PAGE 1
1 THE ROLE OF NOTCH SIGNALING IN OVAL CELL -MEDIATED LIVER REGENERATION By HOUDA DARWICHE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2009
PAGE 2
2 2009 Houda Darwiche
PAGE 3
3 To Hind, the reason Im here and the reason I carry on
PAGE 4
4 ACKNOWLEDGMENTS I would like to thank my principle investigator Dr. Bry on Petersen for all that he has given me a deep understanding of not just the intricacies of scientific research, but also for perspective and the ability to see beyond whats there and look at the big picture. He was also there for me during the roughe st patches of my life, and I will never forget the care he took of me and will be eternally thankful. I would also like to thank the members of my supervisory committee: Drs Chen Liu, Phyllis LuValle, and Nao hiro Terada for their guidance and support in my research and on the doctoral as well as post doctoral path. My family and friends have been of the utmost importance in my life, especially for the last five years. Although most of my family lives overseas, an aunt for whom I am named and her son ( my brother ), have helped give me the guidance and strength to get through. Also my lab mates have been there for me through it all, and I can never really express how much their support has meant to me in particular Nicole Steiger and Dr. SehHoon Oh. I wo uld also like to thank the friends I have amassed during my time here in Gainesville, as well as those who preceeded them from Polk County. There is one last person to thank my mother, who passed away during my fourth year of graduate school My mother sacrificed many things in life in order for me to have the best schooling, and it seemed that my dream of becoming a scientist was as much hers as it was mine. Were it not for her I would not have made it this far nor would I be the person I am today, and it is with a contented but heavy heart that I move towards graduation, with only the hope that she is watching.
PAGE 5
5 TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................................... 4 L IST OF TABLES ................................................................................................................................ 8 LIST OF FIGURES .............................................................................................................................. 9 LIST OF ABBREVIATIONS ............................................................................................................ 11 CHAPTER 1 INTRODUCTION ....................................................................................................................... 15 2 BACKGROUND AND SIGNIFICANCE ................................................................................. 18 2.1 The Liver ............................................................................................................................... 18 2.1.1 Gross Anatomy ........................................................................................................... 1 8 2.1.2 Hepatic Microarchitecture ......................................................................................... 18 2.1.3 Cell Types of the Liver .............................................................................................. 19 2.2 The Functions of the Liver ................................................................................................... 21 2.2.1 Metabolic Homeostasis .............................................................................................. 21 2.2.2 Molecular Silo ............................................................................................................ 21 2.2.3 Detoxification ............................................................................................................. 22 2.2.4 Production of Bile ...................................................................................................... 22 2.3 Hepatic Regen eration ............................................................................................................ 23 2.3.1 General Considerations .............................................................................................. 23 2.3.2 Models of Regeneration ............................................................................................. 23 2.4 Liver Stem Cell Biology ....................................................................................................... 24 2.4.1 The Oval Cell .............................................................................................................. 24 2.4.2 Canals of Hering: Putative Oval Cell Niche ............................................................. 25 2.4.3 Oval Cell Plasticity ..................................................................................................... 26 2.4.4 Oval Cell Mediated Liver Regeneration ................................................................... 26 2.4.5 Clinical Applications for the Oval Cell ..................................................................... 28 2.4.6 Liver Stem Cells and Hepatocellular Carcinoma ..................................................... 29 2.5 The Notch Signalin g Pathway .............................................................................................. 30 2.5.1 General Considerations .............................................................................................. 30 2.5.2 A Brief History ........................................................................................................... 31 2.5.3 Structure of the (Mammalian) Notch Gene .............................................................. 31 2.5.4 Notch Signal Transduction ........................................................................................ 32 2.5.5 Effectors of the Notch Cascade ................................................................................. 33 2.5.6 Hepatic Notch Expression ......................................................................................... 34 2.5.7 Functions of Notch Signaling .................................................................................... 34 2.5.8 Notch and Wnt: A Delicate Balance ......................................................................... 35 2.5.9 Notch-Induced Pathologies ........................................................................................ 36
PAGE 6
6 2.5.9.1 Cerebral Dominant Arteriopathy w ith Subcortical Infarcts and Leukoencephalopathy (CADASIL) ......................................................................... 36 2.5.9.2 Spondylocostal Dysostosis .............................................................................. 37 2.5.9.3 Alagille Syndrome ........................................................................................... 37 2.5.10 Notch and Cancer ..................................................................................................... 39 2.5.10.1 Notch as an oncogene .................................................................................... 40 2.5. 10.2. Notch as a tumor suppressor ........................................................................ 41 3 SPECIFIC AIMS ......................................................................................................................... 49 3.1 Specific Aim I ................................................................................................................ 50 3.2 Specific Aim II .............................................................................................................. 51 4 MATERIALS AND METHODS ............................................................................................... 53 4.1 Animal Studies ...................................................................................................................... 53 4.1.1 Animals and Animal Housing Facilities ................................................................... 53 4.1.2 Animal Sacrifice and Tissue Collection ................................................................... 54 4.1.3 Rat M odel of Oval Cell Induction ............................................................................. 54 4.1.3.1 2AAF pellet i mplantation ................................................................................ 54 4.1.3.2 Twothirds p artial h epatectomy ...................................................................... 55 4.2 Model for Inhibition of Notch Signaling in the Rat ............................................................ 56 4.3 RNA Analysis ....................................................................................................................... 57 4.3.1 Isolation of RNA from Tissue ................................................................................... 57 4.3.2 RT PCR ....................................................................................................................... 58 4.3.3 Real Time RT PCR .................................................................................................... 59 4.4 Protein Analysis .................................................................................................................... 59 4.4.1 Isolation of Protein from Tissue ................................................................................ 59 4.4.2 Protein Quantification with DC Protein Assay ........................................................ 59 4.4.3 Western Blot Analysis of Protein Levels .................................................................. 60 4.5 Histology and Immunohistochemistry ................................................................................. 61 4.5.1 Hematoxylin and Eosin of Paraffin-Embedded Tissue ............................................ 61 4.5.2 Hematoxylin and Eosin of Frozen Tissue ................................................................. 62 4.5.3 Immunohistochemistry: Chromagen Staining .......................................................... 62 4.6 Index of Solutions ................................................................................................................. 63 5 RESULTS .................................................................................................................................... 68 5.1 Analysis of Notch Family Expression During Oval Cell -Mediated Liver Regeneration ............................................................................................................................ 68 5.2 in vivo Inhibition of Notch Signaling During Oval Cell Induction ................................... 70 6 DISCUSSION AND FUTURE STUDIES ................................................................................ 96 6.1 Summary of Results .............................................................................................................. 96 6 .2 Interpretation of Results ....................................................................................................... 97 6.3 Future Studies ...................................................................................................................... 100 6.3.1 Exposure of O val Cells to Notch1 ........................................................................... 100
PAGE 7
7 6.3.2 Conditional K nockout of Notch1 in vivo ................................................................ 100 6.3.3 Notch and Wnt: Oval Cell F ates H ang in the Balance ....................................... 101 6.3.4 Notch and L iver T umorigenesis .............................................................................. 102 6.3.5 Summary of P roposed E xperiments ........................................................................ 102 LIST OF REFERENCES ................................................................................................................. 103 BIOGRAPHICAL SKETCH ........................................................................................................... 112
PAGE 8
8 LIST OF TABLES Table page 2 1 Cellular markers of the live r. ....................................................................................................... 47 2 2 Components of the Notch signaling cascade. ............................................................................. 48 4 1 PCR Primer Sequences.. .............................................................................................................. 66 4 2 Antibodies utilized for western blot analysis. ............................................................................ 67 4 3 Antibodies utilized for immunohistochemical analysis. ............................................................ 67
PAGE 9
9 LIST OF FIGURES Figure pag e 2 1 Diagram of hepatic architecture. ................................................................................................. 42 2 2 Compensatory hyperplasia after ......................................................... 43 2 3 Cellular growth after ............................................................................ 44 2 4 Oval cell response following ............................................................... 45 2 5 Hepatic oval cell differentiation. ................................................................................................. 46 4 1 Model for oval cell induction. ..................................................................................................... 65 4 2 Model of oval cell induction with Notch inhibition.. ................................................................. 65 5 1 RT -PCR analysis ........................................................................................................................ 75 5 2 Expression of Notch and Jagged via in situ PCR.. ..................................................................... 76 5 3 Analysis of Notch1 protein expression during 2AAF PH.. ....................................................... 77 5 4 Immunohistochemistry for Notch1 and Jagged1. ..................................................................... 78 5 5 Immunofluorescence for activated Notch1 at day 11 post 2AAF -PH. ..................................... 79 5 6 H&E staining of liver from animals on the 2AAF -PH protocol or 2AAF_PH combined with GSIXX. ........................................................................................................................... 80 5 7 Real time PCR analysis for expression of Notch pathway members during 2AAF -PH.. ....... 81 5 8 Real time PCR analysis for expression of Notch pathway members during 2AAF -PH with GSIXX. ........................................................................................................................... 82 5 9 Analysis of Notch1 protei n expression during 2AAF PH with GSIXX.. ................................ 83 5 10 OV 6 staining during the 2AAF -PH protocol or 2AAF -PH with GSIXX.. ........................... 84 5 11 AFP staining during the 2AAF -PH protocol or 2AAF -PH with GSIXX.. ............................. 85 5 12 Analysis of CK19 protein expression during 2AAF -PH or 2AAF PH with GSIXX. .......... 86 5 13 Analysis of HNF1 protein expression during 2AAF -PH or 2AAF PH with GSIXX. ....... 87 5 14 Ki67 staining during the 2AAF -PH protocol or 2AAF -PH with GSIXX.. ............................ 88
PAGE 10
10 5 15 Semi -quantiative analysis of Ki67 staining during the 2AAF PH protocol or 2AAF PH with GSIXX. ........................................................................................................................... 89 5 16 Analysis of p21 protein expre ssion during 2AAF -PH or 2AAF -PH with GSIXX. .............. 90 5 17 Analysis of phospho-AKT protein expression during 2AAF PH or 2AAF PH with GSIXX.. .................................................................................................................................. 91 5 18 Hepatocellular mitoinhibition index for 2AAF -PH alone as well as 2AAF PH with GSIXX.. .................................................................................................................................. 92 5 19 CYP3A2 staining during the 2AAF PH protocol or 2AAF -PH with GSIXX.. ..................... 93 5 20 Analysis of Glucose 6 Phosphatase protein expression during 2AAF -PH or 2AAF PH with GSIXX.. ................................................................................................................... 94 5 21 Diagram depicting involvement of Notch signaling in the differentiation of stem cells/progenitors.. ................................................................................................................... 95
PAGE 11
11 LIST OF ABBREVIATIONS AA Allyl alcohol 2AAF 2 acetoaminofluorine AFP -fetoprotein AGS Alagille Syndrome bp base pair bHLH basic helix -loop-helix CADASIL Cerebral dominant arteriopathy with subcortical infarcts and leukoencephalopathy CCl4 CK Cytokeratin Carbon tetrachloride CYP Cytochrome p450 CCC Cholangiocarcinoma DAB 33 diaminobenzidine DEPC Diethyl pyrocarbonate DIG Digoxigenin DNA Deoxyribonucleic acid ECM Extracellular matrix EGF Epidermal Growth Factor G6Pase Glucose 6 -phosphatase GGT glutamyl -transpeptidase GSI -secretase inhibitor H&E Hematoxylin and Eosin HCC Hepatocellular carcinoma Hes Hairy/Enhancer of Split
PAGE 12
12 HGF Hepatic Growth Fact or HSC Hematopoietic Stem Cell IHC Immunohistochemistry NICD Notch Intracellular Cytoplasmic Domain NPC Non -parenchymal cell OCT Optimal cutting temperature O/N Overnight PBS Phosphate -buffered saline PCR Polymerase chain reaction PH Partial Hepatectomy qP CR quantitative PCR RNA Ribonucleic acid RNase Ribonuclease RPM Revolutions per minute RT PCR Reverse transcription PCR SD Spondylocostal dysostosis TEMED Tetramethylethylenediamine TGF Transforming growth factor
PAGE 13
13 Abstract of Dissertation Presented to th e Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ROLE OF NOTCH SIGNALING IN OVAL CELL -MEDIATED LIVER REGENERATION By Houda Darwiche August 2009 Chair: Bryon E. Petersen Major: Medical Sciences Molecular Cell Biology Activation of the oval cell compartment occurs in the liver when hepatocytes are functionally compromised and/or unable to divide. Our goal is to investigate the systemic signals responsible for determini ng the efficiency of oval cell mediated liver regeneration, focusing on the Notch signaling cascade. The established oval cell induction proto col of 2 Acetylaminofluorine (2 AAF) implantation followed by 70% surgical resection of the liver (PH) was employe d in a rat model. This oval cell induction model was further combined with injections of GSI XX to examine the effects of Notch inhibition on stem cellaided regeneration of the liver. Notch signaling was found to be upregulated at the peak of oval cell induction during 2AAF PH alone. Treatment with GSI XX led to interruption of the Notch signal, as shown by a decrease in expression of Hes1. While there was a robust oval cell response seen at day 11 post PH, there was a measurable delay in differentiati on when Notch was inhibited. This was confirmed morphologically as well as by immunohistochemistry for the oval cell markers AFP, OV 6 and CK19. The hepatocytes seen at day 22 demonstrated an enhanced hepatocellular mitoinhibition index (p21Waf1/Ki67), s uggestive of dysregulated proliferation and cell cycle progression. Moreover these hepatocytes exhibited decreased expression of hepatocyte functional markers such as cytochrome p450 and glucose 6 phosphatase Taken together these
PAGE 14
14 results identify the Notch signaling pathway as a potent regulator of differentiation and proliferation in oval cells and is necessary for functional repair of the liver by oval cells.
PAGE 15
15 CHAPTER 1 INTRODUCTION The signals mediating cellular specification are produced by adjace nt or even distant cells, and often these various signals are received by the cell simultaneously; therefore they must be integrated in proper order for the correct specification of cell fate to occur .1 The Notch family of receptors encompasses a group of proteins that function both as cell surface receptors and as direct regulators of cellular specification, leading to differentiation, cell cycle progression, proliferation or apoptosis .2 5 Generally, activation of the Notch pathway inhibits differentiati on via transcriptional repression of genes specific to a certain cell lineage. This limits the number of cells that will assume a certain lineage and thereby leaves a small number of uncommitted progenitors that are able to adopt alternative cell fates The Notch signaling pathway is said to be activated when the extracellular domain of the Notch receptor is bound by its ligand, preferentially Jagged, on neighboring cells. Following activation the receptor is cleaved by -secretase, leading to release an d translocation of the Notch Intracellular Cytoplasmic Domain (NICD) f rom the cytoplasm to the nucleus .5 6 7 This results in the subsequent activation of transcriptional regulators of genes involved in differentiation, proliferation and apoptosis. Inhibiti on of -secretase has been well documented in the literature as a method for inhibition of the Notch signal .810 Experimental evidence has shown that Notch receptors and ligands are widely distributed, and that the Notch cascade is required for mammalian development and growth in many organ systems, including the liver The liver is the only solid organ in the body with the capacity for rapid regeneration in response to injury. If hepatocytes are prevented from initiating the regeneration response, or i f the injury is too severe, then the liver stem cell compartment is activated, giving rise to the oval cell population .11 12 In normal liver tissue, oval cells numbers are very rare; however, when stem
PAGE 16
16 cell activation occurs it leads to the profuse replicati on of these cells in the periportal regions of the lobule. Activation of the oval cell compartment is usually achieved via the 2AAF -PH protocol, which employs 2 acetylaminofluorine implantation to prevent proliferation of resident hepatocytes followed by a 70% partial hepatectomy.1314Morphologically, oval cells are small in size (approximately 10 m), with little cytoplasm and an ovoid nucleu s that lends them their name. Oval cells possess characteristics similar to ductular cells in their distinct isoenzym e profiles, expressing markers such as OV 6, fetoprotein (AFP), and CK19. Approximately 11 days post -PH a large number of oval cells can be seen infiltrating the periportal regions of the liver; these cells further give rise to the hepatocytes and cholangiocytes that restore the liver mass by 22 days after the resection. 15 16 They are capable of generating both hepatocytes and bile duct cells, thereby qualifying them as bipotential progenitor cells in adult livers. In the current study we exa mine the potential role of Notch signaling in the regulation of oval cell -mediated liver regeneration. We have demonstrated induction of oval cells at day 11 post 2AAF -PH as well as a simultaneous increase in Notch1 expression. Combining the 2AAF PH mode l with treatments of the -secretase inhibitor GSI XX during the peak of the oval cell response terminated the Notch signal, as evidenced by a decrease in expression of downstream effector Hes1. Inactivation of Notch signaling led to a stunted differentia tion response by the activated oval cells. This is demonstrated morphologically as well as by aberrant expression levels of such markers as OV 6, AFP, and CK19 at day 22 post -PH. Inhibition of Notch further resulted in an abnormal hepatocellular mitoinhi bition index (p2117 18 Waf1:Ki67) at day 22 post -PH. The hepatocytes generated at this timepoint appear to be functionally impaired, with decreased levels of CYP3A2 and Glucose 6 -Phosphatase (G6Pase) Taken together these data
PAGE 17
17 demonstrate an important regula tory role for Notch signaling in the proper differentiation and growth of oval cells during 2AAF P H.
PAGE 18
1 8 CHAPTER 2 BACKGROUND AND SIGNI FICANCE 2.1 The Liver 2.1.1 Gross Anatomy In an untreated normal adult rat the liver accounts for approximately 5% of tot al body weight, or about 7 8 grams, and is comprised of five liver lobes. In humans, the liver is comprised of only four lobes and makes up only 2% of total body weight, or 14001600 grams. In order to maintain its highly vascular parenchyma, the blood is supplied with blood from both the portal vein and the hepatic artery .18 9 The portal vein supplies the liver with approximately 60% of the incoming blood; although the venous blood is oxygen poor, it is extremely rich in nutrients derived from the direc t draining of intestinal epithelia. The remaining 40% of oxygenrich blood is provided by the hepatic artery. Bile is transported from the liver into the duodenum via the biliary tree, which lies structurally parallel to the blood vessels but flows in th e opposite direction. This trifecta of portal vein, hepatic artery and bile duct form the vascular bundle more commonly referred as a portal triad. 2.1.2 Hepatic Microarchitecture 18, 19 The liver is essentially comprised of hepatic lobules that surround te rminal central veins and are outlined by portal triads (Figure 2 1A).20 Hexagonal columns of hepatocytes are arranged in cords and radiate from the central vein toward the portal triad.21 Each cord of hepatocytes is lined with sinusoids composed of endot helial cells, and it is here that the micro -vascular system of the liver is located. Briefly, blood flows from the portal triads through the parenchyma, coming into direct contact with each hepatocyte contained in that cord and eventually drains into the central vein (Figure 2 1B).20 Hepatocytes within the cords produce metabolites which are
PAGE 19
19 excreted via bile canaliculi into the Canal of Hering, a terminal portion of the biliary tree located within the portal triad.18,21 The liver consists of a various group of cell types including hepatocytes, bile ductular epithelial cells, stellate cells, sinusoidal and vascular endothelial cells, and liver specific macrophages known as Kupffer cells.19 Hepatocytes encompass 90% of the liver weight and carry out the biochemical functions of the liver as well as the production of bile, arguably the most important function of the liver. Hepatocytes are polygonal in shape, approximately 3040um in size, and have a high abundance of smooth and rough endoplasmic reticulum The liver acinus is described as the functional unit of the liver, divided into three zones that are comprised of the hepatocytes that extend from one central vein to the next. Zone 1 includes hepatocytes surrounding the portal triad and receives the greatest concentration of nutrients; Zone 2 is comprised of interzonal hepatocytes, and Zone 3 consists of the poorly oxygenated hepatocytes nearest to the central vein.21 19 Within the liver acinus blood flows through the sinusoids from Zone 1 to Zone 3, while the bile moves from Zone 3 to Zone 1. Interestingly, hepatocytes within Zone 3 have an increased DNA content (4N 16N), predominant bi nucleation, larger size, and can undergo centrilobular necrosis. Conversely, hepatocytes within Zone 1 are smaller a nd have normal DNA content (2N). 2.1.3 Cell Types of the Liver 21 The muralium simplex, an arrangement of liver plates, is built up by polygonal parenchymal cells or hepatocytes, which enclose a chicken -w ire like network of bile canaliculi in the central plane, and are flanked by sinusoids on both sides of the muralium. Because the hepatocyte is a highly metabolically active cell it contains large numbers of a variety of organelles: 15% of the cell volume is for endoplasmic reticulum; it contains over 1,000
PAGE 20
20 mitochondria, about 300 lysosomes, equal numbers of peroxisomes, some 50 Golgi complexes per cell, and a typically organized cytoskeleton. Bile duct cells (sometimes referred to as bile duct epithelial cells or BECs) are known to line the system of channels contained in the liver for the drainage of bile, the exocrine secretion of hepatocytes. The most striking differenc es with hepatocytes include smaller numbers of mitochondria and less extensive endoplasmic reticulum, a more strongly developed network of intermediate cytoskeletal filaments (cytokeratins), and the presence of a basement membrane. BECs are also known to express several markers that are absent from hepatocytes, the most popular of which include cytokeratins 7 and 19and glutamyltranspep tidase. BECs modify the composition of bile by secretion of water, proteins,and bicarbonate, and reabsorption of glucose, glutamate, anions, and proteins. BECs have been shown to participate in the immune response by actively secreting certain cytokines, and are also the targets of auto immune inflammatory destruction.18 Kupffer cells are stellate in shape and attached to the sinusoidal wall, but may also be seen migrating along the lumen. These cells function as garbage collectors, storing all kinds of old, unnecessary, damaged, altered or foreign material. When Kupffer cells are activated, say by zymosan or endotoxin uptake, they secrete a variety of factors including proteases and cytokines that influence cells of the parencymal lining as well as oth ers. The relationship between Kupffer cell s and immunologically involved d endritic cells needs further investigation.18 The term hepatic stellate cells is a consensus term to replace the confusing terminology of the past (para or perisinusoidal cells, Ito cells, fat storing cells, vitamin A storing cells, lipocytes, etc.). Stellate cells occupy a perisunusoidal location, with cytoplasmic extensions wrapped around the sinusoidal endothelial lining, comparable to pericytes in other locations. Stellate cell s 18
PAGE 21
21 are involved in extracellular matrix (ECM) maintenance via their synthesis and secretion of normal components, as well as their degradation by proteases. Thus hepatic stellate cells have four major functions in a normal liver: (a) production and mainten ance of ECM; (b) control of microvascular tone; (c) storage of retinoids; and (d) a role in control of regeneration in the normal liver and in response to necrosis. 2 .2 The Functions of the Liver 18 2.2.1 Metabolic Homeostasis The liver performs a plethora of functions designed to maintain homeostasis within the body. For instance, one of the main sites of glycogen storage in the body is the liver. Carbohydrate metabolism, mediated through gluconeogenesis, glycogenolysis and glycogenesis allows the liver t o effectively control the concentration of glucose in the blood. However it is not only metabolism of carbohydrates that allows the liver homeostatic control; it plays a major role in protein and lipid metabolism (i.e. cholesterol synethesis/breakdown, li pogenesis) as well. The liver is also responsible for the production of such molecules as albumin (the major osmolar component of the blood), as well as prothrombin, fibrinogen, and non-immune and globulins. 2.2.2 Molecular Silo 21 The liver is respon sible for the uptake, storage and utilization of several important vitamins from the bloodstream. For example, the liver stores and converts vitamin D into its circulating form for further modification in the kidney. Vitamin A is stored within the lipid pools of the stellate cells of the liver. Furthermore, vitamin K is utilized by the liver for the production of clotting factors, and decreases in hepatic vitamin K have a legitimate connection to bleeding and/or clotting disorders. The liver also mainta ins stores of copper and vitamin B12.21
PAGE 22
22 Due to its large size as well as the intricate vasculature found within it, the liver is the largest blood storage organ in the body. An adult human liver can hold approximately 1500mL of blood, which equates to about 25% of cardiac output per minute. On a related note, the liver is also the main site of iron storage in the body and therefore responsible for the homeostasis of blood iron levels in the body. 2.2.3 Detoxification 21 Because at any point in time the liver contains such a large percentage of the total blood in the body, this makes it well -suited to function as a detoxification center. Enzymes such as alcohol dehydrogenase (ADH), cytochrome -P (CYP) and uridine glucuronosyltransferase (UGT) allow for the m odification of chemical composition of several compounds, such as antibiotics, and their subsequent removal. Furthermore, the ability of the liver to convert nonhydrophyllic drugs to a more water -soluble form aids in their excretion by the kidneys. 2.2. 4 Production of Bile 19 Arguably the most important function of the liver is the production of bile. Bile is mostly comprised of conjugated bilirubin, bile salts, phospholipids, cholesterol, bicarbonate and water. Bile salts mix with ingested fats to promot e absorption of nutrients from the gastrointestinal tract. After its formation in the liver, bile flows into the hepatic duct on through to the common bile duct, which then enters the duodenum. When food in the gastrointestinal canal enters the duodenum, it stimulates contraction of the gall bladder and further release of the bile into the small intestine. 18
PAGE 23
23 2.3 Hepatic Regeneration 2.3.1 General Considerations The liver is one of the few organs that are known to be capable of rapid regeneration. This p rocess usually takes place in response to liver injury resulting from surgical resection or exposure to destructive agents. Although this ability is referred to as regeneration, what is actually occurring is a process of compens atory growth or hyperplasia Instead of the resected liver tissue growing back, the portions of the liver remaining after (e.g.) a two thirds or partial hepatectomy (PH) increase in size to make up for the loss of tissue.22 This expansion continues until the mass of the regenerat ed liver reaches within 10% of the original liver mass, give or take. Completion of this process usually takes approximately 2 weeks in rodents, but can take up to 2 months in humans. While the original mass of the liver may be restored, the original an atomical form of the liver is not, indicating th at regenerative growth after PH is a closely regulated process synergistic with the bodily demand for liver functionality independent of i ts an atomical form .12 The process of compensatory hyperplasia is demo nstrated graphically in Figure 2 2. 2.3.2 Models of Regeneration 23 At any given time, under normal conditions, only 1 in every 20,000 hepatocytes is undergoing mitotic division; however, during conditions of regeneration hepatocytes are the driving force b ehind the compensatory hyperplasia exhibited .22 Figure 2 3 demonstrates graphically the number of resident hepatic cells within the cell cycle during the time following partial hepatectomy .24 In the rat, hepatocytes first move from G0 resting phase of the cell cycle into G1, as mediated by cyclin D signaling within the first 15 hour s after partial hepatectomy .25,26 Periportal hepatocytes are the first to undergo DNA synthesis, and eventually the hepatocytes proximal to the central vein begin to also proliferate.22,24 A large peak of DNA synthesis occurs
PAGE 24
24 24 hours after PH with another smaller peak occurring 48 hours post PH, reflecting the synthesis of DNA by non-parenchymal cells and pericentral hepatocytes. Unlike hepatocytes, whose proliferative capacity post PH spreads from periportal to perice ntral, NPCs across the hepatic lobule exhibit simultaneous DNA synthesis. Several animal models incorporating the insult to the liver via chemical have been developed to study mechanisms regarding the proliferative response to liver injury. Among the mo st extensively utilized agents are carbon tetrachloride (CCl25 4), which causes necrosis of the centrilobular regions of the liver, and allyl alcohol (AA), which causes periportal necrosis.27 292.4 Liver Stem Cell Biology In both models, regeneration of the necrotic area is mediated by hepatocyte proliferation elsewhere in the lobule. In addition to the hepatocyte capacity for regeneration of the liver lobule, there is also a stem cell compartment that acts as a backup regeneration system. Activation of this compartment only occurs when the hepatocytes are functionally compromised and/or unable to divide. In this model of liver regeneration, a transit amplifying population of stem cells known as oval cells proliferates within the compartment to reconstitute the liver mass. If hepatoc ytes are not compromised, the oval cell contribution to the regeneration process is negligible. Although oval cells have been widely studied, their origins are still controversial and several key questions regarding activation of this cell population as w ell as direct lineage specification remain. 2.4.1 The Oval Cell In normal liver tissue, oval cells numbers are so small that they are almost beyond detection; however, stem cell activation leads to the profuse replication of these cells in the periportal regions of the liver. Morphologically, oval cells are small in size (approximately 10 m), with a large nuclear to cytoplasmic ratio and an ovoid nucleus, t hereby giving them their
PAGE 25
25 name. Oval cells possess characteristics simila r to ductular cells in their distin ct isoenzyme profiles, expressi ng markers such as cytokeratin 19 (CK 19) and -glutamyl transpeptidase (GGT), and also have been shown to express -fetoprotein (AFP) .12,15 They are capable of generating both hepatocytes and bile duct cells, thus qualifying them as bipotential progenitor cells in adult livers .17,30 Characterization of these progenitors can be achieved via the utilization of monoclonal ant ibodies such as OV 6 and Thy1 .312.4.2 Canals of Hering: Putative Oval Cell Niche Figure 2 4 demonstrates immunohis tochemical analysis of the oval cell response at day 11 of the 2AAF PH protocol. In tissues that continuously proliferate (i.e. skin, intestinal epithelia, etc), the stem cell population tends to produce p rogeny ad infinitum; as these cells begin to mature toward a specific lineage, they begin to lose the ability to constantly replicate. Among organs, the liver is unique in that there are two pools of cells from which progeny can be produced: the intrahepa tic stem cells, which actually act as a secondary mechanism for proliferation, and a pool of highly differentiated cells that act as the primary source for proliferating cells .12 The prevailing model localizes the hepatic stem cell niche to the canals of Hering (terminal bile ductules). These cells are components of a functional segment of the biliary system32,33Interestingly, it has been shown that a small percentage of oval cells may in fact arise from within the bone marrow and may traverse to the liver upon migratory signals and not part of a separate compartment of proliferative cells such as basal cells in the skin or the gastro intestinal tract, which continuously generate lineage. 15 Furthermore, several other investigators have confirmed that bone marrow derived cells possess the capability to produce both functioning hepatocytes and bile duct cells. While there are studies that
PAGE 26
26 demonstrate the existence of oval cells within the hepatic architecture adjacent to bile duct epithelium332.4.3 Oval Cell Plasticity the precis e oval cell niche has yet to be elucidated. One of the key factors in determining the developmental potential of a stem cell is environment. It has been demonstrated in a rat model that HSCs can give rise to oval cells, which retain hematopoietic markers such as Thy 1 but also gain expression of liver -specific markers such as AFP Scientists have found that HSCs obtained from adult peripheral blood retain a tremendous developmental plasticity.15,31,35 Taken together this indicates that HSCs and oval cells may share a common developmental origin or may even arise directly from the same cell. Figure 2 5 is a schematic diagram of the potential endpoints of oval cell differentiation according to a review by Lowes et al in 2003. Rega rdless of origin, all stem cells execute their developmental programs by regulating gene expression. Determining which signals are responsible for such processes as induction of differentiation, self -renewal and/or maintenance of pluripotentiality will le ad to a broader and much better understanding of the biology of oval cells and their role in the liver. 34 2.4.4 Oval Cell -Mediated Liver Regeneration There have been many studies looking into the possibility that hepatic progenitor cells can modulate the reg eneration process; how ever, no experimental evidence exists to confirm this hypothesis. In fact, based on data that has been published over the last 100 years or so, hepatocytes irrefutably are the cells responsible for regener ation after partial hepatect omy.12 However in the last 10 years a clear distinction has been made between regeneration after PH alone and regeneration after PH combined with a chemical injury. Though oval cells do not normally participate in the regenerative response to PH or chem ical insult, they can be induced to do so by suppressing mature hepatocyte proliferation. Administration of 2 acetylaminofluorine
PAGE 27
27 in addition to injury via PH or CCl4Oval cell replication is important in many models of liver injury including carcinogenesis induced by azo -dyes and choline deficient/ethionine -containing diets (CDE diet), injury caused by d -galactosamine and injury produced by 2 aceytl aminofluorene ( 2AAF ), dipin or CCl blocks hepatocyte proliferation by interfering with their ability to divide properly. 4 t reatment in combination with PH .36,37 In fact, oval cells may constitute more than 50% of the liver during regeneration caused by administration of 2AAF /PH; it is thought that the cells form a transit amplifying compartment that includes undifferentiated progenitors, medially differentiated transit cells, and newly diff erentiated hepatocytes .12It has been shown that growth factors (i.e. TGF EGF, HGF, and S D F) can stimulate oval cell growth 38, and in fact, oval cells can produce and r espond to several of their own cytokines. It has also been shown that non-parenchymal cells (NPCs), such as stellate cells, can enhance oval cell growth and differentiation via secretion of growth factors, and also b y direct cell -cell interactions .32 Ova l cells are similar to hepatocytes in that both require growth factors for cell cycle progression, and both cell types also require a priming process in ord er to respo nd to these stimuli39; however, global gene expression patterns, as well as expression of specific markers, tend to differ between the two cell types. For example, expression of genes related to the interferon -gamma signaling network is greatly increased in oval cells when they are mediating liver regeneration, but these genes are not activ ated in the regenerating liver after PH alone39 Table 2 1 shows the variable expression of protein markers across the hepatic cell lines.
PAGE 28
28 2.4.5 Clinical Applications for the Oval Cell The existence of a hepatic stem cell compartment gives rise to expect ations regarding its clinical applications. With the increasing interest in characterizing oval cells with respect to their origins, questions arise regarding the mechanism of their recruitment and their differentiation potential. Understanding and ident ification/isolation of these cells in humans may hold promise for new therapeutic treatments to a wide range of liver pathological conditions ranging from congenital metabolic diseases, end-stage liver cirrhosis, and hepatocarcinogenesis Two distinct obst acles must be overcome for oval cells to be considered for clinical application. Maintenance of oval cells in an undifferentiated state in culture has surfaced as the first major hurdle. Developing this technique is critical, because any therapeutic use of these cells will require the expansion of a small population of cells ex vivo prior to transplantation. The second impediment has been selectively directing the differentiation of oval cells down a hepatocyte or cholangiocyte committed pathway as neede d. It is anticipated that the signals mediating these differentiation processes will be sufficiently complex as to disallow their exact replication in vitro. Factors governing oval cell differentiation may include contact -dependence, ECM contact, or expo sure to soluble signaling proteins in the serum. To circumvent the need for overcoming this second hurdle cells could be transplanted in their precursor form and the natural microenvironment of the liver and used to dictate their differentiation, but thi s theory has yet to be validated. An avenue for the clinical use of stem cells presents itself with the advent of bioengineered organs and/or tissues. The development of tissue scaffolds for the seeding of stem cells has immense potential, but until recen tly the clinical applications of these scaffolds have been limited. The most clinically relevant engineere d tissue has been cartilage .40 The injection of tissue engineered cartilage into osteoarthritic as well as nonarthritic knees and other joints were
PAGE 29
29 reported to have greatly improved joint stability and motion; however, further long -termstudies must be made to determine the stability and long t erm effects of these grafts .41 The growth of autologous cells on decllularized human heart valves and subsequent implantation of these valves has also been clinically worthw hile .42 Another engineered tissue that had been evaluated in a clinical study was the bladder. Here, patients received bladders engineered with autologous urothelial and muscle cells; these patients demonstrated clinical benefits from the implanted tissue for up to f ive years post implantation .432.4.6 Liver Stem Cells and Hepatocellular Carcinoma The successes seen with bladders, heart valves and cartilage demonstrate the endless possibilities for the clinical use of stem cells. It has been shown that h uman hepatic stem cells may be able to give rise to hepatocellular carcinoma ( HCC) as well as cholangiocarcinomas (CCC) .33,44 In these models, a periportal population of small primitive ova l epithelial cells proliferate either in association with or before hepatocyte multiplication. Multiple studies have demonstrated that a substantial number of HCCs contain a progenitor cell population. Furthermore, detailed immunophenotyping of HCCs indi cated that 28% to 50% of HCCs express markers of progenitor cells such as CK7 and CK19. These tumors also consist of cells that have an intermediate phenotype between progenitors and mature hepatocytes. In fact, HCCs that express hepatocyte and biliary c ell markers such as albumin, CK7 and CK19 carry a significantly poorer prognosis and higher recur rence after surgical resection One of the goals in this type of research is the identification of markers specific to cancer stem cells in the liver as well as other organs. However, the problem with this lies with the ability to isolate these cells from normal liver or from HCC samples, and the subsequent functional and molecular characterization. Strict double and triple immunohistochemical and confocal l abeling is necessary to identify marker -positive stem cells. Such rigorous labeling, 45
PAGE 30
30 however, has not been consistently adhered to. Furthermore, definitive experiments showing ser ial transplantability of marker -positive cells has yet to be demonstrated. Moreover, it is difficult to identify gene products that are specifically associated with putative LPCs or with HCC. The challenge lies in defining the markers specific to these cells at varying stages of differentiation, in HCC, and the elusive liver ca ncer stem cell. 2.5 The Notch Signaling Pathway 46 2.5.1 General Considerations Cellular differentiation during development is mediated via signals that are produced by adjacent tissues. Often these various signals are received simultaneously by the cell s imultaneously, and therefore they must be integrated in order for the correct specification of cell fate to occur. The Notch family of proteins consists of an evolutionarily conserved group of proteins that serve two functions, the first being that of cell -surface receptors, and the second being as direct transcriptional regulators .1Usually, activation of the Notch pathway inhibits differentiation via transcriptional repression of genes specific to a certain cell lineage, thereby limiting the number of cells that will assume a certain lineage an d leaving a small number of uncommitted progenitors that are able t o adopt alternative cell fates. During de velopment activation of the Notch cascade is essential, and global expression of Notch genes is continuously altered, allowing for Notch influence on cell fate decisions in tis sues throughout the body This family of proteins thereby represents a distinct channel for signal transduction from the cell surface to the nucleus, and also allows for cells to directly influence gen e expression in those adjacent to them. 4
PAGE 31
31 2.5.2 A Brief History Much of what is now known and understood about the Notch gene and its signaling cascade could not have been determined without studies performed in the Drosophila melanogaster m odel. The Notch gene was discovered during genetic experiments in which several different phenotypic variations were noted, one of which exhibited a notch in the wing of flies. These notched flies carried a haploinsufficiency for that particular gene. The gene was first successfully identified and cloned in the early 1980s by Artavanis -Tsakonas {Artavanis Tsakonas, 1983} Throughout years of study in Drosophila, Notch was found to encode a developmentally conserved transmembrane receptor that is expressed in both embryonic and adult cells. This transmembrane receptor and its ligands are part of a signaling cascade in which a family of basic helix loop -helix (bHLH) transcription factors regulates the expression of a myriad of other genes.47 2.5.3 Structure of the (Mammalian) Notch Gene 48 The human Notch receptor family is comprised of four members (Notch1 4), each of which shares a high degree of structural homology with the rest. This homology extends across species as diverse as C elegans and D me lanogaster as well as Mus and Rattus In general, the extracellular domain of Notch1 and Notch 2 is comprised of 36 EGF like repeats and 3 membrane proximal Lin 12/Notch/Glp1 (LNG) repeats. Notch 3 and Notch 4 have 34 and 29 EGF like repeats, respecti vely. The intracellular domain of the Notch receptor, or NICD, consists of a RAM domain, 6 ankyrin (ANK) repeats, 2 nuclear localization sequences (NLS), a transcriptional activator domain (TAD) and a praline -glutamine -serine threonine (PEST) rich domain, with the exception of Notch 4. Notch4 has a shortene d NICD due to the lack of NLS. The RAM domain is the primary binding site for RBPJ a homolog of Drosophila
PAGE 32
32 Su(H). The ANK repeat domain serves as a binding site for regulators of Notch expression s uch as Deltex, Mastermind, and Numb. 2.5.4 Notch Signal Transduction 4 T he Notch signaling pathway is said to be activated when the extracellular domain of the Notch receptor is bound by i ts ligand, preferentially Jagged (mammalian homolog to Drosophila Ser rate ), from neighboring cells. However on the molecular level i t has been demonstrated that Notch activation and processing requires three separate cleavage events: the first proteolytic cleavage produc es a functional Notch receptor via modification of th e EGF -like modules of the Notch extracellular domain in the Golgi, and is performed by a glycosyltransferase known to be a product of the Fringe gene. The resulting receptor unit within the membrane is a non -covalent heteroduplex consisting of a 180kD fra gment (the majority of the extracellular domain) and a 120kD fragment (the NICD). This cleavage alters the ability of the receptor to bind certain ligands, thereby effectively regulating ligand specificity. The second proteolytic cleavage occurs followin g ligand binding to the extracellular domain of the receptor, and is dependent on a member of the ADAM metallo protease family, usually ADAM17.4 6,7The final cleavage event takes place prior to the signal -generating step in the Notch cascade in the transmembrane portion of the receptor, and rel eases a soluble NICD to translocate to the nucleus. Presenilin proteins, specifically 1 and 2, associate with the -secretase enzyme responsible for the cleavage, and are also thought to be required for the event to occur. It is possible that this cleavage event is mediated by more than one enzyme, and inspection of protein sequences indicates that this cleavage mechanism may not be tightly conserved between members of the Notch family.
PAGE 33
33 H owever, it should be noted tha t results obtained by several studies have suggest ed that nuclear translocation may not be required for Notc h function in all systems Upon entry to the nucleus the NICD plays a role in transcriptional regulation of its target genes which include bas ic helix loop -helix transcription factors. This is done largely through the binding of the NICD transcriptional regulator C promoter binding factor (CBF) 1/recombination signal sequence binding protein (RBP) J which allows for transcription to take plac e. 49,50 2.5.5 Effectors of the Notch Cascade Other than the Notch receptors, the main constituents of the signaling cascade in mammals include extracellular ligands such as Jagged, Delta, and the Delta like family of proteins ( Dll1 Dll3 ), and also intracellu lar effectors such as CBF 1/RBP J and the HES (Ha iry/Enhancer of split) proteins .4In the dominant model of Notch signaling, activation of the receptor via binding of DSL ligands results in a proteolytic cleavage event with subsequent release and nuclear translocation of the N ICD. Interaction of the NICD with CSL effectors induces transcriptional activation of the HES genes, which function as negative regulators of li neage -specific gene expression .4 In the nucleus, the NICD can interact with both cytoplasmic and nuclear proteins, allowing for signal transduction through either the CSL ligands or independently of them. CSL -independent signaling via molecules such as Deltex also leads to transcriptional regulation of distinct t arget genes.4 Other effectors, targets, and modulators of Notch have also been evolutionarily conserved. Generally, extracellular ligands are referred to as the DSL ligands, while the intracellular effectors are referred to as the CSL ligands. Other modulators of the pathway incl ude Deltex, a cytoplasmic Notch binding protein that is associated with CBF 1 -independent signaling. Downregulation of the Notch pathway can be
PAGE 34
34 mediated by such enzymes as ubiquitin ligase via its stimulation of phosphorylationdependent ubiquitinazation and subsequent degradation of the NICD by the proteosome. Other molecules such as the transcriptional activator Mastermind can regulate phosphorylation and turnover of the NICD as well 2.5.6 Hepatic Notch Expression 51 Transcripts for all of the Notch re ceptors as well as their ligands Jagged1 and Delta1 can be detected in normal liver, as well as during several models of regeneration. In normal adult rat liver, Notch1, Notch2, Notch3 and Jagged1 expression can be seen on bile ductular cells whereas Notc h2, Notch3 and Delta1 can be found o n normal adult rat hepatocytes Expression of pathway members has also been examined during regeneration using the standard model of tial hepatectomy (without 2AAF) .52 53 Baseline expression of Notch and Jagged in t he different liver cell types reveals widespread expression, with higher levels in the hepatocytes and biliary epithelium, but also expression of Notch1 on endothelial cells of the sinusoids and small vessels. These findings are comparable to what has bee n described in human liver 2.5. 7 Functions of Notch Signaling 54,55 When it comes to cellular specification, there are three choices available: differentiation, cell cycle progression and apoptosis, and Notch signaling is capable of regulating cell fate de cisions for all three p rocesses .56 It has been shown that targeted disruption of Notch1, Notch 2, Jagged 1 or Jagged2 genes in mice leads to severe developmental defects or embryonic leth ality .2 Expression of constitutively active forms of Notch recept ors inhibits or delays terminal differentiation in vitro in many cel lular models On the other hand, it has been illustrated that Notch 1 is needed for differentiation in a number of cell types such as adipocytes ,2 4 57 e rythroid cells ,58 myeloid cells ,4 T cells ,59 murine60
PAGE 35
35 and human612.5.8 Notch and Wnt: A Delicate Balance k eratinocytes and many others. In summary studies by and large have demonstrated that in many circumstances, signaling via the Notch pathway inhibits cellular differentiation toward primary cell fates while generally permittin g cells to respond to secondary cellular specification. Cellular responses t o internal and external stimuli are regulated by numberous positive and negative feedback loops, both within individual signaling cascades a nd also between them. Accordingly, pathway crosstalk is a very complex yet highly utilized feature required for the molecular regulation of cell homeostasis and adaptation, where modulation of one pathway can affect multiple regulatory circuitries. Consi dering that precise signaling strength is important for productive cell responses, it is not surprising that change in the major biochemical pathways and in pathway crosstalk manifests within many diseases that typically accompany human aging. Notch -Wnt interactions are implicated in several developmental stages, such as somitogenesis and hematopoiesis (Wnt activates Notch signals for self -renewal in hematopoietic stem cells), as well as adult intestinal and skin regeneration.19 6365 Additionally, one of t he major components of Wnt pathway, GSK3 is also a crosstalk integrator of multiple signal transduction networks.66 For example, recently published work suggests that a balance between Notch and Wnt signaling controls cellular homeostasis during the reg eneration of adult skeletal muscle.67 Namely, Notch promotes the proliferation of myogenic progenitor cells, and inhibits their precocious terminal differentiation by inhibiting Wnt via GSK3 activation. Conversely, during later stages of muscle repair a nd regeneration, Wnt inactivation of GSK3 therby promotes myoblast and myotube differentiation.67
PAGE 36
36 2.5.9 Notch -Induced Pathologies 2.5.9 .1 Cerebral Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL) CADASIl is an inherite d degenerative vascular disorder that is caused by mutation sin the Notch3 gene. It affects vascular smooth muscle cells, and is the most common genetic form of stroke and vascular dementia. Affected individuals exhibit a variety of symptoms, including m igraines, mood disorders, recurrent subcortical ischemic strokes, progressive cognitive decline, dementia and premature death. One of the most distinguishing features of the disease is the accumulation of granular osmophillic material (GOM) within the smo oth muscle cell basement membrane, but the disease is further characterized by progressive degeneration of vascular smooth muscle cell All Notch3 mutations associated with CADASIL result in a gain of loss of a cysteine reside in one of the 34 EGF -like r epeats in the extracellular domain of the Notch3 receptor. The characteristic nature of these mutations, in addition to the absence of any examples of in CADASIL patients of mutations or deletions of the Notch3 gene that are obviously inactivating, strong ly suggesting that mutations that cause CADASIL are not Notch3 -null alleles. In CADASIL patients the ectodomain of the Notch3 protein accumulates in the cerebral microvasculature at the cytoplasmic membrane of vascular smooth muscle cells .68 No specific t reatment for the disorder is available; however anti -platelet agents such as aspirin or Plavix may slow down the disease and help prevent strokes. Given the propensity for cardiovascular and cerebrovascular complications, minimizing vascular risk factors and implementing therapy for primary or secondary prevention of stroke and myocardial infarction seems prudent .69 69
PAGE 37
37 2.5. 9 .2 Spondylocostal Dysostosis Two of the five known human Notch ligands have been shown to develop mutations that lead to developmental disorders in man. Lesions in the human Delta -like 3 gene give rise to spondylocostal dysostosis (SD), a group of vertebral malsegmentations syndromes resulting from axial skeletal defects. SD is a disorder with autosomal -dominant and autosomal recessive m odes of inheritance and is characterized by multiple hemivertebrae, rib fusions, and deletions with a nonprogressive lateral curving of the spine. In patients with SD, two mutations in the human Delta 3 gene were identified within the conserved extracellular domain and are predicted to give rise to truncated proteins. A third missense mutation present in a highly conserved glycine residue of the fifth epidermal growth factor -like repeat highlights the functi onal im portance of this domain Notch signalin g plays a major role in regulating somite formation and in partitioning somites into anterior and posterior compartments. Notch pathway components appear to regulate, or constitute essential components of, a cell autonomous oscillator functioning in the p resomitic mesoderm. This oscillator has been termed the somite clock. Analysis of marker gene expression in Dll3 mutant mice indicates that progression of the somite clock is disrupted in these mutations. A similar mechanism probably underlies the verte bral defect s observed in patients with SD .70 2.5. 9 .3 Alagille Syndrom e 71,72 Mutations in the second human Notch ligand, Jagged1, lead to Alagille Syndrome, or AGS. Also referred to as arteriohepatic dysplasia, AGS is an autosomal dominant developmental disorder that mainly affects structures in the liver but also heart, skeleton, eyes, face, kidney and other organs. It occurs with a minimal estimated frequency of 1:70,000 live
PAGE 38
38 births when ascertained by the occurrence of neonatal jaundice, but the incidence of the disease is likely higher. The syndrome has traditionally been defined by a paucity of intrahepatic bile ducts in association with five main clinical abnormalities: cholestasis, cardiac disease, skeletal abnormalities, ocular abnormalities, and a ch aracteristic facial phenotype. As a result of the paucity in bile ducts the patients will usually develop cholestasis, and 3 0% of patients will require a liver transplant. The pathogenesis of bile duct paucity in AGS is unknown. Intralobular bile duct development and number is normal or even increased around the time of birth, even in some patients who go on to develop profound paucity later in infancy. The bile ducts that are present are histologically and immunohistochemically normal. Furthermore, several groups have reported a reduction in the number of portal tracts in patients with AGS, suggesting that the development of the portal tract or ductal plate may be abnormal as well. The Notch Jagged interactions may be involved in the development of the portal tract itself along with the bile ducts within it.69 Analyses of many patients with cytogenetic deletions or rearrangements have mapped the gene to chromosome 20p12. The initial association of deletions with a multisystem disorder led to the bel ief that AGS may be a contiguous gene deletion syndrome; however the frequency of observable deletions is actually low, suggesting that the disorder may result from mutations in a single gene with pleiotropic effects.73 The prognosis for Alagille syndrome is variable, and depends on the severity of liver, cardiac, or renal disease. Up to 50% of children may regain normal liver function by adolesecence whereas others may develop renal or liver failure or manifest significant cardiologic or neurological dise ase. Liver transplantation is indicated for the development of 74
PAGE 39
39 cirrhosis and decompensated portal hypertension. Liver transplantation may be contraindicated because of seve re inoperable cardiac disease. 2.5. 10 Notch and c ancer 74 Although it has been know n for more than a decade that Notch can function as an oncogene, the mechanisms by which this occurs and the subsequent effects have not been very well defined. Nonetheless, the consequences of aberrant Notch signaling that have been shown to date are ver y interesting indeed. A few of these include the phosphorylation of PI3K (phosphatidylinositol 3 kinase), activation and consequent induction of ERB2, and induction of NF kB2 expr ession .60,75,76 These target proteins may confer: resistance to anoikis and p53 mediated apoptosis stimulation of proliferation and growth of cells (ERB2), and induction of genes that encode anti a poptotic protein s (NF kB2) While Notch signaling alone certainly contributes to tumorigenesis, actually causing cancer requires cooperation with another oncogene, usually one that is able to override the G1/S checkpoint. For instance, simultaneous expression of Notch with proteins such as adenovirus E1A, papillomavirus E6 and E7, SV40T Ras and Myc has been shown to induce transf ormation in vitro .77 79 8082As Notch can exert tumor -suppressive and differentiation -promoting activities, it could be suggested that tumor progression might select for cells that are refractive to Notch signaling i n tissues in which absence of this pathway promotes growth, enhances survival and/or inhibits differentiation. It is possible that in such tissues, late -stage tumor cells might counter -select The feature that all of these proteins have in common is their ability to override the G1/S checkpoint. Since Notch does not posses this capability, it is likely that Notch signaling functions in another oncogenic capacity, such a s transferring r esistance to apoptosis, anoikis or differentiation.
PAGE 40
40 against expression of Notch receptors or ligands to escape from differentiation and cell -cycle arrest. 2.5.10.1 Notch as an o ncogene 83 One of the most clearly defined protransforming roles for Notch is in T cell acute lymphoblastic leukemia/lymphoma (T -ALL). A small fraction of human T -ALL is associated with a t(7:9 ) translocation that breaks the Notch1 gene and fuses its 3 end to enhancer sequences of the T cell antigen receptor subunit (TCR ), which drives the expression of a series of truncated mRNAs. These mRNAs encode several constitutively active t(7:9) -sp ecific Notch1 poly peptides Notch4 was discovered in DNA isolated from a murine mammary tumor adjacent to the site of a murine mammary tumor virus (MMTV) proviral insertion that truncates that Notch4 gene and drives the expression of constitutively active forms of Notch4. These transcripts are similar to Notch1 IC proteins that are expressed in T cell leukemia. In transgenic mice expressing activated Notch4, breast cancer development is preceded by perturbed ductal development in nonpregnant mice and alveolar/lobular d evelopment in lactating animals.84 Further work has shown that Notch4 associated breast cancer cell lines depend on Ras for anchorage independent growth. At present, there are no definite data supporting a role for Notch4 (or other Notch variants) in human breast cancer.85 81 However, it has been shown that Notch1, Notch2 and certain Notch ligands are highly expressed in human colon adenocarcinomas.86 As Notch signaling can maintain cells in proliferative and undifferentiated state, it is thought that its role in cancer is to prevent neoplastic cells from responding to differentiation cues in their immediate environment 87
PAGE 41
41 2.5. 10.2. Notch as a tumor s uppressor The largest amount of data pointing to Notch as a tumor suppressor has been obtai ned from skin. Experiments performed both in vivo and in vitro indicate that Notch1 signaling induces differentiation in mammalian skin.88 Notch1 signaling in murine keratinocytes stimulates expression of early differentiation markers such as keratin1 and involucrin. In addition, Notch1 signaling increases expression of WAF1, which causes cell cycle arrest in basal cells, to allow the onset of terminal differentiation. Jagged1 -mediated Notch signaling in keratinocytes also results in acti 61 Also, activated Notch2 can decrease AP1 activity via repression of cFos expression and a concomitant increase in FRA1, resulting in inhibition of cellular proliferation.89Furthermore, mice with Notch1 -deficient epithelia develop spontaneous basal -cell carcinoma like tumors over time. So the tumor -suppress ive activity of Notch1 might be mediated by several routes, to induce cell cycle arrest and differentiation. 65 Moreover, Notch1 deficiency in the skin facilitates chemically -induced carcinogenesis. Interestingly, the absence of Notch1 in this tissue is concomitant with downregulation of Waf1, which might explain the increased sensitivity to chemically -induced carcinogenesis, as Waf1 -deficient mice are also more susceptible to chemically -induced tumorigenesis.90,91 In mice and humans, this tumor type is frequently associated with aberrant Sonic -hedgehog (Shh) signaling, and absence of Notch1 in the mouse epidermis leads to aberrant expression of Gli2, a downstream component of the Shh pathway. 92
PAGE 42
42 Figure 2 1. Diagram of hepatic architecture.20 A. Diagram of a classic hepatic lobule. B. Hepatic microarchitecture.
PAGE 43
43 Figure 2 2. Compensatory hyperplasia after partial hepatectomy.23
PAGE 44
44 Figure 2 3. Cellular growth after partial hepatectomy.24
PAGE 45
45 Figure 2 4. Oval cell response following staining of rat liver from day 11 of the 2AAF PH protocol. The smal l oval cells (arrows) are situated between the largest hepatocytes surrounding the portal triad. B. Immunohistochemistry for oval cell marker Thy1 at day 11, showing positivity in the periportal regions of the section. C. Dual immunofluorescence stainin g from day 11 of the 2AAF -PH protocol. Yellow indicates co -expression of the markers Thy1 and OV6, showing oval cells surrounding the portal triad. Magnification 40x.
PAGE 46
46 Figure 2 5. Hepatic oval cell differentiation.
PAGE 47
47 Table 2 1. Cellular markers of the liver. Expression of various protein markers in different hepatic cell lines including oval cells, hepatocytes, bile duct cells and endothelial cells. Marker Oval Cells Hepatocytes Bile Duct Cells Endothelial Cells CK8 + + + CK18 + + + CK19 + + ALB + + AFP + GGT + + OV 6 + + OV 1 + + BDS7 + + OC.2 + + OC.3 + + A6 + +
PAGE 48
48 Table 2 2. Components of the Notch signaling cascade. Conservation of Notch pathway members as seen in mammals, D melanogaster and C elegans Mammals D melanogaster C elegans Notch Receptors Notch1 Notch2 Notch3 Notch4 Notch Lin 12 Glp 1 Extracellular Ligands Delta1 Delta -like1 (Dll1) Delta -like3 (Dll3) Jagged1 (Serrate1) Jagged2 (Serrate2) Serrate Lag 2 Apx 1 Intr acellular Effectors CBF 1/RBP Deltex NF Suppressor of Hairless [Su(H)] Deltex Lag 1 Target Genes Enhancer of Split [E(spl)] bHLH Groucho HES bHLH Processing Molecules Kuzbanian SUP 17 -secretase Complex Presenelin1 Presenelin2 Nicastrin Presenelin Sel12 Aph1,2
PAGE 49
49 CHAPTER 3 SPECIFIC AIMS Cellular differentiation during development is mediated via signals that are produced by adjacent or even distal cells. Often these various signals are received by the cell simultaneously, and therefore they must be integrated in order for the correct specification of cell fate to occur. The Notch family of receptors and its ligands, Jagged in particular, are believed to be involved in regulating the delicate balance between terminal cell differentiat ion and stem cell proliferatio n .2 Notch 4 is thought to be expressed primarily in endothelial cells dur ing development and adult life In mice, it has been shown that Notch 1 expression is fairly stable during gestation as well as after birth, whereas Notch 2 expression peaks at embr yonic day 15, at the time when bile duct differentiation starts .93 94 Notch 3 and Notch4 expression are low during embryogenesis, and usually peak postnatally by 12 weeks of age. It has also been established that Jagged1 is expressed during embryogenesis in the ductal plates and after birth in bile ducts, endothelial cells, and hepatocytes Although it is clear that the Notch signaling pathway is essential for developmental, growth, and regenerative processes in the liver, the role of this signaling syst em in oval cell mediated liver regeneration has not been well studied. The studies proposed in this application have been designed to test the hypothesis that the Notch signaling is critical for the proper response with regards to proliferation and differ entiation during the oval cell -mediated regenerative response. The specific aims are as follows: 94
PAGE 50
50 Specific Aim I: To determine if and which isoforms of Notch and Jagged are predominantly expressed during oval cell -mediated liver regeneration. Specific Ai m II: To examine the effects on oval cell -mediated liver regeneration when Notch signaling is downregulated. 3.1 Specific Aim I Although many resident cell types in the liver are known to be activated in response to injury, it has been shown that only ce rtain types of injuries will induce the activation of oval cells. As mentioned previously, while it is suspected that Notch signaling is required for development, growth, and regeneration, the exact Notch receptor -ligand interactions that regulate these p rocesses have yet to be defined in the oval cell. It has been shown that this pathway is activated in the adult liver during regeneration and that it may be essential for the formation of new, differentiated tissue. The well -established protocol of oval cell induct ion via partial hepatectomy (PH ) combined with chemical insult, in this case 2 acetylaminofluorene ( 2AAF ) to inhibit resident hepatocyte proliferation, was employed in a rat model to examine the expression of Notch receptors 1 4 and of Jagged1 and 2 during the oval cell -mediated regenerative response. Briefly, animals received an implant of 28 day time release 2AAF pellet. Seven days after 2AAF implantation, animals underwent a 2/3 partial hepatectomy. The peak of the oval cell response to injury is approximately 9 11 days post -PH; around day 13 the oval cells begin to differentiate into small, basophilic hepatocytes, and by 21 days post -PH the liver has resumed its normal architecture and little evidence of the oval cell infiltrate remains. RT PCR was performed to determine if and which of the 4 Notch and 2 Jagged isoforms where expressed during the oval cell response, and it was found that only Notch 1 and 2 as well as Jagged1
PAGE 51
51 showed a change in expression as compared to normal liver, whi le Notch 3, Notch 4, and Jagged 2 did not appear to be expressed. Western blot using an antibody specific to cleaved Notch 1 demonstrated increased activation of the receptor on days 7 9 of the oval cell response, with expression leveling back down to nor mal by day 21 post -PH. Immunohistochemistry demonstrated evidence for nuclear translocation of the NICD in the oval cells, while the ligand Jagged was localized to the peri pheral hepatocytes. 3.2 Specific Aim II Upo n determination of the requirement of No tch signaling for properly mediated regeneration, the next step will be to explore the effects that dysfunction of the pathway would have on the regeneration process. A chemical inhibitor of the Notch pathway was employed in conjunction with the oval cell induction protocol mentioned above to inhibit the signaling cascade and thereby determine their effect on the activation, proliferation or differentiation capacity of oval cells during the regenerative response. Briefly, the 2AAF -PH oval cell induction pr otocol mentioned above was also applied here but concomitant with a chemical inhibitor designed to halt transduction of the Notch signal. GSI XX, or dibenzazepine (DBZ), is a potent -secretase inhibitor now being tested in the treatment of Alzheimers Di sease. -secretase, along with its partner -secretase, produces the beta amyloid peptide via the cleavage of its amyloid precursor protein, and inhibition of these enzymes may reduce the burden of beta amyloid buildup in the brain, potentially slowing the progression of the disease. With no functional -secretase, the NICD remains tethered to the membrane and can no longer translocate to the nucleus to modulate expression of its target genes.
PAGE 52
52 GSI XX, in a solution of 0.05% Methocel E4M and 0.01% Tween80, was delivered via tail vein injection to male Fisher 344 rats on the 2AAF /PH protocol for one week, covering days 7 14 of the oval cell response as well as the peak of Notch expression. 3 animals per timepoint were sacked on days 8, 11, 14, and 21. No rthern blot demonstrated reduced mRNA expression of Hes1, a downstream target of the NICD in the nucleus, thereby indicating termination of Notch signal transduction. To further confirm muting of the signal by the inhibitor, western blot using an antibody specific to cleaved Notch1 demonstrated a reduction in activated receptor. Further examination demonstrated an increase in p21 expression when Notch signaling is inhibited indicative of cells that are trapped in the cell cycle and can no longer progres s forward. These cells were also positive for the proliferative marker Ki67 through day 22 post -PH when Notch was inhibited, an observation not seen during 2AAF PH alone. Moreover, treatment with GSI XX resulted in annihilation of cytochrome p450 and G6P ase expression in hepatocytes that lasted through day 22 post -PH.
PAGE 53
53 CHAPTER 4 MATERIALS AND METHOD S 4.1 Animal Studies The 2AAF /PH model was utilized to accurately assess the activation and fundamental biology of the liver stem cell. This model provided the basis for understanding oval cell biology with respect to growth, proliferation and differentiation, as well as in response to extrinsic interventions. The assessment of oval cell biology in vitro can be informational; however, in vivo evaluation hold s greater value in the analysis of the liver stem cells inherent functions. To date, no substitute has been found that adequately replaces an animal model in examining the fates of oval cells. 4.1.1 Animals and Animal Housing Facilities All animals utili zed in this study were under approved animal protocols submitted to the University of Florida IACUC committee. All animals utilized in this study were Fisher 344 male rats obtained from Charles River Laboratories, Inc. (Wilmington, MA). Animals were house d in a barrier facility under sterile conditions at the Animal Care Services Facility in the Medical Science/ Communicore Building. The Animal Care Services is a state of the art animal facility that provides a pathogen -free barrier environment. The animal care program is accredited by AAALAC. The facility is supervised by veterinarians, which are always present at the facility or on call. Animals are checked several times per day, and a veterinarian is always available for consultation, particularly if dec isions need to be made regarding euthanizing an animal prior to the sacrifice date. The University of Florida meets National Institutes of Health standards as set forth in the DHHS publication #NIH 8623 and accepts as mandatory the PHS Policy on Humane Care and Use of Laboratory Animals by Awardee Institutions and the National Institutes of Health Principles for the Utilization and Care of Vertebrate Animals Used in
PAGE 54
54 Testing, Research and Training. The University of Florida has on file with the Office for Protection Form Research Risks an approved Assurance of Compliance. 4.1.2 Animal Sacrifice and Tissue Collection All animals utilized for tissue collection were euthanized by administration of an overdose (150 mg/kg) of Nembutal Sodium Solut ion (Ovatio n P harmaceuticals, Inc., Deerfield, IL) This is consistent with the recommendations from the panel on euthanasia of the American Veterinary Medical Association as well as the Guide for the Use and Care of Laboratory Animals (U.S.Department of Health and Human Services/NIH Publication #8623). After euthanasia, tissue from brain, heart, lung, liver, pancreas, spleen, kidney, and intestine was collected for paraffin embedding, frozen sectioning, and RNA and protein collection. Samples for protein and RNA w ere snap frozen in liquid nitrogen and kept at 80C until isolation was performed. Tissues for paraffin embedding were fixed O/N in 10% Neutral Buffered Formalin (Richard -Allan Scientific, Kalamazoo, MI). The formalin was then exchanged for PBS and the ti ssue submitted for embedding by the University of Florida Molecular Pathology Core Facility. Tissue collected for frozen sectioning was immediately placed in Tissue Tek O.C.T. Compound (Sakura Finetek U.S.A., Inc., Torrance, CA), snap frozen in liquid nitr ogen, and stored at 80C until sectioning. All paraffin and frozen secti ons 4.1.3 Rat Model of Oval Cell Induction 4.1.3.1 2AAF pellet i mplantation Continuous administration of 2AAF was used to suppress proliferation of mature hepatocytes prior to partial hepatectomy. Utilization of a 2AAF time release pellet alleviated undue stress to the animals associated with multiple 2AAF oral gavage and reduced the amount of human exposure to the 2AAF
PAGE 55
55 Briefly, the animals were anesthetiz ed with isoflorane. The abdomen was shaved and scrubbed three times in a circular pattern emanating from the center outward with ethanol and three times with Betadine (Purdue Pharma L.P., Stamford, CT). The animal was then draped with a Steri Drape (3M, St Paul, MN) with only the incision site exposed. Then a very small, approximately 1/4 inch, incision was made in the lower right quadrant of the animals abdomen. A midline incision would not suffice because the pellet must be placed distal to the liver in order to prevent adherence of the pellet to the body of the liver. The fibrosis associated with adherence would complicate the subsequent partial hepatectomy. After opening the abdominal wall, a small incision was made within the abdominal muscle to facil itate entry to the peritoneal cavity. A 70 mg/28 day release (2.5 mg/day) 2AAF time release pellet (Innovative Research Inc., Sarasota, Fl) was carefully introduced through the incision into the peritoneal cavity. The muscle tissue was then closed using 12 sutures of 30 Vicryl (Ethicon, Inc., Cornelia, GA). The skin was closed with the Autoclip Wound Closing System (Braintree Scientific, Inc., Braintree, MA). Rats were then placed in a warmed cage and monitored for complete recovery. This procedure yielde d a survival rate of 100%. 4.1.3.2 Two-thirds p artial h epatectomy The removal of 70 % of the liver was originally described by Higgins and Anderson.95 The animals were anesthetized with isoflorane. The abdomen was shaved and scrubbed three times in a circu lar pattern emanating from the center outward with ethanol and three times with Betadine (Purdue Pharma L.P.). The animal was then draped with a Steri Drape (3M) with only the incision site exposed. A 1.5 cm longitudinal incision was made in the skin just below the xyphoid process. The incision was continued through the midline of the abdominal muscle, exposing the liver. The tip of the xyphoid process was excised to facilitate removal of the liver and limit liver injury during extrusion. Next the left medial, right medial and the left lobe of the
PAGE 56
56 liver were gently extruded through the incision. The lobes were then tied off with a silk suture. The exposed lobes were excised and the remaining stump examined for excessive bleeding prior to replacement within t he peritoneal cavity. Bleeding from the stump indicated incorrect tying off of the excised lobes. If bleeding occurred and was unable to be controlled the animal was euthanized. The muscle tissue was then closed using 4 5 sutures of 30 Vicryl (Ethicon, In c.). The skin was closed with the Autoclip Wound Closing System (Braintree Scientific, Inc.). The stainless steel staples were removed after 10 days. Rats were then placed in a warmed cage and monitored for complete recovery. This procedure yielded a surv ival rate of greater than 95%. The 5% death rate was usually associated with the aforementioned bleeding from the incorrectly tied liver stump. The difficulty obtaining the correct the tension on the ligating suture should be noted. A ligature tied too tightly causes the liver proximal to the knot to tear and this situation is practically impossible to resolve. Conversely, insufficient tension on the ligature results in the inability to staunch the blood flow to the stump and subsequent bleeding. In succes sful procedures, hypothermia and dehydration were not an issue during recovery. In the event that any blood was lost during surgery, animals were injected i.p. with 13 mL sterile saline. The animals were checked every six hours until fully recovered. The stainless steel stapleswere removed after 10 days. Animals were sacrificed at days 3, 5, 7, 9, 11, 13, 15, 17, and 21days post -PH 4.2 Model for Inhibition of Notch Signaling in the Rat In order to confirm that Notch signaling is required for oval cell -med iated liver regeneration, Notch receptor activation was halted using GSI XX, an inhibitor of the cleaving enzyme -secretase and potent downregulator of the Notch cascade. By transiently blocking cleavage of the NICD from the transmembrane receptor duplex transduction of the Notch signal
PAGE 57
57 was successfully impeded; as a result, the capacity of oval cells to both proliferate and properly differentiate was greatly diminished. Animals underwent 2AAF administration along with PH as previously described. 500ug of GSIXX was d issolved in a solution of 0.05% Methocel E4M and 0.01% Tween 80 as previously described.8 104.3 RNA Analysis This solution was d elivered via tail vein injection to each animal once daily beginning day 7 post PH and continuing through day 14 post PH Twelve animals received the inhibitor solution while another six animals received a control solution (Methocel E4M and Tween 80 only). Animals were sacrificed at days 8, 11, 14, and 22 post PH. 4.3.1 Isolation of RNA from Tissue Tissue samples were homogenized in 1mL of RNABee Reagent (Tel Test, Inc., Friendswood, TX) per 50 100mg of tissue using a sonic homogenizer. The homogenized samples were incubated for 5min at RT to allow for the complete dissociation of nucleoprotein complexes. 0.2mL of chloroform was then added per 1mL of RNABee Reagent and the tubes vortexed. The samples were then centrifuged at 12,000 x g for 15min at 4 C. The upper aqueous phase of the supernatant was transferred to a fresh tube and the RNA precipitated out by the addition of 600ul of isopropanol per 1mL of RNABee Reagent. The samples were incubated for 10min at RT and then centrifuged at 12,000 x g for 10min at 4 C. The RNA precipitate formed a gel -like pellet on the bottom of the tube. The supernatant was removed and the pellet washed with 1mL of 75% ethanol. The sample was then vortexed and centrifuged at 7500 x g for 5min at 4 C. The RNA pellet was then air -dried for approximately ten minutes (but not allowed to completely dry), then dissolved in RNase -free water. In order to accurately determine the concentration of RNA in each sample, 2ul of RNA were diluted in 98ul of DEPC H2O, and
PAGE 58
58 the absorbance analyzed at OD of 260 and 280nm in a spectrophotometer. Purity was determined based on an OD 260/280 of 1.6 < x < 1.9. RNA concentration was determined using the formula RNA (ng/ul) = OD2604.3.2 RT -PCR x 50 ng/ul x 100 dilution factor. The RNA samples were then stored in fresh screw -cap tubes at 80 C until further use. 5.0ug RNA from each animal sacrificed wa s utilized for cDNA production. First -strand cDNA was synthesized utilizing the SuperScript First -Strand Synthesis System (Invitrogen) as per manufacturers instructions. The following ingredients were brought together for the reaction: 1ul cDNA, 2ul 10X PCR Buffer, 0.25ul 10mM dNTP mix, 0.5ul 10uM Forward Primer, 0.5ul 10uM Reverse Primer, and 15.55ul Milli -Q H2O. 0.2ul Taq Polymerase was added to each sample just before placement into the thermocycler. The PCR reaction was run in the following manner with the annealing temperature specific to the primer set being utilized: i 94 C for 10min ii. 31 cycles of 94 C for 30sec, annealing temp for 30sec, 72 C for 1min iii. 72 C for 10min iv 4 C for Table 4 1 shows the reaction details for each primer set utilized for cD NA amplification. Following the PCR reaction, 2ul loading dye was added to each 20ul sample and 10ul of that loaded into a 2% agarose mini -gel containing 0.001% Ethidium Bromide, along with an appropriate molecular weight ladder (1kb, 100bp, etc). The ge l was run at about 110 volts for one hour or until desired separation of bands was achieved, as visualized on a UV light box. Pictures of the final gels were taken using the GelDoc XR system (Bio-Rad, Hercules, CA).
PAGE 59
59 4.3.3 Real Time RT -PCR (qPCR) To accur ately assess the variations in gene expression during 2AAF -PH, as well as to confirm successful delivery of GSIXX, levels of Notch1 and other Notchpathway genes were analyzed quantitatively by real time RT PCR. This was accomplished using ready-to use gene plates specific for stem cell genes (SA Biosciences, Frederick, MD) and performed as per the manufacturers instructions. 4.4 Protein Analysis 4.4.1 Isolation of Protein from Tissue A small amount of tissue was placed in the desired amount of RIPA buffe r with Protease Inhibitor. The tissue was broken up then sheared with an 18 gauge needle and syringe, then pipetted up and down until thoroughly homogenized. The sample was vortexed and then centrifuged at 10,000 x g at 4 C to remove excess lipids and DN A. The supernatant was collected in a fresh screw -cap tube and placed at 80 C until further use. 4.4.2 Protein Quantification with DC Protein Assay Blank and protein standards were made up in 1mL tubes as follows: i Blank: 25ul H2O ii. Std #1: 1ul std + 24ul H2O iii. Std #2: 2ul std + 23ul H2O iv Std #3: 4ul std + 21ul H2O v Std #4: 8ul std + 17ul H2O Samples were made up with 1ul sample plus 24ul H2O. Separately, 125ul Reagent A per sample and 2.5ul Reagent S per sample were mixed; 125ul of combined solutions A and S were added to each sample. Just before measurement, 1mL of Reagent B was added and vortexed. After ten minute incubation the OD of the samples was measured in disposable cuvettes using a spectrophotometer set to 750nm.
PAGE 60
60 4.4.3 Western Blot Analysis of Protein Levels 10% acrylamide precast gels were utilized for gel electrophoresis of protein samples. The amount of protein loaded per well was determined based on source of isolation (tissue) and also on the sensitivity of the primary antibody being used for detection. Samples were added to the appropriate amount of RIPA buffer to equal 12ul per lane and placed in a screw cap tube, along with 3ul Western loading buffer. Each sample was boiled for about 10min then incubated for 5min at RT. Individual wells were loaded with 15ul sample with dye with the exception of the first, which was loaded with 7ul of protein molecular weight standard. Any remaining protein solution was placed on ice and returned to storage at 80 C until the next use. Unused wells in t he gel were loaded with 15ul of 1x Western loading buffer. The gel was loaded in the running apparatus with the small plate facing inward. The inner chamber was filled to overflowing with 1X Running Buffer, and the outer chamber was filled approximately 2 inches. The gel was run at 60 volts until the loading dye was out of the stacking gel, then run at 100 volts for the remaining length of the gel. Immuno-blot PVDF (Bio Rad) membrane was prepared by dipping quickly in methanol, soaking in H2O for 5min, then 1X Transfer Buffer for 20min. Sponges and Whatman paper were also saturated in 1X Transfer Buffer. Upon completion of the electrophoresis the gel plates were removed and the stacking gel/wells removed from the gel, which was then transferred to 1X T ransfer Buffer. A sandwich consisting of black assembly tray, sponge, Whatman paper, gel, PVDF membrane, Whatman paper, sponge and red assembly tray along with an ice block and a stir bar were placed in the transfer apparatus. The apparatus was then fill ed with 1X Transfer Buffer and the proteins transferred at 200milliamps for 90min.
PAGE 61
61 Following the transfer, the membrane was blocked O/N at 4 C with a solution consisting of 5% skim milk and 2% glycine in PBS T. The membrane was then probed with the appr opriate concentration of primary antibody O/N at 4 C. After three 5min washes in PBS T, the appropriate HRP -conjugated secondary antibody was applied in PBS T for 30mins to 1hr with shaking at RT, followed by another three 5min washes in PBS T. For development, excess liquid was removed from the membrane and it placed inside a plastic bag. 25ul Solution A along with 1mL of Solution B ECL Plus Reagents (GE Healthcare, Piscataway, NJ) was incubated on the membrane for 5min. Excess reagent was removed, and film (Kodak) exposed to the membrane for 30s to 10min depending on the intensity of the banding pattern. If further probing was necessary, the membrane was then stripped. 714ul of 2mercaptoethanol was added to 100mL 1X Stripping Buffer and the solution along with the membrane sealed inside a plastic bag. The bag was incubated at 55 C for 30min with intermittent shaking. The membrane was then washed 5 7 times of ten minutes each with 1X PBS T until all residual 2 -mercaptoethanol was removed. Membranes were then reblocked with milk and reprobed as per the above protocol. Table 4 2 demonstrates the primary antibodies and conditions utilized for western blot analysis. 4.5 Histology and Immunohistochemistry 4.5.1 Hematoxylin and Eosin of Paraffin Embed ded Tissue Tissue sections 5um in size were cut and placed in a 42 C water bath, then lifted from the bath on a Superfrost Plus (Thermo Fisher Scientific Inc, Waltham, MA) positively-charged slide, which were then allowed to dry O/N at RT. The paraffin wa s removed and the tissue rehydrated by incubating the slides in Xylene 2 x 5min, 100% Ethanol 2 x 2min, 95% Ethanol 2 x 2min and
PAGE 62
62 finally distilled H2O for 1min. Nucleic acids and other positively charged molecules were then stained with Hematoxylin 7211 ( Richard Allan Scientific) for 2.25min, then rinsed with distilled H2O for 2 x 1min. The blue of the hematoxylin was intensified by incubating the slides in Clarifier 1 (Richard -Allan Scientific) for 1min, distilled H2O for 1min, Bluing Reagent (Richard -Al lan Scientific), distilled H2O for 1min, and 80% Ethanol for 1min. Proteins were then stained a pink color with Eosin -Y (Richard -Allan Scientific) for 1.5min. The tissue was then dehydrated for coverslipping with 95% Ethanol 2 x 1min, 100% Ethanol 2 x 1m in, and Xylene 3 x 1min. Coverslips were then applied with Cytoseal XYL (Richard-Allan Scientific). 4.5.2 Hematoxylin and Eosin of Frozen Tissue Tissue sections 6um in size were cut and placed on Superfrost Plus (Thermo Fisher Scientific Inc., Waltham, MA ). The slides were air dried for 30min at RT, then fixed in acetone for 30sec, then washed in distilled H2O for 1min. Nucleic acids and other positively charged molecules were stained with Hematoxylin 7211 (Richard-Allan Scientific) for 45sec then rinsed with distilled H2O for 1min. The blue of the hematoxylin was intensified by incubating the slides in Clarifier 1 (Richard -Allan Scientific) for 25sec, distilled H2O for 30sec, Bluing Reagent (Richard -Allan Scientific) for 30sec, distilled H24.5.3 Immunohistochemistry: Chromagen Staining O for 30sec, and 80% Ethanol for 30sec. Proteins were stained a pink color with Eosin -Y (Richard -Allan Scientific) for 30sec. The tissue was then dehydrated for coverslipping with 95% Ethanol 2 x 1min, 100% Ethanol 2 x 1min, and Xylene 3 x 1min. Coverslips were then applied with Cytoseal XYL (Richard -Allan Scientific). All staining of paraffin and frozen sections was performed with Vector ABC Kits using DAB (Vector Laboratories, Burlingame, CA) and carried out as per manufacturers instructions. Tissue was deparaffinized and rehydrated as in H & E staining. Frozen sections were fixed in acetone unless otherwise noted. Slides were incubated with primary antibody O/N at 4 C and 1
PAGE 63
63 hour for secondary antibodies. Any speci al retrieval method utilized is indicated, along with the details for each antibody used, in T able 4 3. 4.6 Index of Solutions 10X Agarose Gel Loading Buffer 1. 15.0mg bromophenol blue 2. 15.0mg xylene cyanol 3. 8.0g sucrose 4. Milli Q H2O qs to 10mL 10X PBS 1. 80.0g NaCl 2. 2.0g KCl 3. 11.5g Na2HPO4 7H2O 4. 2.0g KH2PO4 5. Milli Q H2O qs to 1L RIPA Buffer and Protease Inhibitor Solution RIPA Buffer 1. 1.5mL 1M NaCl 2. 0.5mL 1M Tris Cl pH 8.0 3. 1.0mL 10% NP 40 4. 1.0mL 10% NaDeoxycholate 5. 5.5mL Milli Q H2O Protease Inhibitor Solution (added to RIPA just prior to use) Total = 10.0mL 5X TBE 1. 54.0g Tris base. 2. 22.5g Boric acid 3. 4.7g EDTA 4. Milli Q H2O qs to 1L 10X TBS 1. 80.0g NaCl 2. 2.0g KCl 3. 30.0g Tris base 4. 800mL H20 5. Milli Q H2O qs to 1L Adjust pH to 7.4 using 1M HCl 5X Western Loading Buffer
PAGE 64
64 1. 1.5mL 0.5M Tris HCl 2. 1.0g 10% SDS -mercaptoethanol 4. 1.5mg Bromophenol Blue 5. Milli Q H2O qs to 10mL 10X Western Running Buffer 1. 144.0g Glycine 2. 30.0g Tris -Base 3. 10.0g SDS 4. Milli Q H2O qs to 1L 5X Western Stripping Solution 1. 37.83g Tris Base 2. 1g SDS 3. pH to 6.8 4. Milli Q H2O qs to 1L 10X Western Transfer Buffer 1. 115.0g Glycine 2. 24.0g Tris -Base 3. Milli Q H2O qs to 1L When diluted to 1X, 80mL of 10X Transfer Buffer was added to 720mL Milli Q H2O and 200mL Methanol.
PAGE 65
65 Figure 4 1. Model for oval cell induction. Diagrammatic representation of the 2AAF -PH protocol in the rat including pellet implantation, sacrifice. Figure 4 2. Model of oval cell induction with Notch inhibition. Diagrammatic representation of the 2AAF -PH protocol combined with -secretase inhibitor in the rat including pellet implantation, sacrifice.
PAGE 66
66 Table 4 1. PCR Primer Sequences. Individual primer sets utilized for RT -PCR, together with the reaction and product details for each primer set. Gene Primer Sequence (5 3) Annealing Temp ( C) Product Amplified (bp) Notch1 Fw:ATCCATGGCTCCATCGTCTA Rev:TTCTGATTGTCGTCCATCAG 55 422 Notch2 Fw: TTTGCTGTCGGAAGACGACC Rev:GCCCATGTTGTCCTGGGCGT 62 403 Jagged1 Fw:TCCAGCCTCCAGCCAGTGAA Rev:GGAAGGCTCACAGGCTATGT 61 201 Hes1 Fw:CAACACGACACCGGACAAACC Rev:AGTGCGCACCTCGGTGTTAAC 55 349 GAPDH Fw: TGAGGGAGATGCTCAGTGTT Rev: ATCACTGCCACTCAGAAGAC 58 490
PAGE 67
67 Table 4 2. Antibodies utilized for western blot analysis. Antibody Host Concentration MW (kDa) Company Notch1 Rabbit 1:1000 120 Cell Signaling p21 Mouse 1:200 21 Santa Cruz G6Pase Goat 1:200 36 Santa Cruz actin Mouse 1:2000 42 AbCam Table 4 3. Antibodies utilized for immunohistochemical analysis. Antibody Host Concentration Section Retrieval Company Notch1 Rabbit 1:1 00 Paraffin Citrate Millipore Jagged1 Goat 1:100 Paraffin Citrate AbCam Ki67 Mouse 1:100 Paraffin Citrate BD Biosciences AFP Mouse 1:500 Paraffin Trilogy Dako OV 6 Rabbit 1:150 Frozen None Gift from S. Sell CYP3A2 Rabbit 1:100 Paraffin Citrate Fitzger ald
PAGE 68
68 CHAPTER 5 RESULTS 5.1 Analysis of Notch Family Expression D uring Oval Cell -Mediated Liver Regeneration As there are multiple isoforms of both the receptor (four) and ligand (two), we set out to determine which isoforms were upregulated during oval cell -mediated liver regeneration. RT PCR analysis across the 2AAF -PH timecourse shows an upregulation of Notch1 and Jagged1 during the peak of oval cell induction (Figure 51) approximately 9 11 days post -partial hepatectomy Expression of Notch2, Notc h3, Notch4 and Jagged2 remained unchanged during the timecourse. Examination of Notch effector Hes1 also revealed an increase in expression during oval cell -induction demonstrating transduction of the Notch signal downstream and true activation of the pa thway. Based on these data, we ascertained that Notch1 signaling via Jagged1 activated the downstream effector Hes1 during the peak of oval cell induction, indicating that Notch signaling may play a critical role in oval cell -mediated liver regeneration. To further confirm Notch1 signaling during oval cell induction, we performed an in situ PCR on liver sections taken from animals on day 11 of the 2AAF -PH protocol. This was accomplished using a DIG -labeled UDP for the otherwise normal PCR reaction follow ed by incubation with a DIG labeled secondary antibody and subsequent development Human lung adenocarcinoma was used as a positive control for Notch activation. Notch1 DNA was found to mainly be localized in the cytoplasm and nuclei of hepatocytes, whil e membranous Jagged1 expression was seen in primarily in biliary cells as well as some hepatocytes at day 11 (Figure 5 2). This is indicative of Notch1 receptor activation by Jagged1 present on adjacent cells, as well as of subsequent translocation of the NICD to the nucleus of the hepatocytes (key indicator of pathway activation).
PAGE 69
69 Next, western blot analysis was used to investigate activation of the pathway at the protein level (Figure 5 3). Protein taken from animals at standard timepoints in the oval c ell induction protocol confirmed upregulation of Notch1 from day 9 to day 13 of the timecourse, with a return to basal levels by day 22 post -PH. To examine receptor ligand protein localization, immunohistochemical analysis was performed on liver sections taken from animals on day 11 of the 2AAF -PH protocol (Figure 5 4). The Notch1 antibody used is specific to the NICD portion of the receptor, while the Jagged1 antibody is specific to the proteins carboxy terminus. Here again we find activation of Notch1 receptor in the hepatocytes, as well as expression of Jagged1 on hepatocytes and cholangiocytes present. This is indicative of Notch1 Jagged1 receptor -ligand interaction between adjacent cells, and further demonstrates translocation of the NICD to the nu cleus in the Notch1 activated hepatocytes. Immunofluorescence, also performed with antibody specific to the NICD, further demonstrates activation of the receptor and translocation of the NICD to the nucleus in activated hepatocytes (Figure 5 5). Investi gation of all the isoforms of Notch and Jagged during 2AAF -PH reveals upregulation of Notch1 and Jagged1 at the peak of oval cell induction. As the peak mRNA and protein expression of both receptor and ligand occurs with the influx of oval cells at days 911 post PH, it can be concluded that activation of Notch1 by its ligand Jagged1 is necessary for oval cell -mediated liver regeneration. Persistent upregulation of Notch1 protein through day 13 of the timecourse indicates a role for Notch signaling in the differentiation of the activated oval cells.
PAGE 70
70 5.2 in vivo Inhibition of Notch Signaling During Oval Cell Induction -secretase is the enzyme responsible for the cleavage and subsequent activation of the Notch receptor. Administration of gamma secretase inhibitor (GSI) XX prevents this cleavage and thereby terminates the Notch signal before it is able to take effect in the nucleus. 2AAF -PH treated rats were injected with GSIXX and the oval cell response was examined at day 11 and day 22 following PH. He matoxylin and Eosin staining shows that there remains a massive activation of the oval cell compartment at day 11 post -PH upon treatment with GSIXX ; however the architecture is more disorganized and there is a larger immune infiltrate, likely due to the so lution used to administer the inhibito r as compared to 2AAF -PH alone (Figure 5 6) Also significant is the number of oval cells remaining in the periportal regions of the liver at day 22 post PH after GSIXX treatment as compared to 2AAF PH alone. The pr esence of oval cells at this late stage of regeneration indicates their failure to differentiate into a mature phenotype, either hepatocyte or cholangiocyte. To further demonstrate downregulation of Notch signaling via GSI XX, we performed a real time PC R analysis of mRNA isolated from livers of animals on the 2AAF PH protocol, both with and without inhibitor treatment Figure 5 7 shows graphical representations of the fold change in expression of Notch pathway genes during 2AAF PH alone. Notch1 express ion levels increase significantly at day 11 post -PH as compared to control and day 22 post PH ( ** P < .001). As expected, no change was seen in Notch2 expression. Analysis also revealed a drastic upregulation of downstream effector Hes1, demonstrating si gnificant Notch signal transduction at the peak of oval cell infiltration. Figure 5 8 demonstrates fold change in expression for Notch pathway genes in animals on the 2AAF -PH protocol with GSIXX. As the inhibitor targets Notch at the protein level, we do
PAGE 71
71 not expect to see a decrease in Notch 1 gene expression at day 11 in the GSI XX treatment group, but should see a change in expression levels of downstream effectors. I n the GSIXX-treatment group there was no increase in Hes1 expression at day 11 post -PH demonstrating interruption of the Notch signal. While we do see a small increase in Notch2 expression levels, it is insignificant as compared to Notch1 and likely due to functional redundancy that is subsequently eliminated by inhibitor targeting. To verif y downregulation of Notch signaling we performed a western analysis with an antibody specific to the cleaved form of Notch1 (Val1774). Figure 5 9 demonstrates a significant decrease in the levels of the activated receptor ( P < .0 0 1) at days 11 and 22 post PH with GSIXX. In order to fully characterize the oval cells activated by 2AAF -PH when Notch signaling is simultaneously inhibited, we examined the expression levels of standard oval cell surface markers. Immunohistochemical analysis of OV 6 express ion (Figure 5 10) demonstrates the activation of oval cells in the periportal regions in response to injury at day 11 post -PH alone, which have generally differentiated into mature phenotypes by day 22 post -PH alone However in the absence of Notch signal ing, while there is a similar infiltration of oval cells at day 11 we see a large number of OV 6 positive cells persisting out to day 22 post -PH Further evidence of this abnormal oval cell differentiation is exhibited in the staining for AFP (Figure 5 11). Note the typical elevated level of expression at day 11 post -PH both with and wit hout treatment but also that there is minimal AFP expression at day 22 when Notc h is inhibited This lack of AFP expression is echoed at the gene level, where mRNA expre ssion of AFP at day 22 in the GSIXX treated group is almost e quivalent to control (Figure 5 8) The fact that the oval cells present at day 22 post -PH are OV 6 positive and AFP negative is indicative of
PAGE 72
72 a short -circuiting within the differentiation progra mming of these progenitors when Notch signaling is inactivated. As it appeared that termination of the Notch signal had an inhibitory effect on the differentiation capacity of oval cells, we decided to investigate other markers of differentiation. Western analysis of protein isolated from livers of GSIXX -treated animals demonstrated a dramatic decrease in levels of the biliary marker CK19 upon treatment with GSI XX at day 22 as compared to 2AAF -PH alone (Figure 5 12). We therefore also decided to examine levels of HNF 1 a transcription factor regulated by Notch signaling and which is involved specifically in biliary differentiation. Western blot analysis reveals a marked downregulation in the expression of this factor during oval cell -mediated liver reg eneration when Notch signaling was concomitantly downregulated (Figure 5 13). Morphological evidence as well as the decreased expression of markers of differentiation by the cells present at day 22 in the GSIXX treated group is evidence that dysregulation of the Notch pathway results in a delay in the differentiation of activated oval cells. T here have been conflicting reports in the literature describing the effects of Notch downregulation on proliferation, particularly in the liver. We therefore examine d cell cycle progression and growth during regeneration by analysis of hepatocellular mitoinhibition index a ratio between expression of p21Waf1 (cell cycle inhibitor) and Ki67 (a marker of cel lular proliferation). Figure 5 14 shows a mass of proliferati ng cells by Ki67 staining at day 11 post PH during 2AAF PH alone, with a similar response seen during 2AAF -PH combined wi th GSI XX treatments W hile the cells re maining at day 22 post -PH alone have ceased proliferating, the hepatocytes seen at this timepo int appear to remain mitotically active when Notch sig naling is
PAGE 73
73 terminated Semi -quantitative analysis of the se data can be seen in Figure 5 15, demonstrating the enhanced effects on proliferation seen during Notch inhibition. We also investigated expre ssion of p21, a well known cell cycle inhibitor and downstream target of Notch signaling. Figure 5 16 shows a western analysis of protein isolated from livers of GSI XXtreated animals, demonstrating a dramatic decrease in expression levels of p21 upon tre atment with GSI XX at day 22 as com pared to 2AAF -PH alone. Expression of phosphor AKT, another marker of cell cycle inhibition, also revealed an interesting result; treatement with GSIXX significantly reduced levels of phosphorylated AKT (Figure 5 17). T his drastic downregulation of cell cycle inhibitors signifies dysregulated cellular growth and cell cycle progression. To fully determine the extent of growth during 2AAF PH with and without GSI XX, we examined the hepatocellular mitoinhibition index. Thi s ratio of replicative arrest/proliferation was determined by dividing the number of p21 -positive nuclei by the number of Ki67-positive nuclei. This ratio as represented graphically in Figure 5 18, was found to be significantly different between the two groups at both day 11 and day 22 post -PH ( ** P < .001). These results demonstrate that diminished Notch signaling leads to an aberrant regulation of factors that works to promotes cell cycle progression and proliferation during regeneration of the liver following 2AAF -PH Mature hepatocytes are responsible for carrying out the functions of the liver that are required for homeostasis. Typically during 2AAF -PH, the hepatocytes produced in response to the injury are mature and functional by day 22 post -PH; h owever when Notch signaling was inhibited, the activated oval cells did not properly differentiate into a mature phenotype We therefore examined the functional characteristics of the hepatocytes produced in the two
PAGE 74
74 treatment groups. Immunohistochemical analysis of CYP3A2 (Figure 5 19) an isoform of cytochrome p450 expressed only by mature hepatocytes, shows a typical decrease in expression at day 11 post -PH with an upsurge back to basal levels by day 22 post -PH (Figure 7A and B). However in the GSI -tre ated group, there is a drastic decrease in CYP3A2 expression at day 11 that remains in effect through day 22 post -PH. We also decided to examine expression of another functional enzyme, glucose 6 phosphatase (G6Pase) Protein a nalysis via Western Blotti ng revealed a dramatic decrease in the amount of en zyme being expressed after GSI XX treatment as compared to 2AAF -PH alone (Figure 5 20) These results are indicative of altered glucose metabolism and call into question the functionality of the hepatocyt es present at this timepoint. Although the decrease in G6Pase upon Notch inhibition is a novel finding, the downregulation of CYP has been previously documented in other tissue systems when Notch signaling was inactivated {Rodriguez, 2008} .96 Altogether t his data suggests that inhibition of Notch signaling may lead to functionally impaired cellular progeny.
PAGE 75
75 Figure 5 1. RT -PCR analysis of normal rat liver as well as liver taken at standard timepoints following 2AAF -PH for mRNA expression of various Notch pathway components.
PAGE 76
76 Figure 5 2. Expression of Notch and Jagged via in situ PCR. A. Notch DNA expression on human lung adenocarcinoma (positive control). B. Expression of Notch DNA on paraffin sections of liver at day 11 post 2AAF -PH. C. Expression o f Jagged DNA on paraffin sections of liver at day 11 post 2AAF -PH.
PAGE 77
77 Figure 5 3. Analysis of Notch1 protein expression during 2AAF -PH. A. Western blot analysis of Notch1 using an antibody specific to the cleaved receptor shows a significant increase in activated Notch1 expression during the peak of oval cell induction. B. Semi quantitative analysis of A. All data was normalized to actin and then compared to control.
PAGE 78
78 Figure 5 4. Immunohistochemistry for Notch1 and Jagged1. A. Antibody IgG negati ve control. B. Localization of Notch1 protein expression using an antibody specific to the Notch Intracellular Cytoplasmic Domain. C. Localization of Jagged1 protein expression using an antibody specific to the proteins carboxy terminus. Notch1 appears to stain hepatocytes while Jagged1 positivity is seen primarily on oval cells and bile duct cells, but also in some hepatocytes.
PAGE 79
79 Figure 5 5. Immunofluorescence for activated Notch1 at day 11 post 2AAF -PH. A. Nuclear localization with DAPI. B. Locali zation of activated Notch1 receptor using an antibody specific to Notch Intracellular Cytoplasmic Domain. C. Merge Notch1 and DAPI. D. Higher magnification of C.
PAGE 80
80 Figure 5 6. H&E staining of liver from animals on the 2AAF PH protocol or 2AAF_PH comb ined with GSIXX. A. 2AAF -PH control; B. Day 11 post -PH; C. Day 22 post PH; D. 2AAF -PH GSIXX control; E. Day 11 post -PH with GSIXX; F. Day 22 post PH with GSIXX. Day 11 shows a massive infiltration of oval cells in both treatment groups. During 2AAF PH a lone, the oval cells have differentiated into mature phenotypes by day 22; however in the GSIXX -treated group, we see oval cells persisting through day 22 post PH. Magnification A&D 200x; B -C&E -F 400x
PAGE 81
81 Figure 5 7. Real time PCR analysis for expression of Notc h pathway members during 2AAF -PH. Significant differences in expression occur during the peak of oval cell induction as compared to control for both the Notch1 receptor as well as the downstream effector Hes1.
PAGE 82
82 Figure 5 8. Real time PCR analys is for expression of Notc h pathway members during 2AAF -PH with GSIXX. The inhibitor targets Notch at the protein level, and therefore we do not see downregulation of message of the receptor; however there is a significant decrease in Hes1 expression, indic ative of interruption of Notch signaling.
PAGE 83
83 Figure 5 9. Analysis of Notch1 protein expression during 2AAF -PH with GSIXX. A. Western blot analysis of Notch1 using an antibody specific to the cleaved receptor shows a significant decrease in activated Notc h1 expression during the peak of oval cell induction that remained in effect through day 22, indicating that the treatment effectively inhibited Notch signaling. B. Semi -quantitative analysis of A. All data was normalized to actin and then compared to control.
PAGE 84
84 Figure 5 10. OV 6 staining during the 2AAF -PH protocol or 2AAF PH with GSIXX. A. 2AAF PH control; B. Day 11 post -PH; C. Day 22 post -PH; D. 2AAF PH GSIXX control; E. Day 11 post -PH with GSIXX; F. Day 22 post -PH with GSIXX. OV6 expression sig nificantly increases at day 11 in both treatment groups, but only in the GSIXX treated group do we still see positivity at day 22 post -PH. Magnification 200x.
PAGE 85
85 Figure 5 11. AFP staining during the 2AAF -PH protocol or 2AAF -PH with GSIXX. A. 2AAF PH con trol; B. Day 11 post -PH; C. Day 22 post -PH; D. 2AAF PH GSIXX control; E. Day 11 post -PH with GSIXX; F. Day 22 post -PH with GSIXX. AFP expression significantly increases at day 11 in both treatment groups; however while OV 6 expression remains in effect at day 22 in the GSIXX treated group we do not see AFP expression at day 22 post -PH. Magnification 200x.
PAGE 86
86 Figure 5 12. Analysis of CK19 protein expression during 2AAF PH or 2AAF PH with GSIXX. A. Western blot analysis of CK19 shows an increase in expre ssion at day 11 that remains in effect through day 22. However in the GSIXX treated group, there is a significant decrease in expression levels at day 22 post -PH. B. Semi -quantitative analysis of A. All data was normalized to actin and then compared t o control.
PAGE 87
87 Figure 5 13. Analysis of HNF1 protein expression during 2AAF PH or 2AAF PH with GSIXX. A. Western blot analysis of HNF1 shows an increase in expression at day 11 that remains in effect through day 22. However in the GSIXX -treated group, there is a significant decrease in expression levels at day 11 that remains in effect through day 22 post PH. B. Semi -quantitative analysis of A. All data was normalized to actin and then compared to control.
PAGE 88
88 Figure 5 14. Ki67 staining during the 2AAF PH protocol or 2AAF PH with GSIXX. A. 2AAF PH control; B. Day 11 post -PH; C. Day 22 post -PH; D. 2AAF PH GSIXX control; E. Day 11 post -PH with GSIXX; F. Day 22 post -PH with GSIXX. Ki67 expression significantly increases at day 11 in both treatment gr oups; however while cells have stopped proliferating at day 22 after 2AAF -PH alone, mitotically active cells persist through day 22 in the GSIXX -treated group. Magnification 200x.
PAGE 89
89 Figure 5 15. Semi quantiative analysis of Ki67 staining during the 2AAF PH protocol or 2AAF PH with GSIXX.
PAGE 90
90 Figure 5 16. Analysis of p21 protein expression during 2AAF -PH or 2AAF -PH with GSIXX. A. Western blot analysis of p21 shows a decrease in expression at day 11 due to liver resection with a return to basal express ion by day 22. However in the GSIXX treated group, there is a significant increase in expression levels at day 22 post PH. B. Semi quantitative analysis of A. All data was normalized to actin and then compared to control.
PAGE 91
91 Figure 5 17. Analysis of phospho-AKT protein expression during 2AAF -PH or 2AAF PH with GSIXX. A. Western blot analysis of p -AKT shows a decrease in expression at day 11 due to liver resection with a return to basal expression by day 22. However in the GSIXXtreated group, expres sion of p-AKT does not return to anywhere near basal levels by day 22 post -PH. B. Semi quantitative analysis of A. All data was normalized to actin and then compared to control.
PAGE 92
92 Figure 5 18. Hepatocellular mitoinhibition index for 2AAF PH alone as well as 2AAF -PH with GSIXX. This is calculated by dividing the number of p21 positive nuclei by the number of Ki67 positive nuclei.
PAGE 93
93 Figure 5 19. CYP3A2 staining during the 2AAF -PH protocol or 2AAF -PH with GSIXX. A. 2AAF -PH control; B. Day 11 post -PH; C. Day 22 post PH; D. 2AAF -PH GSIXX control; E. Day 11 post -PH with GSIXX; F. Day 22 post -PH with GSIXX. CYP3A2 expression significantly decreases at day 11 in both treatment groups due to liver resection; however upon restoration of the liver mass by da y 22 expression of CYP3A2 returns after 2AAF -PH alone. No expression of CYP3A2 is seen at day 22 in the GSIXX -treated group. Magnification 200x.
PAGE 94
94 Figure 5 20. Analysis of Glucose 6 -Phosphatase protein expression during 2AAF -PH or 2AAF -PH with GSIXX. A. Western blot analysis of G6Pase shows a decrease in expression at day 11 due to liver resection with a return to basal expression by day 22. However in the GSIXX treated group, there is no return of G6Pase protein to basal levels by day 22. B. Semi quantitative analysis of A. All data was normalized to actin and then compared to control.
PAGE 95
95 Figure 5 21. Diagram depicting involvement of Notch signaling in the differentiation of stem cells/progenitors. A. In the case of a general bipotential cell, the up or downregulation of Notch signaling decides the fate of that cell. In the absence of the Notch signal, the cell will assume a primary fate; however when the signal is activated the cell will develop into its secondary phenotype. Applying this concept to the oval cell system during liver regeneration, we find that Notch signaling is necessary for the proper ratio of differentiation to occur. B. When Notch signaling is active we see that oval cells assume both hepatocy te and cholangiocyte linages. C. In the absence of the Notch the cells do not appear to be able to differentiate properly into a mature lineage
PAGE 96
96 CHAPTER 6 DISCUSSION AND FUT URE STUDIES 6.1 Summary of Results The role of the Notch signaling pathway in stem cell -mediated liver regeneration was examined using the 2AAF PH oval cell induction protocol. Examination of the multiple isoforms of Notch receptor and Jagged ligand via RT -PCR, immunohistochemistry and western analysis revealed that at the peak of oval cell infiltration, approximately 9 11 days post -PH, there was a significant increase in expression of Notch1, Jagged1 and the downstream effector Hes1. These elevated expression levels abated by day 22 post PH, the accepted endpoint of regeneration by this model indicating a potential necessity for Notch signaling during oval cell mediated liver regeneration. We therefore decided to employ a model of Notch inhibition in vivo to examine what effects, if any, the absence of Notch signaling might have on the oval cells and their capacity for rapid regeneration of the liver after injury. Although a robust response was exhibited by the oval cells at day 11 post -PH, they were still present in the portal regions of the liver at day 22 post -PH upon treatment with GSIXX, indicating that Notch inhibition caused a delay in oval cell differentiation. Examination of oval cell markers OV 6 and AFP revealed interesting results: although the oval cells present at day 22 post PH with GSIXX were OV 6 positive, they w ere not positive for AFP. Further analysis for markers of differentiation showed a decrease in expression of biliary marker CK19 via western blot at day 22 post -PH with GSIXX, a result that was abrogated by a significant decrease in the biliary transcript ion factor HNF 1 T hese experiments demonstrate an asynchronous and skewed differentiation response by the oval cells when Notch is inhibited during 2AAF -PH
PAGE 97
97 Oval cell differentiation was not the only process to be affected by Notch inhibition. Analyhsi s of proteins such as Ki67, p21 and AKT at day 22 post -PH with GSIXX revealed drastic dysregulation of these markers of growth and cell cycle progression, indicating that Notch signaling may be partly responsible for regulation of proliferation upon 2AAF P H. The dysregulation of p21 upon Notch inhibition also supports this idea, as p21 is a well known downstream effector of Notch signaling. Lastly, as the absence of Notch signaling had a profound effect on the oval cell differentiation response, we decided to examine the functionality of the cellular progeny at day 22 post -PH with GSIXX. Investigation of functional enzyme markers CYP3A2 and G6Pase showed a significant decrease in their expression levels upon inhibitor treatment. This indicates not only a failure of the oval cells to differentiate into a mature phenotype but also that any differentiation that does occur will not be normal. 6.2 Interpretation of Results Notch is an evolutionarily conserved local cell -signaling mechanism that participates in the regulation of cell fate specification, cellular growth and proliferation21Here we demonstrate disruption of the Notch signal upon treatment by both a decrease in activated Notch receptor as well as by a decrease in expression of the down stream effector Hes1. Here we have demonstrated activation of the Notch pathway during liver regeneration mediated by oval cells via the 2AAF -PH protocol, as well as showing that Notch inhibiti on during 2AAF -PH has significant consequences for liver regeneration. The data presented here provide novel evidence that Notch signaling is necessary in order for proper regulation of oval cell differentiation to occur, and further implies Notch signali ng in a functional capacity with regard to the progeny produced by the activated oval cells.
PAGE 98
98 Because GSIXX targets all forms of Notch receptor, functional redundancy of receptor/ligand is not called into question. It has been shown that when Notch signaling is upregulated during 2AAF -PH the bipotential oval cells do take on both hepatocyte and cholangiocyte fates; however, in the absence of the signal the number of oval cells committed to primary versus secondary fates is altered. Morphological analysis of GSIXX treated samples shows incomplete differentiation of oval cells into mature lineages upon regeneration after 2AAF PH, an idea that is further supported by persistent expression of oval cell markers OV 6 and AFP at day 22 post PH. The abnormal expression levels of CK19 and HNF 1 are also suggestive of an asynchronous differentiation response by these oval cells, potentially skewing the ratio of differentiating oval cells in favor of a hepatocyte versus a biliary fate. It is possible that the absence of the appropriate signal (i.e. Notch) forces the oval cells to choo se a primary fate, but upon making that choice the cells find that they are incapable of fully differentiating into that functional phenotype. The cells present at day 22 post -PH after Notch inhibition were negative for functional markers of maturity such as CYP and G6Pase This demonstrates a stunted attempt at differentiation and indicates that Notch is required for functional differentiation of oval cells during regeneration of the liver following 2AAF -PH. More specifically, it can be concluded that Notch signaling is necessary for the appropriate ratio of progenitors to assume primary versus secondary phenotypes (hepatocyte vs. biliary, respectively). In 2004 Tanimizu et al. published work demonstrating that expression of NICD in progenitors inhibits the differentiation leading to hepatocytes and induces characteristics of cholangiocytes.97 Furthermore studies performed by Zong et al. give evidence that hepatocytes retain biliary competence in response to Notch signals, suggesting that hepatobilli ary remodeling
PAGE 99
99 after injury is regulated by Notch.98In the last decade conflicting reports have been seen in the literature describing the effects of Notch signaling on proliferation, particularly in the liver. For example, a study by Kohler et al. suggests that Notch1 inactivation has a direct role in inhibiting hepatocyte proliferation; The data presented in this paper corroborate these results and we have outlined our interpretation of Notch involvement in stem cell differentiation during 2AAF -PH in Figure 8, which diagrams the general effects of an increase or decrease in Notch signaling on the process of oval cell fate determination. 53 in contrast, another study by Croquelois et al. suggests that Notch signaling plays a role in promoting rather than inhibiting regeneration and proliferation.94 Our experiments are further evidence of the necessity for Notch signaling in regulation of these processes. Inhibition of Notch during oval cell -mediated regeneration resulted in an aberrant hepatocellular mi toinhibition index (p21Waf1:Ki67) after regeneration. It is likely that the absence of Notch1 during regeneration leads to altered cell cycle regulation, particularly because differentiation and transition through cell cycle checkpoints are closely linked In fact, studies performed by Carlesso et al show that the relative proportion of cells in specific phases of the cell cycle were consistently altered in the presence of activated Notch1;99 conversely it is completely plausible that inhibition of Notch1 would also lead to a visible change in cell cycle kinetics during oval cell mediated liver regeneration, allowing for in creased cell cycle progression. This idea is supported by decreased expression of p21 and increased expression of p-AKT (data not show n). It has further been suggested that results such as these along with the function of Notch1 to inhibit hepatocyte proliferation under non-pathological conditions could mean that Notch signaling is part of a tumor suppressor like program in the liver.94 Although no data has been provided to show that Notch1 inactivation leads to the development of carcinomas in the liver,
PAGE 100
100 the spontaneous proliferation of hepatocytes when Notch is inhibited may represent the first hit in a model of tumorigenic developm ent, where further hits are required in order for hepatocyte growth to be completely disregulated. Determining if inactivation of Notch signaling promotes tumorigenesis could prove to be an exciting avenue to pursue. As Notch is known to be involved in th e mediation of binary cell fate decisions in other systems1001036.3 Future Studies it is logical to conclude that interruption of the signal would lead to impaired integration of cellular fate by the activated oval cells. However much remains to be understood about the m echanisms by which Notch signaling regulates oval cell development and growth. Our studies provide evidence that Notch signaling is activated and plays an important role in the differentiation and proliferation of oval cells after 2AAF -PH. Moreover the data presented here demonstrates that when Notch signaling is inhibited, other downstream signals are also influenced thereby leaving the newly formed hepatocytes functionally deficient. Further studies will be required to fully delineate the effects of No tch signaling on these processes. 6.3.1 Exposure of Oval Cells to Notch1 Isolation of oval cells and exposure of them in vitro to Notch1 may induce cholangiocyte differentiation in culture faster than current differentiation methods, and might also aid in procotols calling for oval cell transplantation and engraftment. Recombinant rat Notch1 protein is now available from R&D Systems and could easily be employed in an in vitro model. Furthermore, portal injections of Notch1 during 2AAF -P H could potentially enhance the oval cell response in vivo 6.3.2 Conditional Knockout of Notch1 in vivo Changes in Notch levels during embryogenesis results in severe and drastic malformations of numerous tissues and/or failure of the embryo to fully deve lop, therefore development of a
PAGE 101
101 conditional Notch1 knockout animal could further define the role of Notch1 in oval cell mediated liver regeneration. Creation of inducible Notch -signaling systems has already been described for analysis of the necessity of Notch signaling for such diseases as Ewing Sarcoma and Kaposis Sarcoma.104,105Furthermore, use of the Tet on/off system wo uld allow for a model of Notch recovery during 2AAF PH, where Notch is initially turned off but then activated at the appropriate timepoint after partial hepatectomy. If the oval cells proceed to differentiate properly and are functional after Notch signa ling is recovered, that would be irrefutable proof that Notch1 is required for functional differentiation of oval cells during liver regeneration. Controlling Notch1 expression with a t et racyclin (Tet) on/off system using the albumin promoter would result in a conditional knockout that would only be active in the liver w hen desired, i.e. at specific timepoints during the 2AAF -PH protocol. This knockout would confirm the results seen in this study and provide alternative methods for looking at t he role of Notch1 in the liver. 6.3.3 Notch and Wnt: Oval Cell Fates Hang in the Balance Crosstalk between the Notch and the Wnt signaling pathways has been demonstrated in a multitude of models in the literature. Inhibitory cross -communication between the two pathways was previously thought to occur at the level of the Notch intracellular cytoplasmic domain binding to Wnt106 and at the leve l of the Notch intracellular cytoplasmic domain binding to disheveled.107 However it has recently been shown that interpathway communication can also occur at the level of processing molecules such as presenelin108, or even at the transcription factor lev el. 39, 109
PAGE 102
102 6.3.4 Notch and Liver Tumorigenesis There has been no data published thus far implicating Notch in liver tumorigenesis, giving this area of research quite the potential As Notch can exert tumor -suppressive and differentiation promoting activi ties, if its signaling does have a role in tumorigenesis it is as yet unclear. I t is possible that tumor progression might select for cells that are refractive to Notch signaling in tissues in which absence of this pathway promotes growth, enhances survival and/or inhibits differentiation. Also as previously stated, Notch alone is a poor oncogene and needs a partner in crime so to speak, one that would allow the cells to override the G1/S checkpoint. There are several likely candidates for this other o ncogene, including Myc and Ras. F urthermore, the inability of Notch1 to allow for override of the G1/S checkpoint indicates that it has some other tumorigenic capability, such as transferring resistance to anoikis or p53 mediated apoptosis.110,111 112,1136.3.5 Summary of Proposed Experiments The latter seems to be the most likely scenario, one that could easily be investigated by analysis of expression levels of p53 upon Notch inhibition as well as a TUNEL assay for cell death or immunohistochemistry for such markers of apoptosis as the caspas es (3, 8,). However, resistance to anoikis could be investigated in isolated primary oval cells treated with GSIXX or other Notch inhibitor in vitro. Each of the experiments proposed above would help to confirm the re sults seen in this study, as well as enhancing the knowledge of the Notch pathways role in oval cell -mediated liver regeneration. Complete evaluation of the contribution of Notch signal ing to the regeneration process, as well as its communication with ot her signaling modulators, is essential for full understanding of oval cell -mediated liver regeneration. With this study and future experiments we hope to demonstrate the necessity for Notch signaling in oval cell -mediated liver regeneration, as well as ho w disregulation of Notch plays a role in disease and malignancy.
PAGE 103
103 LIST OF REFERENCES 1 Artavanis Tsakonas S, Matsuno K, Fortini ME. Notch Signaling. Science 1995; 268:225232. 2 Artavanis Tsakonas S, Rand MD, Lake RJ. Notch signaling: Cell fate control and s ignal integration in development. Science 1999; 284:770776 3 Miele L, Osborne B. Arbiter of differentiation and death: Notch signaling meets apoptosis. Journal of Cellular Physiology 1999; 181:393409. 4 Milner LA, Bigas A. Notch as a mediator of cell fate determination in hematopoiesis: Evidence and speculation. Blood 1999; 93:24312448. 5 Weinmaster G. Notch signal transduction: A real Rip and more. Current Opinion in Genetics & Development 2000; 10:363369. 6 Blaumueller CM, Qi HL, Zagouras P, ArtavanisTsak onas S. Intracellular cleavage of notch leads to a heterodimeric receptor on the plasma membrane. Cell 1997; 90:281291. 7 Schroeter EH, Kisslinger JA, Kopan R. Notch 1 signalling requires ligand induced proteolytic release of intracellular domain. Nature 1 998; 393:382386. 8 Niranjan T, Bielesz B, Gruenwald A, Ponda MP, Kopp JB, Thomas DB, Susztak K. The Notch pathway in podocytes plays a role in the development of glomerular disease. Nature Medicine 2008; 14:290298. 9 van Es JH, van Gijn ME, Riccio O, van den Born M, Vooijs M, Begthel H, Cozijnsen M, Robine S, Winton DJ, Radtke F, Clevers H. Notch/gamma secretase inhibition turns proliferative cells in intestinal crypts and adenomas into goblet cells. Nature 2005; 435:959963. 10. Milano J, McKay J, Dagenais C, Foster Brown L, Pognan F, Gadient R, Jacobs RT, Zacco A, Greenberg B, Ciaccio PJ. Modulation of notch processing by gamma -secretase inhibitors causes intestinal goblet cell metaplasia and induction of genes known to specify gut secretory lineage different iation. Toxicological Sciences 2004; 82:341358. 11. Baldi A, De Falco M, De Luca L, Cottone G, Paggi MG, Nickoloff BJ, Miele L, De Luca A. Characterization of tissue specific expression of Notch 1 in human tissues. Biology of the Cell 2004; 96:303311. 12. Faus to N, Campbell JS. The role of hepatocytes and oval cells in liver regeneration and repopulation. Mechanisms of Development 2003; 120:117130. 13. Oh SH, Hatch HM, Petersen BE. Hepatic oval 'stem' cell in liver regeneration. Seminars in Cell & Developmental B iology 2002; 13:405409.
PAGE 104
104 14. Newsome PN, Hussain MA, Theise ND. Hepatic oval cells: Helping redefine a paradigm in stem cell biology. Current Topics in Developmental Biology, 2004; 61:110. 15. Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, B oggs SS, Greenberger JS, Goff JP. Bone marrow as a potential source of hepatic oval cells. Science 1999; 284:11681170. 16. Sicklick JK, Li YX, Melhem A, Schmelzer E, Zdanowicz M, Huang JW, Caballero M, Fair JH, Ludlow JW, McClelland RE, Reid LM, Diehl AM. He dgehog signaling maintains resident hepatic progenitors throughout life. American Journal of Physiology Gastrointestinal and Liver Physiology 2006; 290:G859G870. 17. Faris RA, Monfils BA, Dunsford HA, Hixson DC. Antigenic relationship between oval cells and a subpopulation of hepatic foci, nodules and carcinomas induced by the resistant hepatocyte model system. Cancer Research 1991; 51:13081317. 18. Desmet VJ. The Liver: Biology and Pathobiology. Arias IM & Boyer JJ (eds), pp1 25, Raven Press, New York, 2001. 19. Crawford JM. Robbins and Cotran: Pathologic Basis of Disease. Kumar V, Abbas A, & Fausto N (eds), pp877938, Elsevier Saunders, Philadelphia PA, 2005. 20. Cunningham CC, Van Horn CG. Energy availability and alcohol related liver pathology. Alcohol Research & Health 2003; 27:291299. 21. Ross MH, Kaye GI, and Paulina W. Histology: A text and atlas. Lippincott Williams and Wilkins, Philadelphia PA, 2003. 22. Steer CJ. Liver Regeneration. Faseb Journal 1995; 9:13961400. 23. Saxena R, Thiese ND, and Crawford JM. Microana tomy of the human liver -exploring the hidden interfaces. Hepatology 1999; 30: 13391346. 24. Rabes HM, Wirsching R, Tuczek HV, Iseler G. Analysis of cell cycle compartments of hepatocytes after partial hepatectomy. Cell and Tissue Kinetics 1976; 9:517-532. 25. Bucher NLR. REGENERATION OF MAMMALIAN LIVER. International Review of Cytology a Survey of Cell Biology 1963;15:245300. 26. Michalopoulos GK, DeFrances MC. Science 1997; 277:14231423. 27. Edwards MJ, Keller BJ, Kauffman FC, Thurman RG. The involvement of Kupffer cells in carbon tetrachloride toxicity. Toxicology and Applied Pharmacology 1993; 119:275 279.
PAGE 105
105 28. Lombardi B, Ugazio G. Serum lipoproteins in rats with carbon tetrachloride induced fatty liver. Journal of Lipid Research 1965; 6:498502. 29. Reid WD. Mechanisms of allyl alcohol induced hepatic necrosis. Experientia 1972; 28:10581063. 30. Crosby HA, Nijjar SS, de Goyet JD, Kelly DA, Strain AJ. Progenitor cells of the biliary epithelial cell lineage. Seminars in Cell & Developmental Biology 2002; 13:397403. 31. Peters en BE, Goff JP, Greenberger JS, Michalopoulos GK. Hepatic oval cells express the hematopoietic stem cell marker Thy 1 in the rat. Hepatology 1998; 27:433445. 32. Paku S, Schnur J, Nagy P, Thorgeirsson SS. Origin and structural evolution of the early proliferating oval cells in rat liver. American Journal of Pathology 2001; 158:13131323. 33. Theise ND, Saxena R, Portmann BC, Thung SN, Yee H, Chiriboga L, Kumar A, Crawford JM. The canals of Hering and hepatic stem cells in humans. Hepatology 1999; 30:14251433. 34. Lowes KN, Croager EJ, Olynyk JK, Abraham LJ, Yeoh GCT. Oval cell -mediated liver regeneration: Role of cytokines and growth factors. Journal of Gastroenterology and Hepatology 2003; 18:412. 35. Petersen BE. Hepatic stem cells: C oming full circle. Blood Cell s Mol Dis 2001; 27:590600. 36. Sell S. Heterogeneity and plasticity of hepatocyte lineage cells. Hepatology 2001; 33:738750. 37. Shafritz DA, Dabeva MD. Liver stem cells and model systems for liver repopulation. Journal of Hepatology 2002; 36:552564. 38. Fausto N. Protooncogenes and growth factors associated with normal and abnormal liver growth. Dig Dis Sci 1991; 36:653658. 39. Nagy P, Bisgaard HC, Santoni -Rugiu E, Thorgeirsson SS. In vivo infusion of growth factors enhances the mitogenic response of rat hepatic d uctal (oval) cells after administration of 2 acetylaminofluorene. Hepatology 1996; 23:7179. 40. Hollander AP. Maturation of tissue -engineered cartilage implanted in injured and osteoarthritic human knees. Tissue Eng 2006; 12: 17871798. 41. Kuo CK, Li WJ, Mauck RL, and Tuan RS. Cartilage tissue engineering: I ts potential and uses. Curr Opin Rheumatol 2006; 18:6473.
PAGE 106
106 42. Cebotari S. Clinical application of tissue engineered human heart valves using autologous progenitor cells. Circulation 2006; 114: I132I137. 43. Atal a A, Bauer SB, Soker S, Yoo JJ, and Retik AB. Tissue -engineered autologous bladders for patients needing cystoplasty. Lancet 2006; 367:12411246. 44. Shafritz DA, Raimondo G, Burk RD, Lieberman HM, Dusheiko GM, Kew MC. Molecular biology of hepatocellular carc inoma. Journal of Medical Virology 1987; 21:A110-A110. 45. Wu PC, Lai VCH, Fang JWS, Gerber MA, Lai CL, Lau JYN. Hepatocellular carcinoma expressing both hepatocellular and biliary markers also expresses cytokeratin 14, a marker of bipotential progenitor cell s. Journal of Hepatology 1999; 31:965966. 46. Mishra L, Banker T, Murray J, Byers S, Thenappan A, He AR, Shetty K, Johnson L, Reddy EP. Liver Stem Cells and Hepatocellular Carcinoma. Hepatology 2009; 49:318329. 47. Artavanistsakonas S, Muskavitch MAT, Yedvobni ck B. Molecular cloning of Notch, a locus affecting neurogenesis in drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America Biological Sciences 1983; 80:19771981. 48. Artavanistsakonas S, Grimwade BG, Harrison RG, Markopoulou K, Muskavitch MAT, Schlesingerbryant R, Wharton K, Yedvobnick B. The Notch locus of drosophila melanogaster a molecular analysis. Developmental Genetics 1984; 4:233254. 49. Aster JC, Robertson ES, Hasserjian RP, Turner JR, Kieff E, Sklar J Oncogenic forms of NOTCH1 lacking either the primary binding site for RBP J kappa or nuclear localization sequences retain the ability to associate with RBP J kappa and activate transcription. Journal of Biological Chemistry 1997; 272:1133611343. 50. Forti ni ME, Rebay I, Caron LA, Artavanistsakonas S. An activated Notch receptor blocks cell fate commitment in the developing drosophila eye. Nature 1993; 365:555557. 51. Fryer CJ, Lamar E, Turbachova I, Kintner C and Jones KA. Mastermind mediates chromatin -speci fic transcription and turnover of the Notch enhancer complex. Genes & Development 2002; 16:13971411. 52. Hansen CH, Jauho El, Santoni -Rugiu E, Holmskov U, Teisner B, Tygstrup N and Bisgaard HC. Transit amplifying ductular (oval) cells and their hepatic proge ny are characterized by a novel and distinctive expression of delta like protein/preadipocyte factor 1/fetal antigen 1. Am J Pathol 2004; 164:13471359. 53. Kohler C, Bell AW, Bowen WC, Monga SP, Fleig W, Michalopoulos GK. Expression of Notch 1 and its ligand Jagged 1 in rat liver during liver regeneration. Hepatology 2004; 39:10561065.
PAGE 107
107 54. Nijjar SS, Crosby HA, Wallace L, Hubscher SG, Strain AJ. Notch receptor expression in adult human liver: A possible role in bile duct formation and hepatic neovascularization Hepatology 2001; 34:11841192. 55. Nijjar SS, Wallace L, Crosby HA, Hubscher SG, Strain AJ. Altered notch ligand expression in human liver disease Further evidence for a role of the notch signaling pathway in hepatic neovascularization and biliary ductula r defects. American Journal of Pathology 2002; 160:16951703. 56. Jang MS, Zlobin A, Kast WM, Miele L. Notch signaling as a target in multimodality cancer therapy. Curr Opin Mol Ther 2000; 2:5565. 57. Garces C, RuizHidalgo MJ, deMora JF, Park C, Miele L, Goldst ein J, Bonvini E, Porras A, Laborda J. Notch 1 controls the expression of fatty acid activated transcription factors and is required for adipogenesis. Journal of Biological Chemistry 1997; 272:2972929734. 58. Shelly LL, Fuchs C, Miele L. Notch 1 inhibits apo ptosis in murine erythroleukemia cells and is necessary for differentiation induced by hybrid polar compounds. Journal of Cellular Biochemistry 1999; 73:164175. 59. Yasutomo K, Doyle C, Miele L, Germain RN. The duration of antigen receptor signaling determin es CD4(+) versus CD8(+) T -cell lineage fate. Nature 2000; 404:506510. 60. Rangarajan A, Talora C, Okuyama R, Nicolas M, Mammucari C, Oh H, Aster JC, Krishna S, Metzgers D, Chambon P, Miele L, Aguet M, Radtke F, Dotto GP. Notch signaling is a direct determina nt of keratinocyte growth arrest and entry into differentiation. Embo Journal 2001; 20:34273436. 61. Nickoloff BJ, Qin JZ, Chaturvedi V, Denning MF, Bonish B, Miele L. Jagged1 mediated activation of notch signaling induces complete maturation of human kerat inocytes through NF kappa B and PPAR gamma. Cell Death and Differentiation 2002; 9:842855. 62. Carlson ME, Silva HS, Conboy IM. Aging of signal transductnion pathways, and pathology. Experimental Cell Research 2008; 314:19511961. 63. Duncan AW, Rattis FM, DiMa scio LN, Congdon KL, Pazianos G, Zhao C, Yoon K, Cook JM, Willert K, Gaiano N, Reya T. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nature Immunology 2005; 6:314322. 64. Galceran J, Sustmann C, Hsu SC, Folberth S, Grosschedl R. LEF1 -mediated regulation of Delta -like1 links Wnt and Notch signaling in somitogenesis. Genes & Development 2004; 18:27182723 65. Nicolas M, Wolfer A, Raj K, Kummer JA, Mill P, van Noort M, Hui CC, Clevers H, Dotto GP, Radtke F. Notch1 functions as a tum or suppressor in mouse skin. Nature Genetics 2003; 33:416421.
PAGE 108
108 66. He X, Semenov M, Tamai K, Zeng X. LDL receptor related proteins 5 and 6 in Wnt/beta catenin signaling: Arrows point the way. Development 2004; 131:16631677. 67. Brack AS, Conboy IM, Conboy MJ, S hen J, Rando TA. A temporal switch from Notch to Wnt signaling in muscle stem cells is necessary for normal adult myogenesis. Cell Stem Cell 2008; 2:5059. 68. Chabriat H, Joutel A, Dichgans M, Tournier Lasserve E, Bousser MG. Lancet Neurology 2009; 8:643653. 69. Gridley T. Notch signaling and inherited disease syndromes. Human Molecular Genetics 2003; 12:R9R13. 70. Bulman MP, Kusumi K, Frayling TM, McKeown C, Garrett C, Lander ES, Krumlauf R, Hattersley AT, Ellard S, Turnpenny PD. Mutations in the human Delta hom ologue, DLL3, cause axial skeletal defects in spondylocostal dysostosis. Nature Genetics 2000; 24:438441. 71. Dunwoodie SL, Clements M, Sparrow DB, Sa X, Conlon RA, Beddington RSP. Axial skeletal defects caused by mutation in the spondylocostal dysplasia/pudgy gene Dll3 are associated with disruption of the segmentation clock within the presomitic mesoderm. Development 2002; 129:17951806. 72. Zhang N, Norton CR, Gridley T. Segmentation defects of Notch pathway mutants and absence of a synergistic phenotype in l unatic fringe/radical fringe double mutant mice. Genesis 2002; 33:2128. 73. Joutel A, Tournier -Lasserve E. Notch signaling pathway and human diseases. Seminars in Cell and Developmental Biology 1998; 9:619625. 74. Li LH, Krantz ID, Deng Y, Genin A, Banta AB, C ollins CC, Qi M, Trask BJ, Kuo WL, Cochran J, Costa T, Pierpont MEM, Rand EB, Piccoli DA, Hood L, Spinner NB. Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nature Genetics 1997; 16:243251. 75. Chen Y, Sharp ZD, Lee WH. HEC binds to the seventh regulatory subunit of the 26 S proteasome and modulates the proteolysis of mitotic cyclins. Journal of Biological Chemistry 1997; 272:2408124087. 76. Oswald F, Liptay S, Adler G, Schmid RM. NF kappa B2 is a putative target g ene of activated notch 1 via RBP J kappa. Molecular and Cellular Biology 1998; 18:20772088. 77. Singh B, Reddy PG, Goberdhan A, Walsh C, Dao S, Ngai I, Chou TC, O -charoenrat P, Levine AJ, Rao PH, Stoffel A. p53 regulates cell survival by inhibiting PIK3CA in squamous cell carcinomas. Genes & Development 2002; 16:984993.
PAGE 109
109 78. Yarden Y. Biology of HER2 and its importance in breast cancer. Oncology 2001; 61:113. 79. Lin A, Karin M. NF kappa B in cancer: A marked target. Seminars in Cancer Biology 2003;13:107114. 80. Bo cchetta M, Miele L, Pass HI, Carbone M. Notch 1 induction, a novel activity of SV40 required for growth of SV40 -transformed human mesothelial cells. Oncogene 2003; 22:8189. 81. Fitzgerald K, Harrington A, Leder P. Ras pathway signals are required for Notch -m ediated oncogenesis. Oncogene 2000; 19:41914198. 82. Girard L, Hanna Z, Beaulieu N, Hoemann CD, Simard C, Kozak CA, Jolicoeur P. Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTV(D)/myc transgenic mice suggests a collaboration of c -myc and Notch1 for oncogenesis. Genes & Development 1996; 10:19301944. 83. Radtke F, Raj K. The role of Notch in tumorigenesis: O ncogene or tumor suppressor? Nature Reviews Cancer 2003; 3:756767. 84. Weng AP, Nam Y, Wolfe MS, Pear WNS, Griffin JD, Blacklow SC, Ast er JC. Growth suppression of pre T acute lymphoblastic leukemia cells by inhibition of notch signaling. Molecular and Cellular Biology 2003; 23:655664. 85. Callahan R, Smith GH. MMTV -induced mammary tumorigenesis: G ene discovery, progression to malignancy an d cellular pathways. Oncogene 2000; 19:9921001. 86. Zagouras P, Stifani S, Blaumueller CM, Carcangiu ML, Artavanis Tsakonas S. Alterations in Notch signaling in neoplastic lesions of the human cervix. Proceedings of the National Academy of Sciences of the Un ited States of America 1995; 92:64146418. 87. Milner LA, Bigas A, Kopan R, Brashem Stein C, Bernstein ID, Martin DIK. Inhibition of granulocytic differentiation by mNotch1. Proceedings of the National Academy of Sciences of the United States of America 1996; 93:1301413019. 88. Lefort K, Dotto GP. Notch signaling in the integrated control of keratinocyte growth/differentiation and tumor suppression. 89. Talora C, Sagroi DC, Crum CP and Dotto GP. Specific down-modulation of Notch1 signaling in cervical cancer cells is required for sustained HPV -E6/E7 expression and late steps of malignant transformation. Genes & Development 2002; 16:22522263. 90. Topley GI, Okuyama R, Gonzales JG, Conti C, Dotto GP. p21(WAF1/Cip1) functions as a suppressor of malignant skin tumor forma tion and a determinant of keratinocyte stem -cell potential. Proceedings of the National Academy of Sciences of the United States of America 1999; 96:90899094.
PAGE 110
110 91. Weinberg WC, Fernandez -Salas E, Morgan DL, Shalizi A, Mirosh E, Stanulis E, Deng CX, Hennings H, Yuspa SH. Genetic deletion of p21(WAF1) enhances papilloma formation but not malignant conversion in experimental mouse skin carcinogenesis. Cancer Research 1999; 59:20502054. 92. Thelu J, Favier B, Rossio P, Dhouailly D. Epidermal cell differentiation is l inked to Notch signalling. Journal of Investigative Dermatology 2000; 115:518518. 93. Uyttendaele H, Marazzi G, Wu GY, Yan QY, Sassoon D, Kitajewski J. Notch4/int 3, a mammary proto -oncogene, is an endothelial cell -specific mammalian Notch gene. Development 1996; 122:22512259. 94. Croquelois A, Blindenbacher A, Terracciano L, Wang XY, Langer I, Radtke F, Heim MH. Inducible inactivation of Notch1 causes nodular regenerative hyperplasia in mice. Hepatology 2005; 41:487496. 95. Higgins GM, Anderson RM. Experimental pathology of the liver I Restoration of the liver of the white rat following partial surgical removal. Archives of Pathology 1931; 12:186202. 96. Rodriguez S, Sickles HM, DeLeonardis C, Alcaraz A, Gridley T, Lin DM. Notch2 is required for maintaining sustent acular cell function in the adult mouse main olfactory epithelium. Developmental Biology 2008; 314:4058. 97. Tanimizu N, Miyajima A. Notch signaling controls hepatoblast differentiation by altering the expression of liver -enriched transcription factors. Jour nal of Cell Science 2004; 117:31653174. 98. Zong YW, Panikkar A, Xu J, Antoniou A, Raynaud P, Lemaigre F, Stanger BZ. Notch signaling controls liver development by regulating biliary differentiation. Development 2009; 136:17271739. 99. Carlesso N, Aster JC, Sk lar J, Scadden DT. Notch1 induced delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics. Blood 1999; 93:838848. 100. Egan SE, St -Pierre B, Leow CC. Notch receptors, partners and regulators: From conserved domains to powerful functions. Protein Modules in Signal Transduction 1998; 228:273324. 101. Dainiak N. Surface membraneassociated regulation of cell assembly, differentiation and growth. Blood 1991; 78:264276. 102. Greenwald I, Rubin GM. Making a difference the role of cell -cell interactions in establishing separate identifies for equivalent cells. Cell 1992; 68:271281. 103. Fortini ME, Artavanis Tsakonas S. Notch neurogenesis is only part of the picture. Cell 1993; 75:12451247.
PAGE 111
111 104. Baliko F, Bright T, Poon R, C ohen B, Egan SE and Alman BA. Inhibition of notch signaling induces neural differentiation in Ewing Sarcoma. American Journal of Pathology 2007; 170:16861694. 105. Chang H. Notch signal transduction induces a novel profile of Kaposis Sarcoma associated herpe svirus gene expression. Journal of Microbiology 2006; 44:217225. 106. Wesley CS. Notch and wingless regulate expression of cuticle patterning genes. Molecular and Cellular Biology 1999; 19:57435748. 107. Axelrod JD, Matsuno K, Artavanis Tsakonas S and Perrimon N Interaction between wingless and notch signaling pathways is mediated by dishevelled. Science 1996; 271:18261832. 108. De Strooper B, Annaert W. Where Notch and Wnt signaling meet: The presenilin hub. Journal of Cell Biology 2001; 152:F17F19. 109. Duncan AW, Rattis FM, DiMascio LN, Congdon KL, Pazianos G, Zhao C, Yoon K, Cook JM, Willert K, Gaiano N, Reya T. Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nature Immunology 2005; 6:314322. 110. Kiaris H, Politi K, Grimm LM Szabolcs M, Fisher P, Efstratiadis A, Artavanis Tsakonas S. Modulation of notch signaling elicits signature tumors and inhibits hras induced oncogenesis in the mouse mammary epithelium. American Journal of Pathology 2004; 165:695705. 111. Efstratiadis A, Sz abolcs M and Klinakis A. Notch, myc and breast cancer. Cell Cycle 2007; 6:418429. 112. Alimirah F, Panchanathan R, Davis FJ, Chen J and Choubey D. Restoration of p53 expression in human cancer cell lines upregulates the expression of Notch1: Implications for cancer cell fate determination after genotoxic stress. Neoplasia 2007; 9:427 434. 113. Rangarajan A, Syal R, Selvarajah S, Chakrabarti O, Sarin A and Krishna S. Activated Notch1 signaling cooperates with papillomavirus oncogenes in transformation and generates resistance to apoptosis on matrix withdrawal through PKB/Akt. Virology 2001; 286:2330.
PAGE 112
112 BIOGRAPHICAL SKETCH Houda A. Darwiche was born in Merrillville, Indiana in 1982. She moved to Florida with her parents in 1985, where she has remained ever since Houda attended Winter Haven High School in Winter Haven Florida, where she was very active in the Drama department as well as a member of the National Junior Honor Society and Future Business Leaders of America. Houda graduated in the top ten of her cl ass in 2000, and was awarded a full scholarship to Florida Southern College (FSC) in Lakeland, Florida. While attending FSC she was an active member of several groups and honoraries including Omicron Delta Kappa, Phi Eta Sigma, Beta Beta Beta and Mu Alpha Theta. She also served as both president of the FSC Student Chapter of the American Chemical Society, as well as president of the chemistry honorary Gamma Sigma Epsilon for two years Under her leadership the student chapter of ACS was given awards at th e SouthEastern Regional Meeting of the American Chemical Society in 2003. In 2004, Houda graduated magna cum laude with a Bachlelor of Science in both b iology and c hemistry with a minor in m athematics. Houda was accepted to the Interdisciplinary Program in Biomedical Sciences at the College of Medicine in the University of Florida in 2004. During her graduate school work, Houda was active in student organizations on campus, most notably the College of Medicines Graduate Student Organization (GSO). Hou da also served as GSO treasurer for two years and was involved in organizing the monthly Biomedical Research Seminar hosted by the GSO. For her graduate work, Houda studied under Dr. Bryon E. Petersen in the department of Pathology, Immunology, and Labora tory Medicine. Her project concerned ascertaining the role of the Notch signaling pathway in stem cell based -liver regeneration. A portion of this research was presented in Snowmass, Colorado at the 2008 Federation of American Societies for Experimental Biology (FASEB) conference in liver biology.
PAGE 113
113 Upon completion of her dissertation requirements, Houda received her Ph.D from the University of Florida in the summer of 2009. She went on to accept a two -year post doctoral position in the laboratory of Dr. Chen Liu under the direction of Dr. David Nelson in the department of Medicine (Gastroenterology) at the University of Florida.
|