Citation
Oxidative Stress Tolerance in Plants

Material Information

Title:
Oxidative Stress Tolerance in Plants Mechanisms of Protection That Extend from Arsenic Toxicity to High-Temperature Stress
Creator:
Krishnamurthy, Aparna
Place of Publication:
[Gainesville, Fla.]
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (108 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Horticultural Sciences
Committee Chair:
RATHINASABAPATHI,BALASUBRAMANI
Committee Co-Chair:
KLEE,HARRY JOHN
Committee Members:
GUY,CHARLES L
KOCH,KAREN E
CHEN,SIXUE
Graduation Date:
8/9/2014

Subjects

Subjects / Keywords:
Arsenic ( jstor )
Arsenites ( jstor )
Auxins ( jstor )
Heat stress disorders ( jstor )
High temperature ( jstor )
Plant roots ( jstor )
Plants ( jstor )
Rice ( jstor )
Root growth ( jstor )
Seedlings ( jstor )
Horticultural Sciences -- Dissertations, Academic -- UF
arsenic -- auxin -- glutaredoxin -- heat -- maize -- rice -- tolerance -- uniformmu
Genre:
Electronic Thesis or Dissertation
bibliography ( marcgt )
theses ( marcgt )
Horticultural Sciences thesis, Ph.D.

Notes

Abstract:
Oxidative stress is a component of many biotic and abiotic stresses in plants and animals. The oxidative contribution is characterized by production of reactive oxygen species (ROS) that can alter redox state and function of many proteins. Protection of these proteins under stress is important for normal growth and development. Plants have evolved several mechanisms to tolerate and maintain the necessary redox homeostasis. Research here tests hypotheses for contributions by two of these mechanisms to related oxidative stresses (arsenic and high temperature), and does so using three different plant species (Arabidopsis thaliana, Oryza sativa, and Zea mays). In our first approach, we used Arabidopsis mutants to study roles of the growth regulator, auxin. Using genetic and biochemical methods, we found that the auxin transporter mutants were significantly more sensitive to As(III) than were wildtype. Data indicated that auxin transport may have had a positive effect on ROS signaling and tolerance. The goal of our second approach was to test the hypothesis that a key mechanism of arsenic tolerance could also enhance heat tolerance. This mechanism depends on action of a glutaredoxin (Grx), a small heat stable protein that protects cellular proteins from oxidative damage. A distinctive Grx (PvGRX5) associated with arsenic tolerance in the fern Pteris vittata was overexpressed in rice. Seedling heat assays showed PvGRX5 overexpressing lines were more thermotolerant in terms of shoot growth, PSII efficiency, and protein oxidation. The purpose of our third approach was to determine whether high temperature tolerance of maize, was affected by an insertional mutation in a maize Grx from the UniformMu population. Mutant status of the UniformMu line (mu1056968) was verified by both genomic PCR and sequencing. Response of homozygous mutant seedlings to high temperature stress showed no detectable difference from wildtype siblings. As often occurs in maize (an ancient tetraploid), a closely related Grx gene was present and a likely source of additional Grx expression. Together, research presented here indicates that in plants, a combination of auxin transport and glutaredoxin are centrally important to oxidative stress tolerance, and that effects can extend from arsenic toxicity to survival of high temperature stress. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: RATHINASABAPATHI,BALASUBRAMANI.
Local:
Co-adviser: KLEE,HARRY JOHN.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-08-31
Statement of Responsibility:
by Aparna Krishnamurthy.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
8/31/2015
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

OXIDATIVE STRESS TOLERANCE IN PLANTS: MECHANISMS OF PROTECTION THAT EXTEND FROM ARSENIC TOXICITY TO HIGHTEMPERATURE STRESS By APARNA KRISHNAMURTHY A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORI DA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2014 Aparna Krishnamurthy

PAGE 3

To my Mom

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my supervi sory committee for their patience and guidance. Special appreciation goes to Dr. Bala Rathinasabapathi, the chair of my supervisory committee, for his intellectual guidance, consistent support, and endless efforts to accomplish this project. I thank Dr. Ha rry Klee and Dr. Sixue Chen for critical reviews of chapters. Additionally, unique gratitude goes to Dr. Karen Koch and Dr. Charles Guy for their interests and invaluable suggestions during the period of study. I thank Dr. Wen Yuan Song, Univ. of Florida for providing the modified pCAMBIA vector and Dr. Charles Guy (University of Florida) for the use of plant efficiency analyzer equipment . We thank Dr. Kan Wang, P lant transformation facility, Iowa for the rice transformation. I thank the Consortium for Pla nt Biotechnology Research Inc. and BASF Plant Science for funding the project and the College of Agriculture and Life Sciences for the matching assistantship. I would like to thank undergraduate students Hoa Tran, Graham Nichols, and Ana Zegarra for help in the laboratory work. Also, I would like to thank my colleagues: Jonathan Saunders, Charles Hunter, Newton Kilasi, Elton Gon calve s, and S a ul Sotomayor for their help in the laboratory analysis. I express my greatest appreciation to my parents , brothers , in laws and friends who have continually supported all my dreams with patience. Last, and most importantly, I thank my husband Kamaljit Banger , for his constant encouragement and for standing by me in all my academic endeavors. I could not end my acknowl edgements without recognizing the A lmighty that guided and lead me into the right directions.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 8 LIST OF FIGURES .......................................................................................................... 9 LIST OF ABBREVIATIONS ........................................................................................... 11 ABSTRACT ................................................................................................................... 12 CHAPTER 1 INTRODUCTION .................................................................................................... 14 Roles of the Plant Growth Regulator, Auxin, in Plant Tolerance to Arsenic in Arabidopsis Thaliana ........................................................................................... 15 Metabolic Engineering of Rice ( Oryz a Sativa Cv. Nipponbare) for Oxidative Stress Tolerance Caused by High Temperature .................................................. 16 Testing the Role of a Glutaredoxin in HighTemperature Stress Tolerance by Maize ................................................................................................................... 17 2 AUXIN AND ITS TRANSPORT PLAY A ROLE IN PLANT TOLERANCE TO ARSENITE – INDUCED OXIDATIVE STRESS IN ARABIDOPSIS THALIANA ....... 19 Chapter Summary ................................................................................................... 19 Background ............................................................................................................. 20 Materials and Methods ............................................................................................ 23 Chemicals ......................................................................................................... 23 Plant Materials and Growth Conditions ............................................................ 23 Bioassays for Arsenite Tolerance ..................................................................... 24 Arsenic Determination ...................................................................................... 24 Auxin Uptake in Plants ..................................................................................... 24 Auxin Uptake into Recombinant Yeast ............................................................. 25 Quantification of Hydrogen Peroxide (H2O2) using Chemiluminescence Assay ............................................................................................................ 26 Semi Quantitative ReverseTranscription (RT) PCR ........................................ 26 Determination of Lipid Peroxidation .................................................................. 27 Bioassay for High Temperature Stress and Salt Stress ................................... 27 Statistical Ana lyses .......................................................................................... 28 Results .................................................................................................................... 28 Arsenite Inhibits Primary Root Growth in A. Thaliana but not Lateral Root Density .......................................................................................................... 28 Auxin Transport Mutants are more Sensitive To As(III) Compared to WildType .............................................................................................................. 29

PAGE 6

6 As(III) Inhibits Auxin Transport in A. thaliana .................................................... 30 AUX1 Protein is Not the Direct Target of As(III) ............................................... 31 Exogenous IAA Treatment Improves As(III) Tolerance in Aux1 Mutant but Not in WT ...................................................................................................... 31 Auxin Transport Inhibitors Increase As(III) Sensitivity in WT ............................ 32 As(III) Induces H2O2 Production in A. Thaliana and Reduces Catalase3 Express ion .................................................................................................... 32 As(III) Stress Resulted in Increased Indicators of Membrane Damage ............ 33 Aux1 Mutant is More Sensitive to High Temperature a nd Salt Stress Compared to WT ........................................................................................... 33 Discussion .............................................................................................................. 34 3 OVEREXPRESSION OF FERN GLUTAREDOXIN PVGRX5 IMPROVES HIGH TEMPERATURE STRESS TOL ERANCE IN RICE AT VEGETATIVE STAGES .... 53 Chapter Summary ................................................................................................... 53 Background ............................................................................................................. 54 Materials And Methods ........................................................................................... 57 Plant Material ................................................................................................... 57 Chemicals ......................................................................................................... 58 Cloning and Plant Transformation .................................................................... 58 Gene Expression .............................................................................................. 59 Glutaredoxin Activity Assay .............................................................................. 59 Germination Assay for High Temperature Stress Tolerance ............................ 60 Vegetative Stage Seedling Tolerance to Heat Stress ....................................... 60 Determination of Carbonyl Content in Proteins ................................................ 60 Statistical Analysis ............................................................................................ 61 Results .................................................................................................................... 61 Phenotypic Evaluation of Grx OE Lines for High Temperature Stress Tolerance ...................................................................................................... 62 PvGRX5 OE Lines are More Tolerant to High Temperature Stress During Germination ................................................................................................... 63 Evaluation of Transgenic Rice Lines for Heat Tolerance at Early Vegetative Stage ............................................................................................................. 63 Discussion .............................................................................................................. 64 4 TESTING THE ROLE OF A GLUTAREDOXIN IN HIGH TEMPERATURE STRESS TOLERANCE BY MAIZE ......................................................................... 77 Background ............................................................................................................. 77 UniformMu Population ...................................................................................... 77 Glutaredoxins ................................................................................................... 78 Orthologs and Homologs of GRMZM2G090736 ............................................... 79 Material and Methods ............................................................................................. 80 Genotyping UniformMu Line for Grx GRMZM2G090736 .................................. 80 Evaluation of Wildtype Maize S eedlings for High Temperature Stress Tolerance ...................................................................................................... 80

PAGE 7

7 Evaluation of GRX Mutant and Wildtype siblings for High Temperature Stress Tolerance ........................................................................................... 80 Results and Discussions ......................................................................................... 81 5 SUMMARY, CONCLUSIONS, AND RECOMMENDATIONS .................................. 88 APPENDIX A SUPPLEMENTARY FIGURES CHAPTER 2 .......................................................... 91 B SUPPLEMENTARY FIGURES CHAPTER 3 .......................................................... 93 LIST OF REFERENCES ............................................................................................... 95 BIOGRAPHICAL SKETCH .......................................................................................... 108

PAGE 8

8 LIST OF TABLES Table page 4 1 Maize homologs of the GRMZM2G090736 gene.. ............................................. 83 B 1 List of primers used in gene expression analysis ............................................... 94

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Glutaredoxin cycle. . ............................................................................................ 18 2 1 Response of Arabidopsis thaliana plants to sodium arsenite. . ........................... 42 2 2 Effect of As(III) on primary root growth and number of lateral roots in WT and auxin transport mutants. ..................................................................................... 43 2 3 Effect of As(III) treatment on shoot growth. ........................................................ 44 2 4 Effect of arsenite on auxin transport. . ................................................................. 45 2 5 AUX1 is not the direct target of arsenite. . ........................................................... 46 2 6 Exogenous IAA treatment improves arsenite tolerance in aux1 mutant but not in WT. ................................................................................................................. 47 2 7 Auxin transport inhibitors increase sensitivity of WT (Columbia) to arsenite. ..... 48 2 8 Quantification of hydrogen peroxide. .................................................................. 49 2 9 As(III) induces lipid peroxidation in WT, aux1 and pin1. ...................................... 50 2 10 Effect of high temperature and salt stress on primary root growth and number of lateral roots in WT and aux1 mutants. ............................................................ 51 2 11 Model for AUX1 function in plant stress tolerance. . ............................................ 52 3 1 Construct map for rice transformation. ............................................................... 71 3 2 Gene expression analyses in wild type (WT), vector control (VC) and transgenic rice: PVGRX5 OE lines (PVG24, PVG18), AtGRX14 OE lines (ATG6, ATG1) and AtGRXS2 OE lines (AT GB 2, ATGB18). .............................. 72 3 3 High temperature tolerance assay during germination. ...................................... 73 3 4 Heat stress assay at vegetative stage in wild type (WT), vector control (VC) and transgenic l ines: PvGRX5 OE lines (PVG24, PVG18), AtGRXS14 OE line (ATG6) and AtGRXS2 OE line (ATGB18). . .................................................. 74 3 5 Oxidative damage caused by heat stress. .......................................................... 75 3 6 Effect of heat stress on PSII efficiency in transgenic rice lines. .......................... 76

PAGE 10

10 4 1 Sequence comparison of glutaredox ins: PvGRX5 (fern), GRMZM2G090736 (maize) and GRMZM5G820188 (maize) using clustal multiple sequence alignment. . .......................................................................................................... 84 4 2 Genotypic analysis of a maize family (13S 24228) segregating for a glutaredoxin mutation (Mu insertion mu1056968 in UniformMu line UFMu07136). . .............................................................................................................. 85 4 3 Effect of a high temperature stress on growth and visible features of W22 wildtype maize seedlings . ................................................................................... 86 4 4 Effect of high temperature stress on WT and homozygous glutaredoxin mutant (Mu insertion mu1056968 in UniformMu line UFMu07136) siblings fr om the same family (13S 24228) . ................................................................... 87 A 1 Effect of As(III) on root cell length. ...................................................................... 91 A 2 As(III) concentration in plant tissues 24 h after treatment in WT and aux1, As(III) concentration is shown in fresh weight basis. .......................................... 92 B 1 Heat stress assay at vegetative stage in wild type (WT), vector control (VC) and transgenic lines: PvGRX5 OE li nes (PVG24, PVG18, PVG182, PVG23, PVG19 and PVGB24). ........................................................................................ 93

PAGE 11

11 LIST OF ABBREVIATIONS AsIII Arsenite At Arabidopsis thaliana DHA Dehydro ascorbate DNA Deoxyribonucleic acid Grx Gl utaredoxin H 2 O 2 Trx WT Hydrogen peroxide Thi o redoxin Wildtype IAA Indole 3 acetic acid OE Over expressing PCR Polymerase chain reaction Pv Pteris vittata RNA Ribonucleic acid

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the Univers ity of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy OXIDATIVE STRESS TOLERANCE IN PLANTS: MECHANISMS OF PROTECTION THAT EXTEND FROM ARSENIC TOXICITY TO HIGHTEMPERATURE STRESS By Aparna Krishnamurthy August 2014 Chair: Bala Rathinasabapat hi Major: Horticultural Sciences Oxidative stress is a component of many biotic and abiotic stresses in plants and animals. The oxidative contribution is characterized by production of reactive oxygen species (ROS) that can alter redox state and function of many proteins. Protection of these proteins under stress is important for normal growth and development. Plants have evolved several mechanisms to tolerate and maintain the necessary redox homeostasis. Res earch here tests hypotheses for contributions by two of these mechanisms to related oxidative stresses (arsenic and high temperature), and does so using three different plant species ( Arabidopsis thaliana, Oryza sativa [rice], and Zea mays [maize]). In ou r first approach, we used Arabidopsis mutants to study roles of the growth regulator , auxin. Using genetic and biochemical methods, we found that the auxin transporter mutants ( aux1 / pin1/pin2) were significantly more sensitive to As(III) than were wild typ e. Data indicated that auxin transport may have had a positive effect on ROS mediated signaling and tolerance.

PAGE 13

13 The goal of our second approach was to test the hypothesis that a key mechanism of arsenic tolerance could also enhance heat tolerance. This mechanism depends on action of a glutaredoxin (Grx), a small heat stable protein that protects cellular proteins from oxidative damage. A distinctive Grx ( PvGRX5 ) associated with arsenic tolerance in the fern Pteris vittata was overexpressed in rice. Seedling heat assays showed PvGRX5 overexpressing lines were more thermotolerant in terms of shoot growth, PSII efficiency, and protein oxidation. The purpose of our third approach was to determine whether hightemperature tolerance of maize, was affected by an insertional mutation in a maize Grx from the UniformMu population. Mutant status of the UniformMu line ( mu1056968) was verified by both genomic PCR and sequencing. Response of homozygous mutant seedlings to high temperature stress showed no detectable di fference from wildtype siblings. As often occurs in maize (an ancient tetraploid), a closely related Grx gene was present and a likely source of additional Grx expression. Together, research presented here indicates that in plants, a combination of auxin transport and glutaredoxin are centrally important to oxidative stress tolerance, and that effects can extend from arsenic toxicity to survival of hightemperature stress.

PAGE 14

14 CHAPTER 1 I NTRODUCTION Oxidative stress is a component of many abiotic stress es such as drought (Moran et al., 1994), high temperature (Larkindale and Knight, 2002), salinity (Hernandez et al., 1993) , and heavy metal s (Sytar et al., 2013) . Oxidative stress also occurs during biotic stresses in response to herbivory (OrozcoCardenas and Ryan, 1999) and plant pathogen interactions (Grant et al., 2000). During these stress es levels of reactive oxygen species (ROS) increase beyond a nonstress threshold level, potentially resulting in oxidations of DNA, proteins and lipids. During plant a cclimation , however, cellular anti oxidant machineries reduce at least some of these oxidized macromolecules. At the same time, ROS have additional signaling roles in plant adaptation to stress es . ROS produced during biotic and abiotic stress, can have dual roles of causing damage and signaling to induce defense responses (Mittler et al., 2011; Potters et al., 2010). It is not known how the two seemingly contrasting functional roles of ROS between oxidative damage to the cell and signaling for stress protec tion are balanced. The amount of ROS in the plant cell is important in guiding these two distinct roles. Redox homeostasis is maintained by balancing mechanisms of ROS production and removal. Major players in regulating redox homeostasis in cells are ROS scavengers and molecular chaperones. ROS scavengers include detoxifying enzymes like superoxide dismutases, catalases , and peroxidases , which directly remove ROS species. Molecular chaperones and similar constituents such as thioredoxins and glutaredoxins regulate the redox status of other proteins and hence the cell redox homeostasis. Since oxidative stress caused by ROS production affects plant growth and

PAGE 15

15 development, plant growth regulators could also contribute substantially to oxidative stress toleranc e. Plants have evolved a range of acclimation mechanisms that provide increased tolerance to oxidative stress. In this study we used genetic, biochemical and functional genomics tools to understand these adaptive mechanisms. This study aims at elucidating commonalities among the different mechanisms involved in oxidative stress tolerance caused by high temperature and arsenite stress . Toward this end, hypotheses were tested using reverse genetic approaches in the model plants , Arabidopsis thaliana, Oryza sat iva , and in some instances, Zea mays . Due to the large number of mutant lines available for Arabidopsis , we chose to work with this species to test our hypothesis for a role of auxin transport in the oxidative stress caused by metalloid arsenite. In additi on, we used rice to test possible roles of glutaredoxin proteins in heat stress, and did so by generating glutaredoxinoverexpressing plants. Lastly, we examined hightemperature stress responses of maize mutants with altered genes for glutaredoxin. Resul ts of this collective work could be useful to genome enabled breeding and/or biotechnological approaches to improve crops for increased tolerance to stress. The f ollowing segments are described in different chapters of this dissertation : Role s of the Pla nt Growth Regulator , Auxin , i n Plant Tolerance to Arsenic i n Arabidopsis Thaliana Arsenic, a naturally available metalloid is highly carcinogenic (Cantor and Lubin, 2007; Kligerman and Tennant, 2007). It is known to cause health hazards through the inducti on of oxidative stress , which generat es reactive oxygen species in mammalian cells (Brown et al., 2008; Qin et al., 2008; Wang et al., 2009; Chowdhury et al., 2010).

PAGE 16

16 Arsenic, in plants is often known to cause phosphorus deficiency and also oxidative stress. Studies on plant responses to arsenic toxicity are limited. Arseniteinduced growth inhibition in Arabidopsis suggested a mechanism associated with the plant growth regulator , auxin. A uxin is well known for regulating many growth and developmental proces ses such as meristem formation, cell division, cell elongation , and maintenance of polarity (Mockaitis and Estelle, 2008; Woodward and Bartel, 2005). Auxin and ROS are rapidly altered by environmental stress es. The ROS can alter auxin biosynthesis, transport, metabolism , and signaling (Tognetti et al., 2012). A series of genetic and biochemical investigations were employed to discover the link between auxin and plant tolerance to oxidative stress. Arsenite was used to induce oxidative stress in Arabidopsis thaliana. Mutants impaired in auxin transport were compared to the wildtype. Metabolic Engineering o f Rice ( Oryza Sativa Cv. Nipponbare ) for Oxi dative Stress Tolerance Caused b y High Temperature Several studies in rice show the potential for improving heat tolerance through transgenic manipulation via the expression of molecular chaperones. Molecular chaperones are proteins that bind to other proteins affecting their folding, function and degradation, thus assisting in maintaining protein homeostasis (r eview on molecular chaperones by Hartl et al., 2011). Glutaredoxins (GRX) are oxidoreductase proteins implicated in oxidative stress tolerance in plants. Glutaredoxins have protective function in cells and are known to reduce disulfide bridges between prot eins or reduce proteinglutathione adducts (Fig ure 1 1) (Rouhier et al., 2008). They protect cellular proteins from ROS damage.

PAGE 17

17 A glutaredoxin, PvGRX 5 , was identified (Sundaram et al., 2008) from a tropical fern Pteris vittata , which has the unusual capac ity to hyperaccumulate arsenic (up to 2% of its dry mass) (Ma et al., 2001) . Improved arsenic tolerance was reported when the PvGRX 5 cDNA was expressed in E. coli (Sundaram et al., 2008) and in PvGRX 5 overexpressing transgenic Arabidopsis thaliana (Sundaram et al., 2009) lines respectively. Transgenic expression of fern Pteris vittata glutaredoxin PvGRX 5 cDNA in Arabidopsis thaliana also increased plant tolerance to high temperature stress and reduced oxidative damage (Sundaram and Rathinasabapathi, 2010). To test whether a similar approach can be applied in a crop, we used transgenic approach to generate and characterize stable transformants of Oryza sativa cv. Nipponbare expressing PvGRX 5 cDNA following A grobacterium mediated transformation. The transgenic lines were evaluated for high temperature stress tolerance . Testing t he Role of a Glutaredoxin i n Hig h Temperature Stress Tolerance by Maize Well characterized insertion mutant lines are useful for studying functional genomics in plants. Since such mutants are rarely available in rice, specific UniformMu insertion lines in maize ( corn ) were used in this study. The individual sequences for specific genes in maize were obtained from Maizesequence.org. The UniformMu lines with insertional mutations in glutar edoxin genes were verified by PCR and sequencing . The verified mutants were phenotyped for high temperature stress tolerance and compared to wildtype siblings.

PAGE 18

18 Figure 1 1 . Glutaredoxin cycle. A ) Glutaredoxin (Grx) catalyses the reduction of disulfide bonds in proteins converting glutathione (GSH) to glutathione disulfide (GSSG). GSSG is in turn recycled to GSH by the enzyme glutathione reductase at the expense of NADPH. During the reaction cycle it is thought that a cysteine pair in the active site of glutaredoxin is converted to a disulfide. B ) Glutaredoxin is also thought to be important for deglutathionylation of protein thiols. In this reaction only a single cysteine is required. Indeed, many naturally occurring glutaredoxins contain only one cyste ine in the active site. It should be noted that the direction of the glutaredoxincatalyzed cycle depends on the relative concentrations of GSH and GSSG. High concentrations in the cell of GSSG relative to GSH will drive glutathionylation or the oxidation of protein thiols to disulfides.

PAGE 19

19 CHAPTER 2 AUXIN AND ITS TRANSPORT PLAY A ROLE IN PLANT TOLERANCE TO ARSENITE – INDUCED OXIDATIVE STRESS IN ARABIDOPSIS THALIANA Chapter Summary The role of auxin in plant development is well known, however its possible f unction in root response to abiotic stress is not well understood. Using genetic and biochemical investigations, we demonstrate a novel role of auxin transport in plant tolerance to oxidative stress. Plant response to arsenite [As(III)] was evaluated by me asuring primary root growth, the initiation of lateral roots and biochemical markers for oxidative stress on seedlings treated with control or As(III) containing medium. Auxin transporter mutants aux1 , pin1 and pin2 were significantly more sensitive to As (III) than the wild type. Auxin transport inhibitors 1naphthoxyacetic acid and N 1 naphthylphthalamic acid, significantly reduced plant tolerance to As(III) in the wildtype. Exogenous supply of indole3 acetic acid improved As(III) tolerance of aux1 an d not that of wild type. Auxin uptake assays using H3IAA, showed As(III) affected auxin transport in wildtype (WT) roots. Together these data confirmed auxin transport and distribution in the tissues were important for tolerance to arseniteinduced oxidative stress. As(III) treatment increased the levels of reactive oxygen species (ROS): H2O2 in WT but not in the mutant. A version of this chapter has been published as Krishnamurthy A. & Rathinasabapathi B. (2013) Auxin and its transport play a role in plant tolerance to arsenite induced oxidative stress in Arabidopsis thaliana . Plant, Cell & Environment , 36, 18381849.

PAGE 20

20 Membrane damage as measured by thiobarbituric acid reactive substances was not significantly altered in the WT but was increased in the mutant. These results strongly suggests auxin transport via AUX1 has a positive control on ROS mediated signaling and subsequently plant tolerance to As(III) stress. The mutant aux1 was also significantly more sensitive to high temperature stress and sal inity than the WT, suggesting auxin transport influences a common element shared by plant tolerance to arsenite, salinity and high temperature stress. Role of auxin transport in multiple stress tolerances has implications in developing new avenues to impr o ve crop tolerance for stress. Background The plant growth regulator auxin is involved in many growth and developmental processes including early cell division, meristem organization, phototropism, gravitropism, development and maintenance of organ polarity (Mockaitis and Estelle 2008). The biosynthetic and signaling network of auxin has been investigated extensively (Vanneste and Friml, 2009; Zhao 2010). Auxin is produced in the young growing leaves (Zhao 2008; Chandler 2009) and then transported to different parts of the plant through both passive diffusion and active auxin influx and efflux transport systems (Blakeslee, Peer & Murphy 2005). AUX1/LAX family proteins are the major auxin influx carriers in plants (Bennett, 1996; Kerr & Bennett, 2007) while, PIN and ABCB/PGP (Murphy et al. 2002; Noh et al. 2001; Petrasek et al . 2006 ; Yang & Murphy 2009) proteins are the major auxin efflux proteins. A set of auxin transport facilitators called PIN LIKES (PILS) regulate growth by modulating intracellular auxin transport and compartmentalization (Barbez et al. 2012). Auxin transport and distribution regulates

PAGE 21

21 root growth (Ruzika et al. 2007), lateral root initiation (Casimiro et al . 2001) and auxin mediated signaling in plants. Auxin signaling is comprised of auxin perception by receptors (Dharmasiri, Dharmasiri & Estelle 2005; Kepinski & Leyser 2005) and transcriptional regulation by AUX/IAA proteins. AUX/IAA proteins are repressors of auxin response and are rapidly induced by auxin (Abel, Oeller & Theologis 1994). These proteins are degraded proteolytically in the presence of auxin (Gray et al . 2001). AUX/IAA proteins and auxin responsive factors (ARFs) regulate the transcription of auxininduced genes (Kim, Harter & Theologis 1997). ARF proteins bind to auxin r esponsive elements (AuxREs) in the promoter regions of the target genes thus inducing their expression (Ulmasov, Hagen & Guilfoyle 1997, 1999). Despite our indepth knowledge about auxin’s role in plant growth, development and auxin signaling, only few st udies have examined possible role of auxin signaling in regulating plant tolerance to abiotic stress. However, interactions of auxin with stress related plant growth regulators ethylene and abscisic acid are known. Ethylene can modulate auxin transport and has a negative role in lateral root formation (Ivanchenko, Muday & Dubrovsky 2008) and a positive role in adventitious root formation (Negi et al . 2010). Cross talk between auxin and abscisic acid during adverse environmental conditions affecting the grow th and wood development has been reported in poplar (Popko et al . 2010). Ethylene influences root growth by mediating auxin biosynthesis and transport (Ruzika et al. 2007). There are f indings on auxin and ethylene interaction in plant tolerance to aluminum toxicity through altered auxin distribution via AUX1 and PIN2 auxin transporters (Sun et al . 2010b).

PAGE 22

22 In the present study we use arsenic as a tool to investigate the role of auxin transport in plant tolerance to oxidative stress. Arsenic is an extremely health hazardous toxic metalloid found in organic and inorganic forms in nature (Dembitsky and Rezanka 2003). Arsenic accumulation in edible plant parts is of great concern in food safety and healthcare sector (Williams et al . 2005; Zhao, McGrath & Meharg 2010). Arsenic can produce free radicals (ROS) and cause oxidative damage in plant (Letterrier et al . 2012; Rao et al. 2011) and animal cells (Shi, Shi & Liu 2004) which could result in DNA damage and protein modifications (Qin et al . 2008). Arsenic trioxide induced apoptosis is reported to be dependent on H2O2 in cancerous animal cells and the levels are dependent on the activity of catalase and peroxidase enzymes (Jing et al . 1999 & Lu et al . 2004). Low levels of H2O2 ( 200 mol/L) inhibited arsenic trioxide induced apoptosis in cancer cells (Lu et al. 2004). However, studies on plant adaptations to arsenic stress are limited. Studying plant responses to arsenic will enable us to understand the plant adaptation mechanisms to oxidative stress. To identify t he link between auxin and arsenic induced oxidative stress we chose to analyze the response of auxin transporter mutants to arsenite. Auxin biosynthetic mutants are difficult to study as they are defective in many developmental processes and have to be res cued only with the addition of auxin (Celenza, Grisafi & Fink 1995) and hence cannot be easily used for comparative analyses. Hence mutants altered for auxin transport are better alternatives. Here we primarily use aux1, an auxin transporter mutant which i s altered for auxin influx and transport to root (Bennett et al . 1996) to demonstrate a novel role of auxin transport in As(III) induced oxidative stress tolerance in plants.

PAGE 23

23 Materials a nd Methods Chemicals Sodium arsenite, sodium chloride and methanol were from Fisher Scientific (Pittsburgh, PA). Agar and indole3 acetic acid (IAA) were purchased from SigmaAldrich (St. Louis, MO) and United States biochemical corporation (Cleveland, OH) respectively. Auxin transport inhibitors N 1 naphthylphthalamic acid , 99.5% (NPA) and 1 naphthoxyacetic acid, 98% (NOA) were from SigmaAldrich (St. Louis, MO). Radioactive 3H IAA (20 Ci.mmol) was from American Radiolabeled Chemicals, Inc (St. Louis, MO). Plant Materials a nd Growth Conditions All the genotypes of Arabido psis thaliana used in the study were purchased from the Arabidopsis Biological Resources Center (ABRC), Ohio State University. Seeds were surface sterilized using 20% (v/v) commercial bleach and 0.01% (v/v) silvetTM for 10 min and were rinsed 5 times with sterile water and chilled for 2 days at 4C. The seeds were then transferred using a pipette onto the growth media solidified in petri plates. The medium was made of half strength Hoagland nutrient medium (Hoagland and Arnon, 1950) with 2% (w/v) sucrose and pH was adjusted to 5.7, and solidified using 0.8% (w/v) agar. Seedlings were grown on vertically placed plates at 2324C with light intensity of 70 80 mol/m2/s and 16:8 h light/dark photoperiods. Recombinant Schizosaccharomyces pombe yeast lines expressing AUX1 were obtained from A. S. Murphy, Purdue University. Yeast extract medium (YE) was prepared using 0.5% (w/v) yeast extract, 3.0% (w/v) glucose and 2.0% (w/v) bacto agar.

PAGE 24

24 YES medium was made of YE supplemented with 225 mg/L each of adenine, histidine, leucine, uracil and lysine hydrochloride. Bioassays f or Arsenite Tolerance Three day old seedlings were transferred to control or arsenitecontaining media plates and the primary root growth and the numbers of lateral roots were recorded for three subsequent days. To study the effect of exogenous application of auxin and auxin transport inhibitors, the three day old seedlings were pretreated with indicated concentrations of IAA or auxin transport inhibitors 1naphthoxyacetic acid (NOA) and N 1 naphthy lphthalamic acid (NPA ). After 24 hours of pretreatment, seedlings were transferred to control or arsenite plates and primary and lateral root growths were evaluated during the next three days. Arsenic D etermination Three replicates of 3day old seedlings (10 seedlings per replicate) were transferred to 12M As(III) plates. After 30 h, whole plants were collected for arsenic determination. The plant tissue was prepared by grinding the samples in liquid nitrogen and extracted with 50% (v/v) methanol. Total arsenic content in the plant samples were measured using graphite furnace atomic absorption spectrophotometry (GFAAS; Varian 240Z, Walnut Creek, CA). Method accuracy and precision was maintained by using internal standards, spikes and appropriate blanks. Auxin Uptake i n Plants Three day old seedlings germinated and grown on control medium, were transferred to either control or As(III) (12 M) plates. After 24 h of As(III) treatment, the seedlings were transferred back to control medium with no arsenite. T he auxin transport

PAGE 25

25 bioassay was done using 3H IAA using the protocol from Lewis and Muday (2009). Droplets of 1.25% (w/v) agar of 10 L volume each containing 100nCi of 3H IAA were prepared. For basipetal transport, individual droplets were placed at the t ip of the primary root and after 16 h of incubation, 5 mm long root sections were collected 5 mm away from the place of application towards the beginning of the root. For acropetal transport, the droplets were placed at the junction of stem and root and the root tissue samples were collected following incubation as 5 mm long sections of the root, collected 5 mm away from the spot of application towards the tip of the root. The sampled plant tissues were placed in individual 5 mL scintillation vials with 2 mL water and 2 mL Ready gel scintillation liquid (Beckman Coulter Inc., Brea, CA). The radioactivity was meas ured for 1 min in Beckman multipurpose scintillation counter (LS6500 Beckman Coulter Inc., Brea, CA). Auxin Uptake i nto Recombinant Yeast 3H IAA t ransport assay in recombinant Schizosaccharomyces pombe expressing functional AUX1 protein in a permeasedeficient vat3 mutant was done using methods as in Yang and Murphy ( 2009) with few modifications. S. pombe cells were grown in YES medium at 30 C to a cell density of OD =2.00. Then the cells were transferred to fresh YE medium and incubated for 19 h followed by 1 h incubation with or without 12 M As(III). Eight replications of 500 L cells (OD =2) were treated with 100 nCi of 3H IAA and incubat ed for 1 h. The samples were centrifuged at 6000 g for 30 sec and the pelleted cells were washed twice in YES medium containing cold 100 nM IAA. The washed pellets were resuspended in 500 L YES medium and 3H IAA radioactivity was measured using Beckman li quid scintillation counter.

PAGE 26

26 Quantification o f Hydrogen Peroxide ( H2O2) u sing Chemiluminescence Assay Hydrogen peroxide was quantified using chemiluminescence assay (Lu, Song & Campbell Palmer 2009; Perez & Rubio 2006). Three day old seedlings were placed on control or As(III) containing medium in vertical plates. After 24 h of individual treatments, samples were collected for H2O2 determination. Twenty seedlings per replication were weighed and ground with liquid Nitrogen, PVPP (0.05 g to 1 mL wet PVPP) an d 0.5 mL of 5% trichloroacetic acid (TCA). Extract was centrifuged for 10 min at 13,000 g and supernatant was diluted using 0.1 M carbonate buffer. Twenty micro liters of diluted samples were incubated with 5 L (50 U) of catalase or distilled water. Follo wing incubation 200 L of luminal diluted mixed reagent solution was added to the samples and chemiluminescence readings were recorded in Synergy2 micro plate reader (Biotek Instruments Inc.). Values for hydrogen peroxide were derived by difference in che miluminescence between parallel samples that were treated or not with catalase. Semi Quantitative ReverseTranscription ( RT ) PCR Three day old seedlings were placed on control or As(III) containing medium in vertical plates. After 24 h of individual tre atments, root samples were collected and total RNA was extracted using RNeasy plant mini kit from Qiagen. RNA was treated with RNase free DNaseI from Ambion. Semi quantitative (RT) PCR was done using one step TaKaRa kit. cDNA was synthesized by reverse t ranscription cycle for 45min and a partial cDNA for catalase3 was amplified for 25 PCR cycles using PCR primers: forward, 5’ AGC TTC CAG TCA ATG CTC CC3’ and reverse, 5’ GTG AGA CGT GGC

PAGE 27

27 TCC GAT AG 3’. Actin cDNA was amplified using primers: forward, 5’ T GG GCA AGT CAT CAC GAT TGG T 3’ and reverse, 5’ TGC TTG GTG CAA GTG CTG TGA T 3’. Determination o f Lipid Peroxidation The thiobarbituric acid test was employed to determine the lipid peroxidation, which determines malondialdehyde and other compounds as end products of lipid peroxidation together referred as thiobarbituric acid reactive substances (TBARS) (Hodges et. al . 1999). After 24 h of individual treatments, five seedlings per replication were pooled, weighed and homogenized in 1mL of 5% of icecold trichloroacetic acid (TCA). Then the homogenate was centrifuged at 12,000 g for 15 min. To 1mL of the hydroxyltoluene (BHT) were added. The mixture was incubated in boiling water bath for 30 min, and the reaction was stopped by incubating on ice. Samples were centrifuged at 10,000 g for 10 min, and the absorbance was measured at 532 nm. Then, subtracting the value for nonspecific absorption at 600 nm, the amount of malondialdehydethiobarbituric acid complex was calculated using the extinction coefficient 155 mM1cm1 (Hodges et al . 1999). Bioassay for High Temperature Stress a nd Salt Stress Three day old seedlings on agar media in petri plates, wrapped in a single layer of parafilm, were subjected to high temperature stress by immersing the wrapped plates in water set at 37 C for 1 h and then left to continue to grow on the plates containing media kept under room temperature (25 C). For salt stress, three day old seedlings were transferred to control or 100 mM sodium chloride containing media plates. The

PAGE 28

28 primary root growth and the number of lateral roots were recorded for three subsequent days. Statistical Analyses All the statistical analysis was done using Duncan’s multi ple range mean comparisons at 5% alpha. Primary root growth values are expressed as percent root growth on arsenite or heat treatment compared to respective controls standard errors (SE). Root growth on control media is considered 100%. Density of lateral roots was expressed as the numbers of lateral root initials per unit primary root length grown over a three day period. Results Arsenite Inhibits Primary Root Growth i n A . Thaliana but not Lateral Root Density The plant response to arsenic stress in nature is expected to be at the roots, as arsenic is a natural edaphic stress. To investigate the developmental effects of arsenite [As(III)] on Arabidopsis (Columbia) root growth, bioassay on root elongation was done over a period of 3 days at 12 M and 25 M concentrations of As(III). Compared to the control, the primary root elongation was 40% and 5% on 12 M and 25 M As(III) respectively (Fig ures 2 1 A and 2 1 C ). When the total number of lateral roots was counted on these seedlings, we found the mean number of lateral roots did not differ significantly. As(III) treatment increased the lateral root density per mm of primary root. Though the mean number of lateral roots produced per plant were not increased due to As(III), the inhibition in primary root growth resulted in higher density of lateral roots on As(III) ( Fig ures 2 1 B and 2 1 C ).

PAGE 29

29 Auxin Transport Mutants are m ore Sensitive To As ( III) Compared t o Wild Type Using a sublethal concentration of As(III) in the medium (12 M) for root bioassays we screened a number of known A. thaliana mutants for their response to arsenite (Krishnamurthy, A., Teo S, Rathinasabapathi, B, Unpublished). Auxin influx transporter mutant aux1 7 (TAIR stock # CS 3074; Pickett et al. 1990) referred to as aux1 in the rest of the pap er for simplicity, was found to be significantly more sensitive to As(III) than the wild type (WT). After two days of As(III) treatment, the primary root growth on As(III) was 25% for aux1 while it was 34% for WT compared to the respective controls ( Fig ure s 2 2 A ). The sensitivity of aux1 increased on day 3, showing 32% root elongation for WT compared to 16% for the mutant ( Fig ures 2 2 A & 2 2 B ). Measurement of root cell length in the elongation zone revealed that As(III) reduced the root cell length in both WT and aux1 . Reduction in cell length was significantly higher in the aux1 mutan t compared to that of WT ( Fig ure A 1). Since our results implicated a role of auxin transport in As(III) tolerance, we screened PIN auxin transport mutants along with aux1 for As(III) sensitivity. The auxin efflux transport mutants pin1 (TAIR stock # CS 86744; Till et al. 2003) and pin2 (TAIR stock # CS8058; Roman et al . 1995) were also significantly more sensitive to As(III) compared to WT ( Figure 2 2 C ). The inhibitory effect o f As(III) on primary root growth was evident as early as 24 h of treatment. Initiation of lateral root primordia (Benkova et al . 2003) was measured and expressed as lateral root density . The density of lateral roots was similar in all the genotypes under control conditions. After 3 days of As(III) treatment the lateral root density significantly increased in all the genotypes ( Figure 2 2 D ). The increase in density of lateral roots of WT is consistent with that found in Figure

PAGE 30

30 2 1 B . The mutant pin2 and aux1 had significantly more lateral root density compared to the WT and pin1 ( Figure 2 2 D ). Following the root assays, the effect of As(III) on shoot growth of WT and aux1 was quantified. Container grown plants treated with or without 100 M As(III) via irrig ation were compared for leaf area and the number of leaves per plant. A significant difference was observed in leaf area between WT and aux1 ( Figure 2 3a). The total leaf area of the plants grown as control without As(III) treatment was considered 100%. As (III) treatment reduced the total leaf area significantly. The percent leaf area of WT and aux1 on As(III) was 60% and 45% respectively compared to the respective controls. Under control conditions, the aux1 mutant had significantly greater number of leaves/plant compared to WT ( Figure 2 3 B ). The number of leaves/plant did not differ in WT under control or As(III) conditions while it decreased significantly in the aux1 mutant under As(III) condition ( Figure 2 3 B ). To verify if aux1’s response to arsenite w as due to differential uptake of As(III) by the mutant and the WT, As(III) concentration was determined in the fresh plant tissues of both genotypes after 24 h of As(III) treatment. There was no significant difference in As(III) concentrati on between the g enotypes ( Figure A 2) indicating the difference in tolerance was indeed due to differential sensitivity of WT and aux 1 plants to As(III). As(III) Inhibits A uxin T ransport in A. thaliana To test if As(III) had an effect on the transport of auxin, radiolabel led H3IAA uptake assay was performed in WT and aux1 . As(III) treated WT plants exhibited significant reduction in acropetal ( Figure 2 4 A ) and basipetal ( Figure 2 4 B ) transport of

PAGE 31

31 auxin. In the aux1 mutant , significantly lower amount of auxin was transport ed to the root tip compared to the WT as expected ( Figure 2 4 A ). When treated with As(III), the aux1 mutant did not show any change in the acropetal auxin transport while basipetal transport was reduced significantly ( Figure 2 4 A & 2 4 B ). Since the acropet al auxin transport was not affected by arsenite in aux1 but was in WT, we hypothesized that As(III) could be directly or indirectly affecting the functional AUX1 protein in WT. We next tested whether the functional AUX1 protein is the direct target of As(I II). AUX1 Protein is Not the Direct Target o f As ( III) We did the 3H IAA transport assay in a recombinant Schizosaccharomyces pombe expressing functional AUX1 protein. Auxin uptake was significantly greater in AUX1 expressing yeast strain than the control strain ( Figure 2 5). Auxin uptake was unaltered in the control and AUX1expressing strains when treated with As(III) ( Figure 2 5), although the levels of As(III) used were high enough to significantly reduce the growth rate of the yeast (data not shown). E xogenous IAA Treatment Improves As ( III) Tolerance i n Aux1 Mutant but Not i n WT We tested if exogenous treatment of WT and aux1 mutants with IAA will increase the tolerance to As(III) stress. Results indicated a dose dependent increase in root elongation of aux1 seedlings on As(III) when treated with IAA ( Figure 2 6 A ) but not in WT ( Figure 2 6 C ). When the seedlings were pretreated with 0.01, 0.1 and 1 M IAA, per cent root elongation of the mutant under As(III) was increased to 30%, 35% and 29% respectivel y compared to the untreated seedlings ( Figure 2 6 A ). WT seedlings did not respond to exogenous IAA treatment ( Figure 2 6 C ). Pre treatment with 0.01, 0.1 and 1 M IAA did not alter the lateral root density under control conditions in both WT

PAGE 32

32 and aux1 ( Figur e 2 6 B and 2 6 D ). Irrespective of the IAA concentration, WT and aux 1 mutant had higher lateral root density on As(III) media compared to the seedlings on control medium ( Figure 2 6 B and 2 6 D ). Auxin Transport Inhibitors Increase As ( III) Sensitivity in WT To verify if auxin transport had a role in As(III) tolerance in WT, we treated WT plants with auxin influx and efflux transport inhibitors: 1naphthoxyacetic acid (NOA) and N 1 naphthylphthalamic acid (NPA ) respectively. Both transport inhibitors signifi cantly reduced the tolerance of the WT plants to As(III) based on primary root growth ( Figure 2 7 A ). The primary root growth on control media was considered 100% and the growth of WT on As(III) was 45%. The primary root growth of WT on As(III) was reduced to 33% and 37%, when pretreated with NOA and NPA respectively. There was also reduction in the number of lateral roots on treatment with auxin transport inhibitors compared to untreated seedlings. The density of lateral roots was higher under As(III) condition in control and NOA pretreated seedlings ( Figure 2 7 B ). The NPA pretreated seedlings did not show significant increase in lateral root density. These seedlings were 4d old when treated with As(III) due to one day pretreatment and hence primary root g rowth and the number of lateral roots and their response are slightly higher than the previous results in Figure 2 2 D . As ( III) Induces H2O2 Production i n A . Thaliana a nd Reduce s Catalase3 Expression To test whether As(III) induced production of reactive oxygen species (ROS), H2O2 was quantified from the control and As(III) treated seedlings using chemiluminescence assay after 24 h of treatment. Under control conditions, WT and aux1 had comparable amounts of H2O2 ( Figure 2 8 A ). On the contrary, under As(II I)

PAGE 33

33 treatment H2O2 concentration was significantly increased in WT while it was not changed in aux1 mutant ( Figure 2 8 A ). Under the conditions of our experiment, As(III) treatment induced generation of H2O2 in WT seedlings but not in aux1 ( Figure 2 8 A ). Sem i quantitative RT PCR showed that As(III) reduced the expression of catalase3 in WT but not in aux1 in relation to the reference gene actin ( Figure 2 8 B & 2 8 C ). As ( III) Stress Resulted i n Increased Indicators o f Membrane Damage Thiobarbituric acid react ive substances (TBARS), indicators of lipid peroxidation used as an index for reactive oxygen damage to cell membranes were measured in WT and mutant plants after 24 h of As(III) treatment. The WT and aux1 plants did not show any significant difference in TBARS under control conditions. TBARS were significantly increased under As(III) condition in aux1 but not in WT compared to respective controls ( Figure 2 9). The pin1 mutant behaved similar to aux1 under As(III) condition ( Figure 2 9). Aux1 Mutant is More Sensitive to High Temperature and Salt Stress Compared t o WT To test whether aux1 is sensitive to other abiotic stress conditions, WT and aux1 seedlings were evaluated for their tolerance to high temperature stress and sodium chloride stress. Three day ol d seedlings were treated to 37 C for 1 h in a water bath and placed back to room temperature (25 C) to monitor growth. For salt treatment, 3 d old seedlings were placed on media containing 100 mM NaCl. Root lengths were measured after 3 days. Primary root elongation was reduced following the heat or salt stress treatments both in aux1 mutant and the WT. The percent root elongation of primary root growth for WT was 54% while that of aux1 was 40% compared to the

PAGE 34

34 respective controls following heat treatment. In case of salt stress, root elongation was reduced to 76% in WT while it was reduced to 44% in aux1compared to respective controls. There was a significant reduction in root elongation in aux1 mutant compared to the WT ( Figure 2 10 A ). The densities of lateral roots were similar in WT and aux1 under control and salt treatment. There was significant increase in lateral root density in the mutant under heat treatment ( Figure 2 10 B ). Discussion Inorganic arsenic occurs in soils in the form of either arsenate [As(V)] or arsenite [As(III)] (Oremland and Stolz, 2003). As(III) is more toxic than As(V) and As(V) is converted to As(III) in the plant tissue. We chose to use As(III) as an agent to cause oxidative damage to plants at sublethal doses. Because arsenic i s naturally found in soils, we expected that plant adaptations to arsenic stress will be observable using root bioassays of intact seedlings. Root bioassay of Arabidopsis WT seedlings on As(III) showed that the root elongation was hindered significantly by As(III) but not the early initiation of lateral roots ( Figure 2 1). Such inhibitory effects could partly be explained by As(III)’s negative effects on cell elongation ( Figure A 2 1). Our results are in agreement with the earlier reports of root growth inhibition by arsenic (Abercrombie et al . 2008). Though the actual number of lateral roots did not increase on As(III) treatment, the density of lateral roots was increased since the primary root elongation was inhibited. It was known that primary root elong ation and lateral root initiation are both regulated by auxin (Tian and Reed 1999; Strader, Chen & Bartel 2010; Teale et al . 2005). Since the primary root growth and lateral root initiation were differentially affected by arsenite, we suspected that auxin may have a role in root response to arsenite.

PAGE 35

35 Given the difficulty to study the auxin biosynthetic mutants in adaptive stress tolerance, we used the auxin transport mutants to study the role of auxin in tolerance to As(III) induced oxidative stress. The auxin transport mutant aux1 is a missense mutation created by EMS mutagenesis and is defective for functional AUX1 auxin influx transporter (Pickett, Wilson & Estelle 1990; Bennett et al . 1996). The aux1 mutant is disrupted for IAA accumulation in the root apex and has lower concentrations of auxin in the root compared to WT (Swarup et al . 2001). Under control conditions, aux1’s primary root growth was significantly reduced compared to the WT ( Figure 2 2, legend). Hence, we evaluated As(III) tolerance by measuring the growth under As(III) as a per cent of growth under respective controls. Our results from such root bioassays show that the auxin transport mutant, aux1 is more sensitive to As(III) compared to WT ( Figure 2 2). Our study focused on 3 d of root g rowth at which time point the WT and aux1 did not differ significantly, unlike other studies (Marchant et al . 2002). Interestingly, the auxin efflux transport mutants pin1 and pin2 , defective in auxin distribution (Blilou et al . 2005) also showed high sens itivity to As(III) ( Figure 2 2). The density of lateral roots was increased in WT and the auxin transporter mutants due to As(III) treatment. Among the mutants studied, aux1 showed the highest lateral root density under As(III) ( Figure 2 2 ). AUX1 and PIN proteins differ in their tissue distribution and in which cell types they control auxin fluxes in the root (Peer et al ., 2011). Hence, increased inhibition of root growth in both aux1 and pin mutants by As(III) suggests that As(III) could inhibit a common target in their functions. Since aux1 exhibited highest inhibition in primary root growth and distinct increase in lateral root density, we used the aux1 mutant among the auxin transport

PAGE 36

36 mutants for further investigation of its As(III) hypersensitivity. There was no significant difference in As(III) uptake by the WT and the mutant ( Figure A 2), indicating that differential growth response to As(III) between the WT and the mutant was due to differential tissue sensitivity and not due to differential uptak e of As(III). Auxin has a role in determining the leaf area (Kozuka et al . 2010), leaf number and phyllotaxy (Reinhardt et al . 2003). The arsenite sensitive phenotype observed in aux1 was not only confined to roots but also was true for leaf growth and dev elopment ( Figure 2 3). Our results also revealed that aux1 plants had a significantly greater number of leaves than WT plants, a new phenotype for this mutation. Sensitivity of auxin transport mutants in root growth assays suggested a novel role of auxin transport in plant tolerance to As(III) stress. Radiotracer uptake studies showed that in the WT both acropetal and basipetal IAA transports were affected by As(III) ( Figure 2 4). However in aux1, acropetal IAA transport was not affected but the basipetal transport was reduced significantly. This data is consistent with As(III) inhibiting AUX1 directly or indirectly. However, further experiments using recombinant yeast S. pombe expressing functional AUX1 protein indicated AUX1 may not be the direct target of As(III) induced inhibition ( Figure 2 5). Pre treating the aux1 seedlings with exogenous IAA improved tolerance to As(III) in a concentration dependent manner, to the levels equivalent to that of WT but arsenite tolerance of WT seedlings was not further improved due to exogenous IAA ( Figure 2 6). The WT seedlings became more sensitive to As(III) upon pretreatment with auxin transport inhibitors NOA and NPA ( Figure 2 7). Together, these results indicate that auxin concentration influenced by

PAGE 37

37 auxin transport has a role in determining arsenite tolerance. NOA pretreatment had more pronounced effect on As(III) sensitivity than NPA. Arsenic is known to produce free radicals (ROS) and cause oxidative damage in plant (Letterrier et al . 2012; Rao et al. 2011) and animal cells (Shi, Shi & Liu 2004). We measured hydrogen peroxide which is one of the major ROS having dual roles of oxidative damage and signaling, depending on its cellular concentration. On As(III) exposure, H2O2 concentration was increased in WT whil e there was no significant change in aux1( Figure 2 8 A ). Consistent with this, semi quantitative RT PCR results showed reduced catalse3 expression in WT on As(III) treatment but not in aux1 ( Figure 2 8 B & 2 8 C ). Reduced expression of catalase3 by arsenic in Arabidopsis was earlier reported by others (Abercrombie et al. 2008; Letterrier et al . 2012). On the contrary, induction of catalase activity by arsenic was reported by Mylona et al . (1998). Recent study in Chlamydomonas shows transient accumulation of H2O2 by down regulation of catalase activity (Michelet et al. 2013). Catalase knockdown mutants fail to establish the transient H2O2 burst and subsequent expression of stress related genes (Michelet et al . 2013). Similar to this, we observed a negative correlation between the catalase3 expression and H2O2 concentration. These results suggest under As(III) stress, auxin transport by AUX1 has a negative control on expression of catalase 3 and in turn regulates H2O2 concentration. Lipid peroxidation measured in terms of thiobarbituric acid reactive substances (TBARS) is often used as an indicator of oxidative damage. Our data indicated that under control conditions, WT and aux1 plants had similar TBARS content. On As(III) treatment, TBARS levels in WT plant s did not alter but that of aux1 increased

PAGE 38

38 significantly ( Figure 2 9) demonstrating higher oxidative damage in the mutant. This shows that the phenotypic sensitivity of aux1 root growth observed on As(III) is preceded by oxidative stress caused by As(III). These results of [H2O2] and [TBARS] together suggest that As(III) induces H2O2 production in WT which has a protective function in controlling the cell lipid peroxidation. So, increase in H2O2 concentration may have a signaling role in protecting cells against oxidative damage caused by As(III) and this is under the control of auxin transport mediated by transporter AUX1. Accumulation of H2O2 is reported during abiotic stress tolerance mechanisms: salt stress tolerance (Tsai et al. 2004, Panda and Upadhyaya 2003, Hernandez et al. 2010) and cold acclimatization and membrane stabilization (Zhou et al . 2012) in plants. Plant defense by H2O2 induce programmed cell death (PCD) is also reported in barley aleurone layer (Bethke and Jones 2001) and in hypersensi tive response in plant pathogen interactions (Levin et al . 1994). Apoplastic ROS decreases auxin signaling and causes O3induced morphological response in Arabidopsis (Blomster et al . 2011). ROS has a role in morphological response of roots in cress via auxin signaling genes (Muller et al . 2012). Under cadmium stress, H2O2 affected expression of genes involved in auxin signaling pathway and cell cycle (Zhao et al . 2012). These studies along with our results from this paper suggest auxin signaling is downstr eam to H2O2 accumulation. Reactive oxygen species are a component of not only heavy metal toxicity but also heat stress (Vacca et al . 2004) and salt stress (Sun et al . 2010a). Stress tolerance assays from our study also indicate a role for auxin in heat and salt stress tolerance ( Figure 2 10). This result is in accord with a recent work, where redox networks

PAGE 39

39 including a glutaredoxin are implicated in heat stress tolerance via auxin (Cheng et al . 2011). Also, recent studies implicated role of auxin in plant tolerance to high salinity (Iglesias et al . 2010; Park et al . 2011). Measurement of primary root growth under stress indicated auxin having a role in plant tolerance to oxidative stress caused by various abiotic agents As(III), high temperature and salinit y. Plant responses to these stress factors in our study are similar with respect to primary root elongation while the number of lateral roots seems to have differential response for various stress factors. The lateral root density of aux1 mutant was increased under As(III) and heat treatment but not under salt stress. We propose a model for AUX1 function in plant tolerance to As(III) stress ( Figure 2 11). Our results show inhibition of auxin transport and primary root growth by As(III). As(III) induces H2O2 production in WT but not in aux1 mutant. In response to As(III) stress, membrane damage in terms of TBARS were increased in the mutant suggesting a role of AUX1 in protecting the cells from ROS damage by controlling H2O2 concentration through different ial expression of H2O2 scavenging enzyme catalase3. This indicates that auxin transport and distribution may have roles in As(III) induced ROS signaling mechanism. AUX1 could directly be involved in induction of ROS signaling via H2O2 mediated pathway whi ch prevents further increase in oxidative damage or could indirectly influence cell elongation and cell division by regulating auxin levels and auxin signaling network, in turn controlling the root growth under stress. The details on how auxin signaling m ay be connected to As(III) tolerance are unknown. Since toxicity of As(III) has been linked to its interaction with thiols and thiol proteins, we speculate that one or more redox regulated proteins to provide this link.

PAGE 40

40 This idea is consistent with the res ults of Bashandy et al. (2010) who showed that a triple mutant impaired for two thioredoxin reductases ( ntra ntrb) and glutathione biosynthesis ( cad2 ) developed auxinrelated phenotypes including those of auxin transport and biosynthesis mutants. Further, inhibition of glutathione synthesis decreased the expression of auxin transporters and auxin response genes (Bashandy et al . 2010). Therefore, both the inhibition of auxin transport by arsenite and As(III) sensitivity of auxin transport mutants in our st udy, could be explained by As(III) thiol complex formation leading to the perturbation of cellular redox homeostasis. In this work, we used As(III) as an agent known to produce ROS in plants (Hartley, Ainsworth & Meharg 2001; Singh et al . 2007; Shri et al . 2009; Duman Ozturk & Aydin 2010) to show that auxin transport has a role in plant response to As(III) induced oxidative stress. Our work suggests that As(III) or other ROS inducing chemicals could be used as tools to investigate auxin transport and plant response to stress. Such chemical agents could be more accurately measured and maneuvered than imposing drought and salinity, thus providing an experimental advantage for the identification of genes involved in plant growth regulator pathways with roles i n plant adaptations to stress. Because auxin is a regulator of growth and development, the sensitivity of aux1 to multiple stress factors could be interpreted as a nonspecific phenotype for any environmental stress. However, the sensitivity of aux1 to thr ee environmental factors and differential responses for lateral root density to these stresses suggest that the effects observed here are specific with a common element likely shared by the stress factors examined. Unlike what is reported here, aux1 mutant is not always sensitive to

PAGE 41

41 stress conditions. The aux1 mutant was significantly less inhibited by aluminum (Sun et al. 2010b) and selenium (Lehotai et al . 2012) than WT. Blomster et al. (2011) reported that aux1 did not differ from WT in its response to ozone stress. Together these results indicate that auxin’s role in stress tolerance is not merely due to effect of tissue auxin’s concentration on growth but auxin transport has specific function in response to different abiotic stress factors. We have pr esented the first genetic and biochemical evidence to show that arsenite affects auxin transport. Our study suggests a novel role of auxin transport in tolerance to As(III) induced oxidative stress via ROS signaling mechanism. These results could be used t o devise novel methodologies to probe the interconnections between oxidative stress tolerance and auxin.

PAGE 42

42 Figure 2 1 . Response of Arabidopsis thaliana plants to sodium arsenite. A ) Effects on primary root growth. B ) lateral root initiation. Three day old WT seedlings were transferred to control or As(III) containing vertical plates. Primary root length was measured and the number of lateral roots was counted two days after transfer to control or As(III) media. Lateral roots are expressed as numbers per unit primary root length grown over a 2 d period. Values are means SE (n=20). Means marked with different letters indicate signifi cant differences at 5% alpha. C ) Phenotype of plants exposed to arsenite (12 or 25 ) for seven days compared to media wi th no As(III) (Control).

PAGE 43

43 Figure 2 2 . Effect of As(III) on primary root growth and number of lateral roots in WT and auxin transport mutants. A ) Relative root growth on As(III) compared to respective controls. Root growth measured for 3 subsequent day s after transfer to As(III) (Values are mean percent root growth on As(III) compared to respective controls SE (n=20). Mean primary root growth of WT & aux1 on control media after 3 d of treatment were 20.63 mm 0.64 and 16.4 mm 1.76 r espectively. B ) Phenotype of plants exposed to arsenite (12 ) for three days compared to media with no arsenite (Control). C ) Relative root growth of WT and auxin transport mutants on As(III) compared to respective controls. Root growth on control medi a is considered 10 0%. D ) Number of lateral roots measured 3 d after transfer to control or arsenite media and are expressed as numbers per unit primary root length grown over a 3 d period. Values are means SE (n=20). Asterisks indicate significant difference between WT a nd aux1 at 5% alpha. Means marked with different letters indicate significant differences at 5% alpha.

PAGE 44

44 Figure 2 3 . Effect of As(III) treatment on shoot growth. Plants were grown in containers with potting media, four week old seedlings were treated w ith 0 m or 100 m As(III) through fertigation to field capacity. Observations were recorded 10 d after treatment. A ) Leaf area; Leaves were separated and scanned and leaf area was measured from scanned images of excised leaves using Image J software. Leaf area of plants grown on control media is considered 100%. B ) Number of leaves per plant counted 10 d after treatment. Values are means SE (n=9). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 45

45 Figure 2 4 . Effect o f arsenite on auxin transport. A ) Acropetal and B ) Basipetal IAA transport in roots of control or As(III) treated WT and aux1 . Radiolabeled IAA was used to measure IAA transport from near the tip of the root to 5 mm toward the base of the stem, over a 24 h period. Analyzed tissue is 5 mm section of root sampled 5 mm away from the spot of application. Acropetal (n=10) Basipetal (n=6). Means marked with different letters indicate significant differences at 5% alpha analyzed using.

PAGE 46

46 Figure 2 5 . AUX1 is no t the direct target of arsenite. IAA uptake in AUX1 expressing yeast strain. IAA uptake in the Schizosaccharomyces pombe control and AUX1 overexpressing lines. The lines were grown for OD=2 and treated with 0 (control) or 120 m As(III) and incubated for 2 h followed by addition of H3IAA (100 nci /500 l of 2 OD cells). After 1 h yeast culture was washed twice with YES media, resuspended in 500 l YES before measuring the radioactivity using scintillation counter. Values are mean SE (n=8). Means marke d with different letters indicate significant differences at 5% alpha. 0 1 2 3 4 5 6 Ctrl 3 Aux1 3 H3 IAA uptake (fmol/plant/24h) Control AsIII a a b b

PAGE 47

47 Figure 2 6 . Exogenous IAA treatment improves arsenite tolerance in aux1 mutant but not in WT. Relative root growth of IAA pretreated A ) aux1 and C ) WT on As(III) compared to cont rol. Seedlings were pretreated with 0, 0.01, 0.1 and 1 m IAA for 24 h before transfer to arsenite media. Root growth was measured after 3 d of transfer to arsenite media (Values are mean percent root growth on arsenite compared to respective controls SE (n=10). Root growth on control media is considered 100%. Effect of exogenous IAA treatment on number of lateral roots in B ) aux1 and D ) WT. Number of lateral roots measured 3 d after transfer to arsenite media and expressed as numbers per unit primary root length grown over a 3 d period. Values are mean SE (n=10). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 48

48 Figure 2 7 . Auxin transport inhibitors increase sensitivity of WT (Columbia) to arsenite. A ) Relative root growth of inhibitor pretreated WT on As(III) compar ed to control. Seedlings were pretreated with either NOA or NPA or control media for 24 h before transfer to arsenite media. Root growth measured after 3 d of transfer to arsenite media (Values are mean percent root growth on arsenite compared to respecti ve controls SE (n=20). Root growth on control media is considered 100%. B ) Effect of auxin transport inhibitors on number of lateral roots. Numbers of lateral roots measured 3 d after transfer to arsenite media and are expressed as numbers per unit primary root length grown over a 3 d period. Values are mean SE (n=20). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 49

49 Figure 2 8 . Quan tification of hydrogen peroxide. A ) Quantification of hydrogen peroxide using chemi luminescence. Hydrogen peroxide (H2O2) was quantified using chemiluminescence assay. Three day old seedlings were placed on control or As(III) containing medium in vertical plates. Plant samples were collected after 24 h of treatment. H2O2 were measured fr om plants, 24 h after placing the seedlings on plates containing 0 or 12 m As(III). Values are means SE (n=3), 20 seedlings were po oled per replicate. Means marked with different letters indicate significant differences at 5% alpha. B ) Semi quantitative RT PCR analysis for the expression of catalase3 in the roots of 1: WT Control; 2:WT As(III); 3: aux1Control; 4: aux1 As(III). C ) Relative expression of catalase3 in relation to reference m RNA for , actin.

PAGE 50

50 Figure 2 9 . As(III) induces lipid peroxidat ion in WT, aux1and pin1. Thiobarbituric acid reactive substances (TBARS) in WT, aux1 and pin1 under control and heat stress conditions. TBARS were measured from plants, 24h after placing the seedlings on plates containing 0 or 12 m As(III). Values are means SE (n=3), five seedlings were pooled per replicate. Means marked with different letters indicate significant differences at 5% alpha. 0 50 100 150 200 250 WT aux1 pin1 TBARS content ( moles/g fw ) Control AsIII c a ab a b d

PAGE 51

51 Figure 2 10. Effect of high temperature and salt stress on primary root growth and number of lateral roots in WT and aux1 mutants. A ) Relative root growth on high temperature and salt treatment compared to respective controls. For heat treatment three day old seedlings on agar media in petriplates, were treated with 370 C for 1 h in water bath and then allowed to grow at room temperature. For salt treatment, 3 d old seedlings were placed on plates containing media with 100mm sodium chloride and allowed to grow. Primary root growth was measured 3 d after the treatment. Values are mean percent root growth on heat compared to respective controls SE (n=30). Root growth on control media is considered 100%. B ) Number of lateral roots was measured 3 d after heat or salt treatment and expressed as numbers per unit primary root length grown ov er a 3 d period. Values are means SE (n=30). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 52

52 Figure 2 11. Model for AUX1 function in plant stress tolerance. The model is based on results presented here. Solid lines have experimental evidence and hypothetical routes are shown with dotted arrows. Green arrows indicate positive regulations and red arrows negative regulations . ROS Damage [TBARS] Catalase 3 Arsenite stress ROS [H2O2] Root/shoot growth AUX1 Auxin transport ROS Signaling

PAGE 53

53 CHAPTER 3 OVEREXPRESSION OF FERN GLUTAREDOXIN PVGRX5 IMPROVES HIGH TEMPERATURE STRESS TOLERANCE IN RICE AT VEGETATIVE STAGES Chapter Summary Glutaredoxins (Grx) are small heat stable proteins that reduce disulfide bridges and glutathione adducts in proteins and protect cellular proteins from oxidative damage. To understand the functions of Grxs in plant tolerance to heat stress, we overexpressed (OE) a Grx cDNA from the fern Pteris vittata ( PvGRX 5 ) or Arabidopsis ( AtGrxS14 or AtGrxS2 ) as independent events in Oryza sativa cv. Nipponbare using Agrobacterium mediated transformation. Transgene expression was verified by semi quantitative RT PCR and protein extracts from GRX OE lines had significantly higher Grx activity compared to the control lines. Grx OE lines were evaluated for high temperature stress tolerance by exposing seedlings to 37C and 45C at germination and V34 stages of plant growth respectively. Compared to unstressed counterparts, following stress treatment there was no or less inhibition of shoot growth in PvGRX 5 OE lines compared to higher inhibition in control lines. PvGRX 5 and A tGrxS14 OE lines showed significantly less protein carbonylation under heat stress conditions indicating the ability of Grx to protect cellular proteins against oxidation. PvGRX 5 OE lines had significantly higher PSII efficiency under heat stress conditions compared to control lines. Together these results demonstrate that overexpression of PvGRX 5 in transgenic rice improved thermotolerance at two vegetative stages of plant growth.

PAGE 54

54 Background Rice is a staple food for half of the world’s population. R ice growing regions in the tropics and subtropics experience high temperature stress, which causes significant reduction in grain yield. F or every 1C increase in night temperature from 22.5 C, yield is reduced by an estimated 10 % (Peng, et al ., 2004). In the past 3 decades, frequent heat stress events were recorded in the rice belts of Asia, Africa and the Middle East (Laborte et al ., 2012 ; Tian et al., 2009). Rice is affected by high temperature at all stages of development. High temperature stress at veg etative and r eproductive growth stages reduces number of tillers, spikelet fertility, grain development and grain yield (Yoshida et al ., 1981; Jagadish, Craufurd & Wheeler, 2007; Yoshida, 1973). Not only does the h igh temperature stress reduce the rice yield but also the grain quality (Lanning et al., 2011; Liu et al., 2013) by increasing the chalkiness (Lanning et al ., 2011) and reducing the milling quality (Ambardekar et al., 2011). High temperature induces oxidative stress in plants (Gong et al., 1997; Larkindale & Knight, 2002; Vacca et al., 2004) leading to protein modifications such as disulfide formation and glutathionylation. Cysteine and methionine residues in proteins are the most sensitiv e targets for oxidation (Giles et al., 2003; Levine et al., 1996). Plants however have built in mechanisms to avoid, resist or reverse the damage caused by oxidative stress and to protect proteins from degradation. One such mechanism is by changing the conformation of the proteins through oxidationreduction react ions. Oxidoreductases, glutaredoxins (Grx) and thioredoxins (Trx) reduce inter and intramolecular disulfide bonds and deglutathionylate proteinGSH adducts (Holmgren, 1989; Meyer et al., 2009). Plant glutaredoxins , classified based on the presence of two major

PAGE 55

55 active site motifs CXX[C/S] (class I) and CGFS (class II) (Garg et al., 2010; Rouhier, 2010 ) are capable of catalyzing direct disulfidethiol exchange reactions with oxidized proteins and thereby reduce disulfide bridges between proteins or resolve proteinglutathione adducts (Rouhier, Lemaire & Jacquot, 2008) , thus protect ing cellular proteins from reactive oxygen species (ROS) damage. Plants contain a large family of Grxs, with the rice genome expressing at least 48 Grxs (Garg et al. , 2010). Althou gh f unctions for all these Grxs are not well understood, emerging research has shown diverse functions for specific Grxs . Plant Grxs have been shown to be reducing 5’ adenylylsulfate reductase (Bick et al., 1998), thioredoxin h (Gelhaye et al, 2003), methi onine sulfoxide reductase B (Santos et al., 2007; Tarrago et al., 2009), cytosolic glyceraldehyde3 phosphate dehydrogenase (Bedhomme et al., 2012) and peroxiredoxin (Couturier et al., 2011). Some of the Grxs function in the assembly and delivery of [2Fe2 S] clusters (Bandyopadhyay et al., 2008; Couturier et al., 2011). ROXY1, a CC type Grx has been shown to be needed for petal initiation and development via post translational modification of target proteins (Xing et al., 2005). This Grx suppresses JA res ponsive transcriptional network (Ndamukong et al., 2007) and JA/ethylene induced defense pathway (Li et al., 2011; Zander et al., 2012). When overexpressed, it leads to an increase in hydrogen peroxide levels and pathogen susceptibility (Wang et al., 2009). Arabidopsis GrxS13, a jasmonic acidrepressed gene (La Camera et al., 2011) has been required for tolerance to photooxidative stress (Laporte et al., 2012), suggesting Grx’s role at the cross roads between biotic and abiotic stress defense.

PAGE 56

56 Proteinpr otein interaction studies have identified 94 interacting partners for a poplar Grx (Rouhier et al ., 2005) including several abiotic stressrelated proteins such as heat shock protein 60, catalase and glutathione reductases. Several membrane proteins also i nteract with Grxs in Cyanobacteria (Li et al ., 2007). Consistent with their biochemical function, some of the plant Grxs have been implicated in their role in oxidative stress tolerance. An Arabidopsis Grx AtGrx 4, when expressed in mutant yeast cells grx5 suppressed the mutant’s sensitive phenotype to oxidative stress (Cheng, 2008). Similarly Arabidopsis plants lacking expression of plastidial Grx AtGrxCp showed high sensitivity to oxidants and increased protein carbonylation in the chloroplast (Cheng et al ., 2006). Recently specific Arabidopsis Grxs have been analyzed for their biological functions in temperaturedependent post embryonic growth via modulating auxin response (Cheng et al ., 2011; Sharma et al., 2013) . Transgenic expression of SlGrx from tomat o in Arabidopsis (Guo et al ., 2010) improved oxidative, drought and salt stress tolerance. In a previous study from our program, Sundaram et al (2008) characterized a cDNA for PvGRX 5 , a plastid targeted Grx with both CRSS and CGFS motifs from the tropical fern Pteris vittata , which has the unusual ability to hyperaccumulate arsenic (Ma et al ., 2001) . Transgenic expression of, PvGRX 5 in Arabidopsis thaliana increased plant tolerance to arsenic and reduced arsenite levels in the leaves (Sundaram et al., 2009) . PvGRX OE lines of Arabidopsis also exhibited tolerance to high temperature stress with significantly reduced oxidative damage (Sundaram & Rathinasabapathi, 2010). High temperature stress tolerant phenotype of the PvGRX 5 OE lines were shown by testing se ed germination under high temperature stress and biomass increase after imposing

PAGE 57

57 heat stress on container grown plants (Sundaram & Rathinasabapathi, 2010). PvGRX 5 OE lines had significantly less ion leakage, lipid peroxidation and protein oxidation under high temperature stress. From this study, however, it was not clear whether PvGRX 5 was unique in its role in improving thermotolerance or other plastidic Grx could function in that role. Also unknown was whether thermotolerance could be improved using PvGR X 5 in tropical crops naturally more adapted to high temperature stress than Arabidopsis. Because of the potential value in improv ing rice crop’s tolerance to high temperature stress, we generated transgenic rice lines constitutively over expressing (OE) PvGRX 5 cDNA. In addition, we generated transgenic rice lines expressing either a cytosolic Grx ( AtGrxS2 ) or a plastidlocalized Grx ( AtGrxS14 ) from Arabidopsis thaliana for comparison. These transgenic lines showed differential responses to high temperature stress imposed at various stages of crop growth. Here we report, over expression of PvGRX 5 improved high temperature stress tolerance in rice at early vegetative growth stages of the crop and PvGRX 5 was unique in that role compared to the two Arabidopsi s Grxs tested . Materials And Methods Plant M aterial Oryza sativa cv. Nipponbare was used for the transgenic overexpression of the glutaredoxins. In all the experiments, seeds were prepared for germination by dehusking and surface sterilization. Dehusked seeds were rinsed in 50 % (v/v) commercial bleach and 0.01 % (v/v) silvetTM for 15 min and then rinsed five times in sterile water. Seedlings were grown in commercial propagation medium (Mix number 2,

PAGE 58

58 Farfard Inc., Agawam, MA, USA). Seedlings were grown under 90 100 mol/m2/s, 16:8 h light/dark photoperiods at a room temperature of 23 1 C and relative humidity ranging from 42 % to 48 %. The plants were subsequently transferred to the naturally lit greenhouse (FebJune 2013 in Gainesville, FL) and allowed t o grow till flowering and seed set. The average temperature in the greenhouse during this period was 29.5 C. Watering was done twice a week to field capacity. Chemicals Dehydroascorbate (DHA) and 2, 4 d initrophenylhydrazine (DNPH) were purchased from Sigm a Aldrich (St. Louis, MO, USA). Restriction enzymes and the cloning kits were purchased from Ambion and Invitrogen, Life technologies, Carlsbad, CA, USA. Cloning and Plant T ransformation The glutaredoxin cDNA PvGRX 5 (768bp), AtGrxS14/AtGrxCp/At3G54900 (815bp) and AtGrxS2/At5G18600 (57 8bp) were amplified from Pteris vittata and Arabidopsis leaf cDNA templates respectively using primers with BamH I ends by high fidelity PCR. The DNA was digested with BamH 1 and subcloned into pTOPO vector using TOPO TA cloning kit (Invitrogen, Carlsbad, C A, USA) and verified by sequencing. Glutaredoxin cDNAs were cloned in independent pCamHu constructs. The gel purified cDNA fragments digested with either BamH I or Bgl II were subcloned into BamHI site in the multiple cloning site of pCamHu vector ( Figure 3 1) . The recombinants were selected on kanamycincontaining media following transformation into E. coli . The inserts in the resulting constructs were sequenced in both directions to

PAGE 59

59 confirm the subcloning direction and integrity of the sequence. Plant trans formation was done using agrobacterium mediated transformation using embryonic calli (Plant transformation facility, Iowa State University ). Putative transformants were regenerated and selected for hygromycin resistance. Gene E xpression Total RNA was extra cted from leaf tissue of putative transgenic plants using RNeasy Plant Minikit (Qiagen) according to manufacturer’s instructions. Gene expression analysis was done using semi quantitative RT PCR. Gene specific primers for PvGRX 5 , AtGrxS14 and AtGrxS2 were us ed for gene expression (Table B 1). Rice actin 1 gene ( OsAct1 ) was used as a reference gene. First generation transgenic lines (T1) were screened on hygromycin and forwarded to next generation to select the homozygous lines. T2 generation seeds (progeny from selfed T1 plants) were used for all the phenotypic characterizations. Glutaredoxin A ctivity A ssay Glutaredoxin activity was determined using the reduction of dehydroascorbate (DHA) in the presence of GSH and crude protein extracts (Stahl et al., 1983) . Leaf tissue was extracted in a pestle and mortar in an extraction medium ( Tris HCl pH 8.0, 100 mM, EDTA 2 mM, Betam ercaptoethanol 5 mM and protease inhibitor cocktail). The extracts were separated from insoluble material by centrifuging 20 min at 20,000 g. Dialyzed protein extracts were used to determine the Grx activity. The assay mixture included 137 mM sodium phosphate, pH 6.8, 1mM EDTA, 2mM GSH and 1mM DHA.

PAGE 60

60 spectrophot ometer (Stahl et al. , 1983). The enzyme specific activity was expressed as nanomol per milligram of protein. Total protein was estimated using Bradford protein assay (Bradford, 1976). Germination Assay f or High Temperature Stress Tolerance Dehusked and sur face sterilized seeds were germinated in a petriplate with wet germination blotter paper. One set of the plates was incubated at 28C and the other at 37C both under dark conditions. After 4 days the shoot and root length of the germinated seedlings were recorded. Vegetative Stage Seedling Tolerance t o Heat Stress Fifteen day old container grown plants were heat stressed in an environmental plant growth chamber set at 45 1 C for 24h. After 24 hours, plants were transferred back to room temperature (23 2 C ) for recovery. The PSII efficiency was measured immediately after 24 hours of heat treatment using plant efficiency analyzer (Hansatech instruments Ltd. Norfolk, England). Leaf tissue samples were used for quantifying lipid peroxidation and protein carbonylation. After 10 days of recovery, shoot fresh and dry weights were measured. Determination of Carbonyl Content i n Proteins The protein carbonyl content was determined using the dinitrophenyl hydrazine (DNPH) method using a UV Visible spectrophotometer (Levine et al ., 1994). Total soluble proteins (0.1 to 0.2 mg) were incubated with the 1% (w/v) streptomycin sulfate and 0.3% (v/v) Triton X 100 for 20 min and centrifuged at 2,000g for 20 min to remove

PAGE 61

61 N HCl. For blank incubated at room temperature for 1 h, and then the protein was precipitated by adding 10% (w/v) TCA. The pellets were washed thoroughly using ethanol: ethyl acetate (1:1). The final pellets were dissolved using 6 M guanidine hydrochloride in 20 mM potassium phosphate at pH 2.3, and the absorption was measured at 360385 nm using a 96 well microplate reader (SynergyTM, Biotek Instruments Inc.). The protein recovery was estimated using Bradford protein assay (Bradford, 1976). The carbonyl content was calculated using the molar absorption coefficient for aliphatic hydraz ones of 22,000 M1 cm1 (Reznick and Packer, 1994). Statistical A nalysis All experiments were done using the completely randomized design and repeated at least thrice with similar results . All statistical analyses were carried out using analysis of varianc e and Duncan’s multiple mean comparisons at 5% alpha. All the values are expressed as mean standard errors (SE). Results In this study, we generated several independent and stable rice transgenic lines overexpressing fern cDNA for PvGRX 5 glutaredoxin und er the control of the maize ubiquitin transcriptional promoter ( Figure 3 1 A ). For comparisons, we also generated several independent stable rice transgenic lines expressing Arabidopsis thaliana Grx, AtGrxS14 or Arabidopsis thaliana Grx, AtGrxS2 ( Figure 3 1 B ). The AtGrxS14 has a chloroplast target peptide similar to PvGRX 5 while AtGrxS2 is cytosol targeted. PvGRX 5 has two Grx motifs CRSS (class I Grx, Couturier et al ., 2009) and CGFS (class II Grx, Couturier et al ., 2009) , while Arabidopsis glutaredoxins AtGrxS14 and AtGrxS2

PAGE 62

62 have one Grx motif each CGFS (class II Grx, Couturier et al ., 2009) and CC (class III Grx, Couturier et al ., 2009) respectively ( Figure 3 1 B ) . Expression of these cDNAs in rice was confirmed by semi quantitative RT PCR ( Figure 3 2 A ). The levels of transgene expression were high in PvGRX 5 , AtGrxS14 and AGrxS2 OE lines compar ed to constitutively expressed rice actin 1 gene ( OsAct1 ) but was not detectable in control lines ( Figure 3 2 A ). Leaf protein extracts were measured for glutaredoxin specific activity. A high background activity was detected in wild type plants. Transgenic lines expressing PvGRX 5 showed significantly higher (alpha = 0.05) Grx specific activity compared to the wild type ( Figure 3 2 B ). PvGRX 5 overexpression resulted in an i ncrease of about 27 to 48% of Grx specific activity compared to that of the wildtype ( Figure 3 2 B ). This increase in Grx activity is similar to that recorded in PvGRX 5 OE lines in Arabidopsis (Sundaram & Rathinasabapathi, 2010) . Specific activities in protein fractions from OE lines expressing AtGrxS14 and AtGrxS2 were more moderate (1827 % compared to wild type) ( Figure 3 2 B ). Phenotypic Evaluation o f Grx OE Lines f or High Temperature Stress Tolerance Grx OE lines had normal growth and development and flowered and set seeds in the greenhouse. We devised a bioassay method to evaluate high temperature stress tolerance of whole plants at germination (S 1 to 3) and vegetative (V 3 4) stages of plant growth (Counce, Keisling & Mitchell, 2000).

PAGE 63

63 PvGRX 5 OE Li nes are More Tolerant t o High Temperature Stress During Germination A 37C heat stress imposed during the germination period for 4 d significantly inhibited cotyledon and radicle growth in rice seedlings. PvGRX 5 OE lines were significantly more tolerant to heat stress compared to the vector control and the wild type ( Figure 3 3 A ). There was significant inhibition of coleoptile growth on heat treatment in wild type and vector control. The coleoptile growth in PvGRX 5 OE lines was less inhibited by heat stress treatment compared to the control lines ( Figure 3 3). Arabidopsis Grx OE lines behaved similar to the vector control line. Under heat stressed condition PVG24 and PVG18 had significantly higher coleoptile length compared to all other lines ( Figure 3 3 A ). All the lines showed significant reduction of radical length in high temperature conditions compared to growth under control conditions ( Figure 3 3 B ). Evaluation of Transgenic Rice Lines for Heat Tolerance at Early Vegetative Stage Next we evaluated the Gr x OE lines for heat tolerance following a prolonged and severe heat stress (24 h, 45 C) on seedlings at vegetative stage (V3 V4) (Figure 3 4 A ). Heat stress treatment produced severe chlorotic blotches in the leaf tip and significantly reduced shoot dry weight in wild type and vector control lines ( Figure 3 4 A and 3 4 B ). Following the 24 h heat stress and recovery under control conditions for 10 d, PvGRX 5 OE lines had greener leaves and less areas of chlorotic tissue in the leaves compared to the control and AtGrx OE lines ( Figure 3 4 A ). Based on shoot dry weight, PvGRX 5 OE lines did not show any significant reduction upon heat stress unlike wild type, vector control and AtGrx OE lines which were significantly inhibited by the stress treatment

PAGE 64

64 ( Figure 3 4 B ). Additional PvGRX 5 OE lines tested, showed similar growth phenotype with no or less reduction in shoot dry weight under heat stressed conditions ( Figure B 1). To evaluate the status of oxidative damage during stress, we sampled leaves of vector control and Grx OE lines following stress recovery as shown in the experiment above ( Figure 3 4). Protein oxidation was estimated by quantifying the carbonyl content of the proteins. Heat stress significantly increased the protein carbonyl content in wild type and ve ctor control, but not in the PvGRX 5 OE and AtGrxS14 OE lines which have both chloroplast targeted Grxs ( Figure 3 5). Under heat stress conditions PvGRX 5 and AtGrxS14 OE lines had significantly less protein oxidation than the control lines ( Figure 3 5). Chlorophyll fluorescence was measured to quantify the PSII efficiency in the plants immediately after the stress treatment. Heat treatment significantly reduced the PSII efficiency in all the lines ( Figure 3 6). Upon stress treatment, PvGRX 5 OE lines had significantly less reduction in PSII efficiency compared to all other lines ( Figure 3 6). In AtGrx OE lines, the PSII efficiency under stress was significantly greater than the vector control but less than that found in PvGRX 5 OE lines ( Figure 3 6). Discussion In a previous study, Grx cDNA from the fern Pteris vittata ( PvGRX 5 ) when overexpressed in Arabidopsis thaliana, resulted in transgenic plants improved for tolerance to high temperature stress (Sundaram & Rathinasabapathi, 2010). This suggested a possibili ty of improving heat tolerance in rice by overexpressing PvGRX 5 . We generated stable transgenic rice lines overexpressing PvGRX 5 cDNA. In addition,

PAGE 65

65 we generated transgenic rice lines expressing either a cytosolic Grx or a plastidlocalized Grx from Arabidopsis thaliana ( AtGrx ) for comparison along with vector control lines ( Figure 3 1). The expression of each cDNA was confirmed by semi quantitative RT PCR ( Figure 3 2 A ). The transgenic lines overexpressing glutaredoxins had higher glutaredoxin specific activ ity compared to the control lines ( Figure 3 2 B ). The T2 generation plants were evaluated for high temperature stress tolerance at two stages of growth. While the current study is confirmatory of Sundaram & Rathinasabapathi (2010), it added further insight into our understanding of PvGRX ’s roles in protein protection from stress and plant growth under high temperature stress. We identified that rice lines overexpressing a fern Grx cDNA exhibited improved tolerance to high temperature stress when whole plants were stressed at the germination stage or at the V34 stage ( Figure 3 3 and 3 4). In the germination stage evaluation, t he coleoptile length ( Figure 3 3) of the lines modified to express the fern glutaredoxin was less/not inhibited by a high temperature s tress treatment, while the control lines were significantly inhibited. Also, Arabidopsis Grx OE lines were significantly affected by high temperature stress ( Figure 3 3). While such differences were observed in the coleoptile length, the lines were not si gnificantly different when radicle length data were analyzed ( Figure 3 3). It is not known whether the transgene expression is different between the coleoptile and radicle tissues. At the early vegetative stage also, growth of the PvGRX 5 OE lines was sig nificantly less affected by a severe stress treatment as measured by above ground biomass weight ( Figure 3 4 A and 3 4 B ) while the lines overexpressing Arabidopsis Grxs

PAGE 66

66 were not significantly different from the vector control ( Figure 3 4 A and 3 4 B ). Together these results suggest that t he fern glutaredoxin was unique in improving the thermotolerance of transgenic rice lines as the lines expressing Arabidopsis Grx cDNAs had no greater thermotolerance compared to control lines. In functional genomics, knockouts and knockdown mutants are often used to link a gene to a function. However, this approach is not suitable for gene families with overlapping functions. But an overexpression (OE) approach is appropriate in cases where transgene function in a heterologous species could lead to a phenotype. Because plants have a large family of Grxs which may have overlapping functions, transgenic OE strategy is advantageous than mutant analysis. In this study we used such a strategy to link the function of a Grx in high t emperature stress tolerance. GlutaredoxinOE lines had significantly lower levels of protein oxidation than the control plants when leaf proteins were evaluated following a high temperature stress treatment ( Figure 3 5). This is consistent with earlier studies where low levels of protein carbonlyation were recorded in proteins isolated from chloroplasts of AtGrxS14 OE lines (Cheng et al. , 2006). Reduced protein carbonylation in both the chloroplast targeted Grx OE lines under heat stress support a protectiv e function of Grx in the chloroplasts from protein oxidation ( Figure 3 5). However, it is to be noted that protein protection from oxidative damage alone was not sufficient to improve the whole plant tolerance to a severe heat stress treatment, because AtGrxS14 OE line which exhibited significantly lower protein oxidation than the control lines under heat stress ( Figure 3 5) was not growing better than the vector control under stress ( Figure 3 4). This suggests that

PAGE 67

67 PvGRX 5 protein may be involved in protect ing specific target protein(s) different from those that are protected by AtGrxS14 OE. In a previous study, transgenic expression of a cytosolic Arabidopsis glutaredoxin AtGrx S17 which has three CGFS motifs induced thermotolerance in tomato and had induc ed expression of heat shock factors (HSFs) & heat shock proteins (HSPs) (Wu et al ., 2012). On the other hand, the atgrxs17 mutants altered for expression of AtGrx S17 were sensitive to high temperature stress (Cheng et al. , 2011). However under the stress condition used in this study, the transgenic lines OE cytosol targeted AtGrx (having one CC type motif) showed protein oxidation levels comparable to that of the vector control lines under stress ( Figure 3 5) and had no tolerance to heat stress ( Figure 3 3 and 3 4) . This suggests that the subcellular localization or the number and type of motifs in Grx or specific interaction partners may be important in imparting heat tolerance. Rice plants subjected to a temperature of more than 35C were previously shown to reduce the PSII efficiency (Yin et al., 2010). Similarly in our study PSII efficiency was significantly reduced in the control lines up on heat treatment. However, the PvGRX 5 and AtGrx OE lines had significantly less reduction in PSII efficiency under he at stress conditions compared to control lines. These results indicate a positive role for Grx in maintaining the photosynthetic process under heat stress. Our results are consistent with the results by Wu et al. , ( 2012) where AtGrx S17 expression in tomato resulted in less inhibition of PSII efficiency under heat stress. Interestingly, PvGRX 5 OE lines had significantly higher PSII efficiency compared to the AtGrx OE lines upon heat stress ( Figure 3 6). Possible explanation for PvGRX 5 OE lines performing better

PAGE 68

68 photochemically than AtGrx OE lines could be its potential ability to bind proteins involved in the photosynthetic processes which are not the targets of AtGrx . Two catalytic sites in PvGRX 5 make it unique compared to the AtGrx s used in this study and may have an effect on protein binding and folding. In Sundaram & Rathinasabapathi (2010) the results suggested that heat tolerance in PvGRX OE Arabidopsis lines could be due to lower ion leakage and lower protein oxidation. However in that study it was not clear whether there was a causal relationship between lower protein oxidation and improved growth under stress. Data from the current study show that the physiological phenotypes for protein oxidation and PSII could be separable from the heat tolerance p henotype. This indicates that PvGRX 's specificity in improving high temperature stress tolerance could be on aspects of cellular function other than these two parameters. Future comparative studies , for example to find Grx interacting proteins in PvGRX OE and AtGrx OE in rice , should be valuable. The chloroplast is one of the major sources of ROS production in plant cells. So ROS homeostasis and protection of proteins from oxidative damage in chloroplasts is important. Many proteins involved in the C alvin c ycle and starch biosynthesis are reported to be induced during high temperature stress both at the transcript and protein levels (Han et al. , 2009). Heat induced chloroplastic proteins altered in rice include HSP70, RuBisCO activase, chloroplastic glutamine synthetase, chaperone 60 subunit and glyceraldehyde3 phosphate dehydrogenase (Han et al. , 2009). In addition, these proteins have been found to be Grx interacting partners in Arabidopsis (Rouhier et al. , 2005) and cyanobacteria (Li et al. , 2007). Also h eat induces antioxidant enzymes,

PAGE 69

69 ascorbate peroxidase and glutathione reductase activities in rice (Yin et al. , 2010). These enzymes are shown to be the interacting partners of Grxs in Arabidopsis (Rouhier, 2010). Ferredoxin 2Fe2S, ferredoxin NADP reductas e and oxygen evolving complex (OEC) are other chloroplastic proteins that are part of the photosynthetic electron transport chain which interact with Grxs (Rouhier, 2010). A 24 h heat stress at 40C caused thylakoid disorgani zation in rice seedlings (Vani et al., 2001) and a heat stress of 38C in potato led to a complete loss of PSII mediated photosynthetic electron transport (Havaux, 1993, Vani et al. , 2001). It is not known whether Grx proteins overexpressed in our study interact with and protect any of the proteins involved in photochemical reactions but the lines generated in our study will be useful for resolving these questions in the future. Improved stress tolerance phenotypes observed in transgenic rice suggest that thiol oxidoreductase function c ould be ratelimiting in controlling the whole plant tolerance to high temperature stress. Differential responses between PvGRX 5 OE lines and AtGrx OE lines indicate possible specificity in their functions in stress tolerance. In vitro proteinprotein interaction studies by others (Rouhier et al. , 2005; Li et al. , 2007) often suggest large number of potential target proteins of Grxs in plants. PvGRX 5 OE improved heat tolerance in both Arabidopsis and rice, two species with much evolutionary distance. This s ignifies PvGRX 5 likely having common and shared targets across species in Arabidopsis and rice. Currently the potential interacting proteins for PvGRX 5 or the two Arabidopsis Grxs are not known, but resolving those will be most useful to obtain mechanistic details on how Grxs function in high temperature stress tolerance.

PAGE 70

70 The cultivar Nipponbare used in this study is relatively tolerant to high temperature stress among the Japonica varieties (Matsui et al 2001). In this study we attempted to improve the genetic base of thermotolerance in this cultivar using a simple biotechnological strategy. Our results indicate that Grx OE strategy did benefit the plant to tolerate high temperature stress at vegetative stages. Such stress tolerance phenotype is useful for stress protection at the early stages of crop season to sustain growth. To our knowledge, this is the first study to implicate a Grx OE in high temperature stress tolerance in rice and has provided the tools needed to investigate the connections between pr otein protection from oxidative stress and whole plant tolerance to high temperature stress. Future studies are needed to evaluate these lines at reproductive stage growth and for field level tolerance to high temperature stress.

PAGE 71

71 Figure 31 . Construc t map for rice transformation. A ) Vector p C am H u , has a hygromycin resistance marker under a C amv35s promoter as a selectable marker for plant transformation and the gene of interest (GRX) is under the control of maize ubiquitin promoter and NOS terminator. For glutaredoxins PvGRX 5 and atgrxs14 the plastid targeting peptide coding regions were included. B ) Glutaredoxins studied here, with catalytic motifs marked: PVGRX 5 (184 aa), AtGRXS14 (173aa) and AtGRX2 (102aa).

PAGE 72

72 Figure 32 . Gene expression analyses in wild type (WT), vector control (VC) and transgenic rice: PVGRX 5 OE lines (PVG24, PVG18), AtGRX14 OE lines (ATG6, ATG1) and AtGRXS2 OE lines (ATGB 2, ATGB18). A ) Transgene expression by semiquantitative RT PCR. Gel electrophoresis of transcripts amplifie d by RT PCR using primers specific for glutaredoxin ( PVGRX 5 : 541bp, AtGRXS14 : 343bp & AtGRXS2 : 404bp) and rice actin 1 gene ( OsACT1 : 25 0bp). B ) Grx activity by direct assay using DHA as substrate. Total soluble proteins were extracted from 7d old germinate d seedlings, desalted by dialysis for 12 h and assayed.

PAGE 73

73 Figure 33 . High temperature tolerance assay during germination. Surface sterilized seeds of wild type (WT), vector control (VC) and transgenic lines ( PvGRX 5 OE lines: PVG24, PVG18, AtGRXS14 OE line: ATG6, AtGRXS2 OE line: ATGB18) were incubated in petri plates kept under control and heat stress conditions. After four days A) cotyledon and B) radicle length were measured . Values are mean growth SE (n= 10). Means marked with different letters i ndicate significant differences at 5% alpha.

PAGE 74

74 Figure 34 . Heat stress assay at vegetative stage in wild type (WT), vector control (VC) and transgenic lines: PvGRX 5 OE lines (PVG24, PVG18), AtGRXS14 OE line (ATG6) and AtGRXS2 OE line (ATGB18). Fifteen day old container grown plants were heat stressed for 24h at 45 1 C and then recovered for 10 days at room temperature (23 2 C ). A ) Photograph showing the shoot phenotype after recovery from stress, B ) Mean shoot dry weight per plant measured after 10 days of recovery. Values are mean SE (n= 10). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 75

75 Figure 35 . Oxidative damage caused by heat stress. Protein carbonylation in wild type (WT), vector control (VC) and trans genic lines: PvGRX 5 OE lines (PVG24, PVG18), AtGRXS14 OE line (ATG6) and AtGRXS2 OE line (ATGB18). Above ground shoot tissues were sampled immediately after the 24 h heat stress treatment at 45 C . Values are means SE (n=6). Means marked with different le tters indicate significant differences at 5% alpha.

PAGE 76

76 Figure 3 6 . Effect of heat stress on PSII efficiency in transgenic rice lines. The PSII efficiency was measured in wild type (WT), vector control (VC) and transgenic lines: PvGRX 5 OE lines (PVG24, PVG18), AtGRXS14 OE line (ATG6) and AtGRXS2 OE line (ATGB18) immediately after 24 hours of heat treatment using plant efficiency analyzer. Leaves under control or high temperature stress were dark adapted for 20 minutes using the clips and the readings were r ecorded immediately after the stress . Values are means SE (n=3). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 77

77 CHAPTER 4 TESTING THE ROLE OF A GLUTAREDOXIN IN HIGHTEMPERATURE STRESS TOLERANCE BY MAIZE Background Un iformMu P opulation Mu transposons were identified in maize populations du e to the high mutation rates they caused at many loci (Robertson, 1978). These mutations are due to new insertions by the mobile transposons , and the Mu type transposons are character ized by distinctive, terminal inverted repeats (TIR). The Mu transposons have highly conserved 0.2 kbp TIRs which are used in designing universal Mu PCR primers. UniformMu is one of the public transposon resources based on Robertson’s Mutator ( Mu ) (McCart y et al., 2005). The UniformMu population was developed by backcross integration of an active Mu line (with a MuDR transposase) into a color converted (purple) W22 inbred background. The W22 population was screened for diverse phenotypes and mutants were a nalyzed initially by MuTAIL sequencing and more recently by Museq technology ( Latshaw & McCarty, 2004; McCarty et al., 2014; Hunter et al., 2014; McCarty et al. , 2005; Settles et al., 2007; Settles). These lines have little to no somatic transposition act ivity , since stable lines (Mu off lines/bronze kernels) are selected based on a color marker. Mapped UniformMu insertions are available from Maize Genetics Cooperation Stock Cent er . The Maize GDB search engine allows one to identify the insertions in a gen e of interest. Mu insertions are confirmed by genomic PCR using gene specific primers for the gene of interest. At least two gene specific primers are designed compatible with the Mu TIR specific primers. Such insertion mutant lines are useful in functional genomics of maize.

PAGE 78

78 Glutaredoxins Glutaredoxins (Grxs) belong to the group of thioredoxin family proteins and are involved in glutathionedependent oxidationreduction reactions. Grxs are involved in reduction of disulfide bonds and deglutathionylation o f proteins thus protecting the proteins against oxidative stress damage. Work described here will contribute to a broader analysis of role s played by glutaredoxins in high temperature stress tolerance by plants. Using biotechnological tools, in Chapter 3 w e generated transgenic rice lines over expressing a glutaredoxin from either an arsenic hyperaccumulator fern or Arabidopsis thaliana (Fern glutaredoxin PvGRX 5 or Arabidopsis glutaredoxins: AtGrxCp or At5G18600). These transgenic lines were evaluated for high temperature stress tolerance at germination, and during vegetative stages of plant development . The rice lines overexpressing a fern glutaredoxin PvGRX 5 were found to be more heat tolerant at germination and vegetative stages compared to the control li nes (in Chapter 3). We thus hypothesized that a loss of function glutaredoxin mutant in maize ( orthologous to PvGRX 5 ) would alter heat tolerance in this species. To test this we used a Mu insertion mutant ( mu1056968 in UniformMu line UFMu 07136) from the U niform Mu population. Sequence data showed that the Mu transposon was inserted into the Grx GRMZM2G090736 gene at 166bp position downstream of the transcription start site, in a predicted exon region. Protein encoded by this gene has 40% identity with Pv GRX 5 (with 50% query coverage). The PvGRX 5 has two Grx motifs, one is a CRSS and the other is a CGFS motif. The maize ortholog of this gene has three Grx motifs; all three being CGFS motifs ( Figure 4 1). Both PvGRX 5 and GRMZM2G090736 proteins have predicte d chloroplast

PAGE 79

79 transit peptides. The most closely related homolog of the GRMZM2G090736 gene in maize is GRMZM5G820188 (with a 95% amino acid sequence identity) , which also has a predicted chloroplast transit peptide ( Figure 4 1 & Table 4 1). The GRMZM2G0907 36 glutaredoxin gene contains 3 exons, with a transcript length of 2428bp and translation length of 597 amino acid residues. Public databases indicate that at the transcript level, th is gene is highly expressed in germinating seeds, embryo, and to a lesser degree in the pollen and anthers ( http://maizegdb.org/ ) . Orthologs and Homologs of GRMZM2G090736 The ortholog of GRMZM2G090736 in Arabidop sis is AT4G04950, a monothiol glutaredoxinS17previously implicated in hightemper ature stress tolerance of both tomato (Wu et al., 2012) and Arabidopsis (Cheng et al., 2011). The AtGrx S17 expression is induced with increased temperature in Arabidopsis (Cheng et al., 2011). The atgrxs17 knockout and RNAi mutants were hypersensitive to high temperature stress and accumulated higher levels of hydrogen peroxide compared to the wildtype (Cheng et al., 2011). AtGrx S17 was also found to be crucial for temperaturedependent postembryonic growth in Arabidopsis via altered auxin perception and tr ansport (Cheng et al., 2011). Ectopic expression of AtGrx S17 in tomato improved thermotolerance and reduced both photooxidation and oxidative damage to cell membranes (Wu et al., 2012). Lines overexpressing AtGrx S17 showed increase in catalase activity an d reduced H2O2 accumulation (Wu et al., 2012). The AtGrx S17 GFP was localized initially in cytosol , but during heat stress showed migration into the nucleus (Wu et al., 2012). The phylogenetic tree shows seven homologs of GRMZM2G090736 in maize (Table 4 1) .

PAGE 80

80 Material and Methods Genotyping UniformMu L ine for Grx GRMZM2G090736 Seeds for this study were obtained from the ear of a selfed, heterozygous plant ( 13S 24228 ) that carried a Mu insertion (mu1056968 in UniformMu line UFMu07136) in a maize Grx gene, GRMZM2G090736. These progeny were genotyped to identify the homozygous mutant and wildtype seedlings among sibling plants. Seeds were germinated in petri plates and transplanted into containers filled with plant growth medium Farfard 2B mix. Leaf samples were collected for genotyping. DNA was extracted from plant leaves using Mobio DNA isolation kit ( Carlsbad, CA ) . Genomic PCR was done using this DNA as a template . Gene specific primers for GRMZM2G090736 (5’ TCGAGGAAGAGCGCGGAAGC 3’ and 5’ TACCGCGGTCCACCTAGCCT 3’) were used in combination with the Muspecific primer TIR6 (5’ AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC 3’). Evaluation of Wildtype Maize Seedlings for High Temperature Stress Tolerance Surface sterilized seeds were germinated and grown in containers with growth mix (Farfard 2B mix) + slow release fertilizer Osmocote ( N;P;K 14:14:14 4 g/L, w/v ) + Sprint330 Fe fertilizer (0.32 g/L, w/v) . Growth conditions and treatment were as described below. Evaluation of GRX Mutant and Wildtype siblings for High Temperature Stress Tolerance The G RX homozygous mutant seedlings and their wildtype siblings were used for heat stress assays. Surfacesterilized seeds were germinated and grown in containers with growth mix (Farfard 2B mix amended with Sprint330 Fe ferti lizer (0.32 g/L, w/v).

PAGE 81

81 Growth conditions were 23 2 C at RH 42 48% , with 90100 mol/m2 light intensity, and a 16:8 light:dark cycle. Sevenday old seedlings were subjected to heat stress in a growth chamber set at 45C 2 C (air temperature) for 20 h, with 30 35 mol/m2 light intensity , and a 16:8 light : dark cycle . After heat treatment , plants were kept at 23 2 C with a 16:8 light:dark cycle for 7 days of recovery. Plants were analyzed immediately after this 7d recovery period. Results and Discussio ns In this study, a Mu transposon insertion in the G RX gene, GRMZM2G090736 , was identified in the UniformMu population and verified by genomi c PCR ( Figure 4 2 ). Genotyping results showed a classic Mendelian segregation ratio of 1:2:1 for this Mu insertion in the 13S 24228 family ( Figure 4 2). Sequence data show that the Mu insertion does indeed reside in our GRX gene of inte rest . Although additional work is needed for full verification of functional “knockout” status, our previous data have indicated that this is likely where transposons have inserted into exons of the coding sequence (unpublished data). Heat treatment of wildtype seedlings inhibited the shoot growth significantly ( Figure 4 3). Older leaves were more damaged by heat stress than the younger leaves ( Figure 4 3 A ). There was distinct necrosis at the leaf tips in response to heat treatment ( Figure 4 3 A ). Most growth inhibition by heat stress was evident in the second leaf. Heat stress significantly reduced shoot length, stem length, and shoot dr y weight of WT seedlings ( Figure 4 3 B ). Among these, shoot dry weight and stem length were the most sensitive parameters for heat stress ( Figure 4 3 B ).

PAGE 82

82 The homozygous mutant mu1056968 and WT seedlings from this family were evaluated for heat stress responses after a 7 d recovery from 45 C for 20 h. Heat stress inhibited shoot growth and induced leaf tip chlorosis in both mutant and WT siblings . There was no significant difference (at alpha = 0.05) between their responses in terms of shoot length, stem length or leaf length ( Figure 4 4 ). Under the heat stress and recovery regime tested in this study, mutant plants did not show any more stress sensitivity symptoms than did their wildtype siblings. The G RX gene GRMZM2G090736 has 7 homologs in maize, each with >90% protein homology (Table 4 1). The protein is predicted to be chloroplast targeted , as is its closely related homolog , GRMZM5G820188. We can thus expect some amount of functional redundancy and hence mutation in one G RX may not show a significan tly visible/distinct phenotype. To test whether GRMZM2G090736 and GRMZM5G820188 are functionally redundant, and to determine whether they have a collective role in stress tolerance, both will need to be disrupted. This can be done using materials generate d in the course of work presented here, in combination with others to be obtained in longer term studies. One approach will be to identify additional mutants in which expression of the homolog , Grx GRMZM5G820188, is reduced (such a search has been initiat ed as a result of data presented here). Another approach will be to utilize antisense or RNAi technology (an option now feasible for maize) . The genotyped, homozygous mutants identified in this study will be invaluable for developing the doublegene alter ations needed to test roles of this GRX pair in heat stress tolerance of maize .

PAGE 83

83 Table 4 1 . Maize homologs of the GRMZM2G090736 gene . Table showing percent protein identity, subcellular localization , and number of conserved domains. Sub cellular localization was predicted using Target P software (Emanuelsson et al., 2000). Cp = plastid, S=secretory pathway, M=mitochondria, =any other location. Sl. No. Gene ID Length of amino acid residues Sub cellular Localiza tion Conserved domains Catalytic motifs Pr otein identity (%) Query coverage (%) Chromosome #: location 1 GRMZM2 G090736 597 Cp 1 trx like fold, 3 grx CGFS, CGFS, CGFS 100 Query 5:24,456,21724,462,565 reverse strand 2 GRMZM5 G820188 483 Cp 1 trx like fold, 2 grx or 3 grx CGFS, CGFS 95 60 2:196,579 ,544 196,583,775 reverse strand 3 GRMZM2 G105720 134 1 grx CGFS, CGFS 98 58 5:160,464,953160,465,417 4 GRMZM2 G369485 747 1 trx like fold, 2 grx or 3 grx CC, CGFS, CGFS 96 60 8:149,796,661 149,802,067 5 GRMZM2 G076796 313 1 trx like fold, 2 grx or 3 grx CGFS, CGFS 97 57 2:202,245,025 202,246,334 6 GRMZM2 G105706 117 1grx 90 37 5:160,450,385 160,456,486 7 GRMZM2 G039707 122 1 grx CGFS 97 57 2:89,042,162 89,044,113 8 GRMZM2 G131769 499 S 1 trx like fold, 3 grx CGFS, CGFS, CGFS 94 85 1:226,551,729 226,556,786 reverse strand

PAGE 84

84 Figure 4 1 . Sequence comparison of glutaredoxins : PvGRX 5 (fern) , GRMZM2G090736 (maize) and GRMZM5G820188 (maize) using clustal multiple sequence alignment. A ) Diagramatic representation of predicted catalytic sites: CRSS ( shown in green) , and CGFS (shown in yellow), and B ) multiple sequence alignment.

PAGE 85

85 Figure 4 2 . Genotypi c analysis of a maize family ( 13S 24228 ) segregating for a glutaredoxin mutation ( Mu insertion mu1056968 in UniformMu line UFMu 07136) . Leaf sample s were used for DNA extraction and PCR analysis using glutaredoxinspecific primers (F1 and R1) , and TIR specific primers (T6 primers amplify DNA adjacent to Mu transposons by priming off of their t erminal i nverted r epeats [TIRs] ). The family shown , segreg at ed for a Mu insertion in the glutaredoxin of interest ( mu1056968) . Seedlings 4, 6, 8, 9, 11, 21, 27 were Wildtype; 1, 2, 5, 10, 12, 14, 15, 16, 17, 19, 23, 24, 25, 26, were heterozygous and 3, 7, 13, 18, 20, 22, 28 were homozygous.

PAGE 86

86 Figure 4 3 . Effe ct of a high temperature stress on growth and visible features of W22 wildtype maize seedlings . A ) morphology and visible features of leaves and stems. B ) percent change in selected, morphological parameters . Sevenday old seedlings were heat stressed for 20 h at 45 C and then allowed to recover at 23 2 C for 7 days [B) , inset, C control and H heat stress ] . Data shown are from immediately after the 7 d recovery period. Values are expressed as percent of control SE (n=12).

PAGE 87

87 Figure 4 4 . Effect of hi gh temperature stress on WT and homozygous glutaredoxin mutant ( Mu insertion mu1056968 in UniformMu line UFMu 07136) siblings from the same family ( 13S 24228 ) . Sevenday old seedlings were heat stressed for 20 h at 45 C and then allowed to recover at 23 2 C for 7 days. Data shown were from immediately after the 7d recovery period. A ) visible phenotypic features of s hoot s, and B ) selected morphological parameters. Values are means SE (n=7). Pair wise mean comparisons were done using Student’s t test at 5% alpha .

PAGE 88

88 CHAPTER 5 SUMMARY, CONCLUSIONS, AND RECOMMENDATIONS Biotic and abiotic stress conditions produce reactive oxygen species (ROS) in plants , causing oxidative stress damage as well as initiating ROS based signals . Oxidative stress is the major component of abiotic stress es caused by such as high temperature, freezing, drought, salinity , and heavy metal s. Redox homeostasis is maintained by balancing mechanisms of ROS production and removal. Major players in regulating redox homeostasis in cells are ROS scavengers and molecular chaperones. The functiona l role of these in ROS balance and mechanisms involved in tolerance to oxidative damage are not well understood. Research presented here indicates that plant growth regulators and antioxidants have a role in regulating the level of ROS in plants under stress. Plants have evolved a range of adaptation mechanisms to tolerate oxidative stress. In this study we used genetic, biochemical , and functional genomic tools to test contributions by these adaptive mechanisms. The main purpose of this study was to determine whether similar mechanisms of oxidative stress tolerance extended from arsenite stress to high temperature stress. Reverse genetic approaches were used in three different plant species, Arabidops is thaliana , Oryza sativa (rice) and Zea mays (maize). Using genetic and biochemical investigations, in chapter 2 we demonstrate a novel role of auxin transport in plant tolerance to oxidative stress. Plant response to arsenite [As(III)] was evaluated by r oot growth assay and biochemical markers for oxidative stress in seedlings treated with control or As(III) containing medi a . The auxin transport mutant , aux1 , was more sensitive to arsenite stress than wildtype Arabidopsis seedlings . Because w ild type , bu t not mutant plants recorded increased H2O2 with

PAGE 89

89 arsenite stress treatment , a positive role of auxin transport was surmised for production of ROS (with an apparently positive signaling role in this instance) . Increase in H2O2 was also correlated with reduc ed transcription of the catalase3 gene in the wildtype seedlings . This can be attributed to the reduced auxin transport and accumulation in the roots of aux1 mutant and its inability to induce H2O2 signaling. These results suggest that auxin transport via AUX1 has a positive control on ROS mediated signaling and subsequently plant tolerance to As(III) stress. In addition to its As(III) sensitivity, this aux1 mutant was also significantly more stressed by high temperature and salinity . Collective results indicate that auxin transport influences a common element shared by mechanisms of plant tolerance to arsenite, salinity , and high temperature stress. The r ole of auxin transport in tolerance to multiple stress es has implications in developing new avenues to improve crop tolerance for stress. Further studies will undoubtedly reveal components in the link between auxin and ROS homeostasis. The studies presented here also open new possibilities for altering crop tolerance to stress by engineering auxin synthesi s and metabolism, auxin signaling, ROS signaling , and/or thiol mediated regulatory pathways. Key genes can also be followed in genomeassisted breeding efforts. New uses for exogenous auxin to optimize crop performance under stress could also be explored. S ubsequently as described in chapter 3, we used transgenic overexpression to study the role of glutaredoxins (Grx) in h igh temperature stress tolerance. Grxs reduce disulfide bridges and glutathione adducts in proteins and protect cellular proteins from damage by ROS . Using biotechnological tools we generated Grx OE lines in rice. W e overexpressed (OE) Grx cDNA from fern Pteris vittata ( PvGRX 5 ) or Arabidopsis

PAGE 90

90 ( AtGrxCp or At5G18600) in rice using agrobacterium mediated transformation. Transgenic lines were e valuated for high temperature stress tolerance during vegetative stages of their growth . The PvGRX 5 OE lines showed little to no inhibition of shoot growth, less protein carbonylation, and higher PSII efficiency compared to wildtype or Arabidopsis Grx OE lines under heat stress . Together these results implicate a positive role for specific Grxs in high temperature stress tolerance. Currently the potential interacting proteins for PvGRX 5 or the two Arabidopsis Grxs are not known. Future work can now be directed towards identification of the specific proteins interacting with these glutaredoxins. High temperature is one of the key concerns for low productivity in cereals. Here we express ed a h eterologous glutaredoxin from fern in rice, and demonstrated that t his increased the t hermotolerance of an already heat tolerant Japonica variety of rice. Such genetic material will be useful in plant breeding programs to improve heat stress tolerance. To our knowledge, this is the first study to implicate a G RX OE in hig h temperature stress tolerance in rice. We further extended this work to Zea mays , where genetic and molecular tools developed during the present work can be used to continue investigations into the potentially critical role of specific glutaredoxins in s tress tolerance.

PAGE 91

91 APPENDIX A SUPPLEMENTARY FIGURES CHAPTER 2 Figure A 1 . Effect of As(III) on root cell length. Three day old seedlings were transferred to plates containing arsenite (0 or 12 m ) and after 4 days, seedlings were stained with toluidine blue and observed under a microscope. Cell length was measured in the root elongation zone. Values indicate means SE (n=30). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 92

92 Figure A 2 . A s(III) concentration in plant tissues 24 h after treatment in WT and aux1, As(III) concentration is shown in fresh weight basis. Three day old seedlings were transferred to plates containing arsenite (12 m ) and after 30 h ti ssue samples were collected and analyzed for total arsenic using atomic absorption spectrophotometer. Values indicate means SE (n=3) for three replicates. Ten seedlings/replicate were pooled for analysis. Means marked with different letters indicate significant differences at 5% alpha.

PAGE 93

93 APPENDIX B SUPPLEMENTARY FIGURES CHAPTER 3 Figure B 1 . Heat stress assay at vegetative stage in wild type (WT), vector control (VC) and transgenic lines : PvGRX 5 OE lines (PVG24, PVG18, PVG18 2, PVG23, PVG19 and PVG B24 ) . Twenty day old container grown plants were heat stressed for 24h at 45c . Mean shoot dry weight per plant was measured after 10 days of recovery. Values are mean SE (n= 10). Means marked with different letters indicate significant differences at 5% alpha.

PAGE 94

94 Table B 1 . List of primers used in gene expression analysis No. Grx Primers Sequence 5’ to 3’ Product length (bp) 1 PvGRX5 FP ACCCAGCACCGTCCGAGTTG 541 RP ACCATCAAACACACGCCTTGAA 2 AtGrxS14 FP CCACCGAAAAACTCACCGCCGAT 343 RP CGTCGGCA CTCGTCGTCCAT 3 AtGrxS2 FP GATAACGAAGATGGTGATGGAGAG 404 RP CCGACGTGGACTCATCATATCAC 4 OsAct1 FP TCCTCCGTGGAGAAGAGCTA 250 RP GCAATGCCAGGGAACATAGT

PAGE 95

95 LIST OF REFERENCES Abel S., Oeller P.W. & Theologis A. (1994) Early auxininduced genes encode short lived nuclear proteins. Proceedings of the National Academy of Sciences 91 , 326330. Abercrombie J., Halfhill M., Ranjan P., Rao M., Saxton A., Yuan J. & Stewart C.N. (2008) Transcriptional responses of Arabidopsis thaliana plants to As (V) str ess. BMC Plant Biology 8 , 87. Ambardekar A.A., Siebenmorgen T.J., Counce P.A., Lanning S.B. & Mauromoustakos A. (2011) Impact of fieldscale nighttime air temperatures during kernel development on rice milling quality. Field Crops Research 122 , 179 185. Ba ndyopadhyay S., Gama F., MolinaNavarro M.M., Gualberto J.M., Claxton R., Naik S.G., Huynh B.H., Herrero E., Jacquot J.P., Johnson M.K. & Rouhier N. (2008) Chloroplast monothiol glutaredoxins as scaffold proteins for the assembly and delivery of [2Fe2S] c lusters. The EMBO Journal , 27 , 11221133. Barbez E., Kubes M., Rolcik J., Beziat C., Pencik A., Wang B., Rosquete M.R., Zhu J., Dobrev P.I., Lee Y., Zazimalova E., Petrasek J., Geisler M., Friml J. & Kleine Vehn J. (2012) A novel putative auxin carrier fam ily regulates intracellular auxin homeostasis in plants. Nature 485 , 119 124. Bashandy T., Guilleminot J., Vernoux T., Caparros Ruiz D., Ljung K., Meyer Y. & Reichheld J. (2010) Interplay between the NADH linked thioredoxin and glutathione systems in Arabi dopsis auxin signaling. The Plant Cell 22 , 376 391. Bedhomme M ., Adamo M ., Marchand, C . H. , Couturier J ., Rouhier N., Lemaire S ., Zaffagnini M. & Trost, P. (2012) Glutathionylation of cytosolic glyceraldehyde3 phosphate dehydrogenase from the model plant A rabidopsis thaliana is reversed by both glutaredoxins and thioredoxins in vitro . Biochemical Journal 445 , 337– 347. Benkova E., Michniewicz M., Sauer M., Teichmann T., Seifertova D., Jurgens G. & Friml J. (2003) Local, efflux dependent auxin gradients as a common module for plant organ formation. Cell 115 , 591602. Bennett M.J., Marchant A., Green H.G., May S.T., Ward S.P., Millner P.A., Walker A.R., Schulz B. & Feldmann K.A. (1996) Arabidopsis AUX1 gene: A permeaselike regulator of root gravitropism. Scie nce 273 , 948 950. Bethke P.C. & Jones R.L. (2001) Cell death of barley aleurone protoplasts is mediated by reactive oxygen species. The Plant Journal 25, 19 29.

PAGE 96

96 Bick J. A., As lund F., Chen Y. & Leustek T. (1998) Glutaredoxin function for the carboxyl termi nal domain of the plant type 5’ adenylylsulfate reductase. Proceedings of the National Academy of Sciences 95 , 84048409. Blakeslee J.J., Peer W.A. & Murphy A.S. (2005) Auxin transport. Current Opinion in Plant Biology 8 , 494500. Blilou I., Xu J., Wildwa ter M., Willemsen V., Paponov I., Friml J., Heidstra R., Aida M., Palme K. & Scheres B. (2005) The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433 , 39 44. Blomster T., Salojarvi J., Sipari N., Brosche M. , Ahlofors R., Keinanen M., Overmyer K., & Kangasjarvi J (2011) Apoplastic reactive oxygen species transiently decrease auxin signaling and cause stress induced morphogenic response in Arabidopsis . Plant Physiology 157 , 18661883. Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Analytical Biochemistry 72, 248 254. Casimiro I., Marchant A., Bhalerao R.P., Beeckman T., Dhooge S., Swarup R., Graham N., In ze D., Sandberg G., Casero P.J. & Bennett M. (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 13, 843852. Celenza J.L., Grisafi P.L. & Fink G.R. (1995) A pathway for lateral root formation in Arabidopsis thaliana . Genes & Development 9 , 2131 2142. Chandler J.W. (2009) Local auxin production: a small contribution to a big field. BioEssays 31, 60 70. Cheng N. H. (2008) AtGRX 4, an Arabidopsis chloroplastic monothiol glutaredoxin, is able to suppress yeast grx5 mutant phenotypes and respond to oxidative stress. FEBS Letters 582 , 848854. Cheng N. H., Liu J. Z., Brock A., Nelson R.S. & Hirschi K.D. (2006) AtGRXcp , an Arabidopsis chloroplastic glutaredoxin, i s critical for p rotec tion against p rotein oxidative damage. Journal of Biol ogical Chemistry 281, 2628026288. Cheng N. H., Liu J. Z., Liu X., Wu Q., Thompson S.M., Lin J., Chang J., Whitham S.A., Park S., Cohen J.D. & Hirschi K.D. (2011) Arabidopsis monothiol g lutaredoxin, AtGRX S17, is critical for temperaturedependent postembry onic growth and development via modulating auxin r esponse. Journal of Biological Chemistry 286, 2039820406. Counce P.A., Keisling T.C. & Mitchell A.J. (2000) A uniform, objective, and adaptive system for expressing rice development. Crop Sci ence 40 , 4364 43.

PAGE 97

97 Couturier J., Jacquot J. P. & Rouhier N. (2009) Evolution and diversity of glutaredoxins in photosynthetic organisms. Cellular and Molecular Life Sciences 66 , 25392557. Couturier J., Wu H. C., Dhalleine T., Pegeot H., Sudre D., Gualberto J.M., Jacquot J. P., Gaymard F., Vignols F. & Rouhier N. (2014) Monothiol GlutaredoxinBolA Interactions: Redox Control of Arabidopsis thaliana BolA2 and SufE1. Molecular Plant 7 , 187 205. Dembitsky V.M. & Rezanka T. (2003) Natural occurrence of arseno compounds in pla nts, lichens, fungi, algal species, and microorganisms. Plant Science 165 , 11771192. Dharmasiri N., Dharmasiri S. & Estelle M. (2005) The F box protein TIR1 is an auxin receptor. Nature 435 , 441445. Duman F., Ozturk F. & Aydin Z. (2010) Biological responses of duckweed ( Lemna minor L.) exposed to the inorganic arsenic species As(III) and As(V): effects of concentration and duration of exposure. Ecotoxicology 19 , 983 993. Emanuelsson O., Nielsen H., Brunak S.r. & von Heijne G. (2000) Predicting Subcellular Localization of Proteins Based on their N terminal Amino Acid Sequence. Journal of Molecular Biology 300 , 10051016. Gaber A . El Awady M., Elarabi N.I. & Soliman M.H. (2007) Overexpression of glutaredoxin2 from Cyanobacterium Synechocystis PCC 6803 in Es cherichia coli co nferring enhanced salt stress tolerance. Arabian Journal of Biotechnology 10(1), 13 22. Garg R., Jhanwar S., Tyagi A.K. & Jain M. (2010) Genome Wide Survey and Expression analysis s uggest diverse roles of g lutaredoxin g ene family members d uring development and response to various stimuli in r ice. DNA Research 17 , 353367. Gelhaye E., Rouhier N. & Jacquot J. P. (2003) Evidence for a subgroup of thioredoxin h that requires GSH/Grx for its reduction. FEBS Letters , 555 , 443 448. Giles N.M., Watts A.B., Giles G.I., Fry F.H, Littlechild J.A. , & Jacob C . ( 2003) Metal and redox modulation of cysteine protein function. Chemistry & Biology 10 , 677 693. Gong M., Chen S.N., Song Y.Q. & Li Z.G. (1997) Effect of calcium and calmodulin on intrinsic heat tolerance in relation to antioxidant systems in maize seedlings. Australian Journal of Plant Physiology 24 , 371 379. Gramene database for maize. http://ensembl.gramene.org/Zea_mays

PAGE 98

98 Gray W.M., Kepinski S., Rou se D., Leyser O. & Estelle M. (2001) Auxin regulates SCF TIR1 dependent degradation of AUX/IAA proteins. Nature 414 , 271 276. Guo Y.S., Huang C.J., Xie Y., Song F.M. & Zhou X.P. (2010) A tomato glutaredoxin gene SlGRX1 regulates plant responses to oxidativ e, drought and salt stresses. Planta 232 , 14991509. Han F., Chen H., Li X. J., Yang M. F., Liu G.S. & Shen S. H. (2009) A comparative proteomic analysis of rice seedlings under various hightemperature stresses. Biochimica et Biophysica Acta (BBA) Prote ins and Proteomics 1794, 16251634. Hartley Whitaker J., Ainsworth G. & Meharg A.A. (2001) Copper and arsenateinduced oxidative stress in Holcus lanatus L. clones with differential sensitivity. Plant, Cell & Environment 24, 713722. Havaux M. (1993) Char acterization of thermal damage to the photosynthetic electron transport system in potato leaves. Plant Science 94 , 19 33. Hernandez M., Fernandez Garcia N., Diaz Vivancos P. & Olmos E. (2010) A different role for hydrogen peroxide and the antioxidative sys tem under short and long salt stress in Brassica oleracea roots. Journal of Experimental Botany 61 , 521 535. Hoagland D.R. & Arnon D.L. (1950) The water culture method for growing plants without soil. California Agricultural Experimental Station Circular 3 47 , 1 32. Hodges M.D., DeLong J. M., Forney C.F. & Prange R.K. (1999) Improving the thiobarbituric acidreactive substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207, 604 61 1. Holmgren A. ( 1989 ) Thioredoxin and Glutaredoxin Systems. Journal of Biological Chemistry 264, 13963 13966. Hunter C.T. Suzuki M., Saunders J., Wu S., Tasi A., McCarty D.R. & Koch K.E. (2014) Phenotype to genotype using forwardgenetic Museq for identif ication and functional classification of maize mutants. Frontiers in Plant Science 4 : 545. Iglesias M., Terrile M., Bartoli C., D'Ippolito S. & Casalongue C. (2010) Auxin signaling participates in the adaptative response against oxidative stress and salini ty by interacting with redox metabolism in Arabidopsis . Plant Molecular Biology 74 , 215222. Ivanchenko M.G., Muday G.K. & Dubrovsky J.G. (2008) Ethyleneauxin interactions regulate lateral root initiation and emergence in Arabidopsis thaliana. Plant Journal 55, 335 347.

PAGE 99

99 Jagadish S.V.K., Craufurd P.Q., & Wheeler T.R. ( 2007) High temperature stress and spikelet fertility in rice (Oryza sativa L.). Journal of Experimental Botany 58 , 16271635. Jing Y.K., Dai J., Chalmers Redman RME., Tatton W.G. & Waxman S. ( 1999) Arsenic trioxide selectively induces acute promyelocytic leukemia cell apoptosis via a hydrogen peroxidedependent pathway. Blood 94 , 21022111. Kepinski S. & Leyser O. (2005) The Arabidopsis F box protein TIR1 is an auxin receptor. Nature 435 , 4464 51. Kerr I.D. & Bennett M.J. (2007) New insight into the biochemical mechanisms regulating auxin transport in plants. Biochemical Journal 401 , 613 622. Kim J., Harter K. & Theologis A. (1997) ProteinProtein Interactions among the Aux/IAA Proteins. Proceedings of the National Academy of Sciences 94, 1178611791. Kozuka T., Kobayashi J., Horiguchi G., Demura T., Sakakibara H., Tsukaya H. & Nagatani A. (2010) Involvement of auxin and brassinosteroid in the regulation of petiole elongation under the shade. Pla nt Physiology 153 , 16081618. Laborte A., Nelson A., Jagadish K., Aunario J., Sparks A., Ye C. & Redoa E. (2012) Rice feels the heat. Rice today 11, 30 31. La Camera S., L'Haridon F., Astier J., Zander M., AbouMansour E., Page G., Thurow C., Wendehenne D ., Gatz C., Metraux J.P. & Lamotte O. (2011) The glutaredoxin ATGRX S13 is required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. The Plant Journal , 68, 507 519. Lanning S.B., Siebenmorgen T.J., Counce P.A., Ambardekar A.A. & Mauromoustakos A. (2011) Extreme nighttime air temperatures in 2010 impact rice chalkiness and milling quality. Field Crops Research 124 , 132 136. Laporte D., Olate E., Salinas P., Salazar M., Jordana X. & Holuigue L. (2012) Glutaredoxin GRXS13 plays a key role in protection against photooxidative stress in Arabidopsis. Journal of Experimental Botany 63, 503 515. Larkindale J. & Knight M.R. (2002) Protection against heat stress induced oxidative damage in Arabidopsis involves calcium, abscisic acid, ethylene, and salicylic acid. Plant Physiology 128, 682 695. Lehotai N., Kolbert Z., Peto A., Feigl G., Ordog A., Kumar D., Tari I. & Erdei L. (2012) Seleniteinduced hormonal and signaling mechanisms during root growth of Arabidopsis thaliana L. Journal of Experimental Botany 63, 56775687.

PAGE 100

100 Leterrier M., Airaki M., Palma J.M., Chaki M., Barroso J.B. & Corpas F.J. (2012) Arsenic triggers the nitric oxide (NO) and S nitrosoglutathione (GSNO) metabolism in Arabidopsis . Environmental Pollution 166 , 136 143. Levine A., T enhaken R., Dixon R. & Lamb C. (1994) H2o2 from the oxidative burst orchestrates the plant hypersensitive disease resistance r esponse. Cell 79, 583593. Levine R.L., Mosoni L., Berlett B.S. & Stadtman E.R. (1996) Methionine residues as endogenous antioxidants in proteins. Proceedings of the National Academy of Sciences of the United States of America 93, 1503615040. Lewis D.R. & Muday G.K. (2009) Measurement of auxin transport in Arabidopsis thaliana. Nature Protocols 4 , 437451. Li M., Yang Q., Zhang L., Li H., Cui Y., & Wu Q. ( 2007) Identification of novel targets of cyanobacterial glutaredoxin. Archives of Biochemistry and Biophysics 458 , 220 228. Li S., Gutsche N. & Zachgo S. (2011) The ROXY1 C Terminal L**LL Motif Is Essential for the Interaction with TGA Transcription Factors. Plant Physiology , 157, 20562068. Liu Q.H., Wu X., Ma J.Q., Li T., Zhou X.B.A. & Guo T. (2013) Effects of high air t emperature on rice grain quality and yield under field c ondition. Agronomy Journal 105 , 446 454. Lu D., Bai X.C. , Gui L., Su Y.C., Deng F., Liu B., Li X.M., Zeng W.S., Cheng B.L. & Luo S.Q. (2004) Hydrogen peroxide in the Burkitt's lymphoma cell line Raji provides protection against arsenic trioxideinduced apoptosis via the phosphoinositide3 kinase signalling path way. British Journal of Haematology 125 , 512 520. Lu S.M., Song J. & Campbell Palmer L. (2009) A modified chemiluminescence method for hydrogen peroxide determination in apple fruit tissues. Scientia Horticulturae 120, 336 341. Ma L.Q., Komar K.M., C. Tu, Zhang W.H., Cai Y., & Kennelley. E.D . ( 2001) A fern that hyperaccumulates arsenic A hardy, versatile, fast growing plant helps to remove arsenic from contaminated soils. Nature 409 , 579579. Maize genetics and genomics database. http://maizegdb.org/ Marchant A., Bhalerao R., Casimiro I., Eklof J., Casero P.J., Bennett M. & Sandberg G. (2002) AUX1 promotes lateral root formation by facilitating indole3 acetic acid distribution between sink and source tissues in the Arabi dopsis seedling. The Plant Cell 14, 589 597.

PAGE 101

101 Matsui T. , Omasa K. , & Horie T . (2001) The differences in sterility due to high temperature during the flowering period among Japonica rice v arieties. Plant Prod uction Sci ence 4 , 90 93. McCarty D.R., Latshaw S., Wu S., Suzuki M., Hunter C.T., Avigne W.T. & Koch K.E. (2013) Museq: SequenceBased Mapping and Identification of Transposon Induced Mutations. PLoS ONE , 8 , e77172. McCarty D.R., Mark Settles A., Suzuki M., Tan B.C., Latshaw S., Porch T., Robin K., Baie r J., Avigne W., Lai J., Messing J., Koch K.E. & Curtis Hannah L. (2005) Steady state transposon mutagenesis in inbred maize. The Plant Journal 44 , 52 61. Meyer Y., Buchanan B.B., Vignols F. & Reichheld J. P. (2009) Thioredoxins and glutaredoxins: unifying e lements i n r edox b iology. Annual Rev iew of Genet ics 43 , 335367. Michelet L., Roach T., Fischer B.B., Bedhomme M., Lemaire S.D. & Krieger Liszkay A. (2013) Downregulation of catalase activity allows transient accumulation of a hydrogen peroxide signal i n Chlamydomonas reinhardtii . Plant, Cell & Environment . doi: 10.1111/pce.12053. Mockaitis K. & Estelle M. (2008) Auxin receptors and plant development: A New signaling paradigm. Annual Review of Cell and Developmental Biology 24 , 55 80. Muller K., Linkies A., Leubner Metzger G. & Kermode A.R. (2012) Role of a respiratory burst oxidase of Lepidium sativum (cress) seedlings in root development and auxin signalling. Journal of Experimental Botany 63 , 63256334. Murphy A.S., Hoogner K.R., Peer W.A. & Taiz L. (2002) Identification, purification, and molecular cloning of N 1 naphthylphthalmic acidbinding plasma membraneassociated aminopeptidases from Arabidopsis . Plant Physiology 128 , 935 950. Mylona P.V., Polidoros, A.N. & Scandalios, J.G. (1998) Modulation of antioxidant responses by arsenic in maize. Free Radical Biology & Medicine 25, 576 585. Ndamukong I., Abdallat A. A., Thurow C., Fode B., Zander M., Weigel R. & Gatz C. (2007) SA inducible Arabidopsis glutaredoxin interacts with TGA factors and suppresses JA responsive PDF1.2 transcription. The Plant Journal , 50, 128139. Negi S., Sukumar P., Liu X., Cohen J.D. & Muday G.K. (2010) Genetic dissection of the role of ethylene in regulating auxindependent lateral and adventitious root formation in tomato. Pl ant Journal 61, 3 15. Noh B., Murphy A.S. & Spalding E.P. (2001) Multidrug Resistance like genes of Arabidopsis required for auxin transport and auxinmediated development. The Plant Cell Online 13, 24412454.

PAGE 102

102 Oremland R.S. & Stolz J.F. (2003) The ecology of arsenic. Science 300, 939 944. Panda S.K. & Upadhyay R.K. (2004) Salt stress injury induces oxidative alterations and antioxidative defence in the roots of Lemna minor . Biologia Plantarum 48, 249 253. Park J., Kim Y S., Kim S G., Jung J H., Woo J C.W. & Park C M. (2011) Integration of auxin and salt signals by a NAC transcription factor NTM2 during seed germination in Arabidopsis . Plant Physiology 156, 537 549. Peer W.A., Blakeslee J.J., Yang H., & Murphy A.S. (2011) Seven things we think we know about auxin tr ansport. Molecular Plant 4 , 48 7 504. Peng S.B., Huang J.L . , Sheehy J.E., Laza R.C., Visperas R.M, Zhong X.H, Centeno G.S., Khush G.S., & Cassman K.G. ( 2004) Rice yields decline with higher night temperature from global warming. Proceedings of the National Academy of Sciences 101 , 9971 9975. Perez F. & Rubio S. (2006) An improved chemiluminescence method for hydrogen peroxide determination in plant tissues. Plant Growth Regulation 48 , 89 95. Petrasek J., Mravec J., Bouchard R., Blakeslee J.J., Abas M., Seifertova D., Wisiniewska J., Tadele Z., Kubes M., Covanov M., Dhonukshe P., Skupa P., Benkova E., Perry L., Krecek P., Lee O.R., Fink G.R., Geisler M., Murphy A.S., Luschnig C., Zazimalova E. & Friml J. (2006) PIN p roteins perform a ratelimiting fu nction in cellular auxin efflux. Science 312 , 914918. Pickett F.B., Wilson A.K. & Estelle M. (1990) The aux1 mutation of Arabidopsis confers both auxin and ethylene resistance. Plant Physiology 94 , 1462 1466. Popko J., Haensch R., Mendel R R., Polle A. & Teichmann T. (2010) The role of abscisic acid and auxin in the response of poplar to abiotic stress. Plant Biology 12, 242258. Qin X.J., Hudson L.G., Liu W.L., Ding W., Cooper K.L. & Liu KH. (2008) Dual actions involved in arseniteinduced oxidative DNA damage. Chemical Research in Toxicology 21, 18061813. Rao K.P, Vani G., Kumar K., Wankhede D.P., Misra M., Gupta M. & Sinha A.K. (2011) Arsenic stress activates MAP kinase in rice roots and leaves. Archives of Biochemistry and Biophysics 506 , 73 82. Reinhardt D., Pesce E R., Stieger P., Mandel T., Baltensperger K., Bennett M., Traas J., Friml J. & Kuhlemeier C. (2003) Regulation of phyllotaxis by polar auxin transport. Nature 426 , 255260.

PAGE 103

103 Reznick AZ, Packer L (1994) Oxidative damage to proteins: spectrophotometric method for carbonyl assay. Methods Enzymology 233 , 357 – 363. Robertson D.S. (1978) Characterization of a mutator system in maize. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 51, 21 28. Rodriguez Manzaneque M.T., Ros J., Ca biscol E., Sorribas A. & Herrero E. (1999) Grx5 glutaredoxin plays a central role in protection against protein oxidative damage in Saccharomyces cerevisiae. Molecular and Cellular Biology 19, 81808190. Roman G., Lubarsky B., Kieber J.J., Rothenberg M. & Ecker J.R. (1995) Genetic analysis of ethylene signal transduction in Arabidopsis thaliana5 novel mutant loci integrated into a stress response pathway. Genetics 139 , 13931409. Rouhier N. (2010) Plant glutaredoxins: pivotal players in redox biology and iron sulphur centre assembly. New Phytologist 186 , 365 372. Rouhier N., Couturier J.r.m. & Jacquot J. P. (2006) Genomewide analysis of plant glutaredoxin systems. Journal of Experimental Botany 57, 16851696. Rouhier N., Lemaire S.D. & Jacquot J.P. (2008) The role of glutathione in photosynthetic organisms: Emerging functions for glutaredoxins and glutathionylation. Annual Review of Plant Biology 59 , 143166. Rouhier N., Villarejo A., Srivastava M., Gelhaye E., Keech O., Droux M., Finkemeier I., Samuelsson G., Dietz K.J., Jacquot J.P. & Wingsle G. (2005) Identification of plant glutaredoxin targets. Antioxidants & Redox Signaling 7 , 919 929. Ruzicka K., Ljung K., Vanneste S., Podhorska R., Beeckman T., Friml J. & Benkova E. (2007) Ethylene regulates root gr owth through effects on auxin biosynthesis and transport dependent auxin distribution. Plant Cell 19, 21972212. Santos C .V. ., Laugier E., Tarrago L., Massot V., Issakidis Bourguet E., Rouhier N. & Rey P. (2007) Specificity of thioredoxins and glutaredoxins as electron donors to two distinct classes of Arabidopsis plastidial methionine sulfoxide reductases B. FEBS Letters 581 , 4371 4376. Settles A.M., Holding D., Tan B., Latshaw S., Liu J., Suzuki M., Li L., O'Brien B., Fajardo D., Wroclawska E., Tseung C. W., Lai J., Hunter C., Avigne W., Baier J., Messing J., Hannah L.C., Koch K., Becraft P., Larkins B. & McCarty D. (2007) Sequenceindexed mutations in maize using the UniformMu transposontagging population. BMC Genomics 8 , 116. Settles A.M., Latshaw S. & McCarty D.R. (2004) Molecular analysis of highcopy insertion sites in maize. Nucleic Acids Research 32 , 54.

PAGE 104

104 Shi H., Shi X. & Liu K.J. (2004) Oxidative mechanism of arsenic toxicity and carcinogenesis. Molecular and Cellular Biochemistry 255, 67 78. Shri M., Kumar S., Chakrabarty D., Trivedi P.K., Mallick S., Misra P., Shukla D., Mishra S., Srivastava S., Tripathi RD. & Tuli R. (2009) Effect of arsenic on growth, oxidative stress, and antioxidant system in rice seedlings. Ecotoxicology and Environmental Saf ety 72, 11021110. Singh H., Batish D., Kohli R. & Arora K. (2007) Arsenic induced root growth inhibition in mung bean ( Phaseolus aureus. ) is due to oxidative stress resulting from enhanced lipid peroxidation. Plant Growth Regulation 53 , 65 73. Stahl R.L., Liebes L.F., Farber C.M. & Silber R. (1983) A spectrophotometric assay for dehydroascorbate reductase. Analytical Biochemistry 131, 341 344. Strader L.C., Chen G.L. & Bartel B. (2010) Ethylene directs auxin to control root cell expansion. The Plant Journal 64, 874 884. Sun J., Liu M., Wang M., Ding M., Deng S., Lu C., Zhou X., Shen X. & Chen S. (2010a) Hydrogen peroxide and nitric oxide mediate K+/Na+ homeostasis and antioxidant defense in NaCl stressed callus cells of two contrasting poplars. Plant Cell, Tissue and Organ Culture 103 , 205215. Sun P., Tian Q Y., Chen J., Zhang W H. (2010b) Aluminum induced inhibition of root elongation in Arabidopsis is mediated by ethylene and auxin. Journal of Experimental Botany 61 , 347 356. Sundaram S. & B. Rathinasabap athi. ( 2010) Transgenic expression of fern Pteris vittata glutaredoxin PvGRX 5 in Arabidopsis thaliana increases plant tolerance to high temperature stress and reduces oxidative damage to proteins. Planta 231 , 361 369. Sundaram, S, Wu, S, Ma L.Q & Rathinasa bapathi B. 2009. Expression of a Pteris vittata glutaredoxin PvGRX 5 in transgenic Arabidopsis thaliana increases plant arsenic tolerance and decreases arsenic accumulation in the leaves. Plant Cell & Environment 32, 851858. Sundaram S., B. Rathinasabapathi, L.Q. Ma, and B.P. Rosen. ( 2008 ) An arsenateactivated glutaredoxin from the arsenic hyperaccumulator fern Pteris vittata L. regulates intracellular arsenite. Journal of Biological Chemistry 283, 60956101. Swarup R., Friml J., Marchant A., Ljung K., S andberg G., Palme K. & Bennett M. (2001) Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes & Development 15 , 2648 2653.

PAGE 105

105 Tarrago L., Laugier E., Zaffagnini M., M archand C., Le Mar echal P., Rouhier N., Lemaire S .D. & Rey P. (2009 ) Regeneration Mechanisms of Arabidopsis thaliana Methionine Sulfoxide Reductases B by Glutaredoxins and Thioredoxins . Journal of Biological Chemistry 284, 18963 18971 . Teale W.D., Paponov I.A., Ditengou F. & Palme K. (2005) Auxin and the developing root of Arabidopsis thaliana . Physiologia Plantarum 123, 130 138. Tian Q. & Reed J.W. (1999) Control of auxinregulated root development by the Arabidopsis thaliana SHY2/IAA3 gene. Development 126 , 711721. Tian X, Luo H, Zhou H, Wu C. ( 2009) Research on heat stress of rice in China: progress and prospect. Chin ese Agric ultural Sci ences Bulletin 25, 166 168. Till B.J., Reynolds S.H., Greene E.A., Codomo C.A., Enns L.C., Johnson J.E., Burtner C., Odden A.R., Young K., Taylor N.E., Henikoff J.G., Comai L. & Henikoff S. (2003) Largescale discovery of induced point mutations with highthroughput TILLING. Genome Research 13 , 524530. Tsai Y.C., Hong C.Y., Liu L.F. & Kao C.H. (2004) Relative importanc e of Na+ and Clin NaClinduced antioxidant systems in roots of rice seedlings. Physiologia Plantarum 122, 86 94. Ulmasov T., Hagen G. & Guilfoyle T.J. (1997) ARF1, a transcription factor that binds to auxin response elements. Science 276 , 18651868. Ulmasov T., Hagen G. & Guilfoyle T.J. (1999) Dimerization and DNA binding of auxin response factors. The Plant Journal 19, 309 319. UniformMu Transposon Resource: project documentation and protocols. http://www.maizegdb.org/documentation/uniformmu/#I Vacca R.A., de Pinto M.C., Valenti D., Passarella S., Marra E. & De Gara L. (2004) Production of reactive oxygen species, alteration of cytosolic ascorbate peroxidase, and impairment of mitoc hondrial metabolism are early events in heat shockinduced programmed cell death in tobacco bright yellow 2 cells. Plant Physiology 134 , 11001112. Vani B., Pardha Saradhi P. & Mohanty P. (2001) Alteration in chloroplast structure and thylakoid membrane composition due to in vivo heat treatment of rice seedlings: correlation with the functional changes. Journal of Plant Physiology 158, 583 592. Vanneste S. & Friml J. (2009) Auxin: A trigger for change in plant development. Cell 136, 10051016.

PAGE 106

106 Wang Z., Xi ng S., Birkenbihl R.P. & Zachgo S. (2009) Conserved Functions of Arabidopsis and Rice CC Type Glutaredoxins in Flower Development and Pathogen Response. Molecular Plant 2 , 323335. Williams P.N., Price A.H., Raab A., Hossain S.A., Feldmann J., Meharg A.A. (2005) Variation in arsenic speciation and concentration in paddy rice related to dietary exposure. Environmental Science & Technology 39 , 55315540. Wu Q., Lin J., Liu J.Z., Wang X., Lim W., Oh M., Park J., Rajashekar C.B., Whitham S.A., Cheng N.H., Hir schi K.D. & Park S. (2012) Ectopic expression of Arabidopsis glutaredoxin AtGRX S17 enhances thermotolerance in tomato. Plant Biotechnology Journal 10, 945955. Xing S., Rosso M.G. & Zachgo S. (2005) ROXY1, a member of the plant glutaredoxin family, is requ ired for petal development in Arabidopsis thaliana . Development 132, 15551565 . Yang H.B. & Murphy A.S. (2009) Functional expression and characterization of Arabidopsis ABCB, AUX 1 and PIN auxin transporters in Schizosaccharomyces pombe. Plant Journal 59, 179191. Yin Y., Li S., Liao W., Lu Q., Wen X. & Lu C. (2010) Photosystem II photochemistry, photoinhibition, and the xanthophyll cycle in heat stressed rice leaves. Journal of Plant Physiology 167 , 959966. Yoshida S, Satake T, Mackill DS. ( 1981) High te mperature stress in ri ce IRRI Research Paper Series 67 . Yoshida S. (1973) Effects of temperature on growth of the rice plant (Oryza sativa L.) in a controlled environment. Soil Science and Plant Nutrition 19 , 299310. Zaffagnini M., Bedhomme M., Lemaire S .D. & Trost P. (2012) The emerging roles of protein glutathionylation in chloroplasts. Plant Science 185 186 , 86 96. Zander M., Chen S., Imkampe J., Thurow C. & Gatz C. (2012) Repression of the Arabidopsis thaliana Jasmonic Acid/Ethylene Induced Defense P athway by TGA Interacting Glutaredoxins Depends on Their C Terminal ALWL Motif. Molecular Plant 5 , 831 840. Zhao F J., McGrath S.P. & Meharg A.A. (2010) Arsenic as a food chain contaminant: mechanisms of plant uptake and metabolism and mitigation strategies. Annual Review of Plant Biology 61, 535 559. Zhao F Y., Han M M., Zhang S Y., Wang K., Zhang C R., Liu T. & Liu W. (2012) Hydrogen peroxidemediated growth of the root system occurs via auxin signaling modification and variations in the expression of cel l cycle genes in rice

PAGE 107

107 seedlings exposed to cadmium stress. Journal o f Integrative Plant Biology 54, 9911006. Zhao Y. (2008) The role of local biosynthesis of auxin and cytokinin in plant development. Current Opinion in Plant Biology 11, 16 22. Zhao Y. (20 10) Auxin biosynthesis and its role in plant development. Annual Review of Plant Biology 61, 49 64. Zhou J., Wang J., Shi K., Xia X.J., Zhou Y.H. & Yu J.Q. (2012) Hydrogen peroxide is involved in the cold acclimationinduced chilling tolerance of tomato pl ants. Plant Physiology and Biochemistry 60, 141 149.

PAGE 108

108 BIOGRAPHICAL SKETCH Aparna Krishnamurthy was born in the southern state of Karnataka, India. The youngest of three children, she spent earl y period of her life in Bangalore city, India . After h er bachelor’s at the University of Agricultural Sciences, Bangalore in 2005, she earned a m aster ’s degree in Genetics and Plant Breeding at the University of Agricul tural Sciences, Bangalore, in 2007 . In A ugust 2009, she started a PhD program in Horticultural Sci ences Department under the supervision of Dr. Bala Rathinasabapa thi at the University of Florida, Gainesville .