Citation
Regulation of Floral Volatile Synthesis in Petunia x hybrida cv 'Mitchell Diploid'

Material Information

Title:
Regulation of Floral Volatile Synthesis in Petunia x hybrida cv 'Mitchell Diploid'
Creator:
DEXTER, RICHARD JAMES ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Alcohols ( jstor )
Biosynthesis ( jstor )
Corolla ( jstor )
Emissions regulations ( jstor )
Enzymes ( jstor )
Flowers ( jstor )
Ovaries ( jstor )
Petals ( jstor )
Pollination ( jstor )
Pollinators ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Richard James Dexter. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
8/31/2006
Resource Identifier:
649814514 ( OCLC )

Downloads

This item has the following downloads:

dexter_r ( .pdf )

dexter_r_Page_042.txt

dexter_r_Page_043.txt

dexter_r_Page_007.txt

dexter_r_Page_068.txt

dexter_r_Page_078.txt

dexter_r_Page_045.txt

dexter_r_Page_004.txt

dexter_r_Page_060.txt

dexter_r_Page_014.txt

dexter_r_Page_117.txt

dexter_r_Page_038.txt

dexter_r_Page_039.txt

dexter_r_Page_052.txt

dexter_r_Page_022.txt

dexter_r_Page_012.txt

dexter_r_Page_113.txt

dexter_r_Page_034.txt

dexter_r_Page_087.txt

dexter_r_Page_053.txt

dexter_r_Page_099.txt

dexter_r_Page_121.txt

dexter_r_Page_082.txt

dexter_r_Page_048.txt

dexter_r_Page_041.txt

dexter_r_Page_067.txt

dexter_r_Page_119.txt

dexter_r_Page_031.txt

dexter_r_Page_096.txt

dexter_r_Page_044.txt

dexter_r_Page_091.txt

dexter_r_Page_081.txt

dexter_r_Page_001.txt

dexter_r_Page_112.txt

dexter_r_Page_109.txt

dexter_r_Page_030.txt

dexter_r_Page_056.txt

dexter_r_Page_059.txt

dexter_r_Page_089.txt

dexter_r_Page_032.txt

dexter_r_Page_062.txt

dexter_r_Page_072.txt

dexter_r_Page_054.txt

dexter_r_Page_008.txt

dexter_r_Page_074.txt

dexter_r_Page_026.txt

dexter_r_Page_116.txt

dexter_r_Page_010.txt

dexter_r_Page_003.txt

dexter_r_Page_103.txt

dexter_r_Page_107.txt

dexter_r_Page_123.txt

dexter_r_Page_065.txt

dexter_r_Page_080.txt

dexter_r_Page_098.txt

dexter_r_Page_036.txt

dexter_r_Page_058.txt

dexter_r_Page_061.txt

dexter_r_Page_051.txt

dexter_r_Page_094.txt

dexter_r_Page_063.txt

dexter_r_Page_064.txt

dexter_r_Page_037.txt

dexter_r_Page_100.txt

dexter_r_Page_104.txt

dexter_r_Page_027.txt

dexter_r_Page_005.txt

dexter_r_Page_047.txt

dexter_r_Page_115.txt

dexter_r_Page_033.txt

dexter_r_Page_095.txt

dexter_r_Page_011.txt

dexter_r_Page_029.txt

dexter_r_Page_101.txt

dexter_r_Page_079.txt

dexter_r_Page_077.txt

dexter_r_Page_057.txt

dexter_r_pdf.txt

dexter_r_Page_040.txt

dexter_r_Page_111.txt

dexter_r_Page_013.txt

dexter_r_Page_083.txt

dexter_r_Page_024.txt

dexter_r_Page_035.txt

dexter_r_Page_118.txt

dexter_r_Page_070.txt

dexter_r_Page_093.txt

dexter_r_Page_021.txt

dexter_r_Page_028.txt

dexter_r_Page_050.txt

dexter_r_Page_066.txt

dexter_r_Page_097.txt

dexter_r_Page_120.txt

dexter_r_Page_084.txt

dexter_r_Page_075.txt

dexter_r_Page_086.txt

dexter_r_Page_108.txt

dexter_r_Page_006.txt

dexter_r_Page_102.txt

dexter_r_Page_071.txt

dexter_r_Page_017.txt

dexter_r_Page_020.txt

dexter_r_Page_049.txt

dexter_r_Page_105.txt

dexter_r_Page_110.txt

dexter_r_Page_055.txt

dexter_r_Page_092.txt

dexter_r_Page_046.txt

dexter_r_Page_122.txt

dexter_r_Page_019.txt

dexter_r_Page_073.txt

dexter_r_Page_023.txt

dexter_r_Page_009.txt

dexter_r_Page_025.txt

dexter_r_Page_076.txt

dexter_r_Page_106.txt

dexter_r_Page_016.txt

dexter_r_Page_090.txt

dexter_r_Page_015.txt

dexter_r_Page_069.txt

dexter_r_Page_018.txt

dexter_r_Page_114.txt

dexter_r_Page_085.txt

dexter_r_Page_088.txt

dexter_r_Page_002.txt


Full Text












REGULATION OF FLORAL VOLATILE SYNTHESIS IN Petunia x hybrida CV
"MITCHELL DIPLOID"


















By

RICHARD JAMES DEXTER


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Richard James Dexter

































To my family; my wife Stephanie; and our two puppies Misty and Carley.















ACKNOWLEDGMENTS

I thank my supervisory committee for all of their hard work, advice and patience. I

especially thank my advisor (Dr. David Clark) for all his guidance and advice on how to

be a better scientist and be a better professional. I thank Dr. Harry Klee for his advice

and allowing me to roam his lab for the past 5 years; Dr. Kevin Folta, for his advice on

the interaction of light and volatile production, and his unique outlook on my research;

and Dr. Charlie Sims for his help with human olfactory panels. I also extend a special

thanks to Dr. Eric Schmelz, for all of his assistance and time invested into measuring

internal volatile pools in wounded petunia leaves.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S .................................................................... ......... .............. iv

L IST O F T A B L E S ......... ..................................................... ........... ....... .. viii

LIST OF FIGURES ......... ............................... ........ ............ ix

ABSTRACT ........ .............. ............. ...... ...................... xi

CHAPTER

1 INTRODUCTION AND LITERATURE REVIEW .............................................1

In tro du ctio n ......................................................... ............... ................. .
Components of Floral Volatile Emission ........................................... ...............2
Physiological Roles of Floral Volatiles .............................................. .................. 3
Pollinator Interactions ........................... ...... .... .................. 3
D defense C om pounds..................................................... ........................ .. .5
Petunia x hybrida cv "Mitchell Diploid" ........................................ ...............6
M itchell Diploid Floral Volatile Em mission ....................................... ............... 7
Benzenoid/Phenylpropanoid Biochem istry ........................................ .....................7
BA H D Fam ily of A cyltransferases...................................... ........................... ........ 8
Complex Regulation of Floral Volatile Synthesis............................................9
Spatial R regulation of Floral V olatile Synthesis................................. .....................9
Developmental Regulation of Floral Volatile Emission............................................ 11
Temporal Regulation of Floral Volatile Emission.................. ................................12
Ethylene-Dependent Regulation of Floral Volatile Emission .............. .....................13
Ethylene Biosynthesis and Signaling Pathways...............................................13
Pollination-Induced Ethylene Production..................................................14
W ound-Induced Ethylene Production ............... .................. ............... .... 14
44568 Transgenic Petunia with Reduced Ethylene Sensitivity ...........................15
Ethylene and Floral Volatile Biosynthesis .................................. ............... 15
Genetic Engineering of Floral Volatile Emission................... ................... ...............16
R research O bjectives.......... ............................................................... ......... .. 19

2 ETHYLENE-DEPENDENT REGULATION OF PhBPBT TRANSCRIPT AND
BENZYL BENZOATE BIOSYNTHESIS IN Petunia x hybrida..................................21

In tro du ctio n ........................................... ................... ..................... 2 1









R esu lts ................................... ................... ....... .. ......... ..................... 2 4
PhBPBT Transcript Levels Following Treatment with Exogenous Ethylene.....24
Post-Pollination PhBPBT Expression............................................. ...............24
PhBPBT Transcript Levels in Petunia Leaves Treated with Ethylene ...............26
Ethylene-Dependent Regulation of PhBPBT Transcript Levels Following
Repeated W wounding Events............................................ ............ ............... 27
D discussion ......... .... ............................... .......... ... ................. 29
Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate
Biosynthesis in Petunia Floral Tissue...........................................................29
Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate
Biosynthesis in Petunia Vegetative Tissue After Wounding...........................32
Experim ental Procedures ............................................................. ............... .34
P lant M material ......................................................................34
cD N A Isolation .......................................................................... ............... 34
PhBPB T Transcript A analysis ........................................ ......................... 34
Internal Benzyl Benzoate Analysis ........................................ ............... 36

3 CHARACTERIZATION OF A PETUNIA ACETYLTRANSFERASE
INVOLVED IN THE BIOSYNTHESIS OF THE FLORAL VOLATILE
IS O E U G E N O L ................................................................................ ....................4 2

P refac e ...............................................................................4 2
Introdu action ...................................... ................................................. 42
R esu lts ................... ............... ... .............. ... ....... ..... ... .. .. ........ ........... 4 4
Identification of a Flower-Specific Putative BAHD Acyltransferase .................44
Suppression of PhCFATExpression Leads to a Decrease in Synthesis and
Emission of Isoeugenol and Several Other Volatiles .................................45
PhCFAT Acetylates Coniferyl Alcohol and Several Other Substrates in a pH-
D dependent M anner ...........4.. ... .... ... .... ............. .....................46
Coniferyl Alcohol is Converted to Isoeugenol by PhCFAT and PhIGS 1 in an
In Vitro C oupled R action ................................................. ...........................48
PhCFAT Expression is Responsive to Ethylene, Shows a Diurnal Rhythm,
and Changes D during D evelopm ent............................................................... 48
D isc u ssio n .............................. ............................ ..... ................. .. ............... 5 0
PhCFAT is a BAHD Acyltransferase Critical to the Production of Isoeugenol .50
PhCFAT Mediates the Synthesis of Other Petunia Floral Volatiles ...................52
PhCFA T Transcription Patterns are Indicative of a Petunia Floral Scent Gene..52
Experim ental Procedures .............. ............................... ...............53
P lant M materials ......... .... ....... ...................................................... ............ 53
cDNA Isolation.................................................. ......... 54
Generation of PhCFATRNAi Transgenic Petunia .............................................54
PhCFAT Expression Analysis by Real-Time RT-PCR ....................................55
V olatile Em mission ........................................ ................... ..... .... 56
Internal Volatile Extraction ..... ............... ............. ..... ...............56
Expression of PhCFAT in Escherichia coli and Purification of Recombinant
Protein ....................................................................... ....... .........................57
E n zy m e A ssay s .............................................................................................. 5 8









C om petition A says ................................................ ...... ......................... 58
C oupled In Vitro R action ........................................................ ............... 59

4 PHYSIOLOGICAL INTERACTIONS AND ENVIRONMENTAL STIMULI........69

In tro d u ctio n ............. ... ............ ........................................................................... 6 9
Physiological Interactions............................ .................. .................. ............... 69
H um an O factory Panels........................................................... ............... 69
P ollinator A attraction ........................ .. ....................... .... .. ........... 70
Defense against Fungal Pathogens ........................... ................................... 73
Environm mental Stim uli ............... ............... ......... .......... ............ 75
L ig h t ................................................................7 5
Temperature ............... ......... ................ 80
Experim ental Procedures ............... ................ ........ .................................82
H um an O factory Panel ............................................... ............................ 82
M anduca sexta Flight Trials........................................... ......................... 82
Fungal Pathogen Experiments ................................... ................. 83
L eight Experim ents ........................................ ................... .. ...... 84
Tem perature Experim ents ............................................................................85

APPENDIX

A PhBPBTRNAI TRANSGENIC PETUNIA......................................................94

In tro d u ctio n ........................................................................................................... 9 4
Results and Discussion .................................... ...... .. ...... ............. 94
Experimental Procedures .................... ...... .......... ......... ..... ............... 95
Construction of PhBPBT RNAi Transgenic Petunia................ ..... ...... ....95
PhBPBTExpression and Volatile Emission Analysis......................................96

B OVEREXPRESSION OF PETUNIA FLORAL VOLATILE SYNTHESIS
G E N E S ............................................................................ 9 8

Introduction ............... .......... .. .................... ........................ 98
Results and Discussion .................................... ...... .. ...... ............. 98
Experim ental Procedures ...................................................................................... 99
Generation of PhBPBT and PhBSMT Overexpression Transgenic Petunia........99
V olatile E m mission ..................................................... .. .... .. .... ........ 99
Expression Analysis .......................... ..... ...... .... ................ 100

L IST O F R E FE R E N C E S ........................................................................ ................... 102

BIOGRAPHICAL SKETCH ........................................................... .................111
















LIST OF TABLES


Table page

3-1 Kinetic parameters of PhCFAT........ ............................................. ............... 64

4-1 The demographics of human olfactory panelists................................................86

4-2 Human olfactory panel results, "ethylene treated vs. air treated flowers". ..............86

4-3 M anduca sexta visitation experiments .......................................... ............... 87

4-4 Extent of floral tissue damage in transgenic petunia 48 h after infection with
B otry tis cinerea ........................................................................89

B-1 Analysis of PhBSMTOE and PhBPBTOE transgenic petunia .............................101
















LIST OF FIGURES


Figure page

1-1 A generalized schematic of biochemical pathways in petunia floral volatile
b io sy nth esis. ....................................................... ................. 2 0

2-1 Mean PhBPBT transcript levels following treatment with exogenous ethylene......38

2-2 The effect of pollination-induced ethylene on PhBPBTtranscript and internal
benzyl benzoate levels............. .... .................................................. ... .. .... ..... 39

2-3 Mean PhBPBT transcript levels (n=3, SE) in petunia leaf tissue following
exogenous ethylene treatm ent. ............................................................................ 40

2-4 PhBPBTtranscript and internal volatile levels in petunia leaves following
repeated w wounding events. .............................................. ............................. 41

3-1 Characterization of the PhCFAT transcript accumulation in petunia.....................60

3-2 Effect of RNAi suppression of PhCFATon emitted and internal volatiles. ............61

3-3 A generalized metabolic pathway for petunia floral volatiles altered in PhCFAT
RNAi transgenic petunia. ............................................... ............................... 62

3-4 Relative activity of PhCFAT with selected alcohol substrates. ............................63

3-5 The coupled in vitro reaction of PhCFAT and PhIGS1 leads to the production of
isoeugenol from coniferyl alcohol....................................... ......................... 65

3-6 Ethylene-dependent regulation of PhCFAT transcript levels..............................66

3-7 Daily light/dark fluctuations in PhCFAT transcript and isoeugenol emission.........67

3-8 Developmental regulation of PhCFATtranscript levels in petunia floral tissue......68

4-1 Diameter ofBotrytis cinerea infection in transgenic petunia 24 h after treatment..88

4-2 Rhythmic emission of petunia floral volatiles .............. ........................................90

4-3 Twenty-four hour volatile emission in MD and 44568 whole flowers. .................91

4-4 Light-dependent regulation of floral volatile emission.........................................92









4-5 Temperature-dependent volatile emission in MD whole flowers ..........................93

A-i PhBPBTRNAi and MD floral volatile emission. .............................................. 97















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

REGULATION OF FLORAL VOLATILE SYNTHESIS IN Petunia x hybrida CV
"MITCHELL DIPLOID"

By

Richard James Dexter

August 2006

Chair: David G. Clark
Major Department: Plant Molecular and Cellular Biology

Floral volatile emission comprises a unique blend of volatile compounds divergent

among species of angiosperms. These volatiles have been proposed to function in a

variety of physiological processes, including pollinator attraction and plant defense

against fungal and bacterial pathogens as well as herbivores. Biosynthesis of floral

volatiles is a tightly regulated process dependent on many factors including time of day,

developmental stage of the flower, pollination status, and wounding. In this study, two

genes from Petunia x hybrida cv "Mitchell Diploid" (MD), benzoyl-CoA: benzyl

alcohol/phenyl ethanol benzoyltransferase (PhBPBT) and acetyl-CoA: coniferyl alcohol

acetyltransferase (PhCFAT), were identified and shown (via RNAi-induced gene

silencing) to be critical to floral volatile biosynthesis in petunia. In PhBPBTRNAi

transgenic petunia lines, benzyl benzoate emission decreased >90%, while emission of

benzyl alcohol and benzaldehyde increased when compared to MD. In PhCFA TRNAi









transgenic petunia lines, isoeugenol emission decreased >90%, with lower levels of

several other volatiles also observed.

To better define the transcriptional regulation of floral volatile biosynthesis genes,

PhBPBT and PhCFATtranscript levels were quantified. Transcript levels from both

genes were primarily expressed in the petal limb, were rhythmically expressed dependent

on the time of day, and underwent developmental regulation with highest levels observed

during anthesis. Utilizing 44568 (35S CaMV:etrl-1) transgenic petunias, effects of

pollination and wound-induced ethylene were also identified. In the corolla, pollination-

induced ethylene decreased transcript levels of both genes. However, in the ovary tissue,

ethylene sensing was associated with an increase in PhBPBTtranscript. Additionally, an

increase in PhBPBTtranscript was also observed in vegetative tissue following

mechanical wounding. Further insight into the effects of environmental stimuli (light and

temperature) on volatile emission, and physiological interactions with pollinator, fungal

pathogens, and humans were also addressed. Improved understanding of the complex

regulation of floral volatile biosynthesis will allow more effective engineering of floral

volatile emission.














CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW

Introduction

Floral volatile emission is composed of a diverse blend of volatile compounds that

is highly variable among species of angiosperms. Production of these volatiles is thought

to lead to more efficient seed set and increased plant defenses, while also increasing the

commercial value of both ornamentals and cut flowers. Over the past decade, these

qualities have made volatile production an attractive target for genetic engineering.

However attempts to date to genetically alter or restore floral volatile emission have been

relatively unsuccessful.

Production of floral volatiles is a tightly regulated process dependent on many

factors including time of day (light/dark cycle), developmental stage of the flower, and

pollination status. In this study, two genes, benzoyl-CoA: benzyl alcohol/phenyl ethanol

benzoyltransferase (PhBPBT) and acetyl-CoA: coniferyl alcohol acetyltransferase

(PhCFAT) were identified, and shown (utilizing RNAi induced gene silencing) to be

critical to floral volatile biosynthesis. Detailed analysis of transcript levels in conjunction

with volatile biosynthesis revealed several common modes of regulation, including

regulation mediated by the gaseous plant hormone ethylene. The goal of this research

was to gain a further understanding into the biosynthetic and hormonal regulation of

floral volatile synthesis to more effectively genetically engineer floral volatile emission.









Components of Floral Volatile Emission

Various floral volatile compounds are emitted at ratios unique to individual species

of angiosperms. These compounds typically have a low molecular weight (100 to 250

D), low polarity, and high vapor pressure (Piechulla and Pott, 2003; Dudareva and

Pichersky, 2000); and can be divided into four major classes depending on their structure:

fatty-acid derivatives, benzenoids and phenylpropanoids, isoprenoids, and nitrogen-

containing compounds (Knudsen et al., 1993). Fatty-acid derived volatiles (eg. n-

hexanol, n-hexanal, and methyl jasmonate) consist mainly of saturated and unsaturated

hydrocarbons generated from the breakdown of fatty acids (primarily linolenic and

linoleic acids) via a family of lipoxygenases (LOX) (Hatanaka, 1993; Seo et al., 2001;

Cheong and Choi, 2003). Benzenoids and phenylpropanoids (the main components of

MD floral volatile emission) are derived from aromatic amino acids phenylalaninee and

tyrosine), and include volatiles such as methyl benzoate and isoeugenol (Knudsen, 1993;

Dudareva and Pichersky, 2000; Boatright et al., 2004, van Schie et al., 2006).

Isoprenoids are the most abundant group of plant volatiles, and are divided into four

groups: irregular (hemi) terpenes, monoterpenes, sesquiterpenes, and diterpenes. Of

these groups, monoterpenes (eg. linalool) and sesquiterpenes (eg. caryophyllene)

comprise the majority of the volatile compounds. The least-abundant group is the

nitrogen-containing compounds, of which indole is the most commonly identified

member (Knudsen 1993; Pichersky et al., 2006).

The amounts and types of volatiles emitted by individual species are diverse. For

example, in C. breweri benzyl acetate is the major constituent of floral volatile emission

(methylsalicylate, linalool, and benzyl benzoate are other minor constituents) (Raguso

and Pichersky, 1995). In A. majus (Snapdragon), methyl benzoate is the main constituent









of its floral volatile emission, along with other volatiles including myrcene and trans-

beta-ocimene (Dudareva et al., 2000). In Rosa hybrid cv "Fragrant Cloud," phenylethyl

alcohol is the major volatile constituent (Guterman et al., 2002).

Physiological Roles of Floral Volatiles

Pollinator Interactions

Floral volatiles have been shown to have many physiological functions in the plant,

including pollinator signaling. For example, in vitro, treatment of paper flowers with

various floral volatiles elicited more frequent hovering and close passes from adult

Manduca sexta, when compared to the untreated controls (Raguso et al., 2002). While

attracted by floral volatiles, these moths never extended their proboscis (an important

step in which the moth is able to collect its nectar reward and enhance pollination)

indicating that floral volatiles might act as long-range signals that guide the pollinator

into close proximity. Once nearby, others factors such as petal color or nectar availability

could induce the moth to extend its proboscis and feed.

More recently, honey bees (Apis mellifera) were shown to relate floral volatile

emission (eg. rose) to a location of a food source. For 2 days, a sugar food source was

placed at two separate locations containing two different scents (eg. rose vs. lemon). The

sugar sources were then removed, and the respective scent was injected directly into the

hive. After injection, the bees visited the location that previously contained the

respective scent and food source (Reinhard et al., 2006). In this case, floral volatile

emission was not the primary attractant, but instead a reminder that led pollinators back

to a location containing a food reward.

For many years, the co-evolution of flowering plants and their respective

pollinators has interested the scientific community (Baker, 1961). One example of









plant:pollinator co-evolution is through temporal emission, where floral volatiles are only

emitted when desired pollinators are active. For example, Snapdragon (Antirrhinum) is a

bee-pollinated angiosperm that maximizes floral volatile emission during the day, when

bees are most active (Dudareva et al., 2000). In contrast, Nicotiana alata is a hawkmoth-

pollinated species with the highest emission of floral volatiles at night, coinciding with

moth activity (Raguso et al., 2003).

In addition to timing of floral volatile emissions, the identity of floral volatiles

emitted is thought to affect pollinator attraction. For example, antennae olfactory

receptor cells from female Manduca sexta were shown to react differently to various

volatiles (Shields and Hildebrand, 2001). Additionally, when Fruit Chafer (Pachnoda

marginata) were released into a box with two exits (one exit contained a control volatile

while the other contained the sample volatile), floral volatiles such as methyl benzoate,

methyl salicylate, and phenylacetaldehyde induced high visitation percentages, while

other volatiles including the green leafy volatiles did not (Larsson et al., 2003).

Not all floral volatiles have been shown to attract pollinators. The flowers of a

sexually-deceptive orchid (Ophrys sphegodes) increase emission of the floral volatile,

famesyl hexanoate, after pollination by solitary male bees (Andrena nigroaenea).

Artificial treatment of flowers with farnesyl hexanoate decreased visits by the male bees

confirming the volatiles' function in deterring visits by pollinators after pollination

(Schiestl and Ayasse, 2001). This is advantageous to the plant since it helps direct

pollinators to un-pollinated flowers, thus increasing pollination efficiency.

While beneficial for pollinator attraction, the production of floral volatiles is not

without risk. Recently it has been shown that floral volatiles produced by Canada Thistle









(Cirsium arvense) attracted 10 different pollinators and 16 different floral herbivores

(Theis, 2006). Benzaldehyde and phenylacetaldehyde (the most abundant volatiles) were

shown to attract both pollinators and herbivores.

Defense Compounds

In addition to pollinator interactions, some floral volatiles are thought to play a role

in plant defense. These volatiles could act either as direct defense compounds, or

indirectly as signaling molecules. To date, there is little evidence supporting a role for

floral volatiles as direct defense compounds. In vitro the floral volatile eugenol (clove

oil) has been shown to act as an anti-bacterial (Salmonella typhimurium, Staphylococcus

aureus and Vibrio parahaemolyticus) and anti-fungal (Cladosporium herbarum) agent

(Karapinar and Aktug, 1987; Adams and Weidenbomer, 1996). Additionally, benzyl

benzoate has been shown to act as a miticide against common mites such as Tyrophagus

putrescentiae (Schrank) and Sheep Mange (Dimri and Sharma, 2004; Harju et al., 2004).

As an indirect defense (signaling) compound, little evidence supporting a role for

floral volatiles in flower defense has been published. However, two floral volatiles,

methyl jasmonate and methyl salicylate, have been shown to act as indirect defense

compounds in vegetative tissue. Methyl jasmonate is a highly fragrant volatile initially

identified in Jasminum grandiflorum and demonstrated to facilitate wound-induced

defense signaling (Cheong and Choi, 2003). In Nicotiana attenuata, treatment of leaves

with exogenous methyl jasmonate led to increased internal levels of nicotine and

decreased damage due to herbivory (Baldwin, 1998). Additionally, treatment of

Lycopersicom esculentum leaves with exogenous methyl jasmonate resulted in increased

levels of proteinase inhibitors 1 and 2, which when ingested by an herbivore, prevent

digestion and limit herbivory (Farmer and Ryan, 1990). Methyl jasmonate has also been









proposed to facilitate the plant systemic response to herbivore-induced wounding (Ryan

and Moura, 2002; Farmer et al., 2003).

Similarly, methyl salicylate (derived from the plant hormone salicylic acid) is

another floral volatile proposed to indirectly induce plant defense (Cauthen and Hester,

1989). Following insect attack, methyl salicylate is emitted from leaves of several

species including tobacco and tomato (Kessler and Bladwin, 2001; Ament et al., 2004;

Effmert et al., 2005). In Nicotiana tabacum, treatment of plants with increasing levels of

exogenous methyl salicylate, reduced tissue damage from tobacco mosaic virus (TMV)

infection and increased expression of the PR-1 gene (Silverman and Raskin, 1997).

Petunia x hybrida cv "Mitchell Diploid"

Over the past 5 years Petunia x hybrida cv "Mitchell Diploid" (MD) has become a

model system for the study of floral volatile emission. It was identified from a backcross

of Petunia axillaris and Petunia hybrid cv "Rose du Ciel" resulting in a haploid plant

(n=7) (Petunia x hybrid cv "Mitchell" (Mitchell et al., 1980)), which, when grown in

tissue culture, spontaneously gave rise to a diploid plant with no genetic variation

between the two sets of chromosomes (Griesbach and Kamo, 1996). The resulting self-

pollinated progeny have an identical genetic composition to the previous generation, and

provides an ideal genetic background for the production of transgenic plants. Other

advantages of MD include a well established transformation protocol (Jorgenson et al.,

1996), a short life cycle, strong floral volatile emission, ethylene-induced floral

senescence (Wilkinson et al., 1997), availability of the ethylene-insensitive 44568

(35SCaMVV:etrl-1) transgenic petunia, and a collection of 10,000 ESTs (Underwood,

2003) that facilitate identification and isolation of novel genes in petunia.









Mitchell Diploid Floral Volatile Emission

MD floral volatile emission is primarily composed of several benzenoid/

phenylpropanoid compounds. Using GC-MS analysis these compounds were identified as

benzaldehyde, phenylacetaldehyde, methyl benzoate, phenylethyl alcohol, isoeugenol,

and benzyl benzoate, with methyl benzoate being the most abundant volatile in the group.

Other volatiles identified include phenylethyl benzoate, vanillin, two sesquiterpenes

(germacene D and cadina-3,9-diene), two aliphatic aldehydes (decanal and dodecanal),

and two fatty-acid derivatives (3-hexenal and 2-hexanal) (Verdonk et al., 2003; Boatright

et al., 2004). Emission of these volatiles is rhythmic with highest emission in the

evening. Spatial analysis showed that the highest emission of volatiles was localized to

the petal limb (Verdonk et al., 2003).

Benzenoid/Phenylpropanoid Biochemistry

Phenylpropanoids and benzenoids make up the primary volatile constituents of

petunia floral volatile emission, and originate from the aromatic amino acid

phenylalanine (Boatright et al. 2004). Via the shikimate pathway, phosphoenol pyruvate

and erythrose 4-phosphate are converted to chorismate, the precursor to the aromatic

amino acids tryptophan, tyrosine and phenylalanine (Weaver and Herrmann, 1997;

Herrmann and Weaver, 1999). Chorismate is converted to phenylalanine through a three

step process, in which prephenate and arogenate are intermediates (Figure 1-1; Knaggs,

2001). Phenylalanine is then converted either to phenylacetaldehyde (with a phenylethyl

amine intermediate (Tieman et al., 2006) or without (Kaminaga et al., 2006)) via an

aromatic amino acid decarboxylase, or converted to trans-cinnamic acid via

phenylalanine ammonia lyase (PAL) (Figure 1-1; Jones H.D., 1984). Phenylacetaldehyde









can then be converted to phenylethyl alcohol (rose oil) via 2-phenylacetaldehyde

reductase, a commercially important enzymatic process.

Trans-cinnamic acid is the precursor to several benzenoid and phenylpropanoid

volatile compounds that make up the floral volatile emission of petunia. Through the use

of radioactive feeding studies, trans-cinnamic acid has been shown to be a precursor of

several benzenoid compounds including benzoic acid, benzyl alcohol, benzaldehyde,

benzyl benzoate, and benzyl acetate (Figure 1-1; Boatright et al., 2004). Additionally, it

can be converted to coniferyl alcohol via the phenylpropanoid pathway (Dixon and Paiva,

1995). Coniferyl alcohol is then converted to isoeugenol via a two-step pathway

(Koeduca et al., 2006; Chapter 3).

BAHD Family of Acyltransferases

The BAHD family of acyltransferases is made up of a group of enzymes that

transfer CoA-thioesters to a diverse group of substrates (D'Auria, 2006). This family

was named after the first four enzymes characterized including benzyl alcohol O-

acetyltransferase (BEAT) from C. breweri, anthocyanin O-hydroxycinnamoyltransferase

(AHCT) from Gentiana triflera, anthranilate N-hydroxycinnamoyl/benzoyltransferase

(HCBT) from Dianthus caryophyllus, and deacetylvindoline 4-O-acetyl-transferase

(DAT) from Catharanthus roseus (St-Pierre and De Luca, 2000). These enzymes contain

two conserved motifs (HxxxD and DFGWG) critical to the function of the transferase

(St-Pierre and De Luca, 2000). Determination of the crystal structure of vinorine

synthase (a BAHD enzyme that catalyzes the formation of ajmaline in Rauvolfia

serpentine) further clarified the importance of these motifs to enzyme function (Ma et

al., 2005). In the HxxxD motif, the H160 residue is located within the solvent channel at

the active site of the enzyme. The D164 residue points in the opposite direction, away









from the active site, and seems to have a structural function. While critical to the

function of the enzyme, the DFGWG motif is far removed from the active site of the

enzyme, and thought to have a purely structural role.

Several members of the BAHD family of acyltransferases have been shown to

catalyze floral volatile biosynthesis. These enzymes include acetyl-CoA: benzyl alcohol

acetyltransferase (CbBEAT) from C. breweri shown to catalyze the production of benzyl

acetate and benzoyl-CoA: benzyl alcohol benzoyl transferase (CbBEBT) from C. breweri

shown to primarily catalyze the production of benzyl benzoate, NtBEBT from Nicotiana

tabacum also shown to primarily catalyzed the production of benzyl benzoate, benzoyl

CoA: benzyl alcohol/phenyl ethanol benzoyltransferase (PhBPBT) from Petunia x

hybrida shown to primarily catalyze the production of benzyl benzoate and phenylethyl

benzoate, and geraniol acetyltransferase (RhAAT) from Rose hybrida shown to primarily

catalyze the production of geranyl acetate, (Dudareva et al., 1998a; D'Auria et al., 2002;

Shalit et al., 2003; Boatright et al., 2004).

Complex Regulation of Floral Volatile Synthesis

Floral volatile biosynthesis is a highly regulated process dependent on may factors

including tissue type (spatial), time of day (light/dark cycle), developmental stage, and

pollination status (ethylene). Through this complex regulation, floral volatile emission is

more efficiently produced to coincide with peak pollinator activity and flower fertility,

while reducing the risk of inadvertently attracting herbivores (Theis, 2006).

Spatial Regulation of Floral Volatile Synthesis

The spatial regulation of floral volatile biosynthesis gene expression varies

dependent on the gene and species. For example, the C. breweri acetyl CoA: benzyl

alcohol acetyltransferase (CbBEAT), which encodes an acyltransferase shown to catalyze









the synthesis of benzyl acetate, was expressed exclusively in the flower, with highest

transcript levels localized to the petal, sepal, and style (Dudareva et al., 1998a). This

pattern of transcript accumulation was shown to coincide with spatial emission of the

volatile benzyl acetate (Dudareva et al., 1998b).

Benzoyl-CoA: benzyl alcohol benzoyltransferase (CbBEBT), another gene

identified in C. breweri, encodes an enzyme that catalyzes production of benzyl benzoate

(D'Auria et al., 2002). Using northern blot analysis, RNA was shown to accumulate

primarily in the petal limb, with transcript also identified in the stamens, style, sepals, and

petals. Transcript levels were also measured in the leaves 4 h after wounding. In the

flower, benzyl benzoate emission coincided with CbBEBTtranscript levels with highest

emission measured from the stigma, and lower levels measured from other parts of the

flower. Benzyl benzoate emission from the leaves was not reported (D'Auria et al.,

2002).

Another floral volatile biosynthesis gene isolated and characterized from C.

breweri, S-adenosyl-L-methionine: (iso)eugenol O-methyltransferase (CblEMT),

expression was again shown exclusively in the flower with highest levels of expression

localized to the petal, and lower expression in the style and stamen (Wang et al., 1998).

This pattern coincided with volatile emission (eugenol, isoeugenol, methyleugenol, and

isomethyleugenol), with highest levels emitted from the petal limb, and some emission

observed in the style and stamen (Wang et al., 1998).

In MD, several floral volatile biosynthesis genes have been identified and

characterized. These genes include S-adenosyl-L-methionine: benzoic acid/salicylic acid

methyltransferase (PhBSMT] and 2), benzoyl-CoA: benzyl alcohol/phenyl ethanol









benzoyltransferase (PhBPBT), and isoeugenol synthase (PhlGS1) (Negre et al., 2003;

Boatright et al., 2004; Underwood et al., 2005; Koeduka et al., 2006). Transcript levels

of all genes are highest in the petal limb, with lower expression found in other parts of the

flower (petal limb, ovary, stigma/style). This pattern of expression coincides with

volatile emission that is primarily produced in the petal limb (Verdonk et al., 2003).

Homologs ofPhBSMT] and 2 have also been identified in other species including

A. majus and Nicotiana suaveolens. In Snapdragon (A. majus), S-adenosyl-L-

methionine: benzoic acid carboxy methyltransferase (AmBAMT) (shown to utilize

benzoic acid as a preferred substrate) gene expression was isolated to the upper and lower

lobes of the flower, and coincided with peak BAMT activity (Dudareva et al., 2000). In

another PhBSMT homolog, NsBSMT, transcript levels were again isolated to the flower,

where highest levels were localized to the petal tissue (Pott et al., 2004).

Developmental Regulation of Floral Volatile Emission

In addition to spatial regulation, floral volatile biosynthesis is also dependent on the

developmental stage of the flower. In C. breweri, CbBEATand CblEMTtranscript (and

CbBEAT activity) levels were undetectable in the petal (tissue with highest transcript

accumulation) until anthesis, where levels rapidly increased peaking 1-2 days after

anthesis (Dudareva 1998a). This pattern of expression coincides with floral volatile

emission, where highest emission was measured 1-2 days after anthesis coinciding with

optimal fertility (Dudareva et al., 1998b). Similarly, in the petal tissue, CbBEBT

transcripts and protein activity were also undetectable until anthesis, peaking between 2

and 4 days after anthesis (D'Auria et al. 2002). However, in the stigma (tissue of highest

transcript accumulation), CbBEBTtranscript and protein levels were highest 2 days prior

to anthesis and gradually decreased throughout the time course (D'Auria et al., 2002).









With the exception of CbBEBTlevels in stigmatic tissue, these results show a direct

correlation between transcript, enzyme activity, and volatile emission levels.

In MD and snapdragon (A. majus) floral expression of PhBPBT and AmBAMThas

also been shown to be developmentally regulated with transcript detected throughout the

time course, peaking 1-2 days after anthesis (Boatright et al., 2004). Coinciding with this

increase in transcript levels, floral volatile emission in both plants peaks 1 to 2 days after

anthesis (Verdonk et al., 2003).

Temporal Regulation of Floral Volatile Emission

Floral volatile emissions rhythmically oscillate dependent on the light/dark cycle

throughout the day. In MD petunia, PhBSMT] and 2, and PhBPBTtranscript levels have

been shown to oscillate with highest levels in the afternoon and lowest levels in the early

morning (Kolosova et al., 2001; Boatright et al., 2004; Underwood et al., 2005). The

peak is followed by maximum volatile emission 6 h later (during the evening)

(Underwood et al., 2005). When petunia plants were moved to constant light or constant

dark conditions, a loss in PhBSMT] and 2 transcripts and methyl benzoate emission

rhythmicity was assessed. Constant dark resulted in an overall decrease in transcript and

methyl benzoate emission, while constant light in an overall increase (Underwood et al.,

2005). This pattern of PhBSMT expression and methyl benzoate emission suggests that

PhBSMTtranscription and subsequent methyl benzoate emission are primarily light-

dependent and not dependent on circadian-related factors.

AmBAMT transcript levels also rhythmically oscillate, with highest levels observed

in the afternoon, and lowest levels observed during the early morning (Kolosova et al.,

2001). This pattern of expression coincided with volatile emission in snapdragon;

however BAMT activity did not fluctuate, indicating possible substrate regulation in the









rhythmic emission of methyl benzoate. Analysis of benzoic acid levels in the flower

revealed a rhythmic oscillation which contributed to the observed pattern of methyl

benzoate emission (Kolosova et al., 2001).

Ethylene-Dependent Regulation of Floral Volatile Emission

Exposure to the gaseous hormone ethylene results in decreased floral volatile

emission in MD. Ethylene regulations of a wide range of physiological processes

including fruit ripening, flower senescence, and responses to wounding (Abeles et al.

1992).

Ethylene Biosynthesis and Signaling Pathways

Ethylene is synthesized from S-adenosyl-L-methionine in a two step reaction

(Bleeker and Kende, 2000). The first step is the synthesis of 1-aminocyclopropane-1-

carboxylic acid (ACC) by ACC synthase, and represents the rate limiting step in ethylene

biosynthesis. In the second step, ACC is then oxidized to ethylene which is catalyzed by

ACC oxidase. Once ethylene is synthesized it is emitted from the cell and sensed through

the ethylene signaling pathway (Guo and Ecker, 2004). In this pathway, a dimerized

membrane-bound receptor (ETR) containing a histidine kinase domain interacts with

CTR1 (a Rafl-like kinase) to down-regulate a downstream regulator EIN2 possibly via a

MAPK cascade. Upon binding of ethylene, the interaction between ETR and CTR1 is

disrupted, leading to the deregulation of EIN2 which has been shown to positively

regulate ethylene responses. EIN3 and the related EILS encode nuclear localized

transcription factors and also are then up-regulated and thought to bind to ethylene

response factor domains (ERF domains) and regulate the expression of other ethylene

response genes.









Pollination-Induced Ethylene Production

Ethylene synthesis is stimulated by many environmental cues including pollination

and wounding (Bleeker and Kende, 2000). In petunia, pollination leads to an initial burst

in ethylene synthesis at 2-4hr after pollination which is synthesized in the stigma (Tang

and Woodson, 1996). This burst in stigmatic ethylene synthesis was also seen following

the pollination of Petunia inflate flowers, and was shown to be associated with pollen

tube growth through the use of the ethylene inhibitor 2,5-norbomadiene (NBD) (Holden

et al., 2003). A second burst in ethylene synthesis is then observed in the stigma and

ovary starting at 12h after pollination, with maximum emission observed 24 h after

pollination coinciding with fertilization (Jones et al., 2003). This is followed by

autocatalytic ethylene production in the corolla 24 to 36 h after pollination. This second

burst of ethylene synthesis is thought to induce corolla senescence in petunia since the

treatment of the stigma with the ethylene inhibitor NBD prevented the synthesis of the

first burst of ethylene, but did not prevent flower senescence (Hoekstra and Weges,

1986).

Wound-Induced Ethylene Production

Ethylene has also been shown to play a role in the plant defense response to

wounding (Leon et al., 2001; Wang et al., 2002). Following wounding, ACC synthase

and ACC oxidase (which encode the two enzymes critical to ethylene biosynthesis)

transcript levels rapidly increase in soybean (Glycine max) and Cucumis melo (melon)

(Liu et al., 1993; Bouquin et al., 1997). Following wounding, ethylene is rapidly

synthesized in many plant species including Pisum sativum, L. esculentum, and P.

hybrida (Saltviet et al., 1979; Boller and Kende, 1980; Kende and Boller, 1981; Gomes,

1996; Boatright, 2000).









44568 Transgenic Petunia with Reduced Ethylene Sensitivity

Many mutants in the ethylene signaling pathway have been isolated and

characterized in Arabidopsis. The etrl-1 Arabidopsis mutant has a missense mutation in

the ethylene-binding domain of the receptor making it unable to bind ethylene (Schaller

and Bleecker 1995). Heterologous expression of this dominant mutant allele in the MD

genetic background has been utilized to produce transgenic lines with highly reduced

ethylene sensitivity (Wilkinson et al. 1997). One transgenic line with greatly reduced

ethylene sensitivity (44568- CaMV35S:etrl-1) has now become a powerful tool for

studying the effects of ethylene in many physiological processes including corolla

senescence (Langston et al., 2005), root formation (Clark et al., 1999), horticultural

performance (Gubrium et al., 2000), seed production (Clevenger et al., 2004), and floral

volatile emission (Negre et al., 2003; Underwood et al., 2005). As a result, MD in

conjunction with 44568 has become an excellent model system for studying the effects of

ethylene on the synthesis of floral volatiles.

Ethylene and Floral Volatile Biosynthesis

Ethylene's involvement in the regulation of floral volatile biosynthesis was first

demonstrated in MD (Negre et al., 2003; Underwood et al., 2005). Following treatment

of MD and 44568 (etri-1) excised flowers with exogenous ethylene, emission of several

volatile benzenoid/phenylpropanoid compounds decreased in MD compared to 44568

(Underwood et al., 2005). Similarly, following pollination, endogenous ethylene

produced within the flower resulted in decreased MD volatile emission by 36 h after

pollination when compared to non-pollinated and 44568 pollinated controls (Underwood

et al., 2005). Physiologically, this observation is significant since floral volatiles are

widely thought to attract pollinators to the flower. Approximately 24 h after pollination,









fertilization of the egg coincides with a second period of ethylene synthesis emitted from

the stigma and ovary resulting in autocatalytic ethylene production in the flower by 36 h

after pollination. This burst of ethylene emission in the corolla coincides with a decrease

in floral volatile biosynthesis and ultimately results in petal senescence.

To determine the effects of ethylene on floral volatile biosynthesis at the level of

transcription, PhBSMT] and 2 transcript levels were quantified in the flower following

exogenous ethylene treatment (Negre et al., 2003; Underwood et al., 2005). Following

treatment, PhBSMT] and 2 transcript levels decreased in all organs of the flower when

compared to 44568. Similarly, following pollination, endogenous ethylene resulted in a

sequential decrease in PhBSMT transcript. Within 2 to 4 h after pollination, ethylene

synthesized in the stigma in response to pollen tube growth resulted in a decrease in

PhBSMTtranscript levels in the stigma. By 12 to 24 h after pollination, ethylene

synthesized in the ovary coinciding with fertilization correlated with a decrease in

PhBSMTtranscript in the ovary. By 24to 36 h after pollination, autocatalytic ethylene

production in the corolla resulted in decreased PhBSMT transcript levels in the petal tube

and petal limb tissue. Therefore following pollination, ethylene is sequentially

synthesized and perceived throughout the flower, resulting in decreased PhBSMT

transcript accumulation and floral volatile emission. This reduces production of floral

volatiles once the function of the corolla in pollinator attraction is complete.

Genetic Engineering of Floral Volatile Emission

Recent advances in genetic engineering have provided the tools necessary to isolate

and express genes critical to floral volatile synthesis in order to alter or restore floral

volatile emission. Linalool synthase was first isolated and characterized in C. breweri

and shown to catalyze the synthesis of the monoterpene alcohol, linalool (Pichersky et al.,









1994; Pichersky et al. 1995). When expressed in Petunia x hybrida it became the first

floral volatile synthesis gene to be used for genetic engineering (Lucker et al., 2001).

This initial attempt resulted in two lines expressing the transgene and showing linalool

synthase activity. However, when these plants were analyzed no linalool was detected.

This was shown to be a result of conjugation, where excess linalool was converted into a

conjugated form (non-volatile S-linalyl-beta-D-glucopyranoside) preventing the desired

increase of linalool. A similar phenomenon was also observed when linalool synthase

was overexpressed in Arabidopsis leaves (Aharoni et al., 2003). The same gene was then

expressed in carnation (Dianthus caryophyllus), where linalool and its derivatives were

detected using headspace GC-MS (Lavy et al., 2002). Human scent panels were used to

test whether this increase in linalool could be perceived by humans; however it could not

be detected.

In another example, FaSAAT, an alcohol acyltransferase isolated from strawberry

(Fragaria x ananassa), was overexpressed in Petunia x hybrida (Beekwilder et al.,

2004). An increase in both FaSAAT expression and protein activity were measured in

these transgenic lines; however, a subsequent increase in ester emission, including benzyl

benzoate, was not detected. This lack of ester formation was attributed to substrate

limitation of the alcohol precursors.

Recently, PhBSMT] and 2 were isolated and characterized in MD and shown to

catalyze the methylation of benzoic acid to methyl benzoate, the most abundant

component of MD floral volatile emission (Negre et al., 2003; Underwood et al., 2005).

To determine the function of PhBSMT in vivo, a PhBSMTRNAi construct was made and

transformed into MD. These lines demonstrated decreased methyl benzoate emission









(90%), and PhBSMT expression in whole flower tissue as compared to wild-type.

Results from a human scent panel showed that 80% of the panelists were able to tell the

difference between the volatile emission of MD and PhBSMTRNAi flowers, providing

evidence for the first genetically engineered plant with altered floral volatile emission

that could be perceived by humans (Underwood et al., 2005).

In Petunia x hybrida, the rose gene RhAATwas overexpressed resulting in an

increase in the acylated compounds phenylethyl acetate and benzyl acetate (Guterman et

al., 2006). Feeding of exogenous geraniol (the preferred substrate in rose) resulted in the

production of geranyl acetate. A similar method was used to overcome substrate

limitation in FaSAAT overexpression flowers where the addition of exogenous isoamyl

alcohol resulted in increased levels of isoamyl acetate emission via GC-MS. These

results highlight the importance of substrate availability when engineering floral volatile

emission.

The identification of the ODORANT 1 transcription factor represents the first of a

potentially larger set of transcription factors that globally regulate floral volatile

emission. ODO 1 was shown to regulate the expression of genes of the shikimate

pathway (DAHP ,/mh/i/\e, EPSP ,/mh,/i\e) and phenylalanine ammonia lyase (PAL)

(Verdonk et al., 2005). These genes encode enzymes critical to the production of

upstream precursors used in the synthesis of all the benzenoid/phenylpropanoid

compounds identified in petunia floral volatile emission. The production of RNAi

ODORANT1 transgenic lines resulted in a global decrease in floral volatile production in

petunia. Since substrate has been a limiting factor in genetic engineering floral volatiles,









transcription factors similar to ODO1 could represent ideal targets for future genetic

engineering by increased upstream substrates.

The above experiments demonstrate the difficulties encountered when trying to

engineer increased levels of floral volatiles in vivo. While a knockout approach resulted

in a perceivable change in emission (Underwood et al., 2005), problems with conjugation

of the product or substrate limitation have made the overexpression of floral volatiles a

greater challenge.

Research Objectives

The purpose of this research was to gain a further understanding into the regulation

of floral volatile biosynthesis in MD. To achieve this goal, a subset of genes previously

shown by microarray analysis to be highly expressed in the flower and down-regulated

following exogenous ethylene treatment and were selected. Utilizing RNAi-induced

gene silencing, the function of these candidate genes was then analyzed to identify genes

critical to floral volatile biosynthesis. Two genes, benzoyl-CoA: benzyl alcohol/ phenyl

ethanol benzoyltransferase (PhBPBT) and acetyl-CoA: coniferyl alcohol acetyltransferase

(PhCFA T) were identified and utilized to study the effects of spatial, temporal,

developmental, and ethylene-dependent regulation on transcript levels. The effect of

environmental stimuli and physiological significance of floral volatiles in pollinator,

fungal, and human interactions was also examined.










Tryptophan
Glycolysis & Shikimic
Pentose Acid --- Chorismate Prephenate
Phosphate Patway CM
Pathway I PA


Phenylethyl amine Phenylalanine


I AADC
Phenylacetaldehyde
I 2PR
Phenylethyl alcohol
IBPBT
Phenylethyl
benzoate


"- Arogenate
ADr
Tyrosine


PAL


Trans-cinnamic -Para-cinnamic acid
acid


Phenylethyl
acetate


Benzoic
acid
1
Methyl
benzoate


* Benzaldehyde 4


SBenzyl E Benzyl
alcohol acetate
I BPBT


-- Salicylic Benzyl benzoate
Acid
BSMT 1
Methyl
salicylate


I
Para-coumarate

I
Caffeic
acid
I
Ferulic
acid
I
Coniferyl
aldehyde
I
Coniferyl
alcohol
PhCFA T
Coniferyl
acetate
PhIGS1 I
Isoeugenol


Figure 1-1. A generalized schematic of biochemical pathways in petunia floral volatile
biosynthesis. Enzymes are presented in italics. (CM chorismate mutase, PA
prephenate aminotransferase, AD arogenate dehydratase, AADC -
aromatic amino acid decarboxylase, 2PR 2-phenylacetaldehyde reductase,
PAL phenylalanine ammonia lyase, CFAT acetyl-CoA: coniferyl alcohol
acetyltransferase, IGS1 isoeugenol synthase 1, BPBT benzoyl-CoA:
benzyl alcohol/ pheylethanol benzoyltransferase, BSMT S-adenosyl
methionine: benzoic acid/ salicylic acid carboxymethyl transferase, BEAT -
acetyl-CoA: benzyl alcohol acetyltransferase)

















CHAPTER 2
ETHYLENE-DEPENDENT REGULATION OF PHBPBT TRANSCRIPT AND
BENZYL BENZOATE BIOSYNTHESIS IN PETUNIA X HYBRIDA

Introduction

Ethylene is a gaseous plant hormone necessary for coordinating a wide range of

physiological processes throughout the plant (Abeles et al. 1992; Bleecker and Kende,

2000). Following pollination in Petunia x hybrida cv "Mitchell Diploid" (MD), ethylene

is first synthesized from the stigma/style 2 to 4 h after pollination coinciding with pollen

tube growth (Tang and Woodsen, 1996; Wilkinson et al., 1997; Jones et al., 2003; Holden

et al., 2003). A second period of ethylene synthesis coinciding with a successful

fertilization occurs in the stigma/style and ovary 24 h after pollination, followed by

ethylene synthesis in the corolla (petal tube and petal limb) from 24 to 36 h after

pollination (Tang and Woodsen, 1996; Jones et al., 2003). This second ethylene signal

coincides with the floral transition from pollinator attraction to fruit development and

ultimately results in corolla senescence and rapid ovary expansion 60 h following a

successful pollination (Hoekstra and Weges 1986).

Ethylene is also known to play a critical role in plant defense responses to chewing-

insects, necrotic pathogens, and wounding (Leon et al., 2001; Wang et al., 2002). In

response to wounding, rapid ethylene synthesis occurs in various tissues of many plant

species including Pisum sativum L. cv Alaska (Saltviet et al., 1979), Lycopersicon

esculentum (Boller and Kende, 1980; Kende and Boller, 1981), Cucumis melo L.

(Hoffman and Yang, 1981), Persea americana (Buse and Laties, 1993), Cucurbita









maxima (Kato et al., 2000), and Petunia x hybrida (Gomes, 1996; Boatright, 2000). In

conjunction with other wound-induced signals (eg. jasmonic acid), endogenous ethylene

has been shown to act synergistically or antagonistically to regulate wound-defense

response genes (PDF1.2, JR1, JR2, VSP) depending on the plant species studied

(O'Donnell et al., 1996; Rojo et al., 1999).

The etrl-1 Arabidopsis mutant has a missense mutation in the ethylene-binding

domain of the receptor making it unable to bind ethylene (Schaller and Bleecker 1995).

Heterologous expression of this dominant mutant allele in the inbred MD genetic

background resulted in transgenic lines with a strongly reduced ethylene sensitivity

(Wilkinson et al. 1997). One such transgenic line (44568- CaMiV35S:etrl-1) is a

powerful tool for studying the effects of ethylene in many physiological processes

including corolla senescence (Langston et al., 2005), root formation (Clark et al., 1999),

horticultural performance (Gubrium et al., 2000), seed production (Clevenger et al.,

2004), and floral volatile emission (Negre et al., 2003; Underwood et al., 2005). As a

result, MD, in conjunction with 44568, is an excellent model system for studying the

effects of ethylene on the synthesis of floral volatiles.

Benzyl benzoate is a volatile produced by many plant species including MD

(Verdonk et al., 2003; Boatright et al., 2004; Underwood et al. 2005). Past work has

shown benzyl benzoate to be a potentially physiologically active compound with a role

both in pollinator attraction and plant defense. For example, benzyl benzoate has been

shown in vitro to excite receptor cells 30-34 ofManduca sexta antennae (Shields and

Hildebrand, 2001), and to induce partial proboscis extension in male Vanessa indica

butterflies (Omura and Honda, 2005). Additionally it is an effective treatment against









common mites such as Tyrophagusputrescentiae (Schrank) and Sheep Mange (Dimri

and Sharma, 2004; Harju et al., 2004), and is the active ingredient in the commercial

product, Acarosan (Bissell Homecare Inc., Grand Rapids, MI), a treatment for dust mites.

Benzoyl-CoA: benzyl alcohol/phenylethanol benzoyltransferase (PhBPBT), is a

single-copy gene with 70% identity to benzoyl-CoA: benzyl alcohol benzoyltransferase

(BEBT) first characterized in Clarkia breweri (D'Auria et al., 2002), and shown to

catalyze the synthesis of benzyl benzoate from benzyl alcohol and benzoyl CoA (D'Auria

et al., 2002). In petunia, PhBPBT has highest affinity for benzoyl-CoA and benzyl

alcohol, but also has an affinity for phenylethyl alcohol which can be converted to

phenylethyl benzoate (Boatright et al., 2004). PhBPBT is 90% identical to a

hypersensitivity-related factor (Hsr201) from Nicotiana tabacum (Czernic et al., 1996),

shown to be rapidly induced following leaf exposure to Pseudomonas solanacearum.

To date research involving PhBPBT has focused predominately on its role in

biochemistry and floral volatile biosynthesis in petunia, but a role in vegetative tissue is

not without precedent. Following mechanical wounding of leaf tissue, transcripts levels

of CbBEBT accumulate rapidly 4-6 h after wounding (D Auria et al., 2002). However,

the physiological significance and effect of wounding on internal benzyl benzoate pools

have not been studied.

The main goal of this study was to determine the effects of ethylene on PhBPBT

transcript levels and subsequent benzyl benzoate biosynthesis in the corolla following

pollination, and in the leaves following mechanical wounding. Through the use of MD

and 44568 (etrl-1) petunias, we show that endogenous ethylene differentially regulates









PhBPBTtranscript levels and benzyl benzoate biosynthesis in corolla, ovary, and leaf

tissue of MD.

Results

PhBPBT Transcript Levels Following Treatment with Exogenous Ethylene

Benzyl benzoate is down-regulated in petunia corollas following exposure to

exogenous or pollination-induced ethylene (Underwood et al., 2005). To determine if

ethylene regulates PhBPBTin separate floral organs, MD and 44568 petunia flowers

were treated with exogenous ethylene, and analyzed for differences in PhBPBTtranscript

levels (Figure 2-1). In MD ovary tissue, exposure to exogenous ethylene resulted in a

marginal decrease in transcript at 2 h after treatment compared to 44568 (Figure 2-1A).

At 10 h after ethylene treatment, PhBPBT transcript levels in MD tissue increased,

peaking at 24 h (where levels were twice that of 44568), then remained elevated

throughout the course of the experiment.

In the corolla tissue, exogenous ethylene decreased PhBPBTtranscript levels in

MD compared to 44568 (Figure 2-1B, C). In MD petal tube tissue, a marginal decrease

in PhBPBTwas observed by 2 h after ethylene treatment, and was immeasurable at 24 h

after ethylene treatment compared to 44568, which showed rhythmic expression (Figure

2-1B). In MD petal limb tissue, a decrease in PhBPBTtranscript was observed by 2 h

after treatment. PhBPBTtranscript levels were immeasurable at all points after 10 h

while transcript levels in 44568 petal limb tissue showed rhythmic expression throughout

the experiment (Figure 2-1C).

Post-Pollination PhBPBT Expression

In ovary tissue, PhBPBTtranscript levels were equivalent through 24 h after

pollination in all treatments (Figure 2-2A). At 36 h after pollination, both 44568 and MD









pollinated ovary tissue contained slightly elevated PhBPBTtranscript levels compared to

their respective non-pollinated controls. By 48 to 60 h, transcript levels in MD pollinated

ovary tissue were three-fold higher than pollinated 44568 ovary tissue, and ten-fold

higher than levels observed in both non-pollinated controls (Figure 2-2A).

In the petal tube, PhBPBTlevels were equivalent among all treatments through 12

h after pollination (Figure 2-2B). At 24 h after pollination, PhBPBTlevels in both MD

treatments were lower than both 44568 treatments, with MD pollinated transcript levels

slightly higher than MD non-pollinated transcript levels. By 48 h after pollination,

PhBPBTtranscript levels were substantially lower in MD pollinated petal tube tissue

compared to the other three treatments. Day/night rhythmic fluctuations in PhBPBT

transcript levels were observed in all treatments examined, with highest levels observed

at Zeitgeber time (ZT) 3 (0, 24, and 48 h after pollination).

Prior to pollination (ZT 3), PhBPBTtranscript abundance in the petal limb tissue

was >75-fold higher then levels measured in ovary and petal tube tissue (Figure 2-2).

After pollination, transcript levels remained equivalent among all treatments through 36 h

after pollination (Figure 2-2). At 48 h after pollination, a two-fold decrease in PhBPBT

was observed in MD pollinated petal limb tissue compared to the 44568 and both non-

pollinated controls. However, PhBPBTtranscript levels were still ten-fold higher than

transcript levels quantified in MD pollinated ovary and 44568 pollinated and non-

pollinated petal tube tissue. This coincides with the previous observation of decreased

benzyl benzoate emission 36 to 48 h after pollination (Underwood et al., 2005).

Similarly, internal volatile analysis of whole corolla tissue revealed decreased benzyl









benzoate levels in MD corolla tissue at 60 h after pollination compared to all other

treatments (Figure 2-2D).

To determine if increased PhBPBTtranscript levels in ovary tissue continued

beyond the range of our original time course (60 h), a second experiment was conducted

to measure daily (ZT 7.5) transcript levels in the ovary during a 5 day period after

pollination. Results from this experiment showed that the effects of ethylene on PhBPBT

transcript levels were transient, with peak transcript levels measured 2-3 days after

pollination in MD ovaries (still >15-fold lower than transcript levels in MD pollinated

tissue 48 h after pollination) compared to 44568 and non-pollinated controls (Figure 2-

2E). By 4 to 5 days after pollination PhBPBTtranscript levels in pollinated MD ovary

tissue were no different from those measured in the other three treatments. To determine

if this increase in PhBPBT transcript resulted in increased benzyl benzoate biosynthesis,

internal volatiles were extracted from MD ovary tissue collected at 3 and 6 days after

pollination. However, analysis of internal benzyl benzoate pools in these extracts (via

flame ionization gas chromatography) was undetectable (data not shown).

PhBPBT Transcript Levels in Petunia Leaves Treated with Ethylene.

To determine the effect of ethylene on PhBPBT transcript levels in petunia leaves,

excised 44568 and MD leaves were treated with air or exogenous ethylene and analyzed

using real-time RT-PCR (Figure 2-3). Within 2 h of ethylene treatment, an induction of

PhBPBTtranscript was observed in MD leaves compared to all other treatments. By 6 h

after treatment, PhBPBTlevels further increased in ethylene treated MD leaves compared

to 44568 leaves, with peak transcript levels comparable to peak levels observed in MD

pollinated ovary tissue (2 days after pollination). Therefore, unlike in the corolla tissue,

and similar to ovary tissue, ethylene resulted in increased levels of PhBPBTin the leaves.









Ethylene-Dependent Regulation of PhBPBT Transcript Levels Following Repeated
Wounding Events

To determine the effect of wound-induced ethylene on PhBPBT transcript levels,

petunia leaves were wounded 3 times at 6 h intervals (0, 6, and 12 h after initial

wounding) to simulate herbivore attack. During each wound event, approximately 25%

of the leaf adaxial epidermis was lightly damaged by scraping, beginning at the tip of the

leaf and moving toward the petiole (Figure 2-4A).

During the period after the first wounding event (0 to 6 h after initial wounding),

little change in PhBPBTtranscript levels were observed in MD or 44568 wounded leaves

compared to controls (Figure 2-4B). After the second wounding event (6 to 12 h after

initial wounding), PhBPBTtranscript levels in 44568 wounded leaf tissue were slightly

elevated compared to the other three treatments. By 12 h after wounding, PhBPBT

transcript levels in both MD and 44568 wounded leaf tissues were elevated compared to

unwounded controls. Following a third wounding event (12 to 24 h after initial

wounding), PhBPBTtranscript levels in both controls and wounded MD leaves remained

static throughout, while levels in wounded 44568 leaves rapidly increased (Figure 2-4B).

However, peak transcript levels in 44568 3x wound leaf tissue was still lower than

transcript levels in MD pollinated petal limb tissue (48 h after pollination) (Figure 2-2C)

To determine whether multiple wounding events are necessary to induce an

increase in PhBPBT transcript in wounded leaf tissue, MD and 44568 leaf tissue were

wounded lx (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times, and tissue was collected at 24 h

after initial wounding. In both MD and 44568 leaf tissue, a single wound (lx) resulted in

no induction in PhBPBT transcript compared to unwounded controls (0.0010 +0.0002

(MD), 0.0009 0.0002 (44568)) (Figure 2-4C). Following a second wounding event









(2x), an increase in PhBPBTtranscript was observed in both MD and 44568 leaf tissue

compared to unwounded controls, with transcript levels in 44568 wounded leaf tissue

substantially higher than those in MD. Following a third wounding event (3x), PhBPBT

transcript levels in MD tissue remained equivalent to 2x transcript levels, while levels in

44568 wounded tissue were increased compared to 44568 2x wounded tissue.

In the corolla, decreased PhBPBTtranscript coincided with decreased benzyl

benzoate levels following pollination. To determine if increased PhBPBT transcript

levels following repeated wounding of MD and 44568 leaf tissue coincided with an

increase in benzyl benzoate biosynthesis, tissues from all treatments were collected at 24

h after initial wounding. Internal volatiles were then extracted from these tissues and

analyzed via GCMS, and the resulting data were reported as a fold increase in benzyl

benzoate over unwounded levels (1.06 0.40 (MD), 3.42 0.95 (44568)) (Figure 2-4D).

Following a single wounding event (lx), a small increase in internal benzyl benzoate was

observed in both MD and 44568 wounded tissue compared to their respective controls

(Figure 2-4D). In MD leaf tissue wounded 2x or 3x times, internal benzyl benzoate pools

were elevated compared to lx and unwounded MD treatments. In 44568 wounded leaf

tissue, no statistical increase in benzyl benzoate pools was observed following 2x

wounding events; however, following a third wounding event, a substantial increase in

benzyl benzoate was observed over 44568 leaf tissue wounded lx and 2x (Figure 2-4D).

While a >50-fold increase in PhBPBTtranscript was observed in 44568 3x wounded

tissue compared MD 3x wounded leaf tissue (Figure 2-4C), there was little difference in

internal benzyl benzoate levels quantified in MD or 44568 wounded leaf tissue (Figure 2-

4D).









To determine if elevated PhBPBT transcript and subsequent benzyl benzoate levels

are transient through 48 h after initial wounding, lx, 2x, 3x wounded, and unwounded

MD and 44568 leaf tissue were collected at 48 h after initial wounding, and analyzed to

determine a fold increase in PhBPBTtranscript and internal benzyl benzoate pools

compared to unwounded controls (0.0007 0.0001 (PhBPBT transcript level in MD),

0.0010 +0.0001 (PhBPBTtranscript level in 44568), 3.63 0.36 (internal benzyl benzoate

level in MD), 3.81 1.25 (internal benzyl benzoate level in 44568)) (Figure 2-4C and D).

In all treatments, PhBPBTtranscript and benzyl benzoate levels were substantially

reduced by 48 h after initial wounding compared to levels quantified at 24 h after initial

wounding. These results indicate that PhBPBT transcript and benzyl benzoate levels are

transiently elevated in response to mechanical wounding.

Discussion

Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate
Biosynthesis in Petunia Floral Tissue

In MD, pollination-induced ethylene is synthesized from the stigma/style, ovary,

and corolla in a sequential manner (Hoekstra and Weges, 1986; Tang and Woodsen,

1996; Jones et al., 2003). These ethylene signals have been demonstrated to lead to the

sequential down-regulation of floral VOC synthesis genes S-adenosyl methonine:

benzoic acid/ salicylic acid carboxy-methyltransferase 1 and 2 (PhBSMT] and 2), which

primarily catalyzes the methylation of benzoic acid to the floral volatile methyl benzoate

(Underwood et al., 2005; Schuurink et al, 2006). Following a successful pollination, a

decrease in PhBSMT] and 2 transcript levels were observed first in the stigma/style 2-4 h

after pollination, then in the ovary at 24 h after pollination, and last in the corolla at 36 h

after pollination as compared to 44568 pollinated floral tissue (Underwood et al., 2005).









Utilizing RNAi-induced gene silencing in connection with in vitro enzyme activity

studies, it has been shown that PhBPBT encodes an enzyme which primarily catalyzes the

conversion of benzyl alcohol to benzyl benzoate, a volatile constituent of petunia volatile

emission (Appendix A; Boatright et al., 2004). Following exposure to exogenous or

pollination-induced ethylene, benzyl benzoate emission is greatly reduced as compared to

levels emitted in 44568 transgenic petunia (Underwood et al., 2005). To determine if

ethylene also regulated PhBPBT expression in the flower, MD and 44568 whole flowers

were pollinated and analyzed to determine the ethylene-dependent regulation of PhBPBT

transcript following pollination.

Unlike PhBSMT] and 2, PhBPBTtranscript levels in the flower do not sequentially

decrease due to ethylene synthesized following pollination (Figure 2-2). Instead,

transcript levels in 44568 and MD pollinated and non pollinated ovary and corolla tissue

remained equivalent, unaffected by the initial period (< 24 h after pollination) of rapid

ethylene synthesis. Prior to fertilization (<24 h after pollination), the primary function of

the flower is to attract a pollinator in order to achieve a successful pollination and ensure

seed set. The corolla is integral to this role, both as a visual cue and as a platform for

volatile emission. In vitro, benzyl benzoate has been proposed to be physiologically

active both as a pollinator attractant and as a miticide (Shields and Hildebrand, 2001;

Dimri and Sharma, 2004; Harju et al., 2004; Omura and Honda, 2005). However, to date

the in vivo function of this compound remains unclear. PhBPBTtranscript produced

during this period were >100-fold higher then peak levels observed in any other tissue

(petal limb, ovary, wounded leaves) (Figure 2-2C). This suggests that the primary

function of PhBPBT and subsequent benzyl benzoate is in the petal limb (Figure 2-2),









and could function either to attract a pollinator or protect the corolla from pathogen attack

until its function in facilitating sexual reproduction is complete.

Following fertilization the function of the flower shifts to ovary and fruit

differentiation and development making the corolla tissue dispensable. Ethylene

produced from the ovary and corolla early in this period signals that the function of the

corolla is complete, resulting in decreased synthesis of many volatiles and ultimately in

corolla senescence (around 60 h after pollination) (Figure 2-2D; Underwood et al., 2005).

Similar to PhBSMT] and 2, PhBPBTtranscript and subsequent benzyl benzoate levels

decrease during this period (24 to 60 h after pollination) compared to both 44568

pollinated and non-pollinated controls (Figure 2-2). This result suggests that the function

of PhBPBT and subsequent benzyl benzoate in pollinator attraction or corolla defense is

complete.

While a decrease in PhBPBTtranscript is consistent with previous results from

PhBSMT] and 2, the observation of increased PhBPBTtranscript in the ovary following

pollination-induced ethylene (still far below levels observed in the petal limb) was

unexpected (Figure 2-2A, E). However, increased transcript levels in ovary tissue

following exogenous ethylene treatment and pollination confirm that in ovary tissue,

ethylene results in an up-regulation in PhBPBT transcript levels (Figure 2-1A).

Therefore, in response to pollination-induced ethylene, PhBPBTtranscript levels are

simultaneously up and down-regulated in two adjacent tissues (corolla and ovary) within

the flower. The differential regulation of a single copy gene (PhBPBT) in two nearby

tissues in response to the same stimuli, highlights the importance of tissue specific

transcription factors in the regulation of gene expression.









While an ethylene-dependent increase in PhBPBT transcript levels in MD ovary

tissue following fertilization was observed, levels remained substantially lower than in

petal limb tissue. Additionally, increased PhBPBTtranscript levels did not coincide with

a measurable increase in benzyl benzoate within the ovary. This suggests that the

physiological function PhBPBT and subsequent benzyl benzoate is primarily restricted to

the petal limb.

Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate
Biosynthesis in Petunia Vegetative Tissue After Wounding

In C. breweri, it has been shown that transcript levels of CbBEBT, a homolog of

PhBPBT, are rapidly up-regulated 4 to 6 h after mechanical wounding; however the effect

and physiological significance of this observation was not addressed (D'Auria et al.,

2002). While previous workers in the field had not reported the accumulation of

PhBPBTtranscript in MD leaves (Boatright et al., 2004), preliminary experiments

indicated that PhBPBT transcript levels were also up-regulated following mechanical

wounding of leaf tissue (data not shown). Since PhBPBTtranscript levels and

subsequent benzyl benzoate biosynthesis had been shown to be regulated by ethylene in

the flower, we were interested to determine if ethylene (shown to be synthesized in

Petunia x hybrida (Gomes, 1996; Boatright, 2000) leaves following mechanical

wounding) was necessary for the up-regulation of PhBPBTtranscript levels. Treatment

of petunia leaves with exogenous ethylene resulted in increased levels of PhBPBT

transcript in MD leaves but not 44568, indicating that ethylene could up-regulate

PhBPBTtranscription in the leaves (Figure 2-3).

Through the use of MD and 44568 transgenic petunias, the role of ethylene in the

up-regulation ofPhBPBTtranscript following wounding was investigated. Following an









initial wounding event, an increase in transcript levels was not evident in either MD or

44568 plants; however, following multiple wounding events (2x or 3x) an increase in

PhBPBTtranscript was observed (Figure 2-4). Interestingly, while exogenous ethylene

treatment resulted in increased PhBPBT transcript levels in MD tissue compared to

44568, transcript levels in 44568 leaf tissue wounded 2x or 3x times were substantially

(>50-fold) higher then MD (Figure 2-4). This suggests that ethylene instead plays an

inhibitory role in the regulation of PhBPBT transcript levels following wounding in

leaves.

While a loss in the regulation of PhBPBT transcription in 44568 wounded leaves

resulted in a substantial increase in transcript compared to MD, little difference in

internal benzyl benzoate levels were observed in MD and 44568 wounded leaf tissues

(Figure 2-4D). This suggests that in MD, transcript levels are likely sufficient to encode

enough PhBPBT protein to convert all available benzyl alcohol to benzyl benzoate.

Therefore in 44568 wounded leaf tissues (where a lack of ethylene sensitivity results in a

substantial increase in transcript after repeated wounding), little increase in benzyl

benzoate pools were observed due to substrate limitation. Combined, these results

indicate that while repressing PhBPBTtranscript levels, ethylene does not regulate benzyl

benzoate biosynthesis in petunia leaves following wounding.

While a physiological role for PhBPBT and subsequent benzyl benzoate in petunia

leaf tissue (after repeated wounding) can not be ruled out, even at its highest levels,

PhBPBTtranscript (0.03% of total mRNA) within MD and 44568 leaf tissue are

substantially lower then levels observed in the petal limb (0.75% of total mRNA) (Figure

2-4D). Similar to MD ovary tissue (where peak transcript levels were 0.01% of total









mRNA), this suggests that the primary function of PhBPBT and subsequent benzyl

benzoate is in the petal limb.

Experimental Procedures

Plant Material

Petunia x hybrida "Mitchell Diploid" (MD) was utilized both as the control and as

the genetic background for 35S: etrl-1 line 44568 (Wilkinson et al., 1997) transgenic

petunias. For all experiments, plants were grown in a glass greenhouse without artificial

lighting and temperatures ranging from 250C during the day to 160C during the night.

Plants were grown in 1.2L pots with Fafard 2B potting medium (Fafard Inc., Apopka,

FL), and fertilized 4 times a week with 150mg/L Scotts's Excel 15-5-15 (Scotts Co.,

Marysville. OH)

cDNA Isolation

Three cDNA libraries were constructed and a minimally redundant subset of clones

was utilized for microarray analysis in order to identify clones down-regulated following

ethylene treatment (Underwood, 2003). One of these clones was a 1.7kb cDNA coding

for a 460 amino acid protein (PhBEBT1, Accession #: AAT68601) with 100% homology

to benzoyl-coenzyme A (CoA):benzyl alcohol/phenylethanol benzoyltransferase (BPBT

Accession #: AAU06226.1) from MD, and subsequently named PhBPBT.

PhBPBT Transcript Analysis

Tissue was collected to determine PhBPBT transcript levels for the following

experiments: exogenous ethylene treatment (whole flowers and leaves), post-pollination,

and mechanical wounding (scrapping). For PhBPBT expression analysis after exogenous

ethylene treatment, MD and 44568 (etrl-1) (Wilkinson et al. 1997) whole flowers were

treated with ethylene and collected as described (Underwood et al. 2005). For post-









pollination expression analysis, MD and 44568 flower tissue was treated and collected as

described (Chapter 3). For PhBPBTtranscript analysis in petunia leaves treated with

exogenous ethylene, MD and 44568 leaves were collected at ZT 3, placed in 1% water

agar blocks and treated with ethylene or air as previously described (Underwood et al.,

2005). Ethylene and air treated tissue were then collected at 0, 2, 4, 6, and 24 h after

treatment. For leaf wounding experiments, MD and 44568 leaves were wounded by

scrapping 25% of the adaxial epidermis with a razor beginning at ZT 3. For the initial

leaf scrapping experiments, 25% of the leaves were wounded at 0, 6, and 12 h after initial

wounding working from the leaf tip towards the petiole. Wounded and unwounded MD

and 44568 leaf tissue were then collected at 2 h intervals for 16 h with one additional

collection made at 24 h. For subsequent leaf wounding experiments, MD and 44568 leaf

tissue was wounded 0, lx (initial wound at 0 h), 2x (0 and 6 h after initial wounding), or

3x (0, 6, and 12 h after initial wounding) times. Tissue was then collected from

unwounded and wounded (lx, 2x, and 3x) MD and 44568 leaves at 24 and 48 h after

initial wounding.

In all cases two sets of 3 flowers/leaves (three sets for 24 h 3x MD and 44568

wound tissue) were collected for each experiment and total RNA was extracted,

quantified, and diluted as previously described (Underwood et al., 2005) resulting in two

independent sets of RNA diluted to 100ng/pl. Real-time RT-PCR reactions were then

setup using Taqman One-Step RT-PCR reagents (Applied Biosystems; Foster City, CA),

the following primers and probe (PhBPBT Reverse Primer: 5'-

GAAATAAGAAAGGTGAGAATGGGATT-3'; PhBPBT Forward Primer: 5'-

AGCTCCTTGACGAATTTTTCCA-3'; PhBPBT Probe: 5'-









/56FAM/TGGTCCCTTATAGTTTGCCTGGCTTTGC/3BHQ_ /-3'), a dilution series of

in vitro-transcribed PhBPBT standards, and 100ng of total RNA as previously described

(Underwood et al., 2005). Each reaction was repeated two times with one set of total

RNA and once more with the second set of RNA, and quantified as previously described

(Underwood et al., 2005). All data with the exception of 24 and 48 h wounded tissue was

then reported as a percent of total mRNA standard error. For 24 and 48 h wounded

tissue, results were reported as a fold-increase in PhBPBT transcript levels as compared

to respective unwounded controls standard error.

Internal Benzyl Benzoate Analysis

To determine internal benzyl benzoate pools in the corolla following pollination,

MD and 44568 flowers were pollinated or set aside as non-pollinated controls. At 36 and

60 h after pollination, four sets of three pollinated or non-pollinated flowers were

collected from MD and 44568 plants. The corolla tissue was then dissected, immediately

frozen in liquid nitrogen, and utilized for internal volatile analysis as previously

described (Schmelz et al., 2004). The resulting extracts were then analyzed in tandem

with pure benzyl benzoate standards via flame-ionization gas chromatography (Hewlett-

Packard model 5890, Series II; Palo Alto, CA), and resulting data converted to a percent

difference in pollinated benzyl benzoate levels as compared to respective non-pollinated

controls standard error.

To identify internal benzyl benzoate pools following mechanical wounding, MD

and 44568 leaf tissue were wounded by scrapping 25% of the adaxial epidermis starting

at the leaf tip and working toward the petiole. Tissue was wounded 0, lx (initial wound

at 0 h), 2x (0 and 6 h after initial wounding), or 3x (0, 6, and 12 h after initial wounding)

times beginning at ZT 3. Two leaves were then collected from unwounded and wounded






37


(lx, 2x, and 3x) MD and 44568 leaves at 24 and 48 h after initial wounding. This

experiment was repeated two times (3 times for 3x 24 hr wounded MD and 44568 tissue),

resulting in 4 sets of two leaves (10 sets of two leaves for 3x 24 h MD and 44568

wounded tissue). Volatiles pools were then extracted and quantified via GCMS as

previously described (Schmelz et al., 2004). The resulting data was reported as ng/g

fresh weight for the unwounded controls, and a fold-increase in benzyl benzoate levels

over unwounded controls for lx, 2x, and 3x wounded MD and 44568 tissue + standard

error.












0.016 Ovary

0.012
A
0.008

0.004

0

0.2
02 Petal Tube

0.15
B B 0.1

o 0.05

0

0.8

0.6
C 0.4

0.2

0


Hours after ethylene treatment (h)

MD 44568
Figure 2-1. Mean PhBPBTtranscript levels following treatment with exogenous
ethylene. A) Mean PhBPBTtranscript levels (n=3, SE) were measured in
MD and 44568 (CaMV35S:etrl-1) ovary tissue collected at 2, 10, 24, 36, and
48 h after ethylene treatment and analyzed via real-time RT-PCR. B) Mean
PhBPBTtranscript levels measured in MD and 44568 petal tube tissues. C)
Mean PhBPBTtranscript levels measured in MD and 44568 petal limb tissue.



















- b~ii ij


100
Ovary g 1
550

S0 0

j -50
) O a -100
( &-100


0.008

S0.006

S0.004

S0.002
=


Benzylbenzoate


0.016

0.012

0.008

0.004

0


Sa- Cafter P nati
Days after Pollination


S 0.015
B
B 0.01

00.005
0

1

0.75
C 0.5

0.25

0




Figure 2-2


0a 0 C


36 h 60 h
Hours after Pollination (h)


0.02


m o -*- MD P -0- 44568 P
Hours after Pollination (h) "- MD NP E 44568 NP
The effect of pollination-induced ethylene on PhBPBTtranscript and internal
benzyl benzoate levels. A) PhBPBTtranscript levels (n=3, SE) in pollinated
and non-pollinated MD and 44568 (CaMV35S:etr1-1) ovary tissue. B)
PhBPBTtranscript levels (n=3, SE) in pollinated and non-pollinated MD and
44568 petal tube tissue. C) PhBPBTtranscript levels (n=3, SE) in pollinated
and non-pollinated MD and 44568 petal limb tissue. D) Internalized benzyl
benzoate levels extracted from MD and 44568 corolla tissue at 36 and 60 h
after pollination, and reported as a percent of respective non-pollinated
controls (n=4, SE). E) Mean PhBPBTtranscript levels (n=3, SE) in both
MD and 44568 pollinated or non-pollinated ovary tissue collected daily at ZT


)









)










0.012

I 0.009

0.006

^ 0.003




Hours after ethylene treatment (h)
-- MD Ethylene 0 MD Air
44568 Ethylene n 44568 Air

Figure 2-3. Mean PhBPBTtranscript levels (n=3, SE) in petunia leaf tissue following
exogenous ethylene treatment. Total RNA was extracted from MD and 44568
(CaMV 35S:etrl-1) leaf tissue following treatment with exogenous ethylene
or air, and analyzed via real-time RT-PCR.
























Hours after Initial Wounding (h)
-*MDW MDUW
--44568 W l 44568 UW


161

H- 121

4. 81
caC

1^ 41
" 13


W 00 0 00 >0


24h 48h
Hours after Initial Wounding (h)


00>0> 0> 0>0


24h 48h
Hours after Initial Wounding (h)


Figure 2-4. PhBPBTtranscript and internal volatile levels in petunia leaves following
repeated wounding events. A) MD petunia leaves wounded lx, 2x, and 3x
times. B) Wounded and unwounded MD and 44568 (CaMV35s:etrl-1)
leaves were collected at 2 h increments for 16 h plus an additional 24 h
collection. Tissue was wounded three times (0, 6, 12 h) beginning at ZT 3 to
simulate herbivore attack. Mean PhBPBTtranscript levels (n=3, SE) were
quantified via real-time RT-PCR. C) Fold increases in PhBPBT transcript
(n=3, SE) in MD and 44568 wounded leaves as compared to respective
unwounded controls. Leaves were wounded lx (0 h), 2x (0, 6 h), or 3x (0, 6,
12 h) times, and total RNA was extracted at 24 and 48 h after initial
wounding. D) Fold increases in benzyl benzoate levels (n=4, SE) in MD
and 44568 wounded leaves as compared to respective unwounded controls.
Leaves were wounded lx (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times and
volatiles were extracted at 24 and 48 h after initial wounding.


0.04

0.03

S0.02

20.01-
O.O


13

I10

S47

4


7-a




.D
0a 0


h

I


L














CHAPTER 3
CHARACTERIZATION OF A PETUNIA ACETYLTRANSFERASE INVOLVED IN
THE BIOSYNTHESIS OF THE FLORAL VOLATILE ISOEUGENOL

Preface

A modified version of this work has been accepted by The Plant Journal for

publication (Dexter R.J. Qualley A., Kish C.M., Ma C., Koeduka T., Nagegowda D.A.,

Dudareva N., Pichersky E, Clark D.G. (2006) Characterization of a petunia

acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. Plant J,

(accepted July 19, 2006).) PhCFAT in vitro enzyme work (Figure 3-4, Figure 3-5, and

Table 3-1) was contributed by the lab of Natalia Dudareva (Purdue University, West

Lafayette, IN), while internal levels of homovanillic acid and coniferyl aldehyde (Figure

3-2) were contributed by the lab of Eran Pichersky (University of Michigan, Ann Arbor,

MI). Natalia Dudareva and Eran Pichersky also assisted in the critical reading of the

manuscript.

Introduction

The scent of petunia flowers consists almost exclusively of volatile

benzenoid/phenylpropanoid compounds, whose emission levels change rhythmically

through a daily light/dark cycle with a maximum at midnight (Kolosova et al., 2001;

Verdonk et al., 2003). Phenylpropanoid compounds, including phenylethyl alcohol,

phenylacetaldehyde, and phenylethyl acetate, have recently been shown to be derived

from phenylalanine (Tieman et al., 2006; Kaminaga et al., 2006). Benzenoid compounds









in petunia scent such as methyl benzoate, benzyl alcohol, benzylaldehyde and benzyl

benzoate are also most likely derived from phenylalanine (Boatright et al., 2004).

Recently it has been shown that isoeugenol, a prominent floral scent component in

petunia, is synthesized from an ester of coniferyl alcohol (Koeduka et al., 2006).

Isoeugenol synthase 1 (PhIGS1), the enzyme catalyzing the formation of isoeugenol in

petunia, has been demonstrated to efficiently use coniferyl acetate as a substrate in vitro

(Koeduka et al., 2006). To date, direct proof of the formation of coniferyl acetate or

similar coniferyl esters in petunia has not yet been presented, nor has the enzyme

responsible for the formation of such an ester been identified. It is possible that the

synthesis of coniferyl esters is catalyzed by a member of the BAHD acyltransferase

family. This class of plant enzymes has been found to catalyze the acylation of numerous

plant secondary compounds (D'Auria, 2006). The BAHD enzymes transfer an acyl

moiety of an acyl-CoA compound to an alcohol, thus forming an ester.

We have previously reported the construction of a petal-specific EST databases for

petunia (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005) and have used

bioinformatics analysis, RNAi-based loss of function approach, and biochemical

characterization to define the contribution of specific proteins encoded by these ESTs in

floral scent biosynthesis. Thus, we were able to identify one type of EST that encodes an

enzyme belonging to the BAHD family, and subsequent RNAi gene inactivation and

biochemical characterization showed that this protein, named PhBPBT benzyll

alcohol/phenyl ethanol benzoyl transferase), catalyzes the formation of benzyl benzoate

and phenyl benzoate (Boatright et al., 2004; Appendix A). Transcripts encoding PhBPBT

as well as other petunia scent-synthesizing enzymes accumulate predominantly in the









petal limbs, change rhythmically during a daily light/dark cycle, and decrease in response

to exogenous or pollination-induced ethylene (Chapter 2).

Here we report the isolation and characterization of a petunia cDNA encoding

another member of the BAHD family, coniferyl alcohol acyltransferase (PhCFAT).

PhCFAT transcript analysis revealed an expression pattern typical of a floral volatile

biosynthesis gene. Inactivation of the PhCFAT gene via RNAi-induced gene silencing

resulted in petunia flowers that neither synthesize nor emit isoeugenol. The biochemical

characterization of the protein encoded by this gene revealed that it can catalyze the

formation of coniferyl acetate from coniferyl alcohol and acetyl-CoA.

Results

Identification of a Flower-Specific Putative BAHD Acyltransferase

To identify floral volatile biosynthesis genes in petunia, we searched our petunia

petal EST database (http://www.tigr.org) for cDNAs encoding proteins with sequence

similarity to known scent biosynthetic enzymes. In this search we identified a cDNA

whose complete open reading frame encoded a protein of 454 amino acids with

homology to several biochemically characterized BAHD acyltransferases that catalyze

floral volatile production, including PhBPBT from petunia (26% identity), benzyl alcohol

acetyl transferase (BEAT) from Clarkia brewer (23% identity), and an alcohol

acyltransferase AAT1 from Rosa hybrida (22% identity). Additionally, this petunia

protein (which based on the biochemical characterization described below was designated

acetyl-CoA: coniferyl alcohol acetyltransferase (PhCFAT)) was 28% identical with

anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (Yang

et al., 1997) and hydroxycinnamoyl transferase (HCT) from Nicotiana tabacum

(Hoffman et al., 2003). However, it had the highest sequence identity, 55%, with two









uncharacterized members of the BAHD family from Arabidopsis (At5g16410 and

Atlg78990).

To determine if this BAHD acyltransferase is critical to floral volatile biosynthesis

in petunia flowers, we first examined the expression pattern of the PhCFA T gene. Real-

time RT-PCR measurements (Figure 3-1) indicated that PhCFATtranscripts are present

only in the limb parts of the petals, and expression was much higher during the night.

This pattern of expression is similar to those of five previously characterized floral scent

genes in petunia that include two benzoic acid/salicylic acid methyltransferases that

catalyze the synthesis of methyl benzoate (PhBSMT] and PhBSMT2) (Negre et al., 2003;

Underwood et al., 2005), phenylacetaldehyde synthase (PhPAAS) responsible for

phenylacetaldehyde formation (Kaminaga et al., 2006), PhlGS1 (Koeduka et al., 2006)

and PhBPBT(Boatright et al., 2004).

Suppression of PhCFAT Expression Leads to a Decrease in Synthesis and Emission
of Isoeugenol and Several Other Volatiles

To determine if PhCFAT functions in floral scent biosynthesis, RNAi-induced gene

silencing was employed to decrease PhCFAT transcript levels and subsequent protein

activity. Three independent transformed lines with reduced PhCFAT levels (PhCFAT

RNAi lines 6, 15, and 16) were obtained and analyzed at the T2 generation for reduced

transcript and altered volatile production (Figure 3-2, 3-3). PhCFATtranscript analysis

of whole flower tissue collected at Zeitgeber time (ZT) 13 revealed a substantial decrease

in PhCFATtranscript in all transgenic lines compared to controls (Figure 3-2). This

decrease in transcript levels coincided with a substantial decrease in isoeugenol emission

as measured over a 1 h period beginning at ZT 13 in all transgenic lines analyzed (Figure

3-2, 3-3). In addition to a decrease in isoeugenol emission, the emission of five other









volatiles also decreased in the RNAi lines compared to MD (Figure 3-2, 3-3). These

volatiles included phenylacetaldehyde, phenylethyl alcohol, phenylethyl acetate,

phenylethyl benzoate, and benzyl acetate. Analysis of the internal concentrations of

volatiles in the flowers further supported emission results, showing reduced levels of

isoeugenol, phenylethyl alcohol, phenylethyl benzoate, and benzyl acetate as compared to

control (MD). No consistent differences in emission and internal levels were observed

for benzaldehyde, benzyl alcohol, benzyl benzoate, methyl benzoate, and methyl

salicylate, while consistent results were not observed for internal pools of

phenylacetaldehyde (line 15 contained wild-type levels) and phenylethyl acetate (non-

detected) (Figure 3-2, 3-3). In addition, two compounds found in the petal tissues,

homovanillic acid and coniferyl aldehyde, were present in levels >1000% and >500%

higher respectively, in the RNAi lines as compared with the control (341 [tg/g FW of

coniferyl aldehyde in PhCFATRNAi lines vs. 51 [tg/g FW in MD, and 445 [tg/g FW of

homovanillic acid in PhCFA TRNAi lines vs. 27 [tg/g FW in MD).

PhCFAT Acetylates Coniferyl Alcohol and Several Other Substrates in a pH-
Dependent Manner

To determine the enzymatic activity of the putative petunia PhCFAT protein, the

complete coding region of a PhCFAT cDNA was subcloned into the expression vector

pET-28a, expressed in E. coli, and the recombinant protein was purified to 99%

homogeneity using nickel-based affinity chromatography. The purified recombinant

protein was evaluated for its ability to acetylate coniferyl alcohol as well as a variety of

other alcohols using acetyl-CoA as a source for the acetyl moiety. Analysis of

recombinant PhCFAT activity across a pH range from 3.5 to 8.5 showed the highest

activity with coniferyl alcohol at pH 6.0, which was two-fold higher than at pH 7.5 (33.2









and 17.0 nkat/mg protein, respectively). It should be noted that at neutral or basic pH

coniferyl alcohol is likely deprotonated, which can be easily noticed by a change in the

color of the reaction mixture before addition of the enzyme. At pH 6.0, PhCFAT

displayed a narrow substrate preference, efficiently accepting only coniferyl alcohol and

sinapyl alcohol (71% of activity with coniferyl alcohol). Activities with all other tested

substrates did not exceed 12% of activity with coniferyl alcohol at this pH (Figure 3-4).

To evaluate PhCFAT activity at a more physiological pH, assays with different alcohol

substrates were also performed at pH 7.5. At this pH, PhCFAT displayed broader

substrate preference. Although activity with coniferyl alcohol was still the highest, the

enzyme could also use 1-octanol, cinnamyl alcohol, geraniol, and sinapyl alcohol

(ranging from 54% to 26% relative to coniferyl alcohol, respectively) (Figure 3-4). The

activities with other substrates such as eugenol, 2-benzyl alcohol, phenylethyl alcohol, 2-

hexanol, p-coumaryl alcohol, 3-hydroxybenzyl alcohol, and isoeugenol were not higher

than 3% of activity utilizing coniferyl alcohol. To evaluate the specificity of the

PhCFAT for the acyl donor, we also checked the larger acyl-CoA substrates benzoyl-

CoA, butyryl-CoA, malonyl-CoA, and hexanoyl-CoA in the presence of coniferyl alcohol

at pH 6.0 (using an indirect test of competition with radiolabelled acetyl-CoA), and found

that PhCFAT can efficiently use butyryl- and hexanoyl-CoA (81% and 54% of PhCFAT

activity with acetyl-CoA, respectively). PhCFAT activities with two other acyl donors,

malonyl-CoA and benzoyl-CoA, did not exceed 30% of that with acetyl-CoA.

Kinetic characterization of the purified recombinant PhCFAT protein revealed that

the apparent Km value for acetyl-CoA with coniferyl alcohol is slightly lower at pH 6.0

than at pH 7.5 (30.6 + 0.2 and 44.1 + 1.0 pM [mean + S.D.; n = 3], respectively), while









the apparent Km value for coniferyl alcohol at pH 6.0 is twice that at pH 7.5 (56.5 + 1.0

and 27.5 + 0.6 pM [mean + S.D.; n = 3], respectively) (Table 3-1). Despite the higher

apparent Km value for coniferyl alcohol at pH 6.0, the apparent catalytic efficiency of

PhCFAT (Kcat/Km ratio) is virtually the same at both pH values due to a higher turnover

rate of enzyme at pH 6.0 (Table 3-1). Overall, the catalytic efficiency of the enzyme is at

least >25 higher with coniferyl alcohol than with cinnamyl alcohol at pH 7.5, although,

interestingly, PhCFAT can use acetyl-CoA 7 times more efficiently with cinnamyl

alcohol as a co-substrate than with coniferyl alcohol.

Coniferyl Alcohol is Converted to Isoeugenol by PhCFAT and PhIGS1 in an In
Vitro Coupled Reaction

The petunia enzyme isoeugenol synthase 1 (PhIGS1) enzyme converts coniferyl

acetate to isoeugenol and cannot use coniferyl alcohol as the substrate (Koeduka et al.

2006). Since biochemical characterization of PhCFAT showed that it was able to

catalyze the formation of coniferyl acetate, we set up an in vitro coupled assay that

included both purified PhCFAT and PhIGS 1 with coniferyl alcohol, acetyl-CoA, and

NADPH. In this reaction, isoeugenol was produced (Figure 3-5A). When PhCFAT was

omitted from the reaction, no isoeugenol was obtained (Figure 3-5B).

PhCFAT Expression is Responsive to Ethylene, Shows a Diurnal Rhythm, and
Changes During Development

In addition to spatial regulation, further analysis of PhCFA T expression is

indicative of a gene that catalyzes the biosynthesis of floral volatiles in petunia.

Following exogenous ethylene treatment, volatile emission in petunia has been shown to

decrease in MD tissue as compared to line 44568 (ertl-1), a transgenic petunia line with

reduced ethylene sensitivity (Underwood et al., 2005; Wilkinson et al., 1997). Similarly

following exogenous ethylene treatment, PhCFAT transcript levels in MD petal limb









tissue decreased (10-fold) 2 h after treatment, compared to levels in line 44568 (Figure 3-

6A). A similar correlation between ethylene and PhCFA Ttranscript levels was also

observed following a successful pollination. At 24 h after pollination a period of rapid

ethylene biosynthesis was observed first in the stigma/style and ovary, and later in the

corolla, coinciding with a successful pollination resulting in decreased volatile emission

and ultimately petal senescence (Tang and Woodsen, 1996; Wilkinson et al., 1997; Jones

et al., 2003; Underwood et al., 2005). Prior to fertilization (<24 h after pollination),

PhCFATtranscript levels in all tissues were similar, however by 36 h after pollination,

endogenous ethylene resulted in decreased transcript levels in MD pollinated petal limb

tissue when compared to both non-pollinated control and line 44568 (Figure 3-6B). By

60 h after pollination, MD PhCFA Ttranscript levels were 500% lower then observed in

all other treatments.

Floral volatile emission has previously been shown to rhythmically oscillate

throughout the day (Kolosova et al., 2001; Verdonk et al., 2003). Diurnal PhCFAT

transcript analysis revealed a 10 tol5-fold change in transcript accumulation between the

highest transcript levels measured in the evening (ZT 13.5 to ZT 19.5) and lowest levels

measured in morning (ZT 1.5 to ZT 7.5) (Figure 3-7A). Emission of isoeugenol, a

downstream product dependent on PhCFAT activity, was also rhythmic with highest

levels in the evening (ZT 13.5 to ZT 1.5) and lowest levels in the afternoon (ZT 7.5)

(Figure 3-7B) coinciding with transcript accumulation. When the plants were

subsequently moved to complete darkness, both transcript accumulation and isoeugenol

emission continued to be rhythmic. However, peak accumulation and emission shifted 6

h and began to lose rhythmicity by 3 days in complete darkness indicating a role for both









light-dependent and circadian oscillator output factors in the regulation of PhCFAT

transcript (Figure 3-7).

Throughout early floral development volatile emission remains low, with a burst of

emission observed at anthesis (Verdonk et al., 2003). To further characterize PhCFAT

transcript accumulation, RNA was analyzed from whole flowers at different

developmental stages collected at ZT 13 (Figure 3-8). At early stages of floral

development (small bud, medium bud, and tube) low levels of PhCFATtranscript were

detected, however at later stages in development anthesiss and two-days past anthesis) a

substantial increase in PhCFATtranscript was observed coinciding with peak volatile

emission.

Discussion

PhCFAT is a BAHD Acyltransferase Critical to the Production of Isoeugenol

The BAHD acyltransferase family represents a diverse group of enzymes which

utilize CoA-thioesters to produce a diverse group of secondary metabolites critical to

many physiological processes in the plant including floral volatile emission (St-Pierre

and De Luca, 2000; D'Auria, 2006). Members of the BAHD family contain two

conserved motifs (HxxxD and DFGWG) as defining characteristics (St-Pierre and De

Luca, 2000). The HxxxD motif (specifically Hisl60) has been shown to be directly

involved in catalysis at the active site of the enzyme, while the DFGWG motif has been

shown to play a more structural role in stabilizing the enzyme (Ma et al., 2005). The

PhCFAT sequence also contains the conserved HxxxD motif and four out of five of the

conserved residues in the DFGWG motif as well significant sequence identity with

BAHD family members in other parts of the protein, indicating that it also belongs to the

BAHD acyltransferase family.









RNAi-based loss-of-function analysis in conjunction with in vitro biochemical

characterization provides a powerful tool for identifying the biochemical function of an

unknown enzyme in plant. Here we used these two approaches to characterize the

biochemical function of PhCFAT in petunia. Initial analysis of PhCFATRNAi transgenic

petunia revealed reduced biosynthesis and emission of the floral volatile isoeugenol

(Figure 3-2, 3-3). The recent discovery of the novel petunia NADPH-dependent

reductase (PhIGS1) capable of reducing coniferyl acetate to isoeugenol (Koeduka et al.,

2006), highlighted the importance of an acyltransferase that can form such a

hypothesized precursor to isoeugenol. To determine if PhCFAT could catalyze this

reaction, in vitro PhCFAT activity assays were used to identify potential substrates

(Figure 3-4). PhCFAT was shown to have the highest activity with coniferyl alcohol and

acetyl-CoA to form coniferyl acetate (Figure 3-4). These observations in conjunction

with an over 90% reduction in isoeugenol synthesis and emission in the PhCFATRNAi

lines support a role for PhCFAT in the acylation of coniferyl alcohol to coniferyl acetate.

Furthermore, a coupled in vitro reaction using coniferyl alcohol, acetyl-CoA and NADPH

and purified PhCFAT and ISG1 yielded isoeugenol, further showing the role of PhCFAT

in isoeugenol biosynthesis.

Our measurements of internal pools of volatiles and some of their precursors in

wild-type plants did not identify coniferyl alcohol or coniferyl acetate. Since coniferyl

alcohol and coniferyl acetate are not volatile (in fact solid at room temperature)

extraction and quantification of theses compounds has proven difficult. However, in the

PhCFATRNAi petals, the internal concentration of coniferyl aldehyde was on average

>500% higher than in wild type, and a second compound, homovanillic acid, also









accumulated at levels >1000% higher than in wild type plants. While a block in the

conversion of coniferyl alcohol to coniferyl acetate would be expected to cause the

accumulation of coniferyl alcohol, it is possible that this compound is not efficiently

extracted or cannot stably accumulate in the cell,(and instead is oxidized back to

coniferyl aldehyde). Homovanillic acid is likely derived from further oxidation and

decarboxylation of coniferyl aldehyde.

PhCFAT Mediates the Synthesis of Other Petunia Floral Volatiles

In addition to its role in acetylating coniferyl alcohol to synthesize the substrate for

isoeugenol synthase, it is possible that PhCFAT could also catalyze the acetylation of

other alcohols in petunia. Levels of benzyl acetate (emitted and internal) and phenylethyl

acetate (emitted) are down-regulated in the PhCFATRNAi lines (Figure 3-2, 3-3),

suggesting that PhCFAT is responsible, at least in part, for synthesizing these

compounds. However, even at pH7.5, the relative activity of PhCFAT with benzyl

alcohol and phenylethyl alcohol is <3% that of coniferyl alcohol. PhCFATRNAi lines

also showed a general reduction in levels of phenylacetaldehyde and compounds derived

from it (phenylethyl alcohol and its esters) (Figure 3-2, 3-3). While not clear, this could

indicate that the PhCFA TRNAi construct is not specific and suppressed the expression of

another unknown gene that is critical to phenylacetaldehyde biosynthesis.

PhCFAT Transcription Patterns are Indicative of a Petunia Floral Scent Gene

The biosynthesis and emission of floral volatiles is a process that depends on many

factors including tissue type, time of day, floral development, and ethylene. In the case

of petunia, these volatiles are synthesized and emitted primarily from the petal limb

throughout the evening, during late stages of floral development, and down-regulated in

response to both exogenous and post-pollination-induced ethylene (Kolosova et al., 2001;









Verdonk et al., 2003; Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005).

Recently we have reported the mode of transcript accumulation of five floral volatile

biosynthesis genes, PhBSMT1, PhBSMT2, PAAS, PhlGS1, and PhBPBT in MD (Negre et

al., 2003; Boatright et al., 2004; Underwood et al., 2005; Koeduka et al., 2006; Kaminaga

et al., 2006). In all cases, transcripts were primarily localized to the petal limb, and

rhythmically expressed with highest levels in the afternoon and lowest levels early in the

morning. Their expression was also developmentally regulated. Additionally,

transcription of PhBSMT and PhBPBTwas shown to be decrease in response to both

exogenous and pollination-induced ethylene (Negre et al., 2003; Underwood et al., 2005;

Chapter 2).

Here we show that PhCFAT expression is similarly restricted to the petal limb,

occurs in rhythmic manner (although with a slightly different temporal optimum than that

observed for PhBPBT and PhBSMT), increases during later stages in floral development,

and decreases in response to ethylene (Figure 3-1, 3-6, 3-7, 3-8). These observations

provide additional support for a shared general mechanism that regulates all floral

volatile biosynthesis genes in MD. Identifying the components of this mechanism, in

addition to the ODORANT1 gene previously described (Verdonk et al., 2005), and its

mode of action, will provide critical tools for future discovery of genes, enzymes, and

pathways critical to floral volatile biosynthesis.

Experimental Procedures

Plant Materials

Petunia x hybrida "Mitchell Diploid" (MD) was utilized as the control for all

experiments and served as the genetic background for the production of CaMAV35S:etrl-1

line 44568 (Wilkinson et al., 1997) and PhCFATRNAi transgenic petunias. Plants were









grown in a glass greenhouse without artificial lighting and an average temperature of 20

+5C dependent on time of day. Plants were grown in 1.2L pots with Fafard 2B potting

material (Fafard Inc., Apopka, Fl), and fertilized 4 times a week with 150mg Nitrogen /L

Scott's Excel 15-5-15 (Scotts Co., Marysville, OH).

cDNA Isolation

A 0.9kb partial cDNA (C2H4-7RR-B05) was selected and full length cDNA

obtained via 5' RACE using BD SMARTTM RACE cDNA Amplification Kit (BD

Biosciences Clontech, Palo Alto, CA). The resulting 1.8kb full-length cDNA coded for a

454 amino acid unknown transferase (subsequently named acetyl-CoA:coniferyl alcohol

acetyl transferase (PhCFAT) accession number DQ767969), with 55% identity to an

unknown Arabidopsis thaliana transferase (NP 178020).

Generation of PhCFATRNAi Transgenic Petunia

To determine the in vivo function of PhCFAT, RNAi induced-gene silencing

technology was utilized. Two fragments of the PhCFA T cDNA (corresponding to bases

1010-1344 and 1010-1671) were amplified using PCR and ligated end to end in a

sense/antisense orientation. The resulting construct was ligated downstream of thepFMV

(Richins et al., 1987) constitutive promoter and upstream of the nopaline synthase (NOS)

3' terminator sequence. The subsequent RNAi construct was sub-cloned into a binary

transformation vector containing the kanamycin resistance gene, neomycin

phosphotransferase (NPTII), and mated with Agrobacterium tumefaciens strain ABI. Six

week old MD leaves were transformed as previously described (Jorgenson et al., 1996),

and 16 primary transformants were recovered, transferred to soil, grown to maturity, and

screened for an altered volatile profile via flame ionization detection gas chromatography

and reduced PhCFAT transcript abundance via quantitative RT-PCR (see below). Plants









showing reduced isoeugenol emission and PhCFAT transcript when compared to MD

were self-pollinated and T1 progeny grown. T1 lines were screened for 3:1 segregation

of the transgene via PCR (verifying the presence of the NPTII gene), reduced PhCFAT

transcript, and reduced isoeugenol emission. Flowers from lines exhibiting 3:1

segregation were again self-pollinated and T2 seeds produced. Screening was repeated as

above and two 3:1 segregating (Lines 6 and 16) and one homozygous line (Line 15) were

identified and used for subsequent research reported here.

PhCFAT Expression Analysis by Real-Time RT-PCR

For spatial transcript analysis, stem, root, leaf, whole flower (at anthesis), petal

limb, petal tube, stigma/style, ovary, and sepal MD tissue were collected at ZT 13 and ZT

1. To determine transcript levels during floral development, small bud (1 cm), medium

bud (3-4 cm), tube (complete tube expansion but limb has not opened), anthesis

(complete limb expansion just prior to pollen release), and post-anthesis (two days past

pollen release) MD whole flowers were collected at ZT 13.

For rhythmic and ethylene-regulated expression, tissue was collected as previously

described (Underwood et al., 2005). For post-pollination transcript analysis, MD and line

44568 flowers were pollinated one day prior to anthesis or set aside as a non-pollinated

control. Beginning at ZT 3 both pollinated and non-pollinated MD and 44568 flowers

were collected, and the petal limb removed since spatial analysis revealed the petal limb

as the target tissue primary containing PhCFAT transcript. This process was repeated at

12 h intervals up to 60 h after pollination. For PhCFATRNAi transcript analysis, both

MD and PhCFA TRNAi whole flowers (at anthesis) were collected at ZT 13.

In all cases, tissue was collected and RNA extracted as previously described

(Underwood et al., 2005). Quantitative RT-PCR utilizing Taqman One-Step RT-PCR









reagents (Applied Biosystems, Foster City, CA), the following primers and probe

(PhCFAT Forward Primer: GCAAGTGTTGGACAGCTCAAGCAA, PhCFAT Reverse

Primer: TCTTGTTAGGGCTAGGCATTGGCA, and PhCFAT Probe: FAM -

TGATGAAGCAGCCATCGTTGTCTCCT-3BHQ 1), a series of in-vitro transcribed

PhCFAT standards, and 1 p1 of 100ng/pl RNA, were then used to quantify mean PhCFA T

levels as previously described (Underwood et al., 2005).

Volatile Emission

For the rhythmic emission experiment, volatiles were collected and analyzed as

previously described (Underwood et al., 2005). For the PhCFATRNAi experiment, seven

flowers were collected from five plants from each line (PhCFA TRNAi Lines 6, 15, and

16 along with MD) at ZT 13 for two nights. In all cases, volatiles were then collected for

1 h and eluted as previously described (Schmelz et al., 2001). The eluted volatiles were

then quantified via Flame-Ionization Detection Gas Chromatography (Hewlett-Packard

model 5890, Series II; Palo Alto, CA), and resulting data converted to ([g/g fresh

weight)/hour. PhCFATRNAi sample replicates were then divided by average MD

emission from the respective day to determine a percent difference for each sample.

Mean percent difference from MD (SE) were then calculated for each transgenic line.

Internal Volatile Extraction

To determine PhCFATRNAi internal volatile levels, three flowers were collected

from five plants from each line (PhCFA TRNAi Lines 6, 15, and 16 along with MD) at

ZT 13. In each case, the corolla (petal limb and tube) were removed, immediately frozen,

and ground using mortar and pestle. Internalized volatiles were then extracted from the

petunia tissue, supplemented with nonyl acetate (internal standard), as previously

described (Schmelz et al., 2004) with two deviations (no HCL added to sample, and









170C instead of 200C during vapor phase extraction). The eluted samples were then

analyzed via Flame-Ionization Gas Chromatography, and resulting data converted to (pg/

g fresh weight). For coniferyl aldehyde and homovanillic acid, tissue was ground and

extracted with dichloromethane overnight, and the extract analyzed on GC-MS and

compared with authentic standards. PhCFATRNAi sample replicates were then divided

by average MD emission from the respective day to determine a percent difference for

each sample. Mean percent difference from MD (SE) were then calculated for each

transgenic line.

Expression of PhCFAT in Escherichia coli and Purification of Recombinant Protein

The coding region of petunia PhCFAT was amplified by PCR using the forward

and reverse primers, 5'-CACATATGGGAAACACAGACTTTCATG-3' and 5'-

CATGGATCCTCAATAAGTAGCAGTAAGGTCC-3', respectively, and subcloned into

the NdeI-BamHI site of the expression vector pET-28a containing an N-terminal hexa-

histidine tag (Novagen, Madison, WI). Sequencing revealed no errors introduced during

PCR amplifications. Expression was performed in E. coli BL21 Rosetta cells grown in

LB medium with 50 [g/ml kanamycin and 37 [g/ml chloramphenicol at 180C.

Induction, harvesting, and protein purification by affinity chromatography on nickel-

nitriloacetic acid agarose (Qiagen, Valencia, CA) were performed as described previously

(Negre et al., 2002). Eluted fractions with the highest PhCFAT activity were desalted on

Econo-Pac 10DG columns (Bio-Rad Laboratories; Hercules, CA) into 50mM Tris-HCl

buffer (pH 7.5) with 2% glycerol and examined by SDS-PAGE gel electrophoresis

followed by Coomassie Brilliant Blue staining of the gel. The purity of the isolated

protein was 99% and was taken into account for calculations of Kcat determination. Total









protein concentration was determined by the Bradford method (Bradford, 1976) using the

Bio-Rad (Hercules, CA) protein reagent and BSA as a standard.

Enzyme Assays

Enzyme activity was measured by determining how much of the 14C-labelled

acetyl group of acetyl coenzyme A was transferred to the side chain of coniferyl alcohol.

The standard reaction mixture (50 pl) contained purified PhCFAT protein (18 Gg) and

140 [iM acetyl-CoA (containing 0.08 iCi; Amersham Biosciences UK Limited,

Buckinghamshire, UK) in assay buffer (50 mM citric acid pH 6.0, ImM DTT or 50mM

Tris-HCl pH 7.5, 1 mM DTT). After incubation for 15 min at room temperature, the

product was extracted with 100 ptl hexane and 50 ptl of the organic phase was counted in

a liquid-scintillation counter (model LS6800; Beckman, Fullerton, CA). The raw data

(cpm, counts per minute) were converted to nanokatals (nkat, nanomoles of product

produced per second) based on the specific activity of the substrate and efficiency of

counting. Controls included assays using boiled protein with and without alcohol

substrate.

For kinetic analysis an appropriate enzyme concentration was chosen so that the

reaction velocity was proportional to the enzyme concentration and was linear with

respect to incubation time for at least 15 min. Kinetic data were evaluated by hyperbolic

regression analysis.

Competition Assays.

Assay conditions were similar to those described for the standard PhCFAT assay.

In addition to 0.08 itCi [1-14C] acetyl-CoA, each reaction mixture contained 182 [tM of

the competitor substrate unlabelledd). The formation of coniferyl acetate was measured

by liquid scintillation counting. The cpm values obtained in competitor substrate assays









were compared to results of control assays with only radioactive acetyl-CoA and

coniferyl alcohol substrates. If assay results of competitor substrates were 85 to 100% of

the counts observed in the control reaction not supplemented with unlabelled CoA esters,

the compound was not considered to be a substrate for PhCFAT.

Product verification was performed using TLC. For TLC analysis, the standard

reaction was scaled to 1 mL using non-radiolabel acetyl-CoA (Sigma, St. Louis, MO).

The reaction product was extracted in ImL of hexane, concentrated to around 10 IL,

spotted onto a pre-coated silica-gel TLC plate (PE SIL G/UV; Whatman, Maidstone,

Kent, England) and co-chromatographed with authentic standards using ethyl acetate-

hexane (7:3, v/v) as a solvent.

Coupled In Vitro Reaction

The coupled reaction with PhCFAT and PhIGS1 was carried out in 100 mM MES-

KOH buffer (pH 6.5) containing 0.5 mM coniferyl alcohol, 0.3 mM acetyl-CoA, 0.5 mM

NADPH, and 2 pg of each purified enzyme, in a total volume of 150 pl. After incubation

at RT for 20 min, reaction solution was extracted with 1 ml of hexane, and the hexane

solution concentrated with liquid N2. A fraction (2pl) was in injected into the GC-MS for

analysis (Figure 3-5A). The reaction shown in Figure 3-5B was carried out and analyzed

in identical fashion, except that PhCFAT was not added to the reaction mixture.






60



0.4

0.3 -

S0.2 -
H I
S0.1 -
0
0 ..--- -- -- i [ -- 1, i,








Figure 3-. Characterization of the PhCFA Ttranscript accumulation in petunia. Mean
PhCFATtranscript levels (+/-SE, n=3) in root, stem, leaf and flower (whole
and dissected) tissue collected at ZT 1 (white) and ZT 13(,, ,/), and analyzed
via real-time RT-PCR.







61




100 100 100
Isoeugenol Benzyl acetate Methyl salicylate
50 50 50

0 0

-50 -50 -50

-100 -100 -100
S 100 100 2400
Phenylacetaldehyde Benzaldehyde Homovanillic acid
50 50 1800


O 0 0 1200
50 0 600
S||
g -10 -100- 0
S 100 100
Phenylethyl acalcohol Coferyl aldehyde











Emission Interal
S50 50 600



-50 -50- 200








003 -
-100- -100- 002
100 100
P henylethylacetate Benzyl benzoate 0 0
50 50 l .
o o T Emission Internal


S00 03-
-100 -100 0023
100 100 *'

50 50
0008 -









Emission Internal Emission Internal


PhCFAT RNAi Transgenic Petunia Lines

Figure 3-2. Effect of RNAi suppression of PhCFATon emitted and internal volatiles.
PhCFATRNAi (Line 6, 15 or 16) emission and internal volatiles levels
relative to MD. Emission values ( SE, n=10) and internal concentration
values (n=12, SE, except for homovanillic acid and coniferyl aldehyde,
where n=4) were collected at ZT 13. ND = Not Detected. Mean PhCFAT
transcript levels ( SE, n=3) are shown in the lower right.








(E: 50%; I: -)
Phenylacetaldehyde E

I
Phenylethyl alcohol (E: ,75%; I: 750/

!
Phenylethyl
benzoate
(E:, 75%; I:-0 )

Phenylethyl
acetate
(E: 50%; I: ND)
(E: ;, I: 1 )
Benzaldehyde o

(E: ; I: ; -1 )
Benzyl alcohol


Benzyl benzoate
(E: -; I: -*)


Phenylalanine


o)

Trans-cinnamic acid Para-coumarate

I
Caffeic
acid

I
Ferulic
acid

I
(E: ND; I: t 600%)
Homovanillic Coniferyl
acid aldehyde
(E: ND; I: 1200%) I


Benzyl acetate
(E: ,75%; I: 75%)


Benzoic Salicylic Acid
acid
1 Methyl salicylate
t (E: 4-; : -I )
Methyl benzoate
(E: ; I: **)


Coniferyl
alcohol
PhCFAT
Coniferyl
acetate
PhlGS1 I
Isoeugenol
(E: 4 95%; I: 95%)


Figure 3-3. A generalized metabolic pathway for petunia floral volatiles altered in
PhCFATRNAi transgenic petunia. Percent change (1 increase, [ decrease,
*- no change) in PhCFATRNAi emitted (E:) and internal (I) volatiles as
compared to MD. PhCFAT and PhIGS1 enzymes are represented in italics.
ND = Not Detected.











Substratea


Relative Activity
pH 6.0 (%)


Cinnamyl alcohol

p-Hydroxycinnamyl
alcohol

Coniferyl alcohol


Sinapyl alcohol


Isoeugenol


Eugenol

2-Phenylethyl
alcohol

Benzyl alcohol

3-Hydroxybenzyl
alcohol


1-Octanol

2-Hexanol

Geraniol


Relative Activity
Structure
pH 7.5 (%)
OH

41.6 H

1.3 -P
0 OH

100 H
H

25.9 Ho-


0.7


2.9 HO -

1.6


2.7

1.1
HO
54.2

1.4

40.4


Figure 3-4. Relative activity of PhCFAT with selected alcohol substrates. Activity was
measured at pH 6.0 and pH 7.5. In both cases activity with coniferyl alcohol
was set at 100% and was 33.2 and 17.0 nkat/mg protein at pH 6.0 and 7.5,
respectively, a alcohols were used at 2 mM; b molecular structure of
alcohols added.












Table 3-1. Kinetic parameters of PhCFAT

Substrate K. (RM)

Coniferyl alcohol 56.5 9.5

pH 6.0 (with acetyl CoA)O
Acetyl CoA 30.6 0.2
(with coniferyl alcohol)b
Coniferyl alcohol
27.5 5.5
(with acetyl CoA)8

Acetyl CoA
44,1 + 10.1
(with coniferyl alcohol)b
pH 7.5
Cinnamyl alcohol 662.1 71.3
(with acetyl CoA)c

Acetyl CoA 4.0 1.9
(with cinnamyl alcohol)d
at 143SM b at2mM at 18gM at4mM


Vmx,(nkat mg-1)


40.1 2.7


45.3 1.8


15.9 1.6


29.5 3.5

15.8 0.8


18.3 8.9


K,(s-")


2.05 0.14


2.32 0.09


0.811 0.08


1.51 0.18

0.81 0.04


Kt/K.(mM-1 s-1)


36.8 4.5


75.7 2.6


30.3 6.5


34,7 3.4

1.2 0.1


0.93 0.014 233.7 5.3













PhCFAT +PhIGS1


A I 5 7" 103 13 1


PhIGS 1

B


14 15 16 17 (min)

Figure 3-5. The coupled in vitro reaction of PhCFAT and PhIGS1 leads to the production
of isoeugenol from coniferyl alcohol. A) Gas chromatogram of the hexane-
soluble compounds present in the reaction mixture after incubation for 20 min
at RT. The reaction mixture contained coniferyl alcohol, acetyl-CoA,
NADPH, and purified PhCFAT and PhIGS 1. The isoeugenol peak was
identified by MS (inset) and comparison of MS and retention time with
authentic isoeugenol. B) Gas chromatogram of the hexane-soluble
compounds present in the reaction mixture after incubation for 20 min at RT.
The reaction mixture contained coniferyl alcohol, acetyl-CoA, NADPH, and
purified PhIGS 1, but no PhCFAT.












0.3
-MD
0.225 44568

A 0.15
0
o 0.075




Hours after ethylene treatment (h)
0.3
44568 P
0.225 NP
B E -- 44568 NP
B 0.15

0.075 -

0


Hours after pollination (h)


Figure 3-6. Ethylene-dependent regulation of PhCFATtranscript levels. A) Mean
PhCFATtranscript levels (+/- SE, n=3) in MD (black) and line 44568 (etri-1)
(white) petal limb tissue treated with exogenous ethylene, collected at 0, 2, 10,
24, 36 and 48 h after treatment, and quantified via real-time RT-PCR. B)
Mean PhCFATtranscript levels (+/- SE, n=3) from pollinated and non-
pollinated MD (black) and 44568 (etri-1) (white) petal limb tissue collected at
12 h intervals following a successful pollination, and analyzed via real-time
RT-PCR.







67



0.2



0.1




0-


4Isoeugenol Emission

S3

B 2




0-






A) Mean PhCFATtranscript levels (+/- SE, n=3) from whole flowers
collected at 6 h increments for five days, and analyzed via real-time RT-PCR.
Plants were grown in standard greenhouse conditions for two days and then
transferred to complete darkness. B) Mean isoeugenol emission (+/- SE, n=3)
collected from whole flowers at 6 h increments for five days as described
above.






68



0.24

0.18 -

S0.12 -

0 0.06

0






Figure 3-8. Developmental regulation ofPhCFATtranscript levels in petunia floral
tissue. Mean PhCFATtranscript levels (+/- SE, n=3) from whole flower
tissue collected at 5 developmental stages (small bud, medium bud, tube,
anthesis, and 2 days past anthesis) at ZT 13, and analyzed via real-time RT-
PCR.














CHAPTER 4
PHYSIOLOGICAL INTERACTIONS AND ENVIRONMENTAL STIMULI

Introduction

Since plants are sessile organisms they must sense and interact favorably with the

environment around them to survive. Here a set of diverse experiments that focus both

on the physiological interactions of floral volatiles with surrounding organisms such as

humans, pollinators, and fungi, and the effect of environmental cues such as light and

temperature on floral volatile biosynthesis are discussed. Based on previous literature

and observations, the primary goal of these experiments was to determine which

physiological processes are directly influenced by the production of these chemicals, and

which environmental cues influence their synthesis. Due to the scope and nature of these

experiments, some experiments were not replicated, but are included below as a basis for

further research.

Physiological Interactions

Human Olfactory Panels

Floral volatile emission in Petunia x hybrida cv "Mitchell Diploid" (MD) has been

shown to rapidly decrease following treatment with exogenous ethylene (Chapter 2;

Chapter 3; Underwood et al., 2005). To determine if humans could perceive this

decrease in volatile emission, excised MD flowers were treated with ethylene or air for

12 h, placed into individual glass jars, and capped 30 minutes prior to sampling. Sixty

panelists were then asked to smell each of three jars ((two with ethylene treated/ one air)

or (two air treated/ one ethylene)) and determine which flower differed from the other









two (Table 4-1). Forty-six out of 60 panelists were able to identify the correct flower,

indicating that a statistically significant (p<.001) number of panelists could correctly

discern ethylene treated petunia flowers from those treated with air (Table 4-2). Those

panelists who correctly identified the MD flower treated with ethylene described it as less

fragrant, earthy, or musty, while those who correctly selected the MD flower treated with

air described it as overwhelming, too sweet, medicinal, and more fragrant. This

observation indicates that human olfaction can discern the decrease in volatile emission

from petunia flowers resulting from ethylene treatment.

The use of human olfactory panels has proved to be an invaluable tool for studying

the ability of human panelists to perceive changes in the floral volatile emission of both

PhBSMTRNAi transgenic petunia, with >90% decreased methyl benzoate emission

(Underwood et al., 2005), and ethylene treated flowers (Table 4-2). In the future, it will

be interesting to utilize this tool to study other transgenic petunia including PhBPBT

RNAi and PhCFATRNAi plants. Though proven difficult to date (Appendix B), the

production of transgenic petunia that over-express floral volatile biosynthesis genes

including PhBSMT1, PhBSMT2, PhBPBT, and PhCFA Twill be good candidates for

future olfactory panels. Identification of genes and subsequent volatile compounds

whose absence or overexpression are perceivable to humans will prove valuable to more

effective genetic engineering of floral volatile emission in the future.

Pollinator Attraction

One of the primary physiological functions of floral volatile emission is to attract

pollinators to the flower to increase the efficiency of fertilization and subsequent seed

yield. Recent work, testing the ability of nine common petunia floral volatiles to excite

Manduca sexta antennae receptors (using an electroantennogram), has shown that









benzaldehyde, methyl benzoate, and benzyl alcohol elicit the strongest response within

the antennae receptors (Hoballah et al., 2005). To test whether the removal of one of

these compounds, methyl benzoate, has an effect on M. sexta attraction in vivo, adult M

sexta moths were placed in a cage containing a MD and PhBSMTRNAi (containing

>90% decreased methyl benzoate emission (Underwood et al., 2005)) plant with an

equivalent number of flowers. For a 30 minute period prior to dusk (Zeitgeber time (ZT)

12.5 to ZT 13) during a summer night, the visitation pattern of the moths was observed to

determine the number of flower visitations to each plant. Prior to experimentation, a visit

was defined as a >1 second hover time over an individual flower. Results from the MD

vs. PhBSMTRNAi flight trial show a larger percentage of visitations to MD flowers

(Table 4-3, Exp. 1). These results suggest that greatly reduced methyl benzoate emission

may affect the flowers ability to attract M sexta. However, further repetition will be

necessary to confirm this result.

In addition to PhBSMTRNAi petunia, other transgenic petunia including PhBPBT

and PhCFA TRNAi., and PhBSMT, PhBPBT, and PhCFA T over-expression plants may be

worthy candidates for future flight trials. Similar to human olfactory panels, the

identification of genes and volatile compounds that affect pollinator attraction may

facilitate more effective genetic engineering of floral volatile emission, potentially

resulting in increased seed set and/or crop yield.

Following a successful pollination in MD petunia, endogenous ethylene is

synthesized throughout the flower signaling a shift in floral function from one of

pollinator attraction to one of ovary expansion and seed development (Jones et al., 2003).

These endogenous ethylene signals down-regulate floral volatile emission since the









function of floral volatile emission as a pollinator attractor is complete (Underwood et al.,

2005). This decrease in volatile emission could make the flower less attractive to a

pollinator, decreasing visitation and increasing the chance of the pollinator visiting a

flower which has not yet been pollinated.

To test this hypothesis, MD flowers were either pollinated or treated with

exogenous ethylene and placed into the flight cage alongside untreated controls (Table 4-

3, Exp. 2-5), and M sexta visitations were analyzed for a 30 minute period beginning at

ZT 12.5 (prior to dusk). As was the case with the PhBSMTRNAi vs. MD experiments,

the effect of both exogenous ethylene treatment and pollination on pollinator visitation

was inconclusive. When a MD plant treated with exogenous ethylene was placed by a

MD plant treated with air, no significant difference in pollinator frequency was observed

(Table 4-3, Exp. 2). When only three branches (10 flowers) of MD flowers treated with

ethylene were placed next to three branches of air treated flowers, substantially more

pollinator visits were seen to ethylene treated flowers than to air-treated flowers (Table 4-

3, Exp. 3).

When either whole plants or branches containing only flowers pollinated for 48 h

were placed beside non-pollinated controls, no difference in visitation was observed

(Table 4-3, Exp. 4, 5). Combined, these results suggest that exogenous or pollination-

induced ethylene did not result in a substantial decrease in pollinator visitation to petunia

flowers.

One explanation for a lack in significant differences in pollinator visitation to

flowers with reduced volatile emission is the distance that the pollinator must travel to

find the flowers emitting floral volatiles. Generally, floral volatiles are thought to be long









distance signals to potential pollinators that a nectar reward awaits (Pichersky and

Gershenzon, 2002). Once in close proximity other cues such as vision may allow a

pollinator to focus on a nearby flower. Therefore, the cage (2 meter square) utilized for

these experiments could have been too small, neutralizing any differing effects of floral

volatile emission. Future work utilizing a much larger enclosure (eg. shaded

greenhouses) or elongated wind tunnel will address this concern.

Defense against Fungal Pathogens

While floral volatiles have primarily been shown to interact with potential

pollinators, it has been suggested that individual volatiles might also play a role in

defense against fungal pathogens (Karapinar and Aktug, 1987; Adams and

Weidenborner, 1996; Gang, 2005). In MD corolla tissue, internal pools of several

volatiles including benzyl benzoate, methyl benzoate, and isoeugenol have been

quantified (Boatright et al., 2004). Utilizing transgenic RNAi petunias, we studied the

potential function of these different volatiles in the resistance of petunia petal tissue to

Botrytis cinerea growth. B. cinerea is a common fungal pathogen shown to attack >200

plant hosts including rose and petunia (van Kan, 2006). In the greenhouse, B. cinerea is

commonly found on damaged or senescing petunia petal tissue (personal observation).

Following 24 h of treatment with increasing dilutions of B. cinerea spores, tissue

necrosis was evident around the stock treatment in all flowers tested (Figure 4-1).

However, at the 1:10 dilution, PhCFATRNAi and MD flowers showed a moderate degree

of necrosis, while PhBSMT and PhBPBTRNAi flowers showed little to no evidence of

infection. Additionally, no evidence of fungal infection was evident in control, 1:100, or

1:1000 dilutions in any treated flowers following 24 h of treatment.









By 48 h after treatment, tissue damage due to B. cinerea infection continued to

expand with damage observed at every dilution in two PhCFAT and one PhBSMTRNAi

flowers (Table 4-4). In MD, B. cinerea growth was observed at 1:100 dilution in all

flowers analyzed. Interestingly, two PhBPBTRNAi flowers showed evidence of fungal

infection only at the 1:10 dilution, while all other flowers showed growth at 1:100.

Together these results indicate only a small difference in the resistance to B.

cinerea in any genotypes studied. PhBSMT and PhCFATRNAi lines were essentially

indistinguishable from MD when treated with varying concentrations of B. cinerea

spores. However, PhBPBTRNAi flowers seemed to be slightly more resistant to fungal

growth. This observation suggests that PhBPBT function weakens the flowers resistance

to fungal attack, however subsequent experiments will be necessary to confirm this

observation.

In addition to B. cinerea (a necrotrophic fungi) it will be interesting to determine if

the resistance to other pathogens such as bacteria (eg. Pseudomonas syringae), insects

(spider mites), and other fungi (biotrophs) are affected in PhBSMT, PhBPBT, and

PhCFA TRNAi transgenic petunia. For example, benzyl benzoate has been shown to act

as a miticide against Tyrophagusputrescentiae (Schrank) and Sheep Mange (Dimri and

Sharma, 2004; Harju et al., 2004), indicating that benzyl benzoate might play a larger role

in the resistance of petunia to herbivores such as mites rather than fungal pathogens. By

identifying genes and subsequent volatile compounds critical to plant defense, we could

more effectively engineer plants with increased resistance to various pathogens,

potentially decreasing the necessity of pesticide use.









Environmental Stimuli

Light

Floral volatile biosynthesis is a metabolically expensive process that utilizes the

sun's energy to convert carbon dioxide to sugar (early precursors of volatile

biosynthesis). In petunia, precursors such as phosphoenol pyruvate and erythrose 4-

phosphate enter the shikimate pathway where they are converted to chorismate, a

precursor to benzenoid and phenylpropanoid volatile compounds that primarily constitute

petunia floral volatile emission (Weaver and Herrmann, 1997; Herrmann and Weaver,

1999; Knaggs, 2001; Boatright 2004). While the rhythmic emission of petunia floral

volatile emission has been well studied (Kolosova et al., 2001; Verdonk et al., 2003;

Underwood et al., 2005), the degree to which this emission is directly dependent on light

is less clear. Thus a series of experiments meant to test the direct correlation between

light and volatile production was conducted. Additionally, through the use of 44568

transgenic petunias, the role of ethylene in light-dependent regulation of floral volatile

emission was also studied.

To determine the role of light in the rhythmic regulation of floral volatile synthesis

in MD petunia, floral volatile emissions were collected from MD flowers at 6 h intervals

for two days in standard greenhouse conditions. As reported previously (Underwood et

al., 2005), methyl benzoate emission was rhythmic with peak levels observed at ZT 13.5

and lowest levels observed at ZT 7.5 (Figure 4-2). This pattern of emission was also

observed for three other floral volatiles, benzaldehyde, phenylacetaldehyde, and benzyl

benzoate, suggesting a similar mode of regulation.

While all volatiles were emitted rhythmically, their patterns were not identical.

Peak benzyl alcohol emission levels were delayed by 12 h (ZT 1.5) compared to









previously discussed volatiles including methyl benzoate and benzyl benzoate. This

increase in benzyl alcohol emission coincides with decreased benzyl benzoate emission,

which is synthesized by the transfer of a benzoyl group to benzyl alcohol via PhBPBT in

petunia. Additionally, peak isoeugenol and phenylethyl alcohol emission was sustained

for a 12 h period (ZT 13.5 to ZT 1.5). For all volatiles, lowest levels of emission were

measured in the early afternoon (ZT 7.5).

Combined, these results suggest two common modes of rhythmic regulation

dependent on the volatile. In one mode (methyl benzoate, benzaldehyde,

phenylacetaldehyde, and benzyl benzoate) peak volatile emission is observed at ZT 13.5,

decreased by ZT 1.5, and lowest at ZT 7.5, while in a second mode (isoeugenol, and

phenylethyl alcohol) peak volatile emission is sustained for a 12 h period (ZT 13.5 to ZT

1.5) followed by a rapid decrease in emission by ZT 7.5. It is probable that benzyl

alcohol emission would also fall into this second mode of regulation; however prior to ZT

19.5 benzyl alcohol is being utilized to produce benzyl benzoate resulting in reduced

benzyl alcohol emission (ZT 13.5 to ZT 19.5). To confirm that benzyl alcohol is

rhythmically emitted similar to isoeugenol and phenylethyl alcohol, it would be

interesting to analyze the rhythmic emission of benzyl alcohol in PhBPBTRNAi

transgenic petunia, which covert benzyl alcohol to benzyl benzoate at a highly reduced

rate. The observation of two distinct groups of regulated volatiles suggests a difference

in function, where volatiles released earlier in the evening could attract one pollinator,

whereas volatiles released in the early morning could attract another.

To determine the dependence of rhythmic volatile emission on light availability,

MD plants were transferred to complete darkness for three days, and volatile emission









was quantified every 6 h (Figure 4-2). If rhythmic emission of each volatile was light

dependent, movement to complete darkness would result in a loss of rhythmic emission.

However, if rhythmic emission was regulated by a rhythmic oscillator (which regulates

several functions throughout the plant independent of light) emitted volatiles would

continue to oscillate even when plants are transferred to complete darkness.

The effect of complete darkness on petunia floral volatile emission varied

dependent on the compound measured (Figure 4-2). In one group of floral volatiles,

which included benzaldehyde, benzyl alcohol, phenylacetaldehyde, methyl benzoate, and

benzyl benzoate, rhythmic emission of each volatile was primarily light-dependent

resulting in one additional circadian cycle of emission observed following 24 h of

complete darkness, and a complete loss of rhythmic emission observed thereafter. In a

second group of volatiles, which included isoeugenol and phenylethyl alcohol, emission

was primarily light-independent with rhythmic emission of each volatile evident

throughout the course of the experiment. Combined, these results indicate that the

regulation of floral volatile emission in petunia is dependent both on light-dependent and

circadian-related factors. However, similar measurements from plants moved to constant

light conditions will be necessary to confirm this result.

To determine if ethylene might play a role in regulating the rhythmic regulation of

volatile emission, MD and 44568 flowers were collected at 4 h intervals for 24 h under

standard greenhouse conditions (Figure 4-3). While the analysis of emission levels of the

7 primary constituents of petunia floral volatile emission revealed slightly increased

levels of benzyl alcohol, methyl benzoate, phenylethyl alcohol, and isoeugenol in MD

volatile emission compared to 44568, and slightly increased levels of benzaldehyde in









44568 floral emission compared to MD, the overall patterns of regulation were

essentially equivalent. These results indicate that ethylene does not play a direct role in

regulating the normal rhythmic emission of floral volatile emission in petunia.

To further determine the direct dependence of floral volatile emission on sunlight,

MD and 44568 plants were placed in normal greenhouse conditions (un-shaded) or

placed in >50% shade conditions and allowed to adjust equilibratee) to these conditions

for one week (Figure 4-4). Floral volatile emissions were then collected at ZT 13 and

analyzed for differences in plants grown in the shade compared to un-shaded. Results

from this experiment revealed that a >50% reduction in light levels did not affect overall

MD or 44568 volatile emission, and is still sufficient to support significant floral volatile

emission in petunia. While results from the previous experiment reveal that most floral

volatile emission is light dependent, it is possible that even after a 50 to 60% light

reduction, the minimal light threshold for volatile production had not yet been reached.

Experiments with further reduced light levels will be critical to determining this

threshold.

In order to further determine the importance of light absorbed within 24 h of

volatile emission, MD and 44568 plants were placed under black cloth overnight, and

either moved to un-shaded greenhouse conditions or left under black cloth for 11 h at

equivalent temperatures prior to floral volatile collection (ZT 13) (Figure 4-4). In

contrast to previous observations (Figure 4-2), all seven primary petunia floral volatiles

emitted from MD flowers were still quantifiable following 24 h under black cloth.

Interestingly, levels of benzyl alcohol, phenylethyl alcohol, and isoeugenol were

statistically equivalent to levels measured in flowers treated with 11 h of light, while









benzaldehyde, phenylacetaldehyde, methyl benzoate, and benzyl benzoate levels were

slightly higher in MD flowers treated with 11 h of light. This observation suggests that

substrates generated as a result of photosynthesis during the prior 24 h period could affect

overall volatile emission in petunia. Interestingly, an increase in volatile emission was

not observed when 44568 plants were treated with light, suggesting a role for ethylene in

the conversion light energy to volatile substrates. Further research will be necessary to

determine significance, if any, of this observation.

One explanation for the difference in volatile emission between this experiment and

the previous experiment (where plants were moved to complete darkness) has to do with

light levels in the dark treatments. In the earlier experiments, plants were moved to

complete darkness absent of any environmental cues. However in the black cloth

experiment, light was not blocked from below resulting in <2imol/m2/s levels quantified

under the black cloth. While low, this amount of light could act as an environmental cue

that triggers floral volatile biosynthesis. If true this observation would indicate that floral

volatile emission is not dependent on light due to high energy needs, but instead as an

environmental cue to stimulate floral volatile biosynthesis.

The observation of prominent floral volatile emission, even when placed under low

light conditions for 24 h, indicates that MD and 44568 plants can utilized stored

substrates to produce floral volatile emission. To determine if these stored substrates

were transferred from the photosynthetic tissue of the plant, excised MD and 44568

flowers were again placed under black cloth overnight and either removed and placed in

un-shaded greenhouse conditions or left in darkness 11 h prior to volatile collection.









As seen previously, excised MD flowers left under black cloth emitted floral

volatile levels equivalent or above levels observed in excised flowers treated with 11 h of

light (Figure 4-4). This observation was even more evident in 44568 flowers where in

some cases (benzaldehyde and phenylethyl alcohol) levels were substantially higher in

dark treated flowers compared to flowers treated with 11 h of light. This observation is

significant in that it shows that excised flowers can still store enough precursor in the

floral tissue to produce floral volatiles in the absence of high light levels and source

tissues of the plant. Additionally, equivalent or reduced levels in flowers treated with 11

h of light indicate that light harvested by floral photosynthetic tissue does not

immediately contribute to floral volatile biosynthesis.

Temperature

To date, the mechanisms regulating floral volatile emission remain largely

unknown. However passive diffusion of floral volatiles, produced within the epidermis

of the corolla, have long been thought to play a role in this process. Recent evidence

from research on Petunia axillaris, a parent of MD, has shown a direct correlation

between the boiling point of a given volatile compound and the emission to internal

volatile ratio (vapor pressure) observed in floral tissue (Oyama-Okubo et al., 2005).

Compounds with lower boiling points were shown to have a higher vapor pressure, where

as volatiles with higher boiling points were shown to have a lower vapor pressure. This

observation indicates that temperature has a critical role in the regulation of floral volatile

emission.

To determine the effect of temperature fluctuations on both internal and emitted

volatile levels, MD and 44568 petunias were placed into 2 side by side greenhouses with

equivalent light levels. One of these houses had an average temperature of 3 10C, while









the other house had an average temperature of 230C. After three days of equilibration,

emitted and internal (extracted from corolla tissue) volatiles were collected at ZT 13, and

analyzed to determine a percent change in both emitted and internalized volatile levels in

flowers from warmer conditions compared to flowers from cooler conditions. In MD

flowers, the emission of volatiles with low boiling points such a benzaldehyde and benzyl

alcohol increased >100% over levels collected at cooler conditions (Figure 4-5). This

coincided with >25% decrease in internal volatile levels of these compounds when

compared to flowers collected from cooler conditions. Additionally, emitted levels of

other volatiles with lower boiling points including phenylacetaldehyde, methyl benzoate,

and phenylethyl alcohol were also elevated in warmer conditions. However, a substantial

decrease in internalized pools was only observed for phenylacetaldehyde. Emitted levels

of isoeugenol and benzyl benzoate (the two volatiles with the highest boiling points) did

not show any significant changes in warmer conditions.

Overall, these results indicate that dependent on the temperature, the ratios of

individual volatiles in floral volatile emission will vary. Volatiles with lower boiling

points are more prominent in floral volatile emission at higher temperatures than lower

temperatures, whereas emission of volatiles with higher boiling points remains static

throughout. This observation is most likely attributed to the physical nature of each

volatile, however changes in metabolism in response to temperature can not be ruled out.

Therefore, in addition to regulation at the molecular level, temperature represents a

critical factor in the regulation of floral volatile emission.









Experimental Procedures

Human Olfactory Panel

MD whole flowers were collected at anthesis at ZT 11, and treated with 2-3 l/L

ethylene or air for 12 h overnight. In conjunction with Dr. Charlie Sims (Food and

Agricultural Sciences, University of Florida) flowers were placed in individual glass jars

and capped for 30 minutes prior to sampling. Using a triangle test format, three jars (two

ethylene / one air treated or two air/ one ethylene treated) were presented to human

panelists who were asked to select the jar whose volatile emission differed from that of

the other two, and give a comment as to why they picked that jar. Statistical significance

(p <.001) was determined as previously described (Lawless and Heyman, 1998).

Manduca sexta Flight Trials

Manduca sexta were purchased from NCSU Entomology (Campus Box 7613,

Raleigh, North Carolina) at the pupa stage and emerged on the day of flight experiments.

Prior to each experiment, whole plants (Exp. 1,2,4) or 3 branches (10 flowers) (Exp. 3,5)

from each of two conditions were then placed into a 2m square pvc cage lined with 30%

shade cloth, and elevated approximately 60 cm off the ground. For PhBSMTRNAi vs.

MD experiments, plants were groomed, leaving an equivalent number of flowers at

anthesis. Forty-eight h prior to the experiment, MD flowers for the pollination vs. non-

pollinated flight trials were pollinated or tagged as non-pollinated controls, while all

other flowers were removed. For ethylene treatment experiments, whole plants or

branches with equivalent number of flowers at anthesis were treated with 2-3 l ethylene

for 10 h prior to flight trials. The plants/branches were then spread 90cm apart.

Dependent on the experiment, a variable number of moths were then released into the

cage 30 minutes prior to dusk (ZT 12.5 to ZT 13) during a summer night and allowed to









forage for 30 minutes. Flight trials were run on evenings following sunny days with a

temperature of 270C + 3. A visit was defined as a >1 second hover over a single flower.

Fungal Pathogen Experiments

Botrytis cinerea, a common fungal pathogen, was isolated from petunia petal tissue

collected from the greenhouse, and grown to sporulation on potato dextrose agar (PDA)

under 16 h of light at 240C. Once sporulated, a sterile loop dipped in potato dextrose

broth (PDB) was lightly dragged across the surface of the plate to reduce hyphal damage

and collect spores. The loop was then placed in 10ml of PDB and the resulting stock

solution was vortexed for 30 seconds. Three subsequent 1 in 10ml PDB dilutions were

then made resulting in 1:10, 1:100, and 1:1000 dilutions.

At ZT 3, five whole flowers at anthesis, were collected from PhBPBTRNAi,

PhBSMTRNAi, PhCFATRNAi, and MD petunia and placed in 1% water agar blocks to

prevent desiccation. On one lobe of the petal limb, two 10Cl drops of PDB were placed

on the upper epidermis to determine orientation and to act as the negative control.

Moving counter-clockwise around the petal limb, 101 drops of PDB solution containing

B. cinerea spores (stock, 1:10 dilution, 1:100 dilution, and 1:1000 dilution) were then

added to each of the four remaining lobes resulting in four fungal treatments and a

negative control on each flower. The flowers were then placed in a 100% humidity

chamber at 240C, with 16 h of light. After 24 h, the diameter of fungal infection (necrotic

tissue) was measure two times and averaged for each treatment where damage was

evident. The flowers were then placed back into 100% humidity for an additional 24 h.

Forty-eight h after treatment, the flowers were again removed, and the largest dilution

with evidence of fungal infection (necrotic tissue) was noted.









Light Experiments

The rhythmic emission of petunia floral volatiles was collected and analyzed over a

five day period (two days under normal greenhouse conditions and three days in

complete darkness) as described previously (Underwood et al., 2005).

For MD and 44568 24 h whole flower emission, four sets of three flowers were

collected at anthesis from MD and 44568 plants grown as previously described (Chapter

3). MD and 44568 flowers were collected at 4 h intervals for 24 h beginning at ZT 1,

analyzed as previously described (Schmelz et al., 2001), and reported as mean volatile

emission standard error.

To determine the effects of reduced light levels on floral volatile emission, MD and

44568 plants were placed under normal light or shaded conditions within the same

greenhouse to control temperature variability. After one week, four sets of whole flowers

collected at anthesis from MD and 44568 shaded and un-shaded plants were the collected

on two subsequent sunny days at ZT 13 and analyzed as previously described to

determine mean volatile emission(n=8, SE) (Schmelz et al., 2001). Light readings

made at ZT 6 prior to each days sampling showed > 50% decrease in light intensity in the

shaded location as compared to un-shaded (Day 1: Un-Shaded 831 imol/m2/s, Shaded -

359 Imol/m2/s (57% decrease); Day 2: Un-shaded 907C mol/m2/s, Shaded -

409.5 Imol/m2/s (55% decrease)).

To determine the dependence of floral volatile emission on light harvested within

24 h of emission, MD and 44568 plants, and MD and 44568 excised whole flowers at

anthesis, were placed under black cloth at ZT 13 (24 h prior to volatile collection). At ZT

2 (the next morning) half the whole MD and 44568 plants or excised flowers were

removed from the black cloth and placed in unshaded conditions within the same









greenhouse to decrease temperature variability. At ZT 13 that evening, MD and 44568

flowers were then collected and analyzed as previously described to determine volatile

emission. The experiment was repeated a second day and results pooled to determine

mean volatile emission (n=8, SE). Light levels in the unshaded location collected at ZT

5 ranged from 487.5 to 975[mol/m2/s dependent on the day and location within the

greenhouse. Light levels under the black cloth were <2 imol/m2/s throughout.

Temperature Experiments

To determine the effects of temperature changes on MD floral volatile production,

MD plants were separated into two side by side greenhouses with equivalent mean light

levels (565.5 and 604.5 imol/m2/s), one with an average temperature of 31 C 1 (n=10,

SE), and one with an average temperature of 230C 1 (n=10, SE). Plants were then

left for three days to equilibrate. Once equilibrated, four sets of three flowers at anthesis

were collected at ZT 13 on two subsequent evenings, and analyzed as previously

described to determine volatile emission (n=8, SE). Two additional sets of three

flowers were collected at ZT 13 on each evening and set aside for internal volatile

analysis. The corolla tissue from these flowers was removed and the tissue was frozen in

liquid nitrogen. Internal volatiles were extracted as previously described (Schmelz et al.,

2004), and internal volatile levels (n=4, SE) determined via flame ionization gas

chromatography. Both emitted and internal volatile levels were reported as a percent

change in volatile levels at 310C as compared to levels at 230C standard error.












Table 4-1. The demographics of human olfactory panelists
Panelist
Panelist Under 18 18-29 30-44 45-65 Over 65 Total
Age (Yrs)
Men 0 22 5 4 1 32
Women 0 25 2 1 0 28
Total 0 47 7 5 1 60


Table 4-2. Human olfactory panel results, "ethylene treated vs. air treated flowers"
Results
Correct 46
Incorrect 14
Total 60
*** 33 out of 60 needed to
attain significance (p<.001)










Table 4-3. Manduca sexta visitation experiments
Flower Type Visits
Experiment 1 PhBSMT RNAi 17
MD 27
*** Moths Flown = 3
Experiment 2 C2H4 Treated MD 35
Air Treated MD 31
*** Moths Flown = 2
Experiment 3 C2H4 Treated MD 39
Air Treated MD 12
*** Moths Flown = 1
Experiment 4 Pollinated MD 61
Non-Pollinated MD 64
*** Moths Flown = 6
Experiment 5 Pollinated MD 31
Non-Pollinated MD 21
*** Moths Flown = 1
















3






Figure 4-1. Diameter of Botrytis cinerea infection in transgenic petunia 24 h after
treatment. PhBSMTRNAi, PhBPBTRNAi, PhCFATRNAi, and MD whole
flowers were collected at anthesis and treated with 10Ol of PDB broth
containing variable concentrations of Botrytis spores. Two 10tl drops off
PBP only were used for orientation and the negative control. The next lobe
counter-clockwise was treated with the stock concentration of Botrytis spores
in 10tl of PDB, followed by a 1:10, 1:100, and 1:1000 dilutions. Pictures
were taken 24 h after treatment. Mean diameter of tissue infection (n=5, +SE)
in stock (grey) and 1:10 dilution (black) concentrations 24 h after treatment.
No evidence of tissue infection was observed in negative controls (not
shown).




Full Text

PAGE 1

REGULATION OF FLORAL VOLATILE SYNTHESIS IN Petunia x hybrida CV MITCHELL DIPLOID By RICHARD JAMES DEXTER A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Richard James Dexter

PAGE 3

To my family; my wife Stephanie; and our two puppies Misty and Carley.

PAGE 4

ACKNOWLEDGMENTS I thank my supervisory committee for all of their hard work, advice and patience. I especially thank my advisor (Dr. David Clark) for all his guidance and advice on how to be a better scientist and be a better professional. I thank Dr. Harry Klee for his advice and allowing me to roam his lab for the past 5 years; Dr. Kevin Folta, for his advice on the interaction of light and volatile production, and his unique outlook on my research; and Dr. Charlie Sims for his help with human olfactory panels. I also extend a special thanks to Dr. Eric Schmelz, for all of his assistance and time invested into measuring internal volatile pools in wounded petunia leaves. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iv LIST OF TABLES ...........................................................................................................viii LIST OF FIGURES ...........................................................................................................ix ABSTRACT .......................................................................................................................xi CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW....................................................1 Introduction...................................................................................................................1 Components of Floral Volatile Emission.....................................................................2 Physiological Roles of Floral Volatiles........................................................................3 Pollinator Interactions...........................................................................................3 Defense Compounds..............................................................................................5 Petunia x hybrida cv Mitchell Diploid.....................................................................6 Mitchell Diploid Floral Volatile Emission...................................................................7 Benzenoid/Phenylpropanoid Biochemistry..................................................................7 BAHD Family of Acyltransferases...............................................................................8 Complex Regulation of Floral Volatile Synthesis........................................................9 Spatial Regulation of Floral Volatile Synthesis............................................................9 Developmental Regulation of Floral Volatile Emission.............................................11 Temporal Regulation of Floral Volatile Emission......................................................12 Ethylene-Dependent Regulation of Floral Volatile Emission....................................13 Ethylene Biosynthesis and Signaling Pathways..................................................13 Pollination-Induced Ethylene Production............................................................14 Wound-Induced Ethylene Production.................................................................14 44568 Transgenic Petunia with Reduced Ethylene Sensitivity...........................15 Ethylene and Floral Volatile Biosynthesis..........................................................15 Genetic Engineering of Floral Volatile Emission.......................................................16 Research Objectives....................................................................................................19 2 ETHYLENE-DEPENDENT REGULATION OF PhBPBT TRANSCRIPT AND BENZYL BENZOATE BIOSYNTHESIS IN Petunia x hybrida..............................21 Introduction.................................................................................................................21 v

PAGE 6

Results.........................................................................................................................24 PhBPBT Transcript Levels Following Treatment with Exogenous Ethylene.....24 Post-Pollination PhBPBT Expression..................................................................24 PhBPBT Transcript Levels in Petunia Leaves Treated with Ethylene................26 Ethylene-Dependent Regulation of PhBPBT Transcript Levels Following Repeated Wounding Events.............................................................................27 Discussion...................................................................................................................29 Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate Biosynthesis in Petunia Floral Tissue..............................................................29 Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate Biosynthesis in Petunia Vegetative Tissue After Wounding...........................32 Experimental Procedures............................................................................................34 Plant Material......................................................................................................34 cDNA Isolation....................................................................................................34 PhBPBT Transcript Analysis..............................................................................34 Internal Benzyl Benzoate Analysis.....................................................................36 3 CHARACTERIZATION OF A PETUNIA ACETYLTRANSFERASE INVOLVED IN THE BIOSYNTHESIS OF THE FLORAL VOLATILE ISOEUGENOL...........................................................................................................42 Preface........................................................................................................................42 Introduction.................................................................................................................42 Results.........................................................................................................................44 Identification of a Flower-Specific Putative BAHD Acyltransferase.................44 Suppression of PhCFAT Expression Leads to a Decrease in Synthesis and Emission of Isoeugenol and Several Other Volatiles......................................45 PhCFAT Acetylates Coniferyl Alcohol and Several Other Substrates in a pH-Dependent Manner...........................................................................................46 Coniferyl Alcohol is Converted to Isoeugenol by PhCFAT and PhIGS1 in an In Vitro Coupled Reaction...............................................................................48 PhCFAT Expression is Responsive to Ethylene, Shows a Diurnal Rhythm, and Changes During Development..................................................................48 Discussion...................................................................................................................50 PhCFAT is a BAHD Acyltransferase Critical to the Production of Isoeugenol.50 PhCFAT Mediates the Synthesis of Other Petunia Floral Volatiles...................52 PhCFAT Transcription Patterns are Indicative of a Petunia Floral Scent Gene..52 Experimental Procedures............................................................................................53 Plant Materials.....................................................................................................53 cDNA Isolation....................................................................................................54 Generation of PhCFAT RNAi Transgenic Petunia..............................................54 PhCFAT Expression Analysis by Real-Time RT-PCR.......................................55 Volatile Emission................................................................................................56 Internal Volatile Extraction.................................................................................56 Expression of PhCFAT in Escherichia coli and Purification of Recombinant Protein..............................................................................................................57 Enzyme Assays....................................................................................................58 vi

PAGE 7

Competition Assays.............................................................................................58 Coupled In Vitro Reaction...................................................................................59 4 PHYSIOLOGICAL INTERACTIONS AND ENVIRONMENTAL STIMULI........69 Introduction.................................................................................................................69 Physiological Interactions...........................................................................................69 Human Olfactory Panels......................................................................................69 Pollinator Attraction............................................................................................70 Defense against Fungal Pathogens......................................................................73 Environmental Stimuli................................................................................................75 Light....................................................................................................................75 Temperature.........................................................................................................80 Experimental Procedures............................................................................................82 Human Olfactory Panel.......................................................................................82 Manduca sexta Flight Trials................................................................................82 Fungal Pathogen Experiments.............................................................................83 Light Experiments...............................................................................................84 Temperature Experiments...................................................................................85 APPENDIX A PhBPBT RNAI TRANSGENIC PETUNIA................................................................94 Introduction.................................................................................................................94 Results and Discussion...............................................................................................94 Experimental Procedures............................................................................................95 Construction of PhBPBT RNAi Transgenic Petunia...........................................95 PhBPBT Expression and Volatile Emission Analysis.........................................96 B OVEREXPRESSION OF PETUNIA FLORAL VOLATILE SYNTHESIS GENES.......................................................................................................................98 Introduction.................................................................................................................98 Results and Discussion...............................................................................................98 Experimental Procedures............................................................................................99 Generation of PhBPBT and PhBSMT Overexpression Transgenic Petunia........99 Volatile Emission................................................................................................99 Expression Analysis..........................................................................................100 LIST OF REFERENCES.................................................................................................102 BIOGRAPHICAL SKETCH...........................................................................................111 vii

PAGE 8

LIST OF TABLES Table page 3-1 Kinetic parameters of PhCFAT................................................................................64 4-1 The demographics of human olfactory panelists......................................................86 4-2 Human olfactory panel results, ethylene treated vs. air treated flowers...............86 4-3 Manduca sexta visitation experiments.....................................................................87 4-4 Extent of floral tissue damage in transgenic petunia 48 h after infection with Botrytis cinerea........................................................................................................89 B-1 Analysis of PhBSMTOE and PhBPBTOE transgenic petunia...............................101 viii

PAGE 9

LIST OF FIGURES Figure page 1-1 A generalized schematic of biochemical pathways in petunia floral volatile biosynthesis..............................................................................................................20 2-1 Mean PhBPBT transcript levels following treatment with exogenous ethylene......38 2-2 The effect of pollination-induced ethylene on PhBPBT transcript and internal benzyl benzoate levels..............................................................................................39 2-3 Mean PhBPBT transcript levels (n=3, SE) in petunia leaf tissue following exogenous ethylene treatment..................................................................................40 2-4 PhBPBT transcript and internal volatile levels in petunia leaves following repeated wounding events........................................................................................41 3-1 Characterization of the PhCFAT transcript accumulation in petunia.......................60 3-2 Effect of RNAi suppression of PhCFAT on emitted and internal volatiles.............61 3-3 A generalized metabolic pathway for petunia floral volatiles altered in PhCFAT RNAi transgenic petunia...........................................................................................62 3-4 Relative activity of PhCFAT with selected alcohol substrates................................63 3-5 The coupled in vitro reaction of PhCFAT and PhIGS1 leads to the production of isoeugenol from coniferyl alcohol............................................................................65 3-6 Ethylene-dependent regulation of PhCFAT transcript levels...................................66 3-7 Daily light/dark fluctuations in PhCFAT transcript and isoeugenol emission.........67 3-8 Developmental regulation of PhCFAT transcript levels in petunia floral tissue......68 4-1 Diameter of Botrytis cinerea infection in transgenic petunia 24 h after treatment..88 4-2 Rhythmic emission of petunia floral volatiles..........................................................90 4-3 Twenty-four hour volatile emission in MD and 44568 whole flowers....................91 4-4 Light-dependent regulation of floral volatile emission............................................92 ix

PAGE 10

4-5 Temperature-dependent volatile emission in MD whole flowers............................93 A-1 PhBPBT RNAi and MD floral volatile emission......................................................97 x

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF FLORAL VOLATILE SYNTHESIS IN Petunia x hybrida CV MITCHELL DIPLOID By Richard James Dexter August 2006 Chair: David G. Clark Major Department: Plant Molecular and Cellular Biology Floral volatile emission comprises a unique blend of volatile compounds divergent among species of angiosperms. These volatiles have been proposed to function in a variety of physiological processes, including pollinator attraction and plant defense against fungal and bacterial pathogens as well as herbivores. Biosynthesis of floral volatiles is a tightly regulated process dependent on many factors including time of day, developmental stage of the flower, pollination status, and wounding. In this study, two genes from Petunia x hybrida cv Mitchell Diploid (MD), benzoyl-CoA: benzyl alcohol/phenyl ethanol benzoyltransferase (PhBPBT) and acetyl-CoA: coniferyl alcohol acetyltransferase (PhCFAT), were identified and shown (via RNAi-induced gene silencing) to be critical to floral volatile biosynthesis in petunia. In PhBPBT RNAi transgenic petunia lines, benzyl benzoate emission decreased >90%, while emission of benzyl alcohol and benzaldehyde increased when compared to MD. In PhCFAT RNAi xi

PAGE 12

transgenic petunia lines, isoeugenol emission decreased >90%, with lower levels of several other volatiles also observed. To better define the transcriptional regulation of floral volatile biosynthesis genes, PhBPBT and PhCFAT transcript levels were quantified. Transcript levels from both genes were primarily expressed in the petal limb, were rhythmically expressed dependent on the time of day, and underwent developmental regulation with highest levels observed during anthesis. Utilizing 44568 (35S CaMV:etr1-1) transgenic petunias, effects of pollination and wound-induced ethylene were also identified. In the corolla, pollination-induced ethylene decreased transcript levels of both genes. However, in the ovary tissue, ethylene sensing was associated with an increase in PhBPBT transcript. Additionally, an increase in PhBPBT transcript was also observed in vegetative tissue following mechanical wounding. Further insight into the effects of environmental stimuli (light and temperature) on volatile emission, and physiological interactions with pollinator, fungal pathogens, and humans were also addressed. Improved understanding of the complex regulation of floral volatile biosynthesis will allow more effective engineering of floral volatile emission. xii

PAGE 13

CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW Introduction Floral volatile emission is composed of a diverse blend of volatile compounds that is highly variable among species of angiosperms. Production of these volatiles is thought to lead to more efficient seed set and increased plant defenses, while also increasing the commercial value of both ornamentals and cut flowers. Over the past decade, these qualities have made volatile production an attractive target for genetic engineering. However attempts to date to genetically alter or restore floral volatile emission have been relatively unsuccessful. Production of floral volatiles is a tightly regulated process dependent on many factors including time of day (light/dark cycle), developmental stage of the flower, and pollination status. In this study, two genes, benzoyl-CoA: benzyl alcohol/phenyl ethanol benzoyltransferase (PhBPBT) and acetyl-CoA: coniferyl alcohol acetyltransferase (PhCFAT) were identified, and shown (utilizing RNAi induced gene silencing) to be critical to floral volatile biosynthesis. Detailed analysis of transcript levels in conjunction with volatile biosynthesis revealed several common modes of regulation, including regulation mediated by the gaseous plant hormone ethylene. The goal of this research was to gain a further understanding into the biosynthetic and hormonal regulation of floral volatile synthesis to more effectively genetically engineer floral volatile emission. 1

PAGE 14

2 Components of Floral Volatile Emission Various floral volatile compounds are emitted at ratios unique to individual species of angiosperms. These compounds typically have a low molecular weight (100 to 250 D), low polarity, and high vapor pressure (Piechulla and Pott, 2003; Dudareva and Pichersky, 2000); and can be divided into four major classes depending on their structure: fatty-acid derivatives, benzenoids and phenylpropanoids, isoprenoids, and nitrogen-containing compounds (Knudsen et al., 1993). Fatty-acid derived volatiles (eg. n-hexanol, n-hexanal, and methyl jasmonate) consist mainly of saturated and unsaturated hydrocarbons generated from the breakdown of fatty acids (primarily linolenic and linoleic acids) via a family of lipoxygenases (LOX) (Hatanaka, 1993; Seo et al., 2001; Cheong and Choi, 2003). Benzenoids and phenylpropanoids (the main components of MD floral volatile emission) are derived from aromatic amino acids (phenylalanine and tyrosine), and include volatiles such as methyl benzoate and isoeugenol (Knudsen, 1993; Dudareva and Pichersky, 2000; Boatright et al., 2004, van Schie et al., 2006). Isoprenoids are the most abundant group of plant volatiles, and are divided into four groups: irregular (hemi) terpenes, monoterpenes, sesquiterpenes, and diterpenes. Of these groups, monoterpenes (eg. linalool) and sesquiterpenes (eg. caryophyllene) comprise the majority of the volatile compounds. The least-abundant group is the nitrogen-containing compounds, of which indole is the most commonly identified member (Knudsen 1993; Pichersky et al., 2006). The amounts and types of volatiles emitted by individual species are diverse. For example, in C. breweri benzyl acetate is the major constituent of floral volatile emission (methylsalicylate, linalool, and benzyl benzoate are other minor constituents) (Raguso and Pichersky, 1995). In A. majus (Snapdragon), methyl benzoate is the main constituent

PAGE 15

3 of its floral volatile emission, along with other volatiles including myrcene and trans-beta-ocimene (Dudareva et al., 2000). In Rosa hybrid cv Fragrant Cloud, phenylethyl alcohol is the major volatile constituent (Guterman et al., 2002). Physiological Roles of Floral Volatiles Pollinator Interactions Floral volatiles have been shown to have many physiological functions in the plant, including pollinator signaling. For example, in vitro, treatment of paper flowers with various floral volatiles elicited more frequent hovering and close passes from adult Manduca sexta, when compared to the untreated controls (Raguso et al., 2002). While attracted by floral volatiles, these moths never extended their proboscis (an important step in which the moth is able to collect its nectar reward and enhance pollination) indicating that floral volatiles might act as long-range signals that guide the pollinator into close proximity. Once nearby, others factors such as petal color or nectar availability could induce the moth to extend its proboscis and feed. More recently, honey bees (Apis mellifera) were shown to relate floral volatile emission (eg. rose) to a location of a food source. For 2 days, a sugar food source was placed at two separate locations containing two different scents (eg. rose vs. lemon). The sugar sources were then removed, and the respective scent was injected directly into the hive. After injection, the bees visited the location that previously contained the respective scent and food source (Reinhard et al., 2006). In this case, floral volatile emission was not the primary attractant, but instead a reminder that led pollinators back to a location containing a food reward. For many years, the co-evolution of flowering plants and their respective pollinators has interested the scientific community (Baker, 1961). One example of

PAGE 16

4 plant:pollinator co-evolution is through temporal emission, where floral volatiles are only emitted when desired pollinators are active. For example, Snapdragon (Antirrhinum) is a bee-pollinated angiosperm that maximizes floral volatile emission during the day, when bees are most active (Dudareva et al., 2000). In contrast, Nicotiana alata is a hawkmoth-pollinated species with the highest emission of floral volatiles at night, coinciding with moth activity (Raguso et al., 2003). In addition to timing of floral volatile emissions, the identity of floral volatiles emitted is thought to affect pollinator attraction. For example, antennae olfactory receptor cells from female Manduca sexta were shown to react differently to various volatiles (Shields and Hildebrand, 2001). Additionally, when Fruit Chafer (Pachnoda marginata) were released into a box with two exits (one exit contained a control volatile while the other contained the sample volatile), floral volatiles such as methyl benzoate, methyl salicylate, and phenylacetaldehyde induced high visitation percentages, while other volatiles including the green leafy volatiles did not (Larsson et al., 2003). Not all floral volatiles have been shown to attract pollinators. The flowers of a sexually-deceptive orchid (Ophrys sphegodes) increase emission of the floral volatile, farnesyl hexanoate, after pollination by solitary male bees (Andrena nigroaenea). Artificial treatment of flowers with farnesyl hexanoate decreased visits by the male bees confirming the volatiles function in deterring visits by pollinators after pollination (Schiestl and Ayasse, 2001). This is advantageous to the plant since it helps direct pollinators to un-pollinated flowers, thus increasing pollination efficiency. While beneficial for pollinator attraction, the production of floral volatiles is not without risk. Recently it has been shown that floral volatiles produced by Canada Thistle

PAGE 17

5 (Cirsium arvense) attracted 10 different pollinators and 16 different floral herbivores (Theis, 2006). Benzaldehyde and phenylacetaldehyde (the most abundant volatiles) were shown to attract both pollinators and herbivores. Defense Compounds In addition to pollinator interactions, some floral volatiles are thought to play a role in plant defense. These volatiles could act either as direct defense compounds, or indirectly as signaling molecules. To date, there is little evidence supporting a role for floral volatiles as direct defense compounds. In vitro the floral volatile eugenol (clove oil) has been shown to act as an anti-bacterial (Salmonella typhimurium, Staphylococcus aureus and Vibrio parahaemolyticus) and anti-fungal (Cladosporium herbarum) agent (Karapinar and Aktug, 1987; Adams and Weidenborner, 1996). Additionally, benzyl benzoate has been shown to act as a miticide against common mites such as Tyrophagus putrescentiae (Schrank) and Sheep Mange (Dimri and Sharma, 2004; Harju et al., 2004). As an indirect defense (signaling) compound, little evidence supporting a role for floral volatiles in flower defense has been published. However, two floral volatiles, methyl jasmonate and methyl salicylate, have been shown to act as indirect defense compounds in vegetative tissue. Methyl jasmonate is a highly fragrant volatile initially identified in Jasminum grandiflorum and demonstrated to facilitate wound-induced defense signaling (Cheong and Choi, 2003). In Nicotiana attenuata, treatment of leaves with exogenous methyl jasmonate led to increased internal levels of nicotine and decreased damage due to herbivory (Baldwin, 1998). Additionally, treatment of Lycopersicom esculentum leaves with exogenous methyl jasmonate resulted in increased levels of proteinase inhibitors 1 and 2, which when ingested by an herbivore, prevent digestion and limit herbivory (Farmer and Ryan, 1990). Methyl jasmonate has also been

PAGE 18

6 proposed to facilitate the plant systemic response to herbivore-induced wounding (Ryan and Moura, 2002; Farmer et al., 2003). Similarly, methyl salicylate (derived from the plant hormone salicylic acid) is another floral volatile proposed to indirectly induce plant defense (Cauthen and Hester, 1989). Following insect attack, methyl salicylate is emitted from leaves of several species including tobacco and tomato (Kessler and Bladwin, 2001; Ament et al., 2004; Effmert et al., 2005). In Nicotiana tabacum, treatment of plants with increasing levels of exogenous methyl salicylate, reduced tissue damage from tobacco mosaic virus (TMV) infection and increased expression of the PR-1 gene (Silverman and Raskin, 1997). Petunia x hybrida cv Mitchell Diploid Over the past 5 years Petunia x hybrida cv Mitchell Diploid (MD) has become a model system for the study of floral volatile emission. It was identified from a backcross of Petunia axillaris and Petunia hybrid cv Rose du Ciel resulting in a haploid plant (n=7) (Petunia x hybrid cv Mitchell (Mitchell et al., 1980)), which, when grown in tissue culture, spontaneously gave rise to a diploid plant with no genetic variation between the two sets of chromosomes (Griesbach and Kamo, 1996). The resulting self-pollinated progeny have an identical genetic composition to the previous generation, and provides an ideal genetic background for the production of transgenic plants. Other advantages of MD include a well established transformation protocol (Jorgenson et al., 1996), a short life cycle, strong floral volatile emission, ethylene-induced floral senescence (Wilkinson et al., 1997), availability of the ethylene-insensitive 44568 (35SCaMV:etr1-1) transgenic petunia, and a collection of 10,000 ESTs (Underwood, 2003) that facilitate identification and isolation of novel genes in petunia.

PAGE 19

7 Mitchell Diploid Floral Volatile Emission MD floral volatile emission is primarily composed of several benzenoid/ phenylpropanoid compounds. Using GC-MS analysis these compounds were identified as benzaldehyde, phenylacetaldehyde, methyl benzoate, phenylethyl alcohol, isoeugenol, and benzyl benzoate, with methyl benzoate being the most abundant volatile in the group. Other volatiles identified include phenylethyl benzoate, vanillin, two sesquiterpenes (germacene D and cadina-3,9-diene), two aliphatic aldehydes (decanal and dodecanal), and two fatty-acid derivatives (3-hexenal and 2-hexanal) (Verdonk et al., 2003; Boatright et al., 2004). Emission of these volatiles is rhythmic with highest emission in the evening. Spatial analysis showed that the highest emission of volatiles was localized to the petal limb (Verdonk et al., 2003). Benzenoid/Phenylpropanoid Biochemistry Phenylpropanoids and benzenoids make up the primary volatile constituents of petunia floral volatile emission, and originate from the aromatic amino acid phenylalanine (Boatright et al. 2004). Via the shikimate pathway, phosphoenol pyruvate and erythrose 4-phosphate are converted to chorismate, the precursor to the aromatic amino acids tryptophan, tyrosine and phenylalanine (Weaver and Herrmann, 1997; Herrmann and Weaver, 1999). Chorismate is converted to phenylalanine through a three step process, in which prephenate and arogenate are intermediates (Figure 1-1; Knaggs, 2001). Phenylalanine is then converted either to phenylacetaldehyde (with a phenylethyl amine intermediate (Tieman et al., 2006) or without (Kaminaga et al., 2006)) via an aromatic amino acid decarboxylase, or converted to trans-cinnamic acid via phenylalanine ammonia lyase (PAL) (Figure 1-1; Jones H.D., 1984). Phenylacetaldehyde

PAGE 20

8 can then be converted to phenylethyl alcohol (rose oil) via 2-phenylacetaldehyde reductase, a commercially important enzymatic process. Trans-cinnamic acid is the precursor to several benzenoid and phenylpropanoid volatile compounds that make up the floral volatile emission of petunia. Through the use of radioactive feeding studies, trans-cinnamic acid has been shown to be a precursor of several benzenoid compounds including benzoic acid, benzyl alcohol, benzaldehyde, benzyl benzoate, and benzyl acetate (Figure 1-1; Boatright et al., 2004). Additionally, it can be converted to coniferyl alcohol via the phenylpropanoid pathway (Dixon and Paiva, 1995). Coniferyl alcohol is then converted to isoeugenol via a two-step pathway (Koeduca et al., 2006; Chapter 3). BAHD Family of Acyltransferases The BAHD family of acyltransferases is made up of a group of enzymes that transfer CoA-thioesters to a diverse group of substrates (DAuria, 2006). This family was named after the first four enzymes characterized including benzyl alcohol O-acetyltransferase (BEAT) from C. breweri, anthocyanin O-hydroxycinnamoyltransferase (AHCT) from Gentiana triflera, anthranilate N-hydroxycinnamoyl/benzoyltransferase (HCBT) from Dianthus caryophyllus, and deacetylvindoline 4-O-acetyl-transferase (DAT) from Catharanthus roseus (St-Pierre and De Luca, 2000). These enzymes contain two conserved motifs (HxxxD and DFGWG) critical to the function of the transferase (St-Pierre and De Luca, 2000). Determination of the crystal structure of vinorine synthase (a BAHD enzyme that catalyzes the formation of ajmaline in Rauvolfia serpentine) further clarified the importance of these motifs to enzyme function (Ma et al., 2005). In the HxxxD motif, the H160 residue is located within the solvent channel at the active site of the enzyme. The D164 residue points in the opposite direction, away

PAGE 21

9 from the active site, and seems to have a structural function. While critical to the function of the enzyme, the DFGWG motif is far removed from the active site of the enzyme, and thought to have a purely structural role. Several members of the BAHD family of acyltransferases have been shown to catalyze floral volatile biosynthesis. These enzymes include acetyl-CoA: benzyl alcohol acetyltransferase (CbBEAT) from C. breweri shown to catalyze the production of benzyl acetate and benzoyl-CoA: benzyl alcohol benzoyl transferase (CbBEBT) from C. breweri shown to primarily catalyze the production of benzyl benzoate, NtBEBT from Nicotiana tabacum also shown to primarily catalyzed the production of benzyl benzoate, benzoyl CoA: benzyl alcohol/phenyl ethanol benzoyltransferase (PhBPBT) from Petunia x hybrida shown to primarily catalyze the production of benzyl benzoate and phenylethyl benzoate, and geraniol acetyltransferase (RhAAT) from Rose hybrida shown to primarily catalyze the production of geranyl acetate, (Dudareva et al., 1998a; DAuria et al., 2002; Shalit et al., 2003; Boatright et al., 2004). Complex Regulation of Floral Volatile Synthesis Floral volatile biosynthesis is a highly regulated process dependent on may factors including tissue type (spatial), time of day (light/dark cycle), developmental stage, and pollination status (ethylene). Through this complex regulation, floral volatile emission is more efficiently produced to coincide with peak pollinator activity and flower fertility, while reducing the risk of inadvertently attracting herbivores (Theis, 2006). Spatial Regulation of Floral Volatile Synthesis The spatial regulation of floral volatile biosynthesis gene expression varies dependent on the gene and species. For example, the C. breweri acetyl CoA: benzyl alcohol acetyltransferase (CbBEAT), which encodes an acyltransferase shown to catalyze

PAGE 22

10 the synthesis of benzyl acetate, was expressed exclusively in the flower, with highest transcript levels localized to the petal, sepal, and style (Dudareva et al., 1998a). This pattern of transcript accumulation was shown to coincide with spatial emission of the volatile benzyl acetate (Dudareva et al., 1998b). Benzoyl-CoA: benzyl alcohol benzoyltransferase (CbBEBT), another gene identified in C. breweri, encodes an enzyme that catalyzes production of benzyl benzoate (DAuria et al., 2002). Using northern blot analysis, RNA was shown to accumulate primarily in the petal limb, with transcript also identified in the stamens, style, sepals, and petals. Transcript levels were also measured in the leaves 4 h after wounding. In the flower, benzyl benzoate emission coincided with CbBEBT transcript levels with highest emission measured from the stigma, and lower levels measured from other parts of the flower. Benzyl benzoate emission from the leaves was not reported (DAuria et al., 2002). Another floral volatile biosynthesis gene isolated and characterized from C. breweri, S-adenosyl-L-methionine: (iso)eugenol O-methyltransferase (CbIEMT), expression was again shown exclusively in the flower with highest levels of expression localized to the petal, and lower expression in the style and stamen (Wang et al., 1998). This pattern coincided with volatile emission (eugenol, isoeugenol, methyleugenol, and isomethyleugenol), with highest levels emitted from the petal limb, and some emission observed in the style and stamen (Wang et al., 1998). In MD, several floral volatile biosynthesis genes have been identified and characterized. These genes include S-adenosyl-L-methionine: benzoic acid/salicylic acid methyltransferase (PhBSMT1 and 2), benzoyl-CoA: benzyl alcohol/phenyl ethanol

PAGE 23

11 benzoyltransferase (PhBPBT), and isoeugenol synthase (PhIGS1) (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005; Koeduka et al., 2006). Transcript levels of all genes are highest in the petal limb, with lower expression found in other parts of the flower (petal limb, ovary, stigma/style). This pattern of expression coincides with volatile emission that is primarily produced in the petal limb (Verdonk et al., 2003). Homologs of PhBSMT1 and 2 have also been identified in other species including A. majus and Nicotiana suaveolens. In Snapdragon (A. majus), S-adenosyl-L-methionine: benzoic acid carboxy methyltransferase (AmBAMT) (shown to utilize benzoic acid as a preferred substrate) gene expression was isolated to the upper and lower lobes of the flower, and coincided with peak BAMT activity (Dudareva et al., 2000). In another PhBSMT homolog, NsBSMT, transcript levels were again isolated to the flower, where highest levels were localized to the petal tissue (Pott et al., 2004). Developmental Regulation of Floral Volatile Emission In addition to spatial regulation, floral volatile biosynthesis is also dependent on the developmental stage of the flower. In C. breweri, CbBEAT and CbIEMT transcript (and CbBEAT activity) levels were undetectable in the petal (tissue with highest transcript accumulation) until anthesis, where levels rapidly increased peaking 1-2 days after anthesis (Dudareva 1998a). This pattern of expression coincides with floral volatile emission, where highest emission was measured 1-2 days after anthesis coinciding with optimal fertility (Dudareva et al., 1998b). Similarly, in the petal tissue, CbBEBT transcripts and protein activity were also undetectable until anthesis, peaking between 2 and 4 days after anthesis (DAuria et al. 2002). However, in the stigma (tissue of highest transcript accumulation), CbBEBT transcript and protein levels were highest 2 days prior to anthesis and gradually decreased throughout the time course (DAuria et al., 2002).

PAGE 24

12 With the exception of CbBEBT levels in stigmatic tissue, these results show a direct correlation between transcript, enzyme activity, and volatile emission levels. In MD and snapdragon (A. majus) floral expression of PhBPBT and AmBAMT has also been shown to be developmentally regulated with transcript detected throughout the time course, peaking 1-2 days after anthesis (Boatright et al., 2004). Coinciding with this increase in transcript levels, floral volatile emission in both plants peaks 1 to 2 days after anthesis (Verdonk et al., 2003). Temporal Regulation of Floral Volatile Emission Floral volatile emissions rhythmically oscillate dependent on the light/dark cycle throughout the day. In MD petunia, PhBSMT1 and 2, and PhBPBT transcript levels have been shown to oscillate with highest levels in the afternoon and lowest levels in the early morning (Kolosova et al., 2001; Boatright et al., 2004; Underwood et al., 2005). The peak is followed by maximum volatile emission 6 h later (during the evening) (Underwood et al., 2005). When petunia plants were moved to constant light or constant dark conditions, a loss in PhBSMT1 and 2 transcripts and methyl benzoate emission rhythmicity was assessed. Constant dark resulted in an overall decrease in transcript and methyl benzoate emission, while constant light in an overall increase (Underwood et al., 2005). This pattern of PhBSMT expression and methyl benzoate emission suggests that PhBSMT transcription and subsequent methyl benzoate emission are primarily light-dependent and not dependent on circadian-related factors. AmBAMT transcript levels also rhythmically oscillate, with highest levels observed in the afternoon, and lowest levels observed during the early morning (Kolosova et al., 2001). This pattern of expression coincided with volatile emission in snapdragon; however BAMT activity did not fluctuate, indicating possible substrate regulation in the

PAGE 25

13 rhythmic emission of methyl benzoate. Analysis of benzoic acid levels in the flower revealed a rhythmic oscillation which contributed to the observed pattern of methyl benzoate emission (Kolosova et al., 2001). Ethylene-Dependent Regulation of Floral Volatile Emission Exposure to the gaseous hormone ethylene results in decreased floral volatile emission in MD. Ethylene regulations of a wide range of physiological processes including fruit ripening, flower senescence, and responses to wounding (Abeles et al. 1992). Ethylene Biosynthesis and Signaling Pathways Ethylene is synthesized from S-adenosyl-L-methionine in a two step reaction (Bleeker and Kende, 2000). The first step is the synthesis of 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase, and represents the rate limiting step in ethylene biosynthesis. In the second step, ACC is then oxidized to ethylene which is catalyzed by ACC oxidase. Once ethylene is synthesized it is emitted from the cell and sensed through the ethylene signaling pathway (Guo and Ecker, 2004). In this pathway, a dimerized membrane-bound receptor (ETR) containing a histidine kinase domain interacts with CTR1 (a Raf1-like kinase) to down-regulate a downstream regulator EIN2 possibly via a MAPK cascade. Upon binding of ethylene, the interaction between ETR and CTR1 is disrupted, leading to the deregulation of EIN2 which has been shown to positively regulate ethylene responses. EIN3 and the related EILS encode nuclear localized transcription factors and also are then up-regulated and thought to bind to ethylene response factor domains (ERF domains) and regulate the expression of other ethylene response genes.

PAGE 26

14 Pollination-Induced Ethylene Production Ethylene synthesis is stimulated by many environmental cues including pollination and wounding (Bleeker and Kende, 2000). In petunia, pollination leads to an initial burst in ethylene synthesis at 2-4hr after pollination which is synthesized in the stigma (Tang and Woodson, 1996). This burst in stigmatic ethylene synthesis was also seen following the pollination of Petunia inflate flowers, and was shown to be associated with pollen tube growth through the use of the ethylene inhibitor 2,5-norbornadiene (NBD) (Holden et al., 2003). A second burst in ethylene synthesis is then observed in the stigma and ovary starting at 12h after pollination, with maximum emission observed 24 h after pollination coinciding with fertilization (Jones et al., 2003). This is followed by autocatalytic ethylene production in the corolla 24 to 36 h after pollination. This second burst of ethylene synthesis is thought to induce corolla senescence in petunia since the treatment of the stigma with the ethylene inhibitor NBD prevented the synthesis of the first burst of ethylene, but did not prevent flower senescence (Hoekstra and Weges, 1986). Wound-Induced Ethylene Production Ethylene has also been shown to play a role in the plant defense response to wounding (Leon et al., 2001; Wang et al., 2002). Following wounding, ACC synthase and ACC oxidase (which encode the two enzymes critical to ethylene biosynthesis) transcript levels rapidly increase in soybean (Glycine max) and Cucumis melo (melon) (Liu et al., 1993; Bouquin et al., 1997). Following wounding, ethylene is rapidly synthesized in many plant species including Pisum sativum, L. esculentum, and P. hybrida (Saltviet et al., 1979; Boller and Kende, 1980; Kende and Boller, 1981; Gomes, 1996; Boatright, 2000).

PAGE 27

15 44568 Transgenic Petunia with Reduced Ethylene Sensitivity Many mutants in the ethylene signaling pathway have been isolated and characterized in Arabidopsis. The etr1-1 Arabidopsis mutant has a missense mutation in the ethylene-binding domain of the receptor making it unable to bind ethylene (Schaller and Bleecker 1995). Heterologous expression of this dominant mutant allele in the MD genetic background has been utilized to produce transgenic lines with highly reduced ethylene sensitivity (Wilkinson et al. 1997). One transgenic line with greatly reduced ethylene sensitivity (44568CaMV35S:etr1-1) has now become a powerful tool for studying the effects of ethylene in many physiological processes including corolla senescence (Langston et al., 2005), root formation (Clark et al., 1999), horticultural performance (Gubrium et al., 2000), seed production (Clevenger et al., 2004), and floral volatile emission (Negre et al., 2003; Underwood et al., 2005). As a result, MD in conjunction with 44568 has become an excellent model system for studying the effects of ethylene on the synthesis of floral volatiles. Ethylene and Floral Volatile Biosynthesis Ethylenes involvement in the regulation of floral volatile biosynthesis was first demonstrated in MD (Negre et al., 2003; Underwood et al., 2005). Following treatment of MD and 44568 (etr1-1) excised flowers with exogenous ethylene, emission of several volatile benzenoid/phenylpropanoid compounds decreased in MD compared to 44568 (Underwood et al., 2005). Similarly, following pollination, endogenous ethylene produced within the flower resulted in decreased MD volatile emission by 36 h after pollination when compared to non-pollinated and 44568 pollinated controls (Underwood et al., 2005). Physiologically, this observation is significant since floral volatiles are widely thought to attract pollinators to the flower. Approximately 24 h after pollination,

PAGE 28

16 fertilization of the egg coincides with a second period of ethylene synthesis emitted from the stigma and ovary resulting in autocatalytic ethylene production in the flower by 36 h after pollination. This burst of ethylene emission in the corolla coincides with a decrease in floral volatile biosynthesis and ultimately results in petal senescence. To determine the effects of ethylene on floral volatile biosynthesis at the level of transcription, PhBSMT1 and 2 transcript levels were quantified in the flower following exogenous ethylene treatment (Negre et al., 2003; Underwood et al., 2005). Following treatment, PhBSMT1 and 2 transcript levels decreased in all organs of the flower when compared to 44568. Similarly, following pollination, endogenous ethylene resulted in a sequential decrease in PhBSMT transcript. Within 2 to 4 h after pollination, ethylene synthesized in the stigma in response to pollen tube growth resulted in a decrease in PhBSMT transcript levels in the stigma. By 12 to 24 h after pollination, ethylene synthesized in the ovary coinciding with fertilization correlated with a decrease in PhBSMT transcript in the ovary. By 24to 36 h after pollination, autocatalytic ethylene production in the corolla resulted in decreased PhBSMT transcript levels in the petal tube and petal limb tissue. Therefore following pollination, ethylene is sequentially synthesized and perceived throughout the flower, resulting in decreased PhBSMT transcript accumulation and floral volatile emission. This reduces production of floral volatiles once the function of the corolla in pollinator attraction is complete. Genetic Engineering of Floral Volatile Emission Recent advances in genetic engineering have provided the tools necessary to isolate and express genes critical to floral volatile synthesis in order to alter or restore floral volatile emission. Linalool synthase was first isolated and characterized in C. breweri and shown to catalyze the synthesis of the monoterpene alcohol, linalool (Pichersky et al.,

PAGE 29

17 1994; Pichersky et al. 1995). When expressed in Petunia x hybrida it became the first floral volatile synthesis gene to be used for genetic engineering (Lucker et al., 2001). This initial attempt resulted in two lines expressing the transgene and showing linalool synthase activity. However, when these plants were analyzed no linalool was detected. This was shown to be a result of conjugation, where excess linalool was converted into a conjugated form (non-volatile S-linalyl-beta-D-glucopyranoside) preventing the desired increase of linalool. A similar phenomenon was also observed when linalool synthase was overexpressed in Arabidopsis leaves (Aharoni et al., 2003). The same gene was then expressed in carnation (Dianthus caryophyllus), where linalool and its derivatives were detected using headspace GC-MS (Lavy et al., 2002). Human scent panels were used to test whether this increase in linalool could be perceived by humans; however it could not be detected. In another example, FaSAAT, an alcohol acyltransferase isolated from strawberry (Fragaria x ananassa), was overexpressed in Petunia x hybrida (Beekwilder et al., 2004). An increase in both FaSAAT expression and protein activity were measured in these transgenic lines; however, a subsequent increase in ester emission, including benzyl benzoate, was not detected. This lack of ester formation was attributed to substrate limitation of the alcohol precursors. Recently, PhBSMT1 and 2 were isolated and characterized in MD and shown to catalyze the methylation of benzoic acid to methyl benzoate, the most abundant component of MD floral volatile emission (Negre et al., 2003; Underwood et al., 2005). To determine the function of PhBSMT in vivo, a PhBSMT RNAi construct was made and transformed into MD. These lines demonstrated decreased methyl benzoate emission

PAGE 30

18 (90%), and PhBSMT expression in whole flower tissue as compared to wild-type. Results from a human scent panel showed that 80% of the panelists were able to tell the difference between the volatile emission of MD and PhBSMT RNAi flowers, providing evidence for the first genetically engineered plant with altered floral volatile emission that could be perceived by humans (Underwood et al., 2005). In Petunia x hybrida, the rose gene RhAAT was overexpressed resulting in an increase in the acylated compounds phenylethyl acetate and benzyl acetate (Guterman et al., 2006). Feeding of exogenous geraniol (the preferred substrate in rose) resulted in the production of geranyl acetate. A similar method was used to overcome substrate limitation in FaSAAT overexpression flowers where the addition of exogenous isoamyl alcohol resulted in increased levels of isoamyl acetate emission via GC-MS. These results highlight the importance of substrate availability when engineering floral volatile emission. The identification of the ODORANT1 transcription factor represents the first of a potentially larger set of transcription factors that globally regulate floral volatile emission. ODO1 was shown to regulate the expression of genes of the shikimate pathway (DAHP synthase, EPSP synthase) and phenylalanine ammonia lyase (PAL) (Verdonk et al., 2005). These genes encode enzymes critical to the production of upstream precursors used in the synthesis of all the benzenoid/phenylpropanoid compounds identified in petunia floral volatile emission. The production of RNAi ODORANT1 transgenic lines resulted in a global decrease in floral volatile production in petunia. Since substrate has been a limiting factor in genetic engineering floral volatiles,

PAGE 31

19 transcription factors similar to ODO1 could represent ideal targets for future genetic engineering by increased upstream substrates. The above experiments demonstrate the difficulties encountered when trying to engineer increased levels of floral volatiles in vivo. While a knockout approach resulted in a perceivable change in emission (Underwood et al., 2005), problems with conjugation of the product or substrate limitation have made the overexpression of floral volatiles a greater challenge. Research Objectives The purpose of this research was to gain a further understanding into the regulation of floral volatile biosynthesis in MD. To achieve this goal, a subset of genes previously shown by microarray analysis to be highly expressed in the flower and down-regulated following exogenous ethylene treatment and were selected. Utilizing RNAi-induced gene silencing, the function of these candidate genes was then analyzed to identify genes critical to floral volatile biosynthesis. Two genes, benzoyl-CoA: benzyl alcohol/ phenyl ethanol benzoyltransferase (PhBPBT) and acetyl-CoA: coniferyl alcohol acetyltransferase (PhCFAT) were identified and utilized to study the effects of spatial, temporal, developmental, and ethylene-dependent regulation on transcript levels. The effect of environmental stimuli and physiological significance of floral volatiles in pollinator, fungal, and human interactions was also examined.

PAGE 32

20 Para-coumarateAADCChorismateShikimicAcid PathwayGlycolysis& Pentose Phosphate PathwayCMPrephenate Tryptophan PAArogenateADPhenylalanine Tyrosine 2PRPhenylethyl alcoholPhenylethyl aminePhenylacetaldehyde PALTrans-cinnamicacid Para-cinnamic acid Coniferyl alcoholFerulicacidConiferyl aldehydeCaffeicacid IsoeugenolBSMTBPBT Benzoic acidMethyl benzoateMethyl salicylateSalicylic Acid Benzyl benzoateBenzyl alcoholBenzaldehydeBenzyl acetateBEAT Phenylethyl acetatePhenylethyl benzoate Coniferyl acetate PhCFATPhIGS1 BPBT Figure 1-1. A generalized schematic of biochemical pathways in petunia floral volatile biosynthesis. Enzymes are presented in italics. (CM chorismate mutase, PA prephenate aminotransferase, AD arogenate dehydratase, AADC aromatic amino acid decarboxylase, 2PR 2-phenylacetaldehyde reductase, PAL phenylalanine ammonia lyase, CFAT acetyl-CoA: coniferyl alcohol acetyltransferase, IGS1 isoeugenol synthase 1, BPBT benzoyl-CoA: benzyl alcohol/ pheylethanol benzoyltransferase, BSMT S-adenosyl methionine: benzoic acid/ salicylic acid carboxymethyl transferase, BEAT acetyl-CoA: benzyl alcohol acetyltransferase)

PAGE 33

CHAPTER 2 ETHYLENE-DEPENDENT REGULATION OF PHBPBT TRANSCRIPT AND BENZYL BENZOATE BIOSYNTHESIS IN PETUNIA X HYBRIDA Introduction Ethylene is a gaseous plant hormone necessary for coordinating a wide range of physiological processes throughout the plant (Abeles et al. 1992; Bleecker and Kende, 2000). Following pollination in Petunia x hybrida cv Mitchell Diploid (MD), ethylene is first synthesized from the stigma/style 2 to 4 h after pollination coinciding with pollen tube growth (Tang and Woodsen, 1996; Wilkinson et al., 1997; Jones et al., 2003; Holden et al., 2003). A second period of ethylene synthesis coinciding with a successful fertilization occurs in the stigma/style and ovary 24 h after pollination, followed by ethylene synthesis in the corolla (petal tube and petal limb) from 24 to 36 h after pollination (Tang and Woodsen, 1996; Jones et al., 2003). This second ethylene signal coincides with the floral transition from pollinator attraction to fruit development and ultimately results in corolla senescence and rapid ovary expansion 60 h following a successful pollination (Hoekstra and Weges 1986). Ethylene is also known to play a critical role in plant defense responses to chewing-insects, necrotic pathogens, and wounding (Leon et al., 2001; Wang et al., 2002). In response to wounding, rapid ethylene synthesis occurs in various tissues of many plant species including Pisum sativum L. cv Alaska (Saltviet et al., 1979), Lycopersicon esculentum (Boller and Kende, 1980; Kende and Boller, 1981), Cucumis melo L. (Hoffman and Yang, 1981), Persea americana (Buse and Laties, 1993), Cucurbita 21

PAGE 34

22 maxima (Kato et al., 2000), and Petunia x hybrida (Gomes, 1996; Boatright, 2000). In conjunction with other wound-induced signals (eg. jasmonic acid), endogenous ethylene has been shown to act synergistically or antagonistically to regulate wound-defense response genes (PDF1.2, JR1, JR2, VSP) depending on the plant species studied (ODonnell et al., 1996; Rojo et al., 1999). The etr1-1 Arabidopsis mutant has a missense mutation in the ethylene-binding domain of the receptor making it unable to bind ethylene (Schaller and Bleecker 1995). Heterologous expression of this dominant mutant allele in the inbred MD genetic background resulted in transgenic lines with a strongly reduced ethylene sensitivity (Wilkinson et al. 1997). One such transgenic line (44568CaMV35S:etr1-1) is a powerful tool for studying the effects of ethylene in many physiological processes including corolla senescence (Langston et al., 2005), root formation (Clark et al., 1999), horticultural performance (Gubrium et al., 2000), seed production (Clevenger et al., 2004), and floral volatile emission (Negre et al., 2003; Underwood et al., 2005). As a result, MD, in conjunction with 44568, is an excellent model system for studying the effects of ethylene on the synthesis of floral volatiles. Benzyl benzoate is a volatile produced by many plant species including MD (Verdonk et al., 2003; Boatright et al., 2004; Underwood et al. 2005). Past work has shown benzyl benzoate to be a potentially physiologically active compound with a role both in pollinator attraction and plant defense. For example, benzyl benzoate has been shown in vitro to excite receptor cells 30-34 of Manduca sexta antennae (Shields and Hildebrand, 2001), and to induce partial proboscis extension in male Vanessa indica butterflies (Omura and Honda, 2005). Additionally it is an effective treatment against

PAGE 35

23 common mites such as Tyrophagus putrescentiae (Schrank) and Sheep Mange (Dimri and Sharma, 2004; Harju et al., 2004), and is the active ingredient in the commercial product, Acarosan (Bissell Homecare Inc., Grand Rapids, MI), a treatment for dust mites. Benzoyl-CoA: benzyl alcohol/phenylethanol benzoyltransferase (PhBPBT), is a single-copy gene with 70% identity to benzoyl-CoA: benzyl alcohol benzoyltransferase (BEBT) first characterized in Clarkia breweri (DAuria et al., 2002), and shown to catalyze the synthesis of benzyl benzoate from benzyl alcohol and benzoyl CoA (DAuria et al., 2002). In petunia, PhBPBT has highest affinity for benzoyl-CoA and benzyl alcohol, but also has an affinity for phenylethyl alcohol which can be converted to phenylethyl benzoate (Boatright et al., 2004). PhBPBT is 90% identical to a hypersensitivity-related factor (Hsr201) from Nicotiana tabacum (Czernic et al., 1996), shown to be rapidly induced following leaf exposure to Pseudomonas solanacearum. To date research involving PhBPBT has focused predominately on its role in biochemistry and floral volatile biosynthesis in petunia, but a role in vegetative tissue is not without precedent. Following mechanical wounding of leaf tissue, transcripts levels of CbBEBT accumulate rapidly 4-6 h after wounding (D Auria et al., 2002). However, the physiological significance and effect of wounding on internal benzyl benzoate pools have not been studied. The main goal of this study was to determine the effects of ethylene on PhBPBT transcript levels and subsequent benzyl benzoate biosynthesis in the corolla following pollination, and in the leaves following mechanical wounding. Through the use of MD and 44568 (etr1-1) petunias, we show that endogenous ethylene differentially regulates

PAGE 36

24 PhBPBT transcript levels and benzyl benzoate biosynthesis in corolla, ovary, and leaf tissue of MD. Results PhBPBT Transcript Levels Following Treatment with Exogenous Ethylene Benzyl benzoate is down-regulated in petunia corollas following exposure to exogenous or pollination-induced ethylene (Underwood et al., 2005). To determine if ethylene regulates PhBPBT in separate floral organs, MD and 44568 petunia flowers were treated with exogenous ethylene, and analyzed for differences in PhBPBT transcript levels (Figure 2-1). In MD ovary tissue, exposure to exogenous ethylene resulted in a marginal decrease in transcript at 2 h after treatment compared to 44568 (Figure 2-1A). At 10 h after ethylene treatment, PhBPBT transcript levels in MD tissue increased, peaking at 24 h (where levels were twice that of 44568), then remained elevated throughout the course of the experiment. In the corolla tissue, exogenous ethylene decreased PhBPBT transcript levels in MD compared to 44568 (Figure 2-1B, C). In MD petal tube tissue, a marginal decrease in PhBPBT was observed by 2 h after ethylene treatment, and was immeasurable at 24 h after ethylene treatment compared to 44568, which showed rhythmic expression (Figure 2-1B). In MD petal limb tissue, a decrease in PhBPBT transcript was observed by 2 h after treatment. PhBPBT transcript levels were immeasurable at all points after 10 h while transcript levels in 44568 petal limb tissue showed rhythmic expression throughout the experiment (Figure 2-1C). Post-Pollination PhBPBT Expression In ovary tissue, PhBPBT transcript levels were equivalent through 24 h after pollination in all treatments (Figure 2-2A). At 36 h after pollination, both 44568 and MD

PAGE 37

25 pollinated ovary tissue contained slightly elevated PhBPBT transcript levels compared to their respective non-pollinated controls. By 48 to 60 h, transcript levels in MD pollinated ovary tissue were three-fold higher than pollinated 44568 ovary tissue, and ten-fold higher than levels observed in both non-pollinated controls (Figure 2-2A). In the petal tube, PhBPBT levels were equivalent among all treatments through 12 h after pollination (Figure 2-2B). At 24 h after pollination, PhBPBT levels in both MD treatments were lower than both 44568 treatments, with MD pollinated transcript levels slightly higher than MD non-pollinated transcript levels. By 48 h after pollination, PhBPBT transcript levels were substantially lower in MD pollinated petal tube tissue compared to the other three treatments. Day/night rhythmic fluctuations in PhBPBT transcript levels were observed in all treatments examined, with highest levels observed at Zeitgeber time (ZT) 3 (0, 24, and 48 h after pollination). Prior to pollination (ZT 3), PhBPBT transcript abundance in the petal limb tissue was >75-fold higher then levels measured in ovary and petal tube tissue (Figure 2-2). After pollination, transcript levels remained equivalent among all treatments through 36 h after pollination (Figure 2-2). At 48 h after pollination, a two-fold decrease in PhBPBT was observed in MD pollinated petal limb tissue compared to the 44568 and both non-pollinated controls. However, PhBPBT transcript levels were still ten-fold higher than transcript levels quantified in MD pollinated ovary and 44568 pollinated and non-pollinated petal tube tissue. This coincides with the previous observation of decreased benzyl benzoate emission 36 to 48 h after pollination (Underwood et al., 2005). Similarly, internal volatile analysis of whole corolla tissue revealed decreased benzyl

PAGE 38

26 benzoate levels in MD corolla tissue at 60 h after pollination compared to all other treatments (Figure 2-2D). To determine if increased PhBPBT transcript levels in ovary tissue continued beyond the range of our original time course (60 h), a second experiment was conducted to measure daily (ZT 7.5) transcript levels in the ovary during a 5 day period after pollination. Results from this experiment showed that the effects of ethylene on PhBPBT transcript levels were transient, with peak transcript levels measured 2-3 days after pollination in MD ovaries (still >15-fold lower than transcript levels in MD pollinated tissue 48 h after pollination) compared to 44568 and non-pollinated controls (Figure 2-2E). By 4 to 5 days after pollination PhBPBT transcript levels in pollinated MD ovary tissue were no different from those measured in the other three treatments. To determine if this increase in PhBPBT transcript resulted in increased benzyl benzoate biosynthesis, internal volatiles were extracted from MD ovary tissue collected at 3 and 6 days after pollination. However, analysis of internal benzyl benzoate pools in these extracts (via flame ionization gas chromatography) was undetectable (data not shown). PhBPBT Transcript Levels in Petunia Leaves Treated with Ethylene. To determine the effect of ethylene on PhBPBT transcript levels in petunia leaves, excised 44568 and MD leaves were treated with air or exogenous ethylene and analyzed using real-time RT-PCR (Figure 2-3). Within 2 h of ethylene treatment, an induction of PhBPBT transcript was observed in MD leaves compared to all other treatments. By 6 h after treatment, PhBPBT levels further increased in ethylene treated MD leaves compared to 44568 leaves, with peak transcript levels comparable to peak levels observed in MD pollinated ovary tissue (2 days after pollination). Therefore, unlike in the corolla tissue, and similar to ovary tissue, ethylene resulted in increased levels of PhBPBT in the leaves.

PAGE 39

27 Ethylene-Dependent Regulation of PhBPBT Transcript Levels Following Repeated Wounding Events To determine the effect of wound-induced ethylene on PhBPBT transcript levels, petunia leaves were wounded 3 times at 6 h intervals (0, 6, and 12 h after initial wounding) to simulate herbivore attack. During each wound event, approximately 25% of the leaf adaxial epidermis was lightly damaged by scraping, beginning at the tip of the leaf and moving toward the petiole (Figure 2-4A). During the period after the first wounding event (0 to 6 h after initial wounding), little change in PhBPBT transcript levels were observed in MD or 44568 wounded leaves compared to controls (Figure 2-4B). After the second wounding event (6 to 12 h after initial wounding), PhBPBT transcript levels in 44568 wounded leaf tissue were slightly elevated compared to the other three treatments. By 12 h after wounding, PhBPBT transcript levels in both MD and 44568 wounded leaf tissues were elevated compared to unwounded controls. Following a third wounding event (12 to 24 h after initial wounding), PhBPBT transcript levels in both controls and wounded MD leaves remained static throughout, while levels in wounded 44568 leaves rapidly increased (Figure 2-4B). However, peak transcript levels in 44568 3x wound leaf tissue was still lower than transcript levels in MD pollinated petal limb tissue (48 h after pollination) (Figure 2-2C) To determine whether multiple wounding events are necessary to induce an increase in PhBPBT transcript in wounded leaf tissue, MD and 44568 leaf tissue were wounded 1x (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times, and tissue was collected at 24 h after initial wounding. In both MD and 44568 leaf tissue, a single wound (1x) resulted in no induction in PhBPBT transcript compared to unwounded controls (0.0010 .0002 (MD), 0.0009 .0002 (44568)) (Figure 2-4C). Following a second wounding event

PAGE 40

28 (2x), an increase in PhBPBT transcript was observed in both MD and 44568 leaf tissue compared to unwounded controls, with transcript levels in 44568 wounded leaf tissue substantially higher than those in MD. Following a third wounding event (3x), PhBPBT transcript levels in MD tissue remained equivalent to 2x transcript levels, while levels in 44568 wounded tissue were increased compared to 44568 2x wounded tissue. In the corolla, decreased PhBPBT transcript coincided with decreased benzyl benzoate levels following pollination. To determine if increased PhBPBT transcript levels following repeated wounding of MD and 44568 leaf tissue coincided with an increase in benzyl benzoate biosynthesis, tissues from all treatments were collected at 24 h after initial wounding. Internal volatiles were then extracted from these tissues and analyzed via GCMS, and the resulting data were reported as a fold increase in benzyl benzoate over unwounded levels (1.06 0.40 (MD), 3.42 .95 (44568)) (Figure 2-4D). Following a single wounding event (1x), a small increase in internal benzyl benzoate was observed in both MD and 44568 wounded tissue compared to their respective controls (Figure 2-4D). In MD leaf tissue wounded 2x or 3x times, internal benzyl benzoate pools were elevated compared to 1x and unwounded MD treatments. In 44568 wounded leaf tissue, no statistical increase in benzyl benzoate pools was observed following 2x wounding events; however, following a third wounding event, a substantial increase in benzyl benzoate was observed over 44568 leaf tissue wounded 1x and 2x (Figure 2-4D). While a >50-fold increase in PhBPBT transcript was observed in 44568 3x wounded tissue compared MD 3x wounded leaf tissue (Figure 2-4C), there was little difference in internal benzyl benzoate levels quantified in MD or 44568 wounded leaf tissue (Figure 2-4D).

PAGE 41

29 To determine if elevated PhBPBT transcript and subsequent benzyl benzoate levels are transient through 48 h after initial wounding, 1x, 2x, 3x wounded, and unwounded MD and 44568 leaf tissue were collected at 48 h after initial wounding, and analyzed to determine a fold increase in PhBPBT transcript and internal benzyl benzoate pools compared to unwounded controls (0.0007 .0001 (PhBPBT transcript level in MD), 0.0010 .0001 (PhBPBT transcript level in 44568), 3.63 .36 (internal benzyl benzoate level in MD), 3.81 .25 (internal benzyl benzoate level in 44568)) (Figure 2-4C and D). In all treatments, PhBPBT transcript and benzyl benzoate levels were substantially reduced by 48 h after initial wounding compared to levels quantified at 24 h after initial wounding. These results indicate that PhBPBT transcript and benzyl benzoate levels are transiently elevated in response to mechanical wounding. Discussion Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate Biosynthesis in Petunia Floral Tissue In MD, pollination-induced ethylene is synthesized from the stigma/style, ovary, and corolla in a sequential manner (Hoekstra and Weges, 1986; Tang and Woodsen, 1996; Jones et al., 2003). These ethylene signals have been demonstrated to lead to the sequential down-regulation of floral VOC synthesis genes S-adenosyl methonine: benzoic acid/ salicylic acid carboxy-methyltransferase 1 and 2 (PhBSMT1 and 2), which primarily catalyzes the methylation of benzoic acid to the floral volatile methyl benzoate (Underwood et al., 2005; Schuurink et al, 2006). Following a successful pollination, a decrease in PhBSMT1 and 2 transcript levels were observed first in the stigma/style 2-4 h after pollination, then in the ovary at 24 h after pollination, and last in the corolla at 36 h after pollination as compared to 44568 pollinated floral tissue (Underwood et al., 2005).

PAGE 42

30 Utilizing RNAi-induced gene silencing in connection with in vitro enzyme activity studies, it has been shown that PhBPBT encodes an enzyme which primarily catalyzes the conversion of benzyl alcohol to benzyl benzoate, a volatile constituent of petunia volatile emission (Appendix A; Boatright et al., 2004). Following exposure to exogenous or pollination-induced ethylene, benzyl benzoate emission is greatly reduced as compared to levels emitted in 44568 transgenic petunia (Underwood et al., 2005). To determine if ethylene also regulated PhBPBT expression in the flower, MD and 44568 whole flowers were pollinated and analyzed to determine the ethylene-dependent regulation of PhBPBT transcript following pollination. Unlike PhBSMT1 and 2, PhBPBT transcript levels in the flower do not sequentially decrease due to ethylene synthesized following pollination (Figure 2-2). Instead, transcript levels in 44568 and MD pollinated and non pollinated ovary and corolla tissue remained equivalent, unaffected by the initial period (< 24 h after pollination) of rapid ethylene synthesis. Prior to fertilization (<24 h after pollination), the primary function of the flower is to attract a pollinator in order to achieve a successful pollination and ensure seed set. The corolla is integral to this role, both as a visual cue and as a platform for volatile emission. In vitro, benzyl benzoate has been proposed to be physiologically active both as a pollinator attractant and as a miticide (Shields and Hildebrand, 2001; Dimri and Sharma, 2004; Harju et al., 2004; Omura and Honda, 2005). However, to date the in vivo function of this compound remains unclear. PhBPBT transcript produced during this period were >100-fold higher then peak levels observed in any other tissue (petal limb, ovary, wounded leaves) (Figure 2-2C). This suggests that the primary function of PhBPBT and subsequent benzyl benzoate is in the petal limb (Figure 2-2),

PAGE 43

31 and could function either to attract a pollinator or protect the corolla from pathogen attack until its function in facilitating sexual reproduction is complete. Following fertilization the function of the flower shifts to ovary and fruit differentiation and development making the corolla tissue dispensable. Ethylene produced from the ovary and corolla early in this period signals that the function of the corolla is complete, resulting in decreased synthesis of many volatiles and ultimately in corolla senescence (around 60 h after pollination) (Figure 2-2D; Underwood et al., 2005). Similar to PhBSMT1 and 2, PhBPBT transcript and subsequent benzyl benzoate levels decrease during this period (24 to 60 h after pollination) compared to both 44568 pollinated and non-pollinated controls (Figure 2-2). This result suggests that the function of PhBPBT and subsequent benzyl benzoate in pollinator attraction or corolla defense is complete. While a decrease in PhBPBT transcript is consistent with previous results from PhBSMT1 and 2, the observation of increased PhBPBT transcript in the ovary following pollination-induced ethylene (still far below levels observed in the petal limb) was unexpected (Figure 2-2A, E). However, increased transcript levels in ovary tissue following exogenous ethylene treatment and pollination confirm that in ovary tissue, ethylene results in an up-regulation in PhBPBT transcript levels (Figure 2-1A). Therefore, in response to pollination-induced ethylene, PhBPBT transcript levels are simultaneously up and down-regulated in two adjacent tissues (corolla and ovary) within the flower. The differential regulation of a single copy gene (PhBPBT) in two nearby tissues in response to the same stimuli, highlights the importance of tissue specific transcription factors in the regulation of gene expression.

PAGE 44

32 While an ethylene-dependent increase in PhBPBT transcript levels in MD ovary tissue following fertilization was observed, levels remained substantially lower than in petal limb tissue. Additionally, increased PhBPBT transcript levels did not coincide with a measurable increase in benzyl benzoate within the ovary. This suggests that the physiological function PhBPBT and subsequent benzyl benzoate is primarily restricted to the petal limb. Ethylene-Dependent Regulation of PhBPBT Transcript and Benzyl Benzoate Biosynthesis in Petunia Vegetative Tissue After Wounding In C. breweri, it has been shown that transcript levels of CbBEBT, a homolog of PhBPBT, are rapidly up-regulated 4 to 6 h after mechanical wounding; however the effect and physiological significance of this observation was not addressed (DAuria et al., 2002). While previous workers in the field had not reported the accumulation of PhBPBT transcript in MD leaves (Boatright et al., 2004), preliminary experiments indicated that PhBPBT transcript levels were also up-regulated following mechanical wounding of leaf tissue (data not shown). Since PhBPBT transcript levels and subsequent benzyl benzoate biosynthesis had been shown to be regulated by ethylene in the flower, we were interested to determine if ethylene (shown to be synthesized in Petunia x hybrida (Gomes, 1996; Boatright, 2000) leaves following mechanical wounding) was necessary for the up-regulation of PhBPBT transcript levels. Treatment of petunia leaves with exogenous ethylene resulted in increased levels of PhBPBT transcript in MD leaves but not 44568, indicating that ethylene could up-regulate PhBPBT transcription in the leaves (Figure 2-3). Through the use of MD and 44568 transgenic petunias, the role of ethylene in the up-regulation of PhBPBT transcript following wounding was investigated. Following an

PAGE 45

33 initial wounding event, an increase in transcript levels was not evident in either MD or 44568 plants; however, following multiple wounding events (2x or 3x) an increase in PhBPBT transcript was observed (Figure 2-4). Interestingly, while exogenous ethylene treatment resulted in increased PhBPBT transcript levels in MD tissue compared to 44568, transcript levels in 44568 leaf tissue wounded 2x or 3x times were substantially (>50-fold) higher then MD (Figure 2-4). This suggests that ethylene instead plays an inhibitory role in the regulation of PhBPBT transcript levels following wounding in leaves. While a loss in the regulation of PhBPBT transcription in 44568 wounded leaves resulted in a substantial increase in transcript compared to MD, little difference in internal benzyl benzoate levels were observed in MD and 44568 wounded leaf tissues (Figure 2-4D). This suggests that in MD, transcript levels are likely sufficient to encode enough PhBPBT protein to convert all available benzyl alcohol to benzyl benzoate. Therefore in 44568 wounded leaf tissues (where a lack of ethylene sensitivity results in a substantial increase in transcript after repeated wounding), little increase in benzyl benzoate pools were observed due to substrate limitation. Combined, these results indicate that while repressing PhBPBT transcript levels, ethylene does not regulate benzyl benzoate biosynthesis in petunia leaves following wounding. While a physiological role for PhBPBT and subsequent benzyl benzoate in petunia leaf tissue (after repeated wounding) can not be ruled out, even at its highest levels, PhBPBT transcript (0.03% of total mRNA) within MD and 44568 leaf tissue are substantially lower then levels observed in the petal limb (0.75% of total mRNA) (Figure 2-4D). Similar to MD ovary tissue (where peak transcript levels were 0.01% of total

PAGE 46

34 mRNA), this suggests that the primary function of PhBPBT and subsequent benzyl benzoate is in the petal limb. Experimental Procedures Plant Material Petunia x hybrida Mitchell Diploid (MD) was utilized both as the control and as the genetic background for 35S: etr1-1 line 44568 (Wilkinson et al., 1997) transgenic petunias. For all experiments, plants were grown in a glass greenhouse without artificial lighting and temperatures ranging from 25C during the day to 16C during the night. Plants were grown in 1.2L pots with Fafard 2B potting medium (Fafard Inc., Apopka, FL), and fertilized 4 times a week with 150mg/L Scottss Excel 15-5-15 (Scotts Co., Marysville. OH) cDNA Isolation Three cDNA libraries were constructed and a minimally redundant subset of clones was utilized for microarray analysis in order to identify clones down-regulated following ethylene treatment (Underwood, 2003). One of these clones was a 1.7kb cDNA coding for a 460 amino acid protein (PhBEBT1, Accession #: AAT68601) with 100% homology to benzoyl-coenzyme A (CoA):benzyl alcohol/phenylethanol benzoyltransferase (BPBT Accession #: AAU06226.1) from MD, and subsequently named PhBPBT. PhBPBT Transcript Analysis Tissue was collected to determine PhBPBT transcript levels for the following experiments: exogenous ethylene treatment (whole flowers and leaves), post-pollination, and mechanical wounding (scrapping). For PhBPBT expression analysis after exogenous ethylene treatment, MD and 44568 (etr1-1) (Wilkinson et al. 1997) whole flowers were treated with ethylene and collected as described (Underwood et al. 2005). For post

PAGE 47

35 pollination expression analysis, MD and 44568 flower tissue was treated and collected as described (Chapter 3). For PhBPBT transcript analysis in petunia leaves treated with exogenous ethylene, MD and 44568 leaves were collected at ZT 3, placed in 1% water agar blocks and treated with ethylene or air as previously described (Underwood et al., 2005). Ethylene and air treated tissue were then collected at 0, 2, 4, 6, and 24 h after treatment. For leaf wounding experiments, MD and 44568 leaves were wounded by scrapping 25% of the adaxial epidermis with a razor beginning at ZT 3. For the initial leaf scrapping experiments, 25% of the leaves were wounded at 0, 6, and 12 h after initial wounding working from the leaf tip towards the petiole. Wounded and unwounded MD and 44568 leaf tissue were then collected at 2 h intervals for 16 h with one additional collection made at 24 h. For subsequent leaf wounding experiments, MD and 44568 leaf tissue was wounded 0, 1x (initial wound at 0 h), 2x (0 and 6 h after initial wounding), or 3x (0, 6, and 12 h after initial wounding) times. Tissue was then collected from unwounded and wounded (1x, 2x, and 3x) MD and 44568 leaves at 24 and 48 h after initial wounding. In all cases two sets of 3 flowers/leaves (three sets for 24 h 3x MD and 44568 wound tissue) were collected for each experiment and total RNA was extracted, quantified, and diluted as previously described (Underwood et al., 2005) resulting in two independent sets of RNA diluted to 100ng/l. Real-time RT-PCR reactions were then setup using Taqman One-Step RT-PCR reagents (Applied Biosystems; Foster City, CA), the following primers and probe (PhBPBT Reverse Primer: 5-GAAATAAGAAAGGTGAGAATGGGATT-3; PhBPBT Forward Primer: 5-AGCTCCTTGACGAATTTTTCCA-3; PhBPBT Probe: 5

PAGE 48

36 /56FAM/TGGTCCCTATATGTTTGCCTGGCTTTGC/3BHQ_1/-3), a dilution series of in vitro-transcribed PhBPBT standards, and 100ng of total RNA as previously described (Underwood et al., 2005). Each reaction was repeated two times with one set of total RNA and once more with the second set of RNA, and quantified as previously described (Underwood et al., 2005). All data with the exception of 24 and 48 h wounded tissue was then reported as a percent of total mRNA standard error. For 24 and 48 h wounded tissue, results were reported as a fold-increase in PhBPBT transcript levels as compared to respective unwounded controls standard error. Internal Benzyl Benzoate Analysis To determine internal benzyl benzoate pools in the corolla following pollination, MD and 44568 flowers were pollinated or set aside as non-pollinated controls. At 36 and 60 h after pollination, four sets of three pollinated or non-pollinated flowers were collected from MD and 44568 plants. The corolla tissue was then dissected, immediately frozen in liquid nitrogen, and utilized for internal volatile analysis as previously described (Schmelz et al., 2004). The resulting extracts were then analyzed in tandem with pure benzyl benzoate standards via flame-ionization gas chromatography (Hewlett-Packard model 5890, Series II; Palo Alto, CA), and resulting data converted to a percent difference in pollinated benzyl benzoate levels as compared to respective non-pollinated controls standard error. To identify internal benzyl benzoate pools following mechanical wounding, MD and 44568 leaf tissue were wounded by scrapping 25% of the adaxial epidermis starting at the leaf tip and working toward the petiole. Tissue was wounded 0, 1x (initial wound at 0 h), 2x (0 and 6 h after initial wounding), or 3x (0, 6, and 12 h after initial wounding) times beginning at ZT 3. Two leaves were then collected from unwounded and wounded

PAGE 49

37 (1x, 2x, and 3x) MD and 44568 leaves at 24 and 48 h after initial wounding. This experiment was repeated two times (3 times for 3x 24 hr wounded MD and 44568 tissue), resulting in 4 sets of two leaves (10 sets of two leaves for 3x 24 h MD and 44568 wounded tissue). Volatiles pools were then extracted and quantified via GCMS as previously described (Schmelz et al., 2004). The resulting data was reported as ng/g fresh weight for the unwounded controls, and a fold-increase in benzyl benzoate levels over unwounded controls for 1x, 2x, and 3x wounded MD and 44568 tissue standard error.

PAGE 50

38 AC% of total mRNAHours after ethylene treatment (h) 00.0040.0080.0120.016 00.050.10.150.2 00.20.40.60.8 0 h2 h10 h24 h36 h48 h B OvaryPetal TubePetal Limb MD 44568 Figure 2-1. Mean PhBPBT transcript levels following treatment with exogenous ethylene. A) Mean PhBPBT transcript levels (n=3, SE) were measured in MD and 44568 (CaMV 35S:etr1-1) ovary tissue collected at 2, 10, 24, 36, and 48 h after ethylene treatment and analyzed via real-time RT-PCR. B) Mean PhBPBT transcript levels measured in MD and 44568 petal tube tissues. C) Mean PhBPBT transcript levels measured in MD and 44568 petal limb tissue.

PAGE 51

39 DPercent change in benzyl benzoate levels vs. non-pollinated controls 00.0050.010.0150.02 Petal Tube 00.250.50.751 Petal Limb 00.0040.0080.0120.016AC% of total mRNAHours after Pollination (h)0 h12 h24 h36 h48 h60 hBOvary 00.0020.0040.0060.008 0 day1 day2 day3 day4 day5 day MD P MD NP 44568 P 44568 NP% of total mRNADays after PollinationE Benzylbenzoate-100-50050100MD 44568 MD 44568 36 h60 hOvaryHours after Pollination (h) Figure 2-2. The effect of pollination-induced ethylene on PhBPBT transcript and internal benzyl benzoate levels. A) PhBPBT transcript levels (n=3, SE) in pollinated and non-pollinated MD and 44568 (CaMV 35S:etr1-1) ovary tissue. B) PhBPBT transcript levels (n=3, SE) in pollinated and non-pollinated MD and 44568 petal tube tissue. C) PhBPBT transcript levels (n=3, SE) in pollinated and non-pollinated MD and 44568 petal limb tissue. D) Internalized benzyl benzoate levels extracted from MD and 44568 corolla tissue at 36 and 60 h after pollination, and reported as a percent of respective non-pollinated controls (n=4, SE). E) Mean PhBPBT transcript levels (n=3, SE) in both MD and 44568 pollinated or non-pollinated ovary tissue collected daily at ZT 7.

PAGE 52

40 Hours after ethylene treatment (h) 00.0030.0060.0090.012 0 h2 h4 h6 h24 h MD Ethylene MD Air 44568 Ethylene 44568 Air% of total mRNA Figure 2-3. Mean PhBPBT transcript levels (n=3, SE) in petunia leaf tissue following exogenous ethylene treatment. Total RNA was extracted from MD and 44568 (CaMV 35S:etr1-1) leaf tissue following treatment with exogenous ethylene or air, and analyzed via real-time RT-PCR.

PAGE 53

41 MD W MD UW 44568 W 44568 UW 0 h4 h8 h12 h16 h24 h 00.010.020.030.04Hours after Initial Wounding (h)% of total mRNAA24h48h 1418112116144568 1x44568 2x44568 3x44568 1x44568 2x44568 3xMD 1xMD 2xMD 3xMD 1xMD 2xMD 3x 44568 3x24h48h44568 1x44568 2x44568 3x44568 1x44568 2xMD 1xMD 2xMD 3xMD 1xMD 2xMD 3x 1471013 1x2x3xBCHours after Initial Wounding (h)Fold-Increase in Transcript over Unwounded Control (%)DFold-Increase in Benzyl Benzoate over Unwounded Control (%)Hours after Initial Wounding (h) Figure 2-4. PhBPBT transcript and internal volatile levels in petunia leaves following repeated wounding events. A) MD petunia leaves wounded 1x, 2x, and 3x times. B) Wounded and unwounded MD and 44568 (CaMV 35s:etr1-1) leaves were collected at 2 h increments for 16 h plus an additional 24 h collection. Tissue was wounded three times (0, 6, 12 h) beginning at ZT 3 to simulate herbivore attack. Mean PhBPBT transcript levels (n=3, SE) were quantified via real-time RT-PCR. C) Fold increases in PhBPBT transcript (n=3, SE) in MD and 44568 wounded leaves as compared to respective unwounded controls. Leaves were wounded 1x (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times, and total RNA was extracted at 24 and 48 h after initial wounding. D) Fold increases in benzyl benzoate levels (n=4, SE) in MD and 44568 wounded leaves as compared to respective unwounded controls. Leaves were wounded 1x (0 h), 2x (0, 6 h), or 3x (0, 6, 12 h) times and volatiles were extracted at 24 and 48 h after initial wounding.

PAGE 54

CHAPTER 3 CHARACTERIZATION OF A PETUNIA ACETYLTRANSFERASE INVOLVED IN THE BIOSYNTHESIS OF THE FLORAL VOLATILE ISOEUGENOL Preface A modified version of this work has been accepted by The Plant Journal for publication (Dexter R.J. Qualley A., Kish C.M., Ma C., Koeduka T., Nagegowda D.A., Dudareva N., Pichersky E, Clark D.G. (2006) Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. Plant J, (accepted July 19, 2006).) PhCFAT in vitro enzyme work (Figure 3-4, Figure 3-5, and Table 3-1) was contributed by the lab of Natalia Dudareva (Purdue University, West Lafayette, IN), while internal levels of homovanillic acid and coniferyl aldehyde (Figure 3-2) were contributed by the lab of Eran Pichersky (University of Michigan, Ann Arbor, MI). Natalia Dudareva and Eran Pichersky also assisted in the critical reading of the manuscript. Introduction The scent of petunia flowers consists almost exclusively of volatile benzenoid/phenylpropanoid compounds, whose emission levels change rhythmically through a daily light/dark cycle with a maximum at midnight (Kolosova et al., 2001; Verdonk et al., 2003). Phenylpropanoid compounds, including phenylethyl alcohol, phenylacetaldehyde, and phenylethyl acetate, have recently been shown to be derived from phenylalanine (Tieman et al., 2006; Kaminaga et al., 2006). Benzenoid compounds 42

PAGE 55

43 in petunia scent such as methyl benzoate, benzyl alcohol, benzylaldehyde and benzyl benzoate are also most likely derived from phenylalanine (Boatright et al., 2004). Recently it has been shown that isoeugenol, a prominent floral scent component in petunia, is synthesized from an ester of coniferyl alcohol (Koeduka et al., 2006). Isoeugenol synthase 1 (PhIGS1), the enzyme catalyzing the formation of isoeugenol in petunia, has been demonstrated to efficiently use coniferyl acetate as a substrate in vitro (Koeduka et al., 2006). To date, direct proof of the formation of coniferyl acetate or similar coniferyl esters in petunia has not yet been presented, nor has the enzyme responsible for the formation of such an ester been identified. It is possible that the synthesis of coniferyl esters is catalyzed by a member of the BAHD acyltransferase family. This class of plant enzymes has been found to catalyze the acylation of numerous plant secondary compounds (DAuria, 2006). The BAHD enzymes transfer an acyl moiety of an acyl-CoA compound to an alcohol, thus forming an ester. We have previously reported the construction of a petal-specific EST databases for petunia (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005) and have used bioinformatics analysis, RNAi-based loss of function approach, and biochemical characterization to define the contribution of specific proteins encoded by these ESTs in floral scent biosynthesis. Thus, we were able to identify one type of EST that encodes an enzyme belonging to the BAHD family, and subsequent RNAi gene inactivation and biochemical characterization showed that this protein, named PhBPBT (benzyl alcohol/phenyl ethanol benzoyl transferase), catalyzes the formation of benzyl benzoate and phenyl benzoate (Boatright et al., 2004; Appendix A). Transcripts encoding PhBPBT as well as other petunia scent-synthesizing enzymes accumulate predominantly in the

PAGE 56

44 petal limbs, change rhythmically during a daily light/dark cycle, and decrease in response to exogenous or pollination-induced ethylene (Chapter 2). Here we report the isolation and characterization of a petunia cDNA encoding another member of the BAHD family, coniferyl alcohol acyltransferase (PhCFAT). PhCFAT transcript analysis revealed an expression pattern typical of a floral volatile biosynthesis gene. Inactivation of the PhCFAT gene via RNAi-induced gene silencing resulted in petunia flowers that neither synthesize nor emit isoeugenol. The biochemical characterization of the protein encoded by this gene revealed that it can catalyze the formation of coniferyl acetate from coniferyl alcohol and acetyl-CoA. Results Identification of a Flower-Specific Putative BAHD Acyltransferase To identify floral volatile biosynthesis genes in petunia, we searched our petunia petal EST database (http://www.tigr.org) for cDNAs encoding proteins with sequence similarity to known scent biosynthetic enzymes. In this search we identified a cDNA whose complete open reading frame encoded a protein of 454 amino acids with homology to several biochemically characterized BAHD acyltransferases that catalyze floral volatile production, including PhBPBT from petunia (26% identity), benzyl alcohol acetyl transferase (BEAT) from Clarkia breweri (23% identity), and an alcohol acyltransferase AAT1 from Rosa hybrida (22% identity). Additionally, this petunia protein (which based on the biochemical characterization described below was designated acetyl-CoA: coniferyl alcohol acetyltransferase (PhCFAT)) was 28% identical with anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (Yang et al., 1997) and hydroxycinnamoyl transferase (HCT) from Nicotiana tabacum (Hoffman et al., 2003). However, it had the highest sequence identity, 55%, with two

PAGE 57

45 uncharacterized members of the BAHD family from Arabidopsis (At5g16410 and At1g78990). To determine if this BAHD acyltransferase is critical to floral volatile biosynthesis in petunia flowers, we first examined the expression pattern of the PhCFAT gene. Real-time RT-PCR measurements (Figure 3-1) indicated that PhCFAT transcripts are present only in the limb parts of the petals, and expression was much higher during the night. This pattern of expression is similar to those of five previously characterized floral scent genes in petunia that include two benzoic acid/salicylic acid methyltransferases that catalyze the synthesis of methyl benzoate (PhBSMT1 and PhBSMT2) (Negre et al., 2003; Underwood et al., 2005), phenylacetaldehyde synthase (PhPAAS ) responsible for phenylacetaldehyde formation (Kaminaga et al., 2006), PhIGS1 ( Koeduka et al., 2006) and PhBPBT (Boatright et al., 2004). Suppression of PhCFAT Expression Leads to a Decrease in Synthesis and Emission of Isoeugenol and Several Other Volatiles To determine if PhCFAT functions in floral scent biosynthesis, RNAi-induced gene silencing was employed to decrease PhCFAT transcript levels and subsequent protein activity. Three independent transformed lines with reduced PhCFAT levels (PhCFAT RNAi lines 6, 15, and 16) were obtained and analyzed at the T2 generation for reduced transcript and altered volatile production (Figure 3-2, 3-3). PhCFAT transcript analysis of whole flower tissue collected at Zeitgeber time (ZT) 13 revealed a substantial decrease in PhCFAT transcript in all transgenic lines compared to controls (Figure 3-2). This decrease in transcript levels coincided with a substantial decrease in isoeugenol emission as measured over a 1 h period beginning at ZT 13 in all transgenic lines analyzed (Figure 3-2, 3-3). In addition to a decrease in isoeugenol emission, the emission of five other

PAGE 58

46 volatiles also decreased in the RNAi lines compared to MD (Figure 3-2, 3-3). These volatiles included phenylacetaldehyde, phenylethyl alcohol, phenylethyl acetate, phenylethyl benzoate, and benzyl acetate. Analysis of the internal concentrations of volatiles in the flowers further supported emission results, showing reduced levels of isoeugenol, phenylethyl alcohol, phenylethyl benzoate, and benzyl acetate as compared to control (MD). No consistent differences in emission and internal levels were observed for benzaldehyde, benzyl alcohol, benzyl benzoate, methyl benzoate, and methyl salicylate, while consistent results were not observed for internal pools of phenylacetaldehyde (line 15 contained wild-type levels) and phenylethyl acetate (non-detected) (Figure 3-2, 3-3). In addition, two compounds found in the petal tissues, homovanillic acid and coniferyl aldehyde, were present in levels >1000% and >500% higher respectively, in the RNAi lines as compared with the control (341 g/g FW of coniferyl aldehyde in PhCFAT RNAi lines vs. 51 g/g FW in MD, and 445 g/g FW of homovanillic acid in PhCFAT RNAi lines vs. 27 g/g FW in MD). PhCFAT Acetylates Coniferyl Alcohol and Several Other Substrates in a pH-Dependent Manner To determine the enzymatic activity of the putative petunia PhCFAT protein, the complete coding region of a PhCFAT cDNA was subcloned into the expression vector pET-28a, expressed in E. coli, and the recombinant protein was purified to 99% homogeneity using nickel-based affinity chromatography. The purified recombinant protein was evaluated for its ability to acetylate coniferyl alcohol as well as a variety of other alcohols using acetyl-CoA as a source for the acetyl moiety. Analysis of recombinant PhCFAT activity across a pH range from 3.5 to 8.5 showed the highest activity with coniferyl alcohol at pH 6.0, which was two-fold higher than at pH 7.5 (33.2

PAGE 59

47 and 17.0 nkat/mg protein, respectively). It should be noted that at neutral or basic pH coniferyl alcohol is likely deprotonated, which can be easily noticed by a change in the color of the reaction mixture before addition of the enzyme. At pH 6.0, PhCFAT displayed a narrow substrate preference, efficiently accepting only coniferyl alcohol and sinapyl alcohol (71% of activity with coniferyl alcohol). Activities with all other tested substrates did not exceed 12% of activity with coniferyl alcohol at this pH (Figure 3-4). To evaluate PhCFAT activity at a more physiological pH, assays with different alcohol substrates were also performed at pH 7.5. At this pH, PhCFAT displayed broader substrate preference. Although activity with coniferyl alcohol was still the highest, the enzyme could also use 1-octanol, cinnamyl alcohol, geraniol, and sinapyl alcohol (ranging from 54% to 26% relative to coniferyl alcohol, respectively) (Figure 3-4). The activities with other substrates such as eugenol, 2-benzyl alcohol, phenylethyl alcohol, 2-hexanol, p-coumaryl alcohol, 3-hydroxybenzyl alcohol, and isoeugenol were not higher than 3% of activity utilizing coniferyl alcohol. To evaluate the specificity of the PhCFAT for the acyl donor, we also checked the larger acyl-CoA substrates benzoyl-CoA, butyryl-CoA, malonyl-CoA, and hexanoyl-CoA in the presence of coniferyl alcohol at pH 6.0 (using an indirect test of competition with radiolabelled acetyl-CoA), and found that PhCFAT can efficiently use butyryland hexanoyl-CoA (81% and 54% of PhCFAT activity with acetyl-CoA, respectively). PhCFAT activities with two other acyl donors, malonyl-CoA and benzoyl-CoA, did not exceed 30% of that with acetyl-CoA. Kinetic characterization of the purified recombinant PhCFAT protein revealed that the apparent K m value for acetyl-CoA with coniferyl alcohol is slightly lower at pH 6.0 than at pH 7.5 (30.6 + 0.2 and 44.1 + 1.0 M [mean + S.D.; n = 3], respectively), while

PAGE 60

48 the apparent K m value for coniferyl alcohol at pH 6.0 is twice that at pH 7.5 (56.5 + 1.0 and 27.5 + 0.6 M [mean + S.D.; n = 3], respectively) (Table 3-1). Despite the higher apparent Km value for coniferyl alcohol at pH 6.0, the apparent catalytic efficiency of PhCFAT (K cat /K m ratio) is virtually the same at both pH values due to a higher turnover rate of enzyme at pH 6.0 (Table 3-1). Overall, the catalytic efficiency of the enzyme is at least >25 higher with coniferyl alcohol than with cinnamyl alcohol at pH 7.5, although, interestingly, PhCFAT can use acetyl-CoA 7 times more efficiently with cinnamyl alcohol as a co-substrate than with coniferyl alcohol. Coniferyl Alcohol is Converted to Isoeugenol by PhCFAT and PhIGS1 in an In Vitro Coupled Reaction The petunia enzyme isoeugenol synthase 1 (PhIGS1) enzyme converts coniferyl acetate to isoeugenol and cannot use coniferyl alcohol as the substrate (Koeduka et al. 2006). Since biochemical characterization of PhCFAT showed that it was able to catalyze the formation of coniferyl acetate, we set up an in vitro coupled assay that included both purified PhCFAT and PhIGS1 with coniferyl alcohol, acetyl-CoA, and NADPH. In this reaction, isoeugenol was produced (Figure 3-5A). When PhCFAT was omitted from the reaction, no isoeugenol was obtained (Figure 3-5B). PhCFAT Expression is Responsive to Ethylene, Shows a Diurnal Rhythm, and Changes During Development In addition to spatial regulation, further analysis of PhCFAT expression is indicative of a gene that catalyzes the biosynthesis of floral volatiles in petunia. Following exogenous ethylene treatment, volatile emission in petunia has been shown to decrease in MD tissue as compared to line 44568 (ert1-1), a transgenic petunia line with reduced ethylene sensitivity (Underwood et al., 2005; Wilkinson et al., 1997). Similarly following exogenous ethylene treatment, PhCFAT transcript levels in MD petal limb

PAGE 61

49 tissue decreased (10-fold) 2 h after treatment, compared to levels in line 44568 (Figure 3-6A). A similar correlation between ethylene and PhCFAT transcript levels was also observed following a successful pollination. At 24 h after pollination a period of rapid ethylene biosynthesis was observed first in the stigma/style and ovary, and later in the corolla, coinciding with a successful pollination resulting in decreased volatile emission and ultimately petal senescence (Tang and Woodsen, 1996; Wilkinson et al., 1997; Jones et al., 2003; Underwood et al., 2005). Prior to fertilization (<24 h after pollination), PhCFAT transcript levels in all tissues were similar, however by 36 h after pollination, endogenous ethylene resulted in decreased transcript levels in MD pollinated petal limb tissue when compared to both non-pollinated control and line 44568 (Figure 3-6B). By 60 h after pollination, MD PhCFAT transcript levels were 500% lower then observed in all other treatments. Floral volatile emission has previously been shown to rhythmically oscillate throughout the day (Kolosova et al., 2001; Verdonk et al., 2003). Diurnal PhCFAT transcript analysis revealed a 10 to15-fold change in transcript accumulation between the highest transcript levels measured in the evening (ZT 13.5 to ZT 19.5) and lowest levels measured in morning (ZT 1.5 to ZT 7.5) (Figure 3-7A). Emission of isoeugenol, a downstream product dependent on PhCFAT activity, was also rhythmic with highest levels in the evening (ZT 13.5 to ZT 1.5) and lowest levels in the afternoon (ZT 7.5) (Figure 3-7B) coinciding with transcript accumulation. When the plants were subsequently moved to complete darkness, both transcript accumulation and isoeugenol emission continued to be rhythmic. However, peak accumulation and emission shifted 6 h and began to lose rhythmicity by 3 days in complete darkness indicating a role for both

PAGE 62

50 light-dependent and circadian oscillator output factors in the regulation of PhCFAT transcript (Figure 3-7). Throughout early floral development volatile emission remains low, with a burst of emission observed at anthesis (Verdonk et al., 2003). To further characterize PhCFAT transcript accumulation, RNA was analyzed from whole flowers at different developmental stages collected at ZT 13 (Fi gure 3-8). At early stages of floral development (small bud, medium bud, and tube) low levels of PhCFAT transcript were detected, however at later stages in development (anthesis and two-days past anthesis) a substantial increase in PhCFAT transcript was observed coinciding with peak volatile emission. Discussion PhCFAT is a BAHD Acyltransferase Critical to the Production of Isoeugenol The BAHD acyltransferase family represents a diverse group of enzymes which utilize CoA-thioesters to produce a diverse group of secondary metabolites critical to many physiological processes in the plant including floral volatile emission (St-Pierre and De Luca, 2000; DAuria, 2006). Members of the BAHD family contain two conserved motifs (HxxxD and DFGWG) as defining characteristics (St-Pierre and De Luca, 2000). The HxxxD motif (specifically His160) has been shown to be directly involved in catalysis at the active site of the enzyme, while the DFGWG motif has been shown to play a more structural role in stabilizing the enzyme (Ma et al., 2005). The PhCFAT sequence also contains the conserved HxxxD motif and four out of five of the conserved residues in the DFGWG motif as well significant sequence identity with BAHD family members in other parts of the protein, indicating that it also belongs to the BAHD acyltransferase family.

PAGE 63

51 RNAi-based loss-of-function analysis in conjunction with in vitro biochemical characterization provides a powerful tool for identifying the biochemical function of an unknown enzyme in planta. Here we used these two approaches to characterize the biochemical function of PhCFAT in petunia. Initial analysis of PhCFAT RNAi transgenic petunia revealed reduced biosynthesis and emission of the floral volatile isoeugenol (Figure 3-2, 3-3). The recent discovery of the novel petunia NADPH-dependent reductase (PhIGS1) capable of reducing coniferyl acetate to isoeugenol (Koeduka et al., 2006), highlighted the importance of an acyltransferase that can form such a hypothesized precursor to isoeugenol. To determine if PhCFAT could catalyze this reaction, in vitro PhCFAT activity assays were used to identify potential substrates (Figure 3-4). PhCFAT was shown to have the highest activity with coniferyl alcohol and acetyl-CoA to form coniferyl acetate (Figure 3-4). These observations in conjunction with an over 90% reduction in isoeugenol synthesis and emission in the PhCFAT RNAi lines support a role for PhCFAT in the acylation of coniferyl alcohol to coniferyl acetate. Furthermore, a coupled in vitro reaction using coniferyl alcohol, acetyl-CoA and NADPH and purified PhCFAT and ISG1 yielded isoeugenol, further showing the role of PhCFAT in isoeugenol biosynthesis. Our measurements of internal pools of volatiles and some of their precursors in wild-type plants did not identify coniferyl alcohol or coniferyl acetate. Since coniferyl alcohol and coniferyl acetate are not volatile (in fact solid at room temperature) extraction and quantification of theses compounds has proven difficult. However, in the PhCFAT RNAi petals, the internal concentration of coniferyl aldehyde was on average >500% higher than in wild type, and a second compound, homovanillic acid, also

PAGE 64

52 accumulated at levels >1000% higher than in wild type plants. While a block in the conversion of coniferyl alcohol to coniferyl acetate would be expected to cause the accumulation of coniferyl alcohol, it is possible that this compound is not efficiently extracted or cannot stably accumulate in the cell,(and instead is oxidized back to coniferyl aldehyde). Homovanillic acid is likely derived from further oxidation and decarboxylation of coniferyl aldehyde. PhCFAT Mediates the Synthesis of Other Petunia Floral Volatiles In addition to its role in acetylating coniferyl alcohol to synthesize the substrate for isoeugenol synthase, it is possible that PhCFAT could also catalyze the acetylation of other alcohols in petunia. Levels of benzyl acetate (emitted and internal) and phenylethyl acetate (emitted) are down-regulated in the PhCFAT RNAi lines (Figure 3-2, 3-3), suggesting that PhCFAT is responsible, at least in part, for synthesizing these compounds. However, even at pH7.5, the relative activity of PhCFAT with benzyl alcohol and phenylethyl alcohol is <3% that of coniferyl alcohol. PhCFAT RNAi lines also showed a general reduction in levels of phenylacetaldehyde and compounds derived from it (phenylethyl alcohol and its esters) (Figure 3-2, 3-3). While not clear, this could indicate that the PhCFAT RNAi construct is not specific and suppressed the expression of another unknown gene that is critical to phenylacetaldehyde biosynthesis. PhCFAT Transcription Patterns are Indicative of a Petunia Floral Scent Gene The biosynthesis and emission of floral volatiles is a process that depends on many factors including tissue type, time of day, floral development, and ethylene. In the case of petunia, these volatiles are synthesized and emitted primarily from the petal limb throughout the evening, during late stages of floral development, and down-regulated in response to both exogenous and post-pollination-induced ethylene (Kolosova et al., 2001;

PAGE 65

53 Verdonk et al., 2003; Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005). Recently we have reported the mode of transcript accumulation of five floral volatile biosynthesis genes, PhBSMT1, PhBSMT2, PAAS, PhIGS1, and PhBPBT in MD (Negre et al., 2003; Boatright et al., 2004; Underwood et al., 2005; Koeduka et al., 2006; Kaminaga et al., 2006). In all cases, transcripts were primarily localized to the petal limb, and rhythmically expressed with highest levels in the afternoon and lowest levels early in the morning. Their expression was also developmentally regulated. Additionally, transcription of PhBSMT and PhBPBT was shown to be decrease in response to both exogenous and pollination-induced ethylene (Negre et al., 2003; Underwood et al., 2005; Chapter 2). Here we show that PhCFAT expression is similarly restricted to the petal limb, occurs in rhythmic manner (although with a slightly different temporal optimum than that observed for PhBPBT and PhBSMT), increases during later stages in floral development, and decreases in response to ethylene (Figure 3-1, 3-6, 3-7, 3-8). These observations provide additional support for a shared general mechanism that regulates all floral volatile biosynthesis genes in MD. Identifying the components of this mechanism, in addition to the ODORANT1 gene previously described (Verdonk et al., 2005), and its mode of action, will provide critical tools for future discovery of genes, enzymes, and pathways critical to floral volatile biosynthesis. Experimental Procedures Plant Materials Petunia x hybrida Mitchell Diploid (MD) was utilized as the control for all experiments and served as the genetic background for the production of CaMV35S:etr1-1 line 44568 (Wilkinson et al., 1997) and PhCFAT RNAi transgenic petunias. Plants were

PAGE 66

54 grown in a glass greenhouse without artificial lighting and an average temperature of 20 C dependent on time of day. Plants were grown in 1.2L pots with Fafard 2B potting material (Fafard Inc., Apopka, Fl), and fertilized 4 times a week with 150mg Nitrogen /L Scotts Excel 15-5-15 (Scotts Co., Marysville, OH). cDNA Isolation A 0.9kb partial cDNA (C2H4-7RR-B05) was selected and full length cDNA obtained via 5 RACE using BD SMARTTM RACE cDNA Amplification Kit (BD Biosciences Clontech, Palo Alto, CA). The resulting 1.8kb full-length cDNA coded for a 454 amino acid unknown transferase (subsequently named acetyl-CoA:coniferyl alcohol acetyl transferase (PhCFAT) accession number DQ767969), with 55% identity to an unknown Arabidopsis thaliana transferase (NP178020). Generation of PhCFAT RNAi Transgenic Petunia To determine the in vivo function of PhCFAT, RNAi induced-gene silencing technology was utilized. Two fragments of the PhCFAT cDNA (corresponding to bases 1010-1344 and 1010-1671) were amplified using PCR and ligated end to end in a sense/antisense orientation. The resulting construct was ligated downstream of the pFMV (Richins et al., 1987) constitutive promoter and upstream of the nopaline synthase (NOS) 3 terminator sequence. The subsequent RNAi construct was sub-cloned into a binary transformation vector containing the kanamycin resistance gene, neomycin phosphotransferase (NPTII), and mated with Agrobacterium tumefaciens strain ABI. Six week old MD leaves were transformed as previously described (Jorgenson et al., 1996), and 16 primary transformants were recovered, transferred to soil, grown to maturity, and screened for an altered volatile profile via flame ionization detection gas chromatography and reduced PhCFAT transcript abundance via quantitative RT-PCR (see below). Plants

PAGE 67

55 showing reduced isoeugenol emission and PhCFAT transcript when compared to MD were self-pollinated and T1 progeny grown. T1 lines were screened for 3:1 segregation of the transgene via PCR (verifying the presence of the NPTII gene), reduced PhCFAT transcript, and reduced isoeugenol emission. Flowers from lines exhibiting 3:1 segregation were again self-pollinated and T2 seeds produced. Screening was repeated as above and two 3:1 segregating (Lines 6 and 16) and one homozygous line (Line 15) were identified and used for subsequent research reported here. PhCFAT Expression Analysis by Real-Time RT-PCR For spatial transcript analysis, stem, root, leaf, whole flower (at anthesis), petal limb, petal tube, stigma/style, ovary, and sepal MD tissue were collected at ZT 13 and ZT 1. To determine transcript levels during floral development, small bud (1 cm), medium bud (3-4 cm), tube (complete tube expansion but limb has not opened), anthesis (complete limb expansion just prior to pollen release), and post-anthesis (two days past pollen release) MD whole flowers were collected at ZT 13. For rhythmic and ethylene-regulated expression, tissue was collected as previously described (Underwood et al., 2005). For post-pollination transcript analysis, MD and line 44568 flowers were pollinated one day prior to anthesis or set aside as a non-pollinated control. Beginning at ZT 3 both pollinated and non-pollinated MD and 44568 flowers were collected, and the petal limb removed since spatial analysis revealed the petal limb as the target tissue primary containing PhCFAT transcript. This process was repeated at 12 h intervals up to 60 h after pollination. For PhCFAT RNAi transcript analysis, both MD and PhCFAT RNAi whole flowers (at anthesis) were collected at ZT 13. In all cases, tissue was collected and RNA extracted as previously described (Underwood et al., 2005). Quantitative RT-PCR utilizing Taqman One-Step RT-PCR

PAGE 68

56 reagents (Applied Biosystems, Foster City, CA), the following primers and probe (PhCFAT Forward Primer: GCAAGTGTTGGACAGCTCAAGCAA, PhCFAT Reverse Primer: TCTTGTTAGGGCTAGGCATTGGCA, and PhCFAT Probe: FAM TGATGAAGCAGCCATCGTTGTCTCCT-3BHQ1), a series of in-vitro transcribed PhCFAT standards, and 1l of 100ng/l RNA, were then used to quantify mean PhCFAT levels as previously described (Underwood et al., 2005). Volatile Emission For the rhythmic emission experiment, volatiles were collected and analyzed as previously described (Underwood et al., 2005). For the PhCFAT RNAi experiment, seven flowers were collected from five plants from each line (PhCFAT RNAi Lines 6, 15, and 16 along with MD) at ZT 13 for two nights. In all cases, volatiles were then collected for 1 h and eluted as previously described (Schmelz et al., 2001). The eluted volatiles were then quantified via Flame-Ionization Detection Gas Chromatography (Hewlett-Packard model 5890, Series II; Palo Alto, CA), and resulting data converted to (g/g fresh weight)/hour. PhCFAT RNAi sample replicates were then divided by average MD emission from the respective day to determine a percent difference for each sample. Mean percent difference from MD (SE) were then calculated for each transgenic line. Internal Volatile Extraction To determine PhCFAT RNAi internal volatile levels, three flowers were collected from five plants from each line (PhCFAT RNAi Lines 6, 15, and 16 along with MD) at ZT 13. In each case, the corolla (petal limb and tube) were removed, immediately frozen, and ground using mortar and pestle. Internalized volatiles were then extracted from the petunia tissue, supplemented with nonyl acetate (internal standard), as previously described (Schmelz et al., 2004) with two deviations (no HCL added to sample, and

PAGE 69

57 170C instead of 200C during vapor phase extraction). The eluted samples were then analyzed via Flame-Ionization Gas Chromatography, and resulting data converted to (g/ g fresh weight). For coniferyl aldehyde and homovanillic acid, tissue was ground and extracted with dichloromethane overnight, and the extract analyzed on GC-MS and compared with authentic standards. PhCFAT RNAi sample replicates were then divided by average MD emission from the respective day to determine a percent difference for each sample. Mean percent difference from MD (SE) were then calculated for each transgenic line. Expression of PhCFAT in Escherichia coli and Purification of Recombinant Protein The coding region of petunia PhCFAT was amplified by PCR using the forward and reverse primers, 5'-CACATATGGGAAACACAGACTTTCATG-3' and 5'-CATGGATCCTCAATAAGTAGCAGTAAGGTCC-3', respectively, and subcloned into the NdeI-BamHI site of the expression vector pET-28a containing an N-terminal hexa-histidine tag (Novagen, Madison, WI). Sequencing revealed no errors introduced during PCR amplifications. Expression was performed in E. coli BL21 Rosetta cells grown in LB medium with 50 g/ml kanamycin and 37 g/ml chloramphenicol at 18C. Induction, harvesting, and protein purification by affinity chromatography on nickel-nitriloacetic acid agarose (Qiagen, Valencia, CA) were performed as described previously (Negre et al., 2002). Eluted fractions with the highest PhCFAT activity were desalted on Econo-Pac 10DG columns (Bio-Rad Laboratories; Hercules, CA) into 50mM Tris-HCl buffer (pH 7.5) with 2% glycerol and examined by SDS-PAGE gel electrophoresis followed by Coomassie Brilliant Blue staining of the gel. The purity of the isolated protein was 99% and was taken into account for calculations of K cat determination. Total

PAGE 70

58 protein concentration was determined by the Bradford method (Bradford, 1976) using the Bio-Rad (Hercules, CA) protein reagent and BSA as a standard. Enzyme Assays Enzyme activity was measured by determining how much of the 14C-labelled acetyl group of acetyl coenzyme A was transferred to the side chain of coniferyl alcohol. The standard reaction mixture (50 l) contained purified PhCFAT protein (18 g) and 140 M acetyl-CoA (containing 0.08 Ci; Amersham Biosciences UK Limited, Buckinghamshire, UK) in assay buffer (50 mM citric acid pH 6.0, 1mM DTT or 50mM Tris-HCl pH 7.5, 1 mM DTT). After incubation for 15 min at room temperature, the product was extracted with 100 l hexane and 50 l of the organic phase was counted in a liquid-scintillation counter (model LS6800; Beckman, Fullerton, CA). The raw data (cpm, counts per minute) were converted to nanokatals (nkat, nanomoles of product produced per second) based on the specific activity of the substrate and efficiency of counting. Controls included assays using boiled protein with and without alcohol substrate. For kinetic analysis an appropriate enzyme concentration was chosen so that the reaction velocity was proportional to the enzyme concentration and was linear with respect to incubation time for at least 15 min. Kinetic data were evaluated by hyperbolic regression analysis. Competition Assays. Assay conditions were similar to those described for the standard PhCFAT assay. In addition to 0.08 Ci [1-14C] acetyl-CoA, each reaction mixture contained 182 M of the competitor substrate (unlabelled). The formation of coniferyl acetate was measured by liquid scintillation counting. The cpm values obtained in competitor substrate assays

PAGE 71

59 were compared to results of control assays with only radioactive acetyl-CoA and coniferyl alcohol substrates. If assay results of competitor substrates were 85 to 100% of the counts observed in the control reaction not supplemented with unlabelled CoA esters, the compound was not considered to be a substrate for PhCFAT. Product verification was performed using TLC. For TLC analysis, the standard reaction was scaled to 1 mL using non-radiolabel acetyl-CoA (Sigma, St. Louis, MO). The reaction product was extracted in 1mL of hexane, concentrated to around 10 L, spotted onto a pre-coated silica-gel TLC plate (PE SIL G/UV; Whatman, Maidstone, Kent, England) and co-chromatographed with authentic standards using ethyl acetate-hexane (7:3, v/v) as a solvent. Coupled In Vitro Reaction The coupled reaction with PhCFAT and PhIGS1 was carried out in 100 mM MES-KOH buffer (pH 6.5) containing 0.5 mM coniferyl alcohol, 0.3 mM acetyl-CoA, 0.5 mM NADPH, and 2 g of each purified enzyme, in a total volume of 150 l. After incubation at RT for 20 min, reaction solution was extracted with 1 ml of hexane, and the hexane solution concentrated with liquid N2. A fraction (2l) was in injected into the GC-MS for analysis (Figure 3-5A). The reaction shown in Figure 3-5B was carried out and analyzed in identical fashion, except that PhCFAT was not added to the reaction mixture.

PAGE 72

60 Limbs -Stigma/ Style -Ovary -Whole Flower -0 -0.1 -0.2 -0.3 -0.4 -% of Total mRNAStem -Leaves -Root -Sepals -Tube Dissected Flower Figure 3-1. Characterization of the PhCFAT transcript accumulation in petunia. Mean PhCFAT transcript levels (+/-SE, n=3) in root, stem, leaf and flower (whole and dissected) tissue collected at ZT 1 (white) and ZT 13(gray), and analyzed via real-time RT-PCR.

PAGE 73

61 Emission -100-50050100Phenylethyl benzoate Benzyl acetate-100-50050100 Methyl benzoate-100-50050100 Methyl salicylate-100-50050100 0600120018002400Homovanillic acid Phenylethyl alcohol-100-50050100 Phenylacetaldehyde-100-50050100 Phenylethyl acetate-100-50050100 0200400600800Coniferyl aldehyde Benzaldehyde-100-50050100 Benzyl alcohol-100-50050100 Isoeugenol-100-50050100 Benzyl benzoate-100-50050100Line 6 -Line 15 -Line 16 Line 6 -Line 15 -Line 16 InternalRelative Difference in Volatile Emission/ Internal Pools (Percent of MD)MDLine 6Line 15Line 16% of Total mRNA0.03 -0.023 -0.015 -0.008 -0 PhCFAT RNAi Transgenic Petunia LinesLine 6 -Line 15 -Line 16 Line 6 Line 15 -Line 16 Emission InternalLine 6 -Line 15 -Line 16 Line 6 Line 15 -Line 16 Emission Internal Figure 3-2. Effect of RNAi suppression of PhCFAT on emitted and internal volatiles. PhCFAT RNAi (Line 6, 15 or 16) emission and internal volatiles levels relative to MD. Emission values ( SE, n=10) and internal concentration values (n=12, SE, except for homovanillic acid and coniferyl aldehyde, where n=4) were collected at ZT 13. ND = Not Detected. Mean PhCFAT transcript levels ( SE, n=3) are shown in the lower right.

PAGE 74

62 (E: 95%; I: 95%)(E: ND; I: 600%)(E: ND; I: 1200%)Para-coumaratePhenylalaninePhenylethyl alcoholPhenylacetaldehyde Trans-cinnamic acid Coniferyl alcoholFerulicacidConiferyl aldehydeCaffeicacid IsoeugenolBenzoic acidMethyl benzoateMethyl salicylateSalicylic Acid Benzyl benzoateBenzyl alcoholBenzaldehydeBenzyl acetate Phenylethyl acetatePhenylethyl benzoate Coniferyl acetate PhCFATPhIGS1 (E: 50%; I: ) (E: 75%; I: 75%) (E: 75%; I: ) (E: 50%; I: ND) (E: ; I: ) (E: ; I: ) (E: ; I: ) (E: ; I: ) (E: ; I: ) Homovanillic acid (E: 75%; I: 75%) Figure 3-3. A generalized metabolic pathway for petunia floral volatiles altered in PhCFAT RNAi transgenic petunia. Percent change ( increase, decrease, no change) in PhCFAT RNAi emitted (E:) and internal (I) volatiles as compared to MD. PhCFAT and PhIGS1 enzymes are represented in italics. ND = Not Detected.

PAGE 75

63 Figure 3-4. Relative activity of PhCFAT with selected alcohol substrates. Activity was measured at pH 6.0 and pH 7.5. In both cases activity with coniferyl alcohol was set at 100% and was 33.2 and 17.0 nkat/mg protein at pH 6.0 and 7.5, respectively. a alcohols were used at 2 mM; b molecular structure of alcohols added.

PAGE 76

64 Table 3-1. Kinetic parameters of PhCFAT

PAGE 77

65 a) PhCFAT+ PhIGS1 b) PhIGS1 A PhCFAT+ PhIGS1 PhIGS1 B a) PhCFAT+ PhIGS1 b) PhIGS1 A PhCFAT+ PhIGS1 PhIGS1 B Figure 3-5. The coupled in vitro reaction of PhCFAT and PhIGS1 leads to the production of isoeugenol from coniferyl alcohol. A) Gas chromatogram of the hexane-soluble compounds present in the reaction mixture after incubation for 20 min at RT. The reaction mixture contained coniferyl alcohol, acetyl-CoA, NADPH, and purified PhCFAT and PhIGS1. The isoeugenol peak was identified by MS (inset) and comparison of MS and retention time with authentic isoeugenol. B) Gas chromatogram of the hexane-soluble compounds present in the reaction mixture after incubation for 20 min at RT. The reaction mixture contained coniferyl alcohol, acetyl-CoA, NADPH, and purified PhIGS1, but no PhCFAT.

PAGE 78

66 0 -0.075 -0.15 -0.225 -0.3 -0 -0.075 -0.15 -0.225 -0.3 -0 h -2 h-10 h -24 h -36 h -48 h -0 h -12 h -24 h -36 h -48 h -60 h -AB% of total mRNA% of total mRNA MD P 44568 P MD NP 44568 NP MD 44568Hours after ethylene treatment (h)Hours after pollination (h) Figure 3-6. Ethylene-dependent regulation of PhCFAT transcript levels. A) Mean PhCFAT transcript levels (+/SE, n=3) in MD (black) and line 44568 (etr1-1) (white) petal limb tissue treated with exogenous ethylene, collected at 0, 2, 10, 24, 36 and 48 h after treatment, and quantified via real-time RT-PCR. B) Mean PhCFAT transcript levels (+/SE, n=3) from pollinated and non-pollinated MD (black) and 44568 (etr1-1) (white) petal limb tissue collected at 12 h intervals following a successful pollination, and analyzed via real-time RT-PCR.

PAGE 79

67 PhCFATTranscript Isoeugenol Emission0 -2 -3 -1 -4 -0 -0.1 -0.15 -0.05 -0.2 -% of total mRNAg(gFW)-1hour-1AB ZT 1.5 -ZT 13.5 -ZT 1.5 -ZT 13.5 -ZT 1.5 -ZT 13.5 -ZT 1.5-ZT 13.5-ZT 1.5-ZT 13.5Figure 3-7. Daily light/dark fluctuations in PhCFAT transcript and isoeugenol emission. A) Mean PhCFAT transcript levels (+/SE, n=3) from whole flowers collected at 6 h increments for five days, and analyzed via real-time RT-PCR. Plants were grown in standard greenhouse conditions for two days and then transferred to complete darkness. B) Mean isoeugenol emission (+/SE, n=3) collected from whole flowers at 6 h increments for five days as described above.

PAGE 80

68 0 -0.06 -0.12 -0.18 -0.24 -Post-Anthesis -Anthesis -Tube -Medium Bud -Small Bud -% of Total mRNA Figure 3-8. Developmental regulation of PhCFAT transcript levels in petunia floral tissue. Mean PhCFAT transcript levels (+/SE, n=3) from whole flower tissue collected at 5 developmental stages (small bud, medium bud, tube, anthesis, and 2 days past anthesis) at ZT 13, and analyzed via real-time RT-PCR.

PAGE 81

CHAPTER 4 PHYSIOLOGICAL INTERACTIONS AND ENVIRONMENTAL STIMULI Introduction Since plants are sessile organisms they must sense and interact favorably with the environment around them to survive. Here a set of diverse experiments that focus both on the physiological interactions of floral volatiles with surrounding organisms such as humans, pollinators, and fungi, and the effect of environmental cues such as light and temperature on floral volatile biosynthesis are discussed. Based on previous literature and observations, the primary goal of these experiments was to determine which physiological processes are directly influenced by the production of these chemicals, and which environmental cues influence their synthesis. Due to the scope and nature of these experiments, some experiments were not replicated, but are included below as a basis for further research. Physiological Interactions Human Olfactory Panels Floral volatile emission in Petunia x hybrida cv Mitchell Diploid (MD) has been shown to rapidly decrease following treatment with exogenous ethylene (Chapter 2; Chapter 3; Underwood et al., 2005). To determine if humans could perceive this decrease in volatile emission, excised MD flowers were treated with ethylene or air for 12 h, placed into individual glass jars, and capped 30 minutes prior to sampling. Sixty panelists were then asked to smell each of three jars ((two with ethylene treated/ one air) or (two air treated/ one ethylene)) and determine which flower differed from the other 69

PAGE 82

70 two (Table 4-1). Forty-six out of 60 panelists were able to identify the correct flower, indicating that a statistically significant (p<.001) number of panelists could correctly discern ethylene treated petunia flowers from those treated with air (Table 4-2). Those panelists who correctly identified the MD flower treated with ethylene described it as less fragrant, earthy, or musty, while those who correctly selected the MD flower treated with air described it as overwhelming, too sweet, medicinal, and more fragrant. This observation indicates that human olfaction can discern the decrease in volatile emission from petunia flowers resulting from ethylene treatment. The use of human olfactory panels has proved to be an invaluable tool for studying the ability of human panelists to perceive changes in the floral volatile emission of both PhBSMT RNAi transgenic petunia, with >90% decreased methyl benzoate emission (Underwood et al., 2005), and ethylene treated flowers (Table 4-2). In the future, it will be interesting to utilize this tool to study other transgenic petunia including PhBPBT RNAi and PhCFAT RNAi plants. Though proven difficult to date (Appendix B), the production of transgenic petunia that over-express floral volatile biosynthesis genes including PhBSMT1, PhBSMT2, PhBPBT, and PhCFAT will be good candidates for future olfactory panels. Identification of genes and subsequent volatile compounds whose absence or overexpression are perceivable to humans will prove valuable to more effective genetic engineering of floral volatile emission in the future. Pollinator Attraction One of the primary physiological functions of floral volatile emission is to attract pollinators to the flower to increase the efficiency of fertilization and subsequent seed yield. Recent work, testing the ability of nine common petunia floral volatiles to excite Manduca sexta antennae receptors (using an electroantennogram), has shown that

PAGE 83

71 benzaldehyde, methyl benzoate, and benzyl alcohol elicit the strongest response within the antennae receptors (Hoballah et al., 2005). To test whether the removal of one of these compounds, methyl benzoate, has an effect on M. sexta attraction in vivo, adult M. sexta moths were placed in a cage containing a MD and PhBSMT RNAi (containing >90% decreased methyl benzoate emission (Underwood et al., 2005)) plant with an equivalent number of flowers. For a 30 minute period prior to dusk (Zeitgeber time (ZT) 12.5 to ZT 13) during a summer night, the visitation pattern of the moths was observed to determine the number of flower visitations to each plant. Prior to experimentation, a visit was defined as a >1 second hover time over an individual flower. Results from the MD vs. PhBSMT RNAi flight trial show a larger percentage of visitations to MD flowers (Table 4-3, Exp.1). These results suggest that greatly reduced methyl benzoate emission may affect the flowers ability to attract M. sexta. However, further repetition will be necessary to confirm this result. In addition to PhBSMT RNAi petunia, other transgenic petunia including PhBPBT and PhCFAT RNAi., and PhBSMT, PhBPBT, and PhCFAT over-expression plants may be worthy candidates for future flight trials. Similar to human olfactory panels, the identification of genes and volatile compounds that affect pollinator attraction may facilitate more effective genetic engineering of floral volatile emission, potentially resulting in increased seed set and/or crop yield. Following a successful pollination in MD petunia, endogenous ethylene is synthesized throughout the flower signaling a shift in floral function from one of pollinator attraction to one of ovary expansion and seed development (Jones et al., 2003). These endogenous ethylene signals down-regulate floral volatile emission since the

PAGE 84

72 function of floral volatile emission as a pollinator attractor is complete (Underwood et al., 2005). This decrease in volatile emission could make the flower less attractive to a pollinator, decreasing visitation and increasing the chance of the pollinator visiting a flower which has not yet been pollinated. To test this hypothesis, MD flowers were either pollinated or treated with exogenous ethylene and placed into the flight cage alongside untreated controls (Table 4-3, Exp. 2-5), and M. sexta visitations were analyzed for a 30 minute period beginning at ZT 12.5 (prior to dusk). As was the case with the PhBSMT RNAi vs. MD experiments, the effect of both exogenous ethylene treatment and pollination on pollinator visitation was inconclusive. When a MD plant treated with exogenous ethylene was placed by a MD plant treated with air, no significant difference in pollinator frequency was observed (Table 4-3, Exp. 2). When only three branches (10 flowers) of MD flowers treated with ethylene were placed next to three branches of air treated flowers, substantially more pollinator visits were seen to ethylene treated flowers than to air-treated flowers (Table 4-3, Exp. 3). When either whole plants or branches containing only flowers pollinated for 48 h were placed beside non-pollinated controls, no difference in visitation was observed (Table 4-3, Exp. 4, 5). Combined, these results suggest that exogenous or pollination-induced ethylene did not result in a substantial decrease in pollinator visitation to petunia flowers. One explanation for a lack in significant differences in pollinator visitation to flowers with reduced volatile emission is the distance that the pollinator must travel to find the flowers emitting floral volatiles. Generally, floral volatiles are thought to be long

PAGE 85

73 distance signals to potential pollinators that a nectar reward awaits (Pichersky and Gershenzon, 2002). Once in close proximity other cues such as vision may allow a pollinator to focus on a nearby flower. Therefore, the cage (2 meter square) utilized for these experiments could have been too small, neutralizing any differing effects of floral volatile emission. Future work utilizing a much larger enclosure (eg. shaded greenhouses) or elongated wind tunnel will address this concern. Defense against Fungal Pathogens While floral volatiles have primarily been shown to interact with potential pollinators, it has been suggested that individual volatiles might also play a role in defense against fungal pathogens (Karapinar and Aktug, 1987; Adams and Weidenborner, 1996; Gang, 2005). In MD corolla tissue, internal pools of several volatiles including benzyl benzoate, methyl benzoate, and isoeugenol have been quantified (Boatright et al., 2004). Utilizing transgenic RNAi petunias, we studied the potential function of these different volatiles in the resistance of petunia petal tissue to Botrytis cinerea growth. B. cinerea is a common fungal pathogen shown to attack >200 plant hosts including rose and petunia (van Kan, 2006). In the greenhouse, B. cinerea is commonly found on damaged or senescing petunia petal tissue (personal observation). Following 24 h of treatment with increasing dilutions of B. cinerea spores, tissue necrosis was evident around the stock treatment in all flowers tested (Figure 4-1). However, at the 1:10 dilution, PhCFAT RNAi and MD flowers showed a moderate degree of necrosis, while PhBSMT and PhBPBT RNAi flowers showed little to no evidence of infection. Additionally, no evidence of fungal infection was evident in control, 1:100, or 1:1000 dilutions in any treated flowers following 24 h of treatment.

PAGE 86

74 By 48 h after treatment, tissue damage due to B. cinerea infection continued to expand with damage observed at every dilution in two PhCFAT and one PhBSMT RNAi flowers (Table 4-4). In MD, B. cinerea growth was observed at 1:100 dilution in all flowers analyzed. Interestingly, two PhBPBT RNAi flowers showed evidence of fungal infection only at the 1:10 dilution, while all other flowers showed growth at 1:100. Together these results indicate only a small difference in the resistance to B. cinerea in any genotypes studied. PhBSMT and PhCFAT RNAi lines were essentially indistinguishable from MD when treated with varying concentrations of B. cinerea spores. However, PhBPBT RNAi flowers seemed to be slightly more resistant to fungal growth. This observation suggests that PhBPBT function weakens the flowers resistance to fungal attack, however subsequent experiments will be necessary to confirm this observation. In addition to B. cinerea (a necrotrophic fungi) it will be interesting to determine if the resistance to other pathogens such as bacteria (eg. Pseudomonas syringae), insects (spider mites), and other fungi (biotrophs) are affected in PhBSMT, PhBPBT, and PhCFAT RNAi transgenic petunia. For example, benzyl benzoate has been shown to act as a miticide against Tyrophagus putrescentiae (Schrank) and Sheep Mange (Dimri and Sharma, 2004; Harju et al., 2004), indicating that benzyl benzoate might play a larger role in the resistance of petunia to herbivores such as mites rather than fungal pathogens. By identifying genes and subsequent volatile compounds critical to plant defense, we could more effectively engineer plants with increased resistance to various pathogens, potentially decreasing the necessity of pesticide use.

PAGE 87

75 Environmental Stimuli Light Floral volatile biosynthesis is a metabolically expensive process that utilizes the suns energy to convert carbon dioxide to sugar (early precursors of volatile biosynthesis). In petunia, precursors such as phosphoenol pyruvate and erythrose 4-phosphate enter the shikimate pathway where they are converted to chorismate, a precursor to benzenoid and phenylpropanoid volatile compounds that primarily constitute petunia floral volatile emission (Weaver and Herrmann, 1997; Herrmann and Weaver, 1999; Knaggs, 2001; Boatright 2004). While the rhythmic emission of petunia floral volatile emission has been well studied (Kolosova et al., 2001; Verdonk et al., 2003; Underwood et al., 2005), the degree to which this emission is directly dependent on light is less clear. Thus a series of experiments meant to test the direct correlation between light and volatile production was conducted. Additionally, through the use of 44568 transgenic petunias, the role of ethylene in light-dependent regulation of floral volatile emission was also studied. To determine the role of light in the rhythmic regulation of floral volatile synthesis in MD petunia, floral volatile emissions were collected from MD flowers at 6 h intervals for two days in standard greenhouse conditions. As reported previously (Underwood et al., 2005), methyl benzoate emission was rhythmic with peak levels observed at ZT 13.5 and lowest levels observed at ZT 7.5 (Figure 4-2). This pattern of emission was also observed for three other floral volatiles, benzaldehyde, phenylacetaldehyde, and benzyl benzoate, suggesting a similar mode of regulation. While all volatiles were emitted rhythmically, their patterns were not identical. Peak benzyl alcohol emission levels were delayed by 12 h (ZT 1.5) compared to

PAGE 88

76 previously discussed volatiles including methyl benzoate and benzyl benzoate. This increase in benzyl alcohol emission coincides with decreased benzyl benzoate emission, which is synthesized by the transfer of a benzoyl group to benzyl alcohol via PhBPBT in petunia. Additionally, peak isoeugenol and phenylethyl alcohol emission was sustained for a 12 h period (ZT 13.5 to ZT 1.5). For all volatiles, lowest levels of emission were measured in the early afternoon (ZT 7.5). Combined, these results suggest two common modes of rhythmic regulation dependent on the volatile. In one mode (methyl benzoate, benzaldehyde, phenylacetaldehyde, and benzyl benzoate) peak volatile emission is observed at ZT 13.5, decreased by ZT 1.5, and lowest at ZT 7.5, while in a second mode (isoeugenol, and phenylethyl alcohol) peak volatile emission is sustained for a 12 h period (ZT 13.5 to ZT 1.5) followed by a rapid decrease in emission by ZT 7.5. It is probable that benzyl alcohol emission would also fall into this second mode of regulation; however prior to ZT 19.5 benzyl alcohol is being utilized to produce benzyl benzoate resulting in reduced benzyl alcohol emission (ZT 13.5 to ZT 19.5). To confirm that benzyl alcohol is rhythmically emitted similar to isoeugenol and phenylethyl alcohol, it would be interesting to analyze the rhythmic emission of benzyl alcohol in PhBPBT RNAi transgenic petunia, which covert benzyl alcohol to benzyl benzoate at a highly reduced rate. The observation of two distinct groups of regulated volatiles suggests a difference in function, where volatiles released earlier in the evening could attract one pollinator, whereas volatiles released in the early morning could attract another. To determine the dependence of rhythmic volatile emission on light availability, MD plants were transferred to complete darkness for three days, and volatile emission

PAGE 89

77 was quantified every 6 h (Figure 4-2). If rhythmic emission of each volatile was light dependent, movement to complete darkness would result in a loss of rhythmic emission. However, if rhythmic emission was regulated by a rhythmic oscillator (which regulates several functions throughout the plant independent of light) emitted volatiles would continue to oscillate even when plants are transferred to complete darkness. The effect of complete darkness on petunia floral volatile emission varied dependent on the compound measured (Figure 4-2). In one group of floral volatiles, which included benzaldehyde, benzyl alcohol, phenylacetaldehyde, methyl benzoate, and benzyl benzoate, rhythmic emission of each volatile was primarily light-dependent resulting in one additional circadian cycle of emission observed following 24 h of complete darkness, and a complete loss of rhythmic emission observed thereafter. In a second group of volatiles, which included isoeugenol and phenylethyl alcohol, emission was primarily light-independent with rhythmic emission of each volatile evident throughout the course of the experiment. Combined, these results indicate that the regulation of floral volatile emission in petunia is dependent both on light-dependent and circadian-related factors. However, similar measurements from plants moved to constant light conditions will be necessary to confirm this result. To determine if ethylene might play a role in regulating the rhythmic regulation of volatile emission, MD and 44568 flowers were collected at 4 h intervals for 24 h under standard greenhouse conditions (Figure 4-3). While the analysis of emission levels of the 7 primary constituents of petunia floral volatile emission revealed slightly increased levels of benzyl alcohol, methyl benzoate, phenylethyl alcohol, and isoeugenol in MD volatile emission compared to 44568, and slightly increased levels of benzaldehyde in

PAGE 90

78 44568 floral emission compared to MD, the overall patterns of regulation were essentially equivalent. These results indicate that ethylene does not play a direct role in regulating the normal rhythmic emission of floral volatile emission in petunia. To further determine the direct dependence of floral volatile emission on sunlight, MD and 44568 plants were placed in normal greenhouse conditions (un-shaded) or placed in >50% shade conditions and allowed to adjust (equilibrate) to these conditions for one week (Figure 4-4). Floral volatile emissions were then collected at ZT 13 and analyzed for differences in plants grown in the shade compared to un-shaded. Results from this experiment revealed that a >50% reduction in light levels did not affect overall MD or 44568 volatile emission, and is still sufficient to support significant floral volatile emission in petunia. While results from the previous experiment reveal that most floral volatile emission is light dependent, it is possible that even after a 50 to 60% light reduction, the minimal light threshold for volatile production had not yet been reached. Experiments with further reduced light levels will be critical to determining this threshold. In order to further determine the importance of light absorbed within 24 h of volatile emission, MD and 44568 plants were placed under black cloth overnight, and either moved to un-shaded greenhouse conditions or left under black cloth for 11 h at equivalent temperatures prior to floral volatile collection (ZT 13) (Figure 4-4). In contrast to previous observations (Figure 4-2), all seven primary petunia floral volatiles emitted from MD flowers were still quantifiable following 24 h under black cloth. Interestingly, levels of benzyl alcohol, phenylethyl alcohol, and isoeugenol were statistically equivalent to levels measured in flowers treated with 11 h of light, while

PAGE 91

79 benzaldehyde, phenylacetaldehyde, methyl benzoate, and benzyl benzoate levels were slightly higher in MD flowers treated with 11 h of light. This observation suggests that substrates generated as a result of photosynthesis during the prior 24 h period could affect overall volatile emission in petunia. Interestingly, an increase in volatile emission was not observed when 44568 plants were treated with light, suggesting a role for ethylene in the conversion light energy to volatile substrates. Further research will be necessary to determine significance, if any, of this observation. One explanation for the difference in volatile emission between this experiment and the previous experiment (where plants were moved to complete darkness) has to do with light levels in the dark treatments. In the earlier experiments, plants were moved to complete darkness absent of any environmental cues. However in the black cloth experiment, light was not blocked from below resulting in <2mol/m 2 /s levels quantified under the black cloth. While low, this amount of light could act as an environmental cue that triggers floral volatile biosynthesis. If true this observation would indicate that floral volatile emission is not dependent on light due to high energy needs, but instead as an environmental cue to stimulate floral volatile biosynthesis. The observation of prominent floral volatile emission, even when placed under low light conditions for 24 h, indicates that MD and 44568 plants can utilized stored substrates to produce floral volatile emission. To determine if these stored substrates were transferred from the photosynthetic tissue of the plant, excised MD and 44568 flowers were again placed under black cloth overnight and either removed and placed in un-shaded greenhouse conditions or left in darkness 11 h prior to volatile collection.

PAGE 92

80 As seen previously, excised MD flowers left under black cloth emitted floral volatile levels equivalent or above levels observed in excised flowers treated with 11 h of light (Figure 4-4). This observation was even more evident in 44568 flowers where in some cases (benzaldehyde and phenylethyl alcohol) levels were substantially higher in dark treated flowers compared to flowers treated with 11 h of light. This observation is significant in that it shows that excised flowers can still store enough precursor in the floral tissue to produce floral volatiles in the absence of high light levels and source tissues of the plant. Additionally, equivalent or reduced levels in flowers treated with 11 h of light indicate that light harvested by floral photosynthetic tissue does not immediately contribute to floral volatile biosynthesis. Temperature To date, the mechanisms regulating floral volatile emission remain largely unknown. However passive diffusion of floral volatiles, produced within the epidermis of the corolla, have long been thought to play a role in this process. Recent evidence from research on Petunia axillaris, a parent of MD, has shown a direct correlation between the boiling point of a given volatile compound and the emission to internal volatile ratio (vapor pressure) observed in floral tissue (Oyama-Okubo et al., 2005). Compounds with lower boiling points were shown to have a higher vapor pressure, where as volatiles with higher boiling points were shown to have a lower vapor pressure. This observation indicates that temperature has a critical role in the regulation of floral volatile emission. To determine the effect of temperature fluctuations on both internal and emitted volatile levels, MD and 44568 petunias were placed into 2 side by side greenhouses with equivalent light levels. One of these houses had an average temperature of 31C, while

PAGE 93

81 the other house had an average temperature of 23C. After three days of equilibration, emitted and internal (extracted from corolla tissue) volatiles were collected at ZT 13, and analyzed to determine a percent change in both emitted and internalized volatile levels in flowers from warmer conditions compared to flowers from cooler conditions. In MD flowers, the emission of volatiles with low boiling points such a benzaldehyde and benzyl alcohol increased >100% over levels collected at cooler conditions (Figure 4-5). This coincided with >25% decrease in internal volatile levels of these compounds when compared to flowers collected from cooler conditions. Additionally, emitted levels of other volatiles with lower boiling points including phenylacetaldehyde, methyl benzoate, and phenylethyl alcohol were also elevated in warmer conditions. However, a substantial decrease in internalized pools was only observed for phenylacetaldehyde. Emitted levels of isoeugenol and benzyl benzoate (the two volatiles with the highest boiling points) did not show any significant changes in warmer conditions. Overall, these results indicate that dependent on the temperature, the ratios of individual volatiles in floral volatile emission will vary. Volatiles with lower boiling points are more prominent in floral volatile emission at higher temperatures than lower temperatures, whereas emission of volatiles with higher boiling points remains static throughout. This observation is most likely attributed to the physical nature of each volatile, however changes in metabolism in response to temperature can not be ruled out. Therefore, in addition to regulation at the molecular level, temperature represents a critical factor in the regulation of floral volatile emission.

PAGE 94

82 Experimental Procedures Human Olfactory Panel MD whole flowers were collected at anthesis at ZT 11, and treated with 2-3l/L ethylene or air for 12 h overnight. In conjunction with Dr. Charlie Sims (Food and Agricultural Sciences, University of Florida) flowers were placed in individual glass jars and capped for 30 minutes prior to sampling. Using a triangle test format, three jars (two ethylene / one air treated or two air/ one ethylene treated) were presented to human panelists who were asked to select the jar whose volatile emission differed from that of the other two, and give a comment as to why they picked that jar. Statistical significance (p <.001) was determined as previously described (Lawless and Heyman, 1998). Manduca sexta Flight Trials Manduca sexta were purchased from NCSU Entomology (Campus Box 7613, Raleigh, North Carolina) at the pupa stage and emerged on the day of flight experiments. Prior to each experiment, whole plants (Exp. 1,2,4) or 3 branches (10 flowers) (Exp. 3,5) from each of two conditions were then placed into a 2m square pvc cage lined with 30% shade cloth, and elevated approximately 60 cm off the ground. For PhBSMT RNAi vs. MD experiments, plants were groomed, leaving an equivalent number of flowers at anthesis. Forty-eight h prior to the experiment, MD flowers for the pollination vs. non-pollinated flight trials were pollinated or tagged as non-pollinated controls, while all other flowers were removed. For ethylene treatment experiments, whole plants or branches with equivalent number of flowers at anthesis were treated with 2-3l ethylene for 10 h prior to flight trials. The plants/branches were then spread 90cm apart. Dependent on the experiment, a variable number of moths were then released into the cage 30 minutes prior to dusk (ZT 12.5 to ZT 13) during a summer night and allowed to

PAGE 95

83 forage for 30 minutes. Flight trials were run on evenings following sunny days with a temperature of 27C 3. A visit was defined as a >1 second hover over a single flower. Fungal Pathogen Experiments Botrytis cinerea, a common fungal pathogen, was isolated from petunia petal tissue collected from the greenhouse, and grown to sporulation on potato dextrose agar (PDA) under 16 h of light at 24C. Once sporulated, a sterile loop dipped in potato dextrose broth (PDB) was lightly dragged across the surface of the plate to reduce hyphal damage and collect spores. The loop was then placed in 10ml of PDB and the resulting stock solution was vortexed for 30 seconds. Three subsequent 1 in 10ml PDB dilutions were then made resulting in 1:10, 1:100, and 1:1000 dilutions. At ZT 3, five whole flowers at anthesis, were collected from PhBPBT RNAi, PhBSMT RNAi, PhCFAT RNAi, and MD petunia and placed in 1% water agar blocks to prevent desiccation. On one lobe of the petal limb, two 10l drops of PDB were placed on the upper epidermis to determine orientation and to act as the negative control. Moving counter-clockwise around the petal limb, 10l drops of PDB solution containing B. cinerea spores (stock, 1:10 dilution, 1:100 dilution, and 1:1000 dilution) were then added to each of the four remaining lobes resulting in four fungal treatments and a negative control on each flower. The flowers were then placed in a 100% humidity chamber at 24C, with 16 h of light. After 24 h, the diameter of fungal infection (necrotic tissue) was measure two times and averaged for each treatment where damage was evident. The flowers were then placed back into 100% humidity for an additional 24 h. Forty-eight h after treatment, the flowers were again removed, and the largest dilution with evidence of fungal infection (necrotic tissue) was noted.

PAGE 96

84 Light Experiments The rhythmic emission of petunia floral volatiles was collected and analyzed over a five day period (two days under normal greenhouse conditions and three days in complete darkness) as described previously (Underwood et al., 2005). For MD and 44568 24 h whole flower emission, four sets of three flowers were collected at anthesis from MD and 44568 plants grown as previously described (Chapter 3). MD and 44568 flowers were collected at 4 h intervals for 24 h beginning at ZT 1, analyzed as previously described (Schmelz et al., 2001), and reported as mean volatile emission standard error. To determine the effects of reduced light levels on floral volatile emission, MD and 44568 plants were placed under normal light or shaded conditions within the same greenhouse to control temperature variability. After one week, four sets of whole flowers collected at anthesis from MD and 44568 shaded and un-shaded plants were the collected on two subsequent sunny days at ZT 13 and analyzed as previously described to determine mean volatile emission(n=8, SE) (Schmelz et al., 2001). Light readings made at ZT 6 prior to each days sampling showed > 50% decrease in light intensity in the shaded location as compared to un-shaded (Day 1: Un-Shaded 831mol/m 2 /s, Shaded 359mol/m 2 /s (57% decrease); Day 2: Un-shaded 907mol/m 2 /s, Shaded 409.5mol/m 2 /s (55% decrease)). To determine the dependence of floral volatile emission on light harvested within 24 h of emission, MD and 44568 plants, and MD and 44568 excised whole flowers at anthesis, were placed under black cloth at ZT 13 (24 h prior to volatile collection). At ZT 2 (the next morning) half the whole MD and 44568 plants or excised flowers were removed from the black cloth and placed in unshaded conditions within the same

PAGE 97

85 greenhouse to decrease temperature variability. At ZT 13 that evening, MD and 44568 flowers were then collected and analyzed as previously described to determine volatile emission. The experiment was repeated a second day and results pooled to determine mean volatile emission (n=8, SE). Light levels in the unshaded location collected at ZT 5 ranged from 487.5 to 975mol/m 2 /s dependent on the day and location within the greenhouse. Light levels under the black cloth were <2 mol/m 2 /s throughout. Temperature Experiments To determine the effects of temperature changes on MD floral volatile production, MD plants were separated into two side by side greenhouses with equivalent mean light levels (565.5 and 604.5 mol/m 2 /s), one with an average temperature of 31C 1 (n=10, SE), and one with an average temperature of 23C 1 (n=10, SE). Plants were then left for three days to equilibrate. Once equilibrated, four sets of three flowers at anthesis were collected at ZT 13 on two subsequent evenings, and analyzed as previously described to determine volatile emission (n=8, SE). Two additional sets of three flowers were collected at ZT 13 on each evening and set aside for internal volatile analysis. The corolla tissue from these flowers was removed and the tissue was frozen in liquid nitrogen. Internal volatiles were extracted as previously described (Schmelz et al., 2004), and internal volatile levels (n=4, SE) determined via flame ionization gas chromatography. Both emitted and internal volatile levels were reported as a percent change in volatile levels at 31C as compared to levels at 23C standard error.

PAGE 98

86 Table 4-1. The demographics of human olfactory panelists Panelist Age (Yrs) Under 18 18-29 30-44 45-65 Over 65 Total Men 0 22 5 4 1 32 Women 0 25 2 1 0 28 Total 0 47 7 5 1 60 Table 4-2. Human olfactory panel results, ethylene treated vs. air treated flowers Results Correct 46 Incorrect 14 Total 60 *** 33 out of 60 needed to attain significance (p<.001)

PAGE 99

87 Table 4-3. Manduca sexta visitation experiments Flower TypeVisitsExperiment 1PhBSMT RNAi17MD27*** Moths Flown = 3Experiment 2C2H4 Treated MD35Air Treated MD31*** Moths Flown = 2Experiment 3C2H4 Treated MD39Air Treated MD12*** Moths Flown = 1Experiment 4Pollinated MD61Non-Pollinated MD64*** Moths Flown = 6Experiment 5Pollinated MD31Non-Pollinated MD21*** Moths Flown = 1

PAGE 100

88 036912PhBPBTRNAiPhBSMTRNAiPhCFATRNAiMD MD 036912PhCFATRNAiMDDiameter of Infection(mm) MD MD Figure 4-1. Diameter of Botrytis cinerea infection in transgenic petunia 24 h after treatment. PhBSMT RNAi, PhBPBT RNAi, PhCFAT RNAi, and MD whole flowers were collected at anthesis and treated with 10l of PDB broth containing variable concentrations of Botrytis spores. Two 10l drops off PBP only were used for orientation and the negative control. The next lobe counter-clockwise was treated with the stock concentration of Botrytis spores in 10l of PDB, followed by a 1:10, 1:100, and 1:1000 dilutions. Pictures were taken 24 h after treatment. Mean diameter of tissue infection (n=5, SE) in stock (grey) and 1:10 dilution (black) concentrations 24 h after treatment. No evidence of tissue infection was observed in negative controls (not shown).

PAGE 101

89 Table 4-4. Extent of floral tissue damage in transgenic petunia 48 h after infection with Botrytis cinerea Flower Type Sample Largest Dilution Where Tissue Damage was Observed PhBPBT RNAi 1 1/100 2 1/10 3 1/100 4 1/10 5 1/100 PhBSMT RNAi 1 1/100 2 1/100 3 1/1000 4 1/100 5 1/100 PhCFAT RNAi 1 1/100 2 1/1000 3 1/100 4 1/1000 5 1/100 MD 1 1/100 2 1/100 3 1/100 4 1/100 5 1/100

PAGE 102

90 Benzyl benzoate02.557.510ZT 1.5ZT 13.5ZT 1.5ZT 13.5ZT 1.5ZT 13.5ZT 1.5ZT 13.5ZT 1.5ZT 13.5 Benzaldehyde0481216 Phenylacetaldehyde02.557.510 Phenylethyl alcohol00.61.21.82.4 Isoeugenol01234 Methylbenzoate015304560 Benzyl alcohol06121824 DarknessVolatile Emission ((g/gfresh weight)/hour) Figure 4-2. Rhythmic emission of petunia floral volatiles. Whole flowers were collected at 6 h intervals beginning at ZT 1.5 and analyzed for 5 days. On day 3, plants were transferred from standard greenhouse conditions to constant darkness. Emitted volatiles (n=3, SE) were quantified via flame ionization gas chromatography.

PAGE 103

91 Benzaldehyde05101520 Benzyl alcohol01.534.56 Phenylacetaldehyde01.534.56 Methyl benzoate020406080 Phenylethyl alcohol01234 Isoeugenol036912 Benzyl benzoate01.534.56ZT 1ZT 13 ZT 1 Time of Day (ZT) MD 44568Volatile Emission ((g/gfresh weight)/hour) Figure 4-3. Twenty-four hour volatile emission in MD and 44568 whole flowers. Emitted volatiles (n=4, SE) were analyzed from whole flower tissue collected at 4 h intervals and analyzed via flame-ionization detection gas chromatography.

PAGE 104

92 036912 0481216Benzaldehyde 0481216 00.511.52Benzyl alcohol 00.511.52 02468Phenylacetaldehyde 02468 015304560Methyl benzoate 015304560 01234Phenylethyl alcohol 01234Isoeugenol 036912 01234Benzyl benzoate 01234MD44568 (g/gfresh weight)/hourUn-ShadedShade0 h Light11 h Light0 h Light11 h Light ExcisedUn-ShadedShade0 h Light11 h Light0 h Light11 h Light Excised Figure 4-4. Light-dependent regulation of floral volatile emission. Mean floral volatile emission from MD and 44568 whole flowers was determined for plants grown in un-shaded and >50% shaded conditions, plants exposed to 0 h and 11 h of sunlight for one day, and excised whole flowers exposed to 0 h or 11 h of sunlight for one day.

PAGE 105

93 -200-150-100-50050100150200Benzaldehyde (179 C)Benzyl alcohol (204 C)Phenylacetaldehyde (195 C)Methyl benzoate (200 C)Phenylethyl alcohol (220 C)Isoeugenol (266 C)Benzyl benzoate (324 C)Percent Change in Volatile Levels at 31C Compared to 23C Emitted Internal Figure 4-5. Temperature-dependent volatile emission in MD whole flowers. MD plants were grown in warm (mean temperature 31C 1) or cool (mean temperature 23C 1) greenhouse conditions with equivalent light for 3 days. Whole flower (emitted) or corolla (internal) tissue was then collected at ZT 13 on days 4 and 5, quantified via flame ionization gas chromatography, and reported as a mean percent change in emitted (black) and internal (white) volatile levels (n=8, SE) at 31C as compared to 23C. Boiling points for each volatile compound are listed in parentheses.

PAGE 106

APPENDIX A PHBPBT RNAI TRANSGENIC PETUNIA Introduction To determine the in vivo function of PhBPBT in Petunia x hybrida cv Mitchell Diploid (MD), RNAi induced gene silencing was utilized to decrease PhBPBT transcript abundance and subsequent PhBPBT enzyme function. Results and Discussion Analysis of PhBPBT levels in three homozygous PhBPBT RNAi transgenic lines (Lines 7, 9, and 15) revealed >99% decrease in PhBPBT transcript compared to MD (Figure A-1). In vitro, PhBPBT catalyzes the conversion of benzyl alcohol to benzyl benzoate (Boatright et al., 2004). PhBPBT RNAi lines contained a 90% decrease in benzyl benzoate emission confirming the in vivo function of PhBPBT in the production of benzyl benzoate (Figure A-1). Additionally, >500% increase in the direct precursor, benzyl alcohol, was also observed. It has been shown through the use of 2H 7 -labled benzyl alcohol feeding studies that benzyl alcohol is not only converted to benzyl benzoate but also reversibly to benzaldehyde in petunia corolla tissue (Boatright et al., 2004). In the PhBPBT RNAi lines a 300% accumulation of benzaldehyde emission was observed compared to MD. These results indicate that increased benzyl alcohol, created in response to reduced PhBPBT function, is converted back to benzaldehyde resulting in increased benzaldehyde levels. 94

PAGE 107

95 PhBPBT has also been shown in vitro to catalyze the transfer of a benzoyl group to phenylethyl alcohol producing phenylethyl benzoate, another compound found in petunia corolla tissue (Boatright et al., 2004). A small increase in phenylethyl alcohol emission was also observed in the RNAi lines compared to MD. However, measurable levels of phenylethyl benzoate could not be observed in MD or RNAi floral volatile emission. Emission of methyl benzoate, phenylacetaldehyde, and isoeugenol were not effected in RNAi transgenic petunia lines when compared to MD. Together these results show that PhBPBT function in floral emission is critical to the production of benzyl benzoate. In addition, functional removal of PhBPBT resulted in a backup of precursor effecting two structurally similar compounds, benzyl alcohol and benzaldehyde, but not other benzenoids including methyl benzoate. Experimental Procedures Construction of PhBPBT RNAi Transgenic Petunia RNAi knockdown technology was utilized to identify the function of PhBPBT. Two fragments of PhBPBT (295-638 and 295-1139) were amplified via PCR, ligated end-to-end in a sense/antisense orientation, ligated downstream of the FMV constitutive promoter and transformed into MD as previously described (Chapter 3). Thirty-five primary transformants were recovered and grown to maturity under previously described greenhouse conditions (Chapter 3), and plants showing reduced PhBPBT expression and benzyl benzoate emission were identified. Flowers from these plants were then self-pollinated and T1 progeny were grown. Positive lines were then screened for 3:1 segregation of the transgene via PCR (verifying the presence of the neomycin phosphotransferase kanamycin resistance gene (NPTII), PhBPBT expression, and benzyl benzoate emission. Flowers from PCR positive plants from lines demonstrating 3:1

PAGE 108

96 segregation were again selfed, the progeny sown, and homozygous lines identified via PCR (NPTII). PhBPBT Expression and Volatile Emission Analysis Two sets of total RNA were extracted from three whole flowers from three plants of each transgenic line and MD collected at Zeitgeber time (ZT) 13, and analyzed via real-time RT-PCR as previously described (Chapter 3). To quantify PhBPBT RNAi and MD volatile emission, three sets of five flowers were collected from each transgenic line and MD at ZT 13 and analyzed as previously described (Schmelz et al., 2001).

PAGE 109

97 Benzyl benzoate00.20.40.60.8 Benzyl alcohol02468 Benzaldehyde07142128 Methyl benzoate05101520Line 7Line 9Line 15MD Phenylacetaldehyde00.751.52.253 Phenylethyl alcohol00.30.60.91.2 Isoeugenol01.252.53.755 PhBPBT Transcript00.050.10.150.2Line 7Line 9Line 15MD(g/gfresh weight)/hour% of Total mRNA Figure A-1. PhBPBT RNAi and MD floral volatile emission. Mean volatile emission (n=9, SE) was measured from PhBPBT RNAi (Line 7, 9, 15) and MD whole flowers for 1 h beginning at ZT 13. To confirm reduced PhBPBT transcript in RNAi lines, total RNA was extracted from PhBPBT RNAi and MD whole flowers collected at ZT 13, and quantified via real-time RT-PCR (n=9, SE).

PAGE 110

APPENDIX B OVEREXPRESSION OF PETUNIA FLORAL VOLATILE SYNTHESIS GENES Introduction In conjunction with RNAi-induced gene silencing, PhBSMT and PhBPBT overexpression transgenic petunia were generated to further determine the in vivo function of PhBSMT1 and PhBPBT in Petunia x hybrida cv Mitchell Diploid (MD). Results and Discussion Out of tissue culture, 46 T0 PhBSMTOE and 44 T0 PhBPBTOE primary transgenics were grown to maturity and screened for altered volatile emission (Table B-1). Out of 46 PhBSMTOE plants screened, 9 contained >90% decrease in methyl benzoate emission compared to MD levels indicating cosuppression, while 3 contained elevate methyl benzoate levels. Out of 44 T0 PhBPBTOE primary transgenics screened, 8 contained >90% decrease in benzyl benzoate emission indicating cosuppression, while 3 contained elevated benzyl benzoate levels. Due to uncertainty in phenotype, all plants were selfed and T1 seed was collected. Lines with highest emission in the T0 were then selected and screened for 3:1 segregation of the transgene via PCR (NPTII) of leaf genomic DNA. Four PhBSMTOE and eight PhBPBTOE T1 transgenic petunia lines segregating 3:1 for presence of the transgene were then selected and analyzed for increased PhBPBT or PhBSMT1 transcript. No PhBSMTOE lines with increased PhBSMT1 transcript were identified, while three 3:1 segregating PhBPBTOE lines with increased PhBPBT transcript levels (compared to MD) 98

PAGE 111

99 were selected. Analysis of volatile emission from these three lines contained no increase in benzyl benzoate emission levels. These results indicate that the overexpression of petunia floral volatile biosynthesis genes from cDNA is not an effective approach to overexpressing native genes in petunia. Although the presence of cosuppressed lines indicates that the constructs were functional, no lines were shown to overexpress the respective gene and subsequent volatile (methyl benzoate or benzyl benzoate) in the T1 generation. Recent discussions have concluded that the overexpressing of native genes via genomic DNA could be a more effective mode of overexpressing target petunia genes in petunia (Klee, personal communication) Experimental Procedures Generation of PhBPBT and PhBSMT Overexpression Transgenic Petunia The PhBSMT1 and PhBPBT complete open reading frames were isolated from via One-Step RT-PCR (Qiagen), and ligated downstream of the pFMV (Richins et al., 1987) constitutive promoter and upstream of the nopaline synthase (NOS) 3 terminator sequence. The subsequent RNAi construct was sub-cloned into a binary transformation vector containing the kanamycin resistance gene, neomycin phosphotransferase(NPTII), and mated with Agrobacterium tumefaciens strain ABI. Six week old MD leaves were transformed as previously described (Jorgenson et al., 1996), and primary transformants were recovered, transferred to soil, and grown to maturity. Volatile Emission T0 transgenic petunias were screened for increased methylbenzoate (PhBSMTOE) or benzylbenzoate (PhBPBTOE) emission. Three to five flowers (at anthesis) were collected from each transgenic plant along with 3 MD plants at Zeitgeber time (ZT) 13, and analyzed as previously described (Underwood et al., 2005). Four sets of 3-5 flowers

PAGE 112

100 (at anthesis) from T1 PhBPBTOE petunia with increased PhBPBT transcript levels were collected at ZT 13 and analyzed as previously described (Underwood et al., 2005). Expression Analysis To determine PhBPBT transcript levels in T1 PhBPBTOE plants, RNA was extracted from whole flower (at anthesis) corolla tissue collected at 13 ZT and analyzed via real-time RT-PCR as previously described (Chapter 2).

PAGE 113

101 Table B-1. Analysis of PhBSMTOE and PhBPBTOE transgenic petunia GenerationPhBSMTOEPhBPBTOET0# of plants4644Co-Suppressed Lines98Lines with Increased Volatile Emission33T13:1 Segregating Lines Identified48Lines OverexpressingTranscript03Lines with Increased Volatile Emission00

PAGE 114

LIST OF REFERENCES Abeles F.B., Morgan P.W., Saltveit M.E. (1992) Ethylene in Plant Biology, Second Edition, Academic Press Inc., New York. Adams S., Weidenborner M. (1996) Mycelial deformations of Cladosporium herbarum due to the application of eugenol or carvacol. J Essent Oil Res, 8, 535-540. Aharoni A, Giri A.P., Deuerlein S., Griepink F., de Kogel W.J., Verstappen F.W., Verhoeven H.A., Jongsma M.A., Schwab W., Bouwmeester H.J. (2003) Terpenoid metabolism in wild-type and transgenic Arabidopsis plants. Plant Cell, 15, 12, 2866-2884. Ament K., Kant M.R., Sabelis M.W., Haring M.A., Schuurink R.C. (2004) Jasmonic acid is a key regulator of spider mite-induced volatile terpenoid and methyl salicylate emission in tomato. Plant Physiol, 135, 4, 2025-2037. Baker H.G. (1961) The adaptation of flowering plants to nocturnal and crepuscular pollinators. The Quarterly Review of Biology, 36, 1, 64-73. Baldwin I.T. (1998) Jasmonate-induced responses are costly but benefit plants under attack in native populations. Proc Natl Acad Sci (USA), 95, 8113-8118. Beekwilder J., Alvarez-Huerta M., Neef E., Verstappen F.W., Bouwmeester H.J., Aharoni A. (2004) Functional characterization of enzymes forming volatile esters from strawberry and banana. Plant Physiol, 135, 4, 1865-1878. Bleecker A.B., Kende H. (2000) Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol, 16, 1-18. Boatright J. (2000) Transcriptional regulation of PHACO1 in Petunia hybrida. Ph.D. Dissertation, Purdue University. West Lafayette, Indiana. Boatright J., Negre F, Chen X., Kish C.M., Wood B., Peel G., Orlova I., Gang D., Rhodes D., Dudareva N. (2004) Understanding in vivo benzenoid metabolism in petunia petal tissue. Plant Physiol, 135, 4, 1993-2011. Boller T., Kende H. (1980) Regulation of wound ethylene synthesis in plants. Nature, 256, 259-260. 102

PAGE 115

103 Bouquin T., Lasserre E., Pradier J., Pech J.C., Balague C. (1997) Wound and ethylene induction of the ACC oxidase melon gene CM-ACO1 occurs via two direct and independent transduction pathways. Plant Mol Biol, 35, 6, 1029-35. Bradford M.M. (1976) A rapid and sensitive for the quantitation of microgram quantitites of protein utilizing the principle of protein-dye binding. Anal Biochem, 72, 248-254. Buse E.L., Laties G.G. (1993) Ethylene-mediated posttranscriptional regulation in ripening Avocado (Persea americana) mesocarp discs. Plant Physiol, 102, 2, 417-423. Cauthen W.L., Hester W.H. (1989) Accidental ingestion of oil of wintergreen. J Fam Pract, 29, 680-681. Cheong J.J., Choi Y.D. (2003) Methyl jasmonate as a vital substance in plants. Trends in Genetics, 19, 7, 409-414. Clark D.G., Gubrium E.K., Klee H.J., Barrett J.E. and Nell T.A. (1999) Root formation in ethylene insensitive plants. Plant Physiol, 121, 53-59. Clevenger D.J., Barrett J.E., Klee H.J. and Clark D.G. (2004) Factors affecting seed production in transgenic ethylene-insensitive petunias. J. Amer. Soc. Hort. Sci, 129, 3, 401-406. Czernic P., Huang H.C., Marco Y. (1996) Characterization of hsr201 and hsr515, two tobacco genes preferentially expressed during the hypersensitive reaction provoked by phytopathogenic bacteria. Plant Mol Biol, 31, 2 255-265. D'Auria J.C. (2006) Acyltransferases in plants: a good time to be BAHD. Curr Opin Plant Biol, 9, 3, 1-40. D'Auria J.C., Chen F., Pichersky E. (2002) Characterization of an acyltransferase capable of synthesizing benzylbenzoate and other volatile esters in flowers and damaged leaves of Clarkia breweri. Plant Physiol, 130, 1, 466-476. Dimri U., Sharma M.C. (2004) Effects of sarcoptic mange and its control with oil of Cedrus deodara, Pongamia glabra, Jatropha curcas and benzyl benzoate, both with and without ascorbic acid on growing sheep: assessment of weight gain, liver function, nutrient digestibility, wool production and meat quality. J Vet Med A Physiol Pathol Clin Med, 51, 2, 79-84. Dixon, R.A., Paiva, N.L. (1995) Stress-induced phenylpropanoid metabolism. Plant Cell, 7, 1085. Dudareva N., DAuria J.C., Nam K.H., Raguso R.A., Pichersky E. (1998a) Acetyl-CoA: benzyl alcohol acetyltransferase -an enzyme involved in floral scent production in Clarkia breweri. Plant J, 14, 297-304.

PAGE 116

104 Dudareva N., Murfitt L.M. Mann C.G., Gorenstein N., Kolosova N., Kish C.M., Bonham C.,Wood K. (2000) Developmental regulation of methyl benzoate biosynthesis and emission in snapdragon flowers. Plant Cell, 12, 949-961. Dudareva N., Pichersky E. (2000) Biochemical and molecular genetic aspects of floral scents. Plant Physiol, 122, 3, 627-633. Dudareva N., Raguso R.A., Wang J., Ross J.R., Pichersky E. (1998b) Floral scent production in Clarkia breweri. III. Enzymatic synthesis and emission of benzenoid esters. Plant Physiol, 116, 2, 599-604. Effmert U., Saschenbrecker S., Ross J., Negre F., Fraser C.M., Noel JP., Dudareva N., Piechulla B. (2005) Floral benzenoid carboxyl methyltransferases: from in vitro to in planta function. Phytochemistry, 66, 11, 1211-1230. Farmer E.E., Almeras E., Krishnamurthy V. (2003) Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Curr Opin Plant Biol, 6, 372378. Farmer E.E., Ryan C.A. (1990) Interplant communication: Airborne methyl jasmonate induces synthesis of proteinase inhibitors in plant leaves. Natl Acad Sci (USA), 87, 7713-7716. Gang D.R. (2005) Evolution of flavors and scents. Annu Rev Plant Biol, 56, 301-25. Gomez A.M. (1996) Regulation and function of 1-aminocyclopropane-1-carboxylate oxidase in Petunia hybrida. Ph.D. Dissertation, Purdue University. West Lafayette, Indiana. Griesbach R.J., Kamo K.K. (1996) The effect of induced polyploidy on the flavonols of Petunia Mitchell. Phytochemistry, 42, 361-363. Gubrium E.K., D.G. Clark, J.E. Barrett and T.A. Nell. (2000) Horticultural performance of transgenic ethylene insensitive petunias. J Amer Soc Hort Sci, 125, 277-281. Guo H., Ecker J.R. (2004) The ethylene signaling pathway: new insights. Curr Opin Plant Biol, 7, 1, 40-49. Guterman I., Masci T., Chen X., Negre F., Pichersky E., Dudareva N., Weiss D., Vainstein A. (2006) Generation of phenylpropanoid pathway-derived volatiles in transgenic plants: rose alcohol acetyltransferase produces phenylethyl acetate and benzyl acetate in petunia flowers. Plant Mol Biol, 60, 4, 555-563.

PAGE 117

105 Guterman I., Shalit M., Menda N., Piestun D., Dafny-Yelin M., Shalev G., Bar E., Davydov O., Ovadis M., Emanuel M., Wang J., Adam Z., Pichersky E., Lewinsohn E. Zamir D., Vainstein A., Weiss D. (2002) Rose scent: Genomics approach to discovering novel floral fragrance-related genes. Plant Cell, 14, 2325-2338. Harju A.T., Pennanen S.M., Liesivuori J. (2004) The efficacy of benzyl benzoate sprays in killing the storage mite Tyrophagus putrescentiae (Acari: Acaridae). Ann Agric Environ Med, 11, 1, 115-119. Hatanaka A. (1993) The biogeneration of green odour by green leaves. Phytochemistry, 34, 1201-1218. Herrmann K.M.; WeaverL.M. (1999) The shikimate pathway. Ann Rev of Plant Phys Mol Bio, 50, 1, 473-504. Hoballah M.E., Stuurman J., Turlings T.C., Guerin P.M., Connetable S., Kuhlemeier C. (2005) The composition and timing of flower odour emission by wild Petunia axillaris coincide with the antennal perception and nocturnal activity of the pollinator Manduca sexta. Planta, 222, 1, 141-150. Hoekstra F.A., Weges R. (1986) Lack of control by early pistillated ethylene of the accelerated wilting of Petuniahybrida flowers. Plant Physiol, 80, 403-408. Hoffmann L., Maury S., Martz F., Geoffroy P., Legrand M. (2003) Purification, cloning, and properties of an acyltransferase controlling shikimate and quinate ester intermediates in phenylpropanoid metabolism. J Biol Chem, 278, 1, 95-103. Hoffman N.E. Yang S.F. (1981) Conversion of 1-aminocyclopropane 1-carboxylic acid to ethylene by plant tissues: Conversion of stereoisomers 1-amino-2-ethylcyclopropane 1-carboxylic acid to 1-butene. Plant Physiol, 67, S51. Holden M.J., Marty J.A., Singh-Cundy A. (2003) Pollination-induced ethylene promotes the early phase of pollen tube growth in Petunia inflata. J Plant Physiol, 160, 3, 261-269. Jones H.D. (1984) Phenylalanine ammonia lyase: Regulation of its induction and its role in plant development. Phytochemisty, 23, 1349-1359. Jones M.L., Langston B.J., Johnson F. (2003) Pollination-induced senescence of ethylene sensitive and insensitive petunias. In Biology and Biotechnology of the Plant Hormone Ethylene III (Vendrell, M, Klee, H, Pech, JC, Romojaro, F, eds.), IOS Press, Amsterdam, The Netherlands, 324-326. Jorgensen R.A., Cluster P.D., English J., Que Q.D., Napoli C.A. (1996) Chalcone synthase cosuppression phenotypes in petunia flowers: Comparison of sense vs antisense constructs and single-copy vs complex T-DNA sequences. Plant Mol Biol, 31, 957973.

PAGE 118

106 Kaminaga Y., Schnepp J., Peel G., Schnepp J., Kish C.M., Ben-Nissan G., Weiss D., Orlova I., Lavie O., Rhodes D., Wood K., Marshall Porterfield D., Cooper A.J.L., Schloss J.V., Pichersky E., Vainstein A., Dudareva N. (2006) Phenylacetaldehyde synthase from Petunia hybrida is a bifunctional enzyme that catalyzes the efficient coupling of phenylalanine decarboxylation to phenylalanine oxidation. J Biol Chem, in press. Karapinar M., Aktug S. (1987) Inhibition of foodborne pathogens by thymol, eugenol, methnol, and anethol. Int J Food Micro, 4, 161-166. Kato M., Hayakawa Y., Hyodo H., Ikoma Y., Yano M. (2000) Wound-induced ethylene synthesis and expression and formation of 1-aminocyclopropane-1-carboxylate (ACC) synthase, ACC oxidase, phenylalanine ammonia-lyase, and peroxidase in wounded mesocarp tissue of Cucurbita maxima. Plant Cell Physiol, 41, 4, 440-447. Kende H., Boller T. (1981) Wound ethylene and I-aminocyclopropanel-carboxylate synthase in ripening tomato fruit. Planta, 151, 476-488. Kessler A., Baldwin I.T. (2001) Defensive function of herbivore-induced plant volatile emissions in nature. Science, 291, 2141. Knaggs A.R. (2001) The biosynthesis of shikimate metabolites. Nat Prod Rep, 18, 3, 334-355. Knudsen J.T., Tollsten L., Bergstrom L.G. (1993) Review article number 76 Floral scents a checklist of volatile compounds isolated by head-space techniques. Phytochemistry, 33, 253-280. Koeduka T., Fridman E., Gang D.R., Vasso D.G., Kackson B.L., Kish C.M., Orlova I., Spassova S.M. Lewis N.G., Noel J.P., Baiga T.J., Dudareva N., Pichersky E. (2006) Eugenol and isoeugenol, characteristic aromatic constituents of spices, are biosynthesized via reduction of a coniferyl alcohol ester. Proc Natl Acad Sci (USA), 103, 10128-10133. Kolosova N., Gorenstein N., Kish C.M., Dudareva N. (2001) Regulation of circadian methyl benzoate emission in diurnally and nocturnally emitting plants. Plant Cell, 13, 2333-2347. Langston B.J., Bai S., Jones M.L. (2005) Increases in DNA fragmentation and induction of a senescence-specific nuclease are delayed during corolla senescence in ethylene-insensitive (etr1-1) transgenic petunias. J Exp Bot, 56, 409, 15-23. Larsson M.C., Stensmyr M.C., Bice S.B., Hansson B.S. (2003) Attractiveness of fruit and flower odorants detected by olfactory receptor neurons in the fruit chafer Pachnoda marginata. J Chem Ecol, 29, 5, 1253-1268.

PAGE 119

107 Lavy M., Zuker A., Lewinsohn E., Larkov O., Ravid U., Vainstein A., Weiss D. (2002) Linalool and linalool oxide production in transgenic carnation flowers expressing the Clarkia breweri linalool synthase gene. Mol Breeding, 9, 103-111. Lawless H.T., Heyman H. (1998) Sensory Evaluation of Food Principles and Practices, Chapman and Hall Publishers, New York, New York, 116-139. Leon J., Rojo E., Sanchez-Serrano J.J. (2001) Wound signalling in plants. J Exp Bot, 52, 354, 1-9. Liu D., Li N., Dube S., Kalinski A., Herman E., Matoo A.K. (1993) Molecular characterization of a rapidly and transiently wound-induced soybean (Glycine max L.) gene encoding 1-aminocyclopropane-1-carboxylate synthase. Plant Cell Physiol, 34, 1151. Lucker J., Bouwmeester H.J., Schwab W., Blaas J., van der Plas L.H.W., Verhoeven H.A.(2001) Expression of Clarkia S-linalool synthase in transgenic Petunia plants results in the accumulation of S-linalyl-beta-D-glucopyranoside. Plant J, 27, 315-324. Ma X., Koepke J., Bayer A., Fritzsch G., Michel H., Stockigt J. (2005) Crystallization and preliminary X-ray analysis of native and selenomethionyl vinorine synthase from Rauvolfia serpentina. Acta Crystallogr D Biol Crystallogr, 6, 694-696. Mitchell A.Z., Hanson M.R., Skvirsky R.C., Ausubel F.M. (1980) Anther culture of Petunia genotypes with high-frequency of callus, root, or plantlet formation. ZPflanzenphysiol, 100, 131-146. Negre F., Kish C.M., Boatright J., Underwood B., Shibuya K., Wagner C. Clark D.G., Dudareva N. (2003) Regulation of methylbenzoate emission after pollination in snapdragon and petunia flowers. Plant Cell, 15, 12, 2992-3006. Negre F., Kolosova N., Knoll J., Kish C.M., Dudareva N. (2002) Novel S-adenosyl-L-methionine:salicylic acid carboxyl methyltransferase, an enzyme responsible for biosynthesis of methyl salicylate and methyl benzoate, is not involved in floral scent production in snapdragon flowers. Arch Biochem Biophys, 406, 261-270. O'Donnell P.J., Calvert C., Atzorn R., Wasternack C., Leyser H.M.O., Bowles D.J. (1996) Ethylene as a signal mediating the wound response of tomato plants science. Science, 274, 1914-1917. Omura H., Honda K. (2005) Priority of color over scent during flower visitation by adult Vanessa indica butterfies. Oecologia, 142, 588-596. Oyama-Okubo N., Ando T., Watanabe N., Marchesi E., Uchida K., Nakayama M. (2005) Emission mechanism of floral scent in Petunia axillaris. Biosci Biotechnol Biochem, 69, 4, 773-777.

PAGE 120

108 Pichersky E., Gershenzon J. (2002) The formation and function of plant volatiles: perfumes for pollinator attraction and defense. Curr Op in Plant Bio, 5, 237-243. Pichersky E., Lewinsohn E., Croteau R. (1995) Purification and characterization of linalool synthase an enzyme involved in the production of floral scent in Clarkia breweri. Arch Biochem Biophys, 316, 803-807. Pichersky E., Noel J.P., Dudareva N. (2006) Biosynthesis of plant volatiles: Natures diversity and ingenuity. Science, 311, 808-811. Pichersky E., Raguso R.A., Lewinsohn E., Croteau R. (1994) Floral Scent Production in Clarkia (Onagraceae) (I. Localization and Developmental Modulation of Monoterpene Emission and Linalool Synthase Activity). Plant Physiol, 106, 4, 1533-1540. Piechulla B., Pott M.B. (2003) Plant scents--mediators of inter-and intraorganismic communication. Planta, 217, 5, 687-689. Pott M.B., Hippauf F., Saschenbrecker S., Chen F., Ross J., Kiefer I., Slusarenko A., Noel J.P., Pichersky E., Effmert U., Piechulla B. (2004) Biochemical and structural characterization of benzenoid carboxyl methyltransferases involved in floral scent production in Stephanotis floribunda and Nicotiana suaveolens. Plant Physiol, 135, 4, 1946-55. Raguso R.A., Levin R.A., Foose S.E., Holmberg M.W., McDade L.A. (2003) Fragrance chemistry, nocturnal rhythms and pollination "syndromes" in Nicotiana. Phytochemistry, 63, 265-284. Raguso R.A., Pichersky E. (1995) Floral volatiles from Clarkia breweri and C. concinna (Onagraceae) recent evolution of floral scent and moth pollination. Plant Syst Evol, 194, 55-67. Raguso, R.A., and Willis M.A. (2002) Synergy between visual and olfactory cues in nectar feeding by naive hawkmoths. Animal Behaviour, 63, 685-695. Reinhard J., Srinivasan M.V., Zhang S. (2006) Scent-triggered navigation in honeybees. Nature, 427, 411. Richins R.D., Scholthof H.B., Shepard R.J. (1987) Sequence of Figwort Mosaic Virus DNA (Caulimovirus group). Nucleic Acids Res, 15, 8451-8466. Rojo E., Len J., Sanchex-Serrano J.J. (1999) Cross-talk between wound-signaling pathways determines local versus systemic gene expression in Arabidopsis thaliana. Plant J, 20, 135. Ryan C.A., Moura D.S. (2002) Systemic wound signaling in plants. A new prospective. Proc Natl Acad Sci (USA), 99, 10, 6519-6520.

PAGE 121

109 St. Pierre B., De Luca V. (2000) Evolution of acyltransferase genes: origin and diversification of the BAHD superfamily of acyltransferases involved in secondary metabolism. Rec Adv Phytochem, 34, 285-315. Saltveit M.E., Dilley D.R. (1979) Studies of rapidly induced wound ethylene synthesis by excised sections of etiolated Pisum sativum L., cv. Alaska: IV. requirement of a water-soluble, heat-stable factor. Plant Physiol, 64, 3, 417-420. Schaller G.E., Bleecker A.B. (1995) Ethylene binding sites generated in yeast expressing the Arabidopsis ETR1 gene. Science, 270, 1809-1811. Schiestl F.P., Ayasse M. (2001) Post-pollination emission of a repellent compound in asexually deceptive orchid: a new mechanism for maximizing reproductive success? Oecologia, 126, 531-534. Schmelz E.A., Alborn H.T., Tumlinson J.H. (2001) The influence of intact-plant and excised-leaf bioassay designs on volicitinand jasmonic acid-induced sesquiterpene volatile release in Zea mays. Planta, 214, 2, 171-179. Schmelz E.A., Engelberth J., Tumlinson J.H., Block A., Alborn H.T. (2004) The use of vapor phase extraction in metabolic profiling of phytohormones and other metabolities. Plant J, 39, 5, 790-808. Schuurink R.C., M.A. Haring and D.G. Clark 2006. Regulation of volatile benzenoid biosynthesis in petunia flowers. Trends in Plant Science, 11, 20-25. Seo H.S., Song J.T., Cheong J.J., Lee Y.H., Lee Y.W., Hwang I., Lee J.S., Choi Y.D. (2001) Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proc Natl Acad Sci U S A, 98, 8, 4788-93. Shalit M., Guterman I., Volpin H., Bar E., Tamari T., Menda N., Adam Z., Zamir D., Vainstein A., Weiss D. (2003)Volatile ester formation in roses. Identification of an acetyl-coenzyme A geraniol/ citronellol acetyltransferase in developing rose petals. Plant Physiol, 131, 1868-1876. Shields V.D.C., Hildebrand J.G. (2001) Responses of a population of antennal olfactory receptor cells in the female moth Manduca sexta to plant-associated volatile organic compounds. J Comp Physiol A, 186, 1135-1151. Silverman P., Raskin I. (1997) Airborne signaling by methyl salicylate in plant pathogen resistance. Nature, 385, 718. Tang X.Y., Woodson W.R. (1996) Temporal and spatial expression of 1-aminocyclopropane -1-carboxylate oxidase mRNA following pollination of immature and mature petunia flowers. Plant Physiol, 112, 503-511. Theis T. (2006) Fragrance of Canada Thistle (Cirsium arvense) attracts both floral herbivores and pollinators. J Chem Ecol, 32, 917.

PAGE 122

110 Tieman D.M., Taylor M.G., Schauer N., Fernie A.R., Hanson A.D., Klee H.J. (2006) Tomato aromatic amino acid decarboxylases participate in synthesis of the flavor volatiles 2-phenylethanol and 2-phenylacetaldehyde. Proc Natl Acad Sci (USA), 103, 8287-8292. Underwood B.A. (2003) Effects of ethylene on floral fragrance of Petunia x hybrida Mitchell Diploid. Ph.D. Dissertation, University of Florida. Gainesville, Florida. Underwood B.A., Tieman D.M., Shibuya K., Dexter R.J., Loucas H.M., Simkin A.J., Sims C.A., Schmelz E.A., Klee H.J., Clark D.G. (2005) Ethylene-regulated floral volatile synthesis in petunia corollas. Plant Physiol, 138, 1, 255-266. van Kan J.C. (2006) Licensed to kill: The lifestyle of a necrotrophic plant pathogen. Trends in Plant Science, 11, 5, 247-253. van Schie C.C., Haring M.A., Schuurink R.C. (2006) Regulation of terpenoid and benzenoid production in flowers. Curr Opin Plant Biol, 9, 2, 203-208. Verdonk J.C., de Vos C.H.R., Verhoeven H.A., Haring M.A., van Tunen A.J., Schuurink R.C. (2003) Regulation of floral scent production in petunia revealed by targeted metabolomics. Phytochemistry, 62, 997-1008. Verdonk J.C., Haring M.A., Tunen A.J., Schurrink R.C. (2005) ODORANT1 regulates fragrance biosynthesis in petunia flowers. Plant Cell, 17, 5, 1612-1624. Wang J.H., Pichersky E. (1998) Characterization of S-adenosyl-L-methionine: (iso)eugenol O-methyltransferase involved in floral scent production in Clarkia breweri. Arch Biochem Biophys, 349, 153-160. Wang K.L., Li H., Ecker J.R. (2002) Ethylene biosynthesis and signaling networks. Plant Cell, 14, S131-51. Wasternack C., Stenzel I., Hause B., Hause G., Kutter C., Maucher H., Neumerkel J., Feussner I., Miersch O. (2006) The wound response in tomato-role of jasmonic acid. J Plant Physiol, 163, 3, 297-306. Weaver L.M., Herrmann K.M. (1997) Dynamics of the shikimate pathway in plants. Trends in Plant Sci, 2, 9, 346-351. Wilkinson J.Q., Lanahan M.B., Clark D.G., Bleecker A.B., Chang C., Meyerowitz E.M., Klee H.J. (1997) A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in heterologous plants. Nat Biotech, 15, 444-447. Yang Q., Reinhard K., Schiltz E., Matern U. (1997) Characterization and heterologous expression of hydroxycinnamoyl/benzoyl-CoA:anthranilate N-hydroxycinnamoyl/benzoyltransferase from elicited cell cultures of carnation, Dianthus caryophyllus L. Plant Mol Biol, 6, 777-789.

PAGE 123

BIOGRAPHICAL SKETCH Richard James Dexter was born in Orlando, Florida on May 16, 1980. There his mother and father (Mary Irene and Jim Dexter) raised him and his younger brother, Patrick. Throughout his childhood, Rick enjoyed many outdoor activities including soccer, basketball, and trips to the beach. After high school, Rick attended the University of Florida, where he earned a bachelors degree in microbiology and cell science, with a minor in botany. During his undergraduate work, Rick found his love for plant molecular and cellular biology while volunteering and working in the labs of Dr. Rex Smith (Agronomy) and Dr. David Clark (Environmental Horticulture). After graduation, Rick joined the Plant Molecular and Cellular Biology Ph.D. Program, where he continued his work with Dr. David Clark, studying the regulation of floral volatile biosynthesis in Petunia x hybrida cv Mitchell Diploid. On June 11, 2005, Rick married his high school sweetheart, Stephanie, a dental student at the University of Florida, and they look forward to a happy life together with their two dogs, Misty and Carley. 111