Citation
Animal Models and Pathophysiology of Rapid-Onset Dystonia-Parkinsonism and Restless Legs Syndrome

Material Information

Title:
Animal Models and Pathophysiology of Rapid-Onset Dystonia-Parkinsonism and Restless Legs Syndrome
Creator:
Deandrade, Mark
Publisher:
University of Florida
Publication Date:
Language:
English

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Neuroscience (IDP)
Committee Chair:
LI,YUQING
Committee Co-Chair:
MANDEL,RONALD JAMES
Committee Members:
OKUN,MICHAEL S
FERNANDEZ-FUNEZ,PEDRO
HUANG,SUMING
Graduation Date:
5/3/2014

Subjects

Subjects / Keywords:
Animal models ( jstor )
Dystonia ( jstor )
Female animals ( jstor )
Knockout mice ( jstor )
Memory ( jstor )
Mice ( jstor )
Restless legs syndrome ( jstor )
Sleep ( jstor )
Stress tests ( jstor )
Wheels ( jstor )
atp1a3
btbd9
dystonia
knockout
mouse
rls

Notes

General Note:
Rapid-onset dystonia-parkinsonism (RDP) and restless legs syndrome (RLS) are two neurological movement disorders that are severely understudied. Patients with RDP exhibit the symptoms of dystonia and Parkinson's disease. However, patients will not present with symptoms until triggered by a physiological stressor, and generally do not remit from there. In RLS, patients present with an uncontrollable urge to move at night or at rest, which is often accompanied by unpleasant sensations in the legs. In the first aim of this research, we characterized the first genotypic mouse model of rapid-onset dystonia-parkinsonism using heterozygous Atp1a3 knockout mice. We demonstrated that these mice, like RDP patients, exhibit no motor deficits prior to a strong physiological stressor. However, post-stress, female mice display alterations in locomotor activity, motor performance, and perception of warm stimuli. In the second aim of this research, we generated and characterized the first potential genotypic model of restless legs syndrome using homozygous Btbd9 knockout mice. We developed a battery of experiments to test these mice, and found motor restlessness, alterations in sleep architecture, changes in perception to warm stimuli, and dysfunction in iron homeostasis in the mice. Furthermore, we found that the Btbd9 knockout mice responded to a common treatment in RLS patients, ropinirole, and rescued the sensory deficits. Finally, in the third aim of this research, we utilized the Btbd9 knockout mice to probe the natural function of the Btbd9 protein. Little is currently known about this protein. We found that mice deficient in Btbd9 exhibit altered neurotransmission and synaptic plasticity, with a consequential effect on learning and memory. Overall, we put forth that the heterozygous Atp1a3 and homozygous Btbd9 knockout animals model their respective diseases well, and represent the first two genotypic models. Furthermore, the comprehensive battery of tests that we developed can be used on future potential animal models. Lastly, these studies provide a launch pad for numerous studies, and several of these are discussed. Most importantly, these mouse models can be used in future studies to elucidate the pathophysiology of their associated diseases and develop novel therapeutics to treat patients.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Deandrade, Mark. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
5/31/2016

Downloads

This item has the following downloads:


Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EGHZ8NAD1_1ANYN3 INGEST_TIME 2014-10-03T21:40:43Z PACKAGE UFE0046519_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES



PAGE 1

ANIMAL MODELS AND PATHOPHYSIOLOGY OF RAPID ONSET DYSTONIA PARKINSONISM AND RESTLESS LEGS SYNDROME By MARK P. DEANDRADE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

2014 Mark P. DeAndrade

PAGE 3

To my parents Avito and Neola, for their love and support ; my brothers, Kevin and James, for their inspiration and motivation to strive for excellence; and in memory of my grandparents Louis and Helena Pereira de Andrade and Michael and Lydia Abreo.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank first and foremost Dr. Yuqing Li and the past and present members of his laboratory, including but not limited to, Dr. Fumiaki Yokoi, Dr. Lin Zhang, Dr. Li Zhang, Chad C. Cheetham, Atbin Doroodchi, Miki Jino, and Kelly Dexter, for all their assistance and guidance. I would like to thank my numerous collaborators who have helped make this work possible. Dr. Thomas van Groen assisted in teaching me how to conduct several of the behavioral experiments in this dis sertation, alongside providing the equipment necessary to carry the experiments out. Dr. J. David Sweatt, Dr. Steven N. Roper, and their respective laboratories helped in conducting the electrophysiological experiments. Drs. J. Michael Wyss and Ning Peng helped in the implantation of the biopotential electrodes in the polysomnography and electromyographic studies, and provided the equipment to carry out and analyze the data from these experiments. Dr. Karen L. Gamble provided the wheel running setup used for the Btbd9 knockout animal studies, assist ed in analyzing the data from these experiments, and serv ed on my committee when I was a Master degree student at the University of Alabama at Birmingham Dr. Erica L. Unger assist ed in analyzing striatal tissue f or iron levels by atomic absorption spectroscopy. Dr. Jerry B. Lingrel graciously supplied the Atp1a3 knockout mice. I would like to thank the members of the Departments of Neurology and Neuroscience, in particular Drs. Tet suo Ashizawa, Lucia Notterpek, Wo lfgang J. Streit, Jennifer Bizon, Harry S. Nick, Jada Lewis, Ms. Linda Kilgore, Ms. Shuri Pass, and Ms. Betty J. Streetman, for their advice, support, and patience. I would also like to thank Dr. Paul Gulig and his staff in the Office of Graduate Education in the College of Medicine in particular Ms. Teresa Richardson and Ms. Susan Gardner, for their advice and

PAGE 5

5 support. I would like to thank Drs. Pedro Fernandez Funez, Suming Huang, Ronald J. Mandel, and Michael S. Okun for serv ing on my graduate supervisory committee, provide useful insight, and positive critiques with the aim of making me a better scientist. I have a heartfelt appreciation to Mnica Santisteban for her invaluable and indispensible support, sage advice, and constant encouragement throughout my graduate studies. Lastly, I would like to thank the funding sources for Dr. Yuqings laboratory [NIH NI N DS (N S47692, NS54246, NS57098, NS47466, NS37406 and NS65273) and startup funds from the Department of Neurology (UAB, UF) and Tylers Hope for a Dystonia Cure, Inc. ] With out the abovementioned people and funding sources, the work in this dissertation would no t be possible.

PAGE 6

6 TABLE OF CONTENTS page ACKNOWLEDGMENT S .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 9 LIST OF FIGURES ........................................................................................................ 10 LIST OF ABBREVIA TIONS ........................................................................................... 12 ABSTRACT ................................................................................................................... 15 CHAPTER 1 INTRODUCTION .................................................................................................... 17 Animal Models ........................................................................................................ 17 Rapid Onset Dystonia Parkinsonism ...................................................................... 18 Clinical Features and Classification .................................................................. 18 Dopaminergic System in Dystonia .................................................................... 19 Genetics of RapidOnset DystoniaParkinsonism ............................................. 21 Alternating Hemiplegia in Childhood and RapidOnset DystoniaParkinsonism ................................................................................................. 22 Restless Legs Syndrome ........................................................................................ 22 Clinical Features, Prevalence, and Comorbidities ............................................ 22 Dopaminergic System in Restless Legs Syndrome .......................................... 23 Iron Homeostasis in Restless Legs Syndrome ................................................. 25 Genetics of Restless Legs Syndrome .............................................................. 26 Goals and Significance ........................................................................................... 27 2 MATERIALS AND METHODS ................................................................................ 28 General Considerations .......................................................................................... 28 Mice ........................................................................................................................ 28 Atp1a3 Knockout Mice ..................................................................................... 28 Btbd9 Knockout Mice ....................................................................................... 29 Behavior Paradigms ............................................................................................... 30 Restraint Stress Protocol .................................................................................. 30 Beam walking Test ........................................................................................... 31 Rotarod Test ..................................................................................................... 31 Grip Strength Test ............................................................................................ 32 Open Field Test ................................................................................................ 32 Wheel Running Te st ......................................................................................... 32 Tail Flick Test ................................................................................................... 33 Fear Conditioning Memory Assessment ........................................................... 34 Polysomnography ............................................................................................. 35

PAGE 7

7 Electromyography ............................................................................................ 36 High Performance Liquid Chromatography ............................................................. 37 Iron Measurements ................................................................................................. 38 Colorimetric Assay for Serum Iron .................................................................... 38 Atomic Absorption Spectroscopy for Iron in Striatal Tissue .............................. 39 Electrophysiology .................................................................................................... 39 Field Recordings .............................................................................................. 39 Whole cell Recor dings ...................................................................................... 40 Western Blot ........................................................................................................... 42 RT PCR .................................................................................................................. 43 Statistics ................................................................................................................. 44 3 PART1: CHARACTERIZATION OF ATP1A3 KNOCKOUT MICE AS A MODEL FOR RAPIDONSET DYSTONIA PARKINSONISM ............................................... 45 Motor Deficits in Female Heterozygous Atp1a3 Mutant Mice ................................. 45 Beam walking test ............................................................................................ 45 Accelerated Rotarod Test ................................................................................. 46 Grip Strength Test .................................................................................................. 46 Activity Level s of Heterozygous Atp1a3 Mutant Mice ............................................. 46 Spontaneous activity levels .............................................................................. 46 Voluntary activity levels .................................................................................... 47 Sensory Deficits in Heterozygous Atp1a3 Mutant Mice .......................................... 47 No Alterations in Striatal Neurochemical Levels ..................................................... 48 4 PART 2: CHARACTERIZATION OF BTBD9 KNOCKOUT MICE AS A POTENTIAL MODEL FOR RESTLESS LEGS SYNDROME .................................. 55 Generation of Btbd9 Knockout Mice ....................................................................... 55 Motor Restlessness in Btbd9 Knockout Mice .......................................................... 57 Thermal Sensory Alterations in Btbd9 Knockout Mice ............................................ 58 Sleep Structure Alterations in Btbd9 Knockout Mice ............................................... 59 Altered Iron Metabolism in Btbd9 Knockout Mice ................................................... 60 Altered Serotonergic Metabolism in Btbd9 Knockout Mice ..................................... 60 5 PART 3: ENHANCED HIPPOCAMPAL LONG TERM POTENTIATION AND FEAR MEMORY IN BTBD9 KNOCKOUT MICE ..................................................... 73 Field Recordings of Btbd9 Knockout Mice .............................................................. 73 Whole cell Recording of Btbd9 Knockout Mice ....................................................... 74 Fear Memory in Btbd9 Knockout Mice .................................................................... 74 Analysis of Proteins Involved in Synaptic Transmission in the Btbd9 Knockout Mice ..................................................................................................................... 75 6 CONCLUSION ........................................................................................................ 81 Rapid Onset Dystonia Parkinsonism ...................................................................... 81 Restless Legs Syndrome ........................................................................................ 83

PAGE 8

8 Future Directions .................................................................................................... 86 Rapid onset Dy stoniaParkinsonism ................................................................ 86 Electromyographic characterization of Atp1a3 mutant mice ...................... 86 Generation and characterization of conditional knockout mice .................. 87 Restless Legs Syndrome .................................................................................. 89 Magnetic r esonance imaging of Btbd9 KO mice ........................................ 89 Electrophysiological characterization of the spinal cord in Btbd9 KO mice ........................................................................................................ 90 Generation and characterization of conditional knockout mice .................. 91 Common Themes ................................................................................................... 92 Disease Perspective ......................................................................................... 92 Animal Model Perspective ................................................................................ 93 LIST OF REFERENCES ............................................................................................. 100 BIOGRAPHICAL SKETCH .......................................................................................... 115

PAGE 9

9 LIST OF TABLES Table page 3 1 DA, 5 HT, and th eir metabolites in the striatum .................................................. 54 4 1 Primers located in the sixth of the Btbd9 gene ................................................... 68 4 2 Primers locate geo gene trap vector .................................................... 69 4 3 Non Mendelian ratios of pups from heterozygous Btbd9 mutant mice interbreeding ....................................................................................................... 70 4 4 No alterations in anxiety or stereotypical behaviors in open field ....................... 70 4 5 Wheel running activity parameters during norm al 12:12 light, dark cycle (LD) ... 70 4 6 Wheel running activity parameter s during constant darkness (DD) .................... 71 4 7 Polysomnographic sleep p arameters during the rest phase ............................... 71 4 8 Levels of dopamine, serotonin, and their metabolites in the striatum ................. 72 6 1 Sustained contractions in wildtype and Dyt1 KI mice ........................................ 99

PAGE 10

10 LIST OF FIGURES Figure page 3 1 Hind limb slips on the beam walking test ............................................................ 49 3 2 Latency to fall on the accelerated rotarod test .................................................... 50 3 3 Forelimb and hind limb grip strength .................................................................. 50 3 4 Open field test to measure spontaneous activity levels ...................................... 51 3 5 Voluntary activity levels measured by wheel running ......................................... 52 3 6 Tail flick sensory test to determine perception of a warm stimulus ..................... 53 4 1 geo vector insertion site and PCR map ................................... 62 4 2 Generation and genotyping of Btbd9 knockout mice .......................................... 63 4 3 Confirmation of loss of WT mRNA and fusion protein expression in hippocampus of Btbd9 knockout mice ................................................................ 64 4 4 Open field test to measure total activity .............................................................. 64 4 5 Wheel running analysis to measure voluntary activity ........................................ 65 4 6 Tail flick test to determine sensory perception to warm stimuli. .......................... 66 4 7 Iron concentrations in the serum and striatum .................................................... 67 5 1 Hippocampal CA1 electrophysiological field recordings ..................................... 76 5 2 Hippocampal CA1 electrophysiological wholecell recordings ............................ 77 5 3 Response to electric shocks. .............................................................................. 78 5 4 Freezing behavior in fear conditioning experiment ............................................. 79 5 5 Western blot analyses of synaptic proteins from hippocampal synaptosome fractions .............................................................................................................. 80 6 1 Electromyographic traces of the bicep femoris muscle ....................................... 94 6 2 MEMRI scans ..................................................................................................... 95 6 3 Quantificati on of MEMRI signals ......................................................................... 96

PAGE 11

11 6 4 Spinal reflex amplitude in response to dopamine and the D2like agonist quinpirole ............................................................................................................ 97 6 5 Quantitative RT PCR revealed a specific reduction of Btbd9 mRNA in the striatum of the Btbd9 sKO mice .......................................................................... 97 6 6 Open field activity ............................................................................................... 98

PAGE 12

12 LIST OF ABBREVIATIONS [ 11 CFT [ 11 C] 2 carbometoxy 3 (4 fluorophenyl)tropane 3 MT 3 methoxytyramine 5 HIAA 5 hydroxyindoleacetic acid 5 HT Serotonin ADP Adenosine diphosphate AHC Alternating hemiplegia in childhood ANOVA Analysis of variance ATP Adenosine triphosphate ATP1A3 Human K ATPase Atp1a3 K ATPase BH 4 Tetrahydrobiopterin BP Base pair BTB Bric brac BTBD9 Human gene coding for the BTBD9 protein Btbd9 Mouse gene coding for the Btbd9 protein BTBD9 Human bric brac, tramtrack, broad complex domain containing 9 protein Btbd9 Mouse bric brac, tramtrack, broad complex domain containing 9 protein CCW Counterclockwise CSF Cerebrospinal fluid CW Clockwise DA Dopamine DAT Dopamine transporter DD Dark, dark cycle/constant darkness

PAGE 13

13 DOPAC 3,4 dihyroxyphenylacetic acid EEG Electroencephalographic EMG Electromyographic ES Embryonic stem GABA Aminobutyric acid GPe Globus pallidus pars externa GPi Globus pallidus pars interna GWAS Genome wide association study Het Heterozygous knockout mouse HPLC High performance liquid chromatography HVA Homovanillic acid I/O Input/output IRLSSG International Restless Legs Syndrome Study Group KB Kilobase KO Homozygous knockout mouse L DOPA L 3,4 dihydroxyphenylalanine LA PCR Long and accurate PCR LD Light, dark cycle LS Least square LTP Long term potentiation mEPSC Miniature excitatory post synaptic currents MHPG 3 methoxy 4 hydroxyphenylglycol MPTP 1 methyl 4 phenyl 1,3,4,6 tetrahydro pA Polyadenylation sequence PCR Polymerase chain reaction

PAGE 14

14 PLM Periodic leg movements PPF Paired pulse facilitation PPR Paired pulse ratios qPCR Quantitative PCR RDP Rapid onset dystonia parkinsonism, DYT12 dystonia REM Rapid eye movement sleep RLS/WED Restless legs syndrome, Willis Ekbom Disease RPM Rotations per minute RT PCR Reverse transcriptase PCR SEM Standard error of the mean SNP Single nucleotide polymorphism SWS Slow wave sleep TW:TS Total awake to total asleep ratio WASO Wake after sleep onset WT Wild type mouse

PAGE 15

15 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ANIMAL MODELS AND PATHOPHYSIOLOGY OF RAPID ONSET DYSTONIA PARKINSONISM AND RESTLESS LEGS SYNDROME By Mark P. DeAndrade May 2014 Chair: Yuqing Li Major: Medical Sciences Neuroscience Rapid onset dystonia parkinsonism (RDP) and restless legs syndrome (RLS) are two neurological movement disorders that are severely understudied Patients with RDP exhibit the symptoms of dystonia and Parkinson's disease. However, patients will not present with symptoms until triggered by a physiological stre ssor, and generally do not remit from there. In RLS, patients present with an uncontrollable urge to move at night or at rest, which is often accompanied by unpleasant sensations in the legs. In the first aim of this research we characterized the first g enotypic mouse model of rapid onset dystonia parkinsonism using heterozygous Atp1a3 knockout mice. We demonstrated that these mice, like RDP patients, exhibit no motor deficits prior to a strong physiological stressor. However, post stress, female mice dis play alterations in locomotor activity, motor performance, and perception of warm stimuli. In the second aim of this research we generated and characterized the first potential genotypic model of restless legs syndrome using homozygous Btbd9 knockout mice We developed a battery of experiments to test these mice, and found motor restlessness, alterations in sleep architecture, changes in perception to warm stimuli, and dysfunction in iron homeostasis in the mice Furthermore, we found that the Btbd9

PAGE 16

16 knockout mice responded to a common treatment in RLS patients, ropinirole, and rescue d the sensory deficits. Finally, in th e third aim of this research, we utilized the Btbd9 knockout mice to probe the natural function of the Btbd9 protein. Little is currently known about this protein. We found that mice deficient in Btbd9 exhibit altered neurotransmission and synaptic plastic ity, with a consequential effect on learning and memory. Overall, we put forth that the heterozygous Atp1a3 and homozygous Btbd9 knockout animals model their respective disease s well, and represent the first two genotypic models. Furthermore, the comprehensive battery of tests that we developed can be used on future potential animal models. Lastly, these studies provide a launch pad for numerous studies, and several of these are discussed. Most importantly, these mouse models can be used in future studies t o elucidate the pathophysiology of their associated diseases and develop novel therapeutics to treat patients.

PAGE 17

17 CHAPTER 1 INTRODUCTION Animal Models From yeast to nonhuman primates, animal models are invaluable tool s in scientific research to discern pathophysiology and develop novel therapeutics. Investigators primarily use r odents, in particular mice and rats, due to their nearly homologous genome to humans, similar physiology, and short generation period (C apecchi, 1994; Hall et al., 2009) With advances in genetic technology, animal models are often developed to model diseases based on a known causative or associated gene. In the late 1980s, two independent groups generated the first genetic knockout mice (Mansour et al., 1988; Schwartzberg et al., 1989) G lobal efforts are underway to generate a knockout mouse of every gene in the mouse genome with approximately 11,000 genes knocked out to date (Grimm, 2006; White et al., 2013) The t wo main methods used to generate knockout mice are gene targeting and gene trapping. In the gene targeting method an artificial DNA vector is designed based on a genomic region of interest. However, the targeting vector contains mutations in the genetic sequence that can be used to effectively silence the gene. This targeting vector is inserted into embryonic stem (ES) cells, e.g. by electroporation, and will align itself with the homologous geno mic region. Using the natural DNA repair mechanism in ES cells in particular the proteins associated with homologous recombination, the targeting vector will replace the normal gen omic region in a small percentage of ES cells In the case of gene trapping, investigators insert a targeting vector into the promoter, an exon, or an intron of a gene at random In general this vector consists of a reporter gene to map the endogenous gene expression, a selection gene to isolate succe ssfully targeted

PAGE 18

18 ES cell s, and a polyadenylation (pA) signal sequence to terminate the transcription of the gene prematurely. After insertion, investigators can identify which gene the targeting vector randomly inserted into using polymerase chain reaction (PCR) techniques We studied two new potential models of rapidonset dystoniaparkinsonism and restless legs syndrome using knockout mice. The first knockout mouse was developed by gene targeting, while the second was developed by gene trapping. In this d issertation, we will discuss the current knowledge base of these two diseases, the characterization of the knockout mice, and what we learned from them. Rapid Onset Dystonia Parkinsonism Clinical Features and Classification The definition of dystoni a has evolved over time, but most recently it is defined as sustained or repetitive contractions that cause abnormal or repetitive movements (Albanese et al., 2013) A recent coalition of dystonia clinicians and researchers suggested a new standard method of classifying dystonia based on two axes: clinical characteristics and etiology (Albanese et al., 2013) The clinical characteristics include the age of onset (e.g. infancy, adolescence, late adulthood), the distribution of the symptoms in the body (e.g. focal, generalized), temporal pattern, and associated features (e.g. myoclonus or parki nsonism). The etiology characteristics assess what is the origin of the disease, such as neurodegeneration, genetics, or another disease. To date, there are at least 22 forms of inherited, monogenic dystonias (Lohmann and Klein, 2013) These monogenic dystonias are often referred to as DYT followed by a number indicating the order in which it was first described. For instance, Oppenheims dystonia is commonly referred to as D YT1 dystonia, and dystonia caused by mutations in GNAL are referred to as DYT25 dystonia.

PAGE 19

19 The symptoms of dystonia and Parkinsons disease can occur together in the same patient For example, rapidonset dystoniaparkinsonism (RDP) also known as DYT12 dystonia is a rare form of generalized, primary dystonia with Parkinsons disease features. RDP patients do not present with any dystonic or parkinsonian symptoms until triggered by a physiological s tressor (e.g. fever alcoholism, traumatic brain injury ), typically in late adolescence or early adulthood (Dobyns et al., 1993; Brashear et al., 1997) After thi s trigger, symptoms appear minutes to days later and are permanent thereafter (Dob yns et al., 1993) Symptoms first affect the face, then the arms, and finally the legs, which is commonly referred to as a rostrocaudal gradient (Brashear et al., 2007) Parkinsons disease is another neurological movement disorder characterized by four hallmark features: resting tremors, akinesia, slowness of movement, and postural instability (Jankovic, 2008) The majority of patients are over the age of 50 and have Parkinsons disease without a specific known cause (Jankovic, 2008) However, 5 10% of patients involve a n identified genetic component, which usually results in Parkinsons disease earlier in life. General ly, both forms of Parkinsons disease result in neurodegeneration of dopaminergic neurons in the substantia nigra, which causes the motor symptoms. Dopaminergic System in Dystonia Similar to other dystonias, investigators hypothesize that a lterations in the dopaminergic system under lie the pathophysiological basis of RDP (Brashear et al., Reproduced with permission from DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapidonset dystonia with parkinsonism. Behavioural Brain Research 216:659665.

PAGE 20

20 1998a; Brashear et al., 1998b) However, unlike Parkinsons disease, dopaminergic neurons do not undergo neurodegeneration in the substanti a nigra (Muller et al., 2002) Additionally dopaminergic treatments, such as LDOPA or ca r bidopa, offer little if any, symptomatic relief (Brashear et al., 2007; Svetel et al., 2010) In a small clinical study analysis of cerebrospinal fluid (CSF) revealed decreased level s of homovanillic acid ( HVA ), a metabolite of dopamine, in severe RDP patients and some asymptomatic ATP1A3 mutation carriers (Brashear et al., 1998a) However, the level of HVA in patients did not correlate with severity of the disease or predict response to treatment (Brashear et al., 1998a) This is similar to HVA levels in Parkinsons disease (LeWitt et al., 1992) A follow up study analyzed whether neurodegeneration of dopaminergic neurons terminating in the striatum or decreased dopamine reuptake by dopamine transporter (DAT) was responsible f or this altered level of HVA. The investigators utilized [11C] 2 carbometoxy 3 (4 fluorophenyl) tropane, also known as [11 CFT or [11C] WIN 35,428 in positron emission tomography (PET) of patients with RDP and idiopathic Parkinsons disease (Brashear et al., 1999) [11 CFT is a structural derivative of cocaine used in PET imaging to assess in directly the function and level of DAT in patients Parkinsons disease patients exhibited a significant decrease in the volume of striatal [11 CFT compared to agematched controls (Brashear et al., 1999) However, RDP patients displayed no observable difference, with a note of their being an increased level of [11 CFT in the caudate of RDP patien ts compared to controls, but not reaching significance perhaps due to the small sample size (Brashear et al., 1999)

PAGE 21

21 These data suggest that there is a subtle dopaminergic system abnormality in RDP patients that should be investigated further. However, there is a critical problem plaguing RDP patient studies. As RDP is a rare type of dystonia, the number of patients available to study is small, and therefore large, well powered studies cannot be conducted. Genetics of Rapid Onset DystoniaParkinsonism RDP is inherited in an autosomal dominant fashion with reduced penetrance (de Carvalho Aguiar et al ., 2004) The causative gene of RDP is ATP1A3 (de Carvalho Aguiar et al., 2004; Brashear et al., 2007) ATP1A3 Na+/K+ATPase which regulates the electrochemical gradients of sodium (Na+) and potassium (K+) ions through active transport. These ions are essential for numerous cellular functions including regulation of cellular osmolarity and action potentials of excitable membranes (Dobretsov and Stimers, 2005) isoforms that serve as the catalytic component of the Na+/K+ATPase by hydrolyzing adenosine triphosphate ( ATP ) to adenosine diphosphate ( ADP ) (Lingrel and Kuntzweiler, 1994) and is exclusively expressed in neurons and cardiac muscle cells (Lingrel et al., 2007) Investigations identified s even missense mutations in ATP1A3 as causing RDP (Brashear et al., 2007; Zanotti Fregonara et al., 2008) S tudies show ed six of these mutations (de Carvalho Aguiar et al., 2004) This suggests that these missense mutations lead to a reduction or loss of function which result s in haploinsufficiency of the Na+/K+ATPase in neurons and cardiac cells (de Carvalho Aguiar et al., 2004) This haploinsufficiency of the Na+/K+ATPase potentially exacerbates the cellular response to a physiological

PAGE 22

22 stressor in RDP patients, similar to stress induced channelopathies such as myasthenia gravis or chronic fatigue syndrome (Cannon, 2006; Breakefield et al., 2008) Alternating Hemiplegia in Childhood and RapidOnset Dystonia Parkinsonism Recent evidence suggest s that mutations in ATP1A3 can also cause alternating hemiplegia of childhood (AHC) (Heinzen et al. 2012; Rosewich et al., 2012; Ishii et al., 2013; Sasaki et al., 2014b) AHC is a neurological disorder a ffecting children generally younger than 18 months of age with bouts of paralysis, dystonia, and abnormal ocular movements (Heinzen et al., 2012; Brashear et al., 2014) Patients can also present with cognitive impairment and developmental retardation. Recently, several leading clinicians and scientist s hypothesized that RDP and AHC are a spectral disorder, with RDP and AHC representing the extremes (Heinzen et al., 2012; Ozelius, 2012; Rosewich et al., 2012; Ishii et al., 2013) A study support ing this hypothesis reported a patient with an intermediate form of RDP and AHC. The patient at first experienced flaccid hemiparalysis followed by frequent hemiplegic dystonic attacks possibly triggered by a high fever and/or emotional excitement. G enetic screen ing revealed a missense mutation in ATP1A3 reported previously in RDP and atypical AHC patients (Sasaki et al., 2014a) Restless Legs Syndrome Clinical Features, Prevalence, and Comorbidities Restless legs syndrome (RLS), also known as Willis Ekbom disease (WED) is a common neurological disorder with motor, sensory, and circadian component s. RLS is characterized by an uncontrollable urge to move the legs for relief and is often accompanied by unpleasant sensations in the legs Patients typically pr esent with these symptoms during rest or at night (Walters, 1995; Trenkwalder et al., 2005; Budhiraja et

PAGE 23

23 al., 2012; Ke rr et al., 2012) However, a recent study observed breakout symptoms during the daytime in moderate to severe RLS patients (Tzonova et al., 2012) RLS affects approximately 3 to 10% of the general population, with an increased risk towards women than men (Trenkwalder et al., 2005) The symptoms of RLS often lead to sleep disturbances, and can severely affect the patients daytime function and quality of life (Abetz et al., 2004) Several studies show an association between RLS and other conditions, including neurological diseases such as Parkinson disease (Peeraully and Tan, 2012) dystonia (Paus et al., 2011) and attention deficit hyperactivity disorder (ADHD) (Cortese et al., 2005; Ming and Walters, 2009) ; cardiovascular diseases such as hypertension (Schlesinger et al., 2009) ; and metabolic dysfunction such as iron deficiency (HabaRubio et al., 2005; Connor, 2008) and renal failure (Araujo et al., 2010; Quinn et al., 2011) Dopaminergic System in Restless Legs Syndrome The leading hypothes i s o n the pathogenesis of RLS focus es on the basal ganglia and alterations in the central dopaminergic system. The basal ganglia includes the striatum (caudate and putamen), subthalamic nucleus, globus pallidus, and substantia nigra. The striatum is the first recipient for most inputs to the basal ganglia, including excitatory input from all of the cerebral cortex except the primary visual and auditory cort ices In addition, the striatum receives inputs from the intralaminar thalamic nuclei and substantia nigra. One major projection from the s triatum is to the globus pallidus pars interna (GPi). These projections use aminobutyric acid ( GABA ) as an inhibitory neurotransmitter and form two pathways, a direct pathway link to the GPi directly and an indirect pathway link to the GPi via the globus pallidus pars externa (GPe). The direct

PAGE 24

24 pathway mainly expresses the D1 dopamine receptor and is likely involved in the facilitation of wanted movement. The indirect pathway, on the other hand, mainly expresses the D2 dopamine receptor and is thought to s uppress unwanted movement. Proper interaction between the direct and indirect pathways leads to the coordinated movement of the body. Additionally, the projections from the GPi are the major output controlling limb movements. The projections use GABA as an inhibitory neurotransmitter and form a major projection to the thalamus that eventually regulates the excitability of the motor cortex and other cortical areas involved in movement control. Most RLS patients respon d to dopamine treatment and can be treated with low doses of a dopamine agonist (Manconi et al., 2007; Zintzaras et al., 2010) How these dopaminergic treatments work and the nature of the dopaminergic system deficit is inconclusive, which could potentially be attributed to a heterogeneous RLS study population with multiple RLS etiologies and other unaccounted factors. For example, a study reported a decrease in 5HIAA and tetrahydrobiopterin (BH4), an essential cofactor for the biosynthesis of the monoamine neurotransmitters, in the cerebrospinal fluid (CSF) of RLS patients (Earley et al., 2001) Moreover, another study observed an increase in synaptic dopamine in RLS patients (Earley et al., 2013) In contrast two independent studies reported no alterations in the level of dopamine, serotonin, or their metabolites in CSF of RLS patients (Stiasny Kolster et al., 2004b; Earley et al., 2006) Other studies reported decreased fluorodopa uptake (Turjanski et al., 1999; Ruottinen et al., 2000) and D2 receptor binding in RLS patients (Staedt et al., 1997; Turjanski et al., 1999; Michaud et al., 2002) Elderly RLS patients exhibited increase d levels of

PAGE 25

25 dopamine transporter (DAT) (Kim et al., 2012) but other studies on RLS patients did not report similar findings (Michaud et al., 2002; Linke et al., 2004) Additionally, t he A11 dopaminergic nucleus of the posterior hypothalamus is hypothesized to be involved in RLS patients. Recent evidence suggest s that periodic limb movements in sleep arise from the spinal cord in RLS patients (Clemens et al., 2006) Moreover, the A11 nucleus is the primary, if not the only, descending dopaminergic innervation to the spinal cord grey matter (Holstege et al., 1996; Earley et al., 2009) R odent lesions of the A11 nucleus which results in hyperactivity, support its role in RLS pathophysiology (Ondo et al., 2000a ; Qu et al., 2007; Zhao et al., 2007; Luo et al., 2011; Lopes et al., 2012) However, no investigator has reported observations of neurodegeneration or gross abnormalities in the A11 nucleus in RLS patients to date (Earley et al., 2009) Nonetheless, subtle alterations in the A11 nucleus could exist that have yet to be elucidated. Lastly, in addition to the regulation of movement in the basal ganglia, the balance between D1 and D2 dopamine receptor activation in the spinal cord is involved in sensory perception and processing. More specifically, D1 dopamine receptor activation is associated with pronociceptive effects, and conversely activation of the D2 dopamine receptor leads to antinociceptive effects (BenSreti et al., 1983; Rooney and Sewell, 1989; Zarrindast and M oghaddampour, 1989; Verma and Kulkarni, 1993; Hore et al., 1997; Zarrindast et al., 1999; Gao et al., 2000) Iron Homeostasis in Restless Legs Syndrome In addition to dopaminergic dysfunction, several studies demonstrated alterations in iron homeostasis in RLS patients (Connor, 2008) MRI studies revealed less iron in the brain of RLS patients than those of controls in the substantia nigra, an ironenriched

PAGE 26

26 area of the brain (Allen et al., 2001) F urther studies demonstrated decreased levels of ferritin in RLS patients compared to controls in both serum and CSF which is indicative of a systemic iron de ficiency (Earley et al., 2000; Mizuno et al., 2005) Additionally, two studies demonstrate d that intravenous iron administration improves symptoms in some RLS patients (Earley et al., 2005; Bhandal and Russell, 2006) Taken together, t hese results point to a deficiency of iron in the brain that could be central to the pathogenesis of RLS. Iron also appears to regulate the function of the dopamine rgic system, thereby potentially linking these two hypotheses of the pathogenesis of RLS. Animals fed with a low iron diet exhibited lower densities of striatal D1 and D2 dopamine receptor ligand bindings compared to controls (Erikson et al., 2001) suggesting a link between iron deficiency and hypofunctioning of the dopaminergic system. Additionally, iron is an essential cofactor for tyrosine hydroxylase, the rate limiting step in the production of dopamine. Genetics of Restless Legs Syndrome A family history of RLS appears in approximately 60% of RLS cases (Trenkwalder et al., 1996; Walters et al., 1996; Montplaisir et al., 1997; Lazzarini et al., 1999; Winkelmann et al., 2002) Moreover, studies of 12 identical twin pairs in which one or both members have RLS revealed a concordance rate of 83.3%, suggesting a high genetic component ( b et al., 2000a) Recently, investigators performed two independent genomewide association studies (GWAS) with the aim of identifying pol ymorphisms in genes that are highly associated with RLS. In these studies single nucleotide polymorphisms (SNPs) in MEIS1 MAP2K5 PTPRD and BTBD9 correlated strongly with RLS (Stefansson et al., 2007; Winkelmann et al., 2007) SNPs are single

PAGE 27

27 nucleotide variations in the genome that exist naturally within the human population. As several investigations observed SNPs in BTBD9 to impart an increased susceptibility to RLS, this made BTBD9 an excellent gene to study. Goals and Significance The overarching goal of this dissertation project is to characterize novel models of rapidonset dystonia parkinsonism and restless legs syndrome using behavioral electrophysiological, and biochemical techniques. This will fill a large knowledge gap in the field. In the first specific aim of this dissertati on project, I analyzed a line of targeted knockout mice ( heterozygous Atp1a3 knockout mice) as a model of rapidonset dystoniaparkinsonism. This aim takes advantage of a previously generated line of mice of a well Na+/K+ATPase. In the second specific aim of this project, I analyzed a different line of targeted knockout mice ( homozygous Btbd9 knockout mice) as a model of restless legs syndrome. W e generated a novel line of mice from a commercially available embryonic stem cell line, with a deficiency in a protein with little known function. In the third specific aim I used the homozygous Btbd9 knockout mice to probe the function of this protein in the regulation of synaptic plasticity and neurotransmission and therefore its consequence on learning and memory. In addition to moving forward the understanding of the pathophysiology of rapid onset dystoniaparkinsonism and restless legs syndrome, these three aims lay the groundwork for numerous follow up studies, including some later discussed as future directions.

PAGE 28

28 CHAPTER 2 MATERIALS AND METHODSGeneral Considerations All experiments were carried out in compliance with the USPHS Guide for Care and Use of Laboratory Animals and approved by the Institutional Ani mal Use and Care Committees at the University of Alabama at Birmingham (UAB) and the University of Florida (UF). Investigators blind to the genotype of the mice conducted all experiments. Animals were housed in a vivarium with a 12 hours light, 12 hours dark cycle with ad libitum access to food and water, unless otherwise noted. Mice Atp1a3 Knockout Mice Heterozygous Atp1a3 knockout mice on the C57BL/6 background were bred with wild type C57BL/6 (WT) mice to produce experimental animals. The animals were ge notyped by PCR as previously described (Moseley et al., 2007) No spontaneous seizures were observed in the heterozygous Atp1a3 knockout mice as reported in mice carrying another Atp1a3 mutation (Clapcote et al., 2009) We used two cohorts of animals in the experiments. The first cohort consisted of 15 WT (9 males and 6 females) and 19 heterozygous Atp1a3 knockout mice (9 males and 10 females) with a mean age of 7.5 months. We first tested the mice on the beam walking test. Following the beam walking test, we stressed the mice using a restraint st ress protocol. After the restraint stress exposure, we tested the mice in the following order: beam walking test, grip Reproduced and adapted with permission from DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapidonset dystonia with parkinsonism. Behavioural Brain Research 216:659665.

PAGE 29

29 strength test, wheel running activity measurement, and tail flick sensory test. Two male animals died during the wheel running test for unknown reasons. The second cohort of mice consisted of 22 WT (10 males and 12 females) and 15 heterozygous Atp1a3 mutant mice (7 males and 8 females). For this cohort, we stressed all mice using the same restraint stress protocol as the first cohort. Following the restraint stress exposure the mice were used in the following order: open field locomotion test, accelerated rotarod test, and high performance liquid chromatography (HPLC) measurements of monoamines in the striatum. Btbd9 Knockout Mice We generat ed a line of Btbd9 knockout mice using a commercially available ES geo gene trap vector within the sixth intron of the Btbd9 gene (RRE078, BayGenomics). The animals were genotyped by PCR using a twostep process. First, a pair of primers was used to specifically detect the gene trap (v1531 5 GGTCCCAGGTCCCGAAAACCAAAGAAGA3 and v1842R 5 ACAGTATCGGCCTCAGGAAGATCGC 3) along with a pair of primers serving as an internal control (10200F 5 actctgagatgattaacaagagctcagggctga 3 and 102200BR 5 agccctcagctcttgttaatcatcta 3). Second, a pair of primers was used to detect the wildtype allele, if one was present (102000B 5 agatgattaacaagagctgagggct 3 and 6ERA 5 tcagccacgtcttctaaatgtaatggtt3). Heterozygous Btbd9 knockout mice were interbre d to produce experimental mice. In all experiments adult heterozygous Btbd9 knockout mice and/or homozygous Btbd9 knockout mice were used along with WT littermate mice as controls. Advanced age in rats (greater than 16 months) has been noted to cause sleeprelated motor phenomena such as periodic limb movements (Baier et al., 2002) Therefore, we conducted all of our studies on nona ged, adult mice typical of

PAGE 30

30 behavior and molecular experiments. The open field, first tail flick, and serum iron analysis were done in mice between the ages of 4 and 6.7 months of age. The second tail flick was performed in mice between the ages of 2 and 2. 3 months of age. The wheel running was performed in mice between the ages of 2.5 and 4.3 months of age. The polysomnography was done in mice between the ages of 7.5 and 8.3 months of age. The atomic absorption and high performance liquid chromatography wer e done in mice between 9.3 and 10 months of age. We used 16 WT mice and 5 homozygous Btbd9 knockout mice for the open field experiment; seven male WT and seven male homozygous Btbd9 knockout mice for the wheel running experiment; 16 WT, six heterozygous Bt bd9 knockout mice, and 5 homozygous Btbd9 knockout mice for the first tail flick experiment; three WT and three homozygous Btbd9 knockout mice for the polysomnography studies; three WT and 4 homozygous Btbd9 knockout mice for the colorimetric iron assays; seven WT and seven homozygous Btbd9 knockout mice for the iron and neurochemical measurements in the striatum; 20 WT mice and 15 homozygous Btbd9 knockout mice for the fear conditioning experiment; 6 WT and 6 homozygous Btbd9 knockout mice for field recordings; and 3 WT and 2 homozygous Btbd9 knockout mice for wholecell recordings. Behavior Paradigms Restraint Stress Protocol To expose mice to a physiological stressor, mouse movement was constrained using a M ouse Decapicone (Braintree Scientific) disposable restrainer. Each mouse was placed in the restrainer for two consecutive 60 minutes sessions a day for five consecutive days. After five days, mice were allowed to rest for two weeks before experimentation. Herein, we define mice that have not undergone a restraint stress

PAGE 31

31 protocol as nonstressed mice and mice that have undergone a restraint stress protocol as stressed mice. Beam walking Test The beam walking test assesses motor coordination and motor learning as mice transverse a narrow beam of various diameters to a dark box at the other end. We performed the test as previously described (Carter, 2001) In brief, we first trained animals to transverse a medium square beam (14 mm wide) for two consecutive days with three trials each day. After training, we tested the animals on the following two consecutive days. On the first testing day, the animals traversed the medium square beam and a medium round beam (17 mm diameter). On the second testing day, the animals traversed a small round beam (10 mm diameter) and a small square beam (7 mm wide). Each beam was repeated twice consecutivel y and the time to transverse the beam and number of hind limb slips were recorded. The beam walking test was performed twice on the same mice, once before the mice underwent a restraint stress protocol and again after the restraint stress protocol. Rotaro d Test The rotarod test assesses the ability of mice to maintain balance and coordination on an accelerating, rotating rod. We performed the experiment as previously described (Dang et al., 2006b) In brief, the accelerating rotarod (Ugo Basile) started at an initial 4 rpm and accelerated at a rate of 0.2 rpm/s to a final rate of 28 rpm over two minutes. We tested the mice for two consecutive days with three trials each day. We performed the trials approximately one hour apart from each other. We recorded the latency for each mouse to fall from the rod, without a maximum cutoff of two minutes.

PAGE 32

32 Grip Strength Test We measured forelimb and hind limb strength using a grip strength meter (San Diego Instruments). The meter records the force of a metal grate being pulled in newtons (N). To measure forelimb strength, we held the mice by their tail and allowed only the mouses forelimbs to hold on to the metal grate. We then quickly pulled back on the mouses tail. To measure hind limb strength, we held the mice by the skin behind their neck and held their tail at an angle that prevented the forelimbs from grasping the metal grate and were quickly pulled back. We conducted three measurements for the hind limbs and three measurements for the forelimbs, and the maximum force of the three trials w as used for statistical analysis. Open Field Test An open field apparatus was used to measure spontaneous activity and stereotypic behaviors. The open field apparatus (Lafayette Instruments) is equipped with infrared sensors that detect breaks in the beams This information was inputted and analyzed by computer software (Digiscan System, Accuscan Instruments) as described previously (Cao and Li, 2002; Dang et al., 2005; Yokoi et al., 2009) The center of t he chamber was exposed to bright illumination (produced by a 60 W bulb). For the Atp1a3 studies, mice were recorded for 15 minutes. For t he Btbd9 studies, mice were recorded for 30 minutes. Wheel Running Test The wheel running test examines voluntary activity levels of mice. For the studies involving Atp1a3 knockout mice we use d a wheel running chamber equipped with an optical sensor to detect the speed and number of revolutions of the wheel (Lafayette Instrume nts). A computer collected this information at five minute intervals across six

PAGE 33

33 consecutive days. The first three days of recordings were excluded from analysis due to acclimation and novelty of the wheel. For the studies involving Btbd9 knockout mice, we used a chamber with a magnetic sensor to detect movement of the wheel The mice were maintained on a 12 hour light, 12 hour dark (LD) cycle for 17 days, and then followed by 17 days of constant darkness (DD). Wheel running activity was recorded as the number of wheel revolutions occurring during 5 min bins and analyzed using ClockLab software (Actimetri cs). For the last 10 days in LD we determined the proportions of activity during lights on and lights off, the total amount of activity per day and alpha length (time between onset and offset of primary activity bout) The activity profile feature of ClockLab was used to determine the proportion of activity over the course of the LD cycle averaged over a 7 day period. The averaged data for each animal was nor malized to the maximum activity for that animal. Means from each group across 24 hr is shown in Figure 35. For statistical comparison, data were binned into 3 hr bins and analyzed with a twoway repeated measures ANOVA. In DD, activity was measured for th e entire 17 days and ClockLab was used to determine average counts per minute and alpha length. In addition, the chi squared periodogram analysis in ClockLab was used to determine period and rhythmic power as a measure of the amplitude and coherence of beh avioral rhythms (Gamble et al., 2007; Ciarleglio et al., 2009) Tail Flick Test We tested the Atp1a3 and Btbd9 knockout mice for perception of pain using the Tail Flick Analgesia Meter (San Diego Instruments). We placed each mouse in an acrylic restrainer with the distal end of its tail protruding under a heat lamp. The heat lamp was then manually switched on. In the first five seconds the lamp r eached a

PAGE 34

34 temperature of approximately 40C and the temperature rose from there to 50C at 10 seconds and 57C at 15 seconds. A timer started once the heat lamp was turned on and automatically stopped when the mouse produced a strong reaction to the heating by moving its tail. This latency to respond was limited to 15 seconds to prevent injury. In a second cohort of Btbd9 knockout mice, we conducted the tail flick experiment during the middle of the active phase (approximately Zeitgeber time (ZT) 18, where Z T 12 refers to lights off); during the middle of the rest phase (approximately ZT 6); and 15 min, 30 min, and 60 min following an intraperitoneal injection of 0.1 mg of ropinirole per kg of body weight (0.1 mL/1 mL of saline). Ropinirole is a common dopami nergic treatment for RLS patients, and previous study usued a similar dosage with efficacy (Qu et al., 2007) Fear Conditioning Memory Assessme nt We assessed memory formation and recall using the contextual and cued fear conditioning test as previously described (Shalin et al., 2006; Yokoi et al., 2009) M ice were trained during the morning of the first day in contextual chambers equipped wire shock grid floors. We allowed the mice to explore the context for four minutes before presentation of the first 30 seconds tone at 90 dB, which coterminated with a 1 second, 0.5 mA electrical foot shock. We presented two toneshock pairings in total with a shock interval of 120 seconds. Mice remained in the chamber for an additional 60 seconds before being returned to their home cages. The chamber was cleaned with 70% ethanol between animals. The next morning, we monitored mice in the context chambers for their freezing behavior for 5 minutes, without the presentation of tone or shock. In the afternoon, we significantly changed the attributes of the environment, including the

PAGE 35

35 shape and smell. We then allowed the mice to explore this novel environment for 3 minutes before presentation of the tone, without shock, for 3 minutes. The chamber was cleaned with 75% isopropanol between animals. The time each mouse spent without any movement during the test was counted as freezing behavior. Freezing behavior was monitored and recorded by video and evaluated by software (Video Freeze, Med Associates). The freezing time was divided by session time (for context, 5 min; for cued, 3 min) and expressed as percent freezing. In a ddition to measurement of freezing behavior, an investigator subjectively scored the response to the electric shocks during the training phase on two rating scales. The first scale measured the gross response to the electric shock, and a score of 1 to 3 was given, where 1 represented no response, 2 represented flinching or modest interrupting in ongoing behavior but did not generate any gross movement, and 3 represented running or jumping or major interruption in ongoing behavior that generated gross movements. As all mice in the fear conditioning experiment responded with level 3 responses, the investigator then rated the response on a scale of 1 to 5, where 1 is a minimal but gross movement in response to the shock and 5 is a very large gross movement in r esponse to the shock. Finally, we measured electrical shock pain threshold as previously described (Polter et al., 2010) In brief, we systematically applied increased shock intensities from 0.1 mA to 1.0 m A to the mice. Intensities at which the mouse flinched, jumped, or vocalized were recorded and analyzed. Polysomnography To measure sleep architecture, we utilized a wireless telemetry device (F20EET, Data Sciences International) that was approximately 3. 9 g in weight and 1.9 cm3 in

PAGE 36

36 volume with two biopotential channels. Each biopotential lead (2 per channel) had an outside diameter of 0.3 mm. We anesthetized the mice and made a small vertical cut (approximately 1 cm) on one side of the skin near the hind limb and the tibialis cranialis muscle was localized. We then inserted a pair of leads into the muscle and sutured and glued in place to obtain electromyographic (EMG) data. We placed another pair of leads on the dura of the brain to obtain electroencephalographic (EEG) data, as suggested by the manufacturer, and secured by dental cement. The body of the transmitter and any excess wire were ins erted under the back of the skin and sutured close. The mice were then allowed 48 hours to recover from surgery. The EEG and EMG signals were processed and sleep patterns analyzed by NeuroScore computer software (DSI Instruments). Electromyography The EMG implantation was done similar to the polysomnography studies. Three Dyt1 in mice, a mouse model of DYT1 dystonia, and three wildtype littermate controls of approximately 6 months of age were used in these studies. The mice were deeply anestheti zed by a mixture of ketamine and xylazine and maintained using isoflurane, shaved, and a small vertical cut (approximately 1 cm) was made on one side of the skin near the hind limb. The bicep femoris, which is involved in knee flexion, and rectus femoris, which is involved in knee extension, were visually localized. The biopotential leads were then inserted into the muscle, fastened with sutures, and glued in place. The wireless transmitter body was then placed under the skin of the back of the mouse alongs ide any excess wire. The incision was then closed with suture, antibiotics were applied to the site, and the mouse was placed in a housing cage on top of a heating pad, which was monitored for temperature, to aid in recovery from surgery.

PAGE 37

37 After mice awoke from anesthesia and were freely walking around with ease, they were returned to a housing room to recover from surgery for an additional 24 to 48 hrs. After this recovery period the wireless transmitters were turned on using a magnet, and EMG data was acquired at 1,000 Hz by a connected computer using Dataquest A.R.T. software (Data Sciences International). The data was filtered using a bandpass filter set from 10 Hz to 100 Hz and analyzed using an automated detection program in NeuroScore (Data Sciences International). We used three independent protocols for the detection program with varying stringency to assess sustained contractions. The first protocol (Protocol 1) assessed sustained contractions as being five times baseline h a 2 s joint interval, the second protocol (Protocol 2) with a 2 s joint interval, and the third protocol (Protocol 3) assessed sustained contractions as being three ti interval. Statistical analysis was conducted using the nonparametric MannWhitney rank sum test. High Performance Liquid Chromatography We analyzed neurochemicals in the striatum of Atp1a3 knockout m ice using high performance liquid chromatography (HPLC). We conducted the experiment on striatal extracts from mice as previously described (Dang et al., 2005; Yokoi et al., 2006) except using 50 mM potassium phosphate buffer with 0.5 mM octyl sulfate (SigmaAldrich) and 8% acetonitrile as running buffer. Dopamine (DA), serotonin (5HT), 3,4 dihyroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), 5hydroxyindoleacetic acid (5HIAA), and 3 methoxytyramine (3MT) were measured by the Neurochemistry Core Lab, Vanderbilt University Medical Center, Nashville, TN (Lindsey et al., 1998)

PAGE 38

38 For the studies involving Btbd9 knockout mice, we performed HPLC using a different protocol. We homogenized the striatum and the homogenate (50 mL), 0.24 M perchloric acid (50 mL) and internal standard 3,4dihydroxybenzylamine (DHBA) were passed through a 0.2 mm micro Sephadex column (SpinX Costar, Corning Inc.) to remove endogenous substrates. Samples were then loaded on to a refrigerated ESA model 542 autosampler and 10 mL of sample was injected onto an ESA MD 150 narrow bore HPLC column (150 2 mm; ESA Inc). The mobile phase consisted of 75 mM sodium phosphate, 1.7 mM 1octanesulfonic acid, 25 M ethylenediaminetetracet ic acid, 7.0 M triethylamine, and 10% v/v acetonitrile in a volume of 2 L (pH 3.0). Once separated, compounds were measured with a coulometric detector (ESA model 5300, guard cell potential, +400 mV; working cell potentials, 174 mV and 350 mV). The neurotransmitter metabolite peak areas were integrated using EZ Chrom Elite Software (Scientific Software, Inc.) and quantified against known standards. The standard curves exceeded r=0.99, and the relative standard deviation of DHBA between samples was less than 3%. Samples were normalized to weight of tissue and reported in pmol of neurochemical per gram of tissue. Iron Measurements Colorimetric Assay for Serum Iron Blood was collected by retroorbital blood collection from mice. The blood was allowed to clot and then separated by centrifugation at 1,500g for 10 min. The serum was removed and centrifuged again at 1,500g for 10 min for further purification. The iron concentration was quantified using a colorimetric assay (QuantiChrom Iron Assay Kit, BioAssay Systems Inc.), according to the manufacturers instructions.

PAGE 39

39 Atomic Absorption Spectroscopy for Iron in Striatal Tissue Striatum from mice were dissected out and homogenized 1:10 in PBS (pH 7.4) containing protease inhibitors (Roche). Brain region aliquots were wet digested by published and standard procedures and analyzed for iron concentration by atomic absorption spectrometry (Perkin Elmer AAnalyst 600, Perkin Elmer) (Piero et al., 2000) Standards were prepared by diluting a Perkin Elmer iron standard (PE#N9300126) in 0.2% ultrapure nitric acid, and blanks prepared with digesting and diluting reagents to control for possible contamination. All standard curves exceeded r > 0.99. Electrophysiology Field Recordings Preparation of hippocampal slice and electrophysiological analysis were performed as described previously (Levenson et al., 2004; Yokoi et al., 2009; Dang et al., 2012) In brief, h ippocampi of adult mutant or wild type mice were rapidly removed and briefly chilled in icecold cutting saline (110 mM sucrose, 60 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 28 mM NaHCO3, 5 mM D 2, 7 m M MgCl2, and and maintained at least 45 min in a holding chamber containing 50% artificial cerebral spinal fluid (aCSF) (125 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 25 mM NaHCO3, 25 mM D glucose, 2 mM CaCl2, and 1 mM MgCl2) and 50% cutting saline. The slices were then transferred to a recording chamber and perfused (1 mL/min) with 100% aCSF. Slices were allowed to equilibrate for 60 90 min in a Fine Science Tools interface chamber at 30C. All solutions were continuously bubbled with 95% O2/5% CO2. For extracellular field recordings, glass recording electrodes were filled with aCSF

PAGE 40

40 and placed in the stratum radiatum of the CA1 hippocampal region. Test stimuli were delivered to the Schaffer collateral/commissural pathway with bipolar Teflon coated platinum stimulating electrode positioned in the stratum radiatum of the CA3 hippocampal region. Responses were recorded using a computer with AxoClamp pClamp 8 data acquisition software. Excitatory post synaptic potential (EPSP) slope measurements were taken after the fiber volley to eliminate contamination by population spikes. Following at least 20 min of stable baseline recording, long term potentiation (LTP) was induced with two, 100 H z tetani (1 second), with an interval of 20 seconds between tetani. Synaptic efficacy was monitored by recording fEPSPs every 20 seconds beginning 0.5 hr prior to induction of LTP and ending 3 hr after induction of LTP (traces were averaged for every 2 min interval). Paired pulse ratios (PPRs) were measured at various inter stimulus intervals (10, 20, 50, 100, 150, 200, 250, and 300 ms). All experimental stimuli were set to an intensity that evoked 50% of the maximum field EPSP (fEPSP) slope. To measure input output relationships, test stimuli were delivered and responses recorded at 0.05 Hz with every six consecutive responses over a 2 min period pooled and averaged. fEPSPs were recorded in response to increasing intensities of stimulation (fr Whole cell Recordings Animals were anesthetized by the inhalation of isoflurane, decapitated and the brain was rapidly removed. 400 m thick coronal brain slices were cut with a Vibratome (Technical Products International, St. Louis MO). Slices were incubated on cell culture inserts (8 m pore diameter, Becton Dickinson, Franklin Lakes, NJ) covered by a thin layer of aCSF containing (in mM) 124 NaCl, 26 NaHCO2, 1.25 NaH2PO4, 2.5 KCl, 1

PAGE 41

41 CaCl2, 6 MgCl2, 10 D glucose and surrounded by a humidified 95% O2 and 5% CO2 atmosphere at room temperature (22C). After at least 1 hr incubation, the slice was transferred to a submerged recording chamber with continuous flow (2 ml/min) of aCSF as described above except for 2.4 mM CaCl2 and 1.3 mM M gCl2 and gassed with 95% O25% CO2 giving pH 7.4. All experiments were carried out at 30C. Whole cell recordings were made from pyramidal cells in the hippocampal CA1 region using infrareddifferential interference contrast microscopy and an Axopatch 1D a mplifier (Axon Instruments, Foster City, CA). Patch electrodes had a resistance of 35 M when filled with intracellular solution containing (in mM): 125 K gluconate, 8 NaCl, 10 HEPES, 4 MgATP, 0.3 Na3GTP, 0.2 EGTA, and 0.1% biocytin (pH 7.3 with KOH, osmolarity 290300 mOsM). mEPSCs were recorded at 68mV and with the both solution containing 1 M TTX(a sodium channel blocker, 50 M AP5(an NMDA receptor blocker) and 50 M picrotoxin (a blocker of GABA receptor). Series resistance was 9 cells were rejected if it changed >10% throughout the recording session. All drugs were purchased from Sigma Aldrich. Data were acquired using pClamp 10 software. The recordings were started 510 min after accessing the cell to allow for stabilization of spontaneous synaptic activity. Analysis of mEPSCs was based on 5 min continuous recordings from each cell. Events were detected using the Mini Analysis Program (Synaptosoft) with parameters optimized for each cell and then visually confirmed prior to analysis. The peak amplitude, 1090% rise time and the decay time constant were measured based on the average of all events aligned by rise phase.

PAGE 42

42 Western Blot Two types of fractions were used depending on the experiment. The first was a whole hippocampus fraction and th e second was a synaptosomal fraction. In both cases, the hippocampi were dissected and quickly frozen in liquid nitrogen. Whole hippocampus fraction preparation was performed as previously described (Yokoi et al., 2010; Dang et al., 2012; Yokoi et al., 2012) In brief, the hippocampi were then homogenized in 400 L of icecold lysis buffer [50 mM TrisCl (pH 7.4), 175 mM NaCl, 5 mM EDTA, Complete Mini Protease Inhibitor Cocktail (Roche)] and sonicated for 10 seconds. Oneninth volume of 10% Triton X 100 in lysis buffer was added to the homogenates. The homogenates were incubated for 30 min on ice, and then centrifuged at 10,000 g for 15 min at 4C. The supernatants were then collected and the protein concentration was measured by Bradford assay with bovine serum albumin as standards. The homogenates were mixed with SDS PAGE loading buffer and boiled for 5 min, incubated on ice for 1 minute, and then centrifuged for 5 min to obtain the supernatant for loading at 40 g each lane. Synaptosomal fractions were prepared as previously described (Hallett et al., 2008; Yokoi et al., 2010) In brief, the hippocampi were defrosted in 5 mL of icecold TEVP buffer [10mM Tris Cl (pH 7.4), 5 mM NaF, 1 mM Na3VO4, 1 mM EDTA, 1 mM EGTA] containing 320 mM sucrose for 5 min and homogenized. The homogenates were centrifuged for 10 min at 800 g at 4 C and the supernatants were collected. Supernatants were then centrifuged for 15 min at 9,200 g and the pellets were obtained. After briefly rinsing with 1 mL TEVP buffer containing 35.6 mM sucrose, pellets were resuspended in 2 mL TEVP buffer and put on ice for 30 min. The samples were vortexed and centrifuged for 20 min at 25,000 g at 4 C. Pellets were briefly rinsed with 1 mL of TEVP buffer and resuspended in 1 mL TEVP

PAGE 43

43 buffer. T hese synaptosomal fractions were sonicated for 10 seconds and the protein concentration was measured by Bradford assay with bovine serum albumin as standards. Synaptosomal fractions were diluted with water containing Complete Mini Protease Inhibitor Cocktail (Roche) and mixed with equal volume of 2 SDS PAGE loading buffer to the final protein concentration of 0.5 g/L. The solution was then boiled for 5 min, incubated on ice for 1 min, and centrifuged for 5 min to obtain the supernatant for loading at 10 g each lane. In both fractions, the separated proteins were transferred to the nitrocellulose membrane. The membrane was blocked with 5% milk in wash buffer and treated with the primary antibody of the protein of interest. The secondary antibodies and detecting reagents were the same as previously described. The experiments were performed in triplicate. For whole hippocampus fraction the galactosidase (55976, MP Biomedicals) and for synaptosomal fraction the antibodies used wer e against syntaxin1 (PA1 1042, Affinity BioReagents), SNAP 25 (SC 7538, Santa Cruz), synaptotagmin1 (AB9202, Millipore), synaptobrevin2 (01815791, Wako), synaptophysin (PA11043, Affinity BioReagents), and dynamin 1 (SC 6402, Santa Cruz). RT PCR Messenger RNA (mRNA) was obtained from 2 WT and 2 homozygous Btbd9 mutant mice brains using a Qiagen RNeasy Protect Kit. RT PCR was performed using protocols from Qiagen OneStep RT PCR kit with the forward primer located in the exon before the intron containing the genetrap (Exon6 5 TTGAAGTGTCCATGGACGAACTTGATTGGA 3) and the reverse primer located in the exon after this intron (Exon7R 5 GAAAATCTTGTTCACTGTGTTGTGAGTCC 3).

PAGE 44

44 Statistics We analyzed open field, wheel running, grip strength, tail flick, fear conditioning data using twoway ANOVAs, with age, sex, weight, and genotype as variables. We analyzed rotarod data using repeated ANOVAs, with age, sex, weight, and genotype as variables. Beam walking data were analyzed by logistic regression (GENMOD) with negative binominal distribution using GEE model using genotype, sex, age and body weight as variables. WT mice were normalized to zero. Fear conditioning behavior response to the shock during training was analyzed using Wilcoxon rank sum test. Shock threshold was analyzed for each of three behaviors using a Students t test Electrophysiological data was analyzed in general by Students t test. However, t he overall distribution was analyzed using a Kolmogorov Smirnov test for the input output curve. A dditionally, miniature excitatory post synaptic current (mEPSC) amplitude and frequency was analyzed using a Kolmogorov Smirnov test. Graphical data shows approximately 9798% of mEPSC data for simplicity. Western blot, HPLC, and iron data analyses were c onducted using a Students t test. All data was analyzed using SAS 9.1 software and/or Microsoft Excel, with significance assigned at p

PAGE 45

45 CHAPTER 3 PART1: CHARACTERIZATION OF ATP1A3 KNOCKOUT MICE AS A MODEL FO R RAPID ONSET DYSTONIA PARKINSONISMMotor Deficits in Female Heterozygous Atp1a3 Mutant Mice Beam walking test We assessed motor coordination and motor learning deficits using the beam walking test (Carter et al., 1999) We observed no statistical difference in nonstressed male or female heterozygous Atp1a3 knockout mice wh en compared to nonstressed wild type mice (p > 0.05, Figure 3 1 A). As the symptoms of DYT12 dystonia are absent until triggered by a physiological stressor (Dobyns et al., 1993; Pittock et al., 2000; Linazasoro et al., 2002; Kamm et al., 2004; Zaremba et al., 2004; Brashear et al., 2007) we examined the effects of stress on motor behavior. We exposed mice to a restraint stress for five days followed by a twoweek rest period. S tressed female heterozygous Atp1a3 mutant mice exhibited a 250% increase in hind limb slips in the beam walking test compared to stressed female WT mice (p < 0.05, Figure 3 1 B). However, we observed no significant increase in the number of hind limb slips in stressed male heterozygous Atp1a3 mutant mice compared to stressed male WT mice (p > 0.05, Figure 3 1 B). Previously, Koehl and colleagues observed that sensitivity to restraint stress is sex dependent (Koehl et al., 2006) Therefore, it is possible that under the current conditions we failed to trigger the dystonic like phenotype in stressed male heterozygous Atp1a3 mutant mice. As stress induced motor deficits in the beam walking test, we conducted the remaining experiments with only stressed animals. Reproduced and adapted with permission from DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapidonset dystonia with parkinsonism. Behavioural Brain Research 216:659665.

PAGE 46

46 Accelerated Rotarod T est We used the rotarod test, another test for motor coordination and motor learning, on stressed mice. Stressed female heterozygous Atp1a3 mutant mice exhibited a significantly decreased latency to fall from the rotarod compared to stressed female WT mice (p < 0.05, Figure 3 2B, C). However, similar to the beam walking test, s tressed male heterozygous Atp1a 3 mutant mice did not exhibit a deficit compared to stressed male WT mice (p > 0.05, Figure 3 2 A,C). Similar to the beam walking test, we observed motor deficits in the stressed female heterozygous Atp1a3 mutant mice. Grip Strength Test To determine if the motor deficits exhibited in the beam walking and rotarod tests arose from a muscular weakness and not a neurological deficit, we assessed the grip strength of the stressed mice for both the forelimbs and the hind limbs. We observed no significant difference between stressed heterozygous Atp1a3 knockout mice and stressed WT mice in forelimb and hindlimb strength in males or females ( 3 3 A ,B ). This suggests that stressed heterozygous Atp1a3 mutant mice do not exhibit a significant muscular deficiency. Activity Levels of Heterozygous Atp1a3 Mutant Mice Spontaneous activity levels Several mouse models of dystonia exhibit alterations in activity levels and circling behavior (Dang et al., 2005; Shashidharan et al., 2005; Dang et al., 2006a; Yokoi et al., 2006; Grundmann et al., 2007; Yokoi et al., 2008) In addition, Mo seley and colleagues previously demonstrated that nonstressed heterozygous Atp1a3 mutant mice exhibit ed an increase in activity levels (Moseley et al., 2007) Therefore, to monitor stressed heterozygous Atp1a3 mutant mice for spontaneous activity, we used an open field

PAGE 47

47 experiment. W e observed no significant differences in the level of horizontal (p > 0.05, Figu re 3 4 A) or vertical activity (p > 0.05, Figure 3 4 A) in stressed heterozygous Atp1a3 mutant mice compared to stressed WT mice, regardless of sex. However, stressed heterozygous Atp1a3 mutant mice exhibited a significant decrease in clockwise circling (p < 0.05, Figure 3 4 B) but no significant difference in counterclockwise circling compared to stressed WT mice (p > 0.05, Figure 3 4 B). Previous studies on mouse models of Parkinsons disease linked alterations in activity and circling with alterations in the dopaminergic system (Kim et al., 2000; Viggiano et al., 2003) suggesting that the stressed heterozygous Atp1a3 mutant mice exhibit alterations in this system. Voluntary activity levels To monitor for voluntary activity levels, we used a standard cage equipped with a wheel. We obser ved no significant difference in cumulative distance for four days for stressed male or female heterozygous Atp1a3 mutant mice compared to stressed male or female WT mice (p > 0.05, Figure 3 5 B). However, the stressed female heterozygous Atp1a3 mutant mice diverged into two separate groups (Figure 3 5 C). One group was significantly hyperactive when compared to stressed female WT mice (n=7, p < 0.05, Figure 3 5 D) and another was significantly hypoactive when compared to stressed female WT mice (n=3, p < 0.0001, Figure 3 5D). This suggests that stressed female heterozygous Atp1a3 mutant mice exhibit alterations in voluntary activity levels. Sensory Deficits in Heterozygous Atp1a3 Mutant Mice We conducted a standard tail flick sensory experiment to assess sensory function in stressed h et erozygous Atp1a3 mutant mice. Stressed female heterozygous Atp1a3 mutant mice showed a significant increase in latency to respond to the stimulus compared to stressed female WT mice (p < 0.05, Figure 26 ). In contrast, we o bserved

PAGE 48

48 no significant difference between stressed male heterozygous Atp1a3 mutant and WT mice (p>0.05, Figure 3 6 ). This suggests stressed female heterozygous Atp1a3 mutant mice ex hibit hyposensitivity No Alterations in Striatal Neurochemical Levels Following the behavioral experiments, we sacrificed the mice and dissected out the striatum from each mouse. We then performed high performance liquid chromatography (HPLC) to analyze the striatal levels of dopamine, serotonin, and their metabolites. We ob served no significant differences between stressed heterozygous Atp1a3 mutant mice and WT mice in dopamine, serotonin, or their metabolites (Table 3 1). Therefore, the behavioral alterations observed in the Atp1a3 mutant mice are not likely caused by gross changes in the dopaminergic or serotonergic system. However, gross changes in these systems are not seen in RDP patients. We hypothesize that subtle changes exist, such as an alteration in the level of dopamine receptors or neurons, in the Atp1a3 mutant m ice. Future studies will be targeted to testing this hypothesis.

PAGE 49

49 Figure 3 1 Hind limb slips on the beam walking test. Non stressed male and female mice showed no significant difference in hind limb slips (A). However, stressed female heterozygous Atp1a3 mutant mice showed an increase in slips compared to stressed female WT mice, while stressed male heterozygous Atp1a3 mutant mice showed no significant difference compared to stressed male WT mice (B). Bars represent means with standard errors of the mean. p < 0.05.

PAGE 50

50 Figure 3 2 Latency to fall on the accelerated rotarod test. Stressed male heterozygous Atp1a3 mutant mice showed no significant alterations in performance on the rotarod test by trial (A) or with all trials combined c ompared to stressed male WT mice (C). However, stressed female heterozygous Atp1a3 mutant mice showed a significant decrease in latency to fall compared to stressed female WT mice in both individual trials and with the trials combined (B, C). Bars represen t means with standard errors of the mean. p < 0.05. Figure 3 3 Forelimb and hind limb grip strength. Stressed male and female heterozygous Atp1a3 mutant mice showed no difference in grip strength for forelimb (A) or hind limb (B) compared to stressed male and female WT mice (A). Bars represent means with standard errors.

PAGE 51

51 Figure 3 4 Open field test to measure spontaneous activity levels Stressed heterozygous Atp1a3 mutant mice, regardless of sex, showed no significant difference in horizont al activity (A) or vertical activity compared to stressed WT mice (A) Stressed heterozygous Atp1a3 mutant mice, regardless of sex, showed a significant decrease in clockwise (CW) circling (B), but no significant difference in counterclockwise circling (CC W) (B). Bars represent means with standard errors of the mean. p < 0.05.

PAGE 52

52 Figure 3 5 Voluntary activity levels measured by wheel running. Stressed male heterozygous Atp1a3 mutant mice showed no difference in the distribution (A) or the mean (B) of cumulative distance run. However, stressed female heterozygous Atp1a3 mutant mice showed a divergence in the distribution (C) with one group being increased in activity compared to stressed WT mice (Het Hyperactive) and the other being decreased in activ ity compared to stressed WT mice (Het Hypoactive) (D). Circles in (A) and (C) represent individual animal cumulative distances. Numbers in parenthesis in (C) indicates number of animals. Bars in (B) and (D) represent means with standard errors of the mea n. p < 0.05 compared to stressed WT mice. ** p < 0.01 compared to stressed WT mice.

PAGE 53

53 Figure 3 6 Tail flick sensory test to determine perception of a warm stimulus. Stressed female heterozygous Atp1a3 mutant mice exhibited a significant increase in lat ency to respond to the stimulus compared to stressed female WT mice while stressed male heterozygous Atp1a3 mutant mice exhibited no difference compared to stressed male WT mice. Bars represent means with standard errors of the mean. p < 0.05.

PAGE 54

54 Table 3 1. DA, 5 HT, and their metabolites in the striatum. Neurochemical WT Het p DA 102.52 3.00 101.05 3.53 0.76 DOPAC 7.31 0.25 7.11 0.30 0.62 HVA 10.44 0.38 10.33 0.44 0.86 3 MT 5.94 0.31 5.74 0.36 0.69 5 HT 6.70 0.28 6.84 0.33 0.76 5 HIAA 2.96 0.10 2.88 0.12 0.62 DOPAC/DA 0.072 0.002 0.070 0.002 0.63 HVA/DA 0.102 0.002 0.102 0.003 0.99 5 HIAA/5 HT 0.446 0.012 0.426 0.014 0.29 The values of neurochemical are shown as mean standard errors (in ng/mg of wet tissue) The turnover of metabolites is shown as the ratio of the neurochemicals. WT, Wild type mice; Het, Heterozygous Atp1a3 mutant mice.

PAGE 55

55 CHAPTER 4PART 2: CHARACTERIZATION OF BTBD9 KNOCKOUT MICE AS A POTENTIAL MODEL FOR RESTLESS LEGS SYNDROME Generation of Btbd9 Knockout M ice We obtained a commercial embryonic stem (ES) cell clone that contained geo gene trap vector in the sixth intron of the Btbd9 gene (RRE078, BayGenomics). The gene trap was approximately 8.5 kilobase pairs (kb) long and included a single exon of the Engrailed2 ( En2 ) gene, the bacterial lacZ and neomycin phosphotransferase II genes and a pA signal sequence The En2 exon contained a 5 splice site, thereby creating an artificial exon within the sixth intron of the Btbd9 gene. The gene trap version of the Btbd9 gene thereby produces a fusion protein containing the N terminal portion of the galactosidase, and neomyc in. The ES cells were expanded and its fusion mRNA verified by RT PCR. Next, we inserted the ES cells into blastocysts, and implanted them into pseudopregnant females, from which chimeras were generated. Chimeras that contained the gene trap in germline ce lls were detected by PCR using primers designed to target and amplify a sequence within the gene trap vector (v1531 5 GGTCCCAGGTCCCGAAAACCAAAGAAGA3 and v1842R 5 ACAGTATCGGCCTCAGGAAGATCGC 3). Heterozygous mutant mice were interbred to generate homozygous mutant mice, which were identified initially using a microsatellite marker approximately 4 megabase pairs from the Btbd9 gene, which can identify differences between mouse inbred strains (D17M100a 5 gttaagaatgattttcacactacaaga3 and D17M100b 5 agcacatgtacttactcatatacgtgc 3). Reproduced and adapted with permis sion from DeAndrade MP, Johnson RL, Unger EL, Zhang L, van Groen T, Gamble KL, Li Y (2012a) Motor restlessness, sleep disturbances, thermal sensory alterations and elevated serum iron levels in Btbd9 mutant mice. Hum Mol Genet 21:39843992.

PAGE 56

56 The size of PCR products from 129/SvJ strain is 129 bp, which represents that of the mutant allele from the ES cell, while those from C57BL/6J is 119 bp, which represents that of the wildtype allele from the backcross. T o determine the location of the gene trap vector within the sixth intron of the Btbd9 gene, we used long and accurate (LA) PCR. With LA PCR we were able to successfully amplify sequences up to approximately 20 kb, which was important as the length of the s ixth intron of the Btbd9 gene is approximately 179.2 kb long. We synthesized primer sets at approximately 10 kb intervals within the sixth intron (Table 41), and then serially amplified approximately 10 kb fragments and screened for failure of LA PCR reac tions using genomic template DNA isolated from the homozygous mutant mice. We were able to narrow down the approximate location of the gene trap in the sixth intron to a 13.2 kb region between approximately 89.3 kb and 102.5 kb from the start of the sixth intron. Next, we synthesized primer sets at approximately 500 bp intervals in this r egion and conducted PCR (Table 41). This narrowed the possible insertion site further to 102,000 to 102,501 bp from the start of the sixth intron (Figure 41A). Lastly, we generated a primer set located at 102,200 bp from the start of the sixth i ntron and conducted PCR (Table 41). This narrowed the insertion site to between 102,200 and 102,501 bp from the start of the sixth intron (Figure 41A). Mice were backcrossed to th e C57BL/6 background. Interbreeding heterozygous Btbd9 mutant mice resulted in a nonMendelian ratio at weaning, with a decrease in both heterozygous and homozygous Btbd9 mutant mice (p < 0.05, Table 4 3). There were no obvious abnormalities in these mice, including weight at time of experiment, ability to right themselves, and gait. To determine how effective the gene trap was in terminating transcription, we used reverse transcriptase

PAGE 57

57 (RT)PCR with th e forward primer located in the exon before the gene trap and the reverse primer located in the exon after the gene trap. The WT mice, in contrast to the homozygous Btbd9 mutant mice, produced a strong RT PCR fragment (Figure 4 3A). This suggests that the gene trap efficiently knocked out the Btbd9 gene. Furthermore, as there are currently no highquality commercially available antibodies for Btbd9 in mice, we took advantage of the mutant mice having the bacterial lacZ gene inserted into the Btbd9 gene as p galactosidaseneomycin galactosidase, we were able to identify that Btbd9 is normally expressed in the hippocampus of mice (Figure 4 3B). The Btbd9 mutant mice produced t wo bands compared to one band by the positive control, which could be attributed to alternate splicing of the Btbd9 gene (Flicek et al., 2008) The expression of the Btbd9 gene in the hippocampus of mice is similar to the result produced by the Allen Mouse Brain Atlas using in situ hybridization of Btbd9 mRNA (Lein et al., 2007) Motor Restlessness in Btbd9 Knockout Mice A cardinal feature of RLS is a n urge to move. Previous ly, phenotypic mouse models of RLS exhibited altered activity levels, including hyperactivity and periodic leg movement like phenomena (Ondo et al., 2000b; Clemens and H ochman, 2004; Esteves et al., 2004) Therefore, to assess the total activity levels of the Btbd9 knockout mice we measured activity using an open field activi ty chamber. We observed an increased total distance traveled in the homozygous Btbd9 knockout mice compared to WT mice (Figure 4 4 A, p < 0.05). Furthermore, we observed an increase in counterclockwise circling in the homozygous Btbd9 knockout mice (Figure 4 4 B, p = 0.05), while no statistical difference in clockwise (CW) circling compared to WT mice (Figure 4 4 B, p >

PAGE 58

58 0.05). Lastly, we observed no statistical differences in stereotypical behavior or anxiety levels in the homozygous Btbd9 knockout mice compar ed to WT mice (Table 4 4 ). The se results suggest that the homozygous Btbd9 knockout mice are hyperactive. Furthermore, alterations in circling behavior in mice have been linked in other studies to imbalances in the dopaminergic system (Kim et al., 2000; Vig giano et al., 2003) Next, we assessed w heel running activity, which measures voluntary act ivity in a home cage (Figure 4 5 ). In normal 12 hour light, 12 hour dark conditions (LD), homozygous Btbd9 knockout mice exhibited a strong trend of increase in total counts, which are the counts duri ng both day and night (Table 4 5 p = 0.06), and a trend of increase in counts during the lights on phase, when the mice would normally be resting or sleeping (Table 4 5 p = 0.08). Next, the mice were placed in constant darkness (DD), which mice typically resp ond with increased activity. T he homozygous Btbd9 knockout mice exhibited an increased locomotor activity compared to W T mice (Table 4 6 p < 0.05). Additionally, we observed no significant alterations in circadian parameters, including period, alpha, or a mplitude in either norm al LD or DD (p > 0.05, Table 4 5, Table 4 6 ). This data, taken together, suggest an increase in voluntary activity which corroborates the total activity being increased in the open field test, in the homozygous Btbd9 mutant mice (Fi gure 4 4 A). Thermal Sensory Alterations in Btbd9 Knockout Mice Commonly associated with the urge to move in RLS patients are uncomfortable sensations in the legs. Therefore, we tested the Btbd9 mutant mice for abnormalities in the sensory system using the tail flick test. We observed a 27% decrease in the latency to respond for the heterozygous Btbd9 knockout compared to WT mice (Figu re 4 6 A, p < 0.05). Furthermore, we observed a 53.4% decrease in time to respond to the warm

PAGE 59

59 stimulus in the homozygous Btbd9 knockout compared to WT mice (Figure 4 6 A, p < 0.01). We further analyzed this sensory alteration in the heterozygous Btbd9 knockout mice, as they may represent more of the RLS population, and showed an intermediary deficit. We observed no significant sensory alteration in the heterozygous Btbd9 knockout mice compared to WT mice during the middle of the active phase (Figure 4 6B, Midnight, p > 0.05). However, we observed a significant sensory alteration in the heterozygous Btbd9 knockout mice during the middle of the rest phase in c omparison to WT mice (Figure 4 6B, Midday, p < 0.01), suggesting a circadian or diurnal component to the sensory deficit. Next, we administered intraperitoneally 0.1 mg/kg of ropinirole, a common D2 receptor like dopaminergic agonist given to RLS patients, to WT and heterozygous Btbd9 knockout mice (Allen and Ritchie, 2008; Zintzaras et al., 2010) After t his treatment we observed no difference in latency to respond to the warm stimuli 15 minutes post injection (PI), 30 minutes P I, and 60 minutes PI (Figure 4 6 B, p > 0.05) between the homozygous Btbd9 knockout and WT mice This suggest s a circadian dependent sensory deficit in the Btbd9 knockout mice and the sensory deficit is responsive to dopaminergic treatment. Sleep S tructure A lterations in Btbd9 Knockout M ice Due to the uncomfortable sensations in the legs and the uncontrollable urge to move, patients with RLS often will have fragmented sleep (Brand et al., 2011; Scholz et al., 2011; YngmanUhlin et al., 2011) To investigate if similar sleep disruptions occur in the homozygous Btbd9 knockout mice, we implanted h omozygous Btbd9 knockout mice and WT mice with a wireless telemetry system capable of electroencephalographic (EEG) and electromyographic (EMG) recordings of the right tibialis cranialis, which is equivalent to the tibialis anterior muscle in humans. We observed that during the rest

PAGE 60

60 phase the homozygous Btbd9 knockout mice had decreased slow wave sleep (SWS) (Table 4 7 p < 0.01), no statistical difference in REM sleep ( Table 4 7 p > 0.05), and an increased awake time (Table 4 7 p < 0.05) compared to WT m ice. Furthermore, we observed an increase in arousals in the homozygous Btbd9 knockout mic e compared to WT mice (Table 4 7 p < 0.05), but no significant alteration in latency to sleep or REM sleep (Table 4 7 p > 0.05). These results suggest a fragmented sleep in the Btbd9 knockout mice, similar to RLS patients. Altered Iron M etabolism in Btbd9 Knockout M ice Analysis of the iron system has been an emphasis of RLS research. Therefore to test whether there is an alteration in iron homeostasis in the Btbd9 knockout mice, we measured serum iron using a colorimetric assay. H omozygous Btbd9 knockout mice exhibited increase d iron levels in the serum (Figure 4 7 A, p < 0.01). We then sacrificed and dissected the striatum from homozygous Btbd9 knockout and WT mice. After homogenizing these samples, we performed atomic absorption (AA) spectroscopy on the homogenates We observed no statistical difference in striatal brain iron levels between homozygous Btbd9 knockout and WT mice (Figure 4 7 B, p > 0.05). These results suggest that there is an imbalance in iron homeostasis, at least in the periphery of the Btbd9 knockout mice. Al tered Serotonergic M etabolism in Btbd9 Knockout M ice We analyzed the striatum of homozygous Btbd9 knockout mice using high HPLC for alte rations in dopamine, serotonin, and their metabolites DOPAC, HVA, and 5 HIAA. We observed no statistical difference between homozygous Btbd9 knockout and WT mice in dopamine, serotonin, DOPAC, or HVA (Table 4 8 p > 0.05). However, we did observe an increase in 5HIAA, a metabolite of serotonin, in the homozygous Btbd9

PAGE 61

61 mutant mice compared to WT (Table 4 8 p < 0.05). This suggests that the gross levels of dopamine and serotonin are not altered, but alterations in the metabolism of the monoamine ne urotransmitters in the striatum exist .

PAGE 62

62 Figure 4 geo vector insertion site and PCR map. ( A) Schematic geo vector insertion site to between 102,250 and 102,501. Reaction 1 produce d PCR products at the appropriate base pair (bp) length, whereas Reaction 2 failed to produce reactions of the appropriate size, thereby narrowing the location to between 102,000 to 102,501. This was further confirmed by Reaction 3, which failed to produce reactions of the appropriate size. This region was further broken down, with Reactions 4 and 5. Reaction 4 produced PCR products at the appropriate bp length, whereas Reaction 5 failed to produce reactions of the appropriate size, thereby narrowing the location to 102,200 to 102,501. (B) Schematic diagram of PCR primer locations used to genotype mice. A set of primers detects the wildtype allele, and a different set of primers detects the mutant allele. Base pair numbers are relative to the start of the s ixth intron of the Btbd9 geo gene trap, and thin line represents the sixth intron of the Btbd9 gene.

PAGE 63

63 Figure 4 2. Generation and genotyping of Btbd9 knockout mice. (A) The normal wild type (WT) allele of the Btbd9 gene contains 12 exons. A commercially available mutant allele of the Btbd9 geo gene trap inserted into the sixth intron. Filled vertical rectangles represent coding exons; open vertical rectangles represent noncoding exons. (B) To genotype the mice a two step process was taken. First, primers were used to detect specifically geo gene trap vector, which produced a fragment of approximately 311 bp in length with an internal control fragment of approximately 200 bp in length. Second, prim ers were used to detect specifically a WT allele, which would produce a fragment of approximately 500 bp in length and an internal geo fragment of 311 bp in length.

PAGE 64

64 Figure 4 3. Confirmation of loss of WT mRNA and fusion protein expressi on in hippocampus of Btbd9 knockout mice (A) The WT mice, in contrast to the homozygous Btbd9 knockout mice, produced a strong RT PCR fragment of the Btbd9 gene. (B) The Btbd9 protein is expressed in the hippocampus of galac geo fusion proteins from both the homozygous Btbd9 knockout and a positive control mouse that had a gene trap insertion in a different gene, while no band was observed in the WT control. Figure 4 4 Open field test to measure total activity. (A) Homozygous Btbd9 knockout mice showed an increased total activity compared to WT mice. (B) Homozygous Btbd9 knockout mice showed no alteration in clockwise (CW) circling, but did show an increase in counterclockwise (CCW) circling. Bars represent means with standard errors of the mean. p

PAGE 65

65 Figure 4 5 Wheel running analysis to measure voluntary activity. (A) Homozygous Btbd9 knockout mice showed a trend of increased activity during the normal light, dark cycle (LD). The li ght was on between ZT 0 and 12. (B) Actograms of WT and homozygous Btbd9 knockout mice. Yellow shaded region represents when the lights were on.

PAGE 66

66 Figure 4 6 Tail flick test to determine sensory perception to warm stimuli. (A) Heterozygous Btbd9 mutant m ice and homozygous Btbd9 mutant mice showed a dramatic decrease in latency to respond to a warm stimulus. (B) Heterozygous Btbd9 mutant mice showed no sensory alteration during the middle of the active phase (midnight), but showed a sensory alteration duri ng the middle of the rest phase (midday). Top schematic describes the experimental design and setup. Bottom graph shows that after a 0.1 mg/kg injection of ropinirole, a dopamine receptor agonist, there was no statistical difference in latency to respond 1 5 minutes post injection (PI), 30 minutes PI, or 60 minutes PI. Bars represent means with standard errors of the mean. p < 0.05, ** p < 0.01.

PAGE 67

67 Figure 4 7 Iron concentrations in the serum and striatum. (A) Homozygous Btbd9 mutant mice showed a signific ant increase in iron levels in blood serum compared to WT mice. (B) However, there was no significant alteration in iron levels in the striatum between homozygous Btbd9 mutant mice and WT mice. Bars represent means with standard errors of the mean. ** p < 0.01.

PAGE 68

68 Table 4 1 Primers located in the sixth of the Btbd9 gene. Primer Name Forward (5' Reverse (5' Length Location of Forward Exon6 TTGAAGTGTCCATGGACGAACTTGATTGGA TCCAATCAAGTTCGTCCATGGACACTTCAA 30 103 to 74 10139 gagcaccaagccctacactgtttcacaatggga tcccattgtgaaacagtgtagggcttggtgctc 33 10,139 to 10,171 6A tactctgggaattcttacaccaatgaactgc gcagttcattggtgtaagaattcccagagta 31 22,003 to 22,033 29572 tctggataatcgtgccgtttaaaaccaagca tgcttggttttaaacggcacgattatccaga 31 29,572 to 29,602 6B gtacaataggtcccgcgttagaagtcgaa ttcgacttctaacgcgggacctattgtac 29 37,001 to 37,029 40880 tgatggttaagcatactgaagcagctttagc gctaaagctgcttcagtatgcttaaccatca 31 40,880 to 40,910 51316 gacaggggcatttattctggtatcatga tcatgataccagaataaatgcccctgtc 28 51,316 to 51,343 6C tatagagtaagaagagcaaacgtgggagca tgctcccacgtttgctcttcttactctata 30 59,997 to 60,026 68504 gctcatctgattactggctactatactgtc gacagtatagtagccagtaatcagatgagc 30 68,504 to 68,533 6D tcaaacatgcctaagataccttacctggatca tgatccaggtaaggtatcttaggcatgtttga 32 77,042 to 77,073 89304 gtacaccaacaatggaaaacatgacacactcc ggagtgtgtcatgttttccattgttggtgtac 32 89,304 to 89,335 100500 gagccgccctacccaacagttctcctcagc gctgaggagaactgttgggtagggcggctc 30 100,525 to 100,554 101500 gaatactgccttgctctggttccgtccaaatccc gggatttggacggaaccagagcaaggcagtattc 34 101,501 to 101,534 102000A ctgagatgattaacaagagctgagggct agccctcagctcttgttaatcatctcag 28 102,007 to 102,034 102000B agatgattaacaagagctgagggct agccctcagctcttgttaatcatct 25 102,010 to 102,034 102200 tcatgtgcacccgtgggaaagcttagtgt acactaagctttcccacgggtgcacat 29 102,195 to 102,223 6E tgaaccattacatttagaagacgtggctga tcagccacgtcttctaaatgtaatggttca 30 102,501 to 102,530 6EA aaccattacatttagaagacgtggctga tcagccacgtcttctaaatgtaatggtt 28 102,503 to 102,530 110510 tgctctcaactcctttcctcctgtactgc gcagtacaggaggaaaggagttgagagca 29 110,510 to 110,538 6F gtcctaccttatgattcaatcttagctgtc gacagctaagattgaatcataaggtaggac 30 118,494 to 118,523 131246 gacatgagtcatagtataagaggggaatca tgattcccctcttatactatgactcatgtc 30 131,246 to 131,275 6G gagtgttaaagatccctaaaggcttaagta tacttaagcctttagggatctttaacactc 30 144,007 to 144,036 153043 gaagaaacgacgatggcctgttgaggttga tcaacctcaacaggccatcgtcgtttcttc 30 153,043 to 153,072 6H ggaatctcctttgtacttttgctgccctgtac gtacagggcagcaaaagtacaaaggagattcc 32 162,001 to 162,032 170481 gtgcagtgagcccctccacacagacaacatc gatgttgtctgtgtggaggggctcactgcac 31 170,481 to 170,511 Exon7 GGACTCACAACACAGTGAACAAGATTTTC GAAAATCTTGTTCACTGTGTTGTGAGTCC 29 179,241 to 179,269

PAGE 69

69 Table 4 2 geo gene trap vector. Name Forward (5' Reverse (5' Length v1531 GGTCCCAGGTCCCGAAAACCAAAGAAGA TCTTCTTTGGTTTTCGGGACCTGGGACC 28 v1525 CAACCAGGTCCCAGGTCCCGAAAACCAAAGAAG CTTCTTTGGTTTTCGGGACCTGGGACCTGGTTG 33 v1842 GCGATCTTCCTGAGGCCGATACTGT ACAGTATCGGCCTCAGGAAGATCGC 25 v5472 CCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGC GCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGG 34

PAGE 70

70 Table 4 3. Non Mendelian ratios of pups from heterozygous Btbd9 mutant mice interbreeding. Genotype Expected Observed Chi square value p value WT 20.5 35 Het 41 34 9.391 0.0022 KO 20.5 13 10.083 0.0015 Total 82 82 14.195 0.0008** WT, Wild type mice; Het heterozygous Btbd9 knockout mice; KO, homozygous Btbd9 knockout mice; p < 0.05, ** p < 0.001. Table 4 4 No alterations in anxiety or stereotypical behaviors in open field. Parameter WT KO p value Vertical Activity 181.45 32.76 179.12 55.86 0.97 Center Time 302.77 59.27 271.09 101.07 0.81 Center:Marginal Distance 0.321 0.070 0.372 0.120 0.74 Stereotypy Count 1653 238 1555 407 0.85 Vertical activity is presented as the number of beam breaks. Center time is presented in s. The ratio of center distance to marginal distance is presented in cm. Stereotypy count is presented as the number of counts. WT, wildtype mice; KO, homozygous Btbd 9 knockout mice. Table 4 5 Wheel running activity parameters during normal 12:12 light, dark cycle (LD). Parameter WT KO p value Alpha 12.3 1.9 13.6 0.6 0.519 Light Counts 55.0 16.2 112.8 23.7 0.067 Dark Counts 7,518 1,829 13,440 2,510 0.081 Total Counts 7,573 1,845 13,552 2,532 0.081 Alpha (activity period length) is presented in hours SEM Light counts, dark counts, and total counts as number of counts SEM WT, wild type mice; KO, homozygous Btbd9 knockout mice p < 0.05.

PAGE 71

71 Table 4 6 Wheel running activity parameters during constant darkness (DD). Parameter WT KO p value Period 23.73 0.05 23.80 0.04 0.289 Amplitude 1,543.7 256.8 1,812.3 292.9 0.504 Alpha 11.5 0.6 11.4 0.6 0.853 Average Counts 4.9 2.2 11.1 1.4 0.032* Alpha (activity period length) and chi square periodogram determined period is presented in hours SEM. Average counts are presented as number of counts SEM WT, wild type mice; KO, homozygous Btbd9 knockout mice p < 0.05. Table 4 7 Polysomnographic sleep parameters during the rest phase. Parameter WT KO p value Awake 5.50 1.10 15.26 2.36 0.020* SWS 93.05 1.58 79.04 1.23 0.002** REM 1.44 1.05 5.70 3.03 0.255 Sleep Onset 0.27 0.27 1.43 2.36 0.42 REM Onset 141.00 115.17 9.60 4.86 0.32 WASO 5.15 1.43 15.08 2.50 0.03* Arousal Index 11.59 1.24 24.93 2.69 0.01* TW:TS 5.85 1.22 18.19 3.35 0.03* Awake, slow wave sleep (SWS), rapid eye movement (REM), sleep onset, and rapideye movement (REM) onset were normalized to total time and are presented in percentage of time SEM Wake after sleep onset (WASO) is the time awake after the initial sleep bout and is normalized to total time and is presented in percentage of time SEM Arousal index is the number of wake bouts per hour SEM Total awake to total asleep (TW:TS) is the ratio of total awake time to total asleep time SEM WT, wild type mice; KO, homozygous Btbd9 knockout mice p < 0.05, ** p < 0.01.

PAGE 72

72 Table 4 8 Levels of dopamine, serotonin, and their metabolites in the striatum. Neurochemical WT KO p value Epinephrine 3.62 1.468 3.21 0.53 0.61 Dopamine (DA) 44.05 5.85 41.28 4.53 0.25 Serotonin (5 HT) 1.30 0.04 1.40 0.07 0.5 DOPAC 15.60 0.98 17.12 1.40 0.74 5 HIAA 0.26 0.04 0.47 0.07 0.04 HVA 20.20 2.21 22.29 1.57 0.8 DOPAC/DA 0.37 0.08 0.43 0.04 0.68 HVA/DA 0.43 0.03 0.56 0.05 0.11 5 HIAA/5 HT 0.20 0.03 0.34 0.06 0.07 The values of neurochemicals represent means SEM in pmol/g of tissue. The turnover of metabolites is shown as ratios of neurochemicals WT, wild type mice; KO, homozygous Btbd9 knockout mice p < 0.05.

PAGE 73

73 CHAPTER 5PART 3: ENHANCED HIPPOCAMPAL LONG TERM POTENTIATION AND FEAR MEMORY IN BTBD9 KNOCKOUT MICE Field Recordings of Btbd9 Knockout Mice As the hippocampus is involved in learning and memory and extensively studied using electrophysiological techniques, we performed field recordings in hippocampal slices in the CA1 region to determine w hether loss of the Btbd9 protein results in alterations in synaptic plasticity and/or neurotransmission To test for postsynaptic deficits in the homozygous Btbd9 knockout mice, we obtained input output curves, which measure the post synaptic potential sl ope versus varying stimulus intensities. Homozygous Btbd9 knockout mice showed no change in their input output relationship at individual stimulus intensity values and no change in the distribution of the curve compared to WT mice (p > 0.05; Figure 5 1 A). Next, to examine short term plasticity in the homozygous Btbd9 knockout mice we looked at pairedpulse ratios (PPRs), which test the ability of two stimuli separated by varying time intervals to elicit an increased post synaptic response. PPRs at three di fferent inter stimulus intervals were significantly enhanced in the homozygous Btbd9 knockout mice compared to WT mice (p < 0.05; Figure 5 1 B). This suggests a decrease d probability of synaptic vesicle release from the presynaptic terminal in the Btbd9 kn ockout mice Next, to examine long term plasticity in the Btbd9 knockout mice we examined long term potentiation (LTP). We observed a significant enhancement in late CA1 LTP in homozygous Btbd9 Reproduced and adapted with permission from DeAndrade MP, Zhang L, Doroodchi A, Yokoi F, Cheetham CC, Chen HX, Roper SN, Sweatt JD, Li Y (2012b) Enhanced hippocampal long term potentiation and fear memory in Btbd9 mutant mice. PLoS One 7:e35518.

PAGE 74

74 knockout mice compared to WT mice (p < 0.05; Figure 5 1 C). Th is suggests an enhancement in long term plasticity in the Btbd9 knockout mice Whole cell Recording of Btbd9 Knockout Mice T o further explore these alterations, we examined miniature excitatory post synaptic currents (mEPSC) for alterations in amplitude, frequency, and rise and decay times. We found an increased frequency and decreased amplitude of mEPSC events in the homozygous Btbd9 knockout mice compared to WT mice (p < 0.01, Figure 5 2 B), but no alteration in the rise and decay times (p > 0.05, Figure 5 2 C). Increased frequency suggests that the number of vesicles released from the presynaptic terminal at rest is increased. D ecreased amplitude suggests that the amount of glutamate per synaptic vesicle, the post synaptic response to a single synaptic vesicle, or both, could be decreased. Additionally, we observed no change in the kinetics of the post synaptic receptors, such as opening and closing of their respective channels. Fear Memory in Btbd9 Knockout Mice As alterations in hippocampal long term potentiation are associated with alterations in hippocampal learning and memory, we performed a classical fear conditioning to test both cued fear memory, freezing behavior caused by an auditory stimulus, and contextual fear memory, freezing behavior caused by recall of the environment or context. The homozygous Btbd9 knockout mice exhibited no difference in behavioral response to t he shock during the training period (p > 0.05, Figure 5 3 A ). Moreover, we observed no difference in the electrical shock required to elicit flinching, jumping, and vocalization behaviors between the homozygous Btbd9 knockout and WT mice (p > 0.05, Figure 5 3 B ). This suggests that the perception to the electrical shock is not different between homozygous Btbd9 knockout and WT mice. However, we

PAGE 75

75 observed that the homozygous Btbd9 knockout mice had an enhancement of both cued (p < 0.05, Figure 5 4 B) and context ual (p < 0.05, Figure 5 4 B) fear memory indicated by increased freezing behavior This suggests that the Btbd9 mutant mice have an enhancement in learning and memory that correlates with the enhanced LTP. Analysis of Proteins Involved in Synaptic Transmi ssion in the Btbd9 Knockout Mice To explore the molecular basis for the presynaptic alteration in the Btbd9 mutant mice, we performed w estern blot analyses to determine the level of several proteins involved in the Soluble NSF Attachment Protein Receptor (SNARE) complex, which are involved in synaptic vesicle docking, fusion, and endocytosis. We first determined the levels of the target SNAREs syntaxin 1 and SNAP 25 and the vesicular SNAREs synaptotagmin1 and synaptobrevin2. We also examined the levels o f endocytosis proteins synaptophysin and dynamin 1. We found no statistical difference in the protein levels of synataxin1, SNAP25, synaptobrevin2, synaptotagmin1, or synaptophysin, suggesting there is no functional alteration in vesicular docking or fus ion events (p > 0.05, Figure 5 5 A E ). However, the Btbd9 knockout mice exhibited increase d level s of dynamin 1 compared to WT mice (p = 0.05, Figure 5 5F ).

PAGE 76

76 Figure 5 1 Hippocampal CA1 electrophysiological field recordings. (A) Homozygous Btbd9 knockout mice showed no differences in input output relationships Small inset graph is a representative trace with varying stimulus intensities. (B) Homozygous Btbd9 knockout mice showed enhanced pairedpulse ratios at three inter stimuli values. Panel above graph are representative traces at the three inter stimuli values that were significantly different between Btbd9 mutant and WT mice. (C) Homozygous Btbd9 knockout mice showed enhanced late long term potentiation. Small inset graphs are representative traces, with red signifying before LTP induction and black signifying after LTP induction. Circles represent means SEM. p < 0.05.

PAGE 77

77 Figure 5 2 Hippocampal CA1 electrophysiological whole cell recordings. (A) Representative traces of mEPSC recording from WT and homozygous Btbd9 knockout mice. (B) Homozygous Btbd9 knockout mice showed an increase in frequency and a decrease in amplitude of mEPSC events compared to WT mice. (C) Homozygous Btbd9 knockout mice showed no difference from WT in rise and decay times of mEPSC events. Bars represent means SEM ** p < 0.01.

PAGE 78

78 Figure 5 3 Response to electric shocks. (A) Homozygous Btbd9 knockout mice showed no difference in their threshold to electrical shock in any of three measured behaviors flinching, jumping, or vocalization. (B) Homozygous Btbd9 knockout mice showed no difference in behavioral response on a rating scale of 1 to 5 to either of the electric shocks during the training phase of the fear conditioning experiment. (C) Homozygous Btbd9 knockout mice showed no difference in freezing behavior in the first 3 minutes of the cued fear conditioning test. Bars represent means SEM.

PAGE 79

79 Figure 5 4 Freezing behavior in fear conditioning experiment. (A) Homozygous Btbd9 knockout mice and WT mice were conditioned to two 30second tones followed by an electric shock, with a shock interval of 120 seconds. Solid black rectangle represents the period of tone. The vertical line at represents the period of the shock. (B) Homozygous Btbd9 knockout mice had increased percentage of freezing behavior in both contextual and cued fear conditioning, suggesting that the homozygous Btbd9 knockout mi ce had enhanced fear memory. Vertical bars represent means SEM. p < 0.05.

PAGE 80

80 Figure 5 5 Western blot analyses of synaptic proteins from hippocampal synaptosome fractions Representative Western blot images and quantitative analysis of syntaxin 1 (A), SNAP25 (B), synaptotagmin1 (C), synaptobrevin2 (D), synaptophysin (E), and dynamin 1 (F) Bars represent means SEM. p = 0.05.

PAGE 81

81 CHAPTER 6 CONCLUSION Rapid Onset Dystonia Parkinsonism Previously, our laboratory and others generated animal models of DYT1 and DYT11 dystonias (Dang et al., 2005; Sharma et al., 2005; Dang et al., 2006a; Yokoi et al., 2006; Grundmann et al., 2007; Yokoi et al., 2010) and tested for motor deficits, hyperactivity, and levels of neurotransmitters in the striatum Therefore, we set forth characterize the first genotypic model of r apid onset dystoniaparkinsonism using Atp1a3 mutant mice Similar to human patients, we demonstrated that motor deficits could be triggered in female heterozygous Atp1a3 knockout mice by stress. Furthermore, we demonstrated that these motor deficits do not arise from a muscular weakness, in line with the origins of dystonia being in the central nervous system (Muller et al., 2002) While previous studies of mouse models of DYT1 and DYT11 dystonias show ed similar decreases in motor performance between WT and mutant mice these mouse models do not shown a female bias of deficits similar to our results (Dang et al., 2005; Sharma et al., 2005; Dang et al., 2006a; Yokoi et al., 2006; Grundmann et al., 2007; Yokoi et al., 2008; Yokoi et al., 2010) Moreover investigations to date do not reveal a female bias in RDP patients. We hypothesize that restraint stress effects females more than males, whic h is supported by other studies (Koehl et al., 2006) Therefore, we failed to trigger motor deficits in male Atp1a3 mutant mice, because they did not receive a strong enough stressor. Previously, Brashear and colleagues observed decreased levels of HVA in the CSF of RDP patients (Brashear et al., 1998a) However, we observed no difference in

PAGE 82

82 dopamine, serotonin, or their metabolites between stressed heterozygous Atp1a3 knockout and WT mic e. It is important to note that Brashear and colleagues did not study the level of neurochemicals in the striatum of post mortem tissue from RDP patients Therefore, the discrepancy between our results and theirs could be due difference in the site of meas urement (CSF versus stria tum). T he sensory system in animal models of dystonia is not well studied However, dystonia patients exhibit alterations in temporal and spatial discrimination and integration of sensory signals (Tinazzi et al., 1999; Sanger et al., 2001; Tinazzi et al., 2002; Aglioti et al., 2003; Molloy et al., 2003; Tinazzi et al., 2004; Fiorio et al., 2007) Similarly, stressed female heterozygous Atp1a3 knockout mice exhibited a hyposensitivity in the tail flick test. Investigators hypothesize sensory alterations in Parkinsons disease and dystonia arise due to changes in the basal ganglia that disrupts the integration of sensory and motor information (Kaji et al., 2005; Peller et al., 2006) Lastly, we conducted a wheel running experiment to measure voluntary activity levels We hypothesized that mice exhibit ing dystonic like and/or parkinsonian symptoms would have decreased voluntary activity levels, due to the physical discomfort of running. Interestingly, stressed female heterozygous Atp1a3 knockout mice diverged into a hyperactive and a hypoactive group compared to stressed female WT mice. We hypothesize that these two groups likely represent a behaviorally penetrant group (hypoactive animals) and a behaviorally nonpenetrant group (hyperactive group). We are actively conducting experiments to examine this hypothesis further

PAGE 83

83 Overall, stressed female Atp1a3 mutant mice model several key behavioral characteristics of RLS (DeAndrade et al., 2011) Therefore, future studies can be developed to understand the pathophysiology underlying RDP dystonia using Atp1a3 mutant mice. Restless Legs Syndrome We generated a line of Btbd9 knockout mice to explore its utility as the first genotypic mouse model of RLS, with clear etiology to RLS (DeAndrade et al., 2012a; DeAndra de et al., 2012b) As direct application of standard diagnostic methods for RLS (e.g. IRLSSG rating scale) are not feasible, we thoroughly examined the Btbd9 knockout mice for similar, relevant phenotypes. We found that the Btbd9 knockout mice exhibited motor restlessness, both in voluntary activity and total act ivity. Additionally, the Btbd9 knockout mice displayed hypersensitivity to warm stimuli that was likely limited to the rest phase. Additionally, the hypersensitivity could be rescued using the common RLS treatment ropinirole, a D2like dopaminergic agonist. Furthermore, we observed decreased sleep time and increased wake time during the rest phase in the homozygous Btbd9 knockout mice Lastly, we found elevated levels of iron in the serum and alterations in the monoamine neurotransmitter system in the homozygous Btbd9 knockout mice. Therefore, these results suggest that the loss of Btbd9 in mice results in several behavioral and biochemical abnormalities that have part icular relevance to RLS, including motor activity, sensory, and levels of monoamine neurotransmitters. Moreover, these results taken together suggest that BTBD9 is involved in RLS, and further studies of the Btbd9 KO mice are warranted to examine its role in RLS pathophysiology. Next, we analyzed the Btbd9 KO mice for alterations in synaptic plasticity and neurotransmission in the hippocampus, a brain region critical for learning and memory.

PAGE 84

84 We found that the Btbd9 knockout mice exhibited enhanced hippocampal late long term potentiation (LTP). Late LTP, unlike early LTP, is believed to be protein synthesis dependent due to its extended time period (Frey et al., 1988; Frey et al., 1996) Additionally, we observed enhanced cued and contextual fear memory in the Btbd9 knockout mice compare d to WT mice Furthermore, in the electrophysiological recordings we observed enhanced pairedpulse ratios (PPR), a measure of neural facilitation in the Btbd9 knockout mice. PPRs measure the ability of a second impulse to evoke the further release of synaptic vesicles from the presynaptic terminal. PPRs are on the order of milliseconds and seconds and therefore are a measure of short term plasticity. PPRs are associated with an inverse probability of synaptic vesicle release, where increases in PPRs are indicative of a decreased probability of synaptic vesicle release and vice versa. T herefore, to determine if there are alterations in synaptic vesicle release we measured miniature excitatory post synaptic current s (mEPSC s). The Btbd9 knockout mice exhibit ed decreased amplitude and increased frequency of mEPSC events. Decreased amplitude of mEPSC events suggest a decrease in quantal size of vesicular glutamate, a decrease in unit post synaptic response, or both. Increased frequency of mEPSC events suggest s that there is an increase in synaptic vesicle release at rest, which is opposite to our PPR results would suggest. It is worth noting that Kavalali and colleagues postulated that evoked responses, such as input output relationships, and spontaneous respons es, such as mEPSC, may not be directly compared due to different synaptic mechanisms underlying them (Kavalali et al., 2011) To determine the molecular mechanisms underlying the observed changes we measured the level of proteins that are involved in synaptic transmission and plasticity.

PAGE 85

85 Btbd9 knockout mice exhibited an elevated level of dynamin 1. Dynamin is a GTPase associated with the cleavage of vesicles from the plasma membrane during endocytosis (Sweitzer and Hinshaw, 1998) D ynamin 1 knockout mice exhibit a decrease in synaptic vesicle recycling, possibly due to an inability of vesicles to be cleaved from the plasma membrane (Ferguson et al., 2007) Additionally, decreases in dynamin 1 levels correlated with the degree of memory impairment in a rat model of Alzheimers disease (Watanabe et al., 2010) Furthermore, treatment of t hese rats with memantine, a classic NMDA antagonist used to treat Alzheimers disease, resulted in decreased dynamin 1 degradation and increased memory performance (Watanabe et al., 2010) Recently, F and colleagues demonstrated that dynamin 1 knockout mice exhibit reduc ed LTP, neurotransmitter release, and contextual fear memory (Fa et al., 2014) This work supports our hypothesis that the alterations in dynamin 1 are integral to the al terations in synaptic plasticity and neurotransmission in the Btbd9 knockout mice. It is possible that like other proteins with BTB domains, BTBD9 is involved in ubiquitination, and one of its targets is dynamin 1. Therefore, loss of BTBD9 results in impai red dynamin 1 ubiquitination, which causes an increase in dynamin 1 levels. Future work to understand the function of BTBD9 will need to be conducted. Of particular relevance, RLS patients have a decrease in pain threshold and temporal summation of heat pain, which has been hypothesized to be attributed to an alteration in the processing centers in the nervous system (Edwards et al. 2011) Furthermore, several studies have suggested that an enhanced synaptic plasticity in nociceptive pathways can cause heightened pain awareness (Gong et al. 2010; Ito et al. 2001; Nakamura et al. 2010; Ruscheweyh et al. 2011) In parti cular, nociceptive nerves

PAGE 86

86 can undergo long term potentiation, which has been suggested as a possible mechanism underlying hyperalgesia (Ikeda et al. 2003) The Btbd9 KO mice had altered short and LTP and neurotransmission in the hippocampus (DeAndrade et al. 2012b) While the hippocampus is not traditionally seen as involved in sensory processing, we hypothesize that similar synaptic alterations may be present in sensory centers, such as the thalamus or the spinal cord, which in turn can lead to an altered sensory perception and the odd sensations in RLS patients. Future Directions Rapid onset Dystonia P arkinsonism Electromyographic characterization of Atp1a3 mutant mice To date, no genotypic animal model of any type of dystonia exhibits overt dystonia. This has led to uncertainty over the validity of these mice as models of dystonia. Previously, Chiken and colleagues analyzed a transgenic mouse model ov erexpressing human DYT1 specific enolase promoter, a model of DYT1 dystonia, for alterations in EMG activity of the forelimb tricep and bicep brachii muscles (Chiken et al., 2008) The transgenic mice exhibited coactivation of these muscles and sustained muscle contractions greater than 10 seconds (Chiken et al., 2008) However the authors noted that the findings of their report could be due to other effects besides the overexpression of DYT1 not consistent with other overexpression models or the knock in models of DYT1 dystonia. Further complicating the study, the authors utilized mice ranging from 5 to 28 weeks of age, nonlittermate controls, and onl y mice exhibiting severe behavioral deficits (approximately 40% of mutant mice) (Chiken et al., 2008)

PAGE 87

8 7 Therefore, w e exami ned the EMG traces of Dyt1 in mice, a different model of DYT1 dystonia that mimics the most prevalent mutation observed in patients and WT mice during the active phase of the mice ( ZT 12 to 24). We detect ed sustained contractions in all of the Dyt1 6 1B, Table 6 1). However, none of the WT mice showed sustained contractions (Figure 6 1A, Table 6 1). Notably, we observed a wide range of sustained contractions in individual Dyt1 KI mice, which could be attributable to penetrance and severity of the disease. Furthermore, this suggests that the Dyt1 dystonia, which are sustained contractions. The next step is to conduct EMG analysis of the heterozygous Atp1a3 knockout mice similar to the Dyt1 We expect to see similar sustained contractions in these mice. Generation and characterization of conditional k nockout mice +/K+ATPase has a selective inhibitor, ouabain, which is a naturally produced steroid hormone. I nfusion of oubain in to the cerebellum resulted in dystonic postures, while infusion of oubain into the basal ganglia resulted in parkinsonism (Cald eron et al., 2011) However, it is important to note that ouabain as a natural steroid hormone has other targets, though to a much lesser degree including MAP kinase phosphorylation (Haas et al., 2000) intracellular calcium signaling cascades (Aizman et al., 2001; Yuan et al., 2005) and NF (Kawamoto et al., 2012) As signaling pathways in the cell undergo signal amplification, even very minor alterations in activation of these pathways could result in unintended and misappropriated phenotypes. Therefore, selectively knocking out the Atp1a3 gene in certain brain regions would be a better approach. One method to generate selective knockout uses Cre loxP

PAGE 88

88 technology. Both Cre and the loxP site are derived from the P1 bacteriophage. Cre is a n expressed will cleave DNA at one loxP site and ligate it to another cleaved loxP site through a Holliday junction. This will result in a contiguous strand of DNA with absolute fidelity. An advantage of the CreloxP system is that no additional proteins or cofactors are necessary for the recombination to occur. Moreover, the c re gene and loxP sequences are not naturally found in the mouse genome. Using genetic targeting loxP sites can be inserted around a crucial exon of the Atp1a3 gene in the preceding and proceeding intronic sequences. Furthermore, these loxP sites are often inserted in a manner to cause a frameshift mutation upon Cre mediated recombination, which will disrupt the transcription of the gene. Atp1a3 loxP mice can then be bred with mice ex pressing Cre in certain brain regions or cell populations. For instance, our laboratory previously generated the Rgs9Lcre mice which express es Cre primarily in medium spiny neurons of the striatum (Dang et al., 2006b) and Emx1 cre, which limits Cre expression to the cerebral cortex and hippocampus (Guo et al., 2000) Another important Cre line that could potentially be used is the Pcp2 cre line, which expresses Cre in the Purkinje cells of the cerebellum (Barski et al., 2000) Anot her method of causing Cre mediated recombination is to inject the gene encoding Cre recombinase using adenoassociated virus into target regions (Ogasawara et al., 1999; Kaspar et al., 2002) The advantage of this system is that it can broadly cause Cre recombination in both neuronal and nonneuronal cells of the region of interest.

PAGE 89

89 Restless Legs S yndrome Magnetic r esonance imaging of Btbd9 KO mice Research in the 1970s through the 1990s led to the development of magnetic resonance imaging (MRI) and its utilization for in vivo analysis of tissue. This technique uses a strong magnet to align the protons of a desired tissue, e.g. the brain, and t hen a radio frequency electromagnetic pulse is used to alter this alignment. After the pulse is turned off, the protons will realign to the magnet at different rates depending on the dynamics of that tissue, which can be detected by a receiver. The first paramagnetic ion used to enhance MRI images was manganese (Lauterbur, 1973) Manganese (Mn2+) enters the cell primarily through voltage gated calcium (Ca2+) channels. Therefore, after a systemic injection of manganese, neurons that are more active will take up more manganese, whereas neurons that are less active will take up less manganese. We hypothesized that different brain regions are differentially acti vated or inactivated in the Btbd9 knockout mice compared to WT mice. The significance of this study is that it may lead to an understanding of how different brain regions contribute to the pathogenesis of RLS. In collaboration with Dr. Marcelo Febo, we im aged 6 WT mice (2 males, 4 females), 6 Btbd9 knockout mice (2 males, 4 females) 24 hours after injection with approximately 70 mg of manganese chloride per kilogram of body weight. Additionally, we imaged 1 WT mouse with no prior injection of manganese as a negative control. After processing and aligning to a standard mouse atlas, we examined individual brain regions for activation levels. Overall, we observed a decrease in manganese signal in the Btbd9 knockout mice compared to WT mice (Figure 6 2) In par ticular we observed decreased signal in the hippocampus and the brainstem of Btbd9 knockout mice

PAGE 90

90 (Students t test, p < 0.05, Figure 63 ). Therefore, this suggest there is a decrease in neuronal activity at baseline in the Btbd9 knockout mice in the hippoc ampus and brainstem, which fits our finding of enhanced LTP in the Btbd9 knockout mice. We plan to conduct additional MRI experiments to elucidate how different brain regions contribute to RLS. Electrophysiological characterization of the spinal cord in Bt bd9 KO mice In addition to the hypothesis that RLS originates in the basal ganglia, another hypothesis suggest that RLS originates in subcortical or spinal regions (Clemens and Hochman, 2004; Clemens et al., 2006; Trotti et al., 2008; Mahowald et al., 2010; Zwartbol et al., 2013) Therefore, we investigated Btbd9 knockout mice for alterations at the spinal cord level In collaboration with Dr. Stefan Clemens of East Carolina University, we preliminarily analyzed the Btbd9 knockout mice for alterations in spinal reflex Complete spinal cords were isolated from P14 old WT mice (n=4), heterozygous Btbd9 knockout mice (n=9) Btbd9 homozygous knockout mice (n=2), and baseline spinal reflex amplitudes were measured according to a previous study (Clemens and Hochman, 2004) Next, either dopamine or the quinpirole, a D2 like agonist, was applied to the spinal cords through the bath solution. W e observed that when dopamine ncrease in spinal reflex amplitude, whereas the homozygous Btbd9 knockout mice responded with a decrease in response (Students t test, p < 0.001, Figure 6 4 A). The heterozygous Btbd9 knockout mice had an intermediary phenotype (Students t test, p < 0.001 Figure 6 4 A). amplitude (Students t test, p < 0.05, Figure 6 4 B) and the homozygous Btbd9 knockout mice responded with a decrease in response. While this result opens up the possibility

PAGE 91

91 of local spinal cord deficits in the Btbd9 knockout mice, it does not rule out the possibility of long lasting descending modulation from cortex or other brain regions. Furthermore, these studies will need to be replicated in a larger sample size for validation purposes. Generation and characterization of conditional k nockout mice Similar to modeling rapidonset dystoniaparkinsonism in mice using conditional knockout mi ce, modeling restless legs syndrome could be benefited by similar studies. Our laboratory and others have proposed the centrality of the basal ganglia to restless legs syndrome. Using Btbd9 knockout mice we can attempt to answer this. If selectively knocki ng out the Btbd9 gene in the basal ganglia results in RLS like phenotypes, this would suggest loss of Btbd9 in that region is important in the development of those phenotypes. The European Mutant Mouse Archive previously generated a line of Btbd9 loxP mice We imported this line and crossed it with the Rgs9L cre line of mice to generate striatum specific Btbd9 conditional knockout mice. As expected, there is significant reduction of Btbd9 mRNA in the striatum compared to control littermates (p < 0.01, Figur e 6 5 ), but not in the cerebral cortex or cerebellum (data not shown). It is worth noting that remaining Btbd9 expression in the striatum can be accounted for by the small subset of neurons (<5%) that do not express Cre, and non neuronal cells such as glia In a preliminary study we examined 13 Btbd9 loxP/ (6 males, 7 females) and 19 homozygous striatum specific Btbd9 conditional knockout mice (7 males, 12 females) for behavior alterations. We observed hyperactivity in the striatum specific Btbd9 conditional knockout mice compared to the WT mice in the open field apparatus (mixed model ANOVA, p < 0.05, Figure 6 6 ). Further examination of locomotor and sensory phenotypes will be necessary.

PAGE 92

92 Common Themes Disease P erspective While disparate diseases, several common themes exist between rapidonset dystoniaparkinsonism and restless legs syndrome Pathogenesis of both diseases is hypothesized to involve dysfunction of the dopaminergic system. A dditionally, a recent study demonstrated that 44% of patient s with cervical dystonia have impaired sleep quality, and 19% have restless legs syndrome (Pa us et al., 2011) Both diseases may also encompass some aspect of sensory or nociception dysfunction. In cervical dystonia patients, the frequency of pain was 68 to 75% (Chan et al., 1991; J ankovic et al., 1991) In patients with blepharospasm, a type of focal dystonia affecting the muscles of the eye, an increase in photosensitivity has be en reported (Stamelou et al., 2012) Sensory symptoms have been reported in a number of studies on RLS patients (Stiasny Kolster et al., 2004a; Mller et al., 2010; Rizzo et al., 2010; Hornyak et al., 2011; Picchietti et al., 2011) ( Happe and Zeitlhofer, 2003; Bachmann et al., 2010) Interestingly, a case report of a single patient with restless legs syndrome associated with generalized dystonia could be treated using deep brain stimulation (DBS). The symptoms for restless legs syndrome and dystonia were reported to be clearly distinguishable, and after bilateral DBS of the globus pallidus interna (GPi) there was resolution of the RLS symptoms (urge to move and uncomfortable sensations) and the dystonic symptoms (dystonic spasms and associated pain) (Okun et al., 2005) As both diseases are hyperkinetic disorders, similar alterations could underlie the pathogenesis, perhaps in the basal ganglia.

PAGE 93

93 Animal Model P erspective Prior to these studies, no animal model of rapidonset dystoniaparkinsonism had been reported. Therefore the methods to comprehensively assess a mouse line as a model of the disease had to be developed. We did this by adapting previously established models of other genotypic models of dystonia to the specific needs of rapidonset dystoniaparkinsonism. Similarly, prior to our studies in restless legs syndrome, no single st udy comprehensively studied a potential mouse model of RLS. However, several studies have proposed methods to test a mouse model of RLS, but in our opinion were still incomplete, and therefore additional tests were needed. In both animal models we utilize d similar techniques. For instance, in both animal models we used the open field and wheel running tests to measure locomotor activity, and the tail flick test was used to identify sensory alterations to warm stimuli. While neither the Atp1a3 heterozygous knockout mice n or the Btbd9 homozygous knockout mice completely model all aspects of their respective disease, we believe that these animals model certain perspectives of the disease and could be used to elucidate pathophysiology and develop novel therapeutics in future studies.

PAGE 94

94 Figure 6 1. Electromyographic traces of the bicep femoris muscle. (A) Representative trace from a wild type mouse. (B) Representative trace from a Dyt1 mouse with a sustained contraction. Analysis revealed that sustained contractions were only present in Dyt1 wild type mice.

PAGE 95

95 Figure 62. MEMRI scans. We scanned Btbd9 knockout and WT mice an aligned it to a mouse brain atlas. Next, we generated Z score maps of Btbd9 knockout and WT mice, and observed a general decrease in MRI signal in Btbd9 knockout mice.

PAGE 96

96 Figure 63. Quantification of MEMRI signals. (A ) Normalized signal intensity and (B ) volume of MEMRI signals revealed decreased signal in the brainstem and hippocampus of Btbd9 knockout mice compared to WT mice. Bars represent means SEM. p < 0.05, ** p < 0.01.

PAGE 97

97 Figure 6 4 Spinal reflex amplitude i n response to dopamine and the D2like agonist quinpirole. ( A ) WT mice showed an increase in amplitude in response to dopamine, whereas the homozygous Btbd9 KO mice showed a decrease in response to dopamine. ( B ) WT mice showed an increase in amplitude in r esponse to quinpirole, whereas the homozygous Btbd9 KO mice showed a decrease in response to quinpirole. Bars represent means SEM. p < 0.05, *** p < 0.001. Figure 6 5 Quantitative RT PCR revealed a specific reduction of Btbd9 mRNA in the striatum o f the Btbd9 sKO mice. Bars represent means SEM. ** p < 0.01.

PAGE 98

98 Figure 6 6 Open field activity. Open field activity showed that the Btbd9 sKO mice are hyperactive compared to Btbd9 loxP control animals. Bars represent means SEM. p < 0.05.

PAGE 99

99 Table 6 1 Sustained contractions in wild type and Dyt1 KI mice. Animal Protocol 1 Protocol 2 Protocol 3 (5 times baseline) (4 times baseline) (3 times baseline) Wild type 1 0 0 0 Wild type 2 0 0 0 Wild type 3 0 0 0 Knock in 1 1 4 41 Knock in 2 5 16 134 Knock in 3 0 0 23 Numbers represent the number of sustained contractions present in each individual animal. Protocol 1: Sustained contractions are defined as greater for at least 10 s with a joint interval of 2 s. Protocol 3: Sustained s with a joint interval of 2 s.

PAGE 100

100 LIST OF REFERENCES Abetz L, Allen R, Follet A, Washburn T, Earley C, Kirsch J, Knight H (2004) Evaluating the quality of life of patients with restless legs syndrome. Clin Ther 26:925935. Aglioti SM, Fiorio M, Forster B, Tinazzi M (2003) Temporal discrimination of cross modal and unimodal stimuli in generalized dystonia. Neurology 60:782785. Aizman O, Uhln P, Lal M, Brismar H, Aperia A (2001) Ouabain, a steroid hormone that signals with slow calcium oscillatio ns. Proc Natl Acad Sci U S A 98:1342013424. Albanese A, Bhatia K, Bressman SB, Delong MR, Fahn S, Fung VS, Hallett M, Jankovic J, Jinnah HA, Klein C, Lang AE, Mink JW, Teller JK (2013) Phenomenology and classification of dystonia: a consensus update. Mov Disord 28:863873. Allen RP, Barker PB, Wehrl F, Song HK, Earley CJ (2001) MRI measurement of brain iron in patients with restless legs syndrome. Neurology 56:263265. Allen RP, Ritchie SY (2008) Clinical efficacy of ropinirole for restless legs syndrome i s not affected by age at symptom onset. Sleep Med 9:899902. Araujo SM, de Bruin VM, Nepomuceno LA, Maximo ML, Daher EeF, Correia Ferrer DP, de Bruin PF (2010) Restless legs syndrome in endstage renal disease: Clinical characteristics and associated comor bidities. Sleep Med 11:785790. Bachmann CG, Rolke R, Scheidt U, Stadelmann C, Sommer M, Pavlakovic G, Happe S, Treede RD, Paulus W (2010) Thermal hypoaesthesia differentiates secondary restless legs syndrome associated with small fibre neuropathy from pri mary restless legs syndrome. Brain 133:762770. Baier PC, Winkelmann J, Hhne A, Lancel M, Trenkwalder C (2002) Assessment of spontaneously occurring periodic limb movements in sleep in the rat. J Neurol Sci 198:7177. Barski JJ, Dethleffsen K, Meyer M (2000) Cre recombinase expression in cerebellar Purkinje cells. Genesis 28:9398. Ben Sreti MM, Gonzalez JP, Sewell RD (1983) Differential effects of SKF 38393 and LY 141865 on nociception and morphine analgesia. Life Sci 33 Suppl 1:665668. Bhandal N, Russel l R (2006) Intravenous versus oral iron therapy for postpartum anaemia. Bjog 113:12481252. Brand S, Beck J, Hatzinger M, Savic M, Holsboer Trachsler E (2011) Unfavorable polysomnographic sleep patterns predict poor sleep and poor psychological functioning 3 years later in patients with restless legs syndrome. Neuropsychobiology 63:92102.

PAGE 101

101 Brashear A, DeLeon D, Bressman SB, Thyagarajan D, Farlow MR, Dobyns WB (1997) Rapid onset dystoniaparkinsonism in a second family. Neurology 48:10661069. Brashear A, Butler IJ, Hyland K, Farlow MR, Dobyns WB (1998a) Cerebrospinal fluid homovanillic acid levels in rapidonset dystoniaparkinsonism. Ann Neurol 43:521526. Brashear A, Butler IJ, Ozelius LJ, Kramer PI, Farlow MR, Breakefield XO, Dobyns WB (1998b) Rapidonset dystoniaparkinsonism: a report of clinical, biochemical, and genetic studies in two families. Adv Neurol 78:335339. Brashear A, Mulholland GK, Zheng QH, Farlow MR, Siemers ER, Hutchins GD (1999) PET imaging of the pre synaptic dopamine uptake sites in r apid onset dystoniaparkinsonism (RDP). Mov Disord 14:132137. Brashear A, Dobyns WB, de Carvalho Aguiar P, Borg M, Frijns CJ, Gollamudi S, Green A, Guimaraes J, Haake BC, Klein C, Linazasoro G, Munchau A, Raymond D, Riley D, Saunders Pullman R, Tijssen MA Webb D, Zaremba J, Bressman SB, Ozelius LJ (2007) The phenotypic spectrum of rapidonset dystoniaparkinsonism (RDP) and mutations in the ATP1A3 gene. Brain 130:828835. Brashear A, Ozelius LJ, Sweadner KJ (2014) ATP1A3 mutations: What is the phenotype? Neurology 82:468469. Breakefield XO, Blood AJ, Li Y, Hallett M, Hanson PI, Standaert DG (2008) The pathophysiological basis of dystonias. Nat Rev Neurosci 9:222234. Budhiraja P, Budhiraja R, Goodwin JL, Allen RP, Newman AB, Koo BB, Quan SF (2012) Incidence of restless legs syndrome and its correlates. J Clin Sleep Med 8:119124. Calderon DP, Fremont R, Kraenzlin F, Khodakhah K (2011) The neural substrates of rapidonset DystoniaParkinsonism. Nat Neurosci 14:357365. Cannon SC (2006) Pathomechanisms in ch annelopathies of skeletal muscle and brain. Annu Rev Neurosci 29:387415. Cao BJ, Li Y (2002) Reduced anxiety -and depressionlike behaviors in Emx1 homozygous mutant mice. Brain Res 937:3240. Capecchi MR (1994) Targeted gene replacement. Sci Am 270:525 9. Carter RJ, Lione LA, Humby T, Mangiarini L, Mahal A, Bates GP, Dunnett SB, Morton AJ (1999) Characterization of progressive motor deficits in mice transgenic for the human Huntington's disease mutation. J Neurosci 19:32483257. Carter RJ, Morton, A.J., and Dunnett, S.B. (2001) Locomotor Behavior. In: Current Protocols in Neuroscience (Crawley J, ed). Canada: Wiley.

PAGE 102

102 Chan J, Brin MF, Fahn S (1991) Idiopathic cervical dystonia: clinical characteristics. Mov Disord 6:119126. Chiken S, Shashidharan P, Nambu A (2008) Cortically evoked long lasting inhibition of pallidal neurons in a transgenic mouse model of dystonia. J Neurosci 28:1396713977. Ciarleglio CM, Gamble KL, Axley JC, Strauss BR, Cohen JY, Colwell CS, McMahon DG (2009) Population encoding by circadian clock neurons organizes circadian behavior. J Neurosci 29:16701676. Clapcote SJ, Duffy S, Xie G, Kirshenbaum G, Bechard AR, Rodacker Schack V, Petersen J, Sinai L, Saab BJ, Lerch JP, Minassian BA, Ackerley CA, Sled JG, Cortez MA, Henderson JT, V ilsen B, Roder JC (2009) Mutation I810N in the alpha3 isoform of Na+,K+ ATPase causes impairments in the sodium pump and hyperexcitability in the CNS. Proc Natl Acad Sci U S A 106:1408514090. Clemens S, Hochman S (2004) Conversion of the modulatory action s of dopamine on spinal reflexes from depression to facilitation in D3 receptor knock out mice. J Neurosci 24:1133711345. Clemens S, Rye D, Hochman S (2006) Restless legs syndrome: revisiting the dopamine hypothesis from the spinal cord perspective. Neurology 67:125130. Connor JR (2008) Pathophysiology of restless legs syndrome: evidence for iron involvement. Curr Neurol Neurosci Rep 8:162 166. Cortese S, Konofal E, Lecendreux M, Arnulf I, Mouren MC, Darra F, Dalla Bernardina B (2005) Restless legs syndrome and attention deficit/hyperactivity disorder: a review of the literature. Sleep 28:10071013. Dang MT, Yokoi F, McNaught KS, Jengelley TA, Jackson T, Li J, Li Y (2005) Generation and characterization of Dyt1 DeltaGAG knock in mouse as a model for early onset dystonia. Exp Neurol 196:452 463. Dang MT, Yokoi F, Pence MA, Li Y (2006a) Motor deficits and hyperactivity in Dyt1 knockdown mice. Neurosci Res 56:470474. Dang MT, Yokoi F, Yin HH, Lovinger DM, Wang Y, Li Y (2006b) Disrupted motor learning an d long term synaptic plasticity in mice lacking NMDAR1 in the striatum. Proc Natl Acad Sci U S A 103:15254 15259. Dang MT, Yokoi F, Cheetham CC, Lu J, Vo V, Lovinger DM, Li Y (2012) An anticholinergic reverses motor control and corticostriatal LTD deficits in Dyt1 in mice. Behav Brain Res 226:465472.

PAGE 103

103 de Carvalho Aguiar P, Sweadner KJ, Penniston JT, Zaremba J, Liu L, Caton M, Linazasoro G, Borg M, Tijssen MA, Bressman SB, Dobyns WB, Brashear A, Ozelius LJ (2004) Mutations in the Na+/K+ ATPase a lpha3 gene ATP1A3 are associated with rapidonset dystonia parkinsonism. Neuron 43:169175. DeAndrade MP, Yokoi F, van Groen T, Lingrel JB, Li Y (2011) Characterization of Atp1a3 mutant mice as a model of rapidonset dystonia with parkinsonism. Behav Brain Res 216:659665. DeAndrade MP, Johnson RL, Unger EL, Zhang L, van Groen T, Gamble KL, Li Y (2012a) Motor restlessness, sleep disturbances, thermal sensory alterations and elevated serum iron levels in Btbd9 mutant mice. Hum Mol Genet 21:39843992. DeAndra de MP, Zhang L, Doroodchi A, Yokoi F, Cheetham CC, Chen HX, Roper SN, Sweatt JD, Li Y (2012b) Enhanced hippocampal long term potentiation and fear memory in Btbd9 mutant mice. PLoS One 7:e35518. Dobretsov M, Stimers JR (2005) Neuronal function and alpha3 i soform of the Na/K ATPase. Front Biosci 10:23732396. Dobyns WB, Ozelius LJ, Kramer PL, Brashear A, Farlow MR, Perry TR, Walsh LE, Kasarskis EJ, Butler IJ, Breakefield XO (1993) Rapidonset dystonia parkinsonism. Neurology 43:25962602. Earley CJ, Connor J R, Beard JL, Malecki EA, Epstein DK, Allen RP (2000) Abnormalities in CSF concentrations of ferritin and transferrin in restless legs syndrome. Neurology 54:16981700. Earley CJ, Hyland K, Allen RP (2001) CSF dopamine, serotonin, and biopterin metabolites in patients with restless legs syndrome. Mov Disord 16:144149. Earley CJ, Heckler D, Allen RP (2005) Repeated IV doses of iron provides effective supplemental treatment of restless legs syndrome. Sleep Med 6:301 305. Earley CJ, Hyland K, Allen RP (2006) C ircadian changes in CSF dopaminergic measures in restless legs syndrome. Sleep Med 7:263268. Earley CJ, Allen RP, Connor JR, Ferrucci L, Troncoso J (2009) The dopaminergic neurons of the A11 system in RLS autopsy brains appear normal. Sleep Med 10:11551157. Dannals RF, Allen RP (2013) Increased synaptic dopamine in the putamen in restless legs syndrome. Sleep 36:5157. Edwards RR, Quartana PJ, Allen RP, Greenbaum S, Earley CJ, Smit h MT (2011) Alterations in pain responses in treated and untreated patients with restless legs syndrome: Associations with sleep disruption. In: Sleep Med, pp 603 609.

PAGE 104

104 Erikson KM, Jones BC, Hess EJ, Zhang Q, Beard JL (2001) Iron deficiency decreases dopami ne D1 and D2 receptors in rat brain. Pharmacol Biochem Behav 69:409418. Esteves AM, de Mello MT, Lancellotti CL, Natal CL, Tufik S (2004) Occurrence of limb movement during sleep in rats with spinal cord injury. Brain Res 1017:3238. Fa M, Staniszewski A, Saeed F, Francis YI, Arancio O (2014) Dynamin 1 is required for memory formation. PLoS One 9:e91954. Ferguson SM, Brasnjo G, Hayashi M, Wolfel M, Collesi C, Giovedi S, Raimondi A, Gong LW, Ariel P, Paradise S, O'Toole E, Flavell R, Cremona O, Miesenbock G Ryan TA, De Camilli P (2007) A selective activity dependent requirement for dynamin 1 in synaptic vesicle endocytosis. In: Science, pp 570574. United States. Fiorio M, Gambarin M, Valente EM, Liberini P, Loi M, Cossu G, Moretto G, Bhatia KP, Defazio G, Aglioti SM, Fiaschi A, Tinazzi M (2007) Defective temporal processing of sensory stimuli in DYT1 mutation carriers: a new endophenotype of dystonia? Brain 130:134142. Flicek P et al. (2008) Ensembl 2008. In: Nucleic Acids Res, pp D707714. England. Frey U, Krug M, Reymann KG, Matthies H (1988) Anisomycin, an inhibitor of protein synthesis, blocks late phases of LTP phenomena in the hippocampal CA1 region in vitro. Brain Res 452:5765. Frey U, Frey S, Schollmeier F, Krug M (1996) Influence of actinomycin D a RNA synthesis inhibitor, on long term potentiation in rat hippocampal neurons in vivo and in vitro. J Physiol 490 ( Pt 3):703711. Gamble KL, Allen GC, Zhou T, McMahon DG (2007) Gastrinreleasing peptide mediates light like resetting of the suprachiasm atic nucleus circadian pacemaker through cAMP response element binding protein and Per1 activation. J Neurosci 27:1207812087. Gao X, Zhang YQ, Wu GC (2000) Effects of dopaminergic agents on carrageenan hyperalgesia in rats. European Journal of Pharmacolog y 406:5358. Gong QJ, Li YY, Xin WJ, Wei XH, Cui Y, Wang J, Liu Y, Liu CC, Liu XG (2010) Differential effects of adenosine A1 receptor on painrelated behavior in normal and nerveinjured rats. In: Brain Res, pp 2330. Grimm D (2006) Mouse genetics. A mous e for every gene. In: Science, pp 18621866. United States.

PAGE 105

105 Grundmann K, Reischmann B, Vanhoutte G, Hubener J, Teismann P, Hauser TK, Bonin M, Wilbertz J, Horn S, Nguyen HP, Kuhn M, Chanarat S, Wolburg H, Van der Linden A, Riess O (2007) Overexpression of human wildtype torsinA and human DeltaGAG torsinA in a transgenic mouse model causes phenotypic abnormalities. Neurobiol Dis 27:190206. Guo H, Hong S, Jin XL, Chen RS, Avasthi PP, Tu YT, Ivanco TL, Li Y (2000) Specificity and efficiency of Cremediated recombination in Emx1Cre knock in mice. Biochem Biophys Res Commun 273:661665. Haas M, Askari A, Xie Z (2000) Involvement of Src and epidermal growth factor receptor in the signal transducing function of Na+/K+ ATPase. J Biol Chem 275:2783227837. HabaR ubio J, Staner L, Petiau C, Erb G, Schunck T, Macher JP (2005) Restless legs syndrome and low brain iron levels in patients with haemochromatosis. J Neurol Neurosurg Psychiatry 76:10091010. Hall B, Limaye A, Kulkarni AB (2009) Overview: generation of gene knockout mice. Curr Protoc Cell Biol Chapter 19:Unit 19.12 19.12.1117. Hallett PJ, Collins TL, Standaert DG, Dunah AW (2008) Biochemical fractionation of brain tissue for studies of receptor distribution and trafficking. Curr Protoc Neurosci Chapter 1:Un it 1.16. Happe S, Zeitlhofer J (2003) Abnormal cutaneous thermal thresholds in patients with restless legs syndrome. J Neurol 250:362365. Heinzen EL et al. (2012) De novo mutations in ATP1A3 cause alternating hemiplegia of childhood. Nat Genet 44:1030103 4. Holstege JC, Van Dijken H, Buijs RM, Goedknegt H, Gosens T, Bongers CM (1996) Distribution of dopamine immunoreactivity in the rat, cat and monkey spinal cord. J Comp Neurol 376:631652. Hore SK, Dumka VK, Kumar D, Tripathi HC, Tandan SK (1997) Central noradrenergic & dopaminergic modulation of Brewer's yeast induced inflammation & nociception in rats. Indian Journal of Medical Research 105:9397. Hornyak M, Sohr M, Busse M, Groups aS (2011) Evaluation of painful sensory symptoms in restless legs syndrom e: experience from two clinical trials. Sleep Med 12:186189. Ikeda H, Heinke B, Ruscheweyh R, Sandkuhler J (2003) Synaptic plasticity in spinal lamina I projection neurons that mediate hyperalgesia. In: Science, pp 12371240.

PAGE 106

106 Ishii A, Saito Y, Mitsui J, Ishiura H, Yoshimura J, Arai H, Yamashita S, Kimura S, Oguni H, Morishita S, Tsuji S, Sasaki M, Hirose S (2013) Identification of ATP1A3 mutations by exome sequencing as the cause of alternating hemiplegia of childhood in Japanese patients. PLoS One 8:e56120. Ito Y, Tabata K, Makimura M, Fukuda H (2001) Acute and chronic intracerebroventricular morphine infusions affect long term potentiation differently in the lateral perforant path. Pharmacol Biochem Behav 70:353358. Jankovic J, Leder S, Warner D, Schwart z K (1991) Cervical dystonia: clinical findings and associated movement disorders. Neurology 41:10881091. Jankovic J (2008) Parkinson's disease: clinical features and diagnosis. J Neurol Neurosurg Psychiatry 79:368376. Kaji R, Urushihara R, Murase N, Shi mazu H, Goto S (2005) Abnormal sensory gating in basal ganglia disorders. J Neurol 252 Suppl 4:IV13IV16. Kamm C, Boston H, Hewett J, Wilbur J, Corey DP, Hanson PI, Ramesh V, Breakefield XO (2004) The early onset dystonia protein torsinA interacts with kinesin light chain 1. J Biol Chem 279:1988219892. Kaspar BK, Vissel B, Bengoechea T, Crone S, RandolphMoore L, Muller R, Brandon EP, Schaffer D, Verma IM, Lee KF, Heinemann SF, Gage FH (2002) Adenoassociated virus effectively mediates conditional gene modification in the brain. Proc Natl Acad Sci U S A 99:23202325. Kavalali ET, Chung C, Khvotchev M, Leitz J, Nosyreva E, Raingo J, Ramirez DM (2011) Spontaneous neurotransmission: an independent pathway for neuronal signaling? Physiology (Bethesda) 26:4553. Kawamoto EM, Lima LS, Munhoz CD, Yshii LM, Kinoshita PF, Amara FG, Pestana RR, Orellana AM, Cipolla Neto J, Britto LR, Avellar MC, Rossoni LV, Scavone C (2012) Influence of N methyl D aspartate receptors on ouabain activation of nuclear factor at hippocampus. J Neurosci Res 90:213228. Kerr S, McKinon W, Bentley A (2012) Descriptors of restless legs syndrome sensations. Sleep Med 13:409413. Kim DS, Szczypka MS, Palmiter RD (2000) Dopaminedeficient mice are hypersensitive to dopamine receptor agonists. J Neurosci 20:44054413. Kim KW, Jhoo JH, Lee SB, Lee SD, Kim TH, Kim SE, Kim YK, Yoon IY (2012) Increased striatal dopamine transporter density in moderately severe old restless legs syndrome patients. Eur J Neurol 19:12131218. Koehl M, Battle S, Meerlo P (2006) Sex differences in sleep: the response to sleep deprivation and restraint stress in mice. Sleep 29:12241231.

PAGE 107

107 Lauterbur P (1973) Image Formation by Induced Local Interactions: Examples Employing Nuclear Magnetic Resonance. Nature 242:190191. Lazzarini A, Walters AS, Hickey K, Coccagna G, Lugaresi E, Ehrenberg BL, Picchietti DL, Brin MF, Stenroos ES, Verrico T, Johnson WG (1999) Studies of penetrance and anticipation in five autosomal dominant restless legs syndrome pedigrees. Mov Disord 14:111116. Lein ES et al. (2007) Genomewide atlas of gene expression in the adult mouse brain. In: Nature, pp 168176. England. Levenson JM, O'Riordan KJ, Brown KD, Trinh MA, Molfese DL, Sweatt JD (2004) Regulation of histone acetylation during memory formation in the hippocampus. In: J Biol Chem, pp 4054540559. United States: 2004 American Society for Biochemistry and Molecular Biology, Inc. LeWitt PA, Galloway MP, Matson W, Milbury P, McDermott M, Srivastava DK, Oakes D (1992) Markers of dopamine metabolism in Parkinson's disease. The Parkinson Study Group. Neurology 42:21112117. Linazasoro G, Indakoetxea B, Ruiz J, Van Blercom N, Lasa A (2002) Possible sporadic rapidonset dystoniaparkinsonism. Mov Disord 17:608609. Lindsey JW, Jung AE, Narayanan TK Ritchie GD (1998) Acute effects of a bicyclophosphate neuroconvulsant on monoamine neurotransmitter and metabolite levels in the rat brain. J Toxicol Environ Health A 54:421429. Lingrel JB, Kuntzweiler T (1994) Na+,K(+) ATPase. J Biol Chem 269:19659196 62. Lingrel JB, Williams MT, Vorhees CV, Moseley AE (2007) Na,K ATPase and the role of alpha isoforms in behavior. J Bioenerg Biomembr 39:385389. Linke R, Eisensehr I, Wetter TC, Gildehaus FJ, Ppperl G, Trenkwalder C, Noachtar S, Tatsch K (2004) Presynaptic dopaminergic function in patients with restless legs syndrome: are there common features with early Parkinson's disease? Mov Disord 19:11581162. Lohmann K, Klein C (2013) Genetics of dystonia: what's known? What's new? What's next? Mov Disord 28:8999 05. Lopes C, Esteves AM, FrussaFilho R, Tufik S, de Mello MT (2012) Evaluation of periodic limb movements in a putative animal model of restless leg syndrome. Mov Disord 27:413420. Luo F, Li C, Ondo WG, Xu P, Xie W, Le W (2011) The long term effects of the dopamine agonist pramipexole in a proposed restless legs syndrome animal model. Sleep Med 12:4146.

PAGE 108

108 Mahowald MW, Cramer Bornemann MA, Schenck CH (2010) A case of reversible restless legs syndrome (RLS) and sleeprelated eating disorder relapse triggered by acute right leg herpes zoster infection: literature review of spinal cord and peripheral nervous system contributions to RLS. Sleep Med 11:583585. Manconi M, Ferri R, Zucconi M, Oldani A, Fantini ML, Castronovo V, Ferini Strambi L (2007) First night efficacy of pramipexole in restless legs syndrome and periodic leg movements. Sleep Med 8:491497. Mansour SL, Thomas KR, Capecchi MR (1988) Disruption of the protooncogene int 2 in mouse embryoderived stem cells: a general strategy for targeting mutatio ns to nonselectable genes. Nature 336:348352. Michaud M, Soucy JP, Chabli A, Lavigne G, Montplaisir J (2002) SPECT imaging of striatal preand postsynaptic dopaminergic status in restless legs syndrome with periodic leg movements in sleep. J Neurol 249: 164 170. Ming X, Walters AS (2009) Autism spectrum disorders, attention deficit/hyperactivity disorder, and sleep disorders. Curr Opin Pulm Med. Mizuno S, Mihara T, Miyaoka T, Inagaki T, Horiguchi J (2005) CSF iron, ferritin and transferrin levels in restl ess legs syndrome. J Sleep Res 14:4347. Molloy FM, Carr TD, Zeuner KE, Dambrosia JM, Hallett M (2003) Abnormalities of spatial discrimination in focal and generalized dystonia. Brain 126:21752182. Montplaisir J, Boucher S, Poirier G, Lavigne G, Lapierre O, Lesprance P (1997) Clinical, polysomnographic, and genetic characteristics of restless legs syndrome: a study of 133 patients diagnosed with new standard criteria. Mov Disord 12:6165. Moseley AE, Williams MT, Schaefer TL, Bohanan CS, Neumann JC, Behbehani MM, Vorhees CV, Lingrel JB (2007) Deficiency in Na,K ATPase alpha isoform genes alters spatial learning, motor activity, and anxiety in mice. J Neurosci 27:616626. Muller B, Hedrich K, Kock N, Dragasevic N, Svetel M, Garrels J, Landt O, Nitschke M, P ramstaller PP, Reik W, Schwinger E, Sperner J, Ozelius L, Kostic V, Klein C (2002) Evidence that paternal expression of the epsilonsarcoglycan gene accounts for reduced penetrance in myoclonus dystonia. Am J Hum Genet 71:13031311. Mller C, Wetter TC, K ster J, Stiasny Kolster K (2010) Differential diagnosis of unpleasant sensations in the legs: prevalence of restless legs syndrome in a primary care population. Sleep Med 11:161166. Nakamura H, Katayama Y, Kawakami Y (2010) Hippocampal CA1/subiculum prefr ontal cortical pathways induce plastic changes of nociceptive responses in cingulate and prelimbic areas. In: BMC Neurosci, p 100.

PAGE 109

109 Ogasawara Y, Mizukami H, Urabe M, Kume A, Kanegae Y, Saito I, Monahan J, Ozawa K (1999) Highly regulated expression of adeno associated virus large Rep proteins in stable 293 cell lines using the Cre/loxP switching system. J Gen Virol 80 ( Pt 9):24772480. Okun MS, Fernandez HH, Foote KD (2005) Deep brain stimulation of the GPi treats restless legs syndrome associated with dystonia. Mov Disord 20:500501. Ondo WG, He Y, Rajasekaran S, Le WD (2000a) Clinical correlates of 6hydroxydopamine injections into A11 dopaminergic neurons in rats: a possible model for restless legs syndrome. Mov Disord 15:154158. Ondo WG, Vuong KD, Wang Q (2000 b ) Restless legs syndrome in monozygotic twins: clinical correlates. Neurology 55:14041406. Ozelius LJ (2012) Clinical spectrum of disease associated with ATP1A3 mutations. In: Lancet Neurol, pp 741743. England. Paus S, Gross J, Moll Mller M, Hentschel F, Spottke A, Wabbels B, Klockgether T, Abele M (2011) Impaired sleep quality and restless legs syndrome in idiopathic focal dystonia: a controlled study. J Neurol 258:18351840. Peeraully T, Tan EK (2012) Linking restless legs syndrome with Parkinson's disease: clinical, imaging and genetic evidence. Transl Neurodegener 1:6. Peller M, Zeuner KE, Munchau A, Quartarone A, Weiss M, Knutzen A, Hallett M, Deuschl G, Siebner HR (2006) The basal ganglia are hyperactive during the discrimination of tac tile stimuli in writer's cramp. Brain 129:26972708. Picchietti DL, Arbuckle RA, Abetz L, Durmer JS, Ivanenko A, Owens JA, Croenlein J, Allen RP, Walters AS (2011) Pediatric restless legs syndrome: analysis of symptom descriptions and drawings. J Child Neurol 26:13651376. Pittock SJ, Joyce C, O'Keane V, Hugle B, Hardiman MO, Brett F, Green AJ, Barton DE, King MD, Webb DW (2000) Rapidonset dystoniaparkinsonism: a clinical and genetic analysis of a new kindred. Neurology 55:991995. Piero DJ, Li NQ, Conno r JR, Beard JL (2000) Variations in dietary iron alter brain iron metabolism in developing rats. J Nutr 130:254 263. Polter A, Beurel E, Yang S, Garner R, Song L, Miller CA, Sweatt JD, McMahon L, Bartolucci AA, Li X, Jope RS (2010) Deficiency in the inhibi tory serinephosphorylation of glycogen synthase kinase3 increases sensitivity to mood disturbances. Neuropsychopharmacology 35:17611774. Qu S, Le W, Zhang X, Xie W, Zhang A, Ondo WG (2007) Locomotion is increased in a11lesioned mice with iron deprivati on: a possible animal model for restless legs syndrome. J Neuropathol Exp Neurol 66:383388.

PAGE 110

110 Quinn C, Uzbeck M, Saleem I, Cotter P, Ali J, O'Malley G, Gilmartin JJ, O'Keeffe ST (2011) Iron status and chronic kidney disease predict restless legs syndrome in an older hospital population. Sleep Med 12:295301. Rizzo V, Aric I, Liotta G, Ricciardi L, Mastroeni C, Morgante F, Allegra R, Condurso R, Girlanda P, Silvestri R, Quartarone A (2010) Impairment of sensory motor integration in patients affected by RLS. J Neurol 257:19791985. Rooney KF, Sewell RD (1989) Evaluation of selective actions of dopamine D 1 and D 2 receptor agonists and antagonists on opioid antinociception. Eur J Pharmacol 168:329336. Rosewich H, Thiele H, Ohlenbusch A, Maschke U, Altmuller J Frommolt P, Zirn B, Ebinger F, Siemes H, Nurnberg P, Brockmann K, Gartner J (2012) Heterozygous denovo mutations in ATP1A3 in patients with alternating hemiplegia of childhood: a wholeexome sequencing geneidentification study. Lancet Neurol 11:764773 Ruottinen HM, Partinen M, Hublin C, Bergman J, Haaparanta M, Solin O, Rinne JO (2000) An FDOPA PET study in patients with periodic limb movement disorder and restless legs syndrome. Neurology 54:502504. Ruscheweyh R, Wilder Smith O, Drdla R, Liu XG, Sandkuhler J (2011) Long term potentiation in spinal nociceptive pathways as a novel target for pain therapy. In: Mol Pain, p 20. England. Sanger TD, Tarsy D, Pascual Leone A (2001) Abnormalities of spatial and temporal sensory discrimination in writer's cram p. Mov Disord 16:9499. Sasaki M, Ishii A, Saito Y, Hirose S (2014a) Intermediate form between alternating hemiplegia of childhood and rapidonset dystoniaparkinsonism. Mov Disord 29:153154. Sasaki M et al. (2014b) Genotypephenotype correlations in alternating hemiplegia of childhood. Neurology. Schlesinger I, Erikh I, Avizohar O, Sprecher E, Yarnitsky D (2009) Cardiovascular risk factors in restless legs syndrome. Mov Disord 24:15871592. Scholz H, Benes H, Happe S, Bengel J, Kohnen R, Hornyak M (2011) Psychological distress of patients suffering from restless legs syndrome: a cross sectional study. Health Qual Life Outcomes 9:73. Schwartzberg PL, Goff SP, Robertson EJ (1989) Germ line transmission of a c abl mutation produced by targeted gene disruption in ES cells. Science 246:799803.

PAGE 111

111 Shalin SC, Hernandez CM, Dougherty MK, Morrison DK, Sweatt JD (2006) Kinase suppressor of Ras1 compartmentalizes hippocampal signal transduction and subserves synaptic plasticity and memory formation. Neuron 50:765 779. S harma N, Baxter MG, Petravicz J, Bragg DC, Schienda A, Standaert DG, Breakefield XO (2005) Impaired motor learning in mice expressing torsinA with the DYT1 dystonia mutation. J Neurosci 25:53515355. Shashidharan P, Sandu D, Potla U, Armata IA, Walker RH, McNaught KS, Weisz D, Sreenath T, Brin MF, Olanow CW (2005) Transgenic mouse model of early onset DYT1 dystonia. Hum Mol Genet 14:125133. Staedt J, Wassmuth F, Ziemann U, Hajak G, Rther E, Stoppe G (1997) Pergolide: treatment of choice in restless legs s yndrome (RLS) and nocturnal myoclonus syndrome (NMS). A doubleblind randomized crossover trial of pergolide versus L Dopa. J Neural Transm 104:461468. Stamelou M, Edwards MJ, Hallett M, Bhatia KP (2012) The nonmotor syndrome of primary dystonia: clinical and pathophysiological implications. Brain 135:16681681. Stefansson H et al. (2007) A genetic risk factor for periodic limb movements in sleep. N Engl J Med 357:639647. Stiasny Kolster K, Magerl W, Oertel WH, Mller JC, Treede RD (2004a) Static mechanical hyperalgesia without dynamic tactile allodynia in patients with restless legs syndrome. Brain 127:773782. Stiasny Kolster K, Mller JC, Zschocke J, Bandmann O, Cassel W, Oertel WH, Hoffmann GF (2004b) Normal dopaminergic and serotonergic metabolites in cerebrospinal fluid and blood of restless legs syndrome patients. Mov Disord 19:192196. Svetel M, Ozelius LJ, Buckley A, Lohmann K, Brajkovic L, Klein C, Kostic VS (2010) Rapid onset dystoniaparkinsonism: case report. J Neurol 257:472474. Sweit zer SM, Hinshaw JE (1998) Dynamin undergoes a GTP dependent conformational change causing vesiculation. Cell 93:10211029. Tinazzi M, Frasson E, Bertolasi L, Fiaschi A, Aglioti S (1999) Temporal discrimination of somesthetic stimuli is impaired in dystonic patients. Neuroreport 10:15471550. Tinazzi M, Rosso T, Fiaschi A, Gambina G, Farina S, Fiorio SM, Aglioti SM (2002) The role of somatosensory feedback in dystonia: a psychophysical [correction of psycophysical] evaluation. Neurol Sci 23 Suppl 2:S113114. Tinazzi M, Fiorio M, Bertolasi L, Aglioti SM (2004) Timing of tactile and visuotactile events is impaired in patients with cervical dystonia. J Neurol 251:8590.

PAGE 112

112 Trenkwalder C, Seidel VC, Gasser T, Oertel WH (1996) Clinical symptoms and possible anticipa tion in a large kindred of familial restless legs syndrome. Mov Disord 11:389394. Trenkwalder C, Paulus W, Walters AS (2005) The restless legs syndrome. Lancet Neurol 4:465475. Trotti L, Bhadriraju S, Rye D (2008) An update on the pathophysiology and genetics of restless legs syndrome. Curr Neurol Neurosci Rep 8:281287. Turjanski N, Lees AJ, Brooks DJ (1999) Striatal dopaminergic function in restless legs syndrome: 18F dopa and 11C raclopride PET studies. Neurology 52:932937. Tzonova D, Larrosa O, Calvo E, Granizo JJ, Williams AM, de la Llave Y, GarcaBorreguero D (2012) Breakthrough symptoms during the daytime in patients with restless legs syndrome (Willis Ekbom disease). Sleep Med 13:151155. Verma A, Kulkarni SK (1993) Modulatory role of D 1 and D 2 dopamine receptor subtypes in nociception in mice. J Psychopharmacol 7:270275. Viggiano D, Ruocco LA, Sadile AG (2003) Dopamine phenotype and behaviour in animal models: in relation to attention deficit hyperactivity disorder. Neurosci Biobehav Rev 27:62 3 637. Walters AS (1995) Toward a better definition of the restless legs syndrome. The International Restless Legs Syndrome Study Group. Mov Disord 10:634642. Walters AS, Hickey K, Maltzman J, Verrico T, Joseph D, Hening W, Wilson V, Chokroverty S (1996) A questionnaire study of 138 patients with restless legs syndrome: the 'Night Walkers' survey. Neurology 46:9295. Watanabe T, Iwasaki K, Takasaki K, Yamagata N, Fujino M, Nogami A, Ii M, Katsurabayashi S, Mishima K, Fujiwara M (2010) Dynamin 1 depletion a nd memory deficits in rats treated with Abeta and cerebral ischemia. J Neurosci Res 88:19081917. White JK et al. (2013) Genomewide generation and systematic phenotyping of knockout mice reveals new roles for many genes. Cell 154:452464. Winkelmann J, Muller Myhsok B, Wittchen HU, Hock B, Prager M, Pfister H, Strohle A, Eisensehr I, Dichgans M, Gasser T, Trenkwalder C (2002) Complex segregation analysis of restless legs syndrome provides evidence for an autosomal dominant mode of inheritance in early age at onset families. Ann Neurol 52:297302. Winkelmann J et al. (2007) Genomewide association study of restless legs syndrome identifies common variants in three genomic regions. Nat Genet 39:10001006.

PAGE 113

113 YngmanUhlin P, Johansson A, Fernstrm A, Brjeson S, Edll Gustafsson U (2011) Fragmented sleep: an unrevealed problem in peritoneal dialysis patients. Scand J Urol Nephrol 45:206215. Yokoi F, Dang MT, Li J, Li Y (2006) Myoclonus, motor deficits, alterations in emotional responses and monoamine metabolism i n epsilonsarcoglycan deficient mice. J Biochem (Tokyo) 140:141146. Yokoi F, Dang MT, Mitsui S, Li J, Li Y (2008) Motor Deficits and Hyperactivity in Cerebral Cortex specific Dyt1 Conditional Knockout Mice. J Biochem 143:3947. Yokoi F, Dang MT, Miller CA Marshall AG, Campbell SL, Sweatt JD, Li Y (2009) Increased c fos expression in the central nucleus of the amygdala and enhancement of cued fear memory in Dyt1 DeltaGAG knock in mice. Neurosci Res 65:228235. Yokoi F, Yang G, Li J, DeAndrade MP, Zhou T, Li Y (2010) Earlier onset of motor deficits in mice with double mutations in Dyt1 and Sgce. J Biochem 148:459466. Yokoi F, Dang MT, Zhou T, Li Y (2012) Abnormal nuclear envelopes in the striatum and motor deficits in DYT11 myoclonus dystonia mouse models. Hum Mol Genet 21:916925. Yuan Z, Cai T, Tian J, Ivanov AV, Giovannucci DR, Xie Z (2005) Na/K ATPase tethers phospholipase C and IP3 receptor into a calcium regulatory complex. Mol Biol Cell 16:40344045. Zanotti Fregonara P, Vidailhet M, Kas A, Ozelius LJ, Clot F, Hindie E, Ravasi L, Devaux JY, Roze E (2008) [123I] FP CIT and [99mTc] HMPAO single photon emission computed tomography in a new sporadic case of rapidonset dystoniaparkinsonism. J Neurol Sci 273:148151. Zaremba J, Mierzewska H, Lysiak Z, Kr amer P, Ozelius LJ, Brashear A (2004) Rapidonset dystoniaparkinsonism: a fourth family consistent with linkage to chromosome 19q13. Mov Disord 19:15061510. Zarrindast MR, Moghaddampour E (1989) Opposing influences of D 1 and D 2 dopamine receptors activ ation on morphineinduced antinociception. Arch Int Pharmacodyn Ther 300:3750. Zarrindast MR, Nassiri Rad S, Pazouki M (1999) Effects of dopaminergic agents on antinociception in formalin test. General Pharmacology the Vascular System 32:517522. Zhao H, Zhu W, Pan T, Xie W, Zhang A, Ondo WG, Le W (2007) Spinal cord dopamine receptor expression and function in mice with 6OHDA lesion of the A11 nucleus and dietary iron deprivation. J Neurosci Res 85:10651076.

PAGE 114

114 Zintzaras E, Kitsios GD, Papathanasiou AA, Konitsiotis S, Miligkos M, Rodopoulou P, Hadjigeorgiou GM (2010) Randomized trials of dopamine agonists in restless legs syndrome: a systematic review, quality assessment, and metaanalysis. Clin Ther 32:221 237. Zwartbol RT, Jellema K, Boiten J, Rijsman R (2013) Acute exacerbation of restless legs due to cervical spinal cord ischaemia. BMJ Case Rep 2013.

PAGE 115

115 BIOGRAPHICAL SKETCH Mark DeAndrade was born in Montgomery, Alabama and is the youngest of three children. He graduated high school at the Alabama School of Math and Science, and attended the University of Alabama at Birmingham for his undergraduate studies. While there, Mark joined the laboratory of Dr. Yuqing Li to gain research experience. Mark fell in love wit h research and its constant pursuit to push the boundaries of knowledge, and decided to do a concurrent Master of Science while pursuing his Bachelor of Science. Upon graduation in May of 2010 with both degrees, Mark decided to continue his research endeav ors by continuing with a doctorate degree, and started the following semester. In the fall of 2010, Dr. Li was recruited to the University of Florida, and Mark quickly followed to continue his doctorate studies and research in the spring of 2011. Mark has had the opportunity to publish his research in Human Molecular Genetics PLoS ONE and Behavioural Brain Research In the spring of 2014, Mark received his PhD from the University of Florida.