Citation
Molecular Regulations and Functional Properties of MYB NFIB in Human Adenoid Cystic Cancer

Material Information

Title:
Molecular Regulations and Functional Properties of MYB NFIB in Human Adenoid Cystic Cancer
Creator:
Gao, Ruli
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (130 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Genetics and Genomics
Committee Chair:
KAYE,FREDERIC JOSEPH
Committee Co-Chair:
BUNGERT,JORG
Committee Members:
LU,JIAN RONG
RENNE,ROLF FRIEDRICH
ZAJAC-KAYE,MARIA
Graduation Date:
5/3/2014

Subjects

Subjects / Keywords:
Cancer ( jstor )
Exons ( jstor )
Gene therapy ( jstor )
MicroRNAs ( jstor )
Oncogenes ( jstor )
Proteins ( jstor )
Receptors ( jstor )
RNA ( jstor )
Salivary glands ( jstor )
Tumors ( jstor )
Genetics and Genomics -- Dissertations, Academic -- UF
adenoid-cystic-cancer -- extracellular -- hapln1 -- microarray -- myb-nfib -- vcan
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Genetics and Genomics thesis, Ph.D.

Notes

Abstract:
Salivary gland tumors (SGT) comprise a heterogeneous group of tumors. The common benign subtype is pleomorphic adenoma (PA), and most common malignant tumors are mucoepidermoid carcinomas (MEC), adenoid cystic cancer (ACC), and adenocarcinoma (ADC)-not otherwise specified. Interestingly, PA, MEC, and ACC are now known to usually arise due to somatic chromosomal translocations. Our laboratory previously cloned and characterized the CRTC1-MAML2 fusion oncogene in MEC. We have now focused on studying the genetics and biology of the MYB:NFIB fusion oncogene in ACC, which is the most lethal subtype of SGT with no known systemic treatment for nonresectable disease. We focused on studying the whole transcriptome expression profile as well as the global miRNA pattern for this lethal disease to define the key molecular alterations, to discover new tumor signaling pathways and to identify novel treatment targets for ACC. Our data demonstrated that MYB was the key molecular alteration in ACC and was the top activated gene. We initially hypothesized that MYB:NFIB translocation offers a novel mechanism for oncogene activation via deletion of regulatory microRNA (miRNA) binding sites within the MYB 3-untranslated region (3-UTR). However, we did not detect any changes in the mRNA and miRNA profiles of ACC tumors that deleted or retained the MYB 3-UTR miRNA binding sites. I also discovered several cases of ACC with low to undetectable MYB expression. Analysis of these samples identified both MYB-dependent and independent gene targets that encoded related components of extracellular matrix (ECM) complex. Integration of ACC signature with exome mutational data suggests that RUNX1, a MYB binding oncogene, participates in ACC tumorigenesis to activate ECM elements including HAPLN1/VCAN. We also observed forced MYB-NFIB expression in immortalized human salivary gland cells alters cell morphology and cell adhesion in vitro. Further, we successfully generated validated human ACC tumor cell line and demonstrated that depletion of HAPLN1/VCAN, blocked tumor cell viability. In summary, we have identified an important ACC signature that is distinct from matched normal samples and from other types of SGTs. We have also discovered MYB-dependent and independent signals and identified HAPLN1/VCAN extracellular complexes as new druggable targets for human ACC. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: KAYE,FREDERIC JOSEPH.
Local:
Co-adviser: BUNGERT,JORG.
Electronic Access:
RESTRICTED TO UF STUDENTS, STAFF, FACULTY, AND ON-CAMPUS USE UNTIL 2016-05-31
Statement of Responsibility:
by Ruli Gao.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Embargo Date:
5/31/2016
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 MOLECULAR REGULATIONS AND FUNCTIONAL PROPERTIES OF MYB /NFIB IN HUMAN ADENOID CYSTIC CANCER By RULI GAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMEN TS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 201 4

PAGE 2

2 201 4 Ruli Gao

PAGE 3

3 To my parents, my husband and twin daughters!

PAGE 4

4 ACKNOWLEDGMENTS The first and foremost, I sincerely thank my advisor, Dr. Frederic Kaye, for his support on this research. His dedication, wisdom and vision always motivate m e to grow as an independent research er. Particularly his solicitude and enthusiasm for clinical patients always inspire me to reveal the myth and find the rapeutic strategies for human cancers. Thanks also to my supervisory committees, Drs Rolf Renne, Jianrong Lu, Jorg Bungert and Maria Zajac Kaye for their scientific guidance and generously sharing of their knowledge. Thanks to Dr s Rolf Renne and Henry Baker for fruitful discussion and co mments on bioinformatics study to Dr Lizi Wu for her advice and support in mice model studies. Thanks all members in the lab, in particular, Min Zhang and Andres Gordillo Villegas for their prompt reagent ordering and efficient laboratory management, to Chunxia Cao and Min Chen for their scientific suggestions and discussions. Thanks to G enetics and G enomics graduate program. I must thank Dr. Marta Wayne, our previous coordinator, for her caring and effort in embracing every student in the program. Thanks to Dr. Wilfred Vermerris for his advice and suggestions in growing to be a successful scientist. Thanks to current coordinators Drs. Connie Mulligan and Jorg Bunger t for their encouragement in exploring broader career prospective Special thanks to Ms. Hope Parmeter for all her assistance. To my family, for their love, patience and encouragement!

PAGE 5

5 TABLE OF CONTENTS P age ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 8 LIST OF FIGURES ................................ ................................ ................................ .......... 9 LIST OF ABBREVIATIONS ................................ ................................ ........................... 11 ABSTRACT ................................ ................................ ................................ ................... 12 CHAPTER 1 RESEARCH BACKGROUND ................................ ................................ ................. 14 Genetic Basis of Human Cancer ................................ ................................ ............. 14 Loss of Function of Tumor Suppressors Familial and Mos t Common .............. 14 Gain of Function Cancer Genes ................................ ................................ ....... 16 Chromosomal Translocation in Cancers ................................ ................................ 17 Modern Understanding of Chromosomal Translocations ................................ 17 Oncogene Activation by Translocation ................................ ............................. 18 Salivary Glan d Tumors ................................ ................................ ........................... 19 Chromosomal Translocation in PA ................................ ................................ ... 20 Chromosomal Translocation in MEC ................................ ................................ 22 Chromosomal Translocation in ACC ................................ ................................ 23 Micro RNA Regulations in Tumor Development ................................ ..................... 25 Micro RNA Regulation Models ................................ ................................ ......... 25 Micro RNA Activation in Tumors ................................ ................................ ....... 26 Significance, Hypothesis and Aims ................................ ................................ ......... 28 Significance ................................ ................................ ................................ ...... 28 Hypothesis ................................ ................................ ................................ ........ 29 Specific Aims ................................ ................................ ................................ .... 29 2 IDEN TIFICATION OF HAPLN1/VCAN COMPLEX AS MYB INDEPENDENT THERAPEUTIC TARGETS FOR ADENOID CYSTIC CANCER ............................. 40 Introduction ................................ ................................ ................................ ............. 40 Materials and Methods ................................ ................................ ............................ 42 RNA extraction, quality control and quantification ................................ ............ 42 Microarray preparation and data a nalysis ................................ ......................... 43 Quality Control ................................ ................................ ................................ .. 44 qRT PCR, w estern blot, and a ntibodies ................................ ........................... 45 Xenograft Tumor Gro wth ................................ ................................ .................. 45 Results of Chapter 2 ................................ ................................ ............................... 46

PAGE 6

6 A unique mRNA gene signature distinguishes ACC from other salivary gland tumors. ................................ ................................ ................................ ... 46 MYB is the top ranking biomarker that distinguishes ACC from MEC and ADC ................................ ................................ ................................ ................. 47 Exon array analysis is a sensitive tool to identify MYB C termina l rearrangement ................................ ................................ ................................ 47 Integrative analysis identifies extracellular matrix signature in ACC ................. 49 Global miRNA signature distinguishes ACC from normal salivary gland tissues ................................ ................................ ................................ .............. 49 Discussion and C onclusions ................................ ................................ ................... 50 3 MYB NFIB FUSION ONCOPROTEIN: A NOVEL APPROACH FOR MYB ACTIVATION IN HUMAN ADENOID CYSTIC CANCER ................................ ........ 66 Background ................................ ................................ ................................ ............. 66 Methods and Materials ................................ ................................ ............................ 69 Plasmid Construction ................................ ................................ ....................... 69 Cell Culture, Transfection, Virus Preparation and Stable Clone Selection ....... 70 Western blot Analysis and Immunostaining Procedures ................................ .. 70 Cycloheximide Blocking Assay ................................ ................................ ......... 71 Soft agar Assay for Anchorage Independent Colony Formation and Foci Assay ................................ ................................ ................................ ............... 71 Self suspension Viable Cell Growth ................................ ................................ 72 Luciferase Reporter Assay ................................ ................................ ............... 72 Xenograft Tumor Growth ................................ ................................ .................. 72 Results of Chapter 3 ................................ ................................ ............................... 72 terminus increase MYB expre ssion levels ......................... 72 Deregulation of MYB hsa miR 150 participate in ACC tumorgenesis .............. 74 s by providing MYB NFIB fusion protein prolonged half life ................................ ................................ ...... 74 Forced expression of MYB NFIB changed morphology of salivary gland cells ................................ ................................ ................................ .................. 75 The MYB NFIB fusion protein acquired transforming potential ......................... 77 MYB NFIB fusion gene has similar transcriptional activity as MYB .................. 78 Discussion ................................ ................................ ................................ .............. 80 4 ACC PRIMARY CELL CULTURE AND TRANSGENIC MOUSE MODEL .............. 90 Rationale ................................ ................................ ................................ ................. 90 Methods ................................ ................................ ................................ .................. 91 Plasmid Construction ................................ ................................ ....................... 91 Transgenic Injection ................................ ................................ ......................... 92 Genotyping of Mouse Tails ................................ ................................ ............... 92 Induction of MYB NFIB Expression ................................ ................................ .. 92 Xenograft Tumor Model for Human ACC and Primary Cell Culture .................. 9 3 Results of Chapter 4 ................................ ................................ ............................... 93

PAGE 7

7 5 CONCLUSIONS ................................ ................................ ................................ ... 103 APPENDIX LIST OF SIGNIFICANTLY ALTERED GENES IN ACC COMPARING TO MATCHED NORMAL ................................ ................................ ............................ 106 LIST OF REFERENCES ................................ ................................ ............................. 115 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 130

PAGE 8

8 LIST OF TABLES Table page 1 1 Summary of human cancer census genes by COSMIC*. ................................ ... 31 1 2 List of human cancer census genes involved in translocation by COSMIC*. ...... 32 1 3 WHO classification for epithelial salivary gland tumors (as of 2005). ................. 36 1 4 MYB NFIB fusion variants found in ACC tumors. ................................ ............... 37 2 1 Sample information of 24 ACC patient tissues ................................ ................... 54 2 2 22 Significant miRNAs in human ACC. ................................ ............................... 55 4 1 Components of ACL 4 or HITES medium ................................ ........................... 97

PAGE 9

9 LIST OF FIGURES Figure page 1 1 Illustration of CRTC1 MAML2 fusion gene in MECs ................................ .......... 38 1 2 Illustration of MYB NFIB fusion transcript in ACC. ................................ .............. 39 2 1 Quality control matrix plots. ................................ ................................ ................ 56 2 2 A unique mRNA gene signature disti nguishes ACC from matched normal salivary gland tissue. ................................ ................................ .......................... 57 2 3 MYB is the top ranking biomarker that distinguishes ACC from MEC and ADC. ................................ ................................ ................................ ................... 58 2 4 Exon a rray analysis is a sensitive tool to identify MYB C terminal rearrangement. ................................ ................................ ................................ ... 59 2 5 Comparison between MYB NFIB fusion positive and fusion negative ACCs. ..... 60 2 6 Top ranking genes selected for therapeutic screening. ................................ ...... 61 2 7 Reanalysis of published gene expression arrays and integration of whole exome mutational datasets. ................................ ................................ ................ 63 2 8 Global gene signature distinguishes ACC from matched normal salivary gland tissue. ................................ ................................ ................................ ....... 63 2 9 Illustration of the HAPLN1/VCAN interaction and the roles of HAPLN1/VCAN complex in cell proliferation, signaling pathway and tumorigenesis. ................... 64 2 10 Demonstration of mol ecular regulatory networks of HAPLN1/VCAN complex in human ACC. ................................ ................................ ................................ ... 65 3 1 MYB /NFIB expression and protein property. ................................ ..................... 83 3 2 terminus. ................. 84 3 3 Forced expression of MYB NFIB changed morphology and attaching behavior of salivary gland cells. ................................ ................................ .......... 85 3 4 Soft agar anchorage independent colony formation assays for MYB /NFIB expressi ng salivary gland cells. ................................ ................................ .......... 86 3 5 Xenograft tumor growth of MYB /NFIB stably expressing salivary gland cells in SCID mice for 6 months. ................................ ................................ ................. 87 3 6 MYB /NFIB protein expression efficiency in different cell lines. ......................... 88

PAGE 10

10 3 7 MYB target gene study using microarray analysis and qRT PCR. ..................... 89 4 1 Cloning process of pCBR MYB NFIB. ................................ ................................ 98 4 2 Validation of pCBR MYB NFIB protein expression in HEK293 cells. .................. 99 4 3 Genotyping using primers of MYB exon 6 and 9. ................................ ............. 100 4 4 Primary human ACC tumor cells survived in HITES medium or F12K/DMEM medium for one to weeks without cell growth. ................................ .................. 100 4 5 Tumor colonies formed on 3T3 cell feeder with ROCK inhibitor. ...................... 101 4 6 Tumor cells cultured in ACL 4 medium with ROCK inhibitor (10x). .................. 102 4 7 Xenograft tumor gr owth of two ACC tumor cell lines. 8 million cells were mixed with 50l Matrigel and then injected into SCID mice. .......................... 102

PAGE 11

11 LIST OF ABBREVIATIONS ACC Adenoid Cystic Cancer ADC Adenocarcinama ATCC American Type Culture Collection DSB Double Strand Break DBD DNA Binding Domain ECM Extracellular Matrix MEC Mucoepidermoid Cancer NHEJ Non H omologous End Joining NRD N egative R egulatory D omain PA Pleomorphic Adenoma ROCK Inhibitor Rho associated Protein Kinase Inhibitor SGT Salivary Gland Tumor TAD T rans criptional A ctivation D omain

PAGE 12

12 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfil lment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR REGULATIONS AND FUNCTIONAL PROPERTIES OF MYB /NFIB IN HUMAN ADENOID CYSTIC CANCER By Ruli Gao May 2014 Chair: Frederic Kaye Major: Genetics and Genomics Salivary gland tumors (SGT) comprise a heterogeneous group of tumors. The common benign subtype is pleomorphic adenoma (PA), and most common malignant tumors are mucoepidermoid carcinomas (MEC), adenoid cystic cancer (ACC), and adenocarcinoma (ADC) not otherwise specified. Int erestingly, PA, MEC, and ACC are now known to usually arise due to somatic chromosomal translocations. Our laboratory previously cloned and characterized the CRTC1 MAML2 fusion oncogene in MEC We have now focused on studying the genetics and biology of th e MYB NFIB fusion oncogene in ACC, which is the most lethal subtype of SGT with no known systemic treatment for nonresectable disease We focused on studying the whole transcriptome expression profile as well as the global miRNA pattern for this lethal dis ease to define the key molecular alterations, to discover new tumor signaling pathways and to identify novel treatment targets for ACC. Our data demonstrated that MYB was the key molecular alteration in ACC and was the top activated gene We initially hypo thesized that MYB :NFIB translocation offers a novel mechanism for oncogene activation via However, we did not detect any changes in the mRNA and miRNA

PAGE 13

13 prof miRNA binding sites. I also discovered several cases of ACC with low to undetectable MYB expression. Analysis of these samples identified both MYB dependent and independent gene targets that encoded related components of extracellular matrix (ECM) complex Integration of ACC signature with exome mutational data suggests that RUNX1, a MYB binding oncogene, participates in ACC tumorigenesis to activate ECM elements including HAPLN1/VCAN. We also observ ed forced MYB NFIB expression in immortalized human salivary gland cells alters cell morphology and cell adhesion in vitro Further we successfully generated validated human ACC tumor cell line and demonstrate d that depletion of H A PLN1 /VCAN blocked tumo r cell viability. In summary, we have identified an important ACC signature that is distinct from matched normal samples and from other types of SGTs. We have also discovered MYB dependent and independent signals and identif ied HAPLN1 /VCAN extracellular c omplex es as new druggable target s for human ACC

PAGE 14

14 CHAPTER 1 RESEARCH BACKGROUND Genetic Basis of Human Cancer Cancer cells arise slowly by the sequential accumulation of many alterations in gene expression However, many of those alterations are not expec ted to play a direct the pathogenesis of cancer, it is the key to define the driver force s of cancers. Because there are so many changes in gene expression between tumor s and normal tissue; one c ould not rely exclusively on the alterations in gene expression for the identification of a specific cancer gene. Therefore, h ow do you define a cancer gene? According to COSMIC ( http://c ancer.sanger.ac.uk/ ), an online database of acquired somatic mutations found in human cancers, all cancers occur as a result of the acquisition of a series of fixed DNA sequence abnormalities or mutations, which ultimately confer a growth advantage upon t heir origin cells. Although microenvironments may promote signals that contribute to cancer progression, it is the clonal accumulation of genetic and epigenetic alterations in tumor cells that drive tumorigenesis The best definition for a cancer gene is a locus that undergoes recurrent structural abnormalit y in its DNA sequence that results in altered gene function driving tumorigenesis Cancer genes therefore can be broadly divided into gain of function mutations and loss of function mutations. Loss of F unction of Tumor Suppressors Familial and Most Common What is the driving force of cancer cells to grow and divide unlimitedly and to escape cell termination? Loss of function of tumor suppressors provides key answer s Tumor suppressor genes function as th e restraints of abnormal cell growth and cell

PAGE 15

15 divisions as well as promoters for cell death in cells at risk for tumorigenesis. L oss of function mutation are the most common event s as th is alteration can arise throughout the sequence and can be inherited i n one allele as they often do not affect embryo growth and develoment With the exception of the M ultiple Endocrine Neoplasia Type 2 (MEN2) syndrome function [ 1 ] a n autosomal dominant cancer, all familial cancer genes are loss of function The classically loss of function cancer gene is the retinoblastoma gene syndrome. Patients with f amilial retinoblastoma normally present with multiple tumor foci 3 4 per patient (so that often meant bilateral disease); and the age of onset was younger. In contrast, the s poradic retinoblast oma has only 1 foci unilateral and age of onset was later [ 2 ] s [ 3 ] Tumor suppressor genes follow the alleles. For example, in inherited retinal cancers with a germ line RB mutant allele, a second mutation in the remaining allele arises so frequently that all affected children develop tumors in early childhood [ 2 ] Since on average at least 3 foci of tumors arise these patients generally present with bilateral disease. In sporadic retinoblastoma, sequential somatic mutations occur in both alleles of RB1 gene in the same retinal cell [ 4 ] This is an exceeding rare event which explains the later age of onset and only unilateral disease. Since the identification of the RB1 gene, many other examples of tumor suppressor cancer genes have been identified. These include TP53 BRCA1/2 APC and WT1/2 Although recurrent structural DNA alterations are a defining feature for cancer genes, epigenetic regulation of tumor can also contribute to the loss of

PAGE 16

16 function of tumor suppressor gen es by transcriptional methylation silencing of their promoter CG islands. For instance, the tumor suppressor protein PTEN (Phosphatase and Tensin Homolog) are typically inactivated by promoter hypermethylation mixed with either gene mutations or loss of he terozygosity (LOH) on 10q23 in about 20 30% cases of colorectal cancer (CRC) [ 5 ] Gain of F unction C ancer G ene s Loss of function mutations of tumor suppressors is predominant, while gain of function mutation is a more restrictive type of alteration. The study of gain of function dominant oncogene mutations played a critical role in our understanding of the genetic basis for human cancer. Amplification of normal genes in tandem like N myc may also lead to structure alterations of its either gene copies [ 6 ] Viral H ras was known for many decades as a potent oncogene in infected rodent cells. However, it was the breakthrough observation that human tumors carry a somatic mutation in the cellular H ras homolog that confirmed the oncogene theory of human cancer. This research identified that Gly12Val point mutation in GTPase H ras ma ke H Ras over active by blocking RAS interaction, which leads cells to grow and divide independently of outside growth signal stimulation and finally cause uncontrolled cell cycle and tumor formatio n [ 7 ] Since then there hav e been many other v alidated dominant gain of function and recessive loss of function cancer genes identified. The Sanger Cosmic Program has worked to organize this data in a registry ( http://cancer.sange r.ac.uk/cancergenome/projects/census/ ). According to the current most release of all cancer census gene list from COSMIC there are about 5 22 cancer genes identified (Table 1 1). The striking feature is that the most common mechanism for cancer gene acti vation is chromosomal translocation (327/5 22 ). This was surprising.

PAGE 17

17 Furthermore, i nitially thought to be only in leukemia and lymphomas and both in solid tumors, but now increasing number of solid tumors have recurrent chromosomal translocation (Table 1 2) Chromosomal T ranslocation in C ancers Chromosomal translocation is an abnormality caused by rearrangement between two or more non homologous chromosomal materials. Chromosomal translocation s were first tologists in the late nineteenth and early twentieth centur y Among the earliest pioneers, Theodor Boveri cancers and he suggested that acquired chromosomal translocation i s an important causal factor of tumor initiation in 1914 [ 8 ] The first balanced chromosome translocation identified in1980s was the translocation between chromosome 9 and 22 with breakpoints in bands 9q34 and 22q11, which results in the famous Philadelphia chromosome that underlies the etiology of chronic myeloid leukemia [ 9 ] Chromosome translocations are now found in more than 70% of leukemia and over 90% of all lymphomas [ 10 ] and also found in carcinomas. Modern U nderstanding of C hromosomal T ranslocations The chromosome non homologous end joining model ( NHEJ) for double strand break (DSB) repairing [ 11 13 ] is now widely accepted based on the observations of breaks found in normal chromosomes and that fusions of broken ends from non homologous chromosomes [ 14 15 ] DSBs can usually cause cell arrest in mi tosis, induce apoptosis; or the breaks can activate the non homolog ous end joining DNA repair systems [ 11 ] As a result of this end joining repairing, a diversity of chromos omal rearrangements occurs [ 16 17 ] Precise rejoining can produce the normal chromosome

PAGE 18

18 and no structure abnor mality caused [ 17 ] However, imprecise joining of two or more breaks in the same chromosome will lead to insertion/deletion mutation, amplification or reversion of regional DNA fragments [ 18 ] Furthermore, joining of breaks from non homologous chromosomes generate the chromosomal rearrangement [ 11 ] Since the DSBs are prerequisite and inducer of chromosomal translocations, factors that raise the chance of DSB will increase the r isk of chromosomal translocations thus causing cancers. So what causes DNA breaks in chromosomal translocations? There are many attempts have been made to reveal the underlying forces for chromosomal translocations [ 19 ] For instance, the AID cleavage model [ 20 ] and the V(D)L recombination model [ 13 ] both defined how the specific nick was generated; however, no much stronger associations found in tumors [ 21 ] Radiation exposure is found to significantly increase the risk of chromosomal translocat ion and thus causing cancers [ 22 ] However, the exact mechanism is still unclear. Oncogene A ctivation by T ranslocation Translocations can usually activate prot o oncogene by forming chimeric fusion gene, exchanging promoters or through terminal deletions. In leukemias, different translocation events usually are linked with specific subtypes of leukemia or different treatment outcomes [ 23 ] For instance, t(12;21) translocation causing fusion gene in acute lymphoblastic leukemia (ALL) are usually linked with the favorable therapeutic outcomes [ 23 ] Nowadays, accumulating chromosomal translocations are also found in carcinomas (tumors of epithelial cell origin) and were used as important biomarkers for the tumor they arise [ 24 ] The fir st example is the fusion of RET gene encoding a tyrosine kinase receptor with the CCDC6 gene (a.k.a D10S170 ) that was identified in the early 1990s. Besides, there are nine other fusion genes found in this tumor types

PAGE 19

19 also involved tyrosine kinase domain of RET and 3 to 4 related to other genes. Therefore, abnormality in the tyrosine kinase activity is considered as an important feature of this epithelial tumor type [ 24 ] Since then, many other gene fusions have been revealed in carcinomas ( listed in Table 1 2 ) [ 25 ] including ETV6 NTRK3 found in secretary breast ductal carc inoma; chromosomal translocations are also found in lung cancer involving the kinase domain encoding genes such as ALK and ROS ; In prostate cancers, ETS gene family members are often found to be fused to androgen responsive genes or ubiquitous promoters. I n all these cases, the detection of a recurrent chromosomal translocation identifies the key genetic alteration that underlies the etiology of that tumor types. Therefore, the chromosomal translocation is the diagnostic biomarker. It is also the prognostic biomarker as well as the therapeutic target to cure the disease. Chromosomal translocation is at the center for understanding the biology of the tumors that harboring significant chromosomal translocations. Malignant salivary gland tumors arise from recur rent pathogenic chromosomal translocations, but little is known about the biology and there are no systemic treatments. Salivary G land T umors The salivary glands are characterized as either major glands or minor glands. The major glands are paired includin g parotid, sublingual and submandibular glands. The minor glands refer to the glands located in the lips, palate and the buccal mucosa. Salivary glands tumors (SGTs) are rare accounting for 2 6% of head and neck tumors [ 26 ] However, SGTs comprise a very heterogeneous group of tumors including benign neoplasms, tumor like conditions, as well as malignant neoplasms (Table 1 3) According to the world health organiza tion classification, there wer e at least 40 subtypes of SGTs including one main premalignant tumor, the pleomorphic adenoma

PAGE 20

20 (PA), and three major subtypes of malignant salivary gland tumors, i.e. malignant mucoepidermoid cancer (MEC), adenocarcinama (ADC) and adenoid cystic cancer (ACC). PA is typically a class of slow growing tumor occurred in parotid. PA is the most common benign salivary gland neoplasms accounting for 85% of all SGTs [ 27 ] MEC is the most frequent malignant SGTs occurred in pediatric populations [ 28 ] accounting for 35% salivary gland cancers. Adenoid cystic carcinoma (ACC) is among the most common aggressive salivary gland malignancies. Neural invasion is commo n for ACC and it usually extends to adjacent soft tissues. And up to 90% patients ar e died of ACC within 10 15 years [ 26 ] Other SGTs like Warthin tumor (WT) and A cinic cell carcinoma are also common. The etiology of SGTs is unknown so far. However, the common subtypes are all known to be associated with chromosomal translocations and there may be an increased risk after radiation exposure. Studies on the recurrent fusion genes caused by chromosomal translocations are predicted to provide essential understandings of the tumor initiations and/or progressions. Chromosomal T ranslocation in PA PA is a type of epithelial SGTs characterized by characteristic morphological cell diversity. PAs can arise from several different comprise frequent chromosomal abnormalities including rearrangement involving 8q12 (39%) or 12q13 15 (8%) [ 26 ] The PLAG1 (pleomorphic adenoma gene 1) and thus activating PLAG1 by exchanging its promoter to a group of highly expressed ubiquitous genes including CTNNB1 (beta 1 catenin) and LIFR (leukemia inhibitory factor receptor) as well as FGFR1 (fibroblast growth factor receptor 1) [ 29 31 ] PLAG1 is a nuclear transcriptional factor which is not expressed in normal salivary glands. Gene fusion of PLAG 1 to another active promoters caused by

PAGE 21

21 chromosomal translocations can activation the gene expression of PLAG1, which then may promote cell proliferation of tumor cells by up regulating growth factors [ 29 31 ] For example, the highly expressed PLAG1 was experimentally found to be associated with IGF II (insulin like growth factor II) [ 32 ] Chromosomal rearrangements of 12q13 15 involve the HMGA2 (also known as HMGIC ) gene. HMGA2 belongs to the high mobility group A (HMGA) family of protein. HMGA2 proteins are highly expressed in early embryo but undetectable in terminall y differentiated normal cells [ 33 ] Their functionalities are involved in many cellular processes, including cell cycle, differentiation, gene regulation and viral integration [ 34 ] Over expression of HMGA2 leads to switches of E2F1 from r epression to activation: F or example HMGA2 contacts to repression complex RB E2F1 HDAC1 by binding to the pRB protein. Then HMGA2 displaces HDAC1 through interaction with pRB. And the transcriptional repression is released by histone acetylation performed by histone acetylase machinery in the absence of HDAC1. In addition, E2F1 is also acetylated and activated [ 35 ] HMGA2 is also involved in the TGF induced EMT pathway in human cancers [ 36 37 ] Ectopic expression of HMGA2 leads to repression of E cadherin expression, which is achieved by increasing the expression of HMGA2 transcriptional inhibitors Snail1, Snail2/Slug and Twist [ 38 ] HMGA2 is also frequently rearranged in other ty pes of tumors including lipoma, lung hamartomas, fibroadenomas [ 39 41 ] Common fusion partners for HMGA2 are LPP FHIT and NFIB Interesting, the NFIB terminal pep terminal exon that fused to MYB. In addition, the reciprocal fusion NFIB HMGA2 has never been found [ 40 ] The HMGA2 gene contains 5 exons: each of the first three

PAGE 22

22 exons encode for an AT hook domain which can binds to AT rich DNA sequences [ 42 44 ] The last two exons encode for a linker and acidic tail region was thought to be important and associated with HMGA2 oncogenicity [ 42 45 46 ] This region, however, is commonly deleted through the fusion event. In addition, the truncated HMGA2 alone or over expressed HMGA2 showed associated with tumor formation [ 39 47 48 ] ed targets for mir let 7 [ 49 ] and AU rich regions [ 40 ] which lead to down regulation of HMGA2 through miRNA targeting [ 50 ] and mRNA decay respectively. Therefore, deletion of transforming activity of HMGA2. Disruption the pairing between let 7 and HMGA2 showed increased transforming activit y [ 3 ] or proliferation [ 47 ] Chromosomal T ranslocation in MEC MECs are normally painless lesions, which account s for up to 35% of salivary gland malignancies [ 26 ] Cytological studies revealed a major genetic abnormali ty in MECs: t(11;19)(q21;p13). Th is recurrent translocation has been detected in salivary gland MECs as well as in Broncho pulmonary originated MECs [ 51 54 ] This chromosomal translocation produces a recurrent fusion gene CRTC1 MAML2 (Figure1 1), which has been shown as an oncogene. CRT C1 (CREB regulated transcription coactivator 1, a.k.a MECT1 or TORC1) functions as CREB co activators together with CBP/p300 in regulation of gene transcriptions [ 5 1 54 ] MAML2 (Mastermind like gene family) is a transcriptional co activator for NOTCH pathway. Full length of MAML2 is functionally dependent on CSL (CBF 1, suppressor of hairless and Lag 1) [ 51 54 ] CRTC1 MAML2 fusion gene keeps the exon 1(encodes for 42 amino acids) of CRTC1 and exon 2 5 of MAML2 (encodes for 981 amino acids) as shown in Figure 1 1 The

PAGE 23

23 exon 1 of CRTC1 reserves the intact CREB binding domain (C BD) and thus retains the CREB dependent functions that are fused to the transcriptional activation domain of MAML2 The fusion gene thus become independent NOTCH pathway activator and was found experimentally oncogenic [ 51 54 ] Chromosomal T ranslocation in ACC Although adenoid cystic cancer (ACC) is rare, it is the most common aggressive salivary gland malignancies with no known curative therapy available. The comm on treatment is surgical resection followed by local radiations; however, recurrence is very common. Recently, the t(6;9)(q22 23;p23 24) chromosomal translocation was characterized in at least half of the ACC tissue by either FISH, RT PCR or Genomic sequen cing approaches [ 55 56 ] The translocation event brings MYB gene, located on chromosome 6q22 23, and NFIB gene, loca ted on chromosome 9p23 24 to form a recurrent fusion gene MYB NFIB, which has at least 14 variants. There are at least 15 variants of MYB NFIB fusion detected in ACCs [ 57 ] including two variants having break (Table 1 4) The most common breakpoints locates in the intron 15 of MYB and the intron 11 of NFIB, which translate a fusion protein MYB NFIB containing the intact exon 1 15 of M YB and intact exon 12 of NFIB (Figure 1 2). The exon 10 of MYB is typically spliced out in ACC tumors. As a transcriptional factor, MYB protein is comprised of three major domains: DNA binding domain, transcriptional activation domain and negative regula tion domain. The c MYB protein is the normal cellular counterpart to v MYB, a transforming protein expressed by two avian leukemia viruses (avian myeloblastosis virus and E26 retrovirus) that transforms immature hematopoietic cells and induces leukemia in chickens and mice [ 58 59 ] Over expression of MYB genes is associated with human

PAGE 24

24 leukemia [ 60 ] breast and colorectal cancers [ 61 ] and the tandem duplication of the myb gene was uncovered in human T cell acute lymphoblastic leukemia (T ALL) [ 62 ] This suggests important roles of MYB in tumor transforming activities. Notably, none of the known functi onal domains are interrupted in the fusion gene except the truncation of harbors several conserved miRNA target sites, for example, hsa miR 155, hsa miR 150 as well as hsa miR 15a/16, which leads to potential mechanism of MYB deregulation caused by the disruption of MYB miRNA pairing. I therefore hypothesize that MYB:NFIB translocation offers a novel mechanism for oncogene activation via deletion of regulatory microRNA (miRN NFIB is a nuclear transcriptional factor belonging to nuclear factor one (NFI) family. NFIB is comprised of an amino terminal DNA binding domain (DBD) and a carboxyl terminal transcriptional activation domain (TAD). Interestingly, this terminal exon encodes only for a small peptide sequence of five amino acids (SWYLG), which is highly conserved within NFI family. Grnder et al. [ 63 ] indicated that this sequence resembled the CTD (C terminal domain) of the largest subunit of RNA pol y merase II which can generate a physical bridge between RNA transcription complex and the pre mRNA processing complex throu gh the CTD tail protein protein interactions [ 63 ] Furthermore, the same terminal exon of NFIB is found to be fused with HMGA2 (a.k.a. HMGIC) in both pleomorphic adenomas [ 40 ] and lipoma [ 41 ] which implied that terminal exon of NFIB might function as a translocation partner corresponding to its

PAGE 25

25 protein protein interaction potentials. I therefore ACC Micro RNA Regulat ions in Tumor Development Micro RNA R egulation M odels Micro RNA (miRNAs) are a class of 18 24 nucleotides small non coding RNAs, which can negatively regulate their target genes [ 64 ] In general, the process of miRNA mediated gene regulation includes mRNA decay [ 65 66 ] mRNA deadenylation [ 67 ] translational repression and activation [ 68 70 ] mRNA decay model [ 65 66 71 ] : mRNA deca y model includes two steps: mRNA targets deadenylation and subsequent degradation [ 71 73 ] In this model, miRNAs mediated the recruitment of miRNA induced silenci ng complex (miRISC) including Argonaute proteins the P body component and GW182, which then interacts with the CCR4:NOT1 deadenylase complex to initiate the deadenylation of the target mRNA poly(A) tail [ 65 66 71 ] Additionally, the PABP (poly(A) binding protein) enhances the deadenylation by direct inter action with the GW182 protein [ 74 ] Lastly, the m 7 G cap on DCP2 and leads to degradation of the coding frame of target mRNA [ 75 76 ] Parsimonious model: This streamlined model for miRNA mediat ed gene repression begins with translational repression, which may then be triggered or enhanced by mRNA deadenylation and finally lead to mRNA decay [ 72 77 ] As known, translation initiation basically can be categorized into two groups: cap dependent initiation and cap independent initiation, which replies on the internal ribosome entry sites TR of target mRNA. In this model, miRISC firstly inhibits

PAGE 26

26 translation initiation by either blocking the eIF4F m7G cap recognition or interfering with the 80S ribosome formation [ 72 77 ] The cap independent translation is refractory to this initiation block. Instead, the IRES dependent translational repression by miRNA might be implied with a post initiation translationa l silencing model, which however has not been well developed yet [ 72 77 ] The CCR4:NOT1 deadenylase complex might po tentially contribute to translational repression at initiation stage. And lastly, miRNA mediated translational repressed mRNA will be accumulated in specific c ytoplasmic foci (GW bodies or P bodies etc.), and finally subjected to degradation after the decap ping of m 7 G cap by the DCP1 DCP2 decapping complex [ 72 77 ] miRNA mediated translational activation model: miRNA can target mRNA and then recruit the fragile X related protein 1 (FXR1) and Ago2 to stimulate target mRNA translation [ 68 70 ] miRNA may also bin IRES to stimulation replication [ 78 ] The miRNA mediated activation is rare, unexpected and not well explained. Micro RNA A ctivation in T umors miRNAs have been known as important facto rs in many biological functions, including tumor formation [ 64 ] The important roles of miRNAs have been proposed in many different animal tumor model systems, but t here are limited examples of human cancers that directly implicate disruption of miRNA binding elements via a reciprocal chromosomal translocation. miR 375 is a significant suppressor in squamous basal cell tumor and repression of miR 375 is associated wi th invasive properties and poor prognosis [ 79 82 ] miR 31 is another significant tumor suppressor, almost completely absent in human metastatic breast cancers [ 83 84 ] And miR 106b 25 cluster is reported as candidate oncogene in prostate cancers [ 85 ] Recently, the competing

PAGE 27

27 endogenous RNAs (ceRNA) hypothesis linked the ps e udogene and miRNA activation in tumorigenesis [ 86 88 ] In general, miRNAs can repress target gene expression by binding to miRNA response elements (MREs) on target RNA transcripts. Many RNA transcripts can share same MREs, that miRNA binding to one RNA target could protect other RNA targets from down regulation by the sequestered miRNAs [ 89 ] Therefore, it is hypothesized that the RNAs sharing same MREs can regulate each other by comp eting for miRNA bindings. Built on this idea, they proposed that cross talk between ceRNAs forms a large scale regulatory network across the whole transcriptome by extending the concept of ceRNAs to messenger RNAs, transcribed pseudogenes, and long non cod ing RNAs (lncRNAs) [ 86 89 ] ceRNAs regulate each other through cross talking, where it has been proposed that miRNAs are letters and MREs are words of their com munication [ 86 88 ] The non coding functio ns of mRNAs do not necessarily overlap with their coding function. cis regulator of their own transcripts or trans modulators of other genes. Therefore, the perturbation of ceRNA could have pathological consequences such as cancer formations. The ceRNA hypothesis has both experimental evidence and bioinformatics support. For example, th e pseudogene PTENP1 was reported to function as a tumor suppressor through depression of PTEN by competing for PTEN [ 90 ] In addition, this hypothesis could potential explain the unbalanced gap between genome size and organism complexity, thereby providing answers to evolutionary questions.

PAGE 28

28 Significance, H ypothesis and A ims Significance Novel insights into the biology and g enetics of rare diseases have always provided new understanding of cancer biology that extends broadly to other more common cancers. For example, the identification of the CRTC1 MAML2 oncogene in MECs has revealed a novel CREB activator cancer pathway that is linked with anabolic metabolism and the Peutz Jegher LKB1 kinase [ 51 91 92 ] To date, there are no promising clinical trials available for human ACCs. The Rare Tumor section of the NCI Head and Neck Steering committee was recently unable to design any new clinical trials for salivary gland cancers until basic scie ntist can uncover an appropriate molecular target to attack. Little was known about the etiology of ACC. Therefore, it is of great importance to study the global molecule expression alterations for human ACC to identify potential therapeutic targets and de fine the etiology of this rare lethal disease. In addition, recent discovery of MYB NFIB fusion events in at least 50% of ACC provides specific important opportunities studying the etiology of ACC and developing potential therapeutic strategies for this l ethal malignancy [ 55 93 94 ] Also, studying the functional characteristics of MYB:NFIB translocation event in this important human malignancy has its specific significance and innovation for developing new treatment strategies. In addition, MYB is reported to be repressed by hsa miR 150 in both leukemic and breast cancer cell lines as well as by hsa miR 15a/16 and hsa miR 140 binding in primary ACC cells and hematopoietic cells. In contrast, little is known about the role of NFIB in tumorigenesis. The observation that NFIB is a recurrent fusion partner for distinct subtypes of cancer and that it may also participate in lung cancer tumorigenesis

PAGE 29

29 emphasizes the importance to define the role of MYB NFIB biology in SGT and identify potential therapeutic targets to improve patient care. Hypothesis In this research, I hy pothesize that MYB:NFIB translocation offers a novel mechanism for oncogene activation via deletion of regulatory microRNA (miRNA) an important tumorigenic factor for ACCs. Specific Aims Since there is no available systemic information on the etiology nor the biology for ACC, I focused on studying the whole transcriptome expression profile as well as the global miRNA patterns for this lethal disease to define the key molecular alterations, to discover new tumor signaling pathways and to identify novel treatment targets for ACC. I also studied the functional roles of this novel fusion oncogene, MYB NFIB that underlies human breast and salivary gland tumors. In addition, the establishment of MYB NFIB fusion gene transgenic mouse model is also pursued for better understanding the biology of MYB activation in ACC and for future development of therapeutic strategies. The long term goal of this research is to develop novel th erapeutic strategies to cure this important group of aggressive tumors for which there is no curative systemic therapy. Three main aims are pursued in this research, including both short term and long term goals. Aim 1 Study the global mRNA and miRNA prof iles of ACC patient samples to identify the key molecular alterations, to discover underlying molecular regulation network and to search for therapeutic targets for this aggressive disease. Comparison between MYB NFIB fusion positive and fusion negative tu mor tissues are also

PAGE 30

30 performed to understand the molecular outcomes caused by recurrent fusion gene between MYB and NFIB Aim 2 Develop both in vitro and in vivo functional assays to test the transforming activity of this novel MYB NFIB fusion gene in AC C. Study the effects of deleting the Study the role of last exon of NFIB to understand its contribut ion to the transforming activity of MYB NFIB fusion gene by comparing the functions of MYB NFIB to truncated MYB. Identify whether MYB segment of MYB by comparing the functions of MYB NFIB to full length MYB. Aim 3 Perform primary tumor cell culture and establish transgenic MYB NFIB fusion gene mouse model to serve as both in vitro and in vivo models for future therapeutic screening and validations. Ultimately, this multidisciplinary project will o ffer new hope for patient care and offer insights that extend well beyond this uncommon, but lethal cancer.

PAGE 31

31 Table 1 1. Summary of human cancer census genes by COSMIC Human cancer genes category Number of genes Percentage (%) Gene Symbol 522 100 Germline Mutations 82 16 Somatic Mutations 482 92 Both Germline and Somatic Mutations 42 8 Amplifications 16 3 Frame shift Mutations 112 21 Large Deletions 39 7 Missense Mutations 169 32 Nonsense Mutations 103 20 Translocations 327 63 Extract from COSMIC cancer gene census as of Feb, 2014. http://cancer.sanger.ac.uk/cancergenome/proj ects/census

PAGE 32

32 Table 1 2. List of human cancer census genes involved in translocation by COSMIC*. Tumour Types (Somatic Mutations) Tissue Type Symbol Translocation Partner acute megakaryocytic leukaemia L MKL1 RBM15 acute megakaryocytic leukaemia L RB M15 MKL1 adenoid cystic carcinoma E MYB NFIB adenoid cystic carcinoma, lipoma E NFIB MYB, HGMA2 AL L ELL MLL AL L FOXO3A MLL AL L GPHN MLL AL L MLLT1 MLL AL L MLLT10 MLL, PICALM, CDK6 AL L MLLT2 MLL AL L MLLT4 MLL AL L MLLT6 MLL AL L MLLT7 MLL AL L SH3GL1 MLL ALCL L ALO17 ALK ALCL L ATIC ALK ALCL L CARS ALK ALCL L CLTCL1 ? ALCL L MSN ALK ALCL L MYH9 ALK ALCL L TPM4 ALK ALCL, NSCLC, neuroblastoma L, E, M ALK NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22 ALCL, renal L CLTC ALK, TFE3 ALL L AF1Q MLL ALL L AF3p21 MLL ALL L AF5q31 MLL ALL L CDK6 MLLT10 ALL L EPS15 MLL ALL L FCGR2B ? ALL L FOXP1 PAX5 ALL L HLF TCF3 ALL L MLLT3 MLL ALL L RANBP17 TRD@ ALL L TTL ETV6 ALL L ZNF521 PAX5 ALL L ZNF384 EWSR1, TAF15 ALL, AML, DLBCL, B NHL L CREBBP MLL, MORF, RUNXBP2 ALL, AML, MPN, CML L JAK2 ETV6, PCM1, BCR ALL, DLBCL L IKZF1 BCL6 ALL, T ALL L LAF4 MLL, RUNX1 alveolar rhabdomyosarcoma M FOXO1A PAX3 alveolar rhabdomyosarcoma M NCOA1 PAX3 alveolar rhabdo myosarcoma M PAX3 FOXO1A, NCOA1 alveolar rhabdomyosarcoma M PAX7 FOXO1A alveolar soft part sarcoma M ASPSCR1 TFE3 AML L ABI1 MLL AML L ABL2 ETV6 AML L AF15Q14 MLL AML L ARHGEF12 MLL AML L ARNT ETV6 AML L CBFA2T1 MLL, RUNX1 AML L CBFA2T3 RUNX1 AML L CBFB MYH11 AML L CDX2 ETV6 AML L CHIC2 ETV6 AML L DEK NUP214 AML L ELF4 ERG AML L FNBP1 MLL AML L GMPS MLL AML L HEAB MLL AML L HLXB9 ETV6 AML L HOXA13 NUP98 AML L HOXC11 NUP98 AML L HOXC13 NUP98 AML L HOXD11 NUP98 AML L LASP1 MLL AML L LC X MLL AML L MLF1 NPM1 AML L MYH11 CBFB AML L MYST4 CREBBP AML L NSD1 NUP98 AML L NUP98 HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11 AML L PMX1 NUP98 AML L PNUTL1 MLL AML L PSIP2 NUP98 AML L RPN1 EVI1 A ML L RUNXBP2 CREBBP, NCOA2, EP300 AML L SEPT6 MLL AML L SET NUP214 AML L TRIP11 PDGFRB AML L WHSC1L1 NUP98 AML L KDM5A NUP98 AML* L DDX10 NUP98 AML* L GAS7 MLL AML* L HOXA9 NUP98, MSI2 AML* L HOXD13 NUP98 AML* L MSF MLL

PAGE 33

33 Table 1 2. Continued Tumour Types (Somatic Mutations) Tissue Type Symbol Translocation Partner AML* L TOP1 NUP98 AML, AEL L FACL6 ETV6 AML, ALL L MLL MLL, MLLT1, MLLT2, MLLT3, MLLT4, MLLT7, MLLT10, MLLT6, ELL, EPS15, AF1Q, CREBBP, SH3GL1, FNBP1, PNUTL1, MSF, GPHN, GMPS, SS H3BP1, ARHGEF12, GAS7, FOXO3A, LAF4, LCX, SEPT6, LPP, CBFA2T1, GRAF, EP300, PICALM, HEAB AML, chondrosarcoma L NCOA2 RUNXBP2, HEY1 AML, CML L EVI1 RUNX1, ETV6, PRDM16, RPN1 AML, CML L RPL22 RUNX1 AML, CMML L PER1 ETV6 AML, JMML, MDS L CBL MLL AML, MD S L GRAF MLL AML, meningioma L, O MN1 ETV6 AML, preB ALL, T ALL L RUNX1 RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4 AML, T ALL L NUP214 DEK, SET, ABL1 aneurysmal bone cyst M CDH11 USP6 aneurysmal bone cyst M OMD USP6 aneurysmal bone cyst M THRAP 3 USP6 aneurysmal bone cyst M USP6 COL1A1, CDH11, ZNF9, OMD, THRAP3 aneurysmal bone cyst M ZNF9 USP6 APL L NUMA1 RARA APL L RARA PML, ZNF145, TIF1, NUMA1, NPM1 APL L TIF1 RARA APL L ZNF145 RARA APL, ALL L PML RARA, PAX5 B ALL L BCL9 IGH@, IGL@ B A LL L ELN PAX5 B ALL L STL ETV6 B ALL, Down syndrome associated ALL L P2RY8 CRLF2 B ALL, Downs associated ALL L CRLF2 P2RY8, IGH@ BCLL L BTG1 MYC B CLL L BCL11A IGH@ B CLL L FSTL3 CCND1 bladder, MM, T cell lymphoma L, E FGFR3 IGH@, ETV6 BNHL L BCL7A MYC B NHL L DDX6 IGH@ B NHL L FVT1 IGK@ B NHL L IRTA1 IGH@ B NHL L MUC1 IGH@ B NHL L NFKB2 IGH@ Burkitt lymphoma L IGL@ BCL9, MYC, CCND2 Burkitt lymphoma, amplified in other cancers, B CLL L, E MYC IGK@, BCL5, BCL7A BTG1, TRA@, IGH@ Burkitt lymp homa, B NHL L IGK@ MYC, FVT1 clear cell sarcoma, angiomatoid fibrous histiocytoma M CREB1 EWSR1 CLL L BCL5 MYC CLL L BCL3 IGH@ CLL, B ALL, breast L, E CCND1 IGH@, FSTL3 CML L HOXA11 NUP98 CML L MSI2 HOXA9 CML, ALL, AML L BCR ABL1, FGFR1, JAK2 CM L, ALL, T ALL L ABL1 BCR, ETV6, NUP214 CMML L HIP1 PDGFRB CMML L RAB5EP PDGFRB colorectal E TCF7L2 VTI1A colorectal E VTI1A TCF7L2 colorectal, breast, pancreatic, AML, ALL, DLBCL L, E EP300 MLL, RUNXBP2 colorectal, ovarian, hepatoblastoma, pleomorph ic salivary gland adenoma, other tumour types E, M, O CTNNB1 PLAG1 congenital fibrosarcoma, multiple leukaemia and lymphoma, secretory breast, MDS, ALL L, E, M ETV6 NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, M DS2, PER1, SYK, TTL, FGFR3, PAX5 congenital fibrosarcoma, secretory breast E, M NTRK3 ETV6 dermatofibrosarcoma protuberans, aneurysmal bone cyst M COL1A1 PDGFB, USP6 DFSP M PDGFB COL1A1 edometrial stromal sarcoma M YWHAE FAM22a, FAM22B endometrial s tromal sarcoma M FAM22A YWHAE endometrial stromal sarcoma M FAM22B YWHAE endometrial stromal tumour M JAZF1 SUZ12 endometrial stromal tumour M SUZ12 JAZF1 epithelioid haemangioendothelioma M CAMTA1 WWTR1 epithelioid haemangioendothelioma M WWTR1 CAMTA 1 Ewing sarcoma M FEV EWSR1, FUS Ewing sarcoma M FLI1 EWSR1 Ewing sarcoma M ZNF278 EWSR1 Ewing sarcoma, desmoplastic small round cell tumour ALL, clear cell sarcoma, sarcoma, myoepithelioma L, M EWSR1 FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1, PBX1 Ewing sarcoma, prostate M, E ETV1 EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3 Ewing sarcoma, prostate carcinoma M, E ETV4 EWSR1, TMPRSS2, DDX5, KLK2, CANT1 Ewing sarcoma, prostate, AML M, E, L ERG EWSR1, TMPRSS 2, ELF4, FUS, HERPUD1, NDRG1 extraskeletal myxoid chondrosarcoma M CHN1 TAF15 extraskeletal myxoid chondrosarcoma M NR4A3 EWSR1 extraskeletal myxoid chondrosarcoma M TCF12 TEC extraskeletal myxoid chondrosarcoma, ALL L, M TAF15 TEC, CHN1, ZNF384 fibro myxoid sarcoma M CREB3L2 FUS follicular lymphoma L SFRS3 BCL6 follicular thyroid E PAX8 PPARG follicular thyroid E PPARG PAX8 follicular thyroid adenoma E ZNF331 ? GIST, idiopathic hypereosinophilic syndrome, paediatric glioblastoma L, M, O PDGFRA FIP 1L1

PAGE 34

34 Table 1 2. Continued Tumour Types (Somatic Mutations) Tissue Type Symbol Translocation Partner idiopathic hypereosinophilic syndrome L FIP1L1 PDGFRA intestinal T cell lymphoma L IL2 TNFRSF17 intestinal T cell lymphoma L TNFRSF17 IL2 JMML L HC MOGT 1 PDGFRB leiomyoma M ALDH2 HMGA2 leiomyoma M CCNB1IP1 HMGA2 lethal midline carcinoma E C15orf55 BRD3, BRD4 lethal midline carcinoma of young people E BRD3 C15orf55 lethal midline carcinoma of young people E BRD4 C15orf55 lipoma M C12orf9 LPP li poma M CMKOR1 HMGA2 lipoma M EBF1 HMGA2 lipoma M LHFP HMGA2 lipoma, leiomyoma, pleomorphic salivary gland adenoma M HMGA2 LHFP, RAD51L1, LPP, COX6C, CMKOR1, NFIB, ALDH2, CCNB1IP1, EBF1, WIF1, FHIT lipoma, leukaemia L, M LPP HMGA2, MLL, C12orf9 lipoma uterine leiomyoma M RAD51L1 HMGA2 liposarcoma M DDIT3 FUS liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma M, L FUS DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1 lymphoblastic leukaemia/biphasic L TAL1 TRD@, SIL malign ant melanoma of soft parts, angiomatoid fibrous histiocytoma E, M ATF1 EWSR1, FUS MALT L MALT1 BIRC3 MALT L BCL10 IGH@ MALT, CLL L BIRC3 MALT1 MDS L MDS2 ETV6 MDS, AML L MDS1 RUNX1 MDS, AML L PRDM16 EVI1 MDS, peripheral T cell lymphoma L SYK ETV6, ITK medullary thyroid, papillary thyroid, pheochromocytoma, NSCLC E, O RET H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6 melanoma, colorectal, papillary thyroid, borderline ovarian, NSCLC, cholangiocarcinoma, pilocytic astr ocytoma E BRAF AKAP9, KIAA1549 mesenchymal chondrosarcoma M HEY1 NCOA2 microfollicular thyroid adenoma, various benign mesenchymal tumours E, M HMGA1 ? MLCLS L PAFAH1B2 IGH@ MLCLS L PCSK7 IGH@ MM L CCND3 IGH@ MM L MAF IGH@ MM L MAFB IGH@ MM L WHSC1 IGH@ MM L IRF4 IGH@ MM, Burkitt lymphoma, NHL, CLL, B ALL, MALT, MLCLS L IGH@ MYC, FGFR3,PAX5, IRTA1, IRF4, CCND1, BCL9, BCL8, BCL6, BCL2, BCL3, BCL10, BCL11A. LHX4, DDX6, NFKB2, PAFAH1B2, PCSK7, CRLF2 MPN L NIN PDGFRB MPN L PDE4DIP PDGFRB MPN, AML, CMML, CML L PDGFRB ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT 1, PDE4DIP MPN, NHL L CEP1 FGFR1 MPN, NHL L FGFR1 BCR, FOP, ZNF198, CEP1 MPN, NHL L FGFR1OP FGFR1 MPN, NHL L ZNF198 FGFR1 myxofibrosarcoma M CREB3L1 FUS myxoma, endocrine, papillary thyr oid E, M PRKAR1A RET NHL L ARHH BCL6 NHL L EIF4A2 BCL6 NHL L HIST1H4I BCL6 NHL L HSPCA BCL6 NHL L HSPCB BCL6 NHL L IL21R BCL6 NHL L NACA BCL6 NHL L PIM1 BCL6 NHL L POU2AF1 BCL6 NHL L TFRC BCL6 NHL L LCP1 BCL6 NHL, ALL, B ALL L PAX5 IGH@, ETV6, PML, FOXP1, ZNF521, ELN NHL, APL, AML L NPM1 ALK, RARA, MLF1 NHL, CLL L BCL2 IGH@ NHL, CLL L BCL6 IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R, POU2AF1, ARHH, EIF4A2, SFRS3 NHL,CLL L CCND2 IGL@ NSCLC E C2orf44 ALK NSCLC E CCDC6 RET NSCLC E CD74 ROS1 NSCLC E EML4 ALK NSCLC E EZR ROS1 NSCLC E KIF5B RET, ALK NSCLC E LRIG3 ROS1 NSCLC E SDC4 ROS1 NSCLC E SLC34A2 ROS1 oligodendroglioma, soft tissue sarcoma O CIC DUX4 papillary renal E NONO TFE3 papillary renal E PRCC TFE3 papillary renal E SFPQ TFE3 papillary renal, alveolar soft part sarcoma, renal E TFE3 SFPQ, ASPSCR1, PRCC, NONO, CLTC papillary thyroid E AKAP9 BRAF papillary thyroid E ELKS RET papillary thyroid E GOLGA5 RET papillary thyroid E HOOK3 R ET

PAGE 35

35 Table 1 2. Continued Tumour Types (Somatic Mutations) Tissue Type Symbol Translocation Partner papillary thyroid E NTRK1 TPM3, TPR, TFG papillary thyroid E TPR NTRK1 papillary thyroid E TRIM27 RET papillary thyroid E TRIM33 RET papillary thyr oid E NCOA4 RET papillary thyroid, ALCL, NSCLC E, L TFG NTRK1, ALK papillary thyroid, ALCL, NSCLC E, L TPM3 NTRK1, ALK, ROS1 papillary thyroid, CML E D10S170 RET, PDGFRB papillary thyroid, CML, MPN E, L PCM1 RET, JAK2 peripheral T cell lymphoma L ITK SYK pilocytic astrocytoma M RAF1 SRGAP3 pilocytic astrocytoma M SRGAP3 RAF1 pleomorphic salivary gland adenoma E FHIT HMGA2 pleomorphic salivary gland adenoma E WIF1 HMGA2 PMBL, Hodgkin lymphoma L C16orf75 CIITA PMBL, Hodgkin lymphoma L CD273 CIITA PMBL, Hodgkin lymphoma L CD274 CIITA PMBL, Hodgkin lymphoma L CIITA FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6 PMBL, Hodgkin lymphoma L FLJ27352 CIITA PMBL, Hodgkin lymphoma L RUNDC2A CIITA PMBL, Hodgkin lymphoma, L RALGDS CIITA pre B A LL L TCF3 PBX1, HLF, TFPT pre B ALL, myoepithelioma L, M PBX1 TCF3, EWSR1 pre B ALL L TFPT TCF3 prostate E ACSL3 ETV1 prostate E C15orf21 ETV1 prostate E CANT1 ETV4 prostate E DDX5 ETV4 prostate E ELK4 SLC45A3 prostate E HERPUD1 ERG prostate E HNR NPA2B1 ETV1 prostate E KLK2 ETV4 prostate E NDRG1 ERG prostate E ETV5 TMPRSS2, SCL45A3 prostate E SLC45A3 ETV1, ETV5, ELK4, ERG prostate E TMPRSS2 ERG, ETV1, ETV4, ETV5 renal cell carcinoma (childhood epithelioid) E,M TFEB ALPHA renal cell carcin oma (childhood epithelioid), lung E MALAT1 TFEB retinoblastoma, AML, APL (translocation) BCOR RARA salivary adenoma E LIFR PLAG1 salivary adenoma E PLAG1 TCEA1, LIFR, CTNNB1, CHCHD7 salivary adenoma E TCEA1 PLAG1 salivary gland adenoma E CHCHD7 PLAG1 salivary gland mucoepidermoid E CRTC3 MAML2 salivary gland mucoepidermoid E MAML2 MECT1, CRTC3 salivary gland mucoepidermoid E MECT1 MAML2 sarcoma M POU5F1 EWSR1 soft tissue sarcoma M DUX4 CIC synovial sarcoma M SS18 SSX1, SSX2 synovial sarcoma M SS18L1 SSX1 synovial sarcoma M SSX1 SS18 synovial sarcoma M SSX2 SS18 synovial sarcoma M SSX4 SS18 T cell prolymphocytic leukaemia L MTCP1 TRA@ T ALL L BCL11B TLX3 T ALL L LCK TRB@ T ALL L LMO2 TRD@ T ALL L LYL1 TRB@ T ALL L OLIG2 TRA@ T ALL L RA P1GDS1 NUP98 T ALL L SIL TAL1 T ALL L TAL2 TRB@ T ALL L TCL6 TRA@ T ALL L TLX1 TRB@, TRD@ T ALL L TLX3 BCL11B T ALL L TRA@ ATL,OLIG2, MYC, TCL1A, TCL6, MTCP1, TCL6 T ALL L TRB@ HOX11, LCK, NOTCH1, TAL2, LYL1 T ALL L NOTCH1 TRB@ TALL, AML, L PICAL M MLLT10, MLL T ALL, neuroblastoma L LMO1 TRD@ T cell leukaemia L TRD@ TAL1, HOX11, TLX1, LMO1, LMO2, RANBP17 T CLL L TCL1A TRA@ uterine leiomyoma M COX6C HMGA2 Wilms tumour O GPC3 Extract from COSMIC cancer gene census as of Feb, 2014. http://ca ncer.sanger.ac.uk/cancergenome/projects/census

PAGE 36

36 Table 1 3. WHO classification for epithelial salivary gland tumors (as of 2005). Malignant epithelial tumors Benign epithelial tumors Acinic cell carcinoma Pleomorphic adenoma Mucoepidermoid carcino ma Myoepithelioma Adenoid cystic carcinoma Basal cell adenoma Polymorphous low grade adenocarcinoma Warthin tumor Epithelial myoepithelial carcinoma Oncocytoma Clear cell carcinoma, not otherwise specified Canalicular adenoma Basal cell aden ocarcinoma Sebaceous adenoma Malignant sebaceous tumors Lymphadenoma Cystadenocarcinoma Ductal papilloma Low grade cribriform cystadenocarcinoma Cystadenoma Mucinous adenocarcinoma Oncocytic carcinoma Salivary duct carcinoma Adenocarci noma, not otherwise specified Myoepithelial carcinoma Carcinoma ex pleomorphic adenoma Carcinosarcoma Metastasizing pleomorphic adenoma Squamous cell carcinoma Small cell carcinoma Large cell carcinoma Lymphoepithelial carcinoma Sialoblastoma

PAGE 37

37 Table 1 4 MYB NFIB fusion variants found in ACC tumors. Variant MYB NFIB exon fusion 1 MYB exon 8a NFIB exon 12 2 MYB exon 8b NFIB exon 11 3 MYB exon 8b NFIB exon 12 4 MYB exon 9b NFIB exon 11 5 MYB exon 9b NFIB exon 1 2 6 MYB exon 11 NFIB exon 12 7 MYB exon 13 8 MYB exon 13 NFIB exon 11 9 MYB exon 13 NFIB exon 12 10 MYB exon 14 NFIB exon 12 11 MYB exon 15 NFIB exon 11 12 MYB exon 15 NFIB exon 12 13 MYB exon 15 F1) 14 MYB exon 15 F2) 15 MYB exon 16 NFIB exon 12

PAGE 38

38 Figure 1 1. Illustration of CRTC1 MAML2 fusion gene in MECs. Exon1 of CRTC1 (a.k.a. MECT1 or TORC1) encoding for 42 amino acids that retain intact CREB binding domain was fuse d to MAML2 exon 2 5 encoding for 981 amino acids. The CRTC1 MAML2 fusion gene thus becomes an independent NOTCH pathway activator.

PAGE 39

39 Figure 1 2. Illustration of MYB NFIB fusion transcript in ACC.

PAGE 40

40 CHAPTER 2 IDENTIFICATION OF HAPLN1/VCAN COMPLEX AS MYB I NDEPENDENT THERAPEUTIC TARGETS FOR ADENOID CYSTIC CANCER Introduction Although malignant epithelial salivary gland tumors (SGTs) represent a large heterogeneous group of tumors [ 95 ] the major subtypes are adenoid cystic cancer (ACC), mucoepidermoid carcinomas (MEC), and adenocarcinoma (ADC) no t otherwise specified. Each of these tumors ha s no effective systemic treatments for patients who present with un resect able disease and, until recently, there was little insight into SGT biology and the molecular basis for tumorigenesis. In 2003, a no vel fusion oncogene, CRTC1 MAML2, was isolated from a recurrent t(11;19) translocation in MEC [ 53 ] This work subsequently led to the discovery of a new CREB co a ctivator gene family, CRTC1 3, that is regulated by the Peutz Jegher LKB1 kinase [ 51 91 92 ] proposing a direct link between anabolic metabolism and salivary gland tumorigenesis. MEC research efforts were greatly facilitated by the availability of human tumor cell lines that allowed mapping chromosomal breakpoints and isolation of the etiologic fusion oncogene. In contrast, the molecular characterization of a recurr ent t(6;9) rearrangement in ACC was delayed by many years due to lack of human ACC tumor cell lines until 2009 when the MYB NFIB fusion oncogene was finall y isolated from short term cultures of ACC surgical biopsies [ 55 ] While MEC tumors are often successfully managed by wide surgical resections with rare late meta stases, ACC is a particularly aggressive subtype of SGT that frequently recurs with incurable metastatic disease after surgical resection. Therefore, the identification of a recurrent MYB fusion event in ACC tumorigenesis provides an important clue to pur sue new therapeutic

PAGE 41

41 strategies. MYB is a nuclear transcription factor that plays an essential role in development and homeostasis of hematopoiesis [ 96 ] In addition, MYB has been suggested to play a role in the development of selected glandular tissues including colon [ 61 ] and breast [ 97 ] In human disease, a tandem duplication of the MYB gene was detected in a subset of human T cell acute lymphoblastic leukemia (T ALL) [ 98 ] and over expression of MYB is associated with leukemia [ 99 ] breast and colorec tal cancers [ 61 ] Ectopic expression of MYB, however, has shown limited in vitro transforming activity that is largely restricted to hematopoietic animal model systems. Therefore, the identification of a recurrent M YB:NFIB translocation in ACC offers an important opportunity to study MYB biology in a defined epithelial human cancer model system. Recently, two studies reported exome sequencing data looking for somatic alterations in ACC tumor samples [ 93 94 ] Aside from the MYB NFIB fusion that was present in about half of cases, the mutational landscapes reported by these t wo groups had few overlaps, indicating uncertainty regarding the role of potential cooperating driver mutations. This confirms the importance of MYB activation but raises many questions regarding downstream MYB signaling events in ACC tumorigenesis that might identify new therapeutic targets for patients with advanced disease. To study ACC biology we have now performed an unbiased global mRNA and miRNA analysis expression as well as mature microRNA array studies for a collection of ACC patient tissues. We compared ACC tumors to their matched normal tissues as well as to MEC and ADC. We also analyzed the difference between MYB NFIB fusion positive and fusion negative tumors to discover whether there exists a distinct tumor activation mechanism that is diffe rentiated by MYB NFIB fusion status. We also

PAGE 42

42 downloaded gene expression array data of ACC with low to undetectable MYB levels from public database and compared them to high MYB ACC samples. Our analysis confirmed that MYB is the key event for ACC tumorige nesis that was significantly up regulated ACC and its target genes were involved in the main affected pathways and biological processes in ACC. No significant changes were found between MYB NFIB fusion positive and fusion negative tumors. However, we found a unique extracellular matrix signature that was elevated in ACC regardless of MYB status, which suggests the importance roles of these altered extracellular matrix ( ECM ) components. Our researches therefore provide important clues for understanding the m echanisms as well as novel therapeutic targets for this lethal disease. Materials and Methods RNA extraction, quality control and quantification A total of 74 Salivary Gland Tumors including 24 ACC (Table 2 1) 28 MEC and 22 ADC samples were exercised from human patients under approved IRB protocol and total RNAs were extracted from fresh frozen tissues using RNAqueous RNA extraction kit (Ambion) in collaboration with Dr Adel El Naggar from MD Anderson Cancer Center. The quantity of RNA samples were deter mined by using NanodropTM 8000 (ThermoFisher Scientific, Waltham, MA). RNA quality control analysis was conducted using Agilent 2100 Bioanalyzer with an RNA 6000 Nano Labchip (Agilent Technologies, Santa Clara, CA) by University of Florida Interdisciplina ry Biotechnology Research Center (ICBR) Genomics Core. Only RNA samples with an average RNA integrity number (RIN) greater than 8 were subjected to microarray analysis.

PAGE 43

43 Microarray preparation and data analysis Microarray sample preparation, labeling and hybridization were performed by following the manufactures instructions (Affymetrix GeneChip human gene 1.0_ST and miRNA GeneChip 1.0) in collaboration with Dr Henery Baker laboratory at University of Florida. Quality control, data normalization and transf ormation were conducted with Affymetrix Expression Console TM (EC) using the robust multichip average (RMA) algorithm [ 100 101 ] and quantile normalization methods followed by a log2 transformation of the intensities. ormalized data were analyzed using SAS JMP Genomics software (SAS Institute). Only well annotated probe sets were used for all analysis. Both b aseline filter (intensity >=50) and fold change variation filter (|fold change|>=2) were applied before differential expression analysis. Low level analysis was performed for microRNA chip data with Affymetrix Expression Console TM (EC) using RMA log2 trans formation. Both baseline filter (intensity >=800) and fold change variation filter (|fold change|>=2) were applied for microRNA chip analysis. Both unsupervised and supervised 2 way ward hierarchical clustering analysis was performed for all samples inclu ding 3 tumor types and their matched normal samples. Paired t tests were performed to compare tumor samples to their matched normal tissues. FDR was set at 0.05 using the [ 102 ] For the comparison between MYB NFIB fusion positive and fusion negative tumors, a mixe d model ANOVA analysis were performed. The list of probe sets that exhibit significant changes in expression were subjected to IPA (Ingenuity IPA, Redwood City, CA ) pathway analysis to determine possible signaling pathways that may act on the initiation of ACC tumorigenesis. The significant probe sets were also be submitted to Expression Analysis Systematic

PAGE 44

44 Explorer (EASE) though the NIH DAVID bioinformatics Resources [ 103 ] to determine correlations of differentially expressed genes with tumorigenesis of ACC. MYB interaction genes were extracted f rom IPA interactions. And MYB target gene list was downloaded from public ChIP Seq data base that listed all genes having significant MYB binding sites in their promoters [ 104 ] Quali t y Control Affymerix GeneChip Human Gene 1.0 ST Array contains hundreds of control probes and control spikes. Positive controls are probes against over 100 housekeeping gene exons and negative controls are those corresponding to th e intro regions. Pos_vs_neg_AUC mat r ix compares signal values for the positive controls to the negative controls. An AUC value of 1 reflects perfect separation between positive and negative controls whereas a value of 0.5 would reflect no separation. pm_m ean matrix plots the mean of the raw intensity for all the PM( perfect match) probes on the array prior to any intensity transformations or data normalization steps. Labeling quality control is an active area of research and a lack of rank order raises que stions about the interpretation of data. In general, several genes from B.Subtilis were put into cloning plasmids and transcribed with polyA in vitro and then mixed into the total sample as spikes with different quantity for each spikes. The expected rank orders of the polyA RNA spikes: Lys
PAGE 45

45 qRT PCR, western blot, and antibodies Reverse transcription and amplification of cDNA was performed in the 7900 HT Fast (Applied Biosystems) system by following manufacture instruction using High Capacity cDNA Reverse Transcription Kits (Applied Biosystems) and TaqMan Fast Universal PCR Master Mix (Applied Biosystems). All gene expres sion probes were commercially purchased (Applied Biosystems). Relative expression of target gene was calculated in comparison to 18s rRNA values. Quantitative miRNA RT PCR analysis was performed by following procedures described in [ 105 ] Cells pellet was lysed in RIPA buffer (Boston Bioproducts) and subjected to SDS polyacrylamide (PAGE) tris g lycine gel separation (Invitrogen). And the membrane transfer was performed using iBlot 7 Minute Blotting System (Invitrogen) following the then incubated with primary antibodies for 1 hour at room temperature. After washed with PBS, the mem brane was incubated with a horseradish peroxidase conjugated secondary antibody for 45 minutes at room temperature. Protein bands were visualized with chemiluminescence (Pierce). Antibody against the N terminus of MYB was purchased from Abcam (Anti v Myb + c Myb antibody, EP769Y). C terminus MYB antibody was purchased from Santa Cruz (c Myb Antibody (C 19) sc 517) Xenograft Tumor Growth A total of 810 6 cells were washed with PBS twice, mixed with 50l cold MatrigelTM (BD Sciences) and subjected to subc utaneous flank injection into NOD.SCID mice (The Jackson Laboratory). 22 gauge needles were used for injection.

PAGE 46

46 Results of C hapter 2 A unique mRNA gene signature distinguishes ACC from other salivary gland tumors. To define a diagnostic adenoid cystic ca ncer ( ACC ) gene signature and to identify new therapeutic targets, we performed global mRNA and miRNA expression array analysis for 12 ACC tumors and matched adjacent normal samples. We also compared ACC to 14 mucoepidermoid cancers (MEC) and 11 salivary a denocarcinomas (ADC). To discover whether ACC has specific molecular expression patterns, we performed both supervised and unsupervised clustering analysis for all tumor samples and their matched normal tissues. For the array analysis, only samples with hi gh RNA integrity (RIN >8) were sent for array analysis and all array samples passed the quality controls ( Figure 2 1 ).The data shows ACC has a unique mRNA signature that easily separates adjacent normal tissues from tumor samples (Figure 2 2 ). We found 11 60 genes were differentially expressed in ACC as compared to matched normal tissues by using paired t tests ( Figure 2 2 FDR=0.05, Appendix A) Although we were able to detect a secondary cluster across tumors and normal tissues that suggest a minor signat ure contribution of the specific tissue of origin (major vs minor salivary glands), the striking finding was a distinct ACC signature regardless of tissue of origin (Figure 2 2 ). This homogeneity suggests a core mutational signaling pathway for ACC. We re alized this observation by detecting no difference in the mRNA signature of normal matched tissue across ACC, MEC, and ADC (date not shown), but marked difference between ACC as compared to MEC and ADC. Although ACC is characterized by a recurrent chromoso mal translocation involving MYB NFIB, we and other have detected fusion negative tumors in 20 40% of ACC samples. To test if MYB

PAGE 47

47 fusion negative ACC tumors exhibit a different biology, we pre selected 6 fusion positive and 6 fusion negative ACC using RT PC R method for analysis. However, we did not detect significant difference between MYB NFIB fusion positive and fusion negative samples ( Figure 2 2, 2 5 ANOVA FDR=0.05). MYB is the top ranking biomarker that distinguishes ACC from MEC and ADC Our data indic ates MYB was the top differentially expressed gene in ACC between both ACC and matched normal tissue as well as ACC and MEC/ADC tumor samples (Figure 2 3 A 2 3B and 2 6A, Appendix A ). We confirmed this by qRT PCR in the same set of ACC samples and by weste rn bl ot in separate ACC tissues (Figure 2 3 C and data not shown). Other ACC activation markers, for instance, c KIT, a tyrosine kinase which was mutated in ACC and considered as ACC markers [ 106 107 ] was also significantly up regulated in ACC by 5 fold changes according to our results; and FGFR1 (fibroblast growth factor receptor 1) [ 108 ] which participate in MAPK cascades and is considered as therapeutic targets by current clinical trials was found about 3.7 up regulated. The detection of MYB as the top differentially activated gene in an unbiased global screen confirms the accuracy of our data collection and methodology We th e n applied an unbiased analysis using IPA pathways which allow us to organize our data into cancer pathways (Fig ure 2 3 D). Interestingly, most of genes altered in th e affected pathways are found to be either known MYB target genes or MYB interaction genes (Fig ure 2 3 D). A striking feature was the detection of elevated levels of inter nested protein that localize to the extracellular space (Figure 2 7D) Exon array an alysis is a sensitive tool to identify MYB C terminal re arrangement The most recent papers on the whole exome sequencing results for a large collection of ACC tumor samples indicated the lack of potential driver mutations except

PAGE 48

48 that MYB NFIB fusion was fo und in at least half of the ACCs in both groups of samples [ 93 94 ] This confirms the importance of MYB or MYB NFIB activation for ACC tumorigenesis or progressions. Unexpectedly, our data observed no significant difference between fusion positive and fusion negative ACC tumors. The homogeneity of the ACC signature suggests several alternative mechanisms: i) the p resence of variant or cryptic MYB fusion events that w ere not detected in our samples. Ii) an alternate non fusion mechanism to activate MYB, or iii) activation of an alternate gene or gene pathway that mimics activated MYB signaling. To test this, we re a nalyzed the expression status of MYB C terminal exons using the exon array approach. In general, the Genechip human gene ST 1.0 array platform has multiple probes covering most the expression of each exon of MYB except exon 10 that was not present in ACC tumors: the average probe set intensities drop immediately after the breakpoints in MYB NFIB fusion positive samples, whereas, the fusion negative samples have consistent intens diversified MYB fusion status (Fig ure 2 4 tumors, which were then validated by FISH in collaboration with MD Anderson Cancer Center. However, we still did not observe significant differences between MYB fusion positive and fusion negative tumors even after this fusion status correction ( Figure 2 5 ). Additionally, we observed some weak MYB exon expressions after the breakpoints in MYB NFIB fusion positive samples, which indicate the existence of a wt MYB allele expressed in fusion positive samples (Fig ure 2 4B segments of MYB are highly expressed in both MYB NFIB fusion positive and fusion

PAGE 49

49 negative tumors, which im ply the main of outcome of this fusion event is to enhance the MYB activation. Integrative analysis identifies extracellular matrix signature in ACC By merging to the public MYB target genes obtained through ChIP Seq with MYB antibodies [ 104 ] we found that about half ACC signature are MYB related genes. About 30 % of the top scoring signatures are components of extracellular matrices including HAPLN1/VCAN Inte restingly, we observed that the ACC signature was still retained in one ACC with very low MYB expression. To investigate potential MYB independent networks, we obtained additional 3 ACC tumors with low to undetectable MYB by searching public gene array dat abase (GSE28996 [ 109 ] ). Analysis of these samples confirmed a unique family of extracellular matrix component genes is up regulated regardless of MYB fusion and expression conditions (Fig ure 2 7A, 2 7B and 2 7D ). Integration of ACC signature to two recently published whole exome sequencing studies on a total of 84 ACCs identifies RUNX1 and NOTCH1 as the only two overlapping genes that were both mutated with eleva ted expression [ 93 94 ] RUNX1 is a MYB binding protein having at least three binding sites upstream of human HA PLN1 (Figure 2 7 C); this suggests RUNX1 could participate as a co activator of MYB for ECM components in ACC tumorigenesis. Global miRNA signature distinguishes ACC from normal salivary gland tissues microRNA (miRNAs) are a class of 18 24 nucleotides smal l non coding RNAs, which can negatively regulate their target genes [ 64 ] by either complementary binding to RNA sequence to decrease the mRNA stability and lead to degradation of target gene To test the potential involvement of miRNAs in the tumorigenesis of ACC, we also performed a miRNA chip analysis for

PAGE 50

50 the same collection of ACC samples. We extracted a tota l of 847 probe sets with each probe set representing one human mature miRNA seed. Similar to the whole transcriptome mRNA expression array analysis, we detected a clear separation of ACC miRNA profile (22 miRNA signature, Figure 2 8B Table 2 2 ) from their matched normal samples (Fig ure 2 8 A), while no significant difference between MYB NFIB fusion positive and n egative samples. This is consistent with previous studied performed for a larger collection of ACCs. Additionally, matching the global miRNA expre ssion atlas to mRNA gene expression profile confirms the importance of ECM components. For example, the HAPLN1 inhibitory hsa miR 29 was down regulated about 2.5 fold (Fig ure 2 8C ). The MYB inhibitory has miR 150 was down regulated while MYB is up regulate d. Discussion and C onclusions Since there is no curative strategy available for this rare but lethal disease, it is especially urgent to define the underlying key driving event and to search for promising therapeutic targets to provide new hope for patient s. Our whole transcriptome gene expression study found that MYB is the top regulated genes and its target genes are involved in biological processes in ACC, which implies that MYB activation is the main event underlying this malignancy. Since MYB is a tran scriptional factor that could potentially regulate thousands of genes necessary for normal cell fucntions MYB itself may not be an ideal target The more selective downstream MYB target genes that we identified, however, could be considered as new therape utic targets including VCAN, ITGA and CCTNB1. We also identified 20 ACC candidate gene targets that are potentially druggable with currently marketed medications (Figure 2 6B). KIT and FGFR1are the gene that have already been tested in clinical trials for ACC [ 108 110 111 ] ; however, those current trials sho wed little or no benefit by targeting against c KIT

PAGE 51

51 or EGFR and clinical trials on FGFR are still ongoing. Since both KIT and FGFR are found significantly up regulated in ACC, we might also propose that mAb therapy could be beneficial by removing the abund ant over expressed proteins as opposed to use of small molecule tyrosine kinase inhibitors that may work better for mutant kinases We found about 30% of the top ranking up regulated genes were located in the extracellular space. Further analysis on thes e genes identified an important extracellular matrx (ECM) component, the HAPLN1/VCAN complex (Figure 2 9) HAPLN1 is a hyaluronan and proteoglycan linked protein; also known as cartilage link protein, CRTL1 or link protein comprised of 354 Aa. HAPLN1 can form hyaluronan rich environment through its binding ability using the duplicate LINK domains, thus promoting tumor growth and angiogenesis by recruiting inflammatory cells with cytokines and chemokines [ 112 ] On the other hand, HAPLN1 can also binds to VCAN thus activating many signaling pathways including the epidermal growth factor receptor like growth factor receptor (IGFIR) and others [ 113 114 ] The protumorigneic role of HAPLN1/VCAN complex has been tested in several other tumor types, m alignant pleural mesothelioma [ 112 ] breast and prostate cancers [ 115 ] And i ncreased VCAN expression level was observed in a diversity of human tumors [ 116 120 ] Th is suggests new therapeutic strategies can be devel oped to target this important ECM complex Unexpectedly, we also detected one case of ACC in our sample that has no MYB expression while retain ing the global gene expression profile (Figure 2 2A and 2 2B ). This implies that there might be a separate mechan ism for ACC activation that is either independent of or complementary to MYB activation. We therefore searched public

PAGE 52

52 database and found additional three cases of ACC had low to undetectable MYB expression. Analysis on these samples allowed us identify bo th MYB dependent and MYB independent ACC signatures. Interestingly, the ECM components are also independent of MYB status. Integrative analysis suggests RUNX1, a MYB binding oncogenes [ 121 122 ] could function as a complementary mechanism for MYB pathway activation. On the other hand, t he down regulated genes in ACC could also be important per therapeutics [ 123 ] ; down regulated SMR3B was a potential interesting marker that is also found deleted by whole exome sequencing by the two separate research institutes [ 93 94 ] We also performed global microRNA chip studies for ACC and found ACC has distinct microRNA profile that separat e ACC from matched normal tissues while MYB NFIB fusion position and fusion negative samples were not separated. The miR 150 was detected as one of the three top down regulated miRNAs in ACC tumor samples compared to their matched normal. The repression of miR 150 was shown to be strongly associated with the activation of MYB in ACC but not in MEC or ADC. H owever, the miR 150 expression was repressed similarly in MYB NFIB fusion positive n of miR 150 possible can activate other targets genes, for instance, the SMARCD1 (Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1) gene (TargerScan, PicTar) was also significantly up regulated in ACC, which may potentially serve as complementary mechanism for MYB activation. Besides miR 150, the miR 375 and miR 31 are the top two repressed genes in ACC. Accumulating data shows that miR 375 is a tumor suppressor, which is reported to

PAGE 53

53 regulate t he hypoxia induced autophagy in human liver cancers [ 28 ] or sensitize the cells to TNF alpha) induced apoptosis in head and neck carcinomas [ 124 ] miR 31 is another known tumor related miRNA involved in distinct human cancers [ 125 127 ] This suggests that miR 375 and miR 31may be used as common miRNAs maker for general tumor diagnosis. Matched microRNA profile with ACC gene signature suggests that m icro RNAs may also participated in HAPLN1/VCAN regulations (Figure 2 8 and 2 10 TargetScan, PicTar ). In summary, we studied both global mRNA and miRNA expression profiles for human ACC patient samples and identified a distinct mRNA signature (1160 genes) and miRNA signature (22 miRNAs) that separate ACC from matched normal tissues and MEC or ADC. While MYB NFIB is the driving force for ACC, we did not detect significant difference between MYB NFIB fusion positive tumors and fusion negative tumors. This sug gests the main outcome of this novel fusion event is to activation MYB pathways in ACC. Unexpectedly, we detected 4 tumors (1/12 of our cases and three from public databases) with undetectable MYB that still retained the distinct ACC mRNA signature includi ng over expression of a network of extracellular matrix (ECM) components. Integration of our ACC signature with somatic mutational analysis suggests that RUNX1, a MYB binding oncogene, participates in ACC tumorigenesis to activate ECM elements including HAPLN1/VCAN. To conclude, we show that the ACC signature arises from MYB dependent and independent signals and identify VCAN/HAPLN1 ECM complexes as new druggable targets.

PAGE 54

54 Table 2 1. Sample information of 24 ACC patient tissues Sample n ame Tissue t yp e Myb Nfib f usion s tatus 405B4TM Tumor Negative 462F2TM Tumor Negative 471E7TM Tumor Negative 485F1TM Tumor Negative 519B2TM Tumor Negative 526B5TM Tumor Negative 364A7TP Tumor Positive 155E6TP Tumor Positive 563G7TP Tumor Positive 605D3TP Tumor Positive 489C6TP Tumor Positive 498B4TP Tumor Positive 405B3NM Normal Negative 462F1NM Normal Negative 471E6NM Normal Negative 485E7NM Normal Negative 519B8NM Normal Negative 526B4NM Normal Negative 364A1NP Normal Positive 155E4NP Normal Positive 563G4NP Normal Positive 605D1NP Normal Positive 489C5NP Normal Positive 498E2NP Normal Positive

PAGE 55

55 Table 2 2. 22 Significant miRNAs in human ACC. Probeset id P value A vg t umor A vg n ormal Fold change of tumor to normal hsa miR 375_st 0.0019 141.5 2 246.3 15.9 hsa miR 31_st 0.0014 166.6 1595.7 9.6 hsa miR 150_st 0.0036 157.4 932.0 5.9 hsa miR 152_st 0.0011 360.8 1091.2 3.0 hsa miR 214_st 0.0254 1110.2 2843.3 2.6 hsa miR 29a_st 0.0001 703.1 1775.7 2.5 hsa miR 126_st 0.0000 1107.0 2601.3 2. 3 hsa miR 140 3p_st 0.0004 1495.8 3500.5 2.3 hsa miR 199b 3p_st 0.0382 818.9 1736.1 2.1 hsa miR 923_st 0.0010 2063.4 4337.1 2.1 hsa miR 199a 3p_st 0.0382 851.2 1730.1 2.0 hsa miR 652_st 0.0043 857.6 367.9 2.3 hsa miR 130a_st 0.0000 1506.2 618.4 2 .4 hsa miR 93_st 0.0000 6382.9 2530.1 2.5 hsa miR 182_st 0.0001 2689.9 1048.5 2.6 hsa miR 181a_st 0.0000 5502.4 1984.0 2.8 hsa miR 106b_st 0.0000 3972.5 1422.5 2.8 hsa miR 146a_st 0.0031 2791.2 979.5 2.8 hsa miR 25_st 0.0001 1687.7 533.7 3.2 hsa miR 744_st 0.0093 820.3 250.3 3.3 hsa miR 181b_st 0.0004 2799.3 597.0 4.7 hsa miR 455 3p_st 0.0000 7361.8 549.1 13.4

PAGE 56

56 Figure 2 1. Quality control matrix plots. A) Pos_vs_neg_AUC matix compares signal values for the positive controls to the negative con trols. Value >0.8 represents a good quality. B) Matrix testing sample quality. No extreme values were observed. C) Labeling quality control. The expected rank orders of the polyA RNA spikes: Lys
PAGE 57

57 Figure 2 2. A unique mRNA gene signature distinguishes ACC from matched normal salivary gland tissue. A) Unsupervised hierarchical 2 way ward clustering for ACC using all annotated 28,0 54 probe sets. B) Supervised clustering using 1160 mRNA genes that were significantly expressed in ACC (two sides paired test, FDR=0.05). C) Principle component analysis (PCA) for all 24 samples. Red and green balls indicate fusion positive and negative tumors respectively. Blue and brown indicate their matched normal tissues. D) Volcano plot for all 28,054 probe sets followed ANOVA analysis (FDR=0.05).

PAGE 58

58 Figure 2 3. MYB is the top ranking biomarker that distinguishes ACC from MEC and ADC. A) Average intensities of MYB probe sets for 37 salivary gland tumors test, two side p value<0.0001). B) MYB intensity in ACC by each sample. C) qPCR validation of MYB mRNA expression in ACC tumors(***, test, two side p value<0.0001). D) MYB centered networks in ACC. Inner layer, MYB regulating genes defined by published ChIP Seq data.

PAGE 59

59 Figure 2 4. Exon array analysis is a sensitive tool to identify MYB C terminal rearrangement. A) Illustrations of MYB protein structure and MYB NFIB fusion events in ACC. B) MYB exon intensity plot for 12 ACC tumor samples.

PAGE 60

60 Figure 2 5. Comparison between MYB NFIB fusion po sitive and fusion negative ACCs. A) MYB exon plot detected a fusion negative tumor did not have MYB breakpoints caused by gene fusion events. B) and C) Volcano plot of significance levels against log2 gene difference between tumors and matched normal samples before and after fusion status correction respectively (FDR=0.05).

PAGE 61

61 Figure 2 6. Top ranking genes selected for therapeutic screening. A) Top genes that are significantly alte red in ACC. B) Fold changes and location of significant genes that could be targeted by current market medications.

PAGE 62

62

PAGE 63

63 Figure 2 7. Reanalysis of published gene expression arrays and integration of whole exome mutational datasets. A)Top genes identified in MYB activated ACC and no MYB ACC. MYB dependent genes were defined by published ChIP Seq data. B) Reanalysis of 9 ACC tumors and 3 normal samples downloaded from gene expression array database. C)Integrative analysis of ACC gene signature to published A CC whole exome sequencing data. D) Top scoring genes that are components of ECM. Figure 2 8. Global gene signature distinguishes ACC from matched normal salivary gland tissue. A) Unsupervised hierarchical 2 way ward clustering for ACC using 847 mature miRNA seed probes. B) Supervised clustering using 22 miRNA seed probes that were significantly expressed in ACC (two sides test, FDR=0.05). C) Regulatory miRNA target predictions.

PAGE 64

64 Figure 2 9. Illustration of the HAPLN1/VCAN interacti on and the roles of HAPLN1/VCAN complex in cell proliferation, signaling pathway and tumorigenesis.

PAGE 65

65 Figure 2 10. Demonstration of molecular regulatory networks of HAPLN1/VCAN complex in human ACC. MYB or MYB/RUNX1 could participate in regulating the HAPLN1/VCAN complex directly by their transcriptional activity or through regulations on the Wnt signalling.

PAGE 66

66 CHAPTER 3 MYB NFIB FUSION ONCOPROTEIN : A NOVEL APPROACH FOR MYB ACTIVATION IN HUMAN ADENOID CYSTIC CANCER Background c MYB protein is the norm al cellular counterpart to v MYB, a transforming protein expressed by two avian leukemia viruses (avian myeloblastosis virus and E26 retrovirus). MYB transcription factor plays an essential role in the development and homeostasis of the bone marrow [ 128 ] as well as several glandular tissues including colon [ 61 ] a nd breast [ 97 ] Over expression of MYB genes is associated with human leukemia [ 60 ] breast and colorectal cancers [ 61 ] which suggest that alterations in MYB expression might be associated with regulatin g cell lineage destiny. In addition, the tandem duplication of the myb gene was uncovered in human T cell acute lymphoblastic leukemia (T ALL) [ 62 ] This suggests important roles of MYB in human tumorigenicity. The transforming activity of oncogene v myb has been verified in hematopoietic cells [ 129 130 ] and hamster emb ryo fib r o blasts [ 131 ] However, wt MYB has weak transforming activity when tested in NIH/3T3, RK3E and REF cells by using the colony formation assays [ 132 ] Ectopic expression of MYB is largely restricted to hematopoietic animal tumor model systems. Recently, the t(6;9)(q22 23;p23 24) chromosomal translocation was c haracterized in at least half of the a denoid cystic carcinoma (ACC) tissue by either FISH, RT PCR or Genomic sequencing approaches [ 55 56 ] The translocation event generated a recurrent fusion gene MYB NFIB thus providing important opportunities for studying the MYB biology in human epithelial cancer system and developing potential therapeutic strategies for this lethal malignancy [ 55 ]

PAGE 67

67 The MYB transcriptional factor contains three major domains including the N terminal DNA binding domain (DBD), the transactivation domain (TAD) and the C terminal negative regulatory domain (NRD) [ 133 ] The NRD contains a leucine zipper motif/he ptad leucine repeats, which might negatively regulate MYB activity by control MYB stability [ 134 ] protein protein interactions [ 135 ] an d intra molecular interactions [ 136 ] It has been indicated that DBD and TAD are important for the transforming activity of oncogene v myb, an N and C terminal tru ncated mutant of MYB, of which the DBD and NRD domains are interrupted [ 137 139 ] C terminal truncated MYB was suggested to increased MYB levels by escaping ubiquitin degradation pathway that targets its C terminal elements [ 134 ] Notably, the MYB gene is trimmed most commonly in the last exons in fusion positive ACC sa mples as a result of MYB:NFIB translocation event [ 55 57 ] This terminal MYB region encodes no known domains o r functional regions. In addition, MYB is reported to be repressed by hsa miR 150 in both leukemic and breast cancer cell lines as well as by hsa miR 15a/16 binding in primary ACC cells and hematopoietic cells [ 140 143 ] Therefore, we need to test whether UTR has major effect on the tumorigenesis initiation in the adenoid cystic cancer. The terminal exon of NFIB encodes only for a small peptide se quence of five amino acids (SWYLG), which is highly conserved within NFI family. Grnder et al [ 63 ] indicated that this sequence resembled the CTD (C terminal dom ain) of the largest subunit of RNA pol y merase II which can generate a physical bridge between RNA transcription complex and the pre mRNA processing complex through the CTD tail protein protein interactions [ 63 ] Furthermore, the same terminal exon of NFIB is found

PAGE 68

68 to be fused with HMGA2 (a.k.a. HMGIC) in both pleomorphic adenomas [ 40 ] and lipoma [ 41 ] which implied that terminal exon of NFIB might function as a translocation partner corresponding to its protein protein intera ction potentials. In addition NFIB was also suggested as a potential oncogene in small cell lung cancer (SCLC) as it is found frequently amplified through genome sequencing analysis [ 144 ] Therefore we predict the terminal NFIB exon may also play an important role in ACC tumorigenesis. I have performed global gene profile studies for a large collection of salivary gland tumors which reveals ACC has distinct gene signature that separates ACC from mucoepidermoid cancer (MEC), adenocarcin o ma (ADC) a nd matched normal samples. MYB was found as the top ranking activated gene signature and the center of molecular alterations in ACC. In addition, two recently published global genome sequencing results suggest that MYB NFIB is the only driving structure al teration in ACC [ 93 94 ] However, global gene expression microarray studies did not discover significant separa tions between MYB NFIB fusion positive and fusion negative ACC tumors. The functionality studies of this novel MYB NFIB fusion therefore will provide important clues for understanding of the translocation outcomes and MYB biology in this lethal human disea se. We therefore established effective functional assays to define the roles of MYB and MYB NFIB in ACC tumorigenesis to guide future studies and therapeutic strategies. In this research, we hypothesized that MYB:NFIB translocation offers a novel mechanis m for oncogene activation via deletion of regulatory terminal coding sequence We also propose that NFIB is an important tumorigenic factor for ACCs. We developed

PAGE 69

69 both in vitr o and in vivo functional assays to test the transforming activity of this novel MYB NFIB fusion gene in ACC. We also MYB to understand the role miRNA regulation on MYB activation by comparing the gene expression studied the role of the NFIB terminal exon to understand its contribution to the transforming activity of MYB NFIB fusion gene by comparing the functions of MYB NFIB to truncated MYB. There fore, our studies on the functional characteristics of MYB:NFIB translocation event in this important human malignancy has great significance and innovation for developing new treatment strategies. Methods and Materials Plasmid Construction cDNA of c Myb w as inserted inside the multiple cloning sites of vector pCMV Sport6 between sites KpnI and NheI. Different MYB /NFIB fragments were inserted into pAcGFP1N1 plasmid under the control of CMV promoter including the full length of MYB coding sequence with its the MYB NFIB fusion gene. Fragments were obtained through PCR approaches introducing restrictive enzyme sites NotI a nd KpnI. All constructs were validated by Sanger sequencing performed by ICBR core facility. The same sets of fragments were is too long for cloning construction, thus 3 co constructed.

PAGE 70

70 Cell Culture, Transfection, Virus Preparation and Stable Clone Selection NIH 3T3 cells were cultured in DMEM supplemented with 10% FBS and 1% pen/strep (Gibco). HEK293 cells were cultured in high glucose DMEM medium. RK3E cells were cultured in RPMI 1640 (Sigma) with 10% FBS and 1% pen/strep (Gibco). Salivary gland cells [ 145 146 ] were generous gift of Dr Stephen Hsu from Medical College of Geogia (Augusta, GA) and were cultured in K SFM medium supplemented with prequalified human recombinant Epidermal Growth Factor 1 53 (EGF 1 53) and Bovine Pituitary Extract (BPE) (Invitrogen). Defined Trypsin Inhibitor was also purchased from Invitrogen. Fugene 6 Lipofectin was used for transient transfection following the product instructions (Roche). For stable clone selection, neomycin (Gibco) was introduced after 48 hou rs of transfection. Retrovirus production and infection were performed using HEK293T cells following the protocols described in [ 147 ] Western blot Analysis an d Immunostaining Procedures Cells were harvested 48 hours after transient transfection. Lysate was made using RIPPA buffer with protease inhibitor cocktail (Sigma). Supernatant was subjected to SDS polyacrylamide (PAGE) tris glycine gel separation (Invit rogen). And the membrane transfer was performed using iBlot 7 Minute B lotting System (Invitrogen) overnight at 4C and then incubated with primary antibodies for 1 hour at room temperature. After washed with PBS, the membrane was incubated with a h orseradish peroxidase conjugated secondary antibody for 45 minutes at room temperature. Protein bands were visualized with chemiluminescence (Pierce).

PAGE 71

71 C ycloheximide B locking Assay Cells were seeded into 100mm dish and then were subjected to inhibition o f protein synthesis with 100 g/ml of cycloheximide ( Sigma ) for 10 min utes 20 min utes 30 min utes 60 min ut es 120 min ut es or no treatment as control. Cycloheximide treated cells were then harvested and subjected to SDS PAGE gel migration separation and western blot analysis. The relat ive protein levels were measured by using ImageJ [ 148 ] Soft agar Assay for Anchorage Independent Colony Formation and Foci Assay For base/bottom agar, 1.6% agar (DIFCO) and 0.4% peptone (DIFCO) were prepared with distilled water (GIBCO) and equilibrated in bead bath (Fisher Scientific Inc.) at 42 43C. 2xRPMI1640 (GIBCO) was supplemented with 40% FBS (GIBCO), 2% glutamine (GIBCO) and 2% P en S trep (GIBCO) and equilibrated to 42 43C. Agar/media mix was prepared by mixing equal volume of base agar and 2xmedium. 3 mls of the mix was poured into each 60mm tissue culture dish (Thermo Scientific, Nunc) and allowed for set evenly for at least one hour. Top agar was prepared with 0.8% Agar and 0.2% peptone and then mixed with 2xMedia. The top agar/media mix was equilibrated for at least 30 minutes at 42C .1x10 5 trypsinized cells were then re suspended in 3 mls of the mix and poured on top of the solidified base agar. Triplicates were set for each cell construc t. Agar plates were then put into incubator (Thermo Scientific) at 37C and 5% CO 2 for 3 weeks. And cells were feed once every week. Colonies were counted manually under microscope (10x). For foci formation assay, cells were seed into 100mm dishes, feed w eekly and then stained with Cry s tal violet after 2 3 weeks [ 149 ]

PAGE 72

72 Self suspension Viable Cell Growth One million cells were seeded into 6 well plates in day one, and then viable cells in the culture supernatant were counted with TrypanBlue (Gibco) staining. Unstained detached cells were washed twice with PBS and then reseed to 6 well plates. Luciferase Reporter Assay Luciferase report construct were described as in figure 3 5. The dual reporter reporter luciferase ass a y kit). Xenograft Tumor Growth Stable constructs of MYB NFIB expressing cells were injected into either nu/nu nude mice or SCID mice subcutaneously as described in C hapter 2 22 gauge needles were used for injection. The tumor volume was calculated as: Volume = (width) 2 x length/2 Results of C hapter 3 terminus increase MYB expression levels To test the functional roles of recurrent MYB NFIB fusion gene in human ACC tumorigenesis and define the func tional domains of thi s novel ch i meric gene product, we constructed multiple MYB /NFIB expression vectors harboring different cDNA fragments including i) M untranslated region (UTR) and full NFIB fusion lot experiment, using anti MYB immunoblotting, we detected the expected band sizes and migration pattern following transient transfection We also observed d MYB protein express ion in three

PAGE 73

73 salivary gland cells as w ell as NIH/3T3 cell, RK3E cells, and HEK293 cells (Figure 3 1 and 3 6 UTR in most cells tested suggest ed a role for regulatory miRNA binding sites within eresting ly, we did not detect changes in MYB expression in salivary acinar cells (AC) or HEK293 cells ( Figure 3 6 ), which may suggest a role for differential miRNA expression patterns among different cell lineage types. We believe that the differential expression of MYB wt in different cells may provide some clues for the role and tissue specificity of MYB NFIB biology in human cancers. The C terminal truncated MYB and MYB NFIB fusion protein exhibited high er expression levels suggesting additional potential escape from possible ubiquitin targeting for degradation [ 134 ] This implies that removing both the MYB carboxyl UTR can rescue MYB from inhibition mechan isms. Additionally, we also observed that there are additional faster migrating bands exist in most cell lines which are specific MYB bands since vector controls do not have them (Figure 3 1 and Figure 3 6 ). Further, these proteins were expressed with cDN A fragments cloned into expression vectors, therefore they cannot be the splicing products of MYB. We then performed cascade cleavage sites prediction ( http://sunflower.kuicr.kyoto u.ac.jp ) for MYB, and found there are seve ral significant cleavage sites that could fit the size of bands observed in the experiments (Figure 3 1F). Further, these extra bands were detected by the N terminus MYB antibody and failed to be detected by the C terminus MYB antibody (data not shown), we therefore propose that the extra bands are N terminal MYB cleavage products.

PAGE 74

74 Deregulation of MYB hsa miR 150 participate in ACC tumorgenesis hsa miR 150 was previously reported to inhibit MYB expression in human B cells [ 140 ] as well as mouse megakaryocytes and UT7/thrombopoietin (TPO) cells and inhibition can be released by repressing the miRNA expression [ 150 ] Furthermore, the UTR of MYB was predicted to have at least two conserved hsa miR 150 binding sites (Figure 3 2). This suggests a potential role for repression of MYB miR 150 in the tumorigenesis for ACC. We then obtained additional two lucifer ase reporter plasmid with either UTR with double mutations of conserved hsa miR 150 target sites being attached to the end of lucifer ase coding sequence. Using these reporter plasmids, we observed the similar depression effect; deletion or mutation of the MY UTR release the inhibition of protein expression that lead to higher luciferase expression (Figure 3 2). Further, we performed global miRNA microarray analysis for a collection of human ACC tumor samples and their matched normal sample as previously d escribed in C hapter 2 The hsa miR 150 was found as the third top ranking down regulated miRNAs in ACC tumors compared to match normal tissues. And the deregulation of MYB by hsa miR 150 is only specific for ACC but not in MEC or ADC (Figure 3 2). segment participated ACC tumorigenesis by providing MYB NFIB fusion protein prolonged half life To study the role of the NFIB terminal exon, we tested the half life of MYB /NFIB proteins in stable expressing salivary gland myoepithelial (MC) cells using c ycloheximide blocking assay followed by western blot analysis. The experimental life

PAGE 75

75 between 30 minutes to one hour (Figure 3 1). However, MYB NFIB fusion protein showed a pro longed half life, which is about twice the half life of full length MYB. Recent studies show two additional variants of MYB NFIB, of which the (http://www.targetscan.org/) prediction r esults indicate its miRNA binding sites are focally distribution in three regions of NFIB 3 UTR correspondingly named as F1, F2 and F3 respectively. And the two MYB NFIB translocation breakpoints are located in F1 NF IB NFIB NFIB UTR decreased the fusion protein levels, whereas the last piece has less effect on the protein amoun t. This provides evidence for additional MYB NFIB activation mechanisms. Forced expression of MYB NFIB changed morphology of salivary gland cells To test the functional effects of MYB NFIB on salivary gland cells, we first confirmed protein expression of the expected ectopic gene products by immune blotting 3 formed clusters of cells loosely attaching to the culture surface which resembled tumor cell growth characteristics. And after 10 days of sitting, the foci constructs (Figure 3 3 E). Bes ides the tests performed in human salivary gland cells, we also isolated primary wt mouse salivary gland cells from FVB strain mice To generate immortalized normal primary mouse salivary cells, we introduced the replication deficient SV40

PAGE 76

76 genomic DNA into the primary cell cultures right after their isolation We then split the primary cells into 4 wells and then transfected with the MYB /NFIB expression constructs in pAcGFP1N1 vector. Interestingly, the similar altered morphology was observed; specificall y, the wells tran s attached clusters which were not detected after expression of 3 C). This similar observation from both mouse and human cells suggests N attachment cell growth and cell cluster formations. In the terms of tumor biology, this recurrent fusion gene may contribute to self dissociation, migration and metastasis of tumor cells. The effect of forced express ion of MYB NFIB on the plastic attaching behavior displayed pattern of cell growth When we seeded the cells into the culture containers, the cells initial ly get attached after one day incubation and then a proportion of the cells become detached from the culture surface. We therefore counted the viable cells in the supernatant and reseed ed the suspended cells into new fresh dishes, and found these cells were still viable and can attach to the new surface to begin a new cycle of growth (Fi gure 3 3 A, 3 3 suspension viability of salivary gland DC cells. Similar phenotype was observed in salivary gland MC cells (Figure 3 3 F) but not the AC cells, which emphasizes the cell spec ificity of this fusion gene functions. Since the rom with either full length MYB or vector control, I propose that the MYB:NFIB translocation event functions not only to remove the UTR, but also to attach a functional C terminal NFIB fragment to MYB, which might participate in tumor initiation of ACCs.

PAGE 77

77 The MYB NFIB fusion protein acquired transforming potential Prior work has showed that MYB transforming activity is largely restricted to hematopoietic c ells. It has negligible transforming activity when tested in NIH/3T3 cells, RK3E cells or REF cells by using standard foci formation assays (data not shown). Since the primary target of this fusion oncogene MYB NFIB is in salivary gland tissues and the dev elopment of a salivary gland transformation assay has never been tested before, we then performed in vitro transformation assay using immortalized primary salivary gland cells [ 145 ] We found that these salivary gland cell lines have low to undetectable endogenous MYB expression using both immunoblotting (Figure 3 1 and Figure 3 6 ) and qRT PCR methods (data not shown), which makes them appropriate to be used for M YB NFIB biological function assays. Based on the method previously described [ 151 ] we pooled stable transformants for each MYB /NFIB constructs and then seeded them into soft agar and scored for the colony formation under microscopy. We observed MYB NFIB stable transformants increas ed colony formation ability about ten times in 0.2% soft agar which is a parameter indicating the transforming abilities of tumor cells (Figure 3 4A, 3 t efficie ncy for soft agar colony formation, however, they only lead to minor effects when 3 4B, 3 4C, 3 4E, 3 4F). To further study the transforming potential of this novel fusion gene, we also pursued in vivo test s to verify the tumorigenic potential in SCID mice system. In preliminary experiments, we injected 8 million stable DC cells expressing MYB NFIB or the vector control into nu/nu nude mice, however, did not observe tumor growth for a 6 months period, which empha sizes the slowing growing features of this tumor type and

PAGE 78

78 possible weak transforming activity of this recurrent fusion gene. We then combined the injections with Matrigel and observed tumor growth in 5 months for the fusion constructs. Unexpectedly, a few controls also gave tumors, which possibly caused by the Matrigel and the large amount of cells or some mutations could be introduced during the stably selection of vector controls. However, tumor volumes formed by MYB NFIB fusion constructs were much big ger than the controls tested with three salivary gland cells using two separate vector systems (Figure 3 5A, 3 5B). Also it is notable that show any tumor growth during the 5 months periods after injection, which implies and emphasize t he role of NFIB as a partner of the MYB NFIB fusion oncoprotein. To examine the associations of the xenograft tumors with the fusion gene, we excised the xenograft tumors and performed primary cell cultures for each tumors formed. Interestingly, the xenog raft tumors have only N terminal cleavage forms of the MYB protein, while the full length MYB is present in primary cells cultured from these same tumors. Similar cleavage events were also observed in human ACC tumor and its primary cell cultures. This sug gests MYB may functions differently with a variety of cleavage products. MYB NFIB fusion gene has similar transcriptional activity as MYB Although MYB is a well known DNA binding transcription factor, its transcriptional mechanism and functional role are poorly understood [ 152 ] Identifying the target genes of MYB is an important goal to solve this problem, and to develop a strategy to find potential therapeutic tar gets for ACCs. One of the notable target genes is the proto oncogene c KIT which encodes a tyrosine kinase CD117, the stem cell growth factor receptor (SCFR) [ 153 154 ] Therefore, we tested and detected the KIT protein

PAGE 79

79 expression in stably selected MYB/NFIB expressing AC cells. We found the KIT mRNA expression follows the similar pattern of MYB using qRT PCR method, for example, KIT expression increased in MYB NFIB transformants that has higher levels of MYB expression and relatively low level of KIT when the cell express less MYB ( Figure 3 7 ). Therefore, we could confirm the targeting of KIT by MYB in s alivary gland cells and new therapeutic strategy can be developed by introducing either stem cell growth factor (SCF) as a potential growth stimulation agent or the treatment with KIT antibodies as potential growth inhibition agent. To systematic study the gene regulation effects, we also performed the whole transcriptome microarray studies on salivary gland DC cells transiently transfected with MYB /NFIB fragments in pAcGFP1N1 vector. Clustering analysis for the significant expressed genes showed that the MYB NFIB fusion gene construct gave the most DC cells (Figure 3 7 and data not shown ntly changed genes. Integrative analysis with our previously generated ACC gene signature revealed that MYB NFIB expression was associate d with 49 ACC gene signatures, while none was associated with ectopic t ru n expression A total of 18 ACC signature genes are induced by targeted W nt pathway genes are significantly involved including FZD3 (frizzled family receptor 3), WNT5A (wingless type MMTV integration site family, member 5A) an d WIF (WNT inhibitory factor 1). Although we detected these and other candidate genes such as RAP80 (Receptor associated protein 80, and UIMC1, ubiquitin interaction motif containing

PAGE 80

80 protein 1), which involves the chromosome break repairing the low percen tage of overlap between the ACC signature obtained from patient samples and the and the transient transfection, data indicates that mouse work is required to mimic MYB pathway activation in ACC. Discussion A recurrent t(6; 9) translocation is a frequent cy togenetic abnormality observed in human adenoid cystic carcinoma (ACC) tumor samples [ 57 155 156 ] Mapping the breakpoint for the t(6; 9) translocation allowed the identification of the MYB NFIB fusion gene, which has now been detected in at least 50% of salivary gland ACC as well as ACC like tumor s arising i n the breast [ 57 155 157 ] It has not been detected in any other normal or non ACC subtype tumor samples. Ac cumulated studies indicate MYB NFIB is the biomarker and key molecular alteration in human ACC. These observations strongly suggest an etiologic role for MYB NFIB in ACC tumorigenesis. MYB gene expression has been detected > 2 fold higher expressions in MY B NFIB fusion positive cases than in the fusion negative ACCs and over 100 times higher than non ACC tumor tissue samples [ 56 ] This emphasizes the important roles of M YB activation in ACC tumorigenesis. Further, recently published analysis on ACC whole exome mutational analysis reveal MYB NFIB fusion is the only recurrent structure alteration in ACC [ 93 158 ] However, there is no known information about the functional properties of this novel MYB NFIB fusion product in ACCs In addition, ectopic MYB expressio n has shown limited in vitro transforming activity that is largely restricted to hematopoietic animal model systems. Therefore, it has been difficult to study the role of MYB expression in epithelial cancers. Since the primary target of this fusion oncogene is in sa livary gland tissues, and the development of a salivary gland transformation assay

PAGE 81

81 has never been tested before, we developed in vitro transformation assay s using immortalized primary salivary gland cells. Both the soft agar colony formation assay and the xenograft tumor growth tests show that MYB NFIB acquired the transforming potential whereas; t ransforming activity. Therefore, the NFIB C terminal fusion partner appears to confer a needed function to MYB NFIB protein activity. The morphological changes and plastic adhesion behavior alterations caused by MYB NFIB fusion protein were observed in both human and wt mouse salivary gland cells which may give clues about MYB NFIB roles in enhancing the self dissociation, migration or metas tatic features of tumor cells. G lobal gene expression assays for transient transfection DC cells with MYB /NFIB fragments did not detect significant changes in the MYB transcriptional activity. In addition our microarray study for ACC tumor samples revea led no significant change between fusion positive and fusion negative samples. We therefore con clude that the DC immortalized cells are not the critical cells of origin for ACC or that another role for the MYB NFIB translocation is to activate MYB by addin g C terminal NFIB sequences, and /or altering C terminal protein degradation element s. We found that MYB NFIB fusion protein has a prolonged half life as compared with In addition, the high incidence of MYB cleavage events found in both salivary gland cells and xenograft tumors make the MYB roles in ACC tumorgensis more complex We propose for future experiments, to test the effects of different cleavage products of MYB on different aspect of MYB functionalities.

PAGE 82

82 In summary, we focused on the role of specific MYB and NFIB sequences in ACC tumorigenesis to define new oncogene activation mechanism s for fusion gene that arise from the chromosomal translocations. We propose M YB:NFIB translocation terminal sequence to enhance protein level and attaching NFIB end amino acid sequence to stabilize activated MYB.

PAGE 83

83 Figure 3 1. MYB /NFIB expression and protein property. A) Illustration of MYB /NFIB fragments tested. B) Expression of MYB /NFIB with pAcGFP1N1 in human immortalized ductal cells (NS SV DC, DC). C) Expression of MYB /NFIB with pLNCX in several different cells. D) MYB expression in ACC tu mor and ACC cells. E) MYB /NFIB protein half life tested in human immortalized myoepithelial cells (NS SV MC, MC). F) Predicted MYB Cas cleavage sites using online tool.

PAGE 84

84 Figure 3 terminus. A) Ill ustration of luciferase reporter assay plasmids. B) Reporter assay for full length MYB 3 UTR and mutant in miR 150 target sited located within MYB miR 150 levels in salivary gland tumors. D) Targe tScan prediction of microRNA target

PAGE 85

85 Figure 3 3. Forced expression of MYB NFIB changed morphology and attaching behavior of salivary gland cells. A) The self suspension viability of MYB /NFIB expressing ductal cells (DC). B) Stain ing of reseeded self suspension cells. C) Morphology alteration of Ori SV40 immortalized wt FVB salivary gland cells induced by MYB NFIB expression. D) Morphology alteration of Ori SV40 immortalized human salivary gland cells (DC) induced by MYB NFIB expre ssion. E) Foci staining of MYB /NFIB stable expressing ductal cells (DC). F) The self suspension viability of MYB /NFIB expressing myoepithelial cells (MC).

PAGE 86

86 Figure 3 4. Soft agar anchorage independent colony formation assays for MYB /NFIB expressing sa livary gland cells. A) B) and C) are performed using pAcGFP1N1 expression vector system. E) and F) are performed using lenti virus infection system. D) Representative colonies formed by MYB NFIB expressing human salivary gland ductal cells.

PAGE 87

87 Figure 3 5. X enograft tumor growth of MYB /NFIB stably expressing salivary gland cells in SCID mice for 6 months. A) MC cells in pLNCX. B) AC and DC cells in pAcGFP1N1 for 5 months. C) MYB NFIB expression in xenograft tumor and primary cell culture of the xenograft tum ors.

PAGE 88

88 Figure 3 6 MYB /NFIB protein expression efficiency in different cell lines. A) Express MYB /NFIB fragments with pAcGFP1N1 vector in MC and AC cells through transient tranfection and followed with G418 selection. B) MYB /NFIB expression level s in different cell lines transient transfected with G418 selection.

PAGE 89

89 Figure 3 7 MYB target gene study using microarray analysis and qRT PCR. A) Clustering for transient transfected DC cells using all significant probe sets. Triplicates were tested for each constructs. B) C) D) and E) Volcano plots for each MYB /NFIB construct to the vector control. Dot lines indicate the fold change and false discovery rate cut offs. F) qRT PCR tests the MYB /NFIB expression levels and c KIT expression in each stabl y selected MYB /NFIB constructs.

PAGE 90

90 CHAPTER 4 ACC PRIMARY CELL CULTURE AND TRANSGENIC MOUSE MODEL Rationale ACC is the most aggressive subtype of salivary gland tumors. The current treatment is surgical resection combined with radiation; and there is no curative systemic th er apy for unresectable disease Our whole transcriptome gene expression microarray study has now discovered potential targets and biomarkers that could be used to develop new therapeutic strategies. Primary tumor cells are commonly used as an efficient tool to validate the global gene expression profile results and to perform in vitro screening to candidate therapeutic targets for ACC tumors. Ten ACC cell lines were reported to be established over the past decades including ACC2, ACC3, A CCS and others These cells were frequently exchanged between laboratories and were widely used as ACC tumor cell lines for identifying disease biomarker and to perform drug screenings for ACC. However, authentication of these cell lines was not performed until 2008, Chio et al. [ 159 ] found that the three ACC cell lines (ACC2, ACC3, ACCM) responded similarly when treated with vandetanib and they all matched Hela cel ls after compared to the genotype database of the ATCC (American Type Culture Collection) tumor cell pools [ 159 ] Then in the following year, Phuchareon et al. [ 160 ] c onfirmed the contamination of Hela cells in each of the ACC cell lines using the DNA fingerprint analysis short tandem repeat (STR) profiling approach [ 160 ] STR profiling was a forensic technique and now is commonly used for authentication of cell lines. In addition to the above three cell lines, they also found that ACCS was mislabeled and matched the T24 urinary bladder cancer cells, ACCNS cell was a mouse cell line and CAC2 cells originated from a rat cell line [ 160 ] Therefore, there are currently no

PAGE 91

91 validated ACC cell lines. Currently, several research groups are working on obtaining authentic ACC cell lines from primary human ACC, however, to date they can only be cultured for 25 generations before senesc ence and can be maintained only as mouse xenograft [ 109 161 ] Considering the importance, urgency and s hortage of ACC cell lines, our laboratory decided to pursue new methods to generate pri mary cell cultures for human ACC In addition to the need for continuously growing human ACC tumor cell lines, there is also a need for development of a genetically eng ineered ACC tumor model. Our functional assays showed that MYB NFIB acquired transforming activity in both in vitro and in vivo transforming assay s MYB NFIB was also detected i n at least 50% of primary ACC samples emphasizing the important role of this re current fusion gene. Two separated research studies on whole exome sequencing results in ACC found a very low rate of somatic mutations with few overlaps with the exception of the recurrent MYB NFIB rearrangement [ 93 94 ] Although there are several research groups working on developing transgenic mouse model for MYB NFIB including the xenograft tumor model [ 161 ] I decided to also pursue this research goal given the importance of this effort to advance our understanding of ACC biology and treatment. Method s Plasmid C onstruction The MYB NFIB cDNA sequence was cut out from pAcGFP1N1 MYB NFIB with restriction enzymes SalI and NotI and then inserted into the cloning sites of pCBR. The plasmid pCBR was a gen at University of Florida The product plasmid pCBR MYB NFIB was then linearlized through overnight digestion with restriction enzymes AscI and PacI. The digested DNA fragments were then purified by

PAGE 92

92 gel separation before sent t o transgenic injection. The DNA purification was performed by UF Cancer Research Complex (CGRC) mouse model core. Transgenic Injection The transg e nic injection was performed by UF Cancer Research Complex (CGRC) mouse model core. Generally, the purified DN A was firstly injected in to FVB mice eggs and put into recipient mice, which are then mated with wt FVB mice to have pups. Genotyping of M ouse T ails Genotyping analysis was performed after 2 weeks of litters born using forward primer against MYB exon 6 a nd reverse primer against MYB exon 9. The forward primer pCBR BN 376F sequence: 5' CAGATGTGCAGTGCCAGCACCGATG 3', reverse primer pCBR BN 1268R sequence: 5' TGGCGAGGCGCTTTCTTCAGGTAGG 3'. The expected PCR product is having 893 bp in length PCR procedures ar e as follows: 95 C, 3 minutes; 25 cycles of 95 C, 45 seconds, 60 C, 30 seconds, 72 C, 50 seconds ; 72 C, 5 minutes. Induction of MYB NFIB E xpression The protein induction of the original vector pCBR MYB NFIB was performed by co transfected the plasmid with iCre expression plasmid to the HEK293 cells for 72 hours and then the protein was detection by western blot as describe d in Chapter 3. For the in vitro induction of MYB NFIB expression, the primary lung fibroblast cells were firstly cultured from s acrificed MYB NFIB genotyping positive pups and then infected with 110 7 adenovirus cre ( provided by University of Iowa Vector Core ). The MYB NFIB protein was tested using western blot after 3 days of infection.

PAGE 93

93 For the in vivo induction of MYB NFIB, the ge notyping positive mice are crossed with homozygous MMTV Cre FVB mice after 3 weeks of age. Xenograft T umor M odel for H uman ACC and P rimary C ell C ulture Fresh cut human ACC tumor was obtained through Shands hospital at UF under t he approval of IRB protocol. The ACC tumor was minced into tiny pieced (less than 1mm) in diameter, mixed with 50ul Matrigel ( BD Sciences) and then injected into SCID mice subcutaneously using 21 gauge needles as described in Chapter 3. After the tumor r eaches to endpoint of 1.5 cm in diameter, the tumor was cut out and then re seeded to a new young mouse. For primary cell culture was performed following procedures described in [ 145 ] The media used including F12K (Sigma) 1:1 mixture with DMEM (Sigma) and supplemented with 5 20% FBS (Gibco), supplemented K SFM medium (Gibco), and HITES medium. Detailed components of HITES or ACL 4 medium are provided in Table 4 1 Rho kinase inhibitor ( ROCK inhibitor Y 27632 dihydrochloride ) was purchased from Enzo Results of C hapter 4 The cloning process is shown in Figure 4 1. A total of 8 positive MYB NFIB constructs were obtained. The clone selected for transgenic injection was validated with both enzyme digestion method and Sanger sequencing approach. The selected positive plasmid was also either transfected alone or co transfected with the iCre expression plasmid into HEK293 T cells to test the protein expression efficiency. As shown in Figure 4 2, MYB NFIB was not detected if transfected only with the pCBR MYB NFIB vector;

PAGE 94

94 the fusion protein is expressed when induced by co transfect ion of Cre expression plasmid. For generating the LoxP MYB NFIB mice, three transgenic inject ions were attempted. Genotyping on the tails of 2 weeks old pups showed all 8 pups of second litter are negative, however, 11 of the 26 third litter pups are positive when tested with primers of MYB exons (Figure 4 3). The 11 founders include 7 females (ea r tag number 880, 882, 888, 889, 890, 891 and 901) and 4 males (ear tag number 885, 886, 895 and 897). To further examine the existence of false positive detection, one pup having relative weaker band was sacrificed and its lung fibroblast cells were cultu red and infected with adenovirus expressing Cre to induce the fusion gene expression. I observed MYB NFIB protein expression only when the cells were exposed to Cre expression adenovirus (Figure 4 3b) which confirms successful insertaion of the MYB NFIB gene I then crossed all 7 female positive FVB m ice with wt FVB male mice, and found 3 of them (ear tag number 888, 890 and 901) are transmissible to their F1 generations. The 3 transmissible founders were then cross ed with homozygous MMTV Cre FVB mice (ge NFIB gene expressions MYB NFIB gene expression induction was also performed by nasal injection of 1 10 7 Cre expression adeno virus into 2 heterozygous MYB NFIB transgenic 890 F1 pups (age of 2 months) and 1 male founder (age of 7 months) The phenotypes of induced transgenic mice are under observation. Simu l taneously I am also trying to obtain primary ACC cell lines. I obtained one human ACC tumor from Shands at UF under an IRB approved protocol and success fully maintained it as xenograft in SCID mice. The first time cells were injected

PAGE 95

95 into SCID mice subcutaneously and it took 5 month to reach endpoint of 1.5 cm tumor in diameter. However, it took only 2.5 months to reach a size of 1.5 cm for the second gen eration of xenograft ACC tumor The third generation tumor began to growth after only one month of injection. We attempted to adapt these tumor cells to growth in vitro and we found they initially grow in suspension and survived in clusters in either F12K/ DMEM 10% FBS medium or HITES medium (Figure 4 4) h owever, they can only survive for one to two weeks before cell arrest or senescence In collaboration with l aboratory of Dr. Adi Gazdar in UT Southwestern Medical Center these clustered tumor cells were grow under several different conditions using the Schlegel method [ 162 ] This method includes growing the larger tumor cell colonies on an NIH/3T3 feeder monolayer with 10M ROCK inhibitor (Figure 4 5). The t umor clones were transfer r ed into fresh ACL 4 medium with 10M ROCK inhibitor and 5% FBS and many typical large ACC cells with multiple vacuoles plus smaller solid cells were successfully expanded out as shown i n Figure 4 6 I then weaned these tumor cells from ACL 4 medium and ROCK inhibitor and now successfully grow them in RPMI medium with 10% FBS (Figure 4 7). To validate whether this is bon fide ACC tumor cells, I tested the MYB expression and seen markedly elevated MYB levels (Figure 3 1D) I also injected into SCID mice subcutaneously and observed tumor growth in one month (Figure 4 7 ) The elevated MYB expression was detected again in the xenograft tumors, which implies that this cell line is authentic ACC cells (Figure 3 1D) I then knock down several ACC signature genes including RUNX1, VCAN, HAPLN1 and MYB using shRNA i method. Interesting, marked growth inhibition was observed in shRNAi VCAN and shRNAi HAPLN1 ACC

PAGE 96

96 tumor cells (data not shown) This confi rms the important roles of HAPLN1/VCAN complex in this important lethal disease.

PAGE 97

97 Table 4 1. Components of ACL 4 or HITES m e dium Chemical Sigma Catalog# Amount in 1000ml RPMI 1640 (final conc.) ACL 4 HITES Insulin I2643 0.02 mg/ml 0.005 mg/ml Sodium s elenite T1147 5 0.01 mg/ml 0.01 mg/ml Hydrocortisone S5261 25 nM 30 nM beta estradiol H0888 50 nM 10 nM HEPES E2758 N/A 10 nM Epidermal Growth Factor Ho887 10 mM 10 mM Ethanolamine E9644 1 ng/ml N/A O Phosphorylethanolamine E0135 0.01 mM N/A Triiodo thyronine P0503 0.01 mM N/A Bovine serum albumin T6397 0.1 nM N/A Sodium serum ablbumin A3059 2 mg/ml N/A Sodium pyruvate S8636 0.5 mM N/A L glutamin (Gibico product) 2.05 mM 2.05 mM

PAGE 98

98 Figure 4 1. Cloning process of pCBR MYB NFIB. A) pCBR vector and pAcGFP1N1 MYB NFIB were both cut with SalI and NotI to serve as vector backbone and insert respectively. B) pCBR. C) After ligation, transformation, and plasmid extraction, 9 clones were selected for further validation us ing either single enzyme cut. D ) D ouble enzyme digestion Clones 2 9 were positive. Then clones 5, 7 and 8 were validated by Sanger sequencing. And the clone 5 was selected for the further transgenic use.

PAGE 99

99 Figure 4 2. Validation of pCBR MYB NFIB protein expression in HEK293 cells. A ) Cre induction. B) MYB NFIB fusion protein was expressed when co transfected the Cre expression plasmid but not present when transfected alone.

PAGE 100

100 Figure 4 3. Genotyping using primers of MYB exon 6 and 9 A) T he expected band size is 893 bp 4 female mic e (blue arrows) were selected to cr oss with MMTV Cre FVB mice. B) In vitro induction of clone 33 (red arrow) using adeno Cre: MYB NFIB fusion protein was expressed in lung fibr o blast cells when infected with Cre expressing adenovirus. Figure 4 4. Primary human ACC tumor cells survived in HITES medium or F12K/DMEM medium for one to weeks without cell growth.

PAGE 101

101 Figure 4 5. Tumor colonies formed on 3T3 cell feeder with ROCK inhibitor.

PAGE 102

102 Figure 4 6. Tumor cells cultured in ACL 4 medium with ROCK inhibito r (10x) Figure 4 7. Xenograft tumor growth of two ACC tumor cell lines. 8 million cells were mixed with 50l Matrigel and then injected into SCID mice. Tumors began to growth after 1 month of injection and were exercised.

PAGE 103

103 C HAPTER 5 C ONCLUSIONS Acqui red chromosomal aberrations were first suggested to be an important causal factor of tumor initiation in 1914 by Boveri [ 8 ] Salivary gland tumors (SGTs) comprise a highly heterogeneously group of tumors [ 95 ] the most common subtypes of which are classified as either benign pleomorphic adenomas (PAs) or as malignant mucoepid ermoid (MECs), adenoid cystic cancer (ACCs) or adenocarcinama (ADC) otherwise specified [ 95 ] Interestingly, the common subtypes of SGTs are frequently associated with different chromosomal translocations. For example, PA usually arises from a HMGA2 NFIB translocation [ 40 ] MEC from a fusion between CRTC1 MAML2 [ 51 53 ] and ACC from the recently published M YB NFIB rearrangement [ 55 57 156 163 ] Adenoid cystic cancer (ACC) is the most common aggressive salivary gland malignancies with no known curative systemic therapy available [ 97 ] Little was known about the etiology of ACC un til the identification of the recurrent MYB NFIB translocation [ 55 ] To discover therapeutic targets for ACC, we performed global mRNA and miRNA analyses of 12 well annotated ACC tumors, each with matching adjacent normal tissues, and compared these data with samples from 14 m ucoepidermoid cancers (MEC) and 11 salivary gland adenocarcinomas (ADC). We detected a unique gene signature of 1160 mRNAs and 22 miRNAs that separated ACC from matched normal tissues, MEC, and ADC. We also detected 4 ACC samples (three from public databas es [ 109 ] ) with low to undetectable MYB expression that retained ACC gene signature. Analysis of these samples identified both MYB dependent and independent gene targets that encoded related components of the extracellular matrix (ECM).

PAGE 104

104 Integration of ACC signature with recently published ACC mutational data suggests that RUNX1, a MYB binding oncogene [ 121 122 ] participates in ACC tumorigenesis to activate ECM elements including HAPLN1/VCAN [ 112 114 ] The microRNA chip analysis for the same set of ACC samples confirmed the importance of this ECM complex. In summary, we show that the ACC signature arises from MYB dependent and independent signals and identify VCAN/HAPLN1 E CM complexes as new druggable targets. The novel MYB NFIB fusion is the biomarker and key structure alteration in human adenoid cystic cancer (ACC) [ 93 158 163 ] However, we did not detect significant alteration of either global mRNA or miRNA expression between MYB NFIB fusion positive and fusion negati ve tumors. This suggests that a main outcome of this gene fusion event is to activate MYB signaling pathways We therefore performed functional studies to discover the roles of this novel MYB NFIB fusion protein and compare this to wt full length and trunc ated MYB. We observed forced expression of MYB NFIB in immortalized human salivary gland cells alters cell morphology and adhesion to polysterene plates in vitro. MYB NFIB fusion gene acquired both increased soft agar colony formation ability and enhanced subcutaneous tumor growth ability in xenograft mouse model. In comparison, truncate d MYB did not show the same functional effects which imply the NFIB fragment also participates as an important factor for ACC tumorigenesis. Furthermore, the MYB NFIB fusio n acquired prolonged protein half life compared to full length or truncated MYB. In addition, terminal increased protein expression levels in immortalized human salivary gland cells. We therefore propose an important role of the MYB NFIB fusion event is to activate

PAGE 105

105 terminus and perhaps, the role of attaching the NFIB fragment probably is to simply stabilize the activated MYB protein. Finally, we successfully generated the first validat ed human ACC tumor cell line and demonstrate that depletion of VCAN or H A PLN1, blocked tumor cell viability. And we also generated a genetically engineered mouse MYB NFIB mouse model as an important tool to study ACC biology and develop and test new treat ments. The long term objective is to identify novel treatment strategies for this important group of tumors for which there is no curative systemic therapy.

PAGE 106

106 APPENDIX LIST OF SIGNIFICANTLY ALTERED GENES IN ACC COMPARING TO MATCHED NORMAL Index probeset_id Symbol Gene_Name Fold Change (T/N) p value 1 8122202 MYB v myb myeloblastosis viral oncogene homolog (avian) 17.8 9.2E 07 2 8095806 ART3 ADP ribosyltransferase 3 15.2 4.6E 08 3 8106743 VCAN versican 13.6 6.8E 08 4 7988563 SHC4 SHC (Src homolog y 2 domain containing) family, member 4 12.0 6.8E 08 5 8109926 GABRP gamma aminobutyric acid (GABA) A receptor, pi 10.6 7.8E 06 6 7953873 OVOS ovostatin 10.0 6.2E 07 7 7961026 LOC728715 ovostatin homolog 2 like 9.3 1.0E 06 8 8132743 ABCA13 ATP binding cassette, sub family A (ABC1), member 13 9.2 5.4E 04 9 8078619 ITGA9 integrin, alpha 9 9.2 5.5E 10 10 8123104 FNDC1 fibronectin type III domain containing 1 8.7 2.7E 07 11 8121784 FABP7 fatty acid binding protein 7, brain 8.5 4.4E 08 12 7 904843 PDZK1 PDZ domain containing 1 8.3 1.8E 04 13 7918936 VTCN1 V set domain containing T cell activation inhibitor 1 8.3 1.4E 05 14 8168534 TBX22 T box 22 8.2 1.9E 05 15 8142194 LAMB1 laminin, beta 1 7.6 9.0E 07 16 8117170 ncrna ncrna:misc_ RNA chromosome:GRCh37:6:22085773:22086147:1 7.3 3.0E 08 17 8074856 PRAME preferentially expressed antigen in melanoma 7.2 2.8E 06 18 7919787 HORMAD1 HORMA domain containing 1 7.0 2.3E 06 19 7991234 MFGE8 milk fat globule EGF factor 8 protein 7.0 8.2E 08 20 8074168 Broad TUCP linc OR4Q3 3 chr14:+:19650031 19684290 6.9 2.4E 10 21 8049187 EFHD1 EF hand domain family, member D1 6.8 2.8E 08 22 8112971 HAPLN1 hyaluronan and proteoglycan link protein 1 6.5 1.9E 04 23 8112980 EDIL3 EGF like re peats and discoidin I like domains 3 6.5 2.5E 04 24 8096511 BMPR1B bone morphogenetic protein receptor, type IB 6.3 1.7E 06 25 7983527 SEMA6D sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D 6.2 1.1E 06 26 8080562 IL1 7RB interleukin 17 receptor B 6.2 8.1E 07 27 8050007 PXDN peroxidasin homolog (Drosophila) 6.1 4.2E 05 28 8001197 NETO2 neuropilin (NRP) and tolloid (TLL) like 2 6.1 3.4E 05 29 8160459 ELAVL2 ELAV (embryonic lethal, abnormal vision, Drosophila) l ike 2 (Hu antigen B) 5.8 1.9E 05 30 8055153 POTEE POTE ankyrin domain family, member E 5.6 1.0E 04 31 8144228 FLJ36840 uncharacterized LOC645524 5.5 2.5E 07 32 7926875 BAMBI BMP and activin membrane bound inhibitor homolog (Xenopus laevis) 5.5 6.0 E 07 33 8140035 GenBank Homo sapiens cDNA FLJ26938 fis, clone RCT07169. 5.5 3.4E 06 34 8108688 PCDHB3 protocadherin beta 3 5.4 2.6E 04 35 7991186 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 5.4 2.9E 06 36 7925320 NID1 nidogen 1 5.3 3.3 E 05 37 8054037 RN5S101 RNA, 5S ribosomal 101 5.2 3.9E 05 38 7910047 DNAH14 dynein, axonemal, heavy chain 14 5.2 6.6E 06 39 8164843 OBP2B odorant binding protein 2B 5.1 1.3E 06 40 8103706 AADAT aminoadipate aminotransferase 5.1 1.8E 06 41 8121 850 HEY2 hairy 5.1 1.4E 05 42 8104079 FAT1 FAT tumor suppressor homolog 1 (Drosophila) 5.1 2.0E 07 43 8095110 KIT v kit Hardy Zuckerman 4 feline sarcoma viral oncogene homolog 5.0 6.1E 05 44 8088848 PDZRN3 PDZ domain containing ring finger 3 5.0 1.1E 06 45 8077366 LRRN1 leucine rich repeat neuronal 1 5.0 3.2E 04 46 8059376 SERPINE2 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 4.9 1.1E 05 47 8017039 SEPT4 septin 4 4.9 5.3E 06 48 8103736 S CRG1 stimulator of chondrogenesis 1 4.8 5.5E 05 49 8097957 GUCY1A3 guanylate cyclase 1, soluble, alpha 3 4.8 2.4E 05 50 8027348 ZNF730 zinc finger protein 730 4.8 7.1E 07 51 8013272 CCDC144A coiled coil domain containing 144A 4.8 1.0E 05 52 7987 405 RASGRP1 RAS guanyl releasing protein 1 (calcium and DAG regulated) 4.8 5.2E 05 53 8096704 NPNT nephronectin 4.7 3.8E 06 54 8127446 COL9A1 collagen, type IX, alpha 1 4.7 2.8E 04 55 8055222 POTEF POTE ankyrin domain family, member F 4.7 1.1E 0 4 56 8041467 VIT vitrin 4.6 2.8E 05 57 8140955 CDK6 cyclin dependent kinase 6 4.6 2.4E 05 58 7947274 MPPED2 metallophosphoesterase domain containing 2 4.6 1.3E 04 59 8047248 PLCL1 phospholipase C like 1 4.5 3.4E 05 60 8043687 ANKRD36C ankyri n repeat domain 36C 4.5 4.7E 05 61 8090133 CCDC14 coiled coil domain containing 14 4.5 2.2E 06 62 8036302 LOC100506930 uncharacterized LOC100506930 4.5 2.6E 07 63 8128284 EPHA7 EPH receptor A7 4.4 1.5E 04 64 8141140 DLX5 distal less homeobox 5 4.4 1.1E 04 65 8168589 ZNF711 zinc finger protein 711 4.4 7.4E 07 66 7911241 OR2L8 olfactory receptor, family 2, subfamily L, member 8 4.4 9.8E 05 67 8028924 MIA RAB4B MIA RAB4B readthrough 4.4 1.5E 05 68 7969288 OLFM4 olfactomedin 4 4.4 2.2E 0 2 69 8147000 ZFHX4 zinc finger homeobox 4 4.3 9.8E 06 70 7988444 MYEF2 myelin expression factor 2 4.3 8.0E 06 71 7908924 PRELP proline 4.3 1.2E 06 72 8099982 APBB2 amyloid beta (A4) precursor protein binding, family B, member 2 4.2 7.9E 09 73 8054054 ANKRD36B ankyrin repeat domain 36B 4.2 9.8E 05 74 8111490 PRLR prolactin receptor 4.2 2.4E 04 75 8151684 MMP16 matrix metallopeptidase 16 (membrane inserted) 4.2 4.0E 05 76 7913869 STMN1 stathmin 1 4.1 2.3E 05 77 8067305 SYCP2 synapto nemal complex protein 2 4.1 2.9E 05 78 7932407 ST8SIA6 ST8 alpha N acetyl neuraminide alpha 2,8 sialyltransferase 6 4.1 8.4E 04 79 7945680 H19 H19, imprinted maternally expressed transcript (non protein coding) 4.1 2.4E 03 80 8046428 RAPGEF4 Rap g uanine nucleotide exchange factor (GEF) 4 4.1 1.6E 04 81 7946323 OR5P2 olfactory receptor, family 5, subfamily P, member 2 4.1 1.1E 04 82 8051573 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 4.1 2.4E 05 83 7908816 LGR6 leucine rich repea t containing G protein coupled receptor 6 4.0 7.4E 05 84 8136645 TAS2R4 taste receptor, type 2, member 4 4.0 3.3E 06 85 7925525 CEP170 centrosomal protein 170kDa 4.0 6.4E 05 86 8108724 PCDHB10 protocadherin beta 10 4.0 1.7E 05 87 8005110 ZNF286A zinc finger protein 286A 3.9 5.2E 07 88 7938364 WEE1 WEE1 homolog (S. pombe) 3.9 4.5E 03 89 8021946 COLEC12 collectin sub family member 12 3.9 1.2E 06 90 8106784 RASA1 RAS p21 protein activator (GTPase activating protein) 1 3.9 2.7E 05 91 81446 99 AY461701 Homo sapiens liver related low express protein 1 (LRLE1) mRNA, complete cds. 3.8 4.5E 06 92 8108744 PCDHB14 protocadherin beta 14 3.8 1.2E 04 93 8043697 ANKRD36 ankyrin repeat domain 36 3.8 3.5E 04 94 8150509 PLAT plasminogen activato r, tissue 3.8 3.7E 04 95 8156199 DAPK1 death associated protein kinase 1 3.8 3.6E 05 96 7951140 LOC100131541 uncharacterized LOC100131541 3.8 2.7E 06 97 7961514 MGP matrix Gla protein 3.8 1.7E 03 98 8171359 GPM6B glycoprotein M6B 3.8 2.2E 06 9 9 8179595 GABBR1 gamma aminobutyric acid (GABA) B receptor, 1 3.7 4.4E 09 100 7927681 BICC1 bicaudal C homolog 1 (Drosophila) 3.7 8.6E 07 101 8076894 MLC1 megalencephalic leukoencephalopathy with subcortical cysts 1 3.7 1.5E 07 102 7951217 MMP7 matrix metallopeptidase 7 (matrilysin, uterine) 3.7 2.9E 02 103 8139977 STAG3L3 stromal antigen 3 like 3 3.7 8.0E 08 104 7933437 PTPN20B protein tyrosine phosphatase, non receptor type 20B 3.7 3.8E 06 105 8150318 FGFR1 fibroblast growth factor rec eptor 1 3.7 1.0E 05 106 8052845 TIA1 TIA1 cytotoxic granule associated RNA binding protein 3.6 5.1E 05 107 8031157 TTYH1 tweety homolog 1 (Drosophila) 3.6 3.6E 05 108 8142270 NRCAM neuronal cell adhesion molecule 3.6 1.9E 04 109 7963353 KRT81 k eratin 81 3.6 1.4E 05 110 8005231 FAM106A family with sequence similarity 106, member A 3.6 4.5E 08 111 8019831 CLUL1 clusterin like 1 (retinal) 3.6 5.7E 06 112 7912887 MFAP2 microfibrillar associated protein 2 3.6 5.6E 07 113 8115327 SPARC sec reted protein, acidic, cysteine rich (osteonectin) 3.6 2.5E 05 114 7997504 CDH13 cadherin 13, H cadherin (heart) 3.5 9.7E 04 115 8068833 PDE9A phosphodiesterase 9A 3.5 5.9E 05 116 8140196 STAG3L1 stromal antigen 3 like 1 3.5 1.2E 07 117 8020321 A F090940 Homo sapiens clone HQ0644 PRO0644 mRNA, complete cds. 3.5 9.4E 06 118 8157383 COL27A1 collagen, type XXVII, alpha 1 3.5 2.4E 07 119 8064978 JAG1 jagged 1 3.5 1.9E 04 120 8108683 PCDHB2 protocadherin beta 2 3.5 1.6E 03 121 7938834 NAV2 neuron navigator 2 3.5 8.8E 06 122 7900336 AY527403 Homo sapiens 10kDa eEF1A interacting protein mRNA, complete cds. 3.4 4.6E 08 123 8146711 C8orf44 chromosome 8 open reading frame 44 3.4 1.2E 05 124 8165217 NOTCH1 notch 1 3.4 3.9E 07 125 7970033 COL4A2 collagen, type IV, alpha 2 3.4 8.7E 05 126 7952451 LOC100130428 IGYY565 3.4 1.5E 04

PAGE 107

107 127 8047910 PTH2R parathyroid hormone 2 receptor 3.4 6.4E 04 128 8005679 CCDC144B coiled coil domain containing 144B (pseudogene) 3.4 2.0E 05 129 7964665 DPY19L2 dpy 19 like 2 (C. elegans) 3.4 8.2E 08 130 8039607 PEG3 paternally expressed 3 3.4 3.2E 04 131 8084923 LOC401109 uncharacterized LOC401109 3.4 3.9E 09 132 8140258 PMS2P6 postmeiotic segregation increased 2 pseudogene 6 3.3 8.4E 06 133 8155754 MAMDC2 MAM domain containing 2 3.3 9.3E 04 134 8130867 THBS2 thrombospondin 2 3.3 2.8E 06 135 8120067 SLC25A27 solute carrier family 25, member 27 3.3 2.5E 05 136 8140668 SEMA3A sema domain, immunoglobulin domain (Ig), short basic domain secreted, (semaphorin) 3A 3.3 8.5E 04 137 7926545 PLXDC2 plexin domain containing 2 3.3 2.6E 07 138 8005957 SNORD4B small nucleolar RNA, C 3.3 7.8E 06 139 8047487 FZD7 frizzled family receptor 7 3.3 1.5E 06 140 8148000 AARD alanine and argini ne rich domain containing protein 3.3 1.5E 06 141 7903188 PTBP2 polypyrimidine tract binding protein 2 3.3 3.1E 05 142 8110666 TRIM52 tripartite motif containing 52 3.3 2.1E 05 143 8112521 NAIP NLR family, apoptosis inhibitory protein 3.3 2.2E 04 144 8078461 FBXL2 F box and leucine rich repeat protein 2 3.3 1.2E 05 145 8124166 MBOAT1 membrane bound O acyltransferase domain containing 1 3.2 1.1E 03 146 8108749 PCDHB18 protocadherin beta 18 pseudogene 3.2 6.3E 06 147 7916984 MIR186 microR NA 186 3.2 1.9E 04 148 8152453 TRPS1 trichorhinophalangeal syndrome I 3.2 2.0E 03 149 8133309 PMS2P5 postmeiotic segregation increased 2 pseudogene 5 3.2 1.6E 06 150 7912157 ERRFI1 ERBB receptor feedback inhibitor 1 3.2 1.0E 05 151 7925257 LYST lysosomal trafficking regulator 3.2 1.3E 04 152 8078196 KCNH8 potassium voltage gated channel, subfamily H (eag related), member 8 3.2 8.0E 08 153 7911252 OR2L2 olfactory receptor, family 2, subfamily L, member 2 3.2 7.4E 04 154 8054831 EN1 engra iled homeobox 1 3.2 2.0E 06 155 8140280 PMS2L2 postmeiotic segregation increased 2 like 2 pseudogene 3.2 1.3E 05 156 8054020 FAM178B family with sequence similarity 178, member B 3.2 5.9E 06 157 8012464 LOC100128288 uncharacterized LOC100128288 3. 2 4.6E 07 158 8144726 TUSC3 tumor suppressor candidate 3 3.2 9.6E 06 159 8113504 NREP neuronal regeneration related protein homolog (rat) 3.2 3.9E 04 160 7952986 WNK1 WNK lysine deficient protein kinase 1 3.1 9.2E 05 161 8023646 BCL2 B cell CLL 3.1 4.8E 06 162 7982187 APBA2 amyloid beta (A4) precursor protein binding, family A, member 2 3.1 1.0E 06 163 8048411 TTLL4 tubulin tyrosine ligase like family, member 4 3.1 1.0E 07 164 8109159 MIR145 microRNA 145 3.1 3.7E 02 165 8063536 TFAP2C transcription factor AP 2 gamma (activating enhancer binding protein 2 gamma) 3.1 2.5E 05 166 7967358 PITPNM2 phosphatidylinositol transfer protein, membrane associated 2 3.1 1.6E 06 167 8129273 C6orf170 chromosome 6 open reading frame 170 3.1 4.6E 05 168 8139896 PMS2P4 postmeiotic segregation increased 2 pseudogene 4 3.1 5.2E 05 169 8133106 SNORA22 small nucleolar RNA, H 3.1 2.7E 02 170 7908861 OCR1 ovarian cancer related protein 1 3.1 1.2E 04 171 8091411 TM4SF1 transmembrane 4 L six fa mily member 1 3.0 1.5E 05 172 7972983 POTEG POTE ankyrin domain family, member G 3.0 1.2E 04 173 8006336 LRRC37B leucine rich repeat containing 37B 3.0 7.3E 05 174 8027297 ZNF738 zinc finger protein 738 3.0 8.7E 05 175 8035793 ZNF737 zinc finge r protein 737 3.0 1.2E 02 176 7945110 ST3GAL4 ST3 beta galactoside alpha 2,3 sialyltransferase 4 3.0 2.2E 07 177 8138592 TRA2A transformer 2 alpha homolog (Drosophila) 3.0 5.8E 06 178 7902957 EPHX4 epoxide hydrolase 4 3.0 4.6E 05 179 8108753 PCD HB15 protocadherin beta 15 3.0 4.6E 05 180 8098439 EPCAM epithelial cell adhesion molecule 3.0 1.2E 02 181 8074286 MICAL3 microtubule associated monoxygenase, calponin and LIM domain containing 3 3.0 1.1E 07 182 8081564 CD96 CD96 molecule 3.0 3.5 E 02 183 7982366 SCG5 secretogranin V (7B2 protein) 3.0 3.0E 03 184 7924817 PRO2012 uncharacterized protein PRO2012 2.9 8.7E 04 185 7972750 COL4A1 collagen, type IV, alpha 1 2.9 1.8E 04 186 7938989 GAS2 growth arrest specific 2 2.9 1.3E 03 187 8145669 RBPMS RNA binding protein with multiple splicing 2.9 1.6E 04 188 8131263 SNORD13P2 small nucleolar RNA, C 2.9 4.8E 04 189 8044225 SULT1C4 sulfotransferase family, cytosolic, 1C, member 4 2.9 1.3E 04 190 8103695 MFAP3L microfibrillar ass ociated protein 3 like 2.9 3.6E 05 191 8083677 SCHIP1 schwannomin interacting protein 1 2.9 3.4E 05 192 8053266 TACR1 tachykinin receptor 1 2.9 2.6E 05 193 8133754 DTX2P1 UPK3BP1 PMS2P11 DTX2P1 UPK3BP1 PMS2P11 readthrough (non protein coding) 2.9 2.1E 05 194 7996954 NFAT5 nuclear factor of activated T cells 5, tonicity responsive 2.9 1.8E 05 195 8150978 CA8 carbonic anhydrase VIII 2.9 1.2E 03 196 8102720 ANKRD50 ankyrin repeat domain 50 2.9 3.3E 07 197 7968417 FRY furry homolog (Drosoph ila) 2.9 3.0E 07 198 8047659 ABI2 abl interactor 2 2.9 1.3E 05 199 8141395 MCM7 minichromosome maintenance complex component 7 2.9 7.0E 07 200 8010978 LOC100130876 uncharacterized LOC100130876 2.8 2.8E 04 201 8055143 LOC440905 uncharacterized L OC440905 2.8 1.2E 03 202 7961291 TAS2R31 taste receptor, type 2, member 31 2.8 4.0E 06 203 8091402 TM4SF18 transmembrane 4 L six family member 18 2.8 4.7E 04 204 8070584 TMPRSS3 transmembrane protease, serine 3 2.8 1.9E 04 205 7961285 TAS2R20 t aste receptor, type 2, member 20 2.8 8.5E 04 206 8157727 GPR21 G protein coupled receptor 21 2.8 2.3E 06 207 7963054 TUBA1A tubulin, alpha 1a 2.8 1.1E 06 208 8033818 OLFM2 olfactomedin 2 2.8 3.8E 06 209 8147461 SDC2 syndecan 2 2.8 8.9E 06 210 8001067 HERC2P4 hect domain and RLD 2 pseudogene 4 2.8 1.2E 06 211 8116247 ZNF354A zinc finger protein 354A 2.8 1.8E 06 212 7911329 LOC100134822 uncharacterized LOC100134822 2.8 1.4E 04 213 7916669 DOCK7 dedicator of cytokinesis 7 2.8 2.4E 05 2 14 8084524 EPHB3 EPH receptor B3 2.8 1.8E 06 215 8022424 NF1P3 neurofibromin 1 pseudogene 3 2.8 1.8E 03 216 8137666 SEPT14 septin 14 2.8 1.6E 04 217 7906307 KIRREL kin of IRRE like (Drosophila) 2.8 1.4E 04 218 8079021 CTNNB1 catenin (cadherin associated protein), beta 1, 88kDa 2.8 1.2E 05 219 8057959 PGAP1 post GPI attachment to proteins 1 2.8 1.9E 04 220 7976496 SERPINA3 serpin peptidase inhibitor, clade A (alpha 1 antiproteinase, antitrypsin), member 3 2.8 3.6E 02 221 7969794 LOC1001 32099 FRSS1829 2.8 1.3E 05 222 8083594 PTX3 pentraxin 3, long 2.8 8.8E 05 223 7897449 SPSB1 splA 2.8 1.4E 05 224 7981346 MOK MOK protein kinase 2.8 2.7E 05 225 8157153 PALM2 AKAP2 PALM2 AKAP2 readthrough 2.8 2.8E 05 226 7947358 TPT1 AS1 TPT 1 antisense RNA 1 (non protein coding) 2.8 2.0E 05 227 8045210 CYP4F43P cytochrome P450, family 4, subfamily F, polypeptide 43, pseudogene 2.8 6.0E 03 228 8151931 TSPYL5 TSPY like 5 2.8 9.7E 05 229 8079131 FAM198A family with sequence similarity 1 98, member A 2.8 1.6E 04 230 7925561 HNRNPU AS1 HNRNPU antisense RNA 1 (non protein coding) 2.8 2.1E 05 231 8005225 USP32P1 ubiquitin specific peptidase 32 pseudogene 1 2.7 2.0E 05 232 8175217 GPC4 glypican 4 2.7 5.2E 03 233 7950391 PGM2L1 phos phoglucomutase 2 like 1 2.7 1.6E 05 234 8173217 ARHGEF9 Cdc42 guanine nucleotide exchange factor (GEF) 9 2.7 2.7E 06 235 7975416 PCNX pecanex homolog (Drosophila) 2.7 8.2E 05 236 8055016 AF234262 Homo sapiens IL 1beta regulated neutrophil survival protein mRNA, complete cds. 2.7 3.2E 04 237 8143663 EZH2 enhancer of zeste homolog 2 (Drosophila) 2.7 1.1E 03 238 7994058 SCNN1G sodium channel, non voltage gated 1, gamma subunit 2.7 1.7E 04 239 8013262 USP32P2 ubiquitin specific peptidase 32 pse udogene 2 2.7 7.6E 07 240 8108720 PCDHB9 protocadherin beta 9 2.7 2.6E 04 241 7923453 KDM5B lysine (K) specific demethylase 5B 2.7 1.2E 06 242 7951159 RN5S346 RNA, 5S ribosomal 346 2.7 4.5E 03 243 8132318 ANLN anillin, actin binding protein 2.7 6.8E 03 244 8161632 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2.7 1.9E 04 245 8141490 PMS2P1 postmeiotic segregation increased 2 pseudogene 1 2.7 4.3E 05 246 7917676 GLMN glomulin, FKBP associated protein 2.7 3.7E 04 247 8177834 ATAT1 alpha tubulin acetyltransferase 1 2.7 3.3E 07 248 8001099 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 2.7 7.6E 07 249 7902441 ST6GALNAC5 ST6 (alpha N acetyl neuraminyl 2,3 beta galactosyl 1,3) N acetylgalactosam inide alpha 2,6 sialyltransferase 5 2.7 7.7E 06 250 7896754 LOC100287497 uncharacterized LOC100287497 2.7 2.1E 05 251 8134789 PILRB paired immunoglobin like type 2 receptor beta 2.7 6.0E 08 252 8035782 ZNF682 zinc finger protein 682 2.7 1.6E 06 2 53 8118890 SCUBE3 signal peptide, CUB domain, EGF like 3 2.7 1.4E 03 254 7950042 SHANK2 SH3 and multiple ankyrin repeat domains 2 2.7 3.8E 04 255 7917649 TGFBR3 transforming growth factor, beta receptor III 2.7 7.3E 03 256 7948904 SNORD28 small nucleolar RNA, C 2.7 1.3E 04 257 7951036 TAF1D TATA box binding protein (TBP) associated factor, RNA polymerase I, D, 41kDa 2.7 2.6E 06 258 7991224 HAPLN3 hyaluronan and proteoglycan link protein 3 2.6 6.5E 04 259 8123446 SMOC2 SPARC related modul ar calcium binding 2 2.6 3.1E 03 260 8144036 XRCC2 X ray repair complementing defective repair in Chinese hamster cells 2 2.6 2.7E 05 261 8130891 WDR27 WD repeat domain 27 2.6 1.9E 06 262 7903404 RNPC3 RNA binding region (RNP1, RRM) containing 3 2 .6 7.6E 05 263 8133914 DMTF1 cyclin D binding myb like transcription factor 1 2.6 3.7E 05 264 8104141 PLEKHG4B pleckstrin homology domain containing, family G (with RhoGef domain) member 4B 2.6 1.6E 07 265 7970624 CENPJ centromere protein J 2.6 5. 3E 07 266 8090152 ROPN1B rhophilin associated tail protein 1B 2.6 3.5E 03

PAGE 108

108 267 8043114 TCF7L1 transcription factor 7 like 1 (T cell specific, HMG box) 2.6 2.2E 06 268 7961281 TAS2R50 taste receptor, type 2, member 50 2.6 1.2E 04 269 8139832 ZNF11 7 zinc finger protein 117 2.6 1.2E 04 270 7972003 KLF12 Kruppel like factor 12 2.6 4.7E 04 271 8088636 LOC100508226 HHSL751 2.6 3.5E 05 272 8074780 YPEL1 yippee like 1 (Drosophila) 2.6 1.1E 06 273 7945663 IFITM10 interferon induced transmembra ne protein 10 2.6 2.9E 05 274 8046380 ITGA6 integrin, alpha 6 2.6 1.2E 05 275 8031857 ZNF135 zinc finger protein 135 2.6 1.3E 07 276 7951133 MAML2 mastermind like 2 (Drosophila) 2.6 1.0E 03 277 8091600 PLCH1 phospholipase C, eta 1 2.6 1.4E 03 278 8076113 FAM227A family with sequence similarity 227, member A 2.6 4.4E 05 279 7937772 IGF2 insulin like growth factor 2 (somatomedin A) 2.6 7.6E 03 280 8069574 C21orf91 chromosome 21 open reading frame 91 2.6 4.1E 08 281 7902977 KIAA1107 KIA A1107 2.6 2.8E 03 282 7936734 FGFR2 fibroblast growth factor receptor 2 2.6 1.2E 03 283 7943369 TMEM133 transmembrane protein 133 2.6 3.4E 04 284 7939374 AF274942 Homo sapiens PNAS 17 mRNA, complete cds. 2.6 1.7E 03 285 8156905 TMEFF1 transmembr ane protein with EGF like and two follistatin like domains 1 2.6 1.9E 05 286 7933263 PTPN20A protein tyrosine phosphatase, non receptor type 20A 2.6 4.9E 06 287 8001423 RPGRIP1L RPGRIP1 like 2.6 2.6E 04 288 8155192 GLIPR2 GLI pathogenesis related 2 2.6 6.7E 03 289 8115196 ZNF300 zinc finger protein 300 2.6 9.0E 05 290 8154394 SNAPC3 small nuclear RNA activating complex, polypeptide 3, 50kDa 2.6 1.2E 03 291 8102232 LEF1 lymphoid enhancer binding factor 1 2.6 6.9E 04 292 8104131 MGC39584 uncharacterized LOC441058 2.6 6.3E 04 293 8114970 C5orf46 chromosome 5 open reading frame 46 2.6 1.5E 02 294 8127932 TBX18 T box 18 2.6 1.4E 02 295 8021442 ZNF532 zinc finger protein 532 2.5 9.1E 08 296 8074925 GUSBP11 glucuronidase, beta pseud ogene 11 2.5 7.3E 06 297 8117165 SOX4 SRY (sex determining region Y) box 4 2.5 1.1E 07 298 7961339 LRP6 low density lipoprotein receptor related protein 6 2.5 1.3E 04 299 7902891 ZNF326 zinc finger protein 326 2.5 6.1E 06 300 7953981 ETV6 ets v ariant 6 2.5 1.5E 05 301 8143188 CREB3L2 cAMP responsive element binding protein 3 like 2 2.5 8.9E 06 302 8095080 PDGFRA platelet derived growth factor receptor, alpha polypeptide 2.5 4.4E 04 303 8169949 MST4 serine 2.5 9.6E 06 304 7910618 SLC35 F3 solute carrier family 35, member F3 2.5 1.6E 05 305 8012257 TP53 tumor protein p53 2.5 4.2E 05 306 8105144 AK001108 Homo sapiens cDNA FLJ10246 fis, clone HEMBB1000673. 2.5 1.2E 04 307 8082767 TMEM108 transmembrane protein 108 2.5 5.6E 04 308 8 094574 TBC1D1 TBC1 (tre 2 2.5 4.8E 05 309 7985560 CSPG4P5 chondroitin sulfate proteoglycan 4 pseudogene 5 2.5 9.1E 05 310 8018114 SDK2 sidekick cell adhesion molecule 2 2.5 2.0E 05 311 8105663 NLN neurolysin (metallopeptidase M3 family) 2.5 2.1E 05 312 8156164 KIF27 kinesin family member 27 2.5 2.4E 03 313 7924712 LIN9 lin 9 homolog (C. elegans) 2.5 2.4E 07 314 8112615 ENC1 ectodermal neural cortex 1 (with BTB like domain) 2.5 1.1E 03 315 7991598 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 2.5 7.5E 04 316 8000687 LOC595101 smg 1 homolog, phosphatidylinositol 3 kinase related kinase (C. elegans) pseudogene 2.5 1.6E 04 317 7903407 AMY2B amylase, alpha 2B (pancreatic) 2.5 2.6E 04 318 8047097 GLS glutaminase 2.5 4.2E 05 319 8008493 LUC7L3 LUC7 like 3 (S. cerevisiae) 2.5 2.5E 06 320 8028194 ZNF382 zinc finger protein 382 2.5 2.2E 03 321 7950082 LOC100133315 transient receptor potential cation channel, subfamily C, member 2 like 2.5 6.3E 05 322 7960143 ZNF84 zin c finger protein 84 2.5 1.3E 05 323 8000823 SMG1 smg 1 homolog, phosphatidylinositol 3 kinase related kinase (C. elegans) 2.5 1.3E 04 324 8084739 FLJ42393 uncharacterized LOC401105 2.5 6.1E 06 325 8104139 LOC389834 ankyrin repeat domain 57 pseudog ene 2.5 8.2E 05 326 7905918 EFNA3 ephrin A3 2.5 3.2E 03 327 8136647 TAS2R5 taste receptor, type 2, member 5 2.5 1.2E 05 328 8012475 MYH10 myosin, heavy chain 10, non muscle 2.5 3.0E 06 329 8123864 TFAP2A transcription factor AP 2 alpha (activat ing enhancer binding protein 2 alpha) 2.5 6.2E 05 330 7972888 PCID2 PCI domain containing 2 2.5 3.1E 06 331 8005765 WSB1 WD repeat and SOCS box containing 1 2.5 2.3E 03 332 8022612 ZNF521 zinc finger protein 521 2.5 5.1E 04 333 8056047 WDSUB1 W D repeat, sterile alpha motif and U box domain containing 1 2.5 9.2E 05 334 7969736 FARP1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte derived) 2.5 8.7E 04 335 7946326 OR5P3 olfactory receptor, family 5, subfamily P, member 3 2. 5 1.0E 03 336 7993999 LOC100271836 smg 1 homolog, phosphatidylinositol 3 kinase related kinase (C. elegans) pseudogene 2.4 7.8E 05 337 8000834 LOC440354 smg 1 homolog, phosphatidylinositol 3 kinase related kinase (C. elegans) pseudogene 2.4 3.0E 04 338 7961540 RERG RAS like, estrogen regulated, growth inhibitor 2.4 7.0E 03 339 7961757 ST8SIA1 ST8 alpha N acetyl neuraminide alpha 2,8 sialyltransferase 1 2.4 9.7E 05 340 8099259 AFAP1 actin filament associated protein 1 2.4 4.1E 06 341 8058390 RAPH1 Ras association (RalGDS 2.4 1.4E 07 342 8096875 ENPEP glutamyl aminopeptidase (aminopeptidase A) 2.4 1.9E 03 343 7961279 TAS2R14 taste receptor, type 2, member 14 2.4 3.0E 04 344 8000156 SMG1P1 smg 1 homolog, phosphatidylinositol 3 kinase related kinase pseudogene 1 2.4 1.5E 04 345 7983638 DTWD1 DTW domain containing 1 2.4 2.0E 03 346 8097058 CEP170P1 centrosomal protein 170kDa pseudogene 1 2.4 3.7E 06 347 8104568 LOC100133299 GALI1870 2.4 1.9E 05 348 8170420 MAMLD1 mastermind l ike domain containing 1 2.4 2.3E 05 349 8147079 LRRCC1 leucine rich repeat and coiled coil centrosomal protein 1 2.4 4.8E 04 350 8027241 ZNF253 zinc finger protein 253 2.4 7.1E 04 351 7986701 HERC2P2 hect domain and RLD 2 pseudogene 2 2.4 6.6E 07 352 8122773 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2.4 1.9E 06 353 7986383 IGF1R insulin like growth factor 1 receptor 2.4 1.8E 07 354 8071061 TPTEP1 transmembrane phosphatase with tensin homology pseudogene 1 2.4 1.6E 04 355 8123520 LINC00266 1 long intergenic non protein coding RNA 266 1 2.4 2.8E 05 356 7991777 C4orf46 chromosome 4 open reading frame 46 2.4 2.1E 05 357 7947189 CCDC34 coiled coil domain containing 34 2.4 5.4E 06 358 8035847 ZNF675 zinc finger protein 675 2.4 6.5E 03 359 7925691 ZNF124 zinc finger protein 124 2.4 1.9E 04 360 8017262 BRIP1 BRCA1 interacting protein C terminal helicase 1 2.4 1.4E 03 361 7991047 LOC100131860 uncharacterized LOC100131860 2.4 4.3E 04 362 8174119 ZM AT1 zinc finger, matrin type 1 2.4 2.6E 03 363 7908347 OCLM oculomedin 2.4 1.5E 04 364 7927876 TET1 tet methylcytosine dioxygenase 1 2.4 4.7E 03 365 7970329 GAS6 growth arrest specific 6 2.4 1.1E 02 366 8147101 E2F5 E2F transcription factor 5, p130 binding 2.4 1.1E 03 367 7998174 LUC7L LUC7 like (S. cerevisiae) 2.4 9.0E 07 368 7978997 MAP4K5 mitogen activated protein kinase kinase kinase kinase 5 2.4 2.8E 04 369 8103644 AB062480 Homo sapiens OK 2.4 3.1E 04 370 8135585 AY143171 Homo sa piens testin related protein TRG mRNA, complete cds. 2.4 2.4E 03 371 8036324 ZNF260 zinc finger protein 260 2.4 1.9E 03 372 8052399 BCL11A B cell CLL 2.4 5.4E 06 373 7965486 CCDC41 coiled coil domain containing 41 2.4 1.1E 04 374 8062623 PLCG1 phospholipase C, gamma 1 2.4 4.8E 07 375 8136347 CALD1 caldesmon 1 2.4 2.1E 04 376 8170648 BGN biglycan 2.4 1.5E 06 377 7962112 CAPRIN2 caprin family member 2 2.4 1.2E 04 378 7951144 CCDC82 coiled coil domain containing 82 2.4 6.7E 04 379 8089 701 ZBTB20 zinc finger and BTB domain containing 20 2.4 7.6E 04 380 8016789 MBTD1 mbt domain containing 1 2.4 1.0E 05 381 7954717 BICD1 bicaudal D homolog 1 (Drosophila) 2.4 3.5E 06 382 7961287 TAS2R19 taste receptor, type 2, member 19 2.4 6.2E 05 383 8079079 NKTR natural killer tumor recognition sequence 2.4 2.4E 05 384 7901993 CACHD1 cache domain containing 1 2.4 1.0E 03 385 8139840 ERV3 1 endogenous retrovirus group 3, member 1 2.4 3.1E 05 386 8084219 KLHL24 kelch like 24 (Drosophi la) 2.4 1.2E 03 387 8038347 TEAD2 TEA domain family member 2 2.4 1.1E 05 388 7916969 ZRANB2 zinc finger, RAN binding domain containing 2 2.3 2.3E 04 389 8093332 ZNF876P zinc finger protein 876, pseudogene 2.3 9.2E 04 390 8109938 RANBP17 RAN bin ding protein 17 2.3 2.8E 03 391 8137670 PDGFA platelet derived growth factor alpha polypeptide 2.3 1.7E 02 392 8147112 CA13 carbonic anhydrase XIII 2.3 1.2E 03 393 8066347 PTPRT protein tyrosine phosphatase, receptor type, T 2.3 7.6E 03 394 81780 59 LY6G5B lymphocyte antigen 6 complex, locus G5B 2.3 2.0E 05 395 8022320 NPIPL2 nuclear pore complex interacting protein like 2 2.3 9.2E 06 396 7972682 KDELC1 KDEL (Lys Asp Glu Leu) containing 1 2.3 1.6E 07 397 8108716 PCDHB16 protocadherin bet a 16 2.3 6.7E 03 398 7932132 FRMD4A FERM domain containing 4A 2.3 2.4E 06 399 8047174 SLC39A10 solute carrier family 39 (zinc transporter), member 10 2.3 9.3E 05 400 8176865 PCMTD2 protein L isoaspartate (D aspartate) O methyltransferase domain co ntaining 2 2.3 4.4E 05 401 8009255 CEP95 centrosomal protein 95kDa 2.3 5.8E 07 402 7918925 TRIM45 tripartite motif containing 45 2.3 7.1E 07 403 8120271 FBXO9 F box protein 9 2.3 5.4E 04 404 8152703 FBXO32 F box protein 32 2.3 7.2E 03 405 7943 160 SCARNA9L small Cajal body specific RNA 9 like 2.3 1.1E 05 406 8027368 ZNF254 zinc finger protein 254 2.3 4.0E 04

PAGE 109

109 407 8147313 TMEM67 transmembrane protein 67 2.3 1.8E 03 408 8128394 PNISR PNN interacting serine 2.3 1.3E 04 409 8135211 FAM18 5A family with sequence similarity 185, member A 2.3 6.2E 04 410 8052598 WDPCP WD repeat containing planar cell polarity effector 2.3 3.1E 04 411 7945864 ZNF195 zinc finger protein 195 2.3 2.0E 06 412 7922402 GAS5 growth arrest specific 5 (non pr otein coding) 2.3 4.8E 05 413 7997239 LOC100507607 nuclear pore complex interacting protein like 2 like 2.3 8.3E 06 414 8064637 C20orf194 chromosome 20 open reading frame 194 2.3 2.1E 04 415 7973056 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 2.3 3.5E 04 416 8094476 TBC1D19 TBC1 domain family, member 19 2.3 2.9E 03 417 8112560 SMA5 glucuronidase, beta pseudogene 2.3 4.2E 07 418 8053315 LRRTM4 leucine rich repeat transmembrane neuronal 4 2.3 2.3E 03 419 8099612 GPR125 G pro tein coupled receptor 125 2.3 9.5E 05 420 8037762 CCDC8 coiled coil domain containing 8 2.3 1.5E 04 421 8084232 YEATS2 YEATS domain containing 2 2.3 8.6E 07 422 8105991 SMA4 glucuronidase, beta pseudogene 2.3 4.6E 07 423 8082165 KALRN kalirin, RhoGEF kinase 2.3 1.2E 08 424 8072705 RASD2 RASD family, member 2 2.3 5.3E 04 425 8088560 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 2.3 2.7E 03 426 8170179 VGLL1 vestigial like 1 (Drosophila) 2.3 4.0E 03 427 8119423 ADCY1 0P1 adenylate cyclase 10 (soluble) pseudogene 1 2.3 7.7E 05 428 8153262 SLC45A4 solute carrier family 45, member 4 2.3 8.5E 04 429 7930537 TCF7L2 transcription factor 7 like 2 (T cell specific, HMG box) 2.3 5.9E 06 430 7981943 SNORD64 small nucle olar RNA, C 2.3 1.7E 03 431 7896744 OR4F3 olfactory receptor, family 4, subfamily F, member 3 2.3 6.8E 05 432 8148317 MYC v myc myelocytomatosis viral oncogene homolog (avian) 2.3 2.6E 03 433 8091550 KIAA1328 KIAA1328 2.3 3.3E 03 434 8166104 OFD 1 oral facial digital syndrome 1 2.3 4.4E 07 435 8155591 ANKRD20A8P ankyrin repeat domain 20 family, member A8, pseudogene 2.3 9.3E 03 436 7915787 PIK3R3 phosphoinositide 3 kinase, regulatory subunit 3 (gamma) 2.3 1.6E 03 437 7993580 PKD1P1 polyc ystic kidney disease 1 (autosomal dominant) pseudogene 1 2.3 8.4E 07 438 8159876 RFX3 regulatory factor X, 3 (influences HLA class II expression) 2.3 7.6E 04 439 7994026 LOC100132247 nuclear pore complex interacting protein related gene 2.3 1.6E 05 440 8104621 GUSBP1 glucuronidase, beta pseudogene 1 2.3 4.7E 07 441 8117395 HIST1H2BF histone cluster 1, H2bf 2.3 2.0E 02 442 8009040 MRC2 mannose receptor, C type 2 2.3 1.7E 05 443 8171493 CTPS2 CTP synthase 2 2.3 1.7E 04 444 8045736 FMNL2 f ormin like 2 2.3 8.7E 04 445 8136641 TAS2R3 taste receptor, type 2, member 3 2.3 4.9E 06 446 8110478 ZNF454 zinc finger protein 454 2.3 8.6E 07 447 8102532 PDE5A phosphodiesterase 5A, cGMP specific 2.3 1.1E 02 448 7909568 DTL denticleless E3 ub iquitin protein ligase homolog (Drosophila) 2.3 5.7E 03 449 8112376 CENPK centromere protein K 2.3 7.3E 04 450 8160138 NFIB nuclear factor I 2.2 1.3E 02 451 8140709 KIAA1324L KIAA1324 like 2.2 2.2E 02 452 8145611 FZD3 frizzled family receptor 3 2.2 3.6E 03 453 7920852 KIAA0907 KIAA0907 2.2 2.6E 05 454 8132917 ZNF713 zinc finger protein 713 2.2 1.8E 05 455 8035813 ZNF43 zinc finger protein 43 2.2 3.5E 03 456 8048171 PKI55 DKFZp434H1419 2.2 1.2E 07 457 8041813 CRIPT cysteine rich PD Z binding protein 2.2 3.1E 03 458 8047738 NRP2 neuropilin 2 2.2 1.3E 02 459 8046461 ZAK sterile alpha motif and leucine zipper containing kinase AZK 2.2 6.6E 06 460 7900051 EIF2C3 eukaryotic translation initiation factor 2C, 3 2.2 1.1E 04 461 794 3442 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 2.2 5.8E 03 462 8060736 BC008667 Homo sapiens cDNA clone MGC:17708 IMAGE:3868595, complete cds. 2.2 4.9E 04 463 8130071 C15orf29 chromosome 15 open reading frame 29 2.2 1.1E 03 464 7974341 GNG2 gu anine nucleotide binding protein (G protein), gamma 2 2.2 2.3E 03 465 8141882 DPY19L2P2 dpy 19 like 2 pseudogene 2 (C. elegans) 2.2 8.8E 06 466 7932433 NSUN6 NOP2 2.2 5.5E 04 467 8111153 MYO10 myosin X 2.2 1.5E 06 468 8048381 STK36 serine 2.2 4 .1E 06 469 7934706 AF130084 Homo sapiens clone FLB8310 PRO2225 mRNA, complete cds. 2.2 1.1E 03 470 7933877 JMJD1C jumonji domain containing 1C 2.2 6.4E 04 471 7967210 LOC338799 uncharacterized LOC338799 2.2 9.8E 07 472 7985053 FBXO22 F box prote in 22 2.2 8.9E 05 473 8087201 IP6K2 inositol hexakisphosphate kinase 2 2.2 1.6E 07 474 8124531 HIST1H3I histone cluster 1, H3i 2.2 1.1E 02 475 8148966 RPL23AP53 ribosomal protein L23a pseudogene 53 2.2 1.2E 06 476 7902127 SGIP1 SH3 domain GRB2 like (endophilin) interacting protein 1 2.2 2.8E 04 477 8069178 ADARB1 adenosine deaminase, RNA specific, B1 2.2 1.4E 04 478 8050497 OSR1 odd skipped related 1 (Drosophila) 2.2 5.3E 03 479 8022295 PIEZO2 piezo type mechanosensitive ion channel com ponent 2 2.2 6.1E 05 480 8037767 PNMAL1 paraneoplastic Ma antigen family like 1 2.2 5.5E 04 481 8132118 AQP1 aquaporin 1 (Colton blood group) 2.2 5.9E 04 482 7957008 CPSF6 cleavage and polyadenylation specific factor 6, 68kDa 2.2 4.6E 05 483 7925 904 AKR1E2 aldo keto reductase family 1, member E2 2.2 8.1E 07 484 7927353 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2.2 9.4E 07 485 8118322 SNORD52 small nucleolar RNA, C 2.2 1.9E 04 486 7987248 GOLGA8A golgin A8 family, m ember A 2.2 4.8E 05 487 8095545 RUFY3 RUN and FYVE domain containing 3 2.2 5.6E 07 488 8069644 APP amyloid beta (A4) precursor protein 2.2 8.9E 04 489 7933092 ZNF248 zinc finger protein 248 2.2 3.5E 04 490 8102171 TBCK TBC1 domain containing ki nase 2.2 1.3E 03 491 7972369 UGGT2 UDP glucose glycoprotein glucosyltransferase 2 2.2 1.5E 03 492 7942596 SERPINH1 serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) 2.2 4.7E 06 493 8092251 GNB4 gua nine nucleotide binding protein (G protein), beta polypeptide 4 2.2 1.0E 04 494 8161575 CBWD5 COBW domain containing 5 2.2 6.6E 06 495 7953765 RIMKLB ribosomal modification protein rimK like family member B 2.2 2.4E 05 496 7943349 ARHGAP42 Rho GTP ase activating protein 42 2.2 1.6E 03 497 7930559 AK027209 Homo sapiens cDNA: FLJ23556 fis, clone LNG09443. 2.2 7.9E 06 498 7917976 SASS6 spindle assembly 6 homolog (C. elegans) 2.2 7.4E 04 499 7934411 USP54 ubiquitin specific peptidase 54 2.2 5.8E 05 500 7921916 RGS5 regulator of G protein signaling 5 2.2 1.9E 03 501 8147503 LAPTM4B lysosomal protein transmembrane 4 beta 2.2 2.0E 04 502 8001800 CDH11 cadherin 11, type 2, OB cadherin (osteoblast) 2.2 1.5E 02 503 7961249 TAS2R10 taste rec eptor, type 2, member 10 2.2 3.5E 04 504 8108954 TCERG1 transcription elongation regulator 1 2.2 7.4E 05 505 8005839 TMEM97 transmembrane protein 97 2.2 1.6E 05 506 8154416 CCDC171 coiled coil domain containing 171 2.2 1.5E 05 507 8086908 PLXNB1 plexin B1 2.2 1.7E 06 508 8166355 CNKSR2 connector enhancer of kinase suppressor of Ras 2 2.2 4.6E 06 509 7932390 TRDMT1 tRNA aspartic acid methyltransferase 1 2.2 1.1E 04 510 8120335 FAM83B family with sequence similarity 83, member B 2.2 5.1E 03 511 7920000 POGZ pogo transposable element with ZNF domain 2.2 9.6E 06 512 7897803 PLOD1 procollagen lysine, 2 oxoglutarate 5 dioxygenase 1 2.2 4.2E 03 513 7910915 CHRM3 cholinergic receptor, muscarinic 3 2.2 4.4E 02 514 8118228 CSNK2B casei n kinase 2, beta polypeptide 2.2 3.7E 05 515 8038967 ZNF83 zinc finger protein 83 2.2 9.9E 04 516 8111339 MTMR12 myotubularin related protein 12 2.2 1.9E 05 517 7960947 A2M alpha 2 macroglobulin 2.2 5.9E 03 518 8178090 C6orf48 chromosome 6 open reading frame 48 2.2 1.7E 06 519 8085145 RAD18 RAD18 homolog (S. cerevisiae) 2.2 7.4E 06 520 7977472 OR11H12 olfactory receptor, family 11, subfamily H, member 12 2.2 2.5E 03 521 8124691 HCG8 HLA complex group 8 2.2 2.5E 06 522 8126710 SUPT3H suppressor of Ty 3 homolog (S. cerevisiae) 2.2 9.3E 04 523 8162490 HIATL1 hippocampus abundant transcript like 1 2.2 2.2E 03 524 7925500 CHML choroideremia like (Rab escort protein 2) 2.2 7.2E 05 525 8028186 ZNF146 zinc finger protein 146 2.1 1.8E 04 526 7951046 MRE11A MRE11 meiotic recombination 11 homolog A (S. cerevisiae) 2.1 6.0E 05 527 8000205 NPIPL3 nuclear pore complex interacting protein like 3 2.1 2.2E 05 528 8066254 LOC388796 uncharacterized LOC388796 2.1 3.1E 03 529 8166511 PD K3 pyruvate dehydrogenase kinase, isozyme 3 2.1 1.1E 03 530 8040985 ZNF512 zinc finger protein 512 2.1 1.5E 04 531 7923426 UBE2T ubiquitin conjugating enzyme E2T (putative) 2.1 5.6E 03 532 7999614 LOC399491 GPS, PLAT and transmembrane domain cont aining protein 2.1 5.3E 08 533 8169419 ALG13 asparagine linked glycosylation 13 homolog (S. cerevisiae) 2.1 2.6E 04 534 8020308 C18orf1 chromosome 18 open reading frame 1 2.1 1.6E 06 535 8122365 GPR126 G protein coupled receptor 126 2.1 1.7E 03 5 36 7905909 EFNA4 ephrin A4 2.1 9.2E 06 537 8070194 RUNX1 runt related transcription factor 1 2.1 2.0E 06 538 8015607 STAT3 signal transducer and activator of transcription 3 (acute phase response factor) 2.1 5.4E 04 539 7933139 ZNF33B zinc finge r protein 33B 2.1 2.9E 03 540 8058477 KLF7 Kruppel like factor 7 (ubiquitous) 2.1 5.5E 05 541 8048014 RPE ribulose 5 phosphate 3 epimerase 2.1 7.3E 04 542 8010078 LOC100507246 uncharacterized LOC100507246 2.1 1.0E 04 543 7922408 SNORD78 small n ucleolar RNA, C 2.1 7.1E 03 544 8021181 SCARNA17 small Cajal body specific RNA 17 2.1 6.8E 06 545 7994565 RRN3P2 RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2 2.1 3.6E 03 546 8093453 FLJ35816 FLJ35816 protein 2.1 2.9E 05

PAGE 110

110 547 7987369 ATPBD4 ATP binding domain 4 2.1 1.7E 03 548 8015526 KAT2A K(lysine) acetyltransferase 2A 2.1 1.7E 07 549 7943690 DDX10 DEAD (Asp Glu Ala Asp) box polypeptide 10 2.1 6.0E 06 550 8158998 RPL7A ribosomal protein L7a 2.1 2.5E 04 551 8039593 ZNF667 zinc finger protein 667 2.1 5.4E 05 552 7965523 NR2C1 nuclear receptor subfamily 2, group C, member 1 2.1 1.6E 04 553 8137474 ACTR3B ARP3 actin related protein 3 homolog B (yeast) 2.1 7.5E 05 554 8094342 PACRGL PARK2 co regulated like 2.1 3.6E 04 555 8035803 ZNF708 zinc finger protein 708 2.1 3.9E 03 556 7933413 BMS1P5 BMS1 pseudogene 5 2.1 8.9E 05 557 7969204 WDFY2 WD repeat and FYVE domain containing 2 2.1 9.6E 06 558 8057045 FKBP7 FK506 binding protein 7 2.1 6.8E 04 559 7902883 LRRC8D leucine rich repeat containing 8 family, member D 2.1 1.1E 04 560 8025488 ZNF559 ZNF177 ZNF559 ZNF177 readthrough 2.1 9.3E 06 561 8176026 FLNA filamin A, alpha 2.1 1.3E 04 562 8173310 OPHN1 oligophrenin 1 2.1 3.2E 03 563 81 13433 EFNA5 ephrin A5 2.1 4.5E 05 564 7920877 ARHGEF2 Rho 2.1 1.8E 06 565 8047577 ALS2CR8 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 2.1 8.7E 04 566 7943890 LOC100132686 uncharacterized LOC100132686 2.1 2.2E 05 56 7 7918913 IGSF3 immunoglobulin superfamily, member 3 2.1 4.2E 04 568 7994371 LOC728741 uncharacterized LOC728741 2.1 7.1E 06 569 7961960 RN5S354 RNA, 5S ribosomal 354 2.1 6.2E 05 570 8068761 ABCG1 ATP binding cassette, sub family G (WHITE), memb er 1 2.1 3.0E 04 571 8162850 TEX10 testis expressed 10 2.1 3.2E 05 572 8141625 EPHB4 EPH receptor B4 2.1 3.3E 06 573 7959761 FAM101A family with sequence similarity 101, member A 2.1 4.9E 04 574 8021924 THOC1 THO complex 1 2.1 8.6E 06 575 8161 373 Rinn lincRNA linc FAM75A7 2 chr9: :42363047 42367092 2.1 3.0E 03 576 8050869 AY358728 Homo sapiens clone DNA108758 GNNC2999 (UNQ2999) mRNA, complete cds. 2.1 9.5E 05 577 8111952 C5orf28 chromosome 5 open reading frame 28 2.1 1.8E 04 578 8133049 ZNF107 zinc finger protein 107 2.1 8.8E 04 579 7949956 MTL5 metallothionein like 5, testis specific (tesmin) 2.1 2.6E 08 580 8167673 MAGED4B melanoma antigen family D, 4B 2.1 1.5E 05 581 8007799 MGC57346 uncharacterized LOC401884 2.1 2.2E 04 5 82 8013015 CENPV centromere protein V 2.1 2.2E 03 583 7933427 AGAP8 ArfGAP with GTPase domain, ankyrin repeat and PH domain 8 2.1 1.6E 07 584 8088264 IL17RD interleukin 17 receptor D 2.1 7.2E 04 585 8088142 CHDH choline dehydrogenase 2.1 2.1E 03 586 7980940 ATXN3 ataxin 3 2.1 2.4E 04 587 7993404 NPIP nuclear pore complex interacting protein 2.1 1.1E 07 588 8023377 MEX3C mex 3 homolog C (C. elegans) 2.1 1.7E 06 589 7916024 TTC39A tetratricopeptide repeat domain 39A 2.1 7.9E 06 590 810 8697 PCDHB5 protocadherin beta 5 2.1 1.7E 03 591 8141872 NAPEPLD N acyl phosphatidylethanolamine phospholipase D 2.1 4.7E 03 592 8090737 NPHP3 nephronophthisis 3 (adolescent) 2.1 1.3E 03 593 7970793 SLC46A3 solute carrier family 46, member 3 2.1 2.0E 02 594 8156263 SPIN1 spindlin 1 2.1 2.1E 04 595 8006237 LOC400590 uncharacterized LOC400590 2.1 1.3E 02 596 8141371 GJC3 gap junction protein, gamma 3, 30.2kDa 2.1 2.4E 03 597 8161587 CBWD3 COBW domain containing 3 2.1 2.9E 05 598 802726 0 ZNF486 zinc finger protein 486 2.1 5.6E 04 599 8147221 OSGIN2 oxidative stress induced growth inhibitor family member 2 2.1 2.2E 04 600 8133057 ZNF138 zinc finger protein 138 2.1 1.2E 03 601 7959408 KNTC1 kinetochore associated 1 2.1 1.7E 04 602 8175432 RBMX RNA binding motif protein, X linked 2.1 1.0E 03 603 8160040 PTPRD protein tyrosine phosphatase, receptor type, D 2.1 1.5E 02 604 8131519 PHF14 PHD finger protein 14 2.1 1.5E 06 605 8166469 SAT1 spermidine 2.1 4.0E 03 606 812315 5 PNLDC1 poly(A) specific ribonuclease (PARN) like domain containing 1 2.1 3.4E 02 607 7984569 LRRC49 leucine rich repeat containing 49 2.1 7.4E 03 608 8094134 LOC728419 ubiquitin carboxyl terminal hydrolase 17 like 2.1 1.1E 02 609 8031992 LOC100 506479 uncharacterized LOC100506479 2.1 5.1E 06 610 8014974 TOP2A topoisomerase (DNA) II alpha 170kDa 2.1 4.2E 02 611 8056113 LY75 lymphocyte antigen 75 2.1 1.3E 03 612 7909503 SERTAD4 SERTA domain containing 4 2.1 3.1E 04 613 8088348 FAM116A family with sequence similarity 116, member A 2.1 4.0E 04 614 8171297 MID1 midline 1 (Opitz 2.1 4.9E 04 615 8161433 AK091508 Homo sapiens cDNA FLJ34189 fis, clone FCBBF3017535. 2.1 4.7E 06 616 7958000 CHPT1 choline phosphotransferase 1 2.1 3.8E 02 617 8119858 POLH polymerase (DNA directed), eta 2.1 6.9E 05 618 8019737 KPNA2 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 2.1 2.4E 02 619 8052908 CLEC4F C type lectin domain family 4, member F 2.1 9.5E 03 620 7899562 PTPRU protein tyro sine phosphatase, receptor type, U 2.1 6.9E 04 621 8169617 PGRMC1 progesterone receptor membrane component 1 2.0 4.8E 03 622 8132439 C7orf10 chromosome 7 open reading frame 10 2.0 9.7E 06 623 8146717 SGK3 serum 2.0 1.3E 03 624 7971039 FAM48A fa mily with sequence similarity 48, member A 2.0 3.4E 04 625 8139212 GLI3 GLI family zinc finger 3 2.0 4.8E 04 626 8075673 RBFOX2 RNA binding protein, fox 1 homolog (C. elegans) 2 2.0 1.0E 06 627 8122099 ENPP1 ectonucleotide pyrophosphatase 2.0 2.2E 02 628 7909708 CENPF centromere protein F, 350 2.0 2.5E 02 629 8105585 RNF180 ring finger protein 180 2.0 1.5E 02 630 8070046 GCFC1 GC rich sequence DNA binding factor 1 2.0 2.5E 05 631 8027247 ZNF93 zinc finger protein 93 2.0 4.6E 05 632 809 0988 CEP70 centrosomal protein 70kDa 2.0 1.1E 03 633 8166289 CDKL5 cyclin dependent kinase like 5 2.0 2.5E 04 634 8047606 NBEAL1 neurobeachin like 1 2.0 1.7E 03 635 8027304 ZNF493 zinc finger protein 493 2.0 3.9E 03 636 8060977 C20orf94 chrom osome 20 open reading frame 94 2.0 8.7E 04 637 8117646 ZNF192 zinc finger protein 192 2.0 1.0E 04 638 7968274 PAN3 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) 2.0 1.8E 03 639 7948906 SNHG1 small nucleolar RNA host gene 1 (no n protein coding) 2.0 7.6E 04 640 8165888 AF118077 Homo sapiens PRO1808 mRNA, complete cds. 2.0 1.7E 04 641 7964347 TMEM194A transmembrane protein 194A 2.0 4.6E 04 642 8044346 LOC151009 uncharacterized LOC151009 2.0 1.3E 03 643 7933574 AGAP4 Arf GAP with GTPase domain, ankyrin repeat and PH domain 4 2.0 9.9E 08 644 8080714 FLNB filamin B, beta 2.0 4.9E 08 645 8153890 ZNF251 zinc finger protein 251 2.0 1.2E 05 646 8160559 DDX58 DEAD (Asp Glu Ala Asp) box polypeptide 58 2.0 1.7E 04 647 812 9418 PTPRK protein tyrosine phosphatase, receptor type, K 2.0 1.5E 03 648 8047538 BMPR2 bone morphogenetic protein receptor, type II (serine 2.0 9.5E 04 649 8042601 ZNF638 zinc finger protein 638 2.0 5.2E 04 650 8096463 SMARCAD1 SWI 2.0 5.3E 04 651 8078784 XYLB xylulokinase homolog (H. influenzae) 2.0 4.9E 04 652 8059279 EPHA4 EPH receptor A4 2.0 4.6E 05 653 8168316 OGT O linked N acetylglucosamine (GlcNAc) transferase 2.0 1.1E 04 654 7917433 ODF2L outer dense fiber of sperm tails 2 l ike 2.0 3.1E 03 655 7925978 FAM208B family with sequence similarity 208, member B 2.0 2.5E 04 656 7904478 LINC00328 long intergenic non protein coding RNA 328 2.0 1.1E 02 657 8091656 METTL15 methyltransferase like 15 2.0 2.0E 02 658 8035842 ZNF9 1 zinc finger protein 91 2.0 1.4E 02 659 8042195 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 2.0 7.5E 05 660 8149774 LOXL2 lysyl oxidase like 2 2.0 1.7E 02 661 8142036 SRPK2 SRSF protein kinase 2 2.0 5.2E 06 662 81 67835 TRO trophinin 2.0 9.2E 06 663 7920317 ILF2 interleukin enhancer binding factor 2, 45kDa 2.0 2.3E 05 664 7916185 ZCCHC11 zinc finger, CCHC domain containing 11 2.0 1.8E 04 665 7967091 SPPL3 signal peptide peptidase like 3 2.0 3.2E 04 666 8 066303 CHD6 chromodomain helicase DNA binding protein 6 2.0 8.4E 06 667 8052526 XPO1 exportin 1 (CRM1 homolog, yeast) 2.0 8.1E 04 668 7926896 CKS1B CDC28 protein kinase regulatory subunit 1B 2.0 1.0E 04 669 8035779 ZNF626 zinc finger protein 626 2.0 4.3E 04 670 7968800 DGKH diacylglycerol kinase, eta 2.0 1.3E 04 671 7902992 RPAP2 RNA polymerase II associated protein 2 2.0 7.2E 05 672 8112202 PLK2 polo like kinase 2 2.0 1.6E 05 673 8097262 SPATA5 spermatogenesis associated 5 2.0 7.4E 0 6 674 8041644 PLEKHH2 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 2.0 9.0E 03 675 8086141 EPM2AIP1 EPM2A (laforin) interacting protein 1 2.0 2.6E 03 676 7928291 CHST3 carbohydrate (chondroitin 6) sulfotransferase 3 2.0 1.4E 04 677 8128522 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2.0 1.4E 04 678 8006170 LRRC37BP1 leucine rich repeat containing 37B pseudogene 1 2.0 5.2E 04 679 8064322 C20orf96 chromosome 20 open reading fr ame 96 2.0 2.8E 05 680 7919584 HIST2H2BF histone cluster 2, H2bf 2.0 1.5E 02 681 7926189 SEC61A2 Sec61 alpha 2 subunit (S. cerevisiae) 2.0 2.3E 05 682 8036151 HSPB6 heat shock protein, alpha crystallin related, B6 2.0 1.8E 04 683 7947512 PAMR1 peptidase domain containing associated with muscle regeneration 1 2.0 3.7E 05 684 8026047 JUNB jun B proto oncogene 2.0 3.5E 02 685 8002778 MLKL mixed lineage kinase domain like 2.0 9.6E 09 686 8091799 SPTSSB serine palmitoyltransferase, small subunit B 2.0 3.0E 03

PAGE 111

111 687 8172425 SLC38A5 solute carrier family 38, member 5 2.0 1.4E 05 688 8126382 C6orf132 chromosome 6 open reading frame 132 2.0 1.2E 02 689 7991386 CIB1 calcium and integrin binding 1 (calmyrin) 2.0 1.1E 05 690 8165496 TUBB4B tubulin, beta 4B class IVb 2.0 1.5E 04 691 8137783 TMEM184A transmembrane protein 184A 2.0 1.6E 04 692 8101874 ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide 2.0 1.3E 03 693 7922474 KIAA0040 KIAA0040 2.0 2.3E 03 694 8161 745 RN5S285 RNA, 5S ribosomal 285 2.0 3.5E 02 695 8028984 CYP2F1 cytochrome P450, family 2, subfamily F, polypeptide 1 2.0 1.6E 02 696 8129837 IL20RA interleukin 20 receptor, alpha 2.0 1.8E 03 697 7901613 ACOT11 acyl CoA thioesterase 11 2.0 2.2E 05 698 8061564 ID1 inhibitor of DNA binding 1, dominant negative helix loop helix protein 2.0 3.7E 02 699 7965873 IGF1 insulin like growth factor 1 (somatomedin C) 2.0 9.4E 03 700 7917875 F3 coagulation factor III (thromboplastin, tissue fa ctor) 2.0 9.0E 03 701 7966779 NOS1 nitric oxide synthase 1 (neuronal) 2.0 2.5E 04 702 8026877 SLC5A5 solute carrier family 5 (sodium iodide symporter), member 5 2.0 7.4E 03 703 8166784 TSPAN7 tetraspanin 7 2.0 2.7E 03 704 7928882 C10orf116 chromosome 10 open reading frame 116 2.0 6.7E 04 705 8114612 CD14 CD14 molecule 2.0 1.3E 03 706 7943984 ZBTB16 zinc finger and BTB domain containing 16 2.0 7.3E 05 707 8005458 LGALS9C lectin, galactoside binding, soluble, 9C 2.0 2.4E 04 708 7 962895 FKBP11 FK506 binding protein 11, 19 kDa 2.1 4.0E 04 709 7920642 MUC1 mucin 1, cell surface associated 2.1 1.8E 02 710 7968062 ATP12A ATPase, H+ 2.1 1.8E 02 711 8095697 CXCL1 chemokine (C X C motif) ligand 1 (melanoma growth stimulating activity, alpha) 2.1 2.5E 03 712 7912659 AGMAT agmatine ureohydrolase (agmatinase) 2.1 7.6E 05 713 7919600 TRNAG34P transfer RNA glycine 34 (anticodon CCC) pseudogene 2.1 2.4E 03 714 8030067 SULT2B1 sulfotransferase family, cytosolic, 2B, memb er 1 2.1 3.4E 02 715 8148476 DENND3 DENN 2.1 9.5E 06 716 8013450 LGALS9 lectin, galactoside binding, soluble, 9 2.1 2.8E 04 717 7979241 BMP4 bone morphogenetic protein 4 2.1 6.8E 04 718 8144121 PTPRN2 protein tyrosine phosphatase, receptor type, N polypeptide 2 2.1 3.8E 03 719 8100994 CXCL2 chemokine (C X C motif) ligand 2 2.1 5.6E 03 720 8106999 C5orf27 chromosome 5 open reading frame 27 2.1 1.0E 02 721 7938299 RN5S330 RNA, 5S ribosomal 330 2.1 3.9E 02 722 8090823 SLCO2A1 so lute carrier organic anion transporter family, member 2A1 2.1 6.5E 04 723 8098414 SPCS3 signal peptidase complex subunit 3 homolog (S. cerevisiae) 2.1 1.1E 04 724 8140463 FGL2 fibrinogen like 2 2.1 3.8E 03 725 8101622 TECR trans 2,3 enoyl CoA r eductase 2.1 1.8E 05 726 8034202 RAB3D RAB3D, member RAS oncogene family 2.1 3.8E 04 727 8090343 KLF15 Kruppel like factor 15 2.1 5.8E 04 728 8092978 MUC4 mucin 4, cell surface associated 2.1 2.9E 03 729 8006123 CPD carboxypeptidase D 2.1 2.5E 02 730 8122334 CCRL1 chemokine (C C motif) receptor like 1 2.1 2.9E 03 731 8044080 SLC9A2 solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2 2.1 1.1E 02 732 7983360 B2M beta 2 microglobulin 2.1 4.5E 03 733 8 115147 CD74 CD74 molecule, major histocompatibility complex, class II invariant chain 2.1 9.5E 04 734 7968015 TNFRSF19 tumor necrosis factor receptor superfamily, member 19 2.1 1.8E 03 735 8174513 CHRDL1 chordin like 1 2.1 7.5E 03 736 7971015 SMAD9 SMAD family member 9 2.1 1.6E 02 737 7937079 BNIP3 BCL2 2.1 5.8E 04 738 7979473 DHRS7 dehydrogenase 2.1 4.5E 03 739 8013319 GRAP GRB2 related adaptor protein 2.1 6.7E 05 740 7952022 AMICA1 adhesion molecule, interacts with CXADR anti gen 1 2.1 1.1E 03 741 8059177 TUBA4A tubulin, alpha 4a 2.1 2.8E 03 742 8041781 EPAS1 endothelial PAS domain protein 1 2.1 6.7E 04 743 7926786 APBB1IP amyloid beta (A4) precursor protein binding, family B, member 1 interacting protein 2.1 9.2E 04 744 7994769 CORO1A coronin, actin binding protein, 1A 2.1 2.5E 02 745 8114215 PITX1 paired like homeodomain 1 2.1 1.8E 04 746 8038785 VSIG10L V set and immunoglobulin domain containing 10 like 2.1 6.8E 03 747 8077899 PPARG peroxisome prol iferator activated receptor gamma 2.1 1.1E 04 748 8000117 CRYM crystallin, mu 2.1 1.3E 03 749 8156228 CTSL1 cathepsin L1 2.1 4.1E 03 750 8028600 NCCRP1 non specific cytotoxic cell receptor protein 1 homolog (zebrafish) 2.1 2.6E 02 751 7932765 MPP7 membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) 2.1 1.2E 04 752 8002020 TPPP3 tubulin polymerization promoting protein family member 3 2.1 9.0E 03 753 8092177 NCEH1 neutral cholesterol ester hydrolase 1 2.1 7.8E 05 754 79 06777 FCGR2B Fc fragment of IgG, low affinity IIb, receptor (CD32) 2.1 3.0E 04 755 8096070 BMP3 bone morphogenetic protein 3 2.1 1.4E 03 756 7916364 LDLRAD1 low density lipoprotein receptor class A domain containing 1 2.1 7.9E 03 757 8153474 T STA3 tissue specific transplantation antigen P35B 2.1 2.3E 05 758 8057599 TFPI tissue factor pathway inhibitor (lipoprotein associated coagulation inhibitor) 2.1 1.3E 02 759 8179481 HLA DRA major histocompatibility complex, class II, DR alpha 2.1 8.5E 03 760 7918457 KCNA3 potassium voltage gated channel, shaker related subfamily, member 3 2.1 3.8E 03 761 8042696 SPR sepiapterin reductase (7,8 dihydrobiopterin:NADP+ oxidoreductase) 2.1 3.4E 06 762 8113214 GLRX glutaredoxin (thioltransfer ase) 2.1 6.5E 03 763 8005097 HS3ST3B1 heparan sulfate (glucosamine) 3 O sulfotransferase 3B1 2.1 6.9E 06 764 8153959 DOCK8 dedicator of cytokinesis 8 2.1 3.0E 03 765 7998233 TMEM8A transmembrane protein 8A 2.1 3.8E 05 766 8092800 ATP13A4 AT Pase type 13A4 2.1 5.7E 03 767 8096845 EGF epidermal growth factor 2.1 3.0E 02 768 7905581 S100A1 S100 calcium binding protein A1 2.1 1.6E 03 769 7928046 TSPAN15 tetraspanin 15 2.1 7.9E 04 770 8115261 CCDC69 coiled coil domain containing 69 2.2 2.2E 04 771 8152812 FAM84B family with sequence similarity 84, member B 2.2 3.5E 05 772 7975268 ARG2 arginase, type II 2.2 9.8E 04 773 7952426 VSIG2 V set and immunoglobulin domain containing 2 2.2 6.1E 05 774 7903893 CD53 CD53 molecul e 2.2 4.6E 02 775 7958410 FICD FIC domain containing 2.2 4.0E 04 776 8125537 HLA DMA major histocompatibility complex, class II, DM alpha 2.2 2.2E 03 777 8131550 SCIN scinderin 2.2 2.7E 02 778 8056323 FIGN fidgetin 2.2 1.1E 02 779 7973084 ANG angiogenin, ribonuclease, RNase A family, 5 2.2 4.6E 03 780 8118345 CFB complement factor B 2.2 2.7E 03 781 8157524 TLR4 toll like receptor 4 2.2 9.1E 03 782 8126820 GPR110 G protein coupled receptor 110 2.2 6.5E 03 783 7941148 TM7SF2 transmembrane 7 superfamily member 2 2.2 2.3E 05 784 8113369 SLCO4C1 solute carrier organic anion transporter family, member 4C1 2.2 4.2E 02 785 8097513 MGST2 microsomal glutathione S transferase 2 2.2 1.7E 05 786 7962274 KIF21A kinesin famil y member 21A 2.2 1.2E 04 787 7976783 DLK1 delta like 1 homolog (Drosophila) 2.2 2.0E 04 788 7909877 MARC1 mitochondrial amidoxime reducing component 1 2.2 4.8E 03 789 7961365 MANSC1 MANSC domain containing 1 2.2 1.7E 02 790 7914342 FABP3 fa tty acid binding protein 3, muscle and heart (mammary derived growth inhibitor) 2.2 3.0E 03 791 8140166 RN5S233 RNA, 5S ribosomal 233 2.2 1.2E 02 792 8147661 SPAG1 sperm associated antigen 1 2.2 2.3E 03 793 8168470 COX7B cytochrome c oxidase su bunit VIIb 2.2 5.9E 06 794 8028332 KCNK6 potassium channel, subfamily K, member 6 2.2 4.1E 06 795 7929065 IFIT1 interferon induced protein with tetratricopeptide repeats 1 2.2 9.9E 04 796 8122265 TNFAIP3 tumor necrosis factor, alpha induced pro tein 3 2.2 2.5E 02 797 8152355 SYBU syntabulin (syntaxin interacting) 2.2 1.0E 04 798 7943413 BIRC3 baculoviral IAP repeat containing 3 2.2 2.8E 02 799 8037835 SLC1A5 solute carrier family 1 (neutral amino acid transporter), member 5 2.2 3.9E 04 800 8122196 RN5S218 RNA, 5S ribosomal 218 2.2 3.5E 02 801 7899023 LDLRAP1 low density lipoprotein receptor adaptor protein 1 2.2 2.4E 05 802 8041582 PKDCC protein kinase domain containing, cytoplasmic homolog (mouse) 2.2 2.1E 04 803 7965357 GALNT4 UDP N acetyl alpha D galactosamine:polypeptide N acetylgalactosaminyltransferase 4 (GalNAc T4) 2.2 1.7E 02 804 8055872 CACNB4 calcium channel, voltage dependent, beta 4 subunit 2.2 2.6E 04 805 7902518 GIPC2 GIPC PDZ domain containing fami ly, member 2 2.2 1.1E 04 806 7944185 CD3G CD3g molecule, gamma (CD3 TCR complex) 2.2 7.5E 03 807 8169174 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 2.2 7.4E 04 808 8175177 MBNL3 muscleblind like splicing regulator 3 2.2 2.4E 0 5 809 7917912 DPYD dihydropyrimidine dehydrogenase 2.2 3.0E 04 810 8007043 RAPGEFL1 Rap guanine nucleotide exchange factor (GEF) like 1 2.2 2.0E 02 811 7920082 RORC RAR related orphan receptor C 2.2 7.4E 04 812 7910377 RN5S19 RNA, 5S ribosom al 19 2.2 5.5E 03 813 8042310 SLC1A4 solute carrier family 1 (glutamate 2.2 1.7E 04 814 7995419 RN5S425 RNA, 5S ribosomal 425 2.2 3.2E 02 815 7956046 DGKA diacylglycerol kinase, alpha 80kDa 2.2 4.3E 04 816 8066619 PLTP phospholipid transfer protein 2.3 2.5E 03 817 8111677 LIFR leukemia inhibitory factor receptor alpha 2.3 2.0E 02 818 8108631 VTRNA1 3 vault RNA 1 3 2.3 3.0E 06 819 7999253 PPL periplakin 2.3 1.9E 02 820 8115623 ATP10B ATPase, class V, type 10B 2.3 2.4E 04 821 7956878 IRAK3 interleukin 1 receptor associated kinase 3 2.3 3.9E 02 822 8041225 EHD3 EH domain containing 3 2.3 8.0E 04 823 8024062 CFD complement factor D (adipsin) 2.3 2.1E 05 824 8056343 COBLL1 COBL like 1 2.3 4.5E 04 825 7930413 DUSP 5 dual specificity phosphatase 5 2.3 4.5E 03 826 7991034 HOMER2 homer homolog 2 (Drosophila) 2.3 1.7E 03

PAGE 112

112 827 7908409 RGS2 regulator of G protein signaling 2, 24kDa 2.3 4.8E 03 828 8152463 RN5S276 RNA, 5S ribosomal 276 2.3 4.4E 02 829 8101992 SLC39A8 solute carrier family 39 (zinc transporter), member 8 2.3 3.8E 02 830 8038747 KLK12 kallikrein related peptidase 12 2.3 1.3E 02 831 8026861 B3GNT3 UDP GlcNAc:betaGal beta 1,3 N acetylglucosaminyltransferase 3 2.3 1.4E 03 832 8068383 C LIC6 chloride intracellular channel 6 2.3 3.6E 03 833 7936494 GFRA1 GDNF family receptor alpha 1 2.3 7.4E 03 834 7965040 PHLDA1 pleckstrin homology like domain, family A, member 1 2.3 1.6E 03 835 8005638 ALDH3A2 aldehyde dehydrogenase 3 family member A2 2.3 1.8E 06 836 7939150 PRRG4 proline rich Gla (G carboxyglutamic acid) 4 (transmembrane) 2.3 1.2E 03 837 8163618 TNFSF15 tumor necrosis factor (ligand) superfamily, member 15 2.3 1.6E 04 838 8144880 SH2D4A SH2 domain containing 4A 2.3 5.2E 06 839 7955348 GPD1 glycerol 3 phosphate dehydrogenase 1 (soluble) 2.3 1.9E 04 840 8156321 SYK spleen tyrosine kinase 2.3 2.1E 04 841 7899160 CD52 CD52 molecule 2.3 2.1E 02 842 8016718 CHAD chondroadherin 2.3 9.8E 03 843 7924450 DUSP10 dual specificity phosphatase 10 2.3 9.5E 03 844 7961075 CD69 CD69 molecule 2.3 1.5E 02 845 7934997 PPP1R3C protein phosphatase 1, regulatory subunit 3C 2.3 1.2E 02 846 8070579 TFF1 trefoil factor 1 2.3 3.8E 03 847 8143221 ATP6V0A4 ATPase, H+ transporting, lysosomal V0 subunit a4 2.3 3.3E 03 848 8151310 EYA1 eyes absent homolog 1 (Drosophila) 2.3 9.9E 03 849 8009685 SLC9A3R1 solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1 2.3 4.1 E 05 850 8084710 ADIPOQ adiponectin, C1Q and collagen domain containing 2.3 1.8E 03 851 8011671 GGT6 gamma glutamyltransferase 6 2.3 2.4E 05 852 8149811 NKX3 1 NK3 homeobox 1 2.3 2.0E 02 853 7931832 LOC100653286 aldo keto reductase family 1 member C2 like 2.3 4.5E 03 854 8146906 RN5S271 RNA, 5S ribosomal 271 2.3 2.3E 02 855 7965964 SLC41A2 solute carrier family 41, member 2 2.3 1.8E 02 856 8000346 ERN2 endoplasmic reticulum to nucleus signaling 2 2.3 7.1E 03 857 8058627 ERBB4 v erb a erythroblastic leukemia viral oncogene homolog 4 (avian) 2.3 1.8E 02 858 8156761 NANS N acetylneuraminic acid synthase 2.3 4.5E 04 859 8155849 ANXA1 annexin A1 2.3 2.5E 02 860 8161945 RASEF RAS and EF hand domain containing 2.3 1.6E 03 861 7912706 EPHA2 EPH receptor A2 2.3 1.6E 03 862 8173745 CYSLTR1 cysteinyl leukotriene receptor 1 2.3 2.1E 03 863 8028652 ZFP36 zinc finger protein 36, C3H type, homolog (mouse) 2.4 1.1E 02 864 8072170 KREMEN1 kringle containing transmembr ane protein 1 2.4 6.0E 06 865 8082797 TF transferrin 2.4 7.9E 03 866 8139712 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 2.4 9.0E 07 867 8009301 PRKCA protein kinase C, alpha 2.4 7.8E 06 868 8152606 SNTB1 syntrophin, bet a 1 (dystrophin associated protein A1, 59kDa, basic component 1) 2.4 4.0E 04 869 8084717 ST6GAL1 ST6 beta galactosamide alpha 2,6 sialyltranferase 1 2.4 3.0E 02 870 8174361 TSC22D3 TSC22 domain family, member 3 2.4 3.9E 05 871 7907702 SOAT1 ste rol O acyltransferase 1 2.4 3.5E 03 872 7971690 RN5S29 RNA, 5S ribosomal 29 2.4 3.3E 02 873 8161892 GNA14 guanine nucleotide binding protein (G protein), alpha 14 2.4 9.9E 04 874 8047272 SPATS2L spermatogenesis associated, serine rich 2 like 2 .4 6.2E 04 875 7929816 SCD stearoyl CoA desaturase (delta 9 desaturase) 2.4 5.8E 03 876 8011516 ATP2A3 ATPase, Ca++ transporting, ubiquitous 2.4 5.1E 03 877 7968789 RGCC regulator of cell cycle 2.4 1.5E 03 878 8161568 LOC642424 ig kappa chai n V I region Walker like 2.4 1.6E 03 879 8059580 DNER delta 2.4 3.3E 02 880 8108447 CXXC5 CXXC finger protein 5 2.4 4.5E 07 881 8104447 RN5S177 RNA, 5S ribosomal 177 2.4 5.4E 03 882 8013384 ALDH3A1 aldehyde dehydrogenase 3 family, member A1 2.4 1.2E 02 883 7958913 OAS2 2' 5' oligoadenylate synthetase 2, 69 2.4 2.4E 05 884 7994265 RN5S405 RNA, 5S ribosomal 405 2.5 2.8E 02 885 8119016 MAPK13 mitogen activated protein kinase 13 2.5 1.2E 05 886 8081288 TMEM45A transmembrane prote in 45A 2.5 2.5E 03 887 7922174 F5 coagulation factor V (proaccelerin, labile factor) 2.5 3.5E 02 888 7975076 HSPA2 heat shock 70kDa protein 2 2.5 6.3E 06 889 8108912 SH3RF2 SH3 domain containing ring finger 2 2.5 4.0E 04 890 7966259 GLTP gl ycolipid transfer protein 2.5 2.8E 04 891 8114572 HBEGF heparin binding EGF like growth factor 2.5 5.1E 03 892 8003156 RN5S433 RNA, 5S ribosomal 433 2.5 2.5E 02 893 7942957 PRSS23 protease, serine, 23 2.5 1.2E 02 894 7997662 KIAA0513 KIAA05 13 2.5 1.3E 06 895 7995362 GPT2 glutamic pyruvate transaminase (alanine aminotransferase) 2 2.5 6.9E 05 896 8121838 TPD52L1 tumor protein D52 like 1 2.5 3.7E 04 897 8096602 DAPP1 dual adaptor of phosphotyrosine and 3 phosphoinositides 2.5 2.3E 03 898 8016390 COPZ2 coatomer protein complex, subunit zeta 2 2.5 2.4E 05 899 7903227 PALMD palmdelphin 2.5 4.3E 03 900 8131600 TSPAN13 tetraspanin 13 2.5 1.1E 02 901 8001547 PLLP plasmolipin 2.5 6.2E 05 902 7949971 CPT1A carnitine palm itoyltransferase 1A (liver) 2.5 3.5E 06 903 7981720 IGHV3 35 immunoglobulin heavy variable 3 35 (non functional) 2.5 2.9E 02 904 8171624 GPR64 G protein coupled receptor 64 2.5 3.6E 03 905 8059642 SLC16A14 solute carrier family 16, member 14 (m onocarboxylic acid transporter 14) 2.5 4.2E 04 906 8125919 FKBP5 FK506 binding protein 5 2.5 2.1E 04 907 8041542 GALM galactose mutarotase (aldose 1 epimerase) 2.5 7.4E 06 908 7967318 HCAR2 hydroxycarboxylic acid receptor 2 2.5 4.1E 05 909 80 08588 HLF hepatic leukemia factor 2.5 4.2E 06 910 8134834 AGFG2 ArfGAP with FG repeats 2 2.6 1.5E 04 911 8040249 ATP6V1C2 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 2.6 7.7E 03 912 8155930 GCNT1 glucosaminyl (N acetyl) transferas e 1, core 2 2.6 1.3E 03 913 8017867 FAM20A family with sequence similarity 20, member A 2.6 1.2E 03 914 8101762 SNCA synuclein, alpha (non A4 component of amyloid precursor) 2.6 6.0E 04 915 8170119 FHL1 four and a half LIM domains 1 2.6 2.8E 0 4 916 7907260 FMO6P flavin containing monooxygenase 6 pseudogene 2.6 1.5E 02 917 8021301 RAB27B RAB27B, member RAS oncogene family 2.6 6.7E 05 918 8047300 AOX1 aldehyde oxidase 1 2.6 2.6E 03 919 8078971 ENTPD3 ectonucleoside triphosphate dip hosphohydrolase 3 2.6 1.5E 03 920 8078933 MYRIP myosin VIIA and Rab interacting protein 2.6 1.2E 04 921 8007493 ARL4D ADP ribosylation factor like 4D 2.6 2.8E 05 922 8023497 ATP8B1 ATPase, aminophospholipid transporter, class I, type 8B, member 1 2.6 4.3E 04 923 8048717 SGPP2 sphingosine 1 phosphate phosphatase 2 2.6 1.7E 03 924 8073680 TRNAU2 transfer RNA selenocysteine 2 (anticodon UCA) 2.6 2.2E 03 925 8029136 CD79A CD79a molecule, immunoglobulin associated alpha 2.6 1.4E 02 926 8081171 CRYBG3 beta gamma crystallin domain containing 3 2.6 1.4E 05 927 8052355 EFEMP1 EGF containing fibulin like extracellular matrix protein 1 2.6 3.7E 03 928 7935337 PIK3AP1 phosphoinositide 3 kinase adaptor protein 1 2.7 2.3E 04 929 81431 44 PTN pleiotrophin 2.7 5.0E 04 930 7981068 SERPINA1 serpin peptidase inhibitor, clade A (alpha 1 antiproteinase, antitrypsin), member 1 2.7 1.1E 02 931 8108627 VTRNA1 1 vault RNA 1 1 2.7 4.8E 04 932 7913385 RAP1GAP RAP1 GTPase activating pro tein 2.7 4.8E 03 933 8070567 TFF3 trefoil factor 3 (intestinal) 2.7 3.2E 02 934 7913667 GALE UDP galactose 4 epimerase 2.7 3.4E 05 935 8033987 ICAM3 intercellular adhesion molecule 3 2.7 4.7E 05 936 7936463 ABLIM1 actin binding LIM protein 1 2.7 2.0E 05 937 7974835 PRKCH protein kinase C, eta 2.7 6.7E 06 938 8133721 HSPB1 heat shock 27kDa protein 1 2.7 9.0E 04 939 7970441 GJB2 gap junction protein, beta 2, 26kDa 2.7 2.6E 02 940 7901256 CYP4B1 cytochrome P450, family 4, subfam ily B, polypeptide 1 2.7 5.1E 04 941 7950906 CTSC cathepsin C 2.7 1.7E 03 942 8021528 TNFRSF11A tumor necrosis factor receptor superfamily, member 11a, NFKB activator 2.7 1.2E 04 943 8078386 GPD1L glycerol 3 phosphate dehydrogenase 1 like 2.7 4.8E 05 944 8014316 CCL5 chemokine (C C motif) ligand 5 2.7 5.8E 03 945 8113220 ELL2 elongation factor, RNA polymerase II, 2 2.7 2.1E 05 946 8043484 IGKV1OR2 118 immunoglobulin kappa variable 1 2.7 3.3E 03 947 8002882 CHST6 carbohydrate (N a cetylglucosamine 6 O) sulfotransferase 6 2.7 2.4E 03 948 8055980 CYTIP cytohesin 1 interacting protein 2.7 1.9E 02 949 8103951 ACSL1 acyl CoA synthetase long chain family member 1 2.7 1.7E 04 950 8121257 PRDM1 PR domain containing 1, with ZNF d omain 2.7 1.2E 02 951 7938629 PDE3B phosphodiesterase 3B, cGMP inhibited 2.7 7.0E 04 952 8116439 SCGB3A1 secretoglobin, family 3A, member 1 2.7 1.5E 02 953 7958884 OAS1 2' 5' oligoadenylate synthetase 1, 40 2.7 6.0E 06 954 8174277 RN5S511 R NA, 5S ribosomal 511 2.7 4.6E 02 955 8146934 LY96 lymphocyte antigen 96 2.7 1.4E 02 956 7991762 HBA1 hemoglobin, alpha 1 2.7 5.5E 03 957 7956826 TBC1D30 TBC1 domain family, member 30 2.8 1.7E 03 958 7922976 PTGS2 prostaglandin endoperoxide synthase 2 (prostaglandin G 2.8 8.7E 03 959 8103769 HPGD hydroxyprostaglandin dehydrogenase 15 (NAD) 2.8 8.2E 03 960 8038633 KLK1 kallikrein 1 2.8 1.0E 02 961 8134452 BHLHA15 basic helix loop helix family, member a15 2.8 5.9E 04 962 8101828 TSPAN5 tetraspanin 5 2.8 5.9E 05 963 7932160 FAM107B family with sequence similarity 107, member B 2.8 1.1E 03 964 8163257 LPAR1 lysophosphatidic acid receptor 1 2.8 1.1E 03 965 8056545 STK39 serine threonine kinase 39 2.8 4.1E 04 966 796132 0 PRB1 proline rich protein BstNI subfamily 1 2.8 3.8E 02

PAGE 113

113 967 7909214 RASSF5 Ras association (RalGDS 2.8 4.7E 08 968 8153002 NDRG1 N myc downstream regulated 1 2.8 5.6E 04 969 7996563 HSD11B2 hydroxysteroid (11 beta) dehydrogenase 2 2.8 9.7E 04 970 8098611 TLR3 toll like receptor 3 2.8 1.3E 05 971 7928944 PAPSS2 3' phosphoadenosine 5' phosphosulfate synthase 2 2.9 3.1E 02 972 8091537 IGSF10 immunoglobulin superfamily, member 10 2.9 1.4E 03 973 7983512 SQRDL sulfide quinone redu ctase like (yeast) 2.9 2.3E 05 974 7928543 RN5S321 RNA, 5S ribosomal 321 2.9 1.6E 02 975 8068583 KCNJ15 potassium inwardly rectifying channel, subfamily J, member 15 2.9 7.6E 05 976 8161174 GNE glucosamine (UDP N acetyl) 2 epimerase 2.9 6.1E 0 3 977 8032392 MKNK2 MAP kinase interacting serine 2.9 4.5E 09 978 8113512 EPB41L4A erythrocyte membrane protein band 4.1 like 4A 2.9 5.5E 06 979 8163002 KLF4 Kruppel like factor 4 (gut) 2.9 9.3E 03 980 7988990 WDR72 WD repeat domain 72 2.9 1.5E 02 981 8126891 CRISP2 cysteine rich secretory protein 2 2.9 1.1E 03 982 7934898 ANKRD22 ankyrin repeat domain 22 2.9 1.2E 02 983 7984001 GCNT3 glucosaminyl (N acetyl) transferase 3, mucin type 2.9 3.4E 03 984 7977933 SLC7A8 solute carri er family 7 (amino acid transporter light chain, L system), member 8 2.9 4.0E 05 985 8101904 ADH7 alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide 3.0 3.9E 02 986 8090314 ALDH1L1 aldehyde dehydrogenase 1 family, member L1 3.0 2.3E 04 9 87 8071658 IGLV7 46 immunoglobulin lambda variable 7 46 (gene 3.0 1.4E 03 988 8115831 DUSP1 dual specificity phosphatase 1 3.0 5.2E 03 989 7919800 CTSS cathepsin S 3.0 1.7E 03 990 8033043 FUT6 fucosyltransferase 6 (alpha (1,3) fucosyltransfer ase) 3.0 1.7E 05 991 7922130 DPT dermatopontin 3.0 7.8E 05 992 8049487 MLPH melanophilin 3.0 1.3E 03 993 8120961 MRAP2 melanocortin 2 receptor accessory protein 2 3.0 1.7E 04 994 7919055 HMGCS2 3 hydroxy 3 methylglutaryl CoA synthase 2 (mit ochondrial) 3.0 5.4E 03 995 8005879 SLC13A2 solute carrier family 13 (sodium dependent dicarboxylate transporter), member 2 3.0 1.1E 02 996 8146115 C8orf4 chromosome 8 open reading frame 4 3.0 2.0E 04 997 8129254 MAN1A1 mannosidase, alpha, clas s 1A, member 1 3.0 9.0E 05 998 7960362 LOC100128816 ACAH3104 3.0 3.9E 02 999 8030094 FUT2 fucosyltransferase 2 (secretor status included) 3.0 1.2E 04 1000 7915910 PDZK1IP1 PDZK1 interacting protein 1 3.0 1.4E 06 1001 8052940 PAIP2B poly(A) binding protein interacting protein 2B 3.1 6.6E 05 1002 8144786 SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 3.1 2.5E 04 1003 8101881 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 3.1 1.1E 03 1004 7917276 LPAR3 lysophosphatidic acid receptor 3 3.1 1.8E 05 1005 7958784 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 3.1 2.1E 05 1006 8127854 ME1 malic enzyme 1, NADP(+) dependent, cytosolic 3.1 2.6E 04 1007 8089145 ABI3BP ABI f amily, member 3 (NESH) binding protein 3.1 1.1E 02 1008 7916432 DHCR24 24 dehydrocholesterol reductase 3.1 1.7E 05 1009 8103226 TMEM154 transmembrane protein 154 3.1 1.2E 02 1010 8141094 PDK4 pyruvate dehydrogenase kinase, isozyme 4 3.2 1.4E 0 3 1011 8045882 DAPL1 death associated protein like 1 3.2 2.1E 03 1012 7981722 IGHV3 38 immunoglobulin heavy variable 3 38 (non functional) 3.2 3.4E 02 1013 7955297 AQP5 aquaporin 5 3.2 1.9E 02 1014 8150889 SDR16C5 short chain dehydrogenase 3.2 2.0E 05 1015 7946579 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 3.2 7.1E 05 1016 8001457 CES1 carboxylesterase 1 3.2 2.8E 05 1017 8157264 SLC31A2 solute carrier family 31 (copper transporters), member 2 3.2 6.9E 04 1018 79225 98 ANGPTL1 angiopoietin like 1 3.2 8.7E 04 1019 8165453 LRRC26 leucine rich repeat containing 26 3.2 1.0E 03 1020 8147132 CA2 carbonic anhydrase II 3.2 8.1E 04 1021 8053713 IGKV2 10 immunoglobulin kappa variable 2 10 (pseudogene) 3.2 1.9E 02 1022 7979505 SIX1 SIX homeobox 1 3.2 1.4E 03 1023 8002303 NQO1 NAD(P)H dehydrogenase, quinone 1 3.2 1.1E 04 1024 8160889 CCL21 chemokine (C C motif) ligand 21 3.2 5.2E 03 1025 7920297 S100A14 S100 calcium binding protein A14 3.3 8.6E 03 1 026 8046099 NOSTRIN nitric oxide synthase trafficker 3.3 1.7E 02 1027 7981737 IGHV3 72 immunoglobulin heavy variable 3 72 3.3 2.4E 02 1028 8043433 IGKC immunoglobulin kappa constant 3.3 1.4E 02 1029 7913593 TCEA3 transcription elongation fact or A (SII), 3 3.3 6.6E 04 1030 8101429 PLAC8 placenta specific 8 3.3 2.3E 02 1031 7979179 ERO1L ERO1 like (S. cerevisiae) 3.3 1.6E 04 1032 8092726 CLDN1 claudin 1 3.3 1.7E 02 1033 7988414 GATM glycine amidinotransferase (L arginine:glycine amidinotransferase) 3.3 7.7E 04 1034 8123598 SERPINB1 serpin peptidase inhibitor, clade B (ovalbumin), member 1 3.4 2.6E 04 1035 7963313 GALNT6 UDP N acetyl alpha D galactosamine:polypeptide N acetylgalactosaminyltransferase 6 (GalNAc T6) 3.4 1.3E 03 1036 8043474 IGKV1D 42 immunoglobulin kappa variable 1D 42 (non functional) 3.4 8.5E 03 1037 8081710 SIDT1 SID1 transmembrane family, member 1 3.4 1.8E 05 1038 7906613 SLAMF7 SLAM family member 7 3.4 1.1E 03 1039 7979658 GPX2 glutathione peroxidase 2 (gastrointestinal) 3.4 6.5E 03 1040 8043360 IGKV3 7 immunoglobulin kappa variable 3 7 (non functional) 3.5 7.5E 03 1041 8067125 BCAS1 breast carcinoma amplified sequence 1 3.5 3.6E 04 1042 8142585 CADPS2 Ca++ dependent secretion a ctivator 2 3.5 2.3E 03 1043 8106448 PDE8B phosphodiesterase 8B 3.5 2.3E 03 1044 8043459 IGKV1D 16 immunoglobulin kappa variable 1D 16 3.5 1.0E 02 1045 7946033 HBB hemoglobin, beta 3.5 2.0E 03 1046 8135544 FOXP2 forkhead box P2 3.5 1.1E 04 1047 8163181 C9orf152 chromosome 9 open reading frame 152 3.5 9.5E 04 1048 8161884 PRUNE2 prune homolog 2 (Drosophila) 3.5 5.9E 03 1049 7925452 GREM2 gremlin 2 3.5 6.8E 04 1050 7907160 ATP1B1 ATPase, Na+ 3.5 8.2E 05 1051 7938687 NUCB2 nu cleobindin 2 3.5 4.6E 04 1052 7981732 IGHV4 61 immunoglobulin heavy variable 4 61 3.5 3.5E 02 1053 8075182 XBP1 X box binding protein 1 3.6 1.0E 03 1054 7951686 IL18 interleukin 18 (interferon gamma inducing factor) 3.6 1.3E 02 1055 7944931 SLC37A2 solute carrier family 37 (glycerol 3 phosphate transporter), member 2 3.6 4.7E 04 1056 8118069 MUC21 mucin 21, cell surface associated 3.6 2.6E 02 1057 8038735 KLK11 kallikrein related peptidase 11 3.6 7.9E 05 1058 8088180 WNT5A wingle ss type MMTV integration site family, member 5A 3.6 1.1E 04 1059 7960365 EFCAB4B EF hand calcium binding domain 4B 3.6 1.6E 02 1060 8043443 IGKV2 24 immunoglobulin kappa variable 2 24 3.6 8.9E 03 1061 7944164 TMPRSS4 transmembrane protease, ser ine 4 3.6 2.0E 03 1062 8163908 GGTA1P glycoprotein, alpha galactosyltransferase 1 pseudogene 3.7 5.8E 03 1063 8140840 STEAP4 STEAP family member 4 3.7 2.9E 03 1064 8029086 CEACAM5 carcinoembryonic antigen related cell adhesion molecule 5 3.7 7 .0E 03 1065 8103877 CLDN22 claudin 22 3.7 2.0E 02 1066 7922846 FAM129A family with sequence similarity 129, member A 3.7 1.4E 03 1067 8043446 IGKV6 21 immunoglobulin kappa variable 6 21 (non functional) 3.7 1.4E 03 1068 8122071 ENPP3 ectonuc leotide pyrophosphatase 3.7 4.2E 03 1069 7981730 IGLJ3 immunoglobulin lambda joining 3 3.7 2.8E 02 1070 7991283 RHCG Rh family, C glycoprotein 3.8 2.6E 02 1071 8033054 FUT3 fucosyltransferase 3 (galactoside 3(4) L fucosyltransferase, Lewis bloo d group) 3.8 7.3E 05 1072 8156770 GALNT12 UDP N acetyl alpha D galactosamine:polypeptide N acetylgalactosaminyltransferase 12 (GalNAc T12) 3.8 7.4E 04 1073 8125843 SPDEF SAM pointed domain containing ets transcription factor 3.8 9.9E 03 1074 8018 774 ST6GALNAC1 ST6 (alpha N acetyl neuraminyl 2,3 beta galactosyl 1,3) N acetylgalactosaminide alpha 2,6 sialyltransferase 1 3.8 1.1E 03 1075 7944023 NXPE2 neurexophilin and PC esterase domain family, member 2 3.8 1.1E 02 1076 8173444 IL2RG inter leukin 2 receptor, gamma 3.8 9.2E 04 1077 7973974 PAX9 paired box 9 3.8 2.5E 04 1078 8043470 IGKV3D 11 immunoglobulin kappa variable 3D 11 3.9 2.1E 02 1079 8021453 SEC11C SEC11 homolog C (S. cerevisiae) 3.9 7.2E 04 1080 8162502 FBP1 fructos e 1,6 bisphosphatase 1 3.9 1.2E 04 1081 8106354 IQGAP2 IQ motif containing GTPase activating protein 2 3.9 5.5E 03 1082 8128123 RRAGD Ras related GTP binding D 3.9 2.0E 04 1083 8096459 RN5S164 RNA, 5S ribosomal 164 3.9 2.9E 02 1084 8172204 M AOB monoamine oxidase B 4.0 3.7E 05 1085 7959102 HSPB8 heat shock 22kDa protein 8 4.0 4.6E 04 1086 7965979 ALDH1L2 aldehyde dehydrogenase 1 family, member L2 4.0 2.0E 03 1087 8043449 IGK@ immunoglobulin kappa locus 4.0 1.3E 02 1088 8120833 SH3BGRL2 SH3 domain binding glutamic acid rich protein like 2 4.0 1.5E 04 1089 8043465 IGKV1D 13 immunoglobulin kappa variable 1D 13 4.0 1.5E 02 1090 7902738 CLCA4 chloride channel accessory 4 4.0 7.3E 03 1091 7993638 TMC5 transmembrane channe l like 5 4.1 8.5E 03 1092 8078227 KAT2B K(lysine) acetyltransferase 2B 4.1 5.9E 08 1093 8133876 CD36 CD36 molecule (thrombospondin receptor) 4.1 1.8E 05 1094 7961252 PRR4 proline rich 4 (lacrimal) 4.1 3.7E 02 1095 8149927 CLU clusterin 4.1 3.5E 03 1096 7983239 CKMT1A creatine kinase, mitochondrial 1A 4.1 1.6E 05 1097 8084165 SOX2 SRY (sex determining region Y) box 2 4.1 9.4E 04 1098 7987385 MEIS2 Meis homeobox 2 4.2 1.3E 04 1099 7904361 FAM46C family with sequence similarity 46, member C 4.2 7.8E 04 1100 8136709 LOC93432 maltase glucoamylase (alpha glucosidase) pseudogene 4.2 1.3E 03 1101 8045835 GALNT5 UDP N acetyl alpha D galactosamine:polypeptide N acetylgalactosaminyltransferase 5 (GalNAc T5) 4.3 2.1E 05 1102 793 9642 CREB3L1 cAMP responsive element binding protein 3 like 1 4.3 9.9E 04 1103 7960529 SCNN1A sodium channel, non voltage gated 1 alpha subunit 4.3 6.4E 06 1104 7923850 SLC26A9 solute carrier family 26, member 9 4.3 3.5E 04 1105 8095451 C4orf4 0 chromosome 4 open reading frame 40 4.3 2.5E 02 1106 8037197 CXCL17 chemokine (C X C motif) ligand 17 4.4 1.9E 03

PAGE 114

114 1107 7981740 IGHV3 74 immunoglobulin heavy variable 3 74 4.4 1.6E 02 1108 8066493 SLPI secretory leukocyte peptidase inhibitor 4.5 9.6E 04 1109 8123246 SLC22A3 solute carrier family 22 (extraneuronal monoamine transporter), member 3 4.6 2.7E 04 1110 8090433 MGLL monoglyceride lipase 4.7 6.1E 08 1111 7947156 MUC15 mucin 15, cell surface associated 4.7 1.3E 04 1112 8043 476 IGKV1D 43 immunoglobulin kappa variable 1D 43 4.7 1.5E 02 1113 7981718 IGHV3 33 immunoglobulin heavy variable 3 33 4.7 2.0E 02 1114 8095488 SMR3A submaxillary gland androgen regulated protein 3A 4.8 5.2E 03 1115 7964722 WIF1 WNT inhibitor y factor 1 4.8 1.2E 03 1116 7966749 TESC tescalcin 4.9 4.8E 04 1117 8043431 IGKV1 33 immunoglobulin kappa variable 1 33 4.9 2.0E 02 1118 8061847 BPIFA2 BPI fold containing family A, member 2 5.0 2.8E 02 1119 8158167 LCN2 lipocalin 2 5.0 1. 6E 03 1120 8138289 ETV1 ets variant 1 5.0 4.3E 03 1121 7945169 TMEM45B transmembrane protein 45B 5.1 7.7E 05 1122 7981728 IGHV3 52 immunoglobulin heavy variable 3 52 (pseudogene) 5.1 2.4E 02 1123 8043436 IGKV2D 29 immunoglobulin kappa variab le 2D 29 5.2 1.0E 02 1124 8082673 ACPP acid phosphatase, prostate 5.2 7.7E 07 1125 8148059 DEPTOR DEP domain containing MTOR interacting protein 5.3 1.7E 04 1126 8095751 PARM1 prostate androgen regulated mucin like protein 1 5.3 5.3E 04 1127 8095467 FDCSP follicular dendritic cell secreted protein 5.5 3.5E 02 1128 8043468 IGKV1 12 immunoglobulin kappa variable 1 12 5.7 6.8E 03 1129 8029098 CEACAM6 carcinoembryonic antigen related cell adhesion molecule 6 (non specific cross reacting antigen) 5.8 1.2E 03 1130 8088425 FAM3D family with sequence similarity 3, member D 6.2 1.3E 05 1131 7964927 TSPAN8 tetraspanin 8 6.2 4.8E 03 1132 8101893 ADH1C alcohol dehydrogenase 1C (class I), gamma polypeptide 6.3 7.8E 04 1133 8095380 T MPRSS11E transmembrane protease, serine 11E 6.4 8.1E 04 1134 8095435 HTN1 histatin 1 6.5 1.4E 02 1135 8008736 LPO lactoperoxidase 6.6 3.5E 03 1136 8149097 DEFB1 defensin, beta 1 6.8 7.2E 05 1137 8043441 IGKV1D 27 immunoglobulin kappa varia ble 1D 27 (pseudogene) 6.8 2.4E 03 1138 7989501 CA12 carbonic anhydrase XII 6.9 8.7E 06 1139 7992732 ZG16B zymogen granule protein 16 homolog B (rat) 6.9 1.7E 02 1140 8151532 FABP4 fatty acid binding protein 4, adipocyte 7.1 9.0E 05 1141 7901 175 TSPAN1 tetraspanin 1 7.2 1.0E 02 1142 8160670 AQP3 aquaporin 3 (Gill blood group) 7.3 7.0E 06 1143 8056222 DPP4 dipeptidyl peptidase 4 7.5 6.2E 04 1144 8061780 BPIFB2 BPI fold containing family B, member 2 7.6 2.1E 02 1145 7948444 TCN1 transcobalamin I (vitamin B12 binding protein, R binder family) 7.6 2.3E 02 1146 8161755 ALDH1A1 aldehyde dehydrogenase 1 family, member A1 7.7 5.9E 04 1147 8173869 POF1B premature ovarian failure, 1B 8.6 4.9E 06 1148 8095491 SMR3B submaxilla ry gland androgen regulated protein 3B 9.0 6.0E 03 1149 8095456 ODAM odontogenic, ameloblast asssociated 9.1 7.2E 03 1150 8138381 AGR2 anterior gradient 2 homolog (Xenopus laevis) 9.3 1.2E 02 1151 8100827 IGJ immunoglobulin J polypeptide, linke r protein for immunoglobulin alpha and mu polypeptides 9.6 1.2E 02 1152 8068684 FAM3B family with sequence similarity 3, member B 10.1 2.1E 05 1153 8061894 BPIFB1 BPI fold containing family B, member 1 10.8 1.9E 02 1154 8095504 MUC7 mucin 7, se creted 10.9 1.2E 02 1155 7957023 LYZ lysozyme 11.2 9.9E 03 1156 7923929 PIGR polymeric immunoglobulin receptor 12.8 8.3E 03 1157 7931108 DMBT1 deleted in malignant brain tumors 1 13.2 5.1E 03 1158 8095422 STATH statherin 17.5 7.8E 03 1159 8136839 PIP prolactin induced protein 20.7 1.3E 03 1160 8126905 CRISP3 cysteine rich secretory protein 3 22.4 1.4E 03

PAGE 115

115 LIST OF REFERENCES 1. Lodish, M., Multiple endocrine neoplasia type 2. Front Horm Res, 2013. 41 : p. 16 2 9. 2. Pruett, R.C. and L. Atkins, Chromosome studies in patients with retinoblastoma. Arch Ophthalmol, 1969. 82 (2): p. 177 81. 3. Mayr, C., M.T. Hemann, and D.P. Bartel, Disrupting the pairing between let 7 and Hmga2 enhances oncogenic transformation. Scie nce, 2007. 315 (5818): p. 1576 9. 4. Francois, J., Autosomal chromosome aberrations in ophthalmology. Int Ophthalmol Clin, 1968. 8 (4): p. 839 910. 5. Molinari, F. and M. Frattini, Functions and Regulation of the PTEN Gene in Colorectal Cancer. Front Oncol, 2013. 3 : p. 326. 6. Hiemstra, J.L., S.S. Schneider, and G.M. Brodeur, High resolution mapping of the N myc amplicon core domain in neuroblastomas. Prog Clin Biol Res, 1994. 385 : p. 51 7. 7. Lacal, J.C., S.K. Srivastava, P.S. Anderson, and S.A. Aaronson, Ra s p21 proteins with high or low GTPase activity can efficiently transform NIH/3T3 cells. Cell, 1986. 44 (4): p. 609 17. 8. Boveri, T., Zur Frage der Entstehung maligner Yumoren. Gustav Fisher Verlag, 1914(Jena). 9. Rowley, J.D., Letter: A new consistent chr omosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature, 1973. 243 (5405): p. 290 3. 10. Lobato, M.N., M. Metzler, L. Drynan, A. Forster, R. Pannell, and T.H. Rabbitts, Modeling chromosomal tra nslocations using conditional alleles to recapitulate initiating events in human leukemias. J Natl Cancer Inst Monogr, 2008(39): p. 58 63. 11. Rassool, F.V., DNA double strand breaks (DSB) and non homologous end joining (NHEJ) pathways in human leukemia. C ancer Lett, 2003. 193 (1): p. 1 9. 12. Taleei, R. and H. Nikjoo, The non homologous end joining (NHEJ) pathway for the repair of DNA double strand breaks: I. A mathematical model. Radiat Res, 2013. 179 (5): p. 530 9. 13. Kallenbach, S. and F. Rougeon, A V(D) J site specific recombination model involving no compulsory double stranded break formation at the coding segments. Res Immunol, 1992. 143 (9): p. 873 8.

PAGE 116

116 14. Williams, G.J., M. Hammel, S.K. Radhakrishnan, D. Ramsden, S.P. Lees Miller, and J.A. Tainer, Struc tural insights into NHEJ: Building up an integrated picture of the dynamic DSB repair super complex, one component and interaction at a time. DNA Repair (Amst), 2014. 15. Sears, C.R. and J.J. Turchi, Complex cisplatin double strand break (DSB) lesions dire ctly impair cellular non homologous end joining (NHEJ) independent of downstream damage response (DDR) pathways. J Biol Chem, 2012. 287 (29): p. 24263 72. 16. Pierce, A.J. and M. Jasin, NHEJ deficiency and disease. Mol Cell, 2001. 8 (6): p. 1160 1. 17. Burma S., B.P. Chen, and D.J. Chen, Role of non homologous end joining (NHEJ) in maintaining genomic integrity. DNA Repair (Amst), 2006. 5 (9 10): p. 1042 8. 18. Brady, N., T.J. Gaymes, M. Cheung, G.J. Mufti, and F.V. Rassool, Increased error prone NHEJ activit y in myeloid leukemias is associated with DNA damage at sites that recruit key nonhomologous end joining proteins. Cancer Res, 2003. 63 (8): p. 1798 805. 19. Ma, Y., H. Lu, K. Schwarz, and M.R. Lieber, Repair of double strand DNA breaks by the human nonhomo logous DNA end joining pathway: the iterative processing model. Cell Cycle, 2005. 4 (9): p. 1193 200. 20. Kosinski, J., E. Kubareva, and J.M. Bujnicki, A model of restriction endonuclease MvaI in complex with DNA: a template for interpretation of experiment al data and a guide for specificity engineering. Proteins, 2007. 68 (1): p. 324 36. 21. Weinstock, D.M., B. Elliott, and M. Jasin, A model of oncogenic rearrangements: differences between chromosomal translocation mechanisms and simple double strand break r epair. Blood, 2006. 107 (2): p. 777 80. 22. Williams, C.J., I. Grandal, D.J. Vesprini, U. Wojtyra, J.S. Danska, and C.J. Guidos, Irradiation promotes V(D)J joining and RAG dependent neoplastic transformation in SCID T cell precursors. Mol Cell Biol, 2001. 2 1 (2): p. 400 13. 23. Avigad, S., G. Kuperstein, J. Zilberstein, E. Liberzon, B. Stark, I. Gelernter, Y. Kodman, D. Luria, S. Ash, J. Stein, Y. Goshen, I. Yaniv, I.J. Cohen, and R. Zaizov, TEL AML1 fusion transcript designates a favorable outcome with an in tensified protocol in childhood acute lymphoblastic leukemia. Leukemia, 1999. 13 (3): p. 481 3. 24. Rabbitts, T.H., Commonality but diversity in cancer gene fusions. Cell, 2009. 137 (3): p. 391 5.

PAGE 117

117 25. Mitelman, F., B. Johansson, and F. Mertens, The impact of translocations and gene fusions on cancer causation. Nat Rev Cancer, 2007. 7 (4): p. 233 45. 26. Huret, J.L., M. Ahmad, M. Arsaban, A. Bernheim, J. Cigna, F. Desangles, J.C. Guignard, M.C. Jacquemot Perbal, M. Labarussias, V. Leberre, A. Malo, C. Morel Pai r, H. Mossafa, J.C. Potier, G. Texier, F. Viguie, S. Yau Chun Wan Senon, A. Zasadzinski, and P. Dessen, Atlas of genetics and cytogenetics in oncology and haematology in 2013. Nucleic Acids Res, 2013. 41 (Database issue): p. D920 4. 27. Ito, F.A., J. Jorge, P.A. Vargas, and M.A. Lopes, Histopathological findings of pleomorphic adenomas of the salivary glands. Med Oral Patol Oral Cir Bucal, 2009. 14 (2): p. E57 61. 28. Spuntarelli, G., L. Santecchia, U. Urbani, and M. Zama, Minor salivary gland neoplasm in chi ldren. J Craniofac Surg, 2013. 24 (2): p. 664 7. 29. Voz, M.L., A.K. Astrom, K. Kas, J. Mark, G. Stenman, and W.J. Van de Ven, The recurrent translocation t(5;8)(p13;q12) in pleomorphic adenomas results in upregulation of PLAG1 gene expression under control of the LIFR promoter. Oncogene, 1998. 16 (11): p. 1409 16. 30. Voz, M.L., N.S. Agten, W.J. Van de Ven, and K. Kas, PLAG1, the main translocation target in pleomorphic adenoma of the salivary glands, is a positive regulator of IGF II. Cancer Res, 2000. 60 (1 ): p. 106 13. 31. Martins, C., I. Fonseca, L. Roque, T. Pereira, C. Ribeiro, J. Bullerdiek, and J. Soares, PLAG1 gene alterations in salivary gland pleomorphic adenoma and carcinoma ex pleomorphic adenoma: a combined study using chromosome banding, in situ hybridization and immunocytochemistry. Mod Pathol, 2005. 18 (8): p. 1048 55. 32. Declercq, J., F. Van Dyck, B. Van Damme, and W.J. Van de Ven, Upregulation of Igf and Wnt signalling associated genes in pleomorphic adenomas of the salivary glands in PLAG1 t ransgenic mice. Int J Oncol, 2008. 32 (5): p. 1041 7. 33. Sgarra, R., A. Rustighi, M.A. Tessari, J. Di Bernardo, S. Altamura, A. Fusco, G. Manfioletti, and V. Giancotti, Nuclear phosphoproteins HMGA and their relationship with chromatin structure and cancer FEBS Lett, 2004. 574 (1 3): p. 1 8. 34. Reeves, R., Molecular biology of HMGA proteins: hubs of nuclear function. Gene, 2001. 277 (1 2): p. 63 81. 35. Fedele, M., R. Visone, I. De Martino, G. Troncone, D. Palmieri, S. Battista, A. Ciarmiello, P. Pallante, C. Arra, R.M. Melillo, K. Helin, C.M. Croce, and A. Fusco, HMGA2 induces pituitary tumorigenesis by enhancing E2F1 activity. Cancer Cell, 2006. 9 (6): p. 459 71.

PAGE 118

118 36. Wu, J., Z. Liu, C. Shao, Y. Gong, E. Hernando, P. Lee, M. Narita, W. Muller, J. Liu, and J. J. Wei, HMGA2 overexpression induced ovarian surface epithelial transformation is mediated through regulation of EMT genes. Cancer Res, 2011. 71 (2): p. 349 59. 37. Zha, L., J. Zhang, W. Tang, N. Zhang, M. He, Y. Guo, and Z. Wang, HMGA2 elicits EMT by activ ating the Wnt/beta catenin pathway in gastric cancer. Dig Dis Sci, 2013. 58 (3): p. 724 33. 38. Thuault, S., U. Valcourt, M. Petersen, G. Manfioletti, C.H. Heldin, and A. Moustakas, Transforming growth factor beta employs HMGA2 to elicit epithelial mesenchy mal transition. J Cell Biol, 2006. 174 (2): p. 175 83. 39. Young, A.R. and M. Narita, Oncogenic HMGA2: short or small? Genes Dev, 2007. 21 (9): p. 1005 9. 40. Geurts, J.M., E.F. Schoenmakers, E. Roijer, A.K. Astrom, G. Stenman, and W.J. van de Ven, Identific ation of NFIB as recurrent translocation partner gene of HMGIC in pleomorphic adenomas. Oncogene, 1998. 16 (7): p. 865 72. 41. Nilsson, M., I. Panagopoulos, F. Mertens, and N. Mandahl, Fusion of the HMGA2 and NFIB genes in lipoma. Virchows Arch, 2005. 447 (5 ): p. 855 8. 42. Sgarra, R., E. Maurizio, S. Zammitti, A. Lo Sardo, V. Giancotti, and G. Manfioletti, Macroscopic differences in HMGA oncoproteins post translational modifications: C terminal phosphorylation of HMGA2 affects its DNA binding properties. J P roteome Res, 2009. 8 (6): p. 2978 89. 43. Cattaruzzi, G., S. Altamura, M.A. Tessari, A. Rustighi, V. Giancotti, C. Pucillo, and G. Manfioletti, The second AT hook of the architectural transcription factor HMGA2 is determinant for nuclear localization and fu nction. Nucleic Acids Res, 2007. 35 (6): p. 1751 60. 44. Pasquali, D., G.M. Pierantoni, A. Fusco, S. Staibano, V. Colantuoni, A. De Bellis, A. Bellastella, and A.A. Sinisi, Fenofibrate increases the expression of high mobility group AT hook 2 (HMGA2) gene a nd induces adipocyte differentiation of orbital fibroblasts from Graves' ophthalmopathy. J Mol Endocrinol, 2004. 33 (1): p. 133 43. 45. Xi, Y.N., X.Y. Xin, and H.M. Ye, Effects of HMGA2 on malignant degree, invasion, metastasis, proliferation and cellular m orphology of ovarian cancer cells. Asian Pac J Trop Med, 2014. 7 (4): p. 289 92. 46. He, X., J. Yang, Q. Zhang, H. Cui, and Y. Zhang, Shortening of the 3' untranslated region: an important mechanism leading to overexpression of HMGA2 in serous ovarian cance r. Chin Med J (Engl), 2014. 127 (3): p. 494 9.

PAGE 119

119 47. Lee, Y.S. and A. Dutta, The tumor suppressor microRNA let 7 represses the HMGA2 oncogene. Genes Dev, 2007. 21 (9): p. 1025 30. 48. Wang, X., X. Liu, A.Y. Li, L. Chen, L. Lai, H.H. Lin, S. Hu, L. Yao, J. Peng S. Loera, L. Xue, B. Zhou, L. Zhou, S. Zheng, P. Chu, S. Zhang, D.K. Ann, and Y. Yen, Overexpression of HMGA2 promotes metastasis and impacts survival of colorectal cancers. Clin Cancer Res. 17 (8): p. 2570 80. 49. Wang, T., X. Zhang, L. Obijuru, J. Laser V. Aris, P. Lee, K. Mittal, P. Soteropoulos, and J.J. Wei, A micro RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas. Genes Chromosomes Cancer, 2007. 46 (4): p. 336 47. 50. Borrmann, L., S. Wilkening, and J. Bullerdiek, The expression of HMGA genes is regulated by their 3'UTR. Oncogene, 2001. 20 (33): p. 4537 41. 51. Tirado, Y., M.D. Williams, E.Y. Hanna, F.J. Kaye, J.G. Batsakis, and A.K. El Naggar, CRTC1/MAML2 fusion transcript in high grade mucoepidermoi d carcinomas of salivary and thyroid glands and Warthin's tumors: implications for histogenesis and biologic behavior. Genes Chromosomes Cancer, 2007. 46 (7): p. 708 15. 52. Anzick, S.L., W.D. Chen, Y. Park, P. Meltzer, D. Bell, A.K. El Naggar, and F.J. Kay e, Unfavorable prognosis of CRTC1 MAML2 positive mucoepidermoid tumors with CDKN2A deletions. Genes Chromosomes Cancer. 49 (1): p. 59 69. 53. Tonon, G., S. Modi, L. Wu, A. Kubo, A.B. Coxon, T. Komiya, K. O'Neil, K. Stover, A. El Naggar, J.D. Griffin, I.R. K irsch, and F.J. Kaye, t(11;19)(q21;p13) translocation in mucoepidermoid carcinoma creates a novel fusion product that disrupts a Notch signaling pathway. Nat Genet, 2003. 33 (2): p. 208 13. 54. Lefkowitz, R.J., Identification of adenylate cyclase coupled be ta adrenergic receptors with radiolabeled beta adrenergic antagonists. Biochem Pharmacol, 1975. 24 (18): p. 1651 8. 55. Persson, M., Y. Andren, J. Mark, H.M. Horlings, F. Persson, and G. Stenman, Recurrent fusion of MYB and NFIB transcription factor genes i n carcinomas of the breast and head and neck. Proc Natl Acad Sci U S A, 2009. 106 (44): p. 18740 4. 56. Mitani, Y., J. Li, P.H. Rao, Y.J. Zhao, D. Bell, S.M. Lippman, R.S. Weber, C. Caulin, and A.K. El Naggar, Comprehensive analysis of the MYB NFIB gene fus ion in salivary adenoid cystic carcinoma: Incidence, variability, and clinicopathologic significance. Clin Cancer Res. 16 (19): p. 4722 31. 57. Mitani, Y., J. Li, P.H. Rao, Y.J. Zhao, D. Bell, S.M. Lippman, R.S. Weber, C. Caulin, and A.K. El Naggar, Compreh ensive analysis of the MYB NFIB gene

PAGE 120

120 fusion in salivary adenoid cystic carcinoma: Incidence, variability, and clinicopathologic significance. Clin Cancer Res, 2010. 16 (19): p. 4722 31. 58. Klempnauer, K.H., T.J. Gonda, and J.M. Bishop, Nucleotide sequence of the retroviral leukemia gene v myb and its cellular progenitor c myb: the architecture of a transduced oncogene. Cell, 1982. 31 (2 Pt 1): p. 453 63. 59. Oh, I.H. and E.P. Reddy, The myb gene family in cell growth, differentiation and apoptosis. Oncogene, 1999. 18 (19): p. 3017 33. 60. Jin, S., H. Zhao, Y. Yi, Y. Nakata, A. Kalota, and A.M. Gewirtz, c Myb binds MLL through menin in human leukemia cells and is an important driver of MLL associated leukemogenesis. J Clin Invest. 120 (2): p. 593 606. 61. Ramsay R.G., A.L. Barton, and T.J. Gonda, Targeting c Myb expression in human disease. Expert Opin Ther Targets, 2003. 7 (2): p. 235 48. 62. O'Neil, J., J. Tchinda, A. Gutierrez, L. Moreau, R.S. Maser, K.K. Wong, W. Li, K. McKenna, X.S. Liu, B. Feng, D. Neuberg, L. Silverman, D.J. DeAngelo, J.L. Kutok, R. Rothstein, R.A. DePinho, L. Chin, C. Lee, and A.T. Look, Alu elements mediate MYB gene tandem duplication in human T ALL. J Exp Med, 2007. 204 (13): p. 3059 66. 63. Grunder, A., F. Qian, T.T. Ebel, A. Mincheva, P Lichter, U. Kruse, and A.E. Sippel, Genomic organization, splice products and mouse chromosomal localization of genes for transcription factor Nuclear Factor One. Gene, 2003. 304 : p. 171 81. 64. Bartel, D.P., MicroRNAs: genomics, biogenesis, mechanism, a nd function. Cell, 2004. 116 (2): p. 281 97. 65. Djuranovic, S., A. Nahvi, and R. Green, miRNA mediated gene silencing by translational repression followed by mRNA deadenylation and decay. Science, 2012. 336 (6078): p. 237 40. 66. Eulalio, A., E. Huntzinger, and E. Izaurralde, GW182 interaction with Argonaute is essential for miRNA mediated translational repression and mRNA decay. Nat Struct Mol Biol, 2008. 15 (4): p. 346 53. 67. Eulalio, A., E. Huntzinger, T. Nishihara, J. Rehwinkel, M. Fauser, and E. Izaurra lde, Deadenylation is a widespread effect of miRNA regulation. RNA, 2009. 15 (1): p. 21 32. 68. Vasudevan, S., Y. Tong, and J.A. Steitz, Switching from repression to activation: microRNAs can up regulate translation. Science, 2007. 318 (5858): p. 1931 4.

PAGE 121

121 69. Orom, U.A., F.C. Nielsen, and A.H. Lund, MicroRNA 10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. Mol Cell, 2008. 30 (4): p. 460 71. 70. Vasudevan, S. and J.A. Steitz, AU rich element mediated upregulation of translation by F XR1 and Argonaute 2. Cell, 2007. 128 (6): p. 1105 18. 71. Eulalio, A., E. Huntzinger, and E. Izaurralde, Getting to the root of miRNA mediated gene silencing. Cell, 2008. 132 (1): p. 9 14. 72. Fabian, M.R., N. Sonenberg, and W. Filipowicz, Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79 : p. 351 79. 73. Fabian, M.R., G. Mathonnet, T. Sundermeier, H. Mathys, J.T. Zipprich, Y.V. Svitkin, F. Rivas, M. Jinek, J. Wohlschlegel, J.A. Doudna, C.Y. Chen, A.B. Shyu, J.R. Yates, 3rd, G.J. Hannon, W. Filipowicz, T.F. Duchaine, and N. Sonenberg, Mammalian miRNA RISC recruits CAF1 and PABP to affect PABP dependent deadenylation. Mol Cell, 2009. 35 (6): p. 868 80. 74. Huntzinger, E., D. Kuzuoglu Ozturk, J.E. Braun, A. Eulalio, L. Wohlbold, and E Izaurralde, The interactions of GW182 proteins with PABP and deadenylases are required for both translational repression and degradation of miRNA targets. Nucleic Acids Res, 2013. 41 (2): p. 978 94. 75. Rehwinkel, J., I. Behm Ansmant, D. Gatfield, and E. Izaurralde, A crucial role for GW182 and the DCP1:DCP2 decapping complex in miRNA mediated gene silencing. RNA, 2005. 11 (11): p. 1640 7. 76. Behm Ansmant, I., J. Rehwinkel, T. Doerks, A. Stark, P. Bork, and E. Izaurralde, mRNA degradation by miRNAs and GW1 82 requires both CCR4:NOT deadenylase and DCP1:DCP2 decapping complexes. Genes Dev, 2006. 20 (14): p. 1885 98. 77. Djuranovic, S., A. Nahvi, and R. Green, A parsimonious model for gene regulation by miRNAs. Science. 331 (6017): p. 550 3. 78. Jopling, C.L., M Yi, A.M. Lancaster, S.M. Lemon, and P. Sarnow, Modulation of hepatitis C virus RNA abundance by a liver specific MicroRNA. Science, 2005. 309 (5740): p. 1577 81. 79. Wang, F., Y. Li, J. Zhou, J. Xu, C. Peng, F. Ye, Y. Shen, W. Lu, X. Wan, and X. Xie, miR 375 is down regulated in squamous cervical cancer and inhibits cell migration and invasion via targeting transcription factor SP1. Am J Pathol, 2011. 179 (5): p. 2580 8. 80. Harris, T., L. Jimenez, N. Kawachi, J.B. Fan, J. Chen, T. Belbin, A. Ramnauth, O. L oudig, C.E. Keller, R. Smith, M.B. Prystowsky, N.F. Schlecht, J.E. Segall, and G. Childs, Low level expression of miR 375 correlates with poor outcome and

PAGE 122

122 metastasis while altering the invasive properties of head and neck squamous cell carcinomas. Am J Pat hol, 2012. 180 (3): p. 917 28. 81. Wu, C., M. Li, C. Hu, and H. Duan, Clinical significance of serum miR 223, miR 25 and miR 375 in patients with esophageal squamous cell carcinoma. Mol Biol Rep, 2014. 41 (3): p. 1257 66. 82. Hu, A. and X. Jin, [Expression o f mir 21 and mir 375 in laryngeal squamous cell carcinoma]. Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi, 2012. 26 (18): p. 788 92. 83. Valastyan, S., F. Reinhardt, N. Benaich, D. Calogrias, A.M. Szasz, Z.C. Wang, J.E. Brock, A.L. Richardson, and R.A. Wei nberg, A pleiotropically acting microRNA, miR 31, inhibits breast cancer metastasis. Cell, 2009. 137 (6): p. 1032 46. 84. Lu, Z., Y. Ye, D. Jiao, J. Qiao, S. Cui, and Z. Liu, miR 155 and miR 31 are differentially expressed in breast cancer patients and are correlated with the estrogen receptor and progesterone receptor status. Oncol Lett, 2012. 4 (5): p. 1027 1032. 85. Liang, H., L. Studach, R.L. Hullinger, J. Xie, and O.M. Andrisani, Down regulation of RE 1 silencing transcription factor (REST) in advanced p rostate cancer by hypoxia induced miR 106b~25. Exp Cell Res, 2014. 320 (2): p. 188 99. 86. Salmena, L., L. Poliseno, Y. Tay, L. Kats, and P.P. Pandolfi, A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell, 2011. 146 (3): p. 353 8. 87. Cesana M. and G.Q. Daley, Deciphering the rules of ceRNA networks. Proc Natl Acad Sci U S A, 2013. 110 (18): p. 7112 3. 88. Karreth, F.A. and P.P. Pandolfi, ceRNA cross talk in cancer: when ce bling rivalries go awry. Cancer Discov, 2013. 3 (10): p. 1113 21. 89. Tay, Y., J. Rinn, and P.P. Pandolfi, The multilayered complexity of ceRNA crosstalk and competition. Nature, 2014. 505 (7483): p. 344 52. 90. Poliseno, L., L. Salmena, J. Zhang, B. Carver, W.J. Haveman, and P.P. Pandolfi, A coding independent function of ge ne and pseudogene mRNAs regulates tumour biology. Nature, 2010. 465 (7301): p. 1033 8. 91. Komiya, T., A. Coxon, Y. Park, W.D. Chen, M. Zajac Kaye, P. Meltzer, T. Karpova, and F.J. Kaye, Enhanced activity of the CREB co activator Crtc1 in LKB1 null lung can cer. Oncogene. 29 (11): p. 1672 80. 92. Coxon, A., E. Rozenblum, Y.S. Park, N. Joshi, J. Tsurutani, P.A. Dennis, I.R. Kirsch, and F.J. Kaye, Mect1 Maml2 fusion oncogene linked to the aberrant

PAGE 123

123 activation of cyclic AMP/CREB regulated genes. Cancer Res, 2005. 65 (16): p. 7137 44. 93. Stephens, P.J., H.R. Davies, Y. Mitani, P. Van Loo, A. Shlien, P.S. Tarpey, E. Papaemmanuil, A. Cheverton, G.R. Bignell, A.P. Butler, J. Gamble, S. Gamble, C. Hardy, J. Hinton, M. Jia, A. Jayakumar, D. Jones, C. Latimer, S. McLaren, D.J. McBride, A. Menzies, L. Mudie, M. Maddison, K. Raine, S. Nik Zainal, S. O'Meara, J.W. Teague, I. Varela, D.C. Wedge, I. Whitmore, et al., Whole exome sequencing of adenoid cystic carcinoma. J Clin Invest, 2013. 123 (7): p. 2965 8. 94. Ho, A.S., K. Kan nan, D.M. Roy, L.G. Morris, I. Ganly, N. Katabi, D. Ramaswami, L.A. Walsh, S. Eng, J.T. Huse, J. Zhang, I. Dolgalev, K. Huberman, A. Heguy, A. Viale, M. Drobnjak, M.A. Leversha, C.E. Rice, B. Singh, N.G. Iyer, C.R. Leemans, E. Bloemena, R.L. Ferris, R.R. S eethala, B.E. Gross, Y. Liang, R. Sinha, L. Peng, B.J. Raphael, S. Turcan, et al., The mutational landscape of adenoid cystic carcinoma. Nat Genet, 2013. 45 (7): p. 791 8. 95. L Barnes, J.E., P Reichart, D Sidransky World Health Organization International C lassification of Tumors. Pathology and Genetics of Head and Neck Tumors 2005, Lyon: IARC Press. 96. Greig, K.T., S. Carotta, and S.L. Nutt, Critical roles for c Myb in hematopoietic progenitor cells. Semin Immunol, 2008. 20 (4): p. 247 56. 97. Rosen, P.P., Adenoid cystic carcinoma Rosen. 2009: Philadelphia: Lippincott Williams and Wilkins. 590 604. 98. Choi, Y.L., K. Tsukasaki, M.C. O'Neill, Y. Yamada, Y. Onimaru, K. Matsumoto, J. Ohashi, Y. Yamashita, S. Tsutsumi, R. Kan eda, S. Takada, H. Aburatani, S. Kamihira, T. Nakamura, M. Tomonaga, and H. Mano, A genomic analysis of adult T cell leukemia. Oncogene, 2007. 26 (8): p. 1245 55. 99. Jin, S., H. Zhao, Y. Yi, Y. Nakata, A. Kalota, and A.M. Gewirtz, c Myb binds MLL through m enin in human leukemia cells and is an important driver of MLL associated leukemogenesis. J Clin Invest, 2010. 120 (2): p. 593 606. 100. Barczak, A., M.W. Rodriguez, K. Hanspers, L.L. Koth, Y.C. Tai, B.M. Bolstad, T.P. Speed, and D.J. Erle, Spotted long oli gonucleotide arrays for human gene expression analysis. Genome Res, 2003. 13 (7): p. 1775 85. 101. Irizarry, R.A., B.M. Bolstad, F. Collin, L.M. Cope, B. Hobbs, and T.P. Speed, Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res, 2003. 31 (4 ): p. e15. 102. Hochberg, Y. and Y. Benjamini, More powerful procedures for multiple significance testing. Stat Med, 1990. 9 (7): p. 811 8.

PAGE 124

124 103. Hosack, D.A., G. Dennis, Jr., B.T. Sherman, H.C. Lane, and R.A. Lempicki, Identifying biological themes within l ists of genes with EASE. Genome Biol, 2003. 4 (10): p. R70. 104. Quintana, A.M., F. Liu, J.P. O'Rourke, and S.A. Ness, Identification and regulation of c Myb target genes in MCF 7 cells. BMC Cancer, 2011. 11 : p. 30. 105. Yan, Y., T.E. Salazar, J.M. Domingue z, 2nd, D.V. Nguyen, S. Li Calzi, A.D. Bhatwadekar, X. Qi, J.V. Busik, M.E. Boulton, and M.B. Grant, Dicer expression exhibits a tissue specific diurnal pattern that is lost during aging and in diabetes. PLoS One, 2013. 8 (11): p. e80029. 106. Holst, V.A., C.E. Marshall, C.A. Moskaluk, and H.F. Frierson, Jr., KIT protein expression and analysis of c kit gene mutation in adenoid cystic carcinoma. Mod Pathol, 1999. 12 (10): p. 956 60. 107. Penner, C.R., A.L. Folpe, and S.D. Budnick, C kit expression distinguish es salivary gland adenoid cystic carcinoma from polymorphous low grade adenocarcinoma. Mod Pathol, 2002. 15 (7): p. 687 91. 108. Ding, L., S.R. Zhu, S.X. Xie, and X.B. Wu, [Effects of basic fibroblast growth factor on the proliferation of human salivary ade noid cystic carcinoma cell line ACC 2 and extracellular signal regulated kinase, Cyclin D1, p2waf/cip1 signaling pathway]. Hua Xi Kou Qiang Yi Xue Za Zhi, 2008. 26 (2): p. 118 20. 109. Moskaluk, C.A., A.S. Baras, S.A. Mancuso, H. Fan, R.J. Davidson, D.C. Di rks, W.L. Golden, and H.F. Frierson, Jr., Development and characterization of xenograft model systems for adenoid cystic carcinoma. Lab Invest, 2011. 91 (10): p. 1480 90. 110. Hotte, S.J., E.W. Winquist, E. Lamont, M. MacKenzie, E. Vokes, E.X. Chen, S. Brow n, G.R. Pond, A. Murgo, and L.L. Siu, Imatinib mesylate in patients with adenoid cystic cancers of the salivary glands expressing c kit: a Princess Margaret Hospital phase II consortium study. J Clin Oncol, 2005. 23 (3): p. 585 90. 111. Faivre, S., E. Raymo nd, O. Casiraghi, S. Temam, and P. Berthaud, Imatinib mesylate can induce objective response in progressing, highly expressing KIT adenoid cystic carcinoma of the salivary glands. J Clin Oncol, 2005. 23 (25): p. 6271 3; author reply 6273 4. 112. Ivanova, A. V., C.M. Goparaju, S.V. Ivanov, D. Nonaka, C. Cruz, A. Beck, F. Lonardo, A. Wali, and H.I. Pass, Protumorigenic role of HAPLN1 and its IgV domain in malignant pleural mesothelioma. Clin Cancer Res, 2009. 15 (8): p. 2602 11.

PAGE 125

125 113. Goldoni, S. and R.V. Iozzo, Tumor microenvironment: Modulation by decorin and related molecules harboring leucine rich tandem motifs. Int J Cancer, 2008. 123 (11): p. 2473 9. 114. Schaefer, L. and R.M. Schaefer, Proteoglycans: from structural compounds to signaling molecules. Cell Tis sue Res, 2010. 339 (1): p. 237 46. 115. Du, W.W., W. Yang, and A.J. Yee, Roles of versican in cancer biology -tumorigenesis, progression and metastasis. Histol Histopathol, 2013. 28 (6): p. 701 13. 116. Touab, M., J. Villena, C. Barranco, M. Arumi Uria, and A. Bassols, Versican is differentially expressed in human melanoma and may play a role in tumor development. Am J Pathol, 2002. 160 (2): p. 549 57. 117. Yeung, T.L., C.S. Leung, K.K. Wong, G. Samimi, M.S. Thompson, J. Liu, T.M. Zaid, S. Ghosh, M.J. Birrer, and S.C. Mok, TGF beta modulates ovarian cancer invasion by upregulating CAF derived versican in the tumor microenvironment. Cancer Res, 2013. 73 (16): p. 5016 28. 118. Kischel, P., D. Waltregny, B. Dumont, A. Turtoi, Y. Greffe, S. Kirsch, E. De Pauw, and V Castronovo, Versican overexpression in human breast cancer lesions: known and new isoforms for stromal tumor targeting. Int J Cancer, 2010. 126 (3): p. 640 50. 119. Gorter, A., H.J. Zijlmans, H. van Gent, J.B. Trimbos, G.J. Fleuren, and E.S. Jordanova, Ve rsican expression is associated with tumor infiltrating CD8 positive T cells and infiltration depth in cervical cancer. Mod Pathol, 2010. 23 (12): p. 1605 15. 120. Miquel Serra, L., M. Serra, D. Hernandez, C. Domenzain, M.J. Docampo, R.M. Rabanal, I. de Tor res, T.N. Wight, A. Fabra, and A. Bassols, V3 versican isoform expression has a dual role in human melanoma tumor growth and metastasis. Lab Invest, 2006. 86 (9): p. 889 901. 121. Friedman, A.D., Runx1, c Myb, and C/EBPalpha couple differentiation to prolif eration or growth arrest during hematopoiesis. J Cell Biochem, 2002. 86 (4): p. 624 9. 122. Carabana, J., E. Ortigoza, and M.S. Krangel, Regulation of the murine Ddelta2 promoter by upstream stimulatory factor 1, Runx1, and c Myb. J Immunol, 2005. 174 (7): p 4144 52. 123. Du, H., S.S. Yang, Z. Liang, B.R. Feng, L. Liu, Y.B. Huang, and Y.X. Tang, Genome wide analysis of the MYB transcription factor superfamily in soybean. BMC Plant Biol, 2012. 12 : p. 106.

PAGE 126

126 124. Wang, J., H. Huang, C. Wang, X. Liu, F. Hu, and M Liu, MicroRNA 375 sensitizes tumour necrosis factor alpha (TNF alpha) induced apoptosis in head and neck squamous cell carcinoma in vitro. Int J Oral Maxillofac Surg, 2013. 42 (8): p. 949 55. 125. Valastyan, S. and R.A. Weinberg, miR 31: a crucial oversee r of tumor metastasis and other emerging roles. Cell Cycle, 2010. 9 (11): p. 2124 9. 126. Xu, R.S., X.D. Wu, S.Q. Zhang, C.F. Li, L. Yang, D.D. Li, B.G. Zhang, Y. Zhang, J.P. Jin, and B. Zhang, The tumor suppressor gene RhoBTB1 is a novel target of miR 31 i n human colon cancer. Int J Oncol, 2013. 42 (2): p. 676 82. 127. Fuse, M., S. Kojima, H. Enokida, T. Chiyomaru, H. Yoshino, N. Nohata, T. Kinoshita, S. Sakamoto, Y. Naya, M. Nakagawa, T. Ichikawa, and N. Seki, Tumor suppressive microRNAs (miR 222 and miR 31 ) regulate molecular pathways based on microRNA expression signature in prostate cancer. J Hum Genet, 2012. 57 (11): p. 691 9. 128. Ramsay, R.G. and T.J. Gonda, MYB function in normal and cancer cells. Nat Rev Cancer, 2008. 8 (7): p. 523 34. 129. Grasser, F. A., T. Graf, and J.S. Lipsick, Protein truncation is required for the activation of the c myb proto oncogene. Mol Cell Biol, 1991. 11 (8): p. 3987 96. 130. Gonda, T.J., C. Buckmaster, and R.G. Ramsay, Activation of c myb by carboxy terminal truncation: rela tionship to transformation of murine haemopoietic cells in vitro. Embo J, 1989. 8 (6): p. 1777 83. 131. Merzak, A., Y. Dooghe, M. Pironin, B. Perbal, and P. Vigier, Cooperation between the H ras oncogene and a truncated derivative of the v myb oncogene in t ransformation of hamster embryo fibroblasts. Oncogene, 1992. 7 (10): p. 2031 9. 132. Nature Protocols, 2006. 1 : p. 2315 9. 133. Gonda, T.J. and J.M. Bishop, Structure and transcription of the cellular homolog (c myb) of the avian myeloblastosis virus transf orming gene (v myb). J Virol, 1983. 46 (1): p. 212 20. 134. Bies, J. and L. Wolff, Oncogenic activation of c Myb by carboxyl terminal truncation leads to decreased proteolysis by the ubiquitin 26S proteasome pathway. Oncogene, 1997. 14 (2): p. 203 12. 135. F avier, D. and T.J. Gonda, Detection of proteins that bind to the leucine zipper motif of c Myb. Oncogene, 1994. 9 (1): p. 305 11.

PAGE 127

127 136. Dash, A.B., F.C. Orrico, and S.A. Ness, The EVES motif mediates both intermolecular and intramolecular regulation of c Myb Genes Dev, 1996. 10 (15): p. 1858 69. 137. Klempnauer, K.H., G. Ramsay, J.M. Bishop, M.G. Moscovici, C. Moscovici, J.P. McGrath, and A.D. Levinson, The product of the retroviral transforming gene v myb is a truncated version of the protein encoded by the cellular oncogene c myb. Cell, 1983. 33 (2): p. 345 55. 138. Perbal, B., F. Reinisch Deschamps, C. Kryceve Martinerie, J. Soret, F. Sor, M. Mechali, and J. Crochet, Transforming potential of the v myb oncogene from avian myeloblastosis virus: alterations in the oncogene product may reveal a new target specificity. Biochimie, 1986. 68 (7 8): p. 969 80. 139. Merzak, A., J. Soret, C. Martinerie, A. Sureau, J. Crochet, and B. Perbal, Transforming potential of truncated v myb and stimulation of replication by gag myb fusion products. Oncogene, 1992. 7 (3): p. 535 42. 140. Lin, Y.C., M.W. Kuo, J. Yu, H.H. Kuo, R.J. Lin, W.L. Lo, and A.L. Yu, c Myb is an evolutionary conserved miR 150 target and miR 150/c Myb interaction is important for embryonic development. Mol Bio l Evol, 2008. 25 (10): p. 2189 98. 141. Bian, Z., L. Li, J. Cui, H. Zhang, Y. Liu, C.Y. Zhang, and K. Zen, Role of miR 150 targeting c Myb in colonic epithelial disruption during dextran sulphate sodium induced murine experimental colitis and human ulcerati ve colitis. J Pathol, 2011. 225 (4): p. 544 53. 142. Xiao, C., D.P. Calado, G. Galler, T.H. Thai, H.C. Patterson, J. Wang, N. Rajewsky, T.P. Bender, and K. Rajewsky, MiR 150 controls B cell differentiation by targeting the transcription factor c Myb. Cell, 2007. 131 (1): p. 146 59. 143. Zhou, B., S. Wang, C. Mayr, D.P. Bartel, and H.F. Lodish, miR 150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely. Proc Natl Acad Sci U S A, 2007. 104 (17): p. 7080 5. 1 44. Dooley, A.L., M.M. Winslow, D.Y. Chiang, S. Banerji, N. Stransky, T.L. Dayton, E.L. Snyder, S. Senna, C.A. Whittaker, R.T. Bronson, D. Crowley, J. Barretina, L. Garraway, M. Meyerson, and T. Jacks, Nuclear factor I/B is an oncogene in small cell lung c ancer. Genes Dev. 25 (14): p. 1470 5. 145. Azuma, M., T. Tamatani, Y. Kasai, and M. Sato, Immortalization of normal human salivary gland cells with duct myoepithelial acinar or squamous phenotype by transfection with SV40 ori mutant deoxyribonucleic acid. Lab Invest, 1993. 69 (1): p. 24 42. 146. Azuma, M. and M. Sato, Morphogenesis of normal human salivary gland cells in vitro. Histol Histopathol, 1994. 9 (4): p. 781 90.

PAGE 128

128 147. Stafford, L.J., C. Xia, W. Ma, Y. Cai, and M. Liu, Identification and characte rization of mouse metastasis suppressor KiSS1 and its G protein coupled receptor. Cancer Res, 2002. 62 (19): p. 5399 404. 148. Schneider, C.A., W.S. Rasband, and K.W. Eliceiri, NIH Image to ImageJ: 25 years of image analysis. Nat Methods, 2012. 9 (7): p. 671 5. 149. Zajac Kaye, M., N. Ben Baruch, E. Kastanos, F.J. Kaye, and C. Allegra, Induction of Myc intron binding polypeptides MIBP1 and RFX1 during retinoic acid mediated differentiation of haemopoietic cells. Biochem J, 2000. 345 Pt 3 : p. 535 41. 150. Mita ni, Y., D.B. Roberts, H. Fatani, R.S. Weber, M.S. Kies, S.M. Lippman, and A.K. El Naggar, MicroRNA profiling of salivary adenoid cystic carcinoma: association of miR 17 92 upregulation with poor outcome. PLoS One, 2013. 8 (6): p. e66778. 151. Zajac Kaye, M. and P.O. Ts'o, DNAase I encapsulated in liposomes can induce neoplastic transformation of Syrian hamster embryo cells in culture. Cell, 1984. 39 (3 Pt 2): p. 427 37. 152. Lang, G., J.R. White, M.J. Argent Katwala, C.G. Allinson, and K. Weston, Myb proteins regulate the expression of diverse target genes. Oncogene, 2005. 24 (8): p. 1375 84. 153. Geissler, E.N., M. Liao, J.D. Brook, F.H. Martin, K.M. Zsebo, D.E. Housman, and S.J. Galli, Stem cell factor (SCF), a novel hematopoietic growth factor and ligand for c kit tyrosine kinase receptor, maps on human chromosome 12 between 12q14.3 and 12qter. Somat Cell Mol Genet, 1991. 17 (2): p. 207 14. 154. Pietsch, T., M.R. Nicotra, R. Fraioli, H.K. Wolf, M. Mottolese, and P.G. Natali, Expression of the c Kit receptor an d its ligand SCF in non small cell lung carcinomas. Int J Cancer, 1998. 75 (2): p. 171 5. 155. Persson, M., Y. Andren, C.A. Moskaluk, H.F. Frierson, Jr., S.L. Cooke, P.A. Futreal, T. Kling, S. Nelander, A. Nordkvist, F. Persson, and G. Stenman, Clinically s ignificant copy number alterations and complex rearrangements of MYB and NFIB in head and neck adenoid cystic carcinoma. Genes Chromosomes Cancer, 2012. 51 (8): p. 805 17. 156. Brill, L.B., 2nd, W.A. Kanner, A. Fehr, Y. Andren, C.A. Moskaluk, T. Loning, G. Stenman, and H.F. Frierson, Jr., Analysis of MYB expression and MYB NFIB gene fusions in adenoid cystic carcinoma and other salivary neoplasms. Mod Pathol, 2011. 24 (9): p. 1169 76. 157. West, R.B., C. Kong, N. Clarke, T. Gilks, J.S. Lipsick, H. Cao, S. Kwo k, K.D. Montgomery, S. Varma, and Q.T. Le, MYB expression and translocation in

PAGE 129

129 adenoid cystic carcinomas and other salivary gland tumors with clinicopathologic correlation. Am J Surg Pathol. 35 (1): p. 92 9. 158. Wetterskog, D., P.M. Wilkerson, D.N. Rodrigu es, M.B. Lambros, K. Fritchie, M.K. Andersson, R. Natrajan, A. Gauthier, S. Di Palma, S. Shousha, Z. Gatalica, C. Topfer, V. Vukovic, R. A'Hern, B. Weigelt, A. Vincent Salomon, G. Stenman, B.P. Rubin, and J.S. Reis Filho, Mutation profiling of adenoid cyst ic carcinomas from multiple anatomical sites identifies mutations in the RAS pathway, but no KIT mutations. Histopathology, 2013. 62 (4): p. 543 50. 159. Choi, S., D. Sano, M. Cheung, M. Zhao, S.A. Jasser, A.J. Ryan, L. Mao, W.T. Chen, A.K. El Naggar, and J .N. Myers, Vandetanib inhibits growth of adenoid cystic carcinoma in an orthotopic nude mouse model. Clin Cancer Res, 2008. 14 (16): p. 5081 9. 160. Phuchareon, J., Y. Ohta, J.M. Woo, D.W. Eisele, and O. Tetsu, Genetic profiling reveals cross contamination and misidentification of 6 adenoid cystic carcinoma cell lines: ACC2, ACC3, ACCM, ACCNS, ACCS and CAC2. PLoS One, 2009. 4 (6): p. e6040. 161. El Naggar, A.K., F.J. Kaye, and G. Stenman, The 3rd Salivary Gland Tumor Workshop meeting report. Head Neck, 2013. 35 (8): p. 1057 60. 162. Liu, X., V. Ory, S. Chapman, H. Yuan, C. Albanese, B. Kallakury, O.A. Timofeeva, C. Nealon, A. Dakic, V. Simic, B.R. Haddad, J.S. Rhim, A. Dritschilo, A. Riegel, A. McBride, and R. Schlegel, ROCK inhibitor and feeder cells induce th e conditional reprogramming of epithelial cells. Am J Pathol, 2012. 180 (2): p. 599 607. 163. Mitani, Y., P.H. Rao, P.A. Futreal, D.B. Roberts, P.J. Stephens, Y.J. Zhao, L. Zhang, M. Mitani, R.S. Weber, S.M. Lippman, C. Caulin, and A.K. El Naggar, Novel chr omosomal rearrangements and break points at the t(6;9) in salivary adenoid cystic carcinoma: association with MYB NFIB chimeric fusion, MYB expression, and clinical outcome. Clin Cancer Res, 2011. 17 (22): p. 7003 14.

PAGE 130

130 BIOGRAPHICAL SKETCH Ruli started to work on this research in the summer of 2010 with an interest in studying cancer biology. She initially trained with a bachelor degree in biotechnology at t he College of Life Science at Yangzhou University in China. She was subsequently accepted into a highly selective Graduate Program in Genetics and Genomics at the University of Florida where she has continued to excel in all her coursework. She also undertook a diverse laboratory rotation experience with mentoring from several different labs at the University of Florida. She received her Ph.D. from the University of Florida in the s pring of 201 4 She initially participated in several projects in our laboratory, but she chose to focus primarily on studying the global molecular profiles for human sali vary gland cancers and defining the functional properties of the novel MYB:NFIB fusion oncogene that underlies the etiology of adenoid cystic cancer as well as related acinar tumors of the breast. Through her critical researches on this disease, she found that the MYB activation is the key for ACC initiation, while MYB NFIB fusion gene provides a novel oncogene activation mechanism by removing the target binding elements of negatively She intends to define and develo p new therapeutic strategies for curing this lethal disease. Her critical research showed that HAPLN1/VCAN extracellular complexes can be served as druggable therapeutic targets for human salivary gland adenoid cystic cancer. She also learned statistical theories and computing skills She is dedicated to apply quantitative techniques in the area of cancer researches. Her long term goal is to become a statistical geneticist in cancer research


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID EFET9QE85_1AOK47 INGEST_TIME 2014-10-03T21:47:27Z PACKAGE UFE0046113_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES