Citation
Cardiomyocyte Differentiation and Heterogeneity of Murine Embryonic Stem Cells

Material Information

Title:
Cardiomyocyte Differentiation and Heterogeneity of Murine Embryonic Stem Cells
Creator:
SINGH, AMAR M. ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Cell lines ( jstor )
Cells ( jstor )
Embryonic stem cells ( jstor )
Embryos ( jstor )
Endoderm ( jstor )
In vitro fertilization ( jstor )
Journalism ( jstor )
Myocardium ( jstor )
Polymerase chain reaction ( jstor )
RNA ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Amar M. Singh. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
12/31/2007

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

1 CARDIOMYOCYTE DIFFERENTIATION AND HETEROGENEITY OF MURINE EMBRYONIC STEM CELLS By AMAR M. SINGH A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

2 Copyright 2006 by Amar M. Singh

PAGE 3

3 To my loving parents and wife for all of their continuous suppor t and encouragement

PAGE 4

4 ACKNOWLEDGMENTS I would first like to thank my mentor, Dr. Na ohiro Terada. Dr. Terada truly exemplifies the word “mentor.” His constant wisdom, guida nce, and friendship are the reasons for any success I have had in my graduate career. Wo rds alone cannot expres s my gratitude towards him. I would next like to thank all of my committee members, Dr. Jorg Bungert, Dr. Brian Harfe, Dr. Hideko Kasahara, Dr. Paul Oh, and Dr. Steve Sugrue, for th eir continuous patience and assistance in my research. I would also like to thank our collaborator, Dr. Ken-Ichi Takemaru at StonyBrook University for all of his support Next, I would like to thank a ll of the members of Dr. Tera da’s lab, past, present, and future, whom all have made a significant impact on my graduate career and overall happiness. In particular, Dr. Takashi (Charlie) Hamazaki, who oversaw a large part of my technical development, but also Dr. Masahiro (Max) Ok a, Amy Meacham, Dr. Nemanja Rodic, Dr. Brad Willenberg, Michael Rutenberg, Sarah Kehoe, Jeffr ey Brower, Katherine Hankowski, and Isaac Boss. I would like to give a special th anks to my parents, Mangal a nd Kaishmati, and sister Devi, whose love, support, and encouragement are neve r ending. Finally, I would like to thank my beautiful and wonderful wife, Maureen. Wit hout her unconditional love, I would not be the person I am today.

PAGE 5

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS...............................................................................................................4 LIST OF TABLES................................................................................................................. ..........7 LIST OF FIGURES................................................................................................................ .........8 ABSTRACT....................................................................................................................... ............10 CHAPTER 1 INTRODUCTION..................................................................................................................12 Cardiovascular Diseases........................................................................................................ .12 Embryonic St em Cells........................................................................................................... .15 Historical Perspective......................................................................................................15 Self-Renewal of Mouse ESCs.........................................................................................16 Differentiation of ESCs...................................................................................................18 ESC differentiation to primitive endoderm..............................................................20 Gata-6 is a master regulator of PE formation...........................................................22 ESC differentiation to cardiomyocytes....................................................................23 ESCM as a treatment for cardiovascular disease.....................................................28 2 MATERIALS AND METHODS...........................................................................................34 Maintenance of Mouse ESCs..................................................................................................34 Differentiation of ESCs to Cardiomyocytes...........................................................................34 Chemical Activation of Wnt/ -catenin Signaling..................................................................35 Vectors, Transfections, and DNA Cloning.............................................................................35 Flow Cytometry and FluorescentAssisted Cell Sorting (FACS)...........................................39 Site-Directed Mutagenesis......................................................................................................39 RT-PCR......................................................................................................................... .........40 Real-Time PCR.................................................................................................................. .....41 Chromatin Immunoprecipitation (ChIP).................................................................................41 Immunoblotting................................................................................................................. .....42 Immunocytochemistry............................................................................................................43 Electrophoretic Mobility Shift Assays (EMSA).....................................................................43 Luciferase Assays.............................................................................................................. .....44 X-gal Staining................................................................................................................. ........44 -galactosidase Ac tivity Assays.............................................................................................45 Fluorescein di-D-Galactopyranoside (FDG) Staining of ESCs..........................................45 Gene Expression Profiling......................................................................................................46 Statistical Analyses........................................................................................................... ......46 3 RESULTS........................................................................................................................ .......50

PAGE 6

6 Chibby Facilitates Cardiomyocyte Diffe rentiation of Embryonic Stem Cells.......................50 The -catenin Antagonist, Chibby, is Ubiquitous ly Expressed in ESCs and in Early Lineage Specification, But is Gradually Downregulated During Differentiation.......50 High Cby Expression is Restri cted to Cardiomyocytes During Late Stages of Differentiation and Development................................................................................51 Cby Expression is Upregulated by the Ca rdiac Specific Transcription Factor, Nkx2.5......................................................................................................................... .52 Cby Antagonizes -catenin Activity in ESCs.................................................................53 Loss of Cby Inhibits Cardiomyocyte Differentiation of ESCs........................................53 Cby Overexpression Promotes Cardio myocyte Differentiation of ESCs........................55 Obstacles for ESCM Formation..............................................................................................56 Heterogeneity of Embryonic Stem Cells.........................................................................56 Nanog Represses Gata-6..................................................................................................57 Consistency in ESCM Differentiation.............................................................................59 4 DISCUSSION AND CONCLUSION....................................................................................95 Development of Pure, High Pe rcentage ESCM Populations..................................................95 Heterogeneity of ESCs.......................................................................................................... .99 Reproducibility of ESCM Formation...................................................................................102 Concluding Remarks............................................................................................................103 LIST OF REFERENCES.............................................................................................................105 BIOGRAPHICAL SKETCH.......................................................................................................115

PAGE 7

7 LIST OF TABLES Table page 2-1 Forward and Reverse Primers used for semi-quantitative RT-PCR.......................................47 3-1 Gene expression profile of ESC and PE genes by microarray analysis.................................90 3-2 Gene expression profile of cell cycle a nd mitotic genes by microarray analysis...................91 3-3 Gene expression profile of mito chondrial genes by microarray analysis...............................92 3-4 Gene expression profile of extracellula r matrix genes by microarray analysis......................93 3-5 Potential Nanog binding sites in the 5.5 kb Gata-6 promoter................................................94

PAGE 8

8 LIST OF FIGURES Figure page 1-1 Factors found to influence the differentia tion of Embryonic Stem (ES) cells to T+ Mesoderm progenitors and then to Embr yonic Stem Cell-derived Cardiomyocytes (ESCM)......................................................................................................................... .....33 3-1 Cby expression patterns during ESC differentiation..............................................................62 3-2 Lineage specific expression pr ofile of Cby and other markers..............................................63 3-3 Cby is expresse d in cardiomyocytes.......................................................................................64 3-4 Real-time PCR for Cby and Nkx2.5 in embryonic and adult mice hearts..............................65 3-5 Five putative Nkx2.5 binding sites are present in the mouse Cby 2 kb promoter sequence....................................................................................................................... ......66 3-6 Nkx2.5 can bind to both the proximal a nd distal binding site on the Cby promoter in vitro ............................................................................................................................... .....67 3-7 Nkx2.5 can activate the Cby promoter...................................................................................68 3-8 Cby inhibits -catenin activity...............................................................................................69 3-9 Wnt/ -catenin activators inhibit cardiac differentiation of ESCs...........................................70 3-10 An immunoblot showing Cby was successfully knocked-down by RNAi...........................71 3-11 In vitro differentiation of Cby RNAi clone show ed severely decreased differentiation and decreased number of beating embr yoid bodies, which could be rescued by reexpression of human Cby...............................................................................................72 3-12 Marker expression at early and late stages of Cby knockdown cells during differentiation by RT-PCR.................................................................................................73 3-13 Overexpression of Cby increases cardiomyocyte differentiation..........................................74 3-14 An increase in the percent MHC-GFP cells and cardiac marker expression when Cby is overexpressed.................................................................................................................. ...75 3-15 The percentage of cardiomyocytes when Cby is overexpressed only in the early or late stages of differentiation......................................................................................................76 3-16 Heterogeneous expression of Nanog.....................................................................................77 3-17 Separation and RNA expression of Nanoggeo heterogeneous cell types..........................78

PAGE 9

9 3-18 Immunocytochemisty of Nanog in R1 ESCs.........................................................................79 3-19 Microarray scatterplot an alysis across treatment...................................................................80 3-20 Gene expression profile analys is performed by GenUS Biosystems....................................81 3-21 Nanog overexpression reduces primitive endoderm and Gata-6 activity..............................82 3-22 Chromatin Immunoprecipitatio n (ChIP) of Nanog on the Gata-6 promoter in R1 ESCs.....83 3-23 Site-directed mutagenesis of the Nanog bi nding site, identified by ChIP (Figure 3-22) on the Gata-6 -galactosidase reporter..............................................................................84 3-24 Comparison of different lots of serum on the effect of ESC differentiation.........................85 3-25 Comparison of different lots of serum and the percentage of serum on the effect of EB attachment after 4 days of differentiation..........................................................................86 3-26 Comparison of different lots of serum and the percentage of serum on the effect of beating cardiomyocyte formati on during ESC differentiation...........................................87 3-27 Comparison of different serum concentr ations on the formation of MHC-GFP ESCMs by flow cytometry..............................................................................................................88 3-28 Comparison of different serum concentr ation on the percent cell death during ESC differentiation................................................................................................................ .....89

PAGE 10

10 Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CARDIOMYOCYTE DIFFERENTIATION AND HETEROGENEITY OF MURINE EMBRYONIC STEM CELLS By Amar M. Singh December 2006 Chair: Naohiro Terada Major Department: Medical Sc iences—Molecular Cell Biology Embryonic stem cell (ESC)-derived cardiomyocyt es are anticipated to serve as a useful source for future cell-based cardiovascular diseas e therapies. Research emphasis is currently focused on determining methods to direct the di fferentiation of ESCs to a large population of cardiomyocytes with high purity. To this aim, understanding the molecular mechanisms that control ESC to cardiomyocyte differentiation sh ould play a critical role to develop this methodology. The Wnt/ -catenin signaling pathway has been implicated in both embryonic cardiac development and in vitro ESC differentiation into cardiomyocytes. Chibby is a recently identified nuclear protein that directly binds to -catenin and antagonizes its transcriptional activity. We found that Chibby was ubiquitously expresse d in early stages of ESC differentiation but upregulated during cardiomyocyte specification. Of interest, the Chibby gene promoter has multiple binding sites for the cardiac-specifi c homeodomain protein, Nkx2.5, and its promoter activity was indeed positivel y regulated by Nkx2.5. Furthermore, overexpression of Chibby increased cardiac differentiation of ESCs, whereas loss of Chibby by RNAi impaired cardiomyocyte differentiation. These data illustra te the regulation and function of Chibby in facilitating cardiomyocyte differentiation from ESCs.

PAGE 11

11 There are many obstacles preventing the use of ESC-derived cardiomyocytes (ESCM) in the clinic, such as heterogeneit y. In addition to this difficult y, we have found that ESCs are actually a heterogeneous cell-type during normal ESC maintenance. Specifically, the expression of the ESC factor, Nanog, was not uniformly distributed in ESC colonies. Upon further investigation of the Nanog positive and negative cells, we found that the positive cells have increased expression for ESC f actors, cell-cycle genes, and mitochondrial genes, while the negative cells have increased expression for pr imitive endoderm markers, cell-cycle inhibitory genes, and extracellular matrix genes. These da ta suggest that there is natural heterogeneity during ESC maintenance, which may provide furt her complications in ESC-derived therapies. By revealing the molecular mechanisms that control ESC to cardiomyocyte differentiation, this study will allow for the future development of technologies to improve ESCM formation. Only through a more detailed understanding of the obstacles that prevent a high percent differentiation to ESCM, can we begin to remove th e barriers to the use of ESCM in the clinic.

PAGE 12

12 CHAPTER 1 INTRODUCTION Cardiovascular Diseases Cardiovascular diseases (CVD) are the leading cause of death in the United States for both men and women. Cardiovascular diseases has been th e leader in this ca tegory since 1900, with the exception of 1918, which was due to the influenza pandemic. It has been approximated that 2500 Americans die everyday from CVD, which is about 1 death every 35 seconds (American Heart Association). Cardiovascular diseases accounts for a multit ude of diseases including hypertensive diseases, coronary (ischemic) heart disease, pulm onary heart disease, vasc ular disease (stroke), and atherosclerosis. Together these diseases account for approximately $400 billion dollars in spending in the US on healthcar e every year (Thom et al., 20 06). CVD therefore places a significant strain on both healthcare system and on the US government. In the most severe forms of CVD, heart tran splantation may be the only viable option. The first human heart transplantation was performe d by Dr. Christiaan Barn ard in South Africa, while the first heart transplant in the United Stat es was performed at Stanford University by Dr. Norman Shumway (Hunt, 2006). While initially th e survival rates were very low due to postoperative complications, in rece nt years heart transplantatio n has proved to be a highly successful surgical procedure with a greater th an 75% 3-year survival rate for both men and women (Thom et al., 2006). However, one of the ma jor limitations of heart transplantation is the availability of donor hearts. In fact, of th e estimated 250,000 patients that may benefit from heart transplantations, only around 2000 are performed every y ear (Hunt, 2006; Thom et al., 2006; American Heart Association).

PAGE 13

13 To overcome the immense need of donor hearts , cell-based therapies have emerged as a promising new technology. In this therapy, stem cells or their differe ntiated progeny, may be injected into an ischemic area and thus be used as a treatment for cardiac injury and disease. In the future, this therapy may not completely repl ace the need for heart transplantation, but may be used as an alternative strategy for which c onventional therapeutics is not a satisfactory alternative. For example, a patient who is suffering from cardiac disease who does not quite meet the rigorous criteria to be a recipient of a do nor heart, may gain significant improvement from cell-based therapeutics as a tr eatment option. To date, several c linical trials have tested the use of various stem and progenitor cell types, including myoblast and bone marrow stem cells, as a treatment for CVD (Murry et al., 2005). Wh ile the results of thes e studies have been promising, the findings are still inconclusive becaus e of a lack of appropria te controls. In most cases, the results have found an improvement in patient condition such as a reduction in endsystolic and diastolic volumes, and an increase in ejection fraction. However, direct cardiac regeneration from these stem cells was not appare nt (Murry et al., 2005). More recent clinical trials have suggested that th e long term effects from bone ma rrow cell transplantation was not beneficial after an 18-month follow-up (Meyer et al., 2006). The original hopes were that these stem cells could transdifferentiate into cardiomyocytes, as suggested by multiple animal studies. However, findings previously thought to have arisen from transdifferentiation are now considered to be a consequence of rare cell-fusi on events (Terada et al, 2002; Ying et al., 2002; Alvarez-Dolado et al., 2003; Vass ilopoulos et al., 2003; Murry et al., 2004). Nonetheless, some studies show improvements in car diovascular function from adult stem cell mediated therapies and thus further larger scale investigations may be warrante d. Currently, the improvements mediated by the adult stem cells are thought to be due to non-cell autonomous “paracrine effect”.

PAGE 14

14 In particular, factors or cytokine s are believed to be secreted from the stem cells and to mediate a recovery in cardiovascular function (Murry et al., 2005). Although, it has not yet been tested clinically, the use of embryonic stem cells (ESCs) for treatmen t of CVD is thought to be a promising avenue for cell-based therapeutics in the future. The current paradigm is that large amounts of ESCs can be directly differentiated to cardiomyocytes in vitro , purified by gradient or other separation technologies, an d then directly injected into damaged myocardium. Animal studies have indeed shown this to be plausi ble technique, as implants with ESC-derived cardiomyocytes were found to functionally integr ate with the host tissue (Kehat et al., 2004; Xue. et al., 2005). In order for cell-based therapies to become a reality, the following requirements for a target cell population would be most ideal. First, the cell must be highly available for widespread clinical use “as an off-the-shelf reagent” (Murry et al ., 2005). This would then suggest that the cell should be tolerated by the immune system regardless of patient blood-type or HLA compatibility, and avoid potential dangers such as tumorigenesis. Seco nd, the cell-type would create new cardiomyocytes and largely repopul ate the damaged myocardium. The cells may achieve this by differentiation either in vitro or in vivo, and then by cellular transplantation. Adult stem cells are thought to “home” to the damaged area, so arterial injection may be a feasible approach. Alternatively, cells may be di rectly injected into the damaged myocardium. Also, if the cells are moderately proliferative af ter implantation, this may be of a further benefit to repopulate the damaged area. Third, the cell s should integrate well with the host tissue to create new vasculature and mini mize scar-tissue formation (Murry et al., 2005). An important consideration here is that the appropriate elec tromechanical coupling take place such to reduce the risk from arrhythmias. While no cell type cu rrently meets these criteria, further investigation

PAGE 15

15 may improve the opportunity to successfully develop a cell-based therapy in the future (Murry et al., 2005). Embryonic Stem Cells Historical Perspective The murine Embryonic Stem Cell (ESC) was first isolated in 1981 by Evans, Kaufman, and Martin (Evans and Kaufman, 1981; Martin, 1981.). Two defining characteristics of ESCs quickly emerged. First, these cells maintain the capacity for indefinite self-renewal in cell culture in the appropriate me dia composition, while maintaini ng a normal karyotype. Second, these cells are pluripotent; that is , they have the ability to differentiate into many different cell lineages. Indeed, ESCs have been shown to di fferentiate in almost every lineage, including neurons, osteocytes, chondrocytes , adipocytes, hepatocytes, a nd cardiomyocytes (Bain et al., 1995; Strubing et al., 1995; Buttery et al., 2001; Kramer et al., 2000; Dani et al., 1997; Hamazaki et al., 2001; Doetschman et al ., 1985; Maltsev et al., 1993). Th ese phenomena perpetuated the notion ESCs may become a useful tool in cell-based treatments. The much-anticipated isolation of human ESCs in 1998 by James Thomson’s group at the University of Wisconsin further magnified the hopes of those who imagined that ESCs may one day be useful for cell-based therapies (Thomson et al., 1998). These cells were also found to have the same characteristics as their murine counterparts. However, research with these cells has lead to significant political and ethical controversies, which prompted a ban on federal funding for the development of new human ESC lines. While these federal mandates ha ve somewhat hampered progress in this field, the allowance of federal funding fo r previously established cell lin es (prior to the 2001), have permitted continual research in this field. Although the potential for ESCs in a clinical envi ronment is clear, the use of these cells as a tool for basic science should also not be ove rlooked. For example, research on mouse ESCs

PAGE 16

16 has been absolutely essential fo r the establishment of knock-out and transgenic mice. Without these technologies, fundamenta l knowledge in embryonic development and gene function would be significantly decreased. Additionally, ESCs ha ve emerged as a useful tool in toxicology studies. Together the use of ES Cs for studying basic science and the use of ESCs in potential clinical treatments prompt furt her research in this field. Self-Renewal of Mouse ESCs The mechanisms that control self-renewal of mouse ESCs have been studied in significant detail. Initially, these cells were maintained on feeder laye rs of mouse embryonic fibroblasts. The identification of Leukemia Inhibitory Factor (LIF) in 1988, as the esse ntial factor secreted from the fibroblasts that maintain the mouse ESCs in the undifferentiated state, was the quintessential finding that perpetuated ESC resear ch (Smith et al., 1988; Williams et al., 1988). This finding allowed for the deve lopment of feeder-free systems to maintain ESCs in culture. Later findings showed that LIF mediates its e ffect through the activati on of LIF/gp130 receptors, which further activates JAK/STAT3 signaling (Zha ng et al., 1997; Niwa et al., 1998; Matsuda et al., 1999). Surprisingly, LIF was found not to promote hESC self-renewal (Thomson et al., 1988; Reubinoff et al., 2000). Othe r factors have also been fo und to be critical for ESC maintenance. These include the identification of the master transcriptional regulators Oct4, Sox2, and Nanog, and the secreted factor BMP4 (Niwa et al., 2000; Ambr osetti et al., 2000; Mitsui et al., 2003; Chambers et al., 2003; Ying et al., 2003). Two groups simultaneously reported the identif ication of Nanog as a factor found to be essential for ESC maintenance and pluripotency (Chambers et al., 2003; M itsui et al., 2003). This protein contains a homeobox domain, and is thus considered to be a DNA binding protein. Nanog does not have high homology to any other known proteins, but its closest relatives are those of the Nk-2 family. Nanog was found to be highly expressed in ES Cs, but then rapidly

PAGE 17

17 down-regulated during their diffe rentiation. Disruption of Nanog in murine ESCs rendered them incapable of differentiation to the mesoderm, trophoblast, primitive ectoderm, or neuroectoderm lineages, as detected by an inability to indu ce markers for T-brachyury, Cdx-2, Fgf-5, Islet-1, respectively. In addition, growth and morphology of the homozygote-null ESCs differed dramatically from the heterozygote or wild ty pe ESCs, as homozygotes c ould not be maintained for longer than 2 months (Mitsui et al., 2003). Also, markers of pluripotency, Oct4 and Rex1, were expressed at lower levels. Interestin gly, markers for primitive endoderm lineages were upregulated, suggesting that Nanog may function to repress these lin eages (Mitsui et al., 2003). Consistent with this data, embryos fro m Nanog knock-out mice completely lacked epiblasts and were composed entirely of di sorganized extraembryonic tissues, such as trophectoderm and primitive endoderm. Together this data suggests that Nanog is essential for ESC maintenance and pluripotency (Mitsui et al ., 2003). Additionally, since Oct4 null embryos do not form trophectoderm, while Nanog null do, this suggests that Nanog is required in the inner cell mass at a stage after ex pression of Oct4 (Nichols et al ., 1998; Niwa et al., 2000; Mitsui et al., 2003). Unlike the overexpression of Oct4, whic h induced differentiation, overexpression of Nanog did not (Niwa et al., 2000; Mitsui et al., 2003). In addition, removal of LIF, which normally leads to spontaneous differentiation, di d not affect ESCs with Nanog overexpressed. These cells could be maintained without change s in morphology or markers of pluripotentcy for longer than one month. Additionally, Stat -3 activation was not induced by Nanog overexpression, nor was Stat-3 downstream factors, such as Socs3, activated (Chambers et al., 2003). Nanog is thus not a downstream factor in LIF/Stat3 pathway, nor is simply able to activate this pathway. In terestingly, using Oct4 knockout ESCs , with a tetracycline-off (Tet-off)

PAGE 18

18 inducible system expressing Oct4 for ESC mainte nance, Nanog was shown to be incapable of compensating for the loss of Oct4 when tetracyc line was added. This suggests that both Nanog and Oct4 are required for ESC main tenance (Chambers et al., 2003). Similar to the removal of LIF, overexpression of Nanog can compensate for the removal of BMP or serum from standard cult ure conditions. However, the grow th rate is significantly lower when LIF is removed, but not when BMP is remove d. This suggests that LIF, but not BMP, may act in combination with Nanog (Chambers et al., 2003; Mitsui et al., 2003). Additionally, the downstream effector of BMP signaling, Id3, was f ound to be maintained or perhaps upregulated when Nanog is overexpressed and BMP is withdrawn. However, it remains to be determined if BMP regulates Nanog. Most likely, the relationship be tween BMP signaling and Nanog expression is indirect, as Nanog does not contain any clear Smad binding sites in its promoter region (Chambers et al., 2003). More recent evid ence has suggested that Oct4/Sox2 cooperate to regulate Nanog (Kuroda et al., 2005). While all 3 function in tande m as a network of factors to promote stem cell self-renewal by the activation of ge nes that promote ESC maintenance, and the repression of lineage-speci fic genes (Boyer et al., 2005). Differentiation of ESCs ESCs may be differentiated in a variety of wa ys. The most classical technique is by the use of the ‘hanging drop’ method (Doetschman et al., 1985). In this method, ESCs are dissociated into a suspension of single cells, and are then aggregat ed into droplets on the lids of Petri dishes in differentiation media not containing LIF. Afte r 2 days, the aggregated ESCs, termed ‘embryoid bodies’ (EBs) are plated on UV -irradiated bacterial dishes in suspension culture for 2 more days. At day 4, the EBs are pl ated onto gelatin-coated cell culture dishes and are allowed to differentiate further. The EBs will attach to the plates a nd form outgrowths. In these outgrowths, cells from all three germ laye rs become apparent. The first 4 days of EB

PAGE 19

19 development is said to recapitu late the early embryo. A well-defined primitive endoderm layer forms at the outer surface overlaying a baseme nt membrane. In the embryo, this primitive endoderm layer will go on to form the yolk sac. The inner cells of the EB also mirror embryonic development as they form an inner core of cel ls along with a cystic region of widespread apoptosis, which is similar to the epiblast in the embryo. In contrast, differentiation during the later days is disorganized and no structural organizati on at the tissue level can be determined. Cardiomyocytes will become a pparent starting around day 9-10 of differentiation, as they will form spontaneously beating regions within the embryoid body. The maximum peak of cardiomyocyte formation is normally at day 1215 of differentiation, depending on the ESC line used. Other methods to differentiate ESCs incl ude monolayer differentiation or suspension culture (bulk aggregation). In monolayer diffe rentiation, ESCs are simply plated on gelatincoated dishes, in the absence of LIF in differentiation media. The cells will differentiate into multiple lineages. In general, we have found th at in this method differentiation to AFP-positive primitive visceral endoderm is decreased, while Brachyury-positive mesendoderm is increased. In contrast, in suspension culture, ESCs are plat ed onto UV-irradiated bacterial dishes, such that they are incapable of attachment. In this me thod ESCs will aggregate spontaneously to form EBs. In gereral, EBs formed in this method are smaller and tend to be less spherical shaped. Nontheless, EBs generated from this method will al so differentiate into multiple cell lineages. Other methods have also been developed to mon itor the differentiation of ESCs, such as the use of Matrigel or by the formation of teratoma s, but are beyond the scope of this research investigation.

PAGE 20

20 ESC differentiation to primitive endoderm During embryonic development, the visceral en doderm (VE) and the parietal endoderm are derived from the hypoblast or primitive endoder m (PE). The parietal endoderm forms in association with the trophectode rm and assists in the development of Reichert’s membrane surrounding the embryo and later assists in forming th e placenta (Bielinska et al., 1999; Lu et al., 2001). The VE forms in association with the epiblast (inner cell ma ss) and along with the extraembryonic mesoderm to help form the yolk s ac. The two major functions of the VE are to first provide a mechanism for nutrient uptake and delivery, and second to influence embryonic epiblast development and patterning by the secret ion of various factors (Bielinska et al., 1999; Lu et al., 2001). VE differentiation can be readily observed dur ing the differentiation of ESCs using the hanging drop technique. VE cells cluster in the outer periphery of EBs after 2 days of differentiation (Hamazaki et al., 2004). Interesti ngly, when EBs are formed in the presence of LIF and serum (ESC maintenance media) we still find that the outer laye r has differentiated to visceral endoderm. This differentiation to VE was verified by aggregating ESCs expressing GFP driven by the alpha-fet oprotein (AFP-GFP) promoter in ESC maintenance media. GFP was clearly visible after 2 days in th e outer layer of EBs regardless of the presence of LIF (Hamazaki et al., 2004). By the use of FACS to isolat e the GFP positive and negative cell populations, RNA expression patterns showed that the negative pop ulation expressed markers for pluripotentcy, while the positive population had markers of primitive endoderm (Hamazaki et al., 2004). These data suggest that PE differentiation induced by cell aggregation occur independently of the LIF/Stat-3 and BMP signaling pathways . Additionally, ESCs that express -galactosidase under control of the endogenous Nanog promoter do not stain for -gal in the outer primitive endoderm

PAGE 21

21 layer when aggregated in LIF containing medi a (Hamazaki et al., 2004). This suggests that aggregation by itself is a cue for the downregul ation of Nanog in th e outer (PE) layer. To determine if forced Nanog expression can inhibit primitive endoderm differentiation, Nanog was inserted into ESCs under control of a te tracycline inducible syst em (Tet-off). In the presence of doxycycline, Nanog was not expressed and ESCs could not be maintained in the absence of LIF. However, without doxycycline, Nanog was expressed and could be maintained in LIF-free media (Hamazaki et al., 2004). Upon a ggregation of ESCs in LIF containing media by the hanging drop method, VE cells developed in the outer layer in the presence of doxycycline, but not in its absence (Hamakai et al., 2004). This data su ggests that when Nanog is overexpressed, ESCs are incapable of differen tiation towards the VE li neage. Additionally, this further suggests that Na nog may act as a repressor for specific endoderm genes. The mechanism by which Nanog downregulatio n occurs in the outer layer of ESC aggregates has been recently ascribed to the FGFR/Grb2/Ras/Mek/Erk signaling pathway (Hamazaki et al., 2006). The use of orthovanadate , a protein tyrosine phosphatase inhibitor, was found to promote differentiation to PE, while the us e of inhibitors against the FGFR or Mek was found to inhibit the differentiation to PE. Na nog RNA expression was subsequently found to be downregulated by orthovanadate, but then upregulated by the FGFR or Mek i nhibitors. Further evidence to support this pathway as the mechan ism of Nanog downregulation came from the use of Grb2 knockout ESCs which faile d to differentiate to PE after orthovanadate treament, as determined by the lack of marker expression for endoderm markers Gata-6, Gata-4, BMP2, and HNF4. Finally, when Nanog was overexpressed by an exogenous promoter, orthovanadate failed to induce differentiation to PE (Hamazaki et al., 2006). These data clearly establish the

PAGE 22

22 role of FGFR/Grb2/Ras/Mek/Erk pathway in the repression of Na nog to establish the differentiation to PE. Gata-6 is a master regulat or of PE formation Gata-6 is a member of the Gata family of tran scription factors. All members of this family contain two zinc-finger binding dom ains and serve as transcriptional activators or repressors depending on the cell-type and co-activator/co-re pressor involved. Expression of Gata factors are generally tissue-type specific, with Gata-6 found in many developing or gans such as heart, vasculature, and primitive endoderm (LaVoie, 2003). Gata-6 consists of a rather unique genomic structure. It consists of two promoters, two first exons (exon Ia and exon Ib), and two initiation codons which begin in exon 2. Thus, both a short form and long form seem to exist for the Gata6 protein, with the long form seeming to be mo re potent. However, there appears to be no diversity in cell or tissue e xpression between these two isof orms (Brewer et al., 1999). Gata-6 is considered to be a master regulat or for primitive endoderm differentiation. ESCs in which Gata-6 is overexpressed by use of a tetracycline inducible system forced the differentiation to the primitive endoderm lineage, as determined by morphology and detection of the upregulation of multiple endodermal genes su ch as Afp, Ttr, HNF3b, BMP2, Ihh, and ApoE. In addition, markers for pluripotency were downregulated, including Oct4, Rex1, and Sox2 (Fujikura et al., 2002). Furthermore, Gata-6 knockout embryos showed cellular defects in visceral endoderm morphologically and failed to develop markers of primitive endoderm. These knockout embryos were early embryonic lethal due to a failure of proper implantation. Gata-4 was found to be down-regulated in the Gata-6 k nockouts, while Gata-6 was up-regulated in the Gata-4 knockouts. This suggests that Gata-6 expression is upstream of Gata-4. Taking all of this data together suggests that Gata-6 may cont rol the differentiation towards primitive endoderm during normal embryonic development and by ESCs in culture (Fuji kura et al., 2002).

PAGE 23

23 Interestingly, during standard ESC culture, low le vels of Gata-6 expression can be detected by RT-PCR (Koutsourakis et al 1999; Fujikura et al., 2002). These da ta led to the threshold level model which suggests that for differentiation to primitive endoderm to occur, the expression of Gata-6 must exceed its basal level in ESCs. Addi tionally, it has been postulated that a repressor of Gata-6 is expressed in ESCs to maintain thes e cells in the undifferen tiated state and to keep Gata-6 below the threshold (Fu jikura et al., 2002). Nanog has been suggested to be this repressor for Gata-6 expression. Using SELEX to identify the DNA binding site for Nanog, a consensus sequence of (C/G)(G/A)(C/G)C(G/C)A TTAN(G/C) was determined (Mitsui et al., 2003). This binding site has been identified in the Gata-6 enahancer region several times, although not at 100%. Finally, since both Nanog-null ESCs and Gata-6 overexpression in ESCs lead to primitive endoderm differentiation, this suggests a potential relationship between Nanog and Gata-6. ESC differentiation to cardiomyocytes Investigating cardiomyocyte differe ntiation from ESCs is import ant for two reasons. First, cardiomyocyte differentiation from ESCs provides a useful tool to study the mechanisms that regulate myocyte development. In this regard, the roles of multiple pathways and factors have been determined to play a role in cardiomyoc yte development, which are described in detail below. Second, ESC-derived cardiomyocytes (ESC M) are considered to be a future potential source in cell-based therapeutics . Therefore, a detailed biochemical understanding of the attributes of these cells will be useful for clinical applications. Wnt/ -catenin and Chibby . The canonical Wnt/ -catenin signaling pathway has been found to be a critical cascade in multiple areas of cellular biology including differentiation and development, stem cell self-renewal, and tumori genesis (Nusse, 2005; Sato et al., 2004; Ogawa

PAGE 24

24 et al., 2006; Reya et al., 2003; Pe ifer, 1997). Briefly, this pathwa y is activated upon Wnt binding to its Frizzled receptor and Lrp5/6 co-receptor . This leads to the inactivation of the “ -catenin destruction complex”, which consists of se veral proteins, includi ng APC, Axin, and GSK3 . The mechanism of this inactivation has been ascribed to inhibition of GSK3 by Dishevelled and/or recruitment of Axin to the cell membrane by Lrp5/6 co -receptors and its subsequent degradation (Reya and Clevers, 2005; Zeng et al., 2005; Davidson et al., 2005). Regardless of the mechanism, -catenin is released from the destruction complex, where it now translocates to the nucleus and complexes with Tcf/Lef transcriptio n factors to activate dow nstream target genes. The Wnt/ -catenin signaling pathway has been desc ribed as being important for cardiac myocyte development from both in vivo and in vitro studies. Most studies have pointed to the inhibition of this pathway as necessary for car diac myocyte differentiation, proliferation, or repair. For example, in vivo studies using Xenopus or Mice with the Wnt antagonists, Dkk1 and sFRP, lead to enhanced cardiac development, or repair after myocardial infarction (Schneider and Mercola, 2001; Foley and Mercola, 2005; Barandon et al., 2003). Furthermore, the conditional deletion of -catenin in endoderm of mice lead s to ectopic heart development (Lickert et al., 2002). In contrast to the above reports, addition of Wnt3a has been suggested to induce cardiomyocyte differentiation of embryon ic carcinoma cells (Nak amura et al., 2003). But, this Wnt3a addition has been recently s uggested to improve cardi omyocyte differentiation in a temporally-regulated manner, where Wnt3a is critical during the very early stages of differentiation to mesoderm lineages and repressi ve during later stages of differentiation to cardiomyocytes (Koyanagi et al., 2005; Yamashita et al., 2005). Wnt11 has also been suggested to enhance cardiomyocyte differentiation (Terami et al., 2004). Unlike Wnt3a, Wnt11 has been shown to activate the non-canoni cal Wnt signaling pathway through JNK and PKC, and instead

PAGE 25

25 inhibit the canonical sign aling pathway through -catenin (Maye et al., 2004). Specifically, the addition of conditioned media containing Wnt11 to differentiating ESCs beginning after 4 days of differentiation was found to induce an appr oximate 2-fold increase in the number of cardiomyocytes (Terami et al., 2004). Chibby was identified in a pr otein-protein interaction sc reen (yeast Ras Recruitment System) using the C-terminal region of -catenin as bait (Takemar u et al., 2003). Chibby is a nuclear protein that is cons erved throughout evolution. Chibby competes with Tcf/Lef for binding to -catenin, and thus represses -catenin-mediated transcriptional activation. From northern blotting, chibby was found to be highly expressed in multiple human tissues including skeletal muscle, kidney, liver, pl acenta, and heart. The identification of chibby expression in heart tissue warranted the furt her study of this newly iden tified protein during cardiac differentiation. Other factors and pathways that reg ulate cardiomyocyte differentiation. In addition to the Wnt/ -catenin pathway, several other signali ng pathways and molecules have been suggested to play a role during cardiomyocyte differentiation of ESCs. An outline of the factors involved in this process is depict ed in Figure 1-1. Several factor s that have been shown to be involved in cardiomyocyte different iation are members of the TGFsuperfamily of genes. This family is composed of two subgroups the TGF/Activin group and the BMP/GDNF group. The growth factors in both of these groups are related structurally, but are subdivided based on their phylogeny (de Caestecker, 2004). In this pathwa y, a growth factor di mer ligand binds to a receptor. This leads to the receptor dimeriza tion and cross-phosphorylation. Smad factors are then recruited to the receptor where they also dimerize following phosphorylation. Activated Smad dimers will then translocate to the nucleus to activate downstream genes (de Caestecker,

PAGE 26

26 2004). Indeed growth factors from both of the TGFsuperfamily subgroups have been found to influence cardiomyocyte differentiation. Activin, fo r example, has been shown to be critical for T-brachyury+ mesendoderm lineages, in a concentration dependent manner. Where high levels of Activin promote definitive endoderm, moderate levels promote cardiac mesoderm, and low levels promote mesoderm of vascular and haem atopoietic lineages (Kelle r, 2005). Other groups have also shown the importance of factors such as BMP2 and TGF2 to promote cardiomyocyte differentiation as either a pre-inc ubation step prior to ESC differen tiation, or beginning at 2 days after differentiation (Behfar et al., 2002; Singl a and Sun, 2005; Bin et al., 2006). Conversely, it was reported that the BMP antagonist, N oggin, had a profound effect on cardiomyocyte differentiation. Specifically, if this factor wa s added for 3 days prior to EB formation and differentiation, this would lead to increased brachyury+ mesoderm cells, and subsequently this would lead to a 100-fold increase in ESCM form ation (Yuasa et al., 2005). Taking all of these data together suggest that the TGFsuperfamily plays an import ant role during differentiation and onset to precardiac mesoderm lineages. Other growth factors and their receptors have also been shown to affect cardiomyocyte differentiation. For example, factors such as Ig f-2 and Fgf2 have both been shown to promote ESCM formation (Morali et al., 2000; Kawai et al., 2004). Meanwhile, the ablation of the secreted factor, Cripto, in ESCs was found to be completely incompatible with differentiation to cardiomyocytes (Xu et al., 1998). Similarly, the deletion of the Fg fR1 also leads to defects in cardiomyocyte differentiation from ESCs (Dell’Er a et al., 2003). Other receptors have been shown to have the opposite effect. For example, the increased expression of the Notch receptor seems to inhibit cardiac differentiation, and its downregulation may then promote ESCM formation (Schroeder et al., 2006; Nemir et al ., 2006). Furthermore, primitive endoderm has

PAGE 27

27 itself been shown to promote cardiac differentia tion (Passier et al., 2005; Bader et al., 2001; Mummery et al., 2003). This is most likely due to a secretion of one or more factors that influence the cell lineage fate. Certain chemicals have also been shown to affect cardiomyocyte differentiation from ESCs. For example, it has been well documented that treatment with all-trans-retinoic acid at high concentrations will re press mesoderm formation and promote neuroectoderm differentiation, during early stages of differentia tion (Wobus et al., 1997). However, treatment with low concentrations during the later stages of differentiation may actually promote cardiac differentiation (Wobus et al., 1997). Recently, a chemical screen of 880 distinct compounds was performed in an attempt to iden tify factors that promote ESCM formation. When ESCs were differentiated in monolayer culture, ascorbic acid was identified to significantly promote differentiation to a cardiac phenotype (Takahashi et al., 2003). In subsequent findings the authors determined that the mechanism by which ascorbic acid promoted cardiac differentiation was through the enhancement of collagen synthesi s (Sato et al., 2006). Ni tric oxide has also been shown to facilitate cardiom yocyte differentiation. Through the sp ecific use of a nitric oxide donor chemical ( SNAP ), ESCs were found to have enha nced differentiation to ESCM. Treatment with this chemical also led to incr eased purity of ESCM, as non-cardiac cells could not survive (Kanno et al., 2004). Lastly, chemi cal inhibitors for diffe rent signaling pathways such as p38MapK, JAK/Stat, and PI3K have all been shown to hinder cardiomyocyte differentiation from ES cells (Aoua di et al., 2006; Foshay et al., 2005; Klinz et al., 1999; Sauer et al., 2000). In total, the mechanisms and pathways that control cardiomy ocyte differentiation of ESCs is particularly complex and likely rely on a large interplay of molecules and factors.

PAGE 28

28 Further work is still needed to identify other players in this process, and how the identified players interact and crosstalk with each other. ESCM as a treatment for cardiovascular disease As described briefly above, ESCM are thought to be one of the most promising cell-types for use in cell-based therapies for the rege neration of damaged myocardium following cardiovascular disease or injury. There are multiple advantages to using ESCM as opposed to other cell-types. However, at the same time , there are considerable drawbacks that are preventing ESCM from immediate clinical use. These advantages and disadvantages are described in detail below. Treatment for cardiovascular diseases with ES CM is considered to be advantageous for several reasons. Firstly, ESCs can be mainta ined and differentiated quite easily with the appropriate culture media compositions. This will allow for large amounts of ESCM to be prepared and to facilitate widespread usage. Second, since ESCM are prepared in vitro, we are not requiring signals from the endogenous tissue “to convert” the st em cells to the appropriate lineage. ESCM are terminally differentiated cell s that have been shown to be the functional equivalents cardiac myocytes isolat ed from heart tissue. Third, ESCM transplanted cells have been shown to functionally integrate in vivo with myocardium and may have low to moderate proliferative capacity. This charact eristic is considered to be hi ghly beneficial for treatment in cardiac disease in which a significa nt amount of myocardium may ne ed to be regenerated (Murry et al., 2005). While the advantages of ESCM as a treatment for cardiovascular disease are clear, there are many disadvantages which impede ESCM treat ment in an immediate therapeutic setting. One obstacle is the considerable ethical controve rsy with the use of huma n ESCs. The basis of this argument lies in the notion of whether it is acceptable to take a life in order to save a life.

PAGE 29

29 Conventional methods to develop human ESCs requi re the destruction of the embryo at the preimplantation blastocyst stage. Natu rally, these embryos are derived from in vitro fertilization, and not by direct isolation, as is performed in pr egnant mice. In almost all cases these embryos are the remains from unwanted embryos not to be utilized for implantation. These embryos may be otherwise discarded or simply stored perman ently in liquid nitrogen. Nonetheless, opponents of ESC research suggest that creation of human ESC lines requires the de struction of the embryo, which has the potential to be a life. Propone nts of ESC research have made the following counter-arguments. Embryos at such an early stage should not be considered alive as an organism, but rather only alive on the cellular level, like any cell line maintained in a laboratory. For example, a person may be pronounced dead when there is a cease in brain activity or function. Since an embryo does not have any neur al development, it should not be considered alive at the organism level. Alternatively, others have suggest ed that embryos should not be considered to be an “alive” until after implantation, as without implantation the embryo will not survive to develop further. Since these embr yos are not given the opportunity for implantation, they should not be considered alive (Landry and Zucker, 2004). Recently investigators have developed methods to try to avoid the crit icisms of “destroying life” by developing ESCs from embryos which would be incapable to develop into a full animal, by deleting a gene, CDX2, require d for trophectoderm formation. In vivo , the trophectoderm lineage is responsible for form ation of the placenta (Meissner and Jaenisch, 2006). Their argument was that this embryo did not have th e potential for life (as it could not form the placenta and then implant properly), and therefor e destroying the embryo should have no ethical conflicts. Other investigators cleverly showed that it was indeed possible to develop ESCs without actually destroying the embryo, and that th is embryo could then still give rise to mice

PAGE 30

30 (Chung et al., 2006). This was achieved by a single cell isolation of an 8cell stage blastomere embryo, and culturing this single cell to obtain an ESC colony. This has also more recently been suggested to be possible with human in vitro fertilized embryos, by the development of ESC lines from a single cell isolated from a blasto mere-stage embryo (Klimanskaya et al., 2006). Furthermore, it has been shown that ESC lines can be developed from “dead embryos” (Zhang et al., 2006). These embryos are consid ered to be dead, since they ha ve undergone a growth arrest, and are likely not to develop any further. Only time will tell how the me dia, public, and elected officials respond to these developments. Besides the ethical controversy, there are also technical and scientific problems with using ESCs for clinical treatments. One such problem with the use of ESCs in cell-based therapies is immune compatibility and rejection. Unlike adult stem cells, which may be technically harvested from a patient or a patient’s family me mber, and used for the appropriate treatment, ESCs cannot be isolated from a patient. Any ES C line would then not likely be tolerated by a patient’s immune system. Idea lly, the development of technologi es to create one or a few ESC lines that would be tolerated by a variety of patients with differe nt genetic backgrounds would be the best option. Alternatively, some have suggested the development of stem cell banks that we could go to when we need the appropriate compa tible line. Finally, the development of methods for reprogramming an adult somatic cell to pluri potent-like embryonic stem cells via somatic cell nuclear transfer (SCNT) or di rect dedifferentiation via reprog ramming factors will likely be useful to avoid the problems with immune compatibility (G urdon, 2006). While it has been shown that SCNT is an effective technique fo r reproductive cloning (clo ning for the purpose to develop a full animal) in animals, SCNT has not been shown to be successful in humans for the development of therapeutic cloning (cloning to develop embryos which may be used for the

PAGE 31

31 production of ESC lines). Recently, progress has b een made to identify 4 factors, Oct4, Sox2, cMyc, and Klf4, which when introduced together we re capable to reprogram mice somatic cells to embryonic stem cell-like cells. These reprogrammed cells had the ability to differentiate into multiple lineages by in vitro differentiation (Takahashi and Yama naka, 2006). Future studies are needed to determine if these same 4 factors are capable to reprogram human somatic cells. Another obstacle with ESCs stems from thei r ability for sustained maintenance in cell culture and capacity to differentiate into almost every cell lineage. Ironically, these are the same criteria which make them potentia l advantageous in cell-based ther apies. These phenomena lead to the strong possibility that treatment with ESCs may lead to uncontrolled growth after implantation and subsequent tumor formation. I ndeed, ESCs injected into immunocompromised mouse will develop teratomas. These are tumors th at are similar to teratocarcinomas that are the rare germ cell tumors generally found in the tes tis. Teratomas, like teratocarcinomas, are large grotesque tumors that have a multitude of cell lineages within them, including hair, teeth, and bone, among others. To circumvent these prob lems, absolute care must be taken during the lineage development stage. In th e case of ESCM for the treatmen t of CVD, the cells must be terminally differentiated, such that no ESCs rema in. Additionally, these cel ls must be purified to the highest standards. To further reduce the ri sk of tumorigenesis, no other cells besides the purified ESCM should be injected into damage d myocardium. ESCM are unlikely to have uncontrolled growth to a capacity that could give rise to a tumor. Therefore the technical problem with ESCM as a cell-therapy is the heterogeneity of celltypes formed during ESC differentiation. How can we effectively purify the ESCM from the total cell population, without usi ng any gene-transfer mediated se lection? Furthermore, since ESCM formation is typically low (less than 5%) how can we increase the differentiation to this

PAGE 32

32 lineage? The ultimate goal would be to take ESCs and directly differentiate them to ESCM. Our data suggest that by modifying signaling pathways this goal may be achievable. Others have also shown that cell density-gradi ent centrifugation is a plausible te chnique to purify ESCM (E et al., 2006). To complicate matters further, we have found that ESCs themselves are a heterogeneous population. One might expect that if we start with a hete rogeneous population of ESCs, it would be less likely to differentiate them to a homogenous population of ESCM. Fortunately, however, our data suggests that by m odifying intracellular factors, we may be able to develop homogeneous populations of ESCs. In summary, we believe that if the obstacles surrounding ESCs are overcome, these cells would provide a valuable re source in cell-based therapies as a treatment for CVD in the not too distant future.

PAGE 33

33 ES cells T+ Mesoderm Progenitors ESCM Day 0 Day 3-5 Day 10-15 Priming TGF2 BMP2 Noggin Notch NORA (low) Wnt11 Fgf2 BMP2 RA (high) Wnt3a Igf-2VE Wnt3a Cripto FGFR1 Ascorbic Acid Chibby Chemical Inhibitors (repressive for ESCM) PD169316 (p38MAPK) AG490 (JAK2/STAT3) Wortmannin/LY294002 (PI3K) LiCl(Wnt/ -catenin) Activin Figure 1-1. Factors found to influence the diffe rentiation of Embryonic Stem (ES) cells to T+ Mesoderm progenitors and then to Embr yonic Stem Cell-derived Cardiomyocytes (ESCM).

PAGE 34

34 CHAPTER 2 MATERIALS AND METHODS Maintenance of Mouse ESCs The cell lines used for this study were -Myosin Heavy Chain-EGFP (MHC-GFP) CGR8 ESCs (a gift from Dr. Richard Lee, Harvard, MA ), Afp-GFP ESCs as we described previously, Nanog-TRE ESCs as we previously described, Brachyury-GFP ESCs (a gift from Dr. Gordon Keller), R1 ESCs (a gift from Dr. A. Nagy, Toronto, Canada), Nanoggeo ESCs (a gift from Dr. S. Yamanka) (Takahashi et al., 2003; Hamazaki et al., 2004; Fehling et al., 2003; Mitusi et al., 2003). All embryonic stem cell lines were maintain ed in an undifferentia ted state on gelatincoated culture plates in K nock-out DMEM (GIBCO BRL, Gra nd Island, NY) containing 10% Knockout-Serum Replacement (GIBCO, BRL), 1% fetal bovine serum (Atlanta Biologicals, Norcross, GA), 2 mM L-glutamine, 100 units/m l penicillin, 100 g/ml streptomycin, 25 mM HEPES (GIBCO BRL), 300 M mo nothioglycerol (Sigma, St. Louis, MO), and 1000 units/ml recombinant mouse LIF (ESGROTM, Chemicon, Temecula, CA). Differentiation of ESCs to Cardiomyocytes ESCs were differentiated by the hanging drop method. ESCs were first washed in PBS and detached from culture plates with 0.05% Trypsin/EDTA (GIBCO BRL). ESCs were aggregated into 25 L droplets on bacterial Petr i dish lids at 2000 cell s/drop in differentiation media. Differentiation media consists of Isc ove’s Modified Dullbeco’s Medium (GIBCO BRL) containing 20% fetal bovine serum (Atlanta Biol ogicals), 100 units/ml pe nicillin, 100 g/ml streptomycin, and 300 M monothi oglycerol (Sigma). After 2 days of hanging drops, embryoid bodies (EBs) were collected and plated in suspen sion culture for 2 more days on a UV-irradiated bacterial Petri dish. At day 4, EBs were plated for attachment on gelatin-coated cell culture plates. Media was changed every other day. In some cases, reduced serum media were used,

PAGE 35

35 containing the same components as described a bove except with 1%, instead of 20%, of fetal bovine serum (Atlanta Biologicals ). Individual EBs contai ning beating areas in some experiments were observed by microscopy a nd scored as positive or negative for cardiomyocytes, and total percentages with standard deviations are shown. In other experiments, the percent of cardiomyocytes within the total sample was determined by flow cytometry. Chemical Activation of Wnt/ -catenin Signaling To determine how activation of Wnt/ -catenin signaling would impact cardiac differentiation of ESCs, Wnt3a and LiCl were use d. Experimental procedures were performed as follows. MHC-GFP ESCs were aggregated by hanging drop as describe d above. EBs were plated onto gelatin coated dishes at day 4. Beginning at day 5, serum in the differentiation media was reduced from 20% to 1%. Additionally, r ecombinant Wnt3a (R&D Systems) at a final concentration of 10 ng/ml, or LiCl (Sigma) at a final concentration of 5 mM was added to the media. Media was changed every other day with th e fresh addition of Wnt3a or LiCl. No visible changes in EB size or percent of cell death were apparent. Flow cytometry analysis was performed at day 15 of differentiation as described in Methods. Vectors, Transfections, and DNA Cloning The Nkx2.5 and mutant R190H Nkx2.5 were cloned into pcDNA3 as previously described (Kasahara and Benson, 2004). MHC-GFP tetracyc line-off inducible cell line was developed by the cotransfection of pCAG20-1 (CAG promoter driving the tet activat or-tTA2) and pUHDIO-3 (CMV minimal promoter with tetoperator driving the puromycin re sistance gene) with Fugene-6 (Roche, Indianapolis, IN) as previously describe d (Era and Witte, 2000). ESCs were selected with 1.25 g/ml of puromycin for 14 days and i ndividual colonies were manually picked up and transferred to a 24-well plate. After further growth of the indi vidual colonies, cell lines were

PAGE 36

36 deemed tetracycline-responsive by the treatmen t of puromycin alone, or puromycin plus doxcycline, where in the former the cells surv ive, but in the latter the cells die. The MHC-GFP Chibby-TRE-off inducible cell line was developed by first cloning flagtagged human Chibby (hCby) into pTRE2-hyg v ector (Clontech, Mountai n View, CA), which contains the tet-operator followed by a minimal CM V promoter, using Not1 and Sal1 restriction endonucleases (New England Biolabs, Ipswich, MA ). pTRE2-Cby was then transfected into MHC-GFP Tet-off inducible cell line. After 14 day selection with hygromycin B (100 g/ml, Invitrogen, Carlsbad, CA), individual colonies were picked up and assayed for Cby inducibility by western blotting. To develop the Cby RNAi vector, mouse C by short-hairpin RNA (shRNA) construct was developed by subcloning the targeting se quence (5’-GTGGCAGACTCCGTGATTAGT-3’) into the pSuppressor Retro vector (Imgenex, Sorre nto Valley, CA). The Cby knockdown ESC and control cell lines were developed by transfecting the empty vector or Cby knockdown vector into R1 ESCs and selecting with G418 for 14 days. Individual colonies were picked up, cultured further, and then analyzed for C by expression by western blotting. The hCby rescue of the mouse Cby RNAi ES C line was developed by cloning flag-tagged hCby, using Not1 and Sal1 restriction endonucleases, into a pCAG-hyg vector (a vector developed by the removal of the tet operator/ min cmv promoter from the pTRE2-vector and insertion of a CAG promoter) and transfection into the C by knockdown clone. After 14 day selection with hygromycin B (100 g/ml, Invitrog en) individual colonies were picked up and assayed by western blotting for human Cby expression. Vectors were constructed using the following pr ocedures. First insert was amplified using LA-Taq kit (Takara Bio Inc., Shiga, Japan). Reaction consisted of 1.5 l each primer to a

PAGE 37

37 1.5 M final concentration, 10 – 50 ng of DNA Template, 10 l 10X LA PCR buffer II, 2 l of 10 mM DNTP, 0.5 l LA-Taq, and H2O to a final volume of 100 l. PCR program was performed by an initial denaturation at 94C for 1 minute, then a denaturing step at 98C for 5 seconds, and anneal/elongation step at 68C for 5 minutes, a repetition to step 2, 19 times, and a final elongation step at 72C for 10 minutes. Second, PCR reactions were purified by Qiagen PCR purification kit. A 5X volume of Buffer PB was added to the PCR reaction. Mixture was spun through Qiagen minicolumn. Minicolumn was washed with 750 l Buffer PE. Following an extra spin to remove residual wash buffer, DNA was eluted using 40 l Elution Buffer. Third, purified PCR products were digeste d. Digestion was performed by mixing 33.6 l purified PCR product with 4 l restriction buffer (NEB), 0.4 l BSA (if suggested by manufacturer), 1 l of each restriction endonuc lease, and then an overnig ht incubation at 37C. Vector was similarly digested to allow for directional cl oning with compatible ends. Fourth, vector and insert were gel purified on 1% agarose/TBE ethidium bromide stained gels. DNA bands were cut out wi th a clean scalpel. DNA was pur ified from gels using Qiagen Gel Extraction Kit according to manufacturer’s instru ctions. Briefly, gel slices were solubilized in 3X (weight to volume) Buffer QG at 50C for 5 to 10 minutes. A 1X volume of Isopropanol was added, and DNA was collected on Qiagen mini columns. Minicolumns were washed with 750 l of Buffer PE, and following an extra spin to remove residual buffer, DNA was eluted using 50 uL Elution Buffer. Fifth, ligation reaction was performed using th e Takara Ligation Kit. DNA concentration was determined by spectrophotemetry at Abs of 260 nm (1 A260 equal 50 ug/ml of DNA). The A260/A280 ratio between 1.8 and 2.0 suggested a high DNA purity. A 3:1, insert:vector molar

PAGE 38

38 ratio was used for the ligation in a volume of 4 l. One l of 5X ligation buffer was added to the mixture. Next 1 l of this mixture was added to 4 l of Buffer A, and then 1 l of Buffer B (containing Ligase) was added. The ligation reaction was pe rformed by incubation at 16C overnight. Sixth, ligated vector was transf ormed using Max Efficiency DH5 E.coli chemical competent cells, according to manufacturer’s protocol (Invitrogen). Approximately, 1 l of ligation reaction was incubated with 40 l of E.coli for 30 minutes on ice. Mixture was incubated at 42C for 45 seconds, and then returned to ice for 2 minutes. Next, 950 l of SOC medium was added, and transformed cells were in cubated at 37C on a bacterial shaker for 1 hour. Then, 100 l of transformation was plated onto LB -antibiotic plates (ampicillin or kanamycin, depending on vector) and incubated overn ight at 37C. Coloni es were then picked up and grown in 2 ml of LB broth with the appropriate antibiotic overnight. Seventh, vectors were purified from the bacter ia using Qiagen Miniprep Kit, according to manufacturer’s instru ctions. First, bacterial cells were pelleted by centrifugation in a table-top centrifuge at max speed for 1 minute. B acterial pellets were resuspended in 250 l of Buffer P1, 250 l of Buffer P2 was added and mixed, and 350 l of Buffer N3 was then added and mixed. Mixture was then pelleted by centrifugation for 10 minutes as above. Supernatant was collected and spun through minicolumns. Minicolumns were washed using 750 l Buffer PE. Following an extra spin to remove residual buf fer, vectors were eluted using 50 l Buffer EB. To confirm the insert was present, vectors were digested as described above for 1 hour and then analyzed by gel electrophoresis to se e if the insert would drop out. DNA sequencing reactions using Big Dye T3 mix were performed to confirm that no DNA mutations had occurred during PCR synthesis.

PAGE 39

39 Flow Cytometry and Fluorescent-Assisted Cell Sorting (FACS) Differentiated cells were prepared into a single cell suspension by treatment with 0.05% trypsin/EDTA and incubation at 37C for 5 mi nutes. Flow cytometric analysis was performed with FACS Sort m achine (Becton Dickinson, Franklin Lakes, NJ) using CellQuest Acquisition data analysis software (Becton Dickinson). Sorted cells were collected by Vantage machine (Becton Dickinson) also using CellQuest Acquisition data analysis software (Becton Dickinson). Quantitation of MHC-GFP flow cyto metry was determined by the ratio of GFP+ cells for each condition to the GFP+ cells fo r Cby-TRE+Dox (non-induced control) for each independent experiment. Site-Directed Mutagenesis Mutagenesis of the Gata-6 -galactosidase reporter vect or was performed using QuikChange Site-Directed Mutagenesis Kit (S tratagene, La Jolla, CA) according to the manufacturer’s instru ctions. Briefly, the following forward (GTGTTACAGCGCTGGATGGGCC TGGGTCGCTGGCC) and reverse (GGCCAGCGACCCAGGCC CATCCAGCGCTGTAACAC) PAGE purified primers were ordered from Integrated DNA Tech nologies, Inc. (Coralville, IA; mu tated sites are underlined). Reaction consisted of 5 l 10X reaction buffer, 50 ng of vect or template, 125 ng each primer, 1 l of dNTP mix, and 1 l of pfuTurbo DNA polymerase up to a final volume of 50 l. Reaction consisted of 1 cycle at 95C for 30 seconds, a nd then 18 cycles of 95C for 30 seconds, 55C for 1 minute, 68C for 9 minutes. Template ve ctor was next degraded by the addition of 1 l of DpnI restriction endonuclease and incubated at 37 C for 1 hour. Reactions were transformed into Max Efficiency DH5 (Invitrogen) and analyzed by gel electr ophoresis and sequencing as described above.

PAGE 40

40 RT-PCR Total RNA was extracted using the RNA a queous kit, according to manufacturer’s instructions (Ambion Inc., Austin, TX). Briefly, cells were collected using 350 l of Lysis/Binding Solution by scraping with a rubber spatula. An equal volume of 64% ethanol was added, and the lysate was spun through a filter ca rtridge at 13,000 RCF for 1 minute in a tabletop centrifuge. Cartridge was washed with 700 l Wash Solution 1, then 2 more times with 500 l Wash Solution 2. RNA was eluted in two steps using first 40 l preheated Elution Solution, followed by 20 l Elution Solution. RNA was stored at -80C. The cDNA was synthesized using SuperScript II first-strand synthesis system with oligo dT (GIBCO BRL). PCR was performed usi ng Taq DNA polymerase kit (Eppendorf, Westbury, NY). RT step was performed by mixing 1 l Oligo(dT), 1 l 10 mM dNTP, and 1 g of total RNA, and DEPC-H2O to a final volume of 10 l. Mixture was incubate d at 65C for 5 minutes, and then 4C for 2 minutes. Next, 9 l of reaction mixture consisting of 2 l 10X PCR buffer, 2 l 0.1 M DTT, 4 l 25 mM MgCl2 and 1 l RNaseOUT, was added to the reaction and incubated at 42C for 2 minutes. Then, 1 l of SuperScript RT was added to the mixture and the reaction was performed by incubation at 42C for 50 mi nutes. The reaction was terminated by a 15 minute incubation at 70C. The RNA was degraded by the addition of 1 l Rnase H at 37C for 20 minutes. The cDNA was dilute up to 200 l with water. The PCR reaction was performed by incubating 5 l of cDNA with 0.25 l of 50 M each primer, 0.5 l 10 mM dNTPs, 2.5 l 10X PCR buffer, 0.125 l Taq in a final volume of 25 l. The PCR reaction program consisted of the following steps: a preliminary incubation at 94C for 3 minutes, then 94C for 1 minute, 55C for 1 minute, 72C for 1 minute, and repeated to step 2, 29 more times. For each gene, primers were designed from different exons, avoiding psuedogenes, and being sure that the PCR product

PAGE 41

41 would represent the mRNA target and not back ground genomic DNA (Primers sequences listed in Table 2-1). Lastly, 5 l of each PCR reaction, mixed with 1 l 6x loading dye, was run on 2% agarose/TBE ethidium bromide-stained gels and an alyzed by UV-light. Pictures of gels were taken using BioRad gel doc. Real-Time PCR Total RNA was extracted using the RNA aque ous kit (Ambion). cDNA was synthesized using the HiCapacity cDNA Archive kit using ra ndom primers (Applied Bios ystems, Foster City, CA). Briefly, 10 l Reverse Transcription Buffer, 4 l 25X dNTPs, 10 l 10X Random Primers, 5 l MultiScribe Reverse Transcriptase, and 21 l of nuclease-free H2O was incubated with 50 l RNA (2 g). Reaction consisted of two steps, fi rst a 25C incubation for 10 minutes, and second a 37C incubation for 120 minutes. Real-time PCR reaction was performed us ing the TaqMan Gene Expression Assay (Applied Biosystems, Foster City, CA) accordin g to manufacturer instructions. Each 20 L reaction consisted of 10 L of TaqMan Universal PCR Ma ster Mix, No AmpErase-UNG; 1 L of TaqMan Gene Expression Assay Mix, for -actin (VIC-labeled), C by/pgea1 (FAM-labeled), or Nkx2.5 (FAM-labeled); and 9 L of cDNA (50 ng). Reactions were performed using Applied Biosystems 7900HT Fast Real-Time PCR instrument . Gene expression analysis was performed using the comparative CT method using -actin for normalization. All data are representative of multiple experiments performed in triplicate. Chromatin Immunoprecipitation (ChIP) ChIP was performed using the Chromatin Immunoprecipitation (ChIP) assay kit from Upstate—Cell Signaling Solutions (Lake Pl acid, NY) according to the manufacturer’s instructions. Briefly, a 100-mm plate of ESCs were fixed by th e addition of formaldehyde to 10

PAGE 42

42 ml of media to a final concentr ation of 1%, and incubated for 10 minutes at 37C. Media was removed, and cells were collected by scraping in ice-cold PBS containing protease inhibitors. Cells were collected by centrif ugation, and resuspended in 1 ml of SDS-Lysis Buffer at room temperature. Cells were sonicated by 3, 20 seco nd bursts with 2 minute re sts on ice using setting 7 of a Fisher Scientific Sonicator Dismembr ator Model 100. Lysates were centrifuged for 10 minutes at maximum speed in a table-top centrif uge. Sonicated cell supernatant was collected and then diluted in ChIP Dilution Buffer by10-fold. A 50 l sample was kept from this step as the Input DNA. The cell supernatant was next precleared using 80 l Salmon Sperm DNA/Protein A Agarose-50% slurry. The supernat ant was again collecte d after centrifugation. Approximately 5 l of each antibody was then a dded to the supernatant and incubated overnight on a rocker at 4C. The following day, 60 l of Salmon Sperm DNA/Protein A Agarose-50% slurry was added to the reacti on and further incubated for 1 hour rocking at 4C. The agarose/protein/DNA complex was then collect ed by gentle centrifuga tion at 1000 rpm in a tabletop centrifuge. The agarose complex was then washed with Low Salt Immune Complex Wash Buffer, High Salt Immune Complex Wash Buffer, LiCl Immune Complex Wash Buffer, and the finally two washes with TE. DNA wa s then eluted off in 1%SDS, 0.1M NaHCO3 and crosslinks were revesed by incubating at 65C for 4 hours. Proteins were degraded by treatment with Proteinase K for 1 hour at 45C. Fi nally, DNA was recovered using the Qiagen PCR Purification Kit as described above, and PCR was performed with the Taq DNA polymerase kit (Eppendorf) as described above. Immunoblotting Immunoblotting was performed by first lysing cells in RIPA buffer and then normalizing total protein using a Lowry assay (Bio-Rad, Hercules, CA). Next , 20 g of total protein were separated on 15% SDS-PAGE gels and transferre d to nitrocellulose membranes at 100V for 1

PAGE 43

43 hour. The following primary antibodies were used : Flag M2 (Stratagene), Actin (Santa Cruz, Santa Cruz, CA), and Cby (Takemaru et al., 2003) . Species specific peroxidase conjugated IgG (Santa Cruz) was used as the secondary an tibody followed by enhanced chemiluminenescence (ECL) detection (Amersham, Piscataway, NJ). Densitometry analysis was performed using ImageJ software (NIH, Bethesda, MD). Immunocytochemistry Immunocytochemistry was performed by firs t fixing the differentiated cells in 3.7% formaldehyde. Cells were next permeabilized with 0.5% Triton X-100 in PBS. Cells were blocked for an hour in 5% BSA/PBS and then in cubated the with the Cb y antibody overnight in blocking solution. Cells were washed 5 times in PBS and incubated with secondary antibody, IgG-rhodamine conjuaged anti-Rabbit for 45 minutes. Cells were again wash ed 5 times in PBS. One drop of DAPI-containing VectaShield was ad ded prior to mounting with cover slip. Immunofluoresence was detected using an Olympus IX70 inverted fluorescent microscope with an Optronics digital camera. Electrophoretic Mobility Shift Assays (EMSA) EMSA assays were performed as previously described (Kasahara et al., 2001). Briefly, MBP fusion proteins with Nkx2.5 or Nkx2.5 home odomain were expressed in Escherichia coli BL21(DE3) by IPTG induction, and purified on amyl ase beads (New England Biolabs, Ipswich, MA) and eluted with maltose. End-labele d oligonucleotide cont aining distal site, TTTGGACAAACCGAGTTAAGTGCAACAATAGTC (1734 to -1701) was annealed to GACTATTGTTGCACTTAACTC GGTTTGTCCAAA; mutant distal end-labeled TTTGGACAAACCGAGTTGGGTGCAACAATAGTC (1734 to -1701) was annealed to GACTATTGTTGCACCCAACTCGGTTTGTCCAAA; pr oximal end-labeled oligonucleotide TCCAGCCTGGGTCACCACTTAACAT TTTTAACACAAC (-385 to 348) was annealed to

PAGE 44

44 GTTGTGTTAAAAATGTTAAGTGGTGACCCAGGCTGGA; mutant proximal end-labeled TCCAGCCTGGGTCACCACCCAACAT TTTTAACACAAC (-385 to 348) was annealed to GTTGTGTTAAAAATGTTGGGTGGTGACCCAGGCTGGA and were used for EMSA. Approximately 50,000 cpm of probe were incubated with 3-fold serial dilutions of 66 ng of fusion protein, 50 g of BSA, 0.5 g of poly( dG-dC) in 10 mM HEPES, pH 8.0, 50 mM KCl, 1mM EGTA, 10% glycerol, 2.5 mM DTT, 7 mM Mg Cl2 in a 15 L reaction for 20 minutes at room temperature, separated on a 5% polyacrylam ide gel in 0.5X Tris-glycine buffer. ProteinDNA binding affinity was estimated by the protei n concentration at which 50% of DNA probe had become bound (Carey, 1991). Luciferase Assays Luciferase assays were performed using Dual-Luciferase Kit (Promega, Madison WI) according to manufacturer’s instructions. Briefly, luciferase reporter vectors were cotransfected with expression vectors and renilla vector. Lysate s were collected with 1X Passive Lysis buffer, and read by a single-sample luminometer. A 20 l aliquot of lysate mixed with 100 l Luciferase Assay Reagent II was measured, follo wed by measurement after addition of 100 l of Stop & Glo Reagent. The activity was determ ined by ratio of luci ferase to renilla. X-gal Staining X-gal staining was performed using the In Situ -galactosidase Staining Kit according to manufacturer’s instru ctions (Stratagene, La Jolla, CA). Media from the cells was removed and the cells were then fixed in 1X fixing solution fo r 10 minutes at room temp erature. Cells were washed twice in PBS, and then 1X staining solu tion was added, which contains 1 mg/ml X-gal. Cells were incubated overnigh t at 37C, and analyzed by br ight field light microscopy.

PAGE 45

45 -galactosidase Activity Assays -galactosidase activity assays were performed using the -galactosidase Enzyme Assay System with Reporter Lysis Buffer kit (Promega ) according to manufacturer’s instructions. Briefly, cells were collected usi ng a rubber scraper in 1X Reporter Lysis Buffer. Next, 150 l of cell lysates were mixed with 150 l of Assay 2X Buffer, and in cubated for 3 hours at 37C. Reactions were stopped by adding 500 l of 1M S odium Carbonate. The absorbance was read at 420 nm. Readings were compared to a standard curve using -galactosidase enzyme. Activity is measured in units of -galactosidase. All assays were pe rformed in triplicate and standard deviations and p-values from St udent’s t-test were determined. Fluorescein di-D-Galactopyranoside (F DG) Staining of ESCs FDG (Sigma) was dissolved in DMSO to make a 20 mM stock solution, and aliquots were frozen at -20C. Staining was performed as pr eviously described (Angelo ti et al., 1993). Cells were first washed twice in PBS, and then incuba ted in PBS for 5 minutes at 37C. Next, a 1 mM FDG solution in 50% PBS/H2O is prepared and warmed to 37C. PBS is then removed from the cells, and FDG solution is added to the plate, and incubated at 37C for 1 minute. Cells are then placed on ice, and 1 ml of ice-cold PBS is added to the cells for 5 minutes. Cells can then be viewed by fluorescent microscopy. To stain cells for FACS, the following protocol is used. A 2 mM FDG solution in sterile warm deionized H2O is first prepared. Next, the cell pellet, collected trypsinization, is resuspended in 100 l of prewarmed reduced se rum media (Opti-Mem, Invitrogen). Then, 100 l of FDG solution is added to th e cells and the mixture is incuba ted at 37C for 1 minute. The cell-suspension is next diluted in ice-cold gr owth medium and kept on ice for 30 minutes.

PAGE 46

46 Before FACS, 2 l of PI stain is added to rem ove the dead cells that have occurred from the osmotic shock. Gene Expression Profiling Gene expression profiling was performed by GenUs Biosystems (Northbrook, IL). RNA was extracted from FDG sorted cells using RNAq ueous Kit (Ambion) as already described and shipped on dry ice to GenUs Biosystems. Total RNA samples were quantitated by UV spectrophotometry (OD260/280). Quality of total RNA was assessed using an Agilent Bioanalyzer. First and sec ond strand cDNA was prepared from the total RNA samples. Biotinylated cRNA target was prepared from the DNA template and verified on the Bioanalyzer. cRNA was fragmented to uniform size and verified on the Bioanalyzer. CodeLinkTM Mouse Whole Genome Bioarrays contai ning approximately 36,000 gene ta rgets were hybridized with the cRNA target and stained with Cy5-streptavidi n. Slides were washed and then scanned on an Axon GenePix 4000B scanner. Data was analyz ed with CodeLink and GeneSpring software packages. Intensity values were normalized to the median value from the array, and those genes that were differentially expressed by 2-fold or more were annotated. Statistical Analyses Real-time PCR, Luciferase assays, -galactosidase activity assa ys, and flow cytometry data are presented as mean with standard deviat ions of experiments in triplicate. Data was analyzed by Student’s t test a nd p-value < 0.05 was considered to be statistically significant.

PAGE 47

47 Table 2-1. Forward and Reverse Primer s used for semi-quantitative RT-PCR. Name Sequence Amplicon size (bp) F-AFP TCGTATT CCAACAGGAGG 173 R-AFP AGGCTTTTGCTTCACCAG F-Albumin GCTACGGCACAGTGCTTG 260 R-Albumin CAGGATTGCAGACAGATAGTC F-antitrypsin AATGGAAGAAGCCATTCGAT 484 R-antitrypsin AAGACTGTAGCTGCTGCAGC F-actin ATGGATGACGATATCGCTG 500 R-actin ATGAGGTAGTCTGTCAGGT F-MHC ACCCCTACGATTATGCG 300 R-MHC GTGACGTACTCGTTGCC F-Brachyury TGCTGCCT GTGAGTCATAAC 947 R-Brachyury TCCAGGTGC TATATATATTGCC F-Chibby AGCATATTC AGCCCAAAGAAG 289 R-Chibby GCATGTCCAGCAGAATGTCCA F-Collagen II CTGCTCATCGCCGC GGTCCTA 432 (splice variant AJuvenile), 225 (splice variant B-adult) R-Collagen II AGGGGTACCAGGTTCTCCATC F-Cytokeratin-19 GTCCTACAGATTGACAATGC 570 R-Cytokeratin-19 CACGCTCTGGATCTGTGACAG

PAGE 48

48 Table 2-1. Continued. F-Fgf5 AAAGTCAATGGCTCCCACGAA 464 R-Fgf5 CTTCAGTCTGTACTTCACTGG F-Flk-1 AGCTCTC CGTGGATCTGAAA 427 R-Flk-1 CAGAGCAACACACCGAAAGA F-Gata-4 GCCTGTATGTAATGCCTGCG 469 R-Gata-4 CCGAGCA GGAATTTGAAGAGG F-Gata-6 GCAATGCATGCGGTCTCTAC 571 R-Gata-6 CTCTTGGTAGCACCAGCTCA F-human Chibby GACAT GGCGGCCGCATGGATTACA AGGATGAC 411 R-human Chibby TCTG GTCGACTCATTTTCTCTTCCG GCT F-Mef2c TAACTCCCAGTCGGCTCAGT 479 R-Mef2c ATGTTGCCCATCCTTCAGAG F-Nanog AGGGTCTGCTACTGAGATGCTCTG 363 R-Nanog CAACCACTGGT TTTTCTGCCACCG F-Nestin GAAGCCCTGGA GCAGGAGAAGCA 159 R-Nestin TCCAGGTGT CTGCAAGCGAAAGTTC F-Nkx2.5 CAAGTGCTCTCCTGCTTTCC 507 R-Nkx2.5 GCGTTGT AGCCATAGGCATT F-Oct4 TGGAGACTTTGCAGCCTGAG 800 R-Oct4 TGAATGCATGGGAGAGCCCA

PAGE 49

49 Table 2-1. Continued. F-Rex1 CGTGTAACATACACCATCCG 130 R-Rex1 GAAATCCTCTTCCAGAATGG F-Sox2 GTTACCTCTTC CTCCCACTCCAG 407 R-Sox2 CCCGCCCTCCC CGCCGCCCTCAG F-Ttr CTCACCACAGATGAGAAG 225 R-Ttr GGCTGAGTCTCTCAATTC F-Wnt1 AAATCGCCCAACTTCTGCA 599 R-Wnt1 AATACCCAAAGAGGTCACAGC F-Wnt2b TGTACTCTGCGCACCTGCT 318 R-Wnt2b TGCACTCACACTGGGTGAC F-Wnt3 ACCTGGA GAAGGCTGGAAGT 406 R-Wnt3 AAAGTTGGGGGAGTTCTCGT F-Wnt3a GCTGGAGTAGCTTTCGCAGT 255 R-Wnt3a CTTGAGGTGCATGTGACTGG F-Wnt5b TCGGAGG AGCAGGGCCGAGC 225 R-Wnt5b CAGCTTGCCCTGGCGGGTGA F-Wnt8a CCATCATGTACGCAGTCACC 358 R-Wnt8a GCGGTCATACTTGGCCTTTA F-Wnt9b AGGAGACGGC CTTCCTGTAT 398 R-Wnt9b GACAGCCGTGTCATAGCGTA F-Wnt11 GCCATGA AGGCCTGCCGTAG 152 R-Wnt11 GATGGTGTGACTGATGGTGG

PAGE 50

50 CHAPTER 3 RESULTS Chibby Facilitates Cardiomyocyte Diffe rentiation of Embryonic Stem Cells The Wnt/ -catenin signaling pathway has been suggested to play a role in cardiomyocyte differentiation and development. To determine th e role of this pathway during the differentiation of ESCs to cardiomyocytes, we decided to i nvestigate a new protein, Chibby (Cby), which was recently identified as a nuclear protein that antagonizes the transcriptional activity of -catenin (Takemaru et al., 2003). The -catenin Antagonist, Chibby, is Ubiquitously Expressed in ESCs and in Early Lineage Specification, But is Gradually Down regulated During Differentiation Since the expression pattern of Cby dur ing embryonic development has not been elucidated, we initially studied the levels of Cby expression in undifferentiated mouse ESCs and during their in vitro differentiation. ESCs may be differentiated in vitro by forming aggregates, termed embryoid bodies (EBs), on the lids of Petri dishes using the ‘hanging drop’ method (Doetschman et al., 1985). To determine the levels of Cby expressi on in ESCs and during in vitro differentiation, R1 ESCs were differentiate d by the hanging drop method and cells were collected at days 0, 4, 7, 10, and 14. Total R NA was extracted and Cby expression, along with other genes, was analyzed by RT-PCR. Our data suggest that Cby is expressed in ESCs, but gradually decreases through 14 days of differen tiation (Figure 3-1A). By comparison, multiple Wnts become upregulated during ESC diffe rentiation, while cardiac markers, Nkx2.5, -MHC, and Mef2c begin to be expresse d at day 7. Real-time PCR c onfirmed the gradual decrease in Cby expression during ESC differentiation and Nkx2.5 upregulation at day 7 (Figure 3-1B). As Cby may be expressed in a temporal or lineage re stricted manner, we analyzed Cby expression in primitive endoderm or mesendoderm progenitor cells . To determine if Cby is expressed in primitive endoderm, AFP (alpha-fetoprotein)-GFP ESCs were aggregated in media for four days.

PAGE 51

51 Similarly, to determine if Cby is expressed in mesendoderm progenitors, Brachyury-GFP ESCs were differentiated in monolayer adherent cultu re for four days. All GFP positive and negative cells were isolated by FACS, and Cby RNA ex pression was detected by RT-PCR (Figure 3-2A and 3-2B). Cby was found to be expressed in all positive and negative GFP cell populations. These data suggest that C by is expressed throughout ear ly lineage differentiation. High Cby Expression is Restricted to Cardiomyocytes During Late Stages of Differentiation and Development We next sought to determine the expression pattern of Cby during late stages of ESC differentiation. After 10 days of differen tiation by the hanging drop method, ESC-derived cardiomyocytes can be detected by a spontaneous beating phenotype . To enhance visualization of the cardiomyocytes, ESCs containing a stable transgene for EGFP under the control of the cardiac promoter, -Cardiac Myosin Heavy Chain (hencefor th referred to as MHC-GFP cells) may be used. Using day 15 embryoid bodies, high Cby expression was speci fically co-localized only with the MHC-GFP cardiomyocytes as dete rmined by immunocytochemistry, as compared to the GFP-negative cells where Cby expression was found to be low or not expressed at all (Figure 3-3A). It should also be noted that C by may be able to shuttle between the nucleus and the cytoplasm (Takemaru et al., unpublished obser vations). To further confirm the increased expression in cardiomyocytes compared to non-myocytes, we performed FACS on MHC-GFP ESCs differentiated for 12 days. Real-time PCR was then used to compare the expression of Cby and Nkx2.5 in the GFP-negative and GFP-postiv e sorted populations (F igure 3-3B). Cby was determined to be 2.7-fold higher in card iomyocytes, compared to non-cardiomyocytes. Altogether, these data suggest that Cby is expresse d fairly ubiquitously du ring the early stages of ESC differentiation, but at later stages high Cby expression is re stricted to cardiomyocytes.

PAGE 52

52 To determine the expression of Cby in vivo , lung, liver, and heart we re isolated from E12.5 mice embryos and 8 week old mice. RNA was ex tracted from the tissu es, and real-time PCR was performed to determine the expression of Cby and Nkx2.5 (Figure 3-4). Cby was approximately 3-fold higher in both embryonic an d adult heart compared to the lung and liver. These data suggest that high leve ls of Cby are expressed in card iac tissue, compared to other tissues. Cby Expression is Upregulated by the Card iac Specific Transcription Factor, Nkx2.5 As Cby expression appeared to be highly e xpressed in cardiomyocyt es during late stage embryoid body differentiation, we analyzed the C by promoter region for any specific cardiac regulatory elements by computer “ in silico ” analysis. Within 2 kb upstream of the transcriptional start site for mu rine Cby, we identified five potential bindings site for Nkx2.5 (Figure 3-5). Of these five si tes, two were highly si gnificant with a score of 97 out of 100 on the TRANSFAC database (http://motif.genome.jp/). To determine if Nkx2.5 can directly bind to the Cby promoter, EMSA assays were performed using probes that incl uded the two highly significant putative binding sites (Figure 36). As predicted, full-length Nkx2.5 and the Nkx2.5 homeodomain were able to induce shifts for both probes with high efficiency (Kd ranged from 0.7 – 6.4 x 10-9 M). However, neither a mutant Nkx2.5 nor the MBP alone was able to induce a sh ift. Interestingly, we found multiple shifts suggesting that Nkx2.5 may bind to multiple positions within these probes To further determine if Nkx2.5 can directly activate Cby expression, the 2 kb promoter region of mouse Cby was cloned into a lucifera se reporter vector. Tr ansfection of an Nkx2.5 expression vector activated the mouse Cby luci ferase reporter in a dose-dependent manner in NIH3T3 cells (Figure 3-7). Furthermore, an Nkx2.5 R190H mutant, incapable of DNA binding, failed to enhance the activity of the Cby luciferase reporter. Altogether, these data suggest that

PAGE 53

53 Nkx2.5 binds to the Cby promoter to activ ate its expression du ring cardiomyocyte differentiation. Cby Antagonizes -catenin Activity in ESCs To confirm the function of Cby as an antagonist of -catenin signaling in pluripotent, nontransformed cells, we performed luciferase act ivity assays in mouse embryonic stem cells. Initially, we found th at the activity of -catenin in ESCs by the T opflash/Fopflash system (a luciferase reporter with wild-typ e or mutated Tcf-binding sites) wa s undetectable (Korinek et al., 1997). To enhance this activity, a constitutive active -catenin vector along with or without a Cby expression vector was transiently tr ansfected into embryonic stem cells and Topflash/Fopflash activity was measured. As expected, Cby overe xpression significantly reduced -catenin-dependent report er activity by more than 3-fold (Figure 3-8). Loss of Cby Inhibits Cardiomyocyte Differentiation of ESCs Previous studies have suggest ed that activation of Wnt/ -catenin signaling can inhibit cardiac differentiation (Koyanagi et al., 2005; Yamashita et al ., 2005; Schmidt et al., 2001). Consistent with these findi ngs, activation of the Wnt/ -catenin signaling casca de during late ESC differentiation by either 5 mM Li Cl or 10 ng/mL of rWnt 3a significantly reduced cardiomyocyte formation (Figure 3-9). We therefore decided to test if the loss of the -catenin antagonist, Cby, may also reduce cardiomyocyte differentiation. R1 ESCs were transfected with a siRNA v ector against Cby to knockdown its expression, and stable cell lines were developed. Imm unoblot analysis demonstr ates that Cby RNAi efficiently reduced endogenous pr otein levels by more than 80 % (Figure 3-10). Although Cby is expressed in ESCs, its knockdown did not se em to have any adverse effects on ESC maintenance. However, upon differentiation of the Cby knockdown cell line, we found that the normal in vitro differentiation patterning between days 5 through 14 were dramatically altered.

PAGE 54

54 Specifically, embryoid bodies showed decreased si ze of outgrowths and a d ecrease in the number of beating cells (Figures 3-11A and 3-11B). To confirm that the differentiation defect was directly due to the loss of Cby, human Cby wa s reexpressed in the Cby knockdown clone (Figure 3-11C). Human Cby is not susceptible to the e ffect of the siRNA against the mouse Cby gene. The expression of human Cby was able to rescue both the differentiation of outgrowths from the embryoid bodies and the beating cardiomyoc ytes (Figure 3-11A and 3-11B). To confirm that the loss of Cby did not aff ect ESC maintenance or early differentiation, but did affect late stages of differentiation, R NA expression of various markers were determined by RT-PCR. Pluripotency marker s, Oct4 and Nanog, were not aff ected by Cby RNAi in ESCs. Similarly, neither early mesendoderm marker, Brachyury, nor endoderm markers, Afp and Ttr (transthyretin), appeared affected by the knockdo wn of Cby within 4 days of differentiation (Figure 3-12A). However by day 12 of differentiation, cardiac markers, Nkx2.5, -MHC, and Mef2c, were downregulated in the Cby knockdown but not in the negative control cells (Figure 3-12B). Furthermore, expression of human Cby rescued the expres sion of the cardiac markers. Interestingly, endoderm differentiation at day 12, as determined by Afp, Albumin, and antitrypsin expression, was also downregulated by the Cby RNAi and rescued by human Cby expression. Additionally, there appeared to be an increase in neuroect oderm differentiation in the Cby knockdown, as determined by Nestin and Sox2 expression. Lastly, a chondrocyte marker, Collagen II, a vascular endothelial mark er, Flk1, and an epithelial marker, Cytokeratin 19, were unaffected by the RNAi. Taking these data together, Cby likely facilitates the formation of late-stage mesoderm/endoderm lin eages, such as cardiomyocytes, but is not required for Brachyury-positive, mesendoderm progenitors.

PAGE 55

55 Cby Overexpression Promotes Cardiomyocyte Differentiation of ESCs To investigate how ectopic expression of Cby would impact cardiac differentiation of ESCs, we developed a tetracycline-off, induc ibile cell line using th e MHC-GFP ESCs. As shown in Figure 3-13A, low levels of Cby expre ssion could be detected in the presence of doxycycline. However upon the removal of doxycyc line, Cby protein expression successively increased after 24, 48, and 72 hours. The readdi tion of doxycycline for 24 hours led to a rapid reduction in protein to near b ackground levels. Sustained Cby overexpression in ESCs, like the loss of Cby by RNAi, did not have any adve rse affects on ESC main tenance. Upon the differentiation of these cells in the presen ce or absence of doxycyc line by the hanging drop method, we found that when Cby was induced cons ecutively for 15 days, there was an increase in the number of GFP positive cells (Figure 3-13B) . To confirm this increase in cardiomyocytes, we performed flow cytometric analysis on the C by inducible cell line and the parental cell line, with or without doxycycline, after 15 days of diff erentiation. From multiple trials, we found that there was approximately a two-fold increase in the number of GFP+ cardiomyocytes among differentiated cells overexpressing Cby (Figures 3-14A and 3-14B). Finally, we confirmed the increased differentiation of ESCs to cardiomyoc ytes by checking the RNA expression of cardiac markers by RT-PCR (Figure 3-14C). Cardiac markers, Nkx2.5, -MHC, and Mef2c, were significantly increased in the Cby-overexpressing cells, comp ared to the non-overexpressing cells. Other lineage markers, Collagen II and Ne stin appeared unchanged. These data suggest that sustained Cby overexpression will increa se cardiomyocyte differentiation, without significantly affecting ot her cell lineages. To further define the time window in wh ich Cby overexpression best increases the cardiomyocyte population, we induced Cby expre ssion by the removal of doxycycline during the early and late stages of differentiation. Over expression of Cby only in the first 4 days of

PAGE 56

56 differentiation led to a cardiomyocyte populatio n of 3.8% of the total cells, which was not significantly different from the control cells of 3.6% (Figures 3-14B and 3-15). On the other hand, overexpression of Cby by doxycycline removal during the later stages of differentiation, days 4 – 15, led to a cardiomyocye population of 7.0%, representing a incr ease over the controls, but still less than sustained Cby overexpressi on through days 0 – 15, which was found to be 9.9%. These data suggest that sustained Cby overexpression throughout ESC differentiation leads to the largest increase in the cardiomyocyte population. Obstacles for ESCM Formation Heterogeneity of Embryonic Stem Cells As described in the introduction, heterogene ity during ESC differentiation is a major obstacle for the use of ESCM in cell-based therap ies. Recently, ESCs have also been suggested to be a heterogeneous population during normal maintenance conditions (Furusawa et al., 2006; Stewart et al., 2006). We ther efore decided to examine this further. Previously, the galactosidase-neomycin fusion gene ( -geo) has been inserted into the Nanog locus of ESCs to develop knock-out mice (Mitsui et al., 2003). Using these Nanog-geo ESCs, we decided to examine the expression pattern of Nanog by X-ga l staining during ESC maintenance (Figure 316A). Interestingly, we found that Nanog expres sion is heterogeneous in ESCs, as both positive and negative cells were evident after staining. To further confirm this expression pattern of Nanog and to isolate the Nanog negative and pos itive populations during ESC maintenance, we used the Fluorescein-di-D-Galactopyranoside (FDG) to stai n ESCs (Figure 3-16B). This substrate is cleaved by -galactosidase to release fluorescein , and live cells may be visualized by fluorescent microscopy or isolated by FACS. Like X-gal staining, staining with the FDG substrate showed a heterogeneous expression pattern for Nanog. To isolate the FDG positive

PAGE 57

57 and negative population, we performed FACS sepa ration (Figures 3-17A and 3-17B). We found that approximately 6% of ESCs were negative for FDG. To further understand the expression profiles of these two sub-populations, we analyz ed the RNA expression of the FDG negative and positive populations by RT-PCR (Figure 3-17C). While Nanog, Oct4, Rex1, and Sox2 were more highly expressed in the FDG positive popula tion, we found that Gata-6 was more highly expressed in the FDG negative population. Thes e data suggest that Nanog and Gata-6 are expressed heterogeneously during ESC maintenance a nd their expression is localized to distinct subpopulations. To examine the heterogeneity of Nanog on the protein level, we performed immunocytochemistry in R1 ESCs (Figure 3-18 ). These data confirm the heterogeneous expression of Nanog during normal ESC maintenance conditions. To further examine the gene expression prof ile of these two subpopulations, we performed a microarray analysis from the RNA extracted fr om each of these cell types. The microarray data fell into a linear plot, confirming the quality of the microarray results (Figure 3-19). From the expression analysis, we found that 917 gene s showed increased expression in the FDG+ population by 2-fold or more, while 542 genes showed increased expression in the FDGpopulation by 2-fold or more (Figure 3-20). 1,236 genes were expressed above background in both populations. In the FDG+ population we f ound that there was increased expression for genes involved in ESC maintenance, cell-cycle regulation, and mitochondri al function (Tables 31, 3-2, and 3-3). In the FDGpopulation, we f ound increased expression of genes important for primitive endoderm formation, cell-cycle inhibiti on, and extracellular matrix formation (Tables 3-1, 3-2 and 3-4). Nanog Represses Gata-6 Nanog has previously been suggested to functio n as a repressor of Gata-6 (Mitusi et al., 2003). This prediction, coupled with our findi ng that Nanog and Gata-6 are expressed in

PAGE 58

58 separate subpopulation during ESC maintenance, pr ompted us to explore if Nanog could directly repress Gata-6. Previously we developed a te tracycline-off, Nanog-inducible (Nanog-TRE) ESC line (Hamazaki et al., 2004). When doxycyclin e is removed from the media, Nanog is overexpressed, and the cells can be maintained in the absence of LIF. To examine how Nanog overexpression would affect Gata-6 expression, Nanog-TRE ESCs and parental cells (TopES) were maintained in LIF media for 3 days with or without the addition of doxycycline. RNA was extracted from these cells and the expression of Gata-6 and Nanog were analyzed by RT-PCR (Figure 3-21A). We found th at when Nanog was overexpresed by the removal of doxycycline, there was a loss of primitive endoderm markers Gata-4, Gata-6, and Dab2. Additionally, there was a loss of extracellular matrix marker s, Fibrillin1, Fibronectin, and Laminin 1. Interestingly, we found that there was not a subs tantial loss of cell cycl e inhibitors INK4B and KIP1. Altogether these data suggest that a lo w level of differentiation takes place during normal ESC maintenance conditions. To confirm that Gata-6 repression by Nanog overexpression occurs at the transcriptional level, we measured the activity of the Gata-6 promoter using a -galactosidase reporter containing a 5.5 kb promoter regi on (Figure 3-21B). Nanog-TRE ES Cs were transfected with the Gata-6 -gal reporter vector or a -gal control vector, and maintained in the presence or absence of doxycycline for 2 days. Nanog overexpression significantly reduced -gal activity from the Gata-6 reporter by approximately 2-fo ld, but had no significant effect on the control reporter. Since Nanog expression could bl ock Gata-6 promoter activity, we decided to test if Nanog could directly interact with the Gata-6 pr omoter. The potential Nanog binding sequence has been previously determined using SELEX to be ‘(C/G)(G/A)(C/G)C(G/C)ATTAN(G/C)’ (Mitsui

PAGE 59

59 et al., 2003). Using this sequence we manually analyzed the previously characterized Gata-6 promoter/enhancer region of approximately 5.5 kb, to look for the highly conserved ‘ATTA’ domain, characteristic of many homeodomain-containing factors. We identified 12 of these regions as putative Nanog binding sites (Table 3-5). To perform a chromatin immunoprecipitation as say based on these putative binding sites, we first confirmed the ability to immunoprecipitate Nanog (Figure 3-22A). We next developed 5 primer sets surrounding these putative binding sites, and analyzed Nanog binding to these regions by chromatin immunoprecipitation (F igure 3-22B). We found that Nanog only immunoprecipitated with the most proximal binding s ite, suggesting this is a likely binding site on the Gata-6 promoter for Nanog in vivo . To further confirm that th is site is required for Nanog repression of Gata-6, we mutated the conserve d ‘ATTA’ domain of this most proximal binding site to a ‘GGCC’ on the Gata-6 -galactosidase reporter and repeated these activity assays (Figure 3-23). Using the mutated reporter with the Nanog overexpressi ng inducible cells, we surprisingly found that mutation of this site led to a complete loss of activity for the reporter. These data suggest that this si te on the Gata-6 promoter is cr itical for Nanog binding, and also facilitates Gata-6 activation. A ltogether, these data suggest th at Nanog binds to and directly represses the Gata-6 promot er during ESC maintenance. Consistency in ESCM Differentiation Another considerable obstacle for the use of ESCM in cell-based therapies as a treatment for cardiovascular diseases is the consistency of differentiation to cardiomyocytes. We have found that cardiac differentiation of ESCs can be quite variable from experiment to experiment, and that the percent cardiomyocyte formati on can range from 0.1-5.0% when ESCs are differentiated by the hanging drop method (data not shown). We pred icted that this high

PAGE 60

60 experimental inconsistency could be partially due to variations in serum. To address this question, we decided to analyze 4 different lo ts of fetal bovine seru m from 3 independent companies. R1 ESCs were differentiated by the hanging drop method in differentiation media with 20% FBS from each of the different lots. As the use of Serum Replacement Media (SRM, Sigma) has been suggested to improve cardiomyo cyte differentiation from ESCs and that the percent of serum during late stages of ESC differentiation may affect cardiomyocyte differentiation, we combined these approaches in the experimental analysis. On day 4 of differentiation, EBs were attached to gelatin coat ed dishes, either in SRM alone, SRM+1% FBS, or SRM+20% FBS. EBs were analyzed by light microscopy on day 2 and day 6 of differentiation (Figure 3-24). Firstly, we found th at lot 2 was generally not permissive of ESC differentiation. EBs from lot 2 were dramatically smaller in size, failed to attach properly, and could not form the appropriate outgrowths found during the later stages of differentiation. Subsequently, EBs differentiated with lot 2 were excluded from further studies. Analysis of the EBs from lots 1, 3, and 4 showed similar phenotyp es on both days 2 and 6. We also found that the % serum dictated the size of EB growth. Fo r example, EBs in SRM alone were smaller than those in SRM+1% FBS, which were smaller that those in SRM+20% FBS. Furthermore, we found that the percent of serum infl uenced the ability for EBs to a ttach to gelatin-coated dishes on day 4 (Figure 3-25). EBs in SRM alone genera lly showed a lessened ability for attachment than those in SRM+1% FBS, while EBs in SRM+ 20% FBS were able to attach almost 100% of the time. We next examined cardiomyocyte differe ntiation with these different serum conditions by counting the number of beating EBs (Figure 326). We found that there was high variability between lot 1 compared to lots 3 and 4, with lo t 1 showing generally a better trend to give increased cardiomyocyte differentiation. Add itionally, we found that there was increased

PAGE 61

61 cardiomyocyte formation in SRM+1% FBS, compar ed to the other two conditions. We next decided to confirm that a reduction in serum to 1% at day 4 of differentiation would increase cardiomyocyte differentiation by more quantitati ve analysis using the MHC-GFP ESC line (Figure 3-27). Indeed, we found that reduction in serum concentration to 1% would lead to increased cardiomyocyte differentiation, comp ared to SRM alone or SRM+20% FBS. Interestingly, we found that in the absence of serum (SRM alone condition) EBs will undergo higher levels of cell death, as determined by PI staining (Figure 3-28). However, the levels of cell death between EBs in 1% or 20% FBS were not significan tly different, suggesting a low level of serum is sufficient to prevent rapid am ounts of EB cell death during differentiation. All of these data combined suggest that both the qua lity and the percent of FBS affect EB growth, attachment, and cardiomyocyte differe ntiation during ESC differentiation.

PAGE 62

62 Nkx2.5 -MHC Mef2c Chibby -actin d0 d4 d7 d10 d14 A Wnt1 Wnt2b Wnt3 Wnt3a Wnt5b Wnt8a Wnt9b Wnt11 0.0 2.0 4.0 6.0Chibby Nkx2.5 B d0 ES d4 EB d7 EB d10 EB d14 EB * * * ** ** ** ** Figure 3-1. Cby expression patter ns during ESC differentiation. A) RNA expression of Cby, cardiac markers, Nkx2.5, -MHC, and Mef2c, and various Wnts determined by RTPCR for ESCs and EBs during differentiati on. B) Real-time PCR analysis of Cby (black) and Nkx2.5 (wh ite), normalized to -actin, in ESCs and EBs during differentiation. Experiments were performe d in triplicate and ar e representative of multiple experiments. Average fold change with st andard deviations are shown, *P<0.05; **P<0.05, for any combination..

PAGE 63

63 AFP-GFP -+ Chibby AFP Oct4 -actin Fgf5 Nanog A Oct4 Nanog Fgf5 Chibby -actin Brachyury-GFP -+ Brachyury B Figure 3-2. Lineage specific expr ession profile of Cby and other ma rkers. A) FACS isolation of primitive endoderm (AFP-GFP cells) at day 4 of differentiation and subsequent RTPCR. B)FACS isolation of mesendoderm (Brachyury-GFP cells) at 4 days of differentiation and subsequent RT-PCR. Cby is expressed in all negative and positive GFP populations.

PAGE 64

64 Figure 3-3. Cby is expressed in cardiomyocyt es. A) Immunocytochemistry of Cby of MHCGFP EBs after 15 days of differentiation. High Cby expression colocalizes with MHC-GFP cells, bar 0.1 mm. B) FACS is olation and real-time PCR of MHC-GFP cells. Purification of cardiomyocytes by FACS shows Cby and Nkx2.5 expression increased significantly in the GFP+ cells, co mpared to GFPcells, by real-time PCR. Mean fold change of samples in triplic ate with standard de viations are shown, *P<0.005; **P<0.001. Phase DAPI MHC-GFP Anti-Cby Merge A 0 50 100 150 MHC-GFP -+ 0 1 2 3 4* ** Chibby Nkx2.5 0 50 100 150 MHC-GFP -+ 0 1 2 3 4* ** 0 50 100 150 MHC-GFP -+ 0 50 100 150 MHC-GFP -+ 0 1 2 3 4* ** Chibby Nkx2.5 Chibby Nkx2.5 B

PAGE 65

65 0 100 200 300 400Lung Liver Heart Lung Liver Heart E12.5 Adult 0 1 2 3 4Lung Liver Heart Lung Liver Heart E12.5 Adult Chibby Nkx2.5 * * * * * * * * 0 100 200 300 400Lung Liver Heart Lung Liver Heart E12.5 Adult 0 1 2 3 4Lung Liver Heart Lung Liver Heart E12.5 Adult 0 1 2 3 4Lung Liver Heart Lung Liver Heart E12.5 Adult Chibby Nkx2.5 Chibby Nkx2.5 * * * * * * * * Figure 3-4. Real-time PCR for Cby and Nkx2.5 in embryonic and adult mice hearts. Cby is approximately 3-fold higher in the heart, compared to lung or liver. . Average fold change of experiment in triplicate with standard deviations are shown; *P<0.001.

PAGE 66

66 AGGAGTTAACTGGCTGATGGGGAGAAGAAACAGCTCCCAGACAGAGGGCAACGAGGCTGG Tranfac score AAGGAAAACACTCCTGGATGCTGCCCAGCCCCACGGCCACTAGCCACACACCAAAACAAA AGTTCTGAAATTTGGTTAGCGTGACTAAAGAAATTAATAACCAATACATGGTAAAAATTT AAAATATTTGTTTATTCGTATTTTGGACAAACCGAG TTAAGTG CAACAATAG TCAAGTT A 97, 86 ATTTAATCTGTTTTGAATTGACTTGTTAAAAAGCCTAGGGCCGGGTATGGAGCACTAGCC TTTAATCCCAGCGCTCTGGAGAAAGAGGCGGGAGGACTTTTGTAAGTTGGGAGAGCAGCC AGAACTACATATTGAGCCCCAGTCTCAAATATCAAACAAACAAAGCGGGGCTGGTGAGAT GGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCCCAGCA ACCACATGGTGGCTCACAACCATCCGTAACGAGATCTGACTCCCTCTTCTGGAGTGTCTG AGGACAGCTACAGTGTACTTACATATAATAAATAAATAAATAAATCTTAAAAAAAAAAAA ACAAACAAAGCAAAAGGGTAGGGGTTGAAGGCAGGCTGGGTGTGTGTCTGTAATTCCAGC ACTGAGAGGCTGAGGCAGGAGGATGAGATAAGGAGTACCCAGGGAGACTTTATCTCAAAA TACGAAAGGTGCTTCGGGGATAGCACCGGTAGAGGGCGCACAAGGTTTAATATCAAAAAG CTTCTAGAGCCTGGCGGTGGTGGCGGACGCCTTTAATCCCAG CACTTGG GAGGCAGGCGG 88 ATTTCTGAGTTTGAGGCCAGCCTGGTCAACAGACTGAGTTCCAGGACAGCCAGGGCTACA CAGAGAAACCCTGTCTCGAAAAAAACAAACAAGCAAACAAACAAACATACAAACAAACAA ACAAACAAAAAAACTTCTAGAATGATCGCAACTTTCAAATGTGTTCTGCTTTATGTTTCT GTAGCGGTTGCTACACTAGATATGGTTGATTTTGATGTGGAATTCTCTCTTCGAACGCTG TGTGGCAAAGGTGGAGGAAGACTGCTTGGAGCTGGGTCCTGTCCTTTATGGTGGGATGAC CTCGTACACCCACTAGGCAGCCAAGAAACGCCTCCTGGATGGCCATTTCTTCATTTACCA AACCGAGCTACAATGTCCTTAG GACTTGA GGAATCCTGGAGCTGACTCTCCAGTTCTCTA 86 CCCCTTGTACACTGGGCAACCTTCCCTGGACCTCAGTTTCCCTTGCTTGTGGGAGTGTGG AGGAGGCAAGACTGGCAGGAGCCAGTTTGCTACTGGCAGGGAGTCGTCATATCTGTCCGT CTGTCTTACCTGAAAGCTTCGGCAGAAGCGTCAGGGCGGGTTCCGCCACCAGCCCCTCCA GTGACCGGACCAAGCTCCGGATGTCCGCCAGCATCCGCGGCCCAAGGGGCGCGGTTTGCT TTGTGGCCGGGGCGGGGGAGCTGCAGGTCGGTCCATTTTGCTACTGTGAGTCCAGCCTGG GTCAC CACTTAA CATTTTTAACACAACAAAGCAGCTTTCGGCCTGCTTTGTTGCCAAGGA 97 AAACGATTACTATGACGACGGCGGCGCTGACCCGGGGACCAGACCAACGTATTTAGGGGG TCATGCCTCTCCCAGCCTATGCCACAAGGCATGTGTGTATCTCCAGAAGTCGTGCCCAAG GCATGTGTGTATCTCCAGAAGTCGTGCCCAAGGCTTTCTTCTATTCGTGAACCTTAGAGA GTCCGCAGGGGCTCCGCTGCTTCGCGGAGGCTCGTCTCGGAGCTGGCTCCCTCTGCATTC TCAGTGGTAGAAGCCAGAGAGGCTGCGCATGCGCACGATGGTTGCCCGGCGCCGGCCAAT CGCGGTCGCGGCGGTTGACGCGGCCTGGGCAGATCCTTGCAGAAAGCTGCAGGCTAGCTC GGGATTCCGGCTTCGCAGACAG Figure 3-5. Five putative Nkx2.5 binding sites are present in the mouse Cby 2 kb promoter sequence (red) as determined by TRANSFAC analysis (http://motif.genome.jp/ ). Two of these sites are predicted to be high affinity binding sites with a score of 97 out of 100. Exon 1, which begins the 5’ UTR, is highlighted blue.

PAGE 67

67 Figure 3-6. Nkx2.5 can bind to both the proximal and distal binding site on the Cby promoter in vitro . A) Nkx2.5 homedomain can bind to the distal site (-1719) shown with 3-fold serial increasing concentrations (lanes 16). B) Nkx2.5 homeodomain can bind to the proximal site (-370) shown with 3-fold serial increasing concentra tions (lanes 1-6). C) Full-length Nkx2.5 can bind to the distal site (-1719) shown with 3-fold serial increasing concentrations (lanes 1-6). D) Full-length Nkx2.5 can bind to the proximal site (-370) shown with 3-fold serial increasing concentra tions (lanes 1-6). Closed arrowhead, shifted probe; open arrowhead, fr ee probe; F, free probe only lane; lane 7, mutated Nkx2.5; lane 8, MBP. [x10-9M] [x10-9M] Exon1 -370 -1719 F 1 2 3 4 5 6 7 8 F 1 2 3 4 5 6 7 8 F 1 2 3 4 5 6 7 8 F 1 2 3 4 5 6 7 80 0.3 0.7 2.1 6.4 19 58 58 100 0 0.3 0.7 2.1 6.4 19 58 58 100 0 0.3 1.0 3.0 9.1 27 82 58 100 [x10-9M] [x10-9M] Kd= 3.0 -9.1 x 10-9MKd= 3.0 -9.1 x 10-9M Kd= 2.1 -6.4 x 10-9M Kd= 0.7 -2.1 x 10-9M0 0.3 1.0 3.0 9.1 27 82 58 100[x10-9M] [x10-9M] Exon1 -370 -1719 F 1 2 3 4 5 6 7 8 F 1 2 3 4 5 6 7 8 F 1 2 3 4 5 6 7 8 F 1 2 3 4 5 6 7 80 0.3 0.7 2.1 6.4 19 58 58 100 0 0.3 0.7 2.1 6.4 19 58 58 100 0 0.3 1.0 3.0 9.1 27 82 58 100 [x10-9M] [x10-9M] Kd= 3.0 -9.1 x 10-9MKd= 3.0 -9.1 x 10-9M Kd= 2.1 -6.4 x 10-9M Kd= 0.7 -2.1 x 10-9M0 0.3 1.0 3.0 9.1 27 82 58 100Nkx2.5 (homeodomain) Nkx2.5 (homeodomain) Nkx2.5 (full-length) Nkx2.5 (full-length) A B C D

PAGE 68

68 0 500 1000 1500 2000 2500 3000 3500 4000 4500Relative Luciferase Units+ + + -------+ + + + + --------SV40 Control Chibby Reporter Nkx2.5 Mut. Nkx2.5 * * 0 500 1000 1500 2000 2500 3000 3500 4000 4500Relative Luciferase Units+ + + -------+ + + + + --------SV40 Control Chibby Reporter Nkx2.5 Mut. Nkx2.5 0 500 1000 1500 2000 2500 3000 3500 4000 4500Relative Luciferase Units+ + + -------+ + + + + --------SV40 Control Chibby Reporter Nkx2.5 Mut. Nkx2.5 * * Figure 3-7. Nkx2.5 can activate th e Cby promoter. Increasing concentrations of Nkx2.5 (0.6 and 1.2 g DNA) failed to activate the SV40 control luciferase, but activated Cby luciferase reporter dose-d ependently in NIH3T3 cells; *P<0.001. An Nkx2.5 R190H mutant, incapable of DNA binding, does not activate the Cby reporter

PAGE 69

69 0 100 200 300 400 500 600 700 800 900 1000Relative Luciferase Units Topflash Fopflash -catenin + + + + Chibby--+ + * 0 100 200 300 400 500 600 700 800 900 1000Relative Luciferase Units Topflash Fopflash -catenin + + + + Chibby--+ + * Figure 3-8. Cby inhibits -catenin activity. Overexpression of Cby and constitutive active catenin mutant inhibits -catenin transcriptional activity in ESCs as measured by Topflash/Fopflash luciferase activity. Open bars, topflash; closed bars, fopflash. Average of 3 trials are shown w ith standard deviation, *P<0.05.

PAGE 70

70 3.6% 5.2% 0.1% Negative Control rWnt3aLiCl 3.6% 5.2% 0.1% 3.6% 5.2% 0.1% Negative Control rWnt3aLiCl Figure 3-9. Wnt/ -catenin activators inhibit cardiac diffe rentiation of ESCs. Wnt 3a (10 ng/mL) or LiCl (5 mM) were added to reduce d serum media beginning at day 5 of differentiation of MHC-GFP ESCs. EBs were collected on day 15 and analyzed by flow cytometry

PAGE 71

71 Control Cby RNAi -actin Cby Cby/ -actin 0 0.5 1 1.5Control Cby RNAi -actin Cby Cby/ -actin 0 0.5 1 1.5 Figure 3-10. An immunoblot showing Cby was successfully knocked-down by RNAi. -Actin was used as a loading control. Densit ometry analysis shows more than 80% reduction in Cby protein.

PAGE 72

72 CbyRNAiCbyRNAi + hCby Flag -actin CbyRNAiCbyRNAi + hCby Flag -actin d0 d4 d7 d10d14 Control Cby RNAi +hCby d0 d4 d7 d10d14 Control Cby RNAi +hCby 0 20 40 60 80 100Day 10 Day 12 Day 14 Cby RNAi Control +hCby% beating EBs 0 20 40 60 80 100Day 10 Day 12 Day 14 Cby RNAi Control +hCby% beating EBs Figure 3-11. In vitro differentiation of Cby RNAi cl one showed severely decreased differentiation and decreased number of beating embryoid bodies, which could be rescued by reexpression of hu man Cby. A) Phase-contrast microscopy at days 0, 4, 7, 10, and 14 of control and Cby RNAi clone. Reexpression of human Cby was able to compensate for the loss of endogenous mous e Cby and restore normal outgrowth size for embryoid bodies, bar: 1 mm. B) Percenta ge of beating embryoi d bodies at day 10, 12, and 14 of differentiation. Cby RNAi failed to develop beating areas compared to the empty RNAi vector control. Introduc tion of human Cby compensated for loss of mouse Cby to restore beating areas. More than 25 embryoid bodies were counted per condition per day (more than 75 embryoid bodi es per condition in total). Open bars, control vector; closed bars, Cby RNA i; and shaded bars, +hCby. Data is representative from multiple experime nts. C) An immunoblot showing the reexpression of human flag-C by in the Cby knockdown clone. -actin was used as a loading control. A B C

PAGE 73

73 Figure 3-12. Marker expressi on at early and late stages of Cby knockdown cells during differentiation by RT-PCR. A) RNA expression at days 0 and 4. In Cby knockdown or rescue cells, expression of ES cell markers, Oct4 a nd Nanog, early mesoderm marker, Brachyury, and primitive endoderm markers, Afp (alpha-fetoprotein) and Ttr (transthyretin) appeared normal. B) At day 12 of differentiation, Cby RNAi blocks induction of cardiac markers, Nkx2.5, -MHC, and Mef2c, and endodermal markers, Afp, Albumin, and -antitrypsin. Expression of these markers was rescued by introduction of human C by. Neuroectodermal markers, Nestin and Sox2, were upregulated in the Cby knockdown. Markers, Collagen II, Flk1, and Cytokeratin-19 were unaffected by the knockdown of Cby. A ll data are representative from multiple experiments. The effect from the loss of Cby (outgrowth formation, cardiomyocyte differentiation defect, and reduced marker expr ession) was confirmed in three independent knockdown clones (data not shown). d0 d4 d0 d4 d0 d4 Control CbyRNAi +hCby Oct4 Nanog Afp Brachyury -actin Ttr d0 d4 d0 d4 d0 d4 Control CbyRNAi +hCby Oct4 Nanog Afp Brachyury -actin Ttr d0 d4 d0 d4 d0 d4 Control CbyRNAi +hCby Oct4 Nanog Afp Brachyury -actin TtrCby RNAi Control -actin Nestin Afp Mef2c -MHC Nkx2.5+hCby -antitrypsin Albumin Sox 2 Flk1 Cytokeratin-19 Collagen II Human Chibby -actin Nestin Afp Mef2c -MHC Nkx2.5+hCby -antitrypsin Albumin Sox 2 Flk1 Cytokeratin-19 Collagen II Human ChibbyB A

PAGE 74

74 0 1 2 3 4Flag -actinFlag-Cby/ -actinDox: + ----/+ Hrs: 72 24 48 72 72/24 0 1 2 3 4Flag -actinFlag-Cby/ -actinDox: + ----/+ Hrs: 72 24 48 72 72/24 0 1 2 3 4Flag -actin 0 1 2 3 4Flag -actinFlag-Cby/ -actinDox: + ----/+ Hrs: 72 24 48 72 72/24 Figure 3-13. Overexpression of Cby increases cardiomyocyte differentiation. A) Induction and clearance of tetracycline-off inducible Cby in MHC-GFP ESCs by immunoblotting. Densitometry analysis shows a more than 3-fold increase after Dox removal for 72 hrs, and rapid reduction back to near background levels after 24 hrs of Dox readdition. B) An increase in MHC-G FP+ cells, as determined by fluorescent microscopy, when Cby is overexpressed. Pa rental cell line (MHC-GFP TopES) +/Dox, and MHC-GFP Cby-TRE +/Dox, bar: 0.25 mm. Cby+Cby+ TopESCbyCbyTopESTopES+TopES+ Cby+Cby+ TopESCbyCbyTopESTopES+TopES+A B

PAGE 75

75 MHC-GFP TOP ES + Dox 3.9% MHC-GFP TOP ES -Dox 3.6% MHC-GFP Cby-TRE -Dox 9.9% MHC-GFP Cby-TRE + Dox 4.5% a. 0% Negative control cells b. 0 0.5 1 1.5 2 2.5Fold increase of GFP+ cells over controlDox: + -+ TopES Chibby * MHC-GFP TOP ES + Dox 3.9% MHC-GFP TOP ES -Dox 3.6% MHC-GFP Cby-TRE -Dox 9.9% MHC-GFP Cby-TRE + Dox 4.5% a. 0% Negative control cells MHC-GFP TOP ES + Dox 3.9% MHC-GFP TOP ES + Dox 3.9% MHC-GFP TOP ES -Dox 3.6% MHC-GFP TOP ES -Dox 3.6% MHC-GFP Cby-TRE -Dox 9.9% MHC-GFP Cby-TRE -Dox 9.9% MHC-GFP Cby-TRE + Dox 4.5% MHC-GFP Cby-TRE + Dox 4.5% a. 0% Negative control cells a. 0% Negative control cells b. 0 0.5 1 1.5 2 2.5Fold increase of GFP+ cells over controlDox: + -+ TopES Chibby * b. 0 0.5 1 1.5 2 2.5Fold increase of GFP+ cells over controlDox: + -+ TopES Chibby * Figure 3-14. An increase in the percent MHCGFP cells and cardiac marker expression when Cby is overexpressed. A) Flow cytometry analysis of parental and Cby inducible cells. B) Average of 3 independent flow cytometry experiments normalized to Cby with Dox, *P<0.05. C) RNA expressi on by RT-PCR for cardiac markers, Nkx2.5, MHC, Mef2c; mesoderm marker, Collagen II; and neuroectoderm marker, Nestin. actin is the loading control. A B Dox: + -+-TopES Chibby Nkx2.5 Nestin Collagen II Mef2c -MHC -actin Dox: + -+-TopES Chibby Nkx2.5 Nestin Collagen II Mef2c -MHC -actin Dox: + -+-TopES Chibby Nkx2.5 Nestin Collagen II Mef2c -MHC -actin C

PAGE 76

76 MHC-GFP Cby-TRE –doxday 0-4 MHC-GFP Cby-TRE –doxday 4-15 3.8%7.0% MHC-GFP Cby-TRE –doxday 0-4 MHC-GFP Cby-TRE –doxday 4-15 3.8%7.0% Figure 3-15. The percentage of cardiomyocytes when Cby is overexpressed only in the early or late stages of differentiation. Flow cyto metry analysis of MHC-GFP Cby-TRE ESCs when doxycycline is removed during days 0-4 or 4-15 of differentiation.

PAGE 77

77 Figure 3-16. Heterogeneous expression of Nanog. A) X-gal staining of Nanoggeo ESCs shows Nanog is heterogeneously expressed during normal ESC maintenance. B) Fluorescein-di-D-Galactopyranoside (FDG) staining of Nanoggeo ESCs. Live staining of ESCs confirms he terogeneous expression for Nanog. A B

PAGE 78

78 FL1 -FDG Forward Scatter 2.1% 97.9% FDG-Treated R1 ESCs FDG-Treated NanoggeoESCsa.b.c.Nanog Gata-6 Oct4 Sox2 Rex1 -actin FDG:+Nanog Gata-6 Oct4 Sox2 Rex1 -actin 6.1%93.9%Forward ScatterFL1 -FDG R2 R1 6.1%93.9%Forward ScatterFL1 -FDG R2 R1 FL1 -FDG Forward Scatter 2.1% 97.9% FL1 -FDG Forward Scatter FL1 -FDG Forward Scatter 2.1% 97.9% FDG-Treated R1 ESCs FDG-Treated NanoggeoESCsa.b.c.Nanog Gata-6 Oct4 Sox2 Rex1 -actin FDG:+Nanog Gata-6 Oct4 Sox2 Rex1 -actin 6.1%93.9%Forward ScatterFL1 -FDG R2 R1 6.1%93.9%Forward ScatterFL1 -FDG R2 R1 Figure 3-17. Separation a nd RNA expression of Nanoggeo heterogeneous cell types. A) Flow cytometric analysis of FDG-treated cont rol R1 ESCs. B) FACS of FDG-treated Nanoggeo ESCs and purification of +/cell po pulations. C) RT-PCR analysis for ESC markers Nanog, Oct4, Sox2, and Rex1; a nd endoderm marker, Gata-6, from the FDG-treated Nanoggeo +/ESC populations. A B C

PAGE 79

79 PhaseNanog DAPIMerge PhaseNanog DAPIMerge Figure 3-18. Immunocytochemisty of Nanog in R1 ESCs. Nanog is also heterogeneously expressed at the protein level. Arrows indicate neighboring ce lls, left arrow highly expresses Nanog, while the right arrow shows low expression of Nanog; bar: 0.5 mm.

PAGE 80

80 Figure 3-19. Microarray scat terplot analysis across treatment. Genes present (above background) in at least one sample ( 14,458); Red=High expression, Yellow=Medium expression, Blue=Low expre ssion. Expression normalized to median value of the array.

PAGE 81

81 FDG+ FDGNanog+ Nanog917 542 1,236ES-cell specific Cell Cycle genes Mitochondrial genes Prim. Endo. genes Cell Cycle inhibitors genes ECM genes FDG+ FDGNanog+ Nanog917 542 1,236ES-cell specific Cell Cycle genes Mitochondrial genes Prim. Endo. genes Cell Cycle inhibitors genes ECM genes Figure 3-20. Gene expression profile analys is performed by GenUS Biosystems. A Venn diagram depicting the increas ed and overlapping number of genes expressed in the FDG +/FACS isolated populations.

PAGE 82

82 0 0.5 1 1.5 2 0 1 2 3 EF2 Gata6 Dox: + -gal activity -gal activity 0 0.5 1 1.5 2 0 1 2 3 EF2 Gata6 Dox: + -gal activity -gal activity 0 0.5 1 1.5 2 0 1 2 3 EF2 Gata6 Dox: + -gal activity -gal activity p < 0.05 Dox: + -+ TopESNanog-TRE Oct4 Nanog Gata-4 Gata-6 Dab2 Fibrillin1 Fibronectin Laminin 1 p15/INK4B p57/KIP1 -actin Dox: + -+ TopESNanog-TRE Oct4 Nanog Gata-4 Gata-6 Dab2 Fibrillin1 Fibronectin Laminin 1 p15/INK4B p57/KIP1 -actinA B Figure 3-21. Nanog overexpression reduces prim itive endoderm and Gata-6 activity. A) RNA expression analysis of Nanog inducible ce lls. Nanog-TRE or parental (TopES) ESC line were maintained in the presence or absence of doxycycline for 3 days. RT-PCR was performed for ESC markers Oct4 and Nanog; endoderm markers, Gata-4, Gata-6, Dab2; extracellular matrix genes, Fibrillin1, Fibronectin, Laminin 1, and cell-cycle inhibitors INK4B and KIP1. B) Gata-6 -galactosidase activity in Nanog-TRE ESCs. Overexpression of Nanog by the removal of doxycycline reduced th e activity of the Gata-6 reporter by almost half, but had no effect on an EF2 control reporter.

PAGE 83

83 Input Control IgG Acetylated H3 MethylatedH3 Nanogb.Western: Anti-Nanog 3T3 cellsR1 ES cells IP: Anti-Nanog Set 1 Set 2 Set 3 Set 4 Set 5 Input Control IgG Acetylated H3 MethylatedH3 Nanoga.Western: Anti-Nanog 3T3 cellsR1 ES cells IP: Anti-Nanog Set 1 Set 2 Set 3 Set 4 Set 5 Input Control IgG Acetylated H3 MethylatedH3 Nanogb.Western: Anti-Nanog 3T3 cellsR1 ES cells IP: Anti-Nanog Set 1 Set 2 Set 3 Set 4 Set 5 Input Control IgG Acetylated H3 MethylatedH3 Nanoga.Western: Anti-Nanog 3T3 cellsR1 ES cells IP: Anti-Nanog Set 1 Set 2 Set 3 Set 4 Set 5 Figure 3-22. Chromatin Immunopr ecipitation (ChIP) of Nanog on th e Gata-6 promoter in R1 ESCs. A) Immunoprecipitation and immunoblotting with Nanog antibody (Chemicon). B) PCR analysis from ChIP assays suggest that Nanog can bind to primer set 1, which contains the most proxi mal potential binding site identified (Table 3-5). A B

PAGE 84

84 Mut. Gata-6GGATG ATTA TGGGT ::::: ::::: GGATG GGCC TGGGTNanog-TRE ES cells 0 0.5 1 1.5 2 * Dox: + + --gal activity Gata-6 Mut. Gata-6GGATG ATTA TGGGT ::::: ::::: GGATG GGCC TGGGTNanog-TRE ES cells 0 0.5 1 1.5 2 * Dox: + + --gal activity Gata-6 GGATG ATTA TGGGT ::::: ::::: GGATG GGCC TGGGTNanog-TRE ES cells 0 0.5 1 1.5 2 * Dox: + + --gal activity Gata-6 Figure 3-23. Site-directed muta genesis of the Nanog binding site, identified by ChIP (Figure 322) on the Gata-6 -galactosidase reporter. Mutati on of the consensus ‘ATTA’ led to a complete inactivity of the reporter.

PAGE 85

85 Figure 3-24. Comparison of different lots of se rum on the effect of ES C differentiation, bar 0.5 mm.

PAGE 86

86 0 5 10 15 20 25 30 35 40 45% EBs not attached SRMSRM+1%FBSSRM+20%FBSFBS media comparison FBS-1 FBS-3 FBS-4 Figure 3-25. Comparison of different lots of seru m and the percentage of serum on the effect of EB attachment after 4 days of differentiation.

PAGE 87

87 0 10 20 30 40 50 60 70 80% Beating EBs d10 d12d14d10 d12d14d10 d12d14FBS media comparison FBS-1 FBS-3 FBS-4 SRM SRM + 1% FBS SRM + 20% FBS Figure 3-26. Comparison of different lots of seru m and the percentage of serum on the effect of beating cardiomyocyte formation during ESC differentiation. A reduction to 1% FBS generally leads to highest perc ent of beating cardiomyocytes.

PAGE 88

88 SRM +1% FBS SRM +20% FBS Negative cells SRM 0% 10.1%3.9% 4.1% SRM +1% FBS SRM +20% FBS Negative cells SRM 0% 10.1%3.9% 4.1% Figure 3-27. Comparison of different serum c oncentrations on the formation of MHC-GFP ESCMs by flow cytometry.

PAGE 89

89 EBsin SRM + 1% FBS EBsin SRM + 20% FBS ES cells EBsin SRM 1.6% 15.2% 15.7% 34.6% EBsin SRM + 1% FBS EBsin SRM + 20% FBS ES cells EBsin SRM 1.6% 15.2% 15.7% 34.6% Figure 3-28. Comparison of different serum c oncentration on the percen t cell death during ESC differentiation. The percentage of cell deat h was determined by PI staining and flow cytometry.

PAGE 90

90 Table 3-1. Gene expression prof ile of ESC and PE genes by micr oarray analysis, orange FDG+ > 2.0, blue FDG< 0.5.

PAGE 91

91 Table 3-2. Gene expression profile of cell cycle and mitotic genes by microarray analysis, orange FDG+ > 2.0, blue FDG< 0.5.

PAGE 92

92 Table 3-3. Gene expression profile of mitochondr ial genes by microarray analysis, orange FDG+ > 2.0, blue FDG< 0.5.

PAGE 93

93 Table 3-4. Gene expression profile of extracellular matrix gene s by microarray analysis, orange FDG+ > 2.0, blue FDG< 0.5 .

PAGE 94

94 Table 3-5. Potential Nanog bindi ng sites in the 5.5 kb Gata-6 promoter, identified from the Nanog consensus binding sequence (C /G)(G/A)(C/G)C(G/C)ATTAN(G/C) determined by SELEX. 251 bp Set 5 -4030 : -4020 8/10 CATAC ATTA AG 12 251 bp Set 5 -3843 : -3833 8/10 GGTGC ATTA GC 11 307 bp Set 4 -3548 : -3538 7/10 GGAAA ATTA GG 10 307 bp Set 4 -3368 : -3358 8/10 TGAAC ATTA AG 9 307 bp Set 4 -3300 : -3290 6/10 TGTTT ATTA AC 8 306 bp Set 3 -2589 : -2579 6/10 AACAA ATTA GA 7 306 bp Set 3 -2528 : 2518 6/10 TTTAC ATTA AC 6 306 bp Set 3 -2356 : -2346 6/10 GTAAA ATTA TG 5 169 bp Set 2 -2035 : -2025 5/10 CATTT ATTA TT 4 169 bp Set 2 -2027 : -2017 5/10 ATTTT ATTA GC 3 169 bp Set 2 -1978 : -1977 8/10 GAGAC ATTA TT 2 179 bp Set 1 -255 : -245 8/10 GGATG ATTA TG 1Amplicon Size Gata-6 Primers Location from transcriptional start site Match to consensus Sequence 251 bp Set 5 -4030 : -4020 8/10 CATAC ATTA AG 12 251 bp Set 5 -3843 : -3833 8/10 GGTGC ATTA GC 11 307 bp Set 4 -3548 : -3538 7/10 GGAAA ATTA GG 10 307 bp Set 4 -3368 : -3358 8/10 TGAAC ATTA AG 9 307 bp Set 4 -3300 : -3290 6/10 TGTTT ATTA AC 8 306 bp Set 3 -2589 : -2579 6/10 AACAA ATTA GA 7 306 bp Set 3 -2528 : 2518 6/10 TTTAC ATTA AC 6 306 bp Set 3 -2356 : -2346 6/10 GTAAA ATTA TG 5 169 bp Set 2 -2035 : -2025 5/10 CATTT ATTA TT 4 169 bp Set 2 -2027 : -2017 5/10 ATTTT ATTA GC 3 169 bp Set 2 -1978 : -1977 8/10 GAGAC ATTA TT 2 179 bp Set 1 -255 : -245 8/10 GGATG ATTA TG 1Amplicon Size Gata-6 Primers Location from transcriptional start site Match to consensus Sequence

PAGE 95

95 CHAPTER 4 DISCUSSION AND CONCLUSION Development of Pure, High Percentage ESCM Populations As discussed in great detail in the introduction, there are many obstacles that need to be overcome prior to using ESCM in the clinic. One of the major difficulties for ESC-based therapies is the development of a pure, high perc entage population of the de sired cell lineage. A major theme of this research investigation was to understand signaling path ways and intracellular factors that influence cell-fate specification, such as to ESCM . We hope that by understanding theses pathways, we may then influence the cell-fa te specification during the ESC differentiation to promote our lineage of choice, and perhaps as equally important, to reduce the resulting heterogeneity. Our data suggest that the -catenin antagonist, Cby, facilitates cardiomyocyte differentiation from mouse ESCs. We find that ect opic expression of Cby will lead to a two-fold increase in the number of cardiomyocytes forme d. Cby overexpression did not have any adverse effects on ESC maintenance or differentiation. Th e expression of multiple lineage markers in the Cby-overexpressing embryoid bodies suggests th at Cby was not increasing cardiomyocyte percentages by simply inducing cell death in non-cardiac lineages. Indeed, the general morphology of embryoid bodies with or without Cby overexpression displayed no significant differences in the size of outgrowths, variety of ce ll lineages that develope d, or the total number of cells. These findings are in c ontrast to other reports that increase the purity of cardiomyocytes formed but not necessarily the total percentage of cardiomyocytes, by purification of progenitor cell populations or by inducing th e cell death of non-cardiomyocyt e lineages (Kouskoff et al., 2005; Kanno et al., 2004). Since the ultimate goal of ESC research is to develop a high percentage and pure population of specific lineage cells useful for transplantation, genetic

PAGE 96

96 manipulation by overexpression of exogenous prot eins may not be a feasible approach. However, by understanding the signaling path ways that are critical to cardiomyocyte differentiation, we may then utilize specific factors or chemicals to influence these pathways and improve the differentiation. To this aim, we have attempted to use several chemicals that have been previously reported to direct ly inhibit the interaction between -catenin and Tcf (Rice et al., 2003; Park et al., 2005; Dashwood et al., 2002). Unfortunately, the chemicals tested so far, Sulindac, Quercetin, and EGCG, have prove d too toxic for use in ESC culture. Although we demonstrate that Cby functions to inhibit -catenin dependent transcription activation of downstream genes, how Cby overe xpression leads to an increase cardiomyocyte differentiation is still unknown. Cby may promote the differentia tion of mesoderm progenitors towards a cardiomyocyte fate, and away from non-cardiac mesoderm. Alternatively, Cby may simply promote increased prolif eration of cardiomyocytes. Yet another hypothesis is that Cby may block cell death of normal cardiomyoc yte turnover that may occur during ESC differentiation. By analyzing the percent of cardiomyoc ytes at a fixed time poi nt in late stages of differentiation, we would thus only see the to tal increase the cardiomyocyte population. While the mechanism of Cby function should be dete rmined, these data suggest that by modifying signal transduction cascades, we may influe nce the resulting li neage specification. Recently, Wnt11 was identified as a factor to increase ESCM formation by 2-fold (Terami et al., 2004). Wnt11 promotes non-canonical signaling through JNK and PKC while inhibiting canonical signaling through -catenin (Maye et al., 2004). These data therefore support our findings with Cby. Several groups ha ve suggested a role for Wnts and -catenin in myocyte maturation or regeneration, which may seem at odds with findings presente d here (Polesskaya et al., 2003; Cossu and Borello, 1999). However, the ro le of Cby may not negate a role for Wnt or

PAGE 97

97 -catenin. Wnts may serve to stabilize -catenin to promote its role in adherens junctions to support contractility in myocyt es (Toyofuku et al., 2000). Cby may thus serve to repress the unwarranted -catenin dependent transcriptional regul ation. Other groups have identified factors, such as Noggin, that significantly pr omote cardiomyocyte diffe rentiation from ESCs (Yuasa et al.,2005). Noggin was found to promot e differentiation preferentially in the early phases of differentiation to Brachyur y+ cells and lead to a 100-fo ld increase in cardiomyocyte differentiation. However, it should be noted that the true percentage of cardiomyocytes within the embryoid body population was not determined in their study. The 100-fold increase was determined by immunostaining and confocal micr oscopy. Since embryoid bodies grow in a 3-D structure, the total cardiomyoc ytes within the population ca nnot be determined unless the embryoid body is dispersed into single cells and analyzed by flow cytometry. The 100-fold increase in ESCM formation most likely does no t represent 100% efficiency. However, by using a combination of methods, such as described by Fukada and colleagues, and by our study, we may further promote cardiac differentia tion to reach this ultimate goal. In contrast to our gain-of-f unction studies, which increased ca rdiac differentiation of ESCs, the loss of Cby by RNAi led to an inhibition of normal embryoid body formation, along with a strong decrease in the number of cardiomyocytes. These data, coupl ed with our finding that Cby expression is ubiquitous during ea rly stages of embryoid body differe ntiation, but at late stages of differentiation high Cby expression is f ound primarily in ESC-derived cardiomyocytes, implicates Cby in the cardiac differentia tion cascade. Cby, thus, likely inhibits -catenin activity of downstream genes in precardiac mesoderm to permit the differentiation towards the cardiomyocyte lineage. It is st ill currently unclear what genes are transcriptionally regulated by the Tcf/ -catenin complex that may be repressive to cardiomyocyte development.

PAGE 98

98 Interestingly, in addition to the loss of cardiac differentiation by the knockdown of Cby, there was also a loss of endoderm during the late stages of di fferentiation (day 12), but not during the early stages of differentiation (day 4). This suggests that while Brachyury+ mesendoderm progenitors form normally, their subs equent differentiation to specified mesoderm or endoderm lineages is defective. Additionally, we find an increase in neuroectoderm markers expression in the Cby RNAi. Since, -catenin activity has been reported to be required for neural differentiation of ESCs, the loss of the -catenin antagonist, Cby, may promote neural differentiation at the expense of mesoderm and endoderm differen tiation (Otero et al., 2004). Alternatively, neuroectoderm lineages may simply be over-represented due to the loss of other cell types. The finding that the homeodomain containing pr otein, Nkx2.5, can bind to and activate the Cby promoter is of significant in terest. Nkx2.5 plays a critical ro le in early cardiac development, as the knockout mice are embryonic lethal at day 9-10 postcoitum with a st rong defect in looping morphogenesis (Lyons et al., 1995). Nkx2.5 has also been shown to be essential for in vitro cardiac differentiation through the use of N kx2.5 dominant negatives in P19 embryonal carcinoma cells (Jamali et al., 2001). Sin ce Cby knockdown led to reduced Nkx2.5 expression during ESC differentiation, and Cby overexpressi on increased Nkx2.5 expr ession, it is possible that Nkx2.5 and Cby may regulate each other through a positive feedback loop to enhance cardiac differentiation. The regulation of Cby by Nkx2.5 may also represent a novel mechanism by which Nkx2.5 can affect the Wnt/ -catenin signaling cascade. In summary, our data strongly i ndicates that th e inhibition of -catenin signaling by Cby, most likely following the onset of Brachyury-positiv e mesendoderm progenitors, is a key step in forming cardiomyocytes from ES Cs. Inhibition of the Wnt/ -catenin pathway, perhaps by the

PAGE 99

99 use of small inhibitory molecules, may provide a useful tool to increase cardiomyocyte differentiation from ESCs. By understanding the intracellular signaling pa thways that control cardiomyocyte differentiation from ES Cs, we may further facilitate the potential use of ESCs in cell-replacement therapies for cardiovascular injury and disease. Heterogeneity of ESCs Heterogeneity during ESC differe ntiation is a major concern for the use of ESCM in cellbased therapies. To further complicate ma tters, we have found that ESCs are also a heterogeneous cell type. By examining the e xpression of Nanog, we have found that during ESC culture, Nanog does not have a ubi quitous expression, and 6% of ce lls in an ESC culture stains negative for Nanog. By examining the expression profile of the Nanog positive and negative cells, we found that most ESC markers were more highly expressed in the Nanog positive cells. Furthermore, we found that in the Nanog negative cells, markers for primitive endoderm, Gata-6, Gata-4, and Disabled-2, were more apparent. Additionally, we found that genes important for cell-cycle regulation and mitochondrial functi on were more highly expressed in the Nanog positive cells, while genes that may be inhibitory to the cell cycle and genes involved in extracellular matrix (ECM) formation were more highly expressed in the Nanog negative population. The identification of ECM gene s in the Nanog negative population was quite surprising, as this suggests that th is cell-type is more differentiate d than we previously imagined. However, neither markers for visceral endoderm , AFP and Ttr, nor pariental endoderm, SPARC, were expressed in the Nanog negative cells. This s uggests that this cell lineag e is more likely to represent an early primitive e ndoderm lineage that has yet to fu rther commit to visceral or parietal endoderm. Recently, work from Janet Rossant’s group ha s shown that early stage E3.5 blastocyst embryos also show heterogeneity in the expressi on of markers for Nanog and Gata-6 in a “salt &

PAGE 100

100 pepper” configuration (Chazaud et al., 2006). Previous models for the development of hypoblast vs. epiblast, suggested that the cellular location specifi ed the resulting cell -lineage. However, her work suggests that heterogeneity exists in th e early blastocyst and a “sorting out” mechanism may occur to specify the hypoblast and epiblast lin eages. Considering this data, along with our data showing the heterogeneity of ESCs, suggest that ESCs may be more representative of the inner cell mass from an early blastocyst, than prev iously thought. Furthermore, the aggregation of ESCs may also facilitate a so rting out mechanism to permit further differentiation to visceral endoderm. This work, thus, demonstrates how th e ESC model of differentiation may recapitulate early embryonic development. The low levels of Gata-6 expression duri ng ESC maintenance have been well documented by others (Fujikura et al., 2002). We predict that the Gata-6 positive cells are the differentiated progeny of the Nanog positive cells. However, we speculate that because of the low expression of cell-cycle regulatory genes in the Gata-6 positive cells, these cel ls do not proliferate well, and are unlikely to sustain themselves in prolonged culture. As the Nanog positive cells do express many cell-cycle genes, they have a high capacity for proliferation, and thus remain as the dominant cell-type in the heterogeneous population. Our lab has shown that the FGFR/Grb2/Ras/ Mek/Erk pathway is responsible for the repression of Nanog and development of primitive endoderm (Hamazaki et al., 2006). In the presence of a FGFR inhibitor, there is a clear loss of Gata-6 expressi on and an increase in Nanog expression. This suggests that th is inhibitor will bloc k the low level differentiation to PE that naturally occurs during ESC maintena nce. Furthermore the use of th is inhibitor, or an inhibitor against Mek, would be sufficient to reduce th e heterogeneity during ESC maintenance, which would likely be useful for ESC-based therapies. However, the question remains as to whether

PAGE 101

101 the Gata-6 positive cells s upport the growth of the Nanog positive cells, such as by the development of ECM. Two pieces of evidence may contradict th is hypothesis. First we, and others, have shown that the overexpression of Nanog is sufficient to maintain ESCs in the absence of LIF. In this culture condition, the low level of expression of Gata-6 is lost, along with the heterogeneity during ESC maintenance. We have been able to maintain ESCs in this manner for several months, suggesting that the expr ession of Gata-6 positive cells is not required for the survival of the Nanog pos itive cells. Second, using Nanoggeo ESCs, we can maintain this cell line in the presence of G418, for seve ral months. Again, the expression of Gata-6 positive cells and the heterogeneity is lost. This then confirms that Nanog-positive cells do not require Gata-6 positive cells for survival. Wh ile we found that the Nanog-positive cells can grow in the absence of Gata-6 positive cells, it is still more difficult to deny that the Gata-6 positive cells support the growth of the Nanog positive cells or vice-versa. Further investigation will be needed to address this difficult question. Nanog was previously predicted to serve a direct repressor for Gata-6 transcription (Mitsui et al., 2003). Since we found that Nanog and Gata-6 are expressed in separate subpopulations in ESCs, we decided to investigate if Nanog could truly repress Gata6. We were able to determine that Nanog overexpression could re press Gata-6 RNA expression, a nd also reduce the activity of a Gata-6 reporter. Using chromatin immunoprecip itation methods we were able to determine a binding site for Nanog in a proximal region to the Gata-6 transcripti onal start site. Surprisingly, the mutation of this site in a Gata-6 reporter led to an inactivity of the reporter. We hypothesize from this finding that this site on the Gata-6 promoter may serve to both positively and negatively regulate Gata-6 expres sion. Nanog may thus compete w ith other factors that normally activate Gata-6 transcription. Recently, Gata-6 wa s identified as a direct target of Nanog using

PAGE 102

102 ChIP on Chip based screening in human ESCs (B oyer et al., 2005). This site was also in a proximal region to the Gata-6 tran scription start site. This findi ng confirms our data that Nanog directly repress Gata-6 in mouse ESCs. In summary, the relationship between Nanog and Gata-6 likely dictates the heterogeneity during ESC culture. By furt her understanding the relationship between these two factors, and the signaling pathways that regul ate their expression, we will be able reduce the heterogeneity du ring ESC maintenance and further promote the potential use of ESCs for cell-based therapeutics. Reproducibility of ESCM Formation Another major issue for using ESCM in a clinic al setting is the reprodu cibility of lineagespecific differentiation. The cl assical method for the differentia tion of ESCs to cardiomyocytes calls for the use of the ‘hanging drop’ method w ith differentiation media that contains a high percentage of serum, usually 15-20%. However, one of the drawbacks from this procedure is the experimental inconsistency that occurs. In gene ral, we have found that the percentage of ESCM formed during differentiation can vary from none, to as low as 0.1%, to as high as 5.0%. As the procedure itself does not vary between experiment s, we sought to determ ine the reason for such high rates of inconsistency. We reasoned that the major unknown in the proc edure was the use of Fetal Bovine Serum in the differentiation media. To investigate if this was a likely cause, we compared 4 different lots of serum from 3 independent companies. Furthermore, the percentage of serum in the media has also been suggested to influence cardiomyoc yte differentiation, so we also compared this factor during the experime nt (Sachinidis et al., 2003; Passier et al., 2005). From our initial experiments, we found that serum was absolute ly required during the in itial aggregation of ESCs. Without any serum, or if we tried to replace the serum using KSR (Invitrogen) or SRM (Sigma), we were unable to develop any embr yoid bodies. When we reduced the serum during

PAGE 103

103 later stages of differentiation, we found this also affected cell gr owth and there was an increased amount of cell death in the absence of serum. Furthermore, serum was important for the attachment of embryoid bodies at day 4. When we looked at the percentage of ESCM formation, we found that serum did indeed play a significant role in experimental variability, as we found one lot of serum was significantl y better than the others to pe rmit cardiomyocyte differentiation. More interestingly, we found that the percentage of serum play ed a critical role. While high serum concentrations seemed to be necessary for the initial aggr egation and embryoid body formation, a reduction in serum to 1% seemed more beneficial during the later stages of differentiation to facilita te cardiomyocyte differentiation. Thes e data suggest that serum contains both positive and negative factors that influence cardiomyocyte di fferentiation from ESCs. In summary, we find that both the quality and the quantity of serum will affect cardiomyocyte differentiation from ESCs. However, we should cons ider that serum itself is not ideal for use in the development of ESCM in cell-based therap ies. The use of animal products should be avoided in preparation of ESCM as this would contaminate the cell-type and render it useless in cell transplantation tr eatments. More research needs to be performed to develop methods for the differentiation of ESCs in serum-free conditions. Concluding Remarks The obstacles that challenge ESC researchers are serious and complicated. Some of these obstacles include ethical, soci al, and political controversies, immune tolerance and rejection, heterogeneity during ESC maintena nce and differentiation, and expe rimental inconsistency. The focus of the present research investigati on was on the latter two, with an emphasis on understanding the signaling pathways and fact ors that regulate both ESC maintenance and differentiation to ESCM. Cardiovascular diseases are the leading cause of death in the United States, and are perhaps one of the areas where ES C-based therapeutics may be most beneficial.

PAGE 104

104 ESCs could theoretically provi de an unlimited source of ESCM , which may be useful in transplantation and subsequent rege neration of damaged cardiac tissue. When considering the use of human ESCs fo r cell-based therapies, three areas are of critical interest. First, we should consider th e source of the cells. Human ESCs are traditionally derived from the destruction of th e pre-implantation blastocyst. Th is is thus the area with the highest level of ethical and polit ical controversy. As the tech niques emerge for the development of ESCs that do not lead to the destruction of the embryo, we feel that this consideration will no longer be at the forefront of ES C research. The second area we must consider is the self-renewal of ESCs. ESCs should be maintained in a feed er-free, serum-free enviro nment that would allow for the propagation of the cells without the occurrence of genetic mutations, epigenetic modifications, or chromosomal aberrations. Last ly, the third area we should consider is the differentiation to our lineage of choice. Ag ain, this should be performed in a serum-free environment, where we may obtain a pure, high percentage population of cells useful for transplantation that is free of any permanen t genetic modifications. We believe that by understanding the signaling path ways that regulate lineage sp ecification, these goals may be achieved. In particular, through the use of various factors, EC M, chemicals, peptides, or scaffolds, lineage-specific differentiation may be attainable. In conclusion, while there are many difficulties that are yet to be overcome, continuous research on basic science with ESCs may be very fruitful for the future development of treatments with cell-based therapies.

PAGE 105

105 LIST OF REFERENCES Alvarez-Dolado M, Pardal R, Garcia-Verdugo JM , Fike JR, Lee HO, Pfeffer K, Lois C, Morrison SJ, Alvarez-Buylla A. Fusion of bone -marrow-derived cells with Purkinje neurons, cardiomyocytes and hepatocytes. Nature . 2003; 425: 968. Ambrosetti DC, Scholer HR, Dailey L, Basilico C. Modulation of the activity of multiple transcriptional activation domains by the DNA bi nding domains mediates the synergistic action of Sox2 and Oct-3 on fibroblast growth factor-4 enhancer. J Biol Chem. 2000; 275: 23387– 23397. American Heart Association [Internet]. Dalla s, TX. American Heart Association, Inc. Accessed: October 12, 2006. Available from: http://www.americanheart.org/. Angeloti TP, Uhler MD, Macdonald RL. Assemb ly of GABAA receptor subunits: analysis of transient single-cell expression utilizing a fl uorescent substrate/marker gene technique. J Neurosci . 1993; 13: 1418. Aouadi M, Bost F, Caron L, Laurent K, Le Marchand Brustel Y, Binetruy B. p38 mitogenactivated protein kinase activity commits embr yonic stem cells to either neurogenesis or cardiomyogeneis. Stem Cells. 2006; 24: 1399. Bader A, Gruss A, Hollrigl A, Al-Dubai H, Capeta naki Y, Weitzer G. Paracrine promotion of cardiomyogenesis in embryoid bodies by LIF modulated endoderm. Differentiation . 2001; 68: 31. Bain G, Kitchens D, Yao M, Huettner JE, Go ttlieb DI. Embryonic stem cells express neuronal properties in vitro. Dev Biol .1995; 168: 342. Barandon, L., Couffinhal, T., Ezan, J., Dufourcq, P., Costet, P., Alzieu, P., Leroux, L., Moreau, C., Dare, D., Duplaa, C. Reduction of infarct size and prevention of cardiac rupture in transgenic mice overexpressing FrzA. Circulation. 2003; 108: 2282. Behfar A, Zingman LV, Hodgson DM, Rauzier JM, Kane GC, Terzic A, Puceat M. Stem cell differentiation requires a paracr ine pathway in the heart. FASEB J . 2002; 16: 1558. Bielinska M, Narita N, Wilson DB. Distinct roles for visceral endoderm during embryonic mouse development. Int J Dev Biol .1999; 43: 183. Bin Z, Sheng LG, Gang ZC, Hong J, Jun C, Bo Y, Hui S. Efficient cardiomyocyte differentiation of embryonic stem cells by bone mophogenetic protein-2 combined with visceral endoderm-like cells. Cell Biol Int . 2006; [Epub ahead of print]. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levi ne SS, Zucker JP, Guenther MG, Kumar RM, Murray HL, Jenner RG, Gifford DK, Melton DA, J aenisch R, Young RA. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell . 2005; 122: 947.

PAGE 106

106 Brewer A, Gove C, Davies A, McNulty C, Barro w D, Koutsourakis M, Farzaneh F, Pizzey J, Bomford A, Patient R. The hum an and mouse GATA-6 genes utilize two promoters and two initiation codons. J Biol Chem . 1999; 274: 38004. Buttery LD, Bourne S, Xynos JD, Wood H, Hughes FJ, Hughes SP, Episkopou V, Polak JM. Differentiation of osteoblasts a nd in vitro bone formation from murine embryonic stem cells. Tissue Eng . 2001; 7: 89. de Caestecker M. The transforming growth factor-beta superfamily of receptors. Cytokine Growth Factor Rev . 2004; 15: 1. Carey J. Gel retardation. Methods Enzymol. 1991; 208: 103. Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A. Functional expression cloning of Nanog, a pluripotency su staining factor in embryonic stem cells. Cell. 2003; 113: 643. Chazaud C, Yamanka Y, Pawson T, Rossant J. Ea rly lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Dev Cell . 2006; 10: 615. Chung Y, Klimanskaya I, Becker S, Marh J, Lu SJ, Johnson J, Meisner L, Lanza R. Embryonic and extraembryonic stem cell lines deri ved from single mouse blastomeres. Nature . 2006; 439: 216. Cossu G and Borello U. Wnt signaling and the activation of myogenesis in mammals. EMBO J . 1999; 18: 6867. Dani C, Smith AG, Dessolin S, Leroy P, Staccini L, Villageois P, Darimont C, Ailhaud G. Differentiation of embryonic stem cells into adipocytes in vitro. J Cell Sci . 1997; 110: 1279– 1285. Dashwood WM, Orner GA, Dashwood RH. Inhibition of beta-catenin/Tcf activity by white tea, green tea, and epigallocatechin-3-gallate (EGCG): minor contribu tion of H(2)O(2) at physiologically relevant EGCG concentrations. Biochem Biophys Res Commun . 2002; 296: 584– 588. Davidson G, Wu W, Shen J, Bilic J, Fenger U, St annek P, Glinka A, Niehrs C. Casein kinase 1 gamma couples Wnt receptor activation to cytoplasmic signal transduction. Nature . 2005; 438: 867. Dell’Era P, Ronca R, Coco L, Nicoli S, Metra M, Presta M. Fibroblast growth factor receptor-1 is essential for in vitro cardiomyocyte development. Circ Res . 2003; 93: 414.

PAGE 107

107 Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R. The in vitro development of blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol . 1985; 87: 27. E LL, Zhao YS, Guo XM, Wang CY, Jiang H, Li J, Duan CM, Song Y. Enrichment of cardiomyocytes derived from mouse embryonic stem cells. J Heart Lung Transplant . 2006; 25: 664. Era, T. and Witte, O. N. Regulated expre ssion of P210 Bcr-Abl during embryonic stem cell differentiation stimulates multipotential pr ogenitor expansion and myeloid cell fate. Proc Natl Acad Sci. 2000; 97: 1737. Evans MJ and Kaufman MH. Establishment in cu lture of pluripotential cells from mouse embryos. Nature . 1981; 292: 154. Fehling HJ, Lacaud G, Kubo A, Kennedy M, Robe rtson S, Keller G, Kouskoff V. Tracking mesoderm induction and its specification to the hemangioblast during embryonic stem cell differentiation. Development . 2003;130: 4217. Foley, A.C., Mercola, M. Heart induction by Wnt antagonists depends on the homeodomain transcription factor Hex. Genes Dev . 2005;19: 387. Foshay K, Rodriguez G, Hoel B, Naraya n J, Gallicano GI. JAK2/STAT3 directs cardiomyogenesis within murine embryonic stem cells in vitro. Stem Cells . 2005; 23: 530. Fujikura J, Yamato E, Yonemura S, Hosoda K, Masui S, Nakao K, Miyazaki Ji J, Niwa H. Genes Dev . 2002; 16: 784. Furusawa T, Ikeda M, Inoue F, Ohkoshi K, Hamano T, Tokunaga T. Gene expression profiling of mouse embryonic stem cell subpopulations. Biol Reprod . 2006; 75: 555. Gurdon JB. From nuclear transfer to nuclear re programming: the reversal of cell differentiation. Annu Rev Cell Dev Biol. 2006; [Epub ahead of print]. Hamazaki T, Iiboshi Y, Oka M, Papst PJ, Meach am AM, Zon LI, Terada N. Hepatic maturation in differentiation embryonic stem cells in vitro. FEBS Lett. 2001; 497: 15. Hamazaki T, Oka M, Yamanaka S, Terada N. Aggregation of embryonic stem cells induces Nanog repression and primitive endoderm differentiation. J Cell Sci . 2004;117: 5681. Hamazaki T, Kehoe SM, Nakano T, Terada N. Th e grb2/mek pathway represses nanog in murine embryonic stem cells. Mol Cell Biol . 2006; 26: 7539. Hunt SA. Taking heart—cardiac transpla ntation past, present, and future. N Engl J Med . 2006; 355: 231.

PAGE 108

108 Jamali M, Rogerson PJ, Wilton S, and Skerja nc IS. Nkx2-5 activity is essential for cardiomyogenesis. J Biol Chem . 2001; 276: 42252. Kanno S, Kim PK, Sallam K, Lei J, Billiar TR, Shears LL 2nd. Nitric oxide facilitates cardiomyogenesis in mouse embryonic stem cells. Proc Natl Acad Sc i. 2004;101:12277. Kasahara H., Usheva A., Ueyama T., Aoki, H., Ho rikoshi N., and Izumo S. Characterization of homoand heterodimerization of cardiac Csx/Nkx2.5 homeoprotein. J Biol Chem. 2001; 276: 4570. Kasahara H, and Benson D.W. Biochemical analyses of eight NKX2.5 homedomain missense mutations causing atrioventricular block and cardiac anomalies. Cardiovascular Research . 2004; 64: 40. Kawai T, Takahashi T, Esaki M, Ushikoshi H, Nagano S, Fujiwara H, Kosai K. Efficient cardiomyogenic differentiation of embryonic stem cell by fibroblast growth factor 2 and bone mophogenetic protein 2. Circ J . 2004; 68; 691. Kehat I, Khimovich L, Caspi O, Gepstein A, Shof ti R, Arbel G, Huber I, Satin J, Itskovitz-Eldor J, Gepstein L. Electromechanical integrati on of cardiomyocytes deri ved from human embryonic stem cells. Nat Biotechnol. 2004; 22: 1282. Keller G. Embryonic stem cell differentiation: em ergence of a new era in biology and medicine. Genes Dev . 2005;19:1129. Klimanskaya I, Chung Y, Becker S, Lu SJ, La nza R. Human embryonic stem cell lines derived from single blastomeres. Nature. 2006; [Epub ahead of print]. Klinz F, Bloch W, Addicks K, Hescheler J. I nhibition of phosphatidylinositol-3-kinase blocks development of functional embryonic cardiomyocytes. Exp Cell Res .1999; 247: 79. Korinek V., Nick Barker, Patrice J. Morin, Di ck van Wichen, Roel de Weger, Kenneth W. Kinzler, Bert Vogelstein, Hans Clevers Consti tutive Transcriptional Activation by a b-CateninTcf Complex in APC / Colon Carcinoma. Science. 1997; 275: 1784. Kouskoff V, Lacaud G, Schwantz S, Fehling HJ, Keller G. Sequential development of hematopoietic and cardiac mesoderm dur ing embryonic stem cell differentiation. Proc Natl Acad Sci . 2005;102:13170. Koutsourakis M, Langeveld A, Patient R, Beddi ngton R, Grosveld F. The transcription factor GATA6 is essential for early extraembryonic development. Development . 1999; 126: 723. Koyanagi, M., Haendeler, J., Badorff, C., Brande s, R.P., Hoffmann, J., Pandur, P., Zeiher, A.M., Kuhl, M., Dimmeler, S. Non-canonical Wnt si gnaling enhances differentiation of human circulating progenitor cell s to cardiomyogenic cells. J Biol Chem. 2005; 280: 16838.

PAGE 109

109 Kramer J, Hegert C, Guan K, Wobus AM, Mulle r PK, Rohwedel J. Embryonic stem cell-derived chondrogenic differentiation in vitro: activation by BMP-2 and BMP-4. Mech Dev . 2000; 92: 193. Kuroda T, Tada M, Kubota H, Kimura H, Hatano SY, Suemori H, Nakatsuji N, Tada T. Octamer and Sox elements are required for transcriptio nal cis regulation of Nanog gene expression. Mol Cell Biol . 2005; 25: 2475. Landry DW and Zucker HA. Embryonic death and the creation of human embryonic stem cells. J Clin Invest . 2004; 114: 1184 LaVoie HA. The role of GATA in mammalian reproduction. Exp Biol Med . 2003; 228: 1282– 1290. Lickert, H., Kutsch, S., Kanzler, B., Tamai, Y ., Taketo, M.M., Kemler, R. Formation of multiple hearts in mice following deletion of be ta-catenin in the embryonic endoderm. Dev Cell. 2002; 3: 171. Lu CC, Brennan J, Robertson EJ. From fertilization to gastrulation: axis formation in the mouse embryo. Curr Opin Genet Dev . 2001; 11: 384. Lyons I, Parsons LM, Hartley L, Li R, A ndrews JE, Robb L, Harvey RP. Myogenic and morphogenetic defects in the heart tubes of mu rine embryos lacking the homeobox gene Nkx2-5. Genes Dev . 1995; 9:1654. Maltsev VA, Rohwedel J, Hescheler J, Wobus AM . Embryonic stem cells differentiatie in vitro into cardiomyocytes representing sinusnoda l, atrial and vent ricular cell types. Mech Dev . 1993; 44: 41. Martin GR. Isolation of a plur ipotent cell line from early mous e embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci . 1981; 78: 7634. Matsuda T, Nakamura T, Nakao K, Arai T, Kas uki M, Heike T, Yokota T. STAT3 activation is sufficient to maintain an undifferentiate d state of mouse embryonic stem cells. EMBO J . 1999; 18: 4261. Maye P, Zheng J, Li L, Wu D. Multiple mech anisms for Wnt11-mediated repression of the canonical Wnt signaling pathway. J Biol Chem . 2004; 279: 24659. Meissner A and Jaenisch R. Generation of nuclear transfer-derived pluripotent ES cells from cloned Cdx2-deficient blastocysts. Nature . 2006; 439: 212. Meyer GP, Wollert KC, Lotz J, Steffens J, Li ppolt P, Fichtner S, Hecker H, Schaefer A, Arseniev L, Hertenstein B, Gans er A, Drexler H. Intracoronary bone marrow cell transfer after myocardial infarction: eighteen months’ follo w-up data from random ized, controlled BOOST

PAGE 110

110 (BOne marrOw transfer to enhance ST-e levation infarct regeneration) trial. Circulation . 2006; 113: 1287. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Mura kami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell . 2003; 113: 631. Morali OG, Jouneau A, McLaughlin KJ, Thiery JP, Larue L. IGF-II promotes mesoderm formation. Dev Biol . 2000; 227: 133. Mummery C, Ward-van Oostwaard D, Doevendans P, Spijker R, van den Brink S, Hassink R, van der Heyden M, Opthof T, Pera M, de la Riviere AB, Passier R, Tertoolen L. Circulation . 2003; 107: 2733. Murry CE, Soonpaa MH, Reinecke H, Nakajima H, Nakajima HO, Rubart M, Pasumarthi KB, Virag JI, Bartelmez SH, Poppa V, Bradford G, Dowell JD, Williams DA, Field LJ. Haematopoietic stem cells do not tr ansdifferentiate into cardiac myocytes in myocardial infarcts. Nature . 2004; 428: 664. Murry CE, Field LJ, Menasche P. Cell-based card iac repair: reflections at the 10-year point. Circulation . 2005; 112: 3174. Nakamura, T., Sano, M., Songyang, Z., Schneider, M. D. A Wntand beta -catenin-dependent pathway for mammalian cardiac myogenesis. Proc Natl Acad Sci . 2003;100: 5834. Nemir M., Croquelois A, Pedrazzini T, Radtke F. Induction of cardiogenesis in embryonic stem cells via downregulation of Notch1 signaling. Circ Res . 2006; 98: 1471. Nichols J, Zevnik B, Anastassia dis K, Niwa H, Klew e-Nebenius D, Chambers I, Scholer H, Smith A. Formation of pluripotent stem ce lls in the mammalian embryo depends on the POU transcription factor Oct4. Cell . 1998; 95: 379. Niwa H, Burdon T, Chambers I, Smith A. Self-r enewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev . 1998; 12: 2048. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet . 2000; 24: 372. Nusse R. Wnt signaling in disease and in development. Cell Res. 2005;15: 28. Review. Ogawa K, Nishinakamura R, Iwamatsu Y, Shimos ato D, Niwa H. Synergistic action of Wnt and LIF in maintaining pluripotency of mouse ES cells. Biochem Biophys Res Commun. 2006; 343: 159. Otero JJ, Fu W, Kan L, Cuadra AE, Kessler JA. Beta-catenin signaling is required for neural differentiation of embryonic stem cells. Developmen t. 2004; 131:3545.

PAGE 111

111 Park CH, Chang JY, Hahm ER, Park S, Kim HK , Yang CH. Quercetin, a pot ent inhibitor against beta-catenin/Tcf signaling in SW480 colon cancer cells. Biochem Biophys Res Commun . 2005; 328: 227. Passier R, Oostwaard DW, Snapper J, Kloots J, Hassink RJ, Kuijk E, Roelen B, de la Riviere AB, Mummery C. Increased cardiomyocyte differe ntiation from human embryonic stem cells in serum-free cultures. Stem Cells . 2005; 23: 772. Peifer M. beta-Catenin as Oncogene--The Smoking Gun. Science. 1997; 275 1752. Polesskaya A, Seale P, Rudnicki MA. Wnt signa ling induces the myogenic specification of resident CD45+ adult stem cells during muscle regeneration. Cell . 2003; 113: 841. Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol . 2000; 18: 399. Reya T, Clevers H. Wnt signal ling in stem cells and cancer. Nature . 2005; 434:843. Review. Reya T, Duncan AW, Ailles L, Domen J, Schere r DC, Willert K, Hintz L, Nusse R, Weissman IL. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature . 2003; 423:409. Rice PL, Kelloff J, Sullivan H, Driggers LJ, Beard KS, Kuwada S, Piazza G, Ahnen DJ. Sulindac metabolites induce caspaseand proteaso me-dependent degradation of beta-catenin protein in human colon cancer cells. Mol Cancer Ther . 2003; 2: 885. Sachinidis A, Gissel C, Nierho ff D, Hippler-Altenburg R, Sauer H, Wartenberg M, Hescheler J. Identification of plateled-deriv ed growth factor-BB as cardiog enesis-inducing f actor in mouse embryonic stem cells under serum-free conditions. Cell Physiol Biochem . 2003; 13: 423. Sato N. , L. Meijer, L. Skaltsounis, P. Gr eengard and A.H. Brivanlou, Maintenance of pluripotency in human and mouse embryonic stem cells through activati on of Wnt signaling by a pharmacological GSK-3-specific inhibitor, Nat Med. 2004; 10: 55. Sato H, Takahashi M, Ise H, Yamada A, Hirose S, Tagawa Y, Morimoto H, Izawa A, Ikeda U. Collagen synthesis is required fo r ascorbic acid-enhanced diffe rentiation of mouse embryonic stem cells into cardiomyocytes. Biochem Biophys Res Commun . 2006; 342: 107. Sauer H, Rahimi G, Hescheler J, Wartenbe rg M. Role of reactive oxygen species and phosphatidylinositol 3-kinase in cardiomyocyte differentiation of embryonic stem cells. FEBS Lett . 2000; 476: 218. Schmidt MM, Guan K, Wobus AM. Lithium influe nces differentiation and tissue-specific gene expression of mouse embryonic stem (ES) cells in vitro . Int J Dev Biol . 2001; 45 :421.

PAGE 112

112 Schneider, V.A., Mercola, M., Wnt antagonism initiates cardiogenesis in Xenopus laevis. Genes Dev. 2001;15: 304. Schroeder T, Meier-Stiegen F, Schwanbeck R, E ilken H, Nishikawa S, Hasler R, Schreiber S, Bornkamm GW, Nishikawa SI, Just U. Activated Notch1 alters differentiation of embryonic stem cells into mesodermal cell lineage s at multiple stages of development. Mech Dev . 2006; 123: 570. Singla DK and Sun B. Transforming growth fact or-beta-2 enhances differentiation of cardiac myocytes from embryonic stem cells. Biochem Biophys Res Commun . 2005; 332: 135. Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D. Inhibition of pluripotential embryonic stem cell di fferentiation by purified polypeptides. Nature . 1988; 336: 688. Stewart MH, Bosse M, Chadwick K, Menendez P, Bendall SC, Bhatia M. Nat Methods . 2006; 3: 807. Strubing C, Ahnerrt-Hilger G, Shan J, Wiedenma nn B, Hescheler J, Wobus AM. Differentiation of pluripotent embryonic stem cells into neuronal lin eage in vitro gives rise to mature inhibitory and excitory neurons. Mech Dev . 1995; 53: 275. Takahashi, T., Lord, B., Schulze, P. C., Fryer, R. M., Sarang, S. S., Gullans, S. R., and Lee, R. T. Ascorbic acid enhances differentiation of em bryonic stem cells into cardiac myocytes. Circulation . 2003; 107: 1912. Takahashi K and Yamanka S. Induction of plurip otent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell . 2006; 126: 663. Takemaru, K., Yamaguchi, S., Lee, Y.S., Zha ng, Y., Carthew, R.W., Moon, R.T. Chibby, a nuclear beta-catenin-associated anta gonist of the Wnt/Wingless pathway. Nature. 2003; 422: 905. Terada N, Hamazaki T, Oka M, Hoki M, Mastalerz DM, Nakano Y, Meyer EM, Morel L, Petersen BE, Scott EW. Bone marrow cells adop t the phenotype of other cells by spontaneous cell fusion. Nature . 2002; 416: 542. Terami H, Hidaka K, Katsumata T, Iio A, Mori saki T. Wnt 11 facilitates embryonic stem cell differentiation to Nkx2.5-positive cardiomyocytes. Biochem Biophys Res Commun . 2004; 325: 968. Thom T, Haase N, Rosamond W, Howard VJ, Ru msfeld J, Manolio T, Zheng ZJ, Flegal K, O'Donnell C, Kittner S, Lloyd-Jones D, Goff DC Jr, Hong Y, Adams R, Friday G, Furie K, Gorelick P, Kissela B, Marler J, Meigs J, R oger V, Sidney S, Sorlie P, Steinberger J, Wasserthiel-Smoller S, Wilson M, Wolf P; Amer ican Heart Association Statistics Committee

PAGE 113

113 and Stroke Statistics Subcommittee. Heart di sease and stroke statis tics update: a report from the American Heart Associ ation Statistics Committee and Stroke Statistics Subcommittee. Circulation . 2006; 113: e85. Toyofuku T, Hong Z, Kuzuya T, Tada M, Hori M. Wnt/frizzled-2 signalin g induces aggregation and adhesion among cardiac myocytes by in creased cadherin-beta-catenin complex. J Cell Biol . 2000; 150: 225. Williams RL, Hilton DJ, Pease S, Willson TA, St ewart CL, Gearing DP, Wagner EF, Metcalf D, Nicola NA, Gough NM. Myeloid leukaemia inhib itory factor maintains the developmental potential of embryonic stem cells. Nature . 1988; 336: 684. Wobus AM, Kaomei G, Shan J, Wellner MC, Rohwedel J, Ji Guanju, Fleischmann B, Katus HA, Hescheler J, Franz WM. Retinoic acid acceler ates embryonic stem cell-derived cardiac differentiation and enhan ces development of vent ricular cardiomyocytes. J Mol Cell Cardiol . 1997; 29: 1525. Xu C, Liquori G, Adamson ED, Persico MG. Specific arrest of cardiogenesis in cultured embryonic stem cells lacking Cripto-1. Dev Biol . 1998; 196: 237. Xue T, Cho HC, Aka FG, Tsang SY, Jones SP, Marban E, Tomaselli GF, Li RA. Functional integration of electrically active cardiac deri vatives from genetically engineered human embryonic stem cells with quiescent recipient ventricular cardiomyocytes: insights into the development of cell-based pacemakers. Circulation . 2005; 111: 11. Vassilopoulos G, Wang PR, Russel DW. Transpla nted bone marrow regenerates liver by cell fusion. Nature. 2003; 422: 901. Yamashita, J.K., Takano, M., Hiraoka-Kanie, M. , Shimazu, C., Peishi, Y., Yanagi, K., Nakano, A., Inoue, E., Kita, F., Nishikawa, S. Prospect ive identification of car diac progenitors by a novel single cell-based cardiomyocyte induction. FASEB J. 2005; 19: 1534. Ying QL, Nichols J, Evans EP, Smith AG. Changing potency by spontaneous fusion. Nature . 2002; 416: 545. Ying QL, Nichols J, Chambers I, Smith A. BMP induction of Id proteins suppresses differentiation and sustains embryonic stem ce ll self-renewal in collaboration with STAT3. Cell . 2003; 115: 281. Yuasa S, Itabashi Y, Koshimizu U, Tanaka T, S ugimura K, Kinoshita M, Hattori F, Fukami S, Shimazaki T, Ogawa S, Okano H, Fukuda K. Tr ansient inhibition of BMP signaling by Noggin induces cardiomyocyte differentiatio n of mouse embryonic stem cells. Nat Biotechnol . 2005; 23: 607.

PAGE 114

114 Zeng X, Tamai K, Doble B, Li S, Huang H, Ha bas R, Okamura H, Woodgett J, He X. A dualkinase mechanism for Wnt co-receptor phosphorylation and activation. Nature . 2005; 438: 873– 877. Zhang JG, Owczarek CM, Ward LD, Howlett GJ, Fabri LJ, Roberts BA, Nicola NA. Evidence for the formation of a heterotrimeric complex of leukaemia inhibitory f actor with its receptor subunits in solution. Biochem J . 1997; 325: 693. Zhang X, Stojkovic P, Przyborski S, Cooke M, Armstrong L, Lako M, Stojkovic M. Derivation of human embryonic stem cells from developing and arrested embryos. Stem Cells . 2006; [Epub ahead of print]. .

PAGE 115

115 BIOGRAPHICAL SKETCH Amar Singh was born in Leicester, England, wher e he lived for nine years. He and his family then moved to New Jersey. Five years late r, they relocated to Cape Coral, Florida, where his parents still reside. Amar received his BS in microbiology with a minor in business at the University of Florida in 2000. In 2002, he married his beloved girlfriend of five years, Maureen Hodges. Amar received his MS in medical sc iences, under the guidance of Dr. Thomas W. O’Brien, in 2003, while investigat ing proteins found to associate with mammalian mitochondrial ribosomes. In 2006, Amar obtained his Ph.D in medical sciences in the molecular cell biology concentration in the laboratory of Dr. Naohiro Terada. His research focused on mechanisms that regulate cardiac differentiation a nd heterogeneity of embryonic stem cells. Amar plans to continue his research career as a postdoctoral fellow at the Univer sity of Miami, where he will join the laboratory of Dr. Mary Lou King, to in vestigate basic transcriptional and translational mechanisms that regulate Xenopus oocyte totipotency.