Citation
Recombinant Myxoma Virus Lacking All Poxvirus Ankyrin-Repeat Proteins Stimulates Multiple Cellular Anti-Viral Pathways and Exhibits a Severe Decrease in Virulence

Material Information

Title:
Recombinant Myxoma Virus Lacking All Poxvirus Ankyrin-Repeat Proteins Stimulates Multiple Cellular Anti-Viral Pathways and Exhibits a Severe Decrease in Virulence
Creator:
Lamb, Stephanie Anne
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (49 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Medicine
Committee Chair:
MCFADDEN,DOUGLAS GRANT
Committee Co-Chair:
LEWIN,ALFRED S
Committee Members:
CONDIT,RICHARD C
KARST,STEPHANIE M
SCHULTZ,GREGORY SCOTT
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Ankyrins ( jstor )
Cell lines ( jstor )
In vitro fertilization ( jstor )
Infections ( jstor )
Lesions ( jstor )
Myxoma virus ( jstor )
Poxviridae ( jstor )
Proteins ( jstor )
Rabbits ( jstor )
Viruses ( jstor )
Medicine -- Dissertations, Academic -- UF
m-t5 -- myxoma -- poxvirus
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Medical Sciences thesis, M.S.

Notes

Abstract:
The study of poxviral host-range proteins has led to the elucidation of numerous anti-viral pathways, the discovery of anti-inflammatory biologics and the development of an immunogenic expression vector for transgene vaccination strategies. A common approach for assessing poxvirus gene function is through the production and characterization of knockout poxviruses. However, this method is somewhat limited by the functional redundancy of multiple genes within the viral genome. For example, cowpox virus encodes multiple ankyrin-repeat (ANK-R) proteins that selectively block the activation of NF-KB, a critical regulator of anti-viral gene expression. In this study, a rabbit-specific poxvirus, myxoma virus (vMyx), was genetically altered to disrupt the open reading frames (ORFs) of one or more ANK-R protein(s). Within the vMyx genome, the four ANK-R proteins, M-T5, M148, M149 and M150, can be knocked out through the disruption of M-T5 in the terminal-inverted repeat (TIR) and the simultaneous deletion of the tandem M148-M150 ORFs. In this report, we demonstrate that the infection of A549 cells with the complete ANK-R knockout vMyx (ANKs KO) results in a robust activation of the NF-KB pathway. Notably, ANKs KO infection was at least 40-fold more potent at stimulating NF-KB activation relative to either MT5KO or M148-M150 KO (148-150 KO) infection. While both 148-150 KO and ANKs KO infection triggered the release of IL-8 into the supernatant, an increased release of IL-6 was only observed upon infection with ANKs KO. In order to determine the role of ANK-R proteins in vivo, rabbits were infected with WT, MT5KO, 148-150 KO, ANKs KO and all revertant vMyxs. ANKs KO exhibited defective viral dissemination, like MT5KO, and produced the smallest primary lesion of all ANK-R mutant viruses. Overall, this study emphasizes the functional redundancy in poxvirus genomes and provides the first characterization of a knockout poxvirus lacking all ANK-R proteins. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2014.
Local:
Adviser: MCFADDEN,DOUGLAS GRANT.
Local:
Co-adviser: LEWIN,ALFRED S.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31
Statement of Responsibility:
by Stephanie Anne Lamb.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

RECOMBINANT MYXOMA VIRUS LACKING ALL POXVIRUS ANKYRIN REPEAT PROTEINS STIMULATES MULTIPLE CELLULAR ANTI VIRAL PATHWAYS AND EXHIBITS A SEVERE DECREASE IN VIRULENCE By STEPHANIE A. LAMB A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Stephanie Lamb

PAGE 3

To all the family, friends and colleagues who have supported me through the discovery process and helped celebrate my achievements .

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank Dr. Grant McFadden for his excellent mentorship during the execution of this project. I must express my appreciation for all of the past and present members of the lab who have provided useful suggestions. I would particularly like to thank Dr. Masmudur Rahman for h is constant guidance during my time at UF. Due to my severe rabbit allergy, Dr. Masmudur Rahman and Dot Smith were jointly responsible for the completion of the rabbit study detailed in this thesis. I would like to express my gratitude for the suggestions and perspective given to me by my supervisory committee. Finally, I would like to thank my family and my fiancé for their unconditional love and support.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 6 LIST OF FIGURE S ................................ ................................ ................................ .......... 7 ABSTRACT ................................ ................................ ................................ ..................... 8 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 10 Poxviruses: Past and Present ................................ ................................ ................. 10 Myxoma Virus ................................ ................................ ................................ ......... 10 Myxoma Viral Host Range Genes ................................ ................................ ........... 11 Cellular Ankyrin Repeat Proteins ................................ ................................ ............ 12 Poxviral ANK R Protein Superfamily ................................ ................................ ....... 12 Myxoma Virus ANK R Proteins ................................ ................................ ............... 13 Research Outline and Rational ................................ ................................ ............... 13 2 IN VITRO CHARACTERIZATION OF ANK R MUTANT MYXOMA VIRUSES ....... 16 Materials and Methods ................................ ................................ ............................ 16 Cell Lines ................................ ................................ ................................ .......... 16 Viral Preparation ................................ ................................ ............................... 16 Construction of Recombinant Viruses ................................ .............................. 16 Single Step Growth Curves ................................ ................................ .............. 18 Immunofluorescence ................................ ................................ ........................ 18 ELISA ................................ ................................ ................................ ............... 19 Cell Viability Assays ................................ ................................ ......................... 19 Results ................................ ................................ ................................ .................... 20 3 IN VIVO CHARACTERIZATION OF ANK R MYXOMA VIRUSES .......................... 32 Materials and Methods ................................ ................................ ............................ 32 Result s ................................ ................................ ................................ .................... 32 4 DISCUSSION ................................ ................................ ................................ ......... 39 LIST OF REFERENCES ................................ ................................ ............................... 44 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 49

PAGE 6

6 LIST OF TABLES Table page 2 1 Nomenclature and characteristics of ANK R KO viruses ................................ .... 25 2 2 Primer sequences used to create recombinant virus plasmids ........................... 26 3 1 Criteria for scoring rabbits ................................ ................................ .................. 35 3 2 Pathogenesis of ANK R KO vMyxs in New Zealand White (NZW) rabbits ......... 37 4 1 Overview of ANK R mutant vMyx construct phenotypes ................................ .... 43

PAGE 7

7 LIST OF FIGURES Figure page 1 1 The inhibition of the NF poxviral ANK R proteins. ...................... 15 2 1 Construction of ANK R mutant and revertant viruses. ................................ ........ 27 2 2 Myxoma virus lacking M T5 exhibits defective replication in A549 (a human lung cancer cell line) and RL 5 (a rabbit T cell line). ................................ .................. 28 2 3 ANK R KO infection stimulates the nuclear accumulation of p65 in A549 cells. . 29 2 4 Kineti cs of cytokine secretion in virus infected A549 cells in vitro. ...................... 30 2 5 Detection of cell death and cell proliferation following infection with ANK R Mutant vMyx. ................................ ................................ ................................ ...... 31 3 1 Attenuation of vMyx virulence during ANK R mutant vMyx infection. ................. 38

PAGE 8

8 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science RECOMBINANT MYXOMA VIRUS LACKING ALL POXVIRUS ANKYRIN REPEAT PROTEINS STIMULATES MULTIPLE CELLULAR ANTI VIRAL PATHWAYS AND EXHIBITS A SEVERE DECREASE IN VIRULENCE By Stephanie A. Lamb August 2014 Chair: Douglas Grant McFadden Major: Medical Sciences (MDM) A common approach for assessing poxvirus gene function is through the production and characterization of knockout poxviruses. However, this method is somewhat limited by the functional redundancy of multiple genes within the viral genome . In this study, a rabbit specific poxvirus, myxoma virus (vMyx), was genetically altered to disrupt the open reading frames (ORFs) of one or more ANK R protein(s). Within the vMyx genome, the four ANK R proteins, M T5, M148, M149 and M150, can be knocked ou t through the disruption of M T5 in the terminal inverted repeat (TIR) and the simultaneous deletion of the tandem M148 M150 ORFs. In this report, we demonstrate that the infection of A549 cells with the complete ANK R knockout vMyx (ANKs KO) results in a robust activation of the NF infection was at least 40 fold more potent at stimulating NF either MT5KO or M148 M150 KO (148 150 KO) infection. While both 148 150 KO and ANKs KO infection triggered the release of IL 8 into the supernatant, an increased release of IL 6 was only observed upon infection with ANKs KO. In order to determine the role of ANK R proteins in vivo, rabbits were infected with WT, MT5KO, 148 150 KO,

PAGE 9

9 ANKs KO and all revertant vMyxs. A NKs KO exhibited defective viral dissemination, like MT5KO, and produced the smallest primary lesion of all ANK R mutant viruses. Overall, this study emphasizes the functional redundancy in poxvirus genomes and provides the first characterization of a knoc kout poxvirus lacking all ANK R proteins.

PAGE 10

10 CHAPTER 1 INTRODUCTION Poxviruses: Past and Present A single poxvirus, variola virus (the causative agent of smallpox), plagued mankind for over 3000 years. [ 1 ] The high morbidity and mortality resulting from smallpox infection led t o a concerted, and ultimately successful, vaccination effort to eradicate the virus. Although the threat of naturally occurring smallpox infections has been eliminated, the continued study of poxviruses remains prudent for a variety of reasons. First, sin ce smallpox vaccination has been discontinued to avoid vaccine related complications, affordable treatments and safer vaccines are being developed to provide protection against smallpox based bioterrorist attacks. [ 2 ] Also, the development of effective treatments and prophylactics for specific poxviruses also helps minimize disfigurement and de ath caused by poxviruses with human tropism, such as cowpox, monkeypox, and Molluscum contagiosum . [ 3 5 ] While some poxviruses are problematic and pathogenic, there are a number of poxviruses that have been exploited to combat human disease. For example, Vaccinia virus (VacV) has been used in clinical trials to treat cancer by selectively infecting cancer cells and, also, to act as an immunogeni c expression vector platform for transgene vaccination strategies [ 2 , 6 , 7 ] Myxoma V irus Myxoma virus (vMyx), a rabbit specific poxvirus, is both an effective vertebrate pest control agent and a promising oncolytic virus candidate. [ 8 , 9 ] After the European rabbit ( Oryctolagus cuniculus ) was introduced to Australia in the mid 19 th century, the now feral rabbits quickly began to breed, spread and consume large quantities of

PAGE 11

11 into wild rabbit populations during the 1950s. [ 10 ] Within its natural host, Sylvilagus sp, vMyx produces a localized, benign lesion. However, within the European rabbit the virus produces a rapid, widespread and usually fatal infection. [ 8 ] Although vMyx exhibits a strict rabbit tropism when inoculated into normal, healthy animals, this virus is also capable of selectively infecting and killing a variety of human and rodent cancer cells in vitro and in vivo . [ 9 ] In general, outside the rabbit species, cancer cells are more susceptible to viral infection, relative to healthy non rabbit cells, because common anti viral pathways are frequently disabled when cells become transformed to the cancerous phenotype. [ 11 ] The ability of vMyx to selectively infect and kill human cancer cells makes it an ideal candidate for oncolytic virotherapy. vMyx, like other poxviruses, consists of a dsDNA genome flanked with terminal inverted repeats and a brick shaped vi rion. The virus genome encodes 159 unique genes that can be classified into two basic categories. [ 12 ] The first classification, housekeeping genes, are absolutely essential for poxviral replication. These gen es are located within the central region of the viral genome and are highly conserved among poxviruses. The terminal inverted repeats and flanking genomic regions contain a large number of immunoregulatory and/or host range genes, which are responsible for determining viral tropism. Myxoma Viral Host Range Genes The functions of numerous vMyx host range genes have been previously reported. In general, the functions of their gene products can be categorized as anti apoptotic, anti NF inflammasome, c ytokine inhibitors, blockers of leukocyte

PAGE 12

12 activation or chemotaxis and serine protease inhibitors. [ 13 , 14 ] Note that NF signaling can be e ither pro apoptotic or anti apoptotic depending on the stimulus. [ 15 18 ] Cellular Ankyrin Repeat Proteins ANK R motifs are one of the most prevalent protein motifs en coded by eukaryotes. Multiple helix loop helix domains within the ANK R protein coalesce and specifically interact with a large variety of target proteins. [ 19 ] Two well studied cellular ANK R proteins, inhibitor of NF activation of NF the sequestration of p65, a subunit of the NF [ 20 , 21 ] ( Figure 1 1 ) It dimerize in the cytoplasm, translocate to the nucleus and activate NF responsive gene transcription. [ 22 ] Despite the ubiquitous presence of ANK R proteins in eukaryotes, the ANK R protein motif is absent in all viruses e xcept poxviruses. [ 23 ] Poxviral ANK R Protein Superfamily Phylogenetic analysis has revealed that the poxviral ANK R protein superfamily lik ely originated from an ancestral ANK R protein containing both an N terminal ANK R domain and a C terminal Poxvirus Repeat of Ankyrin C terminus (PRANC) domain. [ 23 ] The unique arrangement of these two domains has only been observed in poxviruses, Rickettsia sp. and parasitoid wasps. [ 24 ] Thus far, multiple poxvirus members of this superfamily, such as K1L, CP77, CP006, and G1R, have been identified as inhibitors of the NF [ 25 28 ] ( Figure 1 1 )

PAGE 13

13 Myxoma Virus ANK R Proteins Myxoma virus encodes four distinct members of the poxviral ANK R protein superfamily, called M T5, M148, M149 and M150. While each of these proteins possess a different number of N Terminal ANK R domains, they all possess a PRANC C terminal domain, which binds the ce llular adaptor protein Skp1 in vitro and in vivo . [ 29 ] Skp1 is an important member of the cellular Skp1 cullin F box (SCF) complex, which in turn is responsible for ubiquitinating cellular protein targets that regulate key host pathways (such as cell cycle regulation) for proteasome dependent degradation. [ 30 ] Thus far, at least two functional roles have been uncovered for M T5. Early studies have reported that M T5 helps prevent cell cycle arrest and apoptosis during vMyx infection. [ 31 , 32 ] M T5 appears to modulate the cell cycle by acting as an adaptor between the ubiquitination/proteosomal degradation machinery of the cell and the cell cycle regulator p27/Kip1. [ 31 ] MT5KO exhibits defective dissemination in rabbits, likely due to an inability of the virus to suppress apoptosis during T cell infection. [ 32 ] More recently, M T5 has also been found to bind and activate cellular AKT by promoting AKT phosphorylation at serine 473 during vMyx infection. [ 29 , 33 ] Much less is known about the functions of M148, M149 and M150 during viral infection, although the deletion of individual genes reduces virus virulence in infected rabbits. [ 34 , 35 ] Some preliminary evidence suggests that M150, also called Myxoma Nuclear Factor (MNF), might be involved in the suppression of NF [ 35 ] Research Outline and Rational Prior to this study, no knockout poxviruses lacking all ANK R proteins had been characterized in vitro . Although Molluscum contagiosum virus naturally encodes no ANK R proteins, the lack of an effective method to repli cate and purify viral stocks, as

PAGE 14

14 well as the absence of an animal model, severely limits the use of this virus. [ 36 ] In this study, vMy x constructs lacking all, or a combination of, genes encoding ANK R proteins were created, purified and characterized. The ANK R Mutant vMyxs tested in this study are MT5KO (inactivation of both copies of the M T5 gene that maps within the TIR region of th e vMyx genome), 148 150 KO (deletion of the entire M148 M149 M150 gene locus near the right TIR), and ANKs KO (loss of both copies of M T5 plus M148, M149 and M150). The initial characterization of these viruses was performed in both a human cell line with a functional NF predictive for overall virus virulence in animal experiments (RL 5) [ 37 ] . Also, an in vivo study in virus infected rabbits was completed in order to determine the overall impact of the ANK R protein superfamily on vMyx virulence.

PAGE 15

15 Figure 1 1 . The inhibition of the NF R proteins.

PAGE 16

16 CHAPTER 2 IN VITRO CHARACTERIZATION OF ANK R MUTANT MYXOMA VIRUSES Materials and Methods Cell L ines Monkey cell line BSC 40 (ATCC# CRL 1658), human cell line A549 (ATCC# CCL 185), and rabbit cell line RK13 (ATCC# CCL Modified Eagle Medium (DMEM; Invitrogen) suppleme nted with 10% fetal bovine serum (FBS; Gibco), 2 mM L glutamine, and 100 U/mL of penicillin/streptomycin (pen/strep; Invitrogen). RL 5 cells were cultured in RPMI 1640 medium (Lonza, BioWhittaker) supplemented with 10% FBS, 2 mM L glutamine, and 100 U/mL o f pen/strep. All cultures were maintained in a humidified chamber at 37° C and 5% CO 2. The BSC40 monkey kidney cell line was received as a gift from Richard Condit from the University of Florida. During maintenance, cell cultures were periodically tested to confirm the absence of contaminating mycoplasma species, using a PCR based assay (Southern Biotech #13100 01) Viral Preparation All viruses used in this study were grown and amplified in BSC40 cells. Viruses were purified by centrifugation through a suc rose cushion as described previously. [ 39 ] Most viruses in this study were titered in BSC40 cells. However, both WT Lausanne and 148 150 KO Rev were titered in RK13 cells. Construction of Recombinant V iruses The production of MT5KO was described previously. [ 32 ] Two novel ANK R mutant viruses, 148 150 KO and ANKs KO, and three revertant viruses, M T5KO Rev, 148 150 Rev, and ANKs KO Rev, were produced during the course of this study. ( Table

PAGE 17

17 2 1 ) ( Figure 2 1 ) Either recombinant plasmids or recombinant PCR products were constructed to hybridize with specific regions of the vMyx genome. To generate 148 150 150 DSred2 was created. Overlapping PCR was used to flank a DSred2 expression cassette, driven by a synthetic poxviral early promoter, with ~ 1 kb of hybridizing sequence. These flanking sequences were selec ted to facilitate the replacement of the M148, M149, and M150 locus of vMyx with a DSred2 expression cassette. The primers used for the amplification of this recombinant PCR product contained flanking attB sequences that enabled the insertion of the PCR pr oduct into the Gateway cloning donor vector pDNR222. (Invitrogen) ( Table 2 2 ) 148 150 KO and ANKs KO were created by infecting BSC40 cells with either WT or MT5KO, respectively, followed by transfection with 150 DSred2. ( Figure 2 1 B) Multiple rounds of focus purifications were performed based on DSred2 expression and continued until pure foci were isolated and confirmed by PCR using appropriate primers. After ANK R mutant vMyx constructs were purified and confirmed, revertant viruses were mad e from each knockout virus. The M T5 sequence in MT5KO and ANKs KO was restored by infecting a selectively permissive cell line Caki1, which favors WT replication, and subsequently cotransfecting both pBS135 136eGFP (described previously) and a revertant p lasmid containing the complete M T5 sequence with ~ 500 bp flanking genomic sequence. ( Figure 2 1 A) [ 40 ] Multiple rounds of foci purification were performed based on both foci size and eGFP expression. Next, the 148 149 150 locus was reintroduced into 148 150 KO and the Partial ANKs KO revertant vMyx through the infection of BSC 40 cells followed by transfection with a PCR product

PAGE 18

18 containing the ORFs 148 150 and 1000 bp of flanking genomic sequence. ( Figure 2 1 A) 148 150 KO revertant vMyx was purified in RK13 cells through many rounds of clear plaque selection. The complete ANKs KO revertant underwent multiple rounds of foci purification in BSC40s based on eGFP expression in the absence of DSred2 expression. The purity of the revertant viruses were confirmed by PCR using appropriate primers. Single Step Growth C urves Cells were se eded into 24 well dishes in semi confluent monolayers (1.25×10 5 cells) and infected with WT or ANK R mutant vMyx constructs at an MOI of 5 for an hour. After an hour of incubation, the inoculum was removed, the cell monolayer was washed with PBS and fresh complete media was added to the monolayer. Samples were collected at various times post samples were freeze minute to release virus from infected cells. The virus was titrated on BSC40 cells by serial dilution in triplicate. After 48 hrs of infection, the number of fluorescent foci were counted and the viral titer was calculated. Immunofluorescence On rat collagen coated coverslips, vMyx permissive human A549 cells (5×10 3 ) were seeded and either mock infected or infected with WT, MT5KO, 148 150, and ANKs KO vMyx for 1 hr at 37°C. After removal of the inoculum, the monolayers were washed with PBS and covered in fresh media. At specified time points po st infection, coverslips were washed with PBS and fixed with 4% paraformaldehyde (Sigma) for 15 minutes at 4 degrees Celsius. The fixative was then discarded and excess paraformaldehyde was removed by washing 3X with cold PBS. The coverslip was then

PAGE 19

19 blocke d with Blocking buffer (5% FBS +PBS +0.3% TritonX 100) for 1 hr at RT. In order to detect p65, the coverslip was incubated with rabbit anti p65 (sc 372; Santa Cruz) diluted 1:100 in Antibody dilution buffer (1X PBS, 3% BSA/0.3% TritonX 100) overnight at 4 degrees Celsius. Residual primary antibody was removed by 3 15 min washes with PBS. A 2 hr RT incubation with Alexafluor 488 (green) goat anti rabbit antibody diluted 1:1,000 in Antibody dilution buffer was performed next. Another set of PBS washes was exe cuted to remove excess secondary antibody. After p65 labeling, coverslips were mounted on microscope slides with 7.5 µL Vecta shield hard mounting media with DAPI 2 phenylindole; Vector Laboratories) for the visualization of nuclei. Cells w ere viewed using the Leica inverted fluorescent microscope. ELISA A549 cells (5X10 5 ) were seeded in a 6 well plates. The following day, the cells were mock infected, infected with WT, MT5KO, 148 150 or ANKs KO vMyx (at MOI of 5), or treated with the TLR ag onist Pam2CSK4, which is known to stimulate NF activation. Supernatants were collected at specified time points post infection. The concentration of IL 6 and IL 8 in the supernatants was determined using Ready Set Go! ® ELISA assay kits (eBioscience) fo Cell V iability A ssays For trypan blue exclusion assays, A549 cells (5X10 5 ) were seeded into 6 well plates. The following day, the cells were either mock infected or infected with WT, MT5KO, 148 150 or ANKs KO vMyx (at MOI of 5). Both detached cells in the supernatant and trypsinized adherent cells were pooled together. After th e cells were pelleted and resuspended in 250 uL of fresh media, the samples were incubated at room temperature for 15 min in a 0.2% solution of trypan blue dye (Sigma). Cytotoxicity

PAGE 20

20 was calculated as the percentage of cells permeated by trypan blue divided by the total number of cells. The relative quantity of viable, proliferating cells after infection was estimated by measuring mitochondrial function using CellTiter 96 Non Radioactive Cell Proliferation Assay (MTT, Promega). A549 cells (5.0X10 3 ) were see ded into 96 well dishes and infected with WT or ANK R mutant vMyxs (MOI 5) at 24, 48, and 72 hours prior to the execution of the MTT assay. After the first hour of infection, the inoculum was removed, the cell monolayer was washed with PBS and fresh comple te media was added. The was performed in triplicate and the results provide an indication of the relative quantity of viable/proliferating cells after the different treatm ents. Results Previous studies have indicated that the ability of MT5KO vMyx to replicate in a variety of test mammalian cell lines is influenced by the basal level of cellular AKT phosphorylation and/or a cellular susceptibility to cell cycle arrest. [ 31 , 41 ] Since the cellular tropism of 148 150 KO and ANKs KO vMyx has not been i nvestigated, single step growth curves for WT, MT5KO, 148 150 KO, and ANKs KO vMyx were performed in a number of cell lines. Both BSC40 (monkey kidney) and RK13 (rabbit kidney) cell lines are known to be highly permissive to WT vMyx infection. WT, MT5KO, 148 150 KO, and ANKs KO vMyx all demonstrate comparable levels of viral replication and production of progeny virus. ( Figure 2 2 A and C) This control confirms that these viruses are capable of optimal kinetics replication under favorable permissive cellul ar conditions.

PAGE 21

21 The functional NF permissive human lung cancer cell line A549 makes it an optimal model for the study of potential NF modulators, like the poxviral ANK R proteins. Single step growth curve analysis within A5 49 cells revealed a significant defect in the replication of vMyx lacking M T5 in A549 cells. ( Figure 2 2 B) The further deletion of the M148 M150 gene locus did not alter the ability of the recombinant ANKs KO vMyx to replicate within A549 cells. An earli er report by Mossman et. al. reported defective MT5KO replication within the rabbit T cell RL5. [ 32 ] In this study, and others, the defective replication of mutant vMyx in RL 5 cells has frequently been correlated with in vivo virus attenuation in rabbits. [ 32 , 42 , 43 ] Prior to the initiation of vMyx rabbit studies, the ability of newly constructed 148 150 KO and ANKs KO vMyx to replicate in RL5 cells was tested. In agreement with the literature, vMyx lacking M T5 displayed a notable defect in replicative ability within RL 5 cells. ( Figure 2 2 D) However, the M148 M150 deletion alone does not appear to affect vMyx replication in RL 5 cells, nor does it further exacerbate the replication defect observed for the MT5KO virus when it is within the ANKs KO virus. Although several members of the poxviral ANK R superfamily have been shown to act as inhibitors of the classical NF ay, no previous studies have reported NF in vitro infection with vMyx lacking one or multiple ANK R proteins. [ 25 , 26 ] Since A549 cells posses s a functional NF a defect in the replication of vMyx lacking M T5, the ability of WT and ANK R mutant vMyx to stimulate the NF of endogenous p65 from the cytoplasm to the nucleus of a cell is indicative of the

PAGE 22

22 activation of the classical NF cells after WT/ANK R mutant vMyx infection was assessed via immunofluorescence. Overall, ANKs KO infection of A549 cells triggered the nuclear accumulation of p65 in a higher percentage of cells than WT, MT5KO or 148 150 KO vMyx infection. ( Figure 2 3 A) The disparity between the ability of WT and ANK R Mutant vMyx infection to stimulate NF s after infection and was most dramatic at 12 hours post infection. Relative to WT vMyx infection, the percentage of A549 cells with a nuclear accumulation of p65 after 12 hours of MT5KO, 148 150 KO, and ANKs KO vMyx infection (MOI 5) increased approximate ly 40, 20, and 120 fold, respectively. A representative image produced after immunofluorescence for p65 in A549 cells following 12 hours of mock, WT or ANKs KO infection is shown. ( Figure 2 3 B) A majority of cells within the monolayer after mock or WT inf ection exhibit segregation between p65 (green anti p65 immunoflourescence) and nuclei (blue DAPI.) In contrast, most cells within a monolayer infected with ANKs KO vMyx demonstrate extensive co localization between p65 and the nucleus. Previous studies ha ve reported that the activation of the NF A549 cells by various ssRNA viruses leads to the secretion of IL 8 and/or IL 6. [ 44 49 ] Interestingly, all the ANK R mutant vMyx constructs also stimulate NF A549 cells, but to varying degrees. Further experiments with ANK R mutant vMyx constructs were performed to determine if, as in the case of ssRNA virus infections, an i ncreased release of IL 8 and/or IL 6 accompanies NF KO vMyx infection, a slight delay in IL 8 and IL 6 secretion occurred relative to the kinetics of NF t

PAGE 23

23 increase in the release of IL 8 at 48, 72 and 96 HPI compared to WT vMyx infection. ( Figure 2 4 A) ANKs KO vMyx infection also stimulated an increased secretion of IL 6 at 72 and 96 HPI. ( Figure 2 4 B) In contrast, 148 150 KO vMyx infection did not stimu late the release of IL 6. However, 148 150 KO vMyx infection did significantly increase the release of IL 8 at 72 and 96 HPI. Unexpectedly, MT5KO infection did not promote the secretion of IL 8 or IL 6. ( Figure 2 4 A and B) If anything, the secretion of IL 8 and IL 6 appears to be significantly reduced in MT5KO vMyx infected cells relative to WT vMyx infected cells. The ability of MT5KO to trigger excessive levels of apoptotic cell death might provide an explanation for this paradoxical increase in NF timulation accompanied by a decrease in cytokine release. Early studies of M T5 have described the anti apoptotic function of M T5 in vitro . [ 31 ] In order to determine the effect of ANK R mutant vMyx infections on cell viability and proliferation, a trypan blue exclusion assay and the MTT assay were performed at various time points post infection to assess cell integrity and metab olic function of mitochondria, respectively. At both 24 and 48 HPI, MT5KO and ANKs KO vMyx infection caused a significant (~5 fold) increase in cytotoxicity relative to 148 150 KO or WT vMyx infection, as measured by the exclusion of trypan blue. ( Figure 2 5 A) Curiously, the MTT assay detected a similar decrease of mitochondrial function in cells at 24 and 48 HPI during WT, MT5KO, 148 150 KO and ANKs KO vMyx infection. ( Figure 2 5 B) This could indicate that the surviving cells in WT and 148 150 KO infecti on exhibit retarded proliferation. By 72 HPI, the number of cells with actively metabolic mitochondria does begin to significantly decrease during

PAGE 24

24 infection with MT5KO and ANKs KO vMyx, relative to 148 150 KO or WT vMyx infection.

PAGE 25

25 Table 2 1. Nomenclature and characteristics of ANK R KO viruses Virus Name Abbreviation Genetic Alterations vMyx WT Lausanne vMyx WT Lau N/ A vMyx WT LacZ GFP vMyx WT Intergenic p11 LacZ between M010 and M011 Intergenic EL GFP between M135 and M136 vMyx MT5KO LacZ GFP Eco GPT vMyx MT5KO Intergenic p11 LacZ between M010 and M011 Intergenic EL GFP between 135 and 136 Intragenic EL eco GPT within M005 vMyx M148/M149/150KO DSred2 vMyx 148 150KO EL DSred2 replacing M148 M15 0 vMyx MT5KO/M148/M149/ M150KO LacZ Eco GPT DSred2 vMyx ANKsKO Intergenic p11 LacZ between M010 and M011 Intragenic EL eco GPT within M005 EL DSred2 replacing M148 M150 vMyx MT5KO Revertant vMyx MT5KO Rev Intergenic EL GFP between 135 and 136 Intergenic p11 LacZ between M010 and M011 vMyx M148/M149/150KO Revertant vMyx 148 150 KO Rev N/A vMyx MT5KO/M148/M149/M150 KO Revertant vMyx ANKsKO Rev Intergenic EL GFP between 135 and 136 Intergenic p11 LacZ between M010 and M011

PAGE 26

26 Table 2 2. Primer sequences used to create recombinant virus plasmids Primer Name Sequence attB1_F GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACC attB2_R GGGGACCACTTTGTACAAGAAAGCTGGGTCCAA 1_attB1M147F AAAGCAGGCTCCACCACCAGTGTTTTATACACAAAGGAG 2_5M148ELF GGATTATCTAAAGAAAGAACTCTGCAGGTCGACTCTAG 3_RED3M150R CGATGGCTTGAATGTTAGAATTCGAGCTCGGTAC 4_M151R ACAAGAAAGCTGGGTCCAAGCTGTCGTACCGAACTCGGTC attB1_MT5F AAAGCAGGCTCCACCCTCGATAATCGCGAGTACATTTTC attB2_MT5R ACAAGAAAGCTGGGTCCAAGATTCCGGACGTGGAATATTGG AC M147_F_full_attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCACCAGTG TTTTATACACAAAGGAG M151_R_full_attB2 GGGGACCACTTTGTACAAGAAAGCTGGGTCCAAGCTGTCGT ACCGAACTCGGTC

PAGE 27

27 Figure 2 1 . Construction of ANK R mutant and revertant viruses.

PAGE 28

28 Figure 2 2 . Myxoma virus lacking M T5 exhibits defective replication in A549 (a human lung cancer cell line) and RL 5 (a rabbit T cell line).

PAGE 29

29 Figure 2 3 . ANK R KO infection stimulates the nuclear accumulation of p65 in A549 cells.

PAGE 30

30 Figure 2 4 . Kinetics of cytokine secretion in virus infected A549 cells in vitro .

PAGE 31

31 Figure 2 5. Detection of cell death and cell proliferation following infection with ANK R Mutant vMyx.

PAGE 32

32 CHAPTER 3 IN VIVO CHARACTERIZATION OF ANK R MYXOMA VIRUSES Materials and Methods Rabbit Experiments : New Zealand White rabbits were purchased from Charles River Laboratories International. This animal study was approved by the Institutional Animal Care and Usage Committee (IACUC) at the University of Florida. This study was performed as described previous ly. [ 37 ] Briefly, 1000 focus forming units (FFU) of the tested virus was resuspended in 100 µl of PBS and inoculated intradermally in the left flank of each rabbit. Daily physical examinations were performed to evaluate the condition of the rabbits by monitoring respiration, temperature, heart rate, weight, attitude, lung sound, food and water intake, urine and feces output, hydration status, posture, indications of primar y lesion and the appearance of secondary lesions. ( Table 3 1 ) The rabbits receive a daily clinical score (from 0 to 34) that is dependent on observations collected during the daily evaluation. The animals were humanely euthanized when the clinical score re ached 26 to 34, had open mouth breathing due to respiratory stress, orthopnea, cyanosis or no food and water intake for 48 hr. Results In vivo infection studies in NZW rabbits were previously reported for MT5KO, 148 KO, 149 KO, 150 KO, and 148 149 double KO vMyx. [ 32 , 34 , 35 ] Each of these viruses were attenuated, in varying degrees, relative to WT vMyx infection. At the time of writi ng, no previous reports have examined the impact of selectively deleting the entire ANK R protein superfamily on poxviral virulence. In this study, 148 150 KO (lacking 3 ANK R genes) and ANKs KO vMyx (mutant for all 5 ANK R genes) were tested for virulence in NZW rabbits. WT, MT5KO, MT5KO revertant, 148 150 revertant and ANKs

PAGE 33

33 KO revertant vMyx infections were also performed in tandem. In congruence with previous findings, WT and all revertant vMyx inoculations of NZW rabbits resulted in a rapid, wide spread and fatal infection. Within four days of inoculation of WT and revertant vMyx, a sizable primary lesion and minute secondary lesions (5/8 rabbits) were apparent. ( Table 3 2 ) By the seventh day of infection, the lesions became more severe and numerous. Als o, the majority of the infected rabbits developed a mucosal bacterial infection (7/8). Ultimately, at 9 10 days post inoculation, the animals had to be euthanized due to the increasing severity of clinical symptoms, according to IACUC regulations. ( Table 3 1 ) Comparatively, 148 150 KO vMyx infection was much less severe than WT vMyx infection. ( Figure 3 1 B) More specifically, the size/number of lesions and the severity of the mucosal bacterial infections were diminished during 148 150 KO infection. Despite this attenuation, 148 150 KO vMyx infection displayed a similar progression of symptoms within the first 7 DPI as WT vMyx infection. However, while WT vMyx infection symptoms rapidly intensified after 7 days, 148 150 KO vMyx infection began showing signs of healing after 7 DPI and all rabbits recovered fully within 17 DPI. Mossman et. al. previously determined that MT5KO vMyx infection in NZW rabbits exhibited both reduced lesion size and an almost complete absence of viral dissemination. [ 32 ] In this study, our observations during MT5KO vMyx infection were consistent with this previous report. ( Table 3 2 , Figure 3 1 A) Overall, these in vivo observations demonstrate that knocking out M T5 alone produced a more severe viral attenuation than knocking out M148, M149 and M150 together. Since M148 KO, M149 KO, M150 KO and MT5KO vMyx are all attenuated, ANKs KO vMyx was predicted to be

PAGE 34

34 severely atte nuated. Indeed, in vivo ANKs KO vMyx infection produced smaller primary lesions than either 148 150 KO or MT5KO infection. ( Figure 3 1 A) Also, ANKs KO, like the parental virus MT5KO, was defective in systemic viral dissemination. ( Table 3 2 )

PAGE 35

3 5 Table 3 1. Criteria for scoring r abbits Assessments 0 1 2 4 Posture Normal Sitting erect, ears up, moving freely, lying stretched out Abnormal Some reduction in spontaneous activity, will move with gentle encouragement but prefers to be inactive. Change in posture. Very Abnormal Little to no spontaneous activity. Eating and Drinking Normal Abnormal Reduced intake Very Abnormal Minimal intake Attitude Normal Bright and alert, interested in surroundings; usual temperament Abnormal A bit dull but still active in investigating new situation, objects placed in pen. Very Abnormal Very dull, not interested in surroundings, preoccupied. Capitalize first letters of all principal words Hydration Normal No tent or twist Abnormal Tent, but returns to shape after <30 seconds Very Abnormal Tent and does not return to shape readily Eyes Normal Abnormal Conjunctivitis either unilateral or bilateral may be occasional nodules. Eyes are not closed. Very Abnormal Severe conjunctivitis with purulent discharge. Eyes may be partially closed. Lids swollen Nose Normal Abnormal Some swelling or discharge either purulent or purulohaemorrhagic Very Abnormal Severe swelling and/or profuse discharge Respiration Normal Abnormal >10% difference from daily average in uninfected Very Abnormal >20% difference from daily average in uninfected

PAGE 36

36 Table 3 1. Continued Assessments 0 1 2 4 Ears Normal Abnormal Some swelling or discharge either purulent or purulohaemorrhagic Very Abnormal Severe swelling and/or profuse discharge Heart Rate Normal 180 250 bpm Abnormal 140 180 bpm Very Abnormal <140 bpm Temperature Normal 101.3 104°F Abnormal 104.1 106°F Very Abnormal >106°F Weight Normal Constant weight gain Abnormal No weight gain Very Abnormal Weight loss Feces Normal Normal amount and consistency Abnormal Reduced amount or alteration in consistency Very Abnormal Minimal elimination or very liquid feces Injection site Normal No swelling/ reaction at site Abnormal Ulceration and/or diffuse reaction Very Abnormal Severe swelling of lesion, necrosis, etc. Viremia (secondary lesions other than nose, ear and eye) Normal No secondary lesions present. Abnormal Secondary lesions present, minimal Very Abnormal Secondary lesions present, severe. Note: Conditions which require immediate euthanasia: If a rabbit reaches a score of 26/34, or should it exhibit any of the following conditions, it will be euthanized immediately: 1. Orthopnea 2. Mouth breathing 3. Cyanosis 4. Essentially no food or water intake >48 hrs

PAGE 37

37 Table 3 2 . Pathogenesis of ANK R KO vMyxs in New Zealand White (NZW) rabbits Day vMyx WT and Revertants vMyx MT5KO vMyx 148 150KO vMyx ANKsKO 0 Inoculation of two rabbits intradermally with 1,000 PFU or FFU for each of the following viruses: vMyx WT Lausanne, vMyx MT5KO Revertant, vMyx 148 150 Revertant, vMyx ANKsKO Revertant Inoculation of three rabbits intradermally with 1,000 FFU of vMyx MT5KO Inoculation of four rabbits intradermally with 1,000 FFU of vMyx 148 150KO Inoculation of four rabbits intradermally with 1,000 FFU of vMyx ANKsKO 4 Primary lesions at inoculation sites: 2.0 3.0 cm (8/8) Raised, soft, red lesions (4/8) Raised, red, necrotic lesions (4/8) Multiple secondary lesions on ears (5/8) Primary lesions at inoculation sites: Raised, soft, red (ca 2.0 2.5 cm) (3/3) Primary lesions at inoculation sites: Raised, soft, red (ca 2.0 2.5 cm) (4/4) One rabbit exhibited minute secondary lesions on the ear Primary lesions at inoculation sites: R aised, soft, red (ca. 1.5 2.5 cm) (4/4) 7 Primary lesions red, swollen, necrotic (4.0 5.0 cm) 8/8 Multiple secondary myxomas in the eyes, ears, and nose. (8/8) Gram negative bacteria infections of conjunctivas (7/8) Primary lesions red, swollen, necrotic, healing (2.0 2.5 cm) (3/3) Primary lesions red, swollen, necrotic (ca 3.5 5.0 cm) (4/4) Multiple minute secondary myxomas (4/4), gram negative bacterial infections of conjunctivas (2/4) Primary lesions red, swollen, necrotic (ca. 1.5 2.0 cm) (4/ 4) 9 10 Primary lesions red, swollen, necrotic (5.0 6.0 cm) (8/8) Multiple secondary myxomas, turning necrotic, dyspnea, severe infections of respiratory tracts, prostrated and emaciated animals. All rabbits were sacrificed due to the severity of sympto ms Primary lesions swollen, but healing Primary lesions swollen, but healing Secondary lesions healing (4/4) Primary lesions swollen, but healing 17 Full regression of primary lesions Full regression of primary and secondary lesions Full regression of primary lesions

PAGE 38

38 Figure 3 1. Attenuation of vMyx virulence during ANK R mutant vMyx infection.

PAGE 39

39 CHAPTER 4 DISCUSSION ANKs KO vMyx is the first complete ANK R knockout recombinant poxvirus to be propagated and analyzed in vitro and in vivo . ANK R proteins are widely found in eukaryotes, and are often associated with the control of diverse cellular pathways via protein protein interactions. [ 19 ] Double stranded DNA viruses often encode multiple modulatory proteins that selectively interfere with intracellular signaling pathways, such as NF [ 38 , 50 ] In the case of vMyx, there are 5 genes that express ANK R proteins (2 copies of M T5, M148, M149 and M150). This study found that the vMyx gene M T5 i s required for the optimal replication of vMyx in both human A549 and in rabbit RL 5 T cells. ( Figure 2 2 ) This defective replication was associated with excessive cytotoxicity in A549 cells during infection with vMyx lacking M T5. ( Figure 2 5 A) These fin dings are consistent with an early study that demonstrated both defective MT5KO replication and abortive MT5KO infection in RL 5 cells. [ 32 ] In contrast, the triple deletion of M148 M149 M150 from vMyx had no effect on viral replication or cell viability in either of these cells. Thus, the ability of M T5 to prevent cytotoxicity, as measured by both trypan blue exclusion and MTT assays, appears to be unique among the poxviral ANK R proteins. Prior to this study, a number of poxviral ANK R proteins and cellular ANK R proteins have been shown to prevent the activation of NF [ 25 , 26 , 38 , 51 ] This study provides the first evid ence that vMyx ANK R proteins block NF stages of infection. Relative to WT vMyx infection, MT5KO, 148 150 KO and ANKs KO infection, at 12 HPI, increased the percentage of A549 cells with nuclear p65 accumulation by 40, 20 and 120 fold, respectively. ( Figure 2 3 A) Since p65 migration

PAGE 40

40 from the cytoplasm to the nucleus is a classical indicator for the activation of NF data indicates that the one collective function of the vMyx ANK R proteins is to block NF dramatic increase in the number of stimulated cells after ANKs KO infection, relative to both MT5KO and 148 150 KO, indicates that there is some redundancy in the ability of ANK R proteins to prevent NF infection. Thus, the delet ion of the entire ANK R superfamily is necessary investigate the cumulative impact of these viral proteins on NF Thus far, we have shown that ANK R mutant vMyx infection can both activate NF 549 cells with ssRNA viruses, such as Respiratory Syncytial Virus and Influenza A virus, has previously been shown to activate the NF 8/IL 6 secretion. [ 15 , 5 2 ] Similarly, in this study, ANKs KO vMyx infection was found to stimulate the release of IL 8 and IL 6. ( Figure 2 4 A and B) In addition, 148 150 KO vMyx infection triggered IL 8 release. ( Figure 2 4 A) Unexpectedly, the amount of IL 8 and IL 6 released during MT5KO vMyx infection of A549, at most time points post infection, was less than the amount secreted during WT vMyx infection. Since MT5KO exhibits increased NF 8 and IL 6 may be due to the decreased number of viable cells during infection due to cytotoxicity. Although ANKs KO also exhibits this same cytotoxicity, the dramatic upregulation of NF infection still produces more IL 8 and IL 6 than unstimulated WT vMyx infected cells. Given the ability of ANK R m utant vMyx constructs to trigger anti viral pathways like NF in vitro , it is reasonable to hypothesize that these viruses will also be more

PAGE 41

41 susceptible to overall anti viral responses in infected rabbits in vivo . Previously, the secondary spread of MT5K O in vivo was shown to be limited by the induced apoptosis of T cells upon infection with MT5KO. [ 32 ] Similarly, ANKs KO infection does not sp read beyond the primary lesion. ( Table 3 2 ) Although both MT5KO and ANKs KO are restricted to the primary site of infection, the primary lesion produced during ANKs KO infection is notably smaller than the lesion produc ed by MT5KO infection. (Figure 3 1 A) Thus, ANKs KO vMyx could be even further limited by additional anti viral responses within the primary lesion. This study provided the first in vitro evidence that NF activation can be simultaneously suppressed by multiple vMyx ANK R proteins. A varie ty of in vivo studies have demonstrated that poxviruses unable to properly suppress NF [ 14 , 25 , 53 , 54 ] Further in vitro infection studies in primary rabbit cells an d histological studies in NZW rabbits will be required to confirm that the activation of the NF in vivo . Although NF delayed IL 8 and IL 6 secret ion in this study and others, the reason for this delay has yet to be elucidated. [ 44 , 46 , 47 ] A549 cells have been shown to be defective or extremely limited in the production of the NF responsive cytokine TNF during virus infection. [ 44 , 45 ] Similarly, the infection of A549 cells with ANK R mutant vMyx constructs does not enhance TNF secretion. (Data not show n) Since NF driven TNF secretion activates a variety of cellular pathways, including the NF positive autocrine loop, this defect in TNF release may partially responsible for the delayed secretion of IL 8 and IL 6. [ 55 ] In addition to viral infection, the release of

PAGE 42

42 DAMPs from dying or damaged cells during virus infection may also function as secondary ligands to induce the release of cytokines and chemokines at later time points. The induction of other pro inflammatory signaling cascades and also the release of additional cytokines and chemokines during ANK R mutant vMyx infection should be assessed in future studies. Thus far, attempts to perform qRT PCR of genes under control of NF by cellular cytotoxicity. This study has demonstrated that ANKs KO induces a greater innate immune response in vitro than WT vMyx or other ANK R Mutant vMyx const ructs. ( Table 4 1 ) Given the close link between innate immune stimulation and the acquisition of long term acquired immunity, we propose that the ANKs KO virus will also induce higher levels of cellular and/or humoral immune responses. In the field of onco lytic virotherapy, a concerted effort has been undertaken to generate safe oncolytic viruses that trigger an enhanced immune response to tumoral antigen. [ 56 ] These viruses, through infection and replication within the tumor, must also counteract the immunosup pressive microenvironment found within most tumors. Previous clinical trials have shown that some oncolytic viruses capable of eliciting anti tumoral immune responses increase serum levels of proinflammatory cytokines, including IL 6. [ 57 59 ] Additional studies will be required to determine if the immun ogenic ANKs KO vMyx is an effective oncolytic virus.

PAGE 43

43 Table 4 1. Overview of ANK R mutant vMyx construct phenotypes WT vMyx MT5KO vMyx 148 150KO vMyx ANKs KO vMyx Defective growth in A549 and RL 5 cells + + Excessive cell death during A549 infection + + Nuclear localization of p65 (activation of NF + + +++ Increased IL 8 release during infection + + ++ ++ Increased IL 6 release during infection ++ + ++ +++ Primary lesion size during rabbit infection +++ + ++ + Severity of illness during rabbit infection +++ +

PAGE 44

44 LIST OF REFERENCES 1. Fenner, F., Smallpox: emergence, global spread, and eradication. Hist Philos Life Sci, 1993. 15 (3): p. 397 420. 2. Fauci, A.S., Smallpox vaccination policy -the need for dialogue. N Engl J Med, 2002. 346 (17): p. 1319 20. 3. Reynolds, M.G. and I.K. Damon, Outbreaks of human monkeypox after cessation of smallpox vaccination. Trends Microbiol, 2012. 20 (2): p. 80 7. 4. She rwani, S., et al., New method for the assessment of molluscum contagiosum virus infectivity. Methods Mol Biol, 2012. 890 : p. 135 46. 5. Nalca, A., et al., Reemergence of monkeypox: prevalence, diagnostics, and countermeasures. Clin Infect Dis, 2005. 41 (12): p. 1765 71. 6. Kim, M.K., et al., Oncolytic and immunotherapeutic vaccinia induces antibody mediated complement dependent cancer cell lysis in humans. Sci Transl Med, 2013. 5 (185): p. 185ra63. 7. Garcia Arriaza, J., et al., Improving Adaptive and Mem ory Immune Responses of an HIV/AIDS Vaccine Candidate MVA B by Deletion of Vaccinia Virus Genes (C6L and K7R) Blocking Interferon Signaling Pathways. PLoS One, 2013. 8 (6): p. e66894. 8. Best, S.M. and P.J. Kerr, Coevolution of host and virus: the pathogene sis of virulent and attenuated strains of myxoma virus in resistant and susceptible European rabbits. Virology, 2000. 267 (1): p. 36 48. 9. Chan, W.M., M.M. Rahman, and G. McFadden, Oncolytic myxoma virus: the path to clinic. Vaccine, 2013. 31 (39): p. 4252 8. 10. Kerr, P.J., Myxomatosis in Australia and Europe: a model for emerging infectious diseases. Antiviral Res, 2012. 93 (3): p. 387 415. 11. Flemming, A., Cancer: Oncolytic poxvirus homes in on cancer cells. Nat Rev Drug Discov, 2011. 10 (11): p. 814. 12. Cameron, C., et al., The complete DNA sequence of myxoma virus. Virology, 1999. 264 (2): p. 298 318. 13. Spiesschaert, B., et al., The current status and future directions of myxoma virus, a master in immune evasion. Vet Res, 2011. 42 : p. 76. 14. Rahman, M. M., et al., Co regulation of NF kappaB and inflammasome mediated inflammatory responses by myxoma virus pyrin domain containing protein M013. PLoS Pathog, 2009. 5 (10): p. e1000635.

PAGE 45

45 15. Thomas, K.W., et al., Respiratory syncytial virus inhibits apoptosis an d induces NF kappa B activity through a phosphatidylinositol 3 kinase dependent pathway. J Biol Chem, 2002. 277 (1): p. 492 501. 16. Wang, C.Y., M.W. Mayo, and A.S. Baldwin, Jr., TNF and cancer therapy induced apoptosis: potentiation by inhibition of NF ka ppaB. Science, 1996. 274 (5288): p. 784 7. 17. Monks, N.R., D.K. Biswas, and A.B. Pardee, Blocking anti apoptosis as a strategy for cancer chemotherapy: NF kappaB as a target. J Cell Biochem, 2004. 92 (4): p. 646 50. 18. Joshi, S.G., et al., NF kappaB activation suppresses host cell apoptosis during Rickettsia rickettsii infection via regulatory effects on intracellular localization or levels of apoptogenic and anti apoptotic proteins. FEMS Microbiol Lett, 2004. 234 (2): p. 333 41. 19. Li, J., A. Mahajan , and M.D. Tsai, Ankyrin repeat: a unique motif mediating protein protein interactions. Biochemistry, 2006. 45 (51): p. 15168 78. 20. Hatada, E.N., et al., The ankyrin repeat domains of the NF kappa B precursor p105 and the protooncogene bcl 3 act as specif ic inhibitors of NF kappa B DNA binding. Proc Natl Acad Sci U S A, 1992. 89 (6): p. 2489 93. 21. Sachdev, S., A. Hoffmann, and M. Hannink, Nuclear localization of IkappaB alpha is mediated by the second ankyrin repeat: the IkappaB alpha ankyrin repeats defi ne a novel class of cis acting nuclear import sequences. Mol Cell Biol, 1998. 18 (5): p. 2524 34. 22. Urban, M.B., R. Schreck, and P.A. Baeuerle, NF kappa B contacts DNA by a heterodimer of the p50 and p65 subunit. EMBO J, 1991. 10 (7): p. 1817 25. 23. Sonnb erg, S., S.B. Fleming, and A.A. Mercer, Phylogenetic analysis of the large family of poxvirus ankyrin repeat proteins reveals orthologue groups within and across chordopoxvirus genera. J Gen Virol, 2011. 92 (Pt 11): p. 2596 607. 24. Werren, J.H., et al., Fu nctional and evolutionary insights from the genomes of three parasitoid Nasonia species. Science, 2010. 327 (5963): p. 343 8. 25. Mohamed, M.R., et al., Cowpox virus expresses a novel ankyrin repeat NF kappaB inhibitor that controls inflammatory cell influx into virus infected tissues and is critical for virus pathogenesis. J Virol, 2009. 83 (18): p. 9223 36. 26. Mohamed, M.R., et al., Proteomic screening of variola virus reveals a unique NF kappaB inhibitor that is highly conserved among pathogenic orthopoxv iruses. Proc Natl Acad Sci U S A, 2009. 106 (22): p. 9045 50.

PAGE 46

46 27. Shisler, J.L. and X.L. Jin, The vaccinia virus K1L gene product inhibits host NF kappaB activation by preventing IkappaBalpha degradation. J Virol, 2004. 78 (7): p. 3553 60. 28. Chang, S.J., e t al., Poxvirus host range protein CP77 contains an F box like domain that is necessary to suppress NF kappaB activation by tumor necrosis factor alpha but is independent of its host range function. J Virol, 2009. 83 (9): p. 4140 52. 29. Werden, S.J., et al ., The myxoma virus m t5 ankyrin repeat host range protein is a novel adaptor that coordinately links the cellular signaling pathways mediated by Akt and Skp1 in virus infected cells. J Virol, 2009. 83 (23): p. 12068 83. 30. Bai, C., et al., SKP1 connects c ell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F box. Cell, 1996. 86 (2): p. 263 74. 31. Johnston, J.B., et al., Myxoma virus M T5 protects infected cells from the stress of cell cycle arrest through its interaction w ith host cell cullin 1. J Virol, 2005. 79 (16): p. 10750 63. 32. Mossman, K., et al., Disruption of M T5, a novel myxoma virus gene member of poxvirus host range superfamily, results in dramatic attenuation of myxomatosis in infected European rabbits. J Vir ol, 1996. 70 (7): p. 4394 410. 33. Werden, S.J., et al., M T5, the ankyrin repeat, host range protein of myxoma virus, activates Akt and can be functionally replaced by cellular PIKE A. J Virol, 2007. 81 (5): p. 2340 8. 34. Blanie, S., et al., M148R and M149R are two virulence factors for myxoma virus pathogenesis in the European rabbit. Vet Res, 2009. 40 (1): p. 11. 35. Camus Bouclainville, C., et al., A virulence factor of myxoma virus colocalizes with NF kappaB in the nucleus and interferes with inflamm ation. J Virol, 2004. 78 (5): p. 2510 6. 36. Chen, X., A.V. Anstey, and J.J. Bugert, Molluscum contagiosum virus infection. Lancet Infect Dis, 2013. 13 (10): p. 877 88. 37. Liu, J., et al., M062 is a host range factor essential for myxoma virus pathogenesis and functions as an antagonist of host SAMD9 in human cells. J Virol, 2011. 85 (7): p. 3270 82. 38. Rahman, M.M. and G. McFadden, Modulation of NF kappaB signalling by microbial pathogens. Nat Rev Microbiol, 2011. 9 (4): p. 291 306. 39. Smallwood, S.E., et a l., Myxoma virus: propagation, purification, quantification, and storage. Curr Protoc Microbiol, 2010. Chapter 14 : p. Unit 14A 1.

PAGE 47

47 40. Johnston, J.B., et al., Role of the serine threonine kinase PAK 1 in myxoma virus replication. J Virol, 2003. 77 (10): p. 5877 88. 41. Wang, G., et al., Infection of human cancer cells with myxoma virus requires Akt activation via interaction with a viral ankyrin repeat host range factor. Proc Natl Acad Sci U S A, 2006. 103 (12): p. 4640 5. 42. Rahman, M.M., et al., Myxoma vir us protein M029 is a dual function immunomodulator that inhibits PKR and also conscripts RHA/DHX9 to promote expanded host tropism and viral replication. PLoS Pathog, 2013. 9 (7): p. e1003465. 43. Barry, M., et al., The myxoma virus M T4 gene encodes a nove l RDEL containing protein that is retained within the endoplasmic reticulum and is important for the productive infection of lymphocytes. Virology, 1997. 239 (2): p. 360 77. 44. Devhare, P.B., et al., Analysis of antiviral response in human epithelial cells infected with hepatitis E virus. PLoS One, 2013. 8 (5): p. e63793. 45. Arnold, R., et al., Interleukin 8, interleukin 6, and soluble tumour necrosis factor receptor type I release from a human pulmonary epithelial cell line (A549) exposed to respiratory sy ncytial virus. Immunology, 1994. 82 (1): p. 126 33. 46. Julkunen, I., et al., Inflammatory responses in influenza A virus infection. Vaccine, 2000. 19 Suppl 1 : p. S32 7. 47. Chun, Y.H., et al., Rhinovirus Infected Epithelial Cells Produce More IL 8 and RANT ES Compared With Other Respiratory Viruses. Allergy Asthma Immunol Res, 2013. 5 (4): p. 216 23. 48. Bao, X., et al., Airway epithelial cell response to human metapneumovirus infection. Virology, 2007. 368 (1): p. 91 101. 49. Kanzawa, N., et al., Augmentation of chemokine production by severe acute respiratory syndrome coronavirus 3a/X1 and 7a/X4 proteins through NF kappaB activation. FEBS Lett, 2006. 580 (30): p. 6807 12. 50. Benedict, C.A., P.S. Norris, and C.F. Ware, To kill or be killed: viral evasion of ap optosis. Nat Immunol, 2002. 3 (11): p. 1013 8. 51. Basith, S., et al., Evolutionary, structural and functional interplay of the IkappaB family members. PLoS One, 2013. 8 (1): p. e54178. 52. Tripathi, S., et al., Influenza A virus nucleoprotein induces apopto sis in human airway epithelial cells: implications of a novel interaction between nucleoprotein and host protein Clusterin. Cell Death Dis, 2013. 4 : p. e562.

PAGE 48

48 53. Harte, M.T., et al., The poxvirus protein A52R targets Toll like receptor signaling complexes to suppress host defense. J Exp Med, 2003. 197 (3): p. 343 51. 54. Stack, J., et al., Vaccinia virus protein A46R targets multiple Toll like interleukin 1 receptor adaptors and contributes to virulence. J Exp Med, 2005. 201 (6): p. 1007 18. 55. Huerta Yepez, S., et al., Involvement of the TNF alpha autocrine paracrine loop, via NF kappaB and YY1, in the regulation of tumor cell resistance to Fas induced apoptosis. Clin Immunol, 2006. 120 (3): p. 297 309. 56. Russell, S.J., K.W. Peng, and J.C. Bell, Oncolytic v irotherapy. Nat Biotechnol, 2012. 30 (7): p. 658 70. 57. Zeh, H.J. and D.L. Bartlett, Development of a replication selective, oncolytic poxvirus for the treatment of human cancers. Cancer Gene Ther, 2002. 9 (12): p. 1001 12. 58. Kirn, D., Oncolytic virothera py for cancer with the adenovirus dl1520 (Onyx 015): results of phase I and II trials. Expert Opin Biol Ther, 2001. 1 (3): p. 525 38. 59. Prestwich, R.J., et al., Oncolytic viruses: a novel form of immunotherapy. Expert Rev Anticancer Ther, 2008. 8 (10): p. 1581 8.

PAGE 49

49 BIOGRAPHICAL SKETCH Stephanie Anne Lamb was born in 1984, in Orlando, FL. In 2003, she graduated from the Engineering Science and Technology magnet program at Edgewater High School. After four years at the University of Florida, she graduated Summa Cum Laude with a dual degre e in Food Science and Human Nutrition and Microbiology and Cell Science. She also minored in Business Administration. During the completion of her undergraduate degree, Stephanie worked for two years in the lab of Dr. Lynn B. Bailey. She was accepted into graduate school at the University of Wisconsin Madison and her studies in biomedical sciences at UF and joined the laboratory of Grant McFadden. Over the past three yea rs, she has used techniques in basic virology and molecular biology to produce viruses and other reagents. Some of these viruses were characterized in vitro and in animal models.