Citation
Roles of E3 Ubiquitin Ligases Xb3 Family in Plant Immunity

Material Information

Title:
Roles of E3 Ubiquitin Ligases Xb3 Family in Plant Immunity
Creator:
Huang, Xiaoen
Publisher:
University of Florida
Publication Date:
Language:
English

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Plant Pathology
Committee Chair:
Song, Wen-Yuan
Committee Members:
Rollins, Jeffrey A
Altpeter, Fredy
Mou, Zhonglin
Graduation Date:
8/10/2013

Subjects

Subjects / Keywords:
Antibodies ( jstor )
Cell death ( jstor )
Cells ( jstor )
Pathogens ( jstor )
Plant cells ( jstor )
Plant immunity ( jstor )
Proteins ( jstor )
Receptors ( jstor )
Rice ( jstor )
Ubiquitins ( jstor )
arabidopsis
citrus
hr
immunity
pcd
plant
resistance
rice
xoo

Notes

General Note:
Programmed cell death has been associated with plantimmunity and senescence. The receptor kinase XA21 confers resistance tobacterial blight disease of rice (Oryzasativa) caused by Xanthomonas oryzae pv. oryzae (Xoo). Here I show that the XA21 binding protein 3 (XB3) is capable ofinducing cell death when overexpressed in Nicotianabenthamiana. XB3 is a RING finger-containing E3 ubiquitin ligase that has beenpositively implicated in Xa21-mediatedresistance. Mutation abolishing the XB3 E3 activity also eliminates its abilityto induce cell death.  Phylogeneticanalysis of XB3-related protein sequences suggests a family of proteins (XB3family) with members from diverse plant species. I further demonstrated that membersof the XB3 family from rice, Arabidopsis and citrus all can trigger a celldeath response in Nicotiana benthamiana,suggesting an evolutionarily conserved role for these proteins in regulatingprogrammed cell death in the plant kingdom. RERJ1, a jasmonicacid-responsive bHLHtranscription factor,was identified as an interactor of XB3 protein both in vitro and in vivo. RERJ1 is nucleus-localized,whereas XB3 is both plasma membrane-localized and nucleus-localized. RERJ1 proteinis degraded upon Xoo inoculation inrice plants and XB3 can degrade RERJ1 protein in Nicotianabenthamiana.This indicates that RERJ1 protein may be the substrate of XB3. Knockdown ofRERJ1 by RNA interfering confers partial resistance to Xanthomonasoryzae pv. oryzae (Xoo). Theresults suggest a negative role of Rerj1In disease resistance against Xoo.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Huang, Xiaoen. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
8/31/2015

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 ROLES OF E3 UBIQUITIN LIGASE S XB3 FAMILY IN PLANT IMMUNITY By XIAOEN HUANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2013

PAGE 2

2 2013 Xiaoen Huang

PAGE 3

3 To my family

PAGE 4

4 ACKNOWLEDGMENTS I appreciate the UF Alumni Fellowship for supporting my Ph D study at the University of Florida. I would also l ike to express my appreciation to my advisor Dr. Wen yuan Song for his support during my doctoral study I have received a wide range of Ph D training, by successful experience s and by trial and error in his lab, making me independent i n critical thinking and research. I woul d like to express my thanks to Dr Jeffrey A. Rollins, Dr Zhon g lin Mou and Dr. Fredy Altpeter for serving on my committee I learned tremendously from their advice I am also thankful to Dr. Xiu hua Chen, Dr. Qiang Chen and Ms. Terry A. Davoli, who together created a good wor king lab experience and a community of team work I would like to especially express my gratitude to Terry A. Davoli, for critical reading of my dissertation. I feel lucky to have studied and done research in the Department of Plant Pathology with such good faculty and staff.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ .. 4 LIST OF TABLES ................................ ................................ ................................ ............ 7 LIST OF FIGURES ................................ ................................ ................................ .......... 8 LIST OF ABBREVIATIONS ................................ ................................ ............................. 9 ABSTRACT ................................ ................................ ................................ ................... 13 C H A P T E R 1 INTRODUCTION ................................ ................................ ................................ .... 15 1.1 Resistance or Susceptibility of Plant s to Pathogens ................................ ......... 15 1.1.1 PTI and Suppression of PTI by Adapted Microbes ................................ .. 16 1.1.1.1 PAMPs and PRRs ................................ ................................ .......... 16 1.1.1.2 PTI signaling ................................ ................................ .................. 18 1.1.1.3 Negative regulation of PTI ................................ .............................. 20 1.1.1.4 Suppression of PTI by adapted microbes ................................ ...... 20 1.1.2 Effector Triggered Immunity (ETI) ................................ ........................... 23 1.1.2.1 Guard model ................................ ................................ .................. 24 1.1.2.2 Decoy model ................................ ................................ .................. 25 1.2 Ubiquitination in Plant Immunity ................................ ................................ ........ 28 1.2.1 Types of E3 Ubiquitin Ligases ................................ ................................ 28 1.2.2 Roles of E3 Ubiquitin Ligases in Plant Defense ................................ ...... 29 1 .2.3 Degradation of Transcription Factors by E3 Ubiquitin Ligases in Plants 32 2 MEMBERS OF THE XB3 FAMILY FROM DIVERSE PLANT SPECIE S INDUCE PROGRAMMED CELL DEATH IN NICOTIANA BENTHAMIANA .......................... 40 2.1 Background ................................ ................................ ................................ ....... 40 2.2 Materials and Methods ................................ ................................ ...................... 41 2.2.1 Phylogenetic Analysis ................................ ................................ .............. 41 2.2.2 Bacteria and Plant Growth Conditions ................................ ..................... 42 2.2.3 Constructs ................................ ................................ ............................... 42 2.2.4 Agrobacterium Mediated Transie nt Assay in N. Benthamiana ............... 43 2.2.5 Protein Blot Analysis ................................ ................................ ................ 43 2.2.6 Histochemical Staining ................................ ................................ ............ 43 2.2.7 Electrolyte Leakage Measurement ................................ .......................... 43 2.3 Results ................................ ................................ ................................ .............. 44 2.3.1 Sequence Analysis of the XB3 Family Members ................................ ..... 44 2.3 .2 The Rice XB3 Protein Can Elicit Cell Death in Nicotiana Benthamiana ... 44 2.3.3 The RF domain of XB3 I s Required for the Cell Death Response ........... 45

PAGE 6

6 2.3.4 The E3 Deficient Mutant XB3 C323A Is Unable to Induce Cell Death .......... 47 2.3.5 Mutation of the Myristoylation Site of XB3 Compromises Its Cell Death Induction ................................ ................................ ................................ ........ 47 2.3.6 Members of the XB3 Family from Rice, Arabidopsis, and Citrus Can All Induce Cell Death ................................ ................................ ..................... 48 2.4 Discussion ................................ ................................ ................................ ........ 49 3 CHARACTERIZATION OF RERJ1, AN XB3 INTERACTING PROTEIN IN PLANT DEFENSE RESPONSE ................................ ................................ ............. 61 3.1 Background ................................ ................................ ................................ ....... 61 3.2 Materials and Methods ................................ ................................ ...................... 63 3.2.1 Yeast Two Hybrid Assay ................................ ................................ ......... 63 3.2.2 Expression and Puri fication of Proteins in E.coli ................................ ..... 64 3.2.3 In Vitro Pull Down Assay ................................ ................................ ......... 66 3.2.4 Antibody Production and Purification ................................ ....................... 66 3.2.5 Plant Total Protein Extraction ................................ ................................ .. 67 3.2.6 In Vivo Co Immunoprecipitation ................................ .............................. 68 3.2.7 SDS PAGE and Protein Gel Blot Analysis ................................ ............... 68 3.2.8 Subce llular Localization of RERJ1 and XB3 ................................ ............ 69 3.2.9 Nuclear Fractionation of Rice Plant Cells ................................ ................ 69 3.2.10 Xoo Inoculation ................................ ................................ ...................... 70 3.2 .11 Agrobacterium Mediated Transient Gene Expression in Nicotiana Benthamiana ................................ ................................ ................................ 70 3.2.12 Phylogenetic Analysis ................................ ................................ ............ 71 3.3 Results ................................ ................................ ................................ .............. 72 3.3.1 Specificity of the RERJ1 Antibody ................................ ........................... 72 3.3.2 Interac tion between XB3 and RERJ1 ................................ ...................... 73 3.3.3 Mapping Interaction Domains of XB3 and RERJ1 ................................ ... 75 3.3.4 Structural and Phylogenetic Analysis of RERJ1 Protein .......................... 75 3.3.5 Subcellular Localization of RERJ1 and XB3 Proteins .............................. 76 3.3.6 XB3 Protein Is Stabilized in the Presence of Xa21 ................................ .. 77 3.3. 7 XB3 Degrades RERJ1 in N. Benthamiana ................................ .............. 78 3.3.8 Knockdown of Rerj1 Confers Partial Resistance to Xoo .......................... 79 3.4 Discussion ................................ ................................ ................................ ........ 80 4 CONCLUSIONS AND OUTLOOK ................................ ................................ .......... 96 APPENDIX: PUBLICATION ................................ ................................ ......................... 98 LIST OF REFERENCES ................................ ................................ ............................... 99 BIOGRAPHICAL SKETCH ................................ ................................ .......................... 119

PAGE 7

7 LIST OF TABLES Table page 2 1 Primers used in Chapter 2 in this study ................................ ................................ ... 53 3 1 Primers used in Chapter 3 in this study ................................ ................................ ... 86

PAGE 8

8 LIST OF FIGURES Figure page 1 1 Relationship between pathogens and plant immune system.. ............................ 37 1 2 Ubiquitination dependent pro teolysis pathway. ................................ .................. 38 1 3 Different types of E3 ubiquitin ligases.. ................................ ............................... 39 2 1 Phylogenet ic analysis of the XB3 family ................................ ............................. 54 2 2 Cell de ath triggered by XB3 ................................ ................................ ............... 55 2 3 Cell death triggere d by XB3 truncation mutants ................................ ................. 56 2 4 The E3 ubiquitin ligase deficient mutant XB3 C323A is unable to induce cell death. ................................ ................................ ................................ ................. 57 2 5 XB3 G2A mutation c ompromises Cell death induction ................................ ....... 58 2 6 Cell death trigger ed by members of the XB3 family ................................ ............ 59 2 7 Schematic diagram showing structure and comparisons of the characterized protein f amily members in this study ................................ ................................ .. 60 3 1 Characterization of RERJ1antibody specificity ................................ ................... 87 3 2 XB3 and RERJ1 inte ract in vitro and in vivo ................................ ...................... 88 3 3 Mapping interaction domains of XB3 and RERJ1 ................................ ............... 89 3 4 Analysis of RERJ1 protein and its homologs. ................................ ..................... 90 3 5 Localization of RERJ1 and XB3 ................................ ................................ .......... 91 3 6 XB3 protein is stabilized in the presence of Xa21 ................................ .............. 92 3 7 Degradation of RERJ 1 protein by XB3 ................................ ............................... 93 3 8 Identification of RERJ1 RNAi transgenic lines ................................ .................... 94 3 9 Inoculation of rice plants wit h Xoo ................................ ................................ ...... 95

PAGE 9

9 LIST OF ABBREVIATION S 3 AT 3 amino 1, 2, 4 triazole ACC 1 aminocyclopropane 1 carboxylic acid ACRE Avr9/Cf 9 rapidly elicited ACS ACC synthase AD A ctivation domain A VR Avirulence gene/protein A X 21 A ctivation of Xa21 BAK1 BRI1 associated kinase 1 bHLH basic helix loop helix BIK1 Botrytis induced kinase 1 BKK1 BAK1 like 1 BR B rasinosteroid BRI1 Brassinosteroid insensitive 1 BSA B ovine serum albumin CBB Coomassie brilliant blue CC Coiled coil CERK1 Chitin elici tor receptor kinase 1 CEBiP Ch itin elicitor binding protein Cfu C olony forming units CMPG1 Cys, Met, Pro and Gly or ACRE74 COR Coronatine DAMP D amage associated molecular pattern DEX Dexamethasone dNTP deoxyribonucleotide triphosphate

PAGE 10

10 dpi days post inoc ulation E1 E1 u biqui tin activating enzyme E2 E2 u biqui tin conjugating enzyme E3 E3 u biqui tin ligase enzyme EDS Enhanced disease susceptibility EDTA E thylenediaminetetraacetic acid EFR E longation factor receptor EF Tu Elongation factor Tu EIX Ethylene indu cing xylanase EPS E xopolysaccharide ETI E ffector triggered immunity EV Empty vector FLS2 F lagellin sensing 2 GUS G lucuronidases h pi hours post infiltration HR H ypersensitive response Hrc Hypersensitive response and conserved IP I mmunoprecipitation JA J a smonic acid LPS L ipopolysaccharide LRR L eucine rich repeat MAPK M itogen activated protein kinase MAPKK, MEK, MKK MAPK kinase MAPKKK, MAP3K MAPK kinase kinase MBP Maltose binding protein

PAGE 11

11 MS Murashige and Skoog NAG N acetyl D glucosamine NB N ucleo tide bindin g NLS N uclear localization signal PAMP P athogen associated molecular pattern PBS1 AvrPphB susceptible PCD P rogrammed cell death PCR P olymerase chain reaction PEPR AtPep receptor PGN P eptidoglycan PMSF P henylmethanesulfonylfluoride Pph Pseudomonas syringae pv. phaseolicola PR P athogenesis related PRR Pattern recognition receptor PSA P eptone sucrose agar Pst Pseudomonas syringae pv. tomato PTI PAMP triggered immunity PUB Plant U box PVP P olyvinylpyrrolidone pv. p athovar PVDF Polyvinyldifluoride R gene R esista nce gene R protein Resistance protein RIN 4 RPM1 interacting protein 4 RING Really Interesting New Gene

PAGE 12

12 RIPK RPM1 induced protein kinase RLK R eceptor like kinase RNAi RNA inference ROS Reactive oxygen species RPM1 Resistance to P. maculicola protein 1 RPS Resistance to P. syringae SCF Skp1 Cul1 F box SDS PAGE S odium dodecyl sulfate polyacrylamide gel electrophoresis SERK Somatic embryogenesis receptor like kinase ssDNA S almon sperm DNA T3SS Type 3 secretion system TAL T ranscription activator like TALE N TAL effector nuclease TMV T obacco mosaic virus VC Vector control WIPK W ounding induced protein kinase Xac Xanthomona s axonopodis pv. citri XB3 XA21 binding protein 3 Xcc X anthomonas campestris pv. campestris Xcv Xanthomonas campestris pv. vesicatoria Xoo Xanthomonas oryzae pv. oryzae YM Y east extract mannitol ME M ercaptomethanol

PAGE 13

13 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy ROLES OF E3 UBIQUITI N LIGASE S XB3 FAMILY IN PLANT IMMUNITY By Xiaoen Huang August 2013 Chair: Wen yuan Song Major: Plant Pathology Programmed cell death has been associated with p lant immunity and senescence. The receptor kinase XA21 confers resistance to bacterial blight disease of rice ( Oryza sativa ) caused by Xanthomonas oryzae pv. oryzae ( Xoo ). Here I show that the XA21 binding protein 3 (XB3) is capable of inducing cell death when overexpressed in Nicotiana benthamiana XB3 is a RING finger containing E3 ubiquitin ligase that has b een posit ively implicated in Xa 21 med iated resistance. Mutation abolishing the XB3 E3 activity also eliminates its ability to induce cell death. Phylogenetic analysis of XB3 related protein sequences suggests a family of proteins (XB3 family) with memb ers from div erse plant species. I further demonstrate d that members of the XB3 family from rice, Arabidopsis and citrus all can trigger a cell death response in Nicotiana benthamiana suggesting an evolutionarily conserved role for these proteins in regulating program med ce ll death in the plant kingdom. RERJ1 a jasmonic acid responsive b HLH transcription factor was identified as an interact or of XB3 protein both in vitro and in vivo RERJ1 is nucl eus localized whereas XB3 is both plasma membrane localized and nucle us localized RERJ1 protein is degraded upon Xoo inoculation in rice plants and XB3 can degrade RERJ1 protein in

PAGE 14

14 Nicotiana benthamiana This indicates that RERJ1 protein may be the substrate of XB3. Knockdown of RERJ1 by RNA interfering confers partial res istance to Xanthomonas oryzae pv. oryzae ( Xoo ). The results suggest a negative role of Rerj 1 In disease resistance against Xoo

PAGE 15

15 CHAPTER 1 INTRODUCTION 1.1 Resistance or Susceptibility of Plants to P athogens Plants can face challenge s from pathogens during their life cycles. The challenges produce two consequences: the plant is either resistant or susceptible to pathogen invasion. Plant s have pre formed physic al barriers such as cell walls and waxy cutic les for constitutive protection from pest invasion Whe n facing pathogen attack s plants c an perceive some conserved structures of microbes term ed pathogen associated molecular patterns lipopolysaccharides, bacterial EF Tu and fungal chitin. Perception of PAMPs by cell surfaced receptors term ed pattern recognition receptors (PRRs) induces PAMPs triggered immunity (PTI) (Jones and Dangl, 2006) PTI is the first layer of the plant immune system, characteristic of systemic resi stance and broad spectrum resistance To suppress PTI, pathogens such as bacterial pathogens deliver virulence proteins term ed eff ectors directly into host cells, through the Type III secretion system. After overcoming preformed barriers and the first laye r of the plant immunity system, pathogens establish a compatible inte reaction wit h the host, resulting i n diseases. As a countermeasure plant s have developed another more effective, specific typ e of resistance term ed effector triggered immunity (ETI). Eff ectors are specifically recognized by plant resistance protein s (R gene encoding protein s ) and trigger strong resistance, often accompanied by rapid localized cell death, or hypersensitive response (HR). An ar m s r ace between pathogens and their hosts pres sures each to develop new effectors and R genes to pre vail over the other side (Fig. 1 1).

PAGE 16

16 1.1.1 PTI and Suppression of PTI by Adapted M icrobes PAMPs are conserved components found across different pathogen species or strains that activate plant defense an d are termed PTI The PAMPs usually are conserved structures and/or proteins such as fungal chitin or bacterial lipopolysaccharides (LPS), peptidoglycans (PGN), flagellin and Elongation Factor Tu Plants can halt inv asion of most microbes because of PTI. O nly adapted microbes can establish compatible interaction s with their host plant s by escaping and/or suppressing PTI. Perception of PAMPs is initiated and achieved through cell membrane surface localized receptor kinases or receptor like kinases termed pat tern recognition receptors (PRRs). In Arabidopsis, there are more than 600 members in the receptor kinase family (Shiu and Bleecker, 2001) while more than 1,000 members exist in rice (Shiu et al., 2004) PRRs are usually composed of an extrace llular domain a transmembrane domain and an intracellular kinase domain. PAMPs triggered PTI activation involves a series of signal transduction events. Such events include ion flux, reactive oxygen s pecies (ROS ) generation, mitogen activated protein kinases (MAPKs) activation, callose deposition, transcriptional reprogramming, expression of pathogenesis related (PR) genes and defense related genes, culminating in immune response. 1.1.1.1 PAMPs and P R Rs The flagellin/FLS2 combination is the most studied PAMP/PRR in plant s The b acterial flagellum component flagellin is recognized by its cognate receptor FLAGELLIN SENSING2 (FLS2) in many plant species (Gomez Gom ez and Boller, 2000; Gomez Gomez et al., 2001; Zipfel et al., 2004; Chinchilla et al., 2006) Notably, a short stretch of 22 am ino acid peptide flg22 from fla gellin can bind FLS2 and activate FLS2 The flg22 peptide is a conserved epitope across nearly al l gram negative bacteria. The

PAGE 17

17 bacterial elongation factor Tu (EF Tu) and an 18 amino acid peptide elf18 derived from it is recognized by the elongation factor Tu receptor (EFR) (Zipfel et al., 2006) The rice resistance (R) gene XA21 conferring resistance to Xanthomonas oryzae pv. oryzae encodes XA21 that recognize s a type I secreted peptide Ax21 (Song et al., 1995; Lee et al., 2009) The Ax21 sequence is conserved in all Xanthomonas and r elated species. A 17 amino acid peptide sulfated at the N terminus of Ax21 is sufficient to trigger Xa 21 mediated resistance in rice. Intriguingly, an originally identified R gene is now cla ssified as a PRR with clear PRRs c haracteristics FLS2, EFR and XA21 are the best characterized PRRs in plants and they are all from subfamily XII of LRR con taining RLKs (Boller and Felix, 2009; Monaghan and Zipfel, 2012; Schwessinger and Ronald, 2012) The chitin elicitor binding protein (CEBiP) was first identified in rice to bind chitin (a polymer of N acetyl D gluco samine, NAG), a major component of fungal cell wall s (Kaku et al., 2006) CEBiP is a plant receptor protein carrying an extracellular lysine motif (LysM). In Arabid opsis, another LysM motif containing receptor kinase AtCERK1 is required for chitin triggered immunity (Miya et al., 2007) An interesting phenomenon was shown that AtCERK1 is also involved in sensing the b acteria derived peptidoglycans (PGNs) to mediate Arabidopsis immunity (Willmann et al., 2011) This CERK1 may serve as co receptor for multiple PAMPs perceiving PRRs. PRRs LeEIX1 and LeEIX2 in tomato were demonstrated to mediate the perception of a fungal cell wall derived xylanase (Ron and Avni, 2004) Recently, t omato PRR Ve1, mediating resistance to the Verticillium fungus (Kawchuk et al., 2001) was identified to recogn ize the effector Ave1 of multiple fungal pathogens (de Jonge et al., 2012) Ave1 is a

PAGE 18

18 homolog of a widespread family of plant natriuretic peptides and it can b e found among multiple fungi and the bacterium Xanthomonas axonopodis Beyond percepti on of non associated molecular pattern molecules (DAMPs), such as damage caused by wounding or chewing by herbivore s The Arabidopsis L RR RLKs PEPR1 and PEPR2 are examples of these PRRs, recognizing AtPeps, a family of peptide DAMPs that can also initiate PTI signaling (Krol et al., 2010; Yamaguchi et al., 2010) In Arabidopsis, there are more than 600 receptor like kinases (Shiu and Bleecker, 2001) of whi ch only a very small portion were identified as PRRs recognizing c orresponding PAMPs. There are a large number of PAMPs from diverse pathogens yet to be identified for recognition by their PRRs. 1.1.1.2 P TI signaling The best characterized relation ship between PAMP and PTI in plants is the perception of bacterial flagell in by the Arabidopsis FLS2 (FLAGELLIN SENSING2) receptor. FLS2 is a cell surfac e (membrane) localized Pattern Recognition R eceptor (PRR). The later identified EFR shares with FLS2 extremely similar, if not identical, downstream responses (Zipfel et al., 2006) It was found that FLS2 and EFR share similar signaling comp onents. The best characterized component of FLS or EFR signaling complex is BAK1/SERK3. BAK1 is also a LRR RK but contains only five LRRs and it was ident ified initially as the interacting protein of the LRR RK BRI1, which is the receptor of the plant horm one brassinolide (BL) (Li et al., 2002) BAK1 is required for ligand binding (Chinchilla et al., 2007) and serves as coreceptor of both BL receptor BRI1 and PRRs FLS2/EFR. Upon stimulus by flg22 or elf18, FLS2 or EFR immediately forms a complex with BAK1, as fast as 1 minute (Chinchilla et al., 2007; Heese et al.,

PAGE 19

19 2007; Roux et al., 2011) Recently, a nother SOMATIC EMBRYOGENESIS RECEPTOR LIKE KINASE (SERK) family member (BKK1/SERK4) was also identified to hetero di merize with FLS2 or EFR in a ligand dependent manner similar to BAK1 (Roux et al., 2011) Mutation of both BAK1 and BKK1 ( bak1 5 bkk1 1 ) dramatically compromised FLS2 mediated, EFR mediated signaling, making the double muta nt ne arly insensitive to flg22 and elf18 (Roux et al., 2011; Schwessinger et al., 2011) It is imaginable that BAK1 may also heterodimerize with other PRRs. After recruitment of BAK1 and BKK1 to FLS2, both FLS2 and BAK1 are phosphorylated (Schulze et al., 2010) Botrytis induced kinase1 ( BIK1 ) is a membrane localized cytoplasmic kinas e immediately downstream of the PRR BAK1 complex (Lu et al., 2010; Zhang et al., 2010) BIK1 and it s paralog PBL1 constitutively bind FLS2 EFR, CERK1, PEPR1, and PEPR2 and undergo phosphorylation after ligand induced FLS2 or EFR activation. Phosphorylated BIK1 dissociates from the r eceptors BAK1 complex The BIK1 mutation compromised PTI respon ses triggered by flg22, elf18 and chitin whereas it did not affect flg22 triggered MAPKs activation. This suggests existence of other branch es of PTI signaling. Downstream of complex formatio n and dissociation, activation of some MAPKKK/MAPKK/MAPK cascades MEKK MKK4/5 MPK3/6 and MEKK1 MKK1/2 MPK4 were triggered (Nicaise et al., 2009) Activation of MAPK cascade leads to activation of WRKY type transcription factors which cont rol plant defenses related gene expression (Pandey and Somssich, 2009)

PAGE 20

20 Phe notypical out puts o f PTI activation include ion f luxes, ROS production, callose d eposition, and stomata closing. 1.1.1.3 Negative regulation of PTI Plants have mechanisms to balance disease defense and growth, so they develop systems to attenuate PTI. Arabidopsis U box typ e E3 ubiquitin ligases (PUBs), PUB22, PUB23, and PUB24 were demonstrated to play a negative role in PTI (Trujillo et al., 2008) Triple mutant pub22/pub23/pub24 display s heightened PTI marker genes, derepression of MAPK3 activation, and increased production of ROS. The mutant is more resistant to the bacterial pathogen P seudomonas syringae pv. tomato ( Pst ) and the oomycete p athogen Hyaloperonospora arabidopsidis ( Ha ) Another pair of U box type E3 ubiquitin ligases PUB12 and PUB13 also negatively regulate PTI (Lu et al., 2011) Upon flg22 treatment, PUB12 and PUB13 rapidly associate with FLS2 and degrade FLS2. BAK1 is required for this association and it directly phosphorylates PUB12 and PUB13. The pub12/pub13 double mutant plants show enhanced an ROS burst, heightened PTI marker gene expression and most importantly they are more resistant to Pst than the wild type 1.1.1.4 Suppression of PTI by adapted microbes The first step for microbes to successfully infect plants is to enter the plant tissue. N atural openings such as s tomata are one of the paths microbes may enter. P AMPs treatment causes stomatal closure. A phytotoxin called coronatine from Pst is a jasmonate and can manipulate stoma opening for pathogen entry (Melotto et al., 2006) Bacterial p athogens rely mainly on the Type III secretion system (T3SS) to inject effectors into plant cells to subvert plant immunity (Gohre and Robatzek, 2008) T3SS is

PAGE 21

21 a syringe like apparatus utilized by bacteria to penetrate into the plant cell wall and plasma memb rane to inject effector proteins to attack the host (Jin et al., 2003) The first target s that may be envisioned to be attacked by microbes are plant PRRs. Studies have shown that s ome Pseudomonas syr inge strains do at tack PRRs AvrPtoB in P. syringae strain DC3000 was found to ubquitinate FLS2, EFR and BAK1 in vitro (Goehre et al., 2008; Shan et al., 2008a) FLS2 is ubiquitinated and degraded in vivo AvrPtoB c an target another PRR chitin receptor CERK1, leading to the blocking of defense responses through the receptor (Gimenez Ibanez et al., 2009) The C terminus of AvrPtoB carries an E3 ubiquitin ligase domain. AvrPtoB can ubiquitinate the CERK1 k inase domain in vitro and mediates CERK1 for degradation in vivo In addition to E3 ubiquitin ligase act ivity mediated d egradation of its substrates, AvrPtoB also possesses kinase inhibition domains. Another effect or AvrPto from the same bacterium strain can physically bind FLS2 and EFR and acts as a kinase inhibitor by inhibiting FLS2 and EFR kinase activi ty in vitro (Shan et al., 2008b; Xiang et al., 2008) AvrPtoB and AvrPto are two of the major virulence factors in P syringae strain DC3000. DC3000 stain carrying a double mutation of AvrPto and AvrPtoB is drama ti c ally compromised in its virulence (Lin and Martin, 2005; Cunnac et al., 2011) Effector AvrPphB, a cysteine protease in P syringae can cleave BIK1 and other PBS1 like (PBL) kinase family members to disable the kina ses and block the downstream signalling ( Zhang et al., 2010) Another adapted pathogen X. campestris pv campestris ( Xcc ), employs effector AvrAC for virulence by inhibiting BIK1 and RIPK activity (Feng et al., 2012) AvrAC is a uridylyl transfera se and can uridylylate BIK1 and RIPK by ad ding uridine 5' monophosphate to phosphorylation sites in the activation loop of BIK1 and RIPK to

PAGE 22

22 inhibit their kinase activities. Downst ream of the PRR complexes, MAPK cascades are also targets for some adapted microbes HopAI1, a phosphothreonine lyase, physically interacts with MPK3 and MPK6 (Zhang et al., 2007) and inactiv ates MPK3 and MPK6 activity by d ephosphorylation. HopF2, an A DP ribosyltransferase, can ADP r ibosylates MKK5 in vitro and physically interacts with MKK5 to inhibit MAP Kinase cascades (Wang et al., 2010) Interestingly, effect or AvrB manipulates a MAPK, MPK 4 to promote pathogenici ty not by inhibition of its kinase activity but rather by increasing its kinase activity (Cui et al., 2010) Dissection of the PTI signaling pathway is far from complete. Pathogen effectors can be utilized to achiev e such a goal. XopN in X. campestris pv vesicatoria ( Xcv ) can inhibit PTI by decrease of PTI marker gene expression and suppression of host call ose deposition during infection It can physic ally bind an atypical receptor l ike Kinase TARK1. Knockdown o f TA RK1 makes plants more amiable to XopN deleted Xcv infection (Kim et al., 2009) This implies a positive role played by TARK1 in PTI. Another probe is Pseudomonas syringae HopU1 which acts as a suppr essor of plant innate immunity HopU1, a mono ADP ribosyltransfera se, can ADP ribosylate GRP7 on two arginine residues locate d in the RNA recognition motif of glycine rich RNA binding protein GRP7. The knockout mutant grp7 plants were more susceptible to P. syringae than wild type (Fu et al., 2007) .This points to a possibility of RNA binding protein s such as GRP7 being involved in PTI. This decade has see n an explosive increase in exp loring the roles of effectors in subverting or attempting to subvert plant immunity. It is certain that more functions of effectors will be uncovered in the coming years especially in the relatively less explored

PAGE 23

23 area of plant pathogenic fungi and oomycete s. How do plants battle with fast evolving pathogens? Imaginably, not all attacks waged by microbes can succeed. Breakdown of the first layer of defense (PTI) cannot guarantee successful infection. The second layer of immunity (ETI) is waiting there. Thi s one is usually mo re robust than PTI 1.1. 2 Effector T riggered I mmunity ( ETI ) To combat a large array of pathogen effectors delivered into the host cells, plant s have developed a second layer of an immune system effector triggered immunity ( ETI ) to detec t and halt, directly o r indirectly, pathogen attack. Like pathogens, plants also pos sess a n arms arsenal, i.e. resistance (R) proteins. A p lethora of R proteins in plants have been identified namely 149 members in Arabidopsis thaliana (Meyers et al., 2003) and more than 600 members in rice (Luo et al., 2012) S trikingly most of the R proteins are structurally conserved NBS LRR proteins. This type of protein is typically composed of a variabl e amino terminus domain followed by a nucleotide binding site (NBS) and leucine rich repeat domains (LRR) The conserv ation of R proteins is in stark contrast with pathogen effectors which show vastly diverse structures and functions part of which a re dis cussed above. One individual plant in its life time can encounter numerous pathogens attacks and therefore, thousands of effectors. How do limited gene for gene model (Flor, 1971) simply, one R gene matches one effector, is no t sufficient to explain the complex dynamics so the g uard model was proposed (van der Biezen and Jones, 1998; Dangl and Jones, 2001) According to the guard model, R protein s guard/monitor the modification s of some self proteins (guardees) which are targeted by pathogen effectors. Once modifi cations of such guardees are detected R proteins will initiate resistance responses.

PAGE 24

24 1.1.2.1 Guard model The Arabidopsis RIN4 (RPM1 interacting protein4) a membrane anchored protein, is a negative regulator of plant basal defense (Holm et al., 2002) RIN4 is the target of multiple effectors. How RIN4 negatively regulates basal defense is largely unknown. Identification of RIN4 interacting proteins plasma membrane (PM) H + ATP a ses AHA1, AHA2 provides clue of the mechanism (Liu et al., 2009) Activation of PM H + ATPase AHA1 leads to stomata opening while RIN 4 can positively regulate the AHA1 enzymatic activity. It is very likely that effectors m odulate RIN4 to open stomata for entry. Recently, it was found that an other RIN4 interacting protein RPM1 INDUCED PROTEIN KINASE (RIPK), a receptor like cytoplasmic kinase, can phosphorylate RIN4 at some threonine residues in the presence of pathogen effe ctors AvrB and AvrRpm1 (Liu et al., 2011) Phosph orylation of RIN4 at these residues leads to detection of RIN4 modification by R protein RPM1, which initiates ETI. RIN4 mutant s with a phospho mimic amino acid at the threonine 166 position of RIN4 (T166D and T166E) triggered RPM1 dependent immunity response (in the form of HR) in an effectors independent manner in N. benthamiana (Chung et al., 2011) Another effector AvrRpt2, a bacterial cysteine prote ase, acts on RIN4 by directly cleaving RIN4. The cleavage leads to activation of another R protein RPS2 (Axtell and Staskawic z, 2003) Since RIN4 is a negative regulator of plant immunity, cleavage of RIN4 seems counterintuitive for AvrRpt2 to use it for virulence purpose s R ecent finding s provide a possible explanation for this (Afzal et al., 2011) Cleavage of RIN4 into fragments by AvrRpt2 allow s RIN4 to dissociate from the plasma membrane It was found that membrane untethered RIN4 can mor e strongly inhibit PTI than wild type RIN4. RIN4 cleavage fragments also show

PAGE 25

25 the capability of PTI suppression as potently as, if not more potently, than full length RIN4. Another advantage for cleavage of RIN4 by AvrRpt2 is that the cleavage renders modi fication of RIN4 made by AvrB or AvrRpm1 undetectable by the guard s of RIN4 the plant immune system have been frequently targeted by detecting the effectors thems elves (Mukhtar et al., 2011) (Bhattacharjee et al., 2011; Heidrich et al., 2011) EDS1 interacts with NB LRR R proteins RPS4, RPS6, SNC1 and negative regulator SRFR1 while it can a lso interact with effector AvrRps4. These two effectors are found to disrupt interaction between EDS1 and RPS4, RPS6, SNC1 and SRFR1 respectively in N. benthamiana AvrRps4 and H opA1 target EDS1/NB LRR protein complexes and are detected by the EDS1 depende nt resistance genes RPS4 and RPS6, respectively (Wirthmueller et al., 2007; Bhattacharjee et al., 2011) Many kinases such as BIK1 and other PBS1 like (PBL) kinase family members, including PBS1, are cleaved by eff ector AvrPphB. The R protein RPS5 guards PBS1 and is activated upon detection of PBS1 cleavage by AvrPphB (Shao et al., 2002; Shao et al., 2003; Ade et al., 2007) 1.1.2.2 Decoy model I n tomato the R pro t ein Pto a cytoplasmic kinase and its paralog Fen directly interact wi th a NB LRR protein Prf which is required for Pto mediated resistance (Salmeron et al., 1996; Mucyn et al., 2006) AvrPto and AvrPtoB physically interact with Pto, as well as Fen which trigger s Pto mediated ETI. Since AvrPto and AvrPtoB can target many kinase domains of PRRs and Pto exhibit s high simi larity to the kinase domains of PRRs such as CERK1, FLS2 and EFR, it was proposed that Pto and Fen

PAGE 26

26 have ev olved as a decoy for AvrPto and AvrPtoB to activate ETI (Xing et al., 2007) It was found that AvrPto did in hibit kinase activity in vitro Although stru cturally unrelated, both AvrPto and AvrPtoB interact predominately with a peptide positioning loop ( P+1 loop ) of the Pto kinase (Wu et al., 2004; Xing et al., 2007; Dong et al., 2009) The P +1 loop is usually for s ubstrate peptide positioning within the kinase catalytic cleft for phosphorylation. Interestingly, perturbation of the P+1 loop of Pto can release the inhibition imposed by Pto interacting Prf and leads to activation of Prf Pto complex. A recent finding sh ows that Pto/Prf can form oligomers. D imerization of Prf can bring two Pto molecules into close proximity (Gutierrez et al., 2010) D isruption of Pto P+1 loop by AvrPto and AvrPtoB stimulates phosphorylation of Pto by another proximate Pto in trans (Ntoukakis et al., 2013) The transphosphorylation is required for ETI signaling. In this way, Prf/Pto sets a trap to cajole AvrPto and AvrPtoB to pull the trigger to activate defense response A sub set of T3SS effectors from Xanthomonas spec ies encode transcription activator like proteins (called TAL effectors) that can directly bind to promoter regions in the nucleus of plant cells to induce targeted gene expression. The TAL effector AvrBS3 from Xanthomonas campestris pv. v esicatoria ( Xcv ) c an directly bind to the promoter region (UPA box) of UPA20 a bHLH transcription factor, and induce its expression (Kay et al., 2007) UPA20 is the master regulator of cell size and the induction of UPA20 cause s cell enlargement ( hypertrophy ) in mesophyll cells By mimicking host transcription factors AvrBS3 reprograms host cells for Xcv fitness In resistant pepper plants carry ing the BS3 R gene, AvrBS3 binds to the promoter region of the R gene BS3 and transactivates its expression (Romer et al., 2007) The transactivation of BS3

PAGE 27

27 by AvrBS3 leads to a resistance response against the AvrBS3 carrying Xcv The promoter of BS3 appear s to act as a trap to mimic the inducible conserved DNA elements bound by AvrBS3. Anothe r TAL effector AvrXa27 in Xanthomonas oryzae pv. oryzae ( Xoo ) can specifically induce the expression of its cognate R gene Xa27, probably by direct promoter binding and transactivation, leading to a resistance response (Gu et al., 2005; Romer et al., 2009) TAL effectors PthXo1 and AvrXa7 from Xoo can directly induce expression of susceptible genes Os8N3 and Os11N3 respectively (Yang et al., 2006a; Antony et al., 2010) Int er estingly, resistance of the xa13 allele carrying rice cultivar to PthXo1 carrying Xoo is due to the mutation of the promoter region in Os8N3 and loss of inducibility by PthXo1 (Chu et al., 2006) Nota bly, in recent years the codes for determination of TAL effector binding to DNA sequence s hav e been partially elucidated (Boch et al., 2009; Moscou and Bogdanove, 2009; Bogdan ove and Voytas, 2011) Engineered TAL effector s can be designed to target sequence s of interest for gene editing by using TAL nuclease technology (TALEN). By using TALEN, the binding site of the Os11N3 promoter region was mutated. The mutation conf ers the mutant plants resistant to AvrXa7 carrying Xoo (Li et al., 2012) In summary, plant pathogens employ a large number of virulence factors such as T3SS effector s to dampen plant immunity. On the other hand, plants develop layers of immunity, namely plant innate immunity and effector triggered immunity to defend against pathogen invasions. P lants can guard some hub proteins or can use deco ys to detect pathogen inv asions.

PAGE 28

28 1.2 Ubiquitination in Plant Immunity Ubiquitination. Ubiquitin is a small conserved 76 amino acid peptide (about 8 500 Dalton s ) used to covalently attach to the lysine residues of its target protein for modification. Consequences of ubiquitination include protein relocalization, endocytosis or degradation. Monoubiquitination is usually associated with endocytosis and histone modification (Weissman et al., 2011) P olyubiquitination on the other hand mediates degradation of substrate protein through the 26S pr oteasome although in very few cases, polyubiquitination activ ates the modified protein. For example, activation of IKKs by E3 u biquitin ligase TRAF proteins is through polyuniquitination in the NF kappaB signaling pathway (Sun and Chen, 2004) Covalent linkage of ubiquitin to the substrat e proteins is a sequential process (F ig. 1 2) which involves an E1 (u biqui tin activating enzyme), an E2 (u biquitin conjugating enzyme) and an E3 (u biquitin ligase). E3 ubiquitin ligase is the specificity determinant of ubiquitin ation process. Therefore there are many more E3 s than E1 s and E2 s combined. More than 1400 E3 ubiquitin ligases are reported in A. thaliana (Mazzucotelli et al., 2006; Vierstra, 2009) In the first step ubiquitin is activated in an ATP dependent manner, ready for transfer to E2. E2 accepts ubiquitin from E1 and transfers to the substrate proteins recruited by E3. E3 recognizes its substrate protein and catalyzes transfer of ubiquitin to the substrate. The ubiquitinated proteins undergo degr adation through the 26S proteasome 1.2.1 Types of E3 Ubiquitin L iga ses In A. thaliana there are only two E1 genes and 37 E2 genes, but mo re than 1400 E3 genes (S malle and Vierstra, 2004; Vierstra, 2009) E3 proteins are responsible for specifically recruiting s ubstrate proteins for ubiquitination E3 proteins can be further

PAGE 29

29 divided into 5 different types based on components and modes of action (Fig. 1 3). For RIN G type, U box type and HECT type a single protein function s as E3, working together with E1s and E2s for ubiquitination. RING type and U box type E3s can directly transfer ubiquitin from E2 to substrates without E3 ubi quitination. HECT type E3s need to tra nsfer ubiquitin first to itself then transfer it to their substrates. There are complicated E3 complex es with many component s involved in E3 ubiquitin ligase function. The complex of c u llin RING ligases (CRLs) includes the component cullin, E2 bound RING box 1 (RBX1), and different target recognition modules. The major ity of CRLs is the SCF family which is comprised of S phase kinase associ ated protein 1 (SKP1), cullin 1 (CUL1) and F box (SCF). The SKP1 and F box proteins can be substituted by bric a brac tramtrack broad (BTB) motif containing proteins to form cullin BTB type E3 s A Cullin (CUL) protein, CUL1, CUL3, or CUL4, acts as a scaffold to bring together RBX1 and the sub strate recruiting protein. S ubstrate recruiting proteins such as BTB proteins bi nd directly to the CUL protein. However some s ubstrate recruiting proteins need adaptor protein s such as SKP1 to bind to substrates 1.2.2 Roles of E3 Ubiquitin Ligases in Plant D efense Positive roles of E3 ubiquitin ligases in plant defense. E3 ubiquitin ligases play a variety of ro les in a plant life cycle. O ne important role involves defense against bio tic challenges. E3 ubiquitin ligase mediates recognition of protein substrates for ubiquitination. Ubiquitinated products usually go through a proeolyt ic pathway. Only a few E3 ubiquitin ligases have been shown to play roles in plant defense. For most of these E3 ubiquitin ligases, their substrate s have not yet been identified. In some Avr9/Cf 9 Rapidly Elicited (ACRE) genes, the NtCMPG1 gene which encode s a U Box protein was identified (Durrant et al., 2000; Gonzalez Lamothe et al., 2006) This U Box

PAGE 30

30 protein shows in vitro ubiquitination activity. Cf 9/Avr9 induced HR in tobacco is severely compromised in NtCMPG1 s ilenced tobacco plants, while overexpression of NtCMPG1 produces a stronger HR in Cf9 tobacco when elicited by Avr9. The h omologous tomato ( Solanum lycopersicum ) CMPG1 gene is required for full resistance to the fungal pathogen Cladosporium fulvum (Gonzalez Lamothe et al., 2006) Another gene, also encoding a U box cont aining pro tein ACRE276 and its A. thaliana homolog PUB17, was found, by the same screening strategy, to also play a positive role in cell death and defense (Yang et al., 2006b) A n F Box encoding gene in the ACRE ge ne family called ACRE189 is also required for cell death (van den Burg et al., 2008) HR triggered by different elicitors such as Avr9, Avr4, AvrPto, Inf1, and TMV P50 helicase is compromise d when ACRE189 is silenced. Transcript knockdown of the tomato ACRE189 ort holog leads to the loss of Cf 9 mediated r esistance to C. fulvum A pepper RING protein CaRING1 gene is induced by avirulent Xanthomonas campestris pv. vesicatoria ( Xcv ) strain s but not by the virulent strain s (Lee et al., 2011) Transient overexpression of CaRING1 causes HR in pepper leaves. Silencing of pepper CaRING1 increases susceptibility to both virulent and avirulent Xcv Ectopic overexpr ession of CaRING1 in A. thaliana confers enhanced resis tance to Pseudomonas syringae pv. tomato and Hyaloperono spora arabidopsidis (Lee et al., 2011) By using yeast two hybrid screening with tobacco mosaic virus (TMV) RNA dependent RNA polymerase (RdRp) as bait, an interaction partner in tobacco called TARF (TMV associated RING finger protein) containing a RING finger motif was identified. Transient overexpression of TARF ca n impair TMV accumulation, whereas TMV accumulates dramatically when TARF is silenced. This indicates the E3 ubiquitin

PAGE 31

31 ligase can target a virus virulence factor to defend against it. A pair of RING finger ubiquitin ligases was shown to play a positive role in RPM1 and RPS2 dependent HR as wel l (K awasaki et al., 2005) Negative roles of E3 ubiquitin ligases in plant defense. Mutation of the s potted leaf11 gene in rice result s in spontaneous spotted lesion s ( cell death ) in leaves, indicating a negative role for this E3 ubiquitin ligase plays in cel l death and pla nt defense. The mutant lines confer enhanced resistance to the fungal pathogen Magnaporthe grisea and the bacterial pathogen Xanthomonas oryzae pv oryzae (Yin et al., 2000; Zeng et al., 2004) A. th aliana k nockout s of three homologs of U box type E3 ubiquitin ligases (PUBs), PUB22, PUB23, and PUB24 activates the PTI pathway (Trujillo et al., 2008) which suggests their negative roles in plant immunity. Recently an interesting finding has shown that A. thaliana FLAGELLIN SENSING 2 (FLS2), a classical pattern recognition receptor, is the substrate of two closely related U box E3 ubiquitin ligases, PUB12 and PUB13. FLS2 forms a complex with BAK1, PUB2 and PUB13 upon flagellin elicitation (Lu et al., 2011) These two E3 ubiquitin ligases keep innate immunity in check. Double mutants of these two genes confer an elevated immune response upon flagellin treatment. This shows that some E3 ubiquitin ligases can function as a response s need to be kept in check to prevent autoimmnunity. Plants wi th an autoimmune response often show dwarfi sm and retarded growth, an un desirable trait for plants (Li et al., 2001; Zhang et al., 2003) One way to keep immuni ty and plant growth in balance is to degrade immune pro teins by the ubiquitination pathway to prevent overaccumulation of such proteins. An F box protein CPR1 controls the stability

PAGE 32

32 of two NB LRR proteins, SNC1 and RPS2 and they associate in vivo CPR1 loss of function mutation results in increased SNC1 and RPS2 protein levels and enhanced immune response, while overexpression of CPR1 produces the opposite result. This suggests the F box containing SCF E3 ubiquitin ligase regulates immune protein level s and prevent s autoimmunity (Cheng et al., 2011; Gou et al., 2012) Symbiotic interactions are als o a form of infection by microbes in plants A recently identified RING containing E3 ubiquitin ligase SINA4 in Lotus japonicas was demonstrated to play a negative role in reg ulation of rhizobial infection (Den Herder et al., 2012) SINA4 interacts with L. japonicus SYMBIOSIS RECEPTOR LIKE KINASE (SYMRK) which is required for root symbiosis (Yoshida and Parniske, 2005) and targets it for degradation in Nicotiana benthamina 1.2.3 Degradation of Transcription Factors by E3 Ubiquitin Ligases in P lants One way for E3 ubiquitin ligases to control global transcription patterns is to degrade transcription factors or transcription repressors. In the plant light signaling pathway, a negative regulator of photomorphogenesis named CONSTITUTIVELY PHOTOMORPHOGENIC1 (COP1) was identified to play a key role (Deng et al., 1991; Deng et al., 1992) COP1 is a RING finger motif containing E3 ubiquitin ligase. It targets photomorphogenesis promoting factors for degradation in the absence of light. HY5 is a bZIP transcription factor positively regulating light signaling in A. thaliana Direct interaction between COP1 and HY5 and targeting of HY5 for degradation by COP1 was demonstrated (Ang et al., 1998; Osterlund et al., 2000) Another bZIP transcription factor HY H which can forms heterodimers was also found to be targeted by COP1 for degradation (Holm et a l., 2002) More substrates of COP1 were identified, including a MYB type transcription factor LAF1 (Seo et al., 2003) and a bHLH type transcription

PAGE 33

33 factor HFR1 (Jang et al., 2005a; Yang et al., 2005) both of which participate positively in regulating photomorphogenesis. These findings show that controlling turnover of transcription fact ors is an important strategy in light signaling in plants. Recently it has been shown that COP1 also negatively regulates Arabidopsis flowering time through control of a key flowering transcription factor CONSTONS (CO) (Liu et al., 2008) CO a B box type zinc finger t ranscriptional activator, activates transcription of the FLOWERING LOCUS T (FT) gene which promotes flowering (Samach et al., 2000; Suarez Lopez et al., 2001; An et al., 2004) COP1 physically interacts with CO in v ivo and ubiquitinates CO in vitro A s eries of transcriptional events occur when plants face stress stimuli. ICE1 is a constitutively expressed MYC like bHLH transcriptional factor that transcriptionally activates the cold responsive gene CBF3 for cold tol erance (Chinnusamy et al., 2003) RD29A i s a cold induced gen e. An EMS random mutagenesis using the RD29A promoter driven LUC as a marker identified a mutant with enhanced luminescence response named hos1 (Ishitani et al., 1998) In hos1 mutant plants, many cold responsive genes are induced, such as RD29A, COR47, COR15A, KIN1, ADH and C repeat (CRT) binding factors (CBF) (Ishitani et al., 199 8; Lee et al., 2001) Positional cloning identified the HOS1 gene as a RING finger containing E3 ubiquitin ligase encoding gene (Lee et al., 2001) It was found that a HOS1 GFP fusio n protein resides in the cytoplasm at ambient temperature s However, HOS1 GFP accumulates in the nucleus upon cold treatment. Later it was found that HOS1 is a functional E3 ubiq uitin ligase which can interact with and ubiquitinate ICE1, a transcription f actor activating the expres sion of CBFs (Dong et al., 2006) Genetically c old induced degradation of ICE1

PAGE 34

34 requires HOS1. At the same time it has been observed that the hos1 mutant flowers earlier than the wild type (Ishitani et al., 1998) A genetic screen for an early flowering A. thaliana mutant s identified a mutant which was named early in short d ays6 ( esd6 ) (Lazaro et al., 2012) Map based cloning pinpoints the lesion locus to HOS1, the E3 ubiquitin ligase involved in cold response. HOS1 physically interacts with CONSTANS (CO) protein in vitro and in planta HOS1 also regulates CO protein level, which indicates CO could be another substrate of HOS for degradation. E3 u biquitin ligases not only take part in cold stress response signaling, but also are involve d in drought stress response signaling. D ehydration resp onsive element binding protein2A (DREB2A) is an AP2/ERF type transcription factor that binds to the DRE sequ ence for dehydration responses. However, DREB2A overexpression lines do not produce any observable phenotypes or induction of dow nstream genes (Liu et al., 1998) The overexpressed DREB2A protein is not stable under normal growing conditions, while a partial deletion of DREB2A, in which a stretch of a 30 amno acid region adjacent to ERF/AP 2 DNA binding domain of DREB2A was deleted can be stabilized in the overexpression lines (Sakuma et al., 2006a) Transgenic plants with this partial deletion mutant show enhanced tolerance to drought and high temperature (Sakuma et al., 2006b; Sakuma et al., 2006a) It was hypothesized that post transcriptional modification, possibly through the short 30 amino aci d region adjacent to ERF/AP 2 DNA binding dom ain of DREB2A, may regulate protein stability. A later yeast two hybrid screen using DREB2A as a bait identified an interaction partner DRIP1 encoding a RING type E3 ubiquitin ligase (Qin et al., 2008) DRIP1 and its paralog DRIP2 are constitutive ly expressed. DRIP1 is a nucleus localized

PAGE 35

35 protein and associates with DREB2A in planta in b imolecular fluorescence complementation ( BiFC ) assay s (Qin et al., 2008) As expected, DRIP shows in vitro ubiquitin ligase activity and ubiquitinates DREB2A in vitro Overe xpression of DRIP1 delays induction of genes targ eted by DREB2A when subjected to drought, while mutation of DRIP1 and DRIP1 paralo g DRIP2 at the same time confer enhance d drought tolerance. DREB overexpression lines under drip1 mutant background (35S:GFP DREB2A/ drip1 ) show dwarf phenotype and overacuumulated DREB2A protein. E3 ubiquitin ligases also take part in phytohormone signaling pathway s NAC1 is a transcription factor in the auxin signaling pathway regulating lateral root development in A. thaliana (Xie et al., 2000) SINAT5 is a RING containing E3 ubiquitin ligase which functions to ubiquitinate and degrade NAC1 to attenuate auxin signaling for l ateral root development (Xie et al., 2002) Both NAC1 and SINAT5 are induced by auxin treatment. Overex p ression of SINAT5 in plants r esults in decreased NAC1 protein level in roots and correspondingly less lateral roots are produced. A C49S mutation that destroys the RING motif causes a dominant negative phenotype. Overexpression of SINAT5 C49S in plan ts shows the opposite phenotype as the overexpression of wild type SINAT5. Thi s indicates SINAT5 functions in an oligomeric form. All these exemplify that E3 ubiquitin ligase s can function to attenuate signals by targeting transcri ption factors for degradation. As for ABA signaling, ABI3 is a B3 type transcription factor inducible by ABA and involved in ABA signaling (Parcy et al., 1994) The ABI3 protein is turn ed over rapidly in the cell (Zhang et al., 2005) A yeast t wo hybrid screen using ABI3 as bait identified a gene AIP2 encoding a RING motif containing E3 ubiquitin ligase protein

PAGE 36

36 (Kurup et al., 2000) AIP2 interacts with ABI3 in vitro and in viv o also ubiquitinates itself and ABI3 in vitro An e levated ABI3 protein level was found in aip2 mutant plant s while inducible expression of AIP2 causes degradation of ABI3 in t ransgenic plants containing 35S ABI3 6myc and XVE AIP2 3HA. This indicates AIP2 functions in vivo as an E3 ubiquitin ligase targeting ABI3 for degradation. Additionally, mutatio n of AIP2 confers hypersensitivity to ABA the same as in the ABI3 overexpression lines. In contrast overex pre ssion of AIP2 makes plant s more insensitive to ABA the same as abi 3 lines (Zhang et al., 2005) In summary, E3 ubiquitin ligases involve in PTI and ETI, eith er positively or negatively. In response to abiotic and biotic stresses, E3 ubiquitin ligases can be activated and degrade series of substrate proteins to transduce signaling. One type of the substrate proteins is transcription factors. Degradati on of tran scription factors leads to globally reprogram ming of transcription patterns. Many transcription factors involved in abiotic stress have been identified as the substrate proteins of E3 ubiquitin ligases as discussed above. However few transcription factors involved in biotic stress have been identified as the substrate proteins of E3 ubiquitin ligases. This study identifies a basic helix loop helix (bHLH) type transcription factor RERJ1 as the substrate protein of the E3 ubiquitin ligase XA21 Binding Protei n 3 (XB3). Genetic evidence shows that RERJ1 is a negative regulator of plant immunity. XB3 and other members of XB3 family from diverse plant species can induce hypersensitive response like response (programmed cell death) in Nicotiana benthamiana

PAGE 37

37 Figure 1 1. Relationship between pathogens and the plant immune system. Pathogens with pathogen associated molecular patterns (PAMPs), such as bacterial Tu and fungal chitin induce PAMPs trigger ed immunity (PTI). PTI is suppressed by some effectors directly translocat ed into host cells by pathogens Plants evolutionarily deve lop Resistance (R) protein s to recognize effectors and confer effector triggered immunity (ETI). Pathogen s can further develop mo re virulent effectors to attack ETI.

PAGE 38

38 Figure 1 2 Ubiquitination dependent proteolysis pathway. The 76 amino acid ubiquitin forms a thioester bond with the ubiquitin activating enzyme E1 in an ATP dependent manner at the first step of ubiquitination. In the next step, ubiquitin is transferred to the ubiquitin conjugating enzyme E2. Then, ubiquitin i s transferred to the target protein in the presence of the ubiquit in ligase enzyme E3, which specifically recruits the substrate proteins for ubiquitinat ion. This process can repeat many times, so a substrate protein can be polyubiquitinated. The ubiquitin ated protein is targeted to the 26S proteasome for degradation. Ub: ubiquitin.

PAGE 39

39 Figure 1 3 Different types of E3 ubiquitin lig ases. Simple E3s RING/U box type (A) and HECT type (B) only need single protein s for E3 f unction. Complicate d E3s SCF type (C) and CUL3 BTB type (D ) need multi subunits for E3 function.

PAGE 40

40 CHAPTER 2 MEMBERS OF THE XB3 FAMILY FROM DIVE RSE PLANT SPECIES INDUCE PROGRAMMED CELL DEATH IN NICOTIANA BENTHAMIANA 2.1 Background The rice gene Xa21 w as originally identified as an R gene, conferring resistance to Xanthomonas oryzae pv. oryzae ( Xoo ), the causal agent of bacterial blight disease of rice (Song et al., 1995) Xa21 encodes a receptor kinase protein that recognizes a sulfated peptide (axY S 22) embedded in the N terminal region of the bacterial poly peptide Ax21 (Lee et al., 2009) Because of wide conservation of Ax21 in the genus Xanthomonas Xa 21 mediated defense is thought to be a part of PTI. XA21 in teracts through its intracellular kinase domain (XA21K) with a number of rice proteins (Park et al., 2010) One of them, XA21 binding protein 3 (XB3), consists of eight imperfect ankyrin repeats at the N terminal half, a RING (Really Interesting New Gene) finger (RF) motif, and a C terminal tail (XB3 C) that potentially forms a coil coil structure (Wang et al., 2006) XB3 is a RING type E3 ubiquitin li gase in rice ( Oryza sativa ) (Wang et al., 2006) It shows in vit ro ubiquitin ligase activity. XA 21 resistance protein (Song et al., 1995) interacts with and phosphorylates XB3 in vivo Silencing of XB3 compromised Xa21 mediated resistance to avirulent Xanthomonas oryzae pv. oryzae ( Xoo ). Therefore, it was proposed that XB3 functio ns as a positive regulator of Xa 21 mediated immunity (Wang et al., 2006) This demonstrates that XB3 play s a pos itive role in R gene mediated resistance. However, the question of whether XB3 could activate defense resp onses remains to be addressed. Whether it plays any role in basal defense is still yet to be explored. It is also unclear whether the E3 ubiquitin lig ase activity of XB3 is required for its function.

PAGE 41

41 In this study we show that XB3 is a member of a highly conserved E3 ubiquitin ligase family. Overexpression of XB3 or other members of this E3 family from rice, Arabidopsis, and citrus induces a cell death response in N. benthamiana The hypersensitive response (HR) is rapid collapse (cell death) of localized tissue (Dangl et al., 1996) It is often seen as marker of disease resistance to biotrophs, although in a few cases HR can be uncoupled from disease resistance (Yu et al., 1998; Clough et al., 2000; Cole et al., 2001) Some E3 ubiquitin ligases were reported to be involved in the HR process, but few of them have direct role in inducing HR by itself. Recently a RING finger E3 ubiquitin ligase from pepper called CaRING1 wa s r eported to be capable of causing HR in pepper leaves by transient overexpression (Lee et al., 2011) Silencing of pepper CaRING1 increases susceptibility to both virulent and avirulent Xanthomonas campestris pv vesicatoria ( Xcv ) Ectopic overexpression of CaRING1 in Arabidopsis confers enhanced resistance to Pseudomonas syringae pv tomato and Hyaloperonospora arabidopsidis These show that CaRING1 plays a positive role in basal defense. 2.2 Materials and Methods 2.2.1 Phylog enetic Analysis Protein sequences were retrieved from NCBI by using the XB3 sequence as a query and aligned using CLUSTAL W (Thompson et al., 1994) The neighbor joining phylogenetic tree was constructed using the MEGA4 program (Saitou and Nei, 1987; Tamura et al., 2007) Bootstrap values were obtained by 1000 bootstrap replicates.

PAGE 42

42 2.2.2 Bacteria and Plant Growth C onditions Agrobacterium tumefaciens strain EHA105 was grown at 29oC in Luria Bertani medium with appropriate antibiotics. N. benthamiana was grown at 24 26oC with a 16 hour photoperiod under florescent light. 2.2.3 Constructs The XB3 overexpression construct pC1300S XB3 was made by cloning the PCR amplified Xb3 gene (primer pair Xb3nb 1/Xb3nb 2) into the BamHI site of the binary vector pCAMBIA1300S. All the primers used in this study are listed in Table 1 (Table 1). A similar method was used to construct pC1300S XB3C323A (primer pair Xb3nb 1/Xb3nb 2). To fuse a 3xFLAG epitope tag in frame to th e C terminus of XB3, the Xb3 gene was PCR amplified using the primer pair Xb3NEW 1/ Xb3NEW 3 and cloned into the pCR8GW 3xFLAG vector for sequencing. The resultant Xb3 was then subcloned into the Xba I site of the pCAMBIA1300S binary vector. A similar str ategy was used to construct pCAMBIA1300S 3xFLAG (primer pair XB3New 1/ XB3New 7), pCAMBIA1300S XB3Ank 3xFLAG (primer pair XB3New 1/ XB3New 5) pCAMBIA1300S XB3RFC 3xFLAG (primer pair XB3New 6/ XB3CT 3), pCAMBIA1300S XB3RF 3xFLAG (primer pair XB3N ew 6/ XB3New 7), pCAMBIA1300S XB3C 3xFLAG (primer pair XB3New 13/ XB3CT 3), pCAMBIA1300S XBOS31 3xFLAG (primer pair Xbos31nb 5/ Xbos31nb 6), pC1300S XBAT31 3xFLAG (primer pair Xbat31nb 1/ Xbat31nb 1), pC1300S XBAT32 3xFLAG (primer pair Xbat32nb 1/ Xbat32n b 1), pCAMBIA1300S XBCT31 3xFLAG (primer pair Xbct31nb 1/ Xbct31nb 2), and pCAMBIA1300S XBCT32 3xFLAG (primer pair 041054m 3/041054m 4). All constructs were confirmed by sequencing.

PAGE 43

43 2.2.4 Agrobacterium M ediated Transient A ssay in N. B enthamiana Agrobact erium mediated transformation of N. benthamiana was performed according to described method (Wroblewski et al., 2005) with modification. Overnight bacterial cultures carrying the constructs of interest were harvested by centrifugation at 4,000 g for ten minutes. Harvested cells were resuspended into buffer (10 mM MES, pH 5.6, 10 mM MgCl 2 and 1 600 of 0.5. Following incubation at room temperature for three hours, infiltration of 4 week old N. benthamiana leaves was performed using a 1 ml needleless syringe. Cell death phenotypes were scored at 2 and 3 dpi (days post infiltration), unless indicated otherwise. Tissue samples were collected at 40 hpi (hours post infiltration) for protein extraction. 2.2.5 Protein Blot A nalysis Protein blot analysis was performed as described previously [14] using a modifi ed protein extraction buffer: [50m M Tris HCl, pH 7.4, 150m M NaCl, 10% glycerol, 0.5% TritonX 100, 2 mM EDTA, 2% polyvinylpolypyrrolidone (PVPP), 2 mM DTT, 1 mM phenylmethylsulfonyl fluoride]. 2.2.6 Histochemical Staining For visualization of H 2 O 2 inocul ated leaves at indicated time points were detached and soaked in a solution containing 1 mg/mL 3, 3 diaminobenzidine (DAB) solution. Samples were stained for overnight with gentle shaking and then cleared in 95% ethanol. 2.2.7 Electrolyte Leakage Measurem ent To assay cell death, electrolyte leakage was measured from 3 leaf discs with 3 repeats. Leaf discs were immersed in 10 mL non ionic double distilled water and then

PAGE 44

44 shaken slowly at room temperature. After incubation, the conductivity of the solution w as measured using a conductivity meter. 2.3 Results 2.3.1 Sequence Analysis of the XB3 Family M embers To identify proteins functionally related to XB3, the protein sequence of XB3 was used as query to search the databases with the BLASTP program. A total o f 58 proteins were identified from diverse plant species ranging from rice and Arabidopsis (annual) to woody citrus (perennial). All of the identified sequences share similar ankyrin RING structures. Phylogenetic analysis revealed that 34 out of the 58 i dentified proteins, including XB3, form a large group with two major subclades that differentiate sequences from dicotyledonous and monocotyledonous plants (Fig. 2 1). This group of proteins was apparently more related to XB3, and therefore named the XB3 family. The copy number of the XB3 family members varies among plant species. For instance, rice contains three members, XB3, XBOS31 and XBOS37, whereas Arabidopsis carries only one, XBAT31. In the newly sequenced citrus genome (Xu et al., 2013) we identified two XB3 family members, XBCT31 and XBCT32. The XB3 family is phylogenetically distinct from XBAT32, an ankyrin RING protein that participates in lateral root development (Nodzon et al., 2004; Prasad et al., 2010; Lyzenga et al., 2012) 2. 3.2 The R ice XB3 Protein C a n E licit C ell D eath in N icotiana B enthamiana To determine whether XB3 is capable of activating cell death response, we transiently overexpressed this protein in Nicotiana benthamiana (N. benthamiana). This heterologous plant species has a well established transient overexpression system mediated by Agrobacterium transformation (agroinfiltration) (Goodin et al., 2008 ) and is ideal for cell death assays. Furthermore, we assumed that the XB3 function in plant

PAGE 45

45 immunity might be evolutionarily conserved based on the phylogenetic analysis described above. An Xb3 construct, driven by the cauliflower mosaic virus (CaMV) 35 S promoter, was delivered into 4 week old N. benthamiana leaves by agroinfiltration. The infiltrated areas started developing visible grey patches at day 2 (48 hours) and completely collapsed three days after agroinfiltration (Fig. 2 2A). This necrotic ph enotype was reminiscent of HR caused by avirulent pathogen infections. As a control, infiltration of Agrobacterium containing the empty vector (pCAMBIA1300S) failed to induce tissue death. To confirm XB3 accumulation, we carried out protein blot analyses using previously developed anti XB3M antibodies that can specifically detect XB3 in rice (Wang et al., 2006) Leaf samples were harvested 40 hours after infiltration, at which time the necroti c phenotype was not apparent. XB3 was detected in the leaf discs infiltrated with the Xb3 construct, but not in those with the empty vector (Fig. 2 2B). These results indicated that the overexpressed rice XB3 triggers cell death in N. benthamiana. Cell d eath is often associated with electrolyte leakage caused by membrane damage. Ion leakage assays were performed to quantify XB3 induced cell death. As shown in Fig. 2 2 C, significant amounts of ion leakage were detected 48 and 72 hours after infiltration with the Xb3 harboring Agrobacterium. In the infiltrated leaf discs, the development of visible tissue collapse kinetically correlated with the time course of ion leakage. Ion leakage was not induced by agroinfiltration of the empty vector. These data c onfirm the cell death activity of XB3. 2.3.3 The RF domain of XB3 I s Required for the Cell Death R esponse As mentioned above, XB3 mainly consists of three domains: eight ankyrin repeats, a RF motif, and a XB3 C (Wang et al., 2006) We have previously shown that

PAGE 46

46 the ankyrin repeats of XB3 acts as a protein protein interaction domain capable of binding to the kinase region of XA21 (Wang et al., 2006) To define the minimal sequence for cell death activity, different domains of XB3 or combinations of domains (Fig. 2 3A) were transiently expressed in N. benthamiana leaves. Both tissue collapse and ion leakage were used as criteria for the cell death response. For protein detection, a 3xFLAG epitope tag was fused to the C terminus of XB3 and its derivatives. Expression of the tagged XB3 (full length) induced a similar cell death phenotype as that of wild type XB3, indicating that XB3 3xFL AG is functional (Fig. 2 3B, 2 3 C). The terminal coil coil domain, triggered a similar or even slightly higher level of cell death as compared with XB3. Another mutant retaining cell death activity was XB3RFC, which encompasses the RF motif and the XB3 C doma in. ankyrin domain, the RF motif, or XB3 C alone) induced any measurable cell death. To confirm the expression of the XB3 truncations in the infiltrated leaves, protein blot analyses were carried out using anti FLAG M2 antibody. This antibody detected a single product with the expected size of XB3 3xFLAG from the leaves infiltrated with the corresponding construct, but not from t he empty vector control (Fig. 2 3D). Sinc e XB3 3xFLAG and its FLAGged truncation variants encompass a wide range of molecular weights, ranging from 52.0 to 12.5 kDa, proteins were resolved using an 8% or 10% SDS PAGE gel. The XB3RFC 3xFLAG sample was included in both gels for pattern comparisons 3xFLAG, XB3Ank 3xFLAG, XB3RFC 3xFLAG, and XB3C 3xFLAG, accumulated to much higher le vels than XB3 3xFLAG did (Fig. 2 3D, 2 3 E). Almost no protein with the expected

PAGE 47

47 size of XB 3RF 3xFLAG was detected (Fig. 2 3E). In addition to the XB3 variants, judged by the expected molecular weight of each protein, products with higher molecular weights were observed in the samples of XB3Ank 3xFLAG, XB3RFC 3xFLAG, and XB3RF 3xFLAG. These products likely originate from the XB3 variants, possibly representing post translational modifications of these altered proteins. 2.3.4 The E3 Deficient M utant XB3 C323A I s Unable to Induce Cell D eath Mutation of the conserved Cys323 residue abolishes XB3 autoubiquitination activ ity (Wang et al., 2006) We asked whether this mutation also eliminates XB3 cell death activity in N. benthamiana Although the XB3 C323A protein was expressed to a level comparable to or even hi gher than wild type XB3 (Fig. 2 4C ), the mutant failed to trigger any visible cell death (Fig. 2 4A). This observation was further support ed by ion leakage assays (Fig. 2 4B ). Thus, the RF motif is essential for XB3 cell death activity, and the XB3 E3 ubiquitin ligase activity is likely required for this function 2.3.5 Mutation of the Myristoylation Site of XB3 Compromises Its Cell Death I nduction Based on software prediction ( http://web.expasy.org/m yristoylator/ ), there is a putative myristoylation site in XB3 The myristoylation process is to covalently attach a myristoyl group a hydrophobic 14 carbon saturated fatty acid to the glycine residue at the second residue of a myristoylated protein an d myristoylation of a protein is often related to anchoring of the protein the membrane (Resh, 1999) It was shown that myristoylation of the t o mato R protein Pto is required for signal transduction in N. benthamiana although The subc ellular localization of Pto does not dependent on N myristoylatio n (de Vries et al., 2006) Specifically, the G2A mutation of Pto abolished HR induction triggered by Pto AvrPto recognition in N. benthamiana Also, based o n the

PAGE 48

48 demonstrated fact that XB3 physically associates with the membrane localized XA21 (Wang et al., 2006) it is plausible to hypothesize that membrane associated myristoylation of XB3 m ay pl ay a role in XB3 function. To test this hypothesis, a glycine 2 mutation (G2A) as well as a glycine 4 mutation (G4A) w as introduced into XB3 protein. The two mutants, together with wild type XB3 were agroinfiltrated on N. benthamiana At 2 days post infil tration (dpi), both wild type XB3 and G4A mutant developed apparent and measurable HR like cell death, whereas the G2A mutant failed to develop visible and measurable HR like cell death (Fig. 2 5A, 2 5 B). At 3dpi the G2A mutant started showing slight HR li ke cell death (Fig. 2 5A, 2 5 B). The compromised ability of XB3 G2A mutant to trigger cell death could not be due to reduced accumulation of protin, because the protein blot showed that the accumulation of XB3 G2A mutant protein was even apparently higher than wi ld type XB3 and XB3 G4 A mutant (Fig. 2 5C). This result shows that glycine 2 of XB3 is important for XB3 cell death induction in N. benthamiana It is notable that many homologs of XB3 have putative myristoylation site and t he homologs of XB3 chosen for this study all contain putative myristoylation site ( Fig. 2 5D). 2.3.6 Members of the XB3 Family from Rice, Arabidopsis, and Citrus Can All Induce Cell D eath Given the closely related domain structure and sequences (Fig. 2 1), we wanted to determine w hether other members of the XB3 family share cell death activity. The XBOS31 gene was cloned from rice previously (Wang et al., 2006) We isolated, using RT PCR, the genes encoding XBAT31, XBC T31, and XBCT32 from Arabidopsis and citrus, respectively. Because XB3 3xFLAG functions as wild type XB3 in cell death induction, we assumed that the addition of the same tag at the C termini would not

PAGE 49

49 interfere with the potential cell death function of o ther XB 3 members. W hen expressed in leaves by the CaMV 35 promoter, these proteins all elicited tissue collapse to various degrees ( Fig 2 6 A ). Xb3 and Xbct31 appeared to be stronger cell death inducers, whereas Xbct32 seemed to have a weaker activity. In addition to the empty vector, the Arabidopsis Xbat32 gene encoding an active E3 ubiquitin ligase (Nodzon et al., 2004; Prasad et al., 2010; Lyzenga et al., 2012) did not induce any visible tissue collapse. Data f rom ion leakage assays were consistent with the above observations ( Fig. 2 6 B ). Anti FLAG M2 antibody detected the expected XB3 family members in the infiltrated leaf discs ( Fig. 2 6 C ). Notably, the abundance of each protein in the leaves did not correla te with the intensity of tissue death symptoms. For example, XBCT31 accumulated to a lower level as compared with XBCT32. However, a much more severe tissue death was induced by XBCT31. Despite these differences, our results indicated that the XB3 famil y represents a conserved cell death inducing function. 2.4 Discussion Reduction of expression studies have suggest ed a positive role for XB3 in Xa 21 mediated immunity (Wang et al., 2006) The d ata presented here show that XB3 alone is capable of eliciting a cell death response when overexpressed in N. benthamiana. This activity is specific because the Arabidopsis protein XBAT32 with a similar ankyrin RING finger structure but low sequence identi ty (30%) is unable to trigger cell death. Accordingly, the only known role for XBAT32 is the regulation of lateral root development (Nodzon et al., 2004; Prasad et al., 2010; Lyzenga et al., 2012) The specificity of XB3 cell death activity is further supported by the inability of a series of XB3 mutants to trigger cell death.

PAGE 50

50 HR like cell death in Nicotiana species is a hallmark for defense activation by various R proteins and their regulators. For example, coexp ression of the tomato Pto with its cognate Pseudomonas syringae AvrPto genes induces a leaf necrosis (Scofield et al., 1996; Tang et al., 1996) Transient coexpression of the bacterial protease AvrPphB with the Arab idipsis R protein RPS5 and its binding kinase PBS1 initiates cell death (Ade et al., 2007) In some scenarios, HR like responses can be activated by R proteins or their down stream signaling proteins in the absence of pathogen effectors. Well demonstrated examples include the Arabidopsis and ba rley R proteins RPS2, RPS4, and MLA10, and a number of mitogen activated kinase kinase kinases from tomato or N. benthamiana (Jin et al., 2002; del Pozo et al., 2004; Zhang et al., 2004; Melech Bonfil and Sessa, 2010 ; Bai et al., 2012; Hashimoto et al., 2012) ]. These phenomena are thought to be the result of constitutive activation of downstream defense responses due to a stochiometric overabundance of these proteins. Therefore, HR like cell death triggered by ov erexpression of XB3 might be indicative of an activation of defense mechanisms, which is consistent with the proposed function for XB3. We have previously shown that the N terminal ankyrin repeats of XB3 are sufficient for interacting with the XA21 kinase region (Wang et al., 2006) This study identifies the RF motif together with the XB3 C as the minimal region capable of triggering cell death. Therefore, the C terminal half of XB3 likely act s as the signaling domain of this protein. Moreover, a single residue mutation (Cys323 to Ala) in the RF motif abolishes both cell death and E3 ubiquitin ligase activities Relative to other regions, the RF motif shares the highest identity (82.0%) betwe en the rice XB3 and

PAGE 51

51 Arabidopsis XBAT31 (Fig. 2 7 ). These collectively point to an essential role for the RF motif in the conserved cell death activity. Although the RF motif of XB3 possesses E3 ubiquitin ligase activity (Wang et al., 2006) agroinfiltration of a construct containing this domain failed to induce cell death. As evidenced by protein blot analysis, no product with the expected size of the RF motif accumulates in the infiltrated le af discs. Instead, significant amounts of products with higher molecular weight were detected. In contrast, proteins with expected sizes were observed when expressing full length XB3 or other truncation variants, despite the presence of higher molecular weight products in the XB3RFC and XB3Ank expressing leaves. These higher molecular weight products might represent a post translational modification, such as ubiquitination, of the expressed truncation proteins by XB3 or other enzymes. Therefore, the fai lure of cell death activation by the RF construct could be attributed to the degradation of the RF protein. Myristoylation of a protein in many cases is associated with membrane anchoring (Resh, 1999) Interestingly, many R proteins contain N myristoylation sites and myristoylation of such R proteins were found to contribute to their function (Mucyn et al., 2006 ; Qi et al., 2012; Takemoto et al., 2012) The tomato Pto requires N myristoylation for recognition of AvrPto in N. benthamiana (de Vries et al., 2006; Mucyn et al., 2006) Another Pto family kinase Fen also requir es N myristoylation for constitutive signaling in N. benthamiana (Mucyn et al., 2009) The myristo ylation site (glycine 2) and a palmitoylation (cysteine 4) residues affected R protein RPS5 Plasma membrane localization, protein stability, and are required for RPS5 recognition of AvrPphB in the presence of PBS1 (Qi et al., 2012; Takemoto et al., 2012) Interestingly, m any pathogen

PAGE 52

52 effectors also have N myristoylation sites which contribute to their virulence and/or avirulence functions (Shan et al., 2000; Thieme et al., 2007; Wang et al., 2007; Wu et al., 2011) All these point t o a battlefield where host and pathogens battle: plasma membrane. XB3 mediated cell death may not only be a laboratory phenomenon, but could represent a conserved regulatory mechanism by which programmed cell death (PCD) is initiated An XB3 family membe r, MjXB3 from the Mirabilis jalapa ), is induced 40,000 fold, in RT PCR assays, during senescence of flower petals, a developmental process involving PCD (Xu et al., 2007) Silencing a homolo g of MjXB3 in Petunia extends flower life by 20%. It has been suggested that MjXB3 may be involved in regulating flower senescence a developmental process involving PCD (Rogers, 2006) In line with this, analysis of publicly available microarray datasets reveals predomin ant expression of the Arabidopsis member Xbat31 in senescing leaves, mature pollen and the second internode of stem (Zimmermann et al., 2004) Our data might therefore be interpreted as an assay that mimics leaf senescence. Because all five XB3 family members tested to date are capable of triggering cell death it is highly likely that members of the XB3 family function as evolutionarily conserved cell death activators in the plant kingdom The question of whether this cell death can lead to disease resistance remains to be addressed even though XB3 ph ysically associates with XA21. It has been shown that SENESCENCE ASSOCIATED GENE101 positively involved both i n plant senescence and immunity (Feys et al., 2005) This raises a possibility that members of the XB3 family might also be involved in modulating these two processes.

PAGE 53

53 Table 2 1 Primers used in Chapter 2 in this study Name Sequence ( 5' 3' ) Note Xb3nb 1 GGATCCACTAGTATGGGTCACGGTGTCAG For pC1300S XB3 and pC1300S XB3 C323A Xb3nb 2 GGATCCAGGATGATGCGGCGATTGTCCG For pC1300S XB3 andpC1300S XB3 C323A Xb3NEW 1 GTTCTAGAGGATCCATGGGTCACGGTGTCA GCTGCG For pCR8GW XB3 3xFLAG Xb3NEW 3 TTTCTAGAAATCAACTAGTTAGATCGTGCTCAGGCTTGTCCA For pCR8GW XB3 3xFLAG Xbos31nb 5 GTGTAGATCTAGAATGGGGCACGGCCTGAGCTGCA For pC1300S XBOS31 3xFLAG Xbos31nb 6 GTGTAGATCTTCAACTAGTTGTGTCACAAATAGCAGCAG For pC1300S XBOS31 3xFLAG Xbos31nb 7 GTGCTCCCGGGGAATCCGTAGA For pC1300S XBOS31 3xFLAG sequencing Xbat31nb 1 GTGTGGATCCCCTAGGATGGGGCAGAGTATGAGCTGTGGA For pC1300S XBAT31 3xFLAG Xbat31nb 2 GTGTGGATCCTCATCTAGACAATATTGGTTTGTCCATCAGCTCG For pC1300S XBAT31 3xFLAG Xbat31nb 3 CGATCAGCA CCCCAAGCAAGCA For pC1300S XBAT31 3xFLAG sequencing Xbat32nb 1 GTGTGGATCCTCTAGAATGAGGTTTCTAAGCCTCGTCGGA For pC1300S XBAT32 3xFLAG Xbat32nb 2 GTGTGGATCCTCAACTAGTGCAAGCACTTCCACCGGTTGTA For pC1300S XBAT32 3xFLAG Xbat 32 nb 3 TGCGTGTTTCCACCACATGAAGCA For pC130 0S XBAT32 3xFLAG sequencing Xbct31nb 1 GTGGATCCATGGGTCAGAGAATGAGTTGTAGGGA For pC1300S XBCT31 3xFLAG Xbct31nb 2 GTGGATCCTCAACTAACATGGCAAGAAGGAGAAT For pC1300S XBCT31 3xFLAG Xbct31nb 3 AGCAAGGCTGCACACGCTTGA For pC1300S XBCT31 3xFLAG sequencing 041054m 3 GGATCCATGGGTCAGGGACTGAGTTGTGGA For pC1300S XBCT32 3xFLAG 041054m 4 GGATCCTCAACTAGTACGCTTATCAATCCACTCATTTTCGG For pC1300S XBCT32 3xFLAG XB3New 1 GTTCTAGAGGATCCATGGGTCACGGTGTCAGCTGCG For pC1300S XB3Ank 3xFLAG XB3New 5 GTTCTAGATCAACTAGTTGAGCATGCATCGTCATCGG CA For pC1300S XB3Ank 3xFLAG XB3New 1 GTTCTAGAGGATCCATGGGTCACGGTGTCAGCTGCG For pC1300S 3xFLAG XB3New 7 GTTCTAGATCAACTAGTCGGCTTGTCAGGATCACAAGCAG For pC1300S 3xFLAG XB3New 6 GTTCTAGAGGATCCATGGCATGCTCAGAGGTGAGCGACA For pC1300S XB3RFC 3xFLAG XB3CT 3 TTTCTAGAAATCAACTAGTTAGATCGTGCTCAGGCTTGTCCA For pC1300S XB3RFC 3xFL AG XB3New 6 GTTCTAGAGGATCCATGGCATGCTCAGAGGTGAGCGACA For pC1300S XB3RF 3xFLAG XB3New 7 GTTCTAGATCAACTAGTCGGCTTGTCAGGATCACAAGCAG For pC1300S XB3RF 3xFLAG XB3New 13 GTTCTAGAGGATCCATGGGCAGCATCTCACGGCTGGTGG For pC1300S XB3C 3xFLAG XB3CT 3 TTTCTAGAAATCAA CTAGTTAGATCGTGCTCAGGCTTGTCCA For pC1300S XB3C 3xFLAG 1300SFLAG CCTGAGATCTCTAGAGTCGACCT For all FLAG tagged Constructs sequencing

PAGE 54

54 Figure 2 1. Phylogenetic analysis of the XB3 family. The phylogenetic tree was generated by the neighbor joining method Accession numbers for the sequences are indicated. The functionally characterized XB3 family members in this study are boxed.

PAGE 55

55 Figure 2 2 Cell death triggered by XB3 ( A) Indicated proteins were expressed in N. benthamiana leaves by infiltration of Agrobacterium (agroinfiltration) carrying the corresponding constructs. Infiltrated areas are circled. Photograph was taken 3 days post infiltration. EV: empty vector. (B) Quantification of XB3 triggered cell death. Electrolyte leakage was measured in the infiltrated leaves at the indicated time points after agroinfiltration ( hpi: hours post infiltration, dpi: days post infiltration). Each data point represents the mean + SD from 3 infiltrated leaves. Data sets with pound signs indicate statistically significant differences from the control (EV at 16 hpi) as calculated by Student's t test (##: P < 0.01). (C) Protein blot analysis showing the level of XB3 in the infiltrated leaves. Total protein extracts were prepared 40 hpi and immunoblotted with a nti XB3M antibodies (Top). The same blot stained with Ponceau S to show sample loading (Bottom).

PAGE 56

56 Figure 2 3 Cell death triggered by XB3 truncation mutants (A) Indicated proteins were expressed in N. benthamiana leaves The RING finger (RF) motif of XB3 is required for its cell death activity. (A) Schematic diagram showing structure of XB3 and its truncation mutants used for agroinfiltration. Domains were as described by [14]. Numbers on the left indicate amino acid positions of each product in th e full length XB3. A 3xFLAG epitope tag was individually fused to the C terminus of each protein. (B) Phenotypes induced by the expression of XB3 or its truncation mutants in N. benthamiana leaves. (C) Quantification of the cell death induced by the ind icated proteins. Data sets with pound signs indicate statistically significant differences from the control (EV) as calculated by Student's t test (#: P<0.05; ##: P < 0.01). (D, E) Protein blot analyses showing the levels of XB3 and its truncation mutants in the infiltrated leaves. Total protein extracts were prepared 40 hours after infiltration and immunoblotted with anti FLAG M2 antibody (Top). The same blot was stained with Ponceau S to show sample loading (Bottom). The theoretical molecular weights (kDa) of each protein are shown in parentheses. Percentages of the SDS PAGE gels used for resolving the proteins are indicated. Asterisks denote high molecular weight products derived from the indicated mutants.

PAGE 57

57 Figure 2 4 The E3 ubiquitin ligase def icient mutant XB3 C323A is unable to induce cell death. Phenotypes (A) and electrolyte leakage (B) induced by the expression of XB3 or XB3C323A in N. benthamiana leaves. Data sets with pound signs indicate statistically significant differences from the co ntrol (EV) as calculated by Student's t test (##: P< 0.01). (C) Accumulation of the XB3 or XB3C323A protein in the infiltrated leaf discs. All assays were performed as described in the Figure 2 legend.

PAGE 58

58 Figure 2 5. XB3 G2A mutation compromises Cell death induction (A) Indicated proteins were expressed in N. benthamiana leaves by infiltration of Agrobacterium (agroinfiltration) carrying the corresponding constructs. Infiltrated areas are circled. Photograph was taken 2 days post infiltration. EV: empty vector. (B) Quantification of cell death triggered by indicated constructs. Electrolyte leakage was measured in the infiltrated leaves at the indicated time points after agroinfiltratio n ( dpi: days post infi ltration). Each data point represents the mean + SD from 3 infiltrated leaves. Data sets with pound signs indicate statistically significant differen ces from the control (EV at 2 d pi) as calculated by Student's t test (# : P, 0.05; ##: P < 0.01). (C) Prote in blot an alysis showing the level of the indicated proteins in the infiltrated leaves. Total protein extracts were prepared 40 hpi and immunoblotted with anti XB3M antibodies (Top). The same blot stained with Ponceau S to show sample loading (Bottom) R bcL:RubisCo large subunit. (D ) Alignment of putative myristoylation site of selected XB 3 family members with consensus of myristoylation site. X: any amino acid; S/T: either serine or threonine.

PAGE 59

59 Figure 2 6 Cell death triggered by members of the XB3 fam ily. A 3xFLAG epitope tag was individually fused to the C terminus of the indicated protein family members from rice (XB3, XBOS31), Arabidopsis (XBAT31) and citrus (XBCT31 and XBCT32) and the fusion proteins were expressed in N. benthamiana leaves. The A rabidopsis protein XBAT32 with the same tag and the empty vector (EV) was used as negative controls. Leaf phenotypes (A), electrolyte leakage (B) and protein accumulation (C) were determined as described in the Figure 3 legend. Data sets with pound signs indicate statistically significant differences from the control (EV) as calculated by Student's t tes t (#, P < 0.05; ##, P< 0.01).

PAGE 60

60 Figure 2 7 Schematic diagram showing structure and comparisons of the characterized protein family members in this study. Domain identities between the rice XB3 and the Arabidopsis XBAT31 are shown. Sequence alignments of the RING finger (RF) motif and the C terminal tail (XB3 C) of the XB3 family members from rice (XB3 and XBOS31), Arabidopsi s (XBAT31), and citrus (XBCT31 and XBCT32), are demonstrated. Identical amino acid resi dues are highlighted in bold.

PAGE 61

61 CHAPTER 3 CHARACTERIZATION OF RERJ1, AN XB3 INTERACTING PROTEIN IN PLANT DEFENSE RESPONSE 3.1 Background Bacterial blight disease cause d by Xanthomona s oryzae pv. oryzae ( Xoo ), is one of the most devastating diseases affecting rice production To date, a few resistance genes (R genes) have been identified to confer resistance to Xoo One of the R genes Xa21 encoding a receptor kinase, con fer s broad spectrum resistance to many strains of Xoo (Song et al., 1995) By using yeast two hybrid screening, several XA21 interacting proteins have been identified, either playing positiv e roles, or negative roles in Xa 21 mediated resistance to Xoo (Park et al., 2010) Despite identification of these XA21 interacting proteins as components of the Xa 21 signaling pathway, the signaling pathway s downstream of these components remain largely unknown. Of the plethora of XA21 interacting proteins identified, XA21 binding pr otein 3 (XB3) is an E3 ubiquitin ligase. XB3 is required for full Xa21 mediated disease r esistance (Wang et al., 2006) Knock down of XB3 by RNAi compromised Xa21 mediated disease r esistance XB 3 is the substrate of kinase XA21, and can be phosphorylated by the XA21 kinase domain in vitro These findings suggest that XB3 plays a positive role in Xa 21 mediated resistance. I de ntify ing the substrates of XB3 will help elucidate the signaling pathway downstream of XB3. The substrat es of XB3 may play negative roles in Xa 21 mediated resi stance or in basal defense. U sing XB3 as bait, a yeast two hybrid screen of a rice cDNA library has been performed previously in Song lab. Dozens of XB 3 interacting prote ins were identified. One of these XB3 interacting pr oteins is a bZIP, Zinc finger and basic helix loop h elix (bHLH) transcription factor (Song, unpublished)

PAGE 62

62 RERJ1 is a bHLH type transcription factor identified as an interactor of X B3 in yeast two hybrid s creen ing It was previously determined that RERJ1 can be induced by wounding, drought and j asmonic acid ( JA ) treatment (Kiribuchi et al., 2004; Kiribuchi et al., 2005b; Kiribuchi et al., 2005a; Miyamoto et al., 2007) Notably, the induction of RERJ1 by wo unding is JA dependent, since wounding fails to induce RERJ1 expression in JA deficient mutant rice plants (Miyamoto et al., 2013) G eneral ly the s alicylic acid ( SA ) pathway mediates defense against biotroph s whereas the JA pathway against necrotroph s (Grant and Lamb, 2006) Several lines of study have indicated that the JA and SA pathway s antagonize each other (Spoel et al., 2003; DebRoy et al., 2004; Brooks et al., 2005; Glazebrook, 2005; Spoel et al., 2007; El Oirdi et al., 2011; Pieterse et al., 2012) Some biotrophic pathogens can promote JA signaling pathway s for virulence purpose s (Feys et al., 1994; Zheng et al., 2012) One study found that a JA insensitive mutant ( jai1 ) of tomato is highly resistant to the tomato speck disease pathogen Pst DC3000 (Zhao et al., 2003) Recent data has also shown tha t JA treatment can compromise Xa 21 mediated resistance to Xoo (Song, unpublished) Despite the implication of RERJ1 involved in the JA pathway, t he role of RERJ1 in Xoo rice interaction has not been investigated. In this study, I de monstrate that XB3 and RERJ1 interact both in vitro and in vivo The yeast two hybrid assay result s show that the A nkyrin domain and RING domain of XB3 can both interact with the C terminal region of RERJ1. The XB3 protein is located in both the plasma mem brane and nucleus, whereas RERJ1 is localized exclusively in the nucleus. The RERJ1 protein is degraded during Xoo host interaction. XB3, but not the E3 ubiquitin ligase activity deficient mutant XB3 C323A can degrade RERJ1 in

PAGE 63

63 Nicotiana benthamian RERJ1 e xpression is induced during the compatible interaction between Xoo and wild type rice plants Knockd own of RERJ1 by RNA interference confers partial resistance to Xoo This study shows that RERJ1 is a negative regulator of plant immunity against Xoo and it may be a substrate of XB3. 3.2 Materials and Methods 3.2.1 Yeast T wo H ybrid A ssay Yeast two hybrid was conducted as described (Wang et al., 2006) To make the BD XB3 construct for the yeast tw o hybrid assay, full length XB3 cDNA was PCR amplified and cloned into the two hybrid vector pDBLeu carrying the GAL4 DNA binding domain. To make AD RERJ1 construct full length RERJ1 cDNA was PCR amplified and cloned into the two hybrid vector pPC86 carry ing the GAL4 activation domain. All the PCR products in this study were c onfirmed by DNA sequencing. The yeast strain CG1945 (MAT a ura3 52, his3 200, ade2 101, lys2 801 trp1 901, leu2 3, 112, gal4 542, gal80 538, cyh r 2 LYS2 : : GAL1 UAS GAL1 TATA HIS3 URA3 : : GAL4 17 mers(x3) CYC1 TATA lacZ ) was used. Yeast cells were cultured in liquid yeast peptone dextrose (YPD) medium. For 1L YPD 10 g of bacto yeast extract, 20 g of bacto peptone, and 18 g of agar (for solid medium only) were added, and the pH adjusted to 5.8. The medium was autoclave d and cool ed to approximately 55 o C, and then 2% glucose was added (50 mL of a sterile 40% stock solution). Yeast cells were co transformed with plasmid pDBLeu XB3 and p PC86 RERJ1 by using Frozen EZ Yeast Transformation II Kit (ZYMO RESEARCH ) according Y east cells were grown on selective medium/ Leu/ Trp, To prepare 1L selective medium/ Leu/ Trp, 6.7 g of Difco yeast nitrogen base without amin o acids (Difco), 20 g of agar (for solid medium only) and one of the following amino

PAGE 64

64 acid supplements (SD/ Trp Leu: 0.64 g of Trp Leu D ropout supplement, SD/ Trp Le u His: 0.62 g of Trp Leu His Dropout supplements ) were added The pH was ajusted to 5.8, autoclave d and cool ed to approximately 55 o C, and then 2% glucose was added (50 mL of a sterile 40% stock solution). Transformed c olonies were plated onto the selective medium/ Leu/ Trp/ His supplemented with 10mM 3 AT unless indicated otherwise to test for possible interactions and allowed to grow for 2 4 days for observation and analysis 3.2.2 Expression and Purification of P roteins in E.coli To make the RERJ1 His fusion protein, RERJ1 full length cDNA was PCR amplified from pPC86 Os04g23550 with prime r Os04g23550 1: AGATCAATGGACGCCGAGATGGCCATGG/primer Os04g23550 2: AGATCAAGCTCATAACTAATAGCTCATGGAG with Bgl II site s at each 5' primer end and with a s top codon in the reverse primer. The PCR generated amplicon was cloned into vector pSC B amp/kan (Agilent) to m ake pSC RERJ1. RERJ1 was cut from pSC RERJ1 with Bgl II and subcloned into BamHI site of the pET 28a (Novagen) vector with a 6xHis tag to make pET RERJ1. The pET RERJ1 was transformed into E. coli BL21 strain for protein expression. To make the construc t for RERJ1 antibody production the N terminal 96 amino acid fragment upstream of the RERJ1 bHLH motif was PCR am plified using primer RERJ1N 1 and primer RERJ1N 2 with a stop codon in the reverse primer. The PCR product was cloned into vector pSC B amp/ka n (Agilent) to make pSC RERJ1N. RERJ1N was cut out from pSC RERJ1N with SalI and NotI and in frame subcloned into the Sal I/ Not I site of pMAL 86 carrying a Maltose Binding Protein (MBP) tag and GTK 86 vector carrying glutathione S transferase (GST) protein tag The pMAL RERJ1N and

PAGE 65

65 GTK RERJ1N construct was transformed into E. coli ER2566 and the BL21 strain respectively for protein expression. For protein expression and purification, a single bacteria l colony was inoculated on 3ml liquid LB medium with approp riate antibiotics and incubated with shaking (250 rpm) at 37C overnight. The overnight culture was then dilut ed 1:1000 in liquid LB appropriate antibiotics and grow n at 37C to an OD 600 of 0.3 to 0.5 and then induced using a final concentration of 0.5 mM Isopropyl beta thio galactopyranoside (IPTG) at 30C for 3h. The resulting bacteria l culture was collected by centrifugation at 4C, resuspended in lysis buffer (50 mM sodium phosphate, pH 7.5 150 mM NaCl, 10 % glycerol, 0.05% TritonX, 2mM EDTA, 1mM DTT, 1 mM PMSF, 1 tablet protease inhibitor ROCHE ) with 1mg/ml lysozyme and incubated on ice for 1h. For His tagge d protein purification, 50 mM sodium phosphate, pH 8.0; 300 mM NaCl; 20 mM imidazole, 1mM PMSF buffer was used. The bacteria l suspension was then s ubject to sonication at 5x for 10 second s each in an ice bath using a Microson Ultrasonic Cell Disruptor. After centrifugation at 14,000rpm at 4 C for 15 min, t he soluble fraction was bound with 50 l nickel nitrilotriacetic acid (Ni NTA Agarose, Qiagen) with gentle rock ing at 4C for 1h. Bound His tagged fusion protein was eluted with 50 100 l elution buffer (50 mM sodium phosphate, pH 8.0; 300 mM NaCl; 2 50 mM imidazole). For MBP tagged protein, G ST tagged protein and FLAG tagged protein purification, a simi lar procedure as above was used with the exception of a MBP fusion protein lysis and binding buffer ( 5 0 mM Tris HCl pH 7.5, 15 0 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 10% glycerol, protease i nhibitor). The cleared lysate was bound with amylose resin (New England Biolab ) to purify MBP fusion protein and eluted with 10 mM maltose in binding

PAGE 66

66 buffer. For GST fusion protein purification, a similar procedure as above w as used. Modifications were the GST fusion protein lysis and binding buffer ( 50 mM Tris HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 2 mM PMSF, 5% glycerol, 0.5% Triton X, protease inhibitor). The cleared lysate was bound with g lutathione resin (Sigma) to purify GST fusion protein and eluted with 10 mM reduced g lutathione in binding buffer. For FLAG tagged protein, Anti FLAG M2 affinity gel (Sigma) was used and 3x FLAG peptide ( 1u g/ul) was used for FLAG tagged protein elution. 3.2.3 In Vitro Pull Down Assay Two micrograms (2 ) of either purified FLAG XB3 or purified FLAG XBOS31 was incubated with 2 RERJ1 protein in binding buffer (50 mM Tris HCl, pH 7.5, 150 mM NaCl, 0.1% Triton X 100) in the presence of ANTI FLAG M2 Affinity Gel resin (Sigma) for 2 h at 4 C The samples were washed f our times with binding buffer and eluted using l binding buffer containing 1 g/ l 3XFLAG peptide. The eluents were mixed with SDS sample buffer and boiled for 5 min then subject ed to SDS PAGE and Western blot analysis The blot was probed with either anti FLAG (Sigma) or anti His antibody (Sigma ). 3 .2.4 Antibody Production and Purification One hundred micrograms of purified E.coli expressed MBP fu sion protein MBP RERJ1N was used to produce polyclonal antibody in rabbits (Co calico Biologicals Inc.). Antiserum received after a third booster injection was used to affinity purify anti RERJ1 antibody as described (Lin et al., 1996) A purified E.coli expressed GST fusion protein GST RERJ1N was subjected to SDS PAGE loaded in a single wide lane and the protein on the gel w as blotted onto a polyvinylidene fluoride ( PVDF ) membrane (Millipore) The protein band on the membrane was visualized by stained with Ponceau S (0.2%

PAGE 67

67 Ponceau S in 0.3% trichloroacetic acid) for appro ximately 10 min, then destained with several changes of distilled wate r. The protein band was cut from the membrane using a clean r azor blade and the remaining stain was removed by washing with several changes of phosphate buffered saline (PBS : pH 7.4, 13.7 mM NaCl, 0.27 mM KCl, 0.15 mM KH2PO4, 0.8 mM Na2HPO4 ) To minimize nonspecific binding of antibody, the strip was incubated in 10 ml blocking solution (5% nonfat dry milk in PBS) for 1h with gentle agitation. The strip was then was hed 3 times using 10ml PBS, with 5 min of gentle agitation per washing. After 3 washing s the strip was incubated with crude serum with gentle shaking for 2h. After 3 washes in PBS, the antibody was eluted with 300 l of low pH elution buffer (0.1 M glycine HCl pH2.5) and shake n gently for 1 min. The eluent was immediately neutralized with 100 l of 1 M Tris HCl, pH 8.0 and mixed with 300 l of glycerol. Th e strip was further washed with 100 l sterilized deionized water and combined with the previous eluent. The purity and specificity of purified antibody was tested using E.coli expressed proteins and rice plant total proteins. 3 .2.5 Plant Total Protein Ex traction Rice leaves were fast frozen in liquid nitrogen and were ground using a mortar and pestle in liquid nitrogen to a fine powder. The homogenized pow d er was then resuspended in an equal volume of pre chilled protein extraction buffer ( 50 mM Tris HCl, pH7. 4; 150 mM NaCl; 1 mM EDTA; 0.1% Triton X 100; 0.2% proteinase inhibitor (Sigma ME), 1 mM PMSF) and rocked at 4C for 1 h. Cell debris was removed by centrifugation at 12, 000 rpm at 4 C for 2 0 min. The p rotein supernat ant was transferred to a new tube and quant ified by Bradford assay. The p rotein sample then was boiled in sample buffer (31.25 mM Tris HCl, pH 6.8 5%

PAGE 68

68 ME, 0.05% bromophenol blue) for 5 minutes for SDS PAGE or stored at 20C for fu ture use 3.2.6 In Vivo Co I mmunoprecipitation For in vivo co immunoprecipitation, 2 week old rice seedlings of cultivar TP309 were and ground in liquid N2 with a mortar and pestle The powder was extracted in extraction buffer (50 mM Tris HC l at pH 7.5; 150 mM NaCl; 0.1% Triton X 100; 1 mM EDTA; 1 mM DTT, 1 mM PMSF) containing proteinase inhibitor cocktail (Roche). After centrifugation, the supernatants were used for immunoprecipitation reactions. Approximately 1 mg of t otal protein was precleared by the addition of 25 /G agarose beads (Santa Cruz Biotechnology), incubated fo r 1 h at 4C, and centrifugatd at 12 ,000 g for 1 min. Five m icrograms of anti Myc antibody or anti RERJ1 monoclonal or preimmune antiserum were added to the precleared extract, and incubated for 1 h at 4C. Twenty five microliters of protein A /G agarose beads were added to the mixture, and further incubated for 1 h at 4C. After centrifugation, the beads were washed five times with extraction buffer and proteins were eluted by heati n g at 95C for 5 min in SDS sample buffer. Eluted proteins were analyzed by Western blotting using anti RERJ1 and ant i XB3 antibodies. 3 .2.7 SDS PAGE and Protein Gel Blot Analysis Proteins were resolved on 8% SDS polyacrylamide gels and blotted on to PVDF membranes (I mmobilon P; Millipore) The membrane was blocked with 5% non fat dry milk in TBST (20mM Tris HCl pH 7.5, 150mM NaCl, 0.1% Tween 20) for 1h at room temperature and incubated with affinity purified anti RERJ1 (1: 3000 dilution in TBST with 5% nonfat dry mil k ) at 4 o C overnight. After washing 3 times with TBST for 15 min,

PAGE 69

69 t he membrane was then incubated with the secondary antibody (goat anti rabbit IgG HRP; Santa C ruz) (1: 10, 000 dilution in TBST with 5% nonfat dry milk ) at room temperature for 1h After washi ng with TBST, immunodetection was conducted using the ECL plus system ( previously Amersham now GE ) according to the manufacturer's instructions. X antibody complex within linear range in film developing solution and then fixed in film fixing solution. The same procedure was used for antibody against actin The anti actin was diluted 1: 3 00 0. The secondary antibody used wa s goat anti mouse IgG HRP (Santa cruz) (1: 10 000 dilution). The mo lecular weight marker was Magic Mark X P (Invitrogen ). 3.2.8 Subcellular Localization of RERJ1 and XB3 Transgenic rice p lants carrying 35S RERJ1 GFP were g rown on Murashige and Skoog ( MS ) medium for 1 week and analyzed by confocal microscopy (Zeiss Pascal LSM5 Confocal Laser Scanning Microsc ope). Root tips of transgenic rice seedlings were mounted on slides and observed by confocal imaging using a GFP filter setting (excitation 488nm, emission 510 560nm) Prop i dium iodine was used to stain nuclei acids to mark nuclei Transient transfections of rice protoplasts were performed according to the described method (Yoo et al., 2007) Transfected protoplasts were mounted on slides and observe d as described above. 3.2.9 Nuclear Fractionation of Rice Plant C ells Nuclear fract ionation of rice plant cells were performed as described (Kinkema et al., 2000; Shen et al., 2007) wi th slig ht modifications. Leaf t issues (15 g) from 6 week old rice plants were homogenized in 30ml nuclei isolation buffer ( 2.5% Ficoll 400 0.4 M sucrose, 25% glycerol 25 mM Tris HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, 1 mM PMSF, and 1x complete protease inhibitor cocktail) using a mortar and pestle, and then

PAGE 70

70 filtered through a one layer of 75 nylon mesh ( Carolina Biological Supplies ). The filtered supernatan t was further filtered through two layer s of miracloth f ollowed by filtering t hrough another four layers of miracloth After Triton X 100 was added to obtain a final concentration of 0.5%, the homogenate was incubated on ice for 15 min and centrifuged at 1,500 x g for 5 min. The supernatant frac tion was saved (nuclei depleted fraction ) and the pellet fraction was further purified by washing with 1ml nuclei isolation buffer containing 0.1% Triton X 100 and spinning down at 100g for 1 min to remove starch and cell debris T he pellet was further washed 6 times and centrifuged at 1 500 x g for 1 min, then suspended in 1 ml of washing buff er. The supernatant was centrifuged subsequently at 1 800 x g for 5 min to pellet the nuclei. A 10 fold volume of the nuclei enriched f raction compared to the nuclei depleted frac tion was subjected to Western blot anal ysis. Anti h istone H3 (Abcam) and anti PEPC (Rockland) antibodie s we re used as nuclear and cytoplasmic protein markers, respectively. 3.2.10 Xoo Inoculation Five to six week old r ice plants were inoculated with Xoo strain PX O99A by the scissor dip method as described (Song et al., 1995) Xoo was streaked on PSA media (10 g/L peptone, 10 g/L sucrose, 1 g/L glutamic acid monosodium salt, 16 g/L bacto agar, 15 mg/L cycloheximide), and incubated at 28C for three days. The inoculum was suspended in sterilized H 2 O to an optical density of A 600 =0.5. 3.2.11 Agrobacterium M ediated T ransient G ene E xpression i n Nicotiana B enthamiana Each A grobacterium strain carrying a construct was streaked on Luria Bertani (LB) and grown at 28C for 2 d. A single colony was inoculated in 3 mL li quid LB media

PAGE 71

71 1 mL of the overnight culture was then subcultured in to 50 mL liquid LB supplemented with 600 of 0.6. The bacterial cells were then collected by ce ntrifugation at room temperature for 10 min at 3000 rpm. The cells from each centrifugation were resuspended in Agrobacterium inoculation buffer (4.8 gm MES, 5 mL 1 M MgCl2, and 0.147 g acetosyringone in 500 mL water, pH 5.6) and incubated at 28C for 3 h. Infiltration of the abaxial surface of tobacco leaves was performed with needleless syringes. 3.2.12 Phylogenetic Analysis Protein sequences were retr ieved from NCBI using the RERJ1 sequence as a query and aligned using CLUSTAL W (Thompson et al., 1994) The neighbor joining phylogenetic tree was constructed using the MEGA4 program (Saitou and Nei, 1987; Tamura et al., 2007) Bootstrap values were obtained by 1000 bootstrap replicates. Homologs from mo nocot species were : rice ( Oryza sativa ) Os04g23550 (RERJ1); maize1 ( Zea mays ) NP_001147498.1; maize2 ( Zea mays ) ACN33600.1; maize3 ( Zea mays ) NP_001151185.1; sorghum ( Sorghum bicolor ) XP_002445107.1; Brachypodium distachyon XP_003579501.1 ; and b arley ( Hor deum vulgare ) BAJ91059.1. Homologs from dicot species included : poplar ( Populus trichocarpa ) XP_002308110.1; castorbean ( Ricinus communis ) XP_002518255.1; grape ( Vitis vinifera ) XP_002263999.1; medicago ( Medicago truncatula ) XP_003595077.1; soybean1 ( Glyci ne max ) NP_001239951.1; soybean2 ( Glycine max ) XP_003546437.1; Arabidopsis thaliana NP_568850.1 and Arabidopsi lyrata XP_002864502.

PAGE 72

72 3.3 Results 3.3.1 Specificity of the RERJ1 A ntibody To develop a tool for RERJ1 protein characterization RERJ1 antibody wa s raised against rabbit with E.coli exp ressed N terminal 96 amino acid residues upstream of basic helix loop helix domain ( bHLH ) domain of RERJ1 (MBP RERJ1N) The antiserum was affinity purified as described (Lin et al., 1996) A nother E.coli expressed fusion protein GST RERJ1N carrying the antigen fragment was used for affinity purifica tion of antiserum to remove nonspec ifi c IgGs and antibodies produced against MBP. The purified E.coli expressed fusion protein RERJ1 His can be detected specifically with both anti His antibody and affinity purified anti RERJI antibody, producing a n approximate 42KD single band (expected si ze for RERJ1 and fused 6xHis residues) As a control, another His tagged protein OsMPK3C (C terminal of OsM PK3) could only be detected by a nti His antibody but not by anti RERJ1 antibody (Fig. 3 1A, 3 1B) To further test if a nti RERJ1 can specifically de tect RERJ1 protein in rice plants transgenic rice plants carrying a glucocorticoid inducible construct pINDEX RERJ1 (Ouwerkerk et al., 2001) were made. When induced by glucocorticoid such as dexamethasone (DEX), the constitutively expressed GVG chimeras consisting of glucocorticoid receptor domain Gal4 DNA binding domain and VP16 activation domain translocates from the cytoplasm to the nucleus to bi nd GVG recognition sites upstream of the gene of interes t for trans cription. W ith an increased concentration of DEX applied for 2 days, the intensity of an approximate 39 KD protein band in the protein gel blot increased correspondingly in pINDEX RERJ1 transgenic plants, but not in pINDEX vector control plants even when treated with higher concentration s of DEX (10 uM) (Fig. 3 1C) With a lower concentration of DEX (2.5 uM), the protein band intensity increases

PAGE 73

73 with longer DEX treatment (Fig. 3 1D) These in duction experiments demonstrate that the anti RERJ1 ant ibody can specifically recognize RERJ1 protein in rice plants. 3.3.2 Interaction between XB3 and RERJ1 A previou s yeast two hybrid (Y2H) screen of a rice c DNA library using XB3 as bait has identified several XB3 interacting proteins, one of which is RERJ1. RERJ1 contain s a basic helix loop helix (bHLH) struct ure characteristic of this class of transcription factors. To confirm the interaction in yeast, an XB3 cDNA fragment and RERJ1 cDNA fragment were fused to sequences encoding Gal4 DNA binding domain (BD) and the Gal4 activation domain (A D) in pDBLeu and pPC86 respectively to test their interaction Successful transformations were achieved as indicated by the growth of trans f ormants on selective medium/ Leu/ Trp Transformants can only grow on selective me dium/ Leu/ Trp His when the two proteins interact. An interaction between XB3 and RERJ1 was observed as indicated b y growth of transformants on selective medium/ Leu/ Trp His (Fig. 3 2A ) even in high ly stringent condition (with 3 AT) Interestingly the i ntera ction between XB3 and RERJ1 appear s stronger than that between XA21 and XB3 (Fig. 3 2A ) An i n vitro pull down as say was conducted as another method to test the physical interaction between XB3 and RERJ1. Purified His tagged RERJ1 protein from E. coli was incubated either with Anti FLAG Affinity resin bound FLAG tagged XB3 or FLAG tagge d XBOS31 (an XB3 paralog) for two hours Afte r extensive washing, RERJ1 His fusion protein was co precipitated with FLAG XB3 b ut not FLAG XBOS31 as shown in Western blot (Fig. 3 2B ) This shows that the interaction between XB3 and RERJ1 is specific, because only XB3, but not XBOS31 (the closest related paralog of XB3), can interact with RERJ1.

PAGE 74

74 To validate XB3 and RERJ1 interact ion in vivo A grobacterium mediated transient protein expression in Nicotiana benthamiana wa s performed. RERJ1 expression driven by a 35S promoter (construct 35S RERJ1) was coexpressed with FLAG epitope tagged XB3 also driven by the 35S promoter (construct 35S XB3 FLAG) A s a control, RERJ1 driven by a 35S promoter was also coexpressed with FLAG epitope tagged XBOS31 driven by the 35S promoter (construct 35S XBOS31 FLAG) Total protein was subjected to immunoprecipitation (IP) using anti RERJ1 antibody conjugated to Protein A/G beads As shown in F ig. 3 2C, XB3 FLAG, but not XBOS31 FLAG is co immunoprecipitated with RERJ1 Another co immunoprecipitation (C o IP ) between RERJ1 and XB3 C 323A was performed based on two considerations. First, the experiment can determine if the conserved amino acid residu e cysteine at position 323 of XB3 is required for the interaction between XB3 and RERJ1. Second, RERJ1 may be degraded by XB3 In this scenario, the interaction between XB3 an d RERJ1 is difficult to detect as indi cated by the relatively weak band in the p revious Co IP (Fig. 3 2C). The XB3C 323A contains a single amino acid substitution (C323A) in the con served RING domain of XB3, leading to abolishment of XB3 E3 ubiquitin li gase activity as demonstrated previously (Wang et al., 2006) The Co IP result shows a clear, strong interaction between XB3 C 323A and RERJ1, but not betwee n the control XBAT32 and RERJ1 (Fig. 3 2D). The interaction between XB3 C 323A and RERJ1 is easier to detect than that betwe en XB3 and RERJ1. This suggests that XB3 may interact with RERJ1 and degrade it. Finally, to determine if the interaction reflects native protein interaction C o IP was perfor med with wild type rice plants. Since the RERJ1 protein level is relatively low,

PAGE 75

75 t o enrich the RERJ1 protein, plants were treated with the proteasome inhibitor MG132 for three hours before tissu e harvest. As shown in Fig. 3 4E XB3 can be co immunoprecipitat ed with RERJ1 by anti RERJ1 antibody but not by the preimmune antiserum or an u nrelated antibody Anti Myc. This clearly dem onstrates that XB3 and RERJ1 interact in native rice plants. 3.3.3 Mapping Interaction D omains of XB3 and RERJ1 To determine which regions of XB3 and RERJ1 are responsible for their interaction, yeast two hybrid assays were pe rformed. The full length XB3 and its truncation derivatives were fused downstream of the DNA binding domain (BD) o f yeast bait vector pLexA while the full length RERJ1 ant its truncation derivatives were fused downstream of activation domain (AD) of yeast prey vector pB42AD An interaction between full length of XB3 and RERJ1 C terminal domain downstream of bHLH region was observed, while the bHLH domain and upstream region do not show interaction (Fig. 3 3A, 3 3 B left ) This defines the RERJ 1 interaction domain in the C terminal region downstream of bHLH. To define regions in XB3 responsible for interaction, full length and truncation derivatives were used. It was found that both the Ankyrin domain and the RING finger domain can interact with full length RERJ1, but the C terminal region downstream of the RING finger domain did not show an interaction. 3.3. 4 Structural and Phylogenetic Analysis of RERJ1 P rotein To analyze the RERJ1 protein, the RERJ1 protein sequence was queried against public ly availably protein database s It was found that RERJ1 carries a basic helix loop helix (bHLH) domain between amino acid residue 95 and 144 and a nuclear localization signal (DRRRKL) between amino acid residue 100 and 105 (Fig. 3 4A ) Considering that RER J1 interacts with E3 ubiquitin ligase XB3, a search for the existence of any

PAGE 76

76 degradation ( degron ) signal s in the RERJ1 protein was performed. The peptide stretch consisting of about 28 amino acid residues close to the N terminus is a putative PEST domain r ich in proline (P) glutamic a cid (E), serine (S ) and threonine (T) ( http://emboss.bioinformatics.nl/cgi bin/emboss/epestfind ) The PES T domain is implicated in protein degradation (Rechsteiner and Rogers, 1996; Tan g et al., 2011) Alignment of RERJ1 and its orthologs identified a re gion close to the C terminus conserved in monocot plants. This region is known as a conserved C terminal domain (CCD) in monocots (Fig. 3 4B ) The RERJ1 and its homologous proteins were aligned and a phylogenetic tree was constructed. It was found that RERJ1 clustered with orthologs from monocots, while orthologs from dicots form another distinct cluster. This shows the conservation of RERJ1 and RERJ1 like proteins in monocots. 3.3. 5 Subc ell ular Localization of RERJ1 and XB3 P roteins To determine the subcellular localization of RERJ1 transgenic rice plants carrying RERJ1 fused with GFP were obtained The root tips of the transgenic seedlings were subjected to confo cal microscope observati on As shown in Fig. 3 5A, green fl orescence was observed in the nucleus o f the cells, which indicates nucleus localization of RERJ1. P rop idium iodide staining ofcellular DNA further confirms the nuclea localization of RERJ1 (Fig. 3 5A). Rice protoplasts w ere also prepared for transient transfection of the RERJ1 GFP tagged construct an d the control construct GFP It was found that RERJ1 GFP localizes in the nucleus of transfected cell s, while GFP itself localizes through the whole cells ( Fig. 3 5B ) Conside ring that XB3 is an interactor of the plasma membrane localized XA21, it seems paradoxical that XB3 can also interact with the nucleus localized RER J1. The 35S XB3 GFP construct was

PAGE 77

77 transfected into rice protoplast s and the transfected protoplast s were obs erved with confocal microscopy for XB3 GFP localization. XB3 GFP was observed to localize both on the plasma membrane and in the nucleus. This dual localization of XB3 is consistent with the existence of a myristoylation site and a nuclear localization sig nal in XB3 To further determine if XB3 localizes in the nucleus as well as the plasma membrane subcellular fractionation was performed to investigate the subcellular distribution of XB3 in rice plants N uclei were isolated from wild type rice plants TP30 9, as well as Xa21 carry ing plants 4021. I solated nuclei depleted and nuclei enriched fractions were indicated by cytoplasmic protein marker phosphoenolpyruvate carboxylase ( PEPC) and nucleus protein marker histone H3 respectively (Fig. 3 5C) XB3 protein can be detected by affinity purified anti XB3 antibody (Wang et al., 2006) in both nuclei depleted and nuclei enriched fractions (Fig. 3 5C) This result is consistent with the confocal microsc opy result, which shows dual localizations of XB3 in the plasma membrane and the nucleus. Notably, in the nuclei depleted fraction a single XB3 band can be detected by Anti XB3 antibody, while in the nuclei enriched fraction bands with molecular weight hig her than XB3 can also be detected by the Anti XB3 antibody. This could be due to the modification of XB3, presumably by ubiquitination of XB3 in nucleus 3.3. 6 XB3 Protein I s Stabilized in the P resence of Xa 21 Xb3 was previously shown to be required for st abilization of the XA21 protein (Wang et al., 2006) To test if Xa21 contribute s to stabilization of the XB3 protein Agrobacterium mediated transient assay s in N. benthamiana were performed. T he protein blot result shows that XB3 protein accumulates to a much higher level when Xa21 is co expressed with XB3 than when XB3 is expressed alone (Fig. 3 6A).

PAGE 78

78 To test if the XB3 protein is stabilized in the presence of Xa21 in native rice plants, both wild type and Xa21 carrying 4021 were inoculated with Xoo and then subject ed to protein blot assays Western blot result shows that t he XB3 protein level in Xa21 carrying 4021 is higher than that of wild type TP309 More importantly, during Xoo infection XB3 protein abundance in 4021 is much highe r than that in wild type TP309. Interestingly, the XB3 protein level seems decreased during compatible interaction s between Xoo and wild type rice plants TP309, whereas the XB3 protein level is increased during in compatible interaction s between Xoo and Xa21 carrying plants 4021. 3.3. 7 XB3 D egrades RERJ1 in N. B enthamiana RERJ1 protein level was detected by Wes tern blot analysis using Anti RERJ1 antibod y after Xoo inoculation of Xa21 carrying rice plants The result s show that RERJ1 protein accumulat ion is dramatically reduced soon after Xoo inocula tion (Fig. 3 7 A). At 1 d pi RERJ1 protein was reduced by more than half. At 3 dpi the RERJ1 protein was nealy undetectable The 4021 line carrying the Xa21 gene is r esista nt to Xoo At 3 dpi there were no symptom s, so t he degradation of RERJ1 could not be due to general degradation caused by necrotic lesions. In addition, another non related protein, ADP glucose pyrophosphorylase (AGPase) an enzyme involved in starch synth esis, was not affected by Xoo inoculation. This indicates that the disappearance of RERJ1 is specific. Because of the lack of an Xb3 knockout line, the Nicotiana benthamiana transient assay was chosen to test if XB3 can degrade RERJ1. The Agrobacterium st rains carrying construct RERJ1 and XB3 FLAG were co infiltrated into leaves of N benthamian a In addition to the combination of the RERJ1 construc t and empty vector construct, other combinations included a RERJ1 construct and an XB3 C323A FLAG construct. T he GUS GFP His construct was used as an internal con trol for each

PAGE 79

79 combination. I nfiltrated leaf discs were sampled at 30 hpi whe n cell death is not yet evident The Western blot result s show that RERJ1 is degraded in the presence of XB3 FLAG but not XB3 C32 3A FLAG (Fig. 3 7 B). This result indicates that XB3 can degrade RERJ1 in vivo and the degradation requires active E3 ubiquitin ligase activity. The XB3 G2A mutant was defective in cell death induction in N. benthamiana To test if XB3 G2A can degrade RERJ1, an Agrobacterium strain carrying the RERJ1 construct was co infiltrated with either em pty vector carrying Agrobacterium or XB3 G2A construct carrying Agrobacterium Western blot result s show that RERJ1 is degraded when XB3 G2A is present. This indicates tha t XB3 G2A can also degrade RERJ1 despite its defect in cell death induction. 3.3. 8 Knockdown of Rerj 1 Confers P artial R esistance to Xoo The involvement of RERJ1 in the jasmonc acid ( JA ) signaling pathway prompts in vestigation of whether RERJ1 plays a role in the Xoo rice interaction. Inoculation of wild type plants with Xoo induce s RERJ1 expression as early as six hours post inoculation (hpi), as shown by semi quantitative RT PCR (Fig. 3 7A). The RERJ1 induction during Xoo infection peaked at 24 hpi and 48 hpi This indicates RERJ1 may play a role during Xoo infection. Overexpression of RERJ1 was conducted and more than ten overexpression lines were obtained. However, the seedlings of T1 overexpression lines showed dwarfism and finally died. This indicates t hat overexpression of RERJ1 has a lethal effect. Knoc kdown of RERJ1 was conducted using RNA interference (RNAi) A 312 bp fragment in the third exon of RERJ1 which is specific only for RERJ1 was chosen to generate a RNAi construct. The sense RNA arm and an tisense RNA arm are separated by a GUS loop to form a stem loop structure for siRNA generation (Fig. 3 8 A). More than 40 RERJ1 RNAi lines wer e generated.

PAGE 80

80 Northern blot analysis was pe rformed on three randomly chosen RNAi lines by using the GUS loop sequenc e as probe (Fig. 3 8 B) The result s show that all three lines express the RERJ1 RNAi construct. Western blot analysis using Anti RERJ1 antibody confirmed the knockdown of RERJ1 in these th ree lines (Fig. 3 8 C) Although the RERJ1 protein was not completely knock ed down by RNAi, we spec ulate that RNAi may still be able to impede the induction of RERJ1 during RERJ1 infection. Three RERJ1 RNAi line plants at the 6 week stage were inoculated with Xoo D isease development was monitored by measuring lesion length s. As shown in Fig. 3 9 B, 3 9 C the lesion lengths of wild type plants and empty vector transg enic plants are about twice those of RERJ1 RNAi transgenic lines at nine days post inoculation (dpi). T he lesion lengths of wild type plants and empty vector tran sgenic plants are about 18 cm at 12 dpi while those of RERJ1 RNAi transgenic lines are about 10 12cm at 12dpi, which are significant ly shorter This shows that knockdown of RERJ1 conferred partial resistance or tolerance to Xoo infection. This result was f urther confirmed by bacterial po pulation enumerations (Fig. 3 9 D). The bacterial population in wild type plants at 12 dpi is about 3.7 times that of the RERJ1 RNAi transgenic line. Different background s of RERJ1 transgenic lines (cultivar DJ and cultivar T P309) showed the same result s 3 .4 Discussion The initial identification of XB3 as an interactor of XA21 prompted investigation of whether XA21 is targeted for degradation by the E3 ubiquitin lligase XB3.Unexpectedly, the investigation result s show that XB3 does not ubiquitinate and degr ade XA21, but, does stabilizes XA21 (Wang et al., 2006) Genetica lly, XB3 is required for full Xa 21 mediated resistance. HR is usually, although not always, a ha llmar k of R gene mediated

PAGE 81

81 resistance. The fact that transient overexpression of XB3 in N. benthamiana induces HR like cell death is reminiscent of the posi tive role XB3 plays in Xa21 mediated resistance Since XA21, an interactor of XB3 is not a substrat e of the E 3 ubiquitin ligase XB3, XB3 may target other proteins for degradation. It was previously proposed that XB3 may target other protein(s) for degradation (Wang et al., 2006) In this cas e, the XB3 targeted protein(s) may act as a negative regulator of plant immunity. The data from transient overexpression of XB3 in N. benthamiana provides some clues. XB3 is capable of inducing cell death in N. benthamiana whereas a single amino acid muta tion that disrupts the E3 ubiquitin ligase activity of XB3 abolishes the HR inducing ability. This shows that E3 ubiquitin ligase activity is essential for XB3 to induce HR. XB3 may ubiquitinate and degrade negative regulators of cell death which in norma l conditions, wo uld keep cell death in check. By using yeast two hybrid screen ing a number of XB3 interacting proteins were identified (Song lab, unpublished). Interestingly among them, many of the XB3 interacting proteins are transcription factors. One of the candidate interacting proteins RERJ1 is a transcription factor involved in wounding and JA response s (Kiribuchi et al., 2004; Kiribuchi et al., 2005a) However this gene has not been implicated in any Xoo ri ce interaction. In yeast, the interaction between XB3 and RERJ1 is much stronger than that between XB3 and XA21 even under very stringent condition (5mM 3 AT). This observation may be consistent with the role of XA21 as a signal receptor. The interaction b etween XA21 and its signaling partners are dynamic, especially upon ligand binding. Upon ligand binding XA21 may need to recruit new binding partners and

PAGE 82

82 dissociate signaling repression partners (Park et al., 2010 ) The interaction of XB3 and RERJ1 were confirmed by both in vitro pull down and in vivo co IPs. A yeast two hybrid assay to map the interacting domain s of XB3 show s that both Ankyrin repeat and RING domain s can interact with the C terminal part of RERJ1 In terestingly, the XB3 Ankyrin repeat domain can also interact with the XA21 kinase domain in Xa21 carrying plants (Wang et al., 2006) In unchallenged Xa21 carrying plants, the interaction b etween XA21 and XB3 occurs at the plasma membrane associated cytoplasm based on the fact that the ProA tagged XA21 ( ProA at the extracellular LRR domain) can be co immunoprecipitate d with XB3 (W ang et al., 2006) Both transient transfection of rice protoplast s with RERJ1 GFP and stable transgenic rice plants with RERJ1 GFP show that RERJ1 is exclusively localized in the nucleus, which is consistent with its role as a transcription factor. In un challenged wild type plants and Xa21 carrying plants, the interaction between XB3 and RERJ1 is in the nucleus. There are two pools of XB3: a pl asma membrane pool and a nuclear pool. Interestingly, XB3 protein accumulation is higher in 4021 than in TP309 pl ants when inoculated with Xoo Activation of Xa21 mediated resistance leads to more XB3 protein accumulation. Allocation of more XB3 protein to the nuclear pool may occur during activation of Xa21 mediated resistance. Activation of defense may require XB3 translocation to the nucleus to degrade negative regulators such as RERJ1 (Fig. 3 8A) A recent finding show s that the XA21 kinase domain is cleaved and translocated to the nucleus when the XA21 signaling is activated by avirulent Xoo (Park and Ronald, 20 12) When XA21 was fused wit h a nuclear export signal the Xa 21 mediated resistance is dramatically compromised. This shows that the nuclear localization of XA21 is required for Xa 21 mediated resistance It is reasonable

PAGE 83

83 to speculate that XB3 may co trans locate with XA21 kinase to the nucleus when resistance is activated Mobilization of XB3 by XA21 kinase may lead to degradation of negative factors of plant immunity. Another possibility is that activation of Xa21 mediated resistance releases XB3, which ma y otherwise be bound by other repressors, from the plasma membrane. The released XB3 translocates to the nucleus to degrade nucleu s localized negative factors of immunity O ne unexplained observation is that the existence of XB3 in wild type plants does no t confer obvious resistance to Xoo One hypothesis is that XB3 may play a positive role in innate immunity as well as in Xa21 mediated immunity Knockout of XB3 may render th e plants more susceptible to Xoo It was recently found that a rice receptor like cytoplasmic k inase OsRLCK185 is required for innate immunity (Yamaguchi et al., 2013) Knockdown of OsRLCK185 by RNAi renders the plants susceptible to Xoo the type III secretion system (T3SS) deficient hrpX mutant of Xoo In contrast, wild t ype plants are resistant to the Xoo hrpX mutant B ecause effectors can not be injected into the plant cells due to a defective T3SS Xoo hrpX mutants cannot overcome the innate immunity in wild type plants. In addition, XB3 function may be suppressed by ef fectors from Xoo in wild type plants, whereas in Xa21 XA21 directly or indirectly In accordance with this, XB3 protein abundance is decreased during Xoo infection of wild type plant s whereas XB3 protein abundance i s increased or at least stabilized during Xoo infection of Xa21 carrying plants (Fig. 3 6B). An example of pathogen suppression of a host E3 ubiquitin ligase contributing to p athogenicity has been reported in the interaction between a virus pathogen and hu man cells. Latent membrane protein 1 (LMP1), an oncoprotein in a human tumor virus Epstein Barr virus

PAGE 84

84 (EBV) can activate the catenin signaling for transformation of normal B lymphoma cells into lymphomas (cancer cells) (Jang et al. 2005b) Siah 1 a RING domain E3 ubiquitin ligase implicated in apoptosis and tumor suppression (Rope rch et al., 1999) targets catenin for degradation in normal B cells E xpression of LMP1 in B lymphoma cells has been reported to cause a reduction of Siah 1 resulting in increase d catenin protein level associated with oncogenesis Because XB3 degrade s negative regulators in the nucleus, mobilization and translocation of XB3 to the nucleus may contribute to the establishment of resistance. Binding of XB3 by some Xoo effectors may sequester XB3 outside of the nucleus. An effector from Xoo has been ident ified that interact s with XB3 (Bing Yang, unpublished). It will be interesting to see if the binding of this Xoo effector to XB3 can suppress XB3 function. Xoo T3SS effector protein Xoo1488 has also been reported to target a rice receptor like cytoplasmic k inase OsRLCK185 to inhibit plant innate immunity (Yamaguchi et al., 2013) Retention of XB3 in the cytoplasm or plasma membrane by Xoo effector(s) appears to prevent XB3 from degrading negative regulators of immu nity, such as RERJ1 in the nuc leus. Retention of immunity associated proteins in the cytoplasm by T3SS effect ors to prevent them from nuclear translocation for immunity activation is a strategy exploited by some pathogenic bacteria to dampen host immunity (Gao et al., 2009; Newton et al., 2010; Yen et al., 2010) The RERJ1 protein could be one of the substrate proteins targeted by XB3 for degradation. The observation that RERJ1 is degraded upon Xoo inoculation during incompatible interaction s pro vides a clue that RERJ1 may be degraded by XB3. T his is further supported not only by the data showing that XB3 and RERJ1 physically interact

PAGE 85

85 both in vitro and in vivo but also by the observation that XB3 degrade s RERJ1 in N. benthamiana One proposed rol e of XB3 is that it can degrade negative regulators of plant immunity. In line with this proposed function of XB3, when Rerj1 are knock ed down by RNAi, t he Rerj1 RNAi plants show partial resistance to Xoo This genetic evidence supports the hypothesis that RERJ1 is a negative regulato r of immunity. Interestingly, treatment of Xa21 carrying plants with JA compromises Xa21 me di ated resistance to Xoo (Song lab, unpublished) This indicates that JA may play a negative role in immunity against Xoo Identificatio n of XB3 interacting proteins by a yeast two hybrid screen of a rice cDN A library shows that many interactors are transcription factors. This is consistent with the observation that the nucleus is the subcellular localization where XB3 and RERJ1 interactio n and degradation of RERJ1 take place Full a ctivation of resistance may require degradation of a number of negative regulators of immunity. Although partial resistance is observed in Rerj 1 RNAi lines, the single knock down of Rerj1 a negative regulator of immunity, may not be enough to confer full resistance. Additional negative regulators targeted by XB3 for degradation during immunity activation are yet to be investigated.

PAGE 86

86 Table 3 1 Primers used in C hapter 3 in this study Name Sequence ( 5' 3' ) Note R NAiOs04g23550 1 GATATCGATCGAGTACATCCAGCGCCT For RNAi construct RNAiOs04g23550 2 ACTAGTCTCACCACCAGCACCCTGTC For RNAi construct RNAiOs04g23550 3 GGTACCGGATCCCTCACCACCAGCACCCTGTC For RNAi construct RNAiOs04g23550 4 AAGCTT GATCGAGTACATCCAGCGCCT For RNAi con struct GUSloop 1 CCCGGGGGTCAGTGGCAGTGA For GUS loop GUSloop 2 CCCGGGGCGGTTTTTCACCGA For GUS loop Os04g23550 1 AGATCT ATGGACGCCGAGATGG For Oxexpression and His tagged protein Os04g23550 2 AGATCTAGCTCATAACTAATAGCTCATGGAG For Oxexpression and His tagged p rotein Os04g23550SpeI 1 ACTAGT ATGGACGCCGAGATGGCC For pINDEX construct Os04g23550SpeI 2 ACTAGTTAGCTCATAACTAATAGCTCATGGAG For pINDEX construct Os04g23550 1 AGATCT ATGGACGCCGAGATGG Without Stop codon, for GFP fusion Os04g23550 3 AGATCTATAGCTCATGGAGCTCAAC GGACTG Without Stop codon, for GFP fusion RERJ1N 1 GTCGACCATGGACGCCGAGATGGCCATGFor For MBP and GST taged protein RERJ1N 2 GCGGCCGCTCAGAGGATGTTCTTGTTCGCGCCAC For MBP and GST taged protein

PAGE 87

87 Fig ure 3 1 Characterization of RERJ1 antibody specificity A) Protein gel blot analysis performed with Ni NTA affinity purified H is tagged proteins. Protein, 0.01 g per lane, was loaded and probed with mouse raised monoclonal antibody Anti His (Sigma) or B) the affinity purified antibody raised against the N terminal region of REREJ1. Molecular masses of standard proteins are indicated. C) Transgenic rice seedlings with dexamethasone (DEX) inducible promoter fused with RERJ1 (A6 5) full length cDNA or empty vector (A7 1) treated with indicated concentration of DEX for 2 days. Total protein extract is subject to Western blot using affinity purified Anti RERJ1 antibod y. D) A7 1 and A6 5 treated with 2.5 M DEX for indicated time. Wes tern blot procedure same as C).

PAGE 88

88 Figure 3 2 XB3 and RERJ1 interact in vitro and in vivo A) XB3 interacts with RERJ1 in the yeast two hybrid assay. XB3 cDNA fragment and RERJ1 cD NA fragm ent were fused to sequen ces encoding the Gal4 DNA binding domain (BD) and the Gal4 activation domain (A D) in pDBLeu and pPC86 respectively. BD XA21/AD XB3 combination as previously described (Wa ng et al., 2006) was used as a positive control. The two vectors were transformed into the yeast strain CG1945. Transformants were plated onto selective medium/ Leu/ Trp and same set replica plated onto selective medium/ Leu/ Trp/ His +5mM 3 AT and incuba ted for 3 d ays B) In vitro pull down assays of FLAG tagged XB3 or FLAG tagge d XBOS31 with RERJ1 E.coli expressed FLAG XB3, FLAG XBOS31 fusion protein were incubated with E.coli expressed RERJ1 His fusion protei n in Anti FLAG Affinity resin. After extensive washing, the elutes were subject ed to SDS PAGE and Western blot with appropriate anti bodie s as indicated. C) Protein extracts from agrobacteria infiltrated N. benthamiana leaves were subjected to immunoprecipitation by using Anti RERJ1 antibody conjugated to Protein A/G beads. After extensive washing, the precipitates were then subjected t o SDS PAGE and protein blot analysis. The combinations of constructs used for infiltration were listed above the lanes. D) Co IP in N. benthamiana by using Anti FLAG affinity gel. The combinations of constructs used for infiltration were listed above the l anes. E ) for 3h ) were immunoprecipitated with anti RERJ1 or preimmune serum or control a ntib ody anti Myc. After extensive washing, the immunoprecip itates were separated to SDS PAGE gels and subjected to protein blot analysis.

PAGE 89

89 A B Figure 3 3. Mapping interaction domains of XB3 and RERJ1. A) Delineation of the XB3 and RERJ1 interaction domains (indicated on top) by yeast two hybr id experiments. (Left) XB3 cDNA constructs fused to sequences encoding DNA binding domain as indicated. (Right) Same as left panel but with RERJ1 cDNA constructs fused to sequences encoding DNA activation domain. indicates interaction; indicates no interaction. B) T ested d omains responsible for interaction s as indicated on top of the panels. XB3 cDNA truncation derivatives and RERJ1cDNA truncation derivatives were fused to sequences encoding the DNA binding domain (BD) in pLexA and th e activation domain (AD) of pB42AD respectively. The two vectors carrying the indicated fragment were transformed into the yeast strain EGY48. Transformants were plated onto selective medium/ His/ Trp and same set replica plated onto selective medium/ Leu/ Trp/ His +20mM 3 AT and incubated for 3 days.

PAGE 90

90 A B C Figure 3 4. Analysis of RERJ1 protein and its homologs. A) Illustration of RERJ1 protein s tructure. PEST dom ain denotes a peptide stretch rich in proline (P), glutamic acid (E), serine (S), and threo nine (T); bHLH domain denotes basic helix l oop helix domain; CCD denotes conserved C terminal domain in monocot. B) Alignment of RERJ1 and its orthologs from monocot The bHLH domain is underlined with a solid line; the CDD is underlined with a broken line. C) Phylogenetic analysis o f RERJ1 and its homologues. The phylogenetic tree was constructed by the neighbor joining method with 1,000 bootstrap replicat es, using t he MEGA 4 software.

PAGE 91

91 Figure 3 5 Localization of RERJ1 and XB3 A) Root tip s from 1 week old t ransgenic rice seedlings constitutively expressing RERJ1 GFP under a confocal microscope. Propidium iodide stain s DNA ; green floresc ence shows localizatio n of the GFP fusion protein. B) Transfection of indicated construct s (GFP, or GFP fused proteins shown above photographs) of rice propoplasts. T ransfected protoplast s were subjected to c onfocal microscope observation. C) Subcellular f ractionation of rice leaves from wild type TP309 and Xa21 carrying 4021. N: nuclei enriched fraction, N : nuclei depleted fraction, Histone H3: nuclear protein marker, PEPC: cytoplasmic protein marker.

PAGE 92

92 Figure 3 6. XB3 prot ein is stabilized in the presence of Xa21 A) Co infiltration of indicated combinations of constructs in N. benthamiana for 2 days. P rotein extracts were subjected to Western blot using Anti XB3 antibody Concentrations of Agrobacteria used: XB3 OD 600 =0.0 8; EV, Xa21 OD 600 =0.5 ; rbcL: RuBisCO large subunit. B ) Rice leaves were inoculated with Xoo OD 600 =0.5 for the indicated time. Protein extracts were subjected to Western blot using the Anti XB3 antibody Dpi: days post inoculation; rbcL: rubisco large subu nit.

PAGE 93

93 Figure 3 7. Degradation of RERJ1 protein by XB3 A) Time course of RERJ1 protein level upon Xanthomonas oryzae pv. oryzae ( Xoo ) inoculation on rice cultivar 4021 carrying Xa21 Dpi: days post inoculation; mo ck: mock inoculation with water, sampled at 3 dpi. An unrelated protein ADP glucose pyrophosphorylase (AGPase) was used as a control to show that the degradation of RERJ1 is specific. Both actin and Rubisco large subunit (RbcL) were used as loading control s. B) XB3 promotes RERJ1 protein degradation in N. benthamiana Protein extracts from agrobacteria infiltrated N. benthamiana leaf discs were subjected to protein blot analysis. The combinations of constructs used for infiltration were listed above the lan es. 35S GFP GUS His construct was used as an internal control. Each protein was detected with indicated antibodies. Infiltrated leaves were sampled at 30 hours post infiltration (hpi). C) The XB3 HR inducing defective mutant XB3 G2A promotes RERJ1 degradati on in N. benthamiana Infiltrated leaves discs were sampled at 40 hpi. Two different combinations of constructs were infiltrated on the same leaf bilaterally Four to five discs from infiltrated leaves were combined for protein extraction and further analy sis RbcL: RubisCO large subunit.

PAGE 94

94 Figure 3 8 Identification of RERJ1 RNAi transgenic lines. A) Diagram showing RNA i construct used in this study. Ubi: maize ubiquitin promoter; NOS: NOS terminator. B) Northern blot with GUS loop as probe to confirm positive transgenic lines. C) Western blot showing RERJ1 protein levels for vector control line and RERJ1 RNAi lines. RbcL: RubisCO large subunit.

PAGE 95

95 Figure 3 9 Inoculation of rice plants with Xoo A) Semi quantitative RT PCR using cDNA from reverse transcription of RNA of Xoo inoculated wild type rice leaves with indicated time course. Hpi: hours post inoculation ; Ubi: Ubiquitin B) Disease lesion development at 12 dpi. WT: wild type; VC: vector contr ol. C) Lesion lengths measurement at indicated time course. D) Bacterial population counting at indicated time course.

PAGE 96

96 CHAPTER 4 CONCLUSIONS AND OUTLOOK The positive role of XB3 in Xa21 mediated resistance prompt ed further diss ect ion of XB3 function s The finding that overexpression of XB3 in Nicotiana benthamiana induces H R like cell death is indicative of a positive role for XB3 in plant im munity. The cell death induced by XB3 is dependent on its E3 ubiquitin ligase activi ty, which suggests that XB 3 requires the E3 ubiquitin ligase activity to degrade the negative regulators of cell death in N. benthamiana In future work it will be interest ing to transiently express 35S XB3 C323A FLAG to co immunoprecipate XB3 binding part n ers and potential substra tes in N. benthamiana The XB3 G2A mutant (mutation at the putative myristoylation site) is compromised in cell death induction capability. Myristoylated proteins are often membrane associated. This indicates that XB3 may target negative regulators of cell death at the plasma membrane in N. benthamiana Conservation of protein structure and sequence among XB3 family members led to the hypothesis that other members of the XB3 family can al so trigger cell death. The other tested XB3 family member XBOS31 (rice ), XBAT31 (Arabidopsis ), XBCT31 (citrus) and XBCT32 (c itrus) all trigger cell death when they are overexpressed in N. benthamiana This supports the hypothesis of a conserved function among these family members Th e conservation of the XB3 family in the i nduction of cell death justifies the hypothesis that they may also be positively involved in plant immunity. Overexpression of XB3 family members may confer increased disease resistance to plant pathogens. Engineering XB3 family members for disease resista nce (especially in rice and citrus) will be a future direction and application of this research.

PAGE 97

97 XB3 has been shown to be required for full Xa21 mediated resistance (Wang et al., 2006) XB3 can degrade nucleus localized transcription factor RERJ1 in Nicotiana benthamiana It will be interesting to test if nucleus localization is required for XB3 function. Mutation of the nucleus localization signal in XB3 or attachment of a nucleus export signa l to XB3 and then transformation into xb3 knockout lines will elucidate if nucleus localization is required for Xa21 mediated resistance. XB3 interacts with the transcription factor RERJ1 both in vitro and in vivo RERJ1 expression is induced by Xoo infect ion in wild type rice plant s. XB3 protein is localized in both the plasma membrane and the nucleus, while RERJ1 protein is only localized in nucleus. XB3 can degrade RERJ1 in N. benthamiana The degradation of RERJ1 requires E3 ubiquitin ligase activity of XB3. Knockdown of RERJ1 by RNAi confers partial resistance to Xoo This shows that RERJ1 is a negative regulator of plant immunity against Xoo Future work will be directed to test the roles of other XB3 interacting proteins, which were previously identif ied in yeast two hybrid screening in plant immunity Knockout or knockdown of these XB3 interacting proteins may confer elevated resistance to Xoo or even other pathogens.

PAGE 98

98 APPENDIX PUBLICATION Huang X Liu X, Chen X, Snyder S Song WY (201 3) Members of the XB3 family Induce Programmed Cell Death in Nicotiana benthamiana PLOS One 2013 May 22; 8(5):e63868. doi: 10.1371/journal.pone.0063868.

PAGE 99

99 LIST OF REFERENCES Ade, J., DeYoung, B.J., Golstein, C., and Innes, R.W. (2007). Indirect activation of a plant nucleotide binding site leucine rich repeat protein by a bacterial protease. Proceedings of the National Academy of Sciences of the United States of America 104: 2531 2536. Afzal, A.J., da Cunha, L., and Mackey, D. (2011) Separable fragments and membrane tethering of Arabidopsis RIN4 regulate its suppression of PAMP triggered i mmunity. Plant Cell 23: 3798 3811. An, H.L., Roussot, C., Suarez Lopez, P., Corbesler, L., Vincent, C., Pineiro, M., Hepworth, S., Mouradov, A., Jus tin, S., Turnbull, C., and Coupland, G. (2004). CONSTANS acts in the phloem to regulate a systemic signal that induces photoperiodic flowering of Arabidopsis. Development 131 : 3615 3626 Ang, L.H., Chattopadhyay, S., Wei, N., Oyama, T., Okada, K., Batscha uer, A., and Deng, X.W. (1998). Molecular interaction between COP1 and HY5 defines a regulatory switch for light control of Arabidopsis development. Molecular Cell 1 : 213 222 Antony, G., Zhou, J.H., Huang, S., Li, T., Liu, B., White, F., and Yang, B. (20 10). Rice xa13 r ec essive resistance to bacterial blight is defeated by i nduction of the disease susceptibility g ene Os 11N3. Plant Cell 22: 3864 3876. Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2 specified disease resistance in Arabidopsis is coupled to the AvrRpt2 directed elimination of RIN4. Cell 112: 369 377. Bai, S.W., Liu, J., Chang, C., Zhang, L., Maekawa, T., Wang, Q.Y., Xiao, W.K., Liu, Y.L., Chai, J.J., Takken, F.L.W., Schulze Lefert, P., and Shen, Q.H. (2012). Structure f unction analysis of barley NLR immune receptor MLA10 reveals its cell compartment specific activity in cell death and disease r esistance. Plos Pathogens 8 : e1002752 Bhattacharjee, S., Halane, M.K., Kim, S.H., and Gassmann, W. (2011). Pathogen effectors t arget A rabidopsis EDS1 and alter its interactions with immune r egulators. Science 334: 1405 1408. Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. (2009). Breaking the code of DNA binding s pecificity of TAL type III e ffectors. Science 326: 1509 1512. Bogdanove, A.J., and Voytas, D.F. (2011). TAL effectors: customizable p roteins for DNA Targeting. Science 333: 1843 1846.

PAGE 100

100 Boller, T., and Felix, G. (2009). A renaissance of elicitors: perception of micr obe associated molecular patterns and danger signals by pattern recognition receptors Annual Review of Plant Biology 60: 379 406. Brooks, D.M., Bender, C.L., and Kunkel, B.N. (2005). The Pseudomonas syringae phytotoxin coronatine promotes virulence by ove rcoming salicylic acid dependent defences in Arabidopsis thaliana. Molecular Plant Pathology 6: 629 639. Cheng, Y.T., Li, Y.Z., Huang, S.A., Huang, Y., Dong, X.N., Zhang, Y.L., and Li, X. (2011). Stability of plant immune receptor resistance proteins is c ontrolled by SKP1 CULLIN1 F box (SCF) mediated protein degradation. Proceedings of the National Academy of Sciences of the United States of America 108: 14694 14699. Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2006). The Arabidopsi s receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 18: 465 476. Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T., Jones, J.D.G., Felix, G., and Boller, T. (2007). A flagellin induc ed complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448: 497 500 Chinnusamy, V., Ohta, M., Kanrar, S., Lee, B.H., Hong, X.H., Agarwal, M., and Zhu, J.K. (2003). ICE1: a regulator of cold induced transcriptome and freezing tolerance i n Arabidopsis. Genes & Development 17: 1043 1054. Chu, Z.H., Yuan, M., Yao, L.L., Ge, X.J., Yuan, B., Xu, C.G., Li, X.H., Fu, B.Y., Li, Z.K., Bennetzen, J.L., Zhang, Q.F., and Wang, S.P. (2006). Promoter mutations of an essential gene for pollen developme nt result in disease resistance in rice. Genes & Development 20: 1250 1255. Chung, E.H., da Cunha, L., Wu, A.J., Gao, Z.Y., Cherkis, K., Afzal, A.J., Mackey, D., and Dangl, J.L. (2011). Specific threonine phosphorylation of a host target by two unrelated type III effectors activates a host innate immune receptor in plants Cell Host & Microbe 9: 125 136. Clough, S.J., Fengler, K.A., Yu, I.C., Lippok, B., Smith, R.K., and Bent, A.F. (2000). The Arabidopsis dnd1 "defense, no death" gene encodes a mutated cy clic nucleotide gated ion channel. Proceedings of the National Academy of Sciences of the United States of America 97: 9323 9328. Cole, A.B., Kiraly, L., Ross, K., and Scheolz, J.E. (2001). Uncoupling resistance from cell death in the hypersensitive respo nse of Nicotiana species to c auliflower mosaic virus infection. Molecular Plant Microbe Interactions 14: 31 41

PAGE 101

101 Cui, H.T., Wang, Y.J., Xue, L., Chu, J.F., Yan, C.Y., Fu, J.H., Chen, M.S., Innes, R.W., and Zhou, J.M. (2010). Pseudomonas syringae effector p ro tein AvrB pertu rbs Arabidopsis hormone signaling by activating MAP k inase 4. Cell Host & Microbe 7: 164 175. Cunnac, S., Chakravarthy, S., Kvitko, B.H., Russell, A.B., Martin, G.B., and Collmer, A. (2011). Genetic disassembly and combinatorial reassembl y identify a minimal functional repertoire of type III effectors in Pseudomonas syringae. Proceedings of the National Academy of Sciences of the United States of America 108: 2975 2980. Dangl, J.L., and Jones, J.D.G. (2001). Plant pathogens and integrated defence responses to infection. Nature 411: 826 833. Dangl, J.L., Dietrich, R.A., and Richberg, M.H. (1996). Death don't have no mercy: Cell death programs in plant microbe interactions. Plant Cell 8: 1793 1807. de Jonge, R., van Esse, H.P., Maruthachal am, K., Bolton, M.D., Santhanam, P., Saber, M.K., Zhang, Z., Usami, T., Lievens, B., Subbarao, K.V., and Thomma, B.P.H.J. (2012). Tomato immune receptor Ve1 recognizes effector of multiple fungal pathogens uncovered by genome and RNA sequencing. Proceeding s of the National Academy of Sciences of the United States of America 109: 5110 5115. de Vries, J.S., Andriotis, V.M.E., Wu, A.J., and Rathjen, J.P. (2006). Tomato Pto encodes a functional N myristoylation motif that is required for signal transduction in Nicotiana benthamiana. Plant Journal 45: 31 45. DebRoy, S., Thilmony, R., Kwack, Y.B., Nomura, K., and He, S.Y. (2004). A family of conserved bacterial effectors inhibits salicylic acid mediated basal immunity and promotes disease necrosis in plants. Pro ceedings of the National Academy of Sciences of the United States of America 101: 9927 9932. del Pozo, O., Pedley, K.F., and Martin, G.B. (2004). MAPKKK alpha is a positive regulator of cell death associated with both plant immunity and disease. EMBO Jour nal 23: 3072 3082. Den Herder, G., Yoshida, S., Antolin Llovera, M., Ried, M.K., and Parniske, M. (2012). Lotus japonicus E3 l igase SEVEN IN ABSENTIA4 destabilizes the symbiosis receptor like kinas e SYMRK and negatively regulates rhizobial infec tion. Plan t Cell 24 : 1691 1707 Deng, X.W., Caspar, T., and Quail, P.H. (1991). Cop1: a regulatory locus involved in light controlled development and gene expression in arabidopsis Genes & Development 5 : 1172 1182

PAGE 102

102 Deng, X.W., Matsui, M., Wei, N., Wagner, D., Chu A.M., Feldmann, K.A., and Quail, P.H. (1992). COP1, an Arabidopsis regulatory gene, encodes a protein with both a zinc binding motif and a g beta homologous domain Cell 71 : 791 801 Dong, C.H., Agarwal, M., Zhang, Y.Y., Xie, Q., and Zhu, J.K. (2006). T he negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1. Proceedings of the National Academy of Sciences of the United States of America 103: 8281 8286. Dong, J., Xiao, F.M., Fan, F .X., Gu, L.C., Cang, H.X., Martin, G.B., and Chai, J.J. (2009). Crystal structure of the complex between Pseudomonas e ffector AvrPtoB a nd the tomat o Pto kinase reveals both a shared and a unique interface compared with AvrPto Pto. Plant Cell 21: 1846 1859. Durrant, W.E., Rowland, O., Piedras, P., Hammond Kosack, K.E., and Jones, J.D.G. (2000). cDNA AFLP reveals a striking overlap in race specific resistance and wound response gene expression profiles. Plant Cell 12 : 963 977 El Oirdi, M., Abd El Rahman, T ., Rigano, L., El Hadrami, A., Cecilia Rodriguez, M., Daayf, F., Vojnov, A., and Bouarab, K. (2011). Botrytis c inerea manipulates the antagonistic effects between immune pathways to promote disease development in tom ato. Plant Cell 23: 2405 2421. Feng, F. Yang, F., Rong, W., Wu, X.G., Zhang, J., Chen, S., He, C.Z., and Zhou, J.M. (2012). A Xanthomonas uridine 5 monophosphate transferase inhibits plant immune kinases. Nature 485: 114 149. Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina Escobar N., Neu, C., Cabral, A., and Parker, J.E. (2005). Arabidopsis SENESCENCE ASSOCIATED GENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant Cell 17: 2601 2613. Feys, B.J.F., Benedetti, C.E., Penf old, C.N., and Turner, J.G. (1994). Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen Plant Cell 6: 751 759. Flor, H.H. (1971). C urrent status of gene for gene concept Annual Review of Phytopathology 9: 275 296 Fu, Z.Q., Guo, M., Jeong, B.R., Tian, F., Elthon, T.E., Cerny, R.L., Staiger, D., and Alfano, J.R. (2007). A type III effector ADP ribosylates RNA binding proteins and quells plant imm unity. Nature 447: 284 U281. Gao, X.F., Wan, F.Y., Mateo, K., Callegari, E., Wang, D., Deng, W.Y., Puente, J., Li, F., Chaussee, M.S., Finlay, B.B., Lenardo, M.J., and Hardwidge, P.R. (2009).

PAGE 103

103 Bacterial effector binding to ribosomal protei n S3 su bverts NF kappa B f unction. Plos Pathogens 5 : e1000708 Gimenez Ibanez, S., Hann, D.R., Ntoukakls, V., Petutschnig, E., Lipka, V., and Rathjen, J.P. (2009). AvrPtoB t argets the LysM receptor k inase CERK1 to promote bacterial virulence on plants Current Biology 19: 423 429. Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophi c and necrotrophic pathogens. Annual Review of Phytopatho logy 43: 205 227. Goehre, V., Spallek, T., Haeweker, H., Mersmann, S., Mentzel, T., Boller, T., de Torres, M., Ma nsfield, J.W., and Robatzek, S. (2008). Plant pattern recognition rec eptor FLS2 is directed for degradation by the bacterial ubiquitin liga se AvrPtoB. Current Biology 18: 1824 1832. Gohre, V., and Robatzek, S. (2008). Breaking the barriers: m icrobial effe ctor molecules subvert plant immunity. Annual Review of Phytopathology 46: 189 215. Gomez Gomez, L., and Boller, T. (2000). FLS2: a n LRR receptor like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Molecular Cell 5: 1003 1011. Gomez Gomez, L., Bauer, Z., and Boller, T. (2001). Both the extracellular leucine rich repeat domain and the kinase activity of FLS2 are required for flagellin binding and signaling in arabidopsis. Plant Cell 13: 1155 1163. Gonzalez Lamothe, R ., Tsitsigiannis, D.I., Ludwig, A.A., Panicot, M., Shirasu, K., and Jones, J.D.G. (2006). The U Box protein CMPG1 is required for efficient activation of defense mechanisms triggered by multiple resistance genes in tobacco and tomato. Plant Cell 18: 1067 1 083. Goodin, M.M., Zaitlin, D., Naidu, R.A., and Lommel, S.A. (2008). Nicotiana benthamiana: i ts history and future as a model for plant pathogen interactions. Molecular Plant Microbe Interactions 21: 1015 1026. Gou, M., Shi, Z., Zhu, Y., Bao, Z., Wang, G., and Hua, J. (2012). The F box protein CPR1/CPR30 negatively regulates R protein SNC1 accumulation. Plant Journal 69 : 411 420 Grant, M., and Lamb, C. (2006). Systemic immunity. Current Opinion in Plant Biology 9: 414 420. Gu, K.Y., Yang, B., Tian, D. S., Wu, L.F., Wang, D.J., Sreekala, C., Yang, F., Chu, Z.Q., Wang, G.L., White, F.F., and Yin, Z.C. (2005). R gene expression induced by a type III effector triggers disease resistance in rice. Nature 435: 1122 1125.

PAGE 104

104 Gutierrez, J.R., Balmuth, A.L., Ntouka kis, V., Mucyn, T.S., Gimenez Ibanez, S., Jones, A.M.E., and Rathjen, J.P. (2010). Prf immune complexes of tomato are oligomeric and contain multiple Pto like kinases that diversify effector recognition. Plant Journal 61: 507 518. Hashimoto, M., Komatsu, K., Maejima, K., Okano, Y., Shiraishi, T., Ishikawa, K., Takinami, Y., Yamaji, Y., and Namba, S. (2012). Identification of three MAPKKKs forming a linear signaling pathway leading to programmed cell dea th in Nicotiana benthamiana. BMC Plant Biology 12 : 103 Heese, A., Hann, D.R., Gimenez Ibanez, S., Jones, A.M.E., He, K., Li, J., Schroeder, J.I., Peck, S.C., and Rathjen, J.P. (2007). The receptor like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proceedings of the National Academy of Sciences of the United States of America 104: 12217 12222. Heidrich, K., Wirthmueller, L., Tasset, C., Pouzet, C., Deslandes, L., and Parker, J.E. (2011). Arabidopsis EDS1 connects pathogen effector recognition to cell compartment specific immune r esp onses. Science 334: 1401 1404. Holm, M., Ma, L.G., Qu, L.J., and Deng, X.W. (2002). Two interacting bZIP proteins are direct targets of COP1 mediated control of light dependent gene expression in Arabidopsis. Genes & Development 16 : 1247 1259 Ishitani, M., Xiong, L.M., Lee, H.J., Stevenson, B., and Zhu, J.K. (1998). HOS1, a genetic locus involved in cold responsive gene expression in Arabidopsis. Plant Cell 10: 1151 1161. Jang, I.C., Yang, J.Y., Seo, H.S., and Chua, N.H. (2005a). HFR1 is targeted by COP 1 E3 ligase for post translational proteolysis during phytochrome A signaling. Genes & Development 19 : 593 602 Jang, K.L., Shackelford, J., Seo, S.Y., and Pagano, J.S. (2005b). Up regulation of beta catenin by a viral oncogene correlates with inhibition of the seven in absentia homolog 1 in B lymphoma cells. Proceedings of the National Academy of Sciences of the United States of America 102: 18431 18436. Jin, H.L., Axtell, M.J., Dahlbeck, D., Ekwenna, O., Zhang, S.Q., Staskawicz, B., and Baker, B. (2002) NPK1, an MEKK1 like mitogen activated protein kinase kinase kinase, regulates innate immunity and development in plants. Developmental Cell 3: 291 297. Jin, Q.L., Thilmony, R., Zwiesler Vollick, J., and He, S.Y. (2003). Type III protein secretion in Pse udomonas syringae. Microbes and Infection 5: 301 310.

PAGE 105

105 Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature 444: 323 329. Kaku, H., Nishizawa, Y., Ishii Minami, N., Akimoto Tomiyama, C., Dohmae, N., Takio, K., Minami, E., and Shibuya, N. (2006). Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proceedings of the National Academy of Sciences of the United States of America 103: 11086 11091. Kawasaki, T., Nam, J., Boyes, D.C., Holt, B.F., Hub ert, D.A., Wiig, A., and Dangl, J.L. (2005). A duplicated pair of Arabidopsis RING finger E3 ligases contribute to the RPM1 and RPS2 mediated hypersensitive response. Plant Journal 44 : 258 270 Kawchuk, L.M., Hachey, J., Lynch, D.R., Kulcsar, F., van Rooi jen, G., Waterer, D.R., Robertson, A., Kokko, E., Byers, R., Howard, R.J., Fischer, R., and Prufer, D. (2001). Tomato Ve disease resistance genes encode cell surface like receptors. Proceedings of the National Academy of Sciences of the United States of Am erica 98: 6511 6515. Kay, S., Hahn, S., Marois, E., Hause, G., and Bonas, U. (2007). A bacterial effector acts as a plant transcription factor and induces a cell size regulator. Science 318: 648 651. Kim, J.G., Li, X.Y., Roden, J.A., Taylor, K.W., Aakre, C.D., Su, B., Lalonde, S., Kirik, A., Chen, Y.H., Baranage, G., McLane, H., Martin, G.B., and Mudgett, M.B. (2009). Xanthomonas T3S effector XopN suppresses PAMP triggered immunity and interacts with a tomato atypical receptor like k inase and TFT1. Plant Cell 21: 1305 1323. Kinkema, M., Fan, W.H., and Dong, X.N. (2000). Nuclear localization of NPR1 is required for activation of PR gene expression. Plant Cell 12: 2339 2350. Kiribuchi, K., Otani, T., Jikumaru, Y., Kaku, H., Tanabe, S., Minami, E., Nagamura Y., Okada, K., Nojiri, H., and Yamane, H. (2005a). Functional analysis of the jasmonate responsive gene RERJ1 in rice. Plant and Cell Physiology 46: S38 S38. Kiribuchi, K., Jikumaru, Y., Kaku, H., Minami, E., Hasegawa, M., Kodama, O., Seto, H., Okada, K ., Nojiri, H., and Yamane, H. (2005b). Involvement of the basic helix loop helix transcription factor RERJ1 in wounding and drought stress responses in rice plants. Bioscience Biotechnology and Biochemistry 69: 1042 1044. Kiribuchi, K., Sugimori, M., Take da, M., Otani, T., Okada, K., Onodera, H., Ugaki, M., Tanaka, Y., Tomiyama Akimoto, C., Yamaguchi, T., Minami, E., Shibuya,

PAGE 106

106 N., Omori, T., Nishiyama, M., Nojiri, H., and Yamane, H. (2004). RERJI, a jasmonic acid responsive gene from rice, encodes a basic h elix loop helix protein. Biochemical and Biophysical Research Communications 325: 857 863. Krol, E., Mentzel, T., Chinchilla, D., Boller, T., Felix, G., Kemmerling, B., Postel, S., Arents, M., Jeworutzki, E., Al Rasheid, K.A.S., Becker, D., and Hedrich, R (2010). Perception of the Arabidopsis danger s ignal Peptide 1 involves the pattern recognition recepto r AtPEPR1 and its close ho mologue AtPEPR2. Journal of Biological Chemistry 285: 13471 13479. Kurup, S., Jones, H.D., and Holdsworth, M.J. (2000). Inter actions of the developmental regulator ABI3 with proteins identified from developing Arabidopsis seeds. Plant Journal 21 : 143 155 Lazaro, A., Valverde, F., Pineiro, M., and Jarillo, J.A. (2012). The Arabidopsis E3 ubiquitin ligas e HOS1 negatively r egulat es CONSTANS abundance in the photoperiodic control of flowerin g. Plant Cell 24: 982 999. Lee, D.H., Choi, H.W., and Hwang, B.K. (2011). The p epper E3 ubiquitin liga se RING1 g ene, CaRING1, is required for cell death and the salicylic acid dependent defense respon se. Plant Physiology 156 : 2011 2025 Lee, H.J., Xiong, L.M., Gong, Z.Z., Ishitani, M., Stevenson, B., and Zhu, J.K. (2001). The Arabidopsis HOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold regulated nucleo cytoplasmic partitioning. Genes & Development 15: 912 924. Lee, S.W., Han, S.W., Sririyanum, M., Park, C.J., Seo, Y.S., and Ronald, P.C. (2009). A t ype I secreted, sulfated peptide t riggers XA21 mediated innate i mmunity. Science 326: 850 853. Li, J., Wen, J.Q., Lease, K.A., Doke, J.T., Tax, F.E., and Walker, J.C. (2002). BAK1, an Arabidopsis LRR receptor like protein kinase, interacts with BRI1 and modulates brassinosteroid signaling. Cell 110: 213 222. Li, T., Liu, B., Spalding, M.H., Weeks, D.P., and Yang, B. (2012). High efficiency TALEN based gene editing produces disease resistant rice. Nature Biotechnology 30: 390 392. Li, X., Clarke, J.D., Zhang, Y.L., and Dong, X.N. (2001). Activation of an EDS1 mediated R gene pathway in the sn c1 mutant leads to constitutive, NPR1 independent pathogen resistance. Molecular Plant Microbe Interactions 14: 1131 1139.

PAGE 107

107 Lin, N.C., and Martin, G.B. (2005). An avrPto/avrPtoB mutant of Pseudomonas syringae pv. tomato DC3000 does not elicit Pto mediated resistance and is less virulent on tomato. Molecular Plant Microbe Interactions 18: 43 51. Lin, Y.K., Wang, Y.L., Zhu, J.K., and Yang, Z.B. (1996). Localization of a Rho GTPase implies a role in tip growth and movement of the generative cell in pollen tub es. Plant Cell 8: 293 303. Liu, J., Elmore, J.M., Lin, Z.J.D., and Coaker, G. (2011). A receptor like cytoplasmic kinase phosphorylates the host target RIN4, leading to the activation of a plant innate immune recepto r. Cell Host & Microbe 9: 137 146. Liu J., Elmore, J.M., Fuglsang, A.T., Palmgren, M.G., Staskawicz, B.J., and Coaker, G. (2009). RIN4 functions with plasma mem brane H+ ATPases to regulate stomatal apertures during pathogen atta ck. Plos Biology 7 : e1000139 Liu, L. J., Zhang, Y. C., Li, Q. H ., Sang, Y., Mao, J., Lian, H. L., Wang, L., and Yang, H. Q. (2008). COP1 mediated ubiquitination of CONSTANS is implicated in cryptochrome regulation of flowering in Arabidopsis. Plant Cell 20 : 292 306 Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S. Yamaguchi Shinozaki, K., and Shinozaki, K. (1998). Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought and low temperature responsive gene expression, respectivel y, in Arabidopsis. Plant Cell 10 : 1391 1406 Lu, D., Lin, W., Gao, X., Wu, S., Cheng, C., Avila, J., Heese, A., Devarenne, T.P., He, P., and Shan, L. (2011). Direct ubiquitination of pattern recognition recept or FLS2 attenuates plant innate im munity. Scie nce 332 : 1439 1442 Lu, D.P., Wu, S.J., Gao, X.Q., Zhang, Y.L., Shan, L.B., and He, P. (2010). A receptor like cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to initiate plant innate immunity. Proceedings of the National Academy of Sciences of the United States of America 107: 496 501. Luo, S., Zhang, Y., Hu, Q., Chen, J.J., Li, K.P., Lu, C., Liu, H., Wang, W., and Kuang, H.H. (2012). Dynam ic nucleotide binding site and leucine rich repeat encoding genes in the grass f amily. Plant Physiology 159: 197 210. Lyzenga, W.J., Booth, J.K., and Stone, S.L. (2012). The Arabidopsis RING type E3 ligase XBAT32 mediates the proteasomal degradation of the ethylene biosynthetic enzyme, 1 aminocyclopropane 1 carboxylate synthase 7. Plant Journal 7 1: 23 34.

PAGE 108

108 Mazzucotelli, E., Belloni, S., Marone, D., De Leonardis, A.M., Guerra, D., Di Fonzo, N., Cattivelli, L., and Mastrangelo, A.M. (2006). The E3 ubiquitin ligase gene family in plants: r egulation by degradation. Current Genomics 7 : 509 522 Melech Bonfil, S., and Sessa, G. (2010). Tomato MAPKKK epsilon is a positive regulator of cell death signaling networks associated with plant immunity. Plant Journal 64: 379 391. Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006). Plant sto mata function in innate immunity against bacterial invasion. Cell 126: 969 980. Meyers, B.C., Kozik, A., Griego, A., Kuang, H.H., and Michelmore, R.W. (2003). Genome wide analysis of NBS LRR encoding genes in Arabidopsis. Plant Cell 15: 809 834. Miya, A. Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America 104: 19613 19618. Miyamoto, K., Shimizu, T., Mochizuki, S., Nishizawa, Y., Minami, E., Nojiri, H., Yamane, H., and Okada, K. (2013). Stress induced expression of the transcription factor RERJ1 is tightly regulated in response to jasmonic acid accumulation in rice. Protoplasma 250: 241 249. Miyamoto, K., Okada, K., Suzumura, T., Otani, T., Kiribuchi, K., Nagamura, Y., Shibuya, N., Nojiri, H., and Yamane, H. (2007). Functional analysis of RERJ1, a jasmonic acid respo nsive transcription factor from rice. Plant and Cell Physiology 48: S143 S143. Monaghan, J., and Zipfel, C. (2012). Plant pattern recognition receptor complexes at the plasma membrane. Current Opinion in Plant Biology 15, 349 357. Moscou, M.J., and Bogda nove, A.J. (2009). A simple cipher g overns DNA recognition by TAL e ffectors. Science 326: 1501 1501. Mucyn, T.S., Wu, A.J., Balmuth, A.L., Arasteh, J.M., and Rathjen, J.P. (2009). Regulation of t omato Prf by Pto like protein kin ases. Molecular Plant Micro be Interactions 22: 391 401. Mucyn, T.S., Clemente, A., Andriotis, V.M.E., Balmuth, A.L., Oldroyd, G.E.D., Staskawicz, B.J., and Rathjen, J.P. (2006). The tomato NBARC LRR protein Prf interacts with Pto kinase in vivo to regulate specific plant immunity. Plant Cell 18: 2792 2806.

PAGE 109

109 Mukhtar, M.S., Carvunis, A.R., Dreze, M., Epple, P., Steinbrenner, J., Moore, J., Tasan, M., Galli, M., Hao, T., Nishimura, M.T., Pevzner, S.J., Donovan, S.E., Ghamsari, L., Santhanam, B., Romero, V., Poulin, M.M., Gebreab, F., G utierrez, B.J., Tam, S., Monachello, D., Boxem, M., Harbort, C.J., McDonald, N., Gai, L.T., Chen, H.M., He, Y.J., Vandenhaute, J., Roth, F.P., Hill, D.E., Ecker, J.R., Vidal, M., Beynon, J., Braun, P., Dangl, J.L., and European Union Effectoromics, C. (201 1). Independ ently evolved virulence effectors converge onto hubs in a plant immune system ne twork. Science 333: 596 601. Newton, H.J., Pearson, J.S., Badea, L., Kelly, M., Lucas, M., Holloway, G., Wagstaff, K.M., Dunstone, M.A., Sloan, J., Whisstock, J.C. Kaper, J.B., Robins Browne, R.M., Jans, D.A., Frankel, G., Phillips, A.D., Coulson, B.S., and Hartland, E.L. (2010). The Type III e ffectors NleE and NleB from e nteropathogenic E. coli and OspZ from Shigella block nuclear tra nslocation of NF kappa B Plos Pathogens 6: e1000898 Nicaise, V., Roux, M., and Zipfel, C. (2009). Recent a dvances in PAMP t riggered immunity against bacteria: pattern recognition receptors watch over and raise the alarm Plant Physiology 150: 1638 1647. Nodzon, L.A., Xu, W.H., Wang Y.S., Pi, L.Y., Chakrabarty, P.K., and Song, W.Y. (2004). The ubiquitin ligase XBAT32 regulates lateral root development in Arabidopsis. Plant Journal 40: 996 1006. Ntoukakis, V., Balmuth, A.L., Mucyn, T.S., Gutierrez, J.R., Jones, A.M.E., and Rathjen, J.P. (2013). The t omato Prf complex is a molecular trap for bacterial effectors based on Pto tran sphosphorylation. Plos Pathogens 9 : e1003123 Osterlund, M.T., Hardtke, C.S., Wei, N., and Deng, X.W. (2000). Targeted destabilization of HY5 during light reg ulated development of Arabidopsis. Nature 405 : 462 466 Ouwerkerk, P.B.F., de Kam, R.J., Hodge, J.H.C., and Meijer, A.H. (2001). Glucocorticoid inducible gene expression in rice. Planta 213: 370 378. Pandey, S.P., and Somssich, I.E. (2009). The r ole of W RKY transcription factors in plant immunit y. Plant Physiology 150: 1648 1655. Parcy, F., Valon, C., Raynal, M., Gaubiercomella, P., Delseny, M., and Giraudat, J. (1994). Regulation of gene expression programs during Arabidopsis seed development: roles of the ABI3 locus and of endogenous abscisic acid Plant Cell 6 : 1567 1582 Park, C.J., and Ronald, P.C. (2012). Cleavage and nuclear localization of the rice XA21 immune receptor. Nature Communications 3 : 920

PAGE 110

110 Park, C.J., Han, S.W., Chen, X.W., and Ronald, P.C. (2010). Elucidation of XA21 mediated innate immunity. Cellular Microbiology 12: 1017 1025. Pieterse, C.M.J., Van der Does, D., Zamioudis, C., Leon Reyes, A., and Van Wees, S.C.M. (2012). Hormona l modulation of plant i mmunity. Annual Review of Cell a nd Developmental B iology 28: 489 521. Prasad, M.E., Schofield, A., Lyzenga, W., Liu, H.X., and Stone, S.L. (2010). Arabidopsis RING E3 l igase XBAT32 regulates lateral root production through its role in ethylene biosyn thesis. Plant Physiology 153: 1587 15 96. Qi, D., DeYoung, B.J., and Innes, R.W. (2012). Structure f unction analysis of the coiled coil and leucine rich repeat domains of th e RPS5 disease resistance protein. Plant Physiology 158: 1819 1832. Qin, F., Sakuma, Y., Tran, L. S.P., Maruyama, K., K idokoro, S., Fujita, Y., Fujita, M., Umezawa, T., Sawano, Y., Miyazono, K. i., Tanokura, M., Shinozaki, K., and Yamaguchi Shinozaki, K. (2008). Arabidopsis DREB2A interacting proteins function as RING E3 ligases and negatively regulate plant drought stress responsive gene expression. Plant Cell 20 : 1693 1707 Rechsteiner, M., and Rogers, S.W. (1996). PEST sequences and regulation by proteolysis. Trends in Biochemical Sciences 21: 267 271. Resh, M.D. (1999). Fatty acylation of proteins: new insights into m embrane targeting of myristoylated and palmitoylated proteins. Biochimica Et Biophysica Acta Molecular Cell Research 1451: 1 16. Rogers, H.J. (2006). Programmed cell death in floral organs: How and why do flowers die? Annals of Botany 97: 309 315. Romer, P., Recht, S., and Lahaye, T. (2009). A single plant resistance gene promoter engineered to recognize multiple TAL effectors from disparate pathogens. Proceedings of the National Academy of Sciences of the United States of America 106: 20526 20531. Romer P., Hahn, S., Jordan, T., Strauss, T., Bonas, U., and Lahaye, T. (2007). Plant pathogen recognition mediated by promoter activation of the pepper Bs3 resistance gene. Science 318: 645 648. Ron, M., and Avni, A. (2004). The receptor for the fungal elicit or ethylene inducing xylanase is a member of a resistance like gene family in tomato. Plant Cell 16: 1604 1615.

PAGE 111

111 Roperch, J.P., Lethrone, F., Prieur, S., Piouffre, L., Israeli, D., Tuynder, M., Nemani, M., Pasturaud, P., Gendron, M.C., Dausset, J., Oren, M ., Amson, R.B., and Telerman, A. (1999). SIAH 1 promotes apoptosis and tumor suppression through a network involving the regulation of protein folding, unfolding, and trafficking: Identification of common effectors with p53 and p21(Waf1). Proceedings of th e National Academy of Sciences of the United States of America 96: 8070 8073. Roux, M., Schwessinger, B., Albrecht, C., Chinchilla, D., Jones, A., Holton, N., Malinovsky, F.G., Tor, M., de Vries, S., and Zipfel, C. (2011). The Arabidopsis leucine rich rep eat receptor like kina ses BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pat hogens. Plant Cell 23: 2440 2455. Saitou, N., and Nei, M. (1987) The neighbor joining method: a new method for reconstructing phyloge netic trees Molecular Biology and Evolution 4: 406 425. Sakuma, Y., Maruyama, K., Qin, F., Osakabe, Y., Shinozaki, K., and Yamaguchi Shinozaki, K. (2006a). Dual function of an Arabidopsis transcription factor DREB2A in water stress responsive and heat st ress responsive gene expression. Proceedings of the National Academy of Sciences of the United States of America 103 : 18822 18827 Sakuma, Y., Maruyama, K., Osakabe, Y., Qin, F., Seki, M., Shinozaki, K., and Yamaguchi Shinozaki, K. (2006b). Functional ana lysis of an Arabidopsis transcription factor, DREB2A, involved in drought responsive gene expression. Plant Cell 18 : 1292 1309 Salmeron, J.M., Oldroyd, G.E.D., Rommens, C.M.T., Scofield, S.R., Kim, H.S., Lavelle, D.T., Dahlbeck, D., and Staskawicz, B.J. (1996). Tomato Prf is a member of the leucine rich repeat class of plant disease resistance genes and lies embedded within the Pto kinase gene cluster. Cell 86: 123 133. Samach, A., Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz Sommer, Z., Yanofsky, M.F., and Coupland, G. (2000). Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 288: 1613 1616. Schulze, B., Mentzel, T., Jehle, A.K., Mueller, K., Beeler, S., Boller, T., Felix, G., and Chinchilla, D. (2010). Rapid h eteromerization and phosphorylation of ligand activated plant transmembrane receptors and their associated kina se BAK1. Journal of Biological Chemistry 285: 9444 9451. Schwessinger, B., and Ronald, P.C. (2012). P lant innate immunity: perception of conserv ed microbial signatures Annual Review of Plant Biology, Vol 63 63: 451 482.

PAGE 112

112 Schwessinger, B., Roux, M., Kadota, Y., Ntoukakis, V., Sklenar, J., Jones, A., and Zipfel, C. (2011). Phos phorylation dependent differential regulation of plant growth, cell deat h, and innate immunity by the regulatory receptor like kinase BAK1. Plos Genetics 7 : e1002046 Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavelle, D.T., Michelmore, R.W., and Staskawicz, B.J. (1996). Molecular basis of gene for gene specifi city in bacterial speck disease of tomato. Science 274: 2063 2065. Seo, H.S., Yang, J.Y., Ishikawa, M., Bolle, C., Ballesteros, M.L., and Chua, N.H. (2003). LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. Nature 423 : 995 999 Shan, L., He, P., Li, J., Heese, A., Peck, S.C., Nuernberger, T., Martin, G.B., and Sheen, J. (2008a). Bacterial effectors target the common signaling partner BAK1 to disrupt multiple MAMP receptor signaling complexes and impede plant immunity. Cell Host & Microbe 4: 17 27. Shan, L.B., Thara, V.K., Martin, G.B., Zhou, J.M., and Tang, X.Y. (2000). The pseudomonas AvrPto protein is differentially recognized by tomato and tobacco and is localized to the plant plasma membrane. Plant Cell 12: 2323 2337. Shan, L.B., He, P., Li, J.M., Heese, A., Peck, S.C., Nurnberger, T., Martin, G.B., and Sheen, J. (2008b). Bacterial effectors target the common signaling partner BAK1 to disrupt multiple MAMP receptor signaling complexes and impede plant immunity. Cell Ho st & Microbe 4: 17 27. Shao, F., Merritt, P.M., Bao, Z.Q., Innes, R.W., and Dixon, J.E. (2002). A Yersinia effector and a pseudomonas avirulence protein define a family of cysteine proteases functioning in bacterial pathogenesis. Cell 109, 575 588. Shao, F., Golstein, C., Ade, J., Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003). Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301: 1230 1233. Shen, Q.H., Saijo, Y., Mauch, S., Biskup, C., Bieri, S., Keller, B., Seki, H., Ulker, B ., Somssich, I.E., and Schulze Lefert, P. (2007). Nuclear activity of MLA immune receptors links isolate specific and basal disease resistance responses. Science 31 5: 1098 1103. Shiu, S.H., and Bleecker, A.B. (2001). Receptor like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proceedings of the National Academy of Sciences of the United States of America 98: 10763 10768.

PAGE 113

113 Shiu, S.H., Karlowski, W.M., Pan, R.S., Tzeng, Y.H., Mayer, K.F.X., and Li, W.H. (2004). Comparative analysis of the receptor like kinase family in Arabidopsis and rice. Plant Cell 16: 1220 1234. Smalle, J., and Vierstra, R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annual Review of Plant Biology 55 : 555 590 Song, W.Y., Wa ng, G.L., Chen, L.L., Kim, H.S., Pi, L.Y., Holsten, T., Gardner, J., Wang, B., Zhai, W.X., Zhu, L.H., Fauquet, C., and Ronald, P. (1995). A receptor kinase like protein encoded by the rice disease resistance gene, Xa 21. Science 270: 1804 1806. Spoel, S.H. Johnson, J.S., and Dong, X. (2007). Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proceedings of the National Academy of Sciences of the United States of America 104: 18842 18847. Spoel, S.H., Koornneef, A., Claessens, S.M.C., Korzelius, J.P., Van Pelt, J.A., Mueller, M.J., Buchala, A.J., Metraux, J.P., Brown, R., Kazan, K., Van Loon, L.C., Dong, X.N., and Pieterse, C.M.J. (2003). NPR1 modulates cross talk between salicylate and jasmonate dependent defense p athways through a novel function in the cytosol. Plant Cell 15: 760 770. Suarez Lopez, P., Wheatley, K., Robson, F., Onouchi, H., Valverde, F., and Coupland, G. (2001). CONSTANS mediates between the circadian clock and the control of flowering in Arabidop sis. Nature 410 : 1116 1120 Sun, L.J., and Chen, Z.J.J. (2004). The novel functions of ubiquitination in signaling Current Opinion in Cell Biology 16 : 119 126 Takemoto, D., Rafiqi, M., Hurley, U., Lawrence, G.J., Bernoux, M., Hardham, A.R., Ellis, J.G. Dodds, P.N., and Jones, D.A. (2012). N terminal motifs in some plant disease resistance proteins function in membrane attachment and contribute to disease resistance Molecular Plant Microbe Interactions 25: 379 392. Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007). MEGA4: m olecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596 1599. Tang, W.Q., Yuan, M., Wang, R.J., Yang, Y.H., Wang, C.M., Oses Prieto, J.A., Kim, T.W., Zhou, H.W., Deng, Z.P., Gampala, S.S., Gendron, J.M., Jonassen, E.M., Lillo, C., DeLong, A., Burlingame, A.L., Sun, Y., and Wang, Z.Y. (2011). PP2A activates brassinosteroid responsive gene expression and plant growth by dephosphorylating BZR1. Nature Cell Biology 13: 124 131

PAGE 114

114 T ang, X.Y., Frederick, R.D., Zhou, J.M., Halterman, D.A., Jia, Y.L., and Martin, G.B. (1996). Initiation of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science 274: 2060 2063. Thieme, F., Szczesny, R., Urban, A., Kirchner, O. Hause, G., and Bonas, U. (2007). New type III effectors from Xanthomonas campestris pv. vesicatoria trigger plant reactions dependent on a conserved N myristoylation motif. Molecular Plant Microbe Interactions 20: 1250 1261. Thompson, J.D., Higgins, D.G ., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice Nucleic Acids Research 22: 4673 4680. Trujillo, M., Ichimura, K., Casais, C., and Shirasu, K. (2008). Negative regulation of PAMP triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis. Current Biology 18 : 1396 1401 van den Burg, H.A., Tsitsigiannis, D.I., Rowland, O., Lo, J., Rallapalli, G., MacLean, D., Takken, F.L.W., and Jones, J.D.G. (2008). The F box protein ACRE189/ACIF1 regulates cell death and defense responses activated during pathogen recognition in tobacco and tomato. Plant Cell 20: 697 719. van der Biezen, E.A., and Jones, J.D.G. (1998). Plant disease resistance proteins and the gene for gene concept. Trends in Biochemical Sciences 23: 454 456. Vierstra, R.D. (2009). The ubiquitin 26S proteasome system at the nexus of plant biology. Nature Reviews Molecular Cell Biology 10 : 385 3 97 Wang, L.F., Tang, X.Y., and He, C.Z. (2007). The bifunctional effector AvrXccC of Xanthomonas campestris pv. campestris requires plasma membrane anchoring for host recognition. Molecular Plant Pathology 8: 491 501. Wang, Y., Li, J., Hou, S., Wang, X. Li, Y., Ren, D., Chen, S., Tang, X., and Zhou, J. M. (2010). A Pseudomonas syringae ADP Ribosyltransferase Inhibits Arabidopsis Mitogen Activated Protein Kinase Kinases. Plant Cell 22: 2033 2044. Wang, Y.S., Pi, L.Y., Chen, X.H., Chakrabarty, P.K., Jian g, J., De Leon, A.L., Liu, G.Z., Li, L.C., Benny, U., Oard, J., Ronald, P.C., and Song, W.Y. (2006). Rice XA21 binding protein 3 is a ubiquitin ligase required for full Xa21 mediated disease resistance. Plant Cell 18: 3635 3646. Weissman, A.M., Shabek, N. and Ciechanover, A. (2011). The predator becomes the prey: regulating the ubiquitin system by ubiquitylation and degradation. Nature Reviews Molecular Cell Biology 12 : 605 620

PAGE 115

115 Willmann, R., Lajunen, H.M., Erbs, G., Newman, M. A., Kolb, D., Tsuda, K., K atagiri, F., Fliegmann, J., Bono, J. J., Cullimore, J.V., Jehle, A.K., Goetz, F., Kulik, A., Molinaro, A., Lipka, V., Gust, A.A., and Nuernberger, T. (2011). Arabidopsis lysin motif proteins LYM1 LYM3 CERK1 mediate bacterial peptidoglycan sensing and immun ity to bacterial infection. Proceedings of the National Academy of Sciences of the United States of America 108: 19824 19829. Wirthmueller, L., Zhang, Y., Jones, J.D.G., and Parker, J.E. (2007). Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1 dependent defense. Current Biology 17: 2023 2029. Wroblewski, T., Tomczak, A., and Michelmore, R. (2005). Optimization of Agrobacterium mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plan t Biotechnology Journal 3: 259 273. Wu, A.J., Andriotis, V.M.E., Durrant, M.C., and Rathjen, J.P. (2004). A patch of surface exposed residues mediates negative regulation of immune signaling by tomato Pto kinase. Plant Cell 16: 2809 2821. Wu, S.J., Lu, D .P., Kabbage, M., Wei, H.L., Swingle, B., Records, A.R., Dickman, M., He, P., and Shan, L.B. (2011). Bact erial e ffector HopF2 suppresses arabidopsis innate immunity at the plasma me mbrane. Molecular Plant Microbe Interactions 24: 585 593. Xiang, T.T., Zon g, N., Zou, Y., Wu, Y., Zhang, J., Xing, W.M., Li, Y., Tang, X.Y., Zhu, L.H., Chai, J.J., and Zhou, J.M. (2008). Pseudomonas syringae effector AvrPto blocks innate immunity by targeting receptor kinases. Current Biology 18: 74 80. Xie, Q., Frugis, G., Col gan, D., and Chua, N.H. (2000). Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes & Development 14 : 3024 3036 Xie, Q., Guo, H.S., Dallman, G., Fang, S.Y., Weissman, A.M., and Chua, N.H. (2002). SINAT5 promotes ubiquitin related degradation of NAC1 to attenuate auxin signals. Nature 419 : 167 170 Xing, W., Zou, Y., Liu, Q., Liu, J., Luo, X., Huang, Q., Chen, S., Zhu, L., Bi, R., Hao, Q., Wu, J. W., Zhou, J. M., and Chai, J. (2007). The structural basis for activation of plant immunity by bacterial effector protein AvrPto. Nature 449: 243 247 Xu, Q., Chen, L.L., Ruan, X.A., Chen, D.J., Zhu, A.D., Chen, C.L., Bertrand, D., Jiao, W.B., Hao, B.H., Lyon, M.P., Chen, J.J., Gao, S., Xing, F., Lan, H., Chang, J.W., Ge, X.H., Lei, Y., Hu, Q., Miao, Y., Wang, L., Xiao, S.X., Biswas, M.K.,

PAGE 116

116 Zeng, W.F., Guo, F., Cao, H.B., Yang, X.M., Xu, X.W., Cheng, Y.J., Xu, J., Liu, J.H., Luo, O.J., Tang, Z.H., Guo, W.W., Kuang, H.H., Zhang, H.Y., Roose, M.L., Nagarajan, N., Den g, X.X., and Ruan, Y.J. (2013). The draft genome of sweet orange (Citrus sinensis). Nature Genetics 45: 59 U92. Xu, X.J., Gookin, T., Jiang, C.Z., and Reid, M. (2007). Genes associated with opening and senescence of Mirabilis jalapa flowers. Journal of Ex perimental Botany 58: 2193 2201. Yamaguchi, K., Yamada, K., Ishikawa, K., Yoshimura, S., Hayashi, N., Uchihashi, K., Ishihama, N., Kishi Kaboshi, M., Takahashi, A., Tsuge, S., Ochiai, H., Tada, Y., Shimamoto, K., Yoshioka, H., and Kawasaki, T. (2013). A r eceptor like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice im munity. Cell host & microbe 13: 347 357. Yamaguchi, Y., Huffaker, A., Bryan, A.C., Tax, F.E., and Ryan, C.A. (2010) PEPR2 is a second recepto r for the Pep1 and Pep2 peptides and contributes to defense responses in Arabidopsis. Plant Cell 22: 508 522. Yang, B., Sugio, A., and White, F.F. (2006a). Os8N3 is a host disease susceptibility gene for bacterial blight of rice Proceedings of the National Academy of Sciences of the United States of America 103: 10503 10508. Yang, C.W., Gonzalez Lamothe, R., Ewan, R.A., Rowland, O., Yoshioka, H., Shenton, M., Ye, H., O'Donnell, E., Jones, J.D.G., and Sadanandom, A. (2006b). The E3 ubiquitin ligase activity of Arabidopsis PLANT U BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18: 1084 1098. Yang, J.P., Lin, R.C., James, S., Hoecker, U., Liu, B.L., Xu, L., Deng, X.W., and Wang H.Y. (2005). Light regulates COP1 mediated degradation of HFR1, a transcription factor essential for light signaling in arabidopsis. Plant Cell 17 : 804 821 Yen, H.L., Ooka, T., Iguchi, A., Hayashi, T., Sugimoto, N., and Tobe, T. (2010). NleC, a Type II I s ecretion p rotease, c ompromises NF kappa B activation by tar geting p65/RelA. Plos Pathogens 6 : e1001231 Yin, Z.C., Chen, J., Zeng, L.R., Goh, M.L., Leung, H., Khush, G.S., and Wang, G.L. (2000). Characterizing rice lesion mimic mutants and identifying a mutant with broad spectrum resistance to rice blast and bacterial blight. Molecular Plant Microbe Interactions 13: 869 876

PAGE 117

117 Yoo, S. D., Cho, Y. H., and Sheen, J. (2007). Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expre ssion analysis. Nature Protocols 2: 1565 1572. Yoshida, S., and Parniske, M. (2005). Regulation of plant symbiosis receptor kinase through serine and threonine phosphorylation. Journal of Biological Chemistry 280: 9203 9209. Yu, I.C., Parker, J., and Ben t, A.F. (1998). Gene for gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proceedings of the National Academy of Sciences of the United States of America 95: 7819 7824. Zeng, L.R., Qu, S.H., Bordeos, A., Yang, C.W., Baraoidan, M., Yan, H.Y., Xie, Q., Nahm, B.H., Leung, H., and Wang, G.L. (2004). Spotted leaf11, a negative regulator of plant cell death and defense, encodes a U box/armadillo repeat protein endowed with E3 ubiquitin ligase activity. Plant Cell 16: 2795 2 808. Zhang, J., Shao, F., Cui, H., Chen, L.J., Li, H.T., Zou, Y., Long, C.Z., Lan, L.F., Chai, J.J., Chen, S., Tang, X.Y., and Zhou, J.M. (2007). A Pseudomonas syringae effector inac tivates MAPKs to suppress PAMP i nduced immunity in plants. Cell Host & Mi crobe 1: 175 185. Zhang, J., Li, W., Xiang, T.T., Liu, Z.X., Laluk, K., Ding, X.J., Zou, Y., Gao, M.H., Zhang, X.J., Chen, S., Mengiste, T., Zhang, Y.L., and Zhou, J.M. (2010). receptor like cytoplasmic kinases integrate signaling from multiple plant immu ne receptors and are targeted by a pseudomonas syringae eff ector. Cell Host & Microbe 7: 290 301. Zhang, X.R., Garreton, V., and Chua, N.H. (2005). The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes & Development 19 : 1532 1543 Zhang, Y., Dorey, S., Swiderski, M., and Jones, J.D.G. (2004). Expression of RPS4 in tobacco induces an AvrRps4 independent HR that requires EDS1, SGT1 and HSP90. Plant Journal 40: 213 224. Zhang, Y.L., Goritschnig, S., Dong, X.N., and Li, X. (2003). A gain of function mutation in a plant disease resistance gene leads to constitutive activation of downstream signal transduction pathways in suppressor of npr1 1, constitutive 1. Plant Cell 15: 2636 2646. Zhao, Y.F., Thilmony, R ., Bender, C.L., Schaller, A., He, S.Y., and Howe, G.A. (2003). Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant Journal 36: 485 499.

PAGE 118

118 Zheng, X. y., Spivey, N .W., Zeng, W., Liu, P. P., Fu, Z.Q., Klessig, D.F., He, S.Y., and Dong, X. (2012). Coronat ine promotes pseudomonas syringae virulence in plants by activating a signaling cascade that inhibits salicylic acid accumu lation. Cell Host & Microbe 11: 587 596. Z immermann, P., Hirsch Hoffmann, M., Hennig, L., and Gruissem, W. (2004). GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology 136: 2621 2632. Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.G., Felix, G., and Boller, T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428: 764 767. Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G. (2006). Perception of the bacterial PAMP EF Tu by the receptor EFR restricts Agrobacterium mediated transformation. Cell 125: 749 760.

PAGE 119

119 BIOGRAPHICAL SKETCH Xiaoe n Huang was born in Fuqing, Fujian in August of 1981 He grew up in Fuqing, Fujian and gra d uated from Fuqing Huaqiao High School in 199 9. After graduation from high school, Xiaoen Huang attended Fujian Agriculture and Forestry University and graduated in June 2003 with a graduation he attended the same university to pursue a master degree major ing in biochemistry and molecular biology. During the graduate study period, he had received training under his advisor Dr. Lianhui Xie. He received his master degree i n biochemistry and molecular biology on June 2006. Following this, he came to the D epa rtment of Plant Pathology, Uni versity of Florida for PhD studies Under Dr. the direction Wenyuan Song Xiaoen Huang completed all required coursework and dissertatio n research in the summer of 2013.