Citation
Induction of Oxidative Stress in the Retinal Pigment Epithelium of Wild-Type Mice to Model the Early Stages of Age-Related Macular Degeneration

Material Information

Title:
Induction of Oxidative Stress in the Retinal Pigment Epithelium of Wild-Type Mice to Model the Early Stages of Age-Related Macular Degeneration
Creator:
JUSTILIEN, VERLINE ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Antioxidants ( jstor )
Gene therapy ( jstor )
Macular degeneration ( jstor )
Messenger RNA ( jstor )
Photoreceptors ( jstor )
Plasmids ( jstor )
Retina ( jstor )
RNA ( jstor )
Sand sheets ( jstor )
Superoxides ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Verline Justilien. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2007

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

1 INDUCTION OF OXIDATIVE STRESS IN TH E RETINAL PIGMENT EPITHELIUM OF WILD-TYPE MICE TO MODEL THE EA RLY STAGES OF AGE-RELATED MACULAR DEGENERATION By VERLINE JUSTILIEN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

2 Copyright 2006 by Verline Justilien

PAGE 3

3 To my parents, sisters and Ajani.

PAGE 4

4 ACKNOWLEDGMENTS I would like to first and foremost thank th e One with whom all things are possible. I would like to express my sincere gratitude to my mentor, Dr. Alfred Lewin, for the great gifts of knowledge, support and en couragement he has provided over the years. I would also like to thank all of my committee members, Drs. William Hauswirth, Mavis Agbandje-McKenna and Peggy Wallace, for their wonderful guidan ce in formulating this dissertation. Many thanks go to the past and present members of the Lewin laboratory. Most importantly I would like to ac knowledge Mr. James Thomas Jr. and Dr. Marina Gorbatyuk from whom I have learned a great deal about scien ce and life. In addition, I thank Drs. Mary Ann Checkley, Jen Bongorno, Alan White, Lourdes Andino, Fredric Manfreddson and Edgar Rodriguez for the help and friendship they have provided along the way. I am grateful to my partner in crime, Dr. Jia Liu, for helping me to stay focused. I am forever grateful for the help that was provided by Tessa and Alison with the mice. My work was made possible because of the in jection skills of Drs. Adrian Timmers, JiJing Pang, and Seok Hong Min. I would also like to thank Mr. Vince Chiodo for his help with packaging of my viral vectors. I am grateful to Mr. Denny Player and Doug Smith for their help with electron and fluorescent microscopy. I than k Joyce Connors and the ladies of the fiscal office (Julie, Michelle and Jeanine) without whom I would be lost. Finally, I would like to thank my family, especially Mommy, Daddy, Wilna, Wiline and Lucy, for their support. Above a ll, I would like to thank my hus band and best friend, Ajani, for all his patience, sacrifices and unconditional love.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........8 LIST OF FIGURES................................................................................................................ .........9 LIST OF ABBREVIATIONS........................................................................................................12 ABSTRACT....................................................................................................................... ............14 CHAPTER 1 INTRODUCTION..................................................................................................................16 Retinal Anatomy and Function...............................................................................................16 Age-Related Macular Degeneration.......................................................................................20 Histopathological Characteristics....................................................................................20 Epidemiology and Risk Factors.......................................................................................21 Genetics and nonmodifiab le risk factors..................................................................22 Environmental and modifi able risk factors..............................................................25 Reactive Oxygen/Nitrogen Species and Antioxidant Enzymes..............................................27 Current Animal Models of AMD...........................................................................................30 Ribozymes...................................................................................................................... ........30 Adeno-Associated Virus.........................................................................................................33 Project........................................................................................................................ .............36 2 REDUCTION OF SOD2 EX PRESSION IN THE RPE OF WILD-TYPE MICE.................50 Introduction................................................................................................................... ..........50 Materials and Methods.......................................................................................................... .52 Ribozyme Cloning and rAAV.........................................................................................52 Cell Culture Studies with SOD2 Rz432..........................................................................54 RPE-J cells...............................................................................................................54 SOD2 ribozyme delivery to RPE-J Cells.................................................................54 RNA and protein isolat ion from RPE-J Cells..........................................................55 Reverse transcriptase (RT-PCR) mRNA analysis in RPEJ cells.............................55 MnSOD protein analysis in RPEJ cells....................................................................56 Detection of superoxide anion in RPE-J cells..........................................................57 Apoptosis in RPE-J cells..........................................................................................57 In Vivo Studies with SOD2 Rz432.................................................................................58 Experimental animals and injection of AAV vectors...............................................58 Detection of SOD2 ribozyme expression in vivo .....................................................59 MnSOD protein levels in vivo ..................................................................................59 Detection of markers of oxidative damage..............................................................60

PAGE 6

6 Electroretinography..................................................................................................61 Light and electron microscopy.................................................................................62 Retinal apoptotic cell death......................................................................................63 Results........................................................................................................................ .............65 Ribozyme Knockdown of MnSOD in RPE-J Cells.........................................................65 SOD2-suppression Increases the Levels of Superoxide and Apoptosis in RPE-J Cells.......................................................................................................................... ...66 In vivo Comparison of AAV CBA, MOPS, and RPE65-Rz432 Constructs...................66 Ribozyme Expression in the Retin a Reduces Levels of MnSOD...................................67 SOD2-suppression Increases Markers of Oxidative Injury.............................................68 Loss of Electrophysiological Responses.........................................................................69 Suppression of MnSOD Leads to Histol ogical Damage of the Outer Retina.................70 Ultrastructural Analysis of the Outer Retina...................................................................71 Discussion..................................................................................................................... ..........72 3 RIBOZYME-MEDIATED REDUCTION OF GLUTATHIONE PEROXIDASE-1..........104 Introduction................................................................................................................... ........104 Materials and Methods.........................................................................................................105 Ribozyme Design..........................................................................................................105 Radioactive Labeling Of Short RNA Targets...............................................................106 Time-Course Reaction...................................................................................................106 Multiturnover Kinetics Analysis...................................................................................107 In Vitro Transcription of GPX-1 Full Length mRNA...................................................108 Ribozyme Cleavage of Full Length GPX-1 mRNA......................................................109 Ribozyme Cloning and Packaging................................................................................109 GPX-1 Ribozyme Delivery to NIH 3T3 Cells..............................................................110 Assessment of GPX-1 mRNA and Protein in NIH3T3 Cells........................................110 G418 Selection..............................................................................................................110 Viability of NIH 3T3 Cells in H2O2 after Treatment with GPX-1 Ribozymes.............110 Experimental Animals and Injection of AAV...............................................................111 GFP Immunostaining.....................................................................................................111 Dark -adaptated ERG Analysis.....................................................................................111 Histology...................................................................................................................... .111 Results........................................................................................................................ ...........112 Multiple -turnover Kinetic Analysis of GPX-1 Ribozym es with Short Targets...........112 In Vitro Analysis of GPX-1 Ribozyme Cleavage of Full Length Target......................112 GPX-1 mRNA and Protein K nockdown in NIH 3T3 Cells..........................................113 Viability of NIH 3T3 Cells in H2O2 after Treatment with Rz172 and 275...................114 In situ Detection of GPX-1 Ribozymes.........................................................................114 ERG Analysis................................................................................................................114 Histology...................................................................................................................... .115 Conclusions.................................................................................................................... .......115 4 CONCLUSIONS..................................................................................................................135 Summary........................................................................................................................ .......135

PAGE 7

7 General Discussion............................................................................................................. ..135 Future Studies................................................................................................................. ......139 Closing Remarks................................................................................................................ ...141 LIST OF REFERENCES.............................................................................................................143 BIOGRAPHICAL SKETCH.......................................................................................................169

PAGE 8

8 LIST OF TABLES Table page 1-1 Tropism of rAAV serotypes following s ubretinal injection in different animal species........................................................................................................................ ........49 2.1 DNA oligonucleotides used for cloning mouse SOD2 Rz432...........................................79 2-2 DNA oligonucleotides used in RT-PCR reactions for SOD2 and Beta Actin...................82 3-1 DNA oligonucleotides used in RT-PCR of full length GPX-1........................................122 3-2 DNA oligonucleotides used for cloning mouse GPX-1 ribozymes.................................124 3-3 DNA oligonucleotides used for RT-PCR analysis of GPX-1 mRNA.............................126

PAGE 9

9 LIST OF FIGURES Figure page 1-1 The layers of the retina................................................................................................... ...37 1-2 Layers of the retina affected by AMD...............................................................................38 1-3 The macula................................................................................................................. ........39 1-4 SubRPE deposits............................................................................................................ ....40 1-5 Schematic diagram of Dry and Wet AMD........................................................................41 1-6 Injuries that occur in the macula due to AMD results in lost of central vision.................42 1-7 Lipofuscin................................................................................................................. .........43 1-8 Prevalence of early AMD among whites...........................................................................44 1-9 Geographic differences in incidence of AMD...................................................................45 1-10 Reactive oxygen species (ROS) commonly generated in the cell.....................................46 1-11 Structure of the trans-acting hammerhead ribozyme.........................................................47 1-12 Schematic diagram of cleavage by the hammerhead ribozyme.........................................48 2-1 Secondary structure of hammerhead ribozyme targeting MnSOD....................................78 2-2 Plasmids used to deliver A) SOD2 Rz432-GFP and B) GFP control into RPE-J cells.....80 2-3 The recombinant AAV cassettes used to produce A) CBA-Rz432, B) RPE65-Rz432, and C) MOPS500-Rz432 viral vectors..............................................................................81 2-4 Subretinal injection....................................................................................................... .....83 2-5 Sample waveform from an ERG recording.......................................................................84 2-6 Quantization of MnSOD transcript leve ls measured in triplicate with reverse transcription PCR.............................................................................................................. .85 2-7 Representative western blot for MnSOD protein levels from Rz432 or GFP treated cells.......................................................................................................................... ..........86 2-8 Dihydroethidium staining for de tection of superoxide anion............................................87 2-9 Quantification of apoptotic cell death meas ured by an ELISA that detects release of nucleosomes into the cytoplasm........................................................................................88

PAGE 10

10 2-10 B wave scotopic full-fiel d ERGs of DBAJ/1 mice tr eated with CBA, RPE65 or MOPS500-Rz vector at 1.5 and 5.5 months post injection................................................89 2-11 Retinal morphology of DBAJ/1 at 5.5 months after CBA, RPE65 or MOPS500Rz432 vector injection.......................................................................................................90 2-12 Localization of Rz432-GFP expre ssion at 6 weeks post injection....................................91 2-13 Rz432 expression reduces MnSOD prot ein levels in the RPE/Choroid............................92 2-14 Western blots analysis of markers of oxidative damage....................................................93 2-15 Scotopic full-field ERGs of C57BL/6 mice injected with Rz432 or GFP control vector......................................................................................................................... .........95 2-16 Scotopic full-field ERGs of DBAJ/1 mice injected with active Rz432 or control inactive Rz432................................................................................................................. ..96 2-17 Light micrographs of retinas of C57BL/6 injected with Rz432 or GFP control vector....97 2-18 Quantization of the thickness of the outer nuclear layer....................................................98 2-19 Progressive loss of photoreceptor cells is due to apoptotic cell death. 3...........................99 2-20 Ultrastructure changes in the outer retina at 4months after Rz432 treatment..................100 2-21 Ultrastructure changes in Bruch’s membrane..................................................................101 2-22 Quantization of the thickening of Bruch’s membrane.....................................................102 2-23 Accumulation of lipofusci n-like aggregates in RPE........................................................103 3-1 Chemical reaction catalyzed by Glutathione Peroxidase 1..............................................118 3-2 Secondary structure of hammerh ead ribozymes targeting GPX-1..................................119 3-3 Summary of the experimental design for multiple-turnover kinetics analysis................120 3-4 Summary of experimental design used to prepare the calibration curve for multipleturnover kinetics analysis.................................................................................................121 3-5 Plasmid used to in vitro transcribe full length murine GPX-1.........................................123 3-6 Plasmids used to deliver GPX-1 Rz172 and 275 into NIH 3T3 cells and to package ribozymes into AAV........................................................................................................125 3-7 Kinetic analysis of GPX-1 Rz 172 and 275.....................................................................127 3-8 Rz172 and 275 cleavage of full length GPX-1 target......................................................128

PAGE 11

11 3-9 Quantitation of GPX-1 transcript levels in NIH 3T3 cells after ribozyme treatment......129 3-10 Representative western blot for GPX-1 pr otein at 2 days after treatment of NIH 3T3 with Rz172, Rz275 or empty control plasmid.................................................................130 3-11 Viability of NIH 3T3 cells in H2O2 following GPX-1 ribozyme treatment. ..................131 3-12 Localization of Rz172-GFP expression in the retina at 4 weeks post injection..............132 313 Scotopic full-field ERGs of C57BL/ 6 mice injected with Rz172 or GFP control vector......................................................................................................................... .......133 3-14 Light micrograph of retinas at 4 months post treatment with GFP control or GPX-1 Rz172.......................................................................................................................... .....134

PAGE 12

12 LIST OF ABBREVIATIONS 8-OHdG – 8-hydroxy-2-deoxyguanosine AAV – Adeno-Associated Virus ABCR– ATP-binding transporter gene ABTS – 2,2'-azino-bis(3-ethylbenzth iazoline-6-sulphonic acid Ad – Adenovirus AGE – advanced glycation end products ALEs – advanced lipooxidation end-products AMD – Age Related Macular Degeneration APOE – Apolipoprotein E AREDS – Age-Related Eye Diseases Study BHT – Butylated hydroxytoluene BSA – bovine serum albumin CBA – chicken beta-actin promoter Ccl-2 – chemokine ligand 2 CEP – carboxyethylpyrrole CHCL3 – chloroform CMV – cytomegalovirus CFH – complement factor H Ccr-2 – chemokine receptor 2Cc2– complement component 2 DAPI – 4'-6-Diamidino-2-phenylindole DHA – docosahexanoic acid DHE – dihydroethidium DTT – dithiothreitol EDCCS – Eye Disease Case Control Study EGFP – enhanced green fluorescent protein ELOVL4 – elongation of very long chain fatty acids-4 ERG – electroretinogram FACScan – Fluorescence Activated Cell Sorting GPX-1 – Glutathione peroxidase 1 GPX-4 – Glutathione peroxidase 4 GTA – glutaraldehyde H2O2– hydrogen peroxide HNE – 4hydroxy-2-nonenal INL – inner nuclear layer IS – inner segments ITRs – inverted terminal repeats MDA – malondialdehyde MOPS – mouse opsin NADPH – nicotinamide adenine dinucleotide phosphate NO – nitric oxide ONL – outer nuclear layer OH. – hydroxyl radical ONOO – peroxynitrite anion ORF – open reading frame OS – outer segments PBS – phosphate buffered saline

PAGE 13

13 PFA – paraformaldehyde POD – horseradish peroxidase PUFA – polyunsaturated fatty acid PVDF – Polyvinylidene fluoride RDS – retinal degeneration slow RNAi – RNA interference RNS – Reactive nitrogen species ROS – reactive oxygen species RPE – retinal pigment epithelium RT-PCR – reverse transcriptasepolymerase chain reaction SAM – Senescence-Accelerated Mouse SDS – sodium dodecyl sulfate SOD1 – cytoplasmic copper/zi nc superoxide dismutase SOD2 – mitochondrial manganese superoxide dismutase SOD3 – extracellular iron superoxide dismutase TIMP3 – tissue inhibitor of metalloproteinase 3 TLR-4– Toll-like receptor 4 TUNEL – Terminal deoxynucleotidyl Transf erase Biotin-dUTP Nick End Labeling VEGF – vascular endot helial growth factor VLDLR – very low density lipoprotein receptor VMD2 – vitelliform macular dystrophy 2 VPP– vancomycin/ pimafucin/ polymixin B

PAGE 14

14 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy INDUCTION OF OXIDATIVE STRESS IN TH E RETINAL PIGMENT EPITHELIUM OF WILD TYPE MICE TO MODEL THE EA RLY STAGES OF AGE-RELATED MACULAR DEGENERATION By Verline Justilien December 2006 Chair: Alfred S. Lewin Major Department: Medi cal Sciences-Genetics Age-related macular degeneration (AMD) is a degenerative eye diseas e that accounts for the majority of irreversible seve re visual loss in the elderly population of i ndustrialized countries. Some of the risk factors for AMD such as olde r age, smoking, nutrition, an d light exposure have increased oxidative stress as a common denominator . Therefore, it is my hypothesis that some of the initial biochemical processes involved in AMD pathogenesis converge to a common pathway, oxidative tissue injury, to contri bute to the formation of AMD lesions. To test this hypothesis, I ha ve employed small catalytic RNA molecules (ribozymes) to inhibit the expression of the antioxidant enzy mes, manganese superoxide dismutase (MnSOD) and Glutathione Peroxidase-1 (GPX-1), to incr ease oxidative damage of the retinal pigment epithelium which is thought to be the site of the primary lesion of AMD. MnSOD and GPX-1 ribozymes were first tested in vitro in tissue cultured cells. Those ribozymes found to be active were packaged in type1 recombinant Adeno-Associ ated Virus and injected subretinally into the eyes of adult wild-type C57Bl/6 mice. Treatme nt with the MnSOD ribozyme led to increased oxidative stress in the RPE and significant change s in the outer retina associated with AMD, such as atrophy and pigmentary changes of the RPE, accumulation of lipof uscin-like debris in

PAGE 15

15 the RPE, significant increase in the thickness of Bruch’s membrane, progressive loss of retinal electrophysiological function, and apoptotic cell death of the photoreceptors. No significant pathological changes in the retina associated with AMD were observed in mice treated with the GPX-1 ribozyme. The results obtained from ribozyme-mediat ed knockdown of MnSOD suggest oxidative damage to the RPE may contribute to early path ogenesis similar to that occurring in AMD. Additional time or other contributing factors may be needed to observe other hallmarks of AMD such as drusen and choroidal neovascularization. The lack of significant pathology associated with ribozyme-mediated knockdown of GPX-1 may be explained by a redundancy of the function of GPX-1 with other peroxidases in vivo .

PAGE 16

16 CHAPTER 1 INTRODUCTION Vision is perhaps the most important of our senses based on the relatively large proportion of the human cortex devoted to visual processi ng compared to the other senses. Our vision is impaired at older age by a number of age-rela ted eye diseases such as Age-Related Macular Degeneration (AMD), cataract, glaucoma, and diab etic retinopathy. Of these, AMD is the most common cause of visual loss in the el derly population of developed countries1-5 and has the least number of effective therapies to prevent or reduce its progres sion. AMD affects the macula, a yellow-pigmented region of the central retina that is rich in cone photoreceptors and is responsible for central vision. Individuals impair ed by AMD lose their ce ntral vision which is required for reading, driving, and performing othe r activities where fine and sharp vision is needed. Because central but not peripheral vision is usually af fected, total blindness rarely occurs. The loss of clear vision that occurs in late AMD, however, results in decreased mobility, impaired reading ability, and dramatically impact s occupational and recr eational activities. With the population living much longer, AMD is becomi ng a great problem with major economic and social consequences. Currently, AMD is t hought to be a complex disease caused by a combination of environmental factors and the influence of su sceptibility genes.6-8 A large part of the disease’s etiology is still unknown, and it is not clear what ro les the exogenous factors may be playing in combination with the genetic fact ors to lead to the development of AMD. This makes it difficult to discover new pr eventive measures for the disease. Retinal Anatomy and Function The retina is a transparent laye r of tissue found in the posterior of the eye. It is composed of ten distinct layers (Figure 1-1): from the outside of the eye inward (1) the retinal pigment epithelium (RPE); (2) the photoreceptor cell oute r and inner segments; (3) the external limiting

PAGE 17

17 membrane; (4) the outer nuclear layer cont aining the photoreceptor nuclei; (5) the outer plexiform layer; (6) the inner nuclear layer containing the nucle i of the horizontal, bipolar, amacrine, and Muller cells; (7) the inner plexif orm layer; (8) the ganglion cell layer; (9) the nerve fiber layer; and (10) the inner limiting membrane. In AMD, injuries to the macular region’s outer neural retina (i .e. the photoreceptors), the RP E, Bruch’s membrane and the choroid seem to cause the progr essive loss of central vision.9-11 Therefore, their functions will be discussed in more detail below. The photoreceptors (Figure 1-1) are specialized neuroepithel ial cells derived from the neuroectoderm. There are two types of photorecept ors cones and rods whic h capture light via Gprotein coupled receptors called opsins found in their outer segmen ts to begin the vision cascade that eventually leads to our ab ility to see an image. Rods mediate dim light vision, while cones function in bright light and are responsible for color vision and pattern recognition. The rod to cone ratio in the peripheral retina is approximately 20:1,12 but this ratio decreases in the macular portion of the retina. The foveal region of the ma cula is cone-dominated whereas all other parts of the retina are dominated by rods.13 Separating the photoreceptors from the choroid layer of the eye is the RPE, a monolayer of regularly arranged hexagonal cells (Figure 1-1). Under normal physio logical conditions, cells of the RPE do not divide and persist for the life of an individua l. The RPE is one of the most actively metabolic cellular layers in the body, and its proper function is v ital to the maintenance of the photoreceptors. It participates in the regeneration visual pigments,14 maintains the bloodretinal barrier,15 phagocytize shed photor eceptor outer segments,16 synthesizes extracelullar matrix, and actively transports materials to and from the interphotoreceptor matrix.17 RPE cells also contain melanin molecules that absorb light throughout the visible spectrum to increase

PAGE 18

18 visual acuity. Many investigat ors hypothesize that the primar y lesion responsible for AMD occurs in the RPE.13,18-20 These multiple functions may be very taxing for the RPE, a single layer of cells with minimal regenera tive properties. In addition, th ese functions may become less efficient with age, particularly in the macula which is the most visually and, presumably, metabolically active region of the primate retina. Lying between the RPE and the choriocapillari s is Bruch’s membrane, a 5-layer connective tissue made in part by the RPE and the chorioca pillaris (Figure 1-2). Moving outward from the RPE, these layers are the RPE basal lamina, the inner collagenous layer, the elastic layer, the outer collagenous layer and the basa l lamina of the choriocapillaris. Debris from the RPE is passed through Bruch’s membrane to be emptied in to the choriocapillaris just as nutrients are filtered through to be delivered to the RPE and th e cells of the outer neural retina. There are several changes that occur in Bruch’s membrane with age, including an increase in its thickness due to increased collagen deposition,21,22 an exponential increase in lipid content23 and a decrease in its hydraulic conductivity.24,25 All the aforementioned age related changes in Bruch’s membrane may cause a hindrance in the exchange of material between th e choroid and the RPE. The choroid (Figure 1-2) cont ains a network of blood vessels , nerves, immune cells, and fibroblasts. The vital function of the choroid and its associated network of capillaries (choriocapillaries) is to supply the RPE and outer retina with all of thei r nutritional needs. The choroid is also responsible fo r clearance of waste products from the photoreceptors and RPE. The blood flow through the choroid is one of the highest in the body, largel y to support the high metabolic demands of the outer retina.26 The partial pressure of oxygen (pO2) in the choriocapillaris is maintained at a level higher th an any other perfused tissue, which causes the pO2 levels of the RPE to also be very high, due to its close proximity to the choriocappilaris.27

PAGE 19

19 The photoreceptor/RPE/Bruch’s membrane/choroi d complex acts as a unit and its proper function is vital for vision. Damage to one of the components of this unit may disrupt its flow of activities and lead to the manifestation of diseases such as AMD. The macula is a specialized region of the primate retin a upon which light passing through the eye is focused to give sharp, fine or central vision (Figure 1-3A). The term macula is derived from the presence of the xanthophyllic pigments (zeax anthin and lutein) that give this structure its hyperpigmentated yellowish appearance on a fundus photograph (Fig ure 1-3B). Several functions have been hypothesized for the macu lar pigments, including protecting the macula against retinal damage by filtering out phototoxic short wavelength visible light thereby sparing the photoreceptor outer segments from oxidative stress.28 In addition, the pigments may limit the effects of light scatter and chromatic aberration on visual performance.29 The unique arrangement and composition of cells in the macula separate it from the rest of the retina as well as maximize the amount of light that is focused on its photoreceptors (Fig ure 1-3C). The foveal region of the macula contains the greatest concentration of cones as well as inner retinal neurons and ganglion cells that carry visual signals to th e brain. In the fovea, s ynaptic junctions made between the photoreceptor cells, in ner retinal neurons( bipolar cells ) and ganglion cells approach a ratio of 1:1:1 to enhance resolution of images.30 The center of the macula is also free of retinal blood vessels (the capillary-free zone) to furthe r enhance visual acuity. The macula is also distinguished from the peripheral retina because of its increased metabolic activity, elevated blood flow in the choroid, and exposure to focused light.9 The differences in anatomy and physiology between these two regions of the retina may explain the increase d susceptibility of the macula versus the peri pheral retina to degeneration.

PAGE 20

20 Age-Related Macular Degeneration Histopathological Characteristics The histopathological hallmark of AMD is the occurrence of drusen, deposits of debris that form between the RPE cell plasma membrane and its basement membrane (basal laminar deposits or BlamD) or between the basement membrane of the RPE and Bruch’s membrane (basal linear deposits or BlinD)31,32 (Figure 1-4). Basal linear deposits are the most frequent histopathological correl ates of soft drusen.33-35The origin of the memb ranous debris is still debated but is thought to be undigested memb ranes of the photoreceptor outer segments, delivered by the RPE in the form of vacuoles or vesicles.36 Drusen are generally classified into three main categories: small hard drusen, soft drusen, and confluent drusen. Soft and confluent drusen are thought to be specific to AMD.37 Defining AMD is complicated because the diseas e is clinically hete rogeneous. In this dissertation, I will classify AMD as early or late as well as “dry ” or “wet.” Early lesions which include soft or large drusen and pigmentary a bnormalities even in the absence of vision loss are classified as early AMD. Late AMD has two alternative lesions : geographic atrophy (GA), which is the end stage of dry AMD, and wet AMD (F igure 1-5). GA is clinically observed by funduscopy as a well demarcated area of decrease d retinal thickness with relative pigmentary changes that allow for increased visualization of the underlying c horoidal vessel compared to the surrounding retina.38 Histologically, the features of GA incl ude thickening of Bruch’s membrane, disturbances to RPE pigmentation, atrophy, migra tion, and degeneration of the RPE as well as secondary degeneration and loss of the photorecept ors that overlie the degenerating RPE cells. 11,31,38,39 The result of these retinal damages is the gradual, progressive loss of central vision. Although more than 80 % of those w ith the disease have the dry form, 90 % of all severe vision loss from AMD occurs in the fewer than 20 % of patients affected by the wet form.3 In wet

PAGE 21

21 AMD, new vessels are formed from the choroid (choroidal neovasculariza tion) and they grow into the sub RPE or sub retinal areas (Figure 1-5). These new vesse ls are very delicate and break easily, leading to subretinal fluid, subretin al hemorrhage and RPE detachment. The late manifestation of wet AMD is a disciform scar. A ll of these changes that occur in the macular region of the retina are respons ible for the lost of central vision in AMD (Figure 1-6). In addition to accumulating debris beneath its membranes, over time the RPE also accumulates waste in its cytoplasm within second ary lysosomes or residual bodies. This waste is referred to as lipofuscin, a lipid -protein aggregate that autofl uoresces when excited by short wavelength light (Figure 1-7).40,41 The bulk of lipofuscin is derived from partially degraded outer segment disks and autophagocytic processes.42-44 Several components of lipofuscin have been identified including A2E, the major ch romophore of lipofuscin, and components derived from free radical induced oxidation of macromolecules.45 In particular, lipid s and proteins have been detected with subsequent molecular rear rangement and crosslinking to themselves and other macromolecules. The components of lipof uscin are thought to in hibit lysosomal protein degradation,46-48 to produce a variety of ROS through photoreactions 49,50 and to have detergent properties.51 All these characteri stics of lipofuscin may lead to induction of apoptosis in the RPE.52 Accumulation of lipofuscin in the RPE is observed to be grea test in the posterior pole, especially in the macula.53 Lipofuscin also serves as the major source of fundus autofluorescence.54 It is hypothesized that a ccumulation of autofluorescent lipofuscin granules in the lysosomal compartment of postmitotic RPE cells plays an important role in AMD pathogenesis.55 Epidemiology and Risk Factors AMD is the leading cause of irreversible se vere visual loss in those 50 or older in industrialized countries.2,3,56,57 Several population based studies have been conducted to

PAGE 22

22 determine the prevalence of AMD in different pa rts of the world. Based on the results of these studies, an approximate overall prevalence fo r early AMD among whites aged 65-74 years is 15%, 75-84 years 25%, and 85+, 30% (Figure 1-8A). The overall prevalence for late AMD among whites drops to 1% in those aged 65-74 y ears, 5% for age 75-84 years, and 13% for 85 years and over (Figure 1-8B). In the US, the five year cumulative number of new cases (incidence) of early AMD is 4% for patients you nger than 75 years and 18% for those aged 75 and above. These frequencies are 0.15% and 2.6 % respectively for late AMD (Figure 1-9 ). Macular degeneration is a genetically comp lex disease probably involving numerous susceptibility genes. In addition, a number of environmental factor s may be interacting with the genetic components to confer risk for the development of AMD in any given individual . The factors that have thus far been proposed and acknowledged to incr ease one’s risk for developing AMD can be divided into modifiable and non-modi fiable factors. Nonmod ifiable risks factors include age, race/ethnicity, here dity or family history of AMD, female gender and iris color.58-63 Modifiable factors for AMD in clude smoking, sunlight exposure, intake of antioxidants and micronutrients, macular pigment density, cardiovasc ular disease, hypertension, serum lipid levels and its dietary intake, body mass index, hyper opia, as well as cataract and its surgery.58,59,64-67 Genetics and nonmodifiable risk factors Population, family, and twin studies have made the inhe ritance of AMD increasingly evident, demonstrating a strong fa milial prevalence for the disease.7,8,61,68 Klaver et al,61 Hyman et al,7 Seddon et al,8 and the Blue Mountains Eye Study 68 have all reported a significantly higher prevalence of AMD in relatives of subjects with AMD compared to relatives of non AMD controls. Twin studies have also consistently shown higher levels of concordance of the disease among mono and dizygotic twins comp ared to unrelated individuals.69-74

PAGE 23

23 Contribution of genetic factors in AMD deve lopment is further supported by reports of polymorphisms in various genes found to be associat ed with the disease. Recently, 3 independent groups using single nucleotide poly morphism screening identified a DNA sequence change in the gene for the regulator of complement activation, compleme nt factor H (CFH), which causes the amino acid tyrosine at position 402 to be replaced by the amino acid histidine.75-77 The results from these 3 studies indicate that the complement factor Y402H variant in creases the chance of developing macular degeneration by at least 5 fold. Additional studies evaluating the complement factor H variant in AMD patients and controls have confirmed these results.78-81 Another recent study has reported an associatio n between the genes for complement component 2 and factor B with developing AMD.82 A polymorphism in the Toll-like receptor 4 gene has also been found to confer increased risk for developing AMD.83 Because the CFH, CC2, Factor B and TLR4 genes act along the same biological pathway, these findings suggest that the inflammatory process plays a significant role in AMD development. Two recent reports have highlighted the PLEKHA1/LOC387715 locus on chromosome 10 as another possible major locus contributing to AMD development.84,85 The PLEKHA1 gene encodes the protein TAPP1which plays a role in lymphocyte activation. There is a lack of functional information currently available for the LO C387715 gene, therefore, a deta iled physiological hypothesis for LOC387715 is not possi ble at this time. A number of genes known to be involved in inherited maculopathies, which function specifically in the outer retina, have been investigated for association with AMD. Allikmets et al has reported a statistically significant associ ation between AMD and the photoreceptor ATPbinding transporter gene (ABCR) that is responsib le for autosomal recessive Stargardt disease.86 These findings remain controversial because contradictory reports have been published that

PAGE 24

24 refute the association betw een the ABCR gene and AMD.87-89 The ELOVL4 gene, which encodes a retinal photoreceptor-sp ecific factor involve d in the elongation of fatty acids is the causal gene for STGD3 (autosomal dominant St argardt-like macular de generation) and adMD (autosomal dominant atrophic macular degeneration).90 Conley et al have found evidence of an association between AMD and the ELOVL4 gene,78 while Ayyagari and co lleagues did not find a statistically significant association between variants in the ELOVL4 gene sequence and findings of AMD.91 Other genes that have been investig ated include the VMD2 gene implicated in Best’s disease,92 the TIMP3 gene involved in Sorby’s dystrophy, 93 the EFMP1 gene associated with Doyne’s honeyc omb and Mallatia Leventinese,94 and the RDS gene linked to Sorsby’s fundus dystrophy, butterfly dystrophy, and Stargardt’s dis ease. Although variations in these genes were shown to occur more frequently in AMD cases, none of these associations were statistically significant. Other candidate genes that have b een linked to AMD although with mixed results, include APOE,95,96 HEMICENTIN-1, 97-99VLDLR,97 ACE,78,100 SOD1,101 and SOD2.102 To date, age remains the strongest risk fact or associated with AMD. The prevalence, incidence, and progression of all forms of AMD increase with advancing age in all studies conducted.1,103,104 AMD has been reported to be more prevalent among women compared to men.5,59,105 However, gender has not been consistently found to be a risk factor for AMD.103,106108 If women do have an increased risk for de veloping AMD, some hypothesize it may be due to the effect of estrogen-related variables. Th e Eye Disease Case Control Study found that the postmenopausal use of estrogen was prot ective against development of wet AMD.109 Several studies have reported the overall prevalen ce of any AMD was lower in blacks than whites.60,108,110-112 In addition, a higher inci dence of AMD has been reported in people with blue

PAGE 25

25 or light iris color.7,113-115 These findings may be explained in part by differences in genetic susceptibility, as well as protectiv e effects of greater melanin c ontent in the eyes of darker skinned individuals. This increased pigmentation ma y provide some protection to the retina from exposure to sunlight, reducing di rect photooxidative damage there by reducing the risk of AMD. Environmental and modifiable risk factors Of the environmental influences, smoking has most consistently been associated with increased risk of AMD. Data from several large populat ion based studies,116-119 case control studies,7,109,110 and two large prospective cohort studies120,121 provide convincing evidence that cigarette smoking is a risk factor for AMD. Seve ral mechanisms could explain the link between AMD and smoking. Some have suggested that th e effect of smoking on the development of AMD may be related to its e ffect on antioxidants in the body.122 Studies have shown that smokers have much lower plasma levels of beta-carotene than do nonsmokers.123,124 It is possible that by reducing serum antioxidants,124-126 smoking decreases retinal antioxidant enzymes as well. In addition, a study conducted by Hammond et al found that smokers have significantly lower macular pigment density compared to nonsmoking age-matched controls.127 Another pathway that could be involved is alteration of the choroidal blood flow by the components of tobacco.128 Exposure to sunlight has long been sugge sted to be a risk factor for AMD.129-131 Short term exposure to longer wavelength ultr aviolet and blue light can cause retinal damage in animals.132 There are some similarities between long-term ch anges seen in laboratory animals exposed to shorter wavelength visible light and ch anges seen in patients with AMD.133-137 It is theorized that light may lead to the generation of reactive oxygen species in the outer retina and/or choroid and cause injury.137

PAGE 26

26 Given the putative protective role of macular pigments, there has recently been heightened interest in the potential role of the macular pi gments in protecting against AMD. The density of macular pigments has been found to be significantly higher in men than women.138 This finding may explain the higher prevalence of AMD in women. Hammond et al ha ve reported a strong inverse relationship between smoking and macular pi gment density and this may explain in part how smoking increases the risk of AMD.127 The density of macular pi gments can be altered by diet,139 and The Eye Disease Case Control Study repor ted that a higher dietar y intake of macular pigments from leafy green vegetables was asso ciated with reduced ri sk of developing wet AMD.140 Antioxidants, such as vitamin C, vitamin E, be ta-carotene, and glutathione, and antioxidant enzymes, in theory could act as free radical scavengers and thereby prevent cellular damage. Although there are conflicting report s, the overall balance of evid ence does support that there is an inverse relationship betw een antioxidants and AMD.141,142 The most compelling evidence comes from the Eye Diseases Case Control St udy (EDCCS) and the Age-Related Eye Diseases Study (AREDS). The EDCCS reported a progressive decrease in the risk of wet AMD with increasing serum levels of carotenoids and increa sing antioxidant index (a composite score based on serum carotenoids, selenium, vitamins C and E).143 In addition, higher levels of lutein and zeaxanthin, were associated with statistically sign ificant reductions in risk of wet AMD. In the AREDS study participants were randomly assign ed to receive an or al supplement of (1) antioxidant combination (vitamin C, Vitamin E, and beta carotene); (2 ) zinc; (3) antioxidant combination plus zinc; or (4) placebo. Both antioxidant combination plus zinc and zinc alone significantly reduced the progr ession to advanced AMD.144

PAGE 27

27 A possible association between AMD and catarac t is being debated. Several investigators have noted deterioration of AMD following cataract surgery.145-149 In the Beaver Dam Eye Study, eyes having undergone cataract surgery before baseline, compared with eyes that were phakic ( contain corrective lens implanted in to the eye without removing the eye's natural lens) at baseline, were more likely to have progressi on of AMD and to develop signs of late AMD.150 It is possible that retardation of transmission of light to the reti na by cataracts may decrease the extent of light damage.150 A number of documented risk factors for car diovascular disease su ch as hypertension, hypercholesterolemia, diabetes, high dietary inta ke of fats, and a high body mass index have been associated with AMD.113,151-153 The results from these studies are not very consistent. Several studies did not find a significant relations hip between a history of cardiovascular disease and early or late AMD.143,154-157 Reactive Oxygen/Nitrogen Speci es and Antioxidant Enzymes Reactive oxygen and nitrogen species (ROS/R NS) include chemically active molecules such as the superoxide anion (O2.), the hydroxyl radical (OH.), peroxynitrite anion (ONOO.), hydroperoxyl radical (HO2), peroxyl radical (ROO.) and alkoxyl radical (RO.), as well as nonradicals, namely hydrogen peroxide (H2O2), singlet oxygen (1O2), hypochlorous acid (HOCl), and nitric oxide (NO)158 (Figure 1-10). Under normal physio logical conditions, mitochondria are the major intracellular source of ROS, produci ng superoxide anion as a normal byproduct of oxidative metabolism.159 Mitochondria produce approxi mately 90% of cell’s ROS.160 Between 1% and 4% of oxygen used by normal mito chondria is converted to superoxide.161,162 In older subjects the proportion is higher.163,164 Superoxide acts as a precurs or to several other ROS. For example, reduction of superoxide with th e addition of two hydrogen ions produces H2O2 which can decompose to generate the highly reac tive OH radical by th e Haber-Weiss reaction,

PAGE 28

28 catalyzed by a transition metal such as iron (Fe)2+ or copper (Cu)2+ and by the Fenton reaction. Superoxide can also react with NO to produce ONOO. This reaction is highly favorable such that NO efficiently competes with superoxide dismutase (SOD) for O2 ..165 Some free radicals can leak from the confines of the mitochondrial ma trix and cause damage in the cytoplasm and nucleus.166 There are several other sour ces of ROS production in organisms besides the electron transport chain of the mitochondria. Macropha ges and neutrophils use the NADPH oxidase system to produce singlet oxygen an d hydrogen peroxide as part of the respiratory burst used to kill pathogens. ROS may also be produced by xanthine oxidase, nitric oxide synthase167 or as byproduct in the production of pr ostaglandins, from exposure to light, ionizing radiation, pollution, cigarette smoke, and even ischaemia.168 ROS are generated as a second messenger for some cytokines and hormones.169,170 ROS/RNS seek a source of electrons and can abstract them in cells from lipids, proteins, nucleic acids a nd carbohydrates. These reactions usually lead to damage of these macromolecules and may lead to cell death and disease. Lipids are peroxidized when a reactive oxygen species comes in contact with a polyunsaturated fatty acid (PUFA) such as doc osahexanoic acid (DHA), the predominant fatty acid found in the cell membrane the photoreceptor outer segments.171 Lipid peroxyls and lipid peroxides stabilize themselves by stealing elec trons from other PUFA, causing a free radical chain reaction.172 Lipid-derived molecules irreversibly altered by oxidative effects are known as advanced lipoxation end products or ALEs. Lipid peroxides may cross-link with molecules they react with, to produce abnormal conjugates, increas e cell membrane rigidity, and contribute to the aging of the membranes.173-175 Lipid peroxidation generates a variety of relatively stable decomposition end products that can be used as markers for lipid peroxidation. These include

PAGE 29

29 alpha and beta unsaturated reactive aldehyde s, such as malondial dehyde (MDA), 4-hydroxy-2nonenal (HNE),176 2-propenal (acrolein),177,178 and isoprostanes.179,180 Proteins may be oxidized by ROS and result in the production of prot ein carbonyls, protein thiols and nitrotyrosine to render the proteins nonfunctional. ROS a ttack on proteins directly alter the chemical composition of the protein, may sec ondarily affect protein configuration, and can also lead to protein cross-linki ng. The biological turnover of th ese altered prot eins is more difficult and can inhibit normal proteosomal functi on. Histidine, proline, arginine, and lysine have been identified as major targets for oxi dation resulting in the formation of protein carbonyls. Cysteine residues are also susceptible to metal-ca talyzed oxidation resulting in reversible disulfide cross-linking.181,182 ROS induce all forms of DNA damage, includi ng base modifications, strand breakage, and DNA-protein crosslinks. The most prevalent pr oduct of DNA oxidation th at is detected in genomic DNA in mammalian cells is 8-hydroxy -2-deoxyguanosine (8-OHdG). This modification is a major product of hydroxyl radical attack on DNA, and is often used in assessing oxidative damage.183 Carbohydrates may also be modified by ROS. End products derived from carbohydrates and ROS reactions are known as advanced glycation end products or AGEs. Cells are equipped with a number of antioxidant defenses to maintain homeostasis between the production and removal of ROS. When ROS ove rwhelm the antioxidant defense mechanisms a state of oxidative stress may occur. Cells use both enzymatic (Figure 1-10) and nonenzymatic antioxidants systems to counterbalance free-radical generation. In humans, there are three forms of the antioxidant enzyme that detoxifies the ce ll of superoxide anion; cytosolic or copper/zinc superoxide dismutase (SOD1), mitochondrial or manganese superoxide dismutase (SOD2), and extracellular superoxide dismutase (SOD3) which all catalyze the conversion of the superoxide

PAGE 30

30 anion to molecular oxygen and hydrogen peroxide.184 SOD2 serves as the cell’s primary defense against ROS since the mitoc hondria generate the majority of the ROS in the cell.185 In addition, the fact that SOD2 knockouts onl y live for approximately three weeks of age, while SOD1 knockouts are viable, demonstrates how critical this enzyme is to the cell. The hydrogen peroxide produced by the reactions of the SOD enzymes is converted to water by catalase and glutathione peroxida se (Figure 1-10). Nonenzymatic antioxi dants involved in cellular defense include vitamins A, C, and E, wh ich all scavenge and react with O2 and OH, as well as betacarotene, lutein, lycopene, vitamin B2 and coenzyme Q10. Other antioxidant systems include thioredoxin, peroxiredoxins, hemeoxygenase and methionine suldfoxide.186,187,166 Current Animal Models of AMD The current animal models of AMD use both spontaneous and stimulated conditions to study the disease. For example, with age, rhes us macaques develop drusen similar to humans.9 Some models use laser burns in Bruch’s membrane or over expression of angiogenic factors such as VEGF to induce choroidal neovascularization.188-191 Other models attempt to stimulate AMD through senescence acceleration such as the Senescence-Accelerated Mouse.192 A number of candidate genes that are suspect ed to be involved in AMD pat hogenesis have been manipulated in mice. These include the Ccl-2/Ccr-2,193 Abcr,194 Vldlr,195 Sod1, 101and the Cp (ceruloplasmin) knockout mice196 which show varying degree of AMD-like features. Several transgenic lines of mice such as the APO*E3-Leiden,197 ELOVL4198 and mcd/mcd199 also recapitulate aspects of AMD. Finally AMD like features are also stimul ated by high fat diets, phototoxicity, and smoke inhalation.200-202 Ribozymes Gene interference strategies using antise nse oligonucleotides, ribozymes, DNAzymes RNA interference (RNAi), and zinc finger proteins have emerged as not only powerful tools to

PAGE 31

31 study gene function, but as potentia l therapeutic agents for human diseases. The choice of which of the above technologies to use depends on the specific circumstances of the application. From these tools, ribozymes have been shown to be pr omising gene targeting reagents to specifically knockdown gene expression. Ribozymes are catalytic RNAs that mediate the cleavage or ligation of specific RNA molecules by transesterification or hydrolysis of phosphate groups. They have also been found to catalyze the aminotransferase activity of the ribosome.203 The ability of some RNA sequences to possess catalytic properties wa s first demonstrated for th e group I intron ribozyme of Tetrahymena thermophil.204 and the RNA moiety of RNAse P.205 Since then, several more naturally occurring classes of ribozyme have b een identified. These include the hammerhead, hepatitis delta virus (HDV), hairpin, Neuros pora Varkud satellite (Vs) and group II intron ribozymes.206-215 In addition, two totally new RNA cleav age activities have recently emerged. The first is called riboswitches, a group of cont rol elements mainly found in prokaryotic mRNA. Riboswitches regulate gene expression by selectively binding a metabolite related to the function of the gene to sequester or rel ease sequences required for transcriptional termination or initiation of translation.216,217 The second may be an important new class of functional cellular catalytic RNA species, first shown to exist in the human -globin gene. This element lies within a 200 nucleotide sequence in the 3’end of the -globin mRNA, and undergoes self-cleavage at a particular site.218 To date, the hammerhead ribozyme is the mo st commonly used ribozyme to study gene function and for disease therapy because of its s implicity, relatively small size and its ability to be inserted into a variety of flanking sequences without chan ging its ability to cleave its target.219-223 In addition, design of a hammerhead is also less stringent than other ribozymes such

PAGE 32

32 as the hairpin. The hammerhead ribozymes are the smallest of the endonucleolytic cis-acting ribozymes at approximately 30-nucleotides long. This motif was discovered in the RNA genome of different plant viroids and virusoids where th ey exist as self cleaving domains in the RNA genomes to process the products of rolling circle replication into single genome length strands.224 Although in nature these ribozymes function in ci s, Uhlenbeck and others later developed them to work in trans against other RNA targets.225,226 The trans-acting hammerhead is composed of a catalytic core stabilized by a hairpin structure (stem II) and two flanking arms that are us ed to hybridize to its target to form stems I and III 227-229 (Figure 1-11). In theory, the hammerh ead can be designed to cleave any target harboring the consensus NUX cl eavage triplet (N= any nucleo tide; U= uridine; X= any nucleotide except guanine). Its specificity and ef ficiency is determined by the two binding arms that base pair with the sequences flanking the X in the target. Cleavage of a target takes place 3’ of X in a transesterification r eaction, resulting in two products, a 2’,3’ cyclic phosphodiester and a 5’ hydroxyl terminus on the 3’ fragment.230 Following the cleavage of the RNA backbone, the reaction products diffuse away from the active si te leaving the ribozyme free to complete another reaction cycle (Figure 1-12). The multiple turnover characteri stic of the hammerhead ribozyme makes it advantageous over other technologies such as antisense oligonucl eotides, which only act in a 1:1 stoichiometric relationship with the target R NA. Unlike siRNAs, ribozymes do not require endogenous cellular pathways and proteins to carry ou t cleavage of their targets. There are also concerns of off-target effects with antisen se oligonucleotides,231 DNAzymes and siRNAs232. Hammerhead ribozymes appear to be more sensitive to base change s near the cleavage site than other antisense approaches, and therefore can be used to discriminate betw een single nucleotide

PAGE 33

33 polymorphisms.233,234 It has been reported that the CpG motifs of antisense oligonucleotides can elicit immune responses in vivo,235 and siRNAs are capable of ac tivitating the inte rferon response pathway.236 These and other cellular toxicities have not been reported for ribozymes. The hammerhead ribozyme has already been successfu lly used to down-regulate cancer causing genes,237,238 and suppression of viral infections.239,240 Others have used ribozymes to knockdown specific targets to m odel disease phenotypes.241-244 Adeno-Associated Virus Adeno-Associated Virus (AAV) is a member of the small single-stranded DNA viruses of the Parvoviradae family.245,246 The virus is classified under the genus Dependovirus which requires a helper virus such as Adenovirus or Herpes virus for a productive infection. In the absence of helper virus, it’s been shown in hu man cells that AAV intergrates in a specific locus of chromosome 19,19q13.3-qter (AAVS1).247 AAV may also establish a latent infection within the cell by persisting in episomal forms. The cap sid of AAV is approximately 20 nm in diameter and encapsidates its 4.7 kb genome consisting of two large open reading frames (ORF). The first ORF, rep, encodes four replication proteins (R ep78, Rep68, Rep52 and Rep40) responsible for site-specific integration, nicking, and helicase activity, as well as regulation of pr omoters within the AAV genome. The second ORF, cap , encodes the capsid structur al proteins VP1, VP2, and VP3. These three proteins are assembled at a ra tio of 1:1:10 to form the icosahedral virion composed of 60 units. The genome of AAV is fla nked by inverted terminal repeats (ITR) which are the only cis-acting elements required for genome replication and packaging.245 To date, 11 different cloned AAV serot ypes (AAV1-5, AAV7-11) and over 100 AAV variants have been isolated from adenoviru s stocks or from human and nonhuman primate tissues.247-255 AAV2 was the first serotype isolated a nd developed into recombinant vectors for transgene delivery, and is therefore the most wi dely studied. The genome of AAV vectors used

PAGE 34

34 for gene therapy is deleted of the entire w ild-type viral coding regi ons (rep and cap). The production of rAAV vectors is based on the mol ecular cloning of the various AAV components into separate plasmids. A plasmid containing the transgene of interest flanked by the viral ITRs, and a second plasmid that encodes rep and cap pr oteins and the helper plasmid for the adenoviral helper genes (E2A, E4orf6 and VA RNA from human Adenovi rus 5) are transiently cotransfected into 293 cells.256 AAV is purified by harvesting the cel ls after 72 hours. The cells are resuspended in 0.5% sodium deoxycholate, 20 mM Tris HCl, pH 8.0 and 150mM NaCl, and treated with benzonase. The ce llular membranes are disrupted by three cycles of repeated freeze-thaws. Crude lysates are purified usi ng affinity chromatography, followed by cation exchange chromatography. The final product is us ually concentrated to a final titer of 1-2x101213 vector genome/ml . It has been observed that the majority of the general populatio n contain circulating antibodies for AAV capsid. This is a problem if re-a dministration of the v ector is required. Due to this fact, many researchers have sought to us e the different serotypes of AAV. The cap genes used to assemble the capsids of the different AAV serotypes are interc hangeable. Consequently, hybrid AAV vectors containing the IT Rs of one AAV serotype can be packaged in the capsid of another. Hybrid AAV vectors are now produced using a pseudotyping strategy in which the AAV genome is flanked by AAV2 ITRs and the cap sids are from AAV 19. These vectors are typically designated AAV2/1-9.257 The differences in the capsid proteins of the different AAV serotypes are probably the key element to their distinct cell and tissue affinities. AAV has become one of the most efficient vehicles for gene delivery to the retina. AAV has a number of features that makes it an attr active vector for the retinal gene delivery. 1) Vectors are deleted of both rep and cap genes, limiting their natural spread because both wild

PAGE 35

35 type AAV and a helper virus woul d be required for its propagation.258 2) AAV does not invoke an inflammatory immune response and has not been associated w ith any disease in humans or animals. 3) The virus has been shown to tran sduce a wide range of tissues including both dividing and nondividing cells. In the case of the retina, this is very important because the majority of the cell types in the retina do not divide. 4) Transgenes delivered via AAV establish long-term expression. Le Meur et al have demonstrated that s ubretinal injection of AAV2 vector into dogs or primates can sustain constitutive transgene expression in the retina for at least 36 months.259 5) Methods are currently in place for the production and purification of AAV in high titers, which allows a high fraction of the cells being targeted to become exposed to the vector. The tropisms and transduc tion patterns of the AAV vectors lead to efficient and stable gene transfer in RPE, photore ceptor, and ganglion cells.260-263 Various studies have shown that there are distinct differences in retina l cell tropism (Table 1-1), speed of onset and intensity of gene expression among the serotypes of AAV. In rodents, subretinal inj ection of AAV-2/1, -2/2, -2/3, -2/4 and -2/5 resulted in a hierarchy in the levels of gr een fluorescent protein transgene expression. AAV-2/1 shows early onset of eGFP expr ession (3 days) restri cted to the RPE and is more efficient than AAV2/2.260,263,264 Subretinal delivered AAV-2/2 and AAV-2/ 5 vectors are able to transduce both RPE and photoreceptor cells, but do so in a slower onset with transgene expression occurring at 2 weeks.260 The level of gene expression of AAV5 appears to be greater than that of AAV2 in both the RPE and photoreceptors.263 AAV2/3 does not appear to have an affinity for retinal cells and AAV2/4 exhibits exclusive a nd stable transduction of the RPE.263,265 Similar to AAV1, AAV6 transduces primarily the RPE.263 Intravitreal injection of AAV2/2 results in the transduction of ganglion cells and various cells of the inner nuclear layer.260,266-270 No transduced cells are detected fo llowing intravitreal injection of AAV-2/5.271

PAGE 36

36 AAV serotype studies conducted in the retinas of larger animals such as non human primates, dogs, and cats have generally confirmed the results obtained in rodent studies.268,272-274 Project The events that lead to the injury of the macula in AMD are not all known. However, it is postulated that several risk f actors including both genetic and environmental, determine one’s susceptibility to developing AMD. The number a nd variety of risk factors acknowledged or proposed for AMD suggest that ther e may be several different initia ting events that contribute to the formation of the lesions that are recognized as AMD. The initiating events that lead to AMD may share a common mechanism by which they cause injury to the RPE. In this dissertation, I propose that oxidative tissue injury may be a unifying mechanism because it serves a common denominator between a number of the risk factors for AMD. To test this, I report the use of a ribozyme targeting MnSOD to induce oxidative damage to the RPE of wild type mice to model changes in th e RPE/retina that may occur in the early stages AMD. The ability of the SOD2 ribozymes to efficiently target MnSOD transcripts was first assayed in an RPE cell line followed by in vivo testing. After ribozyme treatment of the outer retina, we assayed for levels of MnSOD protein and increased markers of oxidative stress in the RPE/Choroid. Dark adapted full field electror etinogram (ERG) measurements were performed to look for changes in retinal electrophysiology. Li ght and electron microscopy were also used to observe histological changes in the retinas.

PAGE 37

37 Figure 1-1. The layers of the reti na. Left photo is a schematic di agram of the ten layers of the retina and the right photo is a corresponding micrograph. http://www.mc.vanderbilt.edu/histology /labmanual2002/labsection2/Eye03.html

PAGE 38

38 Figure 1-2 . Layers of the retina affected by AMD. A) Electron micrograph of the photoreceptor/RPE/BrM/Choroid complex (Majji IOVS 2000). B) A corresponding schematic diagram of the complex. Note th e inner and outermost layers of BrM are the basal laminas of the RPE and choriocapillaris respectively. (http://content.nejm.org/content /vol351/ issue4/ images/large/04f2.jpeg)

PAGE 39

39 Figure 1-3. The macula. A) The macula contai ns the xanthophylic pigments, zeaxanthin and lutein that gives it a hyperpigmentated yellowish appearance. B) Light passing through the eye is focused on the macula to gi ve us our sharpest vision. C) The retinal cells in the center of the macula are uni quely arranged to maximize the amount of light captured by it photoreceptors.

PAGE 40

40 Figure 1-4. SubRPE deposits. Debris can accumulate between the plasma and basement membranes of the RPE (BlamD) or between the basement membrane of the RPE and Bruch’s membrane (BlinD) (Curcio CA, 1999).

PAGE 41

41 Figure 1-5. Schematic diagram of Dry and Wet AMD. A and B) Dry AMD is characterized by drusen as well as degenerated RPE and photoreceptor cells. In wet AMD there is abnormal growth and leakage of choroida l vessels into the subretinal space.

PAGE 42

42 Figure 1-6. Injuries that occur in the macula due to AMD results in lost of central vision. The picture on the left represents normal vision. The picture on the right is the same scene as viewed by a person with AMD.

PAGE 43

43 Figure 1-7. Lipofuscin. The bri ght yellow fluorescence in the RPE is produced by lipofuscin autofluorescence generated when exc ited by short wavenlengths of light.

PAGE 44

44 Figure 1-8. A. Prevalence of early AMD amon g whites. B. Prevalence of late AMD among whites (Klaver CCW, 2004). US, United St ates; AUS, Australia; NL, Netherlands

PAGE 45

45 Figure 1-9. Geographic differences in incidence of AMD. Comparison of 5 year cumulative incidence of late AMD in individuals 55 a nd older in three population based studies (Klaver CCW, 2004).

PAGE 46

46 Figure 1-10. Reactive oxygen speci es (ROS) commonly generated in the cell (Red), and the mechanisms by which they are generated (black). ROS are removed by antioxidant enzymes (green) to prevent oxidation of cellular components (Temple, 2005).

PAGE 47

47 Figure 1-11. Structure of the trans-acting ha mmerhead ribozyme. Cleavage by the ribozyme occurs after an NUX triplet shown in red. The green nucleotides make up the conserved catalytic core that is necessary fo r catalysis. The ribozym e hybridizes to its target mRNA through complementary base pairing to form helices I and III.

PAGE 48

48 Figure 1-12. Schematic diagram of cleavage by the hammerhead ribozyme. The hammerhead ribozyme in black binds to its target in red through complementary base pairing. Upon cleavage of the target, a 5’ and 3’ produc ts are released and th e ribozyme is free to catalyze successive cleavage reactions

PAGE 49

49 Table1-1. Tropism of rAAV serotypes following subret inal injection in different animal species. RPE, retinal pigment epithelium; PR, photor eceptors; N/A, not available. Adapted from Rolling F, 2004. rAAV vector Mouse Rat Dog Primate. rAAV2/1 RPE N/A N/A N/A rAAV2/2 RPE + PR RPE + PR RPE + PR RPE + PR rAAV2/3 _____ N/A N/A N/A rAAV2/4 N/A RPE RPE RPE rAAV2/5 RPE + PR RPE + PR RPE + PR RPE + PR rAAV5/5 RPE + PR N/A N/A RPE + PR rAAV2/6 RPE N/A N/A N/A

PAGE 50

50 CHAPTER 2 REDUCTION OF SOD2 EXPRESSION IN THE RPE OF WILD-TYPE MICE Introduction As a result of endogenous oxidative processe s and exposure to environmental oxidants, over time we accumulate irreversible tissue damage . These pathologic changes may lead to the development of age-related diseases such as am yotrophic lateral sclerosis, Parkinson Disease, Alzheimer’ Disease, atherosclerosis, and cancer. Similarly, it has been hypothesized that oxidative damage is an integral component in th e occurrence of AMD. This interpretation is supported by numerous observations that sugg est that the retina/RPE/choroid complex is particularly susceptible to da mage by oxidants. The RPE is very metabolically active, consuming a great deal of oxygen, and resides in an environment with high oxygen tension.275 The retina/RPE/choroid complex is highly susc eptible to photooxidative stress due to its continuous exposure to high levels of irradi ation, and its numerous chromophores such as lipofuscin, rhodopsin, cytochrome c oxidase, and pr otoporphyrin IX that ar e able to generate ROS.50,276-279 There is also a high concentration of the polyunsaturated fatty acid (PUFA), docosahexaenoate (DHA), within lipids in the me mbranes of the photoreceptor outer segments thus making the retina inherently susceptible to lipid peroxidation (PUFA are readily oxidized by ROS).280 The RPE is subjected to a variety of metabolic stresses, one of which is the phagocytosis of photoreceptor disks, wh ich has been shown to generate ROS.281 Other supportive evidence that oxidative damage plays a role in AMD pathogenesis include results from a study conducted by Kimura et al that found a significant association between a polymorphism in the gene encoding the protectiv e enzyme manganese superoxide dismutase and wet AMD.102 In addition, high plasma levels of th e antioxidants lutein and zeaxanthin are associated with reduced risk of developing AMD.116 SOD1 deficient mice which develop AMD

PAGE 51

51 like drusen deposits develop an increased number of drusen after prolonged exposure to light.101 Taking high levels of antioxidant s and zinc are shown to slow the progression of early AMD to wet AMD.144 Smoking, which has been reported to de plete antioxidant levels is positively correlated to developing later stages of AMD.116-119,124-126 Espinosa-Heidmann et al. showed that exposure of mice to cigarette smoke resulted in AMD like features such as the formation of subRPE deposits, thickening of Bruch’s membrane, and accumulation of deposits within Bruch’s membrane.282 Finally, Crabb and colleagues have s hown that AMD retinas have increased oxidatively modified proteins compared to non-AMD retinas.283 The production of ROS in the retina/RPE/choroid complex by mitochondrial metabolism, rod outer segment phagocytosis, and chromophore photoxicity sets the stage for damagi ng reactions that can alter structures of macromolecules to yield peroxides, oxidized proteins and DNA strand breaks which are all precursors to cell death and disease. To protect itself from the oxidants generated by the various processes described above, the photoreceptor/RPE/choroid complex contains both enzymatic and nonenzymatic antioxidants such as Mn and Cu/Zn SOD, catalase, th e glutathione (GSH) system, thioredoxins, peroxiredoxins as well as the vitamins C and E.284-288 MnSOD is considered to be one of the most important antioxidant components of a cell. It is a homotetrameric enzyme with monomers of 25 kDa and requires manga nese at the active center of each subunit.184 Mice completely depleted of the MnSOD gene die within 10 da ys after birth from cardiomyopathy, metabolic acidosis and neurodegeneration , further de monstrating the importance of the MnSOD enzyme.160,289-291 The ability to monitor progressive ch anges to the retina of MnSOD deficient mice is greatly limited because th e mice do not live into adulthood. Sandbach et al. characterized the pathologic features in the retinas of SOD2 deficient mice,292 however the

PAGE 52

52 increased oxidative burden was not limited to the RPE where the primary lesion of AMD is thought to lie. In an attempt to study the effects of oxidative da mage to the RPE on the retina, I used a rAAV-ribozyme–mediated approach to knockdown the mRNA of MnSOD in the RPE of wild-type mice. The AAV ribozyme approach allows somatic knockdown of SOD2 expression in normal adult tissue, thus circumventing the pr oblem of the lethality of the SOD2 knockout. This approach has been successfully used to model other eye diseases such as retinitis pigmentosa and Leber Hereditary Optic Neuropathy.241-244 In this chapter, I report the use of ribozyme s targeting MnSOD to induce oxidative damage to the RPE of wildtype mice to model changes in the RPE/retina that may occur in the early stages of AMD. The ability of the SOD2 ribozym es to efficiently target MnSOD transcripts was first assayed in a RPE cell line followed by in vivo testing. After ribozyme treatment of the outer retina, we assayed for levels of MnSOD protein and increased markers of oxidative stress in the RPE/choroid. Dark-adapted full field electr oretinogram (ERG) detected timedependent decrease in the response to light. Light and el ectron microscopy documented damage to the RPE, to Bruch’s membrane and to photorecepto r cells in ribozyme treated eyes. Materials and Methods In this study I used a ribozyme that cleav es after nucleotide 4 32 of the mouse SOD2 transcript. Ribozyme 432 (Rz432) was previously designed and found to be catalytically active in vivo by Qi et al243. The ribozyme and its mRNA targeti ng sequence are pictured in Figure 21. The cleavage triplet is shown in red. Ribozyme Cloning and rAAV DNA oligonucleotides coding for active and inact ive Rz432 were ordered from Invitrogen (Carlsbad, California). The sequences are listed in Table 2.1. The inactive ribozyme contains a G to C mutation (highlighted in re d in Table 2.1) at a conserved posit ion in the catalytic core that

PAGE 53

53 abolishes activity of the ribozyme. In addition to the ribozyme sequence, these oligonucleotides contained sequences (bold letters in Table 2.1) appended to their 5’ and 3’ ends so that when annealed they formed the sticky overhangs corres ponding to HindIII at the 5’ end and SpeI at the 3’ end. Prior to use in vivo , Rz432 was tested in tissue culture cells. For this purpose, the Rz432 was cloned into an AAV packaging plasmid using the HindIII/SpeI sites under the control of the ubiquitous chicken beta-actin promoter (CBA) coupled to the cytomegalovirus enhancer. Immediately downstream of the Rz432 is a self cl eaving hairpin ribozyme that releases it from downstream sequences, thereby making the ribozyme available to cleave its target. Within the same AAV packaging plasmid is a CMV-green fluorescent protein (GFP) cassette to enable visualization of which cells are expressing th e ribozyme. The Rz432 plasmid is depicted in Figure 2-2. Preliminary experiments were performed to de termine whether inducing oxidative stress in photoreceptor cells or in the RPE wo uld have the great est impact on the photoreceptor/RPE/choroid complex. Rz432 was cl oned into three rAAV2 packaging plasmids under the control of: (1) ubiquitous CBA promoter that leads to transduction in both the RPE and photoreceptors; (2) an 800 bp fragment of the RP E65 promoter which limits expression to the RPE; and (3) the 472 bp segment of the mouse opsin promoter (Mops 500) which limits expression to the photoreceptors. The constructs are illustrated in Figure 2-3. Large scale preparations of Rz432 plasmids were made usi ng an alkaline lysis with SDS method to extract DNA from 1L of E. coli “sure cells” (Strategene, La Jolla, CA) transformed with the plasmids. The resulting plasmid preparations were furthe r purified by cesium chloride-ethidium bromide gradient ultracentrifugation.

PAGE 54

54 The packaging of Rz432 into AAV2 vectors was performed by the UF Ophthalmology Packaging Core. Briefly, Human Embryonic Ki dney 293 cells were co-transfected by CaPO4 precipitation with the AAV packaging plasmid encoding the hammerhead ribozyme and a helper plasmid containing the AAV rep and cap genes as well as the adenovirus early genes needed to propagate AAV. After 72 hours, cells were harvested and resuspended in 0.5% sodium deoxycholate in 20 mM Tris HCl, pH 8.0 and 150mM NaCl, and treated with benzonase. The cellular membranes were disrupted by three cycles of repeated freeze-thaws. Crude lysates were purified using affinity chromatography, followed by cation exchange chromatography. The final product was concentrated to a final titer of 1-2x1012-13 genome copies per ml of Balanced Salt Solution/0.014%Tween (Alc on, Fort Worth, TX). Cell Culture Studies with SOD2 Rz432 RPE-J cells RPE-J cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD). The cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM; Cellgro Mediatech, Inc., Herdon, VA) supplemented with 4% fetal bovine serum (FBS) (ATCC, Rockville, MD), non-essential amino acids (Cellgro Mediatech, Inc., Herdon, VA), and penicillin/ streptomycin (Cellgro Mediatech, Inc , Herndon, VA) at 32.5C with 5%CO2. To detach cells, they were treated with 0.5% trypsin EDTA (Ce llgro Mediatech, Inc. (Herndon, VA) in phosphate buffered saline (PBS). PBS is composed of 130mM NaCl and 10mM sodium phosphate, monobasic and diba sic mixed to pH 7.4 SOD2 ribozyme delivery to RPE-J Cells The ability of Rz432 to function in RPE-J cells were determined by delivery of the ribozyme cloned in a plasmid under the control of the CBA promoter. To serve as a control,

PAGE 55

55 RPE-J cells were also treated with a plasmid c ontaining only the GFP marker gene (Figure 2-2). The day before the transfections, the cells were trypsinized and counted using a hematocytometer. 3.5x106 cells were plated on 10cm dishes (Corning, Corning, NY). The next day 24 g of Rz432 or GFP control plasmid DNA and 60L of Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA) were used per t ransfection. The efficiency of the transfections was determined by using Fluorescence Activated Cell Sorting ( FACScan; BD Biosciences, Lincoln Park, NJ ) based on the fraction of cell s expressing the GFP marker. RNA and protein isolatio n from RPE-J Cells At 1, 2, and 4 days post transfection, the RPE-J cells were harvested with the addition of trysin to the cells followed by centrifugation. The re sulting cell pellets were divided in two. Half of the pellet was used to isolate RNA using a Sigma GenElute Mammalian Total RNA Miniprep Kit (SigmaAldrich, St. Louis, MO) according to the manufacturer’s protocols. The RNA samples were eluted in 50l of elution buffer and treated with DNAse I (Ambion, Inc. Austin, TX ) according to the manufacturer’s protocol. Th e concentrations of the RNA samples were determined by measuring the OD260. The other half of the pellet was used to extract protein. The cell pellet was resuspended in 150l 1X Laem lli sample buffer (100mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol) followed by sonication for 30s. A 10l aliquot was removed from each protein sample to measure protein concentrations at OD750 using the Bio-Rad Laboratories (Hercules,CA) DC Protein Assay Kit according to the manufacturer’s protocol. DTT (200 mM) and protease inhibitor cocktail (1X) from Roche Applied Science (Indianapolis, IN) was added to the remaining volume of protein. Reverse transcriptase (RT-PCR) mRNA analysis in RPEJ cells MnSOD mRNA levels after treatment with Rz432 was determined by RT-PCR using actin as an internal control. Reverse transcri ption (RT) reactions were performed using the

PAGE 56

56 Amersham (Piscataway, NJ) First-Strand cDNA S ynthesis Kit in 15 l reaction volumes (7l total RNA (2g), 5 l bulk mix, 1 l 200 mM DTT, 1 l 30pmol SOD2 and 1 l 30pmol actin antisense primers. PCR reactions contained 2 l of the RT reaction, 15 pmol each of actin and MnSOD primers listed in Table 2-2, 0.2 mM dNTPs, Promega Buffer, 2.5 mM MgCl2, and 2.5U Promega Taq Polymerase in a 50 l volume. The pr imers used for RT-PCR reactions are listed in Table 2-2. To determine the linear range of amplification for MnSOD and -actin, increasing number of PCR cycles were carried out consistin g of 30s each at 95 C, 55C and 72C. 3l of -actin and 5l of MnSOD and PCR products were resolved on a 7% polyacrylamide gel. The gels were stained with a 10,000 fold dilution of SYBR Green (Invitrogen Molecular Probes, Carlsbad, CA ), in TBE (10mM EDTA, 0.45M Tris base, and 0.45M Boric Acid) for 15 minutes. The stained PCR products were visualized a nd quantitated using a Storm Phosphoimager and Imagequant software (GE Healthcare, NJ). MnS OD mRNA levels were e xpressed as a ratio of MnSOD to -actin. MnSOD protein analysis in RPEJ cells Protein analysis was performed using western blotting. The proteins from total cellular lysates were separated on a 12% SDS polyacrylamide gel ( Bio-Rad Laboratories, Hercules, CA) . 10g and 20g of lysate were loaded for -actin and MnSOD analysis respectively. Proteins were electrotransferred to a nitrocellulose me mbrane. The membrane was blocked for 1 hr at room temperature in 5% (w/v) skim milk powde r (Carnation) diluted in PBS with 0.1% Tween20 (PBS-T) followed by incubation with a 1:2000 d ilution of affinity-pur ified polyclonal rabbit anti-MnSOD antibody (Stressgen) or 1:5000 of monoclonal mouse anti-actin in 5% (w/v) skim milk powder/PBS-T at 4 C overnight. Membranes were washed 3 times 5 min each in PBS-T and incubated with an anti-rabbit IgG (1:5000 for detection of MnSOD) and anti-mouse (1:5000 for detection of -actin) alkaline phosphatase –conjug ated secondary antibodies in 5%

PAGE 57

57 skim/PBS-T for 1 hr at room temperature. For detection of MnSOD and -actin, the membranes were incubated with a BCIP/NBT substrate ki t (Zymed Laboratories, Carlsbad, CA). The immunostained bands were quantified by densitometry, using the Bio-Rad Quantity One software (Bio-Rad Laboratories, Hercules, CA) . Each MnSOD signal was normalized to the actin signal from the same sample, and the normali zed values were expressed as a percentage of the MnSOD/ -actin ratio from the control cells. Detection of superoxide anion in RPE-J cells To detect intracellular superoxide genera tion, I used the probe dihydroethidium (DHE) (Invitrogen, Molecular Probes, Carlsbad, CA) that is specifically oxidized by superoxide. Upon binding of the oxidized DHE to nucleic acids a red fluorescent signal is produced. RPE-J cells seeded on a 96 well plate were transfected with Rz432 or GFP control plasmid. At 2 days post transfection, treated and untreated cells were incubated with 5 M DHE for 15 minutes at 37C. The cells were washed and then observed w ith a Zeiss fluorescence microscope using the Axiovision 4.4 software (Zeiss International) . A spectrofluoromete r microplate reader (Molecular Devices, Corp., Sunnydale, CA) was us ed to quantitate the red fluorescence. Measurements obtained from the untreated cells were used as background and subtracted from levels obtained from treated cells. Apoptosis in RPE-J cells 104 RPE-J cells were plated per well on a 96 well plate. The next day the cells were transfected in triplic ate with 0.2g of Rz432 plasmid or GFP control plasmid and 0.6l lipofectamine 2000 according to the manufacturer’s protocol. At 48 hours post transfection, the cells were examined for apoptotic cell death. A Cell Death Detection El isa kit (Roche Applied Science, Indianapolis, IN) was used to measur e nucleosome release, one of the hallmarks of apoptosis. The assay was performed according to the methods outlined by the manufacturer.

PAGE 58

58 Briefly, the cell lysates from the different samples we re loaded onto the streptavidin coated plate. A mixture of anti-histone-bio tin and anti-DNA-POD antibodies was added and incubated. The anti-histone antibody binds to the histone compon ent of the nucleosome while simulateneously attaching to the streptavidin coated plate vi a biotin. In addition, the anti-DNA-POD antibody binds to the DNA component of the nucleos ome. The unbound antibodies were removed by washing, and ABTS )which serves as a substrate for POD) was added. The absorbance of the color reaction produced by POD an d ABTS was measured with a microplate reader (Biotek Instruments, Inc., Winoski, VT05404) at 405nm. In Vivo Studies with SOD2 Rz432 Experimental animals and injection of AAV vectors Experimental animals which consisted of 4-7 weeks old wild type C57BL/6J and DBAJ/1 mice were maintained in 12h:12h light/dark regime. Before the injections , 1% atropine sulfate solution (Bausch and Lomb, Tampa, FL) was placed topically on the eyes of the mice 3 times at 1 hour intervals. Prior to injections, the mi ce were anesthetized using a ketamine/xylazine mixture and their eyes further dilated with 2.5% phenylephrine HCl. Proparacaine HCl was also applied topically to the cornea as a local anes thetic. The eyes then received a drop of 2.5% methylcelullose to aid in retinal visualization and to he lp keep the eye hydrate d during injections. Groups of mice were injected subretinally with 1 l of 2.5x1012 particles per ml of active ribozyme or a control of either inactive ribozyme or GFP-only construct. The injections were performed as described by Timmers et al.293. Briefly, under direct observation with a Nikon SM2800 operating microscope (Nikon, Melville, NY), a 28 gauge hypodermic needle was used to puncture the cornea to create an aperture. A blunt 32 gauge needle on a Hamilton syringe was then inserted through the opening, and vector inject ed slowly into the subretinal space in the

PAGE 59

59 posterior retina (Figure 2-4). VPP antibiotic ointment (Akorn, Buffalo Grove, IL) was placed on the eyes of the mice following injection to prevent infection. Detection of SOD2 ribozyme expression in vivo At 6 weeks post injection, mi ce treated with Rz432 or GFP were euthanized by an overdose of isofluorane (Abbott Laboratori es, North Chicago, IL) followed by cervical dislocation. Their eyes were quick ly removed, rinsed briefly in PB S, and enucleated. The eyes were fixed in freshly made 4% paraformaldehyde solution at 4C overnight. Following fixation, the eyes were incubated in 10, 20 and 30% sucrose for 2 hours, 6 hours and overnight respectively. Eyes were embedded in Ti ssue Tek OCT compound embedding medium (Sakura Finetek, Torrance, CA) and frozen by dipping in to isopentane cooled with liquid nitrogen. Frozen serial sections (12 m) were cut w ith a Microm H550 cryosta t (Microm, Walldorf, Germany) through the entire eye and mounted on Superfrost/Plus microscope slides (Fisher Scientific, Pittsburgh, PA). The sections were air dried for 30 minutes and mounted using Vectashield mounting medium with DAPI (Vector Laboratories, Burlingame, CA). The extent of which the retinas of the mice were trans duced was determined by native GFP fluorescence. GFP expression in the retinal s ections was documented using a Leica TCS SP2 AOBS Spectral Confocal Microscope with Leica Conf ocal Software Version 2.61, Build 1537. MnSOD protein levels in vivo To detect levels of MnSOD, at 6 weeks post injection, 6 mice treated with AAV-Rz432 or AAV-GFP were euthanized. Their eyes were qu ickly removed, rinsed briefly in PBS, and enucleated. The anterior chamber and excess tiss ue was also discarded. The neural retina was separated from the posterior eye cup containing the RPE/choriod us ing a dissecting microscope. Pools of 2 posterior eye cups containi ng the RPE/choroid were placed in 150 l of Laemlli sample buffer. Protein was extrac ted as described above. 20 g of total lysates were separated

PAGE 60

60 on a 12% SDS polyacrylamide gel. MnSOD and actin protein bands we re detected using the same protocol outline in the methods for RNA and protein analys is in RPEJ cells. Detection of markers of oxidative damage At 4 months post treatment, groups of 3 mice treated with AAV-Rz432 or AAV-GFP were euthanized by overdose of isofluorane followe d by cervical dislocation. Their eyes were processed as described above. Indirect immunofluores cence staining was done to detect 4-HNE. Briefly, frozen sections of the ey es were dried at room temperatur e for 30 minutes. The sections were blocked and permeabilised in 5% bovi ne serum albumin (BSA) (Roche Diagnostic, Indianapolis, IN)/ 0.05% TritonX100 (Sigma, St Louis, MO) at r oom temperature while shaking for 1h. The sections were incubated overnight at 4o C, with a 1:100 diluti on of rabbit anti-HNE (Alpha Diagnostics Internationa l, Inc., San Antonio, TX) in 1% BSA/0.05% TritonX100. The slides were washed with PBS and then inc ubated with 1:1000 dilution of CY3 fluorescently labeled secondary antibody, for 1h at room temper ature. The sections were visualized and photographed using a Leica TCS SP2 AOBS Spectral Confocal Microscope with Leica Confocal Software Version 2.61, Build 1537. Western blotting was also used to anal yze levels of nitrotyrosine and CEP (carboxyethylpyrrole) in th e posterior eye cup. To prepare tiss ues for detection of nitrotyrosine and CEP, the lipid content was first extracted. Briefly, 750 l of 0.9% NaCl was added to tissues followed by 750 l methanol (both containing 100 M BHT, 2 mM EDTA). 5 l of 0.5 M HCL was added to the tissues and purged with argon. The tissues were homog enized with a white Teflon pestle. After homogenization, 750 l of chloroform (CHCl3) was added and vortexed for 1 min. The mixture was centrifuged to separate the CHCl3 layer and methanol. The heavier CHCl3 layer was transferred to a brown tube wi thout disturbing the lighter methanol/aqueous layer. CHCL3 extraction was performed for two more times. The CHCl3 extractions were

PAGE 61

61 combined and evaporated under argon in red light illumination. The dried samples were purged with argon and were stored at -80C for possible mass spectrometric analysis. The methanol/aqueous fraction was dried under speed vacuum to complete dryness. After drying, 300 l of extraction buffer [60 mM Tris HCl cont aining 2% SDS, 10 mM DTT, 2 mM EDTA and 100 M BHT] was added to each eye cup prepar ation and flushed with argon thoroughly. The mixture was vortexed every 5 mins for 30 mins. After vortexing, the mixture was transferred to a clean Beckman ultracentrifuge tube, and centrifuged at 60,000 g for 7 min. The clarified supernatant was transferred to another tube wi thout disturbing the pe llet. Extraction was repeated two more times with 75 l of extractio n buffer for retina and 150 l for eye cup added directly to the centrifuge tube, followed by vor texing every 5 min for 20 min. The supernatant were combined and flushed thoroughly with arg on. Protein concentrations were approximated using the Bradford Assay. Based on this determin ation, ~5 g of each sample was loaded on an SDS-polyacrylmide gel. The prot eins were partially electrotra nsfered from the gel to PVDF membranes. The membranes were incubated w ith either 1 g/ml of an anti-nitrotyrosine monoclonal antibody (mAb, Upstate Biotec hnology, Lake Placid, NY), or antiCarboxyethylpyrrole mAb (from Dr. Koji Uchida, Co le Eye Institute) overnight at 4C. The membranes were washed with (PBS-T) and in cubated with a 1:10000 dilution of secondary antibody conjugated to horse-radish pe roxidase for 1h at room temper ature. Detection of protein bands was performed with an enhanced chemiluminescence (ECL) detection kit (Amersham, Piscataway, NJ). The western blots presented in Figure 2-14 were prepar ed and analyzed by Mr. N Renganathan in the lab of Dr. John Cr abb of the Cleveland Clinic Foundation. Electroretinography The full-field dark-adapted electroretinogram (E RG) is a record of an electrical response generated by the whole retina to light measured at the cornea. The ERG is characterized by a

PAGE 62

62 negative waveform called the a-wave (reflecting the response of the photoreceptors) followed by a positive waveform called the b-wave (reflectin g the secondary response of the bipolar and Mueller cells) (Figure 2-5). The dark-adaptated ERGs were performed as follows. Animals were dark adapted overnight prior to ERG analysis, and all procedures were performed under dim red light. The mice were anesthetized with a mixtur e of ketamine and xylazine, and eyes were dilated with 1.0% atropine. Gold contact lens electrodes were placed on the eyes with 1% methylcellulose, a reference electrode was placed subcutaneously between the shoulder blades and a ground electrode subcutaneously in a hind leg. The mice were placed on a platform and their heads completely inside a Ganzfeld illu mination dome. Full-field ERGs were obtained in the dark adapted state by flashing increasi ng intensities of light (0.02, 0.18 and 2.68 cd-s/m2) into the eyes of the mice. The electrical responses of the retinas were recorded simultaneously from both eyes using the UTAS-E 2000 Visual Electrod iagnostic System. Intervals between flashes (15 to 60 seconds) were increased with increasing flash intensities . Five recordings were taken and averaged per flash intensity. Light and electron microscopy For light microscopy, at 1, 2, and 4 months pos t treatment groups of 3 mice treated with AAV-Rz432 or AAV-GFP were euthanized. Their ey es were quickly remove d, rinsed briefly in PBS, then processed as described above. The sections were stained with hematoxilin and eosin (Kalamazoo, MI) and their images captured with a video camera mounted on a light microscope. The outer nuclear layer thickness was quantitated using the Zeiss Axiovision 4.4 software. Three measurements were taken at 400 m increments fr om the optic nerve a vertical meridian in both the superior and inferior retina. For electron microscopy, at 4.5 months after treatment with active or inactive AAV-Rz432, 5 mice from each tr eatment group were given an overdose of sodium pentobarbital and then immediately perf used intracardially with freshly made fixative

PAGE 63

63 consisting of 4% paraformaldehyde and 2% glut araldehyde in 0.1M PBS buffer (pH 7.4). The eyes were dissected from the mice and immersed in 4% paraformaldehyde and 2% glutaraldehyde for further fixati on overnight. The cornea, lens, and vitreous were removed. The eyes were postfixed with 1% osmium tetrao xide, 0.1M sodium cacodylate-HCl buffer (pH 7.4) and dehydrated through a series of increasing ethanol concentrat ions leading up to propylene oxide. Eyes were infiltrated using a propyl ene oxide and epoxy resin mixture followed by embedding into epoxy resin and polymerization at 60o C. Sections of 80-100nm thick were cut and examined using an H-7000; Hitach i, transmission electron microscope. Retinal apoptotic cell death TUNEL staining was performed on frozen sectio ns obtained as in the procedures outlined in the light microscopy section. An in situ cell death detection kit (Roche Applied Science, Indianapolis, IN) was used according to the manufact urer’s protocol. Briefly, the retinal sections were air dried for 30 minutes. The slides were rinsed twice for 10 minutes with PBS while shaking and then incubated in permeabilisation solution for 2 minutes on ice. The slides were rinsed twice for 10 minutes with PBS. TUN EL labeling reaction mixture was added to the sections and the slides were covered with a c overslip. The slides were incubated in a humid chamber in the dark at 37C for 1h. The slides were rinsed three times with 1XPBS, air dried and mounted with Vectashield Mounting Medium with DAPI (Vector Labor atories, Burlingame, CA). The sections were visualized and photogr aphed using a Leica TC S SP2 AOBS Spectral Confocal Microscope with Leica Confocal So ftware Version 2.61, Build 1537. To quantitate levels of apoptotic cell death, a kit for an ELI SA based nucleosome release assay (Cell Death Detection Elisa kit; Roche Applied Science, Indianapolis, IN) was us ed as described above. At 6 weeks post injection, mice treated with AAV-Rz432 or AAV-GFP vector were euthanized. The eyes were rinsed in PBS and the neural retina was separated from the eye cup using a dissecting

PAGE 64

64 microscope. The neural retinas were placed in 400uL of lysis buffer provided in the nucleosome release ELISA kit and homogenized. The homogenat es were centrifuged a nd a 1:10 dilution of the supernatant was used in the assay. Autofluorescence analysis At 4 months post injection, 3 AAV-Rz432 treate d or control eyes were examined for autofluorescence in the RPE. Briefly, the eyes were removed from the mice, fixed for 1 hour in 4% paraformaldehyde, and the cornea and lens were then removed. The entire retina was carefully dissected from the posterior RPE/c horoid/sclera eye cup. Ra dial cuts were made from the edge of the eyecup towards the optic nerve head. Flatmounts were mounted in Vectashield mounting medium with DAPI (Vector Laborator ies, Burlingame, CA) and examined for fluorescence using a Leica TCS SP2 AOBS Spectral Confocal Microscope with Leica Confocal Software Version 2.61, Build 1537. A2E and isoA2E levels in the posterior eye cups of 4 AAV-Rz432 trea ted or control eyes were quantitated by high performance liquid ch romatography (HPLC) as described by Zhou et al.323 Briefly, a blade was used to make an inci sion at corneoscleral lim bus (junction of cornea and sclera) and then the corn ea and lens were removed by cu tting circumferentially around the limbus. The posterior eyecups containing the sclera , choroid, RPE, neural retina and vitreous, were solubilized in 0.1% Trit on X-100 and extracted three times with chloroform/methanol (2:1). The extract was dried under argon, redissolved in methanol , and analyzed by reverse-phase HPLC (Waters; 2695 HPLC, Mode l 2996 photodiode array detector) by using a dC18 column (4 x 150 mm) and an acetonitrile and water gradient with 0.1% trif luoroacetic acid (gradient; 90– 100%, 0 min; 100% acetonitrile, 10 min; flow rate, 0.8 ml/min; monitoring at 430 nm). Integrated peak areas were determined by Empower software , and picomolar concentrations were

PAGE 65

65 calculated by using external standards of A2E. Extraction and quantita tion of A2E and isoA2E were performed in the laboratory of Dr. Janet Sparrow at Columbia University by Dr. S. R. Kim. Results Ribozyme Knockdown of MnSOD in RPE-J Cells As a precursor to testing SOD2 Rz432 in mice, its effectiveness was tested in a rat retinal pigment epithelial cell line (R PE-J). A mouse RPE cell line is not currently available commercially. In addition, I was not successful at making primary mouse RPE cells due to other contaminating cell types. Fortu itously, the targeting sequence Rz432 is conserved in rat. RPE-J cells were transfected with plasmids cont aining Rz432 driven by the hybrid CMV enhancerchicken -actin promoter (CBA) and a Cytomegalovi rus promoter (CMV)-GFP marker gene to allow us to monitor cells expressing the Rz432. Cells were also tran sfected with a plasmid containing only CBA-GFP to serve as a control. Transfection effi ciencies of greater than 60% were typically achieved as measured by FACS. Total RNA and protein were harvested from the RPE-J cells at 1, 2, and 4 days following transf ections. Levels of MnSOD mRNA and protein were analyzed by RT-PCR and west ern blotting respectively using -actin as an internal control. Two days post transfection, RPE-J cells treate d with Rz432 showed an approximately 32% (Figure. 2-6) and 60% (Figure. 2-7) reduction of SOD2 mRNA and prot ein levels respectively, compared to control transfected cells. The re turn of SOD2 mRNA and protein towards control levels at 4 days post treatment is likely due to the transient expre ssion of ribozyme following transfection. In addition, cells were split 1: 2 after two days post transfection due to overcrowding. Therefore, by splitting the dishes, cells not expressing Rz 432 may have outgrown those cells expressing the ribozyme.

PAGE 66

66 SOD2-suppression Increases the Levels of Superoxide and Apoptosis in RPE-J Cells The suppression of MnSOD expression is expect ed to cause an increase in levels of superoxide anion. The maxi mum knockdown of MnSOD was ach ieved at two days post treatment of the RPE-J cells wi th Rz432. I therefore selected that time point to observe superoxide anion levels using the dye DHE. RPE-J cells treated with Rz432 showed increased red signal of oxidized DHE generated by increased superoxide anion (Figure. 2-8A). Quantitation of the red fluorescent signal revealed a greater than 33% increase in the levels of reactive oxidants (p<0.03) (Figure. 2-8B) which can induce apoptosis.294 One of the hallmark features of apoptosis is fragmentation of DNA and the release of nucleosomes into the cytoplasm.294,295 To investigate whether apopt osis mediated cell death was occurring after ribozyme treatment, an ELISA based nucleosome release assay was performed. At 2 days after transfection, RP E-J cells treated with Rz432 show ed a modest but significant increase in nucleosome release (Figure 2-9). In vivo Comparison of AAV CBA, MOPS, and RPE65-Rz432 Constructs To determine how to best express the SOD ri bozyme to induce oxidative stress, Rz432 was inserted into rAAV packaging plasmids under th e control of the ubiquito us CBA promoter, the RPE 65 promoter or the mouse opsin promoter (M ops). These constructs were packaged in AAV2 and injected subretinally into the eyes of wild type DBAJ/1 mice. At 1.5 and 5 months post injection the mice were anal yzed by electroretinography. The graph in Figure 2-10 shows the ratio of the b-wave response of ribozyme treat ed eyes to control eyes following flashes of intensity of 0.18 cd-s/m2. The CBA group showed the most reduction in ERG response with an average of 50 % reduction observed in b-wave am plitudes. This loss in response did not vary much between the 1.5 and 5.5 month measuremen ts. Mice injected with the RPE65.8-Rz432 virus did not show a decrease in ERG respons e at the 1.5 month time point but showed a

PAGE 67

67 significant decline of 38% in b-wave amplitude by the 5.5 month measurement. The Mops promoter vector showed a slight decrease in ERG response at 1.5 months, but no further significant decline in response wa s observed at the 5.5 month measur ement. This result suggests that delivery of the ribozyme using the RPE speci fic promoter leads to a progressive loss of visual function. I also looked at the histology of these mice af ter the 5.5 month time point to correlate with the ERG findings. The CBA-Rz432 group showed the most significant changes in histology, with degeneration of the RPE, and loss of photor eceptor cells (Figure 2-11). Degeneration was predominantly limited to the RPE layer in the RPE65-Rz432 group. As observed with the ERG data, no consistent changes were observed in the histology of retina s in the Mops500 group. Because the most significant lo ss of ERG function and histological damage was seen in the CBA-Rz group, this construct was us ed for subsequent experiments. Ribozyme Expression in the Reti na Reduces Levels of MnSOD Since the primary lesion in AMD is thought to reside in the RPE,11 we wanted to express Rz432 in the RPE to determine if we could induc e changes in the retina that resemble AMD. Aurichio and others have shown that rAAV1 pr edominantly transduces the RPE when delivered subretinally.260,263,264 Based on our preliminary experiments with AAV2, we used the potent CBA promoter and packaged our co nstruct in AAV1 capsids to constrain expression primarily to the RPE. The construct also contained a GFP marker gene to visualize areas of the retina transduced by our vector. The AAV1-Rz432-GFP v ector was injected in the subretinal space of adult wild type C57Bl/6 mice. To conf irm expression of Rz432-GFP in the RPE, paraformaldehyde fixed cryostat sections we re analyzed for GFP expression. Rz432-GFP expression was observed predominantly in the RPE layer and scattered expression in the

PAGE 68

68 photoreceptor cells (Figure 2-12). In addition, with a single injec tion we were able to transduce a significant portion of the RPE layer. To determine whether Rz432 could cause knockdown of MnSOD protein in vivo , I performed western immunobloting for MnSOD with total protein from RP E/choroid tissues of AAV-Rz432 and AAV-GFP control eyes. -actin was used as a loading control. At 6 weeks post injection, a greater than 40% re duction of MnSOD protein in Rz 432 treated retinas was observed versus control treated retinas (Figure 2-13). Because AAV1 transduced RPE cells almost exclusively, greater MnSOD knockdown may have b een masked by cells of the choroid that did not express ribozyme and were still expressing MnSOD. SOD2-Suppression Increases Ma rkers of Oxidative Injury Prolonged, increased levels of ROS can overwhe lm the cell’s antioxidant defenses leading to oxidative modification of prot eins, lipids and DNA. Nitrotyros ine, 4-HNE, and CEP are some of the markers that have been used to assess oxidative damage in the retina.283,296,297At 4 months post AAV-Rz432 treatment, we assayed for markers of oxidative stress. Elevated concentrations of superoxide anion in the pres ence of nitric oxide can form peroxynitrite which is able to generate nitrotyrosine resi dues in proteins and lead to their in activation. Levels of nitrotyrosine residues in proteins of Rz432 versus GFP treat ed RPE/choroids were examined by western blotting. We found increased staining for numerous protein bands immunoreactive for nitrotyrosine across a large range of molecula r weights in Rz432 treate d versus GFP control RPE/Choroid (Figure 2-14.A). CE P protein adducts are generate d from the oxidation of the polyunsaturated fatty acid (PUFA) docosahexaen oate (DHA) and are more abundant in the RPE/Bruch’s membrane/ choroid tissue of AMD eyes than in normal eyes.283 Western blotting was also used to assess levels of CEP after Rz432 treatment which showed moderately significant increase of staining for protein ba nds immunoreactive with CEP (Figure 2-14B).

PAGE 69

69 Quantitation of the optical inte nsities of the imm unoreactive bands showed a 2.5 and 2 fold increase in nitrotyrosine and CEP respectively. The aldehyde, 4-HNE, is a specific and stable end product of lipid peroxidation that is gene rated as a consequence of oxidative stress.298 4HNE can readily react with nucleo philic sites of proteins (e.g., hi stidine residues), mainly via a Michael addition.178 Retinal sections from mice treat ed with AAV-Rz432 and AAV-GFP were incubated with an antibody that recognizes cy steine, histidine and lysine-4-HNE Michael adducts. Rz432 treated retinas showed increased staining for 4-HNE reaction products in the RPE and photoreceptor outer/inner segments (Figure 2-14C). Incr eased levels of markers of oxidative damage result from chronic exposure to oxi dants. Therefore, our results indicate that, as a result of ribozymemediated decrease of MnSOD, we were able to establish a chronic environment of oxidative stress in the RPE. Loss of Electrophysiological Responses To assay the effect of Rz432 on the ability of the retinas of mice to respond to light, adult C57BL/6 mice were injected subretinally wi th AAV1 expressing active CBA-Rz 432. Other groups of mice were injected with AAV1 expr essing inactive CBA-Rz432 or CBA-GFP to serve as controls. At 1, 2, 4 and 6 months post inj ection, full-field, scotopic electroretinography were performed to measure the response of Rz432 and G FP treated retinas to different intensities of light stimuli. Figure 2-15 show s the ratio of the a-and b-wave response of Rz432 to GFP control eyes following 0.18 cd-s/m2 intensity flashes of light. A progr essive loss of aand b-response was observed between 1 and 6 months post injecti on. No significant changes were observed in aor b-wave response at the 1 or 2 months post injection time point. However, by 4 months post injection, C57BL/6 Rz432 treated eyes showed significant loss of ERG response, with an average of 33% and 41% decrease in aand bwaves respectively compared to control treated eyes. The a-wave response continued to decl ine from the 4 to 6 month time point, while the b

PAGE 70

70 wave response appeared to plateau. To show th at the effect observed was not specific for C57BL/6 mice and was due to the catalytic activity of Rz432, DB AJ/1 mice were also treated with active or an inactive Rz432. DBAJ/1 mice showed a similar progressive lost of aand bwave ERG amplitudes between 1 and 4 months pos t injection (Figure 2-16). As was observed with the C57BL/6 mice, there was a significant lo ss of aand b-wave response (average of 44% and 35% respectively) by the 4 month post inject ion time point. This result indicates that longterm suppression of MnSOD in the RPE was require d to elicit functional ch anges in the retina. Suppression of MnSOD Leads to Histologi cal Damage of the Outer Retina In addition to functional decay, treated retinas were also examined fo r histological damage at increasing intervals after in jection. By 1 month post injec tion with AAV-Rz432, retinas began to exhibit loss of pigmentation of the RPE, though the neural retina appeared normal at this time. From 2 to 4 months, there were more pronounced changes to the RPE such as vacuole formation and atrophy. By 2 months af ter injection, the ou ter (OS) and inner segments (IS) of photoreceptors were shortened and disorgani zed, and the outer nuclear layer (ONL) was detectably thinner, indicating lo ss of photoreceptor cells (Figure 2-17). The progressive thinning of the ONL in Rz432-treated retinas was quantit ated by measuring the thickness of the ONL at various time points post treatment with Rz432 or GFP control. M easurements were taken at 400 micron increments from the optic nerve to the peripheral retinal on the inferior and superior portions of the retina. By 4 months post tr eatment, there was a 3050% reduction in ONL thickness across retinas treated with Rz432 versus GFP control (Figure 2-18). This reduction was statistically significant (p< 0.05-p<0.01) in both the inferior and superior hemispheres with more pronounced thinning observed in the inferior portion. Dunaief et al. have shown that in huma n AMD, the RPE and photoreceptors die by apoptosis.299 To determine if the progressive thin ning of ONL observed hi stologically was a

PAGE 71

71 result of apoptotic cell death of the phot oreceptors, TUNEL staining was performed on paraformaldehyde fixed retinas from 4 mice at th e 6 weeks post injection time. Retinas treated with Rz 432 showed increased TUNEL positive staini ng specifically in the ONL (Figure 2-19A). A typical section (where the optic nerve is present) from a c ontrol retina has less than one TUNEL positive nucleus, while sections from eyes treated with Rz432 typically exhibits more than 6 positive nuclei. To quantitate the level of apoptosis, an ELISA-b ased nucleosome release assay was used. For this experiment, the anterior chamber, lens and vitreous were removed and only the posterior chamber was used in the anal ysis. A nearly 2-fold increase in nucleosome release in the ribozyme tr eated retinas was observed (p<0.003) (Figure 2-19B). Ultrastructural Analysis of the Outer Retina Ultrastructural analysis of re tinas injected with the active or inactiv e Rz432 was performed after the 4 month time point. Several changes were observed in the RPE of retinas treated with active ribozyme, including deterioration of the ba sal lamina, formation of large vacuoles, and presence of irregular shaped nuc lei (Figure 2-20.). The vacuoles of the RPE were filled with debris (Figure 2-21). The photoreceptor outer an d inner segments were significantly shortened and disorganized (Figure 2-20.). Significant thic kening of Bruch’s membrane was also observed in the inner and outer collagenous zones as well as the middle elastin layer. Some of the eyes showed debris deposition between the plasma and basement membrane as well as in between the basal laminar infoldings of the RPE that re sembled basal laminar deposits observed in AMD eyes 32 (Figure 2-21). Morphometric measurements revealed that Bruch’s membrane was an average of 40% thicker in eyes treated with AAV -Rz432 compared to eyes treated with inactive Rz432 control (Figure 2-22).

PAGE 72

72 Increased Autofluorescent Aggre gates after Rz432 Treatment EM analysis showed debris in vacuoles form ed in the cytoplasm of RPE cells in eyes injected with active Rz432. To determine if the debris contained autofluorescent properties similar to lipofuscin, RPE/choroi d/sclera flatmounts were anal yzed by fluorescence microscopy at 4.5 months post injection. RPE cells of AAVRz432 eyes showed incr eased autofluorescent materials represented by the purple fluorescence in Figure 2-23A. The aggregates varied in sizes with some RPE cells presenting markedly larger granules. A2E and isoA2E, which are the major chromophores that contribute to lipofuscin au tofluorescence, were measured by HPLC to confirm that the fluorescent aggregates in the RPE were lipofuscin-like. Chromatographic tracings of peak areas corres ponding to A2E and isoA2E were elevated in AAV-Rz432 treated eyes. Quantitation of the amount of A2E and isoA 2E content showed a greater than two-fold increase of these lipofuscin chromophores in AAV-Rz432 treated eyes. The average concentration of A2E plus isoA2E was 11.05 pmoles per retina in treated eyes and 5.03 pmole per retina in control eyes. Discussion The aim of this study was to test the hypothesis that cumulative oxidative tissue injury to the RPE could play an important role in AMD deve lopment. Most of the current models used to study RPE oxidative stress use acu te and high dose of either ch emical treatments or light exposure300-302 to induce oxidative stress. In additi on, some studies use RPE cell lines, which may not reflect the behavior of the RPE in vivo . Because AMD is an age-related disease, the changes that occur to the macula in the diseas e that may be mediated by oxidative damage are more likely due to a chronic state of oxidative stress. Therefore, we used the outer retina of wildtype mice as an in vivo model to induce a chronic increase in oxidative stress. In our approach, we selectively blocked the expression of the antioxidant enzyme MnSOD by using a ribozyme.

PAGE 73

73 We selected MnSOD as a target due to its vita l role in the cell’s primary defense against reactive oxygen species, thereby maximizing our chances of inducing oxidative stress-mediated cell dysfunction . In addition, a genetic polymorphism in the SOD2 gene has been associated with wet AMD.102 RPE cells from SOD2 heterozygous mice that have approximately 60% of the level of MnSOD compared to wild-type mice were significantly more susceptible to oxidative stress-mediated apoptotic cell death than wild type RPE cells.303 Although SOD2-/mice die soon after birth, the study conduc ted by Sandbach et al showed significant histopathological changes in the RPE and photoreceptors at even three weeks post birth.292 This indicates that mice deficient in SOD2 display outer re tinal changes in a shorter period of time than other antioxidant enzyme knockouts such as GPX-1 and SOD1 that do not show changes until after 1 year of age.101,304,305 Since, the SOD2-/mice die before reaching full maturity, additional changes to the outer retina may not have had time to develop. There is an ongoing debate concerning the cell layer of the retina in which the primary lesion of AMD lies. The photoreceptors and RPE are both thought to be possible candidates. A preliminary study was performed to determine in which of these two cell types an increase in oxidative stress would have more of an imp act on retinal function. In this study, Rz432 was delivered to the outer retina by using a photoreceptor-specific a nd an RPE-specific promoter, as well as the ubiquitous CBA promoter that e xpresses in both cell types. The Rz432 under the control of the RPE promoter led to signifi cant decay of ERG response by 5.5 months post injection and morphological cha nges in the outer retina of these mice was predominantly observed in the RPE. When the expression of Rz432 was limited to just the photoreceptors, we did not observe a significant lo ss of ERG response or changes in retinal morphology. Treatment with the CBA promoter vector showed the mo st severe loss of ERG response as well as

PAGE 74

74 pathology in the outer retina. From these results it would appear th at oxidative mediated injury of the RPE has a greater impact on th e health of the outer retina than approximately equivilant injury to the photoreceptors. It was a surprise that we di d not observe more significant changes with the photoreceptorspecific promoter since we employed the hi ghly active opsin promoter. In addition, photoreceptors should be very susceptible to oxi dative damage due to their high polyunsaturated fatty acid content. A possible explanation for the greater pa thology observed with the RPE65Rz432 than MOPS500-Rz432 construct may be due to the fact that the photoreceptors far out number the monolayer of RPE ce lls. A single RPE cell is respons ible for the phagocytosis of daily shed outer segment disc from 20 photorecep tor cells. Therefore, loss of a population of RPE cells may more severely impact the function of the outer retina. To date this has not been shown to be the case. Since the constructs did no t contain a marker gene we cannot rule out the possibility of a difference in th e success of the injec tion, although all injections were performed by the same trained injectionist. The expression of Rz432 by the CBA promot er which expresses in both the RPE and photoreceptors led to more significant pathology in the photoreceptor layer than was observed with the RPE65 or photoreceptor specific promoters. One could speculate that the CBA promoter in this particular experiment may ha ve lead to greater expression of Rz432 in the photoreceptor layer than the photor eceptor specific promoter. Similarly, the more severe changes that were observed with the CBA promoter than with the RPE65 promoter may be explained by the CBA being a more potent promoter than RP E65. To date, no direct comparison has been made between the CBA, RPE65 and opsin promoter , either in the RPE or in photoreceptors. Therefore, to circumvent the question of prom oter strength, we decided to package the CBA-

PAGE 75

75 Rz432 construct in AAV serotype 1 which has been shown to predominantly transduce RPE cells when delivered subretinally. Upon treating mice with this Rz432 vector (also expressing a GFP marker gene), we observed similar changes to th e retina that were detected with the CBA-Rz432 construct packaged in AAV serotype 2. The changes induced by the ribozyme delivered by AAV1 were progressive, with pa thology observed in the RPE pr eceding changes observed in the photoreceptors. Therefore, the results we observe from this study are more consistent with the hypothesis that the primary lesion in AMD lies in the RPE.306,307 Our system models oxidative stress in the human retina because we established a chronic elevation of ROS that led to progr essive functional and histological changes to the retina. It was of no surprise that we did not observe any sign ificant changes at one month after injection. AAV1 peak expression occurs 2 weeks after injection.260 In addition , the impact of oxidative stress may be cumulative: Cellular defense m echanisms may become overloaded resulting in histological and functional change s that we observed in the retina at approximately two months post injection. By 4 months post inject the outer retina of mice treated with active AAV-Rz432 showed marked shortening and disorganization of the outer and inner segments of the photoreceptors as well as significant thinning of th e photoreceptor nuclear layer (F igures 2-18 and 2-20). Since, pathological changes to the RPE preceded the above changes to the photoreceptors; it indicates that the photoreceptor cell loss was due to injuries to the RPE. In particular, the disorganization and shortening of the outer segments may be due to phagocytic function of the RPE without elimination of waste to the choriocapilaris as indicated by the accumulation of autoflourescent aggregates in the cytoplasm of RPE cells in AAV-Rz432 treated eyes (Figure 2-23). The significant loss of scotopic ERG function at 4 months in mice injected with AAV-Rz432

PAGE 76

76 (Figures 2-15 and 2-16) is attr ibuted to a significan t loss of rod photoreceptor cells due to the large portion of RPE cells transduced and a ffected by the AAV-Rz432 vect or (Figure 2-12). In AMD, pathology is limited to the macula which makes up a small fraction of the retina and is enriched with cones. Therefore, the full-field scotopic ERG which is a measure of rod response in the entire retina may not s how significant loss of ERG respons e in patients with early AMD. We found a more significant thinning of the infe rior portion of the re tina in mice injected with Rz432 (Figure 2-18). The inferior portion of the retina is exposed to more environmental light than the superior hemisphe re. Therefore, the more severe changes that we observed in the inferior may be due to increas ed susceptibility to photooxidative stress, and light-mediated retinal damage resulting from a lack of MnS OD. Our observations are consistent with the findings of others that light exposure to the re tina may accelerate the progression and severity of age-related macular degeneration and cer tain forms of retinitis pigmentosa.130,308,309 Imamura et al showed that a lack of cytoplasmic SOD in conjunction with increased light exposure caused increased drusen formation in mice.101 In addition, retinitis pigmen tosa patients with the T17M mutation in rhodopsin also show more seve re degeneration of the inferior retina.310 It is unlikely that the hist ological changes that we observed could have been due to mechanical damage done by the injection and not mediated by the ribozyme. We were able to show by both TUNEL and by measuring nucleosome release that loss of cell in the retina was due to apoptotic cell death (Figure 2-19). In a ddition, TUNEL stained reti nal sections of AAVRz432-treated eyes showed cell death was limited to the photoreceptor layer of the retina. Furthermore, AAV-Rz432 treated retinas contai ned a significantly greater number of TUNEL positive cells than AAV-GFP treated control retinas. Injection dama ge is usually indicated by a rapid loss of ERG response due to massi ve cell loss in the injured retina.293 At 1 month post

PAGE 77

77 injection, the first set of ERGs that were measured were c onsidered as baseline; only changes beyond that were considered as true loss of ERG response. In addition, mice found to have a greater than 20% loss of ERG co mpared to untreated eyes are eliminated from the analysis. Our ribozyme mediated deplet ion of MnSOD indicates that the RPE is particularly susceptible to oxidative stress, and increased oxidative burden to the RPE may lead to some of the pathologies observed in dry AMD. In partic ular, we observed atrophy, pigmentary changes and accumulation lipofuscin-like aggregates in the RPE, significant increas e in the thickness of Bruch’s membrane, progressive loss of retinal electrophysiological function, and apoptotic cell death of the photoreceptors. Measurement of th e thickness of the ONL showed varying degree of loss of photoreceptor cells. Sin ce the full field ERG is a measure of the global response of the entire retina to light, a complete loss of ERG response will not o ccur, since we did not transduce the entire retina. In this st udy, we demonstrated that similar patterns of change in the retina could be observed in two different strains of pigmented mice, thus eliminating the idea that the changes we observe may be strain specific. To make a clearer association between AMD pathogenesis and oxidative tissue injury, we want ed to selectively targ et another important protein in the antioxidant defense system of th e retina, which will be the subject of Chapter 3.

PAGE 78

78 Figure 2-1.Secondary structure of hammerhead ri bozyme targeting MnSOD. Illustrated are Rz432 and its mRNA targeting sequence. The cleavage site is shown by the sh ort arrow, and nucleotide position change to produce the inactive by the long arrow .

PAGE 79

79 Table 2.1 DNA oligonucleotides used for cloning mouse SOD2 Rz432. Rz432 Sense 5’AGCTTCAAAACT G ATGAGCGCTTCGGCGCGAAACCCAA 3’ Rz432 Antisense 5’CTAGT TGGGTTTCGCGCCGAAGCGCTCAT C AGTTTTGA 3’

PAGE 80

80 Figure 2-2. Plasmids used to deliver A) SOD2 Rz432-GFP and B) GFP control into RPE-J cells. These constructs were also packaged into AAV1 capsids for in vivo delivery into the subretinal space. TR, inverted terminal repeats; CMV, cytomegalovirus; SD/SA, splice donor/acceptor site; hGFP, humanized green fluorescent protein; AMP-R, ampicillin resistance.

PAGE 81

81 Figure 2-3 The recombinant AAV cassettes us ed to produce A) CBA-Rz432, B) RPE65-Rz432, and C) MOPS500-Rz432 viral vectors. Constr ucts were packaged in AAV serotype 2 capsids. TR, inverted terminal repeats; CMV, cytomegalovirus; SD/SA, splice donor/acceptor site; RPE, retinal pigment epithelium; neoR, neomycin resistance; AMP-R, ampicillin resistance

PAGE 82

82 Table 2-2. DNA oligonucleotides used in RT-PCR reactions for SOD2 and Beta Actin. Primer Sequence Number of cycles SOD2 Sense CGCCTCAGCAATGTTGTGTCGG SOD2 Antisense AGGCGGCAATCTGTAAGCGACC 20 Beta Actin Sense T GAGACCTTCAACACCCCAGCC Beta Actin Antisense TGGCCATCTCCTGCTCGAAGTC 17

PAGE 83

83 Figure 2-4. Subretinal injection. A blunt needle with attached syringe containing AAV vector is inserted through the retina. The AAV vector is delivered into the space between the photoreceptors and RPE, causing a temporary re tinal detachment that resolves itself once the AAV vector spreads along the outer retina. Figure courtesy of Dr. Lynn C. Shaw.

PAGE 84

84 Figure 2-5. Sample waveform from an ERG reco rding. The response is measured in volts on the y-axis and the time elapse since the ini tial flash is on the x-axis. Position of the a and b-waves are also shown.

PAGE 85

85 Figure 2-6 Quantization of MnSOD transcript levels measured in triplicate with reverse transcription PCR. -actin amplified in the same reactions was used as an internal control. PCR products were quantitated by SYBR green staining. A significant decrease in MnSOD transcripts was obs erved by 24hours post treatment with Rz432, (*p<0.05)

PAGE 86

86 Figure 2-7 Representative western blot for MnSOD pr otein levels from Rz432 or GFP treated cells. By day 2 after treatment, RPE-J cells that received Rz432 showed a 60% decrease in MnSOD protein.

PAGE 87

87 Figure 2-8 Dihydroethidium staining for detection of superoxide anion. A) At 2 days post treatment with Rz432 or GFP control, RPEJ cells were incubated with DHE probe. Red fluorescence represents oxidized et hidium bond DNA and green fluorescence indicates cells expressing Rz432-GFP or GFP control plasmid. B). Quantization of red fluorescence determined by spectroflour ometry show significant increase in superoxide levels (p<0.03).

PAGE 88

88 Figure 2-9 Quantification of apoptotic cell death measur ed by an ELISA that detects release of nucleosomes into the cytoplasm. Results ar e expressed as absorb ance at 405nm of the product of the substrate reaction. RPE-J cel ls expressing RZ432 showed a modest increase in apoptotic cell death (p<0.05).

PAGE 89

89 Figure 2-10. B wave scotopic full-field ERGs of DBAJ/1 mice treate d with CBA, RPE65 or MOPS500-Rz vector at 1.5 and 5.5 months pos t injection. The graph shows the ratio of the response of ribozyme treated ey es to control eyes. The CBA-Rz432 group showed the most significant loss of ERG. The RPE 65-Rz group showed progressive loss and no significant changes were seen in ERG function in the Mops 500 group.

PAGE 90

90 Figure 2-11. Retinal morphology of DBAJ/1 at 5.5 months after CBA, RPE65 or MOPS500Rz432 vector injection. CBA-Rz group show ed the most significant changes in histology, with atrophy of the RPE, and loss of photoreceptor cells.

PAGE 91

91 Figure 2-12. Localization of Rz432-GFP expression at 6 weeks post injection. Picture on the left shows an RPE/choroid/sclera flat mount and the picture on the right is a retinal section from an eye treated with AAV Rz 432-GFP. Cells expressing the vector are shown in green. The section is counterstaine d with DAPI to show cell nuclei (blue).

PAGE 92

92 Figure 2-13 Rz432 expression reduces MnSOD protein leve ls in the RPE/Choroid. A) Groups of 6 mice from Rz432 and GFP control treatmen t groups were analyzed by western blot for MnSOD levels at 6 weeks post injecti on. Beta-actin was used as a loading control. Graph shows the ratio of MnSOD to beta actin signal. B) Representative immunoblot of MnSOD protei n from RPE/Choroid of Rz432 and GFP treated eyes. Each sample contains pools of 2 RPE/choroids.

PAGE 93

93 Figure 2-14. Western blots analys is of markers of oxidative da mage. RPE/choroid tissue of Rz432 treated mice show signi ficant increased staining of bands immunoreactive for A) nitrotyrosine and B) CEP, (left pa nels). Optical density measurents of nitrotyrosine and CEP immunoreactive ba nds are shown on right of panels.. Diamond= Rz432 treated, square = control. (p<0.03 for n itrotyrosine and p< 0.045 for CEP). C) Rz432 and GFP treated retinal sections immunostained for 4-HNE. Rz432 treated eyes show increased staining for 4-HNE in RPE and photoreceptor outer and inner segments. Panels 5 and 6 are magnified pictures of panels 1 and 3 respectively. Western blots are courtesy of Dr. John Cr abb of the Cleveland Clinic Foundation.

PAGE 94

94 Figure 2-14. Continued

PAGE 95

95 Figure 2-15 Scotopic full-field ERGs of C57BL/6 mi ce injected with Rz432 or GFP control vector. ERGs were measured at 1, 2, 4 and 6 months post injection. Mice treated with Rz432 show progressive loss of ERG respons e that is significant by 4 months post injection. The graph shows the ratio of th e maximum aand b-wave amplitudes of Rz432 to GFP control treated. *, p<0.05; **, p<0.005. (n=6). Error bars represent standard error of the mean.

PAGE 96

96 Figure 2-16 Scotopic full-field ERGs of DBAJ/1 mi ce injected with active Rz432 or control inactive Rz432. The graph shows the ratio of the maximum aand b-wave amplitudes of active to inactive Rz432c ontrol.Treatment with activ e Rz432 lead to a similar pattern of ERG loss as observed in C57B L/6, (n-5). (* p<0.05; **, p<0.005). Error bars represent standard error of the mean.

PAGE 97

97 Figure 2-17 Light micrographs of retinas of C57BL/ 6 injected with Rz432 or GFP control vector. Retinal sections at 1, 2, and 4 months after Rz432 treatment or 4 months after GFP control are shown. Rz432 treated reti nas show pigmentary changes (arrow heads ) and degeneration of the RPE (arrow s) as well as progressive thinning of the photoreceptor nuclear layer. RPE, retinal pigmented epithelium; OS, photoreceptor outer segments; IS, photoreceptor inner se gments; ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer.

PAGE 98

98 Figure 2-18.Quantization of the th ickness of the outer nuclear laye r. Using the optic nerve head as a landmark, measurements were taken at 400m increments from the optic nerve on both the superior and inferior portions of the retina (n=3 for each time point). Error bars represent standard error of the mean. *=p<0.05-p<0.01.

PAGE 99

99 Figure 2-19. Progressive loss of photoreceptor cells is due to apoptotic cell death. A) TUNEL staining was used to detect apoptosis in th e retina at 6 weeks post Rz432 treatment. Green, Rz432-GFP or GFP only expression; Red, Tunel positive nuclei; Blue, DAPI stained nuclei. B). Quantization of apoptot ic cell death by nucleosome release assay at 6 weeks after injection (Right panel). n=6. * = p<0.003

PAGE 100

100 Figure 2-20. Ultrastructu re changes in the outer retina at 4months after Rz432 treatment. In active Rz432 treated retinas (panels 2 and 4) compared to c ontrol inactive Rz432 injected retinas (panels 1 and 3), the RPE a ppeared diseased with loss of cytolasmic space to vacuoles, as well as massive degene ration of its basal lamina and irregular shaped nuclei. The outer and inner segments of the photoreceptors are shorten and disorganized.

PAGE 101

101 Figure 2-21. Ultrastruc ture changes in Bruch’s membrane. Electron micrographs of Rz432 treated retina showing increased depos its between the plasma and basement membrane of the RPE as well as disorgan ization and increased thickening in the layers of Bruch’s membrane. Scale bar=1m

PAGE 102

102 Figure 2-22. Quantization of the thickening of Bruch’ s membrane. Morphometric measurements were taken on electron micrographs (20,000X ) at 6 locations across each retina and averaged. n=5, p<0.005

PAGE 103

103 Figure 2-23 Accumulation of li pofuscin-like aggregates in RPE. A. Flatmounts of RPE/choroid/sclera from Rz 432 treated or control eyes. Nuclei are stained with DAPI. Purple autoflourescence due to lipofuscin-like aggregates in RPE (Excitation=405, Emission=590-650) B. HPLC analysis of A2E and isoA2E in eye cups of Rz432 treated or control eyes, pr ovided by Dr. Janet Sparrow of COmlumbia University. Control SOD2 Rz432 A B

PAGE 104

104 CHAPTER 3 RIBOZYME-MEDIATED REDUCTION OF GLUTATHIONE PEROXIDASE-1 Introduction The retina/RPE/choroid complex of the eye is at increased risk for oxidative tissue injury due to its environment and high metabolic activ ity. To protect it from ROS generated both endogenously and exogenously, this complex c ontains a host of antioxidant defense mechanisms.284-286,288 Important ROS scavengers that have been localized to the retina/RPE/choroid include the glutathione peroxi dases (GPX), a family of selenium dependent and independent antioxidant enzymes. Humans have at least five di fferent Se-dependent glutathione peroxidases.311 The first to be discovered and major isoform is glutathione peroxidase 1 (GPX-1). GPX-1 is ubiquitously expressed in tissues and can be found in both mitochondria and the cytosol. The enzyme reduces hydrogen peroxide (H2O2) to H2O by oxidizing glutathione as shown in Figure 3-1A. Reduction of th e oxidized/disulfide form of glutathione (GSSG) is then cat alyzed by glutathione reductase through the glutathione cycle (Figure 3-1B). H2O2 is a relatively stable molecule and does not have great oxidative potential. H2O2 is harmful, however, because it can freely cross cell membranes and be converted to the most active of the ROS, the hydroxyl radical through the Fent on or Haber–Weiss reactions.166 Elimination of hydrogen peroxide is therefore critical in protecti ng cells against oxidative stress. To provide further evidence that oxidative dama ge in the RPE plays an important role in AMD pathogenesis, we wanted to reduce the levels of a different antioxidant enzyme than MnSOD. GPX-1 is an attractive target because it is localized to the RPE and outer retina which would indicate that the enzyme is a key com ponent in protecting the retina against oxidants. Since the retina has a high amount of polyunsaturat ed fatty acids, a lack of GPX-1 may increase the retina’s susceptibility to lipid peroxidation. In addition, suppression of GPX-1 would reduce

PAGE 105

105 the retina’s defense against H2O2 generated by the daily phagocyt osis of the photoreceptor outer segments281 and environmental insults such as short wavelength light.312 Stone et al conducted a study in which selenium depletion induced reduction of GPX in rats, which led to reduced retinal function measured by ERG.313 The selenium-deficient rats also showed increased lipid peroxides in the RPE and photoreceptor outer segments. Based on its important role in the enzymatic protection of cells from oxidant s, we hypothesized that a reduc tion of GPX-1 in the RPE may lead to injuries and dysfunction in the outer re tina. In this study, two ribozymes were designed that specifically cleave the GPX-1 transcript. The catalytic activity of the ribozymes was tested in vitro , followed by further testing in tissue culture cells. Finally, we assesse d the ability of the ribozymes to lead to functional a nd histological changes associated with AMD in the outer retina of mice. Materials and Methods Ribozyme Design The first step in designing a ribozyme is to identify potential NUX cleavage sequences within the target mRNA, where N is any nucle otide, U is the base uridine and X is any nucleoside except for guanosine. The GUC triple t is preferred for it has been reported that ribozymes that cleave after this sequence have the highest cat alytic efficiency.314 The two arms of the ribozyme that form helix I and III are desi gned to form Watson-Crick base pairs with the nucleotides surrounding the cleavage site (X) on the target. For highly active ribozymes it has been reported that the flanking ar ms should not exceed 12 nucleotides.315 In the case of the GPX1 ribozymes seen in Figure 3-2, the left arm was six nucleotides and the right arm was five nucleotides with the X remaining unpaired. Th e ribozyme sequence was then entered into a secondary prediction program called MFOLD. Only those ribozymes with secondary structures predicted to have no base pairing in the fl anking arms, which should allow maximum binding

PAGE 106

106 specificity were characterized in vitro. MFOLD was also used to fold 100-200 nucleotides on either side of the NUX cleavage site to dete rmine whether the ribozyme binding location was predicted to be accessible. A BLAS T search was also conducted to ensure the absence of target sites on any other known human or mouse mRNA sequence. We se lected three ribozymes that met the above criteria; Rz172, Rz275, and Rz480. The ribozymes are named according to the nucleotide number of the GPX-1 tran script 5’ to the cleavage site. Radioactive Labeling Of Short RNA Targets The GPX-1 ribozymes and their exact target sequences (Figure 3-2) were purchased as synthetic RNA oligonucleotides from Dharmac on, Inc. (Boulder, CO). The oligonucleotides contain an acid-labile orthoest er protecting group on the 2’-h ydroxyl that must be removed according to Dharmacon’s protocol prior to us e. The targets were 5’-end labeled with [ -32P]ATP (ICN, Irvine,CA) using T4 polynucleotide (Promega, Madison, WI). Labeling reactions were set up as follows: 2 l of the RNA target oligonucleotide (10pmol/ l), 1 l of 10X polynucleotide kinase buffer (P romega, Madison, WI), 1 l RNAsin (Promega, Madison, WI), 1 l 0.1M DTT (Sigma, St. Louis, MO), 3 l water, 1 l [ -32P]-ATP (150ci/l) and 1 l of polynucleotide kinase (5 units). The reacti on was incubated at 37C for 30 minutes. 90 l of water was added to the reaction, wh ich was then extracted with 100 l of phenol/chloroform. The aqueous phase (labeled target) was purified by filtration through a pre-packed G-50 fine spin column (USA Scientific) according to the manufact urer’s protocols. The purified labeled target was stored at -20 C for no more than one week. Time-Course Reaction To assess if the ribozymes were able to clea ve their short 12 nucleotide targets, a time course reaction was used with the following conditions: 13 l of 400mM Tris-HCl, pH 7.4-7.5 was added to 1 l ribozyme (2pmol/ l) and 88 l of water. This mixture was incubated for 2

PAGE 107

107 minutes at 65C followed by incubation for 10 mi nutes at room temperature to allow proper folding of the synthetic ribozyme RNAs. 13 l of a 1:10 ratio of RNas in: 0.1M DTT was added to the reaction mixtur e along with 13 l of 200mM MgCl2 (20mM final). The reaction was incubated at 37 C for 10 minutes. 1 l of the -32P labeled and 1 l of unlabeled target (20pmol total) were premixed and added to the reacti on mixture at 37C. At various time points ranging from one minute to 2 hours, 10 l of the reaction mixture was removed and added to a tube containing 10 l of formamide dye mix (90% formam ide, 50mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol) to stop the reacti on. The samples were then placed on ice. The samples were heat denatured, placed on ice and 6 l of each time point aliquot was loaded onto a 10% polyacrylamide-8M urea gel to separa te the products. The gel was run until the bromophenol blue migrated approximately 2/3 of the gel, and then fixed (10% methanol, 10% acetic). The gels were dried, exposed to a stor age phosphor screen, and analyzed on a Molecular Dynamics Phosphoimager using the ImageQuant pr ogram (GE Healthcare). The percentage of substrate cleaved in each sample was determined from the ratio of radi oactivity in the 5’-end labeled cleavage product (P) to the sum of the radioactivity in the 5’-end labeled cleavage product and the substrate band (S ): % Cleavage = P/P+S. Us ing Excel (Microsoft, Redmond, WA) the percentage of substrate cleaved was then plotted as a function of time. Multiturnover Kinetics Analysis. As in the timecourse reaction, the synthetic RNA oligonucleotides of the ribozymes and their exact target sequences were used. Initial rates were measured when the amount of cleavage was linear with time and before more than 1015% of the substrate has been converted into product. These two parameters were determined from the graph of time versus percent cleaved based on the time-course reaction data.. The ri bozyme (15nM) in 40mM TrisHCl, pH 7.4 was heated for 2 minutes at 65 C and then allowed to cool for 10 minutes at room temperature. A

PAGE 108

108 final concentration of 5mM MgCl2, 4.5mM DTT and 0.5% RNasin were added to the ribozyme, and the mixture was incubated at 37 C for 10 minutes. Increased con centrations of cold target (0-15 M) plus trace amounts of -32P end-labeled target were adde d to the reaction mixture. Each reaction was run in a sepa rate tube and done in duplicate. Figure 3-3 shows a summary of the experimental design for the multiturnover kine tics analysis. The reactions were stopped by adding an equal volume of formamide dye. The sa mples were then placed on ice, and heat denatured prior to being loaded on a 10% polya crylamide-8M urea gel. The gels were then treated as described in the tim ecourse section. To quantify the amount of 5’-end labeled cleavage product, a calibration curve was constructed by preparing solutions containing known amounts of P 5’-end labeled GPX-1 targets (Figure 34), and filtering each ont o a HybondN+ membrane (Amersham Pharmacia Biotech, Piscataway, NJ). The calibration blot was exposed on the same radioanalytic phosphorescent screen as the dried gel and analyzed using a Molecular Dynamics Phosphoimager system and ImageQua nt software (GE Healthcare). The Vmax and Km for the ribozymes were obtained by graphing a Lineweaver-Bur ke plot (the double re ciprocal of velocity versus substrate concentration). The kcat or turnover number was determined by dividing the Vmax by the ribozyme concentrati on used in the reaction. In Vitro Transcription of GPX-1 Full Length mRNA The full length GPX-1 sequence was obtained by RT-PCR using total RNA extracted from mouse NIH 3T3 cells. The primers that were used for RT-PCR of full length GPX-1 are listed in Table 3-1. The GPX-1 PCR product was clone d into the TOPO TA vector following manufacturer’s protocol (Invi trogen, San Diego, CA). The plasmid containing GPX-1 in the forward orientation with respect to the putative bacterial T7 prom oter sequence (Figure 3-5) was linearized with SpeI. Radiolabeled transcripts of full length GPX-1 (801bases) were generated with T7 RNA polymerase and [32 P]-UTP (MP Biochemicals, Ir vine,CA). A typical reaction

PAGE 109

109 was set up as follows: 1 l of linearized GPX-1 plasmid (about 100ng), 5 l 5X phosphate buffer (100mM sodium phosphate, pH 7.7), 5 l 5X magnesium/spermidine buffer(40mM MgCl2 and 16mM spermidine (HCl3)), 2 l 20mM NTP (A,G,T), 1 l 5mM cold UTP, 1 l 1M DTT, 1 l Rnasin, 7 l H2O, 1 l [32 P]-UTP (10 Ci) and 1 l T7 RNA polymerase. The reaction was incubated for 2 hours at 37 C. The resulting GPX-1 transcript was purified as performed for short targets. Ribozyme Cleavage of Full Length GPX-1 mRNA GPX-1 long target cleavage was examined with ribozyme to GPX-1 target ratios of 10:1, 100:1 and 1000:1. Reaction conditions were simila r to short target conditions. The reactions were incubated at 37 C for 2 hours, followed by an addition of equal volume of formamide dye to stop the reaction. Six l of cleavage products were run on a 5%polyacrylamide/ 8M urea gel. The gels were then processed as de scribed in the time-course section. Ribozyme Cloning and Packaging. The GPX-1 ribozymes found to be the most catalytically active in vitro were selected for further testing in tissue culture cells. DNA o ligonucleotides coding for active and inactive versions of Rz172 and 275 (Table 3-2) were ordere d from Invitrogen (Carlsbad, California). The sequences of the inactive ribozymes contain a G to C mutation at a conserved position in the catalytic core that abolishes th at catalytic activity of the riboz yme. Additional sequences were appended to the 5’ and 3’ ends of the ribozyme st rands so that when the strands were annealed they formed the sticky overhangs corresponding to Hi ndIII at the 5’ ends and SpeI at the 3’ ends. Rz172 and Rz275 sequences were ligated into the HindIII and SpeI sites of the p21NHP and UF12 AAV packaging plasmids. The ribozymes were cloned under the cont rol of the ubiquitous chicken beta-actin promoter (CBA) coupled to the cytomegalovirus enhancer. The plasmids are illustrated in Figure 3-6. Large scale preparations of the ribozyme plamids were made using an

PAGE 110

110 alkaline SDS, cesium chloride purification met hod. The packaging of the GPX-1 ribozymes into rAAV was performed by the UF Ophthalmology Packaging Core using the same protocol outlined in Materials and Methods in chapter 2. GPX-1 Ribozyme Delivery to NIH 3T3 Cells Mouse NIH 3T3 cells were grown in Dulbecco ’s modified Eagle’s medium (DMEM; Cell gro) supplemented with 10% newborn calf serum (NCS; ATCC), and penicillin/ streptomycin at 37 C with 5% CO2. Cells were plated on 10cm dishes and transfected with plasmids containing GPX-1 ribozymes according to the manufacture r’s protocol for Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA). Transfection effici ency was determined using FACS based on the fraction of cells expres sing a GFP marker gene. Assessment of GPX-1 mRNA and Protein in NIH3T3 Cells. GPX-1 mRNA and protein levels after GPX-1 ribozyme treatment of NIH 3T3 cells were analyzed by RT-PCR and western bl otting respectively. Analysis was performed as described in Materials and Methods for Chapter 2. The primer s used for RT-PCR reactions are listed in Table 3-3. G418 Selection NIH3T3 cells were transfected with Rz172, Rz275 or p21NHP control plasmid containing the neomycin resistance gene. At two days pos t transfection, the cells were treated with G418 (Sigma, St. Louis , MO) to obtain a uniform popul ation of cells that were expressing the GPX-1 ribozyme or control plasmid. Viability of NIH 3T3 Cells in H2O2 after Treatment with GPX-1 Ribozymes NIH 3T3 cells transfected and selected fo r expression of GPX-1 Rz172, Rz275 or empty plasmid, were seeded on 12 well plates at 40% confluency. At 12 hours after seeding, increasing concentrations of H2O2 (0-750M) were added to the cells in triplicate. 12 hours after addition of

PAGE 111

111 H2O2, the cells were counted by trypan blue (0.4 %) exclusion assay. Briefly, the cells were trypsinized and resuspended in 500 l of plating medium. 40l of trypan blue was added to an equal volume of cells. 10l of th e cell/trypan blue mixture was counted using a hemocytometer. The cells from each well were counted three times . The cells retaining the blue dye were not counted. The results were graphed as a percentage of the cells at 0M that were viable at each H2O2 concentration. Experimental Animals and Injection of AAV Vector 4 week old wild type C57BL/6 mice we re injected subretinally with 1 l of 2.5x1012 particles per ml of active GPX-1 Rz172. A separa te cohort of mice was injected with a GFP only control vector. The injections were performe d as in Materials and Methods of Chapter 2. GFP Immunostaining Mice treated with AAV-Rz172 were euthanized at 4 weeks. Their eyes were processed for frozen sectioning as described in Ma terials and Methods of Chapter2. For in situ detection of GPX-1 Rz-GFP, frozen retinal sections from injected eyes were first blocked and permeabilized with 5% BSA/0.05% TritonX-100. Sections were then treated overnight at 4 o C with a 1:500 dilution of anti-GFP polyclonal antibody raised in rabbit (a gi ft of Dr. Paul Hargrave.). Following incubation, the sections were washed and incubated with a fl uorescein labeled goat anti-rabbit secondary an tibody to localize primary antibody bound GFP. Dark -adaptated ERG Analysis Dark adaptated electroretinogr aphy was performed at 3, 6 and 18 weeks post injection. ERG analyses were performed as describe d in Materials and Methods of Chapter 2. Histology After the 18 weeks (4 months) post injection time point, th e mice were euthanized and their eyes processed for light microscopy as de scribed in Materials and Methods of Chapter 2.

PAGE 112

112 Results Multiple -turnover Kinetic Analysis of GPX-1 Ribozy mes with Short Targets Two hammerhead ribozymes that cleave the mouse GPX-1 mRNA following nucleotides 172 and 275 were selected for in vitro characterization because their predicted secondary structures contained no internal base pairing in the flanking ar ms (Figure3-2). Also, a BLAST search indicated that these tw o ribozymes should not target any other genes in the mouse genome. A time -course reaction was performed with the two ribozymes to determine their ability to cleave their respective 12 nucleotide targets in 5mM MgCl2. Autoradiograms of time course assays for Rz172 and 275 demonstrated that both ribozymes were very active in vitro as seen in Figure 3-7A. Figure 3-7B shows a plot of the fraction of 12nt target cleaved over time. Based on this graph, it was determined that Rz172 achieved 15% cleavage of the target in the reaction at 25 seconds, and Rz275 reached this same point at 1.5 minutes. Multitple urnover kinetic analysis of Rz172 and 275 performed at the 15% cleavage times, yield a kcat of 6.3 min-1 and a of Km 0.566uM for Rz172, and a kcat of 4 min-1 and Km of 3.22uM for Rz275. Rz172 and 275 are considered very efficient, since naturally occurring ribozymes have a kcat of approximately 1 min-1 in 10mM Mg2+ reactions.316 These GPX-1 ribozymes also have better kinetic parameters than others that have been shown to function well in vivo. 233,243,317 In Vitro Analysis of GPX-1 Ribozyme Cleavage of Full Length Target While the timecourse analysis of ribozymes in cubated with their targeting sequences tells whether a ribozyme is catalytically active, it does not reveal whether the cleavage site of the ribozyme is masked by the intrinsic secondary structure of the target mRNA. To determine the accessibility of the target sites for Rz172 and 275, an 800 bp fragment of the full length GPX-1 coding sequence was cloned into the TOPO TA v ector (Invitrogen, Carslba d, CA). I generated in vitro transcripts of GPX-1 and performed cleavag e reactions at different molar amounts of

PAGE 113

113 ribozyme while maintaining a fixed molar amount of target. Figure 3-8 shows autoradiographs of the cleavage products generated by Rz172 and 275 after 2 hours of incubation with GPX-1 transcript. The accumulation of products was obser ved at a 10:1 molar ratio of ribozyme to GPX1 target, and the amount of product formed incr eased proportionally to the molar amount of ribozyme used in the reaction. The accumulation of products of the expected sizes suggested that the target site of Rz172 and 275 are available for binding and cleavage. GPX-1 mRNA and Protein Knockdown in NIH 3T3 Cells I next examined the activity of Rz172 a nd 275 against GPX-1 mRNA and protein in cultured NIH 3T3 cells. Rz172 and 275 were cloned into rAAV vectors under the control of the potent ubiquitous CBA promoter coupled to the CMV enhancer. These plasmids also contain an IRES-GFP marker to help determine transfection efficiencies. NIH 3T3 cells transfected with Rz172 Rz275, or p21NHP control plasmids showed only a 20% transfection efficiency. Because such a small proportion of the cells were expres sing the ribozymes, it might have been difficult to observe a significant change in GPX-1 mRNA and protein leve ls in the total cell population. To obtain a population of NIH 3T3 cells that are all expressing the ribozymes, the cells were sorted by FACS based on cells expressing the GFP marker. Total RNA and protein were extracted from this cell population, and RT-P CR and western blotting were performed to examine GPX-1 levels. Beta-actin was used as an internal control in the assays. Rz172 and Rz275 treated cells showed a sign ificant decrease (>40% of cont rol) of GPX-1 mRNA levels versus control plasmid treated cells (Figure 3-9). Although a significan t decrease of GPX-1 mRNA was observed, we were not able to dete ct a significant knockdow n of GPX-1 protein by two days post treatment (Figure 3-10).

PAGE 114

114 Viability of NIH 3T3 Cells in H2O2 after Treatment with Rz172 and 275 To determine if the knockdown of the GPX-1 levels that was observed could lead to increased sensitivity to H2O2, I incubated NIH3T3 cells treated and selected for expression of Rz172 and 275 with increasing concentrations of H2O2. Compared to cells treated with p21NHP control plasmid, Rz275 treated cells showed a trend towards increased sensitivity to H2O2 (Figure 3-11). Rz172 did not cau se a significant increase in H2O2 sensitivity in treated NIH 3T3 cells. NIH 3T3 cells did not transfect or infect readily (see above). Therefore, the lack of a significant phenotype in the NIH 3T3 cells may be due, in part, to the large fraction of cells not expressing ribozyme. Based on the observation th at AAV vectors can readily transduce the cells of the retina, we decided to proceed with in vivo experiments with GPX-1 Rz172. In situ Detection of GPX-1 Ribozymes For in vivo experiments, 4 week old C57BL/6 mi ce were injected subretinally in the right eye with GPX-1 Rz172 packaged in AAV1 capsids . The left eyes were not treated. As an additional control, we injected a separate cohort of mice with a GFP control vector. At four weeks following injections, a few of the eyes treated with AAV were processed and cryosectioned to determine if AAV Rz172 efficiently transduced the RPE. Figure 3-12 shows a section from a retina that wa s treated with active Rz172 immunos tained for GFP. Based on the GFP staining, the ribozyme appeared to expres s in the RPE. The expression of the vector, however, was scattered and covered less th an 50% of the length of the RPE. ERG Analysis At 3, 9, and 18 weeks post injection, dark-ada pted electroretinography was performed to determine if Rz172 could lead to pathological ch anges that would result in diminished light response. Since peak expression of rAAV1 does not take place until approximately 2 weeks after infection of the retina, we eliminated any mi ce that had reduction of ERGs at 3 weeks post

PAGE 115

115 injection that was greater than 20% of the uni njected eye. A rapid loss in ERG response is usually an indicator of damage that occurred duri ng injection. The response of the retinas of the mice to light intensities of 0.02, 0.18, and 2.68 cd-s/m2 were measured. However, in Figure 3-13 only the response to the 0.18 cd-s/m2 intensity is graphed, because the least variability in measurements at this intensity was detected. Th e graph in Figure 3-13 shows the ratio of the response of eyes treated with active Rz172 to eyes treated with GFP control vector. No significant loss of ERG response in either the a or b-wave response was observed by the 18 weeks (4 months) post injection. Histology The ERG is a global response of the retina to light. Therefore, a significant portion of the retina needs to be affected in order to see a reduction in ERG amplitudes. Since the AAV-Rz172 vector did not appear to transduce the entire re tina, I decided to look at the retinal histology of the mice after the 4 months injection time point to determine if there were any focal changes. The RPE of AAV-Rz172 treated retinas appeared hypopigmented compared to those treated with AAV-GFP vector. At this time poi nt, however, no apparent atrophy of the RPE was observed, and the photoreceptors appeared normal (Figure 3-14). Conclusions The purpose of this study was to help suppor t the findings of Chapter 2 that increased oxidative stress in the RPE leads to decreased function and morphological changes in the outer retina. I employed the same AAV-ribozyme appro ach to selectively reduce the expression levels of the protective antioxidant enzyme GPX-1. Catalase and GPX-1 both serve the purpose of eliminating H2O2. GPX-1 is present in the cytosol and mitochondria, while catalase is localized mainly in peroxisomes. Its more ubiquitous presence indicates GPX-1 may be the more

PAGE 116

116 important enzyme in responding to increased H2O2 In addition, GPX-1 is able to metabolize both H2O2 and lipid peroxides, unlike catalase.318 Two ribozymes that target GPX-1 were designed and tested in vitro . Cleavage analysis of the ribozyme with a full length transcript target showed that the cleavage sites of the ribozymes were not embedded into the secondary structure of the GPX-1 transcript. I was not able to detect a significant decrease in GPX-1 protein or a phenotype in the NIH3T3 cells associated with GPX-1 ribozyme treatment. However, I did observe significant loss of GP X-1 mRNA, indicating that the ribozymes could be active in an environment which closely resembles an in vivo scenario. I decided to test GPX-1 Rz172 in the mouse outer retina based on the observation that AAV vectors are better able to transduce murine cells in vivo than in tissue culture. In addition, a greater number of copies of th e ribozyme may be delivered us ing AAV than via the transfection procedure that we used for the cultured murine cells. GPX-1 Rz172 under the control of the CBA promoter was packaged in AAV serotype 1 and de livered into the subretinal space of wild-type mice. Although I obtained expression of the AAVRz172 vector as visualized by GFP staining, I was not able to detect signif icant loss of ERG response in th ese mice even by 4 months post injection. At this stage, it was my hypothesi s that the fraction of the RPE affected by the ribozyme may not have been enough to produce a significant change in ERG light response. Upon examination of the morphology of treated retinas I did not obser ve any significant pathology at even focal areas that would have pe rhaps corresponded to areas of Rz expression. The pigmentary changes however may be an ear ly indicator of dysfunction in the RPE. The examination of the outer retina at later time points will n eed to be done in order to determine if the former hypothesis was correct.

PAGE 117

117 There is currently a GPX-1 knockout mous e. These mice show no pathology unless challenged by oxidative stress.319 Gosbell et al conducted a recen t study in which the retinas of mice depleted of GPX-1 were subjected to toxic levels of light. The GPX-1 deficient mice used in this study were between of 8 to 14 weeks of ag e. At baseline (before light injury) the retinas showed a small but significan t reduction in a-wave ERG re sponse. Although the retinal morphology of these mice appeared normal, the photoreceptor outer segments were shorter compared to wild type mice. Since no dramatic ch anges were seen at even 3 months of age in the retinas of these mice that are completely defici ent in GPX-1, one could speculate that reducing GPX-1 levels in just the RPE w ould also not have led to signif icant effects at 4 months post treatment. There are no current reports on the electrophys iology and histologica l findings in the retinas of aged GPX-1 deficient mice, but it will be interesting to see if they display similar retinal dysfunction as observed in aged SOD1 deficient mice. GPX-1 is not alone in the cell as a defender against H2O2. For example, catalase, another antioxidant enzyme, functions in the same capac ity, although in a different compartment of the cell. In addition, cells contain an other ubiquitously expressed isof orm of glutathione peroxidase, GPX-4(PHGPX), that functions in the removal of lipid hydroperoxides in the nucleus, cytosol and the mitochondria.320 Unlike GPX-1 deficient mice, GPX-4 knockouts are embryonic lethal.321 The disposal of hydrogen peroxide is also closely associated with other proteins such as the thioredoxins, thiored oxin reductases , peroxire doxins and glutaredoxins.318 Since mice lacking GPX1 do not display any obvious increa se of basal levels of oxidative damage, it indicates that there may be redundancy with the above peroxidases for at least some of its biochemical function in vivo.

PAGE 118

118 Figure 3-1 Chemical reaction cataly zed by Glutathione Peroxidase 1

PAGE 119

119 Figure 3-2. Secondary structure of hammerhead ribozymes targeti ng GPX-1. Illustrated are Rzs 172, 275 and their mRNA targeting sequence. The cleavage site is shown by the sh ort arrow, and nucleotide position change to produce the inactive by the long arrow .

PAGE 120

120 Figure 3-3. Summary of the experimental design for multiple-turnover kinetics analysis.

PAGE 121

121 Figure 3-4. Summary of experime ntal design used to prepare the calibration curve for multipleturnover kinetics analysis.

PAGE 122

122 Table 3-1. DNA oligonucleotides used in RT-PCR of full length GPX-1. Primer Sequence Number of cycles GPX-1 Sense TACGGATTCCACGTTTGAGTCCC GPX-1 Antisense AGGTGGAAAGGCATCGGGAATGG 30

PAGE 123

123 Figure 3-5 Plasmid used to in vitro transcribe full length murine GPX-1. An 800 bp fragment of GPX-1 cDNA was inserted into the pCR II-Topo cloning vector downstream of the T7 promoter.

PAGE 124

124 Table 3-2. DNA oligonucleotides used for cloning mouse GPX-1 ribozymes. Rz172 Sense 5’AGCTTAGAGACT G ATGAGCGCTTCGGCGCGAAACGCGAA 3’ Rz172 Antisense 5’CTAGTTCGC GTTTCGCGCCGAAGCGCTCAT C AGTCTCTA 3’ Rz275 Sense 5’AGCTTTGTCCCT G ATGAGCGCTTCGGCGCGAAAACTGAA 3’ Rz275 Antisense 5’CTAGTTC AGTTTTCGCGCCG AAGCGCTCAT C AGGGACAA 3’

PAGE 125

125 Figure 3-6. Plasmids used to deliver GPX-1 Rz172 and 275 into NIH 3T3 cells and to package ribozymes into AAV. A) Plasmids containing IRES-GFP were used for cell sorting and packaging into AAV1 vectors. B) Plas mids containing the neomycin resistance gene were used to select for expression of GPX-1 ribozymes. TR, inverted terminal repeats; CMV, cytomegalovirus; SD/S A, splice donor/acceptor site; hGFP, humanized green fluorescent protein; AMP-R, ampicillin resistance.

PAGE 126

126 Table 3-3. DNA oligonucleotides used for RT-PCR analysis of GPX-1 mRNA. Primer Sequence Number of cycles Gpx-1 Sense CA CAGTCCACCGTGTATGCCTTCT Gpx-1 Antisense ACTGGGTGTTGGCAAGGCATTC 22 Beta Actin Sense T GAGACCTTCAACACCCCAGCC Beta Actin Antisense TGGCCATCTCCTGCTCGAAGTC 17

PAGE 127

127 Figure 3-7. Kinetic analysis of GPX-1 Rz 172 and 275. A) Autoradiographs of time course cleavage of RNA targets by Rz172 and 275 at 5mM MgCl2. B) Graphical representation of the reactions above showing the fraction of target cleaved over time.

PAGE 128

128 Figure 3-8. Rz172 and 275 cleavage of full lengt h GPX-1 target. Autoradiograph of cleavage products at increasing molar ratios of ribozyme to target. Lane 1, uncut GPX-1 transcript; Lane 2,3 and 4, 10:1, 100:1, and 1000:1 ratio of Rz172 to GPX1 respectively; Lanes 5, 6, and 7, 10: 1, 1000:1 and 100:1 of Rz275 to GPX-1 respectively.

PAGE 129

129 Figure 3-9. Quantitation of GPX-1 transcript leve ls in NIH 3T3 cells after ribozyme treatment. mRNA levels were measured in triplicate with RT-PCR using -actin amplified in the same reaction as an internal control. PCR products were quantitated by SYBR green staining.

PAGE 130

130 Figure 3-10. Representative west ern blot for GPX-1 protein at 2 days after treatment of NIH 3T3 with Rz172, Rz275 or empty control plasmid.

PAGE 131

131 Figure 3-11. Viability of NIH 3T3 cells in H2O2 following GPX-1 ribozyme treatment. The graph shows the percent of cells at 0M vi able at increasing c oncentrations of H2O2

PAGE 132

132 Figure 3-12. Localization of Rz 172-GFP expression in the retina at 4 weeks post injection. Cells expressing the ribozyme are shown in gree n. The sections are counterstained with DAPI to show cell nuclei (blue).

PAGE 133

133 Figure 313. Scotopic full-field ERGs of C5 7BL/6 mice injected with Rz172 or GFP control vector. ERGs were measured at 3, 9,a nd 18 weeks post injection. The graph shows the ratio of the a and b-wave response of Rz172 treated eyes to GFP control vector treated.

PAGE 134

134 Figure 3-14. Light micrograph of retinas at 4 months post treatme nt with GFP control or GPX-1 Rz172. The RPE of ribozyme treated reti nas appear hypopigmented compared to control retinas. The photoreceptor layer appear s normal. Original micrographs at 10X magnification

PAGE 135

135 CHAPTER 4 CONCLUSIONS Summary Modern medicine is enabling us to live l onger, therefore the numb er of new AMD cases will continue to rise. AMD is a complex disease, with both modifiable and nonmodifiable factors contributing to its development. Understanding AM D is further complicated by its slow rate of progression and other confounding health issues that also present them selves in the later years of life. By understanding the molecular pathways that lead to AMD development, we can begin to develop new therapies to effec tively halt the progressi on of the disease towards its end stages that cause blindness. In this study, I showed in mice that excessive oxidative burden on the RPE may contribute to the development of AMD. Specifically, I used an AAV-ribozyme–mediated approach to knockdown the mRNA of the protecti ve antioxidant enzymes MnSOD and GPX-1 in the RPE of wild-type mice. I demonstrated th at suppression of MnSOD led to significant increase of markers in the RPE that are indi cators of oxidative dama ge. As a result of the oxidative injuries to the RPE, I was able to observe some features associated with early AMD. In particular, there was a progressive loss of light response (Figures 2-15 and 2-16), and histological changes (Figures 2-17 and 2-20) including vacuo lization and atrophy of the RPE layer that preceded apoptotic cell death of th e photoreceptors (Figure 2-19), accumulation of lipofuscin-like aggregates in the RPE (Figure 2-23) significant thickeni ng of Bruch’s membrane and debris deposition between the plasma and ba sement membrane as well as in between the basal laminar infoldings of the RPE (Figure 2-21). General Discussion While mice have no macula, we reasoned that manipulation of their oxidative defense mechanisms might reveal damage to Bruch’s memb rane and to the RPE that may contribute to

PAGE 136

136 the accumulation of later manifestations of AMD, such as drusen, geographic atrophy and choroidal neovascularization. Sp ecifically, reactive oxygen speci es-mediated damage of the protein, lipids and DNA of the RPE may impair its phagocytic and transp ort functions. Without proper support from the RPE, the photorecepto rs may starve and accumulate waste products, leading to their apoptotic death. Similarly, th e damaged RPE may send stress signals to the choroidal layer that lead to gr owth of new blood vessels from the choroid into the sub-RPE and sub-retinal spaces. Although our approach invol ved the targeted reduction of antioxidant enzymes in the RPE, I am not suggesting that sp ecific reduction in the activity of these enzymes leads to AMD development, rather their absence leads to increased oxidati ve stress which I used to promote oxidative damage. Homozygous knockout mice for GP X-1 and SOD2 have been created and their retinas have been examined for consequences associat ed with the depletion of these antioxidant enzymes. While retinas of SOD2 depleted mice show significant changes by the time of their death at approximately 3 weeks of age, GPX-1 defi cient mice, at least by 3 months of age, do not display dramatic pathology in the retina. R ecently, a group from Tokyo examined age-related changes in the retinas of SOD1 knockout mi ce and found pathological features resembling AMD. At one year of age these mice demonstrat e thickening of Bruch’s membrane, drusen-like deposits and choroidal neovascul arization. Their findings help support our hypothesis of an important role for oxidative inju ry in AMD pathogenesis. Unlike SOD2, to date SOD1 has not been linked to AMD development, making SOD2 a more attractive target to examine the consequences of its absence. In these knockout s, SOD2, GPX-1, and SOD1 enzyme activity is ubiquitously depleted in all cell types of the reti na, therefore I could not use these mice to study how the outer retina is affected by oxidative tissue inju ry to specifically the RPE.

PAGE 137

137 Ribozyme mediated reduction of GPX-1 in the RPE did not cause significant pathology in the outer retina that resembled AMD by the 4 month post injection time point. My observations, however, do not necessarily refute my hypothesis that oxidative injury plays a role in AMD development. GPX-1 knockout mice, though deficient of GPX-1 activity in al l cell layers of the retina, also do not display severe changes in the retina by 3 months of age. Other members of the GPX enzymes are also expressed in the outer retina, including GP X-4, which is important for its protective role against peroxida tion of lipid components of membranes. The outer segments of the photoreceptors contain an abundant amount of polyunsaturated fatty ac id. Therefore, it is reasonable to hypothesize that GPX-4 may play a more important role in protecting the outer retina from peroxides than GP X-1, and GPX-4 may have been able to compensate for the ribozyme-mediated knockdown of GPX-1. While all people are subjected to macular oxid ative stress, those at genetic risk because they carry the 402H variant of CFH, for example, may ha ve a greater chance of AMD development and progression. Johnson et al showed at risk homoz ygotes for CFH 402H have increased deposition of C-reactive protein (a serum biomarker for chronic inflammation) in the choroid.322 Therefore individuals with the CFH 402H polymorphism may be less able to regulate the complement pathway and over time develop a chronic state of inflammation that over time leads to drusen formation, cell loss in the outer retina, and CNV. Findings from Zhou et al suggest that products resulting from the photooxidation of lipofuscin pigments in the RPE could serve as a factor that triggers th e activation of the complement system323. Their findings offer some explanation of the role environmental fact ors may be playing in conjunction with genetic factors to lead to AMD development. Furthermor e, this evidence demonstrates how an initial

PAGE 138

138 insult on the RPE that is mediated by oxidati ve damage may lead to further events (inflammation) which has been shown to be di rectly associated with AMD development. There have been concerns with off-targeting e ffects associated with antisense technologies. Our results do not indicate that our observations were due to non-specific cleavage since we were able to show an increase in markers of oxidative damage as a consequence of expressing Rz432 that targets SOD2. Nonetheless, the best wa y to address this issue is to deliver a second ribozyme targeting a different section of SOD2 to the outer retina of mice. Qi et al who previously showed that Rz432 was functional in vivo used a second ribozyme in their study that led to similar phenotypes observed with Rz432.243 We have designed another ribozyme (Rz309) that is catalytically active in vitro , but this ribozyme needs to be tested in the RPE culture cells before it can be used in vivo. Heterozygous SOD2 knockout mice do not e xhibit any severe phenotypes as a result of having a 50% reduction in MnSOD activity. To da te, no one has examined the function and the histology of the outer retina of these mice. Because complete loss of MnSOD activity significantly reduces cell survival and leads to neonatal lethality in mice, we decided to conduct the MnSOD knockdown experiments using wild type mice. Suppressi ng the synthesis of MnSOD too much may lead to acute cell loss rather than a chronic state of oxidative injury that would over time overwhelm the antioxidant sy stems of the RPE. To bypass the problem of excessive knockdown of MnSOD, one could do a dose response experiment with Rz432 using mice heterozygous for SOD2 disruption. Perhap s a further knockdown of SOD2 expression might lessen the time in which changes to the reti na are seen, as well as increase the severity of changes.

PAGE 139

139 Future Studies Undoubtedly, one of the biggest challenges in this dissertation pr oject was to obtain successful injections in which la rge portion of the reti na was transduced with minimal injection damage. To circumvent the variability in in jections, one could employ the powerful Cre/lox system. Using this system, an RPE specific knoc kout of the SOD2 gene could be made to examine the consequences of the lost of this key enzyme in this specific layer of the retina. In this approach, a mouse containing the Cre recombin ase gene driven by an RPE specific promoter such as RPE 65 or VMD2 would be crossed to a mouse containing a floxed SOD2 gene. In the offspring of this mating the Cre would lead to recombination between the loxp sites surrounding the SOD2 gene sequences, thereby inhibiting the expression of SOD2 in only the RPE. The Cre recombinase gene may also be delivered by AAV into the subretin al space, thereby circumventing the need for a mouse that expres ses Cre specifically in the RPE. Using the AAV approach, however, we would also run into the problem of variability in the injections. A GFP marker gene may be inserted in to the same construct of the AAV-Cre to determine the area of cells expressing the Cre and if that particular area develops histological abnormalities resembling AMD. Another key aspect to consider is the amount of time it may take to see changes in the retinas of a particular mouse being used as a model of AMD and the age of the mouse at which these changes present themselves. The Ccr2/C cl2 and SOD1 knockouts that exhibit a large a number of the features of AMD require more th an a year before they begin to develop these characteristics.101, 193 In these models, the extremely slow progression of the development of lesions that resemble AMD is on the same time s cale as humans. This produces the challenge of having to wait for long periods of time before one can determine if a particular therapy is working. In this dissertation, the longest time po int following treatment w ith the ribozymes that

PAGE 140

140 was analyzed was 6 months. Thus, it may not be surprising that we did not observe some of the features such as CNV that occur in the late st ages of AMD. A recommendation for future studies is to continue to monitor the mice for longer time points after treatment. The RPE layer of the retina doe s not regenerate, and it accumula tes debris in the form of lipofuscin which in older age can take up as mu ch as 19% of cytoplasmic space in the RPE. 324It is appropriate to assume that this accumulati on would make the RPE less efficient in performing its functions. Therefore, the RPE in an aged pe rson may be less efficient at dealing with oxidative stress. An alternative to treating young adult mice is to treat aged mice with AAVRz432 or other agents to promote oxidative stress. In this way the time lag between treatment and effect would be reduced. As mentioned above, AMD is a multifactorial disease. We did not observe thick drusen and choroidal neovascularization, in dicating that additional factors, in conjunction with increased oxidative burden, may be needed for progression of the disease. A possible future experiment is to combine treatment of SOD2 ribozymes with over-expression of VEGF, which has been shown to induce choroidal neovas cularization. An alternative to treating wild-type mice is to treat the outer retinas of Ccr2/Ccl2 deficient mice with the SOD2 specific ribozymes. Ccr2/Ccl2 mice which show deficiencies in controlling th e complement cascade that lead to chronic inflammation seem to predispose these mice to developing AMD like features. Perhaps loss of key antioxidants in these mice may increase the rate at which we observe changes in the retina related to AMD. Ribozyme-mediated depletion of some of the components of the antioxidant defense system in the RPE may cause the reti nas of mice to become more susceptible to environmental stress such as blue light which has been shown to induce the production of ROS generated by the electron transport chain325 and cigarette smoke which contains ROS326. An

PAGE 141

141 interesting experiment to perf orm may involve exposing ribozy me treated mice to increased amounts of light or cigarette smoke to determine if exogenous factors coul d further aggravate the changes induced by the ribozyme. The next logical step in testing our theory th at oxidative injury to th e RPE is important in the initiation of AMD development is to revers e the phenotype that I ha ve created. Mice treated with ribozyme may be given compounds that prot ect against oxidants. The diet of mice treated with MnSOD ribozymes may easily be supplemente d with antioxidants that are found in wildtype mice, such as zinc, vitamin C, beta-caroten e and vitamin E which have all been found to be able to protect the retina against oxidative injur y. Iron can mediate the pro duction of oxidants to lead to oxidative damage and is thought to be a key player in oxi dative injury of the retina. The levels of iron increase with age and is also thought to play an important role in AMD.327 Another treatment option may be to give mice treated w ith the MnSOD ribozymes, compounds that act as iron-chelating agents. Closing Remarks Most of the current treatments for AMD focus on the end stage wet form. Two of the treatment options are photocoagulation and photodynamic therapy. The former uses focused laser light to locally ablate new choroidal bl ood vessels and the latter uses photosensitizing agents such as verteporfin, which ,when activat ed by exposure to certain wavelengths of light results in the production of reactive oxygen species that cause selective closure of the abnormal blood vessels. Photocoagulation and photodynamic therapy, however, do not alter the underlying progression of AMD. A new altern ative approach to treatment of wet AMD is the use of antivascular endothelial growth factor (VEGF) dir ected therapies such as an anti-VEGF aptamer (Macugen), a humanized anti-VEGF monoclonal antibody (Avastin) and a high-affinity antiVEGF Fab (Lucentis). Although Lucentis and Avastin appear to effective at blocking choroidal

PAGE 142

142 neovascularization, they also target the end stage of the disease. Th ere is still a ne ed for therapies for the end stage of dry AMD (ge ographic atrophy) which also lead s to loss of vision. Therefore, more research is needed to understand the initial biochemical events that lead to AMD development, and these advances will set the stage for the development of more effective mechanism-based therapies. For these purposes, anim al models will continue to be a key in the study of previously unknown pathophysiologica l mechanisms associated with AMD. In closing, we have created an in vivo model of chronic oxidative stress in the RPE layer of the retina. The oxidative injury mediated chan ges in the retinas of these mice resembling AMD lesions occurred at a more rapid rate than other models in whic h these changes ar e observed after a year. Our approach may be used as a model to test the efficacy of an tioxidant drugs for AMD.

PAGE 143

143 LIST OF REFERENCES 1 Klein, R., Klein, B. E., Jensen, S. C., and Meuer, S. M. The five-year incidence and progression of age-related maculopathy: the Beaver Dam Eye Study Ophthalmology. 1997; 104: 7-21. 2 Krumpaszky, H. G., Ludtke, R., Mickler, A ., Klauss, V., and Selbmann, H. K. Blindness incidence in Germany. A population-based study from Wurttemberg-Hohenzollern Ophthalmologica. 1999; 213: 176-182. 3 Leibowitz, H. M., Krueger, D. E., Maunder, L. R., Milton, R. C., Kini, M. M., Kahn, H. A., Nickerson, R. J., Pool, J., Colton, T. L., Ganley, J. P., Loewenstein, J. I., and Dawber, T. R. The Framingham Eye Study monograph: An opht halmological and epidemiological study of cataract, glaucoma, diabetic retinopathy, macular degeneration, and visual acuity in a general population of 2631 adults, 1 973-1975 Surv.Ophthalmol. 1980; 24: 335-610. 4 Mitchell, P., Smith, W., Attebo, K., and Wang, J. J. Prevalence of age-related maculopathy in Australia. The Blue Mountains Eye Study Ophthalmology. 1995; 102: 1450-1460. 5 Vingerling, J. R., Dielemans, I., Hofman, A., Grobbee, D. E., Hijmering, M., Kramer, C. F., and de Jong, P. T. The prevalence of ag e-related maculopathy in the Rotterdam Study Ophthalmology. 1995; 102: 205-210. 6 Heiba, I. M., Elston, R. C., Klein, B. E., a nd Klein, R. Sibling correlations and segregation analysis of age-related macu lopathy: the Beaver Dam Ey e Study Genet.Epidemiol. 1994; 11: 51-67. 7 Hyman, L. G., Lilienfeld, A. M., Ferris, F. L., III, and Fine, S. L. Senile macular degeneration: a case-control study Am.J.Epidemiol. 1983; 118: 213-227. 8 Seddon, J. M., Ajani, U. A., and Mitchell, B. D. Familial aggregation of age-related maculopathy Am.J.Ophthalmol. 1997; 123: 199-206. 9 Ambati, J., Ambati, B. K., Yoo, S. H., Ia nchulev, S., and Adamis, A. P. Age-related macular degeneration: etiology, pathogenesis, and th erapeutic strategies Surv.Ophthalmol. 2003; 48: 257-293. 10 Bressler, N. M., Bressler, S. B., and Fi ne, S. L. Age-related macular degeneration Surv.Ophthalmol. 1988; 32: 375-413. 11 Young, R. W. Pathophysiology of age-relate d macular degeneration Surv.Ophthalmol. 1987; 31: 291-306. 12 Wikler, K. C., Williams, R. W., and Raki c, P. Photoreceptor mosaic: number and distribution of rods and cone s in the rhesus monkey reti na J.Comp Neurol. 1990; 297: 499508.

PAGE 144

144 13 Bouilton M. Ageing of the reti nal pigment epithelium 1991; 125-151. 14 Bok, D. Processing and transp ort of retinoids by the retinal pigment epithelium Eye. 1990; 4 ( Pt 2): 326-332. 15 Steinberg R.H. and Miller S.S. Transport a nd membrane properties of the retinal pigment epithelium 1979; 205-225. 16 Bok, D. Retinal photoreceptor-pigment epitheli um interactions. Friede nwald lecture Invest Ophthalmol.Vis.Sci. 1985; 26: 1659-1694. 17 Hewitt A.T. and Adler R. The retinal pigment epithelium and interphotoreceptor matrix:Structure and spec ialized function 1994; 58-71. 18 Gass, J. D. Pathogenesis of discifor m detachment of the neuroepithelium Am.J.Ophthalmol. 1967; 63: Suppl 139. 19 Newsome D.A., Miceli M.V., and Liles M. R. Antioxidants in the retinal pigment epithelium 1994; 101-123. 20 Sarks S.H. and Sarks J.P. Age-related m acular degeneration: Atrophic form 1994; 2: 10711102. 21 Holz, F. G., Owens, S. L., Marks, J., Haimovici , R., and Bird, A. C. Ultrastructural findings in autosomal dominant drusen Arch.Ophthalmol. 1997; 115: 788-792. 22 van der Schaft, T. L., de Bruijn, W. C., Mooy, C. M., Ketelaars, D. A., and de Jong, P. T. Is basal laminar deposit unique for age-relate d macular degeneration? Arch.Ophthalmol. 1991; 109: 420-425. 23 Holz, F. G., Sheraidah, G., Pauleikhoff, D., and Bird, A. C. Analysis of lipid deposits extracted from human macular and periphera l Bruch's membrane Arch.Ophthalmol. 1994; 112: 402-406. 24 Moore, D. J., Hussain, A. A., and Marshall , J. Age-related variation in the hydraulic conductivity of Bruch's membrane Inve st Ophthalmol.Vis.Sci. 1995; 36: 1290-1297. 25 Starita, C., Hussain, A. A., and Marshall, J. Decreasing hydraulic conductivity of Bruch's membrane: relevance to photoreceptor surviv al and lipofuscinoses Am.J.Med.Genet. 1995; 57: 235-237. 26 McCabe F.J. and Ho A.C. Argon Laser to Drusen 2002; 325-342. 27 Spaide R.F. Aetiology of Late Ag e-Related Macular Disease 2005; 95-127. 28 Margrain, T. H., Boulton, M., Marshall, J., and Sliney, D. H. Do blue light filters confer protection against age-related macular dege neration? Prog.Retin.Eye Res. 2004; 23: 523531.

PAGE 145

145 29 Davies, N. P. and Morland, A. B. Macular pi gments: their characteri stics and putative role Prog.Retin.Eye Res. 2004; 23: 533-559. 30 Eckmiller, M. S. Defective cone photorece ptor cytoskeleton, alignment, feedback, and energetics can lead to energy depletion in macular degenera tion Prog.Retin.Eye Res. 2004; 23: 495-522. 31 Green, W. R. and Enger, C. Age-related m acular degeneration histopathologic studies. The 1992 Lorenz E. Zimmerman Lecture Ophthalmology. 1993; 100: 1519-1535. 32 Grossniklaus, H. E. and Green, W. R. Hi stopathologic and ultras tructural findings of surgically excised choroidal neovasculari zation. Submacular Surgery Trials Research Group Arch.Ophthalmol. 1998; 116: 745-749. 33 Sarks, J. P., Sarks, S. H., and Killingsworth, M. C. Evolution of soft drusen in age-related macular degeneration Eye. 1994; 8 ( Pt 3): 269-283. 34 Curcio, C. A. and Millican, C. L. Basal linear deposit and large drusen are specific for early age-related maculopathy Ar ch.Ophthalmol. 1999; 117: 329-339. 35 Sarks, J. P., Sarks, S. H., and Killingswort h, M. C. Evolution of geographic atrophy of the retinal pigment epithelium Eye. 1988; 2 ( Pt 5): 552-577. 36 Anderson, D. H., Mullins, R. F., Hageman, G. S., and Johnson, L. V. A role for local inflammation in the formation of drusen in the aging eye Am.J.Ophthalmol. 2002; 134: 411-431. 37 Spraul, C. W. and Grossniklaus, H. E. Charact eristics of Drusen and Bruch's membrane in postmortem eyes with age-related macula r degeneration Arch.O phthalmol. 1997; 115: 267273. 38 Bird, A. C., Bressler, N. M., Bressler, S. B., Chisholm, I. H., Coscas, G., Davis, M. D., de Jong, P. T., Klaver, C. C., Klein, B. E., Klein, R., and . An internati onal classification and grading system for age-related maculopat hy and age-related macular degeneration. The International ARM Epidemiological St udy Group Surv.Ophthalmol. 1995; 39: 367-374. 39 Roth, F., Bindewald, A., and Holz, F. G. Keypathophysiologic pathways in age-related macular disease Graefes Arch.C lin.Exp.Ophthalmol. 2004; 242: 710-716. 40 Rakoczy, P. E., Baines, M., Kennedy, C. J., and Constable, I. J. Correlation between autofluorescent debris accumulation and the presence of partially processed forms of cathepsin D in cultured retinal pigment epitheli al cells challenged with rod outer segments Exp.Eye Res. 1996; 63: 159-167. 41 Boulton, M., McKechnie, N. M., Breda, J., Ba yly, M., and Marshall, J. The formation of autofluorescent granules in cultured human RPE Invest O phthalmol.Vis.Sci. 1989; 30: 8289.

PAGE 146

146 42 Burke, J. M. and Skumatz, C. M. Autofl uorescent inclusions in long-term postconfluent cultures of retinal pigment epithelium I nvest Ophthalmol.Vis.Sci. 1998; 39: 1478-1486. 43 Dorey, C. K., Wu, G., Ebenstein, D., Garsd, A ., and Weiter, J. J. Cell loss in the aging retina. Relationship to lipofuscin accumul ation and macular degeneration Invest Ophthalmol.Vis.Sci. 1989; 30: 1691-1699. 44 Wassell, J., Ellis, S., Burke, J., and Boult on, M. Fluorescence properties of autofluorescent granules generated by cultured human RPE ce lls Invest Ophthalmol.Vis.Sci. 1998; 39: 1487-1492. 45 Sparrow, J. R. and Boulton, M. RPE lipofusci n and its role in reti nal pathobiology Exp.Eye Res. 2005; 80: 595-606. 46 Eldred, G. E. Lipofuscin fl uorophore inhibits lysosomal prot ein degradation and may cause early stages of macular degenerati on Gerontology. 1995; 41 Suppl 2: 15-28. 47 Holz, F. G., Schutt, F., Kopitz, J., Eldred, G. E., Kruse, F. E., Volcker, H. E., and Cantz, M. Inhibition of lysosomal degradative functions in RPE cells by a retinoid component of lipofuscin Invest Ophthalmo l.Vis.Sci. 1999; 40: 737-743. 48 Sparrow, J. R., Parish, C. A., Hashimot o, M., and Nakanishi, K. A2E, a lipofuscin fluorophore, in human retinal pigmented epithelial cells in culture Invest Ophthalmol.Vis.Sci. 1999; 40: 2988-2995. 49 Wihlmark, U., Wrigstad, A., Roberg, K., Nilsson, S. E., and Brunk, U. T. Lipofuscin accumulation in cultured retinal pigment epitheli al cells causes enhanced sensitivity to blue light irradiation Free Radi c.Biol.Med. 1997; 22: 1229-1234. 50 Gaillard, E. R., Atherton, S. J., Eldred, G ., and Dillon, J. Photophysical studies on human retinal lipofuscin Photochem.Photobiol. 1995; 61: 448-453. 51 Schutt, F., Bergmann, M., Kopitz, J., and Ho lz, F. G. [Detergent-like effects of the lipofuscin retinoid component A2-E in retinal pigment epithelial cells] Ophthalmologe. 2002; 99: 861-865. 52 Suter, M., Reme, C., Grimm, C., Wenzel, A., Jaattela, M., Esser, P., Kociok, N., Leist, M., and Richter, C. Age-related macular degene ration. The lipofusion co mponent N-retinyl-Nretinylidene ethanolamine detach es proapoptotic proteins fr om mitochondria and induces apoptosis in mammalian retinal pigment epit helial cells J.Biol.Chem. 2000; 275: 3962539630. 53 Weiter, J. J., Delori, F. C., Wing, G. L., and Fitch, K. A. Retinal pigment epithelial lipofuscin and melanin and choroidal melanin in human eyes Invest Ophthalmol.Vis.Sci. 1986; 27: 145-152. 54 Rovati, L. and Docchio, F. Autofluorescen ce methods in ophthalmology J.Biomed.Opt. 2004; 9: 9-21.

PAGE 147

147 55 Bergmann, M., Schutt, F., Holz, F. G., and Ko pitz, J. Inhibition of the ATP-driven proton pump in RPE lysosomes by the major lipofus cin fluorophore A2-E may contribute to the pathogenesis of age-related macular degeneration FASEB J. 2004; 18: 562-564. 56 Attebo, K., Mitchell, P., and Smith, W. Visual acuity and the causes of visual loss in Australia. The Blue Mountains Ey e Study Ophthalmology. 1996; 103: 357-364. 57 Hawkins, B. S., Bird, A., Klein, R., and West , S. K. Epidemiology of age-related macular degeneration Mol.Vis. 1999; 5: 26-32. 58 Risk factors associated with age-related macular degeneration. A case-control study in the age-related eye disease study: Age-Rela ted Eye Disease Study Report Number 3 Ophthalmology. 2000; 107: 2224-2232. 59 Evans, J. R. Risk factors for age-relate d macular degeneration Prog.Retin.Eye Res. 2001; 20: 227-253. 60 Friedman, D. S., Katz, J., Bressler, N. M ., Rahmani, B., and Tielsch, J. M. Racial differences in the prevalence of age-related macular degeneration: the Baltimore Eye Survey Ophthalmology. 1999; 106: 1049-1055. 61 Klaver, C. C., Wolfs, R. C., Assink, J. J., va n Duijn, C. M., Hofman, A., and de Jong, P. T. Genetic risk of age-related maculopathy. Population-based familial aggregation study Arch.Ophthalmol. 1998; 116: 1646-1651. 62 Smith, W., Mitchell, P., and Wang, J. J. Ge nder, oestrogen, hormone replacement and agerelated macular degeneration: result s from the Blue Mountains Eye Study Aust.N.Z.J.Ophthalmol. 1997; 25 Suppl 1: S13-S15. 63 Au Eong K. and Haller J.A. Risk Factor s for Age-Related Macular Degeneration and Choroidal Neovascularization 2002; 355-406. 64 Cruickshanks, K. J., Klein, R., and Klein, B. E. Sunlight and age-related macular degeneration. The Beaver Dam Eye Study Arch.Ophthalmol. 1993; 111: 514-518. 65 Hyman, L. and Neborsky, R. Risk factors for age-related macular degeneration: an update Curr.Opin.Ophthalmol. 2002; 13: 171-175. 66 Smith, W., Mitchell, P., and Leeder, S. R. Dietary fat and fish intake and age-related maculopathy Arch.Ophthalmol. 2000; 118: 401-404. 67 Wang, J. J., Klein, R., Smith, W., Klein, B. E., Tomany, S., and Mitchell, P. Cataract surgery and the 5-year inciden ce of late-stage age-related maculopathy: pooled findings from the Beaver Dam and Blue Mountains eye studies Ophthalmology. 2003; 110: 19601967. 68 Smith, W. and Mitchell, P. Family histor y and age-related maculopathy: the Blue Mountains Eye Study Aust.N.Z .J.Ophthalmol. 1998; 26: 203-206.

PAGE 148

148 69 Dosso, A. A. and Bovet, J. Monozygotic twin brothers with age-related macular degeneration Ophthalmol ogica. 1992; 205: 24-28. 70 Klein, M. L., Mauldin, W. M., and Stoumbos, V. D. Heredity and age-related macular degeneration. Observations in monozygo tic twins Arch.Ophthalmol. 1994; 112: 932-937. 71 Melrose, M. A., Magargal, L. E., and Lucier, A. C. Iden tical twins with subretinal neovascularization complicating senile macu lar degeneration Ophthalmic Surg. 1985; 16: 648-651. 72 Meyers, S. M. and Zachary, A. A. M onozygotic twins with age-related macular degeneration Arch.Ophthalmol. 1988; 106: 651-653. 73 Meyers, S. M. A twin study on age-related macular degeneration Trans.Am.Ophthalmol.Soc. 1994; 92: 775-843. 74 Meyers, S. M., Greene, T., and Gutman, F. A. A twin study of age-related macular degeneration Am.J.Ophthalmol. 1995; 120: 757-766. 75 Edwards, A. O., Ritter, R., III, Abel, K. J., Manning, A., Panhuysen, C., and Farrer, L. A. Complement factor H polymorphism and agerelated macular degene ration Science. 2005; 308: 421-424. 76 Haines, J. L., Hauser, M. A., Schmidt, S., Scott, W. K., Olson, L. M., Gallins, P., Spencer, K. L., Kwan, S. Y., Noureddine, M., Gilber t, J. R., Schnetz-Boutaud, N., Agarwal, A., Postel, E. A., and Pericak-Vance, M. A. Comple ment factor H variant increases the risk of age-related macular degenera tion Science. 2005; 308: 419-421. 77 Klein, R. J., Zeiss, C., Chew, E. Y., Tsai, J. Y., Sackler, R. S., Haynes, C., Henning, A. K., SanGiovanni, J. P., Mane, S. M., Mayne, S. T ., Bracken, M. B., Ferris, F. L., Ott, J., Barnstable, C., and Hoh, J. Complement factor H polymorphi sm in age-related macular degeneration Science. 2005; 308: 385-389. 78 Conley, Y. P., Thalamuthu, A., Jakobsdottir, J ., Weeks, D. E., Mah, T., Ferrell, R. E., and Gorin, M. B. Candidate gene analysis sugge sts a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy Hum.Mol.Genet. 2005; 14: 1991-2002. 79 Hageman, G. S., Anderson, D. H., Johnson, L. V ., Hancox, L. S., Taiber, A. J., Hardisty, L. I., Hageman, J. L., Stockman, H. A., Borchardt, J. D., Gehrs, K. M., Smith, R. J., Silvestri, G., Russell, S. R., Klaver, C. C., Barbazetto, I., Chang, S., Yannuzzi, L. A., Barile, G. R., Merriam, J. C., Smith, R. T., Olsh, A. K., Be rgeron, J., Zernant, J., Merriam, J. E., Gold, B., Dean, M., and Allikmets, R. A common hapl otype in the complement regulatory gene factor H (HF1/CFH) predisposes individua ls to age-related macular degeneration Proc.Natl.Acad.Sci.U.S.A. 2005; 102: 7227-7232. 80 Souied, E. H., Leveziel, N., Richard, F., Dr agon-Durey, M. A., Coscas, G., Soubrane, G., Benlian, P., and Fremeaux-Bacchi, V. Y 402H complement factor H polymorphism

PAGE 149

149 associated with exudative ag e-related macular degenerati on in the French population Mol.Vis. 2005; 11: 1135-1140. 81 Zareparsi, S., Branham, K. E., Li, M., Shah, S., Klein, R. J., Ott, J., Hoh, J., Abecasis, G. R., and Swaroop, A. Strong association of the Y402H variant in complement factor H at 1q32 with susceptibility to age-related m acular degeneration Am.J.Hum.Genet. 2005; 77: 149-153. 82 Gold, B., Merriam, J. E., Zernant, J., Hancox, L. S., Taiber, A. J., Gehrs, K., Cramer, K., Neel, J., Bergeron, J., Barile, G. R., Smit h, R. T., Hageman, G. S., Dean, M., and Allikmets, R. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration Nat.Genet. 2006; 38: 458-462. 83 Zareparsi, S., Buraczynska, M., Branham, K. E., Shah, S., Eng, D., Li, M., Pawar, H., Yashar, B. M., Moroi, S. E., Lichter, P. R., Petty, H. R., Richards, J. E., Abecasis, G. R., Elner, V. M., and Swaroop, A. Toll-like recep tor 4 variant D299G is associated with susceptibility to age-related macular de generation Hum.Mol.Genet. 2005; 14: 1449-1455. 84 Jakobsdottir, J., Conley, Y. P., Weeks, D. E ., Mah, T. S., Ferrell, R. E., and Gorin, M. B. Susceptibility genes for agerelated maculopathy on chro mosome 10q26 Am.J.Hum.Genet. 2005; 77: 389-407. 85 Rivera, A., Fisher, S. A., Fritsche, L. G., Ke ilhauer, C. N., Lichtner, P., Meitinger, T., and Weber, B. H. Hypothetical LOC387715 is a second major susceptib ility gene for agerelated macular degeneration, contributing in dependently of complement factor H to disease risk Hum.Mol. Genet. 2005; 14: 3227-3236. 86 Allikmets, R. Further evidence for an association of ABCR alleles with age-related macular degeneration. The International ABCR Screen ing Consortium Am.J.Hum.Genet. 2000; 67: 487-491. 87 Guymer, R. H., Heon, E., Lotery, A. J., Muni er, F. L., Schorderet, D. F., Baird, P. N., McNeil, R. J., Haines, H., Sheffield, V. C., and Stone, E. M. Variation of codons 1961 and 2177 of the Stargardt disease gene is not associated with ag e-related macular degeneration Arch.Ophthalmol. 2001; 119: 745-751. 88 Schmidt, S., Postel, E. A., Agarwal, A., Allen, I. C., Jr., Walters, S. N., De La Paz, M. A., Scott, W. K., Haines, J. L., Pericak-Vance, M. A., and Gilbert, J. R. Detailed analysis of allelic variation in the ABCA4 gene in age-re lated maculopathy Invest Ophthalmol.Vis.Sci. 2003; 44: 2868-2875. 89 Webster, A. R., Heon, E., Lotery, A. J., Va ndenburgh, K., Casavant, T. L., Oh, K. T., Beck, G., Fishman, G. A., Lam, B. L., Levin, A., H eckenlively, J. R., Jacobson, S. G., Weleber, R. G., Sheffield, V. C., and Stone, E. M. An analysis of allelic variation in the ABCA4 gene Invest Ophthalmol .Vis.Sci. 2001; 42: 1179-1189. 90 Vasireddy, V., Jablonski, M. M., Mandal, M. N., Raz-Prag, D., Wang, X. F., Nizol, L., Iannaccone, A., Musch, D. C., Bush, R. A., Sale m, N., Jr., Sieving, P. A., and Ayyagari, R.

PAGE 150

150 Elovl4 5-bp-Deletion Knock-in Mice Develop Progressive Photoreceptor Degeneration Invest Ophthalmol.Vis.Sci. 2006; 47: 4558-4568. 91 Ayyagari, R., Zhang, K., Hutchinson, A ., Yu, Z., Swaroop, A., Kakuk, L. E., Seddon, J. M., Bernstein, P. S., Lewis, R. A., Tammur, J., Yang, Z., Li, Y., Zhang, H., Yashar, B. M., Liu, J., Petrukhin, K., Sieving, P. A., and Allik mets, R. Evaluation of the ELOVL4 gene in patients with age-related macular degene ration Ophthalmic Genet. 2001; 22: 233-239. 92 Lotery, A. J., Munier, F. L., Fishman, G. A ., Weleber, R. G., Jacobson, S. G., Affatigato, L. M., Nichols, B. E., Schorderet, D. F., Sheffiel d, V. C., and Stone, E. M. Allelic variation in the VMD2 gene in best disease and ag e-related macular degeneration Invest Ophthalmol.Vis.Sci. 2000; 41: 1291-1296. 93 De La Paz, M. A., Pericak-Vance, M. A., Lennon, F., Haines, J. L., and Seddon, J. M. Exclusion of TIMP3 as a candidate locus in age-related macular degeneration Invest Ophthalmol.Vis.Sci. 1997; 38: 1060-1065. 94 Guymer, R. H., McNeil, R., Cain, M., Tomlin, B., Allen, P. J., Dip, C. L., and Baird, P. N. Analysis of the Arg345Trp disease-associated allele of the EFEMP1 gene in individuals with early onset drusen or familial age-related macular degeneration Clin.Experiment.Ophthalmol. 2002; 30: 419-423. 95 Baird, P. N., Richardson, A. J., Robman, L. D., Dimitrov, P. N., Tikellis, G., McCarty, C. A., and Guymer, R. H. Apolipopr otein (APOE) gene is associ ated with progression of agerelated macular degeneration (A MD) Hum.Mutat. 2006; 27: 337-342. 96 Schmidt, S., Haines, J. L., Postel, E. A., Ag arwal, A., Kwan, S. Y., Gilbert, J. R., PericakVance, M. A., and Scott, W. K. Joint eff ects of smoking history and APOE genotypes in age-related macular degenera tion Mol.Vis. 2005; 11: 941-949. 97 Conley, Y. P., Thalamuthu, A., Jakobsdottir, J ., Weeks, D. E., Mah, T., Ferrell, R. E., and Gorin, M. B. Candidate gene analysis sugge sts a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy Hum.Mol.Genet. 2005; 14: 1991-2002. 98 Iyengar, S. K., Song, D., Klein, B. E., Klein, R., Schick, J. H., Hum phrey, J., Millard, C., Liptak, R., Russo, K., Jun, G., Lee, K. E., Fijal, B., and Elston, R. C. Dissection of genomewide-scan data in extended families reveals a major locus and oligogenic susceptibility for age-related macular de generation Am.J.Hum.Genet. 2004; 74: 20-39. 99 Schultz, D. W., Klein, M. L., Humpert, A. J., Luzier, C. W., Persun, V., Schain, M., Mahan, A., Runckel, C., Cassera, M., Vittal, V., Doyle, T. M., Martin, T. M., Weleber, R. G., Francis, P. J., and Acott, T. S. Analysis of the ARMD1 locus: evidence that a mutation in HEMICENTIN-1 is associated with age-re lated macular degeneration in a large family Hum.Mol.Genet. 2003; 12: 3315-3323. 100 Hamdi, H. K., Reznik, J., Castellon, R., Atilano , S. R., Ong, J. M., Udar, N., Tavis, J. H., Aoki, A. M., Nesburn, A. B., Boyer, D. S., Sm all, K. W., Brown, D. J., and Kenney, M. C.

PAGE 151

151 Alu DNA polymorphism in ACE gene is prot ective for age-related macular degeneration Biochem.Biophys.Res.Commun. 2002; 295: 668-672. 101 Imamura, Y., Noda, S., Hashizume, K., Shinoda, K., Yamaguchi, M., Uchiyama, S., Shimizu, T., Mizushima, Y., Shirasawa, T., and Tsubota, K. Drusen, choroidal neovascularization, and retinal pigment epithe lium dysfunction in SOD1-deficient mice: a model of age-related macular degenerati on Proc.Natl.Acad.Sci.U.S.A. 2006; 103: 1128211287. 102 Kimura, K., Isashiki, Y., Sonoda, S., Kaki uchi-Matsumoto, T., and Ohba, N. Genetic association of manganese superoxide dism utase with exudative age-related macular degeneration Am.J.Ophthalmol. 2000; 130: 769-773. 103 Kahn, H. A., Leibowitz, H. M., Ganley, J. P ., Kini, M. M., Colton, T., Nickerson, R. S., and Dawber, T. R. The Framingham Eye Study. I. Outline and major prevalence findings Am.J.Epidemiol. 1977; 106: 17-32. 104 Klein, R., Klein, B. E., and Linton, K. L. Prevalence of age-related maculopathy. The Beaver Dam Eye Study Ophthalmology. 1992; 99: 933-943. 105 Mitchell, P., Smith, W., Attebo, K., and Wang, J. J. Prevalence of age-related maculopathy in Australia. The Blue Mountains Eye Study Ophthalmology. 1995; 102: 1450-1460. 106 Klein, B. E. and Klein, R. Cataracts a nd macular degeneration in older Americans Arch.Ophthalmol. 1982; 100: 571-573. 107 McCarty, C. A., Mukesh, B. N., Fu, C. L., Mitc hell, P., Wang, J. J., and Taylor, H. R. Risk factors for age-related maculopathy: the Vi sual Impairment Project Arch.Ophthalmol. 2001; 119: 1455-1462. 108 Schachat, A. P., Hyman, L., Leske, M. C., Conn ell, A. M., and Wu, S. Y. Features of agerelated macular degeneration in a black population. The Barbados Eye Study Group Arch.Ophthalmol. 1995; 113: 728-735. 109 Risk factors for neovascular age-related macular degene ration. The Eye Disease CaseControl Study Group Arch.Ophthalmol. 1992; 110: 1701-1708. 110 Gregor, Z. and Joffe, L. Senile macular ch anges in the black African Br.J.Ophthalmol. 1978; 62: 547-550. 111 Klein, R., Klein, B. E., Jensen, S. C., MaresPerlman, J. A., Cruickshanks, K. J., and Palta, M. Age-related maculopathy in a multiracial United States population: the National Health and Nutrition Examination Survey III Ophthalmology. 1999; 106: 1056-1065. 112 Sommer, A., Tielsch, J. M., Katz , J., Quigley, H. A., Gottsch, J. D., Javitt, J. C., Martone, J. F., Royall, R. M., Witt, K. A., and Ezrine, S. Racial differences in the cause-specific prevalence of blindness in east Baltimo re N.Engl.J.Med. 1991; 325: 1412-1417.

PAGE 152

152 113 Chaine, G., Hullo, A., Sahel, J., Soubrane , G., Espinasse-Berrod, M. A., Schutz, D., Bourguignon, C., Harpey, C., Brault, Y., Coste, M., Moccatti, D., and Bourgeois, H. Casecontrol study of the risk f actors for age related macular degeneration. France-DMLA Study Group, Br.J.Ophthalmol. 1998; 82: 996-1002. 114 Mitchell, P., Smith, W., and Wang, J. J. Iris color, skin sun sensitivity, and age-related maculopathy. The Blue Mountains Ey e Study Ophthalmology. 1998; 105: 1359-1363. 115 Weiter, J. J., Delori, F. C., Wing, G. L., and Fitch, K. A. Relationship of senile macular degeneration to ocular pigmentati on Am.J.Ophthalmol. 1985; 99: 185-187. 116 Delcourt, C., Diaz, J. L., Ponton-Sanchez, A., and Papoz, L. Smoking and age-related macular degeneration. The POLA Study. Pa thologies Oculaires Liees a l'Age Arch.Ophthalmol. 1998; 116: 1031-1035. 117 Klein, R., Klein, B. E., Linton, K. L., and De Mets, D. L. The Beaver Dam Eye Study: the relation of age-related maculopathy to smoking Am.J.Epidemiol. 1993; 137: 190-200. 118 Smith, W., Mitchell, P., and Leeder, S. R. Smoking and age-related maculopathy. The Blue Mountains Eye Study Arch.O phthalmol. 1996; 114: 1518-1523. 119 Vingerling, J. R., Hofman, A., Grobbee, D. E., and de Jong, P. T. Age-related macular degeneration and smoking. The Rotterdam Study Arch.Ophthalmol. 1996; 114: 1193-1196. 120 Christen, W. G., Glynn, R. J., Manson, J. E., Aj ani, U. A., and Buring, J. E. A prospective study of cigarette smoking and risk of age -related macular degeneration in men JAMA. 1996; 276: 1147-1151. 121 Seddon, J. M., Willett, W. C., Speizer, F. E., and Hankinson, S. E. A prospective study of cigarette smoking and age-related macula r degeneration in women JAMA. 1996; 276: 1141-1146. 122 Tamakoshi, A., Yuzawa, M., Matsui, M., Uyama, M., Fujiwara, N. K., and Ohno, Y. Smoking and neovascular form of age related macular degeneration in late middle aged males: findings from a case-control study in Japan. Research Committee on Chorioretinal Degenerations Br.J.Ophthalmol. 1997; 81: 901-904. 123 Sanders, T. A., Haines, A. P., Wormald, R., Wright, L. A., and Obeid, O. Essential fatty acids, plasma cholesterol, and fat-soluble vitamins in subjects with age-related maculopathy and matched control subj ects Am.J.Clin.Nutr. 1993; 57: 428-433. 124 Stryker, W. S., Kaplan, L. A., Stein, E. A., Stampfer, M. J., Sober, A., and Willett, W. C. The relation of diet, cigarette smoking, and alcohol consump tion to plasma beta-carotene and alpha-tocopherol levels Am .J.Epidemiol. 1988; 127: 283-296. 125 Pryor, W. A., Hales, B. J., Premovic, P. I., a nd Church, D. F. The radicals in cigarette tar: their nature and suggested physiological implications Science. 1983; 220: 425-427.

PAGE 153

153 126 Schectman, G., Byrd, J. C., and Gruchow, H. W. The influence of smoking on vitamin C status in adults Am.J.Pub lic Health. 1989; 79: 158-162. 127 Hammond, B. R., Jr., Wooten, B. R., and Snodde rly, D. M. Cigarette smoking and retinal carotenoids: implications for age-related macular degeneration Vision Res. 1996; 36: 30033009. 128 Solberg, Y., Rosner, M., and Belkin, M. Th e association between cigarette smoking and ocular diseases Surv.Ophthalmol. 1998; 42: 535-547. 129 Belda, J. I., Roma, J., Vilela, C., Puertas, F. J., Diaz-Llopis, M., Bosch-Morell, F., and Romero, F. J. Serum vitamin E levels negative ly correlate with severity of age-related macular degeneration Mech.A geing Dev. 1999; 107: 159-164. 130 Cruickshanks, K. J., Klein, R., and Klein, B. E. Sunlight and age-related macular degeneration. The Beaver Dam Eye Study Arch.Ophthalmol. 1993; 111: 514-518. 131 Taylor, H. R., West, S., Munoz, B., Rosenthal, F. S., Bressler, S. B., and Bressler, N. M. The long-term effects of visible light on the eye Arch.Ophthalmol. 1992; 110: 99-104. 132 Ham, W. T., Jr., Mueller, H. A., Ruffolo, J. J ., Jr., Guerry, D., III, and Guerry, R. K. Action spectrum for retinal injury from near-ultr aviolet radiation in the aphakic monkey Am.J.Ophthalmol. 1982; 93: 299-306. 133 Borges, J., Li, Z. Y., and Tso, M. O. Effect s of repeated photic exposures on the monkey macula Arch.Ophthalmol. 1990; 108: 727-733. 134 Lawwill, T. Three major pathologic processe s caused by light in the primate retina: a search for mechanisms Trans.Am.Ophthalmol.Soc. 1982; 80: 517-579. 135 Noell, W. K. Possible mechanisms of phot oreceptor damage by light in mammalian eyes Vision Res. 1980; 20: 1163-1171. 136 Tso, M. O. Photic maculopathy in rhesus monkey. A light and electron microscopic study Invest Ophthalmol. 1973; 12: 17-34. 137 Young, R. W. Solar radiation and age-rela ted macular degeneration Surv.Ophthalmol. 1988; 32: 252-269. 138 Hammond, B. R., Jr., Curran-Celentano, J., Judd , S., Fuld, K., Krinsky, N. I., Wooten, B. R., and Snodderly, D. M. Sex differences in ma cular pigment optical density: relation to plasma carotenoid concentrations and diet ary patterns Vision Res. 1996; 36: 2001-2012. 139 Hammond, B. R., Jr., Johnson, E. J., Russell, R. M., Krinsky, N. I., Yeum, K. J., Edwards, R. B., and Snodderly, D. M. Di etary modification of human m acular pigment density Invest Ophthalmol.Vis.Sci. 1997; 38: 1795-1801.

PAGE 154

154 140 Seddon, J. M., Ajani, U. A., Sperduto, R. D., Hiller, R., Blair, N., Burton, T. C., Farber, M. D., Gragoudas, E. S., Haller, J., Miller, D. T., and . Dietary carotenoids, vitamins A, C, and E, and advanced age-related macular dege neration. Eye Disease Case-Control Study Group JAMA. 1994; 272: 1413-1420. 141 Jacques, P. F. The potential preventive effects of vitamins for cataract and age-related macular degeneration Int.J.V itam.Nutr.Res. 1999; 69: 198-205. 142 Snodderly, D. M. Evidence for protection ag ainst age-related macu lar degeneration by carotenoids and antioxidant vitamins Am.J.Clin.Nutr. 1995; 62: 1448S-1461S. 143 Antioxidant status and neova scular age-related macular de generation. Eye Disease CaseControl Study Group Arch.Ophthalmol. 1993; 111: 104-109. 144 A randomized, placebo-controlled, clinical trial of high-dose supplementation with vitamins C and E, beta carotene, and zinc for age-related macular degeneration and vision loss: AREDS report no. 8 Arc h.Ophthalmol. 2001; 119: 1417-1436. 145 Blair, C. J. and Ferguson, J., Jr. Exacer bation of senile macular degeneration following cataract extraction Am.J.O phthalmol. 1979; 87: 77-83. 146 Oliver, M. Posterior pole changes afte r cataract extraction in elderly subjects Am.J.Ophthalmol. 1966; 62: 1145-1148. 147 Pollack, A., Marcovich, A., Bukelman, A ., and Oliver, M. Age-related macular degeneration after extracapsular cataract extraction with intraocular lens implantation Ophthalmology. 1996; 103: 1546-1554. 148 Pollack, A., Marcovich, A., Bukelman, A., Za lish, M., and Oliver, M. Development of exudative age-related macular de generation after cataract surgery Eye. 1997; 11 ( Pt 4): 523-530. 149 Pollack, A., Bukelman, A., Zalish, M., Leiba, H ., and Oliver, M. The course of age-related macular degeneration following bilateral catar act surgery Ophthalmic Surg.Lasers. 1998; 29: 286-294. 150 Klein, R., Klein, B. E., Jensen, S. C., and Cr uickshanks, K. J. The relationship of ocular factors to the incidence a nd progression of age-related maculopathy Arch.Ophthalmol. 1998; 116: 506-513. 151 Hyman, L., Schachat, A. P., He, Q., and Leske, M. C. Hypert ension, cardiovascular disease, and age-related macular degenera tion. Age-Related Macula r Degeneration Risk Factors Study Group Arch.O phthalmol. 2000; 118: 351-358. 152 Snow, K. K. and Seddon, J. M. Do age-rela ted macular degeneration and cardiovascular disease share common antecedents? Opht halmic Epidemiol. 1999; 6: 125-143.

PAGE 155

155 153 Vingerling, J. R., Dielemans, I., Bots, M. L., Hofman, A., Grobbee, D. E., and de Jong, P. T. Age-related macular degeneration is associated with atherosclerosis. The Rotterdam Study Am.J.Epidemiol. 1995; 142: 404-409. 154 Bressler, N. M., Bressler, S. B., West, S. K., Fine, S. L., and Taylor, H. R. The grading and prevalence of macular degene ration in Chesapeake Bay wate rmen Arch.Ophthalmol. 1989; 107: 847-852. 155 Klein, R., Clegg, L., Cooper, L. S., Hubbard, L. D., Klein, B. E., King, W. N., and Folsom, A. R. Prevalence of age-related maculopathy in the Atherosclerosis Risk in Communities Study Arch.Ophthalmol. 1999; 117: 1203-1210. 156 Maltzman, B. A., Mulvihill, M. N., and Gr eenbaum, A. Senile macular degeneration and risk factors: a case-control study Ann.Ophthalmol. 1979; 11: 1197-1201. 157 Tsang, N. C., Penfold, P. L., Snitch, P. J., a nd Billson, F. Serum levels of antioxidants and age-related macular degeneration Doc.Ophthalmol. 1992; 81: 387-400. 158 Gomes, A., Fernandes, E., and Lima, J. L. Fluorescence probes used for detection of reactive oxygen species J.Bioc hem.Biophys.Methods. 2005; 65: 45-80. 159 Kang D., Takeshige K., Sekiguchi M., and Singh K.K. Introduction 1998; 1-15. 160 Balaban, R. S., Nemoto, S., and Finkel, T. Mitochondria, oxidants, and aging Cell. 2005; 120: 483-495. 161 Cadenas, E., Boveris, A., Ragan, C. I., and Stoppani, A. O. Production of superoxide radicals and hydrogen peroxi de by NADH-ubiquinone reductase and ubiquinol-cytochrome c reductase from beef-heart mitochondria Arch.Biochem.Biophys. 1977; 180: 248-257. 162 Nohl, H. and Jordan, W. The mitoc hondrial site of superoxide formation Biochem.Biophys.Res.Commun. 1986; 138: 533-539. 163 Brierley, E. J., Johnson, M. A., Lightowlers, R. N., James, O. F., and Turnbull, D. M. Role of mitochondrial DNA mutations in human agi ng: implications for the central nervous system and muscle Ann.Neurol. 1998; 43: 217-223. 164 Hagen, T. M., Yowe, D. L., Bartholomew, J. C ., Wehr, C. M., Do, K. L., Park, J. Y., and Ames, B. N. Mitochondrial decay in hepato cytes from old rats: membrane potential declines, heterogeneity and oxidants increase Proc.Natl.Acad.Sci.U.S.A. 1997; 94: 30643069. 165 Beckman, J. S. and Crow, J. P. Pathological implications of nitric oxide, superoxide and peroxynitrite formation Biochem. Soc.Trans. 1993; 21: 330-334. 166 Halliwell, B. Reactive species and antioxidant s. Redox biology is a fundamental theme of aerobic life Plant Phys iol. 2006; 141: 312-322.

PAGE 156

156 167 Vasquez-Vivar, J., Kalyanaraman, B., Martas ek, P., Hogg, N., Masters, B. S., Karoui, H., Tordo, P., and Pritchard, K. A., Jr. Superoxi de generation by endot helial nitric oxide synthase: the influence of cofactors Proc.Natl.Acad.Sci.U.S.A. 1998; 95: 9220-9225. 168 Bonne, C., Muller, A., and V illain, M. Free radicals in retin al ischemia Gen.Pharmacol. 1998; 30: 275-280. 169 Nose, K. Role of reactive oxygen species in the regulati on of physiological functions Biol.Pharm.Bull. 2000; 23: 897-903. 170 Thannickal, V. J. and Fanburg, B. L. Reactive oxygen species in cell signaling Am.J.Physiol Lung Cell Mol.Physiol. 2000; 279: L1005-L1028. 171 Mitchell, D. C., Niu, S. L., and Litman, B. J. Enhancement of G pr otein-coupled signaling by DHA phospholipids Lipids. 2003; 38: 437-443. 172 Catala, A. An overview of lipid peroxida tion with emphasis in outer segments of photoreceptors and the chemiluminescence a ssay Int.J.Biochem.Cell Biol. 2006; 38: 14821495. 173 Ardelt, B. K., Borowitz, J. L., Maduh, E. U., Swain, S. L., and Isom, G. E. Cyanideinduced lipid peroxidation in different orga ns: subcellular distri bution and hydroperoxide generation in neuronal cells Toxicology. 1994; 89: 127-137. 174 Choe, M., Jackson, C., and Yu, B. P. Lipi d peroxidation contributes to age-related membrane rigidity Free Radi c.Biol.Med. 1995; 18: 977-984. 175 Hruszkewycz, A. M. Evidence for mito chondrial DNA damage by lipid peroxidation Biochem.Biophys.Res.Commun. 1988; 153: 191-197. 176 Okada, K., Wangpoengtrakul, C., Osawa, T., Toyokuni, S., Tanaka, K., and Uchida, K. 4Hydroxy-2-nonenal-mediated impairment of intracellular proteolysis during oxidative stress. Identification of proteasomes as ta rget molecules J.Biol.Chem. 1999; 274: 2378723793. 177 Carini, M., Aldini, G., a nd Facino, R. M. Mass spectrome try for detection of 4-hydroxytrans-2-nonenal (HNE) adducts with peptides and proteins Mass Spectrom.Rev. 2004; 23: 281-305. 178 Uchida, K. 4-Hydroxy-2-nonenal: a product and mediator of oxidative stress Prog.Lipid Res. 2003; 42: 318-343. 179 Cracowski, J. L., Durand, T., and Bessard, G. Isoprostanes as a biomarker of lipid peroxidation in humans: physiology, pharmacol ogy and clinical implications Trends Pharmacol.Sci. 2002; 23: 360-366. 180 Montuschi, P., Barnes, P. J., and Roberts, L. J. Isoprostanes: ma rkers and mediators of oxidative stress FASE B J. 2004; 18: 1791-1800.

PAGE 157

157 181 Oliver, C. N., Ahn, B. W., Moerman, E. J., Goldstein, S., and Stadtman, E. R. Age-related changes in oxidized proteins J.Biol.Chem. 1987; 262: 5488-5491. 182 Stadtman, E. R. Oxidation of free amino aci ds and amino acid residues in proteins by radiolysis and by metal-catalyzed r eactions Annu.Rev.Biochem. 1993; 62: 797-821. 183 Kasai, H. and Kawai, K. Oxidative DNA damage: mechanisms and significance in health and disease Antioxid.Redox.S ignal. 2006; 8: 981-983. 184 Fridovich, I. Superoxide ra dical and superoxide dismutas es Annu.Rev.Biochem. 1995; 64: 97-112. 185 Beyer, W., Imlay, J., and Fridovich, I. Superoxide dismutases Prog.Nucleic Acid Res.Mol.Biol. 1991; 40: 221-253. 186 Opara, E. C. Oxidative stress Dis.Mon. 2006; 52: 183-198. 187 Opara, E. C. and Rockway, S. W. Anti oxidants and micronutrien ts Dis.Mon. 2006; 52: 151-163. 188 Okamoto, N., Tobe, T., Hackett, S. F., Ozaki, H., Vinores, M. A., La Rochelle, W., Zack, D. J., and Campochiaro, P. A. Transgenic mi ce with increased expression of vascular endothelial growth factor in the retina: a new model of intraretinal and subretinal neovascularization Am.J.Pathol. 1997; 151: 281-291. 189 Schwesinger, C., Yee, C., Rohan, R. M., Jou ssen, A. M., Fernandez, A., Meyer, T. N., Poulaki, V., Ma, J. J., Redmond, T. M., Li u, S., Adamis, A. P., and D'Amato, R. J. Intrachoroidal neovascularization in transgen ic mice overexpressing vascular endothelial growth factor in the re tinal pigment epithelium Am .J.Pathol. 2001; 158: 1161-1172. 190 Ryan, S. J. Subretinal neovascularization. Natural history of an experimental model Arch.Ophthalmol. 1982; 100: 1804-1809. 191 Tobe, T., Ortega, S., Luna, J. D., Ozaki, H ., Okamoto, N., Derevjanik, N. L., Vinores, S. A., Basilico, C., and Campochiaro, P. A. Targ eted disruption of the FGF2 gene does not prevent choroidal neovascula rization in a murine model Am.J.Pathol. 1998; 153: 16411646. 192 Majji, A. B., Cao, J., Chang, K. Y., Hayashi, A., Aggarwal, S., Grebe, R. R., and De Juan E Jr Age-related retinal pigment epitheliu m and Bruch's membrane degeneration in senescence-accelerated mouse Invest O phthalmol.Vis.Sci. 2000; 41: 3936-3942. 193 Ambati, J., Anand, A., Fernandez, S., Sakurai , E., Lynn, B. C., Kuziel, W. A., Rollins, B. J., and Ambati, B. K. An animal model of age-related macular degeneration in senescent Ccl-2or Ccr-2-deficient mice Nat.Med. 2003; 9: 1390-1397.

PAGE 158

158 194 Weng, J., Mata, N. L., Azarian, S. M., Tzekov, R. T., Birch, D. G., and Travis, G. H. Insights into the function of Rim protein in photoreceptors and etiology of Stargardt's disease from the phenotype in abcr knockout mice Cell. 1999; 98: 13-23. 195 Heckenlively, J. R., Hawes, N. L., Friedla nder, M., Nusinowitz, S., Hurd, R., Davisson, M., and Chang, B. Mouse model of subretinal ne ovascularization with choroidal anastomosis Retina. 2003; 23: 518-522. 196 Hahn, P., Qian, Y., Dentchev, T., Chen, L., Beard, J., Harris, Z. L., and Dunaief, J. L. Disruption of ceruloplasmin and hephaestin in mice causes retinal iron overload and retinal degeneration with features of age-related macular degenera tion Proc.Natl.Acad.Sci.U.S.A. 2004; 101: 13850-13855. 197 Kliffen, M., Lutgens, E., Daemen, M. J., de Muinck, E. D., Mooy, C. M., and de Jong, P. T. The APO(*)E3-Leiden mouse as an animal model for basal laminar deposit Br.J.Ophthalmol. 2000; 84: 1415-1419. 198 Karan, G., Lillo, C., Yang, Z., Cameron, D. J., Locke, K. G., Zhao, Y., Thirumalaichary, S., Li, C., Birch, D. G., Vollmer-Snarr, H. R., Williams, D. S., and Zhang, K. Lipofuscin accumulation, abnormal electrophysiology, and p hotoreceptor degeneration in mutant ELOVL4 transgenic mice: a model for macula r degeneration Proc.Natl.Acad.Sci.U.S.A. 2005; 102: 4164-4169. 199 Rakoczy, P. E., Zhang, D., Robertson, T., Barnett, N. L., Papadimitriou, J., Constable, I. J., and Lai, C. M. Progressive age-related change s similar to age-related macular degeneration in a transgenic mouse model Am.J.Pathol. 2002; 161: 1515-1524. 200 Dithmar, S., Sharara, N. A., Curcio, C. A., Le, N. A., Zhang, Y., Brown, S., and Grossniklaus, H. E. Murine high-fat diet a nd laser photochemical model of basal deposits in Bruch membrane Arch.Ophthalmol. 2001; 119: 1643-1649. 201 Cousins, S. W., Espinosa-Heidmann, D. G ., Alexandridou, A., Sall, J., Dubovy, S., and Csaky, K. The role of aging, high fat diet and blue light exposure in an experimental mouse model for basal laminar deposit formation Exp.Eye Res. 2002; 75: 543-553. 202 Espinosa-Heidmann, D. G., Suner, I. J., Catanut o, P., Hernandez, E. P., Marin-Castano, M. E., and Cousins, S. W. Cigarette smoke-relate d oxidants and the development of sub-RPE deposits in an experimental animal model of dry AMD Invest Ophthalmol.Vis.Sci. 2006; 47: 729-737. 203 Alifano, P., Rivellini, F., Piscitelli, C., A rraiano, C. M., Bruni, C. B., and Carlomagno, M. S. Ribonuclease E provides substrates fo r ribonuclease P-dependent processing of a polycistronic mRNA Genes Dev. 1994; 8: 3021-3031. 204 Kruger, K., Grabowski, P. J., Zaug, A. J., Sands, J., Gottschling, D. E., and Cech, T. R. Self-splicing RNA: autoexcision and autocyc lization of the ribosomal RNA intervening sequence of Tetrahymena Cell. 1982; 31: 147-157.

PAGE 159

159 205 Guerrier-Takada, C., Gardiner, K., Marsh, T., Pace, N., and Altman, S. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme Cell. 1983; 35: 849-857. 206 Buzayan, J. M., Hampel, A., and Bruening, G. Nucleotide sequence and newly formed phosphodiester bond of spontaneously ligated sate llite tobacco ringspot virus RNA Nucleic Acids Res. 1986; 14: 9729-9743. 207 Buzayan, J. M., Gerlach, W. L., and Bruening, G. Satellite tobacco ringspot virus RNA: A subset of the RNA sequence is sufficient for autolytic processing Proc.Natl.Acad.Sci.U.S.A. 1986; 83: 8859-8862. 208 Buzayan, J. M., McNinch, J. S., Schneider, I. R., and Bruening, G. A nucleotide sequence rearrangement distinguishes two isolates of satellite tobacco ringspot virus RNA Virology. 1987; 160: 95-99. 209 Forster, A. C. and Symons, R. H. Self-cleav age of plus and minus RNAs of a virusoid and a structural model for the act ive sites Cell. 1987; 49: 211-220. 210 Hutchins, C. J., Rathjen, P. D., Forster, A. C ., and Symons, R. H. Self-cleavage of plus and minus RNA transcripts of avo cado sunblotch viroid Nucleic Acids Res. 1986; 14: 36273640. 211 Khan, A. U. and Lal, S. K. Ribozymes: a m odern tool in medicine J.Biomed.Sci. 2003; 10: 457-467. 212 Kumar, P. K., Suh, Y. A., Miyashiro, H., Nishikawa, F., Kawakami, J., Taira, K., and Nishikawa, S. Random mutations to evaluate the role of ba ses at two important singlestranded regions of genomic HDV ribozym e Nucleic Acids Res. 1992; 20: 3919-3924. 213 Kuo, M. Y., Sharmeen, L., Dinter-Gottlieb, G ., and Taylor, J. Char acterization of selfcleaving RNA sequences on the genome and an tigenome of human hepatitis delta virus J.Virol. 1988; 62: 4439-4444. 214 Saville, B. J. and Collins, R. A. A site-s pecific self-cleavage r eaction performed by a novel RNA in Neurospora mitoc hondria Cell. 1990; 61: 685-696. 215 Sharmeen, L., Kuo, M. Y., Dinter-Gottlieb, G ., and Taylor, J. Antigenomic RNA of human hepatitis delta virus can undergo self -cleavage J.Virol. 1988; 62: 2674-2679. 216 Winkler, W. C. and Breaker, R. R. Geneti c control by metabolite-binding riboswitches Chembiochem. 2003; 4: 1024-1032. 217 Winkler, W. C., Nahvi, A., Roth, A., Collins, J. A., and Breaker, R. R. Control of gene expression by a natural metabolite-respons ive ribozyme Nature. 2004; 428: 281-286. 218 Teixeira, A., Tahiri-Alaoui, A., West, S., Thomas, B., Ramadass, A., Martianov, I., Dye, M., James, W., Proudfoot, N. J., and Akoulitc hev, A. Autocatalytic RNA cleavage in the

PAGE 160

160 human beta-globin pre-mRNA promotes tran scription terminati on Nature. 2004; 432: 526530. 219 Castanotto, D., Rossi, J. J., and Sarver, N. An tisense catalytic RNAs as therapeutic agents Adv.Pharmacol. 1994; 25: 289-317. 220 Poeschla, E. and Wong-Staal, F. Antivira l and anticancer ribozy mes Curr.Opin.Oncol. 1994; 6: 601-606. 221 Rossi, J. J. Ribozymes, genomics and th erapeutics Chem.Biol. 1999; 6: R33-R37. 222 Sarver, N., Cantin, E. M., Chang, P. S., Zaia , J. A., Ladne, P. A., Stephens, D. A., and Rossi, J. J. Ribozymes as pot ential anti-HIV-1 th erapeutic agents Science. 1990; 247: 1222-1225. 223 Yu, M., Ojwang, J., Yamada, O., Hampel, A ., Rapapport, J., Looney, D., and Wong-Staal, F. A hairpin ribozyme inhibits expression of diverse strain s of human immunodeficiency virus type 1 Proc.Natl.Acad.Sci.U.S.A. 1993; 90: 6340-6344. 224 Forster, A. C. and Symons, R. H. Self-c leavage of virusoid RNA is performed by the proposed 55-nucleotide activ e site Cell. 1987; 50: 9-16. 225 Haseloff, J. and Gerlach, W. L. Simple RNA enzymes with new and highly specific endoribonuclease activities Nature. 1988; 334: 585-591. 226 Uhlenbeck, O. C. A small catalytic oligoribonucleotide Nature. 1987; 328: 596-600. 227 Conaty, J., Hendry, P., and Lockett, T. Selected classes of minimised hammerhead ribozyme have very high cleavage rates at low Mg2+ concentration Nucleic Acids Res. 1999; 27: 2400-2407. 228 Hammann, C. and Lilley, D. M. Folding and activity of the hammerhead ribozyme Chembiochem. 2002; 3: 690-700. 229 Persson, T., Hartmann, R. K., and Eckstein, F. Selection of hammerhead ribozyme variants with low Mg2+ requirement: importance of stem-loop II Chembiochem. 2002; 3: 10661071. 230 Lavrovsky, Y., Chen, S., and Roy, A. K. Therap eutic potential and me chanism of action of oligonucleotides and ribozymes Biochem.Mol.Med. 1997; 62: 11-22. 231 Scherer, L. J. and Rossi, J. J. Approach es for the sequence-sp ecific knockdown of mRNA Nat.Biotechnol. 2003; 21: 1457-1465. 232 Jackson, A. L. and Linsley, P. S. Noise amidst the silence: off-target effects of siRNAs? Trends Genet. 2004; 20: 521-524.

PAGE 161

161 233 Drenser, K. A., Timmers, A. M., Hauswirt h, W. W., and Lewin, A. S. Ribozyme-targeted destruction of RNA associated with autosomal-dominant retinitis pigmentosa Invest Ophthalmol.Vis.Sci. 1998; 39: 681-689. 234 Lewin, A. S., Drenser, K. A., Hauswirth, W. W., Nishikawa, S., Yasu mura, D., Flannery, J. G., and LaVail, M. M. Ribozyme rescue of phot oreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa Nat.Med. 1998; 4: 967-971. 235 Kurreck, J. Antisense technologies. Improve ment through novel chemical modifications Eur.J.Biochem. 2003; 270: 1628-1644. 236 Sledz, C. A., Holko, M., de Veer, M. J., S ilverman, R. H., and Williams, B. R. Activation of the interferon system by short-interfering RNAs Nat.Cell Biol. 2003; 5: 834-839. 237 Kashani-Sabet, M., Funato, T., Florenes , V. A., Fodstad, O., and Scanlon, K. J. Suppression of the neoplastic phenotype in vi vo by an anti-ras ribozyme Cancer Res. 1994; 54: 900-902. 238 Leopold, L. H., Shore, S. K., Newkirk, T. A., Reddy, R. M., and Reddy, E. P. Multi-unit ribozyme-mediated cleavage of bcr-abl mRNA in myeloid leukemias Blood. 1995; 85: 2162-2170. 239 Bauer, G., Valdez, P., Kearns, K., Bahner, I., Wen, S. F., Zaia, J. A., and Kohn, D. B. Inhibition of human immunodeficiency virus-1 (HIV-1) replication after transduction of granulocyte colony-stimulating factor-mobilized CD34+ cells from HIV-1-infected donors using retroviral vectors containing anti-HIV-1 genes Blood. 1997; 89: 2259-2267. 240 Welch, P. J., Tritz, R., Yei, S., Leavitt, M., Yu, M., and Barber, J. A potential therapeutic application of hairpin ribozymes: in vitro and in vivo studies of gene therapy for hepatitis C virus infection Gene Ther. 1996; 3: 994-1001. 241 Gorbatyuk, M. S., Pang, J. J., Thomas, J., Jr., Hauswirth, W. W., and Lewin, A. S. Knockdown of wild-type mouse rhodopsin using an AAV vectored ribozyme as part of an RNA replacement approach Mol.Vis. 2005; 11: 648-656. 242 Liu, J., Timmers, A. M., Lewin, A. S., a nd Hauswirth, W. W. Ribozyme knockdown of the gamma-subunit of rod cGMP phosphodiesterase a lters the ERG and retinal morphology in wild-type mice Invest Ophtha lmol.Vis.Sci. 2005; 46: 3836-3844. 243 Qi, X., Lewin, A. S., Hauswirth, W. W., and Guy, J. Optic neuropathy induced by reductions in mitochondrial superoxide dism utase Invest Ophthalmol.Vis.Sci. 2003; 44: 1088-1096. 244 Qi, X., Lewin, A. S., Hauswirth, W. W., a nd Guy, J. Suppression of complex I gene expression induces optic neuropa thy Ann.Neurol. 2003; 53: 198-205. 245 Berns, K. I. and Giraud, C. Bi ology of adeno-associated virus Curr.Top.Microbiol.I mmunol. 1996; 218: 1-23.

PAGE 162

162 246 Lu, Y. Recombinant adeno-associated virus as delivery vector for gene therapy--a review Stem Cells Dev. 2004; 13: 133-145. 247 Kotin, R. M., Linden, R. M., and Berns, K. I. Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination EMBO J. 1992; 11: 5071-5078. 248 Atchison, R. W., Casto, B. C., and Hammon, W. M. Adenovirus-associated defective virus particles Science. 1965; 149: 754-756. 249 Bantel-Schaal, U. and zur, Hausen H. Ch aracterization of the DNA of a defective human parvovirus isolated from a geni tal site Virology. 1984; 134: 52Z-63. 250 Gao, G., Vandenberghe, L. H., Alvira, M. R ., Lu, Y., Calcedo, R., Zhou, X., and Wilson, J. M. Clades of Adeno-associated viruses are wi dely disseminated in human tissues J.Virol. 2004; 78: 6381-6388. 251 Gao, G., Vandenberghe, L. H., and Wilson, J. M. New recombinant serotypes of AAV vectors Curr.Gene Ther. 2005; 5: 285-297. 252 Hoggan, M. D., Blacklow, N. R., and Rowe, W. P. Studies of small DNA viruses found in various adenovirus preparations : physical, biological, and immunological characteristics Proc.Natl.Acad.Sci.U.S.A. 1966; 55: 1467-1474. 253 Mori, S., Wang, L., Takeuchi, T., and Kanda, T. Two novel adeno-associated viruses from cynomolgus monkey: pseudotyping characteriza tion of capsid protein Virology. 2004; 330: 375-383. 254 Rutledge, E. A., Halbert, C. L., and Russell, D. W. Infectious clone s and vectors derived from adeno-associated virus (AAV) serotypes other than AAV type 2 J.Virol. 1998; 72: 309-319. 255 Schmidt, M., Grot, E., Cervenka, P., Wainer, S ., Buck, C., and Chiorini, J. A. Identification and characterization of novel adeno-associated virus isolates in ATCC virus stocks J.Virol. 2006; 80: 5082-5085. 256 Rabinowitz, J. E. and Samulski, J. Adeno-a ssociated virus expression systems for gene transfer Curr.Opin.Biotechnol. 1998; 9: 470-475. 257 Flotte, T. R. Gene therapy progress and pr ospects: recombinant adeno-associated virus (rAAV) vectors Gene Ther. 2004; 11: 805-810. 258 Muzyczka, N. Use of adeno-associated vi rus as a general transduction vector for mammalian cells Curr.Top.Micro biol.Immunol. 1992; 158: 97-129. 259 Le Meur, G., Weber, M., Pereon, Y., Mendes-Ma deira, A., Nivard, D., Deschamps, J. Y., Moullier, P., and Rolling, F. Postsurgical a ssessment and long-term safety of recombinant

PAGE 163

163 adeno-associated virus-mediated gene transf er into the retinas of dogs and primates Arch.Ophthalmol. 2005; 123: 500-506. 260 Auricchio, A., Kobinger, G., Anand, V., H ildinger, M., O'Connor, E., Maguire, A. M., Wilson, J. M., and Bennett, J. Exchange of su rface proteins impacts on viral vector cellular specificity and transduction characteristics: the retina as a model Hum.Mol.Genet. 2001; 10: 3075-3081. 261 Auricchio, A. Pseudotyped AAV vectors for co nstitutive and regulated gene expression in the eye Vision Res. 2003; 43: 913-918. 262 Rabinowitz, J. E. and Samulski, R. J. Vector biophysics: crystal-cl ear view Gene Ther. 2002; 9: 1413-1414. 263 Yang, G. S., Schmidt, M., Yan, Z., Lindbloom, J. D., Harding, T. C., Donahue, B. A., Engelhardt, J. F., Kotin, R., and Davidson, B. L. Virus-mediated transduction of murine retina with adeno-associated virus: effects of viral capsid and genome size J.Virol. 2002; 76: 7651-7660. 264 Xiao, W., Chirmule, N., Berta, S. C., Mc Cullough, B., Gao, G., and Wilson, J. M. Gene therapy vectors based on adeno-associat ed virus type 1 J.Virol. 1999; 73: 3994-4003. 265 Weber, M., Rabinowitz, J., Provost, N., Conr ath, H., Folliot, S., Briot, D., Cherel, Y., Chenuaud, P., Samulski, J., Moullier, P., and Rolling, F. Recombinant adeno-associated virus serotype 4 mediates unique and exclusiv e long-term transduction of retinal pigmented epithelium in rat, dog, and nonhuman primate afte r subretinal delivery Mol.Ther. 2003; 7: 774-781. 266 Ali, R. R., Reichel, M. B., Thrasher, A. J., Levinsky, R. J., Kinnon, C., Kanuga, N., Hunt, D. M., and Bhattacharya, S. S. Gene transfer into the mouse retina mediated by an adenoassociated viral vector Hu m.Mol.Genet. 1996; 5: 591-594. 267 Ali, R. R., Reichel, M. B., De Alwis, M ., Kanuga, N., Kinnon, C., Levinsky, R. J., Hunt, D. M., Bhattacharya, S. S., and Thrasher, A. J. Ad eno-associated virus gene transfer to mouse retina Hum.Gene Ther. 1998; 9: 81-86. 268 Dudus, L., Anand, V., Acland, G. M., Chen, S. J., Wilson, J. M., Fisher, K. J., Maguire, A. M., and Bennett, J. Persistent transgene pr oduct in retina, optic nerve and brain after intraocular injection of r AAV Vision Res. 1999; 39: 2545-2553. 269 Liang, F. Q., Dejneka, N. S., Cohen, D. R., Krasnoperova, N. V., Lem, J., Maguire, A. M., Dudus, L., Fisher, K. J., and Bennett, J. AAVmediated delivery of ciliary neurotrophic factor prolongs photoreceptor survival in the rhodopsin knockout mouse Mol.Ther. 2001; 3: 241-248. 270 Martin, K. R., Klein, R. L., and Quigley, H. A. Gene delivery to the eye using adenoassociated viral vector s Methods. 2002; 28: 267-275.

PAGE 164

164 271 Smith, J. R., Verwaerde, C., Rolling, F., Naud, M. C., Delanoye, A., Thillaye-Goldenberg, B., Apparailly, F., and De Kozak, Y. Tetracyc line-inducible viral inte rleukin-10 intraocular gene transfer, using adeno-associated virus in experimental auto immune uveoretinitis Hum.Gene Ther. 2005; 16: 1037-1046. 272 Acland, G. M., Aguirre, G. D., Ray, J., Zhang, Q., Aleman, T. S., Cideciyan, A. V., PearceKelling, S. E., Anand, V., Zeng, Y., Maguire, A. M., Jacobson, S. G., Hauswirth, W. W., and Bennett, J. Gene therapy restores visi on in a canine model of childhood blindness Nat.Genet. 2001; 28: 92-95. 273 Bennett, J., Maguire, A. M., Cideciyan, A. V., Schnell, M., Glover, E., Anand, V., Aleman, T. S., Chirmule, N., Gupta, A. R., Huang, Y ., Gao, G. P., Nyberg, W. C., Tazelaar, J., Hughes, J., Wilson, J. M., and Jacobson, S. G. Stable transgene expression in rod photoreceptors after recombinant adeno-associat ed virus-mediated gene transfer to monkey retina Proc.Natl.Acad.Sci.U.S.A. 1999; 96: 9920-9925. 274 Ho, T. T., Maguire, A. M., Aguirre, G. D., Surace, E. M., Anand, V., Zeng, Y., Salvetti, A., Hopwood, J. J., Haskins, M. E., and Bennett, J. Phenotypic rescue after adeno-associated virus-mediated delivery of 4-sulfatase to the retinal pigment epithelium of feline mucopolysaccharidosis VI J.Gene Med. 2002; 4: 613-621. 275 Alder, V. A. and Cringle, S. J. The effect of the retinal circulation on vitreal oxygen tension Curr.Eye Res. 1985; 4: 121-129. 276 Anderson, R. E., Kretzer, F. L., and Rapp, L. M. Free radicals and ocular disease Adv.Exp.Med.Biol. 1994; 366: 73-86. 277 Boulton, M., Rozanowska, M., and Ro zanowski, B. Retinal photodamage J.Photochem.Photobiol.B. 2001; 64: 144-161. 278 Rozanowska, M., Jarvis-Evans, J., Korytowski, W., Boulton, M. E., Burke, J. M., and Sarna, T. Blue light-induced reactivity of retinal age pigment. In vitro generation of oxygen-reactive species J.Bi ol.Chem. 1995; 270: 18825-18830. 279 Gottsch, J. D., Pou, S., Bynoe, L. A., and Rosen, G. M. Hematogenous photosensitization. A mechanism for the development of ag e-related macular degeneration Invest Ophthalmol.Vis.Sci. 1990; 31: 1674-1682. 280 Bazan, N. G. The metabolism of omega-3 pol yunsaturated fatty acids in the eye: the possible role of docosahexaenoic acid and doc osanoids in retinal physiology and ocular pathology Prog.Clin.Biol.Res. 1989; 312: 95-112. 281 Tate, D. J., Jr., Miceli, M. V., and Newsome, D. A. Phagocytosis and H2O2 induce catalase and metallothionein gene expression in human retinal pigment epit helial cells Invest Ophthalmol.Vis.Sci. 1995; 36: 1271-1279. 282 Espinosa-Heidmann, D. G., Suner, I. J., Catanut o, P., Hernandez, E. P., Marin-Castano, M. E., and Cousins, S. W. Cigarette smoke-relate d oxidants and the development of sub-RPE

PAGE 165

165 deposits in an experimental animal model of dry AMD Invest Ophthalmol.Vis.Sci. 2006; 47: 729 -737. 283 Crabb, J. W., Miyagi, M., Gu, X., Shadrach, K., West, K. A., Sakaguchi, H., Kamei, M., Hasan, A., Yan, L., Rayborn, M. E., Salomon, R. G., and Hollyfield, J. G. Drusen proteome analysis: an approach to the etiol ogy of age-related macular degeneration Proc.Natl.Acad.Sci.U.S.A. 2002; 99: 14682-14687. 284 Atalla, L., Fernandez, M. A., and Rao, N. A. Immunohistochemical localization of catalase in ocular tissue Curr.Eye Res. 1987; 6: 1181-1187. 285 Atalla, L. R., Sevanian, A., and Rao, N. A. Immunohistochemi cal localization of glutathione peroxidase in ocular tissue Curr.Ey e Res. 1988; 7: 1023-1027. 286 Atalla, L. R., Sevanian, A., and Rao, N. A. Immunohistochemi cal localization of peroxidative enzymes in ocular tissue CLAO J. 1990; 16: S30-S33. 287 Penn, J. S., Naash, M. I., and Anderson, R. E. Effect of light histor y on retinal antioxidants and light damage susceptibility in the rat Exp.Eye Res. 1987; 44: 779-788. 288 Rao, N. A., Thaete, L. G., Delmage, J. M ., and Sevanian, A. Supe roxide dismutase in ocular structures Invest Opht halmol.Vis.Sci. 1985; 26: 1778-1781. 289 Huang, T. T., Carlson, E. J., Kozy, H. M., Ma ntha, S., Goodman, S. I., Ursell, P. C., and Epstein, C. J. Genetic modification of prenat al lethality and dilate d cardiomyopathy in Mn superoxide dismutase mutant mice Free Radic.Biol.Med. 2001; 31: 1101-1110. 290 Lebovitz, R. M., Zhang, H., Vogel, H., Cartwr ight, J., Jr., Dionne, L., Lu, N., Huang, S., and Matzuk, M. M. Neurodegeneration, myo cardial injury, and perinatal death in mitochondrial superoxide dismutase-deficien t mice Proc.Natl.Acad.Sci.U.S.A. 1996; 93: 9782-9787. 291 Li, Y., Huang, T. T., Carlson, E. J., Melov, S ., Ursell, P. C., Olson, J. L., Noble, L. J., Yoshimura, M. P., Berger, C., Chan, P. H., Wallace, D. C., and Epstein, C. J. Dilated cardiomyopathy and neonatal lethality in mu tant mice lacking manganese superoxide dismutase Nat.Genet. 1995; 11: 376-381. 292 Sandbach, J. M., Coscun, P. E., Grossniklaus, H. E., Kokoszka, J. E., Newman, N. J., and Wallace, D. C. Ocular pathology in mitochond rial superoxide dismutase (Sod2)-deficient mice Invest Ophthalmol.V is.Sci. 2001; 42: 2173-2178. 293 Timmers, A. M., Zhang, H., Squitieri, A., and Go nzalez-Pola, C. Subretinal injections in rodent eyes: effects on electr ophysiology and histology of rat retina Mol.Vis. 2001; 7: 131137. 294 Anuradha, C. D., Kanno, S., and Hirano, S. Oxidative damage to mitochondria is a preliminary step to caspase-3 activation in fl uoride-induced apoptosis in HL-60 cells Free Radic.Biol.Med. 2001; 31: 367-373.

PAGE 166

166 295 Wyllie, A. H. Glucocorticoid-induced thymoc yte apoptosis is associated with endogenous endonuclease activation Na ture. 1980; 284: 555-556. 296 Shen, J., Yang, X., Dong, A., Petters, R. M ., Peng, Y. W., Wong, F., and Campochiaro, P. A. Oxidative damage is a potential cause of cone cell death in retinitis pigmentosa J.Cell Physiol. 2005; 203: 457-464. 297 Kapphahn, R. J., Giwa, B. M., Berg, K. M ., Roehrich, H., Feng, X., Olsen, T. W., and Ferrington, D. A. Retinal proteins modi fied by 4-hydroxynonenal: identification of molecular targets Exp.Eye Res. 2006; 83: 165-175. 298 Esterbauer, H., Schaur, R. J., and Zolln er, H. Chemistry and biochemistry of 4hydroxynonenal, malonaldehyde and related al dehydes Free Radic.Bi ol.Med. 1991; 11: 81128. 299 Dunaief, J. L., Dentchev, T., Ying, G. S., and Milam, A. H. The role of apoptosis in agerelated macular degeneration Arch.Ophthalmol. 2002; 120: 1435-1442. 300 Bailey, T. A., Kanuga, N., Romero, I. A., Greenwood, J., Luthert, P. J., and Cheetham, M. E. Oxidative stress affects the junctional integr ity of retinal pigment epithelial cells Invest Ophthalmol.Vis.Sci. 2004; 45: 675-684. 301 Cai, J., Wu, M., Nelson, K. C., Sternberg, P., Jr., and Jones, D. P. Oxidant-induced apoptosis in cultured human retinal pigment epithelial cells Invest Ophthalmol.Vis.Sci. 1999; 40: 959-966. 302 Zeitz, O., Schlichting, L., Richard, G., and Stra uss, O. Lack of anti oxidative properties of vitamin C and pyruvate in cultured retin al pigment epithelial cells Graefes Arch.Clin.Exp.Ophthalmol. 2006; 303 Kasahara, E., Lin, L. R., Ho, Y. S., and Reddy, V. N. SOD2 protects against oxidationinduced apoptosis in mouse retinal pigment epithelium: implications for age-related macular degeneration Invest Opht halmol.Vis.Sci. 2005; 46: 3426-3434. 304 Gosbell, A. D., Stefanovic, N., Scurr, L. L., Pe te, J., Kola, I., Favilla, I., and de Haan, J. B. Retinal light damage: structural and functi onal effects of the antioxidant glutathione peroxidase-1 Invest Ophtha lmol.Vis.Sci. 2006; 47: 2613-2622. 305 de Haan, J. B., Bladier, C., Griffiths, P., Kelner, M., O'Shea, R. D., Cheung, N. S., Bronson, R. T., Silvestro, M. J., Wild, S., Zheng, S. S., Beart, P. M., Hertzog, P. J., and Kola, I. Mice with a homozygous null mu tation for the most abundant glutathione peroxidase, Gpx1, show increase d susceptibility to the oxida tive stress-inducing agents paraquat and hydrogen peroxide J. Biol.Chem. 1998; 273: 22528-22536. 306 Green, W. R., McDonnell, P. J., and Yeo, J. H. Pathologic features of senile macular degeneration Ophthalm ology. 1985; 92: 615-627.

PAGE 167

167 307 Spraul, C. W., Lang, G. E., and Grossniklaus, H. E. Morphometric analysis of the choroid, Bruch's membrane, and retinal pigment epithe lium in eyes with age-related macular degeneration Invest Ophthalm ol.Vis.Sci. 1996; 37: 2724-2735. 308 Cideciyan, A. V., Hood, D. C., Huang, Y., Bani n, E., Li, Z. Y., Stone, E. M., Milam, A. H., and Jacobson, S. G. Disease sequence from mutant rhodopsin allele to rod and cone photoreceptor degeneration in man Proc .Natl.Acad.Sci.U.S.A. 1998; 95: 7103-7108. 309 Vaughan, D. K., Coulibaly, S. F., Darrow, R. M., and Organisciak, D. T. A morphometric study of light-induced damage in transgenic rat models of retinitis pigmentosa Invest Ophthalmol.Vis.Sci. 2003; 44: 848-855. 310 Li, Z. Y., Jacobson, S. G., and Milam, A. H. Autosomal dominant retinitis pigmentosa caused by the threonine-17-methionine rhodops in mutation: retina l histopathology and immunocytochemistry Exp.Eye Res. 1994; 58: 397-408. 311 Schomburg, L., Schweizer, U., and Kohrle, J. Selenium and selenoproteins in mammals: extraordinary, essential, enigmatic Cell Mol.Life Sci. 2004; 61: 1988-1995. 312 Yamashita, H., Horie, K., Yamamoto, T., Na gano, T., and Hirano, T. Light-induced retinal damage in mice. Hydrogen peroxide production and superoxide dismutase activity in retina Retina. 1992; 12: 59-66. 313 Stone, W. L., Katz, M. L., Lurie, M., Marmor, M. F., and Dratz, E. A. Effects of dietary vitamin E and selenium on light damage to the rat retina Photochem.Photobiol. 1979; 29: 725-730. 314 Shimayama, T., Nishikawa, S., and Taira, K. Generality of the NUX rule: kinetic analysis of the results of systematic mutations in the trinucleotide at the cleavage site of hammerhead ribozymes Biochemistry. 1995; 34: 3649-3654. 315 Fedor, M. J. and Uhlenbeck, O. C. Kine tics of intermolecular cleavage by hammerhead ribozymes Biochemistry. 1992; 31: 12042-12054. 316 Hertel, K. J., Herschlag, D., and Uhle nbeck, O. C. A kinetic and thermodynamic framework for the hammerhead ribozyme reaction Biochemistry. 1994; 33: 3374-3385. 317 Shaw, L. C., Afzal, A., Lewin, A. S., Timmers, A. M., Spoerri, P. E., and Grant, M. B. Decreased expression of the insulin-like grow th factor 1 receptor by ribozyme cleavage Invest Ophthalmol.Vis.Sci. 2003; 44: 4105-4113. 318 Kinnula, V. L. Focus on antioxidant enzymes and antioxidant strategi es in smoking related airway diseases Thorax. 2005; 60: 693-700. 319 Lei, X. G. Glutathione pe roxidase-1 gene knockout on body antioxidant defense in mice Biofactors. 2001; 14: 93-99.

PAGE 168

168 320 Imai, H. and Nakagawa, Y. Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx, GPx4) in mammalian ce lls Free Radic.Biol.Med. 2003; 34: 145-169. 321 Yant, L. J., Ran, Q., Rao, L., Van Remmen, H ., Shibatani, T., Belter, J. G., Motta, L., Richardson, A., and Prolla, T. A. The se lenoprotein GPX4 is essential for mouse development and protects from radiati on and oxidative damage insults Free Radic.Biol.Med. 2003; 34: 496-502. 322 Johnson, P. T., Betts, K. E., Radeke, M. J ., Hageman, G. S., Anderson, D. H., and Johnson, L. V. Individuals homozygous for the age-re lated macular degene ration risk-conferring variant of complement factor H have el evated levels of CRP in the choroid Proc.Natl.Acad.Sci.U.S.A. 2006; 103: 17456-17461. 323 Zhou, J., Jang, Y. P., Kim, S. R., and Sparrow, J. R. Complement activation by photooxidation products of A2E, a lipofuscin c onstituent of the retinal pigment epithelium Proc.Natl.Acad.Sci.U.S.A. 2006; 103: 16182-16187. 324 Feeney-Burns, L., Hilderbrand, E. S., and El dridge, S. Aging human RPE: morphometric analysis of macular, equatorial, and periphe ral cells Invest Ophtha lmol.Vis.Sci. 1984; 25: 195-200. 325 King, A., Gottlieb, E., Brooks, D. G., Murphy, M. P., and Dunaief, J. L. Mitochondriaderived reactive oxygen species mediate blue light-induced death of retinal pigment epithelial cells Photochem. Photobiol. 2004; 79: 470-475. 326 Ou, B. and Huang, D. Fluorescent approach to quantitation of reactive oxygen species in mainstream cigarette smoke Anal.Chem. 2006; 78: 3097-3103. 327 Dunaief, J. L. Iron induced oxidative damage as a potential factor in age-related macular degeneration: the Cogan Lecture Invest Ophthalmol.Vis.Sci. 2006; 47: 4660-4664.

PAGE 169

169 BIOGRAPHICAL SKETCH Verline Justilien was born in Port-de-Pa ix, Haiti, on August 21, 1979, to Wilson and Oversine Justilien. Verline moved to Fort Laude rdale, FL, in summer of 1987. She attended Ely High School where she participated in the medical Sciences magnet program which helped her to develop a serious interest in research. After graduating from high school in 1997, she moved to Gainesville, Florida and attended the University of Florida. She further pu rsued her interest in research by participating in the McNair Schola rs program and conducted research in molecular biology under the guidance of Dr. Francis Davis. In the spring of 2001, sh e earned a Bachelor of Science in Microbiology and Cell Science from th e University of Florida. In August of 2001, she began graduate studies in the College of Medici ne’s Interdisciplinary Program of Biomedical Sciences to pursue her Doctorate of Philos ophy degree. Verline conducted her dissertation research under the guidance and mentorship of Dr. Alfred Lewin. Verline married her long time sweetheart of 9 years, Ajani Dunn, on September 16, 2006. Following the completion of her dissertation re search, Verline plans to pursue further training as a post-doctoral researcher.