Citation
Alterations in T Cell Functions Mediated by SOCS1 Deficiency

Material Information

Title:
Alterations in T Cell Functions Mediated by SOCS1 Deficiency Implications for SLE Development and Revelation of a Novel Biological Target
Creator:
Wilson, Tenisha D
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (12 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Microbiology and Cell Science
Committee Chair:
LARKIN,JOSEPH,III
Committee Co-Chair:
KIMA,PETER EPEH
Committee Members:
JOHNSON,HOWARD M
YAMAMOTO,JANET K
REEVES,WESTLEY HUBBARD
PECK,AMMON B
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Antigens ( jstor )
Autoantibodies ( jstor )
B lymphocytes ( jstor )
Cells ( jstor )
Cytokines ( jstor )
Diseases ( jstor )
Lupus ( jstor )
Mice ( jstor )
Systemic lupus erythematosus ( jstor )
T lymphocytes ( jstor )
Microbiology and Cell Science -- Dissertations, Academic -- UF
activation -- autoimmunity -- lupus -- mimetic -- murine -- patients -- peptide -- socs1 -- t-cell -- therapuetic -- tolerance
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Microbiology and Cell Science thesis, Ph.D.

Notes

Abstract:
Dysregulated CD4+ T cell activation and cytokine signaling, which are normally regulated by suppressor of cytokine signaling-1 (SOCS1), contribute to systemic lupus erythematosus (SLE). SOCS1 heterozygous (SOCS1+/-) mice develop SLE pathology. However, there is a paucity of data outlining the mechanisms by which SOCS1 deficiency contributes to SLE onset. Therefore, we explored phenotypic abnormalities in SOCS1 deficient CD4+ T cells ex vivo and in vitro. SOCS1+/-, lupus-prone mice possessed enhanced peripheral CD4+ T cell accumulation and activation, which was correlated with a reduced requirement for CD28 co-stimulation in vitro. Furthermore, SOCS1+/- CD4+ T cells aberrantly expressed IFNy, even under Th17 inducing conditions. This enhanced IFNy production precluded proper Th17 differentiation and has significant implications for SLE development. To establish the clinical relevance of these finding to human SLE, we also measured SOCS1 expression in SLE patients and healthy controls. Our studies revealed that PBMCs from SLE patients had reduced SOCS1 expression in comparison to healthy donors. Additionally, while SOCS1 expression was correlated with the IFN-1 signature, expression was not correlated with disease activity. These results suggest that targeting SOCS1 deficiency may have therapeutic value for SLE patients. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: LARKIN,JOSEPH,III.
Local:
Co-adviser: KIMA,PETER EPEH.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-08-31
Statement of Responsibility:
by Tenisha D Wilson.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2016
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

ALTERATIONS IN T CELL FUNCTIONS MEDIATED BY SOCS1 DEFICIENCY: IMPLICATIONS FOR SLE DEVELOPMENT AND REVELATION OF A NOVEL BIOLOGICAL TARGET By TENISHA DENISE WILSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

© 2014 Tenisha Denise Wilson

PAGE 3

To my family: Patrick Wilson Sr., Jannette Wilson, Patrick Wilson Jr., and Jaden Wilson. I could not have completed this without your support. Thank you. I love you.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my basic science mentor, Dr. Joseph Larkin III . In 2009, I started in you r lab as a graduate student with an intense desire to understand clinical immunology in order to fulfill my goal of becoming a physician scientist. Now, five years later assified as an MD PhD stude nt and a CTSI TL1 scholar and I a m well on my way toward achieving my goal. Without you and your lab, this would not be possible. I would also like to thank my clinical science mentor, Dr. Westley H. Reeves. In 2011, when I appl ied to the UF CTSI TL1 p rogram, I needed a clinical mentor and you agreed with no hesitation. You accepted me and began mentoring me without even knowing me. My respect for you is endless and I will forever appreciate your selfless kindness. Thank you for allowing me to learn from you the best rheumatologist in Florida . I will always live up to your standard and I pray that I will one day become as good of a physician scientist as you are. I will always consider you my mentor, not only in the clinic, but marathon. I would also like to thank Dr. Janet Yamamoto. I this to you, but I first decided to become a physician scientist because of you. When I was an und You emphasized the importance of immunology in transplantation. Your passion for science was contagious and your lecture was captivating. Ever since then, I decided that I wanted to d edicate my life to studying immunology in order to better treat my future patients. When I met you again in graduate school, you made an effort to help facilitate my goal. Without your help, I would not be an MD PhD student or a TL1 scholar today. Thank yo u for helping me so selflessly. I will always appreciate you.

PAGE 5

5 Additionally, I thank Dr. Kima. I believe you have known me the longest of all of my committee members. I was a student in your parasitology class as undergraduate. I respected you then and I respect you even more now. Thank you for helping me to think outside of the box and for caring about my success, not only in academia, but also in my personal life. I would also like to thank Dr. Peck. When I was intimidated about writing my fi rst IRB protocol, you were so helpful and encouraging. Thank you for taking the time out of your busy schedule to help me. Last but not least, I would like to thank Dr. Johnson. Thank you for helping to pave the way for young scientists like myself. I app reciate your kindness and advice throughout the years. In addition to my committee members, I would also like to acknowledge several additional scientists who have made a significant impact on my career. Dr. Hsu, thank you for offering me the opportunity o f a lifetime. I will be forever grateful for your efforts to facilitate my entry into the UF MD PhD program. I would also like to thank Skip Harris for his endless support as coordinator of the MD PhD program. You give your life to this program and words c annot express how much I appreciate you. kindness. Your scientific creativity is genius. I hope that in the future , I will be able to become as good of a scientist as you are. I wo uld also be remiss if I did not say thank you to Dr. James Maruniak. You have cared so genuinely, not only about my success as a young scientist, but also as a

PAGE 6

6 well rounded individual. Thank you for your words of encouragement throughout the years. I trul y appreciate you. Additionally, and Erin. Erin, you and I were lab sisters and I will always appreciate our friendship. I would also like to th ank the lab mates, past and present, that I helped to train: Nikki, lab mates, but also friends. By interacting with you, I have learned so much about myself and you have helped me to become the young scientist that I am today. Finally, Dr. Sukka for her endless support.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 LIST OF ABBR EVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 13 CHAPTER 1 INTRODUCTION ................................ ................................ ................................ .... 15 System ic Lupus Erythematosus ................................ ................................ .............. 15 T Lymphocytes in SLE ................................ ................................ ..................... 16 T cell signaling abnormalities in SLE ................................ ......................... 18 T cell subsets associated with SLE ................................ ............................ 23 B lymphocytes in SLE ................................ ................................ ...................... 26 B cell signaling abnormalities in SLE ................................ ......................... 28 B cell Phenotypic and Functional Abnormalities in SLE ............................. 29 The Importance of T cell B cell Interactions in SLE ................................ .......... 30 Dendritic Cells in SLE ................................ ................................ ....................... 31 Enhanced CD86 Expression ................................ ................................ ...... 32 Enhanced Type I Interferon P roduction ................................ ..................... 33 Immune Regulators ................................ ................................ .......................... 35 Regulatory T cells ................................ ................................ ...................... 35 Suppressor s of Cytokine Signaling ................................ ............................ 39 2 MATERIALS AND METHODS ................................ ................................ ................ 42 Animals ................................ ................................ ................................ ................... 42 Genotyping ................................ ................................ ................................ ............. 42 Human Subjects ................................ ................................ ................................ ..... 42 Isolation of Human PBMCs ................................ ................................ ..................... 43 Surface and Intracellular Staining ................................ ................................ ........... 43 Magnetic Cell Separation. ................................ ................................ ....................... 44 In Vitro T Cell Differentiation ................................ ................................ ................... 44 Proliferation Assays ................................ ................................ ................................ 45 RNA Extraction and qPCR ................................ ................................ ...................... 45 In Vitro Cytokine Secretion Analysis. ................................ ................................ ...... 46 IgG Antibody Assessment ................................ ................................ ....................... 46 Stat istical Analysis ................................ ................................ ................................ .. 47

PAGE 8

8 3 RESULTS ................................ ................................ ................................ ............... 49 SOCS1 +/ mice exhibit CD4 + T cell accumulation and enhanced CD4 + T cell activation in the periphery ................................ ................................ .................... 49 CD28 co stimulation of SOCS1 +/ CD4 + CD25 T lymphocytes is not required for activation or clonal expansion ................................ ................................ .............. 50 SOCS1 +/ CD4 + CD25 T cells undergo normal Treg induction, but abnormal Th17 induction ................................ ................................ ................................ ..... 51 SOCS1 +/ CD4 + inducing conditions ................................ ................................ .............................. 52 Reduced SOCS1 expression levels are observed in SLE patients ......................... 53 4 DISCUSSION ................................ ................................ ................................ ......... 64 LIST OF REFERENCES ................................ ................................ ............................... 70 BIOGRAPHICAL SKETCH ................................ ................................ ............................ 84

PAGE 9

9 LIST OF TABLES Table page 2 1 Mouse (mus) and Human (hu) mRNA Primer Sequences and Annealing Temperatures ................................ ................................ ................................ ..... 48

PAGE 10

10 LIST OF FIGURES Figure page 3 1 SOCS1+/ mice do not display serological or clinical signs of disease at <6 mont hs of age ................................ ................................ ................................ ..... 55 3 2 SOCS1 +/ mice exhibit CD4 + T cell accumulation and enhanced CD4 + T cell activation in the periphery ................................ ................................ ................... 56 3 3 SOCS1 +/ mice possess a normal peripheral CD4 + CD25 + Foxp3 + cell frequency ................................ ................................ ................................ ............ 57 3 4 CD28 co stimulation is not required for activation and expansion of SOCS1 +/ CD4 + T lymphocytes ................................ ................................ ........................... 58 3 5 Th17, but not Treg, induction is reduced in SOCS1 +/ CD4 + T lymphocytes ....... 59 3 6 SOCS1 +/ CD4 + T cells display Th1 bias under Th17 inducing conditions .......... 60 3 7 SOCS1 expression is not affected by chloroquine treatment, but is increased by dexamethasone treatment ................................ ................................ ............. 61 3 8 SOCS1 expression is relevant to human SLE ................................ .................... 62 3 9 SOCS1 expression is not correlated with SLEDAI, C3, or C4 levels .................. 63

PAGE 11

11 LIST OF ABBREVIATIONS APCs Antigen Presenting Cells C3 Complement Component 3 C4 Complement Component 4 CD Cluster of Differentiation CTLA Cytotoxic T Lymphocyte Antigen DC Dendritic Cell dsDNA Double stranded DNA EAE Experimental Autoimmune Encephalomyelitis Interferon gamma IFN 1 Type 1 Interferon IL Interleukin IPEX I mmunodysregulation, Polyendocrinopathy, and Enteropathy, X linked IRF Interferon Regulatory Factor iTh17 cell Inducible T helper type 17 cell iTreg Inducible Regulatory T cell JAK Janus Kinase LN Lymph Node MHC Major Histocompatibility Complex NFAT Nuclear Factor of Activated T Cells NF Nuclear F a ctor kappa light chain enhancer of activated B cells PAMP Pathogen Associated Molecular Pattern PBMCs Peripheral Blood Mononuclear Cells PRR Pattern Recognition Receptor

PAGE 12

12 ROR Retinoic Acid Receptor RNP Ribonuclear Protein SLE Systemic Lupus Erythematosus SOCS Suppressors of Cytokine Signaling ssDNA Single stranded DNA STAT Signal Transducers and Activators of Transcription TCR T Cell Receptor Th T helper TLR Toll Like Receptor

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ALTERATIONS IN T CELL FUNCTIONS MEDIATED BY SOCS1 DEFICIENCY: IMPLICATIONS FOR SLE DEVELOPMENT AND REVELATION OF A NOVEL BIOLOGICAL TARGET By Tenisha Denise Wilson August 2014 Chair: Jo s e ph Larkin III Major: Microbiology and Cell Science Dysregulated CD4 + T cell activation and cytokine signaling, which are normally regulated by suppressor of cytokine signaling 1 (SOCS1), contribute to systemic lupus erythematosus (SLE). SOCS1 heterozygous ( SOCS1 +/ ) mice develop SLE pathology . H owever, there is a paucity of data outlining the mechanisms by which SOCS1 defici ency contributes to SLE onset. Therefore, we explored phenotypic abnormalities in SOCS1 deficient CD4 + T cells ex vivo and in vitro . SOCS1 +/ , lupus prone mice possessed enhanced peripheral CD4 + T cell accumulation and activation , which was correlated with a reduced requirement for CD28 co sti mulation in vitro . Furthermore, SOCS1 +/ CD4 + T cells aberrantly expressed IFN conditions and has significant implications for SLE development . To establish the clinical relevance of these finding to human SLE , we also measured SOCS1 expression in SLE patients and healthy controls. Our studies revealed that PBMCs from SLE patients had reduced SOCS1 expression i n comparison to healthy donors. Additionally, while SOCS1 expression was correl ated with the IFN 1 signature, expression was not correlated with

PAGE 14

14 disease activity . These results suggest that targeting SOCS1 deficiency may have therapeutic value for SLE patients .

PAGE 15

15 CHAPTER 1 INTRODUCTION Systemic Lupus Erythematosus Systemic lupus erythematosus (SLE) is a chronic, multi organ autoimmune disease with varied clinical manifestations, ranging from cutaneous pathologies to life threatening renal disease (reviewed in (1) ) . While this disease affects all ethnicities, African American , Hispanic, and Asian populations are more commonly affected (1, 2) . Additionally, SLE is more prevalent in women than men , with a f emale to male ratio of 9:1 (1 ) . Each SLE patient displays a unique combination of serological abnormaliti es and clinical symptoms. This varied clinical presentation result s in significant challenges in the diagnosis and management of lupus. Current treatment for patients with mild lupus includes non steroidal anti inflammatory drugs, antimalarials , and low dose corticosteroids . Patients with more aggressive disease are commonly treated with high dose corticosteroids and cytotoxic agents, such as azathioprine, cyclophophamide, and me cophenolic acid (reviewed in (2) ) A lthough the etiology of SLE has not been completely elucidated, investigations have led to the understanding that this disease is the result of a series of abnormal interactions wit hin the immune system tha t ultimately lead to a breach of self tolerance to nuclear antigens (3) . This leads to the production of pathogenic antinuclear autoantibodies that deposit into vital organs, which causes aberrant inflammation. If not controlled, these immune events may ultimately cause irreversible organ destruction. Over decades, researchers have sought to determine the cellular initiator of tolerance loss. However, it seems that defects in different cell types and their products underlie the pathogenic processes.

PAGE 16

16 T Lymphocytes in SLE SLE is an autoimmune disease characterized by high titer IgG autoantibodies toward nuclear antigens. Although these autoantibodies are produced by pathogenic autoreactive B c ells, three foundational studies published in the 1980s established that antinuclear autoantibody production appears to be dependent upon autoantigen specific CD4 + T cell help (4 6) . These studies demonstrated that depletion of CD4 + T cells in the lupus prone MRL/lpr mouse model, either by neonatal thymectomy (4) or by monoclonal antibody depletion (5, 6) , resulted in a marked reduction of anti DNA autoantibody production and glomerulonephritis and in prolonged survival. This notion that CD4 + T cell help contributes to pathogenic anti DNA autoantibody production and glomerulonephritis in lupus was quickly supported by a study involving lupus nephritis patients (7) . After the establishment of the importance of CD4 + T cells in lupus, researchers intensively sought to determine the immunogen(s) for these pathogenic autoantibody inducing lupogenic T cells. Although DNA is a target antigen for anti DNA autoantibodies, investigators did not suspect it to be an immunogen because DNA immunization does not lead to SLE development in normal mice or to dise ase acceleration in the MRL/lpr mouse model (8) . However, investigators hypothesized that nucleosomal antigens we re potential immunogens, as these antigens were found in immune complexes with anti DNA autoantibodies (9) . In line with this hypothesis, using anti DNA autoantibody inducing T cell clones derived from the SNF 1 lupus model, Mohan et al . were the first to demonstrate that these pathogenic autoreactive CD4 + T helper cells were indeed responsive to processed self nucleosomal peptides in the context of MHC II (10) .

PAGE 17

17 In addition to nucleosomal antigens, small nuclear ribonuclear protein (snRNP) antigens were also suspected to be autor eactive CD4 + T cell immunogens, due to the fact that a large proportion of SLE patients possess autoantibodies against snRNPs (11) . Moreover, the presence of anti RNP autoantibodies was shown to be associated with poly morphisms of HLA DR4 (12, 13) , suggesting that RNP antigen specific CD4 + T cell help is critical for anti RNP autoantibody production. Consistent with this premise, Hoffman et al . determined that SLE patients possessed PBMC derived T cell clones that were reactive against snRNP autoantigens (14) . Interestingly, however, they also found snRNP autoantigen specific T cell clones in healthy control subjects. T he results of this study raise a very important question: If both healthy controls and SLE patients possess autoantigen specific T cell clones, how is tolerance maintained in healthy individ uals, yet lost in SLE patients? Several studies have addressed thi s question and the answer is multifaceted . There is an abundance of data suggesting that there are intrinsic abnormalities in T and B cells that render them hyper respons ive to antigen r eceptor stimulation and cytokine stimulation (reviewed in (15 17) ) . However, there is also a great deal of evidence suggesting that the abnormalities lay within the APCs, particularly dendritic cells, which cause them to display enhanced expres sion of co stimulatory molec ules and pathogenic cytokines (reviewed in (18) ) . These abnormal APC phenotypes provide them with a superior ability to activate lymphocytes and breach tolerance. Considering these views, which will be discussed below, it is likely that both contribute to inappropriate T cell B cell interactions, loss of tol erance, and clinical disease development.

PAGE 18

18 T cell signaling abnormalities in SLE Signaling downstream of the T cell receptor (TCR) is a critical component of a T of and response to an antigen. The TCR of CD4 and CD8 T cells bin ding, these chains are unable to transmit intracellular signals due to their very short cytoplasmic components. Therefore, signal transduction requires additional ains. Together, these molecules form the cell surface, multi subunit TCR CD3 complex (reviewed in (17) ) . Signal transduction by the TCR CD3 complex is initiated by conserved motifs called immunoreceptor tyrosine ac tivation motifs (ITAMS) contained within the cytoplasmic domains of the CD3 chains (19) therefore, a critical signal transducer of T cells (reviewed in (17) ) . In normal, naïve T cells, antigen recognition results a series of signaling events leading to the activation of transcription factors that are critical for initiat ing activation, proliferation, and differentiation. Upon antigen binding, the T cell surface tyrosine phosphotase, CD45, is brought in close proximity to the TCR CD3 complex and removes inhibitory phosphates from the lymphocyte kinase (Lck). Lck then initi ates the protein of 70kD (ZAP70) kinase, which is also phosphorylated by Lck. This phosp horylation activates ZAP70 to phosphorylate the adaptor proteins, linker of activation in T cells (LAT) and SLP 76, which then transmit the signal downstream into several different pathways (reviewed in (17) ) .

PAGE 19

19 In on e pathway, LAT and SLP 76 bind and activate the enzyme phospholipase C inositol triphosphate. While diacyl glycerol is critical for protein kinase C activation and subsequent NF calcium channels. This increased calcium flux increases the intracellular calcium concentrations and activates the phosphotase calcineurin, which activates NFAT. Activation of tra nscription factors NF genes, including IL 2; thus contributing to cell proliferation and differentiation (reviewed in (17) ) . Although TCR stimulation leads to IL 2 p roduction, it is well established that antigen recognition alone is not sufficient to fully activate a T cell. In fact, TCR stimulation without co stimulation leads to T cell anergy (reviewed in (20) ) . CD28 is the bes t understood co stimulatory molecule and is located on the surface of the T cell (reviewed in (20, 21) ) . At the immunological synapse, CD28 binds to its ligand, B7 1 or B7 2, located on the APC (22) . Signaling events downstream of CD28 co stimulation then synergize with TCR signaling events to produce an enhanced pool of activated 2 productio n and full T cell activation. At least t wo pathways downstream of CD28 stimulation lead to . In the first pathway, stimulation of CD28 results in PI3K kinase activation (23) . This kinase then activates protein kinase B (PKB)/Akt, (23) which is particularly important in (24) . Kong et al . recently uncovered novel signaling events associated with the second

PAGE 20

20 pathway downstream of CD28, leading to NF (25) . Similar to the immediate events subsequent to antigen binding to the TCR, CD2 8 stimulation by B7 molecules results in CD45 activation. CD45 then activates Lck, which then associates domain, which is required for efficient binding of Lck to the V3 domain resulting from these pathways , downstream of CD28 co stimulation , leads to IL 2 production and prevents T cell anergy. While the signaling events outlined a bove occur in normal T cells, there are several defects associated with SLE TCR stimulation and co stimulation that ultimately contribute to a hyper responsive phenotype. TCR Signa ling Defects in SLE TCR CD3 complexes are contained within highly ord ered ch olesterol rich platforms called lipid rafts, which facilitate close interactions between TCR CD3 complexes and associated signaling molecul es, including CD45 and Lck (26 28) . In normal T cells, ligation of the TCR induces rapid lipid raft aggregation, aiding in the formation of the immunological synapse (28, 29) . The formation of the immunological synapse is critical fo r the amplification of signals downstream of the TCR and su bsequent T cell activation (30) . Studies have shown that SLE T cells uniquely display pre aggregated lipid rafts, indicating that these T cells are more pre pared for activation prior to encounter with antigen (28, 31) . In addition to the abnormal aggregation of lipid rafts in SLE T cells, these cholesterol ri ch clusters also contain an altered composition of signaling molecules (17,

PAGE 21

21 28, 31) signaling molecules downstream of antigen recognition by the TCR. Howev er, studies have determined that there is a decrease in the expression of these molecules and a concomitant increase in (17, 28, 31, 32) . Tsokos et al . determined that this altered expression of signaling molecules also contributes to the hyper responsive phenotype observed in SLE T cells (28) CD3 complex (33) . Upon antigen binding, rather than recruiting ZAP7 (34) . This Syk interaction is exponentially stronger than that of ZAP70 interaction, which results in greater overall tyrosine phosphorylation of signaling intermediates and an abnormally increased calcium influx (34) . In further studies, Tsokos et al . confirmed in the hyper responsive SLE T cell phenotype by demonstrating that in vitro in normalization of the calcium influx and decreased phosphorylation of signaling molecules (35) . Therefore, these results suggest that correcting this defect either directly by implementing the use of tyrosine kinase inhibitors may result in the amelioration of abnormal S LE T cell effector functions. As outlined above, there are several signaling defects proximal to the TCR. To add to the signaling abnormalities associated with the TCR, there are also defects related to signaling molecules dist al to the TCR . A recently pub lished defect was

PAGE 22

22 discovered by Chuang and colleagues (25, 36) . Their study demonstrated that T cells activation, which is due to the overexpression GLK (25) . GLK is a kinase that is directly activated by SLP 76, the adaptor protein dow nstream of the TCR (25) . This finding may be relevant to disease, as GLK expression wa s positively correlated with the SLE disea se activity index (SLEDAI) (25) signaling may have therapeutic value in SLE. T Cell Co Stimulatory Defe cts: CD28 In addition to signaling defects associated with the TCR in SLE T cells, there are also signaling defects downstream of the CD28 co stimulatory molecule. CD28 is constitutively expressed on both naïve and effector T cells and plays a predominant role in costimulation (37) . As stated above, binding of CD28 to its ligands, B7 1 and B7 2, leads to activation of Akt/PKB, which ultimately contributes to the expression of genes involved in T cell activation (38) . Severa l studies of genetically manipulated mice have linked the PI3K/Akt pathway with autoimmun e susceptibility ( reviewed in (39, 40) ) . More specificall y to lupus, Barber et al . demonstrated that CD4 + T cells from MRL lpr mice display elevated levels of activated Akt compared to wild typ e counterparts (41) . In the same study, it was also demonstrated that inhibitio n of PI3K reduces glomerulonephritis and prolo ngs survival (41) . This Akt abnormality has also been observed in human SLE. It was recently shown that T cells taken from children with lupus nephritis display elevated levels of activated Akt and an enhanced proliferative cap acity compared to controls (40) . Furthermore, it was shown that inhibition of Akt activity significantly reduces the

PAGE 23

23 prolifer ative response of SLE T cells (40) , suggesting that proper regulation of this signaling molecule is critical in preventing excessive T cell activation. T Cell Co Stimulatory Defects: CD40L Although CD28 is constitutively expressed on naïve and effector T cells, CD40 ligand (CD40L) is a co stimulatory molecule that, in healthy individuals, is expressed following T cell activation (42, 43) . Through the expression of CD40L, T cells provide help to CD40 expressing B cells via the CD40 CD40L interaction. Unlike normal T cells, SLE T cells display increased and prolonged expression of CD40L, which is positively correlated with disease activity (44) . Additionally, monoclonal Ab blockade of CD40L in lymphocytes taken from lupus patients with active disease significantly prevented the production of pathogenic anti nuclear antibodies in vitro (44) . Due to the strong evidence that enhanced expression of CD40L contributes to pathogenic autoantibody production, clinical trials employing two different anti CD40L antibodies were performed (45) . However, these trials were unsuccessful as a result of severe adverse effects (46) . Despite the unsuccessful results from these trials, the enhanced expression of CD40L on SLE T cells underscore s the hyper responsive phenotype of these cells. In add i tion to general T cell abn ormalities, there are specific T cell subsets that are thought to contribute to SLE disease development. T cell subsets associated with SLE CD4+ T cells produce large quantit ies of cytokines in response to antigen specific activation. Given that cytokines play a critical role in regulating immune responses, investigations involving the function of these T cell products as effectors or precipitators of autoimmune diseases have led to further confirmation of the importance of CD4+ T cells in SLE development/progression . Nearly three decades ago, Mossman

PAGE 24

24 and colleagues determined that T cell s could be divided in to two main subsets: T helper type 1 (Th1) cells and Th2 cells (47) . Th1 cells develop is response to IL 12 and produce IFN intracellular pathogens. Th2 cells develop in response to IL 4 and produce IL 4, IL 5 and IL 13, which enhance humoral immunity and are important for the elimination of parasitic inf ection (48) . Recently, the Th1/Th2 paradigm has been expanded with the discovery of the Th17 cell subset , which exhibit effector functions that are distinct from the classic Th1 and Th2 subsets . Th17 cells produce IL 17A, IL 17F, IL 22 and IL 21. Transforming growth factor 6 , elicits the differentiation of naïve CD4+ T cells into Th17 cells (49 51) . In addition, IL 1 enhances Th17 development, whereas IL 23 is critical for the survival and expansion of this T cell lineage. Each of these subsets has been associat ed with autoimmune diseases, including SLE. Th1 Cells in SLE Given that SLE is characterized by pathogenic autoantibody production , it was initially hypothesized that the Th2 lineage was the prominent T helper subset involved in the pathogenesis of this d isease. Though investigations led to the support of this hypothesis (52, 53) , later studies produced an abundance of data that emphasize the importance of Th1 cells in SLE particularly mur ine lupus. Several studies involving the MRL lpr/lpr strain of these mice , particularly at the late stage of disease (54 59) . Renal upregulation was also observed (55) . protein level. Additionally, ELISPOT assays f rom cloned kidney infiltrating T cells

PAGE 25

25 Expression of the Th1 promoting cytokine, IL 12, is also enhanced in MRL Fas lpr mice, as increased IL 12 expression has been reported in kidney infiltrating mononuclear cells and tubular epithelial cells of this strain (60, 61) . In addition to the evidence describing great deal of evidence confi rming the pathogenic role of this proinflammatory cytokine in murine SLE. Jacob and colleagues were the first to report this when they found remission in those tha t received anti (62) . S everal studies , thereafter , have confirm ed these initial results (63 66) . Based on these studies , it was determined lly by several mechanisms : (i) enhances the expression of MHC class I and class II o n splenic and renal tissues, (ii) e n hances the expression of MCP 1, a macrophage attracting chemokine, which is associated with glomerulonephritis development, (iii) causes anti dsDNA IgG2a antibody product (67 69) , there is more evidence for type I interferons in the pathogenesis of human disease. Th1 7 Cells in SLE Like Th1 cells, Th17 cells have also been associated with autoimmune diseases. Th17 cells mediate pathology in experimental autoimmune encephalomyelitis, inflammatory bowel disease, and collagen induced arthritis (70 72) . Recent work has also implicated Th17 cells in the development of SLE because of the ability of Th17 cells to produce IL 17 and IL 21, which drive both inflammatory and humoral responses. Increased levels of IL 17 have been detect ed in the serum of SLE patients (73) . Furthermore, one group demonstrated enhanced renal IL 23 and IL 17 expression in

PAGE 26

26 lupus nephritis patients (74) , suggesting that these cytokine s may contribute to renal damage. Murine studies also suggest a pote ntial role of Th17 cel ls in mediating lupus pathogenesis . Studies involving SNF1 mice, revealed increased numbers of infiltrat ing autoreactive Th17 cells (75) . Moreover, downregulation of IL 17 production by T cells has been shown to correlate with ameliora tion of disease (75) The mechanisms by which Th17 cells mediate disease in SLE have not been completely elucidated. However, it has been established that IL 17 controls the mi gration of B cells, leading to their retention within the germinal center. Consistent with this fact, IL 17 is critical for autoreactive germinal center formation in th e DXD2 mouse model for SLE (76) . Given that IL 21 controls humoral responses and germinal center formation, the ability of Th17 cells to secrete this cytokine is also a potential mechanism by Th17 cells contribute to lupus development. This hypothesis is supported by the fact that IL 21 polymorphisms have been recently associated with SLE (77) and enhanced levels of IL 21 have been detected in murine models of lupus (78) . B lymphocytes in SLE B lymphocytes are antibody producin g cells and are therefore the generals of the antigen binding B cell receptor (BCR), which is a membrane bound antibody molecule (mIg). Similar to naive T cells, naïve B cells require 2 signals in order to become fully activated and to differentiate. Most naïve B cells require CD4 + T cell help in order for activation and differentiation to occur. These are called T cell dependent antibody responses. In these cases, after antige n binding by the mIg on the B cell, the antigen is internalized by receptor mediated endocytosis and processed into peptides within the endocytic

PAGE 27

27 pathway . The B cell then serves as an APC, presenting the peptides in the context of the MHC II molecule to the helper CD4 T cell while upregulating B7 molecules for efficient c o stimulation. As stated above , the activated helper T cell upregulates expression of CD40L, which binds to CD40 on the B cell. This CD40 CD40L interaction provides the second signal for progeny differentiate into antibody secreting plasma cells or memory B cells. The antibodies produced by activated B cells function as effectors of the humoral response, which efficiently aid in the e limination of pathogens thr ough complement activation, opso nization, or neutralization. In vivo activation and differentiation of B cells occurs in defined anatomic sites. In T cell dependent antibody responses, the interaction between T and B cells in per ipheral lymphoid organs leads to germinal center formation. Three important B cell differentiation events occur within germinal centers: (i) Affinity maturation through somatic hypermutation, (ii) Class switchi ng , and (iii) formation of plasma and memory c ells. Each of these differentiation events is critical for the development of appropriate effector functions initiated by the antibody response. Though eliminating pathogenic organisms is a critical responsibility of B cells, maintaining tolerance to self is equally important. When tolerance is breached, autoimmunity results. Murine studies of B cell development in the bone marrow have shown that B cells expressin g BCRs that have high affinity for self molecules are eliminated early in development (79, 80) . These selection events prevent autoimmune disease development. However, it is well known that this tolerance mechanism is not completely effective, as autoreactive B cells are also found in the perip hery ( reviewed in

PAGE 28

28 (16) ) . Therefore, there are peripheral selection events that prevent the activation of autoreactive B cells (reviewed in (16) ) . Given that SLE is an autoi mmune disease characterized by autoantibody production, B cells are central players in SLE pathogenesis. Researchers have intensively sought to uncover B cell defects in SLE that contribute to loss of tolerance and subsequent disease development (reviewed in (15, 16) . B cell signaling abnormalities in SLE Given that signal transduction plays an important role in the response of an autoreactive B cell to its autoantigen, several laboratories have investigated BCR signaling events in lupus. Based on t hese studies, there are several intrinsic BCR signaling defects in SLE that are reminiscent of those observed in the SLE TCR signal transduction pathway. As seen in SLE T cells, stimulation of circulati ng SLE B cells through their membrane IgM (BCR) produces significantly higher co ncentrations of intracellular Ca 2+ when compared to similarly induced responses of B cells from normal B cells (81, 82) . Stimulation of the BCR in lupus B cells also results in enhanced protein tyrosyl phosphorylation a nd correlates with the abnormal BCR mediated free Ca 2+ responses (81) . Furthermore, Liossis and colleagues determined that these aberrant BCR mediated signaling responses are not associated with disease activity or specific clinical manifestations and are disease specific, suggesting that SLE B cell defects are intrinsic problems and may cause/perpetuate diseas e (81) . The defects in antigen receptor signaling observed in SLE T and B cells provides an explanation for the observed hyper responsive phenotype of these cells (16) .

PAGE 29

29 B cell Phenotypic and Functional Abnormalities in SLE Dyregulated Expression of CD40L : As discussed previously, CD40L is normally expressed on activated T cells. However, SLE T cells display enhanced expression of this co stimulatory molecule (44) . Strikingly, CD40L is also found on SLE B cel ls (44) . Desai Mehta et al . revealed that the proportion of peripheral blood B cells expressing CD154 (CD40L) in lupus patients is 2 0.5 times higher than that of healthy controls (44) . The same group of investigators also determined, by mRNA analysis, that CD40L is actively transcribed within lupus B cells. Therefore, its expression is not sim ply due to passive absorption on CD40, which is a surface molecule that is constitutively expressed on B cells (44) . The increased Ca 2+ concentrations observed in lupus B cells (81, 82) , discussed above, may serve as a biochemical explanation for the dysregulated expression of CD154, as CD154 upregulation is pr imarily mediated by the calcium dependent transcription factor, NFAT (83, 84) . This dysregulated expression of CD154 is of interest because it may provide insight into a mechanism by which autoimmunity develops. It has been reported that CD154 expressed on the surface of B cells co st imulates other B cells (85) . Therefore, rather than only requiring CD4 + T cell help, autoreactive B cells can also differentiate into autoantibody producing plasma cells as a result of interactions with other B cel ls. In line with this hypothesis, it has been shown that transgenic expression of CD154 on the surface of B cells correlates with autoantibody production and the development of glomerulonephritis (86) . Enhanced Expr ession of CD80 and CD86 : In addition to CD154, CD80 (B7 1) and CD86 (B7 2) are aberrantly expressed on the surface of lupus B cells. While one study has found enhanced CD80 expression on a subset of lupus CD19+ B cells (87) ,

PAGE 30

30 two groups have reported CD86 overexpression on these cells (87, 88) . In addition, Biji et al . found that expression of CD86 correlated with SLE disease activity and wi th concentrat ions of serum anti DNA autoa ntibodies (88) . These observations are of significance, as increased B7 molecule expression encourages B cell T cell interactions. In the case of autoreactive B cells, these increased inter actions can facilitate autoantibody production. The Importance of T cell B cell Interactions in SLE In addition to the evidence that T cell hyper responsiveness and specific T cell subtypes contribute to autoantibody production and the fact that co stimula tory molecules are up regulated on both lupus T and B cells to foster their in teraction, there is additional evidence suggesting that CD4 + T cell help is required for pathogenic autoantibody production in SLE ( reviewed in (15) ) . As outlined above, T and B cell interactions lead to germinal center formation. Within the germinal center, B cells differentiate into plasma and memory cells and undergo affinity maturation and class switching. Though B cell differentiati on and class switching may occur outside of the germinal center, affinity maturation is thought to only occur within this tissue structure. Affinity maturation occurs through somatic hypermutation and a number of SLE patient studies have provided evidence that these mutation events are required for the generation of SLE disease associated autoantibodies (reviewed in (15) ) . Therefore, this disease associated autoantibody production is T cell dependent. The study of ger minal center factors in the BXSB Yaa+ and MRL mouse models of SLE further suggests that autoantibody production is T cell dependent (reviewed in (15) ) . IL 21 is an essential cytokine for co stimulated B cells to diffe rentiate into plasma cells (89) . This cytokine is constitutively produced by the CXCR5 + T FH cell subset ,

PAGE 31

31 which is a subpopulation of CD4+ T cells that reside in B cell follicles and are specialized to provide initia l help to antigen activated B cells (reviewed in (15) ) . Bubier et al . demonstrated that BXSB Yaa+ m ice display enhanced IL 21 production (90) . In addition, blocking IL 21 in th e MRL model or knocking out the IL 21 receptor in the BSXB Yaa+ model has been shown to have therapeutic value (reviewed in (15) . Moreover, the sanroque mouse that constit utively expresses ICOS, a T cell surface co stimulatory molecule required for the generation and differentiation of T FH cells, contains an expanded population of T FH cells that produce large amounts of IL 21. This enhanced pool of IL 21 induces the lupus phenotype in these mice (reviewed in (15) ) . These studies emphasize the importance of germinal center formation and, therefore, T cell help in the development of SLE. The importance of T cell B cell interactions in SLE is also underscored b y the finding that peripheral blood B cells in SLE patients display an enhanced proportion of antigen experienced, po st switched memory B cells (reviewed in (15) ) . Although memory B cells can develop outside of the ge rminal center, the peripheral memory BCR repertoire in SLE is established by exaggerated somatic hypermutation and increased receptor editing (reviewed in (15) , suggesting that these memory cells develop within the ge rminal center. Although there is some evidence to suggest that lupus can develop in the absence of T cells (91, 92) the abundance of human and mouse data favor the requirement of T cells for p athogenic autoantibody production and SLE development. Dendritic Cells in SLE Despite the evidence that intrinsic defects in T cells and B cells foster abnormal interactions between these cell types, there is an abundance of evidence suggesting that d endritic cell (DC) abnormalities play a major role in enhancing these interactions .

PAGE 32

32 DCs are the bridge between the innate and adaptive immune system and are found in all tissues including blood and lymphoid organs (93 ) . There are two main pathways to DC development from hematopoietic progenitor cells. One pathway generates mye loid derived DCs (mDCs), whereas another generates pDCs (93) . While mDCs are found in the blood, secondary lymphoids organs, and peripheral tissues, pDcs mainly circulate in the blood and migrate into secondary lymphoid organs by high endothelial venules (93) . In the peripheral tissues, DCs are found in the im mature stage and possess enhanced phagocytic abilities . Once DCs are activated, they mature into efficient APCs to present antigen to T cells (93) . DC activation may occur by various stimuli, including microbes, d ying cells, innate immune cells, and adaptive immune cells (93) . Pathogen associated molecular patterns (PAMPs) and danger associated molecular patterns (DAMPS) from microbes and dying cells, respectively, stimulat e pattern recognition receptors (PRRs) on DCs (93) . Among other molecules, these PRRs include the TLR class of molecules in which ten human and twelve murine TLR molec ules have been classified (93) . The activation and maturation status of the DC is critical in determining the fate of the immunological response to an antigen. Immature DCs help to maintain tolerance by presenting self antigens to lymphocytes in the absence of costimulation, leading to anergy (94) . However, DC hyperactivity can lead the development of an immunogenic response to self antigens, which would normally be tolerized (94) . As such, alterations in DC homeostasis have been implicated in SLE (93) . Enhanced CD86 Expression Similar to lupus B cells, it has been determined that lupus DCs spontaneously over express CD86 in the absence of DC activation signals when compared to DCs

PAGE 33

33 from healthy individuals (95) . This pre activation suggests lupus DCs may be more efficient antigen presenting cells with a greater capacity of activating autoreactive T c ells. Though this is an important abnormality that provides insight into the mechanisms by which tolerance is breached, another critical DC abnormality is the enhanced production of type I interferons. Enhanced Type I Interferon Production Type I Interfero ns : There are several proteins that make up the type I interferon ( IFN 1 ) family. These proteins are encoded by 17 genes 13 genes for the differen t IFN genes for the each of the four additional IFN 1 family members: IFN (18) . Stimuli for IFN 1 production is generally viral DNA or RNA, which are sensed by four of the ten human TLRs, namely T LR3, 7, 8, and 9. These receptors are located in the endosome of the pathogen sensing cell, which is an opportune location to recognize nucleic acid from viral invaders. TLR3 is activated by double stranded RNA, TLR7 and TLR8 by single stranded RNA, and TL R9 by unmethylated CpG rich DNA (18) . Stimulation of these TLRs leads to the activation of signal transduction pathways that result in phosphorylation of several transrciption factors, including interferon regulator y factor (IRF) 3, IRF 5, and IRF 7. This ultimately leads to IFN 1 production (18) . While many cells types have the capacity to produce small amounts of IFN 1 in response to viral RNA, plasmacytoid DCs (pDCs), whi ch represent less than 1% of PBMCs, are the major producers of these cytokines in response to several different microbes. pDCs have the capacity to produce such great concentrations of IFN 1 , partly due to their expression of TLR7, TLR9, as well as IRF3, 5 , and 7 (96) .

PAGE 34

34 Once IFN 1 is produced, it plays a critical role in modulating effector functions of the adaptive immune system. As such, IFN 1 causes DC activation and maturation, which results in increase d expressio n of MHC I and MHC II mol ecules. In addition, as a consequence of DC activation and maturation, enhanced DC expression of various cytokine s and their receptors, co stimulatory molecules, and B cell activating factors is observed (97) . This promotes T and B cell activation. It also causes Ig isotype class switching on B cells (18, 97) . Moreover, IFN 1 stimulates the production of several cytokines, 6, and IL 10 by cells of the innate immune system, including NK cells, monocytes, macrophages, and DCs (18, 97) . This further influences the adaptive immune response. Therefore, due to the effects that IFN 1 has on every facet of the immune system, this cytokine class has the capacity to cause and/or perpetuate autoreactive immune responses. Type I Interferons in SLE : It is now well established the most SLE patients with active disease display an interferon signature in which IFN 1 regulate d genes are induced in PBMCs (98) . The role of IFN 1 in SLE development was also displayed by the induction of reversible SLE in cancer patient s treated with IFN 1 therapy (93) . Therefore excessive IFN 1 concentrations clearly contribute to the development of lupus. There has been much debate regarding the cause of this enhanced IFN 1 signaling in SLE patients. On e theory involves immune complexes (IC), containing erum. I mmune complexes are internalized by (18) . Once the IC reach es the endosome, the associated nucleic acid stimulates the appropriate TLR, ultimately resulting in massive IFN

PAGE 35

35 production (18) . This mechanism has been demonstrated in vitro , employing both DNA and RNA containin g IC (99) . However, signal tran s duction downstream of TLR 7 seems to be very critical for IFN containing ICs that trigger (18) . As outlined above, SLE patients may have an increased propensity to produce IFN 1, which likely contributes to disease development/progression. However, to add fuel to the fire, there is evidence that there are intrinsic defect s relating to the signal transduction pathway downstream of t he type I IFN receptor (IFNAR) (18) . There is an association between polymorphisms in the gene encoding tyrosine kinase 2 (TYK2) and susceptibility to SLE (100) . TYK2 is a janus kinase (JAK) that binds to IFNAR and is required signaling through this receptor (101) . Additionally, within the last decade, a haplotype in the thi rd intron of STAT4 , which encodes the STAT4 transcription f actor that transmits IFN signals , was associated with susceptibility to SLE (102) . Since these genes are involved in many different cellular functions, the se defects may lead to enhanced responsiveness to IFN 1 and to the production of many other cytokines . Immune Regulators Given that enhanced leukocyte activation and excessive cytokine production are major contributors to pathogenic autoantibody production , one can predict that a lack of immune regulation contributes to autoimmunity and to the development of clinical manifestations of SLE. There are cellular and molecular regulators of the immune system. One of the important cellular regulators is the regul atory T cell (Treg) . Regulatory T cells Tregs play a key role in m aintaining peripheral tolerance and preventing autoimmune diseases. The first description of T cell s with the ability to suppress

PAGE 36

36 autoantibody production was reported several decades ago b y Teague and Friou in 1969 (103) . They demonstrated that transfer of thymus cells from young mice into older mice prevented the production of ant i nucleoprotein antibodies (103) . Though the interest in suppressor T cells diminished for several years, the ir significance resurged in the 1990s when Sakguchi and colleagues reported that 3 day thymectomized mice developed o rgan specific autoimmunity . This group determined that autoim munity developed because suppressor T cells were diminished by thyme ctomy. They revealed that these suppressor cells were CD4+ with high expression of CD25, th chain of the IL 2 receptor (104) . Another foundational study confirming the im portance of these cells demonstrated that transferring CD4 + CD25 cells into nude mice resulted in the development of multi organ specific autoimmune disease, however, this was prevented by cotransfer of CD4 + CD25 + cells (105) . While Tregs constitutively express CD25, activated T cells upregulate this molecule. Therefo re, it was determine that a better marker for Tregs is the forkhead/winged helix transcription factor, Foxp3 (106) . It is now evident that there are various types of Tregs those that express Foxp3 and those that do not. The non Foxp3 expressing Tregs include T regulatory 1 (Tr1) cells that produce predominantly IL 10, and T helper 3 cells that predominantly produce TGF (107) . However, CD4+CD25+Foxp 3 + Tregs are crucial for preventing autoimmunity and maintaining immune homeostasis. This transcription factor is responsible for Treg differentiation (106) and for preventing Tregs from being skewed toward the pro inflammatory Th17 subtype (108) . The importance of Foxp3 is underscored by the evidence that Foxp3 depletion in neonatal or adult mice results in lymphoproliferation and lethal multisystem

PAGE 37

37 autoimmunity (109) . Additionally, humans with a mutation in this gene develop a severe autoimmune syndrome called IPEX (Immunodysregulation, Polyendocrinopathy, and Enteropathy, X linked) (110) . In addition to natural Tregs (nTregs) that develop in the thymus, IL 2 and TGF can induce naïve, peripheral CD4 + T cells to become Foxp3 + T cells in periphera l lymphoid organ s . This differentiation can also occur in vitro (111) . These induced Tregs (iTregs) have similar phenotypic and functional properties to nTregs, and it is thou ght that both of these Treg subsets comprise the CD4 + CD25 + Foxp3 + population that circulates in the periphery. Considering the importance of Tregs in maintaining immune homeostasis and preventing autoimmune disease, they have been extensively studied in human lupus and murine models of the disease. T regs in murine models of lupus : There have been a number of Treg abnormalities reported in several mouse models of lupus (reviewed in (112) ) . These abnormalities are associated with Treg frequency and/or functiona lity. Abnormal Treg proportions have been reported in (NZB x NZW)F 1 (B x W ) mice. Hsu and colleagues reported that t he pool of Tregs in ( B x W) mice is 40% to 50% that of normal mice (113) . This reduced frequency apparently contributes to disease, as the adoptive transfer of expanded CD4 + CD25 + cells to these mice delayed disease onset (114) . While abnormal Treg frequency is associated with disease in the ( B x W) mice, ab normal Treg suppressive function has been attributed to disease progression in other models. However, this reduced Treg functionality does not appear to be due to an intrinsic Treg defect ; rather, the enhanced inflammatory environment in lupus inhibits Tre g suppression. Support of this view is evidenced by several reports that Treg

PAGE 38

38 suppression is intact in vitro (reviewed in (112) , but lupus effector T cells are more res istant to this suppression (115) . Therefore, Tregs in lupus may not be able to overcome the immune cell hyperactivity or the proinflammatory cytokine production by these cells. IL 6, which is a hallmark pathogenic cytokine in lupus, blocks Treg function. Thus, Tr egs may not have the ability to funct ion normally in inflamed environment of lupus models. Tregs in human lupus : Defects in Treg frequency have also been reported in human lupus. Eight groups have demonstrated that SLE patients have decreased percentage s of CD4 + CD25 + Foxp3 + Tregs (reviewed in (112) ) . Additionally, four of these groups have reported that this reduced proportion of Tregs in inversely correlated with disease activity (reviewed in (112) ). Therefore , disease remission appears to normalize the Treg population. These studies may suggest that Tregs are less stable in the inflammatory environment of active SLE patients. In addition to decreased percentages of Tregs in human lupus, several groups have also reported decreased suppressive activity of these cells in vitro (reviewed in (112) . The m ajority of these groups ascribe the decreased sup pression to reduced Treg proportio n or defective Treg function . However, similar to the MRL/lpr model, one group has attributed the suppression defect to resistance of effector T cell to suppression (116) . Based on the murine and human data, it is apparent that there are Treg abnormalities in lupus. Whether this is a consequence of the inflammatory environment

PAGE 39

39 determined. Nonetheless, decreased T reg percentages and/or abnormal Treg functionalit y certainly disrupt immune homeostasis and may perpetuate disease. Suppressors of Cytokine Signaling While cellular regulators are important in preventing autoimmunity, intracellular molecular regulators are also critical. As discussed above, cytokines are key components of the immune system that help direct appropriate immune events. However, aberrant cy tokine production and signaling leads to exce ssive immune cell activation and autoimmune disease development. As such, proinflammatory cytokines, including IFN 1, IFN 6, IL 17, IL 21, and Blys have been associated with SLE. Therefore, regulatory mecha nisms must exist to maintain the fine balance between beneficial and deleterious responses to these cytokines . Similar to antigen binding to the TCR or the BCR, cytokine binding to its rece ptor initiates activation of specific signal transduction pathwa ys leading to transcription of genes involved in the activation and differentiation of the target cell. Several of the proi nflammatory cytokines associated with SLE, including IFN 6, activate the JAK STAT pathway. Therefore , molecular regula tors of this pathway may be potential therap eutic targets for this disease. Almost two decades ago , Starr and co lleagues identified a family of negative regulators of cytokine signaling called suppressors of cytokine signaling (SOCS) (117) . This family contains eight members, SOCS1 to SOCS7 and cytokine inducible SH2 containing protein (CIS) (117) . Of the eight members, SOCS1 and SOCS3 are the most effective cytokine regulators (118) . SOCS1 was originally indentified as a negative regulator of IL 6 (117) . However, subsequent studies re vealed that SOCS1 regulate s var ious cytokines that utilize the JAK ST AT signaling pathway (117) . In line with this

PAGE 40

40 finding , SOCS1 appears to interact with all four members of the JAK family (JAK1 to JAK3 and TYK2) and prevents phosphorylation of JAK targets (119 121) . Therefore, the results of these studies led to the conclusion that SOCS1 is a component of a feedback loop that negatively regulates the cytokines that lead to its expression. The finding that SOCS1 / mice die within three weeks of birth highlights the importance of SOCS1 as a molecular regulator of cytokine signaling (122, 123) . These mice suffer from an inflammatory disease that involves fatt y degeneration of the liver, lymphopenia, and monocyte infiltration of the heart, liver, lung, pancreas, and skin (122, 123) . CS1 / / mice are r escued from peri natal lethality. There is also evidence to suggest that SOCS1 expression prevents murine lupus. While SOCS1 / mice suffer from severe peri natal lethal disease, SOCS1 +/ mice , which possess one functional allele o f this gene, develop lupus like disease characterized by anti DNA autoantibody production and glomerulonephri tis (124) . Additionally, Sharabi and colleagues reported that splenocytes taken from diseased ( B x W ) mice display reduced SOCS1 expression and enhance STAT1 activ ation (125) . They also demonstrated that treatment of these mice with a tolerogenic peptide, hCDR1, both enhanced SOCS1 expression and ameliorated disease (125) . Although reduced SOCS1 expression is implicated in murine lupus, whether the expression of this gene is r elevant in human disease is unc lear (126, 127) . T he refore, the mechanisms by which reduced SOCS1 expression leads to lupus disease onset and the relevance of its expression in human SLE warrants further investigation. These questions were

PAGE 41

41 addressed in this thesis and the results of this investigation hav e let to support of SOCS1 as a therapeutic target in SLE.

PAGE 42

42 CHAPTER 2 MATERIALS AND METHODS Animals SOCS 1 +/ mice (C56BL/6 genetic background) were purchased from the St. Jude animal facility (Memphis, TN) and mated, generating WT, SOCS1 +/ , and SOCS1 / m ice. SOCS1 +/ and WT littermate control mice were chosen for experiments. SOCS1 +/ / mice were also purchased from the St. Jude animal facility. Mice were maintained under specific pathogen free conditions at the University of Florida Cancer an d Genet ics Animal Care Facility under the supervision of the Institutional Animal Care and Use Committee in strict accordance to approved protocols. Genotyping To determine the genotype of each mouse, a tail clip ping (1mm) was acquired and degraded using the DNA easy Blood and Tissue Kit (Quiagen, Valecia, CA) . Once DNA was extracted, quantitative PCR (qPCR) was performed to assess of the presence SOCS1 relative to actin . Primer sequences are listed in Table 2 1 . qPCR reactions were performed using the PTC 200 Peltier Thermal Cycler with a CHROMO 4 Continuous Fluorescence Detector (BioR ad, Hercules, CA) . Expression was calculated Human Subjects 17 SLE patients (16 females and 1 male; mean age: 48) and 8 healthy controls (5 female s and 3 males; mean age: 30) were enrolled in this study. All SLE patients were diagnosed by the 1982 SLE criteria (128) . Subjects with active infections and patients treated with mofetil mycophenolate, azathioprine, me thotrexate, or systemic

PAGE 43

43 corticosteroids were excluded. This study was approved by the University of Florida Institutional Review Board (IRB). Isolation of Human PBMCs PBMCs were purified from heparanized blood by Ficoll Paque gradient centrifugation. Whol e blood was diluted with PBS (1:1) and gently layered on Ficoll (Lymphocyte Separation Medium; Cellgro, Manassas, VA). Cells were centrifuged continuously at 400xg for 20 minutes at room temperature . PBMCs were collected from the interface layer and washed 3 times with PBS. After isolation, PBMCs were harvested for CD64 surface staining, as previously described (129) , or lysed with RNA lysis buffer (Promega) and stored at 80°C until RNA extraction and qPCR protocols were p erformed. Surface and Intracellular Staining To assess ex vivo T cell populations, single cell suspensions were obtained from the thymus or pooled lymph nodes (axillary, brachial, cervical, inguinal, and mesenteric) and spleen. Aliquots of these organ spe cific cell suspensions were stained with the following monoclonal antibodies (mAb): anti CD4 Pacific Blue (RM4 5; BD Biosciences, San Diego, CA) and anti CD8a Alexa Flour 700 (53 6.7; BD Biosciences). To determine the activation status of CD4 + T cells, LN and spleen suspensions were also stained with anti CD25 allophycocyanin (PC61; BD Biosciences) and anti CD69 APC (H1.2F3; BD Biosciences). Foxp3 and IL 17A intracellular staining (ICS) were employed to assess in vitro Treg and Th17 induction, respectively. For Foxp3 ICS, cells were fixed and permeabilized using the reagents provided by the Foxp3 / Transcription Factor Staining Buffer Set (eBioscience). Cells were then stained with anti Foxp3 FITC (FJK 16s; eBioscience) Ab. For IL staining, cells were incubated

PAGE 44

44 Aldrich. St. Louis, MO), and brefeldin A (130) . Cells we re then fixed and permeabilized using the reagents provided by the Intracellular Cytokine Staining Starter Kit Mouse (BD Biosciences). Following fixation and permeabilization, cells were stained with an anti IL17A Alexa Flour 700 or an anti PE mAb. A fter staining (surface and ICS), a total of 50,000 live events were collected on an LSRII (BD Pharmingen) and analyzed using FlowJo software (Tree Star, San Carlos, CA). Magnetic Cell Separation. For each mouse, CD4 + CD25 T cells were enriched using a re gulatory T cell isolation kit and magnetic activated cell sorting (MACS) technology (Miltenyi Biotec, Bergisch Gladbach, Germany). After isolation, flow cytometry was used to assess the purity of CD4 + CD25 T cell populat CD4 + CD25 T cell popu lat ions were used for experiments. In Vitro T Cell Differentiation CD4 + CD25 T lymphocytes (1x10 5 /well) were cultured in triplicate at 37°C (5% CO 2 ) in RPMI 1640 (Cellgro 10 040 CV) containing 10% FBS (Invitrogen TM Gibco ® ) 1% ME (MP Biomedicals, Solon, OH). For bound anti CD3 mAb (BD Pharmingen; clone:145 CD28 mAb ( BD Pharmingen; clone: 37.51), and 2ng/ml human TGF 1 (R&D Systems). Cells were incubated for 72 hours and assessed for Treg differentiation by ICS for Foxp3. For Th17 differentiation, cells bound anti CD3 mAb (BD Pharmingen; clone: 145.2C11), CD28 mAb (BD Pharmingen; clone 37.51), 5ng/ml

PAGE 45

45 human TGF 6 (Ebioscience). CD4 + CD25 cells stimulated with plate bound anti CD3 mAb and soluble anti CD28 mAb, or plate bound anti CD3 mAb alone, served as stimulation controls for both Treg and Th17 differentiation assays. Cells were collected after 5 days and assessed for activation and Th17 differentiation. Proliferation Assays CD4 + T cell proliferati on was assessed 3 H thymidine incorporation and absolut e cell counts. MACS purified CD4 + CD25 T cells, isolated from LN and spleen suspension, were stimulated in triplicate (96 well round bottom plate; 1x10 5 anti CD28 (BD Pharmingen; clone 37.51) at 37°C (5% CO 2 ) in RPMI 1640 (Cellgro; 10 040 CV) containing 10% FBS (Invitrogen TM Gibco ® ), 1% antibiotic/antimycotic (Herndon, VA), ME (MP Biomedicals, Solon, OH). After 72 h of incubation, cell cultures were either pulsed with 0.5 mCi 3 H thymidine (GE Healthcare; Arlington Heights, IL) or counted and harvested for assessment by flow cytometry . 3 H thymidine pulsed T lymphocytes were harvested 16 18 hours after initial pulse followed by the 3 H thymidine incorpo ration assessment using a Beckman LS3801 Liquid Scintillation System. Absolute cell numbers of CD4 + lymphocytes were obtained via Trypan Blue exclusion. RNA Extraction and qPC R Using the Promega RNA extraction protocol, total RNA was extracted from human PBMCs ex vivo or from mouse CD4 + CD25 cells after being cultured under control (anti CD3 and anti CD28) or Th17 inducing conditions in the presence or absence of SOCS1 KIR peptid e . cDNA synthesis was performed using the iQ cDNA synthesis kit (Bio rad; Hercules, CA). To amplify the target and house keeping genes

PAGE 46

46 present in cDNA, qPCR was subsequently performed using the iQ SYBR Green Supermix (Bio Rad) and gene specific primers (Ta ble 2 1 ). The amplification reactions took place in a PTC 200 Peltier Thermal Cycler with a CHROMO 4 Continuous Fluorescence Detector (BioRad). The reaction protocol is as follows: one 2 3 min cycle at 95 °C, followed by 50 cycles of denaturation (9 5 °C, 1 5s), annealing (30s) , and extension (72 °C, 30s). Annealing temperatures are listed in Table 2 1. To confirm amplicon specificity, melting curve analysis was performed. The fold change in In Vitro Cytokine S ecretion Analysis. SOCS1 +/ and WT CD4 + CD25 T cells were plated and stimulated in triplicate with plate bound anti CD3 alone (BD Pharmingen; clone: 145.2C11), plate bound anti CD3 and anti CD28 (BD Pharmingen; clone 37.51), or Th17 inducing conditions fo r 5 days as previously described (130) was collected from each well. Harvested supernatants were used to perform IL 17A and 17A capture (555068) and detection (555067) mAb, and IFN standard (554587) were purchased from BD Biosciences. IL 17 cytokine standard (14 8171 80), IFN 7313 7311 85) mAbs were purchased from eBioscience. IgG Antibod y Assessment Total IgG and anti dsDNA IgG levels were measured by ELISA as in Morel et al . (131) . For the anti ssDNA IgG ELISA, ssDNA was generated by heating rat dsDNA at 100°C for 10 minutes, followed by a 5 minute i ncubation on ice. The resulting ssDNA was then used to coat the wells of flat bottomed 96 well plate. Relative units of anti DNA IgG were standardized using serum taken from C56BL/6 triple congenic (B6.TC)

PAGE 47

47 mice, which co express three lupus susceptibility loci ( Sle1, Sle2, and Sle3) and develop severe lupus like disease (131) . 1:100 dilution of B6.TC serum was set to an equivalent of 100 units. Statistical Analysis GraphPad Prism v.5 was used to calculate the statistica lly significant differences between two different groups using the nonparametric, Mann Whitney U test. For multiple comparisons tests, the nonparametric Kruskal Wallis test was performed, test. For correlati on data, the nonparametric Spearman correlation test was performed. A 95% confidence limit, defined by p

PAGE 48

48 Table 2 1. Mouse (mus) and Human (hu) mRNA Primer Sequences and Annealing Temperatures mRNA Forward Prim er Reverse Primer Annealing Temp (°C) m us actin CCTTCCTTCTTGGGTATGGA GGAGGAGCAATGATCTTGAT 55 mus AACTATTTTAACTCAAGTGGCAT 5' AGGTGTGATTCAATGACG 3' 55 mus Tbet 5' GGGAGAACTTTGAGTCCA 3' 5' GAAGGTCGGGGTAGAAA 3' 50 mus IL 17a 5' ACTCTCCACCGCAATGA 3' 5' CTCTTCAGGACCAGGAT 3' 55 mus 5' ACAGCCACTGCATTCCCAGTTT 3' 5' TCTCGGAAGGACTTGCAGACAT 3' 63 mus SOCS1 5' GACACTCACTTCCGCACCTT 3' 5' GAAGCAGTTCCGTTGGCACT 3' 57 hu GAPDH TGCACCACCAACTGCTTAG GAGGCAGGGATGATGTTC 59 hu SOCS1 GGGAGCGGATGGGTGTAGG AGAGGTAGGAGGTGCGAGTTC 3' 59 hu TGACCAGAGCATCCAAAAGA CTCTTCGACCTCGAAACAGC 59

PAGE 49

49 CHAPTER 3 RESULTS SOCS1 +/ mice exhibit CD4 + T cell accumulation and enhanced CD4 + T cell activation in the periphery Given that murine studies implicate a relationship between decreased SOCS1 expression and increased lupus pathology (124, 125) , in this study we sought to elucidate the mechanisms by which SOCS1 deficiency leads to lupus disease onset. Since SOCS1 +/ mice, which are intrinsically deficient in SOCS1, develop lupus like disease (124) , we selected this mouse model to address the aim of our study. To determine how SOCS1 deficiency precipitates autoimmunity and subsequent clinical manifestation of lupus, it is important to study SOCS1 +/ mice prior to presentation of serological or clinical s igns of lupus. Given that it has previously been shown that SOCS1 +/ mice begin to produce autoantibodies and display proteinuria at 6 months of age, we selected SOCS1 +/ mice between 2 and 5 months of age and assessed anti DNA autoantibody production and proteinuria (Figure 3 1 ). SOCS1 +/ mice in this age range did not display serological evidence of autoantibody production (Figure 3 1B) or evidence of proteinuria (Figure 3 1C). Therefore, mice in this age range were selected for our study. Considering tha t CD4 + T cells play a critical role in lupus development and that SOCS1 is preferentially expressed in lymphoid tissues, we first assessed CD4 + T cell frequencies in the thymus, lymph nodes (LN), and spleen of SOCS1 +/ and SOCS1 +/+ (WT) mice. Although the frequency and absolute numbers of CD4 + CD8 thymocytes within SOCS1 +/ and WT controls were indistinct (Figure 3 2A), CD4 + T lymphocytes in the LN and spleen (periphery) of SOCS1 +/ mice were two fold higher in frequency and four fold higher in absolute cell number, when compared to WT controls (Figure 3 2B).

PAGE 50

50 As T lymphocyte activation precipitates proliferation and enhanced lymphocyte activation contributes to pathogenic autoantibody production (44, 132 135) , we next assessed expression of the activation marker, CD25, on peripheral CD4 + T cells, ex vivo. Indeed, SOCS1 +/ mice possessed an enhanced frequency of peripheral CD4 + CD25 + cells ( Figure 3 2C) . When absolute number s were assessed, we also observed nearly 3 fold more peripheral CD4 + CD25 + cells ( 6.9 x 10 6 vs. 2.4 x 10 6 ) when compared to WT (Figure 3 2C). This increase in CD25 expression was not due to increases in Tregs, as levels of Foxp3 + T lymphocytes were indistinct between SOCS1 +/ mice and littermate controls (Figure 3 3). In addition to CD25 expression, activation of CD4 + T lymphocytes can also be analyzed by the presence of the early activation marker CD69 (136, 137) . CD4 + CD69 + T lymphocytes were also higher in both frequency and absolute number within SOCS1 +/ mice (Figure 3 2C). Together, these data show that SOCS1 +/ mice possess an enhanced population of activated C D4 + T lymphocytes, which have previously been shown to contribute to autoantibody production. CD28 co stimulation of SOCS1 +/ CD4 + CD25 T lymphocytes is not required for activation or clonal expansion Having observed enhanced CD4 + T cell activation within the peripheral lymphoid organs of SOCS1 +/ mice, we conducted in vitro assays next to characterize this observation mechanistically. Given that conventional T lymphocytes (Tcon) require signaling through both TCR and CD28 for activation (reviewed in (138) ), we next stimulated MACs purified, CD4 + CD25 T lymphocytes with antibodies specific to CD3 and CD28 ( CD3/ CD28), in vitro. After 72 hours of incubation, CD3/ CD28 activated CD4 + T lymphocyte populations were greate r than 70% CD25 + , independent of SOCS1

PAGE 51

51 expression (Figure 3 4 A). In similar fashion, CD3/ CD28 treatment mediated comparable CD69 up regulation in both SOCS1 +/ and littermate control T lymphocytes (Figure 3 4 treatment mediated limited CD25 hi expression in SOCS1 sufficient CD4 + T cells, 45% of SOCS1 +/ counterparts had high levels of CD25 expression with CD3 treatment alone (Figure 3 4A). Moreover, the CD69 hi percentage was also greater in CD3 treated SOCS1 +/ CD4 + CD25 + T lymphocytes compared to SOCS1 +/+ CD4 + controls (Figure 3 4 A). Since clonal expansion (eg. proliferation) occurs subsequent to CD4 + T cell activation (139) , we then assessed T cell proliferation after CD3/CD28 stim ulation or after CD3 stimulation alone. Consistent with CD25 and CD69 frequencies after CD3/CD28 stimulation (Figure 3 4A), SOCS1 +/ CD4 + T lymphocyte pro liferation (as assessed by absolute cell counts and 3 H thymidine incorporation) was statistically indi stinguishable to that of SOCS1 +/+ controls place d under this condition (Figure 3 4 B). Strikingly, however, CD3 treatment alone mediated significantly more proliferation of SOCS1 +/ CD4 + T lymphocytes, as depicted by absolute cell numbers that were 3 fold higher, and 3 H thymidine incorporation that was 6 fold greater, under this condition (Figure 3 4B). In summary, these results indicate that SOCS +/ CD4 + T cells have a reduced threshold for activation and clonal expansion in vitro. SOCS1 +/ CD4 + CD25 T cells undergo normal Treg induction, but abnormal Th17 induction As proper T cell differentiation is critical for the maintenance of immune homeostasis and inhibition of autoimmunity (reviewed in (140) ), we next inve stigated the differentiation potential of SOCS1 +/ CD4 + CD25 T lymphocytes through incubation under regulatory and Th17 inducing conditions (iTh17). While flow cytometric analysis of

PAGE 52

52 Treg induction (as denoted by the frequency of Foxp3 + cells) revealed no d ifference in Treg induction between SOCS1 +/ and WT CD4 + T cells (Figure 3 5A), it is noteworthy that, after incubation under iTh17 conditions, there was a significant reduction in the percentage of SOCS1 +/ IL 17A + cells (Figure 3 5B). Reduced Th17 differe ntiation of SOCS1 +/ lymphocytes was confirmed by qPCR and ELISA, which showed reduced levels of IL 17a message, secreted IL 17A protein, and decreased expression levels of the Th17 specific transcription factor (Figure 3 5C). Taken together, these data indicate that while SOCS1 +/ CD4 + T cells have the capacity to undergo normal Treg induction , SOCS1 deficient T cells have a reduced capacity to undergo proper Th17 differentiation. SOCS1 +/ CD4 + T Cells display h eightened I under Th17 inducing conditions Considering (141) ) , we hypothesized that the reduced capacity of SOCS1 +/ T cells to undergo Th17 differen tiation could be due to dysregulated IFN signaling. To test this hypothesis, we placed SOCS1 +/ or WT cells under iTh17 conditions and first assessed mRNA expression of and T bet (142) . As demonstrated, expression was more than 2 fold greater in SOCS1 +/ cells in comparison to WT controls (Figure 3 6A). In parallel with the heightened message expression, T bet expression was also increased more than 2 fold (Figur e 3 6A). Enhanced expression was also seen at the protein level, as ELISA revealed that SOCS1 +/ CD4 + cells produced 2 conditions (Figure 3 6B). Moreover, intracellular staining for IL induction, showed that, while SOCS1 +/ CD4 + cells displayed a lower proportion of

PAGE 53

53 CD4 + IL 17 + cells, they also displayed a concomitant increase in the proportion of CD4 + + cells (Figure 3 6C). Taken together, these results demonstrate that SOCS1 +/ CD4 + T cells display an abnormal Th1 phenotype, even under Th17 inducing conditions. To confirm +/ CD4 + T cells is the culprit for the reduced Th17 differentiatio n, we assessed Th17 differentiation in SOCS1 +/ CD4 + T cells taken from SOCS1 +/ IFN / mice. While Th17 differentiation of SOCS1 +/ cells resulted in a 2.3% CD4 + IL 17A + population, intracellular staining revealed a 4.8% population in SOCS1 +/ / cells (Figure 3 6D). This population of SOCS1 +/ / induced Th17 cells was similar to WT controls (Figure 3 6D). In summary , these data show that preferential expression of IFN by SOCS1 +/ CD4 + T lymphocytes precludes Th17 differentiation. Reduced SOC S1 expression levels are observed in SLE patients Although we demonstrate that SOCS1 deficiency in SOCS1 +/ mice results in enhanced CD4 + shown to be critical to murine lupus development (17, 63 66) , whether SOCS1 deficiency is relevant t o human SLE is un clear (126, 127) . Therefore, to determine whether differences in SOCS1 expression are relevant to human SLE, we assessed SOCS1 expression in peripheral blood mononuclear cells (PBMCs) taken from SLE patients and healthy controls. Although anti malarials and glucocorticoid s are common standard of care medications used to treat SLE (reviewed in (143) ), their effects on the modulation of SOCS1 expression in human leukocytes are unknown. Therefore, prior to selecting our patient popula tion, we treated healthy control PBMCs with an antimalarial,

PAGE 54

54 chloroquine, and a glucocorticoid, dexamethasone, in vitro and assessed SOCS1 expression. Our pilot study revealed that SOCS1 expression was affected by dexamethasome, but not by chloroquine (Fig ure 3 7 ). As such, patients prescribed glucocorticoids were excluded from our study. Strikingly, as demonstrated in Figure 3 8 , SOCS1 mRNA expression was significantly decreased in SLE patients in compariso n to healthy controls (Figure 3 8 A). The differen ces in SOCS1 expression were likely not due to age, as deficiencies in SOCS1 expression were readily observed in SLE patients compared to age matched c ontrols (Figure 3 8B ) . Given that both type I and type II IFNs have been shown to play a key role in the immunopathogenesis of human SLE, and that SOCS1 is a critical regulator of the signaling of these cytokines (63, 144 147) , we next investigated whether SOCS1 for the IFN 1 signature in SLE patients (129) ). While no significant correlation was observed between SO CS1 negative correlation was noted when SOCS1 was compared to monocyte CD64 (Figure 3 8C ). Notably, the patient with the lowest SOCS1 expression disp layed the highest monocyte CD64 expression (Figure 3 8C ). We also investigated whether SOCS1 expression was associated with disease activity, as defined by SLE disease act ivity index (SLEDAI) scores, serum complement component 3 (C3) levels, and serum complement component 4 (C4) levels. C3 and C4 levels were examined because decreases in free com plement molecules in serum are indicative of increased levels of immune complexes and disease activity (reviewed in (148) ). Based on the patient population studied, there was no significant correlation between SOC S1 expression and SLEDAI scores, C3 levels, or C4 levels (Figure 3 9 ).

PAGE 55

55 A B C Figure 3 1. SOCS1+/ mice do not display serological or clinical signs of disease at <6 months of age. ( A ) Display of s chematic timeline for autoantibody production by SOCS1 +/ m ice and of age range of mice chosen for experiments. ( B ) Serum c oncentrations of total IgG antibodies and IgG autoantibodies specific for ssDNA and dsDNA antigens in SOCS1 +/+ or SOCS 1 +/ mice were measured by ELISA . ( C ) Proteinuria was assessed in SOCS1 +/+ and SOCS1 +/ mice . ELISAs and proteinuria measurements were performed on mice <6 months of age. Results are shown as mean ± s.e.m. Statistical comparisons were performed using the Mann Whitney U test.

PAGE 56

56 A B C Figure 3 2. SOCS1 +/ mice exhibit CD4 + T cell accumulation and enhanced CD4 + T cell activation in the periphery. ( A ) SOCS1 +/+ or SOCS1 +/ thymus composition was analyzed. Dot plots display CD4 versus CD8 profiles in SOCS1 +/+ or SOCS1 +/ mice (right). Graphs on left show C D4 + CD8 thymocyte frequency, assessed by flow cytometry , and absolute numbers (n=9). For ( B ) and (C) LN and spleen cells were pooled from SOCS1 +/+ or SOCS1 +/ mice , followed by flow cytometric analysis . (B) Histograms on the right display CD4 + expression present in SOCS1 +/+ or SOCS1 +/ mice . Graphs on the left show the frequency and absolute numbers of CD4+ leukocytes (n=8). ( C) CD4 + CD25 + and CD4 + CD69 + T cell frequencies were assessed for each mouse genotype by flow cytometry (left) (n=9). Each data point represents an individual mouse. Results are shown as mean ± s.e.m. Statistical comparisons were performed using the Mann Whitney U test (*P < 0.05).

PAGE 57

57 Figure 3 3. SOCS1 +/ mice possess a normal peripheral CD4 + CD25 + Foxp3 + cell frequency. LNs and spleen from SOCS1 +/+ or SOCS1 +/ mice were pooled and the CD4 + CD25 + Foxp3 + frequency was assessed by flow cytometry. Results shown as mean ± s.e.m. Statistical comparisons between SOCS1 +/+ and SOCS1 +/ mice were performed using the Mann Whitney U test .

PAGE 58

58 A B Figure 3 4. CD28 co stimulation is not required for activation and expansion of SOCS1 +/ CD4 + T lymphocytes. CD4 + CD25 T cells from SOCS1 +/+ or SOCS1 +/ mice were stimulated with CD3 antibodies alone , or with CD3 and CD28 antibodies , for 72h. ( A) Histograms show CD25 and CD69 expression on CD4 + T lymphocytes. Results are representative of 3 independent experiments. ( B) Proliferati on was assessed by cell counts (top) and 3 [H] thymidine incorporation (bottom). Results are shown as mean ± s.e.m. Statistical compariso ns were performed using the Mann Whitney U test (*P<0.05, ***P<0.0005 .

PAGE 59

59 A B C Figure 3 5. Th17, but not Treg, induction is reduced in SOCS1 +/ CD4 + T lymphocytes. (A ) SOCS1 +/+ or SOCS1 +/ CD4 + CD25 T cells were placed under control ( CD3, CD28) or Treg inducing conditions for 3 d. Foxp3 expression was measured by intracellular staining and flow cytometry. Histograms on the left are representative of 4 independent experiments, which are displayed graphically on the right (each data poi nt represents one mouse). (B) SOCS1 +/+ or SOCS1 +/ CD4 + CD25 T cells were placed under control or Th17 inducing conditions for 5 d. IL 17A expression was measured by intracellular staining followed by flow cytometry. Histograms on the left are representati ve of 10 independent experiments, which are shown graphically on the right (each data point represents one mouse). (C) IL 17 a and ROR t mRNA expression were measured by qPCR (left and right, respectively) and IL 17A secretion was assessed by ELISA (middle) . Graphs of IL 17A qPCR and ELISA are representative of 10 independent experiments and graph of ROR t qPCR is representative of 5 independent experiments .

PAGE 60

60 A D B C Figure 3 6. SOCS1 +/ CD4 + T cells display Th1 bias under Th17 inducing conditions . ( A, B , C ) Sorted SOCS1 +/+ or SOCS1 +/ CD4 + CD25 T cells were placed under Th17 inducing con ditions for 5 d. ( A) Graphs display and Tbet expression, assessed by qPCR (n=4). ( B) Graphs show IFN protein expression, assessed by ELISA. ( C ) Flow diagrams display IL 17 + + cells. (D) Flow diagrams show IL 17A producing cells following Th17 induction of SOCS1 +/+ , SOCS1 +/ , or SOCS1 +/ IFN / CD4 + T cells. Results are representative of 4 indepe ndent experiments . Results are shown as mean ± s.e.m. Statistical comparisons were performed using the Mann Whitney U test (*P<0.05). iTh17 = Th17 inducing conditions. and T bet expression is relative to actin .

PAGE 61

61 A B Figure 3 7. SOCS1 expression is not affected by chloroquine treatment, but is increased by dexamethasone treatment. Total PBMCs were treated with (A) chloroquine diphosphate salt for 12 and 24 h or (B) dexamethasone for 3, 6,12.and 24 h at the indicated concentrations . Post treatment, SOCS1 expression, relative to GAPDH, was assessed via qPCR. Results shown as mean ± s.e.m. The Kruskal chosen to assess statistical significance.

PAGE 62

62 A C Figure 3 8. SOCS1 expression is relevant to human SLE . ( A ) PMBCs were isolated from whole blood , taken from SLE patients or healthy controls , and SOCS1 expression was measured via qPCR, relative to GAPDH . (B) Graph displays SOCS1 expression comparison between SLE patients and age matched controls. (C) For each patient, SOCS1 expression was correlated with expression (left) and monocyte CD64 MFI (rig ht). Results shown as mean ± s.e.m. Statistical comparisons between healthy controls and SLE patients were performed using the Mann correlation was chos en for statistical analyses in ( C ). B

PAGE 63

63 A B Figure 3 9. SOCS1 expression is not correlated with SLEDAI , C3, or C4 levels . PMBCs were isolated measured via qPCR, relative to GAPDH. For each patient, SOCS1 expression was correlate d with (A) SLEDAI, or (B) C3 levels (left) or C4 levels (right). en for statistical analyses.

PAGE 64

64 CHAPTER 4 DISCUSSION The ability of the immune system to differentiate be tween self and non self antigens is a critical to preventing autoimmunity and the subsequent clinical manifestations of autoimmune disease. Although the etiology of SLE remains u nder investigation, it is clear that alterations in different cell types under lie the production of pathogenic anti nuclear autoantibodies . Over several decades, researchers have identified abnormalities within immune cells of the innate and the adaptive immune systems. However, CD4 + T cells have been shown to play an important role . Additionally, there is an abundance of evidence that proinflammatory cytokines, including IL 6, IL 17, IL 21, IFN to the onset/progression of SLE disease. SOCS1 regulates several of these SLE associated proinflammatory cytokines a nd is implicated in Th cell lineage commitment and maintenance . Additionally, SOCS1 +/ mice develop lupus like disease (124) . Moreover, diseased (B x W) mice display reduced SOCS1 expression and treatment of these mic e with a tolerogenic peptide results in enhanced SOCS1 expression and disease amelioration (125) . These murine studies implicate reduced SOCS1 expression with increased lupus pathology. However, the mechanisms by which SOCS1 def iciency precipitates disease have not been established. Therefore, in this study, we investigated SOCS1 +/ mice, prior to disease onset, to determine how SOCS1 deficiency leads to the development of lupus. Considering the evidence supporting the importance of CD4 + T cells in pathogenic autoantibody production and SLE disease development (44, 132 135) , we first examined the CD 4 + T cell frequency in the thymus and the peripheral lymphoid

PAGE 65

65 organs of SOCS1 +/ and control mice. While thymic proportions of CD4 + CD8 T cells in SOCS1 +/ mice were statistically indistinct from WT counterparts (Figure 3 2A), we observed enhanced CD4 + T c ell proportions LNs and spleen (Figure 3 2B). Additionally, SOCS1 +/ peripheral lymphoid organs displayed a 4 fold increase in the absolute number of CD4 + T cells. Given that T cell activation is a requirement for proliferation and that CD4 + T cells in lup us are known to possess intrinsic defects that lead to hyper activation (reviewed in (17) ), we investigated the activation status of these peripheral SOCS1 +/ CD4 + T cells. SOCS1 deficient LN and spleen possessed a n increased proportion of activated CD4 + T cells, as measured by the expression of the activation markers CD25 and CD69. This observation offers a potential explanation for the enhanced percentage and number of CD4 + T cells observed in the periphery of SOC S1 +/ mice. Increased retention of CD4 + T cells in the peripheral lymphoid organs is an additional potential explanation for the enhanced CD4 + T cell population observed in the periphery of SOCS1 +/ mice. However, in 2008, Egwuagu and colleagues reported that SOCS1 / STAT1 / CD4 + T cells displayed decreased expression of chemokine receptor 7 (CCR7), which facilitated the migration of these cells into the peripheral lymphoid tissues (149) . Based on this study, they prop osed that SOCS1 may function in vivo to promote the retention of naive cells in lymph n odes (149) . Therefore, it is unlikely that the increased CD4 + T cell population observed in SOCS1 +/ mice is due to increased retention in the lymph node and spleen. However, due to the fact that there may be differences between these SOCS1 deficient models, measurement of CC7 on CD4 + T cells in peripheral lymphoid organs will confirm this hypothesis.

PAGE 66

66 Nevertheless, the hyperact ivated phenotype of the peripheral SOCS1 +/ CD4 + T cells provides a suitable explanation for the increased proportion of peripheral CD4 + T cells observed in SOCS1 +/ mice. Additionally, this phenotype may be critical to lupus development. Therefore, we soug ht to characterize this observation mechanistically . Interestingly, SOCS1 +/ CD4 + CD25 T cells did not require CD28 co stimulation in order to become activated and to proliferate in vitro (Figure 3 4). This has significant implications for the development of autoimmunity. Although the majority of autoreactive T cell clones are deleted in the thymus, it is well known that this central tolerance mechanism is incomplete (reviewed in (3) ). Therefore, there are peripher al tolerance mechanisms in place to prevent the activation of autoreactive T cells that escape deletion in the thymus. One well established peripheral tolerance mechanism is t he requirement of naïve T cells to receive co stimulation in order to obtain full activation (reviewed in (20, 21) ) . CD28 is constitutively expressed on both naïve and effector T cells and plays a predominant role in co stimulation (37) . Therefore, the observation that SOCS1 +/ CD4 + CD25 T cells do not require CD28 co stimulation suggests that SOCS1 deficiency causes alterations in CD4 + T cell activation. Consequently, autoreactive T cells, that would normally undergo tolerization on a SO CS1 sufficient background, are more likely to become activated and elicit pathogenic effector functions when SOCS1 is not sufficiently expressed. There is a precedent for a hyper responsive CD4 + T cell phenotype in lupus. These cells bear characteristics reminiscent of activated/memory T cells (reviewed in (17) ). Previous research that has outlined molecular and biochemical explanations for this phenotype, including abnormalities associated with signaling molecules

PAGE 67

67 downstream of the TCR. Chuang and colleagues recently reported that SLE peripheral blood T cells possess enhanced expression of GLK, a kinase downstream of the TCR that maintains the activation o (25) . GLK expression was also positively correlated with disease activity (25) , suggesting that regulating the GLK way is important in controlling disease. In addition to defects associated with the GLK abnormalities linked to the PI3K/PKB/Akt pathway in lupus (40, 41 ) . CD4 + T cells from MRL lpr mice display elevated levels of activated Akt compared to control mice (41) . Moreover, it has recently been reported that children with lupus nephritis display enhanced Akt activity i n effector T cells (40) . Therefore, given that SOCS1 regulates kinase activity, investigation of these pathways in SOCS1 +/ CD4 + CD25 T cells may also provide mechanistic insight regarding the reduced requirement for co stimulation observed in these cells. Proper T cell differentiation is also critical for the maintenance of immune homeostasis and the prevention of autoimmune disease development (reviewed in (140) ). Consideri ng the importance of SOCS1 in governing CD4 + T cell differentiation and plasticity (reviewed in ( (141) ), we also explored the capacity of SOCS1 +/ CD4 + CD25 T cells to undergo normal T cell differentiation in vitro. Wh ile SOCS1 +/ CD4 + T cells did not display defects in Treg differentiation in terms of frequency (Figure 3 5A), we cannot conclude that these cells are not defective. Given that Tregs in lupus have been shown to display abnormal Treg function (reviewed in (112) ), It is important measure the suppressive capacity of these iTregs.

PAGE 68

68 Unlike Treg differentiation, SOCS1 +/ CD4 + T cells possess a reduced capacity to undergo Th17 differentiation (Figure 3 5B and Figure 3 5C). We demonstrated that this improper Th17 differentiation was due to enhanced I 3 6), as SOCS1 +/ / CD4 + T cells underwent normal Th17 differentiation (Figure 3 6D). Our results are supported by a previous study published by Yoshi mura and colleagues in 2008 (150) SLE disease pathogenesis (63 66) . Therefore, the fact that SOCS1 +/ CD4 + T cells this phenotype, provides a potential explanation for autoimmune disease development in SOCS1 +/ mice. Whi le previous studies have shown that reduced SOCS1 expression results in lupus development, our study demonstrates that SOCS1 regulates CD4 + T cell abnormalities that have previously been associated with lupus pathogenesis. It has outlined potential mechani sms by which SOCS1 deficiency precipitates disease. Considering the importance of this molecule in murine lupus, we also found it essential to establish the relevance of SOCS1 expression to human disease. Our study revealed that SLE patients have reduced expression in comparison to healthy controls (Figure 3 8A). Although all patients were not age matched with healthy controls, three of the four patients that were age matched displayed reduced SOCS1 expression (Figure 3 8B). This abnormal SOCS1 expression was not correlated with any indicators of disease activity (Figure 3 9), however, it was negatively correlated with monocyte CD64 MFI, a biomarker for IFN 1 signature (129) ) . These data suggest that SOCS1 may be regulating IFN 1 signaling in v i v o. Therefore, patients with lower SOCS1 expression

PAGE 69

69 have a reduced capacity to control IFN 1 signaling and consequently display a more pronounced IFN 1 signature. To strengthen our human results in the future, we will need to increase our study population and include controls that are matched for age, gender, and ethnicity. Specific targeted therapies are developed based on the understanding of dysregulated immunological pathways involved in SLE pathogenesis. Therefore, novel biologica l treatments including B cell targeted therapies, cytokine blockade, and peptide based treatments (reviewed in (2) ) have been developed and studied. Of relevance to new drug development, SOCS1 regulates many of the c ytokines that monoclonal antibodies have been developed to control, including BLys, IL 6, and IFN Moreover, our study has emphasized the importance of SOCS1 in preventing lupus associated CD4 + T lymphocyte abnormalities and has established clinical rele vance of reduced SOCS1 expression to human SLE. Furthermore, we determined that SOCS1 is upregulated by glucocorticoids (Figure 3 7B), which are members of the standard of care arsenal used to treat SLE patients. Therefore, SOCS1 may be a potential novel t argeted molecule for the treatment of SLE. As such, strategies to enhance SOCS1 expression or function, such as the use of SOCS1 mimetic peptides, may have ther apeutic value for SLE patients.

PAGE 70

70 LIST OF REFERENCES 1. Tsokos, G. C. 2011. Systemic lupus erythematosus. N. Engl. J. Med. 365: 2110 2121. 2. Bezalel, S., I. Asher, D. Elbirt, and Z. M. Sthoeger. 2012. Novel biological treatments for systemic lupus erythematosus: current and future modalities. Isr. Med. Assoc. J. 14: 508 514. 3. Shlomchik, M. J., J. E. Craft, and M. J. Mamula. 2001. From T to B and back again: positive feedback in systemic autoimmune disease. Nat. Rev. Immunol. 1: 147 153. 4. Steinberg, A. D., J. B. Roths, E. D. Murphy, R. T. Steinberg, and E. S. Raveche. 1980. Effects of thymectomy or androgen administration upon the autoimmune disease of MRL/Mp lpr/lpr mice. J. Immunol. 125: 871 873. 5. Wofsy, D., J. A. Ledbetter, P. L. Hendler, and W. E. Seaman. 1985. Treatment of murine lupus with monoclonal anti T cell anti body. J. Immunol. 134: 852 857. 6. Santoro, T. J., J. P. Portanova, and B. L. Kotzin. 1988. The contribution of L3T4+ T cells to lymphoproliferation and autoantibody production in MRL lpr/lpr mice. J. Exp. Med. 167: 1713 1718. 7. Shivakumar, S., G. C. Tsok os, and S. K. Datta. 1989. T cell receptor alpha/beta expressing double negative (CD4 /CD8 ) and CD4+ T helper cells in humans augment the production of pathogenic anti DNA autoantibodies associated with lupus nephritis. J. Immunol. 143: 103 112. 8. Madaio , M. P., S. Hodder, R. S. Schwartz, and B. D. Stollar. 1984. Responsiveness of autoimmune and normal mice to nucleic acid antigens. J. Immunol. 132: 872 876. 9. Rumore, P. M. and C. R. Steinman. 1990. Endogenous circulating DNA in systemic lupus erythemato sus. Occurrence as multimeric complexes bound to histone. J. Clin. Invest. 86: 69 74. 10. Mohan, C., S. Adams, V. Stanik, and S. K. Datta. 1993. Nucleosome: a major immunogen for pathogenic autoantibody inducing T cells of lupus. J. Exp. Med. 177: 1367 138 1. 11. Tan, E. M. 1989. Antinuclear antibodies: diagnostic markers for autoimmune diseases and probes for cell biology. Adv. Immunol. 44: 93 151. 12. Genth, E., H. Zarnowski, R. Mierau, D. Wohltmann, and P. W. Hartl. 1987. HLA DR4 and Gm(1,3;5,21) are asso ciated with U1 nRNP antibody positive connective tissue disease. Ann. Rheum. Dis. 46: 189 196.

PAGE 71

71 13. Hoffman, R. W., L. J. Rettenmaier, Y. Takeda, J. E. Hewett, I. Pettersson, U. Nyman, A. M. Luger, and G. C. Sharp. 1990. Human autoantibodies against the 70 kd polypeptide of U1 small nuclear RNP are associated with HLA DR4 among connective tissue disease patients. Arthritis Rheum. 33: 666 673. 14. Hoffman, R. W., Y. Takeda, G. C. Sharp, D. R. Lee, D. L. Hill, H. Kaneoka, and C. W. Caldwell. 1993. Human T cell clones reactive against U small nuclear ribonucleoprotein autoantigens from connective tissue disease patients and healthy individuals. J. Immunol. 151: 6460 6469. 15. Dorner, T., C. Giesecke, and P. E. Lipsky. 2011. Mechanisms of B cell autoimmunity in S LE. Arthritis Res. Ther. 13: 243. 16. Liossis, S. N. and M. Zouali. 2004. B lymphocyte selection and survival in systemic lupus. Int. Arch. Allergy Immunol. 133: 72 83. 17. Moulton, V. R. and G. C. Tsokos. 2011. Abnormalities of T cell signaling in systemi c lupus erythematosus. Arthritis Res. Ther. 13: 207. 18. Ronnblom, L. and V. Pascual. 2008. The innate immune system in SLE: type I interferons and dendritic cells. Lupus 17: 394 399. 19. Love, P. E. and S. M. Hayes. 2010. ITAM mediated signaling by the T cell antigen receptor. Cold Spring Harb Perspect. Biol. 2: a002485. 20. June, C. H., J. A. Bluestone, L. M. Nadler, and C. B. Thompson. 1994. The B7 and CD28 receptor families. Immunol. Today 15: 321 331. 21. Riley, J. L. and C. H. June. 2005. The CD28 fam ily: a T cell rheostat for therapeutic control of T cell activation. Blood 105: 13 21. 22. Pentcheva Hoang, T., J. G. Egen, K. Wojnoonski, and J. P. Allison. 2004. B7 1 and B7 2 selectively recruit CTLA 4 and CD28 to the immunological synapse. Immunity 21: 401 413. 23. Parry, R. V., K. Reif, G. Smith, D. M. Sansom, B. A. Hemmings, and S. G. Ward. 1997. Ligation of the T cell co stimulatory receptor CD28 activates the serine threonine protein kinase protein kinase B. Eur. J. Immunol. 27: 2495 2501. 24. Ghaff ari Tabrizi, N., B. Bauer, A. Villunger, G. Baier Bitterlich, A. Altman, G. Utermann, F. Uberall, and G. Baier. 1999. Protein kinase Ctheta, a selective upstream regulator of JNK/SAPK and IL 2 promoter activation in Jurkat T cells. Eur. J. Immunol. 29: 132 142.

PAGE 72

72 25. Chuang, H. C., J. L. Lan, D. Y. Chen, C. Y. Yang, Y. M. Chen, J. P. Li, C. Y. Huang, P. E. Liu, X. Wang, and T. H. Tan. 2011. The kinase GLK controls autoimmunity and NF kappaB signaling by activating the kinase PKC theta in T cells. Nat. Immuno l. 12: 1113 1118. 26. Jury, E. C., P. S. Kabouridis, F. Flores Borja, R. A. Mageed, and D. A. Isenberg. 2004. Altered lipid raft associated signaling and ganglioside expression in T lymphocytes from patients with systemic lupus erythematosus. J. Clin. Inve st. 113: 1176 1187. 27. Simons, K. and E. Ikonen. 1997. Functional rafts in cell membranes. Nature 387: 569 572. 28. Krishnan, S., M. P. Nambiar, V. G. Warke, C. U. Fisher, J. Mitchell, N. Delaney, and G. C. Tsokos. 2004. Alterations in lipid raft composit ion and dynamics contribute to abnormal T cell responses in systemic lupus erythematosus. J. Immunol. 172: 7821 7831. 29. Monks, C. R., B. A. Freiberg, H. Kupfer, N. Sciaky, and A. Kupfer. 1998. Three dimensional segregation of supramolecular activation cl usters in T cells. Nature 395: 82 86. 30. Dustin, M. L. and A. C. Chan. 2000. Signaling takes shape in the immune system. Cell 103: 283 294. 31. Kabouridis, P. S. and E. C. Jury. 2008. Lipid rafts and T lymphocyte function: implications for autoimmunity. FEBS Lett. 582: 3711 3718. 32. Liossis, S. N., X. Z. Ding, G. J. Dennis, and G. C. Tsokos. 1998. Altered pattern of TCR/CD3 mediated protein tyrosyl phosphorylation in T cells from patients with systemic lupus erythematosus. Deficient expression of the T c ell receptor zeta chain. J. Clin. Invest. 101: 1448 1457. 33. Enyedy, E. J., M. P. Nambiar, S. N. Liossis, G. Dennis, G. M. Kammer, and G. C. Tsokos. 2001. Fc epsilon receptor type I gamma chain replaces the deficient T cell receptor zeta chain in T cells of patients with systemic lupus erythematosus. Arthritis Rheum. 44: 1114 1121. 34. Nambiar, M. P., C. U. Fisher, A. Kumar, C. G. Tsokos, V. G. Warke, and G. C. Tsokos. 2003. Forced expression of the Fc receptor gamma chain renders human T cells hyperrespon sive to TCR/CD3 stimulation. J. Immunol. 170: 2871 2876. 35. Nambiar, M. P., C. U. Fisher, V. G. Warke, S. Krishnan, J. P. Mitchell, N. Delaney, and G. C. Tsokos. 2003. Reconstitution of deficient T cell receptor zeta chain restores T cell signaling and au gments T cell receptor/CD3 induced interleukin 2 production in patients with systemic lupus erythematosus. Arthritis Rheum. 48: 1948 1955.

PAGE 73

73 36. Dustin, M. L. 2011. PKC theta: hitting the bull's eye. Nat. Immunol. 12: 1031 1032. 37. Yokosuka, T., W. Kobayash i, K. Sakata Sogawa, M. Takamatsu, A. Hashimoto Tane, M. L. Dustin, M. Tokunaga, and T. Saito. 2008. Spatiotemporal regulation of T cell costimulation by TCR CD28 microclusters and protein kinase C theta translocation. Immunity 29: 589 601. 38. Sharpe, A. H. and G. J. Freeman. 2002. The B7 CD28 superfamily. Nat. Rev. Immunol. 2: 116 126. 39. Oak, J. S. and D. A. Fruman. 2007. Role of phosphoinositide 3 kinase signaling in autoimmunity. Autoimmunity 40: 433 441. 40. Kshirsagar, S., E. Binder, M. Riedl, G. We chselberger, E. Steichen, and M. Edelbauer. 2013. Enhanced activity of Akt in Teff cells from children with lupus nephritis is associated with reduced induction of tumor necrosis factor receptor associated factor 6 and increased OX40 expression. Arthritis Rheum. 65: 2996 3006. 41. Barber, D. F., A. Bartolome, C. Hernandez, J. M. Flores, C. Redondo, C. Fernandez Arias, M. Camps, T. Ruckle, M. K. Schwarz, S. Rodriguez, C. Martinez A, D. Balomenos, C. Rommel, and A. C. Carrera. 2005. PI3Kgamma inhibition block s glomerulonephritis and extends lifespan in a mouse model of systemic lupus. Nat. Med. 11: 933 935. 42. Noelle, R. J., M. Roy, D. M. Shepherd, I. Stamenkovic, J. A. Ledbetter, and A. Aruffo. 1992. A 39 kDa protein on activated helper T cells binds CD40 an d transduces the signal for cognate activation of B cells. Proc. Natl. Acad. Sci. U. S. A. 89: 6550 6554. 43. Clark, E. A. and J. A. Ledbetter. 1994. How B and T cells talk to each other. Nature 367: 425 428. 44. Desai Mehta, A., L. Lu, R. Ramsey Goldman, and S. K. Datta. 1996. Hyperexpression of CD40 ligand by B and T cells in human lupus and its role in pathogenic autoantibody production. J. Clin. Invest. 97: 2063 2073. 45. Boumpas, D. T., R. Furie, S. Manzi, G. G. Illei, D. J. Wallace, J. E. Balow, A. Va ishnaw, and BG9588 Lupus Nephritis Trial Group. 2003. A short course of BG9588 (anti CD40 ligand antibody) improves serologic activity and decreases hematuria in patients with proliferative lupus glomerulonephritis. Arthritis Rheum. 48: 719 727. 46. Sidiro poulos, P. I. and D. T. Boumpas. 2004. Lessons learned from anti CD40L treatment in systemic lupus erythematosus patients. Lupus 13: 391 397.

PAGE 74

74 47. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, and R. L. Coffman. 2005. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. 1986. J. Immunol. 175: 5 14. 48. Abbas, A. K., K. M. Murphy, and A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383: 787 793. 49. Mangan, P. R., L. E. Harrington, D. B. O'Quinn, W. S. Helms, D. C. Bullard, C. O. Elson, R. D. Hatton, S. M. Wahl, T. R. Schoeb, and C. T. Weaver. 2006. Transforming growth factor beta induces development of the T(H)17 lineage. Nature 441: 231 234. 50. Bettelli, E., Y. Carrier, W. Gao, T. Korn, T. B. Strom, M. Oukka, H. L. Weiner, and V. K. Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441: 235 238. 51. Veldhoen, M., R. J. Hocking, C. J. Atkins, R. M. Locksley, and B. Stockinger. 2006. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL 17 producing T cells. Immunity 24: 179 189. 52. Nakajima, A., S. Hirose, H. Yagita, and K. Okum ura. 1997. Roles of IL 4 and IL 12 in the development of lupus in NZB/W F1 mice. J. Immunol. 158: 1466 1472. 53. Schorlemmer, H. U., G. Dickneite, E. J. Kanzy, and K. H. Enssle. 1995. Modulation of the immunoglobulin dysregulation in GvH and SLE like dise ases by the murine IL 4 receptor (IL 4 R). Inflamm. Res. 44 Suppl 2: S194 6. 54. Prud'homme, G. J., D. H. Kono, and A. N. Theofilopoulos. 1995. Quantitative polymerase chain reaction analysis reveals marked overexpression of interleukin 1 beta, interleukin 1 and interferon gamma mRNA in the lymph nodes of lupus prone mice. Mol. Immunol. 32: 495 503. 55. Fan, X. and R. P. Wuthrich. 1997. Upregulation of lymphoid and renal interferon gamma mRNA in autoimmune MRL Fas(lpr) mice with lupus nephritis. Inflammatio n 21: 105 112. 56. Shirai, A., J. Conover, and D. M. Klinman. 1995. Increased activation and altered ratio of interferon gamma: interleukin 4 secreting cells in MRL lpr/lpr mice. Autoimmunity 21: 107 116. 57. Murray, L. J., R. Lee, and C. Martens. 1990. In vivo cytokine gene expression in T cell subsets of the autoimmune MRL/Mp lpr/lpr mouse. Eur. J. Immunol. 20: 163 170. 58. Umland, S., R. Lee, M. Howard, and C. Martens. 1989. Expression of lymphokine genes in splenic lymphocytes of autoimmune mice. Mol. Immunol. 26: 649 656.

PAGE 75

75 59. Manolios, N., L. Schrieber, M. Nelson, and C. L. Geczy. 1989. Enhanced interferon gamma (IFN) production by lymph node cells from autoimmune (MRL/1, MRL/n) mice. Clin. Exp. Immunol. 76: 301 306. 60. Fan, X., B. Oertli, and R. P. Wuthrich. 1997. Up regulation of tubular epithelial interleukin 12 in autoimmune MRL Fas(lpr) mice with renal injury. Kidney Int. 51: 79 86. 61. Schwarting, A., G. Tesch, K. Kinoshita, R. Maron, H. L. Weiner, and V. R. Kelley. 1999. IL 12 drives IFN ga mma dependent autoimmune kidney disease in MRL Fas(lpr) mice. J. Immunol. 163: 6884 6891. 62. Jacob, C. O., P. H. van der Meide, and H. O. McDevitt. 1987. In vivo treatment of (NZB X NZW)F1 lupus like nephritis with monoclonal antibody to gamma interferon. J. Exp. Med. 166: 798 803. 63. Balomenos, D., R. Rumold, and A. N. Theofilopoulos. 1998. Interferon gamma is required for lupus like disease and lymphoaccumulation in MRL lpr mice. J. Clin. Invest. 101: 364 371. 64. Lawson, B. R., G. J. Prud'homme, Y. Cha ng, H. A. Gardner, J. Kuan, D. H. Kono, and A. N. Theofilopoulos. 2000. Treatment of murine lupus with cDNA encoding IFN gammaR/Fc. J. Clin. Invest. 106: 207 215. 65. Haas, C., B. Ryffel, and M. Le Hir. 1998. IFN gamma receptor deletion prevents autoantibo dy production and glomerulonephritis in lupus prone (NZB x NZW)F1 mice. J. Immunol. 160: 3713 3718. 66. Ozmen, L., D. Roman, M. Fountoulakis, G. Schmid, B. Ryffel, and G. Garotta. 1995. Experimental therapy of systemic lupus erythematosus: the treatment of NZB/W mice with mouse soluble interferon gamma receptor inhibits the onset of glomerulonephritis. Eur. J. Immunol. 25: 6 12. 67. Akahoshi, M., H. Nakashima, Y. Tanaka, T. Kohsaka, S. Nagano, E. Ohgami, Y. Arinobu, K. Yamaoka, H. Niiro, M. Shinozaki, H. Hi rakata, T. Horiuchi, T. Otsuka, and Y. Niho. 1999. Th1/Th2 balance of peripheral T helper cells in systemic lupus erythematosus. Arthritis Rheum. 42: 1644 1648. 68. Nakashima, H., H. Inoue, M. Akahoshi, Y. Tanaka, K. Yamaoka, E. Ogami, S. Nagano, Y. Arinob u, H. Niiro, T. Otsuka, and Y. Niho. 1999. The combination of polymorphisms within interferon gamma receptor 1 and receptor 2 associated with the risk of systemic lupus erythematosus. FEBS Lett. 453: 187 190. 69. Wandl, U. B., M. Nagel Hiemke, D. May, E. K reuzfelder, O. Kloke, M. Kranzhoff, S. Seeber, and N. Niederle. 1992. Lupus like autoimmune disease induced by interferon therapy for myeloproliferative disorders. Clin. Immunol. Immunopathol. 65: 70 74.

PAGE 76

76 70. Langrish, C. L., Y. Chen, W. M. Blumenschein, J. Mattson, B. Basham, J. D. Sedgwick, T. McClanahan, R. A. Kastelein, and D. J. Cua. 2005. IL 23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: 233 240. 71. Yen, D., J. Cheung, H. Scheerens, F. Poulet, T. McCla nahan, B. McKenzie, M. A. Kleinschek, A. Owyang, J. Mattson, W. Blumenschein, E. Murphy, M. Sathe, D. J. Cua, R. A. Kastelein, and D. Rennick. 2006. IL 23 is essential for T cell mediated colitis and promotes inflammation via IL 17 and IL 6. J. Clin. Inves t. 116: 1310 1316. 72. Cua, D. J., J. Sherlock, Y. Chen, C. A. Murphy, B. Joyce, B. Seymour, L. Lucian, W. To, S. Kwan, T. Churakova, S. Zurawski, M. Wiekowski, S. A. Lira, D. Gorman, R. A. Kastelein, and J. D. Sedgwick. 2003. Interleukin 23 rather than in terleukin 12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421: 744 748. 73. Wong, C. K., L. C. Lit, L. S. Tam, E. K. Li, P. T. Wong, and C. W. Lam. 2008. Hyperproduction of IL 23 and IL 17 in patients with systemic lupus erythe matosus: implications for Th17 mediated inflammation in auto immunity. Clin. Immunol. 127: 385 393. 74. Crispin, J. C., M. Oukka, G. Bayliss, R. A. Cohen, C. A. Van Beek, I. E. Stillman, V. C. Kyttaris, Y. T. Juang, and G. C. Tsokos. 2008. Expanded double negative T cells in patients with systemic lupus erythematosus produce IL 17 and infiltrate the kidneys. J. Immunol. 181: 8761 8766. 75. Kang, H. K., M. Liu, and S. K. Datta. 2007. Low dose peptide tolerance therapy of lupus generates plasmacytoid dendriti c cells that cause expansion of autoantigen specific regulatory T cells and contraction of inflammatory Th17 cells. J. Immunol. 178: 7849 7858. 76. Hsu, H. C., P. Yang, J. Wang, Q. Wu, R. Myers, J. Chen, J. Yi, T. Guentert, A. Tousson, A. L. Stanus, T. V. Le, R. G. Lorenz, H. Xu, J. K. Kolls, R. H. Carter, D. D. Chaplin, R. W. Williams, and J. D. Mountz. 2008. Interleukin 17 producing T helper cells and interleukin 17 orchestrate autoreactive germinal center development in autoimmune BXD2 mice. Nat. Immunol . 9: 166 175. 77. Sawalha, A. H., K. M. Kaufman, J. A. Kelly, A. J. Adler, T. Aberle, J. Kilpatrick, E. K. Wakeland, Q. Z. Li, A. E. Wandstrat, D. R. Karp, J. A. James, J. T. Merrill, P. Lipsky, and J. B. Harley. 2008. Genetic association of interleukin 21 polymorphisms with systemic lupus erythematosus. Ann. Rheum. Dis. 67: 458 461. 78. Ozaki, K., R. Spolski, R. Ettinger, H. P. Kim, G. Wang, C. F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, H. C. Morse 3rd, P. E. Lipsky, and W. J. Leonard. 2004 . Regulation of B cell differentiation and plasma cell generation by IL 21, a novel inducer of Blimp 1 and Bcl 6. J. Immunol. 173: 5361 5371.

PAGE 77

77 79. Tiegs, S. L., D. M. Russell, and D. Nemazee. 2011. Receptor editing in self reactive bone marrow B cells. The Journal of Experimental Medicine. 1993. 177: 1009 1020. J. Immunol. 186: 1313 1324. 80. Gay, D., T. Saunders, S. Camper, and M. Weigert. 2011. Receptor editing: an approach by autoreactive B cells to escape tolerance. The Journal of Experimental Medicine. 1993. 177: 999 1008. J. Immunol. 186: 1303 1312. 81. Liossis, S. N., B. Kovacs, G. Dennis, G. M. Kammer, and G. C. Tsokos. 1996. B cells from patients with systemic lupus erythematosus display abnormal antigen receptor mediated early signal transduction ev ents. J. Clin. Invest. 98: 2549 2557. 82. Liossis, S. N., P. P. Sfikakis, and G. C. Tsokos. 1998. Immune cell signaling aberrations in human lupus. Immunol. Res. 18: 27 39. 83. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT famil y: regulation and function. Annu. Rev. Immunol. 15: 707 747. 84. Nusslein, H. G., K. H. Frosch, W. Woith, P. Lane, J. R. Kalden, and B. Manger. 1996. Increase of intracellular calcium is the essential signal for the expression of CD40 ligand. Eur. J. Immun ol. 26: 846 850. 85. Grammer, A. C., M. C. Bergman, Y. Miura, K. Fujita, L. S. Davis, and P. E. Lipsky. 1995. The CD40 ligand expressed by human B cells costimulates B cell responses. J. Immunol. 154: 4996 5010. 86. Higuchi, T., Y. Aiba, T. Nomura, J. Matsuda, K. Mochida, M. Suzuki, H. Kikutani, T. Honjo, K. Nishioka, and T. Tsubata. 2002. Cutting Edge: Ectopic expression of CD40 ligand on B cells induces lupus like autoimmune disease. J. Immunol. 168: 9 12. 87. F olzenlogen, D., M. F. Hofer, D. Y. Leung, J. H. Freed, and M. K. Newell. 1997. Analysis of CD80 and CD86 expression on peripheral blood B lymphocytes reveals increased expression of CD86 in lupus patients. Clin. Immunol. Immunopathol. 83: 199 204. 88. Bijl , M., G. Horst, P. C. Limburg, and C. G. Kallenberg. 2001. Expression of costimulatory molecules on peripheral blood lymphocytes of patients with systemic lupus erythematosus. Ann. Rheum. Dis. 60: 523 526. 89. Ettinger, R., S. Kuchen, and P. E. Lipsky. 200 8. Interleukin 21 as a target of intervention in autoimmune disease. Ann. Rheum. Dis. 67 Suppl 3: iii83 6. 90. Bubier, J. A., T. J. Sproule, O. Foreman, R. Spolski, D. J. Shaffer, H. C. Morse 3rd, W. J. Leonard, and D. C. Roopenian. 2009. A critical role f or IL 21 receptor signaling in the pathogenesis of systemic lupus erythematosus in BXSB Yaa mice. Proc. Natl. Acad. Sci. U. S. A. 106: 1518 1523.

PAGE 78

78 91. Reininger, L., T. Radaszkiewicz, M. Kosco, F. Melchers, and A. G. Rolink. 1992. Development of autoimmune disease in SCID mice populated with long term "in vitro" proliferating (NZB x NZW)F1 pre B cells. J. Exp. Med. 176: 1343 1353. 92. Reininger, L., T. H. Winkler, C. P. Kalberer, M. Jourdan, F. Melchers, and A. G. Rolink. 1996. Intrinsic B cell defects in NZ B and NZW mice contribute to systemic lupus erythematosus in (NZB x NZW)F1 mice. J. Exp. Med. 184: 853 861. 93. Ronnblom, L. E., G. V. Alm, and K. E. Oberg. 1991. Autoimmunity after alpha interferon therapy for malignant carcinoid tumors. Ann. Intern. Med. 115: 178 183. 94. Steinman, R. M. and M. C. Nussenzweig. 2002. Avoiding horror autotoxicus: the importance of dendritic cells in peripheral T cell tolerance. Proc. Natl. Acad. Sci. U. S. A. 99: 351 358. 95. Decker, P., I. Kotter, R. Klein , B. Berner, and H. G. Rammensee. 2006. Monocyte derived dendritic cells over express CD86 in patients with systemic lupus erythematosus. Rheumatology (Oxford) 45: 1087 1095. 96. Fitzgerald Bocarsly, P. and D. Feng. 2007. The role of type I interferon prod uction by dendritic cells in host defense. Biochimie 89: 843 855. 97. Theofilopoulos, A. N., R. Baccala, B. Beutler, and D. H. Kono. 2005. Type I interferons (alpha/beta) in immunity and autoimmunity. Annu. Rev. Immunol. 23: 307 336. 98. Obermoser, G. and V. Pascual. 2010. The interferon alpha signature of systemic lupus erythematosus. Lupus 19: 1012 1019. 99. Lovgren, T., M. L. Eloranta, U. Bave, G. V. Alm, and L. Ronnblom. 2004. Induction of interferon alpha production in plasmacytoid dendritic cells by i mmune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG. Arthritis Rheum. 50: 1861 1872. 100. Sigurdsson, S., G. Nordmark, H. H. Goring, K. Lindroos, A. C. Wiman, G. Sturfelt, A. Jonsen, S. Rantapaa Dahlqvist, B. Moller, J. Kere, S. Koskenmies, E. Widen, M. L. Eloranta, H. Julkunen, H. Kristjansdottir, K. Steinsson, G. Alm, L. Ronnblom, and A. C. Syvanen. 2005. Polymorphisms in the tyrosine kinase 2 and interferon regulatory factor 5 genes are associated with syste mic lupus erythematosus. Am. J. Hum. Genet. 76: 528 537. 101. Schindler, C., D. E. Levy, and T. Decker. 2007. JAK STAT signaling: from interferons to cytokines. J. Biol. Chem. 282: 20059 20063.

PAGE 79

79 102. Remmers, E. F., R. M. Plenge, A. T. Lee, R. R. Graham, G . Hom, T. W. Behrens, P. I. de Bakker, J. M. Le, H. S. Lee, F. Batliwalla, W. Li, S. L. Masters, M. G. Booty, J. P. Carulli, L. Padyukov, L. Alfredsson, L. Klareskog, W. V. Chen, C. I. Amos, L. A. Criswell, M. F. Seldin, D. L. Kastner, and P. K. Gregersen. 2007. STAT4 and the risk of rheumatoid arthritis and systemic lupus erythematosus. N. Engl. J. Med. 357: 977 986. 103. Teague, P. O. and G. J. Friou. 1969. Antinuclear antibodies in mice. II. Transmission with spleen cells; inhibition or prevention with t hymus or spleen cells. Immunology 17: 665 675. 104. Asano, M., M. Toda, N. Sakaguchi, and S. Sakaguchi. 1996. Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J. Exp. Med. 184: 387 396. 105. Sakaguchi, S., N. Saka guchi, M. Asano, M. Itoh, and M. Toda. 1995. Immunologic self tolerance maintained by activated T cells expressing IL 2 receptor alpha chains (CD25). Breakdown of a single mechanism of self tolerance causes various autoimmune diseases. J. Immunol. 155: 115 1 1164. 106. Hori, S. and S. Sakaguchi. 2004. Foxp3: a critical regulator of the development and function of regulatory T cells. Microbes Infect. 6: 745 751. 107. Jonuleit, H. and E. Schmitt. 2003. The regulatory T cell family: distinct subsets and their i nterrelations. J. Immunol. 171: 6323 6327. 108. Zhou, L., J. E. Lopes, M. M. Chong, I. I. Ivanov, R. Min, G. D. Victora, Y. Shen, J. Du, Y. P. Rubtsov, A. Y. Rudensky, S. F. Ziegler, and D. R. Littman. 2008. TGF beta induced Foxp3 inhibits T(H)17 cell diff erentiation by antagonizing RORgammat function. Nature 453: 236 240. 109. Kim, J. M., J. P. Rasmussen, and A. Y. Rudensky. 2007. Regulatory T cells prevent catastrophic autoimmunity throughout the lifespan of mice. Nat. Immunol. 8: 191 197. 110. Bennett, C . L., J. Christie, F. Ramsdell, M. E. Brunkow, P. J. Ferguson, L. Whitesell, T. E. Kelly, F. T. Saulsbury, P. F. Chance, and H. D. Ochs. 2001. The immune dysregulation, polyendocrinopathy, enteropathy, X linked syndrome (IPEX) is caused by mutations of FOX P3. Nat. Genet. 27: 20 21. 111. Chen, W., W. Jin, N. Hardegen, K. J. Lei, L. Li, N. Marinos, G. McGrady, and S. M. Wahl. 2003. Conversion of peripheral CD4+CD25 naive T cells to CD4+CD25+ regulatory T cells by TGF beta induction of transcription factor Fo xp3. J. Exp. Med. 198: 1875 1886. 112. Horwitz, D. A. 2008. Regulatory T cells in systemic lupus erythematosus: past, present and future. Arthritis Res. Ther. 10: 227.

PAGE 80

80 113. Hsu, W. T., J. L. Suen, and B. L. Chiang. 2006. The role of CD4CD25 T cells in autoantibody production in murine lupus. Clin. Exp. Immunol. 145: 513 519. 114. Scalapino, K. J., Q. Tang, J. A. Bluestone, M. L. Bonyhadi, and D. I. Daikh. 2006. Suppressi on of disease in New Zealand Black/New Zealand White lupus prone mice by adoptive transfer of ex vivo expanded regulatory T cells. J. Immunol. 177: 1451 1459. 115. Monk, C. R., M. Spachidou, F. Rovis, E. Leung, M. Botto, R. I. Lechler, and O. A. Garden. 20 05. MRL/Mp CD4+,CD25 T cells show reduced sensitivity to suppression by CD4+,CD25+ regulatory T cells in vitro: a novel defect of T cell regulation in systemic lupus erythematosus. Arthritis Rheum. 52: 1180 1184. 116. Venigalla, R. K., T. Tretter, S. Krie nke, R. Max, V. Eckstein, N. Blank, C. Fiehn, A. D. Ho, and H. M. Lorenz. 2008. Reduced CD4+,CD25 T cell sensitivity to the suppressive function of CD4+,CD25high,CD127 /low regulatory T cells in patients with active systemic lupus erythematosus. Arthriti s Rheum. 58: 2120 2130. 117. Starr, R., T. A. Willson, E. M. Viney, L. J. Murray, J. R. Rayner, B. J. Jenkins, T. J. Gonda, W. S. Alexander, D. Metcalf, N. A. Nicola, and D. J. Hilton. 1997. A family of cytokine inducible inhibitors of signalling. Nature 3 87: 917 921. 118. Nicholson, S. E., T. A. Willson, A. Farley, R. Starr, J. G. Zhang, M. Baca, W. S. Alexander, D. Metcalf, D. J. Hilton, and N. A. Nicola. 1999. Mutational analyses of the SOCS proteins suggest a dual domain requirement but distinct mechani sms for inhibition of LIF and IL 6 signal transduction. EMBO J. 18: 375 385. 119. Endo, T. A., M. Masuhara, M. Yokouchi, R. Suzuki, H. Sakamoto, K. Mitsui, A. Matsumoto, S. Tanimura, M. Ohtsubo, H. Misawa, T. Miyazaki, N. Leonor, T. Taniguchi, T. Fujita, Y . Kanakura, S. Komiya, and A. Yoshimura. 1997. A new protein containing an SH2 domain that inhibits JAK kinases. Nature 387: 921 924. 120. Naka, T., M. Narazaki, M. Hirata, T. Matsumoto, S. Minamoto, A. Aono, N. Nishimoto, T. Kajita, T. Taga, K. Yoshizaki, S. Akira, and T. Kishimoto. 1997. Structure and function of a new STAT induced STAT inhibitor. Nature 387: 924 929. 121. Ohya, K., S. Kajigaya, Y. Yamashita, A. Miyazato, K. Hatake, Y. Miura, U. Ikeda, K. Shimada, K. Ozawa, and H. Mano. 1997. SOCS 1/JAB/S SI 1 can bind to and suppress Tec protein tyrosine kinase. J. Biol. Chem. 272: 27178 27182. 122. Metcalf, D., W. S. Alexander, A. G. Elefanty, N. A. Nicola, D. J. Hilton, R. Starr, S. Mifsud, and L. Di Rago. 1999. Aberrant hematopoiesis in mice with inacti vation of the gene encoding SOCS 1. Leukemia 13: 926 934.

PAGE 81

81 123. Starr, R., D. Metcalf, A. G. Elefanty, M. Brysha, T. A. Willson, N. A. Nicola, D. J. Hilton, and W. S. Alexander. 1998. Liver degeneration and lymphoid deficiencies in mice lacking suppressor of cytokine signaling 1. Proc. Natl. Acad. Sci. U. S. A. 95: 14395 14399. 124. Fujimoto, M., H. Tsutsui, O. Xinshou, M. Tokumoto, D. Watanabe, Y. Shima, T. Yoshimoto, H. Hirakata, I. Kawase, K. Nakanishi, T. Kishimoto, and T. Naka. 2004. Inadequate induct ion of suppressor of cytokine signaling 1 causes systemic autoimmune diseases. Int. Immunol. 16: 303 314. 125. Sharabi, A., Z. M. Sthoeger, K. Mahlab, S. Lapter, H. Zinger, and E. Mozes. 2009. A tolerogenic peptide that induces suppressor of cytokine signa ling (SOCS) 1 restores the aberrant control of IFN gamma signaling in lupus affected (NZB x NZW)F1 mice. Clin. Immunol. 133: 61 68. 126. Chan, H. C., L. Y. Ke, L. L. Chang, C. C. Liu, Y. H. Hung, C. H. Lin, R. N. Li, W. C. Tsai, H. W. Liu, and J. H. Yen. 2 010. Suppressor of cytokine signaling 1 gene expression and polymorphisms in systemic lupus erythematosus. Lupus 19: 696 702. 127. Tsao, J. T., C. C. Kuo, and S. C. Lin. 2008. The analysis of CIS, SOCS1, SOSC2 and SOCS3 transcript levels in peripheral bloo d mononuclear cells of systemic lupus erythematosus and rheumatoid arthritis patients. Clin. Exp. Med. 8: 179 185. 128. Tan, E. M., A. S. Cohen, J. F. Fries, A. T. Masi, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, and R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 25: 1271 1277. 129. Li, Y., P. Y. Lee, E. S. Kellner, M. Paulus, J. Switanek, Y. Xu, H. Zhuang, E. S. Sobel, M. S. Segal, M. Satoh, and W. H. Reeves. 2010. M onocyte surface expression of Fcgamma receptor RI (CD64), a biomarker reflecting type I interferon levels in systemic lupus erythematosus. Arthritis Res. Ther. 12: R90. 130. Bedoya, S. K., T. D. Wilson, E. L. Collins, K. Lau, and J. Larkin III. 2013. Isola tion and Th17 Differentiation of Naïve CD4 T Lymphocytes. J. Vis. Exp. (79) e50765, doi:10.3791/50765: 131. Morel, L., B. P. Croker, K. R. Blenman, C. Mohan, G. Huang, G. Gilkeson, and E. K. Wakeland. 2000. Genetic reconstitution of systemic lupus erythe matosus immunopathology with polycongenic murine strains. Proc. Natl. Acad. Sci. U. S. A. 97: 6670 6675. 132. Stekman, I. L., A. M. Blasini, M. Leon Ponte, M. L. Baroja, I. Abadi, and M. A. Rodriguez. 1991. Enhanced CD3 mediated T lymphocyte proliferation in patients with systemic lupus erythematosus. Arthritis Rheum. 34: 459 467.

PAGE 82

82 133. Mohan, C., Y. Yu, L. Morel, P. Yang, and E. K. Wakeland. 1999. Genetic dissection of Sle pathogenesis: Sle3 on murine chromosome 7 impacts T cell activation, differentiation, and cell death. J. Immunol. 162: 6492 6502. 134. Vratsanos, G. S., S. Jung, Y. M. Park, and J. Craft. 2001. CD4(+) T cells from lupus prone mice are hyperresponsive to T cell receptor engagement with low and high affinity peptide antigens: a model to expl ain spontaneous T cell activation in lupus. J. Exp. Med. 193: 329 337. 135. Bouzahzah, F., S. Jung, and J. Craft. 2003. CD4+ T cells from lupus prone mice avoid antigen specific tolerance induction in vivo. J. Immunol. 170: 741 748. 136. Testi, R., D. D'Am brosio, R. De Maria, and A. Santoni. 1994. The CD69 receptor: a multipurpose cell surface trigger for hematopoietic cells. Immunol. Today 15: 479 483. 137. Larkin, J.,3rd, C. C. Picca, and A. J. Caton. 2007. Activation of CD4+ CD25+ regulatory T cell suppr essor function by analogs of the selecting peptide. Eur. J. Immunol. 37: 139 146. 138. Tivol, E. A., A. N. Schweitzer, and A. H. Sharpe. 1996. Costimulation and autoimmunity. Curr. Opin. Immunol. 8: 822 830. 139. Mondino, A. and M. K. Jenkins. 1994. Surface proteins involved in T cell costimulation. J. Leukoc. Biol. 55: 805 815. 140. Hirahara, K., A. Poholek, G. Vahedi, A. Laurence, Y. Kanno, J. D. Milner, and J. J. O'Shea. 2013. Mechanisms underlying helper T cell plasticity: implications for immune mediated disease. J. Allergy Clin. Immunol. 131: 1276 1287. 141. Knosp, C. A. and J. A. Johnston. 2012. Regulation of CD4+ T cell polarization by suppressor of cytokine signalling proteins. Immunology 135: 101 111. 142. Szabo, S. J., B. M. Sullivan, C. Stemmann, A. R. Satoskar, B. P. Sleckman, and L. H. Glimcher. 2002. Distinct effects of T bet in TH1 lineage commitment and IFN gamma production in CD4 and CD8 T cells. Science 295: 338 342. 143. Gurevitz, S. L., J. A . Snyder, E. K. Wessel, J. Frey, and B. A. Williamson. 2013. Systemic lupus erythematosus: a review of the disease and treatment options. Consult. Pharm. 28: 110 121. 144. Santiago Raber, M. L., R. Baccala, K. M. Haraldsson, D. Choubey, T. A. Stewart, D. H . Kono, and A. N. Theofilopoulos. 2003. Type I interferon receptor deficiency reduces lupus like disease in NZB mice. J. Exp. Med. 197: 777 788.

PAGE 83

83 145. Takahashi, S., L. Fossati, M. Iwamoto, R. Merino, R. Motta, T. Kobayakawa, and S. Izui. 1996. Imbalance to wards Th1 predominance is associated with acceleration of lupus like autoimmune syndrome in MRL mice. J. Clin. Invest. 97: 1597 1604. 146. Piganis, R. A., N. A. De Weerd, J. A. Gould, C. W. Schindler, A. Mansell, S. E. Nicholson, and P. J. Hertzog. 2011. S uppressor of cytokine signaling (SOCS) 1 inhibits type I interferon (IFN) signaling via the interferon alpha receptor (IFNAR1) associated tyrosine kinase Tyk2. J. Biol. Chem. 286: 33811 33818. 147. Alexander, W. S., R. Starr, J. E. Fenner, C. L. Scott, E. Handman, N. S. Sprigg, J. E. Corbin, A. L. Cornish, R. Darwiche, C. M. Owczarek, T. W. Kay, N. A. Nicola, P. J. Hertzog, D. Metcalf, and D. J. Hilton. 1999. SOCS1 is a critical inhibitor of interferon gamma signaling and prevents the potentially fatal neon atal actions of this cytokine. Cell 98: 597 608. 148. Pickering, M. C. and M. J. Walport. 2000. Links between complement abnormalities and systemic lupus erythematosus. Rheumatology (Oxford) 39: 133 141. 149. Yu, C. R., R. M. Mahdi, X. Liu, A. Zhang, T. Na ka, T. Kishimoto, and C. E. Egwuagu. 2008. SOCS1 regulates CCR7 expression and migration of CD4+ T cells into peripheral tissues. J. Immunol. 181: 1190 1198. 150. Tanaka, K., K. Ichiyama, M. Hashimoto, H. Yoshida, T. Takimoto, G. Takaesu, T. Torisu, T. Han ada, H. Yasukawa, S. Fukuyama, H. Inoue, Y. Nakanishi, T. Kobayashi, and A. Yoshimura. 2008. Loss of suppressor of cytokine signaling 1 in helper T cells leads to defective Th17 differentiation by enhancing antagonistic effects of IFN gamma on STAT3 and Sm ads. J. Immunol. 180: 3746 3756.

PAGE 84

84 BIOGRAPHICAL SKETCH Tenisha Wilson is from Miami, Florida. She attended The College Academy at Broward College for high school. This high school required her to take college courses in addition to her normal hig h school classes. When she graduated from high school in undergraduate degree in Microbiology and Cell in 2008. During her undergraduate training, she became passionate about research. In 2009, she entered graduate school, with a desire to study clinical immunology. In 2011, she became a UF CTSI TL 1 scholar and was accepted into the MD PhD program. Her research interest involves the study of systemic lupus erythematosus (SLE). As an MD PhD student and a UF CTSI TL1 scholar, her mission is to improve human health by accelerating the translation of scientific discoveries into practical applications for the treatment/prevention of diseases, particularly SLE. As such, during her gr aduate career, she investigated the role of an intracellular protein, suppressor of cytokine signaling (SOCS) 1, in the prevention of murine lupus. To translate these animal findings to the clinic, she is also explored the clinical relevance of the express ion of the gene to human lupus. The results of this study have led to the proposal that SOCS1 may be a novel biological target and strategies to amplify its expression may have therapeutic value for SLE patients.



PAGE 1

of July 9, 2014. This information is current as Cell Homeostasis Regulatory T + Enhanced Peripheral Foxp3 Autoinflammatory Disease Correlated to Lethal / Inhibition of SOCS1 Haider, Howard M. Johnson and Joseph Larkin III Benitez, Kaitlin Holdstein, Kenneth Lau, Mohammed I. Erin L. Collins, Lindsey D. Jager, Rea Dabelic, Patrick http://www.jimmunol.org/content/187/5/2666 doi: 10.4049/jimmunol.1003819 July 2011; 2011; 187:2666-2676; Prepublished online 25 J Immunol Material Supplementary 819.DC1.html http://www.jimmunol.org/jimmunol/suppl/2011/07/25/jimmunol.1003 References http://www.jimmunol.org/content/187/5/2666.full#ref-list-1 , 13 of which you can access for free at: cites 55 articles This article Subscriptions http://jimmunol.org/subscriptions is online at: The Journal of Immunology Information about subscribing to Permissions http://www.aai.org/ji/copyright.html Submit copyright permission requests at: Email Alerts http://jimmunol.org/cgi/alerts/etoc Receive free email-alerts when new articles cite this article. Sign up at: Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved. Copyright 2011 by The American Association of 9650 Rockville Pike, Bethesda, MD 20814-3994. The American Association of Immunologists, Inc., is published twice each month by The Journal of Immunology at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 2

TheJournalofImmunologyInhibitionofSOCS12 / 2LethalAutoinammatoryDisease CorrelatedtoEnhancedPeripheralFoxp3+RegulatoryTCell HomeostasisErinL.Collins,LindseyD.Jager,ReaDabelic,PatrickBenitez,KaitlinHoldstein, KennethLau,MohammedI.Haider,HowardM.Johnson,andJosephLarkin,IIISuppressorofcytokinesignaling1-decient(SOCS12 / 2)mice,whicharelymphopenic,die , 3wkafterbirthofaTcell-mediated autoimmuneinammatorydiseasecharacterizedbyleukocyteinltrationanddestructionofvitalorgans.Notably,Foxp3+regulatoryTcells(Tregs)havebeenshowntobeparticularlypotentininhibitinginammation-associatedautoimmunediseases. WeobservedthatSOCS12 / 2miceweredecientinperipheralTregsdespiteenhancedthymicdevelopment.Theadoptivetransfer ofSOCS1-sufcientTregs,CD4+Tlymphocytes,oradministrationofSOCS1kinaseinhibitoryregion(KIR),apeptidethat partiallyrestoresSOCS1function,mediatedastatisticallysignicantbutshort-termsurvivalofSOCS12 / 2mice.However,the adoptivetransferofSOCS1-sufcientCD4+Tlymphocytes,combinedwiththeadministrationofSOCS1-KIR,resultedinasignicantincreaseinthesurvivalofSOCS12 / 2micebothshortandlongterm,where100%deathoccurredbyday18intheabsence oftreatment.Moreover,theCD4+/SOCS1-KIRcombinedtherapyresultedindecreasedleukocyticorganinltration,reductionof serumIFNg ,andenhancedperipheralaccumulationofFoxp3+Tregsintreatedmice.ThesedatashowthatCD4+/SOCS1-KIR combinedtreatmentcansynergisticallypromotethelong-termsurvivalofperinatallethalSOCS12 / 2mice.Inaddition,these resultsstronglysuggestthatSOCS1contributestothestabilityoftheFoxp3+Tregperipheralpopulationunderconditionsof strongproinammatoryenvironments. TheJournalofImmunology ,2011,187:2666.Inammationisessentialforeliminationofpathogensand clearanceofcancerouscells(1).However,excessiveinammatoryresponsesareassociatedwithnumerousdiseases, includingmetabolicdisease-associatedtype2diabetes(4);hepatitisCvirus-associatedliverdamage(5);andautoimmunediseases suchasmultiplesclerosis,type1diabetes,rheumatoidarthritis, andinammatoryboweldisease(1,5).Inammationisregulated throughtwoimportantarmsoftheimmunesystem:thesuppressor ofcytokinesignaling(SOCS)familyofintracellularproteins(6, 7)andFoxp3+regulatoryTcells(Tregs)(8).Althoughitisknown thatthesetworegulatorypathwaysplayanessentialroleinthe preventionofexcessiveinammation,whichleadstosignicant tissuedestructionandeventualdeath,specicallyhowthesetwo regulatorypathwaysinterconnecttoregulateinammation-associatedpathologyispoorlyunderstood. TheimportanceofSOCS1intheregulationofautoinammatory pathologyispunctuatedbythefactthat100%ofSOCS1-decient micedieofaperinatalinammatoryautoimmunediseasecharacterizedbymassivemonocyticleukocyteinltrationoftheliver, skin,heart,pancreas,andlungs(9)within21dafterbirth. SOCS1protein,alsoreferredtoasSTAT-inducibleSTATinhibitor 1(12)orJAK-bindingprotein(13),israpidlyinducedsubsequent tostimulationbynumerouscytokinesandactstolimitcellular responsivenesstothecytokinethatmediateditssynthesis,thus preventingtissuedamage(14).SOCS1isinducedbymanycytokinesincludingIFNg ,type1IFNs,IL-6,IL-2,andIL-7(15)in numerouscelltypesofhematopoieticandnonhematopoietic origin(16).Therefore,inadditiontotissueinltrationby leukocytesinSOCS12 / 2mice,tissuessuchastheliverarealso unabletomoderateproinammatorycytokinesignaling(19). Beyonditsroleinlimitinglymphocyteresponsivenesstocytokines,SOCS1isalsoinvolvedinmaintainingthedifferentiation stateofTlymphocytes(20),althoughitsroleinmaintainingthe stabilityoftheTregpopulationislessclear.SOCS1actsthrough atleasttwomechanisms:1)SOCS1possessesakinaseinhibitory region(KIR)thatbindstoJAK2,thusinhibitingfurthercytokine signaling;and2)SOCS1containsaregionknownastheSOCS box,whichtargetsboundproteinstotheproteasomefordegradation(7).TheKIRregionpossessespotentimmunoregulatory propertiesbecausetransgenicmicethatlacktheSOCSboxportionofSOCS1survivetheperilethalityofSOCS12 / 2mice,althoughtheyeventuallysuccumbtolethalautoimmunity(21). IthasbeenrecentlyshownthatsmallpeptidemimeticsofSOCS1 possessingtheKIRofSOCS1,butnottheSOCSbox,caneffectivelyinhibitIL-6andIFNg signalinginvitro(224).TheSOCS1 mimeticsinhibitproinammatorycytokinesviainhibitionofthe JAK/STATsignaling.Specically,themimeticsbindtotheactivationloopofJAKssuchasJAK2andinhibitkinaseautophosphorylationandkinasephosphorylationofSTATtranscriptionfactors (25,26).TheSOCSmimeticpeptideshavebeenusedbothasprophylacticstopreventexperimentalautoimmuneencephalomyelitis (EAE)andastherapeuticsforongoingactiveEAEinmousemodels ofmultiplesclerosis(24,27,28).Thus,althoughSOCS1mimetic DepartmentofMicrobiologyandCellScience,UniversityofFlorida,Gainesville,FL 32611 ReceivedforpublicationNovember18,2010.AcceptedforpublicationJune16, 2011. ThisworkwassupportedbyNationalInstitutesofHealthGrantsR01NS051245and R01AI056152(toH.M.J.)andadiversitysupplementawardedtoParentGrant R01AI056152;aBDBiosciencesresearchgrant;andtheUniversityofFlorida. AddresscorrespondenceandreprintrequeststoDr.JosephLarkin,III,Departmentof MicrobiologyandCellScience,UniversityofFlorida,P.O.Box110700Museum Road,Building981,Gainesville,FL32611.E-mailaddress:jlarkin3@u.edu Theonlineversionofthisarticlecontainssupplementalmaterial. Abbreviationsusedinthisarticle:EAE,experimentalautoimmuneencephalomyelitis;KIR,kinaseinhibitoryregion;qPCR,quantitativePCR;SOCS1,suppressorof cytokinesignaling1;Treg,regulatoryTcell;WT,wild-type. Copyright 2011byTheAmericanAssociationofImmunologists,Inc.0022-1767/11/$16.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1003819 at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 3

peptideshavebeenshowntohaveaclearroleinthepreventionand treatmentofinammatoryautoimmunityinEAEmodelsofdisease, theirabilitytorestoreSOCS1functionduringSOCS1deciency hasnotbeenstudied.Moreover,theroleofSOCS1inmaintaining thestabilityoftheTregperipheralpopulationandphenotypeunder inammatoryconditionsisunknown. Foxp3+Tregs,whichconstitutebetween5and10%oftheperipheralCD4+Tcellsinhealthyhumansandrodents(3),playan essentialroleinthepreventionofautoimmunitypartlythrough limitinginammatoryimmuneresponsestopathogenicorcommensalmicroorganisms(5).Theperipheralrepertoireofnaturally occurringFoxp3+Tregsisgeneratedthroughacombinationof exportfromthethymus(29)andperipheralexpansion(30). However,mechanismstocounterbalancetheimmunosuppressive effectsofTregsmustbeinplacebecauseinammationisessential fortheeliminationofpathogens.Indeed,stronginammatoryresponsesmediateacollapseinTregnumbers(33),attestingtoa criticalbalancebetweenthedegreeofinammationandcontrol byTregs.Althoughinammatorysignalsfromcytokinessuchas IFNg canlimitthesizeoftheperipheralTregpopulation,IL-2 signalingplaysanopposingrolebymediatingtheexpansionof peripheralTregs(29).Notably,bothIL-2andIFNg signaling mediatethesynthesisofSOCS1,whichsubsequentlylimitstheir signaling(20).Althoughitisknownthatdistinctcytokinemilieus inuenceTreghomeostasis,therelationshipbetweenSOCS1and theperipheralhomeostasisofTregsunderinammatoryconditionsisunknown. Inthisstudy,weobservedthattheonsetofautoimmuneinammatorydiseaseinSOCS12 / 2micecoincidedwithaperipheral deciencyofFoxp3+Tregs,despiteenhancedthymicdevelopment.Signicantly,whereas100%ofSOCS12 / 2micedied within18dafterbirth,administrationofaCD4+Tcell/SOCS1KIRtreatmentresultedina60%increaseinthesurvivalof SOCS12 / 2miceshortterm,with20%survivinglongterm.SurvivalofSOCS12 / 2mice,mediatedbythecombinedtreatment, wascorrelatedtodecreasedIFNg serumlevelsanddecreased leukocyticinltrationintovitalorganssuchastheliverandheart. AnalysisofthelymphnodesandspleensofSOCS12 / 2micereceivingthecombinedtreatmentrevealeda10-and16-foldincreaseintotallymphocytenumbers,respectively,whencompared withuntreatedSOCS12 / 2miceat2wk.Ofparticularinterest, unlikeuntreatedSOCS12 / 2mice,whichhadaperipheraldeciencyinTregs,SOCS12 / 2micereceivingthecombinedtreatmenthadabsoluteTregnumberswithinthelymphnodethatwere comparablewithadultwild-type(WT)numbers,suggestingacceleratedTreghomeostasis.BecauseSOCS12 / 2miceexhibitan extremeinammatorydisease,whichbothbiasesTcellstoan inammatoryphenotypeandrenderstissuesrespondingtoinammatorycytokinesunabletocontrolresponsiveness,these resultssuggestthataCD4+/SOCS1-KIRtreatmentstrategylikely couldhaveefcacyinthetreatmentofvariouschronicinammatorydiseases.Inaddition,theseresultsprovidemechanisticinsightintotheintricatebalancebetweentheTregandthe SOCS1immunesystemregulatorypathways.MaterialsandMethodsMiceSOCS1+/ 2miceonaC57BL/6geneticbackgroundwerepurchasedfrom theSt.Judeanimalfacility(Memphis,TN)andmatedintheUniversity ofFloridaCancerandGeneticsAnimalFacility,generatingSOCS12 / 2, SOCS1+/ 2,andSOCS1+/+(WT)mice.C57BL/6miceusedinadoptive transferswerepurchasedfromTheJacksonLaboratory(BarHarbor,ME). MiceweremaintainedinsterilemicroisolatorsunderspecicpathogenfreeconditionsattheUniversityofFloridaCancerandGeneticsAnimal Facility.Miceundergoingvarioustreatmentswereweigheddaily,and generalhealthwasassessed.Micebecomingmorbidorexhibitinga20% weightlosswereeuthanized.Proceduresdescribedinthisarticlewere approvedbytheUniversityofFloridaInstitutionalAnimalCareandUse Committee,andexperimentswereperformedinstrictaccordancetothe approvedprotocols.GenotypingQuantitativePCR(qPCR)wasusedtodeterminethepresenceoftheSOCS1 geneinmice.Tailclips(1mm)isolatedfrom1-wk-oldSOCS1+/+,SOCS1+/ 2, orSOCS12 / 2miceweredegradedusingtheDNAeasyBloodandTissue Kit(Qiagen,Valencia,CA).ABsoluteQPCRSYBRGreenMix(ABgene Epsom,Surrey,U.K.)andprimersspecicforSOCS1(forward:5 9 -GACACTCACTTCCGCACCTT-3 9 ;reverse:5 9 -GAAGCAGTTCCGTTGGCGACT-3 9 )orhousekeepinggene b -actin(forward:5 9 -CCACAGCACTGTAGGGTTTA-3 9 ;reverse:5 9 -ATTGTCTTTCTTCTGCCGTTCTC-3 9 )(200 nM)wereusedtoamplifyandquantifyrelativeamountsofDNAona PTC-200PeltierThermalCyclerwithaCHROMO4ContinuousFluorescenceDetector(BioRad,Hercules,CA).Theamplicationwasperformed byone15-mincycleat95C,whichwasrequiredforenzymeactivation, followedby47cyclesofdenaturation(95C,15s),annealing(57C,30s), andextension(72C,30s).Phenotypeofmicewasdeterminedbyrelative expressionofSOCS1.Meltingcurveanalysiswasperformedtoconrm ampliconspecicity.Thefoldchangeinexpressionwascalculatedusing thedouble D cyclethresholdmethod(i.e.,usingthevalue22 DD CT).PeptidesynthesisPeptidesSOCS1-KIR(53DTHFRTFRSHSDYRRI)andSOCS1-KIR2A (53DTH A RT ARSHSDYRRI)weresynthesizedusingconventionaluorenylmethylcarbonylchemistryaspreviouslydescribed(34)usingan AppliedBiosystems431Aautomatedpeptidesynthesizer(AppliedBiosystems,Carlsbad,CA).Usingasemiautomatedprotocol(35),weadded alipophilicgroup(palmitoyl-lysine)forcellpenetrationtotheNterminus asanalstep.Peptideswerecharacterizedusingmassspectrometryand puriedbyHPLC.PeptidesweredissolvedinDMSOorPBS(SigmaAldrich,St.Louis,MO)beforeuse.MagneticcellseparationCD4+andCD4+CD25+TlymphocyteswereenrichedusingeitheraCD4+orCD4+CD25+Tcellisolationkit(MiltenyiBiotec,BergischGladbach, Germany),respectively,accordingtomanufacturer’sinstructions.Inbrief, asingle-cellsuspensionofpooledlymphnode(axillary,inguinal,brachial, mesenteric,andsupercialcervical)andspleenwasobtainedfromC57BL/ 6micefollowedbyMACScolumnenrichmentperformedunderaseptic conditions.TheenrichedCD4+TcellpopulationwasobtainedviaMACS columnnegativeselectionusingCD4Tcellisolationkit(MiltenyiBiotec). InthecaseofCD4+CD25+Tcellenrichment,anenrichedCD4+lymphocytepopulationwasrstobtainedthroughMACScolumnnegative selection,followedbyMACScolumnpositiveselectionofCD4+CD25+cellsaccordingtomanufacturer’sinstructions.ThepuritiesfortheenrichedCD4+andCD4+CD25+populationsweretypically $ 80%pure (Fig.3).InvivomousetreatmentsIntraperitonealinjectionsofSOCS12 / 2orWT(SOCS1+/+)littermatemice withSOCS1-KIRpeptide(10 m g/g)and/orMACSpuriedCD4+orCD4+CD25+lymphocytes(5 3 105)began24hafterbirth.i.p.injectionsof SOCS1-KIRwereperformeddaily,whereaslymphocyteadoptivetransfers wereperformedtwiceweekly.Insomeexperiments,SOCS1-KIR2A(10 m g/g)wasadministeredasaspecicitycontrol.FlowcytometrySingle-cellsuspensionsofpooledlymphnodes(axillary,inguinal,brachial, mesenteric,andsupercialcervical),spleen,andthymuscellswerestained withthefollowingmAbsforowcytometricanalysis:anti–CD4-Pacic Blue(RM4-5;BDPharmingen,SanDiego,CA),anti–CD8a-AlexaFlour 700(53-6.7;BDPharmingen),anti–CD25-allophycocyanin(PC61;BD Pharmingen),andanti–CD45R(B220)-FITC(RA3-6B2;eBioscience,San Diego,CA).Foxp3intracellularstainingwasperformedaspreviously described(36).Inbrief,cellswerexedandpermeabilizedusingthe reagentsprovidedwiththeanti–Foxp3-PE(FJK-16s;eBioscience)oranti– Foxp3-FITC(FJK-16s;eBioscience)Ab.Atotalof50,00000,000live eventswerecollectedonanLSRII(BDPharmingen)andanalyzedusing FlowJosoftware(TreeStar,SanCarlos,CA).Theabsolutenumbersof cellsrecoveredfromvariousorganswasdeterminedbymultiplyingtheTheJournalofImmunology 2667 at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 4

totalnumberofcellsisolatedfromvarioustissuesbythepercentageof totalcellsbearingalineage-specicmarkerdenotedbyowcytometry.RNAisolationandRT-qPCRTotalRNAwasextracted,aspreviouslydescribed(37),fromthelymph nodesofSOCS12 / 2mice,WTage-matchedlittermates,ormagnetically separatedCD4+CD252andCD4+CD25+TlymphocytesusingtheSV TotalRNAIsolationSystem(Promega,Madison,WI).Theconcentrations andpurityofthetotalRNAweredeterminedusingaSmartSpecPlus Spectrophotometer(BioRad).QualityandintegrityofthetotalRNAwas assessedbya2100Bioanalyzer(AgilentTechnologies,SantaClara,CA) andanRNAintegritynumber $ 7wasroutinelyobtained.First-strand cDNAsynthesiswasperformedusingImProm-IIReverseTranscription System(Promega).iQSYBRGreenSupermix(Bio-Rad)andgene-specic primers(TableI)at200nMwereusedtoamplifyrelativeamountsof cDNAonaPTC-200PeltierThermalCyclerwithaCHROMO4ContinuousFluorescenceDetector(BioRad).Theamplicationwasperformed byone5-mincycleat95C,whichwasrequiredforenzymeactivation, followedby51cyclesofdenaturation(95C,15s),annealing(55Cor 57C,30s),andextension(72C,30s).Meltingcurveanalysiswasperformedtoconrmampliconspecicity.Thefoldchangeinexpression wascalculatedusingthedouble D CTmethod(i.e.,usingthevalue22 DD CT) usingBioRadsoftware.CytokinesecretionanalysisLymphnodeswereisolatedfromSOCS12 / 2miceandWTlittermates, followedbythegenerationofsingle-cellsuspensions.Atotalof2 3 105cellswereplatedwithorwithout3 m g/mlanti-CD3and1 m g/mlantiCD28(BDBiosciences,SanDiego,CA).After72h,supernatantswere collectedfromwells.CytokineELISAsweresubsequentlyperformedas previouslydescribed(37)onharvestedsupernatants.IL-2(555148)ELISA kits,capture(555068)anddetection(555067)mAbforIL-17A,andcytokinestandardforIFNg (554587)wereobtainedfromBDBiosciences. IL-17cytokinestandard(14-8171-80),andIFNg capture(16-7313-85) anddetection(13-7311-85)mAbswerepurchasedfromeBioscience.HistologyHistologyandimmunohistochemistrywasperformedundertheadvisement oftheUniversityofFloridahistologycorelaboratory.Heartandliverwere isolatedfromtreatedanduntreated2-wk-oldSOCS1+/+andSOCS12 / 2mice,andstoredfor24hinPBScontaining2%paraformaldehyde.Organs weresubsequentlytransferredinto70%ethanolforlong-termstorage. Organswereparafnembedded,sectionedatathicknessof3 m m,and stainedforH&E.Photosweretakenat 3 20magnicationusingtheLeica DM2500microscopeequippedwithanOptronicscolorcameraand MagnaFiresoftware(Optronics,Goleta,CA).ImmunohistochemistryThymuseswereisolatedfrom2-wkoldSOCS1+/+andSOCS12 / 2mice, andstoredfor24hinPBScontaining2%paraformaldehydefollowedby transferinto70%ethanol.Thymusesweresubsequentlyparafnembedded,sectionedatathicknessof3 m m,andplacedonsuperfrostplus microscopeslides(Fisher).Slideswereblockedfollowedbyovernight stainingwithprimaryAbsrabbitanti-ratFoxp3(FJK-16s;eBioscience) andrabbitanti-humanCD3(Dako).Slideswerenextwashed,incubated withappropriatesecondaryAbs,anddeveloped.Allphotosweretakenat 3 20magnication.StatisticalanalysisGraphPadPrismv.5wasusedtocalculatethestatisticallysignicantdifferencesbetweendifferentgroupsusingunpairedtwo-tailedStudent t test. ForKaplan–Meiersurvivalcurvetypeexperiments,Mantel–CoxortwowayANOVAanalyseswereapplied.A95%condencelimit,denedby p values # 0.05,wasconsideredsignicantandisindicatedwithinthegures.ResultsSOCS12 / 2micearedecientinperipheralFoxp3+Tregs Foxp3+CD4+Tlymphocytes(Tregs)playacriticalroleinthe preventionofinammation-mediatedautoimmunity(38).Given thatSOCS12 / 2micedieofaninammation-mediatedautoimmunediseaseby21dafterbirth(9),weexaminedforthe presenceofTregsintheperipherallymphoidorgansof2-wk-old SOCS12 / 2mice.WeobservedthatthefrequencyofTregsin SOCS1-decientmice,incomparisonwithWT,wasmodestly reduced27%(Fig.1A )inthelymphnodeanddrasticallyreduced inthespleen62%(Fig.1B ).Moreover,despitecomparable absolutenumbersoftotalandCD4+Tlymphocytesin2-wk-old SOCS12 / 2mice,therewasasignicantreductionintheabsolute numbersofTregspresentwithinthelymphnodesofSOCS12 / 2miceincomparisonwithWTlittermates(6.6 3 104versus1.1 3 105; p =0.02;Fig.1).Consistentwithpreviousreports,thespleens ofSOCS12 / 2miceweresignicantlylymphopenic,astotal splenocytesandCD4+lymphocytesinthespleensoftheSOCS12 / 2micewerereduced6-and3-fold,respectively,incomparison with2-wk-oldWTmice(39)(Fig.1B ).Signicantly,therewas a6-foldreductioninthenumberofTregsinSOCS12 / 2mice comparedwithWT(2 3 104versus1.2 3 105; p =0.0003;Fig. 1 B ).Together,thesedatashowthatSOCS12 / 2mice,whichdie ofautoinammatorypathologybeforeweaning,havenumericand frequencyreductionsofTregswithinthesecondarylymphoid organs. EnhancedthymicdevelopmentofCD4+Foxp3+Tregsinthe absenceofSOCS1 Becausethethymusplaysacriticalroleinthegenerationofa peripheralTregrepertoire(40),wenextdeterminedwhetherthe peripheralreductioninCD4+TlymphocytesandCD4+Foxp3+TregsinSOCS12 / 2micewasassociatedwithdefectivethymic development.Consistentwithpreviousreports,owcytometry analysisofthethymusesfrom2-wk-oldmicerevealedperturbed thymocytedevelopmentinSOCS12 / 2micewithhigherfrequenciesofmatureCD4+CD82andCD8+CD42lymphocytesin comparisonwithWTlittermatecontrolmice(Fig.2)(10).The increasedfrequencyofmaturethymocytesinSOCS12 / 2mice couldbepartlyexplainedbythedecreasedfrequencyofimmature CD4+CD8+thymocytes,asa3-foldreductioninthefrequencyof CD4+CD8+thymocytes(85%WTversus32%knockout;Fig.2A ) wasalsoaccompaniedbya3-foldreductionintotalthymocytesin comparisonwithWTlittermatecontrols(1.5 3 107versus4.8 3 107; p =0.0001;Fig.2C ).However,despitedifferencesinthetotal cellularityandcompositionoftheSOCS12 / 2thymusincomparisonwithWTlittermates,Foxp3+thymocyteswereclearly evident(Fig.2A ,2 B )at14dintheSOCS12 / 2thymus.The Foxp3+thymocyteswerepresentwithinthemedullaryregion ofthethymusandwerelargelyCD4+CD82inbothWTand SOCS12 / 2mice(Fig.2A anddatanotshown).Signicantly,the frequencyofFoxp3+thymocyteswas2-foldgreaterinSOCS12 / 2micecomparedwithWT.Despitea3-foldreductioninthetotal numberofthymocytes,thenumbersofCD4+CD82andFoxp3+CD4+CD82cellswerenotstatisticallydistinctbetweenSOCS12 / 2andWT(Fig.2 C ).Together,thesedatashowthatdespiteperturbationsinthedevelopmentofCD4+CD82thymocytesinSOCS12 / 2mice,TregsindeeddevelopedinSOCS12 / 2miceandexpressed Foxp3attheCD4+CD82maturethymocytestageconsistentwith SOCS1-sufcientthymocytesandpublishedstudiesofTregthymic development(41).Insummary,inadequatedevelopmentofFoxp3+thymocytescouldnotexplaintheirdeciencyintheperiphery. Foxp3expressioninCD4+CD25+TregsiscorrelatedtoSOCS1 expression PeripheralTregsaredistinguishedfromconventionalnaiveTcells bytheconstitutiveexpressionoftheIL-2R a -chain,CD25(40).IL2signaling,whichmediatesSOCS1expression(42),isrequired fortheperipheralsurvivalandexpansionofTregs(43).Giventhat theabsolutenumbersofperipheralCD4+TcellswerelessaffectedbySOCS1deciencythancounterpartFoxp3+Tregs(Fig. 2668SOCS1CONTRIBUTESTOPERIPHERALTregSTABILITY at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 5

1),wenextexaminedSOCS1expressioninWTCD4+CD25+TregscomparedwithconventionalWTCD4+CD252lymphocytes (TableI).AsshowninFig.3A ,WTCD4+CD25+Tregs,which expressedsignicantlymoreFoxp3comparedwithcounterpart CD4+CD252Tcells,alsoexpressedsignicantlymoreSOCS1. Moreover,analysisofCD4+CD25+splenocytesfromSOCS12 / 2micerevealeda6-foldreductioninthefrequencyofFoxp3expressingcellswhencomparedwithWT(Fig.3B ).Together, thesedatashowadistinctcorrelationbetweenthecoexpressionof Foxp3andSOCS1inCD4+CD25+Tregs,thusimplicatingarole forSOCS1inthestabilityofFoxp3+Tregs. SOCS1deciencycorrelatedtodysregulatedcytokine production BecauseSOCS1isacriticalregulatorofcytokinesignaling(42), wenextexaminedcytokineproductionintheabsenceofSOCS1. DirectexvivoanalysisofIL-2messageexpression(whichisessentialforthesurvivalofperipheralTregs)andinammatory cytokinesIL-17andIFNg showednostatisticaldifferencesbetweenSOCS12 / 2miceandWTlittermatecontrols(Fig.3 C ).It was,however,interestingtonotethatIFNg messagelevelsin lymphnodesisolatedfromSOCS12 / 2micewereconsistently higherthaninWTcounterparts(Fig.3C ).Wenextmeasuredthe capacityoflymphocytesisolatedfromSOCS12 / 2micetoproduce IFNg ,IL-17,andIL-2onstimulationinvitrobyELISA.Inthe absenceofTCRstimulation,littleproductionofeitherIL-2orIL17wasdetectedinlymphocytesisolatedfromeitherWTor SOCS12 / 2mice.Incontrast,WTlymphocytesproduced6-and5foldmoreIL-2andIL-17onTCRstimulationcomparedwith SOCS1-decientcounterparts,respectively(Fig.3C ).Incontrast withIL-2orIL-17,IFNg wasproducedintheabsenceofinvitro stimulation.IFNg productionbySOCS12 / 2lymphocytes,however,wasconsistentlyhigherthanWTintheabsenceofTCR stimulationandbecamesignicantlyincreasedonTCRstimulation( p =0.039;Fig.3C ).Together,thesedatashowthatSOCS1decientlymphocyteshaveasignicantlyreducedcapacityto produceIL-2andIL-17comparedwithWTandasignicantly enhancedcapacitytoproduceIFNg .Theseresultssuggestthat modulationofthecytokineperipheralenvironmentislikelycontributingtothereductionofperipheralTregswithinSOCS1mice. CombinedSOCS1-sufcient,CD4+Tcelladoptivetransfer, andSOCS1-KIRmimetictreatmentdelayedonsetoflethal disease CD4+CD25+Foxp3+Tregsplayacriticalroleinthepreventionof autoimmunitywithinlymphopenicanimalsastheadoptivetransferofCD4+CD25+Tregsintovariousautoimmune,lymphopenic modelssuchasday3thymectomizedmiceandcolitisinduction mousemodelsinhibitedonsetofdisease(32,44).Because SOCS12 / 2miceweredecientinperipheralFoxp3+Tregs,despitebeinggeneratedwithinthethymus,wenextexamined whetheradoptivetransferofTregsorCD4+Tcells(whichare 10%Tregs)intotheperipheryofSOCS12 / 2micecoulddelay morbidity,possiblythroughthereversaloflymphopenia.We adoptivelytransferredMACSSOCS1-sufcient,WTCD4+CD25+Foxp3+Tregs,orCD4+lymphocytesintoSOCS12 / 2miceonday 2oflife(Fig.4A ).Weobservedthattheadoptivetransferofeither CD4+CD25+TregsortotalCD4+SOCS1-sufcientlymphocytes increasedthelifespanofSOCS12 / 2micesimilarly(Fig.4 B ). Moreover,althoughnountreatedSOCS12 / 2micesurvivedpast 17d,42%oftheSOCS12 / 2micereceivingadoptivetransfers remainedaliveatthesametimepoint( p =0.002).Insummary,the adoptivetransferofSOCS1-sufcientCD4+CD25+orCD4+lymphocyteswascapableofmodestbutsignicantprolongationof survival. SOCS1hastwowell-characterizedregionsinvolvedininhibiting cytokinesignaling,theSOCSboxandtheKIR.Wehavedeveloped a16-aapeptidethatmimicstheKIRofSOCS1,SOCS1-KIR, whichcontainsacell-penetratinglipophilicgroupandactsintracellularlytoinhibitcytokine(includingIFN-g )responsiveness (25).WenexttreatedSOCS12 / 2micedailywith10 m g/gmouse weightofSOCS1-KIRtodetermineitscapacitytopreventperilethality.AsshowninFig.4B ,treatmentwiththeSOCS1-KIR resultedinincreasedlifespanofSOCS12 / 2mice,similarto thatoftheCD4+,orCD4+CD25+,Tlymphocyteadoptive transfers.Incontrast,administrationofacontrolpeptide,SOCS1FIGURE1. SOCS12 / 2micearedecientinperipheralFoxp3+Tregs. A , Axillary,brachial,inguinal,supercialcervical,andmesentericlymph nodeswereisolatedfromSOCS12 / 2( n =12)orWTlittermatecontrols ( n =12)at2wk. Top ,HistogramshowingpercentagesofCD4+Foxp3+lymphocytesinSOCS12 / 2andlittermatecontrols. Bottom ,Graphs showingabsolutenumbersoftotal,CD4+,andCD4+Foxp3+lymphocytes. Eachdotisrepresentativeofanindividualmouse,withaveragesdenoted bylines. B ,Spleenswereisolatedfrommiceindicatedin A . Top ,HistogramcomparingpercentagesofCD4+Foxp3+lymphocytesinSOCS12 / 2andlittermatecontrols. Bottom ,Graphsshowingabsolutenumbersoftotal, CD4+,andCD4+Foxp3+lymphocytes.Eachdotisrepresentativeofan individualmouse,withaveragesdenotedbylines.Statisticalcomparisons betweenWTandSOCS12 / 2micewereperformedusingunpaired,twotailed t testwithstatisticalsignicancedenotedbyasterisks:* p # 0.05, *** p # 0.0005.TheJournalofImmunology 2669 at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 6

KIR2A,containingtwoalaninesubstitutionsincriticalregionsof SOCS1functionhadnoeffectonthesurvivalofSOCS12 / 2mice (datanotshown).Together,thesedatashowthatSOCS1-KIRhas asignicantpeptide-specic,albeitlimited,effectinprolonging thelifespanofSOCS12 / 2mice. BecauseCD4+andCD4+CD25+Tcelladoptivetransfer,aswell asSOCS1-KIRpeptidetreatment,allindividuallymediatedsignicant,butlimited,survivalofSOCS12 / 2mice,wenextexaminedwhetheraSOCS1-KIRpeptide/WTCD4+Tlymphocyte adoptivetransfercombinedtreatment(referredtohereafteras CD4+/SOCS1-KIRtreatment)coul denhancethesurvivalof SOCS12 / 2mice.AsshowninFig.4C ,atday24,30%of SOCS12 / 2micereceivingcombinedtreatmentwerelivingcomparedwith0%ofuntreatedmiceand15%ofmicereceivingeither ofthesingletreatments.Inaddition,themaximumlifespanof SOCS12 / 2micereceivingtheCD4+/SOCS1-KIRcombined treatmentwas77dcomparedwith17dforuntreatedmice(Fig. 4 C ).Together,thesedatashowthatalthougheitheradoptive transferofCD4+lymphocytesoradministrationofSOCS1-KIR peptidecouldmoderatelyenhancethelifespanofSOCS12 / 2mice,theCD4+/SOCS1-KIRtreatmentcouldextendthelifespan of20%oftreatedSOCS12 / 2mice . 3-fold. CD4+/SOCS1-KIRtreatmentincreasedweightgain,delayed leukocyteinltrationintoheartandliver,andreducedserum IFNg levelsinSOCS12 / 2mice SOCS12 / 2micehavebeencharacterizedbythereducedabilityto gainweight,signicantleukocyteinltrationintonumeroustissues, andaberrantIFNg signaling(39).Wethereforedeterminedthe effectofCD4+/SOCS1-KIRtreatmentontheweightofSOCS12 / 2mice,inadditiontoleukocyticorganinltrationandIFNg serum levels.SOCS12 / 2micereceivingeitherCD4+CD25+Treg,CD4+Tcelladoptivetransfers,SOCS1-KIRtreatments,orCD4+/SOCS1KIRtreatmentallhadstatisticallysignicantincreasesinweight andimprovedoverallappearanceat2wkincomparisonwithuntreatedSOCS12 / 2mice(Fig.5A ,5 B ,anddatanotshown).Wenext measuredthecapacityoftheCD4+/SOCS1-KIRtreatmenttoinhibitleukocyticinltrationandtissuedamageofheartandliver FIGURE2. PeripheralFoxp3+TregdeciencyinSOCS12 / 2miceisnotduetoinadequatethymicdevelopment.WT( n =14)andSOCS12 / 2( n =11)mice weresacricedat2wkafterbirth,thymiwereremoved,andthymuscompositionanalyzed. A ,DotplotsshowingCD4versusCD8expressionintotal( top panels )andFoxp3+( bottompanels )thymocytes. B ,HistogramsshowingFoxp3expressioninCD4+CD82thymocytes. C ,Graphsshowingabsolutecell numbersoftotal,CD4+CD82,andCD4+CD82Foxp3+thymocytes.Eachdotrepresentsanindividualmouse,withlinesdenotingaverages.StatisticalcomparisonsbetweenWTandSOCS12 / 2micewereperformedusingunpaired,two-tailed t testwithstatisticalsignicancedenotedbyasterisks:*** p # 0.0005. TableI.PrimersequencesandannealingtemperaturesPrimer ForwardPrimer ReversePrimer AnnealingTemperature(C)Actin 5 9 -CCTTCCTTCTTGGGTATGGA-3 9 5 9 -GGAGGAGCAATGATCTTGAT-3 9 55 Foxp3 5 9 -TCTGTGGCCTCAATGGACAA-3 9 5 9 -GAAGAACTCTGGGAAGGAACTA-3 9 55 IFNg 5 9 -AACTATTTTAACTCAAGTGGCAT-3 9 5 9 -AGGTGTGATTCAATGACG-3 9 55 IL-2 5 9 -TGCCCAAGCAGGCCACAGAA-3 9 5 9 -GTGTTGTCAGAGCCCTTTAG-3 9 55 IL-17A 5 9 -ACTCTCCACCGCAATGA-3 9 5 9 -CTCTTCAGGACCAGGAT-3 9 55 SOCS1 5 9 -GACACTCACTTCCGCACCTT-3 9 5 9 -GAAGCAGTTCCGTTGGCACT-3 9 572670 SOCS1CONTRIBUTESTOPERIPHERALTregSTABILITY at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 7

of2-wk-oldSOCS12 / 2mice.Hematoxylinandeosinstainingof heartandlivertissuesfromSOCS12 / 2miceshowedexcessive leukocyticinltrationanddamagein100%oftissuesexamined,in comparisonwithWTlittermatecontrols(Fig.5C ).Incontrast,40 and20%ofSOCS12 / 2micetreatedwiththeCD4+/SOCS1-KIR treatmenthadreducedleukocyticinltrationofheartandliver tissue,respectively(Fig.5C ).Signicantly,reductionsininltrationwerenotobservedinanyofthetissuesobtainedfrommice receivingeitherofthesingletreatmentsat2wk(datanotshown). Wenextexaminedseracollectedfrommiceat2wkofagetoexaminethepresenceofinammatorycytokinesviaELISA.AlthoughIL-17levelswereunaffectedbythecombinedtreatment, strikingly,SOCS12 / 2micereceivingthecombinedtreatment showedsignicantlylowerlevelsofserumIFNg incomparison withWToruntreatedSOCS12 / 2mice( p =0.0292;Fig.5 D ).These datashowthatalthougheitherTcelladoptivesingletreatment, SOCS1-KIRadministration,ortheCD4+/SOCS1-KIRtreatment improvedtheweightandoverallappearanceofSOCS12 / 2mice overa2-wkperiod,onlythecombinedtreatmentreducedleukocyteinltration,improvedtheconditionoftheheartandliver,and reducedIFNg serumlevelsinSOCS12 / 2miceat2wk.Signicantly,therewasapositivecorrelationbetweenhealthytissuesin SOCS12 / 2micereceivingthecombinedtreatmentat2wkandlongtermsurvival.Together,thesedatasuggestthattheCD4+/SOCS1KIRtreatment,whichsignicantlyprolongedthelifeofSOCS12 / 2mice,alsodelayeddamageoftheheartandliverbydelayingleukocyticinltrationandreducingIFNg signaling. TreatmentofSOCS12 / 2micewithCD4+/SOCS1-KIR treatmentrestoresFoxp3+Tregperipheralfrequencyand decreasesperipheraleffectorCD4+Tcells BecauseSOCS12 / 2micearelymphopenic(45),haveadysregulatedCD4:CD8ratiointheperiphery(10),andhaveasignicant reductioninFoxp3+Tregs(refertoFig.1),wenextexamined whethertheCD4+/SOCS1-KIRtreatmentpossiblydelayedorgan inltrationthroughregulationofperipherallymphocytefrequencies.ThefrequenciesofCD4+,CD8+,orB220+lymphocytes withinthespleenandlymphnodesofSOCS1-sufcientor-decientmicewerenotsignicantlyaffectedbythecombined treatment(Fig.6A–C ).However,althoughthefrequencyofperipheralCD4+lymphocyteswasnotchangedinSOCS12 / 2mice bythecombinedtreatment,therewasastatisticallysignicant increaseinthefrequencyofFoxp3+Tregsinthelymphnodesof SOCS12 / 2micereceivingthecombinedtreatmentsuchthatthe frequencyofTregswascomparablewitheither2-wk-oldoradult WTmice( p =0.05;Fig.6D ,6 F ,anddatanotshown).Moreover, astatisticallysignicantdecreaseinthefrequencyofFoxp32CD25+CD4+effectorTcellswasobservedinthespleensof SOCS12 / 2micereceivingthecombinedtreatments( p =0.05;Fig. 6 E ,6 F ).Together,thesedatashowthatthecombinedtreatment bothincreasedthefrequencyofperipheralFoxp3+TregsanddecreasedthefrequencyofactivatedCD4+effectorlymphocytes. FIGURE3. DysregulatedcytokineproductionbySOCS12 / 2lymphocytesiscorrelatedtoareductioninperipheralTregs. A ,Comparisonof Foxp3andSOCS1relativeexpressionbetweenWTCD4+CD25+and CD4+CD252lymphocytes.Axillary,brachial,inguinal,supercialcervical,andmesentericlymphnodeswereisolatedfromWTmicefollowedby magneticseparationofCD4+CD25+andCD4+CD252Tlymphocytes. GraphshowingrelativeexpressionofFoxp3andSOCS1inCD4+CD252andCD4+CD25+lymphocytesrelativeto b -actin.Datashownarerepresentativeoffourindependentexperiments. B ,CD4+CD25+Foxp3+Tregsare signicantlyreducedintheperipheryofSOCS12 / 2mice.Densityplot showingfrequencyofCD4+CD25+Foxp3+cellspresentinWTorSOCS12 / 2mousespleen.Dataarerepresentativeof12WTandSOCS12 / 2mice,respectively.StatisticalcomparisonbetweenWTandSOCS12 / 2micewas performedusingunpaired,two-tailed t test; p =0.00415. C ,Dysregulated cytokineproductionbySOCS12 / 2lymphocytes.Single-celllymphnode suspensionswereisolatedfromSOCS12 / 2( n =4)orWTlittermatecontrols ( n =7)at2wkandanalyzedexvivoorafterculture,inthepresenceor absenceofTCRstimulation,fortheproductionofIFNg ,IL-17,orIL-2 cytokinemessageand/orprotein. Left ,GraphsshowmRNAexpressionof IFNg ,IL-2,andIL-17relativeto b -actin.GraphsshowproductionofIFNg ,IL-2,andIL-17bySOCS12 / 2andWTlymphocytesintheabsence ( middlepanels )orpresence( rightpanels )ofTCRstimulation.Statistical comparisonsbetweenWTandSOCS12 / 2micewereperformedusing unpaired,two-tailed t testwithstatisticalsignicancedenotedbyasterisks: * p # 0.05,** p # 0.005,*** p # 0.0005.TheJournalofImmunology 2671 at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 8

CD4+/SOCS1-KIRtreatmentconfersenhancedFoxp3+Treg peripheralhomeostasisandreversaloflymphopeniain SOCS12 / 2mice Becauseautoimmunityhasbeenassociatedwithlymphopenia(32), wenextexaminedwhethertheincreasedsurvivalofSOCS12 / 2mice,subsequenttoreceivingthecombinedtreatment,wasdueto restorationoflymphocytehomeostasis.Althoughthecombined treatmentdidnotinuencethetotalnumbersofcells,CD4+lymphocytes,orCD4+Foxp3+Tregspresentinthelymphnodesor spleensofSOCS1-sufcientmice,signicantincreasesintotal andCD4+cellnumberswereobservedinthelymphnodesand spleensofSOCS12 / 2micereceivingthecombinedtreatment (Fig.7, toppanels )comparedwithuntreatedSOCS12 / 2mice.In addition,therewasa6-foldincreaseinthetotalnumbersof Foxp3+TregsinthelymphnodesofSOCS12 / 2micereceivingthe combinedtreatmentcomparedwithuntreatedSOCS12 / 2mice (Fig.7 A , bottompanel ).IncreasesinperipheralFoxp3+numbers inresponsetothecombinedtreatmentwerelikelynotcausedby changesinthymicdevelopmentbecausefrequencyandthymocyte numberswerenotstatisticallydistinctbetweentreatedanduntreatedSOCS12 / 2mice(datanotshown).NeitherCD4+CD25+norCD4+Tlymphocyteadoptivetransferwascapableofmediatingsimilarincreasesinlymphocytenumbers,norwereSOCS1KIRsingletreatments(datanotshown).Together,thesedatashow that2-wk-oldSOCS12 / 2micereceivingtheCD4+/SOCS1-KIR treatmenthadareversaloflymphopeniawithsignicantlyhigher numbersoftotalandCD4+cellswithinthespleenandlymph nodescomparedwithuntreated2-wk-oldSOCS12 / 2mice.In addition,thecombinedtreatmentsignicantlyincreasedthefrequencyandtotalFoxp3+Tregsinthelymphnodesoftreated2wk-oldSOCS12 / 2micecomparedwithuntreated2-wk-old SOCS12 / 2mice. Notonlydidthecombinedtreatmentincreasethetotalnumberof cellscontainedwithinthespleensandlymphnodesof2-wk-old SOCS12 / 2micecomparedwithuntreated2-wk-oldSOCS12 / 2mice,butalsoincomparisonwitheithertreatedoruntreated2-wkoldWTmice(Fig.7).WethereforehypothesizedthattheTreg repertoireformationmaybeacceleratedin2-wk-oldSOCS12 / 2micereceivingthecombinedtreatment.Totestthishypothesis,we comparedabsolutecellnumberspresentin2-wk-oldSOCS12 / 2receivingthecombinedtreatmentwith6-to8-wk-oldadultmice. Asexpected,signicantlyincreasednumbersoftotal,CD4+, CD8+B220+,andCD4+Foxp3+cellswerepresentwithinthe lymphnodesandspleensofadultWTmiceincomparisonwith2wk-oldWTmice(Fig.7,SupplementalFig.1).Comparisonof2wk-oldSOCS12 / 2micereceivingthecombinedtreatmentwith6wk-oldadultWTmicerevealedtotal,CD4+,andCD8+cell numbersinthelymphnodesthatwereall 2-foldgreaterthanthat ofadultmice(Fig.7A ,SupplementalFig.1).Interestingly,the increaseinabsoluteCD4+Foxp3+TregsinresponsetothecombinedtreatmentwasstatisticallyindistinctfromthatofadultWT miceinthelymphnodes(Fig.7A ).Notably,whereasthecombinedtreatmentinSOCS12 / 2micedidnotmediateastatistically signicantchangeinthefrequencyofCD4+,CD8+,orB220+lymphocytes,thecombinedtreatmentmediatedbothafrequency andnumericincreaseinFoxp3+Tregswithinthelymphnodes (Figs.6D ,7 A ).Althoughtotalsplenocyteswerestatisticallyindistinctbetween2-wk-oldSOCS12 / 2micereceivingthecombinedtreatmentandadultmice,SOCS12 / 2micehadreduced numbersofCD4+andCD8+lymphocytes.Consistentwithresults observedwithintheCD4+lymphocytepopulationinthespleensof SOCS12 / 2micereceivingthecombinedtreatment,Foxp3+Tregs weresignicantlylowerincomparisonwithadultWTmice.The combinedtreatmentalsomediatedanincreaseinB220+lymphocyteswithinthelymphnodesofSOCS12 / 2micethatwere comparablewithadultnumbers(SupplementalFig.1).Together, theseresultsshowthattheCD4+/SOCS1-KIRtreatmentmediated asignicantreductionintheSOCS12 / 2mouseperipherallymphopeniawithsignicantincreasesinCD4+,CD8+,andB220+lymphocytepopulationswithinthelymphnodes.Moreover,the combinedtreatmentyieldedanacceleratedincreaseinperipheral FIGURE4. CD4+/SOCS1-KIRtreatmentprolongslifeofSOCS12 / 2mice. A ,Schematicdiagramofmousetreatmentstrategiesperformedon SOCS12 / 2mice.Asingle-cellsuspensionofsplenocytesobtainedfrom6to8-wk-oldWTmicewasenrichedforCD4+orCD4+CD25+Tlymphocytesbymagneticseparation(MiltenyiBiotec).Atotalof5 3 105CD4+orCD4+CD25+TlymphocytescellswereinjectedintoSOCS12 / 2pups biweeklystartingonday2afterbirthinthepresenceorabsenceofdaily i.p.injectionofSOCS1-KIR(10 m gSOCS1-KIR/gmouse). B ,Kaplan– MeiercurveshowingsurvivalofSOCS12 / 2(blacksquares; n =9),mice receivinginjectionof5 3 105puriedCD4+CD25+Tregs(i.p.)twice aweek(greendiamonds; n =5),micereceivinginjectionof5 3 105puriedCD4+Tcells(i.p.)twiceaweek(bluesquares; n =12),ordaily SOCS1-KIRpeptide(10 m g/g)treatment(redtriangles; n =7). C ,Kaplan– MeiercurveshowingsurvivalofSOCS12 / 2(blacksquares; n =7)or CD4+/SOCS1-KIRtreatment(purpletriangles; n =12).Numbersofmice ineachgroupareindicatedinparentheses.Micewereeuthanizedwhen moribund.SOCS12 / 2survivalcurveisbeingcomparedwithvarious treatmentsurvivalcurvesbyMantel–Coxcomparison.Statisticalsignicanceisdenotedbyasterisks:* p # 0.05,** p # 0.005.2672 SOCS1CONTRIBUTESTOPERIPHERALTregSTABILITY at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 9

Foxp3+Tregsin2-wk-oldSOCS12 / 2micethatwascomparable numericallywiththatofadultWTmice.DiscussionSOCS12 / 2miceuniformlydiein , 21dofaproinammatory autoimmunediseasecharacterizedbyleukocyticinltrationof numeroustissues,whichmediatestissuedestruction.TheautoimmunediseasepossessedbySOCS12 / 2miceisatriple-edged sword:1)intheabsenceofSOCS1,Tlymphocytesareskewedto aproinammatory,IFNg –producing,Th1phenotype(39);2)in theabsenceofSOCS1,tissuessuchastheliverbearingIFNg receptorsareunabletoturnoffIFNg signaling;and3)asthis studyshows,theproinammatoryenvironmentgeneratedin SOCS12 / 2micemediatesareductioninboththepercentageand absolutenumbersofFoxp3+Tregs.Whereas0%ofuntreated SOCS12 / 2micesurvivedpast18d,theCD4+/SOCS1-KIR treatmentyieldedamaximallifespanof77d.Thelong-term survivalobservedwiththecombinedtreatmentofSOCS12 / 2micecoincidedwithdelayedleukocyticinltrationoftheliverand heart,aswellasreducedserumlevelsofIFNg .Thisresultis particularlysignicantgiventheseverityoftheinammatory diseasepresentwithinthesemice.Theseresultsaresimilarto apreviousstudyinwhichSOCS1-decientmicemadetransgenic toexpressSOCS1withKIR,butlackingtheSOCSbox,could surviveperilethality,with 20%survivinglongterm(21).Signicantly,theseresultssuggestthatthecombinedtreatmentprolongedthesurvivalofSOCS12 / 2micebyreducingIFNg signalinganddelayingautoimmunedestructionofvitalorgansby inltratingleukocytes. FIGURE5. CD4+/SOCS1-KIRtreatmentprevents leukocyteinltrationintotheheartandliverof2-wkoldSOCS12 / 2mice. A ,Graphshowingaveragedaily weightsofSOCS12 / 2miceuntreated( n =16),receiving5 3 105WTTregs( n =6),5 3 105WTCD4+Tcells( n =12),SOCS1-KIRpeptidetreatment( n = 7),CD4+/SOCS1-KIRtreatment( n =12),orWT littermatecontrols( n =9)overa2-wkperiod. B , Photographsof2-wk-oldSOCS12 / 2mice,SOCS12 / 2micereceivingdualtreatment,andWTlittermate controls.Photographsdepicttherangeofvisualappearanceundereachcondition. C ,H&Estainsdepictingheartandlivertissuesof2-wk-oldSOCS12 / 2, SOCS12 / 2micereceivingdualtreatments,orlittermatecontrolmice(originalmagnication 3 20).PhotomicrographsofH&E-stainedliverandheartof untreatedSOCS12 / 2( n =8)andWT( n =7)miceare representativeof100%ofsamplesanalyzed.PhotomicrographsofH&E-stainedliverandheartof SOCS12 / 2micereceivingcombinedtreatmentsare representativeoftwoofvemiceinregardtoheart samplesandoneofvemiceinregardtolivertissue. Pleasenotethatthesepercentagesareconsistentwith SOCS12 / 2micewithextendedsurvival. D ,Graphs showingIFNg andIL-17levelswithintheseraof 2-wk-oldWT( n =7)orSOCS12 / 2micewith( n =8) andwithout( n =10)CD4+/SOCS1-KIRtreatment. IFNg andIL-17cytokinelevelswereanalyzedby ELISA.StatisticalcomparisonsbetweenWTand SOCS12 / 2micewereperformedusingunpaired,twotailed t test,withstatisticalsignicancedenotedby asterisks:* p # 0.05,*** p , 0.0005.TheJournalofImmunology 2673 at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 10

TheimportanceofthegenerationofaproperperipheralTreg repertoireisclearlyevidentasFoxp3-decientmicesuccumbto alethalproinammatoryautoimmunediseasewithin21dafter birth(38).TheconstitutionofaperipheralTregrepertoireatbirth, orreconstitutionsubsequenttoalymphopenia-inducingevent,is dependentprimarilyonthymicdevelopmentofFoxp3+Tregs(29) andtheirperipheralexpansion(30),withperipheralconversionofconventionalFoxp32CD4+TcellsintoFoxp3+Tregs playingaminorrole(29).OurresultsshowthatSOCS12 / 2mice aredecientinperipheralTregs.Theperipheraldeciencyof Foxp3+Tregs,however,wasnotduetoinsufcientthymicproduction,becauseTregsweregeneratedinabundancewithinthe thymusof2-wk-oldSOCS12 / 2mice.TheCD4+/SOCS1-KIR treatmentmediatedexpansionoftheFoxp3+Tregrepertoirein 2-wk-oldSOCS12 / 2micetonumberscomparablewiththatof adultWTmice.Nodistinctionswereobservedwithinthe FIGURE6. TreatmentofSOCS12 / 2micewithCD4+/SOCS1-KIRtreatmentincreasesperipheralTregsanddecreasesactivatedCD4+CD25+Foxp32cells.Flowcytometryanalysiswasperformedonlymphnodeandspleenisolatedfrom2-wk-oldWTorSOCS12 / 2micewithandwithoutCD4+/SOCS1-KIR treatment.Histogramsshowing( A )CD4,( B )CD8,and( C )B220levelsintotallymphnodeorspleenpopulations,inthepresenceorabsenceofCD4+/SOCS1KIRtreatment.Foxp3versusCD25dotplotofCD4+cellspresentin( D )lymphnodesor( E )spleen. F ,BargraphsshowingpercentageofCD4+CD25+Foxp3+TregsandCD4+CD25+Foxp32effectorcellsinSOCS12 / 2micewithorwithouttreatment.StatisticalcomparisonsbetweenSOCS12 / 2micewithorwithout treatmentwereperformedusingunpaired,two-tailed t testwithstatisticalsignicancedenotedbyasterisks:* p # 0.05.Dataarerepresentativeofatleastve miceineachgroup.2674 SOCS1CONTRIBUTESTOPERIPHERALTregSTABILITY at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 11

thymusesoftreatedanduntreatedSOCS12 / 2mice,againverifyingthatperipheralincreasesinFoxp3+Tregsinresponsetothe combinedtreatmentwerelikelynotduetochangesinthymic production.Inaddition,thepopulationofTregsundergoingexpansionintheSOCS12 / 2micewastheendogenousSOCS12 / 2Foxp3+CD4+Tcellpopulationbasedonthefollowingevidence: 1)CD4+adoptivetransfersingletreatmentsfailedtomediate Foxp3+TregexpansionsinSOCS12 / 2mice;2)neitherthecombinednorthesingletreatmentsweresufcienttomediateincreasesinTregnumberswithin2-wk-oldWTmice;and3)ithas recentlybeenshownthatinanoninammatoryenvironment(mice decientinbothIFNg andSOCS1),SOCS12 / 2Tregspossessed acompetitiveadvantagetobecomethymicallyselectedandpersist intheperipherycomparedwithSOCS1-sufcientTregs(46,47). Wecannotdenitivelysaythatthepreventionofautoimmunity wasexclusivelyduetotheexpansionofTregs,becauseCD4+, CD8+,andB220+cellsalsoexpanded;however,basedonprevious studiesshowingtheimportanceofTregsinthepreventionof autoimmunity(29),itislikelythattheperipheralexpansionof Tregsthroughthecombinedtreatmentcontributedtotheincreased survivaloftheSOCS12 / 2mice. AlthoughitisknownthatFoxp3+Tregsplayanessentialrole inthepreventionofselftissuedamagethroughlimitingexcessive inammatoryimmunologicalres ponses,processesregulating overzealousimmunosuppressiveTregprocessesarelesswellunderstood.Numerousreportshavesuggestedthatregulationofthe peripheralTregpool/suppressorfunctioniscrucialduringimmunologicalinammatoryprocesses,mediatingtheeliminationof pathogensandcancers(reviewedinRefs.5,48).Mountingevidencesuggeststhat,inadditiontorecognitionofselfpeptides (49),thecytokineenvironmentalsosignicantlycontributestothe stability/sizeoftheperipheralTregpopulation.IL-2,althoughnot madebyTregs(50),isrequiredfortheperipheralsurvivaland expansionofFoxp3+Tregs(51).Incontrast,excessiveproinammatoryenvironmentsthatcontainIFNg mediatethecontractionoftheperipheralTregpool(33).Inthisarticle,wepresentdata thatsupportpreviousreportsstatingthatthelymphopenic,peripheralTcellrepertoireofSOCS12 / 2miceconsistsprimarilyof proinammatorymemoryTlymphocytesproducingabundant IFNg andlimitedamountsofIL-2(20,54).Inaddition,wehave addedtothosestudiesbyshowingthattheperipheralrepertoireof SOCS12 / 2micealsopossessedadeciencyinFoxp3+Tregs.Althoughitistemptingtospeculatethatthereductioninperipheral TregsisduetoconversiontoTH17cells(55),ourdatashowing reducedTH17differentiationintheabsenceofSOCS1suggests thismaynotbethecase.WehaverecentlyshownthatinvivoadministrationofSOCS1-KIRcanpreventtheonsetofEAEthrough inhibitionoftheproductionoftheproinammatorycytokines IFNg andIL-17(24).OurcurrentresultsshowthattheCD4+/ SOCS1-KIRtreatmentmediatedanincreaseinthefrequencyand absolutenumberofperipheralTregsinSOCS12 / 2miceandreducedIFNg butnotIL-17serumlevels.Signicantly,nosingle treatmentwassufcienttoaltertheTlymphocyterepertoire.Given theimportanceofcytokinesinmodulatingtheperipheralTcell repertoire,theseresultssuggestthattheSOCS1-KIRtreatment mediatedareductioninproinammatorycytokines,whereasthe CD4Tlymphocytesprovidednecessarysurvivalcytokines,such asIL-2.Althoughelucidationofthespecicmechanismsofthe combinedtreatmentinSOCS12 / 2miceremainsaprimaryfocus inourlaboratory,theobservedresultthatthecombinedtreatment cansignicantlyincreasethefrequencyandnumberofperipheral Tregsisanimportantone.Moreover,thecombinedtreatmentmediatedreductionsinconventionalTcellactivation,monocyticcell inltrationofvitalorgans,andserumIFNg levels,whereasprolongingthesurvivalofSOCS12 / 2mice.Inaddition,theseresults extendourcurrentknowledgeoftheroleofSOCS1inregulating peripheralTlymphocytehomeostasisasweshowthatSOCS1 playsanintricateroleinthestabilityoftheperipheralFoxp3+Treg populationwithinaproinammatoryenvironment.Therefore,it ispossiblethattargetingSOCS1functionthroughtheuseofmimeticsorantagonistsofSOCS1canbeaneffectivestrategyofmodulatingTregsinenvironmentswheremoreaggressiveinammatoryprocessesorenhancedTreg-mediatedtolerancemechanisms arerequired.AcknowledgmentsWethankDr.NealBensonforowcytometry,Dr.MardaJorgensen,HistologySupportLaboratoryatCell&TissueAnalysisCore,McKnight BrainInstitute,andthestaffoftheUniversityofFloridaanimalfacilities foranimalcare.WealsothankTenishaWilsonforhelpfuldiscussionsand criticalreviewofthemanuscript. FIGURE7. CD4+/SOCS1-KIRtreatmentincreasestotal,CD4+,andCD4+Foxp3+peripherallymphocytenumbersinSOCS12 / 2mice. A ,Graphs showingabsolutenumbersoftotal,CD4+,andCD4+Foxp3+lymphocytes presentin2-wk-oldSOCS12 / 2andWTlittermatecontrolmicewithor withoutCD4+/SOCS1-KIRtreatmentandWT6-to8-wk-oldadultmice. B , Graphsshowingtotal,CD4+,andCD4+Foxp3+splenocytespresentinmice denotedin A .Eachdotisrepresentativeofanindividualmouse,withaverages denotedbylines.Statisticswereperformedusingunpaired,two-tailed t test comparingtreatedSOCS12 / 2withuntreatedSOCS12 / 2,withstatistical signicancedenotedbyasterisks:* p # 0.05,** p # 0.005,*** p # 0.0005.TheJournalofImmunology 2675 at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from

PAGE 12

DisclosuresTheauthorshavenonancialconictsofinterest.References1.Miller,C.H.,S.G.Maher,andH.A.Young.2009.Clinicaluseofinterferongamma. Ann.N.Y.Acad.Sci. 1182:69. 2.Martin-Orozco,N.,andC.Dong.2009.TheIL-17/IL-23axisofinammationin cancer:friendorfoe? Curr.Opin.Investig.Drugs 10:543. 3.Miyara,M.,andS.Sakaguchi.2007.NaturalregulatoryTcells:mechanismsof suppression. TrendsMol.Med. 13:108. 4.Chakraborty,S.,S.Zawieja,W.Wang,D.C.Zawieja,andM.Muthuchamy. 2010.Lymphaticsystem:avitallinkbetweenmetabolicsyndromeandinammation. Ann.N.Y.Acad.Sci. 1207(Suppl1):E94–E102. 5.Belkaid,Y.,andB.T.Rouse.2005.NaturalregulatoryTcellsininfectious disease. Nat.Immunol. 6:353. 6.Croker,B.A.,H.Kiu,andS.E.Nicholson.2008.SOCSregulationoftheJAK/ STATsignallingpathway. Semin.CellDev.Biol. 19:414. 7.Yoshimura,A.2009.RegulationofcytokinesignalingbytheSOCSandSpred familyproteins. KeioJ.Med. 58:73. 8.Shevach,E.M.,R.A.DiPaolo,J.Andersson,D.M.Zhao,G.L.Stephens,and A.M.Thornton.2006.ThelifestyleofnaturallyoccurringCD4+CD25+Foxp3+ regulatoryTcells. Immunol.Rev. 212:60. 9.Starr,R.,D.Metcalf,A.G.Elefanty,M.Brysha,T.A.Willson,N.A.Nicola, D.J.Hilton,andW.S.Alexander.1998.Liverdegenerationandlymphoid decienciesinmicelackingsuppressorofcytokinesignaling-1. Proc.Natl. Acad.Sci.USA 95:14395. 10.Marine,J.C.,D.J.Topham,C.McKay,D.Wang,E.Parganas,D.Stravopodis, A.Yoshimura,andJ.N.Ihle.1999.SOCS1deciencycausesalymphocytedependentperinatallethality. Cell 98:609. 11.Naka,T.,T.Matsumoto,M.Narazaki,M.Fujimoto,Y.Morita,Y.Ohsawa, H.Saito,T.Nagasawa,Y.Uchiyama,andT.Kishimoto.1998.AcceleratedapoptosisoflymphocytesbyaugmentedinductionofBaxinSSI-1(STAT-induced STATinhibitor-1)decientmice. Proc.Natl.Acad.Sci.USA 95:155775582. 12.Naka,T.,M.Narazaki,M.Hirata,T.Matsumoto,S.Minamoto,A.Aono, N.Nishimoto,T.Kajita,T.Taga,K.Yoshizaki,etal.1997.Structureand functionofanewSTAT-inducedSTATinhibitor. Nature 387:924. 13.Endo,T.A.,M.Masuhara,M.Yokouchi,R.Suzuki,H.Sakamoto,K.Mitsui, A.Matsumoto,S.Tanimura,M.Ohtsubo,H.Misawa,etal.1997.Anewprotein containinganSH2domainthatinhibitsJAKkinases. Nature 387:921. 14.Ilangumaran,S.,andR.Rottapel.2003.RegulationofcytokinereceptorsignalingbySOCS1. Immunol.Rev. 192:196. 15.Alexander,W.S.2002.Suppressorsofcytokinesignalling(SOCS)intheimmunesystem. Nat.Rev.Immunol. 2:410. 16.Nakashima,T.,A.Yokoyama,Y.Onari,H.Shoda,Y.Haruta,N.Hattori, T.Naka,andN.Kohno.2008.Suppressorofcytokinesignaling1inhibitspulmonaryinammationandbrosis. J.AllergyClin.Immunol. 121:126976. 17.Dimitriou,I.D.,L.Clemenza,A.J.Scotter,G.Chen,F.M.Guerra,and R.Rottapel.2008.Puttingoutthere:coordinatedsuppressionoftheinnateand adaptiveimmunesystemsbySOCS1andSOCS3proteins. Immunol.Rev. 224: 265. 18.Baker,B.J.,L.N.Akhtar,andE.N.Benveniste.2009.SOCS1andSOCS3inthe controlofCNSimmunity. TrendsImmunol. 30:392. 19.Brysha,M.,J.G.Zhang,P.Bertolino,J.E.Corbin,W.S.Alexander, N.A.Nicola,D.J.Hilton,andR.Starr.2001.Suppressorofcytokinesignaling-1 attenuatesthedurationofinterferongammasignaltransductioninvitroand invivo. J.Biol.Chem. 276:220862089. 20.Palmer,D.C.,andN.P.Restifo.2009.Suppressorsofcytokinesignaling(SOCS) inTcelldifferentiation,maturation,andfunction. TrendsImmunol. 30:592. 21.Zhang,J.G.,D.Metcalf,S.Rakar,M.Asimakis,C.J.Greenhalgh, T.A.Willson,R.Starr,S.E.Nicholson,W.Carter,W.S.Alexander,etal.2001. TheSOCSboxofsuppressorofcytokinesignaling-1isimportantforinhibition ofcytokineactioninvivo. Proc.Natl.Acad.Sci.USA 98:13261. 22.Flowers,L.O.,H.M.Johnson,M.G.Mujtaba,M.R.Ellis,S.M.Haider,and P.S.Subramaniam.2004.CharacterizationofapeptideinhibitorofJanuskinase 2thatmimicssuppressorofcytokinesignaling1function. J.Immunol. 172: 7510. 23. Flowers,L.O.,P.S.Subramaniam,andH.M.Johnson.2005.ASOCS-1peptide mimeticinhibitsbothconstitutiveandIL-6inducedactivationofSTAT3in prostatecancercells. Oncogene 24:2114. 24.Jager,L.D.,R.Dabelic,L.W.Waiboci,K.Lau,M.S.Haider,C.M.I.Ahmed, J.I.Larkin,III,S.David,andH.M.Johnson.2011.Thekinaseinhibitoryregion ofSOCS-1issufcienttoinhibitT-helper17andotherimmunefunctionsin experimentalallergicencephalomyelitis. J.Neuroimmunol. 232:108. 25.Waiboci,L.W.,C.M.Ahmed,M.G.Mujtaba,L.O.Flowers,J.P.Martin, M.I.Haider,andH.M.Johnson.2007.Boththesuppressorofcytokinesignaling 1(SOCS-1)kinaseinhibitoryregionandSOCS-1mimeticbindtoJAK2autophosphorylationsite:implicationsforthedevelopmentofaSOCS-1antagonist. J.Immunol. 178:5058. 26.Ahmed,C.M.,R.Dabelic,J.P.Martin,L.D.Jager,S.M.Haider,and H.M.Johnson.2010.Enhancementofantiviralimmunitybysmallmolecule antagonistofsuppressorofcytokinesignaling. J.Immunol. 185:110313. 27.Berard,J.L.,B.J.Kerr,H.M.Johnson,andS.David.2010.DifferentialexpressionofSOCS1inmacrophagesinrelapsing-remittingandchronicEAEand itsroleindiseaseseverity. Glia 58:1816. 28.Mujtaba,M.G.,L.O.Flowers,C.B.Patel,R.A.Patel,M.I.Haider,and H.M.Johnson.2005.Treatmentofmicewiththesuppressorofcytokine signaling-1mimeticpeptide,tyrosinekinaseinhibitorpeptide,preventsdevelopmentoftheacuteformofexperimentalallergicencephalomyelitisand inducesstableremissioninthechronicrelapsing/remittingform. J.Immunol. 175:507786. 29.Wing,K.,andS.Sakaguchi.2010.RegulatoryTcellsexertchecksandbalances onselftoleranceandautoimmunity. Nat.Immunol. 11:7. 30.Almeida,A.R.,B.Rocha,A.A.Freitas,andC.Tanchot.2005.Homeostasisof Tcellnumbers:fromthymusproductiontoperipheralcompartmentalizationand theindexationofregulatoryTcells. Semin.Immunol. 17:239. 31.Min,B.,R.McHugh,G.D.Sempowski,C.Mackall,G.Foucras,andW.E.Paul. 2003.Neonatessupportlymphopenia-inducedproliferation. Immunity 18:131– 140. 32.Khoruts,A.,andJ.M.Fraser.2005.Acausallinkbetweenlymphopeniaand autoimmunity. Immunol.Lett. 98:23. 33.Oldenhove,G.,N.Bouladoux,E.A.Wohlfert,J.A.Hall,D.Chou,L.Dos Santos,S.O’Brien,R.Blank,E.Lamb,S.Natarajan,etal.2009.Decreaseof Foxp3+Tregcellnumberandacquisitionofeffectorcellphenotypeduringlethal infection. Immunity 31:772. 34.Szente,B.E.,J.M.Soos,andH.W.Johnson.1994.TheC-terminusofIFN gammaissufcientforintracellularfunction. Biochem.Biophys.Res.Commun. 203:164554. 35.Thiam,K.,E.Loing,C.Verwaerde,C.Auriault,andH.Gras-Masse.1999.IFNgamma-derivedlipopeptides:inuenceoflipidmodicationontheconformation andtheabilitytoinduceMHCclassIIexpressiononmurineandhumancells. J. Med.Chem. 42:3732. 36.Larkin,J.,III,A.L.Rankin,C.C.Picca,M.P.Riley,S.A.Jenks,A.J.Sant,and A.J.Caton.2008.CD4+CD25+regulatoryTcellrepertoireformationshapedby differentialpresentationofpeptidesfromaself-antigen. J.Immunol. 180:2149– 2157. 37.Lau,K.,P.Benitez,A.Ardissone,T.D.Wilson,E.L.Collins,G.Lorca,N.Li, D.Sankar,C.Wasserfall,J.Neu,etal.2011.Inhibitionoftype1diabetescorrelatedtoa Lactobacillus johnsoniiN6.2-mediatedTh17bias. J.Immunol. 186: 353846. 38.Rouse,B.T.2007.RegulatoryTcellsinhealthanddisease. J.Intern.Med. 262: 78. 39.Alexander,W.S.,R.Starr,J.E.Fenner,C.L.Scott,E.Handman,N.S.Sprigg, J.E.Corbin,A.L.Cornish,R.Darwiche,C.M.Owczarek,etal.1999.SOCS1is acriticalinhibitorofinterferongammasignalingandpreventsthepotentially fatalneonatalactionsofthiscytokine. Cell 98:597. 40.Picca,C.C.,J.Larkin,III,A.Boesteanu,M.A.Lerman,A.L.Rankin,and A.J.Caton.2006.RoleofTCRspecicityinCD4+CD25+regulatoryT-cell selection. Immunol.Rev. 212:74. 41.Fontenot,J.D.,J.P.Rasmussen,L.M.Williams,J.L.Dooley,A.G.Farr,and A.Y.Rudensky.2005.RegulatoryTcelllineagespecicationbytheforkhead transcriptionfactorfoxp3. Immunity 22:329. 42.Krebs,D.L.,andD.J.Hilton.2001.SOCSproteins:negativeregulatorsof cytokine signaling. StemCells 19:378. 43.Malek,T.R.,A.Yu,L.Zhu,T.Matsutani,D.Adeegbe,andA.L.Bayer.2008. IL-2familyofcytokinesinTregulatorycelldevelopmentandhomeostasis. J. Clin.Immunol. 28:635. 44.Fontenot,J.D.,M.A.Gavin,andA.Y.Rudensky.2003.Foxp3programsthe developmentandfunctionofCD4+CD25+regulatoryTcells. Nat.Immunol. 4: 330. 45.Yoshimura,A.,T.Naka,andM.Kubo.2007.SOCSproteins,cytokinesignalling andimmuneregulation. Nat.Rev.Immunol. 7:454. 46.Lu,L.F.,T.H.Thai,D.P.Calado,A.Chaudhry,M.Kubo,K.Tanaka, G.B.Loeb,H.Lee,A.Yoshimura,K.Rajewsky,andA.Y.Rudensky.2009. Foxp3-dependentmicroRNA155conferscompetitivetnesstoregulatoryTcells bytargetingSOCS1protein. Immunity 30:80. 47.Zhan,Y.,G.M.Davey,K.L.Graham,H.Kiu,N.L.Dudek,T.W.Kay,and A.M.Lew.2009.SOCS1negativelyregulatestheproductionofFoxp3+CD4+ Tcellsinthethymus. Immunol.CellBiol. 87:473. 48.Yamaguchi,T.,andS.Sakaguchi.2006.RegulatoryTcellsinimmunesurveillanceandtreatmentofcancer. Semin.CancerBiol. 16:115. 49.Cozzo,C.,J.Larkin,III,andA.J.Caton.2003.Cuttingedge:self-peptidesdrive theperipheralexpansionofCD4+CD25+regulatoryTcells. J.Immunol. 171: 567882. 50.Sakaguchi,S.,M.Ono,R.Setoguchi,H.Yagi,S.Hori,Z.Fehervari,J.Shimizu, T.Takahashi,andT.Nomura.2006.Foxp3+CD25+CD4+naturalregulatory Tcellsindominantself-toleranceandautoimmunedisease. Immunol.Rev. 212: 8. 51.Setoguchi,R.,S.Hori,T.Takahashi,andS.Sakaguchi.2005.Homeostatic maintenanceofnaturalFoxp3(+)CD25(+)CD4(+)regulatoryTcellsbyinterleukin(IL)-2andinductionofautoimmunediseasebyIL-2neutralization. J. Exp.Med. 201:723. 52.Murakami,M.,A.Sakamoto,J.Bender,J.Kappler,andP.Marrack.2002.CD25+ CD4+TcellscontributetothecontrolofmemoryCD8+Tcells. Proc.Natl. Acad.Sci.USA 99:88327. 53.Horwitz,D.A.,S.G.Zheng,andJ.D.Gray.2008.NaturalandTGF-betainducedFoxp3(+)CD4(+)CD25(+)regulatoryTcellsarenotmirrorimagesof eachother. TrendsImmunol. 29:429. 54.Chong,M.M.,A.L.Cornish,R.Darwiche,E.G.Stanley,J.F.Purton, D.I.Godfrey,D.J.Hilton,R.Starr,W.S.Alexander,andT.W.Kay.2003. Suppressorofcytokinesignaling-1isacriticalregulatorofinterleukin-7dependentCD8+Tcelldifferentiation. Immunity 18:475. 55.Murphy,K.M.,andB.Stockinger.2010.EffectorTcellplasticity:exibilityin thefaceofchangingcircumstances. Nat.Immunol. 11:674.2676 SOCS1CONTRIBUTESTOPERIPHERALTregSTABILITY at University of Florida Health Science Center Lib on July 9, 2014 http://www.jimmunol.org/ Downloaded from