Citation
Regulation of Phase Variation and Deletion Mutation in the Vibrio vulnificus Group 1 CPS Operon

Material Information

Title:
Regulation of Phase Variation and Deletion Mutation in the Vibrio vulnificus Group 1 CPS Operon
Creator:
JONES, MELISSA KOLSCH ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Alleles ( jstor )
Capsules ( jstor )
DNA ( jstor )
Genetic mutation ( jstor )
Genotypes ( jstor )
Incubation ( jstor )
Operator regions ( jstor )
Operon ( jstor )
Plasmids ( jstor )
Vibrio vulnificus ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Melissa Kolsch Jones. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
5/31/2008
Resource Identifier:
496626241 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

REGULATION OF PHASE VARIATION AND DELETION MUTATION IN THE Vibrio vulnificus GROUP 1 CPS OPERON By MELISSA KOLSCH JONES A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Melissa Kolsch Jones

PAGE 3

To my parents, family, and friends who supported and encouraged me throughout this process, and to my husband and best friend, He rb Jones, without whom I could not have done this.

PAGE 4

iv ACKNOWLEDGMENTS I would like to thank Dr. Anita C. Wright for the guidance, direction, and insight she has provided over the years. Her exp ectations challenged me to push beyond my own preconceived limitations and allowed me to realize a potential beyond what I thought I possessed. Her talents as a researcher and writ er were invaluable th roughout my graduate studies and the development of this disse rtation. Sincere thanks also go to my supervisory committee members (Dr. Doug Ar cher, Dr. Ross Brown, Jr., and Dr. Nemat Keyhani), for their guidance and advice throughout my research and for their contributions to my dissertation. I would also like to thank Dr. Maria Chatzidaki-Livanis for her advice, her daily encouragement, and most importantly her friendship. She knew how to make even the most strenuous days enjoyable, and her friendship was an unexpected but treasured blessing. I extend my heartfelt appreci ation to my parents, Mart ha and Norman, who have given me a lifetime of encouragement and inst illed in me the confidence to know I can accomplish anything I set my mind to. Their love and support have carried me through life and were especially cherished while obtaining this degree. Finally, my deepest gratitude and undying love go to my husband, Herb, who was always there to lean on or to cry on when the pressures of life overwhelmed me. He believed in me when I didn’t believe in myse lf, provided a daily example of dignity and

PAGE 5

v grace in the face of hardship, and showed me how to persevere even when I felt like giving up.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................ix LIST OF FIGURES.............................................................................................................x LIST OF ABBREVIATIONS...........................................................................................xii ABSTRACT.....................................................................................................................xiv CHAPTER 1 INTRODUCTION........................................................................................................1 Specific Aim 1: Establish Gr owth Conditions that Increase V. vulnificus Phase Variation Frequency.................................................................................................4 Specific Aim 2: Examine the Relati onship of Genetic Diversity in the V. vulnificus CPS Operon to the Genetics of Phase Variation.....................................5 Specific Aim 3: Study the Role of recA in Deletion Events Associated with the V. vulnificus CPS operon.........................................................................................6 2 LITERATURE REVIEW.............................................................................................7 Vibrio vulnificus ............................................................................................................7 Epidemiology of V. vulnificus ......................................................................................9 Pathogenesis of V. vulnificus ......................................................................................12 Capsular Polysaccharide Operon of V. vulnificus .......................................................19 Regulation of Capsular Po lysaccharide Expression...................................................23 Phase Variation...........................................................................................................25 Role of RecA in Phase Variation................................................................................30 3 MATERIALS AND METHODS...............................................................................33 Bacterial Strains and Culture Conditions...................................................................33 Induction of Phase Variation......................................................................................33 Secreted Factors and V. vulnificus Phase Variation....................................................35 PCR Screening of Translucent CPS Genotypes.........................................................35 Stability of Translucent Genotypes............................................................................37

PAGE 7

vii DNA Cloning and Sequence Analysis of recA in V. vulnificus MO6-24/Op.............37 Insertional Inactivation of recA ..................................................................................38 Delivery of Inactivated recA into V. vulnificus ..........................................................39 Complementation of recA Inactivation.......................................................................45 Ultraviolet Light Sensitivity Analysis........................................................................46 Cloning of Growth Plasmid pGTR902 into V. vulnificus ...........................................47 Statistical Analysis......................................................................................................48 4 RESULTS: SPECIFIC AIM 1...................................................................................49 Rationale for Study.....................................................................................................49 Induction of High Frequency “Phase Variation”........................................................50 Effects of Extended Incubation on Phase Variation...................................................51 Effects of Secreted Factors on Phase Variation..........................................................53 Population Dynamics of Phase Variation...................................................................57 Conclusions.................................................................................................................61 5 RESULTS: SPECIFIC AIM 2...................................................................................63 Rationale for Study.....................................................................................................63 Strain Differences in Phase Variation.........................................................................64 Phase Variation and Allelic Vari ation within the CPS Operon..................................67 Distribution of Tr Genotypes Related to the CPS Operon Among Different Strains.71 Translucent to Opaque Phase Variation.....................................................................79 Conclusions.................................................................................................................80 6 RESULTS: SPECIFIC AIM 3...................................................................................82 Rationale for Study.....................................................................................................82 Mutational Analysis of V. vulnificus recA Activity....................................................83 Role of recA in V. vulnificus Phase Variation............................................................86 Conclusions.................................................................................................................90 7 DISCUSSION AND CONCLUSIONS......................................................................92 Induction of High Frequency “Phase Variation”........................................................92 Growth Phase and Phase Variation.............................................................................93 Population Dynamics of Phase Variation...................................................................95 Genetics of “Phase Variation”....................................................................................97 Repetitive Elements and Deletion Mutation...............................................................99 Deletion Mutation Freque ncy and Allelic Type.......................................................100 Contingency Loci and Phase Variation....................................................................103 RecA-Dependent Deletion Mutation........................................................................104 Genetic Analysis of the Role of recA in V. vulnificus Deletion Mutations..............105 Multiple Pathways for V. vulnificus Tr Colony Formation......................................107 Ecology of Phase Variation......................................................................................111 APPENDIX DNA SEQUENCE COMPARISON......................................................... 113

PAGE 8

viii LIST OF REFERENCES.................................................................................................118 BIOGRAPHICAL SKETCH...........................................................................................133

PAGE 9

ix LIST OF TABLES Table page 3-1 Summary of V. vulnificus strains..............................................................................34 4-1 Effect of media on phase variati on of MO6-24/Op incubated at 30C....................52 4-2 Effect of media on phase variati on of MO6-24/Op incubated at 37C....................52 4-3 Effect of spent PP3 (pH 7.0) on phase variation of MO6-24/Op.............................54 4-4 Phase variation and survival of MO 6-24/Op with growth plasmid pGTR902........60 5-1 Effect of temperature on phase variation in E4125/Op in PP3 (pH 7.0)..................67 5-2 Transitions in colony type for opaque V. vulnificus strains of both alleles..............69 5-3 Frequency of deletion mutations among CPS alleles at 30C..................................77 5-4 Frequency of deletion mutations among CPS alleles at 37C..................................78 5-5 Phenotypic stability of translucent genotypes..........................................................79

PAGE 10

x LIST OF FIGURES Figure page 2-1 Genetic organization of group 1 CPS operons.........................................................21 3-1 Construction of pRECAN and pMKJ1......................................................................40 3-2 Marker exchange resulting in insertional inactivation of recA ................................42 3-3 Construction of pGTRRECAN.................................................................................43 4-1 Effect of temperature on phase va riation in MO6-24/Op in PP3 (pH 7.0)..............53 4-2 Effect of inoculum size on phase variation..............................................................56 4-3 Changes in Op, Tr, and Total cu lture concentrations of MO6-24............................58 4-4 Changes in Op and Tr populations of MO6-24 between sampling days..................59 5-1 Sectored opaque colony with translucent wedges....................................................65 5-2 Translucent colony formation by opaque V. vulnificus strains................................66 5-3 Genetic organization of group 1 CPS operons.........................................................68 5-4 Changes in Op, Tr, and overall culture populations.................................................70 5-5 PCR analysis of CPS transport region in V. vulnificus phase variants.....................71 5-6 Cumulative genotype distribution among Allele 1 strains at 30C..........................72 5-7 Cumulative genotype distribution among Allele 1 strains at 37C..........................73 5-8 Cumulative genotype distribution among Allele 2 strains at 37C..........................74 5-9 Deletion mutation size corresponds to repetitive element location..........................76 6-1 UV exposure assays measuring surv ival after exposure to UV light.......................86 6-2 Comparison of recA mutant, compleme nt and parent cultures concentrations........87 6-3 Effect of recA mutation and complementation on phase variation..........................88

PAGE 11

xi 6-4 Cumulative distribution of Op phe notype and Tr ge notype among singlecrossover recA mutants............................................................................................89 7-1 Repetitive element length flanking wzb within the V. vulnificus CPS operon....... 102 A-1 Sequence comparison of the genomic region encompassing recA in V. vulnificus ............................................................................................................113

PAGE 12

xii LIST OF ABBREVIATIONS Abbreviation Term ASW 15 ppt artificial seawater AI Autoinducer AHL Acyl-homoserine lactone CFU Colony forming unit CPS Capsular polysaccharide DS Double stranded EPS Extracellular p olysaccharide HP Hypothetical protein IS Insertion sequence Kan Kanamycin LA Luria-Bertani a gar LB Luria-Bertani broth LD50 50% lethal dose LPS Lipopolysaccharide MLST Multi-locus s equence tying Op Opaque ORF Open reading frame PBS Phosphate buffered saline PCR Polymerase chain reaction

PAGE 13

xiii PP1 Proteose Peptone # 1 PP3 Proteose Peptone # 3 R1 Repetitive Element 1 (subunit: ACAGGACC) R2 Repetitive Element 2 (subunit: A/CCTAGG/AAA/C) R3 Repetitive Element 3 (subunit: CTAGAAC) Sec Sectored SS Single stranded SSM Slip strand mutagenesis Tr Translucent TR1 Translucent Genotype 1 (intact CPS operon) TR2 Translucent Genotype 2 (deletion of wzb ) TR2A Translucent Genotype 2A (deletion of wzb and ORF encoding HP) TR3A Translucent Genotype 3 (n egative by PCR of CPS operon) UV Ultraviolet VBNC Viable but nonculturable

PAGE 14

xiv Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy REGULATION OF PHASE VARIATION AND DELETION MUTATION IN THE Vibrio vulnificus GROUP 1 CPS OPERON By Melissa Kolsch Jones May 2006 Chair: Anita C. Wright Major Department: Food Science and Human Nutrition Vibrio vulnificus produces fatal human disease asso ciated with the consumption of raw oysters. However, disease is typically limited to individuals with predisposing conditions. Capsular polysaccharide (CPS) expression is required for virulence and differences in colony morphology. Opaque colonies are virulent due to surface expression of CPS, while tran slucent colonies have reduced capsular expression and are avirulent. Phase variation between thes e morphologies occurs at a level of 10-3 to 10-4. Phase variation is influenced by environmen tal conditions; therefore, multiple conditions were examined for higher rates of CPS phase variation in V. vulnificus . Incubation in medium containing proteose peptone #3 at 37C promoted highfrequency transition from opaque to translucent. The group 1 CPS operon responsible for capsule expression in V. vulnificus has two allelic forms (Allele 1/Allele 2). Allele s differ in sequences encoding hypothetical proteins (HP1/HP2, respectiv ely) and in sequence and location of repetitive DNA

PAGE 15

xv elements (R1/R2, respectively). Levels of phase variation varied among strains and were generally higher for strains of Allele 1 vs. Allele 2. Thr ee translucent genotypes (TR1, TR2, TR3) were described for V. vulnificus Allele 1 strains: th e CPS operon of TR1 was identical to the opaque parent, while TR2 and TR3 had deletion mutations in one ( wzb ) or multiple genes, respectively. Deletion w ithin TR2 correlated with the location of repetitive elements. PCR analysis of tr anslucent isolates generated during phase induction assays revealed Allele 2 strain s produced a fourth translucent genotype (TR2A), which had deletion wzb and HP2. Deletion within TR2A also corresponded to the location of repetitive elements. Thus, differences in repetitive element location correlated with differences in phase variation rates and translucent genotype formation. Repetitive elements provide highly ho mologous regions surrounding deleted DNA, and transition to the translucent phenotype occurred during late st ationary phase, which implicated homologous recombination as a pot ential mechanism of deletion formation. Therefore, the role of recA in deletion mutation was examin ed using mutational analysis. Levels of phase variation were reduced in recA mutants, and translucent isolates generated from these mutants had lost the inactiv ate gene construct, suggesting recA may be required for phase variation and deletion mutation.

PAGE 16

1 CHAPTER 1 INTRODUCTION Vibrio vulnificus is a halophilic bacterium comm only found in estuarine waters worldwide and isolated from a variety of aquatic organisms including finfish, eels, oysters, clams, and shrimp (Tison et al. 1982, Tamplin et al. 1982, DePaola et al. 1994, Motes et al. 1998, Bisharat et al. 1999, do Nascimento et al. 2001, Brenton et al. 2001). This bacterium is the leading cause of seafood-related illness in the U.S. and is responsible for 95% of a ll seafood related d eaths (Feldhusen 2000). Localized V. vulnificus infections may be manifested in wounds that are exposed to water harboring the bacteria, while systemic infections may be contracted through the consumption of raw shellfish, particularly oysters (Blake et al. 1979). Wound infections by V. vulnificus are characterized by painful swelling and redne ss, fluid accumulation around the infected area, and eventual necrosis of surrounding tissue (Bowdre et al. 1983, Kl ontz et al. 1988). The mortality rate is lower for wound infecti ons (~25%) than for syst emic disease, which is highly fatal (mortality >50%), and can lead to death within 24 h of shellfish consumption (CDC April 1993). Symptoms of systemic infection by V. vulnificus include fever, chills, nausea, and hypoten sion (Hlady and Klontz 1996). Another unique characteristic of systemic disease is the form ation of bullous lesions , usually occurring in the extremities of patients. Although deadly, V. vulnificus disease typically occurs only in individuals with underlying disorders such as diabetes, cancer, compromised immune systems, liver disease, or hemochromatosis (iron overload disease).

PAGE 17

2 Several potential virulence fact ors have been described for V. vulnificus , however only surface expression of capsular polysacch aride (CPS) has been shown to be a virulence determinant (for reviews see St rom and Paranjpye 2001, Gulig et al. 2005). The presence of CPS contri butes to virulence by allo wing the organism to evade opsonization by complement and phagocytosis by macrophages within the host immune system (Tamplin et al. 1985, Tamplin et al. 1983). V. vulnificus possess a group 1 CPS operon that is required for surface expression of capsule (Chatzidaki 2004, Wright et al. 2001). Expression of CPS is not only required for virulence but also determines colony morphology. Encapsulated strains produce opa que (Op) colonies when plated onto standard microbiological media, while cells with reduced CPS are translucent (Tr). Electron microscopy of cells from Op coloni es showed that these cells have a thick, continuous layer of capsule surrounding the ce ll surface. Electron microscopy of cells from Tr colonies showed that some of th ese cells have thin, patchy areas of capsule around the cell surface and others are complete ly acapsular (Yoshida et al. 1985, Wright et al. 1990). Spontaneous reversions between C PS phenotypes have been reported in V. vulnificus and occur at a level of 10-3 to 10-4 for Op and Tr or Tr and Op transitions (Yoshida et al. 1985, Wright et al. 1990). These reversible phenotypes resemble phase variation, which is defined as a reversible , heritable alteration in surface structure expression. Phase variation is regulated by a variety of environmenta l factors in several bacterial species, and these factors include media iron le vels, carbon source, amino acid concentration, temperature, and pH (Ali et al . 2003, Serkin and Seifert 2000, Gally et al. 1993, Crost et al. 2004, McCarter 1998, Bal et al. 1992). Although, phase variation

PAGE 18

3 occurs in a number of bacteria, few m echanisms have been described. Known mechanisms of phase variation include: DNA inversion, slip strand mispairing, DNA recombination, and differential DNA methyl ation (McClain 1991, Ou J et al. 1988, Levinson and Gutman 1987, van Belkum et al. 1998, Hammerschmidt et al. 1996, Ringquist and Smith 1992). A common feature seen in mechanisms of phase variation is the involvement of intragenic or intergenic repetitive segments of DNA (van Belkumet al. 1998, van der Woude and Baulmer 2004). Recently, Chatzidaki (2004) investigated th e genetic basis for phase variation in V. vulnificus and compared the CPS operons of Op and Tr phase variants of the same strain. Multiple genotypes we re identified in Tr isolates and designated as TR1, TR2, and TR3. The Tr strain MO6-24/TR1 show ed an intact CPS operon and expressed reduced amounts of CPS. Another strain (LC4/TR2) showed precise deletion of the wzb gene, while strain 345/TR3 appeared to be missing multiple genes in the CPS operon. Electron microscopy revealed that the TR1 st rain expressed small amounts of capsule on the cell surface, but both deletion mutants were acapsular. Furthermore, repetitive elements in the CPS operon appeared to be related to the site-specific deletion of wzb in the TR2 strain, as these elements flanked this gene in the Op pare nt strain (Chatzidaki 2004). Complementation in trans of the TR2 deletion mutants with wzb on a plasmid construct restored the Op phe notype, and electron microscopy showed that the strain recovered surface expression of CPS that was equi valent to the Op stra in. The ability of the wzb gene to restore CPS expression in TR 2 deletion mutants indicated that the deletion mutation was specific in this strain for wzb in V. vulnificus and was responsible for the acapsular Tr phenotype (Chatzidaki 2004).

PAGE 19

4 In order to conduct a more detailed ex amination into the genetic basis of V. vulnificus phase variation, the present study in vestigated genetic alterations and diversity of the CPS locus among a much larger number of ph ase variants derived from a variety of strains. To obtain these large numbe rs, growth conditions were identified that promoted rates of phase variation that were significantly higher (>1%) compared to previously reported levels. These conditions we re used to examine strain variability in the phase variation response. The presence, placement, and size of repetitive elements differ within the CPS operons of Op strains of V. vulnificus (Chatzidaki 2004). Therefore, phase variants were also examined to determine if differences in repetitive elements corresponded to differences in ge notype and deletion mu tation among Tr phase variants. These repetitive elements within the CPS operon provide extended regions of homology surrounding wzb , suggesting RecA-mediated homologous recombination may facilitate deletion of this gene. Mutati onal analysis was conducted for the purpose of investigating the role of recA in the formation of Tr deletion mutants. Specific Aim 1: Establish Growth Conditions that Increase V. vulnificus Phase Variation Frequency A previous description of Tr genotypes associated with V. vulnificus CPS phase variation was based on a limited number of Tr is olates (n=3) that we re each derived from different strains of this species (Chatzid aki 2004). In order to determine if these genotypes were distributed throughout specie s and whether or not they represent a significant contribution to th e genetic background of this organism, more extensive analysis of phase variable populations de rived from the same strain was required. Therefore, culture conditions were esta blished that would induce high-frequency formation of altered colony types. Induction of high-frequency phase variation was

PAGE 20

5 previously described for V. cholerae and was related to a specific medium (proteose peptone #3) and temperature (3 7C) that induced high rate s of transition from smooth acapsular colonies to the rugose, encaps ulated morphotype (Ali et al. 2002). Environmental factors such as medium composition, temperature, and pH also influenced phase variation in Escherichia coli , Neisseria gonorrhoeae and some Salmonella serovars, suggesting environmental parameters regulate rates of phase variation (Gally et al. 19 93, Serkin and Seifert 2000, Bl omfield 2001, Ali et al. 2002, Crost et al. 2004). In orde r to optimize recovery of V. vulnificus isolates with altered colony types to be used for subsequent gene tic analysis, a variety of growth media and environmental parameters were examined. Specific Aim 2: Examine the Relation ship of Genetic Diversity in the V. vulnificus CPS Operon to the Genetics of Phase Variation Chatzidaki (2004) identified differences within the conserved transport region of the CPS operon among Op strains of V. vulnificus . DNA sequence of this region showed that most Op strains (n=3) had repetitive el ements flanking the conserved transport gene wzb . However, repetitive elements were not apparent in one stra in (YJ016) based on analysis of genomic sequence. These elements were unique to V. vulnificus and not found in other bacteria with group 1 CPS operons. It was also noted that some Tr isolates of V. vulnificus demonstrated site-specific deletion of the wzb gene. Repetitive elements frequently play a role in mechanisms of phase variation, and it was hypothesized that there was an association betw een repetitive elements and deletion mutation. In order to test this hypothesis, strains with and without repetitive elem ents were inoculated into phase induction assays, and the levels of phase variation were measur ed. In addition, Tr isolates generated during phase induction assa ys were evaluated for genotype in order to

PAGE 21

6 determine if the presence of repetitive elem ents correlated with differences in genetic mutations associated with phase variation. Specific Aim 3: Study the Role of recA in Deletion Events Associated with the V. vulnificus CPS operon RecA-dependent homologous recombination le ading to phase variation is described in Neisseria gonorrhoeae , Psuedomonas tollaasii , and Haemophilus influenzae (Hoiseth et al. 1986, Seifert 1996, Si nha et al. 2000). In V. vulnificus repetitive elements flank the wzb gene within the CPS operon. These repeat s provide extended regions of homology surrounding wzb and also appear to be associated with site-specific deletion of this gene (Chatzidaki 2004). Repetitive elements are prone to DNA br eakage which initiates RecA activity leading to homologous recombination. The produc tion of deletion mutants increased during prol onged incubation of V. vulnificus when RecA activity is elevated, which also implicates homologous recombina tion as a potential mechanism of deletion mutation. Therefore, the role of recA in deletion mutation within the CPS operon of V. vulnificus was investigated using mutational analys is. Mutants deficient in RecA were generated in V. vulnificus MO6-24/Op using insertional inactivation by an antibiotic cassette. Mutants were then exposed to phase induction assays, and the genotype of resulting Tr colonies was ev aluated as described above.

PAGE 22

7 CHAPTER 2 LITERATURE REVIEW Vibrio vulnificus Vibrio vulnificus is a gram-negative, curved rod in the family Vibrionaceae and was first described by Hollis et al. (1976). Other notable Vibrio spp . include V. anguillarium , V. harveyi , V. fisheri , V. parahaemolyticus , and most importantly V. cholerae , the causative agent of cholera. This severe diarrheal disease has been responsible for several pandemics that persist through the present time. Vibrio vulnificus was first distinguished from other Vibrio spp . by its ability to ferment lactose. As a mesophilic, obligate halophile, it is typically is olated from waters where salinities range from 15 to 25 ppt and temperatures range from 9 to 31C (Motes et al. 1998). Vibrio vulnificus is ubiquitous in coastal waters and sediments throughout the United States and the world (Kaysner et al. 1987, Myatt and Da vis 1989, Maxwell et al. 1991, O’Neill et al. 1992, Veenstra et al. 1994, Wright et al. 1996, Hoi et al. 1998, Bisharat et al. 1999). It has also been isolated from shrimp, finfish, eels, and mo lluscan shellfish, including oysters and clams (Tison et al. 1982, Tamplin et al. 1982, DePaola et al. 1994, Motes et al. 1998, Bisharat et al. 1999, do Nascimento et al. 2001, Brenton et al. 2001). Vibrio vulnificus is a pathogen of both humans a nd fish, and characterization of strains from these hosts led to its classification into bi otypes. Before 1999 only two biotypes were reported. Biot ype 1 was primarily derived fr om human infections, while biotype 2 was isolated from eels. Further st udy into host specificity revealed that both biotypes were able to cause disease in hu mans and mice; however, only biotype 2 was

PAGE 23

8 pathogenic to eels (Tison et al. 1982, Amaro and Biosca 1996). Traditionally, biochemical assays have been used to distinguish among biotypes. Biotype 1 was positive for indole production, ornithine decarboxylase activity, growth at 42C, and acid production when grown in the presence of mann itol or sorbitol (Tison et al. 1982, Biosca et al. 1996). Conversely, biotype 2 was nega tive for all these traits. Recent studies comparing V. vulnificus biotypes showed that traditi onal biochemical tests were not adequate for differentiation. Analysis of biotype 2 isolates uncovered several discrepancies in the classic bi ochemical differences. For exam ple, some biotype 2 strains were positive for indole and ornithine decar boxylase production (Biosca et al. 1997). Consistent distinctions that remain include the obligate pathogenicity of biotype 2 to eels and lack of growth at 42C. These biot ypes are also distingu ished serologically by antibody to LPS using agglutina tion tests. Biotype 1 is sero logically heterogeneous, while biotype 2 is homogeneous for serovar E (T ison et al. 1982, Biosca et al. 1996). Given the level of specificity and cost effectiveness, serology has been pr oposed as a means of classifying V. vulnificus biotype 2 as serovar E (Biosca et al. 1997). A third biotype was identified in 1999. Bi otype 3 is indole positive like biotype 1, but has several characteristics that are atypical for most V. vulnificus . Biochemical differences include a lack of fermentation of salicin, cellobiose, citrate, and lactose. These results, along with molecular typing, le d to the new biotype designation (Bisharat et al. 1999). Biotype 3 also di splayed differences in pathogenicity compared to the other biotypes with no reports of fatal human inf ections thus far, nor is it known to be pathogenic to eels or mice (Bisharat et al. 1999). Human disease caused by V. vulnificus usually occurs only as isolat ed cases distributed over several months. However,

PAGE 24

9 biotype 3 strains produced an outbreak in Israel whereby a cluster of 33 cases of V. vulnificus infection were reported in the summer of 1996, with 62 total cases occurring between May 1996 and December 1997 (Bisharat and Raz 1996, Bisharat et al. 1999). All cases were associated with skin exposur e to live fish harvested from aquaculture ponds. Analysis of clinical isolates gather ed from patients during the outbreak revealed all of the infections were caused by a single, clonal strain of biot ype 3 (Bisharat et al. 1999). Interestingly, environmental samples obtained from fish and pond water yielded only biotype 1 isolates, and these strains have not been linked to di sease in that region (Bisharat et al. 1999, Bish arat et al. 2005). Multi-locus sequence typing (MLST) eval uation using STRUCTURE analysis of V. vulnificus isolates from various sources worl dwide divided most strains into two distinct populations (B isharat et al. 2005). Interestingly, the biotype 3 strain did not fall into either of these populations, but instead fell between them, indi cating that biotype 3 may be a hybrid genome of the two populat ions (Bisharat et al. 2005). STRUCTURE analysis also was used to evaluate the ancestral sources of V. vulnificus . This analysis showed that biotype 3 wa s equally related to both V. vulnificus populations, and the clonal nature of the pathogen suggested th at hybridization of population genomes may have occurred relatively recently (Bisharat et al. 2005). Epidemiology of V. vulnificus Vibrio vulnificus is the leading cause of seafood-related illness in the U.S., producing at least 95% of all seafood-rela ted deaths (Feldhusen 2000). Localized infection may be manifested in wounds that are exposed to water harboring the bacteria, while systemic infection may be contracted through the consumpti on of raw shellfish, particularly oysters (Blake et al. 1979). The mortality rate is lower for wound infections

PAGE 25

10 (~25%) than for systemic diseas e (>50%). Wound infections by V. vulnificus are characterized by painful swelling and redne ss, fluid accumulation around the infected area, and eventual necrosis of surrounding tissue (Bowdre et al. 1983, Kl ontz et al. 1988). Symptoms of systemic infection by V. vulnificus include fever, chills, nausea, and hypotension, and death can occur within 24 hours of shellfish consumption (CDC 1993, Hlady and Klontz 1996). Another unique char acteristic of systemic disease is the formation of bullous lesions, usually occurri ng in the extremities of patients. Although deadly, V. vulnificus disease typically occurs only in individuals with underlying disorders such as diabetes, cancer, compromised immune systems, liver disease, or hemochromatosis (iron overload disease). Individuals with compromised immune systems or chronic liver disease can be up to 80 times more likely than healthy individuals to develop prim ary septicemia (CDC 1993). Disease incidence of V. vulnificus peaks yearly between April and September and correlates with increased temperature of coastal waters. Generally, warmer water temperatures (>20C) coincide with higher ba cterial numbers in environmental samples. Seawater can contain between 101 and 104 CFU/mL of V. vulnificus (Oliver et al. 1982, Wright et al. 1996, Randa et al. 2004). Conve rsely, during winter months (particularly December through March) when water temperatures are lower, V .vulnificus often drops to undetectable levels (Tamplin et al . 1982, Kelly 1982, Hlady and Klontz 1996, Wright et al 1996). The number of V. vulnificus isolated from oysters s hows similar fluctuations in response to water temperature. In warm er water temperatures, the concentration of V. vulnificus in oyster tissue can sometimes reach 105 CFU/g, but in cold water

PAGE 26

11 temperatures, concentrations range from undetectable to 103 CFU/g (Wright et al. 1996, Motes et al. 1998). Loss of culturability during winter months may be due to the induction of a viable but nonculturable state (VBNC). VBNC is thought to be a dormant state that occurs in gram-negative bacteria whereby the bact eria are not culturable on standard microbiological media even after prolonged incu bation (Nilsson et al. 1991, Stelma et al. 1992). In V. vulnificus , the VBNC state is characterized by changes in membrane composition, shifts in morphology, and altered RNA and DNA content (Linder and Oliver 1989, Oliver et al. 1991, Weichart et al . 1997). It is induced by cold temperatures (5C) within 7 days, and resu scitation out of the VBNC state can be brought about by incubation at higher temperatur es (Oliver et al. 1991, Nilsso n et al. 1991). Exposure of V. vulnificus cells to a natural aquatic habitat demonstrated that induction into and resuscitation out of VBNC can occur in the environment (Oliv er et al. 1995). Vibrio vulnificus remains pathogenic even when in the VBNC state as evidenced by death of iron-loaded mice inject ed intraperitoneally with VBNC Vibrio vulnificus . Culturable V. vulnificus cells were also isolated from the peritoneal cavity of these fatally infected mice, demonstrating that resuscitati on of VBNC cells within the host can result in lethal infections (Oliver and Bockian 1995). However, the 50% lethal dose (LD50) in iron-loaded mice was 7.4 x 105 for VBNC cells compared to 7.5 x 101 for vegetative cells, indicating that although they remain ed pathogenic virulence of VBNC was diminished. The ability to retain some de gree of virulence suggests VBNC cells within oysters have the potential to cause human disease and has important implications for the seafood industry. Post-harvest treatment of oysters typically involves freezing or

PAGE 27

12 cooling, which could potentially induce th e VBNC state and prevent detection by standard microbiological methods currently used by the oyster industry to identify V. vulnificus . Pathogenesis of V. vulnificus Numerous factors have been implicated in the virulence of V. vulnificus and include the production of siderophores, a metalloprot ease, and an extracellular cytotoxic hemolysin. The expression of pili, flagella, lipopolysaccharide (LPS), and capsular polysaccharide (CPS) on the cell surface are also thought to contribute to virulence. Quorum sensing affects regulati on of some of these genes and hence, may also be related to virulence. Vibrio vulnificus infection in humans is commonly associated with diseases such as cirrhosis and hemochromatosis that lead to increased iron levels in the blood, and the infectious dose of V. vulnificus in mice directly correlates to serum iron levels (Wright et al. 1981). Injection of clinical V. vulnificus strains into non-iron treated mice resulted in LD50 values ranging from 4.4 x 104 to 3.0 x 108 (Wright et al. 1981, Stelma et al. 1992, Kim and Rhee 2003, Lee et al. 2004). Howe ver, injecting mice with iron before challenge with V. vulnificus lowered the LD50 values to as few as 1 cell and shifted the mortality rate in mice to 100% (Wright et al . 1981, Stelma et al. 1992). Iron is required for bacterial growth. However, in huma n serum most iron is bound to transferrin (Weingberg 1978). Bacteria overcome this challenge by producing siderophores, which are iron chelators that can scav enge iron from saturated transf errin or other iron-binding compounds and transport the metal to the bacterial cell (Weinberg 1978). Vibrio vulnificus produces two types of siderophores: catechol and hydroxamate (Simpson and Oliver 1983). Catechol (VenB) sider ophores can use iron from highly saturated

PAGE 28

13 transferrin, and virulence of V. vulnificus was associated with the ability of the bacterium to utilize iron (Morris et al. 1987). A venB deficient mutant generated by transposon mutagenesis was less virulent (LD50 of 2.6 x 106) in non iron-loaded mice compared to the parent strain (LD50 of 7.4 x 104), displaying the role of siderophores in virulence (Litwin et al. 1996). Additionally, examination of V. vulnificus isolates revealed that avirulent strains displayed little or no sider ophore production compared to virulent strain (Stelma et al. 1992). However, this observa tion conflicted with a previous report that siderophore production in an avirulent isolat e was only slightly diminished (Simpson and Oliver 1983). Together these results sugge st that although sider ophores are required for virulence, they are not the sole determinant of virulence. Another potential viru lence factor of V. vulnificus is the production of an extracellular cytolysin that increases vascular permeability and tissue necrosis and is hemolytic for mammalian erythrocytes (Kre ger and Lockwood 1981, Morris et al. 1987). The gene encoding the cytolysin is vvhA , and the deduced amino acid sequence is similar to the sequence of hemolysins produced by V. cholerae El Tor and other Vibrio spp . (Yamamoto et al. 1990, Wright a nd Morris 1991). Injection of V. vulnificus cytotoxin into mice resulted in fluid accumulation around th e lungs, intestinal irregularities, partial paralysis, and was ultimately lethal (Krege r and Lockwood 1981). However, inactivation of the cytolysin structural gene did not affect virulence (Wright and Morris 1991). Intraparetoneal injection of iron-lo aded mice showed no difference in LD50 between the parent and mutant strain, and mice injected with a vvhA transposon mutant displayed tissue damage and necrosis similar to the wild type, which indicated that the presence of

PAGE 29

14 the cytolysin is not solely responsib le for the tissue damage caused by V. vulnificus (Wright and Morris 1991). A related virulence factor is the producti on of an extracellular protease (VvpE), which degrades the hemolysin in vitro as indicated by enhanced cytolysin activity in metalloprotease ( vvpE ) mutants (Shao and Hor 2000). This metalloprotease also increases vascular permeability, and experiment al injections led to cutaneous lesions and edema that are characteristic of systemic disease (Miyoshi and Shinoda 1988). However, both virulent and avirulent strains of V. vulnificus produce cytolysin and protease (Kreger and Lockwood 1981, Morris et al. 1987). Fu rthermore, although enhanced cytolysin activity was observed in metalloprotease mutant s, lethality was unchanged. These results indicated that the roles of both protease and cytolysin in V. vulnificus virulence are limited (Shao and Hor 2000). Along with secreted proteins, surface structur es also contribute to the virulence of V. vulnificus . Electron microscopy was used to identify pili on the surface of V. vulnificus cells, and researchers noted a correlation between the presence of pili and strain origin (Gander and LaRocco 1989). C linical isolates were more likely than environmental isolates to have pili, sugge sting their presence is a potential virulence factor. Initial experiments investigating the role of pili in V. vulnificus pathogenesis used a pili-deficient mutant containing a disrupted pilD gene, which encodes for a type IV peptidase/N-methyltransferase (P aranjpye et al. 1998). The pilD mutant displayed significantly less adherence to HEp-2 cells, had reduced secretion of cytolysin, protease and chitinase, and showed reduced cytotoxi city compared to the wild type parent (Paranjpye et al. 1998). Intr aperitoneal inje ction of the pilD mutants into iron-loaded

PAGE 30

15 mice resulted in a 102 CFU increase in LD50 compared to the wild type strain; however, complementation did not fully restore lethality to wild type levels (Par anjpye et al. 1998). Researchers noted the pilD mutation yielded pleiotropic de ffects in pili expression and suggested that either multiple se creted products are involved in V. vulnificus virulence or close contact mediated by pili is required fo r cytotoxicity (Paranjpye et al. 1998). A nonpolar mutation was also ge nerated in another gene ( pilA ) found within the pilABCD gene cluster. This gene encodes a pili structural subunit, but electron microscopy revealed that pili surface expres sion of by the mutant wa s not different from the wild type (Paranjpye and Strom 2005). Mutation of pilA did, however, lead to significantly less adherence to HE p-2 cells compared to the w ild type, demonstrating that V. vulnificus pili has a role in attachment to human epithelial cells (Paranjpye and Strom 2005). Intraperitoneal injection of the pilA mutant into iron-treated mice led to a 10-fold increase in LD50 compared to the wild type strai n, indicating the mutant was somewhat less virulent than the parent stra in and that pili play a role in V. vulnificus pathogenesis. Transposon mutagenesis and gene specific deletions were used to identify the presence of flagellum as an a dditional virule nce factor of V. vulnificus (Kim and Rhee 2003). Transposon insertion into the flagellar gene flgC (which encodes a flagellar basal body) produced a strain that showed signi ficant decreases in motility, adhesion to epithelial cells, and cytotoxicity in HeLa cells compared to the unaltered parent (Kim and Rhee 2003). Intragastric infection of non ir on-treated mice with the transposon mutant resulted in a 1000-fold increase in LD50 compared to the wild type, indicating that expression of flagella is re quired for virulence (Kim and Rhee 2003,). However, the flgC mutation was polar and likely effected expres sion of downstream ge nes, suggesting that

PAGE 31

16 factors other than flgC may be responsible for the obser ved differences in cytotoxicity and lethality (Kim and Rhee 2003). Site-sp ecific deletion of the gene encoding the monomeric subunit of the flagellar hook ( flgE ) also led to decreases in motility, adhesion, and cytotoxicity, and intraperitoneal inject ion into iron-loaded mice resulted in a 1000fold increase in LD50 compared to the parent (Lee et al. 2004). However, complementation with an intact flgE gene did not restore LD50 to wild type levels. Lee et al. (2004) hypothesized that the obser ved decreases in motility, adhesion, and cytotoxicity may play a concerted role in re duced virulence. Loss of motility may lead to decreased adhesion, which could inhibit deliv ery of cytotoxins (Kim and Rhee 2003). Kim and Rhee (2003) also suggested that flagella function as a type III secretion system, and loss of flagella may lead to loss of toxin secretion (Kim and Rhee 2003). LPS endotoxin is commonly associated with systemic shock in bacterial disease, and LPS produced by V. vulnificus biotype 1 has been shown to be pyrogenic, making it a potential virulence determinant. However, V. vulnificus LPS-related lethality in animals was lower than that seen from LPS de rived from other gram-negative species (McPherson et al. 1991). Vibrio vulnificus LPS did elicit a small cytokine response in mice and caused release of TNF-alpha; how ever, greater immunogenic responses are produced by capsular polysaccharide (Powell et al. 1997). Together these results indicate that while LPS plays a role in stimulation of host responses, it is not sufficiently immune reactive to account for th e disease characteristics observed during infection. Bacteria are able to co mmunicate and coordinate be havior through the use of signaling molecules in a process termed quor um sensing (Waters and Bassler 2005). Increases in cell density lead to the accumulation of signaling molecules called

PAGE 32

17 autoinducers (AI), which provide gene regula tion once they reach a critical threshold concentration. The use of quorum sensing systems has been widely described in environmental survival and has also been show n to regulate virulence factors. In gramnegative bacteria two quorum sensing system s have been identified and each system involves a different signaling molecule. The first system described in gram-negative species was the LuxI/LuxR system. LuxI is the autoinducer synthase and produces the acyl-homoserine lactone (AHL) autoinducer (Eberhard et al. 1981, Engebrecht and Silverman 1984). LuxR serves as the cytoplasmic receptor of the autoinducer and also functions as a DNA binding transcriptional activator (Engebrecht et al. 1983). AHLs diffuse out of the cell, and the concentr ation of AHL in the surrounding environment increases with increasing cell density (Kapla n and Greenberg 1985). When the signaling molecule reaches a threshold concentration and binds cytoplasmic LuxR, transcriptional activation of a target gene or operon is ach ieved (Stevens et al. 1994). The second type of quorum sensing system uses a furanosyl bor ate diester autoinducer called AI2 (Bassler et al. 1994, Chen et al. 2002). The luxS gene is involved in production of AI2. This system functions in a similar manner to the AHL system, whereby the AI2 signal accumulates and stimulates a different tran scriptional activator (also called LuxR) resulting in target gene expr ession (Swartzman et al. 1992). Vibrio vulnificus possesses a LuxS/LuxR system, and the luxR gene (denoted smcR in V. vulnificus ) encodes a regulator that senses the autoinducer (K im et al. 2003, McDougald et al. 2001). To determine the involvement of the AI 2 quorum sensing in virulence factor regulation in V. vulnificus , mutations in both luxS and smcR were generated. The luxS mutant did not display significant decreases in motility or flagella production but did

PAGE 33

18 show decreased protease production due to re duced transcription of the protease gene ( vvpE ). Interestingly, this mutation displa yed increased cytolysin production which correlated with an increase in transcription of the vvhA gene (Kim et al. 2003). Similarly, the smcR mutant showed decreased protease pro duction with reduced transcription of vvpE and also demonstrated increased cytoly sin production compared to the wild type parent (Shao and Hor 2001). Together, these results suggested that the AI2 system is required for vvpE expression and that quorum sens ing systems potentially play a coordinated role in regulati on, acting as a positive regulator of metalloprotease and as a negative regulator of cytolysin (Shao and Hor 2001, Kim et al. 2003). Mutants of luxS and smcR were also examined for their effect on V. vulnificus virulence in mouse models. Intraperitoneal injection of smcR mutants into iron-loaded mice did not result in significant differences in virulence compared to the wild type (Shao and Hor 2001). However, luxS mutants demonstrated a 1000-fold increase in LD50 when injected into iron-overloaded mice compared to the wild type (Kim et al. 2003). Overall, these results indicated that luxS may regulate factors other than protease and cytolysin and control virulence through a nonsmcR pathway (Kim et al. 2003). A virulence property known to be required for pathogenicity of V. vulnificus is the presence of capsular polysaccharide (CPS). Capsule types vary among V. vulnificus strains, and no one particular type is associated with viru lence; however, a common basic structure includes four sugar residues containing at least one uronic acid (Reddy et al. 1992, Hayat et al. 1993). Virulence of V. vulnificus can be attributed in part to the role of CPS in evasion of the host immune system as it provides resistan ce to opsonization by complement and avoidance of phagocytosis by macrophages (Tamplin et al. 1985,

PAGE 34

19 Tamplin et al. 1983). Investigation of V. vulnificus capsule revealed that it may serve to physically mask immunogenic st ructures that normally w ould activate these nonspecific host responses (Roberts 1996). Yoshida et al. (1985) demonstrated that surface expression of CPS on V. vulnificus cells conferred resistance to the bactericidal effects of serum, while cells with reduced capsule did not display this resist ance. Encapsulated cells were also cleared from the bloodstream more slowly and were more invasive in guinea pig subcutaneous tissue than unencapsu lated cells. CPS also contributed to the overall lethality of the bacterium whereby studies examining the affect of CPS on lethality in iron-loaded mice showed that in traperitoneal injecti on of strains without capsule exhibited much higher LD50 (3 x 105) compared to LD50 (<102) of encapsulated strains (Wright et al. 1990). Capsular Polysaccharide Operon of V. vulnificus The presence of CPS not only affects virule nce, but also accounts for differences in colony morphology. Encapsulated strains produ ce opaque (Op) colonies, while cells with reduced CPS are translucent (Tr). Electron mi croscopy revealed encapsulated cells have a thick, continuous layer of capsule surroundi ng the surface (Yoshida et al. 1985, Wright et al. 1990, Wright et al. 1999). Conversely, Tr colonies have cells that posses thin, patchy areas of capsule and sometimes no capsu le at all (Amako et al. 1984, Yoshida et al. 1985, Wright et al. 1990). The amount of CPS present on the surface of Op cells is influenced by environmental factors. The greatest amount of CPS was expressed by V. vulnificus cells grown at 30C compared to 37C during logarithmic growth (Wright et al. 1999). Investigation into th e role of CPS in the formatio n of VBNC showed that there were no differences between Op and Tr phe notypes in the rate at which these cells

PAGE 35

20 entered or resuscitated out of the VBNC state, suggesting VBNC does not favor one capsular phenotype over anothe r (Oliver et al. 1995). The genes responsible for V. vulnificus CPS transport and expression were identified through transposon muta genesis that generated Tr co lonies from Op wild type strains (Wright et al. 2001, Chatzidaki 2004). The organization and sequence of V. vulnificus CPS genes demonstrated homology w ith group 1 CPS operons previously described in E. coli (Whitfield and Roberts 1999). E. coli group 1 capsules are defined by the presence of the wza wzb wzc genes in the CPS operon, a nd a similar gene cluster was found in V. vulnificus (Figure 2-1; Whitfield and Roberts 1999, Rahn et al. 1999, Chatzidaki 2004). Wza is an outer membrane lipoprotein involved in surface assembly of group 1 capsules and transport of polysaccharide to the outer surface (Drummelsmith and Whitfield 1999, Paulsen et al. 1997). Wza monomers come together in a multimeric complex to form a ring-like channel reminiscent of secretins used in type II and type III secretion systems (Drummelsmith and Wh itfield 2000, Whitfield and Paiment 2003). Formation of this channel allows transport of capsule polymer to the outer membrane. Studies have also demonstrated that wza mutants were unable to accumulate polymerized capsule within the cell, indi cating the involvement of a feedback mechanism in capsule regulation (Drummelsmith and Whitfie ld 1999, Whitfield and Paiment 2003). The remaining two genes that define the group 1 CPS operon, wzb and wzc , encode proteins that have cooperative functions. Wzc is a tyrosine kinase and Wzb is its cognate phosphotase (Drummelsmith and Whitfield 199 9, Wugeditsch et al. 2000, Reid and Whitfield 2005). In E. coli K30, Wzc is involved in the surface assembly of the capsular

PAGE 36

21 CONSERVED TRANSPORT REGION BIOSYNTHETIC REGION A) V. vulnificus MO6-24/O group 1 CPS operon: B) V. fischeri group 1 CPS operon: C) E. coli K30 group 1 CPS operon: ORF1 wza HP1 wzb wzc wecC wbpP wzx HP3 HP4 rfaG wbjB rmlD wbjD wbuB wbfT wbfU wbfY-----wbfV R1 R1 R3 ORF1 wza HP2 wzb wzc ------------------------------------POLYMORPHIC GENES-----------------------------wzi wza wzb wzc wbaP wzy orfY wcaN wcaO orfZ wbaZ wzx gnd IS1 ugd manC manB IS1 Figure 2-1. Genetic organizati on of group 1 CPS operons. Adapted from ChatzidakiLivanis et al. 2006. layer. It is located in the plasma membrane where it forms an oligomer that possesses two transmembrane domains (Paulsen et al. 1997, Drummelsmith and Whitfield 1999, Wugeditsch et al. 2001, Paiment et al. 2002, Wh itfiled and Paiment 2003). The protein’s multiple tyrosine sites undergo cycles of phosphorylation and dephosphorylation, and this process is required for capsule assembly (W ugeditsch et al. 2001, Whitfield and Paiment 2003). Wzb is a cytoplasmic acid phosphotase th at functions to catalyze the removal of phosphates from Wzc (Whitfield and Roberts 1999, Vincent et al. 2000, Wugeditsch et al. 2001). Wzc also undergoes autophosphorylation using ATP as a substrate, and the use of ATP may indicate an additi onal role of Wzc in capsule assembly where it potentially serves to “gate” the channel formed by Wza (Vincent et al . 2000, Whitfield and Paiment 2003). The wza wzb wzc genes are needed for capsule expression in E. coli , and homologous gene organization and deduced amino acid identity were found in V. vulnificus (61%, 55% and 47% for Wza, Wzb and Wzc, respectively; Wright et al. 2001, Chatzidaki 2004). Although the conservati on of these transport genes designated this CPS operon as a group 1, the V. vulnificus operon also displayed unique sequences

PAGE 37

22 compared to E. coli (Chatzidaki 2004). Differences included the presence of a gene sequence located between wza and wzb that encodes a hypothetical protein (HP), as well as the presence of extragenic repetitive elements dispersed among the transport gene region (Figure 2-1). This HP region was found in one other Vibrio spp . ( V. fischeri ); however, a repetitive element (R1), consisti ng of multiple copies of the same 8-bp subunit (ACAGGACC) that immediately flanked wzb , was not seen in V. fischeri . Another repetitive element was also identifi ed downstream of the conserved transport genes in the CPS operon. This element rese mbled R1 with linear, tandemly, repeated subunits, but the subunit length (7-bp) a nd sequence (CTAGAAC) were different. Interestingly, identical repetitive elements were described upstream of LPS and CPS operons in V. cholerae but were not found in group 1 CPS operons of other species (Yamasaki et al. 1999). Additional genes in the group 1 CPS oper on encode biosynthetic function and are polymorphic for deduced amino acid sequences among V. vulnificus MO6-24/Op and sequences available from the two available V. vulnificus genomes in GenBank. Other loci related to capsular expre ssion have been identified and may be outside of the group 1 operon in V. vulnificus . An epimerase gene, which is e ssential for surface expression of CPS, was found in V. vulnificus strain 1003 and shows high homology to an epimerase responsible for capsule production in V. cholerae O139 (Comstock et al. 1996, Zuppardo and Siebeling 1998). The V. vulnificus epimerase was located near wecA (a glycosyltransferase), which transf ers capsule building blocks to a lipid carrier. Several glycosyltransferase enzyme s and biosynthetic genes ( rml ) have been identified in V. vulnificus and are essential for surface expressi on of capsule (Smith and Siebeling

PAGE 38

23 2003). Further analysis revealed the presence of three insertion se quence (IS) elements located in close proximity to genes required for capsule expression (Smith and Siebeling 1998). Noteworthy among these is IS492, whic h is known to be involved in capsular phase variation of Psuedomonas altantica (Bartlett and Silverman 1989). In this bacterium, the insertion of the IS element into the eps locus disrupts capsule expression which is subsequently restored upon excisi on of the element. However, IS492 is not related to the group 1 CPS operon in V. vulnificus MO6-24/Op, and its role in expression and regulation of V. vulnificus capsule is unknown. Regulation of Capsular Polysaccharide Expression Surface expression of CPS in V. vulnificus is required for evasion of host immune responses and therefore pathogenesis. C onversely, the role of CPS expression in environmental survival is still unclear due to conflicting reports as to the affect of CPS expression on biofilm formation. Joseph and Wr ight (2004) reported that Tr isolates with decreased CPS expression showed significantly better attachment to surfaces and greater biofilm formation compared to fully encapsulate d Op strains. However, other studies did not observe significant differen ces in biofilm formation by Op compared to Tr strains, (Grau et al. 2005). These findi ngs may suggest divergent roles for Op and Tr variants depending strain or CPS type. CPS expression can be influenced by th e external conditions encountered by the organism and changes in expression may be relate d to survival of the bacteria in different habitats (host or environment). Re gulation of capsular polysaccharide in E. coli occurs via the Rcs (regulator of capsule synthesis) sensor-effector system. This system was first described for regulation of colonic acid synt hesis, but also regulates expression of a variety of capsule types including group 1 (Gottesman et al. 1985, Brill et al. 1988, Stout

PAGE 39

24 and Gottesman 1990, Bernhard et al. 1990, Gottesman and Stout 1991, McCallum and Whitfield 1991, Houng et al. 1992). However, unlike colonic acid synthesis whereby the Rcs system directly influences transcripti on of capsular genes, regulation of group 1 capsules by Rcs occurs indirectly through up -regulation of biosynthetic precursors (Rahn and Whitfield 2003). The Rcs system utilizes a transmembrane sensor kinase (RcsC), a response regulator (RcsB) and an auxiliary regulatory prot ein (RcsA). Environmental stimulation of the RcsC sensor leads to phosphorylation of RcsB. Interaction of the activated RcsB with RcsA forms the RcsA B complex, which then binds to the RcsAB box (a 14-bp consensus sequence (5’-TaAGaat atTCctA-3’) found immediately upstream of biosynthetic loci of nume rous group 1-like polymers) and influences transcription of CPS genes (Stout et al. 1991, Wehland et al. 1999, Wehland and Bernhard 2000). In E. coli K-12, the Rcs system controls transcription of the coloni c acid gene cluster (for a review see Majdalani and Gottesman 2005). Cross complementation between colonic acid rcsB and group 1 CPS rcsB suggested the Rcs system ma y also regulate transcription of group 1 capsule genes (Jayaratne et al. 1993). Inactivation of rcsB inhibited expression of colonic acid CPS. However, it did not completely abolish group 1 CPS expression in E. coli K30, leading research ers to propose that the Rcs system was only important for high levels of group 1 CPS expr ession (Jayaratne et al. 1993). Further studies using inactivated rcsB showed that it did not dimini sh transcription of the group 1 CPS gene cluster in E. coli K-30, and therefore was not re quired for expression of K30 CPS (Rahn and Whitfield 2003). Recently, an RcsAB box was identified upstream of galF (a gene involved in the production of sugar nucleotide precursors), a nd increases in GalF production correlated

PAGE 40

25 with increases in CPS expression (Rahn and Whitfield 2003). Furthermore, increases in RcsB copy number increased galF transcription, indicating the Rcs system does not directly regulate group 1 capsule in E. coli . However, it can indire ctly influence levels of CPS production by increasing galF transcription which leads to an increase in biosynthetic precursors (Ra hn and Whitfield 2003). Capsule expression is regulated through the Rcs system in a variety of bacterial species that occupy different ecological niches. Thus, it is hypothesized that the environmental stimuli that activate the RcsC sensor varies for each organism. Few specific environmental triggers have been identified; however, changes in osmolarity have been shown to activate the Rcs system in E. coli and Salmonella typhi (Sledjeski and Gottesman 1996, Arricau et al. 1998). The role of Rcs in regulation of V. vulnificus is unknown, but homologous sequences are present in both of the genomes available in GenBank. Phase Variation Vibrio vulnificus undergoes switching between Op and Tr morphologies that indicates variability in CPS expression. The level of reversion between these phenotypes is on the order of 10-3 to 10-4 in both directions in some strains, and this reversible, heritable switch resembles phase variation (Yoshida et al. 19 85, Wright et al. 1990). Phase variation is seen in ma ny bacteria and can involve a variety of surface structures, including capsule, pili, fimbri ae, and outer membrane protei ns. Phase variation occurs both in vivo and in the environment (for a review see van der Woude and Baulmer 2004, Lim et al. 1998). It is hypothesized that th is phenomenon allows fo r biological diversity, which leads to increased survival of bacter ial populations due to the avoidance of host defenses and better adaptation to changing c onditions in the environment (van der Woude

PAGE 41

26 and Baulmer 2004, Henderson et al . 1999, Hallett 2001). Survival in the host is enhanced by variation of antigenic structures that function in the evasio n of adaptive immune responses. For example, Borrelia burgdorferi (the causative agent of Lyme disease) changes the expression of its surface lipoproteins allowing it to cause persistent infection (Rosa et al. 1992). Neisseria gonorrhoeae evades adaptive responses through ON/OFF variation of multiple adhesions including type IV fimbriae, LPS and opacity proteins (for a review see van der Woude and Baulmer 2004). The precise role of phase variation in envi ronmental survival is less clear; however, two theories have been proposed. The first th eory suggests that phase variation serves to generate mixed populations, and when new e nvironmental conditions are encountered the better suited variants survive allowing the population as a whole to persist (Dybvig 1993). The second theory proposes that phase variation results in one highly adaptable population that is able to quickly respond when environmental challenges occur (Saunders 1994). Phase variati on is found in an increasing nu mber of bacteria, but few genetic mechanisms have been described. Known mechanisms of phase variation include: DNA inversion, slip strand misp airing, DNA recombination and differential DNA methylation (McClain 1991, Ou J et al. 1988, Levinson and Gutman 1987, van Belkum et al. 1998, Hammerschmidt et al. 1996, Ringquist and Smith 1992). The genetic mechanism(s) responsible for phase variation in Vibrio species are unknown. Phase variation via site-specific DNA inversi on is frequently seen in both bacteria and eukaryotes and can occur in chromoso mes, plasmids and bacteriophage (Dybvig, 1993). DNA inversions involve specific enzy mes (recombinases or integrases) that require short regions of DNA w ith sequence similarity, and reversions can result in

PAGE 42

27 ON/OFF, biphasic, or multiphasic phase vari ation (van der Woude and Baulmer 2004). The inverted region typically co ntains promoter or regulatory elements. Inversion alters the spatial relationship of these elements, resu lting in variations in gene expression. An example of ON/OFF phase variation thr ough DNA inversion is seen in fimbriael expression in E. coli (Henderson et al. 1999). Inverted repetitive elements (9-bp each) provide regions of sequence simila rity and flank the promoter of fimA , which encodes the main fimbriael subunit. Two site-specifi c recombinases (FimB and FimE) use the repetitive elements to mediat e inversion of the promoter. When the promoter is in the proper orientation for transcrip tion it is said to be “ON.” Inversion orients the promoter in the direction opposite of fimA (“OFF”) leading to the formation of a Rho-dependent terminator and arresting fimA expression. Thus, surface expression of fimbriae is eliminated. DNA inversion also leads to biphasic phase variation which regulates expression of flagellar proteins in Salmonella enterica serovar typhimurium . Two genes, fliC and fljB , encode for antigenically distinct prot eins that make-up flagellin (Simon et al. 1980). The gene fljA encodes for a repressor that controls FliC expression. The fljA gene is located adjacent to fljB and both are controlled by the same promoter. When the promoter is in the ON orientation, both fljB and fljA are expressed leading to repression of fliC and surface expression of FljB flagella. Inversion of the promoter abolishes transcription of fliA stopping fliC repression; thus, allowi ng for expression of FliC flagella (Simon et al. 1 980, Henderson et al. 1999). Slip strand mutagenesis (SSM) is anothe r method of phase variation, and like DNA inversions, also utilizes repetitive segments of DNA. Repetitive elements have a wide array of structural characteristics. They may contain tracts of a single nucleotide or

PAGE 43

28 several multimeric repeats, which can be homogeneous or heterogeneous. Repeat subunits can be arranged in a linear, palindrom ic, or inverted fashion, and they may occur contiguously or be interspersed throughout the chromosome (van Belkum et al. 1998, Henderson et al. 1999, Hallet 2001). Repetitiv e elements involved in SSM typically consist of linear, tandemly repeated subunits that are 1 to 7-bp in length. Repeats provide a hot spot for mispairing between mother and daughter strands during DNA replication, which can result in deletion or insertion of one or more repetitive element subunits on the daughter strand (Levinson and Gutman 1987, van der Woude and Baulmer 2004). Changes in the number of repetitive subunits resu lts in a shift in the translational reading frame, which leads to phase variable expressi on of a protein if the location of the repeats is such that either transcript ion or translation of a gene is affected. The location of repetitive elements determines whether SSM a ffects transcription or translation. If the repetitive tract lies upstream of the gene, transc ription is altered; if it lies within the gene translation is altered. Gene expression is directly linked to the st rength of the promoter that controls the gene. RNA polymerase binds the promoter re gion that lies between the -10 and -35 sites upstream of the gene(s) to be expressed. A ny variation in the spaci ng between these sites affects the levels of transcription. Rep eats located within th e promoter region can undergo SSM. The resulting insertions or deletions influence the strength of the promoter; thus, affecting expression (Wille ms et al. 1990, van der Woude and Baulmer 2004). Change in promoter strength can re sult in ON/OFF phase va riation, and can also lead to variations in gene expression that are low or high. This phenomenon is seen in H. influenzae where LKP fimbriae expression is cont rolled by dinucleotide (TA) repeats

PAGE 44

29 located within the promoter re gion (van Belkum et al. 1998). When 9 of the TA repeat subunits are present expression is off, when 10 are present ex pression is at its maximum, and when 11 are present fimbriae expression is reduced (Mhlanga-Mutangadura et al. 1998). Repetitive elements found outside the prom oter but upstream of the gene can also influence the level of transcription by alte ring the binding capabiliti es of activators or repressors targeting that re gion (Willems et al. 1990). Slip strand mutagenesis affects translation when repeats are located within a gene (De Bolle et al. 2000). In H. influenzae phase variation in the e xpression of the mod gene is influenced by changes in the number of tetr anucleotide repeats. Changes in the reading frame result in the premature formation of a stop codon, and formation of a truncated protein. Translation of opacity proteins of N. gonorrhoeae and N. meningititdis are also regulated through SSM due to the presence of a repeated pentamer sequence located within the opa gene. When 6, 9 or 12 subunits are present the initiation codon is in frame and results in a functional pr otein. However, any other number of repetitive subunits yields proteins that are tr uncated and thus, nonfunctional. Another mechanism of phase variati on is general DNA recombination which typically takes place betweens regions of hi gh homology. This mechanism is dependent on general DNA repair and maintenance proteins , and can utilize a variety of pathways. N. gonorrhoeae undergoes phase variation of its t ype IV pilus through recombination between distinct loci: pilE (the structural subunit of the type IV pilus) and pilS (transcriptionally inactive alleles due to the lack of a 5 coding region). These regions can be located as many as 900-bp apar t (Haas et al. 1992, Seifert 1996, Hallet 2001, Henderson et al. 1999). Intramolecular reco mbination between thes e loci results in

PAGE 45

30 exchange of DNA cassettes allowing the unidirec tional transfer of a specific segment of the pilS locus which replaces a region of pilE . Recombination may utilize a repetitive element located at the 3 end of the pil loci, and results in changes in pili expression or eliminates expression altogether. (Seifert 1996, Mehr and Seifert 1998). Differential DNA methylation di ffers from other mechanisms of phase variation in that it leads only to alterations of phenotype (not genotype), and is termed epigenetic. Methylation of adenosine by deoxyadenosin e methylase (Dam) at specific target sequences affects the binding capabilities of re gulator proteins, leadi ng to phase variable expression of genes or operons. This type of phase variation c ontrols expression of polynephritis associated pili (pap) in E. coli , and is dependent on Dam, two target sequences (GATC) which lie in the pap regulatory region, and the global response regulator Lrp (van der Woude et al. 1996, fo r reviews see Henderson et al. 1999, van der Woude and Baulmer 2004). Phase variation of pap results from the binding of Lrp to specific sites upstream of the main promoter , pBA, influencing the expression of the operon. Lrp preferentially bind to the target sequence locate d distal (GATCdist) to pBA compared to the target sequence located proxi mal (GATCprox) to this promoter (van der Woude et al. 1996). Methylation of GATCdis t causes Lrp to bind to GATCprox turning pap expression “OFF.” However, methyla tion of GATCprox promotes Lrp binding to GATCdist turning pap expression “ON,” enabling attachment to the host. Role of RecA in Phase Variation As mentioned previously, DNA recombin ation is a known mechanism of phase variation, and it can be either dependent or independent of RecA. RecA is an enzyme that is critically involved in a variety of cellular processe s including repair of damaged DNA and homologous recombination. Damage to DNA can result in nicks in one of the

PAGE 46

31 double helices leading to a free single strand. RecA binds and stabi lizes single stranded (ss)DNA. A second binding site binds to a homologous area of double stranded (ds)DNA forming a complex between the two regions, which allows for invasion of the (ss)DNA into the (ds)DNA (Weaver 2002). RecA then catalyzes strand exchange between the donor and recipient DNA molecules, and cro ssover between homologous regions on the same chromosome may result in deleti on or insertion of intervening sequence (Kowalczykowski et al. 1994, Weaver 2002). R ecA also plays a critical role as a stationary phase enzyme in the bacterial stress/SOS response. RecA activity is initiated by DNA damage and the formation of single st randed breaks. Binding of RecA signals expression of SOS genes, which play a role in a variety of repair mechanisms, including recombination (Shinagawa 1996). Multiple homologous recombination pathways involve RecA, including the RecBCD and RecF pathways (Kowalczykow ski 1994, Amundsen and Smith 2003). In the RecBCD pathway, the RecBCD enzyme co mplex functions as both a nuclease and a helicase. After DNA breakage has occurred, the enzyme binds free (ds)DNA and degrades it. The exonuclease activity continue s until the complex encounters a chi site (a short DNA sequences (5’-GCTGGTGG-3’) that provides a hotspot for recombination). The complex then functions as a helicase to unwind the donor DNA and degrade one of its strands. RecA binds the resulting ( ss)DNA, and this complex can invade the homologous (ds)DNA molecule resulting in exchange between the two regions. The RecF pathway involves several enzymes in addition to RecA. These include: RecF, RecR, RecO, RecJ, and RecQ (for reviews see Kowalczykowski 1994, Amundsen and Smith 2003). The individual activitie s of each enzyme are known, however, the

PAGE 47

32 precise manner in which they function cooperativ ely is still unresolved. It is known that RecF acts first to bind DNA. Then, RecR e nhances the ATPase activity of RecF, while RecO promotes the exchange of (ss)DNA with RecA (Umezu et al. 1993, Hedge et al. 1996, Shan et al. 1997, Kantake et al. 2002). RecJ functi ons as a single-stranded exonuclease, and catalyzes the removal of deoxy-nucleotide monophosphates from DNA. RecQ serves as a helicase (Ivancic-Bace et al. 2003). RecA-dependent mechanisms have been show n to be involved in phase variation in a variety of organisms. Homologous reco mbination between silent and expressed pil loci in N. gonorrhoeae (which result in changes in pili expression) is mediated by RecA. Psuedomonas tolaasii also undergoes switching from an Op to a Tr phenotype through recA -dependent recombination, resulting in a reversible 661-bp duplication in the putative kinase domain of a regulatory locus (Sinha et al. 2000). A similar phenomenon is seen in H. influenzae , whereby the capsule locus cont ains segments of duplicated DNA that are directly repeated. Thes e repeated regions encompass the bexA gene, which is required for capsule export. Recombination results in loss of the tandem duplication as well as a portion of bexA , and thus, loss of capsule expression (Hoiseth et al. 1986).

PAGE 48

33 CHAPTER 3 MATERIALS AND METHODS Bacterial Strains and Culture Conditions Vibrio vulnificus strains (Table 3-1) were grown in Luria-Bertani broth (LB; 1.0% tryptone, 0.5% yeast extract, a nd 1.0% NaCl) or on LB agar (LA; 1.5% Bacto Agar) at 30 or 37C. Clinical strain MO6-24/Op was us ed for mutational analysis. When required, kanamycin (50-300 g/mL), tetracycline ( 10 g/mL), trimethoprim (50 g/mL) and polymyxin (50 g/mL) were added to cultures of V. vulnificus . Escherichia coli strains S17pir (Simon et al. 1983), JM109 (Promega), and One Shot TOP10 (Invitrogen) were used for complementation and cloning experiments. E. coli strains were grown as above but with different concentra tions of tetracyclin e (30 g/mL), trimethoprim (50 g/mL), ampicillin (100 g/mL), and kanamycin (50 g/mL). Unless otherwise stated, media were purchased from Difco, and chemicals were purchased from Sigma. All strains were stored at C in LB with 50% (v/v) glycerol. Induction of Phase Variation Environmental factors including medium composition, temperature, and pH have been shown to influence levels of phase variat ion in a variety of b acterial species (Serkin and Seifert 2000, Gally et al. 1993, Crost et al. 2004, McCarter 1998, Ball et al. 1992). For investigation into conditions that incr ease capsular polysaccharide (CPS) phase variation of V. vulnificus , individual opaque (Op) or tr anslucent (Tr) colonies were inoculated into LB and grown overnight ( o.n.) at 37C with shaking (120 rpm). Cells were washed three times by centrifugation for 20 min at 4000 rpm (Eppendorf 5810R)

PAGE 49

34 Table 3-1. Summary of V. vulnificus strains Strains CPS Allele Description Reference MO6-24 1 Encapsulated, virulent (blood) Wright et al. 2001 LC4 1 Encapsulated, virulent (blood) Wright et al. 1990 C7184 1 Encapsulated, virulent (blood). Wright et al. 1981 E4125 1 Encapsulated, virulent (blood). Kreger and Lockwood, 1981 CMCP6 1 Encapsulated, virulent (blood) Kim et al. 2003 YJ016 2 Encapsulated, virulent ( hospital) Chen et al. 2003 and then resuspended in phosphate buffered sa line (PBS). Final pellet resuspension was done in the medium to be used in inducti on assays. The optical density at 600 nm was measured, and the concentration of the washed culture was calculated from a standard curve based on plate counts. Washed Tr cells were transferred into media (45 mL) in 250 mL flasks prepared with 1% proteose peptone #3 and 1% NaCl (PP3) at pH 7.0. Washed Op cells were transferred into flasks with media prepared with either PP3 at pH 6.5, 7.0, or 8.0 (adjusted using 1N HCl or 3M NaOH where appropriate), or medium prepared with 1% proteose peptone #1 a nd 1% NaCl (PP1) at pH 7.0, LB, or PBS. Washed cells were also inoculated into 15 ppt artificial seawater (ASW, Instant Ocean purchased from Fisher Scientific). A standa rdized initial culture concentration (106, 107, or 109 CFU/mL) was achieved by adjusting the volu me of washed cells inoculated into culture flasks. Cultures were incubated statically at 30, 37, or 42C and sampled on days 1, 2, 3, 7, and 10 post inoculation. In order to ex amine changes in co lony morphology, cultures were serially diluted in PBS, spread plat ed on LA, and incubated o.n. at 37C. Plates were then examined to determine CFU/mL of different colony types. For evaluation of transition from Op to Tr in PP3 (pH 7.0), two independent experiments were performed using triplicate flasks in each experiment. Fo r evaluation of transition from Op to Tr in

PAGE 50

35 all other media as well as evaluation of tr ansition from Tr to Op, three independent experiments were performed using single flasks in each experiment. At least 80 colonies were observed for plate counts from each flas k. The percent of each Op vs. Tr colony type was calculated as a function of the to tal colony number, and results were based on an average percent translucent calculated fr om the two independent experiments. When available, isolated Tr colonies from each tim e point were frozen and stored at -70C for further genetic analysis. Secreted Factors and V. vulnificus Phase Variation The role of secreted factors in phase va riation was investigated through o.n. growth and examination of spent media derive d from subsequent centrifugation of V. vulnificus MO6-24/Op as described above. Cultures were inoculated into 45 mL of PP3 to achieve a final concentration of 106 CFU/mL and incubated at 30, 37, and 42C. Cultures were removed from incubation after 72 hr, and the su pernatant (henceforth referred to as spent medium) was filter sterilized through a 0.22 m filter using a 50mm f ilter unit with a 250 mL capacity (Nalgene). Spent media were then re-inoculated (final concentration: 106 CFU/mL) with a washed, o.n. culture of MO6-24/Op. Cultures were incubated statically at 30, 37, and 42C, sampled at 24 h, and observed for altered colony type. Three independent experiments were performed using single flasks in each experiment. PCR Screening of Translucent CPS Genotypes Multiple genotypes exist for Tr isolates of V. vulnificus , and differences among these genotypes are related to genetic variations within the CPS operon which sometimes lead to deletion mutation (Chatzidak i 2004). Translucent genotypes of V. vulnificus can be distinguished by PCR amplification of the wza wzc region. Therefore, Tr isolates generated from phase induction assays we re examined for mutations in the wza wzc

PAGE 51

36 region for the group 1 CPS operon as prev iously described (Chatzidaki 2004). Translucent isolates taken from phase induc tion assays were grown o.n. in LB at 37C with shaking (120 rpm), and DNA was extracted using the boiling method. Briefly, 1 mL of culture was centrifuged at 10,000 rpm (E ppendorf) for 10 min. The supernatent was discarded, and the pellet was resuspended in 400 L of PBS and boiled for 10 min. A final centrifugation was done for 3 min at 13,000 rpm. The supernatent was transferred to a clean microfuge tube, and the pellet wa s discarded. DNA (1 to 3 L) that spanned the conserved transport genes ( wza wzb wzc ) was amplified by PCR using the following conditions: incubation at 94C for 5 min, 25 cy cles of 94C for 1 min, 56C for 1 min, and 72C for 1 min with a final 7-min extension at 72C on a thermocycler (Mastercyclergradient, Eppendorf). Primers for either wzaF1 (5-gacgattccagcaggctctta3) and wzcR2 (5-tccatcatcgc aaaatgcaagctg-3) or wzaF2 (5 -cgatggaatcgtgtgatcagt-3) and wzcR3 (5-cagcaccactaaggtatgc ttc-3) were used in the amplification (Chatzidaki 2004). Some strains that did not amplify by PCR at this locus were al so analyzed for the presence of individual genes using primers derived from wza [wzaF1 and wzaR (5tcgcgttatctgatcaacca-3)], wzb [wzbF (5-ggttgatcagataac gcgaa-3) and wzbR (5aaggaatacaagcgtctagg-3)], wzc [wzcF2 (5cccggaaatgaac gagacaatg-3) and wzcR2], and wbfV [wbfVF (5-ctatcgtagatgtggatattgag3) and wbfVR]. PCR products were visualized on 1% agarose gels with ethidi um bromide and compared to Op (MO6024/Op) and Tr (LC4/TR2) standards. Amplicon size was determined by comparison to the Hi-Lo DNA ladder (Minnesota Molecu lar Inc). Additionally, vvhA primers (Campbell and Wright 2003) were used to test the stab ility of chromosomal DNA with previously

PAGE 52

37 described PCR conditions, and a negative contro l without template was also amplified for each assay. Stability of Translucent Genotypes Phase variation assays generated translu cent isolates with varying genotypes, and some of these genotypes showed deletion muta tion within the CPS ope ron. By definition phase variation is a reversible event, and de letion mutations are generally considered to be irreversible. However, some of the Tr genotypes did not show any mutations in the CPS operon. Therefore, in order to determ ine the stability of Tr phenotypes among the different Tr genotypes, cultu res (n=48) were grown o.n., washed, and inoculated as described above into either PP3 or LB. Cu ltures were then incubated at 37C with shaking (120 rpm). Samples were taken at 24 h, serially diluted, a nd plated as described for phase induction experiments to determine th e distribution of diffe rent colony types. Plates were evaluated for the presence of a ltered colony types, and at least 110 colonies were examined for plate counts. DNA Cloning and Sequence Analysis of recA in V. vulnificus MO6-24/Op Gene sequence for recA was obtained from the two published V. vulnificus genomes, CMCP6 (Kim et al. 2003) and YJ016 (C hen et al. 2003), and these strains were aligned using BLAST (National Center fo r Biotechnology Information). Comparisons between the genomes were made for seque nces located 1.5-Kb upstream through 1.5-Kb downstream of recA . Primers chosen from conserved regions localized to 436-bp upstream (RecAF2: 5-gctgtaagtgacaaatgcac gatc -3) and 359-bp downstream (RecAR4: 5-gacgcatacggcaggagttatcgc-3) of recA (Appendix). PCR amplification of MO6-24/Op was conducted using the conditi ons described above and yielded a 1.7-Kb product. Fresh PCR products were ligated into pGEM T-Easy (Promega) per the manufacturer’s

PAGE 53

38 instructions. The ligation reaction (4 L) was introduced into chemically competent E. coli JM109 (Promega) to yield pRECA. Sc reening of insert containing clones was performed using blue/white selection of colonies grown on LA containing ampicillin. Plasmids of the desired colonies were ex tracted using Wizard Plus SV Minipreps DNA Purification System (Promega) and sequenced using T7 and SP6 primers. Automated DNA cycle sequencing (Applied Biosystems) of PCR amplicons and plasmid clones was performed by the University of Florida ICBR core facility. Insertional Inactivation of recA Repetitive elements within the CPS operon were suggested to be related to sitespecific deletion of an interv ening CPS transport gene in V. vulnificus which led to the formation of a Tr phenotype (Chatzidaki 2004) . These repeats provide extended regions of homology surrounding the deleted segm ent, indicating homologous recombination may be a mechanism that facilitates this de letion. Homologous recombination can be either dependent or independent of the RecA enzyme; however, deletion mutations in the V. vulnificus CPS operon increase during prolong ed incubation, suggesting that DNA repair enzymes, like RecA may be involved in deletion mutation. To examine the role of recA in the formation of Tr genotype s, insertional inactivation of recA was attempted through the introduction of a nonpolar kana mycin (Kan) cassette into a unique BamH1 site located 350-bp downstream of the recA start codon (Menard et al. 1993). Vector pUC18K, which contained a Kan casse tte was enzymatically digested ( SacI and HindIII , Promega), and the Kan cassette was separate d from the vector by electrophoresis on agarose gel (1% w/v) visualized with ethi dium bromide. The appropriate 0.8-Kb band was cut from the gel and purified using the GENECLEAN KIT system (Q-BIOgene). In order to generate appropriate BamHI cloning sites flanking the Ka n cassette, the cassette

PAGE 54

39 was ligated (4C o.n. with T4 DNA Liga se) into a TOPO TA Cloning vector (Promega), which was also digested with SacI and HindIII (Figure 3-1). The ligation reaction (4L) was transformed into E. coli Transforming One Shot TOP10 (Invitrogen) chemically competent cells, and transformant s were selected by growth on kanamycin. Plasmids from desired coloni es were extracted as descri bed above and digested with BamH1 (Promega). The Kan cassette was separated from the vector using gel electrophoresis and purified as described a bove. The pRECA plasmid (which contains the V. vulnificus recA gene in the pGEM-Teasy vector) was digested with BamH1 , and the purified Kan cassette was ligated into pRECA using T4 DNA Ligase as previously described. The ligation reacti on (5 L) was cloned into E. coli JM109 to yield pRECAN (Figure 3-1). Screening was performed by growth on LA with kanamycin, and plasmids from desired colonies were ex tracted as described above. Delivery of Inactivated recA into V. vulnificus Marker Exchange Using an Incompatibility Plasmid Marker exchange was used to create mutations within the V. vulnificus chromosome by site-directed mutagenesis of chromosomal recA through recombination of a recA gene that was insertionally inactiv ated by introduction of a nonpolar Kan cassette (Figure 3-2). Homologous sequences facilitate marker exchange between a plasmid containing the inactivated gene with the marker into the gene target on the V. vulnificus chromosome. A broad host range vector (pRK404) is required to deliver the inactivated recA gene into V. vulnificus as other vectors will not replicate within this species (Ditta et al. 1985). The pR ECAN was enzymatically digested ( EcoRI , Promega), and the purified EcoR1 restriction fragment was ligated into pRK404 that had also been digested with EcoR1 (Figure 3-1). The ligation react ion (5L) was then cloned into

PAGE 55

40 Figure 3-1. Construction of pRECAN and pMKJ1. The V. vulnificus MO6-24/Op recA gene was ligated into pGEM-Teas y vector to yield pRECA, and recA was inactivated by insertion of a kanamy cin resistance cassette (Kr) into a BamHI site within the coding sequence of recA . The inactivated recA gene was located on a EcoR1 fragment which was ligated into pRK404 to yield pMKJ1. E. coli S17pir to yield pMKJ1. Screening wa s performed by growth on LA with kanamycin and tetracycline. E. coli S17pir was used as a conjugational donor to deliver pMKJ1 into V. vulnificus . Filters containing a mixture of the V. vulnificus and the transformed E. coli were incubated overnight at 37C on LA plates. The filters were then rinsed with 2 mL LB-kanamycin-polymyxin, a nd the resulting culture was incubated for 1 h at 37C. The culture was then plated onto LA containing the same antibiotics. 6.7Kb pRECA N EcoRI EcoRI K r r ecA Vv r ecA Vv BamHI BamHI BamHI EcoRI EcoRI RecA RecA K r BamHI p MKJ1 14.6 Kb BamHI SacI TOPO TA BamHI HindIII 4.7Kb K r K r EcoRI pREC A EcoRI BamHI 5.9Kb r ecAVv r ecAVv 10.6Kb pRK404 EcoRI

PAGE 56

41 An incompatibility plasmid (pR751, whic h conferred resistance to trimethoprim) was used to facilitate recombination into the chromosome. This plasmid and the pRK404 derivatives cannot replicate simultaneously in the same host because they belong to the same incompatibility group and compete for the same set of replication enzymes. Therefore, screening for the Kan cassette and the incompatibility plasmid using simultaneous Kan and trimethoprim selection sh ould ensure the marker exchange. Thus, kanamycin would select for the inactivated recA gene in the chromosome and trimethoprim would select for pR751. Attempts to transform pR751 into E. coli S17pir revealed this strain of E. coli was also resistant to trimet hoprim. To test the maximum antibiotic threshold levels of E. coli JM10 containing pR751 and E. coli S17pir, each were inoculated in a concentration gradient of trimethoprim and observed for growth. Both strains showed similar leve ls of trimethoprim resistance. E. coli S17pir was also tested for the presence of pR 751, but all extractions were negative for the plasmid. Due to this resistance, E. coli S17pir colonies could not be scre ened for the presence of the incompatibility plasmid and alternate methods of delivery of the recA mutation into V. vulnificus were attempted. Marker Exchange Using a Suicide Vector Suicide vectors require specific functions in order to replicate within bacteria. The suicide vector pGTR1128 was provided by Dr. Paul Gulig of the University of Florida for use in this study and requires pir functions in the host to replicate. When a DNA fragment with a selectable marker is inserted into the suicide vector , it will not replicate when introduced into bacterium, such as V. vulnificus , does not contain pir. Selection for the Kan marker on the cloned fragment results in integration of the plasmid into the

PAGE 57

42 Gene to be disrupted Selection for Kr r ecA r ecA K r recA Kr Inactivated gene recA recA Figure 3-2. Marker exchange resul ting in insertional inactivation of recA . bacterial chromosome through a single-cro ssover mutation. Growth in non-selective broth allows for a second recombination event to occur leading to complete exchange of the DNA insert and excision of the suicide v ector from the chromosome (Figure 3-2). The vector pGTR1128 also contains a sacB gene which encodes for an enzyme that results in lethality to the bacterium in the presence of sucrose. Cultures grown in nonselective broth are then screened on plates c ontaining sucrose and kana mycin to select for colonies that have achieved the second crossover event. Few unique restrictions site s exist in pGTR1128; therefor e, primers were used to engineer restriction site s onto the 5’ and 3’ e nds of the inactivated recA gene. Primers RecAF2 and RecAR4 were modified to include an SphI (gcatgc, Promega) restriction site on the 5 end of each primer. PCR was performed on pRECN as described above, and 4 L of the PCR product was ligated into TO PO TA cloning vector (Invitrogen) per the

PAGE 58

43 manufacturer’s instruct ions to form pTOPORECN. The ligation reac tion was transformed into One Shot TOP10 (Invitrogen) cells which were grown on LA with kanamycin. Colonies were screened using blue/white screening for inserti on into the vector. Plasmids were extracted from appropriate co lonies, and the presence of the insert was verified by DNA sequencing using primers M13F and M13R (Invitrogen) provided by the manufacturer. The suicide plasmid pG TR1128 (provided by Dr. Paul Gulig at the University of Florida) was a modified versi on of suicide vector pC VD442 . The insert and the suicide vector (pGT R1128) were digested with SphI and ligated o.n. using T4 DNA Ligase as described above (Figure 33). The ligation re action (5 L) was transformed into E. coli JM109 to yield pGTRRECN. Cells were grown on LA 5.5 Kb p GTR1128 sacB tetAR SphI SphI SphI r ecA r ecA K r TOPORECA N 6.7 Kb p GTRRECA N r ecA r ecA K r 8.3 Kb SphI SphI tetAR sacB Figure 3-3. Construction of pGTRRECAN. The inactivated V. vulnificus MO6-24/Op recA gene was ligated into TOPO TA vector to yield TOPORECAN. The inactivated recA in TOPORECAN gene was located on a SphI fragment which was ligated into pGTR1128 to yield pGTRRECAN.

PAGE 59

44 with kanamycin. Appropriate colonies were se lected, and the plasmids were extracted as described above. Plasmids were then tr ansformed into the conjugation-competent E. coli S17pir, and transformants were select ed on kanamycin. The plasmid pGTRRECAN was introduced V. vulnificus MO6-24/Op as previously described, and colonies were plated onto LA with kanamycin and polymyxi n. Numerous colonies were picked, and PCR was performed on extracted DNA (QIAmp DNA Mini Kit, Qiagen) using primers RecAF2 and RecAR4 to confirm the pres ence of a single crossover mutation. Single-crossover conjugates were eviden ced by production of two bands: a 2.5-Kb band corresponding to the inactivated recA and a 1.7-Kb band corresponding to the unaltered chromosomal copy of the gene. To bring about the second crossover, singlecrossover conjugates were inc ubated overnight in LB with kanamycin. Cultures were then diluted 1:50 in fresh LB with and w ithout 10% sucrose and grown for 8 h until slightly turbid. The suic ide plasmid contains the sacB gene, which encodes for the enzyme levansucrase which cleaves sucrose. This cleavage produces levan which is toxic to gram-negative bacteria and results in lethality of cells th at contain the suicide vector. Samples were taken, serially diluted in PBS, and plated onto LA with kanamycin and 6% or 10% sucrose. Plat es were incubated o.n. at 37C. To verify the presence of the inactivated gene, PCR was performed on se veral colonies using RecAF2 and RecAR4 primers as described above. Marker Exchange Using Antibiotic Selective Pressure The final attempt at marker exchange within the recA gene of V. vulnificus used antibiotics to negatively select for double-cr ossover mutants. Cells are grown in the presence of an antibiotic (tetracycline) that se lects for a vector contai ning the insert to be integrated into the chromosome. Additionall y, a second antibiotic (ampicillin) is used

PAGE 60

45 that kills actively dividing cells. Thus, only cells that retain the vector are able to replicate and should be killed by the second antib iotic. Cells that were not killed are regrown in non-selective media and re-exposed to the antibiotics. Cultures are then plated onto media with antibiotic (kanam ycin) that selects for the insert. Colonies that grow are replica-plated onto media that selects for the plasmid. Colonies that are positive for the insert but negative for the plasmid are likely to contain the doublecrossover mutation. Vibrio vulnificus MO6-24/Op containing pMKJ1 was incubated in LB o.n. at 30C with shaking (100 rpm). Overnight cultures were diluted 1:1000 into fresh LB and grown for 1 h at 30C with shaking (100 rpm). Cells we re transferred to a 10 mL conical tube and centrifuged for 20 min at 4000 rpm. The s upernatant was discarded and the pellet resuspended in LB containing ampicillin (5 g/mL), tetracycline (0.5 g/mL), and glycerol (1%). The culture was grown at 30 C for 3 h with shaking (100 rpm). A 100 L aliquot was transferred to fr esh LB and the culture was gr own overnight. This process was repeated and 100 L aliquots of the LB-kan -tet-glycerol culture we re plated onto LA containing kanamycin. Plates were incubated overnight at 30C. Colonies which grew on LA-kan plates were replica plated onto LA containing tetracyclin e, and plates were grown o.n. at 30C. LA-tet plates were comp ared to LA-kan plates from the previous day and observed for colonies that were resistant to kanamycin and sensitive to tetracycline. Colonies negative for growth on LA-tet were picked from LA-kan plates and streaked onto LA containing tetracycline to verify their antibiotic sensitivity. Complementation of recA Inactivation Once a gene has been inactivated, in trans complementation of the intact gene into the mutated strain is performed in an attempt to restore the function of the gene to wildtype levels. Restoring the orig inal function of the gene gives final confirmation as to the

PAGE 61

46 gene’s role in the mechanism of intere st. Vector pRECA was digested with EcoR1 to obtain a fragment containing only the recA gene. This fragment was purified and ligated into digested ( EcoR1 ) pRK404 as described previously. The ligation reac tion (4 L) was cloned into conjugation-competent E. coli S17pir to yield pRKRECA. Recombinant DNA was introduced into V. vulnificus single-crossover recA mutants through conjugation as previously descri bed. Transconjugates were th en plated onto LA plates containing kanamycin, tetracycline, and polymyxi n. Complemented strains were verified by extraction of pRKRECA from resulting V. vulnificus colonies. Ultraviolet Light Se nsitivity Analysis The RecA enzyme plays a role in a variety of DNA repair mechanisms and is required for repair of DNA damage due to ul traviolet (UV) light (Kowalczykowski et al. 1994). The activity of RecA in this study was evaluated by incremental exposure of cultures to ultraviolet light and comparing gr owth of mutants to the wildtype. Strains were inoculated into LB with or wit hout kanamycin where appropriate and grown overnight at 37C (100 rpm). Cultures were washed 3 times in PBS as previously described and adjusted to a final concentration of 108 CFU/mL. Washed cultures (500 L) were inoculated into wells of a 12 well culture dish (Costar). The dish was exposed to UV light (Biorad) for 0 to 90 sec. UV exposed samples were serially diluted in PBS and plated onto LA with or without kanamycin for mutant and parent strains, respectively. Plates were incubated in the dark at 37C for 48 h. The ability of a culture to survive UV exposure was determined by di viding the resulting pl ate counts (CFU/mL) after UV exposure by the plate counts (CFU/mL) after 0 sec of UV exposure to yield a percent survival value.

PAGE 62

47 Cloning of Growth Plasmid pGTR902 into V. vulnificus In order to determine whether the appearance of Tr colonies wa s a result of phase variation from the Op to the Tr phenotype or just die off within a population, a growth plasmid was transformed into V. vulnificus . Conjugation competent E. coli S17pir containing the growth plasmid pGTR902 wa s provided by Dr. Paul Gulig at the University of Florida. The gr owth plasmid was transferred to V. vulnificus MO6-24/Op through conjugation as described above, and cu ltures were plated onto LA with arabinose (1%), kanamycin and polymyxin. Plasmids we re extracted from several colonies as described above and digested with SphI to confirm the presence of the growth plasmid. The growth plasmid pGTR902 will only replicate in the presence of arabinose, and growth in non-selective media generates ce lls that do not contain the plasmid. The original inoculum can be distinguished from newly grown cells by growth on a selective medium. The ability to track the original population allows for examination of altered phenotypes (like phase variants ) within a population to be observed and also permits calculation of population death. Vibrio vulnificus with pGTR902 was inoculated into LB containing 1% arabinose and kanamycin. Cultures were washed 3 times with PBS as described above and inoculated into 45 mL of PP3 to achieve a final concentration of 106 CFU/mL. Cultures were incubated statical ly at 37C and sampled at days 1, 2, 3 and 7. Samples were serially diluted into PBS and plated simultaneously onto LA and LA with arabinose (1%) and kanamycin. Colony c ounts of Op vs. Tr co lonies were obtained from the different media and used to dete rmine survivability and killing proportion. Killing proportion = (concentration of pGTR902 containing bacteria) / (concentration of pGTR902 containing bacteria initia lly inoculated into the culture ). Tr cells that retained

PAGE 63

48 antibiotic resistance were presumed to be de rived from phase variation of surviving Op cells. Statistical Analysis Statistical significances found in phase induction assays comparing Tr colony formation in different media were determined using Student's t tests (one-tail distribution with unequal variance) in Micr osoft Excel. Statistical si gnificances found among strains incubated in PP3 (pH 7.0) were determined by an analysis of va riance on transformed data in SAS 8.0.

PAGE 64

49 CHAPTER 4 RESULTS: SPECIFIC AIM 1 Rationale for Study Surface structures such as pili, flagella , and capsular polysaccharide facilitate attachment to surfaces or movement toward nutrient-rich environments. However, expression of these structures may not be a ppropriate under all envi ronmental conditions or may pose a liability in the host as a signal for immune survei llance, leading to death of the invading organism. Thus, the ability of bacteria to maintain populations with differential expression of these structures provides a survival advantage, especially to organisms that inhabit rapidl y changing environments. “P hase variation” provides a means of adaptation to changing environmental conditions, and the frequency of phase variation is responsive to ch anging external conditions. For example, environmental factors such as media composition, iron leve ls, carbon source, amino acid concentration, temperature, and pH have been shown to infl uence the frequency of phase variation in a variety of bacteria (Ali et al. 2002, Gally et al. 1993, Serkin and Seifert 2000, Blomfield 2001, Ali et al. 2002, Crost et al. 2004). Phase variation often involves genetic mu tation and is defined as a reversible, heritable switching between phenotypes (van der Woude and Baulmer 2004). However, deletion mutations may result in more permanent alterations in phenotype (McCarter 1998). Differential expression of V. vulnificus capsular polysaccharide (CPS) is evidenced by changes in colony morphology (fro m opaque to translucent) and involves at least two genetic mechanisms: 1) mutations that are independent of the CPS operon and

PAGE 65

50 result in reduced expression of capsule; and 2) mutations that involve deletions in the CPS operon and result in elimination of CPS expression (Chatzidaki 2004). Although the latter event may not produce typical, reversible phase variation, it may still contribute to survival of acapsular V. vulnificus populations. In order to more extensively examine genetic mutations associated with variable expression of CPS, growth conditions were established that induced high-fr equency phase variation as i ndicated altered colony types. Induction of High Frequency “Phase Variation” Phase variation of V. vulnificus capsule expression was previously observed in LB and involved reversible transi tions between virulent (Op) and avirulent (Tr) phenotypes at a level of 10-3 to 10-4 (Wright et al. 1990). These levels are much higher than spontaneous mutations that occur during DNA re plication but are stil l too infrequent for practical evaluation of population genetics. Furthermore, examination of Tr genotypes revealed some phase variants may not be read ily reversible due to deletion mutations that were observed in the CPS operon (Chatzidaki 20 04). In order to fu rther inves tigate the genetics of phase variation in V. vulnificus , induction of high-fre quency phase variation was examined for different culture conditions . Media containing pr oteose peptone #3 (PP3) induced high-freque ncy phase variation in V. cholerae , and cultures inoculated from a smooth acapsular colony type formed rugose colonies at high frequency (up to 80%). The rugose strains express extracellula r polysaccharide (EPS) and show enhanced production of biofilm compared to smooth phenot ypes (Ali et al. 2002). In the present study, opaque V. vulnificus MO6-24 isolates were grown under similar conditions, and media composition and temperature were found to significantly increa se the transition from the Op to the Tr phenotype. A spontaneous Tr variant of V. vulnificus MO6-24/Op

PAGE 66

51 (derived from LB) was also examined under th ese conditions, but transitions from Tr to Op colony types were not observed. Incubation in media containing proteose pe ptone No.3 at 37C resulted in transition of the Op phenotype to the Tr form at significantly (p 0.018) higher levels compared to other media, including a medium containing pr oteose peptone No. 1 (Table 3 1). After three days incubation in PP3 at pH 7.0, origin ally Op cultures plated onto solid medium showed 40.5% Tr colonies. Increased appearan ce of Tr colonies was also seen in PP3 media at 30C but at much lower frequency, a nd the frequency of Tr colonies averaged <9% (Table 4-1). Translucent co lonies were rarely seen at 42C in any medium and were only observed on Day 1 in PP3 at pH 7.0 with levels of 0.2 0.2%. Adjustment to the initial pH level of PP3 media re vealed significantly higher leve ls of Tr colonies at pH 7.0 and 8.0 (p=0.0032 and p=0.0278, respectively) co mpared to pH 6.5 at 37C by Day 3 (Table 4-2). Incubation at pH 7.0 and 8.0 also produced higher levels of Tr colonies compared to pH 6.5 at 30C by Day 3, but th ese differences were not statistically significant (Table 4-1). A Tr variant of V. vulnificus MO6-24/Op was described in a previous study and derived from overnight growth in LB (Wright et al. 1990). An isolated colony of this strain was also inoculated into PP3 medium, but phase variation invol ving transition from the Tr to the Op phenotype was not observed. The lack of phase variation by this Tr isolate showed that inducti on of high-frequency phase vari ation in PP3 was specific for transition from Op to Tr and did not influence transition from Tr to Op. Effects of Extended Incubation on Phase Variation In experiments described above, the freque ncy of phase variation in PP3 (pH 7.0) generally increased with time; therefore, th e effects of extended incubation (up to 10

PAGE 67

52 Table 4-1. Effect of media on phase variation of MO6-24/Op incubated at 30C aPercentage (%) of translucent (Tr) colonies was calculated as a fraction of total colony number and is shown for all media. bSignificantly (p=0.0132) higher Tr colony formation occurred in PP3 (pH 6.5) vs. PP3 (pH 7.0) at Day 2 and in PP3 (pH 7.0) (p=0.003, 0.006 and 0.003 respectively) vs. PP1, LB and 15 ppt ASW at Day 3. Table 4-2. Effect of media on phase variation of MO6-24/Op incubated at 37C aPercentage (%) of translucent (Tr) colonies wa s calculated as a fraction of total colony number and is shown for all media. bPercent translucent colony formation in PP3 (pH 7.0 and 8.0) was significantly (p<0.0001 a nd p=0.018, respectively) higher than in other media at Day 3. days) in this medium were examined at diffe rent temperatures. As shown in Figure 4-1, levels of transition of MO6-24/Op to the Tr phase continued to increase throughout the experiment for all temperatures examined, but the highest levels were always observed at 37C compared to other temperatures. The fr equency of Tr colonies reached maximum Transition from Op to Tr colonies at 30 C (%)a Time Post Inoculation (days) Media 1 2 3 PP1 0.0 0.0 0.0 0.0 0.3 0.5 PP3 (pH 6.5) 0.0 0.0 2.2 0.6b 0.6 0.1 PP3 (pH 7.0) 0.2 0.0 0.4 0.0 6.3 0.9b PP3 (pH 8.0) 0.4 0.7 1.0 1.2 8.3 10.7 LB 0.6 0.2 0.2 0.0 1.1 0.6 PBS 1.3 2.2 3.6 7.4 3.7 9.6 15 ppt ASW 0.0 0.0 0.1 0.1 0.1 0.0 Transition from Op to Tr colonies (%)a Time Post Inoculation (days) Media 1 2 3 PP1 0.1 0.1 0.0 0.0 0.3 0.6 PP3 (pH 6.5) 0.1 0.0 1.7 0.4 14.9 5.5 PP3 (pH 7.0 0.7 0.8 7.1 2.3 40.5 15.1b PP3 (pH 8.0) 0.8 1.3 12.0 14.2 33.5 9.5 b LB 0.6 0.2 0.9 0.3 5.6 1.1 PBS 0.0 0.0 3.8 6.4 5.6 8.1 15 ppt ASW 0.1 0.1 0.1 0.1 0.1 0.1

PAGE 68

53 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 123710 30 37 42Time Post Inoculation (days) Percent Translucent Colonies (%) #* * * * * * Figure 4-1.Effect of temperature on phase variation in MO6-24/Op in PP3 (pH 7.0). Pound sign (#) indicates significantly (p=0.0064) higher percent Tr colony formation at 37 vs. 42C on Day 2. As trisk (*) indicates significantly (p 0.0095) different percent Tr among all temperatures at Days 3 and 7. levels at Day 10, whereby Tr colonies aver aged about 70% of the population at 37C. However, it should be noted that these conditi ons were designed to detect high-frequency phase variation (>1%), and in creased phase variation at lo wer frequency may occur at earlier time points but at levels below the limit of detection of this assay. In summary, these results indicated that CPS phase variation in V. vulnificus is a late stationary phase event and support the hypothesis that transition to the Tr phenotype may be a response to stress or starvation. Effects of Secreted Factors on Phase Variation Bacteria secrete signaling molecules that a ccumulate over time and alter the local environment to regulate gene expression. These molecules initiate global signaling

PAGE 69

54 systems for communication within a bacter ial population. Quorum sensing is one example of global regulation of gene expressi on that involves secret ed molecules called autoinducers. Once these autoinducers reac h a critical threshold concentration, they provide cell density-dependent communication. Quorum sensing is involved in phase variation of some bact erial species, including V. parahaemolyticus and V. cholerae . For example, in V. parahaemolyticus CPS expression is regulated by a LuxR homolog (OpaR), and deletion within this locus results in a shift to the Tr pha se (McCarter 1998). In V. cholerae , alterations in luxO indirectly regulate EPS expression by changing expression of EPS operon regulat ors (Hammer and Bassler 2003). High-frequency phase varia tion was not detected in V. vulnificus until stationary phase, and it was hypothesized that accumulati on of secreted molecu les in the medium may signal the transition from Op to Tr phenotypes. In orde r to determine the involvement of secreted factors, V. vulnificus MO6-24/Op was incubated in PP3 (pH 7.0) at 30, 37 and 42 C, and cultures were filter-sterilized at Day 3 post inoculation. Spent medium recovered from culture filtrates was re -inoculated with Op cells, and the level of Tr colony formation was compared to levels formed in fresh media during previous experiments (Table 4-3). Results showed that higher levels of Tr co lonies were observed Table 4-3. Effect of spent PP3 (p H 7.0) on phase variation of MO6-24/Op Transition from Op to Tr Colonies (%)b 24 hrs Post Inoculation Mediaa 30 C 37 C 42 C Fresh PP3 0.2 0.0 0.7 0.8 0.2 0.2 Spent PP3 1.4 2.4 2.2 3.0 0.0 0.0 aFresh PP3 (pH 7.0) or spent medium was used for incubation of MO6-24/Op at temperatures shown. Spent medium wa s prepared from filtrates of Day 3 cultures of MO6-24/Op incubated at 30, 37 or 42 C. bPercentage (%) of translucent (Tr) colonies was calculate d as a fraction of total colony number and is shown for both media.

PAGE 70

55 in spent compared to fresh medium at 30 and 37C, but these differences were not significant (p=0.494 and 0.475, respectively). The influence of secreted f actors is also related to ce ll density. Therefore, the effect of initial culture concentration on th e frequency of Op to Tr transitions was evaluated. Washed Op cells were inoculated into fresh media at concentrations of 106, 107, and 109 CFU/mL and observed for Tr colony form ation. Little variation in the levels of Tr colonies derived from different i nocula was observed at Days 3 and 7 post inoculation. However, by Day 10 the highest inoculum (109 CFU/mL) produced levels of Tr colony formation that differe d significantly from lower inoc ula (Figure 4-2). At 37C, the higher inoculum showed a significantly lower proportion of Tr colonies (p<0.004) than those observed at lower inocula; conve rsely, at 42C the cultu re inoculated with 109 CFU/mL produced significantly (p=0.002) highe r levels of Tr col onies than cultures inoculated with 106 CFU/mL (Figure 4-2). In summary, these results did not provide evidence for the influence of secreted signaling molecules on phase variation of V. vulnificus. The effects of quorum sensing are usually observed in middle to late l og phase. However, high-frequency Tr colony formation was not observed consistently until after 48 h of incubation, which would equate to late stationary phase for th is organism under these growth conditions (Figure 4-1). Quorum sensing-dependent m odels would predict earlier onset of highfrequency phase variation, such as that observed in V. cholerae where 80% rugose colonies were observed by 24 h (Ali et al 2002). Therefore, these resu lts indicate that cell density and secreted factors probably do not influence high-f requency phase variation of CPS in V. vulnificus .

PAGE 71

56 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 10^6 10^7 10^918 106 107 109 30C A 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0%Percent Translucent Colonies*37C B 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710Time Post Inoculation (days)# 42C C Figure 4-2. Effect of inoculum size on phase variation. No significant differences were observed percent Tr colonies were observed between the inocula at (A) 30C. At (B) 37C and (C) 42C significant differe nces in percent Tr colonies were observed between cultures: 109 CFU/mL showed significantly (p=0.0018 and 0.004) lower levels vs. 106 and 107 CFU/mL, respectively (indicated by an asterisk (*)), and 106 CFU/mL initial inocula show ed significantly (p=0.002) higher levels vs. 109 CFU/mL (indicated by a pound (#) sign.)

PAGE 72

57 Population Dynamics of Phase Variation Observations of Tr colonies in cultures in itially inoculated with Op isolates are generally attributed to phase variation, but population dynamics of these cultures could also incorporate growth or survival-related events, especially following extended incubation. For example, the appearance of in creased proportions of Tr cells may result from their survival in concert with die-off of Op cells or from in creased cell division of Tr compared to Op cells. In order to investigat e population dynamics of phase variation in V. vulnificus , total culture concentrations were compared to indivi dual concentrations of Op vs. Tr. Results showed an initial increase was followed by a significant (p 0.004) decline of about a 1 log CFU in total bacteria concentration at all temperatures by Day 7 (Figure 4-3). Significant (p 0.0003) decreases were also observed in numbers of Op colonies over the course of the assay. However, these decrea ses were generally larger than corresponding decreases in total CFU. For example, to tal bacteria declined by 1.4 0.23 log CFU between Days 1 and 10 post inoculation at 37C, but a 1.9 0.42 log CFU decrease was observed for Op colonies over the same time period. Thus, overall changes in the population were not attributed wholly to di e-off of Op cells but also corresponded to increasing concentration of Tr colonies. Comparisons of daily population changes showed that the decrease in the number of Op cells was approximately equal to the increase in the number of Tr cells by Days 2 and 3 at 37C (Figure 4-4). However, dieoff of both Op and Tr populations occurr ed by Day 7, and both populations remained relatively unchanged through Day 10. Results demonstrated that loss of Op cells was generally equivalent to the increase in Tr cells and support the hypothesis that increased proportions of Tr colonies was a consequence of phase variation.

PAGE 73

58 # * 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 0123710Time Post Inoculation (days) 42C *# *# 30C0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Total Op Tr 30C*# A 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00Log10 CFU/ml*# 37C # * B C Figure 4-3. Changes in Op, Tr, and Total cultu re concentrations of MO6-24. At (A)30C, (B)37C, and (C)42C significant change s were seen. Pound sign (#) indicates significant (p 0.005) decreases in tota l culture concentratio n, and an asterisk (*) indicates significant (p 0.003) declines in Op culture concentration.

PAGE 74

59 -0.46 0.49 -0 . 92 -0 . 0 3 0 . 5 7 0 .47 0 . 5 1 0.14-1.5 -1 -0.5 0 0.5 1 1.5 Op Tr Change in Population (log CFU) Time Post Inoculation (days) 2 3 7 10 Figure 4-4.Changes in Op and Tr populations of MO6-24 between sampling days. Op and Tr populations of MO6-24 measured throughout incubation in PP3 (pH 7.0) at 37C. Changes in population were calc ulated by subtracting the individual population concentrations (CFU/mL) of the earlier sampling day from the later sampling day and converting to log CFU/mL. A growth plasmid (pGTR902) was introduced into V. vulnificus MO6-24/Op in order to experimentally confirm phase variati on. This plasmid has a kanamycin resistance gene marker, but the plasmid will only replicate in the presence of arabinose. Therefore, incubation in media without arabinose results in loss of the resistance marker in newly dividing cells. The initial inoculum can be distinguished from this newly generated population by growth on medium with or w ithout aribinose and kanamycin, respectively. Therefore, opaque V. vulnificus containing the growth plasmid was inoculated into PP3 (pH 7.0) at a concentration of 106 CFU/mL and incubated at 37C. Cultures were plated simultaneously onto LA and LA with kanamycin and 1% arabinose, and Tr colony formation was observed as described for phase induction experiments.

PAGE 75

60 Results showed that Op cells containing th e growth plasmid were able to form Tr colonies carrying the resistance marker, confir ming that phase variation from Op to Tr had occurred (Table 4-3). The percent of kanamycin resistant Tr colonies remained essentially unchanged through Day 3, indica ting phase variation of this population occurred by Day 1 and that these cells surviv ed extended incubation. However, levels of Tr colonies without the plasmid continued to increase throughout the experiment and were significantly higher (p=0.0237) than the per centage of Tr colonies with the growth plasmid, suggesting phase variation may c ontinue to occur in dividing cells. The proportion of Op cells that were killed (k illing proportion) during extended incubation Table 4-4. Phase variation and survival of MO6-24/Op with grow th plasmid pGTR902. Days Post Inoculation Strain Inoculated Measurement 1 2 3 MO6-24/Op 8.76 0.41 8.32 0.33 8.03 0.10 MO6-24/pGTR902 Total Bacteria (CFU/mL)a 8.23 0.05 8.29 0.27 7.88 0.18 MO6-24/pGTR902 Resistant Bacteria (CFU/mL Kan)b 6.50 0.24 6.11 0.10 5.46 0.15 MO6-24/pGTR902 Total Phase Variation (% Tr)c 0.2 0.4 1.1 1.3 11.6 6.0 MO6-24/pGTR902 Resistant Phase Variation (% Tr Kan)d 0.1 0.1 0.2 0.1 0.2 0.3 MO6-24/pGTR902 Killing Proportion (CFU/mL Kan)e 0.97 0.04 0.41 0.13 0.1 0.06 aTotal number of bacteria (CFU/mL) in cult ures of MO6-24/Op th at did or did not contain pGTR902 following incubation in PP3 (pH 7.0) at 37C. bNumber of bacteria (CFU/mL) that retained gr owth plasmid in cultures inoculated with MO6-24/Op containing pGTR902 following incubation in PP3 (pH 7.0) at 37C. Retention of plasmid was indicated by growth on LA with kanamycin and arabinose as described in materials and methods. cTotal percentage (%) of tr anslucent (Tr) colonies was calculated as a fraction of total colony number dPercentage of Tr co lonies retaining the growth plasmid was calculated as a frac tion of total colony number on LA with aknamycin and arabinose. eKilling proportion= concentration bacteria of retaining pGTR902 / concentration of bacteria with pGTR902 initially inoculated into culture.was determined by dividing the con centration of plasmid-containing cells at each sampling point by the number of cells initially inoculated into the culture.

PAGE 76

61 These calculations showed virtually no change in cells containing the growth plasmid at Day 1; however, nearly 60% of the original inoculum was lost by Day 2 and only 10% remained by Day 3 (Table 4-3). Overall, thes e data confirm phase variation events in the transition of Op cells to the Tr form, but al so indicate that the Op populations may be less fit compared to Tr cells for survival under conditions of extended incubation. Conclusions Conditions were identified that induced high-freque ncy phase variation in V. vulnificus , and these conditions were similar to those previously described for V. cholerae . However, increased phase variatio n occurred much earlier (within 24 hr) with V. cholerae compared to V. vulnificus (at least 48 h). In theory, population changes attributed solely to phase va riation would result in no change s in total bacterial numbers, and decreases in numbers of opaque cells would approximately equal increases in translucent populations. Conversely, if propor tional increases in translucent cell number were due solely to die-off of opaque cells , decreases in the op aque population should equal changes in the overall culture concentr ations. Increases in translucent populations were observed at all temperatures after 24 h, a nd they are most likely attributed to phase variation and not cell division because nutrient limitation dur ing late stationary phase generally limits bacterial reproduction. Additionally, growth plasmid studies revealed that phase variation does occur and also demons trated that die off of the original opaque population occurs with in two days of incubation. Thus, observed changes in V. vulnificus populations are indicative of a combination of both phase variation from opaque to translucent phenotypes, as well as die off of opaque cells during later sampling points. This die off of opaque cells may be due to capsule production because it is metabolically

PAGE 77

62 intensive and therefore, ma y decrease their fitness a nd survival under starvation conditions.

PAGE 78

63 CHAPTER 5 RESULTS: SPECIFIC AIM 2 Rationale for Study In order to study the genetic basis of phase variation in V. vulnificus , conditions were established for induction of high-f requency (>1%) phase variation from opaque (Op) to translucent (Tr) forms. In this chapter phase variants derived from phase induction conditions were examined to determine the role of genetic mutations in the CPS operon to phase variation in V. vulnificus . Chatzidaki (2004) previously identified differences within the CPS operon among different strains (n=4) of V. vulnificus . DNA sequence from the conserved transport region of the CPS operon showed that some strains (MO6-24/Op, LC4/Op, and CMCP6/Op) ha d a certain type of repetitive elements that was lacking in one strain (YJ016). It was noted that a Tr isolate of V. vulnificus LC4 showed deletion of the conserved transport gene wzb gene; however, a Tr isolate of MO6-24/Op did not show this deletion mutations . In fact, the CPS operon of this strain was identical to the parent Op strain, indicating that there were two mechanisms for phase variation: one that involved mutations in the CP S operon and one that was independent of the CPS operon. Complementation of wzb in the deletion mutant restored CPS expression and demonstrated that th e deletion mutation was site-specific for wzb . Because repetitive elements flanked the dele ted gene and are frequently associated with deletion mutation, it was hypothesized that the site of this deletion mutation was determined by the repetitive elements. Therefore, in order to clarify the role of repetitive elements in deletion mutation and phase variation, the present study examined

PAGE 79

64 frequencies of phase variation among V. vulnificus strains with and without repetitive elements. Additionally, large numbers of Tr isolates generated from phase induction were genetically characterized to determine if the presence and location of repetitive elements correlated with deletion mutation. Strain Differences in Phase Variation Opaque V. vulnificus strains MO6-24, LC4, C7184, E4125, CMCP6, and YJ016 were inoculated into phase i nduction assays and examined fo r differences in phase shift to the translucent phenotype at various temperat ures. Levels of phase variation of Op to Tr colonies were much lower for YJ016 compar ed to all other strains for most time points and temperatures. By Day 7 post inoc ulation, YJ016 displayed significantly (p 0.0137 and p 0.0163) lower levels of Tr colony formation compared to all other strains for cells incubated at 30C and 37C, respectively (Figur e 5-2). Levels of Tr colony formation in YJ016 never exceeded 3.0% throughout Day 7 at these temperatures. At 42C higher levels of Tr colonies were seen in YJ016 by Day 7 and 10 compared to other temperatures, but these levels were still lowe r than levels observed in other strains. Another strain where observed levels of phase variation we re unique from other strains was E4125. Interestingly, this strain produced se ctored colonies in addition to the Op and Tr phenotypes (Figure 5-1). Sectored colonies contain a mixture of the Op and Tr morphologies within a single colony, suggesting that this is a highl y variable population. The formation of sectored colonies did not show any significant variation with temperature, indicating this phase was not responsive to temperature (Table 5-1). As shown in the previous chapter levels of phase variation in MO6-24 were higher at 37C compared to 30 and 42C. Some st rains (LC4 and C7184) also showed higher levels of phase variation at 37C compared to other temperatures with significantly

PAGE 80

65 Figure 5-1. Sectored opaque co lony with translucent wedges (p=0.0001, 0.001, and 0.0001, respectively) hi gher levels occurring by Day 3 (Figure 5-2). However, in strain CMCP6 pha se variation levels were highest at 30C compared to other temperatures, although these differences were not significant. Neither E4125 nor YJ016 displayed significant differences in the levels of phase variation as a function of temperature until Day 10 when levels of Tr colonies in YJ016 were significantly (p=0.0251) higher at 42C compared to 30C and levels in E4125 were significantly (p=0.0021) higher at 42C compared to 37C. Ov erall, the observed levels of phase variation among all strains did not show a consistent response to temperature, and temperature specificity appeared to be sp ecific to each strain. One observation that was consistent for all strains was the genera l increase in transition to the Tr phenotype over time (Figure 5-2). These results were al so noted in the previ ous chapter in strain MO6-24. Thus, the observation that all stra ins exhibited increased levels of phase variation during extended incubation indicates th at phase variation in V. vulnificus may be a response to stress or starvation.

PAGE 81

66 123710 123710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 123710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 123710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 123710 30 37 42 C7184 LC4 MO6 24 CMCP6 YJ016 a a a b b c b Percent Translucent Colony (%) Percent Translucent Colony (%) Percent Translucent Colony (%) Time Post Inoculation ( da y s ) Time Post Inoculation ( da y s ) A B C D E Figure 5-2.Translucent colony formation by opaque V. vulnificus strains. The percent (%) Translucent (Tr) colony formation was calculated for strain (A) MO6-24, (B) LC4, (C) C7184, (D) CMCP6, and (E ) YJ016 incubated at 30C, 37C, and 42C. aAt 30C, significant (p<0.037 a nd 0.0137) differences in percent Tr colonies between YJ016 and all other strains were observed at Days 3 and 7. Significant (p<0.0029) differences were also noted on Day 10 for YJ106 vs. CMCP6 and MO6-24. bAt 37C, significant (p<0.0001 and p 0.0001) differences in percent Tr colonies wa s observed at Day 3 for YJ106 vs. C7184 and MO6-24 and for CMPC6 vs. C 7184 and MO6-24. Significant (p 0.0325) differences were also noted at Day 7 between YJ016 and all other strains.

PAGE 82

67 Table 5-1. Effect of temperature on phase variation in E4125/Op in PP3 (pH 7.0) Transition from Op to Tr or Sectored (Sec) Colonies (%)a Time Post Inoculation (days) Temperature 1 2 3 7 10 30 C Tr: 4.6 2.6 Sec: 12.5 4.2 8.7 5.6 20.4 5.2 17.5 10.9 26.0 15.5 53.8 8.3 17.3 1.4 47.5 25.7 35.2 30.8 37 C Tr: 7.9 5.5 Sec: 15.0 4.9 14.9 .6 29.4 22.1 23.4 11.2 19.4 10.6 76.5 26.8 13.5 18.4 32.8 12.2 47.9 32.3 42 C Tr: 5.7 3.8 Sec: 13.7 3.3 11.8 9.8 15.0 3.8 17.9 13.2 21.2 9.9 54.5 8.4 21.3 8.4 81.8 22.6b 3.7 2.4c aPercentage (%) of translucent (Tr) colonies was calculated as a fraction of total colony number and is shown for all te mperatures in PP3 (pH 7.0). bValues of 37C and 42C are significantly different (p=0.0021) from each other. cValues at 37C and 42C are significantly different (p=0.0006) from each other. Phase Variation and Allelic Variation within the CPS Operon DNA sequence comparison by Chatzidaki ( 2004) revealed genetic differences within the CPS operon among V. vulnificus strains. Differences in these profiles alsocorresponded to dramatic differences in le vels of phase variation, as strain YJ016 was genetically distinct from ot her strains and had significan tly lower levels of phase variation. Further sequence comparison by Chazidaki-Livanis of CPS operons among additional strains established that there were two distinct profiles, which were designated as Allele 1 and Allele 2 (d ata not shown). Prominent diffe rences between these alleles included deduced amino acid sequences enco ding hypothetical protei ns (HP1 and HP2, respectively) and DNA sequence of repetitive elements (R1 and R2, respectively). Allelic variation of repetitive elements s howed differences in both their DNA sequence and location within the CPS operon. R1 repe titive elements of Allele 1 contained multiple copies of an identical 8-bp s ubunit (ACAGGACC) and immediately flanked wzb , while R2 repetitive elements of Allele 2 were more variable (A/CCTAGG/AAA/C) and contained an additional element just downstream of wza (Figure 5-3). This genetic

PAGE 83

68 A) Allele 1 V. vulnificus group 1 CPS operon: B) Allele 2 V. vulnificus group 1 CPS operon: ORF1 wza HP1 wzb wzc wecC wbpP wzx HP3 HP4 rfaG wbjB rmlD wbjD wbuB wbfT wbfU wbfY------wbfV R1 R1 R3 ORF1 wza HP2 wzb wzc wecb wecC wbpP wzx---POLYMORPHIC GENES------------------wbfY wbfV R2 R2 R2 R3 CONSERVED TRANSPORT REGION BIOSYNTHETIC REGION Figure 5-3. Genetic organiza tion of group 1 CPS operons. Group 1 CPS operon structure includes conserved transport and poly morphic biosynthetic regions for A) V. vulnificus allele 1 (MO6-24, LC4, C7184, CMCP6, E4125) and B) V. vulnificus allele 2 (YJO16); C). Direction of transcription is indicated by arrows. (Figure adapted from Chatzidaki-Livanis et al. 2006) analysis suggested that strain variation in le vels of phase variation may be a consequence of sequence differences betw een Allele 1 and Allele 2. To determine if strain variability in the fo rmation of Tr colonies was allele-specific, additional Allele 2 strains were inoculated into phase induction assays. The average percent translucent colony formation at Da ys 3 and 7 post inoculation was lower for Allele 2 strains compared to Allele 1 on both days and was significantly (p=0.0235) lower on Day 7 (Table 5-2). Four of the six Allele 2 strains produced individual levels of translucent colony formation that were signi ficantly (p<0.0325) lower than strains of Allele 1. However, strains 99-537DP-G7 a nd 99-623DP-F5 produced levels of Tr colony formation that resembled levels seen in A llele 1 strains. Compar isons among strains of Allele 2 showed significantly (p=0.0 182 and p=0.0437) higher level of Tr colony formation for 99 537DP G7 and 99-623DP-F5, re spectively, compared to other Allele 2 strains. This variability in the levels of phase variation am ong strains of the same allelic type was also observed for Allele 1. For ex ample, strain CMCP6 (Allele 1) displayed significantly (p 0.01) lower levels of Tr colony form ation at 37C compared to other Allele 1 strains on Day 3, but by Day 7 the le vel of Tr colonies formed by CMCP6

PAGE 84

69 Table 5-2. Transitions in colony type for opaque V. vulnificus strains of both alleles Transitions of Op to Tr or Sectored Colonies (%)a Time Post Inoculation (days) Strains 3 7 Allele 1 MO6-24 /Op 40.5 15.1c 64.0 13.9 LC4/Op 16.0 0.2 22.7 15.2 C7184/Op 37.9 0.5c 49.3 2.8 E4125/Op Tr: 23.4 11.2 Sec: 19.4 10.6 76.5 26.8 13.5 18.4 CMCP6/Op 4.7 2.2 53.0 47.2 Allele 1 Average 24.4 14.9 53.1 17.9d Allele 2 YJ016/Op 4.8 5.1 4.2 2.4 b,c 99-581DP-C7 0.9 1.1 10.6 15.9 99-537DP-G7 42.0 6.8b 25.1 19.2 99-742DP-A9 0.0 0.0 14.5 17.9 99-623DP-F5 30.4 24.5b 70.5 48.1b 99-505DP-C8 5.5 2.8 7.0 5.2 Allele 2 Average 13.9 19.2 22.0 23.3c aPercentage (%) of Translucent (Tr) colonies as a fraction of total colony number is shown for all strains. Percentages of sect ored (Sec) colonies are also shown for E4125/Op. bSignificant (p<0.01, p 0.0437, p=0.0317) differences in % Tr between 99537DP-G7 and 99-623DP-F5 vs. all Allele 2 strains at Day3, and between 99-623DPF5 vs. YJ016 at Day7. cSignificant (p<0.0325, p 0.0398, and p 0.0163) differences in the percent translucent between allele types were noted for YJ106, 99-581DP-C7, 99742DP-A9 and 99-505DP-C8 vs. C7184 and MO6-24 at Day 3, for YJ106 vs. C7184, LC4, MO6-24 at Day 3, and for YJ016 vs . MO6-24, LC4, C7184, CMCP6 at Day 7. dSignificant (p=0.0235) differences in the average percent translucent colony formation exists between strains of A llele 1 vs. Allele 2 on Day 7. exceeded 50%, suggesting the appearance of Tr co lonies was simply delayed in this strain (Table 5-2). Thus, differences seen among strains in the appear ance of Tr colonies corresponded somewhat with allelic differen ces associated with the CPS operon, but high levels of variability observed within strains of the same allele prevent conclusions about this association.

PAGE 85

70 -0.44 0. 5 1 -0 . 56 2.23 0.08 0.29 0.02 1. 0 5-4 -3 -2 -1 0 1 2 3 4Time Post Inoculation (days) 2 3 7 10 Time Post Inoculation (days) 2 3 7 10 Y J0 1 6 C7 1 8 4 C M C P 6 L C 4 Chan g e in Po p ulation ( lo g CFU ) Chan g e in Po p ulation ( lo g CFU ) -0.18 1.08 -1 . 1 6 -2 . 6 2 0 . 2 4 1 . 1 1 0.63 2 . 7-4 -3 -2 -1 0 1 2 3 4 -1.99 1.77 2 -0 . 2 3 1 . 8 2 1.55 -1 . 4 2 0.38-4 -3 -2 -1 0 1 2 3 4 0 . 5 2 0.2 7 -2 . 9 8 -1 . 96 0.48 0 . 2 2 2.3 3 2 . 1 9-4 -3 -2 -1 0 1 2 3 4 Op Tr Figure 5-4. Changes in Op, Tr , and overall culture populatio ns. Population differences calculated between sampling days for five Allele 1 strains (MO6-24, LC4, C7184, and CMCP6) and one Allele 2 strain (YJ016). As discussed in Chapter 3, phase variation is the responsible for shifts in Op and Tr populations observed in MO6-24 during Days 1 through 3 of incubation. Examination of population changes in other V. vulnificus strains also showed th at decreases in the Op population corresponded to equivalent increase in the Tr population in most strains (Figure 5-4). However, in Allele 2 stra in YJ016, equivalent shifts in Op and Tr populations were not observed (F igure 5-4). Levels of phase variation in this strain remained low throughout most of the phase induction assay and only exceed 20% by Day 10. Therefore, it is unclear if the lack of equivalent shifts in Op and Tr populations is due to an allelic difference or to low levels of phase variation.

PAGE 86

71 Distribution of Tr Genotypes Related to the CPS Operon Among Different Strains Three genotypes (TR1, TR2, and TR3) we re identified in Tr isolates of V. vulnificus using PCR primers that amplifie d intervening sequences between wza and wzc (Chatzidaki 2004). The TR1 genotype showed a band of the same size as Op strains (3.7-Kb; Figure 5-5). The TR2 genotype produced a single band that was smaller (3.3-Kb) than the band from Op strains, wh ile the TR3 genotype failed to amplify by 3.7 3.3 3.0 Op TR1 TR2 TR3 TR2A Figure 5-5. PCR analysis of CPS transport region in V. vulnificus phase variants. PCR amplicons derived from primers th at spanned the transport region ( wza to wzc ) of the CPS operon are show n for phase variants of V. vulnificus MO6-24/O, MO6-24/Tr (TR1), LC4/Tr (TR2), 345/Tr (TR3), and YJ016/Tr (TR2A). Approximate amplicon sizes (arrows) ar e derived from D NA standards (not shown). PCR. DNA sequencing of the entire TR1 gr oup 1 CPS operon revealed it was identical to the Op parent CPS operon (Chatzidak i 2004). Additionally, DNA sequence from TR2 confirmed the presence of a deletion mutati on and showed it encompassed the entire 435-bp wzb gene. DNA sequence was not available for TR3, as these isolates failed to amplify by PCR.

PAGE 87

72 Time Post Inoculation (days) Time Post Inoculation (days) Genotype Frequency (%) Genotype Frequency (%) LC4 MO 6 24 CMCP6 C7184 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 TR1 TR2 TR3 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 Figure 5-6. Cumulative genotype distribution among Allele 1 strains at 30C. The proportion of each Tr genotype was calcu lated as a function of the total culture population and averaged between two experiments to obtain standard deviations for the Allele 1 st rains MO6-24, LC4, C7184, and CMCP6. The site-specific excision of wzb in a TR2 isolate from an Allele 1 strain indicated that repetitive elements may play a role in deletion formation (Chatzidaki 2004). In order to test this hypothesis, PCR of the wza wzb wzc region was performed on >2000 Tr isolates generated from various V. vulnificus strains during phase induction assays at 30 and 37 C. The distribution of Tr genotypes overtime was examined for each strain at 30and 37C in order to determine the relations hip between allelic type and the formation of Tr genotypes. Results showed that the development of each Tr genotype varied among Allele 1 strains at both te mperatures (Figures 5-6 and 5-7). For example, E4125

PAGE 88

73 MO6-24 C7184 LC4 CMCP6 Time Post Inoculation ( da y s ) Time Post Inoculation ( da y s ) Genot y pe Frequenc y (%) Genot y pe Frequenc y (%) 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 TR1 TR2 TR3 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 Figure 5-7. Cumulative genotype distribution among Allele 1 strains at 37C. The proportion of each Tr genotype was calcu lated as a function of the total culture population and averaged between two experiments to obtain standard deviations for the Allele 1 st rains MO6-24, LC4, C7184, and CMCP6. produced only the TR1 genotype, while all ot her strains produced both TR1 and TR2. Additionally, TR3 isolates were only produced by MO6-24 and CMCP6. At 30C, all Allele 1 strains except CM CP6 displayed an increase in the TR1 genotype that peaked at Day 7 and d eclined through Day 10, but in CMCP6 the proportion of TR1 isolates continued to increase through the end of the assay (Figure 5-6). At 37C, an increase in TR1 was observed in MO6-24 and LC4, while inC7184 and CMCP6 the levels of TR1 remain ed relatively constant (Figure 5-7). Examination of deletion mutant formation reve aled similar inconsistencies among strains

PAGE 89

74 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 3710 TR1 TR2 TR2A TR3YJ016 Genot yp e Fre q uenc y ( % ) Time Post Inoculation (days) 99-537-DPG7 99-623-DPF5 Figure 5-8. Cumulative genot ype distribution among Allele 2 strains at 37C. The proportion of each Tr genotype was calcu lated as a function of the total culture population and averaged between two experiments to obtain standard deviations for the Allele 2 stra ins YJ016, 99-537-DPG7, and 99-623-DPF5.

PAGE 90

75 of Allele 1. At 30C, MO624 displayed high levels of TR2 isolates, but other Allele 1 strains produced very low levels of deletion mutants or none at all. At 37C, MO6 24 showed a decrease in th e TR2 genotype that corresponded to an increase in TR3 isolates during extended in cubation, suggesting these deletion mutations occur in a sequential fashion (Figure 5-7). Th is trend was not observe d in other strains, but TR3 formation was also not as frequent in other strains. In Allele 1 strains, the TR3 genotype was only formed by MO6-24 and CMCP6, and only MO6-24 produced TR3 deletion mutations in a large enough quantity for consistent analysis (Figure 5-7). Overall, the appearance of Tr genotypes was inconsistent among Allele 1 strains indicating that the frequency and type of Tr isolate form ation is strain related. Examination of Tr isolates generated by A llele 2 strains revealed all strains produce the TR1 genotype, but that the frequency of TR2 deletion mutations was lower than that observed for Allele 1 (Figure 5-8). Formati on of the TR2 genotype was only seen in 99623DP-F5, and TR3 deletions were only evident in YJ016 at 30C (data not shown). Interestingly, YJ016 produced a fourth genotype (TR2A) that was not seen in Allele 1 strains, and this genotype yiel ded a PCR product that was slig htly smaller (3.0 Kb) than the 3.3 Kb product seen with TR2 (Figure 5-5). DNA sequencing of TR2A confirmed a larger deletion than what was observed in TR2 and showed loss of both the open reading frame (ORF) encoding the hypothe tical protein (HP2) and the wzb gene The appearance of a unique TR2A mutation in Allele 2 strains demonstrated that the size of the deletion mutation corresponded to the location of repetitive elements for all strains of both alleles (Figure 5-9). T hus, these data support th e association between repetitive element location and deletion mutation in the V. vulnificus CPS operon.

PAGE 91

76 B) Allele 2 for the V. vulnificus group 1 CPS operon (YJ106/Op): TR2 deletion mutation for allele 2: TR2Adeletionmutationforallele2: ORF1 wza wzc R2 ORF1 wza HP2 wzc R2 ORF1 wza HP2 wzb wzc R2 R2 R2 A) Allele 1 for the V. vulnificus group 1 CPS operon: TR2 deletion mutation for allele 1 ORF1 wza HP1 wzc R1 ORF1 wza HP1 wzb wzc R1 R1 Figure 5-9. Deletion mutation si ze corresponds to repetitive element location. Structure of the conserved transport regi on of the group 1 CPS operon and corresponding TR2 andTR2A deletion muta nts are shown for A) Allele 1 and B) Allele 2. Arrows indicate direction of transcription, and genes removed by deletion mutations are shaded. Examination of Tr genotypes formed by A llele 2 strains also showed strain variability in genotype formation within this allelic type. YJ016 was the only Allele 2 strain that produced TR3 isolates; however, TR3 o ccurred at very low levels in this strain. This strain also formed the TR1 and TR2A genotypes. Allele 2 strain 99-537DP-G7 produced theTR1 genotype, while strain 99623DP-F5 produced TR1 and TR2, but not

PAGE 92

77 TR2A or TR3. These results demonstrated th at, like Allele 1, the appearance of Tr genotypes in Allele 2 isolates is strain related. Examination into the extent of deleti on in TR3 was performed using additional primer sets that individually targ eted each of the transport genes (wza, wzb, wzc) and a conserved gene, wbfV, found just downstream of the CPS operons in both published genomes. These primers did not amplify DNA from TR3 isolates but did amplify sequences in an Op variant of the same st rain. However, species-specific PCR primers for the vvhA hemolysin gene produced identical pr oducts in all TR3 st rains (data not Table 5-3. Frequency of deleti on mutations among CPS alleles at 30C Distribution of Deletion Genotypesa Time Post Inoculation (days)b Strains 3 7 10 Allele 1 MO6-24 3.0 1.2 18.6 3.2c 27.0 25.2 LC4 3.2 4.5 2.4 3.5 1.1 1.5 C7184 0.0 0.0 0.0 0.0 0.0 0.0 CMCP6 0.0 0.0 2.0 2.8 0.0 0.0 Allele 2 YJ016 0.0 0.0 0.0 0.0 0.0 0.0 aGenotype distribution indicates the percent of the total colonies recovered from PP3 broth as an average of two experiments st andard deviation. Op genotype was inferred from colony morphology and distribution of Tr genotypes was based on PCR screening. bCultures were sampled at Days 3, 7 and 10 post inoculation to obt ain a combined total of at least 150 Tr isolates for evaluation of each strain. cDeletion mutations were significantly (p 0.0390) higher in MO6-24 vs. al l other strains on Day 7. shown). These results indicated that DNA de letions in the CPS operon of TR3 isolates extend beyond wzb excisions. In order to evaluate whether or not the frequency of deletion mutation was associated with allelic type, the rate of dele tion mutants formed by strains of Allele 1 was compared to the rate of deletion formed by strains of Allele 2. Results showed that Allele 1 strains produced dele tion mutants at higher levels than did Allele 2 strains at both 30

PAGE 93

78 and 37C (Tables 5-3 and 5-4). At 30 C, MO6-24 produced deletion mutants at significantly (p 0.039) higher levels than YJ016. At 37C, all Allele 2 strains produced significantly (p 0.0397) fewer deletion mutants than the Allele 1 strains MO6-24 and LC4 by Day 3. By Day 7, all Allele 2 strains produced significantly (p 0.0462) lower levels of deletion mutants compared to MO6-24, LC4, and C7184. An average percent deletion mutant production was also calculate d across each allelic type and results showed that on average Allele 2 strains produced significantl y (p=0.0267) fewer deletion Table 5-4. Frequency of deleti on mutations among CPS alleles at 37C Distribution of Deletion Genotypesa Time Post Inoculation (days)b Strains 3 7 10 Allele 1 MO6-24 25.0 11.0 c 34.6 15.7d 24.1 8.6 LC4 13.0 0.1 c 3.1 0.7 d 4.7 6.6 C7184 2.1 3.0 22.9 2.0 d 36.0 13.9 CMCP6 0.3 0.4 32.2 44.2 41.2 17.4 Allele 1 Average 10.1 23.2e N.D Allele 2 YJ016 0.6 0.7 1.6 0.7 0.0 0.0 99-537DP-G7 1.4 2.4 1.7 2.9 N.D. 99-623DP-F5 0.0 0.0 0.0 0.0 N.D. Allele 2 Average 0.7 1.1 N.D. aGenotype distribution indicates the percent of the total colonies recovered from PP3 broth as an average of two experiments st andard deviation. Op genotype was inferred from colony morphology and distribution of Tr genotypes was based on PCR screening. bCultures were sampled at Days 3, 7 and 10 post inoculation to obt ain a combined total of at least 150 Tr isolates for evaluation of each strain. cSignificantly (p 0.0397) lower levels of deletion mutation were observed in all Allele 2 strain s vs. MO6-24 and LC4 on Day 3. dSignificantly (p 0.0462) lower levels of deleti on mutation were observed in all Allele 2 strains vs. MO6-24 and LC4 on Day 7. eAverage deletion mutation was significantly (p=0.0267) lower in A llele 2 vs. Allele 1 strains. mutants compared to Allele 1 strains by Day 7. Therefore, these re sults suggest that differences between alleles account for diffe rences in the rate of deletion mutation.

PAGE 94

79 Translucent to Opaque Phase Variation A shift from the Tr phenotype to the Op upon incubation in LB was previously reported for V. vulnificus isolates, and this transition occurred at a level of 10-3 to 10-4 (Yoshida et al. 1985, Wright et al. 1990). Incubation of Tr is olates in PP3 did not result in phase variation to the Op phenotype; theref ore, the stability of TR1, TR2, and TR3 isolates was evaluated by passage in LB. Incubation of TR1 isolates (n=24) showed reversion back to the Op form (Table 5-5) . However, this reversion which occurred within 24 h appeared to be faster in than Op to Tr transitions require 3 to 7 days. Increases in reversion were also indicated by the appearance of sectored colonies, which was observed only after subculture in LB, and continued passage of TR1 isolates in PP3 negated the appearance of the sectored phenotype (Table 5-5). The TR2 and TR3 genotypes were presumed to be stable in the Tr phase due to the loss of wzb, and passage in LB confirmed this hypothesis. TR2 and TR3 isolates (n=24) did not revert to the Op phenotype upon incubation in LB nor did these isolates form sectored colonies. Thus, TR2 and TR3 were locked in the translucent phase (Table 5-5). These results Table 5-5. Phenotypic st ability of translucent genotypes Transitions of Tr to Op or Sectored Colonies (%)a Incubation Medium L. Broth PP3 MO6-24 Translucent Genotype % Opaque % Sectored % Opaque % Sectored TR1 48.9 9.1 5.9 1.2 0.0 0.0 0.0 0.0 TR2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 TR3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 aPercentages of Op and sectored colonies as a fraction of total colony number are shown for all genotypes. demonstrated that some of the Tr isolates (TR1) generated from phase induction assays maintained reversible phase variation and therefore, can be classified as phase variants.

PAGE 95

80 However, other isolates (TR2 and TR3) were not reversible and are thus potentially not phase variants. Conclusions Previous DNA sequence comparisons of the CPS operon among strains of V. vulnificus showed differences within the conserved transport region, and PCR analysis of Tr isolates identified three distinct ge notype (TR1, TR2, TR3). Further analysis of CPS operons from multiple strains revealed two distinct alleles (Allele 1 and Allele 2) at this locus (Chatzidaki 2004). This study demonstrated that V. vulnificus strains varied in their levels of Tr colony formation. However, this variability was only loosely correlated with allelic type, and variability within stra ins of each allele prevented conclusions about an association between phase variation and al lelic type. All strains of both alleles did exhibit increased levels of Tr colony form ation during extended incubation, indicating that phase variation in V. vulnificus may be a response to stress or starvation The presence of repetitive elements fla nking deletion sites within the CPS operon suggested these elements may pl ay a role in deletion mutation. Therefore, Tr isolates produced by multiple strains of both alleles du ring phase induction assays were examined for their genotype and results showed allelic differences in both Tr genotype formation and deletion mutation. The TR1, TR2, a nd TR3 genotypes were formed by strains of both alleles; however, Allele 2 strain YJ016 produced an additional genotype (TR2A), which showed loss of both the open readi ng frame (ORF) encoding the hypothetical protein (HP2) and the wzb gene. In all instan ces of deletion mutation, the size of excised DNA corresponded exactly to the lo cation of the repetitive elem ents for all strains of both alleles. Thus, these data support the association between repetitive element location and deletion mutation. The frequency of de letion mutation between alleles was also

PAGE 96

81 examined and results showed that Allele 1 strains produced deletion mutants at significantly higher frequency than did strains of Allele 2, indicating that differences between these alleles account for differences in the rate of deletion mutation. Finally, evaluation of the stability of th e Tr genotypes revealed that the TR1 genotype (which possessed the intact CPS oper on) was phase variable , while the deletion mutants (TR2 and TR3) were locked in th e Tr phase and thus phase stable under the conditions examined. This observed forma tion of both phase variants and deletion mutants indicated that multiple pathways ar e responsible for regulation of Tr colony formation.

PAGE 97

82 CHAPTER 6 RESULTS: SPECIFIC AIM 3 Rationale for Study The RecA enzyme is involved in DNA repa ir, replication, and some homologous recombination mechanisms. RecA-dependent homologous recombination is initiated by breaks in DNA, which result in the forma tion of free single stranded (ss) or double stranded (ds) DNA ends. (Weaver 2002). Repet itive elements have been shown to be “hot spots” for DNA break formation under stressful conditions (van Belkum 1999). RecA also plays a critical role as a stationa ry phase enzyme in the bacterial stress/SOS response, and binding of RecA to free DNA ends signals expression of SOS genes, which play a role in a variety of repair mechan isms, including recombination (Shinagawa 1996). RecA-dependent homologous recombination leading to phase variation has been described in Neisseria gonorrhoeae, Pseudomonas tollaasii, and Haemophilus influenze (Hoiseth et al. 1986, Seifert 1996, Sinha et al. 2000). N. gonorrhoeae undergoes phase variation of its type IV pilu s through intramolecular recombin ation between di stinct loci (Seifert 1996, Mehr and Seifert 1998). Exchange of DNA cassettes between the pilE and pilS genes allows for replacement of a region of pilE with a portion of pilS, resulting in changes in or elimination of pili expression (Seifert 1996, Mehr and Seifert 1998). Phase variation from an Op to a Tr phenotype in P. tolaasii resulted when capsule expression was disrupted by a reversible 661-bp duplica tion in the putative kinase domain of a regulatory locus (Sinha et al. 2000). Finally, in H. influenzae, duplicated DNA segements are directly repeated and encompass a CPS export gene (bexA). Rec-

PAGE 98

83 dependent recombination resulted in loss of the tandem duplication as well as part of the coding region of bexA, resulting in loss of capsule expr ession (Hoiseth et al. 1986, Kroll and Moxon 1988). In the V. vulnificus CPS operon, tandem copies of repetitive elements appeared to be associated with the site-specifi c deletion of a CPS transport gene (wzb). These repetitive elements exhibit extended regi ons of homologous DNA surrounding the area of excision and may also facilita te DNA breaks leading to bindi ng of RecA. Thus, repetitive elements could provide sites for RecA-d ependent homologous recombination, as a potential mechanism for deletion mutation within the V. vulnificus CPS operon. RecA recombination and the SOS response are associat ed with stationary phase and starvation. Prolonged incubation of V. vulnificus in PP3 increased the appearance of deletion mutations, which would be consistent with Re cA-mediated recombination. Therefore, the present study used mutational analys is to investigate the role of recA in genetic rearrangement leading to transitions from the Op to the Tr phenotype. Mutational Analysis of V. vulnificus recA Activity In order to determine the role of recA in deletion mutation within the CPS operon of V. vulnificus, disruption of the recA gene by insertional inac tivation was attempted. Comparison of the DNA sequence of the genomic region encompassing recA from V. vulnificus strains CMCP6 (Kim et al. 2003) and YJ016 (Chen et al. 2003) showed this region included an upstream gene seque nce encoding a hypothetical protein and a downstream gene encoding the RecA regulator RecX (Appendix). This region is highly conserved, and strains displa yed 98% nucleotide identity. Primers derived from regions flanking recA were used to amplify this target by PCR in V. vulnificus MO6-24/Op, and DNA sequence comparison of this amplicon showed 97 and 98% nucleotide identity

PAGE 99

84 compared to YJ016 and CMCP6, respectively (Appendix). This PCR product was cloned into an appropriate vector, and a DNA casse tte conferring resistance to kanamycin was used for insertional inactivation of the V. vulnificus recA gene. A suicide vector (pGTR1128) was used to deliver the insertiona lly inactivated copy of recA into the V. vulnificus MO6-24/Op chromosome. Results showed that a singlecrossover mutation in recA was generated, and multiple attempts were made to produce a double-crossover mutation. Single-crossover r ecombination results in the integration of the complete circular plasmid at the genomic target site, while double-crossovers lead to deletion of the chromosomal sequence between the crossover sites a nd insertion of the intervening sequence on the plasmid (Weaver 2000). Three attempts at generating the double-crossover mutation using the suicide vect or were made, and at least 60 colonies were screened with each attempt. However, all selected colonies still possessed the single-crossover, and a double-crossover mutatio n was not obtained. Inherent problems with the functionality of the suicide vect or were encountered during this mutational analysis including loss of the vector’s tetracycline resistance. Similar problems were also observed by other labs attempting mutations in other targeted genes (Dr. Gulig, Dr. Paranjpye, personal communication). Due to the problems with achieving a doubl e-crossover with this plasmid, an alternate method of mutation delivery, usi ng a broad host range vector containing the inactivated recA gene, was used in an attempt to produce a double-crossover recA mutation in V. vulnificus. This method employs antibiotic selective pressure to insert mutations into the chromosome and successfu lly generated a mutation in the cytolysin gene of V. vulnificus (Wright and Morris 1991). Unfo rtunately, this method was also

PAGE 100

85 unsuccessful in delivery of the inactivated recA gene. Mutations in recA are notoriously difficult to generate (Dr. Comstock, persona l communication). Therefore, in order to determine whether problems in achieving a double-crossover are due to the delivery method or due to recA studies, generating a mutati on in a different gene (dinB) using the antibiotic selection method are ongoing. Single-crossover mutations can result in cells that are deficient for expression of the mutated gene. Therefore, UV sensitivity assays were used to evaluate the activity of insertionally inactivated recA in single-crossover mutants. These studies indicated that mutants with a single-cross over showed significantly (p 0.022) less growth after 90 sec of UV exposure when compared to the unaltered parent (MO6-24/Op), indicating that the DNA repair function of recA had been lost (Figure 6-1). To ensure the function of recA could be restored, single-cross over mutants were complemented in trans with an intact recA gene on a broad host range plasmid. Complemented strains demonstrated growth levels after UV exposure that did not differ significantly (p 0.290) from the unaltered parent, demonstrating that recA function had been restored (F igure 6-1). Comparisons of overall culture concentration showed that the parent strains had a significantly (p 0.022) higher culture concentr ation in PP3 through 2 days of incubation compared to both the mutant and complemented strains (Figure 6-2) . Overall culture concentrations for the mutant and complemented strains continued to be lower than the parent through the end of the assay, but these differences were not statistically significant. Additionally, significant differences in overall culture c oncentration were not observed between the recA mutants and their complements throughout the assay (Figure 6-2).

PAGE 101

86 Percent Survival after UV Exposure -5 -4.5 -4 -3.5 -3 -2.5 -2 -1.5 -1 -0.5 0 0306090Log10(N/No ) MO6-24 RecA1 RecA2 -5 -4.5 -4 -3.5 -3 -2.5 -2 -1.5 -1 -0.5 0 0306090Time of UV ExposureLog10 (N/No) MO6-24 RecA1 pRECA RecA2 pRECA* Figure 6-1. UV exposure assays measuring survival after exposure to UV light. Asterisk (*) indicates a significantly (p 0.022) higher level of survival of MO6-24 compared to the single crossover recA mutants. Role of recA in V. vulnificus Phase Variation Because the single-crossover mutants showed loss of recA function, the mutants and their complements were inoculated in to phase induction assa ys as previously described. Examination of the leve ls of phase variation generated by recA mutants

PAGE 102

87 revealed significantly (p 0.049) lower levels of translucent colony formation compared to the parent strain at Days 2 and 3 posti noculation (Figure 6-3). However, further incubation increased the percent Tr colonies in mutant strains to near wild type levels. Interestingly, complemented strains produced le vels of translucent colony formation that were lower than both the mutant a nd the parent, with significantly (p 0.0463) lower levels occurring by Day 7 (Figure 6-3). In order to determine if inactivation of recA influenced deletion mutation within the CPS operon, Tr colonies gene rated by the single-crossover recA mutant strains during phase induction assays were evaluated for C PS genotype. As shown in Figure 6-4, PCR 0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 1237Time Post Inoculation (days)Log10 CFU/m MO6-24/Op RecA-1 RecA-2 RecA-1 pRECA RecA-2 pRECA* * Figure 6-2. Comparison of recA mutant, comple ment and parent cultures concentrations. Concentration (log CFU/mL) of recA mutant (RecA-1, RecA-2), complement (RecA-1 pRECA, RecA-2 pRECA) a nd parent (MO6-24/Op) cultures measured throughout incubation in PP3 (p H 7.0). Asterisk (*) indicates a significant (p 0.220) difference in to tal culture concentr ation (TVC) between MO6-24/Op and all other st rains at Days 1 and 2.

PAGE 103

88 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 1237Time Post Inoculation (days)Transition to Tr (%) MO6-24 RecA1 RecA1 pRECA RecA-2 RecA-2 pRECA * # Figure 6-3.Effect of recA mutation and complementation on phase variation. Percent Tr calculated for the MO6-24 parent, single crossover recA mutants 1 and 2, and the mutants complements in trans wi th pRECA. Pound sign (#) indicates significantly (p=0.049) greater percen t Tr colonies formed by parent compared to RecA mutant 1. As terisk (*) indicates significantly (p 0.007) higher percent Tr colonies formed by parent compared to both recA mutant strains. Plus sign (+) indicates significantly (p 0.0463) lower levels of percent Tr colonies formed by complemented strains vs. their mutants. analysis revealed that the recA mutants formed Tr isolates with intact CPS operons (TR1), as well as deletion mutants (TR2). However, the levels of deletion mutation (<10%) was significantly (p 0.0413) less than previously obse rved in the parent strain without the RecA muta tion where levels of T2 genera lly exceeded 20% (Figure 5-9). Also, TR3 strains containing the more extens ive deletion mutations were never seen in these mutants, while levels of TR3 in the pa rent strain approached 20% of the population by Day 7. Translucent isolates were also evaluated for the presence of the single-crossover mutation following extended incubation in PP3, a nd results showed that all Tr isolates

PAGE 104

89 Time Post Inoculation (days) 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 37 Op TR1 TR2 0.0% 10.0% 20.0% 30.0% 40.0% 50.0% 60.0% 70.0% 80.0% 90.0% 100.0% 37RecA-2 RecA-1Genotype Frequency (%) Genotype Frequency (%) Figure 6-4.Cumulative distribution of Op phenotype and Tr genotype among singlecrossover recA mutants. Percent Op colonies (F illed bars) vs. Tr colonies of either TR1 (hatched bars) or TR2 (unfilled bars) genotype derived for Op MO6-24 parent with single crossover r ecA mutants A) RecA-1 and B) RecA2 for Days 3 and 7 pot-inoculation. had lost the inactivated recA gene construct. These resu lts demonstrated that the single-crossover mutation of recA was not stable, but the absence of the recA mutation in

PAGE 105

90 all the Tr colonies following incubation in PP3 also suggests that phase variation and CPS deletion mutations occur onl y after this mutation is lost. Single-crossover mutations are known to be genetically unstable, and the integrated plasmid can return to the free plasmid state with subsequent loss of the plasmid if selective pressure is not maintained (Weaver 2002). While all Tr isolates were ne gative by PCR for the inactivated recA gene with the inserted kanamycin cassette, they all remained resistant to kanamycin as indicated by growth in media containing high levels of the antibiotic (>200 g/ml). Other studies have reported inhe rent resistance to low levels of kanamycin in V. vulnificus strain MO6-24/Op (Wright et al., 1990). Prolonged incubation in PP3 may have enhanced this inherent resi stance through sele ctive pressure. Overa ll, results present evidence that the inactivation of recA delayed the formation of Tr colonies and greatly reduced deletion mutations in V. vulnificus. Conclusions Mutational analysis of the recA gene of V. vulnificus through single-crossover recombination resulted in loss of recA function, as indicated by increased sensitivity to UV light. Introduction of recA mutants and their complements into phase induction assays showed that recA mutants formed lower levels of Tr colonies compared to the wild type throughout much of the assay. However, Tr colony formation in recA mutants eventually increased to levels that were not significantly different from the wild type. Interestingly, complementation of recA did not restore phase varia tion to wild type levels. Genotype analysis of Tr isolates derived from recA mutants revealed formation of both TR1 and TR2 genotypes. TR1 were initially lo wer that wild type at Day 3 but were approximately twice the frequency of wild t ype by Day 7. However, deletion mutations were at much lower levels than that observe d with the parent stra in throughout the study.

PAGE 106

91 Further analysis revealed that all of the Tr isolates derived from single crossover mutants were negative for the inactivated gene construct, indicating that the mutation was unstable. These results are consistent with the hypothesis that phase variation and deletion mutation did not occur until the inactivated recA gene was lost. Thus, it appears likely that recA is involved in both phase vari ation and deletion mutation in the V. vulnificus CPS operon. However, results from th ese experiments are not definitive in determining the role recA, and stable mutations with complementation analysis are needed.

PAGE 107

92 CHAPTER 7 DISCUSSION AND CONCLUSIONS Induction of High Frequency “Phase Variation” Reported levels of spontaneous, reversib le phase variation between opaque (Op) and translucent (Tr) phenotypes of V. vulnificus are too low for extensive analysis of phase variable populations (Wright et al. 1990). In order to evaluate phase variation in multiple strains of V. vulnificus and to analyze the genetics behind mutations within the group 1 capsular polysaccharide (CPS) oper on, different culture conditions were examined for their ability to generate increased levels of phase variation in V. vulnificus. Ali et al. (2002) showed that incubation at 37C in media cont aining peptone #3 (PP3) produced high-frequency phase variation fr om smooth to the rugose phenotype in V. cholerae. In V. vulnificus, incubation in PP3 also resulted in high-frequency phase variation, whereby the appearance of Tr colonies derived from Op cultures was significantly (p 0.018) higher following incubation in this medium compared to other media. Further studies also revealed that high-frequency phase vari ation from Op to Tr occurred in multiple strains of V. vulnificus upon incubation in PP3. However, incubation of Tr isolates in this medium did not result in a shift to the Op phenotype, indicating PP3 only increases reve rsion to the Tr phase. High-frequency phase variation in V. cholerae that was induced by incubation in PP3 varied with incubation temperature. Hi ghest levels of transition from smooth to rugose occurred at 37C compared to 30C, but high-frequency phase variation always occurred within 24 h at both temperatures (Ali et al. 2002). Similar results in response to

PAGE 108

93 temperature were seen for Op to Tr phase variation in V. vulnificus. However, highfrequency phase variation in this species was not observed until late stationary phase, requiring at least 48 h for Tr colonies to appe ar. Studies comparing levels of Tr colony formation among temperatures in multiple strains of V. vulnificus showed that 37C resulted in significantly (p 0.001) higher levels of phase variation compared to 30C for some strains (MO6-24, LC4, and C7184). Conversely, other strains (E4125 and YJ016) exhibited higher percent Tr colonies at 42C, demonstrating that a lthough the temperature that induced the highest levels of phase variation was cons istent among some strains of V. vulnificus, strain variability was also observed. The increases in phase variation seen upon incubation in PP3 and the differences in Tr colony formation observed at varying temperatures, suggested that CPS phase variation in V. vulnificus is responsive to environmenta l conditions. This responsiveness to environmental parameters for regulation of transition from the virulent Op to the avirulent Tr phenotype may permit manipula tion of virulence factor expression. Additionally, the absence of transitions from the Tr to Op phase in PP3 suggests that it may be possible to not only control phase vari ation but also the dire ction of switch. The media component(s) responsible for the induc tion of phase variation have not been identified, and the role of specific nutrients or salts in defined me dium was not compared in the present study and remains to be determined. Therefore, evidence for environmental regulation warrants further i nvestigation into specific parameters that regulate phase variation. Growth Phase and Phase Variation Vibrio vulnificus phase variation in PP3 increased significantly after extended incubation, which produces conditions of stress and nutrient starvation. For all

PAGE 109

94 environmental parameters examined, phase variation of opaque V. vulnificus to the Tr phenotype increased over time in all strain s and was significantly greater in late stationary phase than at earlier time points. These results indicated that transition to the Tr phenotype in V. vulnificus is a stationary phase or starvation response. Environmental stressors, such as decreased nutrient availabil ity and non-optimum growth conditions, create an unfavorable environment that bacteria must overcome in order to survive, and bacteria employ a variety of strategies to adapt to these challenges (Novick 2003). One of these adaptations is increased expression of sigma factors that regulate stress response genes in stationary pha se. Sigma factors ar e structural subunits of prokaryotic RNA polymerase that provide recognition of sp ecific promoters leading to the expression of downstream genes (Weaver 2002). Stationary-phase Gram-negative bacteria express the alternate sigma factor RpoS, which has been shown to enhance survival under strenuous conditions. RpoS is necessary for long-term survival of E. coli during stationary phase, and an RpoS-deficient mutant show ed reduced biofilm formation and decreased survival in response to nutrient stresses compared to the wild type (Shiba et al. 1997, Adams and McLean 199 9, Boaretti et al. 2003). Vibrio vulnificus RpoSdeficient mutants also had significantly reduced survival under nutrient deprivation compared to the unaltered parent, indicating that this sigma factor is active during and plays a role in survival u nder nutrient limiting conditions (H ulsmann et al. 2003). Thus, the increases in transition to the Tr phenotype observed in V. vulnificus during extended incubation in PP3 make RpoS a potential regulator of phase va riation in this bacterium. It has also been proposed that during stationary phase bacteria can accumulate mutations that produce structur al and functional alterations as a means of non-growth

PAGE 110

95 adaptation for survival unde r stressful conditions (Daws on et al. 1981). Experiments examining long-term survival of V. cholerae showed that after 7 days of starvation dispersion of lipids and carbohydrates occurr ed (Hood et al. 1986, Wai et al. 1999). Additionally, nutrient starvation led to a shift to the rugose morphology in V. cholerae, and rugose variants displayed greater biofilm formation than other phenotypes (Wai et al. 1998, Mizunoe et al. 1999, Ali et al . 2001). Previous studies examining V. vulnificus biofilm formation showed that nutrient depl etion produced increased levels of biofilm formation by Tr isolates (Joseph and Wright 2004). The same study also demonstrated that the Tr phase of V. vulnificus produced greater amounts of biofilm than the Op, indicating that Tr cells may be better biofilm formers. Thus, the starvation conditions encountered during extended incubation in PP3 may signal a switch to a phenotype that is better suited for biofilm formation. Population Dynamics of Phase Variation Nutrient deprivation can also result in quorum sensing, which is a mechanism of gene regulation by which bacteria use secr eted signals that are sensed by surrounding bacterial populations to m odulate gene expression. Once these molecules reach a threshold concentration, alterations in gene expression and thus behavior modification occur. Therefore, the impact of these secr eted signaling molecules is associated with increased cell densities. Although V. vulnificus group 1 CPS phase variation was sensitive to environmental parameters, it did not appear to be regulated by secreted factors. Levels of Op to Tr phase variati on increased in spent compared to fresh medium but did not significantly (p 0.363) differ. Furthermore, the levels of phase variation in V. vulnificus were not cell-density-dependent as Tr colony formation did not vary with initial concentrations of 106, 107, and 109 CFU/mL. Additionally, the increased levels of

PAGE 111

96 phase variation that were observed following ex tended incubation are likely not related to quorum sensing because cell-density responses generally peak during late-logarithmic growth. Observed changes in alternate colony types of V. vulnificus are generally attributed to phase variation, but most studies only re port the percent changes in populations and do not specifically examine cell number. The increase in percent of V. vulnificus Tr colonies could be due to growth-related events such as increased survival of Tr compared to Op populations resulting from either die off of Op cells or growth of Tr cells. Investigation into population dynamics showed that phase variation, as opposed to Op population mortality, is the predominant phenomenon resp onsible for the appearance of Tr colonies. Studies tracking population change s in Op vs. Tr cell types revealed a decline in the number of Op CFU/mL over the course of the experiment, but these declines were significantly greater than the overall decreases in total culture concentration. Significant increases in Tr colony formation occurred only after extended incubation when cell division would not be expected to occur due to nutrient lim itations. Therefore, increased growth of Tr cells is unlikely to be the cause of the observed increases in percentage of the Tr phenotype. Thus, neither Op cell mortal ity nor growth of Tr cells accounts for the overall changes in V. vulnificus populations, and appearance of the Tr phenotype is likely to result from phase variation. In order to experimentally confirm ph ase variation, a growth plasmid was introduced into V. vulnificus MO6-24/Op. Results showed that first generation Op cells containing the growth plasmid formed Tr col onies that inherited the antibiotic resistance marker, confirming that phase variation from Op to Tr had occurred. The growth plasmid

PAGE 112

97 was also used to monitor Op cell mortality, and measurements revealed that significant mortality or cell death in th e Op inoculum occurred within three days of incubation. Overall, these data confirmed the role of pha se variation in the transition of Op to Tr cells, but also indicated that phase variati on was combined with simultaneous die off of Op cells after extended incubation. Genetics of “Phase Variation” DNA sequence analysis identifi ed a group 1 CPS operon in V. vulnificus MO6-24/Op (Wright et al. 2001, Chatzidaki 2004 ). PCR screening of Tr phase variants and DNA sequence comparison to their Op parent was used to determine if mutation in the CPS operon were responsible for phase va riation. Three distinct genotypes (TR1, TR2, TR3) were observed among Tr isolates: TR1 had an intact CPS operon, while TR2 and TR3 showed deletion mutations. The deletion mutation in the TR2 strain was specific to the wzb gene, and complementation in trans with wzb restored CPS expression. The extent of deletions in a TR3 strain was unknown, but presumably involved multiple genes and possibly the entire operon (Chatzidaki 2004). Thus, phase variation involved at least two genetic mech anisms: one that was independent of the CPS operon and another that invol ved deletion mutations that were specific for the CPS operon. Comparison of DNA sequen ces from multiple strains of V. vulnificus showed two distinct genotypes or allele s (designated Allele 1 and Alle le 2) in the CPS operon. These alleles differed in the open reading fr ames (ORFs) encoding hypothetical proteins (HP1 and HP2, respectively) as well as in DNA sequence and structure of repetitive elements (R1 and R2, respectively). Repetitiv e elements of Allele 1 contained multiple, tandem copies of the same subunit, and thes e elements were found immediately flanking wzb. Repetitive elements of Allele 2 were co mprised of a more variable subunit and were

PAGE 113

98 found at an additional location downstream of wza. Allele-specific primers were used to examine the distribution of V. vulnificus CPS alleles among strains from clinical and environmental origin. CPS Allele 1 was significantly more common among clinical strains, while Allele 2 was significantly associated with environmental isolates, suggesting an association between allelic type and virulence. In order to determine if differences between CPS alleles corresponded to differences in CPS phase variation, multiple strains of each allelic type were introduced into phase induction assays. In general, Allele 1 showed increased rates of phase variation compared to Allele 2, as indicat ed by averages of all the strains examined. However, responses of individual strains in either allele were not consistent for all samples, as evidenced by large standard de viations. The levels of phase variation among the temperatures in each strain vari ed, whereby incubati on at 37C generated significantly (p 0.0148) higher levels of phase vari ation for most strains, but 30C enhanced phase variation of CMCP6. Interest ingly, changes in temperature did not alter the level of phase variation in E4125. Thes e strains are all Allele 1; therefore, the observed strain variability in response to temper atures did not associate with allelic type. However, within a given temperature strain va riations in translucent colony formation did loosely correlate with CPS allele type. For example, Allele 1 strains displayed significantly higher levels of phase variation at 37C by Day 3 (p 0.0208) and Day 7 (p=0.0236), while only one Allele 1strain (C MCP6) was delayed in Tr colony formation but displayed high levels by Day 7. Most Alle le 2 strains showed lower levels of Tr colony formation compared to Allele 1 at 37C by Day 3. However, Allele 2 strains 99-537DP-G7 and 99-623DP-F5 produced levels of Tr colony formation that were not

PAGE 114

99 significantly different from most strains of Allele 1. Over all, the variability in the phase variation response, as indicated by large standa rd deviations within each strain, prohibits conclusions about allelic diffe rences and suggests multiple mechanisms may be involved. Repetitive Elements and Deletion Mutation Repetitive elements are frequently associated with genetic mutations, and the intergenic placement of theses elements in V. vulnificus implicated their involvement with deletion mutations. Theref ore, genotypes of Tr colonies were examined in the context of allelic variation in order to dete rmine if differences in sequence and placement of repetitive elements influenced these mu tations. Phase induction of multiple strains with either Allele 2 or Allele 1 was used to generate sufficient numbers of Tr strains for this analysis. Although all st rains produced TR1 variants wi th intact CPS operons, the frequency and type of deletion mutation varied among strains and between allelic types. In order to confirm the role of repetitive el ements in deletion mutations, detailed genetic analysis of a large number (>2000) of phase va riants derived from the different alleles was conducted. Results showed that a deleti on mutant TR2A was unique to Allele 2. The TR2A genotype differed from TR2 in that loss of the wzb gene was accompanied by deletion of the gene sequence encoding the hypothetical protein (H P2) found upstream of wzb. The deletion of wzb in a TR2 isolate from an Alle le 1 strains corresponds to the location of repetitive elements found dire ctly upstream and downstream of the gene (Chatzidaki 2004). Association of repetitive element locatio n with deletion mutation was also observed in Allele 2 strains, as th e site of excised DNA in both TR2 and TR2A isolates produced by these strains corresponde d exactly to the locations of repetitive elements within this allele. Thus, these results confirmed the association between the

PAGE 115

100 location of repetitive elements a nd the site of DNA excision in V. vulnificus deletion mutants. More extensive deletions that appear to encompass the entire CPS operon in TR3 isolates of V. vulnificus were also observed in thes e studies. Chatzidaki (2004) previously identified the presence of multip le R3 repetitive elements surrounding the CPS operon in the V. vulnificus strain YJ016 and suggested that these elements may be involved in more extensive deletions in th is bacterium. Given the involvement of repetitive elements in the formation of TR2 and TR2A deletion mutants, it was hypothesized that repetitive elements may also be involved in deleti on mutation in TR3. Investigation into this hypothesis began with attempts to define the limits of the TR3 deletion mutation. PCR analysis using prim ers derived from sequences upstream and downstream of the CPS operon revealed multiple isolates gave variable results showing the limits of the TR3 deletion was variable among strains. In this work, TR3 deletion mutants were analyzed using primers specific fo r genes at the extreme 5 and 3 limits of the CPS operon. All isolates lacked amplifi cation of these genes indicating that deletion or rearrangements within TR3 mutants mi nimally encompassed the entire CPS operon and may include sites outside of the CPS operon. Overall, results demonstrated that the location of repetitive elements corresponded to the size of deletion mutation in TR2 and TR2A isolates. Evidence for the involvement of repetitive elements in deletion mutation in TR3 isolates was not obtained during this study, and further investigation is required to elucidate the role (if any) of repetitive elements in deletion mutation within TR3. Deletion Mutation Frequency and Allelic Type The association of repetitive elem ents with deletion mutation in V. vulnificus led to the hypothesis that differences in repetitiv e elements composition between the allelic

PAGE 116

101 types would lead to allelic di fferences in the frequency of deletion mutation. Therefore, the temporal distribution of Tr genotypes generated from phase induction assays was evaluated. Examination of the levels of deletion mutations revealed Allele 1 strains produced deletion mutants with consistently greater frequency than did strains of Allele 2, indicating that differences in repe at make-up account for differences in the rate of deletion formation observed between alleles. The R1 elements of Allele 1 were highly conserved, containing exact rep eats of the same 8-bp subunit. Conversely, R2 elements in Allele 2 were more variable with interven ing non-repetitive sequences interspersed with repetitive elements. The presence of lengt hy homologous regions surrounding the area of deletion in both alleles implicates homol ogous recombination as a potential mechanism of deletion formation. The R1 presented greater homology in DNA sequence than was observed in R2; thus, R1 elements could pot entially facilitate ho mologous recombination more readily than the more variable R2 elem ents, which would ultimately lead to higher levels of deletion mutation in strains of Allele 1. Strain E4125 was distinct among Allele 1 strains in that only TR1 phase variants were observed in this strain, and it was al so the only strain that produced sectored colonies following incubation of Op stra ins in PP3. Comparisons among the R1 repetitive elements in the CPS operon of Allele 1 strains showed that the R1 elements in E4125 were shorter than other Allele 1 isolat es (Figure 6-1). Th e R1 element upstream of wzb in E4125 was 136-bp in length, and the downstream element was only 40-bp in length. Homologous recombination generally requires regions of ho mology that are >50bp long. Therefore, the downstream elemen t within E4125 may not be long enough to support homologous recombination. Thus, bot h size and DNA composition of repetitive

PAGE 117

102 MO6-24/Op: CMCP6/Op: C7184/Op: LC4/Op: E4125/Op: R1A R1B wzb wzb wzb wzb wzb 240-bp 216-bp 200-bp 184-bp 136-bp 40-bp 80-bp 64-bp 112-bp 104-bp Figure 7-1.Repetitive element length flanking wzb within the V. vulnificus CPS operon. Length of R1A and R1B repetitive el ements found upstream and downstream of wzb, respectively are shortest in st rain E4125/Op compared to other Allele 1 strains (C7184/Op, CMCP 6/Op, MO6-24/Op, and LC4/Op). elements may determine deletion mutations within the CPS operon of V. vulnificus. Further experimental genetic manipulations are required to confir m this hypothesis. The examination into Tr genotype fo rmation overtime also suggested an association between incubation time and the exte nt of deletion mutation development. In MO6-24, deletion mutations occurred in a se quential fashion with TR2 isolates always appearing first, followed by the formation of more extensive deletions resulting in TR3 mutants. This sequential a ppearance suggested a progressi on from the formation of a smaller deletion to a much larger deletion. However, this trend was not observed in other strains, as most strains did not produce TR 3 isolates. TR3 deletion mutations were formed by CMCP6, and YJ016, but only MO 6-24 produced TR3 in numbers high enough for reliable analysis. Although the presence of R3 elements outside the CPS operon have been identified in one strain (YJ016) of V. vulnificus, their presence has not been confirmed in all strains that produce TR3 deletion mutants. Further experimental analysis is needed in order to determine if extensive deletion mutation is related to

PAGE 118

103 repetitive elements and if deletion mutations involving the V. vulnificus CPS operon occur sequentially. Contingency Loci and Phase Variation Specific regions of highly mutable DNA with architecture that targets them for specific genomic rearrangements are termed contingency loci, and some repetitive elements can be classified under this descript ion (Field et al. 1999, Aertsen and Michiels 2005). Contingency loci provide a mechanism for exact temporal and spatial mutations to occur and also provide a means of predicta ble genetic flexibility. These loci are often associated with predictable responses to environmental shifts (i.e. phase variation), which allow bacteria to respond to environmental challenges (Moxen et al. 1994, Field et al. 1999, Bayliss et al. 2001). Contingency loci are involved in a va riety of DNA mutation mechanisms, including site-specific recombin ation, transposition of IS elements, and homologous recombination. Site-specific re combination (often me diated by repetitive elements) can lead to inversion, inser tion, or excision of DNA and occurs in E. coli, Salmonella enterica serotype Typhi, and Bacteriodes fragilis (McClain et al. 1991, Zhang et al. 1997, Krinos et al. 2001, Coyne et al. 2003, van der Woude and Baulmer 2004). Contingency loci provide regions of sequence similarity for site-specific recombination and are recognized by specific recombinases (Coyne et al. 2003, van der Woude and Baulmer 2004). Recombinase-mediated changes in DNA sequence ultimately result in altered gene expression (Coyne et al. 2003). Contingency loci are also involved in DNA mutations that result from the precise transposition of IS elements into and out of the chromosome. In phase variation, insertion of an IS element results in tandem duplication of the targeted insertion site and forms a small repetitive element made up of at leas t two subunits (Bartlett and Silverman 1989,

PAGE 119

104 Hammerschmidt et al. 1996, Ziebuhr et al. 1999). The presence of this newly formed repetitive element is required for precise exci sion of the IS element and restoration of the original phenotype (Perkins-Baldi ng et al. 1999). It has been suggested that the repeat sequence is involved in recognition by trans posases and facilitates removal of the IS element (van der Woude and Baulmer 2004). RecA-Dependent Deletion Mutation RecA-dependent homologous recombinati on also involves c ontingency loci. DNA mutation typically occurs between long (>50-bp), highly homologous regions of DNA, leading to inversion, inserti on, or excision of intervening sequence (van der Woude and Baulmer 2004). Homologous recombination in phase variation differs from general homologous recombination events in that phase variable recombination can occur between regions of lower homology and at a much higher frequency than general recombination rates (van der Woude and Baul mer 2004). Contingency loci consisting of direct repeats mediate deletion of intervening sequence in the pilE locus of N. gonorrhoeae through homologous recombination that is dependent on the RecA enzyme (Bergstrom et al. 1986, Koomey et al. 1987, Hill et al. 1990). DNA deletions in the CPS operon of V. vulnificus are also associated with direct repeats. However, location of thes e repeats differed from those found in N. gonorrhoeae. The Neisseria repeats are intragenic, resulting in the unidirectional exchange of DNA from a distant locus and do not facili tate removal of the entire gene. Vibrio vulnificus repeats are intergenic and located between ORFs for excision of one or more genes. The location of V. vulnificus repetitive elements is unique in that repetitive elements involved in the phase variation events of other bacteria are generally located either within a gene (following the initial methionine sequence) or within the promoter region.

PAGE 120

105 Genetic Analysis of the Role of recA in V. vulnificus Deletion Mutations Vibrio vulnificus phase induction assays revealed th at deletion mutations increased with prolonged incubation, a nd genetic analysis demonstrat ed an association between repetitive element location and the form ation of deletion mutations. Prolonged incubation may damage DNA due to the formation of single stranded breaks that initiate recombination events mediated by RecA (W eaver 2002). Furthermore, some repetitive elements promote DNA breaks due to their inhe rent instability and high mutability (van Belkum et al. 1998). Therefore, mutational an alysis was used to examine the role of RecA-mediated homologous recombination in deletion mutations in the V. vulnificus CPS operon. Insertional inactivation of the recA gene was accomplished by single-crossover of a construct containing a ka namycin resistance marker. The recA mutants had significantly (p 0.022) increased UV sensitivity, as evidenced by reduced survival after UV exposure compared to the wild type, dem onstrating disruption of RecA function in these strains. In trans complementation of recA mutants restored UV resistance to levels that were not significantly different from the wild type, indicating RecA function had been restored. The recA mutants and their complements were th en exposed to conditions that lead to high-frequency phase variation in V. vulnificus. Results showed that recA mutants displayed significantly (p 0.05) lower levels of Op to Tr phase variation compared to the wild type parent through 3 days of incubation. However, the level of Tr colony formation by recA mutants increased to near wild type levels by Day 7. PCR analysis of the recA mutation in Tr isolates generated by recA mutants revealed all Tr isolates had lost the inactivated gene construct, indicating that this mutation was unstable. Evaluation of Tr genotype formation by recA mutants revealed these mutants formed TR1 and TR2

PAGE 121

106 isolated, but only exhibited the TR2 genotype s on an average of 7.1% of the total population by Day 7. Therefore, the delayed ons et in appearance of Tr cells in addition to the loss of the recA mutation in Tr variants, suggests that recA may be required for phase variation and deletion mutation in V. vulnificus. Interestingly, the levels of Tr co lony formation produced by complemented recA mutants incubated in PP3 were lower compared to both the recA mutants and the wild type, and levels of Tr colonies never exceeded 10%. In V. vulnificus, the recX gene (which encodes a RecA regulator protei n) is found immediately downstream of recA. The 5' end of recA and the start codon for recX are separated by only 70 bp, indicating that these genes may be organized in an operon-like structure. The single-crossover mutation in the V. vulnificus recA gene is likely to be a polar mutation, which may inactivate downstream genes. Inactivation of recX has been shown to result in overexpression of recA, which can be toxic to bacterial cells , and in complemented strains where recA activity has been restored the loss of RecX activity may negatively impact cell viability (Papavinasasundaram et al. 1998, Vierling et al. 2000, Sukchawalit et al. 2001). Loss of cell viability in complemented V. vulnificus recA mutants was demonstrated by significantly (p 0.003) lower growth levels compared to the wild type , suggesting that recX activity may also be disrupted in singlecrossover mutants and demonstrating that simply restoring recA function did not restore cell viability. Repeated attempts to generate a stable mutation in V. vulnificus recA were unsuccessful. Loss of RecA activity from a single-crossover may preclude the possibility of a second crossover, as RecA is integral to homologous recombination. Alternatively, the RecA enzyme is involved in a variety of cellular process that are important for cell

PAGE 122

107 maintenance and viability, and mutation of this gene is likely to ha ve pleitropic effects that may effect cell viability. Therefore, results from these experiments are not definitive in determining whether or not recA and homologous recombinat ion are responsible for differences in phase variation observed in V. vulnificus recA mutants. DNA repair mechanisms other than R ecA-mediated homologous recombination may be responsible for formation of deleti on mutations. Another gene that could be involved in deletion mutation in V. vulnificus is dinB, which encodes for the error-prone DNA Polymerase IV that has been shown to increase the rates of mutation. This polymerase is a member of the Y-family of polymerases, which are deficient in proofreading activity and replicate undamaged DNA with low fidelity (Ohmori et al. 2001, Friedberg et al. 2001). Additionally, dinB is activated under conditions of stress and is involved stationary phase mutagenesis in E. coli (Foster 1999, Bull et al. 2001). In order to determine if problems generati ng the double-crossover mutation in recA were due to loss of RecA activity in the single-crossover, a d ouble-crossover mutation in dinB is currently being attempted using the antibiotic selection method. Multiple Pathways for V. vulnificus Tr Colony Formation Phase variation is commonly defined as a reversible process (van der Woude and Baulmer 2004). However, dele tion mutations that lead to changes in phenotype have been observed and classified as phase variation. In V. parahaemolyticus, deletion within the opaR locus resulted in an irreversible shift from the Op to the Tr phase, and the Op phenotype was only rest ored upon in trans complementation with opaR (McCarter 1998). In V. vulnificus, evaluation of the stability of the Tr genotypes revealed that only the TR1 genotype was truly phase variable, while the deletion mutants TR2 and TR3 were locked in the Tr phase and thus not phase variable under the conditions examined. Incubation of

PAGE 123

108 the TR1 genotype in LB demonstrated hi gh-frequency reversion back to the Op phenotype and also showed the appearance of sectored colonies. The formation of these sectored colonies by TR1 strains indicated incr eased rates of reversion in these isolates. This potential hypervariability was observed only after subculture in LB and continued passage in PP3 negated the appearance of this phenotype. These resu lts confirm that the stability of CPS phenotypes is responsive to different growth conditions and that phase variation in PP3 is specific for transition to the Tr phase. Incubation of deletion mutants in LB did not result in spont aneous reversion back to th e Op phenotype, and reversion only occurred upon in trans complementation with an intact wzb gene in TR2 (Chatzidaki 2004). The observed formation of both reversible a nd irreversible phase variants indicates that multiple pathways are responsible for regulation of Tr colony formation. Sequence analysis of the CPS operon in a TR1 isolate s howed that the operon is intact and identical to the Op operon (Chatzidaki 2004). Thus, mu tations responsible for TR1 must reside outside of the CPS operon. Furthermore, surface expression of CPS in TR1 strains is reduced but not eliminated, suggesting gene tic mechanisms target genes involved in down-regulation of CPS expression. Additi onally, the influence of temperature and media composition on Tr colony formation demonstrated that phase variation in V. vulnificus is sensitive to environmental conditi ons. Expression of group 1 capsules in other bacteria has been shown to be responsiv e to changes in nutrien t concentrations, and this response in regulated by the Rcs two comp onent regulatory system. This system is stimulated by changes in osmolarity, wh ich can occur during nut rient depletion. Extended incubation in PP3 lead ing to high-frequency Tr colony formation may result in

PAGE 124

109 starvation conditions that could include a shift in osmolarity. Thus, the Rcs system is a potential mutational target by which phase variation between Op and Tr phenotypes may be regulated. The Rcs system regulates expression of capsule through the use of a consensus sequence (termed the RcsAB box) found immediatel y upstream of the biosynthetic loci of numerous group 1-like polymers (Gottesman et al. 1985, Brill et al. 1988, Stout and Gottesman 1990, Bernhard et al. 1990, Gottesman and Stout 1991, McCallum and Whitfield 1991, Houng et al. 1992, Stout et al. 1991, Wehland et al. 1999,Wehland and Bernhard 2000). Examination of DNA seque nce upstream of the group 1 CPS operon in the two published V. vulnificus genomes identified sequences that may designate RcsAB boxes. The consensus sequence for the RcsA B box is 5'–TaAgaatatTCcta' (uppercase letters designate bases with high probability at the given position; lower case letters designate bases usually found in the given pos ition but at lower frequency than bases with uppercase designations; Weaver 2000). In E. coli K-12, the RcsAB box 5' taaagaaactccta – 3' (bolded letters indica te a match to the consensus sequence) begins 452-bp upstream of the wza start codon (Stout 1996). In V. vulnificus YJ016 and CMCP6 consensus sequences (5' tgagtgcatttcca – 3' or 5' – tgagtacatttcca – 3') are located 1.2-Kb (sequenced genome location: 341334 – 341347) a nd 1.5-Kb (sequenced genome location: 798246-798259), respectively, upstream of the wza start codon. BLAST search of deduced amino acid sequence did not yield a match for RcsA in V. vulnificus. However, E. coli RcsB showed 28 and 29% identity to response regulators in YJ016 (locus tag: VV1233) and CMCP6 (locus tag: VV20511), respectively, and E. coli RcsC showed

PAGE 125

110 some sequence identity (29%) to a sensor histadine kinase in CMCP6 (VV102179) with no matches in strain YJ016. The Rcs system indirectly regulates E. coli group 1 CPS expre ssion through altered expression of the biosynthetic gene galF. BLAST search using the amino acid sequence of E. coli GalF showed no alignment in either V. vulnificus genome. However, polysaccharide composition of group 1 capsule s differs between these species, and biosynthetic gene targets of gene regulation are not likely to be homologous. Therefore, while the Rcs system is a potential regulator of phase variation from the Op to the Tr phenotype in V. vulnificus, further investigation into the role of the Rcs system in CPS regulation and phase variation in V. vulnificus is warranted. In summary, the formation of phase va riable and phase stable Tr genotypes indicated that multiple pathways of Tr colony formation exist in V. vulnificus. Stability assays showed that deletion mutants were lock ed in the Tr phase and not phase variable under the conditions examined, and the pres ence of highly homologous direct repeats flanking the deleted regions implicates hom ologous recombination as a mechanism of deletion formation. Conversely, TR1 strains were phase variable, but these isolate did not exhibit mutations in the CPS operon, indicating that th e genetic target (s) of phase variation in this V. vulnificus genotype are not associated with mutation at this locus. Deletion mutations within regulat ory loci have been shown to result in changes in CPS expression in Vibrio spp. In V. parahaemolyticus, a spontaneous deletion mutation in opaR, a regulatory gene and luxR homologue, resulted in reduced CPS expression and a shift from Op to Tr (McCarter 1998). Conversely, increased CPS gene expression resulting in a rugose phenotype was produced by a frameshift mutation within the

PAGE 126

111 V. cholerae opaR homologue, hapR (Yildiz et al. 2004). Mutations within the V. vulnificus opaR/hapR homologue (smcR) have also been generated, but did not alter group 1 CPS expression (McDougald et al. 2001, Shao and Hor 2001). These differing functions of deletion mutation with regard to CPS expression highlight the complexity of CPS regulation, and the basis for reversible pha se variation has yet to be elucidated in any Vibrio species. Ecology of Phase Variation In V. vulnificus the Op and Tr forms appear to ha ve differing roles in the life cycle the bacterium. Whereas Op cells are better adapted for survival in oysters and human hosts due to their ability to avoid and survive host immune responses, Tr cells may be better adapted for survival in the aqua tic environment through enhanced biofilm formation. Previous research on the attachment of opaque and translucent V. vulnificus cells to algal dinoflagellates showed that th e Tr phenotype had a close association with the algae; however, this close associat ion was not observed with Op cells (Dr. Chatzidaki-Livanis, persona l communication). Recently, V. vulnificus was found attached to plankton harvested from seaw ater, confirming that algae serve as an environmental reservoir for V. vulnificus perhaps by providing increased nutrient availability (Mauge ri et al. 2006). Oysters are one of the main consumers of algae in the environment, and mollusks preferentially filter out particles roughly equivalent to the size of algal cells (Baker and Levinton 2003). Therefore, the Tr phase of V. vulnificus may facilitate acquisition of nutrients through attachment to algae, leading to uptake by oy sters via algal filtration. Once inside the oyster, the bacterium may sw itch back to the Op phenotype, and selective pressure exerted by phagocytosis from oyster hemocytes favors survival of V. vulnificus

PAGE 127

112 Op cells over Tr cells (Harri s-Young et al. 1993). Therefore, the Op form may be the predominant V. vulnificus phenotype inside the oysters, and this hypothesis is supported by cursory evaluation of strains recovered fr om oyster in the Chesapeake Bay, all of which exhibited the Op phenotype (Wright et al. 1996). Thus, susceptible individuals that consume raw oysters are more likely to encounter the pathogenic Op form of V. vulnificus leading to infection and disease. In conclusion, this study has shown that levels of phase variation in V. vulnificus can be increased under certain environmental conditions. Although the genetic basis for reversible phase variation has ye t to be elucidated, genetic an alysis confirmed the role of repetitive elements in deletion mutations that result in the translucent phase. Structure of the group 1 CPS operon suggested that deletion mutations may be a consequence of RecA-dependent homologous recombination, an d mutational analysis of the involvement of RecA was consistent with this hypothesis.

PAGE 128

113 APPENDIX DNA SEQUENCE COMPARISON YJ016: TCGTTATGTGGAACCAACGATGAACTGTCTACGATTTGGTGTCCTTTGCTCTCAAAGAAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TCGTTATGTGGAACCAACGATGAACTGTCTACGATTTGGTGTCCTTTGCTCTCAAAGAAC MO624: YJ016: TTGAGGAACGCGTTACGAACCTCATCAGTGCTCATGTACATGCAGCTCTTCCTGAAAATA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TTGAGGAACGCGTTACGAACCTCATCAGTGCTCATGTACATGCAGCTCTTCCTGAAAATA MO624: YJ016: GTCGAGTTAGAATTTTGCCGTATTGTAGATCATGCTTAAAGCTTCGACTAGTTTTCTTAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GTCGAGTTAGAATTTTGCCGTATTGTAGATCATGCTTAAAGCTTCGACTAGTTTTCTTAT MO624: YJ016: GGAAAAGAGCGGATGAAATGAAAAAATCGTTTAATCGCGGGAAATCATGATTTCTTCACG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GGAAAAGAGCGGATGAAATGAAAAAATCGTTTAATCGCGGGAAATCATGATTTCTTCACG MO624: YJ016: AATGTGAGGAGAGAAAATTGGCAGGGAACTGACGGAAACATTATGCTTTATCGTTCAACG ||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |||| | CMCP6: AATGTGAGGAGAGAAAATTGGCATGGAACTTACGGAAACATTATGCTTCATCGCTCAAAG MO624: YJ016: CATAGCGTATCTGTTCAAATGAAAAACCACGATATTGGAGAAAGCGAACTTGTTTTGCAT |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| CMCP6: CATAACGTATCTGTTCAAATGAGAAACCACGATATTGGAGAAAGCGAACTTGTTTTGCAT MO624: YJ016: ACTCTTTTTGTTCTTTGGCCTTCACTCCGTTGAACTTTTTCATCGCAACGGATTTGGCTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: ACTCTTTTTGTTCTTTGGCCTTCACTCCGTTGAACTTTTTCATCGCAACGGATTTGGCTA MO624: hypthothetical protein Figure A-1.Sequence comparison of the genomic region encompassing recA in V. vulnificus. Comparisons were made among V. vulnificus strains MO6-24/Op, CMCP6/Op, and YJ016/Op.

PAGE 129

114 YJ016: TTGCACTTTCAATGTCTTGACTTGCATACCCTTTAAGTGTGAGCTTTTGCTTCAACTCAT ||||||||||||| |||||||| ||||||||||||| ||||||||||||| ||||||||| CMCP6: TTGCACTTTCAATATCTTGACTAGCATACCCTTTAACTGTGAGCTTTTGCCTCAACTCAT | ||||||||||| |||||||| | ||||||||||| ||||||||||||| ||||||||| MO6-24 TCGCACTTTCAATATCTTGACTAGTATACCCTTTAACTGTGAGCTTTTGCCTCAACTCAT YJ016: ACTGACCATGATCTCGTCGACTGAGCAGTTGAATCGCCGTGTCTTTGCAATTCATCATTG |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| CMCP6: ACTGGCCATGATCTCGTCGACTGAGCAGTTGAATCGCCGTGTCTTTGCAACTCATCATTG |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| MO6-24 ACTGACCATGATCTCGTCGACTGAGCAGTTGAATCGCCGTGTCTTTGCAACTCATCATTG YJ016: GTGGCGTAAAGCGATGATGCATCAGAACTCCTTAAATCGGGGGATAAGTAATAACAATAA | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | CMCP6: GCGGCGTAAAGCGATGATGCATCAGAACTCCTTAAATAGGGGGATAAGTAATAACAATGA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GCGGCGTAAAGCGATGATGCATCAGAACTCCTTAAATCGGGGGATAAGTAATAACAATGA YJ016: ATCCGAAATGGAAAAGAGAAGAAAAAAGCCCTGCATTGCAGGGCTTAATAAAATAGAGGC ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| CMCP6: ATCCGAAATGGAAAATAGAAGAAAAAAGCCCTGCATTGCAGGGCTTAATAAAATAGAGGC ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| MO624: ATCCGAAATGGAAAATAGAAGAAAAAAGCCCTGCATTGCAGGGCTTAATAAAATAGAGGC YJ016: TGAAATTAAAACTCTTCTTGCTCTGGCATTTCTTCGACTAACTCTGCCGATTCATCGTTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TGAAATTAAAACTCTTCTTGCTCTGGCATTTCTTCGACTAACTCTGCCGATTCATCGTTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TGAAATTAAAACTCTTCTTGCTCTGGCATTTCTTCGACTAACTCTGCCGATTCATCGTTG YJ016: ATGTTTGCTGGAGAAAGCAACATTTCACGCAATTTCGTATCCAGTACTTTTGCGACATCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: ATGTTTGCTGGAGAAAGCAACATTTCACGCAATTTCGTATCCAGTACTTTTGCGACATCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: ATGTTTGCTGGAGAAAGCAACATTTCACGCAATTTCGTATCCAGTACTTTTGCGACATCT YJ016: ACGTTTTCTTTCAGGTATTTACAAGCGTTCGCTTTACCTTGGCCAATTTTGTCGCCGTTA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: ACGTTTTCTTTCAGGTATTTACAAGCGTTCGCTTTACCTTGGCCAATTTTGTCGCCGTTA ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| MO624: ACGTTTTCTTTCAGGTACTTACAAGCGTTCGCTTTACCTTGGCCAATTTTGTCGCCGTTA recA YJ016: ACTCAAACCAATCTTGTGGCTCTTCCGCAAATGCATTTTCAACAACAGAATCAGACACTT ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| CMCP6: ACTCAAACCAATCTTGTGGCTCTTCCGCAAATGCATTTTCAACGACAGAATCAGACACTT MO624: YJ016: GTTTAAGCGATAACTCCTGCCGTATGCGTCTTTCGCCATGCCCTTTTCCAACGTGTTGTC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GTTTAAGCGATAACTCCTGCCGTATGCGTCTTTCGCCATGCCCTTTTCCAACGTGTTGTC |||||||||||||||||||| ||||||||| MO624: TTTCGCCATGCCCTTTTCCA-CGTGTTGTC YJ016: GAATTTGGCTTTTGGCATAACGAAGATCATCGAGATAACCATGTTCCAAGCAAAAATGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GAATTTGGCTTTTGGCATAACGAAGATCATCGAGATAACCATGTTCCAAGCAAAAATGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GAATTTGGCTTTTGGCATAACGAAGATCATCGAGATAACCATGTTCCAAGCAAAAATGCA ForwardPrimer Figure A-1. continued

PAGE 130

115 YJ016: TCTTTGATCGCACCAGTACGGCGAATATCAAGACGAACAGAAGCGTAGAATTTCAGAGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || CMCP6: TCTTTGATCGCACCAGTACGGCGAATATCAAGACGAACAGAAGCGTAGAATTTCAGTGCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TCTTTGATCGCACCAGTACGGCGAATATCAAGACGAACAGAAGCGTAGAATTTCAGAGCG YJ016: TTACCACCCGTTGTGGTTTCTGGGTTACCAAACATCACACCGATCTTCATACGGATCTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TTACCACCCGTTGTGGTTTCTGGGTTACCAAACATCACACCGATCTTCATACGGATCTGG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TTACCACCCGTTGTGGTTTCTGGGTTACCAAACATCACACCGATCTTCATACGGATCTGG YJ016: TTGATGAAGATACACATACAGTTAGACTGCTTTAGGTTACCCGTTAACTTACGCATCGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TTGATGAAGATACACATACAGTTAGACTGCTTTAGGTTACCCGTTAACTTACGCATCGCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TTGATGAAGATACACATACAGTTAGACTGCTTTAGGTTACCCGTTAACTTACGCATCGCT YJ016: TGAGATAGCATACGAGCTTGAAGACCCATGTGCGAGTCGCCCATCTCACCTTCGATTTCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TGAGATAGCATACGAGCTTGAAGACCCATGTGCGAGTCGCCCATCTCACCTTCGATTTCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TGAGATAGCATACGAGCTTGAAGACCCATGTGCGAGTCGCCCATCTCACCTTCGATTTCT YJ016: GCCTTTGGCGTCAATGCTGCAACAGAGTCGACAACAATAACGTCAACCGCACCTGAGCGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GCCTTTGGCGTCAATGCTGCAACAGAGTCGACAACAATAACGTCAACCGCACCTGAGCGA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GCCTTTGGCGTCAATGCTGCAACAGAGTCGACAACAATAACGTCAACCGCACCTGAGCGA YJ016: GCAAGAGCATCACAGATTTCCAATGCTTGTTCACCGGTGTCAGGCTGAGATACCAACAAC ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| CMCP6: GCAAGAGCATCACAGATTTCCAACGCTTGTTCACCGGTGTCAGGCTGAGATACCAACAAC ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| MO624: GCAAGAGCATCACAGATTTCCAACGCTTGTTCACCGGTGTCGGGCTGAGATACCAACAAC YJ016: TGGTCGATATTAACGCCAAGCTTCTTCGCATACACAGGATCCAACGCGTGCTCGGCATCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TGGTCGATATTAACGCCAAGCTTCTTCGCATACACAGGATCCAACGCGTGCTCGGCATCG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TGGTCGATATTAACGCCAAGCTTCTTCGCATACACAGGATCCAACGCGTGCTCGGCATCG YJ016: TAGCTGTACCAAGCGCCTGATTTTTCAATCAGCTTACATTTCACGCCTAGGTCAATCAGT ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TAGCTATACCAAGCACCTGATTTTTCAATCAGCTTACATTTCACGCCTAGGTCAATCAGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TAGCTGTACCAAGCGCCTGATTTTTCAATCAGCTTACATTTCACGCCTAGGTCAATCAGT YJ016: TCACCTTCGCGGTTAAAGCCTTGGCCGTACATAATTTGAGTGTTGGCTTCTTTAAACGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TCACCTTCGCGGTTAAAGCCTTGGCCGTACATAATTTGAGTGTTGGCTTCTTTAAACGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: TCACCTTCGCGGTTAAAGCCTTGGCCGTACATAATTTGAGTGTTGGCTTCTTTAAACGGC YJ016: GCAGCGATCTTATTCTTCACCACTTTGATGCGCGTTTCGTTACCCACGACCTCATCACCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GCAGCGATCTTATTCTTCACCACTTTGATGCGCGTTTCGTTACCCACGACCTCATCACCT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GCAGCGATCTTATTCTTCACCACTTTGATGCGCGTTTCGTTACCCACGACCTCATCACCT Figure A-1. continued

PAGE 131

116 YJ016: ATAAACGCACAAGTTTTGCCTTCACGTTGAGCCGCAGCGATCAGCTCAAGGGTCAACGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: ATAAACGCACAAGTTTTGCCTTCACGTTGAGCCGCAGCGATCAGCTCAAGGGTCAACGTG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: ATAAACGCACAAGTTTTGCCTTCACGTTGAGCCGCAGCGATCAGCTCAAGGGTCAACGTG YJ016: GTTTTACCTGAAGATTCTGGACCAAAAATTTCAACGATACGGCCCATTGGTAAGCCACCA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GTTTTACCTGAAGATTCTGGACCAAAAATTTCAACGATACGGCCCATTGGTAAGCCACCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GTTTTACCTGAAGATTCTGGACCAAAAATTTCAACGATACGGCCCATTGGTAAGCCACCC YJ016: GCACCCAGCGCAATATCCAGAGATAGTGAACCTGTCGAGATGGTTTCAACATCCATCGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GCACCCAGCGCAATATCCAGAGATAGTGAACCTGTCGAGATGGTTTCAACATCCATCGCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GCACCCAGCGCAATATCCAGAGATAGTGAACCTGTCGAGATGGTTTCAACATCCATCGCA YJ016: CGGTTGTCACCTAGGCGCATGATTGAACCTTTACCGAACTGCTTTTCAATTTGACCTAGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: CGGTTGTCACCTAGGCGCATGATTGAACCTTTACCGAACTGCTTTTCAATTTGACCTAGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: CGGTTGTCACCTAGGCGCATGATTGAACCTTTACCGAACTGCTTTTCAATTTGACCTAGT YJ016: GCGGCGGCCAGTGCCTTCTGTTTGTTCTCGTCCATTACTCTCTCCAGATAGTCACTCTCA ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: GCGGCGGCCAGAGCCTTCTGTTTGTTCTCGTCCATTACTCTCTCCAGATAGTCACTCTCA |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GCGGCGGCCAGTGCCTTCTGTTTGTTCTCGTCCATTACTCTCTCCAGATAGTCACTCTCA YJ016: GGTGATAGGTAATTATGTCGAAATAGGGTCGACAATGTTTGTCATGTTGGGGCTCATTAT |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| CMCP6: GGTGATAGGTAATTATGTCGAAATAGGGTCGACAATGTTTGTCATGTTGGGGTTCATTAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| MO624: GGTGATAGGTAATTATGTCGAAATAGGGTCGACAATGTTTGTCATGTTGGGGCTCATTAT YJ016: ACTGTTGATTTGTACAGTGTCCACCCCTGTATNNNNNNNTTTCGCCTGTTATTGACGTTC |||||||||||||||||||||||||||||||| ||||||||||||||||||||| CMCP6: ACTGTTGATTTGTACAGTGTCCACCCCTGTATAAAAAAATTTCGCCTGTTATTGACGTTC ||||||||||||||||||||| |||||||| | ||||||||||||||||||||| MO624: ACTGTTGATTTGTACAGTGTCTACCCCTGTGTAAAAAAATTTCGCCTGTTATTGACGTTC YJ016: ACTGTCATTTTTCAGTAACGCATCACACAAGACTTTTAAACTGTATTCAATCGCTTGTAT |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| CMCP6: ACTGCCATTTTTCAGTAGCGCATCACACAAGACTTTTAAACTGTATTCAATCGCTTGTAT |||||||||||||||||||||||||||||||||||||||| MO624: ACTGTCATTTTTCAGTAACGCATCACACAAGACTTTTAAA YJ016: GCGAACTTTTGCTCTATCGCCAGCAAAATAGCAGGTCTCACACCGTAGCCATCCATGCTT ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| CMCP6: GCGAACTTTTGCTCTATCGCCAGCAAAATAGCAAGTCTCACAACGTAGCCATCCATGCTT MO624: YJ016: ATCCGCAAAACCAAAACAAACGGTGCCAACAGGCTTTTCCGCGCTACCGCCGCTCGGCCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: ATCCGCAAAACCAAAACAAACGGTGCCAACAGGCTTTTCCGCGCTACCGCCGCTCGGCCC MO624: recX Reverse Primer Figure A-1. continued

PAGE 132

117 YJ016: TGCAATACCGCTAATGGCAACCGCGATAGTTGCATTCGAATGGGCTAAAGTCCCCAGTAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TGCAATACCGCTAATGGCAACCGCGATAGTTGCATTCGAATGGGCTAAAGTCCCCAGTAC MO624: YJ016: CATTTCTTTGACCACCGCCTCCGAGACCGCACCAAAGTCGGCCAAGGTTTTTTCTGCCAC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: CATTTCTTTGACCACCGCCTCCGAGACCGCACCAAAGTCGGCCAAGGTTTTTTCTGCCAC MO624: YJ016: CCCCAACATTTCTTGTTTTGCTTCATTGCTGTAAGTGACAAATGCACGATCAAACCAAGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: CCCCAACATTTCTTGTTTTGCTTCATTGCTGTAAGTGACAAATGCACGATCAAACCAAGC MO624: YJ016: CGAGCTGCCTGCGACTTCCGTGACTATGTTTGCAACGCCACCGCCAGTACACGATTCGGC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: CGAGCTGCCTGCGACTTCCGTGACTATGTTTGCAACGCCACCGCCAGTACACGATTCGGC MO624: YJ016: GGTAGCCAACACTTCACCTTGTTGCAAAAGACGCTCACCCAGTTGTTCTGATAATTGTAT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: CGTAGCCAACACTTCACCTTGTTGCAAAAGACGCTCACCCAGTTGTTCTGATAATTGTAT MO624: YJ016: TAGTGATTGCATGCCGATTTCCCTTTTCTCTCTTTTACACTATCAGTGATTCACGTATCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TAGTGATTGCATGCCGATTTCCCTTTTCTCTCTTTTACACTATCAGTGATTCACGTATCC MO624: YJ016: TAAGCCGCAAACAGTCCAAACTAAAGATAAAAACCGTGAAAGCTGAACAACAACATACCC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| CMCP6: TAAGCCGCAAACAGTCCAAACTAAAGATAAAAACCGTGAAAGCTGAACAACAACATACCC MO624: Figure A-1. continued

PAGE 133

118 LIST OF REFERENCES Adams, J.L. and R.J. McLean. 1999. Impact of rpoS deletion on Escherichia coli biofilms. Appl Environ Microbiol 65: 4285-4287. Aertsen, A. and C.W. Michiels. 2005. Divers ity or die: generation of diversity in response to stress. Crit Rev Microbiol 31:69-78. Ali, A., M. H. Rashid, D. K. Karaolis. 2002. High frequency rugose exopolysaccharide production by Vibrio cholerae. Appl Environ Micr obiol 68: 5773-5778. Amako, K., K. Okada, S. Miake. 1984. Evidence for the presence of a capsule in Vibrio vulnificus. J Gen Micobiol 130: 2741-2743. Amaro, C. and E.G. Biosca. 1996. Vibrio vulnificus biotype 2, pathogeni c for eels, is also an opportunistic pathogen for humans. Appl Environ Microbiol 62: 1454-1457. Amundsen S.K. and G.R. Smith. 2003. Interchangeable parts of the Escherichia coli recombination machinery. Cell 112: 741-744. Arricau, N., D. Hernant, H. Waxin, C. Ec obichon, P.S. Duffey, M.Y. Popoff. 1998. The RcsB-RcsC regulatory system of Salmonella typhi differentially modulates the expression of invasion proteins, flagellin a nd Vi antigen in response to osmolarity. Mol Microbiol 29: 835-850. Baker, S.M. and J.S. Levinton. 2003. Select ive feeding by three native North American freshwater mussels implies food compe tition with zebra mussels. Hydrobiol 506:97-105. Ball, C.A., R. Osuna, K.C. Ferguson, R.C. J ohnson. 1992. Dramatic changes in Fis levels upon nutrient upshift in Escherichia coli. J Bacteriol 174: 8043-8056. Bartlett, D.H. and M. Silverman. 1989. Nu cleotide sequence of IS492, a novel insertion sequence causing variation in extracellula r polysaccharide production in the marine bacterium Pseudomonas atlantica. J Bacteriol 171: 1763-1766. Bassler, B.L., M. Wright, M.R. Silverman. 1994. Multiple signaling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway. Mol Microbiol 13: 273-286. Bayliss, C.D., D. Field, E.R. Moxon. 2001. The simple sequence contingency loci of Haemophilus influenzae and Neisseria meningitidis. J Clin Invest 107:657-662.

PAGE 134

119 Beck von Bodman, S. and S.K. Farrand. 1995. Capsular polysaccharide biosynthesis and pathogenicity in Erwinia stewartii require induction by an N-acylhomoserine lacton autoinducer. J Bacteriol 177: 5000-5008. Bergstrom, S., K. Robbins, J. M. Koomey, J. Swanson. 1986. Piliation control mechanisms in Neisseria gonorrhoeae. Proc Natl Acad Sci USA 83: 3890-3894. Bernard, F., K. Poetter, K. Geider, D.L. Coplin. 1990. The rcsA gene from Erwinia amylovora: identification, nucleotide seque nce analysis, and regulation of exopolysaccharide biosynthesis. Mol Plant-Microbe Interact 3 : 429-437. Biosca, E.G., C. Amaro, J.L. Larsen, K. Pedersen. 1997. Phenotypic and genotypic characterization of Vibrio vulnificus: proposal for the substitution of the subspecific taxon biotype for serovar. Appl Environ Microbiol 63 : 1460-1466. Biosca E.G., J.D. Oliver, and C. Amar o. 1996a. Phenotypic characterization of Vibrio vulnificus biotype 2, a lipopolysaccharide-base d homogeneous O serogroup within Vibrio vulnificus. Appl Environ Microbiol 62 : 918-927. Bisharat, N., V. Agmon, R. Fi nkelstein, R. Raz, G. Ben-Dror, L. Lemer, S. Soboh, R. Colodner, D.N. Cameron, D.L. Wykstra, D. L. Swerdlow, and J.J. Farmer III. 1999. Clinical, epidemiological, and microbiological features of Vibrio vulnificus biogroup 3 causing outbreaks of wound infec tion and bacteraemia in Israel. The Lancet 354: 1421-1424. Bisharat, N., D.I. Cohen, R.M. Harding, D. Falush, D.W. Crook, T. Peto, M.C. Maiden. 2005. Hybrid Vibrio vulnificus. Emerg Infect Dis 11: 30-35. Bisharat, N. and R. Raz. 1996. Vibrio infection in Israel due to changes in fish marketing. The Lancet 348: 1585-1586. Blake, P. A., M. H. Merson, R. E. Weaver, D. G. Hollis, and P. C. Heublein. 1979. Disease caused by a marine Vibrio. Clinical characteristics and epidemiology. N Engl J Med 300: 1-5. Blomfield I.C.. 2001. The regulation of pap and type 1 fimbriation in Escherichia coli. Adv Microb Physiol 45: 1-49. Boaretti, M. M.M. Lleo, B. Bonato, C. Si gnoretto, P. Canepaari. 2003. Involvement of rpoS in the survival of Escherichia coli in the viable but nonculturable state. Environ Microbiol 5:986-996. Bowdre, J.H., J.H. Hull, D.M. Cocchetto. 1983. Antibiotic efficacy against Vibrio vulnificus in the mouse: superiority of tetr acycline. J Pharmacol Exp Ther 22: 595598.

PAGE 135

120 Brenton, C.E., G.J. Flick Jr., M.D. Pier son, R.E. Croonenberghs, M. Pierson. 2001. Microbiological quality a nd safety of quaho clams, Mercinaria mercinaria, during refrigeration and at elevated storag e temperatures. J Food Prot 64: 343-347/ Brill, J.A., C. Quinlan-Walshe, S. Gottesman. 1988. Fine structure mapping and identification of two regulator s of capsule synthesis in Escherichia coli K-12. J Bacteriol 170: 2599-2611. Bull, H.J., M.J. Lombardo, S.M. Rosenberg. 2001. Stationary-phase mutation in the bacterial chromosome: recombination protein and DNA polymerase IV dependence. Proc Natl Acad Sci USA 98: 83-34-8341. Campbell, M.S. and A.C. Wright. 2003. Real-time PCR analysis of Vibrio vulnificus from oysters. Appl Envir on Microbiol 69: 7137-7144. Center for Disease Control (CDC). 1993. Vibrio vulnificus infections associated with raw oyster consumption. MMWR. 42: 405-407. Chatzidaki, M.A. 2004. Relationship of the Vibrio vulnificus group 1-like capsular polysaccharide operon to phase variation. Dissertation, University of Florida. Chatzidaki-Livanis, M., M.K. Jones, A.C. Wright. 2006. Genetic variation in the Vibrio vulnificus group 1 capsular polysaccharide op eron. J Bacterio l 188: 1987-1998. Chen, X., S. Schauder, N. Potier, A. Van Do rsselaer, I. Pelczer, B.L. Bassler, F.M. Hughson. 2002. Stuctural identification of a bacterial quorum sensing signal containing boron. Nature 415: 545-549. Chen, C.Y., K.M. Wu, Y.C. Chang, C.H. Cha ng, H.C. Tsai, T.L. Liao, Y.M. Liu, H.J. Chen, A.B. Shen, J.C. Li, T.L. Su, C.P. Shao, C.T. Lee, L.I. Hor, S.F. Tsai. 2003. Comparative genome analysis of Vibrio vulnificus, a marine pathogen. Genome Res 13: 2577-2587. Comstock, L.E., J.A. Johnson, J.M. Michalsk i, J.G. Morris Jr, J.B. Kaper. 1996. Cloning and sequencing of a region encoding a surface polysaccharide of Vibrio cholerae O139 and characterization of the inse rtion site in the chromosome of Vibrio cholerae O1. Mol Microbiol 19: 815-826. Coyne, M. J., K. G. Weinacht, C. M. Krinos, and L. E. Comstock. 2003. Mpi recombinase globally modulates the surf ace architecture of a human commensal bacterium. Proc Natl Acad Sci USA 100: 10446-10451. Crost, C., J. Harel, F. Berthiaume, A. Ga rrivier, M.C. Tessier, H. Rakotoarivonina, C. Martin. 2004. Influence of e nvironmental cues on transc riptional regulation of foo and clp coding for F165 and CS31A adhesions in Escherichia coli. Res Microbiol 155: 475-482.

PAGE 136

121 De Bolle, X., C.D. Bayliss, D. Field, T. van de Ven, N.J. Saunders, D.W. Hood, E.R. Moxen. 2000. The length of a tetr anucleotide repeat tract in Haemophilus influenzae determines the phase variation rate of a gene with homology to type III DNA methyltransferases. Mo l Microbiol 35: 211-222. DePaola, A. G.M. Capers and D. Alexander. 1994. Densities of Vibrio vulnificus in the intestines of fish from the U.S. Gulf Coast. Appl Environ Microbiol 60: 984-988. Ditta, G., Y. Schmidhauser, E. Yakobson, P. Lu, X.W. Liang, D.R. Finlay, D. Guiney, D.R. Helinski. 1985. Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monito ring gene expression. Plasmid 13:149-153. do Nascimento, S.M., R.H. dos Fernandes Vieira, G.N. Theophilo, D. Dos Prazeres Rodrigues, G.H. Vieira. 2001. Vibrio vulnificus as a health hazard for shrimp consumers. Rev Inst Med Trop Sao Paulo. 43: 263-266. Drummelsmith, J. and C. Whitfield. 1999. Ge ne products required for surface expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:K30). Mol Microbiol 31: 1321-1332. Drummelsmith J. and C. Whitfield. 2 000. Translocation of group 1 capsular polysaccharide to the surface of Escherichia coli requires multimeric complex in the outer membrane. EMBO J 19: 57-66. Dybvig K. 1993. DNA rearrangements and pheno typic switching in prokaryotes. Mol Microbiol 10: 465-471. Eberhard, A., A.L. Burlingame, C. Eber hard, G.L. Kenyon, K.H. Nealson, N.J. Oppenheimer. 1981. Structural id entification of autoinducer of Photobacterium fischeri luciferase. Bioche mistry 20: 2444-2449. Engebrecht, J., K. Nealson, M. Silverman. 1983. Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell. 32: 773-781. Engebrecht, J. and M. Silverman. 1984. Identification of genes and gene products necessary for bacterial bioluminescence. Proc Natl Acad Sci USA. 81: 4154-4158. Feldhusen, F. 2000. The role of seafood in b acterial foodbourne diseas es. Microbes Infect 2: 1651-1660. Field, D., M.O. Magnasco, E.R. Moxon, D. Metzgar, M.M. Tanaka, C. Willis, D.S. Thaler. 1999. Contingency loci, mutator alle les, and their intera ctions. Synergistic strategies for microbial evolution and ad aptation in pathogenesis. Ann N Y Acad Sci 870: 378-382. Foster, P.L. 1999. Mechanisms of stationa ry phase mutation: a decade of adaptive mutation. Ammu Rev Genet 33: 57-88.

PAGE 137

122 Friedberg, E.C., P.L. Fischhaber, C. Kisk er. 2001. Error-prone DNA polymerases: novel structures and the benefits of infidelity. Cell 107: 9-12. Gally, D.L., J.A. Bogan, B.I. Eisentein, I. C. Blomfield. 1993. E nvironmental regulation of the fim switch controlling type 1 fi mbrial phase variation in Escherichia coli K12: effects of temperature and media. J Bacteriol 175: 6186-6193. Gander, R.M. and M.T. LaRocca. 1989. Detection of pilus-like structures on clinical and environmental isolates of Vibrio vulnificus. J Clin Microbiol 27: 1015-1021. Gottesman, S., P. Trisler, A. Torres-Cabassa. 1985. Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes. J Bacteriol 162: 1111-1119. Gottesman, S. and V. Stout. 1991. Regulati on of capsular polysaccharide synthesis in Escherichia coli K-12. Mol Microbiol 5: 1599-1606. Grau, B.L, M.C. Henk, G.S. Pettis. 2005. High-frequency phase variation of Vibrio vulnificus 1003: isolation and ch aracterization of a rugos e phenotypic variant. J Bacteriol 187: 2519-2525. Gulig, P. A., K. L. Bourdage, and A. M. Starks.. 2005. Molecular pathogenesis of Vibrio vulnificus. J Microbiol 43: 118-131. Haas, R., S. Veit, T.F. Meyer. 1992. Silent pilin genes of Neisseria gonorrhoeae MS11 and the occurrence of related hypervar iant sequences among other gonococcal isolates. Mol Micr obiol 6: 197-208. Hallet, B. 2001. Playing Dr. Jekyll and Mr . Hyde: combined mechanisms of phase variation in bacteria. Cu rr Opin Micro 4: 570-581. Hammerschmidt, S., A. Muller, H. Sillmann, M. Muhlenhoff, R. Borrow, A. Fox, J. Van Putten, W.D. Zollinger, R. Gerardy-Sc hahn, M. Frosch. 1996. Capsule phase variation in Neisseria meningitidis serogroup B by slip strand mispairing in the polysialyltransferase gene (siaD): correlation with b acterial invasion and the outbreak of meningococcal diseas e. Mol Microbiol 20: 1211-1220. Harris-Young, L., M.L. Tamplin, W.S. Fish er, and J.W. Mason. 1993. Effects of physicochemical factors and bacterial colony morphotype on association of Vibrio vulnificus with hemocytes of Crassostrea virginica. Appl Environ Microbiol 59: 1012-1017. Harris-Young, L., M.L. Tamplin, J.W. Mason, H.C. Aldrich, and J.K. Jackson. 1995. Viability of Vibrio vulnificus in association with hemocytes of the American oyster (Crassostrea virginica). Appl Environ Mi crobiol 61: 52-57.

PAGE 138

123 Hayat, U., G.P. Reddy, C.A. Bush, J.A. Johnson, A.C. Wright, J.G. Morris Jr. 1993. Capsular types of Vibrio vulnificus: an analysis of strains from clinical and environmental sources. J Infect Dis 168: 758-762. Hedge, S.P., M.H. Qin, X.H. Li, M.A. Atki nson, A.J. Clark, M. Rajagopalan, M.V. Madiraju. 1996. Interactions of RecF protein with R ecO, RecR and single stranded DNA binding proteins reveal roles fo r the RecF-RecO-Rec-R complex in DNA repair and recombination. Proc Natl Acad Sci USA 93: 14468-14473. Henderson, I. R., P. Owen, and J. P. Nata ro. 1999. Molecular sw itches--the ON and OFF of bacterial phase variation. Mol Microbiol 33: 919-932. Hill, S.A., S.G. Morrison, J. Swanson. 1990. Th e role of direct oligonucleotide repeats in gonococcal pilin gene variati on. Mol Microbiol 12: 855-856. Hlady W.G. and K.C. Klontz. 1996. The epidemiology of Vibrio infections in Florida, 1981-1993. J Infect Dis 173: 1176-1183. Hoi, L. J.L. Larsen, I. Dalsgaard, and A. Dalsgaard. 1998. Occurrence of Vibrio vulnificus biotypes in Danish marine environm ents. Appl Environ Microbiol 64: 713. Hoiseth, S.K., E.R. Moxon, R.P. Silver. 1986. Genes invovled in Haemophilus influenzae type b capsule expression are part of an 18-kilobase tandem duplication. Proc Natl Acad Sci USA 83: 1106-1110. Hollis D.G., R.E. Weaver, C.N. Baker, C. Thornsberry. 1976. Halophilic Vibrio species isolated from blood cultures. J. Clin Microbiol 3:425-431. Hood, M.A., J.B. Guckert, D.C. White, F. D eck. 1986. Effect of nutrient deprivation on lipid, carbohydrate, DNA, RNA, and protein levels in Vibrio cholerae. Appl Environ Microbiol 52: 788-793. Houng, H.S., K.F. Noon, J.T. Ou, L.S. Baron. 1992. Expression of Vi antigen in Escherichia coli K-12: characteriza tion of viaB from Citrobacter freundii and identity with rcsB. J Bacteriol 174: 5910-5915. Hulsmann, A., T.M. Rosche, I.S. Kong, H. M. Hassan, D.M. Beam, J.D. Oliver. 2003. RpoS dependent stress respons e and exoenzyme production in Vibrio vulnificus. Appl Environ Micr obiol 69: 6114-6120. Ivancic-Bace, I., P. Peharec, S. Moslavac, N. Skrobot, E. Salaj-smic, K. Brcic-Kostic. 2003. RecFOR function is required for DNA repair and recombin ation in a RecA loading deficient recB mutant of Escherichia coli. Genetics 163: 485-494.

PAGE 139

124 Jayaratne, P., W.J. Keenleyside, P.R. MacLachlan, C. Dodgson, C. Whitfield. 1993. Characterization of rcsB and rcsC from Escherichia coli O9:K30:H12 and examination of the role of the rcs regu latory system in expression of group 1 capsular polysaccharides. J Bacteriol 175: 5384-5394. Joseph, L.A. and A.C. Wr ight. 2004. Expression of Vibrio vulnificus capsular polysaccharide inhibits biofilm formation. J Bacteriol. 186: 889-893. Kantake, N., M.V. Madiraju, T. S ugiyama, S.C. Kowalczykowski. 2002. Escherichia coli RecO anneals ssDNA complexed with its cognate ssDNA binding protein: A common step in genetic recombination. Proc Natl Acad Sci USA 99: 1532715332. Kaplan, H.B. and E.P. Greenberg. 1985. Diffusion of autoinducer is involved in regulation of the Vibrio fishceri luminescence system. J. Bacteriol. 163:1210-1214. Kaysner C.A., C. Abeyta, Jr., M.M. Wekeel, A. DePaola, R.F. Scott Jr., J.M. Leitch. 1987. Incidence of Vibrio cholerae from estuaries of the United States West Coast. Appl Environ Micr obiol 53: 1344-1348. Kelly M.T.. 1982. Effect of temperature and salinity on Vibrio (Benckea) vulnificus occurrence in a Gulf Coast environment. Appl Environ Micr obiol 44: 820-824. Kim, S.Y., S.E. Lee, Y.R. Kim, C.M. Kin, P. Y. Ryu, H.E. Choy, S.S. Chung, J.H. Rhee. 2003. Regulation of Vibrio vulnificus virulence by the LuxS quorum sensing system. Mol Microbiol 48: 1647-1664. Kim, Y.R. and J.H. Rhee. 2003. Flage llar basal body flg oper on as a virulence determinant of Vibrio vulnificus. Biochem Biophys Re s Commun 304: 405-410. Klontz, K.C., S. Lieb, M. Schreiber, H.T. Janowski, L.M. Baldy, R.A. Gunn. 1988. Syndromes of Vibrio vulnificus infections. Clinical and epidemiological features in Florida cases, 1981-1987. A nn Intern Med 109: 318-323. Koomey, M., E.C. Gotschilich, K. Robbins, S. Bergstrom, J. Swanson. 1987. Effects of recA mutations on pilus antigenic variation and phase transitions in Neisseria gonorrhoeae. Genetics 117: 391-198. Kowalczykowski, S.C., D.A. Dixon, A.K. Eggl eston, S.D. Lauder, W.M. Rehrauer. 1994. Biochemistry of homologous recombination in Escherichia coli. Microbiol Rev 58: 401-465. Kreger, A. and D. Lockwood. 1981. Detect ion of extracellular toxin(s) produced by Vibrio vulnificus. Infect Immun 33: 583-590. Krinos, C.M., M.J. Coyne, K.G. Weinacht, A. O. Tzianobos, D.L. Kasper, L.E. Comstock. 2001. Extensive surface dive rsity of a commensal microorganism by multiple DNA inversions. Nature 414: 555-558.

PAGE 140

125 Kroll, J.S. and E.R. Moxon. 1988. Capsulation and gene copy number at the cap locus of Haemophilus influenzae type b. J Bacteriol 170: 859-864. Lee, J.H., J.B. Rho, K.J. Park, C.B. Kin, Y.S. Han, S.H. Choi, K.H. Lee, S.J. Park. 2004. Role of flagellum and motility in pathogenesis of Vibrio vulnificus. Infect Immun 72: 4905-4910. Levinson, G. and G.A. Gutman. 1987. Slip strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol 4: 203-221. Lim, J.K., N.W.T. Gunther, H. Zhao, D.E. Johnson, S.K. Keay, H.L. Mobley. 1998. In vivo phase variation of Escherichia coli type 1 fimbrial genes in women with urinary tract infection. Infect Immun 66: 3303-3310. Linder, K. and J.D. Oliver. 1989. Membrane fatty acid and virule nce changes in the viable but noncu lturable state of Vibrio vulnificus. Appl Environ Microbiol 55: 2837-2842. Litwin C.M., T.W. Rayback and J. Skinner. 1996. Role of catechol siderophore synthesis in Vibrio vulnificus virulence. Infect Immun 64: 2834-2838. Majdalani, N. and S. Gottesman. 2005. The Rcs phospho-relay: a complex signal transduction system. Annu Re v Microbiol 59: 379-405. Maugeri, T.L., M. Carbone, M.T. Fera, C. Gugliondola. 2006. Detection and differentiation of Vibrio vulnificus in seawater and plankton of a coastal zone of the Mediterranean Sea. Res Microbiol 157: 194-200. Maxwell E.L., B.C. Mayall, S.R. Pearson, P.A. Stanley. 1991. A case of Vibrio vulnificus septicemia acquired in Vict oria. Med J Aust 154:214-215. McCallum, K.L. and C. Whitfield. 1991. The rcsA gene of Klebsiella pneumoniae O1:K20 is involved in expression of the serotype-specific K (capsular) antigen. Infect Immun 59: 494-502. McCarter, L. L. 1998. OpaR, a homolog of Vibrio harveyi LuxR, controls opacity of Vibrio parahaemolyticus. J Bacteriol 180: 3166-3173. McClain, M.S., I.C. Blomfield, B.I. Eisenstein. 1991. Roles of fimB and fimE in site specific DNA inversion associated with pha se variation of type 1 fimbriae in Escherichia coli. J Bacteriol 173: 5308-5314. McDougald, D., S. A. Rice, and S. Kjelle berg. 2001. SmcR depe ndent regulation of adaptive phenotypes in Vibrio vulnificus. J Bacteriol 183: 758-762. McPherson V.L., J.A. Watts, L.M. Simpson, J. D. Oliver. 1991. Phys iological effects of the lipopolysaccharide of Vibrio vulnificus on mice and rats. Microbios 67:141149.

PAGE 141

126 Mehr, I.J. and H.S. Seifert. 1998. Differe ntial roles of homologous recombination pathways in Neisseria gonorrhoeae pilin antigenic variation, DNA transformation and DNA repair. Mol Microbiol 30: 697-710. Mhlanga-Mutangadura, T., G. Morlin, A.L. Smith, A. Eisenstark, M. Golomb. 1998. Evolution of the major pilus gene cluster of Haemophilus influenzae. J Bacteriol 180: 4693-4703. Miyoshi, S. and S. Shinoda. 1988. Role of the protease in the permeability enhancement by Vibrio vulnificus. Microbiol Immu nol 32: 1025-1032. Mizunoe, Y., S.N. Wai, A. Takade, S.I. Yosh ida. 1999. Isolation and characterization of rugose form of Vibrio cholerae O139 strain MO10. In fect Immun 67: 958-963. Morris J.G. Jr., A.C. Wright, L.M. Simpson, P.K. Wood, D.E. Johnson, J.D. Oliver. 1987. Virulence of Vibrio vulnificus: association with uti lization of transferrinbound iron, and lack or correlation with leve ls of cytotoxin or pretease production. FEMS Microbiol Lett 40: 55-60. Motes, M.L., A. DePaola, D.W. Cook, J.E. Veazey, J.C. Hunsucker, W.E. Garthright, R.J. Blodgett, and S.J. Chirtel. 1998. Infl uence of water temperature and salinity on Vibrio vulnificus in northern Gulf and Atlantic Coast oysters (Crassostrea virginica). Appl Environ Mi crobiol 64: 1459-1465. Moxon, E.R., P.B. Rainey, M.A. Nowak, R.E. Lenski. 1994. Adaptive evolution of highly mutable loci in pathogeni c bacteria. Curr Biol 4: 24-33. Myatt D.C. and G.H. Davis. 1989. Is olation of medica lly significant Vibrio species from riverine sources in South East Queensland. Microbios 60: 111-123. Nilsson, L., J.D. Oliver, and S. Kjelleberg. 1991. Resuscitation of Vibrio vulnificus from the viable but nonculturable stat e. J Bacteriol. 173: 5054-5059. Ohmori, H., E.C. Friedber, R.P. Fuchs, M. F. Goodman, F. Hanaoka, D. Hinkle, T.A. Kunkel, C.W. Lawrence, Z. Livneh, T. Nohm i, L. Prakash, S. Prakash, T. Todo, G.C. Walker, Z. Wang, R. Woodgate. Th e Y-family of DNA polymerases. Mol Cell 8: 7-8. Oliver, J.D. and R. Bockian. 1995. In vivo re suscitation and virulence towards mice, of viable but non cu lturable cells of Vibrio vulnificus. Appl Environ Microbiol 61: 2620-2623. Oliver, J.D., F. Hite, D. McDougald, N.L. Andon, L.M. Simpson. 1995. Entry into, and resuscitation from, the viable but nonculturable state by Vibrio vulnificus in an estuarine environment. Appl Environ Microbio l 61: 2624-2630.

PAGE 142

127 Oliver, J.D., L. Nilsson, and S. Kjel leberg. 1991. Formation of nonculturable Vibrio vulnificus cells and its relationship to the star vation state. Appl Environ Microbiol 57: 2640-2644. Oliver, J.D., R.A. Warner, and D.R. Cl eland. 1982. Distri bution and ecology of Vibrio vulnificus and other lactose-fermenting marine vibrios in coastal waters of the southeastern United States. Appl Environ Microbiol 44: 1404-1414. O’Neill, K.R., S.H. Jones, D.J. Grimes. 1992. Seasonal incidence of Vibrio vulnificus in the Great Bay estuary of New Hampshire a nd Maine. Appl Environ Microbiol 58: 3257-3262. Ou, J.T., L.S. Baron, F.A. Rubin, D.J. K opecko. 1988. Specific insertion and deletion of insertion sequence 1-like DNA element cause s the reversible expression of the virulence capsular antigen Vi of Citrobacter freundii in Escherichia coli. Proc Natl Acad Sci USA 85: 4402-4405. Paiment A., J. Hocking and C. Whitfield. 2002. Impact of phosphorylation of specific residues in the tyrosine autokinase, Wzc, on its activity in assembly of group 1 capsules in Escherichia coli. J Bacteriol 184: 6437-6447. Papavinasasundaram, K.G., M. J. Colst on, E.O. Davis. 1998. Construction and complementation of a recA deletion mutant of Mycobacterium smegmatis reveals that the intein in Mycobacterium tuberculosis recA does not affect RecA function. Mol Micrbiol 30: 525-534. Paranjpye, R.N., J.C. Lara, J.C. Pepe, C.M. Pepe, M.S. Strom. 1998. The type IV leader peptidase/N-methyltransferase of Vibrio vulnificus controls factors required for adherence to HEp-2 cells a nd virulence in iron-loaded mice. Infect Immun 66: 5659-5668. Paranjpye, R.N. and M.S. Strom. 2005. A Vibrio vulnificus type IV pilin contributes to biofilm formation, adherence to epithelial cells and virulence. Infect Immun 73: 1411-1422. Paulsen, I.T., A.M Beness, M.H. Saier Jr. 1997. Computer based analyses of the protein constituents of transport systems catal yzing export of complex carbohydrates in bacteria. Microbiology 143: 2685-2699. Perkins-Balding, D., G. Duval-Valentin, A.C. Glasgow. 1999. Excision of IS492 requires flanking target sequences and re sults in circle formation in Pseudoalteromonas atlantica. 181: 4937-4948. Powell, J.L., A.C. Wright, S.S. Wasserman, D. M. Hone, J.G. Morris Jr. 1997. Release of tumor necrosis factor alpha in response to Vibrio vulnificus capsular polysaccharide in in vivo and in vitro mode ls. Infect Immun 65: 3713-3718.

PAGE 143

128 Rahn, A., J. Drummelsmith, C. Whitfield. 1999. Conserved organizati on in the cps gene clusters for expression of Escherichia coli group 1 K antigens: relationship to the colanic acid biosynthesis locu s and the cps genes from Klebsiella pneumoniae. J Bacteriol 181: 2307-2313. Rahn, A. and C. Whitfield. 2003. Transcrip tional organization a nd regulation of the Escherichia coli K30 group 1 capsule biosynthe sis (cps) gene cluster. Mol Microbiol 47: 1045-1060. Randa, M.A., M.F. Polz, and E. Lim. 2004. Effects of temperature and salinity on Vibrio vulnificus population dynamics as assessed by quantitative PCR. Appl Environ Microbiol 70 : 5469-5476. Reddy, G.P., U. Hayat, C. Abeygunawardana, C. Fox, A.C. Wright, D.R. Maneval, C.A. Bush, J.G. Morris Jr. 1992. Purification and determination of the structure of capsular polysaccharide of Vibrio vulnificus MO6-24. J Bacteriol 174: 2620-2630. Reid, A.N. and C. Whitfield. 2005. Functiona l anaylsis of conserved gene products involved in assembly of Escherichia coli capsules and exopolysaccharide: evidence for molecular recognitions between Wza and Wzc for colanic acid biosynthesis. J Bacteriol 187: 5470-5481/ Ringquist, S. and C.L. Smith. 1992. The Escherichia coli chromosome contains specific unmethylated dam and dcm sites. Proc Natl Acad Sci USA 89: 4539-4543. Roberts, I.S. 1996. The biochemistry and ge netics of capsular polysaccharide production in bacteria. Annu Rev Microbiol 50: 285-315. Rosa, P.A., T. Schwan, D. Hogan. 1992. Recombination between gene encoding major outer surface proteins A and B in Borrelia burgdorferi. Mol Microbiol 6: 30313040. Saunders, N.J., E.R. Moxon, M.B. Gravenor . 2003. Mutation rates: estimating phase variation rates when fitness differences are present and their impact on population structure. Microbiology 149: 485-495. Seifert, H.S. 1996. Questions about gonococcal pilus phaseand antig enic variation. Mol Microbiol 21: 433-440. Serkin, C. D. and H.S. Seifert. 2000. Iron availability regulates DNA recombination in Neisseria gonorrhoeae. Mol Microbiol 37: 1075-1086. Shan, Q., J.M. Bork, B.L. Webb, R.B. Inman, M.M. Cox. 1997. RecA protein filaments: end-dependent dissasociation from ssDNA and stabilization by RecO and RecR proteins. J Mol Biol 265: 529-540. Shao C.P. and L.I. Hor. 2000. Me talloprotease is not essential for Vibrio vulnificus virulence in mice. Infect Immun 68: 3569-3573.

PAGE 144

129 Shao, C.P. and L.I. Hor. 2001. Regulation of metalloprotease gene expression in Vibrio vulnificus by a Vibrio harveyi LuxR homologue. J Bacteriol 183: 1369-1375. Shiba, T., K. Tsutsumi, H. Yano, Y. Ihara, A. Kameda, K. Tanaka, H. Takahashi, M. Munekata, N.N. Rao, A. Kornberg. 1997. Inorganic polyphosphate and the induction of rpoS expression. Proc Natl Acad Sci USA 94: 11210-11215. Shinagawa, H. 1996. SOS response as an adaptive response to DNA damage in prokaryotes. EXS 77: 221-235. Simon, M., J. Zieg, M. Silverman, G. Ma ndel, R. Doolittle. 1980. Phase variation: evolution of a controlling el ement. Science 209: 1370-1374. Simpson L.M. and J.D. Oliver. 1983. Siderophore production by Vibrio vulnificus. Infect Immun 41: 644-649. Simpson L.M. and J.D. Oliver. 1987. Ability of Vibrio vulnificus to obtain iron from transferrin and other iron-binding compounds. Curr Microbiol 15: 155-158. Sinha, H., A. Pain, K. Johnstone. 2000. Analysis of the role of recA in phenotypic switching in Pseudomonas tolaasii. J Bacteriol 182: 6532-6535. Sledjeski, D.D. and S. Gottesman. 1996. Osmotic shock induction of capsule synthesis in Escherichia coli K-12. J Bacteriol 178: 1204-1206. Smith, A.B. and R.J. Siebeling. 2003. Identif cation of genetic loci required for capsular expression in Vibrio vulnificus. Infect Immun 71: 1091-1097. Stelma G.N. Jr., A.L. Reyes, J.T. Peter, C. H. Johnson, P.L. Spaulding. 1992. Virulence characteristics of clinical and environmental isolates of Vibrio vulnificus. Appl Environ Microbiol 58:2776-2782. Stevens, A.M., K.M. Dolan, E.P. Greenberg. 1994. Synergistic binding of the Vibrio fischeri LuxR transcriptional activator dom ain and RNA polymerase to the lux promoter region. Proc Natl Acad Sci USA. 91:12619-12623. Stout, V. 1996. Identification of the promot er region for the colanic acid polysaccharide biosynthetic genes in Escherichia coli K-12. J Bacteriol 178: 4273-4280. Stout, V. and S. Gottesman. 1990. RcsB and Rc sC: a two component regulator of capsule synthesis in Escherichia coli. J Bacteriol 172: 659-669. Stout, V., A. Torres-Cabassa, M.R. Maurizi, D. Gutnick, S. Gottesman. 1991. RcsA, and unstable positive regulator of capsular polys accharide biosynthesis. J Bacteriol 173: 1738-1747. Strom, M. S. and R. N. Paranjpye. 2000. Epidemiology and pathogenesis of Vibrio vulnificus. Microb Infect 2: 177-188.

PAGE 145

130 Sukchawalit R., P. Vattanaviboon, S. Utama pongchai, G. Vaughn, S. Mongkolsuk. 2001. Characterization of Xanthomonas oryzae pv. oryzae recX, a gene that is required for high level expression of recA. FEMS Microbiol Lett 205: 83-89. Swartzman, E., M. Silverman, E.A. Me ighen. 1992. The luxR gene product of Vibrio harveyi is a transcriptional ac tivator of the lux prom oter. J Bacteriol 174: 74907493. Tamplin, M.L., G.E. Rodrick, N.J. Blake, T. Cuba. 1982. The isolation and characterization of Vibrio vulnificus from two Florida estuaries. Appl Environ Microbiol 44: 1466-1470. Tamplin, M.L., S. Specter, G.E. Rodrick, H. Friedman. 1983. Differential complement activation and susceptibility to human serum bacteriacidal action by Vibrio species. Infect Immun 42: 1187-1190. Tamplin, M.L., S. Specter, G.E. Rodrick, H. Friedman. 1985. Vibrio vulnificus resists phagocytosis in the absence of seru m opsonins. Infect Immun 49: 715-718. Tison, D.L., M. Nishibuchi, J.D. Greenwood, and R.J. Seidler. 1982. Vibrio vulnificus biogroup 2: new biogroup pa thogenic for eels. Appl Environ Microbiol 44: 640646. Umezu, K., N. Chi, R.D. Kolonder. 1 993. Biochemical interaction of the Escherichia coli RecF, RecO and RecR proteins with RecA protein and single stranded DNA binding protein. Proc Natl Acad Sci USA 90 : 3875-3879. van Belkum, A. 1999. Short sequence repeats in microbial pathogene sis and evolution. Cell Mol Life Sci 56: 729-734. van Belkum, A., S. Scherer, L. van Al phen, and H. Verbough. 1998. Short sequence DNA repeats in prokaryotic genomes. Mi crobiol Mol Biol Rev 62: 275-293. van der Woude, M. W. and A.J. Baumler. 2004. Phase and antigenic variation in bacteria. Clin Microbiol Rev 17: 581-611. van der Woude, M.W., B. Braaten, D. Low. 1996. Epigenetic phase variation of the pap operon in Escherichia coli. Trends Microbiol 4: 5-9. Veenstra, J., P.J. Rietra, J.M. Costor, E. Slaats, S. Dirks-Go . 1994. Seasonal variations in the occurance of Vibrio vulnificus along the Dutch coast. Epidemiol Infect 112: 285-290. Vierling, S., T. Weber, W. Wohlleben, G. Muth. 2000. Tr anscriptional and mutational analyses of the Streptomyces lividans recX-gene and its interf erence with RecA activity. J Bacteriol 182: 4005-4011.

PAGE 146

131 Vincent, C., B. Duclos, C. Grangeassee, E. Vaganay, M. Riberty, A.J. Cozzone, P. Doublet. 2000. Relationship between exopolysaccharide production and proteintyrosine phosphorylation in gram-nega tive bacteria. J Mol Biol 304: 311-321. Wai, S.N., Y. Mizunoe, A. Takade, S.I. Kawabata, S. Yoshida. 1998. Vibrio cholerae O1 strain TSI-4 produces the exopolysacchar ide materials that determine colony porphology, stress resistance, and biofilm formation. Appl Enviorn Microbiol 64: 3648-3655. Wai, S.N., Y. Mizunoe, S. Yoshida. 1999. How Vibrio cholerae survive during starvation. FEMS Microbiol Lett 180: 123-131. Waters, C.M. and B.L. Bassler. 2005. Auor um sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol. 21: 319-346. Weaver, R.F. 2002. Homologous recombina tion. Molecular Microbiology 2nd ed. McGraw-Hill. New York, NY. p.717-746. Wehland, M., C. Kiecker, D.L. Coplin, O. Kelm, W. Saenger, F. Bernhard. 1999. Identifcation of and RcsA/RcsB recognition motiff in the promoters of exopolysaccharide biosynthetic operons from Erwinia amylovora and Pantoea stewartii subspecies stewartii. J Biol Chem 274:3300-3307 Wehland, M. and F. Bernhard. 2000. The Rc sAB box. Characterization of a new operator essential for the regulation of exopolysacch aride biosynthesis in enteric bacteria. J Biol Chem 275:7013-7020. Weichart, D., D. McDougald, D. Jacobs, and S. Kjelleberg. 1997. In situ analysis of nucleic acis in cold-induced nonculturable Vibrio vulnificus. Appl Environ Microbiol. 63: 2754-2758. Weinberg, E.D. 1978. Iron and Infe ction. Microbiol Rev 42: 45-66. Whitfiled, C. and A. Paiment. 2003. Bios ynthesis and assembly of group 1 capsular polysaccharide in Escherichia coli and related extracellular polysaccharides in other bacteria. Carbohydr Res 338: 2491-2502. Whitfield, C. and I.S. Roberts. 1999. Structur e, assembly and regulation of expression of capsule in Escherichia coli. Mol Microbiol 31: 1307-1319. Willems, R., A. Paul, H.G. van der Heide, A.R. ter Avest, F.R. Mooi. 1990. Fimbrial phase variation in Bordetella pertussis: a novel mechanism for transcriptional regulation. EMBO J 9: 2803-2809. Wright A. C., R.T. Hill, J.A. Johnson, M. Roghman, R.R. Colwell, J.G. Morris Jr. 1996. Distribution of Vibrio vulnificus in the Chesapeake Bay. Appl Environ Microbiol 62: 717-724.

PAGE 147

132 Wright A.C and J.G. Morris Jr. 1991. The extracellular cytolysin of Vibrio vulnificus: inactivation and relationship to virulen ce in mice. Infect Immun 59: 192-197. Wright, A. C., J. L. Powell, J. B. Kaper, and J. G. Morris, Jr. 2001. Identification of a group 1-like capsular polysaccharide operon in Vibrio vulnificus. Infect Immun 69: 6893-6901. Wright A.C., J.L. Powell, M.K. Tanner, L.A. Ensor, A.B. Karpas, J.G. Morris Jr., M.B. Steinz. 1999. Differen tial expression of Vibrio vulnificus capsular polysaccharide. Infect Immun 67: 2250-2257. Wright A.C., L.M. Simpson, J.D. Oliver. 1981. Role of iron in the pathogenesis of Vibrio vulnificus infections. Infect Immun 34: 503-507. Wright, A.C., L.M. Simpson, J.D. Oliver, J.G. Morris Jr. 1990. Ph enotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infect Immun 58: 1769-1773. Wugeditsch, T., A. Paiment, J. Hocking, J. Drummelsmith, C. Forrester, C. Whitfield. 2001. Phosphorylation of Wzc, a tyrosine au tokinase, is essentia l for assembly of group 1 capsular polysaccharide in Escherichia coli. J Biol Chem 276-2361-2371. Yamamoto, K., Y. Ichinose, H. Shinagawa, K. Makino, A. Nakata, M. Iwanaga, T. Honda, T. Miwatani. 1990. Two-step processing for activation of the cytolysin/hemolysin of Vibrio cholerae O1 biotype El Tor: nucleotide sequence of the structural gene (hlyA) and characte rization of the proce ssed products. Infect Immun 58:4106-4116. Yamasaki, S., T. Shimizu, K. Hishino, S. Ho , T. Shimada, G.B. Nair, Y. Takeda. 1999. The genes responsible for O-antigen synthesis of Vibrio cholerae O139 are closely related to those of Vibrio cholerae O22. Gene 237: 321-322. Yildiz, F.H., X.S. Liu, A. Heydorn, G.K. Sc hoolnik. 2004. Molicular analysis of rugosity in a Vibrio cholerae O1 El Tor phase variant. Mol Microbiol 53: 497-515. Yoshida, S., M. Ogawa, Y. Mizuguchi. 1985. Relation of capsular materials and colony opacity to virulence of Vibrio vulnificus. Infect Immun 47: 446-451. Ziebuhr, W., V. Krimmer, S. Rachid, I. Lossner, F. Gotz, J. Hacker. 1999. A novel mechanism of phase variation of virulence in Staphylococcus epidermidis: evidence for control of the polysaccharide inter cellular adhesin synt hesis by alternating insertion and excision of th e insertion sequence element IS256. Mol Microbiol 32: 345-356. Zuppardo, A.B. and R.J. Siebeling. 1998. An epimerase gene essential for capsule synthesis in Vibrio vulnificus. Infect Immun 66: 2601-2606.

PAGE 148

133 BIOGRAPHICAL SKETCH Melissa Jones was born on July 3, 1978 is Cocoa Beach, FL. After high school she began her college studies at th e University of Central Flor ida in Orlando, FL where she majored in Chemistry. After 3 years, she transferred into the Food Science and Human Nutrition Department at the Universi ty of Florida where she received her Bachelor of Science degree in May 2001. During her undergraduate career she excelled in her academics and was recognized by Department of Food Science and Human Nutrition with the awarding of the Ronald F. Schmidt IFT scholarship. Her achievements were also noted by the College of Agriculture and Life Sciences who frequently placed her on the Deans List. After graduating with her B.S., Melissa was awarded the University Alumni Fellowship and went on to pursue her Ph.D. under the direction of Dr. Anita Wright in the Department of Food Scie nce and Human Nutriti on at the University of Florida. After graduating with her docto rate, she plans on pursu ing a teaching career at the post-secondary level.