Citation
Description of Osteoprogenitor Gene Expression in Periodontal Soft Tissues

Material Information

Title:
Description of Osteoprogenitor Gene Expression in Periodontal Soft Tissues
Creator:
Mendro, Ryan L.
Place of Publication:
[Gainesville, Fla.]
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (48 p.)

Thesis/Dissertation Information

Degree:
Master's ( M.S.)
Degree Grantor:
University of Florida
Degree Disciplines:
Dental Sciences
Dentistry
Committee Chair:
Aukhil, Ikramuddin
Committee Members:
Wallet, Shannon
Koutouzis, Theofilos
Graduation Date:
5/1/2008

Subjects

Subjects / Keywords:
Bones ( jstor )
Cells ( jstor )
Complementary DNA ( jstor )
Connective tissues ( jstor )
Gene expression ( jstor )
Granulation tissue ( jstor )
Osteoblasts ( jstor )
Osteosarcoma ( jstor )
Polymerase chain reaction ( jstor )
Tissue samples ( jstor )
Dentistry -- Dissertations, Academic -- UF
bone, cells, osteoprogenitor, periodontal, periodontics, stem
Genre:
Electronic Thesis or Dissertation
bibliography ( marcgt )
theses ( marcgt )
Dental Sciences thesis, M.S.

Notes

Abstract:
Recent work has shown that cells outside of periodontal ligament, including those found in granulation tissue may also have the regenerative potential to induce new bone formation by the expression of specific proteins and transcription factors.1 It was therefore the purpose of this investigation to determine if periodontal granulation tissues possess the specific proteins and gene expression pattern necessary for osteoblast differentiation in an effort to determine if this granulation tissue should therefore be retained in the surgical treatment of periodontal defects. In order to accomplish this, granulation tissue and healthy gingival tissue samples were harvested during periodontal surgeries, after which, polymerase chain reaction (PCR) was used to determine the expression of BMP-2, Cbfa1 and Osterix; three genes involved in bone development. In order to demonstrate a potential model of how these genes could be regulated/modulated under inflammatory conditions, an in-vitro stimulation assay using a human monocytic cell line (THP-1) along with a source of BMP-2, specifically an osteosarcoma cells line (SoaS) was also performed. Our results demonstrate the genes for BMP-2, Cbfa1 and Osterix are expressed at similar levels in both granulation as well as healthy gingival tissues. Furthermore, the in vitro stimulation assay was unable to demonstrate that under inflammatory conditions these genes were modulated. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (M.S.)--University of Florida, 2008.
Local:
Adviser: Aukhil, Ikramuddin.
Statement of Responsibility:
by Ryan L. Mendro

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright by Ryan L. Mendro. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
7/11/2008
Classification:
LD1780 2008 ( lcc )

Downloads

This item has the following downloads:


Full Text







~r anulati on Ti ssue


Gingi val
Tissue









C1 C4 CS C6


D1 D2 DB D4 DS DG 07


G;APDH


D1 D2 D3 D4 DS DG D7
B


C1 C4 C5 C6


HIG;K andl HUV\;EC


Figure 4-1.


Bone morphogenic proein-2 gene expression in periodontally diseased granulation
tissue samples (D1-D7) and matched healthy, non-diseased, control, gingival tissue
samples (C1, C4, CS, C6). A) Polymerase chain reaction product from amplification
of cDNA using bmp2 specific primers. B) Polymerase chain reaction product from
amplification of cDNA using GAPDH specific primers. C) Polymerase chain
reaction product from amplification of bmp2 specific primers on HIGK and HUVEC
controls. D) Densitometric analysis of(A) normalized to GAPDH amplification in
(B).


BM P-2


BM P-2


3000




200
D1 D2 D3D 5D 7 1C 5C
pain ape










Specifically, RT-PCR was performed on seven granulation tissue samples as well as four

matching healthy tissues from the same patients. bmp-2 specific primers were used (Figure 4-1A)

to determine gene expression along with GAPDH specific primers (Figure 4-1B) as a

normalization control Finally, as a negative control RT-PCR was also performed on primary

endothelial (HUVEC) cells and keratinocytes (HIGK), cells known not to express the genes of

interest (Figure 4-1C). Once the data was normalized for total cDNA content, densitometric

analysis demonstrated there was no significant difference in the expression levels of bmp-2

among the granulation tissues from our individual participants (Figures 4-1D, 4-4).

Interestingly, there was also no significant difference in the expression levels of bmp-2 in the

granulation tissue and gingival tissue from the same participant. Therefore, while our results do

determine that granulation tissue does have the potential for BMP-2 activity and therefore the

induction of osteoblastic differentiation, it also insinuates that healthy gingival tissues contain

the same properties and potential with regards to BMP-2. (Figures 4-1, 4-4) Additional studies

need to be performed to corroborate this evidence.

Expression of Cbfal in Granulation Tissue

Core binding factor al is the first isolated osteoblastic-specific transcription factor. It is

the earliest and most specific marker for osteogenesis and is capable of inducing osteoblast-

specific gene expression in various cell lines including fibroblasts as well as myoblasts.33, 37

Using immunohistochemi stry, work in our laboratory has shown Cbfal positive cells were also

present in granulation tissue retrieved from periodontal defects.l

As a second step in the investigation of this hypothesis we evaluated the gene expression

of Cbfal in granulation tissue to confirm if this osteoblast-specific transcription factor was

present, which would suggest the presence of osteoblastic cell populations. In addition, we

compared the expression level of Cbfal to that of healthy tissue in order to elucidate if the









dissociation of the nucleoprotein complex. 0.2ml of chloroform was added to each sample.

Sample tubes were shaken vigorously by hand for 15 seconds and then incubated at room

temperature for 15 minutes. Next, the samples were centrifuged at 12,000 X g for 10 minutes at

40C. Then, the aqueous phase was transferred to a clean tube. Five hundred microliters of

isopropyl alcohol was added to each tube and gently mixed. Samples were then incubated at

room temperature for one hour. Next, they were centrifuged at 12,000 X g for 10 minutes at 40

After which, the supernatant was decanted. Then the samples were vortexed following the

addition of 1ml of 75% ethanol. Tubes were then centrifuged at 7,500 X g for 5 minutes at 40C.

The remaining pellet was dried for 10 minutes. Then, 25ul of RNase/DNase free water was

added and the samples were incubated for 20 minutes at 600C. Resulting RNA samples, were

frozen at -200C until reverse transcription (RT) could be performed. Subsequently, the

concentration of RNA for each sample was determined using a conventional spectrophotometer.

Reverse Transcription (RT)

Next cDNA was transcribed through reverse transcription of the RNA in the following

manner. First, a master mix containing 5X buffer, ImM DTTs, 2.5mM dNTPs, RT, and

oligopeptides was prepared and aliquoted for each sample. Next, extracted and normalized

concentrations of RNA from each sample were added to the tubes and the RT reaction was

brought to a final volume of 25ul using RNase/DNase free water. All steps were performed on

ice. After which, the RNA was reverse transcribed in a conventional thermocycler under the

following conditions: 400C for 40 minutes, 700C for 15 minutes and held at 40C. All cDNA

was stored at 40C until PCR could be performed.

Polymerase Chain Reaction (PCR)

Polymerase chain reaction was used to amplify the genes of interest from the cDNA. To

run the PCR, first a master mix was made containing 10X PCR buffer, 25mM MgC1,

































Figure 2-1.


Periodontium A) Healthy Periodontium. A. Cementum, B. Periodontal Ligament,
C. Alveolar Bone, D. Gingiva, E. Junctional Epithelium, F. Connective Tissue,
G. Gingival Sulcus
B) Chronic Periodontitis. Apical migration of the junctional epithelium occurs as
bacterial inflammation destroys the underlying connective tissue attachment and
bone. Consequently, the sulcus depth increases and a periodontal pocket (G*) is
formed. Granulation tissue fills the void where the bone was lost.









In Vitro Stimulation Assay

The lx105 human monocytic THP-1 cells were plated on a 24 well fibronectin spotted

plate and allowed to adhere and differentiate for 24 hours. Non-adherent cells were removed and

the wells washed 3 times with 2mls of phosphate buffered saline (PB S). After which, in some

wells, lx105 osteosarcoma cells (SaoS2) were plated. THP-1 and SaoS2cells were maintained

in RPMI1640, 10% FBS with .05mM P2-ME during the co-culture. After co-incubation of 24

hours, the cells were harvested and the RNA isolated. RT-PCR was performed and gene

expression was quantified as described above. In some wells, THP-1 cells and SaoS2 cells were

incubated alone to serve as baseline gene expression controls (Fig 3-1).













cbfal

Osterix


BMP-2


M~esenchymal Stem Cell


Osteoprogenitor Cell


Figure 2-4.


Factors regulating osteoblast differentiation from mesenchymal stem cells.
Undifferentiated mesenchymal stem cells are influenced by unknown mechanisms to
differentiate towards an osteoblast lineage. An intermediary osteoprogenitor cell is
first formed, upon which BMP-2 binds. After successful binding of BMP-2 several
transcription factors activate the immature osteoprogenitor cell to differentiate into a
fully functioning osteoblast capable of bone formation.


suP-Z


,









Periodontal Tissue Destruction

In health, the JE forms a protective band around the neck of the teeth along the

cementoenamel junction. However, the JE can be compromised by periodontal microorganisms

and their byproducts. Once the JE is breached, microorganisms can spread quickly and begin to

damage the underlying connective tissue and PDL by destroying cellular and extracellular

sub stances through the production of toxins including lipopolysaccharide. 1 Subsequently, an

inflammatory cascade is initiated by the host tissues which begin to produce inflammatory

mediators including proteases, cytokines and prostaglandins to fight off the pathogens.12 The

resultant inflammatory response is responsible for damaging the connective tissue and can

quickly spread into adj acent tissues.4 As the connective tissue and PDL are destroyed, the

rapidly proliferating epithelial cells begin to migrate apically along the root of the tooth,

preventing complete healing of the pre-existing connective tissue and PDL.4

As the inflammatory process progresses, it can extend from vessels in the gingival tissues

into the alveolar bone.13 Subsequently, the bone is resorbed by an increased amount of pro-

inflammatory mediators including interleukin 1 (IL-1) and tumor necrosis factor a (TNF-a) and

an increase in osteoclastic activity.4 Depending on the anatomy of the dentition and site

specificity of the disease process the bone loss may occur horizontally, that is parallel to the

cementoenamel junction; vertically, along a vector of the long axis of the tooth or a

combination of both.14 It has been shown that minimal thickness of alveolar bone, vasculature

and distance between tooth roots is associated with vertical bone loss.l

Predominately vertical bone loss creates the formation of intrabony pockets adj acent to teeth,

also known as intrabony or intraosseous defects (Figure 2-2). Clinically they are classified by

the number of intact bony walls that are present.16 These voids created by the vertical loss of

bone are simultaneously filled with newly forming granulation tissue. Granulation tissue is










further increase the overall Cbfal gene expression. Osteosarcoma cells alone, had a Cbfal gene

expression pattern similar to that of monocytes and osteosarcoma cells combined.

In Vitro Induction of Osterix

Osterix specific primers were used to determine gene expression along with GAPDH

specific primers as a normalization control (Figure 4-5C, D). For Osterix, the presence of

inflammatory mediators, monocytes alone, showed the greatest gene expression. Interestingly,

the addition of Osterix expressing osteosarcoma cells, to the monocytes did not further increase

the overall Osterix gene expression. Osteosarcoma cells alone, had an Osterix gene expression

pattern similar to that of monocytes and osteosarcoma cells combined.













~r anul ati on Ti ssue


~i ngival
Tissue


Osterix


01 Da DS D4 05 D6 D7


LI C4 C5 C6


G;APDH


D1 D2 D3 D4 DS


D6 07
B


C1 C4r CS C6


Osto rix


2500

,2000
31500

ii1000
500
0r


D1 D2 D3 D4 D5 D6 D7
patient samples


C1 C4 C5 C6


Figure 4-3.


Osterix gene expression in periodontally diseased granulation tissue samples (D1-
D7) and matched healthy, non-diseased, control, gingival tissue samples (C1, C4,
CS, C6). A) Polymerase chain reaction product from amplification of cDNA using
osterix specific primers. B) Polymerase chain reaction product from amplification of
cDNA using GAPDH specific primers. C) Polymerase chain reaction product from
amplification of osterix specific primers on HIGK and HUVEC controls. D)
Densitometric analysis of(A) normalized to GAPDH amplification in (B).










mucoperiosteal flaps were elevated beyond the depth of the intraosseous defect. Upon full

reflection, granulation tissue was excised from within the osseous defect. Granulation tissue was

sectioned and immediately placed in Trizol for later processing. In 4 subjects a small piece of

"healthy", control tissue was also excised from a clinically non-inflamed area. Control tissue

included for example, tissue from within the secondary flap or distal wedge tissue. No attempt

was made to harvest control tissue in sites that were not indicated to undergo surgery. This

control tissue was also sectioned and placed into formalin and Trizol. After complete

degranulation of the defect, all teeth in the surgical site were scaled and root planed as needed

with ultrasonic and hand instruments. Next, the defects were filled with freeze dried,

mineralized, bone allograft. At the surgeon's discretion, resorbable membranes were placed over

the bone graft as needed. Flaps were then repositioned and sutured with tension free, primary

closure. Post-operative instructions and antibiotics (1000 mg Amoxicillin at time of surgery,

followed by 500 mg Amoxicillin q8h for 7 days) were administered. Patients were seen for

regular follow-up approximately 2 weeks, 1 month and 3 months post-surgery. Plaque

debridement and oral hygiene instructions were completed as needed at the follow up

appointments .

Tissue Preparation and Storage

After the surgery equal portions of both healthy tissue and granulation tissue were placed

in Trizol. After which, the specimens were frozen at -80oF until RNA harvesting could be

performed.

Ribonucleic Acid (RNA) Isolation

Ribonucleic acid was isolated from each individual tissue sample using a standardized

Trizol protocol. 0.75mL of Trizol LS reagent was added for each 0.25 ml of thawed sample.

The homogenized samples were incubated for 5 minutes at room temperature to permit complete









progression. In health, a small crevice, the gingival sulcus is formed adjacent to the tooth,

extending from the crest of the gingiva to the JE attachment (Figure 2-1A).

Periodontal Disease

Periodontal disease, specifically chronic periodontitis, is an inflammatory disease which

affects all of the tissues of the periodontium. It is initiated by oral bacteria that infect the

gingival sulcus around the teeth. Proliferating bacteria can cause inflammation of the gingiva,

gingivitis, which can subsequently lead to the destruction of the underlying connective tissue

attachment, PDL, cementum and bone known as periodontitis. Clinically, the sulcus depth

increases and the JE begins to migrate apically as the underlying connective tissue and bone are

destroyed, forming a periodontal pocket (Figure 2-1B). Chronic periodontitis is characterized as

a continuous process with episodes of local exacerbation and remission.' Progression of the

disease can lead to continued loss of supporting structures and eventual tooth loss. This

destructive process can vary greatly and is largely influenced by differing host responses.6

Bacteria associated with chronic periodontitis vary significantly, but are often gram-negative,

anaerobes. Some of the primary bacteria associated with periodontitis include Porphyromona~s

gingivalis, Prevotella intermediate, BacteroidesJ;,i sythis, Aggregatibacter (Actinobacillus)

actinomycetemcomitans and Treponema denticola.

Almost one quarter of the United States is affected with at least a mild form of

periodontitis and approximately 13% of adults over 30 years of age have a moderate or severe

form of the disease.8 Periodontitis has both a subject and site predilection and does not affect all

teeth similarly.9 For example, one study showed that 70% of sites with advanced destruction

occurred in just 12% of the population.10









CHAPTER 5
DISCUS SION

Primarily, the objective of periodontal regenerative therapy is to exclude epithelial cells

from the areas where bone loss has occurred in an effort to selectively re-populate the defect with

cells from the PDL, which are presumed to be necessary for new bone and new PDL

attachment.20 More recent work has shown that other cells, including those found in granulation

tissue may also have the regenerative potential to induce new bone formation by the expression

of specific proteins and transcription factors.' It was therefore the purpose of this investigation

to determine if granulation tissue is a beneficial component in periodontal lesion healing due to

the presence of both cells with osteoblastic potential as well as the molecules required for their

osteoblastic differentiation.

Genetic expression of the protein BMP-2 and the transcription factors Cbfal and Osterix

are required for osteoprogenitor cells to differentiate into fully functioning osteoblasts.33, 34, 37

Using PCR, gene expression for BMP-2, Cbfal and Osterix was determined in granulation and

gingival tissue samples. All three genes were expressed in all of the granulation tissue samples.

Additionally, all three genes were also expressed in all gingival tissue samples in levels

comparable to that of the granulation tissue.

Granulation tissue is associated with a healing response. However, in untreated chronic

periodontal disease, the inflammatory insult is not resolved, and thus the granulation tissues

present do not appear to have the ability to spontaneously heal. As such, periodontal granulation

tissue may more appropriately be labeled a "granulomatous" tissue, as it is a tissue that shares

many similarities with granulation tissue, but lacks the distinct ability to repair the damaged

peri odontium.












TABLE OF CONTENTS


page

ACKNOWLEDGMENT S .............. ...............4.....


LI ST OF FIGURE S .............. ...............7.....


AB S TRAC T ......_ ................. ............_........8


CHAPTER


1 INTRODUCTION ................. ...............9.......... ......


2 BACKGROUND ................. ...............11.......... .....


Healthy Periodontium ................. ...............11........_ .....
Periodontal Disease .............. ...............12....
Periodontal Tissue Destruction ........._._._..... ..... ...............13....
Treatment of Chronic Periodontitis .............. .....................14
Mesenchymal stem cells............... ...............16.
Bone Development .............. ...............17....

3 MATERIALS AND METHODS .............. ...............23....


Participant Population ................. ...............23........._.....
Surgical Procedure ................. ...............23........ ......
Tissue Preparation and Storage .............. ...............24....
Ribonucleic Acid (RNA) Isolation ................ ...............24................
Reverse Transcription (RT) .............. ...............25....
Polymerase Chain Reaction (PCR) ................. ...............25......___....
In Vitro Stimulation Assay .............. ...............27....

4 RE SULT S ................. ...............29....... ......


Expression of Bone Morphogenetic Protein in Granulation Tissue ................ .........._.._.. .29
Expression of Cbfal in Granulation Tissue .....___.....__.___ .......____ ...........3
Expression of Osterix in Granulation Tissue ........._...... .. ......___ ....___ ...........3
Comparison of Expression Patterns for BMP-2, Cbfal1 and Osterix............. .... ........._._._32
In Vitro Induction of Osteoblast Associated Genes .............. ...............33....
In Vitro Induction of Bone Morphogenetic Protein .............. ...............33....
In Vitro Induction of Cbfal .............. ...............33....
In Vitro Induction of Osterix .............. ...............34....


5 DI SCUS SSION ........._.._ ..... .___ ...............4 1....




























Harvest RNA


SPCPfol genre erplession of BMP-2, CbfalandOsterix


1


2


3


Plates sported with fibroneetin Tor ~dl
adhesion




~5 IYla~fnF-lni*r;ri~Taraddrd




CJ 1WO'~ OReosarcoma cells added


1 ho~ur for platesto dry










24 hour
InCUDWOODn


Experimental design of in-vitro stimulation assay. The lx105 human monocytic
THP-1 cells were plated on a 24 well fibronectin spotted plate and allowed to adhere
and differentiate for 24 hours. After which, in some wells, lx105 osteosarcoma cells
(SaoS2) were plated. After co-incubation of 24 hours, the RNA was isolated, RT-
PCR was performed and gene expression was quantified. In some wells, THP-1
cells and SaoS2 cells were incubated alone to serve as baseline gene expression
controls.


Figure 3-1.









base of the pocket, which is clinically measured as recession of the gingival tissues.

Additionally, the removal of accretions from the root surfaces can promote a new connective

tissue or long junctional epithelial attachment to form on the root surface coronal to its existing

level, clinically measured as a gain in tissue attachment from the base of the pocket. The main

limitation of non-surgical treatment is that is conducted without tissue reflection, therefore,

visualization of the tooth surface is impaired and subsequently complete root surface cleaning

can not be predictably achieved in even moderately, 5mm deep pockets.l

Surgical intervention is a second modality for treatment of chronic periodontitis. The

objectives of surgical treatment are the similar to non-surgical treatment. However, with surgical

intervention the soft tissue is reflected away from the tooth and bone for better visualization and

access for tooth root instrumentation. Surgical intervention can be accomplished by several

different techniques. First, is resective treatment. Here, mucoperiosteal flap reflection allows

access to the underlying bone, and the contours of the bone can be adjusted to further reduce

periodontal pocketing.19 Additionally, any granulation tissue present is removed, in a process

known as degranulation. Reasons for degranulation are largely empirical, however, it can be

noted that thorough removal of this tissue does undoubtedly provided better visualization and

access to the tooth and bone surfaces and does decrease the amount of residual pocketing

immediately following surgery by decreasing the total thickness of soft tissue.

Another form of surgical treatment of periodontitis is known as guided tissue

regeneration (GTR). Guided tissue regeneration is similar to surgical resective treatment in that,

a surgical flap is first elevated to expose the underlying tooth and bone followed by

degranulation and root instrumentation. However, in addition GTR utilizes the placement of

barrier membranes over the bony defects. Barrier membranes helps to exclude the cells of the









retention of granulation tissue and osteoblastic cell populations would be beneficial in healing

and bone remodeling of the periodontal lesion.

Again, RT-PCR was performed on seven granulation tissue samples as well as 4

matching healthy tissues from the same patients. Cbfa-1 specific primers were used (Figure 4-

2A) to determine gene expression along with GAPDH specific primers (Figure 4-2B) as a

normalization control. Finally, as a negative control RT-PCR was also performed on primary

endothelial (HUVEC) cells and keratinocytes (HIGK), known not to express the gene of interest

(Figure 4-2C). The data was again normalized for total cDNA content and densitometric

analysis demonstrated there was no significant difference in the expression levels of cbfal

among the granulation tissues from our individual participants (Figures 4-2D, 4-4).

Interestingly, there was also no significant difference in the expression levels of cbfal in the

granulation tissue and gingival tissue from the same participant. Therefore, while our results do

determine that granulation tissue does have the potential for Cbfal activity and therefore the

induction of osteoblastic differentiation, it also insinuates that healthy gingival tissues contain

the same properties and potential with regards to Cbfal. (Figures 4-2, 4-4). Additional studies

need to be performed to corroborate this evidence.

Expression of Osterix in Granulation Tissue

Experiments have shown that Osterix, a zinc finger-containing transcription factor is also

required for osteoblast differentiation and bone development (36). Little is known about the

mediators of Osterix with regard to osteoblast differentiation; however research has shown that

BMP-2 induces Osterix expression.38

As a final step in investigation of this hypothesis we evaluated the gene expression of

Osterix in granulation tissue to determine if this osteoblast-specific transcription regulator could

be present. This, similar to the presence of Cbfa-1 would suggest the presence of osteoblastic









the future. Currently, further laboratory and clinical research is needed to determine if

granulation tissue should be removed during the surgical treatment of periodontal defects.









DESCRIPTION OF OSTEOPROGENITOR GENE EXPRESSION INT PERIODONTAL SOFT
TISSUES

















By

RYAN L. MENDRO


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2008









CHAPTER 2
BACKGROUND

Healthy Periodontium

Healthy periodontium consists of all the supporting structures of the tooth, including the

cementum, periodontal ligament (PDL), alveolar bone and gingiva. Cementum is found on the

surface of tooth roots and serves as anchorage for the principal fibers of the PDL. PDL is

specialized, non-mineralized connective tissue, which attaches the tooth to the alveolar bone.

Additionally, the PDL contains cells including osteoblasts and osteoclasts, monocytes and

macrophages, undifferentiated mesenchymal cells, cementoblasts, odontoclasts and fibroblasts.

These cells are important for tissue homeostasis and repair of the periodontium. For example, it

has been shown in animal models that the fibroblast population in the PDL remains at a constant

state with the number of new fibroblast cells produced by mitosis always equaling the number of

cells that die or migrate.2,3 Fibers of the PDL course through an extracellular ground substance.

This substance comprised of approximately 70% water is thought to be important for distributing

forces applied to the tooth.4

Opposite the tooth, the PDL fibers attach to an outer cortical layer of bundle bone which

forms the bony socket around the teeth. This bone as well as the central lamellar component of

the bone form the alveolar process. Gmngiva covers the bony surface and consists of an outer

junctional epithelium (JE) and an underlying connective tissue. JE consists of nondifferentiated,

stratified squamous epithelial cells that attach to the tooth via a hemidesmosomal attachment.

Monocytes are found within JE which secrete a- and P-defensins, cathelicidin LL-37, interleukin

(1L)-8, IL-la and -10, tumor necrosis factor-a, intercellular adhesion molecule-1, and

lymphocyte function antigen-3.4 These molecules in addition to the JEs structural integrity help

to serve as the first line of defense to invading microorganisms and periodontal disease









BIOGRAPHICAL SKETCH

Dr. Ryan L. Mendro received his Bachelor of Science in Food science and human

nutrition at the University of Florida, where he graduated in the spring of 2001. He then

attended dental school at Columbia University where he received his Doctor of Dental Surgery

degree in the summer 2005. Currently, Ryan Mendro is completing his postdoctoral residency in

periodontics at the University of Florida. Upon graduation in the summer 2008, Ryan will begin

practicing periodontics in Orlando, Florida.









any osteoblasts or bone.34 COre binding factor al has also been recognized as a gene responsible

for cleidocranial dysplasia an autosomal-dominant disease with bone abnormalities.35 In

addition, Osterix, a zinc finger-containing transcription factor, has also been shown as a

necessary factor for bone development. Experiments have shown that while Cbfalwas expressed

in Osterix null mice, Osterix is not expressed in Cbfal null mice, thus confirming that Osterix is

located downstream of Cbfal.36



































O 2008 Ryan L. Mendro









CHAPTER 3
MATERIALS AND IVETHODS

We conducted a prospective, observational study to determine if granulation tissue

removed from intrabony periodontal defects contains cells which express key genes necessary

for differentiation of an osteoprogenitor cell lineage capable of producing bone. Specifically, the

quantification of the genes for BlVP-2, Cbfal and Osterix was performed via polymerase chain

reaction (PCR). In addition, an in-vitro experiment was conducted to determine if the expression

of these genes could be modulated by a laboratory model of inflammation.

Participant Population

Seven patients were recruited from the University Of Florida College Of Dentistry,

Department of Periodontology. All patients consented to the study following Institutional

Review Board approval. Inclusion criteria were as follows: a diagnosis of severe periodontal

disease, completion of prior scaling and root planning, an age range between 18-65 years old and

the presence of at least one, 2-3 wall intraosseous periodontal defect with a coronal apical bone

depth of at least 4mm that required surgical treatment. Patients were excluded if they had a

history of severe acute or chronic systemic disease, uncontrolled or poorly controlled diabetes,

were pregnant or lactating or were taking medications known to affect the gingiva.

Prior to the surgery all enrolled patients received a comprehensive oral and periodontal

examination, oral hygiene instructions and scaling and root planing. Surgical intervention was

performed as needed, after a clinical re-evaluation, at least 6 weeks following the completion of

scaling and root planing.

Surgical Procedure

Under local anesthesia by one examiner (RIV), a standard surgical protocol for

periodontal regenerative therapy was completed. Buccal and lingual full-thickness,










31. Urist M. Bone:formation by sutoinduction. Science 1965; 150: 893-899.

32. Katagari T, Takahashi N. Regulatory mechanisms of osteoblast and osteoclast
differentiation. OralDiseases 2002; 8: 147-159.

33. Ducy P, Zhang R, Geoffrey V, Ridall A, Karsenty G. Osf2/Cbfal: a transcriptional
activator of osteoblast differentiation. Cell 1997; 89: 647-654.

34. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson
RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T.
Targeted disruption of Cbfal results in a complete lack of bone formation owing to
maturational arrest of osteoblasts. Cell 1997; 89: 755-764.

35. Lee B, Thirunavukkarasu K, Zhou L, Pastore L, Baldini A, Hecht J, Geoffroy V, Ducy P,
Karsenty G. Missense mutations abolishing DNA binding of osteoblast-specific
transcription factor OSF2/CBFAl in cleidocranial dysplasia. Nature Genetics 1997; 16:
307-310.

36. Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, de Crombrugghe
B. The novel zinc finger-containg transcription factor osterix is required for osteoblast
differentiation and bone formation. Cell 2002; 108(1): 17-29.

37. Ducy P. The osteoblast: A sophisticated fibroblast under central surveillance. Science
2000; 289(5484): 1501-1504.

38. Celil A, Hollinger J, Campbell P. Osx transcriptional regulation is mediated by additional
pathways to BMP2/Smad signaling. Journal of Cellular Biochemistry 2005; 95(3): 518-
528.

39. Zhou Y, Hutmacher D, Sae-Lim VZ. (2008). Osteogenic and Adipogenic Induction
Potential of Human Periodontal Cells. Journal ofPeriodontology 2008; 79(3): 525-534.










16. Goldman H, Cohen DW. The infrabony pocket: Classification and treatment Journal of
Periodontology 1958; 29: 272-291.

17. Nyman S, Sarhed G, Ericsson I, Gottlow J, Karring T. Role of "diseased" root cementum
in healing following treatment of periodontal disease. Journal ofPeriodontalResearch
1986; 21: 496-503.

18. Waerhaug J. Healing of the dento-epithelial junction following subgingival plaque
control. As observed on extracted teeth. Journal ofPeriodontology 1978; 49: 119-134.

19. Schluger S. Osseous resection- a basic principle in periodontal surgery. Oral surgery,
Oral medicine, Oral Pathology, Oral Radiology,~RRR~~RRR~~RR and Endodontics 1949; 2: 3-12.

20. Gottlow J, Nyman S, Lindhe J, Karring T, Wennstroim J. New attachment formation in
the human periodontium by guided tissue regeneration. Case reports. Journal of Clinical
Periodontology 1986; 13: 604-616.

21. Melcher A. On the repair potential of periodontal tissues. Journal ofPeriodontology
1976; 47(5): 255-260.

22. Laurell L, Gottlow J, Zybutz M, Persson R. Treatment of intrabony defects by different
surgical properties. A literature review. Journal ofPeriodontology 1998; 69: 303-313.

23. Mackay-Sim A, Silburn P. Stem cells and genetic disease. CellProbiferation 2008; 41: 85-
93.

24. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA,
Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human
mesenchymal stem cells. Science 1999: 284: 143-147.

25. Seo B, Miura M, Gronthos S. Investigation of multipotenet postnatal stem cells from
human periodontal ligament. Lancet 2004: 364:149-155.

26. Shi S, Gronthos S. Perivascular niche of postnatal mesenchymal stem cells in human
bone marrow and dental pulp. Journal of Bone and Mineral Research : The Official
Journal of the American Society for Bone and Mineral Research 2003; 1 8: 696-704.

27. Marie P. Transcription factors controlling osteoblastogenesis. Archives ofBiochemistry
and Biophysics 2008; In press.

28. Hanamura H. Solubilization and purification of bone morphogenic protein (BMP) from
Dunn osteosarcoma. Clinical Oi therve~l'~ iL \ and Relaedt Research 1980; 153: 232-240.

29. Young M, Kerr J, Ibaraki K. Heegard A, Robey P. Struture expression and regulation of
the maj or noncollagenous matrix proteins of bone. Clinical Oi they wed'tiL \ 1992; 281: 275-
294.

30. Ryoo H, Lee M, Kim Y. Critical molecular switches involved in BMP-2- induced
osteogenic differentiation of mesenchymal cells. Gene 2006; 366: 51-57.









cell populations. In addition, we compared the expression level of Osterix to that of healthy

tissue in order to elucidate if the retention of granulation tissue and osteoblastic cell populations

would be beneficial in healing and bone remodeling of the periodontal lesion.

Again, RT-PCR was performed on seven granulation tissue samples as well as 4

matching healthy tissues from the same patients. Osterix specific primers were used (Figure 4-

3A) to determine gene expression along with GAPDH specific primers (Figure 4-3B) as a

normalization control. Finally, as a negative control RT-PCR was also performed on primary

endothelial (HUVEC) cells and keratinocytes (HIGK), known not to express the gene of interest

(Figure 4-3C). The data was again normalized for total cDNA content and densitometric

analysis demonstrated there was no significant difference in the expression levels of Osterix

among the granulation tissues from our individual participants (Figures 4-3D, 4-4).

Interestingly, there was also no significant difference in the expression levels of Osterix in the

granulation tissue and gingival tissue from the same participant. Therefore, while our results do

determine that granulation tissue does have the potential for Osterix activity and therefore the

induction of osteoblastic differentiation, it also insinuates that healthy gingival tissues contain

the same properties and potential with regards to Osterix. (Figures 4-3, 4-4). Additional studies

need to be performed to corroborate this evidence.

Comparison of Expression Patterns for BMP-2, Cbfal and Osterix

Figure 4-4A illustrates a concurrent overlay of the expression of the BMP-2, Cbfal and

Osterix. No discernable pattern of gene expression was noted between the genes or between the

granulation tissue group and the gingival tissue group. However, it was noted that for all

samples, expression of Cbfal was greater than the expression of Osterix.

In figure 4-4B, the average gene expression of BMP-2, Cbfal and Osterix is compared

between granulation and gingival tissues. On average, Cbfa-1 and Osterix are expressed more in











3500
3P000




2500


Cbfal





12 3


OsteearomaCells
(1) (2)


Cnly
(3)


n
hn~nrcvtrr kleresr~ronlu om~ru~~mlcllr
ORl~rr~~ma(ellr 4nlv
II) (1) I'li
stimulnbn 4~nrp


Figure 4-5.


Bone morphogenic protein-2, Cbfal and Osterix gene expression under bone
inducing conditions of SoaS. A) Polymerase chain reaction products from
amplification of cDNA using bmp-2 and GAPDH specific primers and
accompanying densitometric analysis. B) Polymerase chain reaction products from
amplification of cDNA using cbfal and GAPDH specific primers and accompanying
densitometric analysis. C) Polymerase chain reaction products from amplification of
cDNA using osterix and GAPDH specific primers and accompanying densitometric
analysis. (D) Comparison of BMP-2, Cbfa-1 and Osterix gene expression under co-
or mono- culture conditions.


OdteesrcomaCells C iI
(1) (2) rl
Stimurlation Assay


GAL.*H


2500
Qsterix 000

S1500
1000


123
~,,,,,









osteoprogenitor cells can differentiate into the osteoblasts which are necessary for new bone

formation. If these stem cells are present in granulation tissue it is plausible that they may be

able to regenerate the bone lost from periodontitis.27 Therefore, we hypothesize that the gene

expression pattern necessary for osteoblast differentiation and subsequent new bone formation

can be found in periodontal granulation tissue.

Genes involved in bone development can also be induced experimentally in-vitro,

without the presence of the MSCs. For example, osteosarcoma cell lineages have been shown to

express BMPs and are therefore capable of inducing bone formation.28 Here we use these

osteosarcoma cells in an experimental model of osteoblastic gene induction.

Bone Development

Bone is comprised mainly of hydroxyapatite and extracellular matrix proteins which

include type I collagen, osteocalcin, osteonectin, osteopontin, bone sialoprotein and

proteoglycans.29 It is produced by osteoblasts, specialized cells derived from mesenchymal stem

cells. In order for osteoblast differentiation to occur, the mesenchymal cells must be influenced

by several key regulatory factors (Figure 2-4). One such factor is bone morphogenic protein

(BMP).30 Bone morphogenic protein was discovered in 1965, when it was found that the protein

could ectopically induce bone formation if implanted into muscle.31 Currently, at least 15

different genes of BMPs have been identified.32 Bone morphogenic protein is the only known

growth factor known capable of ectopic bone formation. Signaling of BMP is initiated upon its

binding to two distinct transmembrane receptors.32 Once BMP is bound, the expression of

several other transcription factors are required for further differentiation into an osteoblast

lineage. One such factor, core binding factor al, Cbfal, has been shown to be a primary

transcriptional activator that controls the expression of the maj or structural proteins of the bone

matrix.33 This became evident when it was demonstrated that Cbfal null mice did not produce




































To my family, instructors, fellow residents, and friends who made this possible.









ACKNOWLEDGMENTS

I would like to thank the faculty members of the University of Florida, Department of

Periodontics who faithfully and tirelessly strive to improve the future of this great profession.

Specifically, I would like to thank Shannon Wallet, Tord Lundgren, Theofilos Koutouzis,

Ikramuddin Aukhil, and Dennis Davis for their contributions to my education and this thesis.









CHAPTER 1
INTRODUCTION

Periodontitis is an inflammatory disease in which the cementum, periodontal ligament

(PDL) and alveolar bone surrounding teeth are destroyed. This destruction of the alveolar bone

and supporting periodontal tissues can cause the formation of intrabony periodontal defects

adj acent to teeth. These defects contain a granulomatous tissue that fills the void where the bone

was lost. This tissue is typically excised and discarded in traditional surgical treatment of

periodontal defects. However, many cell types are contained within this granulation tissue

including osteoprogenitor stem cells (OSC). These OSCs are capable of differentiation into the

osteoblast cell lineage, which contribute to bone regeneration and periodontal lesion healing.

This differentiation requires the stimulation of the OSCs by specific proteins and expression of

specific genes necessary for bone formation. This study's aim was to use molecular and

immunohistochemical techniques to examine periodontal granulation tissue for the proteins and

gene expression pattern necessary for osteoblast differentiation to determine if this granulation

tissue is capable of bone regeneration.

To accomplish this, granulation tissue and healthy gingival tissue samples were harvested

during periodontal surgeries, after which, polymerase chain reaction (PCR) was used to

determine the expression of BMP-2, Cbfal and Osterix; three genes involved in bone

development. Here comparisons in gene expression were made between tissues from a non-

inflammatory site and the inflammatory granulation tissue. In order to demonstrate a potential

model of how these genes could be regulated/modulated under inflammatory conditions, an in-

vitro stimulation assay using a human monocytic cell line (THP-1) along with a source of BMP-

2, Cbfal and Osterix; specifically an osteosarcoma cell line (SoaS) was also performed.

Our results here demonstrate the genes for BMP-2, Cbfal and Osterix are expressed at similar


























A B
Figure 2-3. Surgical treatment of an intrabony defect. A) Before and B) after granulation tissue
was removed.














BMP-2
4000 Cbfal
3500 -1 DOtenlx

cn 3000-
3 2500-

O 2000-









3500-


patHeranulation




3000 -Tissue
niGingival
Tissue
ar 2500-


.2 2000 -

S1500-

S1000-


500-



RMP7 Chfe-1 OSterlx

B


Figure 4-4. Bone morphongenic protein-2, Cbfal and Osterix gene expression. A)
Densitometric analysis for concomitant gene expression of BMP-2, Cbfal and
Osterix in periodontally diseased granulation tissue samples (D1-D7) and healthy,
non-diseased, gingival tissues samples (C1, C4, CS, C6). B) Average gene
expression of BMP-2, Cbfal and Osterix in periodontally diseased granulation tissue
samples and healthy, non-diseased, gingival tissue samples.









2.5mMdNTP mix, Taq and 20uM primers for the genes of interest. Primers used included:

BMP -2, "'C GTC AAGC CAAAC ACAAAC AG"' (forward) and

"GAGCCACAATCCAGTCATTCC" (reverse); Cbfal, "CAGTCACCTCAGGCATGTCC"

(forward) and "GAGATATGGAGTGCTGCTGGTG" (reverse); Osterix,

"GGTACAAGGCAGGCATCCATG" (forward) and "AGTGTCCCTTGCAGCCCATC"

(reverse). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a housekeeping gene, was

used as an internal control. Glyceraldehyde 3-phosphate dehydrogenase is constitutively

expressed in all cells and therefore allows for normalization of the total DNA isolated from the

PCR reactions. The primers for GAPDH were, "ACCACAGTCCATGCCATCAC" (forward)

and "TCCACCACCCTGTTGCTGTA" (reverse). Next, the master mix was aliquoted for each

cDNA sample along with RNase/DNase free water. All steps were performed on ice. After

which, the genes of interest were amplified in a conventional thermocycler under the following

conditions: 950C for 4 minutes, 940C for 1 minute, 550C for 45 sec for 30 cycles, at 720C for 2

minutes, 560C for 1 minute, and 720C for 5 minutes. All PCR products were stored at 40C for

until further analysis could be performed. In addition to the study samples, the same PCR

protocol was ran on two control samples known not to express the genes of interest, Human

Immortalized Gingival Keratinocytes (HIGK) and Human Umbilical Vein Endothelial Cells

(HUVEC). Any positive result in the controls would be indicative of either DNA contamination

or non-specificity of the primers designed for the experiment.

Lastly, to visualize the amplified genes, electrophoresis was run on a 2% agarose gel.

This gel was then viewed on a BioRad ChemiDoc and densitometric analysis was performed

using Quantity One (BioRad) software to semi-quantify the genes of interest.









Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

DESCRIPTION OF OSTEOPROGENITOR GENE EXPRESSION INT PERIODONTAL SOFT
TISSUES

By

Ryan L. Mendro
May 2008

Chair: Ikramuddin Aukhil
Major: Dental Sciences

Recent work has shown that cells outside of periodontal ligament, including those found

in granulation tissue may also have the regenerative potential to induce new bone formation by

the expression of specific proteins and transcription factors.l It was therefore the purpose of this

investigation to determine if periodontal granulation tissues possess the specific proteins and

gene expression pattern necessary for osteoblast differentiation in an effort to determine if this

granulation tissue should therefore be retained in the surgical treatment of periodontal defects.

To accomplish this, granulation tissue and healthy gingival tissue samples were harvested

during periodontal surgeries, after which, polymerase chain reaction (PCR) was used to

determine the expression of Bone morphogenic protein-2 (BMP-2), Core binding factor al

(Cbfal) and Osterix; three genes involved in bone development. To demonstrate a potential

model of how these genes could be regulated under inflammatory conditions, an in-vitro

stimulation assay using a human monocytic cell line (THP-1) along with a source of BMP-2,

specifically an osteosarcoma cells line (SoaS) was also performed.

Our results demonstrate that BMP-2, Cbfal and Osterix are expressed at similarly in both

granulation as well as healthy gingival tissues. Furthermore, the in vitro stimulation assay was

unable to demonstrate that under inflammatory conditions these genes were modulated.









is impossible to rule out the possibility that the cells from the existing adj acent bone and or

overlying periosteum were included in the tissue samples. Due to the sensitivity of the PCR

amplification process any amount cDNA from bone or periosteum that was present in the

samples may have had a significant impact on the overall gene expression patterns found within

the granulation or gingival tissues.

Our in vitro assay failed to show that the genes necessary for bone development would be

up-regulated under inflammatory conditions. Our model, perhaps an overly simplistic one, may

not have accurately reflected the "inflammatory" state found in periodontal lesions. While,

monocytes are undoubtedly found in periodontal lesions, their presence alone on a plate does not

necessarily create an environment comparable to the largely anaerobic, bacteria laden

periodontal defect environment which is affected by literally dozens of other chemokines,

cytokines, regulatory molecules, etc., all of which were unaccounted for in this model.

Furthermore, by using monocytes and osteosarcoma cells in combination, causality of the

changes in gene expression can not be determined. That is, from our model it can not be

determined if changes in gene expression in BMP-2, Cbfal and Osterix were related to changes

in the expression pattern of the osteosarcoma cells, or if the monocytes themselves, were induced

into an osteoblastic lineage.

Clearly, the process of osteoblast induction is a complex one, which while dependent on

the presence of the three genes BMP-2, Cbfal and Osterix, is not exclusive to all cells expressing

them. Further studies should be aimed at the examination of other possible factors that may be

ultimately responsible for the induction of osteoblasts. While our results do not offer clinical

results suggesting that leaving granulation tissue in periodontal defects may be advantageous to

defect healing, our results do offer a plausible explanation of how this tissue may be of value in










levels in both granulation as well as healthy gingival tissues. Furthermore, the in vitro

stimulation assay was unable to demonstrate that under inflammation conditions these genes

were modulated.

Hypothesis: Granulation tissue is a beneficial component in periodontal lesion healing

due to the presence of both cells with osteoblastic potential as well as the molecules required for

their osteoblastic differentiation.









gingival connective tissue and epithelium and gives preference for repopulation by PDL cells in

the area of the defects which may be able to regenerate all of the structures lost in the disease

process, including cementum, PDL, and bone.20 Despite evidence that suggests that regeneration

of these structures may be possible, complete regeneration is not predictable.21 How PDL cells

function in tissue regeneration is not well understood. Some studies support the concept that the

PDL has progenitor cells capable of differentiating into bone forming osteoblasts, while others

suggest that the preexisting osteoblasts are responsible for wound repopulation and new bone

formation.21 22 More recent evidence suggests however, that there may be another source of

osteoblast for wound repair and bone regeneration found within the granulation tissue.l Our

hypothesis is that cells found within the granulation tissue are capable of bone formation and

posses the gene expression pattern necessary for new bone development.

Mesenchymal stem cells

Mesenchymal stem cells (MSCs) are bone marrow derived, self-renewing multipotent

progenitor cells that can be found throughout development.23 Mesenchymal stem cells can

differentiate into various mesenchymal cell lineages including adipocytes, chondrocytes,

hepatocytes, cardiomyocytes, neurons, as well as osteoblasts, the cells responsible for bone

development.24 Stem cells have several key features. First, they must be able to undergo cell

division. Additionally, they must be able to differentiate into multiple cell types. Lastly, when

transplanted into a foreign site, they must possess the ability to reform the cells specific to the

transplant tissue. These stem cells have been isolated in various dental tissues including the

dental pulp and PDL.25, 26 More recent evidence suggests that periodontal granulation tissue may

also contain MSCs.l In order for the MSCs to differentiate into osteoblasts, first an intermediary

cell lineage between the mesenchymal stem cell and the osteoblast known as a pre-osteoblast or

osteoprogenitor cell is expressed. Ultimately, given proper signaling and gene expression, the









defined as tissue formed in ulcers and in early wound healing and repair, composed largely of

newly growing capillaries. While granulation tissue is typically indicative of a repair process,

the granulation tissue found chronic periodontitis if left untreated will not ever fully repair or

create a new attachment to the tooth. Subsequently, if the bony defects are treated surgically, the

granulation tissue is typically excised in toto (Figure 2-3).16

More recent evidence suggests however, that this highly vascularized tissue which contains

various inflammatory cells, fibroblasts and stromal cells may be of value in the healing of

periodontal defects.l

Treatment of Chronic Periodontitis

Aims for treating chronic periodontitis are to reduce inflammation and to create an

improved environment for oral hygiene access in order to prevent or reduce disease

reoccurrences. Clinically, treatment outcomes are often measured in pocket depth reduction and

gain in clinical attachment of the soft tissues to the root surface. There are two primary

modalities for the treatment of chronic periodontitis; non-surgical and surgical. Non-surgical

treatment includes scaling and root planing; a procedure in which hand, ultrasonic, rotating or

laser instrumentation is used to cleanse the surface of the teeth without intentional displacement

of the gingival tissues. Scaling is defined as supra or subgingival debridement aimed at

removing the bacterial plaque and their associated mineralized accretions, calculus, from the

tooth surfaces. Root planing is the intentional removal of "diseased" cementum which has been

exposed to cytotoxic byproducts from the periodontal bacteria. It has been shown however, that

intentional aggressive instrumentation to remove all cementum is not necessary to achieve

periodontal health." Scaling and root planing reduces the depth of the pockets and subsequently

the bacterial reservoir by two mechanisms. First, removal of the bacteria decreases the amount

of inflammation present, allowing the gingival tissues to reduce in size and constrict towards the













4500
4000
3500
3000
2500
2000
1500
1000
500
0


BM P-2
m Cbfa-1
0 Osterix


Monocytes+ MonocytesOnly Osteosarcoma
Osteosarcoma Ctlls Only
Cells


Stimulation Assay
D


Figure 4-5. Continued









While traditional surgical treatment of periodontal intrabony defects includes the

meticulous removal of all granulomatous tissues, our research sought to determine if complete

degranulation is necessary.1, 14 We have shown that this highly vascularized tissue may actually

possess the genetic potential to regenerate the bone lost to periodontal disease. If future

treatment could be aimed at shifting the environment within the granulation tissue to an optimal

condition for osteoblast differentiation, it is conceivable that this tissue may in fact be capable of

this differentiation and subsequent new bone formation.

Interestingly, our results found the presence of the three genes of interest for osteoblast

induction BMP-2, Cbfal and Osterix present in not only inflamed granulomatous tissue where

bone was once present, but also in healthy, non-inflamed gingival tissue samples. These results

were supported in a recent study by Zhou et al., who demonstrated that gene expression profiles

for BMPs, Cbfal and Osterix were similar in osteoblasts as well as gingival fibroblasts.39

Despite the presence of these osteogenic markers, the gingival fibroblasts lacked the ability to

induce osteogenesis.39 This was also illustrated in earlier immunohistochemistry work, which

examined only Cbfal, but found that Cbfal positive staining cells were present in granulation

tissues, but not gingival tissue samples.l Therefore, it is evident that even if osteoprogenitor and

osteoblast expression profiles are present, their activation is dependent upon additional unknown

factors which could include for example, cell surface receptors or environmental cues.

One limitation of this study was that the sample size was small and subsequently any

statistical analysis would have been of limited value. Also, while samples were taken either

from granulation or gingival tissues there exists the inherent heterogeneity, not only between

individuals, but between sample sites which may further confound any specific conclusions.

Additionally, while great care was take to retrieve only granulation or gingival tissue samples, it









CHAPTER 4
RESULTS

7 subj ects participated in this study, from which 7 granulation tissue samples and 4

gingival tissue samples were collected. All of the tissue samples were analyzed via PCR for the

gene expression of BMP-2, Cbfal and Osterix. These genes were used because all three have

been previously shown to be key regulators necessary for osteoblast differentiation and therefore

bone formation.

Expression of Bone Morphogenetic Protein in Granulation Tissue

Bone morphogenetic proteins (BMPs) are secreted signaling molecules which belong to

the transforming growth factor-beta (TGF-P) superfamily of growth factors. Bone morphogenic

proteinss were originally identified by their ability to induce ectopic bone formation when

implanted under the skin of rodents. This indicated that these molecules could play important

roles during bone formation. To date over 15 BMPs have been identified and their expression is

widespread and dynamic as development in general proceeds. Therefore, BMPs can have a

broad range of physiologic functions, including the control of osteoblast differentiation. Several

BMPs can induce osteoblast specific gene expression in vitro.

As previously mentioned, periodontal disease results in bone loss. Subsequently,

granulation tissue is formed in the resulting intrabony defect (Fig 2-3). Traditional periodontal

treatment calls for the removal of this tissue. Previous work done in our laboratory suggests that

this tissue may harbor bone regenerating potentially In order to support this hypothesis here, we

evaluated the gene expression of BMP-2 in granulation tissue to determine if this osteoblast

inducing factor could be present. In addition, we compared this expression level to that of

healthy tissue in order to elucidate if the retention of granulation tissue and thus BMP-2 activity

would be beneficial in healing and bone remodeling of the periodontal lesion.










granulation tissue than gingival tissue. Alternatively, a trend of increased expression of BMP-2

was noted in gingival tissue.

In Vitro Induction of Osteoblast Associated Genes

Our results from the previous gene expression analysis clearly demonstrate that

osteoprogenitor gene expression for BMP-2, Cbfal and Osterix are found in both clinically

inflamed granulation tissues as well as clinically healthy, non-inflamed gingival tissues.

Subsequently, we sought to determine a plausible model to represent how, if at all, these genes

could be modulated under the inflammatory conditions as would be seen in a chronic periodontal

defect. To accomplish this, an in-vitro stimulation assay was performed using a source of

inflammatory cells, a human monocytic cell line (THP-1), along with a source bone producing

cells, specifically an osteosarcoma cell line (SoaS). The osteosarcoma cells express BMP-2,

Cbfal and Osterix, all of which are needed for bone development.

In Vitro Induction of Bone Morphogenetic Protein

We used bmp-2 specific primers to determine gene expression along with GAPDH

specific primers as a normalization control (Figure 4-5A, D). For BMP-2, the presence of

inflammatory mediators, monocytes, alone, showed the greatest gene expression. Interestingly,

the addition of BMP-2 expressing osteosarcoma cells, to the monocytes did not further increase

the overall BMP-2 gene expression. Osteosarcoma cells alone, had a BMP-2 gene expression

pattern similar to that of monocytes and osteosarcoma cells combined.

In Vitro Induction of Cbfal

Core binding factor al specific primers were used to determine gene expression along

with GAPDH specific primers as a normalization control (Figure 4-5B, D). For Cbfal, the

presence of inflammatory mediators, monocytes alone, showed the greatest gene expression.

Interestingly, the addition of Cbfal expressing osteosarcoma cells, to the monocytes did not














































IIIII IIIIII


Grlanul ati on Tissue ?


Gjingrival
Tissue


D1 D2 03 04 DE DG D7


C1 CQ C5 C6


G;APD!H


Y~ Y1 V~ VY Y3 Y~ VI


Cbfal1


4000
3500
,3000
S2500
2 000

ii
"CI


D1 D2 D3 D4 D5 D6 D7
patient samples


C1 C4 C5 C6


Figure 4-2.


Core binding factor al gene expression in periodontally diseased granulation tissue
samples (D1-D7) and matched healthy, non-diseased, control, gingival tissue
samples (C1, C4, CS, C6). A) Polymerase chain reaction product from amplification
of cDNA using cbfal specific primers. B) Polymerase chain reaction product from
amplification of cDNA using GAPDH specific primers. C) Polymerase chain
reaction product from amplification of cbfal specific primers on HIGK and HUVEC
controls. D) Densitometric analysis of(A) normalized to GAPDH amplification in
(B).


Cbfa l


-
-
-
-
-


II III


III1









LIST OF REFERENCES

1. Davis D. Multipotent stem cells isolated from the granulation tissue of intrabony
periodontal defects. Masters Thesis 2007. Gainesville: University of Florida.

2. McCulloch C., Melcher A. Cell density and cell generation in the periodontal ligament of
mice. American Journal ofAnatomy 1983; 167: 43-58.

3. Schellens J, Everts V, Beersten W. Quantitative analysis of connective tissue resoption
in the supra-alveolar region of the mouse incisor ligament. Journal ofPeriodontal
Research 1982; 17: 407-422.

4. Nanci A, Bosshardt D. Structure of periodontal tissues in health and disease.
Periodontology 2000 2006; 40: 11-28.

5. Socransky S, Haffajee A, Goodson J, Lindhe J. New concepts of destructive periodontal
disease. Journal of Clinical Periodontology 1984; 11: 21-32.

6. Kinane D. Causation and pathogenesis of periodontal disease. Periodontology 2000 2001;
25: 8-20.

7. Zambon JJ. Periodontal diseases: microbial factors. Annals ofperiodontology/ The
American Acad'emy ofPeriodontology 1996; 1: 879-925.

8. Albandar J, Brunelle J, Kingman A. Destructive periodontal disease in adults 30 years of
age and older in the United States, 1988-1994. Journal ofPeriodontology 1999; 70: 13-
29.

9. Papapanou P, Wennstrom J, Grondahl K. Periodontal status in relation to age and tooth
type. A cross-sectional radiographic study. Journal ofClinicalPeriodontology 1988; 15:
469-478.

10. Lindhe J, Okamoto H, Yoneyama T, Haffajee A, Socransky S. Periodontal loser sites in
untreated adult subjects. Journal of ClinicalPeriodontology 1989; 16: 671-678.

11. Darveau R, Tanner A, Page R. The microbial challenge in periodontitis. Periodontology
2000 1997; 14: 12-32.

12. Kornman K, Page R, Tonetti M. The host response to the microbial challenge.
Periodontology 2000 1997; 14: 33-53.

13. Weinmann J. Progression of gingival inflammation in the supporting structures of the
teeth. Journal ofPeriodontology 1941; 12: 71-82.

14. Prichard J. Advanced Periodontal Disease: Surgical and Prosthetic Management. 2ed.
1965; 265.

15. Tal H. Relationship between the interproximal distance of roots and the prevalence of
intrabony pockets. Journal ofPeriodontology 1984; 55(1): 604-7.



























on of an intrabony defect. Intrabony defect present on mesial of


Radiographic
first molar.










LIST OF FIGURES


Figure page

2-1 Periodontium ........... ..... .._ ...............19...

2-2 Radiographic detection of an intrabony defect. .............. ...............20....

2-3 Surgical treatment of an intrabony defect ................. ...............21........... ..

2-4 Factors regulating osteoblast differentiation from mesenchymal stem cells.. ...................22

3-1 Experimental design of in-vitro stimulation assay. ................ ..............................28

4-1 Bone morphogenic proein-2 gene expression in periodontally diseased granulation
tissue samples (D1-D7) and matched healthy, non-diseased, control, gingival tissue
sampl es (C 1, C 4, C 5, C6) .............. ...............3 5....

4-2 Core binding factor al gene expression in periodontally diseased granulation tissue
samples (D1-D7) and matched healthy, non-diseased, control, gingival tissue
samples (C1, C4, CS, C6) .............. ...............36....

4-3 Osterix gene expression in periodontally diseased granulation tissue samples (D1-
D7) and matched healthy, non-diseased, control, gingival tissue samples (C1, C4,
CS C 6) ................ ...............37................

4-5 Bone morphogenic protein-2, Cbfal and Osterix gene expression under bone
inducing conditions of SoaS .............. ...............39....











6 LIST OF REFERENCES............... ...............4

7 BIOGRAPHICAL SKET CH ................. ...............48................


































































6




Full Text

PAGE 1

1 DESCRIPTION OF OSTEOPROGENITOR GENE EXPRESSION IN PERIODONTAL SOFT TISSUES By RYAN L. MENDRO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2008

PAGE 2

2 2008 Ryan L. Mendro

PAGE 3

3 To my family, instructors, fellow resident s, and friends who made this possible.

PAGE 4

4 ACKNOWLEDGMENTS I would like to thank the faculty members of the University of Florida, Department of Periodontics who faithfully and tirele ssly strive to improve the futu re of this great profession. Specifically, I would like to thank Shannon Wa llet, Tord Lundgren, Theofilos Koutouzis, Ikramuddin Aukhil, and Dennis Davi s for their contributions to my education and this thesis.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4 LIST OF FIGURES ............................................................................................................... ..........7 ABSTRACT ...................................................................................................................... ...............8 CHAPTER 1 INTRODUCTION ................................................................................................................ ....9 2 BACKGROUND .................................................................................................................. ..11 Healthy Periodontium .......................................................................................................... ...11 Periodontal Disease ........................................................................................................... .....12 Periodontal Tissue Destruction ...............................................................................................1 3 Treatment of Chronic Periodontitis ........................................................................................14 Mesenchymal stem cells ........................................................................................................ .16 Bone Development .............................................................................................................. ...17 3 MATERIALS AND METHODS ...........................................................................................23 Participant Population ........................................................................................................ .....23 Surgical Procedure ............................................................................................................ ......23 Tissue Preparation and Storage ..............................................................................................24 Ribonucleic Acid (RNA) Isolation .........................................................................................24 Reverse Transcription (RT) .................................................................................................... 25 Polymerase Chain Reaction (PCR) .........................................................................................25 In Vitro Stimulation Assay .................................................................................................... .27 4 RESULTS ..................................................................................................................... ..........29 Expression of Bone Morphogenetic Protein in Granulation Tissue .......................................29 Expression of Cbfa1 in Granulation Tissue ............................................................................30 Expression of Osterix in Granulation Tissue ..........................................................................31 Comparison of Expression Patterns for BMP-2, Cbfa1 and Osterix ......................................32 In Vitro Induction of Osteoblast Associated Genes ...............................................................33 In Vitro Induction of Bone Morphogenetic Protein ...............................................................33 In Vitro Induction of Cbfa1 ................................................................................................... .33 In Vitro Induction of Osterix ................................................................................................. .34 5 DISCUSSION .................................................................................................................. .......41

PAGE 6

6 6 LIST OF REFERENCES ........................................................................................................45 7 BIOGRAPHICAL SKETCH ..................................................................................................48

PAGE 7

7 LIST OF FIGURES Figure page 2-1 Periodontium .............................................................................................................. ........19 2-2 Radiographic detection of an intrabony defect. .................................................................20 2-3 Surgical treatment of an intrabony defect ..........................................................................21 2-4 Factors regulating osteob last differentiation from me senchymal stem cells.. ...................22 3-1 Experimental design of in-vitro stimulation assay.............................................................28 4-1 Bone morphogenic proein-2 gene expre ssion in periodontally di seased granulation tissue samples (D1-D7) and matched healthy, non-diseased, contro l, gingival tissue samples (C1, C4, C5, C6) ..................................................................................................35 4-2 Core binding factor 1 gene expression in periodontal ly diseased granulation tissue samples (D1-D7) and matched healthy, nondiseased, control, gingival tissue samples (C1, C4, C5, C6) ..................................................................................................36 4-3 Osterix gene expression in periodontally diseased granulati on tissue samples (D1D7) and matched healthy, non-diseased, c ontrol, gingival tiss ue samples (C1, C4, C5, C6) ....................................................................................................................... ........37 4-5 Bone morphogenic protein-2 Cbfa1 and Osterix gene expression under bone inducing conditions of SoaS ..............................................................................................39

PAGE 8

8 Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science DESCRIPTION OF OSTEOPROGENITOR GENE EXPRESSION IN PERIODONTAL SOFT TISSUES By Ryan L. Mendro May 2008 Chair: Ikramuddin Aukhil Major: Dental Sciences Recent work has shown that cells outside of periodontal ligament, including those found in granulation tissue may also have the regene rative potential to induce new bone formation by the expression of specific protei ns and transcription factors.1 It was therefore the purpose of this investigation to determine if periodontal granulation tissues possess the specific proteins and gene expression pattern necessary fo r osteoblast differentiation in an effort to determine if this granulation tissue should therefore be retained in the surgic al treatment of pe riodontal defects. To accomplish this, granulation tissue and heal thy gingival tissue samples were harvested during periodontal surgeries, after which, pol ymerase chain reaction (PCR) was used to determine the expression of Bone morphogenic protein-2 (B MP-2), Core binding factor 1 (Cbfa1) and Osterix; three genes involved in bone development. To demonstrate a potential model of how these genes could be regulated under inflammatory conditions, an in-vitro stimulation assay using a human monocytic cel l line (THP-1) along with a source of BMP-2, specifically an osteosarcoma cells line (SoaS) was al so performed. Our results demonstrate that BMP-2, Cbfa1 and Osterix are expressed at similarly in both granulation as well as healthy gi ngival tissues. Furthermore, the in vitro stimulation assay was unable to demonstrate that under inflammato ry conditions these genes were modulated.

PAGE 9

9 CHAPTER 1 INTRODUCTION Periodontitis is an inflammatory disease in which the cementum, periodontal ligament (PDL) and alveolar bone surrounding teeth are destroyed. This de struction of the alveolar bone and supporting periodontal tissues can cause th e formation of intra bony periodontal defects adjacent to teeth. These defects contain a granulomatous tissue th at fills the void where the bone was lost. This tissue is typically excised and discarded in traditional surgical treatment of periodontal defects. However, many cell types are contained within th is granulation tissue including osteoprogen itor stem cells (OSC). These OSCs ar e capable of differentiation into the osteoblast cell lineage, which cont ribute to bone regeneration a nd periodontal lesion healing. This differentiation requires the stimulation of the OSCs by speci fic proteins and expression of specific genes necessary for bone formation. This studyÂ’s aim was to use molecular and immunohistochemical techniques to examine periodont al granulation tissue for the proteins and gene expression pattern necessary for osteoblast differentiation to determine if this granulation tissue is capable of bone regeneration. To accomplish this, granulation tissue and heal thy gingival tissue samples were harvested during periodontal surgeries, after which, pol ymerase chain reaction (PCR) was used to determine the expression of BMP-2, Cbfa1 a nd Osterix; three genes involved in bone development. Here comparisons in gene e xpression were made between tissues from a noninflammatory site and the inflamma tory granulation tissue. In order to demonstrate a potential model of how these genes could be regulated/mo dulated under inflammatory conditions, an invitro stimulation assay using a human monocytic cell line (THP-1) along w ith a source of BMP2, Cbfa1 and Osterix; specifically an osteosar coma cell line (SoaS) was also performed. Our results here demonstrate the genes for BMP2, Cbfa1 and Osterix are expressed at similar

PAGE 10

10 levels in both granulation as well as healthy gingival tissues. Furt hermore, the in vitro stimulation assay was unable to demonstrate that under inflammation conditions these genes were modulated. Hypothesis: Granulation tissue is a beneficial component in peri odontal lesion healing due to the presence of both cells with osteoblastic potential as well as the molecules required for their osteoblastic differentiation.

PAGE 11

11 CHAPTER 2 BACKGROUND Healthy Periodontium Healthy periodontium consists of all the supporti ng structures of th e tooth, including the cementum, periodontal ligament (PDL), alveolar bone and gingiva. Cementum is found on the surface of tooth roots and serves as anchorage fo r the principal fibers of the PDL. PDL is specialized, non-mineralized connect ive tissue, which attaches the tooth to the alveolar bone. Additionally, the PDL contains cells including osteoblasts and osteoclasts, monocytes and macrophages, undifferentiated mesenchymal cells, cementoblasts, odontoclasts and fibroblasts. These cells are important for tissu e homeostasis and repair of th e periodontium. For example, it has been shown in animal models that the fibrob last population in the PDL remains at a constant state with the number of new fibr oblast cells produced by mitosis always equaling the number of cells that die or migrate.2,3 Fibers of the PDL course through an extracellular ground substance. This substance comprised of approximately 70% wa ter is thought to be im portant for distributing forces applied to the tooth.4 Opposite the tooth, the PDL fibers attach to an outer cortical la yer of bundle bone which forms the bony socket around the teeth. This bone as well as the central lamellar component of the bone form the alveolar process. Gingiva co vers the bony surface and consists of an outer junctional epithelium (JE) and an underlying connec tive tissue. JE consis ts of nondifferentiated, stratified squamous epithelial cells that attach to the tooth via a hemidesmosomal attachment. Monocytes are found within JE which secrete and -defensins, cathelicid in LL-37, interleukin (IL)-8, IL-1 and -1 tumor necrosis factor, intercellular adhesion molecule-1, and lymphocyte function antigen-3.4 These molecules in addition to the JEs structural integrity help to serve as the first line of defense to invading microorganisms and periodontal disease

PAGE 12

12 progression. In health, a small crevice, the gi ngival sulcus is formed adjacent to the tooth, extending from the crest of the gingiva to the JE attachment (Figure 2-1A). Periodontal Disease Periodontal disease, specifically chronic periodontitis, is an inflammatory disease which affects all of the tissues of the periodontium. It is initiated by oral bacteria that infect the gingival sulcus around the teeth. Proliferating b acteria can cause inflammation of the gingiva, gingivitis, which can subsequently lead to the destruction of the underlying connective tissue attachment, PDL, cementum and bone known as periodontitis. Clinically, the sulcus depth increases and the JE begins to migrate apica lly as the underlying connective tissue and bone are destroyed, forming a periodontal pocket (Figure 2-1B ). Chronic periodontitis is characterized as a continuous process with episodes of local exacerbation and remission.5 Progression of the disease can lead to continued loss of supporting structures and eventual tooth loss. This destructive process can vary greatly and is largely influenced by differing host responses.6 Bacteria associated with chr onic periodontitis vary significantly, but are often gram-negative, anaerobes. Some of the primary bacteria associated with periodontitis include Porphyromonas gingivalis, Prevotella intermedia, Bacteroides forsythus, Aggregatibac ter (Actinobacillus) actinomycetemcomitans and Treponema denticola.7 Almost one quarter of the United States is affected with at least a mild form of periodontitis and approximately 13% of adults over 30 years of age have a moderate or severe form of the disease.8 Periodontitis has both a subject and s ite predilection and does not affect all teeth similarly.9 For example, one study showed that 70 % of sites with advanced destruction occurred in just 12% of the population.10

PAGE 13

13 Periodontal Tissue Destruction In health, the JE forms a protective ba nd around the neck of the teeth along the cementoenamel junction. However, the JE can be compromised by periodontal microorganisms and their byproducts. Once the JE is breached, mi croorganisms can spread quickly and begin to damage the underlying connective tissue and PDL by destroying cellular and extracellular substances through the production of toxins including lipopolysaccharide.11 Subsequently, an inflammatory cascade is initiated by the host tissues which begin to produce inflammatory mediators including proteases, cytokines and pr ostaglandins to fight off the pathogens.12 The resultant inflammatory response is responsib le for damaging the connective tissue and can quickly spread into adjacent tissues.4 As the connective tissue and PDL are destroyed, the rapidly proliferating epithelial cells begin to migrate apically along th e root of the tooth, preventing complete healing of the pr e-existing connective tissue and PDL.4 As the inflammatory process progresses, it can extend from vessels in the gingival tissues into the alveolar bone.13 Subsequently, the bone is resorb ed by an increased amount of proinflammatory mediators including interleu kin 1 (IL-1) and tumor necrosis factor (TNF) and an increase in osteoclastic activity.4 Depending on the anatomy of the dentition and site specificity of the disease process the bone loss ma y occur horizontally, th at is parallel to the cementoenamel junction; vertically, along a vector of the long axis of the tooth or a combination of both.14 It has been shown that minimal th ickness of alveolar bone, vasculature and distance between tooth roots is associated with vertical bone loss.15 Predominately vertical bone loss creates the fo rmation of intrabony pockets adjacent to teeth, also known as intrabony or intraosseous defects (F igure 2-2). Clinically they are classified by the number of intact bony walls that are present.16 These voids created by the vertical loss of bone are simultaneously filled with newly formi ng granulation tissue. Granulation tissue is

PAGE 14

14 defined as tissue formed in ulcers and in early wound healing and repair, composed largely of newly growing capillaries. While granulation tissue is typically indicative of a repair process, the granulation tissue found chronic periodontitis if left untreated will not ever fully repair or create a new attachment to the tooth. Subsequent ly, if the bony defects ar e treated surgically, the granulation tissue is typically excised in toto (Figure 2-3).16 More recent evidence suggests however, that this highly vascularized tissue which contains various inflammatory cells, fibroblasts and stro mal cells may be of va lue in the healing of periodontal defects.1 Treatment of Chronic Periodontitis Aims for treating chronic periodontitis are to reduce inflammation and to create an improved environment for oral hygiene access in order to prevent or reduce disease reoccurrences. Clinically, treatment outcomes ar e often measured in pocket depth reduction and gain in clinical attachment of the soft tissu es to the root surface. There are two primary modalities for the treatm ent of chronic periodontitis; non-surgical and surgical. Non-surgical treatment includes scaling and root planing; a procedure in which hand, ultrasonic, rotating or laser instrumentation is used to cleanse the su rface of the teeth without intentional displacement of the gingival tissues. Scaling is defined as supra or subgingival debridement aimed at removing the bacterial plaque and their associat ed mineralized accretions, calculus, from the tooth surfaces. Root planing is the intentiona l removal of “diseased” cementum which has been exposed to cytotoxic byproducts from the periodont al bacteria. It has been shown however, that intentional aggressive instrumentation to rem ove all cementum is not necessary to achieve periodontal health.17 Scaling and root plani ng reduces the depth of the pockets and subsequently the bacterial reservoir by two mechanisms. Firs t, removal of the bacter ia decreases the amount of inflammation present, allowing the gingival tissues to reduce in size and constrict towards the

PAGE 15

15 base of the pocket, which is clinically m easured as recession of the gingival tissues. Additionally, the removal of accretions from th e root surfaces can promote a new connective tissue or long junctional epithelia l attachment to form on the root surface coronal to its existing level, clinically measured as a gain in tissue at tachment from the base of the pocket. The main limitation of non-surgical treatment is that is conducted without tissue reflection, therefore, visualization of the toot h surface is impaired and subsequent ly complete root surface cleaning can not be predictably achieved in even moderately, 5mm deep pockets.18 Surgical intervention is a second modality for treatment of chronic periodontitis. The objectives of surgical treatment are the similar to non-surgical treatment. However, with surgical intervention the soft tissue is re flected away from the tooth and bone for better visualization and access for tooth root instrumentation. Surgic al intervention can be accomplished by several different techniques. First, is resective treatment. Here, mucoperiosteal flap reflection allows access to the underlying bone, and the contours of the bone can be adjusted to further reduce periodontal pocketing.19 Additionally, any granulation tissu e present is removed, in a process known as degranulation. Reasons for degranulat ion are largely empirical, however, it can be noted that thorough removal of this tissue does undoubtedly provided bett er visualization and access to the tooth and bone surfaces and doe s decrease the amount of residual pocketing immediately following surgery by decreasi ng the total thickness of soft tissue. Another form of surgical treatment of periodontitis is known as guided tissue regeneration (GTR). Guided tissu e regeneration is similar to surgical resective treatment in that, a surgical flap is first el evated to expose the underly ing tooth and bone followed by degranulation and root instrumentation. Howe ver, in addition GTR u tilizes the placement of barrier membranes over the bony def ects. Barrier membranes helps to exclude the cells of the

PAGE 16

16 gingival connective tissue and epithelium and gi ves preference for repopulation by PDL cells in the area of the defects which may be able to regene rate all of the structur es lost in the disease process, including cementum, PDL, and bone.20 Despite evidence that suggests that regeneration of these structures may be possible, co mplete regeneration is not predictable.21 How PDL cells function in tissue regeneration is not well understood. Some studies support the concept that the PDL has progenitor cells capable of differentiating into bone form ing osteoblasts, while others suggest that the preexisting osteoblasts ar e responsible for wound repopulation and new bone formation.21, 22 More recent evidence suggests howeve r, that there may be another source of osteoblast for wound repair and bone regenera tion found within the granulation tissue.1 Our hypothesis is that cells found within the granul ation tissue are capable of bone formation and posses the gene expression pattern n ecessary for new bone development. Mesenchymal stem cells Mesenchymal stem cells (MSCs) are bone marrow derived, self-renewing multipotent progenitor cells that can be found throughout development.23 Mesenchymal stem cells can differentiate into va rious mesenchymal cell lineages including adipocytes, chondrocytes, hepatocytes, cardiomyocytes, neurons, as well as osteoblasts, the cells responsible for bone development.24 Stem cells have several key features. First, they must be able to undergo cell division. Additionally, they must be able to diffe rentiate into multiple cell types. Lastly, when transplanted into a foreign site, they must possess the ability to reform the cells specific to the transplant tissue. These stem cells have been isolated in various dent al tissues including the dental pulp and PDL.25, 26 More recent evidence suggests th at periodontal granulation tissue may also contain MSCs.1 In order for the MSCs to differentiate into osteoblasts, first an intermediary cell lineage between the mesenchymal stem cell and the osteoblast known as a pre-osteoblast or osteoprogenitor cell is expressed. Ultimately, given proper signaling and gene expression, the

PAGE 17

17 osteoprogenitor cells can differen tiate into the osteoblasts wh ich are necessary for new bone formation. If these stem cells are present in gran ulation tissue it is plausible that they may be able to regenerate the bone lost from periodontitis.27 Therefore, we hypothesize that the gene expression pattern necessary for osteoblast diffe rentiation and subsequent new bone formation can be found in periodontal granulation tissue. Genes involved in bone development can also be induced experimentally in-vitro, without the presence of the MSCs. For example, osteosarcoma cell lineages have been shown to express BMPs and are therefore cap able of inducing bone formation.28 Here we use these osteosarcoma cells in an experimental model of osteoblastic gene induction. Bone Development Bone is comprised mainly of hydroxyapatite and extracellular matrix proteins which include type I collagen, osteocalcin, oste onectin, osteopontin, bone sialoprotein and proteoglycans.29 It is produced by osteoblasts, speciali zed cells derived from mesenchymal stem cells. In order for osteoblast differentiation to occur, the mesenchymal cells must be influenced by several key regulatory factors (Figure 2-4). One such factor is bone morphogenic protein (BMP).30 Bone morphogenic protein was discovered in 1965, when it was found that the protein could ectopically induce bone forma tion if implanted into muscle.31 Currently, at least 15 different genes of BMPs have been identified.32 Bone morphogenic protein is the only known growth factor known capable of ectopic bone fo rmation. Signaling of BMP is initiated upon its binding to two distinct transmembrane receptors.32 Once BMP is bound, the expression of several other transcription fact ors are required for further differentiation into an osteoblast lineage. One such factor, core binding factor 1, Cbfa1, has been shown to be a primary transcriptional activator that cont rols the expression of the major structural proteins of the bone matrix.33 This became evident when it was demonstrated that Cbfa1 null mice did not produce

PAGE 18

18 any osteoblasts or bone.34 Core binding factor 1 has also been recognize d as a gene responsible for cleidocranial dysplasia an autosomaldominant disease with bone abnormalities.35 In addition, Osterix, a zinc finger-c ontaining transcription factor has also been shown as a necessary factor for bone development. Experime nts have shown that while Cbfa1was expressed in Osterix null mice, Osterix is not expressed in Cbfa1 null mice, thus confirming that Osterix is located downstream of Cbfa1.36

PAGE 19

19 A B Figure 2-1. Periodontium A) Healthy Periodontium A. Cementum, B. Periodontal Ligament, C. Alveolar Bone, D. Gingiva, E. Juncti onal Epithelium, F. Connective Tissue, G. Gingival Sulcus B) Chronic Periodontitis Apical migration of the j unctional epithelium occurs as bacterial inflammation destroys the unde rlying connective tiss ue attachment and bone. Consequently, the sulcus depth incr eases and a periodont al pocket (G*) is formed. Granulation tissue fills the void where the bone was lost.

PAGE 20

20 Figure 2-2. Radiographic detec tion of an intrabony defect. Intrabony defect pres ent on mesial of first molar.

PAGE 21

21 A B Figure 2-3. Surgical treatment of an intrabony defect. A) Before and B) after granulation tissue was removed.

PAGE 22

22 Figure 2-4. Factors regulating osteoblast differentiation fr om mesenchymal stem cells. Undifferentiated mesenchymal stem cells are influenced by unknown mechanisms to differentiate towards an osteoblast lineage. An intermediary osteoprogenitor cell is first formed, upon which BMP-2 binds. After successful binding of BMP-2 several transcription factors activate the immature osteoprogenitor cell to differentiate into a fully functioning osteoblast cap able of bone formation.

PAGE 23

23 CHAPTER 3 MATERIALS AND METHODS We conducted a prospective, observational study to determine if granulation tissue removed from intrabony periodonta l defects contains cells whic h express key genes necessary for differentiation of an osteopr ogenitor cell lineage cap able of producing bone Specifically, the quantification of the genes for BMP-2, Cbfa1 an d Osterix was performed via polymerase chain reaction (PCR). In addition, an in-vitro experiment was conducte d to determine if the expression of these genes could be modulated by a laboratory model of inflammation. Participant Population Seven patients were recruited from the University Of Florida College Of Dentistry, Department of Periodontology. All patients c onsented to the study following Institutional Review Board approval. Inclusion criteria were as follows: a diagnosis of severe periodontal disease, completion of prior scaling and root planning, an age range between 18-65 years old and the presence of at least one, 23 wall intraosseous periodontal def ect with a coronal apical bone depth of at least 4mm that required surgical tr eatment. Patients were excluded if they had a history of severe acute or chronic systemic di sease, uncontrolled or poorly controlled diabetes, were pregnant or lactating or were taking medications known to affect the gingiva. Prior to the surgery all enro lled patients received a comp rehensive oral and periodontal examination, oral hygiene instructions and scali ng and root planing. Su rgical intervention was performed as needed, after a clin ical re-evaluation, at least 6 weeks following the completion of scaling and root planing. Surgical Procedure Under local anesthesia by one examiner (RM), a standard surgical protocol for periodontal regenerative therapy was comp leted. Buccal and lingual full-thickness,

PAGE 24

24 mucoperiosteal flaps were elevated beyond the depth of the intraosse ous defect. Upon full reflection, granulation tissue was ex cised from within the osseous defect. Granulation tissue was sectioned and immediately placed in Trizol for later processing. In 4 subjects a small piece of “healthy”, control tissue was also excised from a clinically non-inflamed area. Control tissue included for example, tissue from within the seconda ry flap or distal wedge tissue. No attempt was made to harvest control tissue in sites that were not indicated to undergo surgery. This control tissue was also sectioned and placed in to formalin and Trizol. After complete degranulation of the defect, all te eth in the surgical site were s caled and root planed as needed with ultrasonic and hand instruments. Next the defects were filled with freeze dried, mineralized, bone allograft. At the surgeon’s discretion, resorbable membranes were placed over the bone graft as needed. Flaps were then repos itioned and sutured with tension free, primary closure. Post-operative instructions and antib iotics (1000 mg Amoxicillin at time of surgery, followed by 500 mg Amoxicillin q8h for 7 days) were administered. Patients were seen for regular follow-up approximately 2 weeks, 1 month and 3 months post-surgery. Plaque debridement and oral hygiene instructions were completed as needed at the follow up appointments. Tissue Preparation and Storage After the surgery equal portions of both heal thy tissue and granulati on tissue were placed in Trizol. After which, the specimens were frozen at -80oF until RNA harvesting could be performed. Ribonucleic Acid (RNA) Isolation Ribonucleic acid was isolated from each indivi dual tissue sample using a standardized Trizol protocol. 0.75mL of Trizol LS reagent was added for each 0.25 ml of thawed sample. The homogenized samples were incubated for 5 minut es at room temperature to permit complete

PAGE 25

25 dissociation of the nucleoprotein complex. 0.2ml of chloroform was added to each sample. Sample tubes were shaken vigorously by hand for 15 seconds and then incubated at room temperature for 15 minutes. Next, the samples were centrifuged at 12,000 X g for 10 minutes at 4C. Then, the aqueous phase was transferred to a clean tube. Five hundred microliters of isopropyl alcohol was added to each tube and gen tly mixed. Samples were then incubated at room temperature for one hour. Next, they were centrifuged at 12,000 X g for 10 minutes at 4. After which, the supernatant was decanted. Th en the samples were vortexed following the addition of 1ml of 75% ethanol. Tubes were then centrifuged at 7,500 X g for 5 minutes at 4C. The remaining pellet was dried for 10 minutes Then, 25ul of RNase/DNase free water was added and the samples were incubated for 20 mi nutes at 60C. Resulting RNA samples, were frozen at -20C until reverse transcription (RT) could be performed. Subsequently, the concentration of RNA for each sample was determ ined using a conventional spectrophotometer. Reverse Transcription (RT) Next cDNA was transcribed through reverse tr anscription of the RNA in the following manner. First, a master mix containing 5X buffer, 1mM DTTs, 2.5mM dNTPs, RT, and oligopeptides was prepared and aliquoted for each sample. Next, extracted and normalized concentrations of RNA from each sample were added to the tubes and the RT reaction was brought to a final volume of 25ul using RNase/DNase free water. All steps were performed on ice. After which, the RNA was reverse transc ribed in a conventional thermocycler under the following conditions: 40C for 40 minutes, 70C fo r 15 minutes and held at 4C. All cDNA was stored at 4C until PCR could be performed. Polymerase Chain Reaction (PCR) Polymerase chain reaction was used to amplify the genes of interest from the cDNA. To run the PCR, first a master mix was made containing 10X PCR buffer, 25mM MgCl,

PAGE 26

26 2.5mMdNTP mix, Taq and 20uM primers for the ge nes of interest. Primers used included: BMP-2, “CGTCAAGCCAAACAC AAACAG” (forward) and “GAGCCACAATCCAGTCATTCC” (reverse); Cbfa1, “CAGTCACCTCAGGCATGTCC” (forward) and “GAGATATGGAGTGCTG CTGGTG” (reverse); Osterix, “GGTACAAGGCAGGCATCCATG” (forwa rd) and “AGTGTCCCTTGCAGCCCATC” (reverse). Glyceraldehyde 3-phosphate dehydr ogenase (GAPDH), a housekeeping gene, was used as an internal control. Glyceral dehyde 3-phosphate dehydrogenase is constitutively expressed in all cells and therefore allows for normalization of the total DNA isolated from the PCR reactions. The primers for GAPDH we re, “ACCACAGTCCATGCCATCAC” (forward) and “TCCACCACCCTGTTGCTGTA” (reverse). Next the master mix was aliquoted for each cDNA sample along with RNase/DNase free water. All steps were performed on ice. After which, the genes of interest were amplified in a conventional thermocy cler under the following conditions: 95C for 4 minutes, 94C for 1 minute 55C for 45 sec for 30 cycles, at 72C for 2 minutes, 56C for 1 minute, and 72C for 5 minutes. All PCR products were stored at 4C for until further analysis could be performed. In addition to the study samples, the same PCR protocol was ran on two control samples known not to express the genes of interest, Human Immortalized Gingival Keratinoc ytes (HIGK) and Human Umb ilical Vein Endothelial Cells (HUVEC). Any positive result in the controls would be indicativ e of either DNA contamination or non-specificity of the primers desi gned for the experiment. Lastly, to visualize the amplified genes, elec trophoresis was run on a 2% agarose gel. This gel was then viewed on a BioRad ChemiD oc and densitometric analysis was performed using Quantity One (BioRad) software to semi-quantify the genes of interest.

PAGE 27

27 In Vitro Stimulation Assay The 1x105 human monocytic THP-1 cel ls were plated on a 24 well fibronectin spotted plate and allowed to adhere and differentiate for 24 hours. Non-a dherent cells were removed and the wells washed 3 times with 2mls of phosphate buffered saline (PBS). After which, in some wells, 1x105 osteosarcoma cells (SaoS2) were plated. THP-1 and SaoS2cells were maintained in RPMI1640, 10% FBS with .05mM 2-ME during the co-culture. After co-inc ubation of 24 hours, the cells were harvested and the RNA isolated. RT-PCR was performed and gene expression was quantified as descri bed above. In some wells, THP-1 cells and SaoS2 cells were incubated alone to serve as baseline gene expression controls (Fig 3-1).

PAGE 28

28 1 2 3 Figure 3-1. Experimental design of in-vitro stimulation assay. The 1x105 human monocytic THP-1 cells were plated on a 24 well fibronectin spotted pl ate and allowed to adhere and differentiate for 24 hours. Af ter which, in some wells, 1x105 osteosarcoma cells (SaoS2) were plated. After co-incubati on of 24 hours, the RNA was isolated, RTPCR was performed and gene expression was quantified. In some wells, THP-1 cells and SaoS2 cells were incubated alone to serve as baseline gene expression controls. 24 hou r

PAGE 29

29 CHAPTER 4 RESULTS 7 subjects participated in this study, from which 7 granulation tissue samples and 4 gingival tissue samples were coll ected. All of the tissue sample s were analyzed via PCR for the gene expression of BMP-2, Cbfa1 and Osterix. Th ese genes were used because all three have been previously shown to be key regulators n ecessary for osteoblast diffe rentiation and therefore bone formation. Expression of Bone Morphogeneti c Protein in Granulation Tissue Bone morphogenetic proteins (BMPs) are s ecreted signaling molecules which belong to the transforming growth factor-beta (TGF) superfamily of growth f actors. Bone morphogenic proteinss were originally identified by thei r ability to induce ectopic bone formation when implanted under the skin of rodents. This indi cated that these molecules could play important roles during bone formation. To date over 15 BMPs have been identified and their expression is widespread and dynamic as development in general proceeds. Therefore, BMPs can have a broad range of physiologic functions including the control of oste oblast differentiation. Several BMPs can induce osteoblast specifi c gene expression in vitro. As previously mentioned, periodontal dis ease results in bone lo ss. Subsequently, granulation tissue is formed in the resulting intrabony defect (Fig 2-3). Traditional periodontal treatment calls for the re moval of this tissue. Previous work done in our laborat ory suggests that this tissue may harbor bone regenerating potential.1 In order to support this hypothesis here, we evaluated the gene expression of BMP-2 in granul ation tissue to determine if this osteoblast inducing factor could be present. In addition, we compared this expression level to that of healthy tissue in order to elucidate if the reten tion of granulation tissue and thus BMP-2 activity would be beneficial in h ealing and bone remodeling of the periodontal lesion.

PAGE 30

30 Specifically, RT-PCR was performed on seven gr anulation tissue samples as well as four matching healthy tissues from the same patients. bmp-2 specific primers were used (Figure 4-1A) to determine gene expression along with GAPDH specific primers (Figure 4-1B) as a normalization control Finall y, as a negative control RT-PCR was also performed on primary endothelial (HUVEC) cells and keratinocytes (HIGK), cells k nown not to express the genes of interest (Figure 4-1C). Once the data was normalized for tota l cDNA content, densitometric analysis demonstrated there was no significan t difference in the expression levels of bmp-2 among the granulation tissues from our indivi dual participants (Figures 4-1D, 4-4). Interestingly, there was also no significan t difference in the expression levels of bmp-2 in the granulation tissue and gingival tissu e from the same participant. Therefore, while our results do determine that granulation tissu e does have the potential for BMP-2 activity and therefore the induction of osteoblastic differentiation, it also in sinuates that healthy gi ngival tissues contain the same properties and potential with regards to BMP-2. (Figures 4-1, 4-4) Additional studies need to be performed to corroborate this evidence. Expression of Cbfa1 in Granulation Tissue Core binding factor 1 is the first isolated osteoblastic-specific transcription factor. It is the earliest and most specific marker for oste ogenesis and is capable of inducing osteoblastspecific gene expression in various cell lines including fibroblasts as well as myoblasts.33, 37 Using immunohistochemistry, work in our laborat ory has shown Cbfa1 positive cells were also present in granulation tissue re trieved from periodontal defects.1 As a second step in the investigation of th is hypothesis we evaluated the gene expression of Cbfa1 in granulation tissue to confirm if this osteoblast-specific transcription factor was present, which would suggest the presence of osteoblastic cell populations. In addition, we compared the expression level of Cbfa1 to that of healthy tissue in orde r to elucidate if the

PAGE 31

31 retention of granulation tissue a nd osteoblastic cell populations w ould be beneficial in healing and bone remodeling of th e periodontal lesion. Again, RT-PCR was performed on seven granulation tissue samples as well as 4 matching healthy tissues from the same patients. Cbfa-1 specific primers were used (Figure 42A) to determine gene expression along with GAPDH specific primers (Figure 4-2B) as a normalization control. Finall y, as a negative control RT-PCR was also performed on primary endothelial (HUVEC) cells and keratinocytes (HIGK), known not to express the gene of interest (Figure 4-2C). The data was again normalized for total cDNA content and densitometric analysis demonstrated there was no significan t difference in the expression levels of cbfa1 among the granulation tissues from our indivi dual participants (Figures 4-2D, 4-4). Interestingly, there was also no significan t difference in the expression levels of cbfa1 in the granulation tissue and gingival tissu e from the same participant. Therefore, while our results do determine that granulation tissu e does have the potential for Cbfa1 activity and therefore the induction of osteoblastic differentiation, it also in sinuates that healthy gi ngival tissues contain the same properties and potential with regards to Cbfa1. (Figures 4-2, 4-4). Additional studies need to be performed to corroborate this evidence. Expression of Osterix in Granulation Tissue Experiments have shown that Osterix, a zinc fi nger-containing transcri ption factor is also required for osteoblast differentiation and bone development (36). Little is known about the mediators of Osterix with regard to osteoblast differentiation; however re search has shown that BMP-2 induces Osterix expression.38 As a final step in investigation of this hypothesis we evaluated the gene expression of Osterix in granulation tissue to determine if th is osteoblast-specific tran scription regulator could be present. This, similar to the presence of Cb fa-1 would suggest the presence of osteoblastic

PAGE 32

32 cell populations. In addition, we compared the expression level of Osterix to that of healthy tissue in order to elucidate if th e retention of granulat ion tissue and osteobla stic cell populations would be beneficial in h ealing and bone remodeling of the periodontal lesion. Again, RT-PCR was performed on seven granulation tissue samples as well as 4 matching healthy tissues from the same patients. Osterix specific primers were used (Figure 43A) to determine gene expression along with GAPDH specific primers (Figure 4-3B) as a normalization control. Finall y, as a negative control RT-PCR was also performed on primary endothelial (HUVEC) cells and keratinocytes (HIGK), known not to express the gene of interest (Figure 4-3C). The data was again normali zed for total cDNA content and densitometric analysis demonstrated there was no significan t difference in the expression levels of Osterix among the granulation tissues from our indivi dual participants (Figures 4-3D, 4-4). Interestingly, there was also no significan t difference in the expression levels of Osterix in the granulation tissue and gingival tissu e from the same participant. Therefore, while our results do determine that granulation tissue does have the potential for Os terix activity and therefore the induction of osteoblastic differentiation, it also in sinuates that healthy gi ngival tissues contain the same properties and potential with regards to Osterix. (Figures 4-3, 4-4). Additional studies need to be performed to corroborate this evidence. Comparison of Expression Patterns for BMP-2, Cbfa1 and Osterix Figure 4-4A illustrates a concurrent overlay of the expression of the BMP-2, Cbfa1 and Osterix. No discernable pattern of gene expres sion was noted between the genes or between the granulation tissue group and the gingival tissue group. However, it was noted that for all samples, expression of Cbfa1 was greater than the expression of Osterix. In figure 4-4B, the average gene expression of BMP-2, Cbfa1 and Osterix is compared between granulation and gingival tissues. On aver age, Cbfa-1 and Osterix are expressed more in

PAGE 33

33 granulation tissue than gingival ti ssue. Alternatively, a trend of increased expression of BMP-2 was noted in gingival tissue. In Vitro Induction of Oste oblast Associated Genes Our results from the previous gene expr ession analysis clearl y demonstrate that osteoprogenitor gene expression for BMP-2, Cbfa 1 and Osterix are found in both clinically inflamed granulation tissues as well as clinically healthy, non -inflamed gingival tissues. Subsequently, we sought to determine a plausible model to represent how, if at all, these genes could be modulated under the inflammatory conditi ons as would be seen in a chronic periodontal defect. To accomplish this, an in-vitro stimul ation assay was performed using a source of inflammatory cells, a human monocytic cell lin e (THP-1), along with a source bone producing cells, specifically an osteosarcoma cell line (SoaS). The osteosarcoma cells express BMP-2, Cbfa1 and Osterix, all of which are needed for bone development. In Vitro Induction of Bo ne Morphogenetic Protein We used bmp-2 specific primers to determine ge ne expression along with GAPDH specific primers as a normalization control (F igure 4-5A, D). For BMP-2, the presence of inflammatory mediators, monocytes, alone, showed the greatest gene expression. Interestingly, the addition of BMP-2 expressing osteosarcoma cel ls, to the monocytes di d not further increase the overall BMP-2 gene expression. Osteosarcoma cells alone, had a BMP-2 gene expression pattern similar to that of monocytes and osteosarcoma cells combined. In Vitro Induction of Cbfa1 Core binding factor 1 specific primers were used to determine gene expression along with GAPDH specific primers as a normalizatio n control (Figure 4-5B, D). For Cbfa1, the presence of inflammatory mediators, monocytes alone, showed the greatest gene expression. Interestingly, the addition of Cbfa1 expressing osteosarcoma cells, to the monocytes did not

PAGE 34

34 further increase the overall Cbfa1 gene expressi on. Osteosarcoma cells alone, had a Cbfa1 gene expression pattern similar to that of m onocytes and osteosarcoma cells combined. In Vitro Induction of Osterix Osterix specific primers were us ed to determine gene expression along with GAPDH specific primers as a normalization control (Fig ure 4-5C, D). For Os terix, the presence of inflammatory mediators, monocytes alone, showed the greatest gene expression. Interestingly, the addition of Osterix expressi ng osteosarcoma cells, to the m onocytes did not further increase the overall Osterix gene expressi on. Osteosarcoma cells alone, had an Osterix gene expression pattern similar to that of monocytes and osteosarcoma cells combined.

PAGE 35

35 A B C D Figure 4-1. Bone morphogenic proein-2 gene ex pression in periodontally diseased granulation tissue samples (D1-D7) and matched healthy, non-diseased, contro l, gingival tissue samples (C1, C4, C5, C6). A) Polymerase chain reaction product from amplification of cDNA using bmp2 specific primers. B) Polymera se chain reaction product from amplification of cDNA using GAPDH specific primers. C) Polymerase chain reaction product from amplification of bmp2 specific primers on HIGK and HUVEC controls. D) Densitometric analysis of (A) normalized to GAPDH amplification in (B).

PAGE 36

36 A B C D Figure 4-2. Core binding factor 1 gene expression in periodontal ly diseased granulation tissue samples (D1-D7) and matched healthy, nondiseased, control, gingival tissue samples (C1, C4, C5, C6). A) Polymerase chain reaction product from amplification of cDNA using cbfa1 specific primers. B) Polymera se chain reaction product from amplification of cDNA using GAPDH specific primers. C) Polymerase chain reaction product from amplification of cbfa1 specific primers on HIGK and HUVEC controls. D) Densitometric analysis of (A) normalized to GAPDH amplification in (B).

PAGE 37

37 A B C D Figure 4-3. Osterix gene expres sion in periodontally diseased granulation tissue samples (D1D7) and matched healthy, non-diseased, c ontrol, gingival tiss ue samples (C1, C4, C5, C6). A) Polymerase chain reaction product from amplification of cDNA using osterix specific primers. B) Polymerase chai n reaction product from amplification of cDNA using GAPDH specific primers. C) Polymera se chain reaction product from amplification of osterix specific prim ers on HIGK and HUVEC controls. D) Densitometric analysis of (A) normalized to GAPDH amplification in (B).

PAGE 38

38 A B Figure 4-4. Bone morphongeni c protein-2, Cbfa1 and Oste rix gene expression. A) Densitometric analysis for concomitant gene expression of BMP-2, Cbfa1 and Osterix in periodontally dis eased granulation tissue samples (D1-D7) and healthy, non-diseased, gingival tissues samples (C1, C4, C5, C6). B) Average gene expression of BMP-2, Cbfa1 and Osterix in periodontally diseased granulation tissue samples and healthy, non-diseas ed, gingival tissue samples.

PAGE 39

39 A B C Figure 4-5. Bone mo rphogenic protein-2 Cbfa1 and Osterix gene expression under bone inducing conditions of SoaS. A) Poly merase chain reaction products from amplification of cDNA using bmp-2 and GAPDH specific primers and accompanying densitometric analysis. B) Polymerase chain reaction products from amplification of cDNA using cbfa1 and GAPDH specific primers and accompanying densitometric analysis. C) Polymerase chai n reaction products from amplification of cDNA using osterix and GAPDH specific primers and accompanying densitometric analysis. (D) Comparison of BMP-2, Cbfa -1 and Osterix gene expression under coor monoculture conditions.

PAGE 40

40 D Figure 4-5. Continued

PAGE 41

41 CHAPTER 5 DISCUSSION Primarily, the objective of peri odontal regenerative therapy is to exclude ep ithelial cells from the areas where bone loss has occurred in an effort to selectively re -populate the defect with cells from the PDL, which are presumed to be necessary for new bone and new PDL attachment.20 More recent work has shown that other cells, incl uding those found in granulation tissue may also have the regenerative potential to induce new bone form ation by the expression of specific proteins a nd transcription factors.1 It was therefore the pur pose of this investigation to determine if granulation tissue is a benefici al component in periodonta l lesion healing due to the presence of both cells with os teoblastic potential as well as the molecules required for their osteoblastic differentiation. Genetic expression of the protein BMP-2 and the transcription factors Cbfa1 and Osterix are required for osteoprogenitor cells to diffe rentiate into fully functioning osteoblasts.33, 34, 37 Using PCR, gene expression for BMP-2, Cbfa1 a nd Osterix was determined in granulation and gingival tissue samples. All thr ee genes were expressed in all of the granulation tissue samples. Additionally, all three genes were also expressed in all gingi val tissue samples in levels comparable to that of the granulation tissue. Granulation tissue is associated with a healing response. Ho wever, in untreated chronic periodontal disease, the inflammatory insult is not resolved, and thus the granulation tissues present do not appear to have the ability to spon taneously heal. As such, periodontal granulation tissue may more appropriately be labeled a “granulomatous” tissue, as it is a tissue that shares many similarities with granulation tissue, but l acks the distinct ability to repair the damaged periodontium.

PAGE 42

42 While traditional surgical treatment of periodontal intrabony defects includes the meticulous removal of all granulomatous tissues, our research sought to determine if complete degranulation is necessary.1, 14 We have shown that this highly vascularized tissue may actually possess the genetic potential to re generate the bone lost to pe riodontal disease. If future treatment could be aimed at shifting the environm ent within the granulati on tissue to an optimal condition for osteoblast differentiati on, it is conceivable that this ti ssue may in fact be capable of this differentiation and subsequent new bone formation. Interestingly, our results found the presence of the three genes of in terest for osteoblast induction BMP-2, Cbfa1 and Osterix present in not only inflamed granulomatous tissue where bone was once present, but also in healthy, non-inf lamed gingival tissue samples. These results were supported in a recent study by Zhou et al., who demonstrated that gene expression profiles for BMPs, Cbfa1 and Osterix were similar in osteoblasts as well as gingival fibroblasts.39 Despite the presence of these osteogenic markers, the gingival fibroblasts lacked the ability to induce osteogenesis.39 This was also illustrated in earli er immunohistochemistry work, which examined only Cbfa1, but found that Cbfa1 positive staining cells were present in granulation tissues, but not gingival tissue samples.1 Therefore, it is evident th at even if osteoprogenitor and osteoblast expression profiles are present, their activation is dependent upon additional unknown factors which could include for example, ce ll surface receptors or environmental cues. One limitation of this study was that the sa mple size was small and subsequently any statistical analysis would have been of limited value. Also, while samples were taken either from granulation or gingival ti ssues there exists the inherent heterogeneity, not only between individuals, but between sample sites which may further confound any specific conclusions. Additionally, while great care was take to retrieve only granulation or ging ival tissue samples, it

PAGE 43

43 is impossible to rule out the possibility that the cells from the existing adjacent bone and or overlying periosteum were included in the tissue samples. Due to the sensitivity of the PCR amplification process any amount cDNA from bone or periosteum that was present in the samples may have had a significant impact on the overall gene expression patterns found within the granulation or gingival tissues. Our in vitro assay failed to show that the genes necessary for bone development would be up-regulated under inflammatory conditions. Our model, perhaps an overly simplistic one, may not have accurately reflected the “inflammat ory” state found in periodontal lesions. While, monocytes are undoubtedly found in periodontal lesi ons, their presence alone on a plate does not necessarily create an envir onment comparable to the larg ely anaerobic, bacteria laden periodontal defect environment which is affected by literally dozens of other chemokines, cytokines, regulatory molecules, etc., all of which were unaccounted for in this model. Furthermore, by using monocytes and osteosarco ma cells in combination, causality of the changes in gene expression can not be determin ed. That is, from our model it can not be determined if changes in gene expression in BM P-2, Cbfa1 and Osterix were related to changes in the expression pattern of the osteosarcoma cells or if the monocytes themselves, were induced into an osteoblastic lineage. Clearly, the process of osteoblast induction is a complex one, which while dependent on the presence of the three genes BMP-2, Cbfa1 and Osterix, is not ex clusive to all cells expressing them. Further studies should be aimed at the ex amination of other possible factors that may be ultimately responsible for the induction of osteobl asts. While our results do not offer clinical results suggesting that leaving gr anulation tissue in pe riodontal defects may be advantageous to defect healing, our results do offer a plausible expl anation of how this tissue may be of value in

PAGE 44

44 the future. Currently, further laboratory and cl inical research is needed to determine if granulation tissue should be removed during th e surgical treatment of periodontal defects.

PAGE 45

45 LIST OF REFERENCES 1. Davis D. Multipotent stem cells isolated from the granulation tissue of intrabony periodontal defects Masters Thesis 2007. Gainesvill e: University of Florida. 2. McCulloch C., Melcher A. Cell density and ce ll generation in the pe riodontal ligament of mice. American Journal of Anatomy 1983; 167: 43-58. 3. Schellens J, Everts V, Beersten W. Quan titative analysis of connective tissue resoption in the supra-alveolar region of the mouse incisor ligment. Journal of Periodontal Research 1982; 17: 407-422. 4. Nanci A, Bosshardt D. Structure of pe riodontal tissues in health and disease. Periodontology 2000 2006; 40: 11-28. 5. Socransky S, Haffajee A, Goodson J, Lindhe J. New concepts of de structive periodontal disease. Journal of Clinical Periodontology 1984; 11: 21-32. 6. Kinane D. Causation and pathoge nesis of periodontal disease. Periodontology 2000 2001; 25: 8-20. 7. Zambon JJ. Periodontal dis eases: microbial factors. Annals of periodontology/ The American Academy of Periodontology 1996; 1: 879-925. 8. Albandar J, Brunelle J, King man A. Destructive periodontal di sease in adults 30 years of age and older in the United States, 1988-1994. Journal of Periodontology 1999; 70: 1329. 9. Papapanou P, Wennstrom J, Grondahl K. Period ontal status in rela tion to age and tooth type. A cross-secti onal radiographic study. Journal of Clinical Periodontology 1988; 15: 469-478. 10. Lindhe J, Okamoto H, Yoneyama T, Haffajee A, Socransky S. Periodontal loser sites in untreated adult subjects. Journal of Clinical Periodontology 1989; 16: 671-678. 11. Darveau R, Tanner A, Page R. The microbial challeng e in periodontitis. Periodontology 2000 1997; 14: 12-32. 12. Kornman K, Page R, Tonetti M. The hos t response to the microbial challenge. Periodontology 2000 1997; 14: 33-53. 13. Weinmann J. Progression of gingival infl ammation in the supporting structures of the teeth. Journal of Periodontology 1941; 12: 71-82. 14. Prichard J. Advanced Periodontal Disease: Surgical and Prosthetic Management. 2ed. 1965; 265. 15. Tal H. Relationship between the interproxi mal distance of roots and the prevalence of intrabony pockets. Journal of Periodontology 1984; 55(1): 604-7.

PAGE 46

46 16. Goldman H, Cohen DW. The infrabony pocket: Classification and treatment Journal of Periodontology 1958; 29: 272-291. 17. Nyman S, Sarhed G, Ericsson I, Gottlow J, Karring T. Role of "diseased" root cementum in healing following treatment of periodontal disease. Journal of Periodontal Research 1986; 21: 496-503. 18. Waerhaug J. Healing of the dento-epithe lial junction followi ng subgingival plaque control. As observed on extracted teeth. Journal of Periodontology 1978; 49:119-134. 19. Schluger S. Osseous resectiona ba sic principle in periodontal surgery. Oral surgery, Oral medicine, Oral Pathology Oral Radiology, and Endodontics 1949; 2: 3-12. 20. Gottlow J, Nyman S, Lindhe J, Karring T, Wennstrm J. New attachment formation in the human periodontium by guided ti ssue regeneration. Case reports. Journal of Clinical Periodontology 1986; 13: 604-616. 21. Melcher A. On the repair potential of periodontal tissues. Journal of Periodontology 1976; 47(5): 255-260. 22. Laurell L, Gottlow J, Zybutz M, Persson R. Treatment of intrabony defects by different surgical properties. A literature review. Journal of Periodontology 1998; 69: 303-313. 23. Mackay-Sim A, Silburn P. Stem cells and gentic disease. Cell Proliferation 2008; 41: 8593. 24. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human mesenchymal stem cells. Science 1999: 284: 143-147. 25. Seo B, Miura M, Gronthos S. Investigation of multipotenet postnatal stem cells from human periodontal ligament. Lancet 2004: 364:149-155. 26. Shi S, Gronthos S. Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp. Journal of Bone and Mineral Research : The Official Journal of the American Society for Bone and Mineral Research 2003; 18: 696-704. 27. Marie P. Transcription factors controlling osteoblastogenesis. Archives of Biochemistry and Biophysics 2008; In press. 28. Hanamura H. Solubilization and purifica tion of bone morphogenic protein (BMP) from Dunn osteosarcoma. Clinical Orthopaedics and Relaedt Research 1980; 153: 232-240. 29. Young M, Kerr J, Ibaraki K. Heegard A, Robe y P. Struture expre ssion and regulation of the major noncollagenous matrix proteins of bone. Clinical Orthopedics 1992; 281: 275294. 30. Ryoo H, Lee M, Kim Y. Critical molecu lar switches involved in BMP-2induced osteogenic differentiation of mesenchymal cells. Gene 2006; 366: 51-57.

PAGE 47

47 31. Urist M. Bone:formation by sutoinduction. Science 1965; 150: 893-899. 32. Katagari T, Takahashi N. Regulatory m echanisms of osteoblast and osteoclast differentiation. Oral Diseases 2002; 8: 147-159. 33. Ducy P, Zhang R, Geoffrey V, Ridall A, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteobl ast differentiation. Cell 1997; 89: 647-654. 34. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T. Targeted disruption of Cbfa1 results in a co mplete lack of bone formation owing to maturational arrest of osteoblasts. Cell 1997; 89: 755-764. 35. Lee B, Thirunavukkarasu K, Zhou L, Pastore L, Baldini A, Hecht J, Geoffroy V, Ducy P, Karsenty G. Missense mutations abolis hing DNA binding of osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. Nature Genetics 1997; 16: 307-310. 36. Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, de Crombrugghe B. The novel zinc finger-contai ng transcription factor osteri x is required for osteoblast differentiation and bone formation. Cell 2002; 108(1):17-29. 37. Ducy P. The osteoblast: A sophisticat ed fibroblast under central surveillance. Science 2000; 289(5484): 1501-1504. 38. Celil A, Hollinger J, Campbell P. Osx transc riptional regulation is mediated by additional pathways to BMP2/Smad signaling. Journal of Cellular Biochemistry 2005; 95(3): 518528. 39. Zhou Y, Hutmacher D, Sae-Lim VZ. ( 2008). Osteogenic and Adipogenic Induction Potential of Human Periodontal Cells. Journal of Periodontology 2008; 79(3): 525-534.

PAGE 48

48 BIOGRAPHICAL SKETCH Dr. Ryan L. Mendro received his Bachelor of Science in F ood science and human nutrition at the University of Florida, where he graduated in the spring of 2001. He then attended dental school at Columbia University where he rece ived his Doctor of Dental Surgery degree in the summer 2005. Currently, Ryan Mendr o is completing his post doctoral residency in periodontics at the University of Florida. U pon graduation in the summer 2008, Ryan will begin practicing periodontics in Orlando, Florida.