Citation
Developmental Programming of the Preimplantation Bovine Embryo by Colony Stimulating Factor 2

Material Information

Title:
Developmental Programming of the Preimplantation Bovine Embryo by Colony Stimulating Factor 2
Creator:
Dobbs, Kyle B
Place of Publication:
[Gainesville, Fla.]
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (178 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Molecular and Cellular Biology
Committee Chair:
HANSEN,PETER J
Committee Co-Chair:
DRURY,KENNETH C
Committee Members:
WOHLGEMUTH,STEPHANIE
RESNICK,JAMES LEWIS
Graduation Date:
5/3/2014

Subjects

Subjects / Keywords:
Blastocyst ( jstor )
Cattle ( jstor )
DNA ( jstor )
Embryogenesis ( jstor )
Embryos ( jstor )
Genes ( jstor )
In vitro fertilization ( jstor )
Methylation ( jstor )
Oocytes ( jstor )
Pregnancy ( jstor )
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
bovine -- csf2 -- embryo
Genre:
Electronic Thesis or Dissertation
born-digital ( sobekcm )
Animal Molecular and Cellular Biology thesis, Ph.D.

Notes

Abstract:
The maternal environment is an important determinant of preimplantation development of the mammalian embryo. Many actions of the mother are mediated by alterations in secretion of regulatory molecules called embryokines produced by the endometrium. One of these molecules, colony stimulating factor 2 (CSF2), causes several actions on the embryo when added from days 5-7 of development including altering lineage commitment of the inner cell mass (ICM) and trophectoderm (TE) of the blastocyst, increasing competence of an embryo to become a blastocyst and to establish pregnancy after transfer. Multiple experiments were carried out to understand the mechanisms of CSF2 on the development of the preimplantation bovine embryo. First, experiments were conducted to evaluate regulation by CSF2 of pluripotency within the ICM and TE differentiation and growth. The proportion of isolated ICM colonies that survived until the end of the first cellular passage was greater for ICM derived from blastocysts produced in the presence of CSF2 than ICM from control blastocysts. There was little effect of CSF2 on characteristics of TE outgrowths from blastocysts. In addition, actions of CSF2 were found to occur through a signaling pathway that is likely independent of CSF2RB because CSF2RB was undetectable from the zygote to blastocyst stages. Second, the actions of CSF2 from day 5-7 of development on characteristics of the embryo at day 15 of gestation to determine whether CSF2 causes long-term changes in embryonic development. CSF2 decreased length and IFNT secretion of female embryos at Day15 but increased length and IFNT secretion of male embryos. Similarly, CSF2 affected the transcriptome and methylome differently for female embryos than male embryos. Finally, immunofluorescent labeling with anti-5- methylcytosine was used to evaluate global DNA methylation during preimplantation development. Results suggest that DNA methylation undergoes dynamic changes during the preimplantation period in a manner that is dependent upon gender and that the TE of the blastocyst is more methylated than the ICM. There was no effect of CSF2 on global DNA methylation at the blastocyst stage. Overall, these results establish a mechanism by which the maternally secreted embryokine, CSF2, alters the developmental trajectory of the bovine preimplantation embryo. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: HANSEN,PETER J.
Local:
Co-adviser: DRURY,KENNETH C.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2015-05-31
Statement of Responsibility:
by Kyle B Dobbs.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Applicable rights reserved.
Embargo Date:
5/31/2015
Resource Identifier:
907294933 ( OCLC )
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EAUN97IAN_M35BAP INGEST_TIME 2014-10-03T21:47:23Z PACKAGE UFE0046537_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

1 DEVELOPMENTAL PROGRAMMING OF THE PREIMPLANTATI O N BOVINE EMBRYO BY COLONY STIMULATING FACTOR 2 By KYLE BRADLEY DOBBS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2 2014 K yle B radley D obbs

PAGE 3

3 To Lauren M om, D ad and Kory

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank my advisor, Dr. Peter J. Hansen, for mentoring me on what it takes to truly be a scientist He always challenged me, which brought out my best, but did so while also being respectful and understanding. His advice, knowledge, expertise and willingness to take a chance on brin ging me down to Florida are some things I will never forget and for which I am truly grateful. I would also like to thank my committee members, Dr. Stephanie Wohlgemuth, Dr. James Resnick and Dr. Kenneth Drury for all the support and advice that was given to me during my PhD program. I also thank the members of the Hansen lab both past and present, for a ll their help during my program Among my lab mates deserving thanks are Anna Denicol, Miki Sakatani, Manabu Ozawa, James Moss, Luciano Bonilla, Maria Padua, Sofia Ortega, Sarah Cochran, Firdous Khan, Mateus Sudano, Juliana Delgado Antonio Ruiz Paula Tribulo, Veronica Negron Perez, Luiz Siq ueira, Jasmine Francis, Serdal Dikman, Christine Meyer and Marlon Rodriguez. Without you guys, I would not have been productive and for that, I am grateful. I am very grateful to the lab of Dr. Marc Andr Sirard and Dr. Claude Robert in Qu bec City, QC for their help and assistance teaching me how to do microarray analysis and helping me survive Qu bec with my broken French M erci beaucoup Thank you to Justin Fear and Dr. Alice Morse in the Lauren McInytre lab for their assistance with analyzing microarray data, specifically. I am also thankful to Dr. Alan Ealy and his lab for assistance on IFNT assays and to Stacey Jo nes and the IFAS communications office for designing figures for th e dissertation. Thanks also to Central P acking Co. in Center Hill, FL for providing the lab with ovaries and fetus es for my experiments and William Rembert for collecting these

PAGE 5

5 samples. Special thanks go to Eric Diepersloot for his assistance and guidance at the University of Florida Dairy Research Unit (Hague, FL). I came into this lab with little experience handling cattle and Eric showed me the ropes I am also grateful fo r the Animal Molecular and Cellular Biology Graduate P rogram for the fellowship that provided me with funding to complete my PhD. Also, thank s to the D epartment of Animal Sciences for housing me and providing me with the resources for my research. I am also grateful to the graduate students of the department for their camaraderie and support including Dale Kelley, Rafael Bisinotto, Karun Kaniyamattam, Na talia Patio Eduardo Ribeiro and Tao Sha. My thanks go out to all of my Gainesville friends outsid e of the lab that my wife and I were fortunate to meet, especially Rev. Dan and Jen Prugh as well as Dr. Peter and Natalie Carter. They made us feel like family and were always there for us. I also want to thank my M om and D ad. No one has been there for me throughout my whole life more than those two. They pushed me in all that I did and made me who I am today I know they never thought the son of a CPA and cartographer would graduate with a PhD in science I also thank the rest of my family, my brothe r Kory and my grandmothers for their love and support. Life was made a lot easier during my program with the love that was available 24/7 from our Jack chi (dog), Lexi. Finally, I thank my wife Lauren, for her love and support. It goes without saying that I could not have done this without her and I am forever indebted to her. She was and is always there for me and even moved 1,000+ miles from everyone and everything that she knew to support me.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 9 LIST OF FIGURES ................................ ................................ ................................ ........ 10 ABSTRACT ................................ ................................ ................................ ................... 15 CHAPTER 1 LITERATURE REVIEW ................................ ................................ .......................... 17 Introduction ................................ ................................ ................................ ............. 17 Development of the Preimplantation Embryo in the Cow ................................ ........ 19 Time Course of Development ................................ ................................ ........... 20 Embryonic Genome Activation ................................ ................................ ......... 23 DNA Methylation ................................ ................................ .............................. 24 Differentiation of the First Two Cell Lineages in the Blastocyst ........................ 26 Evidence for the Importance of the Maternal Environment for Regulation of Development ................................ ................................ ................................ ....... 27 In Vitro Produced Embryo ................................ ................................ ................ 28 Alterations in Maternal Function ................................ ................................ ............. 33 Supplemental Progesterone ................................ ................................ ............. 33 Somatotropin ................................ ................................ ................................ .... 34 Lactation ................................ ................................ ................................ ........... 35 Developmental Programming ................................ ................................ ................. 35 CSF2 as an Embryokine ................................ ................................ ......................... 39 Role of Colony Stimulating Factor 2 as an Embryokine ................................ ... 40 Signal Transduction ................................ ................................ .......................... 40 Production of CSF2 by the Reproductive Tract ................................ ................ 41 Actions on the Preimplantation Embryo ................................ ........................... 42 Characteristics of the CSF2R in the Preimplantation Embryo .......................... 45 Goals of the Current Investigation ................................ ................................ .......... 46 2 REGULATION OF PLURIPOTENCY OF INNER CELL MASS AND GROWTH AND DIFFERENTIATION OF TROPHECTODERM OF THE BOVINE EMBRYO BY COLONY STIMULATING FACTOR 2 ................................ ............................... 48 Introduction ................................ ................................ ................................ ............. 48 Materials and Methods ................................ ................................ ............................ 50 Embryo Production ................................ ................................ ........................... 50 Effect of CSF2 on Survival of Isolated Inner Cell Mass ................................ .... 51 Bovine fetal fibroblast feeder cells ................................ ............................. 51

PAGE 7

7 Isolation of ICM by lysis of trophectoderm using antibody and complement via immunosurgery ................................ ............................. 52 Culture of isolated ICM ................................ ................................ .............. 53 Experiments ................................ ................................ ................................ ..... 54 Analysis of ICM Colonies Surviving Passage ................................ ................... 54 Expression of Pluripotency Genes in ICM ................................ ........................ 55 Actions of CS F2 on Competence of Trophectoderm to Form Outgrowths ....... 55 Establishment of outgrowths ................................ ................................ ...... 55 Immunolabeling of CDX2 ................................ ................................ ........... 56 Assessment of establishment and growth of trophectoderm outgrowths ... 57 Gene expression ................................ ................................ ........................ 57 Antiviral assay ................................ ................................ ............................ 57 Experiments ................................ ................................ ................................ ..... 58 Expression of CSF2 Receptor Subunit Genes ................................ ................. 58 Quantitative PCR ................................ ................................ .............................. 59 Statistical Analysis ................................ ................................ ............................ 60 Results ................................ ................................ ................................ .................... 61 Blast ocyst Development ................................ ................................ ................... 61 Effect of CSF2 on Survival of Isolated ICM ................................ ...................... 62 Expression of Genes Involved in Pluripotency and Differentiation ................... 63 TE Outgrowth ................................ ................................ ................................ ... 64 Expression of CSF2 Receptor Subunit Genes ................................ ................. 65 Discussion ................................ ................................ ................................ .............. 65 3 SEXUAL DIMORPHISM IN DEVELOPMENTAL PROGRAMMING OF THE BOVINE PREIMPLANTATION EMBRYO CAUSED BY COLONY STIMULATING FACTOR 2 ................................ ................................ ..................... 77 Introduction ................................ ................................ ................................ ............. 77 Materials and Methods ................................ ................................ ............................ 80 Embryo Production ................................ ................................ ........................... 80 Embryo Transfer ................................ ................................ ............................... 80 Embryo Recovery ................................ ................................ ............................. 81 IFNT Assay ................................ ................................ ................................ ....... 82 Extract ion of gDNA and Total RNA ................................ ................................ .. 83 Sexing by PCR ................................ ................................ ................................ 83 Overview of Analysis of Transcriptome ................................ ............................ 84 RNA amplification ................................ ................................ ...................... 84 RNA labeling ................................ ................................ .............................. 85 RNA microarray hybridization and scanning ................................ .............. 85 Analysis of transcriptome microarray data ................................ ................. 86 Validation of trancriptome microarray by PCR ................................ ........... 87 Overview of Analysis of Methylome ................................ ................................ .. 88 Fragmentation and amplification of gDNA ................................ ................. 88 DNA labeling ................................ ................................ .............................. 90 DNA microarray hybridization and scanning ................................ .............. 90 Analysis of methylome array ................................ ................................ ...... 91

PAGE 8

8 Results ................................ ................................ ................................ .................... 91 Embryo Length and IFNT Accumulation in the Uterus ................................ ..... 91 Dif ferentially Expressed Genes ................................ ................................ ........ 92 Methylome ................................ ................................ ................................ ........ 94 Discussion ................................ ................................ ................................ .............. 95 4 DYNAMICS OF DNA METHYLATION DURING EARLY DEVELOPMENT OF THE PREIMPLANTATION BOVINE EMBRYO ................................ ..................... 111 Introduction ................................ ................................ ................................ ........... 111 Experimental Procedures ................................ ................................ ...................... 113 Embryo Production ................................ ................................ ......................... 113 Immunofluorescent Labeling for 5 Methylcytosine ................................ ......... 114 Immunofluorescent Labeling for 5 Methylcytosine and CDX2 ........................ 115 Image Analysis Using Imagej ................................ ................................ ......... 115 Separation of TE and ICM by Magnetic Activated Cell Sorting ...................... 116 Reverse Transcription and Quantitative PCR ................................ ................. 117 High Resolution Melting Analysis ................................ ................................ ... 118 Design of Experiments ................................ ................................ .......................... 120 Statistical Analysis ................................ ................................ ................................ 123 Results ................................ ................................ ................................ .................. 123 Changes in DNA Methylation during Development to the Blastocyst Stage ... 123 Effect of Sex on DNA Methylation ................................ ................................ .. 123 DNA Methylation in Blastocysts as Modulated by Sex, CSF2 and Cell Differentiation ................................ ................................ .............................. 124 Developmental Changes in DNMT 3B Gene Expression ................................ 124 Developmental Changes in Methylation of DNMT3B ................................ ..... 125 Discussion ................................ ................................ ................................ ............ 125 5 GENERAL DISCUSSION ................................ ................................ ..................... 138 REFERENCES ................................ ................................ ................................ ............ 147 BIOGRAPHICA L SKETCH ................................ ................................ .......................... 178

PAGE 9

9 LIST OF TABLES Table page 2 1 Effects of CSF2 from Day 5 to 7 or 6 to 8 post insemination on characteristics of TE outgrowths. ................................ ................................ ........ 71 3 1 List of primers used for qPCR. ................................ ................................ .......... 101 3 2 Validation of microarray results by determination of the correlation between fluorescent intensity on the array with C T value in qPCR. ................................ 102

PAGE 10

10 LIST OF FIGURES Figure page 2 1 The effect of CSF2 on the percent of oocytes that became a blastocyst depends on the overall competence of embryos to develop to the blastocyst stage. ................................ ................................ ................................ .................. 72 2 2 Treatment with CSF2 increases ability of isolated ICM to survive following passage.. ................................ ................................ ................................ ............ 73 2 3 Representative appearance of colonies of cells derived from ICM at Day 7 passage 1. ................................ ................................ ................................ .......... 74 2 4 Lack of effect of CSF2 on expression of genes related to pluripotency and differentiation in ICM isolated from Day 8 blastocysts.. ................................ ...... 75 2 5 Developmental changes in steady state mRNA for CSF2RA and CSF2RB.. ..... 76 3 1 Sex by CSF2 interaction affecting length of the embryo and accumulation of IFNT in uterine flushings at day 15 of pregnancy.. ................................ ........... 103 3 2 Venn diagram illustrating differentially expressed transcripts at day 15 of pregnancy in male and female embryos treated with CSF2 or control medium from day 5 7 of development.. ................................ ................................ .......... 104 3 3 Diagram illustrating genes encoding for proteins in the electron transport chain that were diffe rentially expressed between control female and male embryos at day 15 of pregnancy.. ................................ ................................ .... 10 5 3 4 Biological processes predicted to va ry with sex in control embryos... .............. 106 3 5 Predicted changes in cellular function in male embryos at day 15 of pregnancy caused by CSF2 treatment b etween day 5 7 of development. ...... 107 3 6 Venn diagram illustrating differentially methylated probes at day 15 of pregnancy in male and female embryos treated with CSF2 or control medium from day 5 7 of development. ................................ ................................ ........... 108 3 7 Non random clustering of differentially methylated probes example from bovine chromosome 1.. ................................ ................................ .................... 109 3 8 Model illustrating a mechanism for achievement of sex specific developmental programming in response to a change in maternal env ironment. ................................ ................................ ................................ .... 110

PAGE 11

11 4 1 Representative images of embryos labeled for immunoreactive 5 methylcytosine at the 2 cell, 4 cell, 6 8 cell, 9 25 cell, 32 cell morula and blastocyst st ages of development.. ................................ ................................ ... 130 4 2 Developmental changes in labeling of immunoreactive 5 methylcytosine from the 2 cell to blastocyst s tages of development.. ................................ ............... 131 4 3 Effects of sex on immunoreactive 5 methylcytosine in embryos at the 6 8 cell and blastocyst stages of development.. ................................ ............................ 132 4 4 Representative images of an embryo in which labeling with CDX2 (blue) was used to evaluate immunoreactiv e 5 methylcytosine (green) in ICM (CDX2 negative) and TE (CDX2 positive).. ................................ ................................ .. 133 4 5 Effects of sex and cell type [ICM and TE] on immunoreactive 5 methylcytosine in blastocysts.. ................................ ................................ ......... 134 4 6 Developmental changes in steady state mRNA for DNMT3B.. ........................ 135 4 7 Characteristics of the high resolution melt analysis for methylation of an intronic region of DNMT3B.. ................................ ................................ ............. 136 4 8 Developmental changes in DNA methylation for DNMT3B.. ............................. 137 5 1 Schematic illustration of conclusions derived from the dissertation including developmental changes in methylation and sex specific actions of CSF2 on embryonic development.. ................................ ................................ ................. 146

PAGE 12

12 LIST OF ABBREVIATIONS Note: Official gene symbols are used without definition as recommended by the HUGO Gene Nomenclature Committee ( http://www.genenames.org ) 2i Two inhibitors ABAM Anti bacterial, anti microbial aRNA Amplified ribonucleic acid ATP Adenosine triphosphate BSA Bovine serum albumin bST Bovine somatotropin BTA Bos taurus cDNA Compl e mentary deoxyribonucleic acid COC Cumulus oocyte complex ConA Concanavalin A CpG Cytosine guanine dinucleotide C T Cycle threshold DAPI diamidino 2 phenylindole DAVID Database for annotation, visualization and integrated discovery DEG Differentially expressed genes DMEM Dulbecco modified eagle medium DMR Differen tially methylated region DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid DNMT DNA methyltransferase DPBS ED Embryonic disc

PAGE 13

13 EEM Extra embryonic membrane EGA Embryonic genome activation ESC Embryonic stem cell ESM Embryonic stem cell medium FBS Fetal bovine serum FITC Fluorescein isothiocyanate gDNA Genomic deoxyribonucleic acid GO Gene ontology ICM Inner cell mass IgG Immunoglobulin G IPA Ingenuity pathway analysis iPATH Interactive pathway explorer IVF In vitro fe rtilization IVP In vitro produced JAK Janus kinase KEGG Kyoto encyclopedia of genes and genomes MACS Magnetic activated cell sorting MAPK Mitogen activated protein kinase MS HRM Methylation sensitive high resolution melting analysis PBS Phosphate buffered saline pi post insemination PI Propidium iodide PI3K Phosphoinositide 3 kinase PVA Polyvinyl alcohol PVP Polyvinylpyrrolidone

PAGE 14

14 qPCR Q uantitative polymerase chain reaction RNA Ribonucleic acid ROX Reactive oxygen species siRNA Short interfering ribonucleic acid SOF BE1 Synthetic oviductal fluid bovine embryo 1 STAT Signal transduction and activation of transcription SWI/SNF Switch/Sucrose nonfermentable TCJ Tight cell junction TE Trophectoderm TUNEL Terminal deoxynucleotidyl transferase

PAGE 15

15 Abstract of Disser tation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy DEVELOPMENTAL PROGRAMMING OF THE PREIMPLANTATI O N BOVINE EMBRYO BY COLONY STIMULATING FAC TOR 2 By K yle B radley D obbs May 2014 Chair: Peter J. Hansen Major: Animal Molecular and Cellular Biology The maternal environment is an important determinant of preimplantation development of the mammalian embryo. Many actions of the mother are mediated by alterations in secretion of regulatory molecules called embryokines produced by the endometrium. One of these molecules, colony stimulating factor 2 (CSF2), causes several actions on the embryo when added from days 5 7 of development including altering lineage commitment of the inner cell mass ( ICM ) and trophectoderm ( TE ) of the blastocyst, increasing competence of an embryo to become a blastocyst and to establish pregnancy after transfer. Multiple experiments were carried out to understand th e mechanisms of CSF2 on the development of the preimplantation bovine embryo. First, experiments were conducted to evaluate regulation by CSF2 of pluripotency within the ICM and TE differentiation and growth. The proportion of isolated ICM colonies that survived until the end of the first cellular passage was greater for ICM derived from blastocysts produced in the presence of CSF2 than ICM from control blastocysts. There was little effect of CSF2 on characteristics of TE outgrowths from blastocysts. In addition, actions of CSF2 were found to occur through a signaling pathway that is likely

PAGE 16

16 independent of CSF2RB because CSF2RB was undetectable from the zygote to blastocyst stages. Second, the actions of CSF2 from day 5 7 of development on characteristics of the embryo at day 15 of gestation to determine whether CSF2 causes long term changes in embryonic development CSF2 decreased length and IFNT secretion of female embryos at Day15 but increased length and IFNT secretion of male embryos. Similarly, CSF2 affected the transcriptome and methylome differently for female embryos than male embryos Finally, immunofluorescent labeling with anti 5 methylcytosine was used to evaluate global DNA methylation during preimplantation development. Results suggest tha t DNA methylation undergoes dynamic changes during the preimplantation period in a manner that is dependent upon sex and that the TE of the blastocyst is more methylated than the ICM. There was no effect of CSF2 on global DNA methylation at the blastocyst stage. Overall, these results establish a mechanism by which the maternally secreted embryokine, CSF2, alters the developmental trajectory of the bovine preimplantation embryo.

PAGE 17

17 CHAPTER 1 LITERATURE REVIEW Introduction The mammalian embryo only spends a few days developing from the totipotent zygote stage to the blastocyst stage in which the first two lineage commitment events take place. In cattle, the blastocyst, consisting of ICM and T E forms by Day 6 7 in vivo [1] and the hypoblast forms about 48 hou rs later [2] Although development of the zygote to the blastocyst stage can occur in the absence of maternal signals (i.e., in culture media), the maternal environment is important for ensuring optimal development. Indeed, embryos pr oduced in vitro have several characteristics that are altered compared to embryos that develop in vivo, including gene expression [3] lipid content [4, 5] ultrastructure [6, 7] and degree of methylation of CpG islands of specific genes [8] Moreover, perturba tions in the maternal environment during the preimplantation period can compromise embryonic survival and amend the developmental program of the embryo to cause long term changes in physiology and health that extend into postnatal life. In the cow, there are several lines of evidence indicating the importance of perturbations in the maternal environment for development of the preimplantation embryo. An experiment in which embryos were transferred into the oviduct indicated that lactation causes reduced ab ility of embryos to develop to the blastocyst stage [9] Cows in which embryos were transferred into the reproductive tra ct at day 7 after estrus had a different pattern of endometrial gene expression on the day of transfer than cows in which the embryo did not survive [10] The maternal hormonal environment can alter characteristics of t he embryo as well, as shown by studies that premature elevation of

PAGE 18

18 progesterone after ovulation hastened elongation of the trophoblast [11] and that treatment of superovulated cows with somatotropin increased the competence of the resultant embryos to establish pregnancy after embryos were recovered and transferred to recipients [12] Experiments indicating that alterations in maternal environment can reconfigure the developmental program of the embryo come largely from experime nts with rodents. Female mice or rats fed a low protein diet during the period corresponding to preimplantation development produced changes in the resultant offspring, which persisted into adult life [13 15] In the sheep, as well, change in nutritional environment during the peri conception period (this time by reducing the bioavailability of me thionine) caused changes in the adult offspring that included increased rate of obesity, altered immune response, elevated blood pressure and resistance to insulin [16] One of the characteristics of developmental programming caused by changes in the maternal environment during the preimplantation period is that females are programmed differently than males. For example, feeding female mice diets low in protein during embr yonic development affected females differently than males [13, 14] Male adults born from mothers that were fed low protein diets had elevated angiotens in converting enzyme [17] while female adults had increased blood pressure [14] and reduced heart to body weight ratio [13] One of the assumptions of this dissertation is that a major mechanism by which changes in uterine environment affects embryonic development is change in the release of soluble regulators of embryonic development These molecules, hereafter called embryokines are produced by the oviduct and endometrium and are capable of altering

PAGE 19

19 the course of embryo development. Indeed, several maternally derived molecules have been identified that have beneficial effects on th e preimplantation embryo. In the cow, these include CSF2 [18] IGF1 [19] TGFB [20] hyaluronan [21] LIF [20] FGF2 [22] and ILB1 [23] The best studied embryokine is CSF2, which can improve early development and embryonic competence for establishment of pregnancy in mice, cows and human s [18, 24 26] CSF2 is secreted by the endometrial and oviductal epithelium [27 29] Treatment of in vitro produced bovine embryos with CSF2 alters gene expression [30] decreases apoptosis [31] and increases ICM to TE cell ratio within the blastocyst [18] At least two environmental factors can affect CSF2 synthesis in the uterus seminal plasma [shown in mice; [32, 33] ] and obesity (shown in cow) [34] This literature review will be focused on un derstanding how the maternal reproductive milieu regulates development of the early embryo. The focus will be on the specific role of CSF2 as a maternal embryokine. While data from a variety of species will be dealt with, the major research model discusse d will be the cow. For that reason, and to put research on maternal effects on embryonic development in context, the review will begin with an overview of the process of preimplantation development in the cow. Development of the Preimplantation Embryo i n the Cow Preimplantation development involves a specific chain of events. Following fertilization of the oocyte, the embryo proceeds through symmetric cleavages, doubling its cell number and decreasing cell size with each cleavage. During this time, th e embryo utilizes maternally inherited mRNA for protein production until transcription is initiated in a process called embryonic genome activation (EGA). Although the exact

PAGE 20

20 timing is unclear, around the same time as EGA, the embryo loses all DNA methylat ion marks before regaining them during de novo methylation involving actions of embryo specific methyltransferase enzymes. Finally, following blastocyst formation, the embryo hatches and begins to elongate, increasing its size more than 20 fold [35] and then begins to attach to the epithelium of the endometrium in a gradual process that is initiated around Day 20 [36] Time Course of Development Immediately after ovulation, the oocyte is picked up by the fimbria of the oviduct and moved into the oviductal lumen [37] Fertilization takes place near the junction of the isthmus and ampulla [3 8] Following fertilization, the two pronuclei fuse, and meiosis is completed by extrusion of the second polar body [39, 40] The firs t round of cleavage following fertilization occurs within 28 35 hours [41] This is followed by additional rounds of cell division so that the embryo reaches the 4 cell stage by 40 46 hours after fertilization, the 8 cell stage by 58 86 hours after fertilization and the 16 cell stage by 106 hours post fertili zation [41] Cleavage throughout development is asynch ronous [41] By 134 hours post fertilization, the forma tion of tight cell junctions (T C J) have formed [41] T C J formation involves the gathering of T C J constituents to form a protein cluster on E cadherin complex which is located between blastomeres [42] The T C J becomes sealed during the 32 cell to early blastocyst stage following the addition of tight junction protein alpha [42] T C J formation represents the first step in differentiation of the embryo because the presence of tight junctio ns causes a different microenvironment for cells on the outside of the embryo from cells on the inside of the

PAGE 21

21 embryo. In mice, position of blastomeres at the time of morula formation is an important determinant of whether cells give rise to ICM or TE cell s [4 3] Blastocyst formation occurs about 168 hours post insemination [1] Accumulation of fluid in the blastocoelic cavity is the result of actions of Na + /K + ATPase [44] as well as facilitated movement of water by aquaporin channel proteins [45] The blastocyst represents the departure point for the embryo. Before the blastocyst stage, all cells of the embryo are totipotent Beginning at the blastocyst stage, however, cells becoming increasingly restricted in the lineages they can form. The first differentiation is at the blastocyst stage where TE cells become committed towards a placental lineage [46] Cells of the ICM give rise to the pluripotent epiblast and the hypoblast, which contributes to placental endoderm. The hypoblast can first be identified at day 8 after fertilization as a group of cells on the outer face of the ICM th at label with GATA6 [47] Competency of an embryo to develop to the blastocyst stage is in part due to the timing of cleavage. The longer the time between fertilization and the initial cleavage, the lower the likelihood that an embryo can develop to t he blastocyst stage [48] In vitro, embryos that reached the 16 cell stage by 72 hou rs after insemination produced more expanded and hatched blastocysts compared to embryos that were only at the 1 4 cell stage during the same time frame [48] At least some of these differences in developmental potential are likely to be caused by differences in the transcriptome. Embryos that reached the 2 cell stage by 29.5 hours post fe rtilization had increased expression of genes relating to cell cycle control and DNA damage response factors compared to embryos requiring 46 hours to reach the same cell stage [49]

PAGE 22

22 The timing of development is not the same for embryos produced in vitro versus those produced in vivo. In vitro produced embryos proceed through their first cleavage about 33 hours after fertilization, about 5 9 hours later than their in vivo counterparts [1] This delay persists throughout development; for example blastocysts form about one day sooner in vivo than in vitro [1] The timing of development is also dependent upon the sex of the embryo. Female embryos reach the 2 4 cell an d blastocyst stages slower than male embryos [50] In addition, female blastocysts are less likely to be expanded at d ay 8 compared to mal es [51] At 192 240 hours post insemination, the bovine embryo proceeds through a series of events that induces hatching of the embryo from the surrounding zona pellucida [48, 52] Hatching involves two processes: lysis of the zona pellucida with the embryo derived enz yme plasmin [1] and expansion of th e blastocoel cavity to apply pressure to the zona pellucida and allows the blastocyst to protrude and eventually vacate from the structure. After hatching around day 8 10 after fertilization, the blastocyst undergoes a series of morphological changes to c hange shape from spherical to ovoidal [2] By day 14 following fertilization, the embryo begins a dramatic elongation of the trophoblast. At first the embryo assumes a tubular shape, with sizes ranging from 0.5 mm to 19.0 mm in length [2] Subsequently, the embryo assumes a filamentous shape and reaches lengths of 6.0 mm to 160.0 mm by day 16 [1] The initiation of elongation is reliant upon the maternal environment, as in vitro produced embryos will not elongate [53] Rapid elongation also requires rapid cell proliferation. Over 500 genes predominantly associated with trophoblast cell proliferation, are upregulated in embryos

PAGE 23

23 between day 7 and 14 [54] By day 14 16, the process of gastrulation has begun with the formation of the three germ layers [2] One function of the el ongating embryo is production of IFNT to signal to the mother to block luteolysis and allow continued secretion of progesterone from the corpus luteum [55] As the embryo increases in length, secretion of IFNT also increases [56, 57] It is not clear whether the increase in IFNT with size is associated with an increase in INFT gene expression per cell or simply the larger size [54, 57] Starting at gestational day 20, the elongating bovine embryo begin s the process of apposition and adhesion to the endometrial epithelium [54] The bovine embryo, like other species with an epitheliochorial placentation, does not invade through the epithelial basement membrane to cause implantation. Rather, some embryonic cell s adhere to epithelial cells while others (binucleate cells) migrate into the endometrial epithelium and fuse with maternal cells [58] The process of placentation in the cow is slow, requiring around 12 days to be completed. [59] Embryonic Genome Activati on One of the key events in development is activation of the embryonic genome. [60] Therefore, the oocyte and embryo are dependent upon preformed mRNA for direction of protein synthesis unti l the genome is reactivated. The embryo manages protein synthesis by modifying polyadenylation of maternally donated mRNA and controlling the cell cycle clock [61, 62] The first round of transcription from the embryonic genome starts at the 2 4 cell stage, where a couple hundred genes a re activated [63] Some of the genes transcribed during this period of minor genome activation are SARS IL18 CRABP1 ACO2 TXN2 SLC38A2 and SLC25A3 [63] Minor activation is not required for

PAGE 24

24 development to the blastocyst stage because treatment with alpha amanitin to block transcription prior to major EGA had no effect on the percent of embryos that became blastocysts [64] Embryonic RNA transcription begins at the 8 cell stage [65] Full activation of the embryonic genome occurs between the 8 cell and 16 cell stage [66] Development is blocked at this stage if the embryo is exposed to alpha amanitin [64] The mechanism by which EGA occurs in the cow is unknown. In other species such as mice, Drosophila and C. elegans EGA is proposed to be initiated by removal of maternal transcripts through destabilizati on of the poly adenylated tail [67] Other mechanisms that are also likely to be involved including removal of transcriptional repressors and chromatin modifications such as the SWI/SNF complex from embryonic DNA, dilution of an unknown EGA re pressor caused by cellular division, and the acquisition of the cellular machinery for transcription [67] DNA Methylation DNA methylation involves the addition of a methyl group to the 5 th carbon ine in a DNA sequence, also known as a CpG dinucleotide [68] DNA methylation is an important mechanism for regulating gene expression. Methylated DNA elicits a transcriptionally repressive response by recruiting binding proteins to the DNA strand and by physically impedi ng transcriptional machinery fro m proceedin across the DNA [69, 70] DNA methylation is thus an important specific DNA regions [71] In addition, paternal imprinting involves DNA methylation on chromosomes of specific paternal origin [72] Given the role of DNA methylation in controlling differentiation, it is necessary for the embryo to remove methylation marks as

PAGE 25

2 5 part of the process to establish totipotency and restore methylation in a cell lineage dependent manner. The initial loss of global DNA methylation following fertilization occurs by both active and passive mechanisms [73, 74] At least in the mouse, the maternally derived genome is demethylated m ore slowly after fertilization than paternally derived genome [75] Loss of methylation in maternally derived genome is p assive due to the absence of a de novo DNA methyltransferase in the early embryo [76] In contrast, DNA demethylation of the paternally derived genome is accomplished by a host of DNA repair mechanisms such as base excis ion repair through DNA glycosylases [77] nucleotide excision repai r [78] deamination of the methylated cytosine [79] in addition to 5 methylcytosine oxidation [80] A specific DNA demethylation enzyme has not been identified. Before embryonic development, the methylation marks on imprinted genes are established and s ubsequently are maintained during global demethylation [72] and are only demethylated during primordial germ cell migration [81] Following demethylation, the embryo re acquires methylation marks as development proceeds. Indeed, development will not occur unless those methylation marks are restored by DNA methyltransferases [82] DNA methyl transferases D nmt 3 a and D nmt 3b are activated in order to re establish the methylation status of embryonic DNA [82] Uniqu e to the embryo is an imprinting maintenance DNA methyltransferases, DNMT1o. Although imprinting occurs during oogenesis in the absence of DNMT1o, these imprinted marks will disappear during early embryo development when DNMT1o is absent [83]

PAGE 26

26 While DNA demethylation and de novo methylation are critical events, there is wide divergence in the developmental and lineage specific char acteristics of the process. In the mouse, demethylation is complete by the late morula stage, d e novo methylation begins at the blastocyst stage of development and the ICM is more methylat ed than the TE [84] For sheep, in contrast, global methylation decreases continuously from t he 2 cell stage until the blastocyst stage [85] while the pig embryo does not undergo a loss of methylation between the zygote and blastocyst stages [86] For both pig and sheep the ICM is more methylat ed than the TE [85, 86] In the cow, it is unclear at what stage demethylation is complete or at what stage de novo methylation begins [87, 88] Differentiation of the First Two Cell Lineages in the B lastocyst T hree cell populations emerge during the blastocyst stage : the ICM, TE and hypoblast [called primitive endoderm (PE) in mice]. The ICM is a population of cells that will become the embryo proper while the TE and hypoblast will develop into the extra embryonic membrane s forming the placenta and endoderm al structures. Presence of specific transcription factors can be used to identify cells of the ICM ( NANOG and SOX2 ) [89 91] TE ( CDX2 ) or hypoblast ( GATA6 ) [92] lineage Embryos that have inactivation of CDX2 will fail to dev elop a TE [93] CDX2 is required for differentiation of TE since inactivation of the gene preve nts TE formation [93] Unlike the mouse, however, POU5F1 is not responsible for maintenance of I CM and is expressed in both ICM and TE fate [94] Commitment to the TE lineage is a gradual process; cells at Day 7 of development retain the capacity to revert back to a pluripotent cell type [94] By Day 11 of development, the expression of CDX2 is more than 10 times higher than

PAGE 27

27 POU5F1 which subsequently inhibits the activity of POU5F1 and causes irreversible differentiation of TE cells [94] GATA6 is initially expressed throughout the blastocyst and then becomes increasingly restricted to the ICM which is characterized by a mixture of cells expressing either GATA6 or the epiblast marker NANOG [47] GATA6 is not absent from the TE until D ay 8 of development [47] Heterogeneity of the ICM could be the result of variable responses to F gf4 signaling as shown in the mouse. In that species, the second cells produced as a result of proliferation have greater expression of Fgfr2 than cells produced in the first wave [95, 96] Cells from the second wave become hypoblast while the cells from the first wave stay dedicated to the ICM [95] Interestingly, if Fgf4 signaling through mitogen activated protein kinase (MAPK) is blocked in the epibla st cell population, all cells become Nanog positive and Gata6 negative [97] In the bovine, as well, inhibition of MAPK leads to an ICM where all cells are NANOG positive [98] Moreover, activation of F GF4 signaling using human recombinant FGF4, increased the number of cells in the ICM positive for GATA6 [47] Evidence for the Importance of t he Maternal Envir onment for Regulation o f Development That the reproductive tract environment established by the mother can affect the trajectory of development of the preimplantation embryo can be deduced from two lines of evidence. The first comes from examination of the characteristics of embryos produced in vitro. While an embryo can develop to the blastoc yst stage in the complete absence of maternal signals, it is clear that such embryos experience a range of abnormalities that affect competence to establish pregnancy and characteristics of the resultant offspring. In some cases, such aberrations have been shown to be the result

PAGE 28

28 of the culture conditions during embryo development rather than to disorders caused by in vitro maturation or fertilization. The second line of evidence comes from experiments indicating that alterations in maternal functions can al ter embryonic development. In Vitro Produced Embryo Although preimplantation embryonic development ordinarily takes place in the microenvironment of the female reproductive tract, healthy offspring can result when the embryo resides in an artificial cul ture environment during the period up to and including formation of the blastocyst. The embryo produced in vitro (IVP) is derived from an oocyte that underwent maturation in the absence of maternal signals other than those provided by the surrounding cumu lus cells. Examination of the characteristics of the IVP embryo make clear the importance of the maternal environment for regulation of development because embryos produced in vitro experience a variety of abnormalities compared to embryos produced in viv o. As a result, transfer of an IVP bovine embryo is associated with lower pregnancy rate [99] and a higher incidence of a bnormal calves at birth [100] In cattle, one of the consequences of in vitro production is an altered transcriptome [101] Alterations in mRNA expression begin as early as the 4 cell stage [102] By the blastocyst stage of development, there are hundreds of differentially expressed genes between embryos produced by in vitro and in vivo methods [101, 103 105] Specific ontolo gies that are enriched for differentially expressed genes between IVP and in vivo blastocysts include cholesterol synthesis and cell differentiation [101] as well as apoptosis and stress response [105] There is also aberrant DNA methylation in a fraction of IVP embryos [8, 88, 106] Loss of methylation of the maternally inherited allele of KvDMR1 has been shown to be

PAGE 29

29 associated with overgrowth of bovine fetuse s [106] Among the genes that experience decreas ed methylation following culture are genes involved in DNA methylation such as the de novo methylatransferases DNMT3a and DNMT3b and histone methyltransferases G9a and SUV39H1 [8] Ul trastructural morphology of the embryo can be disrupted by IVP. By the morula stage of development, embryos produced in vitro accumulate increased amount of intracellular lipid and have fewer mitochondria as compared to embryos produced in vivo [4 ] Analysis of lipid profile revealed that IVP embryos had increased abundance of phosphatidylcholines 32:0 and 34:1 [107] These lipids contain low amounts of double bonds so as to reduce membrane fluidity [107] At the blastocyst stage, IVP has been reported to decrease the number of microvilli that did not fully cover the plasma membrane [7] increase the debris in the perivitelline space and lead to mitochondria that are translucent in appearance [108] Experiments have been conducted to determine whether the disruption of development caused by IVP is the result of errors in oocyte maturation, fertilization or embryonic development. It is clear that maturation in vitro can disrupt the matured oocyte. Firs t, the ultrastructure of the oocyte matured in vitro is different from oocytes matured in vivo [109] In particular, release of corticle granules after fertilization, which are responsible for helping prevent polyspermy, are delayed [109] Furthermore, in vitro matured oocytes have cumulus cells that are smaller in size and less expanded [109] In addition, gene expression in oocytes and cumulus cells from cumulus oocyte complexes (COC) matured in vitro were found to differ from that of cumulus cells from COC matured in vivo [110] Using microarray, a total of 64 genes were found to be

PAGE 30

30 differentially expressed in cumulus cells from COCs in vivo and in vitro [110] Genes that are downregulated in oocytes matured in vitro include PKP GLUT1 and DSC2 [111] Among differentially expressed genes for in vitro COCs were upregulated genes related to stress response ( HSPA5 and HSP90B1 ) and downregulated genes related to anti apoptosis and ATP binding ( YWHAZ and ACTG1 ) [110] Finally, o ocytes that are matured in vivo followed by in vitro fertilization (IVF) and culture are more likely to become blastocysts on day 7 and 8 of developm ent than oocytes that are matured in vitro [112] In vitro maturation in other species is also associated with alterations in gene expression (mouse) [113] ultrastructure (pig) [114 ] reductions in oocyte competence to form a blastocyst (mouse) [115] and ability of resultant embryos to survive after transfer. In vitro produced embryos also have reduced development because culture conditions for the embryo following fertilization are inadequate. As compared to em bryos produced in vivo, Rizos et al. (2002c) observed a decrease in blastocyst yield for oocytes that were matured in vivo and then cultured for IVF and culture [112] Survival of bovine embryos after freezing could be increased if embryos produced by in vitro maturation and IVF are placed inside the oviduct of female sheep [6, 105] following collection at the blastocyst stage. One characteristic of in vitro produced embryos is increased susceptibility to damage after cryopreservation [6, 116, 117] and as a result, cryopreserved IVP embryos have poor survival after embryo transfer [118] One key aspect of how well a cryopreserved embryo develops is its lipid content prior to freezing [119] Drugs such

PAGE 31

31 as phenazine ethosulfate, which decrease the lipid content of the embryo, improve post thaw survivability of the IVP embryo [119] Recently, Gad et al. (2012) performed an extensive experiment to determine the specific stages of embryonic development relative to EGA in which culture en vironment disrupts gene expression in bovine blastocysts. The transcriptome of six groups of blastocysts were compared. Groups were as follows: 1) blastocysts produced in vitro, 2) blastocysts produced in vivo, 3) blastocysts produced by in vitro maturati on and fertilization, cultured to the 4 cell stage and then transfer to recipients, 4) blastocysts produced as for treatment 3 except that embryos were transferred to recipients at the 16 cell stage, 5) blastocysts that were produced in vivo and then place d in culture at the 4 cell stage, and 6) blastocysts produced in vivo and then placed in culture at the 16 cell stage. The greatest deviation in the transcriptome occurred in the two groups that were in culture during EGA embryos cultured until the 16 ce ll stage or produced in vivo and placed in culture at the 4 cell stage. In these two groups, there was upregulation of genes involved in the NRF2 mediated oxidative stress pathway. This result was interpreted to mean that the oviduct and the uterine envir onment provide some protection against reactive oxygen species and the absence of that protection leads to activation of oxidative stress genes Additionally, lipid metabolism genes ( MSMO1 ANXA1 ANXA3 HMGCR HSD17B11 LDLR and ACAT2 ), were down regulated when embryo culture spanned EGA [102] It is important to recognize that the culture conditions associated with IVP not only compromise the ability of the embryo to establish pregnancy but also change the nature of the developmental program so that there is a greater risk for fetal loss,

PAGE 32

32 neonat al death and developmental abnormalities in offspring produced as a result of IVP [99, 120 123] Offspring from IVP have a higher rate of congenital malformations including incidence of hydroallantois and aberrant limb formation [124] Fetal [125, 126] and birth weight [124, 127, 128] are increased in IVP offspring, which coincides with higher rates of dystocia in recipients of IVP embryos [124, 127] Calves born from IVP embryos are also more likely to be born dead within the first 24 hours [129] or 20 days of life [120] Disorders in development cau sed by IVP are not unique to cattle. In humans, IVP embryos have increased incidence of chromosomal abnormalities [130] implantation failure [131] loss of DNA methylation imprinting [87] abnormal cell division, cell allocation, cell death and embryonic arrest and death [132] In the pig, IVP embryos also have decreased cell numbers [133] over 588 differentially expressed genes (DEG) [133] and aberrant ultrastructure including nucleoli located outside of the nuclear membrane and malformed sm ooth endoplasmic reticulum [134] Mouse IVP embryos also have differential gene expression [135] and abnormal methylation at imprinted genes [136] Consequences of being derived from an IVP embryo can persist into adulthood. This question has not been well examined in the cow but there is evidence for this idea from other species. Mice born from IVP em bryos have increased blood pressure at 21 weeks of age [13] while children between the ages of 8 18 years old born from IVP embryos have increased blood pressure and blood glucose levels [137] Sheep produced from IVP embryos are heavier by day 61 after birth and several major organs ar e larger in size than for offspring produced in vivo [138]

PAGE 33

33 Alterations in Ma ternal Function An additional line of experimentation to evaluate the importance of the reproductive tract environment for development of the embryo is to evaluate how changes in oviductal or uterine function during the preimplantation period affects embr yonic development. Experiments described here indicate that alterations in the endocrine regulation of the reproductive tract by exogenous administration of hormones like progesterone and somatotropin can increase embryonic growth and the likelihood that t he embryo will establish pregnancy. Other influences on the reproductive tract, in particular lactation, can alter the reproductive tract in a way that is detrimental to the developing embryo. Supplemental Progesterone The presence of progesterone dur ing preimplantation embryo development modulates fertility and elongation of the bovine embryo. The importance of the reproductive tract for regulating embryonic development can be observed by evaluating the consequences of hastening the post ovulation ri se in progesterone by providing supplemental progesterone. Cows receiving supplemental progesterone on Days 1, 2, 3 and 4 of pregnancy have embryos which are developmentally advanced at Day 14 [139] larger in size and have premature IFNT secretion [57, 140] The mechanism of action is unknown, but is likely to involve changes in characteristics of the uterine secretome. Forde et al. (2009) conducted a study where pregnant heifers received either an intravaginal device releasing either high or normal amounts of progesterone on day 3 after insemination [141] Tissue was collected from the endometrium on days 5, 7, 13 or 16 of preg nancy and submitted to microarray analysis. On day 5 compared to day 7, heifers that received high progesterone had

PAGE 34

34 more DEG (36 and 124 respectively) than on day 13 and 16, where heifers that received high progesterone had only 15 and 25 DEG respectively. The effects of higher progesterone were greater early in the cycle, when differences in progesterone between supplemented cows and normal progesterone cows would be greater than at later days of the cycle. Endometrial tissue collected from high progester one heifers at day 5 had increased expression of genes associated with triglyceride synthesis and glucose transport. One gene that improves glucose secretion, MSTN increased with high progesterone treatment. These studies suggest that embryo development is not increased by progesterone, but that the timeline of development can be shifted by supplemental progesterone so that embryos reach developmental milestones earlier. Somatotropin Another hormone that can improve the competence of the reproductive tract to support embryonic development is somatotropin. Bovine somatotropin (bST) increases the systemic and liver production of IGF1, leading to increased milk production [142] I njections of bST improve pregnancy rates in lactating cows t hat act as embryo transfer recipients [143] An experiment by Ribeiro et al. (2014) showed that injection of bST on day 0 and 14 following artificial insemination enhanced development of the embryo by increasing embryonic size at day 34 and 48, decreasing embryonic loss betw een day 31 and 66, increasing the number of pregnant cows at day 66 and increasing the number of live calves at birth [144] The increase in embryonic size was also correlated with an increase in expression of ISG15 and RTP4 at day 31 and 66, both of which are markers of IFNT action [145, 146]

PAGE 35

35 Lactation The process of lactation can alter the reproductive tract environment in a way that compromises embryonic development One reason lactating cows have decreased embryonic development during this time is due to corresponding low circulating progesterone levels [147] Ge ne expression in the endometrium differs between la ctating and non lactating cows at day 17 after estrus in cyclic and pregnant cows [148] Several of the upregulated genes in the endometrium of the lactating cow are involved in immune respon se and the WNT pathway [148] Tha t these changes in endometrial function compromise embryonic development is indicated by results of embryo transfer experiments. Fewer embryos develop to the blastocyst stage w hen two to four cell embryos were transferred into the oviduct of lactating cow s then when transferred into the oviducts of non lactating cows [9] Moreover, pregnancy rates were lower in lactating rec ipients when embryo transfer was done at Day 7 after estrus [149 151] Developmental Programming Th e idea that maternal en vironment can change the characteristics of development in a way that affects adult physiology and health is today often called the Barker hypothesis This term refers to the scientist who first noted this phenomenon while studying epidemiological data fr om adults who were fetuses during the World War II Dutch famine crisis of 1944 1945 [152, 153] C aloric intake in Netherlands during that winter was ve ry low ( around 400 800 kcal/d) because of the combination of a harsh winter and blockade of food delivery by Nazi Germany [152] A study of middle aged adults in the 1990s that were in utero during th e famine revealed a variety of change s in physiology as compared to cohorts born before and after the famine. These changes

PAGE 36

36 included increased circulating concentrations of glucose [154] high body mass index [155] reduced plasma concentrations of factor VII and higher plasma concentrations of fibrinogen [ 156] Since these studies, other epidemiological studies in humans suggest the importance of nutrition as a programmer of development. For example, a dults from mothers that consumed less protein during pregnancy ha d higher blood pressure than those who had a balanced diet [157] Additionally, mothers that ingested less folic acid during embryonic development had offspring with an increase rate of congenital malformations due to defects in the formation of the neur al tube [158] Experimental studies in both laboratory and farm animals have confirmed the role of prenatal nutrition as a determinant of physiology of the mature anima l. R ats fed a low protein diet during pregnancy had fewer offspring and those offspring had hypertension at 4 weeks of age [159] In addition, offspring from rat mothers that were malnourished during prenatal development had insulinpenia due to a redu ction in beta cells [160] and increased rates of hyperphagia [161] Caloric restriction from day 28 78 of gestation resulted in offspring who as six year adults had decreased insulin sensitivity, increased body weight an d higher feed consumption than sheep from control mothers [162] Besides nutrition, dehydration, psychological stress and heat stress that are imposed on the mother can also affect developmental programming of the mature animal. Sheep that were exposed to hypernatremia from days 11 0 150 in utero had offspring with higher plasma osmolality, sodium levels and arterial blood pressure as neonates [163] Rhesus monkey mothers that were exposed to unpredictable audible noise from day 90 145 following conception had offspring with higher levels of

PAGE 37

37 circulating ACTH and cortisol as juveniles [164] Pigs that were exposed to heat stress in utero whiles fetuses regulated body temperature at a higher set point as adults than pigs from non stressed mothers [165] Developmental programing can occur very early during pregnancy including in the preimplantation period. Rat mothers that were fed a low protein diet (9% casein) from fert ilization until day 4.25 of gestation had offspring that weighed more at week 4 7 following birth than offspring of mothers fed a control diet (18% casein) [15] In sheep, feeding dams a diet deficient in cobalt and sulfur from 30 days before conception through 6 days following conception resulted in offspring with higher body weight and fat content as adults than control offspring [16] Similar finding were found in mice [13] One characteristic of developmental programming is that the effec t can vary with sex In one experiment in the rat, four types of offspring were examined at 110 days after birth 1) from mothers fed low protein (10% casein) during pregnancy and lactation, 2) from mothers fed low protein during pregnancy but a normal diet (20% casein) during lactation, 3) from mothers fed normal casein during pregnancy but low protein during lactation and 4) from mothers fed normal protein throughout pregnancy and lactation [166] Males but not female offspring from mothers fed low protein during pregnan cy and a normal diet during lactation had insulin resistance compared to controls. In another experiment, baboon mothers fed a 30% maternal nutrient restricted diet had male fetuses at mid gestation with increased renal expression of AT 1 compared to males from control mothers while there was no change in expression for female offspring [167] In sheep restricted to 50% of their normal nutrient intake during early to

PAGE 38

38 mid gestation, there was a reduction in renal glomerulus numbers at gestational da y 135 in male fetuses but did not affect female fetuses [168] Sexual dimorphism in developmental programming also occurs during the preimplantation period. F emale offspring from rats that were fed a low protein (9% casein) diet from day 0 4.25 after mating followed by a normal protein diet for the rest of gestation weighed less at birth than female offspring fed a normal protein (18% casein) diet, while male offspring were not affected by the level of protein within the diet [15] On the other hand, while there was no effect in females, m ale pups from mothers fed a low protein diet also had increased syst olic blood pressure at weeks 4 and 11 of age and a higher kidney and lower liver weight compared to the male pups fed the control diet [15] Female mouse offspring that were from mothers restricted to a low protein diet during preimplantation development had higher expression of Igf1r in the retroperitoneal fat tissue at 1 year of age compared to females from mothers fed a normal pr otein diet; In males, however, there was no effect of protein restriction on Igf1r expression [14] Male mouse offspring born to mothers that were fed a low protein diet (9% casein) during the pre implantation period had elevated levels of lung angiotensin converting enzyme in lung tissue compared to male offspr ing from control mothers while there was no effect of maternal diet on this characteristic in female offspring [17] In another model, designed to disrupt DNA methylation, rat mothers were fed m ethyl deficient diets that d id not contain folic acid from 3 weeks prior to and 5 days after conception At 6 months of age, male offspring from these mothers had higher concentratio ns of oral glucose than control male o ffspring while there was no difference

PAGE 39

39 in the female offspring [169] Additionally, sheep mothers that were fed a similar diet produced offspring with hypertension but only when the sex was male [16] CSF2 as an Embryokine Much of this literature review has focused on the evidence that the environment of the reproductive tract can affect competence of the preimplantation embryo for development and survival to term. What has not been discussed are the processes by which the reproductive tract affects embryonic development. The embryo receives all of its nutrition from the mother through reproductive tract secretions and blood plasma exudate. The nutritional components of uterine fluid are referred to as histotrop h. There are changes in the composition of the historoph during early pregnancy, including changes in amino acids ions, enzymes, hormones, growth factors, proteases and protease inhibitors, vitamins, glucose, mitogens, lymphokines and cytokines [170] In environment as well as providing the epithelial surface to which the embryo will attach during placentation. The reproductive tract also produces a variety of regulatory molecules that can affect either endometrial function, other aspects of maternal physiology or development of the embryo. These include enzymes required for converting cortisone into cortisol in the sheep [171] and cow [172] prostaglandins, especially prostaglandin F2 and E2 [173] and a variety of protein growth factors and cytokines. In th e cow, these include IGF2 IGFBP2 PTGER2 VEGFR2 and CST6 [174] Here we propose the use of the term embryokine to describe regulatory molecules produced by the reproductive tract that regulate embryonic develop ment. Several embryokines have been identified that can alter one or more aspects of

PAGE 40

40 preimplantation development. In the cow, these include hyaluronan [21] IGF1 [19] FGF2 [22] LIF [20] TGFB [20] and ILB1 [23] Role of Colony S ti mulating F actor 2 as an Embryokine Many molecules originally identified as being important for immune function have since been shown to be produced in the reproductive tract where they could either be involved in regulation of immune function in the uteru s or play a role independent of regulation of immune function. The best studied reproductive tract embryokine with respect to regulation of embryonic development is CSF2. CSF2 is a glycosylated, monomeric 23 kDa cytokine that was originally described as a produc t of T lymphocytes and macrophages, which causes differentiation of granulocytes and macrophages from hematopoietic stem cells [175 177] CSF2 is also synthesized by fibroblasts [178] As will be described in detail below, CSF2 is also produced by epithelial and stromal cells of the endometrium [27, 179, 180] Signal Transduction CSF2 binds to CSF2R and signals through the JAK2 STAT5ab pathway or the phosphatidylinositol 3 kinase kinase (PI3K) pathway. Initiation of CSF2 binding begins first with the attachment of the protein to the trans membrane receptor colony stimulating facto r alpha (CSF2R A ). First described as a protein with 56% homology to IL 3 by Hayashida in 1990, CSF2R A is an 80 kDa, low affinity receptor that is specific to CSF2 [181, 182] CSF2R A is capable of binding to CSF2 with a dissociation constant of 2 8 nM [182] There are indications that CSF2 can signal through interactions wit h CSFRA alone [183, 184] but the typical signal transduction involves recruitment of the CSF2R B subunit to the CSF2 CSF2RA complex, which increases the affinity of the receptor to a dissociation constant to 170 pM [181] The 120 140 kDa CSF2R B subunit

PAGE 41

41 is not specific to CS F2Ra but also serves as part of the receptor complex for IL 3 and IL 5 [181, 182] In response to CSF2R B binding, CSF2RA expression is downregulated [185] CSF2R A is expressed in the mouse, human, bovine and porcine embryos [186 189] Upon binding to CSF2, t he CSF2R complex activates Janus kinase (JAK) 2 which in turn causes activation of signal transducer and activator of transcription (STAT) 5 A and B and other Src homology 2 domain containing proteins [181, 190, 191] JAK2 associates with the CSF2R B subunit where it is activated and subsequently phosphorylates tyrosine sites located on the CSF2R B subunit [190, 192] Phosphorylation of Y612, Y695 and Y750 of CSF2R B subunit allow for binding of STAT1 and STAT5, with STAT5 being the most critical for CSF2 [191] Production of CSF2 by the Reproductive Tract CSF2 has been localized immunochemically to the oviduct and endometrium of the human [29] c ow [27] pig [193] and mouse [194] In the mouse, CSF2 protein has been localized to glandular and luminal epithelial cells, while the contribution from th e stroma is minimal; intensity of labeling increases following the post ovulatory increase in estrogen [28] which stimulates the secretion of CSF2 while progesterone inhibits it [194] Mating can increase the release of CSF2 into uterine fluid through the actions of TGF B contained in the seminal fluid [33] In addition, expression of CSF2 in the oviduct is also decreased following mating with males whose seminal vesicle gland was surgically impaired [32] In the human, luminal and glandular epithelium of the endometri um and stroma express CSF2 mRNA and protein [195] Glandular epithelial cells have the highest level of protein and mRNA expression [29, 180] Secretion of CSF2 from luminal and

PAGE 42

42 glandular epithelial cells is highest during the mid secretory phase of the menstrual cycle bef ore decreasing during the proliferative phase [195] However, CSF2 is present in significantly large quantities in the decidua throughout the first trimester of pregnancy compared to non pregnant decidua [196] In the cow, CSF2 can be localized immunochemically to the luminal and glandular epithelium and stroma [27, 197] The majority of CSF2 is localized to the luminal epithelium [27] Although not significant, immunoreactive CSF2 in the endometrium during the estrous cycle had low amounts of CSF2 at estrus (when progesterone concentrations are low) compared to days 7 18 of the estrous cycle [27] Therefore, it appears that CSF2 secretion in the cow could be under the control of progesterone [27] Another molecule that can modify maternal production o f CSF2 in the uterus in ruminant is IFNT. Transcervical infusions of IFNT into the uterine body increased amounts of CSF2 in the luminal epithelium [197] The level of obesity of the cow also determines CSF2 immunoreactivity and CSF2 mRNA expression in the ampulla: it was suppressed in the oviduct of obese cows compared to lean cows on the second day following ovulation [34] Actions on the Preimplantation Embryo The first observed action of CSF2 on the preimplantation embryo was an increase in the proportion of cultured embryos that could develop to the blastocyst stage. Such a phenomenon has been observed in the cow [18, 24] pig [189, 198, 199] mouse [26] and human [200] The mechanism for the increased competence of embryos to develop to the blastocyst stage is not known. However, in both the mouse blastocyst [187] and cow morula [31] CSF2 alters expression of genes in a way that

PAGE 43

43 would block apoptosis. In the mouse, for example, CSF2 decreased expression and abundance of genes involved in stress response and apoptosis, such as Hspa5 Hsp90aa1 Hsp90ab1 and Gas5 and proteins HSP1A/1B and BAX In cattle, CSF2 increased transcript abundance of several anti apoptotic genes, such as CD73/NT5E PRKAR2B and PGR and decreased the abundance of pro apoptotic genes such as MADD RIPK3 NOD2 and CREM [31] Furthermore, treatment with CSF2 also decrease d the magnitude of apoptosis in the bovine embryo after expos ure to heat stress [31] In addition, t reatment with CSF2 prior to freezing improve d post thaw survival of mouse embryos while preventing apoptosis [187, 201] Thus, CSF2 may increase competence for development to the blastocyst stage through inhibition of apoptosis. CSF2 could also act by changing expression of genes involved in development. Among the genes whose expression was altered in the bovine morula were g enes associated with neurogene sis, muscle formation, mesenchyme formation and multiple signaling pathways [31] In the pig, CSF2 altered gene expression in cloned embryos with increases in e xpression of LIF CDX2 POU5F1 B CL2 D NMT1 and PCNA [198, 199] In cattle, CSF2 can increase the blastocyst yield regardless of whether it is added after fertilization or if addition is delayed until day 5 of development [18, 24] Therefore, actions of CSF2 probably occur in later cleavage stages and after embryonic gene activation has occurred. Not only does CSF2 increase blastocyst yield but also embryos cultured with CSF2 have increased likelihood of establishing pregnancy after transfer to recipients. In the mouse, the addition of 2 ng/ml recombinant murine CSF2 to cultured embryos of

PAGE 44

44 that we re subsequently transferred to recipients resulted in increased litter size and more viable progeny compared pregnancies after transfer of control embryos in culture [26] In the c ow pregnancy rate and calving rate was higher for recipients receiving an in vitro produced embryos cultured with 10 ng/ml CSF2 from day 5 7 of development (43% and 37% respectively ) than cows that received control embryos (34% and 23%) [18] The effect of CSF2 was only seen when added during days 5 7 of development. Embryos cultured with CSF2 from days 1 7 did not have superior ability to survive transfer (35% vs. 35% for controls). An interesting observation was that CSF2 also reduced the loss of pregnancies occurring after initial pregnancy diagnosis at Day 30 35 of gestation. Pregnancy losses were 22% for control embryos, 11% for embryos treated with CSF2 from Day 5 7 and 0% for embryos cultured from Day 1 7. [18] Recently, a similar beneficial effect of CSF2 on embryo competence for survival after transfer was seen in humans. Treatment of embryos with 2 ng/ml CSF2 throughout culture increased survival compared to controls at week 7 (23.5% vs. 20%) and 12 of gestation (23% vs. 18.7%) as well as live births (28.9% vs. 24.1%) [25] The ongoing implantation rate in women that previously had one or more miscarriages was also greater if the embryo transferred had been cultur ed with CSF2 [25] The change in the embryo responsible for increased competence to establish pregnancy is not clear. O ne possibility is that CSF2 increases number of cells in the blastocyst, particularly the ICM, and that these increased numbers make the embryo better able to survive transfer. Culture of mouse embryos with CSF2 resulted in blastocysts that contained 15 mo re cells than control blastocysts [186] When 2 cell stage embryos were split and allowed to develop to the blastocyst stage, diameter and

PAGE 45

45 number of cells of th e blastocyst were increased by CSF2 [202] In the pig, as well, CSF2 improved total cell number in blastocysts [199] In both the human [187] and cow [18] number of cells in the ICM of blastocysts was increased by CSF2. There was also a reduction in the number of cells undergoing apoptosis in h uman blastocysts treated with CSF2 [187] There is also evidence that treatment with CSF2 can alter the developmental program of the embryo at a later stage of pregnancy. In one experiment, bovine embryos were treated with CSF2 from d ays 5 7 of development, transferred into cows and then recovered at day 15 of development. Embryos that had been treated with CSF2 had increased expression of IFNT2 and KRT18 increased IFNT2 secretion into the uterine lumen and tended to have increase d length [30] Not all studies with CSF2 indicate positive effects of the molecule on embryonic development. In the one study, the addition of 2, 5, 10 or 50 ng/ml of ovine CSF2 to cultured bovine embryos did not improve the number of blastocysts that developed at day 7 after fertilization [203] In a similar experiment, ovine embryos cultured in the presence of CSF2 did not reach the blastocyst stage at a rate higher than that of control embryos. In the mouse, addition of either 5 or 10 ng/ml CSF2 decrease d the proportion of em bryos that develop ed to the blastocyst stage and although not significant, tended to increase the rate of aneuploidy [204] Characteristi cs of the CSF2R in the Preimplantation E mbryo Although CSF2 can affect embryonic function in a variety of species, it may exert its actions through a cell signaling mechanism that is distinct from the prototypical signal transduction pathway initiated by the CSF2RA CSF2RB complex. This is because, as has been shown for human and mouse the preimplantation embryo express es

PAGE 46

46 CSF2RA but not CSF2RB [186, 187] In the pig, embryo s at the blastocyst cell stage express CSF2R B, but transcript abundance is very low compared to that for CSF2RA [189] Other pathways can b e activated following the binding of CSF2 to receptor, such as the MAPK and the PI3K pathway [191, 205, 206] When CSF2 signaling through PI3K occurs, the regulatory subunit of PI3K (p85), which is bound to CSFRA through its C SH2 domain, is phosphorylated and activates PI3K [183] CSF2 signaling is blocked in Day 12 porcine TE cells when treated with the PI3K inhibitor LY294002 [206] One possibility is that CSF2RB protein is present on the plasma membrane of embryonic cells despite lack of mRNA. This could be the case because bovine oocytes contain CSF2R B in trace amounts [188, 189] and some protein that was synthesized by the oocyte could persist after fertilization Goals of the Current Investigation The aim of this dissertation is to understand the mechanisms responsible for specific actions of a maternally derived cytokine, CS F2 on development of the preimplantation bovine embryo. In cattle, CSF2 treatment from day 5 7 of development can increase the proportion of embryos becoming a blastocyst, alter gene expression, decrease apoptosis, increase ICM number, program the embryo to have altered gene expression and increased trophoblast elongation at day 15 of gestation, and increase competence of the embryo to maintain pregnancy to term [18, 24, 30, 31] This dissertation is focused on understanding key aspects of the biology of some of these effects of CSF2 as follows: In C hapter 2, experiments will be described that det ermine whether CSF2 regulates survival and pluripotency of the ICM or the growth potential and differentiation

PAGE 47

47 of the TE. The mechanism by which CSF2 improves the ability of a blastocyst to establish pregnancy is unknown, but evidence exists that CSF2 aff ects lineage commitment of the ICM and TE of the blastocyst in addition to altering expression of pluripotency and differentiation related genes [18, 31] In Chapter 3, the na ture of the developmental programming of CSF2 to alter trophoblast elongation and gene expression at day 15 [30] will be elucidated. In particular, it will be tested whether CSF2 from day 5 7 alters the transcriptome and methylome at day 15. In addition, an unexpected finding will be described that indicates the nature of developmental programming by CSF2 depends upon sex i.e., CSF2 causes different and often opposite effects in female embryos than male embryos. In Chapter 4, the developmental pattern of DNA methylation in the preimplantation embryo will be described as well as possible alterations in the global methylom e by CSF2 and sex that could form the basis for sexual dimorphism in response to CSF2 seen in Chapter 3.

PAGE 48

48 CHAPTER 2 REGULATION OF PLURIPOTENCY OF INNER CELL MASS AND GROWTH AND DIFFERENTIATION OF TROPHECTODERM OF THE BOVINE EMBRYO BY COLONY STIMULATING F ACTOR 2 Introduction Communication between the preimplantation mammalian embryo and reproductive tract of the mother is important for ability of the embryo to develop into a blastocyst with the ability to develop to term. Even though embryos can become bl astocysts in vitro, they have reduced competence for establishing pregnancy when transferred to recipient females than embryos that developed in vivo [26, 207, 208] Growth factors and cytokines are important components of the embryotropi c milieu of the reproductive tract. Addition of specific growth factors present in the reproductive tract to culture medium can improve the proportion of embryos that develop to the blastocyst stage. Examples in the cow include activin A, EGF, FGF2, IGF1, IGF2, IL1B, and LIF [20, 22, 23, 209 211] Moreover, competence of in v itro produced embryos to establish pregnancy after transfer into females can be improved by LIF and TGFB in the mouse [212 214] and IGF1 in the cow (when recipients were heat stressed) [129, 215] Perhaps the best studied maternally derived cytokine that regulates embryonic development is CSF2. Secreted by the oviduct and endometrium [27, 29, 34] CSF2 can increase the proportion of embryos developing to the blastocyst stage in the cow [18, 24] pig [189, 198, 199] mouse [26] and human [200] Moreover, CSF2 increased the proportion of in vitro produced embryos that established pregnancy after transfer into mice [26] cows [18] and humans [25] That variations in CSF2 signaling might be a cause of female infertility is sugg ested by the recent observation that CSF2 synthesis in the oviduct is decreased in obese cows [34]

PAGE 49

49 The mechanism by which CSF2 improves the ability of a blastocyst to establish pregnancy is not known but there is evidence for the hypothesis that CSF2 affects lineage commitment in both the ICM and TE of the blastocyst. Treatment of embryos with CSF2 at Day 5 post insemination altered expression of several genes involved in pluripotency and differentiation [31] In addition, CSF2 increased the number of ICM cells in the bovine blastocyst at Day 7 post insemination without affecting number of TE cells [18] At Day 15, the trophoblast of conceptuses formed following treatment with CSF2 from Day 5 7 post insemination had higher expression of the maternal signaling gene IFNT2 and tended to be numerically gre ater in length than control embryos [30] Some actions of CSF2 on embryo survival could be the result of regulation of apoptosis pathways because CSF2 affects expression of genes involved in apoptosis in both cattle [31] and mice [216] and can block the induction of apoptosis caused by heat shock in cattle [31] In most cells, CSF2 signaling is accomplished through a cell surface receptor composed of a low affinity subunit (CSF2RA) and a high affinity subunit (CSF2RB) [217] CSF2RA is a low affinity receptor specific for CSF2 while CSF2RB, which is involved in signaling for several cytokines, confers increased affinity of the receptor complex to the ligand [181] C SF2RA is expressed in preimplantation mouse, pig and human embryos but expression of CSF2RB is undetectable or nearly so [186, 187, 189] These observations suggest that CSF2 signaling in the embryo involves an unknown pathway that is independent of CSF2RB. The major objective of this study was to determine whether CSF2 could regulate survival and pluripotency of the ICM and growth potential and differentiation of TE. To

PAGE 50

50 examine pluripotency, we utilized a model to evaluate ability of isolated ICM to remain pluripotent while being cultured and passaged on a layer of fetal fibroblasts in the presence of MAPK1 and GSKB inhibitors [218] It was also tested whether CSF2 regulated expression of genes involved in pluripotency ( NANOG and SOX2 [46, 219] ), differentiation of TE ( CDX2 [46] ) and formation o f hypoblast ( GATA6 [46] ) in isolated ICM. TE growth and differentiation was assessed in a model of TE outgrowth on Matrigel coated plates [220] It was also determined whether both CSF2RA and CSF2RB were expressed by the preimplantation embryo from the zygote to blastocyst stage. Materials and M ethods Embryo P roduction IVP of bovine embryos was performed as previously described [22] unless otherwise noted. Bri efly, COCs were obtained by cutting the surface of slaughterhouse derived ovaries with a scalpel and vigorously rinsing the ovary through a bath of oocyte collection medium [tissue culture medium (Hyclone, Logan, UT, USA), 2 % (v/v) bovine steer serum (Pel Freez, Rogers, AR), 2 U/ml heparin, 100 U/ml penicillin G, 0.1 mg/ml streptomycin and 1mM glutamine]. culture medium s (Invitrogen, Carlsbad, CA, USA), 10% (v/v) bovine steer serum, 2 g/ml estradiol 17 g/ml bovine follicle stimulating hormone (Bioniche Life Sciences, Belleville, Ontario, Canada), 22 g/ml sodium pyruvate, 50 g/ml gentamicin sulfate and 1 mM glut amine] covered with mineral oil for 20 hours at 38.5 o C and in a humidified atmosphere of 5% (v/v) CO 2 Up to 300 matured oocytes

PAGE 51

51 were fertilized with Percoll purified sperm (1.0 x 10 6 /ml) for 8 hours at 38.5C in 1.7 ml of synthetic oviductal fluid fertil ization ( SOF FERT ) [221] Cumulus cells were denuded after fertilization by vortexing in 600 TALP containing 1 ,000 U/ml hyaluronidase. Putative zygotes were then cultured in 50 l microdrops of synthetic oviduct fluid bovine embryo 1 (SOF BE1) [22] covered with mineral oil at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% (v/v) CO 2 with the balance N 2 Cleavage rate was assessed at Day 3 post insemination. Blastocysts were harvested at Day 7 or 8 post insemination. Effect o f CSF2 on Survival o f Isolated Inner Cell Mass Bovine fetal fibroblast feeder c ells Culture on bovine fetal fibroblasts prevent isolated ICM from losing pluripotency and undergoing differentiation [218] Bovine fetal fibroblast (BFF) cells were created from fetal calf skin (~2 3 months old). Pieces of fetal calf skin (~1 cm 3 ) were cut from the mediolateral region of the body an phosphate buffered saline (DPBS) with 1% (v/v) antibiotic antimycotic [10000 U/ml (Invitrogen). Rinsed fetal calf skin was then placed onto 60 mm petri dishes (BD Falcon, Franklin Lake, NJ, USA), cut into 5 mm x 5 mm square pieces, and placed onto scored areas of a new 60 mm petri dish containing 10 ml of a medium consisting of a nvitrogen) containing 10% (v/v) fetal bovine serum [FBS] (Atlanta Biologicals, Norcross, GA, USA) and 1% (v/v) ABAM. On Day 4 after culture, skin pieces were removed from the plate using tweezers. Cells were passaged by removal of medium by aspiration, w ashing twice with DPBS containing 1% (v/v) ABAM, and trypsinization by addition of 5 ml 0.05% (v/v) trypsin with

PAGE 52

52 0.38 mg/ml ethylenediamine tetraacetic acid (EDTA) (Invitrogen) and incubation at 38.5C and 5% (v/v) CO 2 in air for 3 min. Trypsin was inhibi ted by addition of 1.5 ml FBS. Cells were centrifuged for 5 min at 250 x g, supernatant removed and cells resuspended with 25 ml modified DMEM. Cells were then transferred into a 175 cm 2 flask and cultured until confluent. Medium was changed every two d ays until 90 100% confluence was reached. Cells were then trypsinized and passaged at a 1:4 dilution. For culture of ICM, BFF cells at 90% confluence were treated twice, for 3 hours each, with 10 g/ml mitomycin C (Invitrogen) at 38.5 o C in a humidified a tmosphere of 5% (v/v) CO 2 in air. After three washes in medium, cells were cultured overnight, washed with DPBS with 1% (v/v) ABAM, trypsinized as described above, washed, collected by centrifugation for 5 min at 250 x g, and resuspended to 1.5 x 10 6 cell s/ml in modified DMEM that also included 10% (v/v) dimeth yl sulfoxide (DMSO) (Sigma Aldrich, St. Louis, MO, USA). Cells were frozen in liquid nitrogen in 1 ml aliquots until further use. Isolation o f ICM by lysis of trophectoderm using antibody and compl ement via immunosurgery Procedures were modified from those described by Ozawa et al. [218] Blastocysts were washed three times in DPBS containing 1% (w/v) polyvinylpyrrolidone (PVP ) (Kodak, Rochester, NY, USA) (DPBS PVP), treated with 0.1% (w/v) proteinase solution (proteinase from Streptomyces griseus ) in DPBS to remove the zona pellucida, washed three times in DMEM (Invitrogen) with 1% (v/v) ABAM, washed twice in DMEM with 1% (v/v ) ABAM and 10% (v/v) rabbit anti bovine serum (Sigma Aldrich) and then incubated for 1.5 hours at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% (v/v) CO 2 with the balance N 2 Blastocysts were then washed three times in DMEM with

PAGE 53

53 1% (v/v) ABAM, w ashed twice in DMEM with 1% (v/v) ABAM and 20% (v/v) guinea pig complement (Rockland Immunochemicals Inc., Gilbertsville, PA, USA), and then incubated in the same medium for 1.5 hours at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% (v/v) CO 2 wit h the balance N 2 to lyse TE. Those ICM that were free of visible TE cells were washed three times in embryonic stem cell medium (ESM) consisting of knockout DMEM (Invitrogen) with 15% (v/v) knockout serum replacement (Invitrogen), 1 mM Glutamax (Sigma Aldrich), 1% (v/v) ABAM, 0.1 mM minimal mercaptoethanol. Isolated ICM were then individually transferred into a single well of a 12 well plate (BD Falcon) coated 24 hours earlier with 1% (w/v) gelatin (BioRad, Hercules, CA, USA) and 2 x 10 4 cells/cm 2 mitomycin C treated fibroblasts in 1 ml of ESM+2i medium [ESM containing 3 inhibitor PD0325901 (Stemgent)]. These conditi ons were used because they promote maintenance of ICM in a pluripotent state [218] Culture o f isolated ICM Individual clusters of ICM cells (each from a single blastocyst) were cult ured at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% (v/v) CO 2 with the balance N 2 On Day 7 following ICM isolation, ICM colonies were passaged using a finely drawn glass needle to separate the ICM from any surrounding TE that remained and to d islodge the ICM outgrowth from the BFF layer. Individual ICM outgrowths were then transferred into a well of a new 12 well plate prepared with gelatin and mitomycin C inactivated BFF cells as previously described and cultured in 1 ml ESM+2i. Medium was c hanged and cells were passaged according to the same procedure above. For some IVP replicates (i.e, a group of embryos produced on a given day), culture was

PAGE 54

54 terminated 7 days after passage 1 while, in others, cells were passaged three times and cultures s topped at the end of passage 3. Experiments In the first experiment, all embryos were moved at Day 6 post insemination in groups of 30 to 50 l microdrops of either 1) 45 l SOF BE1and 5 l recombinant bovine CSF2 [Novartis, Basle, Switzerland; 100 ng/ml in a 90:10 (v/v) mixture of SOF BE1 and DPBS containing 1% (w/v) bovine serum albumin (BSA); final concentration of CSF2 after dilution in the drops = 10 ng/ml], 2) 45 l SOF BE1 and 5 l vehicle [90:10 SOF BE1: DPBS containing 1% (w/v) BSA; control treatm ent) or 3) 50 l ESM+2i. The concentration of CSF2 was chosen based on its effectiveness for increasing embryonic survival after transfer into recipient females [18] The ESM 2i medium was used as a positive control for survival of ICM colonies because it had previously been reported to enhance survival of ICM colonies when used to culture embryos from Day 6 8 post insemination [218] Embryos were harvested at Day 8 post insemination and ICM isolated and used for culture as described above. The experiment was replicated on 5 occasions with a total of 12 16 isolated ICM per treatment. In a second experiment, procedures were similar except all embryo s were harvested on Day 5 post insemination and cultured with treatments from Day 5 to 7 post insemination before ICM isolation. The experiment was replicated on 6 occasions with total experiments of 8 11 isolated ICM per treatment. Analysis o f ICM Coloni es Surviving Passage One colony derived from CSF2 treated Day 7 blastocysts was harvested 7 days after passage 3, placed in extraction buffer (Arcturus PicoPure RNA isolation kit, Life

PAGE 55

55 Technologies, Grand Island, NY, USA) and measured for steady state amo unts of NANOG, CDX2 and GAPDH by quantitative PCR (qPCR) as described below. Expression of Pluripotency Genes i n ICM All embryos were moved at Day 6 post insemination in groups of 30 to 50 l microdrops of either 45 l SOF BE1 and 5 l CSF2 (prepared a s described above to yield a final concentration of 10 ng/ml) or 45 l SOF BE1 and 5 l vehicle (control treatment). Blastocysts were harvested at Day 8 and ICM were isolated by immunosurgery on Day 8 post insemination as described above. ICM were immedia tely placed in extraction buffer (Life Technologies) and stored at 80C until ready for RNA extraction. RNA was extracted and used to measure steady state amounts of NANOG SOX2 CDX2 GATA6 and GAPDH For each replicate, a total of 3 5 ICM were pooled for an individual treatment. The experiment was replicated using a total of 7 9 pools per procedure. Actions o f CSF2 on Competence of Trophectoderm t o Form Outgrowths Establishment of o utgrowths The procedure for analysis of TE outgrowth was modified from that of Yang et al. [222] On Day 5 or 6 post insemination, all embryos in groups of 30 were moved to 50 l mic rodrops of either 45 l SOF BE1 and 5 l CSF2 (prepared as described above to a final concentration of 10 ng/ml) or 45 l SOF BE1 and 5 l vehicle (control treatment). After culture for 48 hours at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% ( v/v) CO 2 with the balance N 2 blastocysts were collected and transfe rred individually to wells of 96 well plates (BD Biosciences, Bedford, MA USA) that had been coated with Matrigel (Matrigel basement membrane matrix growth factor reduced; BD Biosciences). Embryos were cultured in 100 l of DMEM (Invitrogen) modified to contain 10% (v/v)

PAGE 56

56 FBS (Atlanta Biologicals), 1% (v/v) ABAM, 0.1 mM MEM nonessential amino acids and mercaptoethanol at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% (v/v) CO 2 with the balance N 2 After 5 6 d, medium was removed and replenished with fresh medium. At the end of culture, outgrowths were examined for size, labeling with anti CDX2, and gene expression. Immunolabeling of CDX2 All labeling steps were performed at room temperature unless otherwise stated and in a volume of 100 l in the wells in which outgrowths were established. Attached TE outgrowths were washed in DPBS PVP and fixed in 4% (w/v) paraformaldehyde in DPBS PVP for 15 min. The fixed outgrowths we re washed three times in DPBS PVP, permeabilized for 20 min in DPBS containing 0.25% Triton X 100 and washed three times in 0.1% (v/v) Tween 20 with wash buffer [DPBS containing 10 mg/ml fraction V BSA (Sigma Aldrich)] followed by three washes with wash bu ffer. For immunolabeling, nonspecific binding sites were blocked by incubation with DPBS containing 5 mg/ml BSA for 1 h. Outgrowths were incubated with affinity purified mouse monoclonal antibody against CDX2 (ready to use solution; BioGenex, San Ramon, C A, USA). As a negative control, anti CDX2 was replac ed with an irrelevant mouse IgG antibody (Sigma Aldrich, St. Louis, MO, USA). After 1 h, outgrowths were washed three times in anti mouse IgG (Abcam, Cambridge, MA, USA). After three washes, nuclei were labeled by incubation in 5 g/ml Hoechst 33342 (Sigma Aldrich) in DPBS PVP for 15 min. Outgrowths were washed three times and mounted using ProLong Gold Anti Fade mounting mediu m (Invitrogen) and observed under a Zeiss Axioplan epifluorescence microscope (Zeiss, Gttingen, Germany). Images were acquired using a 40x objective

PAGE 57

57 and green and blue filters. The exposure times were constant for all outgrowths analyzed in an individua l replicate. Assessment of establishment and growth o f trophectoderm outgrowths The ability of embryos to attach to the Matrigel coated well was determined for each IVP replicate as the fraction and percent of embryos that remained attached to the well after aspiration of medium at Day 13 or 15 post insemination. Similarly capacity f or formation of TE outgrowths was calculated within IVP replicate as the percent of blastocysts in which outgrowth could be observed microscopically at either Day 13 or 15 post insemination. Outgrowth surface area was determined with the aid of a microscop e graticule at 40x magnification. Gene e xpression At Day 15 post insemination, steady state expression of CDX2 and GATA6 was determined for a subset of TE outgrowths. Medium was removed, cells washed three times with DPBS (Applied Biosystems, Invitrogen) and pipetting multiple times. For each replicate, pools of 2 10 TE outgrowths were prepared. The total number of repl icates varied from 6 7 depending on the experiment. RNA extraction, DNase treatment and reverse transcription were completed as described below. Antiviral a ssay The ability of samples of conditioned medium to inhibit vesicular stomatitis virus induced d eath of Madin Darby bovine kidney cells by 50% was compared with the activity of recombinant human IFNA standard (3.84x10 8 IU antiviral activity/mg protein; (Millipore, Billerica, MA, USA) using a previously described assay [222] Assay sensitivity was 2.6 pg of IFNA standard. The antiviral activity of conditioned medium

PAGE 58

58 was adjusted based on this standard to represent the IU activity per mm 2 of cell outgrowth. Experim ents A total of 4 experiments were conducted. In two experiments, embryos were treated with 10 ng/ml CSF2 or control from Day 6 to 8 post insemination. This time interval was chosen because CSF2 treatment during this time increased capacity of the ICM to survive culture after isolation from the TE (See Results). In two experiments, embryos were cultured from Day 5 to 7 post insemination. This time interval was chosen because CSF2 treatment during this time increased competence of embryos to survive after transfer to females [18] For each treatment period, one experiment was conducted in which outgrowths were examined at Day 13 post insemination (i.e., 5 6 days after culture on Matrigel) and one experiment was cond ucted in which outgrowths were examined at Day 15 post insemination (i.e., 7 8 days after culture). We examined two separate culture periods because of the possibility that effects of CSF2 on TE characteristics would depend on duration of culture. Each exp eriment was performed with 7 15 IVP replicates containing 2 26 embryos per treatment for each replicate. The replication is described in Table 2 1. Expression o f CSF2 Receptor Subunit Genes Analysis of gene expression was performed by qPCR using five p ools of RNA extracted from 25 30 embryos/pool at the zygote (0 hpi), 2 cell (32 40 hpi), 3 4 cell, 5 8 cell (48 hpi), 9 16 cell (72 hpi), morula (120 hpi) and blastocyst (168 hpi) stages. Zona pellucidae were removed and oocytes and embryos processed for RNA extraction, DNase treatment and reverse transcription as described below. To verify effectiveness

PAGE 59

59 of primers, total RNA was also extracted from leukocytes collected from a saphenous vessel of a Holstein cow. Quantitative PCR Total RNA was extracted us ing the PicoPure RNA isolation kit (Life Technologies), treated with 2 U of DNase (New England Biolabs, Ipswich, MA, USA) at 37C for 30 min to remove DNA, and then incubated at 75C for 15 min to denature DNase. DNase treated RNA was then reverse transcr ibed using the High Capacity cDNA Reverse Transcription Kit (Invitrogen). Reverse transcription occurred using random hexamer primers and involved incubation at 25C for 10 min, 37C for 120 min and 85C for 5 min. The cDNA was stored at 20C until furt her use. Negative controls for real time PCR were also performed by incubation without reverse transcriptase. cDNA was utilized for real time PCR analysis. For detection of transcript levels, a CFX96 Real Time PCR detection System (Bio Rad, Hercules, CA, USA) was utilized with SsoFast EvaGreen Supermix with Low ROX (Bio Rad). Each reaction contained 1 Rad), 6.8 l H 2 O and 1.2 l cDNA sample (0.6 embryo equivalent). Amp lification conditions were: 95C for 30 sec, 40 cycles at 95C for 5 sec, 60C for 5 sec, and 1 cycle of melt curve analysis at 65 95C in increments of 0.5C every 2 sec. Primers for NANOG SOX2, CDX2, GATA6, SDHA, and YWHAZ were described and validated p reviously [218, 223] Primers for CSF2RA ACGCCGGCCTAAATGTGAAGTTTG AC GTGCACTGACACTCACTGTCTT XM_002686598.2) and CSF2RB TTCCCAAGAGCTGATGACATGGGT AGATGATGCGGCTGGTGTAGTCAT PrimerQuest (Integrated DNA Technologies, Coralville, IA, USA) and validated by

PAGE 60

60 evaluation of melt curves, demonstration of standard curves that exhibited a slope of between 3.0 to 3.5, analysis of amplicon size by agarose gel electrophoresis, and T value was determined by subtracting the C T value of the sample by the C T for GAPDH or for the experiment on CSF2RA and CSF2RB expression, by subtracting the C T value of sample by the geometric mean of the C T for three housekeeping genes, SDHA GAPDH and YWHAZ [224] Statistical A nalysis Most data were analyzed by least squares analysis of variance using the GLM procedure of the Statistical Analysis System (SAS) version 9.3 (SAS Institute Inc., Cary, NC, USA). The exception was for data on survival of ICM after passage, which was analyzed by the GLIMMIX procedure of SAS using the Binomial feature. Depending on the experiment, main effects included IVP replicate, stage, treatment and day of treatment. Interactions were also included. The IVP replicate was considered random. For real T values and graphed as either fold change (2 Ct ) relative T Data are shown as least squares means standard error of the means. For the experiments, a total of 62 IVP replicates were performed in which embryos were treated with CSF2 from Day 5 7 and 36 IVP replicates in which e mbryos were treated from Day 6 8. Statistical analysis was performed to determine whether response to CSF2 depended on the competence of control embryos in an individual IVP replicate to develop to the blastocyst stage. Each IVP replicate was classified a s to whether blastocyst development in the control group was within the lowest, middle or

PAGE 61

61 highest tercile of percent blastocyst. For Day 5 7, percent of oocytes that became blastocysts in the control group varied between 10.6 24.9% for the lowest tercile, 25.0 30.4% for the middle tercile and 30.6 46.8% for the highest tercile. For Day 6 8, ranges were 12.5 22.7%, 22.9 35.7% and 36.4 60% for the three terciles, respectively. Data were analyzed as described in the previous paragraph with the inclusion of bl astocyst development class (low, middle and high) and interactions with development class. Results Blastocyst D evelopment A total of 62 embryo culture procedures were performed in which embryos were cultured in the presence or absence of 10 ng/ml CSF2 fr om Day 5 to 7. There was no significant difference between treatments in the proportion of oocytes (i.e., putative zygotes) that became blastocysts at Day 7 post insemination (26.9% 0.7 for CSF2 vs. 28.3% 0.7 for control, P=0.16). However, the effect of CSF2 varied depending on the percent of oocytes that became blastocysts in the control group. In particular, when procedures were ranked according to percent blastocyst development in controls and classified into low, medium and high terciles, there w as an interaction between treatment and development class (P<0.0001). CSF2 increased the proportion of oocytes that became blastocysts in IVP replicates where blastocyst development in the control group was in the lowest tercile, had no effect for IVP rep licates in the middle tercile and had negative effects on development when IVP replicates were in the highest tercil e (Figure 2 1 A). Moreover, the correlation between the percent of oocytes that became blastocysts in the control group and the deviation in percent blastocyst caused by CSF2 was 0.53 (P<0.0001).

PAGE 62

62 A total of 36 embryo culture procedures were performed in which embryos were cultured + 10 ng/ml CSF2 from Day 6 to 8. There was no significant difference between treatments in the percent of oocytes that became blastocysts at Day 8 post insemination (30.8% 1.3 for CSF2 vs. 30.1% 1.3 for control, P=0.69) and no interaction between CSF2 treatment and development class. Nonetheless, there was a correlation of 0.37 between the percent of oocytes th at became blastocysts in the control group and the deviation in percent blastocyst caused by CSF2 (P=0.026 ) ( Figure 2 1B Effect of CSF2 on Survival of I solated ICM Previously, it was shown that a proportion of ICM isolated from blastocysts could be maintained in a pluripotent state when cultured on mitocmyin C treated fetal fibroblasts in the presence of the GSKB inhibitor CHIR99021 and the MEK1 inhibitor PD0325901 [218] Here we tested whether exposure of embryos during the 32 cell to blastocyst stages of development to CSF2 could improve the rate at which isolated ICM persisted in a pluripotent state after repeated passage. In the first experiment, embryos were treated from Day 6 to 8 post insemination with either control, CSF2 or ESM+2i. The lattermost treatment was previously reported to increase competence of ICM to remain pluripotent when us ed for culture from Day 6 to 8 [218] The proportion of ICM colonies that survived until the end of passage 1 was greater for ICM derived from blastocysts produced in the presence of CS F2 than ICM from control blastocysts (P=0.002) (Figure 2 2 A). In contrast, ICM from blastocysts cultured in ESM+2i had survival that was not different from controls. Of the ICM that were passaged, a higher proportion derived from CSF2 treated blastocysts survived to passage 2 (43% vs 7%; P=0.016) and passage 3 (36% vs 4%; P=0.025) than ICM from control or ESM+2i

PAGE 63

63 treated blastocysts. One colony from a CSF2 treated blastocyst that survived to the end of passage 3 was examined for expression of NANOG and CD X2 The colony expressed NANOG but not CDX2 (Figure 2 2 B). In the second experiment, treatments were applied from Day 5 to 7 post insemination. This timing was chosen because exposure of embryos to CSF2 from Day 5 to 7 improves competence to establish an d maintain pregnancy after transfer into recipients [18] The microscopic appearance of ICM that survived passage 1 is shown in Figure 2 3 and the results are summarized in Figure 2 2 C. Although not significant, the percent of Day 7 ICM in the control group that survived passage 1 was higher than in the previous study using Day 8 ICM (64 vs 33%, P=0.17). While also not significant, there was a tendency for survival to the end of passage 1 to be numerically greater for ICM from CSF2 treated blastocysts than control blastocysts. Data on ICM survival were also analyzed across both experiments. The percent of established colonies that survived to the end of passage 1 was greater (P=0.031) for ICM from CSF2 treated emb ryos than ICM from control embryos and there was no interaction between treatment and timing of treatment (i.e., CSF2 increased survival regardless of whether treatment was from Days 5 to 7 or 6 to 8 post insemination). Data on ICM survival were scruti nized to determine whether effectiveness of CSF2 for improving survival of ICM depended on the percent of oocytes that became blastocysts in the control groups. Effects of CSF2 did not depend on development class at either Day 7 or 8 post insemination (re sults not shown). Expression of G enes Involved i n Pluripotency and Differentiation To determine whether CSF2 increases survival of ICM because it regulates genes involved in pluripotency and differentiation, we evaluated the effect of CSF2 from

PAGE 64

64 Day 6 8 pos t insemination on expression of genes involved in pluripotency (NANOG and SOX2 ) and differentiation of TE ( CDX2 ) and hypoblast ( GATA6 ) in isolated ICM. There was no effect of treatment on steady state amounts of mRNA for any of the genes analyzed (Figure 2 4). There was also no interaction between CSF2 and development class. TE O utgrowth When blastocysts are cultured on Matrigel, TE cells spread onto the surrounding substratum and proliferate [220] Moreover, exposure to appropriate growth factors (FGF2) causes accumulation of hypoblast cells in the outgrowths [222] Since the trophoblast of Day 15 conceptuses formed following treatment with CSF2 from Day 5 7 post insemination had higher expression of the maternal signaling gene IFNT2 and tended to be numerically greater in length than control embry os [30] it was hypothesized that CSF2 would increase the spread of TE cells, reinforce commitment to the TE lineage by enhancing expression of CDX2, decrease expression of the hypoblast marker GATA6, and increase IFN T2 secretion (as measured by antiviral activity in the medium). Experiments were conducted by culturing embryos with CSF2 or control from Day 5 to 7 or 6 to 8 post insemination and culturing the resultant blastocysts individually until Day 13 or 15 post in se mination. Results are in Table 2 1 There was no effect of CSF2 on the percent of blastocysts that attached, the percent of blastocysts or attached blastocysts that experienced TE outgrowth or the percent of cells in the outgrowth that were positive fo r CDX2. Similarly, there was no effect of CSF2 on secretion of antiviral activity into the culture medium.

PAGE 65

65 The effect of CSF2 on size of outgrowths depended on the timing of treatment. CSF2 decreased the size of the outgrowth when treatment was from Da y 5 to 7 post insemination but had no effect on outgrowth size when treatment was from Day 6 to 8. Expression of CDX2 was higher for outgrowths of CSF2 treated blastocysts when treatment was from Day 6 to 8 but not when treatment was from Days 5 to 7 (Tab le 2 1). There was no effect of CSF2 at either time on expression of GATA6 (Table 2 1). Effects of CSF2 on characteristics of TE outgrowth were not affected by the overall development to the blastocyst stage in controls, i.e., there were no CSF2 x develo pment class interactions at either Day 7 or 8 post insemination. Expression of CSF2 Receptor Subunit Genes Expression of CSF2RA and CSF2RB was examined at the zygote, 2 cell, 3 4 cell, 5 8 cell, 9 16 cell, morula and blastocyst stages of development. CSF2R A was expressed at all stages. Expression for CSF2RA increased between the zygote to the 9 16 cell stage before declining to the blastocyst stage (P<0.05) (Figure 2 5A). In contrast, CSF2RB was not detected in any sample of embryos regardless of stage of development (Figure 2 5B). CSF2RB was expressed in leukocytes, however (Figure 2 5B), indicating the effectiveness of the PCR procedure. Discussion Exposure of bovine embryos from the morula to blastocyst stage of development with CSF 2 increases survival of the embryo after transfer into a recipient female in cows [18] as well as in mice [26] and humans [25] These results implicate CSF2 as an important maternal signal controlling embr yonic development. Experiments presented here suggest two potential mechanisms by which CSF2 could enhance the competence

PAGE 66

66 of a blastocyst to establish and maintain pregnancy, namely by regulating pluripotency and survival of cells derived from the ICM and alteration of TE function. Similar to the preimplantation mouse, human and pig embryo [186, 187, 189] action s of CSF2 on the bovine embryo are likely mediated by a signaling mechanism that is distinct from that in most cells because the CSF2RB subunit was not detected in any sample of embryos throughout the period culminating in formation of the blastocyst. Ac tions of CSF2 to promote survival of isolated ICM in a pluripotent state are consistent with earlier observations indicating CSF2 regulates ICM formation and embryo differentiation status. In particular, CSF2 increased the number of cells in the ICM of the blastocyst [18] and down regulated expression of sever al genes involved in differentiation in the Day 6 morula [31] Actions of CSF2 on the ICM are likely to reflect an important mechanism for enhancing embryo survival. Inadequate formation or survival of the ICM appears to be an important cause of pregnancy loss. At Day 14 17 of pregnancy, about 25 33% of conceptuses generated following embryo transfer in cattle are missing the embryonic disk derived fro m the ICM [18, 225, 226] In humans, blastocysts with larger ICM were more likely to implant after transfer than blastocysts with smaller ICM [227] There are several possible mechanisms by which CSF2 could affect the ability of the ICM to survive in culture in a pluripotent state. The ICM is not a homogenous group of cells, especially by Day 8 when specific s ubpopulations can be identified based on labeling for NANOG and GATA6 [47] Perhaps CSF2 changes the relative numbers of cell types in the ICM in a way that promotes survival in a pluripotent state. In the absence of CSF2, ICM from Day 7 blastocysts tended to be better able to survive in

PAGE 67

67 culture than ICM from Day 8. The former is less differentiated [47] and it may be that actions of CSF2 to prevent differentiation is responsible for its actions on ICM survival. There was no effect of CSF2 on exp ression of NANOG or SOX2 in ICM but regulation of other pluripotency or differentiation factors by CSF2 could be involved. Also, CSF2 might improve survival of ICM by preventing apoptosis because CSF2 can inhibit apoptosis and induce expression of anti ap optotic genes in bovine [31] and mouse [216] embryos. It is also possible that CSF2 induces changes to cells of the ICM that affect their interaction with the underlying fibroblast layer, for example by affecting cell adhesion or cell signaling. The reason for the failure of the ESM+2i treatment to improve survival of ICM, despite beneficial effects seem earlier [218] is not clear although th e low degree of replication may have obscured small improvements in survival. One implication of the finding that CSF2 promotes survival of ICM in a pluripotent state is that the cytokine might prove useful in generation of embryonic stem cells (ESC) or i nduced pluripotent stem cells in the cow. There is a need for growth factors that promote pluripotency in the cow because growth factors that are involved in maintenance of ESCs in the human and mouse (FGF2 [228] and LIF [229] respectively) are not effective in the cow [230] The effects of CSF2 on chara cteristics of TE outgrowth were small, dependent upon the timing of treatment and did not involve changes in secretion of antiviral activity that represents the trophoblast derived interferon, IFNT2. CSF2 decreased the size of TE outgrowths when embryos we re exposed from Day 5 to 7 but not when embryos were exposed from Day 6 to 8. In addition, CSF2 increased expression of the

PAGE 68

68 transcription factor CDX2 slightly when embryos were treated from Day 6 to 8 but not when treated from Day 5 to 7. Like the ICM, t he TE of the bovine undergoes important changes between Days 7 and 8. The TE is not yet committed to the TE lineage at Day 7 but rather can give rise to ICM when aggregated with cleavage stage embryos [94] Perhaps, the TE is more differentiated at Day 8 than Day 7 and one consequence is the action of CSF2 on TE function changes. Consistent with a change in differentiation status of the TE between Day 7 and 8 is the fact that GATA6 is present in both TE and ICM at Day 7 but becomes localized to the ICM by Day 8 [47] An increase in CDX2 expression in outgrowths of TE from Day 8 blastocysts caused by CSF2 could reflect actions of CDX2 to promote TE function. Indeed, embryos treated with CSF2 from Day 5 7 and transferred into cows had higher expression of the trophoblast gene IFNT2 at Day 15 [30] There are many reports that CSF2 can increase the proportion of cultured embryos that develop to the blastocyst stage, including observations in the cow [24] human [200] pig [189, 198, 199] and mouse [26] In other experiments, however, CSF2 either did not affect development [203] or was detrimental for development of embryos to the blastocyst stage [231] Present results indicate that the e ffect of CSF2 on development to the blastocyst state depended on the overall competence of embryos for development. In particular, CSF2 increased the percent of embryos becoming blastocysts when the development rate in control blastocysts was low. In con trast, CSF2 decreased development when blastocyst development rates in controls were high. This finding is reminiscent of the first report indicating CSF2 improved blastocyst yield [24] In that experiment, CSF2 improved the percent of bovine embryos becoming

PAGE 69

69 blastocysts when serum was not present in the medium and development was low but t here was no effect of CSF2 when serum was present and development was high. It appears, therefore, that CSF2 enhances developmental competence of embryos with characteristics that limit ability for development while reducing the prospects for an embryo be coming a blastocyst for embryos that have characteristics that allow development to proceed to the blastocyst stage. Perhaps, the anti apoptotic effects of CSF2 [31] increase the ability of a poor embryo to become a blastocyst. If in fact CSF2 promotes pluripotency rather than differentiation [18, 30] it might de lay but not prevent the differentiation of the TE in an embryo with a high developmental capacity. Such an explanation is consistent with the effects of CSF2 from Days 5 7 on TE outgrowth as well as the finding that the negative effects of CSF2 on blastoc yst development were lower at Day 8 than Day 7. As found earlier for the mouse and human [186, 187] the preimplantation bovine embryo expresses only one of the two subunits of the CSF2R. Typically, CSF2 signaling occurs through a cell surface receptor consisting of CSF2RA and CSF2RB subunits [181, 217] Binding leads to activation of JAK2 followed by phosphorylation of signal transducer and activation of the STAT5 pathway [190, 232] CSF2RA binds to CSF2 with low affinity (K d = 2.7 nM) while recruitment of CSF2RB causes an increase in affinity to 170 pM [181] It is possible to achieve signal transduction in the absence of CSF2RB. In Xenopus oocytes, CSF2 binding to CSF2 RA in the absence of CSF2RB can signal through activation of phosphatidylinositol 3 kinase [183] Thus, it seems likely that CSF2 signals through a pathway independent of CSF2RB, even though CSF2 can affect the embryo at concentrations as low as 2 ng/ml (i.e., 140 pM) in humans [25]

PAGE 70

70 Nonetheless, the conclusion that CSF2 signals independent of CSF2RB must be tempered by two recent observations. Very low levels of mRNA for CSF2RB were detected in pig embryos at the blas tocyst stage [189] In addition, both CSF2RA and CSF2RB could be immunolocalized to bovine oocytes [188] and it is possible that the embryo uses CSF2RB that was inherited from the oocyte. However, immunolabeling for CSFR2B was much lower than for CSFRA [188] and it seems likely that little CSF2RB is present even in the oocyte. In co nclusion, CSF2 acts on the bovine preimplantation embryo to alter the ICM so it is better able to survive and remain pluripotent while cultured on BFF. Accordingly, it is hypothesized that one mechanism by which CSF2 improves competence of blastocysts to establish pregnancy involves regulation of ICM survival and differentiation status. There were also day of development specific effects of CSF2 on TE outgrowths, indicating that CSF2 regulates the function of cells of the TE lineage as well. The nature of this regulation and its implications for subsequent development remain to be established. Transcripts for CSF2RB were not detected in embryos in the period culminating in blastocyst formation, indicating the likelihood that CSF2 signals only through a CSF 2RB independent mechanism.

PAGE 71

71 Table 2 1. Effects of CSF2 from Day 5 to 7 or 6 to 8 post insemination on characteristics of TE outgrowths. a Data are least squares means SEM b n is equal to the number of IVP replicates in which the experiment was performed. For each replicate, 2 to 26 blastocysts were examined for each treatment. cd Vehicle vs CSF2, P=0.034 ef Vehicle vs CSF2, P=0.047 Day 5 to 7 Day 6 to 8 n b Vehicle CSF2 n b Vehicle CSF2 Analysis at Day 13 post insemination Blastocysts that attached (%) 13 66.2 5.8 65.9 5.8 15 62.3 3.8 69.5 3.8 Blastocysts with outgrowth (%) 13 36.6 5.1 33.2 5.1 15 15.0 2.5 15.8 2.5 Attached blastocysts with outgrowth (%) 13 54.3 6.6 46.3 6.6 15 24.4 4.2 22.4 4.2 Analysis at Day 15 post insemination Blastocysts that attached (%) 13 67.6 4.3 66.2 4.7 15 60.5 4.1 69.5 4.0 Blastocysts with outgrowth (%) 13 48.2 5.1 42.4 5.1 15 27.5 3.6 24.6 3.6 Attached blastocysts with outgrowth (%) 13 69.2 6.0 67.4 6.5 15 42.1 5.4 35.2 5.4 Size of outgrowth (mm 2 ) 7 3.0 0.4 c 1.6 0.5 d 13 2.3 0.4 2.5 0.3 CDX positive cells (%) 3 94.4 1.2 94.9 1.3 4 94.8 1.1 96.1 1.2 CDX2 gene expression (fold change) 7 1.0 1.3 0.2 6 1.0 e 1.4 0.1 f GATA6 gene expression (fold change) NA NA NA 6 1.0 1.2 0.1 [IFNT] (IU/mm 2 ) NA NA NA 3 169.8 76.4 145 61

PAGE 72

72 Figure 2 1. The effect of CSF2 on the percent of oocytes that became a blastocyst depends on the overall competence of embryos to develop to the blastocyst stage. Embryos were cultured + CSF2 from either Day 5 7 (panel A) or 6 8 post insemination (panel B ) and the percent of oocytes becoming blastocysts determined. The total number of IVP replicates was 62 for Day 5 7 and 36 for Day 6 8. The IVP replicates were divided into lowest, middle and highest terciles based on the percent of oocytes that became bl astocysts in the control group. For treatment at Day 5 7, the effect of CSF2 depended upon tercile (interaction; P<0.0001) with CSF2 increasing the percent of oocytes that became blastocysts when development was low, having no effect when development was i n the middle tercile, and having negative effects when development was high. As shown in the inset graph, there was a negative correlation between the percent of control embryos that became blastocysts and the deviation in percent blastocyst due to CSF2 ( 0.53, P<0.0001). At Day 6 8, there was no significant effect of CSF2 or CSF2 x development class but there was a negative correlation between the percent of control embryos that became blastocysts and the deviation in percent blastocyst due to CSF2 ( 0.37 P=0.026) (see inset graph in B).

PAGE 73

73 Figure 2 2. Treatment with CSF2 increases ability of isolated ICM to survive following passage. Numbers above each bar represent the number of colonies that survived for 7 days after a passage divided by the total number of colonies that were passaged. In the first experiment (Panel A), embryos were cultured from Day 6 to 8 post insemination with control medium, CSF2 or ESM containing a MAPK and GSK inhibitor (ESM+2i). Survival of isolated ICM cultured on fetal fibroblasts was determined at Day 7 of passages 1, 2 a nd 3. Expression of NANOG and CDX2 in one ICM colony from CSF2 treated blastocysts that survived to the end of passage 3 is shown as an insert within panel A. In the second experiment, embryos were cultured from Day 5 to 7 after insemination with or wit hout CSF2 (panel B). While not significant, survival to Day 7 of passage 1 was numerically greatest for ICM from CSF2 treated embryos.

PAGE 74

74 Figure 2 3. Representative appearance of colonies of cells derived from ICM at Day 7 passage 1. Colonies were deriv ed from blastocysts that were produced in control medium with control, ESM containing a MAPK and GSK inhibitor

PAGE 75

75 Figure 2 4. Lack of effect of CSF2 on expression of genes related to pluripotency and differentiation in ICM isolated from Day 8 blastocysts. Data for mRNA are squares means SEM of results from 7 9 pools of 3 5 isolated ICM per treatment. Black and white bars r epresent control and CSF2 treated ICMs, respectively. There was no significant effect of treatment on gene expression.

PAGE 76

76 Figure 2 5. Developmental changes in steady state mRNA for CSF2RA and CSF2RB. Panel A: Developmental changes in transcript abundance for CSF2RA expressed as fold change relative to amount for oocytes. Data are the least squares means SEM of results from pools of 25 30 embryos replicated 5 times. Bars with different superscripts differ (P<0.05). Panel B: Represen tative electrophoretogram of PCR products for CSF2RA (A), CSF2RB (B), GAPDH, and SDHA. Abbreviations are as follows: blast=blastocyst, leuk.=leukocytes, GAP.=GAPDH. Arrows represent the amplicon location of CSF2RA (A) and CSF2RB (B).

PAGE 77

77 CHAPTER 3 SEXUAL DIMORPHISM IN DEVELOPMENTAL PROGRAMMING OF THE BOVINE PREIMPLANTATION EMBRYO CAUSED BY COLONY STIMULATING FACTOR 2 Introduction Physiological function and health of the adult is first established during prenatal life: alterations in the maternal environment can lead to changes in the adult that include susceptibility to hypertension, diabetes, cardiovascular disease, and various cancers [233 236] Programming of development occurs as early as the preimplantation period. Feeding pregnant female mice or rats a low protein diet for a limited period corre sponding to preimplantation development caused changes in the offspring that persisted into adult life [13 15] Similarly, postnatal physiology and immune function were altered in sheep derived from mothers fed a diet deficient in cobalt and sulfur for 8 weeks before and 6 days after mating [16] Furthermore, embryos that develop in vitro give rise to neonates that have increased likelihood for a variety of abnormalities as shown in humans [237, 238] cows [239, 240] sheep [240] and mice [241, 242] One of the characteristics of developmental programming in the preimplantation period is that female embryos are programmed differently than male embryos [243] In mice, for example, feeding a low protein diet during the first 3.5 days following conce ption affected females differently than males. Postnatal growth and body size was affected by protein diet in female offspring but not male offspring [13, 14] At adulthood, females from mothers fed low protein diets had altered behavioral scores [13] increased blood pressur e [14] and reduced heart to body weight ratio [13] as compared to animals born from control females. These traits were not affected in male offspring but males from low protein mothe rs had elevated lung angiotensin converting enzyme [17] In rats, feeding a methyl deficient diet with no folic acid for 3 weeks prior to mating

PAGE 78

78 and 5 days after gestation increased the concentration of insulin in males but not female offspring [169] Developmental plasticity in response to maternal environment has been proposed as an evolutionary strategy to allow indi viduals to adapt to transient changes in environment while preserving genotype [236] Sexual dimorphism in developmental programming may reflect the fact that relative value of female and males for reproductive fitness varies with environment [244] The mechanism by which a change in maternal environment alters the developmental program of a female embryo differently than of a mal e embryo is not known. One possibility is that female embryos respond differently to maternally derived molecules that regulate embryonic development (hereafter termed embryokines) than do male embryos. If so, alteration in secretion of maternal embryokin es in response to environmental change could result in a sex specific deviation in the developmental program. The possibility of differential responsiveness to maternal embryokines is strengthened by the observations that gene expression is different betw een female and male embryos as early as the blastocyst stage [245, 246] Colony stimulating factor 2 is a good candidate for an embryokine responsible for sex s pecific programming. This cytokine is produced by the oviductal and endometrial epithelium of a wide range of mammals including mice [28] cattle [27] and humans [29] Treatment of preimplantation embryos with CSF2 leads to an increase in number and pluripotency of cells of the ICM [18, 247, 248] altered gene expression [30] and, increased resistance to apoptosis [31] That CSF2 i s capable of altering the developmental program of the embryo is indicated by findings that bovine [18] mouse

PAGE 79

79 [26] and human [25] embryos treated with CSF2 have increased likelihood to survive to term when transferred into females. Endometrial secretion of CSF2 also changes in response to maternal environment, as indicated by experiments showing reduced expression of CSF2 in oviduct of obese cows [34] and increased secretion of CSF2 after induction of inflammation [33] Culture of bovine embryos with CSF2 from day 5 7 of development resulted in alterations in characteristics of the embryo at a later time point [18, 30] In particular, em bryos treated with CSF2 tended to be longer and produce more of the anti luteolytic signal, IFNT, at day 15 of development than control embryos. For the experiment reported here, we used this model of CSF2 mediated developmental programming to explore whet her such changes in the trajectory of development depend upon sex Day 15 is an important point in time for the survival of the bovine embryo. At this time, the extraembryonic membranes (EEM) of the embryo are in the process of extensive elongation so th at the embryo increases ~50 fold in length between day 13 and day 16 [35] Coincident with elongation of the EEM is activation of trophobl ast transcription of IFNT which encodes for a type I interferon that acts on the endometrium to block secretion of prostaglandin F 2 and thereby ensure survival of the corpus luteum and continued progesterone secretion [55] The results presented here indicate that the consequences of exposure to CSF2 from day 5 7 of development are fundamentally different for the f emale and male embryo at day 15 with respect to embryo elongation, IFNT secretion, and characteristics of the transcriptome and methylome. These results support the contention that sexual dimorphism in response to maternal embryokines is

PAGE 80

80 an important mecha nism for establishment of sex differences in developmental programming. Materials and Methods Embryo P roduction In vitro production of bovine embryos was performed as previously described [22] unless otherwise noted. Bri efly, COC from Holstein females were purchased from either Sexing Technologies (Navasota, TX, USA) or Ovitra (Midway, TX, USA). The COC were shipped overnight at 39 o C in a portable incubator while cultured in a proprietary maturation medium. Once arr ived, groups of 20 35 matured oocytes were fertilized with Percoll purified sperm (1.0 x 10 6 /ml) from a single Holstein bull for 8 hours at 38.5C in 1.7 ml of SOF FERT [221] Cumulus cells were denuded after fertilization by vo TALP containing 1,000 U/ml hyaluronidase. Putative zygotes were then cultured in groups of 30 in 45 l microdrops of SOF BE1 [22] covered with mineral oil at 38.5 o C in a humidified atmosphere of 5 % (v/v) O 2 and 5% (v/v) CO 2 with the balance N 2 Cleavage rate was assessed at day 3 post insemination. On day 5 post insemination, drops were supplemented with either 5 l recombinant bovine CSF2 [Novartis, Basle, Switzerland; 100 ng/ml in DPBS and 1% ( w/v) BSA] ; final concentration of CSF2 after dilution in the drops = 10 ng/ml] or 5 l of the vehicle used to dilute CSF2 (control treatment). The concentration of CSF2 was chosen based on its effectiveness for increasing embryonic survival after transfer into reci pient females [18] Embryo T ransfer Grade 1 expanded blastocysts [249] were harvested from culture drops at day 7 of de TALP [250] suppleme Aldrich).

PAGE 81

81 Each straw contained one embryo and was inserted horizontally into a portable incubator (AI gun warmer, Rusk, TX, USA) at 38.5C and transported to the Dairy Unit at the Univer sity of Florida (Hague, FL, USA). For each replicate, ovulation was synchronized using a modified OvSynch 56 protocol [251] releasing hormone, (GnRH) (Cystorelin Merial, Duluth, GA, USA) on the morning of day 8 (day 0 = expected day of ovulation), 25 mg prostaglandin F 2 (Lutalyse Z oetis, Madison, NJ, USA) on the morning and afternoon of day on the afternoon of Day 1. Cows having a detectable corpus luteum on day 7, as determined by ultrasonography using a Hitachi Aloka 500 ultrasound with 5 MHz linear array tr ansducer (Hitachi Aloka, Tokyo, Japan), were randomly assigned to receive a CSF2 treated or control embryo. The embryo was transferred transcervically to the uterine horn ipsilateral to the ovary containing the corpus luteum using an embryo transfer pipett e after application of a local epidural block using 2% (w/v) lidocaine. Embryo R ecovery Embryos were recovered at day 15 of development by flushing the uterine horn ipsilateral to the corpus luteum with DPBS containing 1% (v/v) polyvinyl alcohol (PVA) (D PBS PVA). Flushing medium was introduced into the uterus by means of a 20 French Foley catheter inserted transcervically using a stainless steel blunt stylet placed inside the catheter. After placement, the stylet was withdrawn and the catheter held in pl ace by inflation of a cuff at the end of the catheter. The flushing procedure, which involved introduction of 60 ml into the uterus and recovery of fluid through the catheter, was repeated four times or until an embryo was recovered.

PAGE 82

82 Embryos recovered by flushing were assessed by light microscopy for stage of development, length, presence of an embryonic disc (ED) and whether the embryo was recovered intact or in pieces. All recovered embryos were at the filamentous stage of development. If found, th e ED was dissected from the EEM using a sterile scalpel and tweezers. The EEM was snap frozen in liquid N 2 in a minimal amount of DPBS PVA and stored at 80C until extraction of gDNA and total RNA. The fluid from the first uterine flush was centrifuged for 10 min at 1000 x g and stored at 20C. The total number of day 15 embryos collected using the procedures described above were 16. An additional 14 day 15 embryos that had been treated with CSF2 or vehicle were used for the analysis of sex and CSF2 e ffects on embryo length and IFNT accumulation in the uterus. Details of production of these embryos were reported by Loureiro et al. (2009). To determine whether sex effects on length and IFNT in embryos occur earlier in development, we analyzed effect of sex on 10 day 14 control embryos (i.e., not treated with growth factors during culture). Details of the procedures for production of these embryos are reported elsewhere [225] IFNT A ssay Amount of biologically active IFNT in uterine flushings was determined by measuring the inhibition of vesicular stomatitis virus (VSV) induced lysis of Madin Darby bovine kidney (MDBK) cells as described elsewhe re [222] Antiviral activity was converted to units of IFN (IU/ml) by comparing inhibition to that achieved with a human IFNA standard (Millipore, Billerica, MA, USA). Data on embryo length and uterine IFNT were analyzed by least squares analysis of variance using the GLM procedure of the Statistical Analysis System (SAS)

PAGE 83

83 version 9.3 (SAS Institute Inc., Cary, NC, USA) with effects of sex treatment and sex x treatment Extraction of gDNA and T otal RNA gDNA and total RNA were extracted using the AllPrep DNA/RNA Mini kit (Qiagen, Valencia, CA, USA). Embryos were disrupted with Buffer RLT Plus containing mercaptoethanol, vortexed for 30 seconds and homogenized throug h QIAshredder columns (Qiagen). Homogenized lysate was then separated into gDNA and total RNA for total RNA. Both gDNA and total RNA were stored at 80C until process ing. Total RNA quantity, quality and integrity were determined using an Agilent Bioanalyzer 2100 (Santa Clara, CA, USA). All samples had an RNA integrity >7.5. There was an absence of DNA contamination of RNA samples as assessed by the Bioanalyzer. Con centration of gDNA was quantified by Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) with all samples being >76 ng/l. Sexing by PCR Sex for each embryo was determined by PCR with primers specific for the Y chromosome (forward: 5 G AT CAC TAT ACA TAC ACC ACT 3, reverse: 5 GCT ATG CTA ACA CAA ATT CTG 3) and an autosomal satellite DNA sequence (forward: 5 TGG AAG CAA AGA ACC CCG CT 3, reverse: 5 TCG TCA GAA ACC GCA CAC TG 3) [252] Master mix was composed of 10X PCR buffer, 2.5 mM dNTP, 50 mM MgCl 2, 10 M of the aforementioned primers and 0.2 l of Taq DNA polymerase (5 U/l) (Invitrogen). A total of 2 l of DNA sample was combined with the 10.2 l master mix and subjected to PCR for 7 min at 95C, 40 cy cles of 30 sec at 95C, 30 sec at 57 C and 30 sec at 72 C followed by a final extension at 72C for 7 min. Each sample (5 l)

PAGE 84

84 was analyzed on a 1.5% (w/v) agarose gel with 5 l ethidium bromide (10 mg/ml) using a 100 bp ladder (New England Biolabs, Ipswi ch, MA, USA). A male control consisted of fibroblast or sperm DNA and a female control consisted of DNA extracted from an ovary. Overview of Analysis of T ranscriptome Total RNA for each sample was extracted, amplified and labeled before proceeding to ana lysis of expression by microarray. The Agilent microarray was specifically designed by EmbryoGene with probes specific for bovine embryo development. Microarray data were analyzed and 6 DEG were verified by qPCR. Raw and normalized data are available on the gene expression omnibus website using the accession number GSE55364. RNA a mplification Total RNA from 3 female control embryos, 3 female CSF2 treated embryos, 2 male control embryos and 4 male CSF2 treated embryos were subjected to T7 RNA amplificatio n using the RiboAmp HS Plus RNA amplification kit as described by the manufacturer (Life Technologies, Carlsbad, CA, USA). A total of 5 ng RNA was reversed transcribed using an mRNA specific first primer and first strand synthesis. Single stranded cDNA was made into double strand ed cDNA using second strand synthesis with an exogenous second primer. aRNA was transcribed in vitro from the purified cDNA second strand synthesis followed by aRNA purification. Round one purified aRNA was then re converted to double stranded cDNA, puri fied and subjected to a second round of in vitro transcription. The aRNA was then purified using PicoPure RNA isolation kit (Life Technologies), quantified by Nanodrop spectrophotometer (Thermo Fisher Scientific) and stored at 80C until labeling.

PAGE 85

85 RNA l abeling The aRNA was labeled using the Universal Linkage System (ULS) (Kreatech Biotechnology, Apeldoorn Gelderland, Netherlands) as described by the manufacturer with either ULS Cy3 or ULS Cy5. Samples were then incubated at 85C for 30 min followed by incubation on ice for 3 min. aRNA was briefly centrifuged at 16,000 x g and purified using PicoPure RNA isolation kit (Life Technologies) and eluted in 11 l elution buffer. Yield and labeling efficiency was determined using the Nanodrop 1000 spectrophoto meter. RNA microarray hybridization and s canning Microarray analysis of labeled aRNA was performed using an Agilent 4x44,000 slide microarray (Agilent, Santa Clara, CA, USA) designed by EmbryoGENE to over represent genes expressed by the bovine preimplant ation embryo. The probes for this array were chosen from one million high quality reads from Roche 454 Titanium deep sequencing datasets from in vitro and in vivo produced bovine embryos from the germinal vesicle stage, 2 cell, 4 cell, 8 cell, 16 cell, mo rula, blastocyst and hatched blastocyst stage [253] The array contains 42,242 probes which represent 21,139 known refere nce genes, 9,322 probes for novel transcribed regions, 3,677 alternatively tiling probes and 3,723 controls [253] For hybridization, 825 ng of one Cy3 labeled aRNA sample and 825 ng of one Cy5 labeled aRNA sample were combined with 2.75 l of 0.01X Agilent spike, 11 l of 10X blocking agent and 2.2 l of 25X fragmentation buffer (all from Agilent) free water. One sample that was CSF2 treated (either Cy3 or Cy5 labeled) was always combined with a sample that was a control (either Cy5 or Cy3 labeled) and of the same sex The mixture was heated at 60C for 15 min to fragment the RNA, placed on ice,

PAGE 86

86 allowed to cool for 1 min and then mixed with an equal volume of 2X GEx hybridization buffer HI RPM (Agilent) to stop RNA fragmentation. The solution was centrifuged for 1 min at 16,000 x g and placed on ice. For each Hybridization proceeded for 17 hours at 65C while rotating at 10 rpm. Following hybridization, array slides were washed as described by the manufacturer, and scanned with a Tecan PowerS canner microarray scanner (Tecan Group Ltd., Mnnedorf, Switzerland). Analysis of transcriptome microarray d ata Microarray images were submitted to BioDiscovery Inc. (Hawthrone, CA, USA) to generate separate datasets for each color (Cy3 and Cy5). In addi tion, spots were aligned to the corresponding GenePix array list, which describes the size, position and label of each spot on the array, and examined for removal if spots on the array that were larger than the spot or contained a blemish. The mean intens ity for each spot was corrected by subtracting the mean intensity of background values for each sample to remove background noise. Mean intensity was then transformed by log2 and analyzed by using JMP Genomics (SAS, Cary, NC, USA). Data were normalized wi th loess normalization for dye dye correction followed by quantile normalization for between array correction. Genes that were differentially expressed were determined by analysis of variance with a model that included effects of treatment, sex and treatment x sex P values for significant genes were then adjusted for multiple testing by SGoF+ estimation, as described by Carvajal Rodriguez and Ua Alvarez [254] All genes that had an adjusted P value of <0.05 an 0.67 were considered differentially expressed.

PAGE 87

87 Ingenuity pathway analysis software (Ingenuity Systems, Redwood City, CA, USA) was used to determine gene ontologies and pathways and to identify pathways with predicted gene activation or inhibition. Canonical pathways were considered significant when th e log of the p value for each pathway was greater than 1.30. Only pathways with 3 or more differently expressed genes were used for analysis. DAVID was used to determine gene ontologies and functions in which differentially expressed genes were overrepr esented at P< 0.05 [255] iPath 2.0 was used to identify KEGG metabolic pathways that contained overrepresentation of differentially expressed genes [256] Validation of trancriptome m icroarray by PCR Validation of microarray gene expression was accomplished by quantitative reverse transcription PCR of 12 samples of embryo RNA. Samples were treated with 1 l (2 U) of DNase I enzyme (New England Biolabs, Ipswich, MA, USA) in a total volume of 20 l volume at 37C for 30 min to remove DNA, and then incubated at 75C for 15 min to denature DNase. DNase treated RNA was then rev erse transcribed using the High Capacity cDNA Reverse Transcription Kit (Life Technologies). Reverse transcription occurred using random hexamer primers and involved incubation at 25C for 10 min, 37C for 120 min and 85C for 5 min. The cDNA was stored at 20C until further use. Negative controls for real time PCR were also performed by incubation without reverse transcriptase. cDNA was utilized for real time PCR analysis. For detection of transcript levels, a CFX96 Real Time PCR detection System (Bio Rad, Hercules, CA, USA) utilizing SsoFast EvaGreen Supermix with Low ROX (Bio Rad) was employed. Each reaction

PAGE 88

88 Supermix (Bio Rad), 6.8 l H 2 O and 1.2 l cDNA sample. Am plification conditions were 95C for 30 sec, 40 cycles at 95C for 5 sec and 60C for 5 sec, and 1 cycle of melt curve analysis at 65 T value was determined by subtracting the C T value of the sample by the ge ometric mean [224] of the C T for three housekeeping genes, GAPDH, SDHA and YWHAZ which were utilized becau se expression is stable over preimplantation development [31, 257] Primer sequences are in Table 3 1 The primers for XIST [258] GAPDH 28 SDHA 58 and YWHAZ 58 were described elsewhere and other primers were designed using PrimerQuest (IDT DNA, Coralville, IA USA). The accuracy of results from microarray T value as determined by PCR with the normalized intensity as determined by microarray analysis Overview of A nalysis of M ethylome To analyze the methylome, gDNA was extracted, digested by MseI and digested with methylation sensitive enzymes HpaII, HinpII and AciI. Products were then amplified, labeled, and then labeled gDNA was subjected to microa rray analysis using an Agilent array designed by EmbryoGene. Raw and normalized data are available on the gene expression omnibus website using the accession number GSE55873. F ragmentation and a mplification of gDNA The use of restriction enzymes that are sensitive to 5 methylcytosine was employed. These restriction enzymes, HpaII, HinpII and AciI, digest when the CpG dinucleotide is not methylated but leave DNA intact if the CpG is methylated. Concentrated gDNA from 3 female control embryos, 3 female CSF 2 treated embryos, 2 male control embryos and 2 male CSF2 treated embryos were diluted to 10 ng in 15 l

PAGE 89

89 and spiked with a 1.5 l mix of specific DNA sequences sensitive to the restriction enzymes to serve as a control for subsequent qPCR. gDNA was digest ed with 0.5 l (5 U) MseI in a total volume of 50 l for 16 hours at 37C followed by inactivation for 20 min at 65C. MseI digested gDNA was precipitated using 1 l of 3 M sodium acetate and linear acrylamide (Life Technologies). The gDNA pellet was reconstituted in 5 l H 2 using 1.0 l (5 U) T4 DNA ligase and 10 mM ATP at 15C for 16 h. Linker ligated gDNA was digested by adding 0.5 l (5 U) HpaII and 0.5 l (5 U) HinpII at 37 C for 12 h. After 12 hours of incubation, an additional restriction enzyme, 0.5 l (5 U) of AciI, was added to each sample and incubated at 37 C for 4 hours followed by heat inactivation at 80C for 10 min. Digestion efficiency was verified usin g qPCR on a Roche lightcycler 2.0 with HpaII, AciI and HinpII specific primers. A difference of a least 5 cycle thresholds was required to proceed to DNA precipitation. If the results were below 5 threshold cycles, the gDNA was subjected to one more roun d of enzyme digestion with the aforementioned enzymes for 4 hours at 37 C. Digested DNA was precipitated as previously mentioned and amplified by ligation mediated PCR. Ligation mediated PCR was accomplished using MseI primers that bind to the MseI lig ated linkers. A second PCR was performed on the amplified purification kit (Qiagen). DNA was eluted in 43.5 l of elution buffer. MseI linkers were removed using 0.5 l M seI (10 U/l) at 37C for 16 hours followed by heat inactivation at 65C for 20 min. gDNA was then re purified using PCR purification kit (Qiagen) and eluted in 43.5 l.

PAGE 90

90 DNA l abeling Digested gDNA was labeled as described for the procedure to label RN A. gDNA was purified using QIAquick PCR purification kit (Qiagen) and eluted in 23.5 l elution buffer. Yield and labeling efficiency of gDNA was determined using the Nanodrop 1000 spectrophotometer. The degree of labeling of gDNA with Cy3 was between 1. 75% and 3.5% while labeling with Cy5 was between 0.75% and 2.5%. DNA microarray hybridization and scanning The degree of methylation was determined by measuring hybridization of restriction digested, amplified, and labeled DNA to probes for DMR in the bo vine genome using an Agilent 2 x 444,000 slide designed by EmbryoGENE. The microarray probes were designed based on a methylation specific deep sequencing analysis of the bovine genome which generated 1.2 million reads from genomic libraries from day 7 bl astocysts and day 12 elongated embryos [259] The microarray containing 414,566 probes surveying 20,355 genes as well as 34,379 CpG islands. of Cy3 labeled DNA from one sample (either CSF2 or control treated embryo for the same sex a second sample (either control of CSF2 treated embryo for the same sex RPM (Agilent) and 100X blocking agent (Agilent); the final volume was b free water. This solution was heated for 3 min at 95C and 30 min at 37C. Samples were CGH Block solution into the slide and hybridized at 65C while rotated at 10 rpm for 40 h. Following incubation, slides were washed

PAGE 91

91 Analysis of m ethylome a rray DNA microarrays were analyzed using the limma package of Bioconductor [260] Raw data were normalized using within array loess normalization followed by between array quantile normalization. No rmalized data were then fit to a linear model before being subjected to an empirical Bayes correction. Mean intensity of each spot on the array was transformed by log2 while p values were determined using a moderated t statistic [260] Regions with an estimated absolute fold change above 1.5 or below 0.67 and a p value < 0.05 were considered as differentially methylated. Development of visualization tools wa s designed to analyze the quality of both overall genomic and spiked in gDNA control digestion. DMR were categorized based on CpG island density [261] length [262] and distance [263] location of the DMR in the genome and types of repeated elements [264] Regions of each chromosome that had a frequency of DMR caused by CSF2 greater than expe cted were determined by chi square analysis. For each chromosome, 5 Mbp segments of the genome were examined for observed number of differentially expressed probes. The expected frequency for chi square analysis was calculated as the number of probes in t he 5 Mbp segment times the overall percent of probes that were differentially methylated. The analysis was performed using sliding windows of 5 Mbp that shifted by 500 Kbp at a time until reaching the end of the chromosome. Analysis was performed separate ly for female and male embryos. Results Embryo Length a nd IFNT A ccumulation in t he Uterus Sex of each embryo was determined by PCR ( Figure 3 1A). Embryo length and amount of IFNT in uterine flushings at day 15 were affected by a treatment x sex

PAGE 92

92 interaction ( Figure 3 1B, P<0.05). For embryos not treated with CSF2, female embryos were longer than male embryos and there was greater accumulation of IFNT in the uterus than for male embryos. In females, CSF2 decreased embryo size and IFNT accumulation while, in m ales, CSF2 increased embryo size and IFNT accumulation. As a result, male embryos treated with CSF2 were larger and secreted more IFNT than female embryos treated with CSF2. Another set of embryos collected at day 14 of gestation were examined for sex di fferences. In this case, involving embryos not treated with growth factors, there was no difference in length between female and male embryos (19.4 mm 11.1 and 23.6 mm 11.1 respectively, n=5 for each sex ). Thus, it is likely that differences in length b etween sex es in control embryos at day 15 represent earlier onset of elongation in female embryos rather than an inherently larger size in females. Differentially E xpressed G enes A Venn diagram illustrating numbers of DEG is presented in Figure 3 2. Among control embryos, a total of 514 genes differed in expression between female and male embryos. This represents 1.5% of the probes on the array. Using DAVID (Database for Annotation, Visualization and Integrated Discovery), DEG genes were overrepresented in 38 gene ontology terms (P<0.05), with terms related to mitochondrial function, protein ubiquitination, electron transport and translation being prominent KEGG pathway functional annotation terms that were overrepresented in the set of DEG were those for oxidative phosphorylation (Figure 3 3 P<0.02) and ribosome (P<0.05). Using IPA software, three canonical pathways having a minimum of three DEG were id entified: EIF2 signaling (P<0.0002), mitochondrial dysfunction (P<0.0003) and fatty acid

PAGE 93

93 oxidation 1 ( Figure 3 4 A, P<0.007). This finding was reiterated when the list of DEG was analyzed by iPATH 2.0 [256] The biofunction analysis feature of IPA was used to predict cellular processes that would experience a change in activation as a result of changes in gene expression between female and male embryos. It predicted that synthesis of protein (z score: 1.723), translation (z score: 1.673) and expression of protein (z score: 1.230) would be lower for female embryos than male embryos ( Figure 3 4 B D). CSF2 caused differential expression of 54 genes i n f emales and 93 genes in males A large proportion of genes regulated by CSF2 in both females and males were among the set of genes whose expression differed between male and female control embryos. In particular, 31 of 54 DEG genes in females (57%) and 48 o f 93 DEG in males (52%) were also regulated by sex in control embryos. Only 7 DEG were regulated by CSF2 in both females and males and regulation was always in opposite directions. For example, expression of HSP90B1 was increased by CSF2 in females and de creased in males ( Figure 3 2). Among the genes regulated by CSF2 in females, only 25 of 54 were annotated. These genes were overrepresented in one DAVID gene ontology, generation of precursor me tabolites and energy (P<0.05), one KEGG pathway, oxidative pho sphorylation (P<0.01). There were no significant IPA canonical pathways or cellular processes identified by the biofunction analysis feature of IPA. In males, only 60 of 93 were annotated. There were no significant DAVID gene ontology, KEGG pathways or I PA canonical pathways containing these DEG. However, the biofunction analysis

PAGE 94

94 feature of IPA indicated CSF2 increased metabolism of protein and decreased invasion of cells in male embryos ( Figure 3 5 ). The accuracy of microarray results was evaluated by determining the correlation T value from qPCR for nine genes significantly affected by either CSF2 within sex or between sexes with c o ntrol treated samples (Table 3 2 ). For 7 of 9 genes, an increase in hybdrization T (i.e., positively correlated with amount of mRNA). The correlation was significant for 6 of 9 genes. Methylome A Venn diagram illustrating numbers of DMR is presented in Figure 3 6 For control embryos, there were 31,706 DMR between females and males. This represents 7.6% of the probes on the array. Of these DMR, 20,658 (65%) were in open sea (>4 Kbp from CpG island), 7,824 (24.6%) were in shelf (2 4 Kbp from CpG island ), 2,463 (7.7%) in shore (1 2 Kbp from CpG island) and 731 (2.3%) were located in CpG islands. A total of 30 DMR were not classified. Treatment with CSF2 from day 5 7 caused hypermethylation at day 15 of 6,227 probes in females and 9,842 probes in males while causing hypomethylation of 3,292 probes in females and 9,322 probes in males ( Figure 3 5). In the female, 6,102 (64%) of these DMR were located in the open sea, 2,452 (25.7%) in the shelf, 787 (8.2%) in the shore and 181 (1.9%) within a CpG island, while 2 DMR were not c lassified In the male, 11,931 (62%) DMR were located in the open sea, 4,790 (25%) in the shelf, 1,641 (8.5%) in the shore and 792 (4.1%) within a CpG island, while 10 DMR were not classified

PAGE 95

95 Of the 9519 DMR regulated by CSF2 in fe males, 2766 (29.1%) were DMR whose methylation status in controls differed between females and males. Similarly, of the 19164 DMR regulated by CSF2 in males, 6597 (34.4%) were regions that were differentially methylated between females and males in control embryos. Thus, a greater percentage of methylation sites regulated by CSF2 are also modified by sex than is the case for the entire genome (7.6%). A total of 1,186 DMR were affected by CSF2 in both females and males. Of these, 773 (65.2%) were regulated in the opposite direction (hypermethylation in one sex and hypomethylation in the other sex ). Chi square analysis was used to identify whether 1) spatial distribution of DMR on regions of each chromosome was non random (as would be expected if DMR were u nder regulation) and 2) whether the chromosomal regions that were differentially methylated by CSF2 in females were distinct from those regions in males. For each chromosome, there were regions that contained hyper and/or hypomethylation that was more fre quent than would be expected due to chance if DMR were randomly distributed across the chromosome. Moreover, the regions of differential methylation caused by CSF2 were usually different for females than for males, as is illustrated for BTA 1 in Figure 3 7 Discussion It is well known that alterations in the maternal environment during prenatal life can have long term effects on the physiology and health of the offspring and that the nature of these effects differs between females and males [14 16, 169] From an evolutionary perspective, sexual dimorphism in developmental programming probably reflects the differential value of males and females for sexual propagation [244] While the phenomenon has been well described, the mechanism by which sexual dimorphism

PAGE 96

96 in developm ental programming is achieved has hitherto been unknown. Current findings lead to the hypothesis that sexual dimorphism results because female and male embryos respond differently to environment driven alterations in secretion of maternally derived embryok ines. In this model, shown schematically in Figure 3 8 the reproductive tract uses altered secretion of embryokines as a signal transducer to transmit information about the maternal environment to the embryo. For certain signals, as shown here for CSF2, male embryos respond differently than do female embryos so that the deviation in the developmental trajectory in response to environmental change varies between sexes The evidence for this idea comes from the present experiment that exposure of bovine pr eimplantation embryos to CSF2 for a two day period from day 5 7 of development, results in changes in embryonic growth, gene expression and DNA methylation in the EEM of embryos at a later time point in pregnancy, day 15 of development. It is at this stag e of pregnancy that the bovine embryo first signals its presence to the mother through the secretion of the antiluteolytic molecule, IFNT [55] Secretion of IFNT is coupled to a process of embryo elongation where the embryo undergoes a rapid increase in length from about 2 5 mm in length on day 14 to about 150 mm in length on day 16 [265] Elongation is a prerequisite for the upregulation of IFNT secretion in the ruminant [56] Present results suggest that, in the absence of prior exposure to CSF2, the female embryo is larger and secretes more IFNT into the uterus than the male embryo. The larger size of female embryos probably reflects earlier onset of elongation rather than an inherently larger size because there was no difference in embryo length

PAGE 97

97 between female and male emb ryos at day 14, around the time when elongation is being initiated. Similar lack of difference between female and male embryos in length were observed for in vitro produced embryos [266] and, in one report, for embryos produced in vivo [267] In another report, female in vivo embryos tended to be larger t han male embryos at day 14, although not significantly different [266] Moreover, IFNT secretion in vitro was greater for female embryos produced in vivo than male embryos at da y 14 [267] By day 16, male embryos have been reported to be longer than female embryos, with differences greater for embryos pr oduced in vivo than for those produced in vitro and subsequently transferred to recipients. Despite its larger size, analysis of the transcriptome reveals that the female embryo is less active with respect to oxidative phosphorylation, with NDUFA11, NDUFS7 UQCRC1, COX6A1 and ATP6V1B2 being downregulated in females and only NDUFB1 being upregulated. Gene expression in female embryos also indicated decreased translation and metabolism. The decreased metabolism of female embryos could reflect the earlier o nset of elongation and reduced metabolism as the rate of growth decreases at the end of the elongation period. However, female embryos have less mtDNA copies as early as the blastocyst stage [245, 268] and may simply be less metabolically active than males. Exposure to CSF2 from day 5 7 reverses differences between female and male embryos by decreasing length and IFNT release in female embryos while increasing it in males. Concomitantly, CSF2 pr ogrammed gene expression of female embryos differently than for male embryos. In most cases, genes whose expression at day 15 was altered by prior exposure to CSF2 from day 5 7 were different for female embryos

PAGE 98

98 than for male embryos. In the few cases wher e the same gene was altered in expression by CSF2 in females and males, regulation was in opposite directions. A similar phenomenon was observed when examining characteristics of the methylome in that DMR tended to be different for females and males and w hen the same, were most often regulated in opposite directions. CSF2 is a good candidate for transmitting information about the maternal environment to the embryo. Produced by the luminal and glandular epithelium of the endometrium [27] expression of CSF2 is sensitive to perturbation in response to the maternal environment. In particular, expression of CSF2 in the bovine oviduct was reduced in obese cows [34] while accumulation of CSF2 or steady stage amounts of CSF2 mRNA in the endometrium was increased by deposition of semen in human, pig and mice [33, 193, 269] One component of semen responsible for increased expression of CSF2 in the mouse is Tgfb [33] Other embryokines exist that could potentially be involved in developmental programming. Among the embryokines in the cow are IGF1 [270] TGFB [20] LIF [20] and FGF2 [22] While each of these molecules can affect embryonic development, it is not known whether their actions on the embryo also depend upon sex It is also not clear how the sex dependent changes in embryo function seen he re affect the survival of the embryo or the physiology of the resultant neonate. In female embryos, treatment with CSF2 from day 5 7 increases the proportion of embryos that establish and maintain pregnancy after transfer to recipient females [18] Thus, the reduction in embryo length and IFNT secretion at day 15 is not inimical to embryo survival. Among the genes upregulated by CSF2 in females were several candidates

PAGE 99

99 related to oxidative phosphorylation and it may be that increased capacity of the EEM to s survival. There is no comparable information about the effects of CSF2 on subsequent survival of male embryos. CSF2 altered gene expression in male embryos in a manner suggesting decreased metabolism of protein and increased invasion of cells in male em bryos and these actions could potentially limit embryo survival. There is also no information regarding the consequences of CSF2 treatment from day 5 7 on characteristics of the resultant calves. Data that CSF2 causes sex specific changes in the methylo me suggest the possibility of long term changes that could extend into fetal or postnatal life. An important unresolved question is the molecular basis for the differential response of female and male embryos to CSF2. One facet of this response may invol ve the nature of genes regulated by CSF2, which include an overrepresentation of genes and CpGs that are also regulated by sex Over 50% of the DEG and 35% of the DMR regulated by CSF2 were among the small pool of genes and DMR that were regulated by sex One possibility is that CSF2 regulates transcription factors and other signaling systems responsible for sex regulated differences in gene expression. Alternatively, a large fraction of genes regulated by sex have transcription factors or regulatory ele ments also regulated by CSF2. In conclusion, we present data to indicate a mechanism for sexual dimorphism in developmental programming. In particular, treatment of preimplantation embryos with the maternally derived cytokine, CSF2, from Day 5 7 of development changes subsequent devel opment so that, at a later stage of pregnancy, Day 15, embryonic

PAGE 100

100 development is altered with respect to length, secretion of the pregnancy signal, IFNT, the transcriptome, and the methylome. Alterations in these characteristics caused by CSF2 were differen t between female and male embryos, with effects being often in the opposite direction. We conclude that alterations in secretion of maternal regulatory factors caused by change in maternal environment could modify the developmental program of the female em bryo differently than for the male embryo.

PAGE 101

101 Table 3 1. List of primers used for qPCR. Gene Gene ID Sequence HSP90B1 NM_174700.2 Forward 5' CAGGAACAGACGAGGAAGAAC 3' Reverse 5' CTCTCCACACAGCATCCAAA 3' PAGE4 NM_001081580.2 Forward 5' CATGGAACCTGGACAAGAGAAG 3' Reverse 5' CAAGCTCACCCTCAACCTTT 3' NDUFB1 NM_175809.2 Forward 5' TGTACTTGTCCCTATGGGATTTG 3' Reverse 5' TTGTTCCGGAAGGCAGTTAG 3' PAG2 NM_176614.1 Forward 5' CCCTCAAGCCTACATCATCAA 3' Reverse 5' CCAAGGATCCAGGTGTTTAGAG 3' EIF3C NM_001034618.2 Forward 5' TTGCTGAGTGAGGATGAAGAAG 3' Reverse 5' CATTACGGATGGTCCGGATAAG 3' PEX10 NM_001076333.1 Forward 5' CGAACCATGCAGAGGAAAGA 3' Reverse 5' GGTTATACACTCCCAGCAGAAC 3' XIST NR_001464.2 Forward 5' TTGGCTTTTAGATTAATTTGATGAACAGCAT 3' Reverse 5' CCCTTTAGACTAGGCCCATTTCATA 3' PCMTD1 NM_001081526.1 Forward 5' CCCAGTATATCCGCACTGAAAG 3' Reverse 5' GTCTCGGTAGCCTTCCAAATAG 3' AMACR XM_002696385.2 Forward 5' TGGTGGAAGGAACAGCATATC 3' Reverse 5' GAAAGGAGCTCCACCATCTAAC 3' GAPDH NM_001034034.2 Forward Reverse ACCCAGAAGACTGTGGATGG CAACAGACACGTTGGGAGTG YWHAZ SDHA BM446307 NM_174178 Forward Reverse Forward Reverse GCATCCCACAGACTATTTCC GCAAAGACAATGACAGACCA GCAGAACCTGATGCTTTGTG CGTAGGAGAGCGTGTGCTT

PAGE 102

102 Table 3 2 Validation of microarray results by determination of the correlation between fluorescent intensity on the array with C T value in qPCR. Gene Correlation coefficient P HSP90B1 0.86 <0.05 PAGE4 0.84 <0.05 NDUFB1 0.74 <0.05 PAG2 0.74 <0.05 EIF3C 0.47 NS PEX10 0.17 NS XIST 0.89 <0.05 PCMTD1 0.09 NS AMACR 0.73 <0.05

PAGE 103

103 Figure 3 1. Sex by CSF2 interaction affecting length of the embryo and accumulation of IFNT in uterine flushings at day 15 of pregnancy. Panel A depicts a representative electrophoretogram of results of the PCR procedure used to sex embryos. Shown are results for three embryos as well as control male and female DNA. The band located at 216 bp represents an amplicon from an automosal satellite DNA sequence while the band at 141 bp represents an amplicon from the Y chromosome. Interactions between CSF2 treatment from day 5 7 of development and sex on embryo length and concentration of IFNT in uterine flushing are shown in Panel B. Data are the least squares means SEM of results from 7 8 males and 6 8 females per treatment. The treatment x sex interaction was significa nt (P<0.05) for both endpoints.

PAGE 104

104 Figure 3 2. Venn diagram illustrating differentially expressed transcripts at day 15 of pregnancy in male and female embryos treated with CSF2 or control medium from day 5 7 of development. Gene symbols represent differ entially expressed genes that were annotated. Genes displayed in red increased in expression (female > male or CSF2 > control) while genes displayed in green decreased in expression.

PAGE 105

105 Figure 3 3. Diagram illustrating genes encoding for proteins in t he electron transport chain that were differentially expressed between control female and male embryos at day 15 of pregnancy. Genes upregulated in females are in red and genes upregulated in males are in green.

PAGE 106

106 Figure 3 4. Biological processes predicted to vary with sex in control embryos. Panel A shows the canonical pathways containing an overrepresented number of differentially expressed genes. Only pathways with 3 or more genes are shown. Gene symbols represent differentially expressed genes for each pathway; genes in red were upregulated in fe males and genes in green are upregulated in males. Panels B D display analyses of predicted differences in cellular function between female and male embryos. Genes in red were upregulated in females while genes in green were upregulated in males (we need to change this). Blue lines represent genes in which the observed change in gene expression are predicted to inhibit the biological function, yellow lines represent genes where the effect of differential expression is inconsistent with the predicted stag e of the process and grey lines represent relationships that are not predicted. Biological processes in blue are predicted to be inhibited. Analysis indicates that female embryos were likely to be less active in expression of protein, translation, and tran slation of protein (panel B), metabolism of protein (panel C) and transport of lipid (panel D) than male embryos.

PAGE 107

107 Figure 3 5. Predicted changes in cellular function in male embryos at day 15 of pregnancy caused by CSF2 treatment between day 5 7 of d evelopment. Genes labeled in red were upregulated by CSF2 while genes labeled in green were downregulated by CSF2. Orange lines represent genes where the change in expression is predicted to active the biological function while blue lines represent genes in which the observed change in gene expression is predicted to inhibit the biological function. Yellow lines represent genes where the effect of differential expression is inconsistent with the predicted state of the process and the gray line represents a relationship that is not predicted. Biological processes in blue are predicted to be inhibited. Analysis indicates that embryos treated with CSF2 were likely to experience decreased metabolism of protein and increased invasion of cells.

PAGE 108

108 Figure 3 6. Venn diagram illustrating differentially methylated probes at day 15 of pregnancy in male and female embryos treated with CSF2 or control medium from day 5 7 of development.

PAGE 109

109 Figure 3 7. Non random clustering of differentially methylated probes exa mple from bovine chromosome 1. The probability that the actual number of differentially methylated probes (DMR) in a 5 Mbp segment was greater than due to chance was determined by chi square analysis after calculating the expected frequency of DMR if loca tion of DMR was randomly distributed throughout the genome. The analysis was performed using sliding windows of 5 Mbp that shifted by 500 Kbp at a time until reaching th e end of the chromosome. The F igure shows the chi square value for 5 Mbp regions wher e the number of DMR was greater than expected due to chance. Bars of orange and red represent regions where for female embryos the number of hyper and hypomethylated DMRs was greater. Blue and green bars represent regions for male embryos where the numb er of hyper and hypomethylated DMRs was greater than expected due to chance.

PAGE 110

110 Figure 3 8. Model illustrating a mechanism for achievement of sex specific developmental programming in response to a change in maternal environment. In this model, a change in maternal environment alters secretion of uterine embryokines such as CSF2. The resultant alteration in the trajectory of development is different for female embryos than male embryos so that subsequent characteristics of the em bryo and neonate are modified differently for each sex In the particular example of CSF2, exposure to CSF2 from days 5 7 of development causes different and often opposite actions on development reflected in characteristics of the embryo at day 15 of deve lopment.

PAGE 111

111 CHAPTER 4 DYNAMICS OF DNA METHYLATION DURING EARLY DEVELOPMENT OF THE PREIMPLANTATION BOVINE EMBRYO Introduction Following fertilization, the embryo remains in a state of transcriptional quiescence that is maintained until a species specific stage (8 16 cell stage in the cow, 2 cell stage in the mouse, 4 cell stage in the pig and 4 8 cell stage in the human) when tra nscription is resumed through a process referred to as EGA [271] In the mouse, activation of transcription is preceded by a decrease in global methylation of DNA as a result of active and passive demethylation that begins at the zygote stage and persists through the morula stage [73, 74] Demethylation is followed by a wave of DNA methylation beginning at the blastocyst stage [84] that is mediated by de novo methylt ransferases Dnmt3A and Dnmt3b [82, 84] Overall levels of methylation in the blastocyst are greater for ICM than TE [84] Epigenetic remodeling is important for EGA because mouse embryos in which the chromatin remodeling gene, Brg1 was knocked out exhibited arrest at the 2 cell stage and decreased transcr iption [272] Moreover, injection of siRNA for the H3K27me3 demethyltransferase JMJD3 decreased competence of bovine embryos to develop to the blastocyst stage [273] Nonetheless, developmental patterns of de novo methylation in early development are not conserved a cross mammalian species. The demethylation occurring during early cleavage stages in the mouse also occurs in sheep [85] but not in the pig [86] or rabbit [274] By the blastocyst stage, the ICM is more methylated than the TE in the sh eep [85] and pig [86] while, in the rabbit, the ICM is less methylated than TE [274] De novo methylati on is not as clearly understood in other species. In the sheep, overall DNA methylation declines from the two cell stage

PAGE 112

112 until the blastocyst stage and the ICM is more methylated than the TE [85] The ICM is also more methylated than the TE in the pig blastocyst, but unlike the mouse and sheep, there is no apparent loss of DNA methylation from the two cell to morula stages of development [86] Results are unclear in the bovine embryo, with one report indicating widespread demethylation occurs through the 8 cell stage before methylation increases at the 16 cell stage of development [87] while another report indicates that demethylation persists through the morula stage [88] The difference in methylation between the ICM and TE of the bovine blastocyst is also unclear, with one report indicating higher methylation in the ICM [87] and another indicating higher methylation in TE [88 ] Developmental changes in the embryonic methylome are also likely to be modified by genetics of the embryo and the environment in which it resides. Genetic sex can have profound effects on development of the embryo as early as the blastocyst stage when, for example, total transcript abundance in cattle is higher in female blastocysts than male counterparts [245] Expression of de novo methyltransferases is also differentially expressed between the two sexes with female blastocysts in the cow having lower expression of DNMT3A and DNMT3B compared to male blastocysts [268] Signals derived from the mother can also affect embryonic development in a way that improves competence for survival after transfer into fema les, as has been demonstrated in the cow for CSF2 [18] insulin like growth factor 1 [129] and hyaluronan [21] The molecular basis for improvement in competence for long term developme nt is not known but could include remodeling of the epigenome. Indirect evidence for epigenetic programming during early development is the observation that treatment of embryos

PAGE 113

113 with CSF2 from Day 5 7 of pregnancy improves late embryonic and fetal survival much later in pregnancy (after Day 30 35 of gestation) [18] In this study, we characterized dynamics of DNA methylation during early development in the cow and determined whether degree of methylation depends upon cell lineage (ICM vs TE), sex and exposure to CSF2. In addition, developmental changes in expression and methylation of DNMT3B were assessed to determine whether developmental changes in DNA methylation could conceivably be due to differences in activity of this methylase. Experimental Procedures Embryo Production In vitro production of bovine embryos was performed as previously described [22] unless otherwise no ted. COC were obta ined with permission by cutting the surface of slaughterhouse (Central Beef Packing Co. (Center Hill, FL, USA) derived ovaries with a scalpel and vigorously rinsing the ovary through a bath of oocyte collection medium [tissue culture medium s salts without phenol red (Hyclone, Logan UT), 2% (v/v) bovine steer serum (Pel Freez, Rogers, AR), 2 U/ml heparin, 100 U/ml penicillin G, 0.1 mg/ml streptomycin and 1mM glutamine]. Groups of 10 COC were ium [tissue culture medium 199 with g/ml estradiol 17 g/ml bovine follicle stimulating hormone (Bioniche Life Sciences, Belleville, Ontario, Canada), 22 g/ml sodium pyruvate 50 g/ml gentamicin sulfate and 1 mM glutamine] covered with mineral oil. Maturation proceeded for 20 hours at 38.5 o C and in a humidified atmosphere of 5% (v/v) CO 2 Up to 300 matured oocytes were fertilized

PAGE 114

114 with Percoll purified sperm (1 x 10 6 ) for 8 hours in 1.7 ml of SOF FERT [221] Cumulus TALP [250] contai ning 1, 000 U/ml hyaluronidase. Embryos were then cultured in 25 l microdrops of SOF BE1 [22] covered with mineral oil at 38.5 o C in a humidified atmosphere of 5% (v/v) O 2 and 5% (v/v) CO 2 with the balance N 2 Cleavage rate was assessed at Day 3 post insemination (pi) and embryos were cultured until Day 7 pi. Immunofluorescent Labeling f or 5 Methylcytosine All labeling steps were pe rformed at room temperature unless otherwise stated and in a volume of 100 l (either in microdrops covered with oil or in wells of a 96 well plate). Embryos were harvested from culture drops, washed in DPBS containing 1% (w/v) polyvinylpyrrolidone (PVP) ( Kodak, Rochester, NY, USA) and fixed in 4% (w/v) paraformaldehyde in DPBS PVP for 15 min. The fixed embryos were washed three times in DPBS PVP, permeabilized for 20 min in 0.25% Triton X 100 (Fisher Scientific, Waltham, MA, USA) diluted in DPBS, and wash ed three times in 0.1% (v/v) Tween 20 with wash buffer [DPBS containing 10 mg/ml fraction V BSA (Sigma Aldrich, St. Louis, MO, USA)]. Embryos were then incubated for 1 hour Valencia, CA, USA) diluted in DPBS PVP at 37C, washe d three times in wash buffer and then incubated at 37C for 30 min with 3 M HCl/ 0.1% (w/v) PVP. The pH was neutralized by incubation of embryos for 10 min with 100 mM Tris HCl, pH 8.5 containing 1% (w/v) PVP followed by three washes with wash buffer. No nspecific binding sites were blocked by incubation with DPBS containin g 5 mg/ml BSA for 1 h. Embryos were then transferred to a solution of 1 g/ml anti 5 methylcytosine (affinity purified mouse monoclonal antibody; (Calbiochem, Darmstadt, Germany) diluted in DPBS containing 0.05% (v/v) Tween 20 and 0.01% (w/v) BSA. As

PAGE 115

115 a negative control, anti 5 methylcytosine was replaced with an irrelevant mouse IgG1 antibody (Sigma Aldrich, St. Louis, MO, USA). After 1 h, embryos were washed three times in wash buffer a conjugated anti mouse IgG (Abcam, Cambridge, MA, USA). After three washes, nuclei PVP for 15 min. Embryos were washed three times and mounted with coverslips on slides using ProLong Gold Anti Fade mounting medium (Invitrogen, Carlsbad, CA, USA) and observed under a Zeiss Axioplan epifluorescence microscope (Zeiss, Gttingen, Germany). Images were acquired using a 40x ob jective and FITC, blue and rhodamine filters. The exposure times were constant for all embryos analyzed in an individual replicate. Immunofluorescent Labeling f or 5 Methylcytosine and CDX2 In one experiment, labeling with antibody to 5 methylcytosine wa s determined for ICM and TE using anti CDX2 to label TE [46] Embryos were labeled for anti methylcytosine as described above, washed six times and t ransferred to a solution of antibody against CDX2 (affinity purified mouse monoclonal antibody against CDX 2, ready to use solution; BioGenex, San Ramon, CA, USA) for 1 h. Embryos were washed goat anti mouse IgG diluted in DPBS containing 0.05% (v/v) Tween 20 and 0.01% (w/v) BSA for 1 h. Embryos were then washed, labeled with PI, mounted on slides and examined as described above. Image Analysis Using Imagej Immunofluorescent intensity was qua ntified using ImageJ software (version 1.60_41, NIH, Washington DC, USA). For two color images (green for 5 methylcytosine

PAGE 116

116 and red for nuclei), individual nuclei were identified by PI labeling and outlined using the free hand tool on imageJ. Mean gray int ensity of the green and red images were determined separately. The ratio of intensity for green and red (5 methylcytosine/DNA) was calculated for each nucleus. Values for all analyzed nuclei from a single embryo were averaged to obtain the average degree of methylation for that embryo. A similar process was used for three color images except that staining for CDX2 was used to distinguish between TE (blue nuclei) and ICM (no blue labeling) and values were averaged separately for TE and ICM. Separation of TE and ICM by Magnetic Activated Cell Sorting Magnetic activated cell sorting was performed as previously described with modifications [223] Blastocysts at Day 7 were harvested and incubated in acidic pellucida free blastocysts were washed three times in MACS buffer [DPBS with 0.5% (w/v) BSA and 2 mM ethylenediaminetetraacetic acid (EDTA), pH 7.2]. Blastocysts were then incubated for 10 min in concanavalin A conjugated with FITC (Sigma Aldrich, St. Louis, MO, USA; ConA FITC, 1 mg/ml in MACS buffer). Following three washes in Aldrich, St. Louis, MO, USA) in MACS buffer for 3 min. Hoechst 33342 labeled blastocysts were then washed three times in MACS buffer and incubated in DPBS containing 1 mM EDTA for 5 min followed by incubation in 0.05% (w/v) trypsin 0.53 mM EDTA solution (Invitrogen Ca rlsbad, CA, USA) for 10 min at 38.5C. Groups of 20 30 blastocysts were then disaggregated into single blastomeres by vortexing three times for 10 sec each. and 10% (v/v) fe tal bovine serum (Atlanta Biologicals, Norcross, GA, USA) followed by

PAGE 117

117 three washes in MACS buffer by centrifugation at 500 x g for 5 min. Large blastomere Biosciences, San Jose, CA, USA). Single blastomeres that passed through the strainer buffer. The re conjugated to mouse ant i FITC (Miltenyi Biotec, Auburn, CA, USA) for 15 min on ice. Following three washes by centrifugation at 500 x g for 5 min, the magnetic bead columns (Miltenyi biotec, Aubur n, CA, USA) attached to a magnetic board (Spherotech, Lake Forest, IL, USA). The FITC MACS buffer washes followed by FITC positive (TE) elution by removing the MACS separation column from the magnetic boa buffer. Purity of eluted ICM and TE using this technique is >91% [223] Reverse Transcription and Quantitative PCR Analysis of gene expression was accomplished by quantitative reverse transcription PCR. Pools of embryos were treated with 0.1% (w/v) proteinase from Streptomyces griseus to remove the zona pelluicida, washed three times in 50 l droplets of DPBS with 1% (w/v) PVP, placed in 100 l extraction buffer from the PicoPure RNA isolation kit (Applied Biosystems, Carlsbad, CA, USA) and heated at 42C for 30 min. Total RNA was extracted using the PicoPure RNA isolation kit (Applied Biosystems), treated with 2 U of DNase (New England Biolabs, Ipswich, MA, USA) at 37C for 30 min to remove DNA, and then incubated at 75C for 15 min to denature DNase. DNase treated RNA was then reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosys tems). Reverse transcription

PAGE 118

118 occurred using random hexamer primers and involved incubation at 25C for 10 min, 37C for 120 min and 85C for 5 min. The cDNA was stored at 20C until further use. Negative controls for real time PCR were also performed b y incubation without reverse transcriptase. cDNA was utilized for real time PCR analysis. For detection of transcript levels, a CFX96 Real Time PCR detection System (Bio Rad, Hercules, CA, USA) utilizing SsoFast EvaGreen Supermix with Low ROX (Bio Rad). Each reaction contained 1 l Evagreen Supermix (Bio Rad), 6.8 l H 2 O and 1.2 l of cDNA sample (0.6 embryo equivalents). Amplification conditions were: 95C for 30 sec, 40 cycles at 95C for 5 s ec, 60C for 5 sec, and 1 cycle of melt curve analysis at 65 T value was determined by subtracting the C T value of the sample by the geometric mean of the C T for three housekeeping genes, SDHA GAPDH and YWHA Z [224, 257] The primer sequence for DNMT3B GGGAAGGAGTTTGGAATAGGAG CGGAGAACTTGCCATCACC [275] High Resolution Melting Analysis The MS HRM (methylation specific high resolution melting analysis) procedure was based on Wojdacz and Dobrovic [276] MS HRM is a procedure that uses an intercalcating dye and sensitive thermocycler to detect single nucleotide changes within an amplicon based on the temperature at which that dsDNA sequence denatures [276, 277] In the case of methylation analysis, nucleotide changes are induced by bisulfite conversion of cytosines (but not methylcytosine) to uracil and, following DNA replication, thymidine.

PAGE 119

119 As a preliminary step, 0% and 100% methylated standards were generat ed for use in standard curve generation. For the 0% methylation control, bovine embryonic fibroblast cells derived from skin cells of a fetus at 2 3 mo nths of gestation were cultured for 1 w ee azacytidine (to inhibit DN A methylation). The concentration of 5 azacytidine used was chosen because it was the highest concentration that did not cause complete loss of cell growth. Other cells were cultured without 5 azacytidine. Cells were collected, stored at 80C until extr action of DNA and RNA extraction using the AllPrep DNA/RNA Mini kit (Qiagen, Valencia, CA, USA). gDNA and total RNA were stored at 80C in extraction buffer and RNase free water, respectively, until ready for use. A sample of 100% methylated DNA was pre azacytidine with SssI methylase (New England Biolabs, Ipswich, MA, USA) for 1 hour at 37C. gDNA was then treated with bisulfite using the Imprint DNA modification kit (Sigma Al drich, St. Louis, MO, USA) and frozen at 20C until further use. Samples of 0 and 100% methylated gDNA were mixed together to create samples of 0, 5, 25, 50, 75 and 100%, methylated gDNA. High resolution melting analysis was performed using a BioRad C10 00 thermal cycler with CFX96 Real time system and Precision Melt analysis software (BioRad, Hercules, CA, USA). PCR conditions were set to the following: 95C for 2 min, 45 cycles of 95C for 10 sec, 60C for 30 sec, 72C for 30 sec, and heteroduplex form ation

PAGE 120

120 at 95C for 30 sec and 60C for 1 min. Subsequently, high resolution melting was performed at 0.2C increments from 65C to 95C. Primers were designed using Methyl Primer Express 1.0 (Applied Biosystems, Carlsbad, CA, USA) with settings to include at converted and non bisulfite converted sequences to decrease bias [278] Primers were designed to amplify an intronic 81 bp sequence containing 5 CpG. This region of DNMT3B was chosen based on the estimation of a CpG island as determined by Methyl Primer Express (Applied Biosystems, Carlsbad, CA, USA). The primer sequence for HRM DNMT3B GGAYGGGTTTTAGGTTTGGGTATT CAAACCCCCRCAAAATAATTCT Primers were generated by Integrated DNA Technologies (Coralville, Iowa, USA). A standard curve was ru n for each PCR procedure using gDNA of 0 100% methylation and prepared as described above. The difference relative fluorescence units (DRFU) were recorded at the melting peak for each sample. All samples were analyzed in duplicate. The relationship betwe en methylation percent and DRFU was exponential. The standard curve was calculated and used to obtain the degree of methylation for samples. Design of Experiments The first experiment was conducted to determine developmental changes in DNA methylation. Embryos were fertilized with X sorted spermatozoa (Genex Cooperative, Shawano, WI, USA, Accelerated Genetics, Baraboo, WI, USA and Select Sires, Plain City, OH, USA) from three separate bulls and then placed into culture with SOF BE1. Separate drops of e mbryos were cultured to allow harvest of 2 cell embryos [28 32 hours post insemination (hpi)], 4 cell embryos (52 56 hpi), 6 8 cell embryos (76 80 hpi),

PAGE 121

121 9 25 cell embryos (104 hpi), 32 cell morula stage embryos (148 152 hpi) and blastocyst stage embryos (1 76 hpi). Embryos were analyzed for DNA methylation by labeling with anti 5 methylcytosine and PI as described above. The experiment was replicated on 6 occasions and a total of 11 24 embryos per stage were subjected to labeling for anti 5 methylcytosine. The effect of sex on DNA methylation was determined by fertilizing oocytes with either X sorted spermatozoa or Y sorted spermatozoa (Accelerated Genetics, Baraboo, WI, USA) from the same bull, using three separate bulls for each replicate. Embryos were t hen cultured and harvested from separate drops at either the 6 8 cell stage (76 80 hpi) or blastocyst stage (176 hpi) for analysis of labeling with anti 5 methylcytosine. The experiment was replicated on 3 occasions and a total of 11 21 embryos per stage w ere subjected to labeling for anti 5 methylcytosine. Effects of CSF2 and cell lineage (ICM and TE) on DNA methylation in the blastocyst were tested as follows. Oocytes were fertilized with either X sorted spermatozoa or Y sorted spermatozoa (Accelerated Genetics, Baraboo, WI, USA) from the same bull, using three separate bulls for each replicate. Embryos were then placed in 45 l drops of SOF BE1 and cultured for 7 d. At Day 5 pi, 5 l of 100 ng/ml recombinant bovine CSF2 (Novartis) in vehicle [DPBS and 1% (w/v) BSA] or vehicle alone was added. The concentration of CSF2 was chosen based on its effectiveness for increasing development to the blastocyst stage and embryonic survival after transfer into recipient females [24] Blastocysts were harvested at Day 7 pi and subjected to labeling with anti 5 methylcytosine, anti CDX2 and PI. The experiment was replicated

PAGE 122

122 on 3 occasions and a total of 14 26 embryos per stage were subjected to la beling for anti 5 methylcytosine. Developmental changes in expression of DNMT3B were determined in another experiment. Embryos were fertilized with conventional semen (Androgenics, Oakdale, CA, USA and Nebraska Bull Service, McCook, NE, USA) using three different bulls for each replicate and then placed into culture with SOF BE1. Se parate drops of embryos were cultured to allow collection of groups of 30 zygotes (0 hpi), 2 cell (28 32 hpi), 3 4 cell (48 hpi), 5 8 cell (56 60 hpi), 9 16 cell (72 hpi), >16 cell (120 hpi) and blastocyst stage (168 hpi) embryos. RNA was extracted as des cribed above and used for RT PCR. The experiment was replicated on 5 occasions. Methylation of an intronic region of DNMT3B was determined in two experiments. In the first experiment, embryos were collected at the 6 8 cell stage (76 80 hpi) and at the b lastocyst stage (176 hpi). In the second, blastocysts were harvested at 176 hpi and ICM and TE isolated using MACS. In both experiments, embryos were fertilized with conventional semen (Androgenics, Oakdale, CA, USA and Nebraska Bull Service, McCook, NE, USA) using three different bulls for each replicate and then placed into culture with SOF BE1. In the first experiment, embryos were collected in groups of 18 48, treated to remove the zona pellucida and snap frozen in liquid N 2 before storage at 80C un til ready for use in MS HRM analysis. A total of 3 pools of embryos were collected at each stage of development. In the second experiment, groups of 20 40 blastocysts were subjected to the MACS procedure to isolate ICM and TE and cells frozen in 20 l of MACS buffer (DPBS with 0.5% (w/v) BSA and 2 mM EDTA, pH 7.2) at

PAGE 123

123 80C until ready for MS HRM. The experiment was replicated with 8 pools of ICM and TE. Statistical Analysis Data were analyzed by least squares analysis of variance using the GLM procedure of the Statistical Analysis System version 9.3 (SAS Institute Inc., Cary, NC, USA). Depending on the experiment, sources of variation included replicate, stage, sex cell type (ICM and TE), treatment (CSF2 or vehicle) as well as all interactions. Replicat e was considered a fixed effect. For real time PCR results, treatment effects T values and graphed as fold change differences relative to values for oocytes. All data are shown as least squares means standard error of the means. Resu lts Changes in DNA Methylation during Development to the Blastocyst Stage Representative images of labeling for 5 methylcytosine from the 2 cell stage through blastocyst development are presented in Figure 4 1 while results from quantitative analysis are presented in Figure 4 2. There was an effect of stage of development on immunoreactive 5 methylcytosine (P<0.0001), with amounts decreasing from a peak at the 2 cell stage to a nadir at the 6 8 cell stage. Thereafter, immunoreactivity increased to the bla stocyst stage. Effect of Sex on DNA Methylation Embryos were fertilized separately with X and Y sorted sperm from the same bull to produce either female or male embryos. DNA methylation was examined at either the 6 8 cell or blastocyst stages of develop ment by evaluating labeling with anti 5 methylcytosine. Results are shown in Figure 4 3. DNA methylation was greater for embryos at the blastocyst stage than at the 6 8 cell stage (stage of development;

PAGE 124

124 P<0.0001). There were, however, effects of sex (P=0. 0029) and sex x stage (P=0.0007). The interaction occurred because female embryos had more intense labeling for 5 methylcytosine than male embryos at the 6 8 cell stage but lower labeling than male embryos at the blastocyst stage. DNA Methylation in Blas tocysts as Modulated b y Sex CSF2 and Cell Differentiation Use of CDX2 to distinguish between ICM and TE revealed that fluorescent activity for immunoreactive 5 methylcytosine was lower in ICM than TE. A representative blastocyst is shown in Figure 4 and quantitative analysis is summarized in Figure 5. As seen i n the previous experiment, DNA was less methylated in female embryos than male embryos (P<0.02) and this was apparent in both the ICM and TE compared to the TE (Figure 4 5). There was no effect of CSF2 or interactions of CSF2 on degree of methylation in ei ther the ICM (0.53 0.09 vs. 0.46 0.07 for CSF2 and vehicle, respectively) or TE (1.17 0.09 vs. 1.18 0.07 for CSF2 and vehicle, respectively). Developmental Changes in DNMT3B Gene Expression To determine whether developmental changes in DNA me thylation could conceivably be caused by changes in DNMT3B activity, changes in expression of DNMT3B from the zygote to the blastocyst stage were determined (Figure 4 6). Stage of development affected (P<0.0001) steady stage amounts of DNMT3B mRNA. Express ion increased between the zygote stage and 2 cell stage and then declined to a nadir for embryos at the >16 cell stage of development. Thereafter, steady state concentrations of DNMT3B increased at the blastocyst stage.

PAGE 125

125 Developmental Changes in Methylati on of DNMT3B The possible role of methylation in controlling developmental changes in expression of DNMT3B was evaluated by determining changes in the degree of methylation in an 81 bp CpG rich intronic region of DNMT3B (Figure 4 7A). A representative stan dard curve is shown in Figure 4 7B and representative results in Figure 4 8A. Methylation in the analyzed region, which contains 5 CpGs, was higher (P<0.0001) for 6 8 cell embryos than for embryos at the blastocyst stage (Figure 4 8B). When ICM and TE we re separated by MACS, there was no significant difference (p=0.25) in methylation of DNMT3B between ICM (70.2 9.8%) or TE (56.3 8.6%). Discussion Epigenetic control of gene expression is an important aspect of early embryonic development. Using the preimplantation bovine embryo as a model, it was observed that dynamic changes in DNA methylation occur throughout development in a manner that depends on sex and cell type. Changes in DNA methylation were associated with similar changes in expression and methylation of DNMT3B, indicating that, as for the mouse [82] this gene may play an important role in modification of the embryonic methylome. There is a steady de crease in overall level of DNA methylation as the mouse embryo undergoes successive cell division [75] A similar loss occurs in the developing sheep embryo [85] and as shown here, the bovine embryo (Figure 4 2). In contrast, there appears to be no widespread demethylation during early cleavage divisions in the pig [86] or rabbit [274] In the mouse, the loss of methyl ation during early development occurs as a result of both passive [279] and active [280] demethylation. Passive demethylation occurs when DNA replication occurs without the presence of DNMT1 to

PAGE 126

126 methylate the newly replicated strand [281] while active DNA demethylation is thought to occur by base excision repair mechanisms utilizing glycolysis or deaminatio n of 5 methylcytosine although the exact enzymes responsible are still unknown in mammals [282] The bovine embryo is also similar to the mouse embryo in that the period of demethylat ion is followed by a period of de novo methylation (Figure 4 2). In the cow, methylation begins following the 6 8 cell stage and is coincident with activation of the embryonic genome [283] Re establishment of methylation marks on DNA in the mouse embryo is accomplished by the de novo methyltransferases Dnmt3a and Dnmt3b [82] Knockout of Dnmt3b caused incomplete methylation of pluripotent genes in the mouse embryo [82, 284] Current results implicate DNMT3B as involved in de n ovo DNA methylation in the cow based on the observation that steady state amounts of mRNA for DNMT3B parallels the pattern of methylation (Figures 4 2 and 4 6). In fact, DNMT3B itself might be under the control of methylation because methylation of an int ronic region within DNMT3B was lower at the blastocyst stage than at the 6 8 cell stage (Figure 4 8B). The role of methylation in DNMT3B expression can be further clarified through experiments to detail the methylation landscape of DNMT3B more fully as we ll as the consequences of changes in methylation on DNMT3B expression. It is also likely that there is regulation of DNMT3B transcription independent of DNA methylation. Developmental patterns of methylation in the preimplantation embryo diverge between the mouse and cow at the blastocyst stage of development. In the mouse, the ICM is more highly methylated than the TE [76] while current resu lts indicate the ICM is less methylated than TE in the cow (Figure 4 4). Indeed, there is much divergence

PAGE 127

127 between species in overall levels of methylation in the ICM and TE, with the sheep and pig showing a pattern similar to the mouse [85, 86] and with the ICM less methylated than the TE in the rabbit [274, 285] One implication of the species variability in DNA methylation patterns in the blastocyst is that there is likely to be signif icant differences between species in the genes that are differentially regulated between ICM and TE. One example is OCT4 (i.e, POU5F1 ). In the mouse, Oct4 is strictly expressed in the ICM while OCT4 in cattle is expressed in both ICM and TE [94] A genome wide study of the bovine ICM and TE revealed genes that exhibited different patterns of differential expression than is the case in mice or humans [286] Sex of the bovine embryo is an important factor that affects development as early as the first cleavage, when the sex ratio is skewe d towards males [50] SRY is expressed as early as the 8 cell stage of development [287] more male embryos than female embryos develop past the 8 cell stage of development [288] and male embryos become blastocysts at a more rapid rate than females [50, 288, 289] At the blastocyst stage, gene expression is affected by sex with the overall level of transcription being greater for female embryos [245] Methylation is likely to play a role in establishing sex patterns of transcription. Earlier studies reported differences in degree of methylation of specific genes at the blastocyst stage [8, 268, 290] Here we show that the overall level of DNA methylation at the blastocyst stage was lower for female embryos than male blastocysts (Figure 4 3). Such a sex difference would be expected if DNA methylation is important for the higher transcript abundance for female blastocysts [245] Earlier in development, at the 6 8 cell stage, DNA is more methylated for female embryos (Figure 4 3), probably because the rate of demethylation was less for female embryos.

PAGE 128

128 DNA methylation can be altered by development in vitro [8] Thus, it will be necessary to determine the extent to which changes in DNA methylation caused by stage of development, cell lineage and sex seen here also occur for embryos developing in vivo. Moreover, it is possible that regulatory molecules such as CSF2 [18] insulin like growth factor 1 [129] and hyaluronan [21] that improve competence of the in vitro produced embryo to survive after transfer into recipients could exert their action, at least in part, by regulating DNA methylation. This hypothesis was tested in the present experiment for the maternally derived cytokine CSF2 [27] There was no effect of CSF2 treatment on the overall level of DNA me thylation at the blastocyst stage (Figure 4 3C) so actions of CSF2 on the embryo that enhance its survival probably do not depend upon broad changes in DNA methylation. Nonetheless, it is possible that CSF2 causes changes in methylation of a more narrow s et of genes. There are long term consequences of embryonic treatment with CSF2 ( decreased pregnancy loss after Day 35 of gestation [18] ) that could represent epigenetic programming. In conclusion, preimplantation development of the bovine embryo is characterized by dynamic changes to DNA methylation that are dependent upon sex and cell lineage. In particular, global methylation declines to a nadir at the 6 8 cell stage and increases thereafter. Methylation is lower for female embryos than male embryos at the blastocyst stage and lower for the ICM than TE. The developmental pa ttern of DNA methylation in the cow is partially representative of events in the mouse, with the major difference being in the relative degree of methylation in ICM and TE. Like the mouse, changes in expression of DNMT3B may be responsible for developmenta l

PAGE 129

129 changes in DNA methylation because levels of methylation are related to expression of DNMT3B.

PAGE 130

130 F igure 4 1. Representative images of embryo s labeled for immunoreactive 5 methylcytosine at the 2 cell, 4 cell, 6 8 cell, 9 25 cell, 32 cell morula and blastocyst stages of development. The scale bar represents 26.75 m.

PAGE 131

131 Figure 4 2. Developmental changes in labeling of immunoreactive 5 methylcytosine from the 2 cell to blastocyst stages of development. Data represent the ratio of flu orescent intensity for anti 5 methylcytosine to that for propidium iodide. There was an overall effect of stage on labeling intensity (P<0.0001). Means with different superscripts differ (P<0.05). Data are least squares meansSEM of results from 11 24 embr yos per stage.

PAGE 132

132 Figure 4 3. Effects of sex on immunoreactive 5 methylcytosine in embryos at the 6 8 cell and blastocyst stages of development. Data represent the ratio of fluorescent intensity for anti 5 methylcytosine to that for propidium iodide. The solid line represents female embryos while the hashed line represents male embryos. Data are least squares meansSEM of results from 11 21 embry os per stage. Amounts of DNA methylation were affected by sex (P = 0.0029), stage of development (P<0.0001) and the stage sex interaction (P = 0.0007).

PAGE 133

133 Figure 4 4. Representative images of an embryo in which labeling with CDX2 (blue) was used to eva luate immunoreactive 5 methylcytosine (green) in ICM (CDX2 negative) and TE (CDX2 positive). Nuclei of all cells were labeled with propidium iodide (red). Panels represent merged images for all three fluorescent labels (A), 5 methylcytosine and PI (B), CD X2 and PI (C), CDX2 and 5 methylcytosine (D) and control antibodies for anti 5methylcytosine and anti CDX2 as well as PI (E). The scale bar is 20 m.

PAGE 134

134 Figure 4 5. Effects of sex and cell type [ ICM and TE ] on immunoreactive 5 methylcytosine in blastocysts. Data represent the ratio of fluorescent intensity for anti 5 methylcytosine to that for propidium iodide. Data are least squares meansSEM of results from 14 26 embryos per sex Amounts of DNA methylati on were affected by sex (P<0.02), and cell type (P<0.0001) but not the sex cell type interaction (P<0.25).

PAGE 135

13 5 Figure 4 6. Developmental changes in steady state mRNA for DNMT3B. Data for mRNA are expressed as fold change relative to amounts for zygotes and represent the least squares meansSEM of results from 5 pools of 30 embryos per stage. Means with different superscript s differ (P<0.05).

PAGE 136

136 Figure 4 7. Characteristics of the high resolution melt analysis for methylation of an intronic region of DNMT3B. Panel A shows the location of the intronic region between exons 7 and 8 that was analyzed. Note the presence of five CpG eligible for methylation in the 81 bp region amplified by PCR. Panel B is a representative result for the standard curve generated by analysis of a mix of control DNA at 0% and 100% methylation. The graph is a plot of the difference relative fluorescen ce units (RFU) as a function of shifted temperature (X axis normalization to reduce variation between wells).

PAGE 137

137 Figure 4 8. Developmental changes in DNA methylation for DNMT3B. Panel A is a representative result of analysis of samples from 6 8 cell embryos (lime green) and blastocysts (red). Panel B shows the degree of methylation between the two stages. Data represent least squares meansSEM of results from 3 pools of 23 48 embryos per stage. Methylation percent was higher at the 6 8 cell stage than at the blastocyst stage (P<0.0001).

PAGE 138

138 C HAPTER 5 GENERAL DISCUSSION The maternal environment is a critical component for the successful development of the embryo. Alterations in this microenvironment during preimplantation development can alter the developmental fate of the fetus, with potential consequences that extend i nto post natal life [13, 15, 99, 291] It was the assumption of this dissertation that effects of the maternal environment on the developmental trajectory of the preimplantation embryo are mediated, at least in part, by altered secretion of regulatory molecules from the endometrium that affect development. Indeed, a variety of molecules produced by th e endometrium have been identified that can affect development to the blastocyst stage and competence of the embryo to establish pregnancy. In the cow, these embryokines include IGF1 [292] IL1 [23] hyaluronan [21] TGFB [20] LIF [20] and FGF2 [22] The most well studied embryokine is CSF2, which has been shown to have a variety of effects on the preimplantation embryo of cattle [24] mice [26] pigs [189] and humans [25] including improved ability to develop to the blastocyst stage [24, 26, 189, 200] increased ICM numbers [18] resistance to apoptosis [31, 187] altered gene expression [30] and improved competence to establish pregnancy when embryos are transferred to f emales [18, 25, 26] The purpose of the research described in this dissertation, was to identify mechanisms by which CSF2 increases the competence of the bovine blastocyst to establish pregnancy. The conclusions derived from the dissertation are summarized in Figure 5 1. It was demonstrated in Chapter 4 that e arly preimplantation development is characterized by a loss in DNA methylation to a nadir at the 8 16 cell stage. At this time, the female embryo maintains a higher level of methylation than the male. Subsequently,

PAGE 139

139 methylation is increased but in a pattern where, a t the blastocyst stage, the TE is more methylated than the ICM. At this stage, DNA is less methylated for the female than the male. Sex effects on methylation may be important for actions of CSF2, which oc cur in a sex specific manner. At the blastocyst stage, CSF2 affects characteristics of the ICM so that its ability to survive passage and remain pluripotent when isolated from TE is increased (Chapter 2) The mechanisms are unclear but, by the blastocyst stage, the program of the embryo has been altered by CSF2 differently in female embryos than in male embryos (Chapter 3) Differential programming is apparent when examining development of embryos after transfer to recipients. There is no size difference between female and male embryos at Day 14 of development but, by Day 15, control female embryos are larger and secrete more IFNT than male embryos. This phenomenon probably represents earlier elongation for females. Moreover, CSF2 alters the differences b etween sexes by decreasing size and IFNT secretion for females but increasing these characteristics for males. In addition, CSF2 programs the transcriptome and methylome at day 15 in a sex specific manner. This observation leads to the possibility that sex specific developmental programming [14 17, 169] occurs because alterations in the maternal milieu during the preimplantation period in response to changes in environment cause sex specific effects on the embryo While seve ral molecules have been shown to increase the competence of an embryo to establish pregnancy after transfer, including CSF2 [18] IGF1 [292] and hyaluronan [21] we know nothing of the mechanism by which embryo competence is increased. Several genes have been identified whose expression at the blastocyst stage differs between embryos that subsequently establi sh pregnancy versus those that

PAGE 140

140 do not [293] and it may be that certain embryokines alter gene expression in a manner than improves embryo compet ence. However, none of the genes that were differentially expressed between embryos establishing pregnancy or not were found to be regulated by CSF2 at the morula stage [31] Results from Chapter 2 suggest that one possible way CSF2 improves embryo competence for survival is regulation of pluripotency and capacity for survival of the ICM. Such an action, if exerted by CSF2, could potentially have a l arge effect on embryonic survival because 20 25% of in vitro produced embryos lose the ED derived from the ICM by Day 14 15 of gestation [18, 225, 226] Perhaps CSF2 increases pregnancy rate in embryo transfer recipients by reducing loss of the ED The evidence for CSF2 regulation of the ICM is based on experiments showing that CSF2 increases ICM cell number [ 18] and that isolated ICM cultured on mitomycin C treated fibroblasts were more likely to survive passage while maintaining pluripotency if embryos were exposed to CSF2 from Day 5 7 or 6 8 of development (Chapter 2). The mechanism by which CSF2 affects the ICM is not known. One possibility is that CSF2 reduced induction of apoptosis. CSF2 can blunt induction of apoptosis by heat shock in the bovine embryo [31] Another possibility is that CSF2 regulates expression of genes associated with pluripotency. Expression for pluripotency related genes NANOG and SOX2 in isolated ICM were not affected by CSF2, however (Chapter 2). However, morula stage embr yos collected after 24 hours of CSF2 treatment did contain differentially expressed genes related to pluripotency [31] Another possible mechanism b y which CSF2 could increase embryo competence to establish pregnancy is through alteration of the methylome of the embryo. As shown in Chapter 3, some effects of CSF2 treatment from Day 5 7 of development are not

PAGE 141

141 realized until several days later (Day 15 i n this case) and such effects are consistent with epigenetic modification. Earlier, Loureiro et al (2011) found a similar long term effect of CSF2 since embryos that established pregnancy were less likely to be lost before term if treated with CSF2 from Da y 5 7. Even though there was no effect of CSF2 on the overall level of methylation in the embryo at the blastocyst stage of development (Chapter 4 ), the technique used to assess methylation (labeling with anti 5 methylcytosine) is crude and it is possible that specific regions of DNA undergo differential methylation in response to CSF2. Use of the methylome array described in Chapter 3 could prove effective at examining whether specific CpG undergo differential methylation at the blastocyst stage in respons e to CSF2. One implication of the findings that CSF2 increases survival of isolated ICM is that CSF2 might be a useful additive to culture media for production of ESC s in the cow. ESC s from the cow are difficult to keep in the pluripotent state. Regulat ory molecules utilized to maintain pluripotency of mouse [229] or human [228] ESC cultures are ineffective for that purpose in cow [230] It is possible that the addition of CSF2 to culture media could improve the survival of bovine stem cells in an undifferentiated state. As has been found earlier for th e human [187] the bovine preimplantation embryo expresses CSF2RA while not expressing CSF2RB CSF2 binds to CSF2RA, which combines with the CSF2R B subunit to signal through JAK2/STAT5ab [181 ] CSF2RA is capable of signaling in the absence of the CSF2R B subunit, but does so a much lower affinity [182] Given that CSF2 can alter the properties of the bovine embryo despite the absence of CSF2RB mRNA, it is likely that CSF2 signals through a separate

PAGE 142

142 pathway other than th e JAK STAT signaling pathway regulated by the CSF2RA CSF2RB dimer. The lack of the CSF2RB subunit implies that the embryo does not have high affinity signaling. However, the dosage of 10 ng/ml of CSF2 used in these experiments, is below the K d of the low affinity CSF2RA. In the absence of the CSF2R B subunit, human myeloid cells are still able to signal through the PI3K pathway [183] Perhaps a similar pathway is operative in blastomeres of the preimplantation embryo. As has been alluded to many times in this dissertation, one im portant rationale for studying regulation of embryonic development is that the embryo produced in vitro is abnormal in many respects [3 5, 7, 8] and is less capable of establishing pregnancy when transferred to recipient s [99] Identification of maternal derived molecules that enhance embryonic competence could be useful to improve effect iveness of embryo transfer using in vitro produced embryos. Few laboratories that study embryonic development in the cow have the opportunity to transfer embryos to recipients and, instead use in vitro measures of development, such as the percent of oocyt es becoming blastocysts, as an indicator of the adequacy of culture systems. Results in this dissertation point out the inadequacy of this approach. There was no consistent effect of CSF2 on the percent of embryos that progressed to the blastocyst stage o f development. Nonetheless, CSF2 can improve the pregnancy rate after transfer to recipients in cattle [18] mice [26] and humans [200] This change in pregnancy rate after transfer without affecting the percent of embryos that develop to the blastocyst stage is also true for other molecules such as IGF1 [129] and hyaluronan [21] In consequence, optimization of culture systems for production of embryos in vitro will

PAGE 143

143 require transfer of embryos to recipient females or development of other in vitro indices of blastocyst quality more predictive of embryo survival than percent blastocyst. Perhaps the most important finding of this dissertation was the unexpected observation that exposure of the morula and blastocyst stage embryo to CSF2 alters the de velopmental program in a sex specific manner (Chapter 3). One implication is that sexual differentiation occurs as early as Day 5 7. This is to be expected because gene expression differs significantly between male and female embryos at the blastocyst stag e [245] and other results from this dissertation show differences in global DNA methylation between female and male embryos as early as the 8 cell stage (Chapter 4). One possibility is that CSF2 uses signal transduction pathways that differ in important respects between males and females. While the signaling pathway for CSF2 in the embryo has not be en identified, and is likely different than the classical JAK STAT pathway (Chapter 2), it is possible that there is more than one pathway and that the relative activity of one or more varies between male and female embryos. Experiments to elucidate signa ling pathways for CSF2 in the embryo should be conducted to determine whether there are sex differences. Another possible reason for sex differences in response to CSF2 would be differences in transcriptional repression of specific regions of DNA by epigen etic modification. At the blastocyst stage, the male embryo is methylated at a higher intensity than the female (Chapter 4) while the female is transcriptionally more active than males at the same stage [245] Interestingly, over 50% of the genes regulated by CSF2 are also regulated by sex Thus, CSF2 acts preferentially on genes that are controlled dir ectly or indirectly by transcription factors involved in sexual differentiation. There may also be sex specific methylation of genes

PAGE 144

144 encoding transcription factors or enhancers. At least in part, genes regulated by sex may have transcription factors or re gulatory elements that are also regulated by CSF2. The observation on sex differences in response to CSF2 is important because it provides a mechanism for the phenomenon by which developmental programming affects female embryos differently than male embry os. Perhaps changes in nutrition or stress that the mother is subjected to in her environment lead to alterations in the embryokine secretion in the uterus, thus preparing the embryo for post natal life in a sex specific manner. In addition, this observat ion implies that much of early development much be examined in a sex specific context. For the phenomenon of sex specific response to CSF2 to be generally relevant to preimplantation developmental programming, it should be that the phenomenon occurs for m ore than one embryokine and in species other than the cow. Other embryokines, such as IGF1 [292] IL1B [23] hyaluronan [21] TGFB [20] LIF [20] and FGF2 [22] have been shown to improve the development of the embryo in the cow, but it has no t been examined whether response of the embryo to these molecules varies with sex We do not know whether sex bias responses to embryokines occurs in other species but at least the embryokine examined, CSF2, causes changes in development in a wide variety of species, including mice [26] pigs [189] and humans [200] CSF2 is a good candidate for mediating certain envir onmental effects on developmental programming because its expression in the uterus depends on diet and inflammatory status. In particular, obese cows had lower CSF2 protein and mRNA present in the oviduct than non obese cows [34] Uterine inflammation caused by the presence of semen, increases CSF2 protein secretion due to TGFB within the seminal

PAGE 145

145 plasma [32, 33] Understanding how CSF2 is regulated by diet may prove useful for minimizing the effects of undernut rition on fertility [294] as well as on the characteristics of the resulting offspring. One implication of the finding that CSF2 affected female embryos differently than male embryos is that research on regulation of preimplantation development should now consider the possibility of differences between female and male embryos. Heretofore, there has been little consideration of embryo sex when trying to understand preimplantation develop ment, which should change. Findings from this dissertation provide the groundwork for understanding 1) the signal transduction system for CSF2 in the preimplantation embryo, 2) mechanisms by which CSF2 affects ICM survival and pluripotency, 3) and how de velopmental programming occurs in a sex specific manner during preimplantation development. Among the promising areas of future r esearch would be to address the mechanism by which CSF2 programs the embryo in a sex specific manner (whether due to sex effec ts on signal transduction, transcription factor usage or epigenetic modification) as well as the mechanisms for actions of CSF2 on survival and pluripotency of the ICM.

PAGE 146

146 Figure 5 1. Schematic illustrati on of conclusions derived from the dissertation including developmental changes in methylation and sex specific actions of CSF2 on embryonic development. Early preimplantation development is characterized by a loss in DNA methylation to a nadir at the 8 1 6 cell stage. At this time, the female embryo maintains a higher level of methylation than the male. Subsequently, methylation is increased but in a pattern where, at the blastocyst stage, the TE is more methylated than the ICM. At this stage, DNA is les s methylated for the female than the male. Sex effects on methylation may be important for actions of CSF2 which occur in a sex specific manner. At the blastocyst stage, CSF2 affects characteristics of the ICM so that its ability to survive passage and rem ain pluripotent when isolated from TE is increased. The mechanisms are unclear but, by the blastocyst stage, the program of the embryo has been altered by CSF2 differently in female embryos than in male embryos. Differential programming is apparent when e xamining development of embryos after transfer to recipients. There is no size difference between female and male embryos at Day 14 of development but, by Day 15, control female embryos are larger and secrete more IFNT than male embryos. This phenomenon p robably represents earlier elongation for females. Moreover, CSF2 alters the differences between sexes by decreasing size and IFNT secretion for females but increasing these characteristics for males. In addition, CSF2 programs the transcriptome and methyl ome at day 15 in a sex specific manner.

PAGE 147

147 REFERENCES 1. Betteridge KJ, Flchon JE. The anatomy and physiology of the pre attachment bovine embryos. Theriogenology 1988; 29:155 187. 2. Maddox Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, Tveden Nyborg P, Trounson A. Immunohistochemical and ultrastructural characterization of the initial post hatching development of bovine embryos. Reproduction 2003; 125:607 623. 3. Corcoran D, Fair T, Park S, Rizos D, Patel OV Smith GW, Coussens PM, Ireland JJ, Boland MP, Evans AC, Lonergan P. Suppressed expression of genes involved in transcription and translation in in vitro compared with in vivo cultured bovine embryos. Reproduction 2006; 131:651 660. 4. Crosier AE, Farin P W, Dykstra MJ, Alexander JE, Farin CE. Ultrastructural morphometry of bovine compact morulae produced in vivo or in vitro. Biol Reprod 2000; 62:1459 1465. 5. Seidel GE. Modifying oocytes and embryos to improve their cryopreservation. Theriogenology 2006; 6 5:228 235. 6. Enright BP, Lonergan P, Dinnyes A, Fair T, Ward FA, Yang X, Boland MP. Culture of in vitro produced bovine zygotes in vitro vs in vivo: implications for early embryo development and quality. Theriogenology 2000; 54:659 673. 7. Rizos D, Fair T Papadopoulos S, Boland MP, Lonergan P. Developmental, qualitative, and ultrastructural differences between ovine and bovine embryos produced in vivo or in vitro. Mol Reprod Dev 2002; 62:320 327. 8. Niemann H, Carnwath JW, Herrmann D, Wieczorek G, Lemme E Lucas Hahn A, Olek S. DNA methylation patterns reflect epigenetic reprogramming in bovine embryos. Cell Reprogram 2010; 12:33 42. 9. Maillo V, Rizos D, Besenfelder U, Havlicek V, Kelly AK, Garrett M, Lonergan P. Influence of lactation on metabolic charac teristics and embryo development in postpartum Holstein dairy cows. J Dairy Sci 2012; 95:3865 3876.

PAGE 148

148 10. Ponsuksili S, Murani E, Schwerin M, Schellander K, Tesfaye D, Wimmers K. Gene expression and DNA methylation of bovine pretransfer endometrium depending on its receptivity after in vitro produced embryo transfer. PLoS One 2012; 7:e42402. 11. Lonergan P, Woods A, Fair T, Carter F, Rizos D, Ward F, Quinn K, Evans A. Effect of embryo source and recipient progesterone environment on embryo development in catt le. Reprod Fertil Dev 2007; 19:861 868. 12. Thatcher WW, Moreira F, Santos JE, Mattos RC, Lopes FL, Pancarci SM, Risco CA. Effects of hormonal treatments on reproductive performance and embryo production. Theriogenology 2001; 55:75 89. 13. Watkins AJ, Urse ll E, Panton R, Papenbrock T, Hollis L, Cunningham C, Wilkins A, Perry VH, Sheth B, Kwong WY, Eckert JJ, Wild AE, et al. Adaptive responses by mouse early embryos to maternal diet protect fetal growth but predispose to adult onset disease. Biol Reprod 2008 ; 78:299 306. 14. Watkins AJ, Lucas ES, Wilkins A, Cagampang FR, Fleming TP. Maternal periconceptional and gestational low protein diet affects mouse offspring growth, cardiovascular and adipose phenotype at 1 year of age. PLoS One 2011; 6:e28745. 15. Kwon g WY, Wild AE, Roberts P, Willis AC, Fleming TP. Maternal undernutrition during the preimplantation period of rat development causes blastocyst abnormalities and programming of postnatal hypertension. Development 2000; 127:4195 4202. 16. Sinclair KD, Alleg rucci C, Singh R, Gardner DS, Sebastian S, Bispham J, Thurston A, Huntley JF, Rees WD, Maloney CA, Lea RG, Craigon J, et al. DNA methylation, insulin resistance, and blood pressure in offspring determined by maternal periconceptional B vitamin and methioni ne status. Proc Natl Acad Sci U S A 2007; 104:19351 19356. 17. Watkins AJ, Lucas ES, Torrens C, Cleal JK, Green L, Osmond C, Eckert JJ, Gray WP, Hanson MA, Fleming TP. Maternal low protein diet during mouse pre implantation development induces vascular dys function and altered renin angiotensin system homeostasis in the offspring. Br J Nutr 2010; 103:1762 1770.

PAGE 149

149 18. Loureiro B, Bonilla L, Block J, Fear JM, Bonilla AQ, Hansen PJ. Colony stimulating factor 2 (CSF 2) improves development and posttransfer surviva l of bovine embryos produced in vitro. Endocrinology 2009; 150:5046 5054. 19. Bonilla AQ, Oliveira LJ, Ozawa M, Newsom EM, Lucy MC, Hansen PJ. Developmental changes in thermoprotective actions of insulin like growth factor 1 on the preimplantation bovine e mbryo. Mol Cell Endocrinol 2011; 332:170 179. 20. Neira JA, Tainturier D, Pea MA, Martal J. Effect of the association of IGF I, IGF II, bFGF, TGF 1, GM CSF, and LIF on the development of bovine embryos produced in vitro. Theriogenology 2010; 73:595 604. 21. Block J, Bonilla L, Hansen PJ. Effect of addition of hyaluronan to embryo culture medium on survival of bovine embryos in vitro following vitrification and establishment of pregnancy after transfer to recipients. Theriogenology 2009; 71:1063 1071. 22. Fields SD, Hansen PJ, Ealy AD. Fibroblast growth factor requirements for in vitro development of bovine embryos. Theriogenology 2011; 75:1466 1475. 23. Paula Lopes FF, de Moraes AA, Edwards JL, Justice JE, Hansen PJ. Regulation of preimplantation developme nt of bovine embryos by interleukin 1 Biol Reprod 1998; 59:1406 1412. 24. de Moraes AA, Hansen PJ. Granulocyte macrophage colony stimulating factor promotes development of in vitro produced bovine embryos. Biol Reprod 1997; 57:1060 1065. 25. Ziebe S, Lof t A, Povlsen BB, Erb K, Agerholm I, Aasted M, Gabrielsen A, Hnida C, Zobel DP, Munding B, Bendz SH, Robertson SA. A randomized clinical trial to evaluate the effect of granulocyte macrophage colony stimulating factor (GM CSF) in embryo culture medium for i n vitro fertilization. Fertil Steril 2013; 99:1600 1609. 26. Sjblom C, Roberts CT, Wikland M, Robertson SA. Granulocyte macrophage colony stimulating factor alleviates adverse consequences of embryo culture on fetal growth trajectory and placental morphog enesis. Endocrinology 2005; 146:2142 2153.

PAGE 150

150 27. de Moraes AA, Paula Lopes FF, Chegini N, Hansen PJ. Localization of granulocyte macrophage colony stimulating factor in the bovine reproductive tract. J Reprod Immunol 1999; 42:135 145. 28. Robertson SA, Mayrhofer G, Seamark RF. Uterine epithelial cells synthesize granulocyte macrophage colony stimulating factor and interleukin 6 in pregnant and nonpregnant mice. Biol Reprod 1992; 46:1069 1079. 29. Giacomini G, Tabibzadeh SS, Satyaswaroop PG, Bonsi L, Vita le L, Bagnara GP, Strippoli P, Jasonni VM. Epithelial cells are the major source of biologically active granulocyte macrophage colony stimulating factor in human endometrium. Hum Reprod 1995; 10:3259 3263. 30. Loureiro B, Block J, Favoreto MG, Carambula S, Pennington KA, Ealy AD, Hansen PJ. Consequences of conceptus exposure to colony stimulating factor 2 on survival, elongation, interferon Reproduction 2011; 141:617 624. 31. Loureiro B, Oliveira LJ, Favoreto MG, Hansen PJ. Colony stimulating factor 2 inhibits induction of apoptosis in the bovine preimplantation embryo. Am J Reprod Immunol 2011; 65:578 588. 32. Bromfield JJ, Schjenken JE, Chin PY, Care AS, Jasper MJ, Robertson SA. Maternal tract factors contribute to paterna l seminal fluid impact on metabolic phenotype in offspring. Proc Natl Acad Sci U S A 2014. 33. Tremellen KP, Seamark RF, Robertson SA. Seminal transforming growth factor beta1 stimulates granulocyte macrophage colony stimulating factor production and infla mmatory cell recruitment in the murine uterus. Biol Reprod 1998; 58:1217 1225. 34. Nahar A, Maki S, Kadokawa H. Suppressed expression of granulocyte macrophage colony stimulating factor in oviduct ampullae of obese cows. Anim Reprod Sci 2013; 139:1 8. 35. Berg DK, van Leeuwen J, Beaumont S, Berg M, Pfeffer PL. Embryo loss in cattle between Days 7 and 16 of pregnancy. Theriogenology 2010; 73:250 260.

PAGE 151

151 36. King GJ, Atkinson BA, Robertson HA. Development of the intercaruncular areas during early gestation and e stablishment of the bovine placenta. J Reprod Fertil 1981; 61:469 474. 37. HAMILTON WJ, LAING JA. Development of the egg of the cow up to the stage of blastocyst formation. J Anat 1946; 80:194 204. 38. Hawk HW. Transport and fate of spermatozoa after insem ination of cattle. J Dairy Sci 1987; 70:1487 1503. 39. Hyttel P, Xu KP, Greve T. Scanning electron microscopy of in vitro fertilization in cattle. Anat Embryol (Berl) 1988; 178:41 46. 40. Hyttel P, Greve T, Callesen H. Ultrastructure of in vivo fertilizati on in superovulated cattle. J Reprod Fertil 1988; 82:1 13. 41. Holm P, Shukri NN, Vajta G, Booth P, Bendixen C, Callesen H. Developmental kinetics of the first cell cycles of bovine in vitro produced embryos in relation to their in vitro viability and sex. Theriogenology 1998; 50:1285 1299. 42. Eckert JJ, Fleming TP. Tight junction biogenesis during early development. Biochim Biophys Acta 2008; 1778:717 728. 43. Tarkowski AK, Wrblewska J. Development of blastomeres of mouse eggs isolated at the 4 and 8 ce ll stage. J Embryol Exp Morphol 1967; 18:155 180. 44. Watson AJ, Kidder GM. Immunofluorescence assessment of the timing of appearance and cellular distribution of Na/K ATPase during mouse embryogenesis. Dev Biol 1988; 126:80 90. 45. Barcroft LC, Offenberg H, Thomsen P, Watson AJ. Aquaporin proteins in murine trophectoderm mediate transepithelial water movements during cavitation. Dev Biol 2003; 256:342 354. 46. Kuijk EW, Du Puy L, Van Tol HT, Oei CH, Haagsman HP, Colenbrander B, Roelen BA. Differences in ea rly lineage segregation between mammals. Dev Dyn 2008; 237:918 927.

PAGE 152

152 47. Kuijk EW, van Tol LT, Van de Velde H, Wubbolts R, Welling M, Geijsen N, Roelen BA. The roles of FGF and MAP kinase signaling in the segregation of the epiblast and hypoblast cell linea ges in bovine and human embryos. Development 2012; 139:871 882. 48. van Soom A, Ysebaert MT, de Kruif A. Relationship between timing of development, morula morphology, and cell allocation to inner cell mass and trophectoderm in in vitro produced bovine emb ryos. Mol Reprod Dev 1997; 47:47 56. 49. Orozco Lucero E, Dufort I, Robert C, Sirard MA. Rapidly cleaving bovine two cell embryos have better developmental potential and a distinctive mRNA pattern. Mol Reprod Dev 2014; 81:31 41. 50. Lonergan P, Khatir H, P iumi F, Rieger D, Humblot P, Boland MP. Effect of time interval from insemination to first cleavage on the developmental characteristics, sex ratio and pregnancy rate after transfer of bovine embryos. J Reprod Fertil 1999; 117:159 167. 51. Larson MA, Kimur a K, Kubisch HM, Roberts RM. Sexual dimorphism among bovine embryos in their ability to make the transition to expanded blastocyst and in the expression of the signaling molecule IFN Proc Natl Acad Sci U S A 2001; 98:9677 9682. 52. Vejlsted M, Du Y, Vaj ta G, Maddox Hyttel P. Post hatching development of the porcine and bovine embryo defining criteria for expected development in vivo and in vitro. Theriogenology 2006; 65:153 165. 53. Brando DO, Maddox Hyttel P, Lvendahl P, Rumpf R, Stringfellow D, Calle sen H. Post hatching development: a novel system for extended in vitro culture of bovine embryos. Biol Reprod 2004; 71:2048 2055. 54. Blomberg L, Hashizume K, Viebahn C. Blastocyst elongation, trophoblastic differentiation, and embryonic pattern formation. Reproduction 2008; 135:181 195. 55. Robinson RS, Hammond AJ, Wathes DC, Hunter MG, Mann GE. Corpus luteum endometrium embryo interactions in the dairy cow: underlying mechanisms and clinical relevance. Reprod Domest Anim 2008; 43 Suppl 2:104 112.

PAGE 153

153 56. Nephew KP, Crdenas H, McClure KE, Ott TL, Bazer FW, Pope WF. Effects of administration of human chorionic gonadotropin or progesterone before maternal recognition of pregnancy on blastocyst development and pregnancy in sheep. J Anim Sci 1994; 72:453 458. 57. Robinson RS, Fray MD, Wathes DC, Lamming GE, Mann GE. In vivo expression of interferon tau mRNA by the embryonic trophoblast and uterine concentrations of interferon tau protein during early pregnancy in the cow. Mol Reprod Dev 2006; 73:470 474. 58. Wo oding FB, Wathes DC. Binucleate cell migration in the bovine placentome. J Reprod Fertil 1980; 59:425 430. 59. Bazer FW, Spencer TE, Johnson GA, Burghardt RC, Wu G. Comparative aspects of implantation. Reproduction 2009; 138:195 209. 60. Hyttel P, Fair T, Callesen H, Greve T. Oocyte growth, capacitation and final maturation in cattle. Theriogenology 1997; 47:23 32. 61. Memili E, First NL. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared wit h other species. Zygote 2000; 8:87 96. 62. Weill L, Belloc E, Bava FA, Mndez R. Translational control by changes in poly(A) tail length: recycling mRNAs. Nat Struct Mol Biol 2012; 19:577 585. 63. Kues WA, Sudheer S, Herrmann D, Carnwath JW, Havlicek V, Be senfelder U, Lehrach H, Adjaye J, Niemann H. Genome wide expression profiling reveals distinct clusters of transcriptional regulation during bovine preimplantation development in vivo. Proc Natl Acad Sci U S A 2008; 105:19768 19773. 64. Memili E, First NL. Developmental changes in RNA polymerase II in bovine oocytes, early embryos, and effect of alpha amanitin on embryo development. Mol Reprod Dev 1998; 51:381 389. 65. Barnes FL, Eyestone WH. Early cleavage and the maternal zygotic transition in bovine embr yos. Theriogenology 1990; 33.

PAGE 154

154 66. Kopecn V, Flchon JE, Camous S, Fulka J. Nucleologenesis and the onset of transcription in the eight cell bovine embryo: fine structural autoradiographic study. Mol Reprod Dev 1989; 1:79 90. 67. Tadros W, Lipshitz HD. The maternal to zygotic transition: a play in two acts. Development 2009; 136:3033 3042. 68. Bird AP. DNA methylation and the frequency of CpG in animal DNA. Nucleic Acids Res 1980; 8:1499 1504. 69. Boyes J, Bird A. DNA methylation inhibits transcription indi rectly via a methyl CpG binding protein. Cell 1991; 64:1123 1134. 70. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev 2002; 16:6 21. 71. Miranda TB, Jones PA. DNA methylation: the nuts and bolts of repression. J Cell Physiol 2007; 213:384 390. 72. Bartolomei MS, Ferguson Smith AC. Mammalian genomic imprinting. Cold Spring Harb Perspect Biol 2011; 3. 73. Oswald J, Engemann S, Lane N, Mayer W, Olek A, Fundele R, Dean W, Reik W, Walter J. Active demethylation of the paternal genome in the mou se zygote. Curr Biol 2000; 10:475 478. 74. Mayer W, Niveleau A, Walter J, Fundele R, Haaf T. Demethylation of the zygotic paternal genome. Nature 2000; 403:501 502. 75. Santos F, Dean W. Epigenetic reprogramming during early development in mammals. Reprodu ction 2004; 127:643 651. 76. Santos F, Hendrich B, Reik W, Dean W. Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol 2002; 241:172 182. 77. Jost JP, Siegmann M, Sun L, Leung R. Mechanisms of DNA demethylation in chicken embryos. Purification and properties of a 5 methylcytosine DNA glycosylase. J Biol Chem 1995; 270:9734 9739.

PAGE 155

155 78. Weiss A, Keshet I, Razin A, Cedar H. DNA demethylation in vitro: involvement of RNA. Cell 1996; 86:709 718. 79. Morgan HD, Dean W, Coker HA, Reik W, Pet ersen Mahrt SK. Activation induced cytidine deaminase deaminates 5 methylcytosine in DNA and is expressed in pluripotent tissues: implications for epigenetic reprogramming. J Biol Chem 2004; 279:52353 52360. 80. Iqbal K, Jin SG, Pfeifer GP, Szab PE. Repro gramming of the paternal genome upon fertilization involves genome wide oxidation of 5 methylcytosine. Proc Natl Acad Sci U S A 2011; 108:3642 3647. 81. Seisenberger S, Andrews S, Krueger F, Arand J, Walter J, Santos F, Popp C, Thienpont B, Dean W, Reik W. The dynamics of genome wide DNA methylation reprogramming in mouse primordial germ cells. Mol Cell 2012; 48:849 862. 82. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian develop ment. Cell 1999; 99:247 257. 83. Howell CY, Bestor TH, Ding F, Latham KE, Mertineit C, Trasler JM, Chaillet JR. Genomic imprinting disrupted by a maternal effect mutation in the Dnmt1 gene. Cell 2001; 104:829 838. 84. Carlson LL, Page AW, Bestor TH. Properties and localization of DNA methyltransferase in preimplantation mouse embryos: implications for genomic imprinting. Genes Dev 1992; 6:2536 2541. 85. Beaujean N, Taylor J, Gardner J, Wilmut I, Meehan R, Young L. Effect of limited DNA methylation rep rogramming in the normal sheep embryo on somatic cell nuclear transfer. Biol Reprod 2004; 71:185 193. 86. Fulka J, Fulka H, Slavik T, Okada K. DNA methylation pattern in pig in vivo produced embryos. Histochem Cell Biol 2006; 126:213 217. 87. Dean W, Santo s F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001; 98:13734 13738.

PAGE 156

156 88. Hou J, Liu L, Lei T, Cui X, An X, Chen Y. Genomic DNA methylation patterns in bovine preimplantation embryos derived from in vitro fertilization. Sci China C Life Sci 2007; 50:56 61. 89. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning o f Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003; 113:643 655. 90. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe Nebenius D, Chambers I, Schler H, Smith A. Formation of pluripotent stem cells in the mammalian embryo depen ds on the POU transcription factor Oct4. Cell 1998; 95:379 391. 91. Avilion AA, Nicolis SK, Pevny LH, Perez L, Vivian N, Lovell Badge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003; 17:126 140. 92. Niwa H, T oyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, Rossant J. Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 2005; 123:917 929. 93. Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, Rossant J. Cdx 2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 2005; 132:2093 2102. 94. Berg DK, Smith CS, Pearton DJ, Wells DN, Broadhurst R, Donnison M, Pfeffer PL. Trophectoderm lineage determ ination in cattle. Dev Cell 2011; 20:244 255. 95. Morris SA, Graham SJ, Jedrusik A, Zernicka Goetz M. The differential response to Fgf signalling in cells internalized at different times influences lineage segregation in preimplantation mouse embryos. Open Biol 2013; 3:130104. 96. Allocation of inner cells to epiblast vs primitive endoderm in the mouse embryo is and cells). Dev Biol 2014; 385:136 148. 97. Yamanaka Y, Lanner F, Rossant J. FGF signal dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development 2010; 137:715 724.

PAGE 157

157 98. Harris D, Huang B, Oback B. Inhibition of MAP2K a nd GSK3 signaling promotes bovine blastocyst development and epiblast associated expression of pluripotency factors. Biol Reprod 2013; 88:74. 99. Farin PW, Farin CE. Transfer of bovine embryos produced in vivo or in vitro: survival and fetal development. B iol Reprod 1995; 52:676 682. 100. Hansen PJ, Block J. Towards an embryocentric world: the current and potential uses of embryo technologies in dairy production. Reprod Fertil Dev 2004; 16:1 14. 101. Driver AM, Peagaricano F, Huang W, Ahmad KR, Hackbart KS Wiltbank MC, Khatib H. RNA Seq analysis uncovers transcriptomic variations between morphologically similar in vivo and in vitro derived bovine blastocysts. BMC Genomics 2012; 13:118. 102. Gad A, Hoelker M, Besenfelder U, Havlicek V, Cinar U, Rings F, He ld E, Dufort I, Sirard MA, Schellander K, Tesfaye D. Molecular mechanisms and pathways involved in bovine embryonic genome activation and their regulation by alternative in vivo and in vitro culture conditions. Biol Reprod 2012; 87:100. 103. Lonergan P, Ri zos D, Gutirrez Adn A, Fair T, Boland MP. Effect of culture environment on embryo quality and gene expression experience from animal studies. Reprod Biomed Online 2003; 7:657 663. 104. Smith SL, Everts RE, Sung LY, Du F, Page RL, Henderson B, Rodriguez Zas SL, Nedambale TL, Renard JP, Lewin HA, Yang X, Tian XC. Gene expression profiling of single bovine embryos uncovers significant effects of in vitro maturation, fertilization and culture. Mol Reprod Dev 2009; 76:38 47. 105. Rizos D, Lonergan P, Boland MP, Arroyo Garca R, Pintado B, de la Fuente J, Gutirrez Adn A. Analysis of differential messenger RNA expression between bovine blastocysts produced in different culture systems: implications for blastocyst quality. Biol Reprod 2002; 66:589 595. 106. Ch en Z, Robbins KM, Wells KD, Rivera RM. Large offspring syndrome: a bovine model for the human loss of imprinting overgrowth syndrome Beckwith Wiedemann. Epigenetics 2013; 8:591 601.

PAGE 158

158 107. Sudano MJ, Santos VG, Tata A, Ferreira CR, Paschoal DM, Machado R, Bu ratini J, Eberlin MN, Landim Alvarenga FD. Phosphatidylcholine and sphingomyelin profiles vary in Bos taurus indicus and Bos taurus taurus in vitro and in vivo produced blastocysts. Biol Reprod 2012; 87:130. 108. Gutirrez Adn A, Lonergan P, Rizos D, War d FA, Boland MP, Pintado B, de la Fuente J. Effect of the in vitro culture system on the kinetics of blastocyst development and sex ratio of bovine embryos. Theriogenology 2001; 55:1117 1126. 109. Hyttel P, Xu KP, Smith S, Greve T. Ultrastructure of in vit ro oocyte maturation in cattle. J Reprod Fertil 1986; 78:615 625. 110. Tesfaye D, Ghanem N, Carter F, Fair T, Sirard MA, Hoelker M, Schellander K, Lonergan P. Gene expression profile of cumulus cells derived from cumulus oocyte complexes matured either in vivo or in vitro. Reprod Fertil Dev 2009; 21:451 461. 111. Knijn HM, Wrenzycki C, Hendriksen PJ, Vos PL, Herrmann D, van der Weijden GC, Niemann H, Dieleman SJ. Effects of oocyte maturation regimen on the relative abundance of gene transcripts in bovine blastocysts derived in vitro or in vivo. Reproduction 2002; 124:365 375. 112. Rizos D, Ward F, Duffy P, Boland MP, Lonergan P. Consequences of bovine oocyte maturation, fertilization or early embryo development in vitro versus in vivo: implications for bla stocyst yield and blastocyst quality. Mol Reprod Dev 2002; 61:234 248. 113. Kind KL, Banwell KM, Gebhardt KM, Macpherson A, Gauld A, Russell DL, Thompson JG. Microarray analysis of mRNA from cumulus cells following in vivo or in vitro maturation of mouse c umulus oocyte complexes. Reprod Fertil Dev 2013; 25:426 438. 114. Motlik J, Fulka J, Flchon JE. Changes in intercellular coupling between pig oocytes and cumulus cells during maturation in vivo and in vitro. J Reprod Fertil 1986; 76:31 37. 115. Eppig JJ, Schroeder AC. Capacity of mouse oocytes from preantral follicles to undergo embryogenesis and development to live young after growth, maturation, and fertilization in vitro. Biol Reprod 1989; 41:268 276.

PAGE 159

159 116. Rizos D, Gutirrez Adn A, Prez Garnelo S, De La Fuente J, Boland MP, Lonergan P. Bovine embryo culture in the presence or absence of serum: implications for blastocyst development, cryotolerance, and messenger RNA expression. Biol Reprod 2003; 68:236 243. 117. Guyader Joly C, Ponchon S, Durand M, Hey man Y, Renard JP, Mnzo Y. Effect of lecithin on in vitro and in vivo survival of in vitro produced bovine blastocysts after cryopreservation. Theriogenology 1999; 52:1193 1202. 118. Hasler JF, Henderson WB, Hurtgen PJ, Jin ZQ, McCauley AD, Mower SA, Nell y B, Shuey LS, Stokes JE, Trimmer SA. Production, freezing and transfer if bovine IVF embryos and subsequent calving results. Theriogeneology 1995; 43:141 152. 119. Seidel GE. Modifying oocytes and embryos to improve their cryopreservation. Theriogenology 2006; 65:228 235. 120. Bonilla L, Block J, Denicol AC, Hansen PJ. Consequences of transfer of an in vitro produced embryo for the dam and resultant calf. J Dairy Sci 2014; 97:229 239. 121. Farin PW, Slenning BD, Britt JH. Estimates of pregnancy outcomes ba sed on selection of bovine embryos produced in vivo or in vitro. Theriogenology 1999; 52:659 670. 122. Siqueira LG, Torres CA, Souza ED, Monteiro PL, Arashiro EK, Camargo LS, Fernandes CA, Viana JH. Pregnancy rates and corpus luteum related factors affecti ng pregnancy establishment in bovine recipients synchronized for fixed time embryo transfer. Theriogenology 2009; 72:949 958. 123. Pontes JH, Nonato Junior I, Sanches BV, Ereno Junior JC, Uvo S, Barreiros TR, Oliveira JA, Hasler JF, Seneda MM. Comparison o f embryo yield and pregnancy rate between in vivo and in vitro methods in the same Nelore (Bos indicus) donor cows. Theriogenology 2009; 71:690 697. 124. van Wagtendonk de Leeuw AM, Aerts BJ, den Daas JH. Abnormal offspring following in vitro production of bovine preimplantation embryos: a field study. Theriogenology 1998; 49:883 894.

PAGE 160

160 125. Miles JR, Farin CE, Rodriguez KF, Alexander JE, Farin PW. Angiogenesis and morphometry of bovine placentas in late gestation from embryos produced in vivo or in vitro. Bi ol Reprod 2004; 71:1919 1926. 126. Miles JR, Farin CE, Rodriguez KF, Alexander JE, Farin PW. Effects of embryo culture on angiogenesis and morphometry of bovine placentas during early gestation. Biol Reprod 2005; 73:663 671. 127. Behboodi E, Anderson GB, B onDurant RH, Cargill SL, Kreuscher BR, Medrano JF, Murray JD. Birth of large calves that developed from in vitro derived bovine embryos. Theriogenology 1995; 44:227 232. 128. Numabe T, Oikawa T, Kikuchi T, Horiuchi T. Birth weight and birth rate of heavy calves conceived by transfer of in vitro or in vivo produced bovine embryos. Anim Reprod Sci 2000; 64:13 20. 129. Block J, Drost M, Monson RL, Rutledge JJ, Rivera RM, Paula Lopes FF, Ocon OM, Krininger CE, Liu J, Hansen PJ. Use of insulin like growth facto r I during embryo culture and treatment of recipients with gonadotropin releasing hormone to increase pregnancy rates following the transfer of in vitro produced embryos to heat stressed, lactating cows. J Anim Sci 2003; 81:1590 1602. 130. Ziebe S, Lundin K, Loft A, Bergh C, Nyboe Andersen A, Selleskog U, Nielsen D, Grndahl C, Kim H, Arce JC, Group CIaS. FISH analysis for chromosomes 13, 16, 18, 21, 22, X and Y in all blastomeres of IVF pre embryos from 144 randomly selected donated human oocytes and impac t on pre embryo morphology. Hum Reprod 2003; 18:2575 2581. 131. Angell RR, Aitken RJ, van Look PF, Lumsden MA, Templeton AA. Chromosome abnormalities in human embryos after in vitro fertilization. Nature 1983; 303:336 338. 132. Hardy K, Handyside AH, Winst on RM. The human blastocyst: cell number, death and allocation during late preimplantation development in vitro. Development 1989; 107:597 604. 133. Bauer BK, Isom SC, Spate LD, Whitworth KM, Spollen WG, Blake SM, Springer GK, Murphy CN, Prather RS. Transc riptional profiling by deep sequencing identifies differences in mRNA transcript abundance in in vivo derived versus in vitro cultured porcine blastocyst stage embryos. Biol Reprod 2010; 83:791 798.

PAGE 161

161 134. Hyttel P, Niemann H. Ultrastructure of porcine embry os following development in vitro versus in vivo. Mol Reprod Dev 1990; 27:136 144. 135. Giritharan G, Talbi S, Donjacour A, Di Sebastiano F, Dobson AT, Rinaudo PF. Effect of in vitro fertilization on gene expression and development of mouse preimplantation embryos. Reproduction 2007; 134:63 72. 136. Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol Reprod 2000; 62:1526 1535. 137. Ceelen M, van We issenbruch MM, Vermeiden JP, van Leeuwen FE, Delemarre van de Waal HA. Cardiometabolic differences in children born after in vitro fertilization: follow up study. J Clin Endocrinol Metab 2008; 93:1682 1688. 138. Sinclair KD, McEvoy TG, Maxfield EK, Maltin CA, Young LE, Wilmut I, Broadbent PJ, Robinson JJ. Aberrant fetal growth and development after in vitro culture of sheep zygotes. J Reprod Fertil 1999; 116:177 186. 139. Garrett JE, Geisert RD, Zavy MT, Morgan GL. Evidence for maternal regulation of early conceptus growth and development in beef cattle. J Reprod Fertil 1988; 84:437 446. 140. Carter F, Forde N, Duffy P, Wade M, Fair T, Crowe MA, Evans AC, Kenny DA, Roche JF, Lonergan P. Effect of increasing progesterone concentration from Day 3 of pregnancy on subsequent embryo survival and development in beef heifers. Reprod Fertil Dev 2008; 20:368 375. 141. Forde N, Carter F, Fair T, Crowe MA, Evans AC, Spencer TE, Bazer FW, McBride R, Boland MP, O'Gaora P, Lonergan P, Roche JF. Progesterone regulated chang es in endometrial gene expression contribute to advanced conceptus development in cattle. Biol Reprod 2009; 81:784 794. 142. Bauman DE. Bovine somatotropin and lactation: from basic science to commercial application. Domest Anim Endocrinol 1999; 17:101 116 143. Moreira F, Badinga L, Burnley C, Thatcher WW. Bovine somatotropin increases embryonic development in superovulated cows and improves post transfer pregnancy rates when given to lactating recipient cows. Theriogenology 2002; 57:1371 1387.

PAGE 162

162 144. Ribeir o ES, Bruno RG, Farias AM, Hernndez Rivera JA, Gomes GC, Surjus R, Becker LF, Birt A, Ott TL, Branen JR, Sasser RG, Keisler DH, et al. Low Doses of Bovine Somatotropin Enhance Conceptus Development and Fertility in Lactating Dairy Cows. Biol Reprod 2013. 145. Gifford CA, Racicot K, Clark DS, Austin KJ, Hansen TR, Lucy MC, Davies CJ, Ott TL. Regulation of interferon stimulated genes in peripheral blood leukocytes in pregnant and bred, nonpregnant dairy cows. J Dairy Sci 2007; 90:274 280. 146. Gifford CA, As siri AM, Satterfield MC, Spencer TE, Ott TL. Receptor transporter protein 4 (RTP4) in endometrium, ovary, and peripheral blood leukocytes of pregnant and cyclic ewes. Biol Reprod 2008; 79:518 524. 147. Lopes da Costa L, Chagas e Silva J, Robalo Silva J. Su perovulatory response, embryo quality and fertility after treatment with different gonadotrophins in native cattle. Theriogenology 2001; 56:65 77. 148. Cerri RL, Thompson IM, Kim IH, Ealy AD, Hansen PJ, Staples CR, Li JL, Santos JE, Thatcher WW. Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at day 17 of the estrous cycle or pregnancy. J Dairy Sci 2012; 95:5657 5675. 149. Hasler J. Factors affecting frozen and fresh embryo transfer pregnancy rates in cattle. Theriogeno logy 2001; 56:1401 1415. 150. Chagas e Silva J, Lopes da Costa L, Robalo Silva J. Plasma progesterone profiles and factors affecting embryo fetal mortality following embryo transfer in dairy cattle. Theriogenology 2002; 58:51 59. 151. Wilson RD, Fricke PM, Leibfried Rutledge ML, Rutledge JJ, Penfield CM, Weigel KA. In vitro production of bovine embryos using sex sorted sperm. Theriogenology 2006; 65:1007 1015. 152. Roseboom TJ, van der Meulen JH, Ravelli AC, Osmond C, Barker DJ, Bleker OP. Effects of prenat al exposure to the Dutch famine on adult disease in later life: an overview. Mol Cell Endocrinol 2001; 185:93 98. 153. Barker DJP. Mothers, Babies and Disease in Later Life. Edinburgh: Churchill Livingstone; 1998.

PAGE 163

163 154. Ravelli AC, van der Meulen JH, Michel s RP, Osmond C, Barker DJ, Hales CN, Bleker OP. Glucose tolerance in adults after prenatal exposure to famine. Lancet 1998; 351:173 177. 155. Ravelli AC, van Der Meulen JH, Osmond C, Barker DJ, Bleker OP. Obesity at the age of 50 y in men and women exposed to famine prenatally. Am J Clin Nutr 1999; 70:811 816. 156. Roseboom TJ, van der Meulen JH, Ravelli AC, Osmond C, Barker DJ, Bleker OP. Plasma fibrinogen and factor VII concentrations in adults after prenatal exposure to famine. Br J Haematol 2000; 111:11 2 117. 157. Roseboom TJ, van der Meulen JH, van Montfrans GA, Ravelli AC, Osmond C, Barker DJ, Bleker OP. Maternal nutrition during gestation and blood pressure in later life. J Hypertens 2001; 19:29 34. 158. Shaw GM, Schaffer D, Velie EM, Morland K, Harri s JA. Periconceptional vitamin use, dietary folate, and the occurrence of neural tube defects. Epidemiology 1995; 6:219 226. 159. Langley Evans SC, Phillips GJ, Jackson AA. In utero exposure to maternal low protein diets induces hypertension in weanling ra ts, independently of maternal blood pressure changes. Clin Nutr 1994; 13:319 324. 160. Garofano A, Czernichow P, Brant B. Effect of ageing on beta cell mass and function in rats malnourished during the perinatal period. Diabetologia 1999; 42:711 718. 161. Vickers MH, Breier BH, Cutfield WS, Hofman PL, Gluckman PD. Fetal origins of hyperphagia, obesity, and hypertension and postnatal amplification by hypercaloric nutrition. Am J Physiol Endocrinol Metab 2000; 279:E83 87. 162. George LA, Zhang L, Tuersunjian g N, Ma Y, Long NM, Uthlaut AB, Smith DT, Nathanielsz PW, Ford SP. Early maternal undernutrition programs increased feed intake, altered glucose metabolism and insulin secretion, and liver function in aged female offspring. Am J Physiol Regul Integr Comp P hysiol 2012; 302:R795 804.

PAGE 164

164 163. Ross MG, Desai M, Guerra C, Wang S. Prenatal programming of hypernatremia and hypertension in neonatal lambs. Am J Physiol Regul Integr Comp Physiol 2005; 288:R97 103. 164. Clarke AS, Wittwer DJ, Abbott DH, Schneider ML. Lon g term effects of prenatal stress on HPA axis activity in juvenile rhesus monkeys. Dev Psychobiol 1994; 27:257 269. 165. Johnson J, Ross J, Selsby J, Boddicker R, Sanz Fernandez V, Baumgard L. Effects of in utero heat stress on porcine post natal thermoreg ualtion. In. Iowa State University Animal Industry Report 2013: Iowa State University; 2013. 166. Zambrano E, Bautista CJ, Des M, Martnez Samayoa PM, Gonzlez Zamorano M, Ledesma H, Morales J, Larrea F, Nathanielsz PW. A low maternal protein diet during pregnancy and lactation has sex and window of exposure specific effects on offspring growth and food intake, glucose metabolism and serum leptin in the rat. J Physiol 2006; 571:221 230. 167. Gilbert J, Cox L, Babcock S, Shade R, Nathanielsz P, Nijland M. Gender on fetal renal renin angiotensin system (RAS). Journal of the Society for Gynecologic Investigation 2006; 13:207A. 168. Gilbert JS, Ford SP, Lang AL, Pahl L R, Drumhiller MC, Babcock SA, Nathanielsz PW, Nijland MJ. Nutrient restriction impairs nephrogenesis in a gender specific manner in the ovine fetus. Pediatr Res 2007; 61:42 47. 169. Maloney CA, Hay SM, Young LE, Sinclair KD, Rees WD. A methyl deficient die t fed to rat dams during the peri conception period programs glucose homeostasis in adult male but not female offspring. J Nutr 2011; 141:95 100. 170. Bazer FW, Wu G, Johnson GA, Kim J, Song G. Uterine histotroph and conceptus development: select nutrients and secreted phosphoprotein 1 affect mechanistic target of rapamycin cell signaling in ewes. Biol Reprod 2011; 85:1094 1107. 171. Simmons RM, Satterfield MC, Welsh TH, Bazer FW, Spencer TE. HSD11B1, HSD11B2, PTGS2, and NR3C1 expression in the peri implant ation ovine uterus: effects of pregnancy, progesterone, and interferon tau. Biol Reprod 2010; 82:35 43.

PAGE 165

165 172. Lee HY, Acosta TJ, Skarzynski DJ, Okuda K. Prostaglandin F2alpha stimulates 11Beta hydroxysteroid dehydrogenase 1 enzyme bioactivity and protein ex pression in bovine endometrial stromal cells. Biol Reprod 2009; 80:657 664. 173. Thatcher WW, Guzeloglu A, Mattos R, Binelli M, Hansen TR, Pru JK. Uterine conceptus interactions and reproductive failure in cattle. Theriogenology 2001; 56:1435 1450. 174. Fo rde N, Lonergan P. Transcriptomic analysis of the bovine endometrium: What is required to establish uterine receptivity to implantation in cattle? J Reprod Dev 2012; 58:189 195. 175. Gough NM, Gough J, Metcalf D, Kelso A, Grail D, Nicola NA, Burgess AW, Dunn AR. Molecular cloning of cDNA encoding a murine haematopoietic growth regulator, granulocyte macrophage colony stimulating factor. Nature 1984; 309:763 767. 176. Ruef C, Coleman DL. Granulocyte macrophage colony stimulating factor: pleiotropic cytokin e with potential clinical usefulness. Rev Infect Dis 1990; 12:41 62. 177. Trapnell BC, Whitsett JA. Gm CSF regulates pulmonary surfactant homeostasis and alveolar macrophage mediated innate host defense. Annu Rev Physiol 2002; 64:775 802. 178. Burgess AW, Metcalf D. The nature and action of granulocyte macrophage colony stimulating factors. Blood 1980; 56:947 958. 179. Kanzaki H, Crainie M, Lin H, Yui J, Guilbert LJ, Mori T, Wegmann TG. The in situ expression of granulocyte macrophage colony stimulating fac tor (GM CSF) mRNA at the maternal fetal interface. Growth Factors 1991; 5:69 74. 180. Chegini N, Tang XM, Dou Q. The expression, activity and regulation of granulocyte macrophage colony stimulating factor in human endometrial epithelial and stromal cells. Mol Hum Reprod 1999; 5:459 466. 181. Hayashida K, Kitamura T, Gorman DM, Arai K, Yokota T, Miyajima A. Molecular cloning of a second subunit of the receptor for human granulocyte macrophage colony stimulating factor (GM CSF): reconstitution of a high affin ity GM CSF receptor. Proc Natl Acad Sci U S A 1990; 87:9655 9659.

PAGE 166

166 182. Gearing DP, King JA, Gough NM, Nicola NA. Expression cloning of a receptor for human granulocyte macrophage colony stimulating factor. EMBO J 1989; 8:3667 3676. 183. Dhar Mascareno M, C hen J, Zhang RH, Crcamo JM, Golde DW. Granulocyte macrophage colony stimulating factor signals for increased glucose transport via phosphatidylinositol 3 kinase and hydrogen peroxide dependent mechanisms. J Biol Chem 2003; 278:11107 11114. 184. Kitamura T, Hayashida K, Sakamaki K, Yokota T, Arai K, Miyajima A. Reconstitution of functional receptors for human granulocyte/macrophage colony stimulating factor (GM CSF): evidence that the protein encoded by the AIC2B cDNA is a subunit of the murine GM CSF rece ptor. Proc Natl Acad Sci U S A 1991; 88:5082 5086. 185. Barreda DR, Hanington PC, Belosevic M. Regulation of myeloid development and function by colony stimulating factors. Dev Comp Immunol 2004; 28:509 554. 186. Robertson SA, Sjblom C, Jasper MJ, Norman RJ, Seamark RF. Granulocyte macrophage colony stimulating factor promotes glucose transport and blastomere viability in murine preimplantation embryos. Biol Reprod 2001; 64:1206 1215. 187. Sjblom C, Wikland M, Robertson SA. Granulocyte macrophage colony s timulating factor (GM CSF) acts independently of the beta common subunit of the GM CSF receptor to prevent inner cell mass apoptosis in human embryos. Biol Reprod 2002; 67:1817 1823. 188. Peralta OA, Bucher D, Fernandez A, Berland M, Strobel P, Ramirez A, Ratto MH, Concha I. Granulocyte macrophage colony stimulating factor (GM CSF) enhances cumulus cell expansion in bovine oocytes. Reprod Biol Endocrinol 2013; 11:55. 189. Lee K, Redel BK, Spate L, Teson J, Brown AN, Park KW, Walters E, Samuel M, Murphy CN, Prather RS. Piglets produced from cloned blastocysts cultured in vitro with GM CSF. Mol Reprod Dev 2013; 80:145 154.

PAGE 167

167 190. Quelle FW, Sato N, Witthuhn BA, Inhorn RC, Eder M, Miyajima A, Griffin JD, Ihle JN. JAK2 associates with the beta c chain of the rece ptor for granulocyte macrophage colony stimulating factor, and its activation requires the membrane proximal region. Mol Cell Biol 1994; 14:4335 4341. 191. Martinez Moczygemba M, Huston DP. Biology of common beta receptor signaling cytokines: IL 3, IL 5, a nd GM CSF. J Allergy Clin Immunol 2003; 112:653 665; quiz 666. 192. Sakamaki K, Miyajima I, Kitamura T, Miyajima A. Critical cytoplasmic domains of the common beta subunit of the human GM CSF, IL 3 and IL 5 receptors for growth signal transduction and tyro sine phosphorylation. EMBO J 1992; 11:3541 3549. 193. O'Leary S, Jasper MJ, Warnes GM, Armstrong DT, Robertson SA. Seminal plasma regulates endometrial cytokine expression, leukocyte recruitment and embryo development in the pig. Reproduction 2004; 128:237 247. 194. Robertson SA, Mayrhofer G, Seamark RF. Ovarian steroid hormones regulate granulocyte macrophage colony stimulating factor synthesis by uterine epithelial cells in the mouse. Biol Reprod 1996; 54:183 196. 195. Zhao Y, Chegini N. The expression of granulocyte macrophage colony stimulating factor (GM CSF) and receptors in human endometrium. Am J Reprod Immunol 1999; 42:303 311. 196. Segerer S, Kammerer U, Kapp M, Dietl J, Rieger L. Upregulation of chemokine and cytokine production during pregnancy. Gynecol Obstet Invest 2009; 67:145 150. 197. Emond V, MacLaren LA, Kimmins S, Arosh JA, Fortier MA, Lambert RD. Expression of cyclooxygenase 2 and granulocyte macrophage colony stimulating factor in the endometrial epithelium of the cow is up regulated dur ing early pregnancy and in response to intrauterine infusions of interferon tau. Biol Reprod 2004; 70:54 64. 198. Cui XS, Lee JY, Choi SH, Kwon MS, Kim T, Kim NH. Mouse granulocyte macrophage colony stimulating factor enhances viability of porcine embryos in defined culture conditions. Anim Reprod Sci 2004; 84:169 177.

PAGE 168

168 199. Kwak SS, Cheong SA, Jeon Y, Hyun SH. Porcine granulocyte macrophage colony stimulating factor improves the in vitro development of cloned porcine embryos. J Vet Med Sci 2012; 74:1095 110 2. 200. Sjblom C, Wikland M, Robertson SA. Granulocyte macrophage colony stimulating factor promotes human blastocyst development in vitro. Hum Reprod 1999; 14:3069 3076. 201. Desai N, Kattal N, AbdelHafez FF, Szeptycki Lawson J, Goldfarb J. Granulocyte m acrophage colony stimulating factor (GM CSF) and co culture can affect post thaw development and apoptosis in cryopreserved embryos. J Assist Reprod Genet 2007; 24:215 222. 202. Sheikholslami B, Salehnia M, Valojerdi MR, Ramezanzadeh M. Developmental poten tial of isolated blastomeres from early mouse embryos in the presence and absence of LIF and GM CSF. J Assist Reprod Genet 2008; 25:7 12. 203. Hickman CF, Ainslie A, Ealy AD, Ashworth CJ, Rooke JA. Effect of ovine granulocyte macrophage colony stimulating factor on bovine in vitro embryo development and blastocyst interferon 46:608 615. 204. Elaimi A, Gardner K, Kistnareddy K, Harper J. The effect of GM CSF on development and aneuploidy in murine blastocysts. Hum Reprod 2012; 27:1590 1595. 205. Dhar Mascareno M, Pedraza A, Golde DW. PI3 kinase activation by GM CSF in endothelium is upstream of Jak/Stat pathway: role of alphaGMR. Biochem Biophys Res Commun 2005; 337:551 556. 206. Jeong W, Kim J, Bazer FW, Song G. Prolifer ation stimulating effect of colony stimulating factor 2 on porcine trophectoderm cells is mediated by activation of phosphatidylinositol 3 kinase and extracellular signal regulated kinase 1/2 mitogen activated protein kinase. PLoS One 2014; 9:e88731. 207. Lazzari G, Wrenzycki C, Herrmann D, Duchi R, Kruip T, Niemann H, Galli C. Cellular and molecular deviations in bovine in vitro produced embryos are related to the large offspring syndrome. Biol Reprod 2002; 67:767 775.

PAGE 169

169 208. Papadopoulos S, Rizos D, Duffy P Wade M, Quinn K, Boland MP, Lonergan P. Embryo survival and recipient pregnancy rates after transfer of fresh or vitrified, in vivo or in vitro produced ovine blastocysts. Anim Reprod Sci 2002; 74:35 44. 209. Lonergan P, Carolan C, Van Langendonckt A, Do nnay I, Khatir H, Mermillod P. Role of epidermal growth factor in bovine oocyte maturation and preimplantation embryo development in vitro. Biol Reprod 1996; 54:1420 1429. 210. Bonilla AQ, Ozawa M, Hansen PJ. Timing and dependence upon mitogen activated pr otein kinase signaling for pro developmental actions of insulin like growth factor 1 on the preimplantation bovine embryo. Growth Horm IGF Res 2011; 21:107 111. 211. Trigal B, Gmez E, Dez C, Caamao JN, Martn D, Carrocera S, Muoz M. In vitro developmen t of bovine embryos cultured with activin A. Theriogenology 2011; 75:584 588. 212. Luo S, Yin HN, Li SW. [Effect of TGF beta1 on embryo implantation and development in mice in vitro]. Sichuan Da Xue Xue Bao Yi Xue Ban 2010; 41:265 268. 213. Cheung LP, Leun g HY, Bongso A. Effect of supplementation of leukemia inhibitory factor and epidermal growth factor on murine embryonic development in vitro, implantation, and outcome of offspring. Fertil Steril 2003; 80 Suppl 2:727 735. 214. Lavranos TC, Rathjen PD, Seam ark RF. Trophic effects of myeloid leukaemia inhibitory factor (LIF) on mouse embryos. J Reprod Fertil 1995; 105:331 338. 215. Block J, Hansen PJ. Interaction between season and culture with insulin like growth factor 1 on survival of in vitro produced emb ryos following transfer to lactating dairy cows. Theriogenology 2007; 67:1518 1529. 216. Chin PY, Macpherson AM, Thompson JG, Lane M, Robertson SA. Stress response genes are suppressed in mouse preimplantation embryos by granulocyte macrophage colony stimu lating factor (GM CSF). Hum Reprod 2009; 24:2997 3009.

PAGE 170

170 217. McClure BJ, Hercus TR, Cambareri BA, Woodcock JM, Bagley CJ, Howlett GJ, Lopez AF. Molecular assembly of the ternary granulocyte macrophage colony stimulating factor receptor complex. Blood 2003; 101:1308 1315. 218. Ozawa M, Sakatani M, Hankowski KE, Terada N, Dobbs KB, Hansen PJ. Importance of culture conditions during the morula to blastocyst period on capacity of inner cell mass cells of bovine blastocysts for establishment of self renewing plur ipotent cells. Theriogenology 2012. 219. Khan DR, Dub D, Gall L, Peynot N, Ruffini S, Laffont L, Le Bourhis D, Degrelle S, Jouneau A, Duranthon V. Expression of pluripotency master regulators during two key developmental transitions: EGA and early lineage specification in the bovine embryo. PLoS One 2012; 7:e34110. 220. Yang QE, Fields SD, Zhang K, Ozawa M, Johnson SE, Ealy AD. Fibroblast growth factor 2 promotes primitive endoderm development in bovine blastocyst outgrowths. Biol Reprod 2011; 85:946 953. 221. Sakatani M, Alvarez NV, Takahashi M, Hansen PJ. Consequences of physiological heat shock beginning at the zygote stage on embryonic development and expression of stress response genes in cattle. J Dairy Sci 2012; 95:3080 3091. 222. Yang QE, Johnson SE, Ealy AD. Protein kinase C delta mediates fibroblast growth factor 2 induced interferon tau expression in bovine trophoblast. Biol Reprod 2011; 84:933 943. 223. Ozawa M, Hansen PJ. A novel method for purification of inner cell mass and trophectoderm cel ls from blastocysts using magnetic activated cell sorting. Fertil Steril 2011; 95:799 802. 224. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real time quantitative RT PCR data by geometric ave raging of multiple internal control genes. Genome Biol 2002; 3:RESEARCH0034. 225. Block J, Fischer Brown AE, Rodina TM, Ealy AD, Hansen PJ. The effect of in vitro treatment of bovine embryos with IGF 1 on subsequent development in utero to Day 14 of gestat ion. Theriogenology 2007; 68:153 161.

PAGE 171

171 226. Fischer Brown AE, Lindsey BR, Ireland FA, Northey DL, Monson RL, Clark SG, Wheeler MB, Kesler DJ, Lane SJ, Weigel KA, Rutledge JJ. Embryonic disc development and subsequent viability of cattle embryos following cu lture in two media under two oxygen concentrations. Reprod Fertil Dev 2004; 16:787 793. 227. Richter KS, Harris DC, Daneshmand ST, Shapiro BS. Quantitative grading of a human blastocyst: optimal inner cell mass size and shape. Fertil Steril 2001; 76:1157 1 167. 228. Vallier L, Alexander M, Pedersen RA. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci 2005; 118:4495 4509. 229. Smith AG, Nichols J, Robertson M, Rathjen PD. Differentiation inhibiting ac tivity (DIA/LIF) and mouse development. Dev Biol 1992; 151:339 351. 230. Gong G, Roach ML, Jiang L, Yang X, Tian XC. Culture conditions and enzymatic passaging of bovine ESC like cells. Cell Reprogram 2010; 12:151 160. 231. Rooke J, Ewen M, McEvoy T, Entri can G, Ashworth C. Effect of inclusion of serum and granulocyte macrophage colony stimulating factor on secretion of interferon tau during the in vitro culture of ovine embryos. Reprod Fertil Dev 2005; 17:513 521. 232. Mui AL, Wakao H, Harada N, O'Farrell AM, Miyajima A. Interleukin 3, granulocyte macrophage colony stimulating factor, and interleukin 5 transduce signals through two forms of STAT5. J Leukoc Biol 1995; 57:799 803. 233. Gluckman PD, Hanson MA, Cooper C, Thornburg KL. Effect of in utero and ear ly life conditions on adult health and disease. N Engl J Med 2008; 359:61 73. 234. Gluckman PD, Hanson MA. Living with the past: evolution, development, and patterns of disease. Science 2004; 305:1733 1736. 235. Gillman MW. Developmental origins of health and disease. N Engl J Med 2005; 353:1848 1850.

PAGE 172

172 236. Gluckman PD, Hanson MA, Beedle AS. Early life events and their consequences for later disease: a life history and evolutionary perspective. Am J Hum Biol 2007; 19:1 19. 237. Scherrer U, Rimoldi SF, Rexhaj E, Stuber T, Duplain H, Garcin S, de Marchi SF, Nicod P, Germond M, Allemann Y, Sartori C. Systemic and pulmonary vascular dysfunction in children conceived by assisted reproductive technologies. Circulation 2012; 125:1890 1896. 238. Reefhuis J, Honein MA Schieve LA, Correa A, Hobbs CA, Rasmussen SA, Study NBDP. Assisted reproductive technology and major structural birth defects in the United States. Hum Reprod 2009; 24:360 366. 239. Farin PW, Crosier AE, Farin CE. Influence of in vitro systems on embryo survival and fetal development in cattle. Theriogenology 2001; 55:151 170. 240. Young LE, Sinclair KD, Wilmut I. Large offspring syndrome in cattle and sheep. Rev Reprod 1998; 3:155 163. 241. Sinclair KD, Young LE, Wilmut I, McEvoy TG. In utero overgrowth in ruminants following embryo culture: lessons from mice and a warning to men. Hum Reprod 2000; 15 Suppl 5:68 86. 242. Fleming TP, Kwong WY, Porter R, Ursell E, Fesenko I, Wilkins A, Miller DJ, Watkins AJ, Eckert JJ. The embryo and its future. Biol Reprod 2004; 71:1046 1054. 243. Aiken CE, Ozanne SE. Sex differences in developmental programming models. Reproduction 2013; 145:R1 13. 244. Trivers RL, Willard DE. Natural selection of parental ability to vary the sex ratio of offspring. Science 1973; 179:90 92. 245. Bermejo Alvarez P, Rizos D, Rath D, Lonergan P, Gutierrez Adan A. Sex determines the expression level of one third of the actively expressed genes in bovine blastocysts. Proc Natl Acad Sci U S A 2010; 107:3394 3399.

PAGE 173

173 246. Kobayashi S, Isotani A, Mise N, Yamamoto M, Fujihara Y, Kaseda K, Nakanishi T, Ikawa M, Hamada H, Abe K, Okabe M. Comparison of gene expression in male and female mouse blastocysts revealed imprinting of the X linked gene, Rhox5/Pem, at preimplantation stages. Curr Biol 2006; 16:166 172. 247. Dobbs KB, Khan FA, Sakatani M, Moss JI, Ozawa M, Ealy AD, Hansen PJ. Regulation of Pluripotency of Inner Cell Mass and Growth and Differentiation of Trophectoderm of the Bovine Embryo by Colony Stimulating Factor 2. Biol Reprod 2013. 248. Karagen c L, Lane M, Gardner DK. Granulocyte macrophage colony stimulating factor stimulates mouse blastocyst inner cell mass development only when media lack human serum albumin. Reprod Biomed Online 2005; 10:511 518. 249. the International Embryo Transfer Society: International Embryo Transfer Society; 1998: 103 116. 250. Parrish JJ, Susko Parrish JL, Leibfried Rutledge ML, Critser ES, Eyestone WH, First NL. Bovine in vitro fertilizati on with frozen thawed semen. Theriogenology 1986; 25:591 600. 251. Bisinotto RS, Ribeiro ES, Martins LT, Marsola RS, Greco LF, Favoreto MG, Risco CA, Thatcher WW, Santos JE. Effect of interval between induction of ovulation and artificial insemination (AI) and supplemental progesterone for resynchronization on fertility of dairy cows subjected to a 5 d timed AI program. J Dairy Sci 2010; 93:5798 5808. 252. Park JH, Lee JH, Choi KM, Joung SY, Kim JY, Chung GM, Jin DI, Im KS. Rapid sexing of preimplantation b ovine embryo using consecutive and multiplex polymerase chain reaction (PCR) with biopsied single blastomere. Theriogenology 2001; 55:1843 1853. 253. Robert C, Nieminen J, Dufort I, Gagn D, Grant JR, Cagnone G, Plourde D, Nivet AL, Fournier , Paquet , B lazejczyk M, Rigault P, et al. Combining resources to obtain a comprehensive survey of the bovine embryo transcriptome through deep sequencing and microarrays. Mol Reprod Dev 2011; 78:651 664. 254. Carvajal Rodriguez A, de Ua Alvarez J. Assessing signific ance in high throughput experiments by sequential goodness of fit and q value estimation. PLoS One 2011; 6:e24700.

PAGE 174

174 255. Dennis G, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Database for Annotation, Visualization, and Integrated Disc overy. Genome Biol 2003; 4:P3. 256. Yamada T, Letunic I, Okuda S, Kanehisa M, Bork P. iPath2.0: interactive pathway explorer. Nucleic Acids Res 2011; 39:W412 415. 257. Goossens K, Van Poucke M, Van Soom A, Vandesompele J, Van Zeveren A, Peelman LJ. Selecti on of reference genes for quantitative real time PCR in bovine preimplantation embryos. BMC Dev Biol 2005; 5:27. 258. Oliveira CS, Saraiva NZ, Cruz MH, Mazeti B, Oliveira LZ, Lopes FL, Garcia JM. HDAC inhibition decreases XIST expression on female IVP bovi ne blastocysts. Reproduction 2013; 145:9 17. 259. de Montera B, Fournier E, Shojaei Saadi HA, Gagn D, Laflamme I, Blondin P, Sirard MA, Robert C. Combined methylation mapping of 5mC and 5hmC during early embryonic stages in bovine. BMC Genomics 2013; 14:406. 260. Smyth GK. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 2004; 3:Article3. 261. Smith ZD, Chan MM, Mikkelsen TS, Gu H, Gnirke A, Regev A, Meissner A. A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature 2012; 484:339 344. 262. Elango N, Yi SV. Functional relevance of CpG island length for regulation of gene expression. Genetics 2011; 187:1077 1083. 263. Krausz C, Sandoval J, Sayols S, Chianese C, Giachini C, Heyn H, Esteller M. Novel insights into DNA methylation features in spermatozoa: stability and peculiarities. PLoS One 2012; 7:e44479. 264. Jurka J, Kapitonov VV, Pavlicek A, Klonowski P, Kohany O, Walichiewicz J. Repbase Update a database of eukaryotic repetitive elements. Cytogenet Genome Res 2005; 110:462 467.

PAGE 175

175 265. Betteridge KJ, Eaglesome MD, Randall GC, Mitchell D. Collection, description and transfer of embryos from cattle 10 -16 days after oestrus. J Reprod Fertil 1980; 5 9:205 216. 266. Machado GM, Ferreira AR, Guardieiro MM, Bastos MR, Carvalho JO, Lucci CM, Diesel TO, Sartori R, Rumpf R, Franco MM, Dode MA. Morphology, sex ratio and gene expression of day 14 in vivo and in vitro bovine embryos. Reprod Fertil Dev 2013; 25 :600 608. 267. Kimura K, Spate LD, Green MP, Murphy CN, Seidel GE, Jr., Roberts RM. Sexual dimorphism in interferon tau production by in vivo derived bovine embryos. Mol Reprod Dev 2004; 67:193 199. 268. Bermejo Alvarez P, Rizos D, Rath D, Lonergan P, Guti errez Adan A. Epigenetic differences between male and female bovine blastocysts produced in vitro. Physiol Genomics 2008; 32:264 272. 269. Sharkey DJ, Macpherson AM, Tremellen KP, Robertson SA. Seminal plasma differentially regulates inflammatory cytokine gene expression in human cervical and vaginal epithelial cells. Mol Hum Reprod 2007; 13:491 501. 270. Palma GA, Mller M, Brem G. Effect of insulin like growth factor I (IGF I) at high concentrations on blastocyst development of bovine embryos produced in vitro. J Reprod Fertil 1997; 110:347 353. 271. Morgan HD, Santos F, Green K, Dean W, Reik W. Epigenetic reprogramming in mammals. Hum Mol Genet 2005; 14 Spec No 1:R47 58. 272. Bultman SJ, Gebuhr TC, Pan H, Svoboda P, Schultz RM, Magnuson T. Maternal BRG1 r egulates zygotic genome activation in the mouse. Genes Dev 2006; 20:1744 1754. 273. Canovas S, Cibelli JB, Ross PJ. Jumonji domain containing protein 3 regulates histone 3 lysine 27 methylation during bovine preimplantation development. Proc Natl Acad Sci U S A 2012; 109:2400 2405. 274. Shi W, Dirim F, Wolf E, Zakhartchenko V, Haaf T. Methylation reprogramming and chromosomal aneuploidy in in vivo fertilized and cloned rabbit preimplantation embryos. Biol Reprod 2004; 71:340 347.

PAGE 176

176 275. Giraldo AM, Hylan DA, Ballard CB, Purpera MN, Vaught TD, Lynn JW, Godke RA, Bondioli KR. Effect of epigenetic modifications of donor somatic cells on the subsequent chromatin remodeling of cloned bovine embryos. Biol Reprod 2008; 78:832 840. 276. Wojdacz TK, Dobrovic A. Methyla tion sensitive high resolution melting (MS HRM): a new approach for sensitive and high throughput assessment of methylation. Nucleic Acids Res 2007; 35:e41. 277. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003; 49:853 860. 278. Wojdacz TK, Dobrovic A, Hansen LL. Methylation sensitive high resolution melting. Nat Protoc 2008; 3:1903 1908. 279. Rougier N, Bourc'his D, Gomes DM, Niveleau A, Plachot M, Pldi A, Viegas Pquignot E. Chromosome methylation patterns during mammalian preimplantation development. Genes Dev 1998; 12:2108 2113. 280. Dean W, Santos F, Reik W. Epigenetic reprogramming in early mammalian development and following somatic nuclear transfer. Semin Cell Dev Biol 2003; 14:93 100. 281. Bestor TH. The DNA methyltransferases of mammals. Hum Mol Genet 2000; 9:2395 2402. 282. Zhu JK. Active DNA demethylation mediated by DNA glycosylases. Annu Rev Genet 2009; 43:143 166. 283. Camous S, Kopecn V, Flc hon JE. Autoradiographic detection of the earliest stage of [3H] uridine incorporation into the cow embryo. Biol Cell 1986; 58:195 200. 284. Borgel J, Guibert S, Li Y, Chiba H, Schbeler D, Sasaki H, Forn T, Weber M. Targets and dynamics of promoter DNA m ethylation during early mouse development. Nat Genet 2010; 42:1093 1100.

PAGE 177

177 285. Chen T, Zhang YL, Jiang Y, Liu SZ, Schatten H, Chen DY, Sun QY. The DNA methylation events in normal and cloned rabbit embryos. FEBS Lett 2004; 578:69 72. 286. Ozawa M, Sakatani M, Yao J, Shanker S, Yu F, Yamashita R, Wakabayashi S, Nakai K, Dobbs KB, Sudano MJ, Farmerie WG, Hansen PJ. Global gene expression of the inner cell mass and trophectoderm of the bovine blastocyst. BMC Dev Biol 2012; 12:33. 287. Gutirrez Adn A, Behboodi E, Murray JD, Anderson GB. Early transcription of the SRY gene by bovine preimplantation embryos. Mol Reprod Dev 1997; 48:246 250. 288. Avery B, Jrgensen CB, Madison V, Greve T. Morphological development and sex of bovine in vitro fertilized embryos. Mol Reprod Dev 1992; 32:265 270. 289. Gutirrez Adn A, Behboodi E, Andersen GB, Medrano JF, Murray JD. Relationship between stage of development and sex of bovine IVM IVF embryos cultured in vitro versus in the sheep oviduct. Theriogenology 1996; 46:515 525. 290. Gebert C, Wrenzycki C, Herrmann D, Grger D, Reinhardt R, Hajkova P, Lucas Hahn A, Carnwath J, Lehrach H, Niemann H. The bovine IGF2 gene is differentially methylated in oocyte and sperm DNA. Genomics 2006; 88:222 229. 291. Hansen PJ, Block J, Lourei ro B, Bonilla L, Hendricks KE. Effects of gamete source and culture conditions on the competence of in vitro produced embryos for post transfer survival in cattle. Reprod Fertil Dev 2010; 22:59 66. 292. Block J. Use of insulin like growth factor 1 to impro ve post transfer survival of bovine embryos produced in vitro. Theriogenology 2007; 68 Suppl 1:S49 55. 293. El Sayed A, Hoelker M, Rings F, Salilew D, Jennen D, Tholen E, Sirard MA, Schellander K, Tesfaye D. Large scale transcriptional analysis of bovine e mbryo biopsies in relation to pregnancy success after transfer to recipients. Physiol Genomics 2006; 28:84 96. 294. Boland MP, Lonergan P, O'Callaghan D. Effect of nutrition on endocrine parameters, ovarian physiology, and oocyte and embryo development. Th eriogenology 2001; 55:1323 1340.

PAGE 178

178 BIOGRAPHICAL SKETCH Kyle Dobbs was born and raised in Webster Groves, MO, a suburb of St. Louis, to Kathy and Brad Dobbs. He is the older brother of Kory. His father spurred his love of science and animals at a young age. He attended high school at Lutheran High School South in Afton, MO where he graduated in 2004. Following graduation, he moved to Columbia, MO to begin his collegiate career at the University of Missouri where he gra duated in 2008 with his Bachelor of Science degree in biological sciences and a minor in chemistry. During his underg raduate studies, he worked as a researcher in the laboratory of Dr. Randall Prather. Following graduation, he began his graduate career where he studied polyadenylation of porcine transcripts during early embryogenesis. After gr aduat ion in 2010 with his Master of Science degree, he married his high school sweetheart, Lauren (Kienstra) and immediately moved the next day to Gainesville, FL to be gin work on his doctorate wit h Dr. Peter J. Hansen in the Animal Molecular and Cellular B iology Graduate Program. While at Florida, he was supported by a Graduate Fellowship One of the experiments for his dissertation was recognized as the outstanding stu dent poster presentation at the 40 th Annual Conference of the International Embryo Transfer Society held January 11 14, 2014 in Reno NV. After completing his Doctor of Philosophy degree, Kyle and Lauren will move to Boston, MA where he will continue his ca reer as a post doctoral researcher at Northeastern University in the lab oratory of Dr. Jonathan Tilly.