Citation
Molecular Engineering of Nucleic Acid Probes for Intracellular Imaging and Bioanalysis

Material Information

Title:
Molecular Engineering of Nucleic Acid Probes for Intracellular Imaging and Bioanalysis
Creator:
YANG, CHAOYONG JAMES ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Beacons ( jstor )
DNA ( jstor )
Excimers ( jstor )
Fluorescence ( jstor )
Molecules ( jstor )
Nucleic acids ( jstor )
Oligonucleotides ( jstor )
Polymers ( jstor )
Quenching ( jstor )
Signals ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Chaoyong James Yang. Permission granted to University of Florida to digitize and display this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
10/10/2006
Resource Identifier:
477327445 ( OCLC )

Downloads

This item has the following downloads:

yang_c ( .pdf )

yang_c_Page_094.txt

yang_c_Page_038.txt

yang_c_Page_044.txt

yang_c_Page_082.txt

yang_c_Page_031.txt

yang_c_Page_124.txt

yang_c_Page_163.txt

yang_c_Page_122.txt

yang_c_Page_056.txt

yang_c_Page_176.txt

yang_c_Page_165.txt

yang_c_Page_025.txt

yang_c_Page_189.txt

yang_c_Page_113.txt

yang_c_Page_111.txt

yang_c_Page_008.txt

yang_c_Page_032.txt

yang_c_Page_023.txt

yang_c_Page_180.txt

yang_c_Page_151.txt

yang_c_Page_026.txt

yang_c_Page_097.txt

yang_c_Page_197.txt

yang_c_Page_194.txt

yang_c_Page_173.txt

yang_c_Page_129.txt

yang_c_Page_140.txt

yang_c_Page_202.txt

yang_c_Page_063.txt

yang_c_Page_179.txt

yang_c_Page_118.txt

yang_c_Page_181.txt

yang_c_Page_037.txt

yang_c_Page_084.txt

yang_c_Page_135.txt

yang_c_Page_185.txt

yang_c_Page_110.txt

yang_c_Page_119.txt

yang_c_Page_062.txt

yang_c_Page_002.txt

yang_c_Page_132.txt

yang_c_Page_009.txt

yang_c_Page_166.txt

yang_c_Page_022.txt

yang_c_Page_120.txt

yang_c_Page_042.txt

yang_c_Page_057.txt

yang_c_Page_098.txt

yang_c_Page_054.txt

yang_c_Page_069.txt

yang_c_Page_085.txt

yang_c_Page_012.txt

yang_c_Page_171.txt

yang_c_Page_178.txt

yang_c_Page_182.txt

yang_c_Page_053.txt

yang_c_Page_092.txt

yang_c_Page_045.txt

yang_c_Page_078.txt

yang_c_Page_116.txt

yang_c_Page_159.txt

yang_c_Page_158.txt

yang_c_Page_152.txt

yang_c_Page_024.txt

yang_c_Page_017.txt

yang_c_Page_036.txt

yang_c_Page_061.txt

yang_c_Page_107.txt

yang_c_Page_003.txt

yang_c_Page_127.txt

yang_c_Page_005.txt

yang_c_Page_001.txt

yang_c_Page_184.txt

yang_c_Page_187.txt

yang_c_Page_162.txt

yang_c_Page_039.txt

yang_c_Page_154.txt

yang_c_Page_134.txt

yang_c_Page_066.txt

yang_c_Page_191.txt

yang_c_Page_149.txt

yang_c_Page_137.txt

yang_c_Page_077.txt

yang_c_Page_089.txt

yang_c_Page_076.txt

yang_c_Page_192.txt

yang_c_Page_010.txt

yang_c_Page_153.txt

yang_c_Page_051.txt

yang_c_Page_095.txt

yang_c_Page_168.txt

yang_c_Page_199.txt

yang_c_Page_143.txt

yang_c_Page_091.txt

yang_c_Page_186.txt

yang_c_Page_138.txt

yang_c_Page_013.txt

yang_c_Page_147.txt

yang_c_Page_183.txt

yang_c_Page_164.txt

yang_c_Page_071.txt

yang_c_Page_109.txt

yang_c_Page_041.txt

yang_c_Page_029.txt

yang_c_Page_080.txt

yang_c_Page_007.txt

yang_c_Page_064.txt

yang_c_Page_101.txt

yang_c_Page_136.txt

yang_c_Page_188.txt

yang_c_Page_130.txt

yang_c_Page_021.txt

yang_c_Page_114.txt

yang_c_Page_150.txt

yang_c_Page_016.txt

yang_c_Page_081.txt

yang_c_Page_043.txt

yang_c_Page_108.txt

yang_c_Page_100.txt

yang_c_Page_093.txt

yang_c_Page_193.txt

yang_c_Page_170.txt

yang_c_Page_131.txt

yang_c_Page_157.txt

yang_c_Page_200.txt

yang_c_Page_117.txt

yang_c_Page_030.txt

yang_c_Page_112.txt

yang_c_Page_033.txt

yang_c_Page_115.txt

yang_c_Page_028.txt

yang_c_Page_074.txt

yang_c_Page_087.txt

yang_c_Page_156.txt

yang_c_Page_049.txt

yang_c_Page_059.txt

yang_c_Page_055.txt

yang_c_Page_133.txt

yang_c_Page_201.txt

yang_c_Page_047.txt

yang_c_Page_175.txt

yang_c_Page_105.txt

yang_c_Page_102.txt

yang_c_Page_148.txt

yang_c_Page_015.txt

yang_c_Page_073.txt

yang_c_Page_006.txt

yang_c_Page_090.txt

yang_c_Page_072.txt

yang_c_Page_046.txt

yang_c_Page_139.txt

yang_c_Page_177.txt

yang_c_Page_174.txt

yang_c_Page_060.txt

yang_c_Page_004.txt

yang_c_Page_035.txt

yang_c_Page_190.txt

yang_c_Page_128.txt

yang_c_Page_050.txt

yang_c_Page_155.txt

yang_c_Page_048.txt

yang_c_Page_144.txt

yang_c_Page_096.txt

yang_c_Page_068.txt

yang_c_Page_123.txt

yang_c_Page_070.txt

yang_c_Page_169.txt

yang_c_Page_145.txt

yang_c_pdf.txt

yang_c_Page_172.txt

yang_c_Page_161.txt

yang_c_Page_018.txt

yang_c_Page_034.txt

yang_c_Page_014.txt

yang_c_Page_141.txt

yang_c_Page_198.txt

yang_c_Page_058.txt

yang_c_Page_027.txt

yang_c_Page_020.txt

yang_c_Page_052.txt

yang_c_Page_125.txt

yang_c_Page_121.txt

yang_c_Page_079.txt

yang_c_Page_019.txt

yang_c_Page_167.txt

yang_c_Page_011.txt

yang_c_Page_196.txt

yang_c_Page_065.txt

yang_c_Page_142.txt

yang_c_Page_088.txt

yang_c_Page_067.txt

yang_c_Page_086.txt

yang_c_Page_103.txt

yang_c_Page_106.txt

yang_c_Page_195.txt

yang_c_Page_075.txt

yang_c_Page_146.txt

yang_c_Page_160.txt

yang_c_Page_083.txt

yang_c_Page_104.txt

yang_c_Page_040.txt

yang_c_Page_126.txt

yang_c_Page_099.txt


Full Text












MOLECULAR ENGINEERING OF NUCLEIC ACID PROBES FOR
INTRACELLULAR IMAGING AND BIOANALYSIS















By

CHAOYONG JAMES YANG


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2006

































Copyright 2006

by

Chaoyong James Yang



























Dedicated to my wife Hui Lin.















ACKNOWLEDGMENTS

I am deeply indebted to a long list of people, without whom this dissertation would

not be possible. First, I wish to express my gratitude to my research advisor, Dr. Weihong

Tan. The advice and suggestions from Dr.Tan made my projects go more smoothly. The

encouragements and support he constantly delivered kept me studying. The help he

generously offered in different ways made life in a totally different country a lot easier.

Also, I thank Dr. Charles Martin, Dr. Leonid Moroz, Dr. Jon Stewart, and Dr.

James Winefordner, for having agreed to be part of my graduate committee. The advice,

assistance, and encouragement from my committee are highly appreciated.

This dissertation is a result of successful collaborations with scientists in different

areas. I would like to thank Dr. Kirk Schanze and his postdoc Dr. Mauricio Pinto for the

successful collaboration on the conjugated polymer project. I greatly appreciate Dr. Nick

Turro and his postdoc Dr. Steffen Jockush at Columbia University for working with us on

the excimer projects. I am very thankful for the critical comments and helpful discussions

from Dr. Leonid Moroz and Dr. Steve Benner on molecular beacon designs. I would like

to thank Ms. Lin Wang for her hard work on different productive side-projects. Karen

Martinez is acknowledged for working on the linear probe. I thank Dr. Marie Vicens for

working on the PDGF project. I also would like to thank Colin Medley for his help in

cellular imaging of LNA MBs and linear probes. Dr. Zunyi Yang's help in ion exchange

HPLC analysis is greatly appreciated. Finally, I am especially grateful to Josh Herr and

Patrick Colon for their research assistance.









The Tan research group is a great place to work in. The help and friendship from

former and current group members make my memory of Gainesville an enjoyable and

unforgettable one. I would like to thank Dr Jianwei Jeff Li, Dr. Kensuke Arai, Dr. Steven

Suljak, Dr. Gang Yao, Dr. Peng Zhang, Dr. Julia Xiaojun Zhao, Dr. Min Yang, Dr.

Swadeshmukul Santra, Dr. Shelly John, Dr. Hong Wang for their support and advice in

my research. I am also very thankful to Dr. Ruby Tapec-Dytioco, Dr. Monde

Qhobosheane, Dr. Zeihui Cao, Dr. Charles Lofton, Dr. Shangguan Dihua, Dr. Zhiwen

Tang, Dr. Lisa Hilliard, Dr. Timothy Drake, Dr. Marie Vicens, Alina Munteanu, Joshua

Smith, Karen Martinez, Prabodhika Mallikaratchy, Lin Wang, Li Tan, Colin Medley, Hui

Chen, Kwame Sefah, Dosung Sohn, Youngmi Sohn, EunJun Lee, Yanrong Wu, Huaizhi

Kang, Yan Chen, Wenjun Zhao, Meng Ling and O'Donoghue, Megan for their

friendship, encouragement, and help.

I am deeply indebted to my parents for their unconditional love, support, and

guidance. I thank my sister and brothers for their love and financial support over the

years.

I am extremely grateful to my wife, Hui Lin, for being a wonderful friend, helpful

colleague, and supportive spouse. It is her love, support, patience, care, encouragement,

motivation and assistance of all kind that enable me to succeed.

Last but not least, I thank my lovely baby daughter, Wendy, for bringing me

laughs, joy, cheer and inspiration everyday.
















TABLE OF CONTENTS



A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES .................................... ......... ........ ......... ................ .x

LIST OF FIGURE S ......... .................................... .. ...... ........... xi

ABSTRACT ............................... .............. xvi

CHAPTERS

1 IN TR OD U CTION .................. ............................ .. ............ .............. .

Probing Biom olecules in Living Cells................................... .........................
M olecular Engineering of Nucleic Acid Probes................................ ............... ..3
Chem ical Synthesis of N ucleic A cids...................................... ......................... 4
Fluorescence M ethods for Signal Transduction ........................................ ................7
Jablonski D iagram .................. ...... ........ ............ ...... .......... ........ .. .. 7
Fluorescence Q uenching ........................................ ............... .. ............... ..9
Fluorescence Resonance Energy Transfer ................ ............................... 11
Excited State D im er-Excim er............................................. ............ ............... 12
W working Principle of M Bs ........ ......... .................................. ............... 13
Using MBs for RNA Monitoring in Living Cells...................................................15
Aptamers and M olecular Aptamer Beacons.......................................... ......... ......21
Challenges of Using Nucleic Acid Probes for Intracellular Analysis ...................25
Scope of This R research ...................................... ................. ..... .... 26

2 DIRECT SYNTHESIS OF AN OLIGONUCLEOTIDE-POLY (PHENYLENE
ETHYNYLENE) CONJUGATE WITH A PRECISE ONE-TO-ONE
M O L E C U L A R R A T IO ................................................................... .....................27

In tro d u ctio n ........................................................................................................... 2 7
E xperim ental Section ............ .... ............................................................. ..... .... .. 30
C hem icals and R eagents.......................................................... ............... 30
Synthesis of PPE -D N A ................................................ ............................ 30
Instrum ents .............................. ....... ............ ........... .......... 3 1
Fluorescence Quenching Experim ents ..................................... .................32
R results and D discussion ............ .... ............ ..................... 32
Biofuctionalization of Conjugated Polymer PPE.................... ................32









Coupling of PPE Monomer and Oligomer to DNA ................. ............. .....34
DN A Hybridization Study .............................................................................. 37
Direct Synthesis of DNA-PPE with One-to-One Ratio.................. .......... 38
Design ofPPE-MB for Signal Amplification.......................................41
Selection of Quencher and Fluorescence Quenching Study.............................42
Synthesis of PPE-M B ........................................................45
C o n clu sio n s..................................................... ................ 4 7

3 MOLECULAR ASSEMBLY OF SUPERQUENCHERS IN SIGNALING
M OLECULAR INTERACTIONS ........................................ ........................ 49

In tro d u ctio n ........................................................................................................... 4 9
E xperim ental Section ............ ............................................................ ........ .. .... 50
M olecular B eacon Synthesis ........................................ .......................... 50
H ybridization of M B ........................ ......... .. ..... ............ 52
R results and D discussion ................................................. .................... ............. 52
Design of Multiple-Quencher MBs.............. .. ........... ................52
Internally Labeled Multiple-Quencher MBs .................................................55
MBs with 1, 2, 3 and 4 Internally Labeled Quenchers ....................................58
MBs with Externally Labeled Multiple Quenchers-Assembling of
Superquenchers ..... .......... ........... ..... .......... .................... .. 62
Superquenchers from Different Number and Types of Quenchers.................65
Superquencher Outperforms Gold Nanoparticle ..............................................70
Use of Superquencher for Molecular Probe Labeling............... ...................71
C o n clu sio n s..................................................... ................ 7 3

4 LIGHT SWITCHING EXCIMER PROBES FOR RAPID PROTEIN
MONITORING IN COMPLEX BIOLOGICAL FLUIDS......................................75

In tro d u ctio n .......................................................................................7 5
E xperim ental Section ............ ................................................................. ..... .... .. 78
C hem icals and R agents ......................................................................... ... .... 78
Instruments ................................................79
Synthesis and Purification ........................................................ ............. 80
Results and Discussion ...................................... ..................... .. .......... 81
Design Light Switching Excimer Aptamer Probe.............................................81
Synthesis of dual Pyrene A ptam er Probe ............................................................82
Light Switching Aptamer Probe for Real-time Rapid PDGF-BB Detection ......84
Optim ization of Aptam er Length ............................................. ......... .........88
S elective ity of th e P rob e ........................ ......................................... .....................90
Direct Quantitative Detection of PDGF in Cell Media ................ ............ 91
C o n clu sio n s.................................................... .................. 9 6

5 MOLECULAR ASSEMBLY OF LONG-LIFE TIME FLUOROPHORES FOR
BIOAN ALY SIS .................. ..................................................... 100

Introduction ...................................... ............................... .......... ...... 100









E x perim ental S section ................................................... ....................................... 10 1
M materials .................................................101
Instruments ......................... ................. 102
Synthesis of Excimer M Bs. ............. ................................ .................. 102
Quantum Yield M measurement .......................... .................. .. ............. 104
Results and D discussion ................................. ............. .. ...... .. .......... .. 104
Design of Excimer MBs ............ ..... ............. ............... 104
Synthesis of Excim er M B s ............. ..................... ................... ............. .. 107
Hybridization of Excimer MBs. ......................................... ............... 108
Time-Resolved Excimer Signaling Approach.............................. ................111
Tunable Intensity through Multiple Labeling.................................. ...............116
Effect of Multiple Pyrene on the Stability and Kinetic of MBs ...................18
C o n clu sio n s.................................................... ................ 12 0

6 SYNTHESIS AND INVESTIGATION OF LOCKED NUCLEIC ACID
MOLECULAR BEACONS................... ................. .................... 122

Introduction .................... ............ .... .................................. 122
M materials and M methods ........................................... ....................................... 125
Chemicals and Reagents.......... .......................... ............... .... 125
In stru m e n ts .................................................................................................. 12 5
M olecular B eacon Synthesis ........................................ ......... ............... 125
H ybridization Study............... .. .... .. .... ............ .............. ............. 126
DN ase I Sensitivity ......... .......... .................... ......... ... ...................... 126
RN ase H sensitivity ..................................... ...... ........ ....... ................. 126
Therm al Stability Studies ............................................................................ 127
Protein B finding Studies ......................................................... ............... 127
R results and D discussion ................ ....................... .... ..... ...... .. ............ 127
Investigating MBs with All Bases Constructed from LNA..............................127
Hybridization Kinetics of LNA-M Bs .......... ........... .........1.............32
Thermodynamics of LNA-M Bs ................................................... ............... 135
Elimination of Sticky-end Pairing in LNA-MB Hybridization......................136
Modified LNA-MBs Show Faster Hybridization Kinetics .............................141
Minimal Binding of Single Stranded Binding Protein with LNA-MB .............142
Effect of LNA on Ribonuclease H Activity ................................... ................144
C o n clu sio n s.................................................... ................ 14 7

7 HYBRID MOLECULAR PROBE FOR REAL-TIME NUCLEIC ACID
ANALYSIS IN BIOLOGICAL SAM PLES............................................................149

In tro d u ctio n ......................................................................................................... 14 9
E x perim ental S section ........................................................................ .................. 150
R results and D discussions ................................................. ...... ....... ... .. ........ .... 151
D esign of H ybrid M olecular Probes............................................................... 151
Hybridization of Hybrid M olecular Probe ................................... ............... 153
Optimization of PEG Linker Length................................. ............. ........... 155
Optimization of Acceptor-Donor Distance .......... ......................................... 158


viii









HMP for Surface DNA Hybridization Study. ................................................ 158
Comparison of Hybrid Molecular Probe with MBs .............. ................160
C o n clu sio n s.................................................... ................ 16 3

8 SUMMARY AND FUTURE DIRECTIONS................................... ... ..................165

Engineering Molecular Probes for Bioanlysis and Intracellular Imaging ...............165
Future D directions .................... ............... ...... ....... ............. 169
Exploration of New Materials for Signal Amplification..............................169
Development of New Probes with Better Stability, Selectivity and Kinectics .171

L IST O F R E F R E N C E S ......................................................................... ....................174

BIOGRAPHICAL SKETCH ................................. .................. ................ 185
















LIST OF TABLES


Table page

3-1 Sequences of M Bs synthesized in this study ...................................................... 51

3-2 Molecular beacon sequences ......... .. .................................. ... 70

4- 1 Probes and oligonucleotides used in PDGF binding study ....................................78

5-1 Quantum yields of multiple-pyrene labels ..... ............................117

6-1 Molecular beacons and oligonucleotides prepared in this study............................135

7-1 Sequences of HMP probes and MB MBTBL and their targets ...........................151

7-2 Target DNA sequence with different numbers of dT ................. ... ..................159
















LIST OF FIGURES


Figure page


1-1 Automated oligonucleotide synthesis achieved through phosphoramidite
chem istry ............................................................................. 5

1-2 A typical Jablonski diagram ................................................................................ .... 8

1-3 The schematic for the formation of pyrene excimer ..............................................13

1-4 W working principle of M B s. ............................................. ............................. 14

1-5 Simultaneous monitoring of multiple genes inside a living cell. ..........................20

1-6 Schematic presentation of a typical SELEX process. ............................................22

1-7 Signaling binding of aptam er to its target. ........................................ ....................24

2-1 Schematic representation of solid state synthesis of DNA-PPE conjugate.............33

2-2 Model molecules used to couple to 51-dU functionalized oligonucleotide..............34

2-3 The (-)ESI mass spectra of DNA-PPE monomer...................................................35

2-4 The negative ESI mass spectra of DNA-PPE oligomer .................. ........... ....36

2-5 The negative ESI mass spectra of control 16mer DNA. ................ ..................36

2-6 Fluorescence enhancement of the MB after addition of cDNAs.............................37

2-7 Fluorescence emission spectra of DNA-PPE, and the control solution .................39

2-8 Fluorescence emission of PPE in agarose gel stained with ethidium bromide ........40

2-9 Gel electrophoresis of PPE-DNA (1), PPE (2), and DNA (3) samples ..................41

2-10 Working principles of a MB and conjugated polymer labelled MB .....................42

2-11 Structures of some commonly used non-fluorescent quenchers for MB synthesis.....43

2-12 Stern-Volmer plot of PPE quenching by DABCYL.................... ...................44









2-13 The emission (left) and Stern-Volmer plot (right) of 3 [M PPE-S03 quenched
by various concentrations of Q SY -7 ............................................. .....................44

2-14 The structure of PPE-S03 low molecular weight PE-S03 and the Stern-Volmer
plot of 3 [M PE-S03 quenched by various concentrations of QSY-7 ....................45

2-15 Schematic representation of solid state synthesis of conjugated polymer labelled
M B ...................... .. .. ......... .. .. ................................................ . 4 6

2-16 Response of PPE labelled MB to its target DNA. MB sequence...........................46

3-1 Structure of an internal labeled three-quencher molecular beacon........................54

3-2 Structure of an end-labeled multiple-quencher MB ...................... ...............55

3-3 Signal enhancement of MB226 and Tri-Q MB..................................................56

3-4 M elting temperature curve of Tri-Q-M B. ........................................ .....................57

3-5 Response of 65nM Tri-Q MB to 325nM perfect matched DNA, single base
mismatched DNA and random sequence DNA..................................................... 58

3-6 Secondary structures of Single-Q-MB (a), Dual-Q-MB (b), Tri-Q-MB(c) and
Q u ad-Q -M B (d)....................................................................................... 59

3-7 HPLC profile of Single-Q-MB, Dual-Q-MB, Tri-Q-MB, and Quad-Q-MB ..........60

3-8 Fluorescent intensity of 65 nM MBs at close state and opened state 315nM
cDNA was used in the hybridization experiments. .............................................60

3-9 Signal enhancem ents of M B s........................................................ ............... 61

3-10 Structures of the dendrimeric linkers used to assemble multiple quenchers to the
end of molecular beacon sequences. ...................................................63

3-11 Signal enhancement of MB 3F51Dand MB 3F53D............... ..........................64

3-12 Response of 65nM MB 3F51D to matched DNA, single base mismatched DNA
and random sequence D N A ......................................................................... ....... 64

3-13 Melting temperature of a single-quencher MB and Triple-Quencher MB...............65

3-14 UV spectra of molecular beacons with different quencher molecules..................67

3-15 A460nm of same concentration of molecular beacons with different quencher
m o lecu le s.............................. ......................................................... ............... 6 7

3-16 Signal enhancements of MBs with different number of quenchers .......................68









3-17 Structures of a six-quencher MB and a three-quencher MB ................................68

3-18 TM R labeled superquencher M B ................................................. .....................69

3-19 Response of 65nM of Cy3 labeled Triple-Quencher MB to target DNA ................70

3-20 Camparison of SBRs of molecular beacons labeled with Superquencher to those
of MB labeled with normal quenchers) or gold nanoparticle..............................71

3-21 Response of a Superquencher labeled Aptamer Beacon to the addition of target
protein PD GF-BB .......... .. ..... ................................... ........ .... 72

4-1 Use of the pyrene excimer to probe PDGF ..... .............................82

4-2 Response of the excimer probe ES3 to different concentrations of PDGF-BB .......85

4-3 Real-time response of ES3 and two pyrene labeled control sequences to 50 nM
of PDGF-BB .............. .. ...... ............... ..... ........... ........... 86

4-4 The fluorescence ratio of excimer over monomer as a function of target protein
concentration ...................................................... ................. 87

4-5 Visual detection of 4 pico-mole PDGF-BB after illumination with an UV lamp....88

4-6 Secondary structures of PDGF aptamer probe ES6 and ES3..............................89

4-7 Fluorescence emission spectra of PDGF excimer probes with different stem
length in the absence of PDGF-BB ...............................................90

4-8 Responses of the excimer probe to BSA, LYS, HEM, MYO and THR and
different grow th factors ........................................................................... 91

4-9 Monitoring PDGF in dyed cell media........ ........................... ...............92

4-10 Time-resolved fluorescence spectra of 200 nM ES3 and 50 nM PDGF-BB in
cell media at different time windows after the excitation pulse ............................95

4-11 Fluorescence decays of cell media, 200 nM ES3 in cell media, and 200 nM ES3
with 50 nM PDGF-BB in cell media......................... ............... 95

4-12 Fluorescence decays of 200 nM ES3 in cell media with various concentrations
of PDGF-BB and the response of fluorescence intensity to the change of protein
concentration ..........................................................................96

4-13 Fluorescence emission spectra of human a-Thrombin aptamer excimer probe
with different concentration of human a-Thrombin and Real-time response of
human a-Thrombin aptamer excimer to the addition of target protein..................98









5-1 Schematic of a two-pyene beacon, MB-2P1D hybridization with complimentary
target D N A ...................................................... ................. 106

5-2 Absorption spectrum of DABCYL and emission spectrum of pyrene excimer in
w after. ............................................................................... 106

5-3 Synthesis of multiple-pyrene labeled molecular beacons .........................108

5-4 Emission spectra of 1 uM MB 2P1D with increasing concentrations of cDNA
(0-700nM ) in buffer solution....................................................... ............... 109

5-5 Hybridization kinetics of 100 nM MB2P1D with varying nucleic acid targets (1
u M ) .............................................................................................. 1 10

5-6 Structure and fluorescence emission of a macromolecule containing two pyrene
and one TMR molecules. ............. ................ ... ............... 11

5-7 Fluorescence decay of MB2P1D in the presence of 10-fold excess of target
D N A ...................................... .................................................. 1 12

5-8 Fluorescence emission of MB2P1D in cell media containing various
concentrations of target DNA. ........................................ ................. 113

5-9 Time resolved spectra of MB2P1D with 5x concentration of target in cell media.114

5-10 Fluorescence decay of 500 nM MB2P1D (blue) and MB2P1D with increase
concentration of cDNA in cell growth mediaat 480nm ............... .....................115

5-11 Quantum yields of multiple-pyrene labels. ........................................................... 117

5-12 Structure of Cacade Blue acetyl azide and its emission spectra at different
concentrations.................................................... .......................... ....... 118

5-13 Melting temperature of multiple pyrene molecular beacons ..............................119

5-14 Hybridization of MB4P1D and MB4P1D to excess of target DNA .................. 120

6-1 Structure of LNA and an LNA-MB ................................ ...............128

6-2 Melting curves for DNA and LNA MBs and hybridization of LNA-MB with
com plem entary target at 95 C ........................................ ......................... 129

6-3 Normalized hybridization kinetics of DNA and LNA MBs with perfectly
matched (PM) or single base mismatched (MM) targets ......................................130

6-4 Response of MBs to nuclease and single stranded binding protein ....................131

6-5 Hybridization of DNA-MB and LNA-MB to loop cDNA................................ 133









6-6 Hybridization of MB-LNA-E3 to loop cDNA and shared-stem cDNA...............137

6-7 Blocking LNA-MB sticky-end pairing with share-stem targets. .........................140

6-8 Hybridization of DNA-MB and LNA-MBs to shared-stem target sequences. ......141

6-9 Interactions between M Bs and SSBs.. ........................................ ...............143

6-10 Degradation of mRNA by RNase H............................................................. 145

6-11 Ion exchange HPLC to monitor the RNase H cleavage of RNA in LNA-MB-
E3/RNA duplex (left) and in DNA-MB/RNA (right). .........................................146

7-1 W working principle of a hybrid m olecular probe.....................................................152

7-2 Hybridization of 300nM of HMPTBL16 to 300nM of its Target DNA and
Control in 20mM Tris-HCl buffer............................................... ............... 154

7-3 Titration of 300 nM HMPTBL16 and 300 probes without a linker with target
D N A 20m M Tris-H C buffer ........................................ .......................... 156

7-4 Effect of spacer length on the hybridization of linear FRET probe to its target....157

7-5 Acceptor-donor distance optimization ....................................... ............... 158

7-6 Immobilization of hybrid molecular probe on solid surface for nucleic acid
d etectio n ........................................................................ 15 9

7-7 Hybridization of surface immobilized HMP to its target DNA ...........................160

7-8 Hybridization result of 300nM of MB and 300nM HMPTBL16 to same
concentration of their targets........................ ................... ................... 161

7-9 Response of 300nM HMP and 300 nM MBs to 300nM target cDNA and 3tg/ml
DNase in 20mM Tris-HCl buffer.................................. .... ................. 162

7-10 Response of MB and HMP to non-specific interactions...................................... 163

8-1 Structure of D-DNA and L-DNA ............................................... ......... ...... 172















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

MOLECULAR ENGINEERING OF NUCLEIC ACID PROBES FOR
INTRACELLULAR IMAGING AND BIOANALYSIS

By

Chaoyong James Yang

August 2006

Chair: Weihong Tan
Major Department: Chemistry

The ability to monitor biological processes in the context of living cells with good

spatial and temporal resolution offers significant potential for understanding many

biological problems. The key to the successful signaling of these processes is the use of

molecular probes. Currently, there are limitations for intracellular probes, which include

low sensitivity, reduced selectivity, and poor stability. The major goal of this research is to

integrate molecular engineering techniques with new signaling materials and approaches to

design more sensitive and effective nucleic acid probes.

In an attempt to develop sensitive molecular probes, novel materials were explored

for signal amplification and background reduction. Conjugated polymers (CPs) are good

candidates for signal amplification because of their excellent light harvesting and

superquenching properties. Using a solid phase synthesis method, CP labeled molecular

beacons (MBs) were prepared. In addition, superquenchers, a series of macromolecules









with exceptional quenching capabilities, were generated through a molecular assembling

approach and used for labeling MBs.

To overcome the problem of autofluorescence from biological fluids, a new

signaling approach called the excimer light switching signaling technique was developed.

An aptamer that selectively binds to platelet derived growth factor (PDGF) was labeled

with pyrene molecules on both ends, resulting in a light-switching aptamer. The probe

changes its emission from a blue monomer emission to a green excimer emission upon

binding to PDGF. Taking advantage of the long fluorescence lifetime of pyrene, time-

gated measurements were performed to eliminate biological background signals.

Finally, the stability and false signals of nucleic acid probes were addressed. When

used inside cells, normal nucleic acid probes are prone to enzymatic digestion, protein

binding, and elicitation of RNase H action, all of which lead to nonspecific signals. The

possibility of alleviating these issues by using locked nucleic acid (LNA) bases in the

molecular probe design was investigated. With different stem lengths and LNA base ratios,

LNA-MBs were designed and their thermodynamic properties, hybridization kinetics,

enzymatic resistance, as well as interactions with DNA binding proteins, were studied. In

addition to using base modification, we designed a new type of molecular probes called

hybrid molecular probe, which does not generate false signal upon digestion by nuclease,

binding to SSB. HMP is capable of selectively detecting targets from cellular samples.

The new materials, synthesis methods, and signaling techniques developed in this

research have the potential for developing sensitive and effective molecular probes for

bioanalysis and intracellular imaging. Future endeavors will include the application of

these probes to single living cell gene expression studies.


xvii














CHAPTER 1
INTRODUCTION

Probing Biomolecules in Living Cells

Selective probing of biological processes in living cells with good spatial and

temporal resolution offers significant potential for the understanding of many biological

phenomena. In the past decades, a great deal of information, such as the DNA double

helix structure, genomic sequences, protein structures, and enzymatic activities, have

been discovered by studying purified biomolecules extracted from cells or by studying

biomolecules using dead homogenized cells. This wealth of information gleaned from in

vitro study forms the foundation of molecular biology. However, it has become clear that

many intracellular conditions such as supramolecular organization, cytoplasmic viscosity,

and substrate heterogeneity in a living cell have a profound effect on the types and rates

of reactions that go on there.1;2 A chemistry reaction in a test tube would have different

thermodynamic and kinetic properties from the same reaction in a live cell.2 As a

consequence, the biochemistry studied in a test tube or dead cell would not yield a

complete understanding of the biological processes that ultimately contribute to life. 12 In

contrast, probing biomolecules in living cells allows us to precisely characterize the

properties of a molecule, and define the role of the molecule in the cellular processes.

Moreover, the intracellular behavior of the molecule such as synthesis, process, mobility,

trafficking, location and interaction with other molecules can be directly visualized

through intracellular analysis and imaging, which is not possible from test tube

experiments or using fixed cell techniques.









To meet the demand for living cell imaging, advanced imaging setups have been

developed. These developments include high speed sensitive CCD cameras, fast

computers, high volume storage devices, powerful lasers and high resolution

microscopes. In parallel, sophisticated software design allows the reconstruction of 3-

dimension images and permits quantitative analysis of fluorescence signal down to the

single molecule level.3 Furthermore, different fluorescence microscopic techniques have

been developed, which include fluorescence recovery after photobleaching, fluorescence

resonance energy transfer microscopy, multi-photon microscopy and fluorescence

lifetime microscopy. These techniques constitute a powerful tool set to interrogate

molecular dynamic information inside a live cell.

From the chemistry side, to quantitatively visualize biochemical reactions and

events in living cells calls for the engineering of selective and sensitive probes. A typical

probe consists of a targeting moiety and a signaling component. The targeting moiety

utilizes selective molecular recognition to allow discriminative tagging of the target

molecule in complex cellular environments. Depending on the signal transduction used

for the probe design, the signaling component generates observable response upon the

probe/target binding. Using fluorescence is the first choice in constructing the signaling

components because of its nondestructive nature, high sensitivity, flexible signaling

schemes and multiplexing capability. The molecular recognition elements available for

probe design include organic molecules, chelates, peptides, proteins, and nucleic acids.

This dissertation focuses on the design of fluorescent nucleic acid probes for

imaging and bioanalysis in complex biological systems. The following sections will

discuss the basics of fluorescence spectroscopy and chemical synthesis of oligonucleotide









for molecular engineering of nucleic acid probes. The principle and the intracellular

application of an important type of nucleic acid probe, molecular beacons (MB)s, will be

reviewed. Aptamers and molecular aptamer beacons for targeting a broader scope of

biomolecules will be introduced. Finally, the challenges of using nucleic acid probes for

complex biological systems such as intracellular imaging will be discussed and the scope

of this dissertation will be outlined.

Molecular Engineering of Nucleic Acid Probes

Nucleic acids are ideal building blocks for the design and construction of molecular

probes for many reasons. First, nucleic acid base pairing is one of the strongest and most

specific biomolecular recognition events. Second, with an in vitro selection technique

called SELEX,4-6 one can obtain nucleic acid sequences (aptamers) that are capable of

binding to ions, organic molecules, peptides, proteins, cells and tissues with high affinity

and selectivity. Aptamer technology greatly expands the targets of nucleic acid probes

from traditional nucleic acid sequences to any type of molecules and identities. Third,

nucleic acid sequences usually form secondary structures, which could be altered or

perturbed by a target binding event. Such a conformation change is valuable for

engineering signal transduction mechanisms into the molecular probe, allowing an

observable response from the probe upon target binding.7 Fourth, nucleic acid sequences

are easy to synthesize and there are numerous types of modifications available to label

nucleic acid sequences with different dyes, radioactive isotopes and other biomolecules.

Therefore, many types of nucleic acid probes have been designed and applied in the

fields of biology, medical science and chemistry. Today, nucleic acid probes, especially

DNA probes are instrumental and ubiquitous tools in exploring biological processes and

in medical diagnostics.









Chemical Synthesis of Nucleic Acids

Nucleic acid has become a widely used building block for the construction of

molecular probes due to its capability for selective recognition against a wide range of

targets. Another important reason for the high popularity is because automated DNA

synthesis technology allows efficient synthesis of nucleic acid probes with a variety of

modifications for different applications. Oligonucleotide synthesis has become a basic

technique for molecular biology and has found applications in almost all the biomedical

sciences. With the aid of oligonucleotide synthesis, molecular engineering of nucleic acid

probes finds numerous applications in biological studies. In the following sections, the

basics of solid state synthesis of oligonucleotide via phosphoramidite chemistry8;9 will be

reviewed.

For the synthesis of oligonucleotides (1-1), the synthesis cycle begins with a

column containing a solid controlled-pored glass (CPG) support where the 3'-hydroxyl of

the first nucleoside is attached through a long spacer arm. This support allows excess

reagents to be removed by filtration and eliminates the need for purification steps

between base additions.

Typically the synthesis of an oligonucleotide starts from 3' to 5'. Using the

phosphoramidite method of oligonucleotide synthesis, the addition of each base requires

four chemical reaction steps: detritylation, coupling, capping and oxidization (Figure 1-

3).

The first step in the synthesis, detritylation, is to remove trityl group protecting the

5' hydroxyl at the end of the oligonucleotide attached to CPG in the column. This is done

by adding a dilute acid solution, either dichloroacetic acid (DCA) or trichloroacetic acid

(TCA) in dichloromethane (DCM), to the reaction column to remove the trityl. Once









deprotected, the 5' hydroxyl becomes the only reactive group on the column to react with

the next incoming monomer bases. The reaction column is then washed to remove extra

acid and any by-products.


INH
NN _N


NCH2CH2CO'


OfvCPG
Figure 1-1. Automated oligonucleotide synthesis achieved through phosphoramidite
chemistry. There are four major steps involved in the synthesis of DNA: (1)
Detritylation, (2) Coupling, (3) Capping/Coupling, and (4) Oxidation.

The next step, coupling, is achieved by simultaneously adding a phosphoramidite

derivative of the next nucleotide and tetrazole, a weak acid, to the growing chain of

nucleotides on the solid support. The phosphoramidite derivative can not be coupled until

it has been activated, which is done by adding tetrazole to the base. The tetrazole

protonates the nitrogen of the diisopropylamine group on the 3'-phosphorous. The

resulting protonated amine makes a very good leaving group upon nucleophilic attack by

the tetrazole to produce a tetrazolyl phosphoramidite, which is susceptible to nucleophilic









attack by the activated 5' hydroxyl group to form a phosphite linkage. The reaction

column is then washed to remove any extra tetrazole, unbound bases or by-products

Since the coupling yield is not always 100%, a small percentage of the support-

bound nucleotides can fail to elongate. Such a support-bound nucleotide, is left

unreacted, and it is possible for it to react in later additions of different bases. This would

result in an oligonucleotide with a deletion that can be difficult to isolate. To prevent this

from occurring, the unbound, active 5'-hydroxyl group is capped with a protective group

which subsequently prohibits that strand from growing again. This is done by adding

acetic anhydride and N-methylimidazole to the reaction column. These compounds only

react with the residual 5'-hydroxyl group. The base is capped by undergoing acetylation.

The reaction column is then washed to remove any extra acetic anhydride or N-

methylimidazole. The capping stem terminates any chains that did not undergo coupling

by acetylation to become 'failure products.'

The capping step is followed by oxidation step where the internucleotide linkage is

then converted from the less stable phosphite to the stable pentavalent phosphate tri-ester.

Iodine is used as the oxidizing agent and water as the oxygen donor.

The four steps are then repeated in the same order until all nucleotides in the

sequence have been added. Following the synthesis, the oligonucleotide is cleaved and

deprotected from the solid support.

By converting into phosphoramidites derivatives, some fluorophores, quenchers,

and ligands can be introduced into any desired position of an oligonucleotide if these

molecules can survive the synthesis process. For some labile molecules, post-synthesis

coupling can be achieved using amino, thiol, or biotin linkers. The freedom to introduce









different fluorescence molecules, quenchers, and other functional biomolecules into a

nucleic acid sequence makes the design of nucleic acid probes much easier than probes

based on other material such as proteins.

Fluorescence Methods for Signal Transduction

Fluorescence spectroscopy is a widely used method for a variety of investigations

in biochemical, medical, and chemical research because of its high sensitivity, non-

destructive nature, and multiplexing capabilities. Fluorescence-based nucleic acid probes

may rely on the changes of emission intensity, excitation or emission wavelength,

lifetime, or anisotropy to signal a molecular recognition event.

Jablonski Diagram

In order to make use of these fluorescence changes in probe design, it is important

to understand the photophysical processes that occur from the absorption and subsequent

reemission of light. A Jablonski diagram is useful to illustrate these processes. Figure 1-2

shows a typical Jablonski diagram where So, Si and S2 stand for the ground electronic

state, first and second singlet exited electronic states respectively, while Ti stands for the

triplet state. In each electronic state, there are different discrete vibrational levels. Upon

irradiation by light molecules are excited to singlet excited energy level Si or higher

levels depending on the magnitude of the absorbed energy. The excitation process is very

fast and usually takes fewer than 10-15 s. Through a process called internal conversion the

molecules in higher vibrational levels of the same spin state rapidly relax to the lowest

vibrational level of Si, S2 to Si for example, in the next 10-12 s. The relaxation from the

lowest excited state Si to the ground state with emission of photon is referred as

fluorescence. Since fluorescence emission typically takes 10-10 to 10-6 s to occur, internal

conversion is generally completed prior to emission and fluorescence emission generally









results from the lowest-energy vibrational state of S1. As a result, fluorescence emission

energy is independent on the excitation energy. Because a small fraction of energy

absorbed is lost in the relaxation process, the emission usually appears at longer

wavelengths than absorption, which allows the spectral separation of the excitation

photon from the emission photon for sensitive studies.


S2
I INTERNAL CONVERSION
S INTERSYSTEM
CROSSING







*h PHOSPHORESCENCE
hu ^hu

So
Figure 1-2. A typical Jablonski diagram

There are several pathways of returning to the ground state from the excited singlet

state besides fluorescence emission, including non-radiative decays and intersystem

crossing to a triplet excited state.1011 Phosphorescence may result from the triplet excited

state. The average time for a molecule to stay in its excited state, called the fluorescence

lifetime, and fluorescence intensity are affected by the decay rate of these processes. The

signal transduction techniques used in fluorescence-based design consider how to

associate the target recognition event with changes in these decay rates which result in

change in fluorescence intensity or lifetime change. In addition, if the target binding

event changes the electronic structure of the fluorophore, changes of fluorescence

excitation/emission will be observed and can be used to signal the target binding event.









Three signal transduction approaches used in our work are fluorescence quenching,

fluorescence resonance energy transfer, and excited state dimer formation.

Fluorescence Quenching

There are a variety of non-radiative processes for an excited state electron to relax

to the ground state. Because these processes occur without giving out a photon, they are

termed fluorescence quenching. Quenching happens through two major mechanisms.10;11

One of them is collisional quenching or dynamic quenching. During its fluorescence

lifetime, an excited fluorophore could collide with other molecules in the solution. The

collision may cause energy loss of the fluorophore. Consequently, the fluorophore returns

to the ground state without giving out photons. The decrease in fluorescence intensity due

to the collisional quenching can be described using the Stern-Volmer equation:

Fo/F = 1+K [Q] = 1+ kqTo [Q]

where K is the Stem-Volmer quenching constant, kq is the bimolecular quenching

constant, To is the fluorescence lifetime in the absence of the quencher, and [Q] is the

quencher concentration. Many molecules can be collisional quenchers, including heavy

ions, oxygen, halogens, amines and acrylamide. In aqueous solutions at room

temperature, the biomolecular collision rate is about 1010 L mol1- s-'. If all collisional

encounters result in quenching, it can be estimated that the maximum value for kq is

about 1010 L mol-1 s-1. For a fluorophore with a lifetime of 1 ns, the Stern-Volmer

quenching constant is approximately 10 L mol-1. This estimation shows that dynamic

quenching of fluorescence is usually negligible when the quencher concentration is below

1 mM. For two molecules that are brought together by linkers in many molecular probes,

the collision rate is not diffusion rate controlled, and the dynamic quenching might be

more prominent.









The other type of quenching is called static quenching, where the quencher can

form non-fluorescent complex (i.e, dark complex) with the fluorophore in the ground

state.10;11 The change in fluorescence intensity for static quenching is described with

following equation:

Fo/F = 1+K [Q] =1+ [FQ]/ ([F] [Q])

where K is the formation constant; [FQ], [F], and [Q] are the concentrations of the

dark complex formed from the fluorophore and quencher molecules, the fluorophore, and

the quencher respectively. Both dynamic quenching and static quenching result in a

decrease of emission intensity, but there are two simple ways to distinguish static

quenching from dynamic quenching.10'11 First, whether the lifetime changes or not

depends on the different mechanisms. In static quenching lifetime does not change

because the only observed fluorescence is from the uncomplexed fluorophore which has

the same lifetime as before quenching. In contrast, in a dynamic quenching mechanism

the lifetime shows the same order of decrease as the intensity. Second, temperature plays

different roles in the two processes. In static quenching higher temperature dissociates

weakly bound complexes and alleviates static quenching. For dynamic quenching, higher

temperature causes faster diffusion and more quenching. But in many cases, both static

and dynamic quenching processes occur in the same system.

Static quenching plays an important role in molecular probes. For example, it is

involved in the fluorescence quenching of fluorophores in MBs.12 It was found that many

fluorophore-quencher pairs, including tetramethylrhodamine(TMR)-DABCYL, EDANS-

DABCYL, eosine-DABCYL, fluorescein-TMR and TMR-TMR display absorption

spectral changes when they were brought close together in the hair-pin conformation,









indicating the formation of non-fluorescent complexes in closed-stem MBs.12 The static

quenching that occur in MBs leads to higher quenching efficiency than other process like

fluorescence resonance energy transfer(FRET).12

Fluorescence Resonance Energy Transfer

FRET is the nonradiative transfer of the electronic excitation energy from an

initially excited donor (D) molecule to an acceptor (A) molecule via a long range dipole-

dipole interaction.11 FRET requires the overlap between the emission spectrum of the

donor with the absorption spectrum of the acceptor. Such an overlap allows the excitation

energy to transfer from the donor to the acceptor if the two molecules are coupled by

dipole-dipole interaction within a distance of 100A. FRET results in quenching of donor

fluorescence and an increase in fluorescence intensity from the acceptor.

The rate of energy transfer depends upon several factors such as the extent of

spectral overlap of the emission spectrum of the donor with the absorption spectrum of

the acceptor, the quantum yield of the donor, the relative orientation of the donor and

acceptor transition dipoles, and the distance between the donor and acceptor molecules.11

FRET efficiency depends strongly on the distance between the donor and the acceptor

molecules as described in the following equation:

E=R6/ (Ro6+r6)

where the Forster radius Ro is the distance at which energy transfer is 50% efficient, and r

is the distance between the donor and the acceptor. Such a strong distance dependent

FRET efficiency has been widely exploited in biomolecular structure and dynamics

studies, intermolecular association detections, intermolecular binding assays

developments as well as molecular probe designs.11 The MB is one of the successful

examples of the applications of FRET for the bio-analysis.12;13









Excited State Dimer-Excimer

Some spatially sensitive fluorescent dyes such as pyrenel1;14-16 and BODIPY F117"1

can form excited state dimers (excimers) upon close encounter of an excited state

molecule with another ground state molecule. The formation of a pyrene excimer is

illustrated in the figure 1-3. First, a pyrene molecule is excited to the excited state. The

excited pyrene can relax to the most stable singlet Si state through internal conversion.

When such an excited pyrene encounters with a second pyrene in its ground electronic

state, a complex with lower energy will form. The complex is called excimer. By

dissociating to produce two ground electronic state pyrene molecules, the excimer could

release one photon at much longer wavelength than the monomer does. The pyrene

excimer emission has a broad, featureless emission centered at 480 to 500 nm. It is easy

to recognize pyrene excimer emission, even when extensive monomer emission occurs,

since the monomer emits in the 370 to 400 nm wavelength range.

Another good example of a dye that exhibits the excimer phenomena is

BODIPY17;18 whose monomer and excimer emits at 520 and 620 nm respectively.

The formation of an excimer is useful to probe spatial arrangements of some

molecules. Similar to FRET, the stringent distance-dependent property of excimer

formation can be used as a unique signal transduction in the development of molecular

probes. This is especially useful for developing aptamer probes because many aptamers

like those aptamers for PDGF-BB,19-21 cocaine,22 and thrombin23;24 undergo

conformational change upon target binding. The approach of using excimer formation for

signal transduction also finds a wide application for other nucleic acid probes. For

example, pyrene was used to label the two ends of a MB sequence to construct a light-








switching DNA probe.16 The probe switches its emission from green light to blue light
upon interaction with its target sequences.

*Py

Internal conversion
(*Py)
+Py
S(*Py+Py)


350nm 398nm 485nm



Ground State PY PY

Figure 1-3. The schematic for the formation of pyrene excimer
Working Principle of MBs
Among many nucleic acid probe, MBs13 are one of the most successful type
molecular probes that are widely used in different areas in molecular biology. MBs
(Figure 1-4) are dual-labeled single-stranded oligonucleotide probes that possess a stem-
and-loop structure. The loop sequence, usually a 15-30 mer sequence, is complementary
to a target DNA or RNA. The stem has 5-7 base pairs that are complementary so that the
structure remains in the closed state prior to binding with its target sequence. A
fluorophore is covalently coupled to one end of the stem and a quencher is conjugated to
the other end. The stem keeps these two moieties in close proximity, causing the
fluorescence of the fluorophore to be quenched through FRET. In most cases, the









quencher is a non-fluorescent molecule that dissipates the energy transferred from the

fluorophore donor as heat. In the presence of target nucleic acid sequence, the loop region

forms a hybrid that is longer and more stable than the stem. This causes the MB to

undergo a spontaneous conformational change, which opens the stem. The spatial

separation of the fluorophore and the quencher leads to the restoration of fluorescence

emission from the fluorophore. The presence of the target sequence is thus directly

reported by the increased fluorescence from the MB. Different MBs can be designed by

choosing different loop sequences and different fluorophores with characteristic emission

wavelengths.




\ mRNA
Loop MB



Stem






Figure 1-4. Working principle of MBs. The MB adapts a stem-loop structure that
maintains the close proximity of the fluorophore (orange) and quencher (blue)
moieties. As a result, the fluorescent emission of the fluorophore is
suppressed. In the presence of target nucleic acid sequences, the loop
sequence of the MB hybridizes to the target, forcing the stem open.
Consequently, fluorophore is separated from the quencher and its fluorescence
is restored

The unique hair-pin structure and signaling mechanism endow the MB with several

advantages. First of all, the light-up signaling mechanism allows it to function as a highly

sensitive probe for real-time nucleic acid monitoring. The unbound MB does not emit

fluorescent signal. Thus signal from target-bound MBs can be clearly observed in the









presence of the unhybridized probe. Such a detection-without-separation ability is useful

for the MB in situations where it is either impossible or undesirable to isolate the probe-

target hybrids from an excess of the unbound MBs as occurs when monitoring mRNA

inside living cells. Another advantage of MBs is their relatively high signal-to-

background ratio which provides higher sensitivity. Upon hybridization with its target, a

well designed MB can generate a fluorescent enhancement as high as 20 to 40-fold under

optimal conditions. This provides the MBs with a significant advantage over other

fluorescent probes in ultrasensitive analysis. In addition to its sensitivity, MBs are highly

selective. They are extraordinarily target-specific and are able to differentiate nucleic acid

targets with single base mismatches. The selectivity of MBs is a direct result of its loop

and stem structure, as the stem hybrid acts as a counterweight to the loop-target hybrid.

The selectivity provided by the MB loop-stem structure has been demonstrated to be

applicable in a variety of biological environments, further extending the applicability of

MBs for these types of analyses. These advantages have allowed MBs to become a class

of nucleic acid probes widely used in chemistry, biology, biotechnology, and medical

sciences since they were first reported in 1996.13

Using MBs for RNA Monitoring in Living Cells

One of the primary advantages of MBs is their inherent capability of detection

without separation. This advantage is necessary for intracellular applications where any

separation of the probe from live samples would likely result in the death of the sample.

By utilizing this property of MBs, RNA can not only be detected inside of a single cell,

but its subcellular localization can also be determined and tracked over time.

The use of MBs for intracellular RNA detection and localization requires first the

design of MB for the RNA target followed delivery of the probe into the cell. The major









concern in designing MBs for intracellular use is selecting an appropriate target region

for the MB. This is especially critical due to the complex secondary structure exhibited

by the large RNA sequences and a MB must be selected that will have good accessibility

to its complementary sequence. The selection of target sites starts with the prediction of

possible RNA secondary structures. The target site is chosen around the regions that have

a high probability to be mostly single stranded to assure that the native RNA structure

would minimally compete with the proposed MB. For the chosen regions, high affinity

oligonucleotides of different lengths that are complementary to the regions will then be

used as the loop sequences of the MBs. Each loop sequence is then flanked with two

complementary arm sequences to generate a potential MB. Usually the stems are 5-7 base

pairs long and have a very high GC content (75 to 100 percent). The secondary structure

of the MB is then predicted using RNA structure analysis programs. The stem sequences

have to be altered if the structure of the sequence chosen does not adopt a hair-pin

structure with a 5-7 bp stem. A non-hair-pin structure will cause high fluorescence

background from the MB while too long of a stem will prevent the binding of the MB to

its target sequence. Since current RNA folding programs do not give a reliable secondary

structure, a series of probes are usually designed and tested in buffer with further testing

inside cells until a probe is found that can hybridize with mRNA inside of a cell with

good sensitivity.

Delivery of MBs inside of the cell has been an area where much effort has been

applied and it has resulted in many very effective options for intracellular delivery. The

most common delivery methods include microinjection,25 electroporation,26 reversible

permeabilization27 and peptide assisted delivery.28 Microinjection has several advantages.









First, it allows MB delivery to a single cell of the investigators choosing. Second, it

delivers relatively reproducible amounts of probe inside cell. Third, it enables immediate

observation of probe response. The disadvantages of using microinjection are related to

the technique itself in that it requires additional instruments and expertise while being a

very low throughput technique. Electroporation and reversible permeabilization offer

much higher throughput options by producing pores in the cell membrane and relying on

passive diffusion to deliver probes to the cytoplasm. However these pores can also allow

the loss of materials from inside of the cell and there is much cell to cell variation in

probe delivery. Peptide-assisted delivery allows the probes to pass through the cell

membrane without disturbing the cell.28 However, it requires the peptide to be conjugated

to the probe which can increase the cost and complexity of the probe synthesis and it

requires an incubation period before monitoring of the cell can begin.

Currently the application of MBs for intracellular analysis is a rather young field

with the majority of the applications focusing on visualizing the localization, distribution,

and transport of a wide variety of mRNAs inside of a cell. Initial intracellular studies

concentrated on detection of MB hybridization to mRNA as opposed to localization and

distribution studies.27;29;30 In 2003, Tyagi et al demonstrated that MBs could be used for

the visualization of the distribution and transport of mRNA.31 In this study a MB for

oskar mRNA was investigated in Drosophila melanogastar oocytes. Initially they

demonstrated visualizing the distribution of oskar mRNA in the cell. To eliminate

background exhibited from the MBs a binary MB approach was developed, which uesed

two MBs that targeted adjacent positions on the mRNA. When both MBs were

hybridized to the mRNA sequence a donor and acceptor fluorophore were brought within









close proximity allowing FRET to occur and generating a new signal that indicated

hybridization of the MBs with the mRNA. In addition to visualizing the mRNA

distribution, they were also able to track the migration of the mRNA throughout the cell

and even into adjacent cells in the oocyte. Other studies have imaged MBs on viral

mRNA inside of host cells to study the behavior of the mRNA.32 This study investigated

both the localization of the mRNA inside of cell and also utilized photobleaching of the

fluorophore on the MB in order to study the diffusion of the MB-mRNA hybrid.

In 2005, Bao et al expanded on mRNA visualization by showing the co-localization

of mRNA and intracellular organelles in human dermal fibroblasts.33 In this study MBs

were used in conjunction with a fluorescent mitochondrial stain. Since the fluorescence

from the MBs and the stain could be spectrally resolved, they were able to demonstrate

that the mRNA of both glyceraldehyde 3-phosphate dehydrogenase and K-ras were

specifically localized with the mitochrondria. Several control experiments, including the

use of negative control MBs, FISH, and detection of colocalization of 28S ribosomal

RNA with the rough endoplasmic reticulum, were performed to confirm their

observation. The authors suggested that the observation of subcellular associations of

mRNA with organelles such as mitochondria might provide new insights into the

transport, dynamics, and function of mRNA and mRNA-protein interactions.

In addition to localization and distribution, expression levels of mRNA have also

been studied inside living cells using MBs. The binary MB approach was used to explore

the relative expression levels of K-ras and surviving mRNA in human dermal

fibroblasts.27 The results indicated a ratio of 2.25 of K-ras mRNA expression in

stimulated and unstimulated HDF cells which was comparable to the ratio of 1.95 using









RT-PCR. Recently, the Tan group studied the stochasticity of Manganese Superoxide

Dismutase (MnSOD) mRNA expression in human breast carcinoma cells using MBs and

an internal standard reference probe to allow ratiometric analysis.34 In this work, the

MnSOD expression of three different cell groups was studied and compared to each other.

The expression of p-actin mRNA was used as a control. The groups of cells studied

included cells at basal expression levels, cells treated with lipopolysaccharide (LPS), and

cells that were transfected with a plasmid that overexpressed a cDNA clone of MnSOD.

Using ratiometric analysis allowed for the ratiometric values from different cells to be

directly compared, compensating for the experimental and instrumental variations. The

study showed that the stochasticity of gene expression between the basal, LPS treated,

and the transfected cells was different for MnSOD while there was little to no difference

in p-actin mRNA in the three groups. This represents a novel means to directly examine

the stochasticity of transcription of MnSOD and other genes implicated in cellular

phenotype regulation. Simultaneous monitoring of multiple MBs labeled with different

fluorophores for different mRNA target sequences allows monitoring and comparison of

the expression levels of multiple mRNA sequences in a single cell.35 In one of the

multiple gene monitoring studies, MBs for MnSOD and p-actin mRNA along with a

negative control MB were used to study the relative expression levels on MnSOD and P-

actin in the cells. Here, a reference probe was used as an internal standard for ratiometric

analysis. Microinjection was used to deliver the probe mixture to single human breast

carcinoma cells and a sample control cell is shown in Figure 1-5.






























Figure 1-5. Simultaneous monitoring of multiple genes inside a living cell. Shown here is
the time elapsed fluorescent images of each MB inside of a single MDA-MB-
231 cell. A: p-actin MB (green), B: control MB (red), C: MnSOD MB (blue)
and D: RuBpy reference probe (orange). (Reprinted with permission from ref
35. Copyright (2005) American Chemical Society)

As can be seen in the image, the P-actin MB signal increases, while the control

MB signal stays at a constant low level. The MnSOD MB stays at a low level that is

consistent with its basal expression. This result indicated not only the feasibility of

multiple gene imaging but also that the increase in the signal of p-actin MB must be due

to a specific interaction since any non-specific interaction would have resulted in an

increase in the control MB as well. This process was repeated with cells that were treated

with LPS, known to stimulate MnSOD expression. It was found that the MnSOD

expression greatly increased while the MnSod expression in the control cell remained

low. A trend was found relating high expression levels of MnSOD mRNA with higher

expression levels of P-actin mRNA in the stimulated cells. This indicates the method's

potential in elucidating gene expression trends in single cells that is not possible with









other methods that use expression levels averaged from millions of cells like northern

blots. Indeed, one of major benefits of single cell analysis is that inherent cell to cell

variations can be studied in more detail to gain further insight into biological processes.

Aptamers and Molecular Aptamer Beacons

Use of MBs allows selective detection of nucleic acids in homogeneous solutions.

MB recognition is based on base to base recognition and the targets for MBs are limited

to nucleic acid sequences. The introduction of aptamers extends the application of nucleic

acid probes to other types of targets.

Aptamers are small oligonucleotides that are identified in vitro to selectively bind

to a wide range of target of molecules such as drugs, proteins or other inorganic or

organic molecules with high affinity and selectivity. The process by which aptamers are

generated is called SELEX which combines combinatorial chemistry and in vitro

evolution. SELEX was first described by three independent laboratories in 1990.4-6

The concept of SELEX process is based on the ability of small oligonucleotides

(typically 80-100mers) to fold into unique secondary or tertiary structures which can

interact with a specific target with high selectivity and affinity. Consequently, the SELEX

process requires chemical synthesis of a large DNA library with completely random base-

sequence flanked by defined primer binding sites for polymerase chain reaction

amplification purpose. The initial library of the SELEX process is incredibly complex

with at least 1015 different DNA molecules. The immense variability of the generated

pool is to ensure that it will contain at least a few molecules with unique conformational

characteristics that will facilitate the selective interactions with the target molecule. In a

typical round of SELEX, the first step is to incubate the library with the target molecule

in a desired buffer condition (Figure 1-6). Some sequences of the library will bind to









target molecule tightly, while some sequences bind weakly and a majority of the initial

sequence do not bind at all. The second step is to separate the few high affinity sequences

from low affinity and no affinity sequences. Several separation techniques have been

explored and established for SELEX, including nitrocellulose filter techniques, affinity

chromatography technique, and capillary electrophoresis (CE). Low affinity sequences

are discarded through the partitioning process, resulting in a library pool with enriched

high affinity sequences. Through polymerase chain reaction (PCR) process, the resulting

pool is amplified and used for the next round of SELEX. By increasing the stringency of

binding condition in later rounds, high affinity sequences can be greatly enriched.

Usually it takes 20-30 rounds of SELEX to obtained aptamer sequences with good

affinity. Once the aptamer sequences are enriched, their sequences can be identified by

high throughput sequencing.

Incubate Remove PCR amplify
S with target unbound bound sequences ,



Library of random
DNA sequences Incubate with less target molecules -enrichment

Figure 1-6. Schematic presentation of a typical SELEX process.

In order to report the binding of an aptamer to its target, a signal transduction

mechanism has to be built into the aptamer sequence in order to engineer molecular

aptamer beacon. For fluorescence imaging, a variety of signal transduction mechanisms

can be used. For example, fluorescence intensity changes, fluorescence wavelength

shifting, fluorescence anisotropy, as well as fluorescence lifetime can be used to signal

the binding event. Different aptamers have different secondary structures, therefore they









require different signal transduction approaches for different aptamers in order to render

high selectivity and high sensitivity to the resulting aptamer probe for real-time imaging.

Different signal transduction approaches have been successfully exploited to design

molecular aptamer beacons for selective and sensitive detection of cancer marker proteins

and other molecules in real-time.

Careful selection of the signal transduction mechanism is conducted according to

the changes of secondary structure of the aptamer before and after binding. When the

aptamer retains the same conformation after target binding (Figurel-7 A), an anisotropy

measurement approach could be used.19 The aptamer sequence is labeled with a

fluorophore. The fluorescence anisotropy fluorophore is mainly dependent on the

rotational motion of the fluorophore which, in turn, is dependent on the size and shape of

the rotating molecule and the viscosity of the solvent environment. Fluorescence

anisotropy methods provide an easy and reliable way for studying aptamer binding with

target and for the detection of the target in real-time. We have used the signal to design

an aptamer probe for PDGF (platelet- derived growth factor) with high selectivity and

sensitivity (with a limit of detection about 0.22nM).19 In designing of an aptamer probe

which changes its conformation from closed conformation (hair-pin) to open structure,

fluorescence intensity measurement methods could be explored (Figure 1-7B). Either end

of the aptamer sequence will be labeled with a fluorophore and a quencher respectively.

Before target binding, the hair-pin structure of aptamer holds the fluorophore close to the

quencher, suppressing the fluorescence. Target binding opens the aptamer structure,

thereby separating quencher from the fluorophore. The separation of fluorophore from

quencher results in an increase in fluorescence intensity. Another signal transduction









mechanism involves fluorophore excimer formation (Figure 1-7C). This approach

applies to any aptamer that changes its conformation from open linear form to a close

conformation upon binding to its target.722 The binding event brings two monomers close

enough to allow the formation of an excimer. Because the excimer emits at a longer

wavelength than the monomer does, the target binding event will be reported by the

increase of fluorescence intensity at the wavelength corresponding to the excimer. This

method is very selective and sensitive. Using this method, we were able to detect

nanomolar PDGF protein with the bare eye.7 A probe based on fluorescence quenching

will be obtained if one of the dyes is replaced by a quencher in the third case, which is

exemplified by an aptamer cocaine sensor.22





Target Target Target


(A) (B) (C)
Figure 1-7 Signaling binding of aptamer to its target. (A) Anisotropy approach. The
secondary structure of aptamer does not change upon target binding. The
rotation rate of aptamer will slow down after binds to its target, resulting in
increase of anisotropy signal. (B) Fluorescence intensity method. After
binding to its target, structure of aptamer changes from closed state to open
structure. The binding event separates quencher (Q) from the fluorophore (F),
leading increase of fluorescence intensity. (C) Excimer approach. The
secondary structure of aptamer change from open to close state, bring two
fluorophore in proximity to allow formation of excimer, excited state dimer.
The excimer gives a fluorescence emission with a different color.

All three of above signal transduction approaches allow the design of molecular

aptamer beacon probes for the detection of target molecules in real-time. For some

aptamers without obvious target-induced structure change or without conformation

information, rational structure engineering 36-39 can be performed to engineer structure-









switching aptamers. This strategy has been well demonstrated by Bayer et al who used

the aptamer/target binding event to switch the aptamer structure to convert it to a gene

expression regulator.39 A simple yet general approach of engineering any aptamer into

structure switching aptamer for real-time signaling applications has also been

reported36'37. In addition, with a combination of the fast turnaround of automatic SELEX

techniques40 and novel selection approaches,41;42 virtually any target can have at least one

conformation-changing aptamer sequence. Thus, numerous molecular aptamer beacons

may be quickly for real-time sensitive and selective monitoring and imaging of their

targets in cells.

Challenges of Using Nucleic Acid Probes for Intracellular Analysis

Many of the applications discussed revealed limitations and challenges that still

exist with intracellular applications of nucleic acid probes. One of the major challenges is

low sensitivity. MB, for example have been reported to be able to detect as low as 10

copies of mRNA sequences,43 but most MB applications so far are limited to detecting

highly expressed or stimulated genes. The low sensitivity is a result from several factors,

including low brightness of the fluorophore used to label molecular probes, high

fluorescence background of the closed MBs, and autofluorescence of the cell.7 Another

challenge is degradation of normal DNA MBs inside of the cell.44 Once the MBs are

degraded by endogenous nucleases, the MB stem opens, creating a false positive signal.

In addition, the interaction of the MBs with introceullar proteins also disrupts the hair-pin

structure, resulting in nonspecific signals. Generating solutions to these problems is

crucial for the use of nucleic acid probes for intracellular imaging and bioanalysis.









Scope of This Research

The scope of the work presented here is to use MBs and molecular aptamer beacons

as model probes to conduct a systematic investigation into the design of effective,

selective and sensitive nucleic acid probes toward intracellular analysis applications. A

new fluorescent material called conjugated polymer PPE was explored as the signaling

element to amplify molecular recognition signal. To minimize the probe background,

macromolecules, called superquenchers with better quenching efficiency were designed

and used to label molecular probes. Time-resolved measurement applied to nucleic acid

probes to remove autofluorescence background for the detection bimolecules such as

proteins and nucleic acid in complex biological systems. To improve the selectivity and

effectiveness of nucleic acid probes, locked nucleic acids (LNAs), were used to construct

MBs. A new signal transduction scheme was also explored to design a new form of

nucleic acid probes called hybrid molecular probe, which is present in the last chapter of

the dissertation.














CHAPTER 2
DIRECT SYNTHESIS OF AN OLIGONUCLEOTIDE-POLY (PHENYLENE
ETHYNYLENE) CONJUGATE WITH A PRECISE ONE-TO-ONE MOLECULAR
RATIO

Introduction

Detection of biomolecules such as DNA, RNA and protein in real-time is of great

importance to a variety of areas such as medical diagnosis, disease prevention, and drug

discovery. While selectivity in bioanalysis can be achieved by capitalizing on highly

selective molecular recognition such as antibody-antigen binding, DNA hybridization,

and receptor-ligand interaction, the sensitivity of a bioprobe is dependent on the

technique used to translate the target recognition events into measurable signals. To date,

the most common signal transduction schemes utilize optical or electrical methods.45;46

Fluorescence is a sensitive optical transduction method which can be integrated into a

variety of molecular probes. Attenuation, enhancement, or wavelength shifts in the

fluorescence emission can be used to signal specific interactions between the probe and

the target biomolecule. In many cases, only a single fluorophore is used to signal a

binding event. Low signal intensity from this single dye and its vulnerability to

photobleaching, limit the sensitivity of these fluorescence based detection approaches.

The introduction of new fluorescent materials capable of signaling molecular recognition

events with greater measurable changes has significant potential in addressing the

predominant sensitivity limitations in current bioanalysis.

Among many new material developed for signal amplification, fluorescent

conjugated polymers ( CP, or amplifying fluorescence polymers (AFP)) have attracted









increasing attention 47-54 because of their unique light harvesting52;55 and

superquenching54;56-58 properties. Conjugated polymers, also called conducting polymers,

are poly-unsaturated macromolecules in which all the backbone atoms are sp or sp2

hybridized. They are known to exhibit photoluminescence with high quantum

efficiency59. A unique and attractive optical property of fluorescent CPs is their

fluorescence superquenching effect;58;60 that is, the CPs are a hundred- to million-fold

more sensitive to fluorescence quenching compared to that of their low molecular weight

analogues. This fluorescence superquenching is attributed to a combination of

delocalization of the electronic excited state (exciton) and fast migration of the exciton

along the conjugated polymer chain. As a result, if the fluorescence of any single repeat

unit is quenched, the entire polymer chain responds. An entire polymer chain of

poly(phenylene vinylene) (PPV) with about 1000 repeat units has been shown to be

quenched by a single methyl viologen molecule.61

With this superquenching capability, conjugated polymers have shown great

potential for sensing applications. Many types of conjugated polymers, including

polythiophenes62-64, polypyrroles65, PPVs66 and poly(phenylene ethynylene)s (PPEs)46;67-

71, have been used in sensing applications. Among them, water soluble poly(phenylene

ethynylene)s (PPEs) are attractive candidates in optical biosensing due to their facile

synthesis and high fluorescence quantum yields in aqueous solution.49;53;72 PPEs can be

prepared through the Pd-catalyzed cross-coupling of bis-acetylenic and diiodoaryl

monomers in an amine environment.50

In order to be useful for bioanalysis and bioapplication, the polymer must be

conjugated with a biomolecule such as a DNA strand, a peptide, or a protein. Such









conjugation can be accomplished by coupling PPEs with pendant reactive groups to

biomolecules with specific reactive moieties, e.g. by formation of an amide bond between

a carboxylic acid-functionalized PPE and an amine functionalized biomolecule. Although

some progress has been made in the coupling of PPEs to biotin,58;68 there remains a clear

need to develop new strategies for coupling PPEs to oligonucleotides and proteins.

Effective strategies for coupling such biomolecucles to conjugated polymers would have

significant implications for a variety of fields, including bioanalysis and biomedical

diagnostics.73 Unfortunately, coupling of PPEs to large biomolecules is fraught with

difficulties. First, introduction of reactive pendant groups can be challenging and may

also change the polymer's properties. Second, the coupling efficiency is low due to

unfavorable steric and electrostatic interactions between the polymer and the target

biomolecule. Moreover, the coupled product has similar chemical and physical properties

to those of the free polymer, making it difficult to separate the conjugated product from

unreacted polymer. Finally, the degree of coupling to the polymer is difficult to control

due to the nature of the polymer, the poor coupling efficiency, as well as the lack of

effective separation methods.

This chapter discusses a new method we have developed for the conjugation of a

water soluble poly (phenylene ethynylene) (PPE) with an oligonucleotide.74 This new

method makes it possible to efficiently couple an AFP with biomolecules for bioanalysis

and biosensor applications. This new strategy was used to label PPE on MB sequences

for signal amplifications.









Experimental Section

Chemicals and Reagents

Synthesis of PPE-S03 was previously described and performed in Dr. Kirk

Schanze's lab.53 The polymer was purified by dialysis against deionized water, and it was

stored as an aqueous stock solution in the dark under an argon atmosphere. The

molecular weight (Mn) of PPE-S03 was estimated to be 100 kD based on ultrafiltration

and end group analysis. The polymer's extinction coefficient (E) was determined to be

57,000 M-1 cm-1 in MeOH solution by gravimetric analysis (all concentrations are

provided as polymer repeat unit concentration: [PRU]). The polymer stock solution

concentration was 2.08 mg mL-1, which corresponds to [PRU] = 4 mM. The stock

solution was diluted as needed to prepare solutions used for spectroscopic experiments.

Final concentrations of the diluted PPE-S03 solutions were determined based on the

polymer's extinction coefficient. DABCYL and QSY 7 were purchased from Molecular

Probes and used as received. All DNA synthesis reagents were supplied by Glen

Research (Sterling,Va,).

Synthesis of PPE-DNA

A 16mer oligonucleotide (GCG ACC ATA GCG A TTT AGA) was synthesized on

a DNA synthesizer. To the last base of the olignonucleotide, 51-dU was coupled using

corresponded phosphoramidite with a coupling time of 15 min to ensure maximum

coupling efficiency. Controlled pored glass support from four 1 [tmol-scale columns

containing the 51-dU modified oligonucleotide was transferred to a 100 mL round

bottomed flask containing 20 mL of DMSO. The PPE monomers disodium 3-[2,5-diiodo-

4-(3-sulfonatopropoxy)phenoxy]propane-l-sulfonate (690 [tmol) and 1,4-

diethynylbenzene (694 [tmol) were then added to the solution under a gentle flow of









argon with stirring. The resulting solution was deoxygenated by several cycles of

vacuum-argon degassing. Another solution comprised of 20 [tmol of Pd(PPh3)4 and 20

[tmol of Cul in a mixture of 10 ml of DMSO and dimethylaminopyridine was likewise

deoxygenated and subsequently added dropwise to the monomer solution. The final

mixture was again deoxygenated and stirred at room temperature under a positive

pressure of argon for 24 hrs. The resulting solution was viscous, brown-yellow in color

and exhibited an intense blue-green fluorescence under near-UV illumination. The

solution was then centrifuged and the precipitated CPG was washed several times with

DMSO and water until the supernatant was clear and colorless. The CPG was then

incubated in ammonia at 550C for 8h to cleave the oligonucleotide from the CPG and to

deprotect the bases. A control synthesis was carried out following the same procedures

and experimental conditions, where a 16mer DNA without the 51-dU base was used.

The solutions that resulted after ammonia incubation of the 51-dU oligonucleotide

derivatized CPG and the control CPG were desalted by ethanol precipitation, dried and

dissolved in deionized water.

Instruments

An ABI 3400 DNA/RNA synthesizer was used for DNA/probe synthesis. UV-

Visible absorption spectra were obtained on a Varian Cary 300 dual-beam

spectrophotometer, with a scan rate of 300 nm/min. Fluorescence measurement were

conducted on a SPEX Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ)

with a 450 W Xenon lamp. A 1 cm square quartz cuvette was used for both absorption

and emission measurements.









Fluorescence Quenching Experiments

Fluorescence quenching experiments were carried out by micro-titration in a

fluorescence cuvette. In a typical titration experiment, 3 mL of a PPE-S03 solution was

placed in a 1 cm quartz fluorescence cell. The fluorescence spectra were recorded at

room temperature. Then fluorescence spectra were repeatedly acquired subsequent to the

addition of [L aliquots of a concentrated solution that contained the quencher. Quencher

solution aliquots were delivered using a calibrated Eppendorf microliter pipetter.

Results and Discussion

Biofuctionalization of Conjugated Polymer PPE

Here we introduce a versatile and effective synthetic method for coupling

oligonucleotides to conjugated polyelectrolytes. Instead of synthesizing the polymer and

oligonucleotide separately before coupling, we treat the oligonucleotide as an "end-

capping" monomer in the Pd-catalyzed step-growth polymerization of the PPE-based

conjugated polyelectrolyte. The oligonucleotide takes part in the polymerization process,

and is incorporated into the PPE chain as an end-capping unit. The oligonucleotide-

functionalized monomer is bound to a controlled pore glass (CPG) solid support,

allowing the DNA-PPE conjugate to be easily separated by centrifugation. As each

oligonucleotide has only one end functionalized with an "end-capping" monomer, only

one polymer chain can grow from a DNA strand, resulting in a precise one-to-one

coupling. Furthermore, this method not only allows an oligonucleotide to be conjugated

to a PPE chain, but it can also be extended to other biomolecules such as biotin using a

similar approach when biotin phosphoramidite is used.










DNA synthesis
0 dG ( ---3*(a) GCC TAT TCT CAA CTC G
W (a)

D
Activation (b)


AGCC TAT TCT CAA CTC G



Polymerization (c) D



i3-GCC TAT TCT CAA CTC G


0


0 ~N


Wash
Cleavage (d)
Deprotection

\ \ I/I/I


Figure 2-1. Schematic representation of solid state synthesis of DNA-PPE conjugate.

Figure 2-1 shows the process of making a DNA-PPE conjugate. On a CPG support,

an oligonucleotide with a defined sequence was synthesized from the 3' end to 5' end

using standard phosphoramidite chemistry. 5'-Dimethoxytrityl-5-iodo-2'-deoxy- uridine

3'-[(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite (51-dU phosphoramidite) was

used to introduce a 51-dU as the last base of the oligonucleotide, providing the

functionalization necessary to render the oligonucleotide active as a monomer for the

PPE. Under Sonogashira conditions, the 51-dU base couples to terminal alkynes with

high efficiency.75;76 The 5I-dU functionalized oligonucleotide was then added to the PPE

polymerization solution as an end-capping monomer, allowing the polymer chain to cross

couple with the CPG-linked oligonucleotide. Two advantages can immediately be seen

from this synthesis approach. First of all, as one end of DNA can be functionalized with

51-dU, only one polymer chain can grow from a DNA a chain, allowing one-to-one









coupling of a DNA chain to a PPE chain. Secondly, every PPE chain coupled to the DNA

chain is linked to CPG, allowing effective separation of DNA-PPE from free PPE by

means of centrifugation.

Coupling of PPE Monomer and Oligomer to DNA

Two small organic molecules (Figure 2-2) were used to confirm that the 51-dU

modified oligonucleotide is able to conjugate to the polymer monomer and oligomers

present in the polymerization reaction mixture. In one model reaction, ethynylbenzene

was coupled with the CPG-linked DNA. In a second reaction, 4-[(2,5-dimethoxyphenyl)

ethynyl]-4'-ethynyl-1,l'-biphenyl, was used to mimic a small PPE oligomer.

OMe



MeO
ethynylbenzene 4-[(2,5-dimethoxyphenyl)ethynyl]-4'-ethynyl-1 ,1 '-biphenyl

Figure 2-2. Model molecules used to couple to 51-dU functionalized oligonucleotide.

The products of the two model molecules coupled with 51-dU functionalized

oligonucleotide were analyzed with reverse phase gradient C8 HPLC/UV/ESI-MS. The

oligonucleotides yielded [M-zH]z- ions in (-)ESI-MS and [M+zH]z+ ions in (+)ESI-MS.

The molecular masses were calculated from the multiple charge ion spectra. As the (-)

ESI-MS yielded more charge states than the (+)ESI-MS, it provided better precision on

the MW determination. The observed molecular weights matched the number calculated

from the product structures. For example, the calculated molecular weight of

ethynylbenzene modified oligonucleotide was 5183.4, while the observed molecular

weight was 5181.6, calculated form the predominant m/z 1728.2 [M+3H]3+ ion in

positive mode. In the negative ion mode (Figure 2-3), this compound yielded several [M-













zH]z- ions, permitting its molecular weight to be determined: MW = 5182 +/- 2. lu, n=6


ions. The calculated molecular weight of 4-[(2,5-dimethoxyphenyl) ethynyl]-4'-ethynyl-


1,l'-biphenyl modified oligonucleotide was 5419, while the observed molecular weight


was 5418.8 from (-) ESI-MS (Figure 2-4) and 5417.7 from (+) ESI-MS. Figure 2-5 is the


negative ESI mass spectrum of a 16mer DNA used in the control synthesis. This 16 mer


DNA has the same sequence as that used to synthesize the DNA-PPE monomer, DNA-


PPE oligomer and DNA-PPE except that there is no 51-dU at the 5' end. The observed


molecular weight of this control 16mer DNA was 4791.9 and matched well with the


calculated molecular weight (4792.2g/mol). These results indicated that the CPG-linked


oligonucleotide is able to undergo cross coupling with terminal acetylenes under


Sonogashira conditions. More importantly, mass spectroscopy shows that the


oligonucleotides remained intact after exposure to the polymerization condition.


100 o 739 5

90 0 MW5182 [M-7H]7
80
70
60
50 GCCTATTCTCAACTC O
40
MW=5182.6 +/-2.1 u, n=6
30 MW5182 [M-8H]8
20 4O1
20 6473 701

10 275 0 3863 463 3 489 506 2524 5630 6049 6413 6849706 7152
150 200 250 300 350 400 450 500 550 600 650 700 750
m/z


100 12944
90
80
, 70
60
50 MW5182 [M-3H]3-
40 125 1 1726 0
30 1 67
20 MW5182 [M-6H]6- MW5182 [M-5H]5-
10 I- 1299 9
0-:
800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000
m/z
Figure 2-3. The (-)ESI mass spectra of DNA-PPE monomer (Calculated MW=5183.4).












6765


/


4

:AA CTCG 'O

MW 5418.8 +/-0.8 u, n=6




300p 346p 401,1 418 0 4475 48
300 350 400 450
m/z


MW 5418 8 [M-8H]8-


7145
543 9028 60 6346 6523 7081 7376
500 550 600 650 700 750
500 550 600 650 700 750


13536


MW5418 8 [M-4H]4-


MW5418 8 [M-3H]3-


18049


[M-5H]5-

in- -


9021

900 1000 1100


S 1 I 16:
1200 1300 1400 1500 1600
m/z


Figure 2-4. The negative ESI mass spectra of DNA-PPE oligomer (Calculated MW

=5419.4).


MW 47919 u [M-7H]


3'-GCC TAT TCT CAA CTC G-5'




MW 4791.9 u +/- 1.08 u, n=5


30

20

10
S 1771 1952 2572 28823052

1 0 200 250 300




100

90


635 3
635657 4 694 4 743 1 749 5
3463 3864 4021 425 9 4632 491 536546 0 6233 95
536_95462 5831 598,0 6 233 .

350 400 450 500 550 600 650 700 750
m/z



11969

[M-4H]4-


[M-3H]'

15960


1197 7

11590 -
. ... .-

1100 1200 1300 1400 1500 1600
m/z


19154


-0 58
1700 1800 1900 2000


Figure 2-5. The negative ESI mass spectra of control 16mer DNA (Calculated

MW=4792.2).


100


2353 249
200 250


100


[M-6H]6-


[M-7H]'
7731

800


170 18 12 1

1700 1800


1900 2000


70


6838


[M-6H]6-


800


[M-5H]5-
0 57 4


900 1000











DNA Hybridization Study

An important criterion in choosing a polymerization condition is that the reaction

environment has to be mild enough to allow DNA to remain intact and reserve its bio-

recognition capability. Mass spectroscopy analysis indicated that DNA structure

remained unchanged after exposure to the polymerization condition. To test the bio-

functionality of those polymerization reaction treated DNA, a MB assay was employed.

The sequence of the MB used was: 5' -DABCYL-CCT AGC TCT AAA TCG CTA TGG

TCG C GCT AGG-TMR-3'. Two cDNA samples, cDNA1 and cDNA2, sharing same

sequence (5'-GCG ACC ATA GCG A TTT AGA-3') were synthesized under different

conditions. The cDNA1 was synthesized with normal DNA preparation procedure, while

cDNA2 had been exposed to the polymerization reaction. The sequence of these two

cDNA targets was designed complementary to the loop sequence of the MB. If the cDNA

functions as a normal DNA strand, it will hybridize to the MB, restoring its fluorescence.



18-
1 16-
1E 4-





6-6
4-)
S 12-
C
> 10-


o-




MB+random DNA MB+c-DNA1 MB+c-DNA2



Figure 2-6. Fluorescence enhancement of the MB after addition of cDNAs. 100 nM of
MB in 20 mM Tris-HCl buffer (50mM NaC1, 5mM MgCl2, pH 7.5 ). cDNA1
concentration = 500 nM, cDNA2 concentration = 500 nM, and the random
sequence DNA concentration used was 2 uM.









Figure 2-6 shows cDNAl and cDNA2 hybridized to a MB, resulting in a similar

signal enhancement. Upon addition of excess random DNA, no significant signal changes

were observed.

These results showed that cDNA2, after exposure to the polymerization condition,

functioned as well as a normal DNA cDNA1 did, indicating that the polymerization

condition had no significant effect on the bio-recognition capability of the DNA.

Direct Synthesis of DNA-PPE with One-to-One Ratio

In the original method of synthesizing water-soluble PPEs53, a mixture of water,

DMF, and diisopropylamine was used. The growth of PPE from the 51-dU functionalized

DNA requires anhydrous conditions since the oligonucleotide is linked to CPG by an

ester bond, which in addition to the base protection groups on the oligonucleotide is

sensitive to any nucleophiles especially under basic condition. Preliminary synthetic

preparations indicate that PPE-S03- can be synthesized in either

DMSO/dimethylaminopyridine or DMF/triethylamine solvent systems. Thus, DMSO/

dimethylaminopyridine was chosen for the synthesis of DNA-PPE. The monomers, CPG

containing 51-dU functionalized DNA, and catalysts were incubated in deoxygenated

DMSO/dimethylaminopyridine solution stirred at room temperature under a positive

pressure of argon for 24 hrs. The solution was then centrifuged and the precipitated CPG

was washed several times with DMSO and water until the supernatant was clear and

colorless. After washing, the CPG was still yellow-green and highly fluorescent. The

color was likely comes from the PPE molecules that covently conjugated to the DNA on

the CPG. The CPG was then incubated in ammonia at 550C to cleave the oligonucleotide

from the CPG and to deprotect the bases. After overnight incubation, the CPG became

white while the liquid phase turned yellow-green and fluoresced under UV illumination,










indicating that the PPE coupled to DNA was cleaved from the CPG as a result of the

cleavage of the DNA from the support. For the control synthesis using CPG with a 16mer

DNA without 51-dU base, the CPG was white after 3 repeated rinses prior to cleaving

DNA from the solid support. No color from the control CPG indicates that PPE was not

coupled to the DNA and could not be coupled without the iodine-derivatized

deoxyuridine.

Figure 2-7 compares the fluorescence emission spectra of the DNA-PPE and the

control solutions. The DNA-PPE solution shows an emission band with a maximum at

520 nm, which is consistent with a previous report that this PPE emits at 520 nm in water

(the emission is broad because the PPE is aggregated in water).53 Deaggregation of the

PPE induced by addition of a non-ionic surfactant,77 dispersion into agarose gel or

changing to methanol solvent,53 shifts the emission maximum of the PPE to 455 nm.

Figure 2-8 shows the emission peak shift of the DNA-PPE conjugate from 520 nm to 455

nm as a result of de-aggregation after being dispersed in agarose gel. The strong

fluorescence from the DNA-PPE solution and the lack of fluorescence from the control

solution suggests that the PPE has been successfully coupled to the DNA.



300000 -- PPE-DNA
S250 -- Control
,& 250000 -

200000 -

150000 -

100000 -

50000 -

450 500 550 600 650 700
Wavelength (/nm)


Figure 2-7. Fluorescence emission spectra of DNA-PPE, and the control solution.











1.0


0.8


C-)
C 0.6


0
2 0.4
LL


0.2


0.0 1 I ,
450 500 550 600 650 700
Wavelength/nm


Figure 2-8. Fluorescence emission of PPE in agarose gel stained with ethidium bromide

The fact that the PPE is coupled to the 51-dU DNA was further confirmed by gel

electrophoresis, where a 0.5% agarose gel was used to analyze DNA-PPE, PPE, and the

DNA obtained from the control synthesis. As shown in Figure 2-9, in the DNA lane (3),

only one band is observed, while in the PPE lane (2), no DNA band exists. By contrast,

there are two bands in the DNA-PPE lane (1), suggesting that at least two types of DNA

are present. One is likely the "free" DNA (this band has a similar migration rate as that in

lane 3), and the second is likely the DNA-PPE conjugate. The DNA-PPE band migrates

very little in the agarose matrix, due to the rigid rod structure50 of the PPE and the large

molecular weight of PPE-DNA conjugate. Quantitative analysis of the DNA-PPE lane

revealed that the ratio of the overall intensity for the DNA band to that for the DNA-PPE

conjugate band is about 1.2, indicating a yield higher than 45% for the coupling reaction

between the DNA strand and the PPE.

























Figure 2-9. Gel electrophoresis of PPE-DNA (1), PPE (2), and DNA (3) samples.
Agarose 0.5%, 1x TBE buffer (0.089 M Tris, 0.089 M borate and 2 mM
EDTA, pH 8.2-8.4), 90V for 20 minutes. The gel was prestained with
ethidium bromide for DNA detection. Pictures were taken with a Kodak
camera in fluorescence mode with a 540-640 nm band pass filter. This filter
passes emission from ethidium bromide, indicating the presence of
oligonucleotide, while removing the emission for PPE under this condition
(PPE emits at 455 nm in agarose gel).

Design of PPE-MB for Signal Amplification

The successful establishment of this conjugation method allows us to construct a

variety of biosensors using conjugated polymers, where a precise control of the coupling

ratio of recognition molecules to polymer and complete separation of free conjugated

polymer from the biofunctionalized conjugated polymer are crucial. Our first attempt was

to synthesize a MB with a conjugated polymer chain as its fluorophore. A MB13 is a

hairpin shaped oligonucleotide with a fluorescent dye (F) at one end and a quencher (Q)

at the other end. In the absence of the target DNA, the fluorescent dye and quencher

molecule are brought close together by the probe's self-complementary stem, suppressing

the fluorescence signal. Because the perfectly matched DNA duplex is more stable than

the single-stranded hairpin, the MB readily hybridizes to its target sequence, thereby

disrupting the stem structure, separating the fluorophore from the quencher, and restoring









the fluorescence signal (Figure 2-10a). Unlike a traditional dye labeled MB, this new

design uses a polymer chain as its fluorophore to amplify the fluorescent signal. When

the MB is in its closed state, the polymer chain will be in close proximity to the quencher.

Because of the superquenching property of the conjugated polymer, it is expected that the

fluorescence of the conjugated polymer will be strongly suppressed. After target DNA

binding, the fluorescence of the conjugated polymer will be restored as a result of the

increased separation distance between the conjugated polymer and the quencher (Figure

2-10b).





TargetrDg -D

Ta' g \ D
V F\F



(a)
(b)


Figure 2-1O.Working principles of a MB (a) and conjugated polymer labelled MB (b). In
a regular MB, one fluorophore is used to report a target binding event while in
the conjugated polymer labelled MB, a conjugated polymer chain is used.

Selection of Quencher and Fluorescence Quenching Study

In order for the new type of MBs to function, careful selection of the quencher is

important. Three criteria were considered when selecting a quencher. First, the quencher

should be able to quench polymer PPE with high efficiency, thereby reducing

background fluorescence. Second, in order to be integrated into a MB, the quencher

should have the appropriate functionalities needed to couple to DNA. Finally, DNA













coupling should not alter the molecular properties of the quencher, particularly its

quenching ability.

Successful superquenching of PPEs has been accomplished by N,N'-dimethyl-4,4'-

bipyridinium (MV2+).53 However, this quencher is inappropriate for our work since it

lacks appropriate functionalities to conjugate to DNA. Alternate non-fluorescent

quenchers, such as DABCYL, Black Hole Quenchers and QSY-7 are widely used in MB

synthesis. These quenchers will be good candidates for our polymeric fluorophore MB

because of their high extinction coefficients and the well developed automatic solid phase

synthesis method used to couple with DNA with high efficiency.

Me Me
I I
Ph N /0 Ph HOEt MeO

HOn n HOEt / N / -N\L/\
HO\ \ 0 O HE N- -Me
II Me
/ --N COOH
II 02N

DABCYL QSY7 BHQ1

Figure 2-11. Structures of some commonly used non-fluorescent quenchers for MB
synthesis.

Among them, DABCYL is most widely used and was chosen in our MB synthesis.

In order for the resulting conjugated polymer labelled MB to work, DABCYL should

effectively quench the fluorescence emission of the polymer. Quenching experiments

were performed to determine if the polymer showed superquenching by DABCYL. As

shown in Figure 2-12, quenching of 2 [M (repeat unit concentration) PPE by different

concentrations of DABCYL was very efficient. The Stern-Volmer quenching constant at

lower quencher concentrations (less than 0.4 pM) was = 4x106 M1. At higher quencher

concentrations, an upward curve was seen in Stern-Volmer plot, giving a much higher

quenching constant, approximately 1.4x107 M'1. Upward curvature is typically seen in









44



the Stem-Volmer plots of conjugated polyelectrolytes by oppositely charged quenchers,


and the mechanism for this behavior has been discussed.


10- 2.0

9-
S1.5
8- Ksv=4x106M I1

7- 1.0

0.5
5 -

4 0.0
0.0 2.0x10 4.0x10
3-

2-

1 U

0
0.0 2.0x10' 4.0x107 6.0x10
[DABCYL] (M)


8.Ox10


1.0x106


Figure 2-12. Stem-Volmer plot of PPE quenching by DABCYL in 40 mM Glycine-HCl

buffer (pH 2.3). The Glycine-HCl buffer was used to protonate DABCYL as a

counter ion to polymer PPE.


The quenching of PPE by QSY-7 was also tested. As shown in Figure 2-13,


quenching of 3 [M (repeat unit concentration) PPE by different concentrations of QSY-7


was very efficient. Approximately 97% fluorescence from 3[tM PPE was quenched by


only 0.5 [M of QSY-7.


-0 uM
-0 luM
0 2um
-0 3uM
0 4uM
-0 5uM


400 450 500 550 600 650 00 1 Ox10 20x10' 30x10' 40x10' 5 Ox10 60x10'
Wavelength (nm) Quencher QSY-7 Concentration (M)


Figure 2-13. The emission (left) and Stem-Volmer plot (right) of 3 PM (repeat unit

concentration) PPE-S03 quenched by various concentrations of QSY-7


2000000-
1800000-
1600000-
S1400000-
1200000-
5 1000000-
S 800000-
0
L 600000-
400000-
200000-
0-










The Stern-Volmer quenching constant at lower quencher concentration (less than

0.3 pM) was as high as 2.5x 107M-. At higher quencher concentration, an upward curve

was seen in Stern-Volmer plot, giving a much higher quenching constant, x 10 M1. The

quenching experiment were conducted on PE-S03 (Figure 2-14 Left), a low molecular

weight analogue of PPE-S03. It was found the quenching constant of PE-S03 by QSY-7

was about 1.9x 105 M1. This comparison clearly showed that the conjugated polymer

PPE-S03 is more than 520 times sensitive to the quencher QSY-7 than its low molecular

weight analogue PE-S03.

These two experiments confirmed that PPE can be superquenched by the non-

fluorescent quenchers DABCYL and QSY-7. DABCYL was chosen for the design of

PPE-MB since it can be directly coupled to a DNA chain directly using a DABCYL

functionalized CPG or phorphoramidite.


NaOS




0




SONa

r'r c' 't" -


030-


r r I- 3 00 30x10 60x10 90x10 122x10" 15x10
QSY-7 Concentration (M)

Figure 2-14. The structure of PE-S03 and the Stern-Volmer plot (right) of 3 pM PE-S03
quenched by various concentrations of QSY-7

Synthesis of PPE-MB

The synthesis of the MB followed the same procedure as described above except

that a 3' DABYCL(4-(4-(dimethylamino)phenylazo)benzoic acid) quencher CPG was

used instead of a regular base CPG (Figure 2-15). The MB sequence synthesized was 5'-











PPE- CC TAG CTC TAA ATC ACT ATG GTC GCG CTA GG-Dabcyl-3'. Theoretical


calculations indicated this sequence could form a stable hairpin structure.7

W washing
Cleavage
DNA synthesis Activation Polymerization Deprotection Tris-HCI Buffer
S (a) (b) ) (d) e)











Figure 2-15 Schematic representation of solid state synthesis of conjugated polymer
labelled MB. Q stands for quencher DABCYL. The resulting MB's sequence
is: 5'-PPE- CC TAG CTC TAA ATC ACT ATG GTC GCG CTA GG-
DABCYL-3'



100000-




40000-


III
60000 -

20000-



-100 0 100 200 300 400 500 600 700
Time (second)

Figure 2-16. Response of PPE labelled MB to its target DNA. MB sequence: 5'-PPE- CC
TAG CTC TAA ATC ACT ATG GTC GCG CTA GG-DABCYL-3', Target
Sequence: 5'- GCG ACC ATA GTG ATT TAG A -3'. Buffer condition:
20mM Tris-HC1, pH7.5, 50mM NaC1, 5mM MgCl2, 0.1%Tween20.

Figure 2-16 shows the response of the conjugated polymer labeled MB to 5-fold


excess of target DNA. Immediately after the addition of target DNA, increase of polymer


emission was observed. When lower concentration of target was used, a slower reaction


profile was observed. As a negative control, a large excess of random sequence DNA was


added to the MB solution, and this did not give any substantial change in the fluorescence









intensity. These hybridization results suggested that: 1) the DABYCL molecule quenches

the polymer chain when the MB is in its hairpin conformation; 2) the conjugated polymer

labeled MB functions as a normal MB that selectively hybridizes to its target DNA.

The initial success of making PPE-MB mixes with several problems that warrant

future optimization of the design. First, it was found that the MB did not work quite well

in a pure buffer in the absence of surfactant. This is likely due to the fact that the polymer

chain tends to stack together. The use of non-ionic surfactant can de-aggregate the

polymer,77 allowing each PPE-MB function as an individual probe. The use of surfactant

might not be compatible with some applications. Designing new conjugate polymers with

no tendency to self-aggregate eliminates the need for surfactant. Second, although the

overall signal intensity from the probe was high, the signal enhancement was very low

due to a very high background signal. High background signal could result from low

quenching capacity of the quencher to quench a polymer chain, or failure of forming

stable hair-pin structure of the probe due to steric hindrance imposed by the bulky

structure of polymer. New quenchers should be explored and the stem of the MB needs to

be carefully optimized in order to counteract this steric hindrance. Finally, current

methods of making polymers result in polymer chain of different length for each probe.

Such a distribution in polymer chain length might cause big signal distributions for

detecting targets with low copy number as each probe might give different signal

intensities. Developing a size controllable polymerization method will benefit the

performance of the probe.

Conclusions

To use conjugated polymers to amplify biomolecular interactions, we have

developed a novel synthetic method for conjugation of a water soluble PPE with an









oligonucleotide. Coupling was achieved by carrying out the PPE polymerization reaction

in the presence of a 51-dU terminated oligonucleotide linked to a CPG support. The

product, DNA-PPE, can be easily separated from free PPE by centrifugation. The

conjugation reaction is simple, fast and easily controllable. The coupling efficiency

between the PPE and the DNA is high. Mass spectroscopy analysis and DNA

hybridization study results indicated that polymerization condition was so mild that the

DNA exposed to polymerization not only remained structurally intact, but also kept their

bio-recognition capability. The new method has four distinct advantages: stoichiometric

labeling of DNA to the polymer chain; easy separation to enable high purity of the

desired final product; high yield for DNA and PPE conjugation; and structural stability to

covalent conjugation between the biomolecules and the PPE. This new method makes it

possible to efficiently couple a fluorescent amplifying polymer with biomolecules for

sensitive signaling in a variety of biosensor applications. To explore the use of

conjugated polymers for DNA sensing, a MB was synthesized with a conjugated polymer

chain as the signaling element. Without the strategies developed here, the preparation of

such a MB would have been extremely difficult or even impossible. This MB produced a

strong fluorescence signal specifically for the complementary sequence and showed

promise as a sensitive bioanalytical probe. The physical, chemical, spectral and biological

properties of this hybrid material DNA-PPE are currently being investigated. The

application of PPE labeled MB in high sensitive bioassays is also in progress.














CHAPTER 3
MOLECULAR ASSEMBLY OF SUPERQUENCHERS IN SIGNALING
MOLECULAR INTERACTIONS

Introduction

This chapter discusses the establishment of a molecular assembling approach to

generate a series of quenchers for the signaling of molecular interactions.79 There are two

important ways to improve the sensitivity of molecular beacons. One is to enhance the

fluorescence intensity of the open-state molecular beacons, which has been tested in

Chapter 2. Another way is to minimize the fluorescence intensity of the molecular

beacons in the closed-stem conformation. In molecular probe design and preparation, the

unquenched high background from the probe itself limits the increment of signal change

upon interacting with their targets, which leads to poor sensitivity of the detection

methods. Strategies for improving the signal-to-background ratio (SBR) of molecular

probes promise higher assay sensitivity as well as better reproducibility. There have been

encouraging progress in attempts at introducing novel signaling schemes,80;81 exploring

nanocomposites82;83, and improving quenching performance using rational molecular

design coupled with sophisticated synthesis methods.8486

In this chapter, we explore the feasibility of assembling multiple quenchers to label

molecular probes in an attempt to improve the overall quenching efficiency of the

quencher moiety thus minimizing the probe background signal and enhancing the probe

SBR. We have explored two ways of introducing multiple quencher molecules into a

molecular beacon sequence: one labels the quenchers on the side chain of beacon stem;









the other tethers multiple quenchers at the end of the stem through a dendrimeric linker.

The resulting quenching efficiencies from these two labeling approaches were compared.

Experimental Section

Molecular Beacon Synthesis

All DNA synthesis reagents were from Glen Research (Starling, Va). Molecular

Beacons were synthesized with an ABI3400 DNA/RNA synthesizer. Table 3-1 lists the

probes synthesized for this study.

For side chain labeling or internal labeling, FAM labeled dT phosphoramidite was

used for FAM labeling. DABCYL labeled dT phophoramidite was used to introduce one

DABCYL molecule into each sequence. Multiple couplings of DABCYL labeled dT

phophoramidite were performed to attach plural DABCYL molecules to the stem

sequence. For FAM-dT and DABCYL-dT coupling, 15 minutes of reaction time was

used to ensure optimal coupling efficiency.

For all end labeling synthesis, FAM CPG was used for all FAM labeled molecular

beacons synthesis. For Cy3 labeled MBs, phosphate CPG and ultramild deprotection

phosphoramidites were used. TMR-CPG and normal phosphoramidites were used for

TMR labeled MB synthesis. Symmetric doubler phosphoramidite, asymmetric doubler

phosphoramidite, and trebler phosphoramidites were used to assemble different

Superquenchers. Coupling time for all linker and quencher labeling was 15 minutes.

For FAM labeled MBs, incubation overnight concentrated in ammonia was used

for cleavage and base deprotection. Ultramild deprotection condition, overnight

/incubation in 0.05M K2CO3/methanol, was used for the Cy3 labeled molecular beacons.

Deprotection of the TMR labeled MBs was done by treating the oligonucleotides with a

tert-butylamine: methanol: water (1:1:2) incubation for 3 h at 65 oC.87










The resulting ammonia-dissolved oligonucleotides were precipitated in ethanol.

The precipitates were then dissolved in 0.5ml of 0.1 M triethylammonium acetate (pH

7.0) for further purification with high-pressure liquid chromatography. The HPLC was

performed on a ProStar HPLC Station (Varian, CA) equipped with a fluorescence and a

photodioarray detector. A C18 reverse phase column (Alltech, C18, 5[aM, 250x4.6mm)

was used. For FAM labeled MBs, the fractions that absorbed at 260, 470 and 488nm

while fluorescing at 520nm with 488nm excitation were collected. Several fractions for a

run were collected for multiple-quencher MBs. For example, in the purification of the

three-quencher MBs, three fractions were collected from HPLC. Each fraction was well

resolved and corresponded to single quencher, two-quencher and three-quencher MBs.

The last fractions in each separation was collected and corresponded to the fully complete

probe.

Table 3-1. Sequences of MBs synthesized in this study. T(D), T(F), FAM, CY3, 5, 6, 7, 8
stand for DABCYL labeled dT, fluorescein labeled dT, fluorescein dye, cy3
dye, symmetric doubler linker, DABCYL, trebler linker and ECLIPSE
respectively.
Name Sequence
MB226 FAM- CCTAGCTCTAAATCACTATGGTCGCGCTAGG-DABCYL
Single-Q-MB CCT T(D)TC GCT CTA AAT CAC TAT GGT CGC GCG AT(F)A GG
Dual-Q-MB CCT(D)T(D)TC GCT CTA AAT CAC TAT GGT CGC GCG AT(F)A GG
Tri-Q-MB CCT(D)T(D)T(D)C GCT CTA AAT CAC TAT GGT CGC GCG AT(F)A GG
Quad-Q-MB GTG T(D)T(D)T(D)T(D)GC TCT AAA TCA CTA TGG TCG CGC AAT(F) ACA C
MB3F51D 6CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM
MB3F52D 65CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM
MB3F53D 67CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM
MB3F54D 655CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM
MB3F56D 675CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM
MB3F95D 677CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM
MB3F51DCY3 6CCTAGCTCTAAATCACTATGGTCGCGCTAGG-CY3
MB3F53DCY3 67CCTAGCTCTAAATCACTATGGTCGCGCTAGG-CY3
MB3F53DTMR 67CCTAGCTCTAAATCACTATGGTCGCGCTAGG-TMR
PDGF3F53D 67CAGGCTACGGCACGTAGAGCATCACCATGATCCTG-FAM









Hybridization of MB

Fluorescence measurements were conducted on a Fluorolog-3 Model FL3-22

spectrofluorometer (JOBIN YVON-SPEX Industries, Edison, NJ) using a 4 ml quartz

cuvette. All hybridization was performed at 25 C with an external circulating water bath.

The background fluorescence of a 3ml buffer solution containing 20mM of Tris-HCl

(pH7.5), 50mM NaCl and 5mM MgCl2 was monitored for about 1 minute. Then 1-10 uL

of MB solution was added the hybridization buffer and the fluorescence emission was

monitored. After a stable fluorescent signal was reached, an excess of target

oligonucleotide was added. The level of fluorescent intensity was recorded. The

excitation/emission wavelengths were set to 488 nm/515 nm, 546 nm/566 nm, 550

nm/580 nm for fluorescein, Cy3 and TMR dye labeled MB respectively.

The signal-to-background ratio was determined by SBR= (Fhybrid-Fbuffer)/ (FMB -

Fbuffer), where Fhybrid, Fbuffer, and FMB probe are the fluorescence intensity of the MB-

target hybrid, the buffer, and the free MB, respectively. The quenching efficiency was

defined as Q%=100*(1-((Fhybrid-Fbuffer)/ (FMB probe-FBuffer)).

Results and Discussion

Design of Multiple-Quencher MBs

Extensive study of the unique thermodynamics and specificity of molecular

beacons8889 has demonstrated two main advantages: excellent sensitivity to the detection

of one base mismatch in a nucleic acid sequence and direct detection of unlabeled

oligonucleotides.82 Although these properties have resulted in a variety of fluorescence-

based applications such as DNA/RNA detection,12;13;90-92 living systems

29;31;35;93 94;95 96;97
investigation,29313593 enzymatic process monitonng,995 biosensor design,9697 protein-

DNA interactions,98;99 and biochip fabrications,100-102 there is still the challenge of









improving the sensitivity of these probe assays. Poor detection sensitivity of the probes

has hindered the biological application and potential of molecular beacon probes. It has

been theorized that MBs should have up to a 200-fold of enhancement in fluorescence

signal, but this enhancement has rarely been achieved in MB applications. Low signal

enhancement, is a result of many factors, including formation of secondary structures,

sticky end pairing, presence of fluorescent impurities and low quenching efficiency of the

quencher molecule. While the first two factors may be eliminated through careful design

of the probe sequences, the latter two factors remain major sources of high background

signal.

The quenching efficiency of the quencher molecule could be improved by

exploring new molecular designs and developing novel synthesis methods to obtain better

quenchers. As a universal quencher,12 4-((4'-(dimethylamion) phyenyl) azo) benzoic acid

(DABCYL) has been widely used in molecular beacon synthesis. DABCYL can quench

at most 99.0% of the fluorescence of a dye placed in close proximity.82 While optimal for

quenching fluorescein, the quencher efficiency of DABCYL diminishes significantly for

dyes emitting at longer wavelengths.82 Recently, new organic quenchers with improved

efficiencies have been developed and are commercially available. Among them include

Black Hole Quenchers, Iowa Black, ECLIPSE, QSY quencher series. Although these

new quenchers offer improved quenching efficiency for different fluorophores, their

performance is limited when used in MBs.

Another possible way to improve the quenching efficiency is to assemble multiple

quenchers together to pair with one fluorophore in a molecular probe. Pairing multiple

quenchers with a single fluorophore provides better quenching efficiency due to the










summation of the quencher's extinction coefficients and the increased probability of

dipole-dipole coupling between the quenchers and the fluorophore as a result of a

increased molecular interaction. In addition to the improved quenching performance, the

attachment of extra quencher molecules to the probe sequence effectively extends the

retention time of the probe in a reverse phase HPLC column, allowing better separation

of the fluorescent impurities.

As a proof of principle, MBs with multiple quenchers were designed and

synthesized. Two ways of labeling quenchers to an MB sequence were explored: internal

labeling and end labeling. In the first design, quencher labeled bases were used to build

several adjacent bases in one arm of the MB. To the corresponding base in the other arm

of the stem, a fluorophore labeled base was used. Figure 3-1 is a schematic showing the

structure of the internally labeled three-quencher MB.


CAC TA
CH AT G CACTAT
,c A T AT TG
S'NA G
o T A *A
'cNN C. & T A TC

SCO G A
SI o GOC Te G

o--5/T T3 3 C G
o -TOA *A
o N1--<"C G 0 (
o COG *SA

COG
3\ COG
c- 5' 3'
CH3


Figure 3-1. Structure of an internal labeled three-quencher molecular beacon. Three
DABCYL molecules, are internally attached to the 5' arm of the molecular
beacon, while the fluorophore is internally labeled next to the 3' end. In this
figure, the red circles stand for DABCYL labeled dT while yellow circle
stands for fluorescein labeled dT.

In the second design, dendrimeric linkers103;104 were used to allow different number

of quenchers to be assembled together at the end of an MB sequence (Figure 3-2).












CA CTAT
A G
A T
TCc. G c
GeC
AeT
T*A
C*G
5' GOC 3'
/ /


rf .


o ",




H,C N-CH3 N CH,
SC N CH3 H3C


TCAC TAT
A G
A G
A T


GeC
Ae T
TeA
C*G

4ad


Figure 3-2 Structure of an end-labeled multiple-quencher MB. The 5' end of the
oligonucleotide is attached to three DABCYL molecules, while the 3' end is
labeled with a fluorescein molecule. In this figure, the red balls are DABCYL
molecules and the, yellow one is the fluorescein molecule.

Internally Labeled Multiple-Quencher MBs

In this design, quencher and fluorophore labeled phosphoramidites were used to

label the quencher and fluorophore to the molecular beacon sequence. The number of

quenchers attached to the probe can be adjusted by controlling the number of quencher

labeled bases in one of the arms of the stem. Because of the commercial availability,

DABCYL-dT phosphoramidite was used for multiple-labeling of DABCYL. Ideally, a

fluorophore labeled dA phosphoramidite should be positioned opposite the dT base in the

other arm of the stem. However, a fluorescein labeled dT phosphoramidite was used for

fluorophore labeling in this initial testing synthesis due to the limited availability of

fluorophore labeled phosphoramidites. The length and base composition of the stem was









adjusted to compensate the T:T base mismatched pair in the stem and allow the formation

a stable hairpin structure. Figure 3-1 shows the structure of the internally labeled three-

quencher molecular beacon. The three DABCYL molecules are internally attached to the

5' arm of the molecular beacon, while the fluorophore is internally labeled adjacent to the

middle quencher on the 3' end.



70-

60-

S50-
E
U 40

30-
Lu
20
0)

10-

0
MB226 Tri-Q MB


Figure 3-3 Signal enhancement of MB226, a regular beacon, and Tri-Q MB, a new
beacon with three quenchers. In both case, the molecular beacons are 65nM,
and the cDNA concentration used is 325nM. These two beacons has the same
loop sequence to recognize the same target DNA, and are designed to have
similar stem stability.

Hybridization experiments resulted in nearly a 69-fold signal enhancement of

fluorescent signal for the three-quencher MB after introduction of target DNA sequence.

Under the same experiment condition, an MB with single quencher showed only about

15-fold signal change (Figure 3-3). These two beacons were designed to have the same

loop sequence and same stem stability. The 54-fold increase over single quencher MBs is










a clear indication of the enhanced quenching of the fluorophore by increasing number of

the quencher molecules used.

The beacon synthesized with this new design exhibits high target selectivity by

discriminating against single base mismatches as evidenced in the thermal denaturing

profiles of the probe with different targets (Figure 3-4). The red plot is a solution of

65nM Tri-Q-MB with 325nM of target DNA. The black one is 65nM Tri-Q-MB and 325

nM of c-DNA with a single base mismatch. The green line is the MB without target. The

sequences of the full compliment and mismatched cDNA are AGA TTT AGT GAT ACC

AGC G and AGA TTT AGC GAT ACC AGC G respectively. The duplex of the MB and

the complimentary sequence is much more stable than the duplex of the MB and the

mismatched sequence, as indicated by the difference in melting temperature. The melting

temperature of the former duplex is approximately 200C higher than that of the later

duplex.



16- Mismatch cDNA
m-m-**. Target DNA
14- MB
S12
65 nM Tri-Q-Mb
S10- 5X MB+CDNA
5X MB+Mismatch cDNA
8- \ 6 minutes temperature
Sequilibration
S6-
0 4-
2


0 10 20 30 40 50 60 70 80 90 100
Temperature (C)

Figure 3-4 Melting temperature curve of Tri-Q-MB, a molecular beacon synthesized with
three quenchers, as described in Figure3-1.










The selectivity was also evident in hybridization kinetics. Figure 3-5 shows the

hybridization of the Tri-Q-MB with perfect matched DNA, one base mismatched DNA

and a scrambled sequence. The mismatched sequence hybridizes to the probe much more

slowly than the perfectly matched target. It should be noted that the purpose of these

experiments was not to do single base mismatched detection. Instead, it was to confirm

the selectivity of this new design MB. Optimal single base discrimination of a MB could

be achieved by careful optimization of the experimental conditions.


16-
>, 14-
S12-
~- 5x Perfect Matched DNA
8 10 -5x Mismatched DNA
8 10x Random Sequence DNA
S 8
o 6-
4-
2
0- .
0 200 400 600 800 1000
Time(second)


Figure 3-5 Response of 65nM Tri-Q MB to 325nM perfect matched DNA
(complementary to its loop), single base mismatched DNA and 10x
concentration of random sequence DNA.

MBs with 1, 2, 3 and 4 Internally Labeled Quenchers

To see how the number of quenchers in a MB sequence affects the background

signal of the closed-stem conformation MB, MBs with different number of quenchers

were synthesized (Figure 3-6). For fair comparison, these MBs were designed in such a

way to have the same loop structure and similar stem stability. Thermodynamic

calculations using the mfold program showed that free energies for the single quencher

MB, dual-quencher MB, Tri-quencher MB and Quad-quencher MB are -2.6, -2.7, -2.7, -









2.7 kcal/mole respectively.78 Secondary structure prediction gave a single hair-pin

structure for each sequence.78 All MBs were prepared according to the same synthesis

and purification protocols.

/CCA-CTA cA-C-CT- A C A-C-T-A C A-C-T.,
1 \/ \ T .T/ \T / \T C
A\ A\ A \ A







T T T T. .
/ T / -r




V* c0-




COG COG CoG
G*C
(a) (b) (c) (d)

Figure 3-6 Secondary structures of Single-Q-MB (a), Dual-Q-MB (b), Tri-Q-MB(c) and
Quad-Q-MB (d). Fluorescein-dT phorsphoramidite and DABCYL-dT
phosphoramidite were used as the internal fluorophore and quencher labels
respectively.

Figure 3-7 shows the HPLC analysis result of these four MBs. The retention time

of the MB increases as the number of quencher molecules increases. The longer retention

time is accounted for by the greater hybrophobicity of the quencher moieties. All of the

MBs were synthesized in 400 nmole scale except Tri-Q-MB, which was synthesized in

800 nmole scale. The overall synthesis efficiency decreased as the number of quenchers

in a sequence increased as estimated from the peak areas in HPLC. During the HPLC

purification, the fluorophore labeled truncated DNA sequence came out first, followed by

the Single-Q-MB, Dual-Q-MB, Tri-Q-MB, and the Quad-Q-MB eluted out last. The

longer retention times allows the multiple-quencher MB sequences to be well separated

from fluorescent impurities.







60





















1125 1150 1175 1200 1225 1250 275
Minutes
Figure3-7. HPLC profile of Single-Q-MB(blue), Dual-Q-MB(red), Tri-Q-MB(pink), and
Quad-Q-MB (green).

Under the same conditions, the hybridization of the MBs was conducted and

compared. As seen in Figure 3-8, except for the Quad-Q-MB, MBs with more quencher

molecules gave lower background signal. All the molecular beacons had similar

fluorescence intensity when 5 time excess of cDNA was present. The decrease in

background signal yielded better signal enhancement for multiple-quencher MBs. (Figure

3-9).


8. 160-
7. s 140
6 6 120



3-. 60
2- 40
0 1 0 20
0 0
SINGLE-Q-MB DOUBLE-Q-MB TRIPLE-Q-MB QUAD-Q-MB SINGLE-Q-MB DOUBLE-Q-MB TRIPLE-Q-MB QUAD-Q-MB


Figure 3-8. Fluorescent intensity of 65 nM MBs at close state (left) and opened state
(right). 315nM cDNA was used in the hybridization experiments.










When the quencher number increased to four per MB sequence, the stem structure

became less stable, which resulted in slightly higher background intensity, and thus lower

signal enhancement for the quad-quencher MB.



70-

60-

S50

40-

5 30

20

10-


SINGLE-Q-MB DOUBLE-Q-MB TRIPLE-Q-MB QUAD-Q-MB



Figure 3-9 Signal enhancements of MBs. The regular molecular beacon is labeled with a
DACYL at 5' and a TMR at 3'.

The results from this experiment suggest that increasing the number of quencher

molecules can be an effective way to improve the fluorescence quenching efficiency of

the quencher moiety in a molecular probe. Because the FRET efficiency is inversely

proportional to the 6th power of the donor-acceptor distance, the multiple quenchers have

negligible quenching effect when the MB is opened. As a result, the multiple quenchers

mostly decrease the background emission of the MB and improve the overall signal

enhancement.

While is easy to incorporate multiple quencher molecules in the stem of MBs by

directly using the dye labeled bases, such a side labeling strategy has its limitations. First,

coupling of multiple-dye labeled bases to a sequence is time-consuming and the overall









efficiency drops significantly with the increased coupling steps. Second, the use of dye-

labeled base in the stem of a molecular beacon limits the freedom to design a MB

sequence because the availability of the dye labeled reagents. Third, the dyes are attached

to the base of a nucleotide, which might affect the stability of the stem by weakening

base pairing. Fourth, there are normally only 5-6 base pairs in an MB stem, which limits

the number of quencher molecules that can be used. And finally, the nature of side

labeling prevents close interactions between the quenchers and the fluorophores, thus

maximum quenching efficiency can not be achieved. To overcome these limitations, a

second labeling strategy-the externally labeling of multiple quenchers was developed

and tested.

MBs with Externally Labeled Multiple Quenchers-Assembling of Superquenchers

The second approach of labeling multiple quenchers in a molecular beacon probe

utilizes dendrimeric linkers103;104 to assemble different number of quencher molecules to

the end of the DNA sequence.79 The synthesis of the multiple-quencher molecular beacon

as shown in Figure 3-2 was started with a fluorophore CPG column. DNA bases were

then coupled one by one as programmed in a DNA synthesizer. Following the coupling

of the the 5' base, a dendrimeric phosphoramiditel03;104 was coupled before incorporation

of the quencher molecules. The dendrimeric phosphoramidite generated multiple

reactive OH groups for the subsequent coupling of quencher molecules. The number of

OH groups generated varies depending on the type of dendrimeric phosophoramide linker

used. For example, a trebler phorsphoramidite (Figure 3-10) has three OH groups once

activated, allowing the coupling of three quencher molecules to the end of the DNA

sequence. A symmetric doubler is a linker for the introduction two quencher molecules.

Utilizing different protecting groups, the asymmetry linker can be used to introduce









different type of molecules in a controllable manner. More quencher molecules can be

coupled by the sequential addition of dendrimeric linkers to the end of the DNA sequence

before adding the quencher molecule. The post-synthesis treatment of the molecular

beacon, including deprotection, desalting, and purification, followed the same procedure

used to produce normal molecular beacons. The sum of the extinction coefficients of the

oligonucleotide sequence, quenchers, and fluorophores at 260 nm was then used for

product quantitation.

o o
DMTO0O- DMTO NH FmocO0 H

DMT O- -P-N O-P-N
MDMTOr Io- --O C N
I I NH I /
DMTO O CNEt DMTO0O CNEt DMTOO CNEt

Trebler Phosphoramidite Symmetric Doubler Phosphoramidite Asymmetric Doubler Phosphoramidite




Figure 3-10. Structures of the dendrimeric linkers used to assemble multiple quenchers to
the end of molecular beacon sequences.


A MB with three DABCYL quencher molecules was first synthesized and tested.

Figure 3-11 compares the hybridization result of this three-quencher beacon MB3F53D

with that of a single-quencher beacon MB3F51D of the same sequence and same

fluorophore. Under the same experimental condition, the three-quencher MB had a signal

enhancement as high as 326-fold upon hybridization to its cDNA. This enhancement is a

dramatic improvement compared to the 14-fold enhancement obtained from the single-

quencher MB. This comparison clearly indicates that the dendrimeric quencher assembly

dramatically improves the SBR of the MB. Figure 3-12 shows that the three quencher

MB had high selectivity by exhibiting single mismatch discrimination ability. These







64


assemblies were called superquenchers because of the excellent quenching efficiency

demonstrated by the dendrimeric quenchers.


0.1
MB 3F51D


MB 3F53D


Figure 3-11 Signal enhancement of MB 3F51D, a regular beacon, and MB 3F53D, a
beacon with three end-label quenchers. In both case, the molecular beacons
are 65nM, and the c-DNA concentration used is 325nM.


- cDNA
- Mismatch
Noncomplementary


0 500 1000 1500 2000 2500 3000
Time (second)


Figure 3-12 Response of 65nM MB 3F51D to 325nM perfect matched DNA
(complementary to its loop), single base mismatched DNA and 10 times
concentration of random sequence DNA.

The bulky structure of the superquencher assembly does not destabilize the MB

stem because quencher molecules are attached to the end of the molecular beacon

sequence rather than in the middle interior of the stem. Instead, the superquencher










actually helps stabilize the hair-pin structure of the MB, as evidenced by the melting

temperatures (Tm) of the MBs (Figure 3-13). Results from melting temperature

measurement experiments indicated that the single-quencher MB had a Tm of about 54.2

C while the triple-Quencher MB has a Tm as high as 59.1C. The Tm of the SQ labeled

MB was about 4.9 C higher than that of a regular MB. This stabilization is likely a result

of the enhanced hydrophobic interaction between the fluorophore and quenchers.


1.0- -*- Single-Quencher MB | :U.
a Triple-Quencher MB
6. /..





I O0 /'

o 0.2- Single-Quencher MB
g T =54.2+0.4C or Triple-Quencher MB
0'. T.=59.1+0.2 OC
0.0 ,- ***********1'

10 20 30 40 50 60 70 80 90
Temperature (C)
Figure 3-13 Melting temperature of a single-quencher MB and Triple-Quencher MB.

Superquenchers from Different Number and Types of Quenchers

Using dendrimeric liners shown in Figure 3-10, the number of conjugated

fluorescence acceptor molecules can be controlled. Figure 3-14 shows the absorbance of

a series of molecular beacons with different numbers of DABCYL molecules. These

molecular beacons are labeled with fluorescein at the 3' end, and have the same stem and

loop sequence. When the number of DABCYL molecules increases, the absorbance at

400-500nm increases accordingly. Figure 3-15 shows a linear response of A460nm to the

number of quencher molecules added. This shows that the superquencher can be

engineered with a desired extinction coefficient. When the number of quencher molecule









increased from 1 to 3, as indicated in Figure 3-16, the signal enhancement of the MBs

increased accordingly. It is expected that with more quencher molecules attached, a

higher signal enhancement may be attained. Surprisingly, however, molecular beacons

with quencher molecules greater than three had a lower SBR than that of a three-

quencher molecule beacon. This seems to contradict to the assumption that the the

quenching capability increases with the number of quencher molecules, as indicated in

Figure 3-15. A closer look at the structure of the MBs explains why molecular beacon

with 4, 6 and 9 quenchers have lower signal enhancement than the MB with three

quenchers. For all of the MBs with more than three quencher molecules attached, a

second generation of dendrimeric linkers were required for quencher coupling. The two

and three-quencher MBs, on the other hand, only required a single layer of dendrimer

linker. Figure 3-17 shows the structures of a six-quencher MB and a three-quencher MB.

Because the six-quencher MB uses two layers of dendrimer linkers for the coupling of

quencher molecules, the quencher molecules are about 10 carbon-carbon bonds further

away from the fluorophore molecule in the closed-stem conformation. Due to the strong

distance dependence of FRET, the increased separation of the quenchers from the

fluorophore significantly decreases their FRET efficiency. In addition, such a separation

might exclude the presence of static quenching, another avenue for quenching in

molecular beacons.12 Although the six-quencher complex has a higher overall extinction

coefficient, the quenching efficiency of the six-quencher MB is lower than the three-

quencher MB. The linker length between dC and FAM at 3' end may be further optimized

to improve the SBR of these superquencher labeled MBs.












- MB3F59D
MB3F56D
- MB3F54D
MB3F53D
- MB3F52D
- MB3F51D


250 300 350 400 450 500 550 600 650 700
Wavelength (nm)


Figure 3-14. UV spectra of molecular beacons with different quencher molecules. The
third digit in each legend designates the number of quencher molecules used.
For example, MB3F 59D D20 stands for the molecular beacon with 3' FAM
label while the 5' labeled with 9 DABCYL molecules.


I I
o 2


Quencher Number I
4 6
Quencher Number


I I
8 10


Figure 3-15. A460nm of same concentration of molecular beacons with different
quencher molecules.







68



350- 326

300-

S250-

S200-

L 150
UJ 109
1082 71
100.

50 14 16

MB3F51D MB3F32D MB3F53D MB3F54D MB3F56D MB3F59D




Figure 3-16. Signal enhancements of MBs with different number of quenchers


ATCACTATG ATCACTATG
A G A G

TCTC.GC TCTCCGC
G C G C
A*T A*T
T:A T:A
C*G CeG
5' C G 3' 5' C G 3'







/ 7 {








Figure 3-17. Structures of a six-quencher MB(left) and a three-quencher MB(right).
Because the six-quencher MB uses two dendrimer phosphoramidites to couple
quencher molecules, the quencher molecules are about 10 more C-C bond far
way from FAM molecule.

Not only can different numbers of quencher molecules be assembled to make

superquenchers with different quenching efficiencies, the type of quencher molecules can

also be varied. This is demonstrated by the performance of a superquencher with three










ECLIPSE quencher molecules. Labeled with such a superquencher and TMR

fluorophore, a MB probe has a signal enhancement as high as 250-fold (Figure 3-18).

CACTAT 16
T G
A G
A T 14-
A C
Tc G
TCtGC 12-
G*C >
AOT
A.T (4
TeA 10
C G
CGG C,
GeC c o
0-'/ NO 8-
\ 08--o
OP-O 0) 4


SLL 4
j j"' .H 2




04. 0 400 800 1200 1600
Time (Second)

(a) (b)

Figure 3-18: TMR labeled superquencher MB. (a) Structure of a molecular beacon with a
Superquencher consisting of three Eclipse quenchers and (b) hybridization of
this molecular beacon with target DNA.

The freedom in assembling different numbers and types of quenchers has important

implications in fluorescent probe design. For example, superquenchers with different

maximum absorption wavelengths and extinction coefficients can be generated to quench

different fluorophores with excellent quenching efficiency. Furthermore, by assembling

different types of quencher molecules, a superquencher with broad absorption range

could be synthesized and used as a universal quencher moiety. We prepared SQ MBs

with fluorophores such as TMR and Cy3. Excellent SBRs were observed for both of

these dyes. For instance, the SQ MB with Cy3 showed a signal increase of 260 fold upon

target hybridization (Figure 3-19).












270-
S240-
S210-
180-
2
M 150-
U
M 120-
- 90-
60-
30-


108


0 400 800 1200 1600 2000 0
Tri-Q--cy3 MB Slngle-Q-cy3 MB
Time (seconds)
(a) (b)


Figure 3-19. Response of 65nM of Cy3 labeled Triple-Quencher MB to 325nM of target
DNA (a) and comparison of S/B of Tri-Q-Cy3 MB to that of single-Q-cy3
MB (b). Both MBs had the same sequence except different quenchers were
used (Quencher-CC TAG CTC TAA ATC ACT ATG GTC GCG CTA GG-
Cy3). All hybridization experiments were carried out in 20mM Tris-HCl
buffer (pH7.5, 50mM NaCl and 5mM MgC12)

Superquencher Outperforms Gold Nanoparticle

The excellent performance of the SQs was further evidenced in MBs with different


sequences. Several reported MB82;105;106 sequences were synthesized (Table 3-2). Up to

300 fold enhancement of SBR was observed for the MBs synthesized with SQs (Figure3-

20). This was about a 20 time improvement compared to the reported value with regular

MBs.

Table 3-2. Molecular beacon sequences
Name Source Sequence
MBS1 Methods Mol Biol 212, 111 FAM-
CGCACCTCTGGTCTGAAGGTTTATTGGTGCG-
DABCYL
MBS2 Antisense Nucleic Acid Drug Dev FAM-
12,225 CGCCATGACACTAGCATCGTATCAGCATGGCG-
DABCYL
MBS3 Nat Biotechnol 19, 365 FAM-GCGAGTTTTTTTTTTTTTTTCTCGC-Gold







71


240. 220-
220 200M 180
S200" o 180. 160-
180- 160- 140-
-a160- 140- 120-
S140
00 120
S120- 120 2 100-
g 100
S100- a 80-
Cm 80. Cu
80 ?60 60
o 60 6
40 40 40-
.) 40" .
O 20c 20- 20-
0 .0 0
MBS1 MBS2 MBS3


Figure 3-20. Comparison of SBRs of molecular beacons labeled with Superquencher
(Green) to those (Red) of MB labeled with normal quenchers (MBS1, MBS2)
or gold nanoparticle (MBS3).

It should be noted that MBS3 was originally labeled with a gold nanoparticle.82

With their exceptional quenching capability, gold nanoparticles have been successfully

used to construct FRET based probes82;83. When used as a quencher in an MB, the

average quenching efficiency of the gold nanoparticle to fluorescein has been shown to

be as high as 98.68%82, which is equivalent to about 76-fold of SBR(Figure3-19). A

dendrimeric quencher, with three DABCYLs, surprisingly, shows a better quenching

efficiency than the gold particle. Furthermore, compared to the gold nanoparticle, the

superquencher is much easier to synthesize and manipulate. The superquencher can be

separated with high purity and used over larger range temperatures. In contrast, the gold

nanoparticle is unstable, which prevents gold-quenched MBs from being separated from

the dye-oligonucleotides, and from being used in any temperatures higher than 50C.82

Use of Superquencher for Molecular Probe Labeling

To further demonstrate the universal applicability of superquenchers for FRET

based probes, we used SQ consisting of three DABCYLs to label one end of a synthetic










DNA aptamer for the B-chain of platelet derived growth factor (PDGF) 21;107. Figure 3-21

shows the response of the dual labeled aptamer, where 5' labeled with three DABCYLs

and 3' with fluorescein, to the addition of PDGF-BB. Contrary to MBs, this aptamer

changes its conformation from an open-stem to close-stem conformation upon binding to

PDGF protein, which brings the quencher moiety close to the fluorophore. As a result of

the conformational change, the fluorescence intensity from the fluorophore decreases.

Upon binding to PDGF, the SQ labeled aptamer underwent a change of fluorescent

intensity from 294770 to the level of the buffer background (Figure 3-21). The

fluorescent intensity changed by a factor of more than 49,000. This indicated that the

quenching efficiency of the SQ to fluoresein is greater than 99.99%. This is a dramatic

improvement considering that binding of the same aptamer with a single DABCYL label

to PDGF only produces about a 95% quenching efficiency.


MB 75 nM
30 FL=294770
30-




S15-

10- Buffer
FL=1284 PDGF:MB=150nM:75nM
S5- FL=1290
U P P
0" 51
0 50 100 150 200 250
Time(second)

Figure 3-21. Response of a Superquencher labeled Aptamer Beacon to the addition of
target protein PDGF-BB









Conclusions

This chapter has shown that the multiple-quencher labeling approach can

effectively improve the quenching of fluorophores in molecular probe designs. Two ways

of labeling quencher molecules to a molecular beacon sequence were developed and

compared. Both approaches proved that increasing the number of quenchers from 1 to 3

in MBs significantly increases the SBR of the probe.

Integrating multiple quenchers in an MB sequence has two important effects. First,

increasing the number of quencher molecules to an adjacent fluorophore greatly increases

the overall quenching ability of MB in the close state. Second, the multi-quencher in a

molecular beacon sequence helps improve the purity of the probe. The hydrophobicity of

the quencher molecules greatly increases the retention time of the probe in the reverse

phase HPLC, which significantly improves the separation efficiency. Overall, the

introduction of multiple quenchers in a molecular beacon effectively reduces background

fluorescence by both significantly increasing quenching efficiency of MB and improving

the purity of MB.

Compared to the internal labeling approach, the end labeling of multiple quenchers

through dendrimeric linker exhibited the following advantages: easy synthesis, high

coupling yields, no observable adverse effect on the stem stability, greater flexibility for

stem design, and wider selection of fluorophore and quenchers combinations. The second

approach has three distinguished features. First, the SQ assembly shows unique

properties for engineering molecular probes. Compared with a regular MB, a SQ

constructed MB has better sensitivity, higher purity, and stronger thermal stability.

Second, the assembly scheme can be widely useful for different types of quencher

molecules. Third, the SQ can be used for different fluorophores and in different types of






74


probes. The SQs used for signaling aptamer-protein interactions generated more than

49,000 fold signal changes when PDGF aptamer bound to PDGF. No detrimental effects

of these SQs on the performance of these probes were observed. The approach of

assembling SQs can effectively improve the sensitivity of a variety of fluorescence

assays and may be very useful for molecular interaction studies.92108














CHAPTER 4
LIGHT SWITCHING EXCIMER PROBES FOR RAPID PROTEIN MONITORING IN
COMPLEX BIOLOGICAL FLUIDS

Introduction

Proteins are ubiquitous and essential for life. Detection of proteins in their native

environments has always been a critical and challenging task. In the proteomics era,

numerous disease marker proteins are expected to be discovered from a variety of

complex biological systems109-111. Methods for the analysis of proteins have become

indispensable tools in new disease marker discovery and protein function studies.

Ultimately, assays that allow rapid, simple, sensitive, selective and cost-effective

detection of the proteins discovered are of significant importance for the understanding,

diagnosis, treatment, and prevention of many diseases. Key factors including a highly

selective molecular recognition element and a novel signal transduction mechanism have

to be engineered together for successful assay development. Among many molecular

recognition elements, synthetic nucleic acid ligands (aptamers)4-6 have gained increasing

attention in this area. Aptamers are single-stranded oligonucleotides selected to bind to

essentially any molecular target with high selectivity and affinity through an in vitro

selection process called SELEX (Systematic Evolution of Ligands by EXponential

enrichment)4-6. Aside from their excellent binding affinity and selectivity, other

characteristics endow aptamers with great potential for use in protein analysis.19112 For

instance, aptamers can be routinely prepared by chemical synthesis, allowing for rapid

preparation in large quantities with excellent reproducibility. Nucleic acid synthetic









chemistry also facilitates conjugation of these aptamer sequences to fluorescent dyes,

radiolabels, or other biomolecules. Furthermore, aptamer sequences are more stable than

proteins under a wide range of conditions and can be repeatedly used without losing their

binding capabilities.

In order to report the binding of an aptamer to its target, a signal transduction

mechanism has to be built into the aptamer sequence. Fluorescent techniques offer

excellent choices for signal transduction because of their non-destructive and highly

sensitive nature. Several fluorescence techniques such as fluorescence anisotropy19;112

fluorescence resonance energy transfer (FRET)113, as well as fluorescence

quenching20;37;113 have been used in aptamer assay development. All these signal

transduction techniques have their individual strengths. Nonetheless, they suffer from

several limitations that could hamper their effectiveness in complex biological samples.

For instance, although fluorescence anisotropy only requires labeling of one dye

molecule on each aptamer sequence, it entails complicated instrumentation and data

interpretation. FRET or fluorescence quenching based probes quantify target

concentrations with changes in fluorescence intensity, but these two methods are also

sensitive to the solution environment. More importantly, they are difficult to be directly

applied to analyzing proteins in their native environments because of interference by

intense background signal.

When monitoring a protein in its native environment, there are usually two

significant background signal sources. The first one is the probe itself. For example,

when a quenching-based FRET molecular probe is used for protein studies, the probe

always has some incomplete quenching, resulting in a significant probe background.









Moreover, in a native biological environment, there are many potential sources for false

positive signals of the molecular probe for protein analysis. The second source of

background signal comes from the native fluorescence of the biological environment

where the target protein resides. There are many molecular species in a biological

environment, some of which will give a strong fluorescence background signal upon

excitation. These problems adversely affect assay sensitivity, compromise probe

selectivity and thus hinder the analysis of proteins. Although there have been great efforts

in solving these problems in bioanalysis114, effective solutions to both problems are

limited.

To address these problems, we have engineered a novel light switching excimer

aptamer probe for protein monitoring in biological fluids by using both steady-state and

time-resolved fluorescence measurements.7 This strategy is a combined approach of

wavelength switching and time-resolved measurement to solve the significant problems

of monitoring proteins in their native environment. Our approach is to label a molecular

aptamer with pyrene, similar to what has been reported in using pyrene for molecular

beacons16. The aptamer sequence that binds with high affinity to the target protein PDGF-

BB is labeled with pyrene molecules at both ends. The specific binding of aptamer to its

target protein changes the aptamer probe conformation, bringing the two pyrene

molecules into close proximity to form an excimer (excited state dimer), which results in

a change of fluorescence wavelength from about 400 nm for the pyrene monomer to 485

nm for the pyrene excimer. This emission wavelength switching solves the probe

background signal problem that occurs with FRET molecular probes. However, this alone

can not solve the problem of strong background signal from the multiple species in the









biological environment. One special feature of the pyrene excimer is that it has a very

long fluorescence lifetime14 compared with other potential fluorescent species. The

lifetime of the pyrene excimer can be 100 ns or longer, while that for most of the

biological background species is shorter than 5 ns. With time-resolved fluorescence

measurements, target binding induced excimer signal can be separated from biological

background interference. Combining light switching and time-resolve measurements, we

are able to detect picomolar PDGF-BB in a few seconds. Therefore, direct detection and

quantification of target molecules in complex biological samples can be carried out

without any need of sample clean-up.

Experimental Section

Chemicals and Reagents.

The sequences of oligonucleotides and aptamer probes prepared are listed in Table

1. DNA synthesis reagents were purchased from Glen Research (Sterling,VA). Four

aptamer sequences with different lengths shown in Table 1 were synthesized: ES3, ES4,

ES5, and ES6 (excimer probes with 3, 4, 5, and 6 bp in the stem, respectively). All the

aptamer sequences were labeled with pyrene at both ends. PS3 was an aptamer sequence,

but only singly labeled with pyrene at the 5' terminus. ESCRBL was a 39mer scramble

oligonucleotide sequence with pyrene labeled at both ends.

Table 4- 1. Probes and oligonucleotides used in PDGF binding study
Name Sequence
ES3 Pyr-AGGCTACGGCACGTAGAGCATCACCATGATCCT-Pyr
ES4 Pyr-CAGGCTACGGCACGTAGAGCATCACCATGATCCTG-Pyr
ES5 Pyr-ACAGGCTACGGCACGTAGAGCATCACCATGATCCTGT-Pyr
ES6 Pyr-CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG-Pyr
PS3 Pyr-AGGCTACGGCACGTAGAGCATCACCATGATCCT
ESCRBL Pyr-GGAACGTAATCAACTGGGAGAATGTAACTGACTGC- Pyr









Recombinant human PDGF-BB, PDGF-AB, and PDGF-AA were purchased from

R&D Systems (Minneapolis, MN) and dissolved in 4 mM HC1 with 0.1% BSA and then

diluted in a Tris buffer (pH 7.5) before use. Other recombinant human growth factors,

including recombinant human epidermal growth factor (EGF) and insulin-like growth

factor 1 (IGF-1), were from Roche (Indianapolis, IN). Human bovine serum albumin

(BSA), human hemoglobin (HEM), horse myoglobin (MYO), chicken lysozyme (LYS),

human a-thrombin (THR) and other chemicals were from Sigma (St. Louis, MO). A

solution of 0.1 M triethylamine acetate (pH 6.5) was used as HPLC buffer A and HPLC

grade acetonitrile (Fisher) was used as HPLC buffer B. Tris-HCl buffer (20mM Tris-HC1,

20 mM NaC1, pH 7.5) was used for all buffer solution based aptamer binding

experiments. Except for the cell media, ultrapure water was used to prepare all the

solutions. The cell media, Dulbecco's Mofication of Eagle's Medium (DMEM)

(Mediatech, Inc, Herndon, VA) supplemented with 10% Fetal Bovine Serum (Invitrogen,

Carlsbad, CA), was used for the detection of PDGF using time-resolved measurements.

Instruments.

An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was

used for DNA synthesis. Probe purification was performed with a ProStar HPLC (Varian,

Walnut Creek, CA) where a C18 column (Econosil, 5U, 250x4.6 mm) from Alltech

(Deerfield, IL) was used. UV-Vis measurements were performed with a Cary Bio-300

UV spectrophotometer (Varian, Walnut Creek, CA) for probe quantitation. Steady-state

fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer

(Jobin Yvon, Inc., Edison, NJ). For emission spectra, 349 nm was used for excitation.

Time-resolved measurements were made with a single photon counting instrument









(OB900, Edinburgh Analytical Instrument), where a nitrogen flash lamp was used as the

excitation source (X=337 nm).

Synthesis and Purification

A solid-phase synthesis method was used to couple pyrene to aptamer sequences at

both 3' and 5' ends. The synthesis started with a 3'-amino-modifier C7 controlled pore

glass (CPG) column at 1 [mol scale. Following the synthesis of the aptamer sequence, a

5'-amine was added to the sequence using 5'-amino-modifier-C6 linker phosphoramidite.

The column was then flushed slowly with 15 ml of DMF, 15 ml of 20% piperidine in

DMF, 15 ml of 3% trichloroacetic acid in dichloromethane, and then another 15 ml of

DMF. The CPG contained within the column was released into lml of DMF solution

containing 57.7 mg (200 [tmol) of pyrene butyric acid, 41.3 mg (200 [tmol)

dicyclocarbodiimide and 24.4 [tg (200 [tmol) of dimethylaminopyridine. After stirring for

three hours, the solution was centrifuged and the supernatant was discarded. The pellet

was washed three times with DMF, methanol, and water respectively before incubated in

a 50% solution of methylamine in ammonia at 650C for about 10 minutes. The resulting

clear and colorless supernatant was collected. Under UV radiation, an intense green

fluorescence was observed. The aptamer solution was desalted with a Sephadex G-25

column (NAP-5, Pharmacia) and dried in a SpeedVac. The dried product was purified by

HPLC using a C18 column with a linear elution gradient with buffer B changing from

25% to 75% in 25 minutes at a flow rate of 1 ml/min. The second peak in

chromatography that absorbed at 260 nm and 350 nm, and emitted at 400 nm with 350

nm excitation was collected as the product. The collected product was then vacuum dried,

desalted with a G-25 column and stored at -200C for future use.









Results and Discussion

Design Light Switching Excimer Aptamer Probe

Some spatially sensitive fluorescent dyes, such as pyrene11'14-16, BODIPY F117ls,

can form excited state dimers (excimers) upon close encounter of an excited state

molecule with another ground state molecule. The excimer emits at a longer wavelength

than does a monomer. The formation of excimer between two pyrene molecules that are

connected by a flexible covalent chain is useful to probe spatial arrangement of some

molecules. Similar to FRET, the stringent distance-dependent properties of excimer

formation can be used as a unique signal transduction in the development of molecular

probes. This is especially useful for developing aptamer probes due to the fact that a

variety of aptamers, like those for PDGF-BB 9-21, cocaine22, thrombin23 24, and HIV1 Tat

protein38 undergo similar conformational changes upon target binding.

As a proof of principle, the excimer signaling approach was used to develop a

probe for PDGF-BB. Identified by Green et al, the PDGF-BB aptamer is a DNA

sequence with an open secondary structure in the absence of protein (Figure 4-1). When

the aptamer binds to PDGF-BB, it changes to a closed conformation where the 3' and 5'

ends hybridize and form a stem. Based on this, an excimer switching aptamer probe has

been developed by labeling both ends with dyes that can form excimers. When the dual-

pyrene-labeled aptamer probe is free in solution without the target protein, both pyrene

molecules are spatially separated and only the monomer emission peaks (at 375 nm and

398 nm) are observed. The binding of the aptamer probe to the target protein brings the

pyrene molecules at 3' and 5' ends together, allowing the formation of an excimer. Thus,

the emission peak appears around 485 nm. The change in emission color serves as a rapid









way for qualitative analysis and the excimer fluorescence intensity can be used for highly

sensitive real-time quantitation of PDGF in homogeneous solutions.








PDGF




Figure 4-1. Use of the pyrene excimer to probe PDGF. PDGF aptamer (red) is end
labeled with pyrene molecules (blue) that are separated from each other
because of the open structure of the aptamer. The pyrene molecule has
monomer emission peaks at around 378 and 398 nm respectively. After
binding to PDGF (purple), the aptamer adapts a closed conformation, bringing
two pyrene molecules close to each other. Consequently, pyrene excimer
(green) forms and green light (around 485 nm) is emitted after photo-
excitation.

Synthesis of dual Pyrene Aptamer Probe

The first step to prepare an excimer aptamer probe is to label an aptamer sequence

with pyrene molecules. A typical method used to label a DNA sequence is based on the

reaction between the 3' and 5' terminal-labeled primary amine of the aptamer with a

carboxylated pyrene. Another method of coupling pyrene to DNA is through reacting the

5'-OH to some precursor dye molecules like N-(1-pyrenepropyl) iodoacetamide, while

attaching 3'-terminal ribose by the carbonyldiimidazole method using pyrenebutanoic

acid.115 Unfortunately, both aforementioned methods suffer low coupling yields as a

result of incompatible solubility between DNA and pyrene. Pyrene is very hydrophobic

and prefers nonpolar solution as opposed to oligonucleotides favoring hydrophilic

conditions. In fact, we attempted to couple terminal amine-labeled aptamers sequences to

pyrenebutyric acid, but it turned out not feasible because a large volume of solvent was









required to use in order to solve solubility problem. Fujimoto et a'16 introduced a method

of labeling single-stranded DNA with pyrene at both 3' and 5' end. Pre-synthesized

pyrene phosphoramidite was used to automatically couple pyrene to the 5' end of an

oligonucleotide on a DNA synthesizer while pyrene succinimidyl ester was used to

couple to the 3' end of the oligonucleotide using a C3 alkylamino linker. Although the

efficiency of pyrene-oligonucleotide coupling can be improved by using pyrene

phosphoramidite on the DNA synthesizer, the preparation of the phosphoramidite is time

consuming, labor intensive and requires advanced synthetic expertise.

The solid phase coupling method used in our work provides a simple and universal

way of multi-labeling organic dyes to DNA sequences. An amine controlled pore glass

(CPG) and 5' amino phosphoramidite were used for amine-labeling 3' and 5' ends of the

aptamer, respectively. The 3'-amine was protected with a fluorenylmethoxycarbonyl

(Fmoc) group and the 5'-amine with a trityl group, which were removed by piperidine

and trifluoroacetic acid, respectively. With a hydrophobic protecting group on its bases,

the resulting oliogonucleotide was soluble in organic solvents. In DMF, pyrenebutyric

acid was easily coupled to the activated amine groups on the aptamer termini with the

mediation of dicyclocarbodiimide. This solid phase coupling method has several

advantages when compared to the other methods. First, it eliminates the use of large

amounts of solvents. Second, the coupling reaction takes place in organic solvents which

results in a higher coupling yield due to the absence of a hydrolysis competition reaction.

Third, it is straightforward, easy, and time saving. Minimal organic synthesis expertise is

required and the coupling reaction finishes within three hours. Finally, the large excess of

un-reacted pyrene dyes can be simply removed with a centrifugation process. After the




Full Text

PAGE 1

MOLECULAR ENGINEERING OF NUCLEIC ACID PROBES FOR INTRACELLULAR IMAGI NG AND BIOANALYSIS By CHAOYONG JAMES YANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Chaoyong James Yang

PAGE 3

Dedicated to my wife Hui Lin.

PAGE 4

iv ACKNOWLEDGMENTS I am deeply indebted to a long list of pe ople, without whom this dissertation would not be possible. First, I wish to express my gratitude to my research advisor, Dr. Weihong Tan. The advice and suggestions from Dr.Tan made my projects go more smoothly. The encouragements and support he constantly delivered kept me studying. The help he generously offered in different ways made life in a totally different country a lot easier. Also, I thank Dr. Charles Martin, Dr. Le onid Moroz, Dr. Jon Stewart, and Dr. James Winefordner, for having agreed to be part of my graduate committee. The advice, assistance, and encouragement from my committee are highly appreciated. This dissertation is a result of successful collaborations with scientists in different areas. I would like to thank Dr Kirk Schanze and his postdoc Dr. Mauricio Pinto for the successful collaboration on the conjugated polym er project. I greatly appreciate Dr. Nick Turro and his postdoc Dr. Steffen Jockush at Columbia University for working with us on the excimer projects. I am very thankful for the critical comments and helpful discussions from Dr. Leonid Moroz and Dr. Steve Benner on molecular beacon designs. I would like to thank Ms. Lin Wang for her hard work on different productive side-projects. Karen Martinez is acknowledged for working on the li near probe. I thank Dr. Marie Vicens for working on the PDGF project. I also would lik e to thank Colin Medley for his help in cellular imaging of LNA MBs a nd linear probes. Dr. Zunyi Ya ngs help in ion exchange HPLC analysis is greatly appreciated. Finally I am especially grateful to Josh Herr and Patrick Colon for their research assistance.

PAGE 5

v The Tan research group is a great place to work in. The help and friendship from former and current group members make my memory of Gainesville an enjoyable and unforgettable one. I would like to thank Dr Ji anwei Jeff Li, Dr. Kens uke Arai, Dr. Steven Suljak Dr. Gang Yao, Dr. Peng Zhang, Dr Julia Xiaojun Zhao, Dr. Min Yang, Dr. Swadeshmukul Santra, Dr. Shelly John, Dr Hong Wang for their support and advice in my research. I am also very thankful to Dr. Ruby Tapec-Dytioco, Dr. Monde Qhobosheane, Dr. Zeihui Cao, Dr. Charle s Lofton, Dr. Shangguan Dihua, Dr. Zhiwen Tang, Dr. Lisa Hilliard, Dr. Timothy Drake, Dr. Marie Vicens, Alina Munteanu, Joshua Smith, Karen Martinez, Prabodhika Mallikaratchy, Lin Wang, Li Tan, Colin Medley, Hui Chen, Kwame Sefah, Dosung Sohn, Youngmi Sohn, EunJun Lee, Yanrong Wu, Huaizhi Kang, Yan Chen, Wenjun Zhao, Meng Ling and ODonoghue, Megan for their friendship, encouragement, and help. I am deeply indebted to my parents for their unconditional love, support, and guidance. I thank my sister and brothers fo r their love and financial support over the years. I am extremely grateful to my wife, Hui Lin, for being a wonderful friend, helpful colleague, and supportive spouse. It is her l ove, support, patience, care, encouragement, motivation and assistance of all kind that enable me to succeed. Last but not least, I th ank my lovely baby daughter, Wendy, for bringing me laughs, joy, cheer and in spiration everyday.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES...............................................................................................................x LIST OF FIGURES...........................................................................................................xi ABSTRACT.....................................................................................................................xv i CHAPTERS 1 INTRODUCTION........................................................................................................1 Probing Biomolecules in Living Cells..........................................................................1 Molecular Engineering of Nucleic Acid Probes...........................................................3 Chemical Synthesis of Nucleic Acids...........................................................................4 Fluorescence Methods for Signal Transduction...........................................................7 Jablonski Diagram.................................................................................................7 Fluorescence Quenching.......................................................................................9 Fluorescence Resonance Energy Transfer...........................................................11 Excited State Dimer-Excimer..............................................................................12 Working Principle of MBs..........................................................................................13 Using MBs for RNA Monitoring in Living Cells.......................................................15 Aptamers and Molecular Aptamer Beacons...............................................................21 Challenges of Using Nucleic Acid Probes for Intracellular Analysis........................25 Scope of This Research..............................................................................................26 2 DIRECT SYNTHESIS OF AN OLIGONUCLEOTIDE-POLY (PHENYLENE ETHYNYLENE) CONJUGATE WITH A PRECISE ONE-TO-ONE MOLECULAR RATIO..............................................................................................27 Introduction.................................................................................................................27 Experimental Section..................................................................................................30 Chemicals and Reagents......................................................................................30 Synthesis of PPE-DNA........................................................................................30 Instruments..........................................................................................................31 Fluorescence Quenching Experiments................................................................32 Results and Discussion...............................................................................................32 Biofuctionalization of Conjugated Polymer PPE................................................32

PAGE 7

vii Coupling of PPE Monomer and Oligomer to DNA............................................34 DNA Hybridization Study...................................................................................37 Direct Synthesis of DNA-PPE with One-to-One Ratio.......................................38 Design of PPE-MB for Signal Amplification......................................................41 Selection of Quencher and Fluorescence Quenching Study................................42 Synthesis of PPE-MB..........................................................................................45 Conclusions.................................................................................................................47 3 MOLECULAR ASSEMBLY OF SUPERQUENCHERS IN SIGNALING MOLECULAR INTERACTIONS.............................................................................49 Introduction.................................................................................................................49 Experimental Section..................................................................................................50 Molecular Beacon Synthesis...............................................................................50 Hybridization of MB...........................................................................................52 Results and Discussion...............................................................................................52 Design of Multiple-Q uencher MBs.....................................................................52 Internally Labeled Multiple-Quencher MBs.......................................................55 MBs with 1, 2, 3 and 4 Internally Labeled Quenchers........................................58 MBs with Externally Labeled Multiple QuenchersAssembling of Superquenchers................................................................................................62 Superquenchers from Different Nu mber and Types of Quenchers.....................65 Superquencher Outperforms Gold Nanoparticle.................................................70 Use of Superquencher for Mo lecular Probe Labeling.........................................71 Conclusions.................................................................................................................73 4 LIGHT SWITCHING EXCIMER PROBES FOR RAPID PROTEIN MONITORING IN COMPLEX BIOLOGICAL FLUIDS.........................................75 Introduction.................................................................................................................75 Experimental Section..................................................................................................78 Chemicals and Reagents......................................................................................78 Instruments..........................................................................................................79 Synthesis and Purification...................................................................................80 Results and Discussion...............................................................................................81 Design Light Switching Excimer Aptamer Probe...............................................81 Synthesis of dual Pyrene Aptamer Probe............................................................82 Light Switching Aptamer Probe for Real -time Rapid PDGF-BB Detection......84 Optimization of Aptamer Length........................................................................88 Selectivity of the Probe.......................................................................................90 Direct Quantitative Detection of PDGF in Cell Media.......................................91 Conclusions.................................................................................................................96 5 MOLECULAR ASSEMBLY OF LONGLIFE TIME FLUOROPHORES FOR BIOANALYSIS........................................................................................................100 Introduction...............................................................................................................100

PAGE 8

viii Experimental Section................................................................................................101 Materials............................................................................................................101 Instruments........................................................................................................102 Synthesis of Excimer MBs................................................................................102 Quantum Yield Measurement............................................................................104 Results and Discussion.............................................................................................104 Design of Excimer MBs....................................................................................104 Synthesis of Excimer MBs................................................................................107 Hybridization of Excimer MBs.........................................................................108 Time-Resolved Excimer Signaling Approach...................................................111 Tunable Intensity throug h Multiple Labeling....................................................116 Effect of Multiple Pyrene on the Stability and Kinetic of MBs........................118 Conclusions...............................................................................................................120 6 SYNTHESIS AND INVESTIGATI ON OF LOCKED NUCLEIC ACID MOLECULAR BEACONS......................................................................................122 Introduction...............................................................................................................122 Materials and Methods.............................................................................................125 Chemicals and Reagents....................................................................................125 Instruments........................................................................................................125 Molecular Beacon Synthesis.............................................................................125 Hybridization Study...........................................................................................126 DNase I Sensitivity............................................................................................126 RNase H sensitivity...........................................................................................126 Thermal Stability Studies..................................................................................127 Protein Binding Studies.....................................................................................127 Results and Discussion.............................................................................................127 Investigating MBs with All Ba ses Constructed from LNA...............................127 Hybridization Kinetics of LNA-MBs................................................................132 Thermodynamics of LNA-MBs........................................................................135 Elimination of Sticky-end Pairi ng in LNA-MB Hybridization.........................136 Modified LNA-MBs Show Faster Hybridization Kinetics...............................141 Minimal Binding of Single Stranded Binding Protein with LNA-MB.............142 Effect of LNA on Ribonuclease H Activity......................................................144 Conclusions...............................................................................................................147 7 HYBRID MOLECULAR PROBE FOR REAL-TIME NUCLEIC ACID ANALYSIS IN BIOLOGICAL SAMPLES.............................................................149 Introduction...............................................................................................................149 Experimental Section................................................................................................150 Results and Discussions............................................................................................151 Design of Hybrid Molecular Probes..................................................................151 Hybridization of Hybrid Molecular Probe........................................................153 Optimization of PEG Linker Length.................................................................155 Optimization of Acceptor-Donor Distance.......................................................158

PAGE 9

ix HMP for Surface DNA Hybridization Study....................................................158 Comparison of Hybrid Molecular Probe with MBs..........................................160 Conclusions...............................................................................................................163 8 SUMMARY AND FUTURE DIRECTIONS...........................................................165 Engineering Molecular Probes for Bioanl ysis and Intracellular Imaging................165 Future Directions......................................................................................................169 Exploration of New Materials for Signal Amplification...................................169 Development of New Probes with Better Stability, Selectivity and Kinectics.171 LIST OF REFRENCES...................................................................................................174 BIOGRAPHICAL SKETCH...........................................................................................185

PAGE 10

x LIST OF TABLES Table page 3-1 Sequences of MBs synthesized in this study............................................................51 3-2 Molecular beacon sequences...................................................................................70 41 Probes and oligonucleotides used in PDGF binding study......................................78 5-1 Quantum yields of multiple-pyrene labels.............................................................117 6-1 Molecular beacons and oligonucleot ides prepared in this study............................135 7-1 Sequences of HMP probes and MB MBTBL and their targets..............................151 7-2 Target DNA sequence with different numbers of dT............................................159

PAGE 11

xi LIST OF FIGURES Figure page 1-1 Automated oligonucleotide synthesis achieved through phosphoramidite chemistry....................................................................................................................5 1-2 A typical Jablonski diagram.......................................................................................8 1-3 The schematic for the formation of pyrene excimer................................................13 1-4 Working principle of MBs.......................................................................................14 1-5 Simultaneous monitoring of multiple genes inside a living cell..............................20 1-6 Schematic presentation of a typical SELEX process...............................................22 1-7 Signaling binding of aptamer to its target................................................................24 2-1 Schematic representation of solid st ate synthesis of DNA-PPE conjugate..............33 2-2 Model molecules used to couple to 5I-dU functionalized oligonucleotide..............34 2-3 The (-)ESI mass spectra of DNA-PPE monomer.....................................................35 2-4 The negative ESI mass spectra of DNA-PPE oligomer ..........................................36 2-5 The negative ESI mass spectra of control 16mer DNA...........................................36 2-6 Fluorescence enhancement of the MB after addition of cDNAs.............................37 2-7 Fluorescence emission spectra of DNA-PPE, and the control solution...................39 2-8 Fluorescence emission of PPE in agaros e gel stained with ethidium bromide........40 2-9 Gel electrophoresis of PPE-DNA (1), PPE (2), and DNA (3) samples....................41 2-10 Working principles of a MB and conjugated polymer labelled MB .......................42 2-11 Structures of some comonly used nonfluorescent quenchers for MB synthesis.....43 2-12 Stern-Volmer plot of PPE quenching by DABCYL................................................44

PAGE 12

xii 2-13 The emission (left) and Stern-Volmer plot (right) of 3 M PPE-SO3 quenched by various concentrations of QSY-7........................................................................44 2-14 The structure of PPE-SO3 low molecula r weight PE-SO3 and the Stern-Volmer plot of 3 M PE-SO3 quenched by va rious concentrations of QSY-7....................45 2-15 Schematic representation of solid stat e synthesis of conjugated polymer labelled MB............................................................................................................................4 6 2-16 Response of PPE labelled MB to its target DNA. MB sequence.............................46 3-1 Structure of an internal labele d three-quencher molecular beacon..........................54 3-2 Structure of an end-labeled multiple-quencher MB.................................................55 3-3 Signal enhancement of MB226 and Tri-Q MB........................................................56 3-4 Melting temperature curve of Tri-Q-MB.................................................................57 3-5 Response of 65nM Tri-Q MB to 325nM perfect matched DNA, single base mismatched DNA and random sequence DNA........................................................58 3-6 Secondary structures of Single-Q-MB (a), Dual-Q -MB (b), Tri-Q-MB(c) and Quad-Q-MB (d)........................................................................................................59 3-7 HPLC profile of Single-Q-MB, Dual -Q-MB, Tri-Q-MB, and Quad-Q-MB...........60 3-8 Fluorescent intensity of 65 nM MBs at close stat e and opened state 315nM cDNA was used in the hybr idization experiments...................................................60 3-9 Signal enhancements of MBs...................................................................................61 3-10 Structures of the dendrimeric linkers used to assemble multiple quenchers to the end of molecular b eacon sequences.........................................................................63 3-11 Signal enhancement of MB 3F51Dand MB 3F53D.................................................64 3-12 Response of 65nM MB 3F51D to ma tched DNA, single base mismatched DNA and random sequence DNA......................................................................................64 3-13 Melting temperature of a single-que ncher MB and Triple-Quencher MB...............65 3-14 UV spectra of molecular beacons wi th different quencher molecules.....................67 3-15 A460nm of same concentration of mo lecular beacons with different quencher molecules..................................................................................................................67 3-16 Signal enhancements of MBs with different number of quenchers.........................68

PAGE 13

xiii 3-17 Structures of a six-quencher MB and a three-quencher MB ..................................68 3-18 TMR labeled superquencher MB.............................................................................69 3-19 Response of 65nM of Cy3 labeled Tr iple-Quencher MB to target DNA................70 3-20 Camparison of SBRs of molecular beacons labeled with Superquencher to those of MB labeled with normal quenchers) or gold nanoparticle...................................71 3-21 Response of a Superquencher labeled Ap tamer Beacon to the addition of target protein PDGF-BB.....................................................................................................72 4-1 Use of the pyrene excimer to probe PDGF..............................................................82 4-2 Response of the excimer probe ES3 to different concentrations of PDGF-BB.......85 4-3 Real-time response of ES3 and two pyren e labeled control sequences to 50 nM of PDGF-BB.............................................................................................................86 4-4 The fluorescence ratio of excimer over monomer as a function of target protein concentration............................................................................................................87 4-5 Visual detection of 4 pico-mole PDGFBB after illumination with an UV lamp....88 4-6 Secondary structures of PDGF aptamer probe ES6 and ES3...................................89 4-7 Fluorescence emission spectra of PDGF excimer probes with different stem length in the absence of PDGF-BB..........................................................................90 4-8 Responses of the excimer probe to BSA, LYS, HEM, MYO and THR and different growth factors............................................................................................91 4-9 Monitoring PDGF in dyed cell media......................................................................92 4-10 Time-resolved fluorescence spectra of 200 nM ES3 and 50 nM PDGF-BB in cell media at different time window s after the exc itation pulse...............................95 4-11 Fluorescence decays of cell media, 200 nM ES3 in cell media, and 200 nM ES3 with 50 nM PDGF-BB in cell media........................................................................95 4-12 Fluorescence decays of 200 nM ES3 in cell media with various concentrations of PDGF-BB and the response of fluorescen ce intensity to the change of protein concentration............................................................................................................96 4-13 Fluorescence emission spectra of human -Thrombin aptamer excimer probe with different concentration of human -Thrombin and Real-time response of human -Thrombin aptamer excimer to the addition of target protein....................98

PAGE 14

xiv 5-1 Schematic of a two-pyene beacon, MB-2P1D hybridization with complimentary target DNA.............................................................................................................106 5-2 Absorption spectrum of DABCYL and em ission spectrum of pyrene excimer in water.......................................................................................................................106 5-3 Synthesis of multiple-pyren e labeled molecular beacons......................................108 5-4 Emission spectra of 1 uM MB 2P1D with increasing concentrations of cDNA (0-700nM) in buffer solution..................................................................................109 5-5 Hybridization kinetics of 100 nM MB2P 1D with varying nucleic acid targets (1 uM).........................................................................................................................110 5-6 Structure and fluorescence emission of a macromolecule containing two pyrene and one TMR molecules........................................................................................111 5-7 Fluorescence decay of MB2P1D in the prescence of 10-fold excess of target DNA.......................................................................................................................112 5-8 Fluorescence emission of MB2P1D in cell media containing various concentrations of target DNA................................................................................113 5-9 Time resolved spectra of MB2P1D with 5x concentration of target in cell media.114 5-10 Fluorescence decay of 500 nM MB2P1D (blue) and MB2P1D with increase concentration of cDNA in ce ll growth mediaat 480nm.........................................115 5-11 Quantum yields of multiple-pyrene labels.............................................................117 5-12 Structure of Cacade Blue acetyl azide and its emission spectra at different concentrations.........................................................................................................118 5-13 Melting temperature of multiple pyrene molecular beacons..................................119 5-14 Hybridization of MB4P1D and MB 4P1D to excess of target DNA......................120 6-1 Structure of LNA and an LNA-MB.......................................................................128 6-2 Melting curves for DNA and LNA MB s and hybridization of LNA-MB with complementary target at 95C ...............................................................................129 6-3 Normalized hybridization kinetics of DNA and LNA MBs with perfectly matched (PM) or single base mismatched (MM) targets.......................................130 6-4 Response of MBs to nuclease and single stranded binding protein ......................131 6-5 Hybridization of DNA-MB and LNA-MB to loop cDNA.....................................133

PAGE 15

xv 6-6 Hybridization of MB-LNA-E3 to loop cDNA and shared-stem cDNA.................137 6-7 Blocking LNA-MB sticky-end pair ing with share-stem targets............................140 6-8 Hybridization of DNA-MB and LNA-MB s to shared-stem target sequences.......141 6-9 Interactions between MBs and SSBs.....................................................................143 6-10 Degradation of mRNA by RNase H.......................................................................145 6-11 Ion exchange HPLC to monitor th e RNase H cleavage of RNA in LNA-MBE3/RNA duplex (left) and in DNA-MB/RNA (right)............................................146 7-1 Working principle of a hybrid molecular probe.....................................................152 7-2 Hybridization of 300nM of HMPT BL16 to 300nM of its Target DNA and Control in 20mM Tris-HCl buffer..........................................................................154 7-3 Titration of 300 nM HMPTBL16 and 30 0 probes without a linker with target DNA. 20mM Tris-HCl buffer................................................................................156 7-4 Effect of spacer length on the hybridiza tion of linear FRET probe to its target....157 7-5 Acceptor-donor dist ance optimi zation...................................................................158 7-6 Immobilization of hybrid molecular probe on solid surface for nucleic acid detection.................................................................................................................159 7-7 Hybridization of surface immobilized HMP to its target DNA.............................160 7-8 Hybridization result of 300nM of MB and 300nM HMPTBL16 to same concentration of their targets..................................................................................161 7-9 Response of 300nM HMP and 300 nM MB s to 300nM target cDNA and 3g/ml DNase in 20mM Tris-HCl buffer...........................................................................162 7-10 Response of MB and HMP to non-specific interactions........................................163 8-1 Structure of D-DNA and L-DNA...........................................................................172

PAGE 16

xvi Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR ENGINEERING OF NUCLEIC ACID PROBES FOR INTRACELLULAR IMAGI NG AND BIOANALYSIS By Chaoyong James Yang August 2006 Chair: Weihong Tan Major Department: Chemistry The ability to monitor biol ogical processes in the cont ext of living cells with good spatial and temporal resolution offers si gnificant potential for understanding many biological problems. The key to the successful signaling of these proc esses is the use of molecular probes. Currently, there are limitations for intracellular probes, which include low sensitivity, reduced selectivity, and poor st ability. The major goal of this research is to integrate molecular engineering techniques with new signaling materials and approaches to design more sensitive and effective nucleic acid probes. In an attempt to develop sensitive molecu lar probes, novel materials were explored for signal amplification and background re duction. Conjugated polymers (CPs) are good candidates for signal amplification because of their excellent light harvesting and superquenching properties. Using a solid phase synthesis method, CP labeled molecular beacons (MBs) were prepared. In addition, superquenchers, a seri es of macromolecules

PAGE 17

xvii with exceptional quenching capabilities, were generated through a molecular assembling approach and used for labeling MBs. To overcome the problem of autofluo rescence from biological fluids, a new signaling approach called the excimer light sw itching signaling technique was developed. An aptamer that selectively binds to platel et derived growth factor (PDGF) was labeled with pyrene molecules on both ends, resulti ng in a light-switching aptamer. The probe changes its emission from a blue monomer emission to a green excimer emission upon binding to PDGF. Taking advantage of the long fluorescence lifetime of pyrene, timegated measurements were performed to eliminate biological background signals. Finally, the stability and fals e signals of nucleic acid prob es were addressed. When used inside cells, normal nucleic acid probes are prone to enzymatic digestion, protein binding, and elicitation of RNase H action, a ll of which lead to nonspecific signals. The possibility of alleviating these issues by us ing locked nucleic acid (LNA) bases in the molecular probe design was investigated. With different stem lengths and LNA base ratios, LNA-MBs were designed and their therm odynamic properties, hybridization kinetics, enzymatic resistance, as well as interactions with DNA binding proteins, were studied. In addition to using base modification, we de signed a new type of molecular probes called hybrid molecular probe, which does not gene rate false signal upon digestion by nuclease, binding to SSB. HMP is capable of selectively detecting targets from cellular samples. The new materials, synthesis methods, and signaling techniques developed in this research have the potential for developing sensitive and effective molecular probes for bioanalysis and intracellular im aging. Future endeavors will include the application of these probes to single living cell gene expression studies.

PAGE 18

1 CHAPTER 1 INTRODUCTION Probing Biomolecules in Living Cells Selective probing of biological processe s in living cells with good spatial and temporal resolution offers si gnificant potential for the understanding of many biological phenomena. In the past decades, a great deal of information, such as the DNA double helix structure, genomic sequences, protein structures, and enzymatic activities, have been discovered by studying purified biom olecules extracted from cells or by studying biomolecules using dead homogenized cells. This wealth of information gleaned from in vitro study forms the foundation of molecular biol ogy. However, it has become clear that many intracellular conditions su ch as supramolecular organiza tion, cytoplasmic viscosity, and substrate heterogeneity in a living cell have a profound ef fect on the types and rates of reactions that go on there.1;2 A chemistry reaction in a test tube would have different thermodynamic and kinetic properties from the same reaction in a live cell.2 As a consequence, the biochemistry studied in a test tube or dead cell would not yield a complete understanding of the biological pro cesses that ultimately contribute to life.1;2 In contrast, probing biomolecules in living cells allows us to precisely characterize the properties of a molecule, and define the role of the molecule in the cellular processes. Moreover, the intracellular behavior of the mole cule such as synthesis, process, mobility, trafficking, location and interaction with ot her molecules can be directly visualized through intracellular analysis and imaging, which is not possible from test tube experiments or using fixed cell techniques.

PAGE 19

2 To meet the demand for living cell imaging, advanced imaging setups have been developed. These developments include high speed sensitive CCD cameras, fast computers, high volume storage devices powerful lasers and high resolution microscopes. In parallel, sophisticated soft ware design allows the reconstruction of 3dimension images and permits quantitative an alysis of fluorescence signal down to the single molecule level.3 Furthermore, different fluores cence microscopic techniques have been developed, which include fluorescence r ecovery after photobleaching, fluorescence resonance energy transfer microscopy, multi-photon microscopy and fluorescence lifetime microscopy. These tec hniques constitute a powerfu l tool set to interrogate molecular dynamic information inside a live cell. From the chemistry side, to quantitative ly visualize bioche mical reactions and events in living cells calls fo r the engineering of selective and sensitive probes. A typical probe consists of a targeting moiety and a signaling component. The targeting moiety utilizes selective molecular recognition to allow discriminative tagging of the target molecule in complex cellular environments Depending on the signa l transduction used for the probe design, the signaling compone nt generates observable response upon the probe/target binding. Using fluorescence is th e first choice in constructing the signaling components because of its nondestructive na ture, high sensitivity, flexible signaling schemes and multiplexing capability. The mol ecular recognition elements available for probe design include organic molecules, chel ates, peptides, proteins, and nucleic acids. This dissertation focuses on the design of fluorescent nucleic acid probes for imaging and bioanalysis in complex biologi cal systems. The following sections will discuss the basics of fluorescence spectrosc opy and chemical synthe sis of oligonucleotide

PAGE 20

3 for molecular engineering of nucleic acid probes. The pr inciple and the intracellular application of an important type of nuclei c acid probe, molecular beacons (MB)s, will be reviewed. Aptamers and molecular aptamer beacons for targeting a broader scope of biomolecules will be introduced. Finally, the ch allenges of using nucleic acid probes for complex biological systems such as intracellular imaging will be discussed and the scope of this dissertation will be outlined. Molecular Engineering of Nucleic Acid Probes Nucleic acids are ideal building blocks fo r the design and construction of molecular probes for many reasons. First, nucleic acid base pairing is one of th e strongest and most specific biomolecular recognition events. Second with an in vitro selection technique called SELEX,4-6 one can obtain nucleic acid sequences (aptamers) that are capable of binding to ions, organic molecules, peptides, proteins, cells and tissu es with high affinity and selectivity. Aptamer technology greatly e xpands the targets of nucleic acid probes from traditional nucleic acid sequences to any type of molecules and identities. Third, nucleic acid sequences usually form secondary structures, which could be altered or perturbed by a target binding event. Such a conformation change is valuable for engineering signal transduction mechanisms into the molecular probe, allowing an observable response from the probe upon target binding.7 Fourth, nucleic acid sequences are easy to synthesize and there are numerous types of modifications available to label nucleic acid sequences with different dyes, ra dioactive isotopes and other biomolecules. Therefore, many types of nucleic acid probe s have been designed and applied in the fields of biology, medical scie nce and chemistry. Today, nucleic acid probes, especially DNA probes are instrumental and ubiquitous tools in explor ing biological processes and in medical diagnostics.

PAGE 21

4 Chemical Synthesis of Nucleic Acids Nucleic acid has become a widely used building block for the construction of molecular probes due to its capability for sele ctive recognition agai nst a wide range of targets. Another important reason for the high popularity is because automated DNA synthesis technology allows efficient synthesi s of nucleic acid probe s with a variety of modifications for different applications. O ligonucleotide synthesis has become a basic technique for molecular biology and has found a pplications in almost all the biomedical sciences. With the aid of oligonucleotide synt hesis, molecular engineering of nucleic acid probes finds numerous applications in biologi cal studies. In the following sections, the basics of solid state synthesis of o ligonucleotide via phosphoramidite chemistry8;9 will be reviewed. For the synthesis of oligonuc leotides (1-1), the synthe sis cycle begins with a column containing a solid controlled-pored glass (CPG) support wher e the 3'-hydroxyl of the first nucleoside is attached through a long spacer arm. This support allows excess reagents to be removed by filtration and eliminates the need for purification steps between base additions. Typically the synthesis of an oligonucleo tide starts from 3' to 5'. Using the phosphoramidite method of oligonucleotide synthe sis, the addition of each base requires four chemical reaction steps: detritylation, coupling, ca pping and oxidization (Figure 13). The first step in the synthesis, detritylati on, is to remove trityl group protecting the 5' hydroxyl at the end of the oligonucleotide a ttached to CPG in the column. This is done by adding a dilute acid solution, either dichloroacetic acid (D CA) or trichloroacetic acid (TCA) in dichloromethane (DCM), to the re action column to remove the trityl. Once

PAGE 22

5 deprotected, the 5' hydroxyl becomes the only reactive group on the column to react with the next incoming monomer bases. The reaction column is then washed to remove extra acid and any by-products. Bn-1O O HO CPG BnO O DMTrO P N NCH2CH2CO NH N N N + BnO O DMTrO P NCH2CH2CO Bn-1O O O CPG Bn-1O O H3CCOO CPG BnO O DMTrO P NCH2CH2CO Bn-1O O O CPG O Bn-1O O DMTrO CPG 1.Detritylation 2.Coupling 3.Capping 4.Oxidation Figure 1-1. Automated oligonucleotide synthesis achieved through phosphoramidite chemistry. There are four major steps involved in the synthesis of DNA: (1) Detritylation, (2) Coupling, (3) Ca pping/Coupling, and (4) Oxidation. The next step, coupling, is achieved by simultaneously adding a phosphoramidite derivative of the next nucleotide and tetrazo le, a weak acid, to the growing chain of nucleotides on the solid support. The phosphoram idite derivative can not be coupled until it has been activated, which is done by adding tetrazole to the base. The tetrazole protonates the nitrogen of the diisop ropylamine group on the 3'-phosphorous. The resulting protonated amine makes a very good leaving group upon nucle ophilic attack by the tetrazole to produce a tetr azolyl phosphoramidite, which is susceptible to nucleophilic

PAGE 23

6 attack by the activated 5 hydroxyl group to form a phosphite linkage. The reaction column is then washed to remove any extra tetrazole, unbound bases or by-products Since the coupling yield is not always 100%, a small percentage of the supportbound nucleotides can fail to elongate. Su ch a support-bound nucleotide, is left unreacted, and it is possible for it to react in later additions of different bases. This would result in an oligonucleotide with a deletion that can be difficult to isolate. To prevent this from occurring, the unbound, active 5-hydroxy l group is capped with a protective group which subsequently prohibits that strand fr om growing again. This is done by adding acetic anhydride and N-methylimidazole to the reaction column. These compounds only react with the residual 5-hydroxyl group. The base is capped by undergoing acetylation. The reaction column is then washed to remove any extra acetic anhydride or Nmethylimidazole. The capping stem terminates any chains that di d not undergo coupling by acetylation to become failure products. The capping step is followed by oxidation st ep where the internucleotide linkage is then converted from the less stable phosphite to the stable pentavalen t phosphate tri-ester. Iodine is used as the oxidizing agent and water as the oxygen donor. The four steps are then repeated in the same order until all nucleotides in the sequence have been added. Following the synthesis, the oligonucleotide is cleaved and deprotected from the solid support. By converting into phosphoramidites deri vatives, some fluor ophores, quenchers, and ligands can be introduced into any desired position of an oligonucleo tide if these molecules can survive the synthesis process. For some labile molecules, post-synthesis coupling can be achieved using amino, thiol, or biotin linkers. The freedom to introduce

PAGE 24

7 different fluorescence molecules, quenchers, and other functional biomolecules into a nucleic acid sequence makes the design of nuc leic acid probes much easier than probes based on other material such as proteins. Fluorescence Methods for Signal Transduction Fluorescence spectroscopy is a widely used method for a variety of investigations in biochemical, medical, and chemical research because of its high sensitivity, nondestructive nature, and multiplexing capabilitie s. Fluorescence-based nucleic acid probes may rely on the changes of emission inte nsity, excitation or emission wavelength, lifetime, or anisotropy to signal a molecular recognition event. Jablonski Diagram In order to make use of these fluorescence changes in probe design, it is important to understand the photophysical processes that occur from the absorption and subsequent reemission of light. A Jablonski diagram is usef ul to illustrate these processes. Figure 1-2 shows a typical Jablonski diagram where S0, S1 and S2 stand for the ground electronic state, first and second si nglet exited electronic stat es respectively, while T1 stands for the triplet state. In each electronic state, there are different discrete vibrational levels. Upon irradiation by light molecules are excited to singlet excited energy level S1 or higher levels depending on the magnitude of the absorb ed energy. The excitation process is very fast and usually takes fewer than 10-15 s. Through a process calle d internal conversion the molecules in higher vibrational levels of the same spin state rapidly relax to the lowest vibrational level of S1, S2 to S1 for example, in the next 10-12 s. The relaxation from the lowest excited state S1 to the ground state with emission of photon is referred as fluorescence. Since fluorescence emission typically takes 10-10 to 10-6 s to occur, internal conversion is generally completed prior to emission and fluorescence emission generally

PAGE 25

8 results from the lowest-ene rgy vibrational state of S1. As a result, fluorescence emission energy is independent on the excitation en ergy. Because a small fraction of energy absorbed is lost in the relaxation proce ss, the emission usually appears at longer wavelengths than absorption, which allows the spectral separation of the excitation photon from the emission photon for sensitive studies. Figure 1-2. A typical Jablonski diagram There are several pathways of returning to the ground state from the excited singlet state besides fluorescence emission, including non-radiative decays and intersystem crossing to a triplet excited state.10;11 Phosphorescence may result from the triplet excited state. The average time for a molecule to stay in its excited state, called the fluorescence lifetime, and fluorescence intensity are affected by the decay rate of these processes. The signal transduction techniques used in fl uorescence-based design consider how to associate the target recognition event with ch anges in these decay rates which result in change in fluorescence intensity or lifetime ch ange. In addition, if the target binding event changes the electronic structure of the fluorophore, changes of fluorescence excitation/emission will be observed and can be used to signal the target binding event.

PAGE 26

9 Three signal transduction approaches used in our work are fluorescence quenching, fluorescence resonance energy transfer, and excited state dimer formation. Fluorescence Quenching There are a variety of non-radiative processe s for an excited state electron to relax to the ground state. Because these processes occur without giving out a photon, they are termed fluorescence quenching. Quenchi ng happens through two major mechanisms.10;11 One of them is collisional quenching or dynamic quenching. During its fluorescence lifetime, an excited fluorophore could collide with other molecules in the solution. The collision may cause energy loss of the fluor ophore. Consequently, the fluorophore returns to the ground state without giving out photons. The decrease in fluorescence intensity due to the collisional quenching can be desc ribed using the Stern-Volmer equation: F0/F = 1+K [Q] = 1+ kq0 [Q] where K is the Stern-Volmer quenching constant, kq is the bimolecular quenching constant, 0 is the fluorescence lifetime in the absence of the quencher, and [Q] is the quencher concentration. Many molecules can be collisional quench ers, including heavy ions, oxygen, halogens, amines and acrylam ide. In aqueous solutions at room temperature, the biomolecular collision rate is about 1010 L mol-1 s-1. If all collisional encounters result in quenching, it can be estimated that the maximum value for kq is about 1010 L mol-1 s-1. For a fluorophore with a lifetime of 1 ns, the Stern-Volmer quenching constant is approximately 10 L mol-1. This estimation shows that dynamic quenching of fluorescence is us ually negligible when the quencher concentration is below 1 mM. For two molecules that are brought toge ther by linkers in many molecular probes, the collision rate is not diffusion rate c ontrolled, and the dynamic quenching might be more prominent.

PAGE 27

10 The other type of quenching is called static quenching, where the quencher can form non-fluorescent complex ( i.e, dark complex) with th e fluorophore in the ground state.10;11 The change in fluorescence intensity fo r static quenching is described with following equation: F0/F = 1+K [Q] =1+ [FQ]/ ([F] [Q]) where K is the formation constant; [FQ], [F ], and [Q] are the concentrations of the dark complex formed from the fluorophore a nd quencher molecules, the fluorophore, and the quencher respectively. Both dynamic que nching and static quenching result in a decrease of emission intensity, but there are two simple ways to distinguish static quenching from dynamic quenching.10;11 First, whether the lifetime changes or not depends on the different mechanisms. In st atic quenching lifetime does not change because the only observed fluorescence is fr om the uncomplexed fluorophore which has the same lifetime as before quenching. In contrast, in a dynamic quenching mechanism the lifetime shows the same order of decrease as the intensity. Second, temperature plays different roles in the two processes. In st atic quenching higher temperature dissociates weakly bound complexes and alleviates static quenching. For dynamic quenching, higher temperature causes faster diffusion and more quenching. But in many cases, both static and dynamic quenching processes occur in the same system. Static quenching plays an important role in molecular probes. For example, it is involved in the fluorescence quenching of fluorophores in MBs.12 It was found that many fluorophore-quencher pairs, including tetramethylrhoda mine(TMR)-DABCYL, EDANSDABCYL, eosine-DABCYL, fluoresceinTMR and TMR-TMR display absorption spectral changes when they were brought clos e together in the ha ir-pin conformation,

PAGE 28

11 indicating the formation of non-fluores cent complexes in closed-stem MBs.12 The static quenching that occur in MBs leads to higher quenching efficiency than other process like fluorescence resonance energy transfer(FRET).12 Fluorescence Resonance Energy Transfer FRET is the nonradiative transfer of the electronic excitation energy from an initially excited donor (D) molecule to an acceptor (A) molecule via a long range dipoledipole interaction.11 FRET requires the overlap between the emission spectrum of the donor with the absorption spectrum of the acceptor. Such an overlap allows the excitation energy to transfer from the donor to the acceptor if the two molecules are coupled by dipole-dipole interaction within a distance of 100. FRET results in quenching of donor fluorescence and an increase in fluorescence intensity from the acceptor. The rate of energy transfer depends upon se veral factors such as the extent of spectral overlap of the emission spectrum of the donor with the ab sorption spectrum of the acceptor, the quantum yield of the donor the relative orientat ion of the donor and acceptor transition dipoles, and the distance between the donor and acceptor molecules.11 FRET efficiency depends strongly on the distance between the donor and the acceptor molecules as described in the following equation: E=R0 6/ (R0 6+r6) where the Forster radius R0 is the distance at which energy transfer is 50% efficient, and r is the distance between the donor and the acceptor. Such a strong distance dependent FRET efficiency has been widely exploite d in biomolecular structure and dynamics studies, intermolecular association det ections, intermolecular binding assays developments as well as molecular probe designs.11 The MB is one of the successful examples of the applications of FRET for the bio-analysis.12;13

PAGE 29

12 Excited State Dimer-Excimer Some spatially sensitive fluorescent dyes such as pyrene11;14-16 and BODIPY Fl17;18 can form excited state dimers (excimers) upon close encounter of an excited state molecule with another ground state molecule. The formation of a pyrene excimer is illustrated in the figure 1-3. First, a pyrene mo lecule is excited to the excited state. The excited pyrene can relax to the most stable singlet S1 state through internal conversion. When such an excited pyrene encounters wi th a second pyrene in its ground electronic state, a complex with lower energy will fo rm. The complex is called excimer. By dissociating to produce two gr ound electronic state pyrene molecules, the excimer could release one photon at much longer wavele ngth than the monomer does. The pyrene excimer emission has a broad, featureless emi ssion centered at 480 to 500 nm. It is easy to recognize pyrene excimer emission, even when extensive monomer emission occurs, since the monomer emits in the 370 to 400 nm wavelength range. Another good example of a dye that exhibits the excimer phenomena is BODIPY17;18 whose monomer and excimer emits at 520 and 620 nm respectively. The formation of an excimer is useful to probe spatial arrangements of some molecules. Similar to FRET, the stringent distance-dependent property of excimer formation can be used as a unique signal tr ansduction in the development of molecular probes. This is especially useful for de veloping aptamer probes because many aptamers like those aptamers for PDGF-BB,19-21 cocaine,22 and thrombin23;24 undergo conformational change upon target binding. Th e approach of using excimer formation for signal transduction also finds a wide applic ation for other nucleic acid probes. For example, pyrene was used to label the two e nds of a MB sequence to construct a light-

PAGE 30

13 switching DNA probe.16 The probe switches its emission from green light to blue light upon interaction with its target sequences. Figure 1-3. The schematic for the formation of pyrene excimer Working Principle of MBs Among many nucleic acid probe, MBs13 are one of the most successful type molecular probes that are widely used in different areas in molecular biology. MBs (Figure 1-4) are dual-labele d single-stranded oligonucleotid e probes that possess a stemand-loop structure. The loop sequence, usua lly a 15-30 mer sequence, is complementary to a target DNA or RNA. The stem has 5-7 ba se pairs that are comp lementary so that the structure remains in the closed state prio r to binding with its target sequence. A fluorophore is covalently coupled to one end of the stem and a quencher is conjugated to the other end. The stem keeps these tw o moieties in close proximity, causing the fluorescence of the fluorophore to be quenc hed through FRET. In most cases, the Internal conversion +Py *Py PyGround State Py (*Py) (*Py+Py) 350nm 398nm 485nm

PAGE 31

14 quencher is a non-fluorescent molecule that dissipates the energy transferred from the fluorophore donor as heat. In the presence of ta rget nucleic acid sequence, the loop region forms a hybrid that is longer and more stab le than the stem. Th is causes the MB to undergo a spontaneous conformational cha nge, which opens the stem. The spatial separation of the fluorophore and the quencher leads to the restor ation of fluorescence emission from the fluorophore. The presence of the target sequence is thus directly reported by the increased fluorescence from the MB. Different MBs can be designed by choosing different loop sequences and differe nt fluorophores with characteristic emission wavelengths. Figure 1-4. Working principle of MBs. Th e MB adapts a stem-loop structure that maintains the close proximity of the fluorophore (orange) and quencher (blue) moieties. As a result, the fluores cent emission of the fluorophore is suppressed. In the presence of targ et nucleic acid sequences, the loop sequence of the MB hybridizes to th e target, forcing the stem open. Consequently, fluorophore is separated fr om the quencher and its fluorescence is restored The unique hair-pin structure and signali ng mechanism endow the MB with several advantages. First of all, the light-up signaling mechanism allows it to function as a highly sensitive probe for real-time nucleic acid monitoring. The unbound MB does not emit fluorescent signal. Thus signal from target -bound MBs can be clearly observed in the

PAGE 32

15 presence of the unhybridized probe. Such a dete ction-without-separati on ability is useful for the MB in situations where it is either impossible or undesirable to isolate the probetarget hybrids from an excess of the unbound MBs as occurs when monitoring mRNA inside living cells. Another advantage of MBs is their relatively high signal-tobackground ratio which provides hi gher sensitivity. Upon hybrid ization with its target, a well designed MB can generate a fluorescent enhancement as high as 20 to 40-fold under optimal conditions. This provi des the MBs with a significa nt advantage over other fluorescent probes in ultrasensitive analysis. In addition to it s sensitivity, MBs are highly selective. They are extraordinarily target-specific and are able to differentiate nucleic acid targets with single base mismatches. The selec tivity of MBs is a direct result of its loop and stem structure, as the stem hybrid acts as a counterweight to th e loop-target hybrid. The selectivity provided by th e MB loop-stem structure has been demonstrated to be applicable in a variety of bi ological environments, further extending the app licability of MBs for these types of analyses. These advantages have allowed MBs to become a class of nucleic acid probes widely used in ch emistry, biology, biotechnology, and medical sciences since they were first reported in 1996.13 Using MBs for RNA Monitoring in Living Cells One of the primary advantages of MBs is their inherent capability of detection without separation. This advantage is necessa ry for intracellular applications where any separation of the probe from live samples woul d likely result in the death of the sample. By utilizing this property of MBs, RNA can not only be detected inside of a single cell, but its subcellular localization can also be determined and tracked over time. The use of MBs for intracellular RNA detect ion and localization requires first the design of MB for the RNA target followed delivery of the probe into the cell. The major

PAGE 33

16 concern in designing MBs for intr acellular use is selecting an appropriate target region for the MB. This is especially critical due to the complex secondary structure exhibited by the large RNA sequences and a MB must be selected that will have good accessibility to its complementary sequence. The selection of target sites starts with the prediction of possible RNA secondary structures. The target site is chosen around the regions that have a high probability to be mostly single strand ed to assure that the native RNA structure would minimally compete with the proposed MB For the chosen regions, high affinity oligonucleotides of different le ngths that are complementary to the regions will then be used as the loop sequences of the MBs. Each loop sequence is then flanked with two complementary arm sequences to generate a potential MB. Usually the stems are 5-7 base pairs long and have a very high GC content (75 to 100 percent). The secondary structure of the MB is then predicted using RNA structure analysis programs. The stem sequences have to be altered if the structure of th e sequence chosen does not adopt a hair-pin structure with a 5-7 bp stem. A non-hair-p in structure will cause high fluorescence background from the MB while too long of a st em will prevent the binding of the MB to its target sequence. Since current RNA fold ing programs do not give a reliable secondary structure, a series of probes are usually desi gned and tested in buffe r with further testing inside cells until a probe is found that can hybridize with mRNA inside of a cell with good sensitivity. Delivery of MBs inside of the cell has b een an area where much effort has been applied and it has resulted in many very effec tive options for intracellular delivery. The most common delivery methods include microinjection,25 electroporation,26 reversible permeabilization27 and peptide assisted delivery.28 Microinjection has several advantages.

PAGE 34

17 First, it allows MB delivery to a single cell of the investigator s choosing. Second, it delivers relatively reproducible amounts of probe inside cell. Third, it enables immediate observation of probe response. The disadvantag es of using microinjection are related to the technique itself in that it requires addi tional instruments and expertise while being a very low throughput technique. Electroporat ion and reversible permeabilization offer much higher throughput options by producing pore s in the cell membrane and relying on passive diffusion to deliver probes to the cy toplasm. However these pores can also allow the loss of materials from inside of the cell and there is much cell to cell variation in probe delivery. Peptide-assisted delivery allows the probes to pass through the cell membrane without disturbing the cell.28 However, it requires the peptide to be conjugated to the probe which can increase the cost a nd complexity of the probe synthesis and it requires an incubation period before monitoring of the cell can begin. Currently the application of MBs for intracellular analysis is a rather young field with the majority of the applications focusi ng on visualizing the localization, distribution, and transport of a wide variety of mRNAs insi de of a cell. Initial intracellular studies concentrated on detection of MB hybridization to mRNA as opposed to localization and distribution studies.27;29;30 In 2003, Tyagi et al demonstrated that MBs could be used for the visualization of the dist ribution and transport of mRNA.31 In this study a MB for oskar mRNA was investigated in Drosophila melanogastar oocytes. Initially they demonstrated visualizing the distribution of oskar mRNA in the cell. To eliminate background exhibited from the MBs a binary MB approach was developed, which uesed two MBs that targeted adjacent positions on the mRNA. When both MBs were hybridized to the mRNA sequence a donor and acceptor fluorophore were brought within

PAGE 35

18 close proximity allowing FRET to occur a nd generating a new signal that indicated hybridization of the MBs with the mRNA. In addition to visualizing the mRNA distribution, they were also able to track the migration of the mRNA throughout the cell and even into adjacent cells in the oocyte. Other studies have imaged MBs on viral mRNA inside of host cells to study the behavior of the mRNA.32 This study investigated both the localization of the mRNA inside of cell and also utilized photobleaching of the fluorophore on the MB in order to study the diffusion of the MB-mRNA hybrid. In 2005, Bao et al expanded on mRNA visualization by showing the co-localization of mRNA and intracellular organelles in human dermal fibroblasts.33 In this study MBs were used in conjunction with a fluorescen t mitochondrial stain. Since the fluorescence from the MBs and the stain could be spectrall y resolved, they were able to demonstrate that the mRNA of both glyceraldehyde 3-phosphate dehydrogenase and K-ras were specifically localized with the mitochrondria. Several control experi ments, including the use of negative control MBs, FISH, and detection of colocalization of 28S ribosomal RNA with the rough endoplasmic reticulum were performed to confirm their observation. The authors suggested that th e observation of sub cellular associations of mRNA with organelles such as mitochondria might provide new insights into the transport, dynamics, and function of mRNA and mRNA-protein interactions. In addition to localization and distributi on, expression levels of mRNA have also been studied inside living cells using MBs. Th e binary MB approach was used to explore the relative expression levels of K-ra s and surviving mRNA in human dermal fibroblasts.27 The results indicated a ratio of 2.25 of K-ras mRNA expression in stimulated and unstimulated HDF cells which was comparable to the ratio of 1.95 using

PAGE 36

19 RT-PCR. Recently, the Tan group studied the stochasticity of Manganese Superoxide Dismutase (MnSOD) mRNA expression in human breast carcinoma cells using MBs and an internal standard reference pr obe to allow ratiometric analysis.34 In this work, the MnSOD expression of three different cell groups was studied and compared to each other. The expression of -actin mRNA was used as a control. The groups of cells studied included cells at basal expre ssion levels, cells treated wi th lipopolysaccharide (LPS), and cells that were transfected with a plasmid that overexpressed a cDNA clone of MnSOD. Using ratiometric analysis allowed for the rati ometric values from different cells to be directly compared, compensating for the experi mental and instrumental variations. The study showed that the stochasticity of gene expression between the basal, LPS treated, and the transfected cells was different for MnSOD while there was little to no difference in -actin mRNA in the three groups. This repr esents a novel means to directly examine the stochasticity of transcription of MnSOD and other genes implicated in cellular phenotype regulation. Simultaneous monitori ng of multiple MBs labeled with different fluorophores for different mRNA target seque nces allows monitoring and comparison of the expression levels of multiple mRNA sequences in a single cell.35 In one of the multiple gene monitoring studies, MBs for MnSOD and -actin mRNA along with a negative control MB were used to study th e relative expression levels on MnSOD and actin in the cells. Here, a reference probe was used as an internal standard for ratiometric analysis. Microinjection was used to deliver the probe mixture to single human breast carcinoma cells and a sample control cell is shown in Figure 1-5.

PAGE 37

20 Figure 1-5. Simultaneous monitoring of multiple genes inside a living cell. Shown here is the time elapsed fluorescent images of each MB inside of a single MDA-MB231 cell. A: -actin MB (green), B: control MB (red), C: MnSOD MB (blue) and D: RuBpy reference probe (orange). (R eprinted with permission from ref 35. Copyright (2005) American Chemical Society) As can be seen in the image, the -actin MB signal increases, while the control MB signal stays at a constant low level. Th e MnSOD MB stays at a low level that is consistent with its basal expression. This result indicated not onl y the feasibility of multiple gene imaging but also that the increase in the signal of -actin MB must be due to a specific interaction si nce any non-specific interacti on would have resulted in an increase in the control MB as well. This pro cess was repeated with cells that were treated with LPS, known to stimulate MnSOD e xpression. It was found that the MnSOD expression greatly increased while the MnS od expression in the control cell remained low. A trend was found relating high expres sion levels of MnSOD mRNA with higher expression levels of -actin mRNA in the stimulated cells. This indicates the methods potential in elucidating gene expression trends in single cells that is not possible with

PAGE 38

21 other methods that use expression levels aver aged from millions of cells like northern blots. Indeed, one of major benefits of singl e cell analysis is that inherent cell to cell variations can be studied in more detail to ga in further insight into biological processes. Aptamers and Molecular Aptamer Beacons Use of MBs allows selective detection of nucleic acids in homogeneous solutions. MB recognition is based on base to base re cognition and the targets for MBs are limited to nucleic acid sequences. The introduction of aptamers extends the application of nucleic acid probes to other types of targets. Aptamers are small oligonucle otides that are identified in vitro to selectively bind to a wide range of target of molecules such as drugs, proteins or other inorganic or organic molecules with high affinity and selectivity. The process by which aptamers are generated is called SELEX which comb ines combinatorial chemistry and in vitro evolution. SELEX was first described by three independent laboratories in 1990.4-6 The concept of SELEX process is based on the ability of small oligonucleotides (typically 80-100mers) to fold into unique secondary or tertiary structures which can interact with a specific target with high selectivity and affinity. Consequently, the SELEX process requires chemical synthesis of a la rge DNA library with completely random basesequence flanked by defined primer bindi ng sites for polymerase chain reaction amplification purpose. The initial library of the SELEX process is incredibly complex with at least 1015 different DNA molecules. The immense variability of the generated pool is to ensure that it will contain at least a few molecules with unique conformational characteristics that will facilitate the selectiv e interactions with the target molecule. In a typical round of SELEX, the first step is to incubate the library with the target molecule in a desired buffer condition (Figure 1-6). So me sequences of the library will bind to

PAGE 39

22 target molecule tightly, while some sequences bind weakly and a majority of the initial sequence do not bind at all. Th e second step is to separate the few high affinity sequences from low affinity and no affinity sequences. Several separation t echniques have been explored and established for SELEX, including nitrocellulose filter techniques, affinity chromatography technique, and capillary elec trophoresis (CE). Low affinity sequences are discarded through the partitioning process, resulting in a library pool with enriched high affinity sequences. Through polymerase ch ain reaction (PCR) process, the resulting pool is amplified and used for the next r ound of SELEX. By increas ing the stringency of binding condition in later rounds, high affi nity sequences can be greatly enriched. Usually it takes 20-30 rounds of SELEX to obtained aptamer sequences with good affinity. Once the aptamer sequences are enrich ed, their sequences can be identified by high throughput sequencing. Figure 1-6. Schematic presentati on of a typical SELEX process. In order to report the binding of an apta mer to its target, a signal transduction mechanism has to be built into the aptame r sequence in order to engineer molecular aptamer beacon. For fluorescence imaging, a variety of signal transduction mechanisms can be used. For example, fluorescence intensity changes, fluorescence wavelength shifting, fluorescence anisotropy, as well as fluorescence lifetime can be used to signal the binding event. Different aptamers have di fferent secondary struct ures, therefore they Incubate with tar g et Remove unbound PCR amplify bound se q uences Incubate with less tar g et molecules -enrichment Library of random DNA se q uences

PAGE 40

23 require different signal transduc tion approaches for different ap tamers in order to render high selectivity and high sensitivity to the re sulting aptamer probe for real-time imaging. Different signal transduction approaches ha ve been successfully exploited to design molecular aptamer beacons for selective and se nsitive detection of cancer marker proteins and other molecules in real-time. Careful selection of the si gnal transduction mechanism is conducted according to the changes of secondary structure of the ap tamer before and afte r binding. When the aptamer retains the same conformation after ta rget binding (Figure1-7 A), an anisotropy measurement approach could be used.19 The aptamer sequence is labeled with a fluorophore. The fluorescence anisotropy fluorophore is mainly dependent on the rotational motion of the fluorophor e which, in turn, is depend ent on the size and shape of the rotating molecule and the viscosity of the solvent environment. Fluorescence anisotropy methods provide an easy and reli able way for studying aptamer binding with target and for the detection of the target in real-time. We have used the signal to design an aptamer probe for PDGF (plateletderive d growth factor) with high selectivity and sensitivity (with a limit of detection about 0.22nM).19 In designing of an aptamer probe which changes its conformation from closed conformation (hair-pin) to open structure, fluorescence intensity measurement methods coul d be explored (Figure 1-7B). Either end of the aptamer sequence will be labeled with a fluorophore and a quencher respectively. Before target binding, the hair-pin structur e of aptamer holds the fluorophore close to the quencher, suppressing the fluorescence. Targ et binding opens the aptamer structure, thereby separating quencher from the fluor ophore. The separation of fluorophore from quencher results in an increase in fluore scence intensity. Another signal transduction

PAGE 41

24 mechanism involves fluorophore excimer form ation (Figure 1-7C). This approach applies to any aptamer that changes its c onformation from open linear form to a close conformation upon bindi ng to its target.7;22 The binding event brings two monomers close enough to allow the formation of an excimer. Because the excimer emits at a longer wavelength than the monomer does, the ta rget binding event will be reported by the increase of fluorescence intensity at the wa velength corresponding to the excimer. This method is very selective and sensitive. Using this method, we were able to detect nanomolar PDGF protein with the bare eye.7 A probe based on fluorescence quenching will be obtained if one of the dyes is repl aced by a quencher in the third case, which is exemplified by an aptamer cocaine sensor.22 Figure 1-7 Signaling binding of aptamer to its target. (A) Anisotropy approach. The secondary structure of aptamer does not change upon target binding. The rotation rate of aptamer will slow down after binds to its target, resulting in increase of anisotropy signal. (B) Fluorescence intensity method. After binding to its target, structure of apta mer changes from closed state to open structure. The binding event separates quencher (Q) from the fluorophore (F), leading increase of fluorescence inte nsity. (C) Excimer approach. The secondary structure of aptamer change from open to close state, bring two fluorophore in proximity to allow formati on of excimer, excited state dimer. The excimer gives a fluorescence emission with a different color. All three of above signal tr ansduction approaches allo w the design of molecular aptamer beacon probes for the detection of ta rget molecules in real-time. For some aptamers without obvious target-induced st ructure change or without conformation information, rational structure engineering 36-39 can be performed to engineer structure-

PAGE 42

25 switching aptamers. This strategy ha s been well demonstrated by Bayer et al who used the aptamer/target binding event to switch the aptamer structure to convert it to a gene expression regulator.39 A simple yet general approach of engineering any aptamer into structure switching aptamer for real-time signaling applications has also been reported36;37. In addition, with a combination of the fast turnaround of automatic SELEX techniques40 and novel selection approaches,41;42 virtually any target can have at least one conformation-changing aptamer sequence. T hus, numerous molecular aptamer beacons may be quickly for real-time sensitive and selective monitoring and imaging of their targets in cells. Challenges of Using Nucleic Acid Pr obes for Intracellular Analysis Many of the applications di scussed revealed limitations and challenges that still exist with intracellular applications of nucleic acid probes. One of the major challenges is low sensitivity. MB, for example have been re ported to be able to detect as low as 10 copies of mRNA sequences,43 but most MB applications so far are limited to detecting highly expressed or stimulated genes. The low sensitivity is a result from several factors, including low brightness of the fluorophor e used to label molecular probes, high fluorescence background of the closed MBs, and autofluorescence of the cell.7 Another challenge is degradation of nor mal DNA MBs inside of the cell.44 Once the MBs are degraded by endogenous nucleases, the MB stem opens, creating a false positive signal. In addition, the interaction of the MBs with in troceullar proteins also disrupts the hair-pin structure, resulting in nonspecific signals. Generating solutions to these problems is crucial for the use of nucleic acid probes for intracellular imaging and bioanalysis.

PAGE 43

26 Scope of This Research The scope of the work presented here is to use MBs and molecular aptamer beacons as model probes to conduct a systematic i nvestigation into the design of effective, selective and sensitive nucleic acid probes to ward intracellular analysis applications. A new fluorescent material called conjugated pol ymer PPE was explored as the signaling element to amplify molecular recognition si gnal. To minimize the probe background, macromolecules, called superquenchers with be tter quenching efficiency were designed and used to label molecular probes. Time-re solved measurement applied to nucleic acid probes to remove autofluorescence background for the detection bimolecules such as proteins and nucleic acid in complex biological systems. To improve the selectivity and effectiveness of nucleic acid probes, locked nuc leic acids (LNAs), were used to construct MBs. A new signal transducti on scheme was also explored to design a new form of nucleic acid probes called hybrid mo lecular probe, which is pres ent in the last chapter of the dissertation.

PAGE 44

27 CHAPTER 2 DIRECT SYNTHESIS OF AN OLIGONUCLEOTIDE-POLY (PHENYLENE ETHYNYLENE) CONJUGATE WITH A PRECISE ONE-TO-ONE MOLECULAR RATIO Introduction Detection of biomolecules such as DNA, R NA and protein in real-time is of great importance to a variety of areas such as me dical diagnosis, disease prevention, and drug discovery. While selectivity in bioanalysi s can be achieved by capitalizing on highly selective molecular recognitions such as antibody-antigen binding, DNA hybridization, and receptor-ligand interaction, the sensit ivity of a bioprobe is dependent on the technique used to translate th e target recognition events into measurable signals. To date, the most common signal transduction scheme s utilize optical or electrical methods.45;46 Fluorescence is a sensitive optical transduc tion method which can be integrated into a variety of molecular probes. Attenuation, e nhancement, or wavelength shifts in the fluorescence emission can be used to signal specific interactions between the probe and the target biomolecule. In many cases, only a single fluorophore is used to signal a binding event. Low signal intensity from this single dye and its vulnerability to photobleaching, limit the sensitivity of th ese fluorescence based detection approaches. The introduction of new fluorescent material s capable of signaling molecular recognition events with greater measurable changes ha s significant potential in addressing the predominant sensitivity limitations in current bioanalysis. Among many new material developed fo r signal amplification, fluorescent conjugated polymers ( CP, or amplifying fl uorescence polymers (AFP)) have attracted

PAGE 45

28 increasing attention 47-54 because of their unique light harvesting52;55 and superquenching54;56-58 properties. Conjugated polymers, also called conducting polymers, are poly-unsaturated macromolecules in whic h all the backbone atoms are sp or sp2 hybridized. They are known to exhi bit photoluminescence with high quantum efficiency59. A unique and attractive optical property of fluorescent CPs is their fluorescence superquenching effect;58;60 that is, the CPs are a hundredto million-fold more sensitive to fluorescence quenching compared to that of their low molecular weight analogues. This fluorescence superquenching is attributed to a combination of delocalization of the electronic excited state (exciton) and fa st migration of the exciton along the conjugated polymer chain. As a resu lt, if the fluorescence of any single repeat unit is quenched, the entire polymer chain responds. An entire polymer chain of poly(phenylene vinylene) (PPV) with about 1000 repeat units has been shown to be quenched by a single methyl viologen molecule.61 With this superquenching capability, conjugated polymers have shown great potential for sensing applications. Ma ny types of conjugated polymers, including polythiophenes62-64, polypyrroles65, PPVs66 and poly(phenylene ethynylene)s (PPEs)46;6771, have been used in sensing applications Among them, water soluble poly(phenylene ethynylene)s (PPEs) are attractiv e candidates in optical bios ensing due to their facile synthesis and high fluorescence quantum yields in aqueous solution.49;53;72 PPEs can be prepared through the Pd-catalyzed crosscoupling of bis-acety lenic and diiodoaryl monomers in an amine environment.50 In order to be useful for bioanalysis and bioapplication, the polymer must be conjugated with a biomolecule such as a DNA strand, a peptide, or a protein. Such

PAGE 46

29 conjugation can be accomplished by coupling PPEs with pendant reactive groups to biomolecules with specific re active moieties, e.g. by formation of an amide bond between a carboxylic acid-functionalized PPE and an amine functionalized biomolecule. Although some progress has been made in the coupling of PPEs to biotin,58;68 there remains a clear need to develop new strategies for coup ling PPEs to oligonucleotides and proteins. Effective strategies for coupling such biomol ecucles to conjugated polymers would have significant implications for a variety of fields, including bioanalysis and biomedical diagnostics.73 Unfortunately, coupling of PPEs to large biomolecules is fraught with difficulties. First, introduction of reactiv e pendant groups can be challenging and may also change the polymers properties. Sec ond, the coupling efficiency is low due to unfavorable steric and electrostatic intera ctions between the polymer and the target biomolecule. Moreover, the coupled product has similar chemical and physical properties to those of the free polymer, making it difficu lt to separate the conjugated product from unreacted polymer. Finally, the degree of coupling to the polymer is difficult to control due to the nature of the polymer, the poor c oupling efficiency, as well as the lack of effective separation methods. This chapter discusses a new method we have developed for the conjugation of a water soluble poly (phenylene ethynyl ene) (PPE) with an oligonucleotide.74 This new method makes it possible to efficiently couple an AFP with biomolecules for bioanalysis and biosensor applications. This new strate gy was used to label PPE on MB sequences for signal amplifications.

PAGE 47

30 Experimental Section Chemicals and Reagents Synthesis of PPE-SO3 was previously described and performed in Dr. Kirk Schanzes lab.53 The polymer was purified by dialysis against deionized water, and it was stored as an aqueous stock solution in the dark under an argon atmosphere. The molecular weight (Mn) of PPE-SO3 was estim ated to be 100 kD based on ultrafiltration and end group analysis. The polym ers extinction coefficient ( ) was determined to be 57,000 M-1 cm-1 in MeOH solution by gravimetric analysis (all concentrations are provided as polymer repeat unit concentra tion: [PRU]). The polymer stock solution concentration was 2.08 mg mL-1, which corresponds to [PRU] = 4 mM. The stock solution was diluted as needed to prepare so lutions used for spectroscopic experiments. Final concentrations of the diluted PPE-SO 3 solutions were determined based on the polymers extinction coefficient. DABCYL an d QSY 7 were purchased from Molecular Probes and used as received. All DNA synt hesis reagents were supplied by Glen Research (Sterling,Va,). Synthesis of PPE-DNA A 16mer oligonucleotide (GCG ACC ATA GCG A TTT AGA) was synthesized on a DNA synthesizer. To the last base of th e olignonucleotide, 5 I-dU was coupled using corresponded phosphoramidite with a coupling time of 15 min to ensure maximum coupling efficiency. Controlled pored gla ss support from four 1 mol-scale columns containing the 5I-dU modified oligonucle otide was transferred to a 100 mL round bottomed flask containing 20 mL of DMSO. The PPE monomers disodium 3-[2,5-diiodo4-(3-sulfonatopropoxy)phenoxy]propane-1 -sulfonate (690 mol) and 1,4diethynylbenzene (694 mol) were then added to the solution under a gentle flow of

PAGE 48

31 argon with stirring. The re sulting solution was deoxygena ted by several cycles of vacuum-argon degassing. Another solu tion comprised of 20 mol of Pd(PPh3)4 and 20 mol of CuI in a mixture of 10 ml of DMSO and dimethylaminopyridine was likewise deoxygenated and subsequently added dropwise to the monomer solution. The final mixture was again deoxygenated and stirred at room temperature under a positive pressure of argon for 24 hrs. The resulting solution was viscous, brown-yellow in color and exhibited an intense blue-green fl uorescence under near-UV illumination. The solution was then centrifuged and the precipitated CPG was washed several times with DMSO and water until the supernatant was clear and colorless. The CPG was then incubated in ammonia at 55C for 8h to clea ve the oligonucleotide from the CPG and to deprotect the bases. A control synthesis wa s carried out following the same procedures and experimental conditions, where a 16mer DNA without the 5I-dU base was used. The solutions that resulted after ammonia incubation of the 5I-dU oligonucleotide derivatized CPG and the control CPG were de salted by ethanol precip itation, dried and dissolved in deionized water. Instruments An ABI 3400 DNA/RNA synthesizer was used for DNA/probe synthesis. UVVisible absorption spectra were obtaine d on a Varian Cary 300 dual-beam spectrophotometer, with a scan rate of 300 nm/min. Fluorescence measurement were conducted on a SPEX Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ) with a 450 W Xenon lamp. A 1 cm square qua rtz cuvette was used for both absorption and emission measurements.

PAGE 49

32 Fluorescence Quenching Experiments Fluorescence quenching experiments were carried out by micro-titration in a fluorescence cuvette. In a typical titration experiment, 3 mL of a PPE-SO3 solution was placed in a 1 cm quartz fluorescence cell. The fluorescence spectra were recorded at room temperature. Then fluorescence spectra were repeatedly acquire d subsequent to the addition of L aliquots of a concentrated solution that contained the quencher. Quencher solution aliquots were deliver ed using a calibrated Eppe ndorf microliter pipetter. Results and Discussion Biofuctionalization of Conjugated Polymer PPE Here we introduce a versatile and effective synthetic method for coupling oligonucleotides to conjugated polyelectrolyte s. Instead of synthesizing the polymer and oligonucleotide separately before coupling, we treat the oligonucleotide as an endcapping monomer in the Pd-catalyzed step -growth polymerizati on of the PPE-based conjugated polyelectrolyte. The oligonucleotide takes part in the polymer ization process, and is incorporated into the PPE chain as an end-capping unit. The oligonucleotidefunctionalized monomer is bound to a cont rolled pore glass (C PG) solid support, allowing the DNA-PPE conjugate to be easil y separated by centrifugation. As each oligonucleotide has only one end functiona lized with an end-ca pping monomer, only one polymer chain can grow from a DNA stra nd, resulting in a precise one-to-one coupling. Furthermore, this method not only a llows an oligonucleot ide to be conjugated to a PPE chain, but it can also be extended to other biomolecules such as biotin using a similar approach when biotin phosphoramidite is used.

PAGE 50

33 Figure 2-1. Schematic representation of so lid state synthesis of DNA-PPE conjugate. Figure 2-1 shows the process of making a DNA-PPE conjugate. On a CPG support, an oligonucleotide with a defined sequence wa s synthesized from the 3 end to 5 end using standard phosphoramidite chemistry. 5'-Dimethoxytrityl-5-iodo-2'-deoxyuridine 3'-[(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite (5I-dU phosphoramidite) was used to introduce a 5I-dU as the last base of the o ligonucleotide, providing the functionalization necessary to render the oli gonucleotide active as a monomer for the PPE. Under Sonogashira conditions, the 5I-dU base couples to terminal alkynes with high efficiency.75;76 The 5IdU functionalized oligonucle otide was then added to the PPE polymerization solution as an end-capping mono mer, allowing the polymer chain to cross couple with the CPG-linked oligonucleotide. Two advantages can immediately be seen from this synthesis approach. First of all, as one end of DNA can be functionalized with 5I-dU, only one polymer chain can grow from a DNA a chain, allowing one-to-one CPG CPG (a) (b) PPE DNA synthesis Activation (c) Polymerization (d) Wash Cleavage DeprotectionndG GCC TAT TCT CAA CTC G O DMTO P O O O O GCC TAT TCT CAA CTC G N N H O O I CNEt O DMTO P O O O O GCC TAT TCT CAA CTC G N NH O O O NaO3S O SO3Na CH 3 CNEt CPG CPG

PAGE 51

34 coupling of a DNA chain to a PPE chain. S econdly, every PPE chain coupled to the DNA chain is linked to CPG, allowing effec tive separation of DNA-PPE from free PPE by means of centrifugation. Coupling of PPE Monomer and Oligomer to DNA Two small organic molecules (Figure 2-2) were used to confirm that the 5I-dU modified oligonucleotide is ab le to conjugate to the polymer monomer and oligomers present in the polymerizati on reaction mixture. In one model reaction, ethynylbenzene was coupled with the CPG-linked DNA. In a second reaction, 4-[(2,5-dimethoxyphenyl) ethynyl]-4'-ethynyl-1,1'-biphenyl, was used to mimic a small PPE oligomer. H MeO OMe H ethynylbenzene 4-[(2,5-dimethoxyphenyl)ethynyl]-4'-ethynyl-1,1'-biphenyl Figure 2-2. Model molecules used to coupl e to 5I-dU functionaliz ed oligonucleotide. The products of the two model molecule s coupled with 5I-dU functionalized oligonucleotide were analyzed with revers e phase gradient C8 HPLC/UV/ESI-MS. The oligonucleotides yielded [M-zH]zions in (-)ESI-MS and [M+zH]z+ ions in (+)ESI-MS. The molecular masses were calculated from the multiple charge ion spectra. As the (-) ESI-MS yielded more charge states than the (+)ESI-MS, it provided better precision on the MW determination. The observed molecu lar weights matched the number calculated from the product structures. For example, the calculated molecular weight of ethynylbenzene modified oligonucleotide wa s 5183.4, while the observed molecular weight was 5181.6, calculated form the predominant m/z 1728.2 [M+3H]3+ ion in positive mode. In the negative ion mode (Fi gure 2-3), this compound yielded several [M

PAGE 52

35 zH]zions, permitting its molecular weight to be determined: MW = 5182 +/2.1u, n=6 ions. The calculated molecular weight of 4-[(2,5-dimethoxyphenyl) ethynyl]-4'-ethynyl1,1'-biphenyl modified oligonucleotide was 5419, while the observed molecular weight was 5418.8 from (-) ESI-MS (Figure 2-4) and 54 17.7 from (+) ESI-MS. Figure 2-5 is the negative ESI mass spectrum of a 16mer DNA used in the control synthesis. This 16 mer DNA has the same sequence as that used to synthesize the DNA-PPE monomer, DNAPPE oligomer and DNA-PPE except that there is no 5I-dU at the 5 end. The observed molecular weight of this control 16mer DNA was 4791.9 and matched well with the calculated molecular weight (4792.2g/mol). Th ese results indicated that the CPG-linked oligonucleotide is able to undergo cro ss coupling with term inal acetylenes under Sonogashira conditions. More importantly mass spectroscopy shows that the oligonucleotides remained intact after exposure to the polymerization condition. Figure 2-3. The (-)ESI mass spectra of DNA-PPE monomer (Calculated MW=5183.4). 150 200 250 300 350 400 450 500 550 600 650 700 750 m/z 0 10 20 30 40 50 60 70 80 90 100 Relative Abundance 739.5 740.1 647.3 715.2 706.1 641.3 684.9 506.2 604.9 489.8 563.0 512.4 463.3 275.0 386.3 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 m/z 0 10 20 30 40 50 60 70 80 90 100 Relative Abundance 1294.4 1726.0 1295.1 1726.7 1299.9 1035.3 1256.9 1733.4 862.6 1477.2 1222.9 1513.1 1303.1 1689.6 1416.8 1573.2 1805.8 1146.6 1629.7 1005.3 1048.0 973.3 1835.4 N N H O OO O HP O O O-O3' GCC TAT TCT CAA CTC G MW5182 [M-7H]7MW5182 [M-8H]8MW5182 [M-6H]6MW5182 [M-5H]5MW5182 [M-3H]3MW=5182.6 +/2.1 u, n=6

PAGE 53

36 Figure 2-4. The negative ESI mass spectra of DNA-PPE oligomer (Calculated MW =5419.4). Figure 2-5. The negative ESI mass spectra of control 16mer DNA (Calculated MW=4792.2). 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 m/z MW5418.8 [M-3H]3150 200 250 300 350 400 450 500 550 600 650 700 750 m/z 0 10 20 30 40 50 60 70 80 90 100 Relative Abundance 676.5 714.5 737.6 652.3 634.6 708.0 481.1 249.0 543.2 610.5 447.5 176.9 601.1 401.1 235.3 418.0 553.8 490.2 303.0 346.0 10 20 30 40 50 60 70 80 90 100 Relative Abundance 1353.6 1804.9 1354.3 1082.8 1358.9 1362.9 1812.1 1804.2 1316.3 773.1 902.1 1652.3 1291.7 1095.7 1512.9 1723.0 1555.6 1416.7 1060.6 O CH3O C H3N N H O OO O HP O O O-3'-GCC TAT TCT CAA CTC G MW 5418.8 +/-0.8 u, n=6 MW 5418.8 [M-8H]8MW5418.8 [M-4H]4[M-5H]5[M-6H]6[M-7H]7150 200 250 300 350 400 450 500 550 600 650 700 750 m/z 0 10 20 30 40 50 60 70 80 90 100 MW 4791.9 u [M-7H]7683.8 635.3 694.4 749.5 657.4 743.1 491.0 288.2 195.2 402.1 623.3 695.5 386.4 598.0 583.1 463.2 425.9 546.2 257.2 177.1 346.3 306.2 536.9 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 m/z 0 10 20 30 40 50 60 70 80 90 100 MW 4791.9 u +/1.08 u, n=5 [M-5H]51196.9 1596.0 1197.7 1915.4 1916.1 1159.0 957.4 1200.7 1134.8 1865.9 1603.2 1918.9 1545.7 1486.4 1443.9 797.5 958.1 1042.7 1219.5 1320.0 1832.4 1391.0 1673.5 1765.0 1995.8 887.0 811.0 950.5 [M-6H]6[M-4H]4[M-3H]33-GCC TAT TCT CAA CTC G-5 Relative Abundance Relative Abundance

PAGE 54

37 DNA Hybridization Study An important criterion in choosing a polymer ization condition is that the reaction environment has to be mild enough to allow DNA to remain intact and reserve its biorecognition capability. Mass sp ectroscopy analysis indicated that DNA structure remained unchanged after exposure to the pol ymerization condition. To test the biofunctionality of those polym erization reaction treated DNA, a MB assay was employed. The sequence of the MB used was: 5 DABCYL-CCT AGC TCT AAA TCG CTA TGG TCG C GCT AGG -TMR-3. Two cDNA samples, cDNA1 and cDNA2, sharing same sequence (5-GCG ACC ATA GCG A TTT AGA-3 ) were synthesized under different conditions. The cDNA1 was synthesized with normal DNA preparation procedure, while cDNA2 had been exposed to the polymeriza tion reaction. The sequence of these two cDNA targets was designed complementary to the loop sequence of the MB. If the cDNA functions as a normal DNA strand, it will hybri dize to the MB, restoring its fluorescence. MB+random DNAMB+c-DNA1MB+c-DNA2 0 2 4 6 8 10 12 14 16 18 Fluorescence Intensity Enhancement Figure 2-6. Fluorescence enhancement of th e MB after addition of cDNAs. 100 nM of MB in 20 mM Tris-HCl buffer (50mM NaCl, 5mM MgCl2, pH 7.5 ). cDNA1 concentration = 500 nM, cDNA2 con centration = 500 nM, and the random sequence DNA concentration used was 2 uM.

PAGE 55

38 Figure 2-6 shows cDNA1 and cDNA2 hybridi zed to a MB, resulting in a similar signal enhancement. Upon addition of excess random DNA, no significant signal changes were observed. These results showed that cDNA2, after exposure to the polymerization condition, functioned as well as a normal DNA cDNA1 did, indicating that the polymerization condition had no significant effect on th e bio-recognition capability of the DNA. Direct Synthesis of DNA-PPE with One-to-One Ratio In the original method of synthesizing water-soluble PPEs53, a mixture of water, DMF, and diisopropylamine was used. The grow th of PPE from the 5I-dU functionalized DNA requires anhydrous conditions since the oligonucleotide is linked to CPG by an ester bond, which in addition to the base pr otection groups on the oligonucleotide is sensitive to any nucleophiles especially unde r basic condition. Preliminary synthetic preparations indicate that PPE-SO3 can be synthesized in either DMSO/dimethylaminopyridine or DMF/triethylamine solvent systems. Thus, DMSO/ dimethylaminopyridine was chosen for the synthesis of DNA-PPE. The monomers, CPG containing 5I-dU functionalized DNA, and cat alysts were incubated in deoxygenated DMSO/dimethylaminopyridine solution stirre d at room temperature under a positive pressure of argon for 24 hrs. The solution wa s then centrifuged and the precipitated CPG was washed several times with DMSO and water until the supernatant was clear and colorless. After washing, the CPG was st ill yellow-green and highly fluorescent. The color was likely comes from the PPE molecule s that covently conjugated to the DNA on the CPG. The CPG was then incubated in am monia at 55C to cleav e the oligonucleotide from the CPG and to deprotect the bases. After overnight incubation, the CPG became white while the liquid phase turned yellowgreen and fluoresced under UV illumination,

PAGE 56

39 indicating that the PPE coupled to DNA was cleaved from the CPG as a result of the cleavage of the DNA from the s upport. For the control synthesis using CPG with a 16mer DNA without 5I-dU base, the CPG was white af ter 3 repeated rinses prior to cleaving DNA from the solid support. No color from the control CPG indica tes that PPE was not coupled to the DNA and could not be c oupled without the iodine-derivatized deoxyuridine. Figure 2-7 compares the fluorescence em ission spectra of the DNA-PPE and the control solutions. The DNA-PPE solution s hows an emission band with a maximum at 520 nm, which is consistent with a previous report that this PPE emits at 520 nm in water (the emission is broad because the PPE is aggregated in water).53 Deaggregation of the PPE induced by addition of a non-ionic surfactant,77 dispersion into agarose gel or changing to methanol solvent,53 shifts the emission maximum of the PPE to 455 nm. Figure 2-8 shows the emission peak shift of the DNA-PPE conjugate from 520 nm to 455 nm as a result of de-aggre gation after being dispersed in agarose gel. The strong fluorescence from the DNA-PPE solution and the lack of fluorescence from the control solution suggests that the PPE has b een successfully coupled to the DNA. 450500550600650700 0 50000 100000 150000 200000 250000 300000 Fluorescence InensityWavelength (/nm) PPE-DNA Control Figure 2-7. Fluorescence emission spectra of DNA-PPE, and the control solution.

PAGE 57

40 450500550600650700 0.0 0.2 0.4 0.6 0.8 1.0 Fluorescence IntensityWavelength/nmFigure 2-8. Fluorescence emission of PPE in agarose gel stained with ethidium bromide The fact that the PPE is coupled to the 5I-dU DNA was further confirmed by gel electrophoresis, where a 0.5% agarose gel was used to analyze DNA-PPE, PPE, and the DNA obtained from the control synthesis. As shown in Figure 2-9, in the DNA lane (3), only one band is observed, while in the PPE lane (2), no DNA band exists. By contrast, there are two bands in the DNA-PPE lane (1), suggesting that at least two types of DNA are present. One is likely the free DNA (this band has a similar migration rate as that in lane 3), and the second is likely the DNAPPE conjugate. The DNA-PPE band migrates very little in the agarose matrix, due to the rigid rod structure50 of the PPE and the large molecular weight of PPE-DNA conjugate. Qu antitative analysis of the DNA-PPE lane revealed that the ratio of the overall intens ity for the DNA band to that for the DNA-PPE conjugate band is about 1.2, indicating a yi eld higher than 45% for the coupling reaction between the DNA strand and the PPE.

PAGE 58

41 Figure 2-9. Gel electrophoresis of PPEDNA (1), PPE (2), and DNA (3) samples. Agarose 0.5%, 1 TBE buffer (0.089 M Tris, 0.089 M borate and 2 mM EDTA, pH 8.2-8.4), 90V for 20 minut es. The gel was prestained with ethidium bromide for DNA detection. Pictures were taken with a Kodak camera in fluorescence mode with a 540640 nm band pass filter. This filter passes emission from ethidium brom ide, indicating the presence of oligonucleotide, while removing the emission for PPE under this condition (PPE emits at 455 nm in agarose gel). Design of PPE-MB for Signal Amplification The successful establishment of this conj ugation method allows us to construct a variety of biosensors using conjugated polymer s, where a precise control of the coupling ratio of recognition molecules to polymer a nd complete separation of free conjugated polymer from the biofunctionalized conjugated polymer are crucial. Our first attempt was to synthesize a MB with a conjugate d polymer chain as its fluorophore. A MB13 is a hairpin shaped oligonucleotide with a fluores cent dye (F) at one end and a quencher (Q) at the other end. In the absence of the target DNA, the fluorescent dye and quencher molecule are brought close together by the probe's self-complementary stem, suppressing the fluorescence signal. Because the perfectly matched DNA dupl ex is more stable than the single-stranded hairpin, the MB readily hybridizes to its targ et sequence, thereby disrupting the stem structure, separating the fluorophore from the quencher, and restoring 1 2 3

PAGE 59

42 the fluorescence signal (Figure 2-10a). Unlike a traditional dye labeled MB, this new design uses a polymer chain as its fluorophor e to amplify the fluorescent signal. When the MB is in its closed state, the polymer chain will be in close proximity to the quencher. Because of the superquenching property of the conjugated polymer, it is expected that the fluorescence of the conjugated polymer will be strongly suppressed. After target DNA binding, the fluorescence of the conjugated polym er will be restored as a result of the increased separation distance between the conj ugated polymer and the quencher (Figure 2-10b). Figure 2-10.Working principles of a MB (a) and conjugated polymer labelled MB (b). In a regular MB, one fluorophore is used to re port a target bind ing event while in the conjugated polymer labelled MB, a conjugated polymer chain is used. Selection of Quencher and Fluorescence Quenching Study In order for the new type of MBs to func tion, careful selection of the quencher is important. Three criteria were considered wh en selecting a quencher. First, the quencher should be able to quench polymer PPE with high efficiency, thereby reducing background fluorescence. Second, in order to be integrated into a MB, the quencher should have the appropriate functionalitie s needed to couple to DNA. Finally, DNA

PAGE 60

43 coupling should not alter the molecular prop erties of the quencher, particularly its quenching ability. Successful superquenching of PPEs has been accomplished by N,N-dimethyl-4,4bipyridinium (MV2+).53 However, this quencher is inappropriate for our work since it lacks appropriate functionalities to conjug ate to DNA. Alternate non-fluorescent quenchers, such as DABCYL, Black Hole Quenchers and QSY-7 are widely used in MB synthesis. These quenchers will be good candidates for our polymeric fluorophore MB because of their high extinction coefficients and the well developed automatic solid phase synthesis method used to couple with DNA with high efficiency. N N O HON DABCYL O N Me Ph N Me Ph S O O N COOH QSY 7 N N N N Me O2N Me MeO N HOEt HOEt BHQ 1 Figure 2-11. Structures of some comonly used non-fluorescent quenchers for MB synthesis. Among them, DABCYL is most widely used and was chosen in our MB synthesis. In order for the resulting conjugated polymer labelled MB to work, DABCYL should effectively quench the fluorescence emission of the polymer. Quenching experiments were performed to determine if the polymer showed superquenching by DABCYL. As shown in Figure 2-12, quenching of 2 M (repeat unit concentration) PPE by different concentrations of DABCYL was very efficient. The Stern-Volmer quenching constant at lower quencher concentrations (less than 0.4 ) was 4106 M-1. At higher quencher concentrations, an upward curve was seen in Stern-Volmer plot, giving a much higher quenching constant, approximately 1.4107 M-1. Upward curvature is typically seen in

PAGE 61

44 the Stern-Volmer plots of conjugated polye lectrolytes by oppositely charged quenchers, and the mechanism for this behavior has been discussed. 0.0 2.0x10-74.0x10-76.0x10-78.0x10-71.0x10-60 1 2 3 4 5 6 7 8 9 10 0.0 2.0x10-74.0x10-70.0 0.5 1.0 1.5 2.0 F0/F-1[DABCYL] (M)Ksv=4x106M-1 Figure 2-12. Stern-Volmer plot of PPE quenching by DABCYL in 40 mM Glycine-HCl buffer (pH 2.3). The Glycine-HCl buffer was used to protonate DABCYL as a counter ion to polymer PPE. The quenching of PPE by QSY-7 was also tested. As shown in Figure 2-13, quenching of 3 M (repeat unit concentration) PPE by different concentrations of QSY-7 was very efficient. Approximately 97% fluorescence from 3M PPE was quenched by only 0.5 M of QSY-7. Figure 2-13. The emission (left) and SternVolmer plot (right) of 3 M (repeat unit concentration) PPE-SO3 quenched by various concentrations of QSY-7 400450500550600650 0 200000 400000 600000 800000 1000000 1200000 1400000 1600000 1800000 2000000 Fluorescence Intensity Wavelength (nm) 0 uM 0.1uM 0.2um 0.3uM 0.4uM 0.5uM0.0 1.0x10-72.0x10-73.0x10-74.0x10-75.0x10-76.0x10-70 5 10 15 20 25 30 (F0/ F)-1Quencher QSY-7 Concentration (M)

PAGE 62

45 The Stern-Volmer quenching constant at lo wer quencher concentration (less than 0.3 ) was as high as 2.57M-1. At higher quencher concentration, an upward curve was seen in Stern-Volmer plot, givi ng a much higher quenching constant, 18 M-1. The quenching experiment were conducted on PE-S O3 (Figure 2-14 Left), a low molecular weight analogue of PPE-SO3. It was found th e quenching constant of PE-SO3 by QSY-7 was about 1.95 M-1. This comparison clearly showed that the conjugated polymer PPE-SO3 is more than 520 times sensitive to the quencher QSY-7 than its low molecular weight analogue PE-SO3. These two experiments confirmed that PPE can be superquenched by the nonfluorescent quenchers DABCYL and QSY-7. DABCYL was chosen for the design of PPE-MB since it can be directly coupled to a DNA chain directly using a DABCYL functionalized CPG or phorphoramidite. Figure 2-14. The structure of PE-SO3 and the Stern-Volmer plot (right) of 3 M PE-SO3 quenched by various con centrations of QSY-7 Synthesis of PPE-MB The synthesis of the MB followed the sa me procedure as described above except that a 3 DABYCL(4-(4-(dimethylamino)phe nylazo)benzoic acid) quencher CPG was used instead of a regular base CPG (Figure 2-15). The MB sequence synthesized was 5-0.0 3.0x10-76.0x10-79.0x10-71.2x10-61.5x10-60.00 0.05 0.10 0.15 0.20 0.25 0.30 F0/F-1QSY-7 Concentration (M)O O SO3Na NaO3S PE-SO3

PAGE 63

46 PPECC TAG CTC TAA ATC ACT ATG GTC GCG CTA GG-Dabcyl-3. Theoretical calculations indicated this sequence c ould form a stable hairpin structure.78 Q GCC......GGCCPG(a) (b)DNA synthesis Activation(c)Polymerization(d)Washing Cleavage DeprotectionQ C P G P P E Q P P EQ (e) Tris-HCl Buffer Q GCC......GGCU*CPG P P E Q GCC......GGCCPG Figure 2-15 Schematic representation of so lid state synthesis of conjugated polymer labelled MB. Q stands for quencher DABCYL. The resulting MBs sequence is: 5-PPECC TAG CTC TAA ATC ACT ATG GTC GCG CTA GGDABCYL-3 -1000100200300400500600700 0 20000 40000 60000 80000 100000 Fluorescence Intensity ChangeTime (second) Figure 2-16. Response of PPE labelled MB to its target DNA. MB sequence: 5'-PPECC TAG CTC TAA ATC ACT ATG GTC GCG CTA GG-DABCYL-3', Target Sequence: 5'GCG ACC ATA GTG A TT TAG A -3'. Buffer condition: 20mM Tris-HCl, pH7.5, 50mM NaCl, 5mM MgCl2, 0.1%Tween20. Figure 2-16 shows the response of the conj ugated polymer labeled MB to 5-fold excess of target DNA. Immediately after the addition of target DNA, increase of polymer emission was observed. When lower concentra tion of target was us ed, a slower reaction profile was observed. As a negative contro l, a large excess of random sequence DNA was added to the MB solution, and this did not gi ve any substantial change in the fluorescence

PAGE 64

47 intensity. These hybridiz ation results suggested that: 1) the DABYCL molecule quenches the polymer chain when the MB is in its ha irpin conformation; 2) the conjugated polymer labeled MB functions as a normal MB that selectively hybridizes to its target DNA. The initial success of making PPE-MB mixes with several problems that warrant future optimization of the design. First, it wa s found that the MB di d not work quite well in a pure buffer in the absence of surfactant. Th is is likely due to the fact that the polymer chain tends to stack together. The use of non-ionic surfactant can de-aggregate the polymer,77 allowing each PPE-MB function as an i ndividual probe. The use of surfactant might not be compatible with some applic ations. Designing new conjugate polymers with no tendency to self-aggregate eliminates the need for su rfactant. Second, although the overall signal intensity from the probe was high, the signal enhancement was very low due to a very high background signal. Hi gh background signal could result from low quenching capacity of the quencher to quenc h a polymer chain, or failure of forming stable hair-pin structure of the probe due to steric hindrance imposed by the bulky structure of polymer. New quenchers should be explored and the stem of the MB needs to be carefully optimized in order to counteract this steric hindran ce. Finally, current methods of making polymers result in polymer chain of different length for each probe. Such a distribution in polymer chain lengt h might cause big signal distributions for detecting targets with low copy number as each probe might give different signal intensities. Developing a size controllabl e polymerization method will benefit the performance of the probe. Conclusions To use conjugated polymers to amplify biomolecular interactions, we have developed a novel synthetic method for conjug ation of a water soluble PPE with an

PAGE 65

48 oligonucleotide. Coupling was achieved by car rying out the PPE pol ymerization reaction in the presence of a 5I-dU terminated o ligonucleotide linked to a CPG support. The product, DNA-PPE, can be easily separate d from free PPE by centrifugation. The conjugation reaction is simple, fast and eas ily controllable. The coupling efficiency between the PPE and the DNA is high. Mass spectroscopy analysis and DNA hybridization study results indi cated that polymerization condition was so mild that the DNA exposed to polymerization not only remained structurally intact, but also kept their bio-recognition capability. The new method has f our distinct advantages: stoichiometric labeling of DNA to the polymer chain; easy separation to enable high purity of the desired final product; high yi eld for DNA and PPE conjugation; and structural stability to covalent conjugation between the biomolecules and the PPE. This new method makes it possible to efficiently couple a fluorescent amplifying polymer with biomolecules for sensitive signaling in a variety of biosen sor applications. To explore the use of conjugated polymers for DNA sensing, a MB wa s synthesized with a conjugated polymer chain as the signaling element. Without the st rategies developed here the preparation of such a MB would have been extremely difficult or even impossible. This MB produced a strong fluorescence signal specifically fo r the complementary sequence and showed promise as a sensitive bioanalytical probe. Th e physical, chemical, spectral and biological properties of this hybrid material DNA-PPE are currently being investigated. The application of PPE labeled MB in high sens itive bioassays is also in progress.

PAGE 66

49 CHAPTER 3 MOLECULAR ASSEMBLY OF SUPERQUENCHERS IN SIGNALING MOLECULAR INTERACTIONS Introduction This chapter discusses the establishment of a molecular assembling approach to generate a series of quenchers for th e signaling of molecular interactions.79 There are two important ways to improve the sensitivity of molecular beacons. One is to enhance the fluorescence intensity of the open-state mol ecular beacons, which has been tested in Chapter 2. Another way is to minimize th e fluorescence intensity of the molecular beacons in the closed-stem conformation. In molecular probe design and preparation, the unquenched high background from the probe itse lf limits the incremen t of signal change upon interacting with their targets, which leads to poor sensitivity of the detection methods. Strategies for improving the signa l-to-background ratio (S BR) of molecular probes promise higher assay sensitivity as well as better reproducibility. There have been encouraging progress in attempts at introducing novel signaling schemes,80;81 exploring nanocomposites82;83, and improving quenching performa nce using rational molecular design coupled with sophisticated synthesis methods.84-86 In this chapter, we explore the feasibility of assembling multiple quenchers to label molecular probes in an attempt to improve the overall quenching efficiency of the quencher moiety thus minimizing the probe background signal and enhancing the probe SBR. We have explored two ways of intr oducing multiple quencher molecules into a molecular beacon sequence: one labels the que nchers on the side chain of beacon stem;

PAGE 67

50 the other tethers multiple quenchers at the en d of the stem through a dendrimeric linker. The resulting quenching efficiencies from thes e two labeling approaches were compared. Experimental Section Molecular Beacon Synthesis All DNA synthesis reagents were from Glen Research (Starling, Va). Molecular Beacons were synthesized with an ABI3400 DNA/RNA synthesizer. Table 3-1 lists the probes synthesized for this study. For side chain labeling or internal la beling, FAM labeled dT phosphoramidite was used for FAM labeling. DABCYL labeled dT phophoramidite was used to introduce one DABCYL molecule into each sequence. Mul tiple couplings of DABCYL labeled dT phophoramidite were performed to attach plural DABCYL molecules to the stem sequence. For FAM-dT and DABCYL-dT coupling, 15 minutes of reaction time was used to ensure optimal coupling efficiency. For all end labeling synthesis, FAM CPG was used for all FAM labeled molecular beacons synthesis. For Cy3 labeled MBs, phosphate CPG and ultramild deprotection phosphoramidites were used. TMR-CPG and normal phosphoramidites were used for TMR labeled MB synthesis. Symmetric doubler phosphoramidite, asymmetric doubler phosphoramidite, and trebler phosphoramidite s were used to assemble different Superquenchers. Coupling time for all linke r and quencher labeling was 15 minutes. For FAM labeled MBs, incubation overnigh t concentrated in ammonia was used for cleavage and base deprotection. Ultr amild deprotection c ondition, overnight /incubation in 0.05M K2CO3/methanol, was used for the Cy3 labeled molecular beacons. Deprotection of the TMR labeled MBs was done by treating the oligonucleotides with a tert-butylamine: methanol: water (1 :1:2) incubation for 3 h at 65 C.87

PAGE 68

51 The resulting ammonia-dissolved oligonucle otides were precipitated in ethanol. The precipitates were then dissolved in 0.5ml of 0.1 M triethylammonium acetate (pH 7.0) for further purification with high-pre ssure liquid chromatography. The HPLC was performed on a ProStar HPLC Station (Varia n, CA) equipped with a fluorescence and a photodioarray detector. A C18 reverse pha se column (Alltech, C18, 5M, 250x4.6mm) was used. For FAM labeled MBs, the fractio ns that absorbed at 260, 470 and 488nm while fluorescing at 520nm with 488nm excitation were collected. Several fractions for a run were collected for multiple-quencher MBs. For example, in the purification of the three-quencher MBs, three fractions were co llected from HPLC. Each fraction was well resolved and corresponded to single quenche r, two-quencher and three-quencher MBs. The last fractions in each separation was colle cted and corresponded to the fully complete probe. Table 3-1. Sequences of MBs synthesized in th is study. T(D), T(F), FAM, CY3, 5, 6, 7, 8 stand for DABCYL labeled dT, fluorescei n labeled dT, fluorescein dye, cy3 dye, symmetric doubler linker, DABCY L, trebler linker and ECLIPSE respectively. Name Sequence MB226 FAMCCTAGCTCTAAATC ACTATGGTCGCGCTAGG-DABCYL Single-Q-MB CCT T(D)TC GCT CTA AAT CAC TAT GGT CGC GCG AT(F)A GG Dual-Q-MB CCT(D)T(D)TC GCT CTA AAT CAC TAT GGT CGC GCG AT(F)A GG Tri-Q-MB CCT(D)T(D)T(D)C GCT CTA AAT CAC TAT GGT CGC GCG AT(F)A GG Quad-Q-MB GTG T(D)T(D)T(D)T(D)GC TCT AAA TCA CTA TGG TCG CGC AAT(F) ACA C MB3F51D 6CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM MB3F52D 65CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM MB3F53D 67CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM MB3F54D 655CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM MB3F56D 675CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM MB3F95D 677CCTAGCTCTAAATCACTATGGTCGCGCTAGG-FAM MB3F51DCY3 6CCTAGCTCTAAATCACTATGGTCGCGCTAGG-CY3 MB3F53DCY3 67CCTAGCTCTAAATCACTATGGTCGCGCTAGG-CY3 MB3F53DTMR 67CCTAGCTCTAAATCACTATGGTCGCGCTAGG-TMR PDGF3F53D 67CAGGCTACGGCACGTAGAGCATCACCATGATCCTG-FAM

PAGE 69

52 Hybridization of MB Fluorescence measurements were co nducted on a Fluorolog-3 Model FL3-22 spectrofluorometer (JOBIN YVON-SPEX Indus tries, Edison, NJ) using a 4 ml quartz cuvette. All hybridizatio n was performed at 25 oC with an external circulating water bath. The background fluorescence of a 3ml buffe r solution containing 20mM of Tris-HCl (pH7.5), 50mM NaCl and 5mM MgCl2 was monitored for about 1 minute. Then 1-10 uL of MB solution was added the hybridization buffer and the fluorescence emission was monitored. After a stable fluorescent si gnal was reached, an excess of target oligonucleotide was added. The level of fluorescent intensity was recorded. The excitation/emission wavelengths were set to 488 nm/515 nm, 546 nm/566 nm, 550 nm/580 nm for fluorescein, Cy3 and TM R dye labeled MB respectively. The signal-to-background ratio was determined by SBR= (Fhybrid-Fbuffer)/ (FMB Fbuffer), where Fhybrid, Fbuffer, and FMB probe are the fluorescence intensity of the MB target hybrid, the buffer, and the free MB, respectively. The quenching efficiency was defined as Q%=100*(1-((Fhybrid-Fbuffer)/ (FMB probe-FBuffer)). Results and Discussion Design of Multiple-Quencher MBs Extensive study of the unique thermodynamics and specificity of molecular beacons88;89 has demonstrated two main advantages: excellent sensitivity to the detection of one base mismatch in a nucleic acid sequence and direct de tection of unlabeled oligonucleotides.82 Although these properties have resulted in a variety of fluorescencebased applications such as DNA/RNA detection,12;13;90-92 living systems investigation,29;31;35;93 enzymatic process monitoring,94;95 biosensor design,96;97 proteinDNA interactions,98;99 and biochip fabrications,100-102 there is still the challenge of

PAGE 70

53 improving the sensitivity of these probe assays Poor detection sensitivity of the probes has hindered the biological application and pot ential of molecular beacon probes. It has been theorized that MBs should have up to a 200-fold of enhancement in fluorescence signal, but this enhancement has rarely been achieved in MB applications. Low signal enhancement, is a result of many factors, including forma tion of secondary structures, sticky end pairing, presence of fluorescent im purities and low quenching efficiency of the quencher molecule. While the first two factor s may be eliminated through careful design of the probe sequences, the latter two factor s remain major sources of high background signal. The quenching efficiency of the quencher molecule could be improved by exploring new molecular designs and developing novel synthesi s methods to obtain better quenchers. As a universal quencher,12 4-((4-(dimethylamion) phyenyl) azo) benzoic acid (DABCYL) has been widely used in mol ecular beacon synthesis. DABCYL can quench at most 99.0% of the fluorescence of a dye placed in close proximity.82 While optimal for quenching fluorescein, the quencher efficien cy of DABCYL diminishes significantly for dyes emitting at longer wavelengths.82 Recently, new organic quenchers with improved efficiencies have been developed and are commercially available. Among them include Black Hole Quenchers, Iowa Black, EC LIPSE, QSY quencher series. Although these new quenchers offer improved quenching effi ciency for different fluorophores, their performance is limited when used in MBs. Another possible way to improve the quenching efficiency is to assemble multiple quenchers together to pair with one fluor ophore in a molecular probe. Pairing multiple quenchers with a single fluorophore provides be tter quenching efficiency due to the

PAGE 71

54 summation of the quenchers extinction coeffi cients and the increased probability of dipole-dipole coupling between the quencher s and the fluorophore as a result of a increased molecular interaction. In additi on to the improved quenching performance, the attachment of extra quencher molecules to the probe sequence effectively extends the retention time of the probe in a reverse phase HPLC column, allowing better separation of the fluorescent impurities. As a proof of principle, MBs with multiple quenchers were designed and synthesized. Two ways of labeling quenchers to an MB sequence were explored: internal labeling and end labeling. In the first design, quencher labeled bases were used to build several adjacent bases in one arm of the MB. To the corresponding base in the other arm of the stem, a fluorophore labeled base was us ed. Figure 3-1 is a schematic showing the structure of the internally labeled three-quencher MB. Figure 3-1. Structure of an internal labe led three-quencher molecular beacon. Three DABCYL molecules, are internally attach ed to the 5' arm of the molecular beacon, while the fluorophore is internally labeled next to the 3 end. In this figure, the red circles stand for DA BCYL labeled dT while yellow circle stands for fluorescein labeled dT. In the second design, dendrimeric linkers103;104 were used to allow different number of quenchers to be assembled together at the end of an MB sequence (Figure 3-2). A CN N N CH3C H3O NH NH OT 5'C G T C A T A A T C T A T G G T C G C C G G C A 3'A C GO O H OH O O O NH NH OT N N N CH3C H3O NH NH OT N N N CH3C H3O NH NH OT C G T C A T A A T C A C T A T G G T C G C C G T G C T A C G T T C C G G A5' 3'

PAGE 72

55 Figure 3-2 Structure of an end-labeled multiple-quencher MB. The 5' end of the oligonucleotide is attached to three DABCYL molecules, while the 3' end is labeled with a fluorescein molecule. In this figure, the red balls are DABCYL molecules and the, yellow one is the fluorescein molecule. Internally Labeled Multiple-Quencher MBs In this design, quencher and fluorophore labeled phosphoramidites were used to label the quencher and fluorophore to the mo lecular beacon sequence. The number of quenchers attached to the probe can be ad justed by controlling the number of quencher labeled bases in one of the arms of the st em. Because of the commercial availability, DABCYL-dT phosphoramidite was used for mu ltiple-labeling of DABCYL. Ideally, a fluorophore labeled dA phosphoramidite should be positioned opposite the dT base in the other arm of the stem. However, a fluoresce in labeled dT phosphoramidite was used for fluorophore labeling in this init ial testing synthesis due to the limited availability of fluorophore labeled phosphoramidites. The length and base composition of the stem was 5'C G T C A T A A T C A C T A T G G T C G C C G A T G C T A O N N N CH3C H3O NH O P O O-P O O-O O O O O N N N CH3C H3O NH O P O O-O N N N CH3C H3O NH O P O O-G O O P O O-CO O H OH O OO NH 3' T C A T A A T C A C T A T G G T C G C C GA TGC T A CG C G

PAGE 73

56 adjusted to compensate the T:T base mismatch ed pair in the stem and allow the formation a stable hairpin structure. Figure 3-1 shows the structure of the internally labeled threequencher molecular beacon. The three DABCYL molecules are internally attached to the 5 arm of the molecular beacon, while the fluor ophore is internally labeled adjacent to the middle quencher on the 3 end. Figure 3-3 Signal enhancement of MB226, a regular beacon, and Tri-Q MB, a new beacon with three quenchers. In both case, the molecular beacons are 65nM, and the cDNA concentration used is 325nM. These two beacons has the same loop sequence to recognize the same ta rget DNA, and are designed to have similar stem stability. Hybridization experiments resulted in nearly a 69-fold si gnal enhancement of fluorescent signal for the three-quencher MB af ter introduction of target DNA sequence. Under the same experiment condition, an MB with single quencher showed only about 15-fold signal change (Figure 3-3). These tw o beacons were designed to have the same loop sequence and same stem stability. The 54-fold increase over single quencher MBs is MB226Tri-Q MB 0 10 20 30 40 50 60 70 Signal Enhancement

PAGE 74

57 a clear indication of the enhanced quench ing of the fluorophore by increasing number of the quencher molecules used. The beacon synthesized with this new de sign exhibits high target selectivity by discriminating against single base mismatches as evidenced in the thermal denaturing profiles of the probe with different targets (Figure 3-4). The red plot is a solution of 65nM Tri-Q-MB with 325nM of target DNA. The black one is 65nM Tri-Q-MB and 325 nM of c-DNA with a single base mismatch. Th e green line is the MB without target. The sequences of the full compliment and mismatched cDNA are AGA TTT AGT GAT ACC AGC G and AGA TTT AGC GAT ACC AGC G respectively. The duplex of the MB and the complimentay sequence is much more stable than the duplex of the MB and the mismatched sequence, as indicated by the difference in melting temperature. The melting temperature of the former duplex is approxi mately 20C higher than that of the later duplex. 0102030405060708090100 0 2 4 6 8 10 12 14 16 65 nM Tri-Q-Mb 5X MB+CDNA 5X MB+Mismatch cDNA 6 minutes temperature equilibrationFluorescence IntensityTemperature (oC) Mismatch cDNA Target DNA MB Figure 3-4 Melting temperature curve of Tri-Q -MB, a molecular beacon synthesized with three quenchers, as described in Figure3-1.

PAGE 75

58 The selectivity was also evident in hyb ridization kinetics. Figure 3-5 shows the hybridization of the Tri-Q-MB with perfect matched DNA, one base mismatched DNA and a scrambled sequence. The mismatched sequence hybridizes to the probe much more slowly than the perfectly matc hed target. It should be noted that the purpose of these experiments was not to do single base mismat ched detection. Instead, it was to confirm the selectivity of this new design MB. Optima l single base discrimination of a MB could be achieved by careful optimization of the experimental conditions. 02004006008001000 0 2 4 6 8 10 12 14 16 Fluorescence IntensityTime(second) 5x Perfect Matched DNA 5x Mismatched DNA 10x Random Sequence DNA Figure 3-5 Response of 65nM Tri-Q MB to 325nM perfect matched DNA (complementary to its loop), single base mismatched DNA and 10 concentration of random sequence DNA. MBs with 1, 2, 3 and 4 Internally Labeled Quenchers To see how the number of quenchers in a MB sequence affects the background signal of the closed-stem conformation MB, MBs with different number of quenchers were synthesized (Figure 3-6). For fair comp arison, these MBs were designed in such a way to have the same loop structure a nd similar stem stability. Thermodynamic calculations using the mfold program showed that free energies for the single quencher MB, dual-quencher MB, Tri-quencher MB and Qu ad-quencher MB are -2.6, -2.7, -2.7, -

PAGE 76

59 2.7 kcal/mole respectively.78 Secondary structure predic tion gave a single hair-pin structure for each sequence.78 All MBs were prepared according to the same synthesis and purification protocols. Figure 3-6 Secondary structures of Single-QMB (a), Dual-Q-MB (b), Tri-Q-MB(c) and Quad-Q-MB (d). Fluorescein-dT phorsphoramidite and DABCYL-dT phosphoramidite were used as the intern al fluorophore and quencher labels respectively. Figure 3-7 shows the HPLC analysis result of these four MBs. The retention time of the MB increases as the number of quenc her molecules increases The longer retention time is accounted for by the greater hybrophobicity of the quencher moieties. All of the MBs were synthesized in 400 nmole scale ex cept Tri-Q-MB, which was synthesized in 800 nmole scale. The overall synthesis effici ency decreased as the number of quenchers in a sequence increased as estimated from the peak areas in HPLC. During the HPLC purification, the fluorophore labeled truncated DNA sequence came out first, followed by the Single-Q-MB, Dual-Q-MB, Tri-Q-MB, and the Quad-Q-MB eluted out last. The longer retention times allows the multiple-quencher MB sequences to be well separated from fluorescent impurities.

PAGE 77

60 12.515.017.520.022.525.027.5 Minutes 0.01 0.25 0.50 0.75 1.00 Volts Figure3-7. HPLC profile of Single-Q-MB(blu e), Dual-Q-MB(red), Tri-Q-MB(pink), and Quad-Q-MB(green). Under the same conditions, the hybridization of the MBs was conducted and compared. As seen in Figure 3-8, except fo r the Quad-Q-MB, MBs with more quencher molecules gave lower background signal. All the molecular beacons had similar fluorescence intensity when 5 time excess of cDNA was present. The decrease in background signal yielded better signal enhanc ement for multiple-quencher MBs. (Figure 3-9). SINGLE-Q-MBDOUBLE-Q-MBTRIPLE-Q-MBQUAD-Q-MB0 1 2 3 4 5 6 7 8 Fluorescence Intensity(X10000) SINGLE-Q-MBDOUBLE-Q-MBTRIPLE-Q-MBQUAD-Q-MB0 20 40 60 80 100 120 140 160 Fluorescence Intensity ( x10000 ) Figure 3-8. Fluorescent intensity of 65 nM MBs at close st ate (left) and opened state (right). 315nM cDNA was used in the hybridization experiments.

PAGE 78

61 When the quencher number increased to four per MB sequence, the stem structure became less stable, which resulted in slightly higher background intensity, and thus lower signal enhancement for the quad-quencher MB. SINGLE-Q-MBDOUBLE-Q-MBTRIPLE-Q-MBQUAD-Q-MB0 10 20 30 40 50 60 70 Fluorescence Intensity Figure 3-9 Signal enhancements of MBs. The regular molecular beacon is labeled with a DACYL at 5 and a TMR at 3. The results from this experiment suggest that increasing the nu mber of quencher molecules can be an effective way to impr ove the fluorescence quenching efficiency of the quencher moiety in a molecular probe. Because the FRET efficiency is inversely proportional to the 6th power of the donor-acceptor distan ce, the multiple quenchers have negligible quenching effect when the MB is opened. As a result, the multiple quenchers mostly decrease the background emission of the MB and improve the overall signal enhancement. While is easy to incorporate multiple quencher molecules in the stem of MBs by directly using the dye labeled bases, such a side labeling st rategy has its limitations. First, coupling of multiple-dye labeled bases to a sequence is time-consuming and the overall

PAGE 79

62 efficiency drops significantly with the increased coupling st eps. Second, the use of dyelabeled base in the stem of a molecular beacon limits the freedom to design a MB sequence because the availability of the dye la beled reagents. Third, the dyes are attached to the base of a nucleotide, which might a ffect the stability of the stem by weakening base pairing. Fourth, there are normally only 5-6 base pairs in an MB stem, which limits the number of quencher molecules that can be used. And finally, the nature of side labeling prevents close interactions betw een the quenchers and the fluorophores, thus maximum quenching efficiency can not be achieved. To overcome these limitations, a second labeling strategythe externally labeling of multiple quenchers was developed and tested. MBs with Externally Labeled Multiple QuenchersAssembling of Superquenchers The second approach of labeling multiple quenchers in a molecular beacon probe utilizes dendrimeric linkers103;104 to assemble different number of quencher molecules to the end of the DNA sequence.79 The synthesis of the multiple-quencher molecular beacon as shown in Figure 3-2 was started with a fluorophore CPG column. DNA bases were then coupled one by one as programmed in a DNA synthesizer. Following the coupling of the the 5' base, a dendrimeric phosphoramidite103;104 was coupled before incorporation of the quencher molecules. The dendrimeric phosphoramidite generated multiple reactive OH groups for the subsequent coupli ng of quencher molecules. The number of OH groups generated varies depending on the type of dendrimeric phosophoramide linker used. For example, a trebler phorsphoramid ite (Figure 3-10) has three OH groups once activated, allowing the coupling of three quencher molecules to the end of the DNA sequence. A symmetric doubler is a linker for the introduction two quencher molecules. Utilizing different protecting groups, the as ymmetry linker can be used to introduce

PAGE 80

63 different type of molecules in a controllable manner. More quencher molecules can be coupled by the sequential addition of dendrime ric linkers to the e nd of the DNA sequence before adding the quencher molecule. The post-synthesis treatment of the molecular beacon, including deprotection, desalting, a nd purification, followed the same procedure used to produce normal molecular beacons. The sum of the extinction coefficients of the oligonucleotide sequence, quenchers, and fl uorophores at 260 nm was then used for product quantitation. DMTO O DMTO O DMTO O O P N O CNEt NH NH OP N O CNEt DMTO DMTO O O NH NH OP N O CNEt FmocO DMTO O O Trebler Phosphoramidite Symmetric Doubler PhosphoramiditeAsymmetric Doubler Phosphoramidite Figure 3-10. Structures of the dendrimeric linkers used to assemble multiple quenchers to the end of molecular beacon sequences. A MB with three DABCYL quencher molecules was first synthesized and tested. Figure 3-11 compares the hybridization result of this three-quen cher beacon MB3F53D with that of a single-quencher beacon MB3F51D of the same sequence and same fluorophore. Under the same experimental condition, the three-quencher MB had a signal enhancement as high as 326-fold upon hybridiza tion to its cDNA. This enhancement is a dramatic improvement compared to the 14fold enhancement obtained from the singlequencher MB. This comparison clearly indicates that the dendrimeric quencher assembly dramatically improves the SBR of the MB. Figure 3-12 shows that the three quencher MB had high selectivity by exhibiting singl e mismatch discrimination ability. These

PAGE 81

64 assemblies were called superquenchers beca use of the excellent quenching efficiency demonstrated by the dendrimeric quenchers. MB 3F51DMB 3F53D 0 20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 320 340 Signal Enhancement Figure 3-11 Signal enhancement of MB 3F 51D, a regular beacon, and MB 3F53D, a beacon with three end-label quenchers. In both case, the molecular beacons are 65nM, and the c-DNA concentration used is 325nM. 050010001500200025003000 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 Fluorescence Intensity x10000Time (second) cDNA Mismatch Noncomplementary Figure 3-12 Response of 65nM MB 3F51D to 325nM perfect matched DNA (complementary to its loop), single base mismatched DNA and 10 times concentration of random sequence DNA. The bulky structure of the superquenche r assembly does not destabilize the MB stem because quencher molecules are attached to the end of the molecular beacon sequence rather than in the middle interior of the stem. Instead, the superquencher

PAGE 82

65 actually helps stabilize the hair-pin struct ure of the MB, as evidenced by the melting temperatures (Tm) of the MBs (Figure 3-13). Results from melting temperature measurement experiments indicated th at the single-quencher MB had a Tm of about 54.2 C while the triple-Quencher MB has a Tm as high as 59.1C. The Tm of the SQ labeled MB was about 4.9 C higher than that of a regular MB. This stabilization is likely a result of the enhanced hydrophobic interaction between the fluorophore and quenchers. Figure 3-13 Melting temperature of a singl e-quencher MB and Triple-Quencher MB. Superquenchers from Different Nu mber and Types of Quenchers Using dendrimeric linkers shown in Figure 3-10, the number of conjugated fluorescence acceptor molecules can be controlled. Figure 3-14 shows the absorbance of a series of molecular beacons with different numbers of DABCYL molecules. These molecular beacons are labeled with fluorescein at the 3 end, and have the same stem and loop sequence. When the number of DABCYL molecules increases, the absorbance at 400-500nm increases accordingly. Figure 3-15 shows a linea r response of A460nm to the number of quencher molecules added. Th is shows that the superquencher can be engineered with a desired ex tinction coefficient. When the number of quencher molecule

PAGE 83

66 increased from 1 to 3, as i ndicated in Figure 3-16, the signal enhancement of the MBs increased accordingly. It is expected that with more quencher molecules attached, a higher signal enhancement may be attained. Surprisingly, however, molecular beacons with quencher molecules greater than three had a lower SBR than that of a threequencher molecule beacon. This seems to contradict to the assumption that the the quenching capability increases with the numbe r of quencher molecules, as indicated in Figure 3-15. A closer look at the structure of the MBs explains why molecular beacon with 4, 6 and 9 quenchers have lower si gnal enhancement than the MB with three quenchers. For all of the MBs with more than three quencher molecules attached, a second generation of dendrimeric linkers were required for quencher coupling. The two and three-quencher MBs, on the other hand, only required a single layer of dendrimer linker. Figure 3-17 shows the structures of a six-quencher MB and a three-quencher MB. Because the six-quencher MB uses two layers of dendrimer linkers for the coupling of quencher molecules, the quencher molecu les are about 10 carbon-carbon bonds further away from the fluorophore molecule in the cl osed-stem conformation. Due to the strong distance dependence of FRET, the increased separation of the quenchers from the fluorophore significantly decreases their FRET ef ficiency. In addition, such a separation might exclude the presence of static que nching, another avenue for quenching in molecular beacons.12 Although the six-quencher complex has a higher overall extinction coefficient, the quenching efficiency of the six-quencher MB is lower than the threequencher MB. The linker length between dC and FAM at 3 end may be further optimized to improve the SBR of these superquencher labeled MBs.

PAGE 84

67 250300350400450500550600650700 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 Absorbance (A.U.)Wavelength (nm) MB3F59D MB3F56D MB3F54D MB3F53D MB3F52D MB3F51D Figure 3-14. UV spectra of molecular beacons with different quencher molecules. The third digit in each legend designates the number of quencher molecules used. For example, MB3F 59D D20 stands for the molecular beacon with 3 FAM label while the 5 labeled with 9 DABCYL molecules. 0246810 0.0 0.1 0.2 0.3 0.4 0.5 0.6 AbsorbanceQuencher Number Figure 3-15. A460nm of same concentration of molecular beacons with different quencher molecules.

PAGE 85

68 MB3F51DMB3F32DMB3F53DMB3F54DMB3F56DMB3F59D0 50 100 150 200 250 300 350 16 109 71 326 82 14Signal Enhancement Figure 3-16. Signal enhancements of MB s with different number of quenchers 5'C G T C A T A A T C A C T A T G G T C G C C G A T G C T A O O P O O-CO O H OH O OO NH 3'O P O-O O O O O OGO N N N CH3C H3O NH O P O O-P O O-O O O O N N N CH3C H3O NH O P O O-O N N N CH3C H3O NH O P O O-P O O-O O O O N N N CH3C H3O NH O P O O-O N N N CH3C H3O NH O P O O-P O O-O O O O N N N CH3C H3O NH O P O O5'C G T C A T A A T C A C T A T G G T C G C C G A T G C T A O N N N CH3C H3O NH O P O O-P O O-O O O O O N N N CH3C H3O NH O P O O-O N N N CH3C H3O NH O P O O-C O O P O O-GO O H OH O OO NH 3' CG Figure 3-17. Structures of a six-quenche r MB(left) and a three-quencher MB(right). Because the six-quencher MB uses tw o dendrimer phosphoramidites to couple quencher molecules, the quencher molecules are about 10 more C-C bond far way from FAM molecule. Not only can different numbers of quencher molecules be assembled to make superquenchers with different quenching effi ciencies, the type of quencher molecules can also be varied. This is demonstrated by the performance of a superquencher with three

PAGE 86

69 ECLIPSE quencher molecules. Labeled with such a superquencher and TMR fluorophore, a MB probe has a signal enhancem ent as high as 250-fold (Figure 3-18). (a) (b) Figure 3-18: TMR labeled superquencher MB. (a ) Structure of a molecular beacon with a Superquencher consisting of three Eclip se quenchers and (b ) hybridization of this molecular beacon with target DNA. The freedom in assembling different numbers and types of quenchers has important implications in fluorescent probe design. Fo r example, superquenchers with different maximum absorption wavelengths and extinction coefficients can be generated to quench different fluorophores with excellent quenchi ng efficiency. Furthermore, by assembling different types of quencher molecules, a superquencher with broad absorption range could be synthesized and used as a universal quencher moiety. We prepared SQ MBs with fluorophores such as TMR and Cy3. Ex cellent SBRs were observed for both of these dyes. For instance, the SQ MB with C y3 showed a signal increase of 260 fold upon target hybridization (Figure 3-19).

PAGE 87

70 Figure 3-19. Response of 65nM of Cy3 labele d Triple-Quencher MB to 325nM of target DNA (a) and comparison of S/B of Tri-Q -Cy3 MB to that of single-Q-cy3 MB (b). Both MBs had the same sequence except different quenchers were used (Quencher-CC TAG CTC TAA ATC ACT ATG GTC GCG CTA GGCy3). All hybridization experiments were carried out in 20mM Tris-HCl buffer (pH7.5, 50mM NaCl and 5mM MgCl2) Superquencher Outperforms Gold Nanoparticle The excellent performance of the SQs was further evidenced in MBs with different sequences. Several reported MB82;105;106 sequences were synthesized (Table 3-2). Up to 300 fold enhancement of SBR was observed for the MBs synthesized with SQs (Figure320). This was about a 20 time improvement comp ared to the reported value with regular MBs. Table 3-2. Molecular beacon sequences Name Source Sequence MBS1 Methods Mol Biol 212, 111 FAMCGCACCTCTGGTCTGAAGGTTTATTGGTGCGDABCYL MBS2 Antisense Nucleic Acid Drug Dev 12, 225 FAMCGCCATGACACTAGCAT CGTATCAGCATGGCGDABCYL MBS3 Nat Biotechnol 19, 3 65 FAM-GCGAGTTTTTTTTTTTTTTTCTCGC-Gold ( a ) 0400800120016002000 0 5 10 15 20 25 Fluorescence Intensity (X10000)Time (seconds) Tri-Q--cy3 MBSIngle-Q-cy3 MB0 30 60 90 120 150 180 210 240 270 10.8 265Signal-to-Background Ratio ( b )

PAGE 88

71 MBS1 0 20 40 60 80 100 120 140 160 180 200 220 240 Signal-to-Background Ratio MBS2 0 20 40 60 80 100 120 140 160 180 200 220 Signal-to-Background Ratio MBS3 0 20 40 60 80 100 120 140 160 180 Sigal-to-Background Ratio Figure 3-20. Camparison of SBRs of mol ecular beacons labeled with Superquencher (Green) to those (Red) of MB labele d with normal quenchers (MBS1, MBS2) or gold nanoparticle (MBS3). It should be noted that MBS3 was origin ally labeled with a gold nanoparticle.82 With their exceptional quenching capability gold nanoparticles have been successfully used to construct FRET based probes82;83. When used as a quencher in an MB, the average quenching efficiency of the gold na noparticle to fluorescein has been shown to be as high as 98.68%82, which is equivalent to about 76-fold of SBR(Figure3-19). A dendrimeric quencher, with three DABCYLs, surprisingly, shows a better quenching efficiency than the gold particle. Furthermor e, compared to the gold nanoparticle, the superquencher is much easier to synthesize and manipulate. The superquencher can be separated with high purity and used over larger range temperatures. In contrast, the gold nanoparticle is unstable, which prevents gol d-quenched MBs from being separated from the dye-oligonucleotides, and from being us ed in any temperatures higher than 50oC.82 Use of Superquencher for Molecular Probe Labeling To further demonstrate the universal applicability of superquenchers for FRET based probes, we used SQ consisting of th ree DABCYLs to label one end of a synthetic

PAGE 89

72 DNA aptamer for the B-chain of platel et derived growth factor (PDGF) 21;107. Figure 3-21 shows the response of the dual labeled aptamer, where 5 labeled with three DABCYLs and 3 with fluorescein, to the addition of PDGF-BB. Contrary to MBs, this aptamer changes its conformation from an open-stem to close-stem conformation upon binding to PDGF protein, which brings the quencher moie ty close to the fluorophore. As a result of the conformational change, the fluorescence intensity from the fluorophore decreases. Upon binding to PDGF, the SQ labeled aptamer underwent a change of fluorescent intensity from 294770 to the level of th e buffer background (Figure 3-21). The fluorescent intensity changed by a factor of more than 49,000. This indicated that the quenching efficiency of the SQ to fluoresein is greater than 99.99%. This is a dramatic improvement considering that binding of th e same aptamer with a single DABCYL label to PDGF only produces about a 95% quenching efficiency. 050100150200250 0 5 10 15 20 25 30 Buffer FL=1284 PDGF:MB=150nM:75nM FL=1290 MB 75 nM FL=294770Fluorescence Intensity(x10000)Time(second) Figure 3-21. Response of a Superquencher labeled Aptamer Beacon to the addition of target protein PDGF-BB

PAGE 90

73 Conclusions This chapter has shown that the multiple-quencher labeling approach can effectively improve the quenching of fluorophor es in molecular probe designs. Two ways of labeling quencher molecules to a mol ecular beacon sequence were developed and compared. Both approaches proved that increasing the number of quenchers from 1 to 3 in MBs significantly increases the SBR of the probe. Integrating multiple quenchers in an MB sequence has two important effects. First, increasing the number of quencher molecules to an adjacent fluorophore greatly increases the overall quenching ability of MB in the close state. Second, the multi-quencher in a molecular beacon sequence helps improve th e purity of the probe. The hydrophobicity of the quencher molecules greatly increases the retention time of the probe in the reverse phase HPLC, which significantly improves the separation efficiency. Overall, the introduction of multiple quenchers in a molecular beacon effectively reduces background fluorescence by both significantly increasing quenching efficiency of MB and improving the purity of MB. Compared to the internal labeling approach, the end labeling of multiple quenchers through dendrimeric linker exhibited the fo llowing advantages: easy synthesis, high coupling yields, no observable adverse effect on the stem stability, greater flexibility for stem design, and wider selection of fluor ophore and quenchers combinations. The second approach has three distinguished features First, the SQ assembly shows unique properties for engineering mo lecular probes. Compared with a regular MB, a SQ constructed MB has better sensitivity, hi gher purity, and stronger thermal stability. Second, the assembly scheme can be widely useful for different types of quencher molecules. Third, the SQ can be used for diffe rent fluorophores and in different types of

PAGE 91

74 probes. The SQs used for signaling aptamer-protein interactions generated more than 49,000 fold signal changes when PDGF aptamer bound to PDGF. No detrimental effects of these SQs on the performance of these probes were observed. The approach of assembling SQs can effectively improve the sensitivity of a variety of fluorescence assays and may be very useful for molecular interaction studies.92;108

PAGE 92

75 CHAPTER 4 LIGHT SWITCHING EXCIMER PROBES FOR RAPID PROTEIN MONITORING IN COMPLEX BIOLOGICAL FLUIDS Introduction Proteins are ubiquitous and essential for lif e. Detection of proteins in their native environments has always been a critical and challenging task. In the proteomics era, numerous disease marker proteins are exp ected to be discovered from a variety of complex biological systems109-111. Methods for the analysis of proteins have become indispensable tools in new disease marker discovery and protein function studies. Ultimately, assays that allow rapid, simp le, sensitive, selective and cost-effective detection of the proteins discovered are of significant importance for the understanding, diagnosis, treatment, and prevention of many diseases. Key factors including a highly selective molecular recognition element and a novel signal transduction mechanism have to be engineered together for successful assay development. Among many molecular recognition elements, synthetic nuc leic acid ligands (aptamers)4-6 have gained increasing attention in this area. Aptamers are single-s tranded oligonucleotides selected to bind to essentially any molecular targ et with high selectivity and affinity through an in vitro selection process called SELEX (Systematic Evolution of Ligands by EXponential enrichment)4-6. Aside from their excellent binding affinity and selectivity, other characteristics endow aptamers with great potential for use in protein analysis.19;112 For instance, aptamers can be routinely prepared by chemical synthesis, allowing for rapid preparation in large quantities with excelle nt reproducibility. Nucleic acid synthetic

PAGE 93

76 chemistry also facilitates conjugation of these aptamer sequences to fluorescent dyes, radiolabels, or other biomolecules. Furthermo re, aptamer sequences are more stable than proteins under a wide range of conditions and can be repeatedly used without losing their binding capabilities. In order to report the binding of an aptamer to its target, a signal transduction mechanism has to be built into the aptamer sequence. Fluorescent techniques offer excellent choices for signal transduction be cause of their non-destructive and highly sensitive nature. Several fluorescence tec hniques such as fluorescence anisotropy19;112, fluorescence resonance energy transfer (FRET)113, as well as fluorescence quenching20;37;113 have been used in aptamer assay development. All these signal transduction techniques have th eir individual strengt hs. Nonetheless, they suffer from several limitations that could hamper their e ffectiveness in complex biological samples. For instance, although fluores cence anisotropy only requ ires labeling of one dye molecule on each aptamer sequence, it entails complicated instrumentation and data interpretation. FRET or fluorescence quenching based probes quantify target concentrations with changes in fluorescence intensity, but these two methods are also sensitive to the solution environment. More im portantly, they are difficult to be directly applied to analyzing proteins in their native environments because of interference by intense background signal. When monitoring a protein in its native environment, there are usually two significant background signal sources. The firs t one is the probe itself. For example, when a quenching-based FRET molecular probe is used for protein studies, the probe always has some incomplete quenching, re sulting in a significant probe background.

PAGE 94

77 Moreover, in a native biological environment, there are many potential sources for false positive signals of the molecular probe for protein analysis. The second source of background signal comes from the native fluo rescence of the biol ogical environment where the target protein resides. There are many molecular species in a biological environment, some of which will gi ve a strong fluorescence background signal upon excitation. These problems adversely affect assay sensitivity, compromise probe selectivity and thus hinder th e analysis of proteins. Although there have been great efforts in solving these problems in bioanalysis114, effective solutions to both problems are limited. To address these problems, we have e ngineered a novel light switching excimer aptamer probe for protein monitoring in biol ogical fluids by usi ng both steady-state and time-resolved fluorescence measurements.7 This strategy is a combined approach of wavelength switching and time-resolved measur ement to solve the significant problems of monitoring proteins in thei r native environment. Our approach is to label a molecular aptamer with pyrene, similar to what has been reported in using pyrene for molecular beacons16. The aptamer sequence that binds with hi gh affinity to the target protein PDGFBB is labeled with pyrene molecules at both ends. The specific binding of aptamer to its target protein changes the aptamer probe conformation, bringing the two pyrene molecules into close proximity to form an ex cimer (excited state dimer), which results in a change of fluorescence wavelength from a bout 400 nm for the pyrene monomer to 485 nm for the pyrene excimer. This emissi on wavelength switching solves the probe background signal problem that occurs with FR ET molecular probes. However, this alone can not solve the problem of strong backgr ound signal from the multiple species in the

PAGE 95

78 biological environment. One special feature of the pyrene excimer is that it has a very long fluorescence lifetime14 compared with other potential fluorescent species. The lifetime of the pyrene excimer can be 100 ns or longer, while that for most of the biological background species is shorter than 5 ns. With time-resolved fluorescence measurements, target binding induced exci mer signal can be separated from biological background interference. Combining light swit ching and time-resolve measurements, we are able to detect picomolar PDGF-BB in a few seconds. Therefore, direct detection and quantification of target molecules in comp lex biological samples can be carried out without any need of sample clean-up. Experimental Section Chemicals and Reagents. The sequences of oligonucleotides and apta mer probes prepared are listed in Table 1. DNA synthesis reagents were purchased from Glen Research (Sterling,VA). Four aptamer sequences with different lengths show n in Table 1 were synthesized: ES3, ES4, ES5, and ES6 (excimer probes with 3, 4, 5, and 6 bp in the stem, respectively). All the aptamer sequences were labeled with pyrene at both ends. PS3 was an aptamer sequence, but only singly labeled with pyrene at the 5' terminus. ESCRBL was a 39mer scramble oligonucleotide sequence with pyr ene labeled at both ends. Table 41. Probes and oligonucleot ides used in PDGF binding study Name Sequence ES3 Pyr-AGGCTACGGCACGTAGAGCATCACCATGATCCT-Pyr ES4 Pyr-CAGGCTACGGCACGTAGAGCATCACCATGATCCTG-Pyr ES5 Pyr-ACAGGCTACGGCACGTAGAGCATCACCATGATCCTGT-Pyr ES6 Pyr-CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG-Pyr PS3 Pyr-AGGCTACGGCACGTAGAGCATCACCATGATCCT ESCRBL Pyr-GGAACGTAATCAACTGGGAGAATGTAACTGACTGC-Pyr

PAGE 96

79 Recombinant human PDGF-BB, PDGF-AB, and PDGF-AA were purchased from R&D Systems (Minneapolis, MN) and dissolved in 4 mM HCl with 0.1% BSA and then diluted in a Tris buffer (pH 7.5) before use. Other recombinant human growth factors, including recombinant human epidermal growth factor (EGF) and insulin-like growth factor 1 (IGF-1), were from Roche (Indian apolis, IN). Human bovine serum albumin (BSA), human hemoglobin (HEM), horse myoglobin (MYO), chicken lysozyme (LYS), human -thrombin (THR) and other chemicals were from Sigma (St. Louis, MO). A solution of 0.1 M triethylamine acetate (pH 6.5) was used as HPLC buffer A and HPLC grade acetonitrile (Fisher) was used as HPLC buffer B. Tris-HCl buffer (20mM Tris-HCl, 20 mM NaCl, pH 7.5) was used for all buffer solution based aptamer binding experiments. Except for the cell media, ultra pure water was used to prepare all the solutions. The cell media, Dulbeccos Mo fication of Eagles Medium (DMEM) (Mediatech, Inc, Herndon, VA) supplemented with 10% Fetal Bovine Serum (Invitrogen, Carlsbad, CA), was used for the detection of PDGF using time-resolved measurements. Instruments. An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was used for DNA synthesis. Probe purification wa s performed with a ProStar HPLC (Varian, Walnut Creek, CA) where a C18 column (Econosil, 5U, 250.6 mm) from Alltech (Deerfield, IL) was used. UV-Vis measuremen ts were performed with a Cary Bio-300 UV spectrophotometer (Varian, Walnut Creek CA) for probe quantitation. Steady-state fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). For emission spectra, 349 nm was used for excitation. Time-resolved measurements were made with a single photon counting instrument

PAGE 97

80 (OB900, Edinburgh Analytical Instrument), wh ere a nitrogen flash lamp was used as the excitation source ( =337 nm). Synthesis and Purification A solid-phase synthesis method was used to couple pyrene to aptamer sequences at both 3' and 5' ends. The synthesis started with a 3'-amino-modifier C7 controlled pore glass (CPG) column at 1 mol scale. Followi ng the synthesis of the aptamer sequence, a 5 -amine was added to the sequence using 5 -amino-modifier-C6 linker phosphoramidite. The column was then flushed slowly with 15 ml of DMF, 15 ml of 20% piperidine in DMF, 15 ml of 3% trichloroacetic acid in dichloromethane, and then another 15 ml of DMF. The CPG contained within the column was released into 1ml of DMF solution containing 57.7 mg (200 mol) of pyrene butyric acid, 41.3 mg (200 mol) dicyclocarbodiimide and 24.4 g (200 mol) of dimethylaminopyridine. After stirring for three hours, the solution was centrifuged and th e supernatant was discarded. The pellet was washed three times with DMF, methanol, and water respectively before incubated in a 50% solution of methylamine in ammonia at 65C for about 10 minutes. The resulting clear and colorless supernatant was collected Under UV radiation, an intense green fluorescence was observed. The aptamer solution was desalted with a Sephadex G-25 column (NAP-5, Pharmacia) and dried in a SpeedVac. The dried product was purified by HPLC using a C18 column with a linear el ution gradient with buffer B changing from 25% to 75% in 25 minutes at a flow rate of 1 ml/min. The second peak in chromatography that absorbed at 260 nm and 350 nm, and emitted at 400 nm with 350 nm excitation was collected as the product. Th e collected product was then vacuum dried, desalted with a G-25 column and st ored at -20C for future use.

PAGE 98

81 Results and Discussion Design Light Switching Excimer Aptamer Probe Some spatially sensitive fluorescent dyes, such as pyrene11;14-16, BODIPY Fl17;18, can form excited state dimers (excimers) upon close encounter of an excited state molecule with another ground state molecule. The excimer emits at a longer wavelength than does a monomer. The formation of exci mer between two pyrene molecules that are connected by a flexible covalent chain is us eful to probe spatial arrangement of some molecules. Similar to FRET, the stringent distance-dependent properties of excimer formation can be used as a unique signal tr ansduction in the development of molecular probes. This is especially useful for deve loping aptamer probes due to the fact that a variety of aptamers, like those for PDGF-BB19-21, cocaine22, thrombin23;24, and HIV1 Tat protein38 undergo similar conformational changes upon target binding. As a proof of principle, the excimer signaling approach was used to develop a probe for PDGF-BB. Identified by Green et al, the PDGF-BB aptamer is a DNA sequence with an open secondary structure in the absence of protein (Figure 4-1). When the aptamer binds to PDGF-BB, it changes to a closed conformation where the 3' and 5' ends hybridize and form a stem. Based on th is, an excimer switching aptamer probe has been developed by labeling both ends with dyes that can form excimers. When the dualpyrene-labeled aptamer probe is free in solu tion without the target protein, both pyrene molecules are spatially separated and only the monomer emission peaks (at 375 nm and 398 nm) are observed. The binding of the aptame r probe to the target protein brings the pyrene molecules at 3' and 5' ends together, allowing the formation of an excimer. Thus, the emission peak appears around 485 nm. The ch ange in emission color serves as a rapid

PAGE 99

82 way for qualitative analysis and the excimer fluorescence intensity can be used for highly sensitive real-time quantitation of PDGF in homogeneous solutions. Figure 4-1. Use of the pyrene excimer to probe PDGF. PDGF aptamer (red) is end labeled with pyrene molecules (blue) that are separated from each other because of the open structure of the aptamer. The pyrene molecule has monomer emission peaks at around 378 and 398 nm respectively. After binding to PDGF (purple), the aptamer adapts a closed conformation, bringing two pyrene molecules close to each ot her. Consequently, pyrene excimer (green) forms and green light (around 485 nm) is emitted after photoexcitation. Synthesis of dual Pyrene Aptamer Probe The first step to prepare an excimer apta mer probe is to label an aptamer sequence with pyrene molecules. A typical method us ed to label a DNA sequence is based on the reaction between the 3' and 5' terminal-lab eled primary amine of the aptamer with a carboxylated pyrene. Another method of coupl ing pyrene to DNA is through reacting the 5'-OH to some precursor dye molecules li ke N-(1-pyrenepropyl) iodoacetamide, while attaching 3 -terminal ribose by the carbonyldiimidazole method using pyrenebutanoic acid.115 Unfortunately, both aforementioned methods suffer low coupling yields as a result of incompatible solubility between DNA and pyrene. Pyrene is very hydrophobic and prefers nonpolar solution as opposed to oligonucleotides favoring hydrophilic conditions. In fact, we attempted to couple te rminal amine-labeled aptamers sequences to pyrenebutyric acid, but it turned out not f easible because a large volume of solvent was

PAGE 100

83 required to use in order to solve solubility problem. Fujimoto et al16 introduced a method of labeling single-stranded DNA with pyrene at both 3 and 5 end. Pre-synthesized pyrene phosphoramidite was used to au tomatically couple pyrene to the 5 end of an oligonucleotide on a DNA synthesizer while py rene succinimidyl ester was used to couple to the 3 end of the oligonucleotide using a C3 alkylamino linker. Although the efficiency of pyrene-olig onucleotide coupling can be improved by using pyrene phosphoramidite on the DNA synthesizer, the prep aration of the phospho ramidite is time consuming, labor intensive and requir es advanced synthetic expertise. The solid phase coupling method used in our work provides a simple and universal way of multi-labeling organic dyes to DNA sequ ences. An amine controlled pore glass (CPG) and 5 amino phosphoramidite were used for amine-labeling 3 and 5 ends of the aptamer, respectively. The 3 -amine was protected with a fluorenylmethoxycarbonyl (Fmoc) group and the 5 -amine with a trityl group, which were removed by piperidine and trifluoroacetic acid, re spectively. With a hydrophobic protecting group on its bases, the resulting oliogonucleotide wa s soluble in organic solven ts. In DMF, pyrenebutyric acid was easily coupled to the activated am ine groups on the aptamer termini with the mediation of dicyclocarbodiimide. This solid phase coupling method has several advantages when compared to the other met hods. First, it eliminates the use of large amounts of solvents. Second, the coupling react ion takes place in organic solvents which results in a higher coupling yield due to the absence of a hydrolysis competition reaction. Third, it is straightforward, easy, and time sa ving. Minimal organic synthesis expertise is required and the coupling reaction finishes within three hours. Finally, the large excess of un-reacted pyrene dyes can be simply removed with a centrifugation process. After the

PAGE 101

84 coupling step, the dual-pyrene-labeled oligonucle otide is still linked to the solid support, which can be easily separated from exce ss of pyrene through cen trifugation. This simplifies the post-synthesis purification step as well. The resulting HPLC separation chromatogram does not show any peak rela ted to free pyrene molecules, suggesting effective removal of un-reacted pyrene in th e centrifugation process. Coupling yields, as high as 80%, were achieved for all probes synthesized. MALDI-TOF results confirmed successful preparation of probes. Light Switching Aptamer Probe for Real-time Rapid PDGF-BB Detection A light switching aptamer probe ES3 (se quence shown in Table 1; E: excimer probe; S3: 3 base pairs in the stem) was pr epared by labeling a 33-nucleotide sequence, specifically selected due to its high affinity to PDGF-BB, with pyrene molecules at both 3 and 5 ends. This aptamer sequence was obtai ned through the SELEX process and was reported to have about 700-fold higher affi nity for PDGF when compared with other random DNA sequences. Figure 4-2 shows the fluorescence emission spectra from solutions of 100 nM ES3 with different c oncentrations of PDGF-BB protein. With no target present, monomer emission peaks we re observed and there was no observable excimer emission. Without the target prot ein, this aptamer sequence adopts an open conformation, spatially separating both pyrene molecules at the 3 and 5 ends. Upon addition of PDGF-BB into the ES3 solution, an aptamer-protein complex was formed, causing the 3 end sequence to hybridize with the 5 end sequence to form a stable stem. This stem brings both pyrene molecules together, resulting in an intense excimer emission at 485nm (Figure 4-2). With incr easing amounts of targ et protein in the solution, the excimer intensity increases proportionally.

PAGE 102

85 375400425450475500525550 0 5 10 15 20 25 30 35 40 45 [PDGF]Fluorescence IntensityWavelength(nm) Figure 4-2. Response of the excimer probe ES 3 to different concentrations of PDGF-BB (0-40nM). [ES3]= 100 nM. Two control DNA sequences, PS3 and ESCRBL (P: pyrene monomer; S3: three base pairs in the stem; ESCRBL: excimer with scrambled sequence), were prepared to confirm that the observed excimer emission was a result of the aptamer-protein binding. The first sequence PS3 was a PDGF aptamer sequence labeled with only one pyrene at the 5 end. Addition of PDGF into the PS3 solution did not change the emission spectrum of the solution (Figure 4-3), indicating that two pyrene molecules in close proximity is necessary for excimer emission and that PDGF-BB itself has no measurable effect on the optical properties of pyrene molecules. The second sequence, ESCRBL, was a random DNA sequence with its 3 and 5 ends labeled with pyrene. As this sequence has no affinity to PDGF, the addition of PDGF s hould not induce any excimer formation. This was to prove that the excimer emission resulted from aptamer-protein binding. As expected, this dual pyrene labeled scrambled sequence did not give any excimer emission

PAGE 103

86 after the addition of PDGF (Figure 4-3). Th ese two control results confirm that the excimer emission shown in Figure 4-2 was due to the aptamer conformational change upon specific binding to PDGF-BB. e255075100125150175200 0.0 0.3 0.5 0.8 1.0 1.3 1.5 1.8 2.0 2.3 2.5 Excimer/MonomerTime (second) ES3 PS3 ESCRBL Figure 4-3. Real-time response of ES3 and tw o pyrene labeled control sequences to 50 nM of PDGF-BB. PS3 is an aptamer se quence with one pyrene labeled at 5 The ESCRBLE is a random DNA sequence with pyrene labeled at both ends. [ES3]= [PS3] = [ESCRBLE] =100 nM. Data shown in Figure 4-3 reveals one im portant advantage of the light switching excimer signaling approach: detection-wit hout-separation. As only target-bound probes give excimer emission, the unbound probe does not have to be separated from the solution for target detection. This detectio n-without-separation method eliminates tedious washing and separating procedures and allows real-time detection13. Another advantage of this probe is that it allows ratiometric measurement. As shown in Figure 2a, proteinbound probe gives three emission peaks, two monomer peaks at 375 nm and 398 nm, respectively, and an excimer peak at 485 nm. By taking intensity ratio of the excimer

PAGE 104

87 peak to either one of the monomer peak s, one could effectively eliminate signal fluctuation and minimize impact of env ironmental quenching on the accuracy of the measurement. Real-time response of excimer/m onomer ratio is shown in Figure 4-3. It revealed that the binding of the aptamer to PDGF-BB took place within seconds. This suggests that the PDGF aptamer probe could be used for the rapid monitoring of PDGF in cells. 051015202530354045 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 Excimer/Monomer[PDGF] (nM) Figure 4-4.The fluorescence ratio of excime r over monomer as a function of target protein concentration. [ES3]=100 nM. The light switching signal transduction appr oach affords high sensitivity. As shown in Figure 4-4, the excimer/monomer emission ratio of the probe responded to different concentrations of PDGF-BB proportionally. A linear response was observed with PDGFBB concentrations ranging from 0 nM to 40 nM Based on 3 times standard deviation of 6 measurements of blank samples, the limit of detection for PDGF-BB was in a picomolar range. Such a high sensitivity, together with the emission wavelength switching,

PAGE 105

88 fast measurements and detection-without-separ ation properties, enab led visual detection of 4 pmoles of PDGF (Figure 4-5). A clear green color was observed when 4 pmoles of PDGF was added to a 100 nM excimer probe solution, which suggests a pico-mole range of PDGF can be viewed by the naked eye for clinical applications. Figure 4-5. Visual detection of 4 pico-m ole PDGF-BB after illumination with an UV lamp. Solution of the 100 nM excimer pr obe without (left) and with 40 nM of PDGF-BB (right). The total volume of the solution was 100 l. Optimization of Aptamer Length The original sequence of the PDGF-BB aptamer reported by Green et al was a 39 mer sequence.21 When it binds to PDGF-BB, this aptamer forms a three-way helix junction with a three-nucleotide loop at the branch point, where the 3 and 5 ends of the aptamer form a 6mer stem. Theoretical calculations116 indicated that a significant fraction of the 39mer aptamer sequence was in a clos ed conformation even without the presence of the target protein (Figure 4-6). An exci mer probe with this sequence would generate excimer emission in the absence of target from this fraction of the aptamer. Because the stem sequence is not important for the high affinity binding to PDGF-BB21, in order to reduce the background emission, the stem was gr adually shortened to identify an aptamer sequence that was in fully opened conformation in the absence of target while reserving a good binding affinity. Four aptamer sequences, ES6, ES5, ES4 and ES3, were prepared, all of which were dually labeled with pyrene at both ends of each sequence. ES6 had the

PAGE 106

89 full length of the reported sequence, while in ES5, ES4 and ES3 1, 2, and 3 bases from both ends of the reported 39mer seque nce were removed, respectively. Figure 4-6. Secondary structures of PDGF aptamer probe ES6 and ES3. Such a stem modification did not affect the binding of the aptamer to protein. Comparable binding constants were observed from binding affinity measurements. For all four probes, comparable excimer emission intensity was recorded for each probe at the same concentration of PDGF-BB. Shorte ning the stem, however, greatly improved signal-to-noise ratio of th e aptamer probe by substantia lly reducing background signal from free probe (Figure 4-7). For the ES6 pr obe without target, a significant excimer emission was observed. This indicates that a la rge fraction of this sequence was in closed conformation, as indicated from the secondary structure prediction.78 Addition of PDGFBB resulted in a further increase of the excime r emission that was due to the closing of the other fraction of the open-structure aptame r because of protein binding. However, the maximum signal change was less than 3-fold for this probe due to the high excimer emission intensity from the probe itself. By removing one base from both ends of ES6, the excimer emission intensity from probe ES5 was significantly reduced. Negligible excimer emissions were observed for ES4 and ES3. As a result, the aptamer probes with

PAGE 107

90 3mer stem (ES3) and 4mer stem (ES4) were found to have the highest signal enhancement (~ 40-fold) upon addition of the target protein. 375400425450475500525550575600 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 ES3 ES4 ES5 ES6F485nm/F378nmWavelength(nm) Figure 4-7. Fluorescence emission spectra of PDGF excimer probes with different stem length in the absence of PDGF-BB. Bu ffer: 20 mM Tris-HCl, pH 7.5, 20mM NaCl. [probe]=100 nM. Selectivity of the Probe To detect PDGF in test samples, the probe has to selectively respond only to PDGF, free from interference from other biological components. To test the probes selectivity in a simulated cell enviorment, PDGF aptamer was challenged by the addition of cellular proteins such as albumin, lysozyme, hemoglobin, myoglobin, and thrombin. Even at 10 times PDGF concentration, these proteins did not caus e significant signal change (Figure 4-8). Further, we tested the selectivity of the excimer probe for proteins and peptides potentially coexisting with PDGF. The results clearly showed that this probe was highly selective for PDGF-BB. It did not respond to the Epidermal Growth Factor

PAGE 108

91 (EGF), Vascular Endothelial Growth Factor (VEGF), or Insulin-Like Growth Factor 1 (IGF-1). PDGF-AA and PDGF-AB, both of which have shown low binding affinity to the aptamer sequence21, induced minimal signal response. Such an enhanced selectivity comes from both the intrinsic high selectivit y of the aptamer sequence and the stringent spatial requirement for the emission from the excimer formation. Partial binding or weak binding by other species for FRET based probes will result in substantial signal change, while the light switching probe will have li ttle response for those binding events as the two pyrene molecules have to be in very close proximity to each other. This feature is an additional advantage for the light switching aptamer excimer probe. Figure 4-8. Responses of the excimer probe (50nM) to BSA, LYS, HEM, MYO and THR (all 500nM) and different growth f actors (EGF, IGF, VEGF, PDGF-AA, PDGF-AB and PDGF-BB, all 50nM). Direct Quantitative Detection of PDGF in Cell Media Results from studies in relatively simple buffer systems demonstrate that the excimer aptamer probe has excellent selectivity and high sensitivity. To be more useful in

PAGE 109

92 bioassays, this probe should be able to tolera te any interference from biological samples. A dyed cell medium mixed with fetal bovine seru m was used to investigate the feasibility of using this probe in biological samples. 350400450500550600650 0 1 2 3 4 5 6 7 8 9 Fluorescence Intensity (x105)Wavelength (nm) 200nM ES3 in Buffer 200nM ES3 in Buffer+ 50nM PDGF Cell Media +200nM ES3 Cell Media Cell Media+200nM ES3+50nM PDGF Figure 4-9. Monitoring PDGF in dyed cell me dia. (a) Steady-state fluorescence spectra of cell media, 200 nM ES3 in cell media, 200 nM PAES3 and 50 nM PDGF-BB in cell media, 200 nM ES3 in Tris-HCl buffer, and 200 nM ES3 with 50 nM PDGF-BB in Tris-HCl buffer. Figure 4-9 shows the spectra of the probe in a Tris-HCl buffer solution and in cell media. In the buffer, the probe functioned well and an intense excimer emission was observed when the target protein was added. Unfortunately, intense background fluorescence, contributing from some indige nous species in the cell media such as proteins, riboflavin, nicotinamide, pyridoxine, tryptophan, tyrosine as well as phenol red, was also observed. This intense background fluorescence buried the signal response from the probe and made the probe signal indisti nguishable from the indigenous background fluorescence. This result indicates steady-stat e fluorescence measurement is implausible

PAGE 110

93 for direct detection of PDGF in such a co mplex biological sample. It was also unclear whether this synthetic aptamer sequence retained its binding affinity and selectivity for PDGF-BB in the cell media. Most of the background fluorescence has a li fetime of < 5 ns. By contrast, the monomer and excimer emission of pyrene ha ve much longer lifetimes (up to 100 ns). Such a big difference allows one to tempor ally separate the probe fluorescence signal from the intense background signal using timeresolved fluorescence spectroscopy. With a short excitation pulse of ~1 ns, all chrom ophores in the solution that absorb at this excitation wavelength, including pyrene and the fluorogenic molecules of the cell media are excited. By employing a time-resolved detection technique, the decay of the fluorescence signal at different wavelengths can be recorded within a relevant time window (e.g. in the window from 40-60 ns). The background signal is expected to have decayed within the first few ns after the pulsed excitation, thus the remaining fluorescence after 20 ns should correspond to the long-lived pyrene fluorescence. As a time-resolved detection technique, time co rrelated single photon counting (TCSPC) was employed, because it is one of the most sensitive methods.11 TCSPC measurement of pure probe and probe with protein solutions suggested that lifetimes of both pyrene monomer and excimer in the cell media were around 40 ns. This is one magnitude longer than the lifetimes of most organic fluorophores and fluorescent components in cell media and cells, which furth er confirmed the possibility of temporal resolution of the excimer signal from in tense background fluorescence. Time-resolved emission spectra of 200 nM ES3 in cell media with 50 nM PDGF-BB (Figure 4-10) revealed the change of the emission spect ra on a nanosecond scale and demonstrated a

PAGE 111

94 clear temporal separation of the signal fr om background noise. Taken over the first 20 ns decay, the emission spectrum resembled the st eady state emission spec trum of the same sample, where excimer peak was masked by severe background fluorescence from endogenous fluorescence species and scattered light. Due to their short fluorescence lifetimes, the fluorescence and scattered light from the cell media decayed rapidly to 0.1 % of its original signal 40 ns after the ex citation pulse (Figure 411). By contrast, the excimer emission decayed slowly, retaining in reasonably high emission intensity even after 40 ns of decay, which allows the probe signal to be well separated from the background signal. As a result, the fluorescen ce emission spectrum taken at 40 ns after excitation looked similar to the emission sp ectrum of protein bound probe in buffer. The temporal separation of intense background from probe signal is evident by comparing the time-resolved fluorescence emission spectrum (40-60 ns) in Figure 4-10 with the steadystate fluorescence emission spectrum of the same sample in Figure 4-9. For steady-state measurement, no resolved peak around 485 nm could be seen when PDGF was added to ES3 solution in cell media due to the signifi cant amount of background signal. However, in the time-resolved emission spectrum whic h was recorded 40 ns after excitation, the long lifetime emission peak at 480 nm was well resolved. This 480 nm peak corresponded to excimer emission from protein-bound probe, which was supported by two observations: 1) its intensity varied with changes of protein concentrations; 2) no such a peak was observed in the time-resolved spectra of either cell media or a cell media solution containing PDGF and a single-pyren e-labeled aptamer sequence PS3. Thus, this characteristic emission peak could be immediately used to examine the presence of PDGF in biological samples.

PAGE 112

95 360400440480520560600 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 Normalized CountsWavelength (nm) 0-20ns 40-60ns Figure 4-10. Time-resolved fluorescence spectra of 200 nM ES3 and 50 nM PDGF-BB in cell media at different time windows after the excitation pulse, 0-20 ns (blue) and 40-60 (red). 0255075100125150175200 1 10 100 1000 10000 100000 Fluorescence IntensityTime (ns) Media @ 398nm Media-Probe@ 398nm Media-Probe-Protein @ 398nm 0255075100125150175200 1 10 100 1000 10000 Fluorescence IntensityTime (ns) Media @ 480nm Media-Probe @ 480nm Media-Probe-Protein @ 480nm Figure 4-11. Fluorescence decays of cell medi a, 200 nM ES3 in cell media, and 200 nM ES3 with 50 nM PDGF-BB in cell media. Excitation= 337 nm. With time-resolved measurement, not only can this probe qualitatively detect target protein in cell media, but it also allows quantitative analysis in situ. When the concentration of PDGF-BB increased, the fluorescence intensity of the excimer peak in time-resolved emission spectrum increased accordingly. Figure 4-12 shows the decays of aptamer probe ES3 in the cell media with vari ous concentrations of protein PDGF-BB at 480 nm emission. Fluorescence intensity from the response of each solution could be

PAGE 113

96 calculated by integrating photons emitted over an optimized time window, where the background signal decays to a minimum while th e excimer signal is still high, to obtain an optimal signal-to-noise ratio for accurate analysis. The highest signal-to-noise ratio at 480 nm was observed from 40 ns to about 100 ns after the exc itation. Thus, photons emitted between 40 ns and 100 ns were counted and integrated for each concentration to construct a calibration curve. The resulting fl uorescence intensities were proportional to the PDGF-BB concentrations (Figure 4-12). This linear response of fluorescence intensity to PDGF in the cell samples demonstra ted the feasibility of direct quantification of target proteins in cell media w ithout any separation or purification. 020406080100120140160180200 1 10 100 1000 10000 CountsTime (ns) 100nM 75nM 50nM 25nM 0nM Medium020406080100 0 2 4 6 8 10 12 14 16 18 20 22 Counts[PDGF-BB](nM) Figure 4-12. Fluorescence decays of 200 nM ES3 in cell media with various concentrations of PDGF-BB(Left) and the response of fluorescence intensity to the change of protein concentration (Right). Conclusions With their unique properties, aptamers are finding increasing applications in therapeutic practices, disease diagnosis a nd protein functional studies. These binding elements, once integrated with a novel signal transduction mechanism, can be used as sensitive and selective probes fo r protein detection. We have demonstrated that the light switching excimer approach is an excellent si gnal transduction system for aptamer probe

PAGE 114

97 development. The generation of excimer emi ssion requires on conformational change of the aptamer brought about by complexation with a target to bring two pyrene molecules together. This signaling approach has wide app licability for several reasons. First, there are many aptamers besides PDGF aptamer that undergo conformation changes with target binding event, for example, human -thrombin aptamer23;24, cocaine aptamer22, and HIV1 TAT protein aptamer38. These conformational changes can be immediately exploited for the excimer light switching probe design. For instance, we demonstrated the same properties with an -thrombin aptamer labeled with two pyrene molecules. The probe gave excimer emission that was proportional to different concentrations of thrombin (Figure 4-13). A pyrene excimer probe fo r potassium ion has also been recently reported117, which further proves the wide applic ability the excimer signaling approach. Such an inorganic ion probe, with time-resolved fluorescence measurement methods described here, should find useful applicati ons for monitoring potassium ion in complex biological environments. Second, even for an aptamer that does not have an obvious target-induced structure change, it can be de signed to change its secondary structure as desired upon target binding with rational structure engineering.36-39 This strategy has been well demonstrated by Bayer et al who used an aptamer/target binding event to switch the aptamer structure, converting it to a gene expression regulator.39 A simple yet general approach of engineering any aptamer into structure switching ap tamer for real-time signaling applications has also been reported36;37. And finally, with a combination of the fast turnaround of automatic SELEX techniques40 and novel selection approaches41;42, for virtually any target at least one conforma tion-changing aptamer sequence can be found.

PAGE 115

98 Thus, numerous excimer signaling probes may be created quickly for proteomics with a similar approach reported here. 325350375400425450475500525550575600625-1 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Fluorescence Intensity (x1E5)Wavelength (nm) 1uM Aptamer 1uM Aptamer+ 0.63 uM Thrombin 1uM Aptamer+ 1.26 uM Thrombin 1uM Aptamer+ 1.9 uM Thrombin 020406080100120 0.10 0.15 0.20 0.25 0.30 0.35 0.40 Thrombin Added Excimer/MonomerTime (second) Figure 4-13. Fluorescence emission spectra of human -Thrombin aptamer excimer probe with different concentration of human -Thrombin (Left) and Real-time response of human -Thrombin aptamer excimer to the addition of target protein(1.3uM)(Right). Human -Thrombin aptamer excimer probe: PyreneGG TTG GTG TGG TTG G Pyrene. Buffer: 20 mM Tris-HCl, pH 7.5, 20mM NaCl. The addition of thrombin enhance of pyrene monomer fluorescence. Such nonspecific signal change can be eliminated by taking the ratio of excimer over monomer during the analysis as shown in the left figure. Besides its universal applicability, the excimer light switching approach offers higher selectivity and excellent sensitivity. A bis-pyrene probe has been recently used for signaling ATP based on ratio changes of the monomer/excimer fluorescence, which is sensitive to its environment118. However, this probe shows lower sensitivity (less than 3.5 fold of signal change at 3 mM target con centration), a narrow dynamic range (0.5-3 mM ATP), and a lack of selectivity (nonspecifi c binding will cause false positive/negative signal). By contrast, the signal approach re ported here requires ta rget-induced structure switching in order to form excimer, pr eventing false signals caused by nucleases degradation or nonspecific binding. Another ad vantage of using our approach is that it allows ratiometric measurement, which can minimize the environmental effects to afford

PAGE 116

99 more precise detection. More importantly, the excimer light switching approach solves the background problem from both probe itself and the biological environment. Using time-resolved single photon counting technique, this probe is able to detect PDGF-BB in a cell media qualitatively and quantitatively w ithout any need of sample pretreatment. This excimer signaling approach has the poten tial for development of highly sensitive aptamer probes for clinical, forensic, and environmental applications. The detectionwithout-separation, high sensit ivity, and excellent selectiv ity characteristics of this approach will enable useful applications to construct aptamer probes for protein function studies in either an intracellular or an intercellular environment. Traditionally, steady-state measurement has been the dominant tool in fluorescence spectroscopy for biological studies. Results in this chapter demonstrate that time-resolved measurement is a more powerful tool to interrogate biological interactions in complex biological systems.

PAGE 117

100 CHAPTER 5 MOLECULAR ASSEMBLY OF LONG-LIFE TIME FLUOROPHORES FOR BIOANALYSIS Introduction Progress in fluorescence microscopy has enabled scientists to examine dynamic cellular events in single living cells in real time instead of looking at the static world of molecules in fixed cells1;2;119. For instance, time-resolved and two-photon microcopy techniques have shown their potential to overcome auto-fluorescence problems in cellular imaging applications.This advance has begun to yield a better unders tanding of cellular processes. However, novel fluorophores have yet to be developed for these imaging approaches. Ideally, a fluorophore should ha ve the following properties for these imaging uses: 1) a large Stokes shift to minimize scattering light; 2) high fluorescence intensity; 3) high stab ility; 4) a long fluorescence lifetim e that supports time resolved measurement; 5) suitable excitation sp ectrum for two-photon excitation (around 300400nm) with femto-second Ti:Sapphire lasers. In Chapter 4, we have shown that ligh t-switching signaling coupled with timeresolved detection helped reduce molecu lar probe background signal, allowing the detection of trace amount of prot eins in complex biological fluids.7 By introducing a long lifetime emission fluorophore into DNA probes such as MBs, we hope to exploit timeresolve measurement or two-photon excitati on techniques to further reduce background signal for nucleic acid analysis in complex samples such as cell media and eventually inside living cells. In the present chapter, multiple-pyrene complexes are assembled to

PAGE 118

101 generate excimer fluorophores and labeled in molecular beacons. Dendrimeric linkers used in Chapter 3 are exploited to connect the pyrene monomers within close proximity, allowing high probability for excimer forma tion. These labels make use of the long fluorescence lifetime and large Stokes shift of the pyrene excimer for improved biomolecular signaling in both steady-s tate and time-resolved assays. Experimental Section Materials. All DNA synthesis reagents, including dendrimer linkers, 5 amino-modifiers, and 3 DABCYL-CPGs were purchased from Glen Res earch (Sterling, Va). Four molecular beacons were synthesized with the following 32-mer sequence: 5 -CCT AGC TCT AAA TCA CTA TGG TCG CGC TAG G -3 (underline indicates stem region). Each was labeled with a single DABCYL molecule at the 3 terminal and between one and four pyrene molecules at the 5' terminal (MB1P1D, MB2P1D, MB3P1D, and MB4P1D). The target cDNA was synthesized with the seque nce complimentary to the loop sequence of the molecular beacon (non-bold region). Py rene acetic acid was supplied by SigmaAldrich (St. Louis, MO). Dimethylformamide, dicyclocarbodiimide, and dimethylaminopyridine were purchased from Fisher. A solution of 0.1 M triethylamine acetate (TEAA, pH7.0) was used as HPLC bu ffer A and HPLC-grade acetonitrile (Fisher) was used as buffer B. Purified oligonucle otides were dissolved in DNase-free water (Fisher). Buffer-based detection assays were conducted at room temperature in a TrisHCl buffer (20mM Tris-HCl, 25mM NaCl, 5mM MgCl2, pH: 7.5). DMEM (Mediatech, Herndon, VA) was used as cell media for time-resolved DNA detection assays. A solution of 9,10-diphenylanthra cene (Fisher) in cyclohexane ( R = 0.95, = 1.423) was

PAGE 119

102 used as a reference standard in quantum yield calculations for pyrene labeled molecular beacons. Instruments An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was used for DNA synthesis. Probe purification wa s performed with a ProStar HPLC (Varian, Walnut Creek, CA) where a C18 column (Econosil, 5U, 250.6 mm) from Alltech (Deerfield, IL) was used. UV-Vis measuremen ts were performed with a Cary Bio-300 UV spectrometer (Varian, Walnut Creek, CA) for probe quantitation. Steady-state fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). For the emission spectra, 350 nm was used for excitation wavelength. Time-resolved measurements were made with a single photon counting instrument (OB900, Edinburgh Analytical Ins trument), where a nitrogen flash lamp was used as the excitation source ( =337 nm). Synthesis of Excimer MBs. Oligonucleotides were synthesized using solid-state phosphoramidite chemistry on a 1 mol scale. Each molecular beacon sequence began on column with a 3 DABCYL molecule covalently attached to a CPG subs trate. After synthesizing each sequence, the 5 nucleotides of MB2P1D, MB3P1D, and MB4P 1D were coupled to dendrimeric linker phosphoramidites bearing DMT protected hydroxyl groups. Doubler and trebler phosphoramidites were used for the MB2P1D and MB3P1D beacons, respectively. For MB4P1D, the oligonucleotide was coupled to one doubler linker to generate two branches, to each of which another doubler linker was then coupled for two more branches, resulting in four terminal bran ches for each sequence. An amine group was added to each branch by coupling a 5 amino-modifier C6 linker phosphoramidite to the

PAGE 120

103 deprotected hydroxyl groups. The 5 terminal of MB1P1D cont ained only a single aminomodifier C6 linker. The columns were then flushed slowly with 15 ml of 3% trichloroacetic acid in dichloromethane to remove the MMT protecting group on the terminal amino group to activate the amino group for subsequent coupling of pyrene. After washing slowly with 15 ml of DMF, the CPG containing MB1P1D sequence was released from the column into a 1 ml solution of DMF containing 14.4 mg (50 mol) pyrenebutyric acid, 10.3 mg (50 mol) di cyclocarbodiimide, and 6.1 mg (50 mol) dimethylaminopyridine. This step was re peated for each beacon sequence with the quantity of coupling reagents scaled by the number of pyrene molecules to be added to the 5 terminal (i.e. 200 mol for 4P1D). The coupling reactions proceeded at room temperature for approximately 6 hours and th e resulting solutions were washed three times with DMF to remove uncoupled pyrene and other reagents. The CPG pellets were then added to 3 ml solutions of 50% v/v ammonium hydroxide/methylamine and incubated at 60 C for 15 minutes to cleav e protecting groups for heterocyclic amines, cyanoethyl groups, and CPG from the oli gonucleotide sequences. The mixtures were centrifuged and the colo rless supernatants were retain ed. The oligonucleotides were precipitated in ethanol and re-dissolved in 0.1M TEAA solution for purification. The dissolved products were purified by HPLC usin g a C18 column with a flow rate of 1 ml/min. Buffer B was increased linearly fr om 20% to 70% over a 30-minute period, while absorbance and fluorescence intensities were monitored. Samples which had absorbance peaks at 260, 350, and 470 nm and emission at 398 nm with 350 nm excitation were collected and dried in a SpeedVac. For each molecular beacon, the peak

PAGE 121

104 with the longest retention time, indicating the maximum pyrene coupling, was retained and used for experiments. Quantum Yield Measurement. The quantum yields of multiple-pyrene complexes labeled in the molecular beacons were determined using 9,10-diphenylanthr acene in cyclohexane as a reference ( R = 0.95).11 The pyrene labeled oligonucleotides were dissolved in aqueous solution with 5 units of DNase I to fully separate th e quenching effect of DABCYL on the pyrene complexes. Concentrations of the refere nce and probes were adjusted to yield approximate absorbance intensities of less th an 0.05 to avoid inner filter effects. An excitation of 346 nm was used and fluores cence emission was integrated from 350-700 nm. The quantum yields were calculated from the following formula: where the subscripts F and R denote sample and reference respectively; I A, and n are fluorescence quantum yield, integrated fluorescence intensity, absorbance, and refractive index of the solvent, respec tively. In this case, n=1.333, and nR=1.423. Results and Discussion Design of Excimer MBs The monomer-excimer switching property of pyrene has been widely explored in signaling molecular interactions and invest igating molecular secondary structures.7;115;120123 This popularity comes from the fact that pyrene excimer formation is more stringently dependent on molecular distance than FRET, as it requires direct complexation of two molecules.14 It is more sensitive than FRET based measurement in studying close 2 2 R R R R Fn n A A I I

PAGE 122

105 distance (less than 1nm) interactions. In contrast to designs based on dynamic excimer/monomer switching mechanisms, we hope to assemble pyrene molecules in a close proximity permanently to form a series of unique fluorescence reporters to be used in different probe design and applications. Effective ways to assemble pyrene molecules include the use of peptides124 and oligonuleotides125 as the scaffolds. In this chapter, we describe the desi gn and synthesis of excimer-signaling molecular beacon probes, containing multiple-pyrene labeled on the 5 terminal and a single DABCYL molecule on the 3 terminal, for sensitive nucleic acid detection in buffer and cell growth media. Unlike excimer-monomer switching mechanisms,7 the multiple-pyrene functionality offers a new a nd versatile approach to excimer-signaling which can be applied to traditional quenching and FRET-based signaling schemes in molecular probes. Dendrimer linkers79;103;104 are used as the scaffold to allow assembly of pyrene molecules in a controllable manner. The close interaction rendered by the dendrimeric linker allows these multiple-pyr ene complexes to give excimer emission with good efficiency. Placed at the terminal of a molecular beacon, the multiple-pyrene complex is quenched by the quencher in clos e proximity when the probe is in close hairpin conformation with no target in the so lution. Figure 5-1 show s the schematic of a two-pyrene MB. DABCYL was chosen as the quencher because its maximum absorption overlaps well with the emission of the pyr ene excimer (Figure 5-2). Good spectral overlap ensures high FRET efficiency,11 resulting in efficien t quenching of excimer signal thus a lower probe background. In a ddition, DABCYL also has absorption in the region where pyrene monomer emits. Quenching of monomer emission will further diminish excimer emission. This happens because the excited state pyrene is one of the

PAGE 123

106 precursors for the formation of an excimer complex. As a consequence, DABCYL could be an effective quencher for pyrene excimer emission. When the molecular beacon interacts with the target, it will open, causi ng the quencher to separate from the multiplepyrene complexes. Excimer emission from the pyrene molecules will be restored to signal such an interaction (Figure 5-1). Figure 5-1. Schematic of a two-pyene beacon, MB-2P1D hybridization with complimentary target DNA. Figure 5-2. Absorption spectrum of DABCYL and emission spectrum of pyrene excimer in water. Overall, these excimer probes might offe r several unique advantages: 1) large Stokes shift (excitation 350nm, emission 485nm);2) long fluorescence lifetime (greater than 40ns) 7; and 3) applicablity for two-photon ex citation (excitation=350nm). Similar to pyrene excimer, the Eu complexes have a long fluorescence lifetime and the overall

PAGE 124

107 quantum yield is high. However, the emi ssion spectra of Eu complexes consist of multiple peaks. For a given emission peak, the quantum yield is not high. The second disadvantage of these rare earth complexes is possible de-complexation of the metal ions from the ligands in complex biological samples. Synthesis of Excimer MBs The synthesis methods developed in both Chapter 3 and Chapter 4 were used to make multiple-pyrene molecular beacons. In particular, the solid phase synthesis method used in Chapter 4 was used to couple pyren e to the oligonucleotide to solve the problem of the solubility incompatibility between oligonucleotide and pyrene.7 The solid phase synthesis method allowed the coupling of pyr ene to oligonucleotides in an anhydrous environment, resulting in high coupling yields. The method of assembling multiple quenchers using dendrimer linke rs developed in Chapter 3 was applied here to assemble different number of pyrene together.79 With different combinations of dendrimer linkers, multiple-pyrene complexes can be assembled with different numbers of pyrene molecules. Figure 5-3 illustrates the synthe sis of multiple-pyrene MBs. The synthesis starts with DABCYL labeled CPG. After all DNA bases are added to the sequence, dendrimeric linkers are coupled to generate plural branches. After functionalization with amino groups, these branches are conjugated with pyrene. As a result, molecular beacon sequences with a DABCYL at 3 end and the desired number of pyrene molecules at the 5 end are produced. For molecular beacon w ith a single pyrene, MB1P1D, no dendrimer linker was used, while two doubler linkers were used in consecutive to generate four coupling sites for pyrene coupling for the synthesis of MB4P1D.

PAGE 125

108 Figure 5-3 Synthesis of multiple-pyrene labeled molecular beacons Hybridization of Excimer MBs. To test the performance of the excimer molecular beacons, MB2P1D was first synthesized and tested. Fluorescence emission of the beacon in buffer did not give a characteristic pyrene excimer peak around 480 nm. Instead, two barely resolved weak peaks at 378 and 398 nm were observed (Figure 5-4, red trace), which were likely the monomer peaks of pyrene. When target DNA was added to the solution, strong emission peak immediately appeared centering at around 485nm. The two peaks below 400 nm also increased as result of the addition of target DNA. The strong emission at 485nm clearly indicates an efficient formation of excimer when the MB is in hybridized duplex form. The experiment also confirmed that DABCYL could effectively quench not only the excimer emission, but also the monomer emission. As high as 29-fold signal

PAGE 126

109 enhancement was recorded when equal-molar target sequences were introduced into the MB solution. Such a signal enhancement was comparable to those of normal FRET based MBs. For example, a FAM labeled MB with the same sequence and quencher label had showed a signal enhancement of about 15-fo ld under the same experimental conditions. When titrated with target DNA, the MB2P1D generated an excimer emission that increased proportionally to the amount of c DNA and reached its maximum with 1 target equivalent. Slow yet steady increases in fluor escence intensity was also observed for two monomer emission peaks (Figure5-4). Figure 5-4. Emission spectra of 1 uM MB 2P 1D with increasing concentrations of cDNA (0-700nM) in buffer solution. The selectivity of MB2P1D for different cDNA targets was compared through an analysis of the molecular beacon hybridizat ion kinetics (Figure 5-5). The rate of hybridization with the loop complimentary target (cDNA-L) was faster than with the extended complimentary target (cDNA-E). The three additional bases on each end of cDNA-E rendered this sequence a hair-pin structure, resulti ng in higher activation energy to reach the more stable hybrid product. H ybridization of the beac on to the single base mismatched target resulted in a much slow er rate with less than 60% of the beacon hybridized at equilibrium.

PAGE 127

110 Figure 5-5. Hybridization kinetics of 100 nM MB2P1D with varying nucleic acid targets (1 uM): cDNA-L (green, GCGACCAT AGTGATTTAGA), cDNA-E (black, AGCGCGACCATAGTGATTTAGAGCT), cDNA-SNP (red, GCGACCATAGCGATTTAGA) The results for MB2P1D show that covalently bringing two pyrene molecules together allows efficient formation of excimer complex. Such an excimer emission can be quenched in the same way as other organic dye s by regular quencher molecules such as DABCYL. The excimer complex can be used for molecular probe designs. One of the attractive features of pyrene excimer is its large Stokes shift as shown in Figure 5-4. With an excitation at 350 nm, pyrene excimer emits at 485 nm. A large Stokes shift allows efficient separation of scattering light from excimer emission and is useful for applications where scattering light is always a concern. The Stokes shift can be further extended by paring the multi-pyrene comple x with other fluorophores. A complex containing a TMR and two pyrene molecules wa s synthesized. Figure 5-6 (left) shows the structure of such a complex, where two pyr ene molecules are closely linked to a TMR molecule. TMR was chosen as an acceptor of pyrene fluorescen ce due to its strong absorption overlap in the 500-550 nm region of the excimer emission. The close proximity ensures highly efficient excimer formation and effective resonance reason energy transferring from the excited-state dimer to TMR. The steady-state emission

PAGE 128

111 spectrum of the compounds revealed in tense peaks at 375, 398 and 590 nm ( exc=350 nm) from the 2-pyrene-TMR conjugate (Figure 56 right). There were no visible peaks in either the excimer or TMR emission channels for a control complex, 1-pyrene-TMR conjugate. Negligible excimer emission was observed from the 2 -pyrene-TMR conjugate. This shows that the fluorescence energy from the excimer was efficiently transferred to the TMR within close spatial proximity. In contrast, FRET was not feasible with the single pyrene label due to the absence of the pyrene dimer emission. The effective Stokes shift of the multiple-pyreneTMR label was extended to as large as 240 nm. The relaying of energy to further red emitting fluorophores could be possible by tagging such a multiple pyrene-TMR with other dyes.126 Figure 5-6. Structure and fluorescence emi ssion of a macromolecule containing two pyrene and one TMR molecules. Time-Resolved Excimer Signaling Approach Large Stokes shift is one of the advantag es that the multiple-pyrene label offers. Another attractive feature of the multiple-pyrene label is its long fluorescence lifetime. Data in Chapter 4 indicated that the lifetime of pyrene excimer was as long as 40 ns in aqueous solution.7 The excimer reported in Chapter 4 wa s a result of a decrease in the spatial distance between two pyrene molecu les induced by the aptamer conformational change. Covalently tethered by a short li nker, the two pyrene molecules in the open O HN O P O O HO O H2N O P O O HO O O NH O P O O OH O P O -O O HO O N H O O CO2 N N+

PAGE 129

112 MB2P1D form an excimer, exhibiting a fluor escence lifetime of about 39 ns as shown in Figure 5-7. This value is about one order ma gnitude longer than fluorescence lifetime of most biological species, which allow tem poral separation of autofluoresecence from excimer emission. Figure 5-7. Fluorescence decay of MB2P1D in the prescence of 10-fold excess of target DNA. Excitation wavelength=337nm, Emission wavelength=485nm. [MB2P1D]=1M One of the predominant challenges in bioa nalysis and bioimaging is to circumvent the high background signals generated by the pr obe and coexisting species in solution. Results from Chapter 4 suggested that th e application of time -resolved fluorescence monitoring is an effective method for detec ting analytes in complex and highly autofluorescent biological fluids. The sensitivity of time-gated analysis in bioassays depends on the fluorescence lifetime and Stokes shift being sufficiently large for the signaling agent (fluorophore) than for the background species. Lanthanide chelates (luminophores) are currently being explored as labeling agents in time-resolved probes due to their extraordinarily long fluorescence lifetimes ( s range) and large Stokes shifts (up to 300 nm). The pyrene excimer is unique am ong organic fluorophores, possessing a long 100101102103104300 200 100 0 = 39 1 ns Counts Time (ns)

PAGE 130

113 fluorescence lifetime (40 ns) and large Stokes shift (>130 nm). Combined with the low background signal of the molecular beacon probe, the excimer-signaling of the multiplepyrene label permits a sensitive time-resolved approach for the detection of nucleic acids in biological media. As in Chapter 4, cell me dia were used here to test the feasibility of using time-resolved measurement and the excimer MBs to detect trace amount of DNA complex in biological fluids. Figure 5-8. Fluorescence emission of MB 2P1D in cell media containing various concentrations of target DNA. [MB2P1D]=500nM Figure 5-8 compares the target hybridizat ion of MB2P1D in cell media with the various concentrations of target DNA at the same 337 nm excitation. High autofluorescence dominated most of the signa l from the cell media with an especially broad peak at 400 nm, which was attributed to a combination of light scattering and autofluorescence from biological species. This intense background masked the excimer emission from the beacon, making it unable to signal the presence of target DNA in the solution. Even when the target concentration was as high as 5000 nM (10 times the probe concentration), no distinguishable peak at around 485 nm could be observed.

PAGE 131

114 To discriminate the excimer signal of the dual pyrene label from the high background fluorescence, time-correlated singl e photon counting technique was used. Time-resolved emission spectrum was first obtained from MB2P1D in cell media. As shown in Figure 5-9, the emission spectrum taken immediately following the excitation had the highest intensity with a profile resembling the steady-state spectrum which included all of the short-lived fluorescence. At 40 ns, the excimer emission outlasted the background fluorescence and was noticeably more intense than emission at 398 nm. The time-resolved spectrum at 40 ns closely resembled the steady-state spectrum of the hybridized MB2P1D in buffer. In addition, it confirmed the integrity of the dual pyrene excimer in biological environments. Clearly, using time-resolved approach, probe signal can be separated from intense biological background. Figure 5-9 Time resolved spectra of MB2P1D with 5x concentration of target in cell media. The sensitivity of the time-resolved excimer signaling approach was also investigated for quantifying DNA in cell grow th media. Time-resolved emission spectra indicated that once the autofluorescence ha d decayed away (less than 40 ns after

PAGE 132

115 excitation), a local emission maximum for MB 2P1D was observed in the pyrene excimer emission channel. The fluorescence decays of MB2P1D were thus appropriately monitored at this channel (480 nm) with vary ing concentrations of target cDNA in the cell media (Figure 5-10). The total phot on counts increased proportionally to cDNA concentration and a clear signal separati on was obtained for the fully hybridized MB2P1D. Maximum signal separation occurred in the 60-110 ns time frame while much of the excimer emission from the dual pyrene label was still retained. DNA quantification was possible by integrating the total photons em itted in this time in terval and calibrating for various DNA concentrations (Figure5-10) Time-resolved signaling combined with the long lifetime and large Stokes shift of the pyrene excimer provided a sensitive method for detecting low nanomolar DNA con centrations in complex biological media without the need for sample pretreatment extraction, or target amplification. Figure 5-10. Fluorescence decay of 500 nM MB2P1D (blue) and MB2P1D with increase concentration of cDNA (red) in cel l growth media (black) at 480nm. Maximum signal is observed in 60-110 ns time interval.

PAGE 133

116 Tunable Intensity through Multiple Labeling. Another unique feature of the multiple-pyrene label is that the excimer intensity is scaled to a large extent by the local pyrene de nsity, or number of monomers conjugated at the terminal of the molecular beacon. Unlik e most commercial, organic fluorophores with Stokes shifts ranging from 10 to 40 nm, the pyr ene excimer exhibits an exceedingly long Stokes shift (approx. 130 nm) with no ove rlap between the absorption (350 nm) and emission (480 nm) bands. This vast peak separation enables the pyrene excimer to avoid the effects of self-quenching even at high concentrations and labeling densities. More importantly, the pyrene excimer formation requi res the complexation of an excited state molecule with a ground state molecule. Increas ing the density of molecules assembled on the terminal of the molecular beacon greatly enhances the probability of forming excited stated dimers. These optical characteristics provide a unique tunable intensity feature for multiple-pyrene labeled probes and may improve the signaling sensitivity of fluorescence-based detection methods. In addition to MB2P1D, we synthesized molecular beacons with 1, 3, and 4 pyrene monomers conjugated at the 5 terminal in an attempt to study the effect of the numb er pyrene molecules on pyrenes emission intensity. The emission spectra of the pyrene labeled beacons in the presence of target cDNA showed a substantial increase in excime r intensity with an increased number of pyrene monomers in the label (Figure 5-11). The monomer emission intensity at 398 nm was highest for MB1P1D and remained n early constant for MB2P1D, MB3P1D, and MB4P1D, indicating that excimer formation was more favorable with higher densities of pyrene at the beacon terminal.

PAGE 134

117 Figure 5-11. Quantum yields of multiple-pyrene labels. Table 5-1 Quantum yields of multiple-pyrene labels MB Name Quantum Yield 1P1D 0.008 0.000 2P1D 0.036 0.001 3P1D 0.090 0.001 4P1D 0.197 0.003 The quantum yield results show that the more pyrene molecules assembled, the higher the quantum yield the label has. As shown in table 5-1, the quantum yield of pyrene in 2-pyrene label was about 4 times the quantum yield of a label with a single pyrene. Having one extra pyrene, the 3-pyrene labels quantum yield was about twice that of a 2-pyrene label. The quantum yield of the 4-pyrene label was about 0.20, about twice as high as that of 3-pyrene label. Such a high quantum yield, together with a remarkable extinction coefficient (56,000x4=236,000 cm-1M-1), makes the 4-pyrene label an exceptional bright UV excitable fluorophore. These results suggest a way to build a bright fluorophore through assembling high numbers of pyrene molecules together. One could use dendrimeric linkers to assemble multiple-pyrene labels or use polypeptides as a backbone to co nnect many pyrene molecules together. Of course, solubility of the product could be a problem for biological

PAGE 135

118 applications because of the hydrophobicity of pyrene. Therefore, water soluble monomers would need to be used for these pursuits. One of the hydrophilic pyrene derivatives is cascade blue (Figure 5-12). Our initial testing indicates that this fluorophore is able to form excimer with emission peak around 510nm. Figure 5-12. Structure of Cacade blue acetyl azide and its emission spectra at different concentrations. Effect of Multiple Pyrene on the Stability and Kinetic of MBs To investigate the effect of the hydr ophobic and bulky multiple-pyrene label on the stability of molecular beacon, melting temperature of 1, 2, 3, and 4 pyrene molecular beacons were measured and results are showed in Figure 5-13. The Tm of molecular beacons MB1P1D, MB2P1D, MB3P1D, and MB4P1D, obtained from the maximum of the first derivative of the melting temper ature curve of the corresponding molecular beacon, were about 60.4, 62.5, 61.8, and 61.5 C respectively (Figure 5-13). For a molecular beacon with FAM and DABCYL labels, the melting temperature measured was about 56 C. Each of these pyrene -labeled molecular beacons has a higher Tm than FAM-labeled MBs. This increase of stem stability could result from 1) hydrophobic interactions127 between DABCYL and pyrene molecule s and 2) the interchelation of Na+Na+Na+S O O-O S OO O-S O O O-O N N N O 4004505005506006500.0 0.2 0.4 0.6 0.8 1.0 Cascade Blue In 20mM Tris BufferFluorescence IntensityWavelength (nm) 1.4mM 14uM

PAGE 136

119 pyrene in stem duplex.128 Increasing the number of pyrene molecules at the 5 end of a molecular beacon sequence did not cause observable change in Tm of the probe, indicating the bulky multiple-pyrene labels tested do no have severe effect on the stability of the molecular beacon. Figure 5-13. Melting temperature of multiple pyrene molecular beacons. Clockwise from top: MB1P1D, MB2P1D, MB3P1D, and MB4P1D. Buffer: 20mM Tris-HCl, 50mM NaCl, 5 mM MgCl2, [MB]=100nM. Except for single pyrene molecular beacon, all the beacons were monitored at pyrene excimer emission at 485nm.

PAGE 137

120 Figure 5-14, Hybridization of MB4P1D and MB4P1D to 5 fold excess of target DNA Hybridization rates of multiple-pyrene MBs were compared. As shown in Figure 514, under the same condition, the half-time to open MB1P1D is about 76 seconds and for 4P1D is about 71 seconds. This result suggests the multiple-pyrene labels do not affect much the binding kinetics of the MB to its target DNA. Conclusions We have designed and synthesized multiple-pyrene labeled molecular beacons for real-time detection of target nucleic acid s in homogeneous solution. The multiple-pyrene MBs produce an intense excimer emission in the presence of cDNA and offer a high sensitivity and selectivity comparable to other fluorophore labeled DNA probes. Rare among organic fluorophores, the long lifetime (~40 ns) and Stokes shift (130 nm) of the pyrene excimer favor a time-resolved signaling approach which easily discriminates between the open and closed conformations of the beacons in complex biological fluids. Monitoring the excimer emission decay of the multiple pyrene MBs results in a sensitive time-resolved method for detecting and quan tifying low concentrations of cDNA in cell

PAGE 138

121 growth media without the need for sample pr etreatment or washing steps. Furthermore, multiple-pyrene labeling provides a unique tuna ble intensity feature in which the excimer intensity is proportional to the number of pyr ene monomer conjugated in the label. The inherently high emission intensities of these multiple-pyrene labels may be useful in enhancing the sensitivity of off/on switching fluorescent probes in both steady-state and time-resolved detection assays. The unique optical properties and versatility of the multiple-pyrene fluorophore offer new opportunities for highly sensitive FRET-based biomolecular probing.

PAGE 139

122 CHAPTER 6 SYNTHESIS AND INVESTIGATION OF LOCKED NUCLEIC ACID MOLECULAR BEACONS Introduction Genetic information analyses increased demand for advanced molecular recognition probes with high sensitivity, excell ent specificity, and biostability. One such probe is the molecular beacon (MB) 13 which is a short hairpin oligonucleotide probe that binds to a specific oligonucle otide sequence and produces a fluorescence signal. With its inherent signal transduction mechanism, MBs are able to detect nucleic acid targets without separation or the additi on of extra reagents. This pr operty makes MBs especially useful for real-time detection of DNA and RNA, which is of great significance to the study of gene expression a nd at the single cell level.92 However, when used for intracellular analysis, MBs tend to generate false-positive signals due to nuclease degradation, protein binding,99;129 and thermodynamic fluctuations.27 For example, it has been reported that unmodified phosphodiester oligonucleotides may possess a half-life as short as 15-20 min in living cells.130 Constructed from DNA, MBs also have a finite lifespan inside of the cell,35 limiting the use of MBs in many biological studies. In addition to nuclease degradation, DNA-MBs ar e exposed to nucleic acid binding proteins in cells. The interaction of these nucleic acid binding proteins with MBs can disrupt the stem-loop structure and cause non-specific fluorescent signal.90 To overcome the bioinstability problem, MBs have been synthesized with nucleaseresistant backbone chemistr ies such as phosphorothioate131 and 2'-O-methyl RNA bases

PAGE 140

123 132-136. More recently, various groups have cons idered neutral peptide nucleic acids (PNAs) as a scaffold for MBs.137-139 Backbone modifications have both advantages and disadvantages. Those that retain the repeating charge continue to behave lik e natural nucleic acids in their hybridizing properties, overcoming certain disadvantages, su ch as the toxicity occasionally associated with phosphorothioate-cont aining oligonucleotides.140 To the extent that MBs incorporating such modifications resemble na tural nucleic acids, however, they still may be opened by intracellular DNAand RNA-bindi ng proteins, many of which are believed to recognize a repeating backbone negative ch arge. This can lead to a signal in the absence of the analyte. MBs with 2'-O-m ethyl RNA bases, for example, possess a good nuclease resistance, higher affinity, increased specificity, and a superior ability to bind to structured targets compared to their DNA c ounterparts. However, 2'-O-methyl modified MBs open up non-specifically in cells, possibly due to protein binding.135;136 Lacking repeating charges, PNAs are not degraded by nucleases and their hybridization products with RNA are therma lly more stable compared with DNA-RNA and RNA-RNA duplexes. The neutral charged PNAs in a MB probe are not likely to be recognized and opened by endogenous RNAor DNA-binding proteins. Xi et al139 reported that using PNA-MBs instead of DNA-MBs for traditional fluorescent in situ hybridization probes would bene fit cell detection under a wide range of environmental conditions. The neutral backbone, however, cr eates other undesirable properties. PNAs have a well documented propensity to self-aggregate141 and fold in a way that interferes with duplex formation. 142 Furthermore, PNAs change their physical properties substantially (and unpredictably) with small changes in sequence,143;144 although adding

PAGE 141

124 charged appendages helps.145. Since the environmental cond itions inside of a living cell can not be predicted or optimized for the solu bility of PNA, intracellular applications of PNA are limited. Considering these facts, we reasoned that a scaffold that differs as much as possible in the geometric and steric properties from ri bose, but retains the re peating charge, might be the most likely to retain the desirable so lubility and rule-based molecular recognition features of natural DNA, while avoiding binding to intracellular DNAand RNA-binding proteins. Locked nucleic acids (LNAs) 146-149 offer one possible implementation of such a rationale. LNA is a conformationally restricte d nucleic acid analogue, in which the ribose ring is locked into a rigid C3'-endo (or Northern-type) conformation by a simple 2'-O, 4'C methylene bridge 149;150. LNA has many attractive properties,149;150 such as high binding affinity, excellent base mismatch discrimina tion capability, and decreased susceptibility to nuclease digestion. Duplexes involvi ng LNA (hybridized to either DNA or RNA) display a large increase in Tm ranging from +3.0 to +9.6oC per LNA modification140 compared to corresponding unmodified reference duplexes. Furthermore, LNA oligonucleotides can be synthesized usi ng conventional phosphoramidite chemistry, allowing automated synthesis of both fully m odified LNA and chimeric oligonucleotides such as LNA/DNA and LNA/RNA. Other advantag es of LNA include its close structural resemblance to native nucleic acids, which l eads to very good solubi lity in physiological conditions and easy handling. In addition, owing to its charged phosphate backbone, LNA is non-toxic and can be delivered into cells using standard protocols that employ

PAGE 142

125 cationic lipids.151 All these properties are highly advantageous for a molecular tool for diagnostic applications. In this chapter, the possibility of a lleviating enzymatic digestion and protein binding by using locked nucleic acid (LNA) ba ses in the molecular probe design is investigated.152;153 LNA-MBs were designed with diffe rent stem lengths and LNA base ratios and their thermodynamic properties, hyb ridization kinetics, enzymatic resistance, as well as interactions with DNA binding proteins were studied. Materials and Methods Chemicals and Reagents Oligonucleotides and MBs prepared are listed in Table 6-1. DNA and LNA synthesis reagents were purchased from Gl en Research (Sterling,VA). Deoxynuclease I, Ribonuclease H, and Single Stranded Binding Protein were bought from Fisher. Instruments An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was used for target DNA synthesis and LNA-MB probe preparation. Probe purification was performed with a ProStar HPLC (Varian, Walnut Creek, CA) where a C18 column (Econosil, 5U, 250.6 mm) from Alltech (Deerfield, IL) was used. UV-Vis measurements were performed with a Cary Bio-300 UV spectrometer (Varian, Walnut Creek, CA) for probe quantitation. Fluores cence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). Molecular Beacon Synthesis Molecular beacons possessing locked nucle ic acid bases were synthesized on an Applied Biosystem 3400 DNA/RNA synthesi zer by using Locked Nucleic Acid phorsphoramidites. The controlled pore gl ass columns used for these syntheses

PAGE 143

126 introduced a DABCYL molecule at the 3' e nd of the oligonucleotides. FAM or Cy3 phorsphoramidite was used to couple resp ective fluorophore to the 5' ends of the sequence. The complete MB sequences were then deprotected in concentrated ammonia overnight at 65C and purified by high-pressu re liquid chromatography. The collection from the first HPLC separation was then vacuum dried, incubated in 200 l 80% acetic acid for 15 min, incubated with 200 l of ethanol and vacuum dried again before the second round of HPLC. HPLC was performe d on a ProStar HPLC Station (Varian, Walnut Creek, CA) equipped with a fluor escent and a photodiode array detector. Hybridization Study Hybridization experiments were co nducted with 100 nM of MBs, 500 nM complimentary target sequen ces in a total volume of 200 L. All experiments were conducted in 20 mM of Tris-HCl (pH 7.5) buffer containing 5 mM of MgCl2 and 50 mM of NaCl. DNase I Sensitivity To test the nuclease sensitivity of MBs the fluorescence of a 200 l solution containing 20 mM of Tris-HCl (pH 7.5), 5 mM of MgCl2, 50 mM of NaCl and 100 nM of MBs was measured as a function of time at room temperature. One unit of DNase I was added, and the subsequent change in fluorescence was recorded. RNase H sensitivity To test the susceptibility of MB-RNA hybrids to ribonuclease H digestion, 100 nM of MBs were incubated with the same concen tration of RNA target in the aforementioned buffer. The fluorescence intensity of the so lution was monitored. After the hybridization reached equilibrium, 12 units of ribonuclease H were added, and the subsequent change in fluorescence was recorded as a function of time.

PAGE 144

127 Thermal Stability Studies The thermal stabilities of the MB samples were determined with a BioRad RTPCR thermal cycler. The fluorescence intensity of 100 l of MBs (100 nM) in 20 mM of Tris-HCl (pH 7.5) buffer containing 5 mM of MgCl2, 50 mM of NaCl was monitored as a function of temperature. The temperature was brought to 10C and increased at 3C increments to 95C, with each step lasting for 2 minutes and fluorescence monitored during each step. The melting temperatures (Tm values) were obtained as the maxima of the first derivative of the melting curves. Protein Binding Studies Gel electrophoresis was performed to study the interaction between single stranded binding protein (SSB) and MBs. In 20 mM of Tris-HCl buffer (pH 7.5, 5 mM of MgCl2, 50 mM of NaCl), 5 M MB was incubated w ith the same concentration of SSB. After one hour, the solution was analyzed in a 3% agarose gel in TBE buffer (100 V) for 50 minutes. The gel was then stained with Gel-code blue stain solution (Pierce) for one hour and washed with de-ionized water for 30 minutes. The image of the resulting gel was obtained by scanning on a regular scanner. Results and Discussion Investigating MBs with All Bases Constructed from LNA The aim of improving nucleic acid hybridi zation has driven researchers to design and synthesize a variety of nucleic acid anal ogues in the past decade. Among these, LNA is the most notable analogue that displays increased helical thermostability, unprecedented hybridization target affinity, unambiguous scoring of single-nucleotide polymorphisms and decreased susceptibility to nucleases.149;154 As shown in Figure 6-1, LNA contains one or more LNA nucleotide monomers with a bicyclic furanose unit

PAGE 145

128 locked in a RNA mimicking sugar conforma tion (Figure 6-1). The methylene bridge connecting the 2'-oxygen of the ribose and the 4'-carbon endows LNA with many attractive properties,149;154 such as high binding affinity, excellent base mismatch discrimination capability, and decreased su sceptibility to nuclease digestion. We reasoned that LNA could be the best NA base in making MB for intracellular monitoring. Advantages of LNA include its very good sol ubility in water, eas y handling, lack of toxicity and convenient delivery into cells using standard pr otocols. All these properties are highly advantageous for a MB fo r RNA dynamics analysis in the cell. B O O C O P O O O O C O P O O O O C O P O O O B B OOO-A C TN+N O H O P O O-O C C G T A N N N O NH O O OH P O O-G T C A T A A T C A T G G T C G C C G A G C T Figure 6-1. Structure of LNA and an LNA-MB To investigate the feasibility of using L NA for MB modification, a fully modified LNA-MB, and an MB with DNA monomers (DNA-MB) were prepared.153 Both molecular beacons were synthesized with a 19mer loop and 6mer stem where Cy3 was the 5'-end reporter and DABCYL was the 3'-end quencher (Cy3-CCT AGC TCT AAA

PAGE 146

129 TCA CTA TGG TCG CGC TAG G-DABCYL). Becau se of its pH insensitivity, Cy3 was chosen with an aim to study the intracellular behavior of the LNA-MB. The structure of the MB is shown in Figure 6-1. Tm measurements were conducted to study the thermostability of both LNA-MB and DNA-MB. Interestingly, the LNA-MB did not open even at 95C, as indicated by the constant low fluorescence; while the DNAMB lost its hairpin conformation at temperatures around 57C (Figure 6-2 ). This observation can be attributed to a tighter binding of the LNALNA homoduplex in the stem To confirm that th e lack of signal was not because the reporter dye was not attached to the stem, the quencher covalently linked to the reporter, or cross-linking of LNA-MB stem, we further added the target to the solution. Figure 6-2 shows the hybridization of LNA-MB to target sequences at 95oC. LNA-MB not only functioned well under room te mperature, but also hybridized with the target at 95oC, implying its exceptionally strong affi nity for the target. Such tight binding make LNA-MB a more efficient molecular pr obe for intracellular mRNA monitoring as it could bind highly to structured mRNA sequences more effectively. 102030405060708090100 0.0 0.2 0.4 0.6 0.8 1.0 Normalized Fluorescence IntensityTemperature (oC) Normal MB LNA MB0102030405060 10 20 30 40 50 60 add cDNAFluorescence Intensity (*1000)Time (minute) Figure 6-2. Melting curves for DNA and L NA MBs(left) and hybridization of LNA-MB with complementary target at 95C(right).

PAGE 147

130 The ability of the LNA-MB to distinguish between perfectly matched complements from complements containing one mismatched was observed. The short and long arrows in Figure 2 display the response differences of DNA and LNA MBs, respectively, to perfectly matched and single-base mismatched target sequences. LNA-MB shows an enhanced discriminatory power during the en tire monitoring cycle, outperforming the DNA-MB in terms of selectivity. Since our pur pose was to compare the selectivity of both beacons, the experiment was not carried out under optimized stringent conditions to achieve the best SNP performance. By car efully optimizing the assay conditions, and fine-tuning the stem and loop lengths, better SN P selectivity can be achieved. This degree of molecular specificity should be valuable in a variety of biological and biotechnological applications, such as real-time PCR monito ring, hybridization-based genotyping, and living cell mRNA monitoring. 050010001500 0.0 0.2 0.4 0.6 0.8 1.0 Normalized Fluorescence IntensityTime(minute) LNA-MB PM LNA-MB MM DNA-MB PM DNA-MB MM Figure 6-3. Normalized hybridization kine tics of DNA and LNA MBs with perfectly matched (PM) or single base mismatch ed (MM) targets. Final concentration ratio of MB:target =1:1. Hybridization buffer: 40 mM Tris, 50 mM NaCl. Pink: hybridization of DNA-MB with perfectly matched target. Green: hybridization of DNA-MB with single base mismatched target. Red: hybridization of LNA-MB w ith perfectly matched target. Blue: hybridization of LNA-MB with single base mismatched target.

PAGE 148

131 In performing intracellular imaging and quantitation of gene expression, degradation of unmodified MBs by endogenous nucleases and NA binding proteins can significantly limit the detection sensitivity and result in fluorescence signals unrelated to probe/target hybridization. Our results (F igure 6-4) show that the DNA-MB was degraded rapidly with the addition of DNAase I while the LNA-MB was not degraded under identical conditions, even after incubati on for 24h. This remarkable stability will extend the use of MB in monitoring gene expression for long time. Another striking property of the LNA-MB comes from its resistance to nonspecific protein binding. Normal DNA-MBs are subject to nonspeci fic binding with proteins such as the ubiquitous SSB. Such binding causes a MB to open up and gives false positive signals, as shown in Figure 6-4. Interestingly, the LNA-MB had no response to the addition of excess SSB. Although nuclease-resistant MBs can be synthesized, this is the first report that LNA-MB has no binding with SSB which makes it well suited to monitor mRNA in the living cells since the native biological environment abounds with these proteins. 0204060 0 100 200 300 400 500 add DNAseI Fluorescence Intensity (*1000)Time (minute) LNA-MB+DNAseI DNA-MB+DNAseI LNA-MBDNA-MB 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 3.2 3.6 4.0 Signal Enhancement Without SSB With SSB Figure 6-4. Response of MBs to nuclease a nd single stranded binding protein (SSB). [MB] = 100 nM, DNAase I: 2 U, [SSB] = 500 nM. Hybridization buffer: 40 mM Tris, 50 mM NaCl and 5 mM MgCl2.

PAGE 149

132 In summary, in vitro experiments show that the LNA-MB not only exhibits excellent thermal stability a nd single base discrimination capability, but also resists nuclease digestion and binding of single st randed DNA binding proteins. All of these properties are ideal for intracellular app lications and studies. Unfortunately, the hybridization kinetics of this LNA-MB are re latively slow as shown in the following section. Hybridization Kinetics of LNA-MBs Compared to DNA-MBs, LNA-MBs hybridize slowly with complementary target DNA or RNA sequences. Figure 6-5 shows the hybridization of a DNA-MB and the fully modified LNA-MB to its target. Th e fluorescence signal of DNA-MB reaches equilibrium within minutes, however, the fl uorescence intensity of the fully modified LNA-MB increases slowly over time, indica ting its slow hybridization kinetics. The reaction does not reach equilibrium even af ter 20 hours under the same conditions. The slow hybridization kinetics would compromise temporal resolution when obtaining the dynamic information of RNA in living cells. In order to make use of the advantages of LNA-MBs for intracellular analysis, it is n ecessary to expedite LNA-MB hybridization kinetics. It is believed that several factors could lead to the slow hybridization kinetics. First of all, hybridization of MBs with target sequences competes with stem dehybridization. The strong bindi ng affinity of the LNA bases in the stem is unfavorable for stem dehybridization. It has been reporte d that replacing DNA with LNA bases in one of the oligonucleotide sequen ces in an octamer duplex had no evident effect on the association rate 155 but significantly decreased the di ssociation rate of the octamer sequence from its complementary sequence. Th e dissociation rate droped as much as 2fold for a single base replacement and 5-fold for two base replacements. More than 30-

PAGE 150

133 fold decrease in dissociation rate was observed after replacing three DNA/DNA base pairs with LNA/DNA base pairs.155 Therefore, inserting severa l LNA bases in a MB stem thus greatly enhances the en ergy barrier of opening the L NA-MB stem and significantly slows down its hybridization kinetics. 01020304050 0 2 4 6 8 10 12 14 16 Fluorescence signal changeTime(min) DNA-MB LNA-MB Figure 6-5. Hybridization of DNA-MB and LNA-MB to loop cDNA. (1:10 Ratio) Secondly, because of the excellent bi nding affinity of LNA, hybridized MB sequences are more likely to form sticky-end pairs.156 DNA sticky-end pairing (SEP) plays an important role in cellular processes and has been well used in various biotechnological applications. For MBs, SEP is defined by the intermolecular interaction between the stems of two or more MBs when loop target DNA is present. Two complementary sticky ends from two MB/targ et hybrids can pair to form a short double helix, leading to the associat ion of two hybrids at one end. These two MB hybrids can form a closed structure, ([MB]2), by pairing the other two sticky ends or polymerize into

PAGE 151

134 a multi-molecular structure, [MB]n (n>3), by pairing with more hybrids. With sticky-end pairing, the fluorophore and quencher are brough t together again (but from different sequences), causing the quenching of the fluores cence. Any parameters that stabilize the short double helix of the sticky-end pairs wi ll lead to a more severe loss of the fluorescence intensity. For example, the higher the Mg2+ ion in the solution, the more signal is lost.156 The direct result of SEP is the quenching of the fluorophore in opened MBs. Therefore, when the opening of MB via target hybridization is immediately followed by sticky-end pairing, only slow signal intensity increase is observed. In summary, slow stem dehybridization ra te and tendency to form sticky-end pairs are two critically important factors for the sl ow apparent hybridization kinetics of the MBs made of LNA bases. Considering the two factors discussed a bove, we believe that the hybridization kinetics of LNA-MBs could be improved by preventing sticky-end paring, or by reducing the LNA percentage in MB sequences, especi ally in the stem, to lower reaction energy barrier and speed up the openi ng rate of MB hair-pin stru cture. A series of DNA/LNA chimeric MBs were prepared as listed in Table 6-1. MB-DNA is a probe constructed solely from DNA bases. The MB-LNA probes were prepared by gr adually replacing every base, every other base, every second base every third base, every fourth base, and every fifth base of the MB-DNA with LNA bases to produce MB-LNA-E0, MB-LNAE1, MB-LNA-E2, MB-LNA-E3, MB-LNA-E4, and MB-LNA-E5 respectively, as shown in Table 6-1. A 5-mer stem MB, designated by MB-LNA-5SE1, with DNA/LNA alternating bases was also prepared.

PAGE 152

135 Table 6-1 Molecular beacons and oligonuc leotides prepared in this study. MB Name Sequence Tm(oC) LNA-MB 5'-Cy3CCTAGC TCTAAATCACTATGGTCGCGCTAGG -DABCYL3' >95 DNA-MB 5'-Cy3-CCTAGC TCTAAATCACTATGGTCGCGCTAGG -DABCYL3' 57 MB-LNA-E0 5'CCTAGC TCTAAATCACTATGGTCGCGCTAGG -3' >95 MB-LNA-E1 5'C C T A G C T C T A A A T C A C T A T G G T C G C G C T A G G -3' >85 MB-LNA-E2 5'C CT A GC T CT A AA T CA C TA T GG T CG C GC T AG G -3' 83 MB-LNA-E3 5'CC T AGC T CTA A ATC A CTA T GGT C GCG C TAG G -3' 83 MB-LNA-E4 5'C CTAG C TCTA A ATCA C TATG G TCGC G CTAG G -3' 84 MB-LNA-E5 5'C CTAGC T CTAAA T CACTA T GGTCG C GCTAG G -3' 76 MB-LNA-5SE1 5'C T A G C T C T A A A T C A C T A T G G T C G C G C T A G -3' 67 MB-DNA 5'CCTAGC TCTAAATCACTATGGTCGCGCTAGG -3' 57 Loop cDNA GCG ACC AT A GTG ATT TAG A Shared-Stem cDNA CCT AGC GCG ACC ATA GTG ATT TAG A Red letters represent LNA bases. Unde rlined letters are bases for MB stem. Except otherwise indicates, all MBs are labeled with DABCYL at 3 ends and FAM at 5 ends. Thermodynamics of LNA-MBs The Tm of a MB changes as a function of LN A percentage in the strand. As shown in Table 6-1, Tm of the MBs with different compositio ns varies with the percentage of LNA in the probe. It was shown that an introduction of LNA bases raised the Tm of the oligonucleotide and its complementary DNA or RNA by as much as 9.6 C per LNA modification.140 The incorporation of LNA bases in an MB sequence stabilizes the stem duplex of the probe. When one DNA/DNA ba se pair was replaced by one LNA/LNA pair in the stem, as in MB-LNA-E5, the Tm increased as high as 20 C. The Tm increased about 27 C when the number of LNA/LNA base pair increased to two (as in MB-LNA-E2, MB-LNA-E4). The melting temperature change was found to be weakly dependent on the nature of base pairs. For example, Tm of MB-LNA-E4 was about 1 C higher than that of MB-

PAGE 153

136 LNA-E2. The main difference in the stem sequence between these two sequences was that the former has two G:C LNA pairs whil e the latter contains one G:C and one A:T LNA pairs. Insertion of three LNA:DNA pairs in the MB stem had similar effects on the stability of MB stem as two LNA:LNA pairs did, as indicated by the Tm of MB-LNA-E4 and MB-LNA-E3. No fluorescence signal change was observed for LNA-MB-E0 when the temperature was increased, suggesting an extremely high Tm of the probe. With a 5mer stem, MB-LNA-5SE1 has Tm of 67 C, which was more than 28 C lower than that of a 6-mer stem molecular beacon MB-LNA-E1. Elimination of Sticky-end Pairing in LNA-MB Hybridization Hybridization of the MBs with a target DNA sequence complementary to the MB loop sequence was investigated. A slow in crease of fluorescen ce signal was observed when target DNA was introduced into the LNA-MB-E0 solution. Lowering the percentage of LNA in the probe sequen ces significantly improved the initial hybridization rate. For LNA-MB-E2, E3 a nd E4, interesting fluorescence traces were observed. The fluorescence of the solution initially had a sharp increase and then suddenly began to decay (Figure 6-6, blue trace). Similar traces were observed for DNAMBs at higher Mg2+ in previous studies, which was attributed to sticky-end pairing (SEP) of MBs in the presence of target.156

PAGE 154

137 0102030 0 5 10 15 20 Fluorescence intensity changeTime (min) LNA-MB-E3+Shared_Stem_cDNA LNA-MB-E3+Loop_cDNA Figure 6-6. Hybridization of MB-LNA-E3 to loop cDNA and shared-stem cDNA Incorporation of LNA bases into MBs significantly enhances the affinity of the stem, as indicated by the elevated melting temperature of the LNA-MBs (Table 6-1). Consequently, intermolecular complexation of LNA-MBs was evident for LNA-MB-E2, LNA-MB-E3, and LNA-MB-E4. The traces of LNA-MB-E1 and LNA-MB-E0 are somewhat different, with no clear drop in fl uorescence after the in itial signal increase (Figure 6-5, red trace). Thes e two beacon sequences were much slower to open because of more LNAs in the stem, and they had hi gher tendency to form sticky-end pairs. Thus, formation of sticky-end pairs might take place at the earlier hybridi zation state, resulting in slower signal increment. Several strategies could be exploited to prevent the form ation of sticky-end pairing. For example, lowering Mg2+ concentration is proven to be an effective way to prevent sticky-end pairing for DNA-MBs.156 However, this approach is not practical for intracellular applications. Another approach is to use a target complementary to the loop plus one of the stem sequences. The hybridizat ion of the so-called shared-stem targets to

PAGE 155

138 MBs results in a MB/target hybrid with onl y one sticky end, making SEP impossible. Figure 6-6 shows the hybridization of a shar ed-stem target to LNA-MB-E3 (red trace). Faster hybridization kinetics and greater signa l enhancement were observed. Clearly, the process of forming SEP results in a very sl ow apparent hybridization rate, lowering the overall signal response. Convers ely, use of shared-stem target effectively blocks SEP, resulting in faster hybridization kine tics and greater signal enhancements. The formation of sticky-end pairs was further confirmed by studying the thermal denaturation profiles of MBs in equilibrium with their targets. The fluorescence of the solutions of LNA-MB-E3 incubated with no ta rget, loop target, and shared-stem target were monitored at different temperatures The results (Figure 6-7A, blue trace) demonstrate that at lower temperatures the MBs are in a closed state, the fluorophore and the quencher are held in close proximity to each other by the hairpin stem, and the MBs do not fluoresce. However, at high temperatures the helical order of the stem gives way to a random-coil configuration, separati ng the fluorophore from the quencher, and thereby restoring fluorescence (Figure 6-7B1). This transition occurred at 84C. This experiment was repeated in the presence of a 5-fold excess of single-stranded loop targets that were perfectly complementary to the loop sequence in the MB. The results (Fig. 67A, green trace) shows that the resulting fluor escence is weak at low temperatures, but increases significantly as the temperature is slowly raised. The signal peaks at around 50 C and then diminishes significantly, follo wed by an increase in fluorescence at higher temperatures. Figure 6-7B2 summarizes th e phase transitions occurred. At low temperatures, MBs hybridize spontaneously to the target sequences that are complementary to the loop sequences. The fo rmation of MB/targe t hybrids exposes the

PAGE 156

139 sticky ends of MBs, leadi ng to the formation of [MB]n complexes through the sticky-end pairing process. Because the sticky-end pairs are relatively weaker than the probe-target helix and the hairpin stem, the [MB]n complexes will be disrupted and separated into individual MB/target duplexes as the temperature increases. Consequently, the fluorophores are unquenched and the fluores cence intensity increases accordingly. Continuing to raise the solution temperature de stabilizes probetarget duplexes, thus the MBs are released. The free MBs return to th eir closed conformation and the fluorescence decreases. As the temperature is raised further, the closed MBs melt into random coils(Figure 6-7B2), restoring their fluorescence. This transi tion occurred at the same temperature (84C) as the transition seen when the MB were incubated in the absence of targets. This experiment was also repeated in the presence of a 5-fold excess of sharedstem DNA targets that were complementary to the loop plus one of the arm sequences. Different changes in fluorescence were observe d as the temperature was raised (Figure 67A, red trace). The results show that the MB s fluoresce brightly at low temperatures, but as the temperature is slowly raised, fluorescence diminishes significantly, followed by an increase in fluorescence at the highest temp eratures. Figure 6-7B3 summarizes the phase transitions that occured. The difference between B2 and B3 is the formation of the [MB]n complexes as in the case of using loop ta rget sequences. Clearly, the SEP process decreases the overall signal change even wh en the target sequences are in excess and result in low signal enhancement even when most MBs are in opened state. The use of shared-stem target sequences effectively blocks SEP formation, leading to a higher signal enhancement and significant faster apparent hybridization kinetics.

PAGE 157

140 Figure 6-7. Blocking LNA-MB sticky-end pair ing with share-stem targets. (A) Thermal denaturation profiles of solution cont aining LNA-MB-E3 in the absence of target (blue), in the presence of 5-fold excess of loop complementary DNA targets (green), and in the presence of 5-fold excess of shared-stem complementary DNA targets (red). (B) Schematic representation of the phases for the MB solutions in the absence of target DNA (B1), in the presence of loop cDNA (B2), and in the presence of shared-stem cDNA(B3). 102030405060708090100 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 1.8 2.0 2.2 MB+Shared_Stem_cDNA MB+Loop_cDNA MBRelative Fluorescence IntensityTemperature (oC) + + + + + + B1 B2 B3

PAGE 158

141 Modified LNA-MBs Show Fast er Hybridization Kinetics The modified LNA-MBs show much faster hybridization kineti cs than the MB made of all LNA bases. The hybridizations of LNA-MBs with shared-stem targets were monitored. It was found that the less the L NA bases one beacon sequence has, the faster the hybridization rate is. Figure 6-8 comp ares the response of the DNA-MB, LNA-MBE0, LNA-MB-E1, and LNA-MB-E3 to the addi tion of target sequences. With less DNA bases being replaced by LNA bases (LNA-MB -E3), the hybridization rates of MBs are significantly increased. Although the hybridiza tion kinetics of DNA-MB still overrides those of LNA-MBs, within 15 minutes, the fluorescence signal enhancement ratio for LNA-MB-E1 is about 12, which meets the need for intracellular gene monitoring. 02468101214 0 2 4 6 8 10 12 14 16 18 Fluorescence intensity changeTime (min) DNA-MB LNA-MB-E0 LNA-MB-E1 LNA-MB-E3 Figure 6-8. Hybridization of DNA-MB and LNA-MBs to shared-stem target sequences.

PAGE 159

142 Minimal Binding of Single Strande d Binding Protein with LNA-MB Normal MBs are subject to nonspecific bindi ng of proteins, such as the ubiquitous single-stranded binding protein (SSB). Su ch binding causes normal DNA-MBs to give false positive signal due to stem-loop structur e instability. In a ddition, protein binding lowers the accessibility of MB s for hybridization to their target sequences. A nucleic acid probe immune to SSB binding will perform its analysis with higher accuracy and better targeting efficiency inside the cell, wh ere such proteins are highly abundant. Earlier, we showed that MBs with fully modified LNA bases had no response to the addition of excess SSB. For DNA/LNA chimeric MBs, new experiments need to be performed in order to see the effect of DNA/LNA ratio on SSB binding. Fluorescence measurements and gel electrophoresis experimen ts were carried out to study the binding of SSB to LNA-MBs. Agarose gel (3%) was used to visualize the SSB/MB complex. Due to the high molecular weight of SSB (74 kD ), SSB migrates slowly in the gel. The binding of the MB to SSB would significantly e xpedite the migration rate of the protein because of the multiple negative charges of nucleic acids. As shown in Figure 6-9, only one band was observed for a sample containi ng only SSB. The SSB barely migrated in the gel under the experimental conditions. When the DNA-MB was added to the SSB solution, an extra protein band with faster mi grating rate appeared while the intensity of the first band decreased. This clearly i ndicates the binding of SSB to DNA-MB. The SSB/MB complex band was observed for LNA-MB-E5, LNA-MB-E4, LNA-MB-E3, and LNA-MB-E2. No visible SSB/MB band was seen for LNA-MB-E1 and LAN-MB-E0. The binding of SSB to MBs was further confirmed by fluorescence measurements. The disruption of MB secondary structure due to SSB binding displaces the fluorophore from the proximity of the quencher molecule, result ing in increase of fluorescence. All the MB

PAGE 160

143 sequences except for LNA-MB-E1 and LNAMB-E0 had higher fluorescence intensity when excess SSB was added. For example, an approximate about four-fold increase in fluorescence signal was observed for L NA-MB-E3. Unfortunately, the signal enhancement is also affected by the purity of MBs; a small fraction of impurity could result in a different background signal and consequently different signal enhancement. Thus, the binding affinity could not be direc tly evaluated with the fluorescence intensity change. Further measurements of the signal change at different concentrations of an individual MB need to be perf ormed in order to measure the Kd of the corresponding probe to SSB. Nonetheless, the fluorescence measurements are consistent with the gel imaging results. Results from both assays s uggested no binding of SSB to MBs with all LNA or alternating DNA/LNA bases. Figure 6-9. Interactions between MBs a nd SSBs. (A) Gel electrophoresis of SSB solutions containing no MB (lane 1), DNAMB (lane 2), LNA-MB-E5 (lane 3), LNA-MB-E4 (lane 4), LNA-MB-E3 (lane 5), LNA-MB-E2 (lane 6), LNAMB-E1 (lane 7), and LNA-MB-E0 (lane 8). (B). Signal enhancement of MBs to the addition of the same concentration of SSB. SSB SSB/MB DNAE5E4E3E2E1E0 1.0 1.5 2.0 2.5 3.0 3.5 4.0 F(MB+SSB)/F(MB)

PAGE 161

144 Effect of LNA on Ribonuclease H Activity We have further studied the LNA-MB in the LNA effect on ribonuclease H activity. Ideal probes for targets in living cells should be stable inside the cell, should not induce the destruction or perturbation of their target, and should signal only at the presence of their target.31 MBs constructed from natura l deoxyribonucleotides are not suitable for the purpose of intracellular analys is because cellular nucleases can degrade them and cellular ribonuclease H can digest the target mRNA in the region where the probe is bound. RNase H (Ribonuclease H) is an endoribonuc lease that specifically hydrolyzes the phosphodiester bonds of RNA when it is hybrid ized to DNA. This enzyme does not digest single or double-stranded RNA. RNase H is found in both the nucleus and the cytoplasm of all cells and its normal functi on is to remove RNA primers from Okazaki fragments during DNA replication. Antisense RNase H activation has proved not only a powerful weapon in assessing gene function an emerging method of choice for antisense therapeutics as well. While favored in an tisense technology, RNase H activation is not favored in RNA monitoring. The action of RNase H on MB:RNA duplexes will lead to destruction of the target RNA and loss of signal due to reformation of MB hair-pin structure (Figure 6-10 left). Such cycle of hybridization, enzyme recognition, cleavage, and release of MB will repeat until all RNA is destroyed. As a result, no fluorescent signal can be observed even though there are plenty of RNA targets initially present. Use of MBs allowed for real-time mon itoring of RNase H activity. Figure 6-10 right shows the response of a DNA-MB to the sequential addition of target RNA, RNase H, and target DNA, respectively. The probe lit up with the introduc tion of target RNA in the solution. After reaching hybridization equilibrium, RNase H was added. An

PAGE 162

145 immediate decrease of the fluorescence si gnal from the probe was observed, which indicates the degradation of RNA on the MB:RNA duplex through enzyme cleavage and the reformation of MB hair-pin structur e. After enzyme digestion, the DNA-MB remained intact, as evidenced by its respons e to the addition of DNA target sequences. Thus, the MB will act as a cat alyst inside the cell to dest roy all target RNA sequences through RNase H degradation. Figure 6-10. Degradation of mRNA by RNase H. (Left)The hybrid ization of DNA-MB to its target mRNA forms MB/mRNA duplex, initiating RNase H action. The enzymatic cleavage breaks RNA in the dupl ex into pieces, releasing MB to restore to hair-pin structure and participa te in next cycle of hybridization and cleavage until all mRNA sequences are cl eaved. (Right)The response of 100 nM of DNA-MB to sequen tial addition of 100 nM of RNA targets, 12 units of RNase H and 100 nM of DNA targets. The series of LNA/DNA chimeric MBs enable the systematic study of the effect of LNA on the RNase H activity using fluorescen ce measurements. Insertion of LNA bases in every fifth base of DNA MB sequence slows down the degradation of RNA in the probe:target duplex as compared to the cas e in DNA-MB. Interestingly, the MB signal was not restored to its original level even after adding the same amount of target DNA. mRNA RNase H MB/mRNA hybrid Cleaved mRNA 0500100015002000 0.0 0.2 0.4 0.6 0.8 1.0 Fluorescence Intensity Change (Normalized)Time (Second) NormalMB

PAGE 163

146 When the DNA gap between LNA bases in a MB was shortened, the activity of RNase was further inhibited. For example, no signi ficant signal decrease was observed when the enzyme was added to the duplex of RNA with LAN-MB-E3, LNA-MB-E2, LNA-MBE1, and LNA-MB-E0. Ion exchange of a solution containing LNA-MB-E3, RNA, and RNase H further confirms the protecti on of RNA after overni ght incubation. RNA remained intact and there were no small pi eces of RNA cleavage fragements observed in HPLC (Figure 6-11). In contrast, for the mixture of DNA-MB, RNA and RNAse H sample, no RNA peak was observed, while di fferent lengths of RNA pieces for the mixture of DNA was seen (Figure 6-11). The results from both fluorescence measurement and IE-HPLC analysis suggested that the number of DNA bases in a stretch for an LNA-MB should be less than 3 in orde r to prevent significant cleavage of the target RNA. Figure 6-11. Ion exchange HPLC to monitor the RNase H cleavage of RNA in LNA-MBE3/RNA duplex (left) and in DNA-MB/RNA (right). LNA-MB-E3 RNA LNA-MB-E3+RNA LNA-MB-E3+RNA +RNase H DNA-MB RNA DNA-MB+RNA DNA-MB+RNA +RNase H

PAGE 164

147 Conclusions Ultrastable, sensitive, and selective mol ecular probes are of great interest and significance for deciphering life processes inside living cells. LNA has shown its interesting properties in nucleic acid base re cognition, such as hi gher affinity, greater selectivity, and better st ability than its DNA counterpart. To take full advantage of LNA based MBs for intracellular ap plications and to gain a better understand ing of LNAs effect on the behavior of MBs, we have synthesized and investigated a series of LNA/DNA chimeric MBs. These series of MB s allow us to systematically study the effect of the LNA/DNA ratio in molecular pr obes for their thermal st ability, hybridization kinetics, protein binding affin ity, and nuclease resistance. The number of LNA bases in a MB stem sequence has a significant effect on the stability of the hair-pin structure. The MB melting temperature was elevated by as high as 20 C by simply replacing one DNA pair to an LNA/LNA pair. A MB with 6-mer LNA stem has a melting temperature higher than 95C. The melting temperature of MBs was found to decrease with lower numbers of LNA bases in the stem. The hybridization rate of LNA-MBs coul d be significantly improved by lowering the LNA/DNA ratio in the probe. The lower th e percentage of LNA bases in a MB, the faster the hybridization kinetics. However, the most important f actor for improving the kinetics is to have a shared-stem cDNA design for the LNA-MB to prevent sticky-end pairing. The designed LNA-MBs can recognize th e part of the target nucleic acids which is complementary not only to th e loop section of the MB, but also to one of the stem sequences. The LNA-MB prepared with this strategy showed higher signal enhancements.

PAGE 165

148 The binding of LNA-MBs to SSB was also studied. It was found that only MB sequences with DNA/LNA alternating bases a nd all LNA bases are able to resist SSB binding. Further detailed studies need to be conducted on how the LNA modification changes the affinity of SSB binding to nucle ic acids. Finally, LNA-MBs with different numbers of DNA bases between two LNA bases enable a systematic study on the effect of LNA modification on the ac tivity of RNase H function. Our results indicate that a sequence consisting of a DNA stretch less than 3 bases between two LNA bases are able to block RNase H function. These findings ha ve great implications on the design of LNA molecular probes for intracellular diagnosis, th erapeutic, and basic biological studies.

PAGE 166

149 CHAPTER 7 HYBRID MOLECULAR PROBE FOR REAL-TIME NUCLEIC ACID ANALYSIS IN BIOLOGICAL SAMPLES Introduction Full deciphering of life processes demands th e study of biochemical events within living cells.1 Although current RNA analysis techniques, including in situ hybridization, northern analysis, RT-PCR, as well as microa rray technology have become powerful and indispensable tools in gene expression st udies, they reveal little dynamic information about RNA synthesis, transportation and localiz ation in living cells. To elucidate these important molecular events, RNA has to be observed in real-time and in its native environment. GFP fused RNA binding proteins157 have been successfully used for intracellular RNA tagging, but they require reco nstruction of transcription. The nucleic acid staining approach158 is simple but lacks specificity. Ideally, a RNA tagging molecular probe should be able to bind target RNA selectively and generate a distinguishable signal with high sensitivity. MBs (MBs)13 are promising in living cell nucleic acid monitoring. A hairpin structure probe, MB is a dual-l abeled oligonucleotide that only fluoresces in the presence of target sequences. The property of detectionwithout-separation makes MBs ideal probes for living cell m onitoring. Several attempts have been reported using MBs to monitor RNA in living cells with various degrees of success.29;33;35;159 However, when used in living cells, MBs generate false positive signals27 due to nuclease degrad ation, protein binding99 or thermodynamic fluctuations. False negative signal also exists as a resu lt of sticky-end pairing between hybridized

PAGE 167

150 MBs.160 Similar to MBs, Quenched Auto-Ligation (QUAL) probes161;162 were designed to be highly sequence specific for nuclei c acids and only fluoresce upon target binding. Unfortunately, QUAL probes suffer low temporal resolution due to the slow chemical reactions involved and false signals result ed from hydrolysis of the quencher. In this chapter, we will present a new design of molecular probe, called hybrid molecular probe,163 for nucleic acid monitoring with hi gh sensitivity and fast kinetics and without the false signals caused by the interac tions with complex solutions like those in cell cytoplasm. Experimental Section All DNA synthesis reagents were from Glen Research (Sterling, VA). All probes and DNAs were synthesized with an ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA). FAM CPG a nd Cy5 phosphoramidite were used for FAM and Cy5 labeling respectively. C18 Spacer phos phoramidite was used for the introduction of PEG. Ultra-mild deprotection phosphoramidites were used for probe synthesis, which allowed the probe to be deprotecte d by overnight incubation in 0.05M K2CO3/methanol. Ultra-mild deprotection avoids degrada tion of Cy5 by ammonia in the regular deprotection process. The solutions resulti ng from deprotection were precipitated in ethanol and the precipitates were then di ssolved in 0.5ml of 0.1 M triethylammonium acetate (pH7.0) for further purification with high-pressure liquid chromatography. The HPLC was performed on a ProStar HPLC Station (Varian, CA) equipped with a fluorescent and a photodiodearray detector. A C-18 reverse phase column (Alltech, C18, 5U, 250x4.6mm) was used.

PAGE 168

151 Table 7-1. Sequences of HMP probes and MB MBTBL and their targets. Name Sequence HMPTBL Cy5-CTC ATT TTG CTG ATG ACG-(PEG)n-CTG TCT GGG TAC TCC TCC-FAM Biotinylated HMP Cy5-CTC ATT TTG CTG ATG ACG-(PEG)8-Biotin2-(PEG)8-CTG TCT GGG TAC TCC TCC-FAM MBTBL FAM-CGC ACC TCC TCC CTC TTT TTG CTG GGT GCG DABCYL Target AT GCT CAT CAG CAA AAT GAG GGA GGA GTA CCC AGA CAG Target AA GCT CAT CAG CAA AAA GAG GGA GGA GTA CCC AGA CAG Target AG GCT CAT CAG CAA AAG GAG GGA GGA GTA CCC AGA CAG Target AC GCT CAT CAG CAA AAC GAG GGA GGA GTA CCC AGA CAG Random Seq TCT GTG TAA TCA ACT GGG AGA ATG TAA CTG ACT AGC Results and Discussions Design of Hybrid Molecular Probes. To meet the demand for sensitive and sele ctive monitoring of RNA inside cells and overcome limitations of existing molecular probes, we have developed a new type of nucleic acid probe, called hybrid molecular pr obes (HMP). The probe consists of two single-stranded DNA sequences tethered to two ends of a polyethylene glycol (PEG) polymer chain (Figure 7-1). The two singlestranded DNA sequences, typically 12 to 20 bases in length, are complementary to adjacen t areas of a target sequence in such a way that hybridization of the probe with the target brings the 5' and 3 ends of the probe in close proximity. Depending on the functional moieties labeled on the ends of the probe, the distance change between the probe termin i can be exploited by a variety of signaling approaches, including FRET,11 surface enhanced Raman scattering, and excimer light switching.7 In the case of FRET, a donor fluorophore is attached to one end of the probe and an acceptor fluorophore to the other. The two fluorophores will be away from each other in free form due to the random coil s tructure of these two DNA strands. Excited at donors excitation, only donor gives fluorescen ce emission. When target-binding event

PAGE 169

152 brings the donor and the acceptor in proxim ity, FRET occurs, resulting in the quenching of the donor fluorescence and the enhancement of the acceptor fluorescence. Figure 7-1. Working principle of a hybrid mo lecular probe. The probe consists of two single-stranded DNA sequence (green ribbons ) tethered to either ends of a polyethylene glycol (PEG) polymer li nker with a controlled length (purple ribbon). A donor fluorophore (Green ball) is attached to the 3 end and an acceptor fluorophore to the 5 end of the probe DNA. Due to the random coil structure of these two DNA strands in th e probe, the two fluorophores will be away from each other in the absence of a target nucleotide sequence. Excited at donors excitation, only donor gives fluorescence emission, while the acceptor has no emission because of the long distance between donor and acceptor. In the presence of a target, th is probe hybridizes to the target and brings two fluorophores in close proximity, which allows fluorescence resonance energy transfer (FRET) to occu r. Hence, target hybridization results in the quenching of the donor fluorophore and enhancement of the acceptor fluorescence. To demonstrate the principle, following se quence was synthesized to target Aplysia Tubulin mRNA(516-551): 5-Cy5-CTC ATT TTG CTG ATG AGC-(X)n-CTG TCT GGG TAC TCC TCC-FAM-3, where X stands for a PEG synthesizing monomer unit (Glen research), n represents the number of PEG monomer unit. Every PEG monomer

PAGE 170

153 unit has a length of about 22 and the PEG linke r is flexible allowing free movement of the two DNA sequences. Several criteria were considered when se lecting donor/acceptor pairs for the probe in order to ensure a high signal-to-background ratio. First, there should be a significant spectra overlap between these donor and acceptor dyes. Second, absorption of acceptor at donor excitation needs to be negligible. And finally, their fluorescence emission spectra should be comple tely separated and hence false positive signals from the acceptor is considerably reduced at the donor ex citation wavelength. Several dye pairs such as FAM/CY5, BODIPY FL/CY5, BODIPY FL/TEXAS RED, and CY3/CY5 meet these criteria. In addition, quantum dots can be used as bright and photostable donors in the probe to pair with a variety of fluorophores164 because of their broad excitation and narrow emission spectra. In this study, FAM and Cy5 were chosen. Hybridization of Hybrid Molecular Probe Figure 7-2 below shows the response of 300nM HMPTBL16 (a hybrid molecular probe targeting Tubulin mRNA with 16-unit spacer) to 300n M of its target DNA. When excited at 488 nm, the probe emitted strongly with a 515 nm peak in the absence of target DNA, while the cy5 emission at 655 nm was ne gligible. When target was added to the solution, because the two fluorophores were brought to close proximity, FRET occurred. As a consequence, fluorescence of FAM decreased and emission of Cy5 increased. This is an indication that this probe worked as expected. To confirm the response was due to specific DNA hybridization, and scrambled DNA se quences were used as a control target in the hybridization experiment. No signifi cant signal change was observed from the HMBTBL16 when same concentration of scrambled sequence was added, which suggested the positive response from cDNA was a result of DNA/DNA hybridization.

PAGE 171

154 050100150200250300350400 0 2 4 6 8 10 12 14 16 18 20 22 24 Normalized I665 nm/I515nmTime (s) Target DNA Random DNA Figure 7-2. Hybridization of 300nM of HMPTBL16 to 300nM of its Target DNA and Control in 20mM Tris-HCl buffer (50 mM NaCl, 5 mM MgCl2, pH 7.5). Probe sequence: Cy5-CTC ATT TTG CTG ATG AGC (X)16CTG TCT GGG TAC TCC TCC-FAM. Target sequencer: GCT CAT CAG CAA AAT GAG GGA GGA GTA CCC AGA CAG. Control Sequence: TCT GTG TAA TCA ACT GGG AGA ATG TAA CTG ACT AGC. Excitation=488 nm. T=25 C. Data shown in Figure 7-2 reveals two impo rtant advantages of the HMP: detectionwithout-separation and ratiometric measurement. The fluorescence intensity ratio of CY5/FAM from free probe is very low. By con trast, when hybridized to its target, the ratio of CY5/FAM is high. This light-up si gnaling approach allows this probe to detect the presence of target sequence without any need of removing unbound probe. This detection-without-separation method elim inates tedious washing and separating procedures. More importantly, it affords real-tim e detection, which is desirable as a probe for detection in living cells. Another advantag e of this probe is that it uses ratiometric measurement. By taking intensity ratios of the CY5 emission to FAM emission, one could effectively eliminate signal fluctuation and minimize the impact of environmental quenching on the accuracy of measurement.

PAGE 172

155 Optimization of PEG Linker Length PEG was used in the probe design because it is easy to synthesize, has a controllable length, is non-toxic, and has good water solubility. The highly flexible PEG chain should not interfere with DNA hybrid ization as long as the linker length is appropriate. The linker in HMP tethers two DNA sequences together, helping them bind to one target molecule instead of two different target molecules. This tethering also facilitates the hybridization of the probes to the target, as one binding probe will bring the other close to the target for hybridization. Such a synergetic effect also results in a better probe/target binding. Indeed, the Tm of HMP/target duplex was found to be about 20C higher than that of a hybrid of target with two separate probes without a linker. The HMP also showed a larger linear dynamic response to its target than th at for two separate probes without a linker.165 As showed in Figure 7-3, signal response from HMPTBL16 was proportional to target DNA concentrations ranging from 0 to 500nM. By contrast, two DNA probes without a linker were titrated with the same target DNA. For two probes without the linker, the fluorescence intens ity ratio 665nm/515nm decreased when the target to probe ratio was larger that 1 to 1 ratio. This is consistent with data reported.165 This nonlinear response shows the disadvantag e of this two probe system. This nonlinear response at high target concentration comes from the fact that the two probes tend to bind to two separated target DNA sequences when th e target is in excess. In contrast, the linear FRET probe uses a linker to tether tw o individual sequences together, increasing local concentrations of each of them, ensuring two individual DNA sequences in the same probe bind to a same target DNA sequence. As a consequence, even at higher target to probe concentration ratios, the signal res ponse is still close to linear. The dual FRET MB approach has been developed to reduce false positive signal for MB in mRNA

PAGE 173

156 imaging in living cells.27 However, one major problem in using the dual FRET beacon approach is the chance of getting two beacons binding two adjacent areas is low and thus nonlinear signal response at high target con centration. A HMP which uses a PEG linker to tether two MBs could effectively solve the aforementioned problem. Another function of PEG linker is to provide a scaffold for th e insertion of functional moieties such as biotins for immobilization of HMP, large mo lecular tags to prevent the probe from nucleus sequestering, or cell membrane pene trating peptides for probe delivery purpose. 0100200300400500 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 Fluorescence Intensity Ratio 665nm/515nmTarget Conctration (nM) 300nM of HMBTBL16 (with linker) 300nM of probes without linker Figure 7-3. Titration of 300 nM HMPTBL16 an d 300 probes without a linker with target DNA. 20mM Tris-HCl buffer (50 mM NaCl, 5 mM MgCl2, pH 7.5). HMPTBL16 sequence: Cy5-CTC ATT TTG CTG ATG AGC (X)16CTG TCT GGG TAC TCC TCC-FAM. Probes with out linker consists of two probe sequences with following sequences respectively: Cy5-CTC ATT TTG CTG ATG AGC and CTG TCT GGG TAC TCC TCC-FAM. Target sequencer: GCT CAT CAG CAA AAT GAG GGA GGA GTA CCC AGA CAG. Excitation=488 nm. T=25 C. The length of this spacer should be carefully optimized to allow these two sequences freely to bind to their target, while still allowing the two sequences to have relatively high local concentration to each other. Four probes, HMPTBL8, HMPTBL12,

PAGE 174

157 HMPTBL16 and HMPTBL20, were prepared. The number in the probe name indicates the number of PEG monomer units in the probe. HMPTBL8HMPTBL12HMPTBL16HMPTBL20 0 5 10 15 20 25 Enhancement of Intensity(665nm/515nm) Figure 7-4. Effect of spacer length on the hybr idization of linear FRET probe to its target As shown in Figure 7-4, when only 8 repeat PEG units were used, as high as 7-fold of signal enhancement was observed. An incr ease in signal enhancement was observed when the PEG spacer length increased. There are two factors that make probes with short linkers unfavorable for good signal enhancem ent. First, FRET could occur between acceptor and donor, which would contribute to background signal from unbound probe. For instance, HMPTBL8 has 30 bases and 8 PEG units, the distance between two fluorophores could be as high as 27.6 nm if th e probe was fully stretched. However, the distance was shorter because free probe tended to be in coiled forms. Secondly, when the spacer length was short, it hi ndered those two DNA sequence to hybridize to its target, weakening probe-target hybrid stability. This doesnt mean the longer the spacer the better. When the spacer is too long, KLP20, the probe with 20 PEG units for example, it decreased the local concentra tion of one DNA to the other on the same probe, lowering

PAGE 175

158 the chance of two probes binding to the sa me target sequence. As a consequence, HMPTBL20 had a slightly lower signal enhancement than HMPTBL16. Optimization of Acceptor-Donor Distance The optimization of the acceptor-donor dist ance was carried out with a goal to minimize static quenching, while maximizing FRET efficiency. Binding of the probe to its target, as designed, will bring acceptor a nd donor in close proximity allowing FRET to happen. In the case of FRET, the closer two fluorophores are, the higher the energy transferring efficiency. On the other hand, if two fluorophores get too close to each other, static quenching will occur which will quench both fluorophores. To get the best signal enhancement, it is important to optimize the distance between these two fluorophores. Different numbers of dTs were inserted into a DNA sequence complementary to the linear probe so that the distance of the accep tor and donor varied once the probe bound to these DNAs. Table 2 shows the sequences that were used in this experiment. For FAM/CY5 pair no static quenching was obs erved (Figure 7-5). Instead, the FRET efficiency decreases exponentially with an in crease of FAM/CY5 distance in target/probe hybrid. 0T1T3T5T7T 0 2 4 6 8 10 12 14 Signal Enhancement Figure 7-5. Acceptor-donor distance optimization

PAGE 176

159 Table 7-2. Target DNA sequence with different numbers of dT HMP for Surface DNA Hybridization Study. One of the advantages of the newly designed probe over conventional two-probe FRET system or dual FRET MBs design is la rger dynamic range. Another advantage of using linear probe is that it can be used fo r surface hybridization applications such as fiber optic DNA sensor, DNA array, as well as microchannel for nucleic acid detection (Figure 7-6). Figure 7-6. Immobilization of hybrid molecu lar probe on solid surface for nucleic acid detection. A HMP probe was prepared with the same sequence as HMPTBL except that there were two biotins inserted in the middle of linker PEG units. Two biotins were used for one sequence to improve the binding effi ciency. Before immobilization onto a streptavidin-coated surface, solution tests were performed, which showed similar signal response of the probe to the probe without biot in. This indicated that biotin in between the linker did not interfere the binding of probe to its target. Figure 7-7 shows the 0T Target GCT CAT CAG CAA AAT GAG GGAGGAGTACCCAGACAG 1T Target GCT CAT CAG CAA AAT GAG T GGAGGAGTACCCAGACAG 3T Target GCT CAT CAG CAA AAT GAG TTT GGAGGAGTACCCAGACAG 5T Target GCT CAT CAG CAA AAT GAG TTT TT GGAGGAGTACCCAGACAG 7T Target GCT CAT CAG CA A AAT GAG TTTTTTTGGAGGAGTACCCAGACAG Target hv hv hv hv

PAGE 177

160 response of the immobilized probe upon th e addition of target DNA. The surface was excited at 488nm, and the images were monitored at two emission channels specific for FAM and Cy5 respectively. Before hybridi zation, fluorescence signal from FAM was strong and weak emission from Cy5 was obser ved. Immediately after addition of c-DNA, the intensity of FAM diminished and the in tensity of Cy5 increased as a result of hybridization. Overall, fluorescent intensity ratios of Cy5/FAM increased dramatically. From the intensity result, large fluctuations for both Cy5 and FAM was observed. This fluctuation was a result of disturbances in the detection system. By using ratiometric analysis, these noises were cancelled out and smooth hybridiza tion results were observed. With ratiometric measurement cap ability, the new DNA probe design removes the internal fluctuations of the detection system, allowing a more precise detection. 01503004506007509001050120013501500 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 Fluorescein IntensityTime(Second) CY5/FAM Figure 7-7 Hybridization of surface immobilized HMP to its target DNA. Buffer: 20mM Tris-HCl (pH7.5), 50mM NaCl, 5mM of MgCl2. Comparison of Hybrid Molecular Probe with MBs MBs have excellent selectivity with single base mismatched discrimination capability. A MB targeting the same target sequence as HMPTBL16 was prepared and

PAGE 178

161 used in single based mismatch detection e xperiments. Figure 8 shows the response of 300 nM the MB to 300nM of different targets. Under experimental conditions, perfect match cDNA was able to produce a signal change of about 8.5 fold. With same concentration, one base mismatch target produced less signal change. When T was replaced by G, target DNA changed signal about 4.5 fold. With A re placing T in the target sequence, target DNA produced about 5.5 times of signal change. Being the less, target DNA with C replacing T, produced only about 2.5 fold in crease. In case of HMP, it generated about 20 fold increase in signal upon hybridized to perfect match target DNA. While one base mismatch, AT, AC, and AG targets showed about 12.5,11,14 times signal change, respectively. Overall, under the same experim ental conditions, the signal enhancement of hybrid molecular probe is higher than MB and the selectivity of hybrid molecular probe is slightly lower than that of MBs. The se lectivity of molecular probe, on the other hand, could be improved by changing the DNA seque nces with a hair-p in structure. AAACAGAT 0 1 2 3 4 5 6 7 8 9 Signal Enhancement AAACAGAT 0 5 10 15 20 Signal Enhancement Figure 7-8 Hybridization result of 300nM of MB (left) and 300nM HMPTBL16 (right) to same concentration of their targets. AT stands for the perfect match target. Buffer: 16mM Tis-HCl (pH7.5), 40mM NaCl, 4mM MgCl2 and 20% DMF For MB, one of its disadvantages is that it gives false-positive signal after protein binding, enzyme digestion, or thermal dena turing. By contrast, hybrid molecular probe

PAGE 179

162 gives minimal positive signal caused by these f actors. Figure 7-9 compares the response of the MB and HMP to target DNA and nucleases. For HMP, no false positive was observed when nuclease was added to the so lution. By contrast, digestion of MBs by nucleases caused high false pos itive signal that is undistin guishable from true target binding signal. Figure 7-9 shows a faster hybridization rate the HMP displayed than the MB did. Unlike HMP, MBs have to overco me the energy barrier for dehybridizing the self-complementary stem before hybrizing to its target sequence, which slows down the hybridization. Similarly, it was found that MB gave a false signal when SSB was added, while negligible responses were observed for the HMPTBL16. 075150225300375450525600675750 0 2 4 6 8 10 12 14 16 Signal ChangesTime (Second) Tublin MB-CDNA Tublin MB-DNase Tublin HMP-CDNA Tublin HMP-DNase Figure 7-9 Response of 300nM HMP and 300 nM MBs to 300nM target cDNA and 3g/ml DNase in 20mM Tris-HCl buffer (50 mM NaCl, 5 mM MgCl2, pH 7.5)

PAGE 180

163 0200400600800100012001400 0 25 50 75 100 125 150 175 200 225 250 (b)Fluorescence IntensityTime (Second) MBTBL+Cell lasate MBTBL+Cell lysate+cDNA 0501001502002503003504004505000.020 0.025 0.030 0.035 0.040 0.045 0.050 0.055 (c)Cy5/FAMTime (Second) HMPTBL + Cell Lysate HMPTBL+ Cell Lysate+cDNA Figure 7-10. Response of MB and HMP to non-specific interactions. Response of 300nM HMPTBL (right) and MBTBL (Left) to cell lysate w/ and w/o cDNA. The performance of both HMP and MB were further tested with cancer cell (CEM) lysate. Blast results against human genome precluded positive response of probes for the CEM cell lysate. However, MBTBL responded immediately after th e addition of cell lysate. With no target sequence in the syst em, this false positive response could have resulted from nuclease digestion or nonsp ecific protein bindings. Conversely, the HMPTBL didnt give any significant signal chan ge when cell lysate was added. The false positive result from MB compromised its ability to detect nucleic acid targets in a cellular enviroment. It failed to differentiate cell lysate containing cDNA from cell lysate w/o cDNA (Figure 7-10). While for the HMP, th e cell lysate itself did not cause any significant signal, and the cel l lysate with cDNA induced an intense and immediate response. Conclusions In conclusion, the developed HMP responds specifically to its complementary sequence. It allows a rapid detection of nucle ic acid target in complex sample matrix. This new probe is similar to MB in the followi ng aspects: 1) Both are light-up probes; 2) Both can detect unlabeled target without separation; 3) Both are very sensitive and

PAGE 181

164 selective in monitoring nucleic acid targets. Compared to MBs, however, this new probe has its own advantages. First, it is easier to design and synthesize. Not every MB designed based on target sequence and then synthesized can detect its target 18, but the HMP can. Second, HMP does not generate a ny false-positive signal upon digestion by nuclease, binding by proteins, forming complexes by sticky-end paring, or by other factors. HMP is capable of selectively detecting targets from cellular samples. In addition, the signal generation in HMP can be easily made with ratiometric measurement, minimizing effect of system fluctuations. Pr eliminary applications of HMP are underway in monitoring the expression and trafficki ng of mRNA in single living cells and in developing DNA/mRNA biosensors and bioc hips for biotechnology and bioimaging.

PAGE 182

165 CHAPTER 8 SUMMARY AND FUTURE DIRECTIONS Engineering Molecular Probes for Bioanlysis and Intracellular Imaging Complete deciphering of life processes de mand the study of molecular interaction in the context of living cells. The key to the successful st udy of these complex interactions is the use of molecular probes. Currently, there are limitations for intracellular probes such as low sensitivity, reduced selectivity, and poor stability. Using molecular beacons as model probes, this research attempted to address these challenges by integrating molecular engineering techni ques with new signaling materials and approaches to design more sens itive and effective probes. To develop sensitive molecular probes, novel materials were explored for signal amplification and background reduction. C onjugated polymers are good candidates for signal amplification because of their excel lent light harvesting and superquenching properties. In order to be useful in bioanaly sis, the polymer must be conjugated with a biomolecule. However, controlled coupling of these polymers to biomolecules is difficult. A solid phase synthesis met hod was developed to couple a fluorescent conjugated polymer with an oligonucleoti de through direct polymerization of the monomers and oligomers on a DNA strand.74 Coupling was achieved by carrying out the PPE polymerization reaction in the presence of a 5I-dU terminated oligonucleotide linked to a CPG support. The product, DNA-PPE, can be easily separated from free PPE by centrifugation. The conjugation reaction is simple, fast and easily controllable. The coupling efficiency between the PPE and the DNA is high. Mass spectroscopy analysis

PAGE 183

166 and DNA hybridization study results indicated that polymerization conditions were so mild that the DNA exposed to polymerization not only remained structurally intact, but also kept its bio-recognition capability. This new method makes it possible for efficiently coupling fluorescent amplifying polymers with biomolecules for bioanalysis and biosensor applications. To examine the use of conjugated polymers for DNA sensing, a molecular beacon with a conjugated polymer chain as the signaling element was prepared. This molecular beacon gave strong fluorescence signal sp ecifically for the complementary sequence and showed promising results in bioanalysis. In addition to exploring new signaling ma terials for brighter probe signal, this research addressed the concern of probe b ackground problem. The third chapter of the dissertation investigated the feasibility of using a multiple-quencher approach to improve quenching efficiency of quenchers for fl uorophores in molecular beacon design. Two ways to label a number of quencher molecu les to a molecular beacon sequence were developed and compared. Both approaches indicated that increasing the number of quenchers in MBs significantly increases the signal-to-back ground ratio of the probe by increasing the quenching efficiency of the que ncher moiety for the probe. Compared to the internal labeling approach, the end labeling of multiple quenchers through dendrimeric linker exhibited the following a dvantages: easy synthesis, high coupling yields, no observable adverse effect on the st em stability, greater flexibility for stem design, and wider selection of fluor ophore and quenchers combinations. The Superquenchers assembled from the second method show unique properties for use in engineering molecular probes. First, comp ared with a regular MB, a Superquencher constructed MB had higher sensitivity, bett er purity, and greater thermal stability.

PAGE 184

167 Second, the assembly scheme can be widely useful for different types of quencher molecules. Third, the SQ can be used for di fferent fluorophores and in different probes.79 The approach of assembling superquenchers can effectively improve the sensitivity of a variety of fluorescent assays a nd can be widely useful for molecular interaction studies. To overcome the problem of autofluo rescence from biological fluids, a new signaling approach called the excimer lig ht switching signaling technique was developed.7 Chapter 4 reported the engineering of light switching excimer aptamer probes for rapid and sensitive detection of a cancer biomarker protein-platelet derived growth factor (PDGF). Labeled with one pyr ene at each end, the aptamer switches its fluorescence emission from around 400nm (pyr ene monomer) to 485nm (pyrene excimer) upon PDGF binding. This fluorescence wavele ngth change from monomer to excimer emission is a result of aptamer conformati on rearrangement induced by target binding. The excimer probe is able to effectively de tect picomolar concentrations of PDGF in homogeneous solutions and with the naked eye. As the excimer has a much longer fluorescence lifetime (~40ns) than that of the background fluorescence (~5ns), timeresolved measurements were used to elim inate the biological background. PDGF were thus able to be detected in cell media wit hout any sample pretreatment. This molecular engineering strategy can be used to devel op other aptamer probes for protein and ion monitoring. Combined with lifetime based measurements and molecular engineering, light-switching excimer aptamer probes hold great potential for protein analysis in future biomedical studies. Chapter 5 extended the excimer signaling and time-gate measurement method to nucleic acid analysis. Macromolecules with 1, 2, 3, and 4 pyrenes were assembled using

PAGE 185

168 dendrimeric linkers for MB labeling. It wa s found that the quantum yield of excimer emission increases with the number of pyrene molecule assembled. The long fluorescence lifetime of pyrene excimer allowe d quantitative detection of trace amounts of nucleic acid targets in complex biological fluids. In Chapter 6, the stability of nucleic acid probes was addressed. When used intracellular applications, norma l nucleic acid probes are prone to enzymatic digestion, protein binding, and elicitation of RNase H action, all of which lead to nonspecific signals. The possibility of alleviating thes e issues by using locked nucleic acid (LNA) bases in the molecular probe design was investigated.152;153 Studies from a MB fully modified with LNA revealed several appeal ing properties: 1) hi gh thermostability and strong binding affinity; 2) excellent single base mismatch discrimination capability; and 3) strong resistance to nuclease degradati on. Such an all-LNA MB, however, showed slow hybridization kinetics, with is undesirable for intracellular imaging applications. To fully take advantage of the LNA properties a nd optimize the probe kinetics, a series of LNA/DNA chimeric MBs were synthesized and used to investigate the effect of LNA/DNA ratio in molecular probes on thei r thermodynamics, hybridization kinetics, protein binding affinity, and enzymatic resi stance. It was found that the LNA bases in a MB stem sequence have a significant effect on the stability of the hair-pin structure and the hybridization rate. The hyb ridization rate of LNA-MB s could be significantly improved by lowering the LNA/DNA ratio in the probe, or most significantly, by having a shared-stem design for the LNA-MB to prevent sticky-end pairing. Other studies indicated that only MB sequen ces with DNA/LNA alternating bases or all LNA bases are able to resist nonspecific protein binding. Additional results showed that a sequence

PAGE 186

169 consisting of a DNA stretch of less than 3 bases between LNA bases are able to block RNase H function. These findings have impo rtant implications in the design of LNA molecular probes for intracellular diagnosis, therapeutic, and basic biological studies. The false signal problems of molecula r probes were also addressed by designing probes with new formats as shown in Chapter 7. In this chapter, we reported the design and synthesis of a hybrid molecular probe (HMP) for intracellular nucleic acid monitoring to overcome false positive signal problems of molecular beacons. HMP has two DNA sequences, one labeled with a donor and the other an accep tor fluorophore. The two DNA probes are linked by a poly(ethylene glycol) (PEG) linker, with each DNA being complementary to adjacent areas of a ta rget sequence. Target binding event brings the donor and acceptor in proximity, resulting in quenching of the donor fluorescence and enhancement of the acceptor emission. Th e newly designed HMP has high sensitivity, selectivity, and fast hybridization kinetics. The probe is easy to design and synthesize. HMP does not generate any false positive si gnal upon digestion by nuclease, binding by proteins, forming complexes by sticky-end pa iring, or by other molecular interaction processes. HMP is capable of selectively detecting nucleic acid targets from cellular samples. Future Directions Exploration of New Material s for Signal Amplification Introducing new fluorescent materials capable of amplifying signals for molecular recognition events will continue to be essent ial to address the gr owing need for highly sensitive bioanalysis. Among many new promising materials, nanoparticles such as dye doped nanoparticles and quantum dots have be en insensitively inve stigated for signal amplification in bioanalysis.

PAGE 187

170 Semiconductor quantum dots (QDs) are extremely attractive fluorescent materials for biosensing applications.166-175 Compared to organic fluo rophores, QDs have several unique properties, including size and com position-tunable fluorescence emission, high extinction coefficients, large absorption across a wide spectral range, narrow emission spectra, and very high levels of brightness a nd photostability. Thes e desirable features make QDs promising alternative signal amplification materials to construct molecular probes. During the past six years, QD have also been used as biological labels in a variety of bioassays, 166-175 some of which would not have been possible with conventional fluorophores. In vitro bioanalytical assa ys were developed by using QD-tagged antibodies fluorescence resonance energy transf er (FRET)QD biosensors as well as by using QD-encoded microbeads. In addition to solution-based assays, the spectroscopic advantages of QD should also benefit sensitiv e optical imaging in living cells and animal models. In FRET assay, the problem is that the fluorescence of QDs can not be effectively quenched by a quencher. Such an incomplete quenching hinders the application of QD in FRET based molecular probes. The Superquencher assembling approach could be an effective way to discover effective quenchers for QDs. The feasibility of using QD-based fluorescence resonance energy transfer (FR ET) to amplify biomolecular recognition signals combined with Superquencher could be explored. The new strategies that use QDs and Superquenchers for signal amplifica tion of molecular recognition events will allow us to construct a variety of highly sens itive and photostable probe s in bioanalysis.

PAGE 188

171 Development of New Probes with Better Stability, Selectivity and Kinectics Chapter 6 discusses the property of L NA-MBs. MBs with alternating LNA/DNA bases shows high affinity, good nuclease stabi lity, excellent resistance to nonspecific protein binding, low protein binding affinity all of which are attractive for intracellular applications. Despite these advantages, there are two aspects of LN A-MBs that could be further improved, selectivity and hybridization kinetics. Questions about the selectivity of MB aris es from concern that the arm sequences in the MBs are prone to fortu itously participate in random binding, thus constituting a potential source of false positive results.176 A solution to this problem is to replace the stem part of a MB by an oligonucleotide pairing system that is orthogonal and consequently does not cross pair with DNA or RNA. Known pairing systems with such properties are, for example, isoC:isoG177 and enantio-DNA (L-DNA).178-183 Such a replacement, would allow the MB stem resist any invasion by adventitious nucleic acids built from AT(U)GC. Preliminary result indicates that shor tening stem length of MB could improve hybridization kinectics of LNA-MBs. Howeve r, a MB with short stem has a higher probability to be opened by any other sequences possing a segmentcomplementary to one of the arms of the stem, leading to n onspecific opening of the MB by non-target sequences. Another drawback is associated with the short stem design is higher probe background. Careful design of MBs stem will present an effective way to solve both of these problems. Such a stem should be built form monomer pairs that can resist enzyme digestion, resist nonspecifi c protein binding, bind weakly with nature bases and thermostable yet possess a fast dehybridizat ion rate. L-DNA meets these criteria well and

PAGE 189

172 thus engineering an MB consisting a loop with alternating DNA/LNA base178-183 and a stem with L-DNA could be an one-stone-for-two-birds solution. O O P O O O OB O B O P O O OO D-DNA L-DNA Figure 8-1. Structure of D-DNA and L-DNA All naturally occurring nucleic acids are composed of D-nucleotides. With different chirality, Non-natural L-DNA (Figure 8-1) should escape from enzymatic recognition and subsequent degradation as well as protein bindings.178-183 It has been reported LDNA resists nuclease digestion and binds weekly to D-DNA and D-RNA. We have synthesized a MB with L-DNA. Hybridization results showed that the opening of the MB by loop cDNA target is faster than a DNA-MB, although the L-DNA stem MB had a stem 5oC more stable than the regular DNA-MB Considering all these factors, a MB with alternating DNA/LNA base loop an d a L-DNA stem could have following properties: high nuclease stability, immune to nonspecific binding, resistant to opening of stem by adventitious nucleic acids, higher stem thermostability, faster hybridization kinetics, and better single base mismatched discrimination capability. Furthermore, the

PAGE 190

173 weak interactions between DNA and L-DNA pr event the interacti on between the loop sequence and the stem sequences, ma king the design of MB easier.

PAGE 191

174 LIST OF REFERENCES (1) Cook, B. N.; Bertozzi, C. R. Bioorganic & Medicinal Chemistry 2002, 10, 829840. (2) Xie, X. S.; Yu, J.; Yang, W. Y. Science 2006, 312, 228-230. (3) Shav-Tal, Y.; Singer, R. H.; Darzacq, X. Nature Reviews Molecular Cell Biology 2004, 5, 855-862. (4) Robertson, D. L.; Joyce, G. F. Nature 1990, 344, 467-468. (5) Tuerk, C.; Gold, L. Science 1990, 249, 505-510. (6) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-822. (7) Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan, W. H. Proc.Natl.Acad.Sci.U.S.A. 2005, 102, 17278-17283. (8) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49, 6123-6194. (9) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1992, 48, 2223-2311. (10) Ingle, J. D.; Crouch Stanley R. Spectrochemical Analysis; Prentice Hall / New Jersey: 1988; p 704. (11) Lakowicz, J. R. Principles of Fluorescent Spectroscopy; Kluwer Academic / Plenum Publishers, New York: 1999. (12) Tyagi, S.; Bratu, D. P.; Kramer, F. R. Nat.Biotechnol. 1998, 16, 49-53. (13) Tyagi, S.; Kramer, F. R. Nat.Biotechnol. 1996, 14, 303-308. (14) Birks, J. B. Photophysics of Aromatic Molecule s (Wiley Monographs in Chemical Physics); 1970; p 704. (15) Winnik, F. M. Chem.Rev. 1993, 93, 587-614. (16) Fujimoto, K.; Shimizu, H.; Inouye, M. J.Org.Chem. 2004, 69, 3271-3275. (17) Dahim, M.; Mizuno, N. K.; Li, X. M.; Momsen, W. E.; Momsen, M. M.; Brockman, H. L. Biophys.J 2002, 83, 1511-1524.

PAGE 192

175 (18) Pagano, R. E.; Martin, O. C.; Kang, H. C.; Haugland, R. P. J.Cell Biol. 1991, 113, 1267-1279. (19) Fang, X. H.; Cao, Z. H.; Beck, T.; Tan, W. H. Anal.Chem. 2001, 73, 5752-5757. (20) Fang, X. H.; Sen, A.; Vicens, M.; Tan, W. H. Chembiochem 2003, 4, 829-834. (21) Green, L. S.; Jellinek, D.; Jenison, R.; Ostman, A.; Heldin, C. H.; Janjic, N. Biochemistry (Mosc). 1996, 35, 14413-14424. (22) Stojanovic, M. N.; de Prada, P.; Landry, D. W. J.Am.Chem.Soc. 2001, 123, 49284931. (23) Paborsky, L. R.; McCurdy, S. N.; G riffin, L. C.; Toole, J. J.; Leung, L. L. J.Biol.Chem. 1993, 268, 20808-20811. (24) Hamaguchi, N.; Ellington, A.; Stanton, M. Anal.Biochem. 2001, 294, 126-131. (25) Dirks, R. W.; Molenaar, C.; Tanke, H. J. Methods 2003, 29, 51-57. (26) Golzio, M.; Rols, M. P.; Teissie, J. Methods 2004, 33, 126-135. (27) Santangelo, P. J.; Ni x, B.; Tsourkas, A.; Bao, G. Nucleic Acids Res. 2004, 32. (28) Nitin, N.; Santangelo, P. J. ; Kim, G.; Nie, S. M.; Bao, G. Nucleic Acids Res. 2004, 32. (29) Perlette, J.; Tan, W. H. Anal.Chem. 2001, 73, 5544-5550. (30) Sokol, D. L.; Zhang, X. L.; Lu, P. Z.; Gewitz, A. M. Proc.Natl.Acad.Sci.U.S.A. 1998, 95, 11538-11543. (31) Bratu, D. P.; Cha, B. J.; Mhlanga, M. M.; Kramer, F. R.; Tyagi, S. Proc.Natl.Acad.Sci.U.S.A. 2003, 100, 13308-13313. (32) Cui, Z. Q.; Zhang, Z. P.; Zhang, X. E.; Wen, J. K.; Zhou, Y. F.; Xie, W. H. Nucleic Acids Res. 2005, 33, 3245-3252. (33) Santangelo, P.; Nitin, N.; Bao, G. Journal of Biomedical Optics 2005, 10. (34) Drake, T. J.; Medley, C. D.; Rogers R.J.; Tan W.H. Chembiochem 2005, Accepted. (35) Medley, C. D.; Drake, T. J.; Toma sini, J. M.; Rogers, R. J.; Tan, W. H. Anal.Chem. 2005, 77, 4713-4718. (36) Nutiu, R.; Li, Y. F. J.Am.Chem.Soc. 2003, 125, 4771-4778. (37) Nutiu, R.; Li, Y. F. Chem.-Eur.J. 2004, 10, 1868-1876.

PAGE 193

176 (38) Yamamoto, R.; Baba, T.; Kumar, P. K. R. Genes Cells 2000, 5, 523. (39) Bayer, T. S.; Smolke, C. D. Nature Biotechnol. 2005, 23, 337-343. (40) Cox, J. C.; Ellington, A. D. Bioorg.Med.Chem. 2001, 9, 2525-2531. (41) Nutiu, R.; Li, Y. F. Angew.Chem.Int.Ed. 2005, 44, 1061-1065. (42) Jhaveri, S.; Rajendran, M.; Ellington, A. D. Nature Biotechnol. 2000, 18, 12931297. (43) Sokol, D. L.; Zhang, X. L.; Lu, P. Z.; Gewitz, A. M. Proc.Natl.Acad.Sci.U.S.A. 1998, 95, 11538-11543. (44) Yang, C. Y. J.; Medley, C. D.; Tan, W. H. Current Pharmaceutical Biotechnology 2005, 6, 445-452. (45) Hirschfeld, T.; Callis, J. B.; Kowalski, B. R. Science 1984, 226, 312-318. (46) Swager, T. M. Accounts of Chemical Research 1998, 31, 201-207. (47) McQuade, D. T.; Pullen, A. E.; Swager, T. M. Chem.Rev. 2000, 100, 2537-2574. (48) Gaylord, B. S.; Heeger, A. J.; Bazan, G. C. Journal of the American Chemical Society 2003, 125, 896-900. (49) Pinto, M. R.; Schanze, K. S. Proceedings of the National Academy of Sciences of the United States of America 2004, 101, 7505-7510. (50) Bunz, U. H. F. Chemical Reviews 2000, 100, 1605-1644. (51) H.M.Huang; K.M.Wang; W.H.Tan; D.L.An; X.H.Yang; S.S.Huang; Q.J.Zhai; L.J.Zhou; Y.Jin Angewandte Chemie Inter.Ed. 2004, 43, 5635-5638. (52) Wang, S.; Bazan, G. C. Advanced Materials 2003, 15, 1425-1428. (53) Tan, C. Y.; Pinto, M. R.; Schanze, K. S. Chemical Communications 2002, 446447. (54) Kushon, S. A.; Bradford, K.; Marin, V.; Suhrada, C.; Armitage, B. A.; McBranch, D.; Whitten, D. Langmuir 2003, 19, 6456-6464. (55) Gaylord, B. S.; Heeger, A. J.; Bazan, G. C. Proc.Nat.Acad.Sci.USA. 2002, 99, 10954-10957. (56) Liu, Y.; Jiang, S. J.; Schanze, K. S. Chemical Communications 2003, 650-651. (57) Jones, R. M.; Bergstedt, T. S.; Buscher, C. T.; McBranch, D.; Whitten, D. Langmuir 2001, 17, 2568-2571.

PAGE 194

177 (58) Kushon, S. A.; Ley, K. D.; Bradfo rd, K.; Jones, R. M.; McBranch, D.; Whitten, D. Langmuir 2002, 18, 7245-7249. (59) Hide, F.; Schwartz, B. J.; Diaz-Garcia, M. A.; Heeger, A. J. Synthetic Metals 1997, 91, 35-40. (60) Lu, L. D.; Jones, R. M.; Helgeson, R.; McBranch, D.; Whitten, D. Abstracts of Papers of the Americ an Chemical Society 2002, 223, D59. (61) Chen, L. H.; McBranch, D. W.; Wang H. L.; Helgeson, R.; Wudl, F.; Whitten, D. G. Proceedings of the National Academy of Sciences of the United States of America 1999, 96, 12287-12292. (62) Bauerle, P.; Scheib, S. Advanced Materials 1993, 5, 848-853. (63) Delabouglise, D.; Roncali, J.; Lemaire, M.; Garnier, F. Journal of the Chemical Society-Chemical Communications 1989, 475-477. (64) Perepichka, I. F.; Besbes, M.; Levillain, E.; Salle, M.; Roncali, J. Chemistry of Materials 2002, 14, 449-457. (65) Hosseini, S. H.; Entezami, A. A. Iranian Polymer Journal 1999, 8, 205-213. (66) Chen, L. H.; McBranch, D. W.; Wang H. L.; Helgeson, R.; Wudl, F.; Whitten, D. G. Proceedings of the National Academy of Sciences of the United States of America 1999, 96, 12287-12292. (67) Yang, J. S.; Swager, T. M. J.Am.Chem.Soc. 1998, 120, 11864-11873. (68) Wilson, J. N.; Wang, Y. Q. ; Lavigne, J. J.; Bunz, U. H. F. Chemical Communications 2003, 1626-1627. (69) Williams, V.; Yang, J. S.; Swager, T. M. Abstracts of Papers of the American Chemical Society 1998, 216, U354-U355. (70) Miao, Y. J.; Kim, J. S.; Swager, T. M. Abstracts of Papers of the American Chemical Society 1999, 218, U455-U456. (71) Wosnick, J. H.; Mello, C. M.; Swager, T. M. J.Am.Chem.Soc. 2005, 127, 34003405. (72) Pinto, M. R.; Schanze, K. S. Synthesis-Stuttgart 2002, 1293-1309. (73) Heeger, P. S.; Heeger, A. J. Proc.Nat.Acad.Sci.USA. 1999, 96, 12219-12221. (74) Yang, C. Y. J.; Pinto, M.; Schanze, K.; Tan, W. H. Angewandte ChemieInternational Edition 2005, 44, 2572-2576. (75) Khan, S. I.; Grinstaff, M. W. J Amer.Chem.Soc. 1999, 121, 4704-4705.

PAGE 195

178 (76) Rist, M.; Amann, N.; Wagenknecht, H. A. Eur.J.Org.Chem. 2003, 2498-2504. (77) Chen, L. H.; Xu, S.; McBranch, D.; Whitten, D. J.Am.Chem.Soc. 2000, 122, 9302-9303. (78) Mathews, D. H.; Sabina J.; Zuker, M.; Turner, D. H. J.Mol.Biol. 1999, 288, 911940. (79) Yang, C. Y. J.; Lin, H.; Tan, W. H. J.Am.Chem.Soc. 2005, 127, 12772-12773. (80) Chen, L. H.; McBranch, D. W.; Wang H. L.; Helgeson, R.; Wudl, F.; Whitten, D. G. Proc.Natl.Acad.Sci.U..S.A. 1999, 96, 12287-12292. (81) Du, H.; Disney, M. D.; Miller, B. L.; Krauss, T. D. J.Am.Chem.Soc. 2003, 125, 4012-4013. (82) Dubertret, B.; Calame, M.; Libchaber, A. J. Nat.Biotechnol. 2001, 19, 365-370. (83) Maxwell, D. J.; Taylor, J. R.; Nie, S. M. J.Am.Chem.Soc. 2002, 124, 9606-9612. (84) Xia, Wensheng, Whitten, David, and McBranch, Duncan. Dark quenchers for fluorescence resonance energy transfer (F RET) in bioassays. (QTL Biosystems Llc, USA. 2004-US30980(2005030979), 30-20050407. WO. 9-22-2004. Ref Type: Patent (85) Cook, Ronald M. Synthesis and methods for dark quencher probes for donoracceptor energy transfer. (Biosearch Technologies, Inc. USA. 2001US15082(2001086001), 95-20011115. WO. 5-8-2001. Ref Type: Patent (86) May, J. P.; Brown, L. J.; Rudloff, I.; Brown, T. Chemical Communications 2003, 970-971. (87) Mullah, B.; Andrus, A. Tetrahedron Lett. 1997, 38, 5751-5754. (88) Bonnet, G.; Krichevsky, O.; Libchaber, A. Proc.Natl.Acad.Sci.U.S.A. 1998, 95, 8602-8606. (89) Bonnet, G.; Tyagi, S.; Libchaber, A.; Kramer, F. R. Proc.Natl.Acad.Sci.U.S.A. 1999, 96, 6171-6176. (90) Fang, X. H.; Li, J. W. J.; Perlette, J.; Tan, W. H.; Wang, K. M. Anal.Chem. 2000, 72, 747A-753A. (91) Tyagi, S.; Marras, S. A. E.; Kramer, F. R. Nat.Biotechnol. 2000, 18, 1191-1196. (92) Tan, W. H.; Wang, K. M.; Drake, T. J. Curr.Opin.Chem.Biol. 2004, 8, 547-553.

PAGE 196

179 (93) Drake, T. J.; Medley, C. D.; Rogers R.J.; Tan W.H. Chembiochem 2005, 6, 900907. (94) Tang, Z. W.; Wang, K. M.; Tan, W. H. ; Li, J.; Liu, L. F.; Guo, Q. P.; Meng, X. X.; Ma, C. B.; Huang, S. S. Nucleic Acids Res. 2003, 31. (95) Tang, Z. W.; Wang, K. M.; Tan, W. H. ; Ma, C. B.; Li, J.; Liu, L. F.; Guo, Q. P.; Meng, X. X. Nucleic Acids Res. 2005, 33. (96) Liu, X. J.; Tan, W. H. Anal.Chem. 1999, 71, 5054-5059. (97) Fang, X. H.; Liu, X. J.; Schuster, S.; Tan, W. H. J.Am.Chem.Soc. 1999, 121, 2921-2922. (98) Fang, X. H.; Li, J. J.; Tan, W. H. Anal.Chem. 2000, 72, 3280-3285. (99) Li, J. W. J.; Fang, X. H.; Schuster, S. M.; Tan, W. H. Angewandte ChemieInternational Edition 2000, 39, 1049-+. (100) Yao, G.; Tan, W. H. Anal.Biochem. 2004, 331, 216-223. (101) Wang, H.; Li, J.; Liu, H. P.; Liu, Q. J. ; Mei, Q.; Wang, Y. J.; Zhu, J. J.; He, N. Y.; Lu, Z. H. Nucleic Acids Res. 2002, 30. (102) Fang, X. H.; Tan, W. H. Anal.Chem. 1999, 71, 3101-3105. (103) Shchepinov, M. S.; Udalova, I. A.; Bridgman, A. J.; Southern, E. M. Nucleic Acids Res. 1997, 25, 4447-4454. (104) Shchepinov, M. S.; Mir, K. U.; Elder, J. K.; Frank-Kamenetskii, M. D.; Southern, E. M. Nucleic Acids Res. 1999, 27, 3035-3041. (105) Vijayanathan, V.; Thomas, T.; Sigal, L. H.; Thomas, T. J. Antisense & Nucleic Acid Drug Development 2002, 12, 225-233. (106) Marras, S. A. E., Kramer, F. R., and Tyagi, S. Genotyping SNPs with molecular beacons. Methods in Molecu lar Biology 212(Single Nu cleotide Polymorphism), 111-128. 2003. Ref Type: Journal (Full) (107) Leitzel, K.; Bryce, W.; Tomita, J. ; Manderino, G.; Tribby, I.; Thomason, A.; Billingsley, M.; Podczaski, E.; Harvey, H.; Bartholomew, M.; Lipton, A. Cancer Research 1991, 51, 4149-4154. (108) Peng, X. H., Cao, Z. H., Xia, J. T., Carlson, G. W., Lewis, M. M., Wood, Wi. C., and Yang, L. Real-time detection of ge ne expression in cancer cells using molecular beacon imaging: new strategies for cancer research. Cancer Res. 65(5), 1909-1917. 2005.

PAGE 197

180 Ref Type: Journal (Full) (109) Hanash, S. Nature 2003, 422, 226-232. (110) Tyers, M.; Mann, M. Nature 2003, 422, 193-197. (111) Wulfkuhle, J. D.; Liotta, L. A.; Petricoin, E. F. Nature Reviews Cancer 2003, 3, 267-275. (112) Potyrailo, R. A.; Conrad, R. C.; Ellington, A. D.; Hieftje, G. M. Anal.Chem. 1998, 70, 3419-3425. (113) Li, J. W. J.; Fang, X. H.; Tan, W. H. Biochem.Biophys.Res.Commun. 2002, 292, 31-40. (114) Gao, X. H.; Cui, Y. Y.; Levenson, R. M.; Chung, L. W. K.; Nie, S. M. Nature Biotechnol. 2004, 22, 969-976. (115) Masuko, M.; Ohtani, H.; Ebata, K.; Shimadzu, A. Nucleic Acids Res. 1998, 26, 5409-5416. (116) Zuker, M. Nucleic Acids Res. 2003, 31, 3406-3415. (117) Nagatoishi, S.; Nojima, T.; Juskowiak, B.; Takenaka, S. Angewandte Chemie (International ed.in English) 2005, 44, 5067-5070. (118) Yamana, K.; Ohtani, Y.; Nakano, H.; Saito, I. Bioorg.Med.Chem.Lett. 2003, 13, 3429-3431. (119) Singer, R. H. Curr Biol 2003, 13, 673-5. (120) Ahn, T.; Kim, J. S.; Choi, H. I.; Yun, C. H. Anal.Biochem. 2002, 306, 247-251. (121) Paris, P. L.; Langenhan, J. M.; Kool, E. T. Nucleic Acids Res. 1998, 26, 37893793. (122) Sun, L. P.; Wang, M.; Kool, E. T.; Taylor, J. S. Biochemistry (Mosc). 2000, 39, 14603-14610. (123) Yamana, K.; Iwai, T.; Ohtani, Y.; Sato, S.; Nakamura, M.; Nakano, H. Bioconjug.Chem. 2002, 13, 1266-1273. (124) Duhamel, J.; Kanagalingam, S. ; O'Brien, T. J.; Ingratta, M. W. J.Am.Chem.Soc. 2003, 125, 12810-12822. (125) Tcherkasskaya, O.; Davidson, E. A.; Schmerr, M. J.; Orser, C. S. Biotechnol.Lett. 2005, 27, 671-675.

PAGE 198

181 (126) Tong, A. K.; Li, Z. M.; Jone s, G. S.; Russo, J. J.; Ju, J. Y. Nat.Biotechnol. 2001, 19, 756-759. (127) Moreira, B. G.; You, Y.; Behlke, M. A.; Owczarzy, R. Biochem.Biophys.Res.Commun. 2005, 327, 473-484. (128) Balakin, K. V.; Korshun, V. A.; Mikha lev, I. I.; Maleev, G. V.; Malakhov, A. D.; Prokhorenko, I. A.; Berlin, Y. A. Biosensors & Bioelectronics 1998, 13, 771-778. (129) Tan, W. H.; Fang, X. H.; Li, J.; Liu, X. J. Chemistry-A European Journal 2000, 6, 1107-1111. (130) Uchiyama, H.; Hirano, K.; KashiwasakeJibu, M.; Taira, K. J.Biol.Chem. 1996, 271, 380-384. (131) Shah, R.; El Deiry, W. S. Cancer Biology & Therapy 2004, 3, 871-875. (132) Kehlenbach, R. H. Nucleic Acids Res. 2003, 31. (133) Marras, S. A. E.; Gold, B.; Kramer, F. R.; Smith, I.; Tyagi, S. Nucleic Acids Res. 2004, 32. (134) Mhlanga, M. M.; Vargas, D. Y.; Fung, C. W.; Kramer, F. R.; Tyagi, S. Nucleic Acids Res. 2005, 33, 1902-1912. (135) Molenaar, C.; Marras, S. A.; Slats, J. C. M.; Truffert, J. C.; Lemaitre, M.; Raap, A. K.; Dirks, R. W.; Tanke, H. J. Nucleic Acids Res. 2001, 29, art-e89. (136) Tsourkas, A.; Behlke, M. A.; Bao, G. Nucleic Acids Res. 2002, 30, 5168-5174. (137) Kuhn, H.; Demidov, V. V.; Gildea, B. D.; Fiandaca, M. J.; Coull, J. C.; FrankKamenetskii, M. D. Antisense & Nucleic Acid Drug Development 2001, 11, 265270. (138) Seitz, O. Angewandte Chemie-Inte rnational Edition 2000, 39, 3249-+. (139) Xi, C. W.; Balberg, M.; Boppart, S. A.; Raskin, L. Appl.Environ.Microbiol. 2003, 69, 5673-5678. (140) Braasch, D. A.; Corey, D. R. Chemistry & Biology 2001, 8, 1-7. (141) Egholm, M.; Nielsen, P. E.; Buchardt, O.; Berg, R. H. J.Am.Chem.Soc. 1992, 114, 9677-9678. (142) Dueholm, K. L.; Egholm, M.; Behrens, C.; Christensen, L.; Hansen, H. F.; Vulpius, T.; Petersen, K. H.; Berg, R. H.; Nielsen, P. E.; Buchardt, O. J.Org.Chem. 1994, 59, 5767-5773. (143) Bergmann, F.; Bannwarth, W.; Tam, S. Tetrahedron Lett. 1995, 36, 6823-6826.

PAGE 199

182 (144) Gildea, B. D.; Casey, S.; MacNeill, J.; Perry-O'Keefe, H.; Sorensen, D.; Coull, J. M. Tetrahedron Lett. 1998, 39, 7255-7258. (145) Gangamani, B. P.; Kumar, V. A.; Ganesh, K. N. Biochem.Biophys.Res.Commun. 1997, 240, 778-782. (146) Koshkin, A. A.; Rajwanshi, V. K.; Wengel, J. Tetrahedron Lett. 1998, 39, 43814384. (147) Koshkin, A. A.; Nielsen, P.; Mel dgaard, M.; Rajwanshi, V. K.; Singh, S. K.; Wengel, J. J.Am.Chem.Soc. 1998, 120, 13252-13253. (148) Wengel, J. Acc.Chem.Res. 1999, 32, 301-310. (149) Vester, B.; Wengel, J. Biochemistry (Mosc). 2004, 43, 13233-13241. (150) Orum, H.; Wengel, J. Current Opinion in Molecular Therapeutics 2001, 3, 239243. (151) Hertoghs, K. M. L.; Ellis, J. H.; Catchpole, I. R. Nucleic Acids Res. 2003, 31, 5817-5830. (152) Yang, C. Y. J.; Wang, L.; Medley, C. D.; Lin, H.; Tan W.H. Manuscript in Preparation 2006. (153) Wang, L.; Yang, C. Y. J.; Medley, C. D.; Benner, S. A.; Tan, W. H. J.Am.Chem.Soc. 2005, 127, 15664-15665. (154) Petersen, M.; Wengel, J. Trends Biotechnol. 2003, 21, 74-81. (155) Christensen, U.; Jacobsen, N.; Ra jwanshi, V. K.; Wengel, J.; Koch, T. Biochem.J. 2001, 354, 481-484. (156) Li, J. W. J.; Tan, W. H. Anal.Biochem. 2003, 312, 251-254. (157) Bertrand, E.; Chartrand, P.; Schaefer, M.; Shenoy, S. M.; Singer, R. H.; Long, R. M. Mol.Cell 1998, 2, 437-445. (158) Knowles, R. B.; Sabry, J. H.; Martone, M. E.; Deerinck, T. J.; Ellisman, M. H.; Bassell, G. J.; Kosik, K. S. J.Neurosci. 1996, 16, 7812-7820. (159) Tyagi, S.; Alsmadi, O. Biophys.J. 2004, 87, 4153-4162. (160) Li, J. W. J.; Tan, W. H. Analytical Biochemistry 2003, 312, 251-254. (161) Silverman, A. P.; Kool, E. T. Trends Biotechnol. 2005, 23, 225-230. (162) Sando, S.; Kool, E. T. J.Am.Chem.Soc. 2002, 124, 9686-9687.

PAGE 200

183 (163) Yang, C. Y. J.; Ma rtinez K.; Lin, H.; Tan W.H. J.Am.Chem.Soc. 2006, (Accepted). (164) Zhang, C. Y.; Yeh, H. C.; Kuroki, M. T.; Wang, T. H. Nature Materials 2005, 4, 826-831. (165) Tsuji, A.; Koshimoto, H.; Sato, Y.; Hirano, M.; Sei-Iida, Y.; Kondo, S.; Ishibashi, K. Biophysical Journal 2000, 78, 3260-3274. (166) Medintz, I. L.; Uyeda, H. T.; Goldman, E. R.; Mattoussi, H. Nature Materials 2005, 4, 435-446. (167) Frangioni, J. V. Nat.Biotechnol. 2006, 24, 326-328. (168) Michalet, X.; Pinaud, F. F.; Bentolila, L. A.; Tsay, J. M.; Doose, S.; Li, J. J.; Sundaresan, G.; Wu, A. M.; Gambhir, S. S.; Weiss, S. Science 2005, 307, 538544. (169) Gao, X. H.; Cui, Y. Y.; Levenson, R. M.; Chung, L. W. K.; Nie, S. M. Nat.Biotechnol. 2004, 22, 969-976. (170) Alivisatos, P. Nat.Biotechnol. 2004, 22, 47-52. (171) Dahan, M.; Levi, S.; Luccardini, C. ; Rostaing, P.; Riveau, B.; Triller, A. Science 2003, 302, 442-445. (172) Larson, D. R.; Zipfel, W. R.; Willia ms, R. M.; Clark, S. W.; Bruchez, M. P.; Wise, F. W.; Webb, W. W. Science 2003, 300, 1434-1436. (173) Jaiswal, J. K.; Mattoussi, H.; Mauro, J. M.; Simon, S. M. Nat.Biotechnol. 2003, 21, 47-51. (174) Dubertret, B.; Skourides, P.; Norris, D. J.; Noireaux, V.; Brivanlou, A. H.; Libchaber, A. Science 2002, 298, 1759-1762. (175) Chan, W. C. W.; Nie, S. M. Science 1998, 281, 2016-2018. (176) Crey-Desbiolles, C.; Ahn, D. R.; Leumann, C. J. Nucleic Acids Res. 2005, 33. (177) Jurczyk, S. C.; Kodra, J. T.; Pa rk, J. H.; Benner, S. A.; Battersby, T. R. Helv.Chim.Acta 1999, 82, 1005-1015. (178) Damha, M. J.; Giannaris, P. A.; Marfey, P.; Reid, L. S. Tetrahedron Lett. 1991, 32, 2573-2576. (179) Garbesi, A.; Capobinanco, M. L. ; Colonna, F. P.; Tondelli, L.; Arcamone, F.; Manzini, G.; hilbers, C. W.; Aelen, J. M. E.; Blommers, M. J. J. Nucleic Acids Res. 1993, 21, 4159-4165.

PAGE 201

184 (180) Damha, M. J.; Giannaris, P. A.; Marfey, P. Biochemistry (Mosc). 1994, 33, 78777885. (181) Masad, J.; Giannaris, P. A.; Marfey, P.; Reid, L. S. Tetrahedron Lett. 1991, 32, 2573-2576. (182) Crey-Desbiolles, C.; Ahn, D. R.; Leumann, C. J. Nucleic Acids Res. 2005, 33. (183) Ashley, G. W. J.Am.Chem.Soc. 1992, 114, 9731-9736.

PAGE 202

185 BIOGRAPHICAL SKETCH Chaoyong James Yang was born in Fujian Province, China, in November, 1975. He went to Xiamen University in 1994 to study ch emistry. After four years of staying in the National Fostering Center for Future Chemists housed at Xiamen University, he entered graduate program in the same university in 1998. Having obtained his MS degree, James moved to University of Flo rida in 2001 and joined Dr. We ihong Tans research group to pursue his PhD degree.