidase allelic isoforms: implications for the reaction specificity of oxalate oxidases and decarboxylases. Appl Environ Microbiol 71 , 3608 16. Espino JJ, Br ito N, Noda J, González C, 2005. Botrytis cinerea endo ß 1,4 glucanase Cel5A is expressed during infection but is not required for pathogenesis. Physiological and Molecular Plant Pathology 66 , 213 21. Fauth M, Schweizer P, Buchala A , et al. , 1998. Cutin mo nomers and surface wax constituents elicit H 2 O 2 in conditioned cucumber hypocotyl segments and enhance the activity of other H 2 O 2 elicitors. Plant Physiol 117 , 1373 80. Favaron F, Sella L, D'ovidio R, 2004. Relationships among endo polygalacturonase, oxala te, pH, and plant polygalacturonase inhibiting protein (PGIP) in the interaction between Sclerotinia sclerotiorum and soybean. Molecular Plant Microbe Interactions 17 , 1402 9. Ferrari S, Galletti R, Denoux C, De Lorenzo G, Ausubel FM, Dewdney J, 2007. Resi stance to Botrytis cinerea induced in Arabidopsis by elicitors is independent of salicylic acid, ethylene, or jasmonate signaling but requires PHYTOALEXIN DEFICIENT3. Plant Physiol 144 , 367 79.

PAGE 204

204 Ferrari S, Galletti R, Pontiggia D , et al. , 2008. Transgenic e xpression of a fungal endo polygalacturonase increases plant resistance to pathogens and reduces auxin sensitivity. Plant Physiol 146 , 669 81. Ferrari S, Plotnikova JM, De Lorenzo G, Ausubel FM, 2003. Arabidopsis local resistance to Botrytis cinerea involv es salicylic acid and camalexin and requires EDS4 and PAD2, but not SID2, EDS5 or PAD4. The Plant Journal 35 , 193 205. expression of polygalacturonase inhibiting proteins in Arabidopsis and wheat increases resistance to the flower pathogen Fusarium graminearum . Plant Biology 14 , 31 8. Forsbach A, Schubert D, Lechtenberg B, Gils M, Schmidt R, 2003. A comprehensive characterization of single copy T DNA insertions in the Arabido psis thaliana genome. Plant Mol Biol 52 , 161 76. Franceschetti M, Bueno E, Wilson RA , et al. , 2011. Fungal virulence and development is regulated by alternative pre mRNA 3' end processing in Magnaporthe oryzae . PLoS Pathog 7 , doi: 10.1371/journal.ppat.1002 441. Frías M, Brito N, González C, 2013. The Botrytis cinerea cerato platanin BcSpl1 is a potent inducer of systemic acquired resistance (SAR) in tobacco and generates a wave of salicylic acid expanding from the site of application. Mol Plant Pathol 14 , 19 1 6. Frías M, González C, Brito N, 2011. BcSpl1, a cerato platanin family protein, contributes to Botrytis cinerea virulence and elicits the hypersensitive response in the host. New Phytologist 192 , 483 95. Friesen TL, Faris JD, Solomon PS, Oliver RP, 2008 . Host specific toxins: effectors of necrotrophic pathogenicity. Cell Microbiol 10 , 1421 8. Garg H, Li H, Sivasithamparam K, Kuo J, Barbetti MJ, 2010. The infection processes of Sclerotinia sclerotiorum in cotyledon tissue of a resistant and a susceptible genotype of Brassica napus . Ann Bot 106 , 897 908. Ghazy MA, He X, Singh BN, Hampsey M, Moore C, 2009. The essential N terminus of the Pta1 scaffold protein is required for snoRNA transcription termination and Ssu72 function but is dispensable for pre mRNA 3' end processing. Molecular and Cellular Biology 29 , 2296 307. Giesbert S, Schumacher J, Kupas V , et al. , 2011. Identification of pathogenesis associated genes by T DNA mediated insertional mutagenesis in Botrytis cinerea : a type 2A phosphoprotein phospha tase and an SPT3 transcription factor have significant impact on virulence. Molecular Plant Microbe Interactions 25 , 481 95.

PAGE 205

205 Giesbert S, Schürg T, Scheele S, Tudzynski P, 2008. The NADPH oxidase Cpnox1 is required for full pathogenicity of the ergot fungus Claviceps purpurea . Mol Plant Pathol 9 , 317 27. Godoy G, Steadman JR, Dickman MB, Dam R, 1990. Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris . Physiological and Molecular Plant Path ology 37 , 179 91. Gombert AK, Veiga T, Puig Martinez M , et al. , 2011. Functional characterization of the oxaloacetase encoding gene and elimination of oxalate formation in the beta lactam producer Penicillium chrysogenum . Fungal Genet Biol 48 , 831 9. Govri n EM, Levine A, 2000. The hypersensitive response facilitates plant infection by the necrotrophic pathogen Botrytis cinerea . Curr Biol 10 , 751 7. Govrin EM, Rachmilevitch S, Tiwari BS, Solomon M, Levine A, 2006. An elicitor from Botrytis cinerea induces th e hypersensitive response in Arabidopsis thaliana and other plants and promotes the gray mold disease. Phytopathology 96 , 299 307. Guimaraes RL, Stotz HU, 2004. Oxalate production by Sclerotinia sclerotiorum deregulates guard cells during infection. Plant Physiol 136 , 3703 11. Guo M, Chen Y, Du Y , et al. , 2011. The bZIP transcription factor MoAP1 mediates the oxidative stress response and is critical for pathogenicity of the rice blast fungus Magnaporthe oryzae . PLoS Pathog 7 , doi: 10.1371/journal.ppat.1001 302. Hafez YM, Bacsó R, Király Z, Künstler A, Király L, 2012. Up regulation of antioxidants in tobacco by low concentrations of H 2 O 2 suppresses necrotic disease symptoms. Phytopathology 102 , 848 56. Han Y, Joosten HJ, Niu W , et al. , 2007. Oxaloacetate hydr olase, the C C bond lyase of oxalate secreting fungi. J Biol Chem 282 , 9581 90. Have AT, Mulder W, Visser J, Van Kan JaL, 1998. The endopolygalacturonase gene Bcpg1 Is required for full virulence of Botrytis cinerea . Molecular Plant Microbe Interactions 11 , 1009 16. Heller A, Witt Geiges T, 2013. Oxalic acid has an additional, detoxifying function in Sclerotinia sclerotiorum pathogenesis. PLoS One 8 , doi: 10.1371/journal.pone.0072292. Hernández Blanco C, Feng DX, Hu J , et al. , 2007. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell 19 , 890 903. Herrero E, Ros J, Bellí G, Cabiscol E, 2008. Redox control and oxidative stress in yeast cells. Biochimica et Biophysica Acta (BBA) Gene ral Subjects 1780 , 1217 35.

PAGE 206

206 Hess DC, Myers CL, Huttenhower C , et al. , 2009. Computationally driven, quantitative experiments discover genes required for mitochondrial biogenesis. PLoS Genet 5 , doi: 10.1371/journal.pgen.1000407. Hiruma K, Onozawa Komori M, Takahashi F , et al. , 2010. Entry mode dependent function of an indole glucosinolate pathway in Arabidopsis for nonhost resistance against anthracnose pathogens. Plant Cell 22 , 2429 43. Horbach R, Navarro Quesada AR, Knogge W, Deising HB, 2011. When and how to kill a plant cell: Infection strategies of plant pathogenic fungi. J Plant Physiol 168 , 51 62. Howard RJ, Ferrari MA, 1989. Role of melanin in appressorium function. Exp Mycol 13 , 403 18. Howell HE, 1975. Correlation of virulence with secretion in vitr o of three wall degrading enzymes in isolates of Sclerotinia fructigena obtained after mutagen treatment. J Gen Microbiol 90 , 32 40. Hu X, Bidney DL, Yalpani N , et al. , 2003. Overexpression of a gene encoding hydrogen peroxide generating oxalate oxidase ev okes defense responses in sunflower. Plant Physiol 133 , 170 81. Huang HC, Dueck J, 1980. Wilt of sunflower from infection by mycelial germinating sclerotia of Sclerotinia sclerotiorum . Canadian Journal of Plant Pathology 2 , 47 52. Huang HC, Kokko EG, 1992. Pod rot of dry peas due to infection by ascospores of Sclerotinia sclerotiorum . Plant Disease 76 , 597 601 . Huffaker A, Dafoe NJ, Schmelz EA, 2011. ZmPep1, an ortholog of Arabidopsis elicitor peptide 1, regulates maize innate immunity and enhances disease resistance. Plant Physiol 155 , 1325 38. Huffaker A, Ryan CA, 2007. Endogenous peptide defense signals in Arabidopsis differentially amplify signaling for the innate immune response. Proceedings of the National Academy of Sciences 104 , 10732 6. Isshiki A, A kimitsu K, Yamamoto M, Yamamoto H, 2001. Endopolygalacturonase is essential for citrus black rot caused by Alternaria citri but not brown spot caused by Alternaria alternata . Molecular Plant Microbe Interactions 14 , 749 57. Jain C, Pastor K, Gonzalez AY, L orenz MC, Rao RP, 2013. The role of Candida albicans AP 1 protein against host derived ROS in in vivo models of infection. Virulence 4 , 67 76.

PAGE 207

207 Jamaux I, Gelie B, Lamarque C, 1995. Early stages of infection of rapeseed petals and leaves by Sclerotinia scler otiorum revealed by scanning electron microscopy. Plant Pathology 44 , 22 31. Jeon J, Choi J, Park J, Lee Y H, 2008. Functional genomics in the rice blast fungus to unravel the fungal pathogenicity. Journal of Zhejiang University SCIENCE B 9 , 747 52. Jooste n HJ, Han Y, Niu W, Vervoort J, Dunaway Mariano D, Schaap PJ, 2008. Identification of fungal oxaloacetate hydrolyase within the isocitrate lyase/PEP mutase enzyme superfamily using a sequence marker based method. Proteins 70 , 157 66. Jurick WM, 2nd, Rollin s JA, 2007. Deletion of the adenylate cyclase (sac1) gene affects multiple developmental pathways and pathogenicity in Sclerotinia sclerotiorum . Fungal Genet Biol 44 , 521 30. Just VJ, Stevenson CEM, Bowater L, Tanner A, Lawson DM, Bornemann S, 2004. A clos ed conformation of Bacillus subtilis oxalate decarboxylase OxdC provides evidence for the true Identity of the active site. Journal of Biological Chemistry 279 , 19867 74. Kabbage M, Williams B, Dickman MB, 2013. Cell death control: the interplay of apoptos is and autophagy in the pathogenicity of Sclerotinia sclerotiorum . PLoS Pathog 9 , doi: 10.1371/journal.ppat.1003287. Kars I, Krooshof GH, Wagemakers L, Joosten R, Benen JaE, Van Kan JaL, 2005. Necrotizing activity of five Botrytis cinerea endopolygalacturo nases produced in Pichia pastoris . The Plant Journal 43 , 213 25. Kasza Z, Vagvolgyi C, Fevre M, Cotton P, 2004. Molecular characterization and in planta detection of Sclerotinia sclerotiorum endopolygalacturonase genes. Curr Microbiol 48 , 208 13. Kesarwani M, Azam M, Natarajan K, Mehta A, Datta A, 2000. Oxalate decarboxylase from Collybia velutipes : molecular cloning and its overexpression to confer resistance to fungal infection in transgenic tobacco and tomato. Journal of Biological Chemistry 275 , 7230 8 . Khan SR, 1995. Calcium oxalate in biological systems . CRC Press. Khuri S, Bakker FT, Dunwell JM, 2001. Phylogeny, function, and evolution of the cupins, a structurally conserved, functionally diverse superfamily of proteins. Molecular Biology and Evoluti on 18 , 593 605. Kim HJ, Chen C, Kabbage M, Dickman MB, 2011. Identification and characterization of Sclerotinia sclerotiorum NADPH oxidases. Appl Environ Microbiol 77 , 7721 9.

PAGE 208

208 Kim JH, Lee BW, Schroeder FC, Jander G, 2008a. Identification of indole glucosin olate breakdown products with antifeedant effects on Myzus persicae (green peach aphid). The Plant Journal 54 , 1015 26. Kim KS, Min JY, Dickman MB, 2008b. Oxalic acid is an elicitor of plant programmed cell death during Sclerotinia sclerotiorum disease dev elopment. Molecular Plant Microbe Interactions 21 , 605 12. Kim YT, Prusky D, Rollins JA, 2007. An activating mutation of the Sclerotinia sclerotiorum pac1 gene increases oxalic acid production at low pH but decreases virulence. Mol Plant Pathol 8 , 611 22. Kora C, Mcdonald MR, Boland GJ, 2003. Sclerotinia rot of carrot: An example of phenological adaptation and bicyclic development by Sclerotinia Sclerotiorum . Plant Disease 87 , 456 70. Kretschmer M, Klose J, Kronstad JW, 2012. Defects in mitochondrial and pe roxisomal oxidation influence virulence in the maize pathogen Ustilago maydis . Eukaryot Cell 11 , 1055 66. Kubicek CP, Schreferl Kunar G, Wohrer W, Rohr M, 1988. Evidence for a cytoplasmic pathway of oxalate biosynthesis in Aspergillus niger . Appl Environ Microbiol 54 , 633 7. Kubo Y, Takano Y, Endo N, Yasuda N, Tajima S, Furusawa I, 1996. Cloning and structural analysis of the melanin biosynthesis gene SCD1 encoding scytalone dehydratase in Colletotrichum lagenarium . Appl Environ Microbiol 62 , 4340 4. Kück U, Hoff B, 2006. Application of the nourseothricin acetyltransferase gene (nat1) as dominant marker for the transformation of filamentous fungi. Fungal Genetics Newsletter 53 , 9 11. Kunz C, Vandelle E, Rolland S , et al. , 2006. Characterization of a new, n onpathogenic mutant of Botrytis cinerea with impaired plant colonization capacity. New Phytologist 170 , 537 50. Kurle JE, Grau CR, Oplinger ES, Mengistu A, 2001. Tillage, crop sequence, and cultivar effects on Sclerotinia stem rot incidence and yield in so ybean. Agron. J. 93 , 973 82. L'haridon F, Besson Bard A, Binda M , et al. , 2011. A permeable cuticle is associated with the release of reactive oxygen species and induction of innate immunity. PLoS Pathog 7 , doi: 10.1371/journal.ppat.1002148. Lai Z, Wang F, Zheng Z, Fan B, Chen Z, 2011. A critical role of autophagy in plant resistance to necrotrophic fungal pathogens. The Plant Journal 66 , 953 68.

PAGE 209

209 Laluk K, Mengiste T, 2010. Necrotroph attacks on plants: wanton destruction or covert extortion? The Arabidopsis Book 8 , doi:10.1199/tab.0136. Lampl N, Alkan N, Davydov O, Fluhr R, 2013. Set point control of RD21 protease activity by AtSerpin1 controls cell death in Arabidopsis . Plant J 74 , 498 510. Lanver D, Mendoza Mendoza A, Brachmann A, Kahmann R, 2010. Sho1 and Msb2 related proteins regulate appressorium development in the smut fungus Ustilago maydis . Plant Cell 22 , 2085 101. Lehner A, Meimoun P, Errakhi R, Madiona K, Barakate M, Bouteau F, 2008. Toxic and signalling effects of oxalic acid: Oxalic acid Natural b orn killer or natural born protector? Plant Signal Behav 3 , 746 8. Lenz HD, Haller E, Melzer E, Gust AA, Nurnberger T, 2011. Autophagy controls plant basal immunity in a pathogenic lifestyle dependent manner. Autophagy 7 , 773 4. Leroch M, Mernke D, Koppenh oefer D , et al. , 2011. Living colors in the gray mold pathogen Botrytis cinerea : codon optimized genes encoding green fluorescent protein and mCherry, which exhibit bright fluorescence. Appl Environ Microbiol 77 , 2887 97. Lessing F, Kniemeyer O, Wozniok I , et al. , 2007. The Aspergillus fumigatus transcriptional regulator AfYap1 represents the major regulator for defense against reactive oxygen intermediates but is dispensable for pathogenicity in an intranasal mouse infection model. Eukaryot Cell 6 , 2290 30 2. Lev S, Hadar R, Amedeo P, Baker SE, Yoder OC, Horwitz BA, 2005. Activation of an AP1 like transcription factor of the maize pathogen Cochliobolus heterostrophus in response to oxidative stress and plant signals. Eukaryot Cell 4 , 443 54. Li G, Zhou Z, Li u G, Zheng F, He C, 2007. Characterization of T DNA insertion patterns in the genome of rice blast fungus Magnaporthe oryzae . Curr Genet 51 , 233 43. Li M, Liang X, Rollins JA, 2012. Sclerotinia sclerotiorum gamma glutamyl transpeptidase (Ss Ggt1) is requir ed for regulating glutathione accumulation and development of sclerotia and compound appressoria. Molecular Plant Microbe Interactions 25 , 412 20. Li M, Rollins JA, 2009. The development specific protein (Ssp1) from Sclerotinia sclerotiorum is encoded by a novel gene expressed exclusively in sclerotium tissues. Mycologia 101 , 34 43. Li M, Rollins JA, 2010. The development specific ssp1 and ssp2 genes of Sclerotinia sclerotiorum encode lectins with distinct yet compensatory regulation. Fungal Genet Biol 47 , 531 8.

PAGE 210

210 Li R, Rimmer R, Buchwaldt L, Sharpe AG, Seguin Swartz G, Hegedus DD, 2004. Interaction of Sclerotinia sclerotiorum with Brassica napus : cloning and characterization of endo and exo polygalacturonases expressed during saprophytic and parasitic modes . Fungal Genet Biol 41 , 754 65. Liberti D, Rollins JA, Dobinson KF, 2013. Peroxysomal carnitine acetyl transferase influences host colonization capacity in Sclerotinia sclerotiorum . Molecular Plant Microbe Interactions 26 , 768 80. Lin CH, Yang SL, Chung KR , 2009. The YAP1 homolog mediated oxidative stress tolerance is crucial for pathogenicity of the necrotrophic fungus Alternaria alternata in citrus. Molecular Plant Microbe Interactions 22 , 942 52. Lin SY, Okuda S, Ikeda K, Okuno T, Takano Y, 2012. LAC2 en coding a secreted laccase is involved in appressorial melanization and conidial pigmentation in Colletotrichum orbiculare . Molecular Plant Microbe Interactions 25 , 1552 61. Lipka V, Dittgen J, Bednarek P , et al. , 2005. Pre and postinvasion defenses both c ontribute to nonhost resistance in Arabidopsis . Science 310 , 1180 3. Liu W, Zhou X, Li G , et al. , 2011. Multiple plant surface signals are sensed by different mechanisms in the rice blast fungus for appressorium formation. PLoS Pathog 7 , doi: 10.1371/journ al.ppat.1001261. Liu Y, Chen Y, 2007. High efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. Biotechniques 43 , 649 56. Liu Z, Wu Y, Yang F , et al. , 2013. BIK1 interacts with PEPRs to mediate ethylene induced immu nity. Proceedings of the National Academy of Sciences 110 , 6205 10. Liu Z, Zhang Z, Faris JD , et al. , 2012. The Cysteine rich necrotrophic effector SnTox1 produced by Stagonospora nodorum triggers susceptibility of wheat lines harboring Snn1 . PLoS Pathog 8 , doi: 10.1371/journal.ppat.1002467. Livak KJ, Schmittgen TD, 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2 method. Methods 25 , 402 8. Livingstone DM, Hampton JL, Phipps PM, Grabau EA, 2005. Enhancing resis tance to Sclerotinia minor in peanut by expressing a barley oxalate oxidase gene. Plant Physiol 137 , 1354 62. Llorente F, Alonso Blanco C, Sánchez Rodriguez C, Jorda L, Molina A, 2005. ERECTA receptor like kinase and heterotrimeric G protein from Arabidops is are required for resistance to the necrotrophic fungus Plectosphaerella cucumerina . The Plant Journal 43 , 165 80.

PAGE 211

211 Lumsden RD, Dow RL, 1972. Histopathology of Sclerotinia sclerotiorum infection of bean. Phytopathology 63 , 708 16. Lumsden RD, Wergin WP, 1 980. Scanning electron microscopy of infection of bean by species of Sclerotinia . Mycologia 12 , 1200 10. essential for acid stress induction of oxalate decarboxylase in Bacillus subtilis . J Bacteriol 191 , 931 9. Magro P, Marciano P, Di Lenna P, 1988. Enzymatic oxalate decarboxylation in isolates of Sclerotinia sclerotiorum . FEMS Microbiol Lett 49 , 49 52. Mäkelä M, Hildén K, Lundell T, 2010. Oxalate decarboxylase: biotechnological update and prevalence of the enzyme in filamentous fungi. Appl Microbiol Biotechnol 87 , 801 14. Mäkelä MR, Hildén K, Hatakka A, Lundell TK, 2009. Oxalate decarboxylase of the white rot fungus Dichomitus squalens demonstrates a novel enzyme primary structur e and non induced expression on wood and in liquid cultures. Microbiology 155 , 2726 38. Mäkelä MR, Sietiö O M, De Vries RP, Timonen S, Hildén K, 2014. Oxalate metabolising genes of the white rot fungus Dichomitus squalens are differentially induced on wood and at high proton concentration. PLoS One 9 , doi: 10.1371/journal.pone.0087959. Malagnac F, Lalucque H, Lepère G, Silar P, 2004. Two NADPH oxidase isoforms are required for sexual reproduction and ascospore germination in the filamentous fungus Podospora anserina . Fungal Genetics and Biology 41 , 982 97. Hydroxyethylorutin mediated enhancement of tomato resistance to Botrytis cinerea depends on a burst of reactive oxygen species. Journal of Phytopathology 150 , 616 24. Mansf ield JW, Richardson A, 1981. The ultrastructure of interactions between Botrytis species and broad bean leaves. Physiological Plant Pathology 19 , 41 8. Marciano P, Di Lenna P, Magro P, 1982. Polygalacturonase isoenzymes produced by Sclerotinia sclerotiorum in vivo and in vitro. Physiological Plant Pathology 20 , 201 12. Marciano P, Di Lenna P, Magro P, 1983. Oxalic acid, cell wall degrading enzymes and pH in pathogenesis and their significance in the virulence of two Sclerotinia sclerotiorum isolates on sunf lower. Physiological Plant Pathology 22 , 339 45. Marciano P, Magro P, Favaron F, 1989. Sclerotinia sclerotiorum growth and oxalic acid production on selected culture media. FEMS Microbiol Lett 61 , 57 60.

PAGE 212

212 Martinez D, Challacombe J, Morgenstern I , et al. , 20 09. Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion. Proceedings of the National Academy of Sciences 106 , 1954 9. Maruthachalam K, Klosterman SJ, Kang S, Hayes RJ, S ubbarao KV, 2011. Identification of pathogenicity related genes in the vascular wilt fungus Verticillium dahliae by Agrobacterium tumefaciens mediated T DNA insertional mutagenesis. Mol Biotechnol 49 , 209 21. Maxwell DP, 1973. Oxalate formation in Whetzeli nia sclerotiorum by oxaloacetate acetylhydrolase. Physiological Plant Pathology 3 , 279 88. Maxwell DP, Bateman DF, 1968. Influence of carbon source and pH on oxalate accumulation in culture filtrates of Sclerotium rolfsii . Phytopathology 58 , 1351 5. Maxwel l DP, Lumsden RD, 1970. Oxalic acid production by Sclerotinia sclerotiorum in infected bean and in culture. Phytopathology 60 , 1395 8. Mckeen WE, 1973. Mode of penetration of epidermal cell walls of Vicia faba by Botrytis cinerea . Phytopathology 64 , 461 7. Mcquilken MP, Chalton D, 2009. Potential for biocontrol of sclerotinia rot of carrot with foliar sprays of Contans ® WG ( Coniothyrium minitans ). Biocontrol Science and Technology 19 , 229 35. Meeley RB, Johal GS, Briggs SP, Walton JD, 1992. A biochemical ph enotype for a disease resistance gene of maize. Plant Cell 4 , 71 7. Mengiste T, 2012. Plant immunity to necrotrophs. Annual Review of Phytopathology 50 , 267 94. Mengiste T, Chen X, Salmeron J, Dietrich R, 2003. The BOTRYTIS SUSCEPTIBLE1 gene encodes an R2R 3MYB transcription factor protein that is required for biotic and abiotic stress responses in Arabidopsis . Plant Cell 15 , 2551 65. Micales JA, 1995. Oxalate decarboxylase in the brown rot wood decay fungus Postia placenta . Material und Organismen 29 , 177 8 6. Micales JA, 1997. Localization and induction of oxalate decarboxylase in the brown rot wood decay fungus Postia placenta . International Biodeterioration & Biodegradation 39 , 125 32. Molina L, Kahmann R, 2007. An Ustilago maydis gene involved in H 2 O 2 det oxification is required for virulence. Plant Cell 19 , 2293 309.

PAGE 213

213 Morita Y, Hyon G S, Hosogi N , et al. , 2013. Appressorium localized NADPH oxidase B is essential for aggressiveness and pathogenicity in the host specific, toxin producing fungus Alternaria al ternata Japanese pear pathotype. Mol Plant Pathol 14 , 365 78. Mueller DS, Pedersen WL, Hartman GL, 2002. Effect of crop rotation and tillage system on sclerotinia stem rot on soybean. Canadian Journal of Plant Pathology 24 , 450 6. Mullins ED, Chen X, Romai ne P, Raina R, Geiser DM, Kang S, 2001. Agrobacterium mediated transformation of Fusarium oxysporum : an efficient tool for insertional mutagenesis and gene transfer. Phytopathology 91 , 173 80. Munir E, Yoon JJ, Tokimatsu T, Hattori T, Shimada M, 2001. A ph ysiological role for oxalic acid biosynthesis in the wood rotting basidiomycete Fomitopsis palustris . Proc Natl Acad Sci U S A 98 , 11126 30. Nakao M, Nakamura R, Kita K, Inukai R, Ishikawa A, 2011. Non host resistance to penetration and hyphal growth of Ma gnaporthe oryzae in Arabidopsis . Scientifc Report , doi:10.1038/srep00171. Narusaka Y, Shinya T, Narusaka M , et al. , 2013. Presence of LYM2 dependent but CERK1 independent disease resistance in Arabidopsis . Plant Signal Behav 8 , doi: 10.4161/psb.25345. Need leman SB, Wunsch CD, 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48 , 443 53. Nguyen QB, Itoh K, Van Vu B, Tosa Y, Nakayashiki H, 2011. Simultaneous silencing of endo 1,4 xylanase genes reveals their roles in the virulence of Magnaporthe oryzae . Mol Microbiol 81 , 1008 19. Noda J, Brito N, Gonzalez C, 2010. The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity. B MC Plant Biol 10 , 38. Noyes RD, Hancock JG, 1981. Role of oxalic acid in the Sclerotinia wilt of sunflower. Physiological Plant Pathology 18 , 123 32. Ohtani K, Yamamoto H, Akimitsu K, 2002. Sensitivity to Alternaria alternata toxin in citrus because of alt ered mitochondrial RNA processing. Proceedings of the National Academy of Sciences 99 , 2439 44. Pedersen H, Christensen B, Hjort C, Nielsen J, 2000a. Construction and characterization of an oxalic acid nonproducing strain of Aspergillus niger . Metab Eng 2 , 34 41.

PAGE 214

214 Pedersen H, Hjort C, Nielsen J, 2000b. Cloning and characterization of oah, the gene encoding oxaloacetate hydrolase in Aspergillus niger . Mol Gen Genet 263 , 281 6. Pedras MS, Hossain M, 2006. Metabolism of crucifer phytoalexins in Sclerotinia scle rotiorum : detoxification of strongly antifungal compounds involves glucosylation. Org Biomol Chem 4 , 2581 90. Peltier AJ, Bradley CA, Chilvers MI , et al. , 2012. Biology, yield loss and control of Sclerotinia stem rot of soybean. Journal of Integrated Pest Management 3 , doi: 10.1603/IPM11033. Peñalva MA, Arst HN, 2002. Regulation of gene expression by ambient pH in filamentous fungi and yeasts. Microbiology and Molecular Biology Reviews 66 , 426 46. Perchepied L, Balague C, Riou C , et al. , 2010. Nitric oxide participates in the complex interplay of defense related signaling pathways controlling disease resistance to Sclerotinia sclerotiorum in Arabidopsis thaliana . Molecular Plant Microbe Interactions 23 , 846 60. Pérez Nadales E, Di Pietro A, 2011. The membran e mucin Msb2 regulates invasive growth and plant infection in Fusarium oxysporum . Plant Cell 23 , 1171 85. Pinedo C, Wang C M, Pradier J M , et al. , 2008. Sesquiterpene synthase from the botrydial biosynthetic gene cluster of the phytopathogen Botrytis ciner ea . ACS Chemical Biology 3 , 791 801. Powell ALT, Van Kan J, Ten Have A , et al. , 2000. Transgenic expression of pear PGIP in tomato limits fungal colonization. Molecular Plant Microbe Interactions 13 , 942 50. Purdy LH, 1958. Some factors affecting penetrati on and infection by Sclerotinia sclerotiorum . Phytopathology 48 , 605 9. Reignault P, Kunz C, Delage N , et al. , 2000. Host and symptom specific pectinase isozymes produced by Botrytis cinerea . Mycol Res 104 , 421 8. Reignault P, Valette Collet O, Boccara M, 2008. The importance of fungal pectinolytic enzymes in plant invasion, host adaptability and symptom type. European Journal of Plant Pathology 120 , 1 11. Reino JL, Hernández Galán R, Durán Patrón R, Collado IG, 2004. Virulence toxin production relationshi p in isolates of the plant pathogenic fungus Botrytis cinerea . Journal of Phytopathology 152 , 563 6.

PAGE 215

215 Rietz S, Bernsdorff FE, Cai D, 2012. Members of the germin like protein family in Brassica napus are candidates for the initiation of an oxidative burst th at impedes pathogenesis of Sclerotinia sclerotiorum . J Exp Bot 63 , 5507 19. Rogers LM, Kim Y K, Guo W, González Candelas L, Li D, Kolattukudy PE, 2000. Requirement for either a host or pectin induced pectate lyase for infection of Pisum sativum by Nectria hematococca . Proceedings of the National Academy of Sciences 97 , 9813 8. Rolke Y, Liu S, Quidde T , et al. , 2004. Functional analysis of H 2 O 2 generating systems in Botrytis cinerea : the major Cu Zn superoxide dismutase (BCSOD1) contributes to virulence on French bean, whereas a glucose oxidase (BCGOD1) is dispensable. Mol Plant Pathol 5 , 17 27. Rollins JA, 2003. The Sclerotinia sclerotiorum pac1 gene is required for sclerotial development and virulence. Molecular Plant Microbe Interactions 16 , 785 95. Rolli ns JA, Dickman MB, 2001. pH signaling in Sclerotinia sclerotiorum : identification of a pacC/RIM1 homolog. Appl Environ Microbiol 67 , 75 81. Rossi FR, Gárriz A, Marina M , et al. , 2011. The sesquiterpene botrydial produced by Botrytis cinerea induces the hyp ersensitive response on plant tissues and its action Is modulated by salicylic acid and jasmonic acid signaling. Molecular Plant Microbe Interactions 24 , 888 96. Rowe HC, Kliebenstein DJ, 2008. Complex genetics control natural variation in Arabidopsis thal iana resistance to Botrytis cinerea . Genetics 180 , 2237 50. Ruijter GJG, Van De Vondervoort PJI, Visser J, 1999. Oxalic acid production by Aspergillus niger : an oxalate non producing mutant produces citric acid at pH 5 and in the presence of manganese. Mic robiology 145 , 2569 76. Ryder LS, Dagdas YF, Mentlak TA , et al. , 2013. NADPH oxidases regulate septin mediated cytoskeletal remodeling during plant infection by the rice blast fungus. Proceedings of the National Academy of Sciences 110 , 3179 84. Sánchez Ro dríguez C, Estévez JM, Llorente F , et al. , 2009. The ERECTA receptor like kinase regulates cell wall mediated resistance to pathogens in Arabidopsis thaliana . Molecular Plant Microbe Interactions 22 , 953 63. Sanchez Vallet A, Ramos B, Bednarek P , et al. , 2 010. Tryptophan derived secondary metabolites in Arabidopsis thaliana confer non host resistance to necrotrophic Plectosphaerella cucumerina fungi. The Plant Journal 63 , 115 27. Schlaeppi K, Abou Mansour E, Buchala A, Mauch F, 2010. Disease resistance of A rabidopsis to Phytophthora brassicae is established by the sequential action of indole glucosinolates and camalexin. The Plant Journal 62 , 840 51.

PAGE 216

216 Schweizer P, Jeanguenat A, Whitacre D, Métraux JP, Mösinge E, 1996. Induction of resistance in barley against Erysiphe graminis f.sp. hordei by free cutin monomers. Physiological and Molecular Plant Pathology 49 , 103 20. Scott Craig JS, Cheng Y Q, Cervone F, De Lorenzo G, Pitkin JW, Walton JD, 1998. Targeted mutants of Cochliobolus carbonum lacking the two major extracellular polygalacturonases. Appl Environ Microbiol 64 , 1497 503. Sedun FS, Brown JF, 1987. Infection of sunflower leaves by ascospores of Sclerotinia sclerotiorum . Annals of Applied Biology 110 , 275 84. Segmüller N, Kokkelink L, Giesbert S, Odinius D , Van Kan J, Tudzynski P, 2008. NADPH oxidases are involved in differentiation and pathogenicity in Botrytis cinerea . Molecular Plant Microbe Interactions 21 , 808 19. Seoane S, Lamas Maceiras M, Rodríguez Torres AM, Freire Picos MA, 2009. Involvement of Pt a1, Pcf11 and a KlCYC1 AU rich element in alternative RNA 3' end processing selection in yeast. FEBS Lett 583 , 2843 8. Sexton AC, Minic Z, Cozijnsen AJ, Pedras MS, Howlett BJ, 2009. Cloning, purification and characterisation of brassinin glucosyltransferas e, a phytoalexin detoxifying enzyme from the plant pathogen Sclerotinia sclerotiorum . Fungal Genet Biol 46 , 201 9. Shen Y H, Liu R J, Wang H Q, 2008. Oxalate decarboxylase from Agrobacterium tumefaciens C58 is translocated by a twin arginine translocation system. J Microbiol Biotechnol 18 , 1245 51. Shieh MT, Brown RL, Whitehead MP , et al. , 1997. Molecular genetic evidence for the involvement of a specific polygalacturonase, P2c, in the invasion and spread of Aspergillus flavus in cotton bolls. Appl Environ Microbiol 63 , 3548 52. Shimazono H, 1955. Oxalic acid decarboxylase, a new enzyme from the mycelium of wood destroying fungi. J Biochem 42 , 321 40. Shingu Vazquez M, Traven A, 2011. Mitochondria and fungal pathogenesis: drug tolerance, virulence, and poten tial for antifungal therapy. Eukaryot Cell 10 , 1376 83. Shinogi T, Suzuki T, Kurihara T, Narusaka Y, Park P, 2003. Microscopic detection of reactive oxygen species generation in the compatible and incompatible interactions of Alternaria alternata Japanese pear pathotype and host plants. Journal of General Plant Pathology 69 , 7 16. Solanas M, Moral R, Escrich E, 2001. Improved non radioactive Northern blot protocol for detecting low abundance mRNAs from mammalian tissues. Biotechnol Lett 23 , 263 6.

PAGE 217

217 Sposato P , Ahn JH, Walton JD, 1995. Characterization and disruption of a gene in the maize pathogen Cochliobolus carbonum encoding a cellulase lacking a cellulose binding domain and hinge region. Molecular Plant Microbe Interactions 8 , 602 10. Staiger D, Korneli C, Lummer M, Navarro L, 2013. Emerging role for RNA based regulation in plant immunity. New Phytologist 197 , 394 404. Starratt AN, Ross LM, Lazarovits G, 2002. 1,8 Dihydroxynaphthalene monoglucoside, a new metabolite of Sclerotinia sclerotiorum , and the effe ct of tricyclazole on its production. Can J Microbiol 48 , 320 5. Stergiopoulos I, Collemare J, Mehrabi R, De Wit PJ, 2013. Phytotoxic secondary metabolites and peptides produced by plant pathogenic Dothideomycete fungi. FEMS Microbiol Rev 37 , 67 93. Stotz HU, Sawada Y, Shimada Y , et al. , 2011. Role of camalexin, indole glucosinolates, and side chain modification of glucosinolate derived isothiocyanates in defense of Arabidopsis against Sclerotinia sclerotiorum . Plant J 67 , 81 93. Subbarao KV, 1998. Progress toward integrated management of lettuce drop. Plant Disease 82 , 1068 78. Sutton DC, Deverall BJ, 1983. Studies on infection of bean ( Phaseolus vulgaris ) and soybean ( Glycine max ) by ascospores of Sclerotinia sclerotiorum . Plant Pathology 32 , 251 61. Svedr , et al. , 2005. The enzymes of oxalate metabolism: unexpected structures and mechanisms. Archives of Biochemistry and Biophysics 433 , 176 92. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S, 2011. MEGA5: Molecular Ev olutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28 , 2731 9. Tang D, Simonich MT, Innes RW, 2007. Mutations in LACS2, a long chain acyl coenzyme A synthetase, enhan ce susceptibility to avirulent Pseudomonas syringae but confer resistance to Botrytis cinerea in Arabidopsis . Plant Physiol 144 , 1093 103. Tariq VN, Jeffries P, 1984. Appressorium formation by Sclerotinia sclerotiorum : scanning electron microscopy. Transac tions of British Mycological Society 82 , 645 52. Tariq VN, Jeffries P, 1985. Changes occurring in chloroplasts of Phaseolus following infection by Sclerotinia : a cytochemical study. J Cell Sci 75 , 195 205.

PAGE 218

218 Tariq VN, Jeffries P, 1986. Ultrastructure of pene tration of Phaseolus spp. by Sclerotinia sclerotiorum . Canadian Journal of Botany 64 , 2909 15. Temme N, Tudzynski P, 2009. Does Botrytis cinerea ignore H 2 O 2 induced oxidative stress during infection? Characterization of Botrytis activator protein 1. Molecu lar Plant Microbe Interactions 22 , 987 98. Tenberge KB, Beckedorf M, Hoppe B, Schouten A, Solf M, Von Den Driesch M, 2002. In situ localization of AOS in host pathogen interactions. Microscopy and Microanalysis 8 , 250 1. Tiedemann AV, 1997. Evidence for a primary role of active oxygen species in induction of host cell death during infection of bean leaves with Botrytis cinerea . Physiological and Molecular Plant Pathology 50 , 151 66. Tsuge T, Harimoto Y, Akimitsu K , et al. , 2013. Host selective toxins produc ed by the plant pathogenic fungus Alternaria alternata . FEMS Microbiol Rev 37 , 44 66. Tsuji J, Jackson EP, Gage DA, Hammerschmidt R, Somerville SC, 1992. Phytoalexin accumulation in Arabidopsis thaliana during the hypersensitive reaction to Pseudomonas syr ingae pv syringae . Plant Physiol 98 , 1304 9. Uchimura H, Enjoji H, Seki T, Taguchi A, Tsakaya N, Shoun+ H, 2002. Nitrate reductase formate dehydrogenase couple involved in the fungal denitrification by Fusarium oxysporum . J Biochem 131 , 579 86. Underwood W , 2012. The plant cell wall: A dynamic barrier against pathogen invasion. Frontiers in Plant Science 3 , doi: 10.3389/fpls.2012.00085. Unger C, Kleta S, Jandl G, Tiedemann AV, 2005. Suppression of the defence related oxidative burst in bean leaf tissue and bean suspension cells by the necrotrophic pathogen Botrytis cinerea . Journal of Phytopathology 153 , 15 26. Valette Collet O, Cimerman A, Reignault P, Levis C, Boccara M, 2003. Disruption of Botrytis cinerea pectin methylesterase gene Bcpme1 reduces virulen ce on several host plants. Molecular Plant Microbe Interactions 16 , 360 7. Van Kan JaL, Van 'T Klooster JW, Wagemakers CaM, Dees DCT, Van Der Vlugt Bergmans CJB, 1997. Cutinase A of Botrytis cinerea is expressed, but not essential, during penetration of ge rbera and tomato. Molecular Plant Microbe Interactions 10 , 30 8. Van Vu B, Itoh K, Nguyen QB, Tosa Y, Nakayashiki H, 2012. Cellulases belonging to glycoside hydrolase families 6 and 7 contribute to the virulence of Magnaporthe oryzae . Molecular Plant Micro be Interactions 25 , 1135 41. Vega RR, Corsini D, Le Tourneau D, 1970. Nonvolatile organic acids produced by Sclerotinia sclerotiorum in synthetic liquid media. Mycologia 62 , 332 8.

PAGE 219

219 Veluchamy S, Rollins JA, 2008. A CRY DASH type photolyase/cryptochrome from Sclerotinia sclerotiorum mediates minor UV A specific effects on development. Fungal Genet Biol 45 , 1265 76. Veluchamy S, Williams B, Kim K, Dickman MB, 2012. The CuZn superoxide dismutase from Sclerotinia sclerotiorum is involved with oxidative stress to lerance, virulence, and oxalate production. Physiological and Molecular Plant Pathology 78 , 14 23. Veronese P, Nakagami H, Bluhm B , et al. , 2006. The membrane anchored BOTRYTIS INDUCED KINASE1 plays distinct roles in Arabidopsis resistance to necrotrophic and biotrophic pathogens. Plant Cell 18 , 257 73. Walton JD, 1994. Deconstructing the cell wall. Plant Physiol 104 , 1113 8. Walz A, Zingen Sell I, Theisen S, Kortekamp A, 2008. Reactive oxygen intermediates and oxalic acid in the pathogenesis of the necrotr ophic fungus Sclerotinia sclerotiorum . European Journal of Plant Pathology 120 , 317 30. Wang X, Zhu X, Tooley P, Zhang X, 2013. Cloning and functional analysis of three genes encoding polygalacturonase inhibiting proteins from Capsicum annuum and transgeni c CaPGIP1 in tobacco in relation to increased resistance to two fungal pathogens. Plant Mol Biol 81 , 379 400. Warwar V, Oved S, Dickman MB, 2000. Antisense expression of the calmodulin gene from Colletotrichum trifolii impairs prepenetration development. F EMS Microbiol Lett 191 , 213 9. Watanabe T, Hattori T, Tengku S, Shimada M, 2005. Purification and characterization of NAD dependent formate dehydrogenase from the white rot fungus Ceriporiopsis subvermispora and a possible role of the enzyme in oxalate met abolism. Enzyme Microb Technol 37 , 68 75. Weiergang I, Dunkle LD, Wood KV, Nicholson RL, 1996. Morphogenic regulation of pathotoxin synthesis in Cochliobolus carbonum . Fungal Genetics and Biology 20 , 74 8. Williams B, Kabbage M, Kim HJ, Britt R, Dickman MB , 2011. Tipping the balance: Sclerotinia sclerotiorum secreted oxalic acid suppresses host defenses by manipulating the host redox environment. PLoS Pathog 7 , doi: 10.1371/journal.ppat.1002107. Winton LM, Krohn AL, Leiner RH, 2006. Genetic diversity of Scl erotinia species from Alaskan vegetable crops. Canadian Journal of Plant Pathology 28 , 426 34. Workneh F, Yang XB, 2000. Prevalence of sclerotinia stem rot of soybeans in the north central United States in relation to tillage, climate, and latitudinal posi tions. Phytopathology 90 , 1375 82.

PAGE 220

2 20 Xiao X, Xie J, Cheng J , et al. , 2013. Novel secretory protein Ss Caf1 of the plant pathogenic fungus Sclerotinia sclerotiorum is required for host penetration and normal sclerotial development. Molecular Plant Microbe Int eractions 27 , 40 55. Xu L, Chen W, 2013. Random T DNA mutagenesis identifies a Cu/Zn superoxide dismutase gene as a virulence factor of Sclerotinia sclerotiorum . Molecular Plant Microbe Interactions 26 , 431 41. Yajima W, Liang Y, Kav NN, 2009. Gene disrupt ion of an arabinofuranosidase/beta xylosidase precursor decreases Sclerotinia sclerotiorum virulence on canola tissue. Molecular Plant Microbe Interactions 22 , 783 9. Yakoby N, Beno Moualem D, Keen NT, Dinoor A, Pines O, Prusky D, 2001. Colletotrichum gloe osporioides pelB is an important virulence factor in avocado fruit fungus interaction. Molecular Plant Microbe Interactions 14 , 988 95. Yang SL, Chung K R, 2013. Similar and distinct roles of NADPH oxidase components in the tangerine pathotype of Alternari a alternata . Mol Plant Pathol 14 , 543 56. Zhang JX, Bruton BD, Miller ME, Isakeit T, 1999. Relationship of developmental stage of cantaloupe fruit to black rot susceptibility and enzyme production by Didymella bryoniae . Plant Disease 83 , 1025 32. Zhou J, S un A, Xing D, 2013. Modulation of cellular redox status by thiamine activated NADPH oxidase confers Arabidopsis resistance to Sclerotinia sclerotiorum . J Exp Bot 64 , 3261 72. Zhou N, Tootle TL, Glazebrook J, 1999. Arabidopsis PAD3, a gene required for cama lexin biosynthesis, encodes a putative cytochrome P450 monooxygenase. Plant Cell 11 , 2419 28. Zhu W, Wei W, Fu Y , et al. , 2013. A secretory protein of necrotrophic fungus Sclerotinia sclerotiorum that suppresses host resistance. PLoS One 8 , doi: 10.1371/jo urnal.pone.0053901. Zuppini A, Navazio L, Sella L, Castiglioni C, Favaron F, Mariani P, 2005. An endopolygalacturonase from Sclerotinia sclerotiorum induces calcium mediated signaling and programmed cell death in soybean cells. Molecular Plant Microbe Inte ractions 18 , 849 55.

PAGE 221

221 BIOGRAPHICAL SKETCH Xiaofei Liang was born in 1987 in Liangping, a small village which belongs to the Henan province, place where he was born and he enjoyed playi ng together with his friends in and out of doors. He l ove s farming and rural life. He was admitted to the Northwest A&F University in September, 2003 , his major was Biotechnology and he received his degree in July, 2007. In September of the same year, he started his graduate study in the department of p lant p athology of the same u niversity and he received his degree in July, 2010. The research project of his master study was on gene cloning and expression analysis of chitin metabolism re lated genes from the wheat stripe rust fungus Puccinia striiformis f.sp. tritici . In 2010, Xiaofei was awarded an Alumni Fellowship from the Plant Pathology Department, University of Florida, which allowed him to pursue a Ph.D. study in Dr. Jeffrey A. Roll His doctoral research project was on genetic regulation of oxalic acid metabolism and pathogenesis in Sclerotinia sclerotiorum .