Citation
Immunity to Rhodococcus equi in Susceptible Foals and Resistant Adult Horses and in Vivo Expression of the R. equi vap Genes

Material Information

Title:
Immunity to Rhodococcus equi in Susceptible Foals and Resistant Adult Horses and in Vivo Expression of the R. equi vap Genes
Creator:
JACKS, STEPHANIE SCOTT ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Antigens ( jstor )
Cytokines ( jstor )
Foals ( jstor )
Horses ( jstor )
Infections ( jstor )
Lungs ( jstor )
Macrophages ( jstor )
Messenger RNA ( jstor )
Rhodococcus equi ( jstor )
Virulence ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Stephanie Scott Jacks. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
11/30/2007

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

IMMUNITY TO Rhodococcus equi IN SUSCEPTIBLE FOALS AND RESISTANT ADULT HORSES AND IN VIVO EXPRESSION OF THE R. equi vap GENES By STEPHANIE SCOTT JACKS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2007 1

PAGE 2

2007 Stephanie Scott Jacks 2

PAGE 3

To Joe and our lazy cats 3

PAGE 4

ACKNOWLEDGMENTS I would like to thank my esteemed advisor, Steeve Gigure, for giving me encouragement and support throughout my program and putting up with my idiosyncracies. I would like to thank my graduate committee (Rob MacKay, William Castleman, Paul Gulig, and Steve Hines) for their guidance and Cynda Crawford for her time and expertise in developing several of the assays. I would also like to thank everyone at the research facility, particularly Sally Beachboard, for the tremendous help, effort and care of my research animals, without this help I would not have been able to complete this project. I especially would like to thank my good friend and fellow graduate student, Kathy Seino, for always being there in whatever capacity I needed: as an extra hand late at night to process samples, moral support to keep me from giving up, and all the goody bags that gave me the sugar/caffeine to keep going. My parents, Steve and Rita Jacks, deserve special thanks for instilling in me the belief that I can accomplish anything that I put my mind to. Lastly and most importantly, I would like to thank my fianc, Joe Nicoletto, for believing in me and giving me support when I most needed it. 4

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS ...............................................................................................................4 LIST OF TABLES ...........................................................................................................................7 LIST OF FIGURES .........................................................................................................................8 ABSTRACT .....................................................................................................................................9 CHAPTER 1 INTRODUCTION..................................................................................................................11 2 LITERATURE REVIEW.......................................................................................................14 Rhodococcus equi...................................................................................................................14 Virulence.................................................................................................................................15 Pathogenesis...........................................................................................................................19 Clinical Disease......................................................................................................................20 Immunity.................................................................................................................................21 Innate Immunity..............................................................................................................21 Humoral Immunity..........................................................................................................23 Cell-Mediated Immunity.................................................................................................24 3 INFECTION WITH Rhodococcus equi IN NEONATAL FOALS RESULTS IN ADULT-LIKE IFNINDUCTION.......................................................................................26 Abstract...................................................................................................................................26 Introduction.............................................................................................................................27 Material and Methods.............................................................................................................29 Preparation of R. equi for Challenge...............................................................................29 Animals, Intrabronchial Challenge, and Study Design...................................................29 Collection of BAL Fluid..................................................................................................31 Preparation of R. equi Antigens.......................................................................................31 Preparation of BLN Cells, Cell Stimulation, and Proliferation Assay............................32 RNA Isolation from BLN Cells, DNase Treatment of RNA Samples, and cDNA Synthesis......................................................................................................................33 Quantification of Cytokine mRNA.................................................................................34 Flow Cytometry for Lymphocyte Immunophenotyping.................................................35 Determination of Immunoglobulin Concentrations.........................................................35 Statistical Analysis..........................................................................................................36 Results.....................................................................................................................................37 Disease Process and Pathologic Findings........................................................................37 R. equi-Specific Proliferative Responses and Cytokine Profile of BLN Cells................38 5

PAGE 6

BAL Fluid Cytology and Lymphocytes Subsets in BAL Fluid and BLN Lymphocytes................................................................................................................39 Antibody Response and Correlation Between IgG Subisotypes and the Cytokine Profile...........................................................................................................................39 Preliminary Studies on the Effects of the Size of the R. equi Inoculum on Cell-Mediated and Humoral Immune Responses in Foals..................................................41 Discussion...............................................................................................................................41 4 IN VIVO EXPRESSION OF, AND CELL MEDIATED IMMUNE RESPONSES TO, THE PLASMID-ENCODED VIRULENCE ASSOCIATED PROTEINS OF Rhodococcus equi IN FOALS................................................................................................55 Abstract...................................................................................................................................55 Introduction.............................................................................................................................56 Materials and Methods...........................................................................................................58 Animals and Intrabronchial Challenge............................................................................58 Preparation of Bronchial Lymph Node Cells, Cell Stimulation, and Lymphocyte Proliferation Assay.......................................................................................................59 RNA Isolation from BLN Cells, DNase Treatment of RNA Samples, and cDNA Synthesis......................................................................................................................60 Quantification of Cytokine mRNA.................................................................................61 Bacterial RNA Isolation, DNase Treatment of Bacterial RNA Samples, and cDNA Synthesis......................................................................................................................62 Quantification of R. equi vap mRNA..............................................................................63 Statistical Analyses..........................................................................................................63 Results.....................................................................................................................................64 Disease Process and Macroscopic Findings....................................................................64 In vivo Expression of the R. equi vap Genes...................................................................64 Vap-Specific Proliferative Responses and Cytokine Expression....................................65 Discussion...............................................................................................................................65 5 SUMMARY AND CONCLUSION.......................................................................................74 LIST OF REFERENCES...............................................................................................................76 BIOGRAPHICAL SKETCH.........................................................................................................86 6

PAGE 7

LIST OF TABLES Table page 3-1 Correlation between IgG subisotypes in serum and IL-4 or IFNmRNA expression in BLN cells.......................................................................................................................48 4-1 Oligonucleotide primer and probe sequences for amplification of the vap genes from R. equi................................................................................................................................70 7

PAGE 8

LIST OF FIGURES Figure page 3-1 Proliferative responses of BLN cells from 5 foals and 5 adult horses 15 days after challenge with virulent R. equi..........................................................................................49 3-2 Relative A) IL-4 and B) IFNmRNA expression as well as C) IFN-/IL-4 ratio following stimulation of BLN cells with soluble R. equi antigens....................................50 3-3 Lymphocyte subpopulations in A) BAL fluid and B) BLN from 5 foals and 5 adult horses 15 days after challenge with virulent R. equi.........................................................51 3-4 Relative serum IgM and IgG subisotype concentrations in 5 foals and 5 adult horses before (solid bars) and 15 days after challenge with virulent R. equi (dotted bars)..........52 3-5 Effect of the size of inoculum on IFN-/IL-4 ratio in the BLN of foals infected intrabronchially with R. equi..............................................................................................53 3-6 Relative increase in antibody concentrations in foals infected with a low or with a high inoculum of R. equi....................................................................................................54 4-1 Relative comparison of in vivo and in vitro expression of the plasmid-encoded vap genes of R. equi..................................................................................................................71 4-2 Recall lymphoproliferative responses of BLN mononuclear cells from foals and adult horses to recombinant R. equi VapA, VapC, VapD, VapE, VapF, VapG, and VapH.......72 4-3 Relative A) IFNand B) IL-4 mRNA expression, and C) IFN-/IL-4 ratio following stimulation of BLN mononuclear cells of foals (striped bars) and adult horses (dotted bars) with recombinant R. equi VapA, VapC, VapD, VapE, VapF, VapG, and VapH.....73 8

PAGE 9

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IMMUNITY TO Rhodococcus equi IN SUSCEPTIBLE FOALS AND RESISTANT ADULT HORSES AND IN VIVO EXPRESSION OF THE R. equi vap GENES By Stephanie Scott Jacks May 2007 Chair: Steeve Gigure Major: Veterinary Medical Sciences Rhodococcus equi is a facultative intracellular pathogen that causes pneumonia in young foals but does not induce disease in immunocompetent adult horses. Virulence of R. equi depends on the presence of a large plasmid, which encodes a family of eight virulence associated proteins (VapA and VapC to VapI). Clearance of R. equi depends mainly on gamma interferon (IFN-) production by T lymphocytes whereas the predominance of Interleukin-4 (IL-4) is detrimental. Young foals, like neonates of many other species, are generally deficient in their ability to produce IFN-. The objective of the first part of this study was to compare the cytokine profile as well as cell-mediated and antibody responses of young foals to that of adult horses following intrabronchial challenge with R. equi. The objectives for the second part of this study were to determine the relative in vivo expression of the vap genes of R. equi in the lungs of infected foals, to determine the proliferative response of bronchial lymph node (BLN) lymphocytes from foals and adult horses to each of the Vap proteins, and to compare the cytokine profile of proliferating lymphocytes between foals and adult horses. Lymphoproliferative responses of BLN cells to concanavalin A were significantly higher in foals than in adult horses. In contrast, foals had significantly lower lymphoproliferative responses to R. equi antigens than adult horses. 9

PAGE 10

Infected foals had significantly lower IL-4 mRNA expression but significantly higher IFNexpression and IFN-/IL-4 ratio in R. equi-stimulated BLN lymphocytes compared to infected adults. Infection with R. equi in foals resulted in a significant increase in the percentage of T lymphocytes and CD4 + T lymphocytes in bronchoalveolar lavage fluid in association with a significant decrease in the percentage of these two cell populations in BLN. Infection of foals also resulted in a marked increase in serum IgGa and IgGb, resulting in serum concentrations significantly higher than that of adult horses. vapA, vapD, and vapG were preferentially expressed in the lungs of infected foals and expression of these genes in the lungs was significantly higher than that achieved during in vitro growth. VapA and VapC induced the strongest lymphoproliferative responses in foals and adult horses. There was no significant difference in lymphoproliferative responses or IFNmRNA expression by BLN lymphocytes between foals and adults after stimulation with any Vap protein. In contrast, IL-4 expression was significantly higher in adults than in foals for each of the Vap proteins. The ratio of IFN-/IL-4 was significantly higher in foals than in adult horses for most Vap proteins. This study demonstrates that the immune response to R. equi in foals is not biased toward IL-4 and is characterized by the predominant induction of IFN-. Thus, the peculiar susceptibility of foals to infection by R. equi cannot be explained by a failure to mount Th1 immunoreactivity to key antigens. 10

PAGE 11

CHAPTER 1 INTRODUCTION Rhodococcus equi is a Gram-positive facultative intracellular pathogen that causes pyogranulomatous pneumonia in foals aged between 3 weeks and 6 months of age. R. equi has also emerged as a cause of pneumonia in immunosuppressed people (Donisi et al., 1996; Harvey and Sunstrum, 1991). In foals, the course of the disease is usually insidious and pathology is often extensive by the time the disease is diagnosed. Isolates of R. equi from pneumonic foals contain a large 80to 90-kb plasmid expressing eight closely related virulence associated proteins (Vap) designated VapA and VapC – VapI (Takai et al., 2000b). Plasmid-cured derivatives of virulent R. equi isolates lose their ability to survive and replicate in macrophages. Plasmid-cured derivatives also fail to induce pneumonia and are completely cleared from the lungs of foals two weeks following heavy intrabronchial challenge, confirming the necessity of the large plasmid for the virulence of R. equi (Gigure et al., 1999a; Wada et al., 1997). In a recent study, a R. equi mutant lacking a 7.9-kb DNA region spanning 5 vap genes (vapA, -C, -D, -E, -F) was attenuated for virulence in mice and failed to replicate in macrophages. Complementation with vapA alone could restore full virulence, whereas complementation with vapC, vapD, or vapE could not (Jain et al., 2003). Because of the facultative intracellular nature of R. equi, cell-mediated immune mechanisms are thought to be of major importance in resistance. Most knowledge of cell-mediated immunity to R. equi infections comes from infection of mice. In mice, administration of immune serum only results in a slight and temporary enhancement of organ clearance of R. equi. In contrast, functional T lymphocytes are absolutely required for the clearance of virulent R. equi. Adoptive transfer of R. equi-specific CD4 + T-lymphocyte lines to R. equi-susceptible nude mice demonstrated that a Th1 response is sufficient to achieve pulmonary clearance, 11

PAGE 12

whereas a Th2 response is detrimental (Kanaly et al., 1996). In addition, blockage of IFNenhances disease in normally resistant immunocompetent mice (Kanaly et al., 1995). Immunity to R. equi in horses likely depends on both humoral and cell-mediated immune responses. Antibodies to the Vap proteins do not provide complete protection but have been shown to enhance pulmonary clearance of R. equi following heavy intrabronchial challenge in foals (Hooper-McGrevy et al., 2001). As opposed to foals, adult horses completely clear intrabronchial challenge with virulent R. equi and do not develop clinical signs of disease (Lopez et al., 2002). Clearance of R. equi in adult horses is associated with a significant increase in Broncho-alveolar lavage (BAL) fluid CD4 + and CD8 + lymphocytes, lymphoproliferative responses to R. equi antigens, development of R. equi-specific cytotoxic T lymphocytes, and IFNinduction (Hines et al., 2003; Hines et al., 2001; Lopez et al., 2002; Patton et al., 2004). While studies in both mice and adult horses seem to support that resistance to R. equi is mediated by a "Th1-like" immune response characterized by IFNinduction, more information is needed on the type of immune response induced in foals and how the immune response of foals differs from that of adult horses. The recognized Th2 bias in immune responses of neonates from many species (Adkins, 2000) along with the recent finding that young foals are deficient in their ability to produce IFNin response to mitogens has led to the hypothesis that an IFNdeficiency may be at the basis of their peculiar susceptibility to R. equi infections (Breathnach et al., 2006). However, the fact that oral administration of live virulent R. equi to newborn foals confers complete protection against subsequent heavy intrabronchial challenge (Chirino-Trejo et al., 1987; Hooper-McGrevy et al., 2005) and the fact that most foals on farms where the disease is endemic do not develop disease or develop subclinical disease and 12

PAGE 13

eventually clear the infection suggests that most foals have the ability to mount protective immune responses to R. equi. The overall goal of the work presented in this dissertation is twofold. First to determine the immune responses of susceptible foals to the pathogen R. equi and compare them to the immune responses of resistant adult horses. Secondly, to determine which Vap proteins of R. equi are upregulated during infection to better understand the pathogenesis of infection and identify potential antigens that maybe used in the production of future vaccines. This dissertation includes two studies. The objectives and hypothesis of the first study (Chapter 3) are: 1. To compare the lymphoproliferative responses, cytokine mRNA profiles, lymphocyte subsets of BAL fluid and lymph node cell populations, and immunoglobulin isotypes of susceptible foals to that of resistant adult horses following intrabronchial challenge with virulent R. equi. It was hypothesized that, although foals have a nave immune system, infection with R. equi results in adult-like IFNinduction. 2. To determine the effect of the size of challenge on the lymphoproliferative response, cytokine profile, and immunoglobulin isotypes of foals infected with virulent R. equi. It was hypothesized that a higher challenge dose of R. equi shifts a predominant IFNresponse to a predominant IL-4 response. The objectives and hypothesis of the second study (Chapter 4) are: 1. To determine the relative in vivo and in vitro expression of the R. equi vap genes. It was hypothesized that the expression of the plasmid-encoded vap genes is stronger in vivo than during in vitro growth. 2. To determine the lymphoproliferative response of foals to each of the functional Vap proteins and compare it to that of resistant adult horses, and to determine the cytokine profile of proliferating lymphocytes in both foals and adult horses. It was hypothesized that the lymphoproliferative response and cytokine profile of foals in response to Vap proteins are similar to that of adult horses. 13

PAGE 14

CHAPTER 2 LITERATURE REVIEW Rhodococcus equi Rhodococcus is a member of the nocardioform actinomycetes and, specifically, the mycolata family. Other members of the nocardioform actinomycetes family are Corynebacterium, Mycobacterium, Nocardia, Gordona, and Tsukamurella. The mycolata family can be divided further into the two groups of Cornyebacteriaceae and the Mycobacteriaceae. Rhodococcus falls into the Mycobacteriaceae group along with Mycobacterium, Nocardia, and Gordonia (Chun et al., 1996). Of all the members of the mycolata family, R. equi most resembles M. tuberculosis in its pathogenesis and disease characteristics. Members of the genus Rhodococcus are defined primarily by their cell wall characteristics. There are thirteen members in the Rhodococcus genus, though only one, R. equi, has frequently been reported as pathogenic to humans and animals. Major characteristics of rhodococcal cell wall are mycelia, tuberculostearic acid, phosphatidyl ethanolamine, eight isoprene units of menaquinone, and mycolic acids with a variable chain length of 32 to 66 carbon units (Finnerty, 1992). The cell wall contributes to pathogenesis of the bacteria and stimulates the immune system in the host. The mycolic acids in the cell wall by their nature protect the bacteria from harm from chemical injury and antimicrobial entry. The mycolic acids are recognized by T-lymphocytes as foreign by a cluster of differentiation (CD)-1 dependent mechanism (Beckman et al., 1994). CD1 are molecules expressed on antigen presenting cells that present lipids to T-lymphocytes. The lipoglycans, which are macroamphiphilic membrane-anchored polymers are also present in the cell envelope of certain gram-positive bacteria including Rhodococcus and are potential immunomodulators. The lipoglycans of Mycobacterium form lipoarabinomannan (LAM) and R. equi cell wall contains LAM-like polymers (Sutcliffe, 1997). The LAM like 14

PAGE 15

polymers account for most of the early macrophage cytokine response following infection with R. equi (Garton et al., 2002). Virulence R. equi has several factors contributing to its virulence and ability to survive and replicate in macrophages. Unlike most environmental R. equi, isolates from pneumonic foals typically contain 80-90 kb plasmids (Haites et al., 1997; Makrai et al., 2002; Martens et al., 2000; Takai et al., 1991; Takai et al., 1993). Plasmid-cured derivatives of virulent R. equi strains lose their ability to replicate and survive in macrophages (Gigure et al., 1999a). Plasmid-cured derivatives also fail to induce pneumonia and are completely cleared from the lungs of foals two weeks following heavy intrabronchial challenge, confirming the absolute necessity of the large plasmid for the virulence of R. equi (Gigure et al., 1999a; Wada et al., 1997). Nucleotide sequencing of the large plasmid of two foal isolates revealed the presence of 69 open reading frames (ORF) (Takai et al., 2000a). Comparisons of the plasmid sequence with genes previously identified in other microorganisms identify 3 functional regions. Two of these regions contain genes encoding proteins involved in conjugation and in plasmid replication stability, and segregation (Takai et al., 2000a). The third region of 27.5 kb bears the hallmark of a pathogenicity island and contains the genes for a family of eight closely related virulence-associated proteins designated VapA and VapC to VapI (Makrai et al., 2002; Polidori and Haas, 2006; Takai et al., 2000a). Of these genes, vapA has been the most extensively studied. The genes vapC-I all show extensive homology with vapA, with most of the homology among the C-terminal halves (Takai et al., 2000a). The genes encoding vapA, -C, -D, and -I are clustered together, vapE and vapF are grouped in pair, whereas vapG and vapH are completely separate from the others and each other. 15

PAGE 16

VapA is expressed on the bacterial surface and its expression is temperature regulated, occurring between 34C and 41C (Takai et al. 1996a). VapC, -D and -E are secreted proteins concomitantly regulated by temperature with VapA (Byrne et al., 2001). Thus these proteins would be expected to be expressed at normal mammalian body temperature and as such would be expected to have a role in virulence. In a recent study, a R. equi mutant lacking a 7.9 kb DNA region spanning 6 vap genes (vapA, -C, -D, -E, -F, -I) was attenuated for virulence in mice and failed to replicate in macrophages (Jain et al., 2003). Complementation with vapA alone could restore full virulence, whereas complementation with vapC, vapD or vapE could not. Conversely, a recombinant plasmid-cured derivative expressing wild-type levels of VapA failed to survive and replicate in macrophages and remained avirulent for foals showing that expression of VapA alone is not sufficient to restore the virulence phenotype (Gigure et al., 1999a). These findings show that although VapA is essential for virulence, other plasmid-encoded products also contribute to the ability of R. equi to cause disease. Consistent with these findings, it was recently demonstrated that two R. equi mutants lacking expression of pathogenicity island genes (ORF4 and ORF8) were fully attenuated despite enhanced transcription of vapA (Ren and Prescott, 2004). All vap genes as well as 5 other ORFs within the pathogenicity island are upregulated when R. equi is grown in macrophage monolayers (Ren and Prescott, 2003). Regulation of expression of the genes of the pathogenicity island is complex and depends on at least 5 environmental signals including temperature, pH, oxidative stress, magnesium, and iron (Benoit et al., 2002; Ren and Prescott, 2003; Takai et al., 1996a). The precise role of each of these genes in the pathogenesis of R. equi infections remains to be determined. After ingestion by a phagocytic cell, intracellular pathogens encounter an acidic environment when the phagosome 16

PAGE 17

fuses with the lysosome. To survive intracellularly, a pathogen must find ways to circumvent or adjust to this acidic environment. In vitro acid tolerance tests show that there is upregulation of vapA and vapD in response to increasing acidity (Benoit et al., 2001). The oxidative burst is another mechanism used by phagocytic cells to destroy invading pathogens. The oxidative burst releases toxic oxygen radicals, nitric oxide, and other molecules into the pathogen’s environment. R. equi is highly resistant to killing in conditions that mimic the oxidative burst response of activated macrophages and R. equi responds to these conditions by increasing the induction of the genes vapA, -D, and –G (Benoit et al., 2002). Macrophages from HIV positive individuals do not produce nitric oxide (NO), while macrophages from HIV negative patients produce NO in response to in vitro infection with R. equi (Vullo et al., 1998). However, the L-arginine-NO pathway does not appear to be required for killing of R. equi by human macrophages because the intracellular killing of R. equi is not altered by either competitive inhibition of NO synthesis or arginine depletion. In contrast, murine macrophages require both NO and reactive oxygen radicals for formation of peroxynitrite to effectively kill intracellular R. equi (Darrah et al., 2000). R. equi can be separated into virulent strains, intermediately virulent strains, and non-virulent strains based on the degree of virulence or lack thereof in mice studies. Virulent R. equi isolates contain the large plasmid described above and express VapA. Intermediately virulent R. equi isolates contain one of four distinct large plasmids encoding a 20-kDa antigen (VapB) that is related to, but distinct from VapA. Though VapA and VapB are homologous, VapB is not expressed by isolates that express VapA and vice versa (Byrne et al., 2001). In contrast, avirulent R. equi isolates do not express Vap antigens. All 3 categories of R. equi have the ability to cause disease in immunosuppressed humans. Analysis of R. equi isolates from 17

PAGE 18

immunocompromised human patients with and without AIDS reveals that only approximately 20% of isolates contain an 80-90 kb plasmid and express VapA (Takai et al., 1994b; Takai et al., 1995). Therefore, the pathogenesis of R. equi infection in immunocompromised human patients appears to be different from the pathogenesis in foals, in which the virulence plasmid is always found. Intermediately virulent isolates (expressing VapB) have not been isolated from foals with naturally acquired R. equi infections. Experimentally, heavy intrabronchial challenge of foals with intermediately virulent R. equi results in pneumonia but at a dose much higher than that required for induction of pneumonia with VapA expressing strains (Takai et al., 2000b). Almost all isolates from the submaxillary lymph nodes of pigs produce VapB and are intermediately virulent to mice, suggesting that pigs or their environment may be the source of intermediately virulent R. equi (Takai et al., 1996c). Other presumed virulence factors described for R. equi are the polysaccharide capsule and the so called “equi factors”. The polysaccharide capsule may prevent ingestion of R. equi by the host’s phagocytic cells by preventing complement fixation and opsonization, and the capsule may also cause increased resistance to complement membrane attack complex. The “equi factors” consist of the cholesterol oxidase (CO), choline phosphohydrolase, and phospholipase C exoenzymes (Machang'u and Prescott, 1991; Prescott, 1991). The enzymes act on the host cell and may cause damage to the cell membrane. In vitro studies of the growth of R. equi demonstrated that CO is induced in the presence of cholesterol and that in response to reactive oxygen radicals, R. equi increases production of catalase, membrane bound CO, and super-oxide dismutase (Fuhrmann et al., 2002). However, both the capsule and “equi factors” are found in virulent as well as in avirulent strains of R. equi. In a recent study, infection of foals with an allelic exchange CO mutant conclusively demonstrated that this enzyme alone is not important to 18

PAGE 19

the virulence of R. equi (Pei et al., 2006). The mycolic acid containing cell wall is likely to be of importance for survival of R. equi under harsh environmental conditions such as those that occur within macrophages. Consistent with this theory, R. equi isolates with a longer carbon chain mycolic are more virulent than those with shorter chains as determined by lethality and granuloma formation in mice than those with shorter chains (Gotoh et al., 1991). Pathogenesis Foals become infected with R. equi primarily by inhalation of environmental bacteria. Ingestion of the organism is a significant route of exposure, and likely also of immunization, but rarely leads to hematogenously acquired pneumonia unless the foal has multiple exposures to large numbers of bacteria (Johnson et al, 1983b). The incubation period following experimental intrabronchial challenge varies from approximately 9 days after administration of a heavy inoculum to approximately 2-4 weeks when a lower inoculum is administered (Barton and Embury, 1987; Gigure et al., 1999a). Lung consolidation can be detected as early as 3 days following heavy intrabronchial challenge (Gigure et al., 1999a). The incubation period under field conditions likely depends on the number of virulent bacteria in the environment as well. Members of the Rhodococcus genus are all soil inhabitants/saprophytes. R. equi can be isolated from the soil and feces of grazing herbivorous animals, though animals without access to pasture do not shed R. equi (Barton and Hughes, 1984). For optimal growth, R. equi requires aerobic conditions, a pH of 7 to 8.5, and a temperature of 30C (Hughes and Sulaiman, 1987). Also, growth of R. equi is enhanced in soil contaminated with herbivorous feces. Horse manure in particular contains the volatile organic acids, acetate and propionate, which support growth and proliferation of R. equi (Hughes and Sulaiman, 1987). R. equi can also be cultured from the soil of areas not inhabited by horses ( Takai et al., 1996b). However, virulent R. equi is not found in urban areas and it is mainly found on horse farms ( Takai et al., 1996b). There is a higher 19

PAGE 20

prevalence of virulent R. equi in the soil and in feces from foals on farms with endemic R. equi infections than on farms without a history of infections with R. equi (Takai et al., 1991). Virulent R. equi that is present in the sputum of pneumonic foals will be swallowed. R. equi can replicate in the intestinal tract of foals less than 3 months of age though no replication takes place in older foals or adults (Takai et al., 1986). Also, under suitable conditions of high summer temperatures, R. equi can multiply in the environment by 10,000-fold in only 2 weeks (Barton and Hughes, 1984). Thus a single gram of soil contaminated with foal manure may therefore, under favorable conditions, contain millions of virulent R. equi. Clinical Disease R. equi is primarily a pathogen of foals aged between 3 weeks and 6 months. In foals, infections with R. equi primarily results in a pyogranulomatous pneumonia. The course of the disease is usually insidious and pathology is usually quite extensive by the time the disease is diagnosed. Extrapulmonary manifestations of rhodococcal infections may also occur. Intestinal lesions are present in approximately 50% of foals with R. equi pneumonia presented for necropsy (Zink et al., 1986). However, the majority of foals with R. equi pneumonia do not show clinical signs of intestinal disease. Polysynovitis is also present in approximately one-third of foals with R. equi infections and, in some cases, effusion of multiple joints may be the presenting complaint (Sweeney et al., 1987). Other manifestations of R. equi infections in foals are: septic arthritis, vertebral osteomyelitis, uveitis, cutaneous abscesses, and ulcerative typhlocolitis (Collatos et al., 1990; Gigure and Lavoie, 1994). Disease caused by R. equi is extremely rare in immunocompetent adult horses. There are a few reports in adult horses of sporadically occurring illness similar to that observed in foals involving primarily lungs or abdominal lymph nodes, or rarely as a wound infection. In one adult horse, acquired combined immunodeficiency of unknown origin led to R. equi septicemia 20

PAGE 21

and lung abscessation (Freestone et al., 1987). Also, the organism has been an infrequent isolate from infertile mares and aborted fetuses (Fitzgerald and Yamini, 1995; Szeredi et al., 2001). In humans, R. equi primarily causes infections in immunocompromised people, such as those infected with HIV (Kwa et al., 2001). Rare infections with R. equi have also been reported in other species such as pigs, dogs, goats, cats, cattle, and camelids (Cantor et al., 1998; Carrigan et al., 1988; Davis et al., 1999; Elliott et al., 1986; Hong and Donahue, 1995; Katsumi et al., 1991). R. equi is frequently cultured from the submaxillary lymph nodes of pigs with granulomatous lymphadenitis. However, R. equi can also be isolated from the submaxillary lymph nodes of 3-5% of apparently healthy pigs (Madarame et al., 1998; Takai et al., 1996b) and experimental infection studies in pigs have failed to reproduce the lesions (Madarame et al., 1998). The causative role of R. equi in porcine granulomatous lymphadenitis thus remains unproven. Isolation of R. equi from other domestic animal species is also rare. R. equi can be isolated from lymph node granulomas in 0.008% of cattle at abattoir post-mortem inspection (Flynn et al., 2001). R. equi has also been cultured from rare cases of bronchopneumonia, mastitis, metritis, ulcerative lymphangitis, and septic arthritis in cattle. In goats, R. equi has a tendency to cause liver abscesses with concurrent bronchopneumonia or pulmonary abscessation (Tkachuk-Saad et al., 1998). R. equi has also been isolated from cases of pneumonia as well as wound infections, subcutaneous abscesses, vaginitis, hepatitis osteomyelitis, myositis, and joint infections in dogs and cats (Takai et al., 2003). Immunity Innate Immunity R. equi is a facultative intracellular pathogen that specifically infects cells of the monocyte-macrophage lineage (Hondalus et al., 1993). Virulent R. equi is able to persist and replicate and eventually destroy infected equine and murine macrophages, while avirulent R. equi replicates 21

PAGE 22

poorly in macrophages (Hietala and Ardans, 1987a;; Zink et al., 1985; Zink et al., 1987) (Hondalus et al 1994). Both viable and non-viable R. equi are able to inhibit fusion of the phagosomes to lysosomes in infected macrophages by an unknown mechanism (Hietala and Ardans, 1987a; Zink et al., 1987). Recent studies in mouse macrophages have shown that R. equi has the ability to block maturation of endocytic organelles after completion of the early endosome stage but before reaching a fully mature late endosome compartment (Fernandez-Mora et al., 2005). Following ingestion by macrophages both virulent strains of R. equi and their avirulent plasmid-cured derivatives replicate in single membrane vacuoles for approximately 6 h. Thereafter, virulent R. equi suppresses acidification of the vacuole and replicates intracellularly whereas the vacuoles containing plasmid-cured derivatives progressively acidify leading to complete eradication of the bacteria (Fernandez-Mora et al., 2005; Toyooka et al., 2005). These findings indicate the importance of plasmid-encoded products in preventing acidification of R. equi-containing vacuoles within macrophages. Similarly, necrotic death of R. equi-infected macrophages is also regulated by plasmid-encoded proteins (Luhrmann et al., 2004). Opsonization of R. equi with specific antibody significantly enhances killing of R. equi by equine macrophages while entry into the cell using complement allows survival of the bacteria (Fernandez-Mora et al., 2005; Hietala and Ardans, 1987a; Hondalus and Mosser, 1994). The role of complement in the host response to infection with R. equi is unknown. There is conflicting data on the amount of involvement of complement in the phagocytosis of R. equi (Hietala and Ardans, 1987b; Hondalus et al., 1993; Martens et al., 1987). These findings suggest that cellular entry by non-Fc receptors may allow R. equi to avoid antibody-associated killing pathways. Entry of several microorganisms into macrophages after adherence to complement receptors, rather than Fc receptors, has been shown to allow them to avoid the toxic consequences of the 22

PAGE 23

oxidative burst (Aderem and Underhill, 1999). Viable R. equi is also able to cause irreversible damage and thus cell death to macrophages after phagocytosis of R. equi (Zink et al., 1987). Neutrophils play an important role in early host defense against virulent R. equi (Martens et al., 2005). As opposed to macrophages, neutrophils from foals and adult horses are fully able to kill R. equi (Hietala and Ardans, 1987b; Yager et al., 1987). As seen with macrophages, killing of R. equi by neutrophils is considerably enhanced by specific opsonizing antibody. Humoral Immunity The humoral immune response also appears important to neutrophil function. In the presence of low levels of R. equi specific antibody, neutrophils are able to phagocytize R. equi but high concentrations of antibody are necessary to allow killing of the bacteria (Hietala and Ardans, 1987b). The humoral immune response is also important for macrophage function. Opsonization of R. equi increases phagosome-lysosome fusion and killing by macrophages (Hietala and Ardans, 1987a). IgG and other “lymphocyte factors” from sensitized foal’s lymphocytes increased the killing of R. equi in nonsensitized foal macrophages by 50% while increasing killing by > 100% in sensitized macrophages (Hietala and Ardans, 1987a). The strongest evidence for a role of antibody in protection against R. equi is the partially protective effect of passively transferred anti-R. equi hyperimmune (HI) equine plasma (Martens et al., 1989b, Madigan et al, 1991). In most studies evaluating the protective effect of HI plasma, plasma donors were immunized with whole cell vaccines or a mixture of several soluble antigens, making it impossible to determine the role of antibody against defined antigens of R. equi. Recent studies have focused more specifically against the role of antibody against plasmid-encoded virulence-associated proteins (Vap). Hooper-McGrevy demonstrated that purified immunoglobulins to VapA and VapC were able to provide a significant degree of protection to foals challenged with virulent R. equi (Hooper-McGrevy et al., 2001). In adult horses, the 23

PAGE 24

concentrations of R. equiand VapA-specific IgGa and IgGb antibodies, the IgG isotypes that preferentially opsonize and fix complement in horses, are dramatically enhanced postchallenge in conjunction with clearance of the bacteria from the lungs (Lopez et al., 2002). In foals, the antibody response to VapA and VapC, but not to that of the other Vap proteins, increases following natural exposure to R. equi (Hooper-McGrevy et al., 2005). Characterization of the subisotype response in naturally infected foals reveals mainly an increase in IgGa, IgGb, and IgG(T) (Hooper-McGrevy et al., 2005; Takai et al., 2002). Cell-Mediated Immunity In murine models of R. equi infection, cell-mediated immunity rather than humoral-mediated immunity is most important for protection (Nordmann et al., 1992). In contrast to immunocompetent mice, T-lymphocyte deficient nude mice are unable to clear infection with virulent R. equi (Madarame et al., 1997). SCID mice are able to eradicate avirulent strains of R. equi by 21 days postinfection but, although there is a slight decrease in the number of organisms, they are not able to clear virulent strains (Ross et al., 1996). This suggests that other cell types besides lymphocytes are involved but are insufficient at mediating a total clearance of R. equi. Although both CD4 + (helper) and CD8 + (cytotoxic) T cells contribute to the host defense against R. equi in mice, CD4 + T lymphocytes play the major role and are absolutely required for complete pulmonary clearance (Kanaly et al., 1993; Nordmann et al., 1992). A T h 1 response characterized by IFNproduction is essential for clearance of R. equi in mice (Kanaly et al., 1995; Kanaly et al., 1996). In contrast a T h 2 response characterized by IL-4 production appears to be involved in disease pathogenesis allowing lesion formation (Kanaly et al., 1995). Pretreatment with anti-IFNantibodies allowed formation of granulomas in mice which progressed to pneumonia and death by 26 days post-infection with R. equi. Mice that were 24

PAGE 25

treated with anti-IL-4 antibody were capable of clearing the infection with R. equi and did not develop any pulmonary lesions (Kanaly et al., 1995). Clearance of R. equi in adult horses is associated with a significant increase in BAL fluid CD4 + and CD8 + lymphocytes, lymphoproliferative responses to R. equi antigens, development of R. equi-specific cytotoxic T lymphocytes, and IFNinduction (Hines et al., 2003; Hines et al., 2001; Lopez et al., 2002; Patton et al., 2004). Cell-mediated immune responses of foals in response to infection with R. equi have not been studied extensively. Age related deficiencies in R. equi specific cytotoxic T lymphocyte activity have been documented in 3-week-old foals (Patton et al., 2005). Cytotoxic T lymphocyte activity was improved by 6 weeks of age and was similar to that of adult horses by 8 weeks (Patton et al., 2005). In another study, foals with a peripheral blood CD4:CD8 T lymphocyte ratio < 3 between 2 and 4 weeks of age were more likely to develop R. equi pneumonia than foals with a higher ratio (Chaffin et al., 2004). These findings may represent important immunologic mechanisms associated with increased susceptibility of individual foals to R. equi infections. Contradicting evidence shows that only a few foals on an endemic farm actually succumb to the disease. Thus even if R. equi has an immunomodulating effect on foals, more factors must be involved to cause clinical disease. 25

PAGE 26

CHAPTER 3 INFECTION WITH Rhodococcus equi IN NEONATAL FOALS RESULTS IN ADULT-LIKE IFNINDUCTION Abstract Rhodococcus equi is a facultative intracellular pathogen that causes pneumonia in young foals but does not induce disease in immunocompetent adult horses. Clearance of R. equi depends mainly on gamma interferon (IFN-) production by T lymphocytes whereas the predominance of IL-4 is detrimental. Young foals, like neonates of many other species, are generally deficient in their ability to produce IFN-. The objective of this study was to compare the cytokine profile as well as cell-mediated and antibody responses of young foals to that of adult horses following intrabronchial challenge with R. equi. Lymphoproliferative responses of bronchial lymph node (BLN) cells to concanavalin A were significantly higher in foals than in adult horses. In contrast, adult horses had significantly higher lymphoproliferative responses to R. equi antigens than foals. Infected foals had significantly lower IL-4 mRNA expression but significantly higher IFNmRNA expression and IFN-/IL-4 ratio in R. equi-stimulated BLN lymphocytes compared to infected adults. Infection with R. equi in foals resulted in a significant increase in the percentage of T lymphocytes and CD4 + T lymphocytes in bronchoalveolar lavage fluid in association with a significant decrease in the percentage of these two cell populations in BLN. Infection of foals also resulted in a marked increase in serum IgGa and IgGb, resulting in serum concentrations significantly higher than that of adult horses. This study demonstrates that the immune response to R. equi in foals is not biased toward IL-4 and is characterized by the predominant induction of IFN-. 26

PAGE 27

Introduction Rhodococcus equi, a Gram-positive facultative intracellular pathogen, is one of the most important causes of pneumonia in foals aged between 3 weeks and 5 months. R. equi has also emerged as a significant opportunistic pathogen in immunosuppressed people, especially those infected with the human immunodeficiency virus (Arlotti et al., 1996; Donisi et al., 1996; Harvey and Sunstrum, 1991). As opposed to foals, adult horses are typically resistant to R. equi infections. R. equi, a soil saprophyte, is widespread in the environment (Takai et al., 1994a; Takai et al., 1996b). Unlike environmental R. equi, isolates from pneumonic foals typically contain an 80-90 kb plasmid encoding a family of seven closely related virulence-associated proteins designated VapA and VapC to VapH (Takai et al., 2000a). Plasmid-cured derivatives of virulent R. equi strains lose their ability to replicate and survive in macrophages (Gigure et al., 1999a). Plasmid-cured derivatives also fail to induce pneumonia and are completely cleared from the lungs of foals, confirming the absolute necessity of the large plasmid for the virulence of R. equi (Gigure et al., 1999a; Wada et al., 1997). Study of the pathogenesis of R. equi infections has been complicated by the fact that typical granulomatous lung lesions have not been reproduced by R. equi infection in any immunocompetent species other than young horses. The normal murine lung can progressively clear an inoculum of R. equi sufficient to induce severe pneumonia in foals, suggesting that the results of studies on the pathogenesis of this infection in mice may not necessarily be extrapolated to foals. Nevertheless, most of what is known of immunity to R. equi comes from experiments with mouse models. Adoptive transfer of R. equi-specific CD4 + T-lymphocyte lines to R. equi-susceptible nude mice demonstrated that a Th1 response is sufficient to achieve pulmonary clearance, whereas a Th2 response is detrimental (Kanaly et al., 1996). In addition, 27

PAGE 28

blockage of IFNenhances disease in normally resistant immunocompetent mice (Kanaly et al., 1995). Immunity to R. equi in horses likely depends on both humoral and cell-mediated immune responses. Antibodies to the Vap proteins do not provide complete protection but have been shown to enhance pulmonary clearance of R. equi following heavy intrabronchial challenge in foals (Hooper-McGrevy et al., 2001). Clearance of R. equi in adult horses is associated with a significant increase in BAL fluid CD4 + and CD8 + lymphocytes, lymphoproliferative responses to R. equi antigens, development of R. equi-specific cytotoxic T lymphocytes, and IFNinduction (Hines et al., 2003; Hines et al., 2001; Lopez et al., 2002; Patton et al., 2004). The concentrations of R. equi-specific IgGa and IgGb are also dramatically enhanced in conjunction with pulmonary clearance in adult horses (Lopez et al., 2002). How these findings in mice and adult horses relate to the foal remains to be determined. Analogy to human immunodeficiency virus-related R. equi pneumonia suggests either that foals are immunocompromised in some way or that infection with virulent R. equi alters immune responses in foals. The recognized Th2 bias in immune responses of neonates from many species (Adkins, 2000) along with the recent finding that young foals are deficient in their ability to produce IFNin response to mitogens has led to the hypothesis that an IFNdeficiency may be at the basis of their peculiar susceptibility to R. equi infections (Breathnach et al., 2006). However, the fact that oral administration of live virulent R. equi to newborn foals confers complete protection against subsequent heavy intrabronchial challenge (Chirino-Trejo et al., 1987; Hooper-McGrevy et al., 2005) and the fact that most foals on farms where the disease is endemic do not develop disease or develop subclinical disease and eventually clear the infection suggests that most foals have the ability to mount protective immune responses to R. equi. 28

PAGE 29

As a basis for the present study, we hypothesized that, although foals have a nave immune system, infection with R. equi results in adult-like IFNinduction. To address this hypothesis, R. equi-susceptible foals and resistant adult horses were infected intrabronchially with a low inoculum of virulent R. equi. Lymphoproliferative responses, cytokine mRNA expression, lymphocyte subsets in bronchoalveolar (BAL) fluid and bronchial lymph node (BLN) cell populations, and immunoglogulin concentrations were measured and compared between groups. Material and Methods Preparation of R. equi for Challenge R. equi ATCC 33701, a virulent strain containing an 80-kb virulence plasmid, was used to infect foals (Takai et al., 2000a). Bacteria were kept as frozen stabilates. Aliquots of R. equi were grown on trypticase soy agar (TSA) plates for 48 h at 37C. Bacteria were harvested with 4 mL of sterile phosphate buffered saline (PBS) per plate. The bacterial concentration was determined by counting colony forming units (CFU). Animals, Intrabronchial Challenge, and Study Design Ten foals between 7 and 10 days of age and ten adult horses between 3 and 12 years of age were used in this study. Adequate transfer of passive immunity was confirmed in foals at 12 to 24 h of age by measurement of plasma IgG concentration using a commercial immunoassay (DVM Stat, Corporation for advanced Applications, Newburg, WI). Foals together with their dams were moved to individual stalls in an isolation facility the day after birth. Adult horses were moved to the isolation facility at least 2 days prior to the beginning of the study. Prior to initiation of the study, all animals were determined to be healthy on the basis of a thorough physical examination, complete blood count, biochemical profile, cytology and bacterial culture of a tracheobronchial aspirate, and thoracic radiographs. 29

PAGE 30

Prior to infection, animals were sedated with 0.5 mg/kg of xylazine hydrochloride and 0.05 mg/kg of butorphanol tartrate, intravenously. Five foals and five adult horses were infected intrabronchially with an inoculum of 2 x 10 4 CFU of R. equi per kg of body weight diluted in 50 mL of PBS. This corresponded to a total inoculum of approximately 1 x 10 6 CFU for each foal and 1 x 10 7 CFU for each adult horse. Five foals and five adults were used as controls and were given only PBS intrabronchially. A flexible fiberoptic endoscope was used to deliver 25 mL of the bacterial suspension or PBS into each main bronchus. The day of infection was designated as day 0. Baseline values for heart rate, respiratory rate, temperature, white blood cell count, and fibrinogen concentrations were obtained on day 0 prior to sedation. Serum was also collected for measurement of baseline immunoglobulin concentrations. Animals were clinically assessed throughout the study based on daily complete physical examinations as well as twice daily heart rate, respiratory rate, and temperature recording. Serum and whole blood samples for white blood cell counts and measurement of fibrinogen concentrations were collected again on day 15 post-infection, and bronchoalveolar lavage (BAL) was performed. Euthanasia was performed immediately following collection of BAL fluid by intravenous administration of a lethal dose of pentobarbital sodium. Bronchial lymph nodes (BLN) were collected aseptically and placed in sterile PBS on ice for transport to the laboratory. All organs were examined macroscopically, and representative samples of normal and diseased lungs as well as bronchial lymph nodes were fixed in 10 % buffered formol-saline. The fixed tissues were embedded in paraffin, sectioned at 10 m, stained with hematoxyllin and eosin (H&E) and examined histologically. The lymph node samples were graded 0 to 3 based on severity of lymphoid hyperplasia and sinus histiocytosis. The pathologist was unaware of the source of the tissue sample. The number of viable R. equi in four dispersed 30

PAGE 31

and preselected loci of both lungs was enumerated by culturing serial dilutions of lung homogenates on TSA plates and counting CFU. The eight sites were the cranio-dorsal, cranio-ventral, middle and caudo-dorsal parts of each lung. In subsequent experiments, three additional foals were infected intrabronchially with an inoculum of 2 x 10 6 CFU of R. equi per kg of body weight (total inoculum of 1 x 10 8 CFU) to assess the effect of challenge dose on immune responses. Monitoring and sample collection was as described above with the exception that BAL fluid was not collected. Collection of BAL Fluid BAL fluid was collected on day 15 post-infection. Animals were sedated with 0.5 mg/kg of xylazine hydrochloride and 0.07 mg/kg of butorphanol tartrate, intravenously. A 10 mm diameter and 1.8 m long bronchoscope was passed via nasal approach into either the left or right lung until wedged in a fourth to sixth generation bronchus. The lavage solution consisted of four aliquots of 50 mL of physiologic saline (0.9% NaCl) solution infused and aspirated immediately. Total nucleated cell count in BAL fluid was determined by use of a hemocytometer. Slides of the BAL fluid were prepared by cytocentrifugation, and air-dried slides were stained by use of Wright-Giemsa stain. A differential count was made by examining 200 cells. Bronchoalveolar lavage fluid was centrifuged at 200 g for 10 minutes. Bronchoalveolar cells were washed and re-suspended in 1 mL of freezing medium containing 90% fetal calf serum (FCS) and 10% DMSO. Cells were placed at -70C for 4 h and then transferred to liquid nitrogen until used for lymphocyte immunophenotyping by flow cytometry. Preparation of R. equi Antigens Antigen for use in proliferation assays was prepared as previously described (Lopez et al., 2002). Briefly, R. equi ATCC 33701 was grown in brain heart infusion (BHI) for 48 h at 37C with agitation. The bacteria were harvested by centrifugation at 3,840 g for 10 minutes and 31

PAGE 32

washed with sterile PBS. Two mL of the bacterial pellet were resuspended in 10 mL of PBS, and the bacteria were disrupted by three cycles of freezing at -20C and thawing in a water bath at 37C. The sample was centrifuged at 12,000 g for 15 min at 4C to separate the pellet of intact bacteria and debris. The resulting supernatant was further centrifuged at 25,000 g for 20 min at 4C to obtain the soluble antigens. The same protocol was used to obtain soluble antigen for Corynebacterium pseudotuberculosis for use as a negative control in the proliferation assays. R. equi antigen for use in ELISA was prepared using a similar protocol except that the bacteria were further disrupted by sonication with 5 sec pulses for 10 min and passage through a French-press at 16,000 psi. Disrupted cells were centrifuged at 13,000 g for 10 minutes, and the supernatant was used. Protein content of each resulting soluble antigen preparation was determined independently using the BCA protein assay kit (Pierce, Rockford IL). The preparations were aliquoted and frozen at -70C until needed. Preparation of BLN Cells, Cell Stimulation, and Proliferation Assay Cells used for proliferation assays were collected from BLN. Briefly, BLN were cut into 125 mm 3 pieces, and cell suspensions were prepared in glass tissue grinders. Mononuclear cells were harvested by density gradient centrifugation using endotoxin-free Ficoll-Paque (Amersham Biosciences, Pittsburgh, PA). Aliquots of 3 X 10 7 cells were placed in 1 mL of freezing medium containing 90% FCS and 10% DMSO. Cells were placed at -70C for 4 h and then transferred to liquid nitrogen until assayed. Immediately after thawing, BLN cells were washed twice and placed in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FCS, 2 mM glutamine, 25 mM HEPES, and penicillin/streptomycin (100 U and 100 g per mL, respectively). More than 70 % of the cells were viable after thawing as assessed using trypan blue exclusion. Proliferative 32

PAGE 33

responses were assessed using a non-radioactive fluorescence assay. This assay has been shown to correlate closely with conventional radioactive [ 3 H] thymidine incorporation in many species, including the horse (Ahmed et al., 1994; Witonsky et al., 2003). Aliquots (100 L) of cells (1 x 10 6 cells/mL) were placed in triplicate wells of 96-well black plates with flat, clear-bottom wells (Corning Inc., Corning, NY). Cells were separately incubated with no antigen (blank), 2 g/mL of Concanavalin A (ConA, positive control), 10 g/mL of C. pseudotuberculosis soluble antigens (negative control), or 10 g/mL of soluble R. equi antigen. Optimal concentrations of antigens and mitogen were determined based on a dose-response curve with soluble R. equi antigen and ConA, respectively. The cells were stimulated at 37C for 72 h in 6% CO 2 . Twelve hours before the end of the assay, 20 L of alamar blue (Accumed International Inc, Westlake, OH) was added to each well and fluorescence was determined with a fluorometer (Synergy HT, BioTek Instruments Inc., Winooski, VT) using an excitation wavelength of 530 nm and emission was measured at 590 nm. Change in fluorescence was calculated as the mean of the stimulated cells minus the mean of the cells without antigen or mitogen (blank). BLN cells used for quantification of mRNA expression were prepared exactly as described above with the exception that the cells were stimulated with the soluble R. equi antigen for 12 h. This time selection was based on a time response curve for IFNand IL-4 mRNA expression. RNA Isolation from BLN Cells, DNase Treatment of RNA Samples, and cDNA Synthesis Isolation of total RNA from BLN cells was performed using Qiagen RNeasy kit (Qiagen Inc., Valencia, CA) according to manufacturer's instructions. RNA concentration was measured by optical density at 260nm. All RNA samples were treated with amplification-grade DNase I (Gibco BRL, Rockville, MD) to remove any trace of genomic DNA contamination. Briefly, 1 U of DNase I and 1 L of 10x DNase I reaction buffer were mixed with 1 g of total RNA for a 33

PAGE 34

total volume of 10 L. The mixture was incubated for 10 minutes at room temperature and then inactivated by addition of 1 L of 25 mM of EDTA and heating at 65C for 10 minutes. cDNA was synthesized with the Advantage RT-for-PCR Kit (Clontech, Palo Alto, CA) by using the protocol of the manufacturer. Briefly, 1 g of DNase-treated total RNA was mixed with 1 L of oligo (dT) 18 primer (20 M) and heated at 70C for 2 min. After cooling to room temperature, the following reagents were added: 4 L of 5 X reaction buffer, 1 L of deoxynucleoside triphosphates (dNTP, 10 mM each), 0.5 L of RNase inhibitor (40 U/L) and 1 L of Moloney murine leukemia virus reverse transcriptase (200 U/L). The mixture was incubated at 42C for 1 h, heated at 94C for 5 min, diluted to a final volume of 100 L, and stored at -70C until used for PCR analysis. Quantification of Cytokine mRNA Gene-specific primers and internal oligonucleotide probes for equine glyceraldehyde-3-phosphate dehydrogenase (G3PDH), IL-2, IL-4, IL-10, and IFNhave been previously described (Ainsworth et al., 2003; Garton et al., 2002). The internal probes were labeled at the 5' end with the reporter dye 6-carboxyfluoresceine and at the 3' end with the quencher dye 6-carboxytetramethyl-rhodamine. Amplification of 2 L of cDNA was performed in a 25 L PCR reaction containing 900 nM of each primer, 250 nM of Taqman probe and 12 L of TaqMan Universal PCR Mastermix (Applied Biosystems). Amplification and detection were performed using the ABI Prism 7700 Sequence Detection System (Applied Biosystems) with initial incubation steps at 50C for 2 min and 95C for 10 min followed by 40 cycles of 95C for 15 sec and 60C for 1 min. Serial dilutions of cDNA from equine blood mononuclear cells stimulated for 24 h with Concanavallin A were used to generate a standard curve for relative quantification of each gene of interest. Each sample was assayed in triplicate, and the mean value was used for 34

PAGE 35

comparison. Samples without cDNA were included in the amplification reactions to determine background fluorescence and check for contamination. To account for variation in the amount and quality of starting material, all the results were normalized to G3PDH expression. Flow Cytometry for Lymphocyte Immunophenotyping Immunophenotyping was performed on BAL and BLN mononuclear cells to determine lymphocyte subsets. All incubations and washes were performed at 4C. After thawing, cells were washed twice in a PBS buffer solution containing 2 % FCS and 0.1% sodium azide. Aliquots of 50 L containing 5x10 5 cells were stained for 30 min with murine monoclonal antibodies binding to equine B lymphocytes (B29A, VMRD Inc., Pullman, WA), T lymphocytes (HB19A, VMRD Inc), CD4 + T lymphocytes (HB61A, VMRD, Inc.), and CD8 + T lymphocytes (MCA2385, Serotec, Raleigh, NC). A monoclonal antibody of the same isotype but not reactive with equine cells was used as the negative control (MCA928, Serotec). After washing twice in cold buffer solution, cells were incubated with rabbit F(ab') 2 anti-mouse IgG conjugated to fluorescein isothiocyante (Serotec) for 30 minutes. Cells were washed and fixed in 1% paraformaldehyde. Analyses were performed with a FACSort flow cytometer equipped with the Cell Quest software (BD Biosciences, Rockville MD). Data were collected from 10,000 events from each sample using forward scatter and side scatter parameters to gate the lymphocyte populations. Data were expressed as the percentage of each subset within the gated population. Determination of Immunoglobulin Concentrations R. equi-specific IgM, IgGa, IgGb, IgGc, and IgG(T) concentrations in serum collected on day 0 (pre-infection) and again on day 15 post-infection were determined by ELISA. Optimal dilutions of reagents were obtained by checkerboard titrations. Wells in Immulon II, 96-well microtiter plates (Thermo Fisher Scientific, Waltham, MA) were coated at 4C overnight with 10 g/mL of the soluble R. equi antigen in carbonate-bicarbonate buffer (pH 9.6; total volume 100 35

PAGE 36

L/well). Plates were washed 4 times with PBS-0.05% Tween 20 between each of the following incubations. Plates were blocked with PBS-1% BSA for 1 h at room temperature. Serum from each experimental animal was diluted 1:100, and 100 L was added to each well for 1 h of incubation at room temperature. To determine isotype-specific responses, 100 L of peroxidase-conjugated goat anti-equine IgGa (1:5000), IgGb (1:5000), IgGc (1:1000), IgG(T) (1:1000), and IgM (1:2500) (Serotec) were added to the wells for 1h incubation at room temperature. After addition of substrate (ABTS, Roche Diagnostics, Indianapolis, IN), plates were incubated for 5 to 45 min in the dark at room temperature, and the OD was measured at 405 nm. For each immunoglobulin subisotype measured, serum from a high responder was serially diluted to generate a standard curve for relative quantification of immunoglobulin concentration in the experimental animals. The standard curve was run on each plate to correct for interplate variability. Wells incubated without serum were used as blank to subtract out the background absorbance. Each sample was run in triplicate, and the mean OD was used. Statistical Analysis Normality of the data and equality of variances was assessed using the Kolmogorov-Smirnov and Levene's tests, respectively. A one way ANOVA was used to compare lymphoproliferative responses, BLN hyperplasia scores, cytokine mRNA expression, and percentage of lymphocyte subsets between experimental groups (control foals, infected foals, control adults, infected adults). Data that did not meet the assumptions for parametric testing were log-transformed. In rare instances when normal distribution of the data was not achieved despite transformation, data were analyzed using the Kruskal-Wallis ANOVA on ranks. A two way ANOVA for repeated measurements was used to determine the effects of time (preversus post-infection), experimental group (control foals, infected foals, control adults, infected adults), 36

PAGE 37

and the interaction between time and experimental group on antibody concentrations. Variables that did not meet the assumptions of the ANOVA were rank-transformed prior to analysis. When appropriate, multiple pairwise comparisons were done using the Student-Newman-Keuls test. Pearson product moment correlations were used to determine the strength of the relationship between each IgG subisotype and IL-4 or IFN-. The z statistic was used to assess significant differences between two coefficients of correlation. For each test, significance was set at P < 0.05. Comparison between immunological parameters from foals infected with a low inoculum and that of foals infected with a high inoculum were done using Student’s t test. Data that did not meet the assumptions for parametric testing after log transformation were compared between the two groups using the Mann-Whitney U test. For each test, significance was set at P < 0.05. Results Disease Process and Pathologic Findings To compare immune responses of foals (susceptible to R. equi infection) and adult horses (resistant to R. equi), five foals and five adult horses were infected intrabronchially with a low inoculum of R. equi. Five foals and five adult horses were not infected and used as controls. Animals were euthanized for sample collection on day 15 post-infection. All animals maintained a normal temperature, heart rate, and respiratory rate, and showed no clinical evidence of disease. White blood cell counts and fibrinogen concentrations also remained within normal limits throughout the study. All five infected foals had macroscopic pulmonary lesions. Approximately 5-15% the lung tissue was firm and reddened, and there were multiple small nodular lesions up to 1 cm in diameter. The BLN of infected foals were considerably larger than those of the other groups. All infected foals had histologic lesions of suppurative to pyogranulomatous bronchopneumonia. R. equi was cultured from the lung of every infected 37

PAGE 38

foal. The mean number of R. equi (log 10 SD) in lung tissue of infected foals was 5.77 1.22 CFU/g of lung tissue. The lungs of control animals and that of infected adult horses were free of lesions and bacterial culture was negative. Lymphoid hyperplasia and sinus histiocytosis were present in the BLN of multiple animals in each group. There was no significant difference in the BLN hyperplasia score between groups. R. equi-Specific Proliferative Responses and Cytokine Profile of BLN Cells To determine whether differences in proliferative responses and cytokine profiles contribute to the susceptibility of foals to infection with R. equi, responses of BLN mononuclear cells from susceptible, infected, foals were compared to that of R. equi-resistant adult horses. Uninfected foals and adult horses were used as controls in these experiments. Proliferative responses of BLN cells to ConA were significantly higher in both groups of foals than in both groups of adult horses (Fig. 3-1A). In contrast, infected and control adult horses had significantly higher proliferative responses to the soluble R. equi antigen than both control and infected foals (Fig. 3-1B). There was no proliferation in response to stimulation with C. pseudotuberculosis (negative control, data not shown). Infected and control foals had significantly lower IL-4 mRNA expression in response to in vitro stimulation of their BLN cells with R. equi antigen compared to both infected and control adults (Fig. 3-2A). Infected foals had had significantly higher IFNmRNA expression than control foals or infected adults (Fig. 3-2B). Infected adult horses had significantly higher IFNmRNA expression than control foals but lower IFNmRNA expression than control adults (Fig. 3-2B). The IFN-/IL-4 ratio of infected foals was significantly higher than that of all 3 other groups (Fig. 3-1C). There was no significant difference in IL-2 or IL-10 mRNA expression between groups (data not shown). 38

PAGE 39

BAL Fluid Cytology and Lymphocytes Subsets in BAL Fluid and BLN Lymphocytes Cytological examination of BAL fluid and immunophenotyping of BAL and BLN cells were performed to determine whether differences in BAL fluid composition exist between R. equiinfected foals and adult horses, and to characterize the subsets of BLN cells used for the proliferation assays and cytokine induction experiments described above. The total nucleated cell count in BAL fluid was not significantly different between groups. The percentage of neutrophils in the BAL fluid of infected foals (17.2 12.3%) was significantly higher than that of all three other groups (mean: 4.7 3.8%). The percentage of macrophages in the BAL fluid of control foals (mean: 84.4 7.2%) was significantly higher than that of both groups of adult horses (mean: 54.9 19.1%). The percentage of lymphocytes in the BAL fluid of control horses (37.8 18.6%) was significantly higher than that of both groups of foals (mean: 10.7 6.9%). There were no significant differences between groups for other cell types on cytological examination. The BAL fluid contained a significantly higher percentage of T cells in all adult horses than in foals (Fig. 3-3A). Adult horses and infected foals had a significantly higher percentage of CD4 + T cells in BAL fluid compared to control foals (Fig. 3-3A). Also, all adult horses had a significantly higher percentage of CD8 + T cells in BAL fluid than both groups of foals (Fig. 3-3A). The BLN cells contained a significantly higher percentage of T cells in control foals than in infected foals (Fig. 3-3B). Infected adult horses had a significantly higher percentage of B cells in their BLN compared to the other 3 experimental groups (Fig. 3-3B). Infected foals had a significantly lower percentage of CD4 + T cells in BLN than control foals (Fig 3-3B). Antibody Response and Correlation Between IgG Subisotypes and the Cytokine Profile Because antibody has been shown to contribute to protection against R. equi infection in foals, we sought to investigate differences in anti-R. equi specific IgM and IgG subisotypes 39

PAGE 40

responses between infected foals and adult horses. Relative antibody concentration between groups was determined by ELISA prior to infection with R. equi, and again on day 15 post-infection. Infection of foals with R. equi resulted in a significant increase in anti-R. equi IgGa, IgGb, IgGc, and IgM concentrations compared to pre-infection values (Fig. 3-4). Control foals had significantly lower anti-R. equi IgGa, IgGb, and IgM concentrations on day 15 post-infection compared to pre-infection values as a result of waning of maternal antibodies (Fig. 3-4). Post-infection anti-R. equi IgGa and IgGb concentrations were significantly higher in infected foals than in both groups of adult horses (Fig. 3-4A and B). Post-infection anti-R. equi IgGc and IgG(T) were not significantly different between infected foals and adult horses (Fig. 3-4C and D). Infection of adult horses with R. equi was only associated with a significant increase in anti-R. equi IgGb concentrations (Fig 3-4B). There were no significant changes in anti-R. equi antibody concentrations in control adult horses during the study. Anti-R. equi IgM concentrations were significantly higher in adult horses than in foals regardless of infection status (Fig 3-4E). To determine if equine IgG subisotypes, like that of mice and humans, can reflect the Th1-Th2 bias of the immune response, we determined the strength of the relationship between each anti-R. equi IgG subisotype and IL-4 or IFN-. There was a significant correlation between anti-R. equi IgG(T) (P = 0.04) and anti-R. equi IgGc (P < 0.0001) and IL-4 (Table 3-1). The coefficient of correlation between anti-R. equi IgGc and IL-4 was significantly higher (P =0.02) than that between anti-R. equi IgGc and IFN(Table 3-1). In contrast, the coefficient of correlation between anti-R. equi IgGa and IFNwas significantly higher (P = 0.04) than that between anti-R. equi IgGa and IL-4 (Table 3-1). 40

PAGE 41

Preliminary Studies on the Effects of the Size of the R. equi Inoculum on Cell-Mediated and Humoral Immune Responses in Foals Three age-matched foals were infected with a 100-fold higher inoculum of R. equi and compared to foals that had received the low inoculum. All 3 foals developed signs of respiratory disease characterized by fever (> 102.5F), tachypnea ( > 40 breaths per minute) and tachycardia (> 100 beats per minute) starting between day 12 and day 14 post-infection. All 3 foals had severe pulmonary lesions characterized by extensive areas of consolidation involving more than 50% of the lungs. The mean number of R. equi in the lungs of foals infected with the high inoculum (log 10 SD: 8.24 1.22 CFU/g) was significantly higher than that of foals infected with the low inoculum (P = 0.02). Proliferative responses to ConA and soluble R. equi antigen as well as immunophenotyping of BAL fluid and BLN cells were not significantly different between the 2 groups (data not shown). Expression of mRNA for IL-2, IL-4, IL-10, and IFNin BLN was not significantly different between groups. There was a tendency (P = 0.084) toward a higher IFN-/IL-4 ratio in the low inoculum group (Fig. 3-5). Foals infected with the high inoculum dose of R. equi produced significantly more anti-R. equi IgG(T) and IgM than foals infected with the low inoculum (Fig. 3-6). Discussion Despite a central role for cell-mediated immune responses in protection against R. equi, most studies in foals have focused on antibody responses. The present study is the first to compare cell-mediated and humoral immune responses of R. equi-susceptible foals to that of resistant adult horses following a controlled experimental challenge. Many studies on the pathogenesis of R. equi in foals have used an overwhelming challenge dose (> 10 9 CFU/foal) that induces considerable pulmonary lesions within 3 days and fulminating clinical signs within 10 days of infection (Gigure et al., 1999a; Hooper-McGrevy et al., 2001; Johnson et al., 1983a). 41

PAGE 42

Epidemiological evidence indicates that most foals on farms where the disease is endemic become infected very early in life (Horowitz et al., 2001). Yet, the median age at the time of diagnosis of R. equi pneumonia on endemic farms is approximately 37 days (Gigure et al., 2002). These findings indicate that the incubation period under natural conditions is much longer than that after overwhelming experimental challenge, presumably because of a lower infective dose. The present study used a lower inoculum of R. equi (approximately 10 6 CFU/foal) to induce subclinical disease and more closely reproduce the situation encountered following natural infection. The small and focal nature of pulmonary lesions may indicate that the foals of the present study were in the process of clearing the infection. Alternatively, it may just reflect a longer incubation period as a result of using a lower inoculum of R. equi. Disease resolution following experimental infection of foals with R. equi has been reported previously (Martens et al., 1989a). In contrast to foals, adult horses are immune and very rarely develop R. equi pneumonia. Prior studies had shown that clearance of R. equi from the lungs of adult horses following intrabronchial challenge is associated with lymphoproliferative responses to R. equi antigens in BAL, but not in peripheral blood lymphocytes (Hines et al., 2001). Because of the paucity of lymphocytes in the BAL fluid of newborn foals (Balson et al., 1997; Hines et al., 2001; Zink and Johnson, 1984), the present study used BLN cells for assessment of immune function. It was found that R. equi-infected foals have significantly reduced proliferative responses to R. equi antigens when compared to adult horses. Poor lymphocyte proliferation in response to R. equi in foals is most likely the result of a naive immune system rather than impaired proliferative ability of neonatal lymphocytes, as evidenced by the significantly higher proliferation of BLN cells from both groups of foals in response to stimulation with ConA. ConA, a mitogen, mediates T 42

PAGE 43

cell proliferation through T cell receptor ligation and activation of downstream signaling pathway, hence indicating normal signaling through the T cell receptors of equine neonates (Pongracz et al., 2003). The proliferative response of control adult horses following in vitro stimulation BLN cells with R. equi was of a similar magnitude to that seen in infected adult horses. This is consistent with the fact that virtually all adult horses are immune to the pathogen and continuously exposed to R. equi in their environment. As a result, the present study did not include true unexposed control adult horses. However, environmental exposure of foals to R. equi was minimized in the present study by moving them to an isolation facility shortly after birth. In one study, pulmonary lymphocytes from adult horses collected 7 days following challenge with R. equi expressed predominantly IFNbut they also expressed IL-4 mRNA in response to in vitro stimulation with R. equi antigen (Lopez et al., 2002). Almost identical results were obtained in the present study with a mean IFN-/IL-4 ratio of 2.4 in infected adult horses. Although the present study is limited to quantification of mRNA expression, a recent study has documented an excellent correlation between IFNmRNA expression and actual protein production in foals (Breathnach et al., 2006). The mechanisms regulating neonatal immune responses are not completely understood, regardless of the species. Cell-mediated immune responses of murine and human neonates are generally thought to be biased toward a Th2 response (Adkins, 2000). In a recent study, peripheral blood and BAL mononuclear cells from newborn foals were deficient in their ability to produce IFNfollowing ex vivo stimulation with phorbol myristate acetate (Breathnach et al., 2006). In the same study IFNproduction increased in an age-dependant manner reaching adult levels around 3 months of age (Breathnach et al., 2006). These findings have led to the 43

PAGE 44

hypothesis that foals are born with an inherent inability to mount a Th-1-based cell-mediated immune response which may contribute to their susceptibility to R. equi (Breathnach et al., 2006). The present study clearly shows that young foals can mount strong Th1-based immune responses to R. equi as evidenced by their significantly higher IFNmRNA expression in BLN cells following stimulation with R. equi antigens and significantly higher IFN-/IL-4 ratio compared to that of adult horses. However, consistent with the findings of Breathnach et al. (Breathnach et al., 2006), IFNinduction in the uninfected control foals was considerably lower than that of uninfected control adult horses. These findings suggest that, like human and murine neonates, foals have the ability to mount adult-like Th1-based responses providing the appropriate stimulus. Consistent with these results, a previous study documented the presence of IFNbut not IL-4 in the lungs of foals experimentally infected with R. equi (Gigure et al., 1999b). Previous studies have shown that, although the default response is of the Th2 phenotype, murine neonates can mount Th1 responses providing the right antigen, dose of antigen, costimulatory signal, or type of adjuvant (Adkins, 2005; Barrios et al., 1996; Forsthuber et al., 1996; Martinez et al., 1997; Sarzotti et al., 1996). Similarly, human neonates also have the ability to mount strong Th1 responses. For example, vaccination of infants with Mycobacterium bovis BCG, a microorganism closely related to R. equi, induces IFNproduction of a similar magnitude to that produced by adults (Marchant et al., 1999; Ota et al., 2002; Vekemans et al., 2001). The higher IFNinduction and IFN-/IL-4 ratio in infected foals compared to infected adults is more likely due to continuous antigenic stimulation as a result of established infection in foals rather than a greater ability to express IFN-. R. equi was cleared very rapidly by adult horses and, in contrast to infected foals, these horses were essentially normal at the time of sample collection. 44

PAGE 45

Consistent with previous studies, the present study also found a significantly higher percentage of macrophages and significantly lower percentage of T lymphocytes, CD4 + T lymphocytes, and CD8 + T lymphocytes in BAL fluid of healthy foals compared to healthy adult horses (Balson et al., 1997; Flaminio et al., 2000). Infection with R. equi in foals does not result in significant alterations in lymphocyte subpopulations in peripheral blood (Flaminio et al., 1999). In contrast, infection of foals with R. equi in the present study resulted in a significant increase in the percentage of T lymphocytes and CD4 + T lymphocytes in BAL fluid. This was associated with a significant decrease in the percentage of these two cell populations in the BLN. Work in adult horses has also shown that immune responses to R. equi are compartmentalized, being detectable in the lungs but not in peripheral blood (Hines et al., 2001). In the present study, inoculation of adult horses with R. equi only resulted in a slight but significant increase in the percentage of B cells compared to uninfected adults. This is in contrast to a previous study in which infection of adult horses with R. equi resulted in a significant increase in both CD4 + and CD8 + T lymphocytes (Hines et al., 2001). Differences between studies may be explained by the different methods of inoculation. Although the size of inoculum was similar, the aforementioned study delivered the entire inoculum in a focal area of a lung (Hines et al., 2001) whereas the current study delivered the bacteria into both main bronchi in an attempt to induce more generalized changes. Consistent with this theory is the fact that the BAL changes reported by Hines et al. (Hines et al., 2001) were much more pronounced in BAL fluid from the infected lung segment compared to that of the contralateral lung. Focal pulmonary challenge with R. equi in adult horses results in mild increase in serum IgG(T) concentrations along with a marked increase in serum IgGa and IgGb concentrations (Lopez et al., 2002). Only a significant increase in serum anti-R. equi IgGb concentrations was 45

PAGE 46

noted in infected adult horses in the present study. Foals showed a marked increase in serum anti-R. equi IgGa and IgGb following infection with R. equi, resulting in serum concentrations significantly higher than that of adult horses. In a previous study, endogenous IgGb production could not be detected in foals until day 63 of age (Sheoran et al., 2000). The present study clearly shows that much younger foals can mount a considerable IgGb response providing the right stimulus. In agreement with the current study, previous studies have also shown that foals naturally exposed to R. equi produce mainly IgGa but also IgGb (Hooper-McGrevy et al., 2003; Takai et al., 2002). In mice and humans, IgG subisotypes are indirect indicators of T cell responses, reflecting the role of Th1 and Th2 cytokines in class switching by B cells. The direct association between IgG subisotypes and cytokine profile has not been established in horses. In the present study, anti-R. equi IgGc and IgG(T) were associated with a Th2 (IL-4) cytokine profile whereas anti-R. equi IgGa was more associated with a Th1 (IFN-) response. A preliminary study was also conducted to look at the effect of challenge dose on the immune responses of foals. A higher inoculum of R. equi was administered to three foals and their immune responses were compared to the five infected foals from our primary study. These higher challenge dose (HCD) foals became clinically ill during the experiment and developed more severe lesions related to the R. equi infection than the lower challenge dose (LCD) foals. Even though there was not a significant difference between the groups in expression of mRNA for the each of the cytokines there was a tendency towards higher IFN-/IL-4 ratio in the LCD foals. Also supporting this difference is the fact that HCD foals have significantly more anti-R. equi IgG(T) concentrations, which this study showed to be more associated with a Th2 cytokine profile. Switching of the type of cell-mediated responses has been shown in neonatal mice when responding to varying inoculums of mouse leukemia virus(Sarzotti et al., 1996). Additional 46

PAGE 47

studies using a larger number of foals will be required to determine the effect of the infective dose on the cytokine profile. If the differences between groups and variance observed in this study are adequate estimates of the population, detection of significant differences in the IFN-/IL-4 ratio between LCD and HCD foals with an 80% probability at a P0.05 level, would have required a sample size of 12 foals per group. In conclusion, the present study shows that foals have a nave immune system when compared to adult horses. However, their peculiar susceptibility to infection with R. equi cannot be explained by generalized IFNdeficiency or inappropriate polarization of the immune response toward the Th2 phenotype. Further work is required to identify the fundamental host basis of the susceptibility of foals to R. equi pneumonia. 47

PAGE 48

Table 3-1. Correlation between IgG subisotypes in serum and IL-4 or IFNmRNA expression in BLN cells. Five foals and five adult horses were infected intrabronchially with virulent R. equi and serum and BLN cells were collected 15 days post-infection. Five uninfected foals and five adult horses were used as controls. Coefficient of correlation IgG subisotype IL-4 IFNIgGa -0.27 a 0.38 b IgGb -0.12 0.33 IgGc 0.79* ,a 0.30 b IgG(T) 0.46* 0.06 a,b Indicates a significantly different coefficient of correlation between a given subisotype and IL-4 versus that of the same subisotype and IFN(P < 0.05). *Indicates a statistically significant correlation (P < 0.05). 48

PAGE 49

Figure 3-1. Proliferative responses of BLN cells from five foals and five adult horses 15 days after challenge with virulent R. equi. Five foals and five adult horses were used as uninfected controls. BLN cells were either stimulated A) with ConA or B) with soluble R. equi antigens. The change in fluorescence was calculated as the mean fluorescence of the stimulated cells minus that of the same cells cultured without mitogen or antigen. The results are displayed as mean SD. a,b Different letters between experimental groups indicate a statistically significant difference (P < 0.05) 49

PAGE 50

Figure 3-2. Relative A) IL-4 and B) IFNmRNA expression as well as C) IFN-/IL-4 ratio following stimulation of BLN cells with soluble R. equi antigens. BLN cells were collected from 5 foals and 5 adult horses 15 days after challenge with virulent R. equi. Five foals and 5 adult horses were used as uninfected controls. The results are displayed as mean SD. a,b,c Different letters between experimental groups indicate a statistically significant difference (P < 0.05). 50

PAGE 51

Infected foals Control foals Infected adults Control adults 0102030405060708090T-cellsB-cellsCD4CD8% cells 0102030405060708090T-cellsB-cellsCD4CD8% cells Infected foals Control foals Infected adults Control adults 0102030405060708090T-cellsB-cellsCD4CD8% cells 0102030405060708090T-cellsB-cellsCD4CD8% cellsABabcacaabbacaababababaaababab Infected foals Control foals Infected adults Control adults 0102030405060708090T-cellsB-cellsCD4CD8% cells 0102030405060708090T-cellsB-cellsCD4CD8% cells Infected foals Control foals Infected adults Control adults 0102030405060708090T-cellsB-cellsCD4CD8% cells 0102030405060708090T-cellsB-cellsCD4CD8% cellsABabcacaabbacaababababaaababab Figure 3-3. Lymphocyte subpopulations in A) BAL fluid and B) BLN from 5 foals and 5 adult horses 15 days after challenge with virulent R. equi. Five foals and 5 adult horses were used as uninfected controls. The subpopulations are displayed as a percentage of the total gated cells (mean SD). a,b,c Different letters between experimental groups indicate a statistically significant difference (P < 0.05). The difference is not significant when at least one letter is in common. 51

PAGE 52

020040060080010001200Infected foalsControl foalsInfected adultsControl adultsRelative concentration 020040060080010001200140016001800Infected foalsControl foalsInfected adultsControl adultsRelative concentration 0100020003000400050006000Infected foalsControl foalsInfected adultsControl adultsRelative concentration 05001000150020002500Infected foalsControl foalsInfected adultsControl adultsRelative concentration 01002003004005006007008009001000Infected foalsControl foalsInfected adultsControl adultsRelative concentrationIgGaIgGcIgG(T)IgGbIgMABCDEacacbcb1222*****acacbcb1222acbca1112*aaaa1,2122aabb1323**a 020040060080010001200Infected foalsControl foalsInfected adultsControl adultsRelative concentration 020040060080010001200140016001800Infected foalsControl foalsInfected adultsControl adultsRelative concentration 0100020003000400050006000Infected foalsControl foalsInfected adultsControl adultsRelative concentration 05001000150020002500Infected foalsControl foalsInfected adultsControl adultsRelative concentration 01002003004005006007008009001000Infected foalsControl foalsInfected adultsControl adultsRelative concentrationIgGaIgGcIgG(T)IgGbIgMABCDEacacbcb1222*****acacbcb1222acbca1112*aaaa1,2122aabb1323**a Figure 3-4. Relative serum anti-R. equi IgM and IgG subisotype concentrations in five foals and five adult horses before (solid bars) and 15 days after challenge with virulent R. equi (dotted bars). Five foals and five adult horses were used as uninfected controls. The results are displayed as mean SD. a,b,c Different letters between experimental groups indicate a statistically significant difference in pre-infection immunoglobulin concentrations. 1,2 Different numbers between experimental groups indicate a statistically significant difference in post-infection immunoglobulin concentrations. *Indicates a significant difference between preand post-infection immunoglobulin concentrations for a given group (P < 0.05). 52

PAGE 53

0.005.0010.0015.0020.0025.0030.0035.00Low inoculumHigh inoculumIFN-/IL-4 ratio P=0.08 Figure 3-5. Effect of the size of inoculum on IFN-/IL-4 ratio in the BLN of foals infected intrabronchially with either a high challenge dose or low challenge dose of R. equi. The results are displayed as mean SD. 53

PAGE 54

* * Figure 3-6. Relative increase in anti-R. equi antibody concentrations in foals infected with a low or with a high inoculum of R. equi. Results represent the ratio of antibody concentration at 15 days post-infection to that of pre-infection. The results are displayed as mean SD. *Indicates a significant difference between low and high inoculum for a given type of immunoglobulin (P < 0.05). 54

PAGE 55

CHAPTER 4 IN VIVO EXPRESSION OF, AND CELL MEDIATED IMMUNE RESPONSES TO, THE PLASMID-ENCODED VIRULENCE ASSOCIATED PROTEINS OF Rhodococcus equi IN FOALS Abstract Rhodococcus equi is a facultative intracellular pathogen that causes pneumonia in foals but does not induce disease in adult horses. Virulence of R. equi depends on the presence of a large plasmid, which encodes a family of seven virulence associated proteins (VapA and VapC to VapH). Eradication of R. equi from the lungs depends on gamma interferon (IFN-) production by T lymphocytes. The objectives of the present study were to determine the relative in vivo mRNA expression of the vap genes of R. equi in the lungs of infected foals, to determine the lymphoproliferative response of bronchial lymph node (BLN) lymphocytes from foals and adult horses to each of the Vap proteins, and to compare the cytokine profile of proliferating lymphocytes between foals and adult horses. vapA, vapD, and vapG were preferentially expressed in the lungs of infected foals and expression of these genes in the lungs was significantly (P < 0.05) higher than that achieved during in vitro growth. VapA and VapC induced the strongest lymphoproliferative responses in foals and adult horses. There was no significant difference in lymphoproliferative responses or IFNmRNA expression by BLN lymphocytes between foals and adults. In contrast, interleukin (IL)-4 mRNA expression was significantly higher in adults than in foals for each of the Vap protein. The ratio of IFN-/IL-4 was significantly higher in foals than in adult horses for most Vap proteins. Therefore, foals are immunocompetent and capable of mounting lymphoproliferative responses of the same magnitude and cytokine phenotype as that of adult horses. 55

PAGE 56

Introduction Rhodococcus equi, a Gram-positive facultative intracellular pathogen, is one of the most important causes of pneumonia in foals aged between 3 weeks and 5 months. R. equi has also emerged as a significant opportunistic pathogen in immunosuppressed people, especially those infected with the human immunodeficiency virus (Arlotti et al., 1996; Donisi et al., 1996; Harvey and Sunstrum, 1991). In foals, the course of the disease is insidious and pathology is often extensive by the time the disease is diagnosed. Unlike environmental R. equi, isolates from pneumonic foals typically contain an 80-90 kb plasmid. Plasmid-cured derivatives of virulent R. equi strains lose their ability to replicate and survive in macrophages (Gigure et al., 1999a). Plasmid-cured derivatives also fail to induce pneumonia and are completely cleared from the lungs of foals, confirming the absolute necessity of the large plasmid for the virulence of R. equi (Gigure et al., 1999a; Wada et al., 1997). A 27.5 kb region of the virulence plasmid bears the hallmark of a pathogenicity island and contains the genes for a family of seven closely related virulence-associated (Vap) proteins designated VapA and VapC to VapH (Takai et al., 2000a). Although a recent study has proposed the designation vapI for another gene of the pathogenicity island, vapI is not functional (Polidori and Haas, 2006). In a recent study, a R. equi mutant lacking a 7.9 kb DNA region spanning 5 vap genes (vapA, -C, -D, -E, -F) was attenuated for virulence in mice and failed to replicate in macrophages (Jain et al., 2003). Only complementation with vapA could restore full virulence, whereas complementation with vapC, vapD or vapE could not (Jain et al., 2003). All vap genes are expressed during in vitro growth and are upregulated when R. equi is grown in equine macrophage monolayers (Ren and Prescott, 2003). Because of the facultative intracellular nature of R. equi, cell-mediated immune mechanisms are thought to be of major importance in resistance. Most knowledge of cell56

PAGE 57

mediated immunity to R. equi infections comes from studying infections of mice. In mice, functional T lymphocytes are required for the clearance of virulent R. equi. Although both CD4 + and CD8 + T cells contribute to host defense against R. equi in mice, CD4 + T lymphocytes play the major role and are required for complete pulmonary clearance (Kanaly et al., 1993). Studies in mice have also clearly shown that a Th1 response, characterized by IFNinduction, is sufficient to effect complete pulmonary clearance of R. equi whereas a Th2 response, characterized by IL-4 induction, is detrimental (Kanaly et al., 1995; Kanaly et al., 1996). How these findings in mice relate to the foal remains to be determined. As opposed to foals, adult horses completely clear an intrabronchial challenge with virulent R. equi and do not develop clinical signs. Clearance of R. equi in adult horses is associated with a significant increase in BAL fluid CD4 + and CD8 + lymphocytes, lymphoproliferative responses to R. equi antigens including VapA, development of R. equi-specific cytotoxic T lymphocytes, and IFNinduction (Hines et al., 2001; Hines et al., 2003; Hooper-McGrevy et al., 2001; Lopez et al., 2002; Patton et al., 2004). A few studies have examined antibody responses of foals and adult horses to the Vap proteins of R. equi (Hooper-McGrevy et al., 2003; Lopez et al., 2002). However, cell-mediated immune responses and cytokine profiles of foals and adult horses to each of the Vap proteins have never been evaluated. Knowledge of gene products preferentially induced during infection in the natural host would provide important insight into the pathogenesis of the disease and may prove important for vaccine development. Despite the documented importance of some of the vap genes in the virulence of R. equi, relative expression of these genes during active infection in foals has not been studied. In regards to the above, the objectives of the present study were to determine the relative in vivo mRNA expression of the functional vap genes of R. equi in the lungs of infected foals, to 57

PAGE 58

determine the lymphoproliferative response of foals to each of the functional Vap protein and compare it to that of resistant adult horses, and to determine the cytokine profile of proliferating lymphocytes in both foals and adult horses. Materials and Methods Animals and Intrabronchial Challenge Five foals between 7 and 10 days of age and five adult horses between 2 and 12 years of age were used in this study. Adequate transfer of passive immunity was confirmed in foals at 12 to 24 h of age by measurement of plasma IgG concentration using a commercial immunoassay (DVM Stat, Corporation for advanced Applications, Newburg, WI). Foals together with their dams were moved to individual stalls in an isolation facility the day after birth. Adult horses were moved to the isolation facility at least 2 days prior to the beginning of the study. Prior to initiation of the study, all animals were determined to be healthy on the basis of a thorough physical examination, complete blood count, biochemical profile, cytology and bacterial culture of a tracheobronchial aspirate, and thoracic radiographs. R. equi ATCC 33701, a strain containing an 80 kb virulence plasmid, was used to infect foals (Takai et al., 2000a). Aliquots of R. equi were grown on trypticase soy agar (TSA) plates for 48 h at 37C. Bacteria were harvested with 4 mL of sterile phosphate buffered saline (PBS) per plate. The bacterial concentration was determined from colony forming unit (CFU) counting. Each animal was infected intrabronchially with an inoculum of 2 x 10 4 CFUs per kg of body weight. This corresponded to a total inoculum of approximately 1 x 10 6 for each foal and 1 x 10 7 for each adult horse. The inoculum was diluted in 50 mL of sterile PBS. Prior to infection, animals were sedated with 0.5 mg/kg of xylazine hydrochloride and 0.07 mg/kg of butorphanol tartrate, intravenously. A flexible fiberoptic endoscope was used to deliver 25 mL of the bacterial suspension into each main bronchi. Animals were clinically assessed based on daily complete 58

PAGE 59

physical examinations as well as twice daily heart rate, respiratory rate and temperature recording. Euthanasia was performed 15 days post-infection by intravenous administration of a lethal dose of pentobarbital sodium. Bronchial lymph nodes (BLN) were collected aseptically and placed in sterile PBS for transport to the laboratory. Two lung tissue samples (approximately 1 g each) were collected aseptically from a cranioventral lung lobe. This area corresponded to the most severely affected location in all foals. One sample was immediately frozen in liquid nitrogen for subsequent bacterial RNA isolation and the other was placed in a sterile bag for quantitative bacterial culture. Preparation of Bronchial Lymph Node Cells, Cell Stimulation, and Lymphocyte Proliferation Assay Vap proteins (VapA, -C, -D, -E, -F, -G, and -H) for use in proliferation assays were obtained as glutathione S-transferase fusion proteins as previously described (Hooper-McGrevy et al., 2003). Cells used for proliferation assays were collected from BLN. Briefly, BLN were cut into 125 mm 3 pieces, and the cells were separated in glass tissue grinders. Mononuclear cells were separated by density gradient centrifugation for 30 min at 400 g using endotoxin-free Ficoll-Paque (Amersham Biosciences, Pittsburgh, PA). Aliquots of 3 X 10 7 cells were placed in 1 mL of freezing medium containing 90% fetal calf serum (FCS) and 10% DMSO. Cells were placed in Mr Frosty (Nalgene cyro 1C Freezing container, Fisher Scientific) controlled freezing containers then frozen at -70C for 4 h and then transferred to liquid nitrogen until assayed. Immediately after thawing, BLN cells were washed twice and placed in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FCS, 2 mM glutamine, 25 mM HEPES, and penicillin/streptomycin (100 U and g per mL, respectively). More than 70 % of the cells were viable after thawing. Proliferative responses were assessed using a non59

PAGE 60

radioactive fluorescence assay. This assay has been shown to correlate closely with conventional radioactive [ 3 H] thymidine incorporation in many species, including the horse (Ahmed et al., 1994; Witonsky et al., 2003). Aliquots (100 L) of cells (1 x 10 6 cells/mL) were placed in triplicate wells of 96-well black plates with flat, clear-bottom wells (Corning Inc., Corning, NY). Cells were separately incubated with no antigen (blank), 2 g/mL of Concanavalin A (positive control), 10 g/mL of Corynebacterium pseudotuberculosis soluble antigens (negative control), or 50 g/mL of each of the recombinant protein (VapA, -C, -D, -E, -F, -G, and -H). Optimal concentrations of antigens and mitogen were determined based on a dose-response curve with VapA and ConA, respectively. The cells were stimulated at 37C for 72 h in 6% CO 2 . Twelve h before the end of the assay, 20 L of alamar blue (Accumed International Inc, Westlake, OH) was added to each of the wells. Plates were read on a fluorometer (Synergy HT, BioTek Instruments Inc., Winooski, VT) using an excitation wavelength of 530 nm and emission was measured at 590 nm. Change in fluorescence ( fluorescence) was calculated as the mean of the stimulated cells minus the mean of the cells without antigen or mitogen (blank). BLN cells used for quantification of mRNA expression were prepared exactly as described above with the exception that the cells were stimulated with each of the Vap antigen for 12 h. This time selection was based on a time response curve for IFNand IL-4 mRNA expression. RNA Isolation from BLN Cells, DNase Treatment of RNA Samples, and cDNA Synthesis Isolation of total RNA from BLN cells was performed using Qiagen RNeasy kit (Qiagen Inc., Valencia, CA) according to manufacturer's instructions. RNA concentration was measured by optical density at 260nm. All RNA samples were treated with amplification-grade DNase I (Gibco BRL, Rockville, MD) to remove any trace of genomic DNA contamination. Briefly, 1 U of DNase I and 1 L of 10x DNase I reaction buffer were mixed with 1 g of total RNA to yield 60

PAGE 61

10 L reaction mixture. The mixture was incubated for 10 minutes at room temperature and then inactivated by addition of 1 L of 25 mM of EDTA and heating at 65C for 10 minutes. cDNA was synthesized with the Advantage RT-for-PCR Kit (Clontech, Palo Alto, CA) by using the protocol of the manufacturer. Briefly, 1 g of total RNA was mixed with 1 L of oligo (dt) 18 primer (20 M) and heated at 70C for 2 min. After cooling to room temperature the following reagents were added: 4 L of 5 X reaction buffer, 1 L of deoxynucleoside triphosphates (dNTP, 10 mM each), 0.5 L of RNase inhibitor (40 U/L) and 1 L of Moloney murine leukemia virus reverse transcriptase (200 U/L). The mixture was incubated at 42C for 1 h, heated at 94C for 5 min, diluted to a final volume of 100 L, and stored at -70C until used for PCR analysis. Quantification of Cytokine mRNA Gene specific primers and internal oligonucleotide probes for equine glyceraldehyde-3-phosphate dehydrogenase (G3PDH), IL-4, and IFNhave been previously described (Garton et al., 2002). The internal probes were labeled at the 5' end with the reporter dye 6-carboxyfluoresceine, and at the 3' end with the quencher dye 6-carboxytetramethyl-rhodamine. Amplification of 2 L of cDNA was performed in a 25 L PCR containing 900 nM of each primer, 250 nM of Taqman probe and 12 L of TaqMan Universal PCR Mastermix (Applied Biosystems, Foster City, CA). Amplification and detection were performed using the ABI Prism 7700 Sequence Detection System (Applied Biosystems) with initial incubation steps at 50C for 2 min and 95C for 10 min followed by 40 cycles of 95C for 15 sec and 60C for 1 min. Serial dilutions of cDNA from 24 h Concanavallin A-stimulated equine blood mononuclear cells were used to generate a standard curve for relative quantification of each gene of interest. Each sample was assayed in triplicate and the mean value was used for comparison. Samples without 61

PAGE 62

cDNA were included in the amplification reactions to determine background fluorescence and check for contamination. To account for variation in the amount and quality of starting material, values obtained for IFNand IL-4 transcripts were normalized by dividing by the G3PDH transcript level for the same sample. The sample with the lowest mRNA expression was designated 1 and relative quantification between samples was reported as the n-fold difference relative to cytokine mRNA expression in that sample. Bacterial RNA Isolation, DNase Treatment of Bacterial RNA Samples, and cDNA Synthesis Bacterial RNA extraction for determination of in vivo mRNA expression of the vap genes was performed on lung tissue from the five infected foals. For determination of in vitro mRNA expression of the vap genes, one colony of R. equi ATCC 33701 was placed into five separate tubes, each containing 5 mL of brain heart infusion (BHI) broth with 1% yeast extract. The suspensions were grown in a shaking incubator at 37C for 18 h. A 125 mm 3 section of lung tissue and pellets from in vitro grown bacteria were independently pulverized in cold Trizol reagents (Invitrogen Corporation, Carlsbad, CA) using glass tissue grinders. Total RNA was extracted using the Trizol reagents by following the instructions from the manufacturer. RNA from each source was further purified independently by passing the resulting sample through RNeasy MinElute Spin Columns (Qiagen Inc.) with on-column DNase treatment according to the manufacturer's instructions. To deplete equine RNA and further enrich bacterial RNA, RNA samples from lung tissue were additionally subjected to the MICROBEnrich kit (Ambion Inc., Austin, TX). Then, in an attempt to completely eliminate genomic DNA contamination, each RNA sample underwent an additional treatment with amplification-grade DNase I (Gibco BRL) before reverse transcription. Synthesis of cDNA was performed as described above except that random hexamer priming (20 M) was used. Duplicate RNA samples were subjected to the 62

PAGE 63

same reverse transcription protocol minus the reverse transcriptase to confirm the absence of genomic DNA contamination or give a baseline used to subtract out traces of remaining genomic DNA contamination. Quantification of R. equi vap mRNA Gene specific primers and internal oligonucleotide probes for vapA, vapC, vapD, vapE, vapF, vapG, and vapH were selected based on the plasmid DNA sequence of R. equi ATCC 33701 using the Primer Express Software (Table 4-1). Primer and probe sequences for 16S rRNA, used as a housekeeping gene in the present study, have been reported previously (Miranda-Casoluengo et al., 2005). Serial dilutions of plasmid DNA from strain ATCC 33701 were used to generate a standard curve for relative quantification of the vap genes. Genomic DNA from R. equi strain 33701 , the plasmid cured derivative of ATCC 33701, was used to generate a standard curve for relative quantification of 16S rRNA. Amplification and detection were performed as described above under quantification of cytokine mRNA. Calculated amplification efficiencies for primer/probe assays ranged between 89.0 % and 99.9 %. Coefficient of correlations (r) of the standard curves ranged between 0.981 and 0.995. To account for variation in the amount and quality of starting material, values obtained for vap transcripts were normalized by dividing by the 16S rRNA transcript level for the same sample. The sample with the lowest mRNA expression was designated 1 and relative quantification between samples was reported as the n-fold difference relative to mRNA expression in that sample. In rare instances when traces of genomic DNA were detected, the concentration of genomic DNA was subtracted from that of mRNA expression. Statistical Analyses Statistical analyses were performed by using SigmaStat (version 3.0, SPSS Inc., Chicago, IL). Differences in lymphocyte proliferation and cytokine mRNA expression between foals and 63

PAGE 64

adult horses as well as differences between in vivo versus in vitro mRNA expression of each vap gene were assessed using the Mann-Whitney U test. Differences in lymphocyte proliferation and cytokine mRNA expression between Vap proteins for a given group (foals or adults) as well as differences in the relative mRNA expression of each vap gene within a given sampling site (in vivo or in vitro) were assessed using the Friedman repeated measure ANOVA on ranks. When appropriate, multiple pairwise comparisons were done using the Student-Newman-Keuls test. Significance was set at P < 0.05. Results Disease Process and Macroscopic Findings All animals maintained normal vital signs during the study and showed no evidence of disease. All five infected foals had macroscopic pulmonary lesions that consisted of mild to moderate areas of consolidation in the ventral lung lobes along with multiple small nodular lesions up to 1 cm in diameter. The mean number of R. equi ( SD) was 9.63 x 10 6 1.21 x 10 7 (range: 6.23 x 10 4 to 2.33 x 10 7 ) CFU/g of lung tissue. The lungs of adult horses were exempt of lesions and bacterial culture was negative. In vivo mRNA Expression of the R. equi vap Genes Real-time PCR was used to quantify the relative in vivo mRNA expression of the vap genes in the lung tissue of infected foals, and the mRNA expression was compared to that of in vitro grown bacteria. mRNA expression of vapA, vapD, and vapG was significantly higher during in vivo than during in vitro growth (Fig. 4-1). mRNA expression of vapG in the lung tissue was significantly higher than that of all the other vap genes. mRNA expression of vapA and vapD in lung tissue was significantly higher than that of vapC, vapE, vapF, and vapH (Fig. 4-1). The mRNA expression of the vap genes during in vitro growth followed a similar pattern with significantly greater mRNA expression of vapA, vapD, and vapG (Fig. 4-1). 64

PAGE 65

Vap-Specific Proliferative Responses and Cytokine mRNA Expression To determine whether differences in lymphoproliferative responses and cytokine profiles may be at the origin of the peculiar susceptibility of foals to infection with R. equi, responses of susceptible, infected foals was compared to that of R. equi resistant adult horses. Proliferation of BLN mononuclear cells following stimulation with each recombinant Vap protein was measured. There were no significant differences in lymphoproliferative responses to each of the Vap proteins between infected foals and adult horses (Fig. 4-2). In foals, lymphoproliferative responses to VapA were significantly higher than that to all of the other Vap proteins and lymphoproliferative responses to VapC were significantly greater than all Vap proteins except VapA (Fig. 4-2). In adult horses, lymphoproliferative responses to VapA and VapC were significantly higher than that to the other Vap proteins (Fig 4-2). Induction of IFNand IL-4 in proliferating cells was quantified by real time RT-PCR. There was no significant difference in IFNmRNA expression by BLN cells between foals and adult horses for any of the Vap proteins (Fig. 4-3A). In contrast, IL-4 mRNA expression for each of the Vap proteins was significantly higher in adult horses than in foals (Fig. 4-3B). The ratio of IFN-/IL-4 was significantly higher in foals than in adult horses for VapA, VapC, VapD, VapF, and VapH (Fig. 4-3C). Discussion Despite a central role for cell-mediated immune responses in protection against R. equi, most studies have focused on antibody responses against the Vap proteins. This is the first study to examine the mRNA expression of vap genes in the lungs of R. equi infected foals and to measure lymphoproliferative responses as well as the cytokine profile of infected foals and adult horses to each of the functional Vap proteins. It complements an earlier study by Hooper-McGrevy et al. (Hooper-McGrevy et al., 2003) that examined the serum immunoglobulin G 65

PAGE 66

subisotype responses to each of the Vap proteins in foals and in adult horses, as well as a study evaluating the expression of the pathogenicity island genes in equine macrophages (Ren and Prescott, 2003). VapA is expressed on the bacterial surface and its expression is temperature regulated, occurring between 34 and 41C (Takai et al., 1996a). In contrast, VapC, -D and -E are secreted proteins concomitantly regulated by temperature with VapA, being produced at 37C but not at 30C (Byrne et al., 2001). The cellular locations of VapF, VapG, and VapH are unknown. In one study, all vap genes were upregulated when R. equi was grown in equine macrophage monolayers compared to expression during in vitro growth at 30C (Ren and Prescott, 2003). In the same study, vapA and vapC were the most highly upregulated of the vap genes (Ren and Prescott, 2003). In the present study, only vapA, vapD, and vapG were expressed at significantly higher levels in vivo compared to during in vitro growth. The discrepancy between these studies may result from the fact that culture in macrophage monolayers does not accurately reflect all the conditions experienced by the pathogen in the lungs of foals. In addition, relative expression of the vap genes may depend on the stage of infection. The present study evaluated mRNA expression in the lungs of foals 2 weeks after infection whereas the macrophage study evaluated expression 4 h after infecting the monolayers with R. equi. Finally, differences in temperatures for in vitro growth between the 2 studies may at least partially explain some of the inconsistencies. The macrophage study grew R. equi in vitro at 30C, a temperature known to decrease expression of the Vap proteins (Byrne et al., 2001; Ren and Prescott, 2003). In contrast, the present study used a more physiological temperature of 37C to maximize vap gene expression during in vitro growth, hence minimizing the likelihood of identifying differences due only to dissimilar growth conditions. 66

PAGE 67

The exact role of each Vap protein remains to be determined, but they are probably involved in preventing acidification and late endosomal maturation of R. equi-containing vacuoles within macrophages (Fernandez-Mora et al., 2005; Toyooka et al., 2005). Regulation of expression of the vap genes is complex and depends on at least 5 environmental signals including temperature, pH, oxidative stress, magnesium, and iron (Benoit et al., 2001; Benoit et al., 2002; Ren and Prescott, 2003; Takai et al., 1996a). The vapA and vapD genes are the major acid-inducible determinants encoded by the virulence plasmid (Benoit et al., 2001). In another study, vapA and vapG were predominantly induced by H 2 O 2 treatment (Benoit et al., 2002). These findings have led to the hypothesis that VapA, VapD, and VapG may play a dominant role in protection against macrophage related stresses (Benoit et al., 2002). That, vapA, vapD, and vapG were expressed at significantly higher levels than the other vap genes in the lungs of infected foals in the present study is consistent with this hypothesis. These 3 genes were also significantly more expressed in vivo than in vitro. Several lines of evidence suggest that immune responses against VapA and potentially other Vap proteins confer a role in protection (Hooper-McGrevy et al., 2001; Lopez et al., 2002). A recent study in mice has shown that DNA immunization with vapA protects against R. equi infection and that the IgG subisotype response is consistent with a Th1-based immune response (Haghighi and Prescott, 2005). A similar DNA vaccine containing the vapA gene has been shown to induce strong cell-mediated immune responses in adult horses (Lopez et al., 2003). In foals, production of antibody to VapA and VapC, but not that to other Vap proteins, increases following natural exposure to R. equi (Hooper-McGrevy et al., 2003). The present study shows that VapA and VapC are also the proteins inducing the strongest lymphoproliferative responses following experimental challenge in both foals and adult horses. A prior study had demonstrated 67

PAGE 68

strong lymphoproliferative recall responses to VapA in association with clearance of R. equi in adult horses (Lopez et al., 2002). The present study confirmed this finding and also demonstrated that lymphocytes from both foals and adult horses proliferate similarly in response to each Vap protein. The documented importance of IFNin protection against infection with R. equi (Kanaly et al., 1995) along with the recognized Th2 bias in immune responses of neonates from many species (Adkins, 2000) has led to the widespread hypothesis that a similar Th2 bias may be at the basis of the peculiar susceptibility of foals to infection by R. equi. The recent finding that young foals are deficient in their ability to produce IFNin response to mitogens led to the conclusion that neonatal foals may also be predisposed to develop a Th2-like immune response (Breathnach et al., 2006). In one study, pulmonary lymphocytes from adult horses collected 7 days following challenge with R. equi expressed predominantly IFNbut they also expressed IL-4 mRNA in response to in vitro stimulation with VapA (Lopez et al., 2002). Similar results were obtained following stimulation of BLN lymphocytes with VapA in the present study. In addition, the present study extends these findings to the other Vap proteins of R. equi. The present study also demonstrates that BLN lymphocytes from foals can express IFNin response to stimulation with each Vap protein just as well as that from immune adult horses. In fact, as a result of the significantly lower IL-4 mRNA expression in foals that in adult horses, foals had a significantly higher IFN-/IL-4 ratio than adult horses in response to stimulation with most Vap proteins. The findings in the present study therefore do not support the conclusion that neonatal foals are predisposed to develop a Th2-like immune response. The reason for the peculiar susceptibility of foals to R. equi must be more complex, and also take into account the unique association of the VapA-containing virulence plasmid with disease in foals. 68

PAGE 69

This strong predominating IFNresponse in a neonate is not unprecedented. Many studies have shown that, despite an apparent Th2 bias, neonates can mount strong Th1 responses to some antigens (Adkins, 2000; Marchant and Goldman, 2005). For example, Mycobacterium bovis BCG, a pathogen closely related to R. equi, triggers a Th1 response of similar magnitude in human neonates as it does when given later in life (Marchant et al., 1999). Virulent R. equi is widespread in the environment of horse breeding farms (Martens et al., 2000; Takai et al., 1994a). Yet, development of clinical disease is the exception rather than the rule. The fact that oral administration of live virulent R. equi to newborn foals confers almost complete protection against subsequent heavy intrabronchial challenge (Chirino-Trejo et al., 1987; Hooper-McGrevy et al., 2005) and the fact that most foals on endemic farms do not develop disease or develop subclinical disease and eventually clear the infection are consistent with the result of the present study which demonstrates that foals develop adequate cell-mediated immune responses to key antigens of R. equi. In conclusion, the data presented here indicate that vapA, vapD, and vapG are likely the most biologically relevant vap genes because they are preferentially induced during infection in the natural host. All the Vap proteins are immunogenic with VapA and VapC providing the strongest lymphoproliferation stimulus. The peculiar susceptibility of foals to infection by R. equi cannot be explained by a failure to mount Th1 immunoreactivity to the Vap proteins. Further work is required to identify the fundamental host basis of the susceptibility of foals to R. equi pneumonia. 69

PAGE 70

Table 4-1. Oligonucleotide primer and probe sequences for amplification of the vap genes from R. equi Gene Primer/probe Sequence 5'-3' vapA Forward CATCAACTTCTTCGATAGCTCAGGTA Reverse GACGCCCACCACAGTACTAACTC Probe TCCTCGGCCATATCCAGTCCGGT vapC Forward GGGTCACGCTTGGTGGC Reverse CCGTATACTGTTCGTCGGCA Probe TCGGAGTTCTACGGCCGCACAATAAA vapD Forward CACGAGCCTTTGGGCG Reverse CATTGAGACCGTTGCGATCA Probe TTATTCACTTTCTTGCTCGCGGTGGCT vapE Forward TGAGTACAACGCTGTCGGTCC Reverse ACGTGCCCCAGCAAACC Probe TACTTGAACATCAATCTTTTCGCCGGAGAC vapF Forward CATCAGCTGCTGGCAAAGTACT Reverse CCCCATGAACCGCATATTG Probe CGCCAATCAATAACAATGCCGACGA vapG Forward CACTGCAACCCCGGGA Reverse GGCGGCGGAAAGACGT Probe TCGAAATCCCGCCAGAATCACCA vapH Forward GTCAACTTCTTCGACGGTCACA Reverse ACGGAGCTCACCCCTCCTA Probe CGCCATACTCGGCCATGCACAA 70

PAGE 71

Relative mRNA expression Figure. 4-1. Relative comparison of in vivo and in vitro mRNA expression of the plasmid-encoded vap genes of R. equi. In vivo mRNA expression was determined in lung tissue from 5 foals experimentally infected with R. equi. In vitro mRNA expression was determined during exponential growth of R. equi in broth. Results are presented as mean SD. a,b,c Different letters indicate a significant difference in mRNA expression in vivo between vap genes. 1,2,3 Different numbers indicate a significant difference in mRNA expression in vitro between vap genes. * Indicates significant difference in mRNA expression of a given vap mRNA expression between in vivo and in vitro growth (P < 0.05). 71

PAGE 72

020040060080010001200VapAVapCVapDVapEVapFVapGVapHChange in fluorescence Foals Adult horsesabccccc1122222 Figure. 4-2. Lymphoproliferative responses of BLN mononuclear cells from foals and adult horses to recombinant R. equi VapA, VapC, VapD, VapE, VapF, VapG, and VapH. The results are expressed as the difference in fluorescence of stimulated cells minus that of unstimulated cells. The results are displayed as mean SD. abc Different letters indicate significant differences in lymphoproliferative responses to Vap proteins in foals (P < 0.05). 1,2,3 Different numbers indicate significant differences in lymphoproliferative responses to Vap proteins in adult horses (P < 0.05). 72

PAGE 73

050100150200250300350400VapAVapCVapDVapEVapFVapGVapH Relative IFNexpression A 0102030405060708090VapAVapCVapDVapEVapFVapGVapHB******* Relative IL-4 expression 020406080100120140160180VapAVapCVapDVapEVapFVapGVapHIFN-/IL-4 ratioC***** Relative IL-4 mRNA expression Relative IFNmRNA expression Figure. 4-3. Relative A) IFNand B) IL-4 mRNA expression, and C) IFN-/IL-4 ratio following stimulation of BLN mononuclear cells of foals (striped bars) and adult horses (dotted bars) with recombinant R. equi VapA, VapC, VapD, VapE, VapF, VapG, and VapH. The results are displayed as mean SD. *Indicates a statistically significant difference between foals and adult horses (P < 0.05). 73

PAGE 74

CHAPTER 5 SUMMARY AND CONCLUSION While studies in both mice and adult horses seem to support that resistance to R. equi is mediated by a "Th1-like" immune response characterized by IFNinduction, more information was needed on the type of immune response R. equi induced in foals and how the immune response of foals differs from that of adult horses. The recognized Th2 bias in immune responses of neonates from many species along with the recent finding that young foals are deficient in their ability to produce IFNin response to mitogens has led to the hypothesis that an IFNdeficiency may be at the basis of their peculiar susceptibility to R. equi infections (Breathnach et al., 2006). Similarly, knowledge of gene products preferentially induced during infection in the natural host would provide important insight into the pathogenesis of the disease and may prove important for vaccine development. Despite the documented importance of some of the vap genes in the virulence of R. equi, relative expression of these genes during active infection in foals has not been studied. In the first part of this dissertation, immune responses of susceptible foals were compared to that of resistant adult horses following intrabronchial challenge with R. equi. Lymphoproliferative responses of BLN cells to concanavalin A were significantly higher in foals than in adult horses. In contrast, foals had significantly lower recall lymphoproliferative responses to R. equi antigens than adult horses, indicating a nave immune system. Infected foals had significantly lower IL-4 mRNA expression but significantly higher IFNexpression and IFN-/IL-4 ratio in R. equi-stimulated BLN lymphocytes compared to infected adults. Infection with R. equi in foals resulted in a significant increase in the percentage of T lymphocytes and CD4 + T lymphocytes in bronchoalveolar lavage fluid in association with a significant decrease in the percentage of these two cell populations in BLN. Infection of foals also resulted in a marked 74

PAGE 75

increase in serum IgGa and IgGb, resulting in serum concentrations significantly higher than that of adult horses. This study demonstrates that the immune response to R. equi in foals is not biased toward IL-4 and is characterized by the predominant induction of IFN-. The data presented in the second part of this dissertation indicates that vapA, vapD, and vapG are likely the most biologically relevant vap genes because they are preferentially induced during infection in the natural host. All the Vap proteins are immunogenic with VapA and VapC providing the strongest lymphoproliferation stimulus. There was no significant difference in recall lymphoproliferative responses or IFNmRNA expression by BLN lymphocytes between foals and adults. In contrast, interleukin (IL)-4 expression was significantly higher in adults than in foals for each of the Vap proteins. The ratio of IFN-/IL-4 was significantly higher in foals than in adult horses for most Vap proteins. In conclusion, the peculiar susceptibility of foals to infection by R. equi cannot be explained by a failure to mount Th1 immunoreactivity to key antigens. Collectively, the findings of the present studies do not support the widespread hypothesis that neonatal foals are predisposed to develop a Th2-like immune response to R. equi. The reason for the peculiar susceptibility of foals to R. equi must be more complex, and also take into account the unique association of the VapA-containing virulence plasmid with disease in foals. Further work is required to identify the fundamental host basis of the susceptibility of foals to R. equi pneumonia. 75

PAGE 76

LIST OF REFERENCES Aderem, A. and D. M. Underhill. 1999. Mechanisms of phagocytosis in macrophages. Annu. Rev. Immunol. 17:593. Adkins, B. 2000. Development of neonatal Th1/Th2 function. Int. Rev. Immunol. 19:157. Adkins, B. 2005. Neonatal T cell function. J. Pediatr. Gastroenterol. Nutr. 40 Suppl 1:S5–S7. Ahmed, S. A., R. M. Gogal, Jr., and J. E. Walsh. 1994. A new rapid and simple non-radioactive assay to monitor and determine the proliferation of lymphocytes: an alternative to [3H]thymidine incorporation assay. J. Immunol. Methods 170:211. Ainsworth, D. M., G. Grunig, M. B. Matychak, J. Young, B. Wagner, H. N. Erb, and D. F. Antczak. 2003. Recurrent airway obstruction (RAO) in horses is characterized by IFN-gamma and IL-8 production in bronchoalveolar lavage cells. Vet. Immunol. Immunopathol. 96:83. Arlotti, M., G. Zoboli, G. L. Moscatelli, G. Magnani, R. Maserati, V. Borghi, M. Andreoni, M. Libanore, L. Bonazzi, A. Piscina, and R. Ciammarughi. 1996. Rhodococcus equi infection in HIV-positive subjects: a retrospective analysis of 24 cases. Scand. J. Infect. Dis. 28:463. Balson, G. A., G. D. Smith, and J. A. Yager. 1997. Immunophenotypic analysis of foal bronchoalveolar lavage lymphocytes. Vet. Microbiol. 56:237. Barrios, C., C. Brandt, M. Berney, P. H. Lambert, and C. A. Siegrist. 1996. Partial correction of the TH2/TH1 imbalance in neonatal murine responses to vaccine antigens through selective adjuvant effects. Eur. J. Immunol. 26:2666. Barton, M. D. and K. L. Hughes. 1984. Ecology of Rhodococcus equi. Vet. Microbiol. 9:65. Barton, M. D. and D. H. Embury. 1987. Studies of the pathogenesis of Rhodococcus equi infection in foals. Aust. Vet. J. 64:332. Beckman, E. M., S. A. Porcelli, C. T. Morita, S. M. Behar, S. T. Furlong, and M. B. Brenner. 1994. Recognition of a lipid antigen by CD1-restricted alpha beta+ T cells. Nature 372:691. Benoit, S., A. Benachour, S. Taouji, Y. Auffray, and A. Hartke. 2001. Induction of vap genes encoded by the virulence plasmid of Rhodococcus equi during acid tolerance response. Res. Microbiol. 152:439. Benoit, S., A. Benachour, S. Taouji, Y. Auffray, and A. Hartke. 2002. H(2)O(2), which causes macrophage-related stress, triggers induction of expression of virulence-associated plasmid determinants in Rhodococcus equi. Infect. Immun. 70:3768. 76

PAGE 77

Breathnach, C. C., T. Sturgill-Wright, J. L. Stiltner, A. A. Adams, D. P. Lunn, and D. W. Horohov. 2006. Foals are interferon gamma-deficient at birth. Vet. Immunol. Immunopathol. 112:199. Byrne, B. A., J. F. Prescott, G. H. Palmer, S. Takai, V. M. Nicholson, D. C. Alperin, and S. A. Hines. 2001. Virulence plasmid of Rhodococcus equi contains inducible gene family encoding secreted proteins. Infect. Immun. 69:650. Cantor, G. H., B. A. Byrne, S. A. Hines, and H. M. Richards, III. 1998. VapA-negative Rhodococcus equi in a dog with necrotizing pyogranulomatous hepatitis, osteomyelitis, and myositis. J. Vet. Diagn. Invest 10:297. Carrigan, M. J., I. J. Links, and A. G. Morton. 1988. Rhodococcus equi infection in goats. Aust. Vet. J. 65:331. Chaffin, M. K., N. D. Cohen, R. J. Martens, R. F. Edwards, M. Nevill, and R. Smith, III. 2004. Hematologic and immunophenotypic factors associated with development of Rhodococcus equi pneumonia of foals at equine breeding farms with endemic infection. Vet. Immunol. Immunopathol. 100:33. Chirino-Trejo, J. M., J. F. Prescott, and J. A. Yager. 1987. Protection of foals against experimental Rhodococcus equi pneumonia by oral immunization. Can. J. Vet. Res. 51:444. Chun, J., S. O. Kang, Y. C. Hah, and M. Goodfellow. 1996. Phylogeny of mycolic acid-containing actinomycetes. Journal of Industrial Microbiology and Biotechnology 17:205–213. Collatos, C., E. S. Clark, V. B. Reef, and D. D. Morris. 1990. Septicemia, atrial fibrillation, cardiomegaly, left atrial mass, and Rhodococcus equi septic osteoarthritis in a foal. J. Am. Vet. Med. Assoc. 197:1039. Darrah, P. A., M. K. Hondalus, Q. Chen, H. Ischiropoulos, and D. M. Mosser. 2000. Cooperation between reactive oxygen and nitrogen intermediates in killing of Rhodococcus equi by activated macrophages. Infect. Immun. 68:3587. Davis, W. P., B. A. Steficek, G. L. Watson, B. Yamini, H. Madarame, S. Takai, and J. A. Render. 1999. Disseminated Rhodococcus equi infection in two goats. Vet. Pathol. 36:336. Donisi, A., M. G. Suardi, S. Casari, M. Longo, G. P. Cadeo, and G. Carosi. 1996. Rhodococcus equi infection in HIV-infected patients. AIDS 10:359. Elliott, G., G. H. Lawson, and C. P. Mackenzie. 1986. Rhodococcus equi infection in cats. Vet. Rec. 118:693. 77

PAGE 78

Fernandez-Mora, E., M. Polidori, A. Luhrmann, U. E. Schaible, and A. Haas. 2005. Maturation of Rhodococcus equi-containing vacuoles is arrested after completion of the early endosome stage. Traffic. 6:635. Finnerty, W. R. 1992. The biology and genetics of the genus Rhodococcus. Annu. Rev. Microbiol. 46:193. Fitzgerald, S. D. and B. Yamini. 1995. Rhodococcal abortion and pneumonia in an equine fetus. J. Vet. Diagn. Invest 7:157. Flaminio, M. J., B. R. Rush, and W. Shuman. 1999. Peripheral blood lymphocyte subpopulations and immunoglobulin concentrations in healthy foals and foals with Rhodococcus equi pneumonia [published erratum appears in J Vet Intern Med 1999 Sep-Oct;13(5):504]. J. Vet. Intern. Med. 13:206. Flaminio, M. J., B. R. Rush, E. G. Davis, K. Hennessy, W. Shuman, and M. J. Wilkerson. 2000. Characterization of peripheral blood and pulmonary leukocyte function in healthy foals. Vet. Immunol. Immunopathol. 73:267. Flynn, O., F. Quigley, E. Costello, D. O'Grady, A. Gogarty, G. J. Mc, and S. Takai. 2001. Virulence-associated protein characterisation of Rhodococcus equi isolated from bovine lymph nodes. Vet. Microbiol. 78:221. Freestone, J. F., S. Hietala, J. Moulton, and S. Vivrette. 1987. Acquired immunodeficiency in a seven-year-old horse. J. Am. Vet. Med. Assoc. 190:689. Forsthuber, T., H. C. Yip, and P. V. Lehmann. 1996. Induction of TH1 and TH2 immunity in neonatal mice. Science 271:1728. Fuhrmann, H., G. Dobeleit, S. Bellair, and T. Guck. 2002. Cholesterol oxidase and resistance of Rhodococcus equi to peroxidative stress in vitro in the presence of cholesterol. J. Vet. Med. B Infect. Dis. Vet. Public Health 49:310. Garton, N. J., M. Gilleron, T. Brando, H. H. Dan, S. Gigure, G. Puzo, J. F. Prescott, and I. C. Sutcliffe. 2002. A novel lipoarabinomannan from the equine pathogen Rhodococcus equi. Structure and effect on macrophage cytokine production. J. Biol. Chem. 277:31722. Gigure, S. and J. P. Lavoie. 1994. Rhodococcus equi vertebral osteomyelitis in 3 quarter horse colts. Equine Vet. J. 26:74. Gigure, S., M. K. Hondalus, J. A. Yager, P. Darrah, D. M. Mosser, and J. F. Prescott. 1999a. Role of the 85-kilobase plasmid and plasmid-encoded virulence-associated protein A in intracellular survival and virulence of Rhodococcus equi. Infect. Immun. 67:3548. Gigure, S., B. N. Wilkie, and J. F. Prescott. 1999b. Modulation of cytokine response of pneumonic foals by virulent Rhodococcus equi. Infect. Immun. 67:5041. 78

PAGE 79

Gigure, S., J. M. Gaskin, C. Miller, and J. L. Bowman. 2002. Evaluation of a commercially available hyperimmune plasma product for prevention of naturally acquired pneumonia caused by Rhodococcus equi in foals. J. Am. Vet. Med. Assoc. 220:59. Gotoh, K., M. Mitsuyama, S. Imaizumi, I. Kawamura, and I. Yano. 1991. Mycolic acid-containing glycolipid as a possible virulence factor of Rhodococcus equi for mice. Microbiol. Immunol. 35:175. Grondahl, G., A. Johannisson, S. Demmers, and W. M. Jensen. 1999. Influence of age and plasma treatment on neutrophil phagocytosis and CD18 expression in foals. Vet. Microbiol. 65:241. Haghighi, H. R. and J. F. Prescott. 2005. Assessment in mice of vapA-DNA vaccination against Rhodococcus equi infection. Vet. Immunol. Immunopathol. 104:215. Haites, R. E., G. Muscatello, A. P. Begg, and G. F. Browning. 1997. Prevalence of the virulence-associated gene of Rhodococcus equi in isolates from infected foals. J. Clin. Microbiol. 35:1642. Harvey, R. L. and J. C. Sunstrum. 1991. Rhodococcus equi infection in patients with and without human immunodeficiency virus infection. Rev. Infect. Dis. 13:139. Hietala, S. K. and A. A. Ardans. 1987a. Interaction of Rhodococcus equi with phagocytic cells from R. equi-exposed and non-exposed foals. Vet. Microbiol. 14:307. Hietala, S. K. and A. A. Ardans. 1987b. Neutrophil phagocytic and serum opsonic response of the foal to Corynebacterium equi. Vet. Immunol. Immunopathol. 14:279. Hines, M. T., K. M. Paasch, D. C. Alperin, G. H. Palmer, N. C. Westhoff, and S. A. Hines. 2001. Immunity to Rhodococcus equi: antigen-specific recall responses in the lungs of adult horses. Vet. Immunol. Immunopathol. 79:101. Hines, S. A., D. M. Stone, M. T. Hines, D. C. Alperin, D. P. Knowles, L. K. Norton, M. J. Hamilton, W. C. Davis, and T. C. McGuire. 2003. Clearance of virulent but not avirulent Rhodococcus equi from the lungs of adult horses is associated with intracytoplasmic gamma interferon production by CD4+ and CD8+ T lymphocytes. Clin. Diagn. Lab Immunol. 10:208. Hondalus, M. K., M. S. Diamond, L. A. Rosenthal, T. A. Springer, and D. M. Mosser. 1993. The intracellular bacterium Rhodococcus equi requires Mac-1 to bind to mammalian cells. Infect. Immun. 61:2919. Hondalus, M. K. and D. M. Mosser. 1994. Survival and replication of Rhodococcus equi in macrophages. Infect. Immun. 62:4167. Hong, C. B. and J. M. Donahue. 1995. Rhodococcus equi-associated necrotizing lymphadenitis in a llama. J. Comp Pathol. 113:85. 79

PAGE 80

Hooper-McGrevy, K. E., S. Gigure, B. N. Wilkie, and J. F. Prescott. 2001. Evaluation of equine immunoglobulin specific for Rhodococcus equi virulence-associated proteins A and C for use in protecting foals against Rhodococcus equi-induced pneumonia. Am. J. Vet. Res. 62:1307. Hooper-McGrevy, K. E., B. N. Wilkie, and J. F. Prescott. 2003. Immunoglobulin G subisotype responses of pneumonic and healthy, exposed foals and adult horses to Rhodococcus equi virulence-associated proteins. Clin. Diagn. Lab Immunol. 10:345. Hooper-McGrevy, K. E., B. N. Wilkie, and J. F. Prescott. 2005. Virulence-associated protein-specific serum immunoglobulin G-isotype expression in young foals protected against Rhodococcus equi pneumonia by oral immunization with virulent R. equi. Vaccine. 23:5760. Horowitz, M. L., N. D. Cohen, S. Takai, T. Becu, M. K. Chaffin, K. K. Chu, K. G. Magdesian, and R. J. Martens. 2001. Application of Sartwell's model (lognormal distribution of incubation periods) to age at onset and age at death of foals with Rhodococcus equi pneumonia as evidence of perinatal infection. J. Vet. Intern. Med. 15:171. Hughes, K. L. and I. Sulaiman. 1987. The ecology of Rhodococcus equi and physicochemical influences on growth. Vet. Microbiol. 14:241. Jain, S., B. R. Bloom, and M. K. Hondalus. 2003. Deletion of vapA encoding Virulence Associated Protein A attenuates the intracellular actinomycete Rhodococcus equi. Mol. Microbiol. 50:115. Johnson, J. A., J. F. Prescott, and R. J. Markham. 1983a. The pathology of experimental Corynebacterium equi infection in foals following intrabronchial challenge. Vet. Pathol. 20:440. Johnson, J. A., J. F. Prescott, and R. J. Markham. 1983b. The pathology of experimental Corynebacterium equi infection in foals following intragastric challenge. Vet. Pathol. 20:450. Kanaly, S. T., S. A. Hines, and G. H. Palmer. 1993. Failure of pulmonary clearance of Rhodococcus equi infection in CD4+ T-lymphocyte-deficient transgenic mice. Infect. Immun. 61:4929. Kanaly, S. T., S. A. Hines, and G. H. Palmer. 1995. Cytokine modulation alters pulmonary clearance of Rhodococcus equi and development of granulomatous pneumonia. Infect. Immun. 63:3037. Kanaly, S. T., S. A. Hines, and G. H. Palmer. 1996. Transfer of a CD4+ Th1 cell line to nude mice effects clearance of Rhodococcus equi from the lung. Infect. Immun. 64:1126. Katsumi, M., N. Kodama, Y. Miki, T. Hiramune, N. Kikuchi, R. Yanagawa, and M. Nakazawa. 1991. Typing of Rhodococcus equi isolated from submaxillary lymph nodes of pigs in Japan. Zentralbl. Veterinarmed. B 38:299. 80

PAGE 81

Kwa, A. L., V. H. Tam, and M. J. Rybak. 2001. Rhodococcus equi pneumonia in a patient with human immunodeficiency virus: case report and review. Pharmacotherapy 21:998. Lopez, A. M., M. T. Hines, G. H. Palmer, D. C. Alperin, and S. A. Hines. 2002. Identification of pulmonary T-lymphocyte and serum antibody isotype responses associated with protection against Rhodococcus equi. Clin. Diagn. Lab Immunol. 9:1270. Lopez, A. M., M. T. Hines, G. H. Palmer, D. P. Knowles, D. C. Alperin, and S. A. Hines. 2003. Analysis of anamnestic immune responses in adult horses and priming in neonates induced by a DNA vaccine expressing the vapA gene of Rhodococcus equi. Vaccine 21:3815–3825. Luhrmann, A., N. Mauder, T. Sydor, E. Fernandez-Mora, J. Schulze-Luehrmann, S. Takai, and A. Haas. 2004. Necrotic death of Rhodococcus equi-infected macrophages is regulated by virulence-associated plasmids. Infect. Immun. 72:853. Machang'u, R. S. and J. F. Prescott. 1991. Purification and properties of cholesterol oxidase and choline phosphohydrolase from Rhodococcus equi. Can. J. Vet. Res. 55:332. Madarame, H., S. Takai, C. Matsumoto, K. Minamiyama, Y. Sasaki, S. Tsubaki, Y. Hasegawa, and A. Nakane. 1997. Virulent and avirulent Rhodococcus equi infection in T-cell deficient athymic nude mice: pathologic, bacteriologic and immunologic responses. FEMS Immunol. Med. Microbiol. 17:251. Madarame, H., H. Matsuda, M. Okada, S. Yoshida, Y. Sasaki, S. Tsubaki, Y. Hasegawa, and S. Takai. 1998. Cutaneous malakoplakia in pigs inoculated with Rhodococcus equi. FEMS Immunol. Med. Microbiol. 22:329. Madigan, J. E., S. Hietala, and N. Muller. 1991. Protection against naturally acquired Rhodococcus equi pneumonia in foals by administration of hyperimmune plasma. J. Reprod. Fertil. Suppl 44:571. Makrai, L., S. Takai, M. Tamura, A. Tsukamoto, R. Sekimoto, Y. Sasaki, T. Kakuda, S. Tsubaki, J. Varga, L. Fodor, N. Solymosi, and A. Major. 2002. Characterization of virulence plasmid types in Rhodococcus equi isolates from foals, pigs, humans and soil in Hungary. Vet. Microbiol. 88:377. Marchant, A., T. Goetghebuer, M. O. Ota, I. Wolfe, S. J. Ceesay, D. De Groote, T. Corrah, S. Bennett, J. Wheeler, K. Huygen, P. Aaby, K. P. McAdam, and M. J. Newport. 1999. Newborns develop a Th1-type immune response to Mycobacterium bovis bacillus Calmette-Guerin vaccination. J. Immunol. 163:2249. Marchant, A. and M. Goldman. 2005. T cell-mediated immune responses in human newborns: ready to learn? Clin. Exp. Immunol. 141:10. Martens, R. J., J. G. Martens, H. W. Renshaw, and S. K. Hietala. 1987. Rhodococcus equi: equine neutrophil chemiluminescent and bactericidal responses to opsonizing antibody. Vet. Microbiol. 14:277. 81

PAGE 82

Martens, R. J., Martens J.G., and R. A. Fiske. 1989a. Rhodococcus equi foal pneumonia: pathogenesis and immunoprophylaxis. Proc. Am. Assoc. Equine Pract. 35:189. Martens, R. J., J. G. Martens, R. A. Fiske, and S. K. Hietala. 1989b. Rhodococcus equi foal pneumonia: protective effects of immune plasma in experimentally infected foals. Equine Vet. J. 21:249. Martens, R. J., S. Takai, N. D. Cohen, M. K. Chaffin, H. Liu, K. Sakurai, H. Sugimoto, and S. W. Lingsweiler. 2000. Association of disease with isolation and virulence of Rhodococcus equi from farm soil and foals with pneumonia. J. Am. Vet. Med. Assoc. 217:220. Martens, R. J., N. D. Cohen, S. L. Jones, T. A. Moore, and J. F. Edwards. 2005. Protective role of neutrophils in mice experimentally infected with Rhodococcus equi. Infect. Immun. 73:7040. Martinez, X., C. Brandt, F. Saddallah, C. Tougne, C. Barrios, F. Wild, G. Dougan, P. H. Lambert, and C. A. Siegrist. 1997. DNA immunization circumvents deficient induction of T helper type 1 and cytotoxic T lymphocyte responses in neonates and during early life. Proc. Natl. Acad. Sci. U. S. A 94:8726. Miranda-Casoluengo, R., P. S. Duffy, E. P. O'Connell, B. J. Graham, M. W. Mangan, J. F. Prescott, and W. G. Meijer. 2005. The iron-regulated iupABC operon is required for saprophytic growth of the intracellular pathogen Rhodococcus equi at low iron concentrations. J. Bacteriol. 187:3438. Nordmann, P., E. Ronco, and C. Nauciel. 1992. Role of T-lymphocyte subsets in Rhodococcus equi infection. Infect. Immun. 60:2748. Ota, M. O., J. Vekemans, S. E. Schlegel-Haueter, K. Fielding, M. Sanneh, M. Kidd, M. J. Newport, P. Aaby, H. Whittle, P. H. Lambert, K. P. McAdam, C. A. Siegrist, and A. Marchant. 2002. Influence of Mycobacterium bovis bacillus Calmette-Guerin on antibody and cytokine responses to human neonatal vaccination. J. Immunol. 168:919. Patton, K. M., T. C. McGuire, D. G. Fraser, and S. A. Hines. 2004. Rhodococcus equi-infected macrophages are recognized and killed by CD8+ T lymphocytes in a major histocompatibility complex class I-unrestricted fashion. Infect. Immun. 72:7073. Patton, K. M., T. C. McGuire, M. T. Hines, R. H. Mealey, and S. A. Hines. 2005. Rhodococcus equi-specific cytotoxic T lymphocytes in immune horses and development in asymptomatic foals. Infect. Immun. 73:2083. Pei, Y., C. Dupont, T. Sydor, A. Haas, and J. F. Prescott. 2006. Cholesterol oxidase (ChoE) is not important in the virulence of Rhodococcus equi. Vet. Microbiol. 118:240. Polidori, M. and A. Haas. 2006. VapI, a new member of the Rhodococcus equi Vap family. Antonie Van Leeuwenhoek 90:299. 82

PAGE 83

Pongracz, J., S. Parnell, G. Anderson, J. P. Jaffrezou, and E. Jenkinson. 2003. Con A activates an Akt/PKB dependent survival mechanism to modulate TCR induced cell death in double positive thymocytes. Mol. Immunol. 39:1013–-1023. Prescott, J. F. 1991. Rhodococcus equi: an animal and human pathogen. Clin. Microbiol. Rev. 4:20. Ren, J. and J. F. Prescott. 2003. Analysis of virulence plasmid gene expression of intra-macrophage and in vitro grown Rhodococcus equi ATCC 33701. Vet. Microbiol. 94:167–182. Ren, J. and J. F. Prescott. 2004. The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence. Vet. Microbiol. 103:219. Ross, T. L., G. A. Balson, J. S. Miners, G. D. Smith, P. E. Shewen, J. F. Prescott, and J. A. Yager. 1996. Role of CD4+, CD8+ and double negative T-cells in the protection of SCID/beige mice against respiratory challenge with Rhodococcus equi. Can. J. Vet. Res. 60:186. Sarzotti, M., D. S. Robbins, and P. M. Hoffman. 1996. Induction of protective CTL responses in newborn mice by a murine retrovirus. Science 271:1726. Sheoran, A. S., J. F. Timoney, M. A. Holmes, S. S. Karzenski, and M. V. Crisman. 2000. Immunoglobulin isotypes in sera and nasal mucosal secretions and their neonatal transfer and distribution in horses. Am. J. Vet. Res. 61:1099. Sutcliffe, I. C. 1997. Macroamphiphilic cell envelope components of Rhodococcus equi and closely related bacteria. Vet. Microbiol. 56:287. Sweeney, C. R., R. W. Sweeney, and T. J. Divers. 1987. Rhodococcus equi pneumonia in 48 foals: response to antimicrobial therapy. Vet. Microbiol. 14:329. Szeredi, L., L. Makrai, and B. Denes. 2001. Rapid immunohistochemical detection of Rhodococcus equi in impression smears from affected foals on postmortem examination. J. Vet. Med. B Infect. Dis. Vet. Public Health 48:751. Takai, S., S. Iimori, and S. Tsubaki. 1986. Quantitative fecal culture for early diagnosis of Corynebacterium (Rhodococcus) equi enteritis in foals. Can. J. Vet. Res. 50:479. Takai, S., S. Ohbushi, K. Koike, S. Tsubaki, H. Oishi, and M. Kamada. 1991. Prevalence of virulent Rhodococcus equi in isolates from soil and feces of horses from horse-breeding farms with and without endemic infections. J. Clin. Microbiol. 29:2887. Takai, S., Y. Watanabe, T. Ikeda, T. Ozawa, S. Matsukura, Y. Tamada, S. Tsubaki, and T. Sekizaki. 1993. Virulence-associated plasmids in Rhodococcus equi. J. Clin. Microbiol. 31:1726. 83

PAGE 84

Takai, S., T. Anzai, K. Yamaguchi, S. Kakizaki, J. Takahagi, Y. Sato, F. Takehara, Y. Tamada, S. Matsukura, A. Tani, M. Kato, N. Seno, Y. Sasaki, S. Tsubaki, and M. Kamada. 1994a. Prevalence of virulence plasmids in environmental isolates of Rhodococcus equi from horse-breeding farms in hokkaido. J.Equine Sci. 5:21. Takai, S., Y. Sasaki, T. Ikeda, Y. Uchida, S. Tsubaki, and T. Sekizaki. 1994b. Virulence of Rhodococcus equi isolates from patients with and without AIDS. J. Clin. Microbiol. 32:457. Takai, S., Y. Imai, N. Fukunaga, Y. Uchida, K. Kamisawa, Y. Sasaki, S. Tsubaki, and T. Sekizaki. 1995. Identification of virulence-associated antigens and plasmids in Rhodococcus equi from patients with AIDS. J. Infect. Dis. 172:1306. Takai, S., N. Fukunaga, K. Kamisawa, Y. Imai, Y. Sasaki, and S. Tsubaki. 1996a. Expression of virulence-associated antigens of Rhodococcus equi is regulated by temperature and pH. Microbiol. Immunol. 40:591. Takai, S., N. Fukunaga, S. Ochiai, T. Sakai, Y. Sasaki, and S. Tsubaki. 1996b. Isolation of virulent and intermediately virulent Rhodococcus equi from soil and sand on parks and yards in Japan. J. Vet. Med. Sci. 58:669. Takai, S., N. Fukunaga, S. Ochiai, Y. Imai, Y. Sasaki, S. Tsubaki, and T. Sekizaki. 1996c. Identification of intermediately virulent Rhodococcus equi isolates from pigs. J. Clin. Microbiol. 34:1034. Takai, S., S. A. Hines, T. Sekizaki, V. M. Nicholson, D. A. Alperin, M. Osaki, D. Takamatsu, M. Nakamura, K. Suzuki, N. Ogino, T. Kakuda, H. Dan, and J. F. Prescott. 2000a. DNA Sequence and Comparison of Virulence Plasmids from Rhodococcus equi ATCC 33701 and 103. Infect. Immun. 68:6840. Takai, S., T. Anzai, Y. Fujita, O. Akita, M. Shoda, S. Tsubaki, and R. Wada. 2000b. Pathogenicity of Rhodococcus equi expressing a virulence-associated 20 kDa protein (VapB) in foals. Vet. Microbiol. 76:71. Takai, S., I. Nakata, N. Fukii, Y. Kimura, Y. Sasaki, T. Kakuda, S. Tsubaki, T. Kondo, and T. Sugiura. 2002. Isotype-specific antibody responses to Rhodococcus equi in foals on a horse-breeding farm with a persistent incidence of R. equi infection. J. Equine Sci. 13:63–70. Takai, S., R. J. Martens, A. Julian, R. M. Garcia, d. F. Rodrigues, Y. Sasaki, K. Inuzuka, T. Kakuda, S. Tsubaki, and J. F. Prescott. 2003. Virulence of Rhodococcus equi isolated from cats and dogs. J. Clin. Microbiol. 41:4468. Tkachuk-Saad, O., P. Lusis, R. D. Welsh, and J. F. Prescott. 1998. Rhodococcus equi infections in goats. Vet. Rec. 143:311. 84

PAGE 85

Toyooka, K., S. Takai, and T. Kirikae. 2005. Rhodococcus equi can survive a phagolysosomal environment in macrophages by suppressing acidification of the phagolysosome. J. Med. Microbiol. 54:1007. Vullo, V., C. M. Mastroianni, M. Lichtner, F. Mengoni, C. D'Agostino, G. Forcina, A. Corpolongo, and S. Delia. 1998. Rhodococcus equi infection of monocytes/macrophages from human immunodeficiency virus (HIV)-infected patients and healthy individuals: evaluation of intracellular killing and nitric oxide production. FEMS Immunol. Med. Microbiol. 21:11. Vekemans, J., A. Amedei, M. O. Ota, M. M. D'Elios, T. Goetghebuer, J. Ismaili, M. J. Newport, G. Del Prete, M. Goldman, K. P. McAdam, and A. Marchant. 2001. Neonatal bacillus Calmette-Guerin vaccination induces adult-like IFN-gamma production by CD4+ T lymphocytes. Eur. J. Immunol. 31:1531. Wada, R., M. Kamada, T. Anzai, A. Nakanishi, T. Kanemaru, S. Takai, and S. Tsubaki. 1997. Pathogenicity and virulence of Rhodococcus equi in foals following intratracheal challenge. Vet. Microbiol. 56:301. Witonsky, S., R. M. Gogal, Jr., V. Buechner-Maxwell, and S. A. Ahmed. 2003. Immunologic analysis of blood samples obtained from horses and stored for twenty-four hours. Am. J. Vet. Res. 64:1003. Yager, J. A., C. K. Duder, J. F. Prescott, and M. C. Zink. 1987. The interaction of Rhodococcus equi and foal neutrophils in vitro. Vet. Microbiol. 14:287. Zink, M. C. and J. A. Johnson. 1984. Cellular constituents of clinically normal foal bronchoalveolar lavage fluid during postnatal maturation. Am. J. Vet. Res. 45:893. Zink, M. C., J. A. Yager, J. F. Prescott, and B. N. Wilkie. 1985. In vitro phagocytosis and killing of Corynebacterium equi by alveolar macrophages of foals. Am. J. Vet. Res. 46:2171–2174. Zink, M. C.; J. A. Yager, N. L. Smart. 1986. Corynebacterium equi infections in horses, 1958–1984: A review of 131 cases. Can. J. Vet. Res. 27:213. Zink, M. C., J. A. Yager, J. F. Prescott, and M. A. Fernando. 1987. Electron microscopic investigation of intracellular events after ingestion of Rhodococcus equi by foal alveolar macrophages. Vet. Microbiol. 14:295. 85

PAGE 86

BIOGRAPHICAL SKETCH Stephanie Scott Jacks was born in Covington, Kentucky, on August 2, 1971. She is the oldest of five children. She attended Kennesaw State University from 1990 to 1994 where she acquired the necessary pre-veterinary courses. She graduated from the University of Georgia College of Veterinary medicine in May of 1998. After obtaining her DVM, she did an internship in equine medicine and surgery at Mid-Rivers Equine Centre in Wentzville, MO. Then she completed a residency in equine internal medicine at the University of Florida and became board certified from the American College of Veterinary Internal Medicine in 2002. While working with Dr. Steeve Gigure on her residency research project, she became interested in pursuing a graduate degree. In 2007 she completed her PhD in Veterinary Medical Sciences. 86