Citation
Effects of Dietary Polyunsaturated Fatty Acids on Lactation Performance, Tissue Gene Expression, and Reproduction in Dairy Cows

Material Information

Title:
Effects of Dietary Polyunsaturated Fatty Acids on Lactation Performance, Tissue Gene Expression, and Reproduction in Dairy Cows
Creator:
Greco, Leandro
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (2 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Animal Molecular and Cellular Biology
Committee Chair:
SANTOS,JOSE EDUARDO
Committee Co-Chair:
THATCHER,WILLIAM W
Committee Members:
HANSEN,PETER J
STAPLES,CHARLES R
Graduation Date:
12/19/2014

Subjects

Subjects / Keywords:
Dairy cattle ( jstor )
Essential fatty acids ( jstor )
Fats ( jstor )
Fatty acids ( jstor )
Luteolysis ( jstor )
Milk ( jstor )
Milk fat ( jstor )
Nonesterified fatty acids ( jstor )
Plasmas ( jstor )
Prostaglandins ( jstor )
Animal Molecular and Cellular Biology -- Dissertations, Academic -- UF
cow -- fat -- nutrition
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Animal Molecular and Cellular Biology thesis, Ph.D.

Notes

Abstract:
The overall objectives of the present dissertation were to investigate the biological effects of fatty acids (FA) in diets fed to lactating dairy cows. Two experiments evaluated the effects of supplementing diets containing low amounts of FA with fat sources of either saturated free FA (SFA) or Ca salts containing essential FA (EFA) during late gestation and early lactation on: performance and energy metabolism (chapter 2); immunity and uterine health (chapter 3); and hepatic FA profile and gene expression (chapter 4). A third experiment evaluated effects of altered ratios of n-6 and n-3 FA (4, 5, or 6 parts of n-6 to 1 part of n-3 FA) in the diet of dairy cows on performance, metabolism, and inflammatory responses after a challenge with lipopolysaccharide (LPS; chapter 5); FA profiles, expression of genes related to endometrial prostaglandin biosynthesis and spontaneous luteolysis (chapter 6). In chapter 2, cows fed no supplemental fat or SFA were in more severe negative linoleic acid balance, and supplementing diets with EFA improved yields of milk and milk components. Chapter 3 demonstrated that feeding dairy cows a low fat diet reduced markers of innate immunity in primiparous cows and those diagnosed with disease. Supplementation with fat overcame some of these effects and reduced the incidence of puerperal metritis. Chapter 4 revealed that dietary FA influenced hepatic FA profile and feeding fat influenced expression of genes associated with hepatic health. Chapter 5 demonstrated that feeding a diet containing a ratio of 4 parts of n-6 to 1 part of n-3 FA increased intake and yields of milk and milk components. Diets containing more n-3 FA attenuated the inflammatory response after an intramammary LPS challenge. Finally, chapter 6 documented that feeding more n-3 FA increased the incorporation of these FA into the endometrial tissue, which downregulated mRNA expression of ERS1, OTR, PGFS, PGES, COX2, and attenuated the amplitude of prostaglandin pulses. Collectively, the studies presented in this dissertation provide new insights on the role of dietary FA on dairy cow production, metabolism, and health. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2014.
Local:
Adviser: SANTOS,JOSE EDUARDO.
Local:
Co-adviser: THATCHER,WILLIAM W.
Statement of Responsibility:
by Leandro Greco.

Record Information

Source Institution:
UFRGP
Rights Management:
Applicable rights reserved.
Resource Identifier:
974372547 ( OCLC )
Classification:
LD1780 2014 ( lcc )

Downloads

This item has the following downloads:


Full Text

PAGE 1

1 EFFECTS OF DIETARY POLYUNSATURATED FATTY ACIDS ON LACTATION PERFORMANCE, TISSUE GENE EXPRESSION, AND REPRODUCTION IN DAIRY COWS By LEANDRO FERREIRA GRECO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 201 4

PAGE 2

2 © 2014 Leandro Ferreira Greco

PAGE 3

3 In memory of my parents, for their endless support and love

PAGE 4

4 ACKNOWLEDGMENTS First of all I thank God f or all the blessings I have been receiv ing during my entire life, for all the strength needed and for always keeping me on the right path. I would like to express my profound gratitude to my major pro fessor, Dr. Jos é E duardo P. Santos. I am very grateful for the opportunity of pursuing my PhD degree under his guidance. The interaction we had along these years of my graduate program allow ed me to grow as a scientist . I admire his passion for science and his standards of high quality work . Finally, I would like to thank him for all the financial support he provided me with, which not only supported all my studies at U niversity of F lorida , but also covered my tuition and paid for my stay in the U nited S tat es at the end of my program . I am proud to be part of his team . I would like to extend gratefulness to my supervisory committee , Drs. Peter Hansen, William Thatcher, and Charles Staples for all the ideas, discussions and help conducting my experiments. It was a pleasure to work with Dr. Staples for all his guidance, wisdom, advices, and willingness to help . I am also really proud to have work ed with one of the most recogni zed reproductive physiologist, Dr. William Thatcher , who alwa ys impresse d and stimulate d me with his endless hunger for learning. I am very thankful for his revisions and edits to this dissertation. I would like to thank other faculty members who directly or indirectly contributed to my education at the University of Florida . Dr s . Lokenga Badinga and Geoffrey D a h l for allowing me to use their laborator ies every time I needed; Dr. Sally Williams , who is one o f the kindest person I ever met. S he and her students helped me with the bacterial identification in my first study; Dr. Joel Yelich who helped me with the progesterone assays; Dr s . Alan Ealy and S ally Johnson for the discussions we ha d and the advices she gave me about molecular biology, sample preparations and assays.

PAGE 5

5 even have words to express my grat i t ude to my lab mates Achil l es Vieira Neto , Dan Wang , Eduardo Ribeiro, Fábio Lima, Gabriel Gomes, Jae Shin, Letícia Sinedino, Marcos Zenobi, Milerky Perdomo, Miriam Garcia, Nat a lia Martinez Pati ñ o, and Rafael Bisinotto . We were a great team, and without them my I would not have this dissertation completed . I also would like to thank students from other laboratories which gave their contribution to for this work : Izabella Thompson , Sha Tao, Oscar Queiroz, Aline and L uci ano Bonilla, Lilian Oliveira, B árbara Lou reiro and Belen Rabaglino . I would like to extend my acknowledgments to all interns and visiting students who visited our lab and provided us with their hard work and friendship, especially Rafael Marsola, Maurício Favoreto, Leonardo Martins, Henderson Ayr es, Mariana Carvalho, Pedro Costa, Rodolfo Peixoto, Pedro Bueno, Lucas Barbosa, Bianca Libanori, Erika Ganda, José Tiago Neto, Angélica Pedrico, and Rodrigo Ferrazza. I would like to express my gratitude for the staff of the Department of Animal Sciences o f the University of Florida for all their help and friendship , e specially Sabrina Rob in son, Jan Kivipelto, Joyce Hayen, Joann Fis c her ( in mem ori a m ) , Glenda Tuc ker , Debra Sykes, Shirley Levi , and Renee Parks Jame s . I owe very special thanks to Dr. Sergei Se n n ikov for all his friendship and help either in the farm, collecting milk samples, transporting blood samples to the lab oratory , and helping me with lab oratory procedures. I would like to thank the staff from the Dairy Unit at University of Florida, namel y Eric Diepersloot and the parlor staff Grady Byers, Pat ty Best, and Jeff Tomilson; James Dunn and the feeding staff Carl Sapp and Shane Langford; Jerry Langford and Molly Gleason of the field staff ; Thomas Orton and Jesse Hooten of the maintenance staff ; Sherry Hay and the calf unit staff Nicole and Latasha Williams for all their help with my experiments, taking care of the cows and providing whatever w as needed to conduct my research.

PAGE 6

6 I would like to thank Dr. Elliot Block, from Church & Dwight Co. I nc . a nd Dr. Kevin Murphy, from Virtus Nutrition LLC for the discussions on the role of fatty acids on dairy cow metabolism and for the financial support for my studies. I would like to thank Rafael for the friendship and for be ing there when I most needed and f or be ing an excellent lab mate and roommate. I also thank Fábio, Eduardo , Izabella , Oscar , Gabriel and Miriam for be ing people that I could count on anytime. Those friends who would go with me to grab a coffee after lunch, that would be available for me to call in the middle of the night when a cow calved in the dairy and I did not have enough help or were there for me when I just wanted to talk because I w as home sick. Finally I would like to thank my family. I cannot express in words how grateful I am to m y mom, Marlene ( in memori a m ), for her endless love, support and friendship. Without her I would not be able to come to the U nited S tates to pursue my PhD studies . I also would like to thank my brothers Frederico and Júnior for their friendship . Mostly impo rtant , I would like to thank them f o r taking care of my mom and for giv ing me the strength to continue my career. Last but not least I thank my niece, Júlia, and my nephew s João Pedro and Antonio , for all the happiness they brought to our home.

PAGE 7

7 TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................ ................................ ................................ ............... 4 LIST OF TABLES ................................ ................................ ................................ ......................... 11 LIST OF FIGURES ................................ ................................ ................................ ....................... 14 LIST OF ABBREVIATIONS ................................ ................................ ................................ ........ 16 ABSTRACT ................................ ................................ ................................ ................................ ... 21 1 REVIEW OF LITERATURE ................................ ................................ ................................ . 23 Overview of the Long Chain Fatty Acid Metabolism ................................ ............................ 23 Structure ................................ ................................ ................................ .......................... 23 Ruminal Metabolism ................................ ................................ ................................ ....... 26 Digestion and Absorption ................................ ................................ ................................ 29 Feeding Long Chain Fatty Acid s to Dairy Cows: Lactational Performance .......................... 3 1 Effects on Milk Production ................................ ................................ ............................. 31 Effects on Milk Composition ................................ ................................ .......................... 33 Effects on Energy Balance ................................ ................................ .............................. 34 Feeding Long Chain Fatty Ac ids to Dairy Cows: Reproductive Performance ...................... 35 Effects on the Ovaries ................................ ................................ ................................ ..... 35 Effects on Embryo and Pregnancy ................................ ................................ .................. 37 The Role of Fatty Acids on Immunity and Inflammation ................................ ...................... 38 The Inflammation Process A Brief Overview ................................ ............................... 38 Beyond the Prostaglandins ................................ ................................ .............................. 39 The Anti and Pro Inflammatory Effects of Prostaglandins and Other Intermediates .... 41 The Role of Fatty Acids on Gene Expression ................................ ................................ ........ 43 The Splanchnic Axis ................................ ................................ ................................ ........ 43 The Reproductive Axis ................................ ................................ ................................ .... 45 2 EFFECTS OF FATTY ACID SUPPLEMENTATION ON PERFORMANCE OF PERIPARTURIENT DAIRY COWS ................................ ................................ ..................... 53 Introduction ................................ ................................ ................................ ............................. 54 Materials and Methods ................................ ................................ ................................ ........... 56 Experiment 1 ................................ ................................ ................................ ................... 57 Study design, animals, housing and feeding ................................ ............................ 57 Measurements of milk and yield and concentrations of milk components .............. 58 Body weight, body condition s core, energy balance, and feed efficiency ............... 58 Blood sampling and analyses ................................ ................................ ................... 59 Fatty acid analysis of plasma, milk fat, and fat supplements ................................ ... 60 Experiment 2 ................................ ................................ ................................ ................... 61 Study design, animals, housing and feeding ................................ ............................ 61

PAGE 8

8 Measurements of milk and milk components ................................ .......................... 61 Body weight, body condition score, energy balance, and feed efficiency ............... 62 Fatty acid analysis of milk fat and plasma ................................ ............................... 62 Linolenic Acid Absorption, Secretion and Balance ................................ 63 Statistical Analyses ................................ ................................ ................................ .......... 64 Results ................................ ................................ ................................ ................................ ..... 65 Experiment 1 ................................ ................................ ................................ ................... 65 Prepartum DM intake, body weight and body condition ................................ ......... 65 Postpartum DM intake, body weight and body condition ................................ ........ 65 Milk production and composition and feed efficiency ................................ ............. 66 Fatty acid profile of milk and plasma ................................ ................................ ....... 67 Plasma metabolites and hormones ................................ ................................ ........... 69 linolenic acid absorption, secretion, and balance ............................ 70 Experiment 2 ................................ ................................ ................................ ................... 70 Lactational performance ................................ ................................ ........................... 70 Fatty acid profile of milk and plasma ................................ ................................ ....... 71 Linoleic and linolenic acids absorption, secretion and balance ............................... 72 Discussion ................................ ................................ ................................ ............................... 73 Conclusion ................................ ................................ ................................ .............................. 80 3 EFFECTS OF FATTY ACID SUPPLEMENTATION TO PERIPARTURIENT DAIRY COW ON UTERINE HEALTH AND IMMUNE COMPETENCE EARLY POSTPARTUM ................................ ................................ ................................ .................... 102 Introduction ................................ ................................ ................................ ........................... 103 Materials and Methods ................................ ................................ ................................ ......... 105 Study Design, Animals, Housing and Feeding ................................ .............................. 105 Immune Competence Markers ................................ ................................ ...................... 106 Acute phase proteins and prostaglandin F metabolite ................................ ............ 106 Neutrophil adhesion molecules, phagocytosis, and oxidative burst ....................... 107 Peripheral blood mononuclear cells isolation and cytokine production ................ 108 Antibody response against ovalbumin immunization ................................ ............ 109 Uterine Health and Postpartum Ovarian Activity ................................ ......................... 111 Uterine diseases ................................ ................................ ................................ ...... 111 Postpartum uterine involution ................................ ................................ ................ 112 Postpartum ovarian cycl icity and synchronization for first AI .............................. 113 Statistical Analysis ................................ ................................ ................................ ........ 114 Results ................................ ................................ ................................ ................................ ... 115 Markers of Immune Response ................................ ................................ ....................... 115 Uterine Involution and Health ................................ ................................ ....................... 117 Ovarian Responses and Pregnancy ................................ ................................ ................ 118 Discussion ................................ ................................ ................................ ............................. 118 Conclusion ................................ ................................ ................................ ............................ 123 4 EFFECTS OF FATTY ACID SUPPLEMENTATION ON HEPATIC FATTY ACID PROFILE AND GENE EXPRESSION IN PERIPARTURIENT DAIRY COWS .............. 137

PAGE 9

9 Introduction ................................ ................................ ................................ ........................... 138 Materials and Methods ................................ ................................ ................................ ......... 139 Study Design, Animals, Housing and Feeding ................................ .............................. 140 Hepatic Tissue Collection for Biopsy ................................ ................................ ............ 141 Hepatic Tissue Fa tty Acid Profile and RNA Isolation ................................ .................. 142 Affymetrix Array Hybridization, Washing, Staining and Scanning ............................. 143 Statistical Analyses ................................ ................................ ................................ ........ 143 Affymetrix Array Data Analysis ................................ ................................ ................... 144 Results ................................ ................................ ................................ ................................ ... 145 Performance on the First 14 d Postpartum ................................ ................................ .... 145 Gene Expression ................................ ................................ ................................ ............ 146 Pathway Analysis ................................ ................................ ................................ .......... 147 Discussion ................................ ................................ ................................ ............................. 148 Performance and Metabolic Responses ................................ ................................ ......... 148 Hepatic Gene Expr ession ................................ ................................ .............................. 150 Conclusion ................................ ................................ ................................ ............................ 154 5 EFFECTS OF ALTERING THE RATIO OF DIETARY n 6 TO n 3 FATTY ACIDS ON PERFORMANCE AND INFLAMMATORY RESPONSES TO A LIPOPOLYSACCHARIDE CHALLENGE IN LACTATING HOLSTEIN COWS .......... 167 Introduction ................................ ................................ ................................ ........................... 168 M aterials and Methods ................................ ................................ ................................ ......... 170 Study Design, Animals, Housing and Feeding ................................ .............................. 170 Measurements of Milk and Milk Components ................................ .............................. 171 Body Weight, Body Condition Score, Energy Balance, and Feed Efficiency .............. 172 Blood Metabolites and Hormones ................................ ................................ ................. 172 Diet and Ingredient Sampling and Chemical Analyses ................................ ................. 173 Blood and Milk Sampling and Fatty Acid Analyses of Plasma, Milk, and Diets ......... 174 Acute Phase Responses to a Lipopolysaccharide Challenge ................................ ......... 175 Statistical Analysis ................................ ................................ ................................ ........ 176 Results ................................ ................................ ................................ ................................ ... 177 Dry Matter Intake, Body Weight, and Body Condition ................................ ................ 177 Milk Production and Composition, Energy Balance, and Feed Efficiency ................... 178 Metabolic and Hormonal Responses ................................ ................................ ............. 178 Fatty Acid Profile of Plasma and Milk ................................ ................................ .......... 179 Intramammary Lipopolysaccharide Challenge ................................ .............................. 180 Discussion ................................ ................................ ................................ ............................. 181 Conclusion ................................ ................................ ................................ ............................ 187 6 EFFECTS OF ALTERING THE RATIO OF DIETARY n 6 TO n 3 FATTY ACIDS ON SPONTANEOUS LUTEOLYSIS IN DAIRY COWS ................................ .................. 2 02 Introduction ................................ ................................ ................................ ........................... 203 Materials and Methods ................................ ................................ ................................ ......... 205 Study Design, Animals, Housing and Feeding ................................ .............................. 205 Estrous Cyc le Synchronization to Characterize Spontaneous Luteolysis ..................... 206

PAGE 10

10 Progesterone Clearance After an Injection of PGF ................................ .................... 206 Pharmacologically Induced Luteolysis ................................ ................................ .......... 207 Spontaneous Luteolysis and Endogenous Release of PGF Based on PGFM ............. 207 Estrous Cycle Synchronization for Endometrial Tissue Collection for Biopsy ............ 209 Endometrium Fatty Acid Profile and Ge ne Expression ................................ ................ 210 Calculations ................................ ................................ ................................ ................... 211 Statistical Analysis ................................ ................................ ................................ ........ 212 Results ................................ ................................ ................................ ................................ ... 213 Concentrations of PGFM after PGF Injection ................................ ............................ 214 Progesterone Clearance after PGF Injection ................................ ............................... 214 Luteolysis and Endogenous Release of PGFM ................................ ............................. 214 Endometrium Fatty Acid Profile and Gene Expression ................................ ................ 216 Dis cussion ................................ ................................ ................................ ............................. 218 Conclusion ................................ ................................ ................................ ............................ 223 7 SUMMARY AND GENERAL CONCLUSIONS ................................ ............................... 242 LIST OF REFERENCES ................................ ................................ ................................ ............. 247 BIOGRAPHICAL SKETCH ................................ ................................ ................................ ....... 270

PAGE 11

11 LIST OF TABLES Table page 2 1 Fatty acid (F A) profile of fat supplements (% of identified fatty acids) ........................... 81 2 2 Ingredient and chemical composition of experimental diets during pre and postpartum periods fed to cows receiving no fat supp lement (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 ................................ ................................ ................................ ...................... 82 2 3 Ingredient and chemical composition of experimental diets fed postpartum to cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 2 ................................ .... 84 2 4 Dry matter (DM) intake, milk production and composition and feed conversion ratio, energy balance, body weight (BW), BW change, and body condition score of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 ................................ ................................ ................................ ...................... 86 2 5 Milk fatty acid profile of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty aci ds (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 ................................ ................................ ...................... 87 2 6 Plasma fatty acid profile of lactating Holstein cows receiving no fat supplementation (control), saturated fre e fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 ................................ ................................ ................................ ........ 89 2 7 Plasma concentrations of noneste OH butyric acid, glucose, urea nitrogen, insulin like growth factor 1 (IGF 1), and insulin of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essentia l fatty acids (EFA) Experiment 1 ................................ ... 90 2 8 linolenic acids intestinal absorption, milk secretion, and balance of lactating Holstein cows receiving no fat supplementatio n (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiments 1 and 2 ................................ ................................ ................................ ........... 91 3 1 Ingredient and chemical composition of experimental diets during pre and postpartum periods fed to cows receiving no fat supplement (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) ....... 125 3 2 Paramet ers of immune competence of periparturient Holstein cows receiving no fat supplementation (control), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) ................................ ................................ ............................... 127

PAGE 12

12 3 3 Uterine health, incidence of mastitis, morbidity of periparturient Holstein cows receiving no fat supplementation (control), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) ................................ ................................ ..... 128 3 4 Ovarian responses during the first 40 DIM of periparturient Holstein cows receiving no fat supplementation (control), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) ................................ ................................ ............. 129 4 1 Parameters of lactation performance and blood metabolites and hormones of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essent ial fatty acids (EFA) ...................... 155 4 2 Liver fatty acid profile of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing ess ential fatty acids (EFA) ................................ ................................ ................................ .............. 157 4 3 Number of differentially expressed genes on hepatic tissue of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty ac ids (SFA), or Ca salts containing essential fatty acids (EFA) ................................ ........................... 159 4 4 List of the identified genes with respective names ................................ .......................... 160 4 5 L east squares means (± SEM) abundance expression of selected genes on hepatic tissue of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) ....... 161 5 1 Dietary ingredients and nutrient composition of diets ................................ ..................... 189 5 2 Fatty acid composition of diets (mean ±SD) ................................ ................................ ... 191 5 3 Effect of altering the dietary ratio of n 6 to n 3 fatty acids on intake, lactation performance, and energy balance ................................ ................................ .................... 192 5 4 Effect of altering the r atio of dietary n 6 to n 3 fatty acids (FA) on plasma FA profile . 193 5 5 Effect of altering the ratio of dietary n 6 to n 3 fatty acids (FA) on milk FA profile ..... 194 5 6 Body temperature, plasma concentrations of hormones, metabolites, cytokines, and acute phase proteins, and blood neutrophil activity of lactating Holstein cows receiving diets varying in the ratio of n 6 to n 3 fatty a cids after an intra mammary challenge with lipopolysaccharide ................................ ................................ ................... 196 6 1 Dietary ingredients and nutrient composition of diets ................................ ..................... 225 6 2 List of genes and primers used on real time PCR analysis ................................ .............. 227 6 3 Effect of altering the ratio of dietary n 6 to n 3 fatty acids on timing of luteolysis and PGFM concentrations and pulses of l actating Holstein cows ................................ .......... 229

PAGE 13

13 6 4 Measures of reliability of number of 13,14 dihydro 15 keto PGF (PGFM) pulses to elicit luteal regression ................................ ................................ ................................ .. 230 6 5 Effect of altering the ratio of dietary n 6 to n 3 fatty acids on endometrium fatty acid profile of lactating Holstein cows on day 8 of the estrous cycle ................................ ..... 231

PAGE 14

14 LIST OF FIGURES Figure page 1 1 Overview of the structure of four different 18 carbon fatty acids ................................ ..... 49 1 2 Biosynthesis of long chain polyunsaturated fatty acids in ma mmals ................................ 50 1 3 Overview of the mechanisms in which fatty acid can alter inflammatory cell funct ion ... 51 1 4 Biosynthetic pathway of ac tive lipid mediators ................................ ................................ . 52 2 1 Milk production of lactating Holstein cows ................................ ................................ ....... 96 2 2 Concentrations of nonesterified fatty acids in plasm a of lactating Holstein cows ............ 97 2 3 hydrox ybutyric acid in plasma of lactating Holstein cows ............... 98 2 4 Linoleic a cid balance of lactating Holstein cows ................................ .............................. 99 2 5 Linolenic acid balance of lactating Holstein cows ................................ .......................... 100 2 6 Fat corrected milk yield o f lactating Holstein cows ................................ ........................ 101 3 1 Concentrations of acid soluble protein and haptoglobin in plasma of Holstein cows ..... 130 3 2 Leukoc yte concentration , lymphocyte percentage , and neutrophil percentage in blood of lactating Holstein cows ................................ ................................ ................................ 132 3 3 Proportions of neutrophils of cows fed no supplemental fat (control), saturated f ree fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) expressing L Selectin according to parity or disease integrin according to parity or disease , or undergoing phagocytosis and oxidative burst according t o parity or disease ................................ ................................ ................................ .............................. 133 3 4 Immunoglobulin G titer in response to ovalbumin immunization of Holstein cows ....... 134 3 5 Concentr ations of 13,14 dihydro 15 keto PGF in plasma, diame ter of the previously pregnant and contralateral uterine horn of lactating Holstein cows ............... 135 3 6 Cumulative concentrations of progesterone according to day postpartum in cows that ovulated or remained anovular by 40 DIM ................................ ................................ ...... 136 4 1 Dry matter intake , milk yield, and plasmatic concentrations of prostaglandin F metabolite of lactating Holstein cows ................................ ................................ .............. 163 4 2 Impact of differentially expressed genes between primiparous and multiparous cows ... 164 4 3 Pathways identified by the Dynamic Impact Approach in lactating Holstein cows ........ 165

PAGE 15

15 4 4 Pathways identified by the Dynamic Impact Approach in lactating Holstein cows ........ 166 5 1 Dry matter intake, 3.5% fat corrected milk, feed conversion ratio of kg of 3.5% FCM/kg of DMI, energy balance, body condition score, and body weight of lactating Holstein cows ................................ ................................ ................................ ................... 197 5 2 Concentr ations of glucose, urea N, nonesterified fatty acids, beta hydroxybutyrate, insulin, and insulin like growth factor 1 in plasma of lactating Holstein co ws ............. 198 5 3 Somatic cell count in milk, and co ncentrations of insulin, haptoglobin, and interleukin 6 in plasma, dry matter intake, and milk yield of lactating Holstein cows ... 200 6 1 Diagram of estrous cycle synchronization and blood sampli ng ................................ ...... 232 6 2 Concentrations of progesterone and 13,14,dihydro 15 keto PGF metabolite (PGFM) in plasma of non lactating, non pregnant Holsteins cows bearing a functional corpus luteum ................................ ................................ ................................ .. 233 6 3 Progesterone concentrations in plasma of lactating Holstein cows ................................ . 234 6 4 Progesterone and 13,14,dihydro 15 keto PGF metabolite in plasma from d 16 to 23 of the estrous cycle of a representative cow t hat underwent luteolysis and a cow that maintained the corpus luteum by day 23 ................................ ................................ ......... 235 6 5 Concentration s of 13,14,dihydro 15 keto PGF metabolite in plasma of lactating Holstein cows ................................ ................................ ................................ ................... 236 6 6 Concentrations of progesterone in plasma of lactating Holstein cows ............................ 238 6 7 Expression of genes related to prostaglandin synthesis; cholesterol and fatty acid metabolism; and somatotropic axis in the endometrium of lactating Holstein cows ...... 239 6 8 Expression of selected genes according to the concentration of n 6 to n 3 fatty acids in the endometrium of dairy cows ................................ ................................ ................... 240 6 9 Regression analyses between expression of selected genes and the ratio of n 6 to n 3 fatty acids in the endometrium of dairy cows ................................ ................................ .. 241

PAGE 16

16 LIST OF ABBREVIATIONS AA Arachidonic acid ACC Acetyl CoA carboxylase ACE2 Angiotensin I converting enzyme (peptidyl dipeptidase A) 2 ACSS2 Acyl CoA synthetase sho rt chain family member 2 ADF Acid detergent fiber AI Artificial insemination ALA linolenic acid APO Apolipoproteins ASP Acid soluble protein BACE2 Beta site APP cleaving enzyme 2 BC S Body condition score BOLA DQA5 Major histocompatibility complex, class II, DQ alpha 5 BOLA DQB Major histocompatibility complex, class II, DQ beta BW Bo dy weight C20H5orf49 Chromosome 20 open reading frame, human C5orf49 C8H9orf152 Chromosome 8 open reading frame, human C9orf152 CD18 integrin, adhesion molecule CD62L L selectin, adhesion molecule CDHR5 Cadherin related family member 5 CLA Conjugated lin oleic acid CLEC2D C type lectin domain family 2, member D COX Cyclooxygenase enzymes CYP Cytochrome P450 DEG Differentially expressed genes

PAGE 17

17 DHA Docosahexaenoic acid DIA Dynamic impact approach DM Dry matter DMI Dry matter intake DPA Docosapentaenoic acid E DNRA Endothelin receptor type A EFA Essential fatty acids EPA Eicosapentaenoic acid FA Fatty acid FABP Fatty acid binding protein FADS2 Fatty acid desaturase 2 FAME Fatty acid methyl esters FASN Fatty acid synthase FATP Fatty acid transport protein FC Fold change FE Feed efficiency (production/intake) FO Fish oil FOXA3 Forkhead box A3 GCLC Glutamate cysteine ligase, catalytic subunit GGT1 Gamma glutamyltransferase 1 GIMAP7 GTPase, IMAP family member 7 GLA linolenic acid GPNMB Glycoprotein (transmembrane) nmb GPX3 Glutathione peroxidase 3 (plasma) HAPLN3 Hyaluronan and proteoglycan link protein 3

PAGE 18

18 HNF Hp Haptoglobin IFN Interferon gamma Ig Immunoglobulin IGF Insulin like growth factor IGFBP IGF binding protein IL Interleukin KDE LR3 Endoplasmic reticulum protein retention receptor 3 KEGG Kyoto encyclopedia of genes and genomes KIF23 Kinesin family member 23 LA Linoleic acid LCFA Long chain fatty acids LOC505468 Cytochrome P450 family 2 subfamily C polypeptide 18 like LOC527068 Al do keto reductase family 1 member C3 like LPS Lipopolysaccharide LT Leucotriene LXR Liver X receptor MBOAT2 Membrane bound O acyltransferase domain containing 2 MCFA Medium chain fatty acids MHC Major histocompatibility complex MUFA Monounsaturated fatty acids MYC V myc myelocytomatosis viral oncogene homolog (avian) n 3 Omega 3 fatty acids n 6 Omega 6 fatty acids n 9 Omega 9 fatty acids

PAGE 19

19 NDF Neutral detergent fiber NEFA Nonesterified fatty acids NPV Negative predictive value NRC The National Research Council NT5C 5', 3' nucleotidase, cytosolic PBMC Peripheral b lood mononuclear cells PDZK1IP1 PDZK1 interacting protein 1 PG Prostaglandin PIM1 Pim 1 oncogene PLEK Pleckstrin PPAR Peroxisome proliferator receptor PPP1R3B Protein phosphatas e 1, regulatory subunit 3B PPP1R3C Protein phosphatase 1, regulatory subunit 3C PPV Positive predictive value PSPH Phosphoserine phosphatase PUFA Polyunsaturated fatty acids Rv Resolvin SCD Stearoyl coa desaturase (delta 9 desaturase) Se Sensitivity SFA Sa turated fatty acids SLC17A9 Solute carrier family 17, member 9 Sp Specificity SREBP Sterol regulatory element binding protein TESC Tescalcin

PAGE 20

20 Th T helper cell TNF Tumor necrosis factor alpha VFA Volatile fatty acids WFS1 Wolfram syndrome 1 (wolframin)

PAGE 21

21 Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECTS OF DIETARY POLYUNSATURATED FATTY ACIDS ON LACTATION PERFORMA NCE, TISSUE GENE EXPRESSION, AND REPRODUCTION IN DAIRY COWS By Leandro Ferreira Greco D ecember 201 4 Chair: José E. P. Santos Major: Animal Molecular and Cellular Biology The overall objectives of the present dissertation were to investigate the biologic al effects of fatty acids (FA) in diets fed to lactating dairy cows. Two experiments evaluated the effects of supplementing diets containing low amounts of FA with fat sources of either saturated free FA (SFA) or Ca salts containing essential FA (EFA) duri ng late gestation and early lactation on: performance and energy metabolism (C hapter 2) ; immunity and uterine health (C hapter 3); and hepatic F A profile and gene expression (C hapter 4). A third experiment evaluated effects of altered ratios of n 6 and n 3 FA ( 4 , 5 , or 6 parts of n 6 to 1 part of n 3 FA) in the diet of dairy cows on performance, metaboli sm , and inflammatory responses after a challenge with lipopolysaccharide (LPS; C hapter 5); FA profiles, expression of genes related to endometrial prostaglan din biosynthes is and spontaneous luteolysis (C hapter 6). In C hapter 2 , c ows fed no supplemental fat or SFA were in more severe negative linoleic acid balance, and s upplementing diets with E FA improved yields of milk and milk components . C hapter 3 demonst rated that feeding dairy cows a low fat diet reduced markers of innate immun ity in primiparous cows and those diagnosed with disease. Supplementation with fat overcame some of these effects and reduced the incidence of puerperal metritis. Chapter 4

PAGE 22

22 reveale d that dietary FA influence d hepatic FA profile and feeding fat influenced expression of genes associated with hepatic health. Chapter 5 demonstrated that feeding a diet containing a ratio of 4 parts of n 6 to 1 part of n 3 FA increased intake and yields o f milk and milk components . Diets containing more n 3 FA attenuated the inflammatory response after an intramammary LPS challenge. Finally, C hapter 6 documented that f eeding more n 3 FA increased the incorporation of these FA into the endometrial tissue, which downregulated mRNA expression of ERS1, OTR, PGFS, PGES , COX2 , and attenuated the amplitude of prostaglandin pulses. Collectively, the studies presented in th is dissertation provide new insights on the role of dietary FA on dairy cow production, metab olism, and health.

PAGE 23

23 CHAPTER 1 REVIEW OF LITERATURE Overview of the Long Chain Fatty Acid Metabolism Structure Fatty acids (FA) are compounds containing a hydrocarbon chain with a carboxylic acid and a methyl group at each end of the acyl chain. As amino acids are the building blocks to form proteins, the FA exert a similar function in the composition of complex lipids (Fahy et al., 2005; Nelson and Cox, 2008). F atty acids can be classified according to the acyl chain length , also known as the aliphatic t ails, carbons, C), medium (8 to 1 4 6 C). The link between carbon atoms confers another classification for FA: as saturated, with no double bonds between carbon atoms; monounsaturated, one double bond present in the acyl chain; and polyunsaturated FA (PUFA), when two or more double bonds are present linking carbon atoms. Unsaturated FA are also classified according to the location of the first double bond relative to the methyl end of the acyl chain, the latter being calle d the omega carbon. Although counting the carbon number in the acyl chain starts from the carboxyl to the methyl group, t he carbon atom where the first double bond appears relative to the omega carbon (methyl end) determines the family as omega 3 (n 3), 6 (n 6), or 9 (n 9; Holman, 1964; Figure 1 1 ). Therefore, if the first double bound is between the 3 rd and 4 th carbon s from the methyl end, the FA will be classified as an n 3 FA (Nelson and Cox, 2008), as depicted on Figure 1 1 , an example of four different 18 C FA with the different nominations. Fatty acids are also classified according to the configuration of the double bond based on the location of the H in the acyl chain as cis or trans . Cis FA, which is the native form, have the H in the same side o f the acyl chain on a double bond, whereas the trans isomers, which are produced during the process of hydrogenation, have the H

PAGE 24

24 located in opposite sides of the acyl chain on a double bond. The process of production of trans isomers is catalyzed by enzymes called isomerases. was discovered that some FA are essential for function of the mammalian organisms. McAmis et al. (1929) demonstrated that rats fed a fat free diet had growth compromised and presented health issues such as kidney and eye problems. These negative effects were rever sed when the rats were supplemented with cod liver extract and/or peanut oil. In fact, the best growth rates were observed w hen the diet was supplemented with both cod liver extract and peanut oil. The authors attributed these negatives responses of the rats fed a fat free diet only to a lack of vitamin A in the diet (McAmis et al., 1929). Burr and Burr (1929) isolated the vita min A effect in a fat free free diet had retarded growth, skin and kidney diseases, females stopped ovulating, and males decreased drastically the matting activity. Those negative effects wer e reversed when the diet was supplemented with either pure isolated linoleic acid (LA; C18:2 n 6 ) or other oils which contained LA in their composition (Burr saturated F A, clearly indicating that some specific FA are essential for animals and not only fat per se. Alpha l inolenic acid (ALA; C18:3 n 3 free diet (Burr et al. , 19 32). The essentiality of the FA was later demonstrated in other species. The rationale for the essentiality of some FA such as LA and ALA is because they cannot be synthetized by some organisms. The analysis of 397 genomes (Hashimoto et al., 2006) demonstr ated the lack of the Delta 12 and 15 desaturase enzymes because of absence of the respective genes, and FAD in the mammalian genome. In addition to mammals, birds,

PAGE 25

25 amphibians, fish, and some species of insects, fungi and protists also do not have t he gene that encodes for those desaturase enzymes . In fact, mammalian cells only possess desaturase enzymes up to carbon number 9 in the acyl chain, counting from the carboxyl end. The function of these enzymes is to remove two hydrogen atoms from the acyl chain, placing a double bond instead. For instance, the n 6 FA LA can be found in a variety of plant material, specially the seeds of soybeans, cottonseeds, sunflower and corn. Linolenic acid, however, is present on green leafs and linseed. Another import ant source n 3 FA are the fish products, especially fish meal and oil, which are rich in longer chain n 3 FA eicosapentaenoic acid (EPA; C20:5 n 3 ) and docosahexaenoic acid (DHA; C22:6 n 3 ). Even though LA and ALA are the truly essential FA, the most biologi cally active FA are the longer chain arachidonic acid (AA; C20:4 n 6 ), EPA and DHA. Arachidonic acid can be formed through elongation and desaturation processes from LA, similarly EPA and DHA can be formed from ALA. The elongation and desaturation process es require the activity of several enzymes (Figure 1 2; Leonard et al., 2004). Each of the elongation step s , with addition of two carbon atoms, requires four enzymatic reactions. The first reaction is the condensation of an acyl CoA molecule and malonyl CoA, r ketoacyl CoA, followed by a reduction, which requires ketoacyl hydroxyacyl CoA. The third step is a dehydration in which hydroxyacyl CoA is converted to enoyl CoA. Lastly, enoyl reductase red uces enoyl CoA, completing the cycle of the extending the acyl chain (Cinti, et al., 1992; Leonard et al., 2004; Jakobsson et al . , 2006). In mammals the elongation machinery for FA with 18 carbons or more is regulated by genes belonging to the elongase fam ily; ELOVL1 ( FA elongase) , ELOVL2 , ELOVL3 , ELOVL4 , ELOVL5 , and ELOVL6 . Each of th ese gene s encode proteins responsible for elongation of specific FA, and they are clustered by the chain length, and

PAGE 26

26 degree of saturation (Leonard et al., 2004; Jakobsson et al ., 2006). In addition to elongation , another important process is the desaturation of FA. Delta 6 and delta 5 desa t urases are the two enzymes responsible for inclusion of double bounds in the acyl chain of PUFA (Sprecher 2000; Guillou et al., 2010). The de saturation of LA and ALA by delta 6 desaturase (Figure 1 2) is the rate limiting reaction in the process of PUFA biosynthesis (Bernert et al., 1975), and the same enzyme is responsible for the desaturation of the 24 carbon FA, resulting in a competition amon g FA for this enzyme (Geiger et al., 1993). The 20 carbon FA of both n 3 and n 6 families are desaturated by the delta 5 desaturase (Sprecher, 2000). Delta 5 and 6 desaturases are encoded by FADS1 and 2 genes, respectively. The conversion of 18 C PUFA to l onger chain FA are greater in women than in men (Burdge, 2006). In females, the expression of the desaturases genes, particularly the FADS2, is up regulated by sex hormones. In both rat and human tissues , progesterone seems to be the most potent sex hormon e capable of up regulation of FA desaturases genes (Childs et al., 2012; Sibbons et al., 2014). Even though this entire process of FA elongation has been well characterized, it appears that the extent in which LA and ALA are converted to the longer chain i s limited in humans (Burdge, 2006). Utilizing 13 C ALA, Burdge et al. (2003) demonstrated that only small portion of dietary ALA is be converted to EPA, docosapent a enoic ( DPA ; C22:5 n 3 ) , and DHA (2.80, 1.20, and 0.04 %, respectively). Therefore, i t is sugge sted that longer chain PUFA should also be supplemented in the diet (Burdge et al., 2006) . Ruminal Metabolism Forage and grains are the major components of a ruminant diet. The most important lipid in cereal grains are the triglycerides, and the maj ority of lipids in leafs are galactolipids and phospholipids (Harfoot, 1978). The two major processes occurring to the lipids in the rumen are hydrolysis and hydrogenation (Van Soest, 1994; Doreau and Chilliard, 1997).

PAGE 27

27 H ydrolysis , also called lipolysis , is the process of cleavage of the ester bonds of lipids leading to free FA and the remaining structural component s such as glycerol and/or galactose and glycerolphosphate ( Harfoot, 1978). Salivar y lipase has low activity in ruminants and, as a result , th e hydrolysis of triglycerides is mostly executed by the bacterial lipase s , particularly in the rumen. Overall, the extent of hydrolysis of triglycerides in the rumen is high, reaching up to 95% and its rate can be decreased by increasing fat content of the diet, reduced rumen pH, and presence of antibiotics inhibiting bacterial growth (Doreau and Ferlay, 1994; Doreau and Chilliard, 1997). The glycerol and galactose released are rapidly fermented by the ruminal bacteria, generating volatile FA (VFA), ma i nly propionate and butyrate. The end products of the ruminal hydrolysis of lipids are VFAs and free FA (Harfoot, 1978). The next step in the ruminal metabolism of lipids is the hydrogenation of the unsaturated FA. One of the primary reasons why rumen bacteria hydrogenate unsaturated FA is because of the reductive environment of rumen with large quantities of H and lack of oxygen, and because FA with double bonds with an ionized carboxyl end are toxic to bacteria. Maczulak et al. (1981) cult u red several strains of rumen bacteria in a media containing 0.01% (w/v) of either palmitic, stearic, or oleic acids. Several of those bacterial strains cultured in media containing the unsaturated FA oleic acid had reduced growth. Considering the media without FA as the refer ence , the percentages of growth relative to the media without FA were, respectively, for media containing 0.01% of palmitic, stearic, and oleic acids: Butyrivibrio fibrisolvens 80.6, 95.3 and 66.7; Ruminococcus albus 90.2, 100.0, and 14.6; Ruminococcus fla vefaciens 87.5, 88.9, and 0. Growth rates of Selenomonas rumina n tium , Bacteroides ruminicola and Lachnospira multiparus were not affected by the presence of oleic acid in the media showing growth rates above 100% relative to the control media without FA. Maia et al. (2007) ranked some PUFA

PAGE 28

28 according to their toxicity to rumen bacteria: EPA > DHA > ALA > LA. The same group (Maia et al., 2010), using propidium iodide, demonstrated that LA damaged the integrity of bacterial cell membrane at different extents for different species. The process of ruminal biohydrogenation is composed by two chemical reactions, isomerization and hydrogenation (Harfoot, 1978). Isomerization is the process in which the geometrical conformation of the chemical compound is changed from a cis to a trans configuration. An example of such conformational change is the isomers of butenedioic acid, maleic acid, which is a cis isomer, and fumaric acid, which is a trans isomer. Hydrogenation is a biochemical process in which a double bond b etween two carbon atoms is replaced by two hydrogen ions (Nelson and Cox, 2008). Biohydrogenation of dietary PUFA is generally extensive in the rumen, ranging from 70 to 95% for LA and 85 to 100% for ALA (Doreau and Ferlay, 1994; Lock et al. , 2006). The qu antitative significance of different bacterial species in the biohydrogenation of PUFA has been evaluated (Jenkins et al., 2008). From the twenty six most common bacterial species in the rumen , 11 were capable to metabolize PUFA to a substantial extent. Th ree strains of Butyr i vibrio and two strains of Clostridium produced trans 11 C18:1, whereas only Clostridium proteoclasticum produced C18:0 (Jenkins et al., 2008). Screening hundreds of sheep rumen, randomly, Wallace et al. (2006) found that the butyrate p roducer bacteria were responsible for the production of trans 11 C18:1, and cis 9, trans 11 conjugated LA (CLA) . These two FA are the classic intermediates of the hydrogenation of the LA, which were depicted over time to characterize ruminal biohydrogenatio n of LA. However, wide range of isomers of these FA has been demonstrated in the literature (Jenkins et al., 2008). It has been demonstrated that low rumen pH selects certain strains of bacteria such as Megasphaera elsdenii which shift the ruminal biohydr ogenation towards an alternative pathway

PAGE 29

29 (Palmonari et al., 2010). This alternative pathway of PUFA biohydrogenation ha s as intermediates, among others, the trans 10 , cis 12 C LA isomer, which is known as a potent antilipogenic FA , particularly in the mammar y gland . Upon absorption in the gut, the trans 10, cis 12 C LA have potent effects decreasing milk fat content by decreasing mRNA of genes encoding several enzymes (e.g. acetyl CoA carboxylase, FA synthase, among others) of the milk fat synthesis cascade (Ba umgard et al., 2000; Baumgard et al., 2002) . Digestion and Absorption Similarly to non ruminant animals, the digestion of FA also occur s in the intestines . Nevertheless, because of the ruminal modifications of the dietary FA, ruminant animals will have gr eater proportion of saturated FA entering the small intestine, compared with ingested form the diet. Approximately 90% of the lipids entering the ruminant small intestine are composed by free FA attached to feed particles and , to a lesser extent, phosphol ipids from microbes and monoglycerides or triglycerides from fats that escaped microbial digestion (Harrison and Leat, 1975; Bauchart, 1993; Doreau and Chilliard, 1997; Lock et al. 2006). On the other hand, in non ruminants, most of the lipids entering the small intestine are composed of triglycerides because of lack of extensive enzymatic digestion before the duodenum. Pancreatic and intestinal lipases are responsible for the hydrolysis of the remaining triglycerides and phospholipids entering the small in testine (Doreau and Ferlay, 1994) . T hese enzymes also convert lisolecithin secreted by the gallbladder into lecithin. Lecithin promotes desorption of FA from feed particles and bacteria. Together with the bile salts, lecithin promotes the micelle formation , which has polar characteristics facilitating the crossing of FA through the unstirred water layer into epithelial cells of the intestinal lumen (Harrison and Leat, 1975). The micelle, compos ed of free FA, monoglycerides, bile salts, phospholipids, and ch olesterol, was thought to p assively diffuse throughout the brush border membrane into the enterocyte ; however,

PAGE 30

30 today it is known that FA absorption is mediated by specific FA transport proteins (FATP) present in the apical plasma membrane of enterocytes. O ne of these FATP, FATP4 is thought to be the main long chain FA transporter present in enterocytes (Stahl et al., 1999). The fact that in ruminants the bile is rich in taurocholic acid, instead of glycocholate as in non ruminants, increases FA solubility i n acid conditions (Harrison and Leat, 1975), which grant s greater digestibility of saturated FA to the ruminant animal compared with non ruminants. In rodents and humans, researchers have demonstrated that bile acids exert functions above and beyond this d etergent action (Hylemon et al., 2009; Zhou and Hylemon, 2014). Bile can activate nuclear receptors and cell signaling in the liver and gastrointestinal tract (Hylemon et al., 2009; Zhou and Hylemon, 2014) . A lthough interesting, further details of these no vel biliary acid functions are beyond the scope of this review and can be found elsewhere (Hylemon et al., 2009; Zhou and Hylemon, 2014). After crossing the plasma membrane of the enterocyte transported by FATP (Stahl et al., 1999), the FA is released in t he cytosol and a cytosolic FA binding protein binds to the FA and transfer s it through the aqueous compartment of the enterocyte to the endoplasmic reticulum glycerophosphate pathway is the main pathway where FA are re esterified into triglycerides (Bauchert, 1993; Palmquist and Jenkins 1980). The newly formed triglyceri de is packed into lipoproteins called chylomicron s and transported to the lymphatic system and then to the blood stream (Bauchart, 1993). The intestinal digestibility of FA varies with the chain length and the degree of unsatura tion in monogastric animals (Doreau and Chilliard, 1997). H owever , for ruminants there are only small differences on the digestibility of individual FA (Lock et al., 2006). Regarding the chain length, greater digestibility was observed for FA containing 18 or more carbon atoms

PAGE 31

31 compared with FA containing 12 to 16 carbons in the acyl chain (Loor at al., 2005 a ). However, Doreau and Chilliard (1997) found a quadratic response with FA with 16 and 18 carbons having the greatest intestinal digestibility compared with FA containing 12, 14, 20, or 22 carbons in the acyl chain. The same authors showed a linear decrease in intestinal digestibility of FA in poultry and pre ruminant calves as the carbon chain length increased. Lock et al. (2006) analyzed data from sever al studies in the literature and observed only numerically greater digestibility for unsaturated C18 FA compared with either C18:0 or C16:0. The digestibility coefficients were similar for C18 FA with one, two or three unsaturation points. Similar to the r esults of Lock et al. (2006), Loor et al. (2005 a ) also observed that degree of unsaturation of C18 unsaturated FA did not affect intestinal digestibility . Feeding Long Chain Fatty Acids t o Dairy Cows: Lactational Performance Effects o n Milk Production Nutr itionists have incorporated supplemental fat to the diet of lactating dairy cows since the beginning of the twentieth century with the goal to improve milk production and composition (Palmquist and Jenkins, 1980). In an extensive review of the literature P almquist and Jenkins (1980) conclude d that feeding fat to lactating dairy cows has great potential to improve milk yield without compromising fiber digestibility and ruminal microbial growth if supplemented at 3 to 5% of dietary DM. R esearch on fat feeding to dairy cows ha s greatly evolved d uring the period from the second half of the 20 th century and the first 2 decades of the 2 1 th . Feeding fat to lactating dairy cows commonly has positive effects on milk yield. The range of this effect, however, can var y extensively. In a meta analysis encompassing 38 published studies, Rabiee et al. (2012) observed an overall increase in milk yield of 1.05 kg/cow/d (95% confidence interval = 0.31 to 3.07) in cows fed fat compared with those that received no supplemental fat. However, this benefit depended on the type of supplemental FA

PAGE 32

32 provided to the cows. The type of FA present in the supplemental fats, PUFA or MUFA or saturated FA , the form in which the supplement was fed, either as Ca salts, oils, tallow, prilled fat , or others, and the quantity of supplemental FA can interact with the other components of the diet and generates this diversity of results found in the literature. Simas et al. (1995) supplemented the diet of early lactation cows with 2.5 % of Ca salts of palm oil and found a numerical decrease in milk yield (1.85 kg/cow/d ; P = 0.27). These authors attributed this decrease in milk to a smaller dry matter (DM) intake of cows fed the diets supplemented with Ca salts. This response was likely caused by a some what high fat content in the diet, as supplemental fat increase the dietary fat content from 5.7 to 7.5%. Evaluating the either saturated FA or flaxseed which is a source of PUFA rich in ALA. The milk production was greater for cows fed either the control diet with no supplemental fat or cows fed flaxseed than cows fed saturated FA. However, corrected for 4% fat content in milk, the yields were similar between t he three dietary treatments. Several other studies detected no differences in milk production comparing different sources of FA: t allow and Ca salts of fish oil (Juchem et al., 2008); saturated FA, Ca salts of trans octadecenoic FA and Ca salts safflower o il (Caldari Torres et al., 2011); Ca salts of n 6, n 3, tras C18:1, linseed oil, or high oleic sunflower oil (Amaral, 2008) . I nside each experiment cows produced similar amount of milk regardless the type and source of FA supplemented. In general, the effe ct of fat feeding on performance of dairy cows is influenced by when supplementation is initiated. Fat supplementation starting in the beginning of lactation improves milk yield, whereas supplementation in mid to late lactation may not necessarily increase production (Onetti and Grummer, 2004). In some studies evaluating fat supplementation to early

PAGE 33

33 postpartum cow fed diets with excessive concentration of supplemental FA (Grum et al., 1996) , which is known to suppress intake . Effects on Milk Composition Fat is the milk component which is most altered by dietary manipulation, both the amount/proportion and the FA profile, followed by protein. Lactose is the least changeable component because it is the main osmotic component of milk responsible for moving wate r from the blood stream , which maintains a fai r ly constant concentration in milk. M ilk fat is derived from two sources . S hort and medium chain FA (respectively, 4 to 8 and 10 to 14 carbons ) are synthetized in the mammary gland by de novo synthesis, wherea s long chain FA , those with > 1 8 carbons, are transferred to milk from the blood. The 16 carbon FA can be derived from either source (Bauman and Griinari, 2003). The foremost impact of dietary fats in the short and medium chain FA in milk is an inhibition caused a syndrome called milk fat depression. Briefly, during the process of biohydrogenation of unsaturated FA some intermediates of the biohydrogenation pathways, such as trans 10, cis 12 C LA, escape the rumen and are absorbed. These FA have potent inhi bitory effects on gene expression and activity of key lipogenic enzymes in the mammary tissue (e.g. acetyl CoA carboxylase, FA synthase), resulting in l ess synthesis of milk fat (Baumgard et al. , 2002; Bauman and Griinari, 2003). The long chain FA can be i ncorporated into milk fat through the mobilization of body fat reserves , when cows are in negative energy balance and experience extensive weight loss, or from FA originated from the diet. Depression in milk fat synthesis is not uncommon when fat supplemen ts rich in PUFA that are not protected against microbial metabolism are fed in dairy cow diets . The production and accumulation of trans intermediates during the biohydrogenation pathway, some of which with anti lipogenic properties, end up depressing milk fat synthesis. However similarities between milk FA profile and supplemental FA is common observed

PAGE 34

34 (Harvatine and Allen, 2006; Petit et al., 2007; Amaral, 2008; Caldari Torres et al. , 2011; Megaro et al. , 2012). Two negative effects of feeding f at to dairy cows, especially PUFA, are possible impairments in fiber digestibility, and decreases in DM intake. An additional effect observed in lactating cows is a possible depression in milk fat synthesis. Changes in fiber digestion and DM intake could r esult in less organic matter fermentation in the rumen, thereby compromising microbial production in the rumen (Allen, 2000 ; Onetti and Grummer, 2004). As consequence , a decreased production of protein in milk would be observed (Juchem et al. , 2008) . Effec ts on Energy Balance Early in lactation , the rapid increase in milk production, but the inability to compensate the nutrient needs with sufficient DM intake causes dairy cows to undergo a period of negative nutrient balance. A reasonable strategy to overco me this problem would be increase the energy density of the diet. In this manner the replacement of grain or forage by fat would be effective to increase the energy density of the diet, improving the energy balance. However, the improvement in energy balan ce is not always observed (Staples et al. , 1998). First , it is frequently observed a slight decrease in DM intake when cows are fed fat and , second , an improvement in milk yield and/or fat corrected milk yield is often observed (Rabiee et al., 2012). In fa ct, in many cases, fat supplementation in early postpartum depresses energy balance of dairy cows (Staples et al. , 1998). Amaral (2008) fed lactating dairy cows a control diet with no supplemental fat or diets supplemented with Ca salts of n 3 or n 6 FA wa s unable to detect difference s in energy balance among treatments. Juchem et al. (2008) also found no treatment effect on energy b alance when cows were fed either tallow or Ca salts of fish and palm oil s . Moallem et al. (2007) found a negative effect on en ergy balance when cows were fed either saturated FA or Ca salts of PUFA pre and postpartum.

PAGE 35

35 Inducing milk fat depression, however, could be a strategic managerial decision to improve energy balance in the beginning of the lactation. Theoretically , because milk f at represents 50 to 60% of all calories in milk, a depression in milk fat synthesis would reduce the caloric cost of synthesizing milk, thereby c ontributing to ameliorat ing the energy balance of early lactation cows . Based on this concept, Odens et al. (2007) fed Holstein cows from 9 d before to 40 d after calving diets supplemented with either 578 g of palm FA distillate (control), 600 g of a mixture of C L A and palm FA distillate for the entire period , or 600 g until 10 d in milk ( DIM ), and then dec reased to 200 g of the mixture CLA and palm FA for the remaining days in the study . These authors found an improvement in energy balance, as well as decrease in circulating nonesterified FA (NEFA) in both groups fed CLA . The improvement in energy balance a ppears to be related to a reduced energetic need for milk synthesis, which decrease d adipocyte FA mobilization . In fact, feeding CLA reduced energy corrected milk, which minimizined the increase in NEFA concentrations immediately after calving ( Schlegel et al. , 2012 ). Interestingly, although CLA has marked effects on milk fat synthesis, minor changes were observed in the hepatic transcriptome of dairy cows in the transition period (Schlegel et al. , 2012). Despite indications of reduced milk fat synthesis, f eeding C LA to improve energy balance is not always observed (Selberg et al. , 2004; Castañ e da Gutiérrez et al. , 2005) , in part because most of the milk FA secreted in the first few weeks of lactation originate from pre formed FA and not de novo synthes ized. The latter FA are those mostly affected by depression in milk fat synthesis caused by feeding trans FA . Feeding Long Chain Fatty Acids to Dairy Cows: Reproductive Performance Effects on the Ovaries It is consistently observed that lactating dairy co ws supplemented with fat had greater follicle development and bigger follicles (Staples e t al. , 1998; Santos et al. , 2008). Several

PAGE 36

36 studies have shown no differential effect of follicle growth and size accounted by the type of FA (Hutchinson et al. , 2012). Nevertheless, a differential follicular growth has been reported in some studies favoring diets enriched with PUFA against monounsaturated FA (Bilby et al. , 2006a) or saturated FA (Oldick et al. , 1997). The size of the ovulatory follicle appears to be sim ilar among cows supplemented with either n 3 or n 6 FA (Petit et al. , 2002; Petit et al. , 2004; Bilby at al. , 2006a) only few studies have shown otherwise (Ambrose et al. , 2006). An important role of FA in the ovaries is related to the follicular environm ent in which the oocyte develops. The formation of follicular fluid is believed to occur through a concentration gradient. Hyaluronan and versican, produced by granulosa cells , are the two main molecules responsible for dragging fluids from the capillaries to the follicle (Rodgers and Irving Rodgers, 2010). A relationship has been demonstrated between the metabolic status of the cow and the hormonal/metabolic profile of the follicular fluid (Leroy et al. , 2011). Negative effect s on oocyte quality ha ve been observed with high concentrations of NEFA and low concentration of glucose in both follicular fluid and plasma (Leroy et al. , 2006; Vanholder et al. , 2005). In dairy cows, the major components of NEFA are the saturated FA palmitic (C16:0) and stearic (C18: 0) acids, and the monounsaturated FA oleic acid (C18:1) (Leroy et al. , 2005). Aardema et al . (2011) showed in vitro a negative effect on oocyte quality when either palmitic or stearic acids were supplemented to the culture media. However, when oleic acid w as added to the media , oocyte development and quality was not impaired. Furthermore, inclusion of oleic acid to the media ameliorates the negative effects of both afore mentioned saturated FA. Supplementation of dairy cattle ration with n 3 PUFA (Bilby et al. , 2006a), n 6 (Bilby et al. , 2006a) or varying the ration between them (Zachut et al. , 2010) has been used with the intention of improve follicular environment, and consequently oocyte quality. However, the positive

PAGE 37

37 effects on oocyte quality caused by PUFA supplementation are not always observed (Bilby et al. , 2006a; Fouladi Nashta et al. , 2009) . Effects on Embryo and Pregnancy A successful pregnancy is a result of an orchestrated synchrony of biological events that result in establishment and maintena nce of gestation. Fatty acids play important roles in several aspects of reproduction, and some PU FA appear to have a combined effect on the embryo and uterine environment leading to a successful pregnancy. Cerri et al . (2009) found an improvement in embry o quality when cows were fed Ca salts of LA and trans octadecenoic acid compared with cows fed Ca salts of palm oil. Juchem et al . (2010) , utilizing the same dietary treatments , found an increase in pregnancy per insemination (35.5 vs . 25.8%) on day 41 aft er the artificial insemination for cows fed Ca salts of LA and tras octadecenoic acid. Reis et al . (2012) found a decrease in pregnancy loss when cows were fed Ca salts of PUFA. However, these results are not always cons itent , with several studies showing no difference of feeding PUFA on reproductive performance (Petit and Twagiramungu, 2006) , likely caused by the lack of statistical power observed in many nutritional studies evaluating reproduction (Santos et al., 2008) . It is believed that different type s of PUFA can alter the uterine environment and also exert some uterine programing that would be favorable for embryo survival. One of these mechanisms goes towards the prostaglandin secretion. Dairy cows diet enriched with n 3 FA can alter the FA profile of the endometrial tissue (Bilby et al. , 2006b), which might attenuate the secretion of prostaglandin F (Mattos et al. , 2002), improve embryo survival, and d ecreas e pregnancy loss (Ambrose et al. , 2006). Strategically feeding a diet enriched with n 6 FA during the transition period is thought to favor a more robust immune system (Silvestre et al. , 2011a) . This might be important because during late gestation and, especially early lactation, many cows undergo a dysregulation of the immune system. Furthermore, a switch to a diet enriched in n 3

PAGE 38

38 FA, which are known to have anti inflammatory properties , after the first weeks postpartum, during the breeding period, favor ed reproduction (Silvestre et al. , 2011b) . The Role of Fatty Acids on Immunity and Inflammation The Inflammation Process A Brief Overview The skin and mucosa represent the organism's first line of defense, acting as a physicochemical barrier against potentially harmful pathogens. Nevertheless, this barrier is often crossed by microorganisms and secondary mechanisms must be activated in order for the pathogen to be eliminated. Macrophag es present in tissues are the sentinel cells of defense. T h rough receptors, these immune cells can recognize bacteria and react to them by two main pathways. Macrophages can engulf and kill bacteri a in a process called phagocytosis and o ther process es trig ged by macrophages is the production of chemokines and cytokines (Murphy, 2011 a ). These proteins have the ability to attract neutrophils and monocytes to the local of injury, initiating the inflammatory process. The clinical hallmark signals of inflammatio n are the result of the actions of cytokines and chemokines whi ch provide physiological alterations in the vascular endothelium promoting extravasation of neutrophils and monocytes to the site of injury. O ther important class of molecules playing pivotal role in the inflammation process are substances derived from FA such as prostaglandins, prostacyclins, leukotrienes, lipoxins, and thromboxanes (Sordillo et al. , 2009). These molecules are very active during the inflammation process and, depending on the timing and the FA origin, the effect of their action can be eithe r pro or anti inflammatory (Calder, 2006). It is undeniable that the inflammatory process is important and helpful to maintain body homeostasis. Inflammation triggers pathogen killing processes and tissue repair (Calder et al. , 2009). However, soon enough the insult is controlled as

PAGE 39

39 an anti inflammatory process must initiate, otherwise, healthy tissue starts be ing damaged. The pathop hysiology of several diseases entails characteristics for an uncontrolled inflammatory process (e.g. inflammatory bowel disea ses, rheumatoid arthritis, asthma, etc.; Calder et al. , 2012). Because of the health relevance and the potential market for the medical industries , a lot of research has been focused in understanding, preventing and resolving the inflammatory process. The pathways by which FA interact with the immune system are summarized in Figure 1 3 . Beyond the Prostaglandins The most known and studied effect of PUFA influencing the immune system is through prostaglandin synthesis and modulation. Nevertheless, a series of other mechanisms could take place as an outcome of the immune system modulated by different FA as outlined in Figure 1 3. One of the mechanisms by which bacteria trigger inflammation is through lipopolysaccharide ( LPS ) activation of the transcript ion factor nuclear factor kappa B ( ) , which occur s by the , s the expression of several genes in which the final product are proteins that stimulates inflammation such as: cytokines (e.g. IL 1, TNF IFN e.g. T cell activation gene 3, c ytokine induced neutrophil chemoattractant 1, etc), proteins for the a cute phase response such as s erum amyloid A, and cell adhesion molecules such as intercellular adhesion molecule among others (Kumar et al. , 2004). Some FA, e specially the n 3 series, act by inhibiting activation of inflammatory proteins (Calder et al. , 2012). It has activation in macrophages and dendritic cells. H owever , unsaturated FA (e.g. o leic, LNA, AA, DHA) were capable to inhibit this activation by lauric acid (Weatherill et al. , 2005; Lee et al. , 2001).

PAGE 40

40 Another mechanism by which long chain FA interferes i n the inflammation process is by the activation of the peroxisome proliferator activated receptors (PPAR). Compared to non ruminants, the effects of PPARs in ruminants are less studied ; however, most of the actions of PPARs seem to follow the same directio n in both ruminants and non ruminants. The major functions of the PPARs are related to lipid metabolism. They p romoting uptake of FA e specially during fasting/ketogenesis (PPAR , 2001; Loor et al. , 2007; Brennan et al. , 2009), regulat e glucose metabolism, lipogenesis and adipogenesis (PPAR , 1999; Garcia Rojas et al. , 2010) , or regulate FA oxidation in sk eletal muscle, heart, and brown and white adipocytes (PPAR , 2006; Loor et al. , 2007; Brennan et al. , 2009). Regarding the immune system, the most acknowledged effects of PPARs are either enhancing the synthesis of anti inflammatory mol ecules or decreasing the pro inflammatory ones. Several studies have been conducted using cell culture and laboratory animals as model to understand how PPARs a ffect disease states (Varga et al. , 2011). In animal models, PPAR has been shown to ameliorate inflammatory bowel disease progression by suppressing the production of IL 12 and T helper lymphocyte 1 (Th 1) cell differentiation. Peroxisome proliferator activated receptor autoimmune enceph alomyelitis as well as myocarditis (Varga et al. , 2011). In human macrophage cell culture , PPAR and the results were even more profound when cells were previously treated with IFN et a l. , 2002). Peroxisome proliferator activated receptor also can be activated by leukotriene B4 which can modulate the arachidonic acid and its derivative molecules , regulating the course of inflammation as a feedback negative model, when triggered by eith er arachidonic acid or leukotriene B4 PPAR , 2011).

PAGE 41

41 One other mechanism PPAR , as described above , to diminished production or pro inflammatory cytokines (Bougarne et al. , 2009). Peroxisome proliferator activated receptor role in liver regulating the production of acute phase proteins (Gervois et al. , 2004). Peroxisome proliferator activate d receptor of all PPAR in both ruminants and non ruminants ; however, its effects controlling inflammation goes towards a reduction of pro inflammatory cytokines production (Varga et al. , 2011). The alternatively activat ion of macro phages (M2 macrophage) and its subgroups (a, b, and c) promotes and regulates type 2 immune response, promotes angiogenesis and tissue repair (Liu and Yang, 2013). The differentiation of these type 2 microphages is stimulated by PPAR PPAR , 2011) . The Anti a nd Pro Inflammatory Effects of Prostaglandins and Other Intermediates Prostaglandins are synthesized by several different tissues of the body, although copious amounts are produced by the uterus during speci fic stages of the estrous cycle or during the postpartum period. Prostaglandins and other intermediates of arachidonic acid metabolism have pivotal roles in the activation and resolution of the inflammatory response. The FA present in the cell membrane pho spholipids are the substrates for synthesis of prostaglandins and other pro and anti inflammatory intermediates, as depicted in Figure 1 4. Long chain PUFA (e.g. LA, AA, ALA, EPA, and DHA) are the precursors for the synthesis of eicosanoids (Figure 1 4). Eico sanoids such as prostaglandins, thromboxanes, and leukotrienes are key regulator molecules for both acute and chronic inflammation (Calder et al. , 2012). The release of arachidonic acid from the phospholipid of the cell membrane through action of the pho spholipase (most common PLA2) will produce substrate for the cyclooxygenase enzymes (COX), resulting in 2 series prostaglandins and thromboxanes. These eicosanoids can

PAGE 42

42 be produced by monocytes and macrophages (PGE 2 , PGF ), neutrophils (PGE 2 ), and mast cells (PGD 2 ). Arachidonic acid can also be metabolized through the 5 lipoxygenase pathway which results in the formation of hydroxy and hydroperoxy derivatives (5 HETE and 5 HPETE, respectively), and the 4 series of leukot rienes, LTA 4 , B 4 , C 4 , D 4 and E 4 . LTB 4 are produced by neutrophils, monocytes and macrophages, and LTC 4 , D 4 and E 4 are produced by mast cells, basophils and eosinophils. These arachidonic acid derived eicosanoids are shown to co exist with signals of inflam mation, such as fever, pro inflammatory cytokines, etc. However, prostaglandin E 2 has been shown to suppress 5 LOX, consequently inhibiting the production of 4 series leukotrienes and enhancing an anti inflammatory action (Gewirtz, et al. , 2002; Serhan et al. , 2003) by inducing production of lipoxins (Vachier et al. , 2002). The n 3 series of long chain FA have been known for its anti inflammatory effects, which are through several mechanisms. First of all by simple competition, some of the n 3 LCFA compete with the n 6 for enzymes (e.g. LA competes with ALA for desaturases and elongases). Substrate availability, feeding animals with n 3 FA (e.g. fish oil rich in EPA and DHA) will change the FA profile of the membrane phospholipids. Consequently the pool of F A released from phospholipids would have greater proportion of n 3 FA, leading to a decreased availability of the n 6 series. These are nonspecific mechanisms of action of the n 3 FA. Specifically the most potent anti inflammatory FA is the DHA. The metabo lism of DHA leads to a two principal compounds: resolvin D1 (RvD1) and protectin D1 (PD1), as reviewed by Calder (2011). The resolvins and protectins act towards clearance of negative effects of inflamma tion, they induces neutrophil apoptosis, decrease vas cular permeability, inhibit polymorphonuclear cells extravasation and stimulates macrophages to phagocyte apoptotic neutrophils (Serhan and Savill,

PAGE 43

43 2005; Singer et al. , 2008). The EPA through lipoxygenase pathway also produces resolvins (RvE1 and RvE2), wh ich has similar effects of the D series of resolvins (Levy, 2010) . The Role of Fatty Acids on Gene Expression The Splanchnic Axis different stages of the life. For ru minants it is not different, as an example, the liver deals with all propionic acid absorbed in the rumen and the gigantic amount of FA mobilized from the adipocytes in high producing dairy cows at the beginning of lactation. Adaptations are required depen ding upon the physiological state of the animal. Much of the temporal changes in liver befall through alterations of gene expression. Besides the physiological modulation of hepatic gene expression the diet can also prepossess a variety of changes in the p attern which hepatic genes are up or down regulated. Following this idea the essential FA can trigger several pathways by influencing hepatic gene expression. The major pathway in which FA affects the expression of genes is through nuclear receptors and t ranscription factors. In which PPAR, LxR (liver x receptor, HNF hepa tocyte nuclear factor 4 alpha] , SREBP (sterol regulatory elem are the most noteworthy (Sampath and Ntambi, 2005). they possess different functions regulating the metabolism, consequently are differently expressed throughout the body. As well as in non the liver. PPAR ng the oxidation of LCFA in both non ruminants (Desvergne et al., 2006) and ruminants (Loor et al., 2005 b ; Loor et al., 2007). In non ruminants some of the PPAR I, acyl Co A synthetase, Acyl Co A oxidase, FA transport protein, among others (Sampath and Ntambi, 2005).

PAGE 44

44 In both ruminant s (Thering et al. , 2009) and non ruminant s (Bragt and Popeijus, 2008; Wahli and Michalik, 2012), long chain FA can modulate the activity of PPAR. Selberg et al. ( 2005 ) fed dairy cows during the peripartum period with either a diet devoid of supplemental FA that was labeled as control , a diet supplemented with C LA, mostly cis 9,cis 12 C18:2 , or a diet supplemented with tra n s 11 octadecenoic acid . Hepatic tissue was collected for b iopsy at 2, 14 and 28 DIM. These authors found that PPAR trans 1 C18:1 compared with all other treatments, and C L A supplementation was not able to alter the PPAR mRNA. Studies using bovine cell culture (Bionaz et al. , 2012) demonstrated that the activation of PPAR ed a different pattern than that described in non ruminants (Bragt and Popeijus, 2008; Wahli and Michalik, 201 2). The culture of Madin Darby bovine k idney cells with several different long chain FA (C16:0; C18:0; cis 9 C18:1; trans 10 C18:1; LA; ALA; cis 9, trans 1 C LA; trans 10, cis 12 C LA; C20:0; EPA; and DHA) resulted in a greater activation of PPAR others MUFA and PUFA (Bionaz et al. , 2012). Another important nuclear receptor acting to orchestrate the metabolism of FA in the body is the LxR. This nuclear receptor is responsible among other pathways in controlling the metabolism of cholesterol. Some of the intermediate compounds of the cholesterol degradation are the oxysterols, when in high levels these compounds can activate LxR. Activated LxR increases the production of bile acids avoiding cholesterol accumulation in the liver (Desvergne et al. , 2006). Other genes having the t ranscription affected by LxR include LPL (lipoprotein lipase, FAS (FA synthase), ACC (Acetyl CoA carboxylase), SCD1 (stearoyl CoA dehydrogenase 1), and the transcription factor SREBP1c (Sampath and Ntambi, 2005). Using HEK293 cell

PAGE 45

45 culture as a model, Yoshi kawa et al. (2002) demonstrated that several PUFA (arachidonic acid > EPA > DHA > ALA, in order of potency) were able to inhibit the SREBP1c promoter activity . H owever, saturated FA and monounsaturated FA had marginal effect. Those effects of PUFA on LxR a nd SREBP1c are directly linked to inhibition of FA synthesis (Sampath and Ntambi, 2005). The end product would be the known effect of PUFAs inhibiting fat synthesis . The Reproductive Axis The reproductive performance is clearly influenced by nutrition , an d it is thought that many of the reproductive response s observed when FA are fed to cows are mediated by regulation of the expression of key gen e s that influence the reproductive axis. In addition, FA can influence fertility as substrate for cholesterol sy nthesis and for synthesis of regulatory molecules such as prostaglandins. One of the most evident effects of PUFA altering gene expression in tissues of the reproductive system is related to the prostaglandin biosynthesis. Prostaglandin is derived from ara chidonic acid incorporated in to the phospholipids of plasmalema . The production of prostaglandin F by bovine endometrial cells cultured in the presence of C LA (Rodrigues Sallaberry et al. , 2006) or EPA and LA (Caldari Torres et al. , 2006) stimulated by p horbol 12,13 dibutyrate was suppressed by both C LA and EPA, without altering the mRNA expression of PPAR and PGHS 2 (prostaglandin endoperoxidase synthase 2). When increasing doses of LA were co incubated with EPA a stepwise type of response was found fo r both the production of prostaglandin F and PGHS 2 expression (Caldari Torres et al. , 2006). These authors suggest a substrate competition (LA vs. EPA) for PGSH 2, in which when more LA is available more prostaglandin F will be synthesized. In a series of experiments evaluating the effects of dietary n 3 FA on uterine tissue gene expression (Coyne et al. , 2008; Coyne et al. , 2011; Waters et al. , 2012) , it was shown that

PAGE 46

46 these group of FA are capable of regulating a multitude of genes. In cattle, t he work from Childs et al. ( 2008) is noteworthy. They took different analytical approaches to understand how n 3 FA influence uterine and hepatic tissues. Briefly, crossbred beef heifers were blocked by body weight and body condition score and then assign ed to one of four dietary treatments: control, with no fish oil supplementation, a low amount of fish oil supplementation to provide a total of 65 g of combined EPA and DHA, a moderate amount of fish oil supplementation to provide a total of 84 g of combin ed EPA and DHA, and a high amount of fish oil to provide a total of 275 g of combined EPA and DHA. It is important to indicate that most diets fed to dairy cows might provide up to 25 g of a combined EPA and DHA. Therefore, the amounts fed in the low treat ment were well above those typically observed in dairy cattle rations. Fourteen days after the dietary treatments started, estrous cycle s of heifers were synchronized with two injections of prostaglandin F 12 d apart. On day 15 of the new estrous cycle , heifers underwent an oxytocin challenge then they were slaughtered either on day 17 or 18 of the estrous cycle, and endometrial and liver samples were collected (Childs et al., 2008). Coyne et al. (2008) se lected 7 heifers from each co ntrol and h igh group s and performed RT PCR analysis to evaluate the expression of genes related to prostaglandin synthesis pathway on the endometrial tissue. From the eleven selected genes , four were differently expressed in response to n 3 dietary treatment. P rostaglandin E synthase, PPAR , and PPAR were up regulated in heifers fed the high n 3 diet compared to control. On the other hand phospholipase A2 were down regulated by n 3 diet. These authors speculate d that the potential modulation in prostaglandin synthesis media ted by n 3 FA could empower embryo survival, improving reproductive performance by dietary manipulations. The same authors evaluated g enes related to the insulin like growth factor ( IGF ) system in the endometrium and liver (Coyne et al., 2011). From the el even genes researched in

PAGE 47

47 the endometrium seven were differently expressed between the two dietary treatments. I nsulin like growth factor 1, IGF binding protein 3, and IGFBP 6 genes were down regulated when cows were fed high n 3 diet, conversely IGF 2 , IGF 1 receptor ( IGF 1R ) , IGF 2R , and IGBP 2 were up regulated. In the hepatic tissue IGF 2R , IGFBP 1 , and IGFBP 5 were up regulated when heifers receive the high n 3 diet , whereas the growth hormone receptor (GHR) 1A was down regulated . All other genes evalu ated were not differently expressed. Interesting, the pattern of gene expression was not the same among the tissues, furthermore the concentrations of IGF 1 in plasma followed a different pattern with higher concentrations been found in heifers fed high n 3 diet (Childs et al., 2008). Because the liver is the major tissue producing IGF 1 and the IGFBP 1 and 5 were up regulated in the hepatic tissue, it could be speculated that binding proteins are increasing the half life of the IGF 1 circulating in plasma (Jones and Clemmons, 1995). In a broader approach, Waters et al. (2012) conducted a microarray analysis in the endometrial tissue of beef heifers fed control or high n 3 diets. A total of 1,807 genes were differently expressed and 50 different networks we re identified by the Ingenuity Pathway Analysis. As anticipated, lipid metabolism was highlighted in several of the pathways identified as influenced by n 3 FA . The prostaglandin synthesis was re confirmed by the microarray analysis to be regulated by PUFA , with the n 3 family of FA inducing a down regulat ion of mRNA expression of the series 2 of prostaglandins. Other two pathways were also identified by the Ingenuity Pathway Analysis with several genes related to maternal immune response and tissue remodel ing. Collectively, these alterations in the uterine transcriptome are thought to be more conducive to maintenance of pregnancy by influencing pregnancy recognition, implantation , and formation of the placenta. The molecular modifications occurring in the e ndometrium as a result of dietary supplementation with n 3 PUFA converges to a decrease in

PAGE 48

48 prostaglandin F synthesis , which could give the embryo a better timing for appropriate cross talk with the endometrium and other maternal tissues. Furthermore , changes in the IGF system could promote enhanced embryo development for maintenance of the pregnancy .

PAGE 49

49 Figu re 1 1. Overview of the structure of four different 18 carbon fatty acids . (A) Stearic acid an 18 carbon saturated fatty acid ; (B) Oleic acid , an 18 carbon monounsaturated FA and representing the omega 9 family; (C) Linoleic acid , an 18 carbon polyunsatura ted fatty acid with two double bonds and Linolenic acid , an 18 carbon polyunsaturated fatty acid with 3 double bonds and representing the omega 3 family.

PAGE 50

5 0 Figure 1 2. Biosynthesis of long chain polyunsaturated fatty acids in mammals (adapted from Leo nard et al., 2004).

PAGE 51

51 Figure 1 3 . Overview of the mechanisms in which fatty acid can alter inflammatory cell function (Adapted from Calder, 2011).

PAGE 52

52 Figure 1 4 linolenic acids are the ancient and less active fatty acids from the n 6 and n 3 families, respectively. These two essential fatty acids compete for enzymes desaturases and elongases which are essential for the formation of longer chain fatty acids, EPA and DHA (n 3), and arachid onic acid (n 6). These PUFA can be incorporated in the membranes and serve as substrates for the biosynthesis of eicosanoids through cyclooxygenase (COX) and lipoxygenase (LOX) pathways. PLA 2 , p hospholipase A 2 ; PGE 2 , p rostaglandin E 2 ; PGF , p rostaglandin F ; PGI 2 , p rostaglandin I 2 ; PGD 2 , p rostaglandin D 2 ; 15d PGJ 2 , c yclopentenone prostaglandin; TX , thromboxane; LX, l ipoxin; LT , l eukotriene; HPETE , h ydroperoxy eicosatetraenoic acid; HODE , h ydroxyoctadecadienoic acid; HETE , h ydroxyeicosatetraenoic acid; 17 sHDHA , 17s hydroxy docosahexaenoic acid; 17sHpDHA , 17s hydroperoxy DHA (Adapted from Sordillo et al. , 2009).

PAGE 53

53 CHAPTER 2 EFFECTS OF FATTY ACID SUPPLEMENTATION ON PERFORMANCE OF PERIPARTURIENT DAIRY COWS Two experiments were conducted to evaluate the effec ts of supplementing diets containing low amounts of fatty acids (FA) with either mostly saturated free FA (SFA) or Ca salts containing essential FA (EFA) on lactation performance and metabolism during late gestation and early lactation. The overall hypothe sis was that supplementing FA to diets with limited concentrations of essential FA, especially linoleic acid, would improve performance, but the benefits would be greater when the fat supplement contained EFA compared with only SFA. Fatty acid absorption w as estimated based on FA intake, using the fat sub model of CPM Dairy software and FA balance was calculated considered FA absorption, secretion in milk and a maintenance requirement. In experiment 1, 23 nulliparous and 53 parous Holstein cows were assigne d to treatments 56 d before calving, and treatments were maintained until 90 d in milk. Feeding fat prepartum did not affect dry matter (DM) intake; however cows fed the EFA diet had less intake than cows fed SFA (control = 11.3 vs. SFA = 11.4 vs. EFA = 10 .2 ± 0.6 kg/d), resulting in reduced positive energy balance (2.1, 2.8, and 0.9 ± 0.9 Mcal/d, respectively for control, SFA and EFA). Postpartum DM intake, body weight, and body condition score did not differ with feeding fat or type of supplemental FA fed ; although cows fed SFA had the greatest energy balance. Milk production tended to be greater for cows fed the EFA diet and averaged 28.1, 25.8, and 30.7 ± 1.5 kg/d for primiparous and 35.3, 37.8, and 37.5 ± 1.0 kg/d for multiparous cows fed control, SFA, and EFA diets, respectively. Cows fed EFA had increased hydroxybutyric acid, whereas, cows fed SFA had increased concentrations of glucose and insulin. In experiment 2, 12 primiparous and 18 multiparous Holstein cows were assigned rando mly to the same treatments at 15 d in milk and the study lasted 91 d. Supplementing the diet with fat tended to increase DM intake (22.5, 23.5 and 23.8 ± 0.6 kg/d, for

PAGE 54

54 control, SFA and EFA, respectively). Yields of milk (37.7, 39.9 and 43.4 ± 0.8 kg/d), mi lk fat (1.31, 1.43 and 1.57 ± 0.04 kg/d), and true protein (1.09, 1.17 and 1.26 ± 0.02 kg/d) increased with feeding fat and with type of FA. Cows fed fat were more efficient in converting feed into 3.5% fat corrected milk, but no differences were observed between diets differing in type of linolenic acids in linolenic acids. Supplementing diets low in FA with C a salts containing EFA improved essential FA balance and lactation performance of dairy cows. Introduction The transition period, characterized by a series of physiological adaptations to accommodate lactation, is the most challenging phase in the life of the modern dairy cow. Nutrient demands for final fetal development and for synthesis of colostrum and milk exponentially increase, with consequent metabolic and hormonal adaptations (Bell, 1995). Concurrent with the transition from nonlactating pregnant to nonpregnant lactating, many cows also experience declines in DM intake during late gestation that is not compatible with their nutrient needs (Bell, 1995; Drackley, 1999). Supplemental fat is used commonly in dairy cattle rations to increase energy intake , with attempts to reduce body fat mobilization and, when fed during transition, to minimize the incidence of early lactation disorders (Damgaard et al., 2013). Nevertheless, feeding supplemental FA to cows in late gestation and early lactation is controve rsial (Drackley, 1999). Criticism of feeding fat has been primarily because it can suppress DM intake (Allen, 2000), and cause further imbalance of supply of nutrients in early lactation (Drackley, 1999) with no benefits to energy balance. Linoleic (C18:2 cis 9, cis linolenic acids (C18:3 cis 9, cis 12, cis 15) are essential to mammals because they lack the delta 12 and 15 desaturases (Hashimoto et al., 2006). Essential FA and other longer chai n omega 6 and 3

PAGE 55

55 FA are active molecules that not only provide calories , but also influence gene expression that affect metabolism (Jump, 2002) and immune responses (Calder et al., 2012), and have impacts on reproduction of dairy cows (Santos et al., 2008). Ruminal microbes extensively hydrogenate unsaturated FA fed to lactat ing dairy cattle linolenic acids. Despite the limited intestinal flow of unsaturated FA, dairy cattle do not display any signs of essential FA deficiency, as obse rved in pre ruminant calves fed fat free diets (Cunningham and Loosli, 1954). Most likely, ruminants evolved conservation mechanisms to preserve and limit the disposal of essential FA to prevent deficiencies during periods of inadequate intake (Lindsay and Leat, 1977; Mattos and Palmquist, 1977). A major drain of essential FA is milk fat synthesis in lactating dairy cows, and estimates of duodenal supply relative to milk secretion indicate that, in many cases, milk secretion surpasses that of intestinal abs linolenic acid that is more extensively biohydrogenated (Avila et al., 2000). As other species, lactating dairy cows have a daily requirement for essential FA beyond milk fat synthesis. If s ecretion of essential FA is greater than intestinal absorption, then cows have to rely on stores of these essential nutrients. An important source of essential FA is blood plasma, but likely mobilization of lipid reserves from adipose tissue also contribut linolenic acids for milk synthesis during periods of negative essential FA balance. As milk production declines, DM int ake increases, and cows gain BW. I t is possible that reserves of essential FA are replenished in blood plasma and body fat such that they can be mobilized to meet the needs in early lactation (Roche et al., 2006; Roche et al., 2009; Gross et al., 2011). If true, then it is possible that altering

PAGE 56

56 dietary FA during the non lactating period might infl uence tissue composition and the supply of essential FA mobilized during early lactation. The effect on performance of dairy cows fed fat is influenced by when supplementation is initiated. Cows supplemented with fat in early lactation have improved milk p roduction, whereas supplementation in mid to late lactation may not necessarily increase production (Onetti and Grummer, 2004), but improve body fat reserves. Nevertheless, criticism of feeding fat prepartum exists, in part because experiments in the liter ature used diets with excessive amounts of supplemental FA (Grum et al., 1996). Limiting the dietary supply of essential FA might influence the response to feeding fat, particularly in early lactation when nutrient intake lags behind the needs for milk syn thesis. It was hypothesized that cows fed diets with limited concentrations of essential FA, particularly linoleic acid, would have decreased performance compared with cows supplemented with essential FA. Furthermore, it was expected that supplementation with saturated FA would not have similar effects on lactation performance to those of supplementing essential FA. Therefore, the objectives of the present study were to evaluate the effects of supplementing diets containing low amounts of FA with either mo stly saturated free FA or Ca salts containing essential FA during late gestation and early lactation on performance, energy metabolism, and metabolic status. Materials and Methods Two experiments were conducted at the University of Florida Dairy Unit (Ha gue, FL). Experiment 1 was conducted from October 2008 to early June 2009 and cows calved between December 2008 and March 2009. Experiment 2 was conducted from October 2011 to March 2012 and cows calved between October and December 2011. All experimental c ows were

PAGE 57

57 managed according to the guidelines approved by the University of Florida Institute of Food and Agricultural Sciences Animal Research Committee. Experiment 1 Study d esig n, animals, h ousi ng and f eeding The experiment was a completely randomized d esign with blocks. Weekly cohorts of cows were blocked by parity (nulliparous, n = 23 and parous, n = 53) and body condition and, within each block, randomly assigned to one of three treatments. Cows were allocated to treatments at 56 d before calving. Tre atments for the pre and postpartum periods were no fat supplementation pre and postpartum (control, n = 26), fat supplementation of 1.7 and 2.0% of dietary DM, respectively, added as mostly saturated free FA (SFA; Energy Booster100, Milk Specialties, Dun dee, IL; n = 25), and 2.0 and 2.4% of dietary DM, respectively, as Ca salts enriched with essential FA (EFA, Megalac R; Church & Dwight, Princeton, NJ; n = 25). The FA composition of the supplemental fat sources is depicted in Table 2 1. The amounts of sup plemental FA from SFA and EFA were based on the FA content of each supplement to ensure similar concentrations of supplemental FA in diets of cows supplemented with fat. The control diet fed pre and postpartum was formulated to contain low concentrations of FA, particularly linoleic acid, but meet the metabolizable protein and energy of a prepartum cow weighing 680 kg and consuming 10 kg of DM/d and of a postpartum cow weighing 620 kg and producing 38 kg of milk/d when consuming 23 kg of DM/d (Table 2 2; N RC, 2001). The total FA content of rations in which fat was supplemented was moderate and the supplies of linoleic linolenic acids were similar between control and SFA diets, but both differed from those of EFA diets. Because cows fed EFA received Ca salts of FA, the total Ca content of the pre and postpartum diets differed from those of cows fed control and SFA (Table 2 2).

PAGE 58

58 Cows were housed in sod based pens and fed in groups during the first 32 d of the study. At 255 d of gestation, cows were moved to a pen equipped with individual feeding gates (Calan gates, America Calan Inc., Northwood, NH) for measurements of daily DM intake. Cows were fed the prepartum diets an average of 56 d, and measurements of prepartum DM intake averaged 23.5 d per cow. Pr epartum diets were offered once daily at 10:00 h to allow 5% orts. Postpartum cows were housed in a free stall barn with sand beds equipped with individual feeding gates. Postpartum diets were fed twice daily, at 07:00 and 13:00 h and amounts were adjusted daily to allow for 5% orts. Amounts offered and refused were measured daily pre and postpartum. Dry matter intakes were calculated for the last 3 wk prepartum and the first 13 wk postpartum. Me asurements of m ilk and yield and c oncentrations of milk c omp onents Cows were milked twice daily at 06:00 and 18:00 h, and milk production was recorded at each milking for individual cows (AfiFlo milk meters, S.A.E. Afikim, Israel). Samples of milk were collected once weekly in two sequential milkings, morning and a fternoon, for measurements of concentrations of fat, true protein, lactose and somatic cells (SCC). Bronopol B 14 was used as a preservative and samples were sent to Southeast Milk laboratory (Belleview, FL) for analyses using a Bentley 2000 NIR analyzer. Milk yield from each sampling was taken into account to calculate the final concentration of milk components. Milk also was sampled on weeks 5, 6, and 7 postpartum and stored at 20 o C without preservative for later analyses of FA. Yields of milk corrected for 3.5% fat content (3.5% FCM) and for total solids (SCM) were calculated as: 3.5% FCM = 0.4324 x milk kg + (16.218 x milk fat kg); SCM = milk kg x [(12.24 x fat %) + (7.10 x protein %) + (6.35 x lactose %) 0.0345], respectively. Body weight, body condi tion s core , energy b alance , and f eed e fficiency Cows were weighed, using a digital scale, twice prepartum, at 55 and 23 d before calving, at calving, and then weekly postpartum. Postpartum BW was measured immediately after the

PAGE 59

59 morning milking. Concurrent w ith BW measurements, the body condition was scored using a 5 point scale (from 1 = emaciated to 5 = obese) divided into 0.25 points according to Fergusson et al. (1994), as depicted in the Elanco BCS chart (Elanco Animal Health, 2009). The BCS was evaluate d by the same person to minimize variation. Pre and postpartum net energy (NE) balances were calculated as: prepartum, NE balance = NE intake (NE for maintenance + NE for gestation); postpartum, NE balance = NE intake (NE for maintenance + NE of milk ). Net energy for maintenance was calculated using equations from NRC (2001) according to the BW of cows. The NE requirement for gestation was considered as 3.5 Mcal/d, based on the equation: NE (Mcal/d) = [(0.00318 x day of pregnancy 0.0352) x (calf bi rth weight/45)]/0.218. The day of pregnancy was considered the average day of gestation during the last 14 d of pregnancy, and calf birth weight. According to concentrations of fat, true protein, and lactose, milk NEL (Mcal/kg) was calculated as follows: [ (0.0929 x fat %) + (0.0563 x protein %) + (0.0395 x lactose %)]. Gross feed efficiency was calculated considering 3.5% FCM and DM intake (3.5% FCM/DM intake). Blood sampling and a nalyses Blood was sampled weekly before calving and then thrice weekly postp artum through 40 DIM. Blood was sampled by puncture of the coccygeal vein/artery into evacuated tubes containing K 2 EDTA (Vacutainer, Becton Dickinson, Franklin Lakes, NJ). Upon collection, tubes were placed immediately in ice and transported to the laborat ory within 4 h. Plasma was separated by centrifugation (2095 x g for 15 min, Allegra X 15R Centrifuge) and aliquots stored at 20 o C for later analyses. Plasma samples were analyzed for concentrations of NEFA according to Johnson and Peters (1993) using a c ommercial kit (NEFA C Kit; Wako Fine Chemical Industries USA, Inc.,

PAGE 60

60 Dallas TX), and BHBA using a commercial kit (Autokit 3 HB Cyclic Enzymatic method; Wako Diagnostics, Richmond, VA) according to the manufacturer guidelines. Concentration of urea N in plas ma was determined with a Technicon Autoanalyzer (Technicon Instruments Corp., Chauncey, NY) using a modification of Coulombe and Favreau (1963) and Marsh et al. (1965). The intra and inter assay CV were 1.9 and 4.3%, respectively. Glucose was analyzed usi ng the autoanalyzer following a modification of the method by Gochman and Schmitz (1972), and the intra and inter assay CV were 1.6 and 3.2%, respectively. Concentration of insulin in plasma was measured using a double antibody radioimmunoassay (Badinga e t al., 1991). The intra and inter assay CV were 8.0 and 8.5%, respectively. Insulin like growth factor 1 concentration was determined using an enzymatically amplified two step sandwich type immunoassay (DSL 10 2800 Active Non Extraction IGF 1 Elisa; Diagn ostic Systems Laboratories Inc., Webster, TX). The intra and inter assay CV were 4.7 and 8.4%, respectively. Fatty a cid a nalysis of plasma, m ilk f at, and fat s upplements Milk sampled on weeks 5, 6, and 7 postpartum were thawed and centrifuged (17,800 x g for 30 min at 8 o C) to isolate the milk fat. Subsequently, milk fat was composited by cow based on the fat yield of each of the milkings sampled, and the FA profile was analyzed by gas chromatography as described by Caldari Torres et al. (2011). Plasma s amples collected thrice weekly during weeks 1, 3, and 5 postpartum were pooled on a weekly basis to generate a 1.5 mL sample, which was subsequently freeze dried (Labconco, Kansas City, MO). The FA isolation and methylation of the fat supplements and freez e dried plasma samples were performed according to Kramer et al. (1997). Fatty acid methyl esters were determined using a Varian CP 3800 gas chromatograph (Varian Inc., Palo Alto, CA) equipped with auto sampler (Varian CP 8400), flame ionization detector, and a Varian capillary column (CP

PAGE 61

61 injector and detector temperatures were maintained at 250 o C. One microliter sample was injected via the auto sampler into the col umn. The oven temperature was set initially at 120 o C for 1 min, increased by 5 o C/min up to 190 o C, held at 190 o C for 30 min, increased by 2 o C/min up to 220 o C, and held at 220 o C for 15 min. The peak was identified and calculated based on the retention time a nd peak area of known standards. Experiment 2 Stud y design, animals, housing and f eeding The experiment was a complete randomized design with blocks. Cows were fed the control diet for the first 14 DIM. Cows were blocked by parity (primiparous [n=12] vs. m ultiparous [n=18]) and, within parity, by milk production from 6 to 10 DIM. Within each block, cows were assigned randomly to one of three dietary treatments as described in experiment 1. Treatments were administered for 90 d, from 15 to 105 DIM, and diets are depicted in Table 2 3. Measurements of milk and milk c omponents Cows were milked twice daily at 0600 and 1800 h. Individual yield of milk (AfiFlo milk meters, S.A.E. Afiki m , Israel) and concentrations of fat, true protein, and lactose (AfiLab on line real time milk analyzer, S.A.E. Afikim, Israel) were recorded by the Afikim milking system. The AfiLab system was calibrated each month, with data on milk composition from 480 cows analyzed by the Southeast DHIA laboratory in Bellview, FL. Concentrations o f milk components from each milking were used to calculate the daily yields of fat, protein, and lactose after adjusting for milk production during each milking. The same equations described for experiment 1 were used to calculate 3.5% FCM and SCM. Milk w as sampled during four consecutive milkings in week 10 of the study, when cows were 81 ± 3 DIM, and stored at 20 o C without preservative for later analysis for FA.

PAGE 62

62 Body weight, body condition s core , energy b alance , and feed e fficiency Cows were weighed im mediately after each milking using a walk through scale (AfiWeigh, S.A.E. Afiki m , Israel), and BW was averaged daily. Body condition was scored weekly as described for experiment 1. The same equations described for experiment 1 were used to calculate energ y balance and feed efficiency . Fatty a cid analysis of milk fat and p lasma Milk samples were thawed and composited based on the yield of fat at each milking sampled, and then centrifuged (17,800 x g for 30 min at 8 o fat using a gas chromatograph (Shimadzu America, Inc., Columbia, MD). The car rier gas was H, the split ratio was 5:1, and the injector and detector temperatures were maintained at 240 o C. One to 3 o C for 2 min, increased by 0.5 o C/min up to 155 o C , increased by 2 o C/min up to 235 o C, and maintained for 13 min. The standards utilized to identify the peaks were GLC 603, GLC 484 and GLC 90 (Nu Check Prep, Inc., Elysian, MN). On week 5 of the study, blood was sampled by puncture of the coccygeal vein/ar tery into tubes containing K 2 DTA (Vacutainer, Becton Dickinson, Franklin Lakes, NJ) and placed immediately in ice. Plasma was separated by centrifugation (2,100 x g for 15 min, Allegra X 15R Centrifuge) and then stored at 20 o C. An aliquot of 2 mL was free ze dried and the FA isolation and methylation was performed according to Kramer et al. (1997). Fatty acid methyl esters were determined using a Varian CP 3800 gas chromatograph (Varian Inc., Palo Alto, CA) equipped with auto sampler (Varian CP 8400), flame ionization detector, and a Varian capillary column (CP

PAGE 63

63 and the injector and detector temperatures were maintained at 250 o C. One microliter sample was injected via the aut o sampler into the column. The oven temperature was set initially at 70 o C for 3 min, increased by 30 o C/min up to 162 o C, increased by 0.5 o C/min up to 165 o C, increased by 0.6 o C/min up to 195 o C, held at 195 o C for 20 min, increased by 3.5 o C/min up to 220 o C, an d held at 220 o C for 6 min. The peaks were identified and calculated based on the retention time and peak area of known standards . Linoleic and Linolenic Acid Absorption, Secretion and Balance Linoleic and linolenic acid absorption for experiments 1 and 2 was estimated based on FA intake, using the fat sub model of the CPM Dairy software (CPM Dairy ver. 3.0.10; www.cpmdairy.net). Weekly averages of DM intake of each cow were entered into the software. Secretion of linoleic and linolenic acid in milk were calculated based on the weekly average of milk fat yield and the proportion of linoleic and linolenic acids detected in milk fat. Milk fat was a ssumed to be all triacylglycerol and a 10% discount was applied to account for the glycerol weight. This is an intermediate value of a diverging calculation from two different laboratories. According to Glasser et al. (2007a) the glycerol weight should rep resent 6.7% of milk fat, whereas Schauff et al. (1992) calculated that 12.0% should be accounted for the glycerol weight. Therefore the amounts of FA secreted in milk were calculated as follows: FA secretion (g/d) = [milk fat (g/d) x 0.90)] x FA in milk fa t (g/100 g of FA). To calculate linoleic and linolenic acids balance, a maintenance requirement of 183.5 and 91.7 mg/kg of BW 0.75 was considered for linoleic and linolenic acids, respectively. These requirements were based on human adequate intake of 2.0 and 1.0 % of the energy intake being linoleic and linolenic acid, respectively (Simopoulos, 2000). A standard 2,000 kcal diet for an average 70 kg human being was considered. The formula was as follows: FA balance (g/d) = {FA absorbed (g/d) [FA secreted in milk (g/d) + FA needed for maintenance (g/d)]}.

PAGE 64

64 Statistical Analyses Data were analyzed by the GLIMMIX procedure of SAS (SAS ver. 9.2, SAS Inst. Inc., Cary, NC) fitting either a Gaussian or Poisson distributions according to the type of data. Data with repeated measurements over time within the same experimental unit were analyzed with cow nested within treatment as the random error for testing the effects of treatment. Continuous data were tested for normality of residuals, and non normally distributed data were transformed before statistical analyses. All statistical models included the effects of treatment, parity, time, and interactions between treatment and parity, treatment and time, parity and time, and treatment and parity and time. The time refe rence for the model was either day or week, relative to calving. The models used in experiment 2 were the same as in experiment 1; however, pre treatment covariates measured when cows were fed a common diet were used for analyses of lactation performance f or experiment 2. The time reference of experiment 2 was either day or week relative to calving. Orthogonal contrasts were performed to determine the effect of supplemental fat (control vs. SFA + EFA) and source of FA (SFA vs. EFA) , and the interactions wit h parity . The covariance structure (compound symmetry, heterogeneous compound symmetry, autoregressive 1, criterion was used. For unequally spaced measurements, the spatial power covariance structure was used. The Kenward Roger method was used to calculate the denominator degrees of freedom to approximate the F tests in the mixed models. When a single measurement was determined for each cow, then the model included th e effects of treatment, parity, and interaction between treatment and parity. .

PAGE 65

65 Results Experiment 1 The duration of treatments prepartum did not d iffer ( P = 0.67) among treatments and averaged 56 d. Additionally, BW ( P = 0.41) and BCS ( P = 0.12) did not differ among treatments at enrollment, which averaged 524 ± 19 and 699 ± 12 kg, and 3.35 ± 0.07 and 3.30 ± 0.04 for nulliparous and parous cows, res pectively . Prepartum DM i ntake , b ody w eight and b ody c ondition Prepartum DM intake was not affected by feeding fat; however, cows fed EFA consumed less DM ( P = 0.03) compared with those fed SFA (control = 11.3, SFA = 11.4, and EFA = 10.2 ± 0.6 kg/d). Mean BW and BCS during the prepartum period were not influenced by diet and averaged 663 kg and 3.41, respectively. Although BW change was not affected by feeding fat, the reduced DM intake prepartum for cows fed EFA resulted in less ( P = 0.05) BW gain than tha t of cows fed SFA. Body weight gains prepartum were 1.1, 1.4, and 1.0 ± 0.2 kg/d, for cows receiving control, SFA, and EFA diets, respectively. Feeding fat did not affect the calculated mean NE balance prepartum. Although cows in all treatments were in pos itive energy balance, which averaged 2.1, 2.8, and 0.9 ± 0.9 Mcal/d, for cows receiving control, SFA, and EFA diets, respectively, the lower DM intake by cows fed EFA compared with SFA resulted in a 1.9 Mcal/d reduction ( P = 0.03) in NE balance . Postpartum DM i ntake , b ody w eight and b ody c ondition Postpartum DM intake was not affected by either feeding fat or source of supplemental FA, but an interaction ( P = 0.01) between FA and parity was detected. Primiparous cows fed EFA had the greatest postpartum DM i ntake followed by cows fed SFA and then control cows (15.1 vs. 16.5 vs. 17.5 ± 0.8 kg/d), whereas for multiparous cows, those fed EFA had the lowest intake followed by control and SFA cows (21.0 vs. 22.1 vs. 18.6 ± 0.8 kg/d).

PAGE 66

66 Energy balance was influenced by feeding fat ( P = 0.02) and by the type of FA fed ( P < 0.01). Control cows had the lowest balance of NE, whereas SFA cows had the highest, with EFA intermediate ( 2.1 ± 1.0 vs. 2.3 ± 0.8 vs. 0.9 ± 0.8 Mcal/d). An interaction ( P = 0.02) between feeding fat and parity was observed for NE balance because control primiparous cows had the lowest balance ( 3.4 vs. 2.7 vs. 1.3 ± 0.9 Mcal/d), whereas for multiparous cows, those fed EFA had the lowest NE balance ( 0.8 vs. 1.9 vs. 3.2 ± 0.9 Mcal/d). Despite the differences in energy balance, treatment did not influence the mean BW, the BW change, and the BCS of cows in the first 90 d postpartum (Table 2 4). Milk p roduction and c omposition and f eed e fficiency Yield of milk in the first 90 d postpartum was not inf luenced by feeding fat, but it was affected ( P = 0.06) by the type of FA fed because EFA cows produced more milk than cows fed SFA (Table 2 4 ; Figure 2 1 ). Yields of milk averaged 28.1, 25.8, and 30.7 ± 1.5 kg/d for primiparous and 35.3, 37.8, and 37.5 ± 1 .0 kg/d for multiparous cows fed control, SFA and EFA, respectively. The positive effect of source of FA was observed primarily in the primiparous cows, in which the milk yield increased 4.9 kg/d for EFA compared with SFA (interaction FA by parity P = 0.03 ). No treatment effect was observed for production of milk corrected for the contents of fat and of solids, and they averaged, respectively, 32.6 ± 1.1 and 28.9 ± 1.0 kg/d for control, 30.8 ± 0.9 and 27.4 ± 0.8 kg/d for SFA, and 32.8 ± 1.0 and 29.2 ± 0.9 k g/d for EFA. The concentration of fat in milk was affected by feeding fat ( P < 0.01), but there was no difference between sources of FA, and averaged 3.76 ± 0.10, 3.33 ± 0.08, and 3.32 ± 0.09 % for cows fed the control, SFA, and EFA diet, respectively (Tab le 2 4). Fat yield was not affected by feeding fat, but tended ( P = 0.10) to be greater for cows fed EFA than SFA (control = 1.16 ± 0.04 vs. SFA = 1.05 ± 0.04 vs. EFA = 1.12 ± 0.04 kg/d). Concentrations of true protein and lactose in milk were not influenc ed by treatment. Although protein yield was not affected by

PAGE 67

67 feeding fat, it increased (P = 0.05) when cows were fed EFA compared with SFA (control = 0.87 ± 0.03 vs. SFA = 0.87 ± 0.03 vs. EFA = 0.94 ± 0.03 kg/d). An interaction ( P = 0.04) between the type o f FA and parity was observed for protein yield because most of the benefit from feeding EFA was observed in primiparous cows. The NE for lactation content of milk was less ( P < 0.01) for cows supplemented with fat, but it did not differ between those fed S FA or EFA. The SCS was not influenced by dietary treatments and averaged 2.27. Cows fed fat tended ( P = 0.09) to be more efficient converting feed into milk, and those fed EFA were more efficient ( P < 0.01) than cows fed SFA. An interaction ( P < 0.01) betw een feeding fat and parity was detected because for primiparous cows, those fed the control diet were more efficient than those fed fat (2.0 vs. 1.5 vs. 1.7 ± 0.1), whereas the opposite was observed for multiparous cows (1.8 vs. 1.8 vs. 2.1 ± 0.1). Fatty a cid p rofile of m ilk and p lasma Supplementation with fat, as well as the type of FA fed, had major impacts on the FA profile of milk fat (Table 2 5). Control cows had milk fat with greater proportions of short and medium chain FA (< 16 C) than cows fed fat. The opposite response was observed for FA with greater than 16 C. Within cows supplemented with fat, those fed EFA produced milk with greater proportion of pre formed long chain FA than cows fed SFA. Supplementing the diets with fat reduced ( P < 0.001) th e proportion of saturated FA in milk fat, and this effect was more pronounced ( P < 0.01) in those fed EFA than SFA. Conversely, cows fed fat, particularly those fed EFA produced milk with a greater ( P < 0.001) proportion of polyunsaturated FA than cows fed either control or SFA (3.62 ± 0.21, 4.91 ± 0.17, and 6.35 ± 0.18 g/100g of FA). The positive effect of feeding fat, particularly EFA, on the polyunsaturated FA content was, in part, because of the increased ( P < 0.001) proportions of the essential FA lino leic and linolenic acids in milk fat. The FA known to cause milk fat depression, C18:2 trans 10, cis 12, increased with feeding fat

PAGE 68

68 ( P < 0.001) and with the type of FA supplemented ( P < 0.001). In fact, cows fed fat, particularly those fed EFA, had the greate st concentrations of total conjugated linoleic acid (CLA) , monoenoic C18 trans FA, and total trans FA (Table 2 5). Because of the increased dietary supply of n 6 and n 3 FA with EFA supplementation, both feeding fat ( P < 0.001) and type of FA ( P < 0.001) a ltered the content of all n 6 and n 3 FA in milk fat. This resulted in a greater ( P < 0.001) ratio of n 6 to n 3 FA in milk fat of cows fed fat, particularly those fed EFA. The transfer efficiency of dietary linoleic acid into milk fat was affected ( P < 0 .01) by the type of FA. Feeding fat did not influence ( P = 0.76) the transfer efficiency of linoleic acid. Cows fed the control diet had intermediate transfer efficiency for linoleic acid transfer, and it was greatest for SFA and lowest for EFA (21.9 ± 1.4 vs. 25.4 ± 1.1% vs. 19.4 ± 1.2%). On the other linolenic acid into milk fat was not affected by feeding either fat ( P = 0.68) or source of FA ( P = 0.69) and it averaged 9.5 ± 0.5, 9.9 ± 0.4, and 9.6 ± 0.5% for co ntrol, SFA, and EFA, respectively. Plasma FA composition followed a similar pattern to that of milk FA (Table 2 6). The proportion of saturated FA in plasma decreased ( P = 0.02) with feeding fat, particularly when cows received EFA compared with SFA ( P < 0.01). The concentration of saturated FA in plasma was highest for control cows, followed by cows fed SFA, and then by cows fed EFA (33.3 ± 0.3 vs. 33.1 ± 0.3 vs. 31.6 ± 0.3 g/100g of FA). The concentration of linoleic acid in plasma of cows increased ( P < 0.001) with feeding fat and with type of FA. Cows fed EFA had the greatest concentration of linoleic acid in plasma, followed by those fed SFA and then control. On the other hand, feeding fat reduced ( P linolenic acid in pla sma, particularly when EFA was fed compared with SFA ( P < 0.001). Because linoleic acid was the predominant unsaturated FA in plasma of cows, feeding fat, particularly EFA increased ( P <

PAGE 69

69 0.001) the concentration of total polyunsaturated FA in plasma. The c hanges in concentrations of linolenic acids altered the ratio of n6 to n3 FA in plasma of cows. Feeding fat tended ( P = 0.09) to influence the ratio mostly because EFA increased ( P < 0.001) the ratio compared with cows fed SFA . Plasma m etabo li tes and h ormon es The concentrations of NEFA were affected ( P = 0.01) by an interaction between feeding fat and parity. For primiparous cows, those fed fat had less NEFA than control cows (control = 431.7 ± 39.7 vs. SFA = 316.7± 28.0 vs. EFA = 341.1 ± 31 .3 µM), whereas for multiparous cows, feeding fat increased plasma NEFA (control = 467.7 ± 19.3 vs. SFA = 463.6 ± 22.8 vs. EFA = 522.4 ± 21.4 µM). These differences in plasma NEFA according to feeding fat seem to have occurred only after 2 wk postpartum (F igure 2 2). The plasma concentrations of BHBA were not influenced ( P = 0.45) by feeding fat. However, cows fed EFA had greater ( P < 0.001) BHBA concentrations than those fed SFA (Table 2 7). Furthermore, an interaction ( P < 0.001) between type of FA and p arity was detected because the increase in BHBA for cows fed EFA was observed only in multiparous cows (Figure 2 3). Feeding fat did not affect the concentrations of glucose in plasma, but the latter were greater ( P < 0.001) for cows fed SFA than EFA (Tab le 2 7). Similar to glucose, feeding fat did not affect the concentrations of insulin; however, cows fed SFA had greater ( P < 0.001) insulin concentrations in plasma than cows fed the EFA. An interaction ( P = 0.05) between feeding fat and parity was observ ed for plasma concentrations of IGF 1. For primiparous cows, feeding supplemental fat increased concentrations of IGF 1 (control = 58.4 ± 10.7 vs. SFA = 74.5 ± 7.5 vs. EFA = 77.2 ± 8.4 ng/mL), whereas no difference was observed for multiparous cows (contro l = 39.3 ± 5.2 vs. SFA = 36.2 ± 6.2 vs. EFA = 22.7 ± 5.9 ng/mL). An interaction ( P = 0.02)

PAGE 70

70 between feeding fat and parity was also detected for plasma urea N. For primiparous cows, feeding fat reduced urea N (control = 13.2 ± 0.5 vs. SFA = 12.2 ± 0.4 vs. E FA = 12.2 ± 0.4 mg/dL), whereas for multiparous cows feeding fat had no effect on concentrations of urea N in plasma (control = 11.3 ± 0.3 vs. SFA = 12.0 ± 0.3 vs. EFA = 11.9 ± 0.3 mg/dL) . l inolenic a cid a bsorption, s ecretion, and b alance The estimated intestinal absorption of linoleic acid increased ( P < 0.001) with fat supplementation, and this increase was greater ( P < 0.001) in cows fed EFA than SFA cows (Table 2 8). The secretion of linoleic acid in milk fat followed the same pattern as the estimated intestinal absorption. It increased (P < 0.001) with feeding fat and the increase was greater ( P < 0.001) for EFA than SFA. The resulting balance of linoleic acid was negativ e throughout the study for cows fed control and SFA (Table 2 8; Figure 2 4), but it became positive in EFA cows after week 5 postpartum. linolenic acid, the estimated intestinal absorption, milk secretion, and balance followed similar patterns as those for linoleic acid. Cows fed the EFA diet had increased ( P < 0.001) estimated intestinal absorption and milk secretion, and the least n linolenic acid balance (Table 2 linolenic acid balance after 8 wk postpartum, whereas control and SFA cows remained in negative balance throughout the study (Figure 2 5). Experiment 2 Lactational p erfor mance Experiment 2 utilized cows only during the early postpartum period, and the DM intake was not affected by either feeding fat or by the type of supplemental FA fed (Table 2 9). Cows fed fat had greater ( P < 0.001) yields of milk, 3.5% FCM and SCM than control cows. In addition, the type of FA supplemented to cows also influenced production. Cows fed EFA

PAGE 71

71 produced more ( P < 0.01) milk and 3.5% FCM and tended ( P = 0.07) to produce more SCM than cows fed SFA. Concentration of fat in milk tended ( P = 0.08) to increase with feeding fat, but no difference was observed between SFA and EFA. Because both milk yield and fat content increased with feeding fat, the milk fat yield was also greater ( P < 0.001) for SFA and EFA than controls, and that of EFA was greater ( P = 0.02) than SFA. Concentrations of protein and lactose did not differ between treatments; however, as a consequence of the greater milk production, both protein and lactose yields increased ( P < 0.001) with feeding fat, and they were greater ( P < 0.01 ) for cows fed EFA than SFA. The numerical differences in milk composition resulted in a tendency ( P = 0.09) for increased NE content of milk when cows were fed fat, but no difference was observed between the two sources of supplemental FA. The efficiency of feed conversion into 3.5% FCM increased ( P = 0.04) with feeding fat, but there was no difference between type of FA fed (Table 2 9). The NE balance did not differ between control and fat supplemented cows, but it tended ( P = 0.10) to be more positive fo r SFA than EFA. After discounting the NE required for maintenance from the caloric intake, the NE available for milk synthesis was greater ( P < 0.05) with feeding fat and averaged 27.0 ± 1.1, 29.8 ± 1.1 and 29.8 ± 1.1 Mca l /d for control, SFA, and EFA cows. No difference was observed for NE available for milk synthesis between the two types of supplemental FA. The mean BW, BW changes, and BCS were similar among the three treatments . Fatty a cid p rofile of m ilk and p lasma As in experiment 1, the FA profile o f milk fat was markedly altered by feeding fat and by the type of FA supplemented to cows (Table 2 10). The concentration of short and medium chain FA was less ( P = 0.03) for cows supplemented with fat compared with controls. On the other hand, feeding fat increased ( P = 0.01) the concentrations of FA with more than 16 C. Cows supplemented with EFA had less ( P = 0.01) saturated FA in milk than those fed SFA. In fact, the

PAGE 72

72 milk of cows fed EFA contained more ( P < 0.001) polyunsaturated FA because of increased proportion of n 6 FA. The increase in n 6 FA, with little change in total n 3 FA, resulted in milk of cows fed fat containing a greater ( P = 0.02) ratio of n 6 to n 3 FA, particularly those supplemented with EFA compared with SFA. The concentrations of mo st C18:1 trans increased with feeding EFA, whereas minor effects of dietary treatments were observed for the concentrations of FA with 20 or more C. Feeding EFA to lactating dairy cows increased ( P = 0.02) the concentration of linoleic acid in plasma comp ared with cows fed SFA, but decreased ( P linolenic and total n 3 FA in plasma (Table 2 11). The total concentration of n 6 FA tended ( P = 0.08) to be greater for cows fed EFA than for cows fed SFA, with no overall effect of feeding fat. Cows fed fat had greater ( P = 0.02) ratio of n 6 to n 3 FA than controls, and this effect was observed primarily because of feeding EFA. In general, the transfer efficiency of dietary essential FA into milk fat was not affected by either feeding fat or t ype of supplemental FA in experiment 2. For linoleic acid, the transfer efficiencies were 13.38 ± 0.72, 13.88 ± 0.72, and 13.89 ± 0.72% for control, SFA, and EFA, respectively, and neither feeding fat ( P = 0.57) nor type of FA ( P = 0.99) affected them. For linolenic acid, the transfer efficiencies were not altered by feeding fat ( P = 0.48) or by the source of FA fed ( P = 0.12) and averaged 9.15 ± 0.34, 9.24 ± 0.34 and 8.48 ± 0.34% for control, SFA and EFA . Linoleic and l inolenic a cids a bsorption, s ecretio n and b alance Similar to the results of experiment 1, the estimated intestinal absorption of linoleic and linolenic acids increased ( P < 0.01) with feeding fat primarily because of supplementation with EFA. Cows fed EFA had greater ( P < 0.001) estimated intestinal absorption of the two essential FA than cows fed SFA (Table 2 linolenic acids was similar

PAGE 73

73 between control and SFA, but increased ( P < 0.02) with feeding EFA. Cows fed control and SFA were in negative balance of essential FA throughout the study, whereas those fed EFA reached a linolenic acid after week 12 postpartum. Discussion Feeding fat, particularly EFA, improved lactation performance of dairy cows fed diets containing small concentrations of FA. The benefits of supplementing diets with EFA were more apparent in primiparous cows in experiment 1 but occurred in all cows in experiment 2. Supplementing diets of dairy cows with FA during late gestation and early lactation has been controversial. When fat is fed in excess, particularly with sources of unsaturated FA, it can suppress appetite and reduce DM intake (Allen, 2000). In the current study, feeding diets supplemented with EFA reduced DM intake prepartum despite the limited amounts of total FA fed. However, feeding fat or altering the type of FA of the supplemental fat source had no effect on DM intake postpartum in both experiments. One of the proposed mechanisms involved in reduction o f DM intake by supplemental FA is the increased secretion of gut peptides that signal satiety (Choi et al., 2000; Bradford et al. 2008). This has been suggested because of the observed increases in concentrations of cholecystokinin (CCK) and glucagon like peptide 1 (GLP 1) when cows are fed fat (Choi et al., 2000; Bradford et al. 2008) . Nevertheless, when wethers were infused intravenously with increasing amounts of either CCK or GLP 1, DM intake did not decrease (Relling et al., 2011), therefore, suggestin g that changes in individual gut peptides with feeding fat might not be the causative signals or simply insufficient to induce satiety. Excessive amounts of unsaturated FA might also influence intake by affecting diet acceptability, the rumen microflora an d fermentation, gastrointestinal motility, supply of substrate for hepatic oxidation, or simply by

PAGE 74

74 meeting the caloric needs of the cow. Collectively, it is possible that multiple mechanisms explain the reduced DM intake of transition cows when supplemente d with FA. Although an overall decrease in DM intake is expected with feeding fat (Onetti and Grummer, 2004; Rabiee et al., 2012), the magnitude of depression in intake depends on the type and amounts of supplemental fat fed. In general, abomasal infusion of large quantities of fat, particularly those containing large proportion of unsaturated FA suppress intake (Bremmer et al., 1998). In many cases, the amounts of supplemental fat fed that reduced DM intake were either excessive or at least in the upper li mit of those recommended for dairy cows (Allen, 2000), particularly in studies with prepartum cows (Grum et al., 1996; Damgaard et al., 2013). An increase in milk production is one of the most recognizable effects of feeding supplemental fat. Two systemat ic reviews of the literature documented the beneficial effects of feeding FA to dairy cows on production performance and efficiency of milk production (Onetti and Grummer, 2004; Rabiee et al., 2012). In both cases, milk production responses to feeding supp lemental FA averaged approximately 1 kg/d, and a large portion of the variation in production responses were caused by interactions between the source of FA and the composition of the basal diet offered. Onetti and Grummer (2004) documented an increased re sponse to FA supplementation when feeding started at the beginning of the lactation. The authors also observed that cows on high corn silage diets respond better to fat sources that are more rumen inert such as those in the form of Ca salts or saturated fr ee fatty acids. In both experiments presented herein, cows were fed control diets with limited amounts of FA, particularly unsaturated FA. In experiment 2, special attention was made to formulate diets with sufficient total and forage NDF to avoid negative associative effects between dietary fat and highly fermentable carbohydrates.

PAGE 75

75 Two different presentations of fat supplements were used in the experiments reported in this study, Ca salts and prilled saturated free FA. The two choices were based on the FA profile and the fact that others have evaluated the responses of dairy cattle when fed supplemental fat with the goal of increasing the caloric density of the diet. In recent systematic reviews of the literature, the use of Ca salts of FA in large quantit ies were more detrimental to intake, particularly when made of unsaturated FA, than feeding saturated free FA (Allen, 2000; Rabiee et al., 2012). Minor differences in production were observed when cows were fed either saturated free FA or Ca salts of FA (R abiee et al., 2012). Therefore, it is unlikely that presentation of the FA supplemented either as Ca salts or a prilled FA influenced responses of cows, particularly with the low total dietary FA content and the low inclusion of supplemental fats in SFA an d EFA. In experiment 1, supplementing diets with EFA starting prepartum improved milk yield, and most of the benefit was observed in primiparous cows. When balance of essential FA was estimated, it was observed that cows fed control and SFA were in negati ve balance of linoleic linolenic acids longer than cows fed EFA. Even when no specific requirement for linolenic acids secreted in milk surpassed those of estimated intestinal absorption for cows fe d control and SFA. These results corroborate with those of the published literature that demonstrated greater milk secretion of essential fatty acids than intestinal absorption in mid lactation cows (Christensen et al., 1998; Avila et al., 2000). Therefore , it is plausible to suggest that early lactation dairy cows, when fed diets with limited amounts of polyunsaturated FA, undergo periods of negative balance of essential FA and have to draw on tissue reserves to maintain milk fat secretion and tissue needs of these FA. It is suggested that the benefits of supplementing EFA to early lactation cows, particularly when

PAGE 76

76 compared with SFA, might have been caused by supplying additional essential FA for intestinal absorption that are needed for tissue metabolism a nd milk synthesis. In experiment 2, the greater magnitude of milk response when cows were fed EFA, suggests that increasing the supply of essential FA results in partition of more calories toward milk synthesis, resulting in less positive NE balance. There fore, it is possible that, when essential FA are limiting, supplementing diets linolenic acids will increase availability of FA for milk synthesis and may improve partition of nutrients for milk synthesis. Feedin g fat generally results in small increases in the plasmatic concentration of NEFA in dairy cows (Drackley, 1999). This increase in plasma NEFA, combined with supply of more lipogenic compounds during the period in which blood lipids are already high has be en prone to criticism. However, the extent of increase in NEFA because of feeding fat is usually small and of lesser magnitude than the rise in NEFA concentrations observed with the onset of lactation (Grummer, 1993). Homeorhetic adaptations with lactation associated with inadequate DM intake result in extensive lipolysis in the first weeks postpartum (Grummer, 1993; Drackley, 1999). Nevertheless, the increases in NEFA and BHBA in the first weeks postpartum seem to be influenced more by unbalances between D M intake and milk yield, than by specific dietary components. In the present study, the patterns of NEFA concentrations in plasma seemed to follow the NE balance of cows. Cows that produced more milk with similar or less intake were in more negative NE bal ance and had increased plasma concentrations of NEFA. In experiment 1, treatments that resulted in increased plasma NEFA also caused reduced concentrations of insulin in plasma. Insulin is known to affect rates of lipolysis (Ahmadian et al., 2010), and red uced insulin likely explains the increased NEFA in plasma of cows fed EFA. Feeding EFA increased BHBA concentrations in plasma of multiparous cows in the postpartum period. Others

PAGE 77

77 have shown that feeding diets with high fat content stimulated hepatic oxida tion of FA and resulted in elevated plasma BHBA (Grum et al., 1996). Therefore, the increments in plasma BHBA of multiparous cows fed EFA were likely the result increased hepatic uptake of NEFA consequent to more pronounced negative NE balance and reduced concentrations of insulin in plasma. One of the concerns with feeding unsaturated FA is the risk of milk fat depression. Supplementing diets with polyunsaturated FA, mainly to those with low forage or high starch, favors changes in the pattern of rumen bi ohydrogenation that result in accumulation of FA isomers that suppress mammary lipogenesis (Bauman et al., 2011). Diet induced milk fat depression is typically characterized by a decrease in total FA, mostly those synthesized de novo, which are of short an d medium C chain length (Chilliard et al., 2007). In experiment 1, feeding fat reduced milk fat content regardless of the type of FA fed. In that experiment, postpartum diets had approximately 30% total NDF, which is thought to be adequate for lactating da iry cows (NRC, 2001), but was substantially less than what was present in the diets in experiment 2. In experiment 2, a portion of the non fibrous carbohydrates was replaced with NDF from soybean hulls, which might have minimized potential changes in rumen pH and avoided depression in milk fat. In fact, in experiment 2, milk fat content and yield were either unchanged or improved in cows fed fat, mostly in those fed EFA. One of the CLA isomers that induce milk fat depression is the trans 10 cis 12 (Baumgard et al., 2000). It depresses milk fat synthesis by inhibiting gene expression and enzymatic activity of key lipogenic enzymes important for de novo synthesis of FA (Baumgard et al., 2002). In experiment 1, diets that resulted in reduced milk fat content al so had increased concentrations of C18:2 trans 10 cis 12 and total trans FA. In general, feeding Ca salts of unsaturated FA decreases milk fat content (Rabiee et al., 2012), and

PAGE 78

78 this effect is likely mediated by the release of unsaturated FA with increased amount of substrate for synthesis of CLA . However, the same mechanism is unlikely when cows were fed SFA, which also depressed milk fat content in experiment 1. Perhaps, addition of fat to a diet with moderate forage and total NDF resulted in negative ass ociative effects that altered patterns of biohydrogenation of unsaturated FA from the basal dietary ingredients. Interestingly, when cows were fed more dietary NDF in experiment 2, feeding fat or EFA did not influence milk fat content or affect the concent rations of CLA in milk fat. The transfer efficiency of long chain FA from absorption to the mammary gland varies considerably between studies (Chilliard et al., 2007; Moate et al., 2008). However, it is observed consistently that feeding more polyunsatura ted FA increases the concentrations of these FA in milk fat (Harvatine and Allen, 2006; Caldari Torres et al., 2011). The extent to which dietary FA influences milk FA composition varies largely with diet, type of forage, grain to concentrate ratio, type o f grain, and the source of supplemental FA fed (Chilliard et al., 2007). In general, the transfer of the absorbed linoleic acid to milk ranges from 40 to 60% (Chilliard et al., 2007; Moate et al., 2008). In the current study, transfer efficiency of essenti al FA was calculated based on the intake of these FA, and not based on the amounts absorbed, which were not quantified. Therefore, because of biohydrogenation, it is expected that transfer efficiency of ingested unsaturated FA would be less than transfer e fficiency of absorbed unsaturated FA (Chilliard et al., 2007). For dietary linoleic acid, the transfer efficiency ranged from 22% in experiment 1 to linolenic, the transfer efficiencies averaged 9.7 and 8.8% for experimen ts 1 and 2, respectively. The larger difference in transfer efficiency for linoleic acid between experiments 1 and 2 was likely caused by the greater content and intake of linoleic acid from the basal diet. If the transfer efficiencies of intestinally abs orbed FA of 40 to 60% were

PAGE 79

79 applied to the cows in the current study, with the expected intestinal supply of polyunsaturated FA (Avila et al., 2000), cows fed control and SFA diets would have to mobilize substantial linolenic acids to meet the needs of the mammary gland for the corresponding amounts of these FA secreted in milk fat. The FA profile of the plasma followed the same pattern observed for milk FA. Feeding EFA was effective in changing the FA profile of the plasma with inc reased concentration of linoleic acid. Conversely, feeding the control diet increased the plasmatic concentration of saturated FA. In general, the proportion of essential FA in plasma is always greater than the proportion observed in the duodenal chime (Do reau et al., 2009). A high correlation between linolenic acid (Glasser et al., 2007b; Chilliard et al., 2007). Plasma seems to be the major reservoir of essential FA, and this high proportion o f essential FA might be related to differential extraction and metabolism between essential and non linolenic acids are spared for more critical biological functions (Chilliard et al., 2007). It is well known that lactose is the milk component that regulates milk volume (Bines and Hart, 1982). However, it is possible that essential FA could exert some influence in milk synthesis by affecting mammary gland metabolism and milk fat synthesis. In diet s without any supplemental FA, linoleic acid typically represents 2 to 3.2 % of the milk FA (Avila et al., 2000; Chilliard et al., 2007). It is known that a certain amount of unsaturated FA and branched chain FA, and the ratio of short to long chain FA are needed to maintain fluidity of cell membranes and for proper assembly of the milk fat globule during secretion of triglycerides in milk (Keenan et al., 1970; Keenan and Patton, 1970). Therefore, it is plausible to hypothesize that limiting the supply of e ssential FA might have some impact on lactation performance and could explain some

PAGE 80

80 of the positive effects of feeding EFA on milk synthesis in the current experiments. In rats, lactation success, represented by litter weight and survival, was profoundly co mpromised when fat free diet or low amounts of essential FA were fed to the dams (Deuel et al., 1954). Even though there are many reasons for the impaired growth of the offspring, low milk production by the dams cannot be ruled out. Because newborns are su sceptible to essential FA deficiency, an assumption from the evolutionary point of view is that a minimum amount of unsaturated FA are needed in milk to supply essential FA to the newborn. Therefore, although speculative, under a limited supply of essentia l FA, mammary cells of a cow might have synthesis of milk reduced, milk synthesis. This concept could help explain the increments in milk production when cows fed d iets with limited amounts of unsaturated FA were supplemented with EFA . Conclusion Dairy cows in late gestation and early lactation fed diets with limited concentrations of essential FA, particularly linoleic acid, had reduced performance compared with cow s fed diets supplemented with fat. When feeding fat was initiated prepartum, the benefits were observed for primarily in primiparous cows fed EFA. When feeding fat started in early lactation, the benefits to feeding fat were observed for both primiparous a nd multiparous cows supplemented with SFA and EFA. Nevertheless, greater improvements in lactation performance occurred when EFA was supplemented to a diet containing limited amounts of FA. Feeding fat altered milk and plasma FA composition, and resulted i linolenic acids in milk, but also having a greater estimated absorption and balance of these essential FA. Supplementing diets low in FA with Ca salts containing EFA improved essential FA balance and lactation p erformance of dairy cows .

PAGE 81

81 Table 2 1. Fatty acid (FA) profile of fat supplements (% of identified fatty acids) SFA EFA Ash, % of DM 0.2 14.5 Fatty acids, % of DM 94.0 84.1 Fatty acids, g/100 g of FA C8:0 0.77 ± 0.00 ND C10:0 0.36 ± 0.00 ND C12:0 0.68 ± 0.01 0.30 ± 0.01 C14:0 4.61 ± 0.00 0.75 ± 0.03 C15:0 0.61 ± 0.00 ND C16:0 36.23 ± 0.0.06 34.26 ± 0.31 C16:1 cis 9 ND 0.14 ± 0.01 C17:0 1.79 ± 0.00 0.13 ± 0.01 C18:0 49.91 ± 0.05 4.54 ± 0.01 C18:1 cis 9 ND 27.10 ± 0.02 C18:2 cis 9, cis 12 ND 27. 39 ± 0.17 C18:3 cis 9, cis 12, cis 15 ND 2.27 ± 0.00 C20:0 0.78 ± 0.00 0.32 ± 0.00 Other FA 4.26 ± 0.01 2.81 ± 0.20 1 SFA = mostly saturated free fatty acids (Energy Booster100; Milk Specialties, Dundee, IL); EFA = Ca salts containing essential fatty acid s (Megalac R; Church & Dwight, Princeton, NJ); ND = Not detected.

PAGE 82

82 Table 2 2. Ingredient and chemical composition of experimental diets during pre and postpartum periods fed to cows receiving no fat supplement (control), mostly saturated free fatty aci ds (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 Prepartum Postpartum Control SFA EFA Control SFA EFA Ingredient, % of DM Bermuda silage 56.0 56.0 56.0 10.8 10.8 10.8 Alfalfa hay 34.4 34.4 34.4 Ground barley 8.0 8.0 8.0 27.7 27.6 27.6 Peanut meal 10.0 10.0 10.0 7.5 7.4 7.4 Citrus pulp 21.9 20.2 19.9 14.9 13.1 12.7 Saturated free fatty acids 1 1.7 1.9 Ca salts of fatty acids 2 2.0 2.4 Minera l mix 3 4.1 4.1 4.1 4.7 4.7 4.7 Nutrient composition, DM basis NE for lactation, 4 Mcal/kg 1.42 1.49 1.50 1.59 1.67 1.67 Crude protein, % 14.0 ± 1.5 13.9 ± 1.4 14.1 ± 1.3 16.7 ± 1.0 16.3 ± 1.0 16.4 ± 1.3 Starch, % 6.7 6.8 6.8 16.4 16.4 16.4 N on fibrous carbohydrates, 5 % 28.2 ± 2.8 25.2 ± 3.1 25.6 ± 1.5 42.0 ± 2.3 41.9 ± 2.9 39.8 ± 2.4 NDF, 5 % 47.0 ± 2.6 48.2 ± 2.4 47.4 ± 1.6 29.5 ± 1.9 29.1 ± 2.5 29.9 ± 1.9 NDF from forage, % 37.6 ± 1.4 37.6 ± 1.4 37.6 ± 1.4 19.0 ± 1.5 19.0 ± 1.5 19.0 ± 1 .5 ADF, 5 % 25.6 ± 2.6 25.3 ± 2.5 25.5 ± 2.3 16.8 ± 1.6 16.2 ± 1.9 16.8 ± 2.1 Fatty acids, 6 % Total 1.99 3.62 3.65 1.98 3.79 3.96 C18:2 cis 9, cis 12 0.49 0.48 0.94 0.60 0.59 1.14 Ca, % 1.41 1.47 1.67 1.36 1.29 1.60 P, % 0.29 0.28 0.30 0.34 0 .34 0.32 Mg, % 0.38 0.38 0.41 0.38 0.35 0.37 K, % 1.35 1.34 1.34 1.45 1.42 1.40 Cl, % 0.76 0.76 0.80 0.47 0.43 0.52 Na, % 0.17 0.17 0.20 0.62 0.50 0.50 1 Energy Booster 100 (Milk Specialties, Dundee, IL).

PAGE 83

83 2 Megalac R (Church & Dwight, Princeton, NJ ). 3 Prepartum, contains (DM basis) 34.5% corn meal, 12.0% ammonium chloride 5.0% dicalcium phosphate, 16.0 calcium carbonate, 10% calcium sulfate, 5% magnesium oxide, 10% magnesium sulfate, 4% sodium chloride, 1.7% Zinpro 4 plex (Zinpro, Eden Prairie, MN) , 0.4% Rumensin 80 (Elanco Animal Health, Greenfield, IN), 0.35% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.002% Ca iodate, and a vitamin premix. Each kg contains 24.5% CP, 9.8% Ca, 1.5% P, 4.2% Mg, 3.2% S, 1.7% Na, 10.7 % Cl, 475 mg Zn, 1 60 mg of Cu, 456 mg of Mn, 7.4 mg of Se, 37.4 mg of Co, 13.2 mg of I, 118,000 IU of vitamin A, 27,500 IU of vitamin D, 2,600 IU of vitamin E, and 770 mg of monensin. 3 Postpartum, contains (DM basis) 30.8% blood meal, 30.5% sodium bicarbonate, 12.0% dical cium phosphate, 6.0% magnesium oxide, 4.8% magnesium sulfate heptahydrate, 2.9% sodium chloride, 0.12% manganese sulfate monohydrate, 0.06% zinc sulfate, 2.9%, MetaSmart (Adisseo, Atlanta, GA), 0.25% Zinpro 4 Plex (Zinpro Co., Eden Prairie, MN), 0.45% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.25% Rumensin 80 (Elanco Animal Health, Greenfield, IN), and vitamin and iodine premix. Each kg contains 28.5% of CP, 6.3% of Ca, 1.2% of P, 3.9% of Mg, 10.5% of Na, 3.1% of Cl, 587 mg of Zn, 124 mg o f Cu, 654 mg of Mn, 9.6 mg of Se, 25 mg of Co, 13 mg of I, 131,000 IU of vitamin A, 36,000 IU of vitamin D, 1,200 IU of vitamin E, and 470 mg of monensin. 4 Net energy of diets considering 12 and 21 kg/d of DM intake for the pre and postpartum periods, re spectively, (CPM dairy). 5 Nonfibrous carbohydrates calculated as: 100 (NDF + CP + EE + Ash); NDF = neutral detergent fiber; ADF = acid detergent fiber. 6 Calculated based on FA analysis.

PAGE 84

84 Table 2 3. Ingredient and chemical composition of experimental diets fed postpartum to cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 2 Control SFA EFA Ingredient, % DM Bermuda silage 8.9 8.9 8.9 Alfalfa hay 6.1 6.1 6.1 Corn silage 20.4 20.4 20.4 Citrus pulp 9.8 9.8 9.8 Corn grain, finely ground 14.3 12.5 12.1 Soybean hulls 20.4 20.4 20.4 Soybean meal, cooker processing 1 5.3 5.3 5.3 Soybean meal, solvent extract 9.9 10.1 10.3 Molasses 1.6 1.6 1.6 S aturated free fatty acids 2 1.6 Ca salts of fatty acids 3 1.8 Mineral mix 4 3.3 3.3 3.3 Nutrient composition, DM basis NE for lactation, 5 Mcal/kg 1.63 1.68 1.68 Crude protein, % 16.6 ± 0.8 16.6 ± 0.8 16.5 ± 0.8 Starch, % 17.6 16.3 16.0 Non fibrous carbohydrates, 6 % 35.9 ± 2.0 34.5 ± 1.9 35.3 ± 1.9 NDF, 6 % 38.5 ± 2.4 38.3 ± 2.3 38.3 ± 2.4 NDF from forage, % 17.8 ± 0.8 17.8 ± 0.8 17.8 ± 0.8 ADF, 6 % 15.9 ± 1.0 15.9 ± 1.1 15.8 ± 1.0 Fatty acids, 7 % Total 2.66 ± 0.10 3.99 ± 0.14 4.14 ± 0.13 C18:2 cis 9, cis 12 1.17 ± 0.07 1.11 ± 0.07 1.53 ± 0.08 Ca, % 0.76 ± 0.07 0.76 ± 0.07 0.92 ± 0.08 P, % 0.33 ± 0.03 0.33 ± 0.03 0.33 ± 0.03 Mg, % 0.31 ± 0.02 0.31 ± 0.03 0.31 ± 0.02 K, % 1.49 ± 0.05 1.48 ± 0.05 1.49 ± 0.05 Cl, % 0.29 ± 0.03 0.29 ± 0.04 0.29 ± 0.03 Na, % 0.31 ± 0.01 0.31 ± 0.01 0.32 ± 0.01 1 AminoPlus (Ag Processing Inc., Omaha, NE). 2 Energy Booster 100 (Milk Specialties, Dundee, IL). 3 Megalac R (Church & Dwight, Princeton, NJ). 4 Contains (DM basis) 30.8% blood meal, 30.5% sodium bicarbonate, 12.0% dicalcium phosphate, 6.0% magnesium oxide, 4.8% magnesium sulfate heptahydrate, 2.9% sodium chloride, 0.12% manganese sulfate monohydrate, 0.06% zinc sulfate, 2.9%, MetaSmart (Adisseo, Atlanta, GA), 0.25% Zinpro 4 Plex (Zi npro Co., Eden Prairie, MN), 0.45% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.25% Rumensin 80 (Elanco Animal Health, Greenfield, IN), and vitamin and iodine premix. Each kg contains 28.5% CP, 6.3% Ca, 1.2% P, 3.9% Mg, 10.5% Na, 3.1% Cl, 58 7 mg of Zn, 124 mg of Cu, 654 mg of Mn, 9.6 mg of Se, 25 mg of Co, 13 mg of I, 131,000 IU of vitamin A, 36,000 IU of vitamin D, 1,200 IU of vitamin E, and 470 mg of monensin.

PAGE 85

85 5 Net energy of diets considering 24.5 kg/d of DM intake (CPM dairy). 6 Nonfibrou s carbohydrates calculated as: 100 (NDF + CP + EE + Ash). 7 Calculated based on fatty acid analysis of TMR.

PAGE 86

86 Table 2 4. Dry matter (DM) intake, milk production and composition and feed conversion ratio, energy balance, body weight (BW), BW change, a nd body condition score of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 Control SFA EFA SEM 1 Fat 1 FA 1 DM intake, kg/d 18.0 1 9.3 18.0 0.6 0.42 0.12 Milk, kg/d 31.7 31.8 34.1 0.9 0.27 0.06 3.5% FCM 2 , kg/d 32.6 30.8 32.8 1.0 0.54 0.14 SCM 2 , kg/d 28.9 27.4 29.2 0.9 0.61 0.14 Milk/DM intake 1.9 1.7 1.9 0.1 0.09 <0.01 Milk fat % 3.75 3.34 3.32 0.07 <0.01 0.84 Yield, kg/d 1.16 1.05 1.11 0.04 0.10 0.23 Milk true protein % 2.81 2.77 2.80 0.05 0.69 0.65 kg/d 0.87 0.87 0.94 0.04 0.40 0.05 Milk lactose % 4.76 4.70 4.68 0.03 0.12 0.65 kg/d 1.51 1.50 1.60 0.04 0.48 0.11 SCC, x 1,000/mL 162.1 217.7 286.7 57.1 ---SCS 4 1.9 2.4 2.5 0.3 0.17 0.79 Milk NE L 2 , Mcal/kg 0.69 0.65 0.65 0.01 <0.01 0.94 Energy balance, Mcal/d 2.1 2.3 0.9 0.9 0.02 <0.01 Body weight, kg 568 586 572 14 0.55 0.45 BW change, kg/d 0.89 0.63 0.69 0.17 0.14 0.71 Body condition (1 to 5) 3.11 3.19 3.17 0.04 0.21 0.68 1 SEM = Standard error of the mean; Fat = control vs. SFA + EFA; FA = EFA vs. SFA. 2 3.5% fat corrected milk (FCM) = 0.4324 x milk yield (kg) + [16.218 x milk fat yield (kg)]; Solids corrected milk (SCM) = milk yield (kg) x [(12.24 x % fat) + (7.10 x % protein) + (6.35 x % lactose) 0.0345]; Milk NE L = [(0.0929 x % fat) + (0.0563 x % protein) + (0.0395 x % lactose)]; SCC = somatic cell count; Somatic cell score (SCS) = [log 10 (SCC/12.5)]/log 10 2.

PAGE 87

87 Table 2 5. Milk fat ty acid profile of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 Control SFA EFA SEM 1 Fat 1 FA 1 g/100 g of FA C4:0 3.91 3 .72 3.53 0.09 0.02 0.13 C6:0 2.14 1.78 1.52 0.05 <0.001 <0.001 C8:0 1.12 0.86 0.70 0.04 <0.001 <0.01 C10:0 2.28 1.76 1.41 0.10 <0.001 0.01 C12:0 2.45 1.99 1.65 0.10 <0.001 0.02 C14:0 9.06 7.82 6.82 0.29 <0.001 0.01 C14:1 cis 9 0.61 0.46 0.40 0.03 <0.0 01 0.12 C16:0 27.97 26.84 25.93 0.33 0.001 0.06 C16:1 cis 9 1.52 1.14 1.11 0.08 <0.001 0.79 C18:0 10.49 12.29 12.14 0.24 <0.001 0.64 C18:1 trans 4 0.02 0.04 0.04 0.02 <0.001 0.02 C18:1 trans 5 0.014 0.027 0.033 0.02 <0.001 <0.01 C18:1 trans 6 8 0.26 0.41 0.45 0.01 <0.001 0.02 C18:1 trans 9 0.23 0.31 0.33 0.01 <0.001 0.01 C18:1 trans 10 0.31 0.64 0.67 0.07 0.06 0.67 C18:1 trans 11 0.97 1.18 1.38 0.05 <0.001 0.001 C18:1 trans 12 0.28 0.42 0.49 0.01 <0.001 <0.001 C18:1 cis 9 24.85 25.19 26.87 0.77 0.24 0.11 C18:2 cis 9, cis 12 2.26 3.29 4.47 0.15 <0.001 <0.001 C18:3 cis 6, cis 9, cis 12 0.02 0.02 0.02 0.002 0.39 0.79 C18:3 cis 9, cis 12, cis 15 0.48 0.60 0.71 0.02 <0.001 0.001 C18:2 cis 9, trans 11 0.43 0.53 0.66 0.02 <0.001 <0.001 C18:2 trans 10, cis 12 0.002 0.039 0. 066 0.004 <0.001 <0.001 C20:2 cis 11, cis 14 0.03 0.03 0.04 0.002 0.001 0.003 C20:3 cis 5, cis 8, cis 11 0.026 0.028 0.031 0.002 0.17 0.21 C20:3 cis 8, cis 11, cis 14 0.08 0.08 0.08 0.004 0.92 0.52 C20:3 cis 11, cis 14, cis 17 0.02 0.03 0.03 0.001 0.05 0.61 C20:4 cis 5 , cis 8, cis 11, cis 14 0.14 0.14 0.13 0.004 0.11 0.09 C20:5 cis 5, cis 8, cis 11, cis 14, cis 17 0.03 0.03 0.03 0.002 0.15 0.10 C22:0 0.11 0.11 0.10 0.004 0.70 0.49 C24:0 0.06 0.06 0.05 0.003 0.07 0.56 C22:4 cis 7, cis 10, cis 13, cis 16 0.021 0.020 0.021 0.001 0.84 0. 54 C22:5 cis 7, cis 10, cis 13, cis 16, cis 19 0.061 0.063 0.056 0.004 0.65 0.05 Others FA 7.69 8.00 7.95 0.11 0.05 0.71 Total < C16:0 23.65 20.40 17.79 0.64 <0.001 <0.01 Total C16 29.49 27.98 27.06 0.35 <0.001 0.05 Total > C16:0 46.85 51.61 55.15 0.87 <0.001 <0.01 Total C18:1 trans 2.09 3.01 3.40 0.11 <0.001 0.01 Total CLA 0.47 0.66 0.83 0.03 <0.001 <0.001 Total saturated FA 59.61 57.22 53.86 0.85 <0.001 <0.01

PAGE 88

88 Table 2 5. Continued. Control SFA EFA SEM 1 Fat 1 FA 1 Total monounsaturated FA 29.08 29.85 31. 81 0.80 0.10 0.07 Total polyunsaturated FA 3.62 4.91 6.35 0.19 <0.001 <0.001 Total branched chain FA 1.88 1.93 1.77 0.04 0.62 0.01 Total n 6 FA 2.56 3.59 4.77 0.15 <0.001 <0.001 Total n 3 FA 0.60 0.72 0.82 0.03 <0.001 0.01 Ratio n 6 to n 3 FA 4.40 4.9 8 5.89 0.19 <0.001 <0.001 1 SEM = Standard error of the mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA.

PAGE 89

89 Table 2 6. Plasma fatty acid profile of lactating Holstein cows receiving no fat supplementation (control), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 Control SFA EFA SEM 1 Fat 1 FA 1 g/100 g of FA C14:0 0.74 0.72 0.63 0.02 0.03 <0.01 C14:1 0.41 0.41 0.36 0.01 0.18 <0.01 C15:0 0.20 0.18 0.16 0.01 0.16 0.35 C16:0 16.80 16.42 15.97 0.25 0.06 0.18 C16:1 1.12 0.81 0.69 0.05 <0.001 0.10 C17:0 0.53 0.54 0.46 0.01 0.05 <0.001 C17:1 0.44 0.36 0.28 0.01 <0.001 <0.001 C18:0 14.81 14.96 14.15 0.17 0.28 <0.01 C18:1 14.88 12.82 10.81 0.37 <0.001 <0.01 C18:2 cis 9, cis 12 34.92 37.43 42.58 0 .43 <0.001 <0.001 C18:3 cis 6, cis 9, cis 12 0.57 0.53 0.40 0.04 0.07 0.04 C18:3 cis 9, cis 12, cis 15 3.29 3.22 2.58 0.12 0.02 <0.001 C20:2 cis 11, cis 14 0.17 0.20 0.28 0.01 <0.001 <0.001 C20:3 cis 8, cis 11, cis 14 1.21 1.17 0.96 0.06 0.07 0.01 C20:4 cis 5, cis 8 , cis 11, cis 14 2.50 2.41 2.34 0.05 0.13 0.37 C20:5 cis 5, cis 8, cis 11, cis 14, cis 17 0.45 0.51 0.36 0.02 0.62 <0.001 C22:4 cis 7, cis 10, cis 13, cis 16 0.10 0.10 0.11 0.01 0.47 0.52 C22:5 cis 7, cis 10, cis 13, cis 16, cis 19 0.34 0.42 0.35 0.02 0.05 <0.01 C22:6 cis 4,cis7,ci s10,cis13,cis16,cis19 0.62 0.68 0.65 0.06 0.53 0.71 C24:0 0.23 0.25 0.25 0.02 0.69 0.99 Others FA 5.58 6.02 5.62 0.37 0.62 0.42 Total saturated FA 33.29 33.07 31.63 0.30 0.02 0.001 Total polyunsaturated FA 44.12 46.55 50.57 0.49 <0.001 <0.001 Total n 6 FA 39.21 41.48 46.51 0.44 <0.001 <0.001 Total n 3 FA 4.70 4.83 3.94 0.17 0.16 <0.001 Ratio n 6 to n 3 FA 9.05 9.02 12.59 0.67 0.09 <0.001 1 SEM = Standard error of the mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA.

PAGE 90

90 Table 2 7. Plasma conce OH butyric acid, glucose, urea nitrogen, insulin like growth factor 1 (IGF 1 ), and insulin of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1 Control SFA EFA SEM 1 Fat 1 FA 1 Nonesterified FA, µM 449.7 390.1 431.7 19.8 0.13 0.11 OH butyrate, mg/dL 7.38 6.59 9.06 0.46 0.45 <0.001 Glucose, mg/dL 61.56 63.76 60.72 0.68 0.44 <0.001 Insulin, ng/mL 0.61 0.82 0.59 0.05 0.19 <0.01 IGF 1 , ng/mL 48.41 53.60 45.95 5.30 0.85 0.30 Plasma urea N, mg/dL 12.26 12.13 12.03 0.26 0.60 0.77 1 SEM = Standard error of the mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA.

PAGE 91

91 Table 2 8. Estimated linoleic linolenic acids intestinal absorption, milk secretion, and balance of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiments 1 an d 2 Control SFA EFA SEM 1 Fat 1 FA 1 Experiment 1 Linoleic acid Intestinal absorption 2 11.17 15.42 63.54 1.92 <0.001 <0.001 Milk secretion 23.64 30.49 43.73 1.46 <0.001 <0.001 Balance 3 33.31 36.65 0.98 1.89 <0.001 <0.001 Linolenic acid Intestinal absorption 3.13 3.01 15.74 0.50 <0.001 <0.001 Milk secretion 5.02 5.53 6.90 0.24 <0.001 <0.001 Balance 12.32 13.29 1.61 0.42 <0.001 <0.001 Experiment 2 Linoleic acid Intestinal absorption 24.64 23.35 96.47 2.7 5 <0.001 <0.001 Milk secretion 34.08 34.98 49.32 2.10 0.01 <0.001 Balance 30.92 33.45 24.58 2.53 <0.001 <0.001 Linolenic acid Intestinal absorption 2.88 2.73 15.71 0.52 <0.001 <0.001 Milk secretion 5.30 5.52 6.60 0.24 0.02 <0.01 Balance 12.90 13.36 1.44 0.31 <0.001 <0.001 1 SEM = Standard error of mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA. 2 Calculated based on individual cow DM intake, diet composition and estimated flow of linoleic linolenic acids to the intestine of cows using the fat sub model of the CPM Dairy software (CPM Dairy ver. 3.0.10; www.cpmdairy.net ). 3 FA balance was calculated using a maintenance requirement of 183.5 and 91.7 mg/kg of BW 0.75 Linolenic acid, respectively from human literature (Simopoulos, 2000). FA balance (g/d) = {FA absorbed (g/d) [FA se creted in milk (g/d) + FA needed for maintenance (g/d)]}.

PAGE 92

92 Table 2 9. Dry matter (DM) intake, milk yield and composition, feed conversion ratio, energy balance, body weight (BW), BW change, and body condition score of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 2 Control SFA EFA SEM 1 Fat 1 FA 1 DM intake, kg/d 22.5 23.5 23.8 0.6 0.11 0.76 Milk, kg/d 37.7 39.9 43.4 0.8 <0.00 1 <0.001 3.5% FCM 2 , kg/d 37.8 40.4 44.1 0.9 <0.001 0.01 SCM 2 , kg/d 34.4 37.3 39.7 0.9 0.001 0.07 Milk fat % 3.46 3.57 3.67 0.07 0.08 0.35 kg/d 1.31 1.43 1.57 0.04 <0.001 0.02 Milk true protein % 2.88 2.94 2.91 0.03 0.27 0.60 kg/d 1.09 1 .17 1.26 0.02 <0.001 0.01 Milk lactose % 4.89 4.91 4.90 0.01 0.42 0.55 kg/d 1.84 1.96 2.12 0.04 <0.001 0.01 Milk NE L 2 , Mcal/kg 0.6 8 0.69 0.70 0.0 1 0.09 0.55 3.5% FCM/DM intake 1.69 1.76 1.85 0.04 0.04 0.16 Energy balance, Mcal/d 1.24 1.82 0.08 0.72 0.75 0.10 Body weight, kg 574.6 575.3 572.4 7.2 0.93 0.78 BW change, kg/d 0.28 0.19 0.05 0.11 0.23 0.38 Body condition (1 to 5) 3.01 3.03 2.95 0.04 0.74 0.20 1 SEM = Standard error of the mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA. 2 3.5 % fat corrected milk (FCM) = 0.4324 x milk yield (kg) + [16.218 x milk fat yield (kg)]; Solids corrected milk (SCM) = milk yield (kg) x [(12.24 x % fat) + (7.10 x % protein) + (6.35 x % lactose) 0.0345]; Milk NE L = [(0.0929 x % fat) + (0.0563 x % protein ) + (0.0395 x % lactose)].

PAGE 93

93 Table 2 10. Milk fatty acid profile of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 2 Control SF A EFA SEM 1 Fat 1 FA 1 g/100 g of FA C6:0 2.27 2.23 2.18 0.75 0.94 0.96 C8:0 1.16 1.17 1.13 0.08 0.91 0.72 C10:0 2.92 2.82 2.41 0.15 0.11 0.06 C11:0 0.07 0.05 0.03 0.01 0.02 0.20 C12:0 3.64 3.35 2.85 0.18 0.02 0.06 C14:0 13.03 11.10 12.75 0.36 0.02 <0.01 C14:1 trans 0.14 0.14 0.21 0.03 0.43 0.12 C14:1 cis 0.88 0.71 0.65 0.04 0.001 0.38 C15:0 1.27 1.11 0.97 0.05 <0.01 0.08 C15:1 trans 0.22 0.21 0.20 0.01 0.07 0.59 C16:0 36.90 36.86 35.13 0.66 0.27 0.07 C16:1 trans 0.03 0.04 0.04 0.01 0.15 0.99 C16:1 cis 1.33 1.21 1.14 0.09 0.17 0.56 C17:0 0.71 0.75 0.64 0.02 0.42 0.001 C18:0 8.27 10.24 10.49 0.34 <0.001 0.60 C18:1 trans 8 0.13 0.12 0.20 0.01 0.06 <0.001 C18:1 trans 9 0.15 0.15 0.20 0.01 0.01 0.01 C18:1 trans 10 0.35 0.32 0.44 0.02 0.41 <0.01 C18:1 trans 11 0.82 0.72 1.00 0.08 0.66 0.02 C18:1 cis 9 11.90 11.42 8.07 2.43 0.47 0.34 C18:1 cis 10 7.75 7.90 14.23 2.52 0.29 0.09 C18:1 cis 11 0.55 0.45 0.53 0.03 0.07 0.06 C18:1 cis 12 0.23 0.22 0.32 0.02 0.12 0.001 C18:2 cis 9, cis 12 2.96 2.69 3.57 0.1 4 0.33 <0.001 C18:2, conjugated 0.08 0.08 0.09 0.01 0.47 0.32 C18:3 cis 6, cis 9, cis 12 0.01 0.01 0.01 0.01 0.89 0.45 C18:3 cis 9, cis 12, cis 15 0.46 0.42 0.48 0.02 0.73 0.04 C20:0 0.10 0.13 0.12 0.01 0.001 0.28 C20:1 trans 11 0.41 0.33 0.48 0.03 0.83 0.001 C 20:4 cis 5, cis8 , cis 11, cis 14 0.17 0.15 0.16 0.01 0.31 0.22 C20:5 cis 5, cis8 ,cis11,cis14, cis 17 0.04 0.02 0.01 0.01 0.18 0.50 C22:0 0.08 0.07 0.06 0.01 0.46 0.59 C22:1 0.002 0.04 0.01 0.01 0.10 0.12 C22:5 cis7 , cis 10, cis 13, cis 16, cis 19 0.06 0.04 0.04 0.01 0.0 6 0.72 C22:6 cis4, cis 7, cis 10, cis 13, cis 16, cis 19 0.03 0.03 0.01 0.01 0.52 0.03 C23:0 0.03 0.01 0.01 0.01 0.13 0.82 C24:0 0.01 0.04 0.02 0.01 0.25 0.11 C24:1 0.48 0.65 0.14 0.12 0.58 0.01 Total < C16 25.97 24.87 22.43 0.84 0.03 0.05 Total C16 38.27 38.1 2 36.31 0.65 0.20 0.06

PAGE 94

94 Table 2 10. Continued. Control SFA EFA SEM 1 Fat 1 FA 1 Total > C16 35.77 36.99 41.26 0.98 0.01 0.01 Total saturated FA 70.83 71.90 67.83 0.96 0.42 0.01 Total monounsaturated FA 25.38 24.65 27.81 0.92 0.46 0.02 Total polyunsatur ed FA 3.79 3.44 4.36 0.17 0.59 0.001 Total n 6 3.21 2.93 3.83 0.14 0.35 <0.001 Total n 3 0.58 0.52 0.54 0.03 0.18 0.66 Ratio n 6 to n 3 FA 5.69 5.72 7.17 0.24 0.02 <0.001 1 SEM = Standard error of the mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA .

PAGE 95

95 Table 2 11. Plasma fatty acid profile of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 2 Control SFA EFA SEM 1 Fat 1 FA 1 g/100 g of FA C10:0 0.01 0.01 0.00 0.01 0.92 0.56 C12:0 0.01 0.01 0.01 0.01 0.73 0.99 C14:0 0.57 0.58 0.43 0.03 0.09 <0.01 C15:0 0.61 0.57 0.51 0.02 <0.01 0.02 C16:0 11.08 11.58 11.94 0.33 0.10 0.43 C16:1 1.38 1.28 1.01 0.13 0.14 0.15 C17:0 0.6 6 0.65 0.62 0.02 0.38 0.41 C18:0 14.23 14.72 14.04 0.23 0.58 0.05 C18:1 6.19 6.29 6.38 0.40 0.77 0.88 C18:2 cis 9, cis 12 46.49 46.49 48.90 0.70 0.17 0.02 C18:3 cis 6, cis 9, cis 12 0.89 0.93 0.59 0.07 0.12 <0.01 C18:3 cis 9, cis 12, cis 15 2.91 3.47 2.46 0.08 0.6 2 <0.001 C20:0 0.01 0.02 0.02 0.01 0.46 0.72 C20:2 cis 11, cis 14 0.01 0.03 0.04 0.01 0.13 0.84 C20:3 cis 8, cis 11, cis 14 2.24 2.00 1.76 0.18 0.13 0.37 C20:4 cis 5, cis 8, cis 11, cis 14 1.87 1.78 2.06 0.14 0.75 0.18 C20:5 cis 5, cis 8, cis 11, cis 14, cis 17 0.35 0.35 0.2 7 0.04 0.40 0.17 C22:5 cis 7, cis 10, cis 13, cis 16, cis 19 0.76 0.43 0.30 0.18 0.09 0.63 C24:1 0.14 0.11 0.12 0.02 0.26 0.71 Others FA 9.57 8.70 8.52 0.54 0.15 0.81 Total saturated FA 27.18 28.14 27.59 0.38 0.16 0.32 Total polyunsaturated FA 55.52 55.48 56.3 8 0.81 0.68 0.43 Total n 6 FA 51.50 51.23 53.36 0.82 0.43 0.08 Total n 3 FA 4.02 4.25 3.03 0.19 0.11 <0.001 Ratio n 6 to n 3 FA 13.15 12.20 17.93 0.60 0.02 <0.001 1 SEM = Standard error of the mean; F at = control vs. SFA + EFA; FA = EFA vs. SFA

PAGE 96

96 Figur e 2 1. Milk production of multiparous (A) and primiparous (B) lactating Holstein cows receiving no fat supplementation (control), mostly saturated free f atty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1. Effect of treatme nt ( P = 0.09), parity ( P < 0.001), and week ( P <0.001). Interaction between treatment and parity ( P = 0.07), and treatment and week ( P = 0.59). Effect of fat supplementation (control vs. EFA + SFA) ( P = 0.27), and type of fatty acid (EFA vs. SFA) ( P = 0.06 ). Interaction between parity and fat supplementation ( P = 0.36), and parity and the type of fatty acid ( P = 0.03). Mean yields of milk during the study were 31.7 ± 1.0, 31.8 ± 0.8, and 34.1 ± 0.9 kg/d, respectively, for cows receiving control, SFA, and EF A .

PAGE 97

97 Figure 2 2. Concentrations of nonesterified fatty acids (NEFA) in plasma of multiparous (A) and primiparous (B) Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatt y acids (EFA) Experiment 1. Effect of treatment ( P = 0.08), parity ( P < 0.001), and day ( P <0.001). Interaction between treatment and parity ( P = 0.04), and treatment and day ( P = 0.80). Effect of fat supplementation (control vs. EFA + SFA) ( P = 0.13), a nd type of fatty acid (EFA vs. SFA) ( P = 0.11). Interaction between parity and fat supplementation ( P = 0.01), and parity and the type of fatty acid ( P = 0.51).Mean plasma NEFA concentrations during the study were 449.7 ± 22.1, 390.1 ± 18.0, and 431.7 ± 19 .0 µM, respectively, for cows receiving control, SFA, and EFA .

PAGE 98

98 Figure 2 3 . hydroxybutyric acid (BHBA) in plasma of multiparous (A) and primiparous (B) lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Experiment 1. Effect of treatment ( P < 0.001), parity ( P < 0.001), and day ( P <0.001). Interaction between treatment and parity ( P < 0.001), and treatment and day ( P = 0.78). Effect of fat supplementation (control vs. EFA + SFA) ( P = 0.45), and type of f atty acid (EFA vs. SFA) ( P < 0.001). Interaction between parity and fat supplementation ( P = 0.06), and parity and the type of fatty acid ( P = < 0.001). Mean plasma concentrations of BHBA during the study were 6.38 ± 0.94, 5.61 ± 0.66, and 5.78 ± 0.74 mg/d L for primiparous cows, and 8.36 ± 0.46, 7.57 ± 0.54, and 12.35 ± 0.51 mg/dL for multiparous cows receiving control, SFA, and EFA diets, respectively .

PAGE 99

99 Figure 2 4. Linoleic acid balance of lactating Holstein cows receiving no fat supplementation (cont rol), saturated free f atty acids (SFA), or Ca salts containing essential fatty acids (EFA). Experiment 1 Effect of treatment ( P < 0.001), parity ( P < 0.01), and week ( P <0.001). Interaction between treatment and parity ( P = 0.61), and treatment and week ( P < 0.001). Effect of fat supplementation (control vs. EFA + SFA) ( P < 0.001), and type of FA (EFA vs. SFA) ( P < 0.001). Interaction between parity and fat supplementation ( P = 0.45), and parity and the type of fatty acid ( P = 0.52). Mean linoleic acid in milk during the study were 33.31 ± 2.12, 36.65 ± 1.74, and 0.98 ± 1.82 g/d, respectively, for cows receiving control, SFA, and EFA .

PAGE 100

100 Figure 2 5. Linolenic acid balance of lactating Holstein cows receiving no fat supplementation (control), saturated free fatty acid s (SFA), or Ca salts containing essential fatty acids (EFA). Experiment 1 Effect of treatment ( P < 0.001), parity ( P = 0.01), and week ( P <0.001). Interaction between treatment and parity ( P = 0.10), and treatment and week ( P < 0.001). Ef fect of fat supplementation (control vs. EFA + SFA) ( P < 0.001), and type of FA (EFA vs. SFA) ( P < 0.001). Interaction between parity and fat supplementation ( P = 0.82), and parity and the type of fatty acid ( P = 0.03). Mean linolenic acid in milk during t he study were 12.32 ± 0.47, 13.29 ± 0.39, and 1.61 ± 0.41 g/d, respectively, for cows receiving control, SFA, and EFA .

PAGE 101

101 Figure 2 6. F at corrected milk yield of lactating Holstein cows receiving no fat supplementation (control), saturated free fatt y acids (SFA), or Ca sal ts containing essential fatty acids (EFA) Experiment 2. Cov = covariate value. Effect of treatment ( P < 0.001), parity ( P < 0.001), and week postpartum ( P = 0.04). Interaction between treatment and parity ( P = 0.86), and treatment and Week ( P = 0.23). Effect of fat supplementation (control vs. EFA + SFA) (P < 0.001), and type of fatty acid (EFA vs. SFA) ( P = 0.01). Interaction between parity and fat supplementation ( P = 0.63), and parity and the type of fatty acid ( P = 0.80). Mean yields of 3.5% fat corrected milk during the study were 37.8 ± 0.9, 40.4 ± 0.9, and 44.1 ± 0.9 kg/d, respectively, for cows receiving control, SFA, and EFA.

PAGE 102

102 CHAPTER 3 EFFECTS OF FATTY ACID SUPPLEMENTATION TO PERIPARTURIENT DAIRY COW ON UTERINE HEALTH AND I MMUNE COMPETENCE EARLY POSTPARTUM The o bjective s were to evaluate the effects of supplementing diets containing low amounts of fatty acids (FA) with either mostly saturated free FA or Ca salts containing essential FA on measures of immune response and uter ine health in early postpartum dairy cows . Twenty three nulliparous and 53 parous Holstein cows were assigned to treatments 56 d before calving, and treatments were maintained until 90 d in milk. Cows were randomly assigned to receive a control diet with 2 .0% FA pre and postpartum, or diets supplemented with mostly saturated free FA (SFA) or Ca salts enriched with essential FA (EFA) to increase the FA content to 3.7% prepartum and to 4.0% postpartum. Intake of FA increased with supplementing fat pre (cont rol = 225 ± 22; SFA = 412 ± 18; EFA = 371 ± 19 g/d) and postpartum (control = 332 ± 23; SFA = 717 ± 19; EFA = 687 ± 20 g/d). Feeding EFA increased the intake of linoleic acid pre (control = 68 ± 5; SFA = 67 ± 4; EFA = 116 ± 4 g/d) and postpartum (control = 107 ± 6; SFA = 119 ± 4; EFA = 220 ± 5 g/d). Concentrations of acid soluble protein and haptoglobin increased for 2 wk after calving and were not affected by treatment among multiparous cows, but were lowest for primiparous fed EFA than those fed control or SFA. Feeding fat increased the proportion of neutrophils (control = 25. 8 ± 3.7, SFA = 35.8 ± 2. 8; EFA = 35. 7 ± 2.7 %) and decreased that of lymphocytes in blood (control = 65.4 ± 4.1 ; SFA = 55.2 ± 3.1 ; EFA = 55.1 ± 3.0% ). Feeding fat increased the propor tion of neutrophils expressing L integrin, and these responses were more remarkable in primiparous cows. The percentage of neutrophils phagocytizing and killing Escherichia coli in vitro increased with feeding fat (control = 88.5 ± 1.3; SFA = 91.1 ± 1.0; EFA = 92.4 ± 0.9%), and the benefit of fat feeding was greater in primiparous cows (control = 87.3 ± 2.4; SFA = 93.3 ± 1.5; EFA = 93.7 ± 1.5%). Disease suppressed neutrophil function, but feeding fat lessen the depression in neutrophil functi on associated with disease. Morbidity

PAGE 103

103 did not differ among treatments, but cows fed fat had reduced incidence of puerperal metritis (control = 26.9; SFA = 4.0; EFA = 8.0%) and fever (control = 46.2; SFA = 28.0; EFA = 32.0%). Cows fed fat had less prevalenc e of isolation of utero pathogenic bacteria from uterine flush at 36 d postpartum (control = 32.0; SFA + EFA = 6.0%). The concentrations of prostaglandin F metabolite in plasma were greater for cows fed EFA than those fed control or SFA only on the day o f calving and d 1 postpartum. Ovarian activity and pregnancy at first AI did not differ among treatments. Collectively, these results suggest that increasing the dietary FA content of diets fed to transition cows from 2.0 to 3.7 or 4.0% with either SFA or EFA improved some measures of immune function, particularly in primiparous cows, and reduced the incidence of puerperal metritis. Introduction The transition period, characterized by a series of physiological adaptations to accommodate lactation, is the m ost challenging phase in the life of a dairy cow. Nutrient demands during late gestation and early lactation increase substantially, in part because of fetal development, but mostly because of synthesis of colostrum and milk (Bell, 1995). Concurrent with t he transition from nonlactating pregnant to nonpregnant lactating, most cows experience some decline in DMI during the last few days of gestation that further complicates the supply of nutrients to meet the increasing needs with the onset of lactation (Bel l, 1995; Drackley, 1999). This negative nutrient balance, coupled with adaptive endocrine changes, induces cows to increase body tissue mobilization resulting in increased concentrations of NEFA and BHBA, which have been associated with decreased humoral a nd innate immune responses (Mallard et al., 1998), and increased risk of uterine (Hammon et al., 2006; Chapinal et al., 2011) and other postpartum diseases (Chapinal et al., 2011).

PAGE 104

104 Supplemental fat is used commonly in dairy cattle rations to increase ener gy intake, with attempts to reduce body fat mobilization and, when fed during transition, to minimize the incidence of early lactation disorders (Damgaard et al., 2013). Linoleic (C18:2 cis 9, cis linolenic acids (C18:3 cis 9, cis 12, cis 15) are essenti al fatty acids (FA) to mammals because mammalian cells lack the delta 12 and 15 desaturases (Hashimoto et al., 2006). Essential FA and their derivative longer chain FA and eicosanoids are active molecules that not only provide calories, but also influence gene expression resulting in changes in metabolism (Jump, 2002) and immune responses (Calder et al., 2012), which can ultimately have impacts on health and reproduction of dairy cows (Santos et al., 2008). One of the well described pathways by which FA aff ect immunity is by modulating immune cell function and inflammatory responses through the balance of pro and anti inflammatory molecules. For instance, FA of the omega 6 family activate LPS induced prostaglandin synthesis and the transcription factor nucl (Calder 2012). The active NF of cytokines, chemokines, proteins involved in the acute phase response, and cell adhesion molecules (Kumar et al. , 2004) which, collectively, facilitate inflammation and immune response s . In addition, omega 6 FA are precursors for the synthesis of prostaglandins, especially PGF , which is an important regulator of reproductive cycle in cattle and synthesized in copious amounts by the uterus during the early postpartum period (G uilbault et al., 1984). Prostaglandins and other intermediates of arachidonic acid metabolism have pivotal roles in the activation and resolution of the inflammatory response (Khanapure et al., 2007), and PGF has been shown to be a neutrophil chemoattrac tant as well as stimulate phagocytosis of bacteria (Hoedemaker et al., 1992). It was hypothesized that supplementing FA to diets containing low concentrations of fat, particularly linoleic acid, would stimulate measures of immune response s and improve ute rine

PAGE 105

105 health in dairy cows. Based on previous work (Silvestre et al., 2011 a ), it was anticipated that the benefits of fat supplementation would be greater with the addition of linoleic acid. Therefore, the objectives were to evaluate the effects of suppleme nting diets containing low amounts of FA with either mostly saturated free FA or Ca salts containing essential FA during late gestation and early lactation on immunity and uterine health during the early postpartum period . Materials and Methods The experim ent was conducted at the University of Florida Dairy Unit (Hague, FL) from October 2008 to early June 2009 and cows calved between December 2008 and March 2009. All experimental cows were managed according to the guidelines approved by the University of Fl orida Institute of Food and Agricultural Sciences Animal Research Committee. Study Design, Animals , Housing and Feeding Detailed information on management of cows is presented in Chapter 2 . Briefly, the experiment was a completely randomized design with blocks. Weekly cohorts of cows were blocked by parity as nulliparous (n = 23) and parous (n = 53) and body condition and, within each block, randomly assigned to one of three treatments. Cows were allocated to the study and treatments initiated at 56 d bef ore the expected date of calving. Treatments were no fat supplementation pre and postpartum (control, n = 26), supplementation with 1.7 and 2.0% FA pre and postpartum, respectively, with either mostly saturated free FA (SFA; Energy Booster100, Milk Speci alties, Dundee, IL; n = 25) or Ca salts enriched with essential FA (EFA, Megalac R; Church & Dwight, Princeton, NJ; n = 25). Description of the diets is depicted in Table 3 1. Because the concentration of FA differed between the supplements used, the amoun ts of each supplement added to the ration were adjusted to ensure the same 1.7 and 2.0% supplemental FA fed pre and postpartum, respectively, of SFA and EFA .

PAGE 106

106 Immune Competence Markers All laboratory assays were performed in duplicate or triplicate, and s amples or assays with CV > 15% were repeated. Acute p hase p roteins and p rostaglandin F m etabolite Blood was sampled weekly before calving and then thrice weekly postpartum through 40 DIM. Blood was sampled by puncture of the coccygeal vessels into evacuate d tubes containing K 2 EDTA (Vacutainer, Becton Dickinson, Franklin Lakes, NJ). Upon collection, tubes were placed immediately in ice and processed within 4 h. Plasma was separated by centrifugation at 2,095 x g for 15 min (Allegra X 15R Centrifuge) and aliq uots stored at 20 o C for later analyses. The concentrations of the acute phase proteins , haptoglobin and acid soluble protein , were measured in plasma. Haptoglobin concentrations were determined by measuring the differences in peroxidase activity within th e haptoglobin/hemoglobin complex as described by Makimura and Suzuki (1982). Samples were analyzed in duplicates and the intra and inter assay CV were, respectively, 3.2 and 11.4%. Haptoglobin was expressed in arbitrary units. Acid soluble protein was det ermined by extracting with 0.6 M perchloric acid (Fisher Scientific, Hampton, NH, USA) diluted in distilled water (66 mL of perchloric acid in 1 L of water). Plasma samples (50 µL) were incubated with perchloric acid solution (1 mL) for 20 minutes at room temperature. At the end of the incubation period, samples were centrifuged (2,095 x g for 30 min, Allegra X 15R Centrifuge, Beckman Coulter Inc., Brea, CA). Bicinchoninic acid kit (Sigma Aldrich, Saint Louis, Mo) was used to analyze the protein concentrati on. The intra and inter assays CV were 4.4 and 9.1%, respectively. During the first 10 DIM, blood was collected daily and plasma harvested as described above. Concentrations of PGF metabolite 13,14 dihydro 15 keto PGF (PGFM) were

PAGE 107

107 measured in plasma using an ELISA described by Ginther et al. (2010). The intra and inter assays CV were 8.6 and 10.9%, respectively. Neutrophil a dhesion m olecules , p hagocytosis , and o xidative b urst On d 14, 0, 4, 7, and 14 relative to parturition, neutrophil phagocytic and oxidative burst activities (pHrodo E.coli BioParticles) and expression of adhesion molecules , L integrin (Silvestre et al., 2011 a ) , were quantified. Blood was collect ed from coccygeal vessels into two 10 mL evacuated tubes containing sodium heparin as anticoagulant (Vacutainer, Becton Dickinson). Samples were kept at room temperature, protected from direct sun light and processed within 2 h of collection. The first t ube was assayed at the University of Florida Clinical Pathology Laboratory to quantify the complete blood cell count using a Bayer Advia 120 hematology analyzer (Siemens Corporation, Washington, DC). Phagocytosis concurrent with oxidative burst was measure d by incubating 100 µL of blood adjusted to contain 5 x 10 3 neutrophils/µL with 40 µL of reconstituted pHrodo E. coli BioParticles conjugate (Molecular Probes, Invitrogen, Life Technologies, Carlsbad, CA). Samples were then incubated for 2 h at 37 o C, rotat ing. After incubation, samples were immediately placed in ice to stop neutrophil activity. Red blood cells were then lysed with 2.5 mL of lysis buffer (449.4 mg NH4Cl + 50.0 mg KHCO3 + 1.86 mg EDTA, diluted in 50 mL of double distilled water), the remainin g white blood cells were then re suspended in 2.5 mL of FACS buffer (Becton Dickinson Biosciences, San Jose, CA), centrifuged and the pellet re suspended in 200 µL of FACSFlow sheath fluid (Becton Dickinson Biosciences). For each tube, optical features of 50,000 neutrophils were acquired using a Facsort flow cytometer equipped with a 488 nm argon ion laser for excitation at 15 mW equipped with CellQuest software (Becton Dickinson Biosciences). Neutrophils exhibiting fluorescence were those undergoing phagoc ytosis concurrent with oxidative burst that result in bacterial killing,

PAGE 108

108 whereas the geometric mean fluorescence intensity (GMFI) represents a proxy for the mean number of E. coli phagocytized and killed per neutrophil. Neutrophils expressing adhesion molecules L integrin were assayed as described by Silvestre at al. (2011 a ). Briefly, monoclonal mouse anti bovine L selectin (CD62L, IgG isotype, Serotec, Raleigh, NC) and mouse anti integrin (CD18, IgG1 isotype, Serotec, Raleigh, NC) with cross reacti vity with bovine CD18 were used. Nonspecific binding of the antibodies with cells was corrected by using an isotype mouse control antibody (IgG1 isotype, Serotec). The flow cytometer procedures occurred as described for neutrophil func tion. Density cytograms were generated by linear amplification of the signals in forward (cell diameter) and side (membrane irregularity) scatters. Percentages of neutrophils positively for L integrin were determined based upon gated cells. The GMFI of the labeling kit, an indicator of the number of L integrin on the surface of each neutrophil cell, was obtained in the histogram for the gated cell population . Peripheral b lood m ononuclear c ells i solation and c ytokine p roduction I solation of peripheral blood mononuclear cells (PBMC) was performed at 15 ± 2 and 30 ± 2 DIM, according to Padua and Hansen (2008) with some modifications. Briefly, 50 mL of blood was sampled from the coccygeal vessels in 10 mL evacuated tubes containing h eparin (Vacutainer, Becton Dickinson) from each cow. Blood was transported to the laboratory at ambient temperature and the isolation was initiated within 2 h of collection. Tubes were centrifuged for 15 min at 931 x g at room temperature (Allegra X 15R ce ntrifuge, Beckman Coulter Inc.). The buffy coat, containing most of the white blood cells, was transferred using sterile transfer pipettes to a 13 mL tube (Sarstedt Inc., Newton, NC) containing 2 mL of medium 199 (M 199, Sigma Aldrich). The buffy coat and M 199 medium were mixed by pipetting up and down several times. This cell suspension was transferred slowly on top of 2 mL of Fico/Lite

PAGE 109

109 LymphoH (Atlanta Biologicals, Lawrenceville, GA). The cell suspension/Fico/Lite LymphoH solution was centrifuged for 30 min at 524 x g at room temperature. Mononuclear cells were collected from the Fico/Lite interface and transferred to pre labeled 13 mL culture tubes containing 2 mL of red blood cell lysing buffer (Sigma Aldrich). Twenty seconds after transferring, the sol ution was neutralized with 8 mL of 1X DPBS (Sigma Aldrich). The solution was centrifuged at 524 x g for 15 min at room temperature. The supernatant was removed by aspiration with a sterile glass pipette attached to a vacuum pump and the pellet containing t he PBMC was re suspended in 4 mL of modified M 199. The M 199 media was supplemented with 5% horse serum, 500 U/mL of penicillin, 0.2 mg/mL of streptomycin, 2 m M of glutamine, and 10 5 mercaptoethanol, all reagents from Sigma Aldrich. The PBMC were cou nted using the Trypan blue dye (Sigma Aldrich) by exclusion method. The suspension was adjusted to 2 x 10 6 cells/mL. Cell suspension in a total volume of 2 mL was plated in triplicate with modified M 199 media and stimulated or not stimulated with 10 of concanavalin A (Sigma Aldrich) on a 6 well plate (Corning Inc., Corning, NY). Plates were incubated for 48 h at 37 o C at 5% CO 2 . After incubation, plates were centrifuged for 10 min at 524 x g and the supernatant was stored at 80°C for analysis of cyto kine production. Quantification of IFN development kit (R&D systems, Minneapolis, MN). Stimulated and non stimulated samples were run in triplicate with an intra assay CV of 9.8% . Antibody r esponse a gainst o valbumin i mmunization Cows were immunized with 1 mg of ovalbumin (Sigma Aldrich) diluted in Quil A adjuvant solution (0.5 mg of Quil A in 1 mL of PBS Accurate Chemical & Scientific Corp., Westbury, NY) on study enrollment ( 60 d relative to expected calving date), again 30 days after the first immunization and lastly at calving. Blood samples were collected at each vaccination

PAGE 110

110 and once a week for the first 5 wk postpartum. Samples were collected from coccygeal vessels in a tube without an ti coagulant (Vacutainer, Becton Dickinson), and serum was separated at room temperature. Tubes were centrifuged (2,095 x g for 15 min, Alleg r a X 15R centrifuge), harvested serum was stored at 20 o C for further analyses. An ELISA was performed to measure s erum IgG concentration. A 96 well flat bottom plate (Immulon 2, Dynex Tech., Chantilly, VA) was coated for 48 h at 4 o C using a coating solution of 1.4 mg of ovalbumin diluted in 1 mL of carbonate bicarbonate buffer. After coating, plates were washed four t imes with 200 µL/well of washing solution (0.5 mL of Tween 20 diluted in 1 L of PBS). Plates were blocked adding 200 µL/well of block solution (30 mL of Tween 20 plus 10 g of bovine serum albumin, diluted in 1 L of PBS) and incubated at room temperature fo r 1 h. After incubation, plates were washed as described before. Serum from a cow never immunized with ovalbumin, and from a cow sampled 21 d after the third immunization were used as negative and positive controls, respectively. Samples, as well as negati ve and positive controls, were diluted (1/50 and 1/200), and 100 µL/well were added in duplicate. Plates were incubated for 2 h at room temperature and then washed. Alkaline phosphatase conjugate rabbit anti bovine IgG whole molecule (Sigma Chemical, St. L ouis, MO) was diluted in TBS (Tris base , Sigma Chemical, St. Louis, MO; dilution was 0.026 µL of antibody/1 mL of TBS), and 100 µL/well added and incubated for 1 h. Plates were washed and 80 µL/well of substrate (P Nitrophenyl Phosphate Disodium, Sigma Che mical, St. Louis, MO) was added. Plates were incubated for 30 min and read immediately after the incubation time ended. An automatic ELISA plate reader (MRX Revelation; Dynex Technologies Inc., Chantilly, VA) was used and the optical density was recorded a t 405 nm and the reference at 650 nm. Results were corrected by dividing the experimental sample by the positive control at the same specific dilution. Results of each dilution were averaged and the average of 2 dilutions was

PAGE 111

111 reported. Inter and intra ass ay coefficients of variation based on the positive control were 9.7 and 9.2%, respectively . Uterine Health and Postpartum Ovarian Activity Uterine d iseases Cows were diagnosed as having retained placenta when the fetal membranes were not expelled within 24 h of calving. Cows were palpated per rectum to evaluate the uterine discharge on d 4, 7 and 12 after calving. Metritis was characterized by the presence of fetid red brown watery uterine discharge. Puerperal metritis was considered when metritis was prese nt concurrent with fever (Sheldon et al., 2006). Clinical endometritis was evaluated using the Metricheck device (Metricheck, Simcro, New Zealand) at 25 ± 2 DIM. The vulva was cleansed with chlorhexidine solution (Novalsan Solution, Zoetis Animal Health, F lorham Park, NJ) and then dried with a paper towel. The Metricheck device was inserted into the vagina towards the cervix and pulled out bringing vaginal fluid. Discharge was classified as clear, mucopurulent, or purulent. Clinical endometritis was conside red when at least 50% of the vaginal discharge was pus. Uterine cytology was performed at 36 ± 2 DIM to evaluate the incidence of cytological endometritis and to perform microbiologic analyses. Briefly, the vagina was cleansed with chlorhexidine solution a nd sanitized with alcohol. A sterile Foley catheter (18 French, 56 cm) covered with a plastic sheet was introduced into the vagina and the protection sheet removed after the catheter was placed into the entrance of the cervix. The catheter was directed to the previously pregnancy horn and placed 3 to 4 cm past the uterine bifurcation. The balloon of the catheter was inflated with 10 to 15 mL of air to keep the catheter in stable position. Subsequently, 30 mL of a 0.9% sterile saline solution (Aqualite Syste m, Abbott Laboratories, North Chicago, IL) was infused into the horn, with subsequent recovery of the solution. The

PAGE 112

112 flush solution was placed immediately in ice and transported to the laboratory within 2 h of collection. The uterine flush solution was hom ogenized and an aliquot of 100 µL was streaked with a sterile glass swab onto blood and MacConkey agar plates. Plates were incubated for 48 h at 35 o C. Colonies of bacteria were characterized by morphology and Gram staining (BD Gram Stain Kits and Reagents, Becton Dickinson). Biochemical tests were performed to identify bacteria species. Immediately after the uterine flush, a sample for uterine cytology was collected using the cytobrush technique (Cytobrush Plus GT, Cooper Surgical, Trumbull, CT). The cyto brush was inserted into an adapted gun and covered with protective plastic (Continental Plastics, Delavan, WI). The gun was passed through the cervix and directed to the previously pregnant horn. The cytobrush was exposed and gently rotated against the ute rine mucosa and then retrieved into the gun. The brush was immediately smeared onto a glass slide. The slide was air dried and subsequently stained using Romanowski stain (Diff Quick, differential quick stain kit, Imeb Inc. San Marcos, CA). Total leukocyte s, neutrophils, and endometrial cells were counted using an optical microscope to complete 200 cells per slide. Cows were considered to have cytological endometritis when more than 10% of the total cells were identified as neutrophils (Martinez et al., 201 2) . Postpartum u terine i nvolution The reproductive tract of cows was scanned by ultrasound using a 5.0 MHz transrectal probe (Aloka 500, Hitachi Aloka America , Wallingford, CT ) thrice weekly from 10 to 40 DIM. Uterine horns were measured as described by Si lvestre at al. (2009) to characterize involution .

PAGE 113

113 Postpartum o varian c yclicity and s ynchronization for f irst AI Cows were scanned by ultrasound equipped with a 7.5 MHz transrectal probe (Aloka 500 , Hitachi Aloka America ) thrice weekly , starting at 5 d post partum through 40 DIM. Ovarian follicles and corpus luteum ( CL ) were mapped. Follicles were measured at the greatest diameter, and the diameters of the CL at a 90 o angle were measured to calculate the area and volume. Ovulatory follicle diameter was consid ered as the last measurement before the disappearance of the follicle followed by appearance of a CL. Ovulation was considered following the disappearance of a follicle and subsequent formation of CL in the same ovary. Blood was sampled thrice weekly by p uncture of coccygeal vessels into evacuated tubes containing K 2 EDTA (Vacutainer; Becton Dickinson) from 12 to 40 DIM to quantify progesterone concentrations in plasma. Blood tubes were placed in ice immediately after collection and centrifuged at 2,000 x g for 15 min for plasma separation within 8 h of collection. Plasma samples were frozen at 20 ºC until assayed. Concentrations of progesterone were evaluated in plasma by RIA using a commercial kit (Coat a Count, Siemens Healthcare Diagnostics, Los Angel es, CA). The sensitivity of the assay was 0.02 ng/mL, calculated as 2 SD below the mean counts per minute at maximum binding. Plasma harvested from cows on d 4 (~ 1.5 ng/mL) and 10 (~ 5.5 ng/mL) of the estrous cycle was incorporated into each assay and use d to calculate the CV. The intra and inter assay CV were 6.0 and 9.0%, respectively. E strous cycle were synchronized with the Ovsynch 56 (d 0 GnRH [ gonadorelin ] , d 7 PGF [25 mg] , d 9.5 GnRH [ ] , d 10 AI) concurrent with the use of a controlled internal drug release insert (CIDR) containing 1.38 g of progesterone (EAZI BREED CIDR, Zoetis) administered on the day of the first GnRH and removed on the day of the PGF injection. Pregnancy was evaluated by transrectal ultrasonogr aphy with a

PAGE 114

114 portable ultrasound equipped with a 7.5 MHz transrectal probe (Easi Scan, BCF technology, Rochester, MN) on d 32 after AI . Statistical Analysis Continuous data were tested for normality of residuals with the Shapiro Wilk test , and non normally distributed data were transformed before statistical analyses. Data with repeated measurements within the same experimental unit were analyzed with cow nested within treatment as the random error for testing the effects of treatment. Data were analyzed by the GLIMMIX procedure of SAS (SAS ver. 9.2, SAS Inst. Inc., Cary, NC) fitting either a Gaussian, Poisson, or binomial distribution according to the type of data. Intervals postpartum to first ovulation or to complete uterine involution were analyzed by th model using the PHREG procedure of SAS. All statistical models included the effects of treatment, parity, and the interaction between treatment and parity. For models with repeated measurements within the same experimental unit , time and the interactions between treatment and time, parity and time, and treatment and parity and time were also included. A covariate was included on the analysis of the immunoglobulin G titers. The time reference for the models was either day or week relative to calving. Orthogonal contrasts were performed to determine the effect of supplemental fat (control vs. SFA + EFA) or source of FA (SFA vs. EFA), and the interactions between supplemental fat and parity and source of FA and parity. The covarianc e structure (compound symmetry, heterogeneous compound symmetry, autoregressive 1, heterogeneous autoregressive 1, toeplitz) that resulted in measurements, the spatial power covariance structure was used. The Kenward Roger method was used to calculate the denominator degrees of freedom to approximate the F tests in the mixed models.

PAGE 115

115 . Results Markers of Immune Response Mean plasma c oncentrations of acid soluble protein did not differ with fat feeding, but cows fed EFA tended ( P = 0.09) to have less acid soluble protein than those fed SFA (Table 3 2). The concentrations of acid soluble protein increased ( P < 0.01) around calving in primiparous and multiparous cows in all three treatments (Figure 3 1, panels A and B). Nevertheless a n interaction ( P = 0.04) between fat feeding and parity was detected because concentrations in primiparous cows fed control were greater than those fed fat, particularly those fed EFA , and there was no difference among the multiparous cows . Concentrations of haptoglobin followed a similar pattern to those of acid soluble protein; they increased ( P < 0.01) around calving in primiparous and multiparous cows in all three treatments (Figure 3 1, panels C and D), but a FA by parity interaction ( P = 0.08) was det ected because for primiparous, those fed EFA had lower concentrations than those fed SFA , and there was no difference among the multiparous cows . The total concentration of leukocytes in blood during the transition period was not altered by treatments (Tab le 3 2; Figure 3 2). On the other hand, the differential count of lymphocytes and neutrophils differed with feeding fat. The proportion of lymphocytes decreased ( P = 0.02), whereas that of neutrophils increased ( P = 0.01) in blood of cows fed fat. Source o f FA or interactions of fat feeding or FA source with parity did not affect the proportions of different leukocytes in blood of cows. The proportion of neutrophils expressing L selectin increased ( P < 0.01) with fat feeding (Table 3 2), and this increase w as greater ( P < 0.01) in primiparous than multiparous cows (Figure 3 3A). Similar to the proportion of neutrophils expressing L selectin, the GMFI for L -

PAGE 116

116 selectin, a proxy for the abundance of this adhesion molecule per neutrophil, increased ( P = 0.04) with fat supplementation, and the increase occurred solely ( P = 0.01) in primiparous (control = 280.7 ± 107.1 vs. SFA = 5 33.9 ± 65.6 vs. 633.7 ± 64.6) but not multiparous cows (control = 319.8 ± 45.0 vs. SFA = 245.4 ± 56.1 vs. 326.3 ± 47.9). Fat feeding also i ncreased ( P = 0.02) the integrin, from primiparous but not multiparous cows ( P = 0.04; Figure 3 3B). No effect of fat feeding or source of FA was detected integrin in neutrophils. The ability of neu trophils to kill E. coli by phagocytizing and undergoing oxidative burst increased with feeding fat ( P = 0.03) and this increase was only ( P = 0.05) in primiparous cows (Figure 3 3C). The GMFI for bacterial killing tended ( P = 0.07) to be greater for EFA t han SFA (Table 3 2). Interestingly, cows that developed disease after calving had neutrophils with reduced ( P < 0.05) expression of L selectin and ability to undergo phagocytosis and oxidative burst (Figures 3 3D and 3 3F), but this depression was prevente d ( P < 0.05) in integrin in neutrophils did not differ between healthy and diseased cows when fed fat, but tended to be less ( P = 0.09) in diseased than healthy cows when fed the control diet (Figure 3 3E). Production of IFN isolated lymphocytes was not altered by fat feeding or type of FA fed (Table 3 2), and averaged 136.5 ± 58.2 and 115.9 ± 44.7 pg in the cell cultures on d 15 and 30 postpartum, respectively. Serum IgG titers against ovalbumin were not affected by treatme nts (Table 3 2); however a tendency ( P = 0.09) for an interaction between type of FA and parity was detected because diet had no effect on anti ovalbumin IgG titers in multiparous cows, but primiparous fed SFA had greater IgG titers than primiparous cows f ed EFA (Figure 3 4). Anti ovalbumin IgG titers

PAGE 117

117 followed the typical immunization response, with increased ( P < 0.01) titers after each subsequent vaccination . Uterine Involution and Health Prostaglandin F metabolite concentrations in plasma during the firs t 10 DIM were high and declined ( P < 0.01) rapidly with day postpartum (Figure 3 5A). Cows fed EFA had greater ( P < 0.05) PGFM concentrations than controls on the day of calving and also greater ( P < 0.05) concentrations than SFA on the first 2 d postpartu m. No treatment effects were detected for concentrations of PGFM on and after 2 DIM. Diseases affected 32.9% of the cows in the first 13 wk of lactation (Table 3 3). Feeding fat or source of fatty acid fed did not influence the risks of retained placenta, metritis, endometritis or mastitis. However, feeding fat tended ( P = 0.07) to decrease the incidence of cows with fever and reduced ( P = 0.01) the incidence of puerperal metritis. The rate of uterine involutions did not differ with dietary treatments (Tab le 3 3; Figures 3 5B and 3 5C). Cows completed the involution of the uterus with a median of 33 to 36 d postpartum. By 39 DIM, the mean diameter of the previously gravid horn equalized with the mean diameter of the contralateral horn. A similar pattern was observed for involution of th e previously gravid horn and the decline in concentrations of PGFM in plasma (Figure 3 5). On d 36 postpartum, 8% of the cows fed control (2 in 25) and SFA (2 in 25) had uterine flush containing Trueperella pyogenes , but none of the cows fed EFA had uterus positive for the same bacterium. Escherichia coli was isolated in 24% of the control cows, but in none of the SFA cows and only 4.0% of the EFA cows. Overall, a larger ( P < 0.05) proportion of control cows had either T. pyog enes or E. coli isolated from the uterus than cows fed fat (32.0 vs. 6.0%).

PAGE 118

118 Ovarian Responses and Pregnancy The days postpartum to detect the first dominant follicle of at least 10 mm in diameter was 13.4 d, and this interval postpartum was not influenced by feeding fat or by the type of FA fed (Table 3 4). The proportion of estrous cyclic cows based on ovulation before 40 DIM was not affected by fat feeding, but an interaction ( P = 0.03) between fat feeding and parity was detected because for controls, th e proportion of cyclic cows was smaller for primiparous than multiparous (40.0 and 85.7%), whereas for cows fed fat the opposite was observed (SFA, 70.0 and 53.3%; EFA, 62.5 and 47.1%). The median d postpartum at first ovulation did not differ among treatm ents. The first ovulatory follicle ovulated with a mean diameter of 18.0 mm, and the resulting CL had similar calculated area and volume among treatments. The lack of differences in rate of ovulation and size of the CL resulted in no overall effect in the cumulative concentrations of progesterone up to 40 DIM (Figure 3 6). However, for ovulated cows, those receiving the SFA diet had greater ( P < 0.05) concentrations of progesterone after 30 DIM compared with cows either control or EFA . The pregnancy at firs t AI was not affected by feeding fat or by source of FA fed and averaged 41.3% (Table 3 4). Discussion Diets of dairy cows are supplemented with fat in an attempt to increase the caloric density of the ration and improve lactation performance; however, di ets of transition dairy cows usually contain low concentrations of dietary fat because of the potential negative effects on DM intake (Allen, 2000). Nevertheless, dietary FA can have effects beyond the supply of calories and can influence immunity and meta bolism (Silvestre et al., 2011a; 2011b). In fact, primiparous cows supplemented with fat in the current study had reduced concentrations of acute phase proteins, improved measures of neutrophil function, and reduced incidences of fever and puerperal metrit is. Furthermore, supplementing the diet with fat starting prepartum attenuated the

PAGE 119

119 reduction observed in neutrophil function when cows became ill. For many of the responses, no difference was observed between the sources of FA fed. One of the goals of tra nsition cow rations is to minimize depression in immune function observed around calving and improve peripartum health. Cows fed the control diet had a more sustained elevation in acute phase proteins postpartum, particularly the primiparous cows compared with primiparous fed EFA. These proteins are produced by the liver when an inflammatory process takes place and they might be interpreted as a sensor of inflammation which would lead to an anti inflammatory coordinated response in order to maintain homeost asis (Hochepied et al., 2003). Feeding EFA improved milk yield and efficiency of milk production ( Chapter 2 ) and this improvement might be related to changes in immune competence and reduced severity of diseases. H aptoglobin in plasma acts as a scavenger m olecule for free hemoglobin (Lim et al., 2000) and concentrations of acute phase proteins increase in inflammatory conditions such as metritis (Sheldon et al., 2001). The fact that puerperal metritis and fever were reduced in cows fed fat might explain the attenuation in acute phase protein response with DIM compared with cows not fed fat . More control cows were affected by p uerperal metritis . This disease is a more severe form of metritis with presentation of systemic signs such as fever, anorexia, and de pressed attitude (Sheldon et al., 2006). Innate immunity is critical for the defense of the uterus against bacterial colonization and elimination of infection in the early postpartum period (Sheldon et al., 2001). Cows fed fat were either less susceptible or more efficient in eliminating bacterial contamination that causes disease. Cows fed fat had improved measures of innate immunity, particularly neutrophil function, and those measures were less depressed during a disease state. Cows with depressed innate immunity either because of negative energy balance or poor Ca

PAGE 120

120 status are usually more susceptible to uterine diseases (Hammon et al., 2006; Martinez et al., 2012), and improvements in innate immune function are likely to have increased ability to clear ba cterial contamination from the uterus (Sheldon et al., 2014). In fact, cow fed fat had less prevalence of utero pathogenic bacteria in uterine flush, suggesting improved bacterial elimination. Together E. coli and T. pyogenes are the most common pathogens responsible for uterine diseases in dairy cows and they have synergistic effects in establishing uterine disease (Sheldon et al., 2006; Bicalho et al., 2012). The reduction in prevalence of these bacteria in the uterus of cows fed fat might be related to t he improved measures of innate immunity observed in cows, even when cows were diagnosed with disease. It has been shown that feeding fat, particularly sources of FA rich in linoleic acid, during the transition period improves measures of innate immunity (S ilvestre et al., 2011 a ) and reduces the severity of metritis in dairy cows (Juchem et al., 2010), which corroborates with the findings of the current study. Concentrations of neutrophil in blood were greater for cows fed fat, and an increased proportion of these cells expressed adhesion molecules that facilitate cell extravasation by diapedesis (Ley, 2007). The process of neutrophil rolling on the vascular endothelium is mediated by L selectin and it is a primordial event for the process of neutrophil extra vasation from the blood stream to injured tissue (Ley, 2007). After parturition, the expression of L selectin by neutrophils is decreased (Weber et al., 2001; Burton et al., 2005), which might impair neutrophil migration to infected tissues such as the ute rus or mammary gland. An inverse relationship between L selectin expression and neutrophil concentration has been indicated in the literature (Weber et al., 2001), and cows fed fat had increased proportion of neutrophils in blood and more of those cells ex pressed L selectin with increased intensity. Similar to L selectin, integrins to be able to firmly attach to the i ntercellular

PAGE 121

121 a dhesion m olecule s on the endothelial surface before extravasation to a tissue. Expression of integrins also was enhanced by feeding fat, and this response was greater in primiparous cows. Collectively, these results suggest that increasing the d ietary FA content of diets fed in late gestation and early lactation to up to 4.0% improves neutrophil function as it was reported when feeding a Ca salts rich in linoleic acid (Silvestre et al., 2011 a ). In cubation of lymphocytes with different polyunsaturated FA increased the proportion of those FA in the phospholipid fraction of the se cells (Calder et al ., 1994). In vivo , feeding diets that differ in FA profile influenced the FA profile of neutrophils (Silvestre et al., 2011 a ) and PBMC (Watts et al., 2013), suggesting that despite extensive rumen biohydrogenation of unsaturated FA, the profile observed in immune cells resemble that of the ingested FA. The FA profile of plasma of cows in the present study was altered by treatments ( Chapter 2 ), suggesting that a similar change also occurred in the immune cells. In humans, in vitro production of IFN by stim ulated PBMC was correlated with concentrations of stearic acid (Kew et al., 2003). Garcia et al. (2014) also reported increased IFN by calves fed linoleic acid. However, the present study was unable to show any effect of altering the dietary lipid conten t of the ration or feeding supplements with differing FA profile on in vitro production of IFN by PBMC in dairy cows . Immediately after calving and in the first few weeks postpartum, the main site of PGF synthesis is the uterus (Guilbault et al., 19 84). It is well known that arachidonic acid , which is present in the phospholipid fraction of endometrial cells (Mattos et al., 2000), is the precursor for the 2 series of PG , which are known to have pro inflammatory action s (Calder et al., 2012). It has b een shown that upregulating the innate immune system by feeding a diet enriched with linoleic acid was beneficial during the transition period (Silvestre et al., 2011a; 2011b), a time

PAGE 122

122 when the immune system is typically compromised (Mallard et al . , 1998). Prostaglandins , thromboxan e s, and leukotrienes originated from n 6 FA are key regulator y molecules during an inflammatory response and they typically are elevated in concentration in blood during the process of calving and uterine involution. Feeding diets enriched in linoleic acid starting prepartum increased plasmatic concentrations of PGFM at 1 (Juchem et al., 2010), 4 (Cullens, 2006), and up to 7 DIM (Silvestre et al., 2011a). Concentrations of PGFM increased with feeding EFA only on the day of calving and the following day in the present study. It is possible that slight elevations in uterine PGF synthesis might enhance uterine defense mechanisms (Seals et al., 2002). Healthy cows had increased concentrations of PGFM after calving compared with the co unterparts that developed metritis (Seals et al., 2002). Furthermore, it has been demonstrated that PGF is a neutrophil chemoattractant that stimulates phagocytosis of bacteria (Hoedemaker et al., 1992). Although arachidonic acid is seldom detected in th e caruncles of cows immediately after calving (Silvestre et al., 2011a), its precursor, linoleic acid, increases in concentration in reproductive tissues with dietary supplementation (Scholljegerdes et al., 2007; Silvestre et al., 2011a). This increased co ncentration might prime the cow to enhance PGF 2 and other inflammatory mediators important for immune defense. Feeding fat or altering the FA profile of the supplemental fat during late gestation and early lactation did not have major effects on ovarian physiology in the first 40 DIM. Two of the most consistent responses to feeding fat are increased ovulatory follicle diameter and subsequent concentrations of progesterone in plasma (Staples at al., 1998; Santos at al., 2008). The current study showed no effect of fat feeding or source of FA fed on inte rval postpartum to first ovulation, diameter of the ovulatory follicle, and dimensions of the CL. However, the cumulative concentrations of progesterone increased after 30 DIM in controls compared with cows fed fat.

PAGE 123

123 An interaction between fat feeding and o vulation was detected and this might be explained by the differences in energy balance observed between primiparous and multiparous cows fed the different diets ( Chapter 2 ). Primiparous cows fed fat had improved energy balance and smaller NEFA concentratio ns in plasma; however, multiparous cows had greater NEFA concentrations and smaller energy balance, especially those fed the EFA diet ( Chapter 2 ). Estrous cyclicity by 40 DIM was greater for primiparous cows fed fat compared with control primiparous, but t he opposite was observed for multiparous cows. The role of energy balance in early lactation influencing ovarian function have been well characterized, and cows that suffer from more pronounced negative energy balance have a delay in first estrous cyclicit y postpartum (Butler, 2003). In fact, Santos et al. (2009) reported an increase in the proportion of estrous cyclic cows by 65 DIM as the loss of BCS was attenuated, therefore, indicating better energy status. Pregnancy at first AI was only numerically imp roved by feeding EFA compared with control or SFA, and the lack of effect is explained by inadequate power to detect pregnancy responses to fat feeding (Santos et al., 2008) . Conclusion Supplementing fat to the diets of pre and postpartum dairy cows t o increase the dietary fat content from 2.0 to 3.7% prepartum and to 4.0% postpartum doubled the intake of FA, which enhanced measures for neutrophils function, reduced the incidence of puerperal metritis, and the prevalence of utero pathogenic bacteria is olated from the uterus of cows. The benefit of fat feeding seemed to be greater in primiparous than multiparous cows. Feeding fat attenuated the depression in neutrophil function observed in cows that developed disease postpartum. Despite the improvements in uterine health, the rate of uterine involution and resumption of ovarian cyclicity did not differ with fat feeding. Results from the current study suggest that increasing the dietary FA content of diets fed to transition cows from 2.0 to 3.7 or 4.0% wi th either SFA or

PAGE 124

124 EFA has the potential to improve peripartum health by influencing innate immune function and reducing the incidence of uterine disease .

PAGE 125

125 Table 3 1. Ingredient and chemical composition of experimental diets during pre and postpartum per iods fed to cows receiving no fat supplement (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Prepartum Postpartum Control SFA EFA Control SFA EFA Ingredient, % of DM Bermuda silage 56.0 5 6.0 56.0 10.8 10.8 10.8 Alfalfa hay 34.4 34.4 34.4 Ground barley 8.0 8.0 8.0 27.7 27.6 27.6 Peanut meal 10.0 10.0 10.0 7.5 7.4 7.4 Citrus pulp 21.9 20.2 19.9 14.9 13.1 12.7 Saturated free fatty acids 1 1.7 1.9 Ca salts of fatty acids 2 2.0 2.4 Mineral mix 3 4.1 4.1 4.1 4.7 4.7 4.7 Nutrient composition, DM basis NE for lactation, 4 Mcal/kg 1.42 1.49 1.50 1.59 1.67 1.67 Crude protein, % 14.0 ± 1.5 13.9 ± 1.4 14.1 ± 1.3 16 .7 ± 1.0 16.3 ± 1.0 16.4 ± 1.3 Starch, % 6.7 6.8 6.8 16.4 16.4 16.4 Non fibrous carbohydrates, 5 % 28.2 ± 2.8 25.2 ± 3.1 25.6 ± 1.5 42.0 ± 2.3 41.9 ± 2.9 39.8 ± 2.4 NDF, % 47.0 ± 2.6 48.2 ± 2.4 47.4 ± 1.6 29.5 ± 1.9 29.1 ± 2.5 29.9 ± 1.9 NDF from for age, % 37.6 ± 1.4 37.6 ± 1.4 37.6 ± 1.4 19.0 ± 1.5 19.0 ± 1.5 19.0 ± 1.5 ADF, % 25.6 ± 2.6 25.3 ± 2.5 25.5 ± 2.3 16.8 ± 1.6 16.2 ± 1.9 16.8 ± 2.1 Fatty acids, 6 % Total 1.99 3.62 3.65 1.98 3.79 3.96 C18:2 cis 9, cis 12 0.49 0.48 0.94 0.60 0.59 1 .14 Ca, % 1.41 1.47 1.67 1.36 1.29 1.60 P, % 0.29 0.28 0.30 0.34 0.34 0.32 Mg, % 0.38 0.38 0.41 0.38 0.35 0.37 K, % 1.35 1.34 1.34 1.45 1.42 1.40 Cl, % 0.76 0.76 0.80 0.47 0.43 0.52 Na, % 0.17 0.17 0.20 0.62 0.50 0.50 1 Energy Booster 100 (Milk Specialties, Dundee, IL). 2 Megalac R (Church & Dwight, Princeton, NJ).

PAGE 126

126 3 Prepartum, contains (DM basis) 34.5% corn meal, 12.0% ammonium chloride 5.0% dicalcium phosphate, 16.0 calcium carbonate, 10% calcium sulfate, 5% magnesium oxide, 10% magnesium sulf ate, 4% sodium chloride, 1.7% Zinpro 4 plex (Zinpro, Eden Prairie, MN), 0.4% Rumensin 80 (Elanco Animal Health, Greenfield, IN), 0.35% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.002% Ca iodate, and a vitamin premix. Each kg contains 24.5% CP, 9.8% Ca, 1.5% P, 4.2% Mg, 3.2% S, 1.7% Na, 10.7 % Cl, 475 mg Zn, 160 mg of Cu, 456 mg of Mn, 7.4 mg of Se, 37.4 mg of Co, 13.2 mg of I, 118,000 IU of vitamin A, 27,500 IU of vitamin D , 2,600 IU of vitamin E, and 770 mg of monensin. 3 Postpartum, conta ins (DM basis) 30.8% blood meal, 30.5% sodium bicarbonate, 12.0% dicalcium phosphate, 6.0% magnesium oxide, 4.8% magnesium sulfate heptahydrate, 2.9% sodium chloride, 0.12% manganese sulfate monohydrate, 0.06% zinc sulfate, 2.9%, MetaSmart (Adisseo, Atlan ta, GA), 0.25% Zinpro 4 Plex (Zinpro Co., Eden Prairie, MN), 0.45% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.25% Rumensin 80 (Elanco Animal Health, Greenfield, IN), and vitamin and iodine premix. Each kg contains 28.5% of CP, 6.3% of Ca, 1.2% of P, 3.9% of Mg, 10.5% of Na, 3.1% of Cl, 587 mg of Zn, 124 mg of Cu, 654 mg of Mn, 9.6 mg of Se, 25 mg of Co, 13 mg of I, 131,000 IU of vitamin A, 36,000 IU of vitamin D, 1,200 IU of vitamin E, and 470 mg of monensin. 4 Net energy of diets consideri ng 12 and 21 kg/d of DM intake for the pre and postpartum periods, respectively ( NRC, 2001 ). 5 Nonfibrous carbohydrates calculated as: 100 (NDF + CP + EE + Ash).

PAGE 127

127 Table 3 2. Parameters of immune competence of periparturient Holstein cows rec eiving no fat supplementation (c ontrol), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Control SFA EFA SEM 1 Fat 1 FA 1 Fat x P 1 FA x P 1 44.6 44.1 39.8 1.9 0.29 0.09 0.04 0.26 Haptoglobin, optical den sity x 1,000 1.67 1.67 1.61 0. 12 0. 8 4 0.7 2 0. 36 0. 08 Leukocytes of blood 13.6 12.4 11.1 1.9 0.47 0.57 0.33 0.89 Lymphocytes, % 65.4 55.2 55.1 3.4 0.02 0.95 0.22 0.90 Neutrophils, % 25.8 35.8 35.7 3.1 0.01 0.98 0.38 0.74 L s ele ctin Percentage of neutrophils 9 0.8 9 5.9 9 6 . 8 1.1 <0.01 0. 50 <0.01 0. 55 GMFI 2 300.3 399.6 480.0 47.1 0.04 0. 18 0. 01 0.99 i ntegrin Percentage of neutrophils 89.5 93.1 94. 4 1. 3 0. 02 0.4 4 0. 04 0.1 7 GMFI 105.8 9 7 . 1 95.5 20.8 0. 73 0. 95 0. 87 0. 59 Phagocytosis with oxidative burst Percentage of neutrophils 88 . 5 91. 1 9 2 .4 1.1 0. 03 0. 36 0.05 0. 58 GMFI 1 05 . 1 98.6 111.9 5.2 0. 98 0. 07 0. 86 0. 76 131.1 146.7 100.6 51.4 0.89 0.43 0.84 0.98 IgG, optical den sity 0.769 0.816 0.747 0.038 0.80 0.20 0.29 0.09 1 SEM = Standard error of the mean; Fat = control vs. ( SFA + EFA ); FA = SFA vs. E FA; Fat x P = interaction between Fat and parity; FA x P = interaction between FA and parity. 2 GMFI = Geometric mean fluore scence intensity.

PAGE 128

128 Table 3 3. Uterine health, in cidence of mastitis, morbidity of periparturient Holstein cows receiving no fat supplementation ( c ontrol), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Control SFA E FA Fat 1 FA 1 Fat x P 1 FA x P 1 % (no./no) Morbidity, 2 % 38.5 (10/26) 28.0 (7/25) 32.0 (8/25) 0.60 0.83 ----Retained placenta 3.9 (1/26) 16.0 (4/25) 0 0.27 0.22 ----Fever 3 46.2 (12/26) 28.0 (7/25) 32.0 (8/25) 0.07 0.71 0.24 0.88 Metriti s 26.9 (7/26) 12.0 (3/25) 16.0 (4/25) 0.17 0.68 ----Puerperal metritis 4 26.9 (7/26) 4.0 (1/25) 8.0 (2/25) 0.01 0.52 ----Endometritis 5 Clinical 53.9 (14/26) 56.0 (14/25) 44.0 (11/25) 0.79 0.38 0.76 0.61 Cytological 30.8 (8/26) 32.0 (8 /25) 36.0 (9/25) 0.96 0.81 0.89 0.68 Mastitis, % 15.4 (4/26) 16.0 (4/25) 16.0 (4/25) 0.70 0.89 ----Uterine involution by 40 DIM % (n/n) 76.9 (20/26) 78.3 (18/23) 72.0 (18/25) 0.88 0.79 0.45 0.98 Adjusted HR (95% CI) Referent 0.94 (0.50 1 .79) 1.06 (0.56 2.00) 0.14 0.46 ----Median d (95% CI) 33 (30 to 36) 36 (30 to 36) 33 (24 to 39) 1 Fat = control vs. SFA + EFA; FA = EFA vs. SFA; Fat x P = interaction between Fat and parity; FA x P = interaction between FA and parity. Some cont rasts were not estimated because of separation of data points. 2 Cows diagnosed with at least one clinical disease that included retained placenta, metritis, displace d abomasum, or mastitis. 3 Rectal temperature > 39.5 o C on d 4, 7 or 12 postpartum. 4 Cow s with metritis concurrent with fever or systemic signs of illness. 5 C linical = mucus score > 2

PAGE 129

129 Table 3 4. Ovarian responses during the first 40 DIM of periparturient Holstein cows receiving no fat supplementation ( c ontrol), saturated free fatty acids (SFA), or Ca salts con taining essential fatty acids (EFA) Control SFA EFA SEM a Fat a FA a Fat x P a FA x P a 13.5 13.3 13.3 0.9 0.89 0.98 0.92 0.86 Rate of ovulation by 40 DIM Ovulated, % (n/n) 76.9 (20/26) 60.0 (15/25) 52.0 (13/25) --0. 58 0.63 0.03 0.95 Adjusted HR b (95% CI) Referent 0. 75 (0. 38 1. 48 ) 0.56 (0.27 1.12) --0.14 0.46 ----Median ( mean ± SEM ) , d 27 ( 26.4 ± 1.6 ) 30 ( 28.1 ± 2.4 ) 3 8 ( 30.3 ± 2.0 ) ----------Ovulatory follicle diameter, mm 18.6 16.8 18.6 1.2 0.58 0 .22 0.31 0.92 Corpus luteum area, cm 2 3.7 4.8 4.2 0.5 0.30 0.39 0.92 0.24 Corpus luteum volume, cm 3 5.5 7.8 6.5 1.2 0.33 0.38 0.97 0.22 Pregnant 1 st AI, % (n) 35.5 (25) 37.6 (25) 50.0 (25) --0.62 0.42 0.47 0.11 a SEM = Standard error of the mean; Fat = control vs. SFA + EFA; FA = EFA vs. SFA; Fat x P = interaction between Fat and parity; FA x P = interaction between FA and parity. b HR = hazard ratio.

PAGE 130

130 Figure 3 1. Concentrations of acid soluble protein (A, primiparous; B, multiparous) and of ha ptoglobin (C, primiparous; D, multiparous) in plasma of Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) .

PAGE 131

131

PAGE 132

132 Figure 3 2. Leukocyte concentration ( A), ly mphocyte percentage (B), and neutrophil percentage (C) in blood of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA). In panel A, effect of feedin g fat ( P = 0.47), source of FA ( P = 0.57), and DIM ( P = 0.90). In panel B, effect of feeding fat ( P = 0.02), source of FA ( P = 0.95 ), and DIM ( P < 0.001). In panel C, effect of feeding fat ( P = 0.01 ), source of FA ( P = 0.9 8 ), and DIM ( P < 0.001) .

PAGE 133

133 F igure 3 3. Proportions of neutrophils of cows fed no supplemental fat (control), saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) expressing L integrin accor ding to parity (B) or disease (E), or undergoing phagocytosis and oxidative burst according to parity (C) or disease (F). Statistical effects of panels A, B, and C are depicted in Table 3 2. In panel D, effect of disease ( P < 0.01) and interactions between feeding fat and disease ( P < 0.01) and source of FA and disease ( P = 85). In panel E, effect of disease ( P = 0.27) and interactions between fat and disease ( P = 0.09) and FA and disease ( P = 0.31). In panel F, effect of disease ( P = 0.03) and interactions between feeding fat and disease ( P < 0.01) and source of FA and disease ( P = 0.45).

PAGE 134

134 Figure 3 4. Immunoglobulin G titer in response to ovalbumin immunization of primiparous (A) and multiparous (B) Holstein cows receiving no fat supplementation (cont rol), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA). For statistical effects refer to Table 3 2 .

PAGE 135

135 Figure 3 5. Concentrations of 13,14 dihydro 15 keto PGF (PGFM ) in plasma (A ) , diameter of the previously pregnant (B) and contralateral uterine horn (C) of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA). In panel A, effect of feeding fat ( P = 0.79 ), source of FA ( P = 0.22), DIM ( P < 0.001). On average concentrations of PGFM were control = 1,658 ± 350, SFA = 1,522 ± 271, and EFA 2,013 ± 289 pg/mL. In panel B, effect of feeding fat ( P = 0.50), source of FA ( P = 0.47), and DIM (P < 0.001). The average diameters of the previously pregnant uterine horn were: control = 26.9 ± 0.7, SFA = 26.1 ± 0.6, and EFA = 26.7 ± 0.6 mm. In panel C, effect of feeding fat ( P = 0.61), source of FA ( P = 0.68), and DIM ( P < 0.001). The average diameters of the contralateral uterine horn were: control = 22.7 ± 0.6, SFA = 22.2 ± 0.5, and EFA = 22.5 ± 0.5 mm. Within a day, pairwise differences ( P < 0.05) are represented as follow: # ( EFA vs. control) or * (EFA vs. SFA) .

PAGE 136

136 Figure 3 6. Cumulative concentrations of progestero ne according to day postpartum in cows that ovulated (A) or remained anovular by 40 DIM (B). Effect of feeding fat ( P = 0.51), source of FA ( P = 0.48), interactions between ovulation and fat feeding ( P = 0.48) and ovulation and source of FA ( P = 0.43). Wit hin cows that ovulated, an interaction between fat feeding and DIM was detected ( P < 0.05). Within a day, * denote pairwise differences between control cows and cows fed SFA and EFA ( P < 0.05) .

PAGE 137

137 CHAPTER 4 EFFECTS OF F ATTY ACID SUPPLEMENTATION ON HEPATIC FATTY ACID PROFILE AND GENE EXPRESSION IN P ERIPARTURIENT DAIRY COWS The objectives were to evaluate the effects of supplementing diets containing low amounts of fatty acids (FA) with either mostly saturated free FA or Ca salts containing essential FA durin g the transition period on hepatic FA profile and gene expression . Fifteen nulliparous and 15 parous Holstein cows were assigned to treatments 56 d before calving and treatments were maintained until 14 d in milk. Cows were randomly assigned to receive a c ontrol diet with 2.0% FA pre and postpartum, or diets supplemented with mostly saturated free FA (SFA) or Ca salts enriched with essential FA (EFA) to increase the FA content to 3.7% prepartum and to 4.0%. Hepatic tissue was collected for biopsy at 14 ± 1 d in milk and FA profile and global gene expression were measured. The total FA content of hepatic tissue was not affected by fat feeding or by the source of FA fed and averaged 17.6 and 27.1 ± 4.7 % of DM for primiparous and multiparous cows, respectivel y. Hepatic tissue of cows fed control diet had greater proportion of the cis isomers of C18:1, whereas the trans isomers were greater on cows fed EFA. Concentrations of linoleic (control = 8.0 ± 0.5; SFA = 8.7 ± 0.5; EFA = 11.2 % of FA) and conjugated lino leic ( CLA; control = 0.28 ± 0.03; SFA = 0.21 ± 0.03; EFA = 0.40 ± 0.03 % of FA) acids were greater on hepatic tissue of cows fed EFA diet. Feeding fat differently regulated 22 genes on hepatic tissue and it was more pronounced within the primiparous (273 g enes) than in multiparous (32 genes) cows. The different source of FA influenced the expression of 27 genes and was also more prominent within primiparous (68 genes) than multiparous (28 genes) cows. The lack of FA on control cows up regulated pathways rel ated to immune system, with genes markers of impaired health ( BOLA DQA5; BOLA DQB; GGT1 ). Whereas cows fed fat had up regulation of the renin angiotensin system, with emphasis on the control and prevention of fibrosis ( ACE2 ). Feeding different sources of F A differently regulated several pathways

PAGE 138

138 related to lipid metabolism. Cows fed SFA had markedly increased the expression of desaturases enzymes ( FADS2 and SCD ) and Acyl CoA synthetase ( ACSS2 ). Feeding EFA up regulated pathways related to vitamin and fat ab sorption ( APOA4 ). Collectively, these results suggest that increasing dietary FA content of diets fed to transition cows with different sources of FA influenced hepatic FA profile and gene expression, especially genes related to immune system and lipid met abolism. Introduction The modern dairy cow undergoes an extensive challenge when transitioning from non lactation to lactation that entails partitioning of nutrients as part of a homeor h etic process to meet the needs of the mammary gland to secrete milk ( Bell and Bauman, 1997). During this transition period, intense physiological adaptations occur to accommodate the increasing demand of nutrients for final fetal development and colostrum synthesis (Bell, 1995). Besides this increased demand for nutrients, it is common that DM intake decreases in late gestation and early lactation (Bell, 1995; Drackley, 1999). In the early postpartum period of transition, DM intake increases but not sufficiently to meet the energy and nutrient needs of the cow because of the copious secretion of milk. Consequently, cows undergo a prolonged period of negative energy balance that enhances the risk for metabolic diseases, diseases of the mammary gland and uterus, and compromised reproductive function. Attempting to increase diet ary energy density via dietary supplementation of fats is a commonly practiced nutritional management strategy for dairy cows (Damgaard et al., 2013). Ideally increasing the energy intake, during the transition period, decreases body fat mobilization there by minimizing the incidence of postpartum metabolic disorders (Damgaard et al., 2013). Although supplementing diets with FA have potential effects on energy metabolism, the type of FA utilized may also be important. Linoleic (C18:2 cis 9, cis linolenic (C18:3 cis 9, cis 12, cis 15) acids are essential to all mammals because

PAGE 139

139 they lack the delta 12 and 15 desaturases (Hashimoto et al., 2006). Essential FA and other longer chain omega 6 (n 6) and 3 (n 3) FA are active molecules that not only provide calories, but also influence the expression of genes affecting metabolism (Jump, 2002) and immune responses (Calder et al., 2012). The liver is one of the key organs in which severe adaptations occur during the transition period (Loor, 2010). Besid es the normal physiological modulations of hepatic gene expression during the periparturient period, the specific nutrients in the diet may differentially regulate the array of hepatic genes being expressed that influence productivity and well being of the dairy cow. These factors in the diet that specifically influence health are referred to as nutraceuticals. Specific FA can regulate gene expression through specific PPAR receptors that control transcription of specific proteins regulating enzymatic pathwa ys, metabolism, immune function etc. (Sampath and Ntambi, 2005; Thering et al. , 2009). The hypothesis of this investigation was that cows fed diets with limited concentrations of essential FA, particularly linoleic acid, would negatively influence liver FA profile and gene expression. Furthermore, it was expected that supplementation with saturated FA would not have similar effects on liver FA profile and gene expression as supplementing with essential FA. Therefore, the objective were to evaluate the effec ts of supplementing diets containing low amounts of FA with either mostly saturated free FA or Ca salts containing essential FA during late gestation and early lactation on hepatic FA profile and gene expression . Materials and Methods The experiment was c onducted at University of Florida Dairy Unit (Hague, FL) from October 2008 to March 2009. All experimental cows were managed according to the guidelines approved by the University of Florida Institute of Food and Agricultural Sciences Animal Research Commi ttee .

PAGE 140

140 Study Design, Animals, Housing and Feeding The present study is complimentary to a large experiment (study 1; Chapter 2 ) ; consequently details referring to animals, facilities, chemical composition of the diets and FA profiles were described in deta il elsewhere ( Chapter 2 ). Nulliparous (n = 15) and parous (n = 15) Holstein cows were selected randomly as a subset for this experiment. Cows were allocated to treatments at 56 ± 5 d before calving , until 90 postpartum . Treatments for the pre and postpar tum periods were no fat supplementation pre and postpartum ( control , n = 10 ), fat supplementation of 1.7 and 2.0% of dietary DM, respectively, added as mostly saturated free FA ( SFA ; Energy Booster100, Milk Specialties, Dundee, IL; n = 10 ), and 2.0 and 2. 4% of dietary DM, respectively, as Ca salts enriched with essential FA ( EFA , Megalac R; Church & Dwight, Princeton, NJ; n = 10 ). The FA compositions of the supplements as well as the diets ar e depicted in Chapter 2 . The amounts of supplemental FA from SFA and EFA were based on the FA content of each supplement to ensure similar concentrations of supplemental FA in diets of cows supplemented with fat. The control diet fed pre and postpartum was formulated to contain low concentrations of FA, particularly li noleic acid, but meet the metabolizable protein and energy of a prepartum cow weighing 680 kg and consuming 10 kg of DM/d and of a postpartum cow weighing 620 kg and producing 38 kg of milk/d when consuming 23 kg of DM/d ( Chapter 2 ; NRC, 2001). The total F A content of rations in which fat was supplemented was moderate and the supplies of linoleic linolenic acids were similar between control and SFA diets, but both differed from those of EFA diets. Because cows fed EFA received Ca salts of FA, the total Ca content of the pre and postpartum diets diff ered from those of cows fed control and SFA ( Chapter 2 ). Cows were housed in sod based pens and fed in groups during the first 32 d of the study. At 255 d of gestation, cows were moved to a pen equipped with individual feeding gates (Calan

PAGE 141

141 gates, America C alan Inc., Northwood, NH) for measurements of daily DM intake. On average cows lasted 56 ± 5 d on prepartum treatments, and there was no difference among treatments regarding days on dietary treatments . Prepartum diets were offered once daily at 10:00 h to allow 5% orts. Postpartum cows were housed in a free stall barn with sand beds equipped with individual feeding gates sprinklers (Rain Bird Manufacturing, Glendale, CA) and fans (J & D Manufacturing, Eau Claire, WI) . Postpartum diets were fed twice daily, at 07:00 and 13:00 h and amounts were adjusted daily to allow for 5% orts. Amounts offered and refused were measured daily pre and postpartum. Dry matter intakes were calculated for the last 3 wk prepartum and the first 1 4 d postpartum. Blood samples we re taken thrice weekly after calving to evaluate the concentrations of metabolites, hormones and acute phase proteins as described elsewhere ( Chapter 2 ; Chapter 3 ) . Samples for prostaglandin F metabolite analysis were collected daily up to 10 DIM . O nly the 30 cows selected for this experiment were included in the statistical analysis, and the dataset truncated at 14 DIM, when the liver tissue was collected for biopsy . Hepatic Tissue Collection for Biopsy On 14 ± 1 d postpartum cows underwent a procedure to collect liver tissue for biopsy. Briefly, the cow was restrained in a chute and an imaginary line was drawn between the ileum and the olecranon on the right side of the cow. The point where this imaginary line crossed the 11th intercostal space was marked , and a 30 cm of edge square around this point was marked. The hair was shaved and the area scanned by ultrasound (Aloka 500 equipped with a 3.5 MHz convex transducer, Hitachi Aloka America, Wallingford, CT) to locate the liver. The skin was thoroughly cle ansed and disinfected with a 7.5% povidone iodine soap scrub (Povidone Iodine Scrub, First Priority, Inc, Elgin, IL) and rinsed with 70% alcohol. A 3 cm line block with 10 mL of lidocaine hydrochloride 2% solution (Lidocaine Hydrochloride Injecti on 2%, Agr ilabs, St.

PAGE 142

142 Joseph, MO) was injected into the subcutaneous and intercostal muscle layers. The area was scrubbed with povidone iodine soap and rinsed multiple times with 70% alcohol. A 2 cm skin incision was made using a scalpel. A percutaneous liver biopsy needle (Aires Surgical, Davis, CA) was inserted in the incised skin penetrating the muscle layer at a 45o angle directed to the liver aiming toward the olecranon of the left front leg. Upon penetration into the liver, the hepatic tissue was sampled by nega tive pressure such that a specimen of 300 to 500 mg of tissue was recovered. Upon removal of the biopsy needle, the recovered tissue was removed from the needle using a forceps, placed on filter paper and rinsed with sterile PBS to remove any blood. The sp ecimen was split into two pieces, placed into RNAse free tubes (Nalgene, Thermo Scientific, Rockford, IL), and plunged into liquid N2. The skin incision was closed with a surgical disposable sterile skin stapler (Oasis Medical Inc., Mettawa, IL). Tubes co ntaining samples were transported to the laboratory and stored at 80 o C for subsequent analyses . Hepatic Tissue Fatty Acid Profile and RNA Isolation Approximately 300 mg of hepatic tissue was freeze dried for 48 h (Labconco, Kansas City, MO). Dried sampl es were sent to the Department of Animal Sciences of Michigan State University where FA profile was analyzed following the protocol described by Caldari Torres et al. (2011). Total RNA was extracted from hepatic tissue using Qiazol reagent (Qiagen, Valenc ia, CA) and purified (RNA MIDI isolation kit, Qiagen) according to instructions provided by the manufacturer. Subsequently, concentration and purity of isolated RNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific). RNA was consider ed of good quality when samples had a ratio of 260/280 between 1.8 and 2.0 .

PAGE 143

143 Affymetrix Array Hybridization, Washing, Staining and Scanning The microarray analysis was performed at the Genomics core division of the Interdisciplinary Center for Biotechnology Research ICBR at University of Florida. An initial 200 ng of RNA was utilized for amplification and biotin labeling throughout with Messag e AMP III (Applied Biosystems Inc., Foster City, CA) following the guidelines of the manufacturer. The quality of th e samples was assessed in the Bioanalyzer (Agilent Technologies, Santa Clara, CA) to assure RNA quality (i.e., RNA integrity number > 7.5), samples were fragmented and hybridized according to the Affymetrix protocol (Affymetrix GeneChip Bovine Genome Array , Affymetrix Inc., Santa Clara, CA) with the hybridization wash and stain kit from Affymetrix. Fluorescent signals were measured with the Affymetrix GeneChip scanner 3000 7G . Statistical Analyses Data associated with repeated measurements of performance, metabolites, hormones and acute phase proteins were analyzed by the GLIMMIX procedure of SAS (SAS ver. 9.2, SAS Inst. Inc., Cary, NC) fitting either a Gaussian or Poisson distributions according to the type of data. Data with repeated measurements over ti me within the same experimental unit were analyzed with cow nested within treatment as the random error for testing the effects of treatment. Continuous data were tested for normality of residuals, and non normally distributed data were transformed before statistical analyses. All statistical models included the effects of treatment, parity, time, and interactions between treatment and parity, treatment and time, parity and time, and treatment and parity and time. The time reference for the model was the d ay relative to an event. Orthogonal contrasts were performed to determine the effect of supplemental fat (control vs. SFA + EFA) and source of FA (SFA vs. EFA). The covariance structure (compound symmetry, heterogeneous compound symmetry, autoregressive 1, heterogeneous autoregressive 1, toeplitz) that resulted in the lowest

PAGE 144

144 covariance structure was used. The Kenward Roger method was used to calculate the denominat or degrees of freedom to approximate the F tests in the mixed models. When a single measurement was determined for each cow, then the model included the effects of treatment, parity, and interaction between treatment and parity. Significance of the differ . Affymetrix Array Data Analysis Array quality control analysis was performed using a web based analysis (Eijssen, et al., 2013; available at http://arrayanalysis.org ). All arrays had good quality analytical responses such that statistical analyses could be performed. The Affymetrix GeneChip Bovine Genome array contains 24,072 probe sets corresponding to approximately 23,000 transcrip ts including assemblies from approximately 19,000 UniGene clusters. The Affymetrix CEL files, originated after the fluorescence signal measure of each Affymetrix chip, were loaded into an AffyBatch object using R Bioconductor environment (Gentleman et al., 2004). Data normalization and background correction were performed using L owess and Robust Multichip Average (RMA) function. Differently expressed genes (DEG) were identified using Proc Mixed (SAS ver. 9.2, SAS Inst. Inc., Cary, NC). The statistical model for analysis of transcriptome abundance included the effect of treatment, parity and interactions between treatment and parity. The significant probability values were adjusted using the method of Benjamini and Hoechberg to adjust for multiple tests and c ontrol for false discovery rate (FDR)

PAGE 145

145 The Dynamic Impact Approach (DIA; Bionaz et al., 2012) was utilized to determine the impact of treatments on pathways by calculating the overall impact and the direction of the i mpact (flux) caused by the expression changes in genes coding for proteins involved in those pathways. The impact and direction of the impact for KEGG pathways were calculated only for those pathways that were represented by at least 30% in the microarray compared with the entire bovine genome and with at least four annotated bovine genes within th ose pathways . Results Performance on the F irst 14 d Postpartum Detailed results of animal performance from the complete number of cows to evaluate lactational per formance are presented in detail s in C hapter s 2 and 3 . Feeding fat or altering the source of FA fed did not affect DM inake of cows in the first 14 d postpartum (Table 4 1 ). However, a tendency ( P = 0.10) for an interaction between fat feeding and parity was detected . Feeding fat increased DM intake of primiparous cow s, whereas for multiparous feeding fat had no effect on intake (Figure 4 1, panels A and B). Milk yield was not affected by feeding fat, but cows fed EFA had greater ( P = 0.02 ) milk yield tha n those fed SFA (Figure 4 1, panels C and D). Similar ly, cows fed EFA also had greater 3.5% FCM than those SFA or control (Table 4 1). Concentrations of fat, true protein and lactose in milk w ere not influenced by feeding fat or the source of FA fed (Table 4 1). Although feeding fat did not increase the yield of milk components, the greater milk yield for EFA compared with SFA also resulted in increased yield s of milk components (Table 4 1). Feeding fat did not affect the energy balance of cows; however, c o ws fed SFA had a less pronounced period of negative energy balance then those fed EFA. Furthermore, an interaction ( P = 0.04) between fat feeding and parity was detected, and primiparous cows fed SFA had less negative energy balance than primiparous cows f ed control or EFA .

PAGE 146

146 There w ere no treatment effects on concentrations of glucose, NEFA, IGF 1 , a cid soluble protein, and haptoglobin (Table 4 1). Concentrations of BHBA in plasma tended ( P = 0.06 ; Table 4 1 ) to be greater in cows fed EFA compared with cows fed SFA. Interactions between fat feeding and parity ( P = 0.09) and the source of FA and parity ( P = 0.08) were also detected. Multiparous cows fed EFA had greater concentrations of BHBA in plasma than those fed either control or SFA diets. However , there were no treatment effects among the primiparous cows. An effect of feeding fat ( P = 0.04) and the source of FA ( P = 0.04) was detected for the concentrations of insulin in plasma. Both primiparous and multiparous cows fed SFA had increased plasma concentr ations of insulin compared with cows fed either control or EFA (Table 4 1). Concentrations of PGFM w ere greater for multiparous cows compared with primiparous ; however, they were not influenced by feeding fat or the source of FA fed (Figure 4 1) . Gene Exp ression The DEG are depicted on Table 4 3. Feeding fat a ffected the expression of 883 genes and the different source of FA altered the expression of 243 genes. When a fold change cut 1.4) was applied the number of DEG genes decreased to 22 and 27, for the fat feeding and source of FA, respectively. Th e treatments had greater effects on primiparous compared with source of F A resulted on 119 and 42 DEG without the FC cut 1.4 for primiparous and multiparous cows, respectively. The effect of parity, regardless of treatments had the greatest effect on DEG with 4,898 and 842 DEG without and with FC respectively. The list of genes with P depicted on Table 4 4, with the respective gene names .

PAGE 147

147 Pathway Analysis The overall effect s of feeding fat or source of FA on DEG that influence the categories of KEGG pathways are presented on Figure 4 2. It is clear that f at feeding had a major impact on pathways that encompass metabolism and disease s. Overall, feeding fat had a greater impact influencing the expression of different pathaways than t he source of FA fed. The source of FA fed influenced pathways related to lipid and amino acid metabolism. The specific categorization of pathways and the specific clusters of DEG influenced by fat feeding are depicted in Figure 4 3. Several pathways rela ted to the immune system were influenced by fat feeding. Within these pathways two genes of the major histocompatibility complex class II (MHC II; e.g., BOLA DQA5 and BOLA DQB ), were identified as being differentially expressed in an inhibitory manner in r esponse to fat feeding compared to control. Conversely, expression of these two MHC II genes was greater in the liver of c ontrol compared with cows fed fat . E xpressions of BOLA DQA5 and BOLA DQB were greatest in multiparous cows , but fat feeding basically shut down expression of both genes (Figure 4 3; Table 4 5). Differential expression of genes associated with metaboli c pathways that influence metabolism of amino acids and arachidonic acid were down regulated in the liver of cows fed fat . These genes incl uded GGT1 (gamma glutamyltransferase 1), GPX3 (glutathione peroxidase 3), NT5C (5', 3' nucleotidase, cytosolic), PSPH (phosphoserine phosphatase), and WFS1 (Wolfram syndrome 1). Primiparous cows fed the control diet had the greatest expression of GPX3 and WFS1 (Table 4 5). Feeding fat up regulated the renin angiotensin system based on increased expression of ACE2 (angiotensin I converting enzyme [peptidyl dipeptidase A] 2; Table 4 5). The comparison of hepatic gene expression between cows fed SFA and those fed EFA, ( P < 0.05 ), and gene abundance expression of 40 (Figure 4 4). Most of these pathways are related to

PAGE 148

148 FA, amino acid, and carbohydrate metabolism. Two of these path ways were down regulated in liver of cows fed SFA compared to EFA and both are related to digestion and absorption of fat and vitamins. This effect is driven by primiparous cows fed SFA, which had marked suppression of gene abundance of the APOA4 (apolipop rotein A IV) gene than those fed EFA (Table 4 5). Two FA desaturases (e.g., FADS2 and SCD ) were up regulated in the liver of cows fed SFA compared to cows fed EFA. The delta nine desaturase ( SCD ) had greater expression on liver of primiparous cows fed SFA compared to either the control or EFA fed primiparous; whereas treatments did not alter SCD gene expression in multiparous cows. Expression of FADS2 (fatty acid desaturase 2) was increased by SFA feeding in both primiparous and multiparous cows. These two desaturase genes were present in three of the 10 differently expressed pathways. Primiparous cows fed SFA had a greater expression of the ACSS2 (acyl CoA synthetase short chain family member 2) gene, and this gen e was present in two pathways (p ropanoate an d p yruvate metabolism) related to FA oxidation. No treatment effect on the ACDD2 expression was detected among the multiparous cows . Discussion The major overarching findings of the experiment is that feeding supplemental saturated FA and/or unsaturated F A enriched in linoleic FA to transition dairy cows alters hepatic gene expression in a manner that may benefit metabolic and health status of the dairy cows. Furthermore, there are apparent differences in responses to dietary Fat depending upon parity of the cow. Performance and Metabolic R esponses Neither feeding fat nor different source of FA throughout the transition period influenced the total FA content of the liver at 14 DIM. As previously reported (Douglas et al., 2004), fat feeding per se does not increase lipid accumulation in the liver during the transition period.

PAGE 149

149 Accumulation of lipids in the liver is more related to decreases in the DM intake around parturition, which causes a homeor h etic mobilization of body fat (Douglas et al., 2004). The FA profile of hepatic tissue resembles th ose found in adipocyte s and plasma . The reason for this similarity is likely the influence that diet has on all pools of body FA. Nevertheless, some bovine tissues are capable of desaturating FA ( Rezamand et al., 2014 ), which would alter the composition of lipids relative to the profile absorbed in the small intestine. Nevertheless, onset of lactation results in massive amounts of body fat rapidly mobilized , and many of these FA are readly taken up and incorporated int o the hepatic parenchyma as resterified triacylglycerols (Rukkwamsuk et al., 2000; Douglas et al., 2007). In general , the proportion of linoleic acid in the triacylglycerol fraction of the liver of cows increases after calving. Akbar et al. (2013) showed t hat regardless of fat feeding or the type of FA supplemented, the linoleic acid concentration of hepatic triacylglycerol increased more than 40% , from 4.2 to 7.2% from 21 before to 11 d after calving . This increase in linoleic acid likely reflects a differ ential uptake of of unsaturated FA by the hepatic tissue (Mashek et al., 2002) or an increased mobilization of unsaturated FA from body fat depots in early lactation. In spite of the natural increase in linoleic acid after calving, cows fed EFA in the pres ent study had greater proportion of linoleic acid in the FA of liver ; therefore, confirming that manipulating the diet provides a mean to alter tissue FA composition. The magnitude of th e increase in hepatic linoleic acid as a percentage of the total FA be tween cows fed SFA and EFA was of 28.7%, from 8.7 in SFA to 11.2% in EFA, and the increment in linoleic acid incorporation into the hepatic tissue with feeding EFA was more pronounced in multiparous , which had an increment of 59.5%, than in primiparous cow s, which had only a 5.3% increment. Incubatin of hepatic cells with l inoleic acid increased linoleic acid concentration in hepatocytes, but reduced ketogenesis

PAGE 150

150 and total FA metabolism compared with other PUFA (Mashek et al., 2002). In the current study, mu ltiparous cows consuming EFA had increased concentrations of BHBA in plasma compared with multiparous fed control or SFA (T able 4 1 and Chapter 2 ). Therefore, the changes in hepatic ketogenesis observed in multiparous fed EFA are unlikely to be mediated by the changes in hepatic FA composition, but likely the result of a greater influx of NEFA from tissue mobilization. Nevertheless, cows fed EFA had the greatest production of milk and 3.5% FCM, perhaps suggesting that feeding EFA starting prepartum might ha ve primed the liver to accommodate the metabolic challenge of increased early lactation performance. Cows fed EFA had greater concentrations of hepatic C 18:1 trans isomers and CLA compared with those fed control or SFA , and th ese trans FA are typical of r uminal metabolism of linoleic acid (Jenkins et al., 2008) , suggesting increased ruminal production and subsequent absorption by the cows fed EFA than the other diets. C onjugated linoleic acid is know n to alter gene expression in the mammary gland and decre ase milk fat synthesis (Baumgard et al., 2002). However, the amounts of CLA fed in the diet capable to alter gene expression in the liver surpass the amounts capable to alter milk fat synthesis (Schlegel et al., 2012). Schlegel fed dairy cows with 172 g of of a fat supplement that supplied 4.3 g of C18:2 cis 9, trans 11 and 3.8 g of C18:2 trans 10, cis 12 per cow per day. Feeding this blend of CLA reduced milk fat synthesis, but did not alter hepatic gene expression. Because no changes in milk fat content wer e observed by 14 DIM in cows in the current study with the different treatments, it is therefore reasonable to speculate the amouts of CLA and trans FA present on hepatic tissue cows fed EFA were not enough to alter hepatic gene expression. Hepatic Gene E xpression Dietary FA caused a differential expression of genes and inferred alterations in cellular pathways of hepatic tissue in early lactation . Feeding f at altered several pathways related to the

PAGE 151

151 immune system. Cows fed the control diet containing a mi nimal level of FA expressed a high abundance of two genes from the MHC II complex, bovine leukocyte antigen ( BOLA ) DQA5 and DQB . In contrast , the expression of these genes on hepatic tissue of cows fed either SFA of EFA was almost absent . The BOLA DQA5 a nd DQB proteins are present on antigen presenting cells such as macrophages and dendritic cells that are responsible for recogniz ing and present ing intra and extravesicular pathogens and toxins to CD4 T cells (Murphy, 201 1b ). Rams chronically infected wi th Brucella ovis had up regulation of several genes of the MHC complex (Antunes, 2012), indicating that these genes are upregulated in inflammatory condition s . The changes in hepatic expression of BOLA DQA5 and DQB might indicate that cows fed control had increased hepatic inflammatory response, which would justify enhanced infiltration of antigen presenting cells into the hepatic tissue a nd the subsequent upregulation BOLA DQA5 and DQB mRNA . It is known that increased triacylglycerol infiltration that oc curs in early lactation can induce hepatic inflammation, and many cows in early lactation respond to diseases by upregulating the acute phase response by the liver (Bobe et al., 2004). It is possible that feeding fat, which altered the FA profile of the he apatic tissue, influenced the response of the liver to subclinical conditions providing some degree of protection to the liver, which reduced expression of genes linked to inflammatory or infectious processes. Additional noteworthy pathways that were up regulated in cows fed control diet are related to metabolism of amino acids and arachidonic acid. One of the important genes up regulated that control several of these pathways is GGT1 , which encodes the enzyme gamma glutamyltransferase. This enzyme is wid ely used as a marker for hepatocyte integrity and hepatic health because inflammation and destruction of hepatocytes increases the enzyme activity in plasma (Djavaheri Mergny et al., 2002; Sarentonglaga et al., 2013). G amma glutamyltransferase

PAGE 152

1 52 is present o n the plasmalemma of hepatocytes and other cells and catalyzes the transfer gamma glutamyl functional groups to glutathione to produce glutamate. Hepatocyte damage or biliary duct inflammation or obstruction increases the concentration of the enzyme in pla sma. The increase in mRNA abundance for GGT1 of cows fed control might indicate changes in hepatic tissue integrity and suggest improved hepatic health when cows were fed fat. A component of the renin angiotensin system was up regulated in hepatic tissue of cows fed fat, based upon an increased abundance of the gene encoding for the angiotensin converting enzyme 2 ( ACE2 ). The enzyme ACE2 efficiently hydrolyses the potent vasoconstrictor angiotensin II to angiotensin (1 7). Using the mice model, ACE2 has be en shown to limit liver fibrosis and has the potential therapeutic effect of reducing fibrosis (Österreicher et al., 2009). Collectively, these effects indicate that perhaps a reduction of FA in the control diet might enh ance inflammation with resulting pr oliferation of connective tissue in the hepatic parenchyma because of a reduction in ACE2 gene expression that can be remediated by addition of f at (i.e., either SFA or EFA) to the diet. This warrants further investigation as to fat acting as a nutraceutic al supplement to improve hepatic health and metabolism. Several pathways related to lipid metabolism were differently regulated when cows were fed SFA vs EFA diets. Feeding EFA up regulated vitamin and fat digestion and absorption pathways, and these path ways were driven by the up regulation of the apolipoproteins A4 gene ( APOA4 ). Apolipoprotein A4 was detected in the heavy high density lipoprotein and is mostly synthetized in the intestines (Bauchart, 1993). Apolipoprotein A4 concentrations in plasma ha ve been shown to be greater in lactating than non lactating cows, and concentrations reduced with fasting (Tahahashi et al., 2004). A pivotal role of the APOA4 is the activation of the lecithin:cholesterol acyl transferase, the enzyme responsible for catalyt ic esterification of

PAGE 153

153 cholesterol, converting cholesterol to cholesteryl ester which would increase the reverse cholesterol transport from periphery to liver (Bauchart, 1993 ; Quintão, 1995 ). Apolipoprotein A4 gene was highly expressed in transition cows on day 14 postpartum across the control, SFA and EFA diets. However, primiparous cows had a profound reduction in hepatic APOA4 gene expression that was not evident when fed EFA. In contrast multiparous cows had high expression of APOA4 regardless of the die ts fed. The primiparous cows appear ed to be more sensitive to feeding of saturated fatty acids , and the changes in hepatic gene expression might have implications to cholesterol metabolism. Liver of cows fed SFA had up regulat ed mRNA expression of two des aturase enzymes FADS2 and SCD . Stearoyl C oA desaturase is responsible for the inclusion of a cis 9 double bond in carbon 9 of stearic and palmitic acids, which form oleic and palmitoleic acids , respectively . This enzyme is present in liver (St. John et al. , 1991) , intestine and mammary gland (Rezamand et al., 2014), and subcutaneous adipocytes (Chang et al., 1992). The ratio of stearic acid to oleic acid has been implicated in the regulation of cell growth and differentiation through effects on cell membran e fluidity and signal transduction. Gene expression of SCD was elevated substantially in primiparous cows fed SFA but not in multiparous cows. The FADS2 gene linolenic acid in the process of formation of longer chain PUFA (Leonard at al., 2004). Hepatic gene expression of FADS2 was highly expressed in lactating dairy c ows on day 14 postpartum. However , expression was greater in SFA than EFA fed cows. This response is in agreement with Hiller et al. (2013) whereby cows fed saturated FA had greater expression of desaturases enzymes in liver compared with cows fed diet enr iched with either n 3 or n 6 PUFA .

PAGE 154

154 Conclusion Supplementing diets of transition cows with either saturated free FA or Ca salts containing PUFA increased the intake of FA , which influenced the FA composition of the hepatic tissue and altered gene expres sion. Feeding a diet with low FA concentration up regulated gene pathways associated with immune system , many of which associated with impaired hepatic health. On the other hand, increasing the dietary FA intake by supplementing transition cows with either saturated free FA or Ca salts containing PUFA upregulated genes associated with the renin angiotensin system, with emphasis on the control and prevention of hepatic fibrosis. Within the cows supplemented with fat, those receiving saturated free FA had a m arked increase in expression of genes encoding desaturases enzymes , whereas supplementing PUFA upregulated pathways related to vitamin and fat absorption. Supplementing diets with EFA resulted in improved yields of milk, 3.5% fat corrected milk, and milk components in the first 14 d postpartum compared with cows supplemented with saturated FA. Collectively, these results indicate that fat supplementation during the late gestation and early lactation improves markers of hepatic health, which might have impl ications to animal performance and well being.

PAGE 155

155 Table 4 1. Parameters of lactation performance and blood metabolites and hormones of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Control SFA EFA Prim 1 Multi 1 Prim Multi Prim Multi SEM 2 Fat 2 FA 2 Fat*P 2 FA*P 2 DM intake, kg/d 10.9 16.6 14.5 15.6 13.2 15.1 1.4 0.51 0.53 0.10 0.76 Milk, kg/d 21.6 28.3 19.9 30.0 24.9 31.7 1.3 0.16 0.02 0.46 0.22 3.5% FCM 2 , kg/d 27.6 34.9 22.1 36.5 30.4 39.1 2.2 0.68 0.02 0.28 0.20 FCM/DM intake 2.7 2.2 1.6 2.5 2.4 2.7 0.3 0.44 0.12 0.04 0.35 Milk fat % 5.25 5.08 4.13 4.91 4.84 4.98 0.36 0.15 0.29 0.32 0.39 Kg/d 1.12 1.40 0.83 1.15 1. 21 1.57 0.11 0.83 0.07 0.22 0.15 Milk true protein % 4.00 3.40 3.53 3.45 4.06 3.62 0.29 0.91 0.24 0.52 0.54 Kg/d 0.86 0.94 0.70 1.03 1.01 1.13 0.09 0.38 0.03 0.34 0.25 Milk lactose % 4.61 4.66 4.69 4.55 4.50 4.48 0.08 0.29 0.14 0 .37 0.48 Kg/d 1.00 1.32 0.94 1.39 1.12 1.42 0.06 0.25 0.07 0.61 0.21 Energy balance, Mcal/d 10.6 7.2 0.2 9.1 8.4 11.6 2.6 0.49 0.05 0.04 0.29

PAGE 156

156 Table 4 1. Continued. Control SFA EFA Prim 1 Multi 1 Prim Multi Prim Multi SEM 2 Fat 2 FA 2 Fat* P 2 FA*P 2 Plasma concentrations Glucose 68.6 61.8 69.4 59.9 67.2 60.8 2.2 0.62 0.75 0.77 0.48 M 494.0 519.2 361.4 600.3 476.5 703.3 82.2 0.69 0.19 0.15 0.94 BHBA, mg/dL 7.2 6.5 6.2 6.7 6.3 10.7 1.1 0.50 0.06 0.09 0.08 IGF 1 , ng/mL 48.7 34.7 68.2 21.5 58.4 26.3 9.5 0.82 0.79 0.14 0.45 Insulin, ng/mL 0.43 0.53 0.77 0.77 0.45 0.6 7 0.10 0.04 0.04 0.99 0.25 Haptoglobin, OD x 1 0 0 2.31 1.70 1.91 1.40 2.17 1.36 0.26 0.19 0.67 0.90 0.55 Acid s oluble p 58.8 37.9 51.3 39.9 51.4 37.7 3.5 0.28 0.76 0.18 0.75 PGFM, pg/mL 1070 2343 1437 2147 1725 2047 332 0.66 0.77 0.21 0.55 1 Prim = primiparous cows; Multi = multiparous cows. 2 SEM = Standard error of the mean; Fat = control vs. SFA + EFA; FA = EFA vs. SFA ; Fat*P = interaction between Fat and parity; FA*P = interaction between FA and parity.

PAGE 157

157 Table 4 2. Liver fatty aci d profile of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) Control SFA EFA Prim 1 Multi 1 Prim Multi Prim Multi SEM 2 Fat 2 FA 2 Fat*P 2 FA* P 2 Total FA, % DM 21.96 26.74 12.99 28.50 17.85 26.08 4.65 0.46 0.79 0.39 0.44 g/100g of total FA C14:0 2.13 2.60 1.26 3.21 1.83 2.38 0.36 0.54 0.71 0.22 0.06 C16:0 27.26 29.81 18.23 34.51 25.52 28.57 2.86 0.47 0.82 0.16 0.03 C16:1 cis9 2.16 2.8 6 1.56 3.20 1.83 2.55 0.35 0.47 0.59 0.43 0.21 C18:0 15.34 12.98 22.80 11.21 16.99 13.04 2.23 0.35 0.38 0.17 0.10 C18:1 cis 2 23.89 24.59 16.87 24.59 18.69 23.38 1.87 0.05 0.87 0.10 0.43 C18:1 trans 2 1.46 1.04 1.54 0.87 1.78 1.51 0.10 0.05 <0.01 0.80 0.0 5 C18:2 cis 9, cis 12 7.56 8.45 10.07 7.36 10.61 11.74 0.65 <0.01 <0.01 0.15 0.01 CLA 2 0.34 0.21 0.24 0.17 0.40 0.39 0.05 0.55 <0.01 0.31 0.46 C18:3 cis 6, cis 9, cis 12 0.11 0.28 0.21 0.36 0.26 0.23 0.05 0.14 0.48 0.23 0.10 C18:3 cis 9, cis 12, cis 15 1.00 0.82 0 .91 0.62 0.93 0.88 0.07 0.22 0.07 0.92 0.10 C20:2 cis 11, cis 14 0.06 0.05 0.11 0.03 0.08 0.06 0.02 0.32 0.91 0.19 0.12 C20:3 cis 8 ,cis 11, cis 14 2.08 2.27 3.79 1.99 2.63 1.66 0.61 0.53 0.23 0.15 0.50 C20:4 cis 5, cis 8 ,cis 11, cis 14 5.31 4.96 8.18 3.86 7.01 5.06 1.05 0.34 0.99 0.14 0.27 C20:5 cis 5, cis 8 ,cis 11, cis 14, cis 17 0.68 0.56 1.35 0.46 0.94 0.44 0.22 0.37 0.34 0.14 0.38 C22:4 cis 7, cis 10 ,cis 13, cis 16 0.63 0.60 1.07 0.34 0.70 0.50 0.17 0.80 0.54 0.14 0.13

PAGE 158

158 Table 4 2. Continued. Control SFA EFA Prim 1 M ulti 1 Prim Multi Prim Multi SEM 2 Fat 2 FA 2 Fat*P 2 FA*P 2 C22:5 cis 7, cis 10 ,cis 13, cis 16, cis 19 2.77 1.59 4.33 1.09 3.19 1.30 0.49 0.49 0.36 0.12 0.18 C22:6 cis 4, cis 7, cis 10 ,cis 13, cis 16, cis 19 0.58 0.16 0.95 0.13 0.58 0.12 0.10 0.40 0.08 0.23 0.09 Others FA 6.6 3 6.17 6.52 6.00 6.03 6.18 0.27 0.36 0.57 0.56 0.23 Total saturated FA 44.73 45.40 42.30 48.94 44.35 44.00 1.15 0.87 0.22 0.23 0.01 Total monounsaturated FA 27.52 28.42 19.97 28.66 22.30 27.45 2.19 0.08 0.80 0.13 0.43 Total polyunsaturated FA 21.13 19.9 5 31.21 16.39 27.33 22.38 3.08 0.17 0.76 0.12 0.12 Total n 3 FA 5.04 3.13 7.54 2.29 5.64 2.75 0.80 0.50 0.38 0.13 0.15 Total n 6 FA 15.74 16.61 23.43 13.94 21.29 19.24 2.33 0.12 0.50 0.11 0.12 1 Prim = primiparous cows; Multi = multiparous cows. 2 SEM = Standard error of the mean; Fat = control vs. SFA + EFA; FA = EFA vs. SFA ; Fat*P = interaction between Fat and parity; FA*P = interaction between FA and parity.

PAGE 159

159 Table 4 3. Number of differentially expressed genes on hepatic tissue of lactating Holst ein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) 1 Primiparous Multiparous Fat 2 FA 2 Parity 3 Fat FA Fat FA No FC 4 cut off Up regulated 267 108 2399 330 50 52 16 Down regulated 616 135 2499 708 69 48 26 Total 883 243 4898 1038 119 100 42 Up regulated 3 13 500 102 27 13 12 Down regulated 19 14 428 171 41 19 16 Total 22 27 928 273 68 32 28 1 Significance was decla red when P value < 0.05. 2 Fat = control vs. SFA + EFA; FA = SFA vs. E FA 3 Primiparous are the reference. 4 FC = Fold change.

PAGE 160

160 Table 4 4. List of the identified genes with respective names 1 Symbol Name ACE2 angiotensin I converting enzyme (peptidyl di peptidase A) 2 ACSS2 acyl CoA synthetase short chain family member 2 APOA4 apolipoprotein A IV BACE2 beta site APP cleaving enzyme 2 BOLA DQA5 major histocompatibility complex, class II, DQ alpha 5 BOLA DQB major histocompatibility complex, class II, DQ beta C20H5orf49 chromosome 20 open reading frame, human C5orf49 C8H9orf152 chromosome 8 open reading frame, human C9orf152 CDHR5 cadherin related family member 5 CLEC2D C type lectin domain family 2, member D EDNRA endothelin receptor type A FADS2 fatty acid desaturase 2 FOXA3 forkhead box A3 GCLC glutamate cysteine ligase, catalytic subunit GGT1 gamma glutamyltransferase 1 GIMAP7 GTPase, IMAP family member 7 GPNMB glycoprotein (transmembrane) nmb GPX3 glutathione peroxidase 3 (plasma) HAPLN 3 hyaluronan and proteoglycan link protein 3 IGFBP1 insulin like growth factor binding protein 1 KDELR3 endoplasmic reticulum protein retention receptor 3 KIF23 kinesin family member 23 LOC505468 cytochrome P450 family 2 subfamily C polypeptide 18 like LOC527068 aldo keto reductase family 1 member C3 like MBOAT2 membrane bound O acyltransferase domain containing 2 MYC v myc myelocytomatosis viral oncogene homolog (avian) NT5C 5', 3' nucleotidase, cytosolic PDZK1IP1 PDZK1 interacting protein 1 PIM 1 pim 1 oncogene PLEK pleckstrin PPP1R3B protein phosphatase 1, regulatory subunit 3B PPP1R3C protein phosphatase 1, regulatory subunit 3C PSPH phosphoserine phosphatase SCD stearoyl CoA desaturase (delta 9 desaturase) SLC17A9 solute carrier family 1 7, member 9 TESC tescalcin WFS1 Wolfram syndrome 1 (wolframin) 1 Genes were selected based on the following criteria: p

PAGE 161

161 Table 4 5 . Least squares means ( ± SEM) abundance expression of selected genes on hepatic tissue of lactating Holstein cows rec eiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) 1 Control SFA EFA Gene Prim 2 Multi 2 Prim Multi Prim Multi P value 3 Fat contrast All Prim Multi ACE2 87.7 ± 4 4.2 93.3 ± 75.5 184.8 ± 26.3 186.8 ± 61.2 164.5 ± 21.3 112.3 ± 50.4 0.05 0.08 0.26 BACE2 210.8 ± 22.3 225.8 ± 138.8 112.2 ± 26.7 108.4 ± 110.6 113.5 ± 26.2 194.6 ± 57.3 0.03 0.08 0.20 BOLA DQA5 11.1 ± 0.001 44.4 ± 111.4 6.1 ± 0.001 5.2 ± 0.01 5.7 ± 0.001 4.9 ± 0.001 0.01 0.23 0.01 BOLA DQB 17.2 ± 0.001 43.8 ± 31.8 11.0 ± 0.001 9.6 ± 0.01 10.2 ± 0.001 8.2 ± 0.001 0.01 0.21 0.0 1 C20H5orf49 26.4 ± 1.9 41 .0 ± 11.0 20.5 ± 0.7 15.1 ± 9.0 24.3 ± 1.8 14.9 ± 9.9 0.02 0.61 0.01 CLEC2D 51.1 ± 8.5 48.9 ± 18.3 68.1 ± 7.4 68.9 ± 66.0 83.3 ± 13.0 63.1 ± 38.0 0.02 0.05 0.13 GGT1 88.3 ± 6.1 70.3 ± 9.1 65.6 ± 3.1 49.4 ± 5.9 59.5 ± 4.2 54.6 ± 9.2 0.01 0.02 0.04 GPX3 98.8 ± 35.2 29 .0 ± 39.4 11.4 ± 2.2 19.6 ± 28.0 26.6 ± 10.6 17.4 ± 14.3 0.01 0.0 1 0.43 HAPLN3 66.3 ± 1.4 48.2 ± 5.5 42.1 ± 0.4 32.9 ± 3.0 37.4 ± 2.4 34.8 ± 5.3 0.01 0.02 0.11 KIF23 88.9 ± 9.8 68.3 ± 38.3 51.2 ± 3.4 61.3 ± 14.8 49.9 ± 5.2 59.4 ± 15.9 0.02 0.01 0.52 NT5C 42.8 ± 1.3 61.5 ± 27.4 29.4 ± 2.3 56.7 ± 16.7 29.9 ± 1.6 37 .0 ± 29.6 0.03 0.23 0.05 PDZK 1IP1 62.6 ± 9.2 25.1 ± 22.5 22.4 ± 2.2 16.6 ± 3.0 23.1 ± 5.0 25.8 ± 19.1 0.03 0.88 0.0 1 PSPH 56.6 ± 24.0 48.9 ± 74.2 29.2 ± 4.1 32.7 ± 23.5 30.8 ± 9.4 33.5 ± 24.5 0.02 0.07 0.14 SLC17A9 106.6 ± 4.7 80.8 ± 7.1 57.2 ± 5.6 48.5 ± 11.4 61.3 ± 3.6 71.5 ± 8.1 0.04 0.02 0.64 TESC 58.8 ± 6.4 51.5 ± 8.2 31.1 ± 1.8 40.7 ± 8.4 26.6 ± 0.9 51.9 ± 3.2 0.01 0.03 0.12 WFS1 60.5 ± 0.8 39.7 ± 2.0 35.4 ± 0.1 37.2 ± 0.5 38.8 ± 1.7 28.9 ± 0.7 0.01 0.0 1 0.57 LOC505468 34.3 ± 2.3 16.9 ± 4.0 46.0 ± 3.3 24.9 ± 7.0 45.8 ± 5.1 3 0.5 ± 14.0 0.01 0.01 0.26

PAGE 162

162 Table 4 5. Continued Control SFA EFA Gene Prim 2 Multi 2 Prim Multi Prim Multi P value 3 FA contrast ACSS2 197.6 ± 28.4 288.1 ± 240.2 475.8 ± 85.0 231.5 ± 64.5 206.2 ± 52.8 183.5 ± 128.2 0.04 0.03 0.52 AP OA4 457.7 ± 45.2 534.4 ± 173.1 170.6 ± 28.8 637.2 ± 404.4 575.8 ± 59.3 624.1 ± 227.6 0.01 0.01 0.94 C8H9orf152 35.4 ± 2.3 20.5 ± 1.6 40.2 ± 2.2 19.2 ± 2.2 27.1 ± 1.2 13.9 ± 1.5 0.02 0.07 0.13 CDHR5 130.1 ± 12.4 128.7 ± 33.1 160.5 ± 23.7 106.2 ± 34.7 56.8 ± 12.5 48.2 ± 51.5 0.01 0.02 0.08 EDNRA 37.9 ± 1.9 42.7 ± 11.8 39.9 ± 0.8 22.1 ± 9.0 35.9 ± 1.7 51.6 ± 8.0 0.01 0.56 0.01 FADS2 801.3 ± 151.2 912.8 ± 998.1 1822 ± 393.7 119 1 ± 983.7 1117 ± 357.9 698.9 ± 491.6 0.01 0.06 0.04 FOXA3 150.9 ± 19.5 93.2 ± 24 .5 109.8 ± 10.9 110.9 ± 29.3 72.2 ± 10.7 55.3 ± 9.9 0.02 0.19 0.04 GCLC 26.7 ± 5.6 24.6 ± 6.1 40.8 ± 2.5 34.0 ± 9.1 27.5 ± 3.6 26 ± 7.6 0.03 0.06 0.19 GIMAP7 92.1 ± 0.01 73.4 ± 0.02 77.3 ± 1.9 90.0 ± 1.2 63.5 ± 0.01 70.1 ± 0.1 0.04 0.04 0.36 GPNMB 63.8 ± 2.0 217.1 ± 35.8 66.5 ± 1.6 123.7 ± 93.5 105.7 ± 5.8 313.2 ± 151.1 0.02 0.29 0.03 IGFBP1 733.2 ± 127.1 467.5 ± 534.7 371.6 ± 54.2 371.5 ± 554.7 781.2 ± 261.0 779.8 ± 519.0 0.02 0.10 0.10 KDELR3 282.7 ± 17.4 269.3 ± 62.9 130.4 ± 14.5 233.7 ± 18.3 244.5 ± 22.9 254.4 ± 64.3 0.01 0.0 1 0.59 LOC527068 40.6 ± 4.0 50 ± 48.2 28.6 ± 3.0 26.2 ± 10.0 40 ± 4.2 47.8 ± 39.1 0.01 0.17 0.02 MBOAT2 40 ± 4.2 85.1 ± 82.0 113.4 ± 19.0 80.6 ± 22.5 46.7 ± 9.3 58.6 ± 28.2 0.04 0.04 0.43 MYC 69.4 ± 9.3 65.6 ± 26.1 42.7 ± 4.5 61.5 ± 50.9 55.8 ± 10.7 98.1 ± 85.7 0.04 0.28 0.07 PIM1 76.7 ± 2.5 58.6 ± 23.9 50.6 ± 3.8 61.4 ± 8.7 86.5 ± 11.1 70.4 ± 21.5 0.02 0.01 0.48 PLEK 54.7 ± 19.9 95.3 ± 14.6 64.5 ± 27.7 90.9 ± 164.5 110.2 ± 36.7 111.5 ± 126.9 0.05 0.05 0.40 PPP1R3B 75.4 ± 9 .0 84.8 ± 39.9 116.7 ± 10.7 79 ± 45.2 71.9 ± 12.4 68.9 ± 47.0 0.01 0.01 0.43 PPP1R3C 203.8 ± 107.6 195.8 ± 120.9 310.7 ± 101.8 180.8 ± 93.8 162.7 ± 87.4 181.2 ± 118.2 0.04 0.01 0.92 SCD 215.9 ± 21.6 337.8 ± 242.3 660 ± 159.9 355.1 ± 116.1 244.8 ± 69.9 28 1.4 ± 193.2 0.01 0.01 0.47 1 Genes were selected based on the following criteria: p least one of the groups (Cerri et al., 2012). 2 Prim = primiparous cows; Multi = multiparous cows. 3 All = Fat contrast (Control vs. SFA + EFA) or FA contrast (SFA vs. EFA); Pri m = Fat or FA contrast within primiparous cows; Multi = Fat or FA contrast within multiparous cows.

PAGE 163

163 Figure 4 1. Dry matter intake (A, primiparous; B, multiparous), milk yield (C, primiparous ; D, multiparous), and plasmatic concentrations of prostag landin F metabolite (E, primiparous ; F, multiparous) of lactating Holstein cows receiving no fat supplementation (control), mostly saturated free fatty acids (SFA), or Ca salts containing essential fatty acids (EFA) .

PAGE 164

164 Figure 4 2. Impact of different ially expressed genes (DEG) between primiparous and multiparous cows on categories and subcategories of pathways as calculated by the of the DEG on the category of pathway s) and the gradient (or direction of the impact due to the effect of the DEG on categories of pathways) .

PAGE 165

165 Figure 4 3. Pathways identified by the Dynamic Impact Approach in lactating Holstein cows receiving no fat supplementa tion (control) compared with cows fed fat (mostly satur ated free FA SFA or Ca salts containing essential FA EFA). KEGG pathways are ranked on their impact with their flux indicated as inhibited (to the left) or activated (to the right) by feeding fat. Differentially expressed g enes we considered when P .

PAGE 166

166 Figure 4 4. Pathways identified by the Dynamic Impact Approach in lactating Holstein cows receiving fat supplementation with mostly saturated free F A (SFA) compared with Ca salts containing essential FA (EFA). KEGG pathwa ys are ranked on their impact with their flux indicated as inhibited (to the left) or activated (to the right) by SFA. Differentially expressed g enes we considered when P .

PAGE 167

167 CHAPTER 5 EFFECTS OF ALTERING THE RATIO OF DIETARY n 6 TO n 3 FATTY ACIDS ON PERFORMANCE AND INFLAMMATORY RESPONSES TO A LIPOPOLYSACCHARIDE CHALLENGE IN LACTATING HOLSTEIN COWS The study was designed to evaluate the effects of altering the ratio between omega 6 (n 6) and omega 3 (n 3) fatty acids (FA) in the diet and the intake of these FA by lactating dairy cows on lactation performance and inflammatory acute phase responses to a challenge with lipopolysaccharide (LPS). Multiparous Holstein cows (n = 45) were blocked based on milk yield during days 6 to 10 p ostpartum and, within each block, assigned randomly to 1 of 3 dietary treatments at 14 d postpartum, which lasted for 90 d. Diets were supplemented with a mixture of Ca salts of fish, safflower, and palm oils to create 3 different ratios of n 6 to n 3 FA, namely 3.9, 4.9, or 5.9 parts of n 6 to 1 part of n 3 FA (R4, R5, and R6, respectively). During the first 5 wk of the study, blood was sampled weekly and analyzed for concentrations of metabolites and hormones. On d 75 postpartum, cows received an infusio n of 10 µg of LPS into one quarter of the mammary gland to evaluate inflammatory acute phase responses. Altering the ratio of dietary n 6 to n 3 FA was reflected in changes in the FA composition of plasma and milk fat. Reducing the ratio of n 6 to n 3 FA f rom R6 to R4 increased dry matter intake (R6 = 24.7, R5 = 24.6, and R4 = 26.1 ± 0.5 kg/d), with concurrent increases in yields of 3.5% fat corrected milk (43.4, 45.4, and 48.0 ± 0.8 kg/d), milk fat (1.53, 1.60, and 1.71 ± 0.03 kg/d), milk true protein (1.2 4, 1.28, and 1.32 ± 0.02 kg/d), and milk lactose (2.12, 2.19, and 2.29 ± 0.04 kg/d). After the LPS challenge, concentrations of IL 6 in plasma increased as the ratio of n 6 to n 3 FA increased (112.5, 353.4, and 365.1 ± 86.6 pg/mL for R4, R5, and R6, respe ctively). Elevation of body temperature and somatic cell count was greater for cows fed R5 compared with those fed R4 or R6 (41.3, 40.8, and 40.8 ± 0.2 o C; 4.33, 3.68, and 3.58 ± 0.25 × 10 6 /mL, for R5, R4, and R6, respectively). Haptoglobin concentration w as greatest at 24 h after LPS challenge for cows fed

PAGE 168

168 R6. Phagocytosis and oxidative burst by neutrophils collected from circulation were unaffected by dietary treatment in the first 48 h after intrama m mary LPS infusion. In conclusion, supplying the same qu antity of FA in the diet of early lactation dairy cows, but altering the ratio of the polyunsaturated FA of the n 6 to n 3 families influenced lactation performance and the inflammatory responses to a LPS challenge . Introduction Feeding fat to lactating d airy cows commonly has a positive effect on milk yield. In a recent systematic review of the literature encompassing 38 previously published studies, Rabiee et al. (2012) reported an overall increase in milk yield of approximately 1 kg/cow/d in cows fed su pplemental fat compared with those fed diets without supplemental fat. Furthermore, an extensive review of the literature on fat feeding to dairy cows showed that the benefits of fat supplementation are dependent on the type and amounts of FA provided, whe n supplementation was initiated, the proportion of forage fed, and other associative effects with the basal dietary ingredients (Onetti and Grummer, 2004). The effects of supplementing dairy cow diets with either n 6 (Harvatine and Allen, 2006; Amaral, 200 8) or n 3 FA (Petit et al., 2007; Juchem et al., 2008) on lactational performance has been investigated. However, concurrent supplementation with n 6 and n 3 FA to markedly affect the intake of both FA has not been performed. From the human literature it o ften is stated that intake of PUFA should be manipulated such that specific amounts of n 6 and n 3 FA are of n 6 and n 3 as well as the ratio between both groups of FA which would optimize lactation and health of dairy cows remain unknown. Increased intake of n 6 FA has the potential to alter the FA profile of the phospholipids of cell membranes with increased proportions of linoleic and arachidonic acids, which in t urn, might alter gene expression and eicosanoid synthesis towards a

PAGE 169

169 pro inflammatory state (Calder, 2012). On the other hand, increased intake of n 3 FA, especially eicosapentaenoic acid (EPA; C20:5 n 3) and docosahexaenoic acid (DHA; C22:6 n 3), would inc rease the proportion of these FA in the membrane phospholipids, which are expected to attenuate inflammatory responses (Calder, 2012). The metabolic cost of a clinical inflammation event has been investigated (Colditz, 2002), although data from cattle are scarce. In poultry, activation of inflammation with Escherichia coli LPS increased the estimated lysine utilization by the immune system from 1. 2 % to 6.7% of the total intake (Klasing and Calvert, 1999). Oxygen consumption and glucose utilization by sheep lymphocytes doubled during the peak of immune response (Cheung and Morris, 1984). When steers were feed restricted for 72 h, the induction of inflammatory response by intratracheal bacterial challenge increased the splanchnic tissue utilization of amino ac ids by 2.67 moles/d (Burciaga Robles, 2009), illustrating the shift in nutrient utilization upon initiation of an inflammatory response. Therefore, it would be reasonable to speculate that animals fed an n 6 enriched diet could have increased nutrient part itioning for an immune response if the inflammatory challenge is exacerbated, whereas the nutrient expenditure would be reduced if an n 3 enriched diet attenuated the inflammatory responses (Gifford et al., 2012). Fatty acids play important roles influenc ing the immune system of dairy cows as they can modulate immune cell function and inflammatory responses through various mechanisms. For instance, n 6 FA activate LPS induced prostaglandin synthesis and activation of the inflammatory transcription factor, upregulates the expression of proteins that stimulate inflammation such as cytokines, chemokines, proteins involved in the acute phase response, and cell adhesion molecules (Kumar et al. 2004). On the o ther hand, FA of n

PAGE 170

170 inhibits synthesis of pro inflammatory proteins (Calder et al. 2012). Therefore, it is clear that both n 6 and n 3 FA are essential for maintaining body physiological functions. It is su ggested that beyond the quantities, the balance between these two groups of FA appears to be important (Papadopoulos et al., 2009) and affects the pro and anti inflammatory responses, which also might be important for lactational performance. The hypot heses were that diets containing different ratios of n 6 to n 3 FA would influence milk production and inflammatory responses of lactating dairy cows. Specifically, increasing the n 6 to n 3 ratio in the diet would enhance the inflammatory response in the mammary gland after a challenge with LPS, whereas decreasing production. Therefore, the objectives were to determine the effect of altering the ratio of n 6 to n 3 FA in the diet of Holstein cows on lactation performance, metabolic status, and acute phase responses after an intramammary challenge with LPS . Materials and Methods The experiment was conducted at University of Florida Dairy Unit, in Hague, FL. Procedures for animal handling and care were approved by the University of Florida Animal Research Com mittee (ARC # 014 11ANS). Study Design, Animals , Housing and Feeding The experimental design was a randomized complete block design. Weekly cohorts of cows in their second (n = 23) or greater lactation (n = 22) were blocked by parity (2 vs. > 2) and milk yield from days 6 to 10 postpartum and, within each block, randomly assigned to 1 of 3 dietary treatments at 14 d postpartum (n = 15/treatment). Only clinically healthy cows (e.g. no metritis, ketosis, displacement of abomasum, or milk fever) during the f irst 13 DIM were eligible.

PAGE 171

171 Cows were housed in a free stall barn with sand beds and equipped with automatic feeding gates (America Calan Inc., Northwood, NH). The diet was offered as a TMR twice daily at 07:30 a.m. and 01:00 p.m. to assure at least 5% ort s daily, and DMI was recorded for individual cows throughout the study. Four days were allowed for cows to adapt to the individual feeding gates before the treatments started. Treatments were mixed as part of the TMR and fed for 90 d. Three ratios of n 6 t o n 3 were designed by altering the supplemental fat added to the diet to influence the intake and estimated duodenal flow of PUFA (Table 5 1). The first ratio was of 3.9 parts of n 6 to 1 part of n 3 FA in the diet (R4). This ratio was expected to result in a 2 to 1 ratio of n 6 to n 3 in the duodenal content based on estimates of duodenal flow of FA (CPM Dairy ver. 3.0.8 software, www.cpmdairy.net). The second ratio was of 4.9 parts of n 6 to 1 part of n 3 in the diet (R5). This ratio was expected to resu lt in a 4 to 1 ratio of n 6 to n 3 in the duodenal contents. The final ratio was of 5.9 parts of n 6 to 1 part of n 3 in the diet (R6). This ratio was expected to result in an 8 to 1 ratio of n 6 to n 3 in the duodenal contents. All diets were isocaloric a nd isonitrogenous and contained the same total FA concentration, and were formulated to minimize the difference in concentrations of total PUFA. The FA composition of diets was manipulated by altering the mixture of Ca salts that were enriched in palm oil FA, safflower oil FA, or fish oil FA (Table 5 1). These Ca salts were blended such that the amount incorporated into the diets, 1.43% of the dietary DM, would alter the dietary FA composition and result in the proposed ratios (Table 5 2). Lactation number averaged 2.7, 2.9, and 2.5 ± 0.3 for cows fed R4, R5, and R6, respectively . Measurements of Milk and Milk Components Cows were milked twice daily at 06:00 a.m. and 06:00 p.m., and yields of milk were recorded automatically (AfiFlo milk meters, S.A.E. Afik i m , Israel). Concentrations of fat, true

PAGE 172

172 protein, and lactose (AfiLab on line real time milk analyzer, S.A.E. Afiki m , Israel) were recorded. Milk yield and composition from each milking were taken into account to calculate the final concentration of milk c omponents. The calibration of the AfiLab system was performed monthly using data from milk composition of 500 University of Florida cows analyzed by the Southeast DHI laboratory in Belleview, FL. Milk corrected for 3.5% fat was calculated as FCM = 0.4324 × kg of milk + (16.218 × kg of milk fat) . Body Weight, Body Condition Score, Energy Balance , and Feed Efficiency Cows were weighed twice daily, immediately after each milking, using a walk through scale (AfiWeigh, S.A.E. Afiki m , Israel) and BW was averaged daily. Once a week, body condition of cows was scored using a 5 point scale (1: thin to 5: obese) divided into 0.25 points according to Ferguson at al. (1994), as depicted in the Elanco BCS chart (Elanco Animal Health, 2009). The same person throughout th e study evaluated BCS to minimize nuisance variation. Energy balance was calculated using the formula of caloric intake (DM intake x NEL of diet) minus the calories required for maintenance and the calories required for milk production using the equations from NRC (2001). Requirements for NEL of maintenance were based on BW (0.08 × BW0.75), and those for milk synthesis were according to milk yield and the concentrations of fat, protein, and lactose in milk using the following formula: NEL milk = (0.0929 × % milk fat) + (0.0563 × % milk true protein) + (0.0395 × % lactose). Gross feed efficiency was calculated considering 3.5% FCM yield and DMI (3.5% FCM/DMI). Blood Metabolites and Hormones Blood was sampled on the same day each week during the first 5 wk of the study. Samples were collected from the coccygeal vessels using evacuated tubes containing K 2 EDTA (Vacutainer, Becton Dickinson, Franklin Lakes, NJ) and placed immediately in ice. Plasma was

PAGE 173

173 separated by centrifugation at 2,095 × g (Allegra X 15R centr ifuge, Beckman Coulter Inc., Brea, CA) for 15 min and then stored at 20 o C for further analyses. Plasma was analyzed for concentrations of NEFA according to Johnson and Peters (1993) using a commercial kit (NEFA C kit; Wako Fine Chemical Industries, Inc., Dallas TX), and BHBA (Autokit 3 HB cyclic enzymatic method Wako Diagnostics Richmond, VA). The intra and inter assay CV were 4.6 and 8.0% for NEFA, and 3.2 and 6.4% for BHBA, respectively. Urea N in plasma was analyzed with a Technicon Autoanalyzer (Te chnicon Autoanalyzer Instruments Corp., Chauncey, NY) using a modification of Coulombe and Favreau (1963) and Marsh et al. (1965). Glucose was analyzed using a Technicon Autoanalyzer following a modification of the method by Gochman and Schmitz (1972). The intra and inter assay CV were 6.8 and 7.5% for plasma urea N and 2.1 and 2.6% for glucose, respectively. Insulin concentration in plasma was measured using a double antibody radioimmunoassay following the assay protocol described by Badinga et al. (1991) ; the intra and inter assay CV were 13.2 and 16.1%, respectively. Insulin like growth factor was assayed using a commercial kit (Quantikine® Elisa; Human IGF 1 Immunoassay; R&D Systems, Inc. Minneapolis, MN), the intra and inter assay CV were 5.4 and 6.9%, respectively. Diet and Ingredient Sampling and Chemical Analyses Samples of forages, concentrate mixtures, and fat supplements were collected weekly, dried at 55 o C and moisture loss recorded. Dried samples w ere composited monthly and ground to pass a 1 mm screen of a Wiley mill (Thomas Scientific, Swedesboro, NJ). Samples were then analyzed for DM (105°C for 12 h), OM (512°C for 8 h), sequential analysis of NDF using a heat amylase and ADF (Van Soest et al., 1991) with the Ankom Fiber Analyzer system (Ankom Technology, Macedon, NY), and N using an automated quantitative combustion

PAGE 174

174 digestion method (Elementar Analysensysteme, Elementar Americas, Inc., Mt. Laurel, NJ). The energy density of the diet was estimated using chemical analysis of dietary components and calculated for 24 kg of DMI using the NRC (2001) model (Table 5 1). Blood and Milk Sampling and Fatty Acid Analyses of Plasma, Milk, and Diets Blood was sampled at approximately 60 DIM by punct ure of the coccygeal vessels into evacuated tubes containing K 2 EDTA (Vacutainer, Becton Dickinson) and placed immediately in ice. Plasma was separated by centrifugation at 2,095 × g for 15 min (Allegra X 15R Centrifuge) and then stored at 20 o C. An aliquot of 2.0 mL was freeze dried (Labconco, Kansas City, MO). The FA isolation and methylation of the concentrates, forages, fat supplements, and freeze dried plasma samples were performed according to Kramer et al. (1997). Fatty acid methyl esters were determ ined using a Varian CP 3800 gas chromatograph (Varian Inc., Palo Alto, CA) equipped with auto sampler (Varian CP 8400), flame ionization detector, and a Varian capillary column (CP was 10:1, and the injector and detector temperatures were maintained at 250 o C. One was injected via the auto sampler into the column. The oven temperature was set initially at 70 o C for 3 min, increased by 30 o C/min up to 162 o C, increased by 0.5 o C/min up to 165 o C, increased by 0.6 o C/min up to 195 o C, held at 195 o C for 20 min, i ncreased by 3.5 o C/min up to 220 o C, and held at 220 o C for 6 min. The peak was identified and calculated based on the retention time and peak area of known standards. Milk samples from 4 consecutive milkings at wk 10 of the study were collected and stored at 20 o C without preservative for analysis of FA. Samples were thawed and composited based on the yield of each milking sampled, and then centrifuged at 17,800 × g for 30 min at 8 o C Clemson University.

PAGE 175

175 Individual FA were identified using a Shimadzu 2010 plus gas chromatograph (Shimadzu America, Inc., Columbia, MD). The carrier gas was H, the split r atio was 5:1, and the injector and detector temperatures were maintained at 240 o column. The oven temperature was initially set to 125 o C for 2 min, increased by 0.5 o C/min up to 155 o C, increased by 2 o C/min up to 235 o C, and maintained for 13 min. The standards utilized to identify the peaks we re GLC 603, GLC 484, and GLC 90 (Nu Check Prep, Inc., Elysian, MN). The apparent transfer efficiency of dietary FA to milk was calculated by dividing the amount of the selected FA in milk fat by the amount the FA ingested during wk 10 of the study. Acute P hase Responses to a Lipopolysaccharide Challenge On d 75 postpartum, cows with SCC < 300,000/mL in the preceding 10 d were eligible to undergo an intramammary challenge with LPS. Of the 45 cows, 39 were selected, 13 per dietary treatment. On the day of i nfusion, mammary quarters had milk evaluated for SCC after the morning milking using the California mastitis test reaction (CMT kit; ImmuCell Corporation, Portland, ME). Only negative CMT quarters were used for infusion and for controls. Approximately 3 h after the morning milking, 10 µg of LPS ( E. coli O111:B4; Sigma L2630, Sigma Aldrich, Saint Louis, MO) diluted in 10 mL of sterile PBS was infused intramammary in one quarter selected randomly via teat canal. Milk samples were collected at 0, 2, 4, 6, 8, 1 4, 24, 48, 72, and 96 h after the infusion. Milk was sampled from the infused quarter separately from others. Milk from the non infused quarters was composited. Samples were preserved with bronopol B 14 and analyzed for SCC by the Southeast Milk Laboratory (Belleview, FL) using a Bentley 2000 mid infrared spectrophotometer analyzer (Bentley Instruments Inc., Chaska, MN). Blood was collected from the coccygeal vessels at 0, 2, 4, 8, 14, 24, and 48 h after the LPS infusion. Harvested plasma (2,095 × g × 15 mi n, Allegra X 15R Centrifuge) was frozen and later analyzed for concentrations of the acute phase proteins haptoglobin (Mikamura and Suzuki,

PAGE 176

176 1982) and acid soluble protein (ASP). Briefly, ASP was extracted with 0.6 M perchloric acid (Fisher Scientific, Hamp ton, NH) diluted in distilled water (66 mL perchloric acid in 1 L water). Plasma samples (50 µL) were incubated with perchloric acid solution (1 mL) for 20 min at room temperature. Samples were then centrifuged (2,095 g × 30 min, Allegra X 15R Centrifuge). Bicinchonimic acid kit (Sigma Aldrich, Saint Louis, MO) was used to analyze the protein concentration in the supernatant. The concentrations of cytokines IFN 6 were measured in plasma using a multiplex chemiluminescent assay following the manufac (CiraplexTM Chemiluminescent Assay Kit 29 038 1 AB; Aushon BioSystems, Billerica, MA). Concurrent samples were collected at 4, 14, 24, and 48 h after the challenge to evaluate neutrophil phagocytic and oxidative burst activities, using m ethodology adapted from Smits et al. (1997) using a dual color flow cytometry assay as described by Martinez et al. (2012). Rectal temperature was measured at 0, 2, 4, 8, 14, 24, and 48 h after the LPS infusion. Statistical Analysis Data were analyzed usi ng the GLIMMIX procedure of SAS (SAS ver. 9.2, SAS Inst. Inc., Cary, NC) fitting either a normal or Poisson distribution according to the type of data. Continuous data were analyzed for normality of residuals before statistical analyses. When residuals wer e not normally distributed, transformation was applied and evaluated to determine if model fit was improved. Daily results were averaged into weekly means before analyses. Data for milk production and composition, BW, BCS, DM intake, and energy balance wer e analyzed including a pretreatment covariate value that was measured before treatments were initiated, while cows were fed a common diet. All models included the fixed effects of treatment, parity (2 or >2), and interactions between treatment and parity. Models for data with repeated measurements over time within the same experimental unit also included the fixed effects of time and interaction between treatment and time, and the random effect of cow nested within

PAGE 177

177 treatment. The time reference for the stat istical models was either day or week relative to the beginning of the study or hour relative to challenge with LPS. Whenever treatment effect was detected, pairwise comparisons were performed with adjustment by the method of Tukey. For models with repeate d measures within experimental unit, the covariance structure (compound symmetry, heterogeneous compound symmetry, autoregressive 1, heterogeneous autoregressive u nequally spaced measurements, the spatial power covariance structure was used. . Results Chemical analyses of dietary ingredients and the rations fed to cows indicated minor deviations from the preplanned ratios of n 6 to n 3 FA in the diet (Table 5 1). The diets contained ratios of 3.9, 4.9, and 5.9 for R4, R5, and R6, respectively, and differed in the FA profile, particularly the concentrations of li noleic, EPA and DHA (Table 5 2). Dry Matter Intake, Body Weight, and Body Condition Intake of DM increased ( P = 0.05) with feeding R4 compared with R5 or R6 (Table 5 3; Figure 5 1A). Based on diet composition and intake of DM, total FA intake did not diffe r and averaged 953 ± 24 g/d. An effect ( P < 0.001) of treatment was detected for intakes of n 6 and n 3 FA (Table 5 3). As the ratio of n 6 to n 3 FA increased, intakes of linoleic and total n 6 FA also increased. Conversely as the ratio of n 6 to n 3 decr eased, the intake of EPA and DHA and total n 3 FA increased (Table 5 3). Cows fed all diets lost body condition immediately before enrollment in the study. From wk 3 to 15 postpartum, cows lost approximately 0.2 units of body condition. Treatment had mino r effects on BCS of cows, and those fed R4 tended ( P = 0.07) to have smaller body

PAGE 178

178 condition than cows fed R5 after wk 7 postpartum. No difference in BCS was observed between R5 and R6 or R4 and R6 (Figure 5 1E). Similar to BCS, cows lost BW immediately bef ore enrollment into treatments, but BW of cows remained stable throughout the experimental period and was unaffected by dietary treatments (Figure 5 1F). From wk 3 to 15 postpartum, the BW of cows averaged 627 ± 6 kg . Milk Production and Composition, Energ y Balance, and Feed Efficiency Yields of milk, 3.5% FCM, milk fat, milk true protein, and lactose all increased ( P < 0.001) as the ratio of n 6 to n 3 FA decreased from R6 to R4 (Table 5 3). In fact, 3.5% FCM increased with R4, and this response was consis tent throughout the duration of the study (Figure 5 1B). Efficiency of feed conversion into 3.5% FCM tended to increase ( P = 0.08) as the ratio of n 6 to n 3 FA decreased (Table 5 3; Figure 5 1C). Concentrations of fat, true protein, and lactose in milk we re not affected by treatments. The similar milk composition across treatments resulted in no dietary treatment effect on the caloric content of milk, which averaged 0.69 ± 0.01 Mcal/kg. Nevertheless, the increased milk nutrient output as cows consumed more n 3 and less n 6 FA resulted in an increase ( P < 0.01) in the amount of calories secreted as milk (Table 5 3), observed primarily in cows fed the R4 diet. In spite of increased DMI by cows fed R4, the greater milk nutrient secretion resulted in a decrease ( P = 0.06) in NE balance as the ratio of n 6 to n 3 FA decreased in the diet (Table 5 3). Cows in all treatments were in negative energy balance until wk 7 postpartum, after which cows averaged a positive energy balance of 1.9 Mcal/d (Figure 5 1D). Throug hout the study, cows fed R6 had a consistently greater energy balance compared with cows fed R4 . Metabolic and Hormonal Responses During the first 5 wk of the study, corresponding to wk 3 to 7 postpartum, mean plasmatic concentrations of glucose, BHBA, in sulin, and IGF 1 were not affected by treatments

PAGE 179

179 (Figure 5 2). Cows fed R5 had a lower mean concentration of urea N in plasma compared with cows fed R4 and R6 diets ( P = 0.04, Figure 5 2B). As the ratio n 6 to n 3 in the diet decreased, the mean plasmatic concentrations of NEFA tended ( P = 0.10) to increase (Figure 5 2C) . Fatty Acid Profile of Plasma and Milk The FA profile of plasma followed similar changes as FA intake (Table 5 4). Increasing the linoleic acid intake by feeding a greater ratio of n 6 to n 3 in the diet tended ( P = 0.08) to enhance the proportion of linoleic acid in plasma. Similarly the longer chain n 3 FA, EPA and DHA, were in greater ( P < 0.001) proportion of the plasma FA as the dietary ratio of n 6 to n 3 decreased from R6 to R4. Beca use the changes in concentrations of n 6 and n 3 FA in plasma followed those imposed by the dietary treatments, the resulting ratio of plasma n 6 to n 3 FA increased ( P < 0.001) from 7.6 to 11.3 ± 0.40 as the dietary treatment changed from R4 to R6 (Table 5 4). Interestingly, the proportion of arachidonic acid in plasma was similar among treatments despite the differences in intake of n 6 FA. The proportions of de novo synthetized FA, those with < 16 carbons, and pre formed FA, those with > 16 carbons, in milk fat remained unaffected by the changes in dietary intake of n 6 and n 3 FA (Table 5 5 ). We detected no differences in the degree of unsaturation or concentrations saturated or monounsaturated FA in milk fat by altering the ratio of n 6 to n 3 FA in th e diet. However, increasing the ratio from R4 to R6 resulted in an increase ( P = 0.03) in n 6 FA in milk fat, and most of this increase was because of changes in linoleic acid. Concurrent with the increase in n 6 FA in milk fat, increasing the dietary rati o from R4 to R6 did not alter ( P = 0.23) the concentration of total n 3 FA in milk fat. However, the concentrations of EPA decreased ( P < 0.01) as the dietary ratio increased from R4 to R6. The apparent transfer efficiency for dietary linoleic acid into m ilk fat was not affected ( P = 0.76) by changes in the intake of linoleic acid, and averaged 12.7 ± 0.9%. Similarly, dietary

PAGE 180

180 treatments did not affect ( P = 0.67) the transfer efficiency of total n 6 FA into milk fat, which averaged 13.6 ± 0.9%. For EPA and DHA combined, the mean transfer efficiency into milk fat increased ( P = 0.03) with increased intake of these FA (R4 = 4.34 ± 0.61 vs. R5 = 4.93 ± 0.57 vs. R6 = 2.84 ± 0.55%). In spite of the effects of dietary n 6 to n 3 FA on transfer efficiency of EPA an d DHA, treatment did not influence ( P = 0.65) the incorporation of dietary total n 3 FA into milk fat and averaged 11.6 ± 0.6%. Intramammary Lipopolysaccharide Challenge After the LPS challenge, treatment did not affect ( P = 0.20) the mean body temperatur e (Table 5 6). Interval from LPS infusion to peak of body temperature was longer ( P = 0.07) for cows fed R6 than those fed R4 or R5 (Table 5 6). However, the duration of elevated body temperature, based on rectal temperature equal to or greater than 39.5 o C , did not differ among dietary treatments. The SCC in milk after the LPS challenge increased in all glands, but the increments were greater in the quarter in which LPS was infused (Figure 5 3A). An effect ( P = 0.09) of diet was observed for SCC; cows fed R4 and R6 had less SCC in milk compared with those fed R5 (Figure 5 3A). The mean concentrations of insulin and glucose in plasma after LPS challenge were not different among treatments. However, cows receiving the R5 diet tended ( P = 0.08) to have greater concentration of insulin than cows fed the R6 diet at h 4, whereas cows fed R6 had greater circulating concentrations of insulin compared with those fed R4 or R5 at h 8 (Figure 5 3B). The mean concentrations of acid soluble protein and haptoglobin in plas ma were not different among treatments (Table 5 6; Figure 5 3C, respectively). Nonetheless, at 24 h after LPS infusion, haptoglobin peaked higher ( P < 0.05) for cows fed R6 compared with those fed R4 or R5 (Figure 5 3C). Concentrations of IFN however, cows fed R4 had a smaller ( P < 0.05) peak and attenuated concentrations of IL 6

PAGE 181

181 compared with those fed R5 or R6 (Figure 5 3D). Dry matter intake decreased in all tre atments on the day of the challenge with LPS, and the decline averaged 2 kg/d or 8.3% of the previous 5 3E). Intake recovered by 2 d after the challenge. Milk yield also declined during the LPS challenge in all treatments (Figure 5 3F) ; however, the drop in production occurred on the day after the challenge. The decline in milk yield was of 4.7 kg/d, which represents 11.5% of the production in the day preceding the challenge. Discussion Altering the ratio of n 6 to n 3 FA in the diet o ffered to early lactation dairy cows improved yields of milk and milk components in part because of an increase in caloric intake. Cows fed the R4 diet consumed the most DM, which combined with the increased concentrations of n 3 FA in the FA supplement r esulted in twice as much EPA and DHA consumed compared with those fed R6. In many reports in the literature, feeding large quantities of EPA and DHA as fish oil to dairy cows reduced DMI (Donavan et al., 2000), but incorporation of moderate amounts of EPA and DHA from fish oil as Ca salts had no impact on intake of dairy cows (Juchem et al., 2008). Some researchers have attributed the decrease in DMI when PUFA are fed to the ability of these FA to stimulate release of gut peptides (Bradford et al., 2008; Al izadeh et al., 2012) or to a potential increase in hepatic oxidation (Mashek et al., 2002), both of which have been linked with satiety (Allen et al., 2009). However, in the present study, all diets were supplemented with the same amount of Ca salts of FA, 1.43% of dietary DM, and the diets had similar concentrations of PUFA. Others have reported that moderate amounts of unsaturated FA from fish oil fed as Ca salts did not have a negative effect on DMI (Juchem et al., 2008). In fact, feeding moderate amount s of supplemental FA as Ca salts containing fish oil FA, in some cases, increased DMI compared with cows fed no supplemental fat (Moussavi et al., 2007).

PAGE 182

182 Decreasing the ratio of n 6 to n 3 FA in the diet enhanced milk yield. A portion of the increased mil k yield was attributed to the increase in caloric intake. Others reported an increase in milk yield when n 3 FA were supplemented to the diet of early lactation dairy cows as Ca salts of fish oil and a portion of the response in production was attributed t o the increased DMI (Moussavi et al. , 2007). In the current study, cows fed R4 produced 4.6 kg more 3.5% FCM compared with those fed R6 and they also consumed 1.4 kg more DM per day. At 1.62 Mcal/kg of diet, the additional DMI provided sufficient calories (2.27 Mcal) for approximately 3.3 kg of milk, which contained 0.69 Mcal/kg. Therefore, 1.3 kg of milk cannot be accounted for the differences in DM and nutrient intakes. It is possible that altering the dietary ratio of n 6 to n 3 FA, which resulted in cha nges in tissue FA composition, influenced nutrient partitioning and favored lactation. Others have reported that changes in the supply of dietary n 3 FA increased the concentrations of these FA in different tissues (Bilby et al. , 2006 c ). Feeding n 3 FA res ulted in increased incorporation into the hepatic tissue, which altered hepatic expression of the gluconeogenic enzymes, pyruvate carboxylase and phosphoenol pyruvate carboxykinase (Amaral, 2008). In fact, Amaral (2008) reported that changes in hepatic mRN A abundance for gluconeogenic enzymes were accompanied by a more rapid rise in IGF 1 concentrations in plasma of cows in early lactation. Likewise, Bilby et al. (2006 c ) reported altered responsiveness to exogenous bST by preferentially increasing growth ho rmone and reducing IGF 1 concentrations in plasma, and also resulted in greater milk production by cows fed fish oil compared to those fed cottonseed. Thus changes in the FA profile of tissues such as liver could influence synthesis and metabolism of other nutrients and impact lactation performance. Improving hepatic gluconeogenesis would favor lactose synthesis in the mammary gland and, potentially, yield of milk.

PAGE 183

183 The concentration of milk components was not altered by treatments, but because of the incre ased milk yield, the yields of fat, true protein and lactose increased as the dietary ratio of n 6 to n 3 FA decreased. A concern of feeding PUFA is the risk of milk fat depression. The latter can be aggravated when PUFA present in fish oil replace linolei c and/or linolenic acids in the diet (Whitlock et al., 2002). In many instances, feeding PUFA has induced a reduction in concentrations of fat and protein in milk (Rabiee et al., 2012), although the effects on yields of these milk components were not neces sarily negative. It is known that negative associative effects exist between dietary ingredients which can influence concentration of milk components (Onetti and Grummer, 2004). In general, feeding fat sources rich in unsaturated FA are more detrimental to milk fat concentration when dietary concentration of NDF is low or when the main forage source is corn silage compared with alfalfa (Smith et al., 1993). In the current study, all diets had similar unsaturated FA concentration, and diets were formulated t o contain more than sufficient NDF (NRC, 2001), and limited starch, although the caloric density of rations were typical of high yielding dairy cows. In fact, results from all 3 diets indicated reasonable milk fat concentrations and excellent yields of 3.5 % FCM, indicating that milk fat depression was not an issue. Feeding fish oil FA can pose a risk for milk fat depression, which is accompanied by increased proportions of CLA and trans C18:1 FA in milk (Donovan et al., 2000). Nevertheless, the concentratio n of trans 10 C18:1 in milk fat was not altered by diet, but concentration of CLA increased with feeding R4. It is likely that either the similar amounts of unsaturated FA consumed by cows from the three experimental diets, or the provision of sufficient d ietary NDF limited the potentially negative associative effects of feeding fish oil FA on milk components. Despite the doubling in intake of EPA and DHA by cows fed R4 compared with those fed R6, the FA profile of milk fat did not reflect shifts compatibl e with a decline in de novo

PAGE 184

184 synthesis of FA. Diets that induce milk fat depression usually result in accumulation of certain trans FA in milk fat and are characterized by a reduction in the proportion of short and medium chain FA in milk (Bauman et al., 20 11). As observed in other studies (Gonthier et al., 2005; Petit et al., 2007), the differences in the proportions of PUFA in milk fat reflected the differences in dietary FA composition. Consequently, as the ratio of n 6 to n 3 FA in the diet changed, so d id that of milk fat. The transfer efficiency of PUFA from the diet to the mammary gland in the present study was greater than the efficiency reported by others (Gonthier et al., 2005). It is possible that the extent of biohydrogenation of PUFA was less, wh ich would have provided a larger proportion of the consumed FA in their original form for absorption in the small intestine. Interestingly, the transfer efficiency of EPA/DHA was affected by diet, with the lowest efficiency observed for cows fed R6, which provided on average only 10 g/d of these FA. The efficiency of transfer achieved a maximum and then plateaued as cows consumed approximately 15 g/d of EPA and DHA in R5, with no further increase with feeding 20 g/d of EPA and DHA in d R4. It is possible th at a larger proportion of the EPA and DHA absorbed by cows fed R6 were used for metabolic functions that prevented them from being secreted into milk fat. Plasma FA profile partially reflects the profile of FA reaching the duodenum and eventually absorbed (Gonthier et al., 2004; Gonthier et al., 2005). Ruminal biohydrogenation limits the supply of unsaturated FA for absorption in ruminants. However, the extent to which unsaturated FA were biohydrogenated in the current study did not impair the n 6 and n 3 F A from being absorbed and detected in plasma in concentrations that paralleled those fed in the diet. Consequently, the major differences detected in the plasma profile of FA were analogous to the differences in the supply of dietary FA.

PAGE 185

185 Energy balance in creased as the ratio of dietary n 6 to n 3 FA increased. Generally, feeding fat to early lactation cows does not improve energy balance and, in many cases, fat supplementation improves milk yield with either no changes or slight decreases in DMI which redu ces energy balance (Staples et al . , 1998). Feeding increasing amounts of n 3 FA improved milk yield and tended to improve feed conversion ratio, which resulted in more ingested calories partitioned into milk calories. These results suggest that cows fed di ets with a greater proportion of n 3 FA had improved partitioning of nutrients towards milk synthesis instead of restoring body tissues. A similar response is often observed when cows are fed supplemental fat compared with no fat supplementation (Rabiee et al., 20012). In the rodent model, increasing the consumption of n 3 FA has been reported to reduce fat deposition in spite of similar caloric intake, reinforcing the role of FA in altering nutrient partitioning (Buckley and Howe, 2010). A more pronounced negative energy balance is associated frequently with greater tissue mobilization (Petit et al., 2007). Although energy balance was slightly but significantly less for cows fed R4 compared with R6, differences in BW, BCS, and concentrations of metabolites and hormones which can be indicative of energetic status were negligible. At the end of the 13 wk experiment, BW and BCS differed only by 7 kg and 0.1 unit, respectively. Therefore, the increased secretion of milk calories did not seem to be at the expense of body reserves. An additional explanation for improved feed efficiency is that feeding more n 6 relative to n 3 FA resulted in increased nutrient expenditure to maintain a more pro inflammatory state (Colditz, 2002). Feeding n 6 FA has the potential to enhance the pro inflammatory state (Calder, 2012), and cows fed the R6 diet had increased markers of inflammation. Under acute inflammation, amino acids and other nutrients are partitioned away from storage and growth and used to maintain immune function ( Gilford et al., 2012). Klasing and Calvert (1999) estimated that

PAGE 186

186 lysine utilization by the immune system of poultry increased five fold during LPS induced inflammation. Induction of inflammatory response in feed restricted steers increased the splanchnic t issue utilization of amino acids by 2.67 moles/d (Burciaga Robles, 2009). These differences in amino acid utilization were independent of the effects of inflammation on appetite. These data illustrate the shift in nutrient utilization and some of the metab olic costs of mounting an inflammatory response. Therefore, we hypothesize that altering the diet might have altered the inflammatory state of cows that could influence nutrient use (Colditz, 2002; Gilford et al., 2012). Increased intake of n 3 FA by cows fed the R4 diet attenuated the inflammatory response induced by the intramammary infusion of LPS. Acute inflammation can induce tissue insulin resistance, which could be accompanied with increased glycogenolysis and gluconeogenesis (Vernay et al., 2012). B allou et al. (2009) supplemented the diet of dairy cows during the transition period with either fish oil or a source of mostly saturated free FA. Mammary glands were then challenged with 100 µg of E. coli LPS, a dose that is 10 fold greater than that used in the present study. The authors were unable to detect any attenuation of the local or systemic acute phase responses by the source of dietary FA fed (Ballou et al., 2009). The discrepancies between the findings of Ballou et al. (2009) and those of the c urrent study, in which some attenuation of the inflammatory response was observed with R4, might be related to the dose of LPS used or, perhaps, the amount of EPA and DHA absorbed and incorporated into tissues, and/or ratio of n 3 to n 6 FA. Ballou et al. (2009) fed a much greater dose of EPA + DHA, 60 g/d pre and 45 g/d postpartum, which was 2 to 3 fold the intake by R4 cows. Decreasing the ratio of n 6 to n 3 FA in the diet of cows from R6 to R4 probably altered the FA profile of the membrane phospholip ids of the immune cells (Silvestre et al., 2011 a ). It is expected that the observed changes in plasma FA profile with the different diets also influenced

PAGE 187

187 the FA composition of cell membrane in leukocytes. Silvestre et al. (2011 a ) demonstrated that feeding fish oil reduced inflammatory cytokine production by PMNL. In cell culture (Huang et al. , 2010) an d in rodent models (Vijay Kumar et al. , 2011), n 3 FA consistently reduced the inflammatory response to LPS. Therefore, n 3 FA have the ability to modulate th e inflammatory response as observed after the LPS challenge, although altering the supply of dietary n 3 FA will not necessarily protect from the deleterious effects of an excessive acute phase response (Ballou et al., 2009). In fact, altering the ratio of FA in the diet did not attenuate the losses in DMI and milk yield during the LPS challenge in the current study. Also, during the challenge, the loss in milk production of 4.7 kg/d represented approximately 3.20 Mcal, which matches exactly the reduction i n caloric consumption due to the 2 kg/d decline in DMI (3.24 Mcal). Conclusion Decreasing the ratio of n 6 to n 3 FA in the diet of lactating dairy cows while maintaining similar dietary concentrations of total FA improved productive performance in ea rly lactation. A dietary n 6 to n 3 ratio of approximately 4:1 resulted in the greatest DMI and production of milk and milk components. Approximately 1.3 kg of milk response could not be accounted for by differences in nutrient intake, which suggests that reducing the dietary FA ratio from 6:1 to 4:1 can influence nutrient partitioning to favor an increased proportion of the total NE consumed allocated to milk synthesis. Although cows fed the lowest ratio of dietary n 6 to n 3 FA had reduced energy balance, other indicators of energy status such as changes in BW, BCS, and circulating concentrations of metabolites and hormones linked to energy status were mostly unaltered. Collectively, these results indicate that improvements in lactation performance were no t at the expense of body reserves. Feeding more n 3 and less n 6 FA in the R4 diet attenuated the acute phase response after the intramammary challenge with LPS, although the diet did not reduce the losses in intake and production during the inflammatory c hallenge. It is possible that

PAGE 188

188 improvements in lactation performance by feeding diets that differ in FA profile might be related with altered nutrient partitioning by attenuating inflammatory responses .

PAGE 189

189 Table 5 1. Dietary ingredients and nutrient compos ition of diets 1 R4 R5 R6 Ingredients, 2 % of DM Corn silage 18.7 18.7 18.7 Bermuda silage 9.0 9.0 9.0 Alfalfa hay 6.1 6.1 6.1 Corn grain, finely ground 13.8 13.8 13.8 Citrus pulp 10.1 10.1 10.1 Soybean hulls 20.3 20.3 20.3 Soybean meal, solvent extract 10.1 10.1 10.1 Soybean meal, cooker processing 3 5.7 5.7 5.7 Molasses 1.6 1.6 1.6 Vitamin mineral protein premix 4 3.0 3.0 3.0 Ca salts of palm oil 5 0.73 0.65 0.53 Ca salts of safflower oil 6 0 0.37 0.70 Ca salts of fish oil 7 0.70 0.41 0.20 Nut rients, DM basis (± SD) NE L , 8 Mcal/kg 1.62 1.62 1.62 CP, % 16.6 ± 0.8 16.6 ± 0.8 16.5 ± 0.8 Starch, % 17.3 17.3 17.3 Non fibrous carbohydrates, 9 % 35.4 ± 1.9 35.4 ± 2.0 35.5 ± 1.9 ADF, % 16.0 ± 0.9 15.9 ± 0.9 15.6 ± 0.9 NDF, % 38.4 ± 2.3 38.4 ± 2.3 3 8.1 ± 2.3 NDF from forage, % 17.1 ± 0.7 17.1 ± 0.7 17.1 ± 0.7 Fatty acids, % 3.66 ± 0.15 3.82 ± 0.17 3.88 ± 0.16 Ca, % 0.87 ± 0.07 0.89 ± 0.07 0.90 ± 0.08 P, % 0.33 ± 0.03 0.33 ± 0.03 0.33 ± 0.03 Mg, % 0.31 ± 0.02 0.31 ± 0.02 0.31 ± 0.02 K, % 1.48 ± 0.05 1.48 ± 0.05 1.48 ± 0.05 Cl, % 0.29 ± 0.03 0.28 ± 0.03 0.29 ± 0.03 Na, % 0.32 ± 0.01 0.32 ± 0.01 0.32 ± 0.01 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4 .9 parts of n 6 to 1 part of n 3; R 6 is a ratio of 5.9 parts of n 6 to 1 part of n 3. 2 Composition of ingredients: corn silage (DM = 30.5%; OM = 95.1%; CP = 8.2%; NDF = 43.0%; ADF = 20.1%, lignin = 1.5%; FA = 3.3%); Bermuda silage (DM = 44.8%; OM = 93.5% ; CP = 11.3%; NDF = 68.4%; ADF = 32.8%, lignin = 4.3%; FA = 1.9%); alfalfa hay (DM = 91.6%; OM = 90.6%; CP = 16.4%; NDF = 47.7%; ADF = 16.7%, lignin = 5.3%; FA = 2.0%); mixture of concentrates (DM = 90.0%; OM = 92.8%; CP = 19.7%; NDF = 31.9%; ADF = 12.2%, lignin = 1.3%; FA = 4.4%). 3 AminoPlus (Ag Processing Inc., Omaha, NE). 4 Contains (DM basis) 30.0% ProvAAl LysAAMet (blend of blood meal and protected lysine and methionine, Venture Milling, Salisbury, MD), 28.5% sodium sesquicarbonate, 13.0% potassium ca rbonate, 7.0% dicalcium phosphate, 7.0% magnesium oxide, 3.5% sodium chloride, 1.2% Availa 4 (Zinpro Co., Eden Prairie, MN), 0.3% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.06% vitamin trace mineral premix, and 0.22% Rumensin 90 (Elanco An imal

PAGE 190

190 Health, Greenfield, IN). Each kg contains 27.8% CP, 5.2% Ca, 1.6% P, 4.1% Mg, 6.8% K, 10.7% Na, 2.3% Cl, 680 mg Zn, 235 mg Cu, 422 mg Mn, 6.6 mg Se, 23 mg Co, 13.8 mg I, 116,000 IU vitamin A, 35,000 IU vitamin D, 1,170 IU vitamin E, and 450 mg of mone nsin. 5 EnerGII, Ca salts of palm oil FA (Virtus Nutrition, Corcoran, CA). Fatty acid composition, g/100g of total FA: C14:0 = 1.2; C16:0 = 49.6; C16:1 = 0.16; C18:0 = 4.3; C18:1 = 34.7; C18:2 cis 9, cis 12 = 8.1; C20:5 cis 5, cis 8, cis 11, cis 14, cis 17 = not detected ; C22:5 cis7 , cis10, cis13, cis16, cis19 = not detected ; C22:6 cis4 , cis7 , cis10, cis13, cis16, cis19 = not detected ; n 6 total = 8.1; n 3 total = 0.2. 6 Prequel21, Ca salts enriched in safflower oil FA (Virtus Nutrition, Corcoran, CA). Fatty acid composition, g/100g of total FA: C14:0 = 0.6; C16:0 = 12.4; C16:1 = 0.7; C18:0 = 2.0; C18:1 = 24.1; C18:2 cis 9, cis 12 = 51.9; C20:5 cis 5, cis 8, cis 11, cis 14, cis 17 = 0.8; C22:5 cis7 , cis10, cis13, cis16, cis19 = 0.1; C22:6 cis4 , cis7 , cis10, cis13, cis16, cis19 = 0.4; n 6 total = 51.9; n 3 total = 2.2. 7 StrataG113, Ca salts enriched in fish oil FA (Virtus Nutrition, Corcoran, CA). Fatty acid composition, g/100g of total FA: C14:0 = 9.0; C16:0 = 23.1; C16:1 = 9.9; C18:0 = 5.5; C18:1 = 11.7; C18:2 cis 9, cis 12 = 1.9; C20:5 cis 5, cis 8, cis 11, cis 14, cis 17 = 11.9; C22:5 cis7 , cis10, cis13, cis16, cis19 = 2.0; C22:6 cis4 , cis7 , cis10, cis13, cis16, cis19 = 6.3; n 6 total = 2.8; n 3 total = 20.9. 8 NE L according to NRC (2001) using analyzed feed values and calcul ated at 24 kg of DMI/d. 9 Non fibrous carbohydrates calculated as: 100 (NDF + CP + FA + Ash).

PAGE 191

191 Table 5 2. Fatty acid composition of diets (mean ±SD) 1 R4 R5 R6 Fatty acids, % of DM C12:0 0.006 ± 0.017 0.006 ± 0.015 0.006 ± 0.015 C14:0 0.053 ± 0.059 0.045 ± 0.037 0.030 ± 0.037 C15:0 0.006 ± 0.041 0.006 ± 0.040 0.005 ± 0.040 C16:0 0.820 ± 0.531 0.824 ± 0.418 0.776 ± 0.451 C16:1 cis 9 0.050 ± 0.053 0.042 ± 0.034 0.027 ± 0.036 C17:0 0.009 ± 0.016 0.009 ± 0.015 0.008 ± 0.015 C18:0 0.135 ± 0.120 0.133 ± 0.114 0.127 ± 0.116 C18:1 cis 9 0.708 ± 0.184 0.762 ± 0.174 0.785 ± 0.194 C18:2 cis 9, cis 12 1.2 5 0 ± 0.838 1. 4 31 ± 0.653 1.5 8 0 ± 0.670 C18:3 cis 9, cis 12, cis 15 0.238 ± 0.181 0.228 ± 0. 163 0. 229 ± 0. 163 C20:0 0.015 ± 0.026 0.018 ± 0.016 0.018 ± 0 .015 C20:3 cis8 , cis11, cis14 0.001 ± 0.001 ND 2 ND C20:3 cis11 , cis14, cis17 0.001 ± 0.003 0.001 ± 0.001 ND C20:4 cis5 , cis8, cis11, cis14 0.004 ± 0.007 0.003 ± 0.007 0.002 ± 0.007 C20:5 cis5 , cis8, cis11, cis14, cis17 0.051 ± 0.007 0.040 ± 0.011 0.023 ± 0.008 C22:4 cis7 , cis10, cis13, cis16 0.005 ± 0.019 0.005 ± 0.019 0.005 ± 0.019 C22:5 cis7 , cis10, cis13, cis16, cis19 0.009 ± 0.002 0.007 ± 0.001 0.004 ± 0.001 C22:6 cis4 , cis7 , cis10, cis13, cis16, cis19 0.028 ± 0.006 0.022 ± 0.009 0.013 ± 0.005 O thers 0. 275 ± 0. 524 0. 225 ± 0. 517 0. 241 ± 0. 592 n 6 total 1.2 6 0 ± 0.10 1. 447 ± 0.08 1.5 8 7 ± 0.08 n 3 total 0.327 ± 0.01 0.298 ± 0.01 0.269 ± 0.01 Ratio of n 6 to n 3 3. 9 4. 9 5. 9 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4.9 parts of n 6 to 1 part of n 3; R 6 is a ratio of 5.9 parts of n 6 to 1 part of n 3. 2 ND = Not detected.

PAGE 192

192 Table 5 3. Effect of altering the dietary ratio of n 6 to n 3 fatty acids on inta ke, lactation performance, and energy balance 1 R4 R5 R6 SEM 2 TRT 2 TRT x Wk 2 DMI, kg/d 26.1 a 24.6 b 24.7 b 0.5 0.07 0.46 FA intake, 3 g/d 931.5 952.9 975.0 24.1 0.45 0.46 Linoleic 298.1 c 329.5 b 369.4 a 8.6 <0.001 0.50 EPA + DHA 2 1 .3 a 14.9 b 10.0 c 0.3 <0.001 0.44 Total n 6 300.6 c 332.0 b 371.9 a 8.6 <0.001 0.50 Total n 3 7 7 .3 a 67.3 bx 62.8 by 1.7 <0.001 0.38 Milk, kg/d 46.8 ax 44.8 y 43.2 b 0.7 < 0.01 0.66 3.5% FCM 48.0 a 45.4 bx 43.4 by 0.8 < 0.01 0.79 3.5% FCM/DMI 1.86 x 1.87 x 1.78 y 0.03 0.08 0.95 Milk fat % 3.64 3.58 3.54 0.05 0.42 0.17 kg/d 1.71 a 1.60 b 1.53 c 0.03 < 0.01 0.73 Milk true protein % 2.82 2.86 2.86 0.02 0.23 0.99 kg/d 1.32 a 1.28 ab 1.24 b 0.02 0.03 0.78 Lactose % 4.90 4.88 4.88 0.01 0.37 0.83 kg/d 2.29 ax 2.19 y 2.12 b 0.04 0.01 0.53 Net energy (NE) of milk 4 Mcal/kg 0.69 0.69 0.68 0.01 0.68 0.15 Mcal/d 32.3 a 30.8 b 29.5 b 0.6 < 0.01 0.82 % of NE intake 78.0 a 78.6 a 74.4 b 1.3 0.04 0.94 Energy balance, Mcal/d 1.22 b 0.79 y 1.03 ax 0.69 0.06 0.81 Different superscript within a row represent differences among treatments ( a,b,c P x,y,z 0.05 < P < 0.10). 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4.9 parts of n 6 to 1 part of n 3; R 6 is a ratio of 5.9 parts of n 6 to 1 part of n 3. 2 SEM = Standard error of the mean; TRT = effect of treatment; TRT x Wk = effect of the interaction between TRT and week. 3 EPA = eicosapentaenoic FA; DHA = docosahexaenoic FA; total n 6 = C18:2 + C18:3 + C20:2 + C20:3 + C20:4 + C22:2 + C22:4; total n 3 = C18:3 + C20:3 + C20:5 + C22:5+ C22:6. 4 NE of milk = (0.0929 × % milk fat) + (0.0563 × % milk true protein) + (0.0395 × % lactose).

PAGE 193

193 Table 5 4. Effect of altering the ratio of dietary n 6 to n 3 fa tty acids (FA) on plasma FA profile 1 R4 R5 R6 SEM 2 P 2 g/100 g of FA C8:0 0.01 0.01 0.01 0.01 0.93 C10:0 0.02 0.02 0.03 0.01 0.30 C12:0 0.01 0.01 0.01 0.01 0.65 C14:0 0.49 0.48 0.44 0.02 0.12 C15:0 0.51 0.500 0.49 0.02 0.68 C16:0 11.52 a 11.13 a 10 .30 b 0.29 0.02 C16:1 * 1.10 1.01 0.79 0.12 0.16 C17:0 0.67 0.62 0.68 0.03 0.26 C17:1 cis10 0.01 0.01 0.01 0.01 0.87 C18:0 11.89 b 12.32 ab 12.89 a 0.23 0.02 C18:1 * 6.02 5.94 5.53 0.41 0.67 C18:2 cis9, cis12 47.13 by 48.73 x 48.83 a 0.59 0.08 C18:3 cis6, ci s9, cis12 0.41 b 0.51 b 0.68 a 0.04 <0.001 C18:3 cis9, cis12, cis15 3.57 a 3.13 b 2.98 b 0.09 <0.001 C20:0 0.03 0.03 0.04 0.01 0.33 C20:2 cis11, cis14 0.08 0.08 0.08 0.01 0.37 C20:3 cis8, cis11, cis14 1.25 b 1.46 b 1.82 a 0.10 0.001 C20:4 cis5, cis8, cis11, ci s14 1.98 1.89 1.90 0.08 0.67 C20:5 cis5, cis8, cis11, cis14, cis17 1.79 a 1.20 b 0.85 c 0.10 <0.001 C22:5 cis7, cis10, cis13, cis16, cis19 0.80 0.78 0.69 0.09 0.68 C22:6 cis4, cis7, cis10, cis13, cis16, cis19 0.52 a 0.35 b 0.24 c 0.04 <0.001 C24:1 cis15 0.05 0.04 0.06 0.02 0.82 Other FA 9.73 9.76 10.69 0.54 0.36 Total saturated FA 25.15 25.13 24.87 0.31 0.77 Total monounsaturated FA 7.18 7.00 6.39 0.50 0.51 Total polyunsaturated FA 57.93 58.12 58.06 0.69 0.98 Total n 6 50.85 b 52.66 a 53.30 a 0.54 0.01 Tot al n 3 7.09 a 5.46 b 4.76 b 0.34 <0.001 n 6 to n 3 ratio 7.60 c 9.84 b 11.3 a 0.40 <0.001 Different superscript within a row represent differences among treatments ( a,b,c P x,y,z 0.05 < P < 0.10). 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4.9 parts of n 6 to 1 part of n 3; R 6 is a ratio of 5.9 parts of n 6 to 1 part of n 3. 2 SEM = Standard error of the mean; P = P value ; * Includes different isomers.

PAGE 194

194 Table 5 5. Effect of altering the ratio of dietary n 6 to n 3 fatty acids (FA) on milk FA profile 1 R4 R5 R6 SEM 2 P 2 g/100 g of FA C6:0 4.33 5.16 4.11 0.63 0.45 C8:0 1.10 1.30 1.13 0.07 0.12 C10:0 2.23 2.38 2.36 0.13 0.69 C11:0 0.02 0.03 0.02 0.01 0.62 C12:0 2.83 3.01 3.00 0.16 0.68 C14:0 11.79 11.17 11.84 0.59 0.66 C14:1 trans9 0.24 0.24 0.24 0.01 0.98 C14:1 cis9 0.95 0.81 0.86 0.07 0.44 C15:0 1.10 a 0.97 b 1.00 ab 0.04 0.10 C15:1 trans10 0.19 0.19 0.21 0.01 0.13 C16:0 38.63 38.05 36.56 0.96 0.30 C16:1 trans * 0.10 0.08 0.08 0.01 0.38 C16:1 cis9 0.58 0.50 0.39 0.08 0.25 C17:0 1.49 1.62 1.62 0.05 0.15 C18:0 7.24 8.02 8.39 0.51 0.29 C18:1 trans8 0.29 0.26 0.31 0.03 0.55 C18:1 trans9 0.31 0.31 0.30 0.04 0.95 C18:1 trans10 1.28 0.85 1.06 0.37 0.73 C18:1 trans11 1.40 1.32 1.47 0.12 0.65 C18:1 cis9 17.27 17.51 15.23 1.47 0.47 C18:1 cis10 0.59 b 0.63 ab 0.73 a 0.04 0.08 C18:1 cis11 0.62 ax 0.50 y 0.48 b 0.04 0. 05 C18:1 cis12 0.30 b 0.39 a 0.42 a 0.02 <0.01 C18:2 cis9, cis12 2.66 b 2.71 b 3.22 a 0.17 0.05 C18:2, conjugated * 0.14 a 0.12 ab 0.11 b 0.01 0.06 C18:3 cis9, cis12, cis15 0.39 0.41 0.43 0.01 0.12 C20:0 0.15 0.15 0.14 0.01 0.61 C20:1 trans11 0.72 0.66 0.70 0. 07 0.84 C20:4 cis5, cis8, cis11, cis14 0.10 0.11 0.11 0.01 0.81 C20:5 cis5, cis8, cis11, cis14, cis17 0.08 a 0.06 a 0.04 b 0.01 <0.01 C22:0 0.04 0.05 0.05 0.01 0.65 C22:1 trans11 0.05 a 0.03 ab 0.02 b 0.01 0.10 C22:5 cis7, cis10, cis13, cis16, cis19 0.12 a 0 .10 b 0.07 c 0.01 0.001 C24:1 cis15 0.14 0.13 0.17 0.02 0.42 Other FA 0.04 0.05 0.01 0.02 0.51 C16 34.65 34.92 37.09 1.34 0.37 Total saturated FA 70.13 70.92 69.23 1.44 0.70 Total monou nsaturated FA 26.31 25.50 26.77 1.30 0.77 Total polyunsaturated FA 3.52 3.53 3.99 0.19 0.15 Total n 6 2.90 b 3.13 ab 3.45 a 0.14 0.03

PAGE 195

195 Table 5 5 . Continued. R4 R5 R6 SEM 2 P 2 Total n 3 0.62 0.60 0.54 0.03 0.23 n 6 to n 3 ratio 4.74 c 5.41 b 6.37 a 0.16 <0. 001 Different superscript within a row represent differences among treatments ( a,b,c P x,y,z 0.05 < P < 0.10). 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4.9 parts of n 6 to 1 part of n 3; R 6 is a ratio of 5.9 parts of n 6 to 1 part of n 3. 2 SEM = Standard error of the mean; P = P value ; * Includes different isomers.

PAGE 196

196 Table 5 6. Body temperature, plasma concentrations of hormones, metabolites, cy tokines, and acute phase proteins, and blood neutrophil activity of lactating Holstein cows receiving diets varying in the ratio of n 6 to n 3 fatty acids after an intra mammary challenge with lipopolysaccharide 1 R4 R5 R6 SEM 2 TRT 2 Hour 2 TRT x Hour 2 Temp erature, o C 39.06 39.26 39.12 0.08 0.20 <0.001 <0.01 Peak temperature 3 , o C 40.80 41.33 40.78 0.21 0.14 ----Time to peak temperature 3 , h 5.08 y 4.83 y 6.23 x 0.66 0.07 ----o C 3 , h 4.69 5.92 6.15 0.84 0.43 ----Glucose, mg/dL 65.70 68.77 66.69 1.68 0.42 <0.001 0.39 A cid soluble protein , µg/mL 50.87 50.67 50.44 5.03 0.99 <0.001 0.77 I nterferon 10.33 29.92 17.85 8.99 0.36 0.001 0.93 Phagocytosis, % 53.41 54.93 52.53 2.40 0.77 0.40 0.80 Oxidative burst, % 28.93 29.91 30.96 2.64 0.86 0.04 0.89 Different superscript within a row represent differences among treatments ( a,b,c P x,y,z 0.05 < P < 0.10). 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4.9 parts of n 6 to 1 part of n 3; R 6 is a ratio of 5.9 parts of n 6 to 1 part of n 3. 2 SEM = Standard error of the mean; TRT = effect of treatment; Hour = effect time in hours relative to LPS infusion; TRT x Hour = effec t of the interaction between TRT and Hour. 3 Peak temperature = highest body temperature after the LPS infusion; Time to peak temperature = time after LPS infusion cows reached o C = hours in which cows had body temperature equal to or greater than 39.5 o C.

PAGE 197

197 Figure 5 1. Dry matter intake (A), 3.5% fat corrected milk (B), feed conversion rati o of kg of 3.5% FCM/kg of DMI (C), energy balance (D), body condition score (E), and body weight (F) of lactating Holstein cows fed diets of 3.9 to 1 (R4), 4.9 to 1 (R5), or 5.9 to 1 (R6) ratios of n 6 to n 3 FA. Cov = covariate value measured between 6 an d 10 DIM .

PAGE 198

198 Figure 5 2. Concentrations of glucose (A; R4 = 65.7, R5 = 67.5 and R6 = 66.1 ± 1.1 mg/dL; effect of treatment P = 0.46; interaction between treatment and week P = 0.74), urea N (B; R4 = 12.4, R5 = 11.0 and R6 = 12.4 ± 0.4 mg/dL; effect of t reatment P = 0.04; interaction between treatment and week P = 0.85; R4 vs. R5 P = 0.03; R4 vs. R6 P = 0.93; R5 vs. R6 P = 0.02), nonesterified fatty acids (C; R4 = 310.8, R5 = 256.7 and R6 = 247.9 ± 22.5 µM; effect of treatment P = 0.10; interaction betwee n treatment and week P = 0.52; R4 vs. R5 P = 0.09; R4 vs. R6 P = 0.06; R5 vs. R6 P = 0.79), beta hydroxybutyrate (D; R4 = 6.51, R5 = 6.34 and R6 = 6.11 ± 0.47 mg/dL; effect of treatment P = 0.83; interaction between treatment and week P = 0.13), insulin (E ; R4 = 0.47, R5 = 0.50 and R6 = 0.52 ± 0.05 effect of treatment P = 0.73 ng/mL;

PAGE 199

199 interaction between treatment and week P = 0.53), and insulin like growth factor 1 (F; R4 = 35.65, R5 = 37.02 and R6 = 36.53 ± 1.93; effect of treatment P = 0.88; interaction between treatment and week P = 0.99) in plasma of lactating Holstein cows fed diets of 3.9 to 1 (R4), 4.9 to 1 (R5), or 5.9 to 1 (R6) ratios of n 6 to n 3 FA .

PAGE 200

200 Figure 5 3 . Somatic cell count (SCC) in milk (A; R4 = 3.68, R5 = 4.33 and R6 = 3.58 ± 0. 25 x106/mL; effect of treatment P = 0.09; interaction between treatment and hour P = 0.07; R4 vs. R5 P = 0.08; R4 vs. R6 P = 0.78; R5 vs. R6 P = 0.04), and concentrations of insulin (B; R4 = 0.94, R5 = 0.94 and R6 = 1.03 ± 0.08 ng/mL; effect of treatment P = 0.66; interaction between treatment and hour P = 0.24), haptoglobin (C; R4 = 0.08, R5 = 0.09 and R6 = 0.11 ± 0.02 OD; effect of treatment P = 0.30; interaction between treatment and hour P = 0.57), and interleukin 6 (D; R4 = 112.5, R5 = 353.4 and R6 = 3 65.1 ± 86.6 pg/mL; effect of treatment P = 0.07;

PAGE 201

201 interaction between treatment and hour P = 0.57; R4 vs. R5 P = 0.05; R4 vs. R6 P = 0.04; R5 vs. R6 P = 0.92) in plasma, dry matter intake (E; R4 = 24.8, R5 = 23.5 and R6 = 22.9 ± 0.7 kg/d; effect of treatmen t P = 0.21; interaction between treatment and day P = 0.94), and milk yield (F; R4 = 41.1, R5 = 40.6 and R6 = 39.2 ± 1.2 kg/d; effect of treatment P = 0.48; interaction between treatment and day P = 0.96) of lactating Holstein cows fed 3.9 to 1 (R4), 4.9 t o 1 (R5) and 5.9 to 1 (R6) ratio of n 6 to n 3 FA in the diet. Milk and blood samples were collected immediately before E. coli lipopolysaccharide (LPS). Dry matter intake and milk yield are represented for the day before (d 1), the day of challenge (d 0), and 3 d after the challenge. Within an hour or day, pairwise differences ( P < 0.05) are represented as follow: $ (R4 vs. R5),

PAGE 202

202 CHAPTER 6 EFFECTS OF ALTERI NG THE RATIO OF DIETARY n 6 TO n 3 FATTY ACIDS ON SPONTANEOUS LUTEOLYSIS IN DAIRY COWS Objectives were to evaluate the effects of altering the ratio between omega 6 (n 6) to omega 3 (n 3) fatty acids (FA) in the diet of lactating Holstein cows on FA profil e and expression of genes related to the prostaglandin biosynthesis on endometrial tissue, uterine secretion of PGF , and timing of spontaneous luteolysis. Multiparous Holstein cows (n = 45) were blocked based on milk yield and, within each block, assigned randomly to 1 of 3 dietary treatments at 14 d postpartum for 90 d. Diets were supplemented with a mixture of Ca s alts of fish, safflower, and palm oils to create 3 different ratios of n 6 to n 3 FA, namely R4, R5, and R6 that resulted in 3. 9 , 4. 9 and 5. 9 parts of n 6 to 1 part of n 3 FA, respectively. Cows on d 15 of the estrous cycle had an indwelling catheter place d in the coccygeal vessel. From d 16 to 23 of the cycle, blood was sampled every 2 h and progesterone and the PGF metabolite 13,14 dihydro 15 keto PGF (PGFM) were assayed in plasma. In a subsequent estrous cycle, endometrial tissue was collected for biopsy on d 8, and endometrial FA profile and gene expression were quantified. The proportion of arachidonic acid o f the endometrial FA increased as the dietary ratio n 6 to n 3 FA increased ( R4 = 9. 0 5 , R5 = 1 1.64 , and R6 = 1 3.41% ). On the other hand, the proportion s of eicosapentaenoic ( R4 = 2. 85 , R5 = 2.14 , and R6 = 2.02 %) and docosahexaenoic (R4 = 3.30 , R5 = 1.57 , a nd R6 = 1.08 %) decreased as the ratio of n 6 to n 3 FA in the diet increased. Increasing the ratio of n 6 to n 3 FA increased the mRNA expression of oxytocin and estradiol receptors and steroidogenic acute regulatory protein in the endometrium. The number of PGFM pulses ( R4 = 5.6, R5 = 4.3, and R6 = 3.8 ± 0.6 pulses) decreased, but the amplitude of the greatest PGFM pulse increased ( R4 = 226, R5 = 267, and R6 = 369 ± 38 pg/mL) as the ratio increased from R4 to R6. Luteolysis by d 23 of the estrous cycle was observed in 79.6% of the cows (R4 = 11/14; R5 = 13/15; R6 = 11/15) and day of spontaneous luteolysis did not differ

PAGE 203

203 among treatments (R4 = 20.8; R5 = 21.1; R6 = 21.0 ± 0.4). Three pulses of PGFM was the best predictor of luteolysis in dairy cows. In concl usion, supplying the same quantity of FA in the diet of lacta ting dairy cows, but altering the ratio of n 6 to n 3 FA influenced the endometrial FA profile and gene expression, and altered the pattern of prostaglandin synthesis; however, the changes were n ot sufficient to alter the length of the estrous cycle. Cows required three pulses of PGF to undergo luteolysis . Introduction Supplemental fat is generally incorporated into dairy cattle rations to increase energy intake with attempts to reduce body fat mobilization and, when fed during transition period, to minimize the incidence of early lactation disorders (Damgaard et al., 2013). Altering the dietary FA intake has been shown to influence various reproductive measures in dairy cattle. Staples et al. (1998) reported that fat supplementation has advantageous effects on reproductive performa nce of dairy cows and the benefits of fat feeding goes beyond the increase in energy intake. In fact, some of the positive effects seem to be influenced by the type of FA fed (Santos et al., 2008). High intake of omega 6 (n 6) FA such as linoleic acid (C1 8:2 cis 9, cis 12) has the potential to alter the FA profile of the phospholipids of cell membranes resulting in increased proportion of arachidonic acid (C20:4 cis 5, cis 8, cis 11, cis 14), which in turn, might favor the synthesis of series 2 prostaglandin (PG) an d eicosanoids (Silvestre et al., 2011 a ), thereby favoring a more pro inflammatory state (Calder, 2012). On the other hand, high intake of omega 3 (n 3) FA, especially eicosapentaenoic acid (EPA; C20:5 cis 5, cis 8, cis 11, cis 14, cis 17) and docosahexaenoic acid ( DHA; C22:6 cis 5, cis 8, cis 11, cis 13, cis 16, cis 19), would increase the proportion of these FA in membrane phospholipids, which are expected to down regulate series 2 PG and eicosanoids (Mattos et al., 2004), thereby exerting anti inflammatory properties (Calder ,

PAGE 204

204 2012). It has been postulated that attenuation of PGF synthesis by feeding n 3 FA might be one of the mechanisms by which these FA benefit reproduction (Mattos and Thatcher, 2000; Santos et al., 2008). Silvestre et al. (2011 b ) reported improved pregnancy and decreased pregnancy loss for cows fed Ca salts e nriched with fish oil during the breeding period compared with cows fed Ca salts of palm oil, the latter composed of mostly saturated or monounsaturated FA. The fertility benefit with feeding n 3 FA was enhanced when cows were fed a Ca salt rich in n 6 FA during late gestation and early lactation (Silvestre et al., 2011 b ). These authors speculated that increasing dietary n 3 FA might influence luteal lifespan and increase the length of estrous cycle, which could allow less developed conceptuses to develop a nd establish the needed cross talk to inhibit uterine secretion PGF and luteolysis. In support of this concept, in vitro production of PGF by bovine endometrial cells was suppressed when the culture media was supplemented with n 3 FA (Mattos et al., 20 03). Indeed, when both n 6 and n 3 FA were present in the culture media, increasing the ratio n 6 to n 3 FA increased the synthesis of PGF (Caldari Torres et al., 2006). Similarly, cows on d 15 of the estrous cycle challenged with oxytocin had increased PGF release when fed diets with increased ratio of n 6 to n 3 FA (Mattos et al., 2002; Petit et al., 2004; Dirandeh et al., 2013). In controlled studies in humans, consumption of 2.7 g/d of n 3 FA extended gestation length (Olsen et al., 1991), presumabl y by altering the balance of stimulatory and inhibitory PG that influence uterine contractility and parturition. Nevertheless, it is unknown if altering the diet of cattle by supplementing either more n 6 or more n 3 FA is capable of influencing luteal lif espan that might have implications to fertility. The hypotheses of the study were that diets containing different ratios of n 6 to n 3 FA would alter the endometrial FA profile and the expression of genes involved in the luteolytic

PAGE 205

205 signaling, thereby affe cting the spontaneous pulsatile pattern of PGF release that could influence luteal lifespan and the length of the estrous cycle. Therefore the objectives were to determine the effects of altering the ratio of n 6 to n 3 FA in the diet of Holstein cows on the FA profile and expression of genes related to PG biosynthesis in the endometrial tissue and timing of spontaneous luteolysis . Materials and Methods The experiment was conducted at University of Florida Dairy Unit (Hague, FL) from December 2011 to July 2012. All procedures for animal handling and care were approved by the University of Florida Animal Care and Use Committee (ARC # 014 11ANS) . Study Design, Animals , Housing and Feeding Details referring to cows, facilities, chemical composition of ingre dients and the respective FA profiles were described elsewhere ( Chapter 5 ). Briefly, weekly cohorts of cows in their second (n = 23) or greater lactation (n = 22) were blocked by parity (2 vs. > 2) and milk yield from d 6 to 10 postpartum and, within each block, randomly assigned to 1 of 3 dietary treatments at 14 d postpartum (n = 15/treatment). The diet was offered as a TMR twice daily at 07:30 a.m. and 01:00 p.m. and the ratios of n 6 to n 3 FA were manipulated by altering the supplemental fat added to the diet. The first ratio was of 3.9 parts of n 6 to 1 part of n 3 FA in the diet (R4). The second ratio was of 4.9 parts of n 6 to 1 part of n 3 in the diet (R5). The final ratio was of 5.9 parts of n 6 to 1 part of n 3 in the diet (R6). All diets were is ocaloric and isonitrogenous and contained the same total FA concentration, and were formulated to minimize the difference in concentrations of total PUFA (Table 6 1). Calcium salts enriched in palm oil FA, safflower oil FA, or fish oil FA were used to mani pulate the concentration of n 6 and n 3 FA in the diets. These Ca salts were blended such that they represented 1.43% of the ration DM .

PAGE 206

206 Estrous Cycle Synchronization to Characterize Spontaneous Luteolysis E strous cycles were synchronized (Figure 6 1) star ting at 40 ± 3 DIM with an i.m. injection of 25 mg of PGF (dinoprost tromethamine; Lutalyse sterile solution, Zoetis, Florham Park, Zoetis) administered 2 d later, at 42 DIM. Seven days later, at 49 DIM, cows received a Gn RH injection and 12 h after the GnRH a controlled internal drug release (Eazi Breed CIDR; Zoetis) containing 1.38 g of progesterone. The CIDR was kept for 6.5 d, until 56 DIM. One hour after the CIDR removal, cows received an i.m. injection of PGF follow ed by another injection of PGF 24 h later. A GnRH injection was administered at 58 DIM to induce ovulation, and this day was considered day 0 of the estrous cycle, which was confirmed by ultrasonography based on disappearance of a pre ovulatory follicle within 48 h of treatment. Cows that did not ovulate to the final GnRH were re enrolled in the same protocol for synchronization of the estrous cycle . Progesterone Clearance After a n Injection of PGF At 56 DIM, 2 h after the CIDR removal (Figure 6 1), co ws received an injection of 25 mg of PGF and blood was sampled to evaluate progesterone clearance. A rectangle of approximately 15 x 5 cm, longitudinal to the mammary vein, i.e. caudal superficial epigastric vein, in both sides of the cow was shaved, cle aned and disinfected with 70% alcohol solution. Blood was withdrawn in an evacuated tubes containing K 2 EDTA (Vacutainer, Becton Dickinson, Franklin Lakes, NJ) at 0, 0.5, 1, 2, 4, 6, 12, and 24 h relative to PGF injection, alternating between the sides of the cow between samples. Samples were immediately placed on ice and within 30 min plasma was separated by centrifugation at 2,095 x g for 15 min and then stored at 20 o C for further analyses. Progesterone concentrations were analyzed by RIA using a commer cial kit (Coat a Count, Siemens Healthcare Diagnostics, Los Angeles, CA). The sensitivity of the assay was 0.1 ng/mL calculated at 2 SD below the mean counts per minute at

PAGE 207

207 maximum biding. Plasma samples containing moderate (1.6 ng/mL) or high (7.4 ng/mL) c oncentrations of progesterone were included throughout all assays and used to calculate the CV. The intra assay CV were 5.4 and 4.4%, and the inter assay CV were 6.6 and 5.3%, respectively, for the moderate and high concentration control samples . Pharmacol ogically Induced Luteolysis In order to characterize the pharmacologically induced luteolysis, two non lactating, non pregnant Holstein cows in mid diestrus bearing a functional CL were selected. An indwelling catheter was placed in the jugular vein 3 h be fore sampling started. Two blood samples were collected, at 30 min and immediately before cows had been given a 25 mg PGF i.m. (dinoprost tromethamine; Lutalyse sterile solution, Zoetis). Blood was then sampled at 5, 10, 15, 20, 25, 30, 40, 50, 60, 75, 9 0, 105, 120, 150, 180, 210, 240, 270, 3 00, 330, and 360 min relative to PGF injection. Samples continued to be collected at 2 h intervals until 24 h and then every 6 h until 48 h of the PGF injection. All blood samples collected were immediately placed in ice, plasma separated by centrifugation, 2,095 x g for 15 min, harvested and stored at 20 o C until analyses. Progesterone concentrations were measured as described above. Concentrations of the PGF metabolite 13,14 dihydro 15 keto PGF (PGFM) were qu antified by an enzyme immune assay as described by Ginther et al. (2010). The intra and inter assays CV were 9.1 and 10.6%, respectively . Spontaneous Luteolysis and Endogenous Release of PGF Based on PGFM On d 15 of the estrous cycle, when cows were app roximately 73 DIM (Figure 6 1), an indwelling catheter was placed in the tail vessel following technique described by Sears et al. (1978). Briefly, the ventral base of the tail was surgically cleaned with soap and disinfected with alcohol. The ventral vert ebral groove, where the coccygeal vessels lay, was manually identified and at approximately 5 cm from the base of the tail, the vessel was punctured with a thin wall 14

PAGE 208

208 G x 5 cm needle (Monoject, Mansfield, MA). A better access to the vessel was achieved w hen the angle between the tail and the needle was nearly 60 o . Once copious amount of blood started flowing through the needle, then approximately 30 cm of tubing (Polyethylene Tubing, sterile, PE90, 0.86 mm ID, 1.70 mm OD; Becton Dickinson, Franklin Lakes, NJ) was inserted in through the vessel, cranially. Then the needle was removed from the tail and a blunt cannula (18G x 2.5 cm; Monoject) was attached to a PRN 0.1 mL adapter (Becton Dickinson) connected to the extremity of the tubing to seal the tubing. The entire system was flushed with 10 mL of sterile heparinized saline solution (50 IU/mL, Sigma Aldrich, Saint Louis, MO). A cotton patch was wrapped around the tail, avoiding contact of the external part of the tubing and the skin of the animal, and the tubing was placed between two layers of cotton patch. An extra protection wrap with self adhesive plastic bandage (Sure Flexx, Stone Mfg. & Supply co. Inc., Kansa City, MO) was placed to prevent humidity and dirtiness. The bandage was stapled on to the ski n to avoid the wrapping falling and misplace the catheter. In order to protect against feces and urine the tail was dressed with a pair of handless sleeves, glued to the base of the tail. Finally a blood sample was taken to assure the catheter was working and then tubing was rinsed with 15 mL of the heparinized saline solution. Serial blood samplings, starting at 0600 h on d 16 of the estrous cycle, were collected every 2 h for 7 d, until d 23 of the cycle (Figure 6 1). Blood was withdrawn using a 12 mL sy ringe (Monoject), the first 20 mL of blood/saline was discarded, and 8 mL of blood was then collected and immediately transferred to an evacuated tube containing K 2 EDTA (Vacutainer, Becton Dickinson) homogenized, and placed in ice bath. Samples were centri fuged at 2,095 x g for 15 min, plasma was harvested and stored at 20 o C for further analyses. Progesterone and PGFM concentrations were measured following the procedures described above.

PAGE 209

209 Estrous Cycle Synchronization for Endometrial Tissue Collection for B iopsy On d 5 of a new estrous cycle, when cows were approximately 85 DIM, ovaries were scanned by ultrasonography for detection of a corpus luteum (CL) and measurements of the largest follicle. Cows with a visible CL received two i.m. injections of PGF 2 4 h apart, followed by a GnRH injection 2 d later (Figure 6 1). The GnRH injection was considered d 0 of the estrous cycle based on ovulation of a follicle confirmed by ultrasonography. Twelve hours after the GnRH injection, cows received a CIDR insert tha t was maintained until day 6 of the estrous cycle. Progesterone was supplemented through the use of CIDR during metestrus and early diestrus to increase the incorporation of FA in the endometrium, which would resemble late diestrus when luteolysis occurs ( Brinsfield and Hawk, 1973; Boshier et al., 1987). On d 8 of the estrous cycle, endometrial tissue was collected for biopsy from the ipsilateral uterine horn to the CL. Briefly, the cow was restrained in a chute and received an epidural block with 4 mL of lidocaine hydrochloride 2% solution (Lidocaine Hydrochloride Injection 2%, Agrilabs, St. Joseph, MO). The vulvar area was t horoughly cleaned with a 7.5% povidone iodine soap scrub (Povidone Iodine Scrub, First Priority, Inc, Elgin, IL) and rinsed with alc ohol. The vagina was inspected and cleansed with gauze pads embedded in diluted chlorhexidine solution (2% Chlorhexidine Gluconate, First Priority) to remove any manure or deposited mucus. The reproductive tract was transrectally palpated to locate the cer vix and the uterine horns. A sterilized endometrial forceps (Miltex Hi Light forceps 30 1485 Eppendorfer, Miltrex, York, PA) was introduced in closed position through the vagina and cervix and positioned midway through the horn ipsilateral to the CL. The f orceps was carefully placed in position to avoid any damage to the uterine wall. The forceps jaw was opened and, with the hand positioned in the rectum of the cow, the endometrium was pressed against the lower jaw and the handle closed to sample the tissue . The forceps was removed through the cervix and vagina and

PAGE 210

210 the tissue removed and placed on filter paper and rinsed with sterile PBS to remove any blood. The specimen was split in two, one placed in RNAse free tubes with RNA later solution and another in Tissue Tek CRYO OCT Compound (Fischer Scientific, Hampton, NH). Tubes were plunged in liquid N2 and transported to the laboratory and placed at 80 o C for later analyses. Endometrium Fatty Acid Profile and Gene Expression Endometrial tissue was analyzed at the Clinical and Translational Science Institute Biomedical Mass Spectrometry Core, University of Florida (Gainesville, FL). Briefly, the FA profile was quantified using an Agilent 5973 gas chromatograph mass spectrometer (Agilent, Framingham, TX), equi pped with a Trace TR 5MS column (30 m x 0.25 mm x 0.25 µm, Thermo sampler into the column. The oven temperature was set initially at 150 o C for 2 min, increased by 5 o C/min up to 320 o C, an d held for 8 min. The mass spectrometer was set to full scan, m/z 30 to 600, at 2.6 scan/sec. A second specimen of endometrial tissue was used to quantify gene expression. The total RNA was extracted using Trizol reagent (Sigma, St. Louis, MO) with the Pur eLink RNA Mini Kit (Invitrogen, Carlsbad, CA), according to instructions provided by the manufacturer. Following extraction, concentration and purity of isolated RNA were assessed using a NanoDrop 200 spectrophotometer (Thermo Scientific). DNase (Applied B iosystems, Foster City, CA) treatment was applied for 30 min at 37 o C to remove genomic DNA and subsequently heat denatured at 75 o C for 15 min. Total RNA (250 ng/reaction) was reverse transcribed to complementary DNA using the high capacity cDNA Reverse Tra nscriptase kit (Applied phosphate dehydrogenase ( GAPDH ) was chosen as the reference gene. The list of all genes and primers utilized are depicted in Table 6 2. Quantitative, reverse transc ription (qRT) PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems). The cycling conditions applied were:

PAGE 211

211 activation/denaturation (60 o C for 2 min; 95 o C for 10 min); 40 cycles of 2 steps amplification protocol (95 o C for 15 sec and 60 o C for 1 min) and dissociation (55 to 95 o C). Each PCR was performed in triplicate, and the specificity for amplification was verified by melting curve analysis. The abundances of the selected genes were calculated relative to GAPDH mRNA using the following formul a: 2 Ct(target gene) /2 Ct( GAPDH ) , where Ct is the cycle threshold, as described by Thompson et al. (2011). Calculations Spontaneous luteolysis was considered when progesterone concentration dropped below 1.0 ng/mL (Ginther et al. , 2007; Mann and Lamming, 2006). A pulse of PGFM was defined to when concentration in plasma was greater than the mean basal concentration plus 2 SD (Mann and Lamming, 2006). Basal PGFM concentration was calculated as the average of all PGFM values until a pulse was detected. Area under the curve of PGFM pulses was calculated following the formula described by Pruessner et al. (2003). In order to characterize spontaneous luteolysis, the events were retrospectively subdivided based on changes in concentrations of progesterone as pre luteolytic, luteolytic, and post luteolytic periods according to description by Ginther et al. (2007). Briefly, the luteolytic period was defined as the period of progressive decrease in progesterone concentration down to 1.0 ng/mL. The pre luteolytic per iod was considered the 24 h preceding the luteolytic period. The post luteolytic period was considered the 36 h after progesterone concentrations declined below 1.0 ng/mL (Ginther et al., 2007). The number of PGF pulses needed to elicit luteolysis was c alculated using the estimates of agreement among the number s of pulses of PGFM to predict CL regression. Sensitivity (Se), specificity (Sp), positive predictive value (PPV), negative predictive value (NPV), and accuracy were calculated. The Se of using num ber of pulses was expressed as number of cows with CL

PAGE 212

212 regression correctly detected with luteolysis by the respective number of pulses [(number of cows with luteolysis correctly detected as having luteolysis based on the respective number of PGFM pulses/nu mber of all cows with luteolysis) x 100]. The Sp was calculated as the proportion of cows without CL regression correctly identified as without luteolysis by the respective number of pulses [(number of cows without luteolysis correctly detected as not havi ng luteolysis based on the respective number of PGFM pulses/number of all cows without luteolysis) x 100]. The PPV was calculated as the proportion of cows correctly detected with CL regression of all cows detected with luteolysis [(number of cows with lut eolysis correctly detected as having luteolysis based on the respective number of PGFM pulses/number of cows detected as having luteolysis based on the respective number of PGFM pulses) x 100]. The NPV was calculated as the proportion of cows correctly det ected without CL relative to all cows detected with luteolysis by the respective number of pulses [(number of cows not having luteolysis correctly detected as not having luteolysis based on the respective number of PGFM pulses/total number of cows detected as not having luteolysis based on the respective number of PGFM pulses) x 100]. Accuracy was calculated as the proportion of correct outcomes [(number of correct detections of luteolysis based on the respective number of PGFM pulses/number of total tests performed) × 100]. Statistical Analysis Data were analyzed using the GLIMMIX procedure of SAS (SAS ver. 9.2, SAS Inst. Inc., Cary, NC) fitting either a normal or Poisson distributions according to the type of data. Tests for normality of residuals and homo geneity of variances were conducted for each dependent variable. Data with repeated measurements over time within the same experimental unit were analyzed with cow nested within treatment as a random effect for testing the effects of treatment. All models included the fixed effects of treatment, parity (2 or > 2), time, and all interaction

PAGE 213

213 between treatment, parity and time. The time reference for the models was hour or day relative to an event. Polynomial orthogonal contrasts were performed to determine li near or quadratic effects of altering the ratios of n 6 to n 3 FA in the diet. The covariance structure (compound symmetry, heterogeneous compound symmetry, autoregressive 1, heterogeneous autoregressive 1, toeplitz) that resulted in the lowest Akaike in formation criterion was selected as best fit for each model. For unequally spaced measurements, the spatial power covariance structure was used. When a single measurement was determined for each cow, then the model included the effects of treatment and par ity. Additional analyses of gene expression were performed using endometrial FA as the explanatory variable. The endometrial FA was categorized based on the observed proportion of n 6 to n 3 FA as low (mean = 4.45, range = 2.65 to 5.6), medium (mean = 8.81 , range = 8.12 to 9.91), or high (mean = 11.10, range = 10.06 to 14.27) ratio. The agreement between the number of PGF pulses needed to elicit CL regression with the proportion of cows undergoing or not luteolysis was calculated by kappa statistic in PROC FREQ of SAS. The kappa value and the respective 95% CI are depicted. 0.05 and tendency to differ when 0.05 < P . Results Detailed description of DM intake and lactation performance is presented elsewhere ( Chapter 5 ). The FA intake did not differ among treatments and averaged 953 ± 24 g/d. Increasing the ratio of n 6 t o n 3 FA in the diet increased ( P < 0.001) the intake of linoleic acid (R4 = 298.1, R5 = 329.5, and R6 = 369.4 g/d), but decreased ( P < 0.001) that of EPA and DHA combined (R4 = 21.3, R5 = 14.9, and R6 = 10.0 g/d).

PAGE 214

214 Concentrations of PGFM after PGF Inject ion Administration of 25 mg of PGF generated an enormous pulse of PGFM in plasma detected within 5 min after the injection (Figure 6 2). Concentrations of PGFM reached almost 4,000 pg/mL in one cow and over 6,000 pg/mL in the second cow. Both cows exper ienced CL regression and concentrations of progesterone dropped to less than 1.0 ng/mL within 24 and remained below 0.5 ng/mL at 48 h of PGF injection, when blood sampling stopped. No additional PGFM pulse was detected in cow 7432, whereas a second pulse was observed at 105 min of PGF injection was detected in cow 15891. Progesterone Clearance a fter PGF Injection After administration of PGF , the concentrations of progesterone in plasma decayed for the first 1 h, from 5.6 to 3.2 ng/mL, after which it increased to 4.2 ng/mL at 2 h and then declined to basal concentrations below 1 ng/mL by 24 h of PGF injection (Figure 6 3). The pattern of progesterone decline after administration of PGF did not differ with treatment. Luteolysis and Endogenous Re lease of PGFM One cow from R4 treatment was excluded from the statistical analyses because the estrous cycle was not synchronized. The remaining 44 cows had the estrous cycle synchronized and were included in all analyses. During late diestrus, progeste rone concentrations presented a pulsatile pattern that was observed in cows that underwent luteolysis as well as in cows that maintained the CL up to day 23 of the estrous cycle. A representative cow that underwent luteolysis and one that maintained by CL is depicted in Figure 6 4. In general, cows that underwent luteolysis had 2 pulses of PGFM during the pre luteolytic period, 2 pulses during the luteolytic period, and 1 post luteolytic pulse.

PAGE 215

215 The proportions of cows undergoing luteolysis by d 20 or 23 of the estrous cycle did not differ among treatments (Table 6 3). For cows undergoing luteolysis, the basal concentration of PGFM was similar among treatments and averaged 30.7 ± 3.8 pg/mL (Table 6 3). The total number of pulses of PGFM decreased ( P < 0.01) w ith increasing the ratio of n 6 to n 3 FA. Number of pre luteolytic and luteolytic pulses tended ( P < 0.10) to decrease with increasing the ratio from R4 to R6. The area under the curve of the PGFM pulses within the pre luteolytic, luteolytic or post luteo lytic periods did not differ among treatments (Table 6 3). However, increasing the ratio from R4 to R6 increased ( P = 0.05) the area under the curve of the greatest pulse of PGFM. During the pre luteolytic period, the greatest PGFM pulse was greater for co ws fed R4 than those fed R5 or R6 ( P < 0.05) (Figure 6 5A). The second greatest pulse of the pre luteolytic period did not differ among treatments. The luteolytic period was characterized by at least two major PGFM pulses in most cows and the greatest puls e was greater ( P < 0.05) for R6 than R5 or R4 (Figure 6 5B). The second greatest pulse of the luteolytic period had smaller amplitude and only minor differences were observed. During the post luteolytic period, cows had on average 1 pulse of PGFM, and the amplitude of the pulse was greater ( P < 0.05) for cows fed R6 than those fed R4 or R5 (Figure 6 5C). One cow underwent luteolysis with two PGFM pulses, however, the measures of reliability indicated that a minimum of three pulses of PGF were required to induce CL regression with highest accuracy and with the best kappa value (Table 6 4). For the 8 cows that did not undergo luteolysis by d 23, the basal PGFM averaged 36.0 ± 6.5 pg/mL and the number of pulses and the area under the curve for those pulses did not differ among treatments (Table 6 3).

PAGE 216

216 All individual cows had a progesterone profile with a pulsatile pattern as indicated for cows in Figure 6 4, but the average concentrations of progesterone showed an elevation immediately before the beginning o f the luteolytic period that was followed by a sharp decline to below 1.0 ng/mL in the next 36 h (Figure 6 6). Concentrations of progesterone did not differ among treatments during the pre luteolytic period. During the luteolytic period, concentrations of progesterone were greater ( P < 0.05) for cows fed R4 than R5 or R6, particularly between 8 and 24 h of the onset of luteolysis. During the post luteolytic period, concentrations remained below 1.0 ng/mL in all 36 cows that underwent luteolysis. Of the cows that underwent luteolysis, one R4, one R5, and four R6 had progesterone concentrations during the post luteolytic phase that did not drop below 0.3 ng/mL. The remaining 30 cows with regressed CL had progesterone concentrations that remained below 0.3 ng/m L during the post luteolytic period. Endometrium Fatty Acid Profile and Gene Expression Altering the ratio of n 6 to n 3 FA in the diet resulted in changes in the FA profile of the endometrium of lactating dairy cows (Table 6 5). The concentrations of pal mitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), eicosadienoic acid (C20:2 cis 11, cis 14), dihomo gamma linolenic acid (C20:3 cis 8, cis 11, cis 14) did not differ among treatments. The proportion of heptadecaenoic acid (C17:0) was greater ( P = 0.02) in the endometrium of cows fed R4 than R5 or R6. Although cows fed R6 consumed an additional 71 g of linoleic acid daily compared with cows fed R4, the proportion of linoleic acid was not altered by treatments and averaged 13.5% of the total endometrial F A. However, the concentration of arachidonic acid, a product of desaturation and elongation of linoleic acid, in the endometrial tissue increased ( P < 0.01) as the ratio of dietary n 6 to n 3 FA increased. On the other hand, the concentrations of EPA and D HA decreased linearly ( P < 0.01) as the ratio of dietary n 6 to n 3 FA increased. The proportions of

PAGE 217

217 total n 6 and n 3 FA in the endometrium were affected ( P < 0.01) by dietary treatments and they followed opposite directions as the ratio of dietary n 6 to n 3 FA in the ration increased. Because of such changes in FA composition of endometrial lipids, the ratio of n 6 to n 3 FA in the endometrium increased ( P < 0.01) from 4.53 to 9.85 as the dietary ratio increased from R4 to R6. Altering the ratio of n 6 to n 3 FA on the diet of lactating dairy cows influenced the expression of genes associated with luteolytic cascade in the endometrium (Figure 6 7A). Increasing the dietary ratio of n 6 to n 3 FA resulted in a linear increase in the mRNA abundance of estr ogen receptor ( ESR1 ; P < 0.01), oxytocin receptor ( OTR ; P < 0.01), cycloo xygenase 2 ( COX2 ; P = 0.08), PGF synthase ( PGFS ; P < 0.05), PG E synthase ( PGES ; P = 0.09) genes, and steroidogenic acute regulatory protein ( STAR ; P = 0.04). Treatment did not influen ce the expression of phospholipase C ( PLC ), COX1 , and PG E2 9 reductase ( 9 KPR ) genes in the endometrium. Expression of genes involved in lipid metabolism such as and peroxisome proliferator activated receptors ( PPAR ) remained unaltered by treatment (Figu re 6 7B). Similarly, dietary treatment did not affect mRNA abundance of genes of the somatotropic axis (Figure 6 7C). Cows were grouped according to the FA composition of the endometrium as having a low (mean = 4.45, range = 2.65 to 5.6), medium (mean = 8.81, range = 8.12 to 9.91), or high ratio (mean = 11.10, range = 10.06 to 14.27) of n 6 to n 3 FA. As the endometrial FA ratio increased, so did the expression of ESR1 ( P < 0.01), OTR ( P = 0.02) PGFS ( P = 0.02), and PGES ( P = 0.06) (Figure 6 8). In fact, linear positive relationships were observed between the expression of these four selected genes and the ratio of n 6 to n 3 FA in the endometrium of dairy cows (Figure 6 9).

PAGE 218

218 Discussion Prostaglandins are local mediators produced by many tissues, particular ly the uterus, and they play critical roles in female reproduction. One of the key roles of PG is the control of luteal lifespan and, in particular, PGF is known to be the molecule responsible for luteolysis in ruminants (McCracken et al., 1972). The precursor of uterine PGF is arachidonic acid, which is present in the endometrial phospholipids and is formed from elongation and desaturation of linolei c acid (Leonard et al., 2004). After exposure to progesterone during diestrus, the endometrium accumulates arachidonic acid (Brinsfield and Hawk, 1973), which serves as precursors of either PGF or PGE2. Studies in vitro have shown that production of PGF 2 by bovine endometrial cells was suppressed when the culture media was supplemented with n 3 FA (Mattos et al., 2003). In fact, when both n 6 and n 3 FA were present in the culture media, increasing the ratio n 6 to n 3 FA resulted in increased synthesis of PGF (Caldari Torres et al., 2006). Furthermore, in vivo studies showed that diets with increased n 3 FA suppressed the release of PGF after an oxytocin challenge (Mattos et al., 2002; Petit et al., 2004; Dirandeh et al., 2013). These studies led to the concept that altering the FA profile of the diet might influence endometrial PG release and, feeding more n 3 FA might attenuate the luteolytic signals and favor the maintenance of the CL. However, in spite of the increase in n 3 FA in endometrium of c ows fed R4, the length of the luteal phase and the day of CL regression was not altered in the current study. Silvestre et al. (2011 b ) reported improved pregnancy and reduced pregnancy loss for cows fed Ca salts enriched in EPA and DHA during the breeding period. The authors and others (Abayasekara and Wathes, 1999; Santos et al., 2008) have speculated that one of the mechanisms by which n 3 FA improve fertility in dairy cows is likely by attenuating PG production, thereby having protective effects on CL ma intenance. Although cows fed R4, which consumed more n 3

PAGE 219

219 FA, primarily EPA and DHA, had some attenuation of the largest pulse of PGF , they also had more total pulses because of an increase in number of pulses during the luteolytic period. Feeding n 3 FA from fish (Mattos et al., 2002) or plant sources (Dirandeh et al., 2013) decreased the uterine synthesis of PGF after a challenge with oxytocin, suggesting that these FA have the ability to attenuate a large pulsatile release of PG. On the other hand, the increased number of pulses in cows fed R4 could be interpreted as favoring luteolysis (Schramm et al., 1983). In sheep, approximat ely 5 pulses of PGF in a 25 h period were required to induce complete luteolysis (Schramm et al., 1983). The number of PGFM pulses has been characterized in heifers and they typically have 2.4, 2.3, and 2.2 pulses during the pre luteolytic, luteolytic and post luteolytic p eriods (Ginther et al., 2010). These values are similar to those observed for lactating dairy cows in the current study. The average number of pulses varied with diet but, in general, cows undergoing luteolysis had 2.0 pre luteolytic PGFM pulses, 2.4 pulse s during the luteolytic period, and 1.1 post luteolytic pulse. For cows to undergo luteolysis, a minimum of 3 pulses of PGF were needed for progesterone to decay below 1.0 ng/mL. Six of the thirty six cows that had CL regression kept progesterone concentrations between 0.4 and 0.7 ng/mL during the post luteolytic period. The reasons for these relatively high concentrations o f progesterone after luteolysis are either lack of complete CL regression, in which a portion of the luteal cells remain active, or simply late luteolysis, with not enough time for the death of the CL to result in concentrations of progesterone to dro p below 0.3 ng/mL within the 23 d sampling period. Cows receiving different doses of PGF on d 5 of the estrous cycle had, in some cases, incomplete luteal regression with a decline followed by a rebound in progesterone concentrations (Nascimento et al., 2014; Chenault et al., 1976). To our knowledge, the same phenomenon has not been charact erized in

PAGE 220

220 late diestrus with cows undergoing spontaneous luteolysis. Incomplete CL regression after a standard dose of PGF treatment on d 5 is expected because many of the luteal cells remain unresponsive to the cell death signaling induced by PGF in a more mature CL. There is substantial variability in the frequency and amplitude of PGF pulses that induce spontaneous luteolysis in heifers, but typically there are 4 to 8 discrete pulses that occur at intervals of 6 to 12 h (Kindahl et al., 1976; Silvi a et al., 1991). Kindahl et al. (1976) characterized 4 distinct PGF pulses that occurred within a period of approximately 30 h for luteolysis to occur in heifers. We observed one lactating cow with only two pulses of PGF that had complete CL regres sion; however, results from the current study suggest that a minimum of 3 PGF pulses are required for the CL to regress based on the measures of reliability of using PGF pulses as a predictor of luteolysis. Infusion of low doses of PGF to mimic the pulses observed during luteolysis depicts a similar pattern of PGFM pulses and subsequent CL regression in heifers as those observed during spontaneous luteolysis (Ginther et al., 2009). Similar to findings observed by Ginther et al. (2007) in heifers , cows showed an initial increase in circulating concentrations of progesterone before a sharp decrease during the pre luteolytic period. Ginther et al. (2007) observed that progesterone concentrations and blood flow to the CL increased and then decreased during the process of spontaneous luteolysis. A similar phenomenon was characterized in heifers induced to have luteolysis with infusion of low doses of PGF to mimic the pulses observed during spontaneous luteolysis (Ginther et al., 2009). When exogen ous PGF was administered to lactating cows in the present study functional luteolysis occurred within 24 h and progesterone concentrations dropped below 1.0 ng/mL. Burke et al. (1997) found that at 48 h after a PGF injection a greater proportion of cow s

PAGE 221

221 fed a diet enriched with n 3 FA from fish meal had progesterone concentrations in plasma above 1.0 ng/mL suggesting a protective effect of the n 3 FA on the CL. Based on studies in vitro and work with exogenous administration of oxytocin and estradiol to induce pulses of PGF (Mattos et al., 2000; 2003), one could expect that an n 6 FA enriched diet would favor luteolysis and an n 3 enriched diet would possess anti luteolytic properties. However, results from the present study in which the dietary ratio of n 6 to n 3 FA was altered suggest that the changes implemented, within the ranges of n 3 FA consumed by these cows, were not sufficient to exert any protective effects on the CL against an exogenous PGF injection. The pulse of PGFM observed with a luteo lytic dose of PGF was massive in both non lactating cows evaluated, reaching concentrations that were 10 to 15 fold those observed in the typical spontaneous PGFM pulse during the luteolytic period for lactating cows fed altered n 6 to n 3 ratios. Also, the duration of th e concentration of PGFM above the thresholds observed for the peak of PGFM pulse in cows undergoing luteolysis was long, lasting several hours (e.g., 8 h), either because the release and absorption of dinoprost from the site of injection was slow or becaus e the half life of PGFM is longer than the short half life typically described for PGF . Altering the dietary ratio of n 6 to n 3 FA did not affect the concentrations of progesterone. All treatments were designed to have the same FA concentration, and dif ferences in PUFA concentrations were small among diets. Therefore, differences in progesterone concentrations typically observed with addition of dietary fat (Staples et al., 1998; Santos et al., 2008) or changes in progesterone clearance (Hawkins et al., 1995) were not anticipated. In fact, the clearance of progesterone after luteolysis was induced did not change among treatments. Interestingly, progesterone concentrations of lactating dairy cows in the present study presented a pulsatile fashion. Ginther et al. (201 1 ) showed a concurrent and coordinated pulse of LH that

PAGE 222

222 preceded the pulses of progesterone during the pre luteolytic period in dairy heifers. Although LH was not quantified in plasma samples in the current study, it is reasonable to suggest th at a similar phenomenon also occur in lactating dairy cows (Procknor et al., 1986) . The FA profile of the endometrial tissue resembled that of the dietary FA offered to cows. In fact, the FA profile of endometrial phospholipids is influenced by the FA dige sted and absorbed from the diet (Bilby et al., 2006 b ). Increasing the ratio of n 6 to n 3 FA, with concurrent increased intake of linoleic acid resulted in a greater proportion of arachidonic acid in the endometrium. Arachidonic acid is the most biological ly active n 6 FA and can be synthetized by elongation and desaturation of linoleic acid (Abayasekara and Wathes, 1999; Leonard et al., 2004). Likewise, increasing the intake of EPA, by decreasing the ratio of n 6 to n 3 FA in the diet granted greater propo rtion of EPA in the endometrium. Concentrations of EPA and DHA were greater in the caruncular tissue when cows were supplemented with 200 g/d of fish oil, starting at 21 d prepartum, compared with cows supplemented with olive oil (Mattos et al., 2004). Fur thermore, cows supplemented with fish oil had greater concentrations of EPA and DHA on the endometrium on d 17 of the estrous cycle (Bilby et al., 2006 b ; Childs et al., 2008). Therefore, results from the current study corroborates with data in the literatu re suggesting that dietary manipulation of the FA profile affects the FA composition of the uterine tissues. Furthermore, these changes on the FA profile of the endometrium might lead to changes in gene expression. In late diestrus, progesterone downregula tes its own receptors in the superficial epithelium, leading to a loss in ability to inhibit the expression of estradiol and oxytocin receptors in the endometrium (Silvia et al., 1991). The oxytocin produced by the CL and the posterior pituitary (Gimpl and Fahrenholz, 2001) initiates the luteolytic cascade by activating endometrial phospholipases to release arachidonic acid from the membrane phospholipids

PAGE 223

223 (Mattos et al. , 2000). As a result arachidonic acid is available for the synthesis of PGF and other P G (Mattos et al. , 2000). In the current study, cows fed more R6 had greater expression of estradiol and oxytocin receptors, which could be interpreted as favoring the luteolytic process by enriching the endometrium with increased concentration of linoleic and arachidonic acids. Waters et al. (2012), demonstrated that on d 17 of the estrous cycle the estradiol receptor was down regulated in the endometrium of cows with high n 3 FA, compared with controls. Therefore, it is possible that changes in the pulsati le pattern of PGFM observed in the current study under spontaneous luteolysis, and that of cows induced to have PGF pulses after treatment with estradiol and oxytocin, is influenced not only by the availability of FA precursors for PG, but also by change s in the gene signaling that favors PG synthesis (i.e., R6 > R4). Also, steroidogenic acute regulatory protein is a rate limiting enzyme responsible for the transport of cholesterol within the mitochondria for steroid synthesis (Manna et al., 2009). Severa l transcription factors are involved in the regulation of STAR (Manna et al., 2009), and arachidonic acid is involved in one of the signaling pathways which up regulates the expression and protein translation of the STAR enzyme (Stocco et al., 2005). Consi stent with these findings, cows in the current study that were fed R6 had greater concentrations of arachidonic acid in the endometrium and increased abundance of STAR mRNA. Furthermore, a positive relationship was observed between mRNA expressions of PGF and PGE synthases and estradiol and oxytocin receptors with increased ratio of n 6 to n 3 FA in the endometrium. Conclusion Altering the ratio of n 6 to n 3 FA in the diet of lactating dairy cows influenced the pattern of prostaglandin synthesis. Increasi ng the ratio of n 6 to n 3 FA increased the amplitude but decreased the frequency of PGFM pulses. Furthermore, in the endometrium, the concentration of arachidonic acid was increased and EPA and DHA was decreased, and mRNA

PAGE 224

224 expression of oxytocin and estrad iol receptors and STAR was increased by increasing the ratio of n 6 to n 3 FA from R4 to R6. In spite of all these changes the length of the estrous cycle was not altered. Three pulses of PGFM was the best predictor of luteolysis in dairy cows .

PAGE 225

225 Table 6 1. Dietary ingredients and nutrient composition of diets 1 R4 R5 R6 Ingredients, % of DM Corn silage 18.7 18.7 18.7 Bermuda silage 9.0 9.0 9.0 Alfalfa hay 6.1 6.1 6.1 Corn grain, finely ground 13.8 13.8 13.8 Citrus pulp 10.1 10.1 10.1 Soybean hul ls 20.3 20.3 20.3 Soybean meal, solvent extract 10.1 10.1 10.1 Soybean meal, cooker processing 2 5.7 5.7 5.7 Molasses 1.6 1.6 1.6 Vitamin mineral protein premix 3 3.0 3.0 3.0 Ca salts of palm oil 4 0.73 0.65 0.53 Ca salts of safflower oil 5 0 0.37 0.70 Ca salts of fish oil 6 0.70 0.41 0.20 Nutrients, DM basis (± SD) NE L , 7 Mcal/kg 1.62 1.62 1.62 CP, % 16.6 ± 0.8 16.6 ± 0.8 16.5 ± 0.8 Starch, % 17.3 17.3 17.3 Non fibrous carbohydrates, 8 % 35.4 ± 1.9 35.4 ± 2.0 35.5 ± 1.9 ADF, % 16.0 ± 0.9 15.9 ± 0.9 1 5.6 ± 0.9 NDF, % 38.4 ± 2.3 38.4 ± 2.3 38.1 ± 2.3 NDF from forage, % 17.1 ± 0.7 17.1 ± 0.7 17.1 ± 0.7 Total f atty acids, % 3.66 ± 0.15 3.82 ± 0.17 3.88 ± 0.16 Total n 6 fatty acids, % 1.2 6 0 ± 0.10 1. 447 ± 0.08 1.5 8 7 ± 0.08 Total n 3 fatty acids, % 0.3 27 ± 0.01 0.298 ± 0.01 0.269 ± 0.01 Ratio of n 6 to n 3 3. 9 4. 9 5. 9 Ca, % 0.87 ± 0.07 0.89 ± 0.07 0.90 ± 0.08 P, % 0.33 ± 0.03 0.33 ± 0.03 0.33 ± 0.03 Mg, % 0.31 ± 0.02 0.31 ± 0.02 0.31 ± 0.02 K, % 1.48 ± 0.05 1.48 ± 0.05 1.48 ± 0.05 Cl, % 0.29 ± 0.0 3 0.28 ± 0.03 0.29 ± 0.03 Na, % 0.32 ± 0.01 0.32 ± 0.01 0.32 ± 0.01 1 Treatments represent the ratio between n 6 to n 3 FA in the diet. R 4 is a ratio of 3.9 parts of n 6 to 1 part of n 3; R 5 is a ratio of 4.9 parts of n 6 to 1 part of n 3; R 6 is a rat io of 5.9 parts of n 6 to 1 part of n 3. 2 AminoPlus (Ag Processing Inc., Omaha, NE). 3 Contains (DM basis) 30.0% ProvAAl LysAAMet (blend of blood meal and protected lysine and methionine, Venture Milling, Salisbury, MD), 28.5% sodium sesquicarbonate, 13.0 % potassium carbonate, 7.0% dicalcium phosphate, 7.0% magnesium oxide, 3.5% sodium chloride, 1.2% Availa 4 (Zinpro Co., Eden Prairie, MN), 0.3% Sel Plex 2000 (Alltech Biotechnology, Nicholasville, KY), 0.06% vitamin trace mineral premix, and 0.22% Rumensin 90 (Elanco Animal Health, Greenfield, IN). Each kg contains 27.8% CP, 5.2% Ca, 1.6% P, 4.1% Mg, 6.8% K, 10.7% Na, 2.3% Cl, 680 mg Zn, 235 mg Cu, 422 mg Mn, 6.6 mg Se, 23 mg Co, 13.8 mg I, 116,000 IU vitamin A, 35,000 IU vitamin D, 1,170 IU vitamin E, and 450 mg of monensin.

PAGE 226

226 4 EnerGII, Ca salts of palm oil FA (Virtus Nutrition, Corcoran, CA). 5 Prequel21, Ca salts enriched in safflower oil FA (Virtus Nutrition, Corcoran, CA). 6 StrataG113, Ca salts enriched in fish oil FA (Virtus Nutrition, Corcoran, CA). 7 NE L according to NRC (2001) using analyzed feed values and calculated at 24 kg of DMI/d. 8 C alculated as: 100 (NDF + CP + FA + Ash).

PAGE 227

227 Table 6 2. List of genes and primers used on real time PCR analysis Gene 1 Primer Accession number Reference ES R1 F: ACTGGGGAGGCAGAGAATTT AY538775.1 Waters et al. ( 2012 ) R: GGCAGAATTCGGCTAGAGTG OTR F: GCACCTGAGCATAGCCGACC NM_174134.2 Lima (2013) R: GTGGCAAGGACGATGACGGG PLC F: AGGTTTCCATGTGGCTGAAG L13937 Coyne et al. ( 2008 ) R: TCACAAATTCAATGGCG TGT COX1 F:TCATGGTCTACGCCACGATA AF004943 Coyne et al. ( 2008 ) R: TCAGCTGCTGCACATACTCC COX2 F: CCAGAGCTCTTCCTCCTGTG AF004944 Coyne et al. ( 2008 ) R: GGCAAAGAATGCAAACATCA PGES F: ATCGTGACGGTCCGTCTCTAA NM_174443.2 Lima (2013) R: GC CCTTTGAGATTGTGACAGG P GFS F: TGTGGTGCACGTATCACGACA NM_001035367 Lima (2013) R: AATCACGTTGCCGTCCTCATC 9 KPR F: GATGGCCACTTCATTCCTGT XM_865970 Coyne et al. ( 2008 ) R: GCCTGACCAACTTGCTCTTC STAR F: CCCATGGAGAGGCTTTATGA NM_174189.2 Nis himura et al. ( 2006 ) R: TGATGACCGTGTCTTTTCCA F: TTGTGGCTGCTATCATTTGC NM_001034036 Coyne et al. ( 2008 ) R: AGAGGAAGACGTCGTCAGGA F: CACTCTCACTGCTGGACCAA NM_001034036 Coyne et al. ( 2008 ) R: GCAGATCCGCTCACATTTCT F : GTGAAGCCCATTGAGGACAT NM_181024 Coyne et al. ( 2008 ) R: AGCTGCACGTGTTCTGTCAC GHR1A F:CCAGCCTCTGTTTCAGGAGTGT AY748827.1 Coyne et al. ( 20 11) R: TGCCACTGCCAAGGTCAAC IGF 1 F: ATGCCCAAGGCTCAGAAG NM_001077828.1 Coyne et al. ( 20 11) R: GGTGGCA TGTCATTCTTCACT

PAGE 228

228 Table 6 2. Continued. Gene 1 Primer Accession number Reference IGFBP3 F: ACAGACACCCAGAACTTCTCCTC NM_174556.1 Coyne et al. ( 20 11) R: GTTCAGGAACTTGAGGTGGTTC GAPDH F: ACCCAGAAGACTGTGGATGG NM_001034034.1 Thompson et al. ( 2011 ) R: CAACAGACACGTTGGGAGTG 1 ESR1 = e strogen receptor 1 ; OTR = o xytocin receptor; PLC = p hospholipase C; COX = c yclooxygenase; PGES = p rostaglandin E synthase; PGFS = p rostaglandin F synthase; 9 KPR = p rostaglandin E2 9 ketoreductase; STAR = s teroidogenic ac ute regulatory protein; PPAR = p eroxisome proliferator activated receptor; IGF 1 = i nsulin like growth factor 1 ; IGFBP3 = i nsulin like growth factor binding protein 3; GHR1A = growth hormone receptor 1A; GAPDH = g lycerald ehyde 3 phosphate dehydrogenase.

PAGE 229

229 Ta ble 6 3. Effect of altering the ratio of dietary n 6 to n 3 fatty acids on timing of luteolysis and PGFM concentrations and pulses of lactating Holstein cows 1 R4 R5 R6 SEM 2 TRT 2 Linear 2 Quad 2 Luteolysis, % (n/n) By day 20 42.9 (6/14) 26.7 (4/15) 46.7 (7/15) --0.50 0.85 0.26 By day 23 78.6 (11/14) 86.7 (13/15) 80.0 (12/15) --0.83 0.93 0.56 Beginning of luteolysis, d 18.9 19.8 19.4 0.4 0.32 0.39 0.21 End of luteolysis, d 20.5 20.8 20.7 0.5 0.91 0.84 0.70 Duration of the luteolytic period, h 39.3 23.4 29.5 3.6 0.01 0.07 0.01 PGFM cows undergoing luteolysis Basal, pg/mL 28.7 34.5 29.0 3.8 0.53 0.96 0.26 Pulses, n Total 6.7 4.9 4.6 0.5 0.02 <0.01 0.24 Pre luteolytic period 2.4 2.3 1.4 0.4 0.17 0.10 0.40 Luteolytic period 3.0 1.9 2.3 0.3 0.04 0.09 0.06 Post luteolytic period 1.5 0.7 0.9 0.3 0.11 0.16 0.11 Area under the curve, pg/h per mL Total 3 , 514 3 , 501 4 , 175 623 0.60 0.57 0.42 Pre luteolytic period 1 , 118 1 , 6 78 752 390 0.4 5 0.22 0. 7 8 Luteolytic period 1 , 7 94 1 , 5 9 7 2 , 386 366 0.2 5 0. 30 0.21 Post luteolytic period 880 954 1 , 616 418 0.40 0.22 0.58 Greatest pulse 793 981 2 , 060 368 0.12 0.05 0.62 PGFM cows with no luteolysis Basal, pg/mL 34.6 34.2 39.2 6.5 0.83 0.62 0.76 Pre luteolytic pulses, n 1.7 0.5 0.7 0.7 0.45 0.31 0.48 Total a rea under the curve, pg/h per mL 1 , 572 567 1312 797 0.77 0.84 0.57 1 R4 = ratio of 4 to 1 of n 6 to n 3 FA; R5 = ratio of 5 to 1 of n 6 to n 3 FA; R6 = ratio of 6 to 1 of n 6 to n 3 FA. 2 SEM = Standard error of the mean; TRT = effect of treatment; Linear = linear effect of altering the ratio of n 6 to n 3 FA; Quad = quadratic effect of altering the ratio of n 6 to n 3 FA.

PAGE 230

230 Table 6 4. Measures of reliability of number of 13,14 dihydro 15 keto PGF (PGFM) pulses to elicit l uteal regression Number of PGFM p ulses Measures of reliability 1 > 0 > 1 > 2 > 3 > 4 Sensitivity 100 (36/36) 100 (36/36) 97.2 (35/36) 77.8 (28/36) 61.1 (22/36) Specificity 37.5 (3/8) 75.0 (6/8) 87.5 (7/8) 100 (8/8) 100 (8/8) Positive predictive value 8 7.8 (36/41) 94.7 (36/38) 97.2 (35/36) 100 (28/28) 100 (22/22) Negative predictive value 100 (3/3) 100 (6/6) 87.5 (7/8) 50.0 (8/16) 36.4 (8/22) Accuracy 88.6 (39/44) 95.5 (42/44) 95.5 (42/44) 81.8 (36/44) 68.2 (30/44) Kappa (95% CI) 49.5 (13.6 85.5) 83.1 (60.5 100) 84.7 (64.1 100) 56.0 (31.2 80.8) 36.4 (15.1 57.6) 1 Sensitivity = (number of cows with luteolysis correctly detected as having luteolysis based on the respective number of PGFM pulses/number of all cows with luteolysis) x 100; Specificity = (n umber of cows without luteolysis correctly detected as not having luteolysis based on the respective number of PGFM pulses/number of all cows without luteolysis) x 100; Positive predictive va lue = (number of cows with luteolysis correctly detected as havin g luteolysis based on the respective number of PGFM pulses/number of cows detected as having luteolysis based on the respective number of PGFM pulses) x 100; Negative predictive value = (number of co ws not having luteolysis correctly detected as not having luteolysis based on the respective number of PGFM pulses/total number of cows detected as not having luteolysis based on the respective number of PGFM pulses) x 100; Accuracy = (number of correct detecti ons of luteolysis based on the respective number of PGFM pulses/number of total tests performed) × 100.

PAGE 231

231 Table 6 5 . Effect of altering the ratio of dietary n 6 to n 3 fatty acids on endometrium fatty acid profile of lactating Holstein cows on day 8 of the estrous cycle 1 R4 R5 R6 TRT 2 Linear 2 Quad 2 % of identified FA C16:0 27.70 ± 0.80 27.88 ± 0.53 27.20 ± 0.46 0.62 0.59 0.55 C17:0 1.43 ± 0.07 1.16 ± 0.05 1.19 ± 0.04 0.02 0.01 0.03 C18:0 27.60 ± 1.61 25.19 ± 1.08 24.84 ± 0.93 0.34 0.15 0.48 C18:1 cis9 12.18 ± 1.37 13. 77 ± 0.91 12.55 ± 0.79 0.51 0.81 0.26 C18:2 cis9 , cis12 12.40 ± 1.40 13.50 ± 0.93 14.44 ± 0.81 0.43 0.22 0.95 C20:2 cis11 , cis14 0.80 ± 0.14 0.67 ± 0.09 0.71 ± 0.08 0.73 0.58 0.49 C20:3 cis8 , cis11, cis14 1.33 ± 0.15 1.30 ± 0.10 1.33 ± 0.09 0.97 0.96 0.83 C20:4 cis7 , cis1 0, cis13, cis16 9.05 ± 0.94 11.64 ± 0.63 13.41 ± 0.54 <0.01 <0.01 0.62 C20:5 cis5 , cis8, cis11, cis14, cis17 2.85 ± 0.21 2.14 ± 0.14 2.02 ± 0.12 <0.01 <0.01 0.12 C22:6 cis4 , cis7 , cis10, cis13, cis16, cis19 3.30 ± 0.53 1.57 ± 0.35 1.08 ± 0.31 <0.01 < 0.01 0.20 Total n 6 23.55 ± 2.05 27.16 ± 1.36 29.89 ± 1.18 0.04 0.01 0.81 Total n 3 6.15 ± 0.62 3.72 ± 0.41 3.08 ± 0.36 <0.01 <0.01 0.12 n 6 to n 3 ratio 4.53 ± 1.12 7.99 ± 0.75 9.85 ± 0.65 <0.01 <0.01 0.43 1 R4 = ratio of 4 to 1 of n 6 to n 3 FA; R 5 = ratio of 5 to 1 of n 6 to n 3 FA; R6 = ratio of 6 to 1 of n 6 to n 3 FA. 2 TRT = effect of treatment; Linear = linear effect of altering the ratio of n 6 to n 3 FA; Quad = quadratic effect of alteri ng the ratio of n 6 to n 3 FA.

PAGE 232

232 Figure 6 1. Diag ram of estrous cycle synchronization and blood sampling. Biopsy = endometrial tissue collected for biopsy. BS = blood sampling; CIDR = controlled internal drug release containing 1.38 g of progesterone; DIM = days in milk; GnRH = f gonadorelin; PGF = i.m. injection of 25 mg PGF ; US = ultrasonography of the ovaries .

PAGE 233

233 Figure 6 2. Concentrations of p rogesterone and 13,14,dihydro 15 keto PGF metabolite (PGFM) in plasma of non lactating, non pregnant Holsteins cows bearing a functional corpus luteum, before and after an i.m. injection of 25 mg dinoprost as tromethamine salt .

PAGE 234

234 Figure 6 3. Progesterone concentrations in plasma of lactating Holstein cows fed 3.9 to 1 (R4), 4. 9 to 1 (R5), and 5.9 to 1 (R6) ratio of n 6 to n 3 FA in the diet, after an i.m. injection of 25 mg PGF . Effect of treatment ( P = 0.83), time ( P < 0.001), and interaction between treatment and time ( P = 0.99). Linear ( P = 0.72) and quadratic ( P = 0.61) effects of increasing the ratio of n 6 to n 3 FA in the diet. Mean progesterone concentrations during th e sampling period were 2.80 ± 0.41, 3.15 ± 0.40, and 3.01 ± 0.39 ng/mL, respectively, for cows receiving the R4, R5 and R6 diets.

PAGE 235

235 Figure 6 4. Progesterone and 13,14,dihydro 15 keto PGF metabolite (PGFM) in plasma from d 16 to 23 of the estrous cyc le of a representative cow that underwent luteolysis (#7 389 ) and a cow that maintained the corpus luteum by day 23 (#7381 ) .

PAGE 236

236 Figure 6 5. Concentrations of 13,14,dihydro 15 keto PGF metabolite (PGFM) in plasma of lactating Holstein cows fed 3. 9 to 1 (R4), 4. 9 to 1 (R5), and 5. 9 to 1 (R6) ratio of n 6 to n 3 FA in the diet during the pre luteolytic (A) , luteolytic (B) , and post luteolytic

PAGE 237

23 7 (C) periods. Within an hour, pairwise differences ( P < 0.05) are represented as follow: $ , R4 vs. R5; R4 vs. R6; or R5 vs. R6; and tendencies ( P < 0.10) are represented as: * , R4 vs. R5, ¶ R4 vs. R6; or R5 vs. R6 .

PAGE 238

238 F igure 6 6. Concentrations of progesterone in plasma of lactating Holstein cows fed 3.9 to 1 (R4), 4.9 to 1 (R5), and 5. 9 to 1 (R6) ratio of n 6 to n 3 FA in the diet during the pre luteolytic, luteolytic , and post luteolytic periods. Within an hour, pairwise differences ( P < 0.05) among treatments are represented as: * P < 0.05; ¶ P < 0.10 .

PAGE 239

239 Figure 6 7. Expression of genes related to prosta glandin synthesis (A; ESR1 = estrogen receptor 1; OTR = oxytocin receptor; PLC = phospholipase C; COX = cyclooxygenase; PGFS = prostaglandin F synthase; PGES = prostaglandin E synthase; 9 KPR = prostaglandin E2 9 ketoreductase); cholesterol and fatty acid m etabolism (B; STAR = steroidogenic acute regulatory protein; PPAR = peroxisome proliferator activated receptor); and somatotropic axis (C; GHR1A = growth hormone receptor 1A; IGF1 = insulin like growth factor 1; IGFBP3 = insulin like growth factor binding protein 3) in the endometrium of lactating Holstein cows fed 3.9 to 1 (R4), 4.9 to 1 (R5), and 5.9 to 1 (R6) ratio of n 6 to n 3 FA. Effect of altering the ratio of n 6 to n 3 fatty acids: * P < 0.05; ¶ P = 0.09.

PAGE 240

240 Figure 6 8 . Expression of selected ge nes according to the concentration of n 6 to n 3 fatty acids in the endometrium of dairy cows. Endometrium was categorized according to the ratio of n 6 to n 3 fatty acids observed by mass spectrometry as low ratio (mean = 4.45, range = 2.65 to 5.6), mediu m ratio (mean = 8.81, range = 8.12 to 9.91), or high ratio (mean = 11.10, range = 10.06 to 14.27). Genes differentially expressed included ESR1 (estrogen receptor 1), OTR (oxytocin receptor), PGFS (prostaglandin F synthase), and PGES (prostaglandin E synth ase). Effect of category of n 6 to n 3 fatty acids in the endometrium: * P < 0.05; ¶ P = 0.06.

PAGE 241

241 Figure 6 9 . Regression analyses between expression of selected genes and the ratio of n 6 to n 3 fatty acids in the endometrium of dairy cows. Expressio n of ESR1 (estrogen receptor 1 ; r 2 = 0.43 ), OTR (oxytocin receptor ; r 2 = 0.22 ), PGFS (prostaglandin F synthase ; r 2 = 0.18 ), and PGES (prostaglandin E synthase ; r 2 = 0.14 ) were positively associated ( P < 0.05) with the ratio of n 6 to n 3 FA observed in the endometrium.

PAGE 242

242 CHAPTER 7 SUMMARY AND GENERAL CONCLUSIONS The overall objectives of the present dissertation were to study the effects of dietary fatty acids (FA) on lactation performance, metabolism, immune responses, health, and gene expression of early po stpartum dairy cows. Two experiments were designed to evaluate the effects of supplementing diets containing low amounts of FA with either mostly saturated free FA (SFA) or Ca salts containing essential FA (EFA) during late gestation and early lactation on performance, energy metabolism, and milk and plasma FA composition (C hapter 2); immunity and ut erine health early postpartum (C hapter 3); FA profile and gene expression of hepatic tissue ( C hapter 4). A third experiment was designed to determine the effect of altering the ratio of n 6 to n 3 FA in the diet of postpartum dairy cows on lactation performance, metabolism, milk and plasma FA profile, and acute phase responses after an intramam m ary challenge with lipopolysaccharide ( LPS ; C hapter 5); FA profile an d expression of genes related to prostaglandin biosynthesis in the endometrial tissue, patterns of prostaglandin release by the uterus, and timing of spontaneous luteolysis ( C hapter 6). In C hapter 2, it was demonstrated that the lactational performance o f dairy cows was impaired when concentrations of FA, particularly linoleic acid, was limited in the diet. Supplementing diets with saturated FA partially improved lactational performance but not to the same extent as supplementing diets with essential FA. Furthermore, the positive effects of essential FA supplementation were more pronounced in primiparous cows, when the supplementation started prepartum and there was no parity effect when the supplementation started after calving. Additionally, feeding esse ntial FA altered milk and plasma FA composition, resulting in greater essential FA balance and secretion of linolei linolenic acids in milk.

PAGE 243

243 In C hapter 3, the early postpartum immune function and uterine health were evaluated. Feeding dairy cows a low fat diet reduced markers of immune function such as the concentration of neutrophils in blood, the proportion of neutrophils expressing adhesion molecules and the ability of neutrophils to phagocytize and kill E. coli in vitro . Disease suppressed neutrophil function, but feeding fat lessened th e depression associated with disease. Feeding fat reduced the incidenc e of puerperal metritis and the prevalence of utero pathogenic bacteria from uterine flush at 36 d postpartum. However, postpartum ovarian activity, uterine involution and pregnancy at first AI w ere not influenced by fat feeding or the source of FA fed. Th e results presented in C hapter 3 suggest that supplementing fat to the diets of dairy cows during the transition period improved immune function and reduced the severity of metritis . Finally, t h e benefits of fat feeding were more pronounced in primiparous cows . The results of C hapters 2 and 3 led to further investigation of hepatic function, which may explain some of the above outcomes. Feeding fat or different sources of FA during the transition period did not alter the FA content of hepatic tissue at 14 d postpartum; h owever, the inclusion of essential FA in the fat supplemented to cows increased the proportion of linoleic acid within the hepatic FA pool . The small but significant increases in linoleic acid and the overall changes in hepatic FA profile inf luence d gene regulation likely via binding to transcription factor complexes such as PPARs. In fact, feeding fat and different sources of FA (i.e., saturated FA or e ssential FA ) influenced an array of cellular pathways in hepatic tissue. The l ow dietary FA fed to control cows up regulated the expression of genes associated with the immune system, particularly markers of impaired health and tissue inflammation ( BOLA DQA5; BOLA DQB; GGT1 ). On the other hand, cows supplemented with FA had a potential up regul ation of the renin angiotensin system with an increase in gene expression of angiotensin I

PAGE 244

244 converting enzyme [peptidyl dipeptidase A] 2 . This is a gene reported to control and prevent tissue fibrosis. The different sources of FA influenced several componen ts of lipid metabolism pathways. Saturated FA markedly increased the expression of desaturase enzymes and coenzyme A synthetase. In contrast, feeding essential FA up regulated pathways associated with vitamin and fat absorption and apolipoprotein genes ( AP OA4 ). Collectively, the set of expe rimental outcomes presented on C hapters 2, 3, and 4 indicate important roles of supplemental dietary FA on transition cow performance and health. In general, cows were in negative balance of essential FA, and this was att enuated by feeding Ca salts containing EFA. Primiparous cows benefit ed more from FA supplementation, particularly when essential FA were fed . The fact that these cows were still growing likely increase s the requirements for essential FA. Further investigat ions are warranted as to the potential nutraceutical effects of FA and the need to define the requirements for essential FA in ruminants. It is well know n that essential FA play pivotal role s on the metabolism of mammals. It is often stated in the scientif ic literature regarding humans that not only is the intake of essential FA per se is important, but the balance between the n 6 and n 3 FA is also vital for optimal biological functions and well being of the individual. An experiment (Chapter 5) was design ed to determine the effects of altering the ratio of n 6 to n 3 FA ( labeled as R4 , R5 and R6 to designate 4, 5, and 6 parts of n 6 to 1 part of n 3 FA, respectively ) in the diets of dairy cows on lactation performance, metabolic status, and acute phase res ponses after an intramammary challenge with LPS. Reducing the ratio of n 6 to n 3 FA increased dry matter intake and markedly increased yields of 3.5% fat corrected milk and milk components. Increasing the ratio of n 6 to n 3 FA influenced the acute phase response to a LPS challenge into a pro inflammatory state (i.e., increase in plasma IL 6 and haptoglobin), whereas R5 had a greater elevation of body

PAGE 245

245 temperature and milk somatic cell count. Altering the ratio of n 6 to n 3 FA can influence the pro and an ti inflammatory state of the cells, which might influence several processes in the body, particularly on the reproductive ax is. The experiment detailed in C hapter 6 was designed to understand the effects of altering the ratio between n 6 to n 3 FA in the d iet of lactating dairy cows on FA profile, expression of genes related to the prostaglandin biosynthesis in endometrial tissue, uterine secretion of PGF , and timing of spontaneous luteolysis. The proportion of arachidonic acid increased in the endometrium of cows as the ratio between n 6 to n 3 FA increased, on the other hand the proportions of eicosapentaenoic and docosahexaenoic acids decreased. Incre asing the ratio of n 6 to n 3 FA increased mRNA expression of oxytocin estr o gen receptors, COX2 , PGFS , and PGES in the endometrium, which would favor PG synthesis as opposed to a lower PG synthetic potential. The number of PGFM pulses decreased but the amp litude of the greatest pulse increased as the ratio between n 6 to n 3 FA increased. However these changes were not sufficient to alter the length of the estrous cycle. The results presented i n C hapters 6 and 7 provide indications that dietary FA influence endometrial gene expression, which affect prostaglandin metabolism. Although the length of the luteal phase did not differ, it is clear that the prostaglandin synthetic pathway can be manipulated by diet, which might have implications to fertility of dair y cows. The optimal ratio between n 6 to n 3 FA in the diet of lactating dairy cows remains unknown , and the exact mechanisms by which altering the dietary FA enhance reproductive performance remain to be elucidate , although results from the current thesi s indicate that manipulation of the dietary FA composition affect the patterns of endometrial response during the estrous cycle and, although no change in luteolysis was demonstrated, feeding more n 3 FA clearly altered the pattern of prostaglandin synthes is. It is possible that changes in the patter of

PAGE 246

246 prostaglandin synthesis might influence the ratio of PGF 2 to PGE 2 in early pregnan cy that can have effects on peri implantation embryonic development, embryo survival, placental function , and fetal programing . All these concepts are areas that need further investigation. The future development of nutraceutical management programs to enhance reproductive performance and improve production efficiency and health of the maternal unit are future goals for scientific inquiry. The interacting effects of pharmaceuticals that enhance lactation and reproduction such as bo vine somatotropin, incorporated with feeding diets containing molecules such as fatty acids that regulate gene expression might create novel venues to improve lactation and fertility of the high producing dairy cow. Furthermore, results from the present th esis clearly demonstrate that the dairy cow is an excellent experimental model for many aspects of biomedical research involving lactation, immune response, and embryo development . The research findings described in this dissertation set the stage for furt her advancements and provide new tools for immediate implementation in the dairy industry to enhance production efficiency and well being of lactating dairy cows.

PAGE 247

247 LIST OF REFERENCES Aardema, H., P.L.M. Vos, F. Lolicato, B.A.J. Roelen, H.M. Knijin, A.B. Vaandrager, J.B. Helms, and B.M. Gadella. 2011. Oleic acid prevents detrimental effects of saturated fatty acids on bovine oocyte developmental competence. Biol. Reprod. 85:62 69. Abayasekara, D.R.E., and D.C. Wathes. 1999. Effects of altering dietary fatt y acid composition on prostaglandin synthesis and fertility. Prostaglandins, Leukot . Essent . Fatty Acids 61 : 275 287. Ahmadian, M., Y. Wang, and H.S. Sul. 2010. Lipolysis in adipocytes. Int. J. Biochem. Cell Biol. 42:555 559. Akbar, H., E. Schmitt, M.A. Bal lou, M.N. Corrêa, E.J. DePeters, and J.J. Loor. 2013. Dietary lipid during late pregnancy and early lactation to manipulate metabolic and inflammatory gene network expression in dairy cattle liver with a focus on PPARs. Gene Reg. Syst. Biol. 7:103 123. Ali zadeh, A.R., M. Alikhani, G.R. Ghorbani, H.R. Rahmani, L. Rashidi, and J.J. Loor. 2012. Effects of feeding roasted safflower seeds (variety IL 111) and fish oil on dry matter intake, performance and milk fatty acid profiles in dairy cattle. J. Anim. Physio l. Anim. Nutr. 96:466 473. Allen, M.S. 2000. Effects of diet on short term regulation of feed intake by lactating dairy cattle. J. Dairy Sci. 83:1598 1624. Allen, M.S., B.J. Bradford, and M. Oba. 2009. Board Invited Review: The hepatic oxidation theory of the control of feed intake and its application to ruminants. J . Anim. Sci. 87: 3317 3334. Amaral, B.C. 2008. Effect of supplemental fat source on production, immunity, hepatic gene expression, and metabolism of periparturient dairy cows. PhD dissertation. Department of Animal Sciences, U n iversity of Florida, Gainesville. Ambrose, D.J., J.P. Kastelic, R. Corbett, P.A. Pitney, H.V. Petit, J.A. Small, and P. Zalkovic. 2006. Lower pregnancy losses in lactating dairy cows fed a diet enriched in linolenic acid . J. Dairy Sci. 89:3066 3074. Antunes, J. M. A. P. 2012. Perfil da expressão gênica induzida pela infecção experimental por Brucella ovis em tecidos reprodutivos e linfóides ovinos. PhD dissertation, Department of Veterinary and Public Health, São Paulo St ate University, Botucatu, Brazil. Avila, C.D., E.J. DePeters, H. Perez Monti, S.J. Taylor, and R.A. Zinn. 2000. Influences of saturation ratio of supplemental dietary fat on digestion and milk yield in dairy cows. J. Dairy Sci. 83:1505 1519.

PAGE 248

248 Badinga , L., R .J. Collier, W.W. Thatcher, C.J. Wilcox, H.H. Head, and F.W. Bazer. 1991. Ontogeny of hepatic bovine growth hormone receptors in cattle. J. Anim. Sci. 69:1925 1934. Ballou, M.A., R.C. Gomes, and E.J. DePeters. 2009. Supplemental fish oil does not alter im mune competence or the pathophysiological response to an intramammary infusion of endotoxin in peri partum multiparous Holstein cows. J. Dairy Res. 76:165 172. Bauchart, D. 1993. Lipid absorption and transport in ruminants. J. Dairy Sci. 76:3864 3881. Baum an, D.E., and M. Griinari. 2003. Nutritional regulation of milk fat synthesis. Annu. Rev. Nutr. 23:203 227. Bauman, D.E., K.J. Harvatine, and A.L. Lock. 2011. Nutrigenomics, rumen derived bioactive fatty acids, and the regulation of milk fat synthesis. Ann u. Rev. Nutr. 31:299 319. Baumgard, L.H., B.A. Corl, D.A. Dwyer, A. Saeb , and D.E. Bauman. 2000. Identification of the conjugated linoleic acid isomer that inhibits milk fat synthesis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278:R179 R184. Baumgard, L.H., B.A. Corl, D.A. Dwyer, A. Saebo, and D.E. Bauman. 2000. Identific ation of the conjugated linoleic acid isomer that inhibits milk fat synthesis. Am. J. Physiol. 278:R179 R184. Baumgard, L.H., E. Matitashvili, B.A. Corl, D.A. Dwyer, and D.E. Bauman. 2002. Trans 10, cis 12 Conjugated linoleic acid decreases lipogenic rate s and expression of genes involved in milk lipid synthesis in dairy cows. J. Dairy Sci. 85:2155 2163. Bell, A.W. 1995. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J. Anim. Sci. 73:2804 2819. Bell, A. W. and D. E. Bauman. 1997. Adaptations of glucose metabolism during pregnancy and lactation. J. Mammary Gland Biol. Neoplasia 2:265 278. Bernert, J.T. and H. Sprecher. 1975. Studies to determine the role rates of chain elongation and desaturation play in r egulating the unsaturated fatty acid composition of rat liver lipids. Biochim. Bioph. Acta 398:354 363. Bicalho, M.L., V.S. Machado, G. Oikonomou, R.O. Gilbert, and R.C. Bicalho. 2012. Association between virulence factors of Escherichia coli, Fusobacteriu m necrophorum, and Arcanobacterium pyogenes and uterine diseases of dairy cows. Vet. Microbiol. 157:125 1231. Bilby, T.R., J. Block, B.C. do Amaral, O. Sa Filho, F.T. Silvestre, P.J. Hansen, C.R. Staples, and W.W. Thatcher. 2006a. Effects of dietary unsatu rated fatty acids on oocyte quality and follicular development in lactating dairy cows in summer. J. Dairy Sci. 89:3891 3903.

PAGE 249

249 Bilby, T.R., A. Sozzi, M. M. Lopez, F. T. Silvestre, A. D. Ealy, C. R. Staples, and W. W. Thatcher. 2006 b . Pregnancy, bovine somat otropin, and dietary n 3 fatty acids in lactating dairy cows: I. Ovarian, conceptus, and growth hormone insulin like growth factor system responses. J. Dairy Sci. 89:3360 3374. Bilby, T.R., T. Jenkins, C.R. Staples, and W.W. Thatcher. 2006 c . Pregnancy, bov ine somatrotopin, and dietary n 3 fatty acids in lactating dairy cows: III. Fatty acid distribution. J. Dairy Sci. 89:3386 3399. Bines, J.A. and I.C. Hart. 1982. Metabolic limits to milk production, especially roles of growth hormone and insulin. J. Dairy Sci. 65:1375 1389. Bionaz, M., B.I. Thering, and J.J. Loor. 2012. Fine metabolic regulation in ruminants via nutrient gene interactions: saturated long chain fatty acids increase expression of genes involved in lipid metabolism and immune response partly through PPAR activation. Br. J. Nutr. 107:179 191. Bobe, G., J.W. Young, and D.C. Beitz. 2004. Invited review: pathology, etiology, prevention, and treatment of fatty liver in dairy cows. J Dairy Sci. 87:3105 3124. Boshier, D.P., R.J. Fairclough, and H. Holloway. 198 7. Assessment of sheep blastocyst effects on neutral lipids in the uterine caruncular epithelium. J. Reprod. Fertil . 79:569 573. Bougarne, N., R. Paumelle, S. Caron, N. Hennuyer, R. Mansouri, P. Gervois, B. Staels, G. Haegeman, and K. Bosscher. 2009. PPAR blocks glucocorticoid receptor mediated transactivation but cooperates with the activated glucocorticoid receptor for transrepression on NF B. Proc. Natl. Acad. Sci. 106:7397 7402. Bradford , B.J., K.J. Harvatine, M.S. Allen. 2008. Dietary unsaturat ed fatty acids increase plasma glucagon like peptide 1 and cholecystokinin and may decrease pre meal ghrelin in lactating dairy cows. J. Dairy Sci. 91:1443 1450. Bragt, M.C.E. and H.E. Popeijus. 2008. Peroxisome proliferator activated receptors and the met abolic syndrome. Physiol. Behav. 94:187 197. Bremmer, D.R., L.D. Ruppert, J.H. Clark, and J.K. Drackley. 1998. Effects of chain length and unsaturation of fatty acids mixtures infused into the abomasum of lactating dairy cows. J. Dairy Sci. 81:176 188. Bre nnan, K.M., J.J. Michal, J.J. Ramsey, and K.A. Johnson. 2009. Body weight loss in beef cows: I. The effect of increased oxidation on messenger ribonucleic acid levels of uncoupling proteins two and three and peroxisome proliferator activated receptor in skeletal muscle. J. Anim. Sci. 87:2860 2866. Brinsfield, T.H. and H.W. Hawk. 1973. Control by progesterone of the concentration of lipid droplets in epithelial cells of the sheep endometrium. J. Anim. Sci. 36:919 922.

PAGE 250

250 Buckley, J.D. and P.R.C. Howe. 2010. L ong chain omega 3 polyunsaturated fatty acids may be beneficial for reducing obesity A review. Nutrients 2:1212 1230. Burciaga Robles, L.O. 2009. Effects of bovine respiratory disease on immune response, animal performance, nitrogen balance, and blood an d nutrient flux across the portal drained viscera in beef steers. PhD dissertation, Department of Animal Sciences, Oklahoma State University, Stillwater, OK. linolenic acid in humans. Prostaglandins Leukot . Essent . Fatty Acids 75:161 168. Burdge, C.G., Y.E. Finnegan, A.M. Minihane, C.M. Williams, and S.A. Wootton. 2003. Effect of altered dietary n 3 fatty acid intake upon plasma lipid fatty acid composition, conversion of [ 13 linolenic acid to longer chain fatty acids a oxidation in older men. Br. J. Nutr. 90:311 321. Burke, J.M., C.R. Staples, C.A. Risco, R.L. De La Sota, and W.W. Thatcher. 1997. Effect of ruminant grade menhaden fish meal on reproductive and productive performance of lactating dairy cows. J. Dairy Sci. 80:3386 3398. Burr, G.O. , and M.M. Burr. 1929. A new deficiency disease produced by the rigid exclusion of fat from the diet. J. Biol. Chem. 82:345 367. Burr, G.O. , and M.M. Burr. 1930. On the nature and role of the fatty acids es sential in nutrition. J. Biol. Chem. 86:587 621. Burr, G.O., M.M. Burr, and E.S. Miller. 1932. On the fatty acids essential in nutrition III. J. Biol. Chem. 97:1 9. Burton, J.L., S.A. Madsen, L.C. Chang, P.S.D. Weber, K.R. Buckham, R. van Dorp, M.C. Hicke y, and B. Earley. 2005. Gene expression signatures in neutrophils exposed to dairy cows. Vet. Immunol. Immunopathol. 105:197 219. Busnadiego, O., J. González Santamaría, D. Lagares, J. Guinea Viniegra, C. Pichol Thievend, L. Muller, and F. Rodríguez Pascual. 2013. LOXL4 is induced by tra nsforming growth Mol. Cell. Biol. 33:2388 2401. Butler, W.R. 2003. Energy balance relationships with follicular development, ovulation and fertility in postpartum dairy cow s. Livest. Prod. Sci. 83:211 218. Caldari Torres, C., C. Rodriguez Sallaberry, E.S. Greene, and L. Badinga. 2006. Differential effects of n 3 and n 6 fatty acids on prostaglandin F2 production by bovine endometrial cells. J. Dairy Sci. 89:971 977.

PAGE 251

251 Caldari Torres, C., A.L. Lock, C.R. Staples, and L. Badinga. 2011. Performane, metabolic, and endocrine responses of periparturient Holstein cows fed 3 sources of fat. J. Dairy Sci. 94:1500 1510. Calder, P.C., C. Yaqoob, D.J. Harvey, A. Watts, and E.A. Newsholme. 1994. Incorporation of FA by concanavalin A stimulated lymphocytes and the effect on fatty acid composition and membrane fluidity. Biochem. J. 1300:509 518. Calder, P. 2006. Polyunsaturated fatty acids a nd inflammation. Prostaglandins Leukot . Essent . Fatt y acids 75:197 202. Calder, P.C., R. Albers, J. M. Antoine, S. Blum, R. Bourdet Sicard, G.A. Ferns, G. Folkerts, P.S. Friedmann, G.S. Frost, F. Guarner, M. L M. Serafini, W. van Eden, J. van Loo, W. Vas Dias, S. Vidry, B.M Winklhofer Roob, and J. Zhao. 2009. Inflammatory disease processes and interactions with nutrition. Br. J. Nutr. 101:S1 S45. Calder, P.C. 2011. Fatty acids and inflammation: The cutting edge between food and pharma. Eur. J. Pharmacol. 668:S50 S5 8. Calder, P.C. 2012. Long chain fatty acids and inflammation. Proc. Nutr . Soc . 71:284 289. Carlier, H., A. Bernard, and C. Caseli. 1991. Digestion and absorption of polyunsaturated fatty acids. Reprod. Nutr. Dev. 31:475 500. Castañeda Gutiérrez, E., T.R. Overton, W.R. Butler, and D.E. Bauman. 2005. Dietary supplements of two doses of calcium salts of conjugated linoleic acid during the transition period and early lactation. J. Dairy. Sci. 88:1078 1089. Cerri, R.L.A., S.O. Juchem, R.C. Chebel, H.M. Rutigli ano, R.G.S. Bruno, K.N. Galvão, W.W. Thatcher, and J.E.P. Santos. 2009. Effect of fat source differing in fatty acid profile on metabolic parameters, fertilization, and embryo quality in high producing dairy cows. J. Dairy Sci. 92:1520 1531. Cerri, R. L. A ., I. M. Thompson, I. H. Kim, A. D. Ealy, P. J. Hansen, C. R. Staples, L. L. Li, J. E. P. Santos, and W. W. Thatcher. 2012. Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at day 17 of the estrous cycle or pregnancy. J . Dairy Sci. 95:5657 5675. Chang, J. H. P., D. K. Lunt, and S. B. Smith. 1992. Fatty acid composition and fatty acid elongase and stearoyl CoA desaturase activities in tissues of steers fed high oleate sunflower seed. J. Nutr. 122:2074 2080 . Chapinal, N., M. Carson, T.F. Duffield, M. Capel, S. Godden, M. Overton, J.E.P. Santos, and S.J. LeBlanc. 2011. The association of serum metabolites with clinical disease during the transition period. J. Dairy Sci. 94:4897 4903.

PAGE 252

252 Chenault, J. R., W. W. Thatcher, P. S. Ka lra, R. M. Abrams, and C. J. Wilcox. 1976. Plasma progestins, estradiol, and luteinizing hormone following prostaglandin F2 injection. J. Dairy Sci. 59:1342 1346. Cheung, K., and B. Morris. 1984. The respiration and energy metabolism of sheep lymphocytes. Aust. J. Exp. Biol. Med. Sci. 62:671 685. Childs, S., A.A. Hennessy, J.M. Sreenan, D.C. Wathes, Z. Cheng, C. Stanton, M.G. Diskin, and D.A. Kenny. 2008. Effect of level of dietary n 3 polyunsaturated fatty acid supplementation on systemic and tissue fatty acid concentrations and on selected reproductive vari ables in cattle. Theriogenology 70:595 611. Childs, C.E., S.P. Hoile, G.C. Burdge, and P.C. Calder. 2012. Changes in rat n 3 and n 6 fatty acid composition during pregnancy are associated with progestero ne concentrations and hepatic FADS2 expression. Prostgl andins Leukotr. Ess ent . Fatty Acids 86:141 147. Chilliard , Y., F. Glasser, A. Ferlay, L. Bernard, J. Rouel, and M. Doreau. 2007. Diet, rumen biohydrogenation and nutritional quality of cow and goat mil k fat. Eur. J. Lipid Technol. 109:828 855. Choi , B. R., D.L. Palmquist, and M.S. Allen. 2000. Cholescystokinin mediates depression of feed intake in dairy cattle fed high fat diets. Domest. Anim. Endocrinol. 19:159 175. Christensen, R.A., J.H. Clark, J.K. Drackley, and S.A. Blum. 1998. Fatty acid flow to the duodenum and in milk from cows fed diets that contained fat and nicotinic acid. J. Dairy Sci. 81:1078 1088. Cinti, D.L., L. Cook, M.N. Nagi, and S.K. Suneja. 1992. The fatty aid chain elongation system of mammalian endoplasmic reticulum. Prog. Lipd. Res. 31:1 51. Colditz, I.G. 2002. Effects of the immune system on metabolism: implication for production and disease resistance in livestock. Livest. Prod. Sci. 75:257 268. Coulombe , J. J. and L. Favreau. 19 63. A new simple method for colorimetric determination of urea. Clin. Chem. 9:102 108. Coyne, G.S., D.A. Kenny, S. Childs, J.M. Sreenan, and S.M. Waters. 2008. Dietary n 3 polyunsaturated fatty acids alter the expression of genes involved in prostaglandin biosynthesis in th e bovine uterus. Theriogenology 70:772 782. Coyne, G.S., D.A. Kenny, and S.M. Waters. 2011. Effect of dietary n 3 polyunsaturated fatty acid supplementation on bovine uterine endometrial and hepatic gene expression of the insulin like gro wt h factor system. Theriogenology 75:500 512. Cullens, F.M. 2005. Effects of the timing of initiation of fat supplementation on productive and reproductive responses of periparturient dairy cows during summer. MS thesis. Department of Animal Sciences, Univ ersity of Florida, Gainesville.

PAGE 253

253 Cunningham, H. M., and J. K. Loosli. 1954. The effect of fat free diets on young dairy calves with observations on metabolic fecal fat and digestion coefficients for lard and hydrogenated coconut oil. J. Dairy Sci. 37:453 46 1. Damgaard, B. M., M. R. Weisbjerg, and T. Larsen. 2013. Priming the cow for lactation by rapeseed supplementation in the dry period. J. Dairy Sci. 96: 3652 3661. Desvergne, B., L. Michalik, and W. Wahli. 2006. Transcriptional regulation of metabolism. Ph ysiol. Rev. 86:465 514. Deuel, H.J. Jr., C.R. Martin, and R.B. Alfinslater. 1954. The effect of fat level of the diet on general nutrition. XII. The requirement of essential fatty acids for pregnancy and lactation. J. Nutr. 54:193 199. Dirandeh, E., A. Tow hidi, Z. Ansari Pirsaraei, F. Adib Hashemi, M. Ganjkhanlou, S. Zeinoaldini, A. Rezaei Roodbari, T. Saberifar, and H.V. Petit. 2013. Plasma concentrations of PGFM and uterine and ovarian responses in early lactation dairy cows fed omega 3 and omega 6 fatty acids. Theriogenology 80:131 137. Djavaheri glutamyl transpeptidase activity mediates NF kB activation through lipid peroxidation in human leukemia U937 cells. Mol. Cell Biochem. 232:103 111. Donovan, D.C., D.J. Schingoethe, R.J. Baer, J. Ryali, A.R. Hippen, and S.T. Franklin. 2000. Influence of dietary fish oil on conjugated linoleic acid and other fatty acids in milk fat from lactating dairy cows. J. Dairy Sci. 83:2620 2628. Doreau, M. , and A. Ferlay. 1994. Digestion and uti lization of fatty acids by ruminants. Anim. Feed Sci. Technol. 45:379 396. Doreau, M. , and Y. Chilliard. 1997. Digestion and metabolism of dietary fat in farm animals. British Journal of Nutrition 78:S15 S35. Doreau, M., S. Laverroux, J. Normand, G. Chesne au, and F. Glasser. 2009. Effect of linseed fed as rolled seeds, extruded seeds or oil on fatty acid rumen metabolism and intestinal digestibility in cows. Lipids 44:53 62. Douglas, G.N., T. R. Overton, H. G. Bateman, and J.K. Drackley. 2004. Peripartal meta bolism and production of Holstein cows fed diets supplemented with fat during the dry period. J. Dairy Sci. 87:4210 4220. Douglas, G. N., J. Rehage, A .D. Beaulieu, A. O. Bahaa, and J.K. Drackley. 2007. Prepartum nutrition alters fatty acid composition in plas ma adipose tissue, and liver lipids of periparturient dairy cows. J. Dairy Sci. 90:2941 2959. Drackley , J.K. 1999. Biology of dairy cows during the transition period: the final frontier? J. Dairy Sci. 82:2259 2273.

PAGE 254

254 Drackley, J.K., T.R. Overton, and G.N. Do uglas. 2001. Adaptations of glucose and long chain fatty acid metabolism in liver of dairy cows during the periparturient period. J. Dairy Sci. 84:E100 E112. Eijssen, L. M. T., M. Jaillard, M. E. Adriaens, S. Gaj, P. J. de Groot, M. Müller, and C. T. Evelo . 2013. User friendly solutions for microarray quality cont rol and pre processing on Arraya nalysis.org. Nucleic Acids Res. 1 6. Elanco Animal Health. 2009. The 5 point body condition scoring system. Bulletin AI 10752. Elanco Animal Health, Greenfield, IN. Fahy, E., S. Subramaniam, H.A. Brown, C.K. Glass, A.H. Merrill Jr., R.C. Murphy, C.R.H. Raetz, D.W. Russell, G. van Meer, M.S. VanNieuwenhze, S.H. White, J.L. Witztum, and E.A. Dennis. 2005. A comprehensive classification system for lipids. J. Lipid Res. 4 6:839 862. Ferguson , J.D., D.T. Galligan, and N. Thomsen. 1994. Principal de scriptors of body condition score in Holstein cows. J. Dairy Sci. 77:2695 2703. Fouladi Nashta, A.A., K.E. Wonnacott, C.G. Gutierrez, J.G. Gong, K.D. Sinclair, P.C. Garnsworthy, an d R. Webb. 2009. Oocyte quality in lactting dairy cows fed on high levels of n 3 and n 6 fatty acids. Reproduction 138:771 781. Garcia, M., L.F. Greco, M.G. Favoreto, R.S. Marsola, D. Wang, J.H. Shin, E. Block, W.W. Thatcher, J.E.P. Santos, and C.R. Staple s. 2014. Effect of supplementing essential fatty acids to pregnant nonlactating Holstein cows and their preweaned calves on calf performance, immune response, and health. J. Dairy Sci. 97:5045 5064. García Rojas, P. A. Antaramian, L. González Dávalos, F. V illarroya, A. Shimada, A. Varela Echavarría, and O. Mora. 2010. Induction of peroxisomal proliferator activated receptor and peroxisomal proliferator activated receptor coativator 1 by unsaturated fatty acids, retinoic acid, andcarotenoids in preadipocytes obtained from bovine white adipose tissue. J. Anim. Sci. 88:1801 1808. Geiger, M., B.S. Mohammed, S. Sankarappa, and H. Sprecher. 1993. Studies to determine if rat liver contains chain length specific acyl CoA 6 desaturases. Biochim. Bioph. Acta 1170:137 142. Gentlman, R. C., V. J. Carey, D. M. Bates, B. Bolstad, M. Dettling, S. Dudoit, B. Ellis, L. Gautier, Y. Ge, J. G entry, K. Hornil, T. Horthorn, W. Huber, S. Iacus, R. Irizarry, F. Leisch, C. Li, M. Maechlers, A.J. Rossini, G. Sawitzki, C. Smith, G. Smith, L. Tierney, J. Y. H. Yang, and J. Zhang. 2004. Bioconductor: open software development for computational biology and bioinformatics. Genome Biol. 5:R80.1 R80.16. Gervois, P., R. Kleemann, A. Pilon, F. Percevault, W. Koenig, B. Staels, and T. Kooistra. 2004. Global suppression of IL 6 induced acute phase response gene expression after chronic in vivo treatment with th e peroxisome proliferator activated receptor activator fenofibrate. J. Biol. Chem. 279:16154 16160.

PAGE 255

255 Gewirtz, A.T., L.S. Collier Hyams, A.N. Young, T. Kucharzik, W.J. Guilford, J.F. Parkinson, I.R. Williams, A.S. Neish, J.L. Madara. 2002. Lipoxin A4 analogs attenuate induction of intestinal epithel ial proinflammatory gene expression and reduce the severity of dextran sodium sulfate induced colitis. J. Immunol. 168:5260 5267. Gifford, C. A., B. P. Holland, R. L. Mills, C. L. Maxwell, J. K. Farney, S. J. Terrill, D. L. Step, C. J. Richards, L. O. Burc iaga Robles, and C. R. Krehbiel. 2012. Impacts of inflammation on cattle growth and carcass merit. J. Anim. Sci. 90:1438 1451. Gimpl, G., and F. Fahrenholz. 2001. The oxytocin receptor system: structure, function, and regulation. Physiol. Rev. 81:629 683. Ginther, O.J., L.A. Silva, R.R. Araujo, and M.A. Beg. 2007. Temporal associations among pulses of 13,14 Dihydro 15 keto PGF2alpha, luteal blood flow, and luteolysis in cattle. Biol. Reprod. 76:506 513. Ginther, O.L., H.K. Shrestha, M.J. Fuenzalida, A.K.M. Shahiduzzaman, and M.A. Beg. 2010. Characteristics of pulse of 13,14 dihydro 15 keto prostaglandin F2alpha before, during, and after spontaneous luteolysis and temporal intrapulse relationships with progesterone concentrations in cattle. Biol. Reprod. 82:1 049 1056. Ginther, O.J., M.J. Fuenzalida, H.K. Shrestha, and M.A. Beg. 2011. Concomitance of luteinizing hormone and progesterone oscillations during the transition from preluteolysis to luteolysis in cattle. Domest. Anim. Endocrinol. 40:77 86. Ginther, O. J., R.R. Araujo, M.P. Palhao, B.L. Rodrigues, and M.A. Beg. 2009. Necessity of sequential pulses of prostaglandin F2alpha for complete physiologic luteolysis in cattle. Biol Reprod. 80:641 648. Glasser, F., M. Doreau, A. Ferlay, and Y. Chilliard. 2007a. Te chnical note: Estimation of milk fatty acid yield from milk fat data. J. Dairy Sci. 90:2302 2304. Glasser, F., M. Doreau, A. Ferlay, J.J. Loor and Y. Chilliard. 2007b. Milk fatty acids: Mammary synthesis could limit transfer from duodenum in cows. Eur. J. Lipid Sci. Technol. 109:817 827. Gochman , N. and J. M. Schmitz. 1972. Application of a new peroxide indicator reaction to the specific automated determination of glucose with glucose oxidase. Clin. Chem. 18:943 950. Gonthier, C., A.F. Mustafa, R. Berthiau me, H.V. Petit, and D.R. Ouellet. 2004. Feeding micronized and extruded flaxseed to dairy cows: Effects on digestion and ruminal biohydrogenation of long chain fatty acids. Can. J. Anim. Sci. 84:705 711. Gonthier, C., A.F. Mustafa, D.R. Ouellet, P.Y. Choui nard, R. Berthiaume, and H.V. Petit. 2005. Feeding micronized and extruded flaxseed to dairy cows: Effects on blood parameters and milk fatty acid composition. J. Dairy Sci. 88:748 756.

PAGE 256

256 Gross, J., H.A. van Dorland, R.M. Bruckmaier, and F.J. Schwarz. 2011. Milk fatty acid profile related to energy balance in dairy cows. J. Dairy Res. 78:479 488. Grum, D.E., J.K. Drackley, R.S. Younker, D.W. LaCount, and J.J. Veenhuizen. 1996. Nutrition during the dry period and hepatic lipid metabolism of periparturient dair y cows. J. Dairy Sci. 79:1850 1864. Grummer , R.R. 1993. Etiology of lipid related metabolic disorders in periparturient dairy cows. J. Dairy Sci. 76:3882 3896. Guilbault, L.A., W.W. Thatcher, M. Drost, and S.M. Hopkins. 1984. Source of F series prostagland ins during the early postpartum period in cattle. Biol. Reprod. 31:879 887. Guillou, H., D. Zadravec, P.G.P. Martin, and A. Jacobsson. 2010. The key roles of elongases and desaturases in mammalian fatty acid metabolism: Insights from transgenic mice. Prog. Lipid Res. 49:186 199. Hammon, D.S., I.M. Evjen, T.R. Dhiman, J.P. Goff, and J.L. Walters. 2006. Neutrophil function and energy status in Holstein cows with uterine health disorders. Vet. Immunol. Immunopathol. 113 21 29. Harfoot, C.G. 1978. Lipid metabol ism in the rumen. Prog. Lipid. Res. 17:21 54. Harrison, F.A., and W.M.F. Leat. 1975. Digestion and absorption of lipids in non ruminant and ruminant animals: a comparison. Proc. Nutr. Soc. 34:203 210. Harvatine, K.J. and M.S. Allen. 2006. Effects of fatty acid supplements on milk yield and energy balance of lactating dairy cows. J. Dairy Sci. 89:1081 1091. Hashimoto, K., A.C. Yoshizawa, K. Saito, T. Yamada, M. Kanehisa. 2006. The repertoire of desaturases for unsaturated fatty acid synthesis in 397 ge nomes. Genome Informatics 17 :173 183. Hawkins, D.E., K.D. Niswender, G.M. Oss, C.L. Moeller, K.G. Odde, H.R. Sawyer, and G.D. Niswender. 1995. An increase in serum lipids increases luteal lipd content and alters the disappearance rate of progesterone in cows. J. Anim. Sci. 73:541 545. Hiller, B., J. Angulo, M. Oliveira, G. Nuernberg, and K. Nuernberg. 2013. How selected tissues of lactating Holstein cows respond to dietary polyunsaturated fatty acid supplementation. Lipids 48:357 367. Hochepied , T., F. G. Berger, H. Baumann, and C. Libert. 2003. Alpha(1) acid glycoprotein: an acute phase protein with inflammatory and immunomodulating properties. Cytokine Growth Factor Rev. 14:25 34. Hoedemaker, M., L.A. Lund, and W.C. Wagner. 1992. Influence of arachidonic acid me tabolites and steroids on function of bovine polymorphonuclear neutrophils. Am. J. Vet. Res. 53:1534 1539.

PAGE 257

257 Holman, R.T. 1964. Nutritional and metabolic interrelationships between fatty acids. Fed. Proc. 23:1962 1967. Huang, L.S., N.D. Hung, D. Sok, and M.R . Kim. 2010. Lysophosphatidylcholine containing docosahexaenoic acid at the sn 1 position is anti inflammatory. Lipids 45:225 236. Hutchinson, I.A., A.A. Hennessy, S.M. Waters, R.J. Dewhurst, A.C.O. Evans, P. Lonergan, and S.T. Butler. 2012. Effect of supp lementation with different fat sources on the mechanisms involved in reproductive performance in lactating dairy cattle. Theriogenology 78:12 27. Hylemon, P.B., H. Zhou, W.M. Pandak, S. Ren, G. Gil, and P. Dent. 2009. Bile acids s regulatory molecules. J. Lipid Res. 50:1509 1520. Jakobsson, A., R. Westerberg, and A. Jacobsson. 2006. Fatty acid elongases in mammals: Their regulation and roles in metabolism. Prog. Lipid Res. 45:237 249. Jenkins, T.C., R.J. Wallace, P.J. Moate, and E.E. Mosley. 2008. Board inv ited review: Recents advances in biohydrogenation of unsaturated fatty acids within the rumen microbial ecosystem. J. Anim. Sci. 86:397 412. Johnson , M. M., and J. P. Peters. 1993. Techincal note: An improved method to quantify nonesterified fatty acids in bovine plasma. J. Anim. Sci. 71:753 756. Jones, D.C., X. Ding, and R.A. Daynes. 2002. Nuclear receptor peroxisome proliferator activated receptor (PPAR ) is expressed in resting murine lymphocytes. The PPAR in T and B lymphocytes is both transactivat ion and trasrepression competent. J. Biol. Chem. 277:6838 6845. Jones, J.I., and D.R. Clemmons. 1995. Insulin like growth factors and their biding proteins: biological actions. Endocr. Rev. 16:3 34. Juchem, S.O., J.E.P. Santos, R.L.A. Cerri, R.C. Chebel, K .N. Galvão, R. Bruno, E.J. DePeters. 2008. Effect of calcium salts of fish and palm oils on lactational performance of Holstein cows. Anim. Feed Sci. Technol. 140:18 38. Juchem, S.O., R.L.A. Cerri, M. Villaseñor, K.N. Galvão, R.G.S. Bruno, H.M. Rutigliano, E.J. DePeters, F.T. Silvestre, W.W. Thatcher, and J.E.P. Santos. 2010. Supplementation with calcium salts of linoleic and trans octadecenoic acids improves fertility of lactating dairy cows. Reprod. Dom. Anim. 45:55 62. Jump, D. M. 2002. Dietary polyunsat urated fatty acids and regulation of gene transcription. Curr. Opin. Lipidol. 13:155 164. Katoh, N. 2002. Relevance of apolipoproteins in the development of fatty liver and fatty liver related peripartum diseases in dairy cows. J. Vet. Med. Sci. 64:293 307 . Keenan, T.W., and S. Patton. 1970. Cholesterol esters of milk and mammary tissue. Lipids 5:42 48.

PAGE 258

258 Keenan, T.W., D.J. Morré, D.E. Olson, W.N. Yunghans, and S. Patton. 1970. Biochemical and morphological comparison of plasma membrane and milk fat globule m embrane from bovine mammary gland. J. Cell Biol. 44:80 93. Kelley, K.M., Y. Oh, S.E. Gargosky, Z. Gucev, T. Matsumoto, V. Hwa, L. Ng, D. M. Simpson, and R. G. Rosenfeld. 1996. Insulin like growth factor binding proteins (IGFBPs) and their regulatory dynamic s. Int. J. Biochem. Cell Biol. 28:619 637. Kew, S., T. Banerjee, A.M. Minihane, Y.E. Finnegan, C.M. Williams, and P.C. Calder. 2003. Relation between the fatty acid composition of peripheral blood mononuclear cells and measures of immune cell function in h ealthy, free living subjects aged 25 72 y ears . Am. J. Clin. Nutr. 77:1278 1286. Khanapure, S.P., D.S. Garvey, D.R. Janero, and L.G. Letts. 2007. Eicosanoids in inflammation: biosynthesis, pharmacology, and therapeutic frontiers. Curr. Top. Med. Chem. 7:311 340. Kindahl, H., L.E. Edqvist, E. Granstrom, and A. Bane. 1976. Release of prostaglandin F2alpha as reflected by 15 Keto 13,14 Dihydroprostaglandin F2alpha in peripheral circulation during normal luteolysis in heifers. Prostaglandins 11:871 878. Klasing , K. C., and C. C. Calvert. 1999. The care and feeding of an immune system: an analysis of lysine needs. Pages 253 264 Proc. 8th International Symposium on Protein Metabolism and Nutrition, Aberdeen, Scotland; Ed. G.E. Lobley, A. White, and J.C. Macrae, Wa geningen Academic Publishers. Kong, F., B. Binas, J. H. Moon, S. S. Kang, and H. J. Kim. 2013. Differential expression of adenylate kinase 4 in the context of disparate stress response strategies of HEK293 and HepG2 cells. Arch. Biochem. Biophys. 533:11 17 . Kramer , J. K. G., V. Feliner, M. E. R. Dugan, F. D. Sauer, M. M. Mossoba, and M. P. Yarawecz, 1997. Evaluating acid and base catalysts in the methylation of milk and rumen fatty acids with special emphasis on conjugated dienes and total trans fatty acids . Lipids 32:1219 1228. Kumar, A., Y. Takada, A.M. Boriek, and B.B. Aggarwal. 2004. Nuclear factor B:its role in health and disease. J. Mol. Med. 82:434 448. Lee, J.Y., K.H. Sohn, S.H. Rhee, and D. Hwang. 2001. Saturated fatty acids, but not unsaturated fa tty acids, induce the expression of cyclooxygenase 2 mediated through Toll like receptor 4. J. Biol. Chem. 276:16683 16689. Leonard, A.E., S.L. Pereira, H. Sprecher, and Y S. Huang. 2004. Elongation of long chain fatty acids. Prog. Lipid Res. 43:36 54. Le roy, J.L.R., T. Vanholder, B. Mateusen, A. Christophe, G. Opsomer, A. de Kruif, G. Genicot, and A. Van Soom. 2005. Non esterified fatty acids in follicular fluid of dairy cows and their effect on developmental capacity of bovine oocytes in vitro. Reproduct ion 130:485 495.

PAGE 259

259 Leroy, J.L.M.R., T. Vanholder, G. Opsomer, A. Van Soom, and A de Kruif. 2006. The in vitro development of bovine oocytes after maturation in glucose and hydroxybutyrate concentrations associated with negative energy blance in dairy cows. Reprod. Dom. Anim. 41:119 123. Leroy, J.L.M.R., D. Rizos, R. Sturmey, P. Bossaert, A. Gutierrez Adan, V. Van Hoeck, S. Valckx, and P.E.J. Bols. 2011. Intrafollicular conditions as a major link between maternal metabolism and oocyte quality: a focus on dai ry cow fertility. Reprod. Fertil. Dev. 24:1 12. Levy, B. 2010. Resolvins and protectins: Natural pharmacophores for resolution biology. Prostag. Leuk ot. Essent. Fatty Acids. 82 :327 332. Ley, K., C. Laudanna, M.I. Cybulsky, and S. Nourshargh. 2007. Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nature Rev. Immunol. 7:678 689. Lim , Y. K., A. Jenner, A. bin Ali, Y. P. Wang, S. I. H. Hsu, S. M. Chong, H. Baumman, B. Halliwell, and S. K. Lim. 2000. Haptoglobin reduces renal oxidativ e DNA and issue damage during phenylhydrazine induced hemolysis. Kidney Int. 58:1033 1044. Lima, F.S. 2013. Manipulating ovarian function and uterine health with the aim of improving fertility in dairy cattle. PhD dissertation. Department of Animal Science s, University of Florida, Gainesville. Lindsay, D.B. and W.M.F. Leat. 1977. Oxidation and metabolism of linoleic acid in fed and fasted sheep. J. Agric. Sci. 89:215 221. Liu, G. , and H. Yang. 2013. Modulation of macrophage activation and programming in imm unity. J. Cell. Physiol. 228:502 512. Lock, A.L., K.J. Harvatine, J.K. Drackley, and D.E. Bauman. 2006. Concepts in fat and fatty acid digestion in ruminants. Pages 85 100 in Proc. Intermountain Nutrition Confere nce. Salt Lake City, UT . Loor, J.J, K. Ueda, A. Ferlay, Y. Chilliard, and M. Doreau. 2005 a . Intestinal flow and digestibility of trans fatty acids and conjugated linoleic acids (CLA) in dairy cows fed a high concentrate diet supplemented with fish oil, linseed oil, or sunflower oil. Anim. Feed Sci. Technol. 119:203 225. Loor, J.J, H.M. Dann, R.E. Everts, R. Oliveira, C.A. Green, N.A. Janovick Guretzky, S.L. Rodrigues Zas, H.A. Lewin, and J.K. Drackley. 2005b . Temporal gene expression profiling of liver from periparturient dairy cows reveals complex adaptative mechanisms in hepatic function. Physiol. Genomics 23:217 226. Loor, J.J., R.E. Everts, M. Bionaz, H.M. Dann, D.E. Morin, R. Oliveira, S.L. Rodriguez Zas, J.K. Drackley, and H.A. Lewin. 2007. Nutrition induced ketosis alters metabolic and signali ng gene networks in liver of periparturient dairy cows. Physiol. Genomics 32:105 116.

PAGE 260

260 Loor, J. J. 2010. Genomics of metabolic adaptations in the peripartal cow. Animal 4:1110 1139. Maia, M.R.G., L.C. Chaudhary, L. Figueres, and R.J. Wallace. 2007. Metaboli sm of polyunsaturated fatty acids and their toxicity to the microflora of the rumen. Antonie van Leeuwenhoek 91:303 314. Maia, MRG, L.C. Chaudhary, C.S. Bestwick, A.J. Richardson, N. McKain, T.R. Larson, I.A. Grahanm, R.J. Wallace. 2010. Toxicity of unsatu rated fatty acids to the biohydrogenating ruminal bacterium, Butyrivibrio fibrisolvens . BMC Microbiology 10:52 62. Maczulak, A.E., B.A. Dehority, and D.L. Palmquist. 1981. Effects of long chain fatty acids on growth of rumen bacteria. Appl. Environ. Microb iol. 42:856 862. Makimura, S., and N. Suzuki. 1982. Quantitative determination of bovine serum haptoglobin and its elevation in some inflammatory diseases. Jpn. J. Vet. Sci. 44:15 21. Mallard, B.B., J.C. Dekkers, M.J. Ireland, K.E. Leslie, S. Sharif, C.L. Vankampen, L. Wagter, and B.N. Wilkie. 1998. Alterations in immune responsiveness during the peripartum period and its ramification on dairy cow and calf health. J. Dairy Sci. 81:585 595. oxytocin receptor development during luteolysis in the cow. Anim. Reprod. Sci. 93:328 336. Manna, P.R., M.T. Dyson, and D.M. Stocco. 2009. Regulation of the steroidogenic a cute regulatory protein gene expression: present and future perspectives. Mol. Hum. Reprod. 15:321 333. Marcos, E., A. Mazur, P. Carder , and Y. Rayssiguier. 1990. Serum apolipoproteins B and A I and naturally occurring fatty liver in dairy cows. Lipids. 25 :575 577. Marsh , W. H, B. Fingerhut, and H. Miller. 1965. Automated and manual direct methods for the determination of blood urea. J. Clin. Chem. 6:624 627. Martinez, N., C.A. Risco, F.S. Lima, R.S. Bisinotto, L.F. Greco, E.S. Ribeiro, F. Maunsell, K.N. Ga lvão, and J.E.P. Santos. 2012. Evaluation of peripartal calcium status, energetic profile, and neutrophil function in dairy cows at low or high risk of developing uterine disease. J. Dairy Sci. 95:7158 7172. Martinez, N., L.D.P. Sinedino, R.S. Bisinotto, E .S. Ribeiro, G.C. Gomes, F.S. Lima, L.F. Greco, C.A. Risco, K.N. Galvão, D. Taylor Rodriguez, J.P. Driver, W.W. Thatcher, and J.E.P. Santos. 2014. Effect of induced subclinical hypocalcemia on physiological responses and neutrophil function in dairy cows. J. Dairy Sci. 97:874 887. Mashek, D. G., S. J. Bertics, and R. R. Grummer. 2002. Metabolic fate of long chain unsaturated fatty acids and their effects on palmitic acid metabolism and gluconeogenesis in bovine hepatocytes. J. Dairy Sci. 85: 2283 2289.

PAGE 261

261 Matt os R . , C.R. Staples , and W.W. Thatcher. 2000. Effects of dietary fatty acids on reproduction in ruminants. Rev. Reprod. 5:38 45. Mattos, R., C.R. Staples, J. Williams, A. Amorocho, M.A. McGuire, and W.W. Thatcher. 2002. Uterine, ovarian, and production res ponses of lactating dairy cows to increasing dietary concentrations of menhaden fish meal. J. Dairy Sci. 85:755 764. Mattos, R., A. Guzeloglu, L. Badinga, C.R. Staples, and W.W. Thatcher. 2003. Polyunsaturated fatty acids and bovine interferon rbol ester induced secretion of 2 and phospholipase A2 in bovine endometrial cells. Biol. Reprod. 69:780 787. Mattos, R., C.R. Staples, A. Arteche, M.C. Wiltbank, F.J. Diaz, T.C. Jenki ns, and W.W. Thatcher. 2004. The effects of feeding fish oil on uterine secretion of PGF , milk composition, and metabolic status of periparturient Holstein cows. J. Dairy Sci. 87:921 932. Mattos, W. and D.L. Palmquist. 1977. Biohydrogenation and availa bility of linoleic acid in lactating cows. J. Nutr. 107:1755 1761. Biol. Chem. 82:247 366. McCracken, J.A., J.C. Carlson, M.E. Glew, J.R. Goding, D.T. Baird, K. Gree m and B. Samuelsson. 1972. Prostaglandin F identified as a luteolytic hormone in sheep. Nat. New Biol. 238:129 134. Mikamura, S. and Suzuki, N. 1982. Quantitative determination of bovine serum haptoglobin and its elevation in some inflammatory diseases. Jpn. J. Vet. Sci. 44:15 21. Moallem, U., M . Katz, H. Lehrer, L. Livshitz, and S. Yakoby. 2007. Effects of peripartum propylene glycol or fats differing in fatty acid profiles on feed intake, production, and plasma metabolites in dairy cows. J. Dairy Sci. 90:3846 3856. Moate, P.J., W. Chalupa, R.C. Boston, and I.J. Lean. 2008. Milk fatty acids II: Prediction of the production of individual fatty acids in bovine milk. J. Dairy Sci. 91:1175 1188. Moussavi , A.R., R.O. Gilbert, T.R. Overton, D.E. Bauman, and W.R. Butler. 2007. Effects of feeding fish me al and n 3 fatty acids on ovarian and uterine responses in early lactatin g dairy cows. J Dairy Sci. 90 : 145 154. Murphy, K. P. 2011 a . Basic concepts in immunology. Pages 1 Murphy, K ed. Garland Science, New York, USA. Murphy, K. P. 2011b. Antigen presentation to T lymphocytes. Pages 201 Immunobiology. Murphy, K ed. Garland Science, New York, USA.

PAGE 262

262 Nascimento, A.B., A.H. Souza, A. Keskin, R. Sartoir, and M.C. Wiltbank. 2014. Lack of complete regression of the Day 5 corpus luteum after one or two doses of PGF in nonlactating Holstein cows. Theriogenology 81:389 395. Nathan, C. 2002. Points of control in inflammation. Nature 420:846 885. Nelson, D.L., and M.M. Cox. 2008. Lipids. Pages 343 367 in Lehninger: Principl es of Biochemistry. Nelson, D.L., and M.M. Cox, ed. W. H. Freeman and Company, New York, USA. Nishimura, R., R. Sakumoto, Y. Tatsukawa, T.J. Acosta, and K. Okuda. 2006. Oxygen concentration is an important factor for modulating progesterone synthesis in b ovine corpus luteum. Endocrinology 147:4273 4280. NRC . 2001. Nutrient Requirements of Dairy Cattle. 7th rev. ed. Natl. Acad. Sci., Washington, DC. Odens, L.J., R. Burgos, M. Innocenti, M.J. VanBaale, and L.H. Baumgard. 2007. Effects of varying doses of sup plemental conjugated linoleic acid on production and energetic variables during the transition period. J. Dairy Sci. 90:293 305. Megaro, J.L. Capper, W.P. Weiss, and D.E. Bauman. 2012. Effect of linoleic acid and dietary vitamin E supplementation on sustained conjugated linoleic acid production in milk fat from dairy cows. J. Dairy Sci. 95:7299 7307. acid methyl ester synthesis: Application to wet meat tissues, oils, and feedstuffs. J. Anim. Sci. 85:1511 1521. Oldick, B.S., C.R. Staples, W.W. Thatcher, and P. Gyawu. 1997. Abomasal infusion of glucose and fat Effect on digestion, production, and ovarian and uterine functions of cows. J. Dairy Sci. 80:1 315 1328. Olsen, S.F., J.D. Sorensen, N.J. Secher, M. Hedegaard, T.B. Henriksen, H.S. Hansen, and A. Grant. 1991. Randomized controlled trial of effect of fish oil supplementation on pregnancy duration. Lancet 339:1003 1007. Onetti, S.G. , and R.R. Grummer. 2004. Response of lactating cows to three supplemental fat sources as affected by forage in the diet and stage of lactation: a meta analysis of literature. Anim. Feed Sci. Technol. 115:65 82. Österreicher, C. H., K. Taura, S. Minicis, E. Seki, M. Penz Öst erreicher, Y. Kodama, J. Kluwe, M. Schuster, G. Y. Oudit, J. M. Penninger, and D. A. Brenner. 2009. Angiotensin converting enzyme 2 inhibits liver fibrosis in mice. Hepatology 50:929 938. Padua, M.B., and P.J. Hansen. 2008. Regulation of DNA synthesis and the cell cycle in human prostate cancer cells and lymphocytes by ovine uterine serpin. BMC Cell Biol. 9:1471 2121.

PAGE 263

263 Palmonari, A., D.M. Stevenson, D.R. Mertens, C.W. Cruywagen, and P.J. Weimer. 2010. pH dynamics and bacterial community composition in the rumen of lactating dairy cows. J. Dairy Sci. 93:279 287. Palmquist, D.L., and T.C. Jenkins. 1980. Fat in lactation rations: Review. J. Dairy Sci. 63:1 14. Papadopoulos, G.A., D.G.D. Maes, S. van Weyenberg, T.A.T.G. van Kempen, J. Buyse, and G.P.J. Janssens . 2009. Peripartal feeding strategy with different n 6:n 3 ratios in sows: J. Nutr. 101:348 357. Park, J. R., J. W. Jung, M. S. Seo, S. K. Kang, Y. S. Lee, and K. S. Ka ng. 2010. DNER modulates adipogenesis of human adipose tissue derived mesenchymal stem cells via regulation of cell proliferation. Cell Prolif. 43:19 28. Petit, H.V., R.J. Dewhurst, N.D. Scollan, J.G. Proulx, M. Khalid, W. Haresign, H. Twagiramungu, and G. E. Mann. 2002. Milk production and composition, ovarian function, and prostaglandin secretion of dairy cows fed omega 3 fats. J. Dairy Sci. 85:889 899. Petit, H.V., C. Germlquet, and D. Lebel. 2004. Effect of feeding whole, unprocessed sunflower seeds and flaxseed on milk production, milk composition, and prostaglandin secretion in dairy cows. J. Dairy Sci. 87:3889 3898. Petit, H.V. , and H. Twagiramungu. 2006. Conception rate and reproductive function of dairy cows fed different fat sources. Theriogenology 66:1316 1324. Petit, H.V., M.F. Palin, and L. Doepel. 2007. Hepatic lipid metabolism in transition dairy cows fed flaxseed. J. Dairy Sci. 90:4780 4792. Poyser, N.L. 1995. The control of prostaglandin production by the endometrium in relation to luteolysis a nd menstruation. Prostaglandins Leukot . Essent . Fatty Acids 53:147 195. Pratt, B.R., R.L. Butcher, and E.K. Inskeep. 1977. Antiluteolytic effect of the conceptus and of PGE 2 in ewes. J. Anim Sci. 45:784 791. Pruessner, J.C., C. Kirschbaum, G. Meinlschmid, and D.H. Hellhammer. 2003. Two formulas for computation of the area under the curve represent measures of total hormone concentration versus time dependent change. Psychoneuroendocrinology 28:916 931. Procknor, M., S. Dachir, R.E. Owens, D.E. Little, and P.G. Harms. 1986. Temporal relationship of the pulsatile fluctuation of luteinizing hormone and progesterone in cattle: A time series cross correlation analysis. J. Anim. Sci. 62:191 198. Quintão, E.C.R. 1995. Is reverse cholesterol transport a misnomer fo r suggesting its role in the prevention of atheroma formation? Atherosclerosis 116:1 14.

PAGE 264

264 Rabiee, A.R., K. Breinhild, W. Scott, H.M Golder, E. Block, and I.J. Lean. 2012. Effect of fat additions to diets of dairy cattle on milk production and components: A meta analysis and meta regression. J. Dairy Sci. 95:3225 3247. Rehman, A. A., H. Ahsan, and F. H. Khan. 2013. Alpha 2 macroglobulin: A physiological guardian. J. Cell. Phys. 228:1665 1675. Reis, M.M., R.F. Cooke, J. Ranches, and J.L.M. Vasconcelos. 2012. E ffects of calcium salts of polyunsaturated fatty acids on productive and reproductive parameters of lactating Holstein cows. J. Dairy Sci. 95:7039 7050. Relling, A.E., C.K. Reynolds, and S.C. Loerch. 2011. Effect of feeding fat or intrajugular infusion of glucagon like peptide 1 and cholecystokinin on dry matter intake, digestibility, and digesta rate of passage in growing wethers. J. Anim. Sci. 89:168 178. Renaville, R., M. Hammadi, D. Portetelle. 2002. Role of the somatotropic axis in the mammalian metabo lism. Domest. Anim. Endocrinol. 23:351 360. Rezamand, P., J.S. Watts, K.M. Yavah, E.E. Mosley, L. Ma, B.A. Corl, and M.A. McGuire. 2014. Relationship between stearoyl CoA desaturase 1 gene expression, relative protein abundance, and its fatty acid products in bovine tissues. J . Dairy Res. 81:333 339. Robinson, R.S., P.G.A. Pushpakumara, Z. Cheng, A.R. Peters, D.R.E. Abayasekara, and D.C. Wathes. 2002. Effects of dietary polyunsaturated fatty acids on ovarian and uterine function in lactating dairy cows. Rep roduction 124:119 131. Roche, J.R., D.P. Berry, and E.S. Kolver. 2006. Holstein Friesian strain and feed effects on milk production, body weight, and body condition score profiles in grazing dairy cows. J. Dairy Sci. 89:3532 3543. Roche, J.R., N.C. Friggen s, J.K. Kay, M.W. Fisher, K.J. Stafford, and D.P. Berry. 2009. Invited review: Body condition score and its association with dairy cow productivity, health, and welfare. J. Dairy Sci. 92:5769 5801. Rodgers, R.J. and H.F. Irving Rodgers. 2010. Formation of the ovarian follicular antrum and follicular fluid. Biol. Reprod. 82:1021 1029. Rodrigues Sallaberry, C., C. Caldari Torres, E.S. Greene, and L. Badinga. 2006. Conjugated linoleic acid reduces phorbol ester induced prostaglandin F2 production by bovine en dometrial cells. J. Dairy Sci. 89:3826 3832. Rukkwamsuk, T., M. J. H. Geelen, T. A. M. Kruip, and T. Wensing. 2000. Interrelation of fatty acid composition in adipose tissue, serum, and liver of dairy cows during the development of fatty liver postpartum. J. Dairy Sci. 83:52 59. Sampath, H. and J.M. Ntambi. 2005. Polyunsaturated fatty acid regulation of genes of lipid metabolism. Annu. Rev. Nutr. 25:317 340.

PAGE 265

265 Santos, J.E.P., T.R. Bilby, W.W. Thatcher, C.R. Staples, and F.T. Silvestre. 2008. Long chain fatty acids of diet as factors influencing reproduction in cattle. Reprod. Dom. Anim. 43:23 30. Santos, J.E.P., H.M. Rutigliano, and M.F. Sá Filho. 2009. Risk factors for resumption of postpartum estrous cycles and embryonic survival in lactating dairy cows. Ani m. Reprod. Sci. 110:207 221. Sarentonglaga, B., K. Ogata, Y. Taguchi, Y. Kato, and Y. Nagao. 2013. The developmental potential of oocytes is impaired in cattle with liver abnormalities. J. Reprod. Dev. 59:168 173. SAS Institute. 2009. SAS/STAT 9.2 User's G uide. SAS Inst., Inc., Cary, NC. Schauff, D.J., J.P. Elliott, J.H. Clark, and J.K. Drackley. 1992. Effects of feeding lactating dairy cows diets containing whole soybean and tallow. J. Dairy Sci. 75:1932:1935. Schlegel, G., R.Ringseis, W. Windisch, F.J. Sc hwarz, and K. Eder. 2012. Effects of a rumen protected mixture of conjugated linoleic acids on hepatic expression of genes involved in lipid metabolism in dairy cows. J. Dairy Sci. 95:3905 3918. Scholljegerdes, E.J., S.L. Lake, T.R. Weston, D.C. Rule, G.E. Moss, T.M. Nett, and B.W. Hess. 2007. Fatty acid composition of plasma, medial basal hypothalamus, and uterine tissue in primiparous beef cows fed high linoleate safflower seeds. J. Anim. Sci. 85:1555 1564. Schramm, W., L. Boyaird, M.E. Glew, G. Schramm, and J.A. McCracken. 1983. Corpus luteum regression induced by ultra low pulses of prostaglandin F . Prostaglandin 26:347 364. Seals, R.C., I. Matamoros, and G.S. Lewis. 2002. Relationship between postpartum changes in 13, 14 dihydro 15 keto PGF2alpha concentrations in Holstein cows and their susceptibility to endometritis. J. Anim. Sci. 80:1068 1073. Sears, P.M., M.J. Paape, R.E. Pearson, and F.C. Gwazdauskas. 1978. Comparison between tail vein and jugular vein cannulation in cattle. J. Dairy Sci. 61:974 979. Selberg, K.T., A.C. Lowe, C.R. Staples, N.D. Luchini, and L. Badinga. 2004. Production and me tabolic responses of periparturient Holstein cows to dietary conjugated linoleic acid and trans octadecenoic acids. J. Dairy Sci. 87:158 168. Selberg, K.T., C.R. Staples, N. Dan Luchini, and L. Badinga. 2005. Dietary tras octadecenoic acids upregulate the liver gene encoding peroxisome proliferator activated receptor in transition dairy cows. J. Dairy Res. 72:107 114. Serhan, C.N., A. Jain, S. Marleau, C. Clish, A. Kantarci, B. Behbehani, S.P. Colgan, G.L. Stahl, A. Merched, N.A. Petasis, L. Chan, T.E. Va n Dyke. 2003. Reduced inflammation and tissue damage in transgenic rabbits overexpressing 15 lipoxygenase and endogenous anti inflammatory lipid mediators. J. Immunol. 171:6856 6865.

PAGE 266

266 Serhan, C.N. and J. Savill. 2005. Resolution of inflammation: the beginni ng programs the end. Nat. Immunol. 6:1191 1197. Sheldon, I.M., D.E. Noakes, A. Rycroft, and H. Dobson. 2001. Acute phase protein responses to uterine bacterial contamination in cattle after calving. Vet. Rec. 148:172 175. Sheldon, M., G.S. Lewis, S. LeBlan c, and R.O. Gilbert. 2006. Defining postpartum uterine disease in cattle. Theriogenology 65:1516 1530. Sheldon, I.M., J.G. Cronin, G.D. Healey, C. Gabler, W. Heuwieser, D. Streyl, J.J. Bromfield, A. Miyamoto, C. Fergani, and H. Dobson. 2014. Innate immunit y and inflammation of the bovine female reproductive tract in health and disease. Reproduction 148:R41 51. Sibbons, C.M., J.T. Brenna, P. Lawrence, S.P. Hoile, R. Clarke Harris, K.A. Lillycrop, and G.C. Burdge. 2014. Effect of sex hormones on n 3 polyunsat urated fatty acid biosynthesis in HepG2 cells and in human primary hepatocytes. Prost a gl andins Leukotr. Ess ent . Fatty Acids 90:47 54. Silvestre, F.T., C.A. Risco, M. Lopez, M.J.S. de Sá, T.R. Bilby, and W.W. Thatcher. 2009. Use of increasing doses of a deg radable Deslorelin implant to enhance uterine involution in postpartum lactating dairy cows. Anim. Reprod. Sci. 116:196 212. Silvestre, F.T., T.S.M. Carvalho, P.C. Crawford, J.E. Santos, C.R. Staples, T. Jenkins, and W.W. Thatcher. 2011a. Effects of differ ential supplementation of fatty acids during the peripartum and breeding periods of Holstein cows: II. Neutrophil fatty acids and function, and acute phase proteins. J. Dairy Sci. 94:2285 2301. Silvestre, F.T., T.S.M. Carvalho, N. Francisco, J.E.P. Santos, C.R. Staples, T.C. Jenkins, and W.W. Thatcher. 2011b. Effects of differential supplementation of fatty acids during the peripartum and breeding periods of Holstein cows: I. Uterine and metabolic responses, reproduction, and lactation. J. Dairy Sci. 94:189 204. Silvia, W.J., G.S. Lewis, J.A. McCracken, W.W. Thatcher, and L. Wilson Jr. 1991. Hormonal regulation of uterine secretion of prostaglandin F during luteolysis in ruminants. Biol. Reprod. 45:655 663. Simas, J.M., J.T. Hubber, Z. Wu, K.H. Chen, S.C. Chan, C.B. Theurer, and R.S. Swingle. 1995. Influence of steam flaked sorghum grain and supplemental fat on performance of dairy cows in early lactation. J. Dairy Sci. 78:1526 1533. Simopoulos, A.P. 2000. Symposium: Role of poultry products in enriching th e human diet with n 3 PUFA. Human requirement for n 3 polyunsaturated fatty acids. Poultry Sci. 79:961 970. Singer, P., H. Shapiro, M. Theilla, R. Anhar, J. Singer, and J. Cohen. 2008. Anti inflammatory properties of omega 3 fatty acids in critical illness : novel mechanisms and an integrative perspective. Intensive Care Med. 34:1580 1592.

PAGE 267

267 Smith, W.A., B. Harris Jr., H.H. Van Horn, and C.J. Wilcox. 1993. Effects of forage type on production of dairy cows supplemented with whole cottonseed, tallow, and yeast. J. Dairy Sci. 76:205 215. Smits, E., C. Burvenich, and R. Heyneman. 1997. Simultaneous flow cytometric measurement of phagocytotic and oxidative burst activity of polymorphonuclear leukocytes in whole bovine blood. Vet. Immunol. Immunopathol. 56:259 269. Sordillo, L.M., G.A. Contreras, and S.L. Aitken. 2009. Metabolic factors affecting the inflammatory response of periparturient dairy cows. Anim al Health Research Reviews 10 :53 63. Soret, B., H J. Lee, E. Finley, S.C. Lee, and R.G. Vernon. 1999. Regulation of differentiation of sheep subcutaneous and abdominal preadipocytes in culture. J. Endoc. 161:517 524. Sprecher, H. 2000. Metabolism of highly unsaturated n 3 and n 6 fatty acids. Biochim. Biophs. Acta 1486:219 231. St. John, L. C., D. K. Lunt, and S. B. Smith. 1991. Fatty acid elongation and desaturation enzyme activities of bovine liver and subcutaneous adipose tissue microsomes. J. Anim. Sci. 69:1064 1073. Stahl, A.L., D.J. Hirsch, R.E. Gimeno, S. Punreddy, P. Ge, N. Watson, S. Patel, M. Kolter, A. Rai mondi, L.A. Tartaglia, and H.F. Lodish. 1999. Identification of the major intestinal fatty acid transport protein. Mol . Cell 4:299 308. Staples, C.R., J.M. Burke, and W.W. Thatcher. 1998. Influence of supplemental fats on reproductive performance of lactat ing cows. J. Dairy Sci. 81:856 871. Stocco, D.M., X. Wang, Y. Jo, and P.R. Manna. 2005. Multiple signaling pathways regulating steroidogenesis and steroidogenic acute regulatory protein expression: more complicated than we thought. Mol. Endocrinol. 19:264 7 2659. Takahashi, Y., H. Konishi, K. Sato, T. Oohashi, and T. Miyamoto. 2004. Enzyme linked immunosorbent assay for bovine apolipoprotein A IV. J. Vet. Med. Sci. 66:1199 1204. Thering, B.J., M. Bionaz, and J.J. Loor. 2009. Long chain fatty acid effects on peroxisome proliferator activated receptor regulated genes in Madin Darby bovine kidney cells: Optimization of culture conditions using palmitate. J. Dairy Sci. 92:2027 2037. Thompson, I.M., M. Ozawa, J.W. Bubolz, Q. Yang, and G.E. Dahl. 2011. Bovine lu teal prolactin receptor expression: Potential involvement in regulation of progesterone during the estrous cycle and pregnancy. J. Anim. Sci. 89:1338 1346. Vachier, I., P. Chanez, C. Bonnans, P. Godard, J. Bousquet, and C. Chavis. 2002. Endogenous anti inf lammatory mediators from arachidonate in human neutrophils. Biochem. Biophys. Res. Commun. 290:219 224.

PAGE 268

268 Van Soest, P.J., J.B. Robertson, B.A. Lewis. 1991. Methods of dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to anima l nutrition. J Dairy Sci. 74: 3583 3597. Van Soest, P. 1994. Lipids. Pages 325 336 in Nutritional ecology of the ruminant. Van Soest, P. Cornell University Press. Ithaca, NY, USA. Vanholder, T., J.L.M.R. Leroy, A. Van Soom, G. Opsomer, D. Maes, M. Coryn, a nd A. de Kruif. 2005. Effect of non esterified fatty acids on bovine granulosa cell steroidogenesis and proliferation in vitro. Anim. Reprod. Sci. 87:33 44. Varga, T., Z. Czimmerer, and L. Nagy. 2011. PPARs are a unique set of fatty acid regulated transcri pition factors controlling both lipid metabolism and inflammation. Biochim. et Biophys. Acta 1812:1007 1022. Vernay, M. C. M. B., O. Wellnitz, L. Kreipe, H. A. van Dorland, and R. M. Bruckmaier. 2012. Local and systemic responses to intramammary lipopolysa ccharide challenge during long term manipulated plasma glucose and insulin concentrations in dairy cows. J. Dairy Sci. 95:2540 2549. Vijay Kumar, M., S. M. Vanegas, N. Patel, J.D. Aitken, T. R. Ziegler, and V. Ganji. 2011. Fish oil rich diet in comparison to saturated fat rich diet offered protection against lipopolysaccharide induced inflammation and insulin resistance in mice. Nutr. Metabol. 8:8 16. Wahli, W. and L. Michalik. 2012. PPARs at the crossroads of lipid sign aling and inflammation. Trends Endocr in ol . M etab. 23:351 363. Wallace, R.J., L.C. Chaudhary, N. McKain, N.R. McEwan, A.J. Richardson, P.E. Vercoe, N.D. Walker, and D. Paillard. 2006. FEMS Microbiol. Lett. 265:195 201. Waters, S.M., G.S. Coyne, D.A. Kenny, D.E. MacHugh, and D.G. Morris. 2012. Dietary n 3 polyunsaturated fatty acid supplementation alters the expression of genes involved in the control of fertility in the bovine uterine endometrium. Physiol. Genomics 44:878 888. Watts, J.S., P. Rezamand, D.L. Sevier, W. Price, and M.A. McGuire. 2 013. Short term effects of dietary trans fatty acids compared with saturated fatty acids on selected measures of inflammation, fatty acid profiles, and production in early lactating Holstein dairy cows. J. Dairy Sci. 96:6932 6943. Weatherill, A.R., J.Y. Le e, L . Zhao, D.G. Lemay, H.S. Youn, a nd D.H. Hwang. 2005. Saturated and polyunsaturated fatty acids reciprocally modulate dendritic cell function mediated through TLR4. J. Immunol. 174:5390 5397. Weber, P.S.D., S.A. Madsen, G.W. Smith, J.J. Ireland, and J. L. Burton. 2001. Pre translational regulation of neutrophil L selectin in glucocorticoid challenged cattle. Vet. Immunol. Immunopathol. 83:213 240.

PAGE 269

269 Whitlock, L.A., D.J. Schingoethe, A.R. Hippen, K.F. Kalscheur, R.J. Baer, N. Ramaswamy, and K.M. Kasperson. 2002. Fish oil and extruded soybeans fed in combination increase conjugated linoleic acids in milk of dairy cows more than when fed separately. J. Dairy Sci. 85:234 243. Wu, Z., R. A. Irizarry, R. Gentleman, F. Martinez Murillo, and F. Spencer. 2004. A mod el based background adjustment for oligonucleotide expression arrays. J. Am. Stat. Assoc. 99:909 917. Yoon, M. J., G. Y. Lee, J. Chung, Y. H. Ahn, S. H. Hong, and J. B. Kim. 2006. Adiponectin increases fatty acid oxidation in skeletal muscle cells by seque ntial activation of AMP activated protein kinase, p38 mitogen activated protein kinase, and peroxisome proliferator 2570. Yoshikawa, T., H. Shimano, N. Yahagi, T. Ide, M. Amemiya Kudo, T. Matsuzaka, M. Nakakuki, S. To mita, H. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, A. Takahashi, H. Sone, J. Osuga, T. Gotoda, S. Ishibashi, and N. Yamada. 2002. Polyunsaturated fatty acids suppress sterol regulatory element binding protein 1c promoter activity by inhiiibition of liver X receptor (LXR) biding to LXR response elements. J. Biol. Chem. 277:1705 1711. Zachut, M., I. Dekel, H. Lehrer, A. Arieli, A. Arav, L. Livshitz, S. Yakoby, and U. Moallem. 2010. Effects of dietary fats differing in n6:n3 ratio fed to high yielding dairy co ws on fatty acid composition of ovarian compartments, follicular status, and oocyte quality. J. Dairy Sci. 93:529 545. Zelinski Wooten, M.B. and R.L. Stouffer. 1990. Intraluteal infusions of prostaglandins of the E, D, I, and A series prevent PGF induced , but not spontaneous, luteal regression in rhesus monkeys. Biol. Reprod. 43:507 516. Zhou, H., and P.B. Hylemon. 2014. Bile acids are nutrient signaling hormones. Steroids 86:62 68. Zinn, R. A., and F. N. Owens. 1986. A rapid procedure for purine measurem ent and its use for estimating net ruminal protein synthesis. Can. J. Anim. Sci. 66:157.

PAGE 270

270 BIOGRAPHICAL SKETCH Leandro Ferreira Greco was born to Marlene F. F. Greco and Ivanderlei Greco in the city of Goiânia , GO, Brazil. Lea ndro is the middle of three brothers , and he lived his entire childhood in a small dairy farm in Goiânia . In 2001, he began his studies in veterinary medicine in the School of Veterinary Medicine at the Federal University of Goiás, Goiânia , GO, Brazil. Whi le in vet erinary school , he was awarded twice with sponsored by the National Research Program (PIBIC/CNPq) . D uring th e 2 years of scholarship , he conducted research in beef cattle nutrition and management. As part of his last year in vet erinary school , Leandro came to the U nited S tates to work with nutrition and reproduction of dairy cattle in Dr. José E.P. at the University of California Davis . He graduated in vet erinary medicine in the S pring of 2006 and started his M aster of Science program in the D epartment of Animal S ciences at the University of São Paulo, Escola Superior de Agricultura Luiz de Queiroz in Piracicaba, Brazil, under supervision of Dr. Flávio A. P. Santos. His thesis focused on supplementation of amino acids to lactating dairy cows on grazing systems. In the S pring of 2009, Leandro was awarded with the Animal Molecular and Cellular Biology Fellowship to pursue his doctoral degree with Dr. José E. P. Santos at the University of Florida . Afte r graduation Leandro plans to return to Brazil to start his career as a professor and continue his research on the interaction of nutrition and reproduct ion in dairy cattle.