Citation
Characterization of an Anaplasma Mutant Generated by Transposon Mutagenesis

Material Information

Title:
Characterization of an Anaplasma Mutant Generated by Transposon Mutagenesis
Creator:
Crosby, Francy L
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (124 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Veterinary Medical Sciences
Veterinary Medicine
Committee Chair:
BARBET,ANTHONY F
Committee Co-Chair:
DARK,MICHAEL JAMES
Committee Members:
DAME,JOHN B
ABBOTT,JEFFREY R
GULIG,PAUL A
Graduation Date:
5/3/2014

Subjects

Subjects / Keywords:
Anaplasma ( jstor )
Anaplasma marginale ( jstor )
Antibodies ( jstor )
Bacteria ( jstor )
Cattle ( jstor )
Genomes ( jstor )
Infections ( jstor )
Mutagenesis ( jstor )
Ticks ( jstor )
Transposons ( jstor )
Veterinary Medicine -- Dissertations, Academic -- UF
anaplasmosis -- himar1 -- transposition -- transposon
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Veterinary Medical Sciences thesis, Ph.D.

Notes

Abstract:
The large amounts of data generated by genomics, transcriptomics and proteomics have increased our understanding of the biology of Anaplasma marginale. However, these data have also led to new assumptions that require testing, ideally through classic genetic mutation. One example is the definition of genes associated with virulence. This dissertation describes the characterization of a red fluorescent and spectinomycin and streptomycin resistant A. marginale mutant generated by Himar1 transposon mutagenesis. Characterization at the molecular level as shown here using high throughput genome sequencing to determine the Himar1-A.marginale genome junctions established that the transposon sequences were integrated within the coding region of the omp10 gene. This gene is arranged within an operon with AM1225 at the 5 end and with omp9, omp8, omp7 and omp6 arranged in tandem at the 3 end. RNA analysis to determine the effects of the transposon insertion on the expression of omp10 and downstream genes revealed that the Himar1 insertion not only reduced the expression of omp10 but also that of downstream genes. Transcript expression from omp9, and omp8 dropped by more than 90% in comparison with their counterparts in wild-type A. marginale. Immunoblot analysis showed a reduction in the production of Omp9 protein in these mutants compared to wild-type A.marginale. Transposon insertion within the omp10 and alteration of its expression and that of downstream genes did not affected the growth of these omp10 mutants in vitro in tick and endothelial cell culture. However these organisms were unable to infect immunocompetent cattle red blood cells in vivo. This work reports for the first time the method to promote transposon mutagenesis in Anaplasma marginale and a detailed characterization of the first Anaplasma marginale transformants obtained by this method. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: BARBET,ANTHONY F.
Local:
Co-adviser: DARK,MICHAEL JAMES.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2014-11-30
Statement of Responsibility:
by Francy L Crosby.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
11/30/2014
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EML3C850C_2ZICOV INGEST_TIME 2014-10-03T21:52:57Z PACKAGE UFE0046612_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

CHARACTERIZATION OF AN ANAPLASMA MU T ANT G E NERATED BY TRANSPOSON MUTAGENESIS By FRANCY LILIANA CROSBY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2014 Francy Liliana Crosby

PAGE 3

3 ACKNOWLEDGMENTS I would like to express my deepest appreciation to my committee chair Dr. Anthony Barbet for being an extraordinary mentor. His patience enthusiastic spirit, research integrity and thoroughness inspired me to go through this journey with the idea of somed ay follow ing his steps. In a similar way, I want to thank Dr. Ulrike Munderloh for her collaboration and generosity. This dissertation owes much to her Her outstanding work and vast knowledge of the subject were instrumental for this work I am also grate ful to all members of my PhD advisory committee: Dr. John Dame, Dr. Paul G u lig, Dr. Jeffrey Abbot and Dr. Michael Dark. Their knowledge, suggestions, comments and insightful discussions about research contributed to this work and to my development as a sci entist. I will be forever thankful to Anna Lundgren for her collaboration, advice, technical support and friendship which were very important during these years. I want to thank to all my friends and family, especially my parents for giving the best educat ion the greatest example of work ethics and support ing me in every endeavor To my sister that despite the distance, her cheerful spirit kept me smiling even during hard times. Finally, but not least I would like to thank my husband Joseph Crosby, his en couragement, patience and love were the rock that support ed me during these years.

PAGE 4

4 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 3 LIST OF TABLES ................................ ................................ ................................ ........................... 6 LIST OF FIGURES ................................ ................................ ................................ ......................... 7 ABSTRACT ................................ ................................ ................................ ................................ ..... 8 CHAPTER 1 BACKGROUND AND SIGNIFICANCE ................................ ................................ .............. 10 Anaplasma m arginale as a Significant Pathogen ................................ ................................ ... 10 Transmission and Pathology ................................ ................................ ................................ ... 11 Ge nome Characteristics ................................ ................................ ................................ .......... 13 Antigenic Variation ................................ ................................ ................................ ................ 18 Superinfection ................................ ................................ ................................ ......................... 21 Methods of Diagnos i s and Vaccines ................................ ................................ ....................... 22 Genetic Tools ................................ ................................ ................................ .......................... 24 Allelic Exchange or Gene Replacement by Homologous Recombination ...................... 24 Rickettsia spp ................................ ................................ ................................ ........... 25 Anaplasma sp p. ................................ ................................ ................................ ........ 26 Transposon Mutagenesis ................................ ................................ ................................ 27 Rickettsia spp. ................................ ................................ ................................ ........... 28 Anaplasma spp ................................ ................................ ................................ ........ 30 Ehrlichia spp ................................ ................................ ................................ ........... 31 Plasmids ................................ ................................ ................................ ........................... 31 Central Hypothesis ................................ ................................ ................................ .................. 33 2 KNOCKOUT OF AN OUTER MEMBRANE PROTEIN OPERON OF ANAPLASMA MARGINALE BY TRANSPOSON MUTAGENESIS ................................ ........................... 36 Introduction ................................ ................................ ................................ ............................. 36 Materials and Methods ................................ ................................ ................................ ........... 38 Cultivation of Anaplasma m arginale ................................ ................................ .............. 38 Isolation of the A naplasma m arginale Mutant by Transposon Mutagenesis .................. 39 Preparation of Host Cell free Anaplasma m arginale Wild Type and o mp10 ::himar1 Mutant from ISE6 Tick Cells ................................ ............................. 40 DNA Isolation and Phi29 Amplification of the Anaplasma m arginale Mutant .............. 41 Genome Sequencing and Bioinformatics ................................ ................................ ........ 41 RNA Isolation ................................ ................................ ................................ .................. 42 RT PCR and RT qPCR Experiments ................................ ................................ .............. 43 RT qPCR Experiments ................................ ................................ ................................ .... 43

PAGE 5

5 qPCR amplification efficiencies ................................ ................................ ............... 44 Relative efficiency plots ................................ ................................ ........................... 45 Western Immunoblots ................................ ................................ ................................ ..... 45 Results ................................ ................................ ................................ ................................ ..... 46 Transformation of Anaplasma m arginale by Transposon Mutagenesis .......................... 46 Mapping of Transposon Insertion within the Anaplasma m arginale Chromosome ....... 47 Evidence for Expression of o mp10 as Part of an Opero n ................................ ................ 49 RNA Transcript Analysis ................................ ................................ ................................ 50 Western Immunoblot Analysis ................................ ................................ ........................ 52 Discussion ................................ ................................ ................................ ............................... 52 3 PHENOTYPICAL CHARACTERIZATION OF AN OUTER MEMBRANE PROTEIN KNOCKOUT GENERATED BY TRANSPOSON MUTAGENESIS ................................ .. 75 Introduction ................................ ................................ ................................ ............................. 75 Materials and Methods ................................ ................................ ................................ ........... 77 Cell L ines and Anaplasma m arginale Cultivation ................................ .......................... 77 Western Immunoblots ................................ ................................ ................................ ..... 77 Immuno Transmission Electron Microscopy ................................ ................................ .. 78 Anaplasma marginale Wild Type and o mp10 ::himar1 Mutant Growth Curves ............ 78 DNA Extraction and qPCR ................................ ................................ ............................. 79 Insert Stability ................................ ................................ ................................ ................. 80 Infection of Endothelial RF/6A cells with Anaplasma m arginale o mp10 ::himar1 Mutant ................................ ................................ ................................ .......................... 81 Infection of Cattle with Anaplasma m arginale o mp10 ::himar1 Mutant ......................... 82 Results ................................ ................................ ................................ ................................ ..... 83 Electron Microscopy of Anaplasma m arginale o mp10 ::himar1 Mutant ........................ 83 Growth Curves of Anaplasma m arginale o mp10 ::himar1 vs. Wild Type ...................... 85 Insert Stability ................................ ................................ ................................ ................. 85 Infectivity of o mp10 ::himar1 Anaplasma m arginale to Mammalian Cells In Vitro and In Vivo ................................ ................................ ................................ ................... 86 Discussion ................................ ................................ ................................ ............................... 88 4 CONCLUSIONS AND FUTURE RESEARCH ................................ ................................ .. 106 LIST OF REFERENCES ................................ ................................ ................................ ............. 110 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 124

PAGE 6

6 LIST OF TABLES Table page 2 1 PCR and Taqman qPCR oligonucleotides used in this study ................................ ............ 57 2 2 PCR conditions for the amplification of transcripts from omp7 through AM1225 intergenic regions ................................ ................................ ................................ ............... 58 2 3 PCR conditions for the amplification of transcripts from omp6 through omp10 from cDNA obtained from ISE6 cells infected with A. marginale wild type and omp10::himar1 mutant organisms ................................ ................................ ..................... 59 2 4 qPCR reactions and amplification conditions ................................ ................................ .... 60 2 5 qPCR amplification efficiencies ................................ ................................ ........................ 61 2 6 Relative amplification efficiencies ................................ ................................ .................... 62 3 1 Taqman qPCR oligonucleotides used in this study ................................ ............................ 91 3 2 aadA copies/ A. marginale omp10::himar1 genome equivalents ................................ ....... 92

PAGE 7

7 LIST OF FIGURES Figure page 2 1 Specificity of primers and probes in RT qPCR reactions ................................ .................. 63 2 2 Transformation of Anaplasma marginale ................................ ................................ ......... 64 2 3 Mapping of Himar1 transposon insertion site ................................ ................................ ... 65 2 4 Himar1 transposon insertion site in the A. marginale str. Virginia genome ..................... 67 2 5 Characterization of Himar1 transposon insertion site ................................ ...................... 69 2 6 Intergenic regions of o mp7 to AM1125 analyzed by RT PCR ................................ ......... 70 2 7 Transcriptional analysis of the effect of the insertion of the Him ar1 transposon within the omp10 gene by RT PCR. ................................ ................................ .................. 71 2 8 Relative gene expression determined by RT qPCR. ................................ .......................... 72 2 9 Immunoblotting of omp10::himar1 mutant and wild type Anaplasma marginale using the specific monoclonal antibody against Omp9 ................................ ..................... 74 3 1 Immunoblotting of host cell free omp10::himar1 mutant and wild type A. marginale using the specific antibody R883 ................................ ................................ ....................... 93 3 2 Transmission electron microscopy of A. marginale omp10::himar1 mutant .................... 94 3 3 Transmission electron microscopy of A. marginale omp10::himar1 mutant immunogold labeled with a polyclonal anti Msp2 antibody R883.. ................................ .. 95 3 4 Growth curves for A. marginale wild type and omp10::himar1 in infected ISE6 tick cells. ................................ ................................ ................................ ................................ ... 98 3 5 Infection of RF/6A endothelial cells with A. marginale omp10:: h imar1 mutant.. ............ 99 3 6 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant growing in media supplemented with antibiotic treatment ................................ 100 3 7 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant growing in media without antibiotic treatment. ................................ ................... 102 3 8 Infection of RF/6A endothelial cells with Anaplasma marginale wild type. .................. 104

PAGE 8

8 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF AN ANAPLASMA MU TA NT G E NE RATED BY TRANSPOSON MUTAGENESIS By Francy L. Crosby May 2 014 Chair: Anthony F. Barbet Major: Veterinary Medical Sciences The large amounts of data generated by genomics, transcriptomics and proteomics have increased our understanding of the biology of Anaplasma marginale However, these data have also led to new assumptions that require testing, ideally through classic genetic mutation. One example is the definition of genes associated with virulence. This dissertation describes the characterization of a red fluorescent a nd spectinomycin and streptomycin resistant A. marginale mutant generated by Himar1 transposon mutagenesis. Characterization at the molecular level as shown here using h igh throughput genome sequencing to determine the Himar1 A.marginale genome junctions established that the transposon sequences were integrated within the coding region of the omp10 gene. This gene is arranged within an operon with AM1225 omp9 omp8 omp7 and omp6 rmine the effects of the transposon insertion on the expression of omp10 and downstream genes revealed that the Himar1 insertion not only reduced the expression of omp10 but also that of downstream genes. Transcript expression from omp9 and omp8 dropped b y more than 90% in comparison with their

PAGE 9

9 counterparts in wild type A. marginale Immunoblot analysis showed a reduction in the production of Omp9 protein in these mutants compared to wild type A.marginale Transposon insertion within omp10 and alteration of its expression and that of downstream genes did not affect the growth of these omp10 mutants in vitro in tick and endothelial cell culture. However these organisms were unable to infect immunocompetent cattle red blood cells in vivo Thi s work reports for the first time a method to promote transposon mutagenesis in Anaplasma marginale and a detailed characterization of the first Anaplasma marginale transformants obtained by this method.

PAGE 10

10 CHAPTER 1 BACKGROUND AND SIGNIFICANCE Anaplasm a m arginale as a Significant Pathogen The order Rickettsiales are a group of obligate intracellular bacteria that includes some of the most notable pathogens in the history of infectious diseases, such as epidemic typhus caused by Rickettsia prowazekii which became one of the biggest plagues to afflict the human race. In 2001 16S rRNA and groESL sequence and antigenic analysis resulted in the re organization of members of this order into the Rickettsiaceae and Anaplasmataceae families, both containing pathogenic species ( 1 2 ) For example, recognized pathogens in the Rickettsiaceae family are the Rickettsia spotted fever group (SFG), the thyphus group Rickettsia (TGR) and Orientia tsutsugamushi ( 2 4 ) Alternatively, pathogenic member s of the Anaplasmataceae family are Ehrlichia canis Ehlichia chaffeensis Ehlichia muris Ehlichia ruminantium Neorickettsia helmithoeca Neorickettsia sennetsu Neorickettsia risticii Anaplasma platys Anaplasma bovis Anaplasma phagocytophilum and Ana plasma marginale ( 1 2 5 8 ) Anaplasma marginale the focus of this study, is the etiologic agent of anaplasmosis in cattle and other ruminants ( 6 9 11 ) This bacterium was the first ri ckettsial pathogen to be identified ( 9 10 12 ) A. margi nale smears as marginal points that correspond to early stages of the infection of erythrocytes with the parasite Babesia bigemina during the course of Redwater disease in cattle ( 6 9 12 ) Careful epidemiological, clinical and pathohistological studi es allowed Theiler to separate both agents and produce pure infections with A. marginale After this investigation, anaplasmosis was recognized in tropical and subtropical areas throughout the world. In the United States this

PAGE 11

11 disease is found throughout th e country. It is also found in Central and South America, the Caribbean islands, Mediterranean countries, in Europe and regions in Africa and Asia ( 9 10 ) Bovine anaplasmosis causes important economic loss in most countries, mainly due to the high morbidity and mortality in susceptible cattle herds. Current annual losses in be ef cattle in the United States as a result of anaplasmosis morbidity and mortality are estimated to be over $300 million per year, whereas in Latin America those losses were calculated to be approximately $800 million. More recently, it was reported that b ovine anaplasmosis and babesiosis were responsible for causing an economic loss of $875 million in Latin American nations ( 9 13 ) Transmission and Pathology Biological transmission of A. marginale to cattle is attributed to Derma centor spp and Riphicephalous spp. ticks, although approximately 20 species of ticks have been incriminated as vectors of this bacterium around the world ( 8 14 ) This pathogen can be transmitted mechanically by blood contaminated fomites or mouthparts of biting flies ( 15 16 ) In the tick, transmission occurs from stage to stage or transstadial transmission, from larvae to nymph and from nymph to adult and by adult male ticks transferred from infected to susceptibl e hosts ( 10 17 ) Extensive work has described the different morphological stages of A. marginale d uring its developmental cycle in the tick, beginning when the erythrocytic stage invades the midgut epithelial cells during tick feeding ( 15 18 ) This is followed by infection of other tick tissues and ends with the development of the infective stage in the salivary glands from wh ere A. marginale is transmitted to cattle ( 18 ) Electron microscopy studies of tick tissues in experimentally infected ticks and cultured tick cells have described the invasion, development and release of A. marginale from those cells ( 18 19 ) For instance, these organisms enter their host cells by an

PAGE 12

12 endocytic process and grow within membrane bound vacuoles throu ghout development. Within this cell structure A. marginale forms a reticulated or vegetative form that multiplies by binary fission, producing large colonies of bacteria known as morulae. Soon after, these reticulated forms of Anaplasma subsequently transf orm into the dense forms presume d to be the infective form released from the cell for further infection cycles ( 19 ) Mature erythrocytes are the only known mammalian host cell of A. marginale ( 20 ) In these cells the organisms grow within membrane bound inclusions known as initial bodies and which may contain from 4 to 8 organisms ( 13 ) Similar reticulated and dense forms of this pathogen described during the tick stag e are found in erythrocytes. Throughout the course of infection in cattle, anaplasmosis can be divided into four stages: incubation, development, convalescent and carrier stages ( 13 21 ) During the incubation or pre patent stage A. marginale replicate and the number of infected erythrocytes increases geometrically ( 10 13 21 ) This stage may last from 7 to 60 days, with an average of 28 days, and its length is related to the infec tious dose inoculated. There are reports that as many as 70% of the erythrocytes may be infected during the acute infection. When higher numbers of Anaplasma have established (~10 9 resulting in the developmental stage that lasts from 4 to 9 days. During this period the clinical signs of this disease are expressed since infected erythrocytes are phagocytized and removed from circulation by reticuloendothelial cells and severe anemia occurs. Other clinical signs include fever, weight loss, abortion, lethargy, icterus, rapid decrease of milk production and in some cases death, especially in animals over 3 years old ( 16 21 22 ) Cattle that survive acute infection during the developmental stage will slowly recover over a period o f 2 or 3 months. This is known as the convalescent stage and is mainly

PAGE 13

13 characterized by erythropoiesis. Cattle that recover remain carriers or reservoirs of this pathogen for the rest of their life and can continue to transmit ( 21 23 26 ) This stage is mainly characterized by cycles of low levels of bacteremia that may fluctuate between 10 2 and 10 6 bacteria/ m L Persistently infected cattle have lifelong immunity and upon challenge, do not normally develop clinical signs of disease ( 9 ) Erythrocyte turnover is approximately 130 days ( 27 ) but together with long pre patent periods and lifelong persistence of A. marginale in cattle, it has been proposed that some other location could ser ve as a focus of infection for this pathogen. Some suggest that this organism can be transferred between terminally differentiated erythrocytes, or since these organisms are phagocytized by reticuloendothelial cells, they could shuttle from erythrocytes in to extravascular cells ( 9 18 27 30 ) Some wo rk has favored these suggestions, however conclusive identification of A. marginale within these cells has not been demonstrated, so currently a complete description of the life cycle of A. marginale in mammalian cells is unknown ( 27 31 32 ) Genome Characteristics Until now the A. marginale strains sequenced are the tick transmissible St Maries, South Idaho, Virginia and Puerto Rico, and the non tick transmissible strains Florida and Mississippi. However just the genome sequences of St Maries and Florida are fully assembled and annotated ( 33 35 ) A. marginale str St Maries and str Florida are composed of 1,197,687bp and 1,202,435bp respectively, while both have a 49.86% GC content ( 33 34 ) Although their small genome size is common to obligate intracellular bacteria due to reductive evolution ( 33 34 36 38 ) their GC content is unusually high, especially wh en other related obligate intracellular bacteria such as E. ruminantium E. chaffeensis Wolbachia and Rickettsia average 30.47% ( 5 ) Both genomes contain a single ribosomal RNA operon and 37 transfer RNAs that represent all of

PAGE 14

14 the 20 amino acids. Rho transcription terminator, normally a single copy, is duplicated in these two geno mes and in all the Anaplasma and Ehrlichia genomes sequenced to date ( 5 33 34 ) Although both genomes have a coding density of 86%, A. marginale str St Maries contains 949 predicted protein encoding genes while the str Florida contains 942. It is suggested that this nnotation ( 34 ) For example mutL murC aatA and aspS have interrupted coding sequences in the A. marginale str. St Maries but are intact in A. marginale str Florida. Similarly genes that are intact in the st r St Maries are fused or ( 33 34 ) This also suggests that these few interrupted coding sequences in these genomes and which are ( 3 4 37 ) Nevertheless A. marginale has less pseudogenes than other intracellular bac teria such as Rickettsia and Mycoplasma ( 33 39 ) In contrast to classical pseudogenes, A. marginale contains functional pseudogenes of the highly immunodom inant and antigenically variable Msp2 and Msp3 proteins. These are truncated copies of msp2 and msp3 genes that are only expressed as part of functional full length proteins after recombination of these copies into the expression site allowing the switchi ng of different expressed variants of Msp2 and Msp3 surface proteins ( 6 13 25 33 34 40 44 ) A. marginale str St Maries carries seven msp2 functional pseudogenes copies, while A. marginale str. Florida carries eight, however 4 are identical to the str St Maries. Both strains have 7 copies of the pseudogene msp3 copies with two shared between the two strains ( 33 34 ) Sequencing of A. marginale also revealed that surface proteins of these bacteria include two immunodomina nt families, the msp2 superfamily and the msp1 superfamily. The msp 2 superfamily is formed by Msp2, Msp3, Msp4, Opag1, Opag2, Opag3 and outer membrane

PAGE 15

15 proteins OMP 1 thr o u gh 15, all these are members of the pfam 01617 family of surface expressed antigens ( 22 33 45 48 ) Both Msp2 and Msp3 are expressed as part of operons: msp2 is located at the 3 end of an operon of four genes, with the operon associated genes opag 1, 2 and 3 at the 5 end ( 41 ) The msp3 gene is expressed from an operon of three genes, with the orfX and orfY genes at the 5 end ( 47 ) These orfX and orfY are not members of the pfam01617 superfamily and recently have been designated as homologs of virB2 genes of the Type 4 secretion system ( orfX has 12 copies and orfY has 7 copies) ( 49 50 ) The msp1 superfamily is formed by a dimer of structurally unrelated polypeptides formed by the Msp1a and Msp1b proteins. Msp1a is expressed from the gene which is used as a genotypic m arker of A. marginale strains, since it contain tandem repeats of 85 to 89bp at the 5 end that vary in sequence and number between strains ( 51 53 ) Msp1b is encoded by a small multige ne family of 5 short genes ( 52 53 ) Msp1a and Msp1b facilitate adherence to bovine and tick cells, however MSP1a was found to bind tick cells suggesting that this protein was important in transmission ( 54 56 ) Studies showed that A. marginale subspecies centrale lack the repeat region that apparently is required for tick cell bindin g and yet invades and replicates in Dermacentor andersoni midgut and salivary glands, showing that this region is not necessarily required for binding ( 57 59 ) On the other hand A. marginale str. Mississipi known as non tick transmissible carries a MSP1a tandem repeat indistinguishable from a transmissible strain bu t fails to colonize Dermacentor andersoni midguts and consequently it is not transmitted ( 58 ) Genome sequencing also allowed the definition of genes with important predicted metabolic functions. All the genes required for the synthesis of lipid A are missing in A. marginale precluding its ability to synthesize LPS, while a putative exporter for lip id A ( msbA2 ) was found ( 33 )

PAGE 16

16 Although a com plete pathway for peptidoglycan biosynthesis is missing, all the genes for diaminopimelic acid (DAP) synthesis are present. This is similar to genes required for the synthesis of murein such as ddlB glmU mraYI murA B C (split ORF), D E F and G and the presence as well, of the slt gene, the product of which is required to remove peptidoglycan units from the murein layer for either recycling or shedding from the cell wall. All of this suggests that A. marginale may synthesize a modified form of peptidoglycan ( 33 38 ) Common to Rickettsiales genomes, A. marginale does not have complete pathways for the synthesis of the m ajority of essential amino acids, and only nine genes encoding enzymes for the terminal pathways for the synthesis of serine, glycine, tyrosine, cysteine, phenylalanine, aspartate, glutamate and glutamine were identified. This implies that these organisms must import the majority of amino acids from the host, but only a proline transporter was identified and a putative assignment was made for a n alanine transporter ( 33 38 ) A. marginale does not have the ability to convert glucose to pyruvate since genes encoding for any sugar transport system and the genes encoding enzymes for either the Embdem Meyerhof Parnas or Entner Doudoroff pathways are missing. However the genes encoding enzymes for the nonoxidative pentose phosphate pathway and most of the enzymes required in gluconeogenesis were identified. Therefore the presence of these pathways in A. marginale suggests that their main function is to supply this pathogen with precursors for the synthesis of glycerol lipids and nucleotides in the absence of glycolysis. All the enzymes for the tricarboxilic acid (TCA) pathway are present ( 38 ) Transporter prediction analysis defined fifty six genes to encod e proteins that form transporters. A. marginale contains 11 ATP dependent transporters. Several transport systems for cations, anions, oligonucleotides, phosphate and ribonucleotides were identified. The S ec

PAGE 17

17 pathway of protein secretion is complete, and tatB and tatC are the only genes predicted to encode proteins for the T at transport system. Genes encoding proteins for type II, III, V and VI secretion systems are missing but similar to all the Rickettsiales sequenced to date, A. marginale encodes genes for the Type IV secretion system ( 6 33 38 ) The prototype of the T ype IV S ecretion S ystem (T4SS) of A. margin ale is Agrobacterium tumefaciens ( 6 33 50 ) In A. tumefaciens the genes encoding the components of this system are arranged in a single operon and the VirB/D T4SS comprises 12 proteins, named VirB1 to VirB11 and VirD4 that combine to form a transmembrane channel ( 60 ) In A. marginale the VirB/D genes are distributed i nto two clusters, with sodB virB3 virB4 and virB6 followed by three virB6 like proteins, while the second operon contains virB8 virB9 virB10 virB11 and virD4 ( 6 33 ) A similar arrangement is found in Rickettsiales with the exception of A. phagocytophilum and E. chaffeensis in wh ich the virB/D system is formed by 5 groups: sodB virB3 virB4 virB6 1 thr o u gh 4 ; virB8 1 virB9 1 virB10 virB11 virD4 ; virB2 1 thr o u gh 8 virB4 2 (in A. phagocytophilum ) or virB2 1 thr o u gh 4 virB4 2 (in E. chaffeensis ); virB8 2 and virB9 2 Additionally A. marginale has 12 copies of orfX and 7 copies of orfY which have been defined as paralogs of virB2 ( 61 ) Interestingly A. marginale T4SS proteins such as VirB2, VirB4, VirB7, VirB9 1, VirB9 2, VirB10 and VirB11 are immunogenic in infected or immunized animals ( 49 ) Recently the transcriptome of erythrocyte sta ge A. marginale str. St Maries and Florida was elucidated using RNA deep sequencing showing that six previously unannotated genes were transcriptionally active. Similarly, transcription start sites and 70 operon structures that involved 292 genes were def ined, showing that at least 30% of A. marginale genes are polycistronic ( 62 ) Comparison of multiple genomes of different strains of a bacterial species is useful to determine interstrain diversity and in this manner define the whole genome repertoire or pan

PAGE 18

18 g enome, which is made up of the core and dispensable genomes. The core genome is the collection of genes that are common to all the strains and which confer s the main characteristic traits and are essential for the biology of that bacterial species. The dis pensable or accessory genome are those genes that are not present in all the strains of a bacterial species but are important because they may give a particular advantage over the other strains, such as antibiotic resistance, colonization of a new host, et c ( 63 64 ) This is particularly important for pathogenic bacter ial species because a better understanding of their diversity may aid in the identification of particular genes that could be associated with virulence traits and which could be targets for drug therapies, or even help with the development of methods for c ontrol and production of vaccines ( 62 64 ) Accordingly, whole genome sequences of five A. marginale strains: Florida, Mississippi, St Maries, Virginia and Puerto Rico were used for global comparison to determine in terstrain diversity. This work showed that there was a high interstrain diversity at the nucleotide level as ( 34 62 ) For instance, relative s train and up to 6000 sites with wise comparisons between all the strains. However, major gene changes were not found showing that there is a high degree of conservation between A. marginale strains at this level. Therefore the authors of this work suggested that in A. marginale species what contributes to their diversity are changes at the nucleotide level or small polymorphisms, rather that major rearrangements in their genomes such as gene deletions or insertions. Consequently A. marginale has a closed core genome with a SNP profile moderately open ( 34 62 ) Antigenic Variation Just as vertebrates have developed different mechanisms of defense against pathogens, so pathogens have evolved ways to overcome these defenses. Antigenic variation is one way in

PAGE 19

19 which infectious agents can evade surveillance by the immune system ( 65 ) In persistence mediated by antigenic variation, A. marginale switches exposed variant specific antigens in a small number of bacter ia of the total population before the immune system mounts a predominant response against the specific variants and kill the entire population. Hence, those variants will survive and persist. It is known that new variants arise throughout acute and persist ent anaplasmosis, and that the antibody present at a given time point will not recognize variants found at later time point ( 25 66 67 ) By using this mechanism A. marginale not only guarantees its survival but also its transmission and continued propagation ( 23 68 ) Extensive and important work has demonstrated that the persisten ce of A. marginale within an immunocompetent host is achieved by the expression of multigene families which share structural features, and which encode polymorphic immunodominant and antigenically variable outer membrane proteins Msp2 and Msp3 ( 25 26 43 47 66 69 70 ) These proteins are characterized by a hyperv ariable region (HVR) flanked by a highly conserved N termini and C termini and which are different in size (Msp2 is 36KDa and Msp3 is 80 90KDa) and in sequence composition (30 40% identity). Despite these differences these two protei ns share 138 identical amino acids at the C termini and short amino acid stretches at the N termini ( 26 47 ) Msp2 HVR varies from 60 to 70 amino acids in length and is arranged in three regions known as block 1 to 3. A given strain may contain a few variants each with one of five amino acid triplets at the beginning of the block 1 region and which are KAV, NAV, NAI, TTV or TTI. Immunological studies showed that this block 1 region contains CD4 + T cell epitopes, and that switching of one triplet will provide immune scape ( 33 71 ) Msp2 and Msp3 variants are generated by a unidirectional gene conversion mechanism involving msp2 and msp3 functional pseudogenes or dono r alleles. These are transcriptionally

PAGE 20

20 silent and recombine into their respective expression site. The structure of these pseudogenes involves a HVR flanked by 5 and 3 conserved regions, which are identical to those in the expression site. Also recombin ation of segments or oligonucleotides from the HVR of the msp2 and msp3 pseudogenes create s unique mosaics in the expression site HVR ( 26 40 42 44 47 67 ) An interesting study that analyzed thousands of variants over the course of infection determined that there are diff This model explains that there is a first recombination event in which the complete HVR from a pseudogene is recombined within the expression site with both recombination sites occurring in the conserved flanking regions. Then a second event occurs when a segment of the HVR from another pseudogene recombines within the HVR of the expression site, without requirement for sequence identity, resulting in mosaic expression sites that serve as the tem plate for additional segmental gene conversion events. So early acute anaplasmosis is composed primarily of simple variants derived from recombination of a single pseudogene into the expression site, while the mosaic variants derived from multiple segmenta l recombination events from different genes emerge during the persistent phase of A. marginale ( 67 68 ) Presence of complex variants are due to immune system selection pressure, as shown in a study in which Dermacentor andersoni adult males were allowed to feed on a persistent ly infected calf and then fed on nave calves. Analysis of msp2 variants in the infected calves during acute anaplasmosi s and from the tick salivary glands demonstrated that the predominant variants were those derived from recombination of whole pseudogenes into the expression site. Consequently the msp2 mosaics of complex variants have a selective advantage only in the

PAGE 21

21 presence of adaptative immunity and are rapidly replace d by simple variants following transmission ( 68 72 ) Superinfection Diversity of alleles involved in antigenic variation is not only important for evasion in an but also has an important role during herd immunity. Studies to determine the strain composition of a herd within a region where A. marginale is endemic using the gene for strain typing, found that despite the prevalence and transmission of genotypic ally distinct strains within the population, the majority of individuals in the herd were infected with one strain. However very few were infected with more than one strain (superinfected animals) with very distinct genotypes. This finding brought up the question whether strains with different genotypes also have a different msp2 pseudogene repertoire. To determine this, the msp2 pseudogene repertoire in strains with identical, similar and very different genotypes were analyzed. Results s how that strains with identical or similar genotypes shared identical msp2 pseudogene repertoire, whereas those that had a different genotype had a different msp2 pseudogene repertoire, and strains in superinfected animals encompassed a differe nt msp2 pseudogene repertoire ( 73 74 ) Futse and colleagues ( 74 ) examined the requirements of the minimal msp2 pseudogene repertoire for superinfectio n in A. marginale establish persistent infection in calves. After persistent infection was confirmed, calves were challenged by tick transmission with one of the other strains. Data analysis shows that the e xistence of a single unique msp2 pseudogene was enough for superinfection to be established in the presence of a strong immune response to the initial infecting strain.

PAGE 22

22 Methods of Diagnos i s and Vaccines Diagnosis of acute anaplasmosis is based on clinical signs and Giemsa or Diff Q uick stained blood smears. During this phase visualization of A. marginale at the periphery of erythrocytes is facilitated because rickettsemia doubles approximately every 24 hours for 10 to 14 days with 10 6 infected erythrocytes / ml of blood. However in chronically infected or carrier cattle the rickettsemia levels are undetectable by this method ( 9 13 24 ) Detection of persistently infected animals can be accomplished via detection of A. marginale specific antibodies or by the detection of DNA in blood. Several serological tests are available to detect infections in carrier animals. A card agglutination test (CAT) and complement fixation (CF) were among the first tests to be used to detect persistently infected cattle and were common for interstate or international shipment. However these tests are not very reliable since CAT has low specificity while CF test has low and variable sensitivity (20%) ( 75 ) Other serological tests are a competitive enzyme linked immunosorbent serologic assay (cELISA), dot ELISA, and indirect fluorescent antibody ( 25 76 ) C ELISA uses a recombinant antigen termed rMSP5 and MSP5 specific monoclonal antibody (MAb) ANAF16C1 that recognizes the A. marginale major surface protein 5 (MSP5) and has been validated using true negatives and true positives specified by nested polyme rase chain reaction (nPCR). This test is actually recommended for anaplasmosis diagnosis by the USDA and has a sensitivity of 96% and specificity of 95% for diagnosis of this disease relative to nPCR ( 77 ) However there are reports of cross reactivity with A. phagocytophilum and Ehrichial spp in naturally and experimentally infected cattle ( 78 79 )

PAGE 23

23 DNA based diagnostic methods have been also developed to identify A. marginale infections and include DNA and RNA probes ( 80 ) nPCR and real time PCR targeting one o r several genes ( 81 83 ) Due to cross r eactivity with the serological tests, both serological and DNA based methods become useful for anaplasmosis diagnosis in animals that are susceptible to A. marginale and A. phagocytophilum and regions in which both organisms might be present. Work on the development of a preventive vaccine against this disease began in the early A. marginale subsp. centrale in 1911 ( 12 13 ) This less virulent strain originated f rom South Africa and is used for immunization of cattle in Africa, Australia, South America and the Middle East It remains the most widely used and practical vaccine against bovine anaplasmosis ( 13 ) This vaccine is not approved in the United Stat es because of the risk of transmitting contaminant blood borne pathogens that will infect cattle since i mmunization involves infection of a susceptible splecnectomized calf and the use of its blood as a vaccine ( 9 ) Recently, comparative genomic studies demonstrate d that the proteins that are conserved in US strains were not conserved in A. marginale subsp. centrale ( 35 57 ) Different vaccination methods have been developed for the control of bovine anaplasmosis range from attenuated live or killed organisms, to DNA and recombinant protein vaccines ( 13 ) But A. marginale derived from cell culture, killed organisms and DNA vaccines induce only partial protection ( 55 84 ) Immunization trials using outer membrane proteins or a complex of linked or unlinked outer membrane proteins of A. marginale derived from erythrocytes have demonstrated good protection against high bacteremia, anemia a nd homologous strain challenge ( 49 85 88 ) However, to promote long lasting protection, several

PAGE 24

24 immunization boosts may be required and in addition to this, produc tion and purification of these components is time consuming and expensive. Genetic Tools Paradoxically one way to understand the function of a gene is by knowing what happens to the organism when it lacks or has an altered form of that gene. The use of ge netic tools such as gene targeting by homologous recombination, transposon mutagenesis to create gene inactivation or alterations may result in the interruption of a cellular process that will provide information use of these genetic tools in pathogenic organisms not only provides information about the role that a gene plays in virulence or pathogenesis but also for the development of attenuated organisms that can be used in vaccination trials ( 89 91 ) In contrast to facultative pathogenic bacteria, characterization of virulence determinants in Rickettsiales by genetic transformation is still difficult, especially because of its obligate intracellular biology. For this reason their viability outside of t he host may be limited, requiring rapid transfection experiments to maintain a high number of viable and competent organisms to infect host cells. However some advances for the development of genetic tools of these organisms have been made during the past 15 years and are reviewed below. Allelic Exchange or Gene Replacement by Homologous Recombination Allelic exchange enables the production of mutants practically in any desired gene by integrating construct sequences into a homologous site of a target gene and interrupting its normal structure ( 92 ) This strategy has been widely used for directed mutagenesis of several type allele is replaced with an introduced l of a replication defective or host specific plasmid bearing DNA sequences identical to the normal allele flanking an antibiotic resistant gene or selectable marker is performed. Since the plasmid cannot replicate, maintenance

PAGE 25

25 of the antibiotic resistance gene under selectable pressure requires homologous recombination of both pairs of identical sequences (double cross over) to mediate the exchange of the normal gene for the alternative one I n this case the selectable marker that confers antibiotic resist ance enables one to specifically select and isolate the desired recombinant bacteria. One problem with this mechanism is that the frequency of double cross over events in the same cell is very low ( 93 94 ) I t is more likely that the entire plasmid may be integr ated by a single cross over event resulting in the formation of merodiploids ( 95 98 ) This type of recombination is leaky, if a second homologous recombination event occurs at the same region the organisms revert to th e wild type or normal allele. If it occurs at another region of homology, the alternative allele will remain stable. Isolating recombinant organisms containing the mutated allele from a two step homologous recombination can be done by adding a counterselec table marker to the plasmid backbone. Hence the transformants carrying the entire plasmid result of a single cross over event can therefore be eliminated in the presence of the expressed counterselectable compound. But it should be noted that finding an ap propriate counterselectable marker is complex ( 93 ) Transformation by homologous recombination has been described for several pathogenic bacteria such as Francisella tularensis subsp. t ularensis Listeria monocytogenes Mycoplasma pneumonia Mycoplasma genitalium Borrelia bur g do r feri Brucella abortu s Chlamydia psittaci ( 99 106 ) Until now there are very few mutant species of the order Rickettsiales generated by homologous recombination. Rickettsia spp Ratchek et al ( 107 108 ) described the transformation of Rickettsia prowazekii str Madrid. Th e construct developed to promote homologous recombination contained a gene carrying a single base pair mutation that conferred rifampim resistance and was isolated from

PAGE 26

26 spontaneously occurring rifampin resistant mutants. To differentiate the mutant from th e wild type, two silent mutations were added to this gene. After electroporation, transformation by homologous recombination was demonstrated by DNA sequencing of PCR products containing the Rif r region of the ropB gene and the silent mutations. Troyer et al ( 109 ) generated a transformant of Rickettsia typhi expressing GFPuv. For this an rpoB GFPuv fusion construct was delivered into host free bacteria. Incorporation of rpoB GFPuv into the chromosome was confirmed by PCR and RFLP (restriction fragment length polymorphisms) and screening of fluorescent bacteria was done by flow cytometric analysis. However these transformants were unstable during long term maintenance. These experiments were very important since they presented evidence that foreign DNA could be introduced by ele ctroporation, subsequently recombine into the genome by homologous recombination and be expressed within these organisms. Over 10 years passed before experiments achieved the deletion of the pld gene in Rickettsia prowazekii str Madrid E Evir a virulent r evertant of the attenuated str Madrid E. The phospholipase D product of the pld gene is thought to enable rickettsia to leave the phagosome. Successful allelic exchange of this gene with a mutated version containing rifampin resistance was confirmed by PCR however phenotypical differences were not observed between the mutant and the wild type during in vitro growth. Even though these mutant organisms infected guinea pigs, they did not produce disease and conferred protection from challenge with R. prowazek ii ( 110 ) Anaplasma spp. In 2007 the first transformed Anaplasma marginale mutants as a result of homologous recombination were described, although their isolation was an unexpected outcome. Since the transformation of A. phagocytophilum was achieved via Himar1 transposon mutagenesis, the

PAGE 27

27 researchers thought that the sa me could be accomplished for A. marginale For this, the Himar1 transposon and the transposase were delivered in two separate vectors into A. marginale organisms resulting in the isolation of green fluorescent and spectinomycin and streptomycin resistant b acteria. Molecular characterization of these mutants established that the entire plasmid bearing the transposon was integrated into the A. marginale chromosome by a single cross over homologous recombination mechanism instead of the transposition mechanism mediated by the transposase. This suggested that A. marginale as well other species of Anaplasma and Ehrlichia could be transformed by homologus recombination. However several parameters toward the optimization of this technology in Rickettsiales and espe cially in A. marginale remain undefined ( 111 ) Transposon Mutagenesis Transposons are DNA elements that move from one locus (donor site) into another one of the same or into another chromosome (target site). This mechanism of recombinat ion is mediated by a transposase and does not requires DNA homology. Mobilization of transposons has had a great impact on the structure and evolution of genes and genomes in eukaryotes and prokaryotes. For example, upon integration in the chromosome they can activate or inactivate genes, and in some instances produce chromosomal rearrangements that may result in deletion or inversions. Especially in bacteria, transposons encode additional functions such as antibiotic resistance and virulence factors ( 112 113 ) Transposons were originally discovered by Barbara McClintock while doing classical genetic experiments in maize during the 1940s. She characterized them as genetic entities that jump in and out of genes, changing the phenotype of corn kernels. As research on these elements advanced, in the mid 1970s scientists began to study transposons as tools to manipulate bacteria, phage and plasmids. Since then, these elements have been used to create insertional mutations in

PAGE 28

28 nonpathogenic and pathogenic bacteria ( 114 115 ) The most common transposon systems used for this goal are the Tn5, Tn10 and the Himar1 ( 112 ) Several techniques using transposon mutagenesis have been developed such as genetic footprinting first developed in Salmonella ( 115 ) and more recently signature tagged mutagenesis that combines whole genome sequencing and the construction of libraries of bacteria containing different tran sposon insertions to link an observed phenotype to a genotype. These studies were conducted to identify virulence genes in Staphylococcus aereous Vibrio chloerae Streptococcus agalactiae Listeria monocytogenes and Streptococcus pneumonie ( 116 ) Transposon mutagenesis in Rickettsiales has proven to be a better tool for the transformation of members of this order ( 117 118 ) Together with a better knowledge of suitable transformatio n vectors, reporter and selectable markers and the characterization of host specific transcriptional regulatory elements such as promoters, this technology has improved genetic analysis in these organisms. This has allowed the construction of fluorescent m utants that are easily visualized, helping define non essential genes and the development of gene knockouts. Achievements specific to this bacterial order using transposon mutagenesis are outlined below. Rickettsia spp. Previous experiments in the transfor mation of Rickettsia prowazekii using homologous recombination show that there was a lack of suitable selectable markers. Based on this, alternate methods of positive selection and transformation were tested. In one case the arr2 gene (Rifampin ADP ribosyl transferase) was used and optimized to rickettsial codon usage and in this manner had a better chance that this gene was expressed within these organisms. The product of this gene ADP r i bosylates the antibiotic rifampin destroying its antibacterial activi ty. This gene was placed downstream from the strong rickettsial rpsL promoter, and then this transcriptional unit was placed into the epicenter EZ::TN transposome system and delivered into

PAGE 29

29 R. prowazekii by electroporation ( 118 ) Following selection, DNA was isolated from rifampin resistant bacteria and used for PCR, Southern blots and rescue cloning to confirm and map the transposon insertion sites. Multiple ins ertions were identified, three within putative genes and five within intergenic regions. This work showed an improved selection system and identified for the first time non essential genes for this bacterial species. Rickettsia monanensis, an endosymbiont isolated from Dermacentor andersoni and Dermacentor variabilis ticks, was transformed using the same EZ::TN transposome system used for R. prowazekii I n this case the researchers added reporter markers to the plasmid carrying the transposon to assist the screening and visualization of mutant bacteria. Two different transposons for the simultaneous expression of reporter markers GFPuv or DsRed2 and the cat gene (chloramphenicol acetyl transferase) were designed. The expression of reporter markers and antibi otic resistance were regulated by Rickettsia ompA and ompB promoters. Visualization of fluorescent bacteria demonstrated that reporter markers could be used to track these organisms and this system could be applicable to other Rickettsia Molecular analysi s to identify and map transposon insertions noted the presence of a plasmid carried by these bacteria since one transposon was integrated in it and this was confirmed by PFGE (pulse field gel electrophoresis and Southern blot in wild type R. monanensis ( 119 ) ( 120 ) In order to expand the repertoire of genetic tools for the genetic manipulation of R. prowazelii the mariner based Himar1 transposon was used to generate insertional mutants of this pathogen. Mu ltiple insertional mutants were obtained in every experiment performed using this system in contrast to the EZ::TN system in which not all experiments produced recombinant bacteria, demonstrating that the Himar1 was more efficient for the creation of mutan ts in this bacterial species ( 121 )

PAGE 30

30 Rickettsia rickettsii is a member of the spotted fever group rickettsioses and the etiologic agent of Rocky Mountain spotted fever. Members of this group exploit the host actin polymerization m achinery to propel themselves intra and intercellularly as a mechanism of cell spread. Previous work has proposed that the rickettsial protein RickA is directly involved in recruiting actin for their motility ( 122 ) Transposon mutagenesis of these orga nisms was achieved with the Himar1 transposon system. Analysis of clones of recombinant bacteria containing transposon insertions isolated a population of organisms that contained the transposon integrated within the sca2 gene and which had a small plaque morphology during the phenotypical characterization of these mutants. Further analysis determined that the small plaque phenotype was not observed because of slower growth but because these mutants could not spread to adjacent cells as they could not indu ce actin polymerization. In the guinea pig model of infection, these sca2 mutants did not induce fever compared to the virulent wild type counterpart, suggesting that the product of this gene is a virulence determinant of spotter fever ( 123 ) Anaplasma spp Taking into account the successful results using transposon mutagenesis to genetically manipulate Rickettsia species, Felsheim et al isolated transformants of Anaplasma phagocytophilum via the Himar1 transposon system. Molecular characterization and sequencing determined multiple insertions of the transposon in the pool of mutants (not cloned), and that half of these insertions occurred within coding regions, three in unknown genes and one in the virB 6 gene. In vitro analysis of these mutants determined that these organisms had normal growth in cell cultures of RF/6A, HL 60 and ISE6 tick cells and in in vivo experiments with mice. These results demonstrate that these genes were not essential for the su rvival of A. phagocytophilum in different hosts ( 124 )

PAGE 31

31 However in a different transformation experiment using the Himar1 transposon system a mutant containing a transposon insertion within the APH_0584 (o methyltr ansferase gene, omt ) exhibited reduced binding and survival in ISE6 tick cells but growth at normal rates in HL 60 and RF 6A cells. Further experiments suggested that this enzyme is required for modification of a protein involved in adhesion of A. phagocyt ophilum to tick cells ( 125 ) Ehrlichia spp Recently the transformation of the human monocytic ehlichiosis agent, Ehrlichia chaffeensis using the Himar1 transposon system was achieved with the isolation of mutants containing multiple insertions in which three were localized within the coding region of transcriptionally active genes. These organism s grew continuously in macrophage and tick cell line s, showing that at least during in vitro growth these genes were not essential. However these mutants failed to infect deer ( 126 ) Plasmids Several Rickettsia species have been found to carry plasmids, some included in the spotted fever group Rickettsia such as R. amblyommii R. massiliae and R. peacockii and some included in the transitional group such as R. felis R. h elvetica R. hoogstraalii and R. monacensis ( 120 127 129 ) Many of these plasmids have been sequenced separately after PFGE and Southern blot analysis ( 120 127 ) and as products of whole genome sequencing of the rickettsial hosts that carry them ( 128 ) Sequencing and annotation showed that these plasmids carry genes encoding potential environmental and host adaptive proteins and virulence factors, and exist as low copy number replicons with sizes varying from 12.4 Kbp up to 63Kbp. With the exception of genes necessary for plasmid maintenance such as dnaA like and parA genes these plasmids share little ho mology ( 120 127 128 )

PAGE 32

32 Burkhardt et al ( 130 ) suggested that these plasmids could offer a good opportunity for the construction of shuttle vectors that could increase the array of tools for the genetic manipulation of Rickettsia especies. Toward this goal, two plasmids derived f rom R. amblyommii (pRAM18 pRAM32) were modified for the construction of shuttle vectors. Sequences from these plamids that share homology to the DnaA like replication initiation protein and partitioning protein parA were ligated into an E. coli plasmid bac kbone to provide the means of replication and segregation in Rickettsia and also propagation in E. coli. T hese shuttle vectors contained a cassette for selection and visualization of recombinant bacteria using the arr2 and gfpuv genes under the control of the rpsL promoter of R. prowazekii and the ompA promoter of R. rickettsi i respectively. Similarly, an additional vector containing a MCS (multiple cloning site) with 7 restriction enzyme sites instead of the selectable and reporter marker cassettes was constructed. Interestingly, a transcriptional unit containing the mCherry gen e under the control of the A. marginale tr promoter was ligated into that MCS. Electroporation of these plasmids into R. bellii and R. montanensis resulted in the isolation of mutant bacteria carrying these plasmids extrachromosomally and expressing Rifamp in ADP ribosyl transferase and green or red fluorescent proteins. These results showed that the DnaA like and parA genes were optimal for replication and maintenance of these plasmids within rickettsial cells. However long term maintenance of these plasmid s is not stable unless the culture is kept under antibiotic selection. Recently one of those R. amblyomii pRAM derived plasmids was used for the transformation of the pathogen R. prowazekii ( 131 ) Molecular characterization of rifampin resistant and green fluorescent bacteria determined that this plasmid was maintained as a lo w copy number (1 copy/Rickettsia) episome. Growth curve experiments showed that these mutants grow at rates comparable to that of wild type R. prowazekii Madrid E strain. So until now, these

PAGE 33

33 recombinant organisms are the first rickettsial pathogens to extr achromosomally maintain and express foreign DNA sequences carried on a replicon. Until now no plasmids have been found in A. marginale or any Anaplasma species, neither experiments using these Rickettsia shuttle plasmids have been documented. However the i nformation described above suggests that these newly developed vectors could be used in Anaplasma and that could facilitate genetic analyses that require an extrach ro mosomal approach. These might include characterization of regulatory sequences or promoter s, testing of potential selectable and new reporter markers and importantly, the development of complementation experiments for the analysis of already genetically modified mutants with an altered phenotype. Central Hypothesis Although the complete DNA seq uence of A. marginale is available ( 33 35 ) about 40% of its protein coding genes have been assigned putative functions, and several of those genes could be important for growth or viability. On the other hand, t he increased use of molecular approaches such as whole genome DNA and RNA sequencing, proteomics and comparative genomics of A. marginale has identified potential virulence associated genes ( 33 35 62 132 133 ) This knowledge gap between gene discovery and gene function in A. marginale could be closed by developing gene tic tools to generate gene knockouts or insertional mutants. The ability to create and characterize those mutants will be important to define genes that are required for invasion and growth of A. marginale in ticks and mammalian cells. Additionally the sel ection of characterized mutants with reduced pathogenicity in vitro could be evaluated in vivo as possible candidates for the production of genetically attenuated vaccines for the control of anaplasmosis. Based on current knowledge one way to create inser tional mutations in pathogenic bacteria is via transposon mutagenesis. Recent advances made toward the genetic manipulation of several members of the order Rickettsiales ( 121 123 ) especially those closely related to A.

PAGE 34

34 marginale such as A. phagocytophylum ( 117 124 ) and Ehrlichia chaf f eensis ( 126 ) have demonstrated that the Himar1 transposon mutagenesis system is the most useful towards this goal. Nevertheless, previous attempts to transform A. marginale by transposon mutagenesis were not successful. Previously, the Himar1 transposon and transposase were delivered on two separate vectors into A. marginale resulting in the isolation of green fluorescent and antib iotic resistant bacteria but with the entire plasmid carrying transposon sequences integrated in the A. marginale chromosome by a single crossover homologous recombination mechanism instead of the classical cut and paste mechanism of transposition ( 111 ) However the probability that both plasmids from the trans system described above will be introduced into the same cell is much lower than for a single plasmid. An optimized construct carrying in cis the Himar1 transposon and transposase sequences was developed for improving the transformation of A. phagocytophilum ( 117 125 ) However data to support transformation efficiency using two constructs vs. a single one is not available. Based on this, it is important to evaluate if this system can be used in A. ma rginale For this, electroporation of host free Anaplasma marginale using a single plasmid carrying the Himar1 and the transposase sequences was performed by our collaborator Dr. Ulrike Munderloh at the University of Minnesota These experiments resulted i n the isolation of recombina n t A. marginale that were characterized herein. T he central hypothesis of this work is that transformation of A. marginale via transposon mutagenesis using the Himar1 transposon/transposase system is achievable and useful for th e creation of insertional mutants.

PAGE 35

35 The specific aims to accomplish this are the following: 1. Analyze if mutated A. marginale results from integration of the Himar1 sequences within the chromosome of these organisms in a mechanism mediated by the transposase and map insertion sites. 2. Determine if transposon insertion occurs within a gene and if so, evaluate its effect on the expression of the gene. 3. Determine if Himar1 transposon insertion affects the expression of upstream and downstream sequences adjacent to the insertion site. 4. Evaluate if integration of the Himar1 transposon within A. marginale results in an altered phenotype.

PAGE 36

36 CHAPTER 2 K NOCKOUT OF AN OUTER ME MBRANE PROTEIN OPERON OF ANAPLASMA MARGINALE BY TRANSPOSON MUTAGENESIS Introduction Anaplasma marginale is a tick borne and obligate intracellular bacteri um that causes bovine anaplasmosis, a disease that has gained particular attention due to the considerable economic losses for the cattle industry ( 9 10 134 135 ) O nset of clinical disease is mainly characterized by a severe hemolytic anemia ( 9 10 ) Cattle that survive acute infection become carriers of A. marginale and organisms can be transmitted to susceptible cattle mechanical ly or by tick bite ( 10 ) A. marginale persists in carrier cattle because of its c apability to subvert the immune system using antigenic variation in which different variants of outer membrane proteins such as Msp2 and Msp3 are expressed ( 26 47 68 136 ) Work on the development of a preventive vaccine against this disease began in the early A. marginale subsp centrale ( 13 57 ) This less virulent strain originally from South Africa is used for immunization of cattle in Africa, Australia South America and the Middle East and remains the most widely used and practical vaccine against bovine anaplasmosis ( 13 57 137 ) T his vaccine is not approved in the United States because of the risk of transmitting contaminant blood borne pathogens that will infect cattle ( 9 ) R ecently comparative genomic studies demonstrated that proteins that are conserved in US strains were not conserved in A. marginale subsp. centrale ( 35 57 137 ) Different vaccination methods have been developed for the control of bovine anaplasmosis that range from attenuated live or killed organisms to DNA and recombinant pr otein vaccines ( 13 ) But A. marginale derived from cell culture, killed organisms and DNA vaccines induce only partial protection ( 55 84 138 ) Immunization trials using outer membrane proteins or a complex of linked or unlinked outer membrane proteins of A marginale derived

PAGE 37

37 from erythrocytes have demonstrated good protection against high bacteremia, anemia and homologous strain challenge ( 49 85 88 ) However, to promote long lasting protection, several immunization boosts may be required and in addition to th is, production and purification of these components is time consuming and expensive. The increased use of molecular approaches such as whole genome, RNA sequencing proteomics and comparative genomics of A. marginale has identified potential virulence asso ciated targets that can be altered or removed by reverse genetics techniques ( 33 35 62 132 133 139 ) This could allow the creation of attenu ated organisms that have reduced pathogenicity but still elicit cellular and antibody responses that stimulate immunity without causing disease. Consequently the development of genetic tools to transform A. marginale and generate in vitro gene knockouts, o r insertional mutants that can be tested for attenuation in their in vivo environment is of great significance. One way to create insertional mutations in pathogenic bacteria is via transposon mutagenesis, in which a library of recombinant bacteria contain ing different transposon insertions can be created allowing for the screening of mutant strains with diverse phenotypes ( 114 140 ) The Himar1 transposon is a non replicative class II DNA transposon that is a member of the Tc1/mariner family and is often used for the creation of insertional mutants. Since these types of transposons are horizontally transferred between species, they do not have host restricted functions making them suitable for use in a wide range of eukaryotic and prokaryotic hosts ( 140 141 ) In addition to this, the Himar1 transposon does not ha ve DNA target specificity since it is integrated randomly in TA dinucleotide sites ( 141 143 ) Because of these advantages transposon mutagenesis using this system has been successfully developed in other tick borne pathogens such as Rickettsia rickettsii Coxiella burnetii Borrelia bur g doferi Francisella

PAGE 38

38 tularensis Ehrlichia chaffeensis and Anaplasma phagocytophilum ( 123 124 126 144 150 ) These previous results suggest that this system could be useful for the transformation of A. marginale Nevertheless, previous attempts by our collaborator Dr. Ulrike Munderloh at the University of Minnesota to transform A. mar ginale by transposon mutagenesis were not successful. Before t he Himar1 transposon and transposase were delivered in two separate vectors into A. marginale which resulted in the isolation of green fluorescent and antibiotic resistant bacteria. However molecular characterization of these recombinant organisms established that the entire plasmid carrying the transposon sequences was integrated in to the A. marginale chromosome by a single crossover homologous recombination mechanism instead of the classical cut and paste mechanism of transposition ( 111 ) Recently transformation experim ents carried out by our collaborator using an optimized constru ct carrying in cis the Himar1 transposon and transposase sequences resulted in the isolation of red fluorescent and s pectinomycin and streptomycin resistant A. marginale Therefore, the purpose o f this work was to evaluate first, if classical transposon mutagenesis using the Himar1 transposon system was the recombination mechanism that allowed the isolation of recombinant A. marginale and second, if transposon mutagenesis using this system, is useful for the c reation of insertional knockout mutations. Materials and Methods Cultivation of Anaplasma m arginale Cultures of A. marginale str Virginia wild t ype and o mp10 :: himar1 mutant were maintained in t ick ISE6 cells derived from embryonated eggs of the blacklegg ed tick, Ixodes scapularis at 34 C in non vented 25 cm 2 cell culture flasks (NUNC). A. marginale infected c ell cultures were maintained in L15B300 medi um supplemented with 5 % fetal bovine serum (FBS,

PAGE 39

39 BenchMark, Gemini Bio Products), 5 % tryptose phosphate broth (TPB, Difco, Becton Dickinson), 0.1 % bovine lipoprotein concentrate (LPC, MP Biomedical), 0.25 % NaHCO 3 and 25 mM Hepes buffer, adjusted to pH 7.8, as previously described ( 151 ) The cell culture m edi um for ISE6 cells infected with the A. marginale omp10 :: himar1 mutant was supplemented with s pectinomycin (S igma A ldrich ) and s treptomycin (S igma A ldrich ) to a final concentration of 50 g/ m L each Isolation of the A naplasma m arginale Mutant by Transposon Mutagenesis Transformation experiments of A. marginale and i solation of mutants were performed in collaborative work with Dr. Ulrike Munderloh at the University of Minnesota. To maximize chances of obtaining a transformant using transposon muta genesis, a single plasmid construct that encoded both the transposon and the transposase in cis configuration as described ( 117 ) was used except that the fluorescent marker was replaced by sequences encoding a monomeric red fluorescent protein, mCherry ( 152 ) A. marginale bacteria passaged 53 times in ISE6 cells were harvested from one 25 cm 2 culture in 5 mL of medium when ~80 % of cells were infected, and many cells were undergoing lysis. The cells were recovered in 2 mL of culture medium, and added to a 2 mL microcentrifuge tube containing 0.3 mL of sterile silicon carbide abrasive ( 60/90 grit ; Lortone, Inc), vortexed at maximum speed for 30 sec and the lysate transferred to a fresh 2 mL tube on ice. B acteria were collected by centrifugation at 11,000 g for 10 min at 4 o C, and washed twice in ice cold 300 mM sucrose. They were then resuspended in 50 L of 300 mM sucrose containing 3 g of plasmid DNA, and incubated on ice for 15 min before being electroporated (Biorad Gene Pulser II) at 2 kV, 400 Ohm and 25 F in a 0.2 cm gap cuvette. The electroporation mixture was recovered in 1.5 mL of an ISE6 cell su spension (~2X10 6 cells), and centrifuged in a microcentrifuge tube at 1,000 g for 10 min at

PAGE 40

40 room temperature. The tube was left undisturbed for 30 min at room temperature, and the pellet then resuspended in the supernatant medium and added to a 25 cm2 flas k containing ~5x10 6 ISE6 cells in 3 mL of L15B300 medium supplemented as described for Anaplasma infected cultures. The culture was incubated at 34 o C in a tightly capped flask. Three days after electroporation, the culture medium was replaced with 5 mL o f medium additionally containing 50 g/ mL of spectinomycin and streptomycin (selection medium). Subsequently, the culture was fed twice weekly with selection medium and examined weekly on an inverted microscope (Diaphot, Nikon) fitted for epifluorescence u sing a Texas Red filter. The first fluorescent colonies of bacteria were noted 6 wk following electroporation, and the culture was maintained in selection medium with twice weekly medium changes until ~90 % of cells were infected. At that time, the mutant was passaged (ten fold dilution) to fresh cells, and the remainder was stored in liquid nitrogen. Preparation of H ost C ell free A naplasma m arginale W ild T ype and o mp10 ::himar1 M utant from ISE6 T ick C ells Isolation of A. marginale wild type and o mp10 :: himar1 mutant was performed by disruption of ISE6 tick cells with 1mm diameter glass beads (BioSpec Technologies) in a Minibead beater (BioSpec technologies) as described elsewhere ( 118 ) with the exception that cells were shaken only once for 10s and immediately placed on ice. Cell lysa tes were transferred to 1.5 m L centrifuge tubes and centrifuged at 100g for 5 min at 4 C to pellet cell debris. The supernatant was then carefully removed and transferred to clean 1. 5m L centrifuge tubes. A. marginale organisms ( wild type and o mp10 :: himar1 mutant) were pelleted at 11,000 g for 10 min at 4 C and stored at 20C.

PAGE 41

41 DNA I solation and Phi29 A mplification of the A naplasma m arginale M utant Before DNA isolation pelleted A. marginale o mp10 :: himar1 mutants were treated with RNaseA (QIAGEN) and DNase I (Sigma Aldrich) to remove ISE6 host cell contaminant nucleic acids. DNA isolation was performed using the QIAamp DNA Mini kit (QIAGEN) as per manufacture r but in this case the DNA was e lut ed in 50 L of 1mM Tris pH 9.0. DNA concentration was determined using the Qubit dsDNA HS assay kit (Life technologies) on a Qubit fluorometer (Life technologies). 5 reactions of 10 ng of DNA were used for whole genome amplification using the Genomi Phi V2 DNA amplification kit (GE Healthcare) and the DNA purified with GelElute Extraction Kit (5 PRIME) by adsorption to silica particles and eluted with 10 mM T ris pH8.2. Genome S equencing and Bioinformatics Samples from 2.0 to 3.6 g of amplified DNA derived from the o mp10::himar1 mutant, were provided for library construction and sequencing by the Roche/454 (GS FLX) method to the Interdisciplinary Center for B iotechnology Research (ICBR) at the University of Florida. Also, samples of equivalent amount s were provided to the Scripps Research Institute, La Jolla, California for sequencing by the Illumina (HiSeq) method. A total of 374,151 and 207,288,916 reads o f Roche/454 and Illumina sequencing data, respectively, were obtained. The FASTQ files provided by the sequencing facilities were uploaded to the UF GALAXY web site http://galaxy.hpc.ufl.edu and analyzed separatel y. Uploaded Illumina FASTQ files were groomed, filtered and formatted into FASTA files using the FASTQ Groomer, Filter FASTQ and FASTQ to FASTA converter tools located in the NGS: QC and manipulation toolbox of GALAXY. FASTA files were then aligned to the A. marginale str St Maries reference genome sequence (CP000030) using the Megablast alignment

PAGE 42

42 tool (NCBI BLAST+ blastn (version 0.0.12) in GALAXY) to obtain sequencing reads that contained A. marginale sequences. These A. marginale sequencing reads were then used for a second Megablast alignment using as a reference sequence 28 nucleotides from the Himar1 terminal inverted repeats (TIR) T he transposon insertion locus within the A. marginale chromosome was then determined, since the reads obtained contai ned the A. marginale Himar1 TIR junctions. A similar strategy was used for the analysis of the Roche/454 sequencing reads. CLC Genomics Workbench version 6.5 was used for assemblies of Roche/454 and Illumina reads. GenBank accession numbers : for assemble d contigs containing the Himar1 transposon and omp9 genes (KJ567139). RNA Isolation For RNA isolation three samples of ISE6 cells infected with A. marginale wild type and three o mp10 :: himar1 samples were used. Each sample derived from separate cultures grown in T 25 cell culture flasks. Samples containing approximately equal numbers of infected cells were collected in RNA stabilization reagent RNAlater (AMBION Life technologies) and stored at 80C DNase I treatment (QIAGEN) Aliquots of extracted RNA were used to measure contaminant DNA conc entration using the Qubit dsDNA HS assay kit (Life technologies). Additionally, RNA was treated three times with RNase free Dnase I (AMBION Life technologies) to remove any trace of contaminant DNA in the sample. RNA concentration was measured with the Qub it RNA assay kit (Life technologies), and samples were stored at 80C

PAGE 43

43 RT PCR and RT qPCR Experiments RNA (2 g) from ISE6 cells infected with A. marginale wild type and o mp10::himar1 mutant was converted to cDNA by random priming using a Omniscript reverse transcriptase kit (QIAGEN) Genomic DNA and n o reverse transcriptase reactions were included as controls for each sample and each nucleic acid target. S pecific primers (Table 2 1) were designed to a mplify transcripts from intergenic regions between o mp7 o mp8 o mp8 o mp9 o mp9 o mp10 and o mp10 AM1225 using cDNA from ISE6 cells infected with A. marginale wild type as template Similarly t ranscripts from within o mp6 o mp7 o mp8 o mp9 and o mp10 genes were detected by PCR amplification of cDNA from ISE6 cells infected with A. marginale wild type and the o mp10::himar1 mutant using o mp6 10 specific primers (Table 2 1). PCR amplification conditions for each PCR experiment are described in (T able 2 2) and ( Table 2 3) respectively and each reaction contained 200ng of cDNA combined with 200M P rimeSTAR GXL DNA polymerase (Takara). PCR products were electrophoretically separated using a 1 and 2% Sea kem LE (Lonza) Agarose gel, and stained with SYBR G old nucleic acid gel stain (Life technologies) for UV visualization. Genomic DNA and samples with no reverse transcriptase for each target were used as positive and negative controls respectively. RT qPCR Experiments Transcript differences between o mp8 o mp9 o mp10 end, and o mp10 3 A. marginale wild type and o mp10::himar1 mutant were determined using the comparative 2 method ( 153 154 ) and the results were based on the mean of three biological samples (individual RNA extracts) For Taqman q uantitative PCR cDNA obtained from ISE6 cells infected with A. mar ginale wild type and the o mp10::himar1 was used with primers and probes (Table 2 1) designed to amplify o mp8 o mp9 o mp10 end, o mp10 3 msp5 rpoH and the 16S gene

PAGE 44

44 sequences. F or relative gene expression data normalization the re ference genes used were msp5 rpoH and 16S Each reaction was performed in triplicate with 5u L of cDNA in a volume of 25u L containing 1x Quantitec t Probe PCR master mix (QIAGEN) 0.4uM of forward and reverse primers, and 0.2uM of probe and cDNA. Amplifications were performed in a Bio Rad DNA engine Opticon 2 thermal cycler with the following conditions, 95 C for 15 min, and 40 cycles of 94 C for 15s and 60 C for 1 min. qPCR amplification efficiencies The cDNA obtained from ISE6 cells infected with wild type A. marg inale was used for qPCR amplification with primers and probes targeting o mp8 o mp9 o mp10 end, o mp10 end msp5 rpoH and the 16S genes (Table 2 1) Primer probe reaction efficiencies were determine d for each primer probe set by performing a ten log ra nge of 5 fold serial dilutions of cDNA for the purpose of generating standard curves from which reaction efficiencies could be calculated. The qPCR reactions were performed in triplicate with 5u L of cDNA from each dilution. Each reaction had a net volume o f 25u L containing 1x Quantitec t Probe PCR master mix (QIAGEN) 0.4uM of forward and reverse primers, and 0.2uM of probe and cDNA. DNA amplifications were performed in a Bio Rad DNA engine Opticon 2 thermal cycler with the following conditions, 95 C for 15 min, and 40 cycles of 94 C for 15s and 60 C for 1 min. 5u L of qPCR product from each target was analyzed in a 2% Seakem LE (Lonza) agarose gel stained with SYBR G old nucleic acid gel stain (Life Technologies) for UV visualization and confirmation of primers and probes target specificity ( Figure 2 1 ). The efficiency of amplification was calculated from the slope of the standard curve plots of Ct values vs. the log of cDNA input, using the formula E = (5 1/slope ) 1. Amplification efficiencies for each t arget are reported on the (Table 2 4).

PAGE 45

45 Relative efficiency plots For a valid 2 calculation, the efficiency of target amplification and the reference genes must be approximately similar in value and fall within acceptable e fficiency range of 90 and 110 %. Relative amplification efficiencies of the target genes ( omp8 omp9 omp10 end and omp10 end) versus reference genes ( msp5 rpoH and 16S ) were calculated by performing standard curves for each amplicon in the same manner and conditions to those u sed to determine target gene Ct reference gene) for each sample which corrected for any template loading s the log of cDNA input were used to determine the slope of standard curve. Relative efficiencies of target vs. reference genes are reported in (T able 2 5) Significant differences between the A. marginale wild type and o mp10::himar1 mutant were calculated (P<0.05) reference gene) of the o mp10::himar1 mutant and the wild type ( o mp10::himar1 wild type Ct which yields the expression ratio. The expression ratio was then expressed as percentage of expression by multiplying the 2 values by 100. For normalization of relative gene expression data msp5 ( 155 ) rpoH and 16S were used as reference genes. Western I mmunoblots Expression of the Omp9 protein in A. marginale wild type and omp10 :: h imar1 mutant was assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting using e qual amounts (10 8 ) of host free bacteria. Membranes were incubated with three different antibodies; the anti O mp 9 monoclonal antibody 121/1055 ( 156 ) the monoclonal antibody F16C1 (reacts with the M sp 5 protein and served as a loading control ) ( 157 ) and the monoclonal

PAGE 46

46 antibody Tryp1E1 (e xhibits specificity for a variable surface glycoprotein of Trypanosome brucei ) ( 157 ) This last antibody served as a negative control. Final concentration s of each antibody used were 4 g/ m L 2 g/ m L and 4 g/ m L Antibody binding was detected with the secondary antibody goat anti mouse IgG horseradish peroxidase labeled and diluted to 1:10,000 using the Pierce ECL Western blotting substrate (Thermo scientific) as described in manufacture r Q uantification of the number of A. marginale w ild type and omp10::himar1 organisms was performed by qPCR using the forward and reverse primers AB1242 and B1243 and the probe AB1250 (Table 2 1) that targets the single copy gene opag2 ( 111 ) Triplicate reactions from each duplicate culture at each time point were used. Reactions of 25 L containing 5 L l of DNA from A. marginale wild type and omp10::himar1 mutant strains, 1X of Quantitect Probe PCR mix (QIAGEN), 0.4uM forward and reverse primers and 0.2uM of probe were used for amplification in a Bio Rad DNA engine Opticon thermal cycler with the following conditions, 95 C for 15 min and 40 cycles of 94C fo r 1 min, 54C for 15s and 60C for 1min. Ten fold serial dilutions of the opag2 /pCR TOPO vector were used for standard curve preparation, and the A. marginale copy number was calculated based on the standard curve. No template control, uninfected cells and D NA from Anaplasma phagocytophilum were used as negative controls. Results Transformation of Anaplasma m arginale by T ransposon M utagenesis A ttempts to transform A. marginale by tr ansposon mutagenesis using the Himar1 transposon / transposase system delivered in two separate plasmids were not successful. The

PAGE 47

47 probability that two plasmids are introduced at once into A. marginale organisms could be very low, especially when viability in the extracellular environment might be highly compromised, resulting in a lo w fraction of cells competent to take up DNA. Therefore i n order to promote transposon mutagenesis in these bacteria, the transposase was provided in cis with the Himar1 transposon sequences (R. F. Felsheim unpublished data) The pHimarcisA7mCherry SS cont ains the hyperreactive allele A7 transposase and the Himar1 TIR flanking the mCherry reporter gene and the aadA gene, which confers resistance against spectinomycin and streptomycin. Expression of the transposase and the reporter and antibiotic selection genes is driven by the A. marginale tr promoter ( 41 111 ) (Figure 2 2 panel A). Antibiotic selection pressure of electroporated bacteria with this construct resulted in the isolation of red fluorescent and antibiotic resistant bacte ria (Figure 2 2 panel B). Mapping of T ransposon I nsertion within the A naplasma m arginale C hromosome Roche/454 and Illumina high throughput genome sequencing methods were used to determine: 1) the location of plasmid sequences within the A. marginale chromosome, 2) the recombination mechanism that allowed the segregation of mutant bacteria and 3) if these recombinant organisms correspond to a population containing insertions in different genomic locations or to a single genome site. Mutations produced by the integration of the Himar1 transposon into the A. marginale chromosome will generate new junction se quences that are absent in the wild type. These new sequences should include the Himar1 terminal inverted repeats (TIR) followed by the sequence of the regions in which the transposon is integrated. Based on this, the strategy used to map the Himar1 insertion site involved alignment of the sequencing reads obtained by Roche/454 and Illumina methods to two reference sequences, the A. marginale str. St Maries genome sequence (CP000030) and the Himar1 TIR sequence. The Himar1 TIR A. marginale genome junctions

PAGE 48

48 were identified by extracting reads that aligned to the A. marginale genome at one end and to the Himar1 TIR at the other end (Figure 2 3 panel A.). Analysis using Illumina reads mapped the Himar1 TIR A. marginale genome junctions into a region of o mp6 and o mp10 genes. Interestingly these reads contained the same mutated sequence. O mp6 and o mp10 share a large stretch of identity 456 nt/459 nt (99%) ( 156 ) The short, 100 nt length of the Illumina reads, made it difficult to d ifferentiate which gene contained the Himar1 transposon. Additional analysis using longer reads obtained on the Roche/454 platform revealed that the Himar1 transposon was integrated within the o mp10 gene. These reads contained a region of o mp10 that is not shared with o mp6 Based on this sequencing analysis the genomic location of the Himar1 transposon in the chromosome of the transformed A. marginale is at nucleotide 245 downstream of the omp10 start codon (Figure 2 3 panel B). These results were verified by PCR amplification of gDNA from ISE6 cells infected with wild type and transformed A. marginale using o mp6 and o mp10 specific primers (Figure 2 3 panels B and C). The size of o mp6 amplicons (492 bp) in wild type and transformed A. marginale was the same. However the size of the o mp10 amplicon in transformed A. marginale was increased by 1836bp when compared to the wild type (969 bp), indicating that the transposon was integrated within the o mp10 gene. Since there is not an A. marginale str. Virginia genome sequence, I wanted to confirm that the transposon location in this strain was the same as the one mapped in the A. marginale str. St Maries reference genome. For this, combined Roche/454 and Illumina reads were assembled and a contig of 21, 324 nucleotides identified. Alignment of this contig with the A. marginale str. St Maries genome showed that this sequence contained part of omp10 and upstream genes

PAGE 49

49 (Figure 2 4 panel A) and that the transposon insertion site in the A. marginale str. Virgi nia matches the same region mapped using the reference genome (figure 2 4 panel B). Further analysis of sequencing reads determined that there is only one transposon insertion in the chromosome of recombinant A marginale The reads containing the Himar1 T IR A. marginale junctions aligned to a single genome site. Although these transformed organisms were not cloned, data suggest that they are isogenic for the transposon insertion site within the o mp10 gene. The mobilization of the Himar1 transposon from one locus to another is mediated by a transposase using a cut and paste mechanism ( 140 143 ) It has been shown previously in other organisms that the Himar1 transposon integrates preferentially into a TA site and leads to duplication of this dinucleotide upon integration into the target site ( 143 ) This was found to be true also for A. marginale Sequencing analysis revealed that the Himar1 transposon targeted a TA dinucleotide in o mp10 (Figure 2 5 panel A) and upon integration it is flanked by a TA dinucleotide sequence (Figure 2 5 panel B). Thus, the mobilization of the Himar1 transposon into the o mp10 gene of A. marginale was mediated by means of the A7 transposase in a cut and paste mechanism. This transformant of A. marginale will be referred to as omp10::himar1 mutant. Evidence for E xpression of o mp10 as P art of an O peron During this analysis I hypothesize d that the transposon insertion could alter the expression of omp10 and downstream genes. This hypothesis is based on recent work in which the transcriptome profile of A. marginale using RNAseq indicated that o mp10 is expressed as part of a six gene operon in erythrocytes of infected cattle ( 62 ) This operon includes AM1225 o mp10 o mp9 o mp8 o mp7 and o mp6 (Figure 2 6 panel A).

PAGE 50

50 Because of this, it was important to determine if o mp10 is expressed within a polycistronic message in A. marginale replicating in ISE6 tick cells. The intergenic region between AM1225 and o mp10 is 440 bp long, while intergenic regions between o mp10 9, o mp9 8, o mp8 7 and o mp7 6 are 62bp, 63bp, 64bp and 39bp respectively (figure 2 6 panel A). To test whether AM1225 through o mp7 are expressed as a single transcriptional unit, total RNA isolated fro m ISE6 cells infected with wild type A. marginale was reverse transcribed and template cDNA was used for amplification of intergenic regions with primers that connect neighboring genes (Figure 2 6 panel A). O mp6 was not included during these experiments, b ecause previous work ( 156 ) and work in our lab showed that transcripts from this gene are not detected in A. marginale during infection of tick cells. Appropriate size amplicons of the intergenic regions between o mp7 8, o mp8 9, o mp9 10 and o mp10 AM1225 gene were detected (Figure 2 6 panel B), providing evidence that these genes are transcribed as a single mRNA in A. marginale infected tick cells. RNA T ranscript A nalysis Next, I determined if insertion of the Himar1 sequences resulted in alteration of o mp10 expression and the expression of genes downstream. For this, total RNA from ISE6 tick cells infected with A. marginale wil d type and o mp10::himar1 mutant was reverse transcribed and cDNA used as template for PCR amplification with specific primers that were designed to anneal to o mp6, o mp7, o mp8, o mp9, and o mp10 in wild type and o mp10::himar1 mutant respectively (Figure 2 7 p anel A). o mp10, 9, 8, and 7 but not o mp6 are transcriptionally active in wild type A. marginale although at low levels (Figure 2 7 panel B). The Himar1 transposon insertion into the coding sequence of o mp10 disrupted its expression and that of o mp9 o mp8 and o mp7 since transcripts from these genes were not detected in o mp10::himar1 mutants of A. marginale by this method (Figure 2 7 panel B). To ensure integrity, cDNA samples from A. marginale wild type

PAGE 51

51 and o mp10::himar1 mutant were used for amplification with specific primers of a region of 131 bp of the 16S rRNA. Amplicons from this region were detected in both wild type and o mp10::himar1 mutant. No bands were visualized in negative controls (Figure 2 7 panel B). Since o mp10 through o mp7 are expressed at low levels in ISE6 tick cells, RT q PCR was used to quantitatively determine differences of expression between A. marginale wild type and o mp10::himar1 mutant. For this, cDNA generated from ISE6 tick cells infected with A marginale wild type and o mp10::himar mutant was used for real time PCR amplification using primers and probes targeting o mp8 o mp9 o mp10 (Figure 2 8 panel A). In order to compare these gene expression results between wild type and o mp10:himar1 A. marginale Ct values were normalized to the rpoH msp5 and 16S rRNA genes. Changes in expression of these genes were calculated by the 2 method, and results were expressed as percentage of expression, with a 100 % expression level being assigned to the calibrator or control group, which in this case is wild type A. marginale Although three different reference genes were used, RT qPCR data normalization led to similar results in which there was a significantly reduced expression for o mp8 ( 98 100 %), o mp9 ( 92 99 %) and o mp10 3 99 %) relative to their counterparts in wild type A. marginale (Figure 2 8 panel B). These results show that Himar1 transposon insertion into o mp10 affected its expression and the expression of genes downstream, confirming the results obtained by RT PCR and agarose gel electrophoresis. A second experiment investigated the possibility of the same effect occurring in regions of o mp10 before the Himar1 t ransposon insertion site. For this a o mp10 (Figure 2 8 panel A). Even though there was a significant reduction in the detection of transcripts from this

PAGE 52

52 region ( 28 58 %) relative to o mp10 in wild type, this reduction was not as great as with the sequences located in o mp10 downstream of the Himar1 transposon insertion site. Western I mmunoblot A nalysis To determine if the decreased expression of mRNA in genes downstream o f o mp10 correlated with protein expression a Western immunoblot analysis using anti Omp9 antibody was performed. To compare the protein expression of o mp9 between A. marginale o mp10::himar 1 and wild type, the number of organisms per sample was quantified by qPCR using the o pag2 single copy gene to determine the copy number of A. marginale 10 8 organisms of A. marginale wild type and o mp10::himar1 mutant were loaded per lane. A. marginale str Virginia initial bodies and uninfected ISE6 cells were used as positive and negative controls respectively. Western immunoblot showed a reduced expression of Omp9 in o mp10::himar1 A. marginale mutant compared with wild type (Figure 2 9 panel A). The Omp9 band of 40kDa was present in wild type and initial bodies but was not detected in the mutant or using negative control antibody Tryp1E1 (Figure 2 9 panel B). Antibody F16C1 that reacts with major surface protein 5 (Msp5) was used as a loading control. Ant i Msp5 detected this protein (19kDa) in wild type and o mp10::himar1 A. marginale (Figure 2 9 panel C). These results correlated with results obtained from the RNA transcript analysis, showing that the transposon insertion severely affected the expression of both mRNA and protein from downstream genes such as o mp9 Discussion The possibility of creating insertional mutations in A. marginale not only could provide a broad understanding of gene products required for infectivity, growth or viability of this

PAGE 53

53 p athogen in the mammalian host and the tick vector, but also would allow the generation of genetically attenuated organisms that can be tested in vaccination trials. Here this dissertation report s that transposon mutagenesis using the Himar1 transposon/tra nsposase system for A. marginale is achievable and it could be useful for creating insertional mutations in these organisms. High throughput genome sequencing analysis for the characterization of these transformants established that transposon sequences ar e integrated within the o mp10 gene of the A. marginale chromosome and its mobilization within this gene was mediated by the transposase in a cut and paste mechanism, since i.) the transposon sequences were integrated within a TA dinucleotide site ii.) upon integration of the transposon, this sequence was duplicated and is found flanking the transposon TIR at the junctions with the A. marginale genome and iii.) sequences from the delivering vector outside the transposon were not found. Although these omp10 :: h imar1 mutant organisms were not cloned, they are isogenic for the transposon insertion within the o mp10 because all the sequencing reads containing the transposon A.marginale genome junctions aligned to the same genome site in the A. marginale str. St. Maries reference genome sequence (CP000030). The o mp10 gene is part of the o mp1 through omp14 clusters, members of the msp2 superfamily that correspond to the pfam01617 family of bacterial surface antigens ( 33 ) Deep sequencing of cDNA generated from total RNA of erythrocytes infected with A. margi nale identified 70 putative operon arrangements. One contained o mp10 transcribed as part of an operon of six genes with AM1225 o mp9 o mp8 o mp7 and o mp6 arranged ( 62 ) In order to have a better understandi ng of the effects of the

PAGE 54

54 transposon insertion in o mp10 on adjacent genes it was important to determine if o mp10 is also expressed as part of a polycistronic message in A. marginale replicating in tick cell cultures. RT PCR of intergenic regions between o mp 7 8 o mp8 9 o mp9 10 and o mp10 AM1225 provided evidence that o mp10 is transcribed within a polycistronic message in A. marginale infected tick cells. However transcripts of o mp6 were not detected. Similar results in which o mp6 expression was not detected i n A. marginale infected IDE8 tick cells and in tick midguts were obtained by others previously ( 156 ) A lack of omp6 transcripts suggests that this gene may not be expressed in tick cells or only at very low leve ls. It has been shown that, in bacteria with reduced genomes such as Mycoplasma pneumonia gene members of an operon are not always expressed at the same levels and those genes distal from the promoter may have lower expression ( 158 ) RT PCR and relative gene expression experiments demonstrated that insertion of Himar1 into o mp10 at nucleotide 246 from the start of the ORF altered the sequence of this gene. This resulted in the loss of its expression since there was a significant reduction in the detection of transcripts from this gene when compared with the expre ssion of o mp10 transcripts from wild type A. marginale It has been shown that in bacteria production and/ or stability of mRNA in regions downstream of a transposon insertion is greatly reduced to the point where very little mRNA corresponding to this re gion can be isolated ( 159 ) Insertion of Himar1 within a gene can affect the expression of neighboring genes, as shown in a variety of bacteria and especially in other tick borne bacteria ( 126 150 160 ) Therefore, the effect of the Himar1 insertion on the expression of genes downstream and upstream of o mp10 in om p10:: himar1 A. marginale was evaluated Results showed that the transcriptional activities of o mp9 and o mp8 were negatively

PAGE 55

55 influenced by the insertion of the Himar1 within o mp10 since detection of transcripts was significantly decreased in relation to wild type o mp9 and o mp8 Although the transcription activity of regions upstream of the transposon insertion site at o mp10 dropped significantly in relation to wil d type A. marginale it was not as severe as with genes downstream of o mp10 Sequencing analysis determined that the transposon sense strand is found in the opposite orientation to o mp10 so it might be possible for transcription to read through the Himar1 sequences and produce anti sense transcripts that could reduce expression of sequences upstream of o mp10 but to demonstrate this further characterization is required. Western immunoblot analysis show ed that the transposon insertion into omp10 markedly reduced protein expression of omp9 in the o mp10::himar1 mutant A. marginale when compared to wild type, corroborating that both mRNA and protein expression fro m genes downstream of omp10 were disrupted. The evidence presented here suggests that these genes are not essential for growth of A. marginale in tick cell culture. Significant work on the possible interactions between the expressed proteins in different host environments has accumulated and offers important clues about the possible phenoty pic effects of the disruption of these genes in A. marginale For example omp7 omp8 omp9 and omp10 are differentially expressed in tick and mammalian cells with lower levels in tick midgut and cultured tick cells ( 156 ) Detection of proteins from these genes has been reported ( 156 161 162 ) Omp7, Omp8 and Omp9 are conserved during tick transmission and in acute and persistently infected cattle ( 156 ) Characterization of the repertoire of outer membrane surface proteins by mass spectrometry identified Omp10 and Omp7 as immunogenic in cattle ( 161 ) Proteome analysis using crosslinking and l iquid chromatography

PAGE 56

56 mass spectromet ry (LC MS/MS) to determine the composition and topological organization of surface proteins in A. marginale in mammalian and tick cells isolated a large protein complex Further analysis demonstrated that Omp7, Omp8 and Omp9 are arranged in the outer membr ane as near neighbors to Msp2, Msp3, Msp4, Omp1, Opag2, Am779, Am780, Am1011, Am854 and VirB1 in A. marginale isolated from erythrocytes ( 87 ) In contrast a similar size d large protein complex in A. marginale isolated from tick cells was formed only by Msp2, Msp3, Msp4, Am778 and Am854. Although Omp7, Omp8 and Omp9 were expressed they did not seem to be localized to the surface This suggests a possible re arrangement in the topology of the surface of A. marginale during the transition from the tick cell into the mammalian cell ( 87 ) Interestingly, the number of Msp2 superfamily members such as omp1 to omp15 in A. marginale subsp centrale i s reduced in comparison with US A. marginale strains ( 57 ) F or example, closely related sequences to omp8 and omp6 are missing and omp10 is found with omp7 and a reduced omp9 in tandem, which may indicate an important function of these genes in the pathogenicity of A. marginale Based on this, further characterization of these omp10::himar1 mutants to understand the effects of the disruption of expression of omp10 9 8 and 7 on the phenotype of A. marginale is of critical importance. Phenotypic effects may include infectivity, ti ck transmissibility, stability under non selectable conditions ability to induce immune responses and ability to establish persistent infection within the natural host

PAGE 57

57 Table 2 1 PCR and Taqman qPCR olig onucleotides used in this study Oligonucleotide sequence (5' to 3') Target Size Reference PCR AB1553 CTCCAATCGGAGGGGTTGTG omp6 492bp (156) AB1554 GCATAAATCCAGTTTAGCCTCC AB1555 GTGGTTAGATCTTTTCTGTTGGG omp7 399bp (156) AB1556 CGCTCTACCACTGACCTTCATG AB1591 GCTGGAGTTCGAAGCGATGC omp8 259bp This study AB1592 CAGAGCGCCCTGTTTCAGTG AB1559 AGCTGGGGCTCTTGCGTTTG omp9 1096bp (156) AB1560 AACATATTCACTATAATCTGACGCTGC AB1561 TCCTTCGGGTTGCTGCGTTG omp10 969bp (156) AB1562 GCTTACCCCCATTCCAGCAC AB1572 AGGATGATCAGCCACACTGGAA 16S 131bp This study AB1573 TACAACCCTAAGGCCTTCCTCA **qPCR AB1591 GCTGGAGTTCGAAGCGATGC AB1592 CAGAGCGCCCTGTTTCAGTG omp8 259bp This study AB1593 GCGTGAGCACTGCGGTACAGACGG AB1581 GAAGTCACTACACGACCTGACTGT AB1582 TAAAGCATCTTCGCGGGTCGT omp9 145bp (156) AB1583 TATTCAGTGCGCTGAACACTGCGATCCA AB1594 GTGGGTGCTGTACGCACATT AB1595 AAAGACAGCAGGCAGCAACA omp10 5' 170bp This study AB1596 CGCGTGTCCTTCGGGTTGCT AB1569 GGTGCTGAGTTGAAGCTTGC AB1570 GCCACAGACCCACTATCAGC omp10 3' 140bp (156) AB1571 TATCTCGCGCTGCATCGGTG AB1572 AGGATGATCAGCCACACTGGAA AB1573 TACAACCCTAAGGCCTTCCTCA 16S 131bp (41) AB1574 TATTGGACAATGGGCGCAAGCCTGAT AB1606 CTCACAGGCGAAGAAGCAGAC AB1607 GCCCGACATACCTGCCTTT msp5 145bp (155) AB1610 TGGGCGACAAGAAGCCAAGTGA AB1608 ATCAAAGCTATTGCGGAGGA AB1607 ACAGAACTCTCCCCATGCAC rpoH 116bp This study AB1611 TGCCAATCGGGACGTTTCGC AB1243 GGCGTGTAGCTAGGCTCAAAGT opag2 151bp (111) AB1250 CTCTCCTCTGCTCAGGGCTCTGCG Primers and TaqMan probes used were manufactured at Eurofins MGM Operon. ** Underlined oligonucleotides are labeled with 6 Carboxyfluorescein 6

PAGE 58

58 Table 2 2 PCR conditions for the amplification of transcripts from omp7 through AM1225 intergenic r egions Step Temperature Time Denaturation 94C 2 minutes Denaturation 94C 10 seconds 35 cycles Annealing 60C 58 seconds Extension 68C 2 minutes Extension 68C 10 minutes

PAGE 59

59 Table 2 3. PCR conditions for the amplification of transcripts from omp6 through omp10 from cDNA obtained from ISE6 cells infected with A. marginale wild type and omp10::himar1 mutant organisms Step Temperature Time Denaturation 94C 2 minutes Denaturation 94C 10 seconds 35 cycles Annealing *60C/**65C 58 seconds Extension 68C 2 minutes Extension 68C 10 minutes *Annealing temperatures used for the amplification of omp6 omp7 omp8 and 16S ribosomal subunit. **Annealing temperature used for the amplification of omp9 and omp10

PAGE 60

60 Table 2 4 qPCR reactions and amplification conditions Step Temperature Time Denaturation 95C 15 minutes Denaturation 94C 15 seconds 40 cycles Annealing/Extension 60C 1 minute Data collection

PAGE 61

61 Table 2 5 qPCR amplification efficiencies *GOI qPCR efficiency E=(5 1 /slope ) 1 omp8 0.98 omp9 0.96 omp10 5' end 0.93 omp10 3' end 0.97 msp5 0.95 rpoH 0.90 16S 0.90 *GOI, gene of interest

PAGE 62

62 Table 2 6. Relative amplification efficiencies Reference genes Relative efficiencies slopes omp8 0 .0327 msp5 omp9 0 .0182 omp10 5' end 0 .0267 omp10 3' end 0 .0826 omp8 0 .0273 rpoH omp9 0 .0127 omp10 5' end 0 .0676 omp10 3' end 0 .1211 omp8 0 .0226 16S omp9 0 .0848 omp10 5' end 0 .0061 omp10 3' end 0 .0223

PAGE 63

63 Figure 2 1 Specificity of primers and probes in RT qPCR reactions. omp8 259bp, omp9 145bp, omp10 end, 170bp, omp10 end, 140bp, msp5 139bp, rpoH 116bp and 16S 131bp.

PAGE 64

64 Figure 2 2 Transformation of Anaplasma marginale A. Plasmid map of pHimarcisA7mCherry SS used for the electroporation of A marginale str.Virginia B. Fluorescent (left) and phase contrast/fluorescence merged ( r ig ht ) images, of red fluorescent A. marginale replicating in ISE6 tick cells.

PAGE 65

65 Figure 2 3 Mapping of Himar1 transposon insertion site A. Sequencing reads that align at one end with A. marginale genome sequences (grey line), and with the Himar1 TIR (black bars) at the other end. Yellow lines represent the TIR A.marginale chromosome junctions. B. Location of primer pairs (AB1553 AB1554) and ( AB1561 AB1562) designed to target the omp6 and omp10 genes respectively, in wild type (WT) and transformed A. marginale Based on sequencing results the Himar1 sequences are i ntegrated in the chromosome of transformed A. marginale at nucleotide 246 from th e omp10 start codon (arrows) and mCherry and aadA (Str/Spc resistant) genes are in the opposite orientation to omp10 C. Agarose Gel electrophoresis. gDNA isolated from ISE6 tick cells infected with WT and transformed A. marginale was used as template for PCR amplification with primers shown in B. (Lane 1) 100bp/1Kb DNA ladder. omp6 amplicons in transformed (lane 2) and WT (lane3) A. marginale were the same 492bp size The o mp10 amplicon in transformed A. marginale (lane 4) was 28 05bp, while in wild type wa s 969bp.

PAGE 66

66 Figure 2 3 Continued

PAGE 67

67 Figure 2 4 Himar1 transposon insertion site in the A. marginale str. Virginia genome. A. ACT (Artemis Comparison Tool) wi ndow showing alignment between the A. marginale genome (CP000030) modified by inserting the Himar1 transposon sequences into omp10 at 1093291 nucleotide. This shows the relationship between part of omp10 and upstream genes of A. marginale str St Maries (reference genome) and the contig formed by Roc he/ 454 and Illumina sequencing reads from the A. marginale str. Virginia mutant. These two sequences share 99% identity (red band) B. Window showing transposon sequences (black arrows). Yellow line represents omp10 start codon 245 nt from the transposon inse rtion site.

PAGE 68

68 Figure 2 4 Continued

PAGE 69

69 Figure 2 5 Characterization of Himar1 transposon insertion site. A. Artemis (genome browser and annotation tool) window showing the A. marginale genome (CP00003 0) used as a reference for the location of the omp10 gene ( AM1223 1092273 1093555), and the TA dinucleotide (1093290 1093291) at the Himar1 tn insertion site (arrow) determined by high throughput genome sequencing analysis. B. Himar1 tn insertion into the omp10 gene was mediated by the A7 transposas e in a cut and paste mechanism leading to the duplication of TA dinucleotide sequences. A. marginale genome (underlined uppercase text, TA dinucleotide duplications (enhanced uppercase text) flanking the tn elements (bold lowercase).

PAGE 70

70 Figure 2 6 In tergenic regions of Omp7 to AM1125 analyzed by RT PCR. A. Diagrammatic representation of the AM1225 Omp6 operon with AM1225 omp10, omp9 omp8 omp7 and omp6 and intergenic regions. Location of primer pairs (AB1556 AB1591), (AB1592 AB1581), (AB1582 AB1569) and (AB1655 AB1595) designed for PCR amplification of omp7 8 omp8 9 omp9 10 and omp10 AM1225 intergenic regions using cDNA from ISE6 cells infected with A. marginale wild type. B. Agarose gel analysis of amplicons connecting intergenic regions from omp7 through AM1225 (lanes 2, 5, 8, and 11). DNA was used as positive control (lanes 4, 7, 10, and 13). cDNAs from reactions with no reverse transcriptase were used as negative controls (lanes 3, 6, 9 and 12). 100bp/1Kb DNA ladder (lane 1).

PAGE 71

71 Figure 2 7 Transcriptional analysis of the effect of the insertion of the Himar1 transposon within the omp10 gene by RT PCR. A ) Binding sites of primers (AB 1553 AB1554), (AB1555 AB1556), (AB1591 AB1592), (AB1559 AB1560), and (AB1561 AB1562), designed to a mplify transcripts on omp6 omp7 omp8 omp9 and omp10 resp ectively in wild type (WT) and omp10::himar1 mutant. cDNA from WT and omp10::himar1 mutant grown in IS E6 tick cells was used for PCR amplification for omp6 throu gh omp10 with specific primers to evaluate gene expression. B ) Agarose gel analy sis of PCR products for omp6 thro ugh 10 in omp10:: h imar1 mutant (lanes 2, 8, 14, 20, and 26). PCR products for omp6 through 10 in WT (lanes 5, 11, 17, 23, and 29). DNA was used as posi tive control (lanes 4, 7, 10, 13, 16, 19, 22, 25, 28, and 31). c DNA from no reverse transcriptase r eactions were used as negative controls (lanes, 3, 6, 9, 12 15, 18, 21, 24, 27, and 30). 100bp/1Kb DNA ladder lan e 1). 16S rRNA (AB1572 AB1573) was used as internal control to e nsure integrity of cDNA (lanes 32 37).

PAGE 72

72 Figure 2 8 Relative gene expression determined by RT qPCR. A ) Location of binding sites for primers and probes designed to target omp8 (1. AB1591, 2. AB1592, 3. AB1593), omp9 (4. AB1581, 5. omp10 (7. AB1569, 8. AB1570, omp10 (10. AB1594, 11. AB1595 12. AB1596). B ) Bar lengths represent the percentage of expre ssion of omp8 omp9 omp10 omp10 in A. marginale wild type (red bars) and o mp10::himar1 mutant (blue bars). msp5 rpoH and 16S rRNA were used as reference genes for data normalization. Changes in expression of these genes were calculated using the 2 method. Significant differences ( P 0.05) w ere calculated as described in materials and methods.

PAGE 73

73 Figure 2 8 Continued

PAGE 74

74 Figure 2 9 Immunoblotting of omp10::himar1 muta nt and wild type Anaplasma marginale using the specific monoclonal antibody against Omp9 Proteins from equal am ounts of host cell free wild type (WT) and omp10::himar1 A. marginale were separated by SDS PAGE gel electrophoresis. Immunoblot PVDF membranes of transferred proteins were reac ted with monoclonal antibodies and reactions were visua lized by chemiluminiscen ce. A ) Monoclonal antibody Omp9 (4 g/ml) with specificity to Omp 9 protein (40kDa) (black arrow). B ) Negative control, monoclonal Tryp1E1 (4 g/ml) (exhibits spec ificity for a variable surface glycoprotein of Trypanosome brucei C ) Monoclonal F16C1 (2 g/ml), reacts with the Msp5 (19kDa) (blue arrow) protein of A. marginale was used as loading control. A. marginale str. Virginia and uninfected ISE6 cells were used as positive and negative controls respectively

PAGE 75

75 CHAPTER 3 PHENOTYPICAL CHARACTERIZATION OF AN OUTER MEMBRANE PROTEIN KNOCKOUT GENERATED BY TRANSPOSON MUTAGENESIS I ntroduction Anaplasma marginale is a tick associated bacterium and the etiologic agent of bovine anaplasmosis, a disease that causes considerable losse s to both dairy and beef industries worldwide ( 6 9 ) Although organisms of this species are principally pathogenic to cattle, they are also found in other ru minants such as water buffalo and deer ( 11 ) The transmission cycle of A. marginale has been well documented and indicates that the success of this pathogen depends on its ability to adapt to its invertebrate and vertebrate hosts. In the tick, during its transit from the midgut up to the salivary glands, A. marginale has to overcome different tissue barriers and defense mechanisms in order to ensure its transmission to the vertebrate host ( 163 165 ) In cattle, A. marginale replicates within mature erythrocytes producing an acute disease characterized by hemolytic anemia. However, one of the most important features of the biology of these bacteria is the lifelong persistent infection of its ruminant host. This is achieved by evasion of the immune system using a mechanism of antigenic variation in which different variants of outer membrane proteins such Msp2 and Msp3 are expressed. Therefore persistently infected cattle remain a reservoir of A. marginale organisms for continue d tick transmission ( 14 23 26 47 165 ) Thus the ability of A. marginale to thrive in such diverse environments could indicate that this pathogen uses a variety of genes to facilitate its survival. Hence the identification and characterization of these genes using recombinant DNA technologies is not only central to understanding the biology and pathogenesis of these organisms but also for the development of drug therapies and vaccines for the control of anaplasmosis. Recently, the use of transposon mutagenesis in A. marginale to create insertional knockout mutations was demonstrated ( 166 )

PAGE 76

76 Delivery of a plasmid containing the Himar1 transposon and the A7 transposase into host cell free A. marginale resulted in the isolat ion of red fluorescent and spectinomycin and streptomycin resistant bacteria. Molecular characterization of these isolated mutant organisms established that the Himar1 transposon sequences were integrated within the omp10 gene and that its insertion not on ly altered the expression of this gene but also the expression of the downstream genes omp9 omp8 and omp7 Nevertheless these recombinant A. marginale organisms, referred to as omp10::himar1 mutants, are capable of infecting tick cell cultures suggesting that these genes are not essential for the survival of A. marginale in this environment ( 166 ) In A. marginale omp10 omp9 omp8 and omp7 are outer membrane protein genes and part of the omp1 t h rough omp14 clusters. These members of the msp2 superfamily correspond to the pfam01617 family of bacterial surface antigen s ( 33 156 ) RNA sequencing demonstrated that in A. marginale infected erythrocytes omp10 is transcribed as part of an operon with AM1225 omp9 omp8 omp7 and omp6 ( 62 ) Similarly during infection of tick ce lls RT PCR experiments showed that A. marginale expresses these genes as a polycistronic message ( 166 ) Given the potential role of omp10 omp9 omp8 and omp7 in the pathogenesis of A. marginale I hypothesized that the reduction of the expression of these outer membrane protein genes c aused by insertion of the Himar1 transposon sequences into omp10 could result in an altered phenotype. Because of this I wanted to determine if these A. marginale omp10::himar1 mutants have morphological and or growth rate defects when compared to wild ty pe A. marginale whether the transposon insert is stable withou t antibiotic selective pressure and f inally, evaluate if these mutant bacteria could infect and colonize mammalian cells.

PAGE 77

77 M aterials and M ethods Cell L ines and Anaplasma m arginale C ultivation For this work two cell lines we re used Tick ISE6 cells derived from embryonated eggs of the blacklegged tick Ixodes scapularis were kept at 34 C in non vented T 25 cell culture flasks (Nunc) and maintained in tick L 15B300 media supplemented with 10% hea t inactivated Fetal Bovine Serum (FBS) (Fisher Scientific) and 5% of tr y ptose phosphate broth (BD diagnostics) ( 151 ) The mammalian cells RF/6A (ATCC CRL 1780) from the retina choroid endothelium of rhesus monkey Macaca mulata were kept at 37C in vented T 25 cell culture flasks (Corning) and maintained in RPMI 1640 media (Hyclone) supplemented with 10% heat inactivated FBS, 2mM L Glutamine (Life technologies), 0.25% NaHCO3 (Sigma Aldrich) and 25mM HEPES (Si gma Aldrich) ( 31 ) A. marginale str. Virginia wild type and omp10::himar1 mutant were maintained in tick ISE6 cells at 34 C in tick cell media supplemented with 1% L ipogro (Rocky Mountain Biologicals), 25mM HEPES (Sigma Aldrich) and 0.1% NaHCO3 (Sigma Aldrich). Infected RF/6A endotheli al cells with wild type and omp10:: h imar1 A. marginale were maintained in supplemented RPMI 1640 media and incubated at 37 C in a 5% CO2 environment. Western Immunoblots Binding pattern and specificity of the rabbit R883 antibody (monospecific antibody t o affinity purified Msp2 ( 167 ) in A. marginale wild type and omp10::himar1 mutant was assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting using equal amounts (10 8 ) of host free bacteria. Membranes were incubated with the polyclonal R883 anti Msp2 antibody, and the n ormal rabbit serum (NRS). This las t antibody served as a negative control. Final dilutions of each antibody were 1:10,000. Antibody binding was detected with protein G, horseradish peroxidase conjugated (Life technologies) diluted to 1: 75,000 and

PAGE 78

78 SuperSignal West Femto Chemiluminescent Sub strate (Thermo scientific) as described in Immuno Transmission Electron M icroscopy Cultures of ISE6 tick cells 50% infected with wild type and omp10::himar1 mutant A. marginale as estimated by microscopy analysis of slides stained with Diff Q u ik were fixed with Electron Microscopy (EM) grade 4% paraformaldehyde, 1 % glutaraldehyde in 1X PBS, pH 7.24. Fixed cells were processed with the aid of a Pelco BioWave Prolaboratory microw ave (Ted Pella, INC). Samples were washed in 1X PBS pH 7.24, water washed and dehydrated in a graded ethanol series 25%, 50%, 75%, 95%, 100%, 100%, infiltrated in HM20 acrylic resin (Electron Microscopy Sciences) and UV cured at 10C for 48 hours. Cured r esin blocks were trimmed, ultra thin sectioned and collected on formvar coated Ni 400 mesh grids (Electron Microscopy Sciences). Ultrathin sections were immune labeled at room temperature as follows: grids were treated with 200mM NH 4 Cl in 1X HST ( 0.5 M NaC l, 0.02M, 0.1% Tween 20, pH 7.2 ) for 20 minutes, rinsed in high salt tween (HST), incubated for 1 hour with blocking solution 1.5% BSA, 0.5% cold water fish skin gelatin, 0.01% tween 20 in HST pH 7.2, and incubated with R883/ anti Msp2 in 1:10,000 dilution or the normal rabbit ser um in 1:10,000 dilution overnight at 4C. The following day, the grids were washed in PBS 3X for 10 minutes each and incubated for 1 hour at 21C i n 18 nm colloidal gold affinity purified goat anti rabbit IgG (Jackson Immuno Rese arch) diluted 1 : 30 in PBS solution. Subsequent washes were in PBS and dist illed water, then samples were post were examined with a Hitachi H 7000 t ransmission electron microscope. Anaplasma m arginale W ild T ype and o mp10 ::himar1 M utant G rowth C urves The growth kinetics of A. marginale wild type and omp10::himar1 mutant were determined by Taqman quantitative real time PCR (qPCR) of genome equivalents (GE). Two

PAGE 79

79 groups of 12 T 25 cell culture flasks, each with confluent monolayers of uninfected ISE6 cells, were inoculated with 1ml of ISE6 >90% infected with A. marginale wild type and omp10::himar1 mutant. 24 hours after inoculation, the inoculum was removed and replaced with 5ml of fres h supplemented tick cell media and this time was considered 0 h postinfection (p.i.). Duplicate cultures of infected cells with each A. marginale strain were harvested at different time points (0, 3, 5,9, 11 and 13 days) p.i. Infected cells were harvested f rom the flask surface with a cell scraper into the supernatant, and centrifuged at 100g for 7 mins at room temperature and washed twice in 1X PBS. The final pellet was used for DNA extraction and quantification of A. marginale GE. Statistical differences in growth rates were evaluated using test with SigmaPlot ( Systat Software ). DNA E xtraction and qPCR DNA isolation from tick ISE6 cells infected with A. marginale wild type and omp10::himar1 mutant was performed using the QIAamp DNA Mini kit (QIAGEN) as per of each sample was determined using the Qubit dsDNA HS assay kit (Life technologies) on a Qubit fluorometer (Life technologies). Quantificati on of A. marginale wild type and omp10::himar1 GE was performed by qPCR using the forward and reverse primers AB1242 and B1243 (table 1) and the probe AB1250 that targets the single copy gene opag2 ( 111 ) Triplicate reactions from each duplicate culture at each time point were used. Reactions of 25 L containing 5 L of DNA from A. marginale wild type and omp10::himar1 mutant strains, 1X of Quantitect Probe PCR mix (QIAGEN), 0.4 M forward and reverse primers and 0.2 M of probe were used fo r amplification in a Bio Rad DNA engine Opticon thermal cycler

PAGE 80

80 with the following conditions, 95 C for 15 min and 40 cycles of 94 C for 1 min, 54 C for 15s and 60 C for 1min. Ten fold serial dilutions of the opag2 /pCR TOPO vector were used for standard cur ve preparation, and the A. marginale copy number was calculated based on the standard curve. No template control, uninfected cells and DNA from Anaplasma phagocytophilum were used as negative controls. Insert S tability The stability of the transposon inse rtion without antibiotic (spectinomycin streptomycin) selective pressure in A. marginale omp10::himar1 mutants was evaluated by measuring the variation of the ratio of the aadA (spectinomycin/streptomycin resistance gene containing insert) copy number over A. marginale GE using qPCR during 7 serial passages. A. marginale GE were calculated using the opag2 single copy gene as previously described and the aadA gene was amplified using the forward and reverse primers AB1345 and AB1346 ; the probe was AB1347 (Table 3 1). Ten fold serial dilutions of the pHimarcisA7mCherry SS plasmid were used for standard curve preparation, and the aadA gene copy number was calculated based on the standard curve. Triplicate reactions from cultures at each passage were used. Reactions of 25 L containing 5 L of DNA from A. marginale omp10::himar1 mutant, 1X of Quantitect Probe PCR mix (QIAGEN), 0.4 M forward and reverse primers and 0.2 M of probe wer e used for amplification in a Bio Rad DNA engine Opticon thermal cycler with the following conditions, 95 C for 15 min and 40 cycles of 94 C for 1 min, 54 C for 15s and 60 C for 1min.

PAGE 81

81 Infection of E ndothelial RF/6A cells with Anaplasma marginale omp10 ::h i mar1 M utant For infection of RF/6A endothelial cells, A. marginale omp10::himar1 and wild type in ISE6 were used as primary i no culum. ISE6 cells that were lysing due to heavy infection ( >90% ) with wild type or omp10::himar1 A. marginale were transferred i nto a sterile centrifuge tube and briefly vortex ed for 30 seconds to release bacteria. 1m L of inoculum from each strain was added to three well s (triplicate) of a six well plate (Corning) and cultures incubated at 37 C in a 5% CO 2 environment. 2 days post infection the inoculum was removed and the media was replaced with fresh supplemented RPMI 1640 media. Media was replaced twice a week and infection was monitored daily by phase contrast and fluorescence and once a week by Diff Qu ik staining. Dual immunofluorescence to confirm RF/6A infection with the omp10::himar1 and wild type A. marginale was performed using the monoclonal ANAF16C1 (anti Msp5) ( 76 ) antibody and the rabbit anti human v on Willebrand factor ( 27 32 ) Ten days after inoculation of RF/6A endothelial cells with A. marginale wild type and omp10::himar1 mutant maintained with and without antibiotic (spectinomycin streptomycin) selection, cell monolayers f ro m T 25 cell culture flasks were detached by trypsinization and centrifuged at 100g for 7 minutes at room temp. The supernatant was resuspended in fresh media then an aliquot was taken for Diff Quik staining and approximately 500 L containing of 10 4 cells were transferred in triplicate into 8 chamber slides (N UNC ) and incubated overnight at 37 C in a 5% CO 2 environment. Next morning RPMI 1640 medi um was remov ed and monolayers were washed three times with buffered saline (PBS), pH 7.5 without Ca 2+ and Mg 2+ Cells were fixed by adding 300 L of acetone and incubated at room temperature for 10 minutes. Samples were blocked by adding 100 L of 5% BSA diluted in PBS and incubated in a humid atmosphere at room temperature for 1 hour and subsequently washed once with 0.05% tween 20 (Sigma Aldrich) in PBS.

PAGE 82

82 Samples were then reacted with primary and secondary antibodies as described previously ( 27 32 168 ) Briefly samples were incubated for 1 hour at room temperature in a humid atmosphere with either antibody, monoclonal anti Msp5 (ANAF16C1) 2 g/ m L or polyclonal anti human v on Willebrand antibody (Dako) 1:2dilution or an equal part mixture of mouse monoclonal anti MSP5 antibody (ANAF16C1) 2g/ m L and rabbit anti human von Willebrand factor antibody (Dako). Negative control monoclonal Tryp 1 E1 antibody that exhibits specificity for a variable surface glycoprotein of Trypanosome brucei was used at a concentration of 2g/ m L and the n ormal rabbit serum was used at 1:2 dilution. Samples were then washed with 500 L of 0.05% tween 20 (Sigma Aldrich) in PBS three times for 5 mins at room t emperature and then reacted with secondary antibodies, Alexa Fluor 488 Goat Anti Mouse IgG antibody (Life technologies) to detect reaction with the primary ANAF16C1 and Alexa Fluor 568 Goat Anti Rabbit IgG antibody (life technologies) to detect reaction wi th v on Willebrand factor. Both secondary antibodies were used at a 1:400 dilution. Afterward, slides were washed as above, air dried and mounted using ProLong Gold Antifade Reagent with DAPI (4',6 diamidino 2 phenylindole, dihydrochloride (Life T echnologie s). I nfection of Cattle with Anaplasma m arginale o mp10 ::himar1 M utant Experiments to evaluate the infectivity of the A. marginale omp10::himar1 mutant for cattle were performed as a collaborati on at Washington State University by Dr. Kelly Brayton. One spleen intact Holstein calf (#42362) was inoculated intravenously with approximately 10 5 A. marginale omp10::himar1 Cells were scraped from a heavily infected T 25 culture flask, passed 20 times through a 20 gauge needle prior to injection. The calf was monitored for signs of infection by Giemsa stained blood smears, PCR and Southern analysis to detect M sp5 ( 169 ) and by competitive Enzyme linked immunosorbent assays (cELISA) ( 77 ) B ecause these tests were negative, a second attempt was made to infect the same calf at day 71

PAGE 83

83 post the initial inoculation. Succesful infection of cattle by intravenous inoclulation of A. marginale has been reported with doses ranging from 10 4 up to 10 8 o rganisms in A. marginale str St. Maries and the attenuated A. marginale subsp c entral e (88, 137) Based on this a second trial delivered approximately 10 8 omp10::himar1 mutant A. marginale The animal was monitored for a further 46 days. R esults Electron M icroscopy of Anaplasma m arginale o mp10 ::himar1 M utant Transmission electron microscopy of omp10:: h imar1 A. marginale immunogold labeled with polyclonal anti Msp2 (R883) antibody could aid i n the localization, visualization and analysis of these o rganisms to determine if their morphology is characteristic of what has been described for wild type A. marginale Control reactions for immunogold labeling included ISE6 cells infected with wild type A. marginale as positive control and n ormal rabbit serum (NRS) as negative control. The polyclonal anti Msp2 R883 antibody binding pattern and specificity was evaluated by Western immunoblot. A. marginale omp10::himar1 and wild type copy number per sample was quantified by qPCR using the opag2 sin gle copy gene. 10 8 organisms of A. marginale wild type and omp10::himar1 mutant were loaded per lane. A. marginale str. Virginia initial bodies and uninfected ISE6 cells were used as positive and negative controls respectively. R883 specifically reacted wi th the major surface protein Msp2 (36 KDa) in A. marginale omp10::himar 1, wild type, and initial bodies ( Figure 3 1 ). A s imilar reaction was not detected in the uninfected ISE6 cells or using negative control n ormal rabbit serum ( F ig 3 1). Immunoelectron microscopy with colloidal gold affinity purified goat anti rabbit IgG and rabbit anti Msp2 antibody revealed gold particles bound to the omp10:: h imar1 and wild type A. marginale surface (Fig ure 3 2 panels A and B) G old particles were not observed on the

PAGE 84

84 m embranes of omp10:: h imar1 and wild type A. marginale labeled with normal rabbit serum (NRS) (Fig ure 3 2 panels C and D). The typical developmental cycle of A. marginale in tick cells involve two stages; a reticulate or vegetative form and the infective den se f or m. Upon internalization A. marginale is enclosed within a parasitophorous vacuole where it transitions into a reticulate form that divides by binary fission to produce multiple organisms that subsequently will change into the infective dense forms th at will be released to infect adjacent cells ( 19 ) Based on electron microscopy analysis morphological defects in the omp10:: h imar1 mutant that could alter its development in infected ISE6 we re not f ou nd I nstead several of the characteristics common to the prototypical wild type A. marginale were visualized for example, A. marginale omp10::himar1 mutant grows within membrane bound inclusions or intravacuolar microcolonies (morulae) ( 19 151 ) ( Figure 3 3 panel A) Also also the ISE6 were infected with several morulae, a n indication of multiple omp10:: h imar1 A. marginale invasion events (Fig ure 3 3 panels B and C) typical of A. marginale infection ( 151 ) We found morulae containing a homogeneous population of only enlarged oval organisms or only round bacteria (Fig ure 3 3 panel B and C) and some containing a heterogeneous population containing both shapes of bacteria (Fig ure 3 3 panel C ). The two distinct morphological forms of A. marginale were also visualized in ISE6 cells infected with the omp10::himar1 mutant; enlarged oval and electron translucent or reticulate forms (Fig ure 3 3 panel D) and the round or coccoid electron dense forms (Fig ure 3 3 panel E). Several reticulated forms of omp10::himar1 A. marginale were undergoing cell division by binary fission consistent with previous TEM descriptions of A. marginale in ISE6 cells (Fig ure 3 3 panel D) ( 19 ) Reticulate and dense forms of omp10:: h imar1 A. marginale have an outer and inner membrane separated by a periplasmic space (Figure 3 3

PAGE 85

85 panel E) These observations suggest that the morphology and development of A. marginale omp10::himar1 mutant in tick cell culture is similar to what has been observed previousl y Growth C urves of Anaplasma m arginale o mp10 ::himar1 vs W ild T ype A. marginale omp10::himar1 mutant was further characterized by comparing its in vitro growth rate to wild type A. marginale Duplicate cultures of infected ISE6 maintained without antibiotic (spectinomycin streptomycin) selection were evaluated to determine the increase of genome equivalents by qPCR over a period of 13 days. At day 0 p.i. the genome equivalents mean copy numbe r for omp10::h imar1 and wild type A. marginale were 6.15x10 5 copies/l (95% CI, 5.99x10 5 to 6.31x10 5 ) and 5.88x10 5 copies/l (95% CI, 5.3x10 5 to 6.37x10 5 ) respectively. At day 13 p.i. the omp10:: h imar1 and wild type genome equivalents copy number were 2.31 x10 7 copies/l (95% CI, 2.25x10 7 to 2.36x10 7 ) and 2.84x10 7 copies/l (95% CI, 2.63x10 7 to 3.04x10 7 ) respectively Both, A. marginale omp10::himar1 and wild type had a log increase of genome equivalents o f ~1. 27 and 1. 28 respectively (Fig ure 3 4). The growth rates of the omp10::himar1 mutant and wild type A. marginale were not significantly different (P=0.763) and rather they had indistinguishable doubling times of 59.4 hours (2.5 days) for omp10:: h imar1 and 55.6 hours (2.3 days) for wild type A. marginale Insert S tability Stable maintenance of the transposon insertion was evaluated by qPCR to determine the copy number of the transposon insert per omp10::himar1 A. marginale genome with primers and probes (Table 3 2 ) specific to the transposon bearing aminoglycoside adenyl transferase gene aadA and the single copy gene opag2 For this purpose, DNA samples obtained from duplicated cultures of ISE6 cells infected with the A. marginale omp10:: h imar1 mutant maintained during seven serial passages ( ~3 months) without antibiotic (spectinomycin/streptomycin) selection were analyzed. DNA obtained from similar cultures of ISE6 cells infected with the A. marginale

PAGE 86

86 omp10:: h imar1 mutant receiving antibiotic selection were used as a positive control for inse rt maintenance. ( Table 3 2) shows the comparison of the copy numbers obtained for the aadA and the opag2 genes in ISE6 cells infected with the mutant with and without antibiotic selection. During the culture, loss of the insert could be indicated by a decr ease in the aadA gene copy number and an increase in the opag2 gene copy number. However during the seven serial passages of the mutant A. marginale maintained without antibiotic selection the aadA and the opag2 copy numbers were close and had an aadA/opa g2 ratio comparable to that in cultures of the mutant receiving antibiotic treatment. These results indicate that the transposon insertion in the A. marginale omp10:: h imar1 mutant appears to be stable without antibiotic selection for prolonged culture periods. Infectivity of o mp10 ::himar1 Anaplasma m arginale to M ammalian C ells I n V i tro and I n V ivo Anaplasma marginale can be propagated in vitro in RF/6A endothelial cells derived from retina choroid of rhesus monkey ( 27 31 ) To investigate if the A. marginale omp10:: h imar1 mutant can infect RF/6A endothelial cells, triplicate cultures of uninfected RF/6A endothelial cells were infected with lysing ISE6 cells ( >90% infected) with A. marginale omp10:: h imar1 mutant and maintained with and without antibiotic (spectinomycin str eptomycin) selection. Similarly, and as control for infection of endothelial cells, triplicate cultures of uninfected RF/6A cells were infected similarly with wild type A. marginale. Infection of A. marginale omp10::himar1 mutant in RF/6A cells was monitor ed by increase of red fluorescence emitted by replicating mCherry expressing Anaplasma By ten da ys postinfection about 50% 60% of the cells were infected in cultures maintained with and without (spectinomycin streptomycin) antibiotic selection (Fig ure 3 5 panels A D). Percentage of infection was confirmed by Diff Quik staining and was similar in RF/6A cells infected with

PAGE 87

87 wild type A. marginale The cytoplasm of infected cells contained a single large morula or was filled with small morulae that fluoresced red and which resembled those visualized in Diff Quik stained cells (Fig ure 3 5 panels C, D and E). To confirm omp10:: h imar1 A. marginale infection of endothelial cells double immunofluorescence was performed using the monoclonal ANAF16C1 antibody that r eacts with the major surface protein 5 (Msp5) of A. marginale ( 76 ) and the rabbit anti human v on Willebrand factor that reacts to this factor present within Weibel Palade bodies of endothelial cells ( 27 32 ) Binding specificity to A. marginale Msp5 was showed in chapter 2 (Figure 2 9 pane l C). Negative controls for the ANAF16C1 and anti human v on Willebrand factor antibodies were the monoclonal antibody Tryp1E1 that exhibits specificity for a variable surface glycoprotein of Trypanosome brucei and n ormal rabbit serum (NRS) respectively. Th e samples used for dual labelling were RF/6A cells infected with A. marginale omp10::himar1 mutant maintained with and without antibiotic and RF/6A endothelial cells infected with wild type A. marginale Fig ures 3 6 and 3 7 panels A and B show the immunofl uorescence results of the specific binding of the antibodies ANAF16C1 anti Msp5 to omp10:: h imar1 A. marginale (green) and the anti human v on Willebrand factor to RF/6A cells (red), that confirms that the entire monolayer was formed by endothelial cells. Juxtaposition of the green and red fluorescence signals showed co localization of omp10::himar mutant A. marginale (green) within endothelia l cells (red). Fluorescence similar to th at emitted using these two specific antibodies was not detected in RF/6A endothelial cells infected with omp10::himar1 A. marginale labeled with the monoclonal TrypE1 and the normal rabbit serum respectively. (Fig ur es 3 6 and 3 7 panels D and E).

PAGE 88

88 Similar results were obtained from RF/6A cells infected with wild type A. marginale Fig ure 3 8 panel A and B show specific binding of the antibodies ANAF16C1 anti Msp5 to wild type A. marginale (green) and the anti human v on Willebrand factor to endothelial cells (red) respectively. Juxtaposition of gre en and red fluorescent signals Fi gure 3 8 panel C show co localization of wild type A. marginale organisms within RF/6A endothelial cells. Fluorescence similar to th at emi tted by these two specific antibodies was not detected in RF/6A endothelial cells infected with omp10:: h imar1 A. marginale labeled with the monoclonal TrypE1 and the normal rabbit serum respectively (Fig ure 3 8 panels D and E). A ssess ment of infectivity of the omp10::himar1 A. marginale derived from ISE6 tick cell culture to cattle was performed at Washington State University For this, a calf was inoculated with 10 5 omp10::himar1 mutant A. marginale but failed to show signs o f infection. After 71 days the calf was inoculated with a second dose of omp10::himar1 mutant A. marginale containing 10 8 organisms. Giemsa stained blood smears, PCR and Southern blot analysis and competitive Enzyme linked immunosorbent assays (cELISA) to identify M sp5 did not detect A. marginale omp10::himar1 infection in red blood cells. A final c ELISA was negative 112 days post the initial inoculation. Seroconversion is a hallmark of infection with A. marginale and, thus a negative cELISA is indicat ive of a lack of infection ( 76 ) D iscussion The ability of A. marginale to cause disease often depends on its ability to invade and replicate within different hosts. During this work we investigate d the phenotype of omp10::himar1 A. marginale that carries the Himar1 transposon integrated within the omp10 gene. Electron micros copy show s that A. marginale omp10::himar1 mutant grows within membrane bound vacuoles, and develops into reticulate forms that divide by binary fission and

PAGE 89

89 into round dense forms suggesting that these mutant organisms develop in similar fashion to wild ty pe A. marginale in tick cell culture ( 15 18 19 151 ) Msp2 is expressed and localized in the A. marginale outer membrane during tick and erythrocyte infection ( 87 157 ) Results obtained with immunolabeling of Msp2 with anti Msp2 antibody (R883) also suggest that the gross structure of the out er membrane of these organisms was not affected by disruption in the expression of omp10 omp9 omp8 and omp7 since this antibody localized on the surface of both omp10:himar1 and wild type A. marginale Growth curve results support electron microscopy findings since they show that A. marginale omp10::himar1 mutant growth is comparable to wild type. Stability of the Himar1 insertion under non antibiotic selectable conditions has been demonstrated in seve ral pathogenic bacterial species ( 170 171 ) and which is also is true for A. marginale omp10::himar1 mutant. Stability of transposon insertion in the omp10::himar1 A. marginale was monitored during seven serial passages over 3 months in cultures of infected ISE6 kept without antibiotic selection and which was maintained as one Himar1 insert per A. marginale geno me. Additionally the red fluorescence phenotype was maintained for the length of the culture period Previous work ha s indicated a possible important role of omp10 omp9 omp8 and omp7 in the pathogenesis of A. marginale For example, these genes are expr essed at lower levels in tick cells than in erythrocytes, and outer membrane proteome analysis and crosslinking experiments showed that although expressed, Omp9, Omp8 and Omp7 proteins are not localized at the surface of A. marginale infecting tick cells ( 87 156 ) O n the other hand, in infected erythrocytes, these proteins are localized at the surface of A. marginale suggesting a possible rearrangement in the topology of the surface of A. marginale during th e transition from tick to mammalian cells ( 87 ) Based on this, I hypothesized that A. marginale omp10::himar1 mutant

PAGE 90

90 was not infective to mammalian cells. To test this, infectivity of A. marginale omp10::himar1 mutant in RF/6A endothelial cell cultures and in cattle w as assessed Surprisingly, A. marginale omp10::himar 1 invades and replicates within RF/6A endothelial cells similar to wild type d emonstrating that disruption of omp10 and downstream genes did not affect infectivity of these mutants in endothelial cell cultures in vitro However, in a preliminary experiment a spleen intact calf was injected intravenously with two different doses o f A. marginale omp10::himar 1 organisms Giemsa stained blood smears, PCR and Southern blot analysis and competitive Enzyme linked immunosorbent assays did not detect A. marginale omp10::himar 1 infection. These results may suggest a correlation between loss of expression of omp10 omp9 omp8 and omp7 genes caused by the Himar1 transposon insertion within omp10 and lack of infectivity to red blood cells in cattle, reinforcing the hypothesis that these genes could be virulence determinants of Anaplasmosis. One example that support s this idea is the fact that in A. marginale subsp. centrale a naturally attenuated subtype, closely related sequences to omp8 are missing and omp10 is found with omp7 and a reduced omp9 in tandem ( 57 ) Hence, further work to confirm that these A. marginale omp10::himar1 mutant organisms are less infective to cattle is of critical importanc e to determine its potential utility as a live attenuate d vaccine. In conclusion this work demonstrated that t ransposon insertion into the coding sequence of omp10 and the disruption of the expression of downstream genes did not affect development and growth of omp10::himar1 in tick cell cultures and that the mutants retain infectivity for endothelial cells in vitro A spleen intact calf inoculated with two different doses of these omp10 ::himar1 A. marginale failed to show signs of infection

PAGE 91

91 Table 3 1 Taqman qPCR olig onucleotides used in this study Oligonucleotide sequence (5' to 3') Target Size Reference AB1242 5' AAA ACA GGC TTA CCG CTC CAA 3' AB1243 5' GGC GTG TAG CTA GGC TCA AAG T 3' opag2 151 bp (111) *AB1250 5' CTC TCC TCT GCT CAG GGC TCT GCG 3' AB1345 5' GGTGACCGTAAGGCTTGATG 3' AB1346 5' ACCAAGGCAACGCTATGTTC 3' aadA 279 bp herein **AB1347 5' ACCATTGTTGTGCACGACGACA 3' Oligonucleotide labeled with 6 Carboxyfluorescein (6 FAM) at the 5' end a n d Tetramethylrhodamine (TAMRA) at the 3' end **Oligonucleotide labeled with Tetrachloro fluorescein (TET) at the 5' end and Black hole quencher 1 (BHQI) at the 3' end

PAGE 92

92 Table 3 2 a a dA copies/ A. marginale omp10:: h imar1 genome equivalents Passage 1 Passage 2 Passage 3 Passage 4 Gene *Spc/Str **NT Spc/Str NT Spc/Str NT Spc/Str NT aadA 10 6.63 0.07 10 6.56 0.002 10 8.45 0.03 10 8.56 0.05 10 6.38 0.10 10 7.76 0.003 10 7.53 0.03 10 7.45 0.05 opag2 10 6.70 0.02 10 6.75 0.05 10 8.73 0.05 10 8.90 0.02 10 6.55 0.02 10 8.21 0.07 10 7.40 0.35 10 7.63 0.02 Ratio 0.9 0.6 0.5 0.5 0.7 0.4 1.3 0.7 Passage 5 Passage 6 Passage 7 Gene Spc/Str NT Spc/Str NT Spc/Str NT aadA 10 7.64 0.07 10 7.72 0.03 10 7.83 0.02 10 7.72 0.03 10 7.84 0.02 10 7.94 0.02 opag2 10 7.86 0.05 10 7.96 0.01 10 8.07 0.04 10 8.02 0.03 10 7.97 0.01 10 8.11 0.04 Ratio 0.6 0.6 0.6 0.5 0.7 0.7 Spc/Str, Spectinomycin and Streptomycin ** NT, Not receiving antibiotic treatment

PAGE 93

93 Figure 3 1 Immunoblotting of host cell free omp10::himar1 mutant and wild type A. marginale using the specific antibody R883. P rotein s from equal amounts o f host cell free wild type and omp10::himar1 A. marginale were separated by SDS PAGE gel electrophoresis. Immuno Blot PVDF membranes of transferred proteins reacted with specific antibodies and reactions were visualized by chemiluminiscenc e. A ) Po lyclonal antibody R883 (1:10000) with specificity to Msp2 protein (36KDa) (black arrow). B ) Negative control, normal rabbit serum (1:10000). A. marginale str. V irginia init ial bodies and uninfected ISE6 cells were used as positive and negative controls res pectively.

PAGE 94

94 Figure 3 2 Transmission electron microscopy of A. marginale A. marginale omp10::himar1 mutant A ) and wild type B ) immunogold labeled with a polyclonal anti Msp2 antibody (R883). Protein G gold particles (18nm) are localized on the surface of the organisms. No gold particles were visualized in omp10:: h imar1 C ) and wild type D ) Anaplasma labeled with normal rabbit serum as negative controls.

PAGE 95

95 Figure 3 3 Transmission electron microscopy of A. marginale omp10::himar1 mutant immunogold lab eled with a polyclonal anti Msp2 antibody (R883). A ) Anaplasma organisms within membrane bound vacuole (arrows). B ) and C ) depict cell infected with multiples colonies (arrowheads). D ) Colony formed by RF, reticulated forms with some organisms dividing by binary fission (red arrows). E ) Colony formed by DC, dense core organisms, inset showing double layered membrane. N, nucleus.

PAGE 96

96 Figure 3 3 Continued

PAGE 97

97 Figure 3 3 Continued

PAGE 98

98 Figure 3 4 Growth curves for A. marginale wild type and omp10::himar1 in infected ISE6 tick cells. Grow th was measured by determining genome equivalents based on the A. marginale single copy gene opag2 R, Pearson correlation coefficient.

PAGE 99

99 Figure 3 5 Infection of RF/6A endothelial cells with A. marginale omp10:: h imar1 mutant. Anaplasma marginale expressing mCherry red fluorescent protein in RF/6A endothelial cells with A ) and C ) and without B ) and D ) antibiotic (spectino mycin streptomycin) selection. E ) RF/6A cell infected with A. marginale omp10::himar1 mutant, Diff Qu ick stained.

PAGE 100

100 Figure 3 6 Infection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant. Mutant bacteria growing in media supplemented with antibiotic (spectinomycin streptomycin) selection. A. marginale organisms (green) A ) and C ) and e ndothelial cells (red) B ) and C ) were visualized by indirect immunoflu orescence using the monoclonal anti Msp5 antibody ANAF16 C1 and the polyclonal anti von Willebrand factor antibody respectively. Host cell nuc lei were counterstained with DAPI (blue ) Similar fluorescence was not detected in infected cells stai ned with the monoclonal Tryp1E1 antibody (specific for a va riable surface glycoprotein of Trypanosome brucei) D ) or with normal rabbit serum NRS E )

PAGE 101

101 Figure 3 6 Continued

PAGE 102

102 Figure 3 7 In fection of RF/6A endothelial cells with Anaplasma marginale omp10::himar1 mutant. Mutant bacteria growing in media without antibiotic treatment. A. marginale organisms (green) A ) and C ) and endothelial cells (red) B ) and C ) were visualized by indirect immunofluorescence using the monoclonal anti Msp5 antibody ANAF16C1 and the polyclonal anti von Willebrand factor antibody, respectively. Host cell nuclei were counterstained with DAPI (blue). Similar fluorescence was not detected in infected cells stained with the monoclonal Tryp 1 E1 D ) or with normal rabbit serum NRS E )

PAGE 103

103 Figure 3 7 Continued

PAGE 104

104 Figure 3 8 Infection of RF/6A endothelial cells with Anaplasma marginale wild type A. marginale organisms (green) A ) and C ) and endothelial cells (red) B ) and C ) were visualized by indirect immunofluorescence using the monoclonal anti Msp5 antibody ANAF16C1 and the polyclonal anti von Willebrand factor antibody respectively. Host cell nuclei were counterstained with DAPI (blue). Similar fluorescence was not detected in infected cells stained with the monoclonal TrypE1 antibody D ) or with normal rabbit serum NRS E )

PAGE 105

105 Figure 3 8 Continued

PAGE 106

106 CHAPTER 4 CONCLUSIONS AND FUTURE RESEARCH As with any genetic system, the initial step in the development of genetic tools necessary to understand the biology of Anaplasma marginale is the capability of introducing and expressing recombinant DNA in this pathogen. Although some work ha s been develo ped to create mutations in th ese bacteria ( 111 ) more work is required to establish genetic tools with specific genetic elements and conditions that will ultimately enable routine mutation strategies such as transposon mutagenesis, comp lementation, and gene replacement by homologous recombination. However the particular physiology of Anaplasma marginale generates serious obstacles in creating useful genetic system tools and developing of protocols for the routine transformation of these pathogens. In this dissertation the possibility of transformation of A. marginale by transposon mutagenesis using the Himar1 transposon was re evaluated. E lectroporation of A. marginale with a plasmid contain ing the Himar1 transposon sequence flanking a reporter and a selectable marker and in cis with the A7 hyper reactive transposase resulted in the isolation of red fluorescent and spectinomycin streptomycin resistant A. marginale. Whole genome sequencing analysis of transformed A. marginale established that in these recombinant organisms the Himar1 transposon sequences are integrated within the coding region of the outer membrane gene omp10 and such integration resulted from a recombination mechanism mediated by the A7 transposase. Subsequen tly analysis of these omp10::himar1 mutants of A. marginale at the transcriptional level evaluate d the effect of the Himar1 insertion within the omp10 gene and of downstream genes such as omp9 omp8 and omp7 This not only demonstrated that these genes a re expressed as a single polycistronic message in wild type A. marginale in tick cell culture but

PAGE 107

107 also showed that i nsertion of the Himar 1 transposon within omp10 disrupted its expression and that of genes downstream, such as omp9 omp8 and omp7 Togeth er these findings show that: Transposon mutagenesis using the Himar1 transposon system is achievable in A. marginale and useful for creating insertional gene knockouts in A. marginale. Taking into account the possible relevance of omp10 omp9, omp8 and omp 7 in the pathogenesis of A. marginale experiments presented in this dissertation to further characterize the phenotype of these transformants at the level of morphology, growth, stability under non selectable conditions in tick cells and infectivity in mammalian cells in vitro and in vivo demonstrated that: A. marginale omp10::himar1 morphology, developmental cycle and growth is similar to wild type A. marginale in tick cell culture. The Himar1 transposon insertion and red fluorescent phenotype of th ese mutant A. marginale organisms is stable under non antibiotic selectable conditions during prolonged periods of culture. A. marginale omp10::himar1 is infective for endothelial cells in vitro however a calf intravenously inoculated with these mutants d id not show signs of infection as demonstrated by a lack of seroconversion and negative PCR and Southern blot analysis. This could suggest a correlation between loss of the expression of omp10 omp9 omp8 and omp7 and a possible absence of infectivity to r ed blood cells in cattle. Nevertheless the lack of a complementation system prevents first, confirm ation of the role of these genes in the pathogenesis of cattle and fulfill ing and second, confer ring a specific function on each of those genes

PAGE 108

108 It is also possible that effector mechanisms of the innate immune system such as activation of a complement cascade could promote the killing of these mutant bacteria and may have affected the development of infection. Importantly, ex periments to inoculate A. marginale omp10::himar1 mutant in splenectomized calves, which are known to be less resistant to A. marginale infection than spleen in tact calves and adults ( 13 23 ) are underway and in this manner should confirm whether or not these mutants infect red blood cells in cattle. Although this work sets the precedent for developing further strategies to transform A. marginale using the Himar1 syst em more work has to be done to optimize this method towards the goal of obtaining saturating levels of mutations High throughput transformation would be extremely valuable to identify vector specific and vertebrate specific A. marginale genes. The effi ciency of this system for the transformation of A. marginale is still low, especially considering that mutants containing just one insertion within the omp10 gene were recovered However this observation could arise from several possib le causes F or example, A. marginale mutants containing different transposon insertions could have been generated but were not recovered because the insertions disrupted the expression of essential genes or regulatory sequences required for growth in tick cells and wh ich resulted in lethal phenotypes. On the other hand, transformed bacteria containing a transposon insertion must compete with other transposon insertion mutants and probably with some spontaneous antibiotic resistant bacteria. So there is the possibility that a population of slow growing bacteria containing different transposon insertions arise during these experiments, but because of their growth disadvantage th ose bacteria were overgrown by the omp10::himar1 mutants making their recovery difficult. Howe ver isolation of mutants containing a single insertion in the same region

PAGE 109

109 also shows that the efficiency of this system in A. marginale is still very low and more work has to be done for optimization. This may include the development of different vector s ystems and delivery methods and improved procedures for purification and manipulation of host free A. marginale in order to maintain its viability and infectivity while in the extracellular environment Importantly the application of transposon mutagenes is not only will be useful to define possible virulence determinants of A. marginale but also can be used to define non essential regions These could be target s for the characterization of optimal parameters for a gene targeting or homologous recombinati on approach Such targeted recombination would be of major relevance for testing of those genes that are suspected to play a role in pathogenesis of A. marginale The possibility of transform ing A. marginale by transposon mutagenesis as shown here will op en new avenues for the definition of genes associated with virulence and the creation of attenuated organisms that could be evaluated in their natural biological system for the development of vaccines

PAGE 110

110 LIST OF REFERENCES 1. Dumler JS, Barbet AF, Bekker CP, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and E hrlichia with Neorickettsia descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila Int J Syst Evol Microbio l 51 :2145 2165. 2. Dumler JS, Walker DH 2005a. Order II Rickettsiales. p 96 145. In Garrity GM, Brenner N.R, and Staley, J. T (ed), Bergey's Manual of Systematic Bacteriology 2nd edn vol 2 Springer, New York, NY 3. Uchiyama T 2012. Tropism and Pathogen i city of Rickettsiae Front Microbiol 3 : 230 241 4. Kim DM, Chung JH, Yun NR, Kim SW, Lee JY, Han MA, Lee YB 2013. Scrub t yphus m eningitis or m eningoencephalitis. Am J Trop Med Hyg 89 : 1206 121 1 5. Dunning Hotopp JC, Lin M, Madupu R, Crabtree J, Angiuoli SV, Eisen JA, Seshadri R, Ren Q, Wu M, Utterback TR, Smith S, Lewis M, Khouri H, Zhang C, Niu H, Lin Q, Ohashi N, Zhi N, Nelson W, Brinkac LM, Dodson RJ, Rosovitz MJ, Sundaram J, Daugherty SC, Davidsen T, Durkin AS, Gwin M, Haft DH, Selengut JD, Sullivan SA, Zafar N, Zhou L, Benahmed F, Foreger H, Halpin R, Mulligan S, Robinson J, White O, Rikihisa Y, Tettelin H 2006. Comparative genomics of emerging human ehrlichiosis agents. PLoS genetics 2 : e21. doi: 10.1371/journal.pgen.0020021 6. Brayt on KA, Dark, M J, and Palmer, G H 2009. Anaplasma p 85 117. In Nene V, Kole C (ed), Genome Mapping and Genomics in Animal associated Microbes. Springer Verla Berlin, Heiderlberg. 7. Ndung'u LW, Aguirre C, Rurangirwa FR, McElwain TF, McGuire TC, Knowles DP, Palmer GH 1995 Detection of Anaplasma ovis infecti on in goats by major surface protein 5 competitive inhibition enzyme linked immunosorbent assay. J Clin Microbiol 33 : 675 679. 8. Rymaszewska SG 2008. Bacteria of the genus Anaplasma characteristics of Anaplasma and their vectors: a review Vet Med (Praha) 53 : 573 584. 9. Kocan KM, de la Fuente J, Blouin EF, Coetzee JF, Ewing SA 2010 The natural history of Anaplasma marginale Vet Parasitol 167 : 95 107. 10. Kocan KM, de la Fuente J, Blouin EF, Garcia Garcia JC 2004. Anaplasma marginale (Ricketts iales: Anaplasmataceae ): recent advances in defining host pathogen adaptations of a tick borne rickettsia Parasitol 129 ( Suppl 1 ) : S285 300.

PAGE 111

111 11. Kuttler KL 1984. Anaplasma infections in wild and domestic ruminants: a review J Wildl Dis 20 : 12 20. 12. Palmer GH 2009. Sir Arnold Theiler and the discovery of A naplasmosis: a centennial perspective. Onderstepoort J Vet Res 76 : 75 79. 13. Kocan KM, de la Fuente J, Guglielmone AA, Melendez RD 2003 Antigens and alternatives for control of Anaplasma margina le infection in cattle. Clin Microbiol Rev 16 : 698 712. 14. Kocan KM, Goff WL, Stiller D, Claypool PL, Edwards W, Ewing SA, Hair JA, Barron SJ 1992. Persistence of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in male Dermacentor andersoni (Acari: Ixodidae) transferred successively from infected to susceptible calves. J Med Entomol 29 : 657 668. 15. Kocan KM 1992. Recent advances in the biology of Anaplasma spp. in Dermacentor andersoni ticks. Ann N Y Acad Sci 653 : 26 32. 16. De la Fuente J Lew A, Lutz H, Meli ML, Hofmann Lehmann R, Shkap V, Molad T, Mangold AJ, Almazan C, Naranjo V, Gortazar C, Torina A, Caracappa S, Garcia Perez AL, Barral M, Oporto B, Ceci L, Carrelli G, Blouin EF, Kocan KM 2005. Genetic diversity of Anaplasma species m ajor surface proteins and implications for anaplasmosis serodiagnosis and vaccine development Anim Health Res Rev 6 : 75 89. 17. Kocan KM, Barron SJ, Ewing SA, Hair JA 1985 Transmission of Anaplasma marginale by adult Dermacentor andersoni during feeding on calves. Am J Vet Res 46 : 1565 1567. 18. Kocan KM 1986. Development of Anaplasma marginale Theiler in ixodid ticks: coordinated development of a rickettsial organism and its tick host. p 472 505. In Sauer JR, Hair JA (ed). Morphology, p hysiology, and behavioral biology of ticks. John Wiley and Sons, New York, NY. 19. Blouin EF, Kocan KM 1998. Morphology and development of Anaplasma marginale (Rickettsiales: Anaplasmataceae ) in cultured Ixodes scapularis (Acari: Ixodidae) cells. J Med Entomol 35 : 788 797. 20. Ristic M, Watrach AM 1963. Anaplasmosis. VI. Studies and a hypothesis concerning the cycle of development of the causative agent. Am J Vet Res 24 : 267 277. 21. Richey EJ, Palmer, GH 1992 Anaplasmosis in beef cattle p 1 8. In Gr egory E (ed). American Association of Bovine Practitioners Annual conference Galveston, TX. 22. Alleman RA, and Barbet, AF 1996 Evaluation of Anaplasma marginale Major Surface Protein 3 (MSP3) as a diagnostic test antigen. J Clin Microbiol 34: 270 276. 23. Palmer GH, Brown WC, Rurangirwa FR 2000 Antigenic variation in the persistence and transmission of the ehrlichia Anaplasma marginale Microbes infect 2 : 167 176.

PAGE 112

112 24. Kieser ST, Eriks IS, Palmer GH 1990. Cyclic rickettsemia during persistent Anaplasm a marginale infection of cattle. Infect Immun 58 : 1117 1119. 25. French DM, McElwain TF, McGuire TC, Palmer GH 1998 Expression of Anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia. Infect I mmun 66 : 1200 1207. 26. Meeus PF, Barbet AF 2001. Ingenious gene generation. Trends Microbiol 9 : 353 355. 27. Wamsley HL, Alleman AR, Johnson CM, Barbet AF, Abbott JR 2011 Investigation of endothelial cells as an in vivo nidus of Anaplasma marginale infection in cattle. Vet M icrobiol 153 : 264 273. 28. Giardina S, Bretana A, Marquez Q Ultrastructural aspects of intraerythrocytic development of a Venezuelan strain of Anaplasma marginale Tropenmedizin und Parasitologie 1983, 34 : 7 10. 29. Waghela SD, Cruz D, Droleskey RE, DeLoach JR, Wagner GG 1997 In vitro cultivation of Anaplasma marginale in bovine erythrocytes co cultured with endothelial cells. Vet Parasitol 73 : 43 52. 30. Waghela SD, Melendy D, Cruz D, Wagner GG 2000 Antigenic analysis of Anaplasma marginale grown in bovine erythrocytes co cultured with bovine endothelial cells. Veterinary Parasitology 94 : 133 139. 31. Munderloh UG, Lynch MJ, Herron MJ, Palmer AT, Kurtti TJ, Nelson RD, Goodman JL 2004. Infection of endothelial cells with Anaplasma marginale and Anaplasma phagocytophilum Vet Microbiol 101 : 53 64. 32. Carreno AD, Alleman AR, Barbet AF, Palmer GH, Noh SM, Johnson CM 2007. In vivo endothelial cell infection by Anaplasma marginale Vet Pathol 44 : 116 118. 33. Brayton KA, Kappmeyer LS, Herndon DR, Dark MJ, Tibbals DL, Palmer GH, McGuire TC, Knowles DP, Jr 2005. Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc Natil Acad Sci U S A 102 : 844 849. 34. Dark M, Herndon D, Kappmeyer L, Gonzales M, Nordeen E, Palmer G, Knowles D, Brayton K. 2009 Conservation in the face of diversity: multistrain analysis of an intracellular bacterium. BMC genomics 10 :16. 35. Dark MJ, Al Khedery B, Barbet AF 2011. Multistrain gen ome analysis identifies candidate vaccine antigens of Anaplasma marginale Vaccine 29 : 4923 4932. 36. Ogata H, Audic S, Renesto Audiffren P, Fournier PE, Barbe V, Samson D, Roux V, Cossart P, Weissenbach J, Claverie JM, Raoult D 2001 Mechanisms of evoluti on in Rickettsia conorii and Rickettsia prowazekii Science 293 : 2093 2098.

PAGE 113

113 37. Wixon J 2001 Featured organism: reductive evolution in bacteria: Buchnera spp. Rickettsia prowazekii and Mycobacterium leprae Comp Funct Genomics 2 : 44 48. 38. Gillespie JJ, Nordberg EK, Azad AF, Sobral WS 2012 Phylogeny and comparative genomics: the shiftting landscape in the genomic era. p 84 141. In Palmer GH, Azad AF (ed). Intracellular pathogens II ASM press Washington, DC. 39. Andersson SG, Zomorodipour A, Anders son JO, Sicheritz Ponten T, Alsmark UC, Podowski RM, Naslund AK, Eriksson AS, Winkler HH, Kurland CG 1998 The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396 : 133 140. 40. Barbet AF, Lundgren A, Yi J, Rurangirwa FR, Palmer GH 2000. Antigenic variation of Anaplasma marginale by expression of MSP2 mosaics. Infect Immun 68 : 6133 6138. 41. Barbet AF, Agnes JT, Moreland AL, Lundgren AM, Alleman AR, Noh SM, Brayton KA, Munderloh UG, Palmer GH 2005. Identification of funct ional promoters in the msp2 expression loci of Anaplasma marginale and Anaplasma phagocytophilum Gene 353 : 89 97. 42. Brayton KA, Palmer GH, Lundgren A, Yi J, Barbet AF 2002. Antigenic variation of Anaplasma marginale msp2 occurs by combinatorial gene conversion Mol Microbiol 43 : 1151 1159. 43. Alleman AR, Palmer GH, McGuire TC, McElwain TF, Perryman LE, Barbet AF 1997. Anaplasma marginale major surfac e protein 3 is encoded by a polymorphic, multigene family Infect Immun 65 : 156 163 44. Brayton KA, Knowles DP, McGuire TC, Palmer GH 2001 Efficient use of a small genome to generate antigenic diversity in tick borne ehrlichial pathogens Proc Natl Acad Sci U S A 98 : 4130 4135. 45. Oberle SM, Barbet AF 1993 Derivation of the complete msp4 gene sequence of Anaplasma marginale without cloning. Gene 136 : 291 294. 46. Oberle SM, Palmer GH, Barbet AF 1993 Expression and immune recognition of the conserved MSP4 outer membrane protein of Anaplasma marginale Infect Immun 61 : 5245 5251. 47. Meeus PF, Brayton KA, Palmer GH, Barbet AF 2003 Conservation of a gene conversion mechanism in two distantly related paralogues of Anaplasma marginale Mol Microbiol 47 : 633 643. 48. Lohr CV, Brayton KA, Shkap V, Molad T, Barbet AF, Brown WC, Palmer GH 2002 Expression of Anaplasma marginale major surface protein 2 operon associated proteins during mammalian and arthropod infection. Infect Immun 70 : 6005 6012.

PAGE 114

114 49. Sutten EL, Norimine J, Beare PA, Heinzen RA, Lopez JE, Morse K, Brayton KA, Gillespie JJ, Brown WC 2010. Anaplasma marginale type IV secretion system proteins VirB2, VirB7, VirB11, and VirD4 are immunogenic components of a protective bacterial membrane vaccine. Infect Immun 78 : 1314 1325. 50. Gillespie JJ, Brayton KA, Williams KP, Diaz MA, Brown WC, Azad AF, Sobral BW 2010. Phylogenomics reveals a diverse Rickettsiales type IV secretion system. Infect Immun 78 : 1809 1823. 51. Allred DR, McGuire TC, Palmer GH, Leib SR, Harkins TM, McElwain TF, Barbet AF 1990. Molecular basis fo r surface antigen size polymorphisms and conservation of a neutralization sensitive epitope in Anaplasma marginale. Proc Natl Acad Sci U S A 87 : 3220 3224. 52. Barbet AF, Palmer GH, Myler PJ, McGuire TC 1987 Characterization of an immunoprotective protei n complex of Anaplasma marginale by cloning and expression of the gene coding for polypeptide Am105L. Infect Immun 55 : 2428 2435. 53. Bowie MV, de la Fuente J, Kocan KM, Blouin EF, Barbet AF 2002. Conservation of major surface protein 1 genes of Anaplasma marginale during cyclic transmission between ticks and cattle. Gene 282 : 95 102. 54. De la Fuente J, Garcia Garcia JC, Blouin EF, Kocan KM 2001. Differential adhesion of major surface proteins 1a and 1b of the ehrlichial cattle pathogen Anaplasma margina le to bovine erythrocytes and tick cells. Int J Parasitol 31 : 145 153. 55. De la Fuente J, Kocan KM, Garcia Garcia JC, Blouin EF, Claypool PL, Saliki JT 2002 Vaccination of cattle with Anaplasma marginale derived from tick cell culture and bovine erythro cytes followed by challenge exposure with infected ticks. Vet Microbiol 89 : 239 251. 56. De la Fuente J, Garcia Garcia JC, Barbet AF, Blouin EF, Kocan KM 2004. Adhesion of outer membrane proteins containing tandem repeats of Anaplasma and Ehrlichia species (Rickettsiales: Anaplasmataceae ) to tick cells. Vet Microbiol 98 : 313 322. 57. Herndon DR, Palmer GH, Shkap V, Knowles DP, Jr., Brayton KA 2010 Complete genome sequence of Anaplasma marginale subsp. centrale J Bacteriol 192 : 379 380. 58. Ueti M W, Reagan JO, Jr., Knowles DP, Jr., Scoles GA, Shkap V, Palmer GH 2007. Identification of midgut and salivary glands as specific and distinct barriers to efficient tick borne transmission of Anaplasma marginale Infect Immun 75 : 2959 2964. 59. Ueti MW, Knowles DP, Davitt CM, Scoles GA, Baszler TV, Palmer GH 2009. Quantitative differences in salivary pathogen load during tick transmission underlie strain specific variation in transmission efficiency of Anaplasma marginale Infect Immun 77 : 70 75.

PAGE 115

115 60. Fronzes R, Christie PJ, Waksman G 2009. The structural biology of type IV secretion systems. Nature Rev Microbiol 7 : 703 714. 61. Carlyon JA 2012 Establishing Intracellular Infection: Modulation of Host cell functions ( Anaplasmataceae ). p 175 220. In Pa lmer GH, Azad AF (ed). Intracellular pathogens II: Ricketssiales ASM press Washington, DC 62. Pierle SA, Dark MJ, Dahmen D, Palmer GH, Brayton KA 2012 Comparative genomics and transcriptomics of trait gene association BMC Genomics 13 :669. doi:10.1186/1471 2164 13 669 63. Medini D, Donati C, Tettelin H, Masignani V, Rappuoli R 2005. The microbial pan genom e Curr Opin Gene Dev 15 : 589 594. 64. Mira A, Martin Cuadrado AB, D'Auria G, Rodriguez Valera F 2010 The bacterial pan genome:a new p aradigm in microbiology Int Microbiol 13 : 45 57. 65. Borst P 1991. Molecular genetics of antigenic variation. Immunol Today 12 : A29 33. 66. French DM, Brown WC, Palmer GH 1999. Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia Infect Immun 67 : 5834 5840. 67. Futse JE, Brayton KA, Knowles DP, Jr., Palmer GH 2005 Structural basis for segmental gene conversion in generation of Anaplasma marginale outer membrane protein variants Mol Microbiol 57 : 212 221. 68. Palmer GH, Brayton KA 2013. Antigenic variation and transmission fitness as drivers of bacterial strain structure. Cell Microbiol 15: 1969 1975. 69. Palmer GH, Eid G, Barbet AF, McGuire TC, McElwain TF 1994. The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family Infect Immun 62 : 3808 3816. 70. Brayton KA, Meeus PF, Barbet AF, Palmer GH 2003 Simultaneous variation of the immunodominant outer membrane pro teins, MSP2 and MSP3, during Anaplasma marginale persistence in vivo Infect Immun 71 : 6627 6632. 71. Brown WC, Brayton KA, Styer CM, Palmer GH 2003 The hypervariable region of Anaplasma marginale major surface protein 2 (MSP2) contains multiple immunodo minant CD 4+ T lymphocyte epitopes that elicit variant specific proliferative and IFN gamma responses in MSP2 vaccinates J Immunol 170 : 3790 3798. 72. Palmer GH, Futse JE, Leverich CK, Knowles DP, Jr., Rurangirwa FR, Brayton KA 2007. Selection for simple major surface protein 2 variants during Anaplasma marginale transmission to immunologically naive animals Infect Immun 75 : 1502 1506.

PAGE 116

116 73. Rodriguez JL, Palmer GH, Knowles DP, Jr., Brayton KA 2005. Distinctly different msp2 pseudogene repertoires in Anaplasma marginale strains that are capable of superinfection Gene 361 : 127 132. 74. Futse JE, Brayton KA, Dark MJ, Knowles DP, Jr., Palmer GH 2008. Superinfection as a driver of genomic diversification in antigenically variant pathogens Proc Natl Acad Sci U S A 105 : 2123 2127. 75. Bradway DS, Torioni de Echaide S, Knowles DP, Hennager SG, McElwain TF 2001 S ensitivity and specificity of the complement fixation test for detection of cattle persistently infected with Anaplasma marginal e J Vet Diag Invest 13 : 79 81. 76. Knowles D, Torioni de Echaide S, Palmer G, McGuire T, Stiller D, McElwain T 1996. Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle J Clin Microbiol 34 : 2225 2230. 77. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH, Suarez CE, McElwain TF 1998. Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme linked immu nosorbent assay using recombinant major surface protein 5 J Clin Microbiol 36 : 777 782. 78. Al Adhami B, Scandrett WB, Lobanov VA, Gajadhar AA 2011. Serological cross reactivity between Anaplasma marginale and an Ehrlichia species in naturally and experimentally infected cattle J Vet Diag Invest 23 : 1181 1188. 79. Dreher UM, De la Fuente J, Hofmann Lehmann R, Meli ML, Pusterla N, Kocan KM, Woldehiwet Z, Braun U, Regula G, Staerk KD, Lutz H 2005. Serologic cross reactivit y between Anaplasma marginale and Anaplasma phagocytophilum Clin Diagn Lab Immunol 12 : 1177 1183. 80. Eriks IS, Palmer GH, McGuire TC, Allred DR, Barbet AF 1989. Detection and quantitation of Anaplasma marginale in carrier cattle by using a nucleic acid probe J Clin Microbiol 27 : 279 284. 81. Carelli G, Decaro N, Lorusso A, Elia G, Lorusso E, Mari V, Ceci L, Buonavoglia C 2007 Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real time PCR Vet Microbiol 124 : 107 114. 82. Decaro N, Carelli G, Lorusso E, Lucente MS, Greco G, Lorusso A, Radogna A, Ceci L, Buonavoglia C 2008 Duplex real time polymerase chain reaction for simultaneous detection and quantification of Anaplasma marginale and Anaplasma centrale J V et Diagn Invest 20 : 606 611. 83. Reinbold JB, Coetzee JF, Sirigireddy KR, Ganta RR 2010 Detection of Anaplasma marginale and Anaplasma phagocytophilum in bovine peripheral blood samples by duplex real time reverse transcriptase PCR assay J Clin Microbio l 48 : 2424 2432.

PAGE 117

117 84. Kano FS, Tamekuni K, Coelho AL, Garcia JL, Vidotto O, Itano EN, Vidotto MC 2008. I nduced immune response of DNA vaccine encoding an association MSP1a, MSP1b, and MSP5 antigens of Anaplasma marginale Vaccine 26 : 3522 3527. 85. Brown W C, Shkap V, Zhu D, McGuire TC, Tuo W, McElwain TF, Palmer GH 1998. CD 4 (+) T lymphocyte and immunoglobulin G2 responses in calves immunized with Anaplasma marginale outer membranes and protected against homologous challenge Infect Immun 66 : 5406 5413. 86. Brown WC, Zhu D, Shkap V, McGuire TC, Blouin EF, Kocan KM, Palmer GH 1998. The repertoire of Anaplasma marginale antigens recognized by CD 4 (+) T lymphocyte clones from protectively immunized cattle is diverse and includes major surface protein 2 (MSP 2) and MSP 3 Infection and Immunity 66 : 5414 5422. 87. Noh SM, Brayton KA, Brown WC, Norimine J, Munske GR, Davitt CM, Palmer GH 2008 Composition of the surface proteome of Anaplasma marginale and its role in protective immunity induced by outer membrane i mmunization Infect Immun 76 : 2219 2226. 88. Noh SM, Turse JE, Brown WC, Norimine J, Palmer GH 2013 Linkage between Anaplasma marginale outer membrane proteins enhances immunogenicity but is not required for protection from challenge Clin and Vaccine Immunol 20 : 651 656. 89. Prez Brandan C, Basombro M 2012 Genetically attenuated Trypanosoma cruzi parasites as a potential vaccination tool Bioengineered 3 : 242 246. 90. Dey R, Dagur PK, Selvapandiyan A, McCoy JP, Salotra P, Duncan R, Nakhasi HL 2013. Live attenuated Leishmania donovani p27 gene knockout parasites are nonpathogenic and elicit long term protective immunity in BALB/c mice J Immunol 190 : 2138 2149. 91. Bozue J, Cote CK, Webster W, Bassett A, Tobery S, Little S, Swietnicki 2012 A Y ersinia pestis YscN ATPase mutant functions as a live attenuated vaccine against bubonic plague in mice FEMS Microbiol Lett 332 : 113 121. 92. Zimmer A 1992 Manipulating the genome by homologous recombination in embryonic stem cells Annu Rev Neurosci 15 :115 137. 93. Faulds Pain A, Wren BW 2013. Improved bacterial mutagenesis by high frequency allele exchange, demonstrated in Clostridium difficile and Streptococcus suis Appl Environ Microbiol 79 : 4768 4771. 94. Reyrat JM, Pelicic V, Gicquel B, Rappuol i R 1998. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis Infect Immun 66 : 4011 4017. 95. Krishnakumar R, Assad Garcia N, Benders GA, Phan Q, Montague MG, Glass JI 2010 Targeted chromosomal knockouts in Mycoplasma pneum oniae Appl Environl Microbiol 76 : 5297 5299.

PAGE 118

118 96. Camerini Otero RD, Hsieh P 1995 Homologous recombination proteins in prokaryotes and eukaryotes Annu Rev Genet 29 :509 552. 97. Court DJ, Sawitzke JA, Thomason LC 2002 G enetic engineering using homologos recombination Annu Rev Genet 36 :361 388. 98. Dresser AR, Hardy PO, Chaconas G 2009. I nvestigation of the genes involved in antigenic switching at the vlsE locus in Borrelia burgdorferi : an essential role for the RuvAB branch migrase PLoS Path ogens 5 :e1000680. doi: 10.1371/journal.ppat.1000680. 99. LoVullo ED, Sherrill LA, Perez LL, Pavelka MS, Jr 2006 Genetic tools for highly pathogenic Francisella tularensis subsp. tularensis Microbiol 152 : 3425 3435. 100. Wallecha A, Maciag PC, Rivera S, P aterson Y, Shahabi V 2009 Construction and characterization of an attenuated Listeria monocytogenes strain for clinical use in cancer immunotherapy Clin Vaccine Immunol 16 : 96 103. 101. Bae D, Seo KS, Zhang T, Wang C 2013. Characterization of a p otential Listeria monocytogenes v irulence f actor a ssociated with a ttachment to f resh p roduce Appl Environ Microbiol 79 : 6855 6861. 102. Pashley CA, Parish T, McAdam RA, Duncan K, Stoker NG 2003. Gene replacement in mycobacteria by using incompatible plas mid s Appl Environ Microbiol 69 : 517 523. 103. Burgos R, Pich OQ, Querol E, Pinol J 2008. Deletion of the Mycoplasma genitalium MG_217 gene modifies cell gliding behavior by altering terminal organelle curvature Mol Microbiol 69 : 1029 1040. 104. Bono JL, Elias AF, Kupko JJ, 3rd, Stevenson B, Tilly K, Rosa P 2000 Efficient targeted mutagenesis in Borrelia burgdorfer i J Bacteriol 182 : 2445 2452. 105. Halling SM, Detilleux PG, Tatum FM, Judge BA, Mayfield JE 1991 Deletion of the BCSP31 gene of Brucella abortus by replacement. Infection and immunity 59 : 3863 3868. 106. Binet R, Maurelli AT 2009. Transformation and isolation of allelic exchange mutants of Chlamydia psittaci using recombinant DNA introduced by electroporation Proc Natl Acad Scie U S A. 106 : 292 297. 107. Rachek LI, Tucker AM, Winkler HH, Wood DO 1998 Transformation of Rickettsia prowazekii to rifampin resistance J Bacteriol 180 : 2118 2124. 108. Rachek LI, Hines A, Tucker AM, Winkler HH, Wood DO 2000 Transformation of Rickettsia prowaz ekii to erythromycin resistance encoded by the Escherichia coli ereB gene J Bacteriol 182 : 3289 3291. 109. Troyer JM, Radulovic S, Azad AF 1999 Green fluorescent protein as a marker in Rickettsia typhi transformation Infect Immun 67 : 3308 3311.

PAGE 119

119 110. Driskell LO, Yu XJ, Zhang L, Liu Y, Popov VL, Walker DH, Tucker AM, Wood DO 2009. Directed mutagenesis of the Rickettsia prowazekii pld gene encoding phospholipase D Infect Immun 77 : 3244 3248. 111. Felsheim RF, Chavez AS, Palmer GH, Crosby L, Barbet AF, Kurtti TJ, Munderloh UG 2010 Transformation of Anaplasma marginale Vet Parasitol 167 : 167 174. 112. Snyder L, Champness W 2007 Transposition, Site specific recombination, and families of recombinases p 377 426 Molecular Genetics of Bacteria 3rd ed i tion. ASM press, Washington, DC. 113. Craig NL 1997. Target site selection in transposition Annu Rev Biochem 66 : 437 474. 114. Van Opijnen T, Camilli A 2013 Transposon insertion sequencing: a new tool for systems level analysis of microorganisms Nature Rev Microbiol 11 : 435 442. 115. Smith V, Botstein D, Brown PO 1995 Genetic footprinting: a genomic strategy for determining a gene's function given its sequence Proc Natl Acad Sci U S A 92 : 6479 6483. 116. Mazurkiewicz P, Tang CM, Boone C, Holden DW 2006. Signature tagged mutagenesis: barcoding mutants for genome wide screens Nature Revs Genet 7 : 929 939. 117. Munderloh UG FR, Burkhardt NY, Herron MJ, Olivia Chavez AS, Nelson CM and Kurtti TJ 2012 The way forward: improving genetic systems p 416 432. In Palmer GH, Azad AF (ed). Intracellular Pathogens II ASM Press Washington, DC 118. Qin A, Tucker AM, Hines A, Wood DO 2004 Transposon mutagenesis of the obligate intracellular pathogen Rickettsia prowazekii Appl Environ Microbiol 70 : 2816 2822. 119. Baldridge GD, Burkhardt N, Herron MJ, Kurtti TJ, Munderloh UG 2005 Analysis of fluorescent protein expression in transformants of Rickettsia monacensis an obligate intracellular tick symbiont Appl Environ Microbiol 71 : 2095 2105. 120. B aldridge GD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG 2007 Transposon insertion reveals pRM, a plasmid of Rickettsia monacensis Appl Environ Microbiol 73 : 4984 4995. 121. Liu ZM, Tucker AM, Driskell LO, Wood DO 2007 Mariner based transposon mutagenesis of Rickettsia prowazekii Appl Environ Microbiol 73 : 6644 6649. 122. Walker DH 2007 Rickettsiae and rickettsial infections: the current state of knowledge Clin Infect Dis 45 ( Suppl 1 ) :S39 44. 123. Kleba B, Clark TR, Lutter EI, Ellison DW, Hackstadt T 2010. Disruption of the Rickettsia rickettsii Sca2 autotransporter inhibits actin based motility Infect Immun 78 : 2240 2247.

PAGE 120

120 124. Felsheim RF, Herron MJ, Nelson CM, Burkhardt NY, Barbet AF, Kurtti TJ, Munderloh UG 200 6. Transformation of Anaplasma phagocytophilum BMC Biotechnol 6 :42. doi :10.1186/1472 6750 6 42 125. Munderloh UG, Chavez AO, Herron MJ, Felsheim RF, Kurtti TJ 2012 An Anaplasma phagocytophilum OMT mutant is unable to infect ticks 25 th American Society for Rickettsiology Conference., abstr 138 Park City, UT 126. Cheng C, Nair AD, Indukuri VV, Gong S, Felsheim RF, Jaworski D, Munderloh UG, Ganta RR 2013 Targeted and random mutagenesis of Ehrlichia chaffeensis for the identification of genes re quired for in vivo infection PLoS Patho 9 : e1003171 doi : 10.1371/journal.ppat.1003171 127. Baldridge GD, Burkhardt NY, Felsheim RF, Kurtti TJ, Munderloh UG 2008 Plasmids of the pRM/pRF family occur in diverse Rickettsia species Appl Environ Microbiol 74 : 645 652. 128. Ogata H, Renesto P, Audic S, Robert C, Blanc G, Fournier PE, Parinello H, Claverie JM, Raoult D 2005 The genome sequence of Rickettsia felis identifies the first putative conjugative plasmid in an obligate intracellular parasi te. PLoS Biol 3 : e248 doi : 10.1371/journal.pbio.0030248 129. Gillespie JJ, Beier MS, Rahman MS, Ammerman NC, Shallom JM, Purkayastha A, Sobral BS, Azad AF 2007 Plasmids and rickettsial evolution: insight from Rickettsia felis PloS One 2 : e266 doi : 10.1371/journal.pone.0000266 130. Burkhardt NY, Baldridge GD, Williamson PC, Billingsley PM, Heu CC, Felsheim RF, Kurtti TJ, Munderloh UG 2011 Development of shuttle vectors for transformation of diverse Rickettsia species PloS One 6 : e29511 doi : 10.1 371/journal.pone.0029511 131. Wood DO, Hines A, Tucker AM, Woodard A, Driskell LO, Burkhardt NY, Kurtti TJ, Baldridge GD, Munderloh UG 2012. Establishment of a replicating plasmid in Rickettsia prowazeki i PloS One 7 :e34715 doi : 10.1371/journal.pone.003 4715 132. Dark MJ, Lundgren AM, Barbet AF 2012, Determining the repertoire of immunodominant proteins via whole genome amplification of intracellular pathogens PloS One 7 : e36456 doi : 10.1371/journal.pone.0036456 133. Brayton KA, Palmer GH, Brown WC 2006 Genomic and proteomic approaches to vaccine candidate identification for Anaplasma marginale Expert Rev Vaccines 5 : 95 101. 134. Morley RS, Hugh Jones ME 1989. The cost of anaplasmosis in the Red River Plains and south east areas of Louisiana Vet Res Commun 13 : 349 358. 135. Goodger WJ, Carpenter T, Riemann H 1979 Estimation of economic loss associated with anaplasmosis in California beef cattle J Am Vet Med Assoc 174 : 1333 1336.

PAGE 121

121 136. P almer GH, Futse JE, Knowles DP, Jr., Brayton KA 2006. Insig hts into mechanisms of bacterial antigenic variation derived from the complete genome sequence of Anaplasma marginale Ann N Y Acad Sci 1078 : 15 25. 137. Agnes JT, Brayton KA, LaFollett M, Norimine J, Brown WC, Palmer GH 2011 Identification of Anaplasma marginale outer membrane protein antigens conserved between A. marginale sensu stricto strains and the live A. marginale subsp. centrale vaccine Infect Immun 79 : 1311 1318. 138. Rodriguez SD, Garcia Ortiz MA, Hernandez Salgado G, Santos Cerda NA, Aboytes Torre R, Canto Alarcon GJ 2000. Anaplasma marginale inactivated vaccine: dose titration against a homologous challenge Comp Immunol, Microbiol Infect Dis 23 : 239 252. 139. Palmer GH, Brown WC, Noh SM, Brayton KA 2012 Genome wide screening and identific ation of antigens for rickettsial vaccine development FEMS Immunol Med Microbiol 64 : 115 119. 140. Claeys Bouuaert C, Chalmers RM 2010. Gene therapy vectors: the prospects and potentials of the cut and paste transposons Genetica 138 : 473 484. 141. Picardeau M : 2010. Transposition of fly mariner elements into bacteria as a genetic tool for mutagenesis Genetica 138 : 551 558. 142. Lampe DJ, Grant TE, Robertson HM 1998 Factors affecting transposition of the Himar1 mariner transposon in vitro Genetic s 149 : 179 187. 143. Plasterk RH, Izsvak Z, Ivics Z 1999. Resident aliens: the Tc1/mariner superfamily of transposable elements Trends Genet 15 : 326 332. 144. Clark TR, Ellison DW, Kleba B, Hackstadt T 2011. Complementation of Rickettsia rickettsii RelA /SpoT restores a nonlytic plaque phenotype Infect I mmun 79 : 1631 1637. 145. Clark TR, Lackey AM, Kleba B, Driskell LO, Lutter EI, Martens C, Wood DO, Hackstadt T 2011. Transformation frequency of a mariner based transposon in Rickettsia rickettsii J Bacteriol 193 : 4993 4995. 146. Beare PA, Sandoz KM, Omsland A, Rockey DD, Heinzen RA 2011. Advances in genetic manipulation of obligate intracellular bacterial pathogens Front Microbiol 2 :97 doi: 10.3389/fmicb.2011.00097. 147. Beare PA 2012 Genetic manipulation of Coxiella burnetii Adv Exp Med Biol 984 :249 271. 148. Botkin DJ, Abbott AN, Stewart PE, Rosa PA, Kawabata H, Watanabe H, Norris SJ 2006. Identification of potential virulence determinants by Himar1 transposition of infectious Borre lia burgdorferi B31 Infect and Immun 74 : 6690 6699.

PAGE 122

122 149. Stewart PE, Hoff J, Fischer E, Krum JG, Rosa PA 2004. Genome wide transposon mutagenesis of Borrelia burgdorferi for identification of phenotypic mutants Appl Environ Microbiol 70 : 5973 5979. 150. Maier TM, Casey MS, Becker RH, Dorsey CW, Glass EM, Maltsev N, Zahrt TC, Frank DW 2007 Identification of Francisella tularensis Himar1 based transposon mutants defective for replication in macrophages Infect Immun 75 : 5376 5389. 151. Munderloh UG, Bloui n EF, Kocan KM, Ge NL, Edwards WL, Kurtti T J. 1996. Establishment of the tick (Acari:Ixodidae) borne cattle pathogen Anaplasma marginale (Rickettsiales: Anaplasmataceae ) in tick cell culture J Med Entomol 33 : 656 664. 152. Shanner N, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein Nature Biotechnol 22 : 1567 1572 153. Schmittgen TD, Livak KJ 2008. Analyzing real time PCR data by the comparative C(T) method Nat Protoc 3 (6):1101 1108. 154. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real time quantitative PCR and the 2 m ethod Methods 25 : 402 408. 155. Lohr CV, Rurangirwa FR, McElwai n TF, Stiller D, Palmer GH 2002. Specific expression of Anaplasma marginale major surface protein 2 salivary gland variants occurs in the midgut and is an early event during tick transmission Infect Immun 70 : 114 120. 156. Noh SM, Brayton KA, Knowles DP, Agnes JT, Dark MJ, Brown WC, Baszler TV, Palmer GH 2006. Differential expression and sequence conservation of the Anaplasma marginale msp2 gene superfamily outer membrane proteins Infect I mmun 74 : 3471 3479. 157. Barbet AF, Blentlinger R, Yi J, Lundgren AM, Blouin EF, Kocan KM 1999 Comparison of surface proteins of Anaplasma marginale grown in tick cell culture, tick salivary glands, and cattle Infect Immun 67 : 102 107. 158. Guell M, van Noort V, Yus E, Chen WH, Leigh Bell J, Michalodimitrakis K, Yamad a T, Arumugam M, Doerks T, Kuhner S, Rode M, Suyama M, Schmidt S, Gavin AC, Bork P, Serrano L 2009 T ranscriptome complexity in a genome reduced bacterium Science 326 : 1268 1271. 159. Kleckner N 1977 Translocatable elements in procaryotes Cell 11 : 11 2 3. 160. Beare PA, Gilk SD, Larson CL, Hill J, Stead CM, Omsland A, Cockrell DC, Howe D, Voth DE, Heinzen RA 2011 Dot/Icm type IVB secretion system requirements for Coxiella burnetii growth in human macrophages mBio 2 : e00175 11 doi : 10.1128/mBio.00175 11. Print 2011

PAGE 123

123 161. Lopez JE, Siems WF, Palmer GH, Brayton KA, McGuire TC, Norimine J, Brown WC 2005. Identification of novel antigenic proteins in a complex Anaplasma marginale outer membrane immunogen by mass spectrometry and genomic mapping Infect Immun 73 : 8109 8118. 162. Riding G, Hope M, Waltisbuhl D, Willadsen P 2003 Identification of novel protective antigens from Anaplasma marginale Vaccine 21 : 1874 1883. 163. Kazimirova M, Stibraniova I 2013 Tick salivary compounds: their role in modulation of host defences and pathogen transmission Front Cell Infect Microbiol 3 :43 50 164. Singhgh SK, Girschick HJ 2003. Tick host interactions and their immunological implications in tick borne diseases Curr Science 85 :1284 1298. 165. Kocan KM, De La Fuente J, Blouin EF, Garcia Garcia JC 2002. Adaptations of the tick borne pathogen, Anaplasma marginale for survival in cattle and ticks Expl Appl Acarol 28 : 9 25. 166. Crosby FL, Munderloh UG, Wamsley HL, Pate MG, Noh SM, Brown WC, Bar bet AF 2013 Characterization of an Anaplasma marginale mutant generated by transposon mutagenesis 26 th American Society for Rickettsiology Conference., abstr 5 Portland, ME 167. Palmer GH, Oberle SM, Barbet AF, Goff WL, Davis WC, McGuire TC : 1988. Imm unization of cattle with a 36 kilodalton surface protein induces protection against homologous and heterologous Anaplasma marginale challenge Infect Immun 56 : 1526 1531. 168. Wamsley HL, Barbet AF 2008 In situ detection of Anaplasma spp. by DNA target primed rolling circle amplification of a padlock probe and intracellular colocalization with immunofluorescently labeled host cell von Willebrand factor Journal of Clin Microbiol 46 : 2314 2319. 169. Futse JE, Ueti MW, Knowles DP, Jr., Palmer GH 2003 Transmission of Anaplasma marginale by Boophilus microplus : retention of vector competence in the absence of vector pathogen interaction J Clin Microbiol 41 : 3829 3834. 170. Rholl DA, Trunck LA, Schweizer HP 2008, In vivo Himar1 transpo son mutagenesis of Burkholderia pseudomallei Appl Environ Microbiol 74 : 7529 7535. 171. Pelicic V, Morelle S, Lampe D, Nassif X 2000. Mutagenesis of Neisseria meningitidis by in vitro transposition of Himar1 mariner J Bacteriol 182 : 5391 5398.

PAGE 124

124 BIOGRAPHICAL SKETCH Francy L Crosby graduated from Agustin Nieto Caballero High School in Cali Colombia and began her undergraduate study as biochemistry major at Santiago de Cali University. After graduation in 2001 she began her m Javeriana University in Bogota Colombia. Her research focused on the development of an in vitro model based on primary cell cultures of neurons and astrocytes to evaluate the effects of different metabolic substrates during the development of the brain. I n 2008 she joined the laboratory of Dr. Anthony Barbet in the Department of Infectious Diseases and Pathology at the College of Veterinary Medicine at the University of Florida to work on her doctoral research with emphasis on the study of the Tick borne p athogen Anaplasma marginale Francy L Crosby received her doctoral degree in May of 2014