Citation
Molecular Analysis of an Acid Invertase Gene Family in Arabidopsis

Material Information

Title:
Molecular Analysis of an Acid Invertase Gene Family in Arabidopsis
Creator:
HUANG, LI-FEN ( Author, Primary )
Copyright Date:
2008

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Cell walls ( jstor )
Complementary DNA ( jstor )
Enzymes ( jstor )
Genes ( jstor )
Leaves ( jstor )
Messenger RNA ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
RNA ( jstor )
Sugars ( jstor )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Li-Fen Huang. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
11/30/2006
Resource Identifier:
496626239 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

MOLECULAR ANALYSIS OF AN ACID INVERTASE GENE FAMILY IN ARABIDOPSIS By LI-FEN HUANG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2006

PAGE 2

Copyright 2006 by Li-Fen Huang

PAGE 3

To my great mother, Yuh-O Huang Yang

PAGE 4

iv ACKNOWLEDGMENTS I would like to thank my advisor, Dr. Ka ren Koch, who has helped me to deepen my knowledge in plant physiology, and expand ways to look at the world. Without her constant support, I would not have gotten this far. Also, I am very grateful to my committee members–Drs. Donald R. McCart y, Harry J. Klee, Donald J. Huber and William B. Gurley–for their valuable advice th roughout my research. Special thanks also go to Dr. Harry Klee’s lab, since their help was instrumental for development of methods for real-time quantative RT-PCR. I would lik e to thank Dr. Andrew Hanson and his lab for sharing their growth facilitie s. I am also truly grateful to the other faculty, staff, and graduate students for their help and encouragement during my time here, especially Dr. Kevin Folta, Dr. Masaharu Su zuki, Wayne Avigne, Rocio Di az, John Mayfield, Philip Bocock, Diago Fajardo, Andrea Eveland and Chip Hunter. There are three persons in the world I can never thank enough for their endless support; my mother Yuh-O Huang Yang, my husband Chung-An Lu and my cute little one Yu-Lin Lu. They have given their full support and love throughout my education in the United States.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii ABSTRACT....................................................................................................................... ..x CHAPTER 1 INTRODUCTION........................................................................................................1 2 LITERATURE REVIEW.............................................................................................5 Sugar Sensing...............................................................................................................5 Crosstalk between Ethylene, ABA a nd Sugar Sensing in Young Seedlings................8 Invertases..................................................................................................................... .9 Inhibition of Invertases...............................................................................................11 The Arabidopsis Acid Invertase Gene Family............................................................13 3 STRUCTURE AND EXPRESSION PROFILES OF THE INVERTASE GENE FAMILY IN ARABIDOPSIS.....................................................................................16 Introduction.................................................................................................................16 Materials and Methods...............................................................................................21 Plant Materials.....................................................................................................21 Sequence Alignment and Phylogenetic Tree Construction.................................21 The cDNA Cloning..............................................................................................22 Real-Time Quantitative RT-PCR........................................................................22 RNA Standard Synthesis and Quantification......................................................23 Results........................................................................................................................ .24 Similarity of Coding Sequences within the Arabidopsis Acid Invertases...........24 Genomic Organization of Invertase Loci............................................................24 Development of a Quantitative RT-PCR System for the Arabidopsis Acid Invertase Family...............................................................................................26 Expression Profile of Acid I nvertase Genes in Arabidopsis...............................27 Discussion...................................................................................................................29

PAGE 6

vi 4 SUGAR REGULATION OF VAC UOLAR INVERTASE GENES..........................43 Introduction.................................................................................................................43 Materials and Methods...............................................................................................45 Plant Material......................................................................................................45 Soluble Sugar Detection......................................................................................46 Genomic PCR of AtvacINV2::GUS Plants.........................................................46 GUS Histochemical Assay..................................................................................47 One Step RT-PCR...............................................................................................47 Quantification of Invertase Tr anscripts by Real-Time PCR...............................48 Results........................................................................................................................ .48 Sugar Regulation of Vacuolar Invertase Genes...................................................48 Glucose, ABA and Ethylene Responses of the Atvacinv Genes.........................50 Glucose Repression of Atvacinv2 ........................................................................51 Sugar Regulation of AtvacINV2 ..........................................................................53 Discussion...................................................................................................................54 5 MUTANT ANALYSIS OF TWO VACUOLAR INVERTASES IN ARABIDOPSIS..........................................................................................................67 Introduction.................................................................................................................67 Materials and Methods...............................................................................................70 Plant Materials.....................................................................................................70 GUS Histochemical Assay..................................................................................70 Southern Blot Analysis........................................................................................70 RNA Gel Blots....................................................................................................71 One Step RT-PCR...............................................................................................71 Soluble Acid Invertase (Vacuolar) Assay...........................................................72 Quantification of Invertase Tr anscripts by Real-Time PCR...............................73 Quantification of Sucrose Synthase Genes by Real-Time Quantitative SYBR Green-PCR.......................................................................................................73 Results........................................................................................................................ .74 The 5Â’ Regulatory Sequences of Both V acuolar Invertase ar e Broadly Active..74 Isolation and Characterization of Vacuolar Invertas e T-DNA Insertion Mutants............................................................................................................74 Phenotypic Characterization of Vacuolar Invertase Mutants..............................79 Discussion...................................................................................................................84 6 SUMMARY AND CONCLUSIONS.......................................................................102 LIST OF REFERENCES.................................................................................................106 BIOGRAPHICAL SKETCH...........................................................................................116

PAGE 7

vii LIST OF TABLES Table page 3-1 Gene specific primers and probes desi gned for Taqman real-time RT-PCR of predicted Arabidopsis acid invertase genes:............................................................34 5-1 Visible phenotype tests of vacuolar invertase mutants............................................88

PAGE 8

viii LIST OF FIGURES Figure page 1-1 Sucrose metabolism in plant cells..............................................................................4 3-1 Multiple alignment of the Arabidopsis acid invertase gene family.........................35 3-2 An unrooted phylogenetic tree of the Arabidopsis acid invertase gene family based on amino acid sequence sim ilarities of coding regions..................................37 3-3 Genomic organization of i nvertase loci in Arabidopsis...........................................38 3-4 Specificity for individual members of an Arabidopsis acid invertase gene family by each set of probes and primer s for TaqMan real-time PCR................................39 3-5 Quantified mRNA levels for acid in vertase family members expressed in different organs of 5-week-old Arabidopsis thaliana plants....................................40 3-6 Quantified contributions by individual acid invertase family members to total mRNA encoding these enzymes in vegetative organs of Arabidopsis.....................41 3-7 Quantification of mRNA for vacuolar invertases in vegetative organs of Arabidopsis plants....................................................................................................42 4-1 Sugars up-regulate AtvacINV1 and down-regulate AtvacINV2 ................................58 4-2 Reciprocal regulation of the vacuol ar invertases (AtvacINV1 and AtvacINV2) by light/dark treatments that alter soluble sugar levels............................................59 4-3 A time-course of responses to glucos e starvation + 50h of recovery (+G) by mRNAs for two vacuolar invertases........................................................................60 4-4 A time-course of responses to glucose star vation + the first 3h of recovery (+G) by mRNAs for two vacuolar invertases...................................................................61 4-5 Glucose and ABA responses by mRNAs for two vacuolar invertase genes ...........62 4-6 Glucose and ACC responses by mRNAs for two vacuolar invertase genes............63 4-7 Analysis of AtvacINV2 promoter::GUS activity in mature Arabidopsis plants and comparison of sugar respons iveness to the endogenous gene...........................64

PAGE 9

ix 4-8 Longevity of AtvacINV2 mRNA..............................................................................65 4-9 Effects of sucrose analog s and glucose analogs on AtvacINV2 mRNA levels........66 5-1 Histochemical localization of GUS activ ity in Arabidopsis plants transformed with an AtvacINV1 promoter:: GUS fusion gene......................................................89 5-2 Histochemical localization of GUS activ ity in Arabidopsis plants transformed with an AtvacINV2 promoter::GUS fusion gene......................................................90 5-3 Maps of T-DNA insertion mutants a nd genomic DNA restriction enzyme sites of the Arabidopsis vacuolar acid invertase genes, AtvacINV1 and AtvacINV2 ........91 5-4 Southern blot analysis of Salk_015898 ( vac1-2 ), an atvacinv1 mutant...................92 5-5 Southern blot analysis of Salk_016136 ( vac2-2 ), an atvacinv2 mutant...................93 5-6 RNA gel blot and RT-PCR analysis of AtvacINV1 expression in different vacuolar acid invertase mutants...............................................................................94 5-7 RNA gel blot and RT-PCR analysis of AtvacINV2 expression in different vacuolar acid invertase mutants...............................................................................95 5-8 Soluble acid invertase activity of mutant lines.........................................................96 5-9 Root-length phenotypes for Arabidops is vacuolar-invertase mutants on onesixth-strength MS sugar-free medium......................................................................97 5-10 Root-length phenotypes for 3-d-old Arab idopsis vacuolar-invertase mutants on moist filter paper......................................................................................................98 5-11 Changes in mRNA levels of other invertase family members in vacuolar invertase mutants of Arabidopsis.............................................................................99 5-12 Glucose responses of acid invertase mRNAs.........................................................100 5-13 Changes in mRNA levels of sucrose synthase genes in vacuolar invertase mutants of Arabidopsis...........................................................................................101

PAGE 10

x Abstract of the Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR ANALYSIS OF AN ACID INVERTASE GENE FAMILY IN ARABIDOPSIS By Li-Fen Huang May 2006 Chair: Karen E. Koch Major Department: Plant Mo lecular and Cellular Biology Invertases can influence pl ant biology in at least tw o ways; first, by affecting resource allocation among plant parts through cleavage of the transport sugar, sucrose, and second, by indirectly altering expressi on of genes sensitive to shifts in sucrose/hexose availability. To initiate a test of roles and regulati on for these invertases, their gene families in Arabidopsis thaliana were subjected to gene expression analyses. A search of predicted protein sequences in the Arabidopsis data base indicated two vacuolarand six cell-wall invertases in this species. Clues to their functions were obtained by analyzing mRNA levels for indivi dual genes using quantitative RT-PCR. The two vacuolar invertase mRNAs, AtvacINV1 and AtvacINV2 , were predominated in vegetative tissues. Sugar respons es of the vacuolar invertas es were reciprocal at the mRNA levels, with AtvacINV1 being up-regulated and AtvacINV2 being down-regulated. Analysis of mRNA turnover indicated that AtvacINV2 mRNAs were destabilized in glucose medium despite glucose induction of the AtvacINV2 promoter (as observed for

PAGE 11

xi the other invertases). Recipr ocal responses of the two vac uolar invertases at the mRNA level may be responsible for a precise balan ce of expression across different conditions. An additional approach to identifying functional significance of these genes was to test the impact of their inactivation in single a nd double mutants. Activity in the vacuolar (soluble) fraction was markedly decreased in each of the single -gene knockouts, and undetectable in the double mutant. Data confirm that these two genes encode functionally active soluble acid invertases. Extensive phenotypic analysis revealed significant decreases in root length of si ngle and double mutants on wet filter paper. However, roots of single mutants consistently outgrew those of wild-type seedlings in agar medium, where abundant osmolytes we re supplied from agar medium for cell expansion. In addition, vac uolar invertase knockouts had markedly altered molecular phenotypes that included changes in mRNA le vels for cell wall invertases and sucrose synthases. Mutants defec tive in the sugar-inducible AtvacINV1 showed diverse gene responses consistent with pr edicted reductions in signal-act ive hexoses. Although effects of the AtvacINV2 mutation were more complex, evid ence from the molecular phenotype of AtvacINV1 knockouts was consistent with an upstr eam role of this vacuolar invertase in sugar signaling.

PAGE 12

1 CHAPTER 1 INTRODUCTION Sucrose is the major carb onhydrate and energy source transported from green leaves to cells of growing plant part such as roots, fruits a nd seeds. Invertase and sucrose synthase, the only known enzymes for utilization of sucrose in these cells, have profound effects on plant growth and development. Although both enzymes cleave sucrose, the invertase reaction produces two-fo ld more hexoses (1 fructose + 1 glucose) than does the reversible sucrose synthase reaction (1 fruc tose + 1 UDP-glucose). These differences mark an important distincti on, because hexose formation can affect subsequent sugar sensing networks. These signaling systems can be separated into those that depend on hexokinase (HXK) reactions (hexose + ATP hexose-P + ADP) and others that are HXK-independent. The signals for sugar sensin g can be initiated from sugars such as sucrose, fructose or glucose, and the se nsors themselves can be HXK and/or other proteins. Because invertase activity typical ly contributes the majority of elevated hexoses in plant cells, this enzyme may pl ay an important role in regulating sugar metabolite sensing (Figure 1-1). Although a number of recent studies have addressed the regulation and functional roles of acid invertase, littl e is known about the capacity of these enzymes to affect sugar signaling. This is especially true for the vacu olar invertases despite the extent of their activity and expression relative to other form s in most vegetative ti ssues (Figure 3-5). Definitive analysis of the acid invertases has been complicated by the involvement of a multi-member gene family encoding both vac uolar and cell-wall forms (Sturm, 1999).

PAGE 13

2 Recent completion, annotation, and release of the Arabidopsis thaliana genome now makes possible a thorough investigation of th e entire acid invertase gene family and its gene regulation in this organism. In a ddition, activity of both solubleand cell-wall invertases have been confirmed in this spec ies (Tang et al 1996; Stessman et al., 2002) and all eight predicted acid i nvertase genes give rise to de tectable transcripts (TymowskaLalanne and Kreis, 1998b; Sherson et al., 2003). These previous st udies also indicate important differences between expression of Arabidopsis invertases (Tymowska-Lalanne and Kreis, 1998a; Sherson et al., 2003), but a full-family analysis has not been undertaken nor have materials been developed to allow comparison of family members via quantitative mRNA expression. Here, to in itiate an investigat ion of regulation and roles for these invertases, the gene family members in Arabid opsis have been subjected to expression analyses. Based on sequence homology, two v acuolar invertase genes ( AtvacINV1 and AtvacINV2 ), plus six cell wall invertase genes ( AtcwINV1 AtcwINV6 ), are predicted in this species. To begin this study, gene-spe cific primers and probes for Taqmanreal-time RT-PCR were delineated to provide a sensitive method fo r detecting and quantifying gene expression. An analysis of mRNA expr ession patterns for the entire acid invertase family in the major Arabidopsis organs was next undertaken. Both vacuolar invertase transcripts predominated in photosynthetic organs, whereas mRNAs from two cell wall invertases, ( AtcwINV2 and AtcwINV4 ), predominated in reproductive structures. Soluble acid invertases in maize can be distinguished by their responses to sugar abundance. The Ivr1 invertase mRNAs are up-regulated by sugar starvation, whereas the Ivr2 invertase mRNAs are up-re gulated by elevated sugar levels (Xu et al. 1996).

PAGE 14

3 However, this contrasting regul ation of vacuolar invertases has thus far been reported only in maize, and has not been tested in di cots or other species. Therefore, sugar regulation of Arabidopsis vacuolar invertases was addressed in this study, and a similar, dichotomous response was revealed. The AtvacINV1 mRNA level rose when sugar supplies were abundant, whereas levels of AtvacINV2 mRNAs decreased. Time-course analyses were also undertaken to further di ssect the glucose responses of these genes, especially the ra pid repression of AtvacINV2 . Posttranscriptional control was also examined. In addition, responses to sugar an alogs were tested to address whether sugar repression of AtvacINV2 could also be regulated by disaccharides. To investigate the role of vacuolar acid invertases in photosyn thetic organs, a TDNA knock-out approach was employed. Si ngle and double mutants were generated from plants obtained through the Arabidopsis Biological Resource Center. These were screened in search of plants lacking detectab le transcripts of eith er vacuolar invertase gene. Mutant lines were confirmed to have T-DNA insertions by Southern blot analyses. Northern blots and RT-PCR analysis confirmed that the mutant lines had reduced levels of RNA. In young Arabidopsis plants, soluble invertase activity from two AtvacINV1 knock-out lines was reduced to ~36% of wild-typ e levels. Soluble invertase activity in an AtvacINV2 knocked-out line remained at 24% of wild type. No soluble invertase activity could be detected in the double muta nt lacking functional genes for both AtvacINV1 and AvacINV2 . This resulted in a two-fold enhancement of sucrose accumulation by mutant plants (Stessman, 2004). The present work al so showed that the molecular phenotype of single invertase mutants included altered mR NA levels for cell wall invertases and sucrose synthases (catalyzing an alternate pa th for sucrose use). In addition, a visible

PAGE 15

4 phenotype was evident in altere d root length when seedlings were grown on minimal agar medium or filter paper. Data support the s uggestion that vacuolar invertases function not only as metabolic enzymes, but also influence regulatory mechanisms. Major goals of work reported here ha ve been to determine whether the dichotomous sugar response of vacuol ar invertases extends from maize to Arabidopsis and to test hypotheses for phys iological roles of soluble i nvertases in this species. Specific objective have been as follows. 1. Characterize the Arabidopsis acid invertase gene family, from bioinformatic to mRNA expression analyses to provide clues fo r each memberÂ’s function (Chapter 3). 2. Dissect the sugar responses of vacuolar invertases in Arabidopsis, with special focus on regulatory mechanisms mediating the distinctive glucose repression of AtvacINV2 (Chapter 4). 3. Test biological roles of vacuolar invertases in knockout mutants of Arabidopsis (Chapter 5). Figure 1-1 Sucrose metabolism in plant cells. The first step in sucrose use as an energy source is its cleavage. This can be catalyzed by only invertase or sucrose synthase. These enzymes are pivotal to the balance between hexose signals and metabolic products.

PAGE 16

5 CHAPTER 2 LITERATURE REVIEW Sugar sensing provides a cri tically important mechanism allowing plants to adjust their growth, metabolism, and development to the prevailing environment. In general, sugars function as signals to repress the e xpression of genes for sugar acquisition and remobilization, while inducing the expression of genes for storage and utilization (Koch, 1996; Rolland et al., 2002; Halford and Paul , 2003). Sugar signaling in plants is complicated by the nature of photoautotrophy an d associated adjustments of balance. Sucrose is the major trans port form of carbohydrates in most plants. The pivotal position of invertase in sugar signaling and carbon metabolism is based on its major role in hydrolysis of sucrose to gluc ose and fructose in an irreve rsible direction. Invertases provide hexoses that serve as an energy sour ce, generate osmotic pressure in growing tissues, and may have profound effects on sugarregulated genes. Invertases can mediate sucrose/hexose balance during th e entire plant life cycle. Sugar Sensing From germination to flowering and sene scence, sugar sensing is involved in numerous plant metabolic and developmen tal processes. For example, during germination of rice seeds, sugars can repress the expression of -amylase genes for sugar production (Yu et al., 1996). In developi ng seedlings, sugars can repress hypocotyl elongation as well as cotyledon greening and expansion (Dijkwel et al., 1997; ArenasHuertero et al., 2000). Duri ng other stages of development, sugars can induce the expression of genes for storage and util ization, such as patatin and ADP-Glc

PAGE 17

6 pyrophosphorylase in potato tubers (Jeffe rson et al., 1990; Koch, 1996, MüllerRöber et al., 1990). In senescing leaves, suga rs can also decrease chlorophyll content and photosynthetic rate (Jiang et al ., 1993). Still further effects are evident in the capacity for sugar to rescue the late-flowering phenotype of severa l mutants (Araki and Komeda, 1993). In addition, increased sugar export a nd starch mobilization from leaves are implicated as critical factors for floral transition in Arabidopsis (Corbesier et al., 1998). There are several avenues of potential input into sugar sensing systems, and these can be perturbed in different ways. Multiple sugar sensing pathways have been proposed to exist in plants (Koch, 1996; Halford et al ., 1999). One of these appears to involve hexokinase, the first enzyme of glycolysis, with a dual role in initia ting sugar signals. In plants, photosynthetic genes can be represse d by substrates for hexokinase such as glucose, and also by the minimally-meta bolized analogs, mannose and 2-deoxyglucose (Jang and Sheen, 1994). There are also hexokinase-independent pathwa ys. One line of evidence is that in Chenopodium rubrum suspension cells, at least one invertase gene is induced by 6deoxyglucose, a glucose analog that can be tr ansported into cells but not phosphorylated by hexokinase (Roitsch et al., 1995). Also, a SnRK1 that encodes the yeast Ser/Thr protein kinase (SNF1) homol og in potato was shown to be required for sucrose synthase induction by sugars (Purcell et al., 1998). In addition, hexose-transporter-like proteins have been implicated in sugar sensing. Most hexose transporters faci litate the uptake of monosaccharides, including glucose and the ot her hexose analogs. However, some of these, especially the transpor ter-like systems, appear likely candidates for initiation of sugar signals. Recent studies in yeast suggest that transporter-like Glc sensors (Snf3 and

PAGE 18

7 Rgt2), together with a G protein–coupled receptor (Gpr1), can function in glucose signaling (Rolland et al., 2001). Hexokinase-dependent and -independent pathways were found to be involved in both upand down-regulation of gene expr ession in rice (Ho et al, 2001). An additional contributor to sugar signaling in plants appears to be trehalose, an unusual disacchardide that consists of two glucose molecules. Although there are only trace amounts in most plants, a role has b een implicated in os moprotection, and recent evidence has suggested a link to glucose se nsing (Avonce et al., 2005). The biosynthesis of trehalose involves a twostep process mediated by tr ehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) (as reviewed by Eastmond et al., 2003). The AtTPS1 , one of 11 putative TPS genes in Arabidopsis, is expressed in all Arabidopsis tissues, and its disruption leads to an embryo lethal phenotype (Eastmond et al., 2002). The arrested tps1 homozygous mutant can be rescued by an inducible AtTPS1 expression system, and this expe rimental system also indicate s that AtTPS1 is essential for normal root growth and transition to flow ering (van Dijken et al., 2004). In addition, a glucose-insensitive phenotype results when AtTPS1 is over-expressed, and levels of both treholose and trehalose-6-phosphate rise (Avonce et al., 2005). Trehalose-6phosphate also accumulates rapidly wh en sucrose induces expression of AtTPS5 and inhibition of seedling growth resu lts (Schluepmann et al., 2004). Trehalase, an enzyme that cleaves trehal ose into its glucose constituents, has also been identified and isolated fr om plants (Goddijn and Smeekens, 1998). In Arabidopsis, external feeding of trehalose strongly induces the expression of th e starch-biosynthetic genes, ADP-glucose pyrophosphorylase , ApL3 . Induction of ApL3 leads to over-

PAGE 19

8 accumulation of starch in shoots and inhibits root growth (Wingler et al., 2000). In soybean, trehalose also affects sucrose synthase and invertase activities (Müller et al., 1998). Furthermore, when accumulation of treh alose is stimulated by validamycin A, a trehalase inhibitor, strong reductions occur in starch and sucrose content of Arabidopsis (Müller et al., 2001). Crosstalk between Ethylene, ABA and Sugar Sensing in Young Seedlings Single plant hormones often affect many cellular responses, and different plant hormones can often elicit the same response. These observations indicate a complicated crosstalk where signal components can be shared betw een hormone-response systems in plants. Genetic analyses have shown that many ethylene-response mutants also alter ABA responses. In general, ethylene appears to be a negative regul ator of ABA at the level of germination, but positively regulates specific ABA actions in root growth. However, ABA does not interact with the “triple response” to et hylene by etiolated seedlings (short, thick hypocot yls, and enhanced curvature of the apical hook), nor is ethylene involved with ABA in stomatal closur e. Still, ABA and ethylene often interact closely and both modulate overall carbon st atus during early seedling growth and development (Gazzarrini and McCourt, 2001). Sugar sensing mutants have been isolated by screening for altered germination or seedling development on media with different su gar levels. Alternately, transgenic plants that have altered expression of a sugar-re gulated promoter have been developed. Analysis of sugar-hypersensitive and insensi tive mutants has revealed extensive overlap with plants identified by screens for muta nts defective in plant hormone signaling pathways (Rolland and Sheen, 2005). Several sugar-insensitive mutants affect genes involved in ABA biosynthesis or signaling. For exampl e, genes involved in ABA

PAGE 20

9 biosynthesis were affected in gin1 ( glucose insensitive 1 ), isi4 ( impaired sucrose induction 4 ) and sis4 ( sucrose insensitive 4 ) mutants (Laby et al., 2000; Rook et al., 2001; Cheng et al., 2002). Gin6 is allelic to ABI4 (ABA insensitiv e), a plant-specific transcription factor (ArenasHuertero et al., 2000). Sugar sensitivity in seedlings is also influenced by ethylene. Mutants that overproduce ethylene or have c onstitutive ethylene responses are also insensitive to high glucose. In addition, ethylene-insens itive mutants are glucose-hypersensitive (as reviewed by Gazzarrini and McCourt, 2003). Identification of an Arabidopsis sugarinsensitive mutant, for example, show ed a constitutive response to ethylene ( sis1 allelic to ctr1 ) (Gibson et al., 2001). Also, seve ral ethylene-insensitive mutants ( ert1, ein2, ein3 and ein6 ) show glucose hypersensitive responses, indicating that glucose sensing might be linked to ethylene signali ng pathways, possibly down-stre am of ETR1 (Cheng et al., 2002; Leon and Sheen, 2003). Alterations in et hylene signal transduction can thus also affect sugar responses. Invertases Invertases are -D-fructofuranosidases (EC 3.2.1.26) that irreversibly hydrolyze sucrose to glucose and fructose. This repres ents a key point of upstream input into sugar signals, and extends well beyond simple initiatio n of sucrose metabolism. A number of different invertase isozymes have been identi fied and classed as soluble forms, which are readily extracted from the cytosol or vacuol e, or insoluble forms, which are bound to cell wall components. Within these groups are ac id invertases, with optimum enzyme activity at acidic pH, and neutral or alkaline invertases, w ith optimum activity at just over pH 7.0. Invertase cDNAs and/or genes encoding insolu ble and soluble acid invertases have been characterized from many plan ts, e.g. tomato, carrot, ma ize and Arabidopsis (Sturm,

PAGE 21

10 1999). The physiological advantage of having mu ltiple invertase isozymes could be that of providing flexibility in the regulation of sucrose me tabolism and mobilization under different developmental and environmental conditions. The gene structures for acid invertases are very similar and contain six to eight exons. In almost all acid invertases, th e second exon is the smallest functional one known in plant biology. This invertase exon co des for only three amino acids, DPN, of the conserved NDPNG motif in the catalytic domain. The mature acid invertases are N-glycosylat ed at multiple sites, and their molecular weights range from 55 to 70 kD (Tymow ska-Lalanne et al., 1998a). Although glycosylation does not seem to be essential fo r enzyme activity or stability, it is required for protein transport across eith er the plasma membrane (for cell wall invertases) or the tonoplast (for vacuolar inve rtases) (as reviewed by Ty mowska-Lalanne and Kreis, 1998a). The attached glycan groups are be lieved to contribute prominently to the intrinsic stability of the acid invertases (Yamaguchi, 2002). The activity of cell-wall invertase (cwINV) determines whether a cell is exposed to apoplastic sucrose or hexoses and plays a cen tral role in phloem unloading. Therefore, cwINV controls many aspects of plant growth and development. A mutation in an endosperm-specific cwINV in maize, for exam ple, decreases kernel size (Cheng et al., 1996). In carrot, antisense reduction of cwINV action abo lishes tap root formation and leads to increased foliar gr owth (Tang et al., 1999). The activity of vacuolar invertase can re gulate turgor pressu re, sucrose import, sugar composition and sugar signals, especi ally during the expansion phases of sink organs (as reviewed by Koch, 2004). When activ ity of vacuolar invertase is reduced by a

PAGE 22

11 constitutive antisense strategy in transgenic tomatos, sucrose levels increase, hexose content decreases, and fruits are 30% smaller th an those of wild type controls (Klann et al., 1996). Also, during the ea rliest period of maize kernel development, when young ovaries are abortion-sensitive, their earliest measurable response to drought stress is a rapid repression of vacuolar invertases (Anderson et al., 2002). This response could contribute to maternal adjust ment of ovary sink strength and kernel number. Induction of invertase activity is usually regulated at the tr anscriptional level (Rausch and Greiner, 2004; Gonzalez et al ., 2005). Invertase tr anscripts are highly responsive to hormones, sugars, pathogens , oxygen, and other environmental changes (Long et al., 2002; Trouverie et al., 2003; Roitsch et al., 200 3; Zeng et al., 1999). These stimuli can evoke opposite responses among diff erent invertases, such as the glucose repression of Ivr1 and induction of Ivr2 (Xu et al., 1996). Expression of the same invertase genes can also have contrasti ng responses in different organs, with Ivr2 mRNAs accumulating in drought-stressed maize leaves (Trouverie et al., 2003), but decreasing in drought-stressed kernels (Ande rson et al., 2002). Inhibition of Invertases In addition to the control of gene expression in invertase gene families, enzyme activity may also be controlled by modificati on of vacuolar or apoplastic pH. Cell wall and vacuolar invertases have highest activities at pH 4~5 a nd only remain 10% active at pH 6 (Rausch and Greiner, 2004). Another potentially important avenue by which plant invertases may be regulated is through action of proteinaceous inhibitors. Se veral small invertase inhibitors, ranging in size from 15 to 23 kDa, have been purifi ed from the cell wall in a number of plant species, e.g. tobacco, potato and maize (Rau sch and Greiner, 2004). They inhibit both

PAGE 23

12 cell wall and vacuolar invertases in vitro but the specific action sites and targets in vivo remain unclear. The first invertase inhibitor gene, Nt-inh1 , was cloned and characterized from tobacco and is considered to be an apoplastic protein (G reiner et al., 1998). Analysis of its recombinant protein in vitro showed that although this inhibitor did not affect yeast invertase, it did decrease activ ity of cell wall invertases extracted from tobacco and Chenopodium rubrum , and as well as vacuolar invertases extracted from tomato fruit (Greiner et al., 1998). Anot her invertase inhibito r (ZM-INVINH1 from maize) was also tested as a recombinant pr otein and found to decrease invertase activity in vitro (Bate et al., 2003). RT-PCR and in situ analysis further showed that this ZMINVINH1 was prominently expressed in the embryo-surrounding region of the developing maize kernel (Bate et al., 2003). The authors sp eculate that role of ZMINVINH1 at this locale may be to compartm entalize invertase activity away from the embryo during early kernel development a nd thereby delay embryo cell division and development relative to the endosperm (Bate et al., 2003). Still another putative invertase inhibitor ( Nt-inhh of tobacco) was hypothesized to targ et vacuolar invertases, and when overexpressed in potato, reduced vacuolar i nvertase activity by ~80% in source leaves (Greiner et al., 1999). In these experiments, cell wall invertase activity was maintained at essentially unchanged levels in nontransforme d controls (Greiner et al., 1999). Because co-localization of vacuolar invertase and an invertase i nhibitor have not yet been demonstrated, it remains unclear whether decr eases of vacuolar invertase by invertase inhibitors represent actual in vivo action or are artifacts of ectopic expression or a contamination by in vitro enzyme assay.

PAGE 24

13 Invertase inhibitors shar e a high level of sequence similarity with pectin methylesterase inhibitors (PMEI). Recent an alysis of PMEI structure has revealed an independent and necessary alpha-helical hairpi n motif that can make differential use of similar modules to inactivate distinct enzymes (Hothorn et al., 2004). However, most cases of decreased invertase activity appear to be controlled at the transcriptional level (Andersen et al., 2002; Rausch and Greiner, 2004; Gonzalez et al ., 2005; Kohorn et al., 2006). Mechanisms were specifically compared for impairment of invertase activities by water deficit during meiosis in wheat anther s, which were found to occurr through downregulation of invertase transcripts, rather than by action of an invert ase inhibito r (Koonjul et al., 2005). The Arabidopsis Acid Invertase Gene Family Analysis of cDNAs and of amino acid sequen ces indicates that there are eight acid invertase genes in Arabidopsis, and each pr oduces a transcript (T ymowska-Lalanne and Kreis, 1998a; Sherson et al., 2003). Six of thes e invertases are predicted to be cell wall forms and two to be vacuolar forms. The six putative cell wall invertase genes have also been identified in the Arabidopsis thaliana genome ( AtcwINV genes) (Sherson et al., 2003). Two cell wall invertase genes, AtcwINV1 (also called At fruct1 ; At3g13790) and AtcwINV2 (also called At fruct2 ; At3g52600) have been cloned and their expression examined (Tymowska-Lalanne and Kreis, 1998a). The AtcwINV1 mRNAs are highly expressed in mature leaves; whereas AtcwINV2 transcripts are found only in flower tissue (Tymowska-Lalanne and Kreis, 1998a) . The AtcwINV1 is induced during fungal infection (Fotopoulos et al., 2003). Later, ex pression patterns of six cell wall invertase genes were investigated all together and shown distinct levels and spatial patterns of

PAGE 25

14 expression in 3-day-old seed lings, expanding rosette leaves , flowers, and developing seeds (Sherson et al., 2003). Tw o vacuolar invertase genes, AtvacINV1 (also called At fruct3 ; At1g62660) and AtvacINV2 (also called At fruct4 ; At1g12240) have been cloned from Arabidopsis (Haouazi ne-Takvorian et.al, 1997). The AtvacINV1 mRNAs are detected in the cotyledon, with less e xpression in tissues elsewhere. The AtvacINV2 is expressed in young leaves (Haou azine-Takvorian et.al, 1997). Recently, heterologous expression of AtcwINV3 (At1g55120) and AtcwINV6 (At5g11920) in Pichia pastoris showed that these enzyme s have fructan exohydrolase (FEH) activities 70 and 150 times higher than their invertase activites, respectively (De Coninck et al., 2005). In this system, Atcw INV1 showed a Km for sucrose of 1mM and did not have FEH activity (De Coninck et al ., 2005). Soluble acid invertase isoforms have been purified from mature leaves of Arabidopsis, and they have shown K m values for sucrose that ranged from 5 to 12 mM. These in vitro analysis also indicated pH optima of 5.5 and maximal activity at 45 °C; implying a high thermostability for these enzymes (Tang et al 1996). The distinct expression patterns within the Arabidopsis invertase gene family indicate differential regulatory mechan isms. Antisense-based decreases in AtcwINV1/Atßfruct1 (driven by a constitutive CaMV 35S promoter) resulted in a shortsilique phenotype and enhanced expression of AtcwINV2/Atßfruct2 in Arabidopsis flowers with emerging siliques. Physiological compensation is thus indicated within this invertase family (Chaivisuthangkura et al, 1998). A functional promoter analysis has been undertaken for two cell wall invertase genes thus far. One was from carrot (Ramlo ch-Lorenze et al., 1993) and the other from

PAGE 26

15 Arabidopsis (Tymowska-Lalanne et al, 1996). Wh en a 5’-deletion seri es of the carrot cell wall invertase promoter region was tested in a transient tobacco protoplast system, two putative silencer elements were revealed (Ramloch-Lorenze et al., 1993). Transient expression analysis of the AtcwINV1/Atßfruct1 promoter in Arabidopsis protoplasts indicated three cis -acting elements: an A/T rich sequence, a repeated element (GTCTGC), and a putative wound-res ponsive element (TTGTGGAAACAAC) (Tymowska-Lalanne et al, 1996). However, analyses have not yet addressed nuclear proteins that could directly bind to any invertase promoter region . Analysis of AtvacINV2/At fruct4 (At1g12240) showed this vacuolar enzyme often remains for extended periods in precursor prot ease vesicles (PPV) be fore being released into vacuoles. A vacuolar processing enzyme(a cysteine proteas e) is also induced, accumulates in PPV, and is released into vac uoles along with one of its target proteins, the AtvacINV2 (Rojo et al., 2003). In senesc ing organs, both the i nvertase and vacuolar processing enzyme are purportedly released toge ther into the vacuole, where acid induces maturation of the protease and eventual tu rnover of the invertase. The regulation of vacuolar invertase therefore includes prot ein compartmentalization and turnover. Recently, fine mapping of a quantitative tra it locus (QTL), together with a knockout mutant analysis, indicates that root length of Arabidops is is also regulate d at least in part, by AtvacINV2 (Sergeeva et al., 2006).

PAGE 27

16 CHAPTER 3 STRUCTURE AND EXPRESSION PROFILES OF THE INVERTASE GENE FAMILY IN ARABIDOPSIS Introduction Sucrose is the major carbohydr ate and energy source for im porting into plant cells. Invertase and sucrose synthase are the only know n enzymes that can ini tiate utilization of this sucrose, and can therefore have marked effects on plant growth and development. Sucrose synthases convert sucrose into UDP-g lucose plus fructose in a reversible reaction; whereas invertases irreversibly hydrolyze sucrose into glucose and fructose. Although both cleave sucrose, the invertase react ion produces two-fold more hexoses than does sucrose synthase. This is an im portant distinction, because sucrose, glucose and fructose are important signaling molecules in addition to their roles in metabolism, cell expansion, osmotic adjustment and vacuolar sugar storage (Farrar, 1996; Xu et al., 1996; Rook et al., 1998; Smeekens 2000). A number of different invertase isozymes have been identified as either soluble (readily extractable from cytosol or vacuole), or insoluble (bound to cell wall components). Within these groups are acid invertases, with optimum activity at low pH (~pH 5.0), and neutral or alkaline invertases with optimum activity at just over pH 7.0. Few of the latter have been characterized molecularly and only limited information is available on their function or biological roles. They sh are low sequence homology with acid invertases and Vargas et al. (2003) sp eculate that the neutral invetases may have originated from orthologous prokaryotic genes. Because activity of the neutral/alkaline

PAGE 28

17 forms is typically quite low, acid invertases ha ve received considerably more attention. Although functionally distinct, vacuolar a nd cell wall acid inve rtases had a common origin, and Ji et al (2005) sp eculate that vacuolar forms ma y have evolved from cell wall forms by replacement of a signal peptide from vacuolar alkaline phosphatase (Ji et al., 2005). Soluble and insoluble acid invertase ge nes have now been characterized from a number of plants, e.g. tomat o, carrot, maize and Arabidopsis (Sturm, 1999). Both cell wall invertases (cwINV) and so luble vacuolar invertases (vacINV) share two conserved amino acid motifs, NDPNG and WECP/V, as well as a high degree of overall cDNA sequence homology. In addition, both groups of genes typically have six to eight exons, and in most instances the second of these is the smallest known exon in plants. Its nine base pairs encode the three-amino-acid DPN of the conserved NDPNG motif in the catalytic domain (Simpson et al., 2000). Another conserved amino acid motif, WECP/V, is located at the C-terminal end of acid i nvertases. Whereas cwINV enzymes contain a proline residue in this WECP/V motif, vacINVs have a valine residue at this site. This single amino acid difference (P instead of V) leads to a more acidic pH optimum and substrate specificity for the cwINV proteins (Goetz and Ro itsch, 1999). The mature acid invertases are N-glycosylat ed and have molecular we ights between 55 and 70 kD (Tymowska-Lalanne and Kreis, 1998b). The physiological advantage of multiple invertase isozymes could be their provision of greater flexibility for regulation of sucrose metabolism and mobilization under diverse deve lopmental and environmental conditions. Cell wall invertases can have central roles in long-distance transport, since their action immediately outside phloem of impor ting tissues could enhance mass flow by

PAGE 29

18 lowering sieve-tube turgor at the import site . In addition, cell wall invertases can help dissipate excess turgor in importing cells as they shift from expa nsion-based sinks to assimilate storage sites. A quite different mode of action for these invertases also includes their probable impact on sugar signals through production of hexoses that can be sensed from the apoplast. These in turn can affect numerous carbohydrate-responsive genes and developmental processes. Examples that probably involve all three of these mechanisms include a mutation of endosperm -specific cwINV in maize that decreases kernel size (Cheng et al., 1996). Also, in carrot, antisense reduction in cwINV action abolishes tap root formation and leads to increased foliar growth (Tang et al., 1999). Roles for vacuolar invertases seem ofte n underestimated considering their activity per unit protein typically predominates over that of cell wall isoforms by 7-fold in vegetative tissues (Stessman, 2004) . Although the involvement of vacuolar invertases in osmotic change and stored sugars seems well-appreciated (Reviewed in Roitsh and Gonzalez, 2004), these enzymes (like the cell wall forms) can also have important roles in import and sugar signaling. The vacuolar invertases generally act during early phases of development for newly expanding sinks (K och, 2004), where they often constitute the primary avenue for cleavage of imported sucr ose. This role in sucrose use can also effectively aid expansion by harnessing the osmotic potential of the two-from-one, hexose-from-sucrose reaction in the vacuole. Compartmentalization of hexoses within the vacuole also mediates the timing and exte nt of their availability for both metabolism and sugar signals. Reduced vacINV activity has been reported in response to waterdeficit stress by young maize ovaries (Andersen et al., 2003) and also by wheat anthers (Dorion et al., 1996). In maize, specific re ductions in vacINV activ ity not only correlate

PAGE 30

19 with the extent of subsequent kernel abortion, but clearly precede it (Andersen et al., 2003). The sequence of events is consistent with a causal relationship, possibly mediated by dual contributions from vacINV to cell e xpansion and sugar si gnaling (the latter affecting cell division). Further evidence for the distinct roles of vacuolar and cell wall invertases comes from the profound consequences to plant development that result from invertase expression at the wrong time, place, or level. Experiments targeting yeast invertase expression to either cytosol, vacuole, or cell wall compartments, but expressing them throughout all organs of transgenic tobacco plan ts, led to stunted grow th and reduced root formation (Sonnewald et al., 1991). When ove r-expression was direct ed solely to the tuber sink organs of potato plants, however, cel l wall invertases gave rise to fewer, but larger potatos. In contrast, elevated expressi on of vacuolar invertas es in tubers yielded more, but smaller potatos (Sonnewald et al., 1997). In carrot, antisense reduction in activities of either vacuolar or cell wall invertases mark edly changed the morphology of cotyledon-stage embryos (Tang et al., 1999). However, when similar methods were used to repress vacuolar invertase in tomato (Klann et al., 1996) or mature potato tubers (Zrenner et al., 1996), sucrose content increas ed and hexose level decreased, but no major effects were evident in vegetative plant development. Arabidopsis has been reported to ha ve six cell-wall invertase genes ( AtcwINV1 through AtcwINV6 ) and two vacuolar invertase genes ( AtvacINV1 AtvacINV2 ), each with different patterns of spatial and tempor al mRNA expression (Tymowska-Lalanne and Kreis, 1998b; Sherson et al., 2003 ). However, profiles of e xpression from earlier reports did not include all acid invertas e genes, and the specificity of probes for Northern blots or

PAGE 31

20 primers for RT-PCR did not fit the requirement for in-depth analysis of the entire acid invertase gene family. Quantitative real-time reverse transcriptase-polymerase chain reaction (Q-RT-PCR) has an unparalleled cap acity to provide a quantitative comparison of expression by different memb ers of a highly conserved gene family such as that of the acid invertases. The high sensitivity and sp ecificity of this appr oach (Bustin, 2000) has successfully defined contributions by sp ecific family members in a xyloglucan endotransglucosylase/ hydrol ase gene family (Yokoyama and Nishitani, 2001), the NRT2 nitrate transporter family (Orsel et al ., 2002), and the shaggy-like kinase multigene family in Arabidopsis (Charrier et al., 2002). In the present work, gene specific primers and probes were designed for each of the six AtcwINV and two AtvacINV genes. All eight were furt her tested for specificity by appraising the extent of cross hybridization in the presence of equal cDNA levels from other family members. To prepare standard curves for each of the eight acid invertases, constructs were generated with their respec tive cDNAs downstream of a T3 or T7 RNA polymerase promoter. These were introduced into plasmids and used to drive isotope labeling sense RNA transcripts by in vitro transcription. The RNA was quantified by scintillation counting and converted to num ber of molecules per µl (Bustin 2000). Development of this system allowed an ab solute, quantitative co mparison of all eight acid invertases at the mRNA level. Here, th is method is used to obtain functional clues for roles of each acid invertase by quantif ying and comparing their respective mRNA contributions to different organs of a developing Arabidopsis plant.

PAGE 32

21 Materials and Methods Plant Materials Arabidopsis thaliana (Col-0) seeds were surface-ster ilized and soaked in sterile, distilled water for 4~5 d at 4ºC in the dark. Seeds were sown on media solidified with 0.16% (w/v) phytagel. Murashige and Skoog (MS) medium (Cat.10632-057, pH 5.8, GIBCOBRL, U.S.A.) was utilized at half-strength strengt h, but without adding the 1% sucrose supplement typically included to enhance vigor of initi al seedling growth (Martínez-Zapater and Salinas, 1998). Materi al was cultured under cycles of 12-h light (80 µmol m-2s-1) and 12-h dark at 25ºC. After 14 d, plantlets were collected for RNA extraction or transferred to soil, grown at 22°C with a 16-h photoperiod, and irrigated twice a week. Organs were harvested fr om 5-wk-old plants. All samples were immediately frozen in liquid nitrogen a nd stored at –80 °C until RNA extraction. Sequence Alignment and Phylogenetic Tree Construction Deduced amino acid sequences of eight Arab idopsis acid invertases were aligned using Multalin (prodes.toul ouse.inra.fr/multalin/m ultalin.html) (Corpet, 1998) and the comparison illustrated using BoxShade (Figure 3-1). Phylogenetic analysis of the Arabidopsis acid invertase protein sequences was carried out using PHYLIP (Felsenstein, 1993) at the Biology Workbench (workbenc h.sdsc.edu) based on the CLUSTAL W program (Thompson et al. 1994). The accessi on numbers of sequences from Arabidopsis used to construct the phylogenetic tree were: AtcwINV1 through AtcwINV6 (NP_566464.1, NP_190828.1, NP_564676.1, NP_565837.1, NP_187994.1, NP_568254.1, respectively) and AtvacINV1 AtvacINV2 (NP_564798.1 and NP_563901.1, respectively).

PAGE 33

22 The cDNA Cloning Full-length cDNAs of the cell wall invert ase genes were isolated by RT–PCR, using gene-specific primers that encompasse d the coding regions. Primer pairs were designed with restriction enzyme cutting site (underlined) that included: for AtcwINV1 , 5’-TCGAATTC AAGCCACAAAGAAATTAAAT-3’ ( Eco RI) and 5’GCACTAGT CAAATAAAATGTCATATATATTAGCC-3’ ( Spe I); for AtcwINV2 , 5’TACTCGAG ATGAGTGCTCCAAAGTTTG-3’ ( Xho I) and 5’GCACTAGT TCACTTTGCACCTTGGTTC-3’ ( Spe I); for AtcwINV3 , 5’TTGAATTC CAAAAGAAACAGAACAACAATG-3’ ( EcoR I) and 5’GCACTAGTTCTTCAAATTTGGAAGTGAATG-3’ ( Spe I); for AtcwINV4 , 5’TCGAATTCATCACATTCTCTCCTTATTCAA-3’ ( EcoR I) and 5’GCACTAGTGAGAGACTAAA GACAGAAAGATAC-3’ ( Spe I); for AtcwINV5 , 5’TCGAATTCATGGCTAATATAGTTTGGTGTAAC-3’ ( EcoR I) and 5’GCACTAGTTTAAAGAGAAG ACTTCATGCTC-3’ ( Spe I). PCR reactions were conducted using cDNAs synthesized with mRNA isolated from leaves, flower buds and 10-day-old seedlings. Three cDNA clones, U21060 for AtcwINV6 , U11243 for AtvacINV1 , and U09864 for AtvacINV2 , were obtained from the ABRC stock center (Yamada et al., 2003). Real-Time Quantitative RT-PCR For each set of analyses, to tal RNA was extracted from three separate samples using RNeasy Plant Mini Kits (Qiagen, Vale ncia, CA), and treated with DNase (DNAfree Kit, Ambion, Austin, TX). Real-tim e quantitative RT-PCR was conducted on 200 ng of RNA in 25µ L reactions using Taq-Man One-St ep RT-PCR Master Mix Reagents (Applied Biosystems, Foster City, CA) and an Applied Biosystems GeneAmp 5700

PAGE 34

23 sequence-detection system. The primers a nd Taq-Man probes (designed with Applied Biosystems Primer Express software, Vers ion 2.0) are described in Table 1. The fluorescent reporter dye FAM and the quenche r dye TAMRA were bonded to the probes’ 5' and 3' ends, respectively. Amplicon length was 66 to 78 bp. For most genes, either the probe or one of the primers was designed to span two exons, thus avoiding amplification of any genomic DNA that may have been presen t. Controls without reverse transcriptase were included for verification. RT-PCR c onditions were 48°C for 30 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. RNA standards were synthesized from cDNAs (see below); the standard curves were linear from 1.2 x 10–10 to 2.4 x 10–14 g. The Ct threshold value was determ ined to be 0.075. Due to variable amounts of RNA input, quantific ation of specific transcript s was expressed relative to 18S ribosomal RNA (Taqman® Ribosomal RN A Control Reagents, Applied Biosystems, Foster City, CA). RNA Standard Synthesis and Quantification The in vitro transcription (MAXIscripts in vitro transcription T7/T3 kit, Ambion) was conducted using 5.4 µ M [5, 6-3H] Uridine 5'-triphosphate or 3.1 µ M Uridine 5'-[ -32P] triphosphate as the limiting nucleotide. The efficiency of incorporation for [5, 6-3H] UTP into synthesized RNA was 44%–91% wh en evaluated by TCA precipitation of in vitro transcription products. The 3Hand 32P-labeled RNAs were run on a 5% (w/v) polyacrylamide gel containing 8 M urea. Each [32P] RNA synthesized in vitro indicated the position of the corresponding [3H] RNA and was visualized autoradiographically on X-ray film. The [3H] RNA fragment of corresponding le ngth of was excised, eluted in 300 µ l extraction buffer (Probe elution buffer, Ambion), and quantified by scintillation counting.

PAGE 35

24 Results Similarity of Coding Sequences within the Arabidopsis Acid Invertases When the amino acid sequence of Atv acINV1 (At1g62660) was used in a BLAST search for other acid invertases in Arabi dopsis, a total of 8 predicted members were identified. Two were vacuolar invertases, AtvacINV1 AtvacINV2 , and six were cell wall invertases, AtcwINV1 AtcwINV6 . Multiple, deduced amino-acid sequences of the eight acid invertases were aligned (Figure 3-1) and all were s hown to include the 13 amino acid motifs most strongly conserved among othe r known acid invertases (Ji et al., 2005). The smallest mini-exon, which encodes three amino acids, DPN, was not recognized when two of the invertases (AtcwINV2 and AtcwINV5) were analyzed by gene prediction programs (Entrez Gene, NCBI). However, analysis of cDNA sequences generated in the present study showed that the invertase mini-exon was indeed spliced correctly for these two genes (complete cDNA sequence for AtcwINV2 , NM_115120, is also available in the NCBI database). Al berto et al. (2004) propos ed four amino acids, NDPN, essential for recognition and stable bi nding of sucrose. These were also found here to be conserved in all eight Arabidops is acid invertases (F igure 3-1). Clustal analysis separated the eight acid invertases into four overall groups (Figure 3-2). The two vacuolar invertase genes grouped together, the AtcwINV2 and AtcwINV4 genes for cell wall invertases grouped togeth er, and a third group included the AtcwINV1 , AtcwINV3 and AtcwINV5 . The AtcwINV6 was not groupted with others and located between the vacuolar and ce ll wall invertases in this unrooted phylogenetic tree. Genomic Organization of Invertase Loci The eight acid invertase genes are distributed among 4 chromosomes in Arabidopsis, with three on chromosome 1; three on chromosome 3; and one each on

PAGE 36

25 chromosomes 4 and 5. The AtcwINV3 gene, located on chromosome 1, was found to be flanked by genes encoding endomembrane pr otein 70 and an F-box family protein (Figure 3-3). Another copy of these two gene s was shown to flank a tandem repeat of two cell wall invertase genes, AtcwINV1 and AtcwINV5 , on chromosome 3. These three cell wall invertase genes shared the highest homology within th e family (Figure 3-4B). The other two cell wa ll invertase genes, AtcwINV2 and AtcwINV4 , were each also found in a similar, linear order re lative to neighboring genes in segmental duplications of chromosome 3 and 2, respectively. Down stream of AtcwINV2 were genes encoding ubiquitin extension protein 1 and 40S ribosom al protein S14. Homologs of the same genes were also found down stream of AtcwINV4 , which shared the highest homology with AtcwINV2 . A gene encoding an F-box family protein was found close to these two cell wall invertase genes. Interestingly, these two inve rtase genes showed similar expression patterns, both characterized by particularly high levels of mRNA in reproductive organs (Figure 3-5). For both v acuolar invertase genes, upstream sequences were found to encode a flavin-containing m onooxygenease family protein, and a disease resistance protein belonging to CC-NBS-LRR class. A gene encoding a NAM (no apical meristem) family protein was also found downstream of both genes, implying a segmental duplication had occurred on chromosome 1. There was no similar gene found near AtcwINV6 , the most divergent among the cell wa ll invertases. Collectively, these data show similar arrangements of genes su rrounding subgroups of invertases, providing hints for evolutionary events affecting this family.

PAGE 37

26 Development of a Quantitative RT -PCR System for the Arabidopsis Acid Invertase Family All of the Arabidopsis acid invertase ge nes are reportedly expressed at the mRNA level (Sherson et al., 2003 and Thymow ska-Lalanne and Kreis, 1998). BLAST comparisons between sequences at SIGnAL (http://signal.salk.edu/bl2seq.html) showed the highest amino-acid level homology for th e gene pair that included AtcwINV2 (At3g52600) and AtcwINV4 (At2g36190), with 76% identical and 86% similar sequences. The second most closely-relate d gene pair was AtvacINV1 and AtvacINV2 (At1g22420), with 76% identical and 84% sim ilar sequences. A close relationship was also observed between AtcwINV1 (At 3g13790), AtcwINV3 (At1g55120) and AtcwINV5 (At3g13784), which shared more than 77% similarity. The high level of protein-sequence conser vation in the acid invertase family extended to the cDNA level (Figure. 3-4B). Nucleotide sequences of the two vacuolar invertase cDNAs were found to share 78% id entity, and two of th e cell wall invertase cDNAs, AtcwINV2 and AtcwINV4 were found to share 77% identity. Results were similar when cDNA sequences of AtcwINV1 , AtcwINV3 and AtcwINV5 were compared. Due to the extent of sequence conservati on among cDNAs within the acid invertase family, the Taqman real-time Q-RT-PCR appro ach was utilized to obtain gene-specific quantification of mRNA levels . A high level of sensit ivity and reproducibly was achieved. To define expression profiles for the entire acid invertase family in various organs of plants, 8 sets of specific primer s and Taqman probes were designed and the specificity of each was checked by a cDNA crosshybridization test. In these tests, each primer and probe set was utilized for PCR in the presence of an equal quantity of different acid invertase cDNAs. To develop this system, full length cDNAs of 5 cell wall

PAGE 38

27 invertase genes were each cloned by RT-P CR into a pCRII-TOPO vector (Invitrogen, CA, U.S.A.). The other three cDNA clones ( AtcwINV6 , AtvacINV1 and AtvacINV2 ) were obtained from the ABRC stock center. Figure 3-4A shows that each of the cDNA templates (listed with the accession number s of corresponding loci) was specifically amplified and quantified by thei r own set of primers and probes. Amplification signals were 107-fold lower when other sets of primers and probes were applied. This level of specificity for primers and probes thus o ffers a precise means of detecting and quantifying each invertase, even when some members are highly represented relative to others. Since specific antibodies for these glycosylated acid inve rtases have been difficult to generate, expression profiles of their mRNAs can provide important clues for the roles of these Arabidopsis acid invertase genes. Expression Profile of Acid In vertase Genes in Arabidopsis Previous work by Kreis and coworkers (Tymowska-Lalanne and Kreis, 1998a) used northern blot and RT-PCR analyses to ch aracterize relative changes in expression of different invertases. Later, initial work with non-Q-RT-PCR provided additional information on patterns of expression for cell wall invertases in seedlings, rosette leaves, flowers and developing seeds (Sherson, et al., 2003). Although these data provided valuable insights into relative changes for a given gene, it was still not possible to compare contributions from different genes. Here, quantification of specifi c transcripts is provided by in vitro -transcribed, sense RNA transcripts that have been prepared for standard curves under either a T3 or T7 RNA polymerase promoter. Levels of each target mRNAs are calculated as the percentage of total mRNAs, and therefore a llows levels of mRNAs from different genes to be compared. There are two assumptions for this presentation. Fi rst, mRNAs comprise

PAGE 39

28 3% of total RNA. Second, av erage size of mRNA molecule s is 3000 bp. In this study, 200 ng of total RNA was applied in each sample for analyses of real-time quantitative RT-PCR. Therefore, 10-3 % mRNA in the following data indicated 6 x 10-11 nmole invertase transcripts (3.6 x 104 molecules) present in each 200 ng total RNA. Values are standardized to 18S rRNA to eliminate error from sample loading, and 18S rRNA level in 200 ng of total RNA extracted from untreated wi ld-type plants was used as an arbitrary standard, and the standard deviation from levels of 18S rRNA in all sa mples tested in this study was less than 0.3. Figure 3-5 shows the mRNA levels of 8 aci d invertase genes in different organs from 5-week-old Arabidopsis plants (values are standardized to 18S rRNA). Plants at this stage of development were used to conc urrently sample rosette leaves, cauline leaves, stems, flower buds, flowers, siliques, and root s. Each invertase mR NA was detected in a unique pattern among these organs. In ge neral agreement with previous findings, expression patterns of invertase family me mbers fell into two overall groups, organspecific or broadly expressed. The AtcwINV2 and AtcwINV4 mRNAs were highly abundant in flowers; suggesting a potentially significant contribution to reproductive development. The mRNA expression profile s for these two genes were very similar, however the AtcwINV4 mRNAs were 30to 50-fold more abundant than those of AtcwINV2 . The AtcwINV5 and AtcwINV6 (At5g11920) were the major invertase transcripts expressed in roots. Two cell wall invertases ( AtcwINV1 and AtcwINV3 ), and both vacuolar invertases, ( AtvacINV1 and AtvacINV2 ), were broadly expressed in leaves, roots, flowers and siliques. For AtcwINV1 , expression was greatest in flowers, less in roots, lowest and minimal in other tissues. The AtcwINV3 mRNAs were present at

PAGE 40

29 modest levels in sink tissues (stems, roots, and reproductive structures), but were low in photosynthetic leaves. In most instances, mRNAs for vacuolar invertases were much more abundant than those of cell wall forms. Transcripts of the vacuolar AtvacINV1 were relatively abundant in all tissues especially in roots, flowers and flower buds. For the vacuolar AtvacINV2 mRNA, levels were greatest in leaves and least in roots. Figure 3-6 shows the respective contributi on by each invertase gene to the total acid invertase mRNA level of above-ground ve getative organs. In each instance, the vacuolar invertases contributed over 77% of the total acid in vertase transcripts, and this rose to over 95% for rosette leaves. For ro sette and cauline leaves, levels of vacuolar invertase transcripts were about 9to 18-fold greater than those of all the other cell wall invertases combined (Figure3-6). Leaf sa mples from younger plants (2-wk-old) were further analyzed and mRNA levels of both v acuolar invertases we re also found to be abundant at this stage (Figure 3-7). Compared to rosette le aves from 5-wk-old plants, AtvacINV1 transcript levels were typically about 4-fold grea ter in leaves from the younger plants. In contrast, AtvacINV2 mRNAs were about 4-fold less prevalent in rosette leaves of young plants than more mature ones. Discussion One contribution of this study is its esta blishment of a method for gene-specific RT-PCR quantification of mRNA levels from each of the 8 acid invertase genes in Arabidopsis. In the course of developing this system, the invertase genes and their syntenic contexts were also compared at a molecular level. In addition, expression of each gene was individually quantified so that their respective contributions at the mRNA level could also be compared.

PAGE 41

30 The 8 acid invertase genes of Arabidopsis include 2 vacuolar and 6 cell wall isoforms. Alignment of amino acid sequen ces for these genes (Figure 3-1) showed extensive sequence similarities between them, and confirmed the pres ence of conserved motifs from other known acid invertases. Ji et al. (2005) pointed out 5 amino acid residues in conserved motifs that consiste ntly differ between cell-wall and vacuolar invertases. In Arabidopsis, 4 amino acid residues fit their mo del. In Figure 3-1, these residues are I/M in motif 5, P/V in motif 7, G/ S in motif 9 and G/A in motif 13. The fifth amino acid residue is S/A in motif 4, but the Arabidopsis cell wall invertase, AtcwINV5 , contained an A in this position, as observed fo r two vacuolar invertases. It is not clear whether these differences are functionally si gnificant. Although changes in the P/V of motif 7 can alter the pH optimum and substr ate specificities of invertases (Goez and Roitsch et al., 1999), it is more difficult to e nvision a mechanism for functional effects of an S/A shift in an enzyme that is theoreti cally not subject to ph osphorylation. On the other hand, ClustalW analysis cl early separated the Arabidopsis vacuolar invertases from cell wall invertases using ot her criteria (Figure3-2). The genomic organization of invertase loci also showed similar gene arrangements and syntenic relationships within the vacuol ar and cell-wall subgroups (Figure 3-3). The positioning of these upand down-stream genes re lative to the invertases is consistent with the theory of segmenta l duplication (Kowalski et al., 1994), and observations by Paterson et al. (2000) that tw o-thirds of the Arabidopsis genome has been duplicated. With the exception of AtcwINV6 , a similar order of neighboring genes was found for each of the vacuolar invertase ge nes and a different set of ne ighbors was identified for cell wall invertase genes ( AtcwINV2 and AtcwINV4 were each flanked with one set of similar

PAGE 42

31 neighbors, and AtcwINV3 shared another set of similar neighbor genes with the AtcwINV1+AtcwINV5 tandem repeat (Figure 3-3). The known genomic structure, together with parallels in mRNA expressi on of invertase gene family members in different species provides clues to the evolution of these gene families. Spatial expression of Arabidopsis acid i nvertase genes was examined in various organs by quantitative real time RT -PCR. Two cell-wall invertase genes ( AtcwINV1 and AtcwINV3 ) and two vacuolar invertase genes ( AtvacINV1 and AtvacINV2 ) were expressed in all organs tested. The AtcwINV2 and AtcwINV4 cell-wall invertase mRNAs predominated in reproduction organs, whereas AtcwINV5 and AtcwINV6 transcripts were the most prominent in roots (Figure 3-5). Among all organs analyzed from 5-week-old plants, flowers and flower buds had the highe st levels of total acid invertase mRNAs. These were contributed primarily by the AtcwINV2 and AtcwINV4 cell wall invertases. The abundance of invertase mRNAs in reproductive sinks is cons istent with the extent of sucrose use typically evident for these st ructures. In 5-week-old Arabidopsis plants, flowers are expanding and young siliques are be ginning to grow. The preponderance of AtcwINV2 and AtcwINV4 mRNAs in flowers al so indicates a capacity for these genes to be involved in in carbohydrat e partitioning and establishmen t of metabolic sinks during reproductive onset. The high levels of AtcwINV2 and AtcwINV4 cell wall invertase mRNAs observed here in flowers and siliques may be analogous to those observed for the LIN5 and LIN7 invertase mRNAs in tomato. These mRNAs are detected only in reproductive organs of tomato, where Lin5 is highly expressed in ovaries and fruits, and LIN7 is detected only in stamens and pollen (Fridman and Zamir, 2003). In addition, genes encoding a 40S

PAGE 43

32 ribosomal protein are found down stream of both the tomato and Arabidopsis genes for the floral cell-wall invertases, indicating a micro-syntenic rela tionship (Fridman and Zamir, 2003). More in-depth analysis of AtcwINV2 and AtcwINV4 expression in reproductive organs of Arab idopsis is in progress. The AtvacINV2 mRNAs predominated over other vac uolar invertase transcripts in mature rosettes, typically at levels 4-fold greater than those of AtvacINV1 (Figure 3-7). A major soluble acid invertase wa s also purified from mature Arabidopsis leaves by Tang et al (1996) and the N-terminal amino-acid sequence of this protein showed a high homology to AtvacINV2 (10 residues, out of 11-amino-acid-sequence, were identical). This soluble invertase (pr obably AtvacINV2 ) was able to bind to Concanavalin Asepharose (indicating it was glycosylated) and the Km for sucrose found to be 12 mM (Tang et al., 1996). In summary, a quantitative RT-PCR met hod has been developed here that is specific for mRNAs from each of the 8 acid invertases in Ar abidopsis. It has allowed characterization and comparison of contributions by each acid invertase gene to different organs. Direct comparison of mRNA quantities in this st udy showed that the most abundant acid invertase mRNA in any tissue was that of the AtcwINV4 cell wall invertase in flowers. This high expressi on level is consistent with a potentially important role in reproductive organs. In addition, AtcwINV6 and AtvacINV1 mRNAs were found to be the most abundant invertase transcripts in root s. In 5 week-old Arabidopsis plants, the two vacuolar invertase mRNAs ( AtvacINV1 and AtvacINV 2) accounted for 77%, 90% and 95% of total acid invertas e mRNAs in stem, cauline and rosette leaves, respectively. Profiles of expression for indivi dual invertases provide clues to their functional roles. In

PAGE 44

33 addition, the microsyntenic orde r around invertase genes in th is study should facilitate structural and functional comparisons of each to their orthologues in other species. Finally, development of this system for quantif ying expression of the entire acid invertase gene family of Arabidopsis provides a plate form for testing divers e effectors of this pivotal point in central metabolism and resource allocation.

PAGE 45

34 Table 1 Gene specific primers and probes designed fo r Taqman real-time RT-PCR of predicted Arabidopsis acid invertase genes: Sequences are written left to right from 5Â’ to 3Â’.

PAGE 46

35Figure 3-1 Multiple alignment of the Arabidopsis acid invertase gene family. Five of the eight, full-length cDNA sequences (AtcwINV1 through AtcwINV5) were cloned in the course of th e present study. Arrows show the four amino acid residues proposed by Alberto et al. ( 2004) to be essential for rec ognition and stable binding of th e sucrose substrate. Well conserved regions from known acid invert ases are underlined and numbered (Ji et al., 2005). Identical residues are shaded in black, and similar residues are shaded in gray. Dashes are gaps introduced to maximize alignment. The alignment was produced with Multalin (Corpet, 198 8) and the figure with BoxShade.

PAGE 47

36

PAGE 48

37 Figure 3-2 An unrooted phylogenetic tree of the Arabidopsis acid invertase gene family based on amino acid sequence similarities of coding regions (generated by PhylipÂ’s Drawgram). Values beneath each gene indicate predicted length of its peptide product. There are two v acuolar invertases (designated as AtvacINV) (location of AtvacINV2 wa s confirmed by Rojo et al., 2003 and activity of AtvacINV was confirmed by Stessman, 2004). There are also six cell wall invertases (designated as AtcwINV) (invertase activity has been confirmed for AtcwINV1 but recombinant AtcwINV3 and AtcwINV6 showed only fructan exohydrolase activity in a heterologous y east system [De Coninck et al., 2005] ).

PAGE 49

38 Figure 3-3 Genomic orga nization of invertase loci in Arabidopsis . Each block represents an open reading frame. Similar patterns denote proba ble homologs. A rooted tree of Arabidopsis acid inve rtases is shown at the left . Direction of each gene (5Â’ to 3Â’) is indicated by the arrow heads.

PAGE 50

39 Figure 3-4 Specificity for individual members of an Arabidopsis ac id invertase gene family by each set of probes and prim ers for TaqMan real-time PCR (A). Fifty pg of each cloned invertase cDNA was added per reaction in pairwise tests against each of the other prob e-primer sets. Based on the same florescence threshold requirement, CT values were determined by quantitative, real-time PCR for each probe-primer set. Under maximal CT=40, one CT cycle between target cDNA converted to two orders of magnitude. Data show equal amounts of fluorescent signal produced by 50pg of each gene. (B) Sequence similarities among acid invertase cDNAs.

PAGE 51

40 Figure 3-5 Quantified mRNA levels for acid invertase family me mbers expressed in different organs of 5-week-old Arabidopsis thaliana plants grown in soil at 22°C, with a 16-h photoperiod. Values were obtained using Taqman-based, quantitative RT-PCR analyses conducted with gene-specific probe-primer sets as shown in Fig 3-4. For analyses, 200 ng of total RNA were used from each sample (extracted from rosette leav es, cauline leaves, stems, flower buds, flowers, siliques or roots). Specific amplicons were used to detect mRNA expression levels of six cell wall invertase genes, AtcwINV1~6 , and two vacuolar invertase genes, AtvacINV1 and AtvacINV2. Values are expressed as percentages of total mRNA and were normalized relative to 18S rRNA . Error bars indicate standard errors from thr ee biological replicat es. Note different units on the Y axes.

PAGE 52

41 Figure 3-6 Quantified contributi ons by individual aci d invertase family members to total mRNA encoding these enzymes in vegeta tive organs of Arabidopsis. Plants were grown in soil for 5 weeks at 22°C with a 16-h photoperiod. Values were obtained using Taqman-based, quantita tive RT-PCR analyses conducted with gene-specific probe-primer sets as show n in Fig 3-4. For analyses, 200 ng of total RNA were used from each sample (e xtracted from rosette leaves, cauline leaves or growing stems). Specific amplicons were used to detect mRNA expression levels of six cell wall invertase genes, AtcwINV1~6 , and two vacuolar invertase genes, AtvacINV1 and AtvacINV2. Values are expressed as percentages of total mRNA and were normalized relative to 18S rRNA .

PAGE 53

42 Figure 3-7 Quantification of mRNA for vacuol ar invertases in vegetative organs of Arabidopsis plants. (A) 2-wk-old Ar abidopsis plants on sugar-free 1/2MS medium under a 12h light/dark cycle at 25 °C. Leaf samples were collected as shown, from cotyledons (Cot ), first leaves (L1), s econd leaves (L2), third leaves (L3) and fourth leaves (L4). Values were obtained using Taqmanbased, quantitative RT-PCR analyses c onducted with gene-specific probeprimer sets as shown in Fig 3-4. For analyses, 200 ng of total RNA were used from each sample (extracted from coty ledons, first leaves, second leaves, third leaves and fourth leaves). Specific amplicons were used to detect mRNA expression levels of two vacuolar invertase genes, AtvacINV1 and AtvacINV2. Values are expressed as percentage s of total mRNA and were normalized relative to 18S rRNA . Error bars indicate standard errors from three biological replicates. Note different units on th e Y axes. (B) Tissues from maturing, 5wk-old Arabidopsis plant grown in soil at 16 h light/ 8 h dark cycle at 22 °C. Tissue samples were collected as shown, from rosette leaves, cauline leaves or growing stems. The mRNA levels of AtvacINV1 and AtvacINV2 in rosette leaves, cauline leaves and stems are as described in (A).

PAGE 54

43 CHAPTER 4 SUGAR REGULATION OF VACUOLAR INVERTASE GENES Introduction Many genes respond to changes in the e ndogenous sugar environment. Some genes are induced by sugars, whereas others are repressed (Koch, 1996). In general, genes affecting storage processes and carbon utiliz ation are up-regulated by sugars. Examples include patatin and ADP-Glc pyrophosphorylase in growing potato tubers (Jefferson et al., 1990; MüllerRöber et al ., 1990). In contrast, genes encoding enzymes for photosynthesis are typically repressed by sugars , such as previously observed in maize and Arabidopsis (Sheen 1990; Jang and Sheen 1994; Xi ao et al., 2000). Sugars are therefore proposed as signal molecules that modulate gene expression. Sucrose is the major transport sugar in vascular plants and al so regulates a number of genes. Sucrose is readily cleaved into hexoses in plant cells, so in many cases, elevated hexose levels may be a direct result of enha nced sucrose import. Sugar sensing has been proposed to occur via several mechanisms in plants (Koch, 1996; Halford and Paul, 2003; Rolland and Sh een, 2005). A sugar molecule could be sensed extracellularly via a membrane-bound receptor molecule or intracellularly by different aspects of sugar metabolism. Hexose transporters facilitate the uptake of monosaccharides, but in yeast, some of th ese have also been shown to function as membrane sugar sensors (Özcan et al., 1998). A signaling role for these transporter-like glucose sensors can also include a G pr otein–coupled recepto r (Johnston, 1999). In

PAGE 55

44 plants, an analogous dual function has been s uggested for involvement of sugar carriers in glucose signaling (Lalonde et al., 1999; Lalonde et al., 2004). Another putative sugar sensing system a ppears linked to hexokinases, and can initiate intracellular sugar signals in plants (Jang et al., 1997; Xiao et al., 2000; Rolland and Sheen., 2005). Mannose and 2-deoxyglucose are substrates for hexokinase, but are minimally metabolizable in most plants (Kle in and Stitt, 1998). Both hexose analogs repress photosynthetic gene expression, consistent with their perturbation of a hexokinase dependent pathway (Jang and Sheen, 1994). However, these two glucose analogues would also be expected to deplete phospha te levels and alter AMP/ATP ratios. Two other glucose analogs, 3O -methylglucose and 6-deoxyglucose, are commonly used to identify hexokinase-independent gene activation, because they can be transported but not phosphorylated by hexokinase (Jang and Sheen, 1994). Expression of at least one cell wall invertase gene, for example, is enhanced by 6-deoxyglucose in Chenopodium rubrum suspension cells (Roitsch et al., 1995), indicating the presence of hexokinaseindependent pathways in plants. Another cell wall invertase gene, CIN1 ( AtcwINV1 ), remains unaffected in young Arabidopsis plants by either overexpression or antisense reduction of the AtHXK1 hexokinase (Xiao et al., 2000) . One hexokinase-independent system also appears to involve SnRK1 , a SNF1-related kinase, which regulates sugar induction of a sucrose synthase gene in potato (Purcell et al., 1998). Both hexokinasedependent and -independent pathways were found to be involved in upas well as downregulation of gene expression in rice (Ho et al, 2001). Reciprocal sugar responses have been observed within some gene families, especially those mediating su crose use (Koch et al., 1992; Xu et al., 1996). Steady-state

PAGE 56

45 levels of mRNA from one ma ize vacuolar invertase ( Ivr1 ) are decreased by glucose, whereas those of anothe r vacuolar invertase ( Ivr2 ) are increased (Xu., et al 1996). Theoretically, this opposite sugar response by vacuolar invertase genes is not maizespecific and is likely to occur in other species as well. This hypothesis was tested in the present study by analyzing sugar responses of the Arabidopsis vacuolar invertase genes. In addition, sugar signaling m echanisms and possible roles were dissected by chemical and environmental perturbations. Reciproc al regulation was indeed observed at the mRNA level for the vacuolar invertases of Arabidopsis ( AtvacINV1 being up-regulated and AtvacINV2 down-regulated). The appare nt glucose repression of AtvacINV2 was rapid and clearly evident with in 30 min in young Arabidopsis plants. However, analyses presented here indicated that much of th is repression may be due to glucose-based destabilization of the AtvacINV2 mRNA. Glucose induced the AtvacINV2 promoter (as observed for the other invertases), but cordycepin blockage of transcription indicated that AtvacINV2 mRNAs were destabilized by glucose. Work here thus indicates that reciprocal responses of the vac uolar invertases to sugars can be rapid, probably involves mRNA stability, and occurs across multiple species. A precise balance of expression for these genes is evident during their responses to different conditions. Materials and Methods Plant Material Arabidopsis thaliana (Col-0) seeds were surface-sterili zed and soaked in sterilized distilled water for 4~5 d at 4 C in the dark. Seeds were so wn on half-strength Murashige and Skoog (MS) medium (Cat.10632-057, pH 5.8, GIBCOBRL, U.S.A.) solidified with 0.16% (w/v) phytagel. The typical sugar suppl ement for enhanced plant growth was omitted. Plantlets were cultured under cycles of 12-h light (80 µmol m-2s-1) and 12-h

PAGE 57

46 dark at 25 C. After 2 weeks, they were transf erred to 1/2 MS minimal liquid medium without sugar for 24h in the dark, at 56 rp m before testing responses pharmaceutical agents. All plant material was immediately frozen in liquid nitrogen after harvesting, and stored at –80 °C prior to RNA or sugar extraction. Soluble Sugar Detection Leaf samples were homogenized in 1 mL of extraction solution (80% ethanol, 4 mM HEPES-NaOH, pH 7.5) and placed in a boiling water bath for 20 min. Samples were then cooled briefly and centrifuged at 13,400 g for 5 min. The soluble fraction was then transferred to a new tube and saved, wh ile 1 ml of extraction solution was added to the insoluble fraction, vortexed briefly, and placed a boiling water bath for another 20 min. After centrifuging, the soluble fractions from these two extractions were pooled together, dried, dissolved in 250 µl of water, and extracted with 250 µl of chloroform to remove chlorophyll. After centrifuging at 13,400 rpm for 5 min, the aqueous fraction was transferred to a new tube and analyzed fo r soluble sugar content. Sucrose, glucose, and fructose were analyzed using a Sucros e/D-Glucose/D-fructose kit (Roche Applied Science, Indianapolis, IN). Genomic PCR of AtvacINV2::GUS Plants To obtain the AtvacINV2 promoter region, PCR was conducted using the following primers on genomic DNA. The forward primer was AAGCTT GGACACCGATTCCTGTGACACG ( Hind III); the reverse primer was GCGGATCC TGGCAAGAGAGCATCGGAGCTCGC ( Bam HI). The product was digested with Hind III and Bam HI, and cloned into a pBI121 vector (digested with Hind III and Bam HI) together to generate a AtvacINV2 :: GUS construct. Transgenic AtvacINV2 :: GUS plants were obtained by the Agrob acterium-mediated floral dip method

PAGE 58

47 (Clough and Bent 1998), and transformants were selected on kanamycin-containing media (Personal communication with Stessman, D.). Transgenic seeds containing AtvacINV2 :: GUS were gifts from Dr. S Rodermel. Genomic PCR analysis was conducted to confirm a 1379bp-DNA fragment that included the junction of promoter and GUS, usi ng AtVIP2-5 (5'TCTCTCTTCCAGCGAAGC 3') as a specific primer for the 3’ end of the AtvacINV2 promoter and GUSR (5'CTGTAAGTGCGCTTGCTGAG-3') as a specific primer for the GUS gene. GUS Histochemical Assay Leaves were fixed in 90% acetone for 10 min and rinsed in a solution of 50 mM NaPO4 (pH 7.0), 0.4 mM K4Fe(CN)6 3H2O, and 0.5 mM K3Fe(CN)6. Samples were vacuum-infiltrated for 10 min in a 50 mM NaPO4 (pH 7.0) buffer containing the GUS substrate, 2 mM X-Gluc (5 -bromo-4-chloro-3-indolyl b -D-glucuronic acid), and incubated at 37°C for 16 h. Chlorophyll was removed from samples by soaking each in 70% ethanol (changed three time s) for a total of 24 h. Samples were photographed under a dissecting microscope (Leica MZ 125, Leica, Bensheim, Germany). One Step RT-PCR To detect levels of AtvacINV2 and GUS transcripts in AtvacINV2 :: GUS transgenic plants, a one-step RT-PCR strategy was undertaken with ATB4-3endLP(5'GTTGGGATGACTGCCAGTTT-3') and ATB4-3endRP(5'ACGGACAGCTTCGTCAGAGT-3'), as specific primers for AtvacINV2, to generate a 858 bp cDNA-fragment. For GUS transcrips, GUSF (5'ACCGTTTGTGTGAACAACGA-3') and GUSR (5'-CTGTAAGTGCGCTTGCTGAG3') were used to amplify a 780 bp DNA fragment. TublinFP (5'CTCAAGAGGTTCTCAGCAGTA-3') and TublinRP (5'-

PAGE 59

48 TCACCTTCTTCATCCGCAGTT-3') were used as gene specific primers for Tubulin , and were applied to amplify a 483 bp DNA fragment. RT-PCR reactions were conducted with S uperScript™ One-Step RT-PCR System with Platinum® Taq DNA Polymerase (Invitrogen, Carlsb ad, CA) using 0.2 µ g of total RNA isolated from 2-wk Arabidopsis young pl ants. The amplified cDNA fragments were analyzed electrophoresis in a 1 % ag arose gel and stained with EtBr. Quantification of Invertase Transcripts by Real-Time PCR Total RNA was extracted from three sa mples of different plants from each treatment. RNeasy Plant Mini Kits (Qia gen, Valencia, CA) were used, followed by treatment with DNase (DNA-free Kit, Ambion, Austin, TX). Real -time quantitative RTPCR was conducted using 200 ng of RNA in 25µ L reactions with Taq-Man one-step RTPCR master mix reagents as described in chapter 3. Results Sugar Regulation of Va cuolar Invertase Genes To characterize the sugar responses of vac uolar invertase genes in Arabidopsis, 2week-old plants were transferred to half-s trength MS liquid medium either with or without 1% sucrose, and incubated in the dark for various lengths of time (Figure 4-1). Within 24h, AtvacINV1 mRNAs accumulated to levels almost two-fold greater under +sucrose conditions than in sugar-free medium . The difference increased to 4-fold by 48h, almost entirely because AtvacINV1 mRNA levels continued to increase in sucrosesupplemented plants. In contrast, AtvacINV2 mRNA accumulated in sugar-free medium, 3-fold more than sucrose-supplemented medi a within the first 24h, and by nearly 2-fold within 48 h. To determine whether sugar re sponses of vacuolar invertase genes were dosage dependant, Arabidopsis plants were in cubated on half-strength MS liquid medium

PAGE 60

49 with 0, 1, 3 or 5 % sucrose (Figure 4-1). For AtvacINV1 , mRNA levels showed a parallel relation to the concentration of sucrose, with 5% sucros e promoting an approximate 4fold increase in transcript abundance. Although AtvacINV2 mRNA levels were decreased by sugars, there appeared to be a threshold effect. AtvacINV2 transcript levels dropped by about 2-fold with addition of anywhere from 1 to 5 % sucrose. In sucrose-feeding experiments such as th ese, sugar responses may arise directly from sucrose or from the hexose products of its hydrolysis. Two approaches were used to simplify interpretation of subsequent experi ments. One was to observe changes in expression under dark starvation (Figure 4-2) and second was to test expression after feeding glucose and sugar anal ogs (Figure 4-3, -4 and -9). For the first approach, 2-week-old Arabi dopsis plants, grown on half-strength MS sugar free medium under a 12-h photoperiod, were separated into two groups. One was covered with foil for an additional 9 h to pr ovide a total of 24 h in the dark (Dark-24h); while the other group was grown under the orig inal photoperiod (Light-9h) (Figure 4-2). Aerial parts of plants were then collected a nd levels of sucrose, glucose, and fructose determined. Compared to plants grown under the standard 12-h dark /light cycle, those subjected to 24h of darkness s howed a 2-fold repression of AtvacINV1 mRNA levels (Figure 4-2B), and a 3-fold induction of AtvacINV2 mRNAs (Figure 4-2C). Glucose and fructose levels dropped markedly in the darkened plants, wher eas sucrose content remained relatively similar (Figure 4-2D). In the second approach, responses of th e vacuolar invertase genes were followed over time in 2-week-old Arabidopsis plants fi rst transferred to suga r-free, half-strength MS liquid medium and incubated in the dark for 2 d, then supplemented with glucose.

PAGE 61

50 The dark treatment was provided to deplete endogenous sugars. Samples were collected throughout this period and immediately after glucose addition. Levels of AtvacINV1 mRNA decreased under starvati on conditions and rose afte r 6h of glucose treatment (Figure 4-3A). In contrast, AtvacINV2 transcripts were 2 to 4-fold higher after sugar starvation and were repressed by glucose to barely-detectable levels in less than 3h (Figure 4-3B). A shorter, more focused time-course of the glucose response was thus conducted for the 3-h period (Figure 4-4). Rapid repression was observe d, with only 30 % of AtvacINV2 mRNAs remaining after the first 30 min (Fi gure 4-4B). Glucose induction of At vacINV1 , however, had not yet become evident (Figure 4-3A). Glucose, ABA and Ethylene Responses of the Atvacinv Genes ABA and ethylene can both modulate overa ll carbon status during early seedling growth and development (Gazzarrini and McC ourt, 2001) and both can reportedly affect invertase gene expression (Tr ouverie et al., 2003). Responses of the vacuolar invertases in Arabidopsis were thus used to test the degree of influence exerted by these effectors and the extent to which thes e interacted with sugar avai lability. Young plants were treated with or without glucose alone or in combination with ABA (Figure 4-5) or the ethylene precursor, ACC (Figure 4-6). The AtvacINV1 mRNAs were induced by not only glucose, but also by ABA. However, co-t reatment with glucose and ABA together decreased the AtvacINV1 mRNA level, compared to ABA treatment alone (Figure 4-5). Signal crosstalk between sugar and ABA t hus compromised the extent of overall induction of AtvacINV1 by ABA. ABA induction was also observed for AtvacINV2 , and was most pronounced in the absence of a glucose supplement. Repression of AtvacINV2 was greatest when both ABA and glucose were present. Both vacuolar invertase genes

PAGE 62

51 thus responded inversely to sugar, but we re maximally up-regulated by ABA alone. A significant role of ABA is thus implied for regulation of both AtvacINV1 and AtvacINV2 . To test the ethylene responses of these ge nes, ACC (a precursor of ethylene) was added to the liquid culture medium. ACC slightly up-regulated AtvacINV1, but the presence of glucose negated this response (Figure 4-6). Levels of AtvacINV2 transcripts were unaffected by ACC (Figure 4-6). Alt hough ABA and ethylene in teract closely in many aspects of plant biology, the ABA effects on vacuolar invertase genes was essentially ethylene-independent. Glucose Repression of Atvacinv2 Among the expressed acid invertases in Arabidop sis vegetative organs, AtvacINV2 was the only one down-regulated by glucose, wh ile others were up-regulated (Chapter 5, Figure 5-11). The glucose repression of AtvacINV2 was also more rapid. Transcriptional and/or posttranscriptional regu lation may be involved in this glucose repression of AtvacINV2 . To address this question, sugar respon ses were tested using transgenic plants with an AtvacINV2 promoter fused with a GUS repor ter (from Dan Stessman and Steve Rodermel). The promoter region of AtvacINV2 was amplified by PCR from genomic DNA, with the resulting 1358-bp product ex tending 27 bp downstream of the predicted translation start site (at +1). The predicte d TATA box was located at -81. This promoter was ligated in frame with a full length GUS re porter. A set of primers, was designed for amplification of the region between the AtvacINV2 promoter and GUS coding sequences. PCR products containing the AtvacINV2 promoter::GUS juction (around 1.5Kb) were generated when genomic DNA extracted from the AtvacINV2 :: GUS lines was utilized as a template, but not when DNA from the native AtvacINV2 of Col-0 was used (Figure 47B). GUS activity was assayed in leaves from individual plants of all six transformed

PAGE 63

52 lines. Positive staining furthe r confirmed expression of the AtvacINV2 :: GUS construct in transgenic lines (F igure 4-7C). Sugar responses of the AtvacINV2 promoter-GUS construct were tested using leaves detached from 2-week old transgenic pl ants. These were firs t depleted of sugars by incubation in half-strength MS liquid medi um minus sugars for 42h in the dark. They were then fed either D-Glucose or L-Gl ucose (non-metabolizeable). The endogenous AtvacINV2 was down-regulated by DGlucose, whereas the GUS reporter, driven by the AtvacINV2 promoter was up-regulated (Figure 4-7D). The length of the AtvacINV2 promoter tested here (1358bp) was thus activated by D-Glucose, but the native AtvacINV2 mRNA was not able to accumulate under the same conditions. A posttranscriptional mechanism of regulation may be involved and could result in destabilization of AtvacINV2 transcripts under conditions of sugar abundance. To test this hypothesis, 0.6 mM Cordycepin was used to block transcription of new mRNA (Gutierrez et al., 2002), so that longevity of exis ting transcripts could be monitored. After Cordycepin treatment, only 24.0±1.5 % of AtvacINV2 mRNA was left in leaves from the glucose-contai ning medium, while 45.5±4.0 % of the AtvacINV2 mRNA still remained in the mannitol-containi ng medium (Figure 4-8A). The longevity of AtvacINV2 mRNA was thus shorter when glucose was more abundant. Two plant mRNA instability elements, DST (downstream element) identifiable by ATAGAT and GTA regions (Sullivan and Gr een., 1996) were identified in the 3’UTR region of AtvacINV2 ; one was 32bp downstream of the stop codon and the other one was 151bp away from the stop codon (Figure 4-8B). DST elements have been reported to be

PAGE 64

53 necessary for RNA instability in plan ts (Sullivan and Green, 1996). These cis -elements may contribute to destabilization of AtvacINV2 mRNA in the presence of glucose. Sugar Regulation of AtvacINV2 Mechanisms of sugar signaling that c ould contribute to repression of the AtvacINV2 vacuolar invertase were tested using glucose and su crose analogs. The sucrose isomers, palatinose and turanose, ar e reportedly not transported into soybean cotyledons or tomato suspension cells (M'Bat chi and Delrot, 1988; Si nha et al., 2002). To determine whether either of these non-me tabolizable sucrose isomers could affect levels of AtvacINV2 mRNA, 30mM palatinose or turano se were added to sugar-depleted, 2-wk-old plants, and incubate d for 8 h. A decrease in AtvacINV2 mRNA levels was observed in response to both sucrose isomers, and its extent was the same as observed for sucrose (Figure 4-9). Results implied involve ment of extracellular disaccharide sensing. To determine whether glucose or its an alogs could also reduce levels of AtvacINV2 transcripts, effects of these sugars were te sted in the same experimental system used above (Figure 4-9). Mannitol was applied as a control to rule out an osmotic induction. Decreases in AtvacINV2 mRNA levels by glucose were mimicked by 2-deoxyglucose, which can be phosphorylated by hexokinase, bu t not further metabolized. In contrast, abundance of the AtvacINV2 transcripts was unaffected by the glucose analog, 3-omethylglucopyranose, which reportedly cannot be phosphorylated by hexokinase. Expression of AtvacINV2 remained similar to that in the mannitol control. Collectively, these data indicate that the glucose repression of AtvacINV2 is subject to input from both membrane-based disaccharide sens ors and hexokinase-linked signals.

PAGE 65

54 Discussion Sugars, especially sucrose and glucose, serve not only as the carbon source for plant growth but also signal molecules to regulate gene expr ession involved in photosynthesis and storage (Koch 1996). Induc tion of cell wall invertase genes by sugar has been reported in tobacco, tomato and Ar abidopsis (Krausgrill et al., 1996; Godt and Roitsch, 1997; Tymowska-Lalanne and Kreis, 1998a). All thr ee cell wall invertase transcripts analyzed here (Figure 5-9) were induced by glucose. The induction of cell wall invertase transcripts is not represse d by their enzyme-reaction product, glucose, which is potentially advantageous for maintain ing or enhancing the ra te of hydrolysis for imported sucrose. Activity of acid invertases in the cytosolic fraction of Chenopodium rubrum suspension cultured cells is not affected by gluc ose, but that of acid invertases in the cell wall fraction is induced (Roitsch et al., 1995). Based on a complex pattern of glucose regulation shown here for acid invertases of Arabidopsis, glucose can induce one vacuolar invertase while repres sing another. Similar results have also been observed for vacuolar invertases of maize (Xu et al ., 1996). In these instances, and possibly for C. rubrum as well, the net balance of vacuolar inve rtase activity would not be altered during these reciprocal responses to glucos e treatment at the mRNA level. Sugars specifically up-re gulate some members of th e invertase and sucrose synthase gene families while repressing others. This was initially reported in maize, where carbohydrate deprivation upregulates expression of the Ivr1 vacuolar invertase and Sh1 sucrose synthase, and sugar abunda nce increases mRNA levels of the Ivr2 vacuolar invertase and Sus1 sucrose synthase (Koch et al. 1992; Xu et al. 1996). In the present study, two vacuolar invertase genes in Arabidopsis also exhibited contrasting

PAGE 66

55 patterns of sugar induction and repression, implying a ge neral dichotomy of sugar regulation for vacuolar invertase genes ex ists among monocot and dicot species. Among all acid invertase genes reported so far, the sugar repressed forms are only found in a subgroup of vacuolar invertase gene s (all known cell wall invertase genes were induced by sugar). In additi on to examples shown in maize and Arabidopsis, sugar repressed vacuolar invertase genes are also found in toma to (Godt and Roitch, 1997) and rice (Huang, data not shown). Activity of vac uolar invertases in petioles of sugar beets are found to oscillate in parallel with levels of glucose and fructo se, all reaching minimal levels at the end of the light period and in creasing during the ni ght (Gonzalez et al., 2005). A model for cell elongation in Arabidops is has been proposed by Harmer et al. (2000), who suggest that cell wall loosening and expansion may occur during the night, followed by cell wall synthesis to reinforce th e enlarged cell period. They base their model on responses of 8,000 Arabidopsis genes in the hypocotyls of young seedlings. Hydrolysis of sucrose to glucose and fructose doubles the osmotic pr essure; therefore, the dark-induced, sugar repressed form of vac uolar invertases could aid cell elongation process at the night. Interpretation of the sucr ose repression observed for AtvacINV2 in response to direct addition of sucrose (Figure 4-1) was complicated by the ready cleavage of sucrose to hexoses throughout the plant. The non-me tabolizable sucrose analogs, palatinose and turanose, were applied here to investigate di saccharide-specific signa ling (Loreti et al., 2000; Fernie et al., 2001; Sinha et al., 2002) . These sucrose isomers differ in their glycosidic linkage between glucose a nd fructose. Gas chromatography/mass spectrometry of palatinose has shown that it is not metabolized by any of the sucrolytic

PAGE 67

56 activities in potato tuber extracts, including sucr ose synthase or invert ase (Fernie et al., 2001). These two sucrose deriva tives stimulate a strong, tran sient induction of the cell wall invertase, Lin6 , in tomato suspension cells (S inha et al., 2002) and inhibit -amylase in barley embryos (Loreti et al., 2000). The present study showed that the nonmetabolizable sucrose analogs (palatinose a nd turanose), as well as the metabolizable sugars (sucrose, glucose and fructo se), repressed gene expression of AtvacINV2 to similar degrees. These data indicate that the repressi on by sucrose observed here results not only from the hexose cleavage products of sucrose, but also from some degree of disaccharide sensing itself. In addition, responses observed with glucose analogs were also consistent with a contribution by hexokinase to the repr ession of vacuolar invertase genes. The complete genomic sequences of Arabidops is and rice provide an opportunity to compare acid invertase families of dicots and monocots. Two vacuolar invertase genes are evident in both species (J i et al., 2005) and in rice, on e of the vacuolar invertase genes, OsVIN1 , was also repressed by sugar (Huang, da ta not shown). This indicates that sugar repression of at least one vacuolar invertase gene is likely to be conserved across many vascular plants. So too is a post-trans criptional contribution to this regulation, as shown here for the AtvacINV2 vacuolar invertase (Figure 4-8). Sugars can affect plant gene expressi on not only by sugar catabolism but also by sugar signal transduction. A primary line of evidence for this is that nonmetabolizable hexose analogs can affect gene expression. The glucose analog, 2-deoxyglucose, is a substrate for hexokinase but it inhibits production of Gl c-6-phosphate and ATP (Klein and Stitt, 1998). It can be catabolized onl y at relatively low ra te. In contrast, 3-Omethylglucose can be transported into cells but is unable to be phosphorylated (Jang and

PAGE 68

57 Sheen, 1994). In the present study, accumu lation of AtvacINV2 mRNA was decreased by applying 2-deoxyglucose, but not 3-O-methylglucose. This implies that the mechanisms affecting glucose repression of AtvacINV2 mRNA included a HXKdependent pathway. Although a HXK-depende nt sugar sensing pathway has been established, HXK-independent sugar sensing pathways also exist in plants. Expression of the cell wall invertase gene (AtcwINV1, At fruct1) in young Arabidopsis plants, for example, is not affected by overexpression or antisense of hexokinase, AtHXK1 (Xia et al., 2000). The major contributions of this chapter are the contrasting patterns of sugar induction and repression of v acuolar invertase genes found in Arabidopsis, the first reported in a dicot species. Sugar repression of vacuolar invertase, AtvacINV2 , was rapid (within 30 min) and was involved post-trans criptional control. In addition, sugar repression of vacuolar inve rtase is commonly found in both monocots and dicots, and also contained RNA instability elements, im plying similar post-tra nscriptional control would generally exist am ong different species.

PAGE 69

58 Figure 4-1 Sugars up-regulate AtvacINV1 and down-regulate AtvacINV2 . (A and B) 2wk-old Arabidopsis plants were transf erred to sugar-free half-strength MS liquid medium (-S) or medium with 1% su crose (+S) for either 24 or 48 h. (C and D) 2-wk-old Arabidopsis plants were transferred to sugar-free halfstrength MS liquid medium with eith er 1% (29.2 mM), 3% (87.6 mM) or 5% (146.0 mM) sucrose for 24h in the dark. Ae rial parts (rosettes with 7 leaves) were collected for RNA extraction. Ta qman-based quantitative RT-PCR (see text for details) was conducted using 200 ng of total RNA extracted from each sample. Percentage of AtvacINV1 and AtvacINV2 mRNAs in total mRNA is shown. Values were normalized relative to 18S rRNA. Error bars indicate standard errors from three biological re plicates. Note different units on the Y axes.

PAGE 70

59 Figure 4-2 Reciprocal regulati on of the vacuolar invertas es (AtvacINV1 and AtvacINV2) by light/dark treatments that alter soluble sugar levels in 2-wk-old Arabidopsis plants. (A) Time-line for treatments designated “Dark-24h” or “Light-9h”. Plants from both groups were harveste d at the same 24-h point (marked by arrows) and were visually similar at th is time (images at left). Prior to treatments, plants were cultured fo r 2 wks at 25°C under a 12-h photoperiod on sugar-free half-strength MS medium. (B and C) In aerial plant-parts (rosettes shown in A.) respective levels of AtvacINV1 and AtvacINV2 mRNAs were quantified by real-time Q-RT-PCR. Values are expressed as percentages of total mRNA and normalized relative to 18S rRNA . Error bars indicate standard errors from three biological re plicates. (D) Soluble sugar levels in aerial plant-parts.

PAGE 71

60 Figure 4-3 A time-course of responses to glucos e starvation + 50h of recovery (+G) by mRNAs for two vacuolar invertases, (A) AtvacINV1 and (B) AtvacINV2 , in 2wk-old whole Arabidopsis plants. Plants were transferred to sugar-free halfstrength MS liquid medium for 48 h in the dark, then moved to medium with 55.5 mM (1%) glucose. Taqman-based Q-RT-PCR was used to analyze 200 ng of total RNA extracted from each sample. Values were normalized to 18S rRNA . Error bars indicate standard erro rs among three biological replicates, and are too small to be visible where not shown.

PAGE 72

61 Figure 4-4 A time-course of responses to glucose starvation + the first 3h of recovery (+G) by mRNAs for two vacuolar invertases, (A) AtvacINV1 and (B) AtvacINV2 , in 2-wk-old whole Arabidopsis plan ts. Plants were transferred to sugar-free half-strength MS liquid medium for 48 h in the dark, then moved to medium with 55.5 mM (1%) glucose. Taqman-based Q-RT-PCR was used to analyze 200 ng of total RNA extracted from each sample. Values were normalized to 18S rRNA . Error bars indicate st andard errors among three biological replicates.

PAGE 73

62 Figure 4-5 Glucose and ABA responses by mRNAs for two vacuolar invertase genes (A) AtvacINV1 and (B) AtvacINV2 in 2-wk-old Arabidopsis plants. Experiments were initiated by transfer ring plants to sugar-free half-strength MS liquid medium for 72 h in the dark, and then to half-strength MS liquid medium with (+) or without (-) 55.5 mM Glucose (Glc) and / or 5 M ABA for an additional 28 h (also in darkness). Taqman-based Q-RT-PCR was used to analyze 200 ng of total RNA extracted from each sample. Values were normalized to 18S rRNA . Error bars indicate stan dard errors among three biological replicates.

PAGE 74

63 Figure 4-6 Glucose and ACC responses by mRNAs for two vacuolar invertase genes (A) AtvacINV1 and (B) AtvacINV2 in 2-wk-old Arabidopsis plants. Experiments were initiated by transferri ng plants to half-strengt h MS liquid medium with 55.5 mM Glc for 24 h in the dark. Each was washed three times with halfstrength MS sugar-free liquid medium be fore transfer to half-strength MS liquid medium with (+) or without (-) 55.5 mM glucose (Glc) and / or 50 M ACC for an additional 26 h (also in da rkness). Taqman-based Q-RT-PCR was used to analyze 200 ng of total RNA ex tracted from each sample. Values were normalized to 18S rRNA . Error bars indicate standard errors.

PAGE 75

64 Figure 4-7 Analysis of AtvacINV2 promoter::GUS activity in mature Arabidopsis plants and comparison of sugar responsiven ess to the endogenous gene. (A) Schematic representation of the AtvacINV2 ::GUS transgene relative to the endogenous AtvacINV2 gene. (B) Genomic PCR analysis using specific primers to amplify a 1379 bp-DNA fragment that includes the promoter::GUS junction. Six transgenic plants were selected at random from 1-mo-old progeny of a T1 plant containing the 3Â’ end of the AtvacINV2 promoter and the 5Â’ end of the GUS genes in six AtvacINV2 promoter::GUS transgenic plants. Nontransformant wild-type (Col -0) was used as a negative control. (C) GUS activity was assayed in rosette le aves from each of the same plants. (D) Sugar responses of the AtvacINV2 promoter::GUS transgene and the endogenous AtvacINV2 in 2-wk-old plants. Leaves and cotyledons were samples from opposite sides of ten, indivi dual, plants after starvation in the dark for 42 h (lane 1 and 2), followed by transfer to liquid media for an additional 24 h with D-glucose (lane 3 and 5) or L-glucose (lane 4 and 6). Leaves from ten different plants were used for each of the two experiments shown. Total RNA was exacted and GUS , AtvacINV2 , and Tubulin mRNA were analyzed by RT-PCR. Each lane was loaded with 400ng of total RNA as template, previously amplifie d with 20 cycles of PCR.

PAGE 76

65 Figure 4-8 Longevity of AtvacINV2 mRNA. (A) Two-wk-old Arabidopsis plants were transferred to darkness and sugar-free half-strength MS liquid medium for 24 h, then fed 0.6 mM Cordycepin, with eith er 1% glucose or 1% mannitol for 0, 1, 2 or 4 h. Total RNAs were extracted and AtvacINV2 mRNAs were quantified by real-time Q-RT-PCR. Using Cordycepin treated time=0 as 100%, the relative percentage of total AtvacINV2 transcripts was labeled for each time point. Error bars indicate st andard errors. (B) The 3Â’untranslated region of AtvacINV2 . The stop codon, TGA, is indicated by capital letters. Sequences similar to an mRNA-destabi lizing element, DST, are indicated by bold capital letters, and identical nucle otides are underlined. The position of the poly(A) signal is labeled by dots.

PAGE 77

66 Figure 4-9 Effects of sucrose analogs and glucose analogs on AtvacINV2 mRNA levels in 2-wk-old Arabidopsis plants. Plants were transfe rred to sugar-free liquid halfstrength MS medium for 36 h and then fed with 30 mM sugars, including mannitol (Man), sucrose (Suc), palatinose (Pal), turanose (Tur), glucose (Glc), frutose (Fru), 2-deoxyglucose (2doG) or 3-o-methylglucopyranose (meGlc) for 8 h in the dark. Tota l RNAs were extracted and AtvacINV2 were quantified by real-time Q-RT-PCR. Values were normalized to rRNA . Error bars indicate standard errors among three biological repeats.

PAGE 78

67 CHAPTER 5 MUTANT ANALYSIS OF TWO VACUOLAR INVERTASES IN ARABIDOPSIS Introduction Sucrose is synthesized in source leaves a nd transported to sink organs, like flowers and roots. Further metabolism is required, and this is initiated by either sucrose synthases or invertases. These are the only tw o plant enzymes known to cleave the 12glycosidic bond within sucrose. Sucrose s ynthases reversibly cl eave sucrose into UDPglucose and fructose; whereas invertases irreversibly hydrol yze sucrose into glucose and fructose. Plants have two types of acid invertases, bot h of which show optimal activity at an acidic pH. The vacuolar invertases are locat ed in vacuoles and th e cell-wall invertases are secreted into the apoplast. A primary role of vacuolar invertase is to provide hexoses to support growth in actively growing ti ssues (Tymowska-Lalanne and Kreis 1998b). The current models for functi ons of vacuolar invertases center on regulation of sucrose levels in the vacuole and remobilization of sucrose for metabolic requirements. The activity of vacuolar invertase often coincides with cell expans ion and may affect extent of enlargement by providing hexoses that can serve as osmotic solutes. Vacuolar invertases are considered primary determinants of sink st rength in expanding organs. However, cell wall invertases can also cleave sucrose if it is unloaded directly into the apoplast from the sieve elements of phloem. In this way, cel l-wall invertases can contribute to sucrose partitioning. Cell-wall invertase activity can also reduce turgor–based inhibition of symplastic transfer (as reviewed by Koch, 2004).

PAGE 79

68 Considerable interest has been directed toward determining the role of acid invertases and studies have extended from expression of yeast-derived invertases in diverse transgenics, to antisense repressi on of endogenous forms in species such as tomato, potato, and carrots (Klann et al., 1996; Zrenner et al., 1996; Tang et al., 1999). However, these approaches have not been ab le to address individua l roles of different invertases in this gene family. Antisense or RNAi strategies provide well-accepted means for blocking expression of a given gene , but promoter efficiency can vary among tissues and a small amount of unblocked transc ript may be sufficient to maintain wildtype status. In addition, a high degree of sequence simila rity was evident among cDNA sequences in the acid invertas e family of Arabidopsis. In this case, application of antisense or RNAi could have affected more th an one invertase transcri pt. It is thus not yet possible to study individual roles of all invertase isomers in this 8-member gene family. However, in Arabidopsis, T-DNA mutagene sis provides an excellent means to silence specific genes and study their functi on (T-DNA mutagenesis results in insertion of T-DNA into a given gene, which is typically disrupted enough to yield a null mutation). Resources for reverse genetic screening of Arabidopsis thalina include the Arabidopsis Biological Resour ce Center (ABRC) and the Arabidopsis Knockout Facility at the University of Madison-Wisconsin Biot echnology Centre. For work presented here, T-DNA insertion mutants of vacuolar inve rtases were requested from ABRC and knockout lines were used to study roles of indi vidual members in the vacuolar invertase family.

PAGE 80

69 Because both sucrose synthase (SUS) and i nvertase function on the same substrate, sucrose, the expression levels of SUS gene family members were also investigated in the vacuolar invertase mutants. Sucrose synthase (SUS; EC 2.4.1.13) catalyses the reversible conversion of sucrose and UDP, to UDP-gluco se and fructose. SUS activity often correlates with the sink strength of storage organs a nd provides UDP-glucose for starch synthesis (Zrenner et al., 1995). SUS expressi on is also associated with developmental processes such as nodule development in legumes (Hohnjec et al., 1999) or apical meristem functioning in tomato (Pien et al., 200 1). In addition, SUS is proposed to play a role in cell wall biosynthesis and may be asso ciated with the cellulose synthase complex (Delmer and Amor, 1995; Winter and Huber, 2000). In vitro experiments suggest that the phosphorylation status of SU S could determine whether SUS is soluble or membranebound (Winter et al., 1997; Hardin et al., 2004) . The genomic database for Arabidopsis indicates six putative SUS genes, AtSUS1 to AtSUS6. Initial work (Baud et al., 2004) using a relative quantitative reverse transcriptase-polymeras e chain reaction showed that the mRNA expression profiles of these six AtSUS genes exhibited dist inct patterns that are partially redundant in di fferent organs and treatments. These included oxygen deprivation, dehydration, col d, and sugar feeding. Both AtSUS1 (At5g20830) and AtSUS4 (At3g43190) mRNAs were also induced under anaerobic conditions (Baud et al., 2004). In contrast, AtSUS3 (At4g02280) mRNAs were induc ed under dehydration stress and the AtSUS2 (At5g49190) gene was highly induced in developing seeds (Baud et al., 2004). The AtSUS5 (At5g37180) and AtSUS6 (At1g73370) genes are essentially unresponsive to stress and are expr essed in most organs (Baud et al., 2004). Here, a hypothesis was proposed that one or more mechanisms of fine tuning may control

PAGE 81

70 expression of genes for sucrose cleaving enzyme s, mainly vacuolar invertase, cell wall invertase, and sucrose synthase. The lack of vacuolar invertas e genes may alter the mRNA expression of the other two sucros e cleaving enzymes. This hypothesis was tested in the present stud y by quantitative RT-PCR analyses in vacuolar invertase mutants. Materials and Methods Plant Materials Arabidopsis thaliana (Col-0) plants were grown as de scribed previously in Chapter 4. Organs for GUS assays were harvested fr om 2-month-old plants. For DNA and RNA extraction, all samples were immediately frozen in liquid nitroge n and stored at -80 °C until extraction. GUS Histochemical Assay Whole plants or organs were fixed in 90% acetone and stained with GUS substrate, 5-bromo-4-chloro-3-indolyl b -D-glucuronic acid, as de scribed previously in chapter 4. Southern Blot Analysis Genomic DNA was isolated from Arabi dopsis leaves using an extraction buffer containing 1% SDS, 100mM sodium chloride, 50 mM EDTA, 1.4% -mercaptoethanol, and 100 mM Tris-HCl (pH 8.0). Digests were conducted overn ight with DNA (10 g) and restriction enzymes, then loaded onto 1% agarose gels for electrophoresis at 40 volts for 12-16 h. Gels were washed with 0.2 M hydr ochloric acid for 10 min, soaked with 0.2 M sodium hydroxide for 90 min, rinsed with 10X SSC ( 1.5 M NaCl, 150 mMM Nacitrate; pH7.0) and blotted onto Hybon-N nyl on membranes by capillary transfer. The membrane-bound DNA was UV-crosslinked for 10 min, and then baked at 80ºC for 2 h.

PAGE 82

71 Blots were probed with 32P-labeled DNA in hybridization buffer for at least for 2 h (42oC; 1X DH salt, 50% formamide, 1 M Na Cl, 1X SSTE, 10 % dextran sulfate, 1 mg/mL salmon testes DNA). Blots were washed with 0.2X SSC and 0.1% SDS at 45oC for 30 min and exposed against X-ray film with an intensifying screen at -80 C. The probe for AtvacINV1 utilized for the Southern blot an alysis shown in Figure 5-4 was a 257-bp region near the 5’ end of the coding region, and was released from a pATB3-1 DNA plasmid using Eco RV and Sal I. The AtvacINV2 probe (293bp), covering part of exon 4 and 5, was released from a pAtbfruct4 DNA plasmid by digestion with BamH I and Xho I. The NPTII probe (352bp) wa s released from pCR2.1 with SphI and PstI . RNA Gel Blots RNA was isolated from Arabidopsis usi ng the RNeasy Plant Mini Kits (Qiagen, Valencia, CA) according to the manufacturer’s protocol. From Northern blot analysis, 6 µg of total RNA was denatured by glyoxal (25% DMSO, 1.32M gl yoxal, 1X MOPS and 0.1 mg/ml ethidium bromide) at 55 C for 1 h, chilled on ice for 2 min, then loaded onto 1% agarose in 1X MOPS buffer (40mM MOPS, pH 7.0, 10mM sodium acetate, 1mM EDTA) for electrophoresis at 70 volts for 2 h. Gels were soaked with 10X SSC, followed by capillary transfer of RNA to HybondN nylon membranes using 10X SSC buffer as the transfer solution. Probes for AtvacINV1 and AtvacINV2 were as described above. RNA blots were probed as describe d above for Southern blots. One step RT-PCR A one-step RT-PCR strategy was undert aken to determine levels of AtvacINV1 and AtvacINV2 transcripts in vacuolar invertase mutants. For AtvacINV1 , ATB3-3endLP (5'TGGGACGTACGATGATTCAA-3') and ATB3-3endRP (5'-

PAGE 83

72 CCTTGAGGTGTCAGTGCAGA-3') were used to amplify a 622 bp cDNA-fragment, including part of exon 4 and exon 6. For AtvacINV2 , ATB4-3endLP (5'GTTGGGATGACTGCCAGTTT-3') and ATB4-3endRP (5'ACGGACAGCTTCGTCAGAGT-3') were used to amplify an 858 bp cDNA-fragment, including part of exon 4 to exon 7. RT -PCR reactions were performed with a SuperScript™ One-Step RT-PCR System using Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using 0.2 µ g of total RNA from 2-wk-old Arabidopsis plants. The amplified cDNA fragments were visualized in 1% agarose gels, stained with EtBr. Soluble Acid Invertase (Vacuolar) Assay Assays of soluble (vacuolar) acid inve rtase were conducted as described by Stessman (1989) with some modifications . Leaf samples, about 50 mg, were homogenized in 400 µl of extraction buffe r (50 mM Mops-NaOH (pH 7.5), 5 mM MgCl2, 1 mM EDTA, 0.05% (w/v) Triton X100, 2.5 mM DTT, 0.1 mM PMSF, 1% Polyvinylpolypyrrolidone) and centrifuged at 14,000 rpm for 10 min at 4oC. A 400l aliquot of the supernatant was dialyzed overn ight at 4ºC using a Spectra/Por membrane with a molecular weight cut off of 50 KD (Spectrum, Rancho Dominguez, CA) and a PBS dialysis buffer (pH 7.4) at 4 oC overnight. The purpose of this was to remove invertase inhibitor proteins which are t ypically small (ranging from 15 to 23 kDa) (Rausch and Greiner, 2004). Two of these have shown specific in hibition of vacuolar invertase activity in Arabidopsis (Link et al., 2004). Invertas e inhibitor proteins typically have a dissociation half-time of abou t 3 h (Bracho and Whitaker, 1990). To analyze invertase activity, 60 µl of dialyzed protein was added to 140 µl substrate solution (50 mM sodium citratephosphate, pH 5.0, and 50 mM sucrose) at 37oC

PAGE 84

73 for 15 min. The reaction was stopped by bo iling for 5 min. The resulting hexose concentrations were determined by glucose oxi dase and peroxidase (glucose assay kit, Sigma, St. Louis, MO) he dialyzed protein was used for protein determination using the Bradford method (Bradford, 1976). Quantification of Invertase Transcripts by Real-Time PCR Total RNA was extracted from three samp les and real-time quantitative RT-PCR using Taq-Man one-step RT-PCR master mix reagents wa s performed as described in Chapter 3. Quantification of Sucrose Synthase Gene s by Real-Time Quantitative SYBR GreenPCR For reverse transcription (RT)-PCR studies for sucrose synthase genes, DNA-free RNA was converted into first-strand c DNA using Taqman® Transcription Reagent (Applied biosystems, Branchburg, NJ) with ol igo dT primers. In all cases, three biological samples were analyzed using i ndependent RT reactions. Reactions were conducted using an Applied Biosyste ms GeneAmp 5700 sequence-detection system with SYBR Green I PCR master mix (Applied Biosys tems, Foster city, CA) according to the manufacturer’s protocol. Each reaction was conducted with 5 µ l of 1:10 of the first cDNA strands in a total volume of 25 µ l. Reactions were incubated at 95 °C for 10 min, followed by 45 cycles of 10 s at 95 °C, 6 s at 55 °C, and 20 s at 72 °C. The specificity of PCR amplification was tested by a heat dissociation curve (from 65 °C to 95 °C) following the final cycle of the PCR. Results were expressed rela tive to those of the selected standard EF1A-4 gene (Liboz et al., 1990). Specific primer sets of each sucrose synthase gene and the EF1A-4 gene were designed as described in Baud et al. (2004).

PAGE 85

74 Results The 5Â’ Regulatory Sequences of Both Vacuolar Invertase are Broadly Active To obtain more detailed information on te mporal and spatial patterns of vacuolar invertase gene expression, a -glucuronidase (GUS) reporte r gene was placed under the control of either the AtvacINV1 5Â’ regulatory sequences (1830bp upstream of AtvacINV1 coding sequence) or those of the AtvacINV2 (1360bp upstream of AtvacINV2 coding sequence). These constructs were introduced into Arabidopsis Col-0 by Dan J. Stessman and Steven Rodermel (Iowa State Universi ty). Resulting transgenic plants were analyzed in this study. In general, pattern s of GUS activity were similar for in situ histochemical assays of pl ants expressing either the AtvacINV1 :: GUS (Figure 5-1A, D, E) or AtvacINV2 :: GUS (Figure5-2 A, D, E). Strong GUS activities were revealed in young, 2-wk-old plants and later, in developing green siliques and flowers. In petals, GUS was expressed primarily along veins. For rosett e leaves, GUS staining appeared mainly at hydathodes and slightly along margins (Figure 51B and 5-2B). For cauline leaves, GUS activity was evident primarily along margins a nd sporadically within the blade (Figure 51C and 5-2C). In mature brown siliques, st rong GUS staining was apparent in abscission zones and funicles of both transgenic GUS lin es (Figure 5-1F; 5-2F). GUS activity was also detected in the replum of AtvacINV1 :: GUS plants (Figure 5-1F). The GUS data presented here indicate that 5Â’ regulatory sequences of both vacuolar invertase were broadly active, especially in the strong sink organs. Isolation and Characterization of Vacu olar Invertase T-DNA Insertion Mutants Another goal of this study was to utilize knock-out mutants of AtvacINV1 and AtvacINV2 to help define individual roles for ea ch vacuolar invertase and determine effects of altered vacuolar acid i nvertase activity. Mutants of both AtvacINV1 and

PAGE 86

75 AtvacINV2 were identified from the Salk T-DNA Arabidopsis insertion collection using the SIGnAL “T-DNA Express” Ar abidopsis Gene Mapping Tool (http://signal.salk.edu/cgi-bin/tdnaexpress) (A lonso et al., 2003). The selected mutants were then obtained from the Arabidopsis Biological Resource Center (ABRC). Multiple T-DNA lines for these two vacuolar invertase gene s were available. At present, there are 11 T-DNA insertion lines for AtvacINV1 ; Salk_038826 contains a T-DNA in the first intron; Salk_006934, Salk_076378, Salk_072478 and Salk_148077 all contain a T-DNA in the second intron; Salk_103271, Sa lk_103272, Salk_103793 and Salk_078358 contain a T-DNA in the third intron; Salk_015898 c ontains a T-DNA in the fifth exon and Salk_147176 contains a T-DNA in the sixth exon. For AtvacINV2 , there are 4 T-DNA insertion lines; three contain a T-DNA inserted in the first exon (Salk_011312, Salk_139119 and Salk_100813) and one cont ains T-DNA in the seventh exon (Salk_016136). Two allelic mutants for each vacuolar invert ase gene were obtained and analyzed in the present study (Figure 5-3). For AtvacINV1 , Salk006934 (abbreviated vac1-1) contains a T-DNA in the second intron and Salk_015898 (abbreviated vac1-2) contains a T-DNA in the fifth exon; for AtvacINV2 , Salk_100813 (abbreviated vac2-1) contains a TDNA insert in the first exon and Salk_016136 (abbreviated vac2-2) contains a T-DNA insert in the seventh exon. Tw o of the single-mutant lines ( vac1-1 and vac2-1 ), plus a double mutant (generated by crossing vac1-1 x vac2-1 ) were obtained as gifts from D. Stessman and S. Rodelmel. Another tw o mutants containing T-DNA inserts in exon regions close to the 3’ end of the coding sequences were isolat ed in this study, for AtvacINV1 , Salk_015898 ( vac1-2 ) and for AtvacINV2 , Salk_016136 ( vac2-2 ).

PAGE 87

76 Mutant status was verified at the molecu lar level by genomic PCR using a pair of gene-specific primers spanning the insertion sites, and a T-DNA-specific primer was used to identify wild-type, heterozygous, and ho mozygous progeny segregating from the TDNA insertion sites (data not shown). Southe rn-blot analyses were further conducted to identify homozygous mutant lines and the nu mber of T-DNA inse rts. Genomic DNA from mutant and wild-type plants were di gested with three restriction enzymes, Xho I (cutting outside the AtvacINV1 gene, without affecting the T-DNA insert), Pst I (cutting once in the AtvacINV1 gene and once inside the T-DNA), and EcoR I (cutting twice in the AtvacINV1 gene and once inside the T-DNA). Figur e 5-4 shows a shift in the size of the fragments from the AtvacINV1 homozygous line (-/-), indica ting an insert in the endogenous gene. Fragments evident in DNA from wild-type (+/+) or a homozygous line (-/-) were also apparent in a heterozygous line (+/-). A binary vector, pROK2, containing the kanamycin resistance gene, NPT II, was used to produce the Salk T-DNA inserti on lines by Agrobacterium transformation. Typically there were 1-2 random insertions of the T-DNA into each transgenic plant. Probing both invertase mutant lines with NP T II revealed that Salk_015898 contained at least three T-DNA insertions, indicating multiple insertions were located in this line (Figure 5-4). Genomic DNA isolated fr om three randomly-selected progeny of Salk_015898 (-/-) mutants were digested with Xho I (cutting outside the AtvacINV1 gene without affecting the T-DNA insert). Subseque nt Southern-blot anal ysis showed a single band hybridizing with the NPTII probe, implying that the multiple T-DNA inserts were located in the same or nearby sites. Because the Xho I fragment includes not only the AtvacINV1 (At1g62660), but also an At1g62650 (encodi ng a protein similar to steroid

PAGE 88

77 sulfotransferase), this region was first amp lified by PCR, then sequenced to confirmed that T-DNA inserts did not interrupt the latt er gene (data not shown). The multiple TDNA inserts in the Salk_015898 line were thus concluded to reside in the same Xho I cutting region containing the AtvacINV1 coding region For molecular confirmation of the AtvacINV2 mutant, DNA from mutantand wildtype plants were digested w ith three restriction enzymes, Pst I (cutting outside the AtvacINV2 gene and once within the T-DNA insert), EcoR V (cutting outside the AtvacINV2 gene and three times within the T-DNA), and Bam HI (cutting once within the AtvacINV2 gene and once within the T-DNA). Figure 5-5 compares DNA from mutant and wild-type plants segregating among F-2 progeny as well as non-transformant wildtype. The size of AtvacINV2 gene fragments differ in homozygous plants (-/-), indicating a DNA insert in the endogenous gene. Probing DNA from mutant s and wildtype control plants with NPT II re vealed that Salk_016136 contai ned about two copies of TDNA inserts, but none were detected in the wild-type segregating plant as well as nontransformant wild-type contro l (Figure 5-5). Again, multipe T-DNA copies were located within the AtvacINV2 coding region. RNA gel blots using dissimilar coding region sequences of the two vacuolar invertases were conducted to appraise the exte nt of transcript reduc tion achieved in the mutant alleles. The two mutants examined in this way had T-DNA insertions at the 3Â’ ends of their coding sequences, so cDNA fragme nts just upstream of these insertion sites were used as probes to determine whether detectable levels of truncated invertase transcripts remained. Signal produced by cross-hybridization w ith other invertase transcripts was possible in these Northern -blot analyses, so supplemental RT-PCR was

PAGE 89

78 utilized to achieve better sp ecificity (Figure5-6B). Desp ite a high background (possibly contributed from AtvacINV2 ), it was possible to determine that levels of AtvacINV1 mRNAs were lower in the atvavinv1 mutants, ( vac1-1 and vac1-2 ) and in progeny of crosses ( vac1-1 x vac2-1 and vac12 x vac2-2 ) (Figure5-6A) than in Col-0. A lack of detectable AtvacINV1 mRNA was more clearly evident in atvavinv1 mutants and double mutants (Figure 5-6B). No AtvacINV2 mRNA was detectable in Northe rn blot analysis of the atvacinv2 mutants ( vac2-1 and vac2-2 ) or in double mutants ( vac1-1 x vac2-1 and vac12 x vac2-2 (Figure5-6A). However, in RT-P CR analysis, a faint presence of AtvacINV2 mRNA was shown for the vac2-2 mutant and in homozygous progeny of crosses between vac12 x vac2-2 . The primer set flanked the putative T-DNA insertion site, with the forward primer upstream of the insert and the reverse primer down stream. The insertion site was originally believed to be locat ed in the fifth exon, but an upda ted database showed it to be in the seventh exon. Using a specific forward primer for the AtvacINV2 gene and Lbal primer (annealing to left boarder of TDNA), 0.9 Kb of DNA was amplified from vac2-2 genomic DNA. Further DNA sequence data indi cated that the insertion site was in the final exon. Primers applied in Figure 5-7B had thus amplified a fragment from the coding region upstream of the T-DNA insert. Based on amino acid sequence homology, AtvacINV1 and AtvacINV2 are the only two vacuolar invertase genes in the Arabidopsis genome. On e of the goals of this study was to test whether these two predicted vacu olar invertases functioned as such, and to determine whether any of the other acid inve rtases in Arabidopsis contributed to this activity. The genetic approach ut ilized here allowed this to be ascertained. The loss of

PAGE 90

79 AtvacINV1 function in two allelic mutants ( vac1-1 and vac1-2 ) decreased soluble acid invertase activity in both of them to 3 4.3% and 38.4%, respectively. A knock-out mutation of the AtvacINV2 gene ( vac2-1 ) reduced soluble acid invertase activity to only 24.34% of that in wild-type Col-0 plants (Fig ure 5-8). Soluble inve rtase activity in the knock-down vac22 mutant decreased to 63.7% of w ild-type levels, showing that the truncated AtvacINV2 gene was able to maintain some level of enzyme activity. The double knock-out mutant ( vac1-1 x vac2-1 ) had no detectable so luble invertase activity, consistent with the functional lo ss of both transcripts. It al so indicates that only the two predicted soluble acid inve rtses in Arabidopsis contri bute to this activity. Phenotypic Characterization of Vacuolar Invertase Mutants Initial characterization of the v acuolar invertase double mutant ( vac1-1 x vac2-1 ) was conducted by D. Stessman (2004). His anal yses showed a two-fold elevation in leaf sucrose level relative to thos e of wild-type plants during di urnal cycles (Stessman, 2004). Root length of the double mutant also appeared visibly shorter than that of wild-type on MS agar medium with or without sucrose (S tessman, 2004). Preliminary analysis of root growth rates indicated that these were si milar for the double mutant and wild-type, leading to the suggestion that shorter roots may have resulte d from delayed germination. However, there appeared to be few other distinguishing features of the double-mutant phenotype. During leaf development (from 17to 31-d-old plants), there was no detectable difference in leaf width, chlo rophyll level, or gene expression of RbcS (the nuclear-encoded photosynthetic gene fo r the small subunit of Rubisco), SUC2 (encoding a sucrose transporter), AtcwINV1 (a cell-wall invertase gene) or SAG12 (a senescence induced gene) between double mutant and wild-type plants (Stessman, 2004). Also, silique size and number of seeds per silique were found to be similar (Stessman, 2004).

PAGE 91

80 In the present work, additional phenotypic analyses were undertaken. Because GUS staining patterns showed strong vac uolar invertase activity in leaves of young Arabidopsis plants (Figures 5-1 and 5-2), fres h weight of 2-wk-old mutants was compared to that of wild-type plants. No difference was apparent (data not shown). Percentages of 11-d-old plants wi th at least two true leaves were also determined. These were found to differ slightly with 72.91%±3.08 for wild-type; 76.23%±3.15 for vac1-1 , 86.99±4.73 for vac2-1 , and 67.49±1.78 for the double knock-out vac1-1 x vac21. Because both vacuolar invertase genes were responsive to glucose (Figure 4-3), hypocotyl length was measured for 6-d-old s eedlings grown on 1/2 MS medium with 0, 1, 4 or 6% glucose in the dark. Results showed that 4 and 6% glucose inhibited hypocotyl growth in all lines tested, bu t no obvious difference was evident between vacuolar invertase mutants and w ild-type plants (data not shown). Additional investigations with Kevin Folta (University of Florida) showed that vacuolar invertase transcripts were induced by far-red and green light, with mRNA levels rising 2to 4-fold above darkened controls (data not shown). Ho wever, regardless of light environment (darkness or far-red for1 µmole m-2S-1), hypocotyl length of 4-d-old seedlings showed no detectable difference between the double mutant and wild-type. Likewise, rapid responses in growth-rate of hypocotyls did not differ between double mutant and wild-type plants when 2-d-old seed lings were tested in response to 5 seconds of green light stimuli (photos were taken hourly under a safe light for 24 h) (data not shown). Focus was thus shifted to root-based aspects of the mutant phenotype. An additional reason for this was the em erging data from analysis of a wak2 mutant ( Wak2

PAGE 92

81 encodes a wall associated kinase). The wak2 seedlings showed a conditional phenotype, in which severe growth retardation in root s was evident if they were grown on 1/6 MS medium lacking sucrose, but not on MS medi um with 2% sucrose (Huang, contribution to Korhorn et al., 2006). E xpression and activity of vacuol ar invertases were also reduced under these conditions. A thorough analysis was thus directed towa rd root length of 5-d-old Arabidopsis seedlings grown on 1/6 MS medium. Th e double vacuolar invertase mutant had consistently shorter roots wh ile single vacuolar invertas e mutants both had longer roots than did wild-type seedlings (Figure 5-9A). The same experiment was repeated multiple times, and each further confirmed that in lo w-nutrient medium, single invertase mutants had longer roots than did wild-t ype plants. In the second experiment, root growth of all lines, except the double mutant was slower than in experiment I, implying that the double mutant was not as responsive as single mu tants or wild-type seedlings to whatever aspects of the experiment had changed (Figur e 5-9B). Recently, Sergeeva et al. (2006) also examined the vin2-1 line used in the present study, and found the root-length of 7-dold seedlings on moist filter paper to be asso ciated with a quantita tive trait locus (QTL) for root elongation in Arabidopsis. This part of the e xperiment were repeated in this study with more vacuolar invertase mutants, including single mutants, vac1-1 , vac2-1 , and double mutants, vac1-1 x vac2-1 . Seeds were sown on a wet single layer of filter paper and root length was measured on da y 3. The same reduced root length (~15% shorter than wild-type) was f ound in both single vacuolar inve rtase mutants, and a severe root length reduction to 64% of wild-type was found in the double mutant (Figure 5-10).

PAGE 93

82 All current visible pheonotypic an alyses of vacuolar invertase mutant were listed in Table 5-1 Previous reports have all indicated that vacuolar i nvertases were abundant and highly active in leaves (Tang et al., 1996; Tymowska-Lalanne and Kreis, 1998a; Stessman, 2004; Sergeeva et al., 2006), so it seems surprising that there has not been a visible phenotype yet discerna ble in photosynthetic organs. The likehood of a molecular phenotype was therefore investigated further. Expression patterns were examined for the major cell wall invertases and for the sucr ose synthases in wild-type plants, then compared to each of the vacuolar invertase mutants. Results demonstrated that vin2-1 mutants lacking a functional AtvacINV2 gene also had reduced levels of AtvacINV1 transcripts. Because AtvacINV1 mRNA levels rise when glucose is abundant, expression of this gene would be expected to drop in instances where capacity for endogenous glucose production was impaired. Deficiency of one functional vacuolar invertase, AtvacINV2 , could do this, and would re sult in less hexose produc tion. However, lack of a functional AtvacINV1 gene in the vin1-1 mutant did not affe ct expression of the AtvacINV2 gene (Figure5-11A). In the vac1-1 mutants, levels of AtcwINV1 , AtcwINV3 and AtcwINV6 mRNA were markedly reduced (Fi gure 5-11B). When wild-type and vacuolar invertase mutants were subjected to 48h of darkness, tran scripts of all four major cell wall invertases in Arabidopsis ro settes accumulated to a greater degree in vac2-1 mutants than in wild-type plants (Figure 5-11B), indicating compensation occurred among cell-wall invertases. Under the same dark conditions the double mutant did not show a further induction or compensa tion; moreover, mRNA levels of most cell wall invertases remained similar to those of wild-type (as observed earlier by Stessman,

PAGE 94

83 [2004]). These data indicate a more complicated role for vacuolar invertase action than is evident for their enzymatic function alone. In vac1-1 mutants, mRNA levels for AtcwINV1 , AtcwINV3 and AtcwINV6 were less than in wild-type plants. However, di fferences were no longer evident when 12-h photoperiods were followed with an additional 48 h of darkness (Figure 5-11B). These treatments reduced expression of all three genes in the vac1-1 , single mutant, the double mutant, and in wild-type plants. These conditions would also have dropped endogenous glucose levels below 23% of those present under growing conditions (refer back to Figure 4-2). A time course of glucose responses was t hus followed for expression of cell wall invertase genes in young Arabidopsis plants (Figure 5-12). Due to the limited expression of AtcwINV2 , AtcwINV4 and AtcwINV5 in young plants, focus was directed toward the remaining three cell wall invertases ( AtcwINV1 , AtcwINV3 and AtcwINV6 ) and the two vacuolar invertases ( AtvacINV1 and AtvacINV2 ). All three cell wall invertase transcripts analyzed here were induced by glucose in 12h or less. Transcript abundance of AtcwINV3 and AtcwINV6 rose within 3 h of glucose addition, whereas AtcwINV1 mRNA levels were not significantly elevated un til 12 h of treatment. Regulation of the two vacuolar invertase mRNA levels in response to glucose was reciprocal; AtvacINV1 was induced (after12 h) while AtvacINV2 was repressed (in less than 3 h). Since mRNA levels for the three major cell-w all invertase genes in leaves all rise in response to glucose, it is possible that thes e genes were responding to decreased glucose levels in the vac1-1 mutant (Figure 5-11B). Howeve r, the mechanisms regulating cell

PAGE 95

84 wall invertase gene expression in the vac21 mutant were less clear, particularly under conditions of extended darkness. Besides invertase, sucros e synthase catalyzes the only other known path for cleaving sucrose in plants; responses of mRNA levels for these genes were examined in the vacuolar invertase gene mutants. There are six sucrose synthase genes in Arabidopsis (Baud et al., 2004). Data presented here show that in wild-type plants, two of these sucrose synthases, AtSUS1 and AtSUS3 , were induced under darkness, whereas three of them, AtSUS1 , AtSUS4 and AtSUS3 were repressed (Figure5-13). Compared to expression of an EF endogenous control, AtSUS3 transcript levels were much higher in young Arabidopsis plants after extended darkness, and especially in the vac2-1 mutant. This mutant lacked a functional gene for AtvacINV 2, which would otherwise have been induced under the darkened, glucose-depleted conditions. Also, the AtSUS5 gene was more active in both vacuolar invertase mutants, implying gene compensation from within another gene family. The two families are related in the extent to which their encoded enzymes catalyze alternate paths for sucrose use. The mRNA levels of AtSUS2 and AtSUS6 were not affected by malfunction of vacuolar invertases. The molecular phenotype of altered mRNA expression patte rns for cell wall invertase and sucrose synthase genes indicated that th e roles of vacuolar invertase were not limited to those can be readily ascribed to their enzyme functions alone. Discussion Initial work on vacuolar invertase mutants in Arabidopsis indicated minimal effect of even double knock-outs lacking functional genes for both AtvacINV1 and AtvacINV2 (S. Rodermel and S. Stessman, personal comm unication). Double-null mutants for both genes were examined under constant light or un der different intensities of light. Mutant

PAGE 96

85 plants were also subjected to increased CO2 concentrations. Carbohydrate analysis revealed a 2-fold accumulation of sucrose in leaves of the double mutant plants, but there was no difference in hexose or starch content. Chlorophyll levels were similar to those of wild-type plants regardless of whether grow n in normal or high light, with or without high CO2. Expression of RbcS mRNA was also f ound to be nearly identical to wild-type in all growth conditions tested. It was theref ore concluded that vacu olar invertases have a limited influence on partitioning of sucrose and little to no detect able effect on gene expression during acclimation in leaves (Stessman, 2004). Changes in sucrose content achieved by introducing enzymes of sucrose metabolism do not always affect plant mo rphology. Heterologous overexpression of a spinach sucrose transporter in potato, for example, reduced su crose levels in leaves and increased sugars in tubers, but a shift in carbon partitioning did not have an impact on tuber morphology (Leggewie et al ., 2003). Recently, a yeast invertase targeted to vacuoles of developing potato tuber decrea sed sucrose content, and significantly increased glucose and hexose-phosphate levels, all with only minor e ffects on starch or amino acid levels (Junker et al, 2006). Still, th e same invertase target ed to the cytosol or cell wall in tubers was shown to markedly alter both tuber metabolism and growth (Sonnewald et al., 1997; Hajirezaei et al., 2000) . When an invertase antisense strategy was applied to tomato, transgenic plants s howed increased sucrose and decreased hexose levels. Still, growth of these constitutive, antisense invertase plan ts did not differ from that of wild-type plants until the reproductiv e phase, at which time they produced fruit that were approximately 30% smaller (Klann et al ., 1996). On the other hand, Arabidopsis showed more resistance to increas ed level of vacuolar invertase activity and

PAGE 97

86 was minimally affected by overexpression of invertase (von Schaewen, 1990) whereas transgenic tabacco, tomato and potato overp roducing invertases had yellow, bleached leaves, some with necrotic spots (von Sch aewen, 1990; Dickinson et al., 1991; Heineke, 1992). In this study of vacuolar invertase mu tants, visible phenotypes were not readily evident in above-ground vegetative organs , but compensation from other sucrose cleavage enzymes occurred at th e transcriptional level. Ch anges in transcript abundance in the vac1-1 mutant differed from those in the vac2-1 mutant, and double mutants showed mRNA profiles that differed from each of the single mutants (Figure 5-11 and 13). Theses changes in gene expression were not as simple as gene compensation or feedback regulation. In anot her system, potato, over-express ion of apoplastic invertase resulted in curled, small leaflets, as well as elevated levels of glucose and fructose, but levels of hexose-phosphate and the ratio of UDP-Glc/ UTP were not markedly differet. This indicated that the respons e to decreased sugar export from leaves was not a simple feedback control of the Calvin cycle or of sucrose synthesis enzymes (Heineke, etal., 1992). Previous immunolocalization of AtvacI NV2 (Rojo et al., 2003) showed this vacuolar invertase to be present in vacuoles and precursor protease vesicles (PPV). The PPV are plant-specific ER bodies that c ontain precursors of proteases and other hydrolytic enzymes. It is intriguing that AtvacINV2 exists in PPV with an inactive precursor to a protease that can target the invertase for degradati on. Rojo et al. (2003) have directly linked the degrad ation of AtvacINV2 with acti on of the vacuolar processing enzyme-(VPE ), a cysteine protease, in th e senescent organs. Although VPE was

PAGE 98

87 senescence-induced, basal levels of the prot ein were also detectable in young organs, implying a possible influence of VPE at pre-senescent developmental stages. The role of AtvacINV2, the only sugar-repressed form of acid invertase examined thus far, warrants further study. Levels of AtvacINV1 mRNA were increased by sucros e in a dosage-dependent way (Figure 4-1C), and this gene was also up -regulated by glucose. Lack of a functional AtvacINV2 gene, in the vin2-1 mutant, would have been expected to decrease glucose levels and this, in turn, w ould likely lower expression of AtvacINV1 (as shown in Figure 5-11A). On the other hand, sugar repression of AtvacINV2 was dosage-independent (Figure 4-1D) and the lack of an AtvacINV1 gene did not affect expression of the AtvacINV2 (Figure 5-11A). Most of the cell wall invertases tested here were repressed in the vin1-1 mutant (lacking a functional AtvacINV1 gene) and induced in the vin2-1 mutant (lacking a functional AtvacINV2 gene). However, absence of f unctional genes for both vacuolar invertase genes did not affect RNA levels of most of ce ll wall invertases and overall responses were similar to those observed in wild-type plants (F igure 5-11B). These results were further supported by data from Dan Stessman (2004) showing that the level of AtcwINV1 mRNA did not differ between leaves of the vacuolar invertase double mutant and those of wild-type plants (Stessm an, 2004). Together, these results imply that the function of vacuolar invert ases extends not only to diverse effects of their sucrosecleaving capacity, but also includes aspects of their balance not read ily explained by their reactions alone.

PAGE 99

88Table 5-1 Visible phenotype tests of vacuolar invertase mutants. NA represents data not applicable. “ ” stands for there is no difference compared to wild-type.

PAGE 100

89 Figure 5-1 Histochemical locali zation of GUS activity in Arab idopsis plants transformed with an AtvacINV1 promoter:: GUS fusion gene. (A) Two-week-old seedling showing overall staining in aerial and basal parts of primary roots. (B) Rosette leaf showing staining along it s margin and hydathodes; (C) cauline leaf; (D) flower buds; (E) developing siliques; (F) mature siliques

PAGE 101

90 Figure 5-2 Histochemical locali zation of GUS activity in Arab idopsis plants transformed with an AtvacINV2 promoter::GUS fusion gene. (A) Two-week-old seedling showing staining in whole plants. (B) Ro sette leaf showing staining mainly at hydathodes; (C) cauline leaf; (D) flower buds; (E) developing siliques; (F) mature siliques.

PAGE 102

91 Figure 5-3 Maps of T-DNA insertion mutants a nd genomic DNA restriction enzyme sites of the Arabidopsis vacuol ar acid invertase genes, AtvacINV1 and AtvacINV2 . Total 10 kb genomic DNA sequences were selected and commonly used restriction enzymes are shown on it. Locations of Salk T-DNA insert lines are displayed by arrow heads for both genes. Locations of Salk T-DNA insert lines used for experi ments are displayed for both genes: For AtvacINV1 , Salk_006934 ( vac1-1 as short name) contains a T-DNA in the second intron and Salk_015898 ( vac1-2 as short name) contains a T-DNA in the fifth exon. For AtvacINV2 , Salk_100813 ( vac2-1 as short name) contains a T-DNA in sert in the first exon and Salk_016136 ( vac2-2 as short name) contains a T-DNA insert in the seventh exon.

PAGE 103

92 Figure 5-4 Southern blot analysis of Salk_015898 ( vac1-2 ), an atvacinv1 mutant. The schematic structure and location of restriction site s surrounding the AtvacINV1 gene are shown. The AtvacINV2 gene is indicated by stippled aera. Locations of T-DNA inserts are di splayed by arrow heads. Each lane represents 3 ug of genomic DNA from heterozygote(+/-), homozygote (-/-) mutants segregated from Salk_015898 lin e or wild-type Col-0 (+/+). Genomic DNA was digested with Xho I (X), Pst I (P) and Eco RI (E). The first panel was probed with 0.9Kb of AtvacINV1 -genomic DNA. The second panel was probed with 0.3Kb of a gene for Kanamysin resistance, NPTII , showing multiple T-DNA inserts are evident in both heterozygous and homozygous lines. The third panel was loaded wi th genomic DNAs from three, randomlyselected progeny of Salk_015898 (-/-) mutants digested with Xho I outside the AtvacINV1 gene. Application of a 0.3Kb NPTII probe indicated the multiple copies of T-DNA were inserted into the same locus.

PAGE 104

93 Figure 5-5 Southern blot analysis of Salk_016136 ( vac2-2 ), an atvacinv2 mutant. The schematic structure and location of restriction site s surrounding the AtvacINV2 gene are shown. The AtvacINV2 gene is indicated by stippled aera. Locations of T-DNA inserts are di splayed by arrow heads. Each lane represents 3 ug of genomic DNA from wild-type (+/+), homozygote (-/-), segregating in F2 progeny from Sa lk_016136 line or wild-type control from Col-0 (+/+). DNA was digested with Pst I (P), Eco RV (Rv), Bam HI (B). The first panel was probed with 0.93Kb of AtvacINV2 -genomic DNA probe was applied. The second panel wa s probe with 0.3Kb of the NPTII gene for Kanamysin resistance to identify TDNA inserts. Multiple T-DNA inserts in the homozygous lines but have been inserted into the same locus, since segregated wild-type did not contain any NTPII gene.

PAGE 105

94 Figure 5-6.RNA gel blot and RT-PCR analysis of AtvacINV1 expression in different vacuolar acid invertase mutants. Ar abidopsis plants were grown on halfstrength MS agar medium under a 12 h photoperiod for 2 wks, then transferred to darkness and half-stren gth MS liquid medium for 2 d. (A) Northern-blot analysis of the muta nts probed with a 257-bp, gene-specific fragment of AtvacINV1 . Each lane was loaded with 6 µg of total RNA, and ethidium-bromide stained rRNA as a loading control. (B) RT-PCR analysis of AtvacINV1 in the mutants. 200ng total RNA was used as a template for each RT-PCR analysis. The vac1-1 and vac1-2 mutants, containing T-DNA inserts in AtvacINV1 , were obtained as the Salk_006934 and Salk_015898 lines, respectively. The vac2-1 and vac2-2 mutants, containi ng T-DNA inserts in AtvacINV2 , were obtained as the Sal k_100813 and Salk_16136, respectively. The double mutant was r ecovered from progeny of vac1-1 x vac2-1 . The vac1-2 and vac2-2 mutants were each selfed to produce the individual progeny analyzed in (A). All mutant lines were homozygous. The V1::GUS transgenic contains a GUS reporter driven by the AtvacINV1 promoter. Tubulin (At5g62690) provides a loading contro l. The PCR cycle was repeated 25 times.

PAGE 106

95 Figure 5-7.RNA gel blot and RT-PCR analysis of AtvacINV2 expression in different vacuolar acid invertase mutants. Arabidopsis plants were grown on halfstrength MS agar medium under a 12 h photoperiod for two wks, then transferred to darkness and half-stren gth MS liquid medium for 2 d. (A) Northern-blot analysis of the muta nts probed with a 293-bp, gene-specific fragment of AtvacINV2 . Each lane was loaded w ith 6 µg of total RNA, and ethidium-bromide stained rRNA as a loading control. Probe (293bp), covering part of exon 4 and 5, was isolated from AtvacINV2 cDNA fragment. (B) RTPCR analysis of AtvacINV2 in the mutants. 200ng total RNA was used as a template for each RT-PCR analysis. The vac1-1 and vac1-2 mutants, containing T-DNA inserts in AtvacINV1 , were obtained as the Salk_006934 and Salk_015898 lines, respectively. The vac2-1 and vac2-2 mutants, containing T-DNA inserts in AtvacINV2 , were obtained as the Salk_100813 and Salk_16136, respectively. The d ouble mutant was recovered from progeny of vac1-1 x vac2-1 . The vac1-2 and vac2-2 mutants were each selfed to produce the individual progeny analyzed in (A). All mutant lines were homozygous. The V1::GUS transgenic contains a GUS reporter driven by the AtvacINV1 promoter. Tubulin (At5g62690) provides a lo ading control. The PCR cycle was repeated 25 times.

PAGE 107

96 Figure 5-8 Soluble acid invertase activity of muta nt lines. Activity was measured from aerial parts of 2-wk-old plants, grow n on half-strength MS sugar-free agar medium under a 12 h photoperiod. Ten plants were used for each of two separate samples. Bars represent the standard er rors. Percentages were indicated for each line compared to wild type (as 100%). ND indicates nondetectable soluble acid invertase activity.

PAGE 108

97 Figure 5-9 Root-length phenotypes for Arab idopsis vacuolar-invertase mutants on onesixth-strength MS sugar-free medium. Plants were cultured for 5 d under a 12-h photoperiod at 25°C. (A) Root lengt h of 5-d-old seedlings. Roots that were less than 7.5 mm on day 5 were omitted, since growth of roots on these plantlets was retarded at least for anot her 6 d. Error bars indicate standard errors for at least 38 measurements of each line. P values <0.01 are designated with **. The vac1-1 mutant (homozygous for atvacinv1 ) was obtained as salk_006934; vac2-1 mutant (homozygous for atvacinv2 ) was obtained as salk_100813-5, and the double mutant, vac1-1 x vac 2-1 ) was obtained by crossing the salk_006934 and salk_100813 lines. (B) Root length of 5-d-old seedlings in Experiment II. Error bars indicate standard errors for measurements of 14 vac1-1 and ~ 30 plants from each of the other. Another acvacinv1 , vac1-2 , was included in Experiment II.

PAGE 109

98 Figure 5-10 Root-length phenotype s for 3-d-old Arabidopsis v acuolar-invertase mutants on moist filter paper. Plants were cu ltured for 3 days under a 12-h photoperiod at 25°C. Root length of 3-d-old seed lings was measured. Error bars indicate standard errors for 14 measurements of each line. P value < 0.01 is designated with **, and P values < 0.05 are shown with *. The vac1-1 mutant (homozygous for atvacinv1 ) was obtained as salk_006934; vac2-1 mutant (homozygous for atvacinv2 ) was obtained as salk_100813-5, and the double mutant, vac1-1 x vac 2-1 was obtained by crossing the salk_006934 and salk_100813 lines.

PAGE 110

99 Figure 5-11 Changes in mRNA le vels of other invertase fa mily members in vacuolar invertase mutants of Arabidopsis. Plants were cultured in half-strength MS sugar-free medium for 2 wks under a 12h-photoperiod, transferred to sugarfree half-strength MS liquid medium fo r 48 h in darkness. Taqman based quantitative RT-PCR analyses were performed using 200 ng of total RNA extracted from each sample. Level of vacuolar invertase transcriots were shown in (A), and cell wall invertase tran scripts were present in (B). Values were normalized to 18S rRNA . Error bars indicate standard errors from three biological repeats. The vac1-1 mutant containing homozygote of atvacinv1 mutant was obtained as salk_006934; v ac2-1 mutant containing homozygote of atvacinv2 mutant was obtained as salk_100813-5 and vac1-11 x vac2-1 was a double mutant of vacuolar invertas es from crossing between salk_600934 and salk_100813.

PAGE 111

100 Figure 5-12 Glucose responses of acid invertas e mRNAs in 2-wk-old Arabidopsis plants. Starvation was initiated by transferring plants to darkness and sugar-free MS liquid medium for 48 h and reversed by moving plants to 55.5 mM Glucose (Glc)-containing medium for 0, 3, 6, 12, 24, 50 h. Taqman based quantification by Q-RT-PCR was co nducted using 200 ng of total RNA extracted from each sample. Percentage relative to total mRNA was shown for AtcwINV1 mRNA, AtcwINV3 mRNA, AtcwINV6 mRNA, AtvacINV1 mRNA and AtvacINV2 mRNA. Values were normalized to 18S rRNA was used to normalize values. Error bars indicate standard deviations from three biological repeats.

PAGE 112

101 Figure 5-13 Changes in mRNA levels of sucr ose synthase genes in vacuolar invertase mutants of Arabidopsis. Plants were cu ltured in half-stre ngth MS sugar-free medium for 2 wks under a 12h-photoperi od, transferred to sugar-free halfstrength MS liquid medium for 48 h in da rkness. Relative tran script levels of sucrose synthase genes (AtSUS1 to AtSUS6) were measured by SYBR-Green real-time PCR after reverse transcription reaction of total RNAs extracted from each sample and standardized to a constitutive EF1A4 ( EF ) RNA. Error bars indicate standard errors from three biological repeats. The vac1-1 mutant containing homozygote of atvacinv1 mutant was obtained as salk_006934; vac2-1 mutant containing homozygote of atvacinv2 mutant was obtained as salk_100813-5 and vac1-1 x vac2-l was a double mutant of vacuolar invertases from cro ssing between salk_600934 and salk_100813.

PAGE 113

102 CHAPTER 6 SUMMARY AND CONCLUSIONS Sucrose is the major form of transporte d photosynthetic prod uct and therefore it plays an essential role in plant growth and de velopment. Sucrose is actively translocated in phloem from source tissues such as leaves to sink tissues such as fruits and roots. Cleavage of sucrose is the first step in its fu rther use as an energy s ource and this initial reaction can be catalyzed by only two known enzy mes in plants. These are invertase and sucrose synthase, the latter mediating a reversib le reaction. They are both pivotal in the control of carbohydrate partitioning and utilization (Koch et al. 1996). These enzymes are also cen tral to sugar-regulated gene expression, since the irreversible invertase reaction provides more substrates for hexose-based sugar sensing than does the sucrose syntha se reaction (Jang et al. 1997; Koch, 2004). In addition, invertase genes, themselves, are sugar-res ponsive (Xu et al. 1996; Godt and Roitsch, 1997; Ciereszko and Kleczkowski, 2002), pr oviding an additional mechanism for feedforward and feed-back adjustments of sugar signals to responsive genes. In maize, one of the vacuolar invertase genes, Ivr2 , is up-regulated by increasing sugar levels, whereas anot her vacuolar invertase, Ivr1 , is repressed by sugars (Xu et al., 1996). One goal of the research presented he re has been to determine whether this dichotomous sugar response by vacuolar inve rtases is common within other species. Arabidopsis was therefore chosen because of its complete sequence information and genome-wide collection of mu tants (Alonso et al., 2003).

PAGE 114

103 Vacuolar invertases belong to a well-conserved acid in vertase gene family that in Arabidopsis includes two v acuolar invertase genes ( AtvacINV1 and AtvacINV2 ) and six cell-wall invertase genes ( AtcwINV1 through AtcwINV6 ). All of them have been shown to differ in their patterns of spatial and temporal mRNA expression (Tymowska-Lalanne and Kreis, 1998b; Sherson et al., 2003). To determine possible roles for vacuolar versus cell wall invertases at different times and si tes during Arabidopsis development, methods and materials were developed for absolute, qua ntitative, real-time RT-PCR for this gene family. This approach provided a quantitati ve, gene-specific comparison of expression for different members of the acid inve rtase family. Results showed that AtvacINV1 and AtvacINV2 mRNA predominated in vegetative ti ssues, typically at levels many-fold greater than the cell wall invertases. Sugar regulation of vacuolar invertase genes was thus studied in greater depth using 2-wk-old, rosette-stage Arabidopsis plan ts. Analyses of time courses for responses and effects of different sugar leve ls showed that sugars induced AtvacINV1 slowly and in a dose-dependent manner, but that repression of AtvacINV2 occurred in less than 30 min and exhibited a threshold-type response to relatively limited sugar abundance. Despite glucose induction of the AtvacINV2 promoter (tested as a promoterGUS fusion) its mRNA longevity (quantified in transcrip tional-blocking experiments) was severely reduced in the glucose treatment. Thes e data implicated a posttranscriptional contribution to control of the Arabidopsis AtvacINV2 vacuolar invertase gene. This interpretation was further supported by id entification of two DSTs (downstream elements) for instability of plant mRNA (Sullivan et al ., 1996) in the 3Â’ UTR of the

PAGE 115

104 AtvacINV2 . Glucose-based destabilization of mRNA could thus provide an overriding contribution to the capacity for this suga r to rapidly repress gene expression. AtvacINV2 was repressed by sucrose and two non-metabolizable sucrose analogs, palatinose and turanose, indicating that dis accharide sensing was also controlling gene expression of AtvacINV2 . In addition, AtvacINV2 was down-regulated by glucose and 2deoxyglucose, but not 3-o-methylglucopyranos e; showing that gl ucose repression of AtvacINV2 also included hexokinase-depende nt mechanisms. Levels of AtvacINV2 mRNA were repressed by both its enzyme s ubstrate and products. A sugar-repressed vacuolar invertase has also been found in maize (Xu et al., 1996), tomato (Godt and Roitsch, 1997), rice (Huang, data not show n), and Arabidopsis (present work). Reciprocal sugar responses of the two vac uolar invertases at the mRNA level may be responsible for a precise balance of expression across di fferent conditions. Another primary goal of the research presen ted here has been to test potential roles for individual vacuolar invert ases. A genetic approach was made possible by availability of vacuolar invertase mutants disrupted by T-DNA insertions. Single mutants were used to generate double mutants lacking detectable transcripts for eith er of the vacuolar invertases. The status of each mutant was confirmed by genomic PCR and Southern blot analyses. Transcript levels were tested by Northern blot and RT-PCR. Enzyme activity in the vacuolar (soluble) fraction was redu ced to non-detectable levels in the double mutant. A molecular phenotype was observe d for both single and double mutants, each generating a unique profile of expression among other members of the invertase and sucrose synthase gene families. This indicated not only that compensation occurred at transcriptional levels across multiple sucrose-cleaving enzymes, but also that each of the

PAGE 116

105 vacuolar invertases had specific effects on signa ls to other responsive genes. A visible, altered-root-length phenotype was also obser ved for these mutants on minimal medium. Data presented in this study indicated that vacuolar invertases function not only as metabolic enzymes, but also in fluence regulatory mechanisms. Overall, work presented here extends our understanding of the roles and regulation of acid invertases in seve ral significant ways. 1. The bioinformatic analysis of all eight acid invertases in Arabidopsis (from the amino acid level to genomic organiza tion) provided basic clues to their evolutionary origins. 2. Absolute, quantitative real-time RT-P CR provided a quantitative gene-specific comparison for acid invertase family members. Evidence showed that AtvacINV1 and AtvacINV2 , predominated in vegetative tissues, whereas AtcwINV2 and AtcwINV4 predominated in reproductive organs. 3. A dichotomous sugar response by vacuolar invertases was shown to extend across monocot (maize) and dicot (Arabidopsis) species, indicating a possibly widespread role for this regulation. 4. Sugar repression of the AtvacINV2 invertase appeared to involve both disaccharide sensing at the plasma membrane and hexokinase-dependant signals. 5. Based on homology of amino acid sequences of AtvacINV1 , two vacuolar invertases were predicted. Their predic ted enzyme functions were confirmed by loss of function from muta nt analysis. Double muta nts, dysfunctional for both vacuolar invertases genes did not contain any detectable solubl e acid invertases activity, indicating that the entirety of th is activity was encoded by these two genes in Arabidopsis. 6. The molecular phenotype of single inve rtase mutants included altered mRNA levels for cell wall invertases and sucrose synthases, that was consistent with an upstream role of the AtvacINV1 vacuolar invertase in sugar signaling. A more complex relationship was evident for AtvacINV2 . 7. A visible phenotype for vacuol ar invertase mutants was also evident in their altered root length on minimal medi um, indicating significant roles for these genes in the growth of roots.

PAGE 117

106 LIST OF REFERENCES Alonso JM, Stepanova AN, Le isse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrin ab C, Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Nduba ku R, Schmidt I, Guzman P, AguilarHenonin L, Schmid M, Weigel D, Cart er DE, Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecke r JR. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science. 301: 653-657. Andersen MN, Asch F, Wu Y, Jensen CR, Naested H, Mogensen VO, Koch KE. (2002) Soluble invertase expression is an early target of drought stress during the critical, abortion-sensitive phase of young ovary development in maize. Plant Physiol. 130: 591-604. Araki T, and Komeda Y. (1993) Flowering in darkness in Arabidopsis thaliana . Plant J. 4: 801–811. Arenas-Huertero F, Arroyo A, Zhou L, Sheen J, Leon P. (2000) Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev. 14: 2085-2096. Avonce N, Leyman B, Thevelein J, Itur riaga G. (2005) Trehalose metabolism and glucose sensing in plants. Biochem Soc Trans. 33: 276-279. Bate NJ, Niu X, Wang Y, Reimann KS, Helent jaris TG. (2003) An invertase inhibitor from maize localizes to the embryo surrounding region during early kernel development. Plant Physiol. 134: 1-9. Baud S, Vaultier MN, Rochat C. (2004) Stru cture and expression pr ofile of the sucrose synthase multigene family in Arabidopsis . J Exp Bot. 55: 397-409. Bracho G, Whitaker JR. (1990) Characteristics of the inhibition of potato (Solanum tuberosum) invertase by an endogenous prot einaceous inhibitor in potatoes. Plant Physiol. 92: 381-385. Bradford MM. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye bindi ng. Anal Biochem. 72: 248-254.

PAGE 118

107 Bustin S. (2000) Absolute qua ntification of mRNA using r eal-time reverse transcription polymerase chain reaction assays. Jour nal of Molecular Endocrinology. 25: 169– 193. Chaivisuthangkura P, Mercier RW, Gogarten JP. (1998) Antisense stimulation of apoplastic invertas e in transgenic Arabidopsis thaliana. Abstracts of the American Society of Plant Biologists. 40:345. Charrier B, Champion A, Henry Y, Kreis M. (2002) Expression prof iling of the whole Arabidopsis shaggy-like kinase multigene family by real-time reverse transcriptasepolymerase chain reaction. Plant Physiol. 130: 577–590. Cheng WH, Endo A, Zhou L, Penney J, Chen HC, Arroyo A, Leon P, Nambara E, Asami T, Seo M, Koshiba T, Sheen J. (2002) A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. Plant Cell. 14: 2723-2743. Cheng WH, Taliercio EW, Chourey PS. (1996) The miniature1 seed locus of maize encodes a cell wall invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell. 8: 971–983. Corbesier L, Lejeune P, Bernier G. (1998). Th e role of carbohydrates in the induction of flowering in Arabidopsis thaliana : Comparison between the wild type and a starchless mutant. Planta. 206: 131–137. Corpet F. (1988) Multiple sequence alignment with hierarchical clustering. Nucl. Acids Res. 16: 10881-10890. De Coninck B, Le Roy K, Francis I, Cler ens S, Vergauwen R, Halliday AM, Smith SM, Van Laere A, Van den Ende W (2005) Arabidopsis AtcwINV3 and 6 are not invertases but are fructan exohydrolases (FEHs) with different substrate specificities. Plant Ce ll Environ. 28: 432-443. Dickinson CD, Altabella T, Chrispeels MJ. (1991) Slow-growth phenotype of transgenic tomato expressing apoplastic inve rtase. Plant Physiol. 95: 420-425 Dijkwel PP, Huijser C, Weisbeek PJ, Chua NH, Smeekens SC. (1997) Sucrose control of phytochrome A signaling in Arabid opsis. Plant Cell. 9: 583-595. Dorion S, Lalonde S, Saini HS. (1996) Inducti on of male sterility in wheat by meioticstage water deficit is preceded by a dec line in invertase activity and changes in carbohydrate metabolism in anthers. Plant Physiol. 111: 137-145. Eastmond PJ, van Dijken AJ, Spielman M, Ke rr A, Tissier AF, Dickinson HG, Jones JD, Smeekens SC, Graham IA. (2002) Trehal ose-6-phosphate synthase 1, which catalyses the first step in trehalose synthesis, is esse ntial for Arabidopsis embryo maturation. Plant J. 29: 225-235.

PAGE 119

108 Farrar, J. (1996) Regulation of shoot-root ratio is mediated by sucrose. Plant Soil 185: 13-19. Fernie AR, Roessner U, Geigenberger P. ( 2001) The sucrose analog palatinose leads to a stimulation of sucrose degradation and star ch synthesis when supplied to discs of growing potato tubers. Pl ant Physiol. 125: 1967-1977. Fotopoulos V, Gilbert MJ, Pittman JK, Marv ier AC, Buchanan AJ, Sauer N, Hall JL, Williams LE. (2003) The monosaccharide transporter gene, AtSTP4, and the cellwall invertase, Atbetafruct1, are induced in Arabidopsis during infection with the fungal biotroph Erysiphe cichoracearum . Plant Physiol. 132: 821-829. Fridman E, Zamir D. (2003) Functional divergen ce of a syntenic invertase gene family in tomato, potato, and Arabidops is. Plant Physiol.131:603-609. Gazzarrini S, McCourt P. (2003) Cross-ta lk in plant hormone signalling: what Arabidopsis mutants are tel ling us. Ann Bot. 91: 605-612. Gibson SI, Laby RJ, Kim D. (2001) The sugar-in sensitive1 (sis1) mutant of Arabidopsis is allelic to ctr1. Bioche m Biophys Res Commun. 280: 196-203. Goddijn O, Smeekens S. (1998) Sensing trehal ose biosynthesis in pl ants. Plant J. 14: 143146. Goetz M, Godt DE, Roitsch T. (1997) Regul ation and tissue-specific distribution of mRNAs for three extracellu lar invertase isoenzymes of tomato suggests an important function in establishing and main taining sink metabolism. Plant Physiol. 115: 273-282. Goetz M, Roitsch T. (1999) The different pH optima and substrate specificities of extracellular and vacuolar invertases from plants are determined by a single aminoacid substitution. Pl ant J. 20:707-711. Gonzalez MC, Roitsch T, Cejudo FJ. (2005) Ci rcadian and developmental regulation of vacuolar invertase expression in petioles of sugar beet plants. Planta. 222:386-395. Greiner S, Krausgrill S, Rausch T. (1998) Cloning of a tobacco apoplasmic invertase inhibitor: proof of functi on of the recombinant protei n and expression analysis during plant development. Plant Physiol. 116: 733-742. Greiner S, Rausch T, Sonnewald U, Herbers K. (1999) Ectopic expression of a tobacco invertase inhibitor homolog pr events cold-induced sweeten ing of potato tubers.Nat Biotechnol. 17: 708-711. Gutierrez RA, Ewing RM, Cherry JM, Green PJ. (2002) Identification of unstable transcripts in Arabidopsis by cDNA microarra y analysis: rapid decay is associated with a group of touchand specific clockcontrolled genes. Proc Natl Acad Sci U S A. 99: 11513-11518.

PAGE 120

109 Hajirezaei MR, Takahata Y, Trethewey RN, Willmitzer L, Sonnewald U. (2000) Impact of elevated cytosolic and apoplastic invertas e activity on carbon metabolism during potato tuber development. J Exp Bot. 51: 439-445. Halford NG, Paul MJ. (2003) Carbon metabolite sensing a nd signaling. Plant Biotech J. 1: 381-398. Halford NG, Purcell PC, Hardie DG (1999) Is hexokinase really a sugar sensor in plants?Trends Plant Sci. 4: 117-120. Haouazine-Takvorian N, Tymowska-Lalanne Z, Takvorian A, Tregear J, Lejeune B, Lecharny A, Kreis M. (1997) Charac terization of two members of the Arabidopsis thaliana gene family, At beta fruct3 and At beta fruct4, coding for vacuolar invertases. Gene. 197: 239-251. Hardin SC, Winter H, Huber SC. (2004) Phos phorylation of the amino terminus of maize sucrose synthase in relation to membrane association and enzyme activity. Plant Physiol. 134: 1427-1438. Harmer SL, Hogenesch JB, Straume M, Cha ng HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA. (2000) Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science. 290: 2110-2113. Heineke D, Sonnewald U, Büssis D, Günter G, Leidreiter K, Wilke I, Raschke K, Willmitzer L, Heldt HW (1992) Apoplastic expression of yeast-de rived invertase in potato: effects on photosynthesis, leaf solute composition, water relations, and tuber composition. Plant Physiol. 100: 301-308. Herbers K, Meuwly P, Frommer WB, Mé traux JP, Sonnewald U (1996) Systemic acquired resistance mediated by the ect opic expression of i nvertase: possible hexose sensing in the secretory pathway. Plant Cell. 8: 793-803. Ho SL, Chao YC, Tong WF, Yu SM. (2001). Sugar coordinately and differentially regulates growthand stress-related gene expression via a complex signal transduction network and multiple contro l mechanisms. Plant Physiol. 125: 877– 890. Hothorn M, Wolf S, Aloy P, Gr einer S, Scheffzek K. (2004) Structural insights into the target specificity of plant invertase and p ectin methylesterase inhibitory proteins. Plant Cell.16:3437-3447. Jang JC, Leon P, Zhou L, Sheen J (1997) Hexokina se as a sugar sensor in higher plants. Plant Cell 9: 5-19. Jang JC, Sheen J. (1994). Sugar sensing in higher plants. Plant Cell. 6: 1665–1679. Jefferson R, Goldsbrough A, Bevan M. (1990) Transcriptional regula tion of a patatin-1 gene in potato. Plant Mol Biol. 14: 995-1006.

PAGE 121

110 Ji X, Van den Ende W, Van Laere A, Cheng S, Bennett J (2005) Struct ure, evolution, and expression of the two invertase gene families of rice. J Mol Evol. 60: 615-634. Jiang CZ, Rodermel SR, and Shibles RM. ( 1993). Photosynthesis, Rubisco activity and amount, and their regulation by transcripti on in senescing soybean leaves. Plant Physiol. 101: 105–112. Johnston M. (1999) Feasting, fasting and ferm enting. Glucose sensing in yeast and other cells. Trends Genet.15:29-33. Junker BH, Wuttke R, Nunes-Nesi A, Steinhaus er D, Schauer N, Bussis D, Willmitzer L, Fernie AR. (2006) Enhancing vacuolar su crose cleavage within the developing potato tuber has only minor effects on me tabolism. Plant Cell Physiol. 47: 277-289. Klann EM, Hall B, Bennett AB. (19 96) Antisense acid invertase ( TIV1 ) gene alters soluble sugar composition and size in transg enic tomato fruit. Plant Physiol. 112: 1321-1330 Klein D, Stitt M. (1998). Effects of 2-de oxyglucose on the expression of RBCS and the metabolism of Chenopodium rubrum cell cultures. Planta 205: 223–234. Koch KE, Nolte KD, Duke ER, McCarty DR, Avigne WT. (1992) Sugar levels modulate differential expression of maize sucrose synthase genes. Plant Cell. 4: 59-69. Koch KE. (1996) Carbohydrate-modulated gene expression in plants. Annu Rev Plant Physiol Plant Mol Biol 47: 509-540. Koch KE. (2004) Sucrose metabolism: regulator y mechanisms and pivo tal roles in sugar sensing and plant development. Curr Opin Plant Biol. 7: 235-246. Kohorn BD, Kobayashi M, Johansen S, Riese J, Huang L-F, Koch K, Fu S, Dotson A, Byers N. (2006) An Arabidopsis cell wall-as sociated kinase required for invertase activity and cell growth. Pl ant Journal. 46: 307-316. Koonjul PK, Minhas JS, Nunes C, Sheoran IS, Saini HS. (2005) Sele ctive transcriptional down-regulation of anther invertases preced es the failure of pollen development in water-stressed wheat. J Exp Bot. 56: 179-190. Kowalski SP, Lan TH, Feldmann KA, Pate rson AH. (1994) Comparative mapping of Arabidopsis thaliana and Brassica oleracea chromosomes rev eals islands of conserved organization. Genetics. 138: 499-510 Krausgrill S, Sander A, Greiner S,Weil M, Rausch T. (1996) Regulation of cell wall invertase by a proteinaceous inhi bitor. J. Exp. Bot. 47: 1193-1198. Laby RJ, Kincaid MS, Kim D, Gibson SI. ( 2000) The Arabidopsis sugar-insensitive mutants sis4 and sis5 are def ective in abscisic acid synt hesis and response. Plant J. 23: 587-596.

PAGE 122

111 Lalonde S, Bolos E, Hellmann H, Barker L, Patrick JW, Fromme r WB, Ward JM (1999) The dual function of sugar carriers: trans port and sugar sensing. Plant Cell 11: 707728. Lalonde S, Wipf D, Fromme r WB. (2004) Transport mechanisms for organic forms of carbon and nitrogen between source a nd sink. Annu Rev Plant Biol. 55: 341-372. Leggewie G, Kolbe A, Lemoine R, Roessner U, Lytovchenko A, Zuther E, Kehr J, Frommer WB, Riesmeier JW, Willmitzer L, Fernie AR. (2003) Overexpression of the sucrose transporter SoSUT1 in potato results in alteratio ns in leaf carbon partitioning and in tuber metabolism but has little impact on tuber morphology. Planta. 217:158-167. Leon P, Sheen J. (2003) Sugar and hormone co nnections. Trends Plant Sci. 8: 110-116. Link M, Rausch T, Greiner S. (2004) In Arabidopsis thaliana , the invertase inhibitors AtC/VIF1 and 2 exhibit distin ct target enzyme specificiti es and expression profiles. FEBS Lett. 573:105-109. Long JC, Zhao W, Rashotte AM, Muday GK, Huber SC. (2002) Gravity-stimulated changes in auxin and invertase gene e xpression in maize pulvinal cells. Plant Physiol. 128:591-602. Loreti E, Alpi A, Perata P. (2000) Gluc ose and disaccharide-sensing mechanisms modulate the expression of alpha-amylase in barley embryos. Plant Physiol. 123: 939-948. Martínez-Zapater JM, Salinas J. (1998) Ar abidopsis protocols, methods in molecular biology (Clifton, N.J.); V. 82 Totowa , N.J. Humana Press, pp16. M'Batchi B, Delrot S. (1988) Stimulati on of sugar exit from leaf tissues of vicia faba L. Planta. 174: 340-348 Moore B, Zhou L, Rolland F, Hall Q, Cheng WH, Liu YX, Hwang I, Jones T, Sheen J. (2003) Role of the Arabidopsis glucose sensor HXK1 in nutrient, light, and hormonal signaling. Science. 300: 332-336. Müller J, Aeschbacher RA, Wingler A, Bo ller T, Wiemken A. (2001). Trehalose and trehalase in Arabidopsis. Plant Physiol. 125: 1086–1093. Müller J, Boller T, Wiemken A. (1998). Trehal ose affects sucrose synthase and invertase activities in soybean ( Glycine max [L.] Merr.) roots. J Plant Physiol. 153: 255–257. Müller-Röber BT, Kossmann J, Hannah LC, W illmitzer L, Sonnewald U. (1990) One of two different ADP-glucose pyrophosphorylas e genes from potato responds strongly to elevated levels of sucr ose. Mol Gen Genet. 224: 136-146.

PAGE 123

112 Orsel M, Krapp A, Daniel-Vedele F. (2002) Analysis of the NRT2 nitrate transporter family in Arabidopsis. Structure and ge ne expression. Plant Physiology. 129: 886– 896. Özcan S, Dover J, Jonston M (1998) Gluc ose sensing and signalling by two glucose receptors in the yeast Saccharomyces cerevisiae . EMBO J. 17: 2666-2673 Paterson AH, Bowers JE, Burow MD, Draye X, Elsik CG, Jiang CX, Katsar CS, Lan TH, Lin YR, Ming R, Wright RJ . (2000) Comparative genomic s of plant chromosomes. Plant Cell. 12: 1523-1540. Purcell PC, Smith AM, Halford NG. (1998) Antisense expression of a sucrose nonfermenting-1-related protein kinase se quence in potato results in decreased expression of sucrose synthase in tubers and loss of sucrose-inducibility of sucrose synthase transcripts in le aves. Plant J. 14: 195-202. Ramloch-Lorenz K, Knudsen S, Sturm A. ( 1993) Molecular characterization of the gene for carrot cell wall beta-fruct osidase. Plant J. 4: 545-554. Rausch T, Greiner S. (2004) Plant protei n inhibitors of inve rtases. Biochim Biophys Acta. 12: 253-261. Roitsch T, Balibrea ME, Hofmann M, Pr oels R, Sinha AK. (2003) Extracellular invertase: key metabolic enzyme a nd PR protein. J Exp Bot. 54: 513-524. Roitsch T, Bittner M, Godt DE. (1995) Induction of apoplastic invertase of Chenopodium rubrum by D-glucose and a glucose analog a nd tissue-specific expression suggest a role in sink-source regulati on. Plant Physiol. 108: 285-294. Roitsch T, Gonzalez MC. (2004) Function a nd regulation of plan t invertases: sweet sensations. Trends Plant Sci. 9:606-613. Rojo E, Zouhar J, Carter C, Kovaleva V, Raikhel NV. (2003) A unique mechanism for protein processing and degradation in Arabidopsis thaliana . Proc Natl Acad Sci U S A. 100: 7389-7394. Rolland F, Moore B, Sheen J. (2002) Sugar se nsing and signaling in plants. Plant Cell. 14 Suppl: S185-205. Rolland F, Sheen J. (2005) Sugar sensing and signaling networks in plants. Biochem Soc Trans. 33: 269-271. Rolland F, Wanke V, Cauwenberg L, Ma P, Boles E, Vanoni M, de Winde JH, Thevelein JM, Winderickx J. (2001) The role of hexose transport and phosphorylation in cAMP signalling in the yeast Saccharomyces cerevisiae. FEMS Yeast Res. 1: 3345.

PAGE 124

113 Rook F, Gerrits N, Kortstee A, Kampen M, Borrias M, Weisbeek P, Smeekens S. (1998) Sucrose-specific signalling represses tran slation of the Arabidopsis ATB2 bZIP transcription factor ge ne. Plant J. 15: 253-263. Schluepmann H, van Dijken A, Aghdasi M, Wobbes B, Paul M, Smeekens S. (2004) Trehalose mediated growth inhibition of Ar abidopsis seedlings is due to trehalose6-phosphate accumulation.Plant Physiol. 135: 879-890. Sergeeva LI, Keurentjes JJ, Bentsink L, Vonk J, van der Plas LH, Koornneef M, Vreugdenhil D. (2006) Vacuolar i nvertase regulate s elongation of Arabidopsis thaliana roots as revealed by QTL and mutant analysis. Proc Natl Acad Sci U S A. 103: 2994-2999. Sherson SM, Alford HL, Forbes SM, Wallace G, Smith SM. (2003) Roles of cell-wall invertases and monosaccharide transporters in the growth and development of Arabidopsis. J Exp Bot. 54: 525-531. Simpson CG, Hedley PE, Watters JA, Clar k GP, McQuade C, Machray GC, Brown JW. (2000) Requirements for mini-exon inclus ion in potato invertase mRNAs provides evidence for exon-scanning interactio ns in plants. RNA. 6: 422-433. Sinha AK, Hofmann MG, Romer U, Kockenberger W, Elling L, Roitsch T. (2002) Metabolizable and non-metabolizable sugars activate different signal transduction pathways in tomato. Plant Physiol. 128: 1480-1489. Smeekens, JCM. (2000) Sugar-induced signal transduction in plants. Ann Rev Plant Physiol Plant Mol Biol. 51: 49-81. Sonnewald U, Brauer M, von Schaewen A, Stitt M, Willmitzer L. (1991) Transgenic tobacco plants expressing yeast-derived inve rtase in either the cytosol, vacuole or the apoplast: A powerful tool for studyi ng sucrose metabolism and sink/source interactions. Plant J. 1:95-106. Sonnewald U, Hajirezaei MR, Kossmann J, Heyer A, Trethewey RN, Willmitzer L. (1997) Increased potato tuber size resulti ng from apoplastic expression of a yeast invertase. Nat Biotechnol. 15(8): 794-797. Stessman D, Miller A, Spalding M, Rode rmel S. (2002) Regula tion of photosynthesis during Arabidopsis leaf development in continuous light. Photosynth Res. 72: 2737. Stessman DJ. (2004) Carbohydrate pa rtitioning and photosynthesis in Arabidopsis thaliana . PhD Dissertation, Iowa State University, Ames, Iowa. Sturm A. (1999) Invertases. Pr imary structures, functions, an d roles in plant development and sucrose partitioning. Plant Physiol. 121: 1-8.

PAGE 125

114 Sullivan ML, Green PJ. (1996) Mutational analys is of the DST element in tobacco cells and transgenic plants: identification of residues critical for mRNA instability. RNA. 2: 308-315. Tang GQ, Luscher M, Sturm A. (1999) Antisen se repression of vacuolar and cell wall invertase in transgenic carrot alters early plant development and sucrose partitioning. Plant Cell. 11: 177-189. Tang X, Ruffner HP, Scholes JD, Rolfe SA. (1996) Purification and characterisation of soluble invertases from leaves of Arabidopsis thaliana . Planta. 198: 17-23. Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignm ent through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Ac ids Res. 22: 4673-4680. Trouverie J, Chateau-Joubert S, Thevenot C, Jacquemot MP, Prioul JL. (2003) Regulation of vacuolar invert ase by abscisic acid or glucose in leaves and roots from maize plantlets. Planta. 219: 894-905. Tymowska-Lalanne Z, Kreis M. (1998a) Expression of the Arabidopsis thaliana invertase gene family. Planta. 207: 259-265. Tymowska-Lalanne Z, Kreis M. (1998b) The plant invertases: physiology, biochemistry and molecular biology. Advance in Bot Re s Inccop Adv in plant pathol. 28: 71117. Tymowska-Lalanne Z, Schwebel-Dugue, N, L echarny A, Kreis M. (1996) Expression and cis -acting elements of the At fruct1 gene from Arabidopsis thaliana encoding a cell wall invertase. Plant Physiol and Biochem. 34: 431-442. van Dijken AJ, Schluepmann H, Smeeken s SC. (2004) Arabidopsis trehalose-6phosphate synthase 1 is essential for norma l vegetative growth and transition to flowering. Plant Physiol. 135:969-977. Vargas W, Cumino A, Salerno GL. (2003) Cy anobacterial alkaline/n eutral invertases. Origin of sucrose hydrolysis in th e plant cytosol? Planta. 216: 951-960. von Schaewen A, Stitt M, Schmidt R, Sonnewald U, Willmitzer L. (1990) Expression of a yeast-derived invertase in the cell wall of tobacco and Arabidopsis plants leads to accumulation of carbohydrate and inhibiti on of photosynthesis and strongly influences growth and phenotype of tr ansgenic tobacco plants. EMBO J.9: 30333044. Wingler A, Fritzius T, Wiemken A, Boller T, Aeschbacher RA. (2000) Trehalose induces the ADP-glucose pyrophosphorylase gene , ApL3, and starch synthesis in Arabidopsis. Plant Physiol. 124: 105-114.

PAGE 126

115 Winter H, Huber SC. (2000) Regulation of sucrose metabolism in higher plants: localization and regulation of activity of key enzymes. Crit Rev Biochem Mol Biol. 35: 253-289. Xiao W, Sheen J, Jang JC. (2000) The ro le of hexokinase in plant sugar signal transduction and growth and develo pment. Plant Mol Biol. 44: 451-461. Xu, J, Avigne, WT, McCarty, DR, Koch, KE . (1996) A similar dichotomy of sugar modulation and development expression aff ects both paths of sucrose metabolism: evidence from maize invertase gene family. Plant Cell. 8: 1209-1220. Yamada K, Lim J, Dale JM, Chen H, Shinn P, Palm CJ, Southwick AM, Wu HC, Kim C, Nguyen M, Pham P, Cheuk R, Karlin-New mann G, Liu SX, Lam B, Sakano H, Wu T, Yu G, Miranda M, Quach HL, Tripp M, Chang CH, Lee JM, Toriumi M, Chan MM, Tang CC, Onodera CS, Deng JM, Akiyama K, Ansari Y, Arakawa T, Banh J, Banno F, Bowser L, Brooks S, Carninci P, Chao Q, Choy N, Enju A, Goldsmith AD, Gurjal M, Hansen NF, Hayashizaki Y, Johnson-Hopson C, Hsuan VW, Iida K, Karnes M, Khan S, Koesema E, Ishida J, Jiang PX, Jones T, Kawai J, Kamiya A, Meyers C, Nakajima M, Narusaka M, Se ki M, Sakurai T, Satou M, Tamse R, Vaysberg M, Wallender EK, Wong C, Yamamu ra Y, Yuan S, Shinozaki K, Davis RW, Theologis A, Ecker JR. (2003) Empirical analysis of transcriptional activity in the Arabidopsis genome.Science. 302: 842-846. Yamaguchi, H. (2002) Chaperone-like functi ons of N-glycans in the formation and stabilization of protein conformation. Trend Glycosci Gl ycotechnol.14: 139-151. Yokoyama R, Nishitani K. (2001) A comprehe nsive expression analysis of all the members of a gene family encoding cell-w all construction in specific organs of Arabidopsis. Plant Cell Physiol. 42: 1025–1033. Yu SM, Lee YC, Fang SC, Chan MT, Hwa SF, Liu LF. (1996) Sugars act as signal molecules and osmotica to regulate the expression of -amylase genes and metabolic activities in ge rminating cereal grains. Plant Mol Biol 30: 1277-1289. Zeng Y, Wu Y, Avigne WT, Koch KE. (1999) Rapid repression of maize invertases by low oxygen. Invertase/sucrose synthase ba lance, sugar signaling potential, and seedling survival. Plant Physiol. 121: 599-608. Zrenner R, Schüler K, Sonnewald U. (1996) Soluble acid invert ase determines the hexose-to-sucrose ratio in cold-store d potato tubers. Planta 198: 246-252

PAGE 127

116 BIOGRAPHICAL SKETCH Li-Fen Huang was born on March 26, 1972, in Taipei County, Taiwan, R.O.C. She entered National Taiwan University, Taipei , Taiwan, in September 1990 and earned her Bachelor of Science degree in the department of Botany in July 1994. Then she started her graduate work in the same department with Dr. Shih-Tong Jeng in September 1994 for a study of multiple poly(A) signals in plants, where she recei ved her Master of Science degree in Botany in July 1996. After that, Li-Fen Huang worked with Dr. Su-May Yu, from 1996 to 2001, as a research assistant in the Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan. In this period of time, she successfully engineered rice as a bioreactor to express human serum albumin in suspension cell systems. For this work she won the best poster presentation and was promoted in 1998. She wa s also involved in the study of the sugar regulation mechanism of alpha-amylase and the targeting of its signal peptide. In September 2001, Li-Fen Huang began her Ph.D. training in the Plant Molecular and Cellular Program at the University of Fl orida to study the function and regulation of vacuolar invertases in Arabidopsis. For this part of her research, she received an award for the best student presen tation at a workshop of the Plant Molecular and Cellular Biology Program at Daytona Beach, Florida, in May 2005, and a Graduate School Travel Award to present her work to the American Society of Plant Bi ologists in Seattle, Washington, July, 2005. The work detailed in this dissertation was conducted in the laboratory of Dr. Karen Koch.