Citation
Streptococcus Mutans OMZ175 Invasion of Human Tissues in Culture

Material Information

Title:
Streptococcus Mutans OMZ175 Invasion of Human Tissues in Culture
Creator:
Sampson, Edith M
Publisher:
University of Florida
Publication Date:
Language:
English

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Medical Sciences
Immunology and Microbiology (IDP)
Committee Chair:
PROGULSKE,ANN
Committee Co-Chair:
BURNE,ROBERT ARTHUR,JR
Committee Members:
GRIESHABER,SCOTT STEPHEN
LUCAS,ALEXANDRA ROSE
DUNN,WILLIAM A,JR
Graduation Date:
5/3/2014

Subjects

Subjects / Keywords:
Antibiotics ( jstor )
Apoptosis ( jstor )
Atherosclerosis ( jstor )
Bacteria ( jstor )
Cell growth ( jstor )
Cells ( jstor )
Diseases ( jstor )
Endothelial cells ( jstor )
Infections ( jstor )
Streptococcus mutans ( jstor )
atherosclerosis
cardiovascular
cnm
invasion
streptococcus

Notes

General Note:
Studies suggest that Streptococcus mutans, an etiological agent of dental caries, may be associated with cardiovascular disease. Our model organism, S. mutans OMZ175, expresses the collagen binding protein Cnm, a virulence factor for invasion, and has been shown to invade human coronary artery endothelial cells (HCAEC) in culture, and to lead to cardiovascular disease in an atherogenic mouse model. The purpose of this study was to gain a better understanding of S. mutans pathogenesis by determining the host tissue tropism, invasion cycle, and the ability of this organism to replicate intracellularly. Furthermore, the effects of invasion on host gene expression and the fate of HCAEC after infection were investigated. It was found that S. mutans invades oral and cardiovascular tissues and remains infectious upon exiting the host cell. No evidence was found to indicate that S. mutans replicates intracellularly; however, S. mutans persisted for >30 h post-infection. Upon infection, HCAEC underwent a change in gene expression, as determined by microarray analysis, indicative of endothelial dysfunction. Key findings include down regulation of genes involved in apoptosis in infected HCAEC and up-regulation of growth factors indicative of angiogenesis. This finding is contrary to the expectation of S. mutans as an organism that disseminates by sepsis. The results of this study support the hypothesis that strains of S. mutans with Cnm possess the pathogenic characteristics (tropism, cycling, persistence) required to transition from an oral site of infection to cardiovascular tissue infection.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Sampson, Edith M. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
5/31/2016

Downloads

This item has the following downloads:


Full Text

PAGE 1

STREPTOCOCCUS MUTANS OMZ175 INVASION OF HUMAN TISSUES IN CULTURE By EDITH MARION SAMPSON A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGR EE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2014

PAGE 2

201 4 Edith Marion Sampson

PAGE 3

To my family

PAGE 4

4 ACKNOWLEDGMENTS I thank my husband, children, and extended family for their support I thank my colleague and partner in science, Dr. Priscilla Phillips, for daring me to chase after my dreams I thank Dr s. Paulette Robinson, Leti ci a Reyes and Brian Bainbridge for their support and kindness. I thank the APF laboratory past and present lab members, including Jacob Burks, Joan Whitlock, Amandeep Chadda, Dr. Amanda Barrett, and Ryan ChastainGross for their support and friendship. I thank my undergraduate research assistants especially Ionut Johnny Albu, Bryce Bergeron, Whitney Swonger, Meaghan Foti and Maria Zimmerman for their time and attention to detail. I thank my mentor Dr. Ann ProgulskeFox, for her example of a successful academic scientist and for guiding me through thoughtful conversation and constructive criticism I thank my committee for their high expectations and guidance: Dr. Bill Dunn for his criticism and guidance dur ing lab meetings on my research; Dr. Bob Burne for sharing his knowledge on streptococci and asking hard questions ; Dr. Alex Lucas for sharing her knowledge of the car diovascular system and cardiovascular research; and Dr. Scott Grieshaber for his assistance with confocal microscopy and criticism of the literature and my data. I thank our collaborators Dr. Henry Baker and Cecilia Lopez for completing the microarray chemistry and data analysis, and I thank Dr. Jacqueline Abranches James Miller, and Dr. Jeanne Brady for sharing bacterial strains specimens reagents, and ideas. I would like to thank Karen Kelley Kim Backer Kelley and Neal Benson at the ICBR core facilities. Finally I would like to thank the Oral Biology T32 DE 007200 Training Grant and the Basic Microbiology and Infectious Diseases (BMID) T32 AI 711029 Training Grant for the financial support to complete this work

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................. 4 LIST OF TABLES ............................................................................................................ 7 LIST OF FIGURES .......................................................................................................... 8 LIST OF ABBREVIATIONS ........................................................................................... 10 ABSTRACT ................................................................................................................... 13 CHAPTER 1 LITERATURE REVIEW .......................................................................................... 15 Introduction ............................................................................................................. 15 Streptococcus mutans ............................................................................................ 17 S. mutans and the Oral Cavity ................................................................................ 23 S. mutans and Cardiovascular Disease .................................................................. 27 Circulatory System ........................................................................................... 36 Arteries ............................................................................................................. 36 Endothelial Cells ............................................................................................... 37 PathogenHost Interaction ...................................................................................... 40 Summary ................................................................................................................ 42 2 STREPTOCOCCUS MUTANS OMZ175 INVASION OF HUMAN ORAL AND CARDIOVASCULAR CELLS .................................................................................. 49 Introduction ............................................................................................................. 49 Materials and Methods ............................................................................................ 52 Cell Culture ....................................................................................................... 52 Bacterial Culture ............................................................................................... 53 At tachment Assay ............................................................................................ 53 Antibiotic Protection Assays ............................................................................. 54 Transmission Electron Microscopy (TEM) ........................................................ 55 Relative Real Time PCR .................................................................................. 56 Host Cell Cycling .............................................................................................. 58 Bacterial Intercellular Spreading ....................................................................... 59 Gene Expression Analysis ................................................................................ 59 Statistical Analysis ............................................................................................ 61 Results .................................................................................................................... 61 S. mutans OMZ175 Invades Human Oral Cells in Culture. .............................. 61 S. mutans Does Not Replicate Intracellularly. .................................................. 63 Intracellular S. mutans Exit the Host and Remain Infectious. ........................... 65

PAGE 6

6 Cnm Affects the Expression of Endothelial Cell Cytoskeleton Linked Proteins. ........................................................................................................ 66 S. mutans OMZ175 Invades Human Coronary Artery Smooth Muscle Cells. ... 67 Discussion .............................................................................................................. 68 3 GENE EXPRESSION CHANGES IN HCAEC DURING INFECTION WITH STREPTOCOCCUS MUTANS OMZ175 ................................................................ 92 Introduction ............................................................................................................. 92 Materials and Methods ............................................................................................ 95 Preparation of Confluent Human Cells in Culture. ............................................ 95 Bacterial Culture ............................................................................................... 95 Gene Expression Analysis ................................................................................ 95 RT2 Profiler PCR Array ................................................................................. 97 RT PCR Validation ........................................................................................... 97 Enzyme Linked Immunosorbant Assay (ELISA) ............................................... 98 Caspase Activity Assay .................................................................................... 99 Assays to Determine the Ratio of Necrosis/Apoptosis ..................................... 99 Microscopy Analysis o f Apoptosis .................................................................. 100 FACS Analysis of Apoptosis ........................................................................... 101 Results .................................................................................................................. 101 Micro array Summary ...................................................................................... 101 Ontology Analysis ........................................................................................... 102 RT PCR Validation of Microarray ................................................................... 103 Cytokines ........................................................................................................ 103 Cytoskeletal Elements and Adhesion Molecules ............................................ 105 Apoptosis ........................................................................................................ 107 Discussion ............................................................................................................ 110 4 DISCUSSION AND FUTURE DIRECTIONS ........................................................ 140 General Summary and Discussion ....................................................................... 140 Route from Oral Cavity to Cardiovascular Tissues ......................................... 140 Mechanisms of Dissemination ........................................................................ 142 Endothelial Response to S. mutans Infection ................................................. 142 Future Work .......................................................................................................... 144 Introduction ..................................................................................................... 144 Entry and Intracellular Trafficking ................................................................... 145 Role of Cnm in S. mutans Entry ..................................................................... 146 Summary ........................................................................................................ 147 APPENDIX: MICROARRAY EXPRESSION DATA AND KEGG PATHWAYS ............ 148 LIST OF REFERENCES ............................................................................................. 166 BIOGRAPHICAL SKETCH .......................................................................................... 194

PAGE 7

7 LIST OF TABLES Table page 1 1 Summary of common characteristics in the genus Streptococcus ................... 44 1 2 Mutans Group Characteristics ............................................................................ 47 1 3 Fast facts about S. mutans ................................................................................. 48 2 1 S. mutans strains used in this study ................................................................... 75 2 2 Microarray differential gene expression in HCAEC due to Cnm interactions 1 h post infection ................................................................................................ 75 3 1 Lis t of primers used in this study ...................................................................... 119 3 2 Supervised analysis of pairwise comparisons .................................................. 119 3 3 Ontology analysis of endothelial cel l pathways impacted by infection with S. mutans OMZ175 over time ........................................................................... 120 3 4 Gene expression changes of growth factor receptors and ligands 5 h post infection with S. mutans OMZ175 compared to uni nfected control (p< 0.001) 121 3 5 Microarray gene expression changes of chemokines and cytokines 5 h post infection with S. mutans OMZ175 compared to uninfected control (p< 0.001) 122 3 6 Differential expression of genes involved in actin cytoskeleton organization, vesicle transport, cell proliferation, migration, and survival of HCAEC ............. 124 3 7 Microarray gene expression changes of leukocyte adhesion molecules 5 h post infection with S. mutans OMZ175 compared to uninfected control ........... 127 3 8 Human RT2 Profiler PCR array of adhesion molecule gene expression ....... 127 3 9 Microarray gene expression changes of genes involved in apoptotic pathways .......................................................................................................... 128 A 1 Microarray gene expression changes of genes with fold changes greater than 2 fold ................................................................................................................. 148 A 2 Microarray gene expression changes of genes with fold reductions less than 2 fold ............................................................................................................... 156

PAGE 8

8 LIST OF FIGURES Figure page 2 1 S. mutans attached and intracellular A) HOK and B) HGF 1 .............................. 76 2 2 Electron micrograph of HGF 1 invasion by S. mutans OMZ175 after 2 h of infection .............................................................................................................. 77 2 3 Electron micrograph of S. mutans OMZ175 invasion of HGF 1 .......................... 78 2 4 Electron micrograph of uninfected HGF 1 .......................................................... 79 2 5 Intracellular S. mutans OMZ175 growth curve.................................................... 80 2 6 Molecular methods to measure bacterial replication over time using RT PCR ... 81 2 7 Sequential antibiotic protection assays to determine if host cell passaged S. mutans remain viable and infec tious .............................................................. 82 2 8 Micrographs of sequential antibiotic protection assays to determine if HCAEC passaged S. mutans remain viable and infectious .............................................. 83 2 9 S. mutans A) attachment and B) invasion of CASMC ......................................... 8 4 2 10 Electron micrograph of CASMC invasion by S. mutans OMZ175 after 2 h of infection .............................................................................................................. 85 2 11 Electron micrograph of S. mutans OMZ175 invasion of CASMC after 2 h infection .............................................................................................................. 86 2 12 Electron micrograph of uninfected CASMC ........................................................ 87 2 13 Molecular methods to measure bacterial replication over time using RT PCR ... 88 2 14 Reservoir Model: Oral Tissue ............................................................................. 89 2 15 Overview of S. mutans invasion of human tissues ............................................. 90 2 16 Invasion Cycle Model: Cardiovascular Tissue .................................................... 91 3 1 Hierarchical clustering of variancenormalized gene expression data .............. 129 3 2 RT PCR validation of microarray results .......................................................... 130 3 3 Enzyme linked immunosorbant assays to measure the levels of VEGF A) and PDGF B) in HCAEC lysates and conditioned media 24 h post infection with S. mutans ......................................................................................................... 131

PAGE 9

9 3 4 Enzyme linked immunosor bant assays to measure the levels of A) IL1A, B) IL1B; C) IL6; and D) IL8 in culture conditioned media 5 and 24 h post infection with S. mutans .................................................................................... 132 3 5 Caspase 3/7 activity to determine activation of the apoptotic pathway presented as a percent of the uninfected HCAEC control ................................ 133 3 6 Flow cytometric analysis of HCAEC fate during infection with S. mutans OMZ175 over time ............................................................................................ 134 3 7 Percentage of HCAEC among the four fate groups as determined by flow cytometry after infection with S. mutans OMZ175 over time ............................ 135 3 8 Flow cytometric analysis of HCAEC fate after infection with S. mutans OMZ175 at MOI = 1 and MOI = 100 ................................................................. 136 3 9 Percentage of HCAEC among the four fate groups as determined by flow cytometry after infection with S. mutans OMZ175 ............................................ 137 3 10 Microscopic analysis of HCAEC to differentiate between apoptosis, necrosis, and healthy cells 5 h post infection with S. mutans OMZ175 ........................... 138 3 11 Percentage of HCAEC among the fate groups as determined by microscopy after 5 h infection with S. mutans ...................................................................... 139

PAGE 10

10 LIST OF ABBREVIATION S ASVD Atherosclerotic vascular disease oC Degrees Celsius CASMC Coronary artery smooth muscle cell Cbm Collagen binding motif CD Cluster of differentiation CFU Colony forming units Cnm C old agglutination negative mutant CO2 Carbon dioxide CSP Complement stimulating peptide DMEM Dulb ecco's Modified Eagle Medium DNA Deoxyribonucleic acids dTDP Deoxythymidine diphosphate gDNA Genomic deoxyribonucleic acids EPS E xtrapolymeric substance Fc receptor Eukaryotic immune cell surface protein that binds to the fragment crystallizable region (Fc region) of antibodies GAG Glycosaminoglycan GAS Group A streptococci GTF Gluco syltransferase h H ours HBSS Hanks buffered saline solution HCAEC Human coronary artery endothelial cell HGF 1 Human gingival fibroblast 1 HOK Human oral keratinocyte

PAGE 11

11 ICBR Inter disciplinary Center for Biotechnology Research a researc h support center for University of Florida IL Interleukin l Liter LDH Lactate dehydrogenase LDL Low density lipid M Molarity MEROPS Peptidase database mg Milligram min Minutes ml M illiliter mm Millim eter mM M illimolarity ORF Open reading frame PBS Phosphate buffered saline without calcium and magnesium PCR Polymerase chain reaction PD Periodontal disease pH Negative base10 logarithm of the m olar concentration of hydrogen ions in a solution pKa Negati ve base10 logarithm of the acid dissociation constant in a solution RGP Rhamnose glucose polymers RNA Ribonucleic acids rRNA Ribosomal ribonucleic acids rt room temperature TH T helper cells

PAGE 12

12 TNF Tumor necrosis factor UDP Uridine diphosphate x g Relative c entrifugal f orce 16S rRNA C omponent of the 30S small subunit of prokaryotic ribosomes 1 8 S rRNA C omponent of the 40S small subunit of eukaryotic ribosomes g Microgram l Microliter m Micrometer M Micromolarity

PAGE 13

13 Abstract of Dissertation Presented to t he Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy STREPTOCOCCUS MUTANS OMZ175 INVASION OF HUMAN TISSUES IN CULTURE By Edith Marion Sampson May 2014 Chair: An n ProgulskeFox Major: Medical Sciences Immunology and Microbiology S tudies suggest that Streptococcus mutans an etiological agent of dental caries, may be associated with cardiovascular disease. Our model organism, S. mutans OMZ175, expresses the col lagen binding protein Cnm, a virulence factor for invasion, and has been shown to invade human coronary artery endothelial cells (HCAEC) in culture, and to lead to cardiovascular disease in an atherogenic mouse model The purpose of this study was to gain a better understanding of S. mutans pathogenesis by determining th e host tissue tropism, invasion cycle, and the ability of this organism to replicate intracellularly. Furthermore, the effects of invasion on host gene expression and the fate of HCAEC after infection were investigated. It was found that S. mutans invades oral and cardiovascular tissues and remains infectious upon exiting the host cell. N o evidence was found to indicate that S. mutans replicates intracellularly ; however, S. mutans persisted f or >30 h post infection Upon infection HCAEC under went a change in gene expression as determined by microarray analysis, indicative of endothelial dysfunction. Key findings include down regulation of genes involved in apoptosis in infected HCAEC and up regulation of growth factors indicative of angiogenesis This finding is contrary to the expectation of S. mutans as an organism

PAGE 14

14 that disseminates by sepsis. The results of this study support the hypothesis that strains of S. mutans with Cnm possess the pathogenic characteristics (tropism, cycling, persistence) required to transition from an oral site of infection to cardiovascular tissue infection

PAGE 15

15 CHAPTER 1 LITERATURE REVIEW Introduction Cardiovascular diseases such as hypertension and atherosclerosis are a heterogeneous group of conditions that are the leading cause of death in the United States and in developed countries [ 1 2 ] However, classic risk factors such as obesity and physical inactivity do not account for all cases [ 3 5 ] For example, almost 25 % and 15 % of coronary deaths in males and females, respectively, occur in persons in the lowest two quintiles of the multivariate Framingham Heart Study risk scores [ 6 ] These and other epidemiological studies have led to the hypothesis of an infectious theory of atherosclerosis, which suggests that a chronic inflammatory response leading to atheros clerosis is caused by a localized infection [ 7 8 ] A significant list of epidemiological studies provides evidence for an association between cardiovascular disease and oral infectious diseases [ 9 20 ] Other studies have shown an association between oral infecti ous diseases and inflammatory factors such as C reactive protein, tissue plasminogen activator TNF (tumor necrosis factor) and low density lipid (LDL) cholesterol in relation to cardiovascular diseases [ 21 24] In addition to the data indicating an epidemiological relationship between oral infectious disease s and cardiovascular disease, there is experimental evidence for such a relationship including histol ogical and/or genomic DNA detection of oral pathogens such as Streptococcus mutans Bacteroides forsythus Porphyromonas gingivalis Aggregatibacter actinomycetemcomitans and Prevotella intermedia in atheromas dissected from human vascular tissues [ 9 10 25, 26] Furthermore, l ive P. gingivalis and A. actinomycetemcomitans have been recovered from excised atheromatous

PAGE 16

16 human tissues [ 11 27 ] A nimal studies also provide evidence for a role for oral pathogens in cardiovascular disease. For instance, S mutans and P. gingivalis w ere found to accelerate atherosclerosis in an apolipoprotein E null mouse as evidenced by increased atherosclerotic plaque formation and express ion of innate immune response markers in the aortic tissue s of infected animals [ 2831 ] The curre nt American Heart Association (AHA) stance on the role of periodontal disease (PD) pathogens in atherosclerotic vascular disease (A SVD) was published in April 2012 in Circulation, a journal of the AHA [ 12] In this scientific statement, the AHA states that 1) Observational studies to date support an association between PD and ASVD independent of known confounders, and 2) Although periodontal interventions re sult in a reduction in systemic inflammation and endothelial dysfunction in short term studies, there is no evidence that they prevent ASVD or modify its outcomes. However, the AHA also states that there are potential associations between PD and ASVD as supported by multiple randomized clinical trials or metaanalyses (Level of Evidence A). Specifically, they state that 1) An association between PD and ASVD is supported by evidence that meets standards for Level of Evidence A and 2) A benefit of periodontal intervention in decreasing local periodontal inflammation is also supported by level A evidence; however, Causation of ASVD by PD is not supported. While S. mutans is generally characterized as a dental caries pathogen and not a periodontal pathoge n, the statement published by the AHA includes data reporting the identification of S. mutans DNA within human atherosclerotic plaque and heart valve specimens at higher frequency than other bacteria (74 % and 69 % of specimens, respectively) Such studies have been the rationale for investigating the potential of S. mutans in the

PAGE 17

17 development or exacerbation of ASVD. This chapter will be focused on reviewing the association of an oral pathogen S. mutans with cardiovascular diseases and the related pathologi cal states. S treptococcus mutans The human oral cavity has over 7 00 species of bacteria in subgingival plaque that have been identified using 16S r ibosomal RNA (rRNA) gene sequenc es though only about two thirds of the oral microbiota have been cultivated [ 3234 ] In prokaryotes the hypervariable regions of 16S rRNA genes (a highly conserved ribosomal component of the 30S small subunit of prokaryotic ribosomes) i mpart species specific signature sequences ; consequently, polymerase chain reaction (PCR) techniques can be used as a tool to identify/ distinguish between bacterial species [ 35] Or al biofilms are initiated through attachment of colonizer bacteria to the host soft and hard tissues, colonized through cell to cell interactions and coadhesion via an acquired pellicle. The oral bacterial community is established after birth with the intr oduction of the early coloniz ing species ( e.g., Streptococcus and Actinomyces) followed by late colonizers ( e.g., Prevotella Fusobacterium and Selenomonas ) acquired after tooth eruption [ 3639 ] Of 37 known genera of bacteria found in the oral cavity, there are 18 genera isolated most frequently from dental plaque, which associate through cell surfaceassociated adherence proteins [ 40 41] Cellto cell interaction is thought to be a property of essentially all oral bacteria and that the various bacterial adhesins recognize glycoprotein, protein, or polysaccharide receptors found on human oral and bacterial cell surfaces [ 40 ] The numerous interactions that can occur bet ween multiple surfaces and cell types is thought to afford late colonizers the same advantages of colonization

PAGE 18

18 as the early colonizers [ 40] It has been shown that 47 % 85 % of the cultivable cells isolated 4 h after a professional dental cleaning are of the G enus Streptococcus S. mutans is a member of the phylum Firmicutes, Class Bacilli, Ord er Lactobacillales, and Family Streptococcaceae. According to Berg e ys Manual of Systematic Bacteriology [ 42] the genus Streptococcus contains over 50 different species. Streptococcus species have been classified classically based on the Lancefield scheme according to cell surface antigens ( e.g., carbohydrates and teichoic acids ) blood hemolytic prop erties biotyping, and more recently into species groups according to 16S r RNA sequence ( e.g., Pyogenic, Bovis, Mitis, Anginosus, Salivarius, and Mutans). O ral streptococci (viridans streptococci) are divided into five groups: Mutans, Anginosus, Salivarius, Sanguinis, and Mitis [ 43 ] and do not include any members of the Pyogenic or Bovis groups, and generally, neither the species S. pneumoniae, S. thermophilus S. suis or S. acidominimus Members of this genus have characteristic features (Table 11 ). Most notably, the bacteria are nonmotile, Gram positive microorganisms with a coccoid morphology and found in chains or pairs. The cell wall consists mainly of peptidoglycan, carbohydrates, teichoic acids, and protein antigens. Some species form capsules which protect against the host immune response ( e.g., phagocytosis). A dhesins expressed on the cell surface are essential for colonization and confer the ability to attach to certain host proteins and carbohydrates that compose saliva, serum, glycocalyx, extracellular matrix, and basement membrane components (reviewed in Nob bs et al [ 44] For instance, species in the Mutans group bind to salivary glycoproteins via species specific adhesi ns, which facilitate attachment to the salivary pellicle on tooth surfaces. T he majority of streptococci are catalase

PAGE 19

19 negative, facultative anaerobes that ferment a wide variety of carbohydrates to lactic (major bi product), acetic, or formic acids, ethanol and CO2. Most streptococci are commensal organisms of the oral cavity, upper respiratory tract, and gastrointestinal tract of mammals and birds; however, some strains are animal pathogens or opportunistic pathogens causing systemic and localized infections S. mutans is one of the six primary members included in the Mutans group based on 16S rRNA sequence similarity and is typically located within the dental plaque of humans and other animals (Table 1 2). Basic characteristics of S. mutans strains are pro vided in Table 1 3. S. mutans grows in chains without a capsule and can be coccoid or rod shaped, depending on the growth conditions. The colonies on blood agar tend to be small, circular and irregularly shaped ( approximately 0.5 1.0 mm in diameter) and grow into the media, pitting the surface of the agarose. Optimal growth is obtained at 37 oC in air containing 5 % CO2. One interesting characteristic of S. mutans is its adaptive ability to grow optimally (with respect to glucose uptake and glycolysis) at a wide pH range (5.1 7.5) by a mechanism of generating intracellular pH gradients [ 45 ] Many strains are naturally competent, though some strains are more efficient at transformation than others [ 46 ] V irulence factors for S. mutans include: 1) environmental sensing [ 44] 2) acidogenicity [ 47] 3) stress tolerance [ 48] 4) a dherence to host cells and components [ 44] 5) and biofilm production [ 49 ] S. mutans is a master at resource acquisition able to sense and respond to changes in its environment, devoting nearly 15 % of the genome to trans port [ 50 ] S. mutans metabolizes a greater variety of carbohydrates than any other known sequenced Gram positive organism, and the fermentation of sugars is the m ain source

PAGE 20

20 of energy production [ 50 ] For example, S. mutans ferments a wide variety of sugars including: glucose, fructose, sucrose, lactose, galactose, mannose, D glucosides, trehalose, maltose/maltodextrin, raffinose, ribulose, melibiose starch, isomaltosaccharides, sorbose, and sugar alcohols mannitol and sorbitol [ 42 ] True to its genus, the major end product of glucose fermentation is lactic acid when cultured under aerobic conditions and its ability to produce acid and survive in an acidic environment contribute to its pathogenicity [ 48, 50, 51] In addition to carbohydrate acquisition and utilization, the MEROPS p eptidase database [ 52, 53] predicts 66 putative peptidases and 20 other proteins ; each of the other 20 proteins could be placed in a peptidase family based on sequence homology except that one or more of the catalytic residues is lacking Among the identified peptidases are those predicted to degrade host extracellular matrix proteins, inactivate host immune proteins, or cleave transmembrane proteins The tricarboxylic acid cycle is incomplete in this organism and postulated t o be used to produce amino acid precursors as S. mutans contains all of the amino acid biosynthetic pathways [ 50] The metabolic diversity of S. mutans not only provides it with a competitive advantage over other oral microbes, fermentative byproducts (such as lactic acid) produced by S. mutans lower the pH of the oral cavity inhibiting the growth of many competing microbial species [ 38, 48, 50] Besides the abilities to acquire and metabolize a wide variety of subst rates, S. mutans uses a number of strategies to colonize the oral cavity. Streptococci are found in different tissues and locations in the human body in part due to a variety of adhesins on the cell surface that facilitate biofilm formation. Biofilm can be described as bacteria irreversibly attached to a surface (viable or nonviable) and embedded in an

PAGE 21

21 extrapolymeric substance (EPS) composed of polysaccharides, proteins, glycolipids, and extracellular DNA (eDNA) [ 5456] Biofilm structures are produced through a series of sequential steps characterized by: 1) reversible adherence of planktonic bacteria to a surface; bacterial replication; small colony aggregates [ 55, 57] ; 2) irreversible adherence; communication through quorum sensing [ 58 ] ; gene expression changes to cope with environmental changes such as nutrient and oxygen limitations; phenotypic differentiation by becoming m etabolically sessile [ 55, 5860 ] ; 3) production of EPS [ 56 ] ; formation of complex structures [ 54] ; tolerance to antibiotics, biocides, antis eptics, and disinfectants [ 61 62 ] ; protection from host immune factors ( e.g., phagocytosis, antibodies, def ensins, complement) [ 59] ; cooperative ecology [ 57] S. mutans accomplishes the above steps by first adher ing to surfaces and other microbes through both sucrose independent and sucrose dependent mechanisms [ 44 63 ] S. mutans a dherence to hard and soft tissues in the oral cavity, which can be in dependent of the presence of sucrose, is accomplished via the expression of adhesins on the bacterial surface. One such adhesin is P rotein A ntigen c ( PAc ) an important adhesi n that facilitat es both attachment to host cells and surfaces as well as bacterial auto aggregation, co aggregation and coadhesion [ 44, 50 64 65 ] Aliases for PAc reported in the literature include Ag I/II, P1, SpaP, B, SR, MSL 1, and IF. A s a member of the antigen ( Ag ) I/II family, PAc contains multiple domains which mediate binding to tooth surfaces, extracellular matrix, serum, and saliva components such as collagen, fibronectin, fibrinogen, and glycoprotein 340 (reviewed in Brady et al [ 66] ) Other strain specific S mutans adhesins are wall associated antigen A (WapA) and collagen binding proteins (Cnm and Cbm). WapA is a protein adhesin involved in cell to cell aggregation

PAGE 22

22 and biofilm production [ 44 ] and Cnm ( c old agglutinationn egative m utant with respect to its phenotype after mutation) and Cbm ( c ollagen b inding m otif) are protein adhesins that mediate cell to cell as well as cell to host extracellular matrix and basement membrane attachment [ 67, 68 ] In addition to protein ant igens, the cell wall serotype specific polysaccharides, rhamnose glucose polymers, also facilitate bacterial attachment to host tissues [ 69] When grown in the presence of sucrose, S. mutans produces water insoluble sugar polymers, (1,3) and (1, 6) glucans and (2,1) and (2,6) fructans, which promote bacterial attachment, aggregation, and biofilm formation in addition to serving as an external food source. Glucosyltransferases and fructosyltransferases extracellularly convert sucr ose into glucans or fructans, respectively. Glucan binding proteins are virulence factors of dental caries and mediate glucandependent aggregation [ 40] Furthermore, glucans contribute to biofilm structures in a sucrose dependent manner, as S. mutans product ion of cell wall anchored or excreted glucan binding proteins facilitate cell to cell and cell to host interactions ( for r ev iew see reference [ 63 ] ) Thus, it may also function as a potential virulence factor for attachment to host cells. There are 4 strain specific glucan binding proteins (GbpA, GbpB, GbpC, GbpD) that function in biofilm structure, peptidoglycan synthesis, bacterial aggrega tion, and plaque cohesion, respectively. Other exoenzymes involved in extracellular sucrose metabolism are dextranase and fructase. acid generation and water insolubility. fructan hydrolases, which release fructose from plaque fructans contributing to the

PAGE 23

23 duration of an acid challenge. The next section will discuss the pathological consequences of S. mutans dental plaque on oral cavity health. S mutans and the Oral Cavity The oral cavity or mouth contains tissues and structures that permit humans to taste swallow, and chew food, as well as, speak. Some oral structures include the tongue, teeth, s upporting tissues of the teeth ( e.g., periodontal ligament and cementum), oral mucosa ( e.g., gingiva and salivary glands), and jaw bones. Though preventable with prescribed oral hygiene practices, b acterial oral infections are a common health problem and w hen left untreated can result in severe pain and mortality. T wo common oral infectious diseases include dental caries and gum disease ( e.g., gingivitis and periodontitis ) Because the primary etiological agents differ for these diseases, it is possible to develop these diseases independently [ 70] However, bacterial colonization of the oral cavity important for the establishment of these diseases generally progresses in a similar manner through the formation of polymicrobial biofilm, otherwise known as dental plaque (reviewed in Kolenbrander et al. in [ 71 ] ). Dental plaque initiation begins with the attachment of early coloniz ing bacteria to the tooth pellicle (predominately facultative anaerobic Gram positive cocci) followed by secondary colonizers ( facultative anaerobic Gram positive and negative r ods) and then late colonizers ( anaerobic Gram negative motile rods) Dental plaque initially forms above the gingiva (supragingival plaque) and may lead to the formation of carious lesions, as well as, progress to the gingival crevice eliciting an inflamm atory response. Once the gingival tissues become inflamed, gingivitis is established and manifested clinically through the bleeding of gingival tissues. When gingivitis goes untreated or treatment is prolonged, periodontitis may develop, which is histologi cally characterized

PAGE 24

24 by the recession of the junctional epithelial attachment to the tooth, deepening of the gingival crevice, and degradation of connective tissue and alveolar bone [ 72 ] In the beginning stages of periodontal disease, gingival epithelial cells ( e.g., gingival junctional, sulcus, and keratinocytes ) are exposed to subgingival plaque and respond by producing chemokines and cytokines that attrac t and activate gingival fibroblasts, neutrophils and T cells [ 7275 ] As a consequence of immune activation, the gingival tissues become engorged with ser um due to the increased permeability of the blood vessels. The leakiness of the blood vessels provides oral bacteria a route to the circulatory system. In the later stages of disease progression, ulcers develop, breaching the continuity of the epithelial l ayer and exposing the underlying connective tissue. The development of ulcers provides bacteria further access to the blood stream [ 72 ] Though S. mutans i s typically associated with supragingival plaque and dental caries there is no doubt that it gains access to the circulatory system as it is a causative agent of endocarditis. Dental caries is an infectious and transmissible disease that is dependent on diet [ 38] since a diet rich in fermentable carbohydrates (like s ucrose) is necessary for the initiation and progression of caries [ 38] According to the National Center for Health Statistics, 92% of adults between the ages of 20 and 64 have had dental caries; more than 20 % of the United States population has untreated caries, and 23 % of adults over the age of 65 are edentulous [ 76 ] S. mutans is the prototypic caries pathogen because of its ability to form biofilm through sucrose independent and dependent adherence, produce acid, and tolerate an acidic environment [ 48 ] However, S. mutans colonization does not necessarily result in caries formation (reviewed in these

PAGE 25

25 references [ 38 44, 77] ). A bacterial load of > 106 S. mutans in a milliliter of stimulated saliva is a clinical indicator of future caries, and antimicrobial therapy is recommended before orthodontic treatments, such as, the placement of dental devices or restorations ( e.g., dental crowns, bridges, and braces) [ 70 ] This section will focus on the role of S. mutans in dental caries. The amount of damage done to the tooth during a carbohydrate challenge is dependent upon the depth and duration of plaque acidification (pH modeling of dental plaque reviewed in this reference [ 78 ] ).One way to describe cha nges in plaque acidity (measured from saliva specimens) over time is the use of "Stephan Curves". First described in 1943 by Robert Stephan, Stephan Curves predict whether an oral environment is conducive to dental caries formation following a carbohydrate challenge, as solubilization of enamel increases exponentially as the pH in the oral cavity drops [ 79, 80] Carious lesions usually develop slowly from repeated cycles of acidification and alkalinization of oral biofilms. Extended periods of low pH exposure influence the oral microbiome by selecting for acid tolerant organisms. Less acid tolerant organisms maintain a relatively alkaline environment through the production of ammonia and other high pKa chemicals and when the pH is lowered they begin to be eliminated or poorly represented. T he ability of S. mutans to lower the pH and survive in an acidic environment provides an advantage over acid sensitive commensal organisms [ 70] S. mutans produces multiple s ucr a se enzymes which catalyze the hydrolysis of sucrose to intra and extracellular glucose and fructose and extracellular glucose and fructose polymer s, which fac ilitate biofilm formation [ 81 ] When s ucrose is available to S. mutans it is ferment ed rapidly to lactic acid, and the pH of dental plaque is reduced

PAGE 26

26 to a pH of 5 or lower [ 82] When the dental plaque pH drops below 5.0 for prolonged periods of time (s ustained by between meal carbohydrate snacks), the buffering and mineral replenishing capacity of saliva is diminished and prolonged localized acid production results in the loss of calcium and phosphates from the external tooth enamel resulting in eventual tooth cavitation [ 38] Shallow compared to deep carious lesions contain different concentrations of bacterial species and elicit different types of T helper (TH1 or TH2) cell mediated immune responses. The type of immune response is driven by the cytokine profile that exists within the lesion. A TH1 or type 1 response is primarily characterized by the recruitment and activation of cluster of differentiation 8 positive ( CD8+ ) cytotoxic T cells that induce cell death of infected host cells generally in response to intracellular pathogens ( e.g., viruses) A TH2 or type 2 response is primarily characterized by the recruitment and activation of B cells to proliferate and differentiate into plasma cells generally in response to extracellular pathogens Plasma cells produce copious amounts of antibodies (~2000 antibody molec ules per second) that function to neutralize antigens [ 83, 84] S. mutans is typically the dominan t bacterial species associated with shallow lesions and Lactobacillus casei with deep lesions. In shallow lesions CD8+ T cells are the predominant form of immune cells localized to the dental pulp through an inflammatory response to bacterial antigens. Th is type 1 immune response is characterized by interferongamma ( IFN ) tumor necrosis factor beta ( TNF ) and interleukin2 (IL) production. In deep lesions the bacteria reach the inflamed dental pulp and a type 2 immune response emerges with localization of CD4+ T cells, B cells, and

PAGE 27

27 plasma cells and the production of IL4, IL 5, IL 6, IL 10, and IL13 i n addition to the type 1 response The presence of S. mutans in human carious lesions has been shown to correlate with IFN mRNA production and the presence of CD8+ T cells in human specimens [ 85] In summary S. mutans is an etiologic agent of dental caries Virulence factors attributed to S. mutans include its ability to: 1) sense and respond to environmen tal changes in the oral cavity, 2) express adhesins that promote attachment and colonization, 3) produce and tolerate acid, and 4) form biofilm Dental caries is a preventable disease that is prevalent in the United States that impacts both oral and system ic health. S. mutans and Cardiovascular Disease S. mutans has long been recognized as a major pathogen of dental caries, one of the most common infectious diseases in humans [ 38, 86, 87 ] What is much less appreciated is its role in extraoral diseases [ 8897] S. muta ns is an opportunistic pathogen that causes extraoral infections that are typically associated with comorbidities such as pregnancy [ 9395 98 ] post surgical infection [ 99 ] congenital heart defects [ 100 ] atrial myxoma [ 91 101 102 ] kidney disease [ 89 ] autoimmune disease (i.e. Sjogrens syndrome) [ 103 104 ] and chronic infections [ 88] A m odel has been proposed to describe how oral bacteria enter the blood stream and lead to cardiovascular pathology [ 105 ] The pathway begins with poor oral hygiene which results in access to the vascular system through bleeding gums tooth abscess es or direct tissue invasion. Once in the blood stream, systemic exposure to the bacteria and bacterial components results in an inflammatory response and subsequent damage

PAGE 28

28 to heart tissues. Transient bacteremias following routine dental procedures such as brushing and scaling [ 106] offer oral pathogens like S. mutans a direct route to the circulatory system. In fact, dissemination of oral bacteria into the bloodstream is common in humans and has been calculated to account for 3 h per day of transient bacteremia on average [ 106 110 ] Thus, the direct interactions between oral derived bacteria and cells of the cardiovascular system may have a significant effect on the progression of cardiovascular diseases ( r eviewed in these references [ 111 113 ] ) S. mutan s has four serotypes ( c, e f and k) with serotype c being the most common in the oral cavities of healthy individuals and f and k being the most rare [ 112 114] This serotype classification is different from the classic streptococci Lancefield group serotyping used to distinguish streptococci genus and species. The oral cavity and cardiovascular tissues of patients with cardiovascular disease compared to healthy individuals were reported to have different S. mutans serotype distributions with an increase of rare and untypable serotypes in atherosclerotic diseased cardiovascular tissues. Serological classific ation of S. mutans strains is dependent upon t he rhamnose glucose polysaccharides (RGP) located in the cell wall [ r eviewed in this reference [ 114 ] ]. Each of the four serotypes have a rhamnose backbone composed of alternating 1,2 linkages [ 115 ] but it is the type of or absence of glucose side chain linkage that is used to distinguish between serotypes. The genes involved in the biosynthesis, transport, and assembly of RGP are located at four different chromosome loci. RmlABCD and GluA function to synthesize RGP nucleotide precursors, deoxythymidine diphosphate ( dTDP ) L rhamnose [ 116 117 ] and uridine diphosphate ( UDP ) D glucose [ 118] ; RgpABCDEF likely function in the transpor t and assembly of

PAGE 29

29 RGP [ 119 ] ; and RgpG, a p utative glycosyl transferase N acetylglucosaminyltransferase, may function to initiate RGP synthesis [ 120 ] Serotype classification can be accomplished using immunodiffusion methodology with rabbit antisera specific for the different serotype antigens or with PCR primers specific for the variable region between rgpF and ORF12 involved in glucose side chain formation [ 121 ] However, serotype classification may only be relevant to the clonal lineage of S. mutans strains and the association between specific serotypes and d isease may be coincidental with respect to the presence and type of glucose sidechains found on the bacterial cell surface and the strains ability to invade. The cell wall characteristics that specifically distinguish the serotypes may have no functional importance relevant to the virulence of the invasive strains being investigated. While it is possible that there is a link between serotype and strain virulence, t he purpose of this study is not to determine if these characteristics are functionally linked rather serotype is only used as a way to classify these strains. In support of an argument for a role of S. mutans in infectious cardiovascular disease, monocytes that were harvested from the blood of healthy human donors and treated with purified serot ype f RGP were shown to have increase d expression of Fc receptors for immunoglobulin G (IgG) on their surface and secrete d pro inflammatory cytokines : tumor necrosis factor i (IL [ 122] The stimulation of monocytes to secrete TNF has been reported to be mediated by interactions with CD14, a tolllike receptor 4 (TLR 4) co receptor [ 123 ] Unfortunately, other studies have not been done with other purified RGPs from other serotypes to determine if the cell surface sugars play a direct role in the host immune response. Overall t h ese data suggest that each S. mutans serotype

PAGE 30

30 may have factors that contribute to their ability to survive under different physiological conditions and that some of these factors may contribute to cardiovascular disease [ 114 ] About 10% of S. mutan s clinical strains have a gene that encodes for a collagen binding protein (Cnm), and the frequency of cnm is 2 to 10 times higher in the f and k rare serotype strains [ 67 89 124 125 ] Recent reports have shown that strains of S. mutans expressing C nm are able to invade and persist in human coronary artery endothelial cells (HCAEC), while Cnm cognate mutant strains were found to be invasion deficient [ 126 127 ] A serotype f strain, S. mutans OMZ175, was determined to be the most invasive strain and was found to express Cnm [ 126 127 ] The intracellular location of S. mutans OMZ175 was confirmed using transmission electron microscopy at 0.5 5, and 29 h post infection [ 127 ] The results showed that S. mutans OMZ175 entered the HCAEC in vacuoles; some bacteria escaped to the cytoplasm by 5 h post infection and those bacteria in vacuoles appeared in tact after 29 h [ 127 ] Once inside the host cell s, some pathogens ( e.g. S. pyogenes ) are destroyed by exposure to increasingly acidic and proteolytic conditi ons of the early endosome, late endosome and lysosomal compartments, while other pathogens are able to subvert this degradative pathway. A function of endosomes is to sort material to be degraded in lysosomes but they also possess enzymes with protease and carboxypeptidase activity [ 128] The pH of early endosomes is typically near 6, late endosomes near 5, and lysosomes even lower [ 129 130] S. mutans is acid tolerant being abl e to grow at pH 5.5 under conditions that allow adaptation [ 131 ] ; therefore, S. mutans may be expected to survive with in early endosomes with an adequate carbohydrate source such as the car bohydrates found on

PAGE 31

31 endothelial membraneassociated glycoproteins and internalized during the formation of vesicles The principle sugars ( e.g., glucose, galactose, mannose, N acetylglucosamine) found in glycoproteins if and when made available, may serve as a nutrient source for S. mutans [ 132 ] [reviewed in [ 128 ] ] Infectious endocarditis is a serious cardiovascular disease with often fatal outcomes Moreover, t he onset of infectious endocarditis following d ental treatment procedures has been reported [ 105 133 134] This infectious disease is characterized by masses of platelets, fibrin, bacteria, and inflammatory cells ( called vegetations ) and disease symptoms or signs include fever, anemia, general weakness, and heart murmur. Infective endocarditis arise s from adherence of bac teria to activated platelet masses that accumulate on the surfaces of heart valves as a result of injury or disease [ 135 136 ] Virulence factors that contribute to infectious endocarditis pathogenesis are the a bilit ies of microorganisms 1) to survive in the blood for an extended time by evading host immun e factors 2) to adhere to host cells or host cell components through bacterial adhesins, 3) or to elicit plat e let aggregation [ 135 ] S. mut ans an etiologic agent of infectious endocarditis, has each of the three phenotypes for contributing to endocarditis virulence. The role of cell surface adhesins in S. mutans induced bacteremia and endocarditis has been investigated. Out of 100 S. mutans strains isolated from 100 Japanese children, 7% of the strains showed an increased ability to survive in the blood, which correlated with the absence of PAc expression or presence of a truncated form of PAc [ 137 138 ] Additionally, S. mutans and other oral streptococci have been reported to promote the differentiation of monocytes to short lived dendritic cells rather than longer lived macrophages [ 139 ] suggesting that they

PAGE 32

32 use monocytes to carry them to diseased sites and establish infections by directing monocyte differentiation. Surface adhesins such as PAc, WapA, collagen binding proteins, and serotype polysaccharides have also been reported to facilitate adherence to host cells and extracellular matrix proteins [ 66, 94, 123 126 140 144] Finally, t he expression of PAc glucosyltransferases, and serotype polysaccha rides ha ve been reported to contribute to human platelet aggregation [ 145 147 ] S. mutans is the causative agent in 14.2% of all patients with streptococcal valvular disease. In the United States, oral streptococci are estimated to be responsible for 35 45% of infectious endocardit is cases each year with increasing incidence [ 148 ] Hemorrhagic stroke which occurs when a blood vessel ruptures in the brain, accounts for 10% of all strokes and has a 40% fatality rate, resulting in 24,000 deaths per year in the United States [ 149 ] In 2011, Nakano et al. [ 150] demonstrated that S. mutans strains isolated from hemorrhagic stroke patients w ere capable of inducing hemorrhagic stroke in mice following a procedure that photochemically induced endothelial injur y of the middle cerebral artery The pathogenic S. mutans localized to the site of injury, disrupted blood vessel barriers by activat ing host collagenases, and interacted with collagen fibers on the surface of damaged vessels thereby blo cking platelet activation through the collagen binding protein, Cnm Using this animal model, Cnm was shown to be directly involved in reducing platelet aggregation by suppressing the interaction between platelets and collagen; typically, exposed collagen in a vessel activates platelets through the interaction of the collagen receptor GPVI, and platelet activation is associated with clot formation [ 151 ] Unexpectedly, purified recombinant Cnm w as able to induce hemorrhagic disease in thi s mouse model suggesting that the

PAGE 33

33 increased cranial bleeding was likely protein adhesin mediated An epidemiological link between cnm expressing S. mutans strains and cerebral hemorrhagic stroke was established by observing that the frequency of cnm expressing strains from age matched, healthy control subjects was significantly lower than that of patients with cerebral hemorrhage (odds ratio, 5.4). This study provided evidence that S. mutans collagen binding prot eins may contribute to hemorrhagic stroke risk and that endothelial injury was necessary for this adverse sequelae. E pidemiological and DNA sequencing evidence supports a contributing role of S. mutans to atherosclerosis [ 124 152154 ] Atherosclerosis is a complex inflammatory disease afflicting medium and large sized arteries and is the leading cause of death in the United States [ 155 ] Atherosclerosis resul ts from an excessive, inflammatory fibroproliferative response to various forms of insult to the endothelium and smooth muscle of the artery wall. An early event in atheroma development is endothelial dysfunction, a pathological state of the endothelium characterized by reduced nitric oxide, increased reactive oxygen species, secretion of proinflammatory molecules, and production of leukocyte adhesion molecules (reviewed in this reference [ 156 ] ) E ndothelial dysfunction contributes to various types of vascular disease such as, hypertension, coronary artery disease, peripheral artery disease and chronic he art failure. D isease onset may be present before symptoms are apparent For instance, the progeny of hypertensive subjects were reported to have endothelial dysfunction without hypertension [ 157 ] and children and young adults at risk for developing atherosclerosis were shown to have endothelial dysfunction without symptoms [ 158 ] The initial vessel

PAGE 34

34 cell type with which bacteremic bacteria interact is the endothelial cell layer, and these interactions appear to be key to ultimate disease outcome. S. mutans has been reported to be the predominant bacterial s pecies isolated from diseased heart valve tissues and in atheromatous plaques [ 10 152, 153 ] Non c serotype isolates of S. mutans were identified with a significantly higher frequency ( 70 75 %) in diseased S. mutans positive cardiovascular specimens than were serotype c isolates [ 154 ] Most significantly, atherogenic prone mice in a restenosis injury model dev eloped atherosclerotic plaques by 18 weeks post surgery when also infected with a cnm positive strain of S. mutans [ 31] The arterial injury was produced using an angioplasty balloon catheter introduced through the femoral artery and inflated in the distal abdo minal aorta, advanced retrograde to the distal thoracic aorta, and then withdrawn. M acrophage infiltration and elevated TLR 4 gene expression indicative of an innate immune response was observed in the injured abdominal aorta tissues when infected with a s train of S. mutans that expresses Cnm compared to injury only and infected only control mice [ 31 ] The increased presence of macrophages and the recovery of S. mutans DNA from balloon angioplasty injured abdominal aortas collected in this study suggests that the bacteria colonized the damaged artery and/ or were carried there by macrophages though live cell culture was not used to confirm bacterial viability [ 31] The ability of a pathogen to attach to and invade endothelial tissues has previously been shown to be required for virulence in animal models of atheroscler osis and infectious endocarditis [ 30, 159 164 ] and the ability to invade endothelial cells has been shown to correlate with infectious endocarditis severity [ 165] For example, some strains

PAGE 35

35 of Lancefield Group A streptococci invade epithelial and endothelial cells through caveolae, resulting in nonphagocytic uptake and persistence in nonlysosomal compartments inside the cells [ 166 ] In contrast, other strains of Group A streptococci invade via a zipper mechanism and localized F actin accumulation, resulting in trafficking to lysosomes [ 167 ] Also, two partially homologous invasins that have been shown to direct different entry mechanisms have been identified in Group A and Group G streptococci where c aveolae mediated entry was found to facilitate greater bacterial persistence than entry and trafficking through the classical endocytic pathway [ 168] Thus the mode of entry plays a major role in cell trafficking, bacterial fate and, very likely, disease outcome. The mechanisms of oral streptococcal species entry into any cell type are not well characterized. Invasion of host cells consists of an active bacterially driven process whereby signal transduction pathways of otherwise nonphagocytic cells are subverted to accommodate bacterial entry [ 169] Species of other groups of streptococci that have been reported to invade host cells include S. uberis [ 170 ] S pyogenes (GAS) [ 171 172 ] Group B streptococci [ 173 ] S. pneumoniae [ 174 ] S. suis [ 175 ] and S. gordonii [ 176 177 ] Stinson and colleagues reported that some oral streptococci were capable of invading human umbilical vein endothelial cells (HUVEC) [ 177 ] S. gordonii was considered the most invasive species of those tested, but differences in invasion efficiency were observed among strains. The authors tested only one strain of S. mutans UA159, a serotype c st rain, which was found not to invade HUVECs. S. mutans adherence to cardiovascular tissues may be enhanced during injury/healing when extracellular matrix and basement membrane molecules are

PAGE 36

36 exposed, since S. mutans adheres selectively to the cell membranes of skeletal, cardiac, and smooth muscle cells (sarcolemmal sheaths) and capillaries of cardiac muscle in monkeys [ 178 ] The next section was assembled to provide the reader background knowledge of the basic anatomy of the artery with emphasis on endothelial cells which were used as a model of infectious cardiovascular disease in this study. Circulatory System Blood travels throughout the body through a closed system of interconnecting vessels in a circuit that travel s from the heart to the tissues and then back to the heart [ 179 ] Arteries are blood vessels that transport oxygenated blood from the heart to tissues throughout the body and venules are vessels that are responsible for transporting deoxygenated blood back to the heart. There are different types of arteries T he large elastic arteries are connected to the heart while the medium mus cular arteries branch out from the elastic arteries to varying regions of the body The medium arteries are further divided into smaller arteries which truncate into even smaller arteries that enter tissues called arterioles. The arterioles further delinea te into capillaries where oxygen, nutrients, and other substances are exchanged between the blood and the tissues. Capillaries connect to venules and the blood begins to move back to the heart from the venules to increasingly larger vessels called veins. Like other tissues, blood vessels require oxygen and nutrients to survive which are supplied by the vasculature of vessels, the vasa vasorum Arteries The wall s of arteries are composed of three layers called the tunica interna (intima), tunica media, and tunica externa (adventitia) [ 179] The intima is the innermost

PAGE 37

37 layer and is in direct contact with th e blood in the lumen of the artery through the endothelium ( specialized epithelial tissues derived from the mesoderm that coat the lumen of the artery in a single layer and connec t to the basement membrane and internal elastic lamina see below ) The media is the middle layer of the artery and is made up of smooth muscle cells and elastic fibers. The adventitia is the outermost layer and contains fibroblasts and connective tissue c omposed principally of elastic and collagen fibers and nourished by the vasa vasorum [ 179 ] The anatomy of the artery provides elasticity and contract ility properties which are essential for function. When the heart contracts, the aortic valve of the heart opens and blood is force d out of the ventricle chamber into the aortic artery which expands to make room for the influx of blood. As the ventricle relaxes, the aortic valve closes preventing blood backflow into ventricles and the elastic recoil of the artery forces the blood aw ay from the heart. The arterial smooth muscle cells, controlled by sympathetic fibers of the autonomous nervous system, are responsible for the contractility properties of the artery and are arranged longitudinally and in rings around the artery to perform this function In addition to the nervous system, chemical substances secreted by endothelial cells ( e.g., nitric oxide) can control arterial vasodilation and vasoconstriction [ 179 ] Endothelial Cells The s imple squamous epitheli al layer that lines the heart, blood vessels, and l ymphatic vessels is known as the endothelium. The endothelium is avascular, arranged in a continuous single layer of tightly packed cells with an apical surface in contact with the blood in the lumen of the artery and a basal surface attached to the basement membrane The molecular composition of endothelial surfaces is of significance since extracellular matrix synthesis and deposition are essential for normal artery function and

PAGE 38

38 facilitate adherence and invasion of certain infectious agents in cardiovascular disease [ 180 ] On the apical side, endothelial cells produce a carbohydrate rich extracellular matrix called the glycocalyx. The glycocalyx consists of membrane bound and secreted m olecules that act as a permeability barrier limiting the access of various blood components to the endothelial cells and vice versa ( review ed in this reference [ 181 ] ) Because the biosynthesis and shedding of the proteoglycans and glycoproteins that make up the glycocalyx is a dynamic process, the exact composition and thickness of the glycocalyx matrix are ever changing and difficult to define. In healthy indiv iduals, the glycocalyx may extend 2 to 3 m in small arteries and 4.5 m in medium arteries [ 181 ] V ascular abnormalities can occur when the glycocalyx is inco mplete or absent from the endothelial surface and may result in increased vascular permeability, adhesion of mononuclear cells and platelets, and reduced vasodilatation capabilities. P articular component s of the glycocalyx that contribute to its thickness are the heavily glycosylated proteoglycans. T he core proteins of proteoglycans are either anchored to the plasma membrane ( e.g., syndecan, glypican) or secreted into the glycocalyx matrix and bloodstream ( e.g., mimecan, perlecan, and biglycan) Core protei ns are decorated with one or more of the five types of glycosaminoglycans (GAGs) : heparin sulfate, chondroitin sulfate, dermatan sulfate, keratin sulfate, and hyaluronan. Many of the sugars of the GAGs contain carboxyl and sulfate groups, which impart a hi ghly negative charge to the glycocalyx. The negative charges of the GAGs attract water molecules forming a hydrated gel, which limits the movement of bacteria and large molecules but allows diffusion of water soluble molecules in healthy tissue. C ertain bacteria produce

PAGE 39

39 enzymes that degrade glycocalyx proteoglycans, which impart a competitive edge through creating a niche for attachment and a food source for extracellular growth and persistence. O n the basal side, t he endothelium uses focal adhesions and hemidesmosomes to adhere firmly to the basement membrane to keep from moving or being torn away by the shear stress that is associated with blood flow The basement membrane consists of two layers including the basal lamina composed of collagen, laminin, and proteoglycans and the reticular lamina composed of reticular fibers, fibronectin, and glycoproteins. Focal adhesins connect act in filaments to fibronectin through cell adhesion molecules called integrins Integrins consist of an and subunit, and mamma ls have 17 types of subunits and 8 types of subunits that combine to form at least 22 heterodimers Though i ntegrins lack enyzymatic activity, they f acilitate communication through conformational changes in a process called o utsidei n integrin signal t ransduction [ 182 ] As integrins localize to both the apical and basal sides of endothelial cells, s ome bacterial pathogens use integrin ligand molecules as molecular bridges to gain entry into host cells [ 183 184 ] Hemidesmosomes connect intermediate filaments ( e.g., vimentin and keratin) i n the cytosol to the basal lamina, increasing the overall rigidity of the endothelial cells. P rimary h uman coronary artery endothelial cells (HCAEC) have been used for in vitro studies of bacterial attachment and invasion, thrombosis, atherosclerosis, and hypertension. Because of the deficient glycocalyx made by HCAEC on polystyrene, our invasion model more closely represents a diseased population [ 185 ]

PAGE 40

40 PathogenHost Interaction A fibronectinbinding protein of Group A streptococ ci (GAS) is required and sufficient to determine/direct the mechanism of and complete entry of GAS into endothelial cells [ 167 ] S. mutans also has surface protein adhesins (PAc, Cbm, and WapA) that have been reported to bind to host basement membrane proteins i.e. fibronectin and collagen [ 186188 ] PAc has been shown to be an important molecule in host cell adherence, as it directly binds to the 5 1 integrins [ 140 189 ] Additionally, a recent report has identified and characterized a new collagen binding protein, Cbm, found in patients with infectious endocarditis and approximately 2% of systemically healthy patients [ 188 190 ] The Cbm collagen binding domain was shown to have 78% identity and 90% similarity to the collagen binding domain of Cnm, and cbm positive strains were primarily identified in the serotype k group whereas the cnm pos itive strains were predominately found in the serotype f group [ 188 ] None of the S. mutans strains identified carried both the cnm and cbm genes in the same organism. Although the adherence rates to human umbilical endothelial cells (HUVEC) were shown to be similar and dependent on either the presence of cnm or cbm the differences in host cell invasion were not reported [ 188 ] A ll of the cbm positive strains in th is 2005 report were isolated from t he oral cavities of healthy subjects ; however, Nomura et al. report that cbm may be important virulence factor associated with S. mutans pathogenesis of infectious endocarditis in 2013 [ 188 190 ] Other studies investigating the role of S. mutans adhesion surface molecules such as PAc and WapA have not shown that these molecules contribute to the invasive phenotype in endothelial cells [ 126 ] While PAc may not be critical for an invasive phenotype, there is no doubt that it plays a role in adherenc e.

PAGE 41

41 Two important pathways for bacterial internalization into eukaryotic cells are the caveolae/lipid raft mediated endocytosis pathway and the receptor mediated (clathrindependent) endocytosis pathway. Entry via caveolae and/or lipid rafts has been repor ted for several Gram positive bacteria including S. uberis [ 191 192] and GAS [ 166 ] but S suis [ 175 ] is believed to enter epithelial cells through both pathways. Durin g the internalization of S suis and S pyogenes large invaginations, through which bacteria enter the cells, have been described [ 166 175 ] Knowledge of the mechanisms of oral streptococcal species internalization is limited, and no studies have been done using cells from the adult human cardiovascular system. Internalization of streptococci including S. su is and S. pyogenes (GAS) in other cell types has been shown to progress starting with large invaginations, through which bacteria enter the cells [ 166 175 ] Caveolaelike structures have been observed close to these invaginations during entry of S. pyogenes [ 166 ] Up on invasion, some Streptococcus species avoid lysosomal death and survive in many diverse host cells. For example, S. uberis internalizes within epithelial cells using GPI anchored molecules and then exits the phagosome avoiding intravesicular acidification and lysosome fusion [ 191 ] while S. suis survives within acidified phagolysosomelike vacuoles [ 175 ] S. pyogenes exploits caveolae to gain entry into both epithelial (HEp2) and endothelial (HUVEC) cells to replicate within caveosomes [ 166 ] However, in HeLa cells, S. pyogenes exits the phagosome to replicate within the cytoplasm, but these cytoplasmic bacteria eventually become sequestered in LC3positive autophagosomelike vacuoles that are approximately 5 to 10 times lar ger than the standard autophagosomes [ 193] A significant decrease in bacterial viability was observed after

PAGE 42

42 fusion of these GAS autophagosomes with lysosomes [ 193 ] Thus the mode and mechanism of entry likely sets the course for intracellular traf ficking and ultimate outcome. The eukaryotic intracellular environment provides bacterial pathogens protection against host immune responses and antibiotics, which may lead to longterm carriage, re current infection, and chronic inflammation. Invasion of human coronary artery endothelial cells (HCAEC) by S. mutans can occur within 1 h and persist at least 29 h post infection under continuous antibiotic pressure [ 127 ] S. mutans invasion of cardiovascular endothelial cells is Cnm dependent As provided above, i t is estimated that approximately 1020% of all S. mutans strains are cnm positive and that thes e strains are more likely to belong to the serotype f group. An increase in serotype f strains was shown to be present in the oral cavities and tissues of patients with cardiovascular disease Recently, two independent studies have reported that systemic i nfection with S. mutans strains expressing Cnm increased the risk of cerebral hemorrhagic stroke and accelerated atherosclerosis in mice. In both cases, endothelial cells lining blood vessels were damaged leading to exposure of the underlying extracellular matrix. Furthermore, S. mutans Cnm shares protein sequence identity with collagenbinding proteins in S. suis [ 194 195 ] Enterococcus faecalis [ 196 198 ] and Staphylococcus aureus [ 199 200 ] : organisms known to cause bacteremia and endocarditis. Summary S. mutans is an oral pathogen of dental caries with access to the bloodstream through every day routine activiti es such as chewing and personal hygiene regimens such as brushing and flossing. Once in the bloodstream, S. mutans has been reported

PAGE 43

43 to promote platelet aggregation, influence monocyte differentiation to the dendritic cell lineage, and adhere to extracellu lar matrix proteins and cells of the cardiovascular system in a strain specific manner In age groups at increased risk for cardiovascular disease (>45 years) the prevalence of untreated caries is approximately 21.5% in the U.S. [ 76 ] S. mutans is kno wn to be a causative agent of endocarditis, a potential risk factor for hemorrhagic stroke, and linked to atherosclerosis all diseases of the cardiovascular system. According to the Centers for D isease Control and P revention, cardiovascular disease morbidi ty and mortality is an enormous burden on the American public and economy with more than 4 million people disabled and accounting for more than 33.6% of all deaths in the U.S. and costs exceeding $444 billion in 2010 [ 201 ] The objective of the research presented in this dissertation is to determine the invasion tropism, define the invasion cycle, and to inves tigate the pathogenic potential of S. mutans invasive strains on endothelial cells

PAGE 44

44 Table 11 Summary of common c haracteristics in the g enus Streptococcus* Property Description Cell Morphology Spherical, or ovoid, less than 2 m in diameter S. mutans : 0.5 0.75 m in diameter or may form rods 1.5 3.0 m in length CellWall Composition Peptidoglycan Peptidoglycan Group A with Llysine as the diamino acid in position 3 of the peptide subunit Most common form is Lys Alan (n < or equal to 4) Ala can be replaced by LThr or L Ser S. mutans and S. bovis have L Thr Carbohydrate Rhamnose is a common constituent of almost all streptococci cell walls Amino sugars glucosamine and muramic acid are always present Galactosamine is a variable component Common reducing sugars are glucose, galactose and rhamnose Rhamnose absent in pneumonia, oralis and mitis Polyols glucitols in S. agalactiae and glycerol present in S. ratti Adhesins Strains with PAc include: mutans, sobrinus, gordonii, oralis, intermedius Bind ext racellular matrix and serum components (fibronectin, and plasminogen) Often contain repeating blocks of amino acids Nutrition and Growth Facultative anaerobic Some require extra CO2 ( S. mutans ) Susceptible to vancomicin Variable reactions for growth in 6. 5% NaCl containing media Require amino acids, peptides, purines, pyrimidines, and vitamins in complex media Colonial and Cultural Features Growth enhanced by addition of 5% sheep blood, serum, or glucose 0.5 1.0 mm in diameter on glucose at 24 h Non pigme nted Genomes S. mutans ~ 2.03 Mb UA159 does not contain temperate bacteriophage DNA Horizontal Gene Transfer Competence is not constitutive but regulated by genes comA comE from 2 com operons comC : C ompetence S timulating P eptide (CSP) comA and comB enco ding a CSP secretion apparatus comD and com E encode a twocomponent regulatory system

PAGE 45

45 Table 11. Continued Property Description Bacteriophages Active temperate and virulent phages have been described. Phages are present within a high proportion of gr oup A streptococci and contribute to the pathogenic potential of the species. The pyrogenic exotoxins SpeA and SpeC are bacteriophage encoded Sequencing of S. pyogenes genome has revealed the presence of complete or partial sequences of four bacteriophage genomes containing genes for one or more previously undiscovered super antigenlike proteins Genes encoding proteins Pb1A and Pb1B involved in the binding of S. mitis to human platelets, with obvious relevance to pathogenesis of infective endocarditis, are encoded by lysogenic bacteriophage Antibiotic Sensitivity In general susceptible to most antibiotics Macrolide resistance has been increasing Increase in penicillin resistance by S. pneumonia due to altered forms of penicillin binding proteins PBP1a, PB P2x, and PBP2b due to interspecies recombination events involving viridians streptococci Ecology Streptococci are associated with warm blooded animals and birds Most species are commensal organisms Colonize mucosal surfaces in the oral cavity, URT, and GI tract, under certain conditions can cause local and systemic infections Adherence to many surfaces present in their natural environment Ability to rapidly utilize available nutrients Ability to tolerate, resist, or destroy host immune defenses Selective media For isolation of cariogenic S. mutans : tryptone yeast cystine media and mitis salivarius media. Members of Anginosus species group can be isolated on semi selective agar medium containing 40 g/l selective agar (Lab M) + 30 g/ml nalidixic acid, 1 m g/ml sulfamethazine, and 5% (v/v) defibrinated horse blood (NAS). NAS will also select for S. mutans and S. sobrinus although recovery is strain dependent. Hemolysis Determined on a blood agar base medium such as ToddHewitt, brain heart infusion, pro teose peptone, plus 5% def ibrinated horse or sheep blood. Anaerobic incubation is recommended. Serological Determination S. pyogenes is divided into serotypes on the basis of streptococcal surface M proteins with more than 80 types known, with 1, 3, 11, 12, and 28 as the most common in invasive and toxic infections

PAGE 46

46 Table 11. Continued Property Description Biochemical and Physiological Tests Carbohydrate fermentation, production of acetyl methyl carbinol from glucose in the Voges Proskauer reaction, pr oduction of ammonia from arginine, hydrolysis of esculin, hippurate, and starch, reduction of litmus milk, production of H2O2, tolerance t o NaCl and bile, and formation of extracellular polysaccharide from sucrose Hydrolysis of sodium hippurate is shared by several species The formation of extracellular polysaccharides is an important characteristic of several of the oral streptococci including S. mutans S. sangius S. salivarius S oralis *Information and categories collected from Bergeys Manual of D eterminative B acteriology [ 42]

PAGE 47

47 Table 12 Mutans Group Characteristics Species Animal host S. mutans Human S. sobrinus Human, Rats S. criceti H amsters, wild rats, and occasionally humans S. ratti Laboratory rats S. downei Monkeys ( Macaca fascicularis ) and occasionally humans S. macacae Monkeys ( Macaca fascicularis ). S. ferus* Wild rats and pigs *Information and categories collected from Bergeys Manual of Determinative Bacteriology [ 42] * S. ferus is a peripheral member of the group due to DNA DNA hybridization studies

PAGE 48

48 Table 1 3. Fast facts about S mutans Characteristic Description Cell Size 0.5 0.75 m m in diameter Cell Shape Typically c occoid ; however, short rods may form under acidic conditions (1.5 3.0 mm in length) DNA G+C content (mol%) 3638 Lancefield grouping antiserum Non grouping Oxygen requirements Facultative anaerobe, some strains require CO2 Temperature 37 oC optimum; no growth at 10 oC Growth on blood agar Usually hemolytic or non hemolytic some strains hemolytic Under anaerobic con ditions: white or gray colonies ATP generation Substrate level phosphorylation M etaboli c by products Lactic acid, acet ate ethanol, formate, acetoin Acid production from growth on these molecules G lucose, fructose, sucros e, lactose, galactose, mannose, D glucosides, trehalose, maltose/maltodextrin, D raffinose, ribulose, melibiose starch, isomaltosaccharides, sorbose, N acetylglucosamine, esculin, arbutin, inulin, salicin and sugar alcohols mannitol and sorbi tol No acid production from these molecules G lycerol, glycogen, starch, rhamnose, adonitol, arabinose, cyclodextrin, dulcitol, erythritol, gluconate, inositol, methyl D glucoside, methyl D mannoside, methyl D xyloside, melezitose, ribose, sorbose, xylose Ability to hydrolyze: Esculin, starch Inability to hydrolyze Arginine, hippurate, and urea Catalase Negative Hydrogen peroxide production Negative Peptidoglycan type Group A peptidoglycan Serotypes c, e f k, and serologically untypable *Informat ion and categories collected from Bergeys Manual of Determinative Bacteriology [ 42]

PAGE 49

49 CHAPTER 2 STREPTOCOCCUS MUTANS OMZ175 INVASION OF H UMAN ORAL AND CARDIOVASCULAR CELLS Introduction The Centers for Disease Control (CDC) and Prevention report that half of American adults over the age of 20 have at least one of the risk factors (high blood pressure, high low density lipid cholesterol levels, and smoking) for heart disease, the leading cause of death in the United States [ 202 ] The CDC also reports that half of American adults over 30 suffer from periodontitis [ 203 ] The American Heart Association has recently reported that heart disease and periodontitis share common risk factors and that there is a potential link between oral health and development of cardiovascular disease (CVD) ; however, a causative link has yet to be established [ 12] Oral bacteria induced bacteremia is common in humans with inflamed gingival tissues. T ypically, transient bacteremia episodes caused by oral bacteria are short lived without obvious health consequences [ 204] However, there are certain comorbidities ( e.g., diabetes, rheumatoid arthritis, malignancies ) which have been linked to oral bacterial infections in sites outside of the mouth [ 105 ] The increased risk of developing these infections may be due to the cardiovascular tissue dysfunction typically sustained in these patients Streptococcus mutans a member of the Mutans group of oral streptococci, is an etiological agent of dental caries (one of the most common human infectious diseases), bacteremia, and infectious endocarditis [ 205 ] Interestingly, the serotype distributions of S. mutans differ in the oral cavities and cardiovascular tissues of healthy versus individuals with cardiovascular disease. This suggests that the strains within each serotype may have unique virulence factors in common, and these factors may contribute to the ability of certain strains to enter and survive in the bloodstream.

PAGE 50

50 Recently, certain strains of S. mutans have been shown to invade human gingival fibroblasts (HGF) and cardiovascular endothelial cells [ 127 206 ] The ability of S. mutans to invade endothelial cells has been linked to the expression o f a cell surface collagen binding protein, Cnm [ 126 ] Strains of S. mutans expressing cnm have been linked to endocarditis [ 207, 208 ] hemorrhagic stroke [ 150 ] and atherosclerosis [ 152 153] This cell surface adhesin/virulence factor is estimated to be pre sent in 1012% of all S. mutans strains, and it is more frequently detected in strains belonging to the rarer serotype f and k groups whose prevalence was reported to increase when isolated from the oral cavities and the cardiovascular tissues of patients with CVD [ 114 ] One potential route for S. mutans to enter the cardiovascular system from the oral cavity is through bleeding gingival tissues, a symptom of periodontal disease. The gingiva is a vascular rich tissue at the site of tooth eruptio n where gingival epithelial cells ( e.g., junctional, sulcal, and keratinocytes) serve as a protective barrier of the underlying connective tissue from plaque biofilm and HGFs maintain the connective tissues during health and healing. The evidence indicating S. mutans invades HGF s suggests that S. mutans has the potential to access the bloodstream through the gingiva. The contribution of cnm expressing strains of S. mutans to the invasion of oral cells has not yet been investigated, so it is unknown whether oral epithelial cells or gingival fibroblasts can serve as a reservoir for extra oral infections caused by cnm expressing strains of S. mutans Previously, the ability of a bacterium to attach to and invade endothelial tissues has been shown to be required for the induction of atherosclerotic plaque formation and the establishment of infection in animal models of atherosclerosis and infectious

PAGE 51

51 endocarditis, respectively [ 30, 159 160 162 ] Furthermore, the ability to invade endothelial cells has been shown to correlate with infectious endocarditis severity [ 165, 209] Bacteria that are able to invade and pers ist within endothelial cells are protected from phagocytosis; consequently, intracellular bacteria may have a selective advantage at remote sites and an opportunity to disseminate into deeper cardiovascular tissues ( e.g., smooth muscle cells) [ 210, 211 ] Our lab has previously investigated intracellular trafficking of S. mutans OMZ175 in human endothelial cel ls using transmission electron microscopy [ 127 ] Within 5 h, S. mutans localized to single and double membrane vacuoles suggesting that both the endocytic and autophagic pathways are important for intracellular trafficking. After 24 h, large numbers of S. mutans were observed in the cytoplasm of infected endothelial cells, suggesting that S. mutans escaped the vacuoles and replicated inside of the cytoplasm of the HCAEC. However, it was also reported that bacterial plate counts from antibiotic protection assays showed little change in bacterial load 29 h post invasion. In contrast, when repeating the antibiotic protection assays for the work reported here, cultivable S. mutans OMZ175 significantly decreased at 30 h post infection, while there was no statistically significant change in bacterial load observed at earlier time points. Before investigating whether there is a causative link between the increased incidence of extraoral infections by oral pathogens and these co morbidities, we must first develop a model of the probable route these organisms take from the oral cavity to these sites, define whether there is a biological potential for these organisms to invade and persist, and determine the dissemination potential to other relevant cell types.

PAGE 52

52 The work described here reports the first evidence that S. mutans attaches to and i nvades human oral cells that reside in the gingiva ( HOK and HGF 1 ) in a cnm dep endent manner, supporting the epidemiological link between S. mutans and cardiovascular disease. Additionally, the fate of S. mutans within endothelial cells was investigated, specifically its ability to replicate intracellularly and the infection cycle i ncluding cytoskeletal gene expression changes attributed to Cnm early in the invasion cycle Furthermore, the potential of S. mutans dissemination to deeper arterial tissues was investigated by assess ing its ability to attach to and invade arterial smooth muscle cells Materials and Methods The follow materials and methods were used in this study. The rationale for the methods and cell types selected to investigate each proposed hypothesis are explained in detail in the results section. Cell C ulture Pri mary human coronary artery endothelial cells (HCAEC; Lonza, Allendale, NJ), primary coronary artery smooth muscle cells (CASMC; Lonza ), primary oral keratinocytes (HOK; ScienCell Carlsbad, CA), and primary human gingival fibroblasts (HGF 1; ATCC Manassa s, VA) were cultured for invasion assays. The HCAEC and CASMC were cultured in endothelial cell basal medium 2 (EBM 2; Lonza) supplemented with EGM 2MV singleuse aliquots (Lonza) or Smooth Muscle Cell Basal Medium (SmBm Media; Lonza) supplemented with SmG M 2 BulletKit (Lonza) respectively. The HGF 1 cells were maintained in Dulbecco's Modified Eagle Medium ( DMEM; Corning Inc., Manassas, VA) containing glucose (4.5 g/ l ), L glutamine (2 mM), and sodium pyruvate (1 mM), and supplemented with 10 % fetal bovin e serum ( FBS;

PAGE 53

53 Atlantic Biological ; Flowery Branch, GA). The HOK were maintained in seru m free OKM media (OKM; ScienCel ) supplemented with OKGS. The primary cells were maintained at 37C in a humidified, 5% carbon dioxide (CO2) atmosphere. The cells were detached using Accutase and washed in cell appropriate media. The cells were counted using a Coulter Counter (Beckman Coulter Model Z1; Brea, CA) and seeded in flat bottom tissue culture treated plates (Corning Inc.) followed by overnight incubation at 37C in a 5% CO2 atmosphere (4). Tissue culture plates used to culture CASMC and HGF 1 were coated with rat tail, type I collagen (Invitrogen; Grand Island, NY), and those used to culture HOK were coated with poly L lysine (SigmaAldrich; Saint Louis, MO) per manufacturer instruction. Bacterial Culture The bacterial strains used in this study are listed in Table 1. S. mutans strains were cultured in either brain heart infusion (BHI; Becton Dickinson & Co., Franklin Lakes, NJ) broth or Todd Hewitt (TH; Becton Dickinson & Co.) broth overnight. Bacterial cultures were then pelleted at 4,629 x g for 5 min at room temperature (rt), the culture conditioned media were aspirated, and the pellets were resuspended in sterile phosphatebuffered saline (PBS, pH 7.2; Corning Inc.) to break up aggregates. Next the bacteria were diluted in host cell appropriate media without antibiotics to obtain bacterial suspensions containing 100 colony forming units (CFU) per well. Attachment Assay Attachment assays were used to measure the ability of S. mut ans to attach to clinically relevant cardiovascular and oral host cell types (HCAEC, CASMC, HOK, and HGF 1) by measuring live attached and intracellular bacteria as previous ly described with some modifications [ 212 ] Prior to infection, host cells were either placed on ice for

PAGE 54

54 20 min or treated with cytochal a sin D (5ug/ml) (Sigma Aldrich Corp. ) for 30 min Ice treatment promotes the disassembly of microtubules and actin filaments, while cytochal a sin D inhibits actin polymerization Both treatments were continued throughout the entire assay HCAEC were infected at 100 bacteria CFU per host cell. After 30 min the host cells were washed three times with Ha nks b uffered saline s olution ( HBSS; Corning Inc.) Preli minary experiments showed that concentrations of dimethyl sulfoxide had no noticeable effect on bacterial internalization and that concentrations of cytochalasin D had no effect on bacterial viability. Cell lysates were diluted in PBS and plated in duplicate. Efficiency of attachment was calculated by taking the ratio of the attached bacteria and the inoculum and multiplying by 100. A sample size of four was used for each condition per experiment, and each experiment was repeated a minimum of two times. Antibiotic Protection Assays Antibiotic protection assay s were used to measure the ability of S. mutans to invade clinically relevant cardiovascular and oral host cell types: HCAEC, CASMC, HOK, and HGF 1 [ 213 214 ] S. mutans OMZ175 was used as a model for S. mutans invasion, since this strain expresses the Cnm protein and has been reported to invade and persist within HCAEC [ 127 ] Primary cells were infected at 100 bacteria CFU per host cell. After 2 h the host cells were washed three times with HBSS and replaced with cell appropriate media supplemented with 300 microgram ml1 gentamicin and 10 microgram ml1 penicillin G for a minimum of 3 h to kill extracellular bacteria. All antibiotics used in this study were s upplied by SigmaAldrich. Prior to host cell lysis, host cells were washed three times with HBSS. Cell lysates were diluted in PBS and plated in duplicate. The efficiency of invasion was calculated by taking the ratio of the

PAGE 55

55 intracellular bacteria and the attached bacteria and multiplying by 100. A sample size of four was used for each condition per experiment, and each experiment was repeated a minimum of three times. Invasion deficient S. mutans strains functioned as the negative control ( e.g., S. mutans UA159 and/or S. mutans OMZ175 :cnm a collagen binding protein deletion mutant) [ 126 ] To assess the ability of S. mutans to replicate intracell ularly, infected HCAEC were transferred to media containing gentamicin at a concentration of 50 g ml1 with and without chloramphenicol at 10 g ml1 after the standard antibiotic protection assay was completed. The gentamicin kills bacteria that exit the host, and chloramphenicol inhibits bacterial protein synthesis of intracellular and extracellular bacteria. Transmission Electron Microscopy (TEM) TEM was used to observe S. mutans internalization and intracellular location within HGF 1 and CASMC. Host ce lls were seeded into 6well plates to confluence and infected with S. mutans OMZ175 at 100 CFU per host cell for 2 h Post invasion, human cells were washed 3X with 3ml HBSS per well. Cells were detached with A ccutase collected, and mixed with an equal volume of cell appropriate media. Cells were pelleted at 90 x g for 5 min. Culture conditioned media were aspirated, and the pellets resuspended in PBS. The cells in PBS were centrifuged at 90 x g over a FBS cushion (5 x the volume of PBS) This centrifugation step is to separate host cells from unattached bacteria and dead host cells After the FBS was aspirated, the cell pellet was fixed with 4 % paraformaldehyde and 2 % glutar aldehyde in 0.1 M caco dylate buffer pH 7. 2 Fixed tissues were processed with the aid of a Pelco BioWave laboratory microwave (Ted Pella, Redding, CA, USA). The samples were washed in 0.1 M sodium

PAGE 56

56 cacodylate pH 7.24, post fixed with buffered 2 % OsO4, washed with H2O and dehydrated in a graded et hanol series 25 %, 50 %, 75 %, 95 %, 100 %. Dehydrated samples were infiltrated in e thanol /LR White Resin (Electron Microscopy Sciences, Hatfield, PA) 50 %, 100 %, and cured at 60 oC. Cured resin blocks were trimmed, thin sectioned and collected on Formvar copper coated grids, post stained with 2% aqueous u ranyl acetate and Reynolds lead citrate. Sections were examined with a Hitachi H 7000 TEM (Hitachi High Technologies America, Inc. Schaumburg, IL) and digital images acquired with a Veleta 2k x 2k camera and iTEM software (Olympus Soft Imaging Solutions Corp, Lakewood, CO). Relative Real Time PCR To investigate intracellular bacterial replication with molecular methods RT PCR was used to detect bacterial and host cell nucleic acids following S. mutans OM Z175 invasion of HCAEC or CASMC. Primers used i n this study include universal 16S sense 5 ACTACGTGCCAGCAGCC3; 16S antisense 5GGACTACCAGGGTATCTAATCC3; 18S sense 5CGCCGCTAGAGGTGAAATTCT3; and 18S antisense 5CGAACCTCCGACTTTCGTTCT3 [ 215 ] Molecular methods were used to meas ure bacterial replication over time using RT PCR. Purified gDNA was used as a template. RT PCR was used to amplify the bacterial 16S and human 18S ribosomal gene sequences using IQ SYBR green supermix (BioRad; Hercules, CA) detection and specific primer s provided above. RT PCR data was analyzed by the comparative Ct method [187]. Assay controls include: 1) HCAEC or CASMC gDNA amplified with 16S and 18S primer set s in separate reactions ; 2) S. mutans OMZ175 gDNA amplified with 16S and 18S primer set s in s eparate reactions ; 3) no template control used with both

PAGE 57

57 16S and 18S primer sets in separate reactions The average Ct value of replicates was determined per sample Calculation 1: t, average Ct of bacterial 16S gene average of h uman 18S Ct, t t n t 5 h) was calculated and used to calculate the fold change (2) in bacterial load per host cell. If the fold change value was l ess than 1, then there was a reduction in bacterial load. To measure bacterial replication in HCAEC, antibiotic protection assays were performed on HCAEC seeded in 6well plates to confluence. T he harvesting times were 5, 7.5, 10, 12.5, 15, 17.5, and 20 h post infection, and the sample size per condition was 3 After the 5 h time point, the wells were washed with HBSS, and replaced with media supplemented with and without the following antibiotics: gentamicin (300 g ml1) with penicillin G (10 g ml1) in the presence or absence of chloramphenicol (10 g ml1). C hloramphenicol was used as a negative control for bacterial replication, since it is bacteriostatic on extracellular and intracellular bacteria. Total nucleic acids were isolated using Trizol reag ent (Invitrogen) per manufacturer instruction. Purified gDNA was used as a template, after template quality control measurements were obtained using NanoDrop 2000c UV Vis Spectrophotometer (Thermo Scientific) R eal time PCR was used to amplify the bacteri al 16S and human 18S ribosomal gene sequences using IQ SYBR green supermix (BioRad; Hercules, CA) detection and specific primers. The data was analyzed as described above. To measure bacterial replication in CASMC antibiotic protection assays were perf ormed on HCAEC seeded in 6well plates to confluence. The harvesting times were 5, 10, 24, and 48 h post infection, and the sample size per condition was 3. After the 5 h

PAGE 58

58 time point, the wells were washed with HBSS, and replaced with media supplemented wit h and without the following antibiotics: gentamicin (300 g ml1) with penicillin G (10 g ml1) in the presence or absence of chloramphenicol (10 g ml1). Genomic DNA (gDNA) was extracted and purified using QiaAmp DNA extraction kit (Qiagen). Purified gD NA was used as a template, after template quality control measurements were obtained using NanoDro p 2000c. RT PCR was used to amplify the bacterial 16S and human 18S ribosomal gene sequences using IQ SYBR green supermix (BioRad; Hercules, CA) detection and specific primers. The data was analyzed as described above. Host Cell Cycling Sequential antibiotic protection assays were performed to determine if intracellular S. mutans OMZ175 exit ed endothelial cells and maintained infectivity. HCAEC were seeded to confluence and infected with bacteria for 2 h and the following day washed, and treated with media containing gentamicin 300 g ml1 and penicillin G 100 g ml1 for 24 h to kill extracellular bacteria (n=6) Next, the infected HCAEC were enzymaticall y detached, diluted, and counted, and then equal volumes of infected HCAEC were overlayed into duplicate wells onto attached uninfected HCAEC An aliquot of the infected HCAEC from each of the original wells was lysed, diluted, and plated to determine the baseline intracellular bacterial load. After 24 h o ne well from each of the infected 6 samples was washed then incubated for 3 h in the presence or absence of gentamicin 300 g ml1 and penicillin G 100 g ml1. Viable, cultivable intracellular bacteria were enumerated from cell lysates through dilution and plating. The remaining well was processed for total extracellular

PAGE 59

59 and intracellular bacteria by diluting and plating media conditioned media and cell lysates. Bact erial Intercellular Spreading This ex periment was designed to determine whether host cell passaged S. mutans remain viable and infectious. HCAEC were seeded into 6 well plates with and without poly L lysine coated 25 mm coverslips (Electron Microscopy Sciences; Hatfield, PA) at 1.5 x 105 cell s per well for 24 h The wells containing the coverslips were infected with a denovirus expressing green fluorescent protein (GFP) (Welgen, Inc., Worcester, MA) at an MOI of 10 virus particles per host cell for 24 h An antibiotic protection assay was compl eted on HCAEC seeded in wells without coverslips using S. mutans OMZ175 (2 h infection followed by 3 h gentamicin 300 g ml1 and penicillin G 100 g ml1 treatment in media), then the infected HCAEC were washed, detached, and overlayed onto the washed monolayer of GFP expressing HCAEC in the presence and absence of gentamicin (50 g m l1). After 24 h t he infected cells were fixed with 4 % paraformaldehyde in PBS, counterstained with the DNA stain Draq 5 ( Cell Signaling Technology; Danvers, MA), and mounted using Prolong Gold (Invitrogen). Controls included slides that contained HCAEC that were only expressing GFP or only infected with S. mutans The microscopy was performed using a Leica inverted fluorescent microscope with a Yokagowa spinning disk conf ocal scan head and a Roper Cascade II EMCCD 512b camera set up for 3 channel fluorescent imaging. Gene Expression Analysis Microarray technology was used t o explore the gene expression changes attributed to pathogen associated molecular patterns, attachment, or attachment with Cnm mediated/associated invasion by S. mutans collagen binding protein, Cnm, during

PAGE 60

60 attachment and invasion of HCAEC using GeneChip Human U133 Plus 2.0 Array (Affymetrix, Inc; Cleveland, OH). For this assay, S. mutans strains, OMZ17 5 or OMZ175: cnm were used to infect HCAEC at 100 CFU per host cell for comparison to noninfected controls Co cultures were carried out in quadruplicate. After 1 h post infection, total RNA was extracted ( RNeasy mini kit ; Qiagen) treated with DNase I (Q iagen) eluted, quantified by using standard methods and submitted to Dr. Henry A. Bakers laboratory, where the microarray chemistry and data analysis procedures were completed. Double stranded cDNA was synthesized using the GeneChip Array protocol from Affymetrix ( SuperScript DoubleStranded cDNA Synthesis Kit ; Invitrogen) using 5 to 8 g of total cellular RNA as a template. Double stranded cDNA was purified and used as a template for labeled cRNA synthesis. In vitro transcription was performed using a BioArray High Yield RNA Transcript Labeling Kit (T7; Enzo Life Science, Farmingdale, NY) to incorporate biotinylated nucleotides. cRNA was subsequently fragmented and hybridized on microarray chips with proper controls. The microarrays were hybridized for 16 h at 45 C, stained with phycoerythrinconjugated streptavidin, and washed using the Affymetrix protocol (EukGE WS2v4) with an Affymetrix fluidics station, and followed by scann ing with an Affymetrix GeneChip III Scanner Microarray data analysi s was performed as previously described [ 216 ] Affymetrix controls and probe sets whose signals were not detected in all samples were removed from the analys is using expression filters. The remaining data set of intensity values were variance normalized, mean centered, and ranked by their coefficients of variation. Unsupervised hierarchical cluster analysis was performed on the data set with the most variation across samples to reduce the background signal

PAGE 61

61 variation on the analysis using Cluster software [ 217 ] Treeview software was used to generate the heat map and cluster dendrograms [ 217 ] Analysis was completed to assess the extent of HCAEC responses to the S. mutans OMZ175 challenge over time. Next, a supervised analysis was completed using log transformed raw signal intensities for the probe sets that passed the initial expression filters in order to investigate the gene regulation differences among treatments. BRB Array Tools (R. Simon and A. PengLam, National Cancer Institute, Rockville, MD) were used to correlate the log transformed signal intensities. In each supervised analysis, biological replicates were grouped into classes based on treatment, and probe sets significant at the P <0.001 level for the class were identified. Next, leaveoneout crossvalidation (LOOCV) studies were used to compute the misclassification rate. The significant probe sets were then used with nearest neighbor predictor analysis. Statistical Analysis One way analysis of variance ( ANOVA) statistical analysis with Tukeys post hoc tests was performed using GraphPad Prism version 5.00 for Windows, GraphPad Software, (San Diego, CA; http://www.graphpad.com/ ). Two way analysis of variance statis tical analysis with Bonferroni post hoc tests was used to determine mean differences over time. Bacterial CFU were log transformed prior to statistical analysis. Statistical significance was defined as p value less than 0.05. Results S. mutans OMZ175 Invad es Human Oral Cells in C ulture. T his laboratory and our collaborators have reported that S. mutans OMZ175 invades and persists within primary endothelial cells in culture and that the bacterial cell surface protein, Cnm, may contribute to systemic disease Therefore, we wanted to

PAGE 62

62 investigate whether cnm expressing S. mutans could potentially use host cells that reside in the gingival tissues as a reservoir for S. mutans induced systemic diseases [ 31, 126 ] To this end, primary human oral cell lines (HOK and HGF 1) were infected with invasive S. mutans OMZ175 and invasion deficient strains OMZ175: cnm and U A159. The data indicate that the presence of Cnm contributed to S. mutans attachment and invasion of HOK when compared to strains without cnm In a representative experiment, all of the S. mutans strains tested were able to attach to HOK ( OMZ175, 5.8 E5 2.0 E5 CFU ; S. mutans OMZ175: cnm 9.1 E4 2.3 E4 CFU; UA159, 1.8 E4 3.4 E3 CFU; p< 0.001) though at different efficiencies, (OMZ175, 5.8 %; S. mutans OMZ175: cnm 0.76 %; UA159, 0.22 %) The number of intracellular bacteria were enumerated after complet ing a 5 h antibiotic protection assay, and the results indicate that cnm contributes to invasion of HOK (9.5 % of attached OMZ175 invaded HOK) but is not required for invasion, since 0.64 % of the OMZ175: cnm invaded the host cell, (OMZ175, 5.6 E4 8.3 E3 CFU; OMZ175: cnm 5.8 E2 1.6 E2; UA159, 3.1 6.3 ; p<0.001) In a representative experiment, there was no difference in the ability of the S. mutans strains to attach to HGF 1 in 30 min (OMZ175, 9.0 E3 2.0 E3 CFU; OMZ175: cnm 2.4 E3 1.9 E2; UA159, 5.2 E3 1.8 E3 p < 0.348). Despite the fact that all of the S. mutans strain attached to the HGF 1 only the strain with cnm was able to invade HGF 1 efficiently (OMZ175, 2.3 E4 9.2 E3 CFU; OMZ175: cnm 3.3 E1 4.2 E1; UA159, 2.3 E1 1.6 E1 p < 0.001) Figure 2 1B. These results demonstrate that

PAGE 63

63 different S. mutans strains are able to adhere to host oral cells, but only the strain with cnm was able to invade efficiently S. mutans invasion of HGF cells during epithelial injury may select for bacterial strains that are more commonly found in the blood as HGF reside in the vascularized connective tissue of the gingiva. Therefore, t ransmission electron microscopy was used t o assess S. mutans contact with the HGF 1 surface and to observe S. mutans localizat ion within HGF 1 cells Figure 2 2 and Figure 2 3 Electron m icrographs reveal ed that S. mutans OMZ175 was engulfed by filipodialike extensions on the surface of the host, and that the intracellular bacteria localized to single membrane vacuoles indicativ e of the endocytic pathway ( Figure 2 2). Furthermore, bacterial surface extensions were visible and appeared to come into direct contact with the host membrane indicating that the space between the bacterial cell and the vacuolar membrane may be a space w here bacterial cell surface molecules were washed away during sample processing ( Figure 2 3). The control noninfected HGF 1 cells contained vacuoles and filipodialike extensions similar to those observed in the presence of the bacteria ( Figure 2 4). S. mutans Does Not Replicate I ntracellularly. Previously, our laboratory and collaborators assessed HCAEC intracellular trafficking and persistence of S. mutans OMZ175 with transmission electron microscopy [ 127 ] After 24 h large numbers of S. mutans were observed in the cytoplasm of infected cells, suggesting that S. mutans escape the endosome and multiply within t he cytoplasm of the HCAEC. However, bacterial counts did not confirm bacterial intracellular replication as there was a net loss (approximately 1 log) in bacterial load at 29 h post infection when compared to the bacterial load at 5 h post infection [ 127 ]

PAGE 64

64 Since the ability of a bacterial pathogen to replicate intracellularly contributes to its persistence by providing a protective niche for growth and dissemination w e wanted to determine if intracellular S. mutans was able to replicate within endothelial cells In this study, intracellular bacterial growth curves were completed to determine the intracellular fate of S. mutans OMZ175 using continuous gentamicin treatment (50 g ml1) to kill bacteria that exited the host and chloramphenicol treatment (10 g ml1) to in hibit intracellular bacterial replication in the negative control. Results showed a reduction in v iable colony counts from antibiotic protection assays in both antibiotic treatment groups ove r 2 5 h with a one log reduction in cultivable intracellular S. mutans OMZ175 (Figure 2 5) There was no statistical difference in intracellular bacterial load between treatment groups for each of the assay time points (5, 10, 15, 20, and 25 h post infecti on) indicating that bacteria were likely not replicating intracellularly. This experiment was repeated with similar results. Since S. mutans normally grows in chains, the cell counts may have been underestimated, or the intracellular S. mutans may have r emained viable but become uncultivable over time which is a phenomenon that has been shown for other intracellular bacterial species isolated from human atheromas [ 11 27] Therefore, molecular techniques were used to measure relative amounts of bacterial 16S RNA transcripts in HCAEC compared to HCAEC 18S transcripts during S. mutans OMZ175 invasion over ti me (Figure 2 6 ) Similar to the viable colony counts, the relative amount of bacterial load decreased over time under continuous antibiotic treatment in both treatment groups These results indicate that intracellular S. mutans does not replicate with in HCAEC, and that S. mutans intracellular numbers begin to decline after 20 h

PAGE 65

65 Intracellular S. mutans Exit the H ost and Remain I nfectious. Results obtained from bacterial growth curves indicated that intracellular S. mut ans numbers decreased slowly over tim e (Figure 25) Thus we wanted to investigate whether intracellular S. mutans was able to exit endothelial cells and remain infectious allowing the invasion of other host cells Therefore, s equential antibiotic protection assays were performed with a sample size of 6 as described in the methods Briefly, HCAEC were infected with S. mutans OMZ175 for 2 h and then treated with antibiotics for 24 h to kill extracellular bacteria. The infected HCAEC were washed, detached, and overlayed onto uninfected HCAEC an d co cultured in media without antibiotics. After 24 h bacteria were enumerated from the coculture conditioned media ( 8.2 E5 6.0 E5 CFU n=12). These results demonstrated that S. mutans was viable after being passaged through a host cell. To determine whether host cell passaged bacteria were able to enter new cells, we compared the average i nitial intracellular bacterial load ( 1.0 E3 0.45 E3 CFU n=6 ) to the average intracellular bacterial load after overlaying infected HCAEC onto uninfected HCAEC ( 5. 7 E4 5.5 E4 CFU n=6 ) for 24 h (Figure 2 7) The results demonstrated that the total intracellular bacterial load increased, and this increase was statistically significant (p< 0.005) Since S. mutans does not replicate intracellularly, the bacteria must have exit ed the host replicated in the media, and entered into new cells However, this data does not eliminate the possibility that S. mutans may enter new host cell through intercellular spread. To determine if the host cell passaged bacteria that had propagated and aggregated in the media conditioned media were still infectious, conditioned media were collected, pelleted, resuspended in fresh culture media, and used to infect HCAEC. An antibiotic protection assay was performed: 1 h infec tion and 3 h an tibiotic treatment. The host cell

PAGE 66

66 twice, passaged bacteria were still infectious ( 2.0 E5 0.32 E5 CFU n=4) Additionally, t he bacteria in the conditioned media were tested for antibiotic susceptibility, since bacterial aggregates were visible. The aggregated bacteria were killed with 3 h of antibiotic treatment Confocal microscopy was also used to confirm that host cell passaged S. mutans were still infectious. HCAEC attached to coverslips were transfected with nonreplicating adenovirus expressing GFP. After 24 h separate HCAEC seeded in culture flasks were infected with S. mutans treated with antibiotics to kill extracellular bacteria, detached, and seeded over the HCAEC transfected with the viral vector This viral vector expresses GFP maximally 48 h post trans fection. S. mutans was observed in the GFP expressing HCAEC in the presence and absence of antibiotics suggesting that S. mutans entered into new cells directly from cell to cell contact and confirmed that exited bacteria were still infectious ( Figure 2 8 ). Cnm Affects the Expression of Endothelial Cell Cytoskeleton Linked P roteins. To determine if invasive S. mutans strain OMZ175 elicited a different host response th an the invasion deficient strain S. mutans OMZ175: cnm microarray analysis was performed. Table 2 2 contains a list of genes linked to cytoskeleton rearrangements that were differentially expressed after 1 h of infection with OMZ175 compared to the noninfected control (p<0.001) but were not differentially expressed after 1 h of infe ction with the OMZ175: cnm mutant compared to the noninfected control (p<0.001) as these genes are likely to be involved in Cnm induced pathways. Since cytoskeletal rearrangements can be associated with mechanisms of endocytosis this data suggests that fut ure work should be conducted to investigate the role Cnm may have in host cell responses in terms of bacterial induced entry.

PAGE 67

67 S. mutans OMZ175 Invades H uman Coronary Artery Smooth Muscle C ells Now that there was evidence that S. mutans OMZ175 was able to exit HCAEC and remain infectious, we wanted to determine if S. mutans was able to invade arterial smooth muscle cells, as they are in close proximity to endothelial cell s, typically separated by a basement membrane. However, stimulated endothelial cells c an induce a cytokine response that may ultimately result in smooth muscle proliferation, as manifested in the disease atherosclerosis. Furthermore, an ability to invade smooth muscle cells would indicate the potential for S. mutans to traverse the endothel ial lining and disseminate in to deeper tissues Four wildtype strains of S. mutans and their cognate cnm mutants: OMZ175, OM50E, LM7, and NCTC11060 were used to determine the role of Cnm in CASMC adherence and invasion as Cnm has already been reported to have a role in the ability of these S. mutans strain to invade HCAEC [ 126 ] The mutant strains were provided by our collaborator Dr. Jacqueline Abranches. S. mutans UA159, a natural cnm negative strain, w as used as a negative control. All of the S. mutans strains tested were able to adhere to CASMC, and there was no statistical difference between the adherence efficiency of each wildtype and cognate cnm mutant strain pair ( Figure 2 9 ). This indicates that each of the S. mutans strains was able to attach to CASM C in a Cnm independent manner. However, invasion results showed that wildtype S. mutans strains expressing cnm were more successful at invading CASMC by a factor of ~2 logs with a statistical di fference of p< 0.05 (Figure 29 ). Additionally, t he cnm mutant strains abilitie s to invade were not significantly different than that of the natural cnm negative strain UA159. Transmission electron mi croscopy was used to confirm S. mutans OMZ175 invasion of CASMC, ( Figure 2 10, 2 11) CASMC were infected with 100 CFU per host

PAGE 68

68 cell. After 2 h the CASMC were processed as described in the methods. E lectron micrographs reveal that S. mutans OMZ175 was engulfed by filipodia like extensions on the surface of the host, and that the intracellular bacteria localized to single membrane vacuoles ( Figure 2 10). Similar to the HGF 1 results bacterial adhesins were visible and appeared to come into contact with the host membrane ( Figure 2 11). The control noninfected CASMC contained vacuoles and filipodialike extensions similar to those observed in the presence of bacteria ( Figure 2 12). With evidence of S. mutans OMZ175 CASMC invasion, we wanted to know if S. mut ans was able to replicate intracellularly. M olecular techniques were used to measure relative amounts of bacteria gDNA normalized to CASMC gDNA over time (Figure 213). T he relative amount of bacterial load decreased over time under continuous antibiotic t reatment. These results do not support the hypothesis that intracellular S. mutans replicates in CASMC. In contrast, bacterial gDNA in the pulse antibiotic treated samples increased 5 fold; the pulse antibiotic treated group served as the positive control, since this group was cultured in antibiotic free media after the initial 5 h antibiotic protection assay. Since there is no evidence of intracellular replication, t hese results support the evidence that S. mutans is capable of exiting the host in a viable state. The negative fold change in CASMC gDNA at 10 h post infection was likely due to the wash steps and media replacement subsequent to the antibiotic protection assay. Discussion Human oral keratinocytes and gingival fibroblasts have an important role in immune surveillance of the gingiva by functioning as the first line of defense against microbial subgingival colonizers. During periodontal disease, activated HOKs recruit

PAGE 69

69 neutrophils to the gingival crevice to mount an immune response against the subgingival plaque. During this immune attack, HOKs may become the indiscriminate target of neutrophil degranulation, causing nonlytic detachment injury, which leaves the underlying connective tissue unprotected [ 218221] Once the connective tissue is exposed to infected gingival crevicular fluids, clotting cascades are activated, closely followed by HGF activation, migration, and proliferation, in an effort to prepare the wound for reepithelialization. Since keratinized epithelium continually grows upward from the basal cell layer shedding dead cells into the oral cavity, S. mutans invasion of HOK cells may act as a reservoir for HGF infection, but would not be expected to directly bring S. mutans closer to the circulatory system Figure 2 14. Thus f or the purpose of this study HGF cells, rather that HOK cells, were selected to investigate the potential of S. mutans to use oral host cells to gain access to the cir culatory system. Attachment and invasion of host cells by bacteria typically involve specific adhesins expressed on the surface of bacterial cells that recognize specific tissue types. Thus, bacteria are known to have a predilection for specific tissue ce ll types and environments. For example, S. mutans is abundant in dental plaque but is not found in high numbers on the epithelial surfaces of the tongue; however, S. salivarius is typically absent in dental plaque, but colonizes epithelial cells of the ton gue in high numbers [ 222 ] Moreover, m ost bacterial pathogens have evolved to express adhesins that bind to specific host cell receptors. For example, adhesins, such as FbaB, expressed by certain strains of Group A Streptococci have been shown to be i nvolved in endothelial cell invasion and linked to invasive diseases such as necrotizing fasciitis [ 167] However, some bacterial adhesins are less discriminating and bind to certain categories

PAGE 70

70 or types of host cell surface molecules ( e.g., carbohydrate and protein motifs). For example, the S. mutans PAc protein has been shown to specifically bind to 5 integrins expressed on endothelial cells, yet this adhesin has also been shown to specifically bind to additional host protein motifs such as collagen and fibronectin. While studies have demonstrated that PAc is involved in host cell adhesion, it does not appear to efficiently trigger invasion in endothelial cells or gingival fibroblasts Thus, ot her bacterial adhesins are suspected to be involved in the mechanism of host cell invasion. Epidemiological studies have reported that the S. mutans serotype distribution in the oral cavity of healthy individuals differs from that of patients with cardiovascular disease [ 88 154 223 224] Furthermore, the oral cavity and cardiovascular tissues of patients with cardiovascular disease were reported to have different S. mutans serotype distributions with an increase of rare and untypable serotypes in both the oral cavities and atherosclerotic tissues of patients with cardiovascular disease. These tissue serotype distribution differences suggest that certain serotypes of S. mutans are more likely to enter the bloodstream, encounter, adhere to, and multiply within cardiovascular tissues than other serotypes Other studies have reported that Cnm is expressed by about 10% of S. mutans clinical strains, and that t here is also a rare serotype bias for the presence of this gene [ 67, 89, 124 125] Furthermore, r ecent reports have shown that strains of S. mutans that express Cnm are able to invade and persist in human coronary artery endothelial cells (HCAEC), whi le the Cnm negative strains were found to be invasion deficient [ 126 127 ] The results of this st udy demonstrate that S. mutans OMZ175 invasion of oral keratinocytes, gingival fibroblast s, and smooth muscle cells is dependent on the

PAGE 71

71 presence of Cnm. A dditionally, this study found no evidence that S. mutans replicates intracellularly in endothelial cel ls but it is possible that there are other cell types or cellular conditions in which intracellular S. mutans can replicate. The study also demonstrates that host cell passaged S. mutans remain v iable and infectious after exiting endothelial cells The se r esults suggest that S. mutans is able to enter the oral epithelium to reside within cells found in deeper gingival tissues which may allow S. mutans increased access to the vasculature of the gingiva. Consequently, the ability of S. mutans to invade oral c ells may contribute to its ability to cause systemic disease. Thus individuals with invasive strains of S. mutans may be at increased risk of infectious systemic disease s, especially if they have other comorbidities that contribute to inflammation such a s gingivitis, diabetes or obesity A s this is the first study to demonstrate that S. mutans invades coronary artery smooth muscle cells, it demonstrates the potential of S. mutans to traverse the endothelium and disseminate into deeper arterial tissues where it may contribute to chronic cardiovascular diseases such as atherosclerosis consistent with S. mutans exiting host cells having the ability to infect other cells. This study presents data that demonstrates that Cnm is key to the ability of S. mutans t o both attach to and enter oral keratinocytes in contrast to gingival fibroblasts, with which Cnm is significantly involved in the invasion of but not the adherence Thus Cnm appears to be an adhesin for S. mutans attachment to oral keratinocytes but not to gingival fibroblasts O ral streptococci including S. mutans have been previously reported to attach to and inhabit human buccal cells [ 225 227 ] Reports hav e also suggested that t he ability of S. mutans to enter oral cells may provide a

PAGE 72

72 competitive advantage for colonizing tooth surfaces in children, as S. mutans has been isolated from the oral cavities of predentate children [ 228230 ] S. mutans and S. sobrinus have both been previously reported to adhere to and invade gingival fibroblasts, especially when present in biofilm s [ 206 ] Fibroblasts are located in the connective tissues under the epithelium and function to form extracellular matrix substances such as c ollagen and elastin. When gingival tissues become inflamed, the vasculature becomes more permeable and leaky and the gingival crevice can deepen, acting as a reservoir for multiple bacterial species. The results of the study reported here suggest that indi viduals with cnm expressing strains of S. mutans may be at an increased risk of bacteremia and other diseases outside the oral cavity. Based on the results, we propose a model for S. mutans route from the gingival tissues to the circulatory system ( Figure 2 1 5 ). T he intracellular location of S. mutans OMZ175 was previously, confirmed in endothelial cells using transmission electron microscopy at 30 min, 5 h and 29 h post infection [ 127 ] The Abranches et al. 2009 study demonstrated that S. mutans entered HCAEC and were initially found in single and multiple membrane vacuoles but at 5 and 29 h post infection, some bacteri a escaped to the cytoplasm, while thos e bacteria in vacuoles appeared intact suggesting the absence of lysosomal fusion [ 127 ] Other studies have shown that once inside the host cell, some pathogens ( e.g., S. pyogenes ) are destroyed by exposure to increasingly acidic and proteolytic conditions of the early, late, and lysosomal compartments, while other pathogens are able to subvert this degradative pathway. Interestingly, we found that a fter 2 9 h large numbers of S. mutans were found in the cytoplasm of infected cells, suggesting that S. mutans

PAGE 73

73 replicates inside HCAEC and escape the endocytic pathway before the late endosome and lysosome fuse. However, bacterial plate counts from antibiotic protection assays did not support this in that CFUs did not increase over time Attachment, entry, trafficking, persistence, and exit are all important for successful bacterial invasion of host cells [ 231 ] Previous reports described each of these stages to occur during S. mutans invasion of endothelial cells except the abilit ies to replicate intracellularly ( potentially contributing to persistence) and to exit the host [ 127 ] Thus we investigated the ability of S. mutans OMZ175 to replicate within endothelial cells and determine d whether S. mutans was able to exit the host We also sought to determine if bacteria that exit a cell are still infectious. The results of i ntracellular bacterial growth curves and molecular methods to study intracellular replication (Figure 2 5 and 26 ) indicate that S. mutans was able to persist within primary endothelial cells but there was no evidence of intracellular replication. S. mutans is dependent on carbohydrat es for energy; however, a ready source of unphosphorylated carbohydrate would not likely be available inside of the host which is consistent with our findings T h e study reported here also demonstrate s that S. mutans OMZ175 is able to exit host cells and that host cell passaged bacteria are still infectious. Additionally, microarray analysis found that the presence of Cnm changes endothelial gene expression patterns in HCAEC including genes linked to cytoskeletal rearrangements. However, future studies mus t be performed to determine if cytoskeletal rearrangements are involved in Cnm mediated entry Reports on Group A Streptococci mechanisms of invasion provide evidence that different cell adhesins direct entry of endothelial and epithelial cells through mul tiple

PAGE 74

74 pathways [ 166, 232 234 ] Based of the results of our study, we propose an invasion cycle model of cardiovascular tissues ( Figure 2 16). The limitations of this study can be attributed by in large to the in vitro model (s) used to investigate S. mutans invasion and trafficking. For instance, the 12 log difference in bacterial adherence and invasion bet ween HOK and HGF 1 may be due to their morphological difference as HOK have a cobblestonelike appearance and HGF 1 are spindle shaped. Although the confluent mono layers used in the assays are more physiologically relevant when studying host cell endotheli um and epithelium interactions with bacteria, as bacteria might be expected to come into direct contact with these cell types in the oral cavity or the bloodstream the limitations of the model must be considered when interpreting fibroblast and smooth mus cle cell invasion data as these cells are typically surrounded by collagen, a likely competitive inhibitor for Cnm interactions with host cell surface molecules. Furthermore, it is unknown whether S. mutans enters the bloodstream in a planktonic or biofilm state. This study was completed using planktonic S. mutans Future studies will be directed toward understanding the mechanism of S. mutans entry into endothelial cells as the mode of entry may influence the intracellular trafficking and fate of the bac teria

PAGE 75

75 Table 21. S. mutans strains used in this study Strain Origin Serotype Source UA159 Dental plaque c University of Alabama OMZ175 Dental plaque f B. Guggenheim LM7 Dental plaque e P. Caufield OM50E Dental plaque e P. Caufield NCTC11060 Dental plaque f University of Rochester OMZ175 : cnm cnm knockout University of Rochester OM50E: cnm cnm knockout University of Rochester LM7: cnm cnm knockout University of Rochester NCTC11060: cnm cnm knockout University of Rochester *Strains obtained from J. Abranches at the U niversity of Rochester [ 126 ] Table 2 2 Microarray d ifferential gene expression in HCAEC due to Cnm interactions 1 h post infection Cytoskeleton rearrangements Endocytic pathway Upregulated ARF6, ARHGAP42, CDC42SE2, CTNNB1, C2CD4B, DOCK10, EHBP1, EZR, GIT2, GBP1, ITGB3, MERTK PRKCE, PIP5K1A, RGL1, SORBS1, SOS2, SPIRE1, SPTAN1, SWAP70, TBC1D1, TRIO AP1S3*, AP3B2*, AP PL2*, ARF6*, CLINT1*, CPNE3, CPNE8, EHBP1*, LDLR*, GIT2, MERTK, MAP3K2**, PHLDB2, PICALM*, PIP5K1A, RHOB*, RHOBTB3, SCIN, SCLT1*, SCYL2*, SNX18*, WDFY1 Downregulated ACTR2, ITGA7, PRKAA1 AAGAB*, AAGAB, ANXA2P1, ANXA2P3, ATG16L2, CEACAM3, EHD4*, SDPR** VPS13A* Genes linked specifically to *clathrin and **caveolin mediated endocytosis

PAGE 76

76 Figure 21. S. mutans attach ed and intracellular A) HOK and B) HGF 1 Host cells were infected for 30 min (adherence assay) or 5 h (antibi otic protection assay) with 100 CFUs per host cell The number of viable S. mutans CFUs recovered is shown SD. S. mutans OMZ175 ( cnm positive strain) attached and invaded HOK and invaded HGF than more efficiently than the cnm negative control strains: OM Z175:cnm and UA159. However, the presence of cnm did not appear to contribute to HGF attachment. This figure is representative of at least 3 separate experiments. One way analysis of variance (ANOVA) statistical analysis with Tukeys post hoc tests was used to determine mean differences of log transformed data points. ( ***, p< 0.0 01)

PAGE 77

77 Figure 22 Electron m icrograph of HGF 1 invasion by S. mutans OMZ175 after 2 h of infection The HGF 1 were detached, fixed and prepared for transmission electron microscopy prior to being examined with a Hitachi H 7000 TEM Attached bacteria appear ed to be engulfed by filipodia like extensions ( black arrows ) Upon entry, i ntracellular bacteria were found in membrane bound vacu oles ( white arrows ) None of the bact eria were observed free in the cytoplasm.

PAGE 78

78 Figure 23 Electron m icrograph of S. mutans OMZ175 invasion of HGF 1 after 2 h infection Bacterial cells enter ed through a vacuole with a single membrane. Structures that appear to be bacterial adhesin s were visible (white arrows) and appeared to be in contact with the HGF 1 membrane (black arrows).

PAGE 79

79 Figure 24 Electron m icrograph of uninfected HGF 1 V acuoles and filipodia like extensions can be observed.

PAGE 80

80 Figur e 25 Intracellular S. mutans OMZ175 growth curve. The number of S. mutans CFUs recovered from intracellular compartments. Gentamicin was used to kill any bacteria that exited the host, and chloramphenicol was used to inhibit bacterial replication within the host cell. Two way ANOVA with Bonferroni post hoc tests was used to calculate mean differences in log transformed data points per antibiotic treatment for each individual time point. ANOVA statistical analysis with Tukeys post hoc tests was used to determine mean differences of log transformed data points within in the same treatment group over time. There was no difference in intracellular bacterial load when comparing mean values between treatment groups at each of the time points. However, there was a statistical difference in bacterial load within the same treatment group between time s 5 and 25 h and 5 and 30 h (p< 0.001). This figure is representative of 2 separate experiments.

PAGE 81

81 Figure 26. Molecular methods to measure bacterial replication over time using RT PCR. HCAEC were infected for 2 h washed, and delivered a 3 h pulse of media with gentamicin and penicillin G antibiotic to kill extracellular bacteria. Next, the antibiotic media was aspirated, washed, and replaced with gentamicin (50 g ml1) chloramphenicol (10 g ml1) for continuous antibiotic treatment. gDNA was isolated every 2.5 h for a total of 25 h RT PCR data was analyzed by the comparative Ct method [ 235 ] The average Ct value of replicates was determined per sample A) t, average Ct of bacterial 16S gene average Ct of host 18S was calculated to normalize the t t n t 5 h) was calculated and used to calculate the fol d change ( 2) in bacterial load per host cell If the fold change value was less than 1 then there was a reduction in bacterial load. For all calculations n is the value at time points after 5 h

PAGE 82

82 Figure 27 Sequential antibiotic protection assays to determine if host cell passaged S. mutans remain vi able and infectious. Comparison of i nitial intracellular bacterial load to the intracellular bacterial load after overlaying infected HCAEC onto uninfected HCAEC. Students t test was used to determine statistical significance between the log transformed r ecovered CFUs. ( p< 0.005, n=6)

PAGE 83

83 A) B) Figure 28 Micrographs of s equential antibiotic protection assays to determine if HCAEC passaged S. mutans remain viable and infectious. Overlaying S. mu tans OMZ175 infected HCAEC onto adenovirus GFP transfected HCAEC in the A) absence B) presence of antibiotics. S. mutans OMZ175 infected HCAEC exit the host to infect AdGFP expressing host since bacteria were found in the GFP labeled cells. Green color i ndicates fluorescence at 488 nm and red at 647 nm.

PAGE 84

84 A) B) Figure 29 S. mutans A) attachment and B) invasion of CASMC. Results indicate that cnm expression does not contribute to attachment, but does contribute to invasion of CASMC The number of viable S. mutans CFUs recovered is shown SD. One way analysis of variance (ANOVA) statistical analysis with Tukeys post hoc tests was used to determine mean differences of log transformed data points ( ns not significant ***, p< 0.0 01) This figure is representative of three separate experiments.

PAGE 85

85 Figure 210 Electron micrograph of CASMC invasion by S. mutans OMZ175 after 2 h of infection. The CASMC were detached, fixed and prepared for transmissi on electron microscopy prior to being examined with a Hitachi H 7000 TEM Attached bacteria appeared to be engulfed by filipodialike extensions (black arrows). None of the bacteria were observed free in the cytoplasm.

PAGE 86

86 Figure 211 Electron microgr aph of S. mutans OMZ175 invasion of CASMC after 2 h infection. Bacterial cells entered through a vacuole with a single membrane. Structures that appear to be b acterial adhesins were visible ( red arrows) and appeared to be in contact with the CASMC membrane (black arrows).

PAGE 87

87 Figure 212. Electron micrograph of uninfected CASMC Vacuoles and filipodia like extensions can be observed.

PAGE 88

88 Figure 21 3 Molecular methods to measure bacterial replication over time using RT PCR. CASMC were infected for 2 h and treated with continuous or 3 h pulsed antibiotics. gDNA was isolated at 5, 10, 24, and 48 h post infection. The relative fold change of 16S to 18S rRNA gene copies over time was calculated using the comparative Ct method, normalized to 5 h data [ 235 ] S. mutans OMZ175 replication was observed in the pos itive pulsed antibiotic control at 24 and 48 h post infection but not in the continuous antibiotic treatment groups.

PAGE 89

89 Figure 214. Reservoir Model: Oral Tissue. This diagram depicts our reservoir model for S. mutans infecti on of oral epithelium and dissemination to gingival fibroblasts. In this model, S. mutans attaches to and may invade oral epithelial cells and these cells become a reservoir for future oral infections (i.e. dental caries). As epithelial cells serve as a regenerative protective barrier, the infected epithelial cell is likely to undergo shedding or cell death. Under conditions of periodontal disease or mechanical injury, the connective tissues and supportive cells are exposed. Once the connective tissue is ex posed to oral bacteria, gingival fibroblasts become activated; and these cells proliferate, fill in the wound bed with extra cellular matrix (e. g. collagen), and initiate an immune response through the production of cytokines. Once the connecti ve tissue i s exposed, invasive S. mutans have an opportunity to enter gingival fibroblasts which then become a reservoir for dissemination, and these bacteria may gain access to the circulatory system. HOK human oral keratinocytes; HGF human gingival fibroblasts; OMZ175 invasive strain of S. mutans

PAGE 90

90 Figure 215. Overview of S. mutans invasion of human tissues. Flow chart of the proposed route of infection from the oral cavity to the artery and disease outcome with graphic diagram to illustrate the proposed route of infection. G means gingival epithelium.

PAGE 91

91 Fig ure 2 16. Invasion Cycle Model: Cardiovascular Tissue. This diagram depicts our invasion cycle model for S. mutans infection of human coronary ar tery endothelial cells (HCAEC) and dissemination to intimal resident arterial smooth muscle cells (CASMC). In this model, S. mutans attaches to and may invade HCAEC. The intracellular bacteria then cycleout of the HCAEC into the tunica intima where they c an replicate and disseminate to intimal resident CASMC. Once invasive S. mutans have an opportunity to enter CASMC, they may become a reservoir for persistence. OMZ175invasive strain of S. mutans

PAGE 92

92 CHAPTER 3 GENE EXPRESSION CHAN GES IN HCAEC DURING IN FECTION WITH STREPTOCOCCUS MUTANS OMZ175 Introduction In healthy tissues, vascular endothelial cells maintain blood fluidity, regulate blood flow, control vessel wall permeability and quiesce circulating leukocytes (reviewed in [ 236238 ] Failure of endothelial cells to adequately perform any of these basal functions constitutes endothelial dysfunction, a contributing factor to atherosclerosis and other types of cardiovascular disease. Atherosclerosis is a progressive disease that results from an excessive, inflammatory fibroproliferative response to various forms of insult to the endothelium and smooth muscle of the artery wall [ 239] It is char acterized by the formation of plaques consisting of foam cells, immune cells, vascular endothelial cells, smooth muscle cells, platelets, extracellular matrix, and a lipidrich core with extensive necrosis and fibrosis of surrounding tissues [ 239 ] In the initial stages of lesion formation, activated endothelial cells present several types of leukocyte adhesion molecules at their membrane surface and secret e cytokines [ 240 ] Cytokines, small soluble proteins that include interleukins, interferons, growth factors, colony stimulating factors, cytotoxic factors, activating or inhibitory factors and chemokines play important roles in not only tissue homeostasis but in regulating the intensity and duration of the immune response in many infectious diseases. Various c ytokines f ound to be expressed by endothelial cells in atherosclerotic lesions include interleukin1 (IL 1 ), IL 1 IL 5, IL 6, IL 8 (CXCL8) IL 11, IL14, IL 15, GM CSF, M CSF, and CD40L [ 241 242] and are reviewed in Tedgui and Mallat [ 243 ] Leukocyte recruitment into sites of inflammation is a tightly regulated process. Although cytokines are crucial in this process, adhesion molecules present in the

PAGE 93

93 membrane of endothelial cells are also equally important as several of these molecules have been shown to be detected in atherosclerotic lesions [ 244 245 ] The role of adhesion molecules in the development and progression of atherosclerosis is reviewed in Blankenberg et al. [ 246 ] Briefly, a ctivated endothelial cells express both soluble and membrane anchored adhesion molecules including P selectin, E selectin, vascular cell adhesion molecule 1 (VCAM 1) and intercellular adhesion molecule 1 (ICAM 1), allowing for the adhesion and diapedesis of leukocytes to the site of inflammation/infection [ 244, 247 ] Different studies have shown modulation of cytokines and adhesion molecules in endothelial cells in response to stimulation by multiple microorganisms including S. mutans [ 248252 ] The p urified recombinant P Ac protein of S. mutans OMZ175 has been shown to directly upregulate E selectin, ICAM 1, and VCAM 1 mediated by lectin activity for N acetylneuraminic acid and Lfucose containing rec eptors [ 253, 254 ] Studies have shown that purified recombinant P Ac on the surface of human saphenous vein endothelial cells (HSVEC) in an N acetylneuraminic acid dependent manner [ 140 189 ] Furthermore, the purified recombinant P Ac protein and the purified rhamnose glucose polymer of S. mutans OMZ175 have been show n to bind and signal through toll like receptors TLR2 and TLR4 and the membrane anchored co receptor CD14 [ 255257 ] Endothelial cel ls constitutively express TLR4 and increased expression level s of TLR4 in atherosclerotic lesions has been s hown to correlate with plaque destabilization and plaque progression [ 149 258 261 ] To date, studies directly investigating the role of other S. mutans

PAGE 94

94 adhesins, like Cnm, in modulating the expression of endothelial adhesion molecules have not been reported. Human aortic endothelial cells infected with S. mutans upregulate inflammatory cytokine product ion (IL6, IL 8, CCL2 ) consistent with the hypothesis that S. mutans is involved in the pathogenesis of atherosclerosis [ 253 262 263 ] Using an in vivo model of restenosis in an atherogenic mouse model, S. mutans mediated an exacerbation of disease pathology demonstrated by atherosclerotic plaque, incre ased inflammation in the outer adventitial area, a nd macrophage infiltration [ 31] In this study microarray technology was used to investigate the global trans criptional responses of primary human coronary artery endothelial cell (HCAEC) to S. mutans OMZ175 challenge d at 1 and 5 h compared to uninfected control. There were 7,550 probe sets reported to be differentially expressed between the groups (f alse detecti on rate; FDR <0.05). There is evidence that apoptotic cells are found within atheromatous tissue ( e.g., foam cells) and that apoptosis of endothelial cells may have a role in the progression of atherosclerosis [ 264 266 ] Many bacterial species, including streptococci, can modulate host cell apoptosis [ 177 267 272 ] For example, S. gordonii and S. pyogenes have been shown to induce apoptosis in epithelial and endothelial cells, respectively [ 177, 269] In addition, lipoteichoic acids of S. mutans have been shown to affect the growth and the mitotic activity of epithelial cells [ 273 ] and to induce apoptosis in dental pulp cells [ 274 ] However, information regarding the effects on the fate of HCAEC upon contact/ invasion with live S. mutans to this point had been lacking.

PAGE 95

95 Materials and Methods Preparation of C onfluent Human Cells in C ulture. Primary human coronary artery endothelial cells (HCAEC; Lonza, Allendale, NJ), were cultured in endothelial cell basal medi um 2 (EBM 2; Lonza) supplemented with EGM 2MV singleuse aliquots (Lonza) for a maximum of 8 passages The primary cells were maintained at 37 C in a humidified, 5 % CO2 atmosphere. The cells were washed with H anks buffered s aline solution (HBSS; Corning Inc., Manassas, VA) detached using Accutase (Innovative Cell Tech., Inc., San Diego, CA) and washed in cell appropriate media. The cells were counted using a Coulter Counter (Beckman Coulter Model Z1; Brea, CA) and seeded in flat bottom tissue culture treated plates (Corning) followed by overnight incubation at 37C in a 5% CO2 atmosphere. Bacterial Culture S. mutans was cultured in Todd Hewitt broth overnight (TH; Becton Dickinson & Co.). Bacterial cultures were pelleted at 4,629 x g for 5 min using a table top centrifuge at rt Culture conditio ned media were aspirated, and the pellets were resuspended in sterile phosphatebuffered saline (PBS, pH 7.2; Corning). Next the bacteria were diluted in EBM2 complete media without antibiotics to obtain bacterial suspensions containing 100 colony forming units (CFU) per host cell Gene Expression Analysis This experiment wa s designed to evaluate gene expression changes of HCAEC infected by S. mutans OMZ175 over time using GeneChip Human U133 Plus 2.0 Array (Affymetrix, Inc; Cleveland, OH). HCAEC were co cultured with bacteria at 100 cfu per host cell Q uadruplicate repeats were carried out for each treatment After either 1 or 5 h post infection, total RNA was extracted using the RNeasy mini kit from

PAGE 96

96 Qiagen, treated with DNase I, purified, and quantified by using standard methods cDNA was synthesized using the GeneChip Array protocol from Affymetrix ( SuperScript DoubleStranded cDNA Synthesis Kit ; Invitrogen); 5 to 8 g of total cellular RNA was used as a template to amplify mRNA species for detection. Double stranded cDNA was purified and used as a template for labeled cRNA synthesis. In vitro transcription was performed using a BioArray HighY ield RNA Transcript Labeling K it (T7; Enzo Life Science, Farmingdale, NY) to incorporate biotinylated nucleotides. cRNA was subsequently fragmented and hybridized on GeneChip Human U133 Plus 2.0 Array (Affymetrix) w ith proper controls. The microarrays were hybridized for 16 h at 45 C, stained with phycoerythrinconjugated streptavidin, and washed using the Affymetrix protocol (EukGE WS2v4) with an Affymetrix fluidics station, and then followed by scanning with an Affymetrix GeneChip III Scanner Microarray data analysis was performed as previously described [ 216 ] Affymetrix controls and probe sets whose signals wer e not detected in all samples were removed from the analysis using expression filters. The remaining data set of intensity values were variance normalized, mean centered, and ranked by their coefficients of variation. Unsupervised hierarchical cluster anal ysis was performed on the data set with the most variation across samples to reduce the background signal variation on the analysis using Cluster software [ 217 ] Treeview software was used to generate the heat map and cluster dendrograms [ 217 ] Analysis was completed to assess the extent of HCAEC responses to the S. mutans OMZ175 challenge over time. Next, a supervised analysis was completed using log transformed raw signal intensities for the probe sets that passed the initial expression filters in order to

PAGE 97

97 investigate the gene regulation differences among treatm ents. BRB Array Tools (R. Simon and A. PengLam, National Cancer Institute, Rockville, MD) were used to correlate the log transformed signal intensities. In each supervised analysis, biological replicates were grouped into classes based on treatment, and probe sets significant at the P <0.001 level for the class were identified. Next, leaveoneout crossvalidation (LOOCV) studies were used to compute the misclassification rate. The significant probe sets were then used with nearest neighbor predictor analy sis. RT2 Profiler PCR Array This assay was performed using RNA that was collected for the microarray assay as directed by manufacturer s protocol and was used t o validate gene expression levels for human adhesion molecules 5 hrs post infection RNA ( 0 .5 ug ) from each replicate (n=4) was pooled, and single strand cDNA was synthesized using the RT2 First S trand K it (Qiagen). The data was analyzed using the web based data analysis tool RT Profiler PCR Array Data Analysis version 3.5 [ 275 ] Expression levels were normalized to the average CT values generated by HPRT1, RPL13A, GAPDH, and ACTB. RT PCR Validation HCAEC were co cultured with bacteria at 100 CFU per host cell. Co cultures and uninfected contr ol were carried out in triplicate. After 5 h infection, total RNA was extracted using the RNeasy mini kit from Qiagen, treated with DNase I, purified, and quantified by using standard methods. Single strand cDNA was generated from RNA samples using iScript cDNA synthesis kit (Bio Rad) as per the manufacturer s instructions. The RT PCR reactions wer e prepared using IQ SYBR Green RT PCR kit (Bio Rad) as per the manufacturer s instructions with custom primer pairs (Table 31) to

PAGE 98

98 gene targets and run on an iQ 5 icycler (Bio Rad). RT PCR data was analyzed by the comparative Ct method. The average Ct value of replicates was determined per target. t, average Ct of target gene average Ct of betaactin control gene, was calculated t t infected t uninfected) was calculated to determine the difference in expression of target genes. To determine the fold change in expression value for each target gene, the 2was calculated. Enzyme Linked Immunosorbant Assay (ELISA) The level of cytokine proteins ( IL 6, IL 8, IL 1 IL 1 ) secreted by HCAEC during invasion with S. mutans OMZ175 was investigated using capture ELISA For this, HCAEC were seeded in 24 well plates to confluence for 24 h HCAEC were in fected with S. mutans for 5 h at 100 CFU per host cell in EBM2 complete media without antibiotics. The conditioned media were collected and stored at 80 oC For ELISA, culture conditioned media were thawed on ice and assayed according to the manufactures instruction. Human IL 6 CytoS et, Human IL 8 CytoSet, and Human IL 1 CytoSet (Invitrogen, Camarillo, CA) ELISA kits were used with the manufacturer recommended Buffer Kit for Antibody Pairs (Novex). Human IL1 /IL 1F1 Quantikine ELISA kit supplied all assay materials (R&D Systems Inc., Minneapolis, MN). The level of vascular endothelial growth factors (VEGF) and platelet derived growth factor (PDGF AA) produced by HCAEC after 24 h of infection with S. mutans OMZ175 was investigated using capture ELISA For this, HCAEC were seeded in 24 well plates to confluence for 24 h The standard media (EBM 2) for culturing endothelial cells contains growth factor rich fetal bovine serum ( FBS ) and additional growth factor supplements, such as VEGF; therefore the media used to infect HCAEC for ELISA analysis was RPMI media supplemented with 0.1% FBS (Atlanta Biologicals, Inc.,

PAGE 99

99 Flowery Branch, GA) and 1% bovine serum albumin (Sigma). HCAEC were infected with S. mutans for 5 h at 100 CFU per host cell in RPMI media with supplements without antibi otics. Conditioned media were aspirated, and the HCAEC were washed 2x with HBSS and placed in RPMI media with supplements and containing gentamicin (300 g ml1) and penicillin G (100 g ml1) The conditioned media were collected and stored at 80 oC. For VEGF and PDGF AA ELISA (Thermo Scientific, Rockford, IL) (Abcam, Cambridge, MA) conditioned media were thawed on ice and assayed according to the manufactures instruction. Caspase A ctivity A ssay C aspase activity was measured to determine the induction of apoptosis of HCAEC by S. mutans HCAEC extracts were collected at each time point of invasion and analyzed for caspase 3/7 activity using a colorimetric caspase assay ( Apo ONE Homogeneous Caspase3/7 Assay ; Promega, Madison, WI ) according to the manufa cturers instructions. The caspase substrate rhodamine 110, bis (N CBZ L aspatyl L glutamyl L valyl L aspartic acid amide; Z DEVD R110) is sequentially cleaved; and with the removal of DEVD peptides, the rhodamine 110 leaving group becomes intensely fluorescent. T he caspase activity was measured using the BioTek Synergy 2 Multi Mode Microplate Reader (Bio Tek Instruments, Winooski, VT ). The amount of fluorescent product produced is proportional to the amount of caspase 3/7 activity. C aspase involvement was evaluated by treating S. mutans challenged HC AEC with the irreversible broadspectrum caspase inhibitor z VAD FMK ( Calbiochem, ). Assays to D etermine the Ratio of Necrosis/A poptosis Two assays were used to determine the number of necrotic versus apoptotic infected cells. For the first assay, S. mutan sinfected HCAEC, at the indicated time

PAGE 100

100 points, were treated with propidium iodide (PI) and the nuclei were counterstained with Hoechst 33258 (Sigma Aldrich), which labels DNA. C ondensed chromatins are a universal marker of apoptotic cells. The number of PI positive cells (necrotic cells) and the number of condensed chromatincells (apoptotic cells) relative to the total number of nuclei per field were counted by fluorescence microscopy in a blind manner. Each condition was assayed in triplicate, and at least 300 cells were counted in each well. A topoisomerase inhibitor C amptothecin (SigmaAldrich ), was used as a positive cont rol for induction of apoptosis, and unchallenged HCAEC were used as the negative control. Microscopy Analysis of A poptosis E arly in the apoptotic cascade of events, phosphatidyl serine residues are translocated from the internal to external leaflet of the cell membrane, while the cell membrane retains its integrity. Accordingly, Annexin V binds specifically to phosphatidyl serine residues and was used as a probe for apoptosis [ 276 ] Ethidium homodimer III (EthD III) was used as an exclusion method for plasma membrane integrity of cells. Annexin V and EthD III were used in association to determine if dead cells were necrotic (only PI labeled cells) or apopt ot ic (Annexin V labeled cells). HCAEC were seeded onto coverslips with poly L lysine coating. Coverslips with S. mutans infected HCAEC were collected 5 h post infection, and the cells were stained using a kit from PromoKine (Heidelberg, Germany) per the manufacturers instruction. Coverslips were mounted onto microscope slides with ProLong Gold antifade reagent The slides were observed with a Leica DM LB2 upright fluorescent scope (Leica Microsystems; Wetzlar, Germany), and micrograph images w ere captured with a QImaging camera and QCapture Pro software and analyzed usi ng ImageJ software [ 277 278] Camptothecin (10 M) was used as a positive control for the induc tion of apoptosis ; hydrogen peroxide

PAGE 101

101 was used as a positive control for necrosis, and unchallenged HCAEC were used as a negative control. FACS Analysis of A poptosis For FACS analysis infected and control cells were stained as above, using Annexin V and ethidium homodimer III. Cells were then analyzed using a FACSCalibur flow cytometer (BD Biosciences). The cytometric data produced was analyzed using the FACSDiva Software Version 6.1.2 (BD Biosciences). C amptothecin (10 M) was used as a positive control fo r the induction of apoptosis ; hydrogen peroxide (2 mM) was used as a positive control for necrosis, and unchallenged HCAEC were used as a negative control. Results Microarray Summary The purpose of this microarray expression analysis was to provide a broad overview of host/pathogen interactions and pathways that are altered in response to these interactions to look at specific pathways that are associated with endothelial activation/dysfunction and to generate potential leads for future studies A c ompariso n of transcriptional profiles between uninfected HCAEC and S. mutans OMZ175 infected HCAEC at 1 and 5 h was used to determine the overall transcriptional responses to S. mutans challenge. RNA from confluent monolayers was isolated, labeled, and hybridized onto microarrays each containing 54,675 probes representing more than 38,500 well characterized genes and UniGenes. A low level analysis was completed, using Robust Multi Array Average (RMA), to create an expression matrix from background corrected, log2 transformed, and quantile normalized signal intensity data. Signal intensity data for 54,675 probe sets were included in the unsupervised clustering

PAGE 102

102 analysis and supervised class prediction analysis as these probe sets passed the initial filtering criteria The unsupervised hierarchial clustering showed that biological replicates clustered together (data not shown). A time series analysis using data from all three conditions identified 7550 probe sets that were differential ly express ed with a f alse d iscover y rate (FDR) of p<0.0 5 When comparing each of the treatments, t he major separation node occurred between the 5 h OMZ175 treatment group and the uninfected control and 1 h OMZ175 treat ed groups ( Figure 3 1 ), indicating that the cluster of upregulated genes between the control and 1 h OMZ175 treatments were mo st similar. Additionally, pairwise comparisons were completed as described above using different iterations of the three test conditions. For this analysis signal intensities were normalized between groups and supervised analyses were completed. The l eaveoneout cross validation method was used to compute a misclassification rate, which indicated that the classifiers correctly predicted the treatment grou ps Significance was set to p< 0.001, and the number of probe sets that were differentially expressed are reported in Table 32. Ontology Analysis O ntology analysis tools (BRB ArrayTools Version 4.1.0 and Bioconductor annotation package Version 2.4.5) were used to group genes into biologically relevant metabolic pathways. The signal intensity data was separated into 3 classes based on treatment and 54,675 probe sets were included in the analysis as they passed the filtering criteria. The probe sets were organized into gene sets based on Biocarta Pathway definitions. The total number of gene sets investigated was 309. The univariate test used was the F test. The random variance model was not used because the distribution assumptions were not satisfied for this model. 120 out of 309 gene sets

PAGE 103

103 exceeded the significance threshold of p<0.005. The LS/KS permutation tests identified 117 significant genesets ; this test was designed to find gene sets that have more differentially expressed genes among the classes than expected by chance. Efron Tibshirani's test identified 12 significant genesets under 200 permutations ; this test uses 'maxmean' statistics to find dif ferentially expressed gene sets. Table 33 is an abridged list of the Biocarta Pathways in endothelial cells that were impacted over time when challenged with S. mutans OMZ175 RT PCR Validation of Microarray RT PCR was performed using primers to transcriptional factors (cFOS, JUN, EGR1, EGR2, EGR3) that were shown to be differentially regulated during 5 h invasion with S. mutans OMZ175 compared to an uninfected control. These transcriptional factors are inducers of cell motility and apoptosis. These experiments were designed to validate the microarray experiment results, so the RNA used was isolated from a different set of invasion experiments than the microarray. The internal transcriptional control was betaactin. Using microarray analysis, cFOS, JUN, EGR1, EGR2, EGR3 were found to have 62.5, 2.1, 45.5, 5.9, and 37 fold increases in transcriptional expression, respectively. The upregulation of these genes in HCAEC infected with S. mutans OMZ175 for 5 h was verified using RT PCR, though the fold changes (in parentheses) were different than those observed with microarray: cFOS (9.1), JUN (17.1), EGR1 (25.7), EGR2 (8.0), and EGR3 (4.2) ( Figure 3 2). Cyt okine s Cytokines are a group of small proteins that include growth factors, interleukins, interferons, colony stimulating factors, and chemokines. Assessing the changes in the expression of these molecules serve a dual purpose 1) to validate that the cytok ine

PAGE 104

104 expression profile generated from the microarray analysis in this study is consistent with published data that shows that S. mutans invasion stimulate expression in endothelial cells 2) to determine the specific HCAEC chemokine response to S. mutans OM Z175 under in vitro culture conditions. Changes in the HCAEC cytokine microarray profile were observed at both one and five h post infection with S. mutans OMZ 175. However, changes were most significant 5 h post infection compared to the uninfected control (Tables 34, 3 5, 3 7). Th ere are no published studies investigating the production of growth factors by endothelial cells in response to S. mutans infection However, it would be expected that there would be an upregulation of growth factors if S. muta ns induced a wounding or hypoxic response [ 279281 ] Specifically, vascular endothelial g rowth factor A (VEGF A ) VEGF C, hepat ocyte growth factor ( HGF), and heparin binding EGF like growth factor (HBEGF) were found to have 3.2, 2.6, 2.9, 3.6 fold increases in transcriptional expression, respectively. Other growth factors that were impacted to a lesser, but significant, extent include transforming growth factor beta1 (TGF beta), TGF beta 2, platelet derived growth factor (PDGF) A, PDGF D, insulin like growth factor, fibroblast growth factor 2 (FGF), FGF16, FGF 18 (Table 34). In addition to microarray analysis of mRNAs, the relative amount of protei n expressed was measured by ELISA assays To this end, assays were performed to measure VEGF and PDGF in conditioned media and cell lysates collected from HCAEC cultured in RPMI media supplemented with 0.1% FBS and 1% BSA infected with S. mutans OMZ175. Th e r esults at 24 h post infection under continuous antibiotic demonstrated no differences between treatment and control groups ( Figure 3 3). These

PAGE 105

105 results indicate that any change in growth factor transcriptional induction at early time points does not appe ar to translate to increased growth factor production under the conditions assayed. In addition to growth factor expression changes, we observed global changes in the expression of chemokines, cytokines, and some of their receptors using microarray analys is (Table 35) Changes were most significant five h post infection compared to the uninfected control. Cytokines cytokine receptors, and chemokines that had greater than a twofold increase (indicated in parenthesis) in expression include: CCL2 (2.5) CCL20 (19.2) CD69 (13.9) CX3CL1 (2.2) CXCL1 (2.9) CXCL2 (24.4) CXCL3 (28.6) CXCL5 (2.4) CXCL6 (2.1), CXCL8 (10), CXCL12 (2.2), IL6 (6.7), IL1RL1 (2), and IL11 (5.9). None of the factors in this class were shown to have a decreased change in expression greater than twofold ELISAs were also performed to measure the levels of inflammatory cytokines IL1A, IL1B, IL6, and IL8 in HCAEC conditioned media 5 h post infection with S. mutans OMZ175. The 5 h infection group included HCAEC cultured in EBM 2 media complete without antibiotic treatment. The 24 h infection group was treated with continuous antibiotics 5 h post infection. There was no difference in IL1A or IL1B levels when comparing the uninfected control to the S. mutans OMZ175 treated group at both 5 and 24 h post infection ( Figure 3 4 A & B). In contrast, both IL6 and IL8 levels increased significantly in the S. mutans OMZ175 infection group compared to the uninfected control at both 5 and 24 h post infection (p<0.001) ( Figure 3 4 C & D). Cytoskelet al Elements and Adhesion Molecules Cytoskeletal elements are important for cell motility, morphology, vesicle formation, proliferation, and survival. Changes in HCAEC cytoskeletal gene expression

PAGE 106

106 were observed using microarray analysis at both 1 and 5 h po st infection with S. mutans OMZ 175, with the most significant changes occurring at 5 h post infection (Table 3 6 ). Those with greater than two fold induction include Rho Related GTP Binding Protein Rho 6 ( RND1 ; 5.6), Rho GTPaseactivating protein 5 ( ARHGAP 5 ; 2.4), Ras ProteinSpecific Guanine NucleotideReleasing Factor 2 ( RASGRF2 ; 2), and R as related Protein Rab23 ( RAB23 ; 2.3). T hese proteins are classified as GTPase or GTPase regulatory proteins that appear to be involved in cytoskeleton organization. RND1 and ARHGAP5 are members of the Rho family which mediat e the regulati on of the cytoskeleton pathway. Overexpression of RND1 has been shown to lead to cell rounding in fibroblasts [ 282 ] Furthermore, ARHGAP5 interaction with RND1 is critical to the cellular effects elicited by the expression of RND1 in fibroblasts [ 283 ] They function as antagonists of RhoA GTPase [ 283 ] causing the disassembly of actin stress fibers in response to extracellular growth factors. RASGR F2, Ras specific guanine nucleotider eleasing f actor 2, is an activator of Ras and Rac1, both shown to be important for S. pyogenes invasion of human cells [ 167 284 ] RAB23 is a member of the Rab GTPase family and has been demonstrated to be required for the formation of Group A streptococci containing autophagosomelike vacuoles and eventual fusion to lysosomes during S. pyogenes infection [ 285 ] Therefore, it is possible that S. mutans uses mechanisms of entry similar to S. pyogenes, and should be investi gated further in future studies. Endothelial cell adhesion molecules are cell surface proteins important for homing immune cells from the lumen to the interior of the artery. Changes in the HCAEC adhesion molecule expression were observed using microarray analysis at both one

PAGE 107

107 and five h post infection with S. mutans OMZ 175 with the most significant changes occurring at five h post infection (Table 37 ). Specifically, intercellular adhesion molecule (ICAM) 1, ICAM 4, selectin E (SELE), and vascular cell adh esion molecule 1 (VCAM 1) were found to have 3.3, 2.6, 35.7, 10.9 fold increases in transcriptional expression, respectively P reviously published studies have shown that S. mutans infection of endothelial cells impact expression of ICAM 1, VCAM 1, and SEL E therefore, we sought to identify other adhesion molecules that may be impacted by S. mutans infection using Human RT2 profiler PCR array analysis. Targeted RT PCR can be more sensitive than microarray profiling in identifying changes in gene expression. To ensure no additional changes were introduced, RNA samples that were collected and used for microarray analysis were pooled (no infection control and 5 h post infection), and the two sample sets were analyzed using RT PCR. This data set (Table 38 ) confirmed an increase in the expression of ICAM 1, VCAM 1, SELE with fold increases of 3.1, 31.0 and 81.8, respectively. Additionally, this analysis identified matrix metallopeptidase (MMP) 1 and 10 to be upregulated by 2.6 and 9.5 fold, respectively. Other MMPs that were shown to be notably downregulated include MMP 2 and MMP 14 by 1. 9 and 2.2 f old, respectively. A poptosis Changes in HCAEC gene expression of the apoptotic pathway were observed using microarray analysis at both one and five h post infection with S. mutans OMZ175 with most significant changes occurring at five h post infection (Table 3 9 ). BIRC3, a member of the apoptotic inhibition pathway mediators, demonstrated a 12.04 increase in expression. TNFSF10, a member of the tumor necrosis factor superfamily that

PAGE 108

108 functions to induce apoptosis demonstrated a 2.82, 3.43, and 3.57 fold reduction in expression reflected by three microarray probe sets The remaining g enes involved in this pathway showed less than two fold changes including Caspase1, 2, 3, 6, 7, 8, 9, 10. C aspase proteins are inducers of apoptosis. With the exception of cas pase 3, all other caspase proteins were down regulated. E nzymatic assays were performed to validate these observations. Caspase 3/7 activity was measured using HCAEC lysates collected 5 h post infection with S. mutans OMZ175 ( Figure 3 5 ) both with and wi thout coincubation with the broadspectrum caspase inhibitor zVAD FMK Caspase activity was normalized to the activity of the uninfected control. In wells that were treated with caspase inhibitor z VAD FMK, caspase activity was significantly reduced. Re sults show there was a statistically significant increase (p <0.001) in caspase activity in HCAEC infected with OMZ175 and OMZ175: cnm ; however, a 20 % induction in caspase activity is not expected to be biologically relevant The results also indicate that the observed caspase induction was not stimulated by invasion, as the invasion deficient cnm mutant demonstrates similar levels of caspase activity to the invasive strain. Previous experiments indicated that S. mutans had no intrinsic caspase activity (data not shown), thus contribution to caspase activity by the bacteria was ruled out. Considering the data generated from the microarray and biochemical assays were not conclusive, both flow cytometry and microscopy were performed to determine the population of apoptotic HCAEC in response to S. mutans infection. For these assays, camptothecin (10 M) was used as an inducer of apoptosis and hydrogen peroxide (2 mM) was used to trigger necrosis. Flow cytometry was used to measure HCAEC fate

PAGE 109

109 during infection wit h S. mutans OMZ175 over time (1.25, 2.5, and 5 h ) Cells were stained with FITC labeled Annexin V and Ethidium homodimer III cell impermeable DNA stain The results demonstrate that HCAEC live cell populations decreas ed over time with approximately 66% healthy cells remaining 5 h post infection ( Figure 3 6 3 7 ). Uninfected HCAEC control cells had approximately 84% healthy cells, thus increased HCAEC death was attributed to bacterial infection. Flow cytometry was also used to measure HCAEC fate during an in fection with S. mutans OMZ175 at MOI of 1 and 100 ( Figure3 8 3 9 ) The cell population distributions were similar between these two groups 4 h post infection and correlated with the previous flow cytometry assay. Analysis of population distribution indicated that both apoptosis and necrosis occurred, but at low levels Camptothecin and hydrogen peroxide, agents selected as the apoptotic and necrotic positive controls, did not perform as expected based on flow cytometry results as a significant proportion o f the population formed aggregates and were thus not reflected in the flow cytometry cell counts. Contrary to the flow cytometry cell count data, the cells from the positive control groups used in flow cytometry assays, monitored by phasecontrast microsco py prior to detachment and staining, were observed to have cell morphologies consistent with greater that 50% of the population undergoing apoptosis and necrosis. In retrospect, flow cytometry is designed to assess the state of cell population for suspensi on cell types. It is not amenable to adherent cell types because they form cell aggregates making it impossible to generate accurate population data. Therefore, m icroscopy was used to further investigate cell fate. Consequently, fluorescent m icroscopic ana lysis was used to differentiate between apoptosis, necrosis, and healthy HCAEC populations 5 h post infection with S. mutan s.

PAGE 110

110 The DNA stain Hoechst 33342 was used to detect all nuclei; ethidium homodimer III was used to stain necrotic cells ; FITC labeled Annexin V was used to stain apoptotic cells ( Figure 3 10) Image J software was used to subtract background fluorescence, merge the images, and to count cells in each of the three categories The average number of cells counted per treatment was 1031 378. Camptothecin and hydrogen peroxide, agents selected as the apoptotic and necrotic positive controls, performed as expected, detecting 47.1% apoptotic cells and 94.8% necrotic cells in the respective treatment group. The results demonstrate that HCAEC live cell populations decrease 5 h post infection by approximately 10 % ( Figure 3 11 ) and the numbers were independent of S. mutans strain or viability. At 5 h post infection, S. mutans does not appear to induce a cell death response in HCAEC at levels that would suggest biological relevance. Discussion The purpose of this study was to investigate the gene expression changes of HCAEC during attachment and invasion over time by S. mutans OMZ175 in comparison to uninfected HCAEC using microarray analysis. We hypothesized that S. mutans OMZ175 invasion of HCAEC would result in endothelial dysfunction, a pathological state of the endothelium associated with the increased expression and production of adhesion molecules and inflammatory markers (chemokines and other cytokines). We also expected the up regulation of genes involved in the innate immune response at early time points to heighten over time when infected with S. mutans OMZ175, particularly genes involved in pathogen associated molecular pattern recognitio n and signaling, autophagy, and apoptosis based on previous studies.

PAGE 111

111 The tran scriptional profiling data presented in this study provides a global view of the HCAEC response to S. mutans OMZ175 infection. In this analysis, we focused on infection induced expression of cytokines, cytoskeletal elements, adhesion molecules, and factors linked to the apoptotic response. S. mutans is considered the primary etiologic agent of dental caries, affecting 60 to 90% of the population. S. mutans gains access to the bloodstream through procedures such as tooth brushing, tooth extraction, endodontic treatment, and periodontal surgery and is often the causative agent of infectious endocarditis. A variety of data suggest S. mutans may contribute to the pathology of cardiovas cular diseases such as atherosclerosis [ 152 154, 20 7 ] The presence of S. mutans has also been recently linked to the pathology of hemorrhagic stroke [ 150 ] Previously, S. mutans strains expressing a collagen binding protein (Cnm) have been shown to invade human coronary artery endothelial cells [ 127 ] Serotype f strain S. mutans OMZ175 invades HCAEC in a Cnm, col lagen binding protein, dependant manner and has induced an accelerated induction of atherosclerosis in an ApoE null mouse model of disease [ 31 126 ] The inflammation response of endothelial cells to oral streptococci including S. mutans has been the subject of several studies [ 139 262 286 289 ] and the cytokine profile generated during the study presented here agrees with previously published data ( e g. CCL2 IL6 and CXCL8) CCL2 plays a crucial role in initiating coronary artery disease by recruiting monocytes/m acrophages to the vessel wall, which leads to the formation of atherosclerotic lesions and vulnerability of the plaque [ 242 ] Another important study has reported that macrophages are converted to atherosclerotic foam cells when infected with S. mutans [ 290 ] Other factors such as CXCL8 ha ve been

PAGE 112

112 reported to stimulate neutrophilic respiratory burst, degranulation, and adherence to endothelial luminal surface s, and activate monocytes, directing their recruitment to atherosclerotic lesions [ 291 ] Glucosyltransferases ( excr eted enzymes produced by S. mutans ) have been reported to stimulate the production of oxygen reactive species (hydrogen peroxide) and TNF in macrophages [ 292 ] and induce the production of IL6 in T cells [ 293 ] While the role of individual chemokines or cytokines in the development or exacerbation of atherosclerosis is under investigation by many laboratories, epidemi ological studies, as well as animal studies, have linked certain chemokines and cytokines to a proatherogenic or atheroprotective phenotype. For instance, circulating CCL20 has been shown to be higher in asymptomatic patients with hypercholesterolemia, a disease that results in the deposition of cholesterol in vascular tissues, and to be overexpressed in atherosclerotic lesions from coronary artery patients [ 294 ] Furthermore, in a study using CCL20 receptor knockout mice (CCR6( / )ApoE ( / )), it was reported that these mice had 40 % less atherosclerotic lesions and 44 % less macrophage infiltrates when compared to CCR6(+/+)ApoE ( / ) mice [ 295 ] In contrast, CXCL2 induction has been reported to be atheroprotective and has been shown to remain uninduced in patients with coronary artery atherosclerosis [ 296 297 ] However, CXCL2 is a proinflammatory cytokine that is induced during bacterial infections and important for bacterial clearance by neutrophils, leukocytes that contributes to the development of atherosclerosis at various stages [ 298300 ] CXCL3 is specifically induce d in macrophages in response to oxidized low density lipoprotein of patients with hypercholesterolemia, and like CXCL2, it is reported to be involved in the endothelial

PAGE 113

113 recruitment of neutrophils and monocytes [ 301 ] In this study, we report a 19.2, 24.4, and 28.6 fold induction of CCL20, CXCL2, and CXCL3 in HCAEC 5 h post infection (Table 35). Overall, the study reported here found that several chemokin es were induce d, as would be expected during the early response period after bacterial infection; among them, 10 were induced > 2 fold An interesting observation was the induction of chemokines involved in recruiting monocytes and immature dendritic cells ( e.g., CCL2, CCL5, CCL8, CCL20, and CXCL12). A recent study has reported that S. mutans stimulated differentiation of monocytes to dendritic cells and has been hypothesized as the possible mechanism by which S. mutans is able to persist in the bloodstream [ 139 ] Such a mechanism could facilitate S. mutans ability to colonize downstream sites such as cardiac lesions. In addition w e found significant induction of expression of growth factors by endothelial cells in response to S. mutans infection that have not been previously reported (p<0.001) For example, growth factors important for endothelial proliferation, migration, and angiogenesis were significantly upreg ulated (i.e. VEGF PDGF, HGF, and HBEGF). VEGF and PDGF protein levels in conditioned media and lysates of HCAEC cultured in growth factor depleted media after S. mutans infection were assayed using ELISAs. We found no significant changes of VEGF or PDGF l evels relative to the control. Unlike the microarray assay, these biochemical assays were performed under continuous antibiotic treatment to measure the endothelial response to intracellular bacteria. It is possible that the continuous antibiotic treatment interfered with growth factor production. For example, under these conditions bacteria which cycle

PAGE 114

114 out of the cell are exposed to antibiotics and are unable to grow or secrete metabolic byproducts (e.g., lactic acid). With respect to S. mutans infection, we hypothesize that growth factor induction may be the result of lactic acid secreted by S. mutans in culture media. P revious studies have shown that lactic acid is a small molecule product of human metabolis m, mediated by a hypoxic environment in healthy tissue, and has been demonstrated to have a regulator y role in cell migration and is believed to be importan t in tissue growth and repair [ 302 304 ] Furtherm ore, s tudies have shown that the presence of lactic acid impact tumor me tas ta sis and angiogenesis in a manner independent of oxygen concentration [ 305 306 ] Considering that S. mutans primary metabolic byproduct is L lactic acid, we hypothesize that S. mutans infection would have significant impact on pre existing disease pathologies and could contribute to atherosclerosis th r ough this mechanism. Preliminary data generated using a wound scratch model of HCAEC cultured in growth factor depleted media showed increased migration and/or cell proliferation when infected with S. mutans OMZ175 over a 72 h peri od. The results were only observed in cultures with intermediate pulse antibiotic treatments but not with continuous antibiotic treatment ( data not shown). Furthermore, factors that are associated with cytoskeletal modifications would be expected to occur in conjunction with factors that regulate cell proliferation and migration and bacterial entry and trafficking. Those factors that were differentially expressed (Table 36) were induced or repressed in response to S. mutans 5 h post infection by a factor < 2 fold, except for RND1 (5.6 fold; disassembly of actin stress fibers) and ARHGAP5 (2.4 fold; positive regulator of cell migration) Thus, w e hypothesize that cell migration, rather than cell

PAGE 115

115 proliferation, is induced upon infection with S. mutans These results are interesting in that other oral streptococci have also been linked to cardiovascular diseases, thus this mechanism of streptococci pathogenesis would theoretically be invasion independent. This previously unstudied phenomenon will be the focus o f future studies. During bacterial infection, the host cell inflammatory response functions to call immune cells to the site of infection, while the expression of surface adhesion molecules are upregulated and function to capture leukocytes and facilitat e diapedesis. For example, upon stimulation with S. mutans OMZ17 5 purified PAc adhesin protein endothelial cells have been reported to result in increased expression of adhesion molecules and promotion of the transendothelial migration of neutrophils [ 254 ] through specific binding of PAc to [ 140 ] This binding event results in a signal cascade involving phospholipase C (PLC ), focal adhesion kinase (FAK) and paxillin phosphorlyation with downstream mitogen activating protein kinase (MAPK) and protein kinase C (PKC) which in turn causes an increase in production of CXCL8 [ 189 307 ] The work present ed here demonstrated an up regulation i n expression of adhesion molecules ICAM 1 ICAM 4, VCAM 1 and SELE using both microarray and RT PCR analyses ICAM 1 is constitutively expressed in resting endothelial cells at a low levels [ 308 309 ] Once activated by cytokines, endothelial cells increase expression of ICAM 1 and VCAM 1 [ 310] P and E selectins are produced by endothelial c ells in acute, as well as, in active atheromatous plaques and serve as rolling molecules for monocytes, neutrophils, effector T cells, B cells, and natural killer cells [ 310, 311 ] E selectin is not constitutively expressed; however, it is found on the surface of activated endothelial cells [ 312 ] P selectin has been reported to be sequestered in

PAGE 116

116 Weibel Palade bodies (an endothelial cell organelle that contains biologically active compounds that modulates local and systemic processes like inflammation) that undergo exocytosis in activated endothelial cells depositing P selectin to the membrane [ 313 ] We did not observe an increase in P selectin expression at the trans criptional level. Future studies will include measuring VCAM 1, E and P selectin protein levels after S. mutans infection to confirm endothelial activation. Microarray analysis indicated inhibition of apoptotic pathways 1 and 5 h post infection of HCAEC w ith S. mutans OMZ175. S ubsequent analyses, measuring caspase 3/7 activity and induction of apoptosis and necrosis in HCAEC 5 h post infection with S. mutans OMZ175 we found an induction of apoptosis; however the observed levels of induction do not indicat e a biologically relevant apoptotic response D ata presented herein also indicated that a noninvasive strain OMZ175: cnm and nonviable heat killed OMZ175 induced cell death at 5 h to a similar degree, indicating that invasion was not required for this respo nse Furthermore, induction of the autophagic pathway was not detected by microarray analysis except for a 2.3 fold induction of RAB23 reported to be involved in autophagic vacuole assembly suggesting an absence of autophagy driven apoptosis. Another int eresting observation derived from both micr o array and RT PCR analyses were the induction of JUN, c FOS and EGR 1. These factors have been shown to be key in induction of Ca+ 2 regulated growth inhibition and cell death [ 314 ] In addition to the transient modifications occurring upon entry, intracellular bacteria induce drastic changes in the pattern of transcription and translation of infected cells, which may under go programmed cell death (e.g. apoptosis) or necrosis, taking over the fate of their host cell with significant implications in the progression of diseases. Microarray

PAGE 117

1 17 and RT PCR analyses capture a moment in time and do not always reflect the final outcom e of cell fate. In future studies, time course studies using microscopy will investigate the role of intracellular S. mutans in HCAEC fate. Unfortunately, m ethods available to investigate the mechanisms of apoptosis and necrosis are limited as S. mutans gr ows robustly in culture media and endothelial cells are an adherent cell type In summary, while we observed an induction of cytokines and adhesion molecules which by in large agreed with published reports typical of a streptococci infection, we found changes in gene expression due to S. mutans infection that were unexpected or contrary to our expectations. We expected genes involved in the autophagic pathway to be induced, since S. mutans was observed in double membrane vacuoles of infected HCAEC using TE M; however, none of these genes were changed 5 h post infection. O ther unexpected result s include an anti apoptotic response and the induction of growth factors post infection as cell death and growth arrest were expected responses to sepsis causing bacter ial infections. Specifically, the induction of VEGF and repression of genes involved in apoptosis 5 h post infection with S. mutans is reminiscent of a vascular endothelial response during Bartonella and Chlamydia infections, two successful intracellular pathogens [ 315 316 ] Interestingly, infections with Bartonella and Chlamydia have been shown to i nduce host cell proliferation, while we currently hypothesize that S. mutans is inducing a cell migration response. In conclusion, t his study indicates that S. mutans can be an important bacterium in the pathology of human systemic disease that may or may not require invasion. Although the data collected to date using cell culture models does not suggest that cnm

PAGE 118

118 is important for the host cell response and fate of endothelial cells, our data indicates that invasion and bacterial trafficking is affected by cnm (Chapter 2), thus cnm appears to be important to bacterial fate and would be expected to impact bacterial persistence and development of chronic infection. Consequently, in vivo studies may be required to investigate the host response to S. mutans infe ction with respect to cnm

PAGE 119

119 Table 31. List of primers used in this study Gene P rimer sequence cFOS_F TAGTTAGTAGCATGTTGAGCCAGG cFOS_R ACCACCTCAACAATGCATGA cJUN_F GGCTGGTGTTTCGGGAGTGT3 cJUN_R CGCCGCCTTCTGGTCTTTAC EGR1_F CTTCAACCCTCAGGCGGACA EGR1_R GGAAAAGCGGCCAGTATAGGT EGR2_F ACGTCGGTGACCATCTTTCCCAAT EGR2_R TGCCCATGTAAGTGAAGGTCTGGT EGR3_F GCTTTGTTCAGTTCGGATCGCCTT EGR3_R AAACAATGAGGTGTTTGGGTCGGG Table 32. Supervised analysis of pairwise comparisons Condition A/Condition B Significant prob e sets t test p<0.001 OMZ175 1 h Uninfected 1507 OMZ175 5 h Uninfected 6600 OMZ175 1 h OMZ175 5 h 950

PAGE 120

120 Table 33 Ontology analysis of endothelial cell pathways impacted by infection with S. mutans OMZ175 over time Impacted signaling pathway ** p<0.01* Description MAPK 89/228 Regulates genes that are important to cell cycle regulation Toll like receptor 26/62 Stimulation of the innate immune system and inflammation Phosphatidylinositol 30/66 Calcium released to the cytosol and PKC activation Ce ll cycle 27/58 Cell cycle regulation Wnt 28/70 Regulation of gene transcription, cytoskeleton, and intracellular calcium Adhesion and diapedesis of lymphoc y tes 16/34 Lymphocyte rolling and diapedesis Adhesion and diapedesis of granulocytes 14/29 Granul ocyte rolling and diapedesis Cytokine cytokine receptor 15/48 Inflammatory response Protein translation 28/51 Genes involved in protein production Apoptosis death pathway 45/86 Extrinsic c ell programmed death Apoptosis caspase pathway 29/62 Effectors o f apoptosis TNF stress related pathway 30/57 Regulation of apoptotic pathways, NF kB activation, and stress activated protein kinases IGF 1 signaling pathway 24/63 AKT signaling pathway activator EGF signaling pathway 33/85 Regulates growth, differentia tion, migration, adhesion and cell survival PDGF signaling pathway 36/84 Regulates growth and angiogenesis, potent mitogen of smooth muscle cells VEGF, hypoxia, and angiogenesis 39/79 Regulates physiological and pathological angiogenesis such as tumor growth and ischemic diseases Hypoxia inducible factor 26/48 Regulates oxygen homeostasis Low density lipid pathway 10/17 Involved in the production of "bad cholesterol" Rac1 cell motility signaling pathway 28/59 Stimulates the formation of filipodia and lamellopodia and regulates cell motility *Number of regulated genes in the pathway/Number of total genes defined for this pathway **BioCarta pathway s database ( http://www.biocarta.com/genes/index.as p )

PAGE 121

121 Table 34 Gene expression changes of growth factor receptors and ligands 5 h post infection with S. mutans OMZ175 compared to uninfected control (p< 0.001) Fold change Gene symbol Gene name 2.6 VEGFC V ascular endothelial growth factor C 3.2 VE GFA V ascular endothelial growth factor A 1.2 TGFBI Tr ansforming growth factor, beta induced, 68kDa 1.4 TGFB2 T ransforming growth factor, beta 2 1.5 PDGFA P latelet derived growth factor alpha polypeptide 1.3 PDGFA P latelet derived growth factor alpha po lypeptide 1.5 PDGFD P latelet derived growth factor D 1.5 PDGFD P latelet derived growth factor D 1.2 IGF1 I nsulin like growth factor 1 (somatomedin C) 1.3 HDGFRP3 H epatoma derived growth factor, related protein 3 1.2 HGS H epatocyte growth factor regul ated tyrosine kinase substrate 2.9 HGF H epatocyte growth factor 3.6 HBEGF H eparin binding EGF like growth factor 1.3 FGF2 F ibroblast growth factor 2 (basic) 1.4 FGF18 F ibroblast growth factor 18 1.3 FGF16 F ibroblast growth factor 16 1.6 EGFR E piderm al growth factor receptor

PAGE 122

122 Table 35 Microarray g ene expression changes of chemokines and cytokines 5 h post infection with S. mutans OMZ175 compared to uninfected control (p< 0.001) Fold change Gene symbol Common name and function 1.3 CCL11 Eotaxin 1 selectively recruits eosinophils by inducing their chemotaxis 2.5 CCL2 MCP 1 recruits monocytes, memory T cells, and dendritic cells to the sites of inflammation produced by either tissue injury or infection 19.2 CCL20 Macrophage i nflammatory protein chemotactic for dendritic cells 1.6 CCL5 RANTES is chemotactic for T cells, eosinophils, and basophils 1.4 CCL8 MCP 2 is chemotactic for and activates mast cells, eosinophils and basophils, and monocytes, T cells, and NK cells 13.9 CD69 I nvolved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, including natural killer (NK) cells, and platelets 2.2 CX3CL1 Fractalkine in the soluble form recruits T cells and monocytes ; P romotes adhesion of leukocytes through CX3CR1 2.9 CXCL1 Neutrophil activating protein is a secreted growth factor that binds to CXCR2 and is chemotactic for neutrophils 2.2 CXCL12 Stromal c ell d erived f actor 1 activates CXCR4 to induce the rapid uptake of intracellular calcium ions and to r ecruit T cells and monocytes ; Activates betaarrestin pathway through binding CXCR7 24.4 CXCL2 Macrophage i nflammatory p rotein 2 production of VEGF and considered to be atheroprotective; Recruits neutrophils 28.6 CXCL3 GRO targets neutro phils, fibroblasts, and melanoma cells by CXCR2 2.4 CXCL5 ENA 78 recruits neutrophils and endothelial cells by CXCR2 ; 2.1 CXCL6 Granulocyte chemotactic p rotein 2 targets neutrophils and endothelial cells 10 CXC L8 Neutrophil chemotactic factor or IL 8 induces chemotaxis and phagocytosis in neutrophils but also other granulocytes ; P otent promoter of angiogenesis

PAGE 123

123 Table 35 Continued Fold change Gene symbol Description 1.6 IL1A Induces inflammation, as wel l as, fever and sepsis 2 IL1RL1 Induced by proinflammatory stimuli, and may be involved in the function of helper T cells 6.7 IL6 I mportant mediator of fever and of the acute phase response 1.4 IL6ST The receptor systems for IL6, LIF, OSM, CNTF, IL11, CTF1 and BSF3 can utilize gp130 for initiating signal transmission; Binds to IL6/IL6R (alpha chain) complex 1.6 IL7 I nduces inflammation via PI3K/AKT dependent and independent activation of NF recruits monocytes/macrophages, and has an activ e role in atherogenesis 1.5 IL7R R eceptor (CD127) for interleukin 7 1.2 IL10RB Accessory chain essential for the active interleukin 10 receptor complex ; Co expression of this and IL10RA proteins has been shown to be required for IL10induced signal transduction 5.9 IL11 Key regulator of hematopoiesis, including the stimulation of megakaryocyte maturation 1.4 IL13RA2 B inds IL13 with high affinity ; Regulate s the effects of both IL 13 and IL4 1.2 IL13RA1 A subunit of the interleukin 13 receptor that forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors ; Bind to tyrosine kinase TYK2, and may be involved in JAK1, STAT3 and STAT6 activation 1.3 IL15RA High affinity receptor for interleukin 15 which regulat es T and natural killer cell activation and proliferation 1.4 IL18R1 Receptor for IL 18 which differentially regulates apoptosis mediated by TNF and Fas 1.3 IL27RA Receptor for IL27 which is involved in the regulation of Th1 type immune responses and innate defense mechanisms 1.9 IL33 I nduces T helper cells, mast cells, eosinophils and basophils to produce type 2 cytokines This table was generated from data collected at the The GeneCards Human Gene Database [ 317 ]

PAGE 124

124 Table 36 Differential expression of genes involved in actin cytoskeleton organization, vesicle transport, cell proliferation, migration, and survival of HCAEC 5 h post infection with S. mutans OMZ175 compared to uninfected control (p<0.001) Fold Change Gene Name Description 5.6 RND1 Disassembly of actin stress fibers 1.4 RND3 Disassembly of actin stress fibers 1.3 RHOBTB3 Required for e ndosome to Golgi transport ; Specifically binds Rab9, but not other Rab proteins 1.3 ARHGEF18 Colocalizes with actin stress fibers ; Positive regulation of apoptosis 2.4 ARHGAP5 Positive regulation of cell migration 1.3 ARHGAP31 Required for cell spread ing, polarized lamellipodia formation and cell migration ; Activates RAC1 and CDC42 1.4 ARHGAP29 Essential role in blood vessel tubulogenesis ; Suppresses RhoA signaling and reduces ROCK and MYH9 activity 1.3 ARHGAP27 May be involved in clathrin mediated endocytosis/receptor mediated endocytosis 1.6 ARHGAP26 Activates RhoA and CDC42 1.4 ARHGAP24 Filamin A associated. Filamin A is involved in ciliogenesis and early to late endosome transport ; Suppresses RAC1 and CDC42 activity 1.9 ARHGAP22 Regulates en dothelial cell capillary tube formation during angiogenesis 1.3 ARHGAP21 Interacts with GTP bound ARF1 and ARF6 ; O rganelle transport along microtubules 1.3 ARHGDIA Inhibits cell migration and invasion by indirectly inhib i ting RAC1 ; N egative regulator of apoptosis and cell adhesion 1.3 RRAGB Activation of the TOR signaling cascade by amino acids 1.3 RRAGC Activation of the TOR signaling cascade by amino acids 1.9 RASL10A Potent inhibitor of cellular proliferation 1.3 RIT1 Activation of both EPHB2 and MAPK14 signaling pathways 1.7 RASD1 Involved in nitric oxide signaling 2 RASGRF2 Positive regulation of apoptosis 1.4 RASAL2 Inhibitory regulator of the Ras cyclic AMP pathway 1.5 RASA3 Inhibitory regulator of the Ras cyclic AMP pathway 1.3 RASA2 I nhibitory regulator of the Ras cyclic AMP pathway 1.2 RASIP1 Required for the proper f ormation of vascular structures

PAGE 125

125 Table 36 Continued Fold Change Gene Name Description 1.2 RAB11FIP1 Endosomal recycling 1.3 RAB11FIP5 Transport from apical endosomes to apical plasma membrane 1.4 RAB14 Endocytic recycling 1.2 RAB18 Plays a role in apical endocytosis/recycling 1. 2 RAB21 Regulates integrin internalization and recycling 2.3 RAB23 Involved in autophagic vacuole assembly and defense against pathogens 1.3 RAB2B Positive regulation of exocytosis 1.3 RAB31 Involved in the acidification of phagosomes containing pathogens 1.3 RAB31P May activate RAB8A and RAB8B 1.8 RAB33B Acts as a modulator of autophagosome formation 1.2 RAB35 E ssential rate limiting regulator of a recycling pathway to the plasma membrane 1.3 RAB38 Involved in the acidification of phagosomes containing pathogens 1.3 RAB3D Probably involved in regulated exocytosis 1.2 RAB40B Involved in substrate recognition and ubitquitination 1.3 RAB5A Required for the fusion of plasma membranes and early endosomes and involved in the regulation of filopodia extension 1.3 RAB7A Regulator in endo lysosomal trafficking 1.4 RAB8B May be involved in vesicular trafficking 1.2 RABEP2 Role in membrane trafficking and early endosome fusion 1.2 RABGGTB Rab geranylgeranyltransferase activity 1.2 RAP2B May play a role in cytoskeletal rearrangements and regulate cell spreading 1.2 RAPGEF1 P DGF receptor signaling pathway in c ell cell adhesion 1.3 RAPGEF3 Positive regulation of angiogenesis 1.6 RAPGEF4 Involved in cAMP dependent, PKA independent exocytosis through interaction with RIMS2 1.8 RAPH1 Colocalizes at the tip s of lamellipodia and filipodia and m ay colocalize with pathogens 1.6 RASGRP3 MAPK cascade

PAGE 126

126 Table 36 Continued Fold Change Gene Name Description 1. 3 RASSF1 Required for dea th receptor dependent apoptosis and i nduced in response to DNA damage 1.3 RASSF2 May promote apoptosis and cell cycle arrest 1.3 RHEB Activates the protein kinase activity of mTORC1, a protein that reg ulates cell growth and survival 1.3 RHOB Up r egulated by DNA damaging agents 1.2 RHOD Involved in endosome dynamics 1.2 RHOJ Regulation of cell morphology 1.3 RIN2 Downstream effector for RAB5B in endocytic pathwa y This table was generated from data collected at UniProt Knowledgebase [ 310 318 ]

PAGE 127

127 Table 37 Microarray g ene expression changes of leukocyte adhesion molecules 5 h post infection with S. mutans OMZ175 compared to uninfected control Gene symbol Fold Change Description ICAM4 2.6 I ntercellular adhesion molecule 4 ICAM3 1.3 i ntercellular adhesion molecule 3 ICAM2 1.3 I ntercellular adhesion molecule 2 IC AM1 3.3 I ntercellular adhesion molecule 1 SELPLG 1.2 S electin P ligand SELE 35.7 S electin E VCAM1 10.9 V ascular cell adhesion molecule 1 Table 38 Human RT2 Profiler PCR array of ad hesion molecule gene expression using pooled RNA previously isolated for microarray analysis 5 h post infection with S. mutans OMZ175 compared to uninfected control Gene s ymbol Fold r egulation Description COL8A1 2.5 Collagen, type VIII, alpha 1 ICAM1 3.1 Intercellular adhesion molecule 1 ITGA3 2.1 Integrin, alpha 3 (CD49C, subunit of VLA 3 receptor) ITGB5 1.8 Integrin, beta 5 MMP1 2.6 Matrix metallopeptidase 1 (interstitial collagenase) MMP10 9.5 Matrix metallopeptidase 10 (stromelysin 2) MMP14 2.2 Matrix metallopeptidase 14 (membrane inserted) MMP2 1.9 Matrix metallopeptidase 2 (type IV collagenase) SE LE 81.8 Selectin E SPG7 3.1 Spas tic paraplegia 7 THBS3 1.9 T hrombospondin 3 VCAM1 31.0 Vascular cell adhesion molecule 1

PAGE 128

128 Table 39. Microarray g ene expression changes of genes involved in apoptotic pathway s 5 h post infection with S. mutans OMZ175 compared to uninfected control. Fold Change Gene Name Description 1.24 APAF1 A poptotic peptidase activatin g factor 1 1.29 BCL2 B cell CLL/lymphoma 2 1.22 BID BH3 interacting domain death agonist ; C leaved by C aspase 8 to yield t Bid 12.04 BIRC3 B aculoviral IAP repeat containing 3 1.26 CASP10 C aspase 10, apoptosis related cysteine peptidase 1.14 CASP3 C aspase 3, apoptosis related cysteine peptidase 1.29 CASP6 C aspase 6, apoptosis related cysteine peptidase 1.18 CASP7 C aspase 7, apoptosis related cysteine peptidase 1.27 CASP8 C aspase 8, apoptosis related cysteine peptidase 1.37 CASP9 C aspase 9, ap optosis related cysteine peptidase 2.2 CCAR1 C ell division cycle and apoptosis regulator 1 1.39 CFLAR FLIP ; B locks activation of caspase 8 1.18 CHUK C onserved helix loop helix ubiquitous kinase 1.3 CIAPIN1 C ytokine induced apoptosis inhibitor 1 ; D ep endent on growth factor stimulation 1.28 DFFB DNA fragmentation factor, 40kDa, beta polypeptide (caspase activated DNase) 1.17 FADD Fas (TNFRSF6) associated via death domain 1.28 LMNA L amin A/C 1.06 MAP3K14 M itogen activated protein kinase kinase ki nase 14 1.60 NFKB1 N uclear factor of kappa light polypeptide gene enhancer in B cells 1 1.2 PAWR Pro apoptotic protein by Fas pathway; downregulates BCL2 by ts interactions with WT1 1.19 RIPK1 R eceptor (TNFRSF) interacting serine threonine kinase 1 1.26 SPTAN1 S pectrin, alpha, non erythrocytic 1 (alpha fodrin) 2.82 TNFSF10 T umor necrosis factor (ligand) superfamily, member 10 3.43 TNFSF10 T umor necrosis factor (ligand) superfamily, member 10 3.57 TNFSF10 T umor necrosis factor (ligand) superfami ly, member 10 1.09 XIAP X linked inhibitor of apoptosis ; B locks activation of caspases 3 and 9

PAGE 129

129 Figure 31. Hierarchical clustering of variance norm alized gene expression data The expression pattern of the cRNA generated for each condition tested by microarray analysis was determined by a supervised analysis of variancenormalized data set of differentially expressed genes ( FDR; (p < 0.0 5 ). I n this heat map, each column represents an individual gene element on the array, and each row represents the gene expression state for each of the conditions tested. Each expression data point represents the relative fluor e scence intensity of the cRNA from S. mutans OMZ175 infected HCAEC at 1 and 5 h to the fluorescence intensity of the cRNA of uninfected HCAEC. The distance matrix used to measure the relatedness of samples through gene expression space was 1 Pearsons correlation coefficient The cluster is subdivided into t wo groups Repressed genes are blue, and induced genes are red. Genes that did not change are white. The variation in the gene expression for a given gene is expressed as the distance from the mean observation for that gene according to the color scale below the heat map. Gene annotation enrichment analysis determine d that 135 gene clusters were significantly impacted (p<0.001) and that 28 out of 135 annotated gene clusters were relevant to endothelial activation/dysfunction (eg. anti apoptosis, apoptosis, immune response, and cell proliferation).

PAGE 130

130 Figure 32 RT PCR validation of microarray results. Single strand cDNA was generated from RNA samples using iScript cDNA synthesis kit (Bio Rad) as per manufacturer instructions. The RT PCR reactions wer e prepared using IQ SYBR Green RT PCR kit (Bio Rad) as per manufacturer instruct ions with custom primer pairs to transcription factors that were observed to be upregulated in the microarray. RT PCR data was analyzed by the comparative Ct method.

PAGE 131

131 A) B) Figure 33 Enzyme linked immunosorbant assay s to measure the levels of VEGF A) and PD GF B) in HCAEC lysates and conditioned media 24 h post infection with S. mutans Infection was performed in RPMI media supplemented with 0.1% FBS and 1% BSA with continuous antibiotic treatment. There is no statistical difference in the presence of grow th factor (VEGF or PDGF) in the lysates or supernatants of uninfected compared to HCAEC 24 h post infection. The error bars indicate standard error (n= 6 ). Students t test statistics to compare VEGF or PDGF mean levels detected in lysates and supernatants (conditioned media) between treatments and the uninfected control.

PAGE 132

132 Figure 34. Enzyme linked immunosorbant assays to measure the levels of A) IL1A, B) IL1B; C) IL6; and D) IL8 in culture conditioned media 5 and 24 h post in fection with S. mutans Infection was performed in EBM2 media complete: 5 h time point without antibiotic treatment; 24 h time point without antibiotic for 5 h and 19 h with continuous antibiotic treatment. The error bars indicate standard deviation (n=4). Students t test statistics to compare means between treatments at a certain time. (***, p<0.001; ns, not significant)

PAGE 133

133 Figure 35 Caspase 3/7 activity to determine activation of the apoptotic pathway presented as a percent of the uninfected HCAEC control. HCAEC extracts were collected 5 h post infection and analyzed for caspase 3/7 activi ty using a colorimetric caspase. Caspase 3/7 protease activity was induced above basal levels independent of invasion, suggesti ng that innate surveillance by toll like receptors m ay be activated in response to pathogen associated molecular patterns but this result may not be biologically relevant in viv o CI = broadspectrum caspase inhibitor z VAD FMK 100 M

PAGE 134

134 Figure 36 Flow cytometric analysis of HCAEC fate during infection with S. mutans OMZ175 over time. These are representative dot plots with FITC labeled Annexin V (FITC A) versus Ethidium homodimer III cell impermeable DNA stain (PI A). The top 3 dot pl ots were of the control treatment groups. Camptothecin is an alkaloid which inhibits the DNA enzyme topoisomerase I and induces apoptosis, while hydrogen peroxide induces necrosis. (n=3; 3839 286 cells counted per condition) Upper left quadrant of the dot plot indicates percentage of necrotic cells. Upper right quadrant of the dot plot indicates percentage of dead cells. Lower left quadrant of the dot plot indicates percentage of live cells. Lower right quadrant of the dot plot indicates percentage of apoptotic cells.

PAGE 135

135 Figure 37 Percentage of HCAEC among the four fate groups as determined by flow cytometry after infection with S. mutans OMZ175 over time. Stacked column chart shows the percent population within the four fate groups. Necrotic column indicates HCAEC treated with 2 mM hydrogen peroxide (control). Apoptotic column indicates HCAEC treated with Camptothecin 10 uM (control) (n=3)

PAGE 136

136 Figure 38 Flow cytometric analysis of HCAEC fate after infection with S. mutans OMZ175 at M OI = 1 and MOI = 100. These are representative dot plots with FITC labeled Annexin V (FITC A) versus Ethidium homodimer III cell impermeable DNA stain (PI A). The top 3 dot plots were of the control treatment groups. Ca mptothecin is an alkaloid which inhibits the DNA enzyme topoisomerase I and induces apoptosis, while hydrogen peroxide induces necrosis. Upper left quadrant of the dot plot indicates percentage of necrotic cells. Upper right quadrant of the dot plot indicates percentage of dead cells. Lower left quadrant of the dot plot indicates percentage of live cells. Lower right quadrant of the dot plot indicates percentage of apoptotic cells. (n=1; 5621 224 cells counted per condition)

PAGE 137

137 Figure 39 Percentage of HCAEC among the four fate groups as determined by flow cytometry after infection with S. mutans OMZ175 at MOI = 1 and MOI = 100. Stacked column chart shows the percent population within the four fate groups. Necrotic column indic ates HCAEC treated with 8 mM hydrogen peroxide (control) Apoptotic column indicates HCAEC treated with Camptothecin 10 uM (control) (n=1)

PAGE 138

138 Figure 310 Microscop ic analysis of HCAEC to differentiate between apoptosis, necrosis, and healthy cells 5 h post infection with S. mutans OMZ175. Panels A D are micrographs of HCAEC treated with apoptosis inducing agent camptothecin (10 M). Panels E H are micrographs of uni nfected HCAEC. Panels I L are micrographs of HCAEC infected with S. mutans OMZ175 for 5 h Panels A, E, and I micrographs were obtained with a 350/461nm filter set to detect all nuclei with DNA stain Hoechst 33342. Panels B, F, J micrographs were obtained with a 528/617nm filter set to detect necrotic cells stained with cell impermeable DNA intercalating dye e thidium homodimer III. Panels C, G, and K micrographs were obtained with a 492/514nm filter set to detect apoptotic cells stained with FITC labeled An nexin V Panels D, H, and L are composite micrographs generated using Image J software. In the composite micrographs, blue nuclei are healthy, red or purple nuclei are necrotic, and green cells are apoptotic.

PAGE 139

139 Figure 311 P ercentage of HCAEC among the fate groups as determined by microscopy after 5 h infection with S. mutans Stacked column chart shows the percent population within the fate groups. Necrotic column indicates HCAEC treated with 2 mM hydrogen peroxide. Apoptoti c column indicates HCAEC treated with Camptothecin 10 M. Dead OMZ175 group indicates that the bacteria were heat killed prior to infection. Results suggest that apoptosis is induced in a subset of infected cells independent of invasion.

PAGE 140

140 CHAPTER 4 DISCUSSION AND FUTURE DIRECTIONS G eneral Summary and D iscussion This dissertation work challenges the current paradigm that S. mutans is a noninvasive pathogen, restricted to dental caries and infectious endocarditis. Invasive strains of S. mutans express ing the collagen binding protein, Cnm, have been isolated from patients with infectious endocarditis shown to induce hemorrhagic stroke and promote atherogenesis in mice [ 31 150 ] Non invasive strains of S. mutans are the most common strains in the oral cavity and are the best studied oral organisms whereas relatively little is known about the invasive strains. Route f rom O ral C avity to C ardiovascular T issues In order to investigate S. mutans ability to transition from an oral site of infection to a cardiovascular tissue infection, antibiotic protection assays and transmission electron microscopy were used to determine the tropism of S. mutans to gingival and arterial tissues and to determine the role of Cnm in attachment and invasion of these cell types. T hese studies are the first to show that S. mutans invades oral keratinocytes, gingival fibroblasts, and coronary artery smooth muscle cells in a cnm dependent manner with similar efficacy to its ability to attach to and invade HCAEC. The ability of cnm expressing strains of S. mutans to invade cells associated with the gingiva may provide them an environmen t for a persistent infection as well as increased access to the bloodstream. This ability to invade oral keratinocytes provides an environmental niche that protects these strains from host defenses (oral healthcare, saliva, antibodies, defensins, bacterioc ins, etc.). Thus, invasive strains of S. mutans strains would have a selective advantage by having the ability to use oral epithelium as a reservoir allowing

PAGE 141

141 this opportunistic pathogen access to deeper tissues in the gingiva and the circulatory system par ticularly during incidences of gingival inflammation or injury. The reservoir model hypothesis (Figure 214) is supported by epidemiological studies that S. mutans can colonize the oral cavities of children before tooth eruption [ 228 229, 319 ] Once S. mutans enters the circulatory system, strains capable of invading cardiovascular tissues would have a selective advantage by being removed from innate immunity factors (e.g., complement and antibodies) by entering the vascular endothelium. In such a situation this opportunistic pathogen may lead to the development of infectious endocarditis and could contribute to arterial inflammation and exacerbate cardiovascular disease development. The hypothesis that S. mutans contributes to other vascular disease besides endocarditis is supported by clinical data that suggest that specific strains of S. mutans may play a role in infections of cardiovascular tissues and that individuals harboring these strains may be at a higher risk for cardiovascular involved diseases [ 320 ] S. mutans has been reported to be the predominant bacterial species isolated from diseased heart valve tissues and in atheromatous plaques [ 152 153 ] Furthermore, s ystemic infection with S. mutans strains expressing Cnm increased the risk of cerebral hemorrhagic stroke [ 150 ] and accelerated atherosclerosis in mice [ 31] w here the endothelial cells lining blood vessels were damaged leading to exposure of the underlying extracellular matrix. Studies investigating the role of other collagen binding S. mutans adhesins (e.g. PAc, WapA) have shown that these molecules do not con tribute to the invasive phenotype in a manner similar to Cnm [ 126 ] Others have found that a S. mutans serotype c strain (GS 5), which we have s ubsequently

PAGE 142

142 established as a noninvasive cnm negative strain, did not promote atherosclerosis in an ApoE null mouse model [ 321 ] Mechanisms of D issemination In this study, we investigated mechanism of dissemination using multiple derivations of the standard antibiotic protection assay (e.g., intracellular replication, intracellular growth curves, cell to cell transfer, exiting and reinfection) in conjunction with live cell counts, RT PCR, and fluorescent microscopy. This work did not find evidence of S. mutans intracellular replication within primary endothelial cells ; however, in tracellular S. mutans were found to exit host endothelial cells, and they r emained in vasive This data provides support that S. mutans has the potential to traverse t he endothelium and to enter cells in the intima, such as smooth muscle cells. The ability of cnm expressing strains of S. mutans to invade coronary artery smooth muscle cells may further support a role for S. mutans in fection/invasion in atherosclerosis and provide information as to a possible mechanism. Endothelial R esponse to S. mutans I nfection T his work investigated the gene pattern changes of primary endothelial cells when infected with an invasive strain compared to a cognate mutant strain using microarrays. The transcriptional profiles generated indicated that genes involved in cytoskeletal regulation and rearrangements were impacted in a Cnm dependent manner. The specifi c mechanisms of S. mutans entry into endothelial cells (i.e. caveolinmediated and/or clathrinmediated endocytosis) is the topic of an NIH R21 awarded to the ProgulskeFox laboratory, and these microarray results will be used to support that project. Furt hermore, t his work investigated the changes in the endothelial transcription response to S. mutans infection over time. It was known through previous studies that

PAGE 143

143 S. mutans invasion of endothelial cells elicited changes in adhesion molecule expression, cyt okine production, and outsidein signaling through binding to 5 1 integrins. However, this work is the first to report a global view of the impact of S. mutans on endothelial cells. We found an increase in the expression of genes whose enhanced expression leads to dysregulated tissue repair ( e.g., [ 322 ] genes important for the development of atherosclerotic lesions ( e.g., lo w density lipoprotein receptor, LDLR [ 323 324 ] and modified LDL scavenger receptor CD36 [ 325 ] ), as well as genes involved in initiating morphological changes characteristic of atherosclerosis ( e.g. platelet derived growth factor, PDGF [ 326 ] ). Overall, the dysregulation of these genes are linked to net positive growth stimulation and development of chronic inflammation indicative of atherosclerosis progression/ exacerbation [ 327 ] Therefore, we hypothesize that endothelial injury and subsequent inflammation as a result of S. mutans invasion leads to endothelial activation and eventual dysfunction, the initiating event in cardiovascular disease. Of interest was the upregulation of growth factors including VEGF and PDGF. These growth factors have been shown to be differentially expressed in the presence of lactate. This finding may open a new avenue of research focusing on the effect of bacterial lactic acid production on host cells of the cardiovascular system. VEGF is also an important fact or in angiogenesis. Interestingly the induction of VEGF and repression of genes involved in apoptosis in S. mutans infected HCAEC has also been reported for Bartonella and Chlamydia v ascular endothelial infections and it is hypothesized that angiogenesi s, cell proliferation, and repression of apoptosis are key components of their virulence.

PAGE 144

144 Future W ork Introduction S. mutans has long been recognized as a major pathogen of dental caries, the most common infectious disease in humans [ 38, 86, 87] What is much less appreciated is its role in extra oral diseases [ 8897] S. mutans is an opportunistic pathogen frequently identified in human bacteremias and is an etiologic agent of infectious endocarditis [ 207 ] I nfectious endocarditis, a valvular vegetation of the endothelial layer, is a serious cardiovascular disease with often fatal outcomes directly r elated to dental procedures [ 105 133 ] It is estimated that oral streptococci are responsible for 35 4 5% of infectious endocarditis cases each year in the U S A and the incidence is increasing [ 148 ] There is now also strong evidence that S. m utans is involved in hemorrhagic stroke, which occurs when a blood vessel ruptures in the brain [ 150 ] Hemorrhagic stroke accounts for 10% of all strokes and has a 40% fatality rate, resulting in 24,000 deaths per year in the USA [ 149 ] In addition, epidemiological and DNA sequencing evidence supports a contributing rol e of S. mutans to atherosclerosis [ 152 153 ] Atherosclerosis is a complex inflammatory disease afflicting medium and large sized arteries and is the leading cause of death in the USA [ 328 ] The commonality of these diseases is that they are diseases of the cardiovascular system. Intracellular pathogens have evolved multiple pathways and mechanisms to enter, traffic and survive within eukaryotic cells [ 329 ] The process of internalization, coincident or subsequent to adherence is critical to the cell signaling and trafficki ng within host cells. Thus the mode of entry plays a major role in determining bacterial fate. There are no reports about the cellular events that govern S. mutans entry into cells. It is likely that strains of S. mutans expressing Cnm, such as OMZ175, are able to adhere to, enter,

PAGE 145

145 and persist in HCAECs and that the mechanism of entry is critical to the trafficking and survival of S. mutans intracellularly. It is also likely that invasive S. mutans enters endothelial cells using specific mechanisms and that Cnm plays a central role in this entry. In addition, cnm has now been found in strains of S. sanguinis (Abranches, personal communication), S. suis and S. rattus Therefore future studies investigating the role of cnm in endothelial cell invasion will hav e significance beyond S. mutans as well as cardiovascular disease pathology. Entry and Intracellular Trafficking Two important pathways for bacterial internalization into eukaryotic cells are the caveolae/lipid raft mediated endocytosis pathway and the rec eptor mediated (clathrindependent) endocytosis pathway. Entry via caveolae and/or lipid rafts has been reported for several Gram positive bacteria including streptococci. S canning electron microscopy (SEM) can be used to determine if S. mutans enters thro ugh a trigger mechanism (membraneruffling pattern), a zipper like mechanism, both mechanisms of receptor mediated entry, and/or through caveolae entry in the host cell membrane. Furthermore, protein markers (e.g. transferrin receptor) specific inhibitors and geneknockdowns (e.g. caveolin1, clathrin) can be used to better define the entry process. Methodology has recently been developed to isolate specific classes of endosomes using antibody conjugated magnetic nanoparticles [ 330 331 ] I solation and characterization of S. mutans containing endosomes using magnetic nanoparticle methodology and Multidime nsional Protein Identification Technology (MudPIT) could be used by modifying this methodology to isolate endocytic vesicles containing S. mutans OMZ175. T his analysis w ould provide new data concerning protein markers in the S. mutans containing vesicles. For example, vesicles isolated as part of caveolae-

PAGE 146

146 mediated entry would contain caveolin 1, while vesicles isolated as part of clathrin driven receptor mediated entry would contain clathrin and the cargo receptor. In the event of the later situation, a hos t receptor that binds to S m utans may be identified. It is possible that both modes of entry are used by S m utans as described for S. suis [ 175 ] Role of Cnm in S. mutans Entry The S m utans surface protein adhesin, P Ac has been reported to bind to host proteins i.e. fibronectin and collagen [ 186 ] Purified P Ac pr otein has been shown to elicit a cytokine response and induced expression of leukocyte homing receptors (I CAM, V CAM, and E selectin) in endothelial cells [ 253, 254 ] P Ac has also been shown to be an important molecule in host cell adherence as it directly binds to the alpha 5 beta 1 integrin [ 140 189 ] However, studies investigating the role of S m utans adhesion surface molecules such as P Ac have not shown that these molecules contribu te to the invasive phenotype in a manner similar to Cnm. Given that Cnm is required for invasion of endothelial cells [ 126 ] studies designed to elucidate the role of Cnm in invasion could be completed using purified Cnm coupled to latex beads to determine if Cnm is sufficient for entry. GAS invasins including a fibronectin binding protein have been functionally expressed in other bacteria [ 167 ] Similarly, full length cnm could be expressed in Lactococcus lactis as previously described[ 167 ] If Cnm is sufficient for entry of S m utans OMZ175, then the heterologous expressing strains should behave as strain OMZ175. If Cnm is not sufficient, or induces a different kind of entry than the whole bacterium, as reported for a GAS protein [ 233 ] then there will either be minimal intracellular bacteria (not expected) or the bacteria may enter by a different m echanism.

PAGE 147

147 It is expect ed that the coated beads and heterologous expression strains w ould provide similar results. However if the heterologous strain results are consistent with results from OMZ175 but the coated bead results are different, such as no inter nalization, then an additional factor supplied by the live bacteria is likely required. It may be that the coated beads as well as the heterologous strains will attach to the cells but not be internalized, in which case it would concluded that Cnm is not s ufficient for entry. Whatever the outcome, these experiments would obtain additional understanding of a group of important but minimally studied S m utans strains. Summary T h e future work proposed would begin to fill a critical gap in our knowledge of S m utans pathogenesis. Follow up studies would include the trans cellular passage of S m utans through the endothelium to deeper tissues and cell responses to invasion by S m utans D ata presented in this dissertation and that of others indicate that invasive strains of S m utans also invade oral cells in vitro; furthermore, S m utans can be detected in predentate children, supporting this claim Therefore these studies may have significance beyond cardiovascular disease and endothelial cells. Finally, the se fu ture studies would contribute information concerning the possible future application of cnm as a biomarker for s creening patients at risk for S. mutans non oral infections.

PAGE 148

148 APPENDIX MICROARRAY EXPRESSIO N DATA AND KEGG PATH WAYS Table A 1. Microarray g en e expression changes of genes with fold changes greater than 2 fold 5 h post infection with S. mutans OMZ175 compared to uninfected control. Parametric p value Control OMZ175 6h Fold change Gene symbol Gene name < 1e 07 1182.4 5556.65 4.8 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 < 1e 07 1470.92 4513.4 3 AKAP12 A kinase (PRKA) anchor protein 12 < 1e 07 85.18 225.19 2.6 ALCAM activated leukocyte cell adhesion molecule < 1e 07 2048 4451.27 2.2 ANGPT2 angiopoietin 2 < 1e 07 299 .73 1110.89 3.7 ANKRD55 ankyrin repeat domain 55 1.50E 06 300.25 688.59 2.3 ANP32E acidic (leucine rich) nuclear phosphoprotein 32 family, member E < 1e 07 73.39 604.67 8.3 AREG amphiregulin < 1e 07 58.89 143.26 2.4 ARHGAP5 Rho GTPase activating protein 5 < 1e 07 434.29 1034.7 2.4 ARID5B AT rich interactive domain 5B (MRF1 like) < 1e 07 135.06 5104.31 38.5 ATF3 activating transcription factor 3 < 1e 07 128.89 590.18 4.5 ATOH8 atonal homolog 8 (Drosophila) < 1e 07 2094.66 4576.41 2.2 ATP13A3 ATPase ty pe 13A3 < 1e 07 776.05 1833.01 2.4 ATP2B1 ATPase, Ca++ transporting, plasma membrane 1 < 1e 07 54.66 113.38 2.1 BCL2A1 BCL2 related protein A1 < 1e 07 1637.75 3281.18 2 BCL6 B cell CLL/lymphoma 6 < 1e 07 1649.14 4999.26 3 BHLHE40 basic helix loop helix family, member e40 < 1e 07 81.29 978.89 12 BIRC3 baculoviral IAP repeat containing 3 < 1e 07 496.28 2642.16 5.3 BMP2 bone morphogenetic protein 2 1.00E 07 694.58 1598.5 2.3 CALCRL calcitonin receptor like < 1e 07 142.52 324.6 2.3 CAMTA1 calmodulin bin ding transcription activator 1 < 1e 07 118.19 346.69 2.9 CBLN2 cerebellin 2 precursor < 1e 07 236.39 699.41 2.9 CCDC68 coiled coil domain containing 68 < 1e 07 6144.16 15393.14 2.5 CCL2 chemokine (C C motif) ligand 2 < 1e 07 124.72 2410.31 19.2 CCL20 c hemokine (C C motif) ligand 20

PAGE 149

149 Table A 1. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Gene name < 1e 07 1746.2 4262.55 2.4 CD274 CD274 molecule < 1e 07 22.55 311.91 13.9 CD69 CD69 molecule 1.00E 07 66.49 147.54 2.2 CDC14 A CDC14 cell division cycle 14 homolog A (S. cerevisiae) 3.82E 05 195.36 380.04 2 CDC23 cell division cycle 23 homolog (S. cerevisiae) < 1e 07 688.59 1420.81 2.1 CDK6 cyclin dependent kinase 6 < 1e 07 335.46 849.22 2.5 CEBPD CCAAT/enhancer binding prote in (C/EBP), delta < 1e 07 189.03 507.58 2.7 CHSY3 chondroitin sulfate synthase 3 < 1e 07 306.55 916.51 3 CLDN14 claudin 14 3.10E 06 207.22 408.02 2 CLK4 CDC like kinase 4 < 1e 07 282.58 1029.34 3.7 CNKSR3 CNKSR family member 3 < 1e 07 331.99 725.33 2. 2 CREB5 cAMP responsive element binding protein 5 < 1e 07 117.17 512 4.3 CSF2 colony stimulating factor 2 (granulocyte macrophage) < 1e 07 255.11 657.11 2.6 CSRNP1 cysteine serine rich nuclear protein 1 < 1e 07 158.41 350.31 2.2 CX3CL1 chemokine (C X3 C motif) ligand 1 < 1e 07 3875.05 11405.96 2.9 CXCL1 chemokine (C X C motif) ligand 1 (melanoma growth stimulating activity, alpha) 1.70E 06 247.28 543.07 2.2 CXCL12 chemokine (C X C motif) ligand 12 < 1e 07 354.59 8569.53 24.4 CXCL2 chemokine (C X C mot if) ligand 2 < 1e 07 154.88 4474.47 28.6 CXCL3 chemokine (C X C motif) ligand 3 < 1e 07 38.59 93.7 2.4 CXCL5 chemokine (C X C motif) ligand 5 3.80E 06 1878.02 3942.79 2.1 CXCL6 chemokine (C X C motif) ligand 6 (granulocyte chemotactic protein 2) < 1e 0 7 471.95 1470.92 3.1 CXCR7 chemokine (C X C motif) receptor 7 3.40E 06 186.43 420.95 2.3 DIRAS3 DIRAS family, GTP binding RAS like 3 < 1e 07 18.47 94.68 5 DKK2 dickkopf homolog 2 (Xenopus laevis) < 1e 07 328.56 700.63 2.1 DOK5 docking protein 5 < 1e 07 3432.4 13331.02 3.8 DUSP1 dual specificity phosphatase 1 < 1e 07 118.81 325.16 2.7 DUSP10 dual specificity phosphatase 10 < 1e 07 428.31 1807.78 4.2 DUSP5 dual specificity phosphatase 5

PAGE 150

150 Table A 1. Continued. Parametric p value Control OMZ175 6h Fol d change Gene symbol Gene name < 1e 07 193.01 376.76 2 DUSP8 dual specificity phosphatase 8 < 1e 07 955.43 2252.79 2.4 E2F7 E2F transcription factor 7 2.30E 06 60.03 146.02 2.4 EGOT eosinophil granule ontogeny transcript (non protein coding) < 1e 07 13 2.51 5965.8 45.5 EGR1 early growth response 1 < 1e 07 81.15 471.14 5.9 EGR2 early growth response 2 < 1e 07 23.79 874.61 37 EGR3 early growth response 3 < 1e 07 73.9 145.76 2 EGR4 early growth response 4 4.00E 07 73.01 145.51 2 EIF4E eukaryotic transla tion initiation factor 4E < 1e 07 1293.89 2911.41 2.3 ELL2 elongation factor, RNA polymerase II, 2 < 1e 07 1680.88 5451.74 3.2 ERRFI1 ERBB receptor feedback inhibitor 1 < 1e 07 88.8 882.22 10 F3 coagulation factor III (thromboplastin, tissue factor) < 1e 07 182.28 365.82 2 FBXO32 F box protein 32 3.00E 07 123.43 400.32 3.2 FGFR3 fibroblast growth factor receptor 3 < 1e 07 1930.82 5792.62 3 FLT1 fms related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) < 1e 07 43.56 2787.97 62.5 FOS FBJ murine osteosarcoma viral oncogene homolog < 1e 07 121.31 2418.67 20 FOSB FBJ murine osteosarcoma viral oncogene homolog B < 1e 07 1612.41 3321.23 2 FOSL2 FOS like antigen 2 < 1e 07 67.53 199.12 2.9 FREM3 FRAS1 related extracellular matrix 3 < 1e 07 367.09 2288.2 6.3 FST follistatin < 1e 07 67.53 1243.34 18.5 GEM GTP binding protein overexpressed in skeletal muscle < 1e 07 68.83 492 7.1 GPR137C G proteincoupled receptor 137C < 1e 07 22.94 142.77 6.3 GREM1 gremlin 1 < 1e 07 1573.76 3492.39 2.2 GULP1 GULP, engulfment adaptor PTB domain containing 1 < 1e 07 259.12 545.9 2.1 HABP4 hyaluronan binding protein 4 < 1e 07 1823.51 6080.61 3.3 HBEGF heparinbinding EGF like growth factor < 1e 07 160.62 1049.15 6.7 HDAC9 hist one deacetylase 9 3.72E 05 238.44 614.17 2.6 HEY1 hairy/enhancer of split related with YRPW motif 1 < 1e 07 25.77 75.98 2.9 HGF hepatocyte growth factor (hepapoietin A; scatter factor)

PAGE 151

151 Table A 1. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Gene name < 1e 07 189.36 368.37 2 HIVEP2 human immunodeficiency virus type I enhancer binding protein 2 9.00E 07 220.56 603.62 2.7 HLX H2.0 like homeobox < 1e 07 1047.33 2127.58 2 HMGCR 3 hydroxy 3 methylglutaryl CoA reductase < 1e 0 7 355.82 1166.12 3.2 HMGCS1 3 hydroxy 3 methylglutaryl CoA synthase 1 (soluble) < 1e 07 705.5 2320.15 3.3 ICAM1 intercellular adhesion molecule 1 4.00E 07 25.24 66.72 2.6 ICAM4 intercellular adhesion molecule 4 (Landsteiner Wiener blood group) < 1e 07 2 058.67 4138.81 2 IDI1 isopentenyl diphosphate delta isomerase 1 < 1e 07 64.45 388.7 5.9 IL11 interleukin 11 7.00E 07 1377.18 2792.81 2 IL1RL1 interleukin 1 receptor like 1 < 1e 07 715.35 4746.01 6.7 IL6 interleukin 6 (interferon, beta 2) < 1e 07 3647.0 1 16130.46 4.3 IL8 interleukin 8 < 1e 07 2091.03 6483.24 3.1 INSIG1 insulin induced gene 1 < 1e 07 405.2 1006.41 2.5 IRF6 interferon regulatory factor 6 < 1e 07 1126.4 2921.51 2.6 ITGB8 integrin, beta 8 < 1e 07 1425.74 2998.45 2.1 JUN jun proto oncogen e < 1e 07 188.38 897.64 4.8 JUNB jun B proto oncogene < 1e 07 3565.77 8192 2.3 JUND jun D proto oncogene 1.10E 06 31.45 71.88 2.3 KCNN2 potassium intermediate/small conductance calcium activated channel, subfamily N, member 2 < 1e 07 603.62 1190.62 2 K DM6B lysine (K) specific demethylase 6B 2.00E 07 17.85 40.02 2.2 KIAA0146 KIAA0146 < 1e 07 2646.74 7434.4 2.8 KITLG KIT ligand < 1e 07 151.95 2977.74 19.6 KLF4 Kruppel like factor 4 (gut) < 1e 07 149.86 438.82 2.9 KLF5 Kruppel like factor 5 (intestinal ) < 1e 07 6494.49 13517.12 2.1 KLF6 Kruppel like factor 6 1.80E 06 90.51 185.46 2 LBH limb bud and heart development homolog (mouse) < 1e 07 1826.67 6059.57 3.3 LDLR low density lipoprotein receptor < 1e 07 101.48 789.61 7.7 LIF leukemia inhibitory fac tor (cholinergic differentiation factor)

PAGE 152

152 Table A 1. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Gene name < 1e 07 309.22 638.04 2.1 LONRF1 LON peptidase N terminal domain and ring finger 1 < 1e 07 1719.17 3344.33 2 MAFF v maf musculoaponeurotic fibrosarcoma oncogene homolog F < 1e 07 1465.83 3029.79 2.1 MALL mal, T cell differentiation protein like < 1e 07 2735.33 5556.65 2 MCL1 myeloid cell leukemia sequence 1 (BCL2 related) 2.90E 06 86.22 278.2 3.2 MGP matrix Gla pro tein < 1e 07 321.24 765.36 2.4 MMP1 matrix metallopeptidase 1 (interstitial collagenase) < 1e 07 305.49 1579.22 5.3 MMP10 matrix metallopeptidase 10 (stromelysin 2) < 1e 07 6677.07 19997.05 3 MT1E metallothionein 1E < 1e 07 1408.55 6112.3 4.3 MT1F meta llothionein 1F < 1e 07 119.22 4762.49 40 MT1M metallothionein 1M < 1e 07 3019.3 12633.79 4.2 MT1X metallothionein 1X < 1e 07 7525.13 16469.39 2.2 MYADM myeloid associated differentiation marker < 1e 07 623.83 1389.16 2.2 MYO1E myosin IE < 1e 07 182.59 465.46 2.6 NAMPT nicotinamide phosphoribosyltransferase < 1e 07 880.7 1967.98 2.2 NAV3 neuron navigator 3 < 1e 07 1770.57 4787.31 2.7 NCOA7 nuclear receptor coactivator 7 < 1e 07 672.09 1525.43 2.3 NEDD4L neural precursor cell expressed, developmentall y down regulated 4 like < 1e 07 3414.6 7525.13 2.2 NEDD9 neural precursor cell expressed, developmentally down regulated 9 < 1e 07 103.43 234.35 2.3 NEK3 NIMA (never in mitosis gene a) related kinase 3 < 1e 07 930.91 1900.94 2 NEXN nexilin (F actin bind ing protein) < 1e 07 423.14 947.18 2.2 NFATC1 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 < 1e 07 255.11 645.83 2.5 NFATC2 nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 < 1e 07 438.06 1154.06 2.6 NFIL3 nuclear factor, interleukin 3 regulated < 1e 07 105.42 292.04 2.8 NFKB2 nuclear factor of kappa light polypeptide gene enhancer in B cells 2 (p49/p100) < 1e 07 2373.01 6316.89 2.6 NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha

PAGE 153

153 Table A 1. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Gene name < 1e 07 673.25 3666.02 5.6 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta 3.00E 07 72.88 221.32 3 NPTX1 neuronal pentraxin I < 1e 07 291.53 734.19 2.5 NR4A1 nuclear receptor subfamily 4, group A, member 1 < 1e 07 30.17 554.48 18.5 NR4A2 nuclear receptor subfamily 4, group A, member 2 < 1e 07 73.9 235.16 3.2 NR4A3 nuclear receptor subfamily 4, group A, member 3 < 1e 07 332.57 714.11 2.1 PCDH17 protocadherin 17 < 1e 07 71.01 206.86 2.9 PDLIM3 PDZ and LIM domain 3 < 1e 07 79.2 224.8 2.9 PDLIM3 PDZ and LIM domain 3 < 1e 07 238.44 509.35 2.1 PDLIM4 PDZ and LIM domain 4 < 1e 07 1080.51 2198.8 2 PDLIM5 PDZ and LIM domain 5 < 1e 07 470.32 948.83 2 PICALM phosphatidylinositol binding clathrin assembly protein < 1e 07 65.57 127.78 2 PID1 phosphotyrosine interaction domain containing 1 < 1e 07 962.07 3801.89 4 PLA2G4A phospholipase A2, group IVA (cytosolic, calcium dependent) < 1e 07 504.95 1047.33 2.1 PPP1R10 protein phosphatase 1, regulatory (inhibitor) subunit 10 < 1e 07 581.04 1230.48 2.1 PPP1R15A protein phosphatase 1, regulatory (inhibitor) subunit 15A < 1e 07 13.57 62.03 4.5 PRR16 proli ne rich 16 < 1e 07 373.51 10903.47 29.4 PTGS2 prostaglandin endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) < 1e 07 67.3 323.47 4.8 PTHLH parathyroid hormone like hormone < 1e 07 268.26 606.77 2.3 RAB23 RAB23, member RAS oncogene family < 1e 07 72.13 171.85 2.4 RAI2 retinoic acid induced 2 < 1e 07 221.71 443.41 2 RASGRF2 Ras protein specific guanine nucleotide releasing factor 2 < 1e 07 391.4 903.89 2.3 RBM24 RNA binding motif protein 24 < 1e 07 1232.61 4211.15 3.4 RCAN1 regul ator of calcineurin 1 < 1e 07 378.07 828.87 2.2 RIMKLB ribosomal modification protein rimK like family member B < 1e 07 321.8 709.18 2.2 RIPK2 receptor interacting serine threonine kinase 2

PAGE 154

154 Table A 1. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Gene name < 1e 07 183.23 1013.41 5.6 RND1 Rho family GTPase 1 < 1e 07 111.24 559.31 5 RRAD Ras related associated with diabetes < 1e 07 45.73 231.52 5 RRAD Ras related associated with diabetes < 1e 07 204.36 465.46 2.3 RUNDC3B RUN domain containing 3B < 1e 07 5175.56 10423.12 2 SAT1 spermidine/spermine N1 acetyltransferase 1 < 1e 07 152.75 5527.84 35.7 SELE selectin E 8.00E 07 202.6 426.82 2.1 SEMA6D sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin ) 6D < 1e 07 205.79 3219.23 15.6 SERPINB2 serpin peptidase inhibitor, clade B (ovalbumin), member 2 1.20E 06 505.83 990.83 2 SLC2A3 solute carrier family 2 (facilitated glucose transporter), member 3 < 1e 07 83.43 225.58 2.7 SLC35F5 solute carrier famil y 35, member F5 3.03E 05 38.85 75.45 2 SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 < 1e 07 563.2 2846.55 5 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 4.00E 07 92.09 204.72 2.2 SMC 4 structural maintenance of chromosomes 4 1.13E 05 73.52 148.83 2 SOCS1 suppressor of cytokine signaling 1 < 1e 07 258.23 1215.64 4.8 SOCS3 suppressor of cytokine signaling 3 < 1e 07 313 612.05 2 SPAG9 sperm associated antigen 9 < 1e 07 770.69 1541.37 2 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) < 1e 07 970.44 3929.15 4 SPRY2 sprouty homolog 2 (Drosophila) < 1e 07 632.53 1804.65 2.9 SPRY4 sprouty homolog 4 (Drosophila) < 1e 07 435.04 958.74 2.2 SQSTM1 sequestosome 1 < 1e 07 51 9.15 1084.26 2.1 ST3GAL6 ST3 beta galactoside alpha 2,3 sialyltransferase 6 1.00E 07 276.76 601.53 2.2 ST8SIA4 ST8 alpha N acetyl neuraminide alpha 2,8 sialyltransferase 4 < 1e 07 522.76 1316.51 2.5 STK38L serine/threonine kinase 38 like < 1e 07 147.03 358.29 2.4 TBX3 T box 3 1.40E 06 982.29 2503.97 2.6 TFPI2 tissue factor pathway inhibitor 2 < 1e 07 336.63 792.35 2.4 TMEM158 transmembrane protein 158 (gene/pseudogene) 2.00E 07 80.73 219.79 2.7 TMEM200A transmembrane protein 200A

PAGE 155

155 Table A 1. Continued. Parametric p value Control* OMZ175 6h Fold change Gene symbol Gene name < 1e 07 513.78 3685.13 7.1 TNFAIP3 t umor necrosis factor, alpha induced protein 3 < 1e 07 506.7 1325.66 2.6 TNFAIP8 tumor necrosis factor, alpha induced protein 8 < 1e 07 163.71 512 3.1 TRAF1 TNF receptor associated factor 1 < 1e 07 1353.52 5113.16 3.8 TRIB1 tribbles homolog 1 (Drosophila) < 1e 07 27.67 110.47 4 TSLP thymic stromal lymphopoietin < 1e 07 404.5 4397.6 10.9 VCAM1 vascular cell adhesion molecule 1 < 1e 07 512 164 3.44 3.2 VEGFA vascular endothelial growth factor A < 1e 07 1465.83 3821.7 2.6 VEGFC vascular endothelial growth factor C 3.90E 06 145.76 340.14 2.3 VIM vimentin < 1e 07 127.78 265.03 2.1 ZBTB16 zinc finger and BTB domain containing 16 < 1e 07 285.53 4 060.66 14.3 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) < 1e 07 45.57 108.57 2.4 ZNF93 zinc finger protein 93 *Background corrected, normalized signal intensity readout.

PAGE 156

156 Table A 2. Microarray g ene expression changes of genes with fold red uctions less than 2 fold 5 h post infection with S. mutans OMZ175 compared to uninfected control. Parametric p value Control OMZ175 6h Fold change Gene symbol Description < 1e 07 567.12 245.57 2.3 AIM1 absent in melanoma 1 < 1e 07 3432.4 1307.41 2.6 A NGPTL4 angiopoietin like 4 4.00E 07 116.36 53.91 2.2 ANO2 anoctamin 2 < 1e 07 3723.65 1365.3 2.7 BMP4 bone morphogenetic protein 4 < 1e 07 1761.39 514.67 3.4 CABLES1 Cdk5 and Abl enzyme substrate 1 4.80E 06 107.82 48.59 2.2 CCAR1 cell division cycl e and apoptosis regulator 1 2.10E 06 104.33 52.71 2 CCDC76 coiled coil domain containing 76 < 1e 07 1995.45 888.36 2.3 CGNL1 cingulin like 1 < 1e 07 1280.51 491.14 2.6 CHST1 carbohydrate (keratan sulfate Gal 6) sulfotransferase 1 < 1e 07 1423.28 558 .34 2.6 CHST15 carbohydrate (N acetylgalactosamine 4 sulfate 6 O) sulfotransferase 15 < 1e 07 3834.97 1509.65 2.5 CLDN5 claudin 5 < 1e 07 158.68 63.12 2.5 CLMN calmin (calponin like, transmembrane) < 1e 07 512 258.68 2 CNTNAP3B similar to cell recog nition molecule CASPR3 < 1e 07 4600.26 2176.06 2.1 DDIT4 DNA damage inducible transcript 4 1.98E 05 645.83 320.68 2 DUSP4 dual specificity phosphatase 4 < 1e 07 1761.39 844.82 2.1 EFNA1 ephrin A1 < 1e 07 8436.92 2344.4 3.6 EIF5 eukaryotic translati on initiation factor 5 < 1e 07 543.07 210.11 2.6 ENC1 ectodermal neural cortex 1 (with BTB like domain) < 1e 07 212.31 85.63 2.5 EPHX4 epoxide hydrolase 4 < 1e 07 1549.41 602.58 2.6 FAM124B family with sequence similarity 124B < 1e 07 635.83 170.07 3.7 FAM13B family with sequence similarity 13, member B < 1e 07 6793.79 3208.09 2.1 FAM43A family with sequence similarity 43, member A < 1e 07 1130.31 456.67 2.5 FAM84B family with sequence similarity 84, member B < 1e 07 934.14 445.72 2.1 FAM89A f amily with sequence similarity 89, member A < 1e 07 355.82 139.34 2.6 FILIP1 filamin A interacting protein 1

PAGE 157

157 Table A 2. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Description < 1e 07 536.52 244.72 2.2 FLRT2 fibronectin l eucine rich transmembrane protein 2 < 1e 07 91.14 41.36 2.2 FSTL5 follistatin like 5 < 1e 07 242.19 116.16 2.1 GATA3 GATA binding protein 3 < 1e 07 905.46 312.45 2.9 GIMAP1 GTPase, IMAP family member 1 < 1e 07 1629.26 740.57 2.2 GIMAP2 GTPase, IMAP family member 2 1.00E 07 1761.39 892.99 2 GIMAP4 GTPase, IMAP family member 4 < 1e 07 3578.15 1549.41 2.3 GIMAP6 GTPase, IMAP family member 6 < 1e 07 1606.83 524.57 3.1 GIMAP7 GTPase, IMAP family member 7 < 1e 07 2040.91 924.48 2.2 GIMAP8 GTPase, IMAP family member 8 3.30E 06 32.67 15.73 2.1 GOPC golgi associated PDZ and coiled coil motif containing < 1e 07 179.77 60.03 3 GPR146 G protein coupled receptor 146 2.60E 06 453.51 218.27 2.1 HNRNPD heterogeneous nuclear ribonucleoprotein D (AU rich element RNA binding protein 1, 37kDa) < 1e 07 413 196.72 2.1 HOXA3 homeobox A3 < 1e 07 268.73 130.24 2.1 HOXA9 homeobox A9 < 1e 07 1344.17 688.59 2 HOXD1 homeobox D1 7.00E 07 517.35 244.72 2.1 HRCT1 histidine rich carboxyl terminus 1 < 1e 07 226. 36 86.37 2.6 HSD17B2 hydroxysteroid (17 beta) dehydrogenase 2 < 1e 07 548.75 251.17 2.2 INO80C INO80 complex subunit C < 1e 07 703.06 331.42 2.1 INPP5D inositol polyphosphate 5 phosphatase, 145kDa 2.40E 06 371.57 190.02 2 KIAA1274 KIAA1274 < 1e 07 1071.19 549.7 2 KIAA1370 KIAA1370 < 1e 07 1164.1 237.21 4.9 KIT v kit Hardy Zuckerman 4 feline sarcoma viral oncogene homolog < 1e 07 396.86 172.45 2.3 LFNG LFNG O fucosylpeptide 3 beta N acetylglucosaminyltransferase 4.00E 07 532.82 251.6 2.1 LHX6 LIM homeobox 6 < 1e 07 1302.89 629.25 2.1 LOC158376 hypothetical LOC158376 < 1e 07 193.01 70.4 2.7 MBD5 methyl CpG binding domain protein 5 < 1e 07 919.69 454.3 2 MERTK c mer proto oncogene tyrosine kinase < 1e 07 166.57 83.14 2 MGC16121 hypothetic al protein MGC16121

PAGE 158

158 Table A 2. Continued. Parametric p value Control OMZ175 6h Fold change Gene symbol Description 2.00E 07 88.95 41.43 2.2 MMP28 matrix metallopeptidase 28 < 1e 07 437.31 175.16 2.5 MN1 meningioma (disrupted in balanced translocation) 1 2.00E 07 2206.43 1126.4 2 MTUS1 microtubule associated tumor suppressor 1 < 1e 07 782.8 326.29 2.4 MYLIP myosin regulatory light chain interacting protein 3.90E 06 492.85 241.77 2 N4BP2L2 NEDD4 binding protein 2 like 2 < 1e 07 101.48 52.07 2 NAV 2 neuron navigator 2 < 1e 07 211.94 108.2 2 NBPF1 neuroblastoma breakpoint family, member 1 < 1e 07 461.44 220.94 2.1 NFAT5 nuclear factor of activated T cells 5, tonicity responsive < 1e 07 1278.29 638.04 2 NR1D2 nuclear receptor subfamily 1, group D, member 2 < 1e 07 2019.8 1024 2 NR2F1 nuclear receptor subfamily 2, group F, member 1 < 1e 07 1981.67 1018.69 2 NRARP NOTCH regulated ankyrin repeat protein 6.00E 07 190.02 83.72 2.3 OAS1 2',5' oligoadenylate synthetase 1, 40/46kDa 3.30E 06 121.1 34.54 3.5 PDK4 pyruvate dehydrogenase kinase, isozyme 4 < 1e 07 403.8 170.96 2.4 PLLP plasmolipin < 1e 07 376.76 164.85 2.3 PNMAL1 PNMA like 1 2.00E 07 987.41 487.75 2 PPP1R16B protein phosphatase 1, regulatory (inhibitor) subunit 16B < 1e 07 296.6 3 137.66 2.2 PPP1R3C protein phosphatase 1, regulatory (inhibitor) subunit 3C < 1e 07 2711.73 1084.26 2.5 PRICKLE1 prickle homolog 1 (Drosophila) 2.10E 06 58.79 27.47 2.1 PRKAA1 protein kinase, AMP activated, alpha 1 catalytic subunit 8.00E 06 94.35 45.81 2.1 REV3L REV3 like, catalytic subunit of DNA polymerase zeta (yeast) 1.80E 06 98.53 34.84 2.8 RGS7BP regulator of G protein signaling 7 binding protein 1.00E 07 667.44 316.82 2.1 RPS24 ribosomal protein S24 2.70E 06 53.82 26.72 2 SFRS18 splic ing factor, arginine/serine rich 18 < 1e 07 3152.98 1573.76 2 SLC39A10 solute carrier family 39 (zinc transporter), member 10 < 1e 07 418.04 131.83 3.2 SNAI2 snail homolog 2 (Drosophila) < 1e 07 476.06 225.58 2.1 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 < 1e 07 4812.26 2414.49 2 TFRC transferrin receptor (p90, CD71) < 1e 07 924.48 472.77 2 TGFBRAP1 transforming growth factor, beta receptor associated protein 1

PAGE 159

159 Table A 2. Continued. Parametric p value Control OMZ175 6h Fold c hange Gene symbol Description < 1e 07 244.3 120.68 2 TIGD2 tigger transposable element derived 2 < 1e 07 830.31 232.73 3.6 TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 < 1e 07 172.74 59.51 2.9 TRA2A transformer 2 alpha homolog (Droso phila) < 1e 07 666.29 259.57 2.6 TRIB2 tribbles homolog 2 (Drosophila) 2.36E 05 167.15 85.92 2 VASH1 vasohibin 1 4.50E 06 558.34 267.33 2.1 XAF1 XIAP associated factor 1 7.50E 06 191.34 92.89 2.1 XPO1 exportin 1 (CRM1 homolog, yeast) < 1e 07 1190. 62 554.48 2.2 ZBTB1 zinc finger and BTB domain containing 1 < 1e 07 103.97 41.14 2.5 ZBTB24 zinc finger and BTB domain containing 24 6.40E 06 241.35 119.43 2 ZCCHC18 zinc finger, CCHC domain containing 18 9.00E 07 334.88 129.11 2.6 ZNF207 zinc finge r protein 207 < 1e 07 132.51 51.54 2.6 ZNF345 zinc finger protein 345 < 1e 07 2931.66 1337.2 2.2 ZNF521 zinc finger protein 521 < 1e 07 116.77 56.89 2.1 ZNF658 zinc finger protein 658 < 1e 07 371.57 111.24 3.3 ZNF792 zinc finger protein 792 2.00E 07 176.68 87.58 2 ZSCAN16 zinc finger and SCAN domain containing 16

PAGE 160

160 Generate using Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Database ( http://www .genome.jp/dbget bin/www_bget?map04210). Each box may represent more than one gene or probe set, hence the purple designation.

PAGE 161

161 Generate using Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Database ( http://www.genome.jp/dbget bin/www_bget?map04350). Each box may represent more than one gene or probe set, hence the purple designation.

PAGE 162

162 Generate using Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Database ( http://www.genome.jp/dbget bin/www_bget?map04010). Each box may represent more than one gene or probe set, hence the purple designation.

PAGE 163

163 Generate using Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Database ( http://www.genome.jp/dbget bin/www_bget?map04620). Each box may represent more than one gen e or probe set, hence the purple designation.

PAGE 164

164 Generate using Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Database ( http://www.genome.jp/dbget bin/www _bget?map04620). Each box may represent more than one gene or probe set, hence the purple designation.

PAGE 165

165 Generate using Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway Database ( http://www.genome.jp/dbget bin/www_bget?map04370). Each box may represent more than one gene or probe set, hence the purple designation.

PAGE 166

166 LIST OF REFERENCES 1. Breslow JL: Cardiovascular disease burden incre ases, NIH funding decreases. Nat M ed 1997, 3 (6):600 601. 2. Braunwald E: Shattuck le cture --C ardiovascular medicine at the turn of the millennium: triumphs, concerns, and opportunities N E ngl J M ed 1997, 337(19):13601369. 3. Berenson GS, Srinivasan SR, Ba o W, Newman WP, 3rd, Tracy RE, Wattigney WA: Association between multiple cardiovascular risk factors and atherosclerosis in children and young adults. The Bogalusa Heart Study N Engl J M ed 1998, 338 (23):16501656. 4. Glantz SA, Parmley WW: Passive smokin g and heart disease. Mechanisms and risk J A m M ed A ssoc 1995, 273 (13):10471053. 5. Kannel WB: Blood pressure as a cardiovascular risk factor: prevention and treatment J A m M ed A ssoc 1996, 275 (20):15711576. 6. Leaverton PE, Sorlie PD, Kleinman JC, Dannenberg AL, Ingster Moore L, Kannel WB, Cornoni Huntley JC: Representativeness of the Framingham risk model for coronary heart disease mortality: a comparison with a national cohort study J Chronic Dis 1987, 40(8):775784. 7. Mehta JL, Saldeen TG, Rand K: I nteractive role of infection, inflammation and traditional risk factors in atherosclerosis and coronary artery disease. J Am Coll Cardiol 1998, 31(6):12171225. 8. Rothenbacher D, Brenner H, Hoffmeister A, Mertens T, Persson K, Koenig W: Relationship betwe en infectious burden, systemic inflammatory response, and risk of stable coronary artery disease: role of confounding and reference group. Atherosclerosis 2003, 170(2):339345. 9. Haraszthy VI, Zambon JJ, Trevisan M, Zeid M, Genco RJ: Identification of per iodontal pathogens in atheromatous plaques J Periodontol 2000, 71(10):15541560. 10. Kozarov E, Sweier D, Shelburne C, ProgulskeFox A, Lopatin D: Detection of bacterial DNA in atheromatous plaques by quantitative PCR Microbes I nfect 2006, 8 (3):687693. 11. Kozarov EV, Dorn BR, Shelburne CE, Dunn WA, Jr., ProgulskeFox A: Human atherosclerotic plaque contains viable invasive Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis Arterioscler Thromb Vasc Biol 2005, 25(3):e1718.

PAGE 167

167 12. Lockhart PB Bolger AF, Papapanou PN, Osinbowale O, Trevisan M, Levison ME, Taubert KA, Newburger JW, Gornik HL, Gewitz MH et al : Periodontal disease and atherosclerotic vascular disease: does the evidence suppor t an independent association?: A scientific statement f rom the American Heart Association Circulation 2012, 125(20):25202544. 13. Senba T, Kobayashi Y, Inoue K, Kaneto C, Inoue M, Toyokawa S, Suyama Y, Suzuki T, Miyano Y, Miyoshi Y: The association between self reported periodontitis and coronary heart disea se --from MY Health Up Study J O ccup H ealth 2008, 50(3):283 287. 14. Ylostalo PV, Jarvelin MR, Laitinen J, Knuuttila ML: Gingivitis, dental caries and tooth loss: risk factors for cardiovascular diseases or indicators of elevated health risks. J Clin Perio dontol 2006, 33 (2):92 101. 15. Beck JD, Eke P, Heiss G, Madianos P, Couper D, Lin D, Moss K, Elter J, Offenbacher S: Periodontal disease and coronary heart disease: a reappraisal of the exposure. Circulation 2005, 112(1):19 24. 16. Elter JR, Champagne CM, Offenbacher S, Beck JD: Relationship of periodontal disease and tooth loss to prevalence of coronary heart disease J Periodontol 2004, 75 (6):782790. 17. Persson RE, Hollender LG, Powell VL, MacEntee M, Wyatt CC, Kiyak HA, Persson GR: Assessment of period ontal conditions and systemic disease in older subjects. II. Focus on cardiovascular diseases. J Clin Periodontol 2002, 29(9):803 810. 18. Dorn JM, Genco RJ, Grossi SG, Falkner KL, Hovey KM, Iacoviello L, Trevisan M: Periodontal disease and recurrent cardi ovascular events in survivors of myocardial infarction (MI): the Western New York Acute MI Study J Periodontol 2010, 81 (4):502511. 19. Dietrich T, Jimenez M, Krall Kaye EA, Vokonas PS, Garcia RI: Age dependent associations between chronic periodontitis/e dentulism and risk of coronary heart disease. Circulation 2008, 117 (13):16681674. 20. Hung HC, Joshipura KJ, Colditz G, Manson JE, Rimm EB, Speizer FE, Willett WC: The association between tooth loss and coronary heart disease in men and women. J Public He alth D ent 2004, 64 (4):209215. 21. Joshipura KJ, Wand HC, Merchant AT, Rimm EB: Periodontal disease and biomarkers related to cardiovascular disease. J Dent Res 2004, 83 (2):151 155. 22. Meurman JH, Janket SJ, Qvarnstrom M, Nuutinen P: Dental infections and serum inflammatory markers in patients with and without severe heart

PAGE 168

168 disease. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003, 96 (6):695 700. 23. Tonetti MS, D'Aiuto F, Nibali L, Donald A, Storry C, Parkar M, Suvan J, Hingorani AD, Vallance P, Deanf ield J: Treatment of periodontitis and endothelial function. N Engl J Med 2007, 356 (9):911 920. 24. Ide M, Jagdev D, Coward PY, Crook M, Barclay GR, Wilson RF: The short term effects of treatment of chronic periodontitis on circulating levels of endotoxin, C reactive protein, tumor necrosis factor alpha, and interleukin 6 J Periodontol 2004, 75(3):420 428. 25. Beck JD, Offenbacher S: Systemic effects of periodontitis: epidemiology of periodontal disease and cardiovascular disease. J Periodontol 2005, 76(11 Suppl):20892100. 26. Chiu B: Multiple infections in carotid atherosclerotic plaques Am Heart J 1999, 138 (5 Pt 2):S534536. 27. Rafferty B, Jonsson D, Kalachikov S, Demmer RT, Nowygrod R, Elkind MS, Bush H, Jr., Kozarov E: Impact of monocytic cells on re covery of uncultivable bacteria from atherosclerotic lesions. J I ntern M ed 2011, 270(3):273280. 28. Gibson FC, 3rd, Hong C, Chou HH, Yumoto H, Chen J, Lien E, Wong J, Genco CA: Innate immune recognition of invasive bacteria accelerates atherosclerosis in apolipoprotein E deficient mice. Circulation 2004, 109(22):28012806. 29. Lalla E, Lamster IB, Hofmann MA, Bucciarelli L, Jerud AP, Tucker S, Lu Y, Papapanou PN, Schmidt AM: Oral infection with a periodontal pathogen accelerates early atherosclerosis in ap olipoprotein E null mice Arterioscler T hromb V asc B iol 2003, 23 (8):14051411. 30. Li L, Messas E, Batista EL, Jr., Levine RA, Amar S: Porphyromonas gingivalis infection accelerates the progression of atherosclerosis in a heterozygous apolipoprotein E defi cient murine model Circulation 2002, 105 (7):861867. 31. Kesavalu L, Lucas AR, Verma RK, Liu L, Dai E, Sampson E, ProgulskeFox A: Increased atherogenesis during Streptococcus mutans infection in ApoE null mice J Dent Res 2012, 91 (3):255 260. 32. Paster BJ, Boches SK, Galvin JL, Ericson RE, Lau CN, Levanos VA, Sahasrabudhe A, Dewhirst FE: Bacterial diversity in human subgingival plaque J B acteriol 2001, 183(12):37703783. 33. Dewhirst FE, Chen T, Izard J, Paster BJ, Tanner AC, Yu WH, Lakshmanan A, Wade W G: The human oral microbiome J Bacteriol 2010, 192 (19):50025017.

PAGE 169

169 34. Vartoukian SR, Palmer RM, Wade WG: Strategies for culture of 'unculturable' bacteria FEMS Microbiol Lett 2010, 309 (1):1 7. 35. Kolbert CP, Persing DH: Ribosomal DNA sequencing as a tool for identification of bacterial pathogens Curr O pin M icrobiol 1999, 2 (3):299305. 36. Russell RRB: Pathogenesis of oral s treptococci In: Gram Positve Pathogens. 2 edn. Edited by Fischetti VA, Novick, R.P., Ferretti, J.J., Portnoy D.A., Rood, J.I. Was hington D.C.: ASM Press; 2006: 332339. 37. Marsh M, Martin, M.V.: Acquisition, a dherence, distribution and m etabolism of the o ral m icroflora In: Oral Microbiol. 4 edn. Woburn, MA: Wright; 1999: 34 57. 38. Loesche WJ: Role of Streptococcus mutans in human dental decay Microbiol R ev 1986, 50 :353380. 39. Li J, Helmerhorst EJ, Leone CW, Troxler RF, Yaskell T, Haffajee AD, Socransky SS, Oppenheim FG: Identification of early microbial colonizers in human dental biofilm J A ppl M icrobiol 2004, 97 (6):13111318. 40. Kolenbrander PE, London J: Adhere Today, Here Tomorrow Oral Bacterial Adherence. J B acteriol 1993, 175 (11):32473252. 41. Kolenbrander PE, Andersen RN, Moore LVH: Intrageneric Coaggregation among Strains of Human Oral Bacteria Potential Role in Pr imary Colonization of the Tooth Surface Appl E nviron M icrobiol 1990, 56 (12):38903894. 42. De Vos P: Bergey's Manual of Systematic Bacteriology vol. 3, 2nd edn. Dordrecht ; New York Springer; 2009. 43. Kreth J, Merritt J, Qi F: Bacterial and host interactions of oral streptococci DNA C ell B iol 2009, 28 (8):397403. 44. Nobbs AH, Lamont RJ, Jenkinson HF: Streptococcus adherence and colonization. Microbiol Mol Biol Rev 2009, 73 (3):407 450, Table of Contents. 45. Hamilton IR, Buckley ND: Adaptation by Strept ococcus mutans to acid tolerance Oral Microbiol Immunol 1991, 6 (2):65 71. 46. Li YH, Lau PC, Lee JH, Ellen RP, Cvitkovitch DG: Natural genetic transformation of Streptococcus mutans growing in biofilms J B acteriol 2001, 183 (3):897 908. 47. Banas JA: Viru lence properties of Streptococcus mutans. Front Biosci 2004, 9 :12671277.

PAGE 170

170 48. Lemos JA, Burne RA: A model of efficiency: stress tolerance by Streptococcus mutans Microbiology 2008, 154(Pt 11):32473255. 49. Senadheera D, Cvitkovitch DG: Quorum sensing and biofilm formation by Streptococcus mutans Adv E xp Me d B iol 2008, 631 :178 188. 50. Ajdic D, McShan WM, McLaughlin RE, Savic G, Chang J, Carson MB, Primeaux C, Tian R, Kenton S, Jia H et al : Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci USA 2002, 99(22):1443414439. 51. Yamada T, Takahashi Abbe S, Abbe K: Effects of oxygen on pyruvate formate lyase in situ and sugar metabolism of Streptococcus mutans and Streptococcus sanguis Infect Immun 1985, 47(1):129 134 52. Rawlings ND, Tolle DP, Barrett AJ: MEROPS: the peptidase database. Nucleic Acids Res 2004, 32 (Database issue):D160164. 53. MEROPS Peptidase Database [ http://merops.sanger.ac.uk ] 54. HallStoodley L, Stoodl ey P: Evolving concepts in biofilm infections Cell Microbiol 2009, 11 (7):10341043. 55. Flemming HC, Neu TR, Wozniak DJ: The EPS matrix: the "house of biofilm cells" J B acteriol 2007, 189 (22):79457947. 56. Sutherland I: Biofilm exopolysaccharides: a str ong and sticky framework Microbiology 2001, 147 (Pt 1):3 9. 57. Stoodley P, Sauer K, Davies DG, Costerton JW: Biofilms as complex differentiated communities. Ann R ev M icrobiol 2002, 56:187 209. 58. Horswill AR, Stoodley P, Stewart PS, Parsek MR: The effect of the chemical, biological, and physical environment on quorum sensing in structured microbial communities Anal B ioanal C hem 2007, 387(2):371380. 59. Donlan RM, Costerton JW: Biofilms: survival mechanisms of clinically relevant microorganisms. Clin M ic robiol R ev 2002, 15(2):167 193. 60. Lewis K: Persister cells, dormancy and infectious disease. Nat R ev Microbiol 2007, 5 (1):48 56. 61. Brooun A, Liu S, Lewis K: A dose response study of antibiotic resistance in Pseudomonas aeruginosa biofilms Antimicrob A gents Chemother 2000, 44(3):640 646. 62. Guiot E, Georges P, Brun A, FontaineAupart MP, BellonFontaine MN, Briandet R: Heterogeneity of diffusion inside microbial biofilms determined by

PAGE 171

171 fluorescence correlation spectroscopy under two photon excitation. P hotochem Photobiol 2002, 75 (6):570 578. 63. Banas JA, Vickerman MM: Glucan binding proteins of the oral streptococci Crit Rev Oral Biol Med 2003, 14 (2):89 99. 64. Sciotti MA, Yamodo I, Klein JP, Ogier JA: The N terminal half part of the oral streptococcal antigen I/IIf contains two distinct binding domains FEMS Microbiol Lett 1997, 153 (2):439 445. 65. Demuth DR, Davis CA, Corner AM, Lamont RJ, Leboy PS, Malamud D: Cloning and expression of a Streptococcus sanguis surface antigen that interacts with a huma n salivary agglutinin. Infect Immun 1988, 56(9):24842490. 66. Brady LJ, Maddocks SE, Larson MR, Forsgren N, Persson K, Deivanayagam CC, Jenkinson HF: The changing faces of Streptococcus antigen I/II polypeptide family adhesins Mol Microbiol 2010, 77 (2):2 76 286. 67. Nakano K, Nomura R, Taniguchi N, Lapirattanakul J, Kojima A, Naka S, Senawongse P, Srisatjaluk R, Gronroos L, Alaluusua S et al : Molecular characterization of Streptococcus mutans strains containing the cnm gene encoding a collagenbinding adhe sin Arch O ral B iol 2010, 55(1):3439. 68. Nomura R, Nakano K, Naka S, Nemoto H, Masuda K, Lapirattanakul J, Alaluusua S, Matsumoto M, Kawabata S, Ooshima T: Identification and characterization of a collagen binding protein, Cbm, in Streptococcus mutans M ol Oral Microbiol 2012, 27 (4):308 323. 69. Gibbons RJ, van Houte J: Bacterial adherence and the formation of dental plaque In: Bacterial A dherence. edn. Edited by Beachy EH. London: Chapman and Hall; 1980. 70. Loesche WJ: Microbiology of dental decay and periodontal disease. In: Medical Microbiology. 4th edn. Edited by Baron S. Galveston (TX); 1996. 71. Kolenbrander PE, Palmer RJ, Jr., Rickard AH, Jakubovics NS, Chalmers NI, Diaz PI: Bacterial interactions and successions during plaque development Periodo ntol 2000 2006, 42:47 79. 72. Suchett Kaye G, Morrier JJ, Barsotti O: Interactions between nonimmune host cells and the immune system during periodontal disease: Role of the gingival keratinocyte Crit Rev Oral Biol M 1998, 9 (3):292 305. 73. Tonetti MS, I mboden MA, Lang NP: Neutrophil migration into the gingival sulcus is associated with transepithelial gradients of interleukin 8 and ICAM 1 J Periodontol 1998, 69 (10):11391147.

PAGE 172

172 74. Sugiyama A, Uehara A, Iki K, Matsushita K, Nakamura R, Ogawa T, Sugawara S Takada H: Activation of human gingival epithelial cells by cell surface components of black pigmented bacteria: augmentation of production of interleukin 8, granulocyte colony stimulating factor and granulocyte macrophage colony stimulating factor and ex pression of intercellular adhesion molecule 1 J M ed M icrobiol 2002, 51(1):27 33. 75. Wilson M, Reddi K, Henderson B: Cytokine inducing components of periodontopathogenic bacteria J Periodontal Res 1996, 31 (6):393 407. 76. Dye BA, Li X, Beltran Aguilar ED : Selected oral health indicators in the United States, 20052008. NCHS data brief 2012(96):18. 77. Hamada S, Slade HD: Biology, immunology, and cariogenicity of Streptococcus mutans Microbiol R ev 1980, 44(2):331 384. 78. Preston AJ, Edgar WM: Developmen ts in dental plaque pH modelling. Journal of dentistry 2005, 33 (3):209 222. 79. Stephan RM Miller BF : A quantitative method for evaluating physical and chemical agents which modify production of acids in bacterial plaques on human teeth. J Dent Res 1943, 22:45 51. 80. Stephan RM: Changes in hydrogen ion concentration on tooth surfaces and in carious lesions J Am Dent Assoc 1940, 27:718 723. 81. Chassy BM, Beall JR, Bielawski RM, Porter EV, Donkersloot JA: Occurrence and distribution of sucrose metabolizing enzymes in oral streptococci Infect Immun 1976, 14 (2):408415. 82. Dashper SG, Reynolds EC: Lactic acid excretion by Streptococcus mutans Microbiol Uk 1996, 142 :33 39. 83. ShapiroShelef M, Calame K: Regulation of plasma cell development Nat R ev Immun ol 2005, 5 (3):230 242. 84. Brewer JW, Hendershot LM: Building an antibody factory: a job for the unfolded protein response Nat I mmunol 2005, 6 (1):23 29. 85. Hahn CL, Best AM, Tew JG: Cytokine induction by Streptococcus mutans and pulpal pathogenesis Infe ct I mmun 2000, 68 (12):67856789. 86. Petersen PE: Priorities for research for oral health in the 21st century -the approach of the WHO Global Oral Health Programme Community D ent Health 2005, 22(2):71 74.

PAGE 173

173 87. Petersen PE, Yamamoto T: Improving the oral health of older people: the approach of the WHO Global Oral Health Programme Community D ent O ral E pidemiol 2005, 33 (2):81 92. 88. Malicka M, Zielinski R, Piotrowska V, Andrzejewski J, Zakrzewska A: Can dental problems have influence on difficulties in trea ting paranasal sinusitis in children?. Przeglad lekarski 2011, 68 (1):68 72. 89. Zeledon JI, McKelvey RL, Servilla KS, Hofinger D, Konstantinov KN, Kellie S, Sun Y, Massie LW, Hartshorne MF, Tzamaloukas AH: Glomerulonephritis causing acute renal failure dur ing the course of bacterial infections. Histological varieties, potential pathogenetic pathways and treatment Int Urol Nephrol 2008, 40 (2):461470. 90. Ullman RF, Strampfer MJ, Cunha BA: Streptococcus mutans vertebral osteomyelitis Heart L ung 1988, 17(3):319 321. 91. Rajpal RS, Leibsohn JA, Liekweg WG, Gross CM, Olinger GN, Rose HD, Bamrah VS: Infected left atrial myxoma with bacteremia simulating infective endocarditis Arch I ntern M ed 1979, 139(10):11761178. 92. Sattler FR, Ruskin J: Empyema due to Str eptococcus mutans. Chest 1977, 71(2):229 231. 93. Durand R, Gunselman EL, Hodges JS, Diangelis AJ, Michalowicz BS: A pilot study of the association between cariogenic oral bacteria and preterm birth Oral D is 2009, 15 (6):400 406. 94. Romero R, Schaudinn C, Kusanovic JP, Gorur A, Gotsch F, Webster P, Nhan Chang CL, Erez O, Kim CJ, Espinoza J et al : Detection of a microbial biofilm in intraamniotic infection. Am J O bstet G ynecol 2008, 198 (1):135 e131135. 95. Rabe LK, Winterscheid KK, Hillier SL: Association of viridans group streptococci from pregnant women with bacterial vaginosis and upper genital tract infection J Clin Microbiol 1988, 26(6):11561160. 96. Reeder JC, Westwell AJ, Hutchinson DN: Indifferent streptococci in normal and purulent eyes of neonat es. J C lin P athol 1985, 38(8):942 945. 97. Parker MT, Ball LC: Streptococci and aerococci associated with systemic infection in man. J M ed M icrobiol 1976, 9 (3):275302. 98. Morency AM, Rallu F, Laferriere C, Bujoldg E: Eradication of intra amniotic Strepto coccus mutans in a woman with a short cervix J O bstet G ynaecol Can 2006, 28(10):898902.

PAGE 174

174 99. Ioannidis O, Kakoutis E, Katsifa H, Rafail S, Chatzopoulos S, Kotronis A, Makrantonakis N: Streptococcus mutans : a rare cause of retroperitoneal abscess. Adv M ed S ci 2011, 56(1):113 118. 100. Ferrieri P, Gewitz MH, Gerber MA, Newburger JW, Dajani AS, Shulman ST, Wilson W, Bolger AF, Bayer A, Levison ME et al : Unique features of infective endocarditis in childhood. Circulation 2002, 105 (17):21152126. 101. Dekkers P Elbers HR, Morshuis WJ, Jaarsma W: Infected left atrial myxoma. J Am Soc Echocardiogr 2001, 14 (6):644 645. 102. Vogt PR, Jenni R, Turina MI: Infected left atrial myxoma with concomitant mitral valve endocarditis. Eur J C ardiothorac S urg 1996, 10(1):71 73. 103. Nomura R, Hamada M, Nakano K, Nemoto H, Fujimoto K, Ooshima T: Repeated bacteraemia caused by Streptococcus mutans in a patient with Sjogren's syndrome J M ed M icrobiol 2007, 56 (Pt 7):988 992. 104. Siudikiene J, Machiulskiene V, Nyvad B, Tenovuo J, Nedzelskiene I: Dental caries increments and related factors in children with type 1 diabetes mellitus Caries R es 2008, 42(5):354362. 105. Li X, Kolltveit KM, Tronstad L, Olsen I: Systemic diseases caused by oral infection Clin M icrobiol R ev 2000, 13(4) :547558. 106. Forner L, Larsen T, Kilian M, Holmstrup P: Incidence of bacteremia after chewing, tooth brushing and scaling in individuals with periodontal inflammation J Clin Periodontol 2006, 33 (6):401407. 107. Kinane DF, Riggio MP, Walker KF, MacKenzi e D, Shearer B: Bacteraemia following periodontal procedures J Clin Periodontol 2005, 32 (7):708713. 108. Lofthus JE, Waki MY, Jolkovsky DL, Otomo Corgel J, Newman MG, Flemmig T, Nachnani S: Bacteremia following subgingival irrigation and scaling and root planing. J Periodontol 1991, 62(10):602607. 109. Carroll GC, Sebor RJ: Dental flossing and its relationship to transient bacteremia. J Periodontol 1980, 51 (12):691692. 110. Daly C, Mitchell D, Grossberg D, Highfield J, Stewart D: Bacteraemia caused by p eriodontal probing. Aust Dent J 1997, 42(2):77 80. 111. Rosenfeld ME, Campbell LA: Pathogens and atherosclerosis: update on the potential contribution of multiple infectious organisms to the pathogenesis of atherosclerosis. Thromb Haemost 2011, 106(5):858867. 112. Nakano K, Nomura R, Ooshima T: Streptococcus mutans and cardiovascular diseases Jpn Dent Sci Rev 2008, 44(1):29 37.

PAGE 175

175 113. Meyer DH, Fives Taylor PM: Oral pathogens: from dental plaque to cardiac disease. Curr O pin M icrobiol 1998, 1 :88 95. 114. Na kano K, Ooshima T: Serotype classification of Streptococcus mutans and its detection outside the oral cavity Future Microbiol 2009, 4 (7):891 902. 115. Linzer R, M. S. Reddy, M. J. Levine: Molecular Microbiology and Immunology of Streptococcus mutans. Ams terdam, The Netherlands: Elsevier Science Publishers; 1986. 116. Tsukioka Y, Yamashita Y, Oho T, Nakano Y, Koga T: Biological function of the dTDP rhamnose synthesis pathway in Streptococcus mutans J B acteriol 1997, 179 (4):1126 1134. 117. Tsukioka Y, Yamashita Y, Nakano Y, Oho T, Koga T: Identification of a fourth gene involved in dTDP rhamnose synthesis in Streptococcus mutans. J B acteriol 1997, 179(13):44114414. 118. Yamashita Y, Tsukioka Y, Nakano Y, Tomihisa K, Oho T, Koga T: Biological functions of U DP glucose synthesis in Streptococcus mutans Microbiology 1998, 144 ( Pt 5) :1235 1245. 119. Yamashita Y, Tsukioka Y, Tomihisa K, Nakano Y, Koga T: Genes involved in cell wall localization and side chain formation of rhamnose glucose polysaccharide in Stre ptococcus mutans J B acteriol 1998, 180(21):58035807. 120. Yamashita Y, Shibata Y, Nakano Y, Tsuda H, Kido N, Ohta M, Koga T: A novel gene required for rhamnose glucose polysaccharide synthesis in Streptococcus mutans J B acteriol 1999, 181 (20):65566559. 121. Shibata Y, Ozaki K, Seki M, Kawato T, Tanaka H, Nakano Y, Yamashita Y: Analysis of loci required for determination of serotype antigenicity in Streptococcus mutans and its clinical utilization J Clin Microbiol 2003, 41(9):41074112. 122. Benabdelmou mene S, Dumont S, Petit C, Poindron P, Wachsmann D, Klein JP: Activation of human monocytes by Streptococcus mutans serotype f polysaccharide: immunoglobulin G Fc receptor expression and tumor necrosis factor and interleukin 1 production. Infect Immun 1991 59(9):32613266. 123. Soell M, Lett E, Holveck F, Scholler M, Wachsmann D, Klein JP: Activation of human monocytes by streptococcal rhamnose glucose polymers is mediated by CD14 antigen, and mannan binding protein inhibits TNFalpha release. J Immunol 19 95, 154(2):851860.

PAGE 176

176 124. Nakano K, Nomura R, Matsumoto M, Ooshima T: Roles of oral bacteria in cardiovascular diseases--from molecular mechanisms to clinical cases: Cell surface structures of novel serotype k Streptococcus mutans strains and their correlat ion to virulence J Pharmacol Sci 2010, 113 (2):120125. 125. Nomura R, Naka S, Nakano K, Taniguchi N, Matsumoto M, Ooshima T: Detection of oral streptococci with collagen binding properties in saliva specimens from mothers and their children. Int J Paediat r Dent 2010, 20(4):254 260. 126. Abranches J, Miller JH, Martinez AR, SimpsonHaidaris PJ, Burne RA, Lemos JA: The c ollagen b inding p rotein Cnm is r equired for Streptococcus mutans adherence to and i ntracellular i nvasion of human c oronary a rtery e ndothelia l c ells Infect Immun 2011, 79 (6):22772284. 127. Abranches J, Zeng L, Belanger M, Rodrigues PH, SimpsonHaidaris PJ, Akin D, Dunn WA, Jr., ProgulskeFox A, Burne RA: Invasion of human coronary artery endothelial cells by Streptococcus mutans OMZ175. Oral Microbiol Immunol 2009, 24 (2):141 145. 128. Guha S, Padh H: Cathepsins: fundamental effectors of endolysosomal proteolysis Indi an J B iochem B iophys 2008, 45(2):75 90. 129. Maxfield FR, Yamashiro DJ: Endosome acidification and the pathways of receptor medi ated endocytosis Adv E xp M ed B iol 1987, 225 :189 198. 130. Huotari J, Helenius A: Endosome maturation. EMBO J 2011, 30(17):34813500. 131. Matsui R, Cvitkovitch D: Acid tolerance mechanisms utilized by Streptococcus mutans Future M icrobiol 2010, 5 (3):403417. 132. Diment S, Stahl P: Macrophage endosomes contain proteases which degrade endocytosed protein ligands J Biol Chem 1985, 260 (28):1531115317. 133. Drangsholt MT: A new causal model of dental diseases associated with endocarditis Ann Periodontol 19 98, 3 (1):184 196. 134. Giglio JA, Rowland RW, Dalton HP, Laskin DM: Suture removal induced bacteremia: a possible endocarditis risk. J Am Dent Assoc 1992, 123(8):65 66, 6970. 135. Herzberg MC: Platelet streptococcal interactions in endocarditis. Crit Rev Oral Biol Med 1996, 7 (3):222236.

PAGE 177

177 136. Plummer C, Wu H, Kerrigan SW, Meade G, Cox D, Ian Douglas CW: A serinerich glycoprotein of Streptococcus sanguis mediates adhesion to platelets via GPIb Br J H aematol 2005, 129(1):101109. 137. Nakano K, Tsuji M, Nishimura K, Nomura R, Ooshima T: Contribution of cell surface protein antigen PAc of Streptococcus mutans to bacteremia. Microbes I nfect 2006, 8 (1):114 121. 138. Nakano K, Nomura R, Nemoto H, Lapirattanakul J, Taniguchi N, Gronroos L, Alaluusua S, Ooshima T : Protein antigen in serotype k Streptococcus mutans clinical isolates. J Dent Res 2008, 87 (10):964968. 139. Hahn CL, Schenkein HA, Tew JG: Endocarditis associated oral streptococci promote rapid differentiation of monocytes into mature dendritic cells I nfect Immun 2005, 73 (8):50155021. 140. Engels Deutsch M, Rizk S, Haikel Y: Streptococcus mutans antigen I/II binds to alpha5beta1 integrins via its A domain and increases beta1 integrins expression on periodontal ligament fibroblast cells Arch O ral B iol 2011, 56(1):22 28. 141. Qian H, Dao ML: Inactivation of the Streptococcus mutans wall associated protein A gene (wapA) results in a decrease in sucrosedependent adherence and aggregation. Infect Immun 1993, 61(12):50215028. 142. Love RM, McMillan MD, Jenkinson HF: Invasion of dentinal tubules by oral streptococci is associated with collagen recognition mediated by the antigen I/II family of polypeptides Infect Immun 1997, 65(12):5157 5164. 143. Nomura R, Nakano K, Taniguchi N, Lapirattanakul J, Nemoto H, Gronroos L, Alaluusua S, Ooshima T: Molecular and clinical analyses of the gene encoding the collagenbinding adhesin of Streptococcus mutans J M ed M icrobiol 2009, 58 (Pt 4):469475. 144. Engels Deutsch M, Pini A, Yamashita Y, Shibata Y, Haikel Y, Scholler Guinard M, Klein JP: Insertional inactivation of pac and rmlB genes reduces the release of tumor necrosis factor alpha, interleukin 6, and interleukin 8 induced by Streptococcus mutans in monocytic, dental pulp, and periodontal ligament cells Infect Imm un 2003, 71(9):51695177. 145. MatsumotoNakano M, Tsuji M, Inagaki S, Fujita K, Nagayama K, Nomura R, Ooshima T: Contribution of cell surface protein antigen c of Streptococcus mutans to platelet aggregation Oral Microbiol Immunol 2009, 24(5):427430. 146. Taniguchi N, Nakano K, Nomura R, Naka S, Kojima A, Matsumoto M, Ooshima T: Defect of glucosyltransferases reduces platelet aggregation activity of Streptococcus mutans : analysis of clinical strains isolated from oral cavities. Arch O ral B iol 2010, 55 (6):410 416.

PAGE 178

178 147. Chen Y Y, Peng B, Yang Q, Glew MD, Veith PD, Cross KJ, Goldie KN, Chen D, O'Brien Simpson N, Dashper SG et al : The outer membrane protein LptO is essential for the O deacylation of LPS and the coordinated secretion and attachment of A LPS a nd CTD proteins in Porphyromonas gingivalis Mol Microbiol 2011, 79 (5):13801401. 148. Hill EE, Herijgers P, Herregods MC, Peetermans WE: Evolving trends in infective endocarditis. Clin Microbiol Infect 2006, 12 (1):5 12. 149. Roger VL, Go AS, LloydJones D M, Benjamin EJ, Berry JD, Borden WB, Bravata DM, Dai S, Ford ES, Fox CS et al : Heart d isease and s troke statistics2012 u pdate : A report f rom the American Heart Association Circulation 2012, 125(1):E2 E220. 150. Nakano K, Hokamura K, Taniguchi N, Wada K, Kudo C, Nomura R, Kojima A, Naka S, Muranaka Y, Thura M et al : The collagenbinding protein of Streptococcus mutans is involved in haemorrhagic stroke Nat C ommun 2011, 2 :485. 151. Offermanns S: Activation of platelet function through G proteincoupled rec eptors Circ Res 2006, 99(12):12931304. 152. Nakano K, Nemoto H, Nomura R, Inaba H, Yoshioka H, Taniguchi K, Amano A, Ooshima T: Detection of oral bacteria in cardiovascular specimens. Oral Microbiol Immunol 2009, 24 (1):64 68. 153. Nakano K, Inaba H, Nomura R, Nemoto H, Takeda M, Yoshioka H, Matsue H, Takahashi T, Taniguchi K, Amano A et al : Detection of cariogenic Streptococcus mutans in extirpated heart valve and atheromatous plaque specimens. J Clin Microbiol 2006, 44(9):33133317. 154. Nakano K, Nemoto H, Nomura R, Homma H, Yoshioka H, Shudo Y, Hata H, Toda K, Taniguchi K, Amano A et al : Serotype distribution of Streptococcus mutans a pathogen of dental caries in cardiovascular specimens from Japanese patients. J M ed M icrobiol 2007, 56 (Pt 4):551 556. 155. Roger VL, Go AS, LloydJones DM, Benjamin EJ, Berry JD, Borden WB, Bravata DM, Dai S, Ford ES, Fox CS et al : Heart disease and stroke statistics2012 update: A report f rom the American Heart Association Circulation 2012, 125(22):E1002E1002. 156. Endem ann DH, Schiffrin EL: Endothelial dysfunction. J Am Soc Nephrol 2004, 15(8):19831992. 157. Taddei S, Virdis A, Mattei P, Ghiadoni L, Sudano I, Salvetti A: Defective L arginine nitric oxide pathway in offspring of essential hypertensive patients Circulation 1996, 94(6):12981303.

PAGE 179

179 158. Celermajer DS, Sorensen KE, Gooch VM, Spiegelhalter DJ, Miller OI, Sullivan ID, Lloyd JK, Deanfield JE: Non invasive detection of endothelial dysfunction in children and adults at risk of atherosclerosis Lancet 1992, 340(882 8):11111115. 159. Singh KV, Nallapareddy SR, Sillanpaa J, Murray BE: Importance of the collagen adhesin ace in pathogenesis and protection against Enterococcus faecalis experimental endocarditis. PLoS Pathog 2010, 6 (1):e1000716. 160. Gibson FC, 3rd, Ukai T, Genco CA: Engagement of specific innate immune signaling pathways during Porphyromonas gingivalis induced chronic inflammation and atherosclerosis. Front Biosci 2008, 13:20412059. 161. Gibson FC, 3rd, Yumoto H, Takahashi Y, Chou HH, Genco CA: Innate im mune signaling and Porphyromonas gingivalis accelerated atherosclerosis. J Dent Res 2006, 85(2):106 121. 162. Madan M, Bishayi B, Hoge M, Messas E, Amar S: Doxycycline affects diet and bacteriaassociated atherosclerosis in an ApoE heterozygote murine model: cytokine profiling implications Atherosclerosis 2007, 190(1):62 72. 163. Madan M, Bishayi B, Hoge M, Amar S: Atheroprotective role of interleukin6 in diet and/or pathogenassociated atherosclerosis using an ApoE heterozygote murine model Atherosclerosis 2008, 197(2):504514. 164. Madan M, Amar S: Toll like receptor 2 mediates diet and/or pathogen associated atherosclerosis: proteomic findings. PLoS One 2008, 3 (9):e3204. 165. Piroth L, Que YA, Widmer E, Panchaud A, Piu S, Entenza JM, Moreillon P: The fibrinogenand fibronectinbinding domains of Staphylococcus aureus fibronectinbinding protein A synergistically promote endothelial invasion and experimental endocarditis. Infect Immun 2008, 76 (8):38243831. 166. Rohde M, Muller E, Chhatwal GS, Talay S R: Host cell caveolae act as an entry port for group A streptococci Cell Microbiol 2003, 5 (5):323 342. 167. Amelung S, Nerlich A, Rohde M, Spellerberg B, Cole JN, Nizet V, Chhatwal GS, Talay SR: The FbaB type fibronectinbinding protein of Streptococcus p yogenes promotes specific invasion into endothelial cells Cell Microbiol 2011. 168. Rohde M, Graham RM, Branitzki Heinemann K, Borchers P, Preuss C, Schleicher I, Zahner D, Talay SR, Fulde M, Dinkla K et al : Differences in the aromatic domain of homologous streptococcal fibronectin binding proteins trigger different cell invasion mechanisms and survival rates. Cell Microbiol 2011, 13 (3):450 468.

PAGE 180

180 169. Jenkinson HF, Lamont RJ: Oral microbial communities in sickness and in health Trends M icrobiol 2005, 13(12 ):589 595. 170. Tamilselvam B, Almeida RA, Dunlap JR, Oliver SP: Streptococcus uberis internalizes and persists in bovine mammary epithelial cells. Microb Pathog 2006, 40 (6):279 285. 171. Courtney HS, Hasty DL, Dale JB: Molecular mechanisms of adhesion, co lonization, and invasion of group A streptococci Ann Med 2002, 34(2):77 87. 172. Nitsche Schmitz DP, Rohde M, Chhatwal GS: Invasion mechanisms of Gram positive pathogenic cocci Thromb Haemost 2007, 98(3):488496. 173. Burnham CA, Shokoples SE, Tyrrell GJ : Inv asion of HeLa cells by group B S treptococcus requires the phosphoinositide 3 kinase signalling pathway and modulates phosphorylation of host cell Akt and glycogen synthase kinase3 Microbiology 2007, 153(Pt 12):4240 4252. 174. Ring A, Tuomanen E: Hos t cell invasion by Streptococcus pneumoniae Subcell Biochem 2000, 33:125135. 175. Benga L, Goethe R, Rohde M, ValentinWeigand P: Non encapsulated strains reveal novel insights in invasion and survival of Streptococcus suis in epithelial cells Cell Micr obiol 2004, 6 (9):867 881. 176. Nobbs AH, Shearer BH, Drobni M, Jepson MA, Jenkinson HF: Adherence and internalization of Streptococcus gordonii by epithelial cells involves beta1 integrin recognition by SspA and SspB (antigen I/II family) polypeptides Cell Microbiol 2007, 9 (1):6583. 177. Stinson MW, Alder S, Kumar S: Invasion and killing of human endothelial cells by viridans group streptococci Infect Immun 2003, 71 (5):23652372. 178. Stinson MW, Barua PK, Bergey EJ, Nisengard RJ, Neiders ME, Albini B: B inding of Streptococcus mutans antigens to heart and kidney basement membranes Infect Immun 1984, 46(1):145 151. 179. Tortora G. J. DBH: Principles of Anatomy and Physiology 7 edn. New York, NY: HarperCollins; 1993. 180. Rostand KS, Esko JD: Microbial ad herence to and invasion through proteoglycans Infect Immun 1997, 65(1):1 8. 181. Reitsma S, Slaaf DW, Vink H, van Zandvoort MA, oude Egbrink MG: The endothelial glycocalyx: composition, functions, and visualization. Eur J P hysiol 2007, 454 (3):345 359.

PAGE 181

181 182. Law DA, Nannizzi Alaimo L, Phillips DR: Outside in integrin signal transduction. Alpha IIb beta 3 (GP IIb IIIa) tyrosine phosphorylation induced by platelet aggregation J Biol Chem 1996, 271(18):1081110815. 183. Scibelli A, Roperto S, Manna L, Pavone LM, Tafuri S, Della Morte R, Staiano N: Engagement of integrins as a cellular route of invasion by bacterial pathogens Vet J 2007, 173 (3):482 491. 184. Conforti G, Dominguez Jimenez C, Zanetti A, Gimbrone MA, Jr., Cremona O, Marchisio PC, Dejana E: Human e ndothelial cells express integrin receptors on the luminal aspect of their membrane Blood 1992, 80 (2):437 446. 185. Yang JJ, Chen YM, Kurokawa T, Gong JP, Onodera S, Yasuda K: Gene expression, glycocalyx assay, and surface properties of human endothelial cells cultured on hydrogel matrix with sulfonic moiety: Effect of elasticity of hydrogel J B iomed M ater R es 2010, 95 (2):531 542. 186. Petersen FC, Assev S, van der Mei HC, Busscher HJ, Scheie AA: Functional variation of the antigen I/II surface protein in Streptococcus mutans and Streptococcus intermedius Infect Immun 2002, 70 (1):249 256. 187. Ridker PM: On evolutionary biology, inflammation, infection, and the causes of atherosclerosis. Circulation 2002, 105(1):2 4. 188. Bartruff JB, Yukna RA, Layman DL: Outer membrane vesicles from Porphyromonas gingivalis affect the growth and function of cultured human gingival fibroblasts and umbilical vein endothelial cells J Periodontol 2005, 76 (6):972979. 189. Al Okla S, Chatenay Rivauday C, Klein JP, Wachsmann D : Involvement of alpha5beta1 integrins in interleukin 8 production induced by oral viridans streptococcal protein I/IIf in cultured endothelial cells Cell Microbiol 1999, 1 (2):157 168. 190. Nomura R, Naka S, Nemoto H, Inagaki S, Taniguchi K, Ooshima T, Nakano K: Potential involvement of collagenbinding proteins of Streptococcus mutans in infective endocarditis Oral D is 2013, 19 (4):387 393. 191. Almeida RA, Oliver SP: Trafficking of Streptococcus uberis in bovine mammary epithelial cells Microb Pathog 2006, 41(2 3):80 89. 192. Almeida RA, Dunlap JR, Oliver SP: Binding of Host Factors Influences Internalization and Intracellular Trafficking of Streptococcus uberis in Bovine Mammary Epithelial Cells Vet Med Int 2010, 2010 :319192. 193. Nakagawa I, Amano A, Mizushima N, Yamamoto A, Yamaguchi H, Kamimoto T, Nara A, Funao J, Nakata M, Tsuda K et al : Autophagy defends cells against invading group A Streptococcus Science 2004, 306 (5698):10371040.

PAGE 182

182 194. Huang YT, Teng LJ, Ho SW, Hsueh PR: Streptococcus suis infec tion J M icrobiol I mmunol I nfect 2005, 38 (5):306 313. 195. Gottschalk M, Segura M, Xu J: Streptococcus suis infections in humans: the Chinese experience and the situation in North America. Anim Health R es R ev 2007, 8 (1):29 45. 196. Fisher K, Phillips C: Th e ecology, epidemiology and virulence of Enterococcus. Microbiology 2009, 155 (Pt 6):17491757. 197. Koch S, Hufnagel M, Theilacker C, Huebner J: Enterococcal infections: host response, therapeutic, and prophylactic possibilities. Vaccine 2004, 22(7):822 83 0. 198. Nallapareddy SR, Singh KV, Duh RW, Weinstock GM, Murray BE: Diversity of ace, a gene encoding a microbial surface component recognizing adhesive matrix molecules, from different strains of Enterococcus faecalis and evidence for production of ace during human infections Infect Immun 2000, 68(9):52105217. 199. Ryding U, Flock JI, Flock M, Soderquist B, Christensson B: Expression of collagen binding protein and types 5 and 8 capsular polysaccharide in clinical isolates of Staphylococcus aureus J Inf ect Dis 1997, 176(4):10961099. 200. Hienz SA, Schennings T, Heimdahl A, Flock JI: Collagen binding of Staphylococcus aureus is a virulence factor in experimental endocarditis. J Infect Dis 1996, 174 (1):83 88. 201. Heart Disease and Stroke Prevention: Add ressing the Nation's Leading Killers: At A Glance 2011 [ http://www.cdc.gov/chronicdisease/resources/ publications/aag/dhdsp.htm ] 202. Centers for Disease C ontrol and Pr evention: Million hearts: strategies to reduce the prevalence of leading cardiovascular disease risk factors-United States, 2011. MMWR 2011, 60 (36):12481251. 203. Eke PI, Dye BA, Wei L, ThorntonEvans GO, Genco RJ, Cdc Periodontal Disease Surveillance workgroup: James Beck GDRP: Prevalence of periodontitis in adults in the United States: 2009 and 2010 J Dent Res 2012, 91(10):914920. 204. Parahitiyawa NB, Jin LJ, Leung WK, Yam WC, Samaranayake LP: Microbiology of odontogenic bacteremia: beyond endocardit is Clin M icrobiol R ev 2009, 22(1):46 64.

PAGE 183

183 205. Lockhart PB, Brennan MT, Sasser HC, Fox PC, Paster BJ, Bahrani Mougeot FK: Bacteremia associated with toothbrushing and dental extraction Circulation 2008, 117 (24):31183125. 206. Berlutti F, Catizone A, Ricc i G, Frioni A, Natalizi T, Valenti P, Polimeni A: Streptococcus mutans and Streptococcus sobrinus are able to adhere and invade human gingival fibroblast cell line Int J Immunopathol Pharmacol 2010, 23 (4):12531260. 207. Nakano K, Nomura R, Nemoto H, Mukai T, Yoshioka H, Shudo Y, Hata H, Toda K, Taniguchi K, Amano A et al : Detection of novel serotype k Streptococcus mutans in infective endocarditis patients J M ed M icrobiol 2007, 56(Pt 10):14131415. 208. Nakano K, Lapirattanakul J, Nomura R, Nemoto H, Alaluusua S, Gronroos L, Vaara M, Hamada S, Ooshima T, Nakagawa I: Streptococcus mutans clonal variation revealed by multilocus sequence typing. J Clin Microbiol 2007, 45(8):26162625. 209. Panagia M, Winston B, Click JW, Sabatine MS, Resnic FS: A rare compli cation of infective endocarditis Circulation 2012, 125(10):13161317. 210. Gdoura R, Pereyre S, Frikha L, Hammami N, Clerc M, Sahnoun Y, Bebear C, Daoud M, de Barbeyrac B, Hammami A: Culture negative endocarditis due to Chlamydia pneumoniae J Clin Microb iol 2002, 40(2):718 720. 211. Gaydos CA, Summersgill JT, Sahney NN, Ramirez JA, Quinn TC: Replication of Chlamydia pneumoniae in vitro in human macrophages, endothelial cells, and aortic artery smooth muscle cells. Infect Immun 1996, 64 (5):16141620. 212. Rosenshine I, Ruschkowski S, Finlay BB: Inhibitors of cytoskeletal function and signal transduction to study bacterial invasion. Methods E nzymol 1994, 236:467476. 213. Vosbeck K, James PR, Zimmermann W: Antibiotic a ction on p hagocytosed bacteria m easured by a new m ethod for d etermining v iable b acteria. Antimicrob Agents Ch 1984, 25 (6):735 741. 214. Tang P, Foubister V, Pucciarelli MG, Finlay BB: Methods to s tudy b acterial i nvasion. J Microbiol Meth 1993, 18 (3):227 240. 215. Wang ZY, Wang JQ, Zhou Y, Zhao D Xiao B: Quantitative detection of Streptococcus mutans and bacteria of dental caries and no caries groups in permanent teeth from a north China population. Chin M ed J 2012, 125(21):38803884.

PAGE 184

184 216. Hasegawa Y, Mans JJ, Mao S, Lopez MC, Baker HV, Handfield M, Lamont RJ: Gingival epithelial cell transcriptional responses to commensal and opportunistic oral microbial species Infect Immun 2007, 75 (5):25402547. 217. Eisen MB, Spellman PT, Brown PO, Botstein D: Cluster analysis and display of genome wide expre ssion patterns. Proc Natl Acad Sci U S A 1998, 95(25):1486314868. 218. Tonetti MS: Molecular factors associated with compartmentalization of gingival immune responses and transepithelial neutrophil migration. J Periodontal Res 1997, 32 (1 Pt 2):104109. 219. Uitto VJ: Degradation of basement membrane collagen by proteinases from human gingiva, leukocytes and bacterial plaque J Periodontol 1983, 54(12):740745. 220. Peng TK, Nisengard RJ, Levine MJ: The alteration in gingival basement membrane antigens in c hronic periodontitis J Periodontol 1986, 57(1):20 24. 221. Sugiyama E, Baehni P, Cimasoni G: An in vitro study of polymorphonuclear leucocytemediated injury to human gingival keratinocytes by periodontopathic bacterial extracts. Arch O ral B iol 1992, 37(1 2):10071012. 222. Krasse B: The proportional dist ribution of different types of s treptococci in saliva and plaque material Odontol R evy 1953, 4 (4):304 312. 223. Hamada S, Masuda N, Ooshima T, Sobue S, Kotani S: Epidemiological survey of Streptococcus mut ans among Japanese children. Identification and serological typing of the isolated strains Jpn J Microbiol 1976, 20 (1):33 44. 224. Malicka E, Sitko R, Zawisza B, Heimann J, Kajewski D, Kita A: Nondestructive analysis of single crystals of selenide spinels by X ray spectrometry techniques Anal B ioanal C hem 2011, 399(9):32853292. 225. Rudney JD, Chen R: The vital status of human buccal epithelial cells and the bacteria associated with them Arch O ral B iol 2006, 51(4):291298. 226. Rudney JD, Chen R, Zhang G: Streptococci dominate the diverse flora within buccal cells. J Dent Res 2005, 84(12):11651171. 227. Liljemark WF, Gibbons RJ: Proportional distribution and relative adherence of S treptococcus miteor ( mitis ) on various surfaces in the human oral cavity Infect Immun 1972, 6 (5):852 859. 228. Milgrom P, Riedy CA, Weinstein P, Tanner AC, Manibusan L, Bruss J: Dental caries and its relationship to bacterial infection, hypoplasia, diet, and oral hygiene in 6 to 36 monthold children. Commun D ent O ral E pidemi ol 2000, 28(4):295 306.

PAGE 185

185 229. Wan AK, Seow WK, Purdie DM, Bird PS, Walsh LJ, Tudehope DI: Oral colonization of Streptococcus mutans in six monthold predentate infants J Dent Res 2001, 80(12):20602065. 230. Tankkunnasombut S, Youcharoen K, Wisuttisak W, V ichayanrat S, Tiranathanagul S: Early colonization of mutans streptococci in 2 to 36 monthold Thai children. Pediatr D ent 2009, 31(1):47 51. 231. Reyes L, Herrera D, Kozarov E, Rolda S, ProgulskeFox A: Periodontal bacterial invasion and infection: contr ibution to atherosclerotic pathology J Periodontol 2013, 84 (4 Suppl):S3050. 232. Molinari G, Talay SR, ValentinWeigand P, Rohde M, Chhatwal GS: The fibronectinbinding protein of Streptococcus pyogenes SfbI, is involved in the internalization of group A streptococci by epithelial cells. Infect Immun 1997, 65 (4):13571363. 233. Kaur SJ, Nerlich A, Bergmann S, Rohde M, Fulde M, Zahner D, Hanski E, Zinkernagel A, Nizet V, Chhatwal GS et al : The CXC chemokine degrading protease SpyCep of Streptococcus pyoge nes promotes its uptake into endothelial cells. J Biol Chem 2010, 285 (36):2779827805. 234. Amelung S, Nerlich A, Rohde M, Spellerberg B, Cole JN, Nizet V, Chhatwal GS, Talay SR: The FbaB type fibronectinbinding protein of Streptococcus pyogenes promotes specific invasion into endothelial cells Cell Microbiol 2011, 13 (8):12001211. 235. Schmittgen TD, Livak KJ: Analyzing real time PCR data by the comparative C(T) method Nat Protoc 2008, 3 (6):11011108. 236. Vita JA: Endothelial function. Circulation 2011, 124 (25):e906912. 237. Deanfield JE, Halcox JP, Rabelink TJ: Endothelial function and dysfunction: testing and clinical relevance. Circulation 2007, 115 (10):12851295. 238. Lerman A, Zeiher AM: Endothelial function: C ardiac events. Circulation 2005, 111( 3):363368. 239. Ross R: Atherosclerosisan inflammatory disease. New Engl J M ed 1999, 340(2):115126. 240. Glass CK, Witztum JL: Atherosclerosis. T he road ahead. Cell 2001, 104(4):503516. 241. Barlic J, Murphy PM: Chemokine regulation of atherosclerosis J Leukoc Biol 2007, 82 (2):226 236.

PAGE 186

186 242. Kraaijeveld AO, de Jager SC, van Berkel TJ, Biessen EA, Jukema JW: Chemokines and atherosclerotic plaque progression: towards therapeutic targeting? Curr Pharm Des 2007, 13(10):10391052. 243. Tedgui A, Mallat Z: Cy tokines in atherosclerosis: pathogenic and regulatory pathways. Physiol R ev 2006, 86(2):515 581. 244. Braunersreuther V, Mach F: Leukocyte recruitment in atherosclerosis: potential targets for therapeutic approaches? Cell Mol Life Sci 2006, 63(18):2079208 8. 245. Rao RM, Yang L, GarciaCardena G, Luscinskas FW: Endothelial dependent mechanisms of leukocyte recruitment to the vascular wall Circ Res 2007, 101(3):234247. 246. Blankenberg S, Barbaux S, Tiret L: Adhesion molecules and atherosclerosis Atherosc lerosis 2003, 170(2):191203. 247. Hansson GK, Libby P: The immune response in atherosclerosis: A double edged sword. Nat R ev Immunol 2006, 6 (7):508519. 248. Abiko Y: Passive immunization against dental caries and periodontal disease: D evelopment of recom binant and human monoclonal antibodies Crit Rev Oral Biol Med 2000, 11 (2):140 158. 249. Hoge M, Amar S: Role of interleukin1 in bacterial atherogenesis Drugs Today 2006, 42(10):683688. 250. Keller TT, Mairuhu AT, de Kruif MD, Klein SK, Gerdes VE, ten C ate H, Brandjes DP, Levi M, van Gorp EC: Infections and endothelial cells Cardiovasc Res 2003, 60 (1):40 48. 251. Parent C, Eichacker PQ: Neutrophil and endothelial cell interactions in sepsis. The role of adhesion molecules. Infect Dis Clin North Am 1999, 13(2):427 447, x. 252. Vallet B, Wiel E: Endothelial cell dysfunction and coagulation. Crit Care Med 2001, 29 (7 Suppl):S36 41. 253. Vernier A, Diab M, Soell M, HaanArchipoff G, Beretz A, Wachsmann D, Klein JP: Cytokine production by human epithelial and endothelial cells following exposure to oral viridans streptococci involves lectin interactions between bacteria and cell surface receptors. Infect Immun 1996, 64(8):3016 3022. 254. Vernier Georgenthum A, al Okla S, Gourieux B, Klein JP, Wachsmann D: Prote in I/II of oral viridans streptococci increases expression of adhesion molecules on endothelial cells and promotes transendothelial migration of neutrophils in vitro. Cell I mmunol 1998, 187 (2):145 150.

PAGE 187

187 255. Hajishengallis G, Sharma A, Russell MW, Genco RJ: Interactions of oral pathogens with toll like receptors: possible role in atherosclerosis. Ann Periodontol 2002, 7 (1):72 78. 256. Soell M, Diab M, Haan Archipoff G, Beretz A, Herbelin C, Poutrel B, Klein JP: Capsular polysaccharide types 5 and 8 of Staphy lococcus aureus bind specifically to human epithelial (KB) cells, endothelial cells, and monocytes and induce release of cytokines Infect Immun 1995, 63 (4):13801386. 257. Soell M, Holveck F, Scholler M, Wachsmann RD, Klein JP: Binding of Streptococcus mutans SR protein to human monocytes: production of tumor necrosis factor, interleukin 1, and interleukin 6. Infect Immun 1994, 62(5):18051812. 258. Katsargyris A, Theocharis SE, Tsiodras S, Giaginis K, Bastounis E, Klonaris C: Enhanced TLR4 endothelial cel l immunohistochemical expression in symptomatic carotid atherosclerotic plaques. Expert O pin T her T argets 2010, 14(1):1 10. 259. Schoneveld AH, Hoefer I, Sluijter JP, Laman JD, de Kleijn DP, Pasterkamp G: Atherosc lerotic lesion development and t oll like re ceptor 2 and 4 responsiveness. Atherosclerosis 2008, 197(1):95104. 260. Edfeldt K, Swedenborg J, Hansson GK, Yan ZQ: Expression of toll like receptors in human atherosclerotic lesions: a possible pathway for plaque activation Circulation 2002, 105 (10):11 581161. 261. den Dekker WK, Cheng C, Pasterkamp G, Duckers HJ: Toll like receptor 4 in atherosclerosis and plaque destabilization Atherosclerosis 2010, 209 (2):314 320. 262. Nagata E, de Toledo A, Oho T: Invasion of human aortic endothelial cells by oral viridans group streptococci and induction of inflammatory cytokine production. Mol O ral M icrobiol 2011, 26 (1):78 88. 263. Tieu BC, Lee C, Sun H, Lejeune W, Recinos A, 3rd, Ju X, Spratt H, Guo DC, Milewicz D, Tilton RG et al : An adventitial IL 6/MCP1 amplif ication loop accelerates macrophagemediated vascular inflammation leading to aortic dissection in mice J C lin Invest 2009, 119(12):36373651. 264. Best PJ, Hasdai D, Sangiorgi G, Schwartz RS, Holmes DR, Jr., Simari RD, Lerman A: Apoptosis : Basic c oncept s and i mplications in c oronary artery d isease. Arterioscler T hromb V asc B iol 1999, 19(1):14 22. 265. Geng YJ, Libby P: Evidence for apoptosis in advanced human atheroma. Colocalization with inter leukin 1 betaconverting enzyme Am J Pathol 1995, 147(2):251266.

PAGE 188

188 266. Han DK, Haudenschild CC, Hong MK, Tinkle BT, Leon MB, Liau G: Evidence for apoptosis in human atherogenesis and in a rat vascular injury model Am J Pathol 1995, 147 (2):267 277. 267. Gao L, Abu Kwaik Y: Hijacking of apoptotic pathwaysby bacterial pathogens Microbes I nfect 2000, 2 (14):17051719. 268. Handfield M, Mans JJ, Zheng G, Lopez MC, Mao S, ProgulskeFox A, Narasimhan G, Baker HV, Lamont RJ: Distinct transcriptional profiles characterize oral epithelium microbiota interactions Cell Microb iol 2005, 7 (6):811 823. 269. Klenk M, Nakata M, Podbielski A, Skupin B, Schroten H, Kreikemeyer B: Streptococcus pyogenes serotype dependent and independent changes in infected HEp 2 epithelial cells Isme J 2007, 1 (8):678 692. 270. Nakhjiri SF, Park Y, Yilmaz O, Chung WO, Watanabe K, El Sabaeny A, Park K, Lamont RJ: Inhibition of epithelial cell apoptosis by Porphyromonas gingivalis FEMS Microbiol Lett 2001, 200(2):145149. 271. DeLeo FR: Modulation of phagocyte apoptosis by bacterial pathogens Apoptosis 2004, 9 (4):399 413. 272. Weinrauch Y, Zychlinsky A: The induction of apoptosis by bacterial pathogens Ann u R ev M icrobiol 1999, 53:155 187. 273. Pollanen MT, Salonen JI, Grenier D, Uitto VJ: Epithelial cell response to challenge of bacterial lipoteichoic acids and lipopolysaccharides in vitro. J M ed M icrobiol 2000, 49(3):245 252. 274. Wang PL, Shirasu S, Daito M, Ohura K: Streptococcus mutans lipoteichoic acid induced apoptosis in cultured dental pulp cells from human deciduous teeth. Biochem B iophys R es C ommun 2001, 281 (4):957 961. 275. RT Profiler PCR Array Data Analysis version 3.5 [ http://www.sabiosciences.com/pcrarraydataanalysis.php] 276. Vermes I, Haanen C, Steffens Nakken H, Reutelingsperger C: A novel assay f or apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic ce lls using fluorescein labelled a nnexin V J I mmunol M ethods 1995, 184 (1):39 51. 277. Schneider CA, Rasband WS, Eliceiri KW: NIH Image to ImageJ: 25 years of image analysis. Nat M ethods 2012, 9 (7):671 675. 278. ImageJ [ http://imagej.nih.gov/ij/ ]

PAGE 189

189 279. Grando Mattuella L, Westphalen Bento L, de Figueiredo JA, Nor JE, de Araujo FB, Fossati AC: Vascular endothelial growth facto r and its relationship with the dental pulp. J E ndod 2007, 33 (5):524 530. 280. Roberts Clark DJ, Smith AJ: Angiogenic growth factors in human dentine matrix Arch O ral B iol 2000, 45 (11):10131016. 281. Telles PD, Hanks CT, Machado MA, Nor JE: Lipoteichoic acid upregulates VEGF expression in macrophages and pulp cells J Dent Res 2003, 82(6):466 470. 282. Nobes CD, Lauritzen I, Mattei MG, Paris S, Hall A, Chardin P: A new member of the Rho family, Rnd1, promotes disassembly of actin filament structures and loss of cell adhesion. J C ell Biol 1998, 141(1):187197. 283. Wennerberg K, Forget MA, Ellerbroek SM, Arthur WT, Burridge K, Settleman J, Der CJ, Hansen SH: Rnd proteins function as RhoA antagonists by activating p190 RhoGAP Curr B iol 2003, 13 (13):110611 15. 284. Purushothaman SS, Wang B, Cleary PP: M1 protein triggers a phosphoinositide cascade for group A Streptococcus invasion of epithelial cells. Infect Immun 2003, 71(10):58235830. 285. Nozawa T, Aikawa C, Goda A, Maruyama F, Hamada S, Nakagawa I: The small GTPases Rab9A and Rab23 function at distinct steps in autophagy during Group A Streptococcus infection Cell Microbiol 2012, 14 (8):1149 1165. 286. de Toledo A, Nagata E, Yoshida Y, Oho T: Streptococcus oralis coaggregation receptor polysaccharides i nduce inflammatory responses in human aortic endothelial cells Mol O ral M icrobiol 2012, 27(4):295 307. 287. Jiang Y, Russell TR, Schilder H, Graves DT: Endodontic pathogens stimulate monocyte chemoattractant protein1 and interleukin 8 in mononuclear cell s J E ndod 1998, 24 (2):86 90. 288. Jiang Y, Magli L, Russo M: Bacterium dependent induction of cytokines in mononuclear cells and their pathologic consequences in vivo. Infect Immun 1999, 67 (5):21252130. 289. Jiang Y, Schilder H: An optimal host response to a bacterium may require the interaction of leukocytes and resident host cells. J E ndod 2002, 28(4):279 282. 290. Qi M, Miyakawa H, Kuramitsu HK: Porphyromonas gingivalis induces murine macrophage foam cell formation. Microb Pathog 2003, 35 (6):259 267. 2 91. Charo IF, Taubman MB: Chemokines in the pathogenesis of vascular disease. Circ Res 2004, 95 (9):858 866.

PAGE 190

190 292. Choi I, Jo G, Kim S, Jung C, Kim Y, Shin K: Stimulation of various functions in murine peritoneal macrophages by glucans produced by glucosyltr ansferases from Streptococcus mutans. Biosci Biotechnol Biochem 2005, 69 (9):16931699. 293. Chia JS, Lien HT, Hsueh PR, Chen PM, Sun A, Chen JY: Induction of cytoki nes by glucosyltransferases of S treptococcus mutans Clin Diagn Lab Immunol 2002, 9 (4):892 8 97. 294. Calvayrac O, Rodriguez Calvo R, Alonso J, Orbe J, MartinVentura JL, Guadall A, Gentile M, Juan Babot O, Egido J, Beloqui O et al : CCL20 is increased in hypercholesterolemic subjects and is upregulated by LDL in vascular smooth muscle cells: role of NF kappaB Arterioscler T hromb V asc B iol 2011, 31(11):27332741. 295. Wan W, Lim JK, Lionakis MS, Rivollier A, McDermott DH, Kelsall BL, Farber JM, Murphy PM: Genetic deletion of chemokine receptor Ccr6 decreases atherogenesis in ApoE deficient mice. Circ Res 2011, 109 (4):374 381. 296. Castillo L, Rohatgi A, Ayers CR, Owens AW, Das SR, Khera A, McGuire DK, de Lemos JA: Associations of four circulating chemokines with multiple atherosclerosis phenotypes in a large population based sample: results from the D allas H eart S tudy J I nterferon C ytokine R es 2010, 30(5):339347. 297. McPherson R, Davies RW: Inflammation and coronary artery disease: insights from genetic studies Can J C ardiol 2012, 28 (6):662 666. 298. Munoz N, Van Maele L, Marques JM, Rial A, Sirard JC, Chabalgoity JA: Mucosal administration of flagellin protects mice from Streptococcus pneumoniae lung infection. Infect Immun 2010, 78(10):42264233. 299. Massena S, Christoffersson G, Hjertstrom E, Zcharia E, Vlodavsky I, Ausmees N, Rolny C, Li JP, Phillipson M: A chemotactic gradient sequestered on endothelial heparan sulfate induces directional intraluminal crawling of neutrophils Blood 2010, 116(11):19241931. 300. Soehnlein O: Multiple roles for neutrophils in atherosclerosis Circ Res 2012, 110(6):875888. 301. Martin Fuentes P, Civeira F, Solanas Barca M, Garcia Otin AL, Jarauta E, Cenarro A: Overexpression of the CXCL3 gene in response to oxidized low density lipoprotein is associated with the presence of tendon xanthomas in familial hyperchol esterolemia. Biochem C ell B iol 2009, 87(3):493 498. 302. Beckert S, Farrahi F, Aslam RS, Scheuenstuhl H, Konigsrainer A, Hussain MZ, Hunt TK: Lactate stimulates endothelial cell migration Wound R epair R egen 2006, 14 (3):321 324.

PAGE 191

191 303. Lamalice L, Le Boeuf F Huot J: Endothelial cell migration during angiogenesis Circ Res 2007, 100 (6):782 794. 304. Hunt TK, Aslam RS, Beckert S, Wagner S, Ghani QP, Hussain MZ, Roy S, Sen CK: Aerobically derived lactate stimulates revascularization and tissue repair via redox mechanisms. Antioxid R edox S ignal 2007, 9 (8):11151124. 305. Walenta S, Wetterling M, Lehrke M, Schwickert G, Sundfor K, Rofstad EK, Mueller Klieser W: High lactate levels predict likelihood of metastases, tumor recurrence, and restricted patient survival in human cervical cancers. Cancer R es 2000, 60 (4):916 921. 306. Bonuccelli G, Tsirigos A, Whitaker Menezes D, Pavlides S, Pestell RG, Chiavarina B, Frank PG, Flomenberg N, Howell A, Martinez Outschoorn UE et al : Ketones and lactate "fuel" tumor growth and metastasis: Evidence that epithelial cancer cells use oxidative mitochondrial metabolism Cell Cycle 2010, 9 (17):35063514. 307. Zeisel MB, Druet VA, Sibilia J, Klein JP, Quesniaux V, Wachsmann D: Cross talk between MyD88 and focal adhesion kinase pathways. J I mmunol 2005, 174(11):73937397. 308. Attar MA, Bailie MB, Christensen PJ, Brock TG, Wilcoxen SE, Paine R, 3rd: Induction of ICAM 1 expression on alveolar epithelial cells during lung development in rats and humans Exp Lung Res 1999, 25 (3):245 259. 309. Huang GT, Eckmann L, Savidge TC, Kagnoff MF: Infection of human intestinal epithelial cells with invasive bacteria upregulates apical intercellular adhesion molecule 1 (ICAM)1) expression and neutrophil adhesion. J Clin Invest 1996, 98(2):572 583. 310. Consortium TU: Reorganizing the protein space at the Universal Protein Resource (UniProt) Nucleic Acids Res 2012, 40 (D1):D71 D75. 311. McEver RP: Selectins: lectins that initiate cell adhesion under flow Curr Opin Cell Biol 2002, 14 (5):581586. 312. Mil lan MT, Geczy C, Stuhlmeier KM, Goodman DJ, Ferran C, Bach FH: Human monocytes activate porcine endothelial cells, resulting in increased E selectin, interleukin 8, monocyte chemotactic protein1, and plasminogen activator inhibitor type 1 expression Tran splantation 1997, 63(3):421429. 313. Metcalf DJ, Nightingale TD, Zenner HL, Lui Roberts WW, Cutler DF: Formation and function of Weibel Palade bodies J C ell S ci 2008, 121 (Pt 1):19 27. 314. Chen L, Wang S, Zhou Y, Wu X, Entin I, Epstein J, Yaccoby S, Xiong W, Barlogie B, Shaughnessy JD, Jr. et al : Identification of early growth response

PAGE 192

192 protein 1 (EGR 1) as a novel target for JUN induced apoptosis in multiple myeloma Blood 2010, 115(1):61 70. 315. Resto Ruiz SI, Schmiederer M, Sweger D, Newton C, Klein TW Friedman H, Anderson BE: Induction of a potential paracrine angiogenic loop between human THP 1 macrophages and human microvascular endothelial cells during Bartonella henselae infection Infect Immun 2002, 70 (8):45644570. 316. Carratelli CR, Paolillo R, Rizzo A: Chlamydia pneumoniae stimulates the proliferation of HUVEC through the induction of VEGF by THP 1 Int Immunopharmacol 2007, 7 (3):287294. 317. The GeneCards Human Gene Database [ http://www.genecards.org/ ] 318. UniProt Knowledgebase [ http://www.uniprot.org/ ] 319. Edwardsson S, Mejare B: Streptococcus milleri (Guthof) and Streptococcus mutans in the mouths of infants before and after tooth eruption. Arch Oral Biol 1978, 23(9):811814. 320. Nakano K, Nomura R, Nemoto H, al. e: Detection of novel serotype k Streptococcus mutans in infective endocarditis patients J M ed M icrobiol 2007(56):14131415. 321. Zhang T, KuritaOchiai T, Hashizume T, Du Y, Oguchi S, Yamamoto M : Aggregatibacter actinomycetemcomitans accelerates atherosclerosis with an increase in atherogenic factors in spontaneously hyperlipidemic mice FEMS Immunol Med Microbiol 2010, 59(2):143 151. 322. Seki E, De Minicis S, Osterreicher CH, Kluwe J, Osawa Y, Brenner DA, Schwabe RF: TLR4 enhances TGFbeta signaling and hepatic fibrosis Nat M ed 2007, 13(11):13241332. 323. Linton MF, Babaev VR, Gleaves LA, Fazio S: A direct role for the macrophage low density lipoprotein receptor in atherosclerotic lesion forma tion J Biol Chem 1999, 274 (27):1920419210. 324. Chen Y, Ruan XZ, Li Q, Huang A, Moorhead JF, Powis SH, Varghese Z: Inflammatory cytokines disrupt LDLreceptor feedback regulation and cause statin resistance: a comparative study in human hepatic cells and mesangial cells. Am J P hysiol Renal 2007, 293 (3):F680 687. 325. Greaves DR, Gordon S: The macrophage scavenger receptor at 30 years of age: current knowledge and future challenges. J Lipid R es 2009, 50 Suppl :S282 286. 326. Vanhoutte PM: Endothelial dysfunction and atherosclerosis. Eur Heart J 1997, 18 Suppl E :E19 29.

PAGE 193

193 327. Libby P: Changing concepts of atherogenesis J I ntern M ed 2000, 247(3):349358. 328. Go AS, Mozaffarian D, Roger VL Benjamin EJ, Berry JD Borden WB Bravata DM Dai S Ford ES, Fox CS Franco S Fullerton HJ Gillespie C ; et al. Heart disease and stroke statistics2013 update: A report from the American Heart Association Circulation 2013, 127(1):E 6 E 245 329. Casadevall A: Evolution of intracellular pathogens Annu R ev M icrobiol 2008, 6 2 :19 33. 330. Wittrup A, Zhang SH, Svensson KJ, Kucharzewska P, Johansson MC, Morgelin M, Belting M: Magnetic nanoparticle based isolation of endocytic vesicles reveals a role of the heat shock protein GRP75 in macromolecular delivery Proc Natl Acad Sci U S A 2010, 107 (30):13342 13347. 331. Wittrup A, Zhang SH, ten Dam GB, van Kuppevelt TH, Bengtson P, Johansson M, Welch J, Morgelin M, Belting M: ScFv antibody induced translocation of cell surface heparan sulfate proteoglycan to endocytic vesicles: evidence for heparan sulfate epitope specificity and role of both syndecan and glypican. J Biol Chem 2009, 284(47):32959 32967.

PAGE 194

194 BIOGRAPHICAL SKETCH Edith M. Sampson is a United States Army Signal Corps veteran with training in communi cations and information systems. After her military service, Edith graduated with an A ssociate of Arts (A. A.) d egree summa cum laude from Daytona Beach Commu nity College 1996. After receiving an A. A. degree, she transferred to the University of Florida and completed a Bachelor of Science degree through the Microbiology and Cell Science (MCS) Department graduating cum laude I n 2004, Edith received a M. S. degree in MCS in the College of Agriculture at UF under the mentorship of Thomas Bobik. Her graduate project was to complete a genetic characterization of the twenty one genes of the propanediol utilization ( pdu) operon in Salmonella enterica. To complete this assignment, she was trained in bacterial genetics, molecular biology, chromatography, and transmission electron microscopy. While working on this project, discoveries were made that led to a better understanding of Salmonella microcompartment protein composition and function and cobalamin (vitamin B12) reduction and activation during 1,2 propanediol metabolism. After leavi ng the microbiology department, Edith accepted a senior biological scientist position to pursue medical science research with Dr. Gregory Schultz, director and professor of the Wound Institute in the Department of Obstetrics and Gynecology at UF. While in this lab, she was cross trained in a variety of methodologies including eukaryotic cell culture (integument and eye tissues), monoclonal antibody production, gene therapies (antisense oligos, siRNA and ribozymes), enzyme linked immunosorbant assays, collag enase assays, zymography, eukaryotic molecular biology, microarray technology, and immunohistochemistry (IHC) The duties of this position required experimental support of many collaborative projects including NEI and

PAGE 195

195 industry funded research. When the opp ortunity came, she accepted a position as research manager in 2006 with Patrick Antonelli, Professor and Chairman of the Department of Otolaryngology (ENT). As research manager for ENT, Edith was responsible for designing and directing hypothesis driven r esearch while ensuring timely completion of experimental objectives to accomplish overall project goals. As a researcher, she developed methods for growing and assessing staphylococcal, pseudomonal, and streptococcal biofilms on medical devices such as tym panosotomy tubes, cochlear implants, and other materials. As a part of this objective, she was trained to process samples and operate the scanning electron microscope. She also received electrocochleography training to determine the effects of various medi cal treatments on hearing using animal models This position both broadened her skills and experience in medical research and cemented her desire to conduct independent research. In 2009, Edith was accepted into the Interdisciplinary Program in Medical Sciences in the Immunology and Microbiology Concentration. U nder the mentorship of Dr. Ann ProgulskeFox in the College of Dentistrys Department of Oral Biology, Edith completed her dissertation work presented in this document.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EENSN47T3_JCQC0E INGEST_TIME 2014-10-03T21:58:24Z PACKAGE UFE0046195_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES