Characterization of Two Novel Marine Caliciviruses

Material Information

Characterization of Two Novel Marine Caliciviruses Molecular and Serological Approaches for Improved Diagnostics
Mcclenahan, Shasta
Place of Publication:
[Gainesville, Fla.]
University of Florida
Publication Date:
Physical Description:
1 online resource (220 p.)

Thesis/Dissertation Information

Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Veterinary Medical Sciences
Veterinary Medicine
Committee Chair:
Romero, Carlos H.
Committee Members:
McGuire, Peter M.
Mergia, Ayalew
Maruniak, James E.
Manire, Charles
Graduation Date:


Subjects / Keywords:
Capsid ( jstor )
Cultured cells ( jstor )
Lions ( jstor )
Marine mammals ( jstor )
Polymerase chain reaction ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
RNA ( jstor )
Seas ( jstor )
Vesivirus ( jstor )
Viruses ( jstor )
Veterinary Medicine -- Dissertations, Academic -- UF
caliciviridae, diagnostics, elisa, genomic, marine, novel, real, steller, vesivirus, virus
Atlantic Ocean ( local )
Electronic Thesis or Dissertation
born-digital ( sobekcm )
Veterinary Medical Sciences thesis, Ph.D.


The Caliciviridae is a diverse family of viruses with a wide host range including humans, cats, dogs, swine, marine mammals, amphibians, fish, and reptiles. The Vesivirus genus of this family is of particular interest due to the ability to infect both aquatic and terrestrial hosts, cause vesicular disease in livestock, and because of its zoonotic potential. The goals of this doctoral research were to isolate and characterize currently circulating vesiviruses in marine mammals and use these data to develop improved diagnostic assays for the molecular and serological detection of these viruses. We isolated and characterized two novel marine vesiviruses from Steller sea lions (Eumetopias jubatus) from Alaska. Through full genomic sequencing and phylogenetic analyses, we identified conserved and variable domains in the Vesivirus genomes and determined genetic relationships among the marine vesiviruses. We also partially characterized, through nucleotide sequencing, two other marine vesivirus serotypes that had previously not been analyzed. With the molecular data obtained from the genetic characterization, two novel diagnostic assays were developed for the marine vesiviruses. A real-time RT-PCR assay was developed as a rapid, sensitive, specific, and quantitative molecular assay for the detection of the marine vesiviruses. This assay specifically detected different serotypes of marine vesiviruses, and can distinguish them from other agents causing vesicular disease in marine mammals or livestock. We also developed a serological assay in the form of an enzyme linked immunosorbent assay (ELISA). The novel vesiviruses were used to produce virus-like particles (VLPs); the first demonstration of these structures for the marine vesiviruses. The VLPs are non-infectious proteins, which are virtually identical to the native virions and can be used as viral antigens. This ELISA was cross-reactive with many different marine vesiviruses, and detected antibodies to these viruses in serum from marine mammals. Thus far, these viruses have only been isolated from marine mammals in the Pacific Ocean. Through our collaboration with organizations within the Southeastern United States, we tested marine mammal samples from the Atlantic Ocean and Gulf of Mexico to potentially determine viral presence. We tested 223 samples and did not find any evidence of vesivirus activity in these waters. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis (Ph.D.)--University of Florida, 2008.
Adviser: Romero, Carlos H.
Electronic Access:
Statement of Responsibility:
by Shasta Mcclenahan.

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Mcclenahan, Shasta. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
LD1780 2008 ( lcc )


This item has the following downloads:

Full Text




2 2008 Shasta Dawn McClenahan


3 To my best friend and husband, Justin McClen ahan. He has supported me unconditionally over the past nine years to help me get to the pl ace I am today. He has followed me wherever I wanted to go for my education and now it is my turn to follow his lead.


4 ACKNOWLEDGMENTS I acknowledge the support from my mentor Dr Carlos Romero. Without his acceptance into this program, I would not be here today. His guidance and mentor ing over the past four years were extremely valuable during my doctorate degree, and I am forever indebted to him. I acknowledge my committee members, Dr. Ayalew Mergia, Dr. Peter McGuire, Dr. James Maruniak, and Dr. Charles Mani re. Their assistance and guida nce helped me tremendously during my research and prepar ation of this dissertation. I also acknowledge Dr. Kim Green from the Nati onal Institutes of Health, and all of her staff, especially Dr. Karin Bok and Dr. Slava Sos novtsev. They welcomed me into their lab with open arms, spent much of their valuable time with me, and taught me so much. Their experience with baculovirus expression was valuable, and he lped with a crucial pa rt of my research. I also thank Dr. Kathy Burek, with Alaska Veterinary Pathology Services, and Dr. Kimberlee Beckmen with the Alaska Department of Fish and Game. They made the collection of Steller sea lion samples possible, and help ed me tremendously th roughout this project. I thank my husband, and number one fan, Justin McClenahan. He has been there for me more than any other person to offer support. I al so thank my family including my parents, Don and Kathi Cooper, and my sisters Shiloh Cooper a nd Sarah Cooper. I also thank Rebecca Grant, my partner in crime for the last four years of th is program. She has been there to offer help and useful suggestions during difficult experiments, but mostly for just being a good friend. I also thank Heather Townsend. Her friendship and help navigating the University of Florida, the Veterinary School, and the Marine Mammal Program were very valuable. She especially made our immunology course more fun, and easier to get through, and she makes me laugh more than anyone else that I know.


5 I acknowledge the grants and funding that made this research possible. This research was funded by sub agreement No. 6402-181-L0-C between the University of Florida and the Center for Biological Defense, University of Sout h Florida, under contract No. DAAD13-01-C-0043 of the Office of Naval Research. I would also li ke to thank the Marine Mammal Health Program for funding my research program, and the Departme nt of Infectious Diseases and Pathology of the College of Veterinary Medici ne, University of Florida. This research would also not be possible if it were not for the many permits and agencies that allowed this research to be conducted. Ti ssues, lesions, and swabs from Steller sea lions were harvested under permit numbers 358-1564-03 and 782-1889 from the National Oceanic and Atmospheric administration, US Department of Co mmerce. The University of FloridaÂ’s Aquatic Animal Health permits from the National Ma rine Fisheries permit numbers 1054-1731-00 and 1054-1731-01. Institutional Animal Care and Use Committee (IUCAC) numbers for this research were D438, D805, E853, and E883. The stra nding networks in the Southeastern United States also made tissue samples available fo r research. Some of the organizations and individuals in this network in cluded Mote Marine Lab, Dr. Ruth Ewing and the National Marine Fisheries Service, Dr. Connie Chevis, Florida Fish and Wildlife Conservation Commission, Bob Bonde and the United States Geological Survey, a nd the University of Florida stranding response team, veterinarians, pathologists, and necropsy teams. I would also like to thank several individuals from the Pacific Coast for mari ne mammal samples including Dr. Pam Tuomi and Dr. Carol Stephens of the Alaska Sea Life Ce nter, Dr. Judy St. Leger of SeaWorld San Diego, and Dr. Tracey Goldstein of The Marine Mammal Center.


6 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ........10 LIST OF FIGURES................................................................................................................ .......12 LIST OF ABBREVIATIONS........................................................................................................14 ABSTRACT....................................................................................................................... ............17 CHAPTER 1 INTRODUCTION................................................................................................................. .19 Caliciviridae.................................................................................................................. ..........19 Phylogeny...................................................................................................................... ..19 Genomic Organization.....................................................................................................20 Capsid Structure..............................................................................................................2 1 Viral Replication.............................................................................................................2 2 Viral Members of the Caliciviridae ........................................................................................24 Norovirus Genus..............................................................................................................24 Sapovirus Genus..............................................................................................................26 Lagovirus Genus..............................................................................................................26 Vesivirus Genus...............................................................................................................27 Vesivirus History.............................................................................................................. ......28 Vesicular Exanthema of Swine.......................................................................................28 Marine Vesiviruses..........................................................................................................30 Marine Vesivirus Link to Vesi cular Exanthema of Swine..............................................31 Other Terrestrial Vesiviruses of an Ocean Origin...........................................................32 Caliciviridae Pathogenesis..................................................................................................... .35 Vesivirus Receptor..........................................................................................................37 Immune Response to Caliciviruses.................................................................................38 Epidemiology of Caliciviruses...............................................................................................39 Viral Transmission..........................................................................................................39 Viral Prevalence..............................................................................................................4 0 Control and Prevention of Calicivirus Infections............................................................42 Viral Evolution and Quasispecies...........................................................................................43 Steller Sea Lion Decline....................................................................................................... ..44 2 GENOMIC CHARACTERIZATION OF NOVEL MARINE VESIVIRUSES FROM STELLER SEA LIONS (Eumetopias jubatus ) FROM ALASKA.........................................51 Introduction................................................................................................................... ..........51 Materials and Methods.......................................................................................................... .53


7 Source of Viruses............................................................................................................53 Virus Isolation in Cell Culture........................................................................................53 Electron Microscopy.......................................................................................................54 Extraction of RNA from Cell Cultures............................................................................54 Reverse Transcription......................................................................................................55 Oligonucleotide Primers..................................................................................................55 Polymerase Chain Reaction.............................................................................................55 Capsid gene fragment...............................................................................................55 Amplification of the complete vesivi rus capsid: open reading frame two...............56 Open reading frame one amplification.....................................................................56 Open reading frame three amplification...................................................................57 Cloning........................................................................................................................ ....57 Sequencing..................................................................................................................... .58 Rapid Amplification of cDNA Ends...............................................................................58 5Â’ RACE...................................................................................................................59 3Â’ RACE...................................................................................................................59 Phylogenetic Analyses.....................................................................................................59 Serological Assays...........................................................................................................60 RNA Transfection: Infectivity Recovery Assay..............................................................61 Results........................................................................................................................ .............61 Virus Isolation................................................................................................................ .61 Genomic Sequencing and Phylogenetic Analyses..........................................................62 Rapid Amplification of cDNA Ends...............................................................................65 Serology....................................................................................................................... ....66 RNA Transfection: Infectivity Recovery Assay..............................................................66 Discussion..................................................................................................................... ..........67 3 AN IMPROVED DIAGNOSTIC A SSAY FOR MARINE VESIVIRUSE S: APPLICATION OF A REAL-TIME RT-PCR ASSAY........................................................88 Introduction................................................................................................................... ..........88 Materials and Methods.......................................................................................................... .91 Viruses and RNA.............................................................................................................91 Reverse Transcription Reaction......................................................................................91 Primer and Probe Design.................................................................................................92 Real-Time RT-PCR Reaction Conditions.......................................................................92 Optimization of Real-time Reaction................................................................................93 Specificity.................................................................................................................... ....94 Sensitivity Versus Infectivity..........................................................................................94 Standards for Real-Time RT-PCR Assays......................................................................95 Plasmid dilutions......................................................................................................95 RNA dilutions..........................................................................................................96 In vitro transcription assay.......................................................................................96


8 Results........................................................................................................................ .............98 Optimization of the Real-Time RT-PCR Assay..............................................................98 Specificity.................................................................................................................... ....98 Viral Infectivity, Sensitivity, and Standards....................................................................98 Discussion..................................................................................................................... ........100 4 EXPRESSION AND SELF-ASSEMBLY OF VIRUS-LIKE PARTICLES FROM TWO MARINE VESIVIRUSES AND THEIR USE IN A DIAGNOSTIC ENZYME LINKED IMMUNOSORBENT ASSAY.............................................................................................112 Introduction................................................................................................................... ........112 Materials and Methods.........................................................................................................1 16 Viruses........................................................................................................................ ...116 Baculovirus Expression.................................................................................................117 Protein Purification................................................................................................118 The SDS-PAGE and western blotting....................................................................119 Yeast Expression...........................................................................................................120 Construction of recombinant yeast.........................................................................120 Integration assay.....................................................................................................121 Large scale yeast production..................................................................................122 The SDS-PAGE protein analysis...........................................................................122 Immunoprecipitation..............................................................................................123 Western blotting.....................................................................................................123 Electron Microscopy.....................................................................................................124 Enzyme Linked Immunosorbent Assay.........................................................................124 Results........................................................................................................................ ...........126 Baculovirus Expression of Vesi virus Virus-Like Particles...........................................126 Yeast Expression of Vesivirus Virus-Like Particles.....................................................128 Enzyme Linked Immunosorbent Assay.........................................................................129 Discussion..................................................................................................................... ........130 5 CHARACTERIZATION OF TWO ATYPIC AL MARINE VESIVI RUS SEROTYPES...144 Introduction................................................................................................................... ........144 Materials and Methods.........................................................................................................1 45 Source of Viruses..........................................................................................................145 Polymerase Chain Reaction...........................................................................................145 Cloning, Sequencing, and Phylogenetic Analysis.........................................................146 Results........................................................................................................................ ...........147 Viruses, Polymerase Chain Reaction, and Sequencing.................................................147 Phylogenetic Analysis...................................................................................................149 Real-time polymerase chain reaction fragment......................................................149 Region A capsid fragment......................................................................................149 Discussion..................................................................................................................... ........150


9 6 MARINE VESIVIRUSES IN THE ATL ANTIC OCEAN: DO THEY EXIST?.................159 Introduction................................................................................................................... ........159 Materials and Methods.........................................................................................................1 60 Sample Collection.........................................................................................................160 Virus Isolation...............................................................................................................1 61 Extraction of Total RNA...............................................................................................161 Reverse Transcription Polymerase Chain Reaction......................................................162 Enzyme Linked Immunosorbent Assay.........................................................................163 Results........................................................................................................................ ...........164 Samples........................................................................................................................ ..164 Virus Isolation in Cell Culture......................................................................................164 Reverse Transcription Polymerase Chain Reaction......................................................165 Enzyme Linked Immunosorbent Assay.........................................................................165 Discussion..................................................................................................................... ........165 7 CONCLUSIONS.................................................................................................................. 180 APPENDIX ALL STELLER SEA LION SAMPLES TESTED FOR THIS DISSERTATION..................................................................................................................1 85 LIST OF REFERENCES............................................................................................................. 205 BIOGRAPHICAL SKETCH.......................................................................................................220


10 LIST OF TABLES Table page 1-1 Marine vesiviruses isolated from terrestrial and aquatic species.......................................46 1-2 Prevalence of antibodies to marine vesi viruses in aquatic an d terrestrial animal species........................................................................................................................ ........49 2-2 Oligonucleotide primers used for PCR reactions...............................................................74 2-3 Genomic organization of marine vesiviruses with complete genomic sequences available in the NCBI database, includ ing the two novel SSL isolates, V810 and V1415 described in this dissertation..................................................................................74 2-4 Nucleotide identities of the Steller sea lion vesiviruses compared to other members of the Vesivirus genus........................................................................................................75 2-6 Peptide similarities of the Steller sea li on vesiviruses compared to other members of the Vesivirus genus............................................................................................................77 2-7 Virus neutralization results............................................................................................... .78 3-1 Primers and probe designed for the real -time RT-PCR described in this section...........105 3-2 Real-time RT-PCR results for various viruses of the Caliciviridae family.....................105 3-3 Comparative sensitivity of diagnostic assays for marine vesiviruses..............................106 4-1 Primer sequences used for cloning and e xpression of the Steller sea lion vesiviruses V810 and V1415..............................................................................................................135 4-2 Antibody titers obtained by virus neutralization (VN) us ing infectious virus and enzyme linked immunosorbent assay (ELISA) using recombinant VLPs as antigen.....136 5-1 Primers used for PCR assays for SMSV-8 and SMSV-12. All primers target the capsid gene.................................................................................................................... ...154 5-2 Amino acid and nucleotide identities of predicted 176-bp fragments obtained after real-time PCR assays of several marine vesiviruses........................................................154 6-1 Primers used for the detection of calici viruses and the control beta-actin gene in marine mammal tissues....................................................................................................172 6-2 Tissues and samples collected from stra nded or captive animals from the Atlantic Ocean and tested for marine vesiviruses..........................................................................173


11 6-3 Serum and plasma samples collected from marine mammals from the Atlantic Ocean and Gulf of Mexico..........................................................................................................177 A-1 Steller sea lions ( Eumetopias jubatus ) sampled from Alaska..........................................186


12 LIST OF FIGURES Figure page 1-1 Genomic organization of the genus Vesivirus ...................................................................50 2-1 Cytopathic effects of vesiviruse s isolated from Steller sea lions.......................................80 2-2 Electron micrograph of a Vero cell cultu re infected with vesivirus isolate V810 originating from an oral swab of a juvenile Steller sea lion..............................................81 2-3 Plaque assay from Steller sea lion vesivirus isolate V810.................................................81 2-4 Agarose gel electrophoresis of 768-bp capsid gene fragments of caliciviruses isolated from Stelle r sea lions......................................................................................................... 83 2-5 Neighbor-joining phylogram of the nucleotid e sequences of the complete genome of members of the family Caliciviridae .................................................................................83 2-6 Unrooted neighbor-joini ng phylogram of the deduced amino acid sequences of complete ORF1 of members of the Caliciviridae family..................................................84 2-7 Unrooted neighbor-joining phylogram of the deduced am ino acid sequences of the full capsid gene of members of the family Caliciviridae ..................................................85 2-8 Unrooted neighbor-joining phylogram of the deduced am ino acid sequences of the complete minor capsid gene, VP2, of members of the Caliciviridae family.....................86 2-9 Gel electrophoresis afte r RNA transfection assay.............................................................87 3-1 Multiple alignment of marine vesivirus sequences..........................................................107 3-3 Optimization of the primer concentration........................................................................108 3-4 Optimization of the TaqMan probe concentration...........................................................109 3-5 Sensitivity of the conventional RT-PCR..........................................................................109 3-6 Quantitative analysis of the real -time RT-PCR assay with plasmid DNA......................110 3-7 Quantitative analysis of the real -time RT-PCR assay with viral RNA............................111 4-1 SDS-PAGE analysis of proteins from the baculovirus expression system......................139 4-2 Western blot analysis of proteins from the bacu lovirus expression system....................140 4-3 RT-PCR products from th e yeast expression system.......................................................141 4-4 Protein analysis of proteins expr essed in the yeast expression system............................141


13 4-5 Electron micrograph of vi rus-like particles (VLPs) e xpressed in the baculovirus expression system............................................................................................................14 2 4-6 Electron micrographs of proteins pr oduced in the yeast expression system...................143 5-1 RT-PCR analysis of SMSV-8 and SMSV -12 for the 768-bp fragment of the capsid gene........................................................................................................................... .......155 5-2 RT-PCR analysis of SMSV-8 and SM SV-12 with virus specific primers......................155 5-3 Neighbor-joining phylogram of the real -time RT-PCR product deduced amino acid sequences...................................................................................................................... ...156 5-4 Multiple alignment of the real time RT-PCR products of the marine vesiviruses including San Miguel sea lion virus (SMSV) serotypes..................................................157 5-5 Unrooted phylogenetic tree of the deduced amino acid sequences of the A region of the capsid gene of several members of the marine vesiviruses.......................................158


14 LIST OF ABBREVIATIONS Aa amino acid ABTS 2,2Â’-azino-bis 3-ethylbenz thiazoline-6-sulfonic acid Bos-1/BCV bovine calicivirus BSA bovine serum albumin CaCV canine calicivirus CCV cetacean calicivirus cDNA complementary DNA CPE cytopathic effects CSL California sea lion Ct cycle threshold value EBHSV European brown hare syndrome virus ELISA enzyme linked immunosorbent assay EM electron microscopy FBS fetal bovine serum FCV feline calicivirus FMD foot and mouth disease HRP horseradish peroxidase HuCV human calicivirus ICTV International Committee on the Taxonomy of Viruses IP immunoprecipitation JAM-1 junctional adhesion molecule LNA locked nucleic acids MCV mink calicivirus MNV murine norovirus


15 MOI multiplicity of infection Nt nucleotide NV Norwalk virus ORF open reading frame PCR polymerase chain reaction PCV/Pan-1 primate calicivirus PFU plaque forming unit PTA phosphotungstic acid PVDF polyvinylidene difluoride RACE rapid amplification of cDNA ends RaV rabbit vesivirus RCV reptile calicivirus RdRp RNA-dependant RNA polymerase RHDV rabbit hemorrhagic disease virus RT reverse transcription RT-PCR reverse transcription polymerase chain reaction rRT-PCR real-time reverse transc ription polymerase chain reaction SCV skunk calicivirus SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis SMSV San Miguel sea lion virus SSL Steller sea lion SV Sapporo virus TC tissue culture TBS tris-buffered saline


16 TBST tris-buffered sa line with 0.1% Tween-20 TCID50 tissue culture infectious dose fifty VESV vesicular exanthema of swine virus VLP virus-like particle VN virus neutralization VPg viral glycoprotein VP1 viral protein one: the mature capsid protein (ORF2) VP2 viral protein two: ORF3 protein WCV walrus calicivirus


17 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF TWO MARINE CALICIVIRUSES: MOLECULAR AND SEROLOGICAL APPROACHES FOR IMPROVED DIAGNOSTICS By Shasta Dawn McClenahan August 2008 Chair: Carlos H. Romero Major: Veterinary Medical Sciences The Caliciviridae is a diverse family of viruses w ith a wide host range including humans, cats, dogs, swine, marine mammals, amphibians, fish, and reptiles. The Vesivirus genus of this family is of particular interest due to the ability to infect both a quatic and terrestrial hosts, cause vesicular disease in livestock, a nd because of its zoonotic potentia l. The goals of this doctoral research were to isolate and characterize curren tly circulating vesiviruses in marine mammals and use these data to develop improved diagnos tic assays for the molecular and serological detection of these viruses. We isolated and characterized two novel ma rine vesiviruses from Steller sea lions ( Eumetopias jubatus ) from Alaska. Through full genomic sequencing and phylogenetic analyses, we identified conserve d and variable domains in the Vesivirus genomes and determined genetic relationships among the marine vesiviruse s. We also partially characterized, through nucleotide sequencing, two other marine vesiviru s serotypes that had previously not been analyzed. With the molecular data obtained from the genetic characterizati on, two novel diagnostic assays were developed for the marine vesiviruse s. A real-time RT-PCR assay was developed as


18 a rapid, sensitive, specific, and quantitative molecular assay for the detection of the marine vesiviruses. This assay specifically detected di fferent serotypes of mari ne vesiviruses, and can distinguish them from other agents causing vesicu lar disease in marine mammals or livestock. We also developed a serological assay in the form of an enzyme linked immunosorbent assay (ELISA). The novel vesiviruses were used to produce virus-like par ticles (VLPs); the first demonstration of these structures for the mari ne vesiviruses. The VLPs are non-infectious proteins, which are virtually identi cal to the native virions and can be used as viral antigens. This ELISA was cross-reactive w ith many different marine vesivi ruses, and detected antibodies to these viruses in seru m from marine mammals. Thus far, these viruses have only been isolated from marine mammals in the Pacific Ocean. Through our collaboration with organizations within the Southeastern United States, we tested marine mammal samples from the Atlantic Ocean and Gulf of Mexico to potentially determine viral presence. We tested 223 samples and did not find any evidence of vesivirus activity in these waters.


19 CHAPTER 1 INTRODUCTION Caliciviridae Members of the family Caliciviridae are single-stranded, positiv e sense, RNA viruses. The viral structure is an icosah edral shaped capsid, approximately 27-40 nm in diameter with no envelope. The Caliciviridae has four recognized genera; Norovirus Sapovirus Lagovirus and Vesivirus (Green et al. 2000; Green et al. 2001). Members of this family infect humans and animals and have zoonotic potential. The viru ses have large economic impact due to the detrimental effects on humans and livestock. Humans are impacted by noroviruses and sapoviruses, which are responsible for gastroenteri tis. The animal viruses have a large impact on cats, livestock (mainly swine), and marine mammal s. The focus of this dissertation will be on the Vesivirus genus, which predominantly impacts marine mammals, felids, and livestock. Phylogeny The Caliciviridae is divided into four genera: Norovirus Sapovirus Lagovirus and Vesivirus (Green et al. 2000; Green et al. 2001). These genera were designated based on phylogenetic analysis of several re gions of the viral genomes (Berke et al. 1997; Berke & Matson, 2000; Fauquet & Mayo, 2001). The individual viruses within these clades or genera are viral strains, some of which have been recognized as dist inct species (Green et al. 2000). A viral species is defined as “a cluster of viruses that constitu tes a major phylogenetic branch within a genus and is also distinguishable from other branches by one or more of the following biological properties: natural host range, natura l cell and tissue tropism, and antigenicity”(Van Regenmortel et al. 2000). The recognized species of the Caliciviridae family include feline calicivirus (FCV), vesicular exanthema of sw ine (VESV), rabbit hemorrhagic disease virus (RHDV), European brown hare syndrome virus (EBHSV), Norwalk virus (NV), and Sapporo


20 virus (SV). This analysis also supported the removal of hepatit is E virus from the Caliciviridae family. The Caliciviridae was once considered a genus of the Picornaviridae family. The removal of the caliciviruses was first suggested when subgenomic RNA was detected in calicivirus infected cells, unlike picornaviruses which onl y have full length genome RNAs present during replication (Ehresmann & Schaffer, 1977). Further evidence of calicivirus separation from the picornaviruses came from analysis of genomic organization. The picornaviruses encode their structural capsid genes at the 5Â’ end of the ge nome, and the non-structural genes at the 3Â’ end, while the caliciviruses encode the non-structural genes at the 5Â’ end, and encode a single structural capsid gene at the 3Â’ end of the ge nome. The caliciviruses were removed from the Picornaviridae and placed in their own family, the Caliciviridae by the Third Report of the ICTV (Matthews, 1979) Recently, novel viruses have been described that are divergent from th e currently described genera of the Caliciviridae family. These include a bovine viru s isolate with the suggested genus name Becovirus (Oliver et al. 2006). Another virus was isolated from rhesus monkeys, named Tulane virus, and a genus name was suggested as Recovirus (Farkas et al. 2008). Genomic Organization The genome of caliciviruses is typically 7500-800 0 nucleotides (nt) in length. The genome of members of the Caliciviridae has a viral protein, VPg, bound to the 5Â’ end of the genome and is polyadenylated at the 3Â’ e nd. The genomic RNA is organize d into two open reading frames (ORF) in the sapoviruses and lagoviruses, while the noroviruses and vesiviruses both contain three ORFs (Green et al. 2001). ORF1 for all of the caliciv iruses encodes the non-structural genes including the helicase, RNA dependant RNA polymerase, and protease, and the viral protein (VPg), which is a structur al protein that is attached to the 5Â’ end of the viral genome.


21 This ORF is fairly conserved among all members of the Caliciviridae The second ORF encodes the structural capsid gene, designated VP1, and is much more variable among the caliciviruses. The third ORF of the Norovirus and Vesivirus genera encodes a minor structural gene, VP2, which is packaged into the mature virions. This gene is fairly conserved and postulated to be a nucleic acid binding protein, which may be involved in encapsidat ion of the viral genome. The most conserved regions of the Caliciviridae genome are found in the functional enzymesthe polymerase, helicase, and protease. Few mutations can be tolerated in these genes, as deleterious mutations would eliminate thei r function, and the virus would be unable to replicate. The most variable region among the caliciviruses is the capsid gene. Within the capsid gene lies a hypervariable region, designa ted region E (Neill, 1992). This E region includes the virus neutra lizing epitopes (Matsuura et al. 2001). Immune pressure from the host drives mutations in this region to allow new ge notypes to emerge, which may be able to evade the host immune system and persist. Capsid Structure The Caliciviridae name comes from the Latin word “ calici ” or calyx, which means cup or chalice. This refers to the c up-like depressions that are characteristic of the calicivirus capsid when viewed with electron microscopy. The first three-dimensional structures of caliciviruses were done with primate calicivirus (P an-1) by electron cryomicroscopy (Prasad et al. 1994a). This imaging revealed the 32 surface depressions and showed that the capsid is composed of 90 capsomeres in a T3 icosahedral symmetry. Each capsomere contains two copies of the capsid protein gene, giving a total of 180 copies in the virion. The capsid displays arch -like capsomers that form the protruding domain (P). These P domains surround the calyx, or shell domain (S) of the capsid. X-ray crystallography is an advanced imaging tec hnique that gives much higher resolution than electron cryom icroscopy. X-ray crystallograp hic structures have been


22 determined for Norwalk virus (NV) and San Mi guel sea lion virus (SMSV) serotype 4 (Chen et al. 2006; Prasad et al. 1999). The capsids of NV and SMSV were determined to have several similarities, but also several diffe rences that may account for the di fferences in host specificity of the viruses. Norwalk virus is a human cal icivirus, which causes gastroenteritis (Green et al. 2001), and the SMSV are viruses of marine origin capable of infecting a wide variety of hosts including marine mammals, swine, fish, reptiles, amphibians, and humans (Smith et al. 1998b). Viral Replication Much of the literature review ed here will focus on the noroviruses and FCV, as the majority of the replication work has been done with these viruses. The first step in viral replication is the binding to th e specific receptors on the host ce ll for entry. Only recently was the first calicivirus receptor discovered for FC V. The cellular receptor was identified as junctional adhesion molecule (JAM-1), an im munoglobulin like recepto r found in the tight junctions of cells (Makino et al. 2006). Another publica tion demonstrated that 2,6-linked sialic acid on an N-linked glycoprotein was also used as an additional receptor (Stuart & Brown, 2007) The FCV only infects feline cells in vitro and does not infect murine, human, or simian cell cultures. These FCV receptors could therefor e be very specific to the feline caliciviruses. The human caliciviruses and RHDV have been shown to bind to histo-blood group antigens (Hutson et al. 2003), but the specific receptors for other caliciviruses have not yet been determined. Once the virus is bound to the receptor, the vi rion must enter host cells via endocytosis (Kreutz & Seal, 1995) Previous work demonstrated that FCV enters th e host cell through clathrin mediated endocytosis of the virus particles (Stuart & Brown, 2006). The endosome containing the virus particles must be acidified in order to uncoat the capsid from the viral genome. Further experiments are necessary to determine how the viral RNA is released from the


23 endosome. The release could be by one of tw o methods; either forming a pore within the endosome, like picornaviruses or by disrupting the entire endosome membrane, similar to adenoviruses (Prchla et al. 1995) Once the viral genome enters the host cell tr anscription can take place immediately by host ribosomes because of the genomeÂ’s positive sense polarity. Thus, the genome serves directly as mRNA and can immediately initiate translation in the cytoplasm of the host cell. A 15 kDa viral protein, VPg, covalently attached to the 5Â’ end of the genome may serve as the cap to initiate translation (Burroughs & Brown, 1978; Dunham et al. 1998; Herbert et al. 1997; Schaffer et al. 1980; Sosnovtsev & Green, 1995). The Norwalk viru s VPg was shown to interact with a cap binding initiation factor eIF3 (Daughenbaugh et al. 2003) A vesivirus, FCV, and a norovirus, Lordsdale virus, both use VPg to bind a euka ryotic initiation fact or, eIF4E (Goodfellow et al. 2005). Loss of VPg has been shown to decrease th e translation of viral pr oteins and can cause a loss of infectivity for FCV (Burroughs & Brown, 1978; Dunham et al. 1998; Herbert et al. 1997) All replication occurs within the cytoplas m on the surface of membranous vesicles (Love & Sabine, 1975; Studdert & O'Shea, 1975). Active replication complexes have been isolated from infected cells for FCV (Green et al. 2002) The first proteins produced duri ng translation are the non-struct ural proteins from ORF1. This includes the helicase (NTPase), the VPg, the protease, and RNA-dependant RNA polymerase (RdRp). The full ORF1 is translated as an approx imate 200 kDa polyprotein and is self cleaved by its own protease. The protease and polymerase may stay joined and work as a duplex molecule (Wei et al. 2001). The polymerase now can func tion to replicate the genome. The positive sense genome is first transcribed into a negative sense copy. This negative strand serves as the template to make progeny viruses.


24 A subgenomic RNA of 2.5 Kb in leng th has been demonstrated (Herbert et al. 1996) This subgenomic RNA includes the stru ctural genes, ORF2 and ORF3 for Norovirus and Vesivirus genera, and ORF2 only for the Lagovirus and Sapovirus genome. The calicivirus RdRp has been proposed to recognize a subgenomic promoter on the negative strand in order to copy the subgenomic RNA, as it is not packaged in the virion (Green et al. 2002). The VPg is also covalently attached to the 5Â’ end of the sub-genomic RNA (Herbert et al. 1997) Thus, the major capsid protein (VP1) can be transcribed dir ectly from this sub-genomic RNA. The capsid protein is the most abundantly pr oduced protein during translation. The capsid is made as a precursor, 76 kDa in FCV, and then processed into the mature cap sid protein (62 kDa in FCV) by the viral protease (Carter, 1989; Carter et al. 1992b; Sosnovtsev et al. 1998). The mature virion has 180 copies of the mature capsid protein (Prasad et al. 1994b). Little is known about the packag ing of the calicivirus genome in to the mature capsids. The VPg has been shown to interact with the mature capsid protein, and therefore may play a role in encapsidation and packaging (Kaiser et al. 2006). All the structural and non-structural proteins of FCV, as well as abundant copy numbers of the mature capsid protein are present in replication complexes on membranous vesicles (Green et al. 2002). This suggests th at all replication and packaging of progeny virions occurs in these replication complexes. The release of viral particles has been show n to be mediated through virus induction of apoptosis for FCV (Al-Molawi et al. 2003; Sosnovtsev et al. 2003), and the lagoviruses (Alonso et al. 1998). Viral Members of the Caliciviridae Norovirus Genus The Norovirus genus includes mainly human enteric vi ruses, which cause the majority of acute gastroenteritis outbreaks in the world (Green et al. 2001). These enteric caliciviruses have


25 also been reported in sw ine, cattle, and mice (Liu et al. 1999; Sugieda et al. 1998; Wobus et al. 2006). The Noroviruses are divided into two genogroups based on sequence homology. These groups are the Norwalk virus genogroup a nd the Snow Mountain agent genogroup (Wang et al. 1994). Caliciviruses cause acute gastroenteritis with vomiting and diarrhea within 24-48 h following infection that lasts up to 72 h. Calicivir uses are spread by direct contact with infected individuals, contaminated food or water, fom ites such as counter surfaces, door handles, water faucets, food utensils, and through aerosol dropl ets from vomit. The explosive vomiting and diarrhea cause viral particle s to be spread in aerosol droplets. Caliciviruses are very resistant in the environment; they can survive temperatur es between 0C and 60C, and can persist on surfaces for long periods of time (CDC, 2006). Human caliciviruses (HuCV), of the Norovirus and Sapovirus genera, do not replicate in cell culture, while many of the animal caliciviruses do replicate well in cu lture systems, and the reason for this discrepancy has not been dete rmined. One difference between HuCVs and the vesiviruses that could account fo r these differences are the viral receptors used. The functional receptor for HuCV has not yet been identified, but the susceptibility to HuCVs have been shown to be associated with HBO histo-blood group antigens and ABH antigens present on intestinal villi (Hutson et al. 2002). Some advancements in the growth of norovi ruses and sapoviruses have been made. The porcine enteric calicivirus (PEC) was grown in porcine kidney cells by the addition of bile acids. The bile acids were shown to increase cAMP in the cells, which caused down regulation of key elements of innate immunity including interfer on-mediated signal transducer and transcription factor 1 (Chang et al. 2004). A similar study found that ST AT-1 deficient mice, cell cultures, and macrophages were more susceptible to murine Norovirus (MNV) infection than non-


26 deficient mice (Wobus et al. 2006). STAT-1 is an important mediator in the production of interferons in response to viral infection. This indicates that interferon production in response to a calicivirus infection may also be an important part of th e hostÂ’s immune response to an infection. This may provide clues for another t echnique for the culture of HuCVs. Developing STAT deficient cell cultures may also help gr ow the HuCVs in cell cu lture. While the HuCVs resist in vitro propagation, a recent publication describe s the replication of Norwalk virus from cDNA through a reverse genetics system using the T7 polymerase (Asanaka et al. 2005). This system allows for viral RNA to be synthesized in cell culture systems, a nd although it is not true viral replication, at leas t it produces infectious virus that can be used for experimentation, and may help develop a cell culture system for HuCVs. Sapovirus Genus The Sapovirus genus includes many human enteric vi ruses that cause gastroenteritis (Green et al. 2001). This group also includes several vi ruses known to infect animals, including swine (Saif et al. 1980). The virus was first isolated dur ing an outbreak of gastroenteritis in infants in Sapporo, Japan in 1977 (Chiba, 1979), thus the genus name. Lagovirus Genus The genus Lagovirus includes two viruses that infect rabbits and hares ( Lagomorpha ). These viruses include RHDV (Ohlinger et al. 1990) and EHBSV (Ohlinger & Thiel, 1991). These viruses are very detrimental to the la gomorph hosts, as the virus can cause up to 95% mortality within 48 h (Ohlinger et al. 1990). The geographic distri bution of these viruses is mainly in Europe, although recent reports of the viruses have appeared within the United States (McIntosh et al. 2007).


27 Vesivirus Genus The viral members of the Vesivirus genus are very diverse, ha ve a wide host range, and cause a diverse set of clinical signs. Disease caused by vesivi ruses, as the name implies, typically involves vesicles on the skin and mucosa of infected animals. These viruses have also been shown to cause respiratory disease, di arrhea, reproductive problem s including abortion and runting, encephalitis, myocarditis, and hemorrhagic disease (Smith et al. 1998b). The currently identified hosts of vesiviruses include swine (Traum, 1936), marine mammals (Smith et al. 1973), fish (Smith et al. 1980a), skunks (Seal et al. 1995b), cats (Fastier, 1957), dogs (Mochizuki et al. 1993; Schaffer et al. 1985), primates (Smith et al. 1985a; Smith et al. 1985b; Smith et al. 1983c), rabbits (Martin-Alonso et al. 2005), cows (Smith et al. 1983a), mink (Evermann et al. 1983; Guo et al. 2001; Long et al. 1980; Wilder & Dardiri, 1978), reptiles, amphibians (Smith et al. 1986), and humans (Al-Molawi et al. 2003; Smith et al. 1998a; Smith et al. 2006; Smith et al. 1978). The Vesivirus genus has only two officially r ecognized species, FCV and VESV, although, there are two additional proposed spec ies, canine calicivirus (CaCV) and mink calicivirus (MCV). The FCV is a widely studied virus that is a highly in fectious pathogen of cats, and occasionally dogs. The virus causes oral vesicles and respirator y disease in infected cats. Recently outbreaks of a new virulent stra in of FCV has emerged that causes virulent systemic disease (VSD; Radford et al. 2007). Infection of FCV is widespread and generally higher in large colonies of cats, generally 25-40%, compared to approximately 10% in single cat homes. Although genetic variabil ity exists in the hypervariable region of the FCV capsid, crossprotection is seen both in vitro and in vivo demonstrating one single serotype of FCV (Povey & Ingersoll, 1975; Povey, 1974). This is furt her demonstrated by FCV vaccines, which are


28 monovalent attenuated or inactivated viruses grow n in cell culture. Thes e vaccines protect cats from the majority of field strains (Radford et al. 2007). The VESV species incorporates more than 40 different serotypes of viruses, all with a common origin from the ocean (Smith & Boyt, 1 990). These will be the main focus for this dissertation and this literature re view from this point forward. Vesivirus History Vesicular Exanthema of Swine In April 1932, a vesicular disease outbreak o ccurred on a swine farm in Orange County, California where raw garbage was fed to swine (T raum, 1936). Due to the vesicular nature of the disease with low mortality and high morbidit y with lameness, foot and mouth disease (FMD) was suspected. In accordance with FMD eradica tion guidelines, all swine were quarantined, slaughtered, and buried. In 1933 on a second sw ine farm in San Diego County, California, where raw garbage was also fed to swine, a second outbreak of vesicu lar disease occurred. During this outbreak, lesion materi als were saved and used to e xperimentally infect several species of livestock. Horses, which are not susc eptible to FMD infection, were infected by the material from the swine vesicular lesions. The virus causing the vesicular disease in swine could not be FMD, and thus was determined to be a new virus. This virus was named vesicular exanthema of swine virus (Crawford, 1937). Th e United States Department of Agriculture suspended all eradication procedures, and anim als showing signs of disease were no longer destroyed, instead they were allo wed to heal and then shipped to slaughter houses. Embargoes were placed on shipping raw pork out of California. Several mo re outbreaks of VESV occurred in California until 1939 when it was estimated that one quarter of all the sw ine in the state were infected with VESV (Smith & Akers, 1976). Quar antine of infected animals did not provide any control of the virus spread. Regul ations were created that required garbage to be cooked before


29 being fed to swine. These regulations were ha rd to enforce and thus the raw consumption of offal continued, as did the VESV outbreaks. In 1952, the first case of VESV outside the stat e of California occurred in Wyoming. A passenger train originating in San Francisco was serving pork from Calif ornia to passengers. The train made a stop in Cheyenne, Wyoming, a nd the garbage, including pork scraps, were collected by local farmers and fed to their pigs. The swine were infected with VESV, and then the virus began to spread rapidly throughout the United States, eventually with 41 out of the 48 continental states reporting cases of VESV. The Bureau of Animal Industry declared a national state of emergency and an eradication program was started, again requir ing that garbage be cooked before fed to swine. In 1955, the only ca se occurring outside the United States occurred in Hrafnarfijord, Iceland where raw garbage from a nearby US military base was fed to local swine (Bankowski, 1965). The eradication procedur es worked this time, as the last reported outbreak of VESV occurred in New Jersey in 1956, and on October 22, 1959, VESV was officially declared an exotic virus to the United States. The estimated cost of VESV, and the eradication was $39,000,000 (Bar lough et al., 1986). The disease caused by VESV was characteri zed by high morbidity and low mortality. The disease started with a fever followed by forma tion of vesicles on the nasal and oral mucosa, feet, and teats of nursing sows. The virus wa s spread among the swine herds through both direct and indirect contact, and virus wa s shed in feces, urine, and secretions from the nasal cavity, oral cavity, and vesicles (Bankowski & Sawyer, 1994). Over the 27 years when VESV occurred in the United States, 17 distinct but closely related serotypes were identifie d by virus neutralization testing and cross-immunity animal inoculation (Tab le 1-1). The first four isolates that were


30 present in 1933 and 1934 have been lost due to er adication procedures wher e all material had to be destroyed. The source of the VESV outbreaks was neve r identified, but it was assumed that the feeding of raw garbage, which contained mari ne products and pork scraps, was the source of initial infections (Smith & Akers, 1976). Marine Vesiviruses In 1972, during a study of reproductive fa ilure of California sea lions (CSL; Zalophus californianus ) on San Miguel Island, California, a virus wa s isolated from rectal swabs from two sea lions that had recently aborted (Smith et al. 1973). The virus was determined to be a calicivirus and given the name Sa n Miguel sea lion virus (SMSV). Over the next several decades, additional vesi viruses were isolated from many different species of marine mammals within the Pacific Oc ean (Table 1-1). The viruses were identified by isolation in cell culture, and diffe rent serotypes were designated based on virus neutralization assays. This assay used 100 tissue culture infect ious doses (TCID) that infected 50% of cell cultures (TCID50) with specific antiserum against the previously identified isolates. The newly isolated virus was considered a new serotype if 20 units of spec ific antibody failed to neutralize it (Smith & Boyt, 1990). The new viral seroty pes were given the name SMSV serotype 2, serotype 3, etc, and up to 17 different serotypes were identified (Table 1-1). Following the designation of seventeen SMSV serotypes, additional marine vesiviruses were named for the animal species from which the virus isolated. Walrus calicivirus (WCV) was isolated from feces collected from i ce pack in the Chukchi sea in 1977 (Smith et al. 1983b), and the full genome of this virus has been sequenced and characterized (Ganova-Raeva et al. 2004). Cetacean calicivirus (CCV) was recovered from a vesicle on a tattoo pox lesion on an Atlantic bottlenose dolphin ( Tursiops truncatus ) in San Diego, California (Smith et al. 1983d). This


31 virus was also recovered from a CSL in the same facility and from vesi cles on a second dolphin in a second facility several miles away. The marine caliciviruses thus far have only been isolated from marine mammals in the Pacific Ocean. There is one report of a mixed in fection of calicivirus with a poxvirus by electron microscopy from two grey seal pups ( Halichoerus grypus ) in Europe (Stack et al. 1993). The virus could not be isolated, and no sequence data were obtained to determine if the virus was of the SMSV group. Marine Vesivirus Link to Vesicular Exanthema of Swine The original source of the virus that cause d the VESV outbreaks was never determined during the years of the epizootic After the isolation of the marine caliciviruses in 1972, experimental studies indicated that these viruses were indistinguish able from the VESV isolates. These tests included pH stability, sensitivity to he at and ether, sedimentation coefficient, virus morphology, and animal infectivity (Smith et al. 1974). Swine that were experimentally infected with vesiviruses isol ated from marine mammals devel oped a disease identical to VES (Smith et al. 1974). Other experiments demonstrated that when infected seal meat was fed to swine, a severe vesicular disease identical to VES resulted within 2 days, and virus could be recovered from infected animals (Wilder & Dardir i, 1978). Serological studies revealed that antibodies to the VESV serotype s that were circulating in do mestic swine from 1930-1959 were present in marine mammals. It was widely ac cepted that the source of the VESV was from marine animal products, includi ng raw fish scraps and marine mammal meat, fed to the swine (Bankowski & Sawyer, 1994; Smith & Akers, 1976). Two serotypes, SMSV-6 and SMSV-7, were isolated from a fish species, the opaleye Girella nigricans (Smith et al. 1980b). This species is also susc eptible to experimental infection with SMSV-5 (Smith et al. 1981b). The opaleye fish inhabits the same areas as the sea lions,


32 and is a host of the sea lion lungworm ( Parafilaroides decorus ). It has been suggested that the SMSV could cycle through sea lions, the fish and the lungworm (Smith et al. 1980a). Swine were experimentally inoculated with the viru s isolated from fish and the infected swine developed a vesicular disease identical to VES. The virus then was transmitted directly from pig to pig, similar to the original VES outbreaks. The lungworm larvae were experimentally infected, fed to fish, and when these fish were fed to Northern fur seals, a vesicular disease developed, and the virus was isolated from the ve sicular lesions. This fish species has been postulated to be a potential reservoir, or carrier, for the marine vesiviruses (Smith et al. 1980b; Smith et al. 1981b). The question arises, how did these marine viruse s move into the terrestrial environment? Several theories have been suggested (Smith & Boyt, 1990). Marine mammal carcasses wash onto shore and are most likely eat en by carnivores, or shed viru s onto vegetation that is then eaten by herbivorous animals. Haul-out areas of marine mammals are another location where viral shedding occurs in the terrestrial environment. The viru ses are viable in seawater for at least 14 d (Smith et al. 1981b), and are thought to rise from the water into the air through bubbles that burst at the surface re leasing virus particles into the air. The capture of marine mammals for aquariums also may expose other anim als to these viruses. Fish, which may be a potential reservoir or ca rrier, could also be potential s ource of terrestrial movement, by anadromous fish, which swim upstream into fres hwater rivers and may bring viruses further inland. Other Terrestrial Vesiviru ses of an Ocean Origin Similar to VESV, other terrestrial animals have also contracted marine vesiviruses (Table 1-1). A vesivirus, Bos-1, was isolated from dairy calves exhibiting respiratory illness (Smith et al. 1983a). A vesivirus was also isolated fr om the feces of skunks showing no clinical


33 symptoms, and was named skunk calicivirus (SCV; Seal et al. 1995b). Caliciviruses of marine origin were also isolated from reptiles and amphibians at a zoo in 1978 (Smith et al. 1986). The virus, reptile calicivirus (RCV) was isol ated from an Aruba Island rattlesnake ( Crotalus unicolor ), a rock rattlesnake ( Crotalus lepidus ), Eyelash viper ( Bothrops schlegelii ), and BellÂ’s horned frog ( Ceratophrys orata ). The same RCV was also isolated from CSL and northern fur seals on San Miguel Island, and from a SSL in Or egon in 1987. A new vesivirus from European rabbits ( Oryctolagus cuniculus ) with diarrhea, named rabbit ve sivirus (RaV) has also been identified (Martin-Alonso et al. 2005). The full genome of RaV was sequenced and determined to be most closely related to the SMSV isolates A calicivirus was isolated from apparently healthy mink in 1977, named mink calicivirus (MCV). The mink were housed near animals that had died of hemorrhagic pneumonia, a nd some mink with diarrhea (Evermann et al. 1983; Long et al. 1980). Mink were also used as experimental feed for fur seals, and virus was transmitted through the food source (Sawyer et al. 1978). The MCV isolate showed sequence similarity to both the vesiviruses and the sapoviruses (Guo et al. 2001). This MCV could potentially represent a new species within the Vesivirus genus (Rhodes et al. 2007). A calicivirus was isolated from vesicles on the feet of a white tern ( Gygis alba rothschildi ) in Hawaii (Poet et al. 1996). This was the first report of a vesicular disease cau sed by a calicivirus in wild birds. The virus could not be grown in cell culture, and no sequencing was obtained to determine if this virus belonged to the Vesivirus genus. Experimental infections had previously shown that primates were susceptible to vesicular disease by vesiviruses SMSV-4, SMSV-5, and VESV-C52 (Smith et al. 1978). The first natural infection of a marine calicivirus in primates wa s primate calicivirus (Pan-1), isolated from a pygmy chimpanzee ( Pan paniscus ) with a persistent oral vesicl es over a period of six months


34 (Smith et al. 1983c). The viral genome was completely sequenced (Rinehart-Kim et al. 1999). The primate calicivirus has also been isolated from the lowland gorilla ( Gorilla gorilla ), silverleaf langur ( Presbytis cristata ), and from a spider monkey ( Ateles fusciceps ) at the San Diego Zoo between 1978 and 1980. It was also isolated from the brain of a douc langur ( Pygathrix nemaeus ) that developed fatal encephalitis (Smith et al. 1985a; Smith et al. 1985b). The marine vesiviruses have also been show n to cause zoonotic infections. Researchers working with various SMSV serotypes developed virus neutralizing antibodi es to those viruses (Smith et al. 1978). The first report of a human contra cting a vesiviral disease came from a laboratory scientist working with SMSVs and experimental infections of calves (Smith et al. 1998a). This individual develope d vesicular lesions on the hands and feet and general flu-like symptoms. A virus was isolated from the vesicle fluid and was shown to be SMSV-5, and this isolate was designated Hom-1. A second individual was a field bi ologist working with Steller sea lions ( Eumetopias jubatus ) that developed vesicular lesions on the face. A virus was isolated and was found to be different from any other desc ribed vesiviruses. This isolate was designated McAll (Smith et al. 1998a). Another report ex ists of a field biologist working with infected fur seals in Alaska who developed vesicles on hi s eyes and required medical evacuation (Smith et al. 1977a). More recently, it has been reported th at humans living along the Pacific coast of the United States may also develop vesivirus viremia (Smith et al. 2006). This study used serum collected from blood donation site s in the Pacific northwest collection region. Donors had specific antibodies against vesiviruses by an ELISA using pooled antigens (SMSV-5, and two other un-named SMSV types), with up to 47% containing vesivirus antibodies. The presence of vesiviruses in the human sera was also dete cted by RT-PCR and dot-blot hybridization. The potential of these marine vesiviruses to infect humans in the general popu lation makes them very


35 important viruses for further study, especially if the blood supply could be contaminated with vesiviruses. Caliciviridae Pathogenesis Vesiviruses cause cytopathic effects (CPE) in susceptible cell cultures within 18-60 h postinfection, and progeny virus appears within 3-4 h (Fastier, 1957). In vivo the caliciviruses cause varied pathogenesis in their wide range of hos ts. Marine caliciviruses do not typically cause mortality in marine mammals, although abortions have been impli cated to have been caused by these viruses (Smith & Boyt, 1990). Morbidity can be high in response to large vesicles on the extremities making movement painful, and vesicl es in the mouth, which would probably make feeding difficult. Captive pinnipe ds with oral vesicles refused food and learned behaviors (Van Bonn et al. 2000). The VESV is characterized by hi gh morbidity in swine, mainly due to painful vesicles on the feet, which prevent walki ng and standing. VESV also causes abortions of pregnant sows (Bankowski & Sawyer, 1994). Morbidit y due to respiratory disease in calves from bovine calicivirus has also been observed (Smith & Latham, 1978). The diseases caused by vesiviruses are as variable as th e host species. Classic presentati on of the marine vesiviruses are blistering or vesicle formation of the skin, pneumonia, abortion, encephalitis, myocarditis, hepatitis, diarrhea, and hemorrhage (Smith et al. 1998b). Feline calicivirus causes oral ve sicles and upper respiratory tract disease, and has also been shown to cause lameness due to lesions in the joints (Radford et al. 2007). Recently, new isolates of FCV that cause viru lent systemic disease (VSD) have emerged. These VSD strains have been associated with mortality (Radford et al. 2007). Canine calicivirus (CaCV) has caused high morbidity and some mortality due to diarrhea and severe dehydration (Schaffer et al. 1985). Mortality associated with hemorrhagic pneumonia and diarrhea has been associated with mink calicivirus (Evermann et al. 1983; Long et al. 1980). The initial VES outbreaks


36 were characterized by vesicular lesions of the s nout and feet, as well as abortions (Bankowski & Sawyer, 1994). The initial isolation of SMSV came from sea lions that had recently aborted and the virus was isolated from the mothers and fetuse s, demonstrating vertical transfer of virus (Smith et al. 1973). A recent report of vesi virus infections of humans demonstrated viremia and possibly hepatitis (Smith et al. 2006). Other laboratory work ers acquiring infections from animals developed vesicles on the hands, feet, and face and flu-like symptoms (Smith et al. 1998a; Smith et al. 1977a). Infected mink ha d hemorrhagic pneumonia (Guo et al. 2001). Calves infected with Bos-1 had respiratory disease (Smith et al. 1983a). Experimentally infected swine developed vesicles of the feet, mouth, and snout, and virus was isolated from vesicle fluids, blood, oral and nasal secreti ons, feces, urine, and brain tissue (Gelberg et al. 1982a; Gelberg & Lewis, 1982; Gelberg et al. 1982b). The human caliciviruses of the Norovirus and Sapovirus genera infect the gastrointestinal tract, specifically the epithelium. This infl ammation prevents the abso rption of nutrients and liquids and causes severe vomiti ng and diarrhea in infected indi viduals. Other clinical signs include fever, nausea, malaise, abdominal pai n, and often dehydration. While many individuals have clinical signs, some infected individuals are asymptomatic (Green et al. 2001). The nausea and vomiting associated with infection are cau sed by abnormal gastric motor function (Meeroff et al. 1980). Initial vo lunteer studies with Norw alk virus (NV) found that some individuals are asymptomatic after infection, and re-exposure di d not protect those indi viduals who experience clinical infections in the first challenge (Parrino et al. 1977). This was puzzling to many until the discovery that the susceptibil ity of individuals to calicivirus infection is partially determined by ABO histo-blood group antigens (Hutson et al. 2002). The A, B, and O antigens are carbohydrates on glycolipids and glycoprotei ns found on red blood cells, and mucosal


37 epithelium. Individuals expressi ng the O antigen are the most susceptible to infection, and those expressing the B antigen are the least susceptible. A similar pattern has also been seen with other gut pathogens including Vibrio cholera and Escherichia coli O157:H7 (Hutson et al. 2002). The lagoviruses cause a much more severe hemorrhagic disease in rabbits and hares (Moussa et al. 1992) with 95-100% mortality in 48 h s. The pathology of these viruses includes liver necrosis and disseminated va scular coagulation, or hemorrhage. The necrosis of the liver has actually been shown to be caused by apoptosis (Alonso et al. 1998). The induction of apoptosis during the late stages of infection allows the virus to be released from the host cell without stimulating the inflammatory and im mune systems (Teodoro & Branton, 1997). Many RNA viruses have been shown to cause apoptosis in order to release progeny viruses including feline calicivirus (Al-Molawi et al. 2003; Sosnovtsev et al. 2003; Teodoro & Branton, 1997). Vesivirus Receptor The receptor for FCV has been identified to be junctional adhesion molecule (JAM), in conjunction with sialic acid (Makino et al. 2006; Stuart & Brown, 2007). The exact receptors for SMSVs have not been identifie d, but are assumed to be similar or the same receptors as FCV. These JAM receptors are common in endothelial a nd epithelial tight junc tions in many different tissue types. This may explain the diverse ti ssue tropism, and disease manifestations of the vesiviruses. These viruses also enter the host through the oral rout e, but instead of targeting the intestinal tract, they become systemic and may infect multiple organs, evidence of the wide diversity of disease caused by the ve siviruses. Vesiviruses are also transported to the skin where secondary viral replication occurs, causing blis ters or vesicles on th e skin surface (Diaz & Giudice, 2000), a common patholog y with other vesicular diseas es such as foot and mouth disease (Davies, 2002).


38 Immune Response to Caliciviruses The immune response to the calic iviruses is not completely understood. Virus neutralizing antibodies are produced against the capsid protei n, and appear within three to five d post exposure (Gelberg et al. 1982a). The antibody titers remain high for at least 90 d (Smith & Latham, 1978). The length of time that animal s are immune to re-infection following exposure is unknown. Swine have been shown to be immune to a single serotype of VESV for at least 30 months (Bankowski, 1965), but immunity was not pr otective against another genetically related, but distinct serotype of VESV. Some swin e experimentally infected with seal meat contaminated with SMSVs developed high levels of neutralizing antibodies, while others failed to seroconvert (Gelberg et al. 1982a). Thus, the immunological pi cture of vesiviruses remains unclear. The innate immune system has also been s hown to be important for other caliciviruses infecting mice. STAT-1 deficient mice were found to be highly susceptible to murine norovirus. This held true in tissue culture, where STAT -1 deficient cell cultures and macrophages were more susceptible to norovirus infection (Wobus et al. 2006). STAT-1 is an important mediator in the production of interferons in response to viral infection. This i ndicates that interferon production in response to a vesivirus infection ma y also be an important part of the hostÂ’s immune response to an infection. The immune system response to vesiviruses se ems to be fairly competent, as the viruses seem to be prevalent in the marine environmen t, but have not been linked to large mortality events. However, immunocompromised individua ls may experience a different disease when exposed to vesiviruses. Marine pollution and othe r environmental factors ar e a constant threat to marine mammals, and could hamper their immune re sponse to infectious agents in general. The recent declines of Steller sea lions have led to speculation that environmental pollution, along


39 with other factors such as malnutrition and in creased predation have caused immunosuppression and could be involved in the decline of the species (Burek et al. 2005). Epidemiology of Caliciviruses Viral Transmission Caliciviruses are predominantly transmitted thr ough the fecal-oral route. The virus also can be transmitted via respiratory secretions, as in FCV infections (Radford et al. 2007) and the human caliciviruses through projectile vomiting (Green et al. 2001). Virus particles spread in the feces can be transferred via fomites. The mari ne vesiviruses have been shown to be stable in 15C for up to 14 d (Smith et al. 1981b), and both FCV and NV pa rticles are very stabile on various surfaces, and can be infective for at least 7 d (D'Souza et al. 2006). During the VES outbreaks, the initial introducti on of viruses seemed to be from infected fish and marine mammal products. Once the vi rus established in the swine host, viral transmission occurred from pig to pig through di rect contact and indirect contact through fomites such as feed and water. Virus was shed in f eces, urine, vesicular lesions, and nasal and oral secretions (Bankowski & Sawyer, 1994). Transmission of vesiviruses occurs through the fe cal-oral route, typically by direct contact, or indirect contact of contamin ated objects, food, or water. Th ere is some evidence of marine vesivirus spread from the aquatic environment to the terrestrial environment, suggesting that other routes of transmission must be possibl e. The proposed mechanisms include aerosols generated from ocean spray, excretion of viru ses on land from marine mammal carcasses rotting on the beach and marine mammal haul-out areas, and movement of aquatic species for zoos and aquaria (Smith & Boyt, 1990). The medium of transport most likel y plays a role in transmission of these viruses as well. The marine caliciviruses are present in the wate r and therefore could be easily spread to larger geographic areas directly in the water, and by aerosols generated from the


40 ocean blown onto land. The FCV, on the othe r hand, is only present in the terrestrial environment and is not as easily spread. Transm ission is mostly through direct contact between infected individuals. The presence of a carrier state is unknown. The Pan-1 virus has been shown to cause a persistent infection in chimpanzees (Smith et al. 1983c); some cats are pers istently infected with FCV (Radford et al. 2007). Some animals infected with FCV and vesicular exanthema of swine (VES) are asymptomatic carri ers of infection (Gelberg et al. 1982a; Radford et al. 2007) and most likely cause the spread of th e virus to susceptible animals. There is some suggestion that fish may serve as a carrier or reservoir fo r SMSVs, cycle them through the marine mammal population, and subsequently the terrestr ial and wild animal populations (Smith et al. 1980b; Smith et al. 1981b). Viral Prevalence The prevalence of caliciviruses in marine mammals has been determined using virus neutralization assays for many different serotypes (Table 1-2) The SMSVs were first isolated from CSL ( Zalophus californianus ) and seem to be most closely associated with this species. The virus serotypes SMSV 1-7, 9, 12, and 13, and CCV have all been isolated from CSL. The CSL have additionally tested positive for anti bodies to SMSV-8, 10, Bos-1, and VESV (Table 12). The SSL has also been associated with seve ral marine vesiviruses. The serotype SMSV-6 virus was isolated from SSL (Skilling et al. 1987), and exposure to SMSV-1, 2, 5 through 8, 10, 13, and Bos-1 has been demonstrated (Table 1-2). One SSL serum sample obtained in St. PaulÂ’s Island in 1961 was antibody positive for SMSV-2, and is probably the earliest documented exposure to a SMSV serotype in a marine mammal (Akers et al. 1974) Northern fur seals ( Callorhinus ursinus) have also been exposed to many diff erent marine vesiviruses. These include virus isolations of SMSV-1, 5, 8, 10, 11, and exposure of SMSV-2, and 6 (Smith &


41 Latham, 1978). Northern fur seals migrate each y ear from southern California up to the Pribliof Islands in Alaska. They are one likely source for movement of the viruses throughout the north Pacific Ocean. California gray whales ( Eschrichtius robustus ) have tested seropositive for SMSV-2, 5, and VESV (Akers et al. 1974; Smith & Latham, 1978). Antibodies to SMSV-5 and VESV were demonstrated in sperm whales ( Physetor catadon ), fin whales ( Balenoptera physalus ), and Sei whales (Balaeneptera borealis ) from the Pacific Ocean (Smith & Latham, 1978). The WCV has been isolated from Pacific walruses ( Odebenus rosmarus (Smith et al. 1983b). Northern elephant seals ( Mirounga angustirostris ) tested positive for antibodies to SMSV-2 (Akers et al. 1974). Although exposure to SMSV -1 and VESV has been shown in Hawaiian monk seals ( Monachus schauinslandi ), virus has not yet been recovered from this endangered species (Poet et al. 1993; Smith et al. 1998b). Several species of feral terrestrial mammals including sheep, goats, swine, donkeys, foxes, and domestic swine and cattle along the Pacific coast of California and on the Channel Islands have also tested positive for antibodies to ma ny of the marine caliciviruses. These included VESV serotypes, SMSV-1, 2, 4, 5, and Bos-1 (Akers et al. 1974; Prato et al. 1974; Smith et al. 1976; Smith & Latham, 1978). Gray foxes from sout hern California were shown to carry virus neutralizing antibodies to se veral SMSV serotypes (Prato et al. 1977). The serological surveys cited above have demons trated that marine caliciviruses have been circulating between the sea and land for at least 70 years. The viruses seem well adapted to moving back and forth between these two enviro nments. The viruses also seem to be well distributed along the Pacific coast of the United States and Canada and maybe as far south as Hawaii. Migrating marine mammals such as fur seals and gray whales may be responsible for the widespread dispersal of the cal icivirus serotypes, as it was estimated that an infected gray


42 whale could shed 106 virus particles per gram of feces, and up to 1013 virus particles per day (Smith et al. 1998b). Vesiviruses are also well adapted to severa l marine and terrestrial hosts. One single serotype, SMSV-5, has been isolated from 16 di fferent species, including humans, primates, sea lions, seals, cattle, whal es, donkeys, and foxes (Smith et al. 1998b). Control and Prevention of Calicivirus Infections The only vaccine available against a ny calicivirus is for FCV (Radford et al. 2007). There are several licensed commercial vaccines made fr om attenuated strains of FCV, but these are mainly for domestic cats. Ther e is currently no vaccine availa ble for the HuCVs, although many are in development (Ball et al. 1996). There is little that can be done to control the spread of th e marine caliciviruses. The viruses are stable in sea water for at least 14 days and very resistant in the environment. Other measures for the control of vesiviruses in non-do mestic animals do not curre ntly exist. Control in captive animals can be implemented through quar antine of infected animals, removal of fecal material, and thorough disinfection of instrument s and holding areas with bleach. FCV can be controlled through separation of in fected individuals, immediat e removal of fecal material, keeping cat colony sizes low, and most impor tantly through the use of vaccines (Radford et al. 2007). The main method to control the spread of the HuCVs is simple hand washing and safe food handling practices. Sick individu als should not be allowed to work in food production areas, and should avoid contact with la rge groups of people. One promising technology that may be used to control calicivirus infections is antisense targeting of viral replication. Antisense oligonucleotides have been developed that have shown promising results in stop ping viral infection (Smith et al. 2002; Stein et al. 2001).


43 Viral Evolution and Quasispecies RNA viruses, including the caliciviruses, use an RNA dependant RNA polymerase to replicate their genomes in infected host cells which, unlike DNA polymeras es, does not have 3Â’ to 5Â’ exonuclease activity, or proofreading capability. This means that the RNA polymerase cannot correct any mistakes that are incorporat ed into the progeny vi ruses (Ball, 2001). The RNA polymerase error rate is approximat ely 10,000 times higher than DNA polymerases (Domingo & Holland, 1997; Moya et al. 2000), and is estimated to make one mistake for every 103-105 nucleotides copied, or on average 1 in every 10,000 nucleotides. This forces the genomes of RNA viruses to be relatively small, typically between 5,000 and 10,000 nucleotides. The size of the genome is just below the error-th reshold that the virus ca n tolerate to prevent deleterious mutations from build ing up and hampering the replic ation of the genome (Ball, 2001). Thus, the population of progeny virus th at forms during viral replication does not represent one single popul ation. Instead, it is a heterogene ous population of viruses, each slightly different from the others. This populat ion is called a quasispecies, or molecular swarm (Eigen, 1993). This failure of the RNA polymerase to proof read nucleotide incorporation allows RNA viruses to evolve up to one million times fa ster than DNA viruses (Eigen, 1993; Domingo and Holland, 1997). The quasispecies swarm of sligh tly different viruses forms a population of many genetically different viruses. This variation allows the virus to respond to changing conditions, and makes them more fit as viruses. The high pl asticity allows the virus to respond to selection pressures, and makes RNA viruses very adap table to changing environmental conditions. Many of the changes incorporated into the genome of the new progeny virus will be deleterious, and the resultant virus will not su rvive, but advantageous changes will also be incorporated into some of the progeny viruses and may allow a particular virus to bind to a


44 slightly different receptor, giving that virus a new tissue tropism. The changes may also allow the new virus to infect a completely different host species. If changes are incorporated in to the virus neutralizing epitope s on the virionÂ’s surface, this may allow the virus to evade the host immune sy stem and provide the virus with an advantage over other viruses that have the same neutralizing epitopes that th e host recognizes. This mutant would be able to replicate, virtually unnotice d, within the host before the immune system could mount an attack, and could allow this new virus to emerge as the dominant genotype in the host or population. A mutation in this region could al so change the viral st ructure enough that the virus would no longer be recognized by the memory immune response, and therefore vaccination against this virus would not be effective. The quasispecies evolution of FC V has been ascertained (Radford et al. 1999). The rate of evolution was determined by sequence analysis of the hypervariable region of the capsid gene after 90 passages of FCV in cell culture, and in pe rsistently infected cats. It was found that the virus existed as a quasispecies in cell culture and in cats, and th at the viruses varied up to 7.3% from the original isolates. The rate of evolu tion was determined to be 0.10 to 10.7 substitutions per nucleotide per year. It was also determin ed that the virus neutralizing epitopes changed within persistently infected cats, but not in cell culture. These findings revealed that immune pressure from the host drives the selection of viruses with mutations in the virus neutralizing epitopes. Steller Sea Lion Decline The Steller sea lion (SSL; Eumetopias jubatus ) is the largest member of the family Otariidae The SSL range encompasses the northern Pacific Ocean along the west coast of the United States and Canada into Eastern Russia and Japan, with the majority of the population, greater than 70%, residing in Alaska (Kenyon & Rice, 1961).


45 The Alaskan population of SSL is divide d into two distinct subpopulations, both geographically and genetically at Cape Suckling, Alaska (Bickham et al. 1996), separating the eastern stock and the western stock. The SSL e xperienced huge population declines in the late 1970s and it was estimated that more than 70 % of the animals, especially in the western stock were lost (Braham et al. 1980; Calkins et al. 1997; Loughlin, 1998; Trites & Larkin, 1996). These declines led to the wester n stock of SSL to be listed as an endangered species, and the eastern stock of SSL as threat ened under the United States Endangered Species Act (Loughlin, 1998; Trites & Larkin, 1996) The cause of the decline is unknown, but a considerable amount of research and funding has has b een invested to determine the cause for this decline. The currently accepted hypothesis is that poor nutrition of the young a dults and pups is causing the deaths of these animals. The poor nutriti on, also known as the “junk food hypothesis”, is partially blamed on overfishing by commercial fisheries and cha nges in the Alaskan ecosystem (Trites & Donnelly, 2003). Alternate hypothesis are disease ag ents including viruses (Burek et al. 2005; Burek et al. 2003), killer whale predation, and anthropogenic impacts including entanglement, pollution, and il legal hunting (Loughlin, 1998). Due to the previous evidence of reproductive failures in pinnipeds due to caliciviruses, efforts to isolate and charact erize caliciviruses from SSL are ongoing. Vesivirus serotypes SMSV-6 and SMSV-14 were previously isolat ed from SSL on Rouge Reef, Oregon in 1985 (Skilling et al. 1987; Smith, 2000).


46Table 1-1. Marine vesiviruses is olated from terrestrial and aqua tic species. VESV= Vesicular ex anthema of swine virus, SMSV= San Miguel sea lion virus, CSL= Califor nia sea lion, SSL= Steller sea lion. Virus Year Animal Location Sample Reference VESV-34 1934 swine San Jose, CA (Bankowski & Sawyer, 1994; Smith & Akers, 1976) VESV101-43 1943 swine San Francisco, CA See VESV-34 VESV A48 1948 swine Fontana, CA See VESV-34 VESV B51 1951 swine Davis, CA See VESV-34 VESV C52 1952 swine San Francisco, CA See VESV-34 VESV D53 1953 swine Riverside, CA See VESV-34 VESV E54 1954 swine Warm Springs, CA See VESV-34 VESV F 55 1955 swine San Mateo, CA See VESV-34 VESV G55 1955 swine San Mateo, CA See VESV-34 VESV H54 1954 swine San Mateo, CA See VESV-34 VESV I55 1955 swine San Mateo, CA See VESV-34 VESV J56 1956 swine Secaucus, NJ See VESV-34 VESV K56 1956 swine Secaucus, NJ See VESV-34 SMSV-1 1972 CSL San Miguel Isla nd, CA Rectal swab (Smith et al. 1973) SMSV-1 1972 N. fur seal AK Nasal swab (Smith et al. 1974) SMSV-2 1972 CSL CA Throat and rectal (Smith et al. 1974) SMSV-3 1972 CSL CA Nasal swab (Smith et al. 1974) SMSV-4 1973 CSL CA Throat swab (Smith et al. 1977b) SMSV-4 1976 Swine CA Throat and rectal Smith et al. 1978 SMSV-5 1973 N. fur seal AK vesicle (Smith et al. 1977b) SMSV-5 1974 Mink AK Tissuesfeed (Sawyer et al. 1978) SMSV-5 1985 Human OR vesicles (Smith et al. 1998a) SMSV-6 1975 CSL CA Vesicle (Smith et al. 1979) SMSV-6 1976 Opaleye fish CA spleen (Smith et al. 1980b) SMSV-6 1977 N. Fur seal CA Throat swab (Smith et al. 1980b) SMSV-6 1985 SSL OR Rectal swab (Skilling et al. 1987)


47Table 1-1 Continued. Mink calicivirus (MCV) 1977 Mink Idaho Pharyngeal and rectal swabs (Evermann et al. 1983) Virus Year Animal Location Sample Reference SMSV-7 1976 N. elephant seal CA Throat and rectal swab (Smith et al. 1980b) SMSV-7 1976 Opaleye fish CA Viscera (Smith et al. 1980b) SMSV-8 1976 N. fur seal Alaska vesicle (Smith et al. 1981a) SMSV-9 1975 CSL CAThroat swab ( Smith et al. 1981a ) SMSV-9 Pacific bottlenose HI Throat swab (Smith, 2000) SMSV-10 1977 N. fur seal AK Vesicle (Smith et al. 1981a) SMSV-11 1977 N. fur seal CA Throat and rectal (Smith et al. 1981a) SMSV-12 1977 N. fur seal CA Throat and rectal (Smith et al. 1981a) SMSV-12 1977 CSL CA Throat and rectal (Smith et al. 1981a) SMSV-13 1984 CSL CA Vesicle (Berry et al. 1990; Smith, 2000) SMSV-14 1987 SSL OR (Berry et al. 1990; Smith, 2000 ) SMSV-14 1987 CSL CA (Berry et al. 1990; Smith, 2000 ) SMSV-15 1988 CSL CA Throat and rectal (Smith, 2000) SMSV-16 1988 CSL CA feces (Smith, 2000) SMSV-17 1991 CSL CA Nasal swab (Smith, 2000) SMSV-17 1992 Pacific mussel CA Intestines (Smith, 2000) Cetacean calicivirus (CCV) 1979 Atlantic bottlenose CA Lesion (Smith et al. 1983d) CCV 1979 CSL CA (Smith et al. 1983d) Walrus calicivirus (WCV) 1977 Walrus Chukchi Sea, AK Feces (Smith et al. 1983b) Rabbit vesivirus (RaV) 1995 European rabbit Oregon Feces (Martin-Alonso et al. 2005)


48Table 1-1. Continued. Bovine calicivirus (Bos-1) 1981 Cattle Oregon Throat and rectal swab (Smith et al. 1983a) Virus Year Animal Location Sample Reference Reptile Calicivirus (RCV) 1978 Aruba Island rattlesnake San Diego, CA Rectal swabs and tissues (Smith et al. 1986) RCV 1986 rock rattlesnake (Smith et al. 1986) RCV 1986 Eyelash viper (Smith et al. 1986) RCV 1986 BellÂ’s horned frog (Smith et al. 1986) RCV 1986 CSL (Smith, 2000) RCV 1986 N. fur seal (Smith, 2000) RCV 1987 SSL (Smith, 2000) Primate calicivirus (Pan-1) 1978 Pygmy chimpanzee San Diego, CA Lip lesion (Smith et al. 1983c) Pan-1 1978 Lowland gorilla San Diego, CA spleen (Smith et al. 1985b) Pan-1 1978 Spider monkey San Diego, CA Throat swab (Smith et al. 1985b) Pan-1 1979 Silverleaf langur Sa n Diego, CA Throat swab (Smith et al. 1985b) Pan-1 1979 Douc langur San Diego, CA Brain (Smith et al. 1985a)


49Table 1-2. Prevalence of antibodies to marine vesiviruses in aquati c and terrestrial animal species. Species Serotype Source(s) California sea lion SMSV-1, 2, 3, 4, 5, 6, 13, Bos-1 (Akers et al. 1974; Barlough et al. 1987b; Berry et al. 1990; Smith et al. 1979; Smith & Latham, 1978) Steller sea lion SMSV-1, 2, 5, 6, 7, 8, 10, 13, Bos-1 (Akers et al. 1974; Barlough et al. 1987a; Berry et al. 1990 ) Northern fur seal SMSV-1, 2, 5, 6 (Akers et al. 1974; Smith et al. 1979) Northern elephant seal SMSV-1, 2 (Akers et al. 1974) Gray whale SMSV-1, 2, 3, 5 (Akers et al. 1974) Pacific walrus WCV, SMSV-5, 8 (Barlough et al. 1986; Calle et al. 2002) Polar bear FCV (Tryland et al. 2005) Bowhead whale VESV-F55, 34B, J56, SMSV-8, 12 (O'Hara et al. 1998; Smith et al. 1987) Monk seal SMSV-1, VESV (Poet et al. 1996; Smith et al. 1998b) Wild fox SMSV-1, 2, 4, 5 (Prato et al. 1977) Sperm whale SMSV-5 and VESV (Smith & Latham, 1978) Sei whale SMSV-5 and VESV (Smith & Latham, 1978) Fin whale SMSV-5 and VESV (Smith & Latham, 1978) Feral pigs SMSV-1, 2, 5 (Akers et al. 1974; Smith & Latham, 1978) Feral sheep SMSV-2 (Prato et al. 1974; Smith & Latham, 1978); Humans Hom-1, Pool (SMSV-5, 13, 17) (Prato et al. 1974; Smith et al. 1998a; Smith et al. 2006)


50 Figure 1-1. Genomic orga nization of the genus Vesivirus Genome annotat ion is from San Miguel sea lion virus serotype 1 (SMSV1) from GenBank accession U15301. The genomes encode three open reading frames (ORF). The ORF1 encodes the helicase (NTPase), viral protein (VPg), which is c ovalently attached to the 5Â’ end of the genome, the protease (Pro), and the RNA dependant RNA polymerase (Pol). The ORF2 encodes the structural capsid protein, and has a leader capsid (LC) portion that is cleaved by the viral protease. The OR F3 encodes a structural protein of an unknown function. The 5Â’ and 3Â’ ends contain untranslated regions (UTR) of 19 and 180 nucleotides, respectively.


51 CHAPTER 2 GENOMIC CHARACTERIZATION OF NOVEL MARINE VESIVIRUSES FROM STELLER SEA LIONS (EUMETOPIAS JUBATUS ) FROM ALASKA Introduction Members of the Caliciviridae family of viruses are singl e-stranded positive sense RNA viruses whose linear genomes are about 7500-8000 nucle otides (nt) in length with a poly (A) tail at the 3Â’ end. The virions are non-en veloped and icosahedral in shape (Green et al. 2000). The Caliciviridae family contains viruses currently assigned to one of four genera: Norovirus Sapovirus Lagovirus and Vesivirus Marine caliciviruses presently classified within the genus Vesivirus, were first isolated from California sea lions ( Zalophus californianus ) in 1972 during a study of reproductive failure in pinnipeds (Smith et al. 1973) in San Miguel Island, California. Thus, the viruses were named San Miguel sea lion viruses (SMSV). Following these initial isolations, caliciviruses were is olated from several other species of marine mammals and a total of 16 different serotypes of SMSV have been hi therto identified (Smith & Boyt, 1990). Other marine vesiviruses include a walrus calicivirus (WCV) isolated from the feces of walrus (Ganova-Raeva et al. 2004; Smith et al. 1983b) and cetacean calicivirus (CCV) from an Atlantic bottlenose dolphin (Smith et al. 1983d). Although marine cal iciviruses were not recognized until 1972, caliciviruses of ocean orig in were present long before and infected terrestrial animals, especially domestic swine. A calicivirus of ocean origin was determined to be the causative agent of vesicular exanthema of swine (VES) outbreak s in the early 1930s (Schaffer & Soergel, 1973; Smith et al. 1973). The clinical signs of VES in domestic swine are clinically indistinguishable from those of foot-and-mouth diseas e and swine vesicular disease; both are exotic, highly infectious diseases of explosive dissemin ation whose causative agents are presently included the Office Inte rnational des Epizooties (OIE) A list of pathogens. The marine caliciviruses were probably introduced into sw ine by the feeding of uncooked garbage, which


52 included fish. The opaleye perch ( Girella nigricans ) has been shown to be a calicivirus carrier (Smith et al. 1980b). Thus, marine caliciviruses are cons idered restricted vi ruses due to their potential to produce exo tic vesicular disease in livestock and swine. Terrestrial isolates of marine caliciviruses have also been described in the bovine (Smith et al. 1983a), primates (Smith et al. 1985a; Smith et al. 1985b; Smith et al. 1983c), reptiles and amphibians (Smith et al. 1986), skunks (Seal et al. 1995b), and rabbits (Martin-Alonso et al. 2005). While more than 40 serotypes of calicivirus es of ocean origin have been recognized by serology, only five complete viral genomes have been fully sequenced; namely, SMSV-1 (GenBank accession number U15301), WCV (Ganova-Raeva et al. 2004); NC_004541), VESV serotype A48 (U76874), primate calicivirus-Pan-1(Rinehart-Kim et al. 1999); AF091736) and rabbit vesivirus (RaV; Martin-Alonso et al., 2005 ; AJ866991). There have been some attempts to characterize different sero types using partial sequences from the capsid gene (Neill et al. 1998), and from the helicase and polymerase gene s (Neill & Seal, 1995). However, a definitive molecular characterization would require sequences of full gene s or of the whole genome. Caliciviruses of Steller sea lions (SSL; Eumetopias jubatus) were first isolated in 1985 from animals from Rogue Reef, Oregon (Skilling et al. 1987). These viruses have been shown to cause vesicular lesions on the flippers, abor tion, and premature birt hs in pinnipeds (Smith et al. 1973) and approximately 20% of SSL sera obt ained as early as 1986 and between 1998 and 2000 had group-specific antibodies to marine caliciviruses (Burek et al. 2005). In the course of an investigation into the possible causes for th e decline of the wester n population of SSL in Alaska (Braham et al. 1980; Calkins et al. 1997; Loughlin, 1998; Trit es & Larkin, 1996), we have isolated several caliciviruses from sample s obtained from apparently healthy and diseased SSL.


53 Herein, we describe the isola tion and molecular and serological characterization of these SSL viral isolates that may represent the occurrence of two novel genotypes of marine vesiviruses in SSL from southeast Alaska. Th e complete genomes of representatives of both genotypes were fully sequenced and their gene co ntent and genome structure were determined. Materials and Methods Source of Viruses Oral and rectal swabs, vesi cle fluids, and serum samples were collected from SSL from several locations in Alaska between 2001 and 2005. Swabs and vesicle fluids were immediately placed in cryogenic tubes containing 2 ml of DulbeccoÂ’s modified EagleÂ’s medium (DMEM) supplemented with penicillin (200 U/ml), strept omycin (200 g/ml), amphotericin B (50 g/ml), gentamicin (100 g/ml) and 2 % fetal bovine serum (FBS). The samples were shipped on dry ice to the laboratory at the University of Florida fo r virus isolation. Tissues, lesions, and swabs from Steller sea lions were harvested under pe rmit numbers 358-1564-03 and 782-1889 from the National Oceanic and Atmospheric administration, US Department of Commerce. The research at the University of Florida was conducted unde r the National Marine Fisheries permit numbers 1054-1731-00 and 1054-1731-01, and the Institutional Animal Care and Use Committee (IUCAC) numbers D438, D805, E853, and E883. Virus Isolation in Cell Culture Cell cultures were propagated in DMEM s upplemented with penicillin (100 U/ml), streptomycin (100 g/ml), amphotericin B (25 g /ml), gentamicin (50 g/ml) and FBS (2%). Sample fluids were inoculated onto drai ned monolayers of Madin-Darby canine kidney (MDCK), African green monkey kidney (Vero) and or embryonic swine kidney (ESK) cell cultures grown in 35-mm tissue cult ure dishes and incubated at 37oC in an atmosphere of 5 % CO2. After 1 h, the inocula were removed and the cultures fed w ith 2 ml of DMEM containing


54 antibiotics as above and 0.5 % FBS. Cultures were evaluated daily for 7 d for the appearance of cytopathogenic effects (CPE) compatible with calicivirus replication. Positive samples were propagated as a second passage a nd, when CPE was extensive, total RNA was extracted from the cell monolayers and tested for caliciviruses by RT-PCR (Reid et al. 1999). Cultures that did not show CPE after primary inoculation were also su b-cultured after 7 d and discarded after a week if no CPE had developed. To determine if the SSL vesiviruses would form plaques, a plaque assay was performed for isolates V810 and V1415. Viruses that had b een grown for 24 h in Ve ro cell cultures were harvested and clarified to remove cellular debris. The supernatants were then diluted 10-fold in DMEM, and one ml of each viral dilution was th en absorbed onto conflu ent Vero cell culture monolayers in 6-well (60 mm) tissu e culture dishes. The inocula we re absorbed for 1 h at 37C, and then replaced with a 1% agarose overlay wi th DMEM supplemented with 5% FBS. The 6well plates were then incubate d at 37C for 2 d to allow plaques to form, and then fixed overnight with 10% neutral buffered formalin. Th e agarose overlays were gently removed with a stream of water, and the cells we re stained with crystal violet. Electron Microscopy Ultra-thin sections were prep ared from a cell culture of Ve ro cells grown in a 35mm tissue culture (TC) dish and infected with the third passage of isolate V810 recovered from an oral swab of a young SSL in southeast Alaska in 2002. Sections were stained with uranyl acetatelead citrate and evaluated for th e presence of calicivirus-like particles by electron microscopy. The procedure was performed at the Electron Micros copy Core of the University of Florida. Extraction of RNA from Cell Cultures Total RNA was extracted from MDCK and Ve ro cell cultures showing CPE using TRIzol Reagent (Invitrogen). Briefly, ce ll monolayers were lysed in 1 ml of TRIzol Reagent for 5 min


55 at room temperature, followed by the addition of chloroform. The samples were mixed well and incubated at room temperature for 5 min, followed by centrifugation at 12,000 x g for 10 min at 8C. The aqueous phase was harvested and RN A was precipitated with an equal volume of isopropyl alcohol. After 10 min incubation at room temperature, the RNA was pelleted by centrifugation at 12,000 x g for 10 min at 8C, rinsed with 70 % ethanol, air dried, and dissolved in RNase-free water. Reverse Transcription Between 500 ng and 1 g of total RNA were denatured by heating at 70C for 10 min and rapidly chilled on ice. Complementary DNA (cD NA) was obtained by reverse transcription of the RNA in a 20 l reaction containing random hexanucleo tide primers, 40U of the ribonuclease inhibitor RNaseOUT (Invitrogen, Carlsbad, CA) and 200 U Superscript II (Invitrogen) following the manufacturerÂ’s protocol. The cDNA was stored at -80C until use in PCR. Oligonucleotide Primers Several sets of primers (Table 2-2) were designed to amplif y different genomic regions and were based on consensus sequences of marine ve siviruses available in the NCBI database or previously published (Reid et al. 1999). Polymerase Chain Reaction Capsid gene fragment. Complementary DNA was amplified by PCR to generate a 768bp fragment of the A-region of the capsid ge ne using primers previ ously described (Reid et al. 1999). Briefly, 5 l of cDNA were added to 45 l of a PCR mix (pH 8.4) containing 10 mM KCl, 10 mM (NH4)2S04, 20 mM Tris-HCl, 2 mM MgSO4, 0.1% Triton X-100, 400 nM of each specific primer (Table 2-2), 200 M of each dNTP, and 2 U of Taq DNA polymerase (New England Biolabs). Thermal cycling was perfor med in the DNA Engine DYAD Thermal Cycler (MJ Research, Inc.) as follows: Initial denatura tion at 94C for 2 min, followed by 39 cycles of


56 denaturation at 94C for 30 s, annealing at 48 C for 30 s, and extension at 72C for 2 min. Amplified DNA products (approximately 25 l) we re resolved by gel electrophoresis in 1% agarose containing ethidium bromide (0.5 g/ml) and the DNA fragments were visualized on a UV transilluminator and photographed with a gel documentation system (Bio-Rad Laboratories, Inc.). Amplification of the complete vesivi rus capsid: open reading frame two The complete capsid open reading frame two (ORF 2) of the ve sivirus isolates with an expected size of approximately 2000-bp was amplified using primers CR-567 and CR-568 (Table 2-2). Five l of cDNA from each RT reaction were used in PCR in final volumes of 50 l as described above; however, 1U of the enzyme Expand High Fidelity (Roche, Indianapolis, IN) was used instead of Taq polymerase. Thermal cycling conditions were: initial denaturation at 94C for 2 min, followed by 38 cycles of a denaturation step at 94C for 30 s, annealing at 47C for 30 s, and extension at 68C for 2.5 min. One final cycle of denaturation at 94C for 1 min, annealing at 47C for 1 min and extension at 68C for 7 mi n completed the amplification cycling. Open reading frame one amplification Two different primer sets were designed to amplify the complete ORF 1 as a single fragment (CR656 and CR-657) or in tw o fragments; ORF 1A (CR-656 and CR-673) and ORF 1B (CR-672 and CR-657; Table 2-2). The predicted size of the complete ORF1 is approximately 5600-bp; ORF 1A is approximately 2500-bp while ORF 1B is approximately 3100-bp. These ORFs were amp lified from cDNA using 1 U of the enzyme Expand Long Template (Roche). The program for the amplification of the complete ORF 1 consisted of: initial denaturation at 94C for 2 min followed by 10 cycles of denaturation at 94C for 10 s, annealing at 49C for 30 s, and extens ion at 68C for 7 min. The following 25 cycles consisted of: denaturation at 94C for 15 s, annea ling at 49C for 30 s, and extension at 68C for


57 7 min for the first cycle, increasing the latter by 20 s for each additional cycle. The cycling conditions to obtain ORF 1 fragme nts were: initial denaturati on at 94C for 2 min, followed by 38 cycles of denaturation at 94C for 30 s, a nnealing at 49C or 53C (ORF 1A and ORF 1B, respectively) for 30 s, and extension at 68C for 7 min. The final amplification cycle consisted of denaturation at 94C for 1 min, annealing at 49 or 53C for 1 min and extension at 68C for 7 min. Open reading frame three amplification. The complete ORF 3 with an expected size of approximately 500-bp was amplified using prim ers CR-658 and CR-659. Five l of cDNA from the RT described above were used in PCR in a final volume mix of 50 l using 1 U Expand High Fidelity enzyme (Roche), 400 nM of each primer, 200 M of each dNTP, and 2 mM MgCl2. Thermal cycling conditions were: initial denaturation at 94C for 2 min, followed by 38 cycles of denaturation at 94C for 30 s, annealing at 41C for 30 s, and extension at 68C for 1 min. The final cycle consisted of a denaturation at 94 C for 1 min, annealing at 41C for 1 min and extension at 68C for 7 min. Cloning Amplified ORFs and gene fragments were resolved by electrophoresis in 1% low melting point agarose (Invitrogen), exci sion of the proper DNA band from the gel and extraction using the Wizard SV Gel and PCR Clean-up System (Promega, Madison, WI). The isolated and purified DNA fragments were cloned into the ba cterial plasmid pCR2.1-TOPO TA (Invitrogen) following the manufactureÂ’s in structions. Competent DH5 Escherichia coli bacteria (Invitrogen) were transformed with the recomb inant plasmids and grown overnight on 2XYT agar plates containing ampicillin (100 g/ml) at 37C. Individua l white colonies were picked and grown in 3 ml of 2XYT me dium containing ampicillin (100 g/ml) at 37C overnight, while shaking at 250 rpm. The plasmid DNAs were ex tracted from 1.5 ml of the overnight cultures


58 using a rapid phenol-free extr action procedure (Zhou, 1990) and screened for the correct DNA inserts by restriction analyses with various e ndonucleases. Remaining overnight cultures (1.5 ml) of correct recombinant plasmids were purif ied using the Aurum™ Plasmid Mini Kit (BioRad Laboratories, Hercules, CA) and the DNA inserts were sequenced. Sequencing Fifty fmol of purified recombinant plasmid DNAs were initially sequenced in duplicate using M13 forward and reverse primers in the CEQ 2000 XL Sequencer (Beckman Coulter, Fullerton, CA) following the manufacturer’s inst ructions. Sequencing was continued using newly designed specific primers that anneal ed approximately 100-bp upstream or downstream from the previously obtained sequences. PCR products representing each of the ORFs were also sequenced directly to confirm the correct viral sequence, and e liminate any error from the cloning of the viral cDNAs. Following sequencing, the chromatograms were visually checked using the Chromas 2.3 software (Technelysium Pty) for potential miscal ls. Sequences were then transferred to the University of Wisconsin Package Version 10.2 (G enetics Computer Group – GCG, University of Wisconsin, Madison, WI) to assemble the comp lete sequences of each ORF and for further analysis. The BLAST function of the NCBI database was used to compare the generated sequences to the sequences of other caliciviruses availabl e in the GenBank database. Rapid Amplification of cDNA Ends To obtain the correct sequence of the 5’ and 3’ ends of each viral genome, rapid amplification of cDNA ends (RACE) was performed usi ng commercially available kits (Invitrogen) according to the manufacture’s instru ctions. Viral RNA was extracted from infected Vero cell cultures, as described above. Two sepa rate viral RNAs were tested for each virus to confirm the correct sequence was obtained. Gene specific primers (GSP) were designed at the 5’


59 and 3Â’ ends of the genome based on cons ensus sequence from the cloned cDNA for the vesiviruses, and other homologue vesiviruses in GenBank. 5Â’ RACE. The first strand cDNA synthesis was completed using the SuperScript II enzyme (Invitrogen) and an an tisense GSP1 approximately 576-bp downstream from the 5Â’ end of the viral genome (Table 2-2). Any remain ing RNA was degraded with RNAse H, and the cDNA was purified through GlassM ax columns, provided with the commercial kit. A homopolymeric tail was then liga ted to the 3Â’ end of the cDNA with TdT enzyme and dCTP. The tailed cDNA was then amplified by PCR us ing an abridged adapter primer (AUAP) containing poly-G sequence, and GSP2 approxi mately 360-bp downstream of the 5Â’ end of the viral genome (Table 2-2). The PCR products we re gel purified and sequenced directly. 3Â’ RACE. The first strand cDNA synthesis was completed using the SuperScript II enzyme (Invitrogen) and an oligo-dT primer with an attached adapter primer (AP). The RNA was degraded with RNAse H, and the cDNA was amplified by PCR using the AP primer, and a GSP3 approximately 200-bp upstream of the 3Â’ e nd of the viral genome (Table 2-2). The PCR products were gel purified and sequenced directly. Phylogenetic Analyses The amino acid (aa) sequences deduced from the SSL vesivirus ORFs and those of other calicivirus homologues from the GenBank databa se were aligned using Clustal X slow and accurate function, Gonnet 250 residue weight table, gap penalty of 11 and gap length penalty of 0.2. Neighbor-joining phylogenetic trees were constructed using PAUP version 4.0b10 (Sinauer Associates) and drawn with TreeView softwa re (Page, 1996). Confidence values were determined from 1000 bootstrap replications. GenBank accession numbers for sequences used in phylogenetic analyses were: VESV-A 48 NC_002551, Pan-1 AF091736, SMSV-1 U15301, WCV NC_004541, RaV AJ866991, feline calicivirus (FCV) Urbana strain NC_001481, FCV F4


60 strain D31836, FCV F9 strain M86379, canine calicivirus (CaCV) NC_004542, European brown hare syndrome virus (EBHSV) Z69620, rabbit hemorrhagic disease virus (RHDV) Iowa strain AF258618, RHDV FRG strain NC_001543, bovine enteric calicivirus (BEC) AY082891, porcine enteric calicivirus (PEC) NC_000940, Manchester virus X86560, Sapovirus NC_010624, bovine calicivirus (BoCV) Je na strain AJ011099, Norwalk virus NC_001959, Southampton virus L07418, Lordsdale viru s X86557, Snow Mountain virus AY134748, SMSV4 M87482, and SMSV-17 U52005. The complete genomic sequence of marine vesivirus isolates V810 and V1415 have been deposited in the NCBI database under accession numbers EF193004 and EF195384, respectively. Serological Assays In an attempt to serotype the two SSL nove l vesivirus isolates, a limited number of available type specific antisera against previously described marine vesiviruses were used in virus neutralization (VN) assays. Specific antiserum to serotypes SMSV-1, 2, 4, 5, 6, 7, 9, 10, 11, and 13 and VESV serotypes A48, B51, C 52, D53, E54, F55, G55, H54, I55, J56, K54, and 1934B were assayed against two SSL vesiviruses, isolates V810 and V1415, each representing one of the two novel genotypes. The general dilu ent for serum, virus, and indicator cells was DMEM supplemented with 1 % FBS and antibiotic s. Before testing, all sera were heat inactivated at 56C for 30 min and two-fold seri al dilutions (in 50 l vol.) in duplicate were incubated with 100 TCID50 (in 50 l vol.) of each vesivirus is olate in 96-well cell culture plates. Following the 60 min virus-serum dilutions incubation, 2 x 104 Vero cells (in 100 l vol.) were added to each well. The plates were inc ubated at 37C in an atmosphere of 5% CO2 and monitored daily for the appearance of CPE until day 7 when all wells were scored for VN. Similar VN assays were performed with sera collected in 2004 from free-ranging SSL in


61 southeast Alaska from populations from which is olates V810 and V1415 had originated, and sera collected from free-ranging SSL in the Aleutian Islands, Alaska in 2005. RNA Transfection: Infect ivity Recovery Assay Viral RNA extracted from cultures infected with the SSL vesivirus isolates were used to transfect Vero cell cultures grow n in 60 mm TC dishes to determine if the RNA was infectious. Viral RNA was extracted with TRIzol Reagent as described above, and one g of each viral RNA was used for transfection in the presence of 20 l (1 mg/ml) of Lipofectin Reagent (Invitrogen). Controls included a culture treated with viral R NA in the absence of Lipofectin, and a culture treated only with Lipofectin in the absence of RNA to determine its potential toxicity for Vero cell cultures. Cultures were incubated at 37C for 5 h in a 5% CO2 atmosphere, the inocula removed and the cultures fed with DMEM containing 1% FBS. Cultures were monitored daily for CPE and then harvested and at 72 h post-transfection. RNA was extracted from all cultures and reverse transcribed for calic ivirus analysis as prev iously described (Reid et al. 1999). Results Virus Isolation A total of 594 clinical samp les were collected from SSL in Alaska between 2001 and 2007 for the purpose of virus isola tion (Appendix Table A-1). Cytopa thogenic agents were isolated from nine different samples on Vero or MDCK cell cultures (Table 2-1) at the following rate: two (0.80 %) were isolated out of 248 oral swabs tested, six (2.2 %) out of 269 rectal swabs, one (1.7 %) out of 60 vesicle lesions, and none from 15 various tissues and two fecal samples. The CPE was initially observed at 24 to 48 h post-infe ction and was characterized by isolated groups of discrete and small rounded cells followed by dissemination across the cell monolayer in the next 3 to 7 (Figure 2-1). Ultra thin sections prepared from a Ve ro cell monolayer infected with


62 the third passage of isolate V810 that had orig inated from a SSL oral swab were shown by electron microscopy to contain larg e numbers of viral pa rticles that formed crystal-like arrays and had the characteristic size and morphology of members of the Caliciviridae family (Figure 2-2). The viruses also produced distinct pl aques in a plaque assay on Vero cell culture monolayers (Figure 2-3). Reverse transcription of total RNA extracted from all nine infected cultures at the peak of CPE, and PCR amplification using a primer set that targets the capsid gene (Reid et al., 1999), amplified DNA fragments of the predicted size, 768-bp (Figure 2-4). Se quencing of all nine amplicons and a BLAST search with the NCBI e ngine of the deduced amino acid (aa) sequences confirmed that these corresponded to fragment s of the viral capsid of members of the Vesivirus genus within the Caliciviridae family. Furthermore, multiple alignments of all nine fragments aa sequences showed that eight of the isolates, all de rived from oral and rect al swabs were identical to each other, while one isolate, (V1415) derived fr om blister fluids was clearly distinct. The nt sequence from isolate V1415 capsid fragment shar ed 85.6 % identity with orthologous sequences of the remaining eight isolates, while the dedu ced aa sequences shared 94.1 % similarity and 92.6 % identity. Multiple seque nce analysis and phylogeny of these fragmentsÂ’ deduced aa sequences with homologous fragments from other marine vesivirus sequences available in the GenBank database revealed that the SSL isolates constituted nove l marine vesivirus genotypes. For further characterization, isolate V810 was chos en to represent the gr oup of eight identical sequences. Genomic Sequencing and Phylogenetic Analyses To obtain the complete genomes to fully anal yze these two novel viral genotypes, several sets of primers were designed based on consensu s sequences from marine vesivirus sequences available in the GenBank database and from sequen ces generated from both isolates (Table 2-2).


63 The complete genomes of isolates V810 and V1415 were obtained by sequencing cloned viral cDNA, and confirmed by direct sequencing of P CR products representing the majority of the viral genomes. The ends of the viral genomes were obtained from 5Â’ and 3Â’ RACE. The assembled genomic sequences were then compar ed to all complete calicivirus sequences available in the GenBank database. Because of the limited number of complete genomic vesivirus sequences that were av ailable, only five of the more than 40 serotypes described were used to compare and analyze full genomic seque nces. The genome of SSL vesivirus isolate V810 was 8302 nt in length and V1415 were found to contain 8305 nt. Both genomes were organized into three open reading frames (ORFs) and contained 5Â’ and 3Â’ untranslated regions (UTR) of 19 nt and 180 nt, respectively (Table 2-3). The genome base composition of isolate V810 included 27.2 % C, 22.1 % G, 23.1 % T and 27.5 % A while isolate V1415 contained 26.4 % C, 22.2 % G, 23.5 % T, and 27.9 % A. These fi ndings are consistent with those of other vesiviruses whose full genomic sequences have been published, includ ing WCV, Pan-1, SMSV1, VESV-A48, and RaV (Table 2-3). Comparisons of the full genome sequences of these marine vesivirus to those described here revealed identities at the nt level ranging from 79.4 to 83.0 % for isolate V810, and 79.2 to 83.8 % for isolate V1415 (Table 2-4). The SSL viruses were most similar to each other, at 83.0 %, and least similar to RaV at 79 .4 % and 79.2 % for isolates V810 and V1415, respectively (Table 2-4). ORF1 of isolate V810 contained 5652 nt wh ile that of isolate V1415 had 5645 nt, and encoded polyproteins of 1883 and 1882 aa, respectiv ely (Table 2-3). The polyproteins were 209 kDa in the case of isolate V810 and 208 kDa in th e case of isolate V1415 and were predicted to encode the non-structural prot eins; helicase, protease, RNA de pendant RNA polymerase (RdRp), and the viral protein (VPg), which is covalently attached to the 5Â’ end of the genomic and


64 subgenomic RNA Conserved residues within ORF1 were identified with those of other caliciviruses (Martin-Alonso et al. 2005; Neill, 1990; Rinehart-Kim et al. 1999). These residues included the 2C helicase-NTPase resi due GxxGxGKT (position 593 for V810 and 589 for V1415), the 3C cysteine protease GDCG (position 1305 for V810 and 1302 for V1415), the 3D RdRp motif A VDYSKW (position 1600 for V 810 and 1597 for V1415), and 3D RdRp motif CYGDD (position 1704 for V810 and 1701 for V1415) ORF1 was the most conserved of the three ORFs. Within ORF1, the RdRp was the mo st highly conserved, with nt identities ranging from 83.7 to 91.4%, deduced aa similarities rang ing from 92.2 to 100 % and aa identities of 90.0 to 99.3 % for isolate V810, when compared to othe r marine vesiviruses. For isolate V1415, the RdRp nt identities ranged from 83.3 to 90.1%, aa similarities ranged from 93.3 to 98.7 % while the aa identities varied from 87.8 to 96.6%. The helicase gene within ORF1 is also highly conserved among marine vesiviruses with nt identities varying from 78.8 to 91.3%, aa similarities ranging from 91.0 to 99.0 % and aa id entities of 88.2 to 96.6 % when compared to isolate V810. Isolate V1415 shared 81.0 to 93.0 % nt identities, 86.4 to 93.9 % aa similarities and 83.1 to 92.5 % aa identities. ORF2, containing the capsid gene, started five nt downstream fr om ORF1, and was 2118 nt long for isolate V810 and 2127 nt for V1415, en coding, respectively, proteins of 705 and 708 aa (Table 2-3). The full capsid protein of vesivi ruses contains a leader sequence that is posttranslationally cleaved by the viral protease to produce the mature capsid protein or VP1 (Matsuura et al. 2000; Rinehart-Kim et al. 1999; Sosnovtsev et al. 1998). The molecular weight of the full capsid is approximately 78 kDa while that of the mature capsid VP1 is approximately 61 kDa for both SSL vesivirus isolat es. Pair-wise alignments of the complete capsid genes showed that the V810 and V1415 SSL vesiviruses were 79.6% and 89.58%


65 identical at the nt and aa levels respectively. The capsid gene contained within ORF2, was the least conserved ORF in the genome of both isolat es. For isolate V810 the aa similarities among other marine vesiviruses ranged from 78.7 % to 89.7 % while for isolate V1415 they ranged from 78.9 to 90.0% (Table 2-6). However, the E region, which has been suggested to be responsible for serotype determination for the Vesivirus genus members (Neill, 1992; Seal et al. 1993), was the most divergent region within the capsid ge ne and the entire genome. The aa similarities between the SSL isolates and their homologues among the marine vesiviruses ranged only from 59.9 to 83.3% for isolate V810 and 55.5 to 85.3% for isolate V1415 (Table 2-6). ORF3 was 333 nt in length in both SSL vesivi rus isolates and encoded a protein of 110 aa (Table 2-3) of molecular weight approximately 13 kDa. The size of ORF3 seems to be well conserved among marine vesiviruses, as all publis hed sequences available in the NCBI database are 333 nt in length. The V810 and V1415 SSL ve siviruses shared 83.5% nt identity with each other, and 90.1% and 95.5% at the aa identity, a nd similarity levels, resp ectively. In the case of isolate V810, the aa similarities with other vesivirus homologues ranged from 82.9 to 99.1 % (Table 2-6). For isolate V1415, this similarity ranged from 80.2 to 96.4 % (Table 2-6). Both SSL viruses had the least similarity ( 80.2 to 82.9 %) to WCV and RaV (Table 2-6). Rapid Amplification of cDNA Ends Both the 5Â’ and 3Â’ RACE strategies produ ced strong PCR products from the ends of the viral RNA, which were gel purifie d and sequenced directly. The sequences obtained from the 5Â’ end contained the poly-C ligated sequence, indi cating that the exact 5Â’ end was intact and complete. The 3Â’ end sequence contained the poly -A sequence, indicating that the exact 3Â’ end was also obtained. The RACE sequences from two separate viral RNAs were compared to each other, and compared to the cloned cDNA sequences and nucleotide changes were revealed. The duplicate RNA sequences for both V810 and V1415 were identical for both the 5Â’ and 3Â’ ends.


66 In the case of cloned cDNA, the 5Â’ end of the viral genome, isolate V810 had two nucleotide changes while that of isolate V1415 had one nucle otide change. The 5Â’ mistake in the cloned cDNA sequence for V1415 was in the PCR primer CR-656 (Table 2-2). The 3Â’ RACE sequences revealed one nucleotide change in is olate V810, and one nucleotide change in isolate V1415. The 3Â’ mistake in the cloned V1415 seque nce was also found in the PCR primer CR-657 (Table 2-2). Serology Serotype specific antisera against 10 marine vesiviruses, and 12 VESV serotypes were assayed by VN against SSL isolates V810 and V 1415. These antisera corresponded to SMSV-1, 2, 4, 5, 6, 7, 9, 10, 11, and 13, and VESV serotypes A48, B51, C52, D53, E54, F55, G55, H54, I55, J56, K54, and 1934B. None of these antisera neutralized the SSL isolates, even when used at a 1:2 dilution. Serological surveys using the VN assay on 41 sera from free-ranging SSL collected in southeast Alaska in 2004 showed that 19 (46.4 %) had antibodies against the 2002 V810 isolate that ranged in titers from 8 to 1024 with a median of 16 (Table 2-7). When the same sera were assayed against the 2004 V1415 isol ate, 38 (92.7 %) had antibodies th at ranged in titers from 8 to 8192 with a median of 512 (Table 2-7). All 16 SSL sera collected in 2005 from the Aleutian Islands, Alaska were free of VN antibodies for isolates V810 and V1415 (Table 2-7). RNA Transfection: Infect ivity Recovery Assay Within 48 h of transfection, Vero cell cultures transfected with viral RNA in the presence of Lipofectin developed CPE charact eristic of calicivirus infecti on. By 72 h post-infection, the CPE had progressed and destroyed the entire monola yers. Cultures exposed to viral RNA in the absence of Lipofectin or to Lipofectin in the ab sence of viral RNA remain ed healthy and did not show CPE. The presence of in fectious caliciviruses was conf irmed by RT-PCR amplification of


67 the 768-bp DNA fragment in cultures transfected with viral RNA in the presence of Lipofectin (Figure 2-9). No DNA fragment was amplifie d from the control cultures (Figure 2-9). Discussion Marine vesiviruses were isolated at very low frequency from oral (0.95%) and rectal (2.6%) swabs, and from vesicula r fluids (1.7%) obtained from young SSL from southeast Alaska between 2001 and 2005. These low successes in vi rus isolation most likely indicate low active vesivirus infection at the time of sample co llections in the SSL population examined. One isolate (V1415) was derived from blister fluids while the remaining ei ght isolates, including isolate V810, originated from oral and rectal swabs. These isol ates may represent two groups of marine vesiviruses with different tissue tropism and possibly di fferent pathogenic outcomes. This thought is reinforced by the recovery of isolate V1415 only in MDCK but not in Vero cell cultures. Similarly, all isolates from oral and rectal swabs were recovered in Vero cell cultures but not in MDCK cultures. Furtherm ore, isolate V1415 was associated with the occurrence of vesicles on the skin of the aff ected SSL while the isolates represented by V810 were all recovered from oral swabs from SSL, although two of the eight animals had scars from previous lesions on the flippers, which could pot entially indicate past vesicular calicivirus lesions. Initial molecular data obtained after sequencing, and multiple sequence and phylogenetic analyses of both nt and aa derived from the nine 768-bp capsid gene fragments, indicated that these viruses all belonged to the Vesivirus genus within the family Caliciviridae. These vesiviruses grouped into two well-defin ed and novel clades; one represented by isolate V1415 (a vesicular isolate) and the other by is olate V810 (an enteric isolate) that shared identities of 85.5 and 92.6% at the nt and aa level, respectively (Tables 2-4 and 2-5). It is not known whether viruses representi ng these two groups may cause disease similar to foot-and-


68 mouth disease in swine and ruminants as previous ly described (Smith et al., 1973; Smith et al., 1980). The full genomes of isolates V810 and V 1415 were initially sequenced from cloned cDNA. To ensure that the correct viral sequ ence was obtained, we additionally confirmed the ends of the genomes with RACE, and the majori ty of the rest of the genome from direct sequencing of the PCR products. Overlapping P CR products were obtained for greater than 90% of the genome of isolate V1415 and 75% of the genomic sequence for isolate V810. We were unable to obtain reliable PCR products representing the first a pproximately 2000-bp of the ORF1 for isolate V810, excluding the extreme 5Â’ end of the genome obtained by 5Â’ RACE. However the other marine vesiviruses with full genomic sequences available in the GenBank database were also sequenced by cloned c DNA, including WCV (Ganova-Raeva et al. 2004), Pan-1 (Rinehart-Kim et al. 1999), and RaV (Martin-Alonso et al. 2005). The methods for sequencing the genomes of VESV-A48 and SMSV-1 were not published. The genome of isolate V810 was 8302 nt in length and isolate V1415 contained 8305 nt. Like all members of the Vesivirus genus, the genome was organized into three ORFs, with 5Â’ and 3Â’ UTRs of 19 and 180 nt, respectively locate d at the beginning and end of the genome. Unfortunately, of the more than 40 serotypes of marine vesiviruses described, complete genomic sequences in the NCBI database were only ava ilable for five vesiviru ses of marine origin, namely VESV-A48, SMSV-1, WCV, Pan-1, and RaV. Phylogenetic analysis including these five complete genomes showed that SSL isolat es V810 and V1415 form distinct clades between themselves and also when compared to the abov e five vesiviruses (Fi gure 2-5). This grouping was also observed when the SSL vesiviruses ORF1 that contains the non-structural proteins; helicase, protease, RdRp and VPg was phylogeneti cally analyzed against the ORF1 orthologous


69 proteins of the five available vesivirus genom es. This scarcity of data precludes more meaningful and definitive comparisons and an alyses of the novel SSL viral genotypes here described and their comparison to the numerous vesivirus isolates representing serotypes recovered from the north Pacific over the last ha lf-century. In the ca se of both V810 and V1415 isolates, ORF1 was more conserved than ORF2 and ORF3 and within ORF1, the RdRp gene was the most highly conserved. ORF2 of both isolates encoded the capsid pr otein that is considered responsible for antigenic diversity and serotype specificity (Neill, 1992). The complete capsid protein of both SSL vesiviruses contained a leader sequence that is most likely post-translationally cleaved by the viral protease to produce the mature capsid protein (Matsuura et al. 2000; Rinehart-Kim et al. 1999; Sosnovtsev et al. 1998). The predicted cl eavage site within ORF2 is consistent with that of other vesiviruses, and is located at the ES residue at positions 152/153 (Rinehart-Kim et al. 1999). Work with protein expr ession systems has demonstrated self-assembly of the capsid protein in vitro in absence of viral genomic RNA (Jiang et al. 1992; Matsuura et al. 2000). As is the case with previously described marine ve siviruses, the capsid E re gion contained the most divergent sequence within the capsid gene and the entire genome. The conserved motif NxT(N/H)F(K/R)GxYI(C/M)GxLx(T/R) has been described in the E region of vesiviruses (Neill et al. 1998) and was also identified in both SSL ma rine vesiviruses described here. Multiple alignment and phylogenetic analysis of the co mplete capsid protein sequence of both SSL isolates and the seven complete orthologous se quences available in the GenBank database showed that these capsids corres ponded to genotypically different viruses, with SMSV-17 being the most closely evolutionarily related, while WCV and RaV were evolutionarily the most


70 distant (Figure 2-6). However, these data are st ill intrinsically not definitive since the small number of existing complete capsi d protein sequences limited the si gnificance of the analyses. ORF3 was the same length, 333-nt in both SSL viruses and consistent with all published marine vesivirus sequences available in the GenB ank database. Phylogene tic analysis of ORF3 aa sequences of V810 and V1415 isolates showed th at in both cases, they were evolutionarily more closely related to Pan-1, a simian vesivirus of marine orig in and less related to WCV and RaV (Figure 2-8). ORF3 is beli eved to have a nucleic acid bind ing function due to the presence of conserved basic aa residues, possibly involved with encapsida tion of the genomic viral RNA (Neill et al. 1991). The VP2 protein of FCV has been s hown to be required to form infectious virions (Sosnovtsev et al. 2005). The RACE at the 5’ and 3’ end of the viral genomes was an important exercise to perform to get the correct sequence fo r isolates V810 and V1415. The RACE sequences revealed mistakes in the sequences obtained from cloned cDNA fragments. Two of the three nt changes in V1415 were found in the PCR primer used for cDNA cloning. The primers, CR-656 and CR657 (Table 2-2) were based on what appeared to be a consensus sequence at the 5’ and 3’ ends of the viral genome, but this analysis reveals that not all marine vesiviruse s share these conserved ends. Specific antisera for all the nearly 40 serot ypes of marine vesiviru ses described over the last five decades were not available, as there is not a single reliable source and because some of these antisera no longer exist. Furthermore, typing of recently emerging vesiviruses is increasingly difficult, if not impo ssible, not only due to the unav ailability of specific antiserum but possibly to the real possibility that vesiviruses isolated over the last half-century may have emerged and then disappeared as they were substituted by newly emerging “fitter” viruses that


71 eventually underwent the same fate Thus, there is an urgent n eed to fully sequence the capsid gene of previously described ve sivirus serotypes to decipher th eir genetic relationship to the newly emerging viral genotypes as the ones described here. Multiple sequence alignment and phylogeny of the conserved sequences within the capsid A region (Neill, 1992) and the divergent capsid E region indicated that SMSV-4, SMSV6, SMSV-13, and SMSV-17 were genetically the most closely related vesiviruses to SSL isol ates V810 and V1415 (not shown). However, specific antiserum to serotypes SMSV-4, SMSV -6, and SMSV-13 failed to neutralize the SSL viruses while no SMSV-17 antiserum was available to assay for its VN activity against the SSL isolates. All of the hitherto described marine vesivirus serotypes with sequence data available, form distinct clades after phylogenetic analyses, i ndicating that different se rotypes also constitute different genotypes. Our SSL vesiviruses form distinct clades from all sequenced marine vesiviruses, including SMSV-17; therefore, we can assume these SSL isolates also are different serotypes, although we were not ab le to test these isol ates against antisera to all previously described marine vesiviruses. The VN assays performed on the 41 SSL sera collected in 2004 indicated a much lower prevalence of antibodies agains t the 2002 isolate V810 (46.4 %) th an against the V1415 (92.7 %) isolate from 2004 (Table 2-7). These results strongly suggest that isolate V810 was being replaced in 2004 in the SSL population survey ed, if not already replaced, by the newly circulating V1415 isolate. The VN assays perf ormed on the serum samples collected from the Aleutian Islands in 2005 indicated that the SSL vesiviruses describe d here were not circulating in this region. In summary, two novel marine vesiviruses from SSL have been isolated and fully characterized by molecular means and partiall y characterized by VN. Although genotypically


72 distinct from previously describe d vesiviruses, these isolates sh ared many features and seem to represent novel genotypes. The addition of two complete genomic sequences of novel vesiviruses to the limited number available in the GenBank database shou ld aid in improving the reliability of genetic analyses to better understand the relationsh ip between previously described serotypes and newly emerging geno types. There is an urgent n eed to continue sequencing the genome of known marine vesivirus serotypes if we are to understand wh y potentially pathogenic vesiviruses of ocean origin are constantly emerging.


73 Table 2-1. Marine vesivi ruses isolated from Alas kan Steller sea lions ( Eumetopias jubatus ) in African green monkey (Vero) or Madin-Darby canine kidney (MDCK) cell cultures. Animal ID Year collected Locationa Sample Age (months) Sex Cell Culture V855 2001 PWS-Perry Island rectal swab 5 M Vero V857 2001 PWS-Perry Island rectal swab 5 M Vero V848 2001 PWS-Perry Island rectal swab 5 F Vero V849 2001 PWS-Perry Island rectal swab 17 F Vero V794 2002 SE-Benjamin rectal swab 5 F Vero V810 2002 SE-Brothers oral swab 5 M Vero V823 2002 SE-Benjamin rectal swab 17 M Vero V824 2002 SE-Brothers oral swab 17 M Vero V1415 2004 SE-Cape Horn Rock vesicle fluid 0.5 M MDCK a PWS = Prince William Sound, SE = Southeastern Alaska


74Table 2-2. Oligonucleotide primers used for PCR reactions. Name Amplified region Amplicon length (bp) Primer sequence Sense Source 1F/CR-436 Capsid A 768 GTGAGGTGTTTGAGAATTAG + Reid et al ., 1999 1R/CR-437 Capsid A 768 ACATCAATTCCGCCAGACCA Reid et al ., 1999 CR-567 Full capsid ~2100 GTGAGGTGTTTGAGAATTAG + Reid et al., 1999 CR-568 Full capsid ~2100 TCCAAAATTTGCATAATTCA This paper CR-656 ORF1 ~5600 GTAAATGAGAATTTGAGCTATGGCTC + This paper CR-657 ORF1 ~5600 GGCTAATTCTCAAACACCTCACCAC This paper CR-672 ORF1B ~2500 TGCACACGAGAACAGTGGGTGT + This paper CR-673 ORF1A ~3100 ACACCCACTGTTCTCGTGTGCA This paper CR-658 ORF3 ~500 ATGAATTATGCAAATTTTGGA + This paper CR-659 ORF3 ~500 CCTAATGCAACCTACCAATTAA This paper GSP1 5Â’ RACE 576 GTTGTTTCGATCTGATCCCAGGAAGG This paper GSP2 5Â’ RACE 360 CAACTCCTAACTA CACCTCCATCCTTAACTTThis paper GSP3 3Â’ RACE 200 TCGCCAAATTTATC AAGATGAAGCTGACC + This paper Table 2-3. Genomic organiza tion of marine vesiviruses with complete genomic sequences available in th e NCBI database, includin g the two novel SSL isolates, V810 and V1415 described in this dissertation. Virus Genome length 5Â’ UTR ORF1 location ORF1 nt length ORF1 aa length ORF2 location ORF2 nt length ORF2 aa length ORF 3 location ORF3 nt length ORF3 aa length 3Â’ UTR V810 8302 19 20-5671 5652 1883 5677-7794 2118 705 7791-8123 333 110 180 V1415 8305 19 20-5665 5646 1881 5671-7797 2127 708 7794-8126 333 110 180 VESV-A48 8284 19 20-5665 5646 1881 5671-7776 2106 701 7773-8105 333 110 180 SMSV-1 8284 19 20-5659 5640 1879 5665-7773 2109 702 7770-8102 333 110 183 WCV 8289 4-5646 5627 1876 5652-7778 2126 707 7775-8107 333 110 183 Pan-1 8304 19 20-5659 5640 1880 5668-7794 2127 709 7794-8123 333 110 178 RaV 8295 19 20-5662 5642 1880 5668-7785 2118 705 7782-8114 333 110 181


75Table 2-4. Nucleotide identities of the Steller sea lion vesiviruses compared to other members of the Vesivirus genus. Genome ORF1 Polymerase Helicase ORF2 ORF2 E region ORF3 V810 V1415 V810V1415V810V1415V 810V1415V810V1415V810V1415V810V1415 V810 100.0 83.8 100.083.9100.085.6100.081.3100.080.1100.065.4100.083.5 V1415 83.8 100.0 83.9100.085.6100.081.3100.080.1100.065.4100.083.5100.0 SMSV-1 78.5 79.4 82.883.683.784.981. WCV 79.7 80.1 83.784.986.187.178.881.573.071.946.647.870.668.2 VESV-A48 82.0 83.0 83.384.285.485.381.283.678.179.762.266.984.783.5 Pan-1 83.3 83.2 84.684.286.884.682.284.078.779.364.369.385.684.7 RaV 79.4 79.2 83.583.584.885.580.981.072.371.652.748.669.767.3 SMSV-4 SMSV-17 85.283.481.380.263.965.9 SMSV-14 86.790.188.591.954.351.3 SMSV-13 86.084.489.489.163.672.4 SMSV-7 88.988.291.091.352.648.8 SMSV-6 90.085.790.292.762.667.3 SMSV-5 83.984.685.485.764.565.2 SMSV-2 87.584.689.190.554.353.7 SMSV-9 83.984.9 SMSV-15 91.485.2 BCV-1 86.786.790.289.9 BCV-2 85.183.3 PCV 87.785.789.091.4 CCV 85.083.790.093.0 SCV 87.386.591.391.9 RCV 85.783.7 VESV-34B 89.286.886.986.9 VESV-C52 88.287.990.289.2 VESV-E54 87.187.489.792.4 VESV-I55 85.087.390.690.6


76Table 2-5. Peptide identities of the Steller sea li on vesiviruses compared to other members of the Vesivirus genus. ORF1 Polymerase Helicase ORF2 ORF2 E region ORF3 V810 V1415V810V1415V810V 1415V810 V1415V810V1415V810V1415 V810 100.0 91.3100.094.7100.088.2100.0 86.6100.078.2100.090.1 V1415 91.3 100.094.7100.088.2100.086.6 100.078.2100.090.1100.0 SMSV-1 90.8 89.694.194.489.090.073.8 73.156.856.790.889.0 WCV 91.8 90.594.995.190.191.472.6 72.157.357.176.673.9 VESV-A48 90.8 90.093.994.991.692.583.5 83.572.773.691.990.1 Pan-1 91.2 90.493.492.790.091.883.4 83.774. RaV 91.2 89.795.196.489.490.072.5 71.558.758.575.771.2 SMSV-4 93.1 84.673.570.890.187.4 SMSV-17 96.095.385.5 84.176.677.8 SMSV-14 92.491.795.889.0 49.146.0 SMSV-13 90.087.896.689.0 67.773.5 SMSV-7 97.194.995.089.8 49.750.6 SMSV-6 97.893.595.089.8 68.068.9 SMSV-5 92.591.989.183.1 66.168.2 SMSV-2 93.691.995.890.7 49.145.7 SMSV-9 95.393.3 SMSV-15 99.394.7 BCV-1 95.493.694.287.3 BCV-2 98.796.6 PCV 94.593.995.087.8 CCV SCV RCV 96.796.0 VESV-34B 97.995.995.985.6 VESV-C52 97.695.294.984.4 VESV-E54 VESV-I55


77Table 2-6. Peptide similarities of the Steller sea lion vesiviruses compared to other members of the Vesivirus genus ORF1 Polymerase Helicase ORF2 ORF2 E region ORF3 V810 V1415 V810V1415V810V 1415V810 V1415V810V1415V810V1415 V810 100.0 93.8 100.096.9100.091.0100.0 89.7100.083.3100.095.5 V1415 93.8 100.0 96.9100.091.0100.089.7 100.083.3100.095.5100.0 SMSV-1 93.6 92.0 79.767.968.095.490.8 WCV 94.0 92.9 95.996.792.493.378.7 79.064.966.382.981.1 VESV-A48 93.0 92.3 95.796.993.393.986.3 87.277.678.899.196.4 Pan-1 93.7 92.4 94.594.492.692.986.7 86.878.079.295.592.8 RaV 93.7 92.5 96.598.192.692.979.2 78.968.169.882.980.2 SMSV-4 94.7 95.1 94.896.593.691.787.9 89.079.879.695.592.8 SMSV-17 97.396.787.7 SMSV-14 93.193.898.391.5 60.856.9 SMSV-13 92.293.397.590.7 73.878.2 SMSV-7 97.197.897.592.4 60.160.0 SMSV-6 97.897.197.592.4 73.375.1 SMSV-5 94.895.493.386.4 70.774.9 SMSV-2 95.494.897.592.4 59.955.5 SMSV-9 97.396.6 SMSV-15 100.098.0 BCV-1 96.097.796.691.5 BCV-2 99.398.7 PCV 96.396.998.090.8 CCV 99.398.799.091.8 SCV 96.596.597.592.4 RCV 98.798.0 VESV-34B 99.097.998.088.7 VESV-C52 97.698.497.989.6 VESV-E54 VESV-I55


78 Table 2-7. Virus neutralization re sults. Steller sea lion sera collected from two locations in Alaska in 2004 and 2005. Each serum samp le was tested by virus neutralization against vesivirus isolates V810 and V1415. Animal number Year sampled Age (months) Sex V810 Titer V1415 Titer SSL2004-499SE 2004 14 M <4128 SSL2004-500SE 2004 14 M <4>8,192 SSL2004-501SE 2004 14 M 4512 SSL2004-502SE 2004 14 M <416 SSL2004-503SE 2004 14 M 4512 SSL2004-504SE 2004 26 F <48 SSL2004-505SE 2004 26 M <464 SSL2004-506SE 2004 26 F 1,024512 SSL2004-507SE 2004 14 M 41,024 SSL2004-508SE 2004 2 M 32512 SSL2004-509SE 2004 2 M 162,048 SSL2004-510SE 2004 2 M 8256 SSL2004-511SE 2004 2 F 164,096 SSL2004-512SE 2004 2 M 8>8,192 SSL2004-513SE 2004 2 F 416 SSL2004-514SE 2004 2 M 32512 SSL2004-515SE 2004 2 F <4512 SSL2004-516SE 2004 2 F <432 SSL2004-517SE 2004 2 F <41,024 SSL2004-518SE 2004 2 F <44,096 SSL2004-519SE 2004 2 F 1282,048 SSL2004-520SE 2004 2 M 642,048 SSL2004-521SE 2004 2 M <432 SSL2004-522SE 2004 2 M 168 SSL2004-523SE 2004 2 M 48 SSL2004-524SE 2004 2 M 642,048 SSL2004-525SE 2004 2 M 16<4 SSL2004-526SE 2004 2 F 328 SSL2004-527SE 2004 2 F 16<4 SSL2004-528SE 2004 2 F 41,024 SSL2004-529SE 2004 2 M 4<4 SSL2004-530SE 2004 2 M 4128 SSL2004-531SE 2004 2 M 162,048 SSL2004-532SE 2004 2 M 6464 SSL2004-533SE 2004 2 M 8>8,192 SSL2004-534SE 2004 2 F 1,0248 SSL2004-535SE 2004 14 M 8128 SSL2004-536SE 2004 26 F <41,024 SSL2004-537SE 2004 14 M <41,024 SSL2004-538SE 2004 26 M <4512 SSL2004-539SE 2004 14 <48


79 Table 2-7. Continued. Animal number Year sampled Age (months) Sex V810 Titer V1415 Titer SSL2005-594AL 2005 11 F <4<4 SSL2005-595AL 2005 11 F <4<4 SSL2005-596AL 2005 11 M <4<4 SSL2005-597AL 2005 11 M <4<4 SSL2005-598AL 2005 11 M <4<4 SSL2005-599AL 2005 11 M <4<4 SSL2005-600AL 2005 11 M <4<4 SSL2005-601AL 2005 11 F <4<4 SSL2005-602AL 2005 11 M <4<4 SSL2005-603AL 2005 11 F <4<4 SSL2005-604AL 2005 11 M <4<4 SSL2005-605AL 2005 11 M <4<4 SSL2005-606AL 2005 11 F <4<4 SSL2005-607AL 2005 11 M <4<4 SSL2005-608AL 2005 11 M <4<4 SSL2005-609AL 2005 11 M <4<4 SSL2005-610AL 2005 11 F <4<4


80 Figure 2-1. Cytopathic effects of vesiviruses isolated from Ste ller sea lions. Vesivirus isolate V810 was inoculated onto Madin-Darby canine kidney (MDCK) and Vero cell cultures, and observed approximately 18 h pos t-infection. This virus had previously been passaged three times in each cell line Panels A and B are MDCK cells, with control cells in Panel A and the infected ce lls in Panel B. Pane ls C and D are Vero cell cultures, with control cells in Panel C and infected cells in Panel D. A. B. C. D.


81 Figure 2-2. Electron micrograph of a Vero cell culture infected with vesivirus isolate V810 originating from an oral swab of a juvenile Steller sea lion. Figure 2-3. Plaque assay from Steller sea lion vesivirus isolat e V810. Confluent monolayers of Vero cell cultures were infected with one ml of 10-fold serial dilutions of virus isolate V810 and then overlayed with 1% agarose. Cultures were stained w ith crystal violet. Pictured are the 10-7 and 10-8 dilutions of the virus. Di stinct plaques were visible after 2 d of incubation at 37C. 10-7 10-8


82 1234567 89101112 800-bp 650-bp


83 Figure 2-4. Agarose gel electr ophoresis of 768-bp capsid gene fragments of caliciviruses isolated from Steller sea lions. Lane 11 Kb ladder, lane 2V794, lane 3-V810, lane 4-V823, lane 5-V824, lane 6-V848, lane 7-V 849, lane 8-V855, lane 9-V857, lane 10V1415, lane 11PCR control, no DNA added, a nd lane 121 Kb ladder. Figure 2-5. Neighbor-joining phylogram of the nucleotide sequences of the complete genome of members of the family Caliciviridae. Seque nces were aligned using Clustal X slow and accurate function, Gonnet 250 residue weig ht table, gap penalty of 11 and gap length penalty of 0.2. The phylogram was generated using PAUP version 4.0b10 and interpreted and drawn using the TreeView software. Valu es at nodes indicate the percentage confidence out of 1000 bootstrap replications. The rectangular format shows a 0.1 divergence scale representing 0.1 substitutions per site. The complete genomic sequences of marine vesivirus is olates V810 and V1415 have been deposited in the NCBI database under accession numbers EF193004 and EF195384, respectively. NCBI accession numbers of sequences retrieved and used in the construction of phylograms are described unde r Materials and Methods of Chapter 2. 0.1 V810 V1415 VESV-A48 Pan-1 SMSV-1 WCV RaV FCV-Urbana FCV-F4 FCV-F9 CaCV EHBSV RHDV-FRG RHDV-Iowa BEC PEC Manchester Sapovirus BoCV-Jena N orwal k Southampton Lordsdale Snow Mtn. 100 97 100 100 100 100 100 71.2 73.6 100 100 100 100 100 100 100 100 100 100 Norovirus Sapovirus Lagovirus Vesivirus 100


84 Figure 2-6. Unrooted neighbor -joining phylogram of the dedu ced amino acid sequences of complete ORF1 of members of the Caliciviridae family. Analyses were performed as described in Fig. 2-3. NCBI accession nu mbers are presented under Materials and Methods section of Chapter 2. 0.1 Manchester Sapovirus PEC CaCV FCV-Urbana FCV-F9 FCV-F4 V810 V1415 Pan-1 SMSV-1 VESV-A48 WCV RaV BEC EHBV RHDV-FRG RHDV-Iowa Snow Mtn. Lordsdale BoCvJena N orwal k Southampton Vesivirus Sapovirus Lagovirus Norovirus 100 100 99.4 100 50.3 99.8 100 100100 100 100 100100 62.7 100 71.2 59.3 77.1 85.4 50.8


85 Figure 2-7. Unrooted neighbor-j oining phylogram of the deduced amino acid sequences of the full capsid gene of members of the family Caliciviridae Analyses were performed as described in Fig. 2-3. NCBI accession nu mbers are presented under Materials and Methods section of Chapter 2. 0.1 RHDVFRG RHDVIowa EHBV PEC Manchester Sapovirus BEC CaCV Pan-1 SMSV-4 VESV V1415 V810 SMSV-17 SMSV-1 WCV RaV FCV-F9 FCV-Urbana FCV-F4 Snow Mtn. Lordsdale BoCv-Jena N orwal k Southampton Sapovirus Lagovirus Vesivirus Norovirus 100 100 100 100 100 100 100 100 100 100 87.5100 100 62.5 60.5 100 100 100 100 100


86 Figure 2-8. Unrooted neighbor-j oining phylogram of the deduced amino acid sequences of the complete minor capsid gene, VP2, of members of the Caliciviridae family This gene represents ORF3 of the Norovirus and Vesivirus genera, and ORF2 of the Lagovirus and Sapovirus genera. Analyses were performe d as described in Fig. 2-3. NCBI accession numbers are presented under Materi als and Methods section of Chapter 2. 0.1 Manchester Sapovirus PEC FCV-F4 FCV-F9 FCV-Urbana CaCV WCV RaV Pan-1 V1415 VESVA48 V810 SMSV-1 SMSV-4 BEC EBHSV RHDV-FRG RHDV-Iowa Snow Mtn. Lordsdale BoCv-Jena N orwal k Southampton Vesivirus Lagovirus Norovirus Sapovirus 68.9 100 99.5 100 58.9 100 100100 100 100 100 90 100 10068.9 100 100 100 100 88 96.2


87 Figure 2-9. Gel electrophoresis after RNA transfection assay. RNA extracted from vesivirus isolates V810 and V1415 was transfected into Vero cell cultures in the presence and absence of Lipofectin reagent. RNA was ex tracted from the cell cultures, and tested by RT-PCR for a 768-bp fragment of the capsid ge ne. Recovery of infectious virus is indicated by the 768-bp fragment with cel l cultures transfected with RNA and Lipofectin. Lanes 1 and 10-molecular si ze marker, lanes 2 and 3–Vesivirus RNA V810 and V1415, respectively, transfected wi th Lipofectin. Lanes 4 and 5-Vesivirus RNA V810 and V1415, respectivel y, transfected without Li pofectin. Lanes 6 and 7Uninfected cultures RNA transfected with Lipofectin. Lane 8-Ne gative PCR control, Lane 9-V1415 RNA positive PCR control. 1 2 3 4 5 6 7 8 9 10 650-bp


88 CHAPTER 3 AN IMPROVED DIAGNOSTIC ASS AY FOR MARINE VESIVIRUSE S: APPLICATION OF A REAL-TIME RT-PCR ASSAY Introduction The viral members of the Vesivirus genus within the Caliciviridae family represent many different viruses of marine and terrestrial animals. These viru ses were first described in the United States during outbreaks of vesicular diseas e in swine in Californi a in 1932 (Traum, 1936). Initially thought to be foot and mouth disease (F MD), thousands of pigs were destroyed before the causal agent was determined to be a novel virus that was named vesicular exanthema of swine virus (VESV). Marine mammals are also naturally infected with vesiviruses, in which they cause vesicular disease and re productive failure (Smith et al. 1973). Marine mammals infected by vesiviruses include sea lions, seals, walrus, wh ales, and dolphins (Smith & Boyt, 1990). One species of fish has also been shown to carry the virus (Smith et al. 1980a; Smith et al. 1980b). The VESV is thought to have entered the swin e industry through cont aminated feed, which contained marine mammal and fish products harb oring vesiviruses (Smith & Boyt, 1990). Other strains of vesiviruses ve ry closely related to the marine vesiviruses have been identified in terrestrial animal s (Smith & Boyt, 1990). These include isolates from rabbits (Martin-Alonso et al. 2005), skunks (Seal et al. 1995b), reptiles and amphibians (Smith et al. 1986), monkeys (Smith et al. 1978; Smith et al. 1985b), and humans (Smith et al. 1998a; Smith et al. 2006; Smith et al. 1978). More than 40 different se rotypes of marine vesiviruses, which infect both marine and terrestrial animals, have been described (Smith & Boyt, 1990). The vesicular nature of the disease in livestock makes these viruses very important economically, not only because of the similarity with other ex otic vesicular diseases, but also because they could be used as bioterrorism agents in livestoc k. It is crucial theref ore, to have rapid and


89 sensitive diagnostic assays to id entify vesiviruses in clinical samples from marine animals, livestock, or humans. The currently used diagnostic methods for id entification of marine vesiviruses include 1) traditional virological techniques, such as virus isolation in cell culture and electron microscopy, 2) serological methods, including virus neutra lization (VN) and enzyme linked immunosorbent assays (ELISA) assays, and 3) molecular assays such as conventional reverse-transcription polymerase chain reaction (RT-PCR) targeting the capsid gene (Reid et al. 1999) and real-time RT-PCR (rRT-PCR; Reid et al. 2007). The marine vesiviruses replicate well in cell culture, in both Madin-Darby canine kidney (MDCK) and African green monkey kidney (Vero) cel l cultures, and therefore viral isolation is a useful technique to identify these viruses. The cytopathic effects (CPE) are characterized by rounding and degeneration of cells that lift from the monolayer. If CPE appear in culture, electron microscopy can be used to confirm the calicivirus morphology exemplified by the distinct cup-like depressions of the 27-40 nm virus particles. Serological diagnostic methods such as VN and ELISA demonstrate previous exposure to these agents, either to a specific serotype or to ve siviruses in general. Mo st, if not all, of the previously identified marine vesiviruses were described by VN assays. A new virus serotype was designated if 20 units of specific antisera were unable to neutra lize 100 tissue culture infectious doses (TCID50) of previously isolated serotype (Smith & Boyt, 1990). Indirect sandwich ELISAs using specific antisera created for each of several marine vesiviruses have been described (Ferris & Oxtoby, 1994). The ELISAs were very sensitive, but also completely type specific. A different indirect ELISA that uses a recombinant antigen, D3A, expressed from bacteria has been described (Kurth et al. 2006a; Kurth et al. 2006b). This recombinant protein


90 was reported to cross-react with more than 30 serotypes of marine ve siviruses. A western blotting technique has also been deve loped for marine vesiviruses (Seal et al. 1995a). While VN and ELISA assays are specific among the serotype s, the western blot a ssay are cross-reactive among the closely related marine vesivirus seroty pes, with the exception of the serotypes SMSV8 and SMSV-12. These two serotypes have been de scribed to be different from the other SMSV serotypes, and did not amplif y in a molecular assay (Reid et al. 2007). Molecular techniques have al so been developed for the identification of marine vesiviruses, including the use of PCR. A diagnostic RT-PCR that amplifies a 768-base pair fragment of the capsid gene has been described (Reid et al. 1999). This assay was determined not to be sufficient alone for the detection of ve siviruses in clinical samples. Real-time RT-PCR is a rapid, sensitive, specific, and quantitative assay for the detection of RNA. A real-time RTPCR for the marine vesiviruses targeting the polymerase gene was recently described (Reid et al. 2007). However, since the assay failed to am plify cDNA from two serotypes of marine vesiviruses, SMSV-8 and SMSV-12, an improved assa y that identifies all described serotypes is needed. Here we describe the development of a novel rRT-PCR assay to detect the marine vesiviruses. The goal of this research phase was to develop an rRT-PCR assay that targets a conserved region of the capsid gene to allow for the detection of all the marine vesiviruses in a single assay. The newly develope d assay has been found to be specific, sensitive, and rapid, and has the advantage over the previously described rRT-PCR assay (Reid et al., 2007) of correctly identifying vesiviruses not dete cted in the previous assay.


91 Materials and Methods Viruses and RNA The marine vesiviruses used for this rRT-P CR assay were grown in Vero cell cultures and RNA was extracted at the height of CPE usi ng TRIzol-LS (Invitrogen, Carlsbad, CA) according to the manufactureÂ’s protocol. Briefly, the infect ed cell cultures were lysed in TRIzol-LS and phase separated with chloroform The RNA was precipitated with isopropyl alcohol, washed, air-dried, and resuspended in RNase-free water. The viruses used in these experiments were 10 previously described marine vesiviruses incl uding SMSV-1, 2, 4, 5, 6, 13, 14, bovine calicivirus (Bos-1; gifts of Dr. John Neill, USDA, Ames, Iowa ), SMSV-8 and SMSV-12 (gifts of Dr. Alvin Smith, Oregon State University, Corvallis, Or egon), and two novel marine vesiviruses from Steller sea lions (SSL) from Alaska isol ated in our laboratories (Chapter 2). Several other viral members of the Vesivirus genus, but representing different species were assayed to determine the specificity of this rRTPCR assay. Three different Florida isolates of feline calicivirus (FCV), pr eviously described (Weeks et al. 2001), were grown in CrandleReese feline kidney (CRFK) cell cultures, and vira l RNA was extracted as described above. The FCV Urbana strain and the mink calicivirus (MCV) were also us ed in the rRT-PCR assay and were a gift from Dr. Kim Green (National Institutes of Health, Bethesda, MD). Several viruses of the Norovirus genus were also tested to ascertain their reactivity in this rRT-PCR assay. The viral RNAs (a gift from Dr. Kim Green) included two strains of human Norwalk virus (NV), a human genogroup II.1 (D C-56 strain), human genogroup II.4 (DeFutio strain), and two strains of murine norovirus (MNV). Reverse Transcription Reaction Between 500-1000 ng of total RNA were revers e transcribed (RT) into complementary DNA (cDNA). The RT reaction volume was 20 l and consisted of 0.5 l of random


92 hexanucleotide primers (3g.l), 40 U of ribonuclease inhibitor RNase OUT, and 200 U Superscript enzyme (all purchased from Invitrogen or New England Biolabs, Ipswich, MA). The cDNA was stored at -80C until used in the real-time PCR reaction. Primer and Probe Design A multiple alignment of the full capsid gene of nine marine vesiviruses was performed with Megalign function of the Lasergene soft ware (DNA Star, Madison, WI) to identify conserved regions (Figure 3-1). These viruse s included SMSV-1, SMSV-4, SMSV-17, vesicular exanthema of swine (VESV), primate calicivirus (Pan-1), walrus calicivirus (WCV), rabbit vesivirus (RaV) and both novel SSL vesiviruses repor ted in this dissertation. Conserved regions were identified and used to de sign consensus primers, and a 16nucleotide TaqMan probe (Table 3-1). The TaqMan probe was designed with a Fam label at the 5Â’ end and an Iowa Black quencher at the 3Â’ end. The TaqMan probe al so incorporated locked nucleic acids (LNA; Integrated DNA Technologies, Coralv ille, IA) to increase the melti ng temperature of the probe in the assay. Real-Time RT-PCR Reaction Conditions Two separate platforms were utilized for the development of this rRT-PCR assay, the Smart Cycler II (Cepheid, Sunnyvale, CA) a nd the 7900HT Fast Real-time PCR machine (Applied Biosystems [ABI], Foster City, CA). The Smart Cycler II is the primary machine used in our laboratory. The second machine (ABI) was av ailable and used to determine if the marine vesivirus primers and probe set would also work in other platforms. The ABI machine can run up to 96 samples in one run, whereas the Smart Cycler II can only run 16 samples per run. The ABI machine was used to test the standards, as dilution series in triplicate were necessary. A two-step reaction was performed in the Smart Cycler II. The RNA was reverse transcribed, as described above, and then added to the real-time PCR reaction mixture. The PCR


93 reaction total volume was 25 l and consisted of 3.5 mM magnesium chloride, 0.2 M of each forward and reverse primer, 0.24 M of the TaqMan probe, 1 mM of each dNTP, 1 U of Taq DNA polymerase (New Engl and Biolabs), and 1-5 l of cDNA. A one-step reaction was utilized in the ABI machine. The mastermix was prepared from a commercial kit, Brilliant II QPCR Mastermix with Rox (Stratagene, La Jolla, CA). The final volume of 25 l contained of 5.5 mM MgCl2, 0.5 M of each forward and reverse primer, 0.5 M of the TaqMan probe, 1 mM of each dNTP 1.25 U of SureStart Taq polymerase, 1 l StrataScript reverse transcriptase, 500 nM ROX reference dye, and 5 l of RNA. The two-step rRT-PCR program utilized in th e Cepheid Smart Cycler II consisted of an initial denaturation at 95C for 120 s followed by 40 cycles of 2 s melting at 95C, 30 s of annealing at 47C, and 10 s extension at 72C. The fluorescent signal from the Taqman probe was measured during the elongation step of each cycle. The one-step rRT-PCR program utilized in th e ABI platform consis ted of an initial incubation at 45C for 30 min, and then 95C for 10 min, for the reverse-transcription of RNA. This was followed by 40 cycles of 95C for 15 s, 48C for 1 min, and 72C for 30 s. The fluorescent signal from the Taqman probe was measured during the elongation step of each cycle. Optimization of Real-time Reaction To develop the optimal conditions for this rR T-PCR assay in the Smart Cycler II used in our laboratory, several variables were evaluated at different concentrations. The variables assayed were magnesium ion concentration, fo rward and reverse primer concentration, and TaqMan probe concentration. The optimal concentr ation of each variable was determined as the amount that gave the lowest cycle threshold (Ct) value with the positive control SSL vesiviruses RNA. Two independent rRT-PCR assays were used to evaluate each variable, and within each


94 run, the variables were tested in duplicate. Thes e four Ct values for each variable were then averaged to get one final Ct value for each conc entration tested. The values for the magnesium ion concentration ranged from 0 to 6 mM in 0.5 mM increments. The concentrations evaluated for the forward and reverse primer were: 0.05, 0.1, 0.2, 0.4, 0.6, 0.8, and 1 M. The concentrations of the TaqMan probe were assayed at 0.02, 0.06, 0.09, 0.12, 0.15, 0.18, and 0.24 M. Previous analysis with other caliciviruses in the laboratory housing the ABI platform were used without further optimization, due to time constraints and accessibility to the machine. Specificity The specificity of the rRT-PCR assay wa s determined by testing different RNAs representing different members of the Caliciviridae family. The marine vesiviruses tested included SMSV-1, 2, 4, 5, 6, 8, 12, 13, 14, Bos-1, and two SSL vesiviruses, isolates V810 and V1415. Other vesiviruses included MCV and four strains of FCV. Members of the Norovirus genus included two strains of NV, two strains of MNV, a GII.1 human Norovirus, and a GII.4 human norovirus. Five l of each cDNA sample were tested in the real-time PCR reaction in the two platforms tested. Following the rRT-PCR assay, the PCR products were collected and sequenced directly to confirm that the correct viral sequence was amplified for each of the marine vesiviruses tested. Sensitivity Versus Infectivity The sensitivity of the rRT-PCR was evaluate d and compared to the infectivity of the viruses in cell culture. The SSL marine vesivi ruses, isolates V810 and V1415, were grown in Vero cells in T-75 cm2 flasks, and harvested 24 h post-infect ion. The cells and supernatant were frozen and thawed twice, and cl arified by centrifugation at 12,000 x g for 10 min at 4C. The supernatants containing infectious vesiviruses we re serially diluted ten-fold in DMEM. These


95 dilutions were used in virus titration assays a nd to extract RNA from 1 ml of each dilution with TRIzol-LS, as described above. Two separate methods were used for viral titration, an end-poin t dilution method to determine mean tissue culture infectious doses (TCID50), and plaque assay to determine plaque forming units (PFU) per ml. For the end-point dilution method, 100 l of each ten-fold serial dilution was added to eight sepa rate wells in a 96-well cell cu lture plate. Then, 20,000 Vero cells in 100 l of DMEM supplemented with 1% fetal bovine serum (FBS) were added to each well; the plates were incubated at 37C and obser ved for CPE after 3 d and 7 d. The virus titer was determined using the modifi ed Karber Method (Karber, 1931). For the plaque assay, Vero cells were plated in 6-well plates and incubated at 37C until confluent. One ml of each viral dilution wa s then absorbed onto the cell monolayers, in duplicate, for 1 h. The inoculum was removed a nd replaced with a 1% agarose overlay with DMEM and supplemented with FBS. The plates we re then incubated at 37C for 2 d to allow plaques to form, and then fixed overnight with 10% neutral buffered formalin. The agarose overlays were gently removed with a stream of water, and the cel ls were stained with crystal violet. The plaques were count ed, averaged between the duplicate wells, and the titer was reported in PFU/ml. The RNA extracted from each of the ten-fold serial dilutions was re verse-transcribed as described above and tested in the conven tional RT-PCR assay, and the rRT-PCR assay. Standards for Real-Time RT-PCR Assays Several different methods were evaluated to determine the sensitivity of the rRT-PCR assay and to make th e assay quantitative. Plasmid dilutions. A plasmid containing the 176-bp targ eted fragment of the capsid gene from V810 and V1415 was used directly in serial d ilutions to evaluate the sensitivity when using


96 plasmid DNA. The plasmid DNA was quantified us ing an ultra-violet ( UV) spectrophotometer (Pharmacia Biotech, Uppsala, Sweden). Th e copy numbers for the 176-bp fragment were determined by using traditional molecular biology techniques (AppliedBiosystems, 2003; Bookout et al. 2006) similar to other rRT-PCR assays (Wilhelm & Truyen, 2006); with the average weight of one basepair equal to 650 Daltons and AvogadroÂ’s number, 6.022 x 1023 molecules per mole. The plasmid DNA was se rially diluted, 10-fold, to make samples containing 108 to 10 copies. The serial dilutions were tested in the rRT-PCR assay to determine the sensitivity of this assay. RNA dilutions. RNA was extracted as previously de scribed, and further purified using the RNeasy Mini Kit (Qiagen, Valencia, CA). The RNA was quantified using a NanoDrop Spectrophotomer (Labtech, Dublin, Ir eland), and 10-fold serial diluti ons were prepared in water. The 10-fold serial dilutions were tested in th e rRT-PCR assay in a one -step protocol, and the RNA was quantified as compared to the plasmid d ilution standard curve, a nd with the traditional molecular biology techniques described above. In vitro transcription assay. RNA was transcribed in vitro using the MEGAshort Script Kit (Ambion, Austin, TX) corresp onding to the 176-bp targeted fr agment of the capsid gene. The 176-bp fragments for virus isolates V810 and V1415 were cloned into the pGemT Easy vector (Promega, Madison, WI) using T/A cloning. This vector was chosen because it has the T7 promoter directly upstream of the multiple clon ing site (MCS). The T7 promoter is used to drive the transcription of the 176 nucleotide frag ment by the T7 RNA polymerase present in the in vitro transcription kit. Five g of each recombinant plasmid were lineari zed with SpeI restriction enzyme (New England Biolabs) for 6 h at 37C. The SpeI site is located directly after the 176-bp fragment in


97 the recombinant plasmid, and linearization of the fragment at this location will terminate the RNA transcription directly downstream of the 176-bp fragment and prevent long RNA transcripts. The linearized DNA was then transcribe d into RNA using the T7 polymerase in vitro with MEGAShort Script Kit (Ambion). The DNA was a dded to a reaction mix containing 75 mM of each dATP, dUTP, dGTP, and dCTP, T7 RNA poly merase enzyme mix, and the reaction buffer provided with the kit. The reaction mixture was incubated for 6 h at 37C and treated with 10U of Turbo DNase (Ambion) to remove the pl asmid DNA. The newly transcribed RNA was extracted with a mixture of phenol:chloroform:isoa myl alcohol (25:24:1). Briefly, 1 ml of this mixture was added to the DNase tr eated DNA/RNA mixture, followed by 500 l of chloroform. The sample was mixed well and incubated for 10 min at room temperature and centrifuged at 5000 x g for 10 min at 10C to separate the organi c and aqueous phases. The aqueous phase was transferred to a new tube and 1 ml of ethanol wa s used to precipitate the RNA. The sample was incubated at -20C for 15 min, and then the RNA was pelleted at 14,000 x g for 20 min at 4C. The DNA was washed one time with 70% etha nol, air dried, and resuspended in 8 l of RNasefree water. To test for the removal of DNA, the RNA wa s reverse-transcribed in the presence and absence of the RT enzyme (New England Biolab s), and then tested for the 176-bp fragment by PCR. If DNA contamination was evident by th e presence of the 176-bp fragment when no RT enzyme was used in the reverse transcription step, the DNase treatment and RNA extraction were repeated.


98 Results Optimization of the Real-Time RT-PCR Assay The average Ct values for each of the primer s, magnesium, and probe concentrations were evaluated. The optimal magnesium concentration was determined to be 3.5 to 4 mM per reaction (Figure 3-2). The optimal concentration of primers was determined to be 0.2 M per reaction (Figure 3-3). The final probe c oncentration was found to be 0.9 M per reaction (Figure 3-4). Specificity Twelve different marine vesivi ruses were tested in the rRT-PCR assay. All twelve viruses tested were positive in this assay with Ct values ranging from 12 to 31 (Table 3-2). Each of the rRT-PCR products were sequenced and confir med to be the correct viral sequence. Four isolates of FCV, three is olates from Florida and the Urba na strain, were tested with the primers and probe described here. None of the four FCV isolates tested had positive Ct values (Table 3-2). The six isolates of the Norovirus genus were also negative in this rRT-PCR assay (Table 3-2). The MCV RNA was positive w ith the rRT-PCR assay with a Ct value of 30 (Table 3-2). Viral Infectivity, Sensitivity, and Standards Several different methods were evaluated to co mpare the sensitivity of the rRT-PCR to that of virus isolation in cel l culture and to conventional RT-PCR. These methods are summarized in Table 3-3. Vesivirus isolates V810 and V1415 from SSLs were titrated using an endpoint dilution method to determine the TCID50 and by plaque assay to quantify the PFU per ml. Viral isolate V810 titer was 109.75 TCID50 and 1 x 109 PFU/ml, while isolate V1415 titer was 108.5 TCID50 and 6 x 108 PFU/ml. The CPE consistent with vesi virus infection was visible in the Vero cell cultures up to the 10-9 dilution for V1415 and the 10-10 dilution for V810, and plaques were visible up to 10-8 dilution for isolate V810 and 10-9 dilution for isolate V1415. When the same


99 viral dilutions were tested in the rRT-PCR a ssay, the viral RNA was detectible up to the 10-8 dilution in the case of isolate V1415 and 10-9 for V810 (Table 3-3). In comparison, the conventional RT-PCR assay only det ected the viral RNA up to the 10-4 dilution (Figure 3-5). The rRT-PCR assay improved the sensitivity by 104 to 105. The viral RNA and plasmids were serially dilu ted and used as standards in this rRT-PCR assay, in order to make the assay quantitative an d determine the sensitivity of the assay. The starting concentrations of th e undiluted viral RNA were 221 ng/l and 395 ng/l for V810 and V1415, respectively. For the plasmid DNA, the c oncentration of the undiluted sample was 161 ng/l for V810 and 89 ng/l for V1415. The viral R NA was detectable in dilutions down to the 10-8 for V1415 and 10-9 for V810 (Table 3-3; Figure 3-7) The plasmid DNA was detectable down to the 10-10 for both V1415 and V810 (Figure 3-6). A standard curve was generated for each viral isolate, and an r2 value of 0.99 was obtained for the RNA and plasmid dilutions (Figures 3-6 and 3-7). The slope of the amplif ication plots of the se rial diluted plasmid DNA and RNA were used to calculate the efficien cy of each reaction from the equation (-1 + 10 (1/slope); AppliedBiosystems, 2003; Bookout et al. 2006). The efficiency for the plasmid DNA was 97.24% and 100.5% for V810 and V1415, respectiv ely. The RNA efficiencies were 94.54% and 87.23% for V810 and V1415, respectively. The in vitro transcribed RNA was also evaluated as a standard in this rRT-PCR assay. A large quantity, 5 g, of plasmid DNA was necessary to get optimal transcription of the target RNA, but it became very difficult to remove the DNA from the RNA. Excessive DNase treatment was required even when using 10U of enzyme and extended incubation times up to 18 h at 37C. This in vitro transcribed RNA, when tested in th e rRT-PCR assay, was sporadic in its reactivity and at the most was de tected only when present at 105 copies of the target or more.

PAGE 100

100 Discussion An rRT-PCR assay for the detection of marine vesiviruses was devel oped in this study. The assay successfully amplified and identified twelve different marine vesiviruses, including two vesiviruses not previ ously amplified with othe r diagnostic assays (Reid et al. 1999; Reid et al. 2007). This rRT-PCR assay did not amplify four different isolates of the closely related FCV, or six viral isolates of the Norovirus genus. This assay targets the A region of the capsid ge ne (ORF2), a conserved region at the 5Â’ end of the capsid protein (Neill, 1992). This region was chosen for the rRT-PCR assay because it is well conserved among the marine vesiviruses, an d should allow for the detection of all the known vesivirus serotypes and currently untyped marine vesiviruses. The TaqMan probe was designed to bind to an extremely conserved area of 16 nucleotides The incorporation of LNAs into the probe should have increased the specificity of the assay due to their binding properties. The LNAs lock the sugar backbone into the 3Â’ endo conformation, wh ich causes the melting temperature of the probe to increase. This in tu rn allows higher specific ity of the probe for the target sequence, and reduces background fluorescen ce. The probe is also more resistant to nuclease degradation (Integrated DNA Technology). Comparison of the infectivity of the viruses a nd sensitivity of the rRT-PCR assay revealed the rRT-PCR assay to be very sensitive. The te n-fold serial dilutions of the viruses produced CPE in Vero cell cultures and plaques up to 10-9 dilution. When the same serial dilutions were tested in the rRT-PCR assay, the viral RNA was detected up to the 10-8 dilution in the case of V1415 (Table 3-3) and up to the 10-9 dilution with isolate V810 (Tab le 3-3 and Figure 3-7). This rRT-PCR assay detected virus in the same dilutions that produced CPE in Vero cell cultures, the V810 10-10 dilution did not produce viral plaques, and was not detected by rRT-PCR, but three of the 8 inoculated wells were positive for CPE by the end-point dilution method. This could be

PAGE 101

101 interpreted as the end point dilu tion method is more sensitive than the plaque assay method for viral titration. Comparison of the rRT-PCR assay to the conve ntional RT-PCR assay re vealed an increase in sensitivity. The conventional RT-PCR assay was only able to detect the viral RNA diluted up to the 10-4 dilution (Figure 3-5), while the rRT-PCR assa y was able to detect the viral RNA up to the 10-9 dilution (Table 3-3). This represents an increased sensitivity of 100,000-fold for the rRT-PCR assay. Standardization of this assay was also po ssible using known concentrations of diluted plasmid containing the target frag ment, and serially diluted viral RNA. The copy numbers of the target fragment cloned into a plasmid were cal culated using traditional methods with AvogadroÂ’s number and the average mass of DNA molecules. The rRT-PCR assay was able to detect the viral target down to 10 copies of the plasmid c ontaining the target DNA (Fi gure 3-6). The serial dilutions of the viral RNA were also tested. The copy numbers of the RNA were determined using the standardized plasmid dilutions, and th e rRT-PCR assay was able to detect the viral RNA down to 100 copies of viral target (Figure 3-7). These standards can then be used with unknown tissue samples to quantify the amount of virus present in the sample. Two different platforms were used to evaluate the rRT-PCR assay in a one-step and a twostep assay. The Cepheid Smart Cycler II was th e primary machine used, and is present in our laboratory at the University of Florida. Ho wever, the opportunity occured to use another platform, the Applied Biosystems 7900HT Fast Real-time machine. One drawback of the Cepheid machine for real-time assays is that onl y 16 samples can be tested at one time. This limited the various assays in the ability to r un the known concentrations of plasmid DNA or RNA in duplicate or triplicat e for validation purposes and for quantification of unknown

PAGE 102

102 samples. The ABI machine therefore was very impor tant to run the standards in triplicate. The advantage of the Smart Cycler II is that the mach ine is small, and could ea sily be transported to test samples in the field. The ABI machine has the advantage of increased sample size, up to 96, and the technology uses an extended-life 488 nm ar gon-ion laser to read th e fluorescence of each sample, instead of the high intensity light-emittin g diodes (LEDs) used by the Cepheid machine. These highly sensitive lasers and LEDs may have led to the increased sensitivity of the rRT-PCR over the conventional RT-PCR. Optimization is a very important step in th e development of rRT-PCR assays. If the conditions of the reaction are not optimized, the assay may not be as sensitive or specific for the intended procedure. The conditi ons described above were optim ized for the Smart Cycler II platform used in our laboratory. In the Smart Cy cler II, we found that varying concentrations of the TaqMan probe did not alter the Ct values in this assay (Figur e 3-4). Therefore, 0.24 M of the probe was used in the assay. This probe c oncentration was similar to other rRT-PCR assays (Reid et al., 2007), and suggests th at using a higher concentrati on of the probe may allow for increased detection with low amounts of target vi ral RNA. The concentration of the primers did cause more variation in the Ct values (Figure 33). Very low concentrations, such as 0.05 uM increased the average Ct values and it was found that high primer concentrations caused false positive reactions with no cDNA temp late (data not shown). We th erefore chose an intermediate concentration of 0.2 uM for each primer for the rRT-PCR assay. This was similar to the previously published rRT-PCR assay by Reid et al. (2007). The magnesium ion concentration was also evaluated, and it was determined that an intermediate value was also optimal between 3.5 and 4 mM. Higher Mg seemed to increase the average Ct values (Fi gure 3-2). Previous experimentation and optimization on the ABI mach ine with other calicivirus rRT-PCR assays

PAGE 103

103 revealed that a commercial kit (Stratagene) gave the best results. Time and accessibility to this machine precluded optimizing the reaction conditions, as they were for the Smart Cycler II. All assays run in the Smart Cycler II in our la boratory were two-step, or two-tube assays. The cDNA was synthesized first, and then 2-5 l were added to a second tube containing all reagents for the real-time PCR assay. The adva ntage of this is that the cDNA made for each sample could be used for testing other RNA viruse s in different PCR assays, i. e. coronaviruses, retroviruses, enteroviruses, para myxoviruses, etc. The one-step, or one-tube, assay was run in the ABI machine. This assay may be more sens itive. When serial diluted plasmid DNA was tested in both machines, the ABI platform detected the vira l target down to 101 copies, while the Smart Cycler II was only able to detect 103 copies or more (data not shown). Recently, another rRT-PCR assay was desc ribed for marine vesiviruses (Reid et al. 2007). This assay targeted the polymerase gene, instead of the capsid gene targeted in this report, and failed to amplify SMSV-8 or SMSV-12. These two viral serotypes are distinct from other marine vesivirus serotypes, as specific antisera against thes e viruses do not cross react in immunoassays, while other SMSV serotypes do (Seal et al. 1995a). A set of primers designed for the conventional RT-PCR of marine vesiviruse s also failed to amplify SMSV-8 and 12 (Reid et al. 1999). As mentioned before, both SMSV-8 and SMSV-12 were amplified and correctly identified as marine vesiviruse s in the rRT-PCR assay described here. The region of the capsid gene targeted corresponds to a conserved re gion of the capsid gene (Neill, 1992) and may represent a better target region than the RNA polymerase region ta rgeted in other assays. In summary, a novel rRT-PCR assay has been developed for the detection of marine vesiviruses. The assay successfully amplif ied a 176 nucleotide fragment from a highly conserved region of the capsid gene after reve rse transcription of to tal RNA derived from cell

PAGE 104

104 cultures infected with 12 different marine vesivi ruses. The assay did not amplify closely related terrestrial vesiviruses such as FCV and noroviru ses. The newly developed rRT-PCR assay is 104 to 105 times more sensitive than conventional RT -PCR assays. This novel diagnostic assay can be used as a rapid, sensitive, and specific test to detect marine vesiviruses in clinical samples such as oropharyngeal and rectal swabs and blister fluids.

PAGE 105

105 Table 3-1. Primers and probe designed for the r eal-time RT-PCR described in this section. The TaqMan probe had modified bases known as locked nucleic acids (Integrated DNA Technologies) indicated with a + sign. Table 3-2. Real-time RT-PCR resu lts for various viruses of the Caliciviridae family. Several viral members of this family were tested in the real-time RT-PCR assay to determine the specificity of the primers and TaqMan probe. The cycle threshold value (Ct) is indicated for each virus. A Ct value of 0 indicates a negative result in the real-time RT-PCR assay. a SMSV= San Miguel sea lion virus, SSL= St eller sea lion, FCV= feline calicivirus Name Sequence Length Forward primer CR-792 ATGGCTACTACTCAIACGCT 20 Reverse primer CR-793 CAGTTGAAIGGATCATCACA 20 Probe 6-FAM/A+CCT+CGA A+TTT+CT+CTT/IABlkFQ 16 Virusa Ct value SMSV-1 12 SMSV-2 15 SMSV-4 12 SMSV-5 17 SMSV-6 14 SMSV-8 31 SMSV-12 12 SMSV-13 15 SMSV-14 18 Bovine calicivirus 12 SSL vesivirus V810 16 SSL vesivirus V1415 13 FCV-C01 0 FCV-C46 0 FCV-C58 0 FCVUrbana 0 Mink calicivirus 30 Murine Norovirus-2409 0 Murine Norovirus-K 0 Norovirus GII.1DC56 0 Norovirus GII.4DeFutio 0 Norwalk virus 0 Norwalk viruschimpanzee 0

PAGE 106

106Table 3-3. Comparative sensitivity of diagnostic assays for marine vesiviruses. Two vesivirus isolates from Steller sea lions were tested, V810 and V1415. The one-step real-time RT-PCR assays were tested in the Applied Biosystems 7900 real-time machine. V810 Titer= 109.75 TCID50 ; 1 x 109 PFU/ml 10-1 10-2 10-3 10-4 10-5 10-6 10-7 10-8 10-9 10-10 Cell culturewells with CPE 8/8 8/ 8 8/8 8/8 8/8 8/8 8/8 8/8 8/8 3/8 Plaquesa TNTC TNTC TNTC TNTC TNTC TNTC 75 7 1 0 Conventional RT-PCR + + + + Real-time RT-PCR (RNA) + + + + + + + + + Real-time RT-PCR (Plasmid) + + + + + + + + + + V1415 Titer= 10 8.5 TCID50 ; 6 x 108 PFU/ml 10-1 10-2 10-3 10-4 10-5 10-6 10-7 10-8 10-9 10-10 Cell culturewells with CPE 8/88/88/88/88/88/8 8/88/81/80/8 Plaquesa TNTCTNTCTNTC TNTC TNTC TNTC 44 6 0 0 Conventional RT-PCR + + + + Real-time RT-PCR (RNA) + + + + + + + + Real-time RT-PCR (Plasmid) + + + + + + + + + + a TNTC= too numerous to count

PAGE 107

107 Probe Probe Probe Probe Figure 3-1. Multiple alignment of marine vesivirus sequences. This region represents the highly conserved region of the capsid gene, and was used in the design of primers and probe. The alignment was created with the Mega lign function of the Lasergene software (DNA Star). The location of the forward and reverse primers are indicated with boxes and directional arrows. The location of the TaqMan probe is designated by the shaded box.

PAGE 108

108 Figure 3-2. Optimization of the magnesium ion c oncentration for the real-time RT-PCR assay. Several different concentra tions of magnesium (Mg), ranging from 0.5 to 6.5 mM, were evaluated to determine the optimal Mg concentration for the real-time RT-PCR assay in the Cepheid Smart Cycler II. Th e optimal concentration was determined to be 3.5 to 4 mM, as this value gave the lo west average Ct value for both vesivirus isolates V810 and V1415. Figure 3-3. Optimization of the primer concentr ation. Seven different concentrations of the oligonucleotide primers were evaluated to de termine the optimal c oncentration for the real-time RT-PCR assay in the Cepheid Smart Cycler II. The optimal concentration was determined to be 0.2 uM, as it gave the lowest average Ct value for both viral isolates tested. 15 16 17 18 19 20 21 0.511.522.533.544.555.566.5 Mg Concentration (mM)Average Ct value V810 V1415 13 14 15 16 17 18 19 20 Primer Concentration (uM)Average Ct value V810 V1415

PAGE 109

109 15 16 17 18 19 20 Probe concentration (uM)Average Ct value V810 V1415 Figure 3-4. Optimization of the TaqMan probe con centration. Six different concentrations of the TaqMan probe were evaluated to determ ine the optimal concentration for the realtime RT-PCR assay in the Cepheid Smart Cycl er II. The Ct values did not change significantly with varying amounts of probe assayed. Figure 3-5. Sensitivity of the conventional RT-PCR. RNA was extracted from ten-fold serial dilutions of vesivirus isolates V810 (pan el A) and V1415 (panel B). The RNA was then tested by conventional RT-PCR for th e 176-bp capsid gene fragment targeted in the real-time RT-PCR assay. The target fr agment was only detectable up to the 10-4 dilution for both viral isolates. A. MW 10-1 10-2 10-3 10-4 10-5 10-6 MW 10-1 10-2 10-3 10-4 10-5 10-6 B.

PAGE 110

110 Figure 3-6. Quantitative analysis of the real-tim e RT-PCR assay with plas mid DNA. A) serial dilutions of plasmid DNA containing the 176bp target fragment of the capsid gene for virus isolate V810 performed in triplicat e. The copy numbers of the plasmid are indicated. B) standard curve generated fr om the amplification plot in panel A. A. 101 105 108 107 106 104 103 102 B. y= -3.3x + 44.7, r2= 0.99

PAGE 111

111 Figure 3-7. Quantitative analysis of the real -time RT-PCR assay with viral RNA. A) se rial dilutions of V 810 viral RNA perform ed in triplicate. The copy numbers of the RNA ar e indicated. B) standard curve generate d from the amplification plot in panel A. A. B. 10 8 10 7 10 6 10 5 10 4 10 3 10 2 10 1 y = -3.3x + 46.4, r 2 = 0.99

PAGE 112

112 CHAPTER 4 EXPRESSION AND SELF-ASSEMBLY OF VIRUS-LIKE PARTICLES FROM TWO MARINE VESIVIRUSES AND THEIR USE IN A DIAGNOSTIC ENZYME LINKED IMMUNOSORBENT ASSAY Introduction The viral members of the Vesivirus genus, family Caliciviridae infect both marine and terrestrial hosts (Smith & Boyt, 1990). The vesiviruses are restrict ed viruses due to their ability to cause vesicular disease in livestock, with clin ical signs indistinguishable from those caused by foot-and-mouth disease virus and special USDA-APHIS permits are required to handle these viruses in the laboratory or obtai n them from another laboratory. Due to these restrictions, the viruses cannot be easily shared among laboratories, and working w ith the infectious viruses can be difficult. The availability of non-infectious viral antigens would be very useful for further study of the vesiviruses, to have reagents that could be shared among laboratories, and for use as an antigen for the development of diagnostic assa ys. A virus-like partic le (VLP) is an empty capsid of a virus that resembles the capsid of the native virus, but does not contain any nucleic acid (Noad & Roy, 2003). The VLPs are a relativ ely new technology used for the production of vaccines, and used to study the morphology and phys ical properties of viruses. The VLPs are useful because they mimic the natural structur e of the virus and are recognized by the hostÂ’s immune system, the same way infectious vesiviru ses are. More than 30 viruses of humans and animals have been used to produce VLPs. Thes e include caliciviruses, poliovirus, Hepatitis B and C, several retroviruses, including HIV, Newc astle disease, influenza A, bluetongue virus, parvoviruses, circoviruses, and the papillomavi ruses (Noad & Roy, 2003). Currently, the most successful VLP vaccines are for human papilloma virus (HPV), types 16 and 18, the main causes of human cervical cancer (Lowy & Schiller, 2006 ; Stanley, 2006). The caliciviruses make good

PAGE 113

113 candidates for production of VLPs because the capsid gene self-assembles into VLPs when expressed in eukaryotic systems (Jiang et al. 1992). Several different systems are available for protein expression; the main systems currently used include bacterial, baculovirus, and yeas t expression. The baculovirus and yeast systems have the advantage of being eukaryotic expr ession systems, so the proteins are posttranslationally modified, and are folded and glyc osylated, similar to the native proteins. The most common baculovirus expression system corresponds to Autographa californica nuclear polyhedrosis virus (AcNPV). The expression of the gene of interest is under the control of the very active and strong polyhedron promoter, so high levels of proteins ar e expressed. Tags can also be added to the plasmid to make purification of the expressed protein easier. This virus is only infectious to insects, so th ere is little or no human health risk in working with recombinant baculoviruses (Kost et al., 2005). The yeast expression system is another widely used eukaryotic expression system with many advantages similar to the baculovirus expression system (Yin et al., 2007). The recombinant yeast cells achieve high culture density and produce very large quantities of protein. One advantage of this syst em over the baculovirus system is that the gene of interest is integrated into the genome of the yeast, not a recombinant virus. This eliminates the possibility of reversions and time-consuming pr ocesses of removing wild-type viruses. This system also eliminates the need for cell culture, also a time-consuming process. The development of expression systems to pr oduce recombinant proteins or VLPs were important for the human caliciviruses because th e viruses cannot be grown in cultures (Ball et al. 1999). The VLPs produced in baculovirus expr ession systems can be used to analyze the morphology of the capsid, develop diagnostic test s, in sero-epidemiol ogic studies, and more recently as vaccines. The first calicivirus that was used in an expression system to produce

PAGE 114

114 VLPs was Norwalk virus (Jiang et al. 1992). The subgenomic cDNA, which encodes both ORF2 and ORF3 were expressed in a baculovirus expression system. The VLPs were used as a vaccine to immunize mice, rabbits, and guinea pigs and all three sp ecies produced antibodies that were highly reactive with native Norwalk virus by ELISA and immunoprecipitation assays. Ball et al. (1999) reported several adva ntages of VLPs as components of an efficient mucosal vaccine against human caliciviruses 1) th e capsid contains 180 copies of a single protein, 2) the VLPs are very stable at low pH, like that found in the stomach, and 3) VLPs are particulate and may target PeyerÂ’s patches in the gastrointestinal tract. A VLP vaccine was created in a baculovirus expression system and used in a phase I tria l for protection against Norwalk virus (Ball et al. 1999). Animal caliciviruses in the Lagovirus genus have also been e xpressed to produce VLPs in the baculovirus expression system from rabbit hemorrhagic disease virus (RHDV). These VLPs were found to be indistinguishable from the native virus both physica lly and immunologically (Laurent et al. 1994; Sibilia et al. 1995). For the vesiviruses, the hypervariable region of the capsid gene, designated region E (Neill, 1992), was shown to contai n the specific virus neutralizing epitopes for feline calicivirus (FCV; Guiver et al. 1992; Milton et al. 1992; Tohya et al. 1997) and for canine calic ivirus (CaCV(Matsuura et al. 2001; Matsuura et al. 2000). Crystallography of the capsid gene of San Migue l sea lion virus (SMSV) and Norwalk virus has shown that the hypervariable region of the capsi d gene forms the protruding arches on the surface of the virion (Chen et al. 2006; Prasad et al. 1999). A bacterial expression system was used to expr ess linear proteins of the virus neutralizing epitopes of CaCV, but these proteins failed to pr oduce neutralizing antibodies when injected into animals (Matsuura et al. 2001). This suggests that systems that make native proteins, with

PAGE 115

115 natural folding, such as in the case of mammalian, yeast, or ba culovirus expression systems are better antigens. However, recombinant proteins of the FCV capsid gene produced in bacterial expression systems were able to elicit th e production of virus ne utralizing antibodies in vitro (Guiver et al. 1992). The vesiviruses have a unique feature of the capsid gene not found in other members of the Caliciviridae. The full capsid gene is translat ed as a polyprotein, of approximately 73 kDa and then cleaved by the viral protease encoded in ORF1 to make the mature capsid protein, designated VP1, of approximately 60 kDa (Carter et al. 1992a; Neill et al. 1991). The CaCV full capsid protein expressed in mammalian cell cu ltures could not be cleaved to produce the 57 kDa mature protein unless the FCV proteinase was present (Matsuura et al. 2000). However, the FCV full capsid and mature capsid protein both produced VLPs using the vaccinia virus MVA/T7 RNA polymerase system (Geissler et al. 1999). FCV VLPs have also been produced using the mature capsid gene in a recombinant myxoma virus (McCabe et al. 2002) and also in the baculovirus expression system (DeSilver et al. 1997; Di Martino et al. 2007). None of the marine vesiviruses of the vesicular exanthema of swine virus species has been utilized for protein expression to produce VL Ps. A recombinant antigen was produced in a bacterial expression system (Kurth et al. 2006a; Kurth et al. 2006b). This antigen, named D3A, was produced in a commercial laboratory from an 882-bp fragment of the capsid gene from San Miguel sea lion virus (SMSV) serotype 5, and the expressed 293 aa peptide was purified. The peptide was reported to be cross-reactive with more than 30 differen t serotypes of marine vesiviruses and has been used to screen sera from bovine (Kurth et al. 2006a) and horses (Kurth et al. 2006b) for vesivirus antibodies.

PAGE 116

116 The ORF3 protein product, VP2, has an unknown function. Because of the basic characteristic of this VP2 protein, it has been proposed to interact with the viral RNA and possibly, to encapsidate the progeny viruses (Neill et al. 1991; Prasad et al. 1999). The VP2 protein has been shown to be a structural protein (Glass et al. 2000; Sosnovtsev & Green, 2000), and is necessary for infection of FCV (Sosnovtsev et al. 2005). This protein has also been expressed in baculovirus expres sion systems together with the mature capsid protein VP1 and shown to increase the level of cap sid expression (Bertolotti-Ciarlet et al. 2003). The VP2 gene also made the VLPs more stable and preven ted degradation of th e protein structure. We have recently isolated and characterized through fu ll genomic sequencing two novel marine vesiviruses from Steller sea lions (SSL). Here, we report the expression of the mature capsid protein, VP1, from the SSL vesiviruses in th e yeast and baculovirus expression systems to produce VLPs. We also expressed the VP1 + VP 2, the ORF3 protein product in the baculovirus expression system to compare the VLPs to those produced from VP1 only. The expressed proteins were used as antigens to develop an enzyme linked immunosorbent assay (ELISA) for the detection of antibodies to mari ne vesiviruses. As far as we know, this constitutes the first report of the expression of VLPs from marine vesiviruses. Materials and Methods Viruses The isolation and characterizat ion of two novel marine vesivi ruses from Steller sea lions (SSL) from Alaska have been described in Chap ter 2. These two virus isolates are designated V810 and V1415 and were used in the expression systems. RNA from the vesiviruses was isolated by TRIzol-LS (Invitrogen, Carlsbad, CA) from infected Vero cell cultures. Briefly, the cell pe llet was lysed with TRIz ol-LS reagent for 10 min, and then chloroform was added for phase separa tion. The aqueous phase was transferred to a

PAGE 117

117 new tube, and the RNA was precipitated with an equal volume of isopropyl alcohol. The RNA was pelleted at 12,000 x g for 10 min at 8C, washed one tim e with 70% ethanol, air dried, and resuspended in RNase-free water. Baculovirus Expression Construction of Recombinant Baculoviruses. Oligonucleotide primers were designed to amplify the mature capsid gene (VP1) from the SS L vesiviruses (Table 4-1). The mature capsid gene is produced after cleavage of the full capsi d protein gene; therefore, there is not a start codon, ATG, within the mature capsid gene. An ATG was engineered into the forward primer for the mature capsid protein gene. The primer s NIH-1 and NIH-2 (Table 4-1) were used to create a fragment of approximately 1680 nucleotides (nt). Separate baculovirus construc ts were also created with the VP1 and the ORF3 protein product, VP2. The forward PCR primer, NIH-1, was the same as the primer for the VP1-only construct, but a second reverse primer, NIH-3, wa s designed to amplify the entire VP1 and the ORF3 product (Table 4-1). The PCR pr oduct was approximately 2170 nt in length. The PCR products were cloned into the Gate way vector, pEntr (Inv itrogen) using Topo cloning. Recombinant plasmids were verified by restriction enzyme digestion and PCR, and then sequenced to confirm the correct gene se quence and insertion. The recombinant plasmid DNA was then recombined with the baculoviru s DNA (Baculodirect, Invi trogen) and PCR was used to confirm that recombination had occurred. Upon successful confirmation of recombination, the baculovirus wa s then transfected into Sf-9 insect cells using Lipofectin (Invitrogen). The Sf-9 insect cells were plated into 6-well plates with a density of 8 x 105 cells per ml in 2 ml per well of HyQ media (HyClone Logan, UT) without feta l bovine serum (FBS), but containing penicillin, streptomycin, and Amp hotericin B (all from Invitrogen). The cells were allowed to attach for 1 h at 28C, and then the medium was removed and replaced with the

PAGE 118

118 transfection mixture. The transf ection mixture consiste d of 250 ng of recombinant DNA, 6 l of Cellfectin (Invitrogen), and GraceÂ’s Medium (I nvitrogen). The transfection mixture was incubated at room temperature for 45 min, and then adsorbed onto the Sf-9 cell cultures for 5 h at 28C. Following incubation, the transfection mixt ure was replaced with 2 ml of HyQ medium containing 100 mg/ml ganciclovir (Invitrogen), as a negative se lection agent, as recombinant baculoviruses contain a resistant gene from herp es virus origin. The transfected cell cultures were incubated at 28C for 5 d and then the cells and supernatant were harvested. This harvested cell culture served as the first passage (P1) vi ral stock. This P1 viral stock was propagated a second time, becoming the P2 viral stock, by infecting Sf-9 cells in 6-well pl ates with five l of the P1 viral stock containing 100 mg/ml ganciclovi r. This P2 stock was incubated for 72 h at 28C and then harvested. The P2 viral stock was then passed once more to create a P3 viral stock, just as the P2 viral stock was create d, except that ganciclovir was no longer used. The P3 viral stock was titrated by plaque assay on Sf-9 cell cultures in 6-well plates. The insect cells were plated at 8 x 105 cells per well, and allowed to at tach for 1 h at 28C. The cell culture medium was removed and replaced with 0.5 ml of 10-fold serial dilutions of the P3 viral stock in duplicate. The dilutions were adsorbed for 1 h at 27C and then replaced with a 1% agarose overlay. The plates were incubated for 5 d at 28C, and then stained with a 1 mg/ml neutral red solution (Invitrogen). Viral plaques for duplicate cultures were counted and used to determine the titer for each P3 viral stock re ported as plaque forming units (PFU) per ml. Protein Purification. Recombinant viruses were propaga ted in tissue culture flasks and five d post-infection the entire culture (150 ml ) was harvested, cycled through two freeze-thaw cycles at -70C, and centrifuged to separate the cells from the supernatant. The supernatant was purified first through a 25% sucrose cushion in an SW28 rotor at 24,000 rpm for 4 h at 10C.

PAGE 119

119 The resulting pellets were resuspended in PBS, combined, and then further purified through a cesium chloride (CsCl) gradient. The sample s were mixed in equal volumes with 1.6 g/cm3 of CsCl. The final density was 1.38 g/cm3 as checked by a refractometer. The samples were subjected to ultra-centr ifugation in a SW55Ti rotor at 48,000 rp m for 18 h at 15C. The protein band was extracted with a needle and syringe and dialyzed against PBS to remove the CsCl using a Slide-A-Lyzer cassette (Pierce, Rockford, IL). The dialyzed proteins were quantified using a Bradford assay with a commercial kit and know n bovine serum albumin standards (Pierce). The SDS-PAGE and western blotting. The protein samples were mixed with sample loading buffer containing 2% sodium-dodecyl sulfate (SDS), 0.5 M Tris-HCl, pH 6.8, 25% glycerol, 0.5% bromophenol blue, and 2% beta-mercaptoethanol, he ated at 95C for 5 min. The proteins were resolved by SDS polyacrylamide gel electrophoresis (S DS-PAGE) in duramide 420% gradient gels (Lonza, Basel, Switzerland) run at 125 V for 1.5 h with a protein standard (Invitrogen). At the end of th e run, the protein gel was blotte d onto a polyvinylidene difluoride (PVDF) membrane (Invitrogen) fo r 7 min using the iBlot Gel Tr ansfer Device (Invitrogen). Following blotting, the protein gel was then stained with Gel code Blue (I nvitrogen) to stain the remaining proteins. The membrane was blocked for 1h at room te mperature in 5% Blotto (milk in phosphatebuffered saline). The membrane was then incu bated with a mixture of specific polyclonal antiserum against SMSV serotypes (SMSV-1, 2, 4, 5, 6, 9, 10, 11, and 13) diluted 1:2000 in 5% Blotto and incubated for 1 h on the shaker table, and then overnight at 4C. The membrane was washed four times, for 5 min each time, with Western Breeze wash buffer (Invitrogen). The secondary reagent, goat antirabbit-alkaline phosphatase (P ierce), was diluted 1:1,000 in blocking buffer for 1 h on a shaker table at room temperature. The membrane was washed four

PAGE 120

120 times for 10 min each time. The substrate BCI P/NBT (Zymed lab, South San Fransisco, CA) was then added and incubated for 5 min at ro om temperature with shaking. The substrate reaction was stopped with water and the membranes were photographed. Yeast Expression Construction of recombinant yeast. The mature capsid protein, VP1, was also expressed in a yeast expression system using a commercia l kit (New England Biol abs, Ipswich, MA) for comparison to the baculovirus expressed proteins The primers for the yeast expression system incorporated restriction endonuc lease restriction sites for un idirectional cloning into the appropriate expression vector. The forward primer (CR-836) has an XhoI site, and the reverse primer (CR-837) has a NotI restriction site. The targeted capsid gene, VP1, was amplified by RT-PCR using proofreading enzymes to minimize mistakes, and then gel purified from a 1% agarose gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Valencia, CA). The cleaned PCR products and the expression plasmids we re digested with the appropriate restriction enzymes in the presence of bovine serum albu min (BSA) for 2 h at 37C. The digestion reactions were then purified using a commercial kit (QIAquick PCR purifi cation kit, Qiagen) and ligated overnight at 14C with 1 U of T4 D NA ligase (Invitrogen). The ligated DNA was then used to transform competent Top 10 E. coli cells (Invitrogen) and plat ed on 2XYT agar plates containing ampicillin to select recombinant plas mids. Colonies were grown overnight at 37C, and then single colonies were picked and grown overnight with shaking in liquid cultures of 2XYT at 37C. The overnight cultures were an alyzed for recombinant plasmids by restriction digest and PCR. Following the confirmation of a recombinant pKlac vector with the capsid gene by restriction digest, the plasmi d was sequenced to confirm the correct nucleotide sequence of the capsid gene.

PAGE 121

121 Following sequencing of the mature capsi d VP1 gene in the pKlac vector, the recombinant plasmid was used to transform Kluyveromyces lactis competent yeast cells (New England Biolabs). The recombinant plasmid was linearized with the SacII enzyme overnight at 37C. The linearized vector was cleaned with a commercial kit (QIAquick PCR purification kit, Qiagen) and then added to competent K. lactis yeast cells with the provided transformation reagent. The transformation reaction was incuba ted at 30C for 30 min, heat shocked at 37C for 1 h, and then 1 ml of YP Glucose media was ad ded. The reaction was incubated at 30C for 30 min with gentle shaking at 200 rpm. The yeast cells were pelleted at 7,000 x g for 2 min and the supernatant was removed. The yeast cells were ge ntly resuspended in 1 ml of sterile water and 10, 50, and 100 l were plated on three YCB ag ar plates containing 5 mM acetamide for negative selection. Only recombinant yeast cells can use acetamide as their nitrogen source. The plates were incubated at 30C for 4 d. Indi vidual yeast colonies were picked and streaked onto a second YCB agar plate c ontaining acetamide and incubated for 2 d at 30C to obtain a lawn growth of the single colony. Integration assay. To test for integration of the ca psid gene into the yeast genomes, a PCR assay was utilized. An approximately two-mm2 area of each lawn growth was picked with a sterile toothpick and added to a PCR tube. Twenty-five l of a zymolase (Seikagaku Corporation, Tokyo, Japan) soluti on, 1 mg/ml in 30 mM sodium phosphate buffer, were added to each of the tubes. Zymolase is an enzyme that breaks down the yeast cell walls and is necessary to release the yeast DNA and proteins. The samp les were incubated with the zymolase enzyme for 1 h at 25C, and then 96C for 10 min. This pr eparation was then added directly to 75 l of a PCR mastermix to test for integration of the capsi d gene. The PCR master mix consisted of 5 l of each dNTPs (10 mM), 10 l of each Primer 1 a nd Primer 2 (Table 4-1) supplied with the kit,

PAGE 122

122 and 1 U of Taq polymerase. The PCR program for th e integration test consis ted of 30 cycles of 94C for 30 s, 50C for 30 s, and 72C for 3 min, and a final elongation step at 72C for 10 min. The PCR products were run in a 1% agarose ge l and visualized under UV transillumination. A yeast cell that contained the integrated gene of interest yielded a 1.9 Kb PCR product. Large scale yeast production. For the yeast plates verified by PCR to contain the integrated capsid gene, another approximately 2-mm2 area of each lawn growth was used to inoculate a broth of YPGal media. The tube was incubated on a slanted platform at 30C for 2 d on an orbital shaker. This 2 d culture was then stor ed at 4C and used to i noculate larger cultures for protein expression. Several 500 ml cultures of YPGl u medium were inoculated w ith 5 ml of 2 d cultures of recombinant yeast cells and negative control yeas t cells. The cultures we re incubated at 30C with shaking at 250 rpm for 14 d. Each day, a 50 ml aliquot of each culture was harvested. The sample was centrifuged at 3,000 x g for 10 min to separate the cel ls from the supernatant, and each was stored at -70C until further use. The cell pellets from the 14 d cultures were lysed with Zymolase for 1 h at room temperature to disrupt the yeast cell wall and then further disrupted by breakage with glass beads (Sigma, St. Louis, MO). One g of beads was added to each cell pellet, and the sample was vortexed for 30 s, and then place on ice for 30 s. This cycle was repeated 10 times. The SDS-PAGE protein analysis. The yeast samples were resuspended in sample loading buffer containing 2% SDS, 0.5 M Tris -HCl, pH 6.8, 25% glyc erol, 0.5% bromophenol blue, and 2% beta-mercaptoethanol heated to 95C for 5 min and resolved by SDS-PAGE. The 12% Bis-tris gels (Invitrogen) were run at 200 V for 1 h with a protein standard (Invitrogen). The protein gel was then stained for 1 h with Coom assie blue to stain all proteins, and destained

PAGE 123

123 overnight on a shaker table with a solution c onsisting of 10% acetic acid and 15% methanol. The stained gel was then photographed. Immunoprecipitation. An immunoprecipitation (IP) as say was used to separate the expressed viral proteins from the other proteins in the yeast expr ession system. Cell lysates were diluted 1:2 in an IP buffer containing 50 mM Hepes buffer, 22.5 mM NaOH, 100 mM NaCl, and 1% Triton X-100. Specific antibody against SMSV-5 was then diluted 1:10 in TBS and added to each sample. The sample was incubated for 2 h at room temperature with gentle agitation on a shaker table. Protein A-sepharose beads (Invitr ogen) were washed three times in IP buffer and 50 l of the bead slurry was added to each sample The samples were incubated for 2 h with gentle agitation at room temperature. The beads were then pelleted at 8000 x g for 1 min, and washed three times with IP buffer to remove any non-specific proteins and debris. Western blotting. Following the IP, the yeast sample s were separated by SDS-PAGE, as described above. The protein gel was blotted onto a PVDF membrane (B io-Rad, Hercules, CA) at 30V for 1 h, and then blocke d overnight at 4C while shaki ng in blocking buffer (5% non-fat powdered milk in tris-buffered saline containi ng 0.1% Tween-20 [TBST]). The membrane was washed four times with TBST and incubated with specific polyclonal an tiserum against one of the SMSV serotypes (SMSV-1, 2, 4, 5, 6, 9, 10, 11, or 13) diluted 1:200 in blocking buffer for 1 h at room temperature on a shaker table. The membrane was washed four times for 10 min with TBST. The secondary reagent Native IgG (Pie rce, Rockford, IL), diluted 1:10,000 in blocking buffer, was added and incubated for 1 h on a shaker table at room temperature. The membrane was washed four times for 10 min each and the chemiluminescent substrate Immobilon Western Chemiluminescent horseradish peroxidase (HRP) su sbtrate (Millepore, Billerica, MA) was added to the membrane and incubated for 5 min at ro om temperature without shaking. The membrane

PAGE 124

124 was finally exposed to chemiluminescent film (Roche, Indianapolis, IN) and the film was developed. Electron Microscopy Electron microscopy was used to visualize the VLPs from the baculovirus and yeast expression systems. The purified proteins were spotted onto Formvar-coate d grids, stained with phosphotungstic acid (PTA), blotted dry, and examined with a FEI Tecnai 12 electron microscope. Enzyme Linked Immunosorbent Assay The VLPs produced from recombinant baculoviruses expressing the mature capsid protein VP1 of vesivirus isolates V810 and V1415 were used as viral antigens in newly developed ELISAs. The V810 and V1415 VLPs were tested separately. Antigens were diluted in carbonate-bicarbonate buffer (Sigma) to a final concentration of 1 g/ml. This concentration was determined to be optimal based on a check erboard titration of each antigen with positive sera. One hundred l of each antigen were adsorbed overnight at 4C per well of 96-well MaxiSorp polystyrene plates (Nunc, Roskilde, De nmark). The plates were washed once with 100 l wash buffer (TBST), and 200 l blocking buffer (5% milk diluted in TBST) were added to each well and the plates were incubated for 1 h at 37C. Rabbit polyclonal antibody against various SMSV serotypes or serum collected from wild SSL from Alaska (primary reagent) were diluted 1:50 in 1% non-fat dry milk in TBST. One hundred l of the 1:50 dilution of each antibody was added to the first colu mn, and 50 l of 1% milk in TB ST (diluent) was added to all other wells in the plate. Then each antibody samp le was serially diluted 2-fold across the rows of the plate by transfer of 50 l of the previous dilution to the next well. The highest dilution tested was 1:25,600. Each serum sample was also te sted in at least two blank wells (no antigen wells) to determine the background of the serum sample. The plate was incubated for 1 h at

PAGE 125

125 37C and subsequently washed six times with TBST wash buffer. The secondary reagent, Protein A-peroxidase (0.5 mg/ml, Pierce, Rockford, IL) was diluted 1:3000 in blocking buffer, 100 l was added to each well, and the plate was incubated again at 37C for an additional h. The substrate, ABTS (2,2Â’-azino-bis 3-ethylbenzt hiazoline-6-sulfonic acid; Kirkegaard & Perry Laboratories, Gaithersburg, MD), in 100 l quantities, was then added to each well and the plate was incubated for 30 min at room temperature. The absorbance of each reaction in the 96-well plate was read at 405 nm on a Synergy pl ate reader (Bio-Tek, Winooski, VT). Serum and plasma samples tested in this ELISA platform have been collected from freeranging marine mammals. These included SSL, California sea lions (CSL), and harbor porpoises, all from the Pacific Coast of the United States. The SSL serum samples included 41 serum samples from southeastern Alaska collected in 2004 and 16 SSL serum samples from the Aleutian Islands, Alaska, collected in 2005. F our CSL samples were obtained from animals brought to rehabilitation centers in California, and two harbor porpoise plasma samples were collected from stranded animals from Alaska. H yperimmune sera specific for the various SMSV and VESV serotypes ( kindly provided by Dr. J ohn Neill from USDA-APHIS, Ames, Iowa) were also tested for their reactivity in this ELISA platform. These reagents included sera specific for SMSV-1, 2, 4, 5, 6, 7, 9, 10, 11, and 13, and VESV-A48, B51, C52, D53, E54, F55, G55, H54, I55, J56, K54, and 1934B. Other hyperimm une sera against members of the Caliciviridae were also tested for cross-reactivity with the marine vesivirus VLPs. These in cluded feline calicivirus (FCV) and mink calicivirus (MCV), both members of the Vesivirus genus, and serum against Norovirus VLPs. Each serum sample was clarified at 10,000 x g for 3 min prior to testing in the ELISA.

PAGE 126

126 A serum sample was considered to contain antibodies to marine vesiviruses (positive serum) if two criteria were met, 1) the corrected absorbance values were 0.2 or greater, and 2) if the index was greater than 2.0. The absorbance ob tained from the blank wells (no antigen) was considered the background, and was subtracted from the corresponding abso rbance of the wells containing antigen to give the corrected absorban ce value. Each serum sample was tested in triplicate in the blank wells. The index was calculated by dividing the absorbance obtained in the antigen wells by the blank well (no antigen). The titer for each serum sample was reported as the reciprocal of the highest serum dilution that was positive by the two criteria above. This protocol and cutoff values were modeled af ter conventional ELISA techniques, and other calicivirus ELISAs (Barajas-Rojas et al. 1993; Crowther, 2001; Ferris & Oxtoby, 1994; Kurth et al. 2006a; Kurth et al. 2006b). Results Baculovirus Expression of Ve sivirus Virus-Like Particles Recombinant baculoviruses containing geneti c material from SSL vesiviruses V810 and V1415 were constructed by inserting the approx imately 1680-bp fragment of the VP1 gene of these vesiviruses. A third recombinant bacu lovirus was constructed by insertion of the approximately 2170-bp fragment of VP1 + VP2 of SSL vesivirus V810. These recombinant viruses were passed three times in Sf-9 cell cultures in the pres ence of ganciclovir for negative selection. The recombinant viruses were titrated in a plaque assay and the titers were found to be 2.3 x 107 PFU/ml for V810 VP1, 2.5 x 107 PFU/ml for V1415 VP1, and 3.0 x 107 PFU/ml for V810 VP1 + VP2. Each of the three recombinant baculoviruses wa s used to infect 150 ml cultures of Sf-9 cell cultures at an multiplicity of infection (MOI) of 3. Each day a 500 l sample was collected and the cell viability was monitored. The cell viability started at 95% prior to infection and dropped

PAGE 127

127 every day until day 5, when the cell viability was only 30% in all three infected cell cultures. Daily samples collected on days one through fi ve were analyzed by SDS-PAGE for protein expression. An approximately 60 kDa protein was apparent in ex tracts from the infected cell pellets and supernatants harveste d from all three recombinant bacul oviruses, but not in the mock infected cell controls (Figure 4-1, Panels A-C). Degradatio n products of the 60 kDa protein are also apparent, most likely due to prot einase degreation of the capsid protein. The five-day cultures were frozen and thaw ed twice, and then clarified by low speed centrifugation. The supernatants were then purified, first through a 25% sucrose cushion followed by ultracentrifugation in an isopycnic self-generating CsCl gradient. A distinct protein band with a density of 1.29 g/cm3 was evident in the upper half of the CsCl gradients. Following dialysis of the harvested protein bands, the sa mples were analyzed by SDS-PAGE (Figure 4-1). An approximately 60 kDa protein, consistent with those of other calicivirus capsid genes, was evident in the case of recombin ant baculoviruses (Figure 4-1, Pa nel D). An approximately 65 kDa protein band was apparent in the V810 a nd V1415 positive control viruses. This band represents the fetal bovine serum used in the Vero culture media to grow these viruses (Figure 41, Panel D). The daily harvested cell samples and the purifie d proteins were anal yzed by Western blot using a mixture of type specific antibodies agai nst SMSV serotypes. A band of approximately 60 kDa was visible in the daily coll ections of cell pellets and supe rnatants (Figure 4-2, Panels AC). The protein band purified from the CsCl gradient also containe d the 60 kDa protein band and seemed to be of the same size as the native pr otein extracted from Vero cell cultures infected with SSL vesiviruses V810 and V1415 (Figure 4-2, Panel D). Some smaller molecular weight bands, presumably from protei n degreation, were apparent.

PAGE 128

128 Negative staining electron microsco py revealed VLPs consistent with the size and shape of native calicivirus virions in pur ified protein samples from all three recombinant baculoviruses (Figure 4-5). The VLPs from the V810 VP1+ VP2 show the distinct cup-like depressions characteristic of the Caliciviridae family. Yeast Expression of Vesivirus Virus-Like Particles Expression of VLPs in the yeast system wa s only attempted for the capsid gene of vesivirus isolate V810. The approximately 1650bp VP1 gene was amplified by PCR (Figure 43, Panel A). This PCR product was cloned into the pKlac vector by unidirectional cloning and sequenced to confirm the correct inserted VP1 se quence. Successful recombination of the VP1 plasmid and the K. lactis yeast was confirmed by the pres ence of a 1.9 Kb fragment by PCR (Figure 4-3, Panel B). The yeast cells collected from the 14 d of pr otein expression experiments were lysed with Zymolase enzyme and disrupted by glass beads. The samples were clarified and harvests from days 1, 5, 10 through 14 from the recombinant yeas t, and day 7 from the control yeast were analyzed by SDS-PAGE (Figure 44, Panel A). Many proteins were present in the control and recombinant yeast samples. A band of approxima tely 60 kDa appeared in the recombinant yeast cell samples; however, because of the abundance of many other proteins, it was difficult to determine unambiguously the presence of the spec ific 60 kDa band from y east cellular proteins. To attempt resolving the potential ve sivirus protein, the cell lysates were immunoprecipitated with a specifi c anti-SMSV sera. The precip itated proteins were then analyzed by western blot and a protein of a pproximately 60 kDa consistent with the native protein of isolate V810 was visible on days 13 and 14 (F igure 4-4, Panel B). The crude lysates and sucrose purified yeast samples were processed by negative staining and screened by electron microscopy. Some round structures of approximately 30 nm were

PAGE 129

129 visualized in the yeast lysate s after 4 d of expression (Figur e 4-6, Panel A). “Lattice-like” structures were also visible in the sucrose pur ified yeast samples from the 14 d cultures (Figure 4-6, Panel B), but not in the cont rol yeast cells. VLPs consiste nt with the size and shape of native virions were not seen in the recombinant yeast samples. Enzyme Linked Immunosorbent Assay Specific antiserum against several SMSV serotypes, other viral members of the Caliciviridae family, and sera collected from free-rang ing SSL in Alaska were tested in the newly developed ELISA platform using antigen in the form of VLPs that represent the capsid protein of SSL vesivirus isolat es V810 and V1415. We also tested serum samples from one captive SSL, and two wild harbor porpoises from Alaska, and four wild California sea lions (CSL) from California. A serum was considered positive if the corrected absorbance values were greater than 0.2 and if the index was 2.0 or greater. The blank we ll reactions (no antigen) generally had absorbance values of 0.1 or less. Each serum sample was tested in triplicate blank wells for background subtraction. The titers for each serum sample tested are reported in Table 4-2. A total of 92 different serum samples were tested in the ELISA for antibodies and sera were found to react with the VLP antigens. The titers of the positive SSL sera ranged from <50 to 12,800 (Table 4-2). Sera with titers <50 were considered negative. A few serum samples in the blank wells (no antigen) had absorbance valu es greater than 0.1, indi cating that some sera could potentially give false positive results. Th ese findings should be addressed and resolved by incorporating blank wells (no antigen) for each serum sample being tested. Rabbit hyperimmune sera prepared against se veral SMSV and VESV serotypes were found to be cross-reactive with the VL Ps from SSL vesiviruses V810 and V1415. The titers were very high, and ranged from 200 to greater than 25,600. Specific antisera against other members of the

PAGE 130

130 Vesivirus genus were tested including FCV and MCV, and both were found to be cross-reactive with the SSL vesivirus VLPs (Table 4-2). The FCV titer was >25,600 and the MCV titers were 800 and 1600 for the V810 and V1415 VLPs, re spectively. The serum against the Norovirus VLPs were only slightly cross-r eactive, with titers of 800 and 6,400 to the VLPs (Table 4-2). This could be a result of cross reactivity with pr oteins made in the baculovirus system, and our vesivirus VLPs may not cross-reac t with serum from animals naturally infected with noroviruses. Discussion The capsid gene of the SSL vesiviruses was chosen for protein expression because the capsid is the most abundant gene produced durin g viral infection, as ea ch virion contains 180 copies of the capsid gene, and the calicivirus capsi d gene self-assembles into VLPs in eukaryotic expression systems (Di Martino et al. 2007; Jiang et al. 1992; Laurent et al. 1994). The VLPs are nearly indistinguishable from the native virions, and therefore have the potential for serving as non-infectious antigens for diagno stic and vaccine manufacturing (Ball et al. 1996). In a natural calicivirus inf ection, the most abundant antibodies ar e produced against the capsid gene, and most of these antibodies ha ve neutralizing activity (Guiver et al. 1992; Matsuura et al. 2001; Neill et al. 1991; Tohya et al. 1991). VLPs consistent with the size and shape of the vesivirus virions were produced in the baculovirus expression system containing the VP1-only gene fragment and both VP1 and VP2 gene sequences. Previous experiments with norovi ruses indicated that VLPs expressed with the ORF2 and ORF3 have increased production of VLPs with increased stability (Bertolotti-Ciarlet et al. 2003). It appears that the V810 vesivi rus VLPs produced with both VP1+VP2 genes exemplifies the traditional “cup-like” morphology, while the VP1-only constructs do not (Figure 4-6). No stability experiments of the two di fferent VLPs were performed here and further experimentation may reveal structural or stability advantages to co-expressing VP1 + VP2.

PAGE 131

131 The yeast expression system failed to produce VLPs, although a protein of approximately 60 kDa, consistent with the mature capsid protein, was apparent in western blot analysis (Figure 4-4). There were “lattice-like” structures visibl e by EM in the yeast cell lysates after 13 to 14 d of culturing (Figure 4-6). These structures may represent the earl y formation of capsid subunits, which were unable to completely form the VLPs The HPV vaccine, Guardisil (Merck and Co.), uses a yeast expression system with Saccharomyces cerevisiae to produce the VLPs of HPV genotypes 6, 11, 16 and 18 to protect young women agai nst certain forms of genital and cervical cancer. Due to proprietary constraints, comp lete protocols are not published for the VLP production or the complete purification of the v accine. The scantly published reports describe VLP release from cells through freeze-thaw cycl es and homogenization. The cell debris is pelleted, and the supernatant is placed onto a cesium chloride gradient for banding of the VLPs (Hofmann et al. 1995; Koutsky et al. 2002). The expression system used here, K. lactis (New England Biolabs) uses a new and incompletely studied yeast strain system that ma y not be suitable for the production of VLPs. It is also likely that proteins produced in the yeas t cells were trapped in the Golgi apparatus (NEB technical support personal communication), and this may have prevented the formation of VLPs. There was also the problem associated with the ha rdiness of the yeast cell walls that made lysing or breaking the yeast a very challenging exercise. Also, the K. lactis yeast cells are very small, and difficult to see under the light microscope which makes evaluation of the thorough lysis procedure difficult. We have successfully developed a novel ELISA platform using recombinant VLPs produced in the baculovirus expr ession system. Specific antisera against various serotypes of marine vesiviruses were crossreactive with the VLPs produced from SSL vesiviruses V810 and

PAGE 132

132 V1415 genes. These findings indicate that these VLPs can be used as antigens for the detection of antibodies to any of the marine vesiviruses, re gardless of the serotype involved. Our data with the SSL sera collected in 2004 and 2005 indicate that this assumpti on is correct. Each of these 57 SSL sera was tested both by VN against vesivi ruses V810 and V1415, and by ELISA against the VLPs produced by recombinant baculoviruses carrying genes from isolates V810 and V1415 separately. There was clearly a difference in the range of reactiv ity by SSL sera assayed in the ELISA and some sera with negative VN titers were found to have positive titers by ELISA (Table 4-2). This apparent discrepancy most lik ely indicates the specifici ty of the VN assays for isolates V810 and V1415 and the wider cross-re activity of the VLPs w ith antibodies against SMSV serotypes other than that against isolat es V810 and V1415. These results also indicate that marine vesiviruses serologi cally distinct from isolates V 810 and V1415 are still circulating in free-ranging SSL populations in Alaska waters. The SSL serum samples from the Aleutian Isla nds in 2005 were generally negative, with titers lower than 50. This finding most likely indicates that these animals had not been previously exposed to marine vesiviruses. The SSL serum used in this ELISA has been stored at 4C for approximately two years, which may ha ve an impact on the results. Fresh serum samples may provide different resu lts. Although both the VN assay and the ELISA platform rely on using good quality sera, uncontaminated with microbial agents and preferably not frozen more than a few times, it is recommended that fr esh sera should be used for these assays for reliable results. Interestingly, we tested the V810 VLPs a nd V1415 VLPs mixed together as one single antigen in an ELISA. We found that the second ary reagent, protein A-peroxidase bound to the mixed VLPs in the absence of se ra. This indicates that the VL Ps must bind together and undergo

PAGE 133

133 a conformational change that pr otein A binds to. This “synergis tic” effect of the mixed VLPs would cause false positive results, and therefore the two antigens must be tested separately. Further analysis of the mixed VLPs would be important to determine why and how these VLPs are binding to each other, and the changes it causes in the proteins. A previously described ELISA for marine calic iviruses was found to be specific for each viral serotype tested, with lit tle to no cross-reactivity (Ferri s & Oxtoby, 1994). This ELISA was designed as an antigen capture assay, which is different from the ELISA platform described in our work, in which the main use is the detec tion of antibodies. The authors acknowledged that the narrow specificity may indicate serious shor tcomings of that ELISA for diagnostic purposes. Our ELISA assay was found to be cr oss-reactive in the detection of calicivirus antibodies. The major difference of an antigen capture ELISA is th e coating of the wells with specific antibodies while for the detection of serum antibodies, the we lls are coated with an tigen. Thus, a direct comparison of these two assays is not possible. A more recently described ELISA for the detection of antibodies against marine vesiviruses uses a bacterial expresse d peptide, D3A, as antigen (Kurth et al. 2006a; Kurth et al. 2006b). This assay was described to be cross-reactive with mo re than 30 different marine vesivirus serotypes, which is similar to the cr oss-reactivity of our ELISA platform described here. A potential drawback of th e D3A antigen ELISA is that bact erially expressed peptides may also be contaminated with bacterial proteins and the described cross-r eactivity may represent reactivity to these bacterial proteins and not to the vesivirus antigens. In summary, we report for the first time, the development, expression and production of VLPs of marine vesiviruses from recombinant ba culoviruses, in which either the mature capsid gene VP1 or both VP1 and VP2 sequences had been introduced. These VLPs were consistent in

PAGE 134

134 appearance with native virions both in size and structure, and were successfully used to develop a diagnostic ELISA for the detec tion of vesivirus antibodies. This novel ELISA platform was used in the detection of serum antibodies to many different serotypes of ma rine vesiviruses, and will be a very useful diagnostic assay to identify animals previously exposed to marine vesiviruses. It will also make possible for the first time, the mass screening of marine mammals for infection with vesiviruses in sero-epidemi ological studies both in the north Pacific Ocean waters, known to be a natural habita t of these viruses as well as in the Atlantic Ocean and Gulf of Mexico waters in which marine vesiviruses are not known to exist. Since VLPs are not infectious in nature and marine vesiviruses are restricted agents as they may cause clinical signs in livestock indistinguishable from foot-and-mout h disease, the VLP antigens could be used in conventional virology laboratories to monitor the potential emer gence of marine vesiviruses anywhere in U.S. territory.

PAGE 135

135Table 4-1. Primer sequences used for cloning and expres sion of the Steller sea lion vesiviruses V810 and V1415. Primer Sequence Product Product length (bp) Sense Source CR-836 CTCCTCGAGAAAAGA ATG TCGGATGGTCCAGG VP1 1650 + This dissertation CR-837 CTCGCGGCCGCAGTCCAAAA TTTGCATAATTCA VP1 1650 This dissertation Primer 1 TACCGACGTATATCAAGCCCA Inte gration 1900 + New England Biolabs Primer 2 ATCATCCTTGTCAGCGAAAGC In tegration 1900 New England Biolabs NIH-1 CACC ATG TCGGATGGTCCAG VP1 1680 + This dissertation NIH-2 TCCAAAATTTGCATAATTCAT VP1 1680 This dissertation NIH-3 GCAACCTACCAATTAAC TAATTC VP1 + VP2 2170 This dissertation

PAGE 136

136 Table 4-2. Antibody titers obtai ned by virus neutralization (VN) using infectious virus and enzyme linked immunosorbent assay (ELISA) using recombinant VLPs as antigen. Specific antisera to various marine vesiviruses (SMSV) and vesicular exanthema of swine virus (VESV), as well as antisera to FCV, Norovirus and sera from freeranging marine mammals including Steller sea lions (SSL) and California sea lions (CSL) were assayed by VN and ELISA as desc ribed in this Chapter. The VN titers were previously determined and described in Chapter 2. a ND= not done Serum sample V810 VLP ELISA Titer V810 VN TiteraV1415 VLP ELISA Titer V1415 VN Titera SMSV-1 6400<43,200<4 SMSV-2 12800<46,400<4 SMSV-4 3200<43,200<4 SMSV-5 >25600<4>25,600<4 SMSV-6 200<4200<4 SMSV-7 >25600<4>25,600<4 SMSV-9 6400<46,400<4 SMSV-10 12800<46,400<4 SMSV-11 6400<46,400<4 SMSV-13 >25,600<4>25,600<4 VESV-A48 800<41,600<4 VESV-B51 3,200<43,200<4 VESV-C52 6,400<4>25,600<4 VESV-D53 >25,6004>25,6004 VESV-E54 6,400<412,800<4 VESV-F55 1,600<43,200<4 VESV-G55 12,800<412,800<4 VESV-H54 12,800<412,800<4 VESV-I55 12,800<412,800<4 VESV-J56 3,200<43,200<4 VESV-K54 3,200<43,200<4 VESV-1934B >25600<4>25,600<4 Feline calicivirus >25,600ND>25,600ND Mink calicivirus 800ND1,600ND NorovirusVLPs 800ND6,400ND SSL2004-499SE 200<4800128 SSL2004-500SE 100<4800>8,192 SSL2004-501SE 1004800512 SSL2004-502SE <50<4<5016 SSL2004-503SE 2004800512 SSL2004-504SE 400<44008 SSL2004-505SE 400<480064 SSL2004-506SE 2001,024200512 SSL2004-507SE 40044001,024 SSL2004-508SE 5032800512 SSL2004-509SE 800162002,048

PAGE 137

137 Table 4-2. Continued. Serum Sample V810 VLP ELISA Titer V810 VN Titer V1415 VLP ELISA Titer V1415 VN Titer SSL2004-510SE 2008400256 SSL2004-511SE 200168004,096 SSL2004-512SE <508200>8,192 SSL2004-513SE 2004320016 SSL2004-514SE 400326400512 SSL2004-515SE 50 <4400512 SSL2004-516SE 100<410032 SSL2004-517SE 400<412,8001,024 SSL2004-518SE 100<48004,096 SSL2004-519SE 1001282002,048 SSL2004-520SE 200641,6002,048 SSL2004-521SE 100<410032 SSL2004-522SE 400168008 SSL2004-523SE 20042008 SSL2004-524SE 800643,2002,048 SSL2004-525SE 80016800<4 SSL2004-526SE 100322008 SSL2004-527SE 80016400<4 SSL2004-528SE 40048001,024 SSL2004-529SE 504200<4 SSL2004-530SE 1004200128 SSL2004-531SE 100168002,048 SSL2004-532SE 506420064 SSL2004-533SE 20083,200>8,192 SSL2004-534SE 8001,0244008 SSL2004-535SE <508<50128 SSL2004-536SE 100<44001,024 SSL2004-537SE <50<42001,024 SSL2004-538SE 100<4200512 SSL2004-539SE <50<4<508 SSL2005-594AL <50<4<50<4 SSL2005-595AL <50<4<50<4 SSL2005-596AL <50<450<4 SSL2005-597AL <50<4<50<4 SSL2005-598AL <50<4<50<4 SSL2005-599AL 50<4<50<4 SSL2005-600AL <50<4<50<4 SSL2005-601AL <50<4<50<4 SSL2005-602AL 50<450<4 SSL2005-603AL <50<4<50<4 SSL2005-604AL 50<450<4 SSL2005-605AL <50<4<50<4 SSL2005-606AL <50<4<50<4

PAGE 138

138 Table 4-2. Continued. Serum Sample V810 VLP ELISA Tite r V810 VN Tite r aV1415 VLP ELISA Tite r aV1415 VN Tite r SSL2005-607AL <50<4<50<4 SSL2005-608AL <50<4<50<4 SSL2005-609AL <50<4<50<4 SSL2005-610AL <50<4<50<4 CSL-1 Virginia 800<4400<4 CSL-2 Reuben 800<4800<4 CSL-3 Lenora 1,600<4800<4 CSLV2645 800ND800ND SSLWoody 1 <50<4<50<4 SSLWoody 2 <50<4<50<4 Harbor porpoise <50ND<50ND Harbor porpoise <50ND<50ND a ND= not done

PAGE 139

139 Figure 4-1. SDS-PAGE analysis of proteins from the baculoviru s expression system. Proteins were separated by SDS-PAGE and stained with Gel Code Blue (Invitrogen). Panels A-C: samples were harvested daily for 5 d from recombinant baculovirus infected Sf9 cell cultures. Lane 1molecular weight marker, lanes 2 through 6daily collections from cell pellets, lanes 7 through 11daily collections from cell culture supernatant, lane 12uninfected Sf-9 cell control. A) V810 VP1, B) V1415 VP1, panel C) V810 VP1+VP2. D) proteins purif ied from cesium chloride gr adients of the supernatant from day five from the three recombinant viruses. Lane 1molecular weight marker, lane 2V810 VP1, lane 3V1415 VP1, lane-4 V810 VP1+VP2, lanes 5 and 6positive control vesivirus V810 and V1415, respectively, grown in cell culture. 1 2 3 4 5 6 7 8 9 10 11 12 62 49 38 92 Cell pellet Supernatant Time Time A. 1 2 3 4 5 6 7 8 9 10 11 12 62 49 38 92 Cell pellet Supernatant Time Time B. 1 2 3 4 5 6 7 8 9 10 11 12 62 49 38 92 Cell pellet Supernatant Time Time C. 1 2 3 4 5 6 62 49 38 D.

PAGE 140

140 Figure 4-2. Western blot analysis of proteins from the baculovirus expression sy stem. The panels are th e same as described ab ove for Figure 4-1. The viral proteins were detected using a 1:2000 dilu tion of a mixture of type spec ific antibodies to San Miguel sea lion virus (SMSV) serotypes 4, 6, 9, 10, 11, and 13. A 60 kD a protein consistent with th e positive control vesiviruses (panel D, lanes 5 and 6) were detected from the daily sample s and from proteins purified from cesium chloride gradients. 1 2 3 4 5 6 7 8 9 10 11 12 62 49 38 Cell pellet Supernatant Time Time C. 1 2 3 4 5 6 62 49 38 D. 62 49 38 1 2 3 4 5 6 7 8 9 10 11 12 Cell pellet Supernatant Time Time A. 62 49 38 Cell pellet Supernatant Time Time 1 2 3 4 5 6 7 8 9 10 11 12 B.

PAGE 141

141 Figure 4-3. RT-PCR produc ts from the yeast expression system Panel A1.6 Kb mature capsid proteins amplified from the Steller sea lion vesivirus is olate V810. Panel BRT-PCR products of the integration test. A 1.9 Kb pr oduct results when the ge ne of interest is integrated into the yeast genome. Figure 4-4. Protein analysis of proteins expressed in the yeast expression system. The mature capsid protein, VP1, of vesivirus isolate V 810 was expressed in the yeast system for 14 d, and daily samples were collected. Pa nel ASDS-PAGE stained with coomassie blue. The recombinant viral proteins were separated from the yeast cell lysate by immunoprecipitation with specific antisera and then analyzed by western blot (Panel B). A specific antibody for the SMSV was used to detect the viral proteins. For both panels: lane 1molecular weight marker, la ne 2 negative control yeast cells, lanes 3-9 recombinant yeast d 1, 5, 10, 11, 12, 13, 14, lane 10positive contro l V810 vesivirus. 80 60 50 40 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 80 60 50 40 A. B. A. B. 1 2 1 2 3 4 5 6 7 2 Kb

PAGE 142

142 Figure 4-5. Electron micrograph of virus-like particles (VLPs) expressed in the baculovirus expression system. Proteins were visualized by negative staining with phosphotungstic acid. Panels A and BVLPs from vesiviru s isolate V810 VP1 gene. Panels C and DVLPs from vesivirus is olate V1415 VP1 gene. Panels E and FVLPs from vesivirus isolate V810 VP1 + VP2 gene. A. B. C. D. E. F.

PAGE 143

143 Figure 4-6. Electron micrographs of proteins produced in the yeas t expression system. Proteins were visualized by negative st aining with phosph otungstic acid. Panel AWeak structures seen in yeast cell lysates after 4 d. Panel B“Lattice-like” structures visible from 14 d culture of yeast cells. Ch aracteristic VLPs were not visible in the yeast samples. B. A.

PAGE 144

144 CHAPTER 5 CHARACTERIZATION OF TWO ATYPIC AL MARINE VESI VIRUS SEROTYPES Introduction There are more than 40 different serotypes of marine vesiviruses isol ated to date belonging to the Vesicular exanthema of swine virus species within the Caliciviridae family (Green et al. 2000; Smith et al. 1998b). Of these serotypes, two viru ses have been described that seem atypical of the other serotypes in this viral specie s. San Miguel sea lion virus (SMSV) serotype 8 (SMSV-8) was first isolated from a vesi cular lesion of a Northern fur seal ( Callorhinus ursinus ) in Alaska in 1976 (Smith et al. 1981a). The SMSV-12 was isolated from throat and rectal swabs from Northern fur seals and California sea lions ( Zalophus californianus ) in California in 1977 (Smith et al. 1981a). A reverse-transcriptase polymerase chain reac tion (RT-PCR) was described for the marine vesiviruses (Reid et al. 1999). This assay amplifies a 768-bp fragment of the capsid gene of more than 30 serotypes of the marine vesiviru s group, but it did not amplify SMSV-8 or SMSV12. A real-time RT-PCR (rRT-PCR) assay was also developed for the marine vesiviruses, and like the conventional RT-PCR assay described above this assay failed to amplify SMSV-8 or SMSV-12, yet it did amplify more than 30 other marine vesiviruses (Reid et al. 2007). Serological assays have also been described for the marine vesiviruses. A western blot assay was developed with specific antisera agains t many of the SMSV serotypes were created in rabbits (Seal et al. 1995a). The specific ra bbit antisera were found to be cross-reactive among different serotypes, except for SMSV-8 and SMSV -12. Another serological assay utilizing an enzyme linked immunosorbent assay (ELISA) for the detection of antibodies to the marine vesiviruses (Ferris & Oxtoby, 1994) has also been described.

PAGE 145

145 Despite the molecular and serological eviden ce that SMSV-8 and SMSV-12 are distinct from known marine vesivirus seroty pes, no sequence data are availabl e for either isolate. Here we report the sequencing of fragments from the capsid gene of both SMSV-8 and SMSV-12. These results provide the first nuc leotide sequences for these viruse s, and may provide insight as to why these viruses are so different from the previ ously described serotypes. Materials and Methods Source of Viruses The SMSV-8 and SMSV-12 viruses were a gene rous gift of Dr. Al Smith (Oregon State University). The viruses were grown in Afri can green monkey kidney (Vero) and Madin-Darby canine kidney (MDCK) cell cultures at 37C in a 5% C02 atmosphere. Following the appearance of cytopathic effects (CPE) in the cultures, total RNA was extracted from the infected monolayers using TRIzol-LS (Invi trogen, Carlsbad, CA). The cell monolayers were lysed in TRIzol Reagent for 5 min at room temperat ure, and phase separated by the addition of chloroform. The aqueous phase was harvested and RNA was precipitated with an equal volume of isopropyl alcohol, pellet ed by centrifugation at 12,000 x g for 10 min at 8C, rinsed with 70% ethanol, air dried, and dissolved in RNase-free water. The RNA was reverse transcri bed to produce cDNA in a 20 l reaction containing 0.5 l (3 g/l) random hexanucleotide primers (Invitrogen), 0.5 l of 10 mM each dNTP (Invitrogen), 40U of the ribonuclease inhibito r RNaseOUT (Invitrogen), and 200 U of reverse transcriptase enzyme (Invitrogen, or New England Biolabs, Ipswich, MA), following the manufacturerÂ’s protocol. The cDNA was stored at -80C until used in PCR. Polymerase Chain Reaction The cDNA was used in PCR assays using severa l primer sets, and in rRT-PCR. For the conventional RT-PCR assay, previously published pr imers that amplify a 768-bp fragment of the

PAGE 146

146 capsid gene (Reid et al. 1999) were tested (Table 5-1). Th ese primers were previously reported not to amplify SMSV-8 and SMSV-12 cDNA (Reid et al. 1999). A novel rRT-PCR, described in Chapter 3, was also utilized with SMSV-8 and SMSV-12 cDNA. The rRT-PCR products were sequenced directly, and then us ed to design new PCR primers to obtain larger fragme nts of the capsid gene (Table 5-1). Primer CR-967 was designed as a forward primer for SMSV-8 and primer CR-969 was designed as a forward primer for SMSV-12. These primers were used with the prev iously described primer CR-437 (Table 5-1) to generate an approximately 650-bp fragment of the capsid gene. The PCR products were gel purified and sequenced directly using the B eckman-Coulter 2000XL instrument. These PCR products were also cloned into the Topo T/A vect or (Invitrogen) and sequenced from the vector. For the RT-PCR, 5 l of cDNA was added to 45 l of a PCR mix (pH 8.4) containing 10 mM KCl, 10 mM (NH4)2S04, 20 mM Tris-HCl, 2 mM MgSO4, 0.1% Triton X-100, 400 nM of each specific primer (Table 5-1), 200 M of each dNTP, and 1 U of Taq DNA polymerase (Invitrogen). Thermal cycling was performe d in the DNA Engine DYAD Thermal Cycler (MJ Research, Inc., Waltham, MA) as follows: initial denaturation at 94C for 2 min, followed by 39 cycles of denaturation at 94C for 30 s, annealin g at 48C for 30 s, and extension at 72C for 2 min. Cloning, Sequencing, and Phylogenetic Analysis The conventional RT-PCR products were cut ou t of 1% low melting point agarose gels, and the DNA was extracted from the band with a commercial kit (Gel Extraction Kit, Qiagen, Valencia, CA). These PCR products were sequenced directly, or cloned in to the TopoT/A vector (Invitrogen) and sequenced from the vector. The DNA products of the rRT-PCR assays were cleaned with a commercial kit (Qiagen QiaQui ck PCR kit) and then sequenced directly.

PAGE 147

147 Chromatograms from the sequenced capsid gene fragments were visually checked using the Chromas 2.3 software (Technelysium Pty Ltd, Tewantin QLD, Australia) for potential miscalls, and further analyzed with the Univers ity of Wisconsin Package Version 10.2 (Genetics Computer Group – GCG, University of Wisconsin, Madison, WI). The amino acid (aa) sequences deduced from th e vesivirus capsid gene were aligned using Clustal X slow and accurate function, Gonnet 250 residue weight table, gap penalty of 11 and gap length penalty of 0.2. Neighbor-joining phyl ogenetic trees were c onstructed using PAUP version 4.0b10 (Sinauer Associates, Sunderlan, MA ) and drawn with TreeView software (Page, 1996). Confidence values were determined from 1000 bootstrap repl ications. GenBank accession numbers for sequences used in phyloge netic analyses were: SSL vesivirus V810 EF193004, SSL vesivirus V1415 EF195384, Vesicular ex anthema of swine (VESV) serotype A48 NC_002551, primate calicivirus (Pan -1) AF091736, SMSV-1 U15301, WCV NC_004541, RaV AJ866991, SMSV-4 M87482, SMSV17 U52005, SMSV-13 AJ131388, SMSV-14 U76879, VESV-G55 DQ666637, VESV-C52 DQ666633, VESV-K54 DQ666634, SMSV-6 U766885, SMSV-14 U76879, SMSV-5 U76883, SMSV-2 U76881, bovine calicivirus (Bos-1) U76875, SMSV-7 U76887, SMSV-10 DQ666631, rept ile calicivirus (RCV) 1 AY772542, RCV 2 AY772540, RCV 3 AY772538, RCV 4 AY 772539, untyped vesiviruses AY772544, AY772543, AY772539, and CSL untyped DQ666635. Results Viruses, Polymerase Chain Reaction, and Sequencing The SMSV-8 and SMSV-12 viruses produced CPE in Vero and MDCK cell cultures similar to that produced by other marine vesivi ruses. The infected cells were rounded and detaching from the monolayer, and within 24 h post-infection, the entire monolayer was destroyed.

PAGE 148

148 The RT-PCR assay performed as described by Reid et al. (1999) to amplify a 768-bp fragment of the capsid gene generated DNA fr agments approximately 700-bp in size from both SMSV-8 and SMSV-12 (Figure 5-1). These PCR products were sequenced directly, and also cloned and sequenced, but the sequences obtai ned did not correspond to those of any known calicivirus sequences. However, the rRT-PCR assay, described in Chapter 3, successfully amplified the 176-bp fragment of the A region of the capsid gene from SMSV-8 and SMSV-12. These PCR products were sequenced directly and yielded 116 and 91 nucleotides (nt) of SMSV8 and SMSV-12 capsid genes, resp ectively. Other marine vesivi ruses including Steller sea lion (SSL) vesiviruses V810 and V1415, SMSV-1, SMSV-2, SMSV-4, SMSV-5, SMSV-13, SMSV14, and bovine calicivirus (Bos-1) were al so amplified by rRT-PCR and sequenced. The sequences obtained from the rRT-PCR pr oducts of SMSV-8 and SMSV-12 were used to design new forward primers to amplify a frag ment of about 650-bp in length using the existing CR-437 reverse PCR primer (Table 5-1). Fragment s of the predicted size were amplified from both SMSV-8 and SMSV-12 cDNAs (Figure 5-2) The PCR products were gel purified, sequenced directly, and also cloned into the Topo T/A vector (Invitr ogen) and sequenced. Sequencing of the SMSV-12 fragme nt revealed 657 nucleotides co rresponding to the A region of the capsid gene. The amplified product fr om SMSV-8 was sequenced from both the PCR product and cloned cDNA, yet neither sequence corre sponded to a vesivirus sequence. The PCR product was therefore assumed to have resulted from non-specific primer binding. Because we know the forward primer, CR-968, faithfully corr esponded to sequences obtained by directly sequencing rRT-PCR produc ts, it is assumed that the revers e primer, 1R/CR-437, is incorrect and must not bind to the SMSV-8 viral cDNA.

PAGE 149

149 Phylogenetic Analysis Real-time polymerase chain reaction fragment. Phylogenetic analysis of the predicted 176-bp rRT-PCR products of SMSV-8 and SMSV -12 and eight other marine vesiviruses revealed that SMSV-8 and SMSV-12 are most cl osely related to SSL ve sivirus V810 (Figure 52). Comparisons of the nt and aa identities of this fragment revealed that the SMSV-8 and SMSV-12 are very distinct from other known marine vesiviruses. The nt identity for SMSV-8 when compared to the analyzed vesivirus orthologous fragments ranged from 70.2 to 85.1 %, with the highest identity to V 810 and the least identi ty to SMSV-2 and SMSV-13 (Table 5-2). The deduced aa identities of SMSV-8 ranged from 57.7 to 78.9%, with the highest identity to the V810 isolate and the least iden tity to SMSV-12 (Table 5-2). The SMSV-12 nt identities ranged from 66.3 to 73.0%, most closely related to V1415, and least related to Bos-1 (Table 5-2). The aa identities ranged fr om 50.7 to 70.4%, with the closest match to SMSV-5 and SMSV-4 (Table 5-2). In comparison, the other marine vesiviruses all shared 66.7 to 93.4% nt identity, and 80.0 to 97.7% aa identity (Table 5-2). The deduced amino acid sequences were used to create an unrooted divergent phylogram of the approximate ly 176-bp fragments (Figure 5-3) to further assess the phylogenetic relationshi ps among these viral isolates. Region A capsid fragment. A sequence of 657 nt of SMSV-12 was obtained from the cloned cDNA using a specific forward primer. Th is sequence corresponded to the A region of the capsid gene and was comparable to that of other known marine vesiviruses. Unfortunately, this procedure did not result in the corresponding sequence from SMSV-8, theref ore the latter was excluded from this analysis. The SMSV-12 sequence of 657 nt shared nt identities with other marine vesivirus homologues ranging from 61.6 to 71.8% and was most closely re lated to SMSV-2 and least

PAGE 150

150 related to RCV. The deduced aa sequence shared identities ranging from 60.8 to 78.9%, with the highest identity to SMSV-2, and the least to RCV (data not shown). In comparison, the other homologous marine vesiviruses shared among them selves nt identities ranging from 60 to 95%, and aa identities ranging from 54.4 to 94.8%. The deduced aa sequences of the approximately 650-bp A region of the capsid gene of marine ve siviruses were used to create an unrooted phylogenetic tree (Figure 5-5). SMSV-12 cl ustered closely with SMSV-1 and SMSV-2, consistent with the sequence data above, as SMSV -12 shared the highest nt and aa identities with these serotypes. Discussion Here, we report the first nucleotide sequen ce data of SMSV-8 and SMSV-12 vesivirus serotypes. Sequences of two se parate regions of the capsid gene were obtained by conventional RT-PCR and rRT-PCR. These viruses were previ ously reported to be at ypical among marine vesiviruses, as several previous ly described molecular diagnostic assays had failed to identify them. An RT-PCR assay targeting the capsid gene that amplified more than 30 serotypes of marine vesiviruses did not amplify SMSV-8 or SMSV-12 cDNA (Reid et al. 1999). These viruses were similarly not detect ed by an rRT-PCR assay that targets the polymerase gene, in spite of the successful amplification of more than 30 other serotypes of marine vesiviruses (Reid et al. 2007). The failure of these two molecular assays suggeste d that the viral genomic RNA sequence is different in SMSV -8 and SMSV-12, as the molecular primers and probes did not seem to bind these two SMSV serotypes. Howeve r, because no sequence data were available for SMSV-8 and SMSV-12, the sequence di fferences could not be confirmed. The previously described RT-PCR for a fragment of the capsid gene reported that this assay failed to amplify SMSV-8 and SMSV-12 (Reid et al. 1999). We also were unable to amplify the 768-bp fragment, even by lowering th e annealing temperature of the PCR reaction

PAGE 151

151 ten degrees below the melting temperature of the primers. Smaller PCR products were generated (Figure 5-1), but sequencing of these PCR products revealed them to be most likely driven by non-specific primer binding and unr elated to vesivirus sequence s. This suggests that the nucleotide sequence at the primer binding sites must be distinct in serotypes SMSV-8 and SMSV-12. We have previously described a novel rR T-PCR assay for the detection of marine vesiviruses (Chapter 3). This assay was successful in amplification of a 176-bp fragment of the capsid gene from SMSV-8, SMSV-12 and ten othe r marine vesiviruses, including our two novel Steller sea lion vesivirus isolates. We sequen ced the rRT-PCR products of 11 of these marine vesiviruses, including SMSV-8 and SMSV-12. The resulting sequences of 116-nt of SMSV-8 and 91-nt of SMSV-12 represent the first nt sequ ences of these atypical marine vesiviruses. Comparisons of the short sequences now available from these viruses to those of nine other rRTPCR products at the nt and dedu ced aa levels revealed that SMSV-8 and SMSV-12 are quite different than the homologous viral isolates (Tab le 5-2). The other ni ne marine vesiviruses shared up to 93.4% nt identity and 97.7% aa identity, while SMSV-8 and SMSV-12 only share identities at the most 85.1% at the nt level, and 78.9% at the aa level with the other marine vesiviruses (Table 5-2). The SMSV-8 and SM SV-12 serotypes grouped closely with V810 and with each other by phylogenetic analysis (Figure 5-3). We used the rRT-PCR generated sequences to design new forward primers to use with the published 1R reverse primer (Reid et al. 1999) and successfully amplified a 657-bp fragment of the A region of the capsid gene of SMSV-12 (Fi gure 5-2). When this nt sequence was compared to homologous marine vesivirus sequences availa ble in the GenBank database, very distinct differences were observed. The SMSV-12 shar ed at the most only 71.8% nt and 77.1% aa

PAGE 152

152 identities with homologous marine vesivirus sequ ences, while the other viruses shared up to 95% nt and aa identities. The result s of the phylogenetic anal ysis agreed with these data, as SMSV-12 grouped with SMSV-2 and SMSV-1 (Figure 5-5). Th e A region of the capsid gene has also been described as being highly conserved among the vesiviruses (Neill, 1992; Neill et al. 1998). These researchers reported the A region to be 86 to 96% similar among the marine vesiviruses, which is similar to the data we describe here. The sequence a nd phylogenetic analysis indicate that the SMSV-12 is also quite different in th is most conserved regi on of the capsid gene. The A region of the capsid was targeted in the development of the rRT-PCR assay described in Chapter 3. This molecular assay successfully amplified both SMSV-8 and SMSV12 sequences, indicating that the annealing locati ons of the newly designed primers and probe were in highly conserved regions. These results lend much credibility to the rRT-PCR assay not only for its ability to detect all marine vesiviruses, but also beca use of the detection of SMSV-8 and SMSV-12 vesiviruses not detected by previously described assays. The same strategy was used to obtain a fragme nt of the A region of the capsid gene for SMSV-8, however this was unsuccessful. PCR products of approximately 600-bp were amplified (Figure 5-2 Panel A); however, sequen cing revealed that thes e did not correspond to authentic vesivirus sequences a nd, most likely, were the result of non-specific primer binding. Because we designed the forward primer to be specific based on the sequence obtained from the rRT-PCR product, the reverse primer, 1R, must not have bound to the SMSV-8 viral cDNA. In this study, we have reporte d the first nt sequences of tw o atypical marine vesiviruses, SMSV-8 and SMSV-12. Previous literature a nd diagnostic assays had suggested that these viruses were significantly different from known vesivi ruses, by the failure of the assays to detect these viral serotypes. We have confirmed th at these viruses are qui te different through

PAGE 153

153 sequencing of small fragments of the capsid gene of both SMSV-8 and SMSV-12. Through analysis of these small fragments, we were able to see distinct differences in these serotypes when compared to homologous sequences of other ma rine vesivirus serotypes. Future research should aim initially at sequencing larger por tions of SMSV-8 and SMSV-12 genomes and eventually the complete genomes of these isolates Further phylogenetic an alysis may lead to the removal of these two serotypes from the Vesicular exanthema of swine viral species, as previously suggested, and by our data presented here.

PAGE 154

154Table 5-1. Primers used for PCR assays for SMSV-8 and SMSV-12. All primers target the capsid gene. Primer Sequence Sense Product size (bp) Source 1F/CR-436 GTGAGGT GTTTGAGAATTAG + 768 Reid et al ., 1999 1R/CR-437 ACATCAATTCCGCCAGACCA 768 Reid et al ., 1999 CR-967 CCGAATGCTCTGAC GGGCAG + ~600 This dissertation CR-969 GTGGACACTCTACAACTTGG + 657 This dissertation CR-792 ATGGCTACTACTCAIACGCT + 176 This dissertation CR-793 CAGTTGAAIGGATCATCACA 176 This dissertation Table 5-2. Amino acid and nucleotide identi ties of predicted 176-bp frag ments obtained after real-time PCR assays of several m arine vesiviruses. Amino acid Identity (%) V810 SMSV-12Bos-1SMSV-14SMSV-13SMSV-5 SMSV-4SMSV-2SMSV-1SMSV-8V1415 V810 63.0 84.4 86.7 80.0 91.7 82.2 84.4 86.7 78.9 89.6 SMSV-12 70.7 59.3 69.2 66.7 70.4 70.4 66.7 63.0 57.7 50.7 Bos-1 70.9 66.3 84.1 84.4 86.7 84.4 88.9 88.9 63.2 88.9 SMSV-14 72.6 71.7 84.1 93.2 95.6 97.7 93.2 90.9 70.3 91.1 SMSV-13 70.1 67.4 85.5 89.9 88.9 95.6 93.3 86.7 63.2 86.7 SMSV-5 69.2 71.7 83.3 90.6 87.0 91.1 91.1 93.3 71.1 95.8 SMSV-4 66.7 65.2 80.4 91.3 87.7 89.6 95.6 88.9 65.8 86.7 SMSV-2 69.2 70.7 88.4 87.0 89.1 87.5 86.8 93.3 65.8 91.1 SMSV-1 68.1 70.3 88.2 87.5 88.2 87.5 84.6 93.4 68.4 93.3 SMSV-8 85.1 70.8 71.1 76.3 70.2 73.7 72.8 70.2 71.1 68.4 Nucleotide Identity (%) V1415 92.5 73.0 70.2 77.2 73.7 71.9 71.1 71.9 77.0 76.6

PAGE 155

155 Figure 5-1. RT-PCR analysis of SMSV-8 and SMSV-12 for the 768-bp fragment of the capsid gene. Lane 1: 1 Kb Molecular weight mark er, Lane 2: SMSV-8 in Vero cells, Lane 3: SMSV-8 in MDCK cells, Lane 4: SMSV-12 in Vero cells, Lane 5: SMSV-12 in MDCK cells, Lane 6: Waternegative c ontrol, Lane 7: Positive control SSL vesivirus, Lane 8: 1 Kb Molecular weight marker. Figure 5-2. RT-PCR analysis of SMSV-8 and SMSV-12 with virus specific primers. Specific primers were designed to amplify an a pproximately 600-bp fragment for SMSV-8 (Panel A) and approximately 650-bp of SM SV-12 (Panel B) based on sequencing of the 176-bp fragment of the capsid gene fo r real-time RT-PCR analysis. For both panels, Lane 11Kb molecular weight ma rker, and Lane 2viral cDNA from SMSV8 (Panel A) and SMSV-12 (Panel B). 1 2 A. 650-bp 500-bp 1 2 B. 650-bp 500-bp 1 2 3 4 5 6 7 8 650-bp 500-bp

PAGE 156

156 Figure 5-3. Neighbor-joining phylogram of the real-time RT-PCR product deduced amino acid sequences. The PCR products we re obtained with the assay described in Chapter 3 of this dissertation and sequenced directly. The Clustal X program was used to align sequences with the slow and accurate func tion, Gonnet 250 residue weight table, gap penalty of 11, and gap length penalty of 0.2. The PAUP version 4.0b10 was used to construct the phylogram, and the TreeView so ftware was used for interpretation and drawing of the phylogram. Values at nodes in dicate the percentage confidence out of 1000 bootstrap replications. The rectangul ar format shows a 0.1 divergence scale representing 0.1 amino acid substitutions per site. 0.1 SMSV-4 SMSV-13 SMSV-14 SMSV-2 SMSV-1 V1415 Bos-1 SMSV-5 SMSV-12 V810 SMSV-8 52.4 53.0 100 100 100 100 100 100

PAGE 157

157 1 50 100 SMSV14 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ .......... .....gat.. .......... ....t..... .......... ..t....... SMSV5 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~....... ........c. ......a... ........t. .......... ....c..... ..t....... SMSV4 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~...... .......... .......... .......... ....c..... ..t....... SMSV13 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ .......... .......... .......... ...g...... ..t..a.... SMSV1 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ .......... .........a .......... .......... ...g...... .....a.... V1415 .......... .......... .......... .......... .......... g......... .......... .......... .......... .......... SMSV2 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~.....t .......... .........a .......... .......... ....c....c .....a.... V810 .......... .......... .......... .......... .......... g......... .......... .......... ...g.....c .......... Bos1 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ .......... .........a ..t..g.... .......... ...g...... .......... SMSV12 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ca.t.taca. SMSV8 ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ tgacggg.a. cacc.....c .......... Consensus ATGGCTACTA CTCATACGCT TCTGTCGTTT GACGACCTCG AATTTCTCTT ACACAAGAAG GACCTAACCG ATCTCTACGG AGAAAGGTGT GGCACCCTCA 101 150 180 SMSV14 .......... .......... .....a.... ....c..c.. .......... .......... .......... .......... SMSV5 .ct....... .......... ........t. .......a.. .......... .......... .......... .......... SMSV4 .......... .......... .....a..t. .ct.g..t.. .......... ........c. .......... .......atg SMSV13 .......... ......t... .....a.... .......t.. .......... .......... .......... SMSV1 ..t....... .......... ..c..c.... .......a.. .......... ........g. ........~~ V1415 .......... .......... ..c..c.... .......t.. ...t...... .......... ...t.....~ SMSV2 ..t....... ......t... .....a.... .c.....a.. ........c. .......... ..~~~~~~~~ V810 .c........ .g....t... .......... ....a..t.. .......... .......... ...t..t..~ Bos1 .c........ .g....t..c .......... ....c..a.. .......... .......... SMSV12 .....g.... .......... .......a.. ....tca... ........c. .......... t.a......~ SMSV8 .c........ .gcatg.a.. .......... ....a..t.. .......... .......... ......~~~~ Consensus ATCTGGTCAT CA---ACCCT TATGATCTCT TTCTTCC-GA TGAACTTGAT GATGATTGGT GTGATGATCC CTTCAACTGA Figure 5-4. Multiple alignment of the real time RT-PCR products of the marine vesiviruses incl uding San Miguel sea lion virus (SMSV) serotypes.

PAGE 158

158 Figure 5-5. Unrooted phylogeneti c tree of the deduced amino acid sequences of the A region of the capsid gene of several members of the marine vesiviruses. The phylogram was created as described above for Figure 5-3, and the GenBank accession numbers are indicated in the Materials and Methods section of Chapter 5. 0.1 SMSV-13 UntypedAY772543 V1415 Pan-1 VESV-G55 SMSV-6 SMSV-14 CSLUntyped DQ666637 VESV-A48 SMSV-4 SMSV-5 V810 SMSV-17 SMSV-12 SMSV-2 SMSV-1 Bos-1 SMSV-7 RaV RCV-2 RCV-3 WCV VESV-C52 VESV-K54 RCV-1 RCV-4 SMSV-10 Untyped-AY772539 UntypedAY772544 53.3 53.7 99.1 52.5 53.7 100 87.6 100 95.5 67.0 100 100 100 100 100 100 100 100 100 100 100 100 100

PAGE 159

159 CHAPTER 6 MARINE VESIVIRUSES IN THE ATL ANTIC OCEAN: DO THEY EXIST? Introduction There have been more than 40 different sero types of marine vesiviruses isolated from marine mammals of the Pacific Ocean, and along the Pacific coast of the U.S.A. including the states of California, Oregon, Wa shington, and Alaska. Livestock of these regions were also infected with marine vesiviruses after being fe d with uncooked meat and offal originating from marine products, including marine mammals and fish (Smith & Boyt, 1990). The marine mammal species known to have been infected wi th marine vesiviruses include California sea lions ( Zalophus californianus; CSL; (Smith et al. 1973), Steller sea lions ( Eumetopias jubatus; SSL; (Skilling et al. 1987), Northern fur seals ( Callorhinus ursinus ; Smith et al. 1974), Northern elephant seals ( Mirounga angustirostris ; Smith et al. 1980b), Pacific walrus ( Odobenus rosmarus ; Ganova-Raeva et al. 2004; Smith et al. 1983b), and the Atlantic bottlenose dolphin ( Tursiops truncatus ; Smith et al. 1983d). The marine vesiviruses seem most closely associated with pinniped species in the Pacific Ocean, mainly centered in California, and northern coastal United States into Alaska. To this date, there are no reports of marine vesiviruses isolated from marine mammal species from the Atlantic Ocean. However, there is one single report of a poten tial calicivirus infection of two grey seal pups ( Halichoerus grypus ) in Europe (Stack et al. 1993). Virus particles were obser ved by electron microscopy in a mixed infection of a parapoxvirus and a nother virus that appeared to have calicivirus morphology. The “calici-like” virus could not be isolated for further characterization or sequencing. The aim of this research phase was to determine whether evidence for the occurrence of marine vesiviruses in the Atlantic Ocean could be obtained. Several possibilities exist; firstly, vesiviruses do not occur in marine mammals fr om the Atlantic Ocean. These viruses have

PAGE 160

160 emerged in pinnipeds in the Pacific Ocean, and may not have become established or transmitted to marine mammals in the Atlantic Ocean, or ot her oceans of the world. Secondly, caliciviruses may be present in marine mammals in the Atlantic Ocean, yet they have not been identified since very little or no effort is bei ng spent on testing for these viruses. To the best of our knowledge, there is no ongoing research aimed at testing fo r vesiviruses in the A tlantic Ocean. Thirdly, more sensitive assays may be necessary to detect these viruses in infect ed animals that may not be showing clinical si gns of disease. In this research phase, we have tested tissues from stranded marine mammals made available from colleagues from the Southeastern stranding network of the United States, and from tissues and samples from captive and free-ranging marine mammals located in the southeast region to determine if marine vesiviruses are present in marine mammals from the Atlantic Ocean and Gulf of Mexico. Materials and Methods Sample Collection Tissues were collected from marine mammals stranded in the southeas tern United States. This region included Florida, Georgia, South Caro lina, North Carolina, Mississippi, and Texas. Tissue samples were collected from freshly dead animals in carcass c ondition code 2freshly dead “edible”, or code 3-moderate decompos ition (Dierauf & Gulland, 2001). Samples were also collected from captive and free-ranging anim als in the same region. The tissues and other samples collected included spl een, lung, brain, cerebrum, cerebe llum, spinal cord, lymph node, large and small intestine, liver thymus, kidney, heart, tongue, skin lesions, pancreas, pharynx, blood, feces, penile lesion, tonsil, thymus, thyroi d, adrenal, placenta, tonsil, uterus, and swabs from the intestine, oral cavity, lip, vagina blow hole, pharynx, serum, and plasma.

PAGE 161

161 The animal species from which samples were collected were Atlantic bottlenose dolphin ( T. truncatus ), spinner dolphin ( Stenella longirostris ) RissoÂ’s dolphin ( Grampus griseus ) roughtoothed dolphin ( Steno bredanensis ) sperm whale ( Physeter macrocephalus ), pygmy sperm whale ( Kogia breviceps ), pantropical spotted dolphin ( Stenella attenuata ), pygmy killer whale ( Feresa attenuata ) harbor porpoise ( Phocoena phocoena ), common dolphin ( Delphinus delphis ), the Florida manatee ( Trichechus manatus latirostris ), and the West Indian manatee ( Trichechus manatus manatus ). The research at the University of Flor ida was conducted under the National Marine Fisheries permit numbers 1054-1731-00 and 10541731-01, and the Institutional Animal Care and Use Committee (IUCAC) numbers D438, D805, E853, and E883. Virus Isolation Swabs and fecal samples suitable for virus isolation were homogenized in DulbeccoÂ’s modified essential medium (DMEM) and inocul ated onto drained monolayers of African green monkey kidney (Vero) and/or Madin-Darby can ine kidney (MDCK) cell cultures grown in 35mm tissue culture dishes. Af ter adsorption for 1 h, the inoc ula were removed, the cultures were fed with 2 ml of DMEM containing 1% fetal bovine serum and incubated at 37C for at least 7d. Cultures were monitored daily for the appearance of CPE consistent with vesivirus infection. If no CPE was present after 7 d, the monolayers were disperse d by trypsinization, and the cultures grown as before in 35 mm TC dishes Cultures were incubated for an additional 7 d at 37C and if no CPE was observed, the cult ures were discarded and the samples were considered negative for vesiviruses. Extraction of Total RNA RNA was extracted from marine mammal ti ssues using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufactureÂ’s in structions. Briefly, 25 mg of tissue were

PAGE 162

162 homogenized with a mortar and pestle, followed by the addition of 1 ml of TRIzol reagent and 0.2 ml of chloroform. The homogenized tissue wa s mixed well, incubated at room temperature for 5 min, and centrifuged at 5,000 x g for 10 min at 10C. The top aqueous phase containing most of the RNA was harvested and the RNA was precipitated with an equal volume of isopropyl alcohol. After 10 min incubation at room temperature, the RNA was pelleted by centrifugation at 12,000 x g for 10 min at 8C, rinsed with 2 ml of 70% ethanol, air dried, and dissolved in RNase-free water. Total RNA was also extracted from liquid sa mples, including blood, swab media, and cell culture monolayers and their media using TRIzol -LS (Invitrogen). The samples were lysed in TRIzol Reagent for 5 min at room temperature, and the RNA was extrac ted as described above. Reverse Transcription Polymerase Chain Reaction Complementary DNA (cDNA) was synthesized from 0.5-1 g of total RNA. The 20 l reaction included 0.5 l (3 g/l) random hexanucleotid e primers (Invitrogen), 0.5 l of 10 mM each dNTP (Invitrogen) and 200 U of reverse transcriptase enzy me (Invitrogen, or New England Biolabs, Ipswich, MA). The cDNA was stor ed at -80C until used in PCR. The cDNA was amplified by PCR to generate a 768-bp fragment of the A-region of the capsid gene using primers previous ly described (Reid et al., 1999). Briefly, 5 l of cDNA were added to 45 l of a PCR mix (pH 8.4 ) containing 10 mM KCl, 10 mM (NH4)2S04, 20 mM TrisHCl, 2 mM MgSO4, 0.1% Triton X-100, 400 nM of each specific primer (Table 6-1), 200 M of each dNTP, and 2 U of Taq DNA polymerase (New England Biolabs). Thermal cycling was performed in the DNA Engine DYAD Thermal Cycl er (MJ Research, In c., Waltham, MA) as follows: initial denaturation at 94C for 2 min, fo llowed by 39 cycles of denaturation at 94C for 30 s, annealing at 48C for 30 s, and extens ion at 72C for 2 min. Amplified DNA products were resolved by gel electrophoresis in 1% agaros e containing 0.5 g/ml ethidium bromide. The

PAGE 163

163 DNA fragments were visualized on a UV tran silluminator and photographed with a gel documentation system (Bio-Rad Laborat ories, Inc., Hercules, CA). A control PCR was also used with most tissu e samples to ensure that good quality RNA was extracted from the tissue samples. The PCR of the beta-actin gene was used as a tissue control, using a set of primers that amplify a 275-bp fragment (Table 6-1). These primers were developed in our laboratory a nd are specific for the mammalian beta-actin gene (SmolarekBenson, 2005). The PCR was performed as descri bed above, except that the primers were annealed at 53C. Enzyme Linked Immunosorbent Assay An indirect enzyme linked immunosorbent as say (ELISA) was described in Chapter 3 for the detection of antibodies to th e marine vesiviruses using viruslike particles (VLPs). We used the assay with serum and plasma collected from marine mammals in the Atlantic Ocean and Gulf of Mexico for antibodies to the marine vesiviru ses. The assay was performed as described in Chapter 4. Briefly, antigens in the form of VLPs were coated overnight at 4C in 96-well ELISA plates at a concentration of 1 mg/ml in carbonate-bicarbonate bu ffer (Sigma, St. Louis, MO). The plates were washed between each of the fo llowing steps with a tris-buffered saline with 0.1% Tween-20 (TBST) wash buffer. The plates were blocked with 5% milk in TBST, and each serum was tested in two-fold serial diluti ons starting with 1:100 and going up to 1:25,600, diluted in 1% milk in TBST. Each serum was also tested in wells with no antigen as a blank for background subtraction. The sec ondary reagent was Protein A-pe roxidase (Pierce, Rockford, IL), and the substrate was ABTS (2,2Â’-azinobis 3-ethylbenzthiazoline-6-sulfonic acid; Kirkegaard & Perry Laboratories, Gaithersburg, MD). The absorbances of the 96-well plates were then read at 405 nm on a Synergy plate r eader (Bio-Tek, Winooski, VT). A serum sample was considered positive if the absorbance, after correction for background, was greater than 0.2,

PAGE 164

164 and if the index was greater than two. The i ndex was calculated as the absorbance with all components divided by the absorbance obtai ned in the respective blank wells. The samples tested in the present ELISA platform included 69 sera and 3 plasma samples (Table 6-3). The samples were collected from Atlantic bottlenose dolphins, pygmy sperm whales, harbor porpoises, RissoÂ’s dolphins, rough-toothed dolphins, pygmy killer whales, a pantropical spotted dolphin, a common dolphin, a spinner dolphin, the Florida manatee, and the West Indian manatee. Results Samples A total of 223 samples were collected fr om stranded, captive, or free-ranging marine mammals and tested for marine vesiviruses. These included 151 tissue samples and swabs for virus isolation in cell culture and RT-PCR (Table 6-2), and 72 serum and plasma samples that were assayed for vesivirus antibodies using the ELISA (Table 6-3). The tissue samples included 20 spleens, 28 lungs, 10 brains, 11 cerebrum, 4 cer ebellum, 2 spinal cords, 9 lymph nodes, 2 large intestines, 12 livers, 8 kidneys, 3 hearts, 5 tongue tissues or scrapings, 3 blood, 9 skin samples or lesions, 2 pancreas, 6 pharynx tissues or swabs, 2 oral lesion s and swabs, 2 vaginal lesion swab, and 1 each of penile lesion, blow hole swab, lip scraping, thymus, feces sample, thyroid, adrenal, placenta, small in testine, tonsil, and uterus. Virus Isolation in Cell Culture Only three samples were suitable for virus is olation in cell culture. These included one fecal sample and swabs from a blowhole and the large intestine. Each inoculated culture was monitored for at least 14d and passaged once in Vero and MDCK cell cultures. None of these samples produced CPE consistent with marine ve siviruses, or any other known viral infection.

PAGE 165

165 Reverse Transcription Polymerase Chain Reaction A total of 151 marine mammal samples were tested by RT-PCR for the 768-bp fragment of the vesivirus capsid gene. None of the samples tested were positive for marine vesiviruses. The RT-PCR for the control beta-actin gene was also used for tissue sa mples. If the betaactin RT-PCR result was negative for a tissue sample, the sample was determined to be too degraded, and therefore, unsuitable for testing, and the RT-PCR results were considered invalid. Enzyme Linked Immunosorbent Assay The indirect ELISA was used to test 69 serum and 3 plasma samples from marine mammals in the southeastern Atlantic Ocean and Gulf of Mexico for the presence of antibodies to the marine vesiviruses (Table 6-3). All but one of the samples tested were considered negative for vesivirus antibodies, as they did not react with the VLPs used as antigens. One serum sample collected from a manatee in 2001 was reactive with V1415 VLPs at a 1 in 200 dilution but did not react with V810 VLPs even at the 1:100 dilution, the lowest dilution tested. Discussion A total of 223 tissue samples, swabs, or seru m were tested for marine vesiviruses from stranded, captive, and free-ranging marine mamm als from the southeast region of the United States and originating from the Atlantic Ocean a nd the Gulf of Mexico. No marine vesiviruses were isolated in cell culture or detected by RT-P CR from these tissue samples. We also tested for antibodies to marine vesiviruses by ELISA a nd did not find evidence of large scale exposures to the marine vesiviruses. It could be speculated that these results we re obtained because there are no marine vesiviruses present in this region of the Atlantic Ocean and Gulf of Mexico. However, this is questionable since the number and appropriatene ss of samples were not high enough or of the best possible quality. Pinnipeds that inhabit the north Pacific Ocean on the west US including

PAGE 166

166 California sea lions, Steller sea li ons, and northern fur seals seem to be most closely associated with the marine vesiviruses, and it is conceivable that these viru ses may have evolved with these host species. There are no pinniped species that naturally inhabit the waters of the southeastern regions of the United States. A few reports descri be the finding of marine vesiviruses in a prey item of the California sea li on, the opaleye perch (Smith et al. 1980b; Smith et al. 1981b), and the sea lion lungworm ( Parafilaroides decorus; Smith et al. 1980a) These events might be responsible for the infection of pinnipeds with marine vesiviruses in the north Pacific Ocean. Since the hosts, prey, and parasites are not pres ent in this region of the Atlantic Ocean in southeastern region of the U.S., marine vesiviruses may not have become established in this region. The temperature of the ocean may also play an important role in the distribution and long term survival of the virus. The Pacific Ocean in the regions where marine vesiviruses are most often isolated from California to Alaska are typically 15C or less, whereas in the Atlantic Ocean and Gulf of Mexico, the waters are much warmer. In the southeastern region, including Florida, the summer temperatures reach 30C, and only d ecrease to about 15C during the winter months (NOAA, 2008). Marine vesiviruses have been found to remain viable in 15C seawater for 14 d (Smith et al. 1981b). Thus, warmer water temperatures in the southeastern U.S. and Gulf of Mexico throughout the year may be a limiting factor in the permanent esta blishment of vesivirus infections in marine mammals that might inhabit these regions. The northern Atlantic Ocean is much colder th an in the southeastern region of the United States and harbors several pinniped species. These include the walrus ( Odobenus rosmarus ), bearded seal ( Erignathus barbatus ), harbor seal ( Phoca vitulina ), ringed seal ( Pusa hispida ), gray seal ( Halichoerus grypus ), harp seal ( Pagophilus groenlandicus ), and hooded seal

PAGE 167

167 ( Cystophora cristata (Folkens, 2002). This northern region of the A tlantic Ocean of the US and Canada is more likely to sust ain marine mammals that may be infected with vesiviruses, and therefore surveillance for vesivirus infecti ons should be implemented in this region. Stack et al. (1993) reported mixed infections of a parapoxvirus and a calicivirus in two grey seal pups in Europe. The calicivirus infection was diagnos ed solely on electron microscopy, as the virus particles displayed th e characteristic cup-like morphology of the Caliciviridae However, the suspected calicivirus was not isolated for further characterization or genetic sequencing to confirm the diagnosis. The virus visu alized by EM could potentially represent another member of the Caliciviridae family, not necessarily a Vesivirus or potentially another viral family. This has been the first a nd only report of a calicivir us infection in marine mammals in the Atlantic Ocean. For the above mentioned reasons, the northern Atlantic in European countries may provide a better environment for the establishment of caliciviruses, as the temperature and marine mammal species presen t are more conducive to the persistence of the marine vesiviruses. However, if the marine ve siviruses are present in marine mammals of the Northern Atlantic, one would expect more reports of vesivirus infection, yet this may represent a lack of testing for these viruses. Both of the grey seal pups apparently had dual infections of calicivirus and parapoxvirus. If the report is correct, it could be speculated that infection with one virus may have predisposed these animal s to infection with the second virus. The ELISA assay used for the serum and plas ma samples was described in Chapter 4 of this dissertation. We found that in this ELISA, the VLPs were cross-reactive with SSL sera and with specific antisera against 10 different SMSV serotypes, and 12 different vesicular exanthema of swine virus serotypes. If the animals that we tested in this ELISA had been exposed to a vesivirus, antibodies in their sera should have cr oss-reacted with the VLP an tigens. If the viruses

PAGE 168

168 were circulating in the Atlan tic Ocean and Gulf of Mexico, some marine mammal sera should have been positive for antibodies. The lack of positive sera suggests that caliciviruses may not be established in the southeast region of the U.S.. One serum sample collected from a free-ra nging manatee in 2001 in Tampa Bay, Florida was positive by ELISA with a 200 titer to only on e of the VLP antigens, isolate V1415. Our vesivirus VLPs were found to cross-react with hyperimmune serum agains t other caliciviruses including feline calicivirus (FCV ), mink calicivir us (MCV), and Norovirus VLPs. The positive manatee could have potentially been infected with a terrestrial calicivirus such as FCV, a human virus, or an unknown Calicivirus. As only one of the 72 samples tested reacted with the VLP antigens, we do not feel this finding represents evidence that marine vesiviruses are present in the Atlantic Ocean. Tissues from stranded marine mammals are ofte n degraded due to the time carcasses have been on the beach exposed to high environmental temperatures before tissues are harvested for diagnosis. This is accentuated when marine mammals strand in locations far away from inhabited places and begin decomposing before th e carcasses are found. It should be evident that tissues derived from these carcasse s do not qualify for virus isolati on and the latter should not be attempted as results would be negative, regardless of a viral involvement in the stranding event. Ultimately, testing total RNA for th e presence of housekeeping genes such as the beta-actin gene or the lactate dehydrogenase gene should provide an answer as to the quality of tissue to be examined. These genes are always present in many copy numbers, while viral RNA, depending on the stage of the infection, is typically present in smaller co py numbers. The stage of the infection thus may improve or diminish the ability to detect viruses in tissue samples, with the best opportunities prov ided during the acute infection stage.

PAGE 169

169 The serum samples processed, however, were fres h samples. Degradation of viruses or the viral RNA in tissues is possible, but if an anim al was exposed to vesivi ruses, the cross-reactive antibodies should have been presen t in the serum or plasma. We were only able to test 72 serum and plasma samples, and found no evidence of antibodies to the marine vesiviruses. Another more plausible explanation for not finding marine vesiviruses in the samples examined is the relatively small sample size tested. Only 223 samples were assayed, which probably represents a very low percentage of th e total populations of ma rine mammals in this region. In addition to this sample number limitati on, it is clear that marine vesiviruses are not isolated at high frequencies from infected popul ations as exemplified by the isolation of only nine vesiviruses from more than 500 oropharyngeal and rectal swabs collected from Steller sea lions from Alaska (Chapter 2). The absence of vesivirus isolation reports from marine mammals that inhabit oceans other than the north Pacific ma y then be a reflection of the small numbers of samples tested. Another possible reason for not de tecting or isolating marine ve siviruses may be due to the current diagnostic assays available for their detection. The RT-PCR assay used here was previously described for the de tection of marine vesiviruses in clinical samples (Reid et al. 1999). The authors reported that th is assay is 1000-fold less sensit ive than virus isolation in cell culture, and that additional methods for virus dete ction should be used in conjunction with this RT-PCR. Unfortunately, due to the state of many of the tissu es we received from stranded animals, cell culture isolation was not possible. In general, calicivirus es are transmitted through the fecal-oral route, although th e marine vesiviruses may also be transmitted directly from infectious fluids present in blisters or vesicles. As a result of our work, it seems that the optimal samples for virus isolation are oropharyngeal and rectal swabs co llected in transport medium

PAGE 170

170 containing FBS and antibiotics, a nd vesicle fluids. These samples are usually collected from live animals, not from carcasses. Vesicular fluids fr om marine mammals strande d in the southeastern region were not available for testing. A few sa mples with vesicular lesions similar to those associated with vesiviruses were assayed with ne gative results. Since ve ry little is known about these infections in cetaceans, these lesions may represent pat hology induced by other infectious agents including viruses, fungi, or bacteria. The real-time RT-PCR (rRT-PCR) assay, described in Chapter 3, was 10,000 to 100,000 times more sensitive th an the conventional RT-PCR assay pr eviously published by scientists from the Calicivirus Reference Center from the Pirbright Laborat ory, United Kingdom (Reid et al. 1999), that was also used in some phases of our work. This conventional RT-PCR assay most likely represented the most sensitive diagnostic assay for the detection of marine vesiviruses in clinical samples available at the time. More recently, a rRT-PCR was developed by the same group (Reid et al. 2007) and reported to have improve d sensitivity and specificity in relation to the conventio nal RT-PCR assay. However, as previously discussed, the new rRTPCR developed during the course of our work se ems to be more sensitive than the rRT-PCR previously reported, and it also de tected vesiviruses such as SMSV-8 and SMSV-12 not detected by the Pirbright Laboratory assay. Because of these improved features, it is recommended that our more sensitive and specific rRT-PCR assay be us ed in the search for vesiviruses in marine mammals that inhabit the US Atlantic coast a nd the Gulf of Mexico. Unfortunately, our rRTPCR assay had not been developed when the majo rity of the tissue samples were tested and evaluated for marine vesiviruses. Due to time co nstraints, the availabil ity of additional sample material, and the length of time the viral RNA ha s been stored, it is not possible to repeat the

PAGE 171

171 testing with these samples in our rRT-PCR assay. Future tissue samples received should be evaluated by conventional RT-PCR as well as rR T-PCR, and virus isola tion in cell culture. In conclusion, we evaluated 223 marine ma mmal samples for the pr esence of marine vesiviruses, and did not find any evidence of the virus, its nucleic acid, or antibodies to these viruses. These results may suggest that marine vesiviruses are not pres ently infecting marine mammals that inhabit the southeas tern coasts of the Atlantic Oc ean. However, the number of samples tested was much lower than the number assayed from marine mammals from the Pacific Ocean. Further testing of a more significant num ber of oropharyngeal and rectal swab samples from marine mammals that inhab it the northern U.S. waters of th e Atlantic Ocean is needed. The newly developed rRT-PCR is highly recomme nded as the primary diagnostic tool for the search of yet unrecognized vesiviru ses in the Atlantic Ocean.

PAGE 172

172Table 6-1. Primers used for the detecti on of caliciviruses and the control betaactin gene in marine mammal tissues. Primer Sequence Sense Amplicon Product length (bp) Source CR-436 GTGAGGTGTTTGAGAATT AG + Calicivirus capsid frag ment 768 Reid et al. 1999 CR-437 ACATCAATTCCGCCAGACCA Calicivirus capsid fragme nt 768 Reid et al. 1999 CR-244 GAGAAGCTGTGCTACGTCGC + Beta-actin 275 Smolarek-Benson, 2005 CR-245 CCAGACAGCACTGTGTTGGC Beta -actin 275 Smolarek-Benson, 2005

PAGE 173

173Table 6-2. Tissues and samples collected fr om stranded or captive animals from the A tlantic Ocean and tested for marine vesivi ruses. All tissues were tested by RT-PCR, and so me by virus isolation in cell culture. All samples were negative for marine vesiviruses. ID Species Animal ID Tissue Location Date Collected V1444 Steno bredanensis MML-0414D spleen St. Lucie, FL Aug. 6 2004 V1446 Steno bredanensis MML-0414D lung St. Lucie, FL Aug. 6 2004 V1449 Steno bredanensis MML-0414D lymphnode St. Lucie, FL Aug. 6 2004 V1451 Steno bredanensis MML-0414D brain St. Lucie, FL Aug. 6 2004 V1452 Steno bredanensis MML-0414E spleen St. Lucie, FL Aug. 6 2004 V1454 Steno bredanensis MML-0414E brain St. Lucie, FL Aug. 6 2004 V1457 Steno bredanensis MML-0414E lymphnode St. Lucie, FL Aug. 6 2004 V1459 Steno bredanensis MML-0414E large intestine St. Lucie, FL Aug. 6 2004 V1462 Kogia breviceps GA2004030 lung Sea Island, GA Sep. 8 2004 V1463 Kogia breviceps GA2004030 liver Sea Island, GA Sep. 8 2004 V1464 Kogia breviceps GA2004030 spleen Sea Island, GA Sep. 8 2004 V1465 Kogia breviceps GA2004030 brain Sea Island, GA Sep. 8 2004 V1468 Kogia breviceps MMES2004090SC spleen South Carolina Sep. 8 2004 V1470 Kogia breviceps MMES2004090SC liver South Carolina Sep. 8 2004 V1472 Kogia breviceps MMES2004089SC liver South Carolina Sep. 8 2004 V1473 Kogia breviceps MMES2004089SC lung South Carolina Sep. 8 2004 V1474 Kogia breviceps MMES2004092SC liver South Carolina Sep. 8 2004 V1477 Kogia breviceps MMES2004092SC lung South Carolina Sep. 8 2004 V1480 Kogia breviceps MMES2004092SC spleen South Carolina Sep. 8 2004 V1482 Kogia breviceps MMES2004088SC lung South Carolina Sep. 8 2004 V1485 Kogia breviceps MMES2004088SC spleen South Carolina Sep. 8 2004 V1489 Tursiops truncatus MMES2004085SC lung South Carolina Sep. 8 2004 V1496 Tursiops truncatus MMES2004084SC lung North Carolina Sep. 8 2004 V1500 Tursiops truncatus MMES2004084SC cerebrum South Carolina Sep. 8 2004 V1502 Tursiops truncatus MMES2004084SC thymus South Carolina Sep. 8 2004 V1503 Tursiops truncatus MMES2004123SC lung South Carolina Sep. 8 2004 V1504 Tursiops truncatus MMES2004123SC kidney South Carolina Sep. 8 2004 V1506 Tursiops truncatus MMES2004123SC spleen South Carolina Sep. 8 2004 V1505 Tursiops truncatus MMES2004123SC spleen South Carolina Sep. 8 2004

PAGE 174

174Table 6-2. Continued. ID Species Animal ID Tissue Location Date Collected V1509 Tursiops truncatus KMS365 liver South Carolina Sep. 28 2004 V1510 Tursiops truncatus KMS365 pancreas South Carolina Sep. 28 2004 V1511 Tursiops truncatus KMS365 thyroid South Carolina Sep. 28 2004 V1512 Tursiops truncatus KMS365 lymph nodetracheal South Carolina Sep. 28 2004 V1513 Tursiops truncatus KMS365 lymph nodeprescapular South Carolina Sep. 28 2004 V1514 Tursiops truncatus KMS367 cerebrum South Carolina Sep. 28 2004 V1514 Tursiops truncatus KMS367 cerebrum South Carolina Sep. 28 2004 V1515 Tursiops truncatus KMS367 lung South Carolina Sep. 28 2004 V1515 Tursiops truncatus KMS367 lymph nodelung South Carolina Sep. 28 2004 V1516 Tursiops truncatus KMS367 spleen South Carolina Sep. 28 2004 V1516 Tursiops truncatus KMS367 spleen South Carolina Sep. 28 2004 V1519 Tursiops truncatus KMS367 lung South Carolina Sep. 28 2004 V1519 Tursiops truncatus KMS367 lung South Carolina Sep. 28 2004 V1521 Tursiops truncatus KMS367 cerebrum South Carolina Sep. 28 2004 V1522 Grampus griseus GMC028 cerebrum North Carolina Sep. 24 2004 V1523 Grampus griseus GMC028 cerebrum North Carolina Sep. 24 2004 V1524 Grampus griseus GMC028 cerebrum North Carolina Sep. 24 2004 V1527 Grampus griseus GMC028 spleen North Carolina Sep. 24 2004 V1527 Grampus griseus GMC028 spleen North Carolina Sep. 24 2004 V1531 Grampus griseus GMC028 penile lesion North Carolina Sep. 24 2004 V1537 Grampus griseus KMS364 liver North Carolina Sep. 24 2004 V1537 Grampus griseus KMS364 spleen North Carolina Sep. 24 2004 V1542 Steno bredanensis Noah-CCTX blow hole swab Corpus Christi, TX Oct. 1 2004 V1543 Steno bredanensis Noah-CCTX pharyngeal swab Corpus Christi, TX Oct. 1 2004 V1550 Tursiops truncatus MAR 50403 lung Florida Oct. 10 2004 V1561 Kogia breviceps MAR 50402 lung Florida Oct. 10 2004 V1573 Tursiops truncatus MIA0414 lung Florida Oct. 10 2004 V1610 Tursiops truncatus MAR50402 lung Florida Oct. 10 2004 V1616 Grampus griseus MMCGg022004 lung Florida Oct. 10 2004 V1635 Physeter macrocephalus FKMMRT0403 lung Florida Oct. 10 2004 V1645 Steno bredanensis GW04008A cerebrum Florida Keys Oct. 5 2004

PAGE 175

175Table 6-2. Continued. ID Species Animal ID Tissue Location Date Collected V2129 Grampus griseus MML-0514A "Bonnie" vaginal lesion Mote Marine Lab Sep. 26 2005 V2175 Grampus griseus MML-0514A "Bonnie" blood Mote Marine Lab Feb. 13 2006 V2176 Grampus griseus MML-0514A "Bonnie" blood Mote Marine Lab Feb. 13 2006 V2177 Grampus griseus MML-0514A "Bonnie" blood Mote Marine Lab Feb. 13 2006 V2178 Tursiops truncatus MML9628 skin Mote Marine Lab 1996 V2179 Tursiops truncatus MML9628 liver Mote Marine Lab 1996 V2229 Grampus griseus 06-32-81 cerebellum Mote Marine Lab Feb. 7 2006 V2230 Grampus griseus MML-0514A "Bonnie" brain Mote Marine Lab Feb. 7 2006 V2231 Grampus griseus MML-0514A "Bonnie" spleen Mote Marine Lab Feb. 7 2006 V2232 Grampus griseus MML-0514A "Bonnie" placenta Mote Marine Lab Feb. 7 2006 V2233 Grampus griseus MML-0514A "Bonnie" liver Mote Marine Lab Feb. 7 2006 V2234 Grampus griseus MML-0514A "Bonnie" brain stem Mote Marine Lab Feb. 7 2006 V2235 Grampus griseus MML-0514A "Bonnie" pharynx Mote Marine Lab Feb. 7 2006 V2236 Grampus griseus MML-0514A "Bonnie" tonsil Mote Marine Lab Feb. 7 2006 V2237 Grampus griseus MML-0514A "Bonnie" brain medulla Mote Marine Lab Feb. 7 2006 V2238 Grampus griseus MML-0514A "Bonnie" kidney Mote Marine Lab Feb. 7 2006 V2239 Grampus griseus MML-0514A "Bonnie" pancreas Mote Marine Lab Feb. 7 2006 V2240 Grampus griseus MML-0514A "Bonnie" lung Mote Marine Lab Feb. 7 2006 V2241 Grampus griseus MML-0514A "Bonnie" heart Mote Marine Lab Feb. 7 2006 V2242 Grampus griseus MML-0514A "Bonnie" adrenal Mote Marine Lab Feb. 7 2006 V2243 Grampus griseus MML-0514A "Bonnie" small intestine Mote Marine Lab Feb. 7 2006 V2244 Grampus griseus MML-0514A "Bonnie" lymph node-prescapular Mote Marine Lab Feb. 7 2006 V2245 Grampus griseus MML-0514A "Bonnie" uterus Mote Marine Lab Feb. 7 2006 V2247 Grampus griseus MML-0514A "Bonnie" lymph nodepulmonary Mote Marine Lab Feb. 7 2006 V2248 Grampus griseus MML-0514A "Bonnie" large intestin e Mote Marine Lab Feb. 7 2006 V2249 Grampus griseus MML-0514A "Bonnie" lung Mote Marine Lab Feb. 7 2006 V2250 Grampus griseus MML-0514A "Bonnie" lymph nodepancreatic Mote Marine Lab Feb. 7 2006 V2251 Tursiops truncatus MML-0606 skin lesion Mote Marine Lab Feb. 15 2006 V2252 Tursiops truncatus MML-0606 skin lesion Mote Marine Lab Feb. 15 2006 V2339 Tursiops truncatus MML-0606 brain Mote Marine Lab Mar. 8 2006 V2340 Tursiops truncatus MML-0606 liver Mote Marine Lab Mar. 8 2006

PAGE 176

176Table 6-2. Continued. ID Species Animal ID Tissue Location Date Collected V2341 Tursiops truncatus MML-0606 heart Mote Marine Lab Mar. 8 2006 V2342 Tursiops truncatus MML-0606 spleen Mote Marine Lab Mar. 8 2006 V2343 Tursiops truncatus MML-0606 kidney Mote Marine Lab Mar. 8 2006 V2344 Tursiops truncatus MML-0606 lung Mote Marine Lab Mar. 8 2006 V2345 Tursiops truncatus MML-0606 lymph node Mote Marine Lab Mar. 8 2006 V2346 Tursiops truncatus MML-0606 skin Mote Marine Lab Mar. 8 2006 V2359 Tursiops truncatus NO6-166 kidney Florida Mar. 10 2006 V2360 Tursiops truncatus NO6-166 lung Florida Mar. 10 2006 V2361 Tursiops truncatus NO6-166 heart Florida Mar. 10 2006 V2362 Tursiops truncatus NO6-166 skin lesion Florida Mar. 10 2006 V2363 Tursiops truncatus NO6-166 tongue Florida Mar. 10 2006 V2364 Tursiops truncatus NO6-166 tongue scraping Florida Mar. 10 2006 V2365 Tursiops truncatus NO6-166 lip scraping Florida Mar. 10 2006 V2375 Tursiops truncatus NO6-199 kidney Florida May 2 2006 V2376 Tursiops truncatus NO6-199 liver Florida May 2 2006 V2377 Tursiops truncatus NO6-199 lung Florida May 2 2006 V2378 Tursiops truncatus NO6-199 brain Florida May 2 2006 V2379 Tursiops truncatus NO6-199 spinal cord Florida May 2 2006 V2380 Tursiops truncatus spinal cord Gulfport, MS May 31 2006 V2381 Tursiops truncatus spleen Gulfport, MS May 31 2006 V2382 Tursiops truncatus liver Gulfport, MS May 31 2006 V2383 Tursiops truncatus lung Gulfport, MS May 31 2006 V2384 Tursiops truncatus cerebrum Gulfport, MS May 31 2006 V2385 Tursiops truncatus kidney Gulfport, MS May 31 2006 V2386 Tursiops truncatus cerebellum Gulfport, MS May 31 2006 V2387 Tursiops truncatus large intestine swab Gulfport, MS May 31 2006 V2388 Tursiops truncatus blow hole swab Gulfport, MS May 31 2006 V2435 Stenella longirostris MML-0509 "Harley" oral lesion sw ab Mote Marine Lab Sep. 13 2006 V2500 Tursiops truncatus kidney Gulfport, MS Oct. 2006 V2501 Tursiops truncatus lung Gulfport, MS Oct. 2006 V2677 Stenella longirostris MML-0509 "Harley" oral swab Mote Marine Lab Nov. 2007

PAGE 177

177Table 6-3. Serum and plasma samples collec ted from marine mammals from the Atlantic Ocean and Gulf of Mexico. All samples were tested by enzyme linked immunosorbent assay for th e presence of antibodies to the marine vesiviruses. ID Species Animal ID Sample Location Date Collected Phocoena phocoena serum Atlantic Ocean Phocoena phocoena serum Atlantic Ocean V2042 Grampus griseus MML-0514A “Bonnie” serum Mote Marine Lab Aug 2, 2005 V2047 Grampus griseus MML-0514B “Clyde" serum Mote Marine Lab Aug 2, 2005 V2640 Grampus griseus MML-0706B “Wilma” plasma Mote Marine Lab Jun 6, 2007 V2641 Grampus griseus MML-0706AA “Big Al” plasma Mote Marine Lab Jun 6, 2007 V2642 Grampus griseus MML-0706A “Betty” plasma Mote Marine Lab Jun 6, 2007 V2068 Trichechus manatus latirostris “Betsy” serum Crystal River, FL Jul 9, 1998 V2070 Trichechus manatus latirostris “Holly” serum Crystal River, FL Aug 22, 2002 V2072 Trichechus manatus latirostris “Oakley” serum Crystal River, FL Jun 20, 2002 V2075 Trichechus manatus latirostris “Willoughby” serum Crystal River, FL Feb 25, 1999 V2080 Trichechus manatus latirostris “Amanda” serum Crystal River, FL Jan 13, 2000 V2081 Trichechus manatus latirostris “Lorelei” serum Crystal River, FL Jan 13, 2000 V2083 Trichechus manatus latirostris “Ariel” serum Feb 20, 2001 V2084 Trichechus manatus latirostris “Star” serum Jul 9, 1998 V2840 Trichechus manatus latirostris CSW035 serum Southwest FL Jan 30, 2001 V2841 Trichechus manatus latirostris 2 serum May 2001 V2842 Trichechus manatus latirostris CWS serum Southwest FL Jan 2001 V2843 Trichechus manatus latirostris Ttb065 serum Tampa Bay, FL Feb 27, 2001 V2844 Trichechus manatus latirostris LC210320 serum May 4, 2001 V2845 Trichechus manatus latirostris 1348 serum May 4, 2001 V2846 Trichechus manatus latirostris Playton serum Feb 26, 2001 V2847 Trichechus manatus latirostris CSW037 serum Southwest FL Jan 31, 2001 V2848 Trichechus manatus latirostris CSW036 serum Southwest FL Jan 30, 2001 V2849 Trichechus manatus latirostris TTB061 serum Tampa Bay, FL Feb 23, 2001 V2850 Trichechus manatus latirostris TNP-11 serum Jan 21, 2001 V2851 Trichechus manatus latirostris 12 serum V2852 Trichechus manatus latirostris FSW031 serum Southwest FL Jan 30, 2001 V2853 Trichechus manatus latirostris TNP-21 serum Mar 21, 2001

PAGE 178

178Table 6-3. Continued. ID Species Animal ID Sample Location Date Collected V2854 Trichechus manatus latirostris TSW-033 serum Southwest FL Jan 30, 2001 V2855 Trichechus manatus latirostris TSW-034 serum Southwest FL Jan 31, 2001 V2856 Trichechus manatus latirostris LP2101357 “Cupid” serum V2857 Trichechus manatus latirostris TNP-10 serum Mar 20, 2001 V2858 220962813a serum May 16, 2001 V2869 220962813b serum May 16, 2001 V2860 620410078 serum May 16, 2001 V2090 Trichechus manatus manatus BZ03F28 serum Belize Apr 19, 2005 V2783 Steno bredanesis MML0103A “Ami” serum Mote Marine Lab Aug 5, 2002 V2784 Steno bredanesis MML0108 “Nemo” serum Mote Marine Lab Jan 10, 2001 V2786 Feresa attenuata MML9805 serum Mote Marine Lab Aug 25, 1998 V2788 Tursiops truncatus MML9905 serum Mote Marine Lab Aug 1, 1999 V2792 Stenella attenuata MML0326 “Moonshine” serum Mote Marine Lab Mar 28, 2007 V2796 Steno bredanesis MML0509 “Harley” serum Mote Marine Lab Feb 5, 2007 V2799 Steno bredanesis MML0237 “Vixen” serum Mote Marine Lab Jul 28, 2003 V2801 Steno bredanesis MML0414C “Bashful” serum Mote Marine Lab Sep 15, 2004 V2803 Steno bredanesis MML0414G “Sneezy” serum Mote Marine Lab Jan 28, 2005 V2804 Steno bredanesis MML0414A “Doc” serum Mote Marine Lab Sep 27, 2004 V2805 Steno bredanesis MML0414B “Dopey” serum Mote Marine Lab Aug 20, 2004 V2806 Steno bredanesis MML0414D “Happy” serum Mote Marine Lab Aug 9, 2004 V2809 Steno bredanesis MML0414F “Sleepy” serum Mote Marine Lab Jan 28, 2005 V2810 Kogia breviceps MML0234 “Armand” serum Mote Marine Lab Jan 13, 2003 V2812 Tursiops truncatus MML0311 “CR” serum Mote Marine Lab Apr 22, 2003 V2813 Delphinus delphis MML0004 serum Mote Marine Lab Feb 9, 2000 V2814 Kogia breviceps MML0006 serum Mote Marine Lab Feb 20, 2000 V2815 Tursiops truncatus MML0008 serum Mote Marine Lab Mar 7, 2000 V2816 Kogia breviceps MML0009 serum Mote Marine Lab Mar 13, 2000 V2817 Kogia breviceps MML0017 serum Mote Marine Lab Oct 2, 2000 V2820 Tursiops truncatus MML0334 “Jack” serum Mote Marine Lab Jan 19, 2004 V2821 Tursiops truncatus MML0403 “Toro” serum Mote Marine Lab Mar 15, 2004

PAGE 179

179Table 6-3. Continued. ID Species Animal ID Sample Location Date Collected V2823 Tursiops truncatus MML0605 “Val” serum Mote Marine Lab May 3, 2006 V2825 Tursiops truncatus MML0624 “Castaway” serum Mote Marine Lab Jan 8, 2007 V2827 Tursiops truncatus MML0701 “Filly” serum Mote Marine Lab Mar 23, 2007 V2829 Tursiops truncatus MML0705 “Dancer serum Mote Marine Lab Apr 23, 2007 V2831 Grampus griseus MML0706B “Wilma” serum Mote Marine Lab Jun 1, 2007 V2834 Grampus griseus MML0706A “Betty” serum Mote Marine Lab Aug 20, 2007 V2836 Grampus griseus MML0706AA “Big Al” serum Mote Marine Lab Aug 31, 2007 V2837 Grampus griseus MML0514B “Clyde” serum Mote Marine Lab Oct 25, 2005 V2838 Grampus griseus MML0514A “Bonnie” serum Mote Marine Lab Oct 10, 2005 V2839 Grampus griseus MML0329 serum Mote Marine Lab Aug 13, 2003 V2861 Feresa attenuata serum Pascagula, MS Apr 18, 2008

PAGE 180

180 CHAPTER 7 CONCLUSIONS The goals for this research were to isolate and characterize marine vesiviruses that are currently circulating in marine mammals and dete rmine if these viruses were novel isolates or ones that had previously been seen in marine ma mmals. If the viruses represented novel isolates, we wanted to characterize the viruses by full genomic sequencing and ph ylogenetic analyses. We wanted to use the data from the characte rization from the novel and existing isolates to develop new diagnostic assays for the detection of the marine vesiviruses. Attainment of these goals here have generated many adva nces in the calicivirus field. The decrease of Stelle r sea lion populations ( Eumetopias jubatus ; SSL) has led to the search for microbial agents, including caliciviruses which may be contributing to this decline. We recovered nine vesivirus isolates from SS L samples in cell culture. The viruses were visualized by electron microscopy, and demonstrated to be members of the Vesivirus genus by sequence analyses of a 768-bp RT-PCR product from the capsid gene. Multiple sequence analyses and phylogeny revealed th at these isolates grouped in tw o distinct and novel genotypes. The prototype isolates were designated V810 and V1415. The complete genomes of both isolates were sequenced to make possible the full genetic characterization. Through these analyses, we identified conserve d and variable regions within the genomes. The capsid gene, ORF2, was th e most divergent region of both genomes, especially in the hypervariable E region, respons ible for the antigenic determination of the serotypes. The most conserved areas of the ge nome were found in the n on-structural genes of ORF1 that included the RNA polymerase, helicase and protease genes. Of the more than 40 described serotypes of marine vesiviruses, only the genomes of five viruses have been completely sequenced. From the present research, we have added two additional full genomic

PAGE 181

181 sequences, which should aid in im proving the reliability of genetic analyses to better understand the relationship between previously descri bed serotypes and newly emerging genotypes. Because of the lack of availability of sero logical assays for the mass screening of sera, limited serological surveys were conducted us ing the virus neutralization (VN) assay to determine the presence of these novel genotypes within SSL populations. The VN titers in SSL sera suggested that new genotypes might be temp orally emerging in these SSL populations, most likely replacing previously circ ulating vesiviruses. This em ergence could be facilitated by mutations in the capsid gene, which may allo w the new genotypes to evade the host immune system and become the most prevalent viruses. To detect active vesivirus in fections, we have developed a novel real-time RT-PCR (rRTPCR) assay for the identification of marine vesivi ruses in clinical and di agnostic samples. The real-time assay targeted a 176 nucleotide fragment within the conserved A region of the capsid gene and successfully detected 12 different marine vesiviruses, including two serotypes that had not been identified using previous ly described diagnostic assays. This assay was specific for marine vesiviruses, as it did not am plify closely related members of the Caliciviridae family such as human noroviruses and feline calicivirus es. The assay was found to be at least 10,000 times more sensitive than conve ntional RT-PCR assays that were previously described. This rRT-PCR assay is also quantitative and is capab le of detecting 10 copies of plasmid DNA or 100 copies of viral RNA. This nove l diagnostic assay can be used as a rapid, sensitive, and specific assay to detect marine vesiviruse s in clinical samples such as oropharyngeal and rectal swabs and vesicle fluids. The novel marine vesiviruses were used to produce virus-like particles (VLPs) in the baculovirus expression system. This was the fi rst demonstration of VLPs from the marine

PAGE 182

182 vesivirus group. The VLPs were virtually indisti nguishable from the native virions, as they are identical in size and structure when observed by the electron microscope. The VLPs are antigenically reactive, as they bind to vesiviru s antibodies, yet the VLPs are non-infectious. The marine vesiviruses are considered restricted viruses because of the vesicular disease they produce in livestock; therefore, a non-infectious protein that can be used in diagnostic assays is crucial for safe and approved laboratory research and this is the case of the recombinant vesivirus VLPs described here. The VLPs thus can be used as diagnostic antigens instead of infectious virus, and to this end, we have successfully used the VLPs to develop a diagnostic enzyme linked immunosorbent assay (ELISA). The VLPs were co ated onto 96-well plates as antigens and used to detect antibodies in free-ra nging mammal serum samples. We tested 97 serum samples from marine mammals and found that the VLPs not only reacted with sera from SSL from the geographical regions from where th e viruses had been isolated, but were also cross-reactive with antibodies against other marine ve sivirus serotypes. This cross -reactivity was demonstrated in the case of 24 specific antisera of different cal icivirus serotypes including San Miguel sea lion viruses and vesicular exanthema of swine viruses. Therefor e, VLPs make good diagnostic antigens for the detection of an tibodies to the marine vesiviru ses in populations of marine mammals with the unsurpassable ad vantage of being cross-reactive with most, if not all, known marine vesiviruses. We have partially characterized two marine vesiviruses that are considered atypical members of the Vesivirus genus and had not previously be en detected or identified using published diagnostic assays. The first nucleotid e sequences for serotypes SMSV-8 and SMSV12 were obtained after amplification with the newly developed rRT-PCR and conventional RTPCR. Sequence analysis of fragments of the cap sid gene showed that these viruses are very

PAGE 183

183 different from known vesiviruses, which probably explains why these viruses were not detected by previous assays. In an effort to determine whether vesiviruse s may occur in marine mammals that inhabit the Atlantic Ocean in the southeastern region of the United States, we collected samples from stranded and captive marine mammals though estab lished connections with stranding networks and marine facilities in the s outheastern region. A total of 22 3 samples from several marine mammal species were assayed for virus isolation in cell cultures, RT-PCR to detect viral RNA, and ELISA to test for antibodies. No evid ence was found for the oc currence of marine vesiviruses in the Atlantic Ocean off the southeas t region of the United States or in the Gulf of Mexico. These negative findings may indicate th at the sample size may not have been large enough to detect vesiviruses in the region. It is also possible that marine vesiviruses may not be active or present in the Atlantic Ocean, due to the ocean temperatures and to the species of marine mammals that inhabit these waters. It is recommended that testing with sensitive diagnostic assays be continued; in the case of antibodies, using the novel ELISA here described, and in the case of virus, usi ng the improved real-tim e RT-PCR assay also described in this dissertation. In conclusion, we have advanced the field of marine calicivirus re search through the work conducted during the course of th is dissertation. We have isol ated and characterized two novel viral members of the Vesivirus genus through full genomic sequenc ing. We have also partially characterized two atypical marine vesiviruses, which previously had not been analyzed. A novel diagnostic technique in the form of an ELISA platform that uses recombinant virus-like particles as antigen was developed for the detection of antibodies to marine ve siviruses. The newly developed rRT-PCR is an improve ment over previously described assays to identify vesivirus

PAGE 184

184 RNA as it correctly detects previ ously undetected vesiviruses. Th e marine vesiviruses represent important emerging viruses, not only in the marine environment, but also in the terrestrial one, as they pose a threat to livestock and be cause of their zoonotic potential.

PAGE 185


PAGE 186

186Table A-1. Steller sea lions ( Eumetopias jubatus ) sampled from Alaska. Each sample was tested for marine vesiviruses by cell culture with African green monkey ki dney (Vero), Madin-Darby canine kidne y (MDCK), or embryonic swine kidney (ESK) cell cultures. Some samples were also anal yzed by RT-PCR for the presence of vesivirus RNA. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture RT-PCR V1722 SSL225SE01 14 M rectal swab Biali Rocks Negative MDCK V1723 SSL217SE01 14 M rectal swab Biali Rocks Negative MDCK V1724 SSL224SE01 14 F rectal swab Biali Rocks Negative MDCK V1725 SSL230SE01 2 M rectal swab Hazy I Negative MDCK V1726 SSL226SE01 14 M rectal swab Biali Rocks Negative MDCK V1727 SSL227SE01 14 M oral viral swab Biali Rocks Negative MDCK V1728 SSL226SE01 14 M oral swab Biali Rocks Negative MDCK V1729 SSL236SE01 14 M oral viral swab SW Brothers Negative MDCK V1730 SSL230SE01 2 M oral swab Hazy I Negative MDCK V1731 SSL232SE01 14 M rectal swab SW Brothers Negative MDCK V1732 SSL231SE01 2 F rectal viral swab Hazy Island Negative MDCK V1733 SSL235SE01 14 M oral viral swab SW Brothers Negative MDCK V1734 SSL239SE01 14 M oral viral swab SW Brothers Negative MDCK V1735 SSL215SE01 14 M oral viral swab Biali Rocks Negative MDCK V1736 SSL219SE01 14 M oral viral swab Biali Rocks Negative MDCK V1737 SSL237SE01 14 M rectal viral swab SW Brothers Negative MDCK V1738 SSL236SE01 14 M rectal viral swab SW Brothers Negative MDCK V1739 SSL237SE01 14 M oral viral swab SW Brothers Negative MDCK V1740 SSL215SE01 14 M rectal viral swab Biali Rocks Negative MDCK V1741 SSL230SE01 2 M rectal viral swab Hazy I Negative MDCK V1742 SSL234SE01 14 M rectal viral swab SW Brothers Negative MDCK V1743 SSL218SE01 14 F oral viral swab Biali Rocks Negative MDCK V1745 SSL212SE01 2 M rectal viral swab White Sisters Negative MDCK V1746 SSL217SE01 14 M oral viral swab Biali Rocks Negative MDCK V1744 SSL214SE01 26 F rectal viral swab White Sisters Negative MDCK V1747 SSL222SE01 14 F oral viral swab Biali Rocks Negative MDCK V1748 SSL218SE01 14 F oral viral swab Biali Rocks Negative MDCK V1749 SSL204SE01 11 F rectal viral swab Gran Point Negative MDCK V1750 SSL209SE01 2 F oral viral swab White Sisters Negative MDCK V1751 SSL214SE01 26 F oral viral swab White Sisters Negative MDCK

PAGE 187

187Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1752 SSL212SE01 2 M oral viral swab White Sisters Negative MDCK V1753 SSL213SE01 2 F rectal viral swab White Sisters Negative MDCK V1754 SSL207SE01 2 F rectal viral swab White Sisters Negative MDCK V1755 SSL207SE01 2 F oral viral swab White Sisters Negative MDCK V1756 SSL218SE01 14 F rectal viral swab Biali Rocks Negative MDCK V1757 SSL224SE01 14 F oral viral swab Biali Rocks Negative MDCK V1758 SSL208SE01 2 F oral viral swab White Sisters Negative MDCK V1759 SSL209SE01 2 F oral viral swab White Sisters Negative MDCK V1760 SSL208SE01 2 F rectal viral swab White Sisters Negative MDCK V1761 SSL213SE01 2 F oral viral swab White Sisters Negative MDCK V1762 SSL231SE01 2 F oral viral swab Hazy Island Negative MDCK V1763 SSL233SE01 14 F rectal viral swab SW Brothers Negative MDCK V2334 SSL242SE01 14 M rectal swab SW Brothers Negative Vero V2335 SSL250AL01 3 F oral swab South Clubbing Rock Negative Vero V2336 SSL249AL01 3 M vesicle swab South Clubbing Rock Negative Vero V2338 SSL249AL01 3 M oral swab South Clubbing Rock Negative Vero V832 SSL260AL01 3 F oral viral Cape Morgan Negative Vero, ESK V833 SSL268PWS01 5 M rectal viral Gl acier Island Negative Vero, ESK V834 SSL268PWS01 5 M oral viral Glacier Island Negative Vero, ESK V835 SSL272PWS01 5 M oral viral Perry Island Negative Vero, ESK V836 SSL272PWS01 5 M rectal viral Perry Island Negative Vero, ESK V837 SSL279PWS01 5 F rectal viral Perry Island Negative Vero, ESK V846 SSL287PWS01 5 M rectal swab Perry Island Negative Vero V847 SSL285PWS01 5 M oral swab Perry Island Negative Vero V848 SSL290PWS01 5 F rectal swab Perry Island Positive Vero V838 SSL280PWS01 17 M oral viral Perry Island Negative Vero, ESK V849 SSL286PWS01 17 F oral swab Perry Island Positive Vero V850 SSL291PWS01 17 M rectal swab Perry Island Negative Vero V851 SSL291PWS01 17 M oral swab Perry Island Negative Vero V852 SSL286PWS01 17 F rectal swab Perry Island Negative Vero V854 SSL290PWS01 5 F oral swab Perry Island Negative Vero V855 SSL285PWS01 5 M rectal swab Perry Island Positive Vero

PAGE 188

188Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V856 SSL279PWS01 5 F oral swab Perry Island Negative Vero V857 SSL272PWS01 5 M rectal swab Perry Island Positive Vero V858 SSL267PWS01 17 M oral swab Glacier Island Negative Vero V859 SSL263AL01 15 M rectal sw ab Billinghead Negative Vero V861 SSL255AL01 3 F rectal swab Cape Morgan Negative Vero V862 SSL294PWS01 17 F rectal swab Perry Island Negative Vero V863 SSL289PWS01 5 F rectal swab Perry Island Negative Vero V868 SSL259AL01 3 M rectal viral cu lture Cape Morgan Negative Vero V869 SSL255AL01 3 F oral viral culture Cape Morgan Negative Vero V870 SSL293PWS01 29 F rectal viral culture Perry Island Negative Vero V871 SSL289PWS01 5 F oral viral culture Perry Island Negative Vero V872 SSL284PWS01 5 F oral viral culture Perry Island Negative Vero V873 SSL278PWS01 5 F rectal viral culture Perry Island Negative Vero V874 SSL271PWS01 5 F oral viral culture Glacier Island Negative Vero V876 SSL262AL01 3 F oral viral culture Cape Morgan Negative Vero V877 SSL258AL01 3 M rectal viral cu lture Cape Morgan Negative Vero V878 SSL293PWS01 29 F oral viral Perry Island Negative Vero V879 SSL254AL01 3 M oral viral culture Ugamak Island Negative Vero V880 SSL288PWS01 5 M rectal viral Perry Island Negative Vero V881 SSL284PWS01 5 F rectal viral Perry Island Negative Vero V882 SSL270PWS01 17 F oral viral Glacier Island Negative Vero V883 SSL277PWS01 5 F oral viral Perry Island Negative Vero V884 SSL265PWS01 5 M rectal viral culture The Needle Negative Vero V885 SSL262AL01 3 F rectal viral cu lture Cape Morgan Negative Vero V886 SSL254AL01 3 M rectal viral cultu re Ugamak Island Negative Vero V887 SSL258AL01 3 M oral viral culture Cape Morgan Negative Vero V888 SSL261AL01 3 F oral viral culture Cape Morgan Negative Vero V889 SSL257AL01 3 F rectal viral cu lture Cape Morgan Negative Vero V890 SSL253AL01 3 M oral viral culture Ugamak Island Negative Vero V891 SSL264PWS01 5 M oral viral culture The Needle Negative Vero V892 SSL287PWS01 5 M oral viral Perry Island Negative Vero V893 SSL281PWS01 5 M rectal viral Perry Island Negative Vero

PAGE 189

189 Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V894 SSL274PWS01 29 M rectal viral Perry Island Negative Vero V895 SSL269PWS01 5 M rectal viral Glacier Island Negative Vero V896 SSL264PWS01 5 M rectal viral culture The Needle Negative Vero V897 SSL261AL01 3 F rectal viral cu lture Cape Morgan Negative Vero V898 SSL257AL01 3 F oral viral culture Cape Morgan Negative Vero V899 SSL253AL01 3 M rectal viral cultu re Ugamak Island Negative Vero V900 SSL292PWS01 5 F rectal viral Perry Island Negative Vero V901 SSL288PWS01 5 M oral viral Perry Island Negative Vero V902 SSL281PWS01 5 M oral viral Perry Island Negative Vero V903 SSL276PWS01 17 M rectal viral Perry Island Negative Vero V904 SSL271PWS01 5 F rectal viral Glacier Island Negative Vero V905 SSL278PWS01 5 F oral viral Perry Island Negative Vero V906 SSL267PWS01 17 M rectal viral cultu re Glacier Island Negative Vero V907 SSL263AL01 15 M oral viral cu lture Billinghead Negative Vero V911 SSL280PWS01 17 M rectal swab Perry Island Negative Vero V912 SSL260AL01 3 F rectal swab Cape Morgan Negative Vero V913 SSL269PWS01 5 M oral swab Glacier Island Negative Vero V914 SSL274PWS01 29 M rectal swab Perry Island Negative Vero V917 SSL260AL01 3 F rectal swab Cape Morgan Negative Vero V921 SSL292PWS01 5 F oral swab Perry Island Negative Vero V923 SSL270PWS01 17 F rectal swab Glacier Island Negative Vero V928 SSL274PWS01 29 M rectal swab Perry Island Negative Vero V942 SSL177SE01 11 M SW Brothers Negative Vero V948 SSL269PWS01 5 M oral swab Glacier Island Negative Vero V947 SSL280PWS01 17 M rectal swab Perry Island Negative Vero V1408 SSL 2002 FDP3 SE 0.5 vesicle ulcer Lowry 1A Negative Vero, MDCK V1418 SSL 2002 FDP3 SE 0.5 F ulcer viral Lowry 1A Negative Vero, MDCK V2258 SSL329PWS02 11 M oral swab Pt. Elington Negative Vero V2259 SSL328PWS02 11 M oral swab The Needle Negative Vero V2260 SSL311PWS02 23 M oral swab Glacier Island Negative Vero V2261 SSL311PWS02 23 M rectal swab Glacier Island Negative Vero

PAGE 190

190Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V2262 SSL288PWS02314 11 M oral swab Glacier Island Negative Vero V2263 SSL288PWS02314 11 M rectal swab Glacier Island Negative Vero V2264 SSL315PWS02 11 F oral swab Glacier Island Negative Vero V2265 SSL317PWS02 23 F oral swab Glacier Island Negative Vero V2266 SSL317PWS02 23 F rectal swab Glacier Island Negative Vero V2267 SSL318PWS02 23 M oral swab Glacier Island Negative Vero V2268 SSL318PWS02 23 M rectal swab Glacier Island Negative Vero V2269 SSL319PWS02 23 M oral swab Glacier Island Negative Vero V2270 SSL319PWS02 23 M rectal swab Glacier Island Negative Vero V2271 SSL320PWS02 11 M oral swab Glacier Island Negative Vero V2272 SSL320PWS02 11 M rectal swab Glacier Island Negative Vero V2273 SSL321PWS02 11 F oral swab The Needle Negative Vero V2274 SSL321PWS02 11 F rectal swab The Needle Negative Vero V2275 SSL322PWS02 23 M oral swab The Needle Negative Vero V2276 SSL322PWS02 23 M rectal swab The Needle Negative Vero V2277 SSL324PWS02 35 M oral swab The Needle Negative Vero V2278 SSL324PWS02 35 M rectal swab The Needle Negative Vero V2279 SSL325PWS02 11 M oral swab The Needle Negative Vero V2280 SSL325PWS02 11 M rectal swab The Needle Negative Vero V2281 SSL327PWS02 11 M oral swab The Needle Negative Vero V2282 SSL327PWS02 11 M rectal swab The Needle Negative Vero V2283 SSL328PWS02 11 M rectal swab The Needle Negative Vero V2284 SSL329PWS02 11 M rectal swab Pt. Elington Negative Vero V2286 SSL330PWS02 11 F rectal swab Pt. Elington Negative Vero V2287 SSL333PWS02 23 M oral swab Procession Rocks Negative Vero V2285 SSL330PWS02 11 F oral swab Pt. Elington Negative Vero V2288 SSL333PWS02 23 M rectal swab Procession Rocks Negative Vero V2289 SSL334PWS02 23 M oral swab Procession Rocks Negative Vero V2290 SSL334PWS02 23 M rectal swab Procession Rocks Negative Vero V2291 SSL2002-362PWS 15 M rectal swab Glacier Island Negative Vero V2292 SSL2002-295-AL 9 M oral swab Seguam I Negative Vero V2293 SSL2002-295-AL 9 M rectal swab Seguam I Negative Vero

PAGE 191

191Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V2294 SSL2002-296-AL 9 M oral swab Seguam I Negative Vero V2295 SSL2002-296-AL 9 M rectal swab Seguam I Negative Vero V2296 SSL2002-297-AL 9 M rectal swab Amlia I Negative Vero V2297 SSL2002-298-AL 9 M oral swab Amlia I Negative Vero V2298 SSL2002-298-AL 9 M rectal swab Amlia I Negative Vero V2299 SSL2002-299-AL 9 F oral swab Silak Islands Negative Vero V2300 SSL2002-299-AL 9 F rectal swab Silak Islands Negative Vero V2301 SSL2002-300-AL 9 M oral swab Silak Islands Negative Vero V2302 SSL2002-300-AL 9 M rectal swab Silak Islands Negative Vero V2303 SSL2002-301-AL 9 F oral swab Silak Islands Negative Vero V2304 SSL2002-302-AL 9 M oral swab Little Tanaga / Silak Is. Negative Vero V2305 SSL2002-302-AL 9 M rectal swab Little Tanaga / Silak Is. Negative Vero V2306 SSL2002-303-AL 9 F oral swab Little Tanaga / Silak Is. Negative Vero V2307 SSL2002-303-AL 9 F rectal swab Little Tanaga / Silak Is. Negative Vero V2308 SSL2002-304-AL 9 F oral swab Little Tanaga / Silak Is. Negative Vero V2309 SSL2002-304-AL 9 F rectal swab Little Tanaga / Silak Is. Negative Vero V2310 SSL2002-305-AL 9 F oral swab Tagalda Is Negative Vero V2311 SSL2002-305-AL 9 F rectal swab Tagalda Is Negative Vero V2312 SSL2002-306-AL 9 F oral swab Oglala Pt/ Kagalaska Is Negative Vero V2313 SSL2002-306-AL 9 F rectal swab Oglala Pt/ Kagalaska Is Negative Vero V2314 SSL2002-307-AL 9 M oral swab Lake Pt on Adak Negative Vero V2315 SSL2002-307-AL 9 M rectal swab Lake Pt on Adak Negative Vero V2317 SSL2002-308-AL 9 M rectal swab Lake Pt on Adak Negative Vero V2318 SSL2002-309-AL 9 M oral swab glala Pt/ Kagalaska Is Negative Vero V2319 SSL2002-309-AL 9 M rectal swab glala Pt/ Kagalaska Is Negative Vero V2316 SSL2002-308-AL 9 M oral swab Lake Pt on Adak Negative Vero V2320 SSL2002-339-SE 12 F oral swab SW Brothers Negative Vero V2321 SSL2002-339-SE 12 F rectal swab SW Brothers Negative Vero V2322 SSL2002-340-SE 12 M rectal swab SW Brothers Negative Vero V2323 SSL2002-341-SE 12 F rectal swab SW Brothers Negative Vero V2324 SSL2002-342-SE 12 F rectal swab SW Brothers Negative Vero V2325 SSL2002-343-SE 12 F rectal swab SW Brothers Negative Vero

PAGE 192

192Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V2326 SSL2002-344-SE 12 M rectal swab SW Brothers Negative Vero V2327 SSL2002-344-SE 12 M oral swab SW Brothers Negative Vero V2328 SSL2002-345-SE 12 F vesicle swab SW Brothers Negative Vero V2329 SSL2002-345-SE 12 F vesicle swab SW Brothers Negative Vero V2330 SSL2002-349-SE 12 F vesicle swab SW Brothers Negative Vero V2331 SSL2002-350-SE 12 M oral swab SW Brothers Negative Vero V2333 SSL2002-385SE 17 M vesicle swab W Brother Negative Vero V2337 SSL2002-364PWS 15 M oral swab Glacier Island Negative Vero V780 SSL2002-396SE 17 F rectal viral culture Benjamin Negative Vero V781 SSL2002-403SE 5 M oral viral culture Benjamin Negative Vero V784 SSL2002-391SE 5 M rectal W Brother Negative Vero V785 SSL2002-395SE 5 F rectal Benjamin Negative Vero V786 SSL2002-391SE 5 M oral W Brother Negative Vero V787 SSL2002-403SE 5 F rectal Benjamin Negative Vero V788 SSL2002-396SE 17 F oral Benjamin Negative Vero V789 SSL2002-399SE 17 M rectal Benjamin Negative Vero V790 SSL2002-400SE 5 F rectal Benjamin Negative Vero V791 SSL2002-401SE 5 F oral Benjamin Negative Vero V792 SSL2002-401SE 5 F rectal Benjamin Negative Vero V793 SSL2002-383SE 5 M rectal SW Brothers Negative Vero V794 SSL2002-395SE 5 F rectal Benjamin Positive Vero V796 SSL2002-397SE 29 M rectal Benjamin Negative Vero V797 SSL2002-399SE 17 M oral Benjamin Negative Vero V798 SSL2002-382SE 5 F rectal viral SW Brothers Negative Vero, ESK V799 SSL2002-387SE 17 F oral viral W Brother Negative Vero, ESK V795 SSL2002-400SE 5 F oral Benjamin Negative Vero V800 SSL2002-383SE 5 M oral viral SW Brothers Negative Vero, ESK V801 SSL2002-384SE 5 M oral viral W Brother Negative Vero, ESK V802 SSL2002-384SE 5 M rectal viral W Brother Negative Vero, ESK V803 SSL2002-385SE 17 M oral viral W Brother Negative Vero, ESK V804 SSL2002-385SE 17 M rectal viral W Brother Negative Vero, ESK V805 SSL2002-386SE 5 M rectal viral W Brother Negative Vero, ESK

PAGE 193

193Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V806 SSL2002-386SE 5 M oral viral W Brother Negative Vero, ESK V807 SSL2002-387SE 17 F rectal viral W Brother Negative Vero, ESK V808 SSL2002-378SE 17 M rectal viral SW Brothers Negative Vero, ESK V809 SSL2002-379SE 5 M rectal viral SW Brothers Negative Vero, ESK V810 SSL2002-379SE 5 M oral viral SW Brothers Positive Vero + ESK V811 SSL2002-380SE 17 M rectal viral SW Brothers Negative Vero, ESK V813 SSL2002-381SE 17 M oral viral SW Brothers Negative Vero, ESK V814 SSL2002-381SE 17 M rectal viral SW Brothers Negative Vero, ESK V815 SSL2002-382SE 5 F oral viral SW Brothers Negative Vero, ESK V816 SSL2002-392SE 29 M oral viral Benjamin Negative Vero, ESK V817 SSL2002-392SE 29 M rectal viral Benjamin Negative Vero, ESK V818 SSL2002-393SE 17 F oral viral Benjamin Negative Vero, ESK V819 SSL2002-388SE 17 F oral viral W Brother Negative Vero, ESK V820 SSL2002-397SE 29 M oral viral Benjamin Negative Vero, ESK V821 SSL2002-380SE 17 M oral viral SW Brothers Negative Vero, ESK V822 SSL2002-398SE 17 M rectal viral Benjamin Negative Vero, ESK V823 SSL2002-394SE 17 M rectal viral Benjamin Positive Vero ESK + V824 SSL2002-378SE 17 M oral viral SW Brothers Positive Vero + ESK V825 SSL2002-390SE 5 M oral viral W Brother Negative Vero, ESK V826 SSL2002-389SE 17 M rectal viral W Brother Negative Vero, ESK V828 SSL2002-388SE 17 F rectal viral W Brother Negative Vero, ESK V829 SSL2002-390SE 5 M rectal viral W Brother Negative Vero, ESK V830 SSL2002-393SE 17 F rectal viral Benjamin Negative Vero, ESK V831 SSL2002-394SE 17 M oral viral Benjamin Negative Vero, ESK V839 SSL2002-359-SE 24 F rectal viral Sunset Island Negative Vero, ESK V827 SSL2002-389SE 17 M oral viral W Brother Negative Vero, ESK V840 SSL2002-318 SE oral viral Negative Vero, ESK V916 SSL2002-359-SE 24 F rectal swab Sunset Island Negative Vero V919 R817 9 F rectal swab Aikt ak (near Ugamak) Negative Vero V933 R817 9 F oral swab Aiktak (near Ugamak) Negative Vero V952 R813 9 M oral swab Aiktak (near Ugamak) Negative Vero V953 R813 9 M rectal swab Aikt ak (near Ugamak) Negative Vero

PAGE 194

194Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V954 R812 9 F rectal swab Aikt ak (near Ugamak) Negative Vero V955 R812 9 F oral swab Aiktak (near Ugamak) Negative Vero V753 SSL2003-425SE 17 M oral viral culture Little Island Negative Vero, ESK V754 SSL2003-438PWS 17 M rectal viral culture Perry Island Negative Vero, ESK V755 SSL2003-438PWS 17 M oral viral culture Perry Island Negative Vero, ESK V756 SSL2003-450PWS 6 M lesion Glacier Negative Vero, ESK V757 SSL2003-438PWS 17 M lesion Perry Island Negative Vero, ESK V758 SSL2003-439PWS 5 M lesion Perry Island Negative Vero, ESK V759 SSL2003-451PWS 6 M lesion Glacier Negative Vero, ESK V760 SSL2003-439PWS 5 M oral viral culture Perry Island Negative Vero, ESK V761 SSL2003-439PWS 5 M rectal viral culture Perry Island Negative Vero, ESK V762 SSL2003-426SE 17 M oral viral culture Benjamin Negative Vero, ESK V763 SSL2003-447PWS 5 F lesion Glacier Negative Vero, ESK V764 SSL2003-457PWS 6 M rectal viral culture Perry Island Negative Vero, ESK V765 SSL2003-454PWS 17 M lesion Perry Island Negative Vero, ESK V766 SSL2003-447PWS 5 F oral viral culture Glacier Negative Vero, ESK V767 SSL2003-458PWS 6 F lesion Perry Island Negative Vero, ESK V768 SSL2003-457PWS 6 M oral viral culture Perry Island Negative Vero, ESK V769 SSL2003-458PWS 6 F rectal viral culture Perry Island Negative Vero, ESK V771 SSL2003-458PWS 6 F oral viral culture Perry Island Negative Vero, ESK V772 SSL2003-426SE 17 M lesion Benjamin Negative Vero, ESK V773 SSL2003-457PWS 6 M lesion Perry Island Negative Vero, ESK V774 SSL2003-447PWS 5 F rectal viral culture Glacier Negative Vero, ESK V775 SSL2003-428SE 5 M lesion Benjamin Negative Vero, ESK V776 SSL2003-428SE 5 M rectal swab Benjamin Negative Vero V770 SSL2003-426SE 17 M rectal viral culture Benjamin Negative Vero, ESK V777 SSL2003-425SE 17 M rectal viral culture Little Island Negative Vero V778 SSL2003-425SE 17 M lesion Little Island Negative Vero V779 SSL2003-428SE 5 M oral viral culture Benjamin Negative Vero V782 SSL2003-407AL 9 F oral Yunaska Negative Vero V783 SSL2003-407AL 9 F rectal Yunaska Negative Vero V915 F3042 0.5 M rectal swab North Rocks Negative Vero

PAGE 195

195Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V918 NR-1-2003 0.5 F lung North Rocks Negative Vero V920 SSL2003-405AL 9 F oral swab Yunaska Negative Vero V922 SSL2003-409AL 9 F oral swab Kagalaska Negative Vero V924 F3024 0.5 F rectal swab North Rocks Negative Vero V925 SSLH319SE03 0.5 F lesions Hazy Island Negative Vero V926 F3034 0.5 F rectal swab North Rocks Negative Vero V927 F3044 0.5 F rectal swab North Rocks Negative Vero V929 SSL2003-407AL 9 F oral swab Yunaska Negative Vero V930 SSL2003-407AL 9 F rectal swab Yunaska Negative Vero V931 SSL2003-408AL 9 F oral swab Kagalaska Negative Vero V932 SSL2003-410AL 21 F rectal swab Kagalaska Negative Vero V934 SSL2003-410AL 21 F oral swab Kagalaska Negative Vero V935 F3016 0.5 F rectal swab North Rocks Negative Vero V936 F3014 0.5 F rectal viral swab North Rocks Negative Vero V937 SSLH319SE03 0.5 F lung Hazy Island Negative Vero V938 SSLH319SE03 0.5 F viral Hazy Island Negative Vero V939 SSL2003-408AL 9 F rectal swab Kagalaska Negative Vero V940 F3042 0.5 rectal swab North Rocks Negative Vero V944 SSL2003-405AL 9 F rectal swab Yunaska Negative Vero V945 SSL2003-404AL 21 F rectal swab Yunaska Negative Vero V946 SSL2003-404AL 21 F oral swab Yunaska Negative Vero V949 SSL2003-406AL 9 M rectal swab Yunaska Negative Vero V950 SSL2003-409AL 9 F oral swab Kagalaska Negative Vero V951 SSL2003-406AL 9 M oral swab Yunaska Negative Vero V956 SSL2003-412AL 9 M rectal swab Kagalaska Negative Vero V957 SSL2003-412AL 9 M oral swab Kagalaska Negative Vero V958 SSLH319SE03 0.5 F Ag or Ln Hazy Island Negative Vero V959 SSLH319SE03 0.5 F spleen Hazy Island Negative Vero V960 SSLH319SE03 0.5 F oral swab Hazy Island Negative Vero V961 SSL2003-411AL 9 F rectal swab Kagalaska Negative Vero V962 SSL2003-411AL 9 F oral swab Kagalaska Negative Vero

PAGE 196

196Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1354 SSL2004-466SE 8 M oral viral culture Benjamin Negative Vero, MDCK V1355 SSL2004-466SE 8 M oral viral PCR Benjamin Negative Vero, MDCK V1356 SSL2004-466SE 8 M rectal viral culture Benjamin Negative Vero, MDCK V1357 SSL2004-466SE 8 M rectal viral PCR Benjamin Negative Vero, MDCK V1358 SSL2004-468SE 8 F oral viral PCR Benjamin Negative Vero, MDCK V1359 SSL2004-468SE 8 F oral viral culture Benjamin Negative Vero, MDCK V1360 SSL2004-472SE 8 M lesion biopsy Benjamin Negative Vero, MDCK V1361 SSL2004-472SE 8 M biopsy Benjamin Negative Vero, MDCK V1362 SSL2004-472SE 8 M lesion viral culture Benjamin Negative Vero, MDCK V1363 SSL2004-472SE 8 M oral viral PCR Benjamin Negative Vero, MDCK V1364 SSL2004-472SE 8 M lesion viral PCR Benjamin Negative Vero, MDCK V1365 SSL2004-472SE 8 M rectal viral culture Benjamin Negative Vero, MDCK V1366 SSL2004-472SE 8 M rectal viral PCR Benjamin Negative Vero, MDCK V1367 SSL2004-472SE 8 M oral viral culture Benjamin Negative Vero, MDCK V1368 SSL2004-473SE 8 F rectal viral culture Benjamin Negative Vero, MDCK V1369 SSL2004-473SE 8 F oral viral PCR Benjamin Negative Vero, MDCK V1371 SSL2004-473SE 8 F oral viral culture Benjamin Negative Vero, MDCK V1372 SSL2004-489AL 11 M oral viral culture Kagalaska Negative Vero, MDCK V1373 SSL2004-489AL 11 M rectal viral culture Kagalaska Negative Vero, MDCK V1374 SSL2004-490AL 11 M lesion viral culture Kagalaska Negative Vero, MDCK V1375 SSL2004-490AL 11 M lesion viral PCR Kagalaska Negative Vero, MDCK V1376 SSL2004-490AL 11 M oral viral culture Kagalaska Negative Vero, MDCK V1377 SSL2004-490AL 11 M rectal viral culture Kagalaska Negative Vero, MDCK V1378 SSL2004-491AL 11 M oral viral culture Kagalaska Negative Vero, MDCK V1370 SSL2004-473SE 8 F rectal viral PCR Benjamin Negative Vero, MDCK V1379 SSL2004-491AL 11 M rectal viral culture Kagalaska Negative Vero, MDCK V1380 SSL2004-492AL 11 M lung Kagalaska Negative Vero V1381 SSL2004-492AL 11 M rectal viral culture Kagalaska Negative Vero V1382 SSL2004-493AL 11 M rectal viral culture Kagalaska Negative Vero V1383 SSL2004-493AL 11 M oral viral culture Kagalaska Negative Vero V1384 SSL2004-494AL 11 M rectal viral culture Kagalaska Negative Vero

PAGE 197

197Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1385 SSL2004-494AL 11 M oral viral culture Kagalaska Negative Vero V1386 SSL2004-495AL 23 F lesion viral culture Semisapochnoi Negative Vero V1387 SSL2004-495AL 23 F rectal viral culture Semisapochnoi Negative Vero V1388 SSL2004-496AL 23 F rectal viral culture Silak Island Negative Vero V1389 SSL2004-496AL 23 F oral viral culture Silak Island Negative Vero V1390 SSL2004 fetus C SE 0 M viral gastric Benjamin Island Negative Vero V1391 SSL2004 fetus C SE 0 M oral viral culture Benjamin Island Negative Vero V1392 SSL2004 fetus C SE 0 M viral PCR Benjamin Island Negative Negative V1393 SSL2004 fetus C SE 0 M PCR lung Benjamin Island Negative Negative V1394 SSL2004-497AL 23 M rectal viral culture Billingshead Akun Island Negative Vero V1395 SSL2004-497AL 23 M oral viral culture Billingshead Akun Island Negative Vero V1396 SSL2004-498AL 35 M oral viral culture Billingshead Akun Island Negative Vero V1398 12F 0.5 F perineal ulcer Sea Lion Rocks Negative Vero, MDCK V1399 12F 0.5 F flipper Sea Lion Rocks Negative Vero, MDCK V1400 14F 0.5 M flipper ulcer swab Sea Lion Rocks Negative Vero, MDCK V1402 27F 0.5 M flipper ulcer swab Sea Lion Rocks Negative Vero, MDCK V1403 28F 0.5 M perineal ulcer swab Sea Lion Rocks Negative Vero, MDCK V1404 57F 0.5 F flipper ulcer North Rocks Negative Vero, MDCK V1405 61F 0.5 M flipper vesicle fluid North Rocks Negative Vero, MDCK V1406 66F 0.5 M perputial ulcer North Rocks Negative Vero, MDCK V1407 156F 0.5 F flippper ulcer North Rocks Gully Negative Vero, MDCK V1410 166F 0.5 M vesicle ulcer North Rocks Gully Negative Vero, MDCK V1409 127F 0.5 M lung North Rocks Gully Negative Vero, MDCK V1401 21F 0.5 M flipper vesicle fluid Sea Lion Rocks Negative Vero, MDCK V1411 158F 0.5 F vesicle ulcer North Rocks Gully Negative Vero, MDCK V1412 168F 0.5 M vesicular fluid North Rocks Gully Negative Vero, MDCK V1413 234F 0.5 F feces Cape Ho rn Rocks Negative Vero, MDCK V1414 241F 0.5 F flipper ulcer swab Cape Horn Rocks Negative Vero, MDCK V1415 250F 0.5 M vesiclar fluid in viral media Cape Horn Rocks Positive MDCK + Vero

PAGE 198

198Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1416 226F 0.5 F flipper vesicle fluid Cape Horn Rocks Negative Vero, MDCK V1417 158F 0.5 F flipper ulcer in media North Rocks Gully Negative Vero, MDCK V1670 SSL2004-500SE 14 M oral lesion Negative Vero, MDCK V1671 SSL2004-500SE 14 M viral oral lesion Negative Vero, MDCK V1672 SSL2004-502SE 14 M viral culture lesion Negative Vero, MDCK V1673 SSL2004-510SE 2 M viral culture lesion Hazy Negative Vero, MDCK V1674 SSL2004-514SE 2 M rectal swab Lowrie Island Negative Vero, MDCK V1675 SSL2004-514SE 2 M viral PCR rectal Lowrie Island Negative Negative V1676 SSL2004-517SE 2 F viral lesion North Rocks Negative Vero, MDCK V1677 SSL2004-517SE 2 F rectal swab North Rocks Negative Vero, MDCK V1678 SSL2004-517SE 2 F viral PCR lesion North Rocks Negative Negative V1680 SSL2004-520SE 2 M PCR rectal swab Lowrie Island Negative Negative V1681 SSL2004-520SE 2 M rectal swab Lowrie Island Negative Vero, MDCK V1682 SSL2004-520SE 2 M viral culture lesion Lowrie Island Negative Vero, MDCK V1683 SSL2004-522SE 2 M viral culture swab Lowrie Island Negative Vero, MDCK V1684 SSL2004-522SE 2 M rectal swab Lowrie Island Negative Vero, MDCK V1685 SSL2004-523SE 2 M viral culture rectal swab Lowrie Island Negative Vero, MDCK V1686 SSL2004-524SE 2 M PCR rectal swab Lowrie Island Negative Negative V1687 SSL2004-524SE 2 M rectal lesion Lowrie Island Negative Vero, MDCK V1688 SSL2004-527SE 2 F RNAlater rectal Lowrie Island Negative Negative V1689 SSL2004-527SE 2 F viral culture lesion Lowrie Island Negative Negative V1690 SSL2004-533SE 2 M culture rectal swab Lowrie Island Negative Vero, MDCK V1691 SSL2004-533SE 2 M RNAlater rectal Lowrie Island Negative Negative V1679 SSL2004-517SE 2 F PCR rectal swab North Rocks Negative Vero, MDCK V1692 SSL2004-539SE 14 M rectal viral swab Negative Vero, MDCK V1853 SSL2004 fetus 5 SE 0 M tissue pool Glacier Island Negative Vero, MDCK V1779 SSL2005-540PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1780 SSL2005-540PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1781 SSL2005-541PWS 84 M oral viral media Perry Island Negative Vero, MDCK

PAGE 199

199Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1782 SSL2005-541PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1783 SSL2005-542PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1784 SSL2005-542PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1785 SSL2005-543PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1786 SSL2005-543PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1787 SSL2005-544PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1788 SSL2005-544PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1789 SSL2005-545PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1791 SSL2005-546PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1792 SSL2005-546PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1793 SSL2005-547PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1794 SSL2005-547PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1795 SSL2005-548PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1796 SSL2005-548PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1797 SSL2005-549PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1798 SSL2005-549PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1799 SSL2005-550PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1800 SSL2005-550PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1801 SSL2005-551PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1802 SSL2005-551PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1803 SSL2005-552PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1804 SSL2005-552PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1805 SSL2005-553PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1806 SSL2005-553PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1807 SSL2005-554PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1808 SSL2005-554PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1790 SSL2005-545PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1809 SSL2005-555PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1810 SSL2005-555PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1811 SSL2005-556PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1812 SSL2005-556PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1813 SSL2005-557PWS 84 M oral viral media Perry Island Negative Vero, MDCK

PAGE 200

200Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1814 SSL2005-557PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1815 SSL2005-558PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1816 SSL2005-558PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1817 SSL2005-559PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1818 SSL2005-559PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1819 SSL2005-559PWS 84 M eye viral Perry Island Negative Vero, MDCK V1820 SSL2005-560PWS 228 F oral viral media Perry Island Negative Vero, MDCK V1822 SSL2005-561PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1823 SSL2005-561PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1824 SSL2005-561PWS 84 M vesicle near rectum Perry Island Negative Vero, MDCK V1825 SSL2005-562PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1826 SSL2005-562PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1827 SSL2005-562PWS 84 M eye lesion Perry Island Negative Vero, MDCK V1828 SSL2005-563PWS 372 F oral viral media Perry Island Negative Vero, MDCK V1829 SSL2005-563PWS 372 F rectal viral media Perry Island Negative Vero, MDCK V1830 SSL2005-564PWS 228 F oral viral media Perry Island Negative Vero, MDCK V1831 SSL2005-564PWS 228 F rectal viral media Perry Island Negative Vero, MDCK V1832 SSL2005-565PWS 228 F oral viral media Perry Island Negative Vero, MDCK V1833 SSL2005-565PWS 228 F rectal viral media Perry Island Negative Vero, MDCK V1834 SSL2005-566PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1835 SSL2005-566PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1836 SSL2005-567PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1837 SSL2005-567PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1838 SSL2005-568PWS 84 F oral viral media Perry Island Negative Vero, MDCK V1839 SSL2005-568PWS 84 F rectal viral media Perry Island Negative Vero, MDCK V1840 SSL2005-569PWS 84 M oral viral media Perry Island Negative Vero, MDCK V1821 SSL2005-560PWS 228 F rectal viral media Perry Island Negative Vero, MDCK V1841 SSL2005-569PWS 84 M rectal viral media Perry Island Negative Vero, MDCK V1842 SSL2005-569PWS 84 M lip lesion Perry Island Negative Vero, MDCK V1843 SSL2005-570PWS 84 M oral viral media Glacier Island Negative Vero, MDCK V1844 SSL2005-570PWS 84 M rectal viral media Glacier Island Negative Vero, MDCK V1845 SSL2005-571PWS 84 M oral viral media Glacier Island Negative Vero, MDCK

PAGE 201

201Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V1846 SSL2005-571PWS 84 M rectal viral media Glacier Island Negative Vero, MDCK V1847 SSL2005-572PWS 84 M oral viral media Glacier Island Negative Vero, MDCK V1848 SSL2005-572PWS 84 M rectal viral media Glacier Island Negative Vero, MDCK V1849 SSL2005-573PWS 84 M oral viral media Glacier Island Negative Vero, MDCK V1850 SSL2005-573PWS 84 M rectal viral media Glacier Island Negative Vero, MDCK V1852 SSL2005-574PWS 228 M rectal viral media Glacier Island Negative Vero, MDCK V1854 SSL2005-573PWS 84 M viral eye Glacier Island Negative Vero, MDCK V1981 SSL2005-594AL 10.5 F oral swab Silak Island Negative Vero, MDCK V1982 SSL2005-594AL 10.5 F rectal swab Silak Island Negative Vero, MDCK V1983 SSL2005-595AL 10.5 F oral swab Silak Island Negative Vero, MDCK V1984 SSL2005-595AL 10.5 F rectal swab Silak Island Negative Vero, MDCK V1985 SSL2005-596AL 10.5 M oral swab Little Tanaga Negative Vero, MDCK V1986 SSL2005-596AL 10.5 M rectal swab Little Tanaga Negative Vero, MDCK V1987 SSL2005-597AL 10.5 M oral swab Lake Point -Adak Negative Vero, MDCK V1988 SSL2005-597AL 10.5 M rectal swab Lake Point -Adak Negative Vero, MDCK V1989 SSL2005-598AL 10.5 M oral swab Lake Point -Adak Negative Vero, MDCK V1990 SSL2005-598AL 10.5 M rectal swab Lake Point -Adak Negative Vero, MDCK V1991 SSL2005-599AL 10.5 M oral swab Lake Point -Adak Negative Vero, MDCK V1992 SSL2005-599AL 10.5 M rectal swab Lake Point -Adak Negative Vero, MDCK V1993 SSL2005-600AL 10.5 M oral swab Lake Point -Adak Negative Vero, MDCK V1994 SSL2005-600AL 10.5 M rectal swab Lake Point -Adak Negative Vero, MDCK V1995 SSL2005-601AL 10.5 F oral swab Lake Point -Adak Negative Vero, MDCK V1996 SSL2005-601AL 10.5 F rectal swab Lake Point Adak Negative Vero, MDCK V1997 SSL2005-602AL 10.5 M oral swab Lake Point Adak Negative Vero, MDCK V1998 SSL2005-603AL 10.5 F oral swab Kanaga Is. Ship Rock Negative Vero, MDCK V1999 SSL2005-603AL 10.5 F rectal swab Kanaga Is. Ship Rock Negative Vero, MDCK V1851 SSL2005-574PWS 228 M oral viral media Glacier Island Negative Vero, MDCK V2000 SSL2005-604AL 10.5 M oral swab Kanaga Is. Ship Rock Negative Vero, MDCK V2001 SSL2005-604AL 10.5 M rectal swab Kanaga Is. Ship Rock Negative Vero, MDCK V2002 SSL2005-605AL 10.5 M oral swab Ogalala Point, Kagalaskaa Negative Vero, MDCK V2003 SSL2005-605AL 10.5 M rectal swab Ogalala Point, Kagalaskaa Negative Vero, MDCK V2004 SSL2005-606AL 10.5 F oral swab Ogalala Point, Kagalaskaa Negative Vero, MDCK

PAGE 202

202Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V2005 SSL2005-606AL 10.5 F rectal swab Ogalala Point, Kagalaskaa Negative Vero, MDCK V2006 SSL2005-607AL 10.5 M oral swab Semosophochnoi Negative Vero, MDCK V2007 SSL2005-607AL 10.5 M rectal swab Semosophochnoi Negative Vero, MDCK V2008 SSL2005-607AL 10.5 M lesion Semosophochnoi Negative Vero, MDCK V2010 SSL2005-609AL 10.5 M oral swab Lake Point -Adak Negative Vero, MDCK V2011 SSL2005-610AL 10.5 F oral swab Lake Point -Adak Negative Vero, MDCK V2012 SSL2005-610AL 10.5 F rectal swab Lake Point -Adak Negative Vero, MDCK V2144 SSL2005 J245PWS 1 M feces Seal Rocks Ne gative Vero, MDCK V2145 SSL2005J245PWS 0.5-1 M ulcer swab White Sisters Negative Vero, MDCK V2146 Tag V85 0.5-1 M vesicle fluid Grave's Rock Negative Vero, MDCK V2147 Tag W332 0.5-1 M prepuce swab White Sisters Negative Vero, MDCK V2148 Tag V61 1 M vesicle fluid Grave's Rock Negative Vero, MDCK V2149 SSL2005NEC21PWS 1 F rectal swab Seal Rocks Negative Vero, MDCK V2150 SSL2005NEC21PWS 1 F oral swab Seal Rocks Negative Vero, MDCK V2151 SSL2005NEC21PWS 1 F lung Seal Rocks Negative Vero, MDCK V2152 SSL2005NEC22PWS 1 M rectal swab Seal Rocks Negative Vero, MDCK V2153 SSL2005NEC22PWS 1 M oral swab Seal Rocks Negative Vero, MDCK V2154 SSL2005NEC24PWS 1 M rectal swab Seal Rocks Negative Vero, MDCK V2155 SSL2005NEC24PWS 1 M oral swab Seal Rocks Negative Vero, MDCK V2156 SSL2005NEC25PWS 1 M rectal swab Seal Rocks Negative Vero, MDCK V2157 SSL2005NEC25PWS 1 M oral swab Seal Rocks Negative Vero, MDCK V2704 SSL2007662-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2705 SSL2007662-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2706 SSL2007663-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2707 SSL2007663-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2708 SSL2007664-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2009 SSL2005-608AL 10.5 M oral swab Lake Point -Adak Negative Vero, MDCK V2709 SSL2007664-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2710 SSL2007665-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2711 SSL2007665-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2712 SSL2007666-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2713 SSL2007666-PWS 5 F rectal swab Perry Island Negative Vero, MDCK

PAGE 203

203Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V2714 SSL2007667-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2715 SSL2007667-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2716 SSL2007668-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2718 SSL2007669-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2719 SSL2007669-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2720 SSL2007670-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2721 SSL2007670-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2722 SSL2007671-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2723 SSL2007671-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2724 SSL2007672-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2725 SSL2007672-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2726 SSL2007673-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2727 SSL2007673-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2728 SSL2007674-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2729 SSL2007674-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2730 SSL2007675-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2731 SSL2007675-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2732 SSL2007676-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2733 SSL2007676-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2734 SSL2007677-PWS 5 F oral swab Perry Island Negative Vero, MDCK V2735 SSL2007677-PWS 5 F rectal swab Perry Island Negative Vero, MDCK V2736 SSL2007678-PWS 5 M oral swab Perry Island Negative Vero, MDCK V2737 SSL2007678-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2717 SSL2007668-PWS 5 M rectal swab Perry Island Negative Vero, MDCK V2738 SSL2007679-PWS 5 F oral swab Perry Island Negative Vero V2739 SSL2007679-PWS 5 F rectal swab Perry Island Negative Vero V2741 SSL2007680-PWS 5 F rectal swab Perry Island Negative Vero V2740 SSL2007680-PWS 5 F oral swab Perry Island Negative Vero V2741 SSL2007680-PWS 5 F rectal swab Perry Island Negative Vero V2742 SSL2007681-PWS 5 M oral swab Perry Island Negative Vero V2743 SSL2007681-PWS 5 M rectal swab Perry Island Negative Vero V2744 SSL2007682-PWS 5 F oral swab Perry Island Negative Vero V2745 SSL2007682-PWS 5 F rectal swab Perry Island Negative Vero

PAGE 204

204Table A-1. Continued. UF ID Animal number Age (month) Sex Sample Site Calicivirus Result Cell culture Direct RTPCR V2746 SSL2007683-PWS 5 F oral swab Perry Island Negative Vero V2747 SSL2007683-PWS 5 F rectal swab Perry Island Negative Vero V2748 SSL2007684-PWS 5 M oral swab Perry Island Negative Vero V2749 SSL2007684-PWS 5 M rectal swab Perry Island Negative Vero V2750 SSL2007685-PWS 5 M oral swab Perry Island Negative Vero V2751 SSL2007685-PWS 5 M rectal swab Perry Island Negative Vero V2752 SSL2007686-PWS 5 M oral swab Perry Island Negative Vero V2753 SSL2007686-PWS 5 M rectal swab Perry Island Negative Vero V2754 SSL2007687-PWS 5 F oral swab Glacier Island Negative Vero V2755 SSL2007687-PWS 5 F rectal swab Glacier Island Negative Vero V2756 SSL2007688-PWS 5 F oral swab Glacier Island Negative Vero V2757 SSL2007688-PWS 5 F rectal swab Glacier Island Negative Vero V2758 SSL2007689-PWS 5 F oral swab Glacier Island Negative Vero V2759 SSL2007689-PWS 5 F rectal swab Glacier Island Negative Vero V2760 SSL2007690-PWS 5 M oral swab Glacier Island Negative Vero V2761 SSL2007690-PWS 5 M rectal swab Glacier Island Negative Vero V2762 SSL2007691-PWS 5 M oral swab Glacier Island Negative Vero V2763 SSL2007691-PWS 5 M rectal swab Glacier Island Negative Vero V2764 SSL2007692-PWS 5 F oral swab Glacier Island Negative Vero V2765 SSL2007692-PWS 5 F rectal swab Glacier Island Negative Vero V2766 SSL2007693-PWS 5 M oral swab Glacier Island Negative Vero V2767 SSL2007693-PWS 5 M rectal swab Glacier Island Negative Vero V2768 SSL2007694-PWS 5 F oral swab Glacier Island Negative Vero V2769 SSL2007694-PWS 5 F rectal swab Glacier Island Negative Vero V2770 SSL2007695-PWS 5 M oral swab Perry Island Negative Vero V2771 SSL2007696-PWS 5 M oral swab Perry Island Negative Vero V2772 SSL2007697-PWS 5 M oral swab Perry Island Negative Vero V2773 SSL2007698-PWS 5 F oral swab Perry Island Negative Vero

PAGE 205

205 LIST OF REFERENCES Akers, T. G., Smith, A. W., Latham, A. B. & Watkins, H. M. (1974). Calicivirus antibodies in California gray whales ( Eschrichtius robustus ) and Steller sea lions ( Eumetopias jubatus ). Arch Gesamte Virusforsch 46 175-177. Al-Molawi, N., Beardmore, V. A., Carter, M. J., Kass, G. E. & Roberts, L. O. (2003). Caspase-mediated cleavage of the feline calicivirus capsid protein. J Gen Virol 84 12371244. Alonso, C., Oviedo, J. M., Martin-Alonso, J. M., Diaz, E., Boga, J. A. & Parra, F. (1998). Programmed cell death in the pathogenes is of rabbit hemorrhagic disease. Arch Virol 143 321-332. AppliedBiosystems (2003). Creating standard curves with genomic DNA or plasmid DNA templates for use in quantitative PCR. Asanaka, M., Atmar, R. L., Ruvolo, V., Crawford S. E., Neill, F. H. & Estes, M. K. (2005). Replication and packaging of Norwalk vi rus RNA in cultured mammalian cells. Proc Natl Acad Sci U S A 102 10327-10332. Ball, J. M., Estes, M. K., Hardy, M. E., Conner, M. E., Opekun, A. R. & Graham, D. Y. (1996). Recombinant Norwalk virus-like particles as an oral vaccine. Arch Virol Suppl 12 243-249. Ball, J. M., Graham, D. Y., Opekun, A. R., Gilg er, M. A., Guerrero, R. A. & Estes, M. K. (1999). Recombinant Norwalk virus-like particle s given orally to volunteers: phase I study. Gastroenterology 117 40-48. Ball, L. A. (2001). Replication Strategies of RNA Viruses. In Fields Virology Fourth edn. Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman & S. E. Straus. Philidelphia: Lippincott, Williams, and Wilkins. Bankowski, R. A. (1965). Vesicular exanthema. Adv Vet Sci 10 23-64. Bankowski, R. A. & Sawyer, J. C. (1994). Vesicular exanthema of sw ine and marine caliciviral infections. In Handbook of Zoonoses Second edn, pp. 445-452. Edited by G. W. Beran. Florida: CRC Press Inc. Barajas-Rojas, J. A., Riemann, H. P. & Franti, C. E. (1993). Notes about determining the cutoff value in enzyme linked immunosorbent assay (ELISA). Preventive Veterinary Medicine 15 231-233. Barlough, J. E., Berry, E. S., Goodwin, E. A., Brown, R. F., DeLong, R. L. & Smith, A. W. (1987a). Antibodies to marine calicivir uses in the Steller sea lion ( Eumetopias jubatus Schreber ). J Wildl Dis 23 34-44.

PAGE 206

206 Barlough, J. E., Berry, E. S., Skilling, D. E., Smith, A. W. & Fay, F. H. (1986). Antibodies to marine caliciviruses in the Pacific walrus ( Odobenus rosmarus divergens Illiger ). J Wildl Dis 22 165-168. Barlough, J. E., Berry, E. S., Smith, A. W. & Skilling, D. E. (1987b). Prevalence and distribution of serum neutraliz ing antibodies to Tillamook (bovi ne) calicivirus in selected populations of marine mammals. J Wildl Dis 23 45-51. Berke, T., Golding, B., Jiang, X., Cubitt, D. W., Wolfaardt, M., Smith, A. W. & Matson, D. O. (1997). Phylogenetic analysis of the Caliciviruses. J Med Virol 52 419-424. Berke, T. & Matson, D. O. (2000). Reclassification of the Calicivir idae into distinct genera and exclusion of hepatitis E virus from the fa mily on the basis of comparative phylogenetic analysis. Arch Virol 145 1421-1436. Berry, E. S., Skilling, D. E., Barlough, J. E., Vedros, N. A., Gage, L. J. & Smith, A. W. (1990). New marine calicivirus sero type infective for swine. Am J Vet Res 51 11841187. Bertolotti-Ciarlet, A., Craw ford, S. E., Hutson, A. M. & Estes, M. K. (2003). The 3' end of Norwalk virus mRNA contains determinants that regulate the expressi on and stability of the viral capsid protein VP1: a novel function for the VP2 protein. J Virol 77 1160311615. Bickham, J. W., Patton, J. C. & Loughlin, T. R. (1996). High variability for control-region sequences in a marine mammal: Implicati ons for conservation and biogeography of Steller sea lions (Eumetopias jubatus). Journal of Mammalogy 77 95-108. Bookout, A. L., Cummins, C. L., Mangelsdorf, D. J., Pesola, J. M. & Kramer, M. F. (2006). High-Throughput Real-Time Quantitative Reverse Transcription PCR. In Current Protocols in Molecular Biology : John Wiley & Sons, Inc. Braham, H. W., Everitt, R. D. & Rugh, D. J. (1980). Northern sea lion decline in the eastern Aleutian Islands. Journal of Wildlife Management 44 25-33. Burek, K. A., Gulland, F. M., Sheffield, G., B eckmen, K. B., Keyes, E., Spraker, T. R., Smith, A. W., Skilling, D. E., Evermann, J. F., Stott, J. L., Saliki, J. T. & Trites, A. W. (2005). Infectious disease and the decline of Steller sea lions ( Eumetopias jubatus) in Alaska, USA: insights from serologic data. J Wildl Dis 41 512-524. Burek, K. A., Gulland, F. M. D., Sheffield, G. Keyes, E., Spraker, T. R., Smith, A. W., Skilling, D. E., Evermann, J., Stot t, J. L. & Trites, A. W. (2003). Disease Agents in Steller Sea Lions in Alaska: A Review a nd Analysis of Serology Data from 1975-2000. Fisheries Centre Research Reports 11

PAGE 207

207 Burroughs, J. N. & Brown, F. (1978). Presence of a covalently linked protein on calicivirus RNA. J Gen Virol 41 443-446. Calkins, D. G., McAllister, D. C. & Pitcher, K. W. (1997). Steller sea lions status and trend in southeast Alaska. NOAA Contract Report Report No. NA57FX0256 Calle, P. P., Seagars, D. J., McClave, C., Senne, D., House, C. & House, J. A. (2002). Viral and bacterial serology of fr ee-ranging Pacific walrus. J Wildl Dis 38 93-100. Carter, M. J. (1989). Feline calicivirus protein synthesi s investigated by western blotting. Arch Virol 108 69-79. Carter, M. J., Milton, I. D., Meanger, J., Benne tt, M., Gaskell, R. M. & Turner, P. C. (1992a). The complete nucleotide seque nce of a feline calicivirus. Virology 190 443448. Carter, M. J., Milton, I. D., Turner, P. C., Meanger, J., Bennett, M. & Gaskell, R. M. (1992b). Identification and sequence determination of the capsid protein gene of feline calicivirus. Arch Virol 122 223-235. CDC (2006). Norovirus in Healthcare facilities Fact Sheet: Centers for Disease Control and Prevention. Chang, K. O., Sosnovtsev, S. V., Belliot, G., Kim, Y., Saif, L. J. & Green, K. Y. (2004). Bile acids are essential for porcine enteric caliciv irus replication in association with downregulation of signal transducer a nd activator of transcription 1. Proc Natl Acad Sci U S A 101 8733-8738. Chen, R., Neill, J. D., Estes, M. K. & Prasad, B. V. (2006). X-ray structure of a native calicivirus: structural insights into an tigenic diversity and host specificity. Proc Natl Acad Sci U S A 103 8048-8053. Chiba, S. (1979). An outbreak of gastroenteritis associated with calicivirus in an infant home. J Med Virol 4 249-254. Crawford, A. B. (1937). Experimental vesicular exanthema of swine. J Am Vet Med Assoc 90 380-395. Crowther, J. R. (2001). The ELISA Guidebook Totowa, NJ: Humana Press. D'Souza, D. H., Sair, A., Williams, K., Papafr agkou, E., Jean, J., Moore, C. & Jaykus, L. (2006). Persistence of caliciviruses on environm ental surfaces and their transfer to food. Int J Food Microbiol 108 84-91.

PAGE 208

208 Daughenbaugh, K. F., Fraser, C. S., Hershey, J. W. & Hardy, M. E. (2003). The genomelinked protein VPg of the Norwalk virus binds eIF3, suggesting its role in translation initiation complex recruitment. EMBO J 22 2852-2859. Davies, G. (2002). Foot and mouth disease. Res Vet Sci 73 195-199. DeSilver, D. A., Guimond, P. M., Gibson, J. K ., Thomsen, D. R., Wardley, R. C. & Lowery, D. E. (1997). Expression of the complete capsid and the hypervariable region of feline calicivirus in the baculovirus expression system. In Proceedins of the First International Symposium on Caliciviruses pp. 131–143. Edited by R. M. G. D. Chasey, and I. N. Clarke. Reading, United Kingdom: Europ ean Society for Veterinary Virology. Di Martino, B., Marsilio, F. & Roy, P. (2007). Assembly of feline calicivirus-like particle and its immunogenicity. Vet Microbiol 120 173-178. Diaz, L. A. & Giudice, G. J. (2000). End of the century overview of skin blisters. Arch Dermatol 136 106-112. Dierauf, L. A. & Gulland, F. M. D. (2001). CRC Handbook of Marine Mammal Medicine Boca Raton, FL.: CRC Press. Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness for survival. Annu Rev Microbiol 51 151-178. Dunham, D. M., Jiang, X., Berke, T., Smith, A. W. & Matson, D. O. (1998). Genomic mapping of a calicivirus VPg. Arch Virol 143 2421-2430. Ehresmann, D. W. & Schaffer, F. L. (1977). RNA synthesized in calicivirus-infected cells is atypical of picornaviruses. J Virol 22 572-576. Eigen, M. (1993). Viral quasispecies. Sci Am 269 42-49. Evermann, J. F., Smith, A. W., Skilling, D. E. & McKeirnan, A. J. (1983). Ultrastructure of newly recognized caliciviruses of the dog and mink. Arch Virol 76 257-261. Farkas, T., Sestak, K., We i, C. & Jiang, X. (2008). Characterization of a rhesus monkey calicivirus representing a ne w genus of Caliciviridae. J Virol 82 5408-5416. Fastier, L. B. (1957). A new feline virus isolated in tissue culture. Am J Vet Res 18 382-389. Fauquet, C. M. & Mayo, M. A. (2001). The 7th ICTV report. Arch Virol 146 189-194. Ferris, N. P. & Oxtoby, J. M. (1994). An enzyme-linked immunosorbent assay for the detection of marine caliciviruses. Vet Microbiol 42 229-238. Folkens, P. (2002). Guide to Marine Mammals of the World New York: Chanticleer Press, Inc.

PAGE 209

209 Ganova-Raeva, L., Smith, A. W., Fi elds, H. & Khudyakov, Y. (2004). New Calicivirus isolated from walrus. Virus Res 102 207-213. Geissler, K., Schneider, K., Fleuchaus, A., Pa rrish, C. R., Sutter, G. & Truyen, U. (1999). Feline calicivirus capsid protein expression and capsid assembly in cultured feline cells. J Virol 73 834-838. Gelberg, H. B., Dieterich, R. A. & Lewis, R. M. (1982a). Vesicular exanthema of swine and San Miguel sea lion virus: experime ntal and field studies in otarid seals, feeding trials in swine. Vet Pathol 19 413-423. Gelberg, H. B. & Lewis, R. M. (1982). The pathogenesis of vesicula r exanthema of swine virus and San Miguel sea lion virus in swine. Vet Pathol 19 424-443. Gelberg, H. B., Mebus, C. A. & Lewis, R. M. (1982b). Experimental vesicular exanthema of swine virus and San Miguel sea lion virus infection in phocid seals. Vet Pathol 19 406412. Glass, P. J., White, L. J., Ball, J. M., LeparcGoffart, I., Hardy, M. E. & Estes, M. K. (2000). Norwalk virus open reading frame 3 encodes a minor structural protein. J Virol 74 6581-6591. Goodfellow, I., Chaudhry, Y., Gioldasi, I., Gerondopoulos, A., Natoni, A., Labrie, L., Laliberte, J. F. & Roberts, L. (2005). Calicivirus translation initiation requires an interaction between VPg and eIF 4 E. EMBO Rep 6 968-972. Green, K. Y., Ando, T., Balayan, M. S., Berke, T., Clarke, I. N., Estes, M. K., Matson, D. O., Nakata, S., Neill, J. D., Studdert, M. J. & Thiel, H. J. (2000). Taxonomy of the caliciviruses. J Infect Dis 181 Suppl 2 S322-330. Green, K. Y., Chanock, R. M. & Kapikian, A. Z. (2001). Human Caliciviruses. In Fields Virology Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman & S. E. Straus. Philade lphia: Lippincott, Williams, and Wilkins. Green, K. Y., Mory, A., Fogg, M. H., Weisb erg, A., Belliot, G., Wagner, M., Mitra, T., Ehrenfeld, E., Cameron, C. E. & Sosnovtsev, S. V. (2002). Isolation of enzymatically active replication complexes from feline calicivirus-infected cells. J Virol 76 8582-8595. Guiver, M., Littler, E., Caul, E. O. & Fox, A. J. (1992). The cloning, sequencing and expression of a major antigenic region fr om the feline calicivirus capsid protein. J Gen Virol 73 ( Pt 9) 2429-2433. Guo, M., Evermann, J. F. & Saif, L. J. (2001). Detection and molecula r characterization of cultivable caliciviruses from clinically norma l mink and enteric caliciviruses associated with diarrhea in mink. Arch Virol 146 479-493.

PAGE 210

210 Herbert, T. P., Brierley, I. & Brown, T. D. (1996). Detection of the ORF3 polypeptide of feline calicivirus in infected cells and evidence for its expression from a single, functionally bicistronic, subgenomic mRNA. J Gen Virol 77 ( Pt 1) 123-127. Herbert, T. P., Brierley, I. & Brown, T. D. (1997). Identification of a protein linked to the genomic and subgenomic mRNAs of feline cal icivirus and its ro le in translation. J Gen Virol 78 ( Pt 5) 1033-1040. Hofmann, K. J., Cook, J. C., Joyce, J. G., Brown, D. R., Schultz, L. D., George, H. A., Rosolowsky, M., Fife, K. H. & Jansen, K. U. (1995). Sequence determination of human papillomavirus type 6a and assembly of viru s-like particles in Saccharomyces cerevisiae. Virology 209 506-518. Hutson, A. M., Atmar, R. L., Graham, D. Y. & Estes, M. K. (2002). Norwalk virus infection and disease is associated w ith ABO histo-blood group type. J Infect Dis 185 1335-1337. Hutson, A. M., Atmar, R. L., Marcus, D. M. & Estes, M. K. (2003). Norwalk virus-like particle hemagglutination by binding to h histo-blood group antigens. J Virol 77 405415. Jiang, X., Wang, M., Graham, D. Y. & Estes, M. K. (1992). Expression, self-assembly, and antigenicity of the Norw alk virus capsid protein. J Virol 66 6527-6532. Kaiser, W. J., Chaudhry, Y., Sosnovtsev, S. V. & Goodfellow, I. G. (2006). Analysis of protein-protein interactions in the feline calicivirus replication complex. J Gen Virol 87 363-368. Karber, G. (1931). Beitrag zur killektiven Behandlung pha rmakologischer Reinenversuche. Arch Exp Path Pharmak 162 480-493. Kenyon, K. W. & Rice, D. W. (1961). Abundance and distribution of the Steller sea lion. J Mammal 42 223-234. Koutsky, L. A., Ault, K. A., Wheeler, C. M ., Brown, D. R., Barr, E., Alvarez, F. B., Chiacchierini, L. M. & Jansen, K. U. (2002). A controlled trial of a human papillomavirus type 16 vaccine. N Engl J Med 347 1645-1651. Kreutz, L. C. & Seal, B. S. (1995). The pathway of feline calicivirus entry. Virus Res 35 63-70. Kurth, A., Evermann, J. F., Skilling, D. E., Matson, D. O. & Smith, A. W. (2006a). Prevalence of vesivirus in a laboratory-based set of serum samples obtained from dairy and beef cattle. Am J Vet Res 67 114-119. Kurth, A., Skilling, D. E. & Smith, A. W. (2006b). Serologic evidence of vesivirus-specific antibodies associated with abortion in horses. Am J Vet Res 67 1033-1039.

PAGE 211

211 Laurent, S., Vautherot, J. F., Madelaine, M. F., Le Gall, G. & Rasschaert, D. (1994). Recombinant rabbit hemorrhagic disease virus capsid protein expre ssed in baculovirus self-assembles into viruslike pa rticles and induces protection. J Virol 68 6794-6798. Liu, B. L., Lambden, P. R., Gunther, H., Ot to, P., Elschner, M. & Clarke, I. N. (1999). Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalklike viruses. J Virol 73 819-825. Long, G. G., Evermann, J. F. & Gorham, J. R. (1980). Naturally occurring picornavirus infection of domestic mink. Can J Comp Med 44 412-417. Loughlin, T. R. (1998). The Steller sea lion: A declining species. Biosphere Conservation 1 9198. Love, D. N. & Sabine, M. (1975). Electron microscopic observ ation of feline kidney cells infected with a feline calicivirus. Arch Virol 48 213-228. Lowy, D. R. & Schiller, J. T. (2006). Prophylactic human papillomavirus vaccines. J Clin Invest 116 1167-1173. Makino, A., Shimojima, M., Miyazawa, T., Ka to, K., Tohya, Y. & Akashi, H. (2006). Junctional adhesion molecule 1 is a functional receptor for feline calicivirus. J Virol 80 4482-4490. Martin-Alonso, J. M., Skilling, D. E., Gonzalez-Molleda, L., del Barrio, G., Machin, A., Keefer, N. K., Matson, D. O., Iversen, P. L., Smith, A. W. & Parra, F. (2005). Isolation and characterization of a new Vesivirus from rabbits. Virology 337 373-383. Matsuura, Y., Tohya, Y., Mochizuki, M ., Takase, K. & Sugimura, T. (2001). Identification of conformational neut ralizing epitopes on the capsid protein of canine calicivirus. J Gen Virol 82 1695-1702. Matsuura, Y., Tohya, Y., Onuma, M., Roerink, F., Mochizuki, M. & Sugimura, T. (2000). Expression and processing of the ca nine calicivirus capsid precursor. J Gen Virol 81 195-199. Matthews, R. E. (1979). Third report of the Internati onal Committee on Taxonomy of Viruses. Classification and nomenclature of viruses. Intervirology 12 129-296. McCabe, V. J., Tarpey, I. & Spibey, N. (2002). Vaccination of cats with an attenuated recombinant myxoma virus expressing feline calicivirus capsid protein. Vaccine 20 2454-2462.

PAGE 212

212 McIntosh, M. T., Behan, S. C., Mohamed, F. M., Lu, Z., Moran, K. E., Burrage, T. G., Neilan, J. G., Ward, G. B., Botti, G., Capucci, L. & Metwally, S. A. (2007). A pandemic strain of calicivirus threaten s rabbit industries in the Americas. Virol J 4 96. Meeroff, J. C., Schreiber, D. S., Tri er, J. S. & Blacklow, N. R. (1980). Abnormal gastric motor function in viral gastroenteritis. Ann Intern Med 92 370-373. Milton, I. D., Turner, J., Teelan, A., Gaskell, R., Turner, P. C. & Carter, M. J. (1992). Location of monoclonal antibody bi nding sites in the capsid prot ein of feline calicivirus. J Gen Virol 73 ( Pt 9) 2435-2439. Mochizuki, M., Kawanishi, A., Sakamoto, H ., Tashiro, S., Fujimoto, R. & Ohwaki, M. (1993). A calicivirus isolated from a dog with fatal diarrhoea. Vet Rec 132 221-222. Moussa, A., Chasey, D., Lavazza, A., Capucci, L ., Smid, B., Meyers, G., Rossi, C., Thiel, H. J., Vlasak, R., Ronsholt, L. & et al. (1992). Haemorrhagic disease of lagomorphs: evidence for a calicivirus. Vet Microbiol 33 375-381. Moya, A., Elena, S. F., Bracho, A., Miralles, R. & Barrio, E. (2000). The evolution of RNA viruses: A population genetics view. Proc Natl Acad Sci U S A 97 6967-6973. Neill, J. D. (1990). Nucleotide sequence of a region of the feline ca licivirus genome which encodes picornavirus-like RNA-dependent R NA polymerase, cysteine protease and 2C polypeptides. Virus Res 17 145-160. Neill, J. D. (1992). Nucleotide sequence of the capsid pr otein gene of two serotypes of San Miguel sea lion virus: iden tification of conserved a nd non-conserved amino acid sequences among calicivir us capsid proteins. Virus Res 24 211-222. Neill, J. D., Meyer, R. F. & Seal, B. S. (1998). The capsid protein of vesicular exanthema of swine virus serotype A48: rela tionship to the capsid protein of other animal caliciviruses. Virus Res 54 39-50. Neill, J. D., Reardon, I. M. & Heinrikson, R. L. (1991). Nucleotide sequence and expression of the capsid protein gene of feline calicivirus. J Virol 65 5440-5447. Neill, J. D. & Seal, B. S. (1995). Development of PCR primers fo r specific amplification of two distinct regions of the genom es of San Miguel sea-lion and vesicular exanthema of swine viruses. Mol Cell Probes 9 33-37. NOAA (2008). Coastal Water Temperature Guid e. Edited by N. O. D. Center. Noad, R. & Roy, P. (2003). Virus-like particles as immunogens. Trends Microbiol 11 438-444. O'Hara, T. M., House, C., House, J. A., Suydam, R. S. & George, J. C. (1998). Viral serologic survey of bowhead whales in Alaska. J Wildl Dis 34 39-46.

PAGE 213

213 Ohlinger, V. F., Haas, B., Meyers, G., Weiland, F. & Thiel, H. J. (1990). Identification and characterization of the virus causing rabbit hemorrhagic disease. J Virol 64 3331-3336. Ohlinger, V. F. & Thiel, H. J. (1991). Identification of the viral ha emorrhagic disease virus of rabbits as a calicivirus. Rev Sci Tech 10 311-323. Oliver, S. L., Asobayire, E., Dastjerdi, A. M. & Bridger, J. C. (2006). Genomic characterization of the unclassified bovine enteric virus Newbury agent-1 (Newbury1) endorses a new genus in the family Caliciviridae. Virology 350 240-250. Page, R. D. (1996). TreeView: an application to disp lay phylogenetic trees on personal computers. Comput Appl Biosci 12 357-358. Parrino, T. A., Schreiber, D. S., Trier, J. S ., Kapikian, A. Z. & Blacklow, N. R. (1977). Clinical immunity in acute gastroenteritis caused by Norwalk agent. N Engl J Med 297 86-89. Poet, S. E., Gilmartin, W., Skilling, D. E., Craig, M. P. & Smith, A. W. (1993). Detection of a non-cultivatable monk seal calicivirus using a cDNA hybridization probe. In Proceedings of the International Association for Aquatic Animal Medicine pp. 85-89. Edited by B. F. Andrews. Poet, S. E., Skilling, D. E., Megyesl, J. L ., Gilmartin, W. G. & Smith, A. W. (1996). Detection of a non-cultivatable cal icivirus from the white tern ( Gygis alba rothschildi ). J Wildl Dis 32 461-467. Povey, C. & Ingersoll, J. (1975). Cross-Protection Among Feline Caliciviruses. Infect Immun 11 877-885. Povey, R. C. (1974). Serological relationships among feline caliciviruses. Infect Immun 10 1307-1314. Prasad, B. V., Hardy, M. E., Dokland, T., Bell a, J., Rossmann, M. G. & Estes, M. K. (1999). X-ray crystallographic structur e of the Norwalk virus capsid. Science 286 287-290. Prasad, B. V., Matson, D. O. & Smith, A. W. (1994a). Three-dimensional structure of calicivirus. J Mol Biol 240 256-264. Prasad, B. V., Rothnagel, R., Jiang, X. & Estes, M. K. (1994b). Three-dimensional structure of baculovirus-expressed Norwalk virus capsids. J Virol 68 5117-5125. Prato, C. M., Akers, T. G. & Smith, A. W. (1974). Serological evidence of calcivirus transmission between marine and terrestrial mammals. Nature 249 255-256. Prato, C. M., Akers, T. G. & Smith, A. W. (1977). Calicivirus antibodies in wild fox populations. J Wildl Dis 13 448-450.

PAGE 214

214 Prchla, E., Plank, C., Wagner, E., Blaas, D. & Fuchs, R. (1995). Virus-mediated release of endosomal content in vitro: di fferent behavior of adenoviru s and rhinovirus serotype 2. J Cell Biol 131 111-123. Radford, A. D., Bennett, M., McArdle, F., Dawson, S., Turner, P. C., Williams, R. A., Glenn, M. A. & Gaskell, R. M. (1999). Quasispecies evolution of a hypervariable region of the feline calicivirus capsid gene in ce ll culture and persistently infected cats. Vet Microbiol 69 67-68. Radford, A. D., Coyne, K. P., Dawson, S ., Porter, C. J. & Gaskell, R. M. (2007). Feline calicivirus. Vet Res 38 319-335. Reid, S. M., Ansell, D. M., Ferris, N. P., Hutchings, G. H., Knowles, N. J. & Smith, A. W. (1999). Development of a reverse transcription polymerase chain re action procedure for the detection of marine caliciv iruses with potential applic ation for nucleotide sequencing. J Virol Methods 82 99-107. Reid, S. M., King, D. P., Shaw, A. E., Knowle s, N. J., Hutchings, G. H., Cooper, E. J., Smith, A. W. & Ferris, N. P. (2007). Development of a real-time reverse transcription polymerase chain reaction assay for detec tion of marine caliciviruses (genus Vesivirus ). J Virol Methods 140 166-173. Rhodes, C. R., Brooks, E. M., Barron, E. L., Bok, K., Mitra, T., Saif, L. J., Guo, M., Evermann, J. F., Sosnovtsev, S. V. & Green, K. Y. (2007). Characterization of mink calicivirus, a proposed new species in the genus Vesivirus of the Caliciviridae In Proceedings of the American Society for Virology Corvallis, Oregon. Rinehart-Kim, J. E., Zhong, W. M., Jiang, X ., Smith, A. W. & Matson, D. O. (1999). Complete nucleotide sequence and genomic or ganization of a primat e calicivirus, Pan-1. Arch Virol 144 199-208. Saif, L. J., Bohl, E. H., Theil, K. W., Cross, R. F. & House, J. A. (1980). Rotavirus-like, calicivirus-like, and 23-nm vi rus-like particles associated with diarrhea in young pigs. J Clin Microbiol 12 105-111. Sawyer, J. C., Madin, S. H. & Skilling, D. E. (1978). Isolation of San Miguel Sea Lion Virus from Samples of an animal food product produced from northern fur seal ( Callorhinus ursinus ) carcasses. Am J Vet Res 39 137-139. Schaffer, F. L., Ehresmann, D. W., Fretz, M. K. & Soergel, M. I. (1980). A protein, VPg, covalently linked to 36S calicivirus RNA. J Gen Virol 47 215-220. Schaffer, F. L. & Soergel, M. E. (1973). Biochemical and biophysical characterization of calicivirus isolates from pinnipeds. Intervirology 1 210-219.

PAGE 215

215 Schaffer, F. L., Soergel, M. E., Black, J. W., Skilling, D. E., Smith, A. W. & Cubitt, W. D. (1985). Characterization of a new calicivir us isolated from feces of a dog. Arch Virol 84 181-195. Seal, B. S., House, J. A., Whetstone, C. A. & Neill, J. D. (1995a). Analysis of the serologic relationship among San Miguel sea lion virus and vesicular exanthema of swine virus isolates. Application of the western blot assay for detection of antibod ies in swine sera to these virus types. J Vet Diagn Invest 7 190-195. Seal, B. S., Lutze-Wallace, C., Kreutz, L. C., Sapp, T., Dulac, G. C. & Neill, J. D. (1995b). Isolation of caliciviruses from skunks that are antigenically and genotypically related to San Miguel sea lion virus. Virus Res 37 1-12. Seal, B. S., Ridpath, J. F. & Mengeling, W. L. (1993). Analysis of feline calicivirus capsid protein genes: identification of variable antigenic determ inant regions of the protein. J Gen Virol 74 ( Pt 11) 2519-2524. Sibilia, M., Boniotti, M. B., Angoscini P., Capucci, L. & Rossi, C. (1995). Two independent pathways of expression lead to self-assemb ly of the rabbit hemorrhagic disease virus capsid protein. J Virol 69 5812-5815. Skilling, D. E., Barlough, J. E., Berry, E. S., Brown, R. F. & Smith, A. W. (1987). First isolation of a calicivirus from the Steller sea lion ( Eumetopias jubatus ). J Wildl Dis 23 534-538. Smith, A. W. (2000). Virus cycles in aquatic mammals, po ikioltherms, and invertebrates. In Viral ecology pp. 447-491. Edited by C. J. Hurst. San Diego: Academic Press Smith, A. W. & Akers, T. G. (1976). Vesicular exanthema of swine. J Am Vet Med Assoc 169 700-703. Smith, A. W., Akers, T. G., Latham, A. B., Skilling, D. E. & Bray, H. L. (1979). A new calicivirus isolated from a marine mammal. Arch Virol 61 255-259. Smith, A. W., Akers, T. G., Madin, S. H. & Vedros, N. A. (1973). San Miguel sea lion virus isolation, preliminary characte rization and relationship to ve sicular exanth ema of swine virus. Nature 244 108-110. Smith, A. W., Akers, T. G., Prat o, C. M. & Bray, H. (1976). Prevalence and distribution of four serotypes of SMSV serum neutralizi ng antibodies in wild animal populations. J Wildl Dis 12 326-334. Smith, A. W., Anderson, M. P., Skilling, D. E., Barlough, J. E. & Ensley, P. K. (1986). First isolation of calicivirus fro m reptiles and amphibians. Am J Vet Res 47 1718-1721.

PAGE 216

216 Smith, A. W., Berry, E. S., Skilling, D. E., Barl ough, J. E., Poet, S. E., Berke, T., Mead, J. & Matson, D. O. (1998a). In vitro isolation a nd characterization of a calicivirus causing a vesicular disease of the hands and feet. Clin Infect Dis 26 434-439. Smith, A. W. & Boyt, P. M. (1990). Caliciviruses of ocean origin: a review. J Zoo Wildl Med 21 3-23. Smith, A. W., Iversen, P. L., Skilling, D. E., St ein, D. A., Bok, K. & Matson, D. O. (2006). Vesivirus viremia and seroprevalence in humans. J Med Virol 78 693-701. Smith, A. W. & Latham, A. B. (1978). Prevalence of vesicular ex anthema of swine antibodies among feral mammals associated with th e southern California coastal zones. Am J Vet Res 39 291-296. Smith, A. W., Madin, S. H., Vedros, N. A. & Bankowski, R. A. (1977a). Host range comparisons of five serotypes of caliciviruses. Am J Vet Res 38 101-105. Smith, A. W., Matson, D. O., Stein, D. A., Sk illing, D. E., Kroeker, A. D., Berke, T. & Iversen, P. L. (2002). Antisense treatment of calicivirid ae: an emerging disease agent of animals and humans. Curr Opin Mol Ther 4 177-184. Smith, A. W., Mattson, D. E., Skilling, D. E. & Schmitz, J. A. (1983a). Isolation and partial characterization of a calicivirus from calves. Am J Vet Res 44 851-855. Smith, A. W., Prato, C. & Skilling, D. E. (1978). Caliciviruses infecting monkeys and possibly man. Am J Vet Res 39 287-289. Smith, A. W., Prato, C. M., Gilmartin, W. G., Brown, R. J. & Keyes, M. C. (1974). A preliminary report on potentially pathogenic microbiological agents recently isolated from pinnipeds. J Wildl Dis 10 54-59. Smith, A. W., Prato, C. M. & Skilling, D. E. (1977b). Characterization of two new serotypes of San Miguel sea lion virus. Intervirology 8 30-36. Smith, A. W., Ritter, D. G., Ray, G. C ., Skilling, D. E. & Wartzok, D. (1983b). New calicivirus isolates from feces of walrus (Odobenus rosmarus). J Wildl Dis 19 86-89. Smith, A. W., Skilling, D. E., Anders on, M. P. & Benirschke, K. (1985a). Isolation of primate calicivirus Pan paniscus type 1 from a douc langur ( Pygathrix nemaeus l .). J Wildl Dis 21 426-428. Smith, A. W., Skilling, D. E. & Benirschke, K. (1985b). Calicivirus isolation from three species of primates: an incidental finding. Am J Vet Res 46 2197-2199.

PAGE 217

217 Smith, A. W., Skilling, D. E., Benirschke, K., Albert, T. F. & Barlough, J. E. (1987). Serology and virology of the bowhead whale ( Balaena mysticetus L. ). J Wildl Dis 23 9298. Smith, A. W., Skilling, D. E. & Brown, R. J. (1980a). Preliminary investig ation of a possible lung worm ( Parafilaroides decorus ), fish ( Girella nigricans ), and marine mammal ( Callorhinus ursinus ) cycle for San Miguel sea lion virus type 5. Am J Vet Res 41 18461850. Smith, A. W., Skilling, D. E., Cherry, N., Mead, J. H. & Matson, D. O. (1998b). Calicivirus emergence from ocean reservoirs: zoono tic and interspecies movements. Emerg Infect Dis 4 13-20. Smith, A. W., Skilling, D. E., Dardir i, A. H. & Latham, A. B. (1980b). Calicivirus pathogenic for swine: a new serotype isolated from opaleye Girella nigricans an ocean fish. Science 209 940-941. Smith, A. W., Skilling, D. E., Ensley, P. K., Benirschke, K. & Lester, T. L. (1983c). Calicivirus isolation and pers istence in a pygmy chimpanzee ( Pan paniscus ). Science 221 79-81. Smith, A. W., Skilling, D. E. & Latham, A. B. (1981a). Isolation and identification of five new serotypes of calicivirus from marine mammals. Am J Vet Res 42 693-694. Smith, A. W., Skilling, D. E., Prato, C. M. & Bray, H. L. (1981b). Calcivirus (SMSV-5) infection in experimentally inoculated Opaleye fish ( Girella nigricans ). Arch Virol 67 165-168. Smith, A. W., Skilling, D. E. & Ridgway, S. (1983d). Calicivirus-induced vesicular disease in cetaceans and probable interspecies transmission. J Am Vet Med Assoc 183 1223-1225. Smolarek-Benson, K. A. (2005). Molecular identification and genetic characterization of cetacean herpesviruses and porpoise morbillivirus In Master of Science Thesis-Infectious Diseases and Pathology Department p. 118. Gainesville: University of Florida. Sosnovtsev, S. & Green, K. Y. (1995). RNA transcripts derived from a cloned full-length copy of the feline calicivirus genome do not require VpG for infectivity. Virology 210 383390. Sosnovtsev, S. V., Belliot, G., Chang, K. O., Onwudiwe, O. & Green, K. Y. (2005). Feline calicivirus VP2 is essential for th e production of infectious virions. J Virol 79 40124024. Sosnovtsev, S. V. & Green, K. Y. (2000). Identification and genomic mapping of the ORF3 and VPg proteins in feline calicivirus virions. Virology 277 193-203.

PAGE 218

218 Sosnovtsev, S. V., Prikhod'ko, E. A., Bellio t, G., Cohen, J. I. & Green, K. Y. (2003). Feline calicivirus replication induces apoptosis in cultured cells. Virus Res 94 1-10. Sosnovtsev, S. V., Sosnovtseva, S. A. & Green, K. Y. (1998). Cleavage of the feline calicivirus capsid precursor is mediated by a virus-encoded proteinase. J Virol 72 3051-3059. Stack, M. J., Simpson, V. R. & Scott, A. C. (1993). Mixed poxvirus and calicivirus infections of grey seals ( Halichoerus grypus ) in Cornwall. Vet Rec 132 163-165. Stanley, M. A. (2006). Human papillomavirus vaccines. Rev Med Virol 16 139-149. Stein, D. A., Skilling, D. E., Iversen, P. L. & Smith, A. W. (2001). Inhibition of Vesivirus infections in mammalian tissue culture with antisense morpholino oligomers. Antisense Nucleic Acid Drug Dev 11 317-325. Stuart, A. D. & Brown, T. D. (2006). Entry of feline calicivirus is dependent on clathrinmediated endocytosis and acidification in endosomes. J Virol 80 7500-7509. Stuart, A. D. & Brown, T. D. (2007). Alpha2,6-linked sialic acid acts as a receptor for Feline calicivirus. J Gen Virol 88 177-186. Studdert, M. J. & O'Shea, J. D. (1975). Ultrastructural studies of the development of feline calicivirus in a feline embryo cell line. Arch Virol 48 317-325. Sugieda, M., Nagaoka, H., Kakishima, Y., Ohsh ita, T., Nakamura, S. & Nakajima, S. (1998). Detection of Norwalk-like virus ge nes in the caecum contents of pigs. Arch Virol 143 1215-1221. Teodoro, J. G. & Branton, P. E. (1997). Regulation of apoptosis by viral gene products. J Virol 71 1739-1746. Tohya, Y., Masuoka, K., Takahash i, E. & Mikami, T. (1991). Neutralizing epitopes of feline calicivirus. Arch Virol 117, 173-181. ohya, Y., Yokoyama, N., Maeda, K., Kawaguchi, Y. & Mikami, T. (1997). Mapping of antigenic sites involved in neutralization on the capsid protein of feline calicivirus. J Gen Virol 78 ( Pt 2) 303-305. Traum, J. (1936). Vesicular exanthema of swine. J Am Vet Med Assoc 88 316-334. Trites, A. W. & Donnelly, C. P. (2003). The decline of Steller sea lions Eumetopias jubatus in Alaska: a review of the nutritional stress hypothesis. Mammal Review 33 3-28.

PAGE 219

219 Trites, A. W. & Larkin, P. A. (1996). Changes in the abundan ce of Steller sea lions ( Eumetopias jubatus ) in Alaska from 1956 to 1992: how many were there? Aquatic Mammals 22 153-166. Tryland, M., Neuvonen, E., Huovilainen, A., Tapiovaara, H., Osterhaus, A., Wiig, O. & Derocher, A. E. (2005). Serologic survey for selected vi rus infections in polar bears at Svalbard. J wildl dis 41 310-316. Van Bonn, W., Jensen, E. D., House, C., House, J. A., Burrage, T. & Gregg, D. A. (2000). Epizootic vesicular disease in captive California sea lions. J Wildl Dis 36 500-507. Van Regenmortel, M. H. V., Fauquet, C. M., Bishop D. H. L., Carstens, E., Estes, M., Lemon, S., Maniloff, J., Mayo, M. A., McGeoch, D., Pringle, C. R. & Wickner, R. B. (2000). Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses. New York San Diego: Academic Press. Wang, J., Jiang, X., Madore, H. P., Gray, J., Desse lberger, U., Ando, T., Seto, Y., Oishi, I., Lew, J. F., Green, K. Y. & et al. (1994). Sequence diversity of small, round-structured viruses in the Norwalk virus group. J Virol 68 5982-5990. Weeks, M. L., Gallagher, A. & Romero, C. H. (2001). Sequence analysis of feline caliciviruses isolated from the oral cavity of clinically norm al domestic cats ( Felis catus ) in Florida. Res Vet Sci 71 223-225. Wei, L., Huhn, J. S., Mory, A., Pathak, H. B., Sosnovtsev, S. V., Green, K. Y. & Cameron, C. E. (2001). Proteinase-polymerase precursor as the active form of feline calicivirus RNA-dependent RNA polymerase. J Virol 75 1211-1219. Wilder, F. W. & Dardiri, A. H. (1978). San Miguel sea lion virus fed to mink and pigs. Can J Comp Med 42 200-204. Wilhelm, S. & Truyen, U. (2006). Real-time reverse transcrip tion polymerase chain reaction assay to detect a broad range of feline calicivirus isolates. J Virol Methods 133 105-108. Wobus, C. E., Thackray, L. B. & Virgin, H. W. t. (2006). Murine norovirus: a model system to study norovirus biology and pathogenesis. J Virol 80 5104-5112. Zhou, C., Y. Yang, and A. Y. Yong (1990). Mini-preps in ten minutes. BioTechniques 8 172173.

PAGE 220

220 BIOGRAPHICAL SKETCH Shasta Dawn (Cooper) McClenahan was born in 1980 in Houston, Missouri to parents Kathleen (Porter) Cooper and Donald Lee Cooper of Cabool, Missouri. Shasta was raised in Cabool, and graduated from Cabool High School in May of 1999 as the class valedictorian. She went on to attend college at Auburn Universi ty in Auburn, Alabama where she majored in marine biology. During her undergraduate ye ars she was employed at the Southeastern Cooperative Fish Project within the Department of Fisheries and Allie d Aquacultures. She graduated in 2003 cum laude with a Bachelor of Science degree. Shasta then enrolled in a Master of Science program in the Fisheries Department under the supervision of Dr. John Grizzle. Her masterÂ’s project involved the development of impr oved techniques for the detection of largemouth bass virus. In August 2003, Shasta married her high school sweetheart, Justin Caleb McClenahan, in a beachside ceremony in Fort Walton Beach, Florida. Shasta completed her Master of Science degr ee in 2004, and then elec ted to continue her education even further, and went to the Univer sity of Florida to obtain a Doctor of Philosophy degree under the direction of Dr. Carlos H. Romero.