Citation
Nitric Oxide Facilitates Nuclear Factor of Activated T-Cell (NFAT) Activity through AKT Induced Glycogen Synthase Kinase-3Beta (GSK-3Beta) Phosphorylation

Material Information

Title:
Nitric Oxide Facilitates Nuclear Factor of Activated T-Cell (NFAT) Activity through AKT Induced Glycogen Synthase Kinase-3Beta (GSK-3Beta) Phosphorylation
Creator:
Drenning, Jason
Place of Publication:
[Gainesville, Fla.]
Florida
Publisher:
University of Florida
Publication Date:
Language:
english
Physical Description:
1 online resource (73 p.)

Thesis/Dissertation Information

Degree:
Doctorate ( Ph.D.)
Degree Grantor:
University of Florida
Degree Disciplines:
Health and Human Performance
Applied Physiology and Kinesiology
Committee Chair:
Criswell, David S.
Committee Members:
Powers, Scott K.
Dodd, Stephen L.
Hall, Allyson Gail
Graduation Date:
8/9/2008

Subjects

Subjects / Keywords:
Calcium ( jstor )
Insulin ( jstor )
Messenger RNA ( jstor )
Muscle fibers ( jstor )
Muscles ( jstor )
Oxides ( jstor )
Phosphatases ( jstor )
Phosphorylation ( jstor )
Protein isoforms ( jstor )
Skeletal muscle ( jstor )
Applied Physiology and Kinesiology -- Dissertations, Academic -- UF
akt, fiber, gsk, nfat, nitric, skeletal
Genre:
bibliography ( marcgt )
theses ( marcgt )
government publication (state, provincial, terriorial, dependent) ( marcgt )
born-digital ( sobekcm )
Electronic Thesis or Dissertation
Health and Human Performance thesis, Ph.D.

Notes

Abstract:
Skeletal muscle is characterized by different fiber types including one slow (type 1/beta), and three fast (IIa, IIx, and IIb). These various phenotypes display contractile and biochemical properties responsive to altered physiological demand. Activity induced increases in intracellular calcium transients facilitate slow phenotypic adaptations via activation of calcineurin and its downstream target, nuclear factor of activated t-cells (NFAT). Nitric Oxide (NO) is an important signaling molecule in skeletal muscle and is produced enzymatically by nitric oxide synthases (NOS). Our lab has recently shown that NO facilitates NFAT activity through the NO-cGMP driven inactivation of glycogen synthase kinase-3beta (GSK-3beta) in C2C12 myotubes. While NOS activity seems to be necessary for the calcium induced effects on fiber type change in C2C12s, it is unknown whether NOS is necessary for changes in adult skeletal muscle. Further, the pathway by which NO-cGMP activity results in GSK-3beta phosphorylation has not been clearly elucidated. These experiments tested the central hypothesis that NO facilitates NFAT function by AKT-induced GSK-3beta phosphorylation both in the C2C12 cell line, and in a genetic model. We tested this postulate by addressing two integrated specific aims: 1) we determined that cultured myotubes and plantaris muscle from nNOS and eNOS knockout mice display altered NFAT function, and 2) we determined that AKT-induced GSK-3beta phosphorylation explains a mechanism by which the NO-cGMP pathway affects NFAT in C2C12 myotubes. We investigated the role of NOS activity in NFAT function by ex vivo and in vitro methods using both an animal model and a myogenic cell line. Type II diabetes mellitus (DM2) is a growing disease population and is becoming increasingly costly due to associated health care costs. DM2 is characterized by insulin resistance and impaired glucose clearance which has been linked to reduced expression of slow-oxidative muscle fibers. Skeletal muscle is responsible for most insulin-mediated glucose oxidation as muscle contractile activity augments glucose clearance by improving insulin sensitivity. Slow, type I/beta muscle fibers, in particular, are characterized as insulin sensitive due to a proclivity for being metabolically active. Therefore, understanding the mechanism(s) that contribute to the activity-induced changes in muscle phenotype is important. Our proposed experiments can provide insight into potential therapeutic interventions for DM2 patients. ( en )
General Note:
In the series University of Florida Digital Collections.
General Note:
Includes vita.
Bibliography:
Includes bibliographical references.
Source of Description:
Description based on online resource; title from PDF title page.
Source of Description:
This bibliographic record is available under the Creative Commons CC0 public domain dedication. The University of Florida Libraries, as creator of this bibliographic record, has waived all rights to it worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law.
Thesis:
Thesis (Ph.D.)--University of Florida, 2008.
Local:
Adviser: Criswell, David S.
Statement of Responsibility:
by Jason Drenning.

Record Information

Source Institution:
UFRGP
Rights Management:
Copyright Drenning, Jason. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Classification:
LD1780 2008 ( lcc )

Downloads

This item has the following downloads:


Full Text





slow genes, particularly MHC I/P (Meissner et al 2007). Further, our recent data confirm the

role of NO in NFAT function as NOS activity has been shown to be necessary for NFAT

translocation and transcription (Drenning et al 2008).

Problem Statement

A better understanding of how habitual physical activity can lead to changes in skeletal

muscle gene expression has expanded our knowledge of the benefits of exercise. However,

additional research is needed to provide a more comprehensive understanding of how chronic

exercise improves fitness and decreases the risk of diabetes. In addition, more studies aimed at

exploring the calcium-regulated signaling pathways and their molecular targets are needed.

Work by numerous authors confirms that the transcription factor, NFAT is integral to

calcium/calcineurin-induced fiber type changes in skeletal muscle. Given the importance of NO

as an important signaling molecule capable of mediating NFAT in C2C12 myotubes, we propose

that NO is essential to NFAT function ex vivo and in vivo as well. We postulate that removal of

the NOS isoform in mice will result in altered NFAT nuclear translocation and fiber type

aberration. NO could exert its effects on NFAT by activating AKT in a cGMP/PI3K dependent

manner, thereby allowing NFAT nuclear accumulation due to AKT induced GSK-30

phosphorylation (inactivation). Discovery of the mechanisms) that regulate exercise-related

fiber type changes could lead to therapies with broad clinical application.

Variables in Study

Independent variables: Genetic manipulation of NOS expression will be achieved by

purchasing homozygous mice harboring a targeted mutation of either the nNOS or eNOS gene.

Knockout of the nNOS or eNOS protein, respectively, was confirmed in skeletal muscles of

these mice compared to control mice from the parent strain. Cultured myotubes will be exposed









of different muscles is largely influenced by the pattern of nerve activity induced by the motor

neuron (Williams & Kraus, 2005). This is important in exercise-related research since different

patterns of nerve activity can result in changes in muscle fiber type. The "tonic" pattern of

contractions associated with endurance exercise has been shown to be helpful in reducing the

risk of a number of diseases associated with inactivity, including diabetes (Shiaffino, 2007).

Fiber Type Switching

A number of studies have described fiber type switching based on the frequency of

electrical stimulation. High frequency stimulation results in a shift in the direction:

I--IIa--IId/x--IIb (Shiaffino, 2007) and is similarly induced by inactivity. Fast to slow

transformations (IIb--IIx-IIIa--I) occur by tonic low-frequency stimulation characteristic of the

pattern induced by slow motoneurons (Pette, 2001; Kraus et al. 1994).

Ausoni et al. (1990) has shown that there are limitations to these transformations in rat

skeletal muscle. Particularly, they observed that fast fibers have the ability to shift from

IIbI--Ix--TIIa. Slow fibers also seem to be limited as the same researchers saw adaptability in

the range of I--IIa--IIx.

Conflicting data with regard to the range of myofiber plasticity were published by

Caiozzo et al. (1998). This group found that changes in the thyroid state may extend the range of

fiber type changes. They showed that MHC lib can be enhanced in type I fibers by multiple

factors. Specifically, both the effect of hyperthyroidism and inactivity resulted in a shift from

type I to type lib MHC. Earlier data published by Kirshbaum et al. (1990) confirms the

possibility of an expanded range with regard to IIb--I fiber type changes. These researchers

found that hypothyroidism in conjuction with chronic low frequency stimulation resulted in a

shift from type lib to type I fibers.









Oberbach A, Bossenz Y, Lehmann S, Niebauer J, Adams V, Paschke R, Schon MR, Bluher M &
Punkt K (2006). Altered fiber distribution and fiber-specific glycolytic and oxidative enzyme
activity in skeletal muscle of patients with type 2 diabetes. Diabetes Care 29, 895-900.

Parsons SA, Wilkins BJ, Bueno OF & Molkentin JD (2003). Altered skeletal muscle phenotypes
in calcineurin Aalpha and Abeta gene-targeted mice. Mol CellBiol 23, 4331-4343.

Pette D (2001). Cellular and molecular diversities of mammalian skeletal muscle fibers. JAppl
Physiol 90, 1119-1124.

Pette D & Vrbova G (1999). What odes chronic electrical stimulation teach us about muscle
plasticity? Muscle Nerve 22, 666-667.
Rao KM, Wentworth BM, Rosenthal N & Vill-Komarolf L (1997). Transcription factors of the
NFAT family: regulation and function. Annu Rev Immunol 15, 707-747.

Reid MB (1998). Role of nitric oxide in skeletal muscle: synthesis, distribution and functional
importance. Acta Physiol Scand 162, 401-409.

Reiser PJ, Kline WO & Vaghy PL (1997). Induction of neuronal type nitric oxide synthase in
skeletal muscle by chronic electrical stimulation in vivo. JAppl Physiol 82, 1250-1255.

Roberts CK, Barnard RJ, Scheck SH & Balon TW (1997). Exercise-stimulated glucose transport
in skeletal muscle is nitric oxide dependent. Am JPhysiol 273, E220-E225.

Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stiff TN, Yancopoulos GD & Glass
DJ (2001). Mediation of IGF-1-induced skeletal myotube hypertrophy by PI3K/AKT/mTOR
and PI3K/AKT/GSK3 pathways. Nat Cell Biol 3, 1009-1113.

Roy D, Perreault M & Marette A (1998). Insulin stimulation of glucose uptake in skeletal
muscles and adipose tissues in vivo is NO dependent. Am JPhysiolEndocrinolMetab 274,
E692-E699.

Ryder JW, Bassel-Duby R, Olson EN & Zierath JR (2001). Skeletal muscle reprogramming by
activation of calcineurin improves insulin action on metabolic pathways. JBiol Chem 278,
44298-44304.

Schiaffino S, Sandri M & Murgia M (2007). Activity dependent signaling pathways controlling
muscle diversity and plasticity. Physiology 22, 269-278.

Schultz RA & Yutzey KE (2004). Calcineurin signaling and NFAT activation in cardiovascular
and skeletal muscle development. Genes Dev 12, 2499-2509.
Sellman JE, DeRuisseau KC, Betters JL, Lira VA, Soltow QA, Selsby JT & Criswell DS (2006).
In vivo inhibition of nitric oxide synthase impairs up regulation of contractile protein mRNA
in overloaded plantaris muscle. JApplPhysiol 100, 258-265.









Fiber Type Characteristics

Type I fibers are also known as slow oxidative fibers and contain large numbers of

oxidative enzymes and are enveloped by more capillaries than type II fibers. This phenotype

also contains higher concentrations of myoglobin than fast fibers. All of these characteristics

allow for type I fibers to have a large capacity for aerobic metabolism and a high resistance to

fatigue (Williams & Kraus, 2005). Further, these types of cells have been shown to be insulin

sensitive which contributes to the interest in understanding the mechanisms) underlying the

therapeutic effectiveness of endurance exercise in mediating DM2 (Shiaffino et al. 2007).

Type 2 fibers, or fast glycolytic fibers have a smaller number of mitochondria, limited

capacity for aerobic metabolism and are less fatigue resistant than type I fibers. In contrast to

slow oxidative fibers, fast glycolytic fibers are less metabolically active and more insulin

resistant (Pette, 2001). However, it should be noted that type IIa fibers can be viewed as an

intermediate between type I and type IIb fibers. Chronic exercise or tonic neural stimulation

induces an increase in the oxidative capacity of IIa fibers to the extent that their oxidative

capacity reaches levels close to that of type I fibers. Type IIb and type IId/x fibers are less

efficient than the other fibers most likely due to high ATPase activity leading to greater energy

expenditure per unit of work performed (Liu et al. 2005).

Nerve Activity

Skeletal muscle is a plastic tissue in the sense that it undergoes phenotypic changes based

on the stress under which it is placed. Nerve activity has been shown by both nerve cross union

and electrical stimulation studies to be able to induce fiber-type switching (Williams & Kraus,

2005). Phasic, high-frequency electrical stimulation causes a shift from slow oxidative fibers to

a fast, glycolytic fiber. Motor neurons innervate skeletal myofibers and determine the timing,

intensity, and duration of each myofibrillar contraction (Shiaffino, 2007). The fiber-type profile



















= nNOS WT
- nNOS-4-


PAPA-NO
1gM


B



= eNOS WT
m eNOS-/-


I.11


PAPA-NO
1pM


Figure 4-2. MHC I/P mRNA expression in NOS-- mice. (A) Quantitative RT-real time PCR
analysis of MHC I/P mRNA in total RNA isolated from nNOS- and WT mouse
myotubes (24h treatment). (B) Quantitative RT-real time PCR analysis of MHC I/P
mRNA in total RNA isolated from eNOS-- and WT mouse myotubes (24h treatment).
Values represent mean + SEM. = significant difference from nNOS WT control
and eNOS WT control respectively


2
o 1.5.
Sio
4J


Control


A23187
0.4 gM


A23187
0.4 pM


2
0

o 1.5.
0
. 1.0-
2 o
is
EZ


Control
Control













C N C N C N


eNOS-/-


eNOSWT


uo.roil Mr o.10 rm'm-ivw
0.4 pM 1RM


Control


A23187
0.4 pM


> NFATcl






I p -actin
histone







D


= eNOS WT
- eNOS --


PAPA-NO
1iM


Figure 4-3 Continued.









LIST OF FIGURES


Figure page

4-1 Representative immunoblots for nNOS and eNOS ...................................... ... ......42

4-2 Myosin Heavy Chain I/0 mRNA as quantified by RT-PCR........................................ 43

4-3 Representative immunoblots of NFAT nuclear/cytoplasmic ratio.................................44

4-4 Representative immunoblots of GSK-30 from nNOS-/-, eNOS-/- and WT mouse
myotubes.................... ........................................46

4-5 Representative immunoblots of AKT from nNOS-/-, eNOS-/- and WT mouse
myotubes.................... ........................................48

4-6 Representative image of fiber type analysis by immunohistochemical staining ..............50

4-7 Representative immunoblots of GSK-30 from plantaris homogenate..............................51

4-8 Representative immunoblots of AKT from plantaris homogenate......................... 52

4-9 Representative immunoblots from SNAP dose response experiment ............................53

4-10 Representative immunoblots showing NO induced AKT phsophorylation is cGMP
d ep en d e n t ...................................... ..................................................... 5 4

4-11 Representative immunoblots showing NO induced AKT phsophorylation is
cG M P /P I3K dependent ..................................................................... ....... ....................55

4-12 Nitric Oxide is capable of inhibiting protein phosphatase activity...............................56





















nNOS WT


nNOS -I


eNOS WT eNOS -t-


Figure 4-6. Immunohistochemical measurement of fiber type. (A) Representative cross section
of nNOS-'- mouse plantaris muscle compared to WT. (B) Representative cross
section of eNOS-'- mouse plantaris muscle compared to WT.









CHAPTER 3
MATERIALS AND METHODS

Experimental Designs

This project was designed to answer the following questions with the accompanying

experimental designs:

Question 1. Do mice with nNOS and eNOS genetically silenced have altered NFAT function?

Experiment 1. Cultured myotubes from wild-type (WT), nNOS and eNOS knockout mice were

treated for as follows: 1) Control (DMSO), 2) A23187 (0.4AM), or 3) PAPA-NO (1LM). MHC

I/P mRNA (24h treatment), NFAT nuclear accumulation (4h treatment), NFAT translocation,

AKT phosphorylation (lh treatment) and GSK-30 phosphorylation (lh treatment) were

measured.

Table 3-1. Experiment 1.
Animals Control A23187 (0.4pM) PAPA-NO (1 [M)
WT n=4 n=4 n=4
nNOS KO n=4 n=4 n=4
WT n=4 n=4 n=4
eNOS KO n=4 n=4 n=4
(n=number of cultures for each treatment)

Experiment 2. Western blots for AKT and GSK-30 phosphorylation were run using muscle

homogenate from the plantaris muscle of each animal. Also, the plantaris was used for

immunohistochemical staining for detecting fiber type differences.

Table 3-2. Experiment 2.
Animals Number of animals
WT n=3
nNOS KO n=3
WT n=3
eNOS KO n=3
(n=number of muscles from each group)









loss of function and rescue experiments demonstrate that NO is an important signal for calcium-

induced nuclear translocation of NFAT. However, the effect of A23187 may be time sensitive.

Further, calcium-dependent activation of NOS does not fully account for slow gene induction.

Neuronal NOS and eNOS Are Necessary for NFAT Activity in Vivo

To ensure that the effects of NO on NFAT function are not limited to in vitro measures, we

sought to determine whether NOS-'- mice display aberrant NFAT activity in vivo. Our in vivo

data confirms that both nNOS and eNOS are necessary for normal expression of Type I fibers as

well as, GSK-3p and AKT phosphorylation in the plantaris muscle of WT and NOS-'- mice

(Table 4-1 and Figures 4-6 to 4-8). As has been mentioned, the role of both isoforms as they

pertain to NO-related signaling in skeletal muscle was unexpected. Interestingly, although other

authors have suggested that basal NOS activity is involved in fiber type establishment (Stamler

& Meissner, 2001), no one has reported fiber type differences in nNOS- mice compared to WT

mice. Also, no previous studies have reported fiber type differences in eNOS-'- mice. Hirschfield

et al. (2000) report that soleus and diaphragm muscles from 6-8 week-old eNOS knockout mice

exhibit essentially normal contractile characteristics. This suggests that fiber type distribution

may be normal at this age. However, several potentially important differences exist between our

study and that of Hirschfield et al. For instance, we studied plantaris muscle of 3-4 week-old

mice from a different transgenic strain (Jackson Labortory). We propose that either nNOS or

eNOS ablation delays the development of slow-twitch fibers by interfering with NFAT signaling.

However, this may not prevent the attainment of normal fiber type distribution as the animal

reaches adulthood. Further study will be required to examine this possibility.

Low Levels of NO Induce Phosphorylation of AKT

In response to varying levels of NO, AKT phosphorylation was shown to be concentration

dependent (Figure 4-9). These data confirm previous work from Bollegue et al. (2007)









al. 2006). IGF-1 binding to its receptor leads to the activation of its downstream target, PI3K,

which facilitates the recruitment of AKT (Bodine et al. 2006). Recently, the necessity of NOS

activity on IGF-1 receptor induced PI3K/AKT activation has been studied (Chung et al. 2004).

While this research group showed the possibility of NO activating IGF-1 receptor expression and

subsequent PI3K/AKT activity in neurons, this pathway has not been explored in skeletal

muscle.

Another possible explanation for the effect of NO on AKT could be the role NO may play

in inhibiting protein phosphatase activity. Mdx mice, which are known to have aberrant nNOS

expression, exhibit high protein phosphatase-1 (PP1) and GSK-33 activity (Villa-Moruzzi et al.

1996). Tokui et al. 1996) has demonstrated that protein phosphatase inhibitor-1 (PPI-1) is a

potent inhibitor of PP 1 when phosphorylated by cGMP dependent kinase. Additionally, Ugi et

al. (2004) has recently shown that protein phosphatase 2A (PP2A) is capable of inhibiting AKT.

These findings all suggest that the NO-cGMP pathway may be affecting AKT by decreasing the

activity of certain protein phosphatases, thereby removing their inhibitory effect on AKT.

Summary

The continued expansion of the type II diabetes mellitus (DM2) epidemic can be greatly

aided by researching exercise-related changes in skeletal muscle glucose tolerance and insulin

sensitivity. By understanding the mechanisms behind why exercise is therapeutically successful

in terms of DM2, intervention strategies can be better implemented. In the regard, preliminary

work in our laboratory has demonstrated that the signaling molecule NO is integral to the

molecular adaptations experienced during exercise induced nerve activity in skeletal muscle

(Sellman et al. 2006; Lira et al. 2007; Drenning et al. 2008). Since NO can facilitate NFAT

function, determining the mechanisms by which this occurs is important. Similarly, exploring

this model in vivo is integral to potential therapeutic strategies aimed at alleviating DM2.









muscle signaling molecule to be studied will be discussed. Subsequently, the contribution of NO

to the control of the calcineurin/NFAT pathway will be examined in detail.

Introduction to NO

NO is modulated biosynthetically by the family of enzymes known as NO synthases

(NOS) which are homodimers. The generation of NO by these enzymes requires L-arginine,

nicotamide adenine dinucleotide phosphate (NADPH) and oxygen, as well as, five other

cofactors flavinn adenine nucleotide, flavin mononucleotide, tetrahydrobiopterin, heme, and

calmodulin) (Reid, 1998).

There are three known isoforms expressed by skeletal muscle including, nNOS, eNOS and

iNOS. The particular isoform of nNOS in skeletal muscle is tissue specific, and is an

alternatively spliced isoform sometimes referred to as nNOSt. This isoform is targeted by the

dystrophin-associated protein, al-synrophin, and thus is located in the sarcolemma (Kaminski &

Andrade, 2001). eNOS is also present at low levels in all skeletal muscle fibers, co-localizing

with mitochondrial markers (Kaminski & Andrade, 2001). The activity of nNOS and eNOS is

closely related to intracellular calcium levels and calmodulin binding. iNOS also displays a

sarcolemmal localization and its activity varies in skeletal muscle depending on disease state and

species investigated (Reid, 1998). Increases in cytokines often provide the stimulus for iNOS

upregulation, and thus iNOS typically exerts an antimicrobial action (Reid, 1998)

Nitric Oxide and Skeletal Muscle

NO has been found through numerous studies to be an important signaling molecule in

muscle (Reid, 1998, Stamler & Meissner, 2001; Sugita et al. 2005; Nisoli et al. 2004).

Endogenous production of NO via calcium-calmodulin-dependent NOS may play a role in

skeletal muscle phenotypic plasticity. Also, stimulation of soluble guanylate cyclase (sGC) and

the resultant accumulation of cGMP mediates many of the signaling functions of NO and









to various pharmacological agents in the treatment medium (supplementing with A23187, L-

NAME, PAPA-NO, SNAP, ODQ, YC-1 and LY29004).

Dependent variables: We will measure NFAT nuclear accumulation and translocation,

GSK-30 phosphorylation, AKT phosphorylation, MHC I/P mRNA, protein phosphatase activity

and muscle fiber type.

Control variables: Only male C57 mice will be studied, so gender is purposely excluded

from this study.

Extraneous variables: We will not control prior activity level or food and water intake of

the mice. However, this should not affect chronic satellite cell/myotube cultures or the stable

phenotype of the plantaris muscle.

Specific Aims and Hypotheses

* Question 1: Do mice with targeted mutation of nNOS and eNOS have altered NFAT
function in primary cultured myotubes and aberrant fiber type phenotype in the plantaris
muscle?

* Hypothesis 1: nNOS and/or eNOS knockout mice display altered NFAT function compared
to wild type (WT) mice. In addition, AKT and GSK-30 phosphorylation is reduced, MHC
I/P mRNA activity is lessened, and fiber type expression is aberrant in NOS knockout mice.

* Question 2: Does the NO-cGMP pathway inhibit GSK-30 by activating the PI3K/AKT
pathway?

* Hypothesis 2: Low levels of NO induce phosphorylation of AKT, which inhibits GSK-30 in
a cGMP/PI3K-dependent manner.

* Question 3: Does NO have the capacity to inhibit protein phosphatases?

* Hypothesis 3: The NO-cGMP pathway inhibits protein phophatase activity subsequently
leading to AKT activation.









Chem icals and Reagents ................ .................. ............... ............. .......... 32
C e ll C u ltu re ................................. .........................................3 3
Ribonucleic Acid Expression by RT-PCR ........................................ ......................... 34
W western B lottin g ....................... .................. ................................ 3 5
Statistical A nalysis................................................... 36

4 R E SU L T S ..................... ................................................................. 37

Nuclear Factor of Activated T-Cell Activity Is Attenuated in Cultured Myotubes from
N O S-- M ice .................... ........ .... .... ....... ..... .. ....... ....................................37
Nitric Oxide Synthase-- Mice Display Aberrant NFAT Function in Vivo ........................38
Effect of NO on AKT Is Dose Dependent.............................................. 38
Nitric Oxide -cGMP Pathway Phosphorylates AKT ............. ..... ........ .... ........ 38
Nitric Oxide -cGMP Induced AKT Phosphorylation Is PI-3K-Dependent...................... 39
Nitric Oxide Inhibits Protein Phosphatase Activity ................. ................... ..... ........... .39

5 D ISCU SSION ..................................................................................................... 57

Main Findings ....... ................. .. .. .... .....................57
Neuronal NOS and eNOS Are Necessary for NFAT Function ex Vivo ................................58
Nuclear Factor of Activated T-Cell Activity Can be Rescued With Pharmacological
M manipulation in N O S-/- M ice ............................. ....... ................... 59
Low Levels of NO Induce Phosphorylation of AKT ....................... .. ...............60
Nitric Oxide-induced AKT Activity Is cGMP Dependent ............................................... 62
The NO-cGMP Pathway Activates the PI-3K/AKT Pathway......... ...............................62
Nitric Oxide Inhibits Protein Phosphatase Activity.....................................................63
Lim stations and Future D directions ........................................................... ...............64
C o n c lu sio n s ............................................................................................................................. 6 5
Conclusions..........wP............... ...............65

L IST O F R EFE R E N C E S ...................................................................................................66

B IO G R A PH IC A L SK E T C H .......................................................................... .. .......................73









Assumptions: It is assumed that the specific NOS isoform deleted in each of the

respective knockout mice is not expressed. Previous experiments have confirmed that nNOS and

eNOS knockout mice do not express the genetically removed NOS isoform.

Significance of the Study

Type 2 diabetes mellitus is modulated therapeutically by regular exercise as muscle cells

undergo phenotypic changes resulting in insulin sensitive, metabolically active skeletal muscle.

Inactivity results in a shift toward an insulin resistant, metabolically inactive phenotype. Thus,

there is a need for individuals susceptible to DM2 to remain active throughout life.

This research will improve our knowledge of the mechanisms underlying the changes in

skeletal muscle phenotype with chronic exercise. We seek to better understand the signaling

pathways responsible for these phenotypic changes, and to explore the role of Nitric Oxide in

skeletal muscle plasticity. This study will provide insight into clinical therapies designed to

improve skeletal muscle metabolic activity and provide potential solutions for DM2 mediation.













WT KO WT KO WT KO


4 GSK-3p

I4- phospho-GSK


Control A23187 PAPA-NO
0.4 iM 1M


"3
4>
2 2.


-o
Oh..
||1.



- 0.

O
Q .
0
0.- 0.


Control


A23187
0.4 [M


C nNOS WT
1 nNOS 4-


PAPA-NO
1pM


Figure 4-4. Protein expression of phospho/total GSK-33. (A) Representative immunoblot of
GSK-3p from nNOS- and WT mouse myotubes treated for lh. (B) Quantification of
GSK-3p3 immunoblots normalized to nNOS WT control. (C) Representative
immunoblot of GSK-3p from eNOS- and WT mouse myotubes treated for lh. (D)
Quantification of GSK-3p immunoblots normalized to eNOS WT control. Values
represent mean + SEM. = significant difference from nNOS WT control and eNOS
WT control respectively.


~LI"









demonstrating that low levels of NO activate, and high levels of NO inhibit AKT in vascular

smooth muscle cells. Our study provides evidence ofNOS-dependent AKT phosphorylation in

C2C 12 myotubes. Further, these data indicate a possible mechanism for the effect of NO on

GSK-30, as AKT is capable of phosphorylating GSK-30 (Ser-9).

Our data from the knockout mice imply that NOS isoform specificity may not play a role

in NO/cGMP induced activation of the AKT. Previous work has established that both

constituitive isoforms ofNOS (nNOS and eNOS) sythesize NO at a low rate, resulting in

nanomolar levels. Similarly, treatment with 1M and 10tM of SNAP respectively, resulted in

an increase in phosphor-total-AKT ratio. We did not measure NO concentration in the culture

media during NO-donor treatments. However, based on SNAP concentration, the half-life of NO

in solution, and the half-life of NO release from SNAP, we estimate that 1-10 [tM SNAP

produces steady-state NO concentrations in the nM range. In addition, low levels of NO

production by constituitive NOS appears to be a calcium-dependent process (Reid, 1998), which

is consistent with our findings of NOS involvement in calcium-dependent effects. Although we

did not quantify which NOS isoform is responsible for the our previous data regarding NFAT in

C2C12s, the effect of the calcium ionophore, A23187, on NFAT function in our previous work is

in accordance with both nNOS and eNOS regulating physiological levels of NO downstream of

calcium. iNOS activity in skeletal muscle is observed in response to an inflammatory challenge,

and produces NO at micromolar levels. It seems likely that the treatment groups with high

concentrations of SNAP (500[tM and ImM) could have caused S-nitrosylation-induced events

similar to effects observed with iNOS induction, subsequently leading to a decrease in phosphor-

total-AKT ratio.









inhibitors and 1% v/v phosphatase inhibitors from Sigma. For RNA, cells were harvested in

Trizol Reagent (Life Tech, Carlsbad, CA) according to manufacturer's instructions.

Ribonucleic Acid Expression by RT-PCR

Concentration and purity of the extracted RNA were measured spectrophotometrically at

A260 and A280 in 1X TE buffer (Promega, Madison, WI). Reverse transcription (RT) was

performed using the SuperScript III First-Strand Synthesis System for reverse transcription-

polymerase chain reaction (RT-PCR) according to the manufacturer's instructions (Life

Technologies, Carlsbad, CA). Reactions were carried out using 5[tg of total RNA and 2.5taM

oligo(dT)20 primers. First strand cDNA was treated with two units of RNase H and stored at -

800 C. Primers and probes for MHC I/P (GenBank NM_012751,lm Assay # Rn00562597_ml)

were obtained from the ABI Assays-on-Demand service and consist of Taqman 5' labeled FAM

reporters and 3' nonfluorescent quenchers. Primer and probe sequences from this service are

proprietary and therefore, are not reported. Primer and probe sequences also consisting of

Taqman 5' labeled FAM reporters and 3' nonfluorescent quenchers for hypoxanthine guanine

phosphoribosyl transferase (HPRT) were obtained from Applied Biosystems (Assays-by-Design)

and are: Forward, 5'-GTTGGATACAGGCCAGACTTTGT-3'; Reverse, 5'-

AGTCAAGGGCATATCCAACAACAA -3'; Probe, 5'-ACTTGTCTGGAATTTCA-3'.

Quantitative real-time PCR was performed using the ABI Prism 7700 Sequence Detection

System (ABI, Foster City, CA). Each 25[l PCR reaction will contain 1 01 of cDNA reaction

mixture. In this technique, amplification of the fluorescently labeled probe sequence located

between the PCR primers was monitored in real-time during the PCR program. The number of

PCR cycles required to reach a pre-determined threshold of fluorescence (CT) was determined

for each sample. Samples were quantified relative to the CT (using the 2 -AACT method, where









are unsure of the difference in NO production in the nNOS-- and eNOS-- mice. Future studies

should seek to understand better the details of the amount of NO needed to enhance NFAT

function.

Lastly, we did not do any in vivo measurement in muscles other than the plantaris muscle.

Since the plantaris is predominantly a type II muscle, we are unsure as to the levels of GSK-30

and AKT phosphorylation in other fiber types in NOS-- mice. Also, our fiber type data is limited

to the plantaris muscle, thus the fiber type differences observed may not be present in other

muscles.

Conclusions

Although the present study does not provide evidence for the specific NOS isoform

responsible for enhanced NFAT activity, we do demonstrate that NO is necessary for NFAT

function ex vivo and in vivo. Based on our data, both nNOS and eNOS may work together to

produce an optimal amount of NO to exert its downstream molecular signaling effects. We

conclude that the NO-cGMP pathway activates the PI3K/AKT pathway through protein

phosphatase inhibition, and leads to GSK-30 phosphorylation, thus facilitating NFAT activity

and leading to slow gene induction.










Table 4-1. Plantaris fiber type morphology for nNOS WT, nNOS -/-, eNOS WT, and eNOS -/-
mice as measured by percentage.
animals % type I % type IIa % type IIb/x % non-contractile tissue
nNOS WT 111.1 301.4 402.3 191.1
nNOS -/- 5+0.9* 32+2.0 421.3 211.3
eNOS WT 131.4 292.2 360.8 222.1
eNOS -/- 61.9# 31+2.1 431.4 200.8
Values represent mean SEM. *Significantly different from nNOS WT. #Significantly different
from eNOS WT.

















WT KO WT KO WT KO


AKT

|1 phospho-AKT


Control A23187 PAPA-NO
OA pM 1iM


A23187
0.4 piM


= eNOS WT

1 eNOS 4-


PAPA-NO
1gM


Figure 4-5 Continued.


Control









Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

NITRIC OXIDE FACILITATES NUCLEAR FACTOR OF ACTIVATED T-CELL (NFAT)
ACTIVITY THROUGH AKT INDUCED GLYCOGEN SYNTHASE KINASE-3BETA
(GSK-3Beta) PHOSPHORYLATION

By

Jason A. Drenning

August 2008

Chair: David Criswell
Major: Health and Human Performance

Skeletal muscle is characterized by different fiber types including one slow (type 1/0),

and three fast (IIa, IIx, and IIb). These various phenotypes display contractile and biochemical

properties responsive to altered physiological demand. Activity induced increases in

intracellular calcium transients facilitate slow phenotypic adaptations via activation of

calcineurin and its downstream target, nuclear factor of activated t-cells (NFAT). Nitric Oxide

(NO) is an important signaling molecule in skeletal muscle and is produced enzymatically by

nitric oxide synthases (NOS). Our lab has recently shown that NO facilitates NFAT activity

through the NO-cGMP driven inactivation of glycogen synthase kinase-30 (GSK-30) in C2C12

myotubes.

While NOS activity seems to be necessary for the calcium induced effects on fiber type

change in C2C12s, it is unknown whether NOS is necessary for changes in adult skeletal muscle.

Further, the pathway by which NO-cGMP activity results in GSK-30 phosphorylation has not

been clearly elucidated. These experiments tested the central hypothesis that NO facilitates

NFAT function by AKT-induced GSK-33 phosphorylation both in the C2C12 cell line, and in a

genetic model. We tested this postulate by addressing two integrated specific aims: 1) we









The protein kinase GSK-3p was originally discovered as a suppressor of glycogen synthase

(Embi et al. 1980). GSK-3p has been shown to be involved in various metabolic and signaling

pathways (Frame & Cohen, 2001). Recently, GSK-3p has been implicated as a negative regulator

of both cardiac and skeletal muscle hypertrophy (Haq et al. 2000; Rommel et al. 2001) as well as

muscle differentiation (van der Velden et al. 2007).

Regulation of NFAT in skeletal muscle seems to be dependent on GSK-3p activation as

Chin et al. (1998) demonstrated that phosphorylation of GSK-3p resulted in greater NFAT

nuclear translocation. Other research groups have shown that active GSK-3p masks the nuclear

localization signal, resulting in NFAT nuclear effusion and a subsequent decrease in gene

transcription (Beals et al. 1997; Neal & Clipstone, 2001).

Overexpression of GSK-3p in avian skeletal muscle promotes nuclear export of NFAT

while inhibition of GSK-30 augments NFAT transactivating potential and enhances MHC I/P

expression (Jiang et al. 2006). We have shown that an NO donor induces inhibitory

phosphorylation of GSK-3p (Drenning et al. 2008). Further, our lab has demonstrated that

inhibition of GSK-3p by lithium chloride (LiC1) causes nuclear accumulation of NFATcl and

stimulates NFAT dependent transcription (Drenning et al. 2008). Additionally, these

experiments have shown that the effects of LiCl on NFAT are not attenuated by the NO inhibitor

L-NAME, suggesting that GSK-3p inhibition occurs downstream of NOS activity. However, the

kinase involved in NO-dependent GSK-3p phosphorylation is unknown. Therefore, this study

will focus, in part, on the pathway responsible for NO mediated GSK-3p phophorylation as

discussed in the following section.

Nitric Oxide

This section will detail the role nitric oxide (NO) may play in affecting the

calcineurin/NFAT pathway. First, the basis for the selection of NO as an important skeletal









determined that cultured myotubes and plantaris muscle from nNOS and eNOS knockout mice

display altered NFAT function, and 2) we determined that AKT-induced GSK-30

phosphorylation explains a mechanism by which the NO-cGMP pathway affects NFAT in

C2C 12 myotubes. We investigated the role of NOS activity in NFAT function by ex vivo and in

vitro methods using both an animal model and a myogenic cell line.

Type II diabetes mellitus (DM2) is a growing disease population and is becoming

increasingly costly due to associated health care costs. DM2 is characterized by insulin

resistance and impaired glucose clearance which has been linked to reduced expression of slow-

oxidative muscle fibers. Skeletal muscle is responsible for most insulin-mediated glucose

oxidation as muscle contractile activity augments glucose clearance by improving insulin

sensitivity. Slow, type I/ P muscle fibers, in particular, are characterized as insulin sensitive due

to a proclivity for being metabolically active. Therefore, understanding the mechanisms) that

contribute to the activity-induced changes in muscle phenotype is important. Our proposed

experiments can provide insight into potential therapeutic interventions for DM2 patients.









Neuronal NOS and eNOS Are Necessary for NFAT Function ex Vivo

Our first aim was directed at confirming the validity of our previously published data

concerning NO and NFAT activity (Drenning et al. 2008). Also, we sought to determine which

constituitive NOS isoform is responsible for the effects of NO on NFAT in skeletal muscle.

Unexpectedly, we found that both nNOS-'- and eNOS-'- mice display attenuated NFAT function

compared to WT control mice in cultured myotubes. Experiments directed at measuring MHC

1/P mRNA, NFAT nuclear accumulation, GSK-30 phosphorylation and AKT phosphorylation

(Figures 4-2 to 4-5) all displayed similar results suggesting that nNOS and eNOS are necessary

collectively for NO-dependent NFAT activity.

Other studies have looked specifically at the effect of chronic exercise and nerve activity

on nNOS and eNOS protein expression (Roberts et al. 1997; Balon & Nadler, 1997; Tidball et

al. 2000). Both nNOS and eNOS are activated by interaction with calcium and calmodulin

(Stamler & Meissner, 2001) and each have been shown to be increased with prolonged treadmill

running in rats (Balon & Nadler, 1997; Tidball et al. 1998). However, most studies aimed at

determining which NOS isoform is most responsive to nerve activity, and subsequent calcium

transient influx, have concluded that nNOS is more dominant than eNOS in affecting the

molecular signaling pathways associated with NO in skeletal muscle (Reiser et al. 1997; Roberts

et al.; Reid et al. 1998; Stamler & Meissner, 2001). Interestingly, our data shows that both

nNOS and eNOS are necessary for calcium-induced NFAT function. NO biosynthesis in skeletal

muscle could be dependent on collaboration of the calcium-calmodulin dependent NOS isoforms

(nNOS and eNOS) in generating an optimal amount of NO to induce the effects on NFAT

function observed in these experiments. However, this is the first study to imply that both

nNOS and eNOS play a major role in skeletal muscle plasticity; our findings may be due to a

number of factors: 1) The eNOS isoform, while constituitive in skeletal muscle, has been









CHAPTER 4
RESULTS

Nuclear Factor of Activated T-Cell Activity Is Attenuated in Cultured Myotubes from
NOS-'- Mice

Immunoblots confirmed that nNOS and eNOS protein was undetectable in plantaris muscle

of nNOS-'- and eNOS-- mice, respectively (Figure 4-1). We found evidence of reduced NFAT

function in cultured myotubes from both nNOS- and eNOS-- mice. Specifically, baseline (i.e. in

untreated control cultures) MHC 1/P mRNA (Figure 4-2), NFAT nuclear accumulation (Figure 4-

3), GSK-30 phosphorylation (Figure 4-4), and AKT phosphorylation (Figure 4-5) were all

significantly lower in both transgenic models compared to WT mice. This was unexpected as we

anticipated either nNOS-/- or eNOS-/- mice to display attenuated NFAT activity, but not both.

Measurement of MHC I/P mRNA via RT-PCR showed that 24h treatment with the calcium

ionophore, A23187 (0.4O M) rescued the blunted NFAT effect in the NOS-- mice (Figure 4-2).

However, A23187 did not enhance abrogated AKT or GSK-30 phosphorylation after lh of

treatment (Figures 4-4 and 4-5) or NFAT nuclear accumulation after 4h of treatment (Figure 4-3)

in either nNOS- or eNOS-/- mice. Further, cultured myotubes from WT mice showed

responsiveness to A23187. Treatment with the NO donor, PAPA-NO (1 iM), resulted in

significant changes in MHC I/P mRNA, NFAT nuclear accumulation, GSK-30 phosphorylation,

and AKT phosphorylation in both groups of WT mice, as well as, in both nNOS-/- and eNOS-/

mice, as anticipated. Our findings suggest that both nNOS and eNOS are necessary for NFAT

activity, and may collaborate to produce physiologically significant levels of NO. However, the

blunted effects from loss of either isoform can be rescued by extended exposure (24h) of

myotubes to A23187, and by treatment with PAPA-NO (lh, 4h, and 24h).














WT KO WT KO WT KO


SGSK-3p

I phospho-GSK


0.4 IM IgM


A23187
0.4 pM


= eNOS WT
B eNOS i-


PAPA-NO
1pM


Figure 4-4 Continued.


e 2.0-







S0.5-
nn-
2L 2n


Control
Control









NITRIC OXIDE FACILITATES NUCLEAR FACTOR OF ACTIVATED T-CELL (NFAT)
ACTIVITY THROUGH AKT INDUCED GLYCOGEN SYNTHASE KINASE-3BETA
(GSK-3Beta) PHOSPHORYLATION




















By

JASON A. DRENNING


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2008














WT KO WT KO


.*- GSK-3p


4 phospho-GSK


nNOS eNOS


I 1.00-
Co

E 0.75-


- 0.50-


S 0.25-


0.00M
nNOS


= WT

1 -I-


T-


eNOS


Figure 4-8. Plantaris homogenate protein expression of phospho/total AKT. (A) Representative
immunoblot of AKT from nNOS- and eNOS compared to respective WT control.
(B) Quantification of immunoblots for AKT from nNOS-- and eNOS-- compared to
WT control mice. Values represent mean + SEM. = significantly different than
respective WT control.


1


I 1 1









ACKNOWLEDGMENTS

This work was completed with the help and encouragement of many. Much appreciation is

extended to Dr. David Criswell, my supervisory committee chair. I gained valuable knowledge

during my years working with him as he guided me through the completion of this degree.

I thank my committee members (Drs. Scott Powers and Steve Dodd from Applied

Physiology and Kinesiology, and Dr. Allyson Hall from Public Health and Health Professions).

Each has contributed uniquely to my progress at the University of Florida, and to this project

especially.

Fellow members of the Molecular Physiology Lab deserve special credit as they have

endured me over the past several years. Without their selflessness in helping me, I would not

have made it.

Finally, and most importantly I want to thank those closest to me. In particular, my family

and my wife's family have been supportive in ways beyond what I could have asked. My wife,

Tiffany, and daughter, Alexandra, deserve never to have to go through this process again.














WT KO WT KO


- pGSK-3p


4- phospho-GSK


nNOS eNOS


S1.00-
o
0

4u 0.75-


0.50-


" 0.25-

0.2
0.00-


nNOS


Wr
- -/-


eNOS


Figure 4-7. Plantaris homogenate protein expression of phospho-/total GSK-3p. (A)
Representative immunoblot of GSK-3p from nNOS- and eNOS-- compared to
respective WT mice. (B) Quantification of immunoblots for GSK-30 from nNOS--
and eNOS- compared to WT control mice. Values represent mean + SEM. =
significantly different than respective WT control.


,k









trafficking (Stitt et al. 2004). Many of these functions relate to the ability of class I PI 3-kinases

to activate AKT. PI-3K is also a key component of the insulin signaling pathway. Hence, there

is great interest in the role of PI 3-kinase signaling in DM2. AKT is activated as a result of PI3-

kinase activity as AKT requires the formation of the PtdIns, P3 (or "PIP3") molecule in order to

be translocated to the cell membrane (Stitt et al. 2004). At PIP3, AKT is then phosphorylated by

another kinase called phosphoinositide dependent kinase 1 (PDK1), and is thereby activated. The

PI-3K/AKT signaling pathway has been shown to be required for an extremely diverse array of

cellular activities. Our data is novel in that this is the first study to show that the NO/cGMP

pathway can activate the PI-3K/AKT pathway.

We hypothesized that PI-3K is necessary for the effect of the NO/cGMP pathway on AKT

phosphorylation. Our data confirm that NO activates AKT via a cGMP/PI-3K dependent

pathway (Figure 4-11). The drug, LY294002 was used as it has been shown to be a potent

inhibitor of the PI-3K/AKT pathway. Consistent with data from the previous experiment,

PAPA-NO induced an increase in phospho-total-AKT ratio. Myotubes treated with PAPA-NO

and LY294002 demonstrated that PI-3K is necessary for NO induced AKT phosphorylation.

These data provide a further understanding of our previous data, but it remains unclear how the

NO-cGMP pathway activates the PI-3K pathway.

Nitric Oxide Inhibits Protein Phosphatase Activity

Although these data have provided insight into the mechanisms) behind the role NO plays

in mediating NFAT function, some questions remain. Particularly, the mechanism of activation

of the PI-3K/AKT pathway by the NO/cGMP pathway is unclear. In skeletal muscle, the PI-

3K/AKT pathway is induced in numerous ways. Some typical enhancers of this pathway

include hormones such as insulin-like growth factor (IGF-1) and insulin (Bodine et al. 2006;

Kimball et al. 2002). IGF-1 binding to its receptor leads to the activation of PI-3K which









Nitric Oxide Synthase--' Mice Display Aberrant NFAT Function in Vivo

Immunohistochemical staining of serial cross-sections of the plantaris muscle for specific

fiber types revealed that both nNOS-'- and eNOS-1- had significantly less Type I myofibers per

cross sectional area (.im2) (Table 4-1 and Figure 4-6). Also, plantaris homogenate from all four

groups was used for western blotting to observe potential deficits in GSK-30 (Figure 4-7) and

AKT phosphorylation (Figure 4-8). Indeed, we did see deficits in NOS-- mice compared to WT

controls. Our findings suggest that both NOS isoforms found constitutively in skeletal muscle

contribute to enhancing NFAT activity and are necessary for normal fiber type distributions.

Effect of NO on AKT Is Dose Dependent

C2C12 myotubes treated with varying concentrations of the NO donor, SNAP (1 rIM,

10M, 100lM, 500M, and ImM) for Ih showed that low levels of NO (1KM and 10M) cause

phosphorylation (activation) of AKT (Figure 4-9). Conversely, high, S-nitrosylation-inducing

levels of NO (500MM and ImM) result in less phosphorylation of AKT. These results are in

agreement with previously reported data by Boullegue et al. (2007) showing a similar dose-

dependent effect of NO in vascular smooth muscle.

Nitric Oxide -cGMP Pathway Phosphorylates AKT

Our lab has shown that NO is capable of inducing phosphorylation of GSK-30 in a cGMP

dependent manner. In addition, our preliminary data indicate that AKT is necessary for NO-

cGMP-induced GSK-30 phosphorylation (unpublished data). Therefore, we sought to determine

if the NO-cGMP pathway is responsible for the NO-induced AKT phosphorylation shown in

experiment 3. Treatment of C2C12 myotubes with the NO donor, PAPA-NO, increased the ratio

of phopho-/total-AKT by 2 fold (Figure 4-10). Co-treatment with the guanylate cyclase

inhibitor, ODQ, completely prevented this effect. YC-1, which activates soluble guanylate









Gonzalez-Bosc LV, Wilkerson MK, Bradley KN, Eckman DM, Hill-Eubanks DC & Nelson MT
(2004). Intraluminal pressure is a stimulus for NFATc3 nuclear accumulation. JBiol Chem
279, 10702-10709.

Haq S, Choukroun G, Kang ZB, Ranu H, Matsui T, Rosenzweig A, Molkentin JD, Alessandrini
A, Woodgett J, Hajjar R, Michael A & Force T (2000). Glycogen synthase kinase-3beta is a
negative regulator of cardiomyocyte hypertrophy. JCellBiol 151, 117-130.

Horsley V, Friday BB, Matteson S, Kegley KM, Gephart J & Pavlath GK (2001). Regulation of
the growth of multinucleated muscle cells by an NFATC2-dependent pathway. J CellBiol
153, 329-338.

Hirschfield W, Moody MR, O'Brien WE, Gregg AT, Bryan RM Jr & Reid MB (2000). Nitric
oxide release and contractile properties of skeletal muscles from mice deficient in type III
NOS. Am JPhysiol Regulatory Integrative Comp Physiol 278, R95-R100.

Ivy JL & Holloszy JO (1981). Persistent increase in glucose uptake by rat skeletal muscle
following exercise. Am JPhysiol 241, C200-C203.

Jensen J, Brennesvik EO, Lai YC & Shepherd P (2007). GSK-30 regulation in skeletal muscles
by adrenaline and insulin: Evidence that PKA and PKB regulate different pools of GSK-33.
Cellular Signalling 19, 204-210.

Jiang H, Li H & DiMario JX (2006). Control of slow myosin heavy chain 2 gene expression by
glycogen synthase kinase activity in skeletal muscle fibers. Cell Tissue Res 323, 489-494.

Kaminski HJ & Andrade FH (2001). Nitric oxide: Biologic effects on muscle and role in
muscle diseases. Neuromuscular Disorders 11, 517-524.

Katz LD, Glickman MG, Rapoport S, Ferrannini E & DeFronzo RA (1983). Splanchnic and
peripheral disposal of oral glucose in man. Diabetes 32, 675-679.

Kegley KM, Gephart J, Warren GL & Pavlath GK (2001). Altered primary myogenesis in
NFATC3-/- mice leads to decreased muscle size in the adult. Dev Biol 232, 115-126.

Kelly LK, Wedgwood S, Steinhom RH & Black SM (2004). Nitric oxide decreases endothelin-1
secretion through the activation of soluble guanylate cyclase. Am JPhysiol Lung CellMol
Physiol 86, 984-91.

Kimball SR, Farrell PA & Jefferson LS (2002). Invited review: role of insulin in translational
control of protein synthesis in skeletal muscle by amino acids or exercise. JApplPhysiol 93,
1168-1180.

Kirshbaum BJ, Kucher HB, Termin A, Kelly AM & Pette D (1990). Antagonistic effects of
chronic low frequency stimulation and thyroid hormone on myosin expression in rat fast-
twitch muscle. JBiol Chem 265, 13974-13980.









Fiber type changes seem to be influenced by the duration of stimulation as evidenced by

looking at long term (2-4 mo) low frequency stimulation. Termin et al. (1989) stimulated fast

twitch muscles in rats for 2 mo and did not observe a significant increase in MHC I expression.

However, Windisch et al (1998) performed a similar experiment, stimulating fast twitch muscles

in rats for 4 mo and saw a fast to slow transformation. Further, type I fibers tend to disappear

after long periods of inactivity.

Expanding our understanding of how skeletal muscle responds to repeated bouts of activity

can help in the prevention of diabetes and other chronic diseases. Particularly, a greater

knowledge of the molecular signaling pathways which serve as the mechanisms for the

aforementioned plastic nature of muscle could lead to important biotechnological advances,

potentially providing an alternative to physical activity. The molecular events pertinent to this

study will be discussed below.

Nuclear Factor of Activated T-Cells and Skeletal Muscle

Nuclear factor of activated T-cells (NFAT) is a general name applied to a family of

transcription factors shown to be expressed in a number of cells in the body. The NFAT

transcription factor family consists of five members: NFATc1, NFATc2, NFATc3, and

NFATc4. All the NFAT isoforms are regulated by calcium signaling and stimulated by the

protein phosphatase calcineurin (Rao et al. 1997).

Activation of Calcineurin/NFAT Pathway

Calcium signaling pathways dependent on nerve activity play a major role in the

maintenance and modulation of muscle fiber-type (Crabtree, 1999; Naya et al. 2000; Pette &

Vroba, 1999). These molecular pathways have been studied extensively. Our laboratory has

examined specifically the calcineurin/NFAT pathway.










TABLE OF CONTENTS

page

A CK N O W LED G M EN T S ................................................................. ........... ............. .....

LIST OF TABLES ...................... ......... .................................... 7

LIST OF FIGURES .................................. .. ..... ..... ................. .8

A B S T R A C T ......... ....................... .................. .......................... ................ .. 9

CHAPTER

1 IN TRODU CTION ......................................................... ................. ......... 11

B ack g rou n d ................... ...................1...................2..........
Problem Statement ................................................................ ..... ..... ........ 13
V a riab le s in S tu d y ............................................................................................................. 1 3
Specific Aims and Hypotheses ................................. .......................... .........14
L ist o f T e rm s ..................................................................................................................... 1 5
Limitations/Delimitations/Assumptions ................................. ................................... 16
S ig n ifican ce of th e Stu dy ................................................................. ...............................17

2 L IT E R A T U R E R E V IE W ................................................................ ...............................18

Overview of Skeletal M uscle Fiber Type ............................................................. .....18
Fiber Type Characteristics.................................. 19
N e rv e A ctiv ity ........................................................................................................... 1 9
Fiber Type Switching ................................................... 20
Nuclear Factor of Activated T-Cells and Skeletal Muscle ..............................................21
Activation of Calcineurin/NFAT Pathway .......................... .......... .... ...........21
Nuclear Factor of Activated T-Cell Signaling..... ............ ......... .. ................... 22
Nuclear Factor of Activated T-Cell Interaction with Other Transcription Factors.........24
R ole of G SK -30 in N FA T Function ...................................................................... ..... 24
N itric O x id e .............................................................2 5
Introduction to N O ..............................................................26
Nitric Oxide and Skeletal Muscle.............................. ...............26
Role of Nitric Oxide and AKT .......... .............................27
S u m m ary ................... ...................2...................8..........

3 M A TER IA L S A N D M ETH O D S ..................................................................................... 29

Experim mental D designs .................................................................................................. .......29
A nim als.............................. .. ................................ ......... 31
Protocol for Experim ents 1 and 2 ................................................................................... 31
T ran sent T ran section s .................................................................................................32
Im m unohistochem istry ...............................................................................................32









CT is threshold cycle) (20) for a normalizing gene (HPRT) determined separately in the same

sample.

Western Blotting

Protein concentrations were measured using the DC Protein Assay Kit (Bio-Rad

Laboratories, Richmond, CA). Aliquots of cell lysates (8-15[tg) were run in 4-20%, and 12%

SDS-PAGE gels for phospho-AKT (p-AKT), total AKT (AKT), phospho-GSK-30 (p-GSK-3p),

total GSK-30 (GSK), NFATcl, P-actin and histone. Nuclear extracts (11 lg) were run in 12%

SDS-PAGE gels for NFAT blots. Protein was transferred to nitrocellulose membrane and

blocked with Odyssey blocking buffer for 1 hour. The primary antibodies used were: p-

AKT1/2/3 (Ser-473): sc-7985-R (rabbit), 1:1000 dilution, AKT1/2 (N-19): sc-1619 (goat), 1:500

dilution, (Santa Cruz Biotechnology, Santa Cruz, CA) p-GSK-3p (Ser-9): sc-11757 (goat),

1:1000 dilution, GSK-30 (H-76): sc-9166 (rabbit), 1:1000 dilution, (Santa Cruz Biotechnology,

Santa Cruz, CA), NFAT cl (F-l) sc-8405 (mouse), 1:500 dilution, (Santa Cruz Biotechnology,

Santa Cruz, CA), p-actin (mouse), 1:4000 dilution, (Abcam, Cambridge, MA) and anti-histone

H2B, (rabbit), 1:5000 dilution (Upstate, Lake Placid, NY). The membranes were incubated at

4C overnight in primary antibody diluted with Odyssey blocking buffer (LI-COR Biosciences,

Lincoln NE), TBS and 0.01% Tween-20, then washed with TBS-T four times and incubated for

35 minutes in secondary antibody, Odyssey blocking buffer and TBS-T. Secondary antibodies

used were: IRDye 800CW rabbit anti-goat, (LI-COR, 1:5000); IRDye 680 mouse anti-rabbit (LI-

COR, 1:2500); IRDye 680 rabbit anti-mouse, (LI-COR, 1:5000). Membranes were washed four

times with TBS-T and once with TBS before being scanned and detected using the Odyssey

infrared imaging system (LI-COR).











C N C N C N


nNOS-/-

nNOSWT w


Control A23187 PAPA-NO
0.4 pM IlM


Control


A23187
OA RM


>: FMATcl



1 p-actin
4 histone





B


C= nNOSWT
_. nNOS 4-


PAPA-NO
1pM


Figure 4-3. Protein expression of NFAT nuclear/cytoplasmic ratio. (A) Representative
immunoblot of nuclear/cytoplasmic NFAT from nNOS-- and WT mouse myotubes
treated for 4h. (B) Quantification of immunoblots for NFAT normalized to nNOS WT
control. (C) Representative immunoblot of nuclear/cytoplasmic NFAT from eNOS-
and WT mouse myotubes treated for 4h. (D) Quantification of immunoblots for
NFAT normalized to eNOS WT control. Values represent mean + SEM. =
significant difference from nNOS WT control and eNOS WT control respectively.









(DETA-NO), methylamine hexamethylene methylamine-NONO (MAHMA-NO), 2-(4-

Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002) and 3-(2-Hydroxy-2-nitroso-1-

propylhydrazino)-1-propanamine-NONO (PAPA-NO) were obtained from Cayman Chemical

(Ann Arbor, MI).

Cell Culture

Mouse C2C12 myoblasts were obtained from American Type Culture Collection

(Manassas, VA) and cultured at 370C in 5% CO2 and 95% atmospheric air.

Myoblasts were plated on 6-well collagen-coated plates and proliferated in Dulbecco's

Modified Eagle's Medium (DMEM) growth media (GM) containing 10% Fetal Bovine Serum

(FBS) and 1% penicillin/streptomycin. For all Western Blots and RNA isolation, C2C12

myotubes were grown to 70-80% confluency, and differentiation induced by switching to

medium containing 2% horse serum for 7 days. Myotubes were treated with one or more of the

following chemicals in media containing 2% serum: LY294002, L-NAME, PAPA-NO, ODQ,

YC-1. Whenever treatments were used in combination, inhibitors of NOS (L-NAME), PI3K

(LY294002) and guanylate cyclase (ODQ) were added 30 minutes prior to other treatments.

Control groups were exposed to treatment vehicles in concentrations equal to experimental

groups. When harvesting for total protein extracts, cells were washed twice in ice-cold PBS and

harvested in non-denaturing lysis buffer (NDL) containing 1% v/v Triton X-100, 0.3M NaC1,

0.05M TRIS-Base, 5mM EDTA, 3.1 [M NaN3, 95mM NaF, 22[M Na3VO4. For isolation of

nuclear proteins, cells were harvested in ice-cold PBS containing 1 IM Na3VO4 and 0.05% v/v

protease inhibitors (catalog #p-8340) and 0.5% v/v phosphatase inhibitors (catalog #p-5726)

from Sigma (Saint Louis, MO), centrifuged, and the resulting pellets treated with NE-PER

nuclear and cytosolic extraction reagents according to the manufacturer's procedures (Pierce

Biotechnology Inc., Rockford, IL). Both NDL and NE-PER buffers contained 0.1% v/v protease



































2008 Jason A. Drenning









muscle fiber type and neural stimulation in mice. Specifically, an NFATcl-GFP fusion protein

expressed in isolated fibers in the flexor digitorum brevis (FDB) muscle was found to be

predominantly cytoplasmic when unstimulated. The FDB typically displays fast-twitch

glycolytic fibers and thus this study shows evidence for these type of myofibers to have less

nuclear NFAT particularly when inactive. However, in the same study, when exposed to a low-

frequency pattern of neural stimulation, the same NFAT-cl-GFP did indeed translocate to the

nucleus demonstrating the plasticity of myofibers. In a similar study, Tothova et al (2006) used

an in vivo model to demonstrate that NFATcl-GFP is largely cytoplasmic in the fast twitch,

tibialis anterior (TA) muscle. Further, they observed a predominantly nuclear localization of

NFATcl in the soleus, a slow twitch muscle. Additional experiments by this group

demonstrated a rapid nuclear import of NFATcl via low-frequency stimulation in the TA.

Additional studies using NFAT reporters to monitor NFAT transcriptional activity have

shown similar results. NFAT transcriptional activity is higher in slow twitch muscles and lower

in fast twitch muscles. Also, when denervated, slow twitch muscles have attenuated NFAT

activity (Parsons et al. 2003). McCullagh et al (2004) observed an ability for denervated, slow

twitch muscles to respond to stimulation by increasing NFAT activity. However, this response

could only be induced by continuous, low-frequency stimulation. Phasic, high-frequency firing

patterns characteristic of fast motoneurons did not cause an increase in NFAT activity.

Other approaches to studying NFAT used a constituitively active form for the purpose of

transfection experiments. Particularly, constituitively active NFATcl has been shown to

increase MHC I mRNA in regenerating, denervated muscle (McCullagh et al. 2004). This

phenomenon was limited to the soleus though, as regenerating extensor digitorum longus

muscles did not show the same induction of MHC I expression. Interestingly, NFAT knockout









BIOGRAPHICAL SKETCH

Jason Drenning was born in Roaring Spring, Pennsylvania, in 1975. He was an all-state

baseball (pitcher) and football (quarterback) player at Northern Bedford High School. After

finishing 9th in his graduating class of 1993, he received his bachelor's degree in exercise science

from The George Washington University (GW) in Washington, D.C., in 1997. At GW, he was

on the Athletic Director's Honor Roll (baseball) and won the Warren Fulton award for leadership

in a team sport. Jason obtained his Master of Science in clinical exercise physiology in 2000 and

started his own personal training business. He went on to pursue a Doctor of Philosophy degree

from the University of Florida and worked in the Center for Exercise Science both in clinical and

basic science research. After graduating, Jason intends to work in the medical device or

pharmaceutical industry.









List of Terms

A23187 (calcimycin): calcium ionophore known to upregulate calcineurin and NFAT

activity

Calcineurin: protein phosphatase which dephosphorylates NFAT and induces nuclear

translocation

Calcium (Ca2+): essential element for cellular and molecular signaling in muscle

Cyclic Guanosine Monophosphate (cGMP): synthesis of cGMP catalyzed by guanylate

cyclase (GC); activated by, and often associated with NO in the NO-cGMP pathway

Endothelial Nitric Oxide Synthase (eNOS): NOS isoform present at low levels in all

skeletal muscle fibers, co-localizing with mitochondrial markers and closely related to

intracellular calcium levels and calmodulin binding

Glycogen Synthase Kinase-3p (GSK-3p): kinase which phosphorylates NFAT exporting

it from the nucleus

L-NAME (N (G)-nitro-L-arginine methyl ester): NOS inhibitor capable of abrogating

expression of all three NOS isoforms

LY294002 (2-(4-Morpholino)-8-phenyl-4H- 1-benzopyran-4-one): potent inhibitor of PI-

3K/AKT pathway

Muscle Fiber Type: slow- twitch (Type I) fibers characterized by slow contraction time,

high resistance to fatigue and displaying insulin sensitivity; fast-twitch (Type II) fibers identified

by quick contraction time, low resistance to fatigue and insulin resistant

Myosin Heavy Chain I/P: (MHC I/P): fatigue-resistant isoform most responsible for

contracile force in skeletal muscle

Neuronal Nitric Oxide Synthase: isoform located in the sarcolemma and closely related

to intracellular calcium levels and calmodulin binding





















S 4 AphosphoAKT
-- 0 phospho-AKT


SNAP Conce ntration


10gM 100pM 500pM 1mM


2.5-


*- 2.0-
e -

o

U-
0 1.0-


a 0.5-
o


0gM 1pM 10pM 100pM 500pM
SNAP Concentration


imM


Figure 4-9. Protein expression of AKT. (A) Representative immunoblot of phospho/total AKT
from C2C12 myotubes treated with varying does of the NO donor, SNAP. (B)
Quantification of immuoblots for phosphor/total AKT normalized to control. Values
represent mean + SEM. = significantly different from control (OgM).


%t tw









regulates complex signaling cascades through downstream effectors (Kelly et al. 2004; Lucas et

al. 2000). We recently reported that NOS activity is necessary for overload-induced expression

of MHC I/P mRNA in the rat plantaris (Sellman et al. 2006). Further data from our laboratory

confirms these findings in C2C12 myotubes (Drenning et al. 2008). Additionally, Gonzalez-

Bosc et al. (2006) demonstrated that NO is required for NFATc3 accumulation in vascular tissue.

Our preliminary data indicates that indeed NFAT function is enchanced by the NO-cGMP

pathway in mouse myotubes (Drenning et al. 2008). However, further study of the mechanism

by which NO affects skeletal muscle plasticity is needed. Therefore, it is important to

understand the molecular pathway controlling NFAT activity downstream of NO. Further,

similar ex vivo and in vivo experiments in nNOS and eNOS knockout mice are necessary to

substantiate our previous findings related to NO and NFAT.

Role of Nitric Oxide and AKT

As has been mentioned, numerous studies have provided evidence which suggest various

molecular signaling pathways are in control of changes in skeletal muscle plasticity. Signaling

molecules such as phosphatidylinositol 3-kinase (PI3K) and AKT have been studied mainly in

the context of catabolic and anabolic processes (Stitt et al. 2004; Bodine et al. 2006). However,

recently some of these molecules have been implicated as being involved in skeletal muscle

metabolism as well (Jensen et al. 2007). Specifically, AKT and its downstream target GSK-30

have been examined (Jensen et al. 2007). AKT is known to phosphorylate GSK-30 at Ser9

rendering it inactive. Interestingly, it has been shown recently that high, S-nitrosylation-like

levels of NO can inactivate AKT (Bouallegue et al. 2007). However, low levels of NO in

muscle may have the opposite effect on AKT.

Skeletal muscle AKT activity increases in response to numerous stimuli, including

hormones such as insulin-like growth factor (IGF-1) and insulin (Kimball et al. 2002; Bodine et









LIST OF REFERENCES


Abbott, KL, Friday BB, Thaloor D, Murphy J & Pavlath GK (1998). Activation and cellular
localization of the cyclosporine A-sensitive transcription factor NFAT in skeletal muscle
cells. MolBiol Cell 9, 2905-2916.

Aramburu J, Yaffe MB, Lopez-Rodriguez C, Cantley LC, Hogan PG & Rao A (1999). Affinity-
driven peptide selection of an NFAT inhibitor more selective than cyclosporine A. Science
285, 2.

Attie AD & Kendziorski CM (2003). PGC-la at the crossroads of type 2 diabetes. Nature
Genetics 34, 244-245.

Ausoni S, Gorze L, Schiaffino S, Gundersen K & Lomo T (1990). Experssion of myosin heavy
chain isoforms in stimulated fast and slow rat muscles. JNeurosci 10, 153-160.

Balon TW & Nadler JL (1997). Evidence that nitric oxide increases glucose transport in skeletal
muscle. JApplPhysiol 82, 359-363.

Beals CR, Sheridan CM, Turck CW, Gardner P & Crabtree GR (1997). Nuclear export of
NFAT-c enhanced by glycogen synthase kinase-3. Science 275, 1930-1934.

Bodine SC (2006). mTOR signaling and the molecular adaptation to resistance exercise. Med
Sci Sports Exerc 38, 1950-1957.

Bouallegue A, Daou GB & Srivastava AK (2007). Nitric oxide attenuates endothelin-1-induced
activation ofERK1/2, PKB and Pyk2 in vascular smooth muscle cells by a cGMP-dependent
pathway. Am JPhysiol Heart Circ Physiol 293, 2072-9.

Butler R, Morris AD & Struthers AD (1998). Systemic nitric oxide synthase inhibition increases
insulin sensitivity in man. Clin Sci 94, 175-180.

Caiozzo VJ, Baker MJ & Baldwin KM (1998). Novel transitions in MHC isoforms: separate and
combined effects of thyroid hormone and mechanical unloading. JAppl Physiol 85, 2237-
2249.

Chang WJ, lannaccone ST, Lau KS, Masters BS, McCabe TJ, McMillan K, Padre RC, Spencer
MJ, Tidball JG & Stull JT (1996). Neuronal nitric oxide synthase and dystrophin-deficient
muscular dystrophy. Proc NatlAcad Sci USA, 93, 9142-9147.

Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C., Shelton JM, Wu H, Zhu W, Bassel-
Duby R & Williams RS (1998). A calcineurin-dependent transcriptional pathway controls
skeletal muscle fiber type. Genes andDevelopment 12, 2499-2509.

Chung YH, Joo KM, Nam RH, Lee WB, Lee KH & Cha CI (2004). Region-specific alterations
in insulin-like growth factor-1 receptor in the central nervous system of nNOS knockout
mice. Brain Research 1021, 132-139.









Nitric Oxide-induced AKT Activity Is cGMP Dependent

Stimulation of sGC and the resultant accumulation of cGMP mediates many of the

signaling functions of NO and regulates complex signaling cascades through immediate

downstream effectors, including cGMP-dependent protein kinases, cGMP-regulated

phosphodiesterases, and cyclic nucleotide-gated ion channels (Lucas et al. 2000). Guanylate

cyclases and cGMP-mediated signaling cascades play a central role in the regulation of diverse

physiological processes (Kelly et al. 2004; Lucas et al. 2000). Previous studies have shown that

the NO-cGMP pathway can affect the phosphorylation of AKT (Boullegue et al. 2007) and our

preliminary work (unpublished data) indicated that AKT activity is necessary for NO-induced

GSK-30 phosphorylation. In addition, our previous data show that the sGC inhibitor, ODQ,

effectively blocks calcium-induced nuclear accumulation of NFATc1 and NFAT dependent

transcription. Further, our lab has shown that GSK-30 phosphorylation is NO-cGMP-dependent

in C2C12 myotubes. Therefore, understanding the role of the NO-cGMP pathway on AKT

phosphorylation is important for this study as it provides a potential mechanism to explain our

previous work (Drenning et al. 2008).

To better understand the effect of NO on GSK-30 and subsequently NFAT, we designed

this experiment expecting to observe NO-cGMP-dependent phosphorylation of AKT. Indeed,

phospho-total-AKT ratio was increased by the NO donor, PAPA-NO, while the sGC inhibitor,

ODQ, abrogated this effect (Figure 4-10). Similar to our previous data, YC-1 induced

phosphorylation of AKT. Taken together, these data indicate that low levels of NOS activate

AKT through the NO-cGMP pathway.

The NO-cGMP Pathway Activates the PI-3K/AKT Pathway

PI 3-kinases (PI-3K) have been linked to an extraordinarily diverse group of cellular

functions, including cell growth, proliferation, differentiation, motility, survival and intracellular









subsequently recruits AKT (Bodine et al. 2006). Chung et al. (2004) has recently shown that

NO is necessary for IGF-1R activity.

We proposed that NO is capable of inhibiting protein phosphatase activity. Previous

studies have shown that NO can inhibit specific protein phosphatases including PP1 and PP2A

(Tokui et al. 1996; Ugi et al. 2004; Villa-Moruzzi et al. 1996). We expected, in a general

protein phosphatase assay, to see inhibition of phosphatase activity by NO in a cGMP-dependent

manner. Our data confirms this hypothesis as pharmacological manipulation of C2C12

myotubes with a number of drugs showed that phosphatase activity was inhibited by the

NO/cGMP pathway (Figure 4-12). Interestingly, dose responses were seen both by the NO-

donor SNAP, and the sGC enhancer YC-1. Both drugs inhibited phosphatase activity at low

levels, and were not significantly different than the untreated control group at high levels. This

data implies again that low levels of NO have physiogical effects, and high levels do not.

Limitations and Future Directions

The selection of treatment times for cultured myotubes were based on optimal times

reported in other studies. Also, we wanted to extend our previous studies in a myogenic cell line,

to a transgenic animal model. Therefore, we chose to treat myotubes for Ih for the

phosphorylation experiments, 4h for the NFAT nuclear accumulation experiment, and 24h for

the MHC I/P just as we did in our previous work (Drenning et al. 2008). This did not affect our

data regarding the NO donor, PAPA-NO, but we did see a discrepancy in the results from

myotubes treated with A23187. Therefore, the effect of NOS ablation on myotube responses to

calcium ionophore treatment may be time dependent.

We did not measure NO activity via DAF-FM fluorometric analysis in the NOS-- or in the

WT mice. Our results suggest that when both nNOS and eNOS are present, physiologically

significant levels of NO are produced, which would be expected in the WT mice. However, we









Shen T, Cseresnyes Z, Liu Y, Randall WR & Schneider MF (2007). Regulation of the nuclear
export of the transcription factor NFATcl by protein kinases after slow fiber type electrical
stimulation of adult mouse skeletal muscle fibers. JPhysiol 579, 535-551.

Stamler JS & Meissner G (2001). Physiology of nitric oxide in skeletal muscle. Physiol Rev 81,
209-237.

Stitt TN, Drujan D, Clarke BA, Panaro F & Timofeyva T (2004). The IGF-1/PI3K/Akt pathway
prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO
transcription factors. Mol Cell 14, 395-403.
Sugita H, Fujimoto M, Yasukawa T, Shimizu N, Sugita M, Yasuhara S, Jeevendra- Martyn JA &
Kaneki M (2005). Inducible nitric-oxide synthase and NO donor induce insulin receptor
substrate-1 degradation in skeletal muscle cells. JBiol Chem 280,14203-14211.

Termin A, Staron RS & Pette D (1989). Changes in myosin heavy chain isoforms during chronic
low-frequency stimulation of rat fast hindlimb muscles. A single-fiber study. Eur JBiochem
186, 749-754.

Tidball JG, Lavergna E, Lau KS, Spencer MJ, Stull JT & Wehling M (1998). Mechanical
loading regulates NOS expression and activity in developing and adult skeletal muscle. Am J
Physiol Cell Physiol 275, C260-C266.

Tokui T, Brozovich F, Ando S & Ikebe M (1996). Enhancement of smooth muscle contraction
with protein phosphatase inhibitor 1: activation of inhibitor 1 by cGMP-dependent protein
kinase. Biochem Biophys Res Commun 220, 777-83.

Tothova J, Blaauw B, Pallafacchina G, Rudolf R, Argentini C, Reggiani C & Schiaffino S
(2006). NFATcl nucleocytoplasmic shuttling is controlled by nerve activity in skeletal
muscle. JCellSci 119, 1604-1611.

Ugi S, Imamura T, Maegawa H, Egawa K, Yoshizaki T, Shi K, Obata T, Ebina Y, Kashiwagi A
& Olefsky JM (2004). Protein phosphatase-2A negatively regulates insulin's metabolic
signaling pathway by inhibiting AKT activity in 3T3-L1 adipocytes. Mol CellBiol 19, 8778-
89.

Van der Velden J, Schols A, Wilems J, Kelders M & Langen R (2007). Glycogen Synthase
Kinase 30 suppresses myogenic differentiation through negative regulation of NFATc3. J
Biol Chem 283, 358-366.

Villa-Moruzzi E, Puntoni F & Marin O (1996). Activation of protein phosphatase-1 isoforms
and GSK-33 in muscle from mdx mice. Int JBiochem Cell Biol 1, 13-22.

Williams RS & Kraus WE (2005). Exercise and Health: Can biotechnology confer similar
benefits? PLoSMed2, 209-212.
























PAPA-NO(14M)
ODQ (10pM)
YC-1 (200pM)


Con


+ +


PAPA-NO PAPA YC-1 ODQ
lyM ODQ 200gM 10pM


Figure 4-10. Protein expression of AKT. (A) Representative immunoblot of phospho/total AKT
from C2C12 myotubes treated with the NO donor, PAPA NO, the sGC inhibitor
ODQ, and the sGC enhancer YC-1. (B) Quantification ofimmunoblots for
phospho/total AKT normalized to control. Values represent mean + SEM. =
significantly different from control (Con).


._ AKT

4$_ phospho-AKT









Question 2. Does the NO-cGMP pathway inhibit GSK-30 by activating the PI3K/AKT

pathway?

Experiment 3. C2C12 myotubes were cultured with varying concentrations of the NO donor

SNAP (1tM-1mM) for lh. Western blots were run to measure AKT phosphorylation.

Table 3-3. Experiment 3.
Cell type Control 1aM 10[tM 100pM 500[tM ImM
C2C12 n=6 n=6 n=6 n=6 n=6 n=6
myotubes
(n=number of cultures for each group)

Experiment 4. C2C12 myotubes were cultured with the NO donor, PAPA-NO, the sGC

inhibitor ODQ, and the sGC enhancer, YC-1 for lh. Western blots were run to measure AKT

phosphorylation.

Table 3-4. Experiment 4.
Cell type Control PAPA-NO PAPA-NO ODQ ODQ YC-1
ItpM 10oM 200tM
C2C12 n=6 n=6 n=6 n=6 n=6
myotubes
(n=number of cultures for each group)

Experiment 5. C2C12 myotubes were cultured with the NO donor, PAPA-NO, the sGC

enhancer YC-1, and the PI-3K/AKT inhibitor LY294002 for Ih.

Table 3-5. Experiment 5.
Cell type Control PAPA-NO PAPA-NO YC-1 YC-1 LY29
1IaM LY29 ImM 200LaM LY29 ImM
C2C12 n=6 n=6 n=6 n=6 n=6 n=6
myotubes
(n=number of cultures for each group)

Question 3. Does NO have the capacity to inhibit protein phosphatases?

Experiment 6. C2C12 myotubes were cultured with the calcium ionophore A23187, the NO

inhibitor, L-NAME, the NO donor, SNAP, the sGC inhibitor ODQ, and the sGC enhancer, YC-

1. A PnPP assay was used to detect protein phosphatase activity.









Kramer HF, & Goodyear LJ. Exercise, MAPK, and NF-kappaB signaling in skeletal muscle. J
ApplPhysiol 103, 388-395.

Kraus WE, Torgan CE & Taylor DA (1994). Skeletal muscle adaptation to chronic low-
frequency motor nerve stimulation. Exerc Sport Sci Review 50, 313-360.

Kubis HP, Hanke N, Scheibe RJ, Meissner JD & Gros G (2003). Ca2+ transients activate
calcineurin/NFATcl and intiate fast-to-slow transformation in a primary skeletal muscle
culture. Am JPhysiol Cell Physiol 285, c56-c63.

Larsen JJS, Dela F, Kjaer M & Galbo H (1997). The effect of moderate exercise on post prandial
glucose homeostasis in NIDDM patients. Diabetologia 40, 447-453.

Lira VA, Soltow QA, Long JH, Betters JL, Sellman JE & Criswell DS (2007). Nitric oxide
increases GLUT4 expression and regulates AMPK signaling in skeletal muscle. Am JPhysiol
EndocrinolMetab 293, E1062-E1068.

Liu Y, Cseresnyes Z & Randall WR (2001). Activity dependent nuclear translocation and
intranuclear distribution of NFATc in adult skeletal muscle fibers. JCellBiol 155, 27-39.

Liu Y, Shen T, Randall WR & Schneider MF (2005). Signaling pathways in activity-dependent
fiber type plasticity in adult skeletal muscle. JMuscle Res CellMotil 26, 13-21.

Lucas KA, Pitari GM, Kazerounian S, Ruiz-Stewart I, Park J, Schulz S, Chepenik KP &
Waldman SA (2000). Guanylyl cyclases and signaling by cyclic GMP. Pharmacol Rev 52,
375-414.

McCullagh KJ, Calabria E, Pallafacchina G, Ciciliot S & Serrano AL (2004). NFAT is a nerve
activity sensor in skeletal muscle and controls activity-dependent myosin switching. Proc
NatlAcad Sci 101, 105900-105905.

Meissner JD, Umeda PK, Chang, KC, Gros G & Scheibe RJ (2007). Activation of the 0 myosin
heavy chain promoter by MEF-2D, MyoD, p300 and the calcineurin/NFATcl pathway. J
Cell Physiol 211, 138-148.

Naya FJ, Mercer B, Shelton J, Richardson JA, Williams RS & Olson EN (2000). Stimulation of
slow skeletal muscle fiber gene expression by calcineurin in vivo. JBiol Chem 275, 4545-
4548.

Neal JW & Clipstone NA (2001). Glycogen synthase kinase-3 inhibits the DNA binding activity
ofNFATc. JBiol Chem 276, 3666-3773.

Nisoli E, Falcone S, Tonello C, Cozzi V, Palomba L, Fiorani M, Pisconti A, Brunelli S, Cardile
A, Francolini M, Cantoni O, Carruba MO, Moncada S & Clementi E (2004). Mitochondrial
biogenesis by NO yields functionally active mitochondria in mammals. Proc NatlAcadSci
USA 101, 16507-12.









difficult to localize and study due to its low level of expression; thus, eNOS may exert its effects

at very low, undetectable physiological levels, possibly explaining nNOS predominance in

previous findings. 2) The NOS proteins are among the most tightly regulated enzymes

(Christopherson & Bredt, 1997), and it is unknown how much NO needs to be produced to

activate soluble guanylate cyclase optimally, and subsequently the PI3K/AKT/GSK-30 pathway

facilitating NFAT nuclear accumulation and slow gene induction. Our data suggest that both

isoforms work collectively to produce the optimal amount of NO needed for NFAT function. 3)

nNOS has been shown to increase in mice with age (Chang et al. 1996); the mice used for this

study were young (3-4 weeks) and may have lower levels of nNOS as compared to adult mice

used in other studies, providing another explanation for the similar effects observed in nNOS--

and eNOS-- mice.

Nuclear Factor of Activated T-Cell Activity Can be Rescued With Pharmacological
Manipulation in NOS-'- Mice

The NO donor, PAPA-NO (1 M) rescued the attenuated NO pathway in both nNOS-/- and

eNOS-/- mice. Treatment with PAPA-NO resulted in increased MHC I/P mRNA, NFAT nuclear

accumulation, GSK-30 phosphorylation, and AKT phosphorylation in WT control mice, and the

NOS-- mice (Figures 4-2 to 4-5). This correlates with our previous work (Drenning et al. 2008)

which showed a significant effect of PAPA-NO on GSK-30 phosphorylation in C2C12

myotubes. Treatment of cultured myotubes with the calcium ionophore, A23187 (0.4tM)

yielded conflicting results. Experiments aimed at studying GSK-30 and AKT phosphorylation

from myotubes treated with A23187 for lh were not responsive in nNOS- or eNOS-/- mice.

Similarly, immunoblots for NFAT nuclear accumulation, showed an inability for A23187 to

increase nuclear NFAT at 4h in the NOS- mice. However, myotubes from both nNOS- and

eNOS-/- mice, treated for 24h, demonstrated a significant increase in MHC I/P mRNA. These









harvested, measured for protein content and western blots run according the cell culture and

western blot methods described below.

Transient Transfections

C2C12 myotubes were terminally differentiated and transfected with the .4ag of the

NFAT promoter plasmid, NFAT-GFP (2). The NFAT-GFP construct was prepared by fusing

three tandem NFAT-binding sites with enhanced GFP cDNA. (Addgene plasmid 11107). The

plasmid was completed with Lipofectamine reagent (Invitrogen) and exposed to myotubes in

serum-free DMEM for 24h. After transfection, cells were placed in 2% HoS media and cultures

visualized by fluorescent microscopy before and during treatment with the calcium ionophore,

A23187, A23187 and the NOS inhibitor L-NAME, and L-NAME alone.

Immunohistochemistry

Histochemistry was done on serial cross-sections of frozen muscles that will be collected

on glass coverslips. Sections of the plantaris were of 10gM muscle thickness. Fiber types were

determined by immunohistochemical analysis of serial sections using monoclonal antibodies

specific for IIB [BF-F3 (53)], IIA [SC-71 (53)], and type I [A4.840 (64)] myosin heavy chains.

Type IIX fibers were identified on the basis of their lack of reaction with these three antibodies.

A variable percentage of muscle fibers were hybrid or intermediate types that contain more than

one myosin isoform. Any IIB/IIX or IIX/IIA intermediate fibers were counted as IIB and IIA

fibers, respectively, on the basis of their reaction with the IIB- and IIA-specific antibodies, so the

IIX fiber type excludes intermediate types. Hybrid fibers reacting with both type IIA and type I

myosin antibodies were typed as IIA fibers.

Chemicals and Reagents

N(G)-L-nitro-arginine methyl ester (L-NAME), 1H-[1,2,4]Oxadiazolo[4,3-a]quinoxalin-1-

one (ODQ), 3-(5'-hydroxymethyl-2'furyl)-l-benzyl indazole (YC-1), diethylenetriamine-NONO









the NO donor, SNAP (1I M and 10lM) resulted in an inhibitory effect on protein phosphatase

activity below control levels. As concentrations of SNAP increased, the inhibitory effect

lessened, demonstrating that high levels (500gM and ImM) were similar to untreated myotubes.

The sGC inhibitor, ODQ attenuated the inhibitory effect of SNAP. In addition, YC-1, at low

levels, had a similar concentration-dependent effect as SNAP indicating a NO-cGMP-dependent

mechanism by which NO inhibits protein phosphatase activity.









Tonic patterns of motor nerve activity promote changes in intracellular calcium that result

in the activation of numerous molecular signaling pathways (Williams & Kraus, 2005). These

pathways link changes in nerve activity to changes in gene expression which establish myofiber

diversity (Shiaffino et al. 2007). The calcineurin/NFAT pathway is an important mechanism

which has been shown to affect fiber-type plasticity (Chin et al. 1998; Schultz & Yutzey, 2004;

McCullagh et al. 2004; Fenyvesi et al. 2004), Rao et al. 1997; Ryder et al. 2001; Wu et al. 2000;

Yan et al. 2001; Meissner et al. 2007; Fielder et al. 2002). This pathway is largely dependent on

increases in intracellular calcium activity. Calcium signaling is critical to NFAT activation

because calmodulin, a well known calcium sensor protein, activates calcineurin. Calcineurin is a

calcium-dependent, serine/threonine protein phosphatase also known as protein phosphatase-2B

(PP2B). The signaling cascade modulated by calcineurin results in the nuclear translocation of

the transcription factor, NFAT. Activated calcineurin dephosphorylates the serine rich region

and SP-repeats in the amino termini of NFAT, resulting in a conformational change that exposes

a nuclear localization signal resulting in NFAT nuclear import (Meissner et al. 2007). Generally,

nuclear import of NFAT is opposed by maintenance kinases in the cytoplasm and export kinases

in the nucleus. Export kinases such as GSK-30 must be inactivated for NFAT nuclear retention.

Accordingly, a number of studies have shown that an increases in calcium transients

phophorylates GSK-30, rendering it inactive and thus allowing for NFAT nuclear accumulation

(Jiang et al. 2006; Shen et al. 2007). The details of the relationship between NFAT and GSK-30

will be addressed in the section entitled, "Role of GSK-30 in NFAT Function" below.

Nuclear Factor of Activated T-Cell Signaling

The importance of the transcription factors of the NFAT family as nerve activity-

dependent mediators in skeletal muscle has been demonstrated by numerous studies. Liu et al.

(2001) has observed differences in nuclear and cytoplasmic NFATcl localization based on









mice have not been shown to have altered fiber type make-up. However, to date only NFATc2

and NFATc3 knockouts have been studied (Horsely et al. 2001; Kegley et al. 2001),

strengthening the conclusion that the NFATcl isoform is primarily responsible for fiber type

regulation.

Nuclear Factor of Activated T-Cell Interaction with Other Transcription Factors

Work has shown that NFAT transcriptional activity is dependent on interaction with other

transcription factors. Meissner et al (2007) has recently described the assembly of a

transcriptional complex including NFATcl, MyoD, MEF2D, and the co-activator p300. This

group observed that all these transcriptional factors assemble on the MHC I promoter region in

response to calcium ionophore treatment, stimulating the induction of the MHC I gene.

The potential for NFAT interacting with AP-1 has been studied as well. AP-1, which is a

co-factor known to interact with NFAT in the induction of the immune response, may play an

important role in working with NFAT in skeletal muscle. Kramer et al. (2007) have recently

shown that ERK1/2 are activated during exercise and during contraction of isolated muscle.

ERK1/2 has shown a propensity for regulating AP-1 and has been shown to induce MHC I

expression in rat soleus muscle. Therefore, ERK1/2 and AP-1 may both interact with NFAT to

allow for the induction of slow genes.

Role of GSK-3p in NFAT Function

Nuclear NFAT concentrations are dependent on a balance between import and export

(activation or deactivation). Kinases are known to phosphorylate NFAT (Shen et al. 2007),

cause its nuclear export (Gonzolez-Bosc et al. 2004), inhibit DNA binding (Jiang et al. 2006),

and blunt its transactivating potential (Shen et al. 2007). In skeletal muscle, a number of studies

have shown that GSK-33 is most likely the kinase responsible for NFAT nuclear export.









Windisch A, Gundersen K, Szabolcs MJ, Gruber H & Lomo T (1998). Fast to slow
transformation of denervated and electrically stimulated rat muscle. JPhysiol 510, 623-632.

Wu H, Naya FJ, McKinsey TA, Mercer B, Shelton JM, Chin ER, Simard AR, Michel RN,
Bassel-Duby R, Olson EN & Williams RS (2000). MEF2 responds to multiple calcium-
regulated signals in the control of skeletal muscle fiber type. EMBO J 19, 1963-1973.

Yan Z, Serrano AL, Schiaffino S, Bassel-Duby & Williams RS (2001). Regualtory elements
governing transcription in specialized myofiber subtypes. JBiol Chem 276, 17361-17366.









Statistical Analysis

Data were analyzed by a two-way ANOVA with Tukey's HSD post hoc test. Significance

was established a priori at p<0.05. Values reported are means + SEM.









cyclase (sGC) independent of NO (Kelly et al. 2004), also increased the ratio of phospho-/total

AKT by 2-fold demonstrating that activation of sGC is sufficient for this effect.

Nitric Oxide -cGMP Induced AKT Phosphorylation Is PI-3K-Dependent

Next, we sought to determine if the NO-cGMP-induced effects on AKT, seen in

experiment 4, were PI-3K-dependent. A common stimulator of AKT activity is PI-3K (Stitt et

al. 2004). These kinases are often associated, acting as a mediator of insulin or IGF-1 signaling.

We found that treatment of myotubes with PAPA-NO, ODQ, and YC-1 produced effects similar

to the previous experiment. Also, co-treatment of myotubes with PAPA-NO and the PI-3K

inhibitor LY294002 resulted in no increase in phosphor-/total AKT. (Figure 4-11). Thus, our

findings indicate that the NO-cGMP pathway activates the PI-3K/AKT pathway, and that these

pathways work in conjunction, providing a possible mechanism for the effect of NO on NFAT

function seen in our previous work.

Nitric Oxide Inhibits Protein Phosphatase Activity

We hypothesized that NO may play a role in inhibiting protein phosphatase activity.

Given the unknown mechanism by which the NO-cGMP pathway activates the PI-3K/AKT

pathway, and the evidence in previous studies for NOS activity being capable of inhibiting

several protein phosphatases, we sought to determine if NO is a general protein phosphatase

inhibitor (Tokui et al. 1996; Ugi et al. 2004; Villa-Moruzzi et al. 1996). Further, PP2A has been

shown to have an inhibitory effect on AKT. We performed a general protein phosphatase assay

on protein lysates from C2C12 myotubes treated with several pharmacological agents intended to

determine ifNOS and GC activity limit protein phosphatase activity. Our findings demonstrated

that indeed NO does inhibit protein phosphatase activity, and does so through cGMP (Figure 4-

12). Myotubes treated with the calcium ionophore showed a significant increase in enzyme

activity, while co-treament with the NO inhibitor, L-NAME prevented this effect. Low levels of









CHAPTER 1
INTRODUCTION

Skeletal muscle is responsible for most insulin-mediated glucose clearance in the body

(DeFronzo et al. 1981; Devlin et al. 1987; Ivy & Holloszy, 1981; Katz et al. 1983; Larsen et al.

1997). There is considerable plasticity in skeletal muscle as chronic exercise results in increased

expression of slow, oxidative genes giving muscle fibers an insulin sensitive and metabolically

active phenotype. Given the importance of understanding the mechanisms) that contribute to

fiber type switching and the potential role of nitric oxide (NO) to regulate the slow gene

transcription factor NFAT, we postulate that NO is necessary for NFAT function both in vivo

and in vitro.

Previous work in our lab suggests that NO is an important signaling molecule in

controlling skeletal muscle plasticity downstream of calcium (Drenning et al. 2008). NO is

produced enzymatically by nitric oxide synthases (NOS). The isoforms eNOS and nNOS are

calcium-sensitive and constituitively expressed in skeletal muscle. These enzymes synthesize

NO at low levels associated with low frequency muscle activation. Our preliminary data shows

that NOS activity results in inhibitory phosphorylation of GSK-30 (in a NO-cGMP dependent

manner) and subsequently enhances NFAT activity but, the mechanism by which this occurs is

unclear. Further, our data regarding NFAT is limited to C2C12 myotubes. Hence, these

experiments will investigate NFAT function in vivo and in cultured myotubes from nNOS and

eNOS knockout mice and examine the mechanisms) by which NO inhibits GSK-30 in C2C12

myotubes. Our central hypothesis is that NO facilitates NFAT function by inhibiting GSK-30 in

a cGMP/PI3K/AKT dependent manner.










Crabtree GR (1999). Generic signals and specific outcomes: signaling through Ca(2+),
calcineurin, and NFAT. Cell 96, 611-614.

Christopherson KS & Bredt DS (1997). Nitric oxide in excitable tissues: Physiological roles and
disease. J Clin Invest 100, 2424-2429.

DeFronzo RA, Jacot E, Jequeir E, Maeder E, Wahren J & Felber F (1981). The effect of insulin
on the disposal of intravenous glucose. Diabetes 30, 1000-1007.

Delling U, Tureckova J, Lim HW, De Windt LJ, Rotwein P & Molkentin JD (2000). A
calcineurin-NFATc3 -dependent pathway regulates skeletal muscle differentiation and slow
myosin heavy-chain expression. Mol Cell Biol 20, 6600-6611.

Devlin JT, Hishman M, Horton ED & Horton ES (1987). Enhanced peripheral and splanchnic
insulin sensitivity in NIDDM men after single bout of exercise. Diabetes 36, 434-439.

Drenning JA, Lira VA, Simmons CG, Soltow QA, Sellman JE & Criswell DS (2008). Nitric
Oxide facilitates NFAT-dependent transcription in mouse myotubes. Am JPhysiol Cell
Physiol (Epub ahead of print).

Dunn SE, Simard AR, Bassel-Duby R, Williams RS & Michel RN (2001). Nerve activity-
dependent modulation of calcineurin signaling in adult fast and slow skeletal muscle fibers. J
Biol Chem 276, 45243-45254.

Embi N, Rylatt DB & Cohen P (1980). Glycogen synthase kinase-3 from rabbit skeletal muscle.
Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J
Biochem 107, 519-527.

Eyre H, Kahn R, Robertson RM, Clark NG, Doyle C, Hong Y, Gansler T, Glynn T, Smith RA,
Taubert K & Thun MJ (2004). Preventing cancer, cardiovascular disease and diabetes: a
common agenda for the American Cencer Society, the American Diabetes Association, and
the American Heart Association. Circulation 109, 3244-3255.

Fenyvesi R, Raez G, Wuytack F & Zador E (2004). The calcineurin activity and MCIP1.4
mRNA levels are increased by innervation in regenerating soleus muscle. Biochem Biophys
Res Commun 320, 599-615.

Fiedler B, Lohmann SM, Smolenski A, Linnemuller S, Pieske B, Schroder F, Molkentin JD,
Drexler H & Wollert KC (2002). Inhibition of calcineurin-NFAT hypertrophy signaling by
cGMP-dependent protein kinase type I in cardiac myocytes. Proc NatlAcadSci USA 99,
11363-11368.

Frame S & Cohen P (2001). GSK3 takes centre stage more than 20 years after its discovery.
Biochem J359, 1-16.













nNOS nNOS eNOS eNOS
WT KO WT KO


4 nNOS

-0- eNOS


B



= nNOS WT
- nNOS-/-
e eNOS WT
C eNOS -I-


LXIjMMa I M:flj,
nNOS eNOS
protein levels protein levels


Figure 4-1. Protein expression of neuronal nitric oxide synthase (nNOS) and endothelial nitric
oxide synthase (eNOS). (A) Representative immunoblots from nNOS WT, nNOS-/-,
eNOS WT, and eNOS-/- primary myotubes. (B) Quantification ofimmunoblots for
nNOS and eNOS. nNOS-/- were compared to nNOS WT and eNOS-/- to eNOS WT.
Values represent mean + SEM. *Significantly different from WT.














WT KO WT KO WT KO


MA0.4 O
0.4 RM


Control A23187
0.4 pM


1rM-w
1pM


AKT

- phospho-AKT








B




= nNOS WT
IM nNOS 4-


PAPA-NO
1AM


Figure 4-5. Protein expression of phospho-/total AKT. (A) Representative immunoblot of AKT
from nNOS-- and WT mouse myotubes treated for lh. (B) Quantification of AKT
immunoblots normalized to nNOS WT control. (C) Representative immunoblot of
AKT from eNOS-/- and WT mouse myotubes treated for lh. (D) Quantification of
AKT immunoblots normalized to eNOS WT control. Values represent mean + SEM.
= significant difference from nNOS WT control and eNOS WT control
respectively.






















3.00-
2.75-
S2.50-
2.25-
2.00-
1.75-
1.50

r1.25


a nin


C= Control
m ODQ (25pM)


0 1 10 100 500 1000
SNAP CONCENTRATION (,M)

Figure 4-12. pNPP protein phosphatase activity assay. C2C12 myotubes were treated with or
without the sGC inhibitor, ODQ, and with the NO donor, SNAP. at varying
concentrations. Bars are representative of enzyme activity normalized to protein
content. Values represent mean + SEM. = significantly different than control
(OM).

































To my wife, Tiffany Drenning, who sacrificed much for this degree









CHAPTER 2
LITERATURE REVIEW

Many studies have shown that skeletal muscle is responsible for most insulin-mediated

glucose oxidation (DeFronzo et al. 1981; Devlin et al. 1987; Ivy et al. 1981; Katz et al. 1983;

Larsen et al. 1997). Exercise improves muscle glucose clearance due to the chronic effect of

activity on fiber type expression (Shiaffino et al. 2007). While the calcium/calcineurin related

pathways have been well established as contributing to the shift in fiber type toward a slow

twitch, metabolically active phenotype, (Chin et al. 1998; Kubis et al. 2003; Naya et al. 2000)

the role NO plays is unclear. To further understand the function of NO in fiber type related

calcium signaling, this project examined the hypothesis that NOS activity promotes NFAT by

inhibiting GSK-30 in a cGMP/PI3K/AKT dependent manner. The background section of this

proposal will discuss the importance of the proposed work and develop ideas behind our

hypothesis based on our prior research and the work of others. The preliminary data section will

provide evidence of the feasibility of our proposed experiments.

Overview of Skeletal Muscle Fiber Type

The cells that make up skeletal muscle are known as myofibers. They are large

multinucleated cells that often extend the entire length of individual muscles. These individual

myofibers are expressed as different types and vary in size, metabolic activity, and contractile

function. These "types" are generally categorized into two groups. Slow fibers are characterized

as type I, and fast fibers as type IIa, IIb, and IId/x. Thus, skeletal muscle is comprised of

numerous fiber types with different structural and functional properties (Kraus et al. 1994;

Williams & Kraus, 2005; Pette 2001).









Table 3-6. Experiment 6.
Cell type Control A23187 A23 LNAME SNAP SNAP A23 ODQ YC-1
0.4atM LNAME Dose Dose ODQ Dose
1 tM- ODQ 200t-
ImM 10oM ImM
C2C12 n=8 n=8 n=8 n=8 n=8 n=8 n=8 n=8 n=8
myotubes
(n=number of cultures for each group)

Animals

Young C57 wild type, as well as, eNOS and nNOS knockout mice were used for

experiments one and two. The animals were approximately 3-4 weeks old at the time of

sacrifice. Hindlimb skeletal muscle, excluding the plantaris, was pooled from 3 animals for each

satellite cell isolation. All animals were housed at the University of Florida Animal Care

Services Center according to guidelines set forth by the Institutional Animal Care and Use

Committee.

Protocol for Experiments 1 and 2

Myogenic cultures were prepared in parallel from WT and nNOS/eNOS knockout mice

(C57), using 3 mice per isolation. Cells were isolated from soleus, gastrocnemius, tibialis

anterior (TA), and quadriceps muscles after careful dissection of the muscles to minimize

connective tissue contribution. Collected muscles were enzymatically digested, satellite cells

released, and single cells cultured. Isolated cells were re-suspended from a pellet into serum-rich

growth medium consisting of Dulbecco's minimum essential medium (DMEM) supplemented

with 25% fetal bovine serum (Hyclone, Logan, UT), 10% horse serum (Hyclone), 1% chicken

embryo extract, and antibiotics. Cells were plated at a density of 105 cells per plate using 35-mm

plates pre-coated with 2% gelatin. Myoblasts were trypsinized and passed to 6-well plates at

60% confluency. Cultures were maintained in a standard tissue culture, with fresh growth

medium replaced following the first 3 days in culture and every 2 days thereafter, and were























.4-MAKT


.4* phospho-AKT


PAPA-NO (1IMM)
LY294002 (25anm)
ODQ(1IOM)
YC-1 (200gM)


+ +


Con PAPA-NO PAPA YC-1 YC-1 LY29 ODQ
ipM LY29 200pM LY29 25pM 104uM


Figure 4-11. Protein expression of AKT. (A) Representative immunoblot of phospho/total AKT
from C2C12 myotubes treated with the NO donor, PAPA-NO, PI3K inhibitor LY29,
sGC enhancer YC-1, and sGC inhibitor ODQ. (B) Quantification ofimmunoblots for
phospho/total AKT normalized to control. Values represent mean + SEM. =
significantly different than control (Con).









Nitric Oxide (NO): small, highly diffusible molecule synthesized by the enzyme nitric

oxide sythase (NOS) from the conversion of L-arginine to L-citrulline

Nuclear Factor of Activated T-Cells (NFAT):_ important in skeletal muscle as

transcription factor which contributes to the induction of slow genes

ODQ (1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-l-one): highly selective, irreversible, heme-

site inhibitor of soluble guanylyl cyclase

PAPA-NO (1-[N-(3-Ammoniopropyl)-N-(n-propyl)amino]diazen-1 -ium-1,2-diolate):

rapidly degraded NO donor with half life of release of 15 minutes

Phosphoinositide-3 kinase (PI-3K): kinase which activates AKT

Protein Kinase-B (AKT): kinase known to be capable of phosphorylating GSK-30 at

serine-9

Type 2 Diabetes Mellitus (DM2): metabolic disorder primarily characterized by insulin

resistance, relative insulin deficiency and hyperglycemia often managed by engaging in exercise

YC-1 (3-(5'hydroxymethyl-2'furyl)- -benzyl indazole): NO independent activator of

soluble guanylyl cyclase

Limitations/Delimitations/Assumptions

Limitations: The invasive nature of this study negates the use of human subjects. A

mouse model has been selected because of the similarities in structure and function of mouse and

human skeletal muscle.

Delimitations: Gender, age and species differences may exist in regard to signaling

pathways and muscle fiber type. In our animal model, we have chosen to study young, male C57

mice.









Background

Adult vertebrate skeletal muscle consists of different fiber types, one slow (type I/P) and

three fast (IIa, IIx, and IIb), which differ in their contraction speed, strength, fatigability, and

insulin sensitivity. Skeletal muscle exhibits a high degree of plasticity with transformations in

fiber type occurring in response to altered physiological demand and contractile load (Chin et al.

1998; Schiaffino et al. 2007). Tonic, low-frequency neural activity or electrical stimulation

causes a shift from fast, glycolytic fibers toward the slow, oxidative phenotype (Liu et al. 2005;

Pette, 2001). The pathway by which low frequency muscle activation induces transcription of

slow-twitch genes involves sustained calcium levels sufficient to stimulate calcineurin

phosphatase activity (Dunn et al. 2001; Jiang et al. 2006; Wu et al. 2000). Dephosphorylation of

the nuclear factor of activated t-cells (NFAT) transcription factors by calcineurin promotes its

translocation from the cytoplasm to the nucleus, where it will bind to a nucleotide recognition

sequence and stimulate the transcription of target, slow-twitch genes (Chin et al. 1998; Kubis et

al. 2003;). Although this pathway explains activity-induced activation of NFAT, overall

transcriptional activity, and therefore fiber type change, is determined by the balance between

activation and deactivation of this transcription factor (Abbott et al. 1998; Delling et al. 2000).

Recent studies suggest that GSK-30 synergistically regulates nuclear export of NFAT in skeletal

muscle fibers by phosphorylation of its serine residues (Jiang et al. 2006; Shen et al. 2007).

Nitric Oxide (NO) is a ubiquitous signaling molecule produced enzymatically by nitric

oxide synthases (NOS). Recently, it has been reported that NO is required for NFATc3 nuclear

accumulation in mouse cerebral arteries in response to increased intravascular pressure, and that

this effect was dependent upon inhibition of NFAT nuclear export (Gonzalez-Bosc et al. 2004).

NFAT has been shown to be an important transcription factor in skeletal muscle as its

calcium/calcineurin induced nuclear translocation and accumulation stimulate the expression of









CHAPTER 5
DISCUSSION

Main Findings

Although our previous work with regard to NO-cGMP mediated NFAT activity via GSK-

30 phosphorylation was novel, we sought to extend our data from a myogenic cell line to a

transgenic animal model, and to better understand the mechanisms) by which the NO-cGMP

pathway affects GSK-30. We used commercially available nNOS-"- and eNOS- mice (The

Jackson Laboratory (Bar Harbor, ME) to determine both the ex vivo and in vivo effects of NO on

NFAT function. Also, experiments in this study aimed at furthering our understanding of how

NO inhibits GSK-30 were done in C2C12 myotubes. The main findings of this study are: 1)

Both nNOS and eNOS are necessary for the ex vivo facilitation of NFAT activity, as evidenced

by attenuated MHC I/P mRNA, NFAT nuclear accumulation, GSK-30 phosphorylation and AKT

phosphorylation in nNOS-- and eNOS-- mice; 2) With regard to NFAT activity, cultured

myotubes from nNOS-- and eNOS-/- mice did not show responsiveness to the calcium ionophore,

A23187 (0.4tM) at Ih and 4h. Nevertheless, MHC I/P mRNA is induced in nNOS-/- and eNOS-/

cultures after 24h of ionophore treatment. Further, the NO donor, PAPA-NO (1 M) is capable

of enhancing NFAT function, GSK-30 and AKT phosphorylation, and MHC I/P mRNA

expression in myotube cultures from nNOS- and eNOS mice. 3) nNOS and eNOS are both

necessary for NFAT activity and fiber type regulation in vivo as demonstrated by significant

differences in Type I fibers, GSK-30 phosphorylation, and AKT phophorylation in nNOS-/- and

eNOS -/- mice as compared to WT control mice. 4) NO inhibits GSK-30 in a cGMP/PI3K/AKT

dependent manner, and the interaction of the NO-cGMP and PI3K/AKT pathways may be

mediated by NO-dependent inhibition of protein phosphatases.









LIST OF TABLES

Table page

3-1 E xperim ent 1 ..............................................................................29

3 -2 E x p erim ent 2 ........................................................................... 2 9

3 -3 E x p erim en t 3 .............. ........ ............... ...................... ....... ................ .................... 3 0

3-4 Experim ent 4. ............................................................................. 30

3-5 Experim ent 5 ......... .... .............. .................................... ........................... 30

3-6 E xperim ent 6 ................. ................................... ........................... 3 1

4-1 Plantaris fiber type morphology for nNOS WT, nNOS -/-, eNOS WT, and eNOS -/-
m ice as m measured by percentage............................................................. .....................4 1




Full Text

PAGE 1

NITRIC OXIDE FACILITATES NUCLEAR FACTOR OF ACTIVATED T-CELL (NFAT) ACTIVITY THROUGH AKT INDUCED GLYCOGEN SYNTHASE KINASE-3BETA (GSK-3Beta) PHOSPHORYLATION By JASON A. DRENNING A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2008 1

PAGE 2

2008 Jason A. Drenning 2

PAGE 3

To my wife, Tiffany Drenning, who s acrificed much for this degree 3

PAGE 4

ACKNOWLEDGMENTS This work was completed with the help and encouragement of many. Much appreciation is extended to Dr. David Criswell, my supervisory committee chair. I gained valuable knowledge during my years working with him as he guide d me through the completion of this degree. I thank my committee members (Drs. Scott Powers and Steve Dodd from Applied Physiology and Kinesiology, and Dr. Allyson Hall from Public Hea lth and Health Professions). Each has contributed uni quely to my progress at the University of Florida, and to this project especially. Fellow members of the Molecular Physiology Lab deserve special credit as they have endured me over the past several years. Without their selflessness in helping me, I would not have made it. Finally, and most importantly I wa nt to thank those closest to me In particular, my family and my wifes family have been supportive in ways beyond what I could have asked. My wife, Tiffany, and daughter, Alexandra, deserve never to have to go through this process again. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ............................................................................................................... 4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT ...................................................................................................................... ...............9 CHAPTER 1 INTRODUCTION ................................................................................................................ ..11 Background .................................................................................................................... .........12 Problem Statement ............................................................................................................. .....13 Variables in Study ............................................................................................................ .......13 Specific Aims and Hypotheses ...............................................................................................14 List of Terms ...........................................................................................................................15 Limitations/Delimitations/Assumptions .................................................................................16 Significance of the Study ........................................................................................................17 2 LITERATURE REVIEW .......................................................................................................18 Overview of Skeletal Muscle Fiber Type ...............................................................................18 Fiber Type Characteristics ...............................................................................................19 Nerve Activity .................................................................................................................19 Fiber Type Switching ......................................................................................................20 Nuclear Factor of Activated TCells and Skeletal Muscle .....................................................21 Activation of Calcineurin/NFAT Pathway ......................................................................21 Nuclear Factor of Activated T-Cell Signaling .................................................................22 Nuclear Factor of Activated T-Cell Intera ction with Other Transcription Factors .........24 Role of GSK-3 in NFAT Function ................................................................................24 Nitric Oxide ............................................................................................................................25 Introduction to NO ..........................................................................................................26 Nitric Oxide and Skeletal Muscle ....................................................................................26 Role of Nitric Oxide and AKT ........................................................................................27 Summary ....................................................................................................................... ..........28 3 MATERIALS AND METHODS ...........................................................................................29 Experimental Designs .......................................................................................................... ...29 Animals ....................................................................................................................... ............31 Protocol for Experiments 1 and 2 ...........................................................................................31 Transient Transfections ..........................................................................................................32 Immunohistochemistry .......................................................................................................... .32 5

PAGE 6

Chemicals and Reagents .........................................................................................................32 Cell Culture .............................................................................................................................33 Ribonucleic Acid Expression by RT-PCR .............................................................................34 Western Blotting .............................................................................................................. .......35 Statistical Analysis .......................................................................................................... ........36 4 RESULTS ..................................................................................................................... ..........37 Nuclear Factor of Activated T-Cell Activity Is Attenuated in Cultured Myotubes from NOS-/Mice ......................................................................................................................... 37 Nitric Oxide Synthase--/Mice Display Aberrant NF AT Function in Vivo ...........................38 Effect of NO on AKT Is Dose Dependent ..............................................................................38 Nitric Oxide -cGMP Pathway Phosphorylates AKT ..............................................................38 Nitric Oxide -cGMP Induced AKT P hosphorylation Is PI-3K-Dependent ............................39 Nitric Oxide Inhibits Protein Phosphatase Activity ................................................................39 5 DISCUSSION .................................................................................................................. .......57 Main Findings .........................................................................................................................57 Neuronal NOS and eNOS Are Necessary for NFAT Function ex Vivo ................................58 Nuclear Factor of Activated T-Cell Activ ity Can be Rescued With Pharmacological Manipulation in NOS-/Mice ..............................................................................................59 Low Levels of NO Induce Phosphorylation of AKT ..............................................................60 Nitric Oxide-induced AKT Activity Is cGMP Dependent .....................................................62 The NO-cGMP Pathway Activates the PI-3K/AKT Pathway ................................................62 Nitric Oxide Inhibits Protein Phosphatase Activity ................................................................63 Limitations and Future Directions ..........................................................................................64 Conclusions .............................................................................................................................65 LIST OF REFERENCES ...............................................................................................................66 BIOGRAPHICAL SKETCH .........................................................................................................73 6

PAGE 7

LIST OF TABLES Table page 3-1 Experiment 1. ............................................................................................................. ........29 3-2 Experiment 2. ............................................................................................................. ........29 3-3 Experiment 3. ............................................................................................................. ........30 3-4 Experiment 4. ............................................................................................................. ........30 3-5 Experiment 5. ............................................................................................................. ........30 3-6 Experiment 6. ............................................................................................................. ........31 4-1 Plantaris fiber type morphology for nNOS WT, nNOS -/-, eNOS WT, and eNOS -/mice as measured by percentage. .......................................................................................41 7

PAGE 8

LIST OF FIGURES Figure page 4-1 Representative immunoblots for nNOS and eNOS ...........................................................42 4-2 Myosin Heavy Chain I/ mRNA as quantified by RT-PCR ..............................................43 4-3 Representative immunoblots of NFAT nuclear/cytoplasmic ratio. ...................................44 4-4 Representative immunoblots of GSK-3 from nNOS-/-, eNOS-/and WT mouse myotubes. ..................................................................................................................... ......46 4-5 Representative immunoblots of AKT from nNOS-/-, eNOS-/and WT mouse myotubes. ..................................................................................................................... ......48 4-6 Representative image of fiber type analysis by immunohistochemical staining ...............50 4-7 Representative immunoblots of GSK-3 from plantaris homogenate ...............................51 4-8 Representative immunoblots of AKT from plantaris homogenate ....................................52 4-9 Representative immunoblots from SNAP dose response experiment ...............................53 4-10 Representative immunoblots showing NO induced AKT phsophorylation is cGMP dependent ...........................................................................................................................54 4-11 Representative immunoblots show ing NO induced AKT phsophorylation is cGMP/PI3K dependent ......................................................................................................55 4-12 Nitric Oxide is capable of i nhibiting protein phos phatase activity ....................................56 8

PAGE 9

Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NITRIC OXIDE FACILITATES NUCLEAR FACTOR OF ACTIVATED T-CELL (NFAT) ACTIVITY THROUGH AKT INDUCED GLYCOGEN SYNTHASE KINASE-3BETA (GSK-3Beta) PHOSPHORYLATION By Jason A. Drenning August 2008 Chair: David Criswell Major: Health and Human Performance Skeletal muscle is characte rized by different fiber type s including one slow (type 1/ ), and three fast (IIa, IIx, and IIb). These various phenotypes display contractile and biochemical properties responsive to alte red physiological demand. Activ ity induced increases in intracellular calcium transients facilitate slow phenotypic adaptations via activation of calcineurin and its downstream target, nuclear factor of activated t-cells (NFAT). Nitric Oxide (NO) is an important signaling molecule in skeletal muscle and is produced enzymatically by nitric oxide synthases (NOS). Our lab has recently shown that NO facilitates NFAT activity through the NO-cGMP driven inactiva tion of glycogen synthase kinase-3 (GSK-3 ) in C2C12 myotubes. While NOS activity seems to be necessary fo r the calcium induced effects on fiber type change in C2C12s, it is unknown whether NOS is neces sary for changes in adult skeletal muscle. Further, the pathway by which NOcGMP activity results in GSK-3 phosphorylation has not been clearly elucidated. Thes e experiments tested the central hypothesis that NO facilitates NFAT function by AKT-induced GSK-3 phosphorylation both in the C2C12 cell line, and in a genetic model. We tested this postulate by ad dressing two integrated sp ecific aims: 1) we 9

PAGE 10

10 determined that cultured myotubes and planta ris muscle from nNOS and eNOS knockout mice display altered NFAT func tion, and 2) we determined that AKT-induced GSK-3 phosphorylation explains a mechanism by whic h the NO-cGMP pathway affects NFAT in C2C12 myotubes. We investigated the role of NOS activity in NFAT function by ex vivo and in vitro methods using both an animal model and a myogenic cell line. Type II diabetes mellitus (DM2) is a gr owing disease population and is becoming increasingly costly due to associated health care costs. DM2 is characterized by insulin resistance and impaired glucose clearance which ha s been linked to reduced expression of slowoxidative muscle fibers. Skeletal muscle is responsible for most insulin-mediated glucose oxidation as muscle contractile activity augments glucose clearance by improving insulin sensitivity. Slow, type I/ muscle fibers, in particular, are characterized as insulin sensitive due to a proclivity for being metabolically active. Therefore, understanding the mechanism(s) that contribute to the activity-induced changes in muscle phenotype is important. Our proposed experiments can provide insight into potential therapeutic inte rventions for DM2 patients.

PAGE 11

CHAPTER 1 INTRODUCTION Skeletal muscle is responsible for most insulin-mediated glucose clearance in the body (DeFronzo et al. 1981; Devlin et al. 1987; Ivy & Holloszy, 1981; Katz et al. 1983; Larsen et al. 1997). There is considerable plasticity in skeletal muscle as chronic exerci se results in increased expression of slow, oxidative gene s giving muscle fibers an insu lin sensitive and metabolically active phenotype. Given the importance of understanding the mechanism(s) that contribute to fiber type switching and the potential role of nitric oxide (N O) to regulate the slow gene transcription factor NFAT, we postulate that NO is necessary for NFAT function both in vivo and in vitro. Previous work in our lab s uggests that NO is an importa nt signaling molecule in controlling skeletal muscle plastic ity downstream of calcium (Drenning et al. 2008). NO is produced enzymatically by nitric oxide synthase s (NOS). The isoforms eNOS and nNOS are calcium-sensitive and constituitively expressed in skeletal muscle. These enzymes synthesize NO at low levels associated with low frequency muscle activation. Our preliminary data shows that NOS activity results in i nhibitory phosphorylation of GSK-3 (in a NO-cGMP dependent manner) and subsequently enhances NFAT activit y but, the mechanism by which this occurs is unclear. Further, our data regarding NFAT is limited to C2C12 myotubes. Hence, these experiments will investigate NFAT function in vivo and in cultured myotubes from nNOS and eNOS knockout mice and examine the mechanism(s) by which NO inhibits GSK-3 in C2C12 myotubes. Our central hypothesis is that NO facilitates NFAT func tion by inhibiting GSK-3 in a cGMP/PI3K/AKT dependent manner. 11

PAGE 12

Background Adult vertebrate skeletal muscle consists of different fiber type s, one slow (type I/ ) and three fast (IIa, IIx, and IIb), which differ in th eir contraction speed, st rength, fatigability, and insulin sensitivity. Skeletal muscle exhibits a high degree of plas ticity with transformations in fiber type occurring in response to altered phys iological demand and contractile load (Chin et al. 1998; Schiaffino et al. 2007). Tonic, low-fre quency neural activity or electrical stimulation causes a shift from fast, glyc olytic fibers toward the sl ow, oxidative phenotype (Liu et al. 2005; Pette, 2001). The pathway by which low frequenc y muscle activation indu ces transcription of slow-twitch genes involves su stained calcium levels sufficient to stimulate calcineurin phosphatase activity (Dunn et al. 2001; Jiang et al. 2006; Wu et al. 2000). Dephosphorylation of the nuclear factor of activated t-cells (NFAT) transcription factors by calcineurin promotes its translocation from the cytoplasm to the nucleus where it will bind to a nucleotide recognition sequence and stimulate the transcripti on of target, slow-twitch genes (Chin et al. 1998; Kubis et al. 2003;). Although this pathway explains act ivity-induced activation of NFAT, overall transcriptional activity, and therefore fiber type change, is determined by the balance between activation and deactivation of th is transcription factor (Abbott et al. 1998; Delling et al. 2000). Recent studies suggest that GSK-3 synergistically regulates nuclea r export of NFAT in skeletal muscle fibers by phosphorylation of its serine residues (Jiang et al. 2006; Shen et al. 2007). Nitric Oxide (NO) is a ubiquitous signali ng molecule produced enzymatically by nitric oxide synthases (NOS). Recently, it has been repo rted that NO is required for NFATc3 nuclear accumulation in mouse cerebral arteries in response to increased intravascular pressure, and that this effect was dependent upon inhibition of NFAT nuclear export (Gonzalez-Bosc et al. 2004). NFAT has been shown to be an important transcription factor in skeletal muscle as its calcium/calcineurin induced nuclear translocat ion and accumulation stimulate the expression of 12

PAGE 13

slow genes, particularly MHC I/ (Meissner et al 2007). Further, our recent data confirm the role of NO in NFAT function as NOS activity has been shown to be necessary for NFAT translocation and tr anscription (Drenning et al 2008). Problem Statement A better understanding of how habitual physical activity can lead to changes in skeletal muscle gene expression has expanded our knowledge of the benefits of exercise. However, additional research is needed to provide a mo re comprehensive understanding of how chronic exercise improves fitness and decreases the risk of diabetes. In addition, more studies aimed at exploring the calcium-regulated si gnaling pathways and their mo lecular targets are needed. Work by numerous authors confirms that the tr anscription factor, NFAT is integral to calcium/calcineurin-induced fiber type changes in skeletal muscle. Given the importance of NO as an important signaling molecule capable of mediating NFAT in C2 C12 myotubes, we propose that NO is essential to NFAT function ex vivo and in vivo as well. We po stulate that removal of the NOS isoform in mice will resu lt in altered NFAT nuclear translocation and fiber type aberration. NO could exert its effects on NFAT by activating AKT in a cGMP/PI3K dependent manner, thereby allowing NFAT nuclear accumulation due to AKT induced GSK-3 phosphorylation (inactivation). Di scovery of the mechanism(s) th at regulate exercise-related fiber type changes could lead to therap ies with broad clinical application. Variables in Study Independent variables: Genetic manipulation of NOS expression will be achieved by purchasing homozygous mice harboring a targeted mutation of either the nNOS or eNOS gene. Knockout of the nNOS or eNOS protein, respec tively, was confirmed in skeletal muscles of these mice compared to control mice from the pa rent strain. Cultured m yotubes will be exposed 13

PAGE 14

to various pharmacological agents in the treatment medium (supplementing with A23187, LNAME, PAPA-NO, SNAP, ODQ, YC-1 and LY29004). Dependent variables: We will measure NFAT nuclear accumulation and translocation, GSK-3 phosphorylation, AKT phosphorylation, MHC I/ mRNA, protein phosphatase activity and muscle fiber type. Control variables: Only male C57 mice will be studied, so gender is purposely excluded from this study. Extraneous variables: We will not control prior activity level or food and water intake of the mice. However, this should not affect chr onic satellite cell/myotube cultures or the stable phenotype of the plantaris muscle. Specific Aims and Hypotheses Question 1: Do mice with targeted mutation of nNOS and eNOS have altered NFAT function in primary cultured myotubes and aber rant fiber type phenotype in the plantaris muscle? Hypothesis 1: nNOS and/or eNOS knockout mice disp lay altered NFAT function compared to wild type (WT) mice. In addition, AKT and GSK-3 phosphorylation is reduced, MHC I/ mRNA activity is lessened, and fiber type expression is aberrant in NOS knockout mice. Question 2: Does the NO-cGMP pathway inhibit GSK-3 by activating the PI3K/AKT pathway? Hypothesis 2: Low levels of NO induce phosphoryla tion of AKT, which inhibits GSK-3 in a cGMP/PI3K-dependent manner. Question 3: Does NO have the capacity to inhibit protein phosphatases? Hypothesis 3: The NO-cGMP pathway inhibits prot ein phophatase activity subsequently leading to AKT activation. 14

PAGE 15

List of Terms A23187 (calcimycin): calcium ionophore known to upregulate calcineurin and NFAT activity Calcineurin: protein phosphatase which dephosphorylates NFAT and induces nuclear translocation Calcium (Ca2+): essential element for cellular and molecular signaling in muscle Cyclic Guanosine Monophosphate (cGMP): synthesis of cGMP catalyzed by guanylate cyclase (GC); activated by, and often asso ciated with NO in the NO-cGMP pathway Endothelial Nitric Oxide Synthase (eNOS): NOS isoform present at low levels in all skeletal muscle fibers, co-localizing with mitochondrial markers and closely related to intracellular calcium levels and calmodulin binding Glycogen Synthase Kinase-3 (GSK-3 ): kinase which phosphorylates NFAT exporting it from the nucleus L-NAME (N (G)-nitro-L-arginine methyl ester) : NOS inhibitor capable of abrogating expression of all three NOS isoforms LY294002 (2-(4-Morpholino)-8-phenyl-4 H -1-benzopyran-4-one): po tent inhibitor of PI3K/AKT pathway Muscle Fiber Type: slowtwitch (Type I) fibers char acterized by slow contraction time, high resistance to fatigue and displaying insulin se nsitivity; fast-twitch (Type II) fibers identified by quick contraction time, low resistance to fatigue and insulin resistant Myosin Heavy Chain I/ : (MHC I/ ): fatigue-resistant isof orm most responsible for contracile force in skeletal muscle Neuronal Nitric Oxide Synthase: isoform located in the sarcolemma and closely related to intracellular calcium leve ls and calmodulin binding 15

PAGE 16

Nitric Oxide (NO): small, highly diffusible molecule synthesized by the enzyme nitric oxide sythase (NOS) from the conversi on of L-arginine to L-citrulline Nuclear Factor of Activated T-Cells (NFAT): important in skeletal muscle as transcription factor which contributes to the induction of slow genes ODQ (1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one): highly selective, irreversible, hemesite inhibitor of soluble guanylyl cyclase PAPA-NO (1-[N-(3-Ammoniopropyl)-N-(n-propyl )amino]diazen-1-ium-1,2-diolate): rapidly degraded NO donor with half life of releas e of 15 minutes Phosphoinositide-3 kinase (PI-3K): kinase which activates AKT Protein Kinase-B (AKT): kinase known to be ca pable of phosphorylating GSK-3 at serine-9 Type 2 Diabetes Mellitus (DM2): metabolic disorder primar ily characterized by insulin resistance, relative insulin defi ciency and hyperglycemia often managed by engaging in exercise YC-1 (3-(5hydroxymethyl-2furyl)-1-benzyl ind azole): NO independent activator of soluble guanylyl cyclase Limitations/Delimitations/Assumptions Limitations: The invasive nature of this study negates the use of human subjects. A mouse model has been selected because of the sim ilarities in structure a nd function of mouse and human skeletal muscle. Delimitations: Gender, age and species differences may exist in regard to signaling pathways and muscle fiber type. In our animal model, we have chosen to study young, male C57 mice. 16

PAGE 17

17 Assumptions: It is assumed that the specific NOS isoform deleted in each of the respective knockout mice is not e xpressed. Previous experiments have confirmed that nNOS and eNOS knockout mice do not express the genetically removed NOS isoform. Significance of the Study Type 2 diabetes mellitus is modulated therapeutically by regular exercise as muscle cells undergo phenotypic changes re sulting in insulin sens itive, metabolically ac tive skeletal muscle. Inactivity results in a shift towa rd an insulin resistant, metabolically inactive phenotype. Thus, there is a need for individuals susceptible to DM2 to remain active throughout life. This research will improve our knowledge of the mechanisms underlying the changes in skeletal muscle phenotype with chronic exerci se. We seek to better understand the signaling pathways responsible for these ph enotypic changes, and to explore the role of Nitric Oxide in skeletal muscle plasticity. This study will provid e insight into clinical therapies designed to improve skeletal muscle metabolic activity and provide potential soluti ons for DM2 mediation.

PAGE 18

CHAPTER 2 LITERATURE REVIEW Many studies have shown that skeletal muscle is responsible for most insulin-mediated glucose oxidation (DeFronzo et al. 1981; Devlin et al. 1987; Ivy et al. 1981; Katz et al. 1983; Larsen et al. 1997). Exercise improves muscle glucose clearance due to the chronic effect of activity on fiber type expression (Shiaffino et al. 2007). While the calcium/calcineurin related pathways have been well established as contribu ting to the shift in fibe r type toward a slow twitch, metabolically active phenotype, (Chin et al. 1998; Kubis et al. 2003; Naya et al. 2000 ) the role NO plays is unclear. To further unders tand the function of NO in fiber type related calcium signaling, this project examined the hyp othesis that NOS activity promotes NFAT by inhibiting GSK-3 in a cGMP/PI3K/AKT dependent manner. The background section of this proposal will discuss the importance of the proposed work and develop ideas behind our hypothesis based on our prior research and the work of others. The preliminary data section will provide evidence of th e feasibility of our proposed experiments. Overview of Skeletal Muscle Fiber Type The cells that make up skeletal muscle are known as myofibers. They are large multinucleated cells that often extend the entire length of individual muscles. These individual myofibers are expressed as different types and va ry in size, metabolic activity, and contractile function. These types are generally categorized into two groups. Slow fibers are characterized as type I, and fast fibers as type IIa, IIb, and IId/x. Thus, sk eletal muscle is comprised of numerous fiber types with different stru ctural and functional properties (Kraus et al. 1994; Williams & Kraus, 2005; Pette 2001). 18

PAGE 19

Fiber Type Characteristics Type I fibers are also known as slow oxida tive fibers and contain large numbers of oxidative enzymes and are envelope d by more capillaries than type II fibers. This phenotype also contains higher concentrations of myoglobin th an fast fibers. All of these characteristics allow for type I fibers to have a large capaci ty for aerobic metabolism and a high resistance to fatigue (Williams & Kraus, 2005). Further, these t ypes of cells have been shown to be insulin sensitive which contributes to the interest in understanding th e mechanism(s) underlying the therapeutic effectiveness of endurance exercise in mediating DM2 (Shiaffino et al. 2007). Type 2 fibers, or fast glyc olytic fibers have a smaller number of mitochondria, limited capacity for aerobic metabolism and are less fatigue re sistant than type I fibers. In contrast to slow oxidative fibers, fast glyc olytic fibers are less metabolically active and more insulin resistant (Pette, 2001). However, it should be noted that type IIa fibers can be viewed as an intermediate between type I and type IIb fibers. Chronic exercise or t onic neural stimulation induces an increase in the oxidati ve capacity of IIa fibers to the extent that their oxidative capacity reaches levels close to th at of type I fibers. Type IIb and type IId/x fibers are less efficient than the other fibers most likely due to high ATPase activity leading to greater energy expenditure per unit of work performed (Liu et al. 2005). Nerve Activity Skeletal muscle is a plastic tissue in the sense that it undergoes phenotypic changes based on the stress under which it is pl aced. Nerve activity has been shown by both nerve cross union and electrical stimulation studies to be able to induce fiber-type switching (Williams & Kraus, 2005). Phasic, high-frequency elec trical stimulation causes a shift from slow oxidative fibers to a fast, glycolytic fiber. Moto r neurons innervate skeletal m yofibers and determine the timing, intensity, and duration of each myofibrillar contraction (Shiaffino, 2007). The fiber-type profile 19

PAGE 20

of different muscles is largely influenced by th e pattern of nerve activ ity induced by the motor neuron (Williams & Kraus, 2005). This is important in exercise-related re search since different patterns of nerve activity can result in changes in muscle fiber type. The tonic pattern of contractions associated with e ndurance exercise has been shown to be helpful in reducing the risk of a number of diseases associated with inactivity, includ ing diabetes (Shiaffino, 2007). Fiber Type Switching A number of studies have described fiber type switchi ng based on the frequency of electrical stimulation. High frequency stimula tion results in a shif t in the direction: I IIa IId/x IIb (Shiaffino, 2007) and is similarly i nduced by inactivity. Fast to slow transformations (IIb IIxIIa I) occur by tonic low-frequency s timulation characteristic of the pattern induced by slow mot oneurons (Pette, 2001; Kraus et al. 1994). Ausoni et al. (1990) has shown that there are limitati ons to these transformations in rat skeletal muscle. Particularly, they observed th at fast fibers have the ability to shift from IIb IIxIIa. Slow fibers also seem to be limited as the same researchers saw adaptability in the range of I IIa IIx. Conflicting data with regard to the range of myofiber plasticity were published by Caiozzo et al. (1998). This group found that changes in th e thyroid state may extend the range of fiber type changes. They showed that MHC IIb can be enhanced in type I fibers by multiple factors. Specifically, both the effect of hyperthyroidism and inac tivity resulted in a shift from type I to type IIb MHC. Earlier data published by Kirshbaum et al. (1990) confirms the possibility of an expanded range with regard to IIb I fiber type changes. These researchers found that hypothyroidism in conjuction with chr onic low frequency stimulation resulted in a shift from type IIb to type I fibers. 20

PAGE 21

Fiber type changes seem to be influenced by the duration of stimulation as evidenced by looking at long term (2-4 mo) low frequency stimulation. Termin et al. (1989) stimulated fast twitch muscles in rats for 2 mo and did not obser ve a significant increas e in MHC I expression. However, Windisch et al (1998) performed a similar experiment, stimulating fast twitch muscles in rats for 4 mo and saw a fast to slow transformation. Further, type I fibers tend to disappear after long periods of inactivity. Expanding our understanding of how skeletal musc le responds to repeated bouts of activity can help in the prevention of diabetes and other chronic dise ases. Particularly, a greater knowledge of the molecular signaling pathways which serve as the mechanisms for the aforementioned plastic nature of muscle could lead to important biotechnological advances, potentially providing an alternative to physical activity. The molecu lar events pertinent to this study will be discussed below. Nuclear Factor of Activated T-Cells and Skeletal Muscle Nuclear factor of activated T-cells (NFAT) is a general name applied to a family of transcription factors shown to be expressed in a number of cells in the body. The NFAT transcription factor family consists of fi ve members: NFATc1, NFATc2, NFATc3, and NFATc4. All the NFAT isoforms are regulat ed by calcium signaling and stimulated by the protein phosphatase calcineurin (Rao et al. 1997). Activation of Calcineurin/NFAT Pathway Calcium signaling pathways dependent on nerve activity play a major role in the maintenance and modulation of muscle fiber-type (Crabtree, 1999; Naya et al. 2000; Pette & Vroba, 1999). These molecular pathways have b een studied extensively. Our laboratory has examined specifically the calcineur in/NFAT pathway. 21

PAGE 22

Tonic patterns of motor nerve activity promote changes in intracellular calcium that result in the activation of numerous molecular signaling pathways (Williams & Kraus, 2005). These pathways link changes in nerve activity to chan ges in gene expression wh ich establish myofiber diversity (Shiaffino et al. 2007). The calcineurin/NFAT pathway is an important mechanism which has been shown to affect fiber-type plasticity (Chin et al. 1998; Schultz & Yutzey, 2004; McCullagh et al. 2004; Fenyvesi et al. 2004), Rao et al. 1997; Ryder et al. 2001; Wu et al. 2000; Yan et al. 2001; Meissner et al. 2007; Fielder et al. 2002). This pathway is largely dependent on increases in intracellular calcium activity. Calc ium signaling is critical to NFAT activation because calmodulin, a well known calcium sensor prot ein, activates calcineuri n. Calcineurin is a calcium-dependent, serine/threonine protein phosphatase also know n as protein phosphatase-2B (PP2B). The signaling cascade modulated by calcineurin results in the nu clear translocation of the transcription factor, NFAT. Activated calcineurin dephosphor ylates the serine rich region and SP-repeats in the amino term ini of NFAT, resulting in a conf ormational change that exposes a nuclear localization signal resulting in NFAT nuclear import (Meissner et al. 2007). Generally, nuclear import of NFAT is opposed by maintenance kinases in the cytoplasm and export kinases in the nucleus. Export kinases such as GSK-3 must be inactivated for NFAT nuclear retention. Accordingly, a number of studies have shown that an increases in calcium transients phophorylates GSK-3 rendering it inactive and thus allo wing for NFAT nuclear accumulation (Jiang et al. 2006; Shen et al. 2007). The details of the rela tionship between NFAT and GSK-3 will be addressed in the sect ion entitled, Role of GSK-3 in NFAT Function below. Nuclear Factor of Activated T-Cell Signaling The importance of the transcription factors of the NFAT family as nerve activitydependent mediators in skeletal muscle has been demonstrated by numerous studies. Liu et al. (2001) has observed differences in nuclear and cytoplasmic NFATc1 localization based on 22

PAGE 23

muscle fiber type and neural stimulation in mice. Specifically, an NFATc1-GFP fusion protein expressed in isolated fibers in the flexor digitorum brevis (FDB) muscle was found to be predominantly cytoplasmic when unstimulated. The FDB typically displays fast-twitch glycolytic fibers and thus this study shows evid ence for these type of myofibers to have less nuclear NFAT particularly when inactive. Howe ver, in the same study, when exposed to a lowfrequency pattern of neural stimulation, the sa me NFAT-c1-GFP did indeed translocate to the nucleus demonstrating the pl asticity of myofibers. In a similar study, Tothova et al (2006) used an in vivo model to demonstrate that NFATc1-G FP is largely cytoplasmic in the fast twitch, tibialis anterior (TA) muscle. Further, they observed a predominantly nuclear localization of NFATc1 in the soleus, a slow twitch musc le. Additional experiments by this group demonstrated a rapid nuclear import of NFATc1 via low-frequency st imulation in the TA. Additional studies using NFAT reporters to monitor NFAT transcriptional activity have shown similar results. NFAT transcriptional activity is higher in slow twitch muscles and lower in fast twitch muscles. Also, when denerv ated, slow twitch muscle s have attenuated NFAT activity (Parsons et al. 2003). McCullagh et al (2004) observed an ability for denervated, slow twitch muscles to respond to stimulation by incr easing NFAT activity. However, this response could only be induced by continuous, low-freque ncy stimulation. Phasic, high-frequency firing patterns characteristic of fast motoneurons did not cause an increase in NFAT activity. Other approaches to studying NFAT used a constituitively active form for the purpose of transfection experiments. Part icularly, constituitively active NFATc1 has been shown to increase MHC I mRNA in regenera ting, denervated muscle (McCullagh et al. 2004). This phenomenon was limited to the soleus though, as regenerating extensor digitorum longus muscles did not show the same induction of MH C I expression. Interestingly, NFAT knockout 23

PAGE 24

mice have not been shown to have altered fiber type make-up. However, to date only NFATc2 and NFATc3 knockouts have been studied (Horsely et al. 2001; Kegley et al. 2001), strengthening the conclusion that the NFATc1 is oform is primarily responsible for fiber type regulation. Nuclear Factor of Activated T-Cell Int eraction with Other Transcription Factors Work has shown that NFAT transcriptional act ivity is dependent on interaction with other transcription factors. Meissner et al (2007) has recently described the assembly of a transcriptional complex including NFATc1, MyoD MEF2D, and the co-activator p300. This group observed that all these transcriptional factors assemble on the MHC I promoter region in response to calcium ionophore treatment, stim ulating the induction of the MHC I gene. The potential for NFAT interacting with AP-1 has been studied as well. AP-1, which is a co-factor known to inter act with NFAT in the induction of the immune response, may play an important role in working with NFAT in skeletal muscle. Kramer et al. (2007) have recently shown that ERK1/2 are activated during exercise and during contraction of isolated muscle. ERK1/2 has shown a propensity for regulating AP-1 and has been shown to induce MHC I expression in rat soleus muscle. Therefore, ER K1/2 and AP-1 may both interact with NFAT to allow for the induction of slow genes. Role of GSK-3 in NFAT Function Nuclear NFAT concentrations are depende nt on a balance between import and export (activation or deactivation). Kinase s are known to phosphorylate NFAT (Shen et al. 2007), cause its nuclear export (Gonzolez-Bosc et al. 2004), inhibit DNA binding (Jiang et al. 2006), and blunt its transact ivating potential (Shen et al. 2007). In skeletal muscle, a number of studies have shown that GSK-3 is most likely the kinase responsible for NFAT nuclear export. 24

PAGE 25

The protein kinase GSK-3 was originally discovered as a suppressor of glycogen synthase (Embi et al. 1980). GSK-3 has been shown to be involved in various metabolic and signaling pathways (Frame & Cohen, 2001). Recently, GSK-3 has been implicated as a negative regulator of both cardiac and skeletal muscle hypertrophy (Haq et al. 2000; Rommel et al. 2001) as well as muscle differentiation (van der Velden et al. 2007). Regulation of NFAT in skeletal muscle seems to be dependent on GSK-3 activation as Chin et al. (1998) demonstrated that phosphorylation of GSK-3 resulted in greater NFAT nuclear translocation. Other research groups have shown that active GSK-3 masks the nuclear localization signal, resulting in NFAT nuclear effusion and a s ubsequent decrease in gene transcription (Beals et al. 1997; Neal & Clipstone, 2001). Overexpression of GSK-3 in avian skeletal muscle prom otes nuclear export of NFAT while inhibition of GSK-3 augments NFAT transactivating potential and enhances MHC I/ expression (Jiang et al. 2006). We have shown that an NO donor induces inhibitory phosphorylation of GSK-3 (Drenning et al. 2008). Further, our lab has demonstrated that inhibition of GSK-3 by lithium chloride (LiCl) causes nuclear accumulation of NFATc1 and stimulates NFAT dependent transcription (Drenning et al. 2008). Additionally, these experiments have shown that the effects of LiCl on NFAT are not attenuated by the NO inhibitor L-NAME, suggesting that GSK-3 inhibition occurs downstream of NOS activity. However, the kinase involved in NO-dependent GSK-3 phosphorylation is unknown. Therefore, this study will focus, in part, on the pathway responsible for NO mediated GSK-3 phophorylation as discussed in the following section. Nitric Oxide This section will detail the role nitric oxide (NO) may play in affecting the calcineurin/NFAT pathway. First, the basis for the selection of NO as an important skeletal 25

PAGE 26

muscle signaling molecule to be studied will be disc ussed. Subsequently, the contribution of NO to the control of the calcineurin/NFAT pathway will be examined in detail. Introduction to NO NO is modulated biosyntheti cally by the family of enzymes known as NO synthases (NOS) which are homodimers. The generation of NO by these enzymes requires L-arginine, nicotamide adenine dinucleotide phosphate (NADPH) and oxygen, as well as, five other cofactors (flavin adenine nucleotide, flavin mononucleotide, tetrahydrobiopterin, heme, and calmodulin) (Reid, 1998). There are three known isoforms expressed by sk eletal muscle includ ing, nNOS, eNOS and iNOS. The particular isoform of nNOS in skeletal muscle is tissue specific, and is an alternatively spliced isoform sometimes referred to as nNOS. This isoform is targeted by the dystrophin-associated protein, 1-synrophin, and thus is located in the sarcolemma (Kaminski & Andrade, 2001). eNOS is also present at low leve ls in all skeletal musc le fibers, co-localizing with mitochondrial markers (Kaminski & Andrade, 2001). The activity of nNOS and eNOS is closely related to intracellular calcium levels and calmodulin binding. iNOS also displays a sarcolemmal localization and its act ivity varies in skeletal muscle depending on disease state and species investigated (Reid, 1998). Increases in cytokines often provide the stimulus for iNOS upregulation, and thus iNOS typically ex erts an antimicrobial action (Reid, 1998) Nitric Oxide and Skeletal Muscle NO has been found through numerous studies to be an important signaling molecule in muscle (Reid, 1998, Stamler & Meissner, 2001; Sugita et al. 2005; Nisoli et al. 2004). Endogenous production of NO via calcium-calmodulin-dependent NOS may play a role in skeletal muscle phenotypic plasticity. Also, stimulation of soluble guan ylate cyclase (sGC) and the resultant accumulation of cGMP mediates many of the signaling functions of NO and 26

PAGE 27

regulates complex signaling cascades through downstream effectors (Kelly et al. 2004; Lucas et al. 2000). We recently reported that NOS activity is necessary for overload-induced expression of MHC I/ mRNA in the rat plantaris (Sellman et al. 2006). Further data from our laboratory confirms these findings in C2C12 myotubes (Drenning et al. 2008). Additionally, GonzalezBosc et al. (2006) demonstrated that NO is required fo r NFATc3 accumulation in vascular tissue. Our preliminary data indicates that indeed NFAT function is enchanced by the NO-cGMP pathway in mouse myotubes (Drenning et al. 2008). However, further study of the mechanism by which NO affects skeletal muscle plasticity is needed. Therefore, it is important to understand the molecular pathway controlling NF AT activity downstream of NO. Further, similar ex vivo and in vivo experiments in nNOS and eNOS knockout mice are necessary to substantiate our previous fi ndings related to NO and NFAT. Role of Nitric Oxide and AKT As has been mentioned, numerous studies ha ve provided evidence wh ich suggest various molecular signaling pathways are in control of changes in skeletal muscle plasticity. Signaling molecules such as phosphatidylinos itol 3-kinase (PI3K) and AKT ha ve been studied mainly in the context of catabolic a nd anabolic processes (Stitt et al. 2004; Bodine et al. 2006). However, recently some of these molecules have been implicated as being involved in skeletal muscle metabolism as well (Jensen et al. 2007). Specifically, AKT and its downstream target GSK-3 have been examined (Jensen et al. 2007). AKT is known to phosphorylate GSK-3 at Ser9 rendering it inactive. Interestingly, it has b een shown recently that high, S-nitrosylation-like levels of NO can inactivate AKT (Bouallegue et al. 2007). However, low levels of NO in muscle may have the opposite effect on AKT. Skeletal muscle AKT activity increases in response to numerous stimuli, including hormones such as insulinlike growth factor (IGF -1) and insulin (Kimball et al. 2002; Bodine et 27

PAGE 28

28 al. 2006). IGF-1 binding to its receptor leads to the activation of its downstream target, PI3K, which facilitates the recruitment of AKT (Bodine et al. 2006). Recently, the necessity of NOS activity on IGF-1 receptor induced PI3K/ AKT activation has been studied (Chung et al. 2004). While this research group showed the possibility of NO activati ng IGF-1 receptor expression and subsequent PI3K/AKT activity in neurons, this pathway has not been explored in skeletal muscle. Another possible explanation fo r the effect of NO on AKT could be the role NO may play in inhibiting protein phosphata se activity. Mdx mice, which ar e known to have aberrant nNOS expression, exhibit high protein phosphatase-1 (PP1) and GSK-3 activity (Villa-Moruzzi et al. 1996). Tokui et al. 1996) has demonstrated that protein phosphatase inhibitor-1 (PPI-1) is a potent inhibitor of PP1 when phosphorylated by cGMP dependent kinase. Additionally, Ugi et al. (2004) has recently shown that protein phosphatase 2A (PP2A) is capable of inhibiting AKT. These findings all suggest that the NO-cGMP pa thway may be affecting AKT by decreasing the activity of certain protein phosphatases, thereby removing their inhibitory effect on AKT. Summary The continued expansion of the type II diabetes mellitus (DM2) epidemic can be greatly aided by researching exercise-related changes in skeletal muscle glucose tolerance and insulin sensitivity. By understanding the mechanisms behi nd why exercise is therapeutically successful in terms of DM2, intervention stra tegies can be better implemente d. In the regard, preliminary work in our laboratory has demonstrated that the signaling molecule NO is integral to the molecular adaptations experienced during exercise induced nerve activity in skeletal muscle (Sellman et al. 2006; Lira et al. 2007; Drenning et al. 2008). Since NO can facilitate NFAT function, determining the mechanisms by which this occurs is important. Similarly, exploring this model in vivo is integral to potential th erapeutic strategies ai med at alleviating DM2.

PAGE 29

CHAPTER 3 MATERIALS AND METHODS Experimental Designs This project was designed to answer the following questions with the accompanying experimental designs: Question 1. Do mice with nNOS and eNOS genetically silenced have alte red NFAT function? Experiment 1. Cultured myotubes from wild-type (WT) nNOS and eNOS knockout mice were treated for as follows: 1) Control (DMSO), 2) A23187 (0.4 M), or 3) PAPA-NO (1 M). MHC I/ mRNA (24h treatment), NFAT nuclear accumu lation (4h treatment), NFAT translocation, AKT phosphorylation (1h treatment) and GSK-3 phosphorylation (1h treatment) were measured. Table 3-1. Experiment 1. Animals Control A23187 (0.4 M) PAPA-NO (1 M) WT n=4 n=4 n=4 nNOS KO n=4 n=4 n=4 WT n=4 n=4 n=4 eNOS KO n=4 n=4 n=4 (n=number of cultures for each treatment) Experiment 2. Western blots for AKT and GSK-3 phosphorylation were run using muscle homogenate from the plantaris muscle of each animal. Also, the plantaris was used for immunohistochemical staining for det ecting fiber type differences. Table 3-2. Experiment 2. Animals Number of animals WT n=3 nNOS KO n=3 WT n=3 eNOS KO n=3 (n=number of muscles from each group) 29

PAGE 30

Question 2. Does the NO-cGMP pathway inhibit GSK-3 by activating the PI3K/AKT pathway? Experiment 3. C2C12 myotubes were cultured with varying concentrtations of the NO donor SNAP (1 M-1mM) for 1h. Western blots were run to measure AKT phosphorylation. Table 3-3. Experiment 3. Cell type Control 1 M 10 M 100 M 500 M 1mM C2C12 myotubes n=6 n=6 n=6 n=6 n=6 n=6 (n=number of cultures for each group) Experiment 4. C2C12 myotubes were cultured with the NO donor, PAPA-NO, the sGC inhibitor ODQ, and the sGC enhancer, YC-1 fo r 1h. Western blots were run to measure AKT phosphorylation. Table 3-4. Experiment 4. Cell type Control PAPA-NO 1 M PAPA-NO ODQ 10 M ODQ YC-1 200 M C2C12 myotubes n=6 n=6 n=6 n=6 n=6 (n=number of cultures for each group) Experiment 5. C2C12 myotubes were cultured with the NO donor, PAPA-NO, the sGC enhancer YC-1, and the PI-3K/AKT inhibitor LY294002 for 1h. Table 3-5. Experiment 5. Cell type Control PAPA-NO 1 M PAPA-NO LY29 1mM YC-1 200 M YC-1 LY29 1mM LY29 C2C12 myotubes n=6 n=6 n=6 n=6 n=6 n=6 (n=number of cultures for each group) Question 3. Does NO have the capacity to inhibit protein phosphatases? Experiment 6. C2C12 myotubes were cultured with the calcium ionophore A23187, the NO inhibitor, L-NAME, the NO donor, SNAP, the sG C inhibitor ODQ, and the sGC enhancer, YC1. A PnPP assay was used to dete ct protein phosphatase activity. 30

PAGE 31

Table 3-6. Experiment 6. Cell type Control A23187 0.4 M A23 LNAME LNAME SNAP Dose 1 M1mM SNAP Dose ODQ 10 M A23 ODQ ODQ YC-1 Dose 200 1mM C2C12 myotubes n=8 n=8 n=8 n=8 n=8 n=8 n=8 n=8 n=8 (n=number of cultures for each group) Animals Young C57 wild type, as well as, eNOS and nNOS knockout mice were used for experiments one and two. The animals were approximately 3-4 weeks old at the time of sacrifice. Hindlimb skeletal mu scle, excluding the plantaris, was pooled from 3 animals for each satellite cell isolation. All animals were housed at the Un iversity of Florida Animal Care Services Center according to guidelines set forth by the Institutional Animal Care and Use Committee. Protocol for Experiments 1 and 2 Myogenic cultures were prepared in para llel from WT and nNOS/eNOS knockout mice (C57), using 3 mice per isolation. Cells were is olated from soleus, gastrocnemius, tibialis anterior (TA), and quadriceps muscles after ca reful dissection of the muscles to minimize connective tissue contribution. Collected muscles were enzymatically dige sted, satellite cells released, and single cells cultured. Isolated cells were re-suspended from a pellet into serum-rich growth medium consisting of Dulbeccos mini mum essential medium (DMEM) supplemented with 25% fetal bovine serum (Hyclone, Logan, UT), 10% horse serum (Hyclone), 1% chicken embryo extract, and antibiotics. Cells were plated at a density of 105 cells per plate using 35-mm plates pre-coated with 2% gelati n. Myoblasts were trypsinized a nd passed to 6-well plates at 60% confluency. Cultures were maintained in a standard tissue cultu re, with fresh growth medium replaced following the first 3 days in cu lture and every 2 days thereafter, and were 31

PAGE 32

harvested, measured for protein content and we stern blots run according the cell culture and western blot methods described below. Transient Transfections C2C12 myotubes were terminally differe ntiated and transfected with the .4 g of the NFAT promoter plasmid, NFAT-GFP (2). The NFAT-GFP construct was prepared by fusing three tandem NFAT-binding site s with enhanced GFP cDNA. (Addgene plasmid 11107). The plasmid was complexed with Lipofectamine reagent (Invitrogen) and exposed to myotubes in serum-free DMEM for 24h. After transfection, cel ls were placed in 2% HoS media and cultures visualized by fluorescent microscopy before an d during treatment with the calcium ionophore, A23187, A23187 and the NOS inhibitor L-NAME, and L-NAME alone. Immunohistochemistry Histochemistry was done on serial cross-sections of frozen muscles th at will be collected on glass coverslips. Sections of the plantaris we re of 10M muscle thickness. Fiber types were determined by immunohistochemical analysis of serial sections using monoclonal antibodies specific for IIB [BF-F3 (53)], IIA [SC-71 (53)], and type I [A 4.840 (64)] myosin heavy chains. Type IIX fibers were identified on the basis of their l ack of reaction with these three antibodies. A variable percentage of muscle fibers were hybrid or intermediate types that contain more than one myosin isoform. Any IIB/IIX or IIX/IIA intermediate fibers were counted as IIB and IIA fibers, respectively, on the basis of their reaction with the IIBand IIA-specific antibodies, so the IIX fiber type excludes intermediate types. Hybrid fibers reacting with bo th type IIA and type I myosin antibodies were typed as IIA fibers. Chemicals and Reagents N(G)-L-nitro-arginine methyl ester (LNAME), 1H-[1,2,4]Oxadiazolo[4,3-a]quinoxalin-1one (ODQ), 3-(5'-hydroxymethyl-2'f uryl)-1-benzyl indazole (Y C-1), diethylenetriamine-NONO 32

PAGE 33

(DETA-NO), methylamine hexamethylene methylamine-NONO (MAHMA-NO), 2-(4Morpholinyl)-8-phenyl-4H-1-benzopyran-4-on e (LY294002) and 3-(2-Hydroxy-2-nitroso-1propylhydrazino)-1-propanamine-NONO (PAPA-NO) were obtaine d from Cayman Chemical (Ann Arbor, MI). Cell Culture Mouse C2C12 myoblasts were obtained fr om American Type Culture Collection (Manassas, VA) and cultured at 37C in 5% CO2 and 95% atmospheric air. Myoblasts were plated on 6-well collagen-coated plates and proliferated in Dulbeccos Modified Eagles Medium (DMEM) growth me dia (GM) containing 10% Fetal Bovine Serum (FBS) and 1% penicillin/streptomycin. For all Western Blots and RNA isolation, C2C12 myotubes were grown to 70-80% confluency, and differentiation induced by switching to medium containing 2% horse serum for 7 days. M yotubes were treated with one or more of the following chemicals in media containing 2% serum: LY294002, L-NAME, PAPA-NO, ODQ, YC-1. Whenever treatments were used in co mbination, inhibitors of NOS (L-NAME), PI3K (LY294002) and guanylate cyclase ( ODQ) were added 30 minutes pr ior to other treatments. Control groups were exposed to treatment vehicl es in concentrations equal to experimental groups. When harvesting for total protein extracts cells were washed twic e in ice-cold PBS and harvested in non-denaturing lysis buffer (NDL ) containing 1% v/v Triton X-100, 0.3M NaCl, 0.05M TRIS-Base, 5mM EDTA, 3.1M NaN3, 95m M NaF, 22M Na3VO4. For isolation of nuclear proteins, cells were harvested in ic e-cold PBS containing 1M Na3VO4 and 0.05% v/v protease inhibitors (catalog #p-8340) and 0.5% v/v phosphatase inhibitors (catalog #p-5726) from Sigma (Saint Louis, MO), centrifuged, a nd the resulting pellets treated with NE-PER nuclear and cytosolic extraction reagents according to the manufacturers procedures (Pierce Biotechnology Inc., Rockford, IL). Both NDL and NE-PER buffers contained 0.1% v/v protease 33

PAGE 34

inhibitors and 1% v/v phosphatase inhibitors from Sigma. For RNA, cells were harvested in Trizol Reagent (Life Tech, Carlsbad, CA) according to manufacturers instructions. Ribonucleic Acid Expression by RT-PCR Concentration and purity of the extracted R NA were measured spectrophotometrically at A260 and A280 in 1X TE buffer (Promega, Madi son, WI). Reverse transcription (RT) was performed using the SuperScript III First-Stra nd Synthesis System for reverse transcriptionpolymerase chain reaction (RT-PCR) according to the manufacturers instructions (Life Technologies, Carlsbad, CA). Reactions were carried out using 5 g of total RNA and 2.5 M oligo(dT)20 primers. First strand cDNA was treated with two units of RNase H and stored at 80 C. Primers and probes for MHC I/ (GenBank NM_012751,1m Assay # Rn00562597_m1) were obtained from the ABI Assays-on-Demand se rvice and consist of Taqman 5' labeled FAM reporters and 3' nonfluorescent que nchers. Primer and probe sequences from this service are proprietary and therefore, are not reported. Primer and probe sequences also consisting of Taqman 5' labeled FAM reporters and 3' non fluorescent quenchers for hypoxanthine guanine phosphoribosyl transferase (HPRT) were obtained from Applied Biosystems (Assays-by-Design) and are: Forward, 5'-GTTGGATACAGGCCAGACTTTGT-3'; Reverse, 5'AGTCAAGGGCATATCCAACAACAA -3'; Probe 5'-ACTTGTCTGGAATTTCA-3'. Quantitative real-time PCR was performed us ing the ABI Prism 7700 Sequence Detection System (ABI, Foster City, CA). Each 25 l PCR reaction will contai n 1 l of cDNA reaction mixture. In this technique, amplification of the fluorescently labele d probe sequence located between the PCR primers was monitored in r eal-time during the PCR program. The number of PCR cycles required to reach a pre-determined threshold of fluorescence (CT) was determined for each sample. Samples were quantifie d relative to the CT (using the 2 CT method, where 34

PAGE 35

CT is threshold cycle) (20) for a normalizing ge ne (HPRT) determined separately in the same sample. Western Blotting Protein concentrations were measured us ing the DC Protein Assay Kit (Bio-Rad Laboratories, Richmond, CA). Aliquots of cell lysates (8-15 g) were run in 4-20%, and 12% SDS-PAGE gels for phospho-AKT (pAKT), total AKT (AKT), phospho-GSK-3 (p-GSK-3 ), total GSK-3 (GSK), NFATc1, -actin and histone. Nuclear extracts (11 g) were run in 12% SDS-PAGE gels for NFAT blots. Protein was transferred to nitrocellulose membrane and blocked with Odyssey blocking buffer for 1 hour. The primary antibodies used were: pAKT1/2/3 (Ser-473): sc-7985-R (rabbit), 1:1000 dilution, AKT1/2 (N-19): sc-1619 (goat), 1:500 dilution, (Santa Cruz Biotec hnology, Santa Cruz, CA) p-GSK-3 (Ser-9): sc-11757 (goat), 1:1000 dilution, GSK-3 (H-76): sc-9166 (rabbit), 1:1000 dilution, (Santa Cruz Biotechnology, Santa Cruz, CA), NFAT c1 (F-1) sc-8405 (m ouse), 1:500 dilution, (Santa Cruz Biotechnology, Santa Cruz, CA), -actin (mouse), 1:4000 dilution, (Abcam Cambridge, MA) and anti-histone H2B, (rabbit), 1:5000 dilution (Upstate, Lake Plac id, NY). The membranes were incubated at 4C overnight in primary antibody diluted with Odyssey blocking buffer (LI-COR Biosciences, Lincoln NE), TBS and 0.01% Tween-20, then wash ed with TBS-T four times and incubated for 35 minutes in secondary antibody, Odyssey blocki ng buffer and TBS-T. Secondary antibodies used were: IRDye 800CW rabbit anti-goat, (L I-COR, 1:5000); IRDye 680 mouse anti-rabbit (LICOR, 1:2500); IRDye 680 rabbit anti-mouse, (LI-COR, 1:5000). Membranes were washed four times with TBS-T and once with TBS before be ing scanned and detected using the Odyssey infrared imaging system (LI-COR). 35

PAGE 36

36 Statistical Analysis Data were analyzed by a two-way ANOVA with Tukeys HSD post hoc test. Significance was established a priori at p<0.05. Values reported are means SEM.

PAGE 37

CHAPTER 4 RESULTS Nuclear Factor of Activated T-Cell Activity Is Attenuated in Cultured Myotubes from NOS-/Mice Immunoblots confirmed that nNOS and eNOS protein was undetectable in plantaris muscle of nNOS-/and eNOS-/mice, respectively (Figure 4-1). We found evidence of reduced NFAT function in cultured myotubes from both nNOS-/and eNOS-/mice. Specifically, baseline (i.e. in untreated control cultures) MHC I/ mRNA (Figure 4-2), NFAT nuclear accumulation (Figure 43), GSK-3 phosphorylation (Figure 4-4), and AKT phosphorylation (Figure 4-5) were all significantly lower in both transgenic models comp ared to WT mice. This was unexpected as we anticipated either nNOS-/or eNOS-/mice to display attenuated NFAT activity, but not both. Measurement of MHC I/ mRNA via RT-PCR showed that 24h treatment with the calcium ionophore, A23187 (0.4M) rescued the blunted NFAT effect in the NOS-/mice (Figure 4-2). However, A23187 did not enhance abrogated AKT or GSK-3 phosphorylation after 1h of treatment (Figures 4-4 and 4-5) or NFAT nuclear accumulation after 4h of treatment (Figure 4-3) in either nNOS-/or eNOS-/mice. Further, cultured myotubes from WT mice showed responsiveness to A23187. Tr eatment with the NO donor, PA PA-NO (1M), resulted in significant changes in MHC I/ mRNA, NFAT nuclear accumulation, GSK-3 phosphorylation, and AKT phosphorylation in both groups of WT mice, as well as, in both nNOS-/and eNOS-/mice, as anticipated. Our findings suggest that both nNOS and eNOS are necessary for NFAT activity, and may collaborate to produce physiologically significant levels of NO. However, the blunted effects from loss of either isoform can be rescued by extended exposure (24h) of myotubes to A23187, and by treatment with PAPA-NO (1h, 4h, and 24h). 37

PAGE 38

Nitric Oxide Synthase--/Mice Display Aberrant NFAT Function in Vivo Immunohistochemical staining of serial cross-sections of the pl antaris muscle for specific fiber types revealed that both nNOS-/and eNOS-/had significantly less Type I myofibers per cross sectional area (m2) (Table 4-1 and Figure 4-6). Also, plantaris homogenate from all four groups was used for western blotting to observe potential deficits in GSK-3 (Figure 4-7) and AKT phosphorylation (Figur e 4-8). Indeed, we di d see deficits in NOS-/mice compared to WT controls. Our findings suggest that both NOS isof orms found constitutively in skeletal muscle contribute to enhancing NFAT ac tivity and are necessary for nor mal fiber type distributions. Effect of NO on AKT Is Dose Dependent C2C12 myotubes treated with varying concentrations of the NO donor, SNAP (1M, 10M, 100M, 500M, and 1mM) for 1h showed th at low levels of NO (1M and 10M) cause phosphorylation (activation) of AKT (Figure 4-9). Conversely, high, S-nitrosylation-inducing levels of NO (500M and 1mM) result in less ph osphorylation of AKT. These results are in agreement with previously reported data by Boullegue et al. (2007) showing a similar dosedependent effect of NO in vascular smooth muscle. Nitric Oxide -cGMP Pathway Phosphorylates AKT Our lab has shown that NO is capable of inducing phosphorylation of GSK-3 in a cGMP dependent manner. In addition, our preliminary data indicate that AKT is necessary for NOcGMP-induced GSK-3 phosphorylation (unpublished data). Therefore, we sought to determine if the NO-cGMP pathway is responsible for the NO-induced AKT phosphorylation shown in experiment 3. Treatment of C2C12 myotubes with the NO donor, PAPA-NO, increased the ratio of phopho-/total-AKT by 2 fold (Figure 4-10). Co-treatment with the guanylate cyclase inhibitor, ODQ, completely prevented this effect. YC-1, which activates soluble guanylate 38

PAGE 39

cyclase (sGC) independent of NO (Kelly et al. 2004), also increased th e ratio of phospho-/total AKT by 2-fold demonstrating that activation of sGC is sufficient for this effect. Nitric Oxide -cGMP Induced AKT Ph osphorylation Is PI-3K-Dependent Next, we sought to determine if the NO-cGMP-induced effects on AKT, seen in experiment 4, were PI-3K-dependent. A common stimulator of AKT activity is PI-3K (Stitt et al. 2004). These kinases are often associated, acting as a mediator of insu lin or IGF-1 signaling. We found that treatment of myotubes with PAPA-NO, ODQ, and YC-1 produced effects similar to the previous experiment. Also, co-treatment of myotubes with PAPA-NO and the PI-3K inhibitor LY294002 resulted in no in crease in phosphor-/total AKT. (Figure 4-11). Thus, our findings indicate that the NO-cG MP pathway activates the PI-3K/AKT pathway, and that these pathways work in conjunction, providing a possi ble mechanism for the effect of NO on NFAT function seen in our previous work. Nitric Oxide Inhibits Protein Phosphatase Activity We hypothesized that NO may play a role in inhibiting protein phosphatase activity. Given the unknown mechanism by which the NO-cGMP pathway activates the PI-3K/AKT pathway, and the evidence in pr evious studies for NOS activit y being capable of inhibiting several protein phosphatases, we sought to dete rmine if NO is a general protein phosphatase inhibitor (Tokui et al. 1996; Ugi et al. 2004; Villa-Moruzzi et al. 1996). Further, PP2A has been shown to have an inhibitory effect on AKT. We performed a general protein phosphatase assay on protein lysates from C2C12 m yotubes treated with several pharm acological agents intended to determine if NOS and GC activity limit protein phosphatase activity. Our findings demonstrated that indeed NO does inhibit pr otein phosphatase activity, and doe s so through cGMP (Figure 412). Myotubes treated with the calcium ionopho re showed a significant increase in enzyme activity, while co-treament with the NO inhibitor, L-NAME prevented this effect. Low levels of 39

PAGE 40

the NO donor, SNAP (1M and 10M) resulted in an inhibitory effect on protein phosphatase activity below control levels. As concentratio ns of SNAP increased, the inhibitory effect lessened, demonstrating that high levels (500M and 1mM) were si milar to untreated myotubes. The sGC inhibitor, ODQ attenuated the inhibitory effect of SNAP. In addition, YC-1, at low levels, had a similar concentration-dependent e ffect as SNAP indicating a NO-cGMP-dependent mechanism by which NO inhibits protein phosphatase activity. 40

PAGE 41

Table 4-1. Plantaris fiber type morphology for nNOS WT, nNOS -/-, eNOS WT, and eNOS -/mice as measured by percentage. animals % type I % type IIa % t ype IIb/x % non-contractile tissue nNOS WT 11.1 30.4 40.3 19.1 nNOS -/5.9* 32.0 42.3 21.3 eNOS WT 13.4 29.2 36.8 22.1 eNOS -/6.9# 31.1 43.4 20.8 Values represent mean SEM. *Significantly di fferent from nNOS WT. #Significantly different from eNOS WT. 41

PAGE 42

Figure 4-1. Protein expression of neuronal nitric oxide synthase (nNOS) and endothelial nitric oxide synthase (eNOS). (A) Representati ve immunoblots from nNOS WT, nNOS-/-, eNOS WT, and eNOS-/primary myotubes. (B) Quantification of immunoblots for nNOS and eNOS. nNOS-/were compared to nNOS WT and eNOS-/to eNOS WT. Values represent mean SEM. *Significantly different from WT. 42

PAGE 43

43 Figure 4-2. MHC I/ mRNA expression in NOS-/mice. (A) Quantitativ e RT-real time PCR analysis of MHC I/ mRNA in total RNA isolated from nNOS-/and WT mouse myotubes (24h treatment). (B ) Quantitative RT-real time PCR analysis of MHC I/ mRNA in total RNA isolated from eNOS-/and WT mouse myotubes (24h treatment). Values represent mean SEM. = signi ficant difference from nNOS WT control and eNOS WT control respectively

PAGE 44

Figure 4-3. Protein expressi on of NFAT nuclear/cytoplasmic ratio. (A) Representative immunoblot of nuclear/cyt oplasmic NFAT from nNOS-/and WT mouse myotubes treated for 4h. (B) Quantification of imm unoblots for NFAT normalized to nNOS WT control. (C) Representative immunobl ot of nuclear/cytoplasmic NFAT from eNOS-/and WT mouse myotubes treated for 4h. (D) Quantification of immunoblots for NFAT normalized to eNOS WT control. Values represent mean SEM. = significant difference from nNOS WT cont rol and eNOS WT c ontrol respectively. 44

PAGE 45

Figure 4-3 Continued. 45

PAGE 46

Figure 4-4. Protein expre ssion of phospho/total GSK-3 (A) Representative immunoblot of GSK-3 from nNOS-/and WT mouse myotubes treated for 1h. (B) Quantification of GSK-3 immunoblots normalized to nNOS WT control. (C) Representative immunoblot of GSK-3 from eNOS-/and WT mouse myotubes treated for 1h. (D) Quantification of GSK-3 immunoblots normalized to eNOS WT control. Values represent mean SEM. = significant di fference from nNOS WT control and eNOS WT control respectively. 46

PAGE 47

Figure 4-4 Continued. 47

PAGE 48

Figure 4-5. Protein ex pression of phospho-/total AKT. (A) Representative immunoblot of AKT from nNOS-/and WT mouse myotubes treated fo r 1h. (B) Quantification of AKT immunoblots normalized to nNOS WT contro l. (C) Representative immunoblot of AKT from eNOS-/and WT mouse myotubes treated for 1h. (D) Quantification of AKT immunoblots normalized to eNOS WT control. Values represent mean SEM. = significant difference from nNOS WT control and eNOS WT control respectively. 48

PAGE 49

Figure 4-5 Continued. 49

PAGE 50

Figure 4-6. Immunohistochemical measurement of fiber type. (A ) Representative cross section of nNOS-/mouse plantaris muscle compared to WT. (B) Representative cross section of eNOS-/mouse plantaris muscle compared to WT. 50

PAGE 51

Figure 4-7. Plantaris homogenate pr otein expression of phospho-/total GSK-3 (A) Representative immunoblot of GSK-3 from nNOS-/and eNOS-/compared to respective WT mice. (B) Quantif ication of immunoblots for GSK-3 from nNOS-/and eNOS-/compared to WT control mice. Va lues represent mean SEM. = significantly different than respective WT control. 51

PAGE 52

Figure 4-8. Plantaris homogena te protein expression of phospho/total AKT. (A) Representative immunoblot of AKT from nNOS-/and eNOS-/compared to respective WT control. (B) Quantification of imm unoblots for AKT from nNOS-/and eNOS-/compared to WT control mice. Values represent mean SEM. = significantly different than respective WT control. 52

PAGE 53

Figure 4-9. Protein ex pression of AKT. (A) Representati ve immunoblot of phospho/total AKT from C2C12 myotubes treated with vary ing does of the NO donor, SNAP. (B) Quantification of immuoblots for phosphor/tota l AKT normalized to control. Values represent mean SEM. = significan tly different from control (0M). 53

PAGE 54

Figure 4-10. Protein expressi on of AKT. (A) Representative immunoblot of phospho/total AKT from C2C12 myotubes treated with the NO donor, PAPA NO, the sGC inhibitor ODQ, and the sGC enhancer YC-1. (B) Quantification of immunoblots for phospho/total AKT normalized to control. Values represent mean SEM. = significantly different from control (Con). 54

PAGE 55

Figure 4-11. Protein expression of AKT. (A) Representative immunoblot of phospho/total AKT from C2C12 myotubes treated with the NO donor, PAPA-NO, PI3K inhibitor LY29, sGC enhancer YC-1, and sGC inhibitor ODQ. (B) Quantification of immunoblots for phospho/total AKT normalized to control. Values represent mean SEM. = significantly different than control (Con). 55

PAGE 56

Figure 4-12. pNPP protein phosphatase activity assay. C2C12 myotubes were treated with or without the sGC inhibitor, ODQ, and with the NO donor, SNAP. at varying concentrations. Bars are representative of enzyme activity normalized to protein content. Values represent mean SEM. = significantly different than control (0M). 56

PAGE 57

CHAPTER 5 DISCUSSION Main Findings Although our previous work with regard to NO-cGMP mediated NFAT activity via GSK3 phosphorylation was novel, we so ught to extend our data from a myogenic cell line to a transgenic animal model, and to better unders tand the mechanism(s) by which the NO-cGMP pathway affects GSK-3 We used commercially available nNOS-/and eNOS-/mice (The Jackson Laboratory (Bar Harbor, ME) to determ ine both the ex vivo and in vivo effects of NO on NFAT function. Also, experiments in this study aimed at furthering our understanding of how NO inhibits GSK-3 were done in C2C12 myotubes. The ma in findings of this study are: 1) Both nNOS and eNOS are necessary for the ex vi vo facilitation of NFAT activity, as evidenced by attenuated MHC I/ mRNA, NFAT nuclear accumulation, GSK-3 phosphorylation and AKT phosphorylation in nNOS-/and eNOS-/mice; 2) With regard to NFAT activity, cultured myotubes from nNOS-/and eNOS-/mice did not show responsiveness to the calcium ionophore, A23187 (0.4M) at 1h and 4h. Nevertheless, MHC I/ mRNA is induced in nNOS-/and eNOS-/cultures after 24h of ionophore tr eatment. Further, the NO donor, PAPA-NO (1M) is capable of enhancing NFAT function, GSK-3 and AKT phosphorylation, and MHC I/ mRNA expression in myotube cultures from nNOS-/and eNOS -/mice. 3) nNOS and eNOS are both necessary for NFAT activity and fiber type re gulation in vivo as demonstrated by significant differences in Type I fibers, GSK-3 phosphorylation, and AKT phophorylation in nNOS-/and eNOS -/mice as compared to WT control mice. 4) NO inhibits GSK-3 in a cGMP/PI3K/AKT dependent manner, and the interaction of the NO-cGMP and PI3K/AKT pathways may be mediated by NO-dependent inhibi tion of protein phosphatases. 57

PAGE 58

Neuronal NOS and eNOS Are Necessary for NFAT Function ex Vivo Our first aim was directed at confirming the validity of our previously published data concerning NO and NFAT activity (Drenning et al. 2008). Also, we sought to determine which constituitive NOS isoform is responsible for th e effects of NO on NFAT in skeletal muscle. Unexpectedly, we found that both nNOS-/and eNOS-/mice display attenuated NFAT function compared to WT control mice in cultured myotube s. Experiments directed at measuring MHC I/ mRNA, NFAT nuclear accumulation, GSK-3 phosphorylation and AKT phosphorylation (Figures 4-2 to 4-5) all displayed similar resu lts suggesting that nNOS and eNOS are necessary collectively for NO-dependent NFAT activity. Other studies have looked specifi cally at the effect of chroni c exercise and nerve activity on nNOS and eNOS protein expression (Roberts et al. 1997; Balon & Nadler, 1997; Tidball et al. 2000). Both nNOS and eNOS are activated by interaction with calcium and calmodulin (Stamler & Meissner, 2001) and each have been shown to be increased with prolonged treadmill running in rats (Balon & Nadler, 1997; Tidball et al. 1998). However, most studies aimed at determining which NOS isoform is most responsive to nerve ac tivity, and subsequent calcium transient influx, have concluded that nNOS is more dominant than eNOS in affecting the molecular signaling pathways associated with NO in skeletal muscle (Reiser et al. 1997; Roberts et al. ; Reid et al. 1998; Stamler & Meissner, 2001). Inte restingly, our data shows that both nNOS and eNOS are necessary for calcium-induced NFAT function. NO bios ynthesis in skeletal muscle could be dependent on collaboration of the calcium-calmodulin dependent NOS isoforms (nNOS and eNOS) in generating an optimal am ount of NO to induce the effects on NFAT function observed in these experiments. Howeve r, this is the first study to imply that both nNOS and eNOS play a major role in skeletal muscle plasticity; our findings may be due to a number of factors: 1) The eNOS isoform, wh ile constituitive in skel etal muscle, has been 58

PAGE 59

difficult to localize and study due to its low level of expression; thus, eNOS may exert its effects at very low, undetectable physiological leve ls, possibly explaining nNOS predominance in previous findings. 2) The NOS proteins are among the most tightly regulated enzymes (Christopherson & Bredt, 1997), and it is unkn own how much NO needs to be produced to activate soluble guanylate cyclase optimall y, and subsequently the PI3K/AKT/GSK-3 pathway facilitating NFAT nuclear accumulation and slow gene induction. Our data suggest that both isoforms work collectively to produce the optim al amount of NO needed for NFAT function. 3) nNOS has been shown to increase in mice with age (Chang et al. 1996); the mice used for this study were young (3-4 weeks) and may have lower levels of nNOS as compared to adult mice used in other studies, providing another explanation for the similar effects observed in nNOS-/and eNOS-/mice. Nuclear Factor of Activated T-Cell Activity Can be Rescued With Pharmacological Manipulation in NOS-/Mice The NO donor, PAPA-NO (1M) rescued the attenuated NO pathway in both nNOS-/and eNOS-/mice. Treatment with PAPA-NO resulted in increased MHC I/ mRNA, NFAT nuclear accumulation, GSK-3 phosphorylation, and AKT phosphorylation in WT control mice, and the NOS-/mice (Figures 4-2 to 4-5). This corre lates with our previous work (Drenning et al. 2008) which showed a significant e ffect of PAPA-NO on GSK-3 phosphorylation in C2C12 myotubes. Treatment of cultured myotube s with the calcium ionophore, A23187 (0.4M) yielded conflicting results. Expe riments aimed at studying GSK-3 and AKT phosphorylation from myotubes treated with A23187 for 1h were not responsive in nNOS-/or eNOS-/mice. Similarly, immunoblots for NFAT nuclear accumulation, showed an inability for A23187 to increase nuclear NFAT at 4h in the NOS-/mice. However, myotubes from both nNOS-/and eNOS-/mice, treated for 24h, demonstrated a significant increase in MHC I/ mRNA. These 59

PAGE 60

loss of function and rescue experiments demonstrate that NO is an important signal for calciuminduced nuclear translocation of NFAT. However, the effect of A23187 may be time sensitive. Further, calcium-dependent activ ation of NOS does not fully acc ount for slow gene induction. Neuronal NOS and eNOS Are Necessary for NFAT Activity in Vivo To ensure that the effects of NO on NFAT function are not limite d to in vitro measures, we sought to determine whether NOS-/mice display aberrant NFAT activity in vivo. Our in vivo data confirms that both nNOS and eNOS are nece ssary for normal expression of Type I fibers as well as, GSK-3 and AKT phosphorylation in the pl antaris muscle of WT and NOS-/mice (Table 4-1 and Figures 4-6 to 4-8) As has been mentioned, the ro le of both isoforms as they pertain to NO-related signaling in skeletal musc le was unexpected. Interestingly, although other authors have suggested that basa l NOS activity is involved in fibe r type establishment (Stamler & Meissner, 2001), no one has reported fiber type differences in nNOS-/mice compared to WT mice. Also, no previous studies have re ported fiber type di fferences in eNOS-/mice. Hirschfield et al. (2000) report that soleus and diaphragm muscles from 6-8 week-old eNOS knockout mice exhibit essentially normal contractile characteris tics. This suggests that fiber type distribution may be normal at this age. However, several pot entially important differences exist between our study and that of Hirschfield et al. For instance, we studied plantaris muscle of 3-4 week-old mice from a different transgenic strain (Jacks on Labortory). We propose that either nNOS or eNOS ablation delays the development of slow-twitch fibers by interfering with NFAT signaling. However, this may not prevent the attainment of normal fiber type dist ribution as the animal reaches adulthood. Further study will be required to examine this possibility. Low Levels of NO Induce Phosphorylation of AKT In response to varying levels of NO, AKT phos phorylation was shown to be concentration dependent (Figure 4-9). These data confirm previous work from Bollegue et al. (2007) 60

PAGE 61

demonstrating that low levels of NO activate, and high levels of NO inhibit AKT in vascular smooth muscle cells. Our study provides evid ence of NOS-dependent AKT phosphorylation in C2C12 myotubes. Further, these data indicate a possible mechanism for the effect of NO on GSK-3 as AKT is capable of phosphorylating GSK-3 (Ser-9). Our data from the knockout mice imply that NOS isoform specificity may not play a role in NO/cGMP induced activation of the AKT. Previous work has established that both constituitive isoforms of NOS (nNOS and eNOS) sythesize NO at a low rate, resulting in nanomolar levels. Similarly, treatment with 1 M and 10 M of SNAP respectively, resulted in an increase in phosphor-total-AKT ratio. We did not measure NO concentration in the culture media during NO-donor treatments. However, base d on SNAP concentrati on, the half-life of NO in solution, and the half-life of NO rel ease from SNAP, we estimate that 1-10 M SNAP produces steady-state NO concentrations in the nM range. In addition, low levels of NO production by constituitive NOS appears to be a calcium-dependent process (Reid, 1998), which is consistent with our findings of NOS involve ment in calcium-dependent effects. Although we did not quantify which NOS isoform is responsible for the our prev ious data regarding NFAT in C2C12s, the effect of the calcium ionophore, A 23187, on NFAT function in our previous work is in accordance with both nNOS and eNOS regulat ing physiological levels of NO downstream of calcium. iNOS activity in skelet al muscle is observed in respons e to an inflammatory challenge, and produces NO at micromolar levels. It s eems likely that the treatment groups with high concentrations of SNAP (500 M and 1mM) could have caused S-nitrosylation-induced events similar to effects observed with iNOS induction, subsequently leading to a decrease in phosphortotal-AKT ratio. 61

PAGE 62

Nitric Oxide-induced AKT Ac tivity Is cGMP Dependent Stimulation of sGC and the resultant accu mulation of cGMP mediates many of the signaling functions of NO and regulates co mplex signaling cascades through immediate downstream effectors, including cGMP-dependent protein kinases, cGMP-regulated phosphodiesterases, and cyclic nucleo tide-gated ion channels (Lucas et al. 2000). Guanylate cyclases and cGMP-mediated signa ling cascades play a central role in the regulation of diverse physiological processes (Kelly et al. 2004; Lucas et al. 2000). Previous studies have shown that the NO-cGMP pathway can affect the phosphorylation of AKT (Boullegue et al. 2007) and our preliminary work (unpublished data) indicated th at AKT activity is necessary for NO-induced GSK-3 phosphorylation. In addition, our previous data show that the sGC inhibitor, ODQ, effectively blocks calcium-induced nuclear accumulation of NFATc1 and NFAT dependent transcription. Further, ou r lab has shown that GSK-3 phosphorylation is NO-cGMP-dependent in C2C12 myotubes. Therefor e, understanding the role of the NO-cGMP pathway on AKT phosphorylation is important for th is study as it provides a potential mechanism to explain our previous work (Drenning et al. 2008). To better understand the effect of NO on GSK-3 and subsequently NFAT, we designed this experiment expecting to observe NO-cGMP -dependent phosphorylation of AKT. Indeed, phospho-total-AKT ratio was increased by the NO donor, PAPA-NO, while the sGC inhibitor, ODQ, abrogated this effect (Figure 4-10). Si milar to our previous data, YC-1 induced phosphorylation of AKT. Taken toge ther, these data indicate that low levels of NOS activate AKT through the NO-cGMP pathway. The NO-cGMP Pathway Activates the PI-3K/AKT Pathway PI 3-kinases (PI-3K) have been linked to an extraordinarily diverse group of cellular functions, including cell growth, proliferation, di fferentiation, motility, survival and intracellular 62

PAGE 63

trafficking (Stitt et al. 2004). Many of these functions relate to the ability of cl ass I PI 3-kinases to activate AKT. PI-3K is also a key component of the insulin signaling pathway. Hence, there is great interest in the role of PI 3-kinase signaling in DM2. AKT is activated as a result of PI3kinase activity as AKT requires the formation of the PtdIns, P3 (or "PIP3") molecule in order to be translocated to the cell membrane (Stitt et al. 2004). At PIP3, AKT is then phosphorylated by another kinase called phosphoinositide dependent ki nase 1 (PDK1), and is thereby activated. The PI-3K/AKT signaling pathway has been shown to be required for an extremely diverse array of cellular activities. Our data is novel in that th is is the first study to show that the NO/cGMP pathway can activate the PI-3K/AKT pathway. We hypothesized that PI-3K is necessary for the effect of the NO/cGMP pathway on AKT phosphorylation. Our data confirm that NO activates AKT via a cGMP/PI-3K dependent pathway (Figure 4-11). The drug, LY294002 was us ed as it has been shown to be a potent inhibitor of the PI-3K/AKT pathway. Consiste nt with data from the previous experiment, PAPA-NO induced an increase in phospho-totalAKT ratio. Myotubes treated with PAPA-NO and LY294002 demonstrated that PI-3K is necessary for NO induced AKT phosphorylation. These data provide a further understanding of our previous data, but it re mains unclear how the NO-cGMP pathway activates the PI-3K pathway. Nitric Oxide Inhibits Protein Phosphatase Activity Although these data have provided insight into the mechanism(s) behind the role NO plays in mediating NFAT function, some questions rema in. Particularly, the mechanism of activation of the PI-3K/AKT pathway by the NO/cGMP pathwa y is unclear. In skeletal muscle, the PI3K/AKT pathway is induced in numerous ways. Some typical enhancer s of this pathway include hormones such as insulin-like gr owth factor (IGF-1) and insulin (Bodine et al. 2006; Kimball et al. 2002). IGF-1 binding to its receptor l eads to the activation of PI-3K which 63

PAGE 64

subsequently recruits AKT (Bodine et al. 2006). Chung et al. (2004) has recently shown that NO is necessary for IGF-1R activity. We proposed that NO is capable of inhibi ting protein phosphatase activity. Previous studies have shown that NO can inhibit specif ic protein phosphatases including PP1 and PP2A (Tokui et al. 1996; Ugi et al. 2004; Villa-Moruzzi et al. 1996). We expect ed, in a general protein phosphatase assay, to see inhibition of phosphatase activity by NO in a cGMP-dependent manner. Our data confirms this hypothesi s as pharmacological manipulation of C2C12 myotubes with a number of drugs showed that phosphatase activity was inhibited by the NO/cGMP pathway (Figure 4-12). Interestingl y, dose responses were seen both by the NOdonor SNAP, and the sGC enhancer YC-1. Both drugs inhibited phosphatase activity at low levels, and were not significantl y different than the untreated c ontrol group at high levels. This data implies again that low levels of NO have physiogical effects, and high levels do not. Limitations and Future Directions The selection of treatment times for cultu red myotubes were based on optimal times reported in other studies. Also, we wanted to ex tend our previous studies in a myogenic cell line, to a transgenic animal model. Therefore, we chose to treat myotubes for 1h for the phosphorylation experiments, 4h for the NFAT nuclear accumulation experiment, and 24h for the MHC I/ just as we did in our previous work (Drenning et al. 2008). This did not affect our data regarding the NO donor, PAPA-NO, but we did see a discrepancy in the results from myotubes treated with A23187. Therefore, the effect of NOS ab lation on myotube responses to calcium ionophore treatment may be time dependent. We did not measure NO activity via DAF -FM fluorometric analysis in the NOS-/or in the WT mice. Our results suggest that when bot h nNOS and eNOS are pr esent, physiologically significant levels of NO are produced, which would be expected in the WT mice. However, we 64

PAGE 65

65 are unsure of the difference in NO production in the nNOS-/and eNOS-/mice. Future studies should seek to understand better the details of the amount of NO needed to enhance NFAT function. Lastly, we did not do any in vivo measurement in muscles other than the plantaris muscle. Since the plantaris is predominantly a type II mu scle, we are unsure as to the levels of GSK-3 and AKT phosphorylation in other fiber types in NOS-/mice. Also, our fiber type data is limited to the plantaris muscle, thus the fiber type differences observed may not be present in other muscles. Conclusions Although the present study doe s not provide evidence for the specific NOS isoform responsible for enhanced NFAT activity, we do demonstate that NO is necessary for NFAT function ex vivo and in vivo. Ba sed on our data, both nNOS and eNOS may work together to produce an optimal amount of NO to exert its downstream molecu lar signaling effects. We conclude that the NO-cGMP pathway activat es the PI3K/AKT pathway through protein phosphatase inhibition, and leads to GSK-3 phosphorylation, thus facilitating NFAT activity and leading to slow gene induction.

PAGE 66

LIST OF REFERENCES Abbott, KL, Friday BB, Thaloor D, Murphy J & Pavlath GK (1998). Ac tivation and cellular localization of the cyclosporine A-sensitive tran scription factor NFAT in skeletal muscle cells. Mol Biol Cell 9, 2905-2916. Aramburu J, Yaffe MB, Lopez-Rodriguez C, Can tley LC, Hogan PG & Rao A (1999). Affinitydriven peptide selection of an NFAT inhibi tor more selective than cyclosporine A. Science 285, 2. Attie AD & Kendziorski CM (2003). PGC-1 at the crossroads of type 2 diabetes. Nature Genetics 34, 244-245. Ausoni S, Gorze L, Schiaffino S, Gundersen K & Lomo T (1990). Experssion of myosin heavy chain isoforms in stimulated fast and slow rat muscles. J Neurosci 10, 153-160. Balon TW & Nadler JL (1997). Evidence that nitric oxide increases glucose transport in skeletal muscle. J Appl Physiol 82, 359-363. Beals CR, Sheridan CM, Turck CW, Gardner P & Crabtree GR (1997). Nuclear export of NFAT-c enhanced by glycogen synthase kinase-3. Science 275 1930-1934. Bodine SC (2006). mTOR signaling and the molecular adaptation to resistance exercise. Med Sci Sports Exerc 38, 1950-1957. Bouallegue A, Daou GB & Srivas tava AK (2007). Nitric oxide attenuates endothelin-1-induced activation of ERK1/2, PKB and Pyk2 in vascul ar smooth muscle cells by a cGMP-dependent pathway. Am J Physiol Heart Circ Physiol 293, 2072-9. Butler R, Morris AD & Struthers AD (1998). Systemic nitric oxide synthase inhibition increases insulin sensitivity in man. Clin Sci 94 175-180. Caiozzo VJ, Baker MJ & Baldwin KM (1998). Nove l transitions in MHC isoforms: separate and comined effects of thyroid horm one and mechanical unloading. J Appl Physiol 85, 22372249. Chang WJ, Iannaccone ST, Lau KS, Masters BS, McCabe TJ, McMillan K, Padre RC, Spencer MJ, Tidball JG & Stull JT (1996). Neuronal ni tric oxide synthase and dystrophin-deficient muscular dystrophy. Proc Natl Acad Sci USA 93, 9142-9147. Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C., Shelton JM, Wu H, Zhu W, BasselDuby R & Williams RS (1998). A calcineurin-dep endent transcriptional pathway controls skeletal muscle fiber type. Genes and Development 12, 2499-2509. Chung YH, Joo KM, Nam RH, Lee WB, Lee KH & Ch a CI (2004). Region-sp ecific alterations in insulin-like growth factor-1 receptor in the central nervous sy stem of nNOS knockout mice. Brain Research 1021, 132-139. 66

PAGE 67

Crabtree GR (1999). Generic signals and specific outcome s: signaling through Ca(2+), calcineurin, and NFAT. Cell 96, 611-614. Christopherson KS & Bredt DS (1997). Nitric oxid e in excitable tissues: Physiological roles and disease. J Clin Invest 100 2424-2429. DeFronzo RA, Jacot E, Jequeir E, Maeder E, Wahren J & Felber F (1981). The effect of insulin on the disposal of intravenous glucose. Diabetes 30, 1000-1007. Delling U, Tureckova J, Lim HW, De Windt LJ, Rotwein P & Molkentin JD (2000). A calcineurin-NFATc3-dependent pa thway regulates skeletal musc le differentiation and slow myosin heavy-chain expression. Mol Cell Biol 20, 6600-6611. Devlin JT, Hishman M, Horton ED & Horton ES (1987). Enhanced peripheral and splanchnic insulin sensitivity in NIDDM men after single bout of exercise. Diabetes 36, 434-439. Drenning JA, Lira VA, Simmons CG, Soltow QA, Sellman JE & Criswell DS (2008). Nitric Oxide facilitates NFAT-dependent tr anscription in mouse myotubes. Am J Physiol Cell Physiol (Epub ahead of print). Dunn SE, Simard AR, Bassel-Duby R, Williams RS & Michel RN (2001). Nerve activitydependent modulation of calcineur in signaling in adult fast and slow skeletal muscle fibers. J Biol Chem 276, 45243-45254. Embi N, Rylatt DB & Cohen P (1980). Glycogen s ynthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent pr otein kinase and p hosphorylase kinase. Eur J Biochem 107, 519-527. Eyre H, Kahn R, Robertson RM, Clark NG, Doyl e C, Hong Y, Gansler T, Glynn T, Smith RA, Taubert K & Thun MJ (2004). Preventing cancer, cardiovascular diseas e and diabetes: a common agenda for the American Cencer Soci ety, the American Diabetes Association, and the American Heart Association. Circulation 109 3244-3255. Fenyvesi R, Raez G, Wuytack F & Zador E ( 2004). The calcineurin activity and MCIP1.4 mRNA levels are increased by innerva tion in regenerating soleus muscle. Biochem Biophys Res Commun 320, 599-615. Fiedler B, Lohmann SM, Smolenski A, Linnemull er S, Pieske B, Schroder F, Molkentin JD, Drexler H & Wollert KC (2002). Inhibition of calcineurin-NFAT hypertrophy signaling by cGMP-dependent protein kinase type I in cardiac myocytes. Proc Natl Acad Sci U S A 99, 11363-11368. Frame S & Cohen P (2001). GSK3 takes centre st age more than 20 years after its discovery. Biochem J 359 1-16. 67

PAGE 68

Gonzalez-Bosc LV, Wilkerson MK, Bradley KN, Eckman DM, Hill-Eubanks DC & Nelson MT (2004). Intraluminal pressure is a s timulus for NFATc3 nuclear accumulation. J Biol Chem 279, 10702-10709. Haq S, Choukroun G, Kang ZB, Ranu H, Matsui T, Rosenzweig A, Molkentin JD, Alessandrini A, Woodgett J, Hajjar R, Michael A & Force T (2000). Glycogen synthase kinase-3beta is a negative regulator of cardiomyocyte hypertrophy. J Cell Biol 151, 117-130. Horsley V, Friday BB, Matteson S, Kegley KM Gephart J & Pavlath GK (2001). Regulation of the growth of multinucleated muscle cel ls by an NFATC2-dependent pathway. J Cell Biol 153, 329-338. Hirschfield W, Moody MR, OBrien WE, Gregg AT, Bryan RM Jr & Reid MB (2000). Nitric oxide release and contractile properties of skeletal muscles from mice deficient in type III NOS Am J Physiol Regulatory Integrative Comp Physiol 278 R95-R100. Ivy JL & Holloszy JO (1981). Persistent increas e in glucose uptake by rat skeletal muscle following exercise. Am J Physiol 241, C200-C203. Jensen J, Brennesvik EO, Lai YC & Shepherd P (2007). GSK-3 regulation in skeletal muscles by adrenaline and insulin: Ev idence that PKA and PKB regul ate different pools of GSK-3 Cellular Signalling 19, 204-210. Jiang H, Li H & DiMario JX ( 2006). Control of slow myosin h eavy chain 2 gene expression by glycogen synthase kinase activity in skeletal muscle fibers. Cell Tissue Res 323, 489-494. Kaminski HJ & Andrade FH (2001). Nitric oxide: Biologic effects on muscle and role in muscle diseases. Neuromuscular Disorders 11, 517-524. Katz LD, Glickman MG, Rapoport S, Ferrannini E & DeFronzo RA (1983). Splanchnic and peripheral disposal of oral glucose in man. Diabetes 32, 675-679. Kegley KM, Gephart J, Warren GL & Pavlat h GK (2001). Altered primary myogenesis in NFATC3-/mice leads to decreased muscle size in the adult. Dev Biol 232 115-126. Kelly LK, Wedgwood S, Steinhorn RH & Black SM (2004). Nitric oxide decreases endothelin-1 secretion through the activation of soluble guanylate cyclase. Am J Physiol Lung Cell Mol Physiol 86, 984-91. Kimball SR, Farrell PA & Jefferson LS (2002). Invi ted review: role of insulin in translational control of protein synthesis in skeletal muscle by amino acids or exercise. J Appl Physiol 93, 1168-1180. Kirshbaum BJ, Kucher HB, Termin A, Kelly AM & Pette D (1990). Antagonistic effects of chronic low frequency stimulation and thyroi d hormone on myosin expression in rat fasttwitch muscle. J Biol Chem 265, 13974-13980. 68

PAGE 69

Kramer HF, & Goodyear LJ. Exercise, MAPK, a nd NF-kappaB signaling in skeletal muscle. J Appl Physiol 103, 388-395. Kraus WE, Torgan CE & Taylor DA (1994). Sk eletal muscle adaptation to chronic lowfrequency motor nerve stimulation. Exerc Sport Sci Review 50, 313-360. Kubis HP, Hanke N, Scheibe RJ, Meissner JD & Gros G (2003). Ca2+ transients activate calcineurin/NFATc1 and intiate fast-to-slow tr ansformation in a primary skeletal muscle culture. Am J Physiol Cell Physiol 285 c56-c63. Larsen JJS, Dela F, Kjaer M & Galbo H (1997). The effect of moderate exer cise on post prandial glucose homeostasis in NIDDM patients. Diabetologia 40, 447-453. Lira VA, Soltow QA, Long JH, Betters JL, Sellm an JE & Criswell DS (2007). Nitric oxide increases GLUT4 expression and regulates AMPK signaling in skeletal muscle. Am J Physiol Endocrinol Metab 293, E1062-E1068. Liu Y, Cseresnyes Z & Randall WR (2001). Activity dependent nuclear translocation and intranuclear distribution of NFATc in adult skeletal muscle fibers. J Cell Biol 155, 27-39. Liu Y, Shen T, Randall WR & Schneider MF (2 005). Signaling pathways in activity-dependent fiber type plasticity in adult skeletal muscle. J Muscle Res Cell Motil 26, 13-21. Lucas KA, Pitari GM, Kazerounian S, Ruiz-Stewart I, Park J, Schulz S, Chepenik KP & Waldman SA (2000). Guanylyl cyclas es and signaling by cyclic GMP. Pharmacol Rev 52, 375-414. McCullagh KJ, Calabria E, Pallafacchina G, Cici liot S & Serrano AL (2004). NFAT is a nerve activity sensor in skeletal muscle and controls activity-dependent myosin switching. Proc Natl Acad Sci 101, 105900-105905. Meissner JD, Umeda PK, Chang, KC, Gros G & Scheibe RJ (2007). Activation of the myosin heavy chain promoter by MEF-2D, MyoD, p300 and the calcineurin/NFATc1 pathway. J Cell Physiol 211, 138-148. Naya FJ, Mercer B, Shelton J, Richardson JA, Williams RS & Olson EN (2000). Stimulation of slow skeletal muscle fiber gene expression by calcineurin in vivo. J Biol Chem 275, 45454548. Neal JW & Clipstone NA (2001). Glycogen synthase kinase-3 inhibits the DNA binding activity of NFATc. J Biol Chem 276, 3666-3773. Nisoli E, Falcone S, Tonello C, Cozzi V, Palomb a L, Fiorani M, Pisconti A, Brunelli S, Cardile A, Francolini M, Cantoni O, Carruba MO, Moncada S & Clementi E (2004). Mitochondrial biogenesis by NO yields functionall y active mitochondria in mammals. Proc Natl Acad Sci USA 101, 16507-12. 69

PAGE 70

Oberbach A, Bossenz Y, Lehmann S, Niebauer J, Adams V, Paschke R, Schon MR, Bluher M & Punkt K (2006). Altered fiber dist ribution and fiber-specific glyc olytic and oxidative enzyme activity in skeletal muscle of patients with type 2 diabetes. Diabetes Care 29, 895-900. Parsons SA, Wilkins BJ, Bueno OF & Molkentin JD (2003). Altered skeletal muscle phenotypes in calcineurin Aalpha and Abeta gene-targeted mice. Mol Cell Biol 23, 4331-4343. Pette D (2001). Cellular and molecular divers ities of mammalian skel etal muscle fibers. J Appl Physiol 90, 1119-1124. Pette D & Vrbova G (1999). What odes chronic electrical stimulation te ach us about muscle plasticity? Muscle Nerve 22, 666-667. Rao KM, Wentworth BM, Rosenthal N & Vill-Kom arolf L (1997). Transcri ption factors of the NFAT family: regula tion and function. Annu Rev Immunol 15, 707-747. Reid MB (1998). Role of nitric oxide in skelet al muscle: synthesis, di stribution and functional importance. Acta Physiol Scand 162, 401-409. Reiser PJ, Kline WO & Vaghy PL (1997). Inducti on of neuronal type nitr ic oxide synthase in skeletal muscle by chronic el ectrical stimulation in vivo. J Appl Physiol 82 1250-1255. Roberts CK, Barnard RJ, Scheck SH & Balon TW (1997). Exercise-stimulated glucose transport in skeletal muscle is nitric oxide dependent. Am J Physiol 273, E220-E225. Rommel C, Bodine SC, Clarke BA, Rossman R, Nunez L, Stiff TN, Yancopoulos GD & Glass DJ (2001). Mediation of IGF-1-induced sk eletal myotube hypertrophy by PI3K/AKT/mTOR and PI3K/AKT/GSK3 pathways. Nat Cell Biol 3, 1009-1113. Roy D, Perreault M & Marette A (1998). Insulin stimulation of glucos e uptake in skeletal muscles and adipose tissues in vivo is NO dependent. Am J Physiol Endocrinol Metab 274, E692-E699. Ryder JW, Bassel-Duby R, Olson EN & Zierath JR (2001). Skeletal muscle reprogramming by activation of calcineurin improves insulin action on metabolic pathways. J Biol Chem 278, 44298-44304. Schiaffino S, Sandri M & Murgia M (2007). Activ ity dependent signaling pathways controlling muscle diversity and plasticity. Physiology 22, 269-278. Schultz RA & Yutzey KE (2004). Calcineurin si gnaling and NFAT activation in cardiovascular and skeletal muscle development. Genes Dev 12 2499-2509. Sellman JE, DeRuisseau KC, Betters JL, Lira VA, Soltow QA, Selsby JT & Criswell DS (2006). In vivo inhibition of nitric oxide synthase im pairs up regulation of contractile protein mRNA in overloaded plantaris muscle. J Appl Physiol 100, 258-265. 70

PAGE 71

Shen T, Cseresnyes Z, Liu Y, Randall WR & Schneider MF (2007). Regul ation of the nuclear export of the transcriptio n factor NFATc1 by protein kinases after slow fiber type electrical stimulation of adult mouse skeletal muscle fibers. J Physiol 579, 535-551. Stamler JS & Meissner G (2001). Physiology of nitric oxide in skeletal muscle. Physiol Rev 81, 209-237. Stitt TN, Drujan D, Clarke BA, Panaro F & Timofeyva T (2004). The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-i nduced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell 14, 395-403. Sugita H, Fujimoto M, Yasukawa T, Shimizu N, Sugita M, Yasuhara S, JeevendraMartyn JA & Kaneki M (2005). Inducible nitric-oxide s ynthase and NO donor induce insulin receptor substrate-1 degradation in skeletal muscle cells. J Biol Chem 280,14203-14211. Termin A, Staron RS & Pette D (1989). Changes in myosin heavy chain isoforms during chronic low-frequency stimulation of rat fast hindlimb muscles. A single-fiber study. Eur J Biochem 186, 749-754. Tidball JG, Lavergna E, Lau KS, Spencer MJ, Stull JT & Wehling M (1998). Mechanical loading regulates NOS expression and activity in developing and adult skeletal muscle. Am J Physiol Cell Physiol 275 C260-C266. Tokui T, Brozovich F, Ando S & Ikebe M (1996). Enhancement of smooth muscle contraction with protein phosphatase inhibi tor 1: activation of inhibitor 1 by cGMP-dependent protein kinase. Biochem Biophys Res Commun 220, 777-83. Tothova J, Blaauw B, Pallafacchina G, Rudolf R, Argentini C, Reggiani C & Schiaffino S (2006). NFATc1 nucleocytoplasmic shuttling is controlled by nerve activity in skeletal muscle. J Cell Sci 119, 1604-1611. Ugi S, Imamura T, Maegawa H, Egawa K, Yoshi zaki T, Shi K, Obata T, Ebina Y, Kashiwagi A & Olefsky JM (2004). Protein phosphatase-2A negatively regulates insulins metabolic signaling pathway by inhibiting AKT ac tivity in 3T3-L1 adipocytes. Mol Cell Biol 19, 877889. Van der Velden J, Schols A, Wilems J, Ke lders M & Langen R (2007). Glycogen Synthase Kinase 3 suppresses myogenic differentiation th rough negative regulat ion of NFATc3. J Biol Chem 283, 358-366. Villa-Moruzzi E, Puntoni F & Marin O (1996). Activation of protein phosphatase-1 isoforms and GSK-3 in muscle from mdx mice. Int J Biochem Cell Biol 1, 13-22. Williams RS & Kraus WE (2005). Exercise an d Health: Can biotechnology confer similar benefits? PLoS Med 2, 209-212. 71

PAGE 72

72 Windisch A, Gundersen K, S zabolcs MJ, Gruber H & Lomo T (1998). Fast to slow transformation of denervated and el ectrically stimulated rat muscle. J Physiol 510, 623-632. Wu H, Naya FJ, McKinsey TA, Mercer B, Sh elton JM, Chin ER, Simard AR, Michel RN, Bassel-Duby R, Olson EN & Williams RS ( 2000). MEF2 responds to multiple calciumregulated signals in the control of skeletal muscle fiber type. EMBO J 19, 1963-1973. Yan Z, Serrano AL, Schiaffino S, Bassel-Duby & Williams RS (2001). Regualtory elements governing transcription in specialized myofiber subtypes. J Biol Chem 276, 17361-17366.

PAGE 73

BIOGRAPHICAL SKETCH Jason Drenning was born in Roaring Spring, Pe nnsylvania, in 1975. He was an all-state baseball (pitcher) and football (quarterback) player at Northern Bedford High School. After finishing 9th in his graduating class of 1993, he received hi s bachelors degree in exercise science from The George Washington University (GW) in Washington, D.C., in 1997. At GW, he was on the Athletic Directors Honor Roll (baseball) and won the Warren Fulton award for leadership in a team sport. Jason obtained his Master of Science in clinical ex ercise physiology in 2000 and started his own personal training business. He went on to pursue a Doctor of Philosophy degree from the University of Florida and worked in the Center for Exercise Science both in clinical and basic science research. After graduating, Jason intends to wo rk in the medical device or pharmaceutical industry. 74