Citation
Genome Sequence and Molecular Characterization of Homalodisca coagulata virus-1, a Novel Virus Discovered in the Glassy-Winged Sharpshooter (Hemiptera: Cicadellidae)

Material Information

Title:
Genome Sequence and Molecular Characterization of Homalodisca coagulata virus-1, a Novel Virus Discovered in the Glassy-Winged Sharpshooter (Hemiptera: Cicadellidae)
Creator:
HUNNICUTT, LAURA E.
Copyright Date:
2008

Subjects

Subjects / Keywords:
Amino acids ( jstor )
Dicistroviridae ( jstor )
Gels ( jstor )
Genomes ( jstor )
Insects ( jstor )
Open reading frames ( jstor )
Reverse transcriptase polymerase chain reaction ( jstor )
RNA ( jstor )
Virology ( jstor )
Viruses ( jstor )
Gadsden County ( local )

Record Information

Source Institution:
University of Florida
Holding Location:
University of Florida
Rights Management:
Copyright Laura E. Hunnicutt. Permission granted to the University of Florida to digitize, archive and distribute this item for non-profit research and educational purposes. Any reuse of this item in excess of fair use or other copyright exemptions requires permission of the copyright holder.
Embargo Date:
6/30/2006
Resource Identifier:
443999078 ( OCLC )

Downloads

This item is only available as the following downloads:


Full Text

PAGE 1

GENOME SEQUENCE AND MOLECULAR CHARACTERIZATION OF Homalodisca coagulata virus-1, A NOVEL VIRUS DISCOVERED IN THE GLASSYWINGED SHARPSHOOTER (HEMIPTERA: CICADELLIDAE) By LAURA E. HUNNICUTT A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Laura E. Hunnicutt

PAGE 3

ACKNOWLEDGMENTS There are many people without whom eff ecting this thesis and the research described herein would not have been possible. I would first like to take the opportunity to thank my supervisory chair, Dr. Ron Cave. Dr. Cave was instrume ntal not only as an excellent instructor but also as a constant source of direct ion, support, and encouragement over the past two years. I would also like to thank the supplementary members of my committee including Dr. Chuck Powell for his ap proachability and insight regarding my thesis research as well as his adept critical review of the resultant journal manuscripts. I would like to extend a special thanks to Dr . Wayne Hunter who generously apportioned CRIS funds to finance this pr oject and exposed me to a remarkably creative way of viewing science and sc ientific discovery. I am very appreciative to my colleague s at the USDA ARS U.S. Horticultural Research Laboratory (Ft. Pierce, Florida) for providing an educational, and often entertaining, work environment. I would like to thank Matt Hentz for help with insect collection, Dr. Phat Dang for help with ES T sequencing, Dr. Bob Shatters for helpful discussions pertaining to general molecular biology concepts/theorems, and Dr. Laura Boykin for providing critical a ssistance with phylogenetic an alyses on this and other works. I would especially like to thank Jerry Mozoruk, with whom I spent nearly all of graduate school working side-by-side. I will always be grateful to him for being such a wonderful friend and mentor to me. iii

PAGE 4

I would also like to acknowledge thos e associates who acted as outside collaborators. I thank Drs. Chris Tippi ng and Russ Mizell (Unive rsity of Florida, NFREC) for help in collecting Homalodisca coagulata and Oncometopia nigricans in Quincy, Florida, and their direction regarding collections made in Cairo, Georgia. I am thankful to Dr. Heather Costa (University of California, Riverside) as well as Dr. Gary Puterka and Mike Reinke (USDA ARS AFRS) for samples of H. coagulata from California; Tina Winstrom (University of California, Berkeley) and Robert Keiffer (University of California, Davis Hopl and Field Station) for samples of Draeculacephala minerva and Graphocephala atropunctata from California; and Dr. Renato Bautista (Hawaii Department of Agriculture Plant I ndustry Division) for valuable information regarding H. coagulata collection sites in Oahu, Hawaii. Finally, I am very grateful to my family for their unwavering support and encouragement. I would especially like to thank my parents, Kermit Hunnicutt and Barbara Hunnicutt-Greenwell, for instilling in me the work ethic and ambition which enabled me to reach this goal. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iii LIST OF TABLES ............................................................................................................vii LIST OF FIGURES .........................................................................................................viii ABSTRACT .........................................................................................................................x CHAPTER 1 INTRODUCTION........................................................................................................1 2 MATERIALS AND METHODS.................................................................................4 Sequencing of the HoCV-1 Genome .............................................................................4 cDNA Library Construction ..................................................................................4 5 -Rapid Amplification of cDNA Ends (RACE)...................................................5 Sequence Verification and Cloning ..............................................................................6 Computer Analysis of HoCV-1 Nucleic Acid and Deduced Protein Sequences ..........7 Theoretical Modeling of the HoCV-1 RNA-dependent RNA Polymerase (RdRp) ......8 Development and Application of an RT-PCR Assay to Determine the Geographical Distribution a nd Natural Host Range of HoCV-1 .............................8 Insect Sampling .....................................................................................................8 Sample Preparation and RT-PCR Analysis ...........................................................9 RT-PCR Primer Design.......................................................................................10 Determination of the Sensitivity of Amplification of HoCV-1 by RT-PCR .......10 3 RESULTS AND DISCUSSION.................................................................................12 Nucleotide Sequence of HoCV-1 ................................................................................12 Similarity with Other Taxa in Regards to Partition and Arrangement of the Genome ..................................................................................................................20 Alignment of the Amino Acid Sequences of Viral Non-structural Proteins with HoCV-1 ORF1 .......................................................................................................21 The RNA-dependent RNA Po lymerase (RdRp) Domain ....................................21 The Nucleotide-binding (Helicase) Domain .......................................................26 The Protease Domain ..........................................................................................29 The Intergenic Region (IGR) of HoCV-1 ...................................................................30 v

PAGE 6

Mapping of the Coding Region of the Structural Proteins .........................................32 Analysis of the HoCV-1 ORF2 Amino Acid Product .........................................32 Structural Models of the HoCV-1 Capsid Proteins ..............................................35 Phylogenetic Analysis ................................................................................................38 Development of an RT-PCR Assay as a Diagnostic Tool for Sharpshooter Virus Detection ................................................................................................................39 Incidence of HoCV-1 Infection in Geographically Disparate Regions of North America ..................................................................................................................41 4 CONCLUSION...........................................................................................................44 APPENDIX -RT-PCR ASSAY GEL IMAGES ..............................................................46 LIST OF REFERENCES ...................................................................................................50 BIOGRAPHICAL SKETCH .............................................................................................58 vi

PAGE 7

TABLE Table page 1 Survey of sharpshooter populations for the presence of HoCV-1 ............................42 vii

PAGE 8

LIST OF FIGURES Figure page 1 The nucleotide sequence of HoCV-1 genomic RNA ................................................12 2 Restriction enzyme analyses of a cloned cDNA spanning the complete HoCV-1 genome .....................................................................................................................18 3 Multiple sequence alignment of the putative RNA-dependent RNA polymerase (RdRp) domain of suggested members of the genus Cripavirus .............................22 4 Structural model analysis of the HoCV-1 RNA-dependent RNA polymerase (RdRp) ......................................................................................................................23 5 Structure of the HoCV-1 RNA-dependent RNA polymerase (RdRp) showing conserved motifs relevant to enzymatic activity ......................................................25 6 Multiple sequence alignment of the nucleotide binding (helicase) domain of suggested members of the genus Cripavirus ............................................................27 7 Multiple sequence alignment of the protease domain of suggested members of the genus Cripavirus ................................................................................................29 8 Multiple nucleotide sequence alignment of the intergenic regions (IGR) of CrPV, PSIV , RhPV , and HoCV-1 .............................................................................30 9 Secondary structure of the HoCV-1 internal ribosomal entry site (IRES) within the intergenic region as predicted by Mfold .............................................................31 10 Multiple alignment of conserved amino acid sequences specific for capsid protein 2 (CP2), 3 (CP3) and 1 (CP1) of suggested members of the genus Cripavirus .................................................................................................................33 11 Organization of the genome of HoCV-1, with the structural proteins highlighted to show the order of the individual capsid proteins .................................................34 12 The structures of the four HoCV-1 capsid proteins, CP1-4 ......................................36 13 Phylogenetic analysis of HoCV-1 and other ssRNA positive-strand viruses based on the amino acid sequence of the puta tive RNA-dependent RNA polymerase (RdRp) ......................................................................................................................39 viii

PAGE 9

14 Determination of the sensitivity of amplification by RT-PCR of the HoCV-1 ........41 15 Agarose gel analysis of RT-PCR pro ducts using total RNA from male and female Homalodisca coagulata collected from a wild population on crepe myrtle ( Lagerstroemia indica ) in Quincy, Florida (Gadsden county) .................................46 16 Agarose gel analysis of RT-PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from wild populations in Cairo, Georgia (Grady county) .........................................................................................................47 17 Agarose gel analysis of RT-PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from ye llow sticky traps secured to African tulip-trees ( Spathodea campanulata ) in Oahu, Hawaii (Honolulu county) .............47 18 Agarose gel analysis of RT-PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from a wild population on crepe myrtle ( Lagerstroemia indica ) in Ft. Pierce, Florida (St. Lucie county) .............................47 19 Agarose gel analysis of RT-PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from a wild population on crepe myrtle ( Lagerstroemia indica x ‘Natchez’) in Okeechobee, Florida (Okeechobee county) ......................................................................................................................47 20 Agarose gel analysis of RT-PCR products using total RNA from Homalodisca insolita (mixed sexes) collected from a wild population on Johnsongrass ( Sorghum halepense ) in Quincy, Florida (Gadsden county) ....................................48 21 Agarose gel analysis of RT-PCR products using total RNA from Homalodisca insolita (mixed sexes) collected from a wild population on Johnsongrass ( Sorghum halepense ) in Ft. Pierce, Florida (St. Lucie county) ................................48 22 Agarose gel analysis of RT-PCR products using total RNA from Oncometopia nigricans (mixed sexes) collected from a wild population on holly ( Ilex x meserveae ‘China Girl’) in Quincy, Florida (Gadsden county) ...............................48 23 Agarose gel analysis of RT-PCR products using total RNA from Oncometopia nigricans (mixed sexes) collected from a wild population on holly ( Ilex hybrids) in Cairo, Georgia (Grady county) ............................................................................48 24 Agarose gel analysis of RT-PCR products using total RNA from Graphocephala atropunctata and Draeculacepahala minerva (mixed sexes) collected from several wild populations in central California ..........................................................49 ix

PAGE 10

Abstract of Thesis Presen ted to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science GENOME SEQUENCE AND MOLECULAR CHARACTERIZATION OF Homalodisca coagulata virus-1, A NOVEL VIRUS DISCOVERED IN THE GLASSYWINGED SHARPSHOOTER (HEMIPTERA: CICADELLIDAE) By Laura E. Hunnicutt December 2005 Chair: Ronald D. Cave Major Department: Entomology and Nematology The complete nucleotide sequence of a novel single-stranded RNA virus infecting the glassy-winged sharpshooter, Homalodisca coagulata (Say), has been determined. In silico analysis of Homalodisca coagulata virus-1 ( HoCV-1 ) revealed a 9321 nucleotide (nt) polyadenylated genome encoding two large open reading frames (ORF1 and ORF2) separated by a 179 nt intergenic region (IGR) . The deduced amino acid sequence of the 5 -proximal ORF (ORF1, nt 420-5807) exhibited conserved core motifs characteristic of the helicases, cysteine proteas es, and RNA-dependent RNA po lymerases of other insectinfecting picorna-like viruses. A structural model created using Mfold exposed a series of stem-loop (SL) structures immediately preceding the second ORF which are analogous to an internal ribosome entry site (IRES), s uggesting that ORF2 begins with a noncognate GCA triplet rather than th e canonical AUG. This 3 ORF2 (nt 5987-8740) showed significant similarity to the structural proteins of members of the family Dicistroviridae , particularly those be longing to the genus Cripavirus . Evidence demonstrating x

PAGE 11

relatedness of these viru ses regarding genome organization, amino acid sequence similarity, and putative replication strategy substantiate inclusion of HoCV-1 into this taxonomic position. In addition to molecular analyses, a prel iminary study was undertaken to determine the occurrence of HoCV-1 in geographically disparat e glassy-winged sharpshooter populations. Adult leafhoppers were field-collected from six different locations within Florida, Georgia, California and Hawaii. Reverse transcriptase polymerase chain reaction (RT-PCR) assays indicated positive infection of north Florida populations as well as insects found in south Georgia and Ca lifornia, but were negative for both south Florida and Hawaii. To gauge whether HoCV-1 was isolated only to H. coagulata populations, similar assays were used to test for the virus in four other leafhopper species. Of these, HoCV-1 infection was identified in select samples of Homalodisca insolita (Walker) and Oncometopia nigricans (Walker), but not in Draeculacephala minerva Ball nor Graphocephala atropunctata (Signoret). Hypotheses wh ich attempt to explain the incidence of the virus in heterogeni c leafhopper populations are presented. xi

PAGE 12

CHAPTER 1 INTRODUCTION A native to the southeastern United States (Young, 1958), the glassy-winged sharpshooter (GWSS) [ Homalodisca coagulata (Say) (Hemiptera: Cicadellidae)] is present throughout the region from Florida to Ke ntucky and as far west as Texas. In the late 1980s, this insect was introduced as an invasive pest into California, presumably translocated as egg masses on ornamental plants shipped in to the state (Sorenson and Gill, 1996). Without the accompaniment of natu ral enemies such as parasitic wasps and entomopathogenic fungi, inordinate number s of GWSS have become established throughout southern California and incipient popu lations have been detected as far north as Sacramento and Butte Counties (Califor nia Department of Food and Agriculture [CDFA], 2003). Subsequently, GWSS has succe ssfully occupied the French Polynesian island of Moorea and coastal areas of Tahiti [established 1999 (Cheou, 2002)] as well as the Hawaiian island Oahu [established 2004 (Heu et al., 2004)]. GWSS are extremely vagile, dispersing rela tively long distances as both adults and late-instar nymphs in their search for host plants on which they can feed, mature, and oviposit. These leafhoppers are also highly polyphagous, infes ting a broad range of hosts comprised of over 100 species in 35 fa milies including both woody and herbaceous plants (Hoddle et al., 2003; CDFA, 2005). Because sharpsh ooters are also xylophagous, they must feed voraciously in order to consume ample quantities of nutrients for reproduction and development. As a result, th ey often cause physical damage to the host plant through multiple, aggressive insertions of their stylets into plant tissue or by 1

PAGE 13

2 robbing the plants of water and important nutrients. More im portantly, however, is their ability to vector a myriad of pathogens including viruses, bacteria, and other microorganisms, most notable of wh ich is the xylem-limited bacterium, Xylella fastidiosa Wells. X. fastidiosa deleteriously impacts numerous plant species, causing a variety of economically important diseases including leaf scorches of plum (Kitajima et al., 1975); almond (Mircetich et al., 1976); maple (Sherald et al., 1987); oleander (Opgenorth, 1995; Purcell et al., 1999; Costa et al., 2000); coff ee (Lima et al., 1998); elm, sycamore and oak (Hearon et al., 1980); Pierce’s disease of grapes (Wells, 1987; Mizell III et al., 2003); phony peach disease (Hopkins et al., 1973); pe riwinkle wilt (Brlansky et al., 1983); ragweed stunt and citrus variegated chloro sis (Roistacher, 1992; Chang et al., 1993; Derrick and Timmer, 2000; Damsteegt et al., 2003). Application of pyrethroid a nd neonicotinoid insecticides such as imidacloprid and acetamiprid continues to be the first line of defense against the GWSS in large-scale commercial vineyards and orchards. However, this type of chemical control is often associated with residue contamination, de velopment of resistance within the pest population and injury to non-target organi sms. Consequently, many producers are moving away from broad-spectrum chemical c ontrol to more environmentally “benign” pest management strategies. Currentl y, two species of entomopathogenic fungi, Pseudogibellula formicarum mains (Samson and Evans) and Metarhizium anisopliae (Metschinkoff), and four myma rid wasps comprise the arsenal of available selfsustaining, biocontrol agents against this inse ct vector (Kanga et al., 2004; Irvin and Hoddle, 2005). However, despite their potentia l against insect pests, nominal effort has gone into the discovery and el ucidation of viruses which na turally occur within GWSS

PAGE 14

3 populations. Here we report the complete nucleotide sequence a nd genome organization of a novel virus, henceforth referred to as Homalodisca coagulata virus-1 ( HoCV-1 ), discovered in field-collected GWSS. A co mprehensive molecular characterization and phylogenetic analysis of the virus evincing its placement in the genus Cripavirus (family Dicistroviridae) are also presented. Additionally, a simple, rapid, cost-eff ective technique for detection of HoCV-1 in insect tissue was developed and successfu lly applied to determine the geographic distribution and natural host range of the virus. Information detailing this reverse transcription polymerase chain reaction (RT-PC R) assay is provided along with a brief statement concerning the advantages of this t ype of investigative tool over other classical diagnostic methodologies. Employing this assa y, a preliminary study was undertaken to determine the occurrence of HoCV-1 in geographically disparate GWSS populations (Florida, Georgia, California and Hawaii). A secondary investigation was also conducted to gauge whether HoCV-1 is isolated only to H. coagulata populations or, alternatively, if it naturally infects othe r sharpshooter vector species. To test this theory, two species were taken from each tribe within the family Cicadellidae, with Homalodisca insolita (Walker) and Oncometopia nigricans (Walker) representing the Proconiini and Draeculacephala minerva Ball and Graphocephala atropunctata (Signoret) representing the Cicadellini. Hypotheses which attempt to explain the incidence of the virus in heterogenic leafhopper popul ations are discussed.

PAGE 15

CHAPTER 2 MATERIALS AND METHODS Sequencing of the HoCV-1 Genome Complementary DNA (cDNA) Library Construction HoCV-1 virus sequence was initially discove red through analysis of expressed sequence tags (ESTs) derived from a cDNA library created using total RNA from 160 adult GWSS collected on citrus [ Citrus sinensis (L.) Osbeck] in Riverside, California. Briefly, insects were collected into RNA later (Ambion, Inc., Austin, TX) and total RNA extracted using the guanidinium salt-phenol -chloroform procedure as described by Strommer et al. (1993). Contaminati ng DNA was removed using RQ1 RNase-free DNase (Promega, Madison, WI) and poly(A) + RNA purified using a MicroPoly(A)Pure kit (Ambion, Inc.) according to the manufacturer's instru ctions. A directional cDNA library was constructed in Lambda Uni-ZAP XR Vector using St ratagene's ZAP-cDNA Synthesis kit (Stratagene, La Jolla, CA). DNA was packaged into lambda particles using Gigapack III Gold Packaging Extract (Stratagene) and the resultant primary library mass excised using ExAssist Helper Phage (Stratagene). An aliquot of the excised library was used to infect XL1-Blue MRF' cells and subsequently plated on Luria-Bertani (LB) agar containing 100 g/mL ampicillin (amp). Bacterial clones containing excised pBluescript SK(+) phagemids were recovere d by random colony selection. Selected transformants were grown overnight at 37C and 240 rpm in 96-deep well culture plates containing 1.7 mL of LB broth, supplemen ted with 100 g/mL ampicillin. Archived stocks were prepared from the cell culture s using 75 L of a LB-ampglycerol mixture 4

PAGE 16

5 and 75 L of cells. These archived stocks are held at the U.S. Horticultural Research Laboratory where they are kept in an ultra-low temperature freezer (-80C). Plasmid DNA was extracted using the Qi agen 9600 liquid handling robot and the QIAprep 96 Turbo Miniprep kit according to the recommended protocol (Qiagen, Valencia, CA). Sequencing reactions were performed using the ABI PRISM BigDye Primer Cycle Sequencing kit (Applied Biosystems, Foster City, CA) along with a universal T3 primer. Reaction products were precipitated with 70% isopropanol, resuspended in 15 L of sterile water and loaded onto an ABI 3700 DNA Analyzer (Applied Biosystems). When sequence data was compared to the National Center for Biotechnology Information (NCBI) database using BLAS TX, it showed greatest similarity to Triatoma virus ( TrV ). Considering that TrV replicates within the cy toplasm of gut cells of triatomines (Muscio et al., 1988), a second c DNA library was constructed in the same manner using midgut tissue dissected from GWSS adults field-collected from citrus in Riverside, California. 5 -Rapid Amplification of cDNA Ends (RACE) Total RNA from 41 mg of GWSS adults colle cted near Bakersfield, California was extracted using the RNeasy Mini kit (Qiagen) and cont aminating DNA removed using a MessageClean kit (GenHunter, Nashville, TN) according to the manufacturer’s instructions. First strand c DNA synthesis was carried out by pr iming with a gene specific primer (GSP; 5 -GTG TTT CCA CTG TCT C-3 ) using the 5 RACE System for Rapid Amplification of cDNA Ends , Version 2.0 (Invitrogen, Carlsbad, CA) according to the supplier’s directives. First strand pro ducts were purified using a S.N.A.P. column and then homopolymerically tailed using te rminal deoxynucleotidyl transferase (TdT)

PAGE 17

6 (Invitrogen). Resultant dC-tailed cDNA was amplified directly by PCR using a second nested GSP (5 -CGT GTC GGG TTG TCC GTA AC-3 ). The amplimer was loaded onto a 1% agarose (TAE) gel stained with 0.5 g/m L ethidium bromide (EtBr). A single band was excised and products extracted using a QIAquick Gel Extraction kit (Qiagen). Double-stranded (ds) cDNA fragments we re then TOPO-cl oned into the pCR 4-TOPO Vector (Invitrogen) and subseque ntly transformed using One Shot Max Efficiency DH5 -T1 Escherichia coli cells (Invitrogen). Recombinant clones were randomly selected and grown-up as desc ribed previously. Nucleotide sequencing was completed in both directions with an Applied Biosyste ms 3730xl DNA Analyzer in conjunction with universal T3 and T7 primers. Sequence Verification and Cloning HoCV-1 genomic RNA was transcribed using SuperScript III Reverse Transcriptase (Invitrogen) and a weighted GSP (5 -TTT TTT TTT TTT TTT TTT GCT AAG AAA ACT CTC GTG CGC AG-3 ), and the cDNA amplified using GSPs designed in the forward (5 -CAA AAA TTG TAC GCA GCA AAC ACT GCG TAC AAT GAG3 ) and reverse directions (5 -GCT AAG AAA ACT CTC GTG CGC AGT GAA GCT G3 ) to cover the complete genome. PCR conditions were as follows: 94 o C for 1 min; 94 o C for 30 sec; 68 o C for 30 sec; 68 o C for 11 min; cycling from steps 2 thru 4, 35x; 68 o C for 11 min. The ds-cDNA produced was run on a 1% agarose (TAE) gel stained with 0.5 g/mL EtBr and the appropriate band extrac ted as aforementioned. The fragments were then ligated into the pCR 8/GW/TOPO Vector (Invitrogen) and transformed using One Shot TOP10 chemically-competent E. coli (Invitrogen). Plasmids were extracted as described previously and the DNA subjected to restriction enzyme digest using Eco RI to first linearize the plasmid containing the cloned insert and then by Bgl I and Stu I

PAGE 18

7 (Promega). The banding pattern was visu alized using a Lab Bioanalyzer (Agilent Technologies, Palo Alto, CA) and compared to a restriction map constructed with Vector NTI Suite 6 (Invitrogen). Computer Analysis of HoCV-1 Nucleic Acid and Deduced Protein Sequences Base confidence scores were designated using TraceTuner (Paracel, Pasadena, CA). Low-quality bases (confidence score <20) were trimmed from both ends of each sequence. All quality trimming, vector trim ming and sequence fragment alignments were executed using Sequencher software (Gene Codes Corp., Ann Arbor, MI). Contig assembly parameters were set using a mini mum overlap of 50 bases and 90% identity match. Multiple alignments were pe rformed with CLUSTAL_X, version 1.83 (Thompson et al ., 1997) using the following sequences [with their respective GenBank accession numbers]: acute bee paralysis virus (ABPV) [ NP_066241 ; Govan et al., 2000], aphid lethal paralysis virus (ALPV) [ NP_733845 ; van Munster et al., 2002], black queen cell virus (BQCV) [ NP_620564 ; Leat et al., 2000], cricket paralysis virus (CrPV) [ NP_647481 ; Wilson et al., 2000], Drosophila C virus (DCV) [ NP_044945 ; Johnson and Christian, 1998], Himetobi P virus (HiPV) [ NP_620560 ; Nakashima et al., 1999], kashmir bee virus (KBV) [ NP_851403 ; De Miranda et al., 2004], Plautia stali intestine virus (PSIV) [ NP_620555 ; Sasaki et al., 1998], Rhopalosiphum padi virus (RhPV) [ NP_046155 ; Moon et al., 1998], Solenopsis invicta virus-1 (SINV-1) [ YP_164440 ; Valles et al., 2004], Triatoma virus (TrV) [ NP_620562 ; Czibener et al., 2000], Taura syndrome virus (TSV) [ NP_149057 ; Mari et al., 2002]. Protein molecular weights were approximated via The Sequence Manipulation Suite 2 (Stothard, 2000). The secondary structure of the HoCV-1 internal ribosome entry site (IRES) element for capsid translation was predicted us ing the Mfold web server, version 3.1 (Zuker, 2003). To

PAGE 19

8 determine relatedness, the putative RNA-de pendent RNA polymerase (RdRp) domain of HoCV-1 was compared with equivalent sequences from the picorna-like insect viruses listed above as well as members of three other picorna-like virus families including Iflaviridae [ sacbrood virus ( SBV ) NP_049374 ; Ghosh et al., 1999], Comoviridae [ squash mosaic virus ( SqMV ) RNA 1 NP_620657 ; Han et al., 2002], and Sequiviridae [ rice tungro spherical virus ( RTSV ) NP_042507 ; Thole and Hull, 1998]. Phylogenetic trees were constructed via the neighbor-joining method using PAUP* version 4.0 (Swofford, 2003). For each tree, confidence levels were estimated using the bootstrap resampling procedure (1000 trials). Theoretical Modeling of the HoCV-1 RNA-dependent RNA polymerase (RdRp) The theoretical structures of HoCV -1 RdRp were determined using human rhinovirus serotype 16 ( HRV-16) PDB entry 1XR7. Initial alignments were generated using the “magic fit” command in Deep View – spdbv 3.7 (Guex and Peitsch, 1997). Refinement of each model was performed by the SWISS-MODEL server. Relevant statistics were taken directly from Deep View and model accuracy and correctness were judged according to the root mean square value [rms; alpha carbons only (C )], number of outliers exhibited in the Ramachandran diagram, as well as number of unfavorable contacts or “clashes” of main chain and backbone atoms. Development and Application of an RT-P CR Assay to Determine the Geographical Distribution and Natural Host Range of HoCV-1 Insect Sampling Adult leafhoppers were collected from si x geographical locations within Florida, Georgia, California and Hawaii. All samples were placed into indi vidual microfuge tubes to prevent cross-contamination of any virus which may be emitted via aerosols or excreta.

PAGE 20

9 Insect/viral RNA was preserved in RNA later and maintained at 4C until total RNA could be extracted. Sample Preparation and RT-PCR Analysis Upon arrival to the USDA ARS U.S. Hortic ultural Research La boratory, Ft. Pierce, Florida, insect tissue was removed from RNA later , washed with 1X phosphate buffered saline (PBS) (4C), and ground directly in Bu ffer RLT (Qiagen) using a sterile pestle. RNA extraction was performed using the RNeasy Mini kit (Qiagen) according to the manufacturer’s instru ctions. Total RNA was eluted in RNase-free water and quantified by UV spectrophotometry. An equal concentration (500 ng) of total RNA was retrotranscribed for each sample reaction by first combining RNA, 1 L dNTPs (10 mM), and 1 L oligo(dT) 17 primer (2.0 g/L) for a reaction volume of 13 L. This mixture was incubated at 65C for 5 min after which 4 L 5x buffer, 2 L dithiothreitol (DTT), 1 L RNasin Ribonuclease Inhibitor (40 U/L) (P romega), and 1 L SuperScript III (200 U/L) (Invitrogen) were added. The reaction mixture was then incubated at 55C for another 60 min and subsequently terminat ed at 65C for 10 min. Amplification was performed using 22.5 L Platinum PCR Supermix (Invitrogen), 1 L of the forward (5 TCC GAG TTC TCA GCC AAA CT-3 ) and reverse (5 -CGG CAT ATC GAA ATG AGG TT-3 ) primers combined (10 M each), and 1.5 L cDNA. The reaction mixture was subjected to an initial denaturation at 95C for 2 min followed by 35 cycles of 95C for 30 sec, 60C for 30 sec, and 72C for 1 min, and concluded with a final DNA extension at 72C for 5 min. Samples were considered positive when a visible amplicon (443 nucleotides) was present after separation on a 1% agarose(TAE) gel stained with EtBr (0.5 g/mL).

PAGE 21

10 Primer Design Primers were designed using Primer3 (Ro zen and Skaletsky, 2000) in conjunction with GenBank accession number DQ288865 ( Homalodisca coagulata virus-1 ). Determination of the Sensitivity of Amplification of HoCV-1 by RT-PCR Plasmid DNA containing the full length HoCV-1 cDNA cloned into the pCR 8/GW/TOPO Vector was recombined with the pEXP3-DEST (Invitrogen) destination vector in th e presence of LR Clonase (Invitrogen) using the LR recombination protocol supplied by the manufac turer. The LR reactions were incubated at 25C for 18 h, treated with 2 L Proteinase K solution (2 g/ L) and incubated for another 10 min at 37C. The final LR react ion was then used to transform One Shot MAX Efficiency DH5 chemically competent E. coli (Invitrogen). Recombinants were chosen using double selection (i.e., only thos e clones demonstrating ampicillin-resistance and chloramphenicol-sensitivity were sele cted) and grown overnight at 37C and 150 rpm in 15 mL culture tubes containing ~4 mL of LB broth, supplemented with 100 g/mL ampicillin. Plasmid DNA wa s extracted using the QIAprep Spin Miniprep kit (Qiagen) according to manufacturer’s instru ctions. DNA concentration was determined using a NanoDrop ND-3300 Fluorospectrometer (NanoDrop Technologies, Wilmington, DE) and a 1 g aliquot transcribed using the AmpliScribe T7 High Yield Transcription kit (EPICENTRE Biotechnologies, Madison, WI), yiel ding ~50 ng of RNA. RT-PCRs were performed with the QIAGEN OneStep RT-PCR kit (Qiagen) using a range of serial dilutions (50 ng-500 ag) incorporated into the reaction either alone or as a complex mixture. Composite mixtures were prepared by combining the appropriate dilution with 400 ng total RNA extracted from an uni nfected GWSS. Template RNA (1 L) was reverse transcribed for each sa mple reaction by combining 5 L QIAGEN OneStep RT

PAGE 22

11 PCR Buffer, 1 L dNTP mix (containing 10 mM of each dNTP), 5 L 5x Q-Solution, 0.5 L each forward and reverse primer (10 mM), 1 L QIAGEN OneStep RT-PCR Enzyme Mix and 1 L RNasin Ribonuclease Inhibitor (40 U/L) (Promega) for a final reaction volume of 25 L. This mixture was incubated at 50 C for 30 min after which an initial PCR activation step was performed at 95 C for 15 min to activate the HotStarTaq DNA polymerase. Amplification was performed usi ng 3-step cycling (35x) at 94C for 30 sec, 60C for 30 sec, and 72C for 1 min followed by a final extension at 72C for 10 min. An aliquot of the resulting amplicons (20 L each) was loaded onto a 1% agarose gel stained with EtBr and elec trophoresed at 105V for 35 min. A gel image was acquired using a Kodak Image Station 440CF and band intensities quantifie d with Kodak 1D Image Analysis Software (Eastman Kodak, Rochester, NY). Samples were considered positive if a DNA band of the pred icted molecular weight was visible. Detection limits for both the stand-alone and co mplex mixture assays were es timated using the “weight” to “mole” conversion calculator at http://molbiol.edu.ru/eng/scripts/h01_04.html .

PAGE 23

CHAPTER 3 RESULTS AND DISCUSSION Nucleotide Sequence of HoCV-1 The nucleotide sequence of the genomic RNA from HoCV-1 was constructed by compiling ESTs obtained from two cDNA lib raries, WHHc and WHMg, derived from GWSS whole body and midgut-specific tissues, respectively. The first library, WHHc, produced 94 overlapping ESTs which covered the 3 -end of the genome, while the second library, WHMg, resulted in 347 overlapping ESTs covering a great er portion of the 5 end. 5 -terminal sequence [15 nucleotides (nt)] of the viral genome was determined by sequencing both strands of el even independently obtained, overlapping cDNA clones. Alignment of the ESTs with the 5 RACE products produ ced a single contiguous sequence consisting of 9321 nt, excluding the poly(A) tail (Fig. 1). 1 CAAAAAUUGUACGCAGCAAACACUGCGUACAAUGAGUAGCAUGACUAAGAUGGAGA 5 UTR 57 GUUCCUAACCCGGCUCUCAAAUUAGUGAUGCAAUACUUAAGUAGUAGAAACGAAAGAGUUAGCAGAUGAUCGAACAAACAU 138 CUAAGUCAAACCAAAAACCCAACCCAACAAACACAACCGUUAGCAUAUCCCAAAAGUUUUAUAGUACCAACUAGAAAUAGA 219 GAGAUGAUAAAACUUUAUUGCUAACACAUUGACGUUACGGACAACCCGACACGGACUGAACAGGAGCAUGUUAGACAUGUA 300 UUAUGGCUCCGGAAGAUAGAAAAUAUGCUUACAUCCCCAUGGUAGGUAAGAUUUCUAUAACUACUGGCCACUGAAAAGUGA Fig. 1. The nucleotide sequence of HoCV-1 genom i c RNA. The predicted am ino acid sequences of both ORFs 1 and 2 are s hown below the nucleotide sequence. Non-coding sequence is indicated by a dash ed line. The first m e thionine in each ORF has been high lighted usin g a green circle. The no n-canonical transc rip tion star t site is em phasized by a green square. The polyadenylation signal and the polyadeny lation site at the 3 -proxim a l region of the genome are dem a rcated with red boxes. 12

PAGE 24

13 381 AUGCAGUAGGCGGCAACCCCGCAUCCAAACUUCAACCAAAUGCCCAAAACCCAACAGAGAGAGACAGUGGAAACACAAACU M P K T Q Q R E T V E T Q T 462 CCUCAACAGCGGAUUCGGACCCCGCUUCGGACUGAACAAACGGAAACGACCCUUGCAACCCCGGUGUGCUCUUCAUUGAGU P Q Q R I R T P L R T E Q T E T T L A T P V C S S L S 543 GGAACAGAUGCCUCACCAGCUAUCACUGUUCUUAGCACCAACAUGACCAGCCUUCUCAACGAAAUUUAUUCAAAUACAUAC G T D A S P A I T V L S T N M T S L L N E I Y S N T Y 624 UCUGUCACUUUGAAAGAUUUUCGACGAGCUUUACACAGGUGGACGAACAAGACACAAAUUCAAUUUCGUCAUUCACCACCU S V T L K D F R R A L H R W T N K T Q I Q F R H S P P 705 UCAAAGGAUCGAGCGGCCUUGUGUCUCUUGCAGAUAUAUUGGUGGCUUCAACAACAUCAAGAUUCUUAUUUUUCCAUAUCC S K D R A A L C L L Q I Y W W L Q Q H Q D S Y F S I S 786 CUUGAACAGUUGGCAGAUGAUUGUUUUAAAGUGCUUGAAUUGCAGUACCGCCCAUAUUACGACAAAGUCGUGUAUGGAAGU L E Q L A D D C F K V L E L Q Y R P Y Y D K V V Y G S 867 AUUGAUAAUGCACUUUGGACUGAAAUUUCAUGGCAAGACCUCCUCCUCAAGGUAGUCUCACACAAAUUGGAAUAUUUGUCA I D N A L W T E I S W Q D L L L K V V S H K L E Y L S 948 UUGUCUCAGGUUCUUGGAAACAGGAUUUUGCGUCGCAAAUUCAACAUUCGCUCUCACAUGUUGAGAAUGUUGCUAUCGGCG L S Q V L G N R I L R R K F N I R S H M L R M L L S A 1029 AUACGCAUGGACCUGGAAAGAGAAUUGAAACUUGAAGGAAAAGUGCAACAGCGAAUUGAUCAAGUCAAAGCAGAGAAUGCA I R M D L E F E L K L E G K V Q Q R I D Q V K A E N A 1110 GAAGAUUGGAGAGAGUAUGACAGAGGUGGACCUGUCCCUUCACGAGACAGAGAUACCUACUGCCAGAUUCUUUUGGAGAAC E D W R E Y D R G G P V P S R D R D T Y C Q I L L E N 1191 GAACUGGAACGACUCAUGCAAUCCACCUGGACACGCGACCUCUUGACAAAUGAAUGGAUCCAAGCAGAAGUACAAGGUCUU E L E R L M Q S T W T R D L L T N E W I Q A E V Q G L 1272 UUUGACAUCAAAAUUGUCCCCGACGAAGCAGCCUUUAUGGAAGUCUUUACUUCAAUCAAAGAUUACAUUUCAGAGCAAUUU F D I K I V P D E A A F M E V F T S I K D Y I S E Q F 1353 GGGGCUUCACUCCGAUUUGCUAAAGAUUUGCUUGUUAACAUUGUAGUUCUCAUCAUCCUUUGGAACUUAGUAUCCUUGCUA G A S L R F A K D L L V N I V V L I I L W N L V S L L 1434 UGGAACAAAGCAUAUGAUGUGAAAUACAUUGGAGUAGUUCUCACACUACUCUCAGGACUUGUAGCCGUCAUUUGCGCUGCU W N K A Y K V K Y I G V V L T L L S G L V A V I C A A 1515 GGAGUAGCUGCAGUGAUUGGCCGCAUCCUGAUGCAAAUCUUAGAUCUUUUCAAAACUCCUCAAACCCUUCCCGCACCCUUU G V A A V I G R I L M Q I L D L F K T P Q T L P A P F 1596 GACAAUUGGCGUCAAGAAGAUCAAGAAAAUGAAGCUUGGGCGCGUUGGCACCAACGAAAUUCCCAACAAACUUUCAUUCAC D N W R Q E D Q E N E A W A R W H Q R N S Q Q T F I H 1677 CCUUCCCUUCUCGAAAACACUGGAAACAAUCAUUGGAUUGAGGCGGAAGCACAGGCGGGAGAGCCUAAACAAUCCAAAGUU P S L L E N T G N N H W I E A E A Q A G E P K Q S K V 1758 UUAGCUCUUCUAUCCUUGGCGACCAUCUCACUGGUGACUUCAAAAAUCAAAGACAGUUGGUCUCUUGACUAUUUCACAAAA L A L L S L A T I S L V T S K I K D S W S L D Y F T K 1839 CAGAUUGCACUCCUACCUCGCUUCACGACAGGAGUGACUUGUUUGCUUGACAGUGCUCAGGCAGUUUUCAAAAUUGUCCAC Q I A L L P R F T T G V T C L L D S A Q A V F K I V H 1920 AAAGAAAUUUUGGUUGAUAUCUUCGGAUAUGAGCCUUUGACUGAGGAAGGAGAACACCCCAUGAUUGACGACUUCAACACU K E I L V D I F G Y E P L T E E G E H P M I D D F N T 2001 CUUAUGCAACAGAUUAUUGAUGCUGACCAACGAAACGAAAUUCAAACAUCAACAAUCUAUCAGUCCCUUGUUCUUCAAGCA L M Q Q I I D A D Q R N E I Q T S T I Y Q S L V L Q A 2082 GAACAACUUGGCUUGCGUAUUCUUCAGACUUCUGGUUUAGGAGAGUAUCGCGCUGUUGUCUCACAACAGUAUGCCAUUUUG E Q L G L R I L Q T S G L G E Y R A V V S Q Q Y A I L 2163 CGACGGCUUCACGACCGUCUUGGACUGAGAGGACUGAAUGCCAAAGGACAGCGAAUGGCACCCAUCAUAAUUCAGUUGUAU R R L H D R L G L R G L N A K G Q R M A P I I I Q L Y Fig. 1. Continued.

PAGE 25

14 2244 GGAGAGACAGGACAAGGAAAGUCAACCAUUGURACAACAUUGGCACUCAAGCUUCUUUCAAAAAUCUGUGAUGCAGAAGGU G E T G Q G K S T I V T T L A L K L L S K I C D A E G 2325 AUAGACAAAGCUGUUAUCAAUCCAGACAAUCUCAUCUACGCCCGCAACGUAGAACAAGAGUUUUGGGACGGAUAUCACGGA I D K A V I N P D N L I Y A R N V E Q E F W D G Y H G 2406 CAGCUGGUUAGUGUGUUUGAUGAUUUCGCACAACAUCAAGAUUUUGCUCAGGUUCCAAACCCUGAGCUAUUUGAAAUCAUU Q L V S V F D D F A Q H Q D F A Q V P N P E L F E I I 2487 CGAGCAGGAAACACUUUCCCCUAUCCUUUGCAUAUGGCUGACAUUGCUGACAAAAACACAACAACUUUUCAGUCACGCAUU R A G N T F P Y P L H M A D I A D K N T T T F Q S R I 2568 GUCAUUUUGACGACCAACCAAAAGAAGCCAAAAGUGGAAUCCUUAGUAGCACCAGAAGCUUUCUAUCGCCGUAUUGACCAG V I L T T N Q K K P K V E S L V A P E A F Y R R I D Q 2649 UCCUACGAAGUAUCCUUCAAACCAGAGGUACUUACUAGGCAGUCAAAAACGGUUGAGACAAUUGAAGAAAGUGCUCGUGGG S Y E V S F K P E V L T R Q S K T V E T I E E S A R G 2730 AAUUUGACAACCUACUCCUACUCUCUCAAGCCCGAACAUCGGCAGGAGUAUUCCCCAGAGAUCCAACAGUUUCAGCAGUUU N L T T Y S Y S L K P E H R Q E Y S P E I Q Q F Q Q F 2811 GACAUCAAUACUGAAAGGAAGAUUGGCAACCCAAUUUCACUUGAUGAAUUGGUUGACAAUGCUUUUCGCCAGUACAAUGCC D I N T E R K I G N P I S L D E L V D N A F R Q Y N A 2892 CGGUUCAACUUCGAAACAACACGCAAAAUGCAUGAUGAUCAAUUGGCACGUCAACUUGGGUUCAUCAGAGCCCAACCCCAA R F N F E T T R K M H D D Q L A R Q L G F I R A Q P Q 2973 AUUGGAUGGUUCGCUCCACUACACUAUAUUCGCCCUGCCCAACCUCGGGARGAURUAGAUGUGGAGAGGCGCAACCUAGCA I G W F A P L H Y I R P A Q P R E D ? D V E R R N L A 3064 CAAGAAUUUCAUGCAAGUUUUCAAAAUUACAAAAUCAAACUCCAACAAAUCAAGGAAAAUUUGAAACGCAAAAUGGAAGAA Q E F H A S F Q N Y K I K L Q Q I K E N L K R K M E E 3145 CACAAAGUUGUGUUGAAGGCUCUUGGCGUUGUUGCUAUGGCUGUUGGGGUGUAUAAGAUUGGUAGUGCACUUGCUGGACUU H K V V L K A L G V V A M A V G V Y K I G S A L A G L 3226 GUUUCAAAAAGAGACACUCAACCUAAAGUGUCUGCAAGUGCGCAAUCACCUUAUGCUCCCCGACCUGUGGCGCUGCGUCAG V S K R D T Q P K V S A S A Q S P Y A P R P V A L R Q 3307 UCAGCCUAUCAUCCGACAACACGGGCAACAAAAACCACCAUCAACAAAAUUGUGAAAGCGACAGGACAAGCAGCGGAUAAU S A Y H P T T R A T K T T I N K I V K A T G Q A A D N 3388 AGCGCGCGUGACAUCAUCACAAGCGUUAUGAACCGAGGCAUGUACUCCUUGAGCGUCGAUUCUCGCGUUCUAGGGAGUGCA S A R D I I T S V M N R G M Y S L S V D S R V L G S A 3469 ACGUUCUUAACUGGAAAAAUUUUGAUGUUUCCCCGACAUUUCAUUAGUUUCAUGGCCCAUCAGGCAGAAGCUAAUCCAAAU T F L T G K I L M F P R H F I S F M A H Q A E A N P N 3550 UCAAAAGUCACACUCAAAUCACACAACACACAGUAUGAAAUGCUGACAAAGGACGUGCUGCUUGAAGUGGAGAACAUUUUU S K V T L K S H N T Q Y E M L T K D V L L E V E N I F 3631 GACGACGACAAUCUUCCCCUUGAUUCUGACGGAAAUCCCGACCAAACUUGGACUCAUGACUGUGUUGCUGUAGUCUUCAAG D D D N L P L D S D G N P D Q T W T H D C V A V V F K 3712 ACUGCAGACAACCACAAAGACAGAACAGAUCAAUUCUUGUCGAGGGAGGAGCAAUCCAAACUUGACAAAGUUGAUGUAAUU T A D N H K D R T D Q F L S R E E Q S K L D K V D V I 3793 CUGGCAAACAUCCACGAAAAAGACAACAACAUCACACACACAACAUCGUGUGUUUCAGCAUCUGGUGUCCAACGAGUAACG L A N I H E K D N N I T H T T S C V S A S G V Q R V T 3874 CCUGGGGCAGGACCACCUGUCUAUGGUGAAUACGAAAUUGGAGACACUCAAUAUAGAACCUACACGCGUGACUAUUGGAGA P G A G P P V Y G E Y E I G D T Q Y R T Y T R D Y W R 3955 UAUGCCCUCAACACUACCUACGGGGACUGUGGAGGACUAAUCUUCUUGAACAACAAAAUGAGUCACCGUAAGAUUCUUGGA Y A L N T T Y G D C G G L I F L N N K M S H R K I L G Fig. 1. Continued.

PAGE 26

15 4036 AUGCACGUUAUGGGACUUUCGCAACUAGAUUCUGGCUUUGCCCUCUCGGUUUACCGAGAGGAUGUACAAGCUUACGUUCGA M H V M G L S Q L D S G F A L S V Y R E D V Q A Y V R 4117 CUAGUACGACAGGACGAUCCUUCACUGGUGACACCCUGUGCAGAGCCCAUCAUAACGACAGCAGUCCAGUGUUUGCCAUUU L V R Q D D P S L V T P C A E P I I T T A V Q C L P F 4198 GCUGGAGACUUCCACCCCUUGGGAAAAAGUCCGUUCCCUAGCACAAAUCCUGGAAAGAGUAAGAUUGAAAAGUCAGAACUC A G D F H P L G K S P F P S U N P G K S K I E K S E L 4279 CAUCCUGACAAUUGUGCUGUGGCAUGGAGGGAACCCGUUUCUCAUCCCGCACUGUUGAAACCCAUCACAGUGAGGCCUGAG H P D N C A V A W R E P V S H P A L L K P I T V R P E 4360 GACGGUAUUCCCUUCCCAAGUGGCACGACAUUCGACCCCCUUCAUUACCGACUGGAAAAGUGUGGACAGCGUGCAAAAUGU D G I P F P S G T T F D P L H Y R L E K C G Q R A K C 4441 CUAGACCAACAGCUUUUGGACAUUGUGCGUCGUUCAUACACCACCGAACUUCGACAAAUUUUGCAGACUCACAAGCACCCU L D Q Q L L D I V R R S Y T T E L R Q I L Q T H K H P 4522 GAGUACAAGUCAGCCUACACAUUUGAUGAAGCAGUACUAGGUUUGCCUGGUGAUCCCUAUGUAAAUUCGAUAAACAGAGCG E Y K S A Y T F D E A V L G L P G D P Y V N S I N R A 4603 UCAGCUCCUGGUUACGGAUGGACUAAGGACCCAGGCUUUCCUGGCAAGAAAACAUGGUUUGGAAGAGACGAAGAGUUUGAU S A P G Y G W T K D P G F P G K K T W F G R D E E F D 4684 CUUAGUCGCGCUGGACCCGUGAGGGAAAGGUGUGCAAAGAUCAUUGACCUUGCACGAAACAAUGAAAGGUACCCUCAUGUC L S R A G P V R E R C A K I I D L A R N N E R Y P H V 4765 UUCAUUGACACCCUGAAGGAUGAGAGGAAGCCCAUUGCAAAGUGGUGGAAGACGCGUGUGUUUUCUGCAUGUAGCCAGGAU F I D T L K D E R K P I A K W W K T R V F S A C S Q D 4846 UACUACAUUGCAUGUAAGCAAUACUAUCAAGGUAUCGUCGGUCUACUGACACGGCAUCGUAUUGAUACUGGGAUUUGUGUC Y Y I A C K Q Y Y Q G I V G L L T R H R I D T G I C V 4927 GGCAUUAAUGUCUACUCUCACGAGUGGGACUUAAUUGUUCGGCAUUUGCACCAGUGCAAUGAUCGAGUUGUAGCAGGAGAU G I N V Y S H E W D L I V R H L H Q C N D R V V A G D 5008 UUUGAGAACUUUGAUGCCAGCUUGCUGACUCAAGUUCUCGAUGCAGCCAGAAUUGUUUUGAAUGAUCUCGCCGGUGAUCUU F E N F D A S L L T Q V L D A A R I V L N D L A G D L 5089 CCAGACCAUCAACGAGAACAUGAUGAUAUUCGUUCUGUGCUGUUCCUCGACCUUGUACAUUCCACCCACCUUGCUCGGGAU P D H Q R E H D D I R S V L F L D L V H S T H L A R D 5170 GUCCUCUAUUCAUGGACACAUUCACUCCCAAGUGGUCAUUUUCUCACAGCAAUUGUAAAUUCUUUGUACGUAAAUCUGAUC V L Y S W T H S L P S G H F L T A I V N S L Y V N L I 5251 UUCAGAUAUCUUCUUGCAAAAUCUUCAAAAUUGACUUCACACAUCCAAAUUGACCAGCUGUGUCGUCGGAUGAAACUUGUU F R Y L L A K S S K L T S H I Q I D Q L C R R M K L V 5332 UCAUACGGCGAUGACCACAUUGUCUCUAUCCCUUCUGGAUACGAGAAAAUUUUCAACCAAUCCACUCUUCCAACCUUGUUU S Y G D D H I V S I P S G Y E K I F N Q S T L P T L F 5413 UCUGAAAUAGGUAUGACCUACACAGACGAGACAAAAUCCGACAGAGAAGUACCUGAAACAAGACGCAUCGAGGACGUAACU S E I G M T Y T D E T K S D R E V P E T R R I E D V T 5494 UUCUUGAAACGUGGGUUUCGAUGGGAAAAAGAACUUAAUCGCUAUGUCGCACCGCUAUCUUUAGACACAGUGCUUGAAACG F L K R G F R W E K E L N R Y V A P L S L D T V L E T 5575 CCAUUUUGGCGCUCAAAAUCCCUCAACCCGCGCUCUAUCACAGAGAGUAGCGUAGAGUGGGCUUGCCAUGAGCUAGCCCUC P F W R S K S L N P R S I T E S S V E W A C H E L A L 5656 CACGAUGAGUCAACAUUUCAGGAGUGGACGAAAAAGAUUGGGUUAGUCUGCAAAGAUGCAAUUAAUUUUGUGCCUAAUCUG H D E S T F Q E W T K K I G L V C K D A I N F V P N L 5737 UCUGCGCAACGCGUGGAAUAUAUCCGCUAUUUGGAAACUUCUUGGGACUCACUUGAUGAGUCUCGCGAUGACGAGGACUAA S A Q R V E Y I R Y L E T S W D S L D E S R D D E D . 5818 GUGUGAACUUGCCUCUCUCAACAAAAAGCCACCGACAUUAAGAGAGAGAGUAUUGCUGCUUAGUUAACUGCAGGCCCUAUU Fig. 1. Continued.

PAGE 27

16 5899 UAGGGUUACCGCCCAGGAUCUGCAACAGCAUUCCUGUAUCAUCCAGGGCACCGGUGGACUUGGUGAGGAUUGAGUUGACCU 5980 CAUCAUUAGAGACCAGACUCGCAACAUCACAACAAAUACACGACACCAUGGAAACUCAUUCACAUGAGCCCAUAAACACCA A T S Q Q I H D T M E T H S H E P I N T 6061 ACAUAGAUGGAGAAACUUCUGAGAACACGUUCGAAGAGAAGCGCGAAAUCACCCACUUCACAGAGGAUGACCGCGUACUCA N I D G E T S E N T F E E K R E I T H F T E D D R V L 6142 CCGACGCAGUGACAGAAAUUACUUCAUUACCCCUCUCUUUACUACAGUAUGGAGACGAGCCACGAGAACAUAGUGUAAUAU T D A V T E I T S L P L S L L Q Y G D E P R E H S V I 6223 CCUUUCUUCAAAGACCGGAGAAAAUCGCUACAGUGACGUGGACUACGGCUCAAACAAAGACGACUAACUUGGUAUCCUUGC S F L Q R P E K I A T V T W T T A Q T K T T N L V S L 6304 CAAUUCCAUCGUCUGUGUUGACGACUAUGUACAGAGAGAAGCUGAGAGGCUUUGGCCUGCUUCGCGCAGACAUUGUCUUUA P I P S S V L T T M Y R E K L R G F G L L R A D I V F 6385 AGCUGCAAUUCAACUCACAGCCCUUCCAAGCUGGGAGAUUGAUUGCGACAUACAUUCCAGUUCCUGCCUAUCUUUUACAAA K L Q F N S Q P F Q A G R L I A T Y I P V P A Y L L Q 6466 GAACGCGUAUGGCUCGAGCAAGUCUCACAAGACUGACCUCGUUACCUAACGUGAUUAUUGACAUUAGUAAGCAGACUGAAU R T R M A R A S L T R L T S L P N V I I D I S K Q T E 6547 GUAAUAUCACAUUACCCUACGUAAGCUCGUUUACCCACUAUGAUUUAACAAGUGGCGGAGGAGAUUGGGGCUUGUUCGACC C N I T L P Y V S S F T H Y D L T S G G G D W G L F D 6628 UUUGGGUCUAUAGUCCCCUCAGUAGUGCGUCUUCUCAGACAAUCAACAUCUCAAUACGAGCCUACCUCGACAAUGUACGCU L W V Y S P L S S A S S Q T I N I S I R A Y L D N V R 6709 UGGGUGCGCCCACGCAACAAUCGUUAGUCACAGCGGAAAAGAUGCUAAAAGCAAACGUACAGACACGGGAUUUAUCCCGGG L G A P T Q Q S L V T A E K M L K A N V Q T R D L S R 6790 GUACAUCUAGUUGUGGCUCGAUCUCAGCGCGCGCCCAAGGAGGAAAGCAGACAGCCGGCUCGGGCGAUGGAUCCUUCGGAU G T S S C G S I S A R A Q G G K Q T A G S G D G S F G 6871 CUCUCCUGAAUAAGGGCACAAAAAGUGUCACUAUGCAGGAGCGAUCCGCAGGGACUAUCUCCCGAGUUGGACAUAGUAUAC S L L N K G T K S V T M Q E R S A G T I S R V G H S I 6952 GUGAGGGCCUUGUCAGGGGACUCAAUGUCGUCGGCGAAUUUAUUCCCGGCCUCAGUGAGAUCACUGACACCGCCAACAGUG R E G L V R G L N V V G E F I P G L S E I T D T A N S 7033 UUGCUAUGGGAGUUUUAAACACUCUUGCUGCUUUCGGCCUUGGAAAGCCCAAGAACCUCGACAAAAUUGCACCUAGGACGC V A M G V L N T L A A F G L G K P K N L D K I A P R T 7114 UGCAUGCGUUUUCUGAUUUUGCUCAGGCCACUGGUGUGGACAAUGGUCACAUUUUGUCUCUUCACGGAGACAACAAGGUGA L H A F S D F A Q A T G V D N G H I L S L H G D N K V 7195 CCGUGCUCCCCGGCUUUGCUGGUUCAAACACCGAUGAACUGUCAAUGACGUAUCUCAUGCAGACCCUACAGUACUACGACA T V L P G F A G S N T D E L S M T Y L M Q T L Q Y Y D 7276 CUCACACGAUUUCAACAACUACAGCUGUUGGCACGCAGAUCGCUGCUUAUCGUGUAACUCCGUUUCGUUUUGACUUAGACC T H T I S T T T A V G T Q I A A Y R V T P F R F D L D 7357 UUGCAAAGACUGCACAGUCUUUUGUUAGUGGUAGCCCACUCAUCAACUUUGGGCAACCCAACCUUCAAUGGUACAUAGGUU L A K T A Q S F V S G S P L I N F G Q P N L Q W Y I G 7438 CUAAUUUCAAAUACUGGCGGGGCGACAUAAUAAUGCAUCUCGCUCUCGUGAAAACUGACUAUCAUAGCGUAAGGUUAAAGA S N F K Y W R G D I I M H L A L V K T D Y H S V R L K 7519 UCGUCUACGAUCCAAUGGCGCAGUCCGCUGCUGCCGUGACGUAUGAUGCAUCCGAAUACUGCUACUCAAUAGUUGUAGAUU I V Y D P M A Q S A A A V T Y D A S E Y C Y S I V V D 7600 UCCGUGACAAGACUGACAUAUAUGUGCGUUUACCAUUCAUUUCCGCAACACCUUGGAAAUUGGUACCACCAUCAACUUACA F R D K T D I Y V R L P F I S A T P W K L V P P S T Y 7681 CCGGAUACACUCCUCCGCCUGUGAACCAACAGGAAGGCCUUUCCACUUAUAGUGGUUAUGUGGCUGUGUUCGUUGAUAAUA T G Y T P P P V N Q Q E G L S T Y S G Y V A V F V D N Fig. 1. Continued.

PAGE 28

17 7762 UUCUGCAAGCUUCCUCAGCGGUAGUUAGUCAGAGUAUAGAAAUGGUGAGUGAGUUUUGCGCAGCUUCAAACCUGGACAUGG I L Q A S S A V V S Q S I E M V S E F C A A S N L D M 7843 GUUUCCCCCAUGGCGGACAAAAUUGGAUCCCGAUUAGUACCGUUCUUAAUCCCGGUGACCCUAUACAAGCAGACGUACAAU G F P H G G Q N W I P I S T V L N P G D P I Q A D V Q 7924 CUGCGUUCGCAGCUGAUGGCAUACUCAAAACACGCACUAAUAUGCAAGAAAAUACCCUGGACAUCAAAAACAUUACAGGAA S A F A A D G I L K T R T N M Q E N T L D I K N I T G 8005 UGGCUCCGAGACCUCUAUACGAUAACAUCACGAGUUACACGACUGGUGAAGAAGUUUAUUCCCUUAGAAUGUUAAUGAAAC M A P R P L Y D N I T S Y T T G E E V Y S L R M L M K 8086 GCUUCAAUUGGAUAGCGUCUGUCCCUUCUGGACAGGCGUCAAUAGCACUCCCAAACACAGUCAAGACCAUAGAUGCUGCUG R F N W I A S V P S G Q A S I A L P N T V K T I D A A 8167 CUCCUGUGUCAAAUCCUAACCAGAUUGUCGACAUUCGAACAGGGCCUCCCUAUGCCAACAACACAGUCUCAGAUUGCGCUU A P V S N P N Q I V D I R T G P P Y A N N T V S D C A 8248 UGGUGGAUGUUGUAGGAGCAUUGUUUGCCUUUAGAGCGGGCGGGUUUCGAUGGAAAGCCUGGGACUCCGGUUCUGAGCUCA L V D V V G A L F A F R A G G F R W K A W D S G S E L 8329 UAUCAGCCUAUCUCGUUCCUUUUGGACCAUACAAUACCUAUGGCAUCCCUCCUUCUACAUUUACAAACUUGAUUAGUAAUA I S A Y L V P F G P Y N T Y G I P P S T F T N L I S N 8410 CUUCCGUUUACGAGUUAGAUUCAAGACAGGUUAAAGGCUCCGCAGAGUUUGCAACCCCUUUUUAUCAUCCUUGUUACACCC T S V Y E L D S R Q V K G S A E F A T P F Y H P C Y T 8491 AAGUAAAUUCAAAUUUUUCAUAUUUUACAGAAGGAGGAGAACCAGAUUUGUAUUUUCACUUUACUCAACCCCAAACAGUAA Q V N S N F S Y F T E G G E P D L Y F H F T Q P Q T V 8572 CAGUAGUCAGUCGUAGUAACCCCGGAUCAGAGAUGAAUAUCGCGAAAUCUGCUGGCGACGAUCUCAAUUUUGGCUUUCUCU T V V S R S N P G S E M N I A K S A G D D L N F G F L 8653 UAGGAGUUCCAGAUUGUUUGCCGUCUCAGAUAGUAGCAGGACUUCUCUCACGUCCGAGUUCUCAGCCAAACUUACCCAAUU L G V P D C L P S Q I V A G L L S R P S S Q P N L P N 8734 CGACACCAAUCUCAUAGAACCGCUGACCCGAGAAACAGGUCCCGGGCGCCUCUGUGAGAGAACCUUUCAGAAUCGCUGACC S T P I S . 8815 CGAGAAACAGGUCCCGGGCGCCUCUGGAAGUCAUUUUCUUCUUUACUUAGUUUUAGAGCGAAGGAUCAGUCUCUUCCCUUU 8896 GGUAUGUAUCCUAGAUACAGUCACUAUUGGGGGGCAGCCCUUAGCUAACUUAGAUUUAAGGCAGAUUAGUUUAUAGUCAAA 8977 UUAGGCAGAGCGAAGCAACUUUCUUGAGGUAAGUGGUCAUCCACUGUCACUUCGAGGGGGCUUGCCGACACUCUAGAUAAG 9058 UACACGUGGUCGCAGGUUUCUGUAGGGUUUCCCUGUGAUGUAACUAGAAUUAGCACGUGAAGAGCAAUACCAACCUCAUUU 9139 CGAUAUGCCGUAUGUCCCAAUAAACCGCACGGUUUCCCUAGGGAAGUAACCGGAUGAGUCUUGAGUUUUGGUUUUGCUGUG 9220 GCUUCACCACCCCCUACAUUUGUUUAUUCUUUUGGCAAUUUAGGAUAUCCACGGAUUAAACUCCCGUGAGGUGCUUGUGUG 9301 CAGCUUCACUGCGCACGAGAGUUUUCUUAGCAAAAAAAAAAAAAAAAAAAAAAAA poly(A) Fig. 1. Continued. To validate that the final consensus seque nce was an accurate representation of a single virus and not conjoined sequences bel onging to multiple related viruses, a cDNA spanning the entire genome was cloned and subse quently used to create a restriction map.

PAGE 29

18 Duplex restriction enzyme analysis using Bgl I and Stu I rendered five distinct bands measuring 853, 1278, 1529, 2219, and 3514 nt, respectiv ely (Fig. 2). These results are consistent with the banding pattern predicted in silico . Fig. 2. Restriction enzyme analyses of a cloned cDNA spanning the complete HoCV-1 genome. (A) Capillary electrophoresis image of Bgl I and Stu I restriction digest products flanked to th e left by DNA 7500 Ladder (Agilent Technologies). (B) Restriction map predicted using Vector NTI Suite. Note: Because the speed of migration through the two media (capillary versus simulated gel electrophoresis) is diffe rent, the two images are not exact replicas. However, the banding pattern was the same for the digested product in each image when compared to the ladder (denoted ‘M’). Similar to other insect picorna and picorna-like viruses, the genome is slightly A/U rich (54.6%) with base composition of th e entire genome as follows: A (28.8%), U (25.8%), C (24.0%), G (21.4%). However, unlik e picornaviruses whic h contain a single, large open reading frame (ORF), comput er-aided ORF prediction analyses of HoCV-1 segregated the genome into two distinct ci strons, delineating a monopartite bicistronic genome. The two large ORFs were located between nt 420-5807 (ORF1) and 5987-8740 (ORF2) with a -1 frameshift occurring between the first and second ORFs. Taken together, these ORFs account for 87% of the genome, whereas only 13% is allocated to

PAGE 30

19 non-coding or untranslated region (U TR) sequence including a 419 nt 5 UTR, a 179 nt intergenic region (IGR), and a 581 nt 3 UTR. No substantial ORFs were found in the inverse orientation of the HoCV-1 genome, thus confirming HoCV-1 as a positive-strand RNA virus. The 5 -proximal ORF (ORF1) was found to have an AUG initiation codon between nt 420 and 422 and a UAA termination codon between nt 5805 and 5807. These assignments result in a coding capacity of 1795 amino acids (aa) forming a polyprotein with a calculated molecular mass of 205 kDa. However, it is questionable whether the first AUG represents the correct initiation codon or if transl ation begins at the second AUG located between nt 585 and 587 as the nucleotide arrangement surrounding this methionine is more plausible (CAA AUG C vs. AAC AUG A). In particular, there is a strong preference for purine s (A/G) at the -3 position upstream of the start codon (Cavener and Ray, 1991). The second arrangem ent would result in a coding capacity of 1740 aa forming a polyprotein with a calculated molecular mass of 199 kDa. It is important to note, however, the multiposit ional analyses on which this supposition is founded were originally calcula ted based on eukaryotic tran slation start site sequence data and not viral initia tion sites and, thereby, may not be applicable. The 3 -proximal ORF (ORF2) contains an AUG codon between nt 6017 and 6019. However, preceding this codon there exists a sequence within the IGR which is congruent with regions that have been demonstrated th rough mutational studies to act as internal ribosome entry sites (IRESs) facilitating cap-independent translation of the 3 -proximal ORF in several other insect-i nfecting RNA viruses including Cricket paralysis virus, Plautia stali intestine virus and Rhopalosiphum padi virus (Wilson et al., 2000; Sasaki

PAGE 31

20 and Nakashima, 2000; Domier et al., 2000; Woolaway et al., 2001). As such, it is reasonable to postulate that initiation occurs prior to the AUG codon at the CUC codon located between nt 5987 and 5989. Given th is assumption is correct, ORF2 would encode a 917 aa protein with a calculated mol ecular mass of 100 kDa. Similarity with Other Taxa in Regards to Partition and Arrangement of the Genome Viruses possessing similar bicistronic genomes have recently been accommodated in the newly described family Dicistroviridae, containing the single genus Cripavirus (Mayo, 2002) with the type species CrPV (Wilson et al., 2000). To date, seven singlestranded positive sense RNA viruses have been assigned to the genus including black queen cell virus ( BQCV ), Drosophila C virus ( DCV ), Himetobi P virus ( HiPV), Plautia stali intestine virus ( PSIV ), Rhopalosiphum padi virus ( RhPV ), Taura syndrome virus ( TSV), and Triatoma virus ( TrV). Tentative species in the genus include acute bee paralysis virus ( ABPV ), aphid lethal paralysis virus ( ALPV), kashmir bee virus ( KBV), and Solenopsis invicta virus-1 ( SINV-1 ). As seen in members of the picornavirus “superfamily”, cripaviruses exhibit a conserved array of replicative proteins incl uding a helicase, protease, and replicase. While superficially most similar to the Calciviridae inasmuch as the capsid protein is located downstream of the re plicase domain, ther e exist fundamental differences in regards to partition of the ge nome and replication strategy. More specifically, the capsid protein of calciviruses are either translated as part of a single, large polyprotein or from a subgenomic RNA; whereas, the genome of crip aviruses is divided into two distinct polyproteins with production of the capsid prot eins initiated internally from the genomiclength RNA (Minor et al., 1995; Wu et al., 2002).

PAGE 32

21 Alignment of the Amino Acid Sequences of Viral Non-structural Proteins with HoCV-1 ORF1 The RNA-dependent RNA Polymerase (RdRp) Domain Proteolytic cleavage of the nonstructural polyprotein precursor yields an active RNA-dependent RNA polymerase (RdRp). Up on release from the polyprotein, the RdRp acts to synthesize the complementary RNA molecu le from the parental template strand. Because replication of genetic material is comp ulsory for the proliferation of a particular species or lineage, polymerases typically carry sequence motifs which are conserved across all the major RNA virus classes and, in fact, represent th e only universally conserved protein found in viable positive-strand RNA viruses (Koonin and Dolja, 1993). As such, the three-dimensional configurat ion for RdRps of positive-strand RNA and dsRNA viruses show structural similarity to each other as well as to DNA-dependent RNA/DNA polymerases and reverse transc riptases (Ahlquist, 2002 and references therein). The DX 3 (F/Y/W/L/C/A)X 0-1 DX n (S/T/M)GX 3 TX 3 (N/E)X n (G/S)DD signature located in the C-terminal of the polyprotein serv ed as an identifier of the RdRp of HoCV-1 (DX 3 FX 0 DX 59 SGX 3 TX 3 NX 32 GDD, aa 1526-1639). Comparative analysis of this signature and the surrounding amino acid sequence with the nonstructural polyproteins of putatively related viruses revealed eight cons erved sequence motifs (I-VIII) characteristic of Supergroup 1 RdRps starting at amino aci d position 1449 and extending to position 1718 (Koonin and Dolja, 1993) (Fig. 3). The presen ce of this ordered series of motifs is congruent with the F1, F2, F3, A, B, C, D, and E motifs originally described for bovine viral diarrhea virus ( BVDV) RdRp (Lai et al., 1999).

PAGE 33

22 Fig. 3. Multiple sequence alignment of the putative RNA-dependent RNA polymerase (RdRp) domain of suggested members of the genus Cripavirus . Numbers on the left indicate the starting amino aci d positions of the aligned sequences. Amino acid positions showing similarity to HoCV-1 are shaded. Conserved regions correspondent to those recogn ized by Koonin and Dolja (1993) are labeled I-VIII. Delineation of the motifs within the RdRp domain of HoCV-1 was further validated by structural comparison with the RdRp 3d from human rhinovirus serotype 16 ( HRV-16) (PDB 1XR7). Although there was seemingly lo w sequence identity (e -14) between these polymerases, HoCV-1 RdRp was superimposed onto the model structure with few outliers noted on the Ramachandran plot (Fig . 4b). Moreover, the overall superposition

PAGE 34

23 of the two RdRps resulted in root mean s quared (rms) deviations of only 0.08 for 460 topologically equivalent C atoms and 0.10 for 1840 backbone atoms of the HoCV-1 polymerase as compared to HRV-16. Overall, both sequences formed the basic fingerspalm-thumb domain structure prevalent among polymerases (Fig. 4a). During replication of the genome, these structures act to coordinate catalytic metal ions, participate in binding of the primer:template or nucleoside triphosphate (NTP), and act as a guide for the template and product during elongation (C hoi et al., 2004). Throughout the process, the template and product lie within a channe l created by the thumb and finger domains. Upon elongation, they are impelled by the t humb domain, moving along the channel over the palm domain with its exposed ca talytic site (Butcher et al., 2001). Fig. 4. Structural model analysis of the HoCV-1 RNA-dependent RNA polymerase (RdRp). (A) Normal view of the structure of HoCV-1 RdRp. The fingers, palm, and thumb domains are colored blue, green, and red, respectively. The 5 and 3 -most residues are labeled accord ing to their amino acid position within the RdRp. (B) Ramachandran plot of HoCV-1 superimposed upon the HRV-16 model. Residues which lie with in the yellow demarcation signify regions of sterically allowed values of and , residues lying between the blue and yellow demarcations signify re gions of maximum tolerable limits of steric strain, and residues lying outside of the blue demarcation signify regions which do not conform to the allowable angles.

PAGE 35

24 The HoCV-1 polymerase core (residues 1187-1780) has a roughly spherical shape, with the exception of brief Nand Cterminal regions (residues 1187-1306 and 17621780, respectively) which exist in a potentia lly amorphic state and are therefore omitted from the reported structure. The fingers domain (residues 1187-1492 and 1535-1594) is comprised of 12 -helices and 9 -strands. The first structur e noted is the index finger (aa 1307-1525) which is formed by motifs F1, F2, F3 sited in a contiguous fashion to one another (Fig. 5a). The series of motif s sweeps across the palm to define the upper perimeter of the tunnel into which the template RNA enters. This structure contains three conserved basic residues (K 1455 , K 1459 , R 1468 ) analogous to R 163 , K 167 , and R 174 of the active RdRp of poliovirus, 3D pol . This triad contains a stric tly conserved arginine residue at the third position equivalent to R 174 of HRV, R 188 of rabbit hemorrhagic disease virus ( RHDV ), and R 72 of human immunodeficiency virus-type 1 reverse transcriptase ( HIV RT), which have been shown to interact directly with the -phosphate of the nascent NTP as it transverses the trough formed by the thumb and finger domains (Thompson and Peersen, 2004; Huang et al ., 1998). This final structure is trailed by residues 1468-1484 which double back over the palm domain in a re latively planar structure that completes the index finger. The remainder of the finger domains (aa 1485-1492 and 1535-1594) are -strand and -helix-rich with the ring finger formi ng the roof of the NTP entry tunnel. Following the finger domain is the palm domain containing motifs III-VII (equivalent to motifs A-E, HoCV-1 aa 1494-1534 and 1595-1690). This domain possesses a central -sheet bordered on two sides by -helices (shown as green in Fig. 4a). The first motif in this domain, denoted motif A, includes a conserved aspartic acid, D 1526 , which has been indicated in earlier studi es to be one of the principal magnesium

PAGE 36

25 coordination residues required for catalysis (Fig. 5b) (Love et al ., 2004). A second Asp Fig. 5. Structure of the HoCV-1 RNA-dependent RNA polymerase (RdRp) showing conserved motifs relevant to enzymatic activity. (A) Normal view in the Nterminal region including conserved motif F. (B) Normal view in the region including conserved motifs A to E. The conserved motifs are shown in color and labeled accordingly. located 5 amino acids downstream is consider ed to play a key role in discriminating between ribonucleotides and 2 -deoxyribonucleotides in RdRps by H + -bonding to the 2 OH of NTP (Hansen et al., 1997) . Continuing up into the -helix is motif B which features a highly conserved asparagine, N 1600 , which is thought to H + -bond to D 1531 , poising the latter residue for NT P recognition (Hansen et al., 1997). The third motif of the palm domain, motif C, is equivalent to motif VI and is clearly defined by the amino acid tetrad YGDD 1636-1639 . Both D 1638 and D 1639 can be mapped to the nucleotide-binding pocket and have been found to be essential for catalytic activity in th at they are required for chelation of two Mg 2+ ions at the active site (van Dijk et al., 2004 and references therein; Castro et al., 2005). Motif D (aa 1669-1673) precedes the hi ghly variable motif VII and is easily recognized as TXEXK in cripaviruses. The final motif of the palm domain of HoCV-1 RdRp, motif E, was determined by sequence comparison to several other viral RdRps (Bruenn, 2003; Xu et al., 2003 ). The residues which comprise this

PAGE 37

26 short motif (TFLKR 1688-1692 ) form a -hairpin turn that connects two -helices which lead into the thumb domain. The thumb domain of the HoCV-1 RdRp lies at the C-terminal portion of the polyprotein (aa 1691-1795) and likely assumes an -helical structure. The folding topology of the HoCV-1 RdRp thumb is generally similar to HRV-16 except that HoCV-1 15 and 16 are separated by a short -helix ( 17). The Nucleotide-binding (Helicase) Domain Alignment of HoCV-1 ORF1 with previously characterized RNA viruses revealed all five (A, B, B , C and D) of the conserved motifs characteristic of SF3 helicases situated approximately 598 amino acids from the N-terminus of the replicase polyprotein (Fig. 6). The first strictly conserved sequence, denoted motif A, occurs in a variety of enzymes responsible for nucleotide binding and/or hydrolysis (Walker et al., 1982) and is generally exemplified as (G/A)X 4 GK(T/S) [ HoCV-1 GETGQGKS 609-616 ]. Studies involving extensive structure an alyses of equivalent motifs in ATP-binding proteins via X-ray crystallography revealed that the residues contained within this motif form a relatively fixed phosphate-binding loop or ‘P-loop’ that enables the -amino group of Lys to interact with the and -phosphates of MgATP/MgADP while positioning the hydroxyl group of the adjacent Ser resi due to ligate directly to the Mg 2+ ion of the Mg•ATP complex (Mitchell et al., 2002). Motif B, originally defined as a single invariant asparagine residue, has been expounded in members of SF3 to include seven additional residues summarized as (E/Q)X 5 D(D/E). A correspondent sequence, QLVSVFDD, was detected in HoCV-1 starting 48 aa downstream of the Walker A Lys residue. Based on sequence similarity with adeno-associated virus type 2 ( AAV2) Rep40, a SF3 DNA helicase, and by analogy

PAGE 38

27 to structurally related AAA+ ( A TPases a ssociated with diverse cellular a ctivities) proteins, this motif represents the catalytic co re of the enzyme with the carboxyl group of the asparatic acid involved in chelation of the Mg 2+ ion of MgATP/MgADP complex through outer sphere interactions and the Glu positioned as the catalytic carboxylate residue in ATP hydrolysis (James et al., 2003). Fig. 6. Multiple sequence alignment of the nucleotide binding (helicase) domain of suggested members of the genus Cripavirus. Numbers on the left indicate the starting amino acid positions of the a ligned sequences. Amino acid positions showing similarity to HoCV-1 are shaded. Conserved regions within the helicase correspondent to those recognized by Koonin and Dolja (1993) are labeled A, B and C. In HoCV-1 , motif C deviates slightly from the consensus sequence KGX 2 @XSX&U&X(T/S)(T/S)N originally identified by Koonin and Dolja (1993) [where @ designates an aromatic residue (F,Y,W), & designates either a bulky aliphatic or aromatic hydrophobic residue, and U designates a bulky aliphatic resi due (I,L,V,M)]. However, the series identified as KNTTTFQSRIVILTTN 707-722 is still recognizable.

PAGE 39

28 Analogous to the sensor 1 region in Rep 40, this motif contains an invariant Asn at the 5 end which is poised to form hydrogen bonds with the -phosphate of the ATP in preparation for nucleophilic at tack (Abbate et al., 2004). In addition to motifs A, B, and C, SF3 helicases carry a four th signature motif, denoted B . While somewhat variable, stru cture-based sequence alignment of representative members of the SF3 fam ily around the B and C motifs purports the consensus sequence as (K/R)X 2 (L/C)XGX 2-3 (I/V)X 2 (D/E)XKX 5-6 Q(I/L)X 1-2 PX 0-1 P (YoonRobarts et al., 2004). This motif was not detected in HoCV-1 nor was it observed in any other cripavirus species. Notable, however, is a string of conserved amino acids with the consensus sequence RX 2 NX 2 P. While not obvious, certain comparisons can be made to the previously reported B motif. For example, both HoCV-1 R 690 and AAV2 K 404 are hydrophobic and electropositive and thus both fit into the accepted hexameric model, equivalently positioned as part of a -hairpin that projects from the core of the protein into a central pore. In AAV2, this loop transitions directly into a second -loop containing a highly conserved Gln which may be exchanged with the Asn at HoCV-1 position 693. Pertinent to the oligomeric nature of SF3 helicases is the presence of an ‘arginine finger’ which is formed by the final motif, motif D. In HoCV-1, this structural feature was manifested as a single Arg residue lo cated 17 amino acids downstream from the terminal Asn of motif C. Analogous residue s have been documente d in other helicases, where they are proposed to bind to the te rminal phosphate an ion of ATP. Upon hydrolysis of the ATP, the pyrophosphate acts upon the Arg to displace it from the nucleotide. This liberation cau ses the second domain (motif B) to separate from the first

PAGE 40

29 (motif A), allowing a conformational change that may facilitate olignonucleotide duplex destabilization or strand displacem ent (Caruthers and McKay, 2002). The Protease Domain When aligned with putatively related proteins, a conserved Cys residue was detected in the 5 ORF product of HoCV-1 at amino acid position 1185. Flanking the cysteine are two glycines (G 1183 and G 1186 ) which take the form of GXCG, a classic signature of cysteine proteases. In theory, the sulphydryl/thiol (-SH) group of the active site Cys should act as a strong nucleophile – the sulphur atom forming a thiolate anion/imidazolium couple with histidine (H 1026 ). The amide oxygen of a third residue, asparagine (D 1101 ), could then interact with the His, forming a catalytic triad (Fig. 7). Fig. 7. Multiple sequence alignment of the protease domain of suggested members of the genus Cripavirus . Numbers on the left indica te the starting amino acid positions of the aligned sequences. Amino acid positions showing similarity to HoCV-1 are shaded. Residues believed to be involved in forming the catalytic triad are marked by an asterisk (*). In comparison with serine proteinases and human rhinovirus 14 ( HRV-14) structural data, the residues which immediately su rround the active cysteine of HoCV-1 (GDCGG 11831187 ) should engender a similar conformationa l structure analogous to the oxygenation hole observed with picorna and picorna-like virus GXCG[G/S/A] motifs (Ryan and Flint, 1997).

PAGE 41

30 The Intergenic Region (IGR) of HoCV-1 Internal ribosome entry is an alternative translation initiation strategy adopted by an array of RNA viruses. This novel tactic has been ascribed to a RNA tertiary structure that is formed a short distance upstream of the coding ORF. These highly structured RNA elements are unusual in that they di rectly assemble 80S monosomes despite the absence of the canonical initiation factors (e.g., eIF4F, eIF2, eIF3, and Met-tRNA i ) (Sasaki and Nakashima, 1999; Sasaki and Na kashima, 2000; Wilson et al., 2000). To determine if translation initiation of HoCV-1 ORF2 occurs in the same manner via an IGR-IRES, the region between HoCV-1 ORF1 and ORF2 was aligned with the nucleotide sequences upstream of th e capsid coding region of CrPV, PSIV and RhPV . The resultant alignment revealed several short, conserved RNA segments shared among the four viruses starting at HoCV-1 nt position 5798 and continuing to position 5989 (Fig. 8). Fig. 8. Multiple nucleotide sequence alignm ent of the intergenic regions (IGR) of CrPV, PSIV , RhPV , and HoCV-1 . The numbers on the left show the starting nucleotide position of each sequence. Amino acid positions showing similarity to HoCV-1 are shaded. "*" denotes nucleotides which were identical in all sequences in the alignment. These conserved regions were consistent with secondary structural features predicated for the other three viruses, sugges ting that this virus may also employ an IGRIRES-mediated translation mechanism for capsid protein translation. When the

PAGE 42

31 secondary structure of the HoCV-1 IGR was predicted using the program Mfold, four stem-loop (SLI-SLIV) structures were formed (Fig. 9). Additional analysis led to the Fig. 9. Secondary structure of the HoCV-1 internal ribosomal entry site (IRES) within the intergenic region (IGR) as predic ted by Mfold. SL = stem loop. Boxes highlight nucleotides which may form pseudoknots (PK). The adenine bordered by a triangle marks a single nucleotide polymorphism (SNP) at base 5985. resolution of three pseudoknots (PKI PKIII) cr eated by the interacti on of small inverted repeats distributed throughout the sequence. The predicted SLI consisted of nt 58015872 of which nt 5836-5841 were the reverse complement of single-stranded nt 59405945, suggesting the presence of a pseudoknot (P KI) at this position. SLII and III were comprised of nt 5881-5894 and nt 5899-5936, resp ectively. SLII is t hought to exist as predicted, however, SLIII contains an asym metric internal loop (CGGUGG) between nt 5908 and 5912 which may pair with nt 5876-5880 to form a second pseudoknot (PKII). The final stem-loop structure, SLIV, is constituted by nt 5949-5974 of which nt 59605964 (GAGUU) are the reverse complement of nt 5985-5989 [(A/G)ACUC]. The

PAGE 43

32 intergenic (IG) IRESs of RhPV and CrPV contain and direct tran slation initiation from CCU codons in the second ORF and the IG-IRES of PSIV elicits translation of the structural polyprotein fr om a CCU triplet. Similarly, the IG-IRES of HoCV-1 may initiate translation at the CUC codon which becomes paired with GAG 5960-5962 of SLIV. The formation of the resultant pseudoknot (PKIII) immediately upstream of the capsid ORF (ORF2) enables initiation of translat ion from alanine (GCA) rather than the conventional methionine, a notable feature of dicistroviruses examined thus far (Kanamori and Nakashima, 2001). More specif ically, the PKI folded structure should mimic the deacylated tRNA which normally would occupy the ribosomal P-site (or donor site), thereby positioning the GCA triplet into the ribosomal A-site (or acceptor site) from which translation of the second polyprotein commences (Jan and Sarnow, 2002; Pestova et al., 2004). Mapping of the Coding Region of the Structural Proteins Analysis of the HoCV-1 ORF2 Amino Acid Product By aligning the struct ural polyprotein of HoCV-1 (ORF2) with those of other cripaviruses, we were able to successfully identify three major proteins (CP2, CP3 and CP1) (Fig. 10) and one minor (CP4) protein. In many picorn a-like virus systems, the latter protein exists initially as the N-term inal extension of CP2 but is subsequently autocatalytically detached from an intermediate protein (VP0) following capsid formation (Isawa et al., 1998). Consequently, the arrangement of the structural proteins within the structural polyprotein of HoCV-1 was resolved as NH 2 -CP2-CP4-CP3-CP1-COOH (Fig. 11).

PAGE 44

33 Fig. 10. Multiple alignment of conserved amino acid sequences specific for capsid protein 2 (CP2), 3 (CP3) and 1 (CP1) of suggested members of the genus Cripavirus . Numbers on the left indicate the starting amino acid positions of the aligned sequences according to the st ructural protein submitted to NCBI’s GenBank . Amino acid positions showing similarity to HoCV-1 are shaded. Consensus symbols denoting the degree of conservation are shown beneath each alignment and were used as follows: "*" residues or nucleotides in that column were identical in all sequen ces, ":" conserved substitutions were observed, "." semi-conserved substitutions were observed.

PAGE 45

34 Fig. 11. Continued. Fig. 12. Organization of the genome of HoCV-1 with the structural proteins highlighted to show the order of the i ndividual capsid proteins. The coloring scheme is as follows: CP4 = green, CP2 = yellow, CP3 = red, and CP1 = blue. Equipped with multiple sequence alignment data and aware of the proteolytic preferences of cysteine proteases, potentia l cleavage sites for the individual capsid proteins were discerne d as follows: KSVTMQ 303 /E 304 RSAGT (CP2/CP4), LAAFGL 358 /G 359 KPKNL (CP4/CP3), and IQADVQ 641 /S 642 AFAAD (CP3/CP1) (where / represents the sessile bond). Based on the predicted cleav age sites, molecular weights of the HoCV-1 structural proteins should measur e approximately 32 kDa (CP1), 31 kDa (CP2), 30 kDa (CP3), and 5.6 kDa (CP4). Is important to note, however, that the individual proteins may appear larger when analyzed by SDS-PAGE versus computational analysis due to posttranslational modifications.

PAGE 46

35 Structural Models of the HoCV-1 Capsid Proteins By marrying multiple sequence alignment data of HoCV-1 ORF2 with preconceived crystallographic data for CrPV, we were able to approximate the general structure of each of the four capsid prot eins (CP1-4) and, by comparison, associate particular residues within each protein with a putative function. Residues are labeled following the standard convention, namely, subunits are numbered starting from 1,1 for CP1, 2,1 for CP2, etc. with amino acids numbe red starting from 1 in each protein. As seen in Fig. 12, CP1-3 each possess the be ta-barrel core common among viral coat proteins. This structure, co mmonly referred to as a “jelly roll”, results from two Greek key motifs that are linked by two connections rather than the one seen in the gammacrystalin domains. CP4, on the other hand, adopts a rather simple conformation with rather uncomplicated protein architecture. The homology model of HoCV-1 CP2 incorporates residues E 16 to S 270 with a final rms value between corresponding C positions of 0.48. Of the eleven residues noted in the conformation-forbidden areas of the Ra machandran plot (i.e ., outside the blue boundaries), four were glycines (G 2,118 , G 2,203 , G 2,206 , and G 2,269 ). Because the side chains of glycine are small, these residues are sterically unhi ndered, allowing them to adopt conformations that are otherwise forbidden. As such, their presence outside the range of acceptable / angles had only a marginal influence on the overall quality of the model. All fifteen of the conserved residues reported as conserved in insect picorna-like viruses by Lijas et al. (2002) were easily discerned. Their positions in HoCV-1 CP2 are as follows: R 2,79 , W 2,88 , P 2,104 , Q 2,131 , N 2,133 , F 2,137 , G 2,140 , L 2,142 , P 2,148 , P 2,171 , D 2,176 , P 2,188 , Y 2,189 , P 2,215 , and L 2,216 .

PAGE 47

36 Fig. 12. The structures of the four HoCV-1 capsid proteins, CP1-4. The -strands are shown in green, -helices in red and other stru ctures in yellow. Secondary structure assignment was performed by superimposing HoCV-1 CP1-4 with CrPV capsid proteins (PDB 1b35a, 1b35b, 1b35c, and 1b35d respectively) using DeepView. The carboxy-(COOH) and amino-(NH) terminals are labeled accordingly. Glycines are repr esented by squares; all additional residues are indica ted with a + sign.

PAGE 48

37 The refined model of HoCV-1 CP4, ORF2 aa 304-358, was the least complex of the four models constructed, taking on a rather extended shape with two -helices located near the Nand C-terminal ends connect ed by a polypeptide forming loop. The rms deviation in C positions between the final HoCV-1 CP1 model and the model of CrPV was 0.08 for 55 of 55 nucleobases (nb). All modeled residues fell within the allowed regions of the Ramachandran plot and no main chain or backbone conflicts were observed. In addition to several other cons erved residues, a large hydrophobic residue is present at the C-terminus of CP4 of all cripaviruses including HoCV-1 (L 4,55 ). HoCV-1 CP3 was derived from the coordinates of CrPV PDB 1b35c and consists of HoCV-1 structural polyprotein residues 369-641 amended to a 0.09 resolution for 272 equivalent C positions. There were nine outliers on the Ramachandran plot and six backbone residues with steric proble ms all of which were prolines (P 3,88 , P 3,114 , P 3,187 , P 3,198 , P 3,199 , and P 3,208 ). When compared to other pico rnaand picorna-like viruses the following residues were f ound to be conserved in HoCV-1 CP3: K 3,2 , P 3,3 , G 3,25 , D 3,52 , E 3,53 , P 3,88 , W 3,127 , G 3,129 , V 3,138 , H 3,143 , P 3,153 , D 3,175 , P 3,187 , and G 3,221 . Furthermore, a asparagine was noted at position 253 in HoCV-1 , substituting for the aspartic acid typically noted at this positi on in Type I insect picorna-li ke viruses. This finding is congruent with N 3,262 and N 3,243 located within CP3 of IFV and SBV , which may suggest a shared ancestry among the three viruses. Superposition of HoCV-1 CP1 and CrPV CP1 (PDB 1b35a) generated a theoretical model with a rms deviation of 0.07 (255 C atoms) and no steric clashes. Additionally, there were few outliers in the Ramachandran pl ot with ~95% of the residues residing in favored regions. Alignment of the amino aci d sequences used in the model revealed

PAGE 49

38 several highly conserved residues including HoCV-1 R 1,55 , F 1,119 , A 1,121 , G 1,122 , P 1,182 , D 1,236 , D 1,237 , G 1,245 , and P 1,247 . Some variations on the theme were noted, however. For example, the residue immediately following the asparagine couple of CrPV (DD 1,241-242 ) is phenylalanine (F 1,243 ); whereas, in HoCV-1 CP1, this position contains a lysine (L 1,238 ). Because both phenylalanine and lysine are non -polar, large hydrophobic amino acids, it is not remarkable that they be intercha nged. Another, perhaps more surprising, inconsistency between HoCV-1 and CrPV is the presence of a phenylalanine at HoCV-1 CP1 position 183 which replaces the only slightly hydrophobic/indifferent tyrosine of Type I viruses for a large, very hydrophobic amino acid as observed in Type II viruses (e.g., IFV and SBV ). Phylogenetic Analysis The highly conserved fragments of the Rd Rp proteins containing motifs I to VIII (~270 aa) of the cripaviruses and repr esentative members of the families Iflaviridae, Comoviridae and Sequiviridae were used in a phylogene tic analysis. The neighborjoining tree method was used and the robustness of the results examined using 1000 bootstrap replicates. The phylogram constructe d by PAUP reflects the current systematic assignment of the viruses as dictated in the Seventh Report of the International Committee on Taxonomy of Viruses (2000). The tw o plant viruses and the Iflavirus were clearly distinct from all of the cripaviruses. As reflected in Fig. 13, th ree discrete clusters were formed with ABPV , KBV, SINV-1 , CrPV and DCV belonging to the first, BQCV , HiPV, TrV, PSIV and HoCV-1 belonging to the second, and ALPV and RhPV making up the third.

PAGE 50

39 Fig. 13. Phylogenetic analysis of HoCV-1 and other ssRNA positive-strand viruses based on the amino acid sequence of the puta tive RNA-dependent RNA polymerase (RdRp). The neighbor-joining tree wa s produced using PAUP* 4.0b software and the robustness of the tree tested using 1000 bootstrap replicates. Outgroups include sacbrood virus ( SBV ) (Iflaviridae), squash mosaic virus ( SqMV ) RNA 1 ( Comoviridae ), and rice tungro spherical virus ( RTSV ) ( Sequiviridae). Virus abbreviations and appropr iate references are provided in the ‘Materials and Methods’ section of the manuscript. This finding affirms the inclusion of HoCV-1 into the recently recognized genus Cripavirus (family Dicistroviridae ). Evidence demonstrating re latedness of these viruses regarding genome organizati on, amino acid sequence similar ity, and putative replication strategy further bolster this taxonomic position. Development of an RT-PCR Assay as a Diagnostic Tool for Sharpshooter Virus Detection Conventional diagnosis of viral infecti on generally includes methods such as transmission electron microscopy (TEM), agar-gel immunodiffusion (AGID), and/or enzyme-linked immunosorbent assay (ELISA). However, these diagnostic tools are timeconsuming, labor-intensive and, in the cas e of AGID and ELISA, may rely on the

PAGE 51

40 production of large amounts of purified virus in order to manufacture a suitable antisera. Additionally, methods such as TEM fail to disc riminate between viral species in the event of coinfection. The availability of virus se quence data, however, rais es the possibility of employing a PCR-based approach for rapid, sp ecific, and cost-effective detection of virus-infected insect populations . This technique has been su ccessfully applied to detect a variety of insect picorn a-like viruses including ABPV (Benjeddou et al., 2001; Bakonyi et al., 2002), BQCV (Davison et al., 2003), KBV (Hung and Shimanuki, 1999), and SBV (Grabsteiner et al., 2001). In the pres ent study, unique PCR primers were designed against the capsid-coding re gion (nt 8695-9138) and a basic pr otocol was developed for the detection of HoCV-1 and two other GWSS-infecting viral species, tentatively designated HoCV-2 and HoCV-3 . Using these primers, the RT-PCR was able to detect HoCV-1 in field-collected leafhopper populations. To determine the sensitivity of the RT-PCR, a cDNA encoding the full-length of the viral genome was transcribed and an aliquot (1 g) of the resultant RNA serial diluted to concentrations ra nging from 50 ng to 500 ag. Each dilution was incorporated into a reverse transcripti on reaction as a standalone template or as a complex mixture and then subjected to am plification by way of PCR. Fig. 14 shows the detection sens itivity of RT-PCR on these samples. The detection limit of HoCV-1 was estimated to be about 95 genome equivalents (geq).

PAGE 52

41 Fig. 14. Determination of the sensitiv ity of amplification by RT-PCR of the HoCV-1 . RNA stock (50 ng/ L) obtained through transcrip tion of a cDNA encoding the full genome of HoCV-1 was serially 10-fold dilu ted to produce eight working solutions with concentrations ranging from 5 ng/ L to 500 ag/ L. One microliter of each working solution was used in a one step RT-PCR reaction. M, DirectLoad marker (Sigma-Aldrich, St. Louis, MO); CA, H. coagulata collected from Citrus sinensis in Riverside, California; Water, water/no template control; Lane 1, 50 ng/ L dilution; Lane 2, 5 ng/ L dilution; Lane 3, 500 pg/ L dilution; Lane 4, 50 pg/ L dilution; Lane 5, 5 pg/ L dilution; Lane 6, 500 fg/ L dilution; Lane 7, 50 fg/ L dilution; Lane 8, 5 fg/ L dilution; Lane 9, 500 ag/ L dilution. Incidence of HoCV-1 Infection in Geographically Disparate Regions of North America An RT-PCR analytic survey for HoCV-1 from extracts of H. coagulata , O. nigricans , and H. insolita collected in California, north Florida, and south Georgia revealed a pattern of fairly widespread geogr aphical distribution (Table 1; refer to the Appendix for RT-PCR gel images). Conversely, HoCV-1 infections were not detected in either H. coagulata or H. insolita in south Florida, nor were they detected in H. coagulata collected from Hawaii.

PAGE 53

Table 1. Survey of sharpshooter populations for the presence of HoCV-1 42 Date of Collection Location (County, State) Tissue Source (Genus species)LifestageHost Plant(s) No. Surveyed H oCV-1 Infection 30-Apr-02Riverside, CA H. coagulata Adult Citrus sp. 164a+ 10 and 13-June-05Alameda, CA G. atropunctata Adult Rosa sp. 2a10-Jun-05Alameda, CA G. atropunctata Nymph Ocimum basilicum 25a,b10-Jun-05Mendocino, CA D. minerva Adult Mixed riparian spp. (primarily Vitis californica )1 2a10-Jun-05Napa, CA G. atropunctata Nymph Mixed riparian spp. (primarily Artemisia douglasiana and V. californica )12a10-Jun-05Sonoma, CA G. atropunctata Adult, Nymph Mixed riparian spp. (primarily A. douglasiana )4 , 1 5a10-Jun-05Sonoma, CA G. atropunctata Nymph Mixed riparian spp. (primarily A. douglasiana )1 2a10-Jun-05Sonoma, CA D. minerva Adult Mixed riparian spp. (primarily A. douglasiana )2 3a10-Jun-05Sonoma, CA G. atropunctata Adult Mixed riparian spp. (primarily A. douglasiana )1 6a17-Sep-03Gadsden, FL H. coagulata Adult Lagerstroemia indica 10 + 4-Mar-04Gadsden, FL H. insolita Adult Sorghum halepense 10 + 22-Mar-04Gadsden, FL O. nigricans Adult Ilex x 'China Girl' 9 + 9-Aug-05St. Lucie, FL H. coagulata Adult Lagerstroemia indica 11 2-Sep-05St. Lucie, FL H. insolita Adult Sorghum halepense 63-Sep-05Okeechobee, FL H. coagulata Adult Lagerstroemia indica x 'Natchez' 11 28-Aug-04Grady, GA H. coagulata Adult Lagerstroemia indica 11 + 28-Aug-04Grady, GA H. coagulata Adult Ilex spp. 12c+ 28-Aug-04Grady, GA O. nigricans Adult Ilex spp. 12d+ 14-Jul-05Honolulu, HI H. coagulata Adult Spathodea companulata 11 -aSamples processed as a population b Collected from a colonycThree individuals were sampled from each of the following Ilex hybrids: x 'Attenuata', x 'Nellie', x 'Oakleaf', x 'Robin' d Four individuals were sampled from each of the following Ilex hybrids: x 'Attenuata', x 'Nellie', x 'Oakleaf'

PAGE 54

43 Because it has been suggested that California sharpshooters originated from the southeastern United States and because of the nearly equivalent climatic conditions (e.g., average daily temperature, rainfall and humid ity) of the two regions, it is not surprising that the virus could subs ist in both populations . The indication that HoCV-1 exists in north Florida sharpshooters but not in thos e found in south Florida, however, is more difficult to interpret. Several factors could contribute to this phenomenon including: The existence of multiple insect biotypes representing variant geneticallyproscribed defense responses Geographical distinction am ong populations (i.e., populations that do not coexist or interbreed) Induction of virus replication in resp onse to secondary pathogens/stress (e.g., crowding, epizootic fungal infections, coin fection of an additional virus, etc.) The existence of “polyfactorial” disease complexes (e.g., occurrence of a secondary vector or activator of ina pparent infection as seen w ith the ectoparasitic mite Varroa destructor Anderson & Truemen and ABPV (Ball and Allen, 1988; BowenWalker et al., 1999)) Climatic variations between the two regions (e.g., temperate vs. tropical) Likewise, the RT-assay failed to detect HoCV-1 in either Draeculacephala minerva or Graphocephala atropunctata . These findings suggest that while HoCV-1 is not limited to H. coagulata, infection is not ubiquitous to all sharpshooter genera.

PAGE 55

CHAPTER 4 CONCLUSION The molecular analyses of the HoCV-1 genome presented in this paper substantiate its inclusion into the recently recognized genus Cripavirus within the family Dicistroviridae. Evidence demonstrating relatedne ss of these viruses regarding genome organization, amino acid sequence similarity, an d putative replication strategy bolster this taxonomic position. The availability of virus sequence data ra ised the possibility of using molecular methods for the detection of HoCV-1 . Unique PCR primers were designed against the capsid region of HoCV-1 and a basic protocol which employed RT-PCR was developed. This rapid, low-cost technique was demonstrated to be rather sensitive, with a lower detection limit of approximately 100 geq. Results of the RT-PCR assays performed in this study indicate strongly that HoCV-1 has a relatively narrow host range, shown thus far to be restricted to leafhopper species. Furthermore, the virus was shown to be present in two geographically isolated regions, s uggesting that it can endure somewhat variant climatic conditions. The proposed degree of specificity and biological stability of HoCV1 in diverse environments are ideal characters in ascertaining the potential utility of this virus as a biological control ag ent. However, further studie s are necessary to determine pathogenicity and feasibility of large-scale production of the virus. In the case of relatively efficient replication yet low toxicity, HoCV-1 could be developed as an advanced vector for stab le gene expression. Similar bicistronic expression vectors surmount the functionality of conventional cotransfection systems in 44

PAGE 56

45 that the IRES located between the two genetic elements allows both elements to be translated simultaneously, allowing for constituti ve expression of vira l or foreign genetic elements.

PAGE 57

APPENDIX RT-PCR ASSAY GEL IMAGES The results of the RT-PCR assays for determining the geographic range of HoCV-1 within disparate H. coagulata populations are shown in Fig. 15-19. Fig. 20-24 present results from similar assays which define th e relative host range of the virus. Samples were considered positive when a visible am plicon (443 nt) was present after separation on a 1% agarose(TAE) gel stained with EtBr (0.5 g/mL). Amplic on fragment size was determined using the DirectLoad marker (Sigma-Aldrich, St. Louis, MO) in the well labeled ‘M’ located to the left of the RT-PCR test samples. Positive controls included (+) (virus clone from adult H. coagulata cDNA library) and CA ( H. coagulata collected from C. sinensis in Riverside, California) . ‘Water’ denotes the wate r/no template control and ‘--‘ denotes that no sample was run in the lane. Fig. 15. Agarose gel analysis of RT-PCR products using total RNA from male and female Homalodisca coagulata collected from a w ild population on crepe myrtle ( Lagerstroemia indica ) in Quincy, Florida (Gadsden county). 46

PAGE 58

47 A B Fig. 16. Agarose gel analysis of RT -PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from wild populations in Cairo, Georgia (Grady county). (A) H. coagulata collected from crepe myrtle ( Lagerstroemia indica ). (B) H. coagulata collected from holly ( Ilex spp.). Holly hybrids were as follows: Lanes 1-3 ( Ilex x ‘Robin’), Lanes 4-6 ( Ilex x ‘Nellie’), Lanes 7-9 ( Ilex x ‘Oakleaf’), Lanes 10-12 ( Ilex x ‘Attenuata’). Fig. 17. Agarose gel analysis of RT -PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from ye llow sticky traps secured to African tulip-trees ( Spathodea campanulata ) in Oahu, Hawaii (Honolulu county). Fig. 18. Agarose gel analysis of RT -PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from a wild population on crepe myrtle ( Lagerstroemia indica ) in Ft. Pierce, Florid a (St. Lucie county). Fig. 19. Agarose gel analysis of RT -PCR products using total RNA from Homalodisca coagulata (mixed sexes) collected from a wild population on crepe myrtle ( Lagerstroemia indica x ‘Natchez’) in Okeechobee, Florida (Okeechobee county).

PAGE 59

48 Fig. 20. Agarose gel analysis of RT -PCR products using total RNA from Homalodisca insolita (mixed sexes) collected from a wild population on Johnsongrass ( Sorghum halepense ) in Quincy, Florida (Gadsden county). Fig. 21. Agarose gel analysis of RT -PCR products using total RNA from Homalodisca insolita (mixed sexes) collected from a wild population on Johnsongrass ( Sorghum halepense ) in Ft. Pierce, Florida (St. Lucie county). Fig. 22. Agarose gel analysis of RT -PCR products using total RNA from Oncometopia nigricans (mixed sexes) collected from a wild population on holly ( Ilex x meserveae ‘China Girl’) in Quin cy, Florida (Gadsden county). Fig. 23. Agarose gel analysis of RT -PCR products using total RNA from Oncometopia nigricans (mixed sexes) collected from a wild population on holly ( Ilex hybrids) in Cairo, Georgia (G rady county). Lanes 1-3 ( Ilex x ‘Robin’), Lanes 4-6 ( Ilex x ‘Nellie’), Lanes 7-9 ( Ilex x ‘Attenuata’).

PAGE 60

49 Fig. 24. Agarose gel analysis of RT -PCR products using total RNA from Graphocephala atropunctata and Draeculacepahala minerva (mixed sexes) collected from several wild populations in centr al California. Lane 1 (Adult G. atropunctata collected from Rosa sp., Alameda Co.), Lane 2 (Nymph G. atropunctata collected from Artemisia douglasiana and Vitis californica , Napa Co.), Lane 3 (Adult and nymph G. atropunctata collected from mixed riparian habitat, Sonoma Co.), Lane 4 (Nymph G. atropunctata collected from mixed riparian habitat, Sonoma Co.), Lane 5 (Adult D. minerva collected from mixed riparian habitat, Sonoma Co.), Lane 6 (Adult D. minerva collected from mixed riparian habitat, Me ndocino Co.), Lane 7 (Adult G. atropunctata collected from A. douglasiana, Sonoma Co.), Lane 8 (greenhouse-reared offspring of #7).

PAGE 61

LIST OF REFERENCES Abbate, E.A., Berger, J.M., Botchan, M.R., 2004. The X-ray structure of the papillomavirus helicase in complex with its molecular matchmaker E2. Genes & Development 18, 1981-1996. Ahlquist, P., 2002. RNA-depe ndent RNA polymerases, viru ses, and RNA silencing. Science 296, 1270-1273. Bakonyi, T., Farkas, R., Szendri, Dobos-Kov cs, M., Rusvai, M., 2002. Detection of acute bee paralysis virus by RT-PCR in honey bee and Varroa destructor field samples: rapid screening of representati ve Hungarian apiaries. Apidologie 33, 6374. Ball, B.V., Allen, M.F., 1988. The prevalence of pathogens in the honey bee ( Apis mellifera ) colonies infested w ith the parasitic mite Varroa jacobsoni. Annals of Applied Biology 113, 237-244. Benjeddou, M., Leat, N., Allsopp, M., Davison, S., 2001. Detection of acute bee paralysis virus and black queen cell virus from honeybees by reverse transcriptase PCR. Applied and Environmental Microbiology 67(5), 2384-2387. Bowen-Walker, P.L., Martin, S.J., Gunn, A., 1999. The transmission of deformed wing virus between honeybees ( Apis mellifera L.) by the ectoparasitic mite Varroa jacobsoni Oud. Journal of Invert ebrate Pathology 73, 101-106. Brlansky, R.H., Timmer, L.W., French, W.J ., McCoy, R.E., 1983. Colonization of the sharpshooter vectors, Oncometopia nigricans and Homalodisca coagulata , by xylem-limited bacteria carriers of xylem-limited bacterial disease. Phytopathology 73, 530-535. Bruenn, J.A., 2003. A structural and primar y sequence comparison of the viral RNAdependent RNA polymerase. Nucleic Acids Research 31(7), 1821-1829. Butcher, S.J., Grimes, J.M., Makeyev, E. V., Bamford, D.H., Stuart, D.I., 2001. A mechanism for initiating RNA-dependent RNA polymerization. Nature 410, 235240. Caruthers, J.M., McKay, D.B., 2002. Heli case structure and mechanism. Current Opinion in Structural Biology 12, 123-133. 50

PAGE 62

51 Castro, C., Arnold, J.J., Cameron, C.E., 2005. Incorporation fidelity of the viral RNAdependent RNA polymerase: a kinetic, ther modynamic and structural perspective. Virus Research 107, 141-149. Cavener, D.R., Ray, S.C., 1991. Eukaryotic st art and stop translation sites. Nucleic Acids Research 19, 3185-3192. California Department of Food and Agriculture (CDFA), 2003. Pierce ’s disease control program – report to the legi slature. Available at http://www.cdfa.ca.gov/phpps/pdcp/docs/2002LegReport.pdf . (verified 4/2/2005) California Department of Food and Agriculture (CDFA), 2005. Pierce ’s disease control program – plant quarantine manual. Available at http://pi.cdfa.ca.gov/pqm/manual/htm/454.htm . (verified 4/2/2005) Chang, C.J., Garnier, M., Zreik, L., Ro sseti, V., Bove, J.M., 1993. Culture and serological detection of the xylem-limite d bacterium causing citrus variegated chlorosis and its identification as a strain of Xylella fastidiosa. Current Microbiology 27, 137-142. Cheou, D., 2002. Incursion of glassy winged sharpshooter Homalodisca coagulata in French Polynesia. Plant Protec tion Service Pest Alert No. 24. Choi, K.H., Groarke, J.M., Young, D.C., Kuhn, R.J., Smith, J.L., Pevear, D.C., Rossmann, M.G., 2004. The structure of the RNA-dependent RNA polymerase from bovine diarrhea virus establishes the role of GTP in de novo initiation. Proceedings of the National Academ y of Sciences (USA) 101(13), 4425-4430. Christian, P., Cartens, E., Domier, L., Johnson, K., Nakashima, N., Scotti, P., van der Wilk, F., 2000. Genus “cricket paralysis-like viruses.” In: van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pr ingle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy: Seventh Report of the Internal Committee on Taxonomy of Viruses. Academic Press, London, United Kingdom, pp. 678-683. Costa, H.S., Blua, M.S., Bethke, J.A., Redak, R.A., 2000. Transmission of Xylella fastidiosa to oleander by the gla ssy-winged sharpshooter, Homalodisca coagulata. HortScience 35, 1265-1267. Czibener, C., La Torre, J.L., Muscio, O.A., Ugalde, R.A., Scodeller, E.A., 2000. Nucleotide sequence analysis of Triatoma virus shows that it is a member of a novel group of insect RNA viruses. Journal of General Virology 81, 1149-1154. Damsteegt, V.D., Brlansky, R.H., Phillip s, P.A., Roy, A., 2003. Glassy-winged sharpshooter transmission of Xylella fastidiosa , causal agent of citrus variegated chlorosis. Phytopathology 93, s19.

PAGE 63

52 Davison, S., Leat, N., Benjeddou, M., 2003. Development of molecular tools for honeybee virus research: th e South African contributi on. African Journal of Biotechnology 2(12), 698-713. De Miranda, J.R., Drebot, M., Tyler, S ., Shen, M., Cameron, C.E., Stoltz, D.B., Camazine, S.M., 2004. Complete nucleotide sequence of kashmir bee virus and comparison with acute bee paralysis virus . Journal of General Virology 85, 22632270. Derrick, K.S., Timmer, L.W., 2000. Citrus bli ght and other diseases of recalcitrant etiology. Annual Review of Phytopathology 38, 181-205. Domier, L.L., McCoppin, N.K., D'Arcy, C.J., 2000. Sequence requirements for translation initiation of Rhopalosiphum padi virus ORF2. Virology 268, 264. Ghosh, R.C., Ball, B.V., Willcocks, M.M., Carter, M.J., 1999. The nucleotide sequence of sacbrood virus of the honey bee: an insect picorn a-like virus. Journal of General Virology 80, 1541-1549. Govan, V.A., Leat, N., Allsopp, M., Davison, S ., 2000. Analysis of the complete genome sequence of acute bee paralysis virus shows that it belongs to the novel group of insect-infecting RNA viruses. Virology 277, 457-463. Grabsteiner, E., Ritter, W., Carter, M.J., Davison, S., Pechhacker, H., Kolodziejek, J., Boecking, O., Derkhshifar, I., Moosbec khofer, R., Licek, E., Nowotny, N., 2001. Sacbrood virus of the honeybee ( Apis mellifera ): rapid identification and phylogenetic analysis using reverse tran scription-PCR. Clinical Diagnostic Laboratory Immunology 8, 93-104. Guex, N., Peitsch, M.C., 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18, 2714-2723. Han, S.S., Yoshida, K., Karasev, A.V., Iwanami, T., 2002. Nucleotide sequence of a Japanese isolate of squash mosaic virus . Archives of Virology 147(2), 437-443. Hansen, J.L., Long, A.M., Schultz, S.C., 1997. Structure of the RNA-dependent RNA polymerase of poliovirus. Structure 5, 1109-1122. Hearon, S.S., Sherald, J.L., Kostka, S.J., 1980. Association of xylem-limited bacterium with elm, sycamore, and oak leaf scorch. Canadian Journal of Botany 28, 19861993. Heu, R.A., Kumashiro, B.R., Suh, T.H., Bautista, R.C., 2004. Glassy-winged sharpshooter Homalodisca coagulata (Say) (Homoptera: Ci cadellidae). State of Hawaii Department of Agriculture New Pest Advisory No. 04-02.

PAGE 64

53 Hoddle, M.S., Triapitsyn, S.V., Morgan, D.J. W., 2003. Distribution and plant association records for Homalodisca coagulata (Hemiptera: Cicadellidae) in Florida. Florida Entomologist 86, 89-91. Hopkins, D.L., Mollenhauer, H.H., French, W. J., 1973. Occurrence of a rickettsia-like bacterium in the xylem of peach trees with phony disease. Phytopathology 63, 1422-1423. Huang, H., Chopra, R., Verdine, D.L., Harris on, S.C., 1998. Structur e of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug design. Science 282, 1669-1675. Hung, A.C.F., Shimanuki, H. 1999. A sc ientific note on the detection of kashmir bee virus in individual honeybees and Varroa jacobsoni mites. Apidologie 30, 353354. Irvin, N.A., Hoddle, M.S., 2005. Determination of Homalodisca coagulata (Hemiptera: Cicadellidae) egg ages suitable for oviposition by Gonatocerus ashmeadi, Gonatocerus triguttatus, and Gonatocerus fasciatus (Hymenoptera: Mymaridae). Biological Control 32, 391-400. Isawa, H., Asano, S., Sahara, K., Iizka, T., Bando, H., 1998. Analysis of genetic information of an insect picorna-like virus, infectious flacherie virus of silkworm: evidence for evolutionary relationshi ps among insect, mammalian and plant picorna (-like) viruses. Archives of Virology 143, 127-143. James, J.A., Escalante, C.R., Yoon-Roberts, M., Edwards, T.A., Linden, R.M., Aggarwai, A.K., 2003. Crystal structure of the SF3 helicase from adeno-associated virus type 2. Structure 11, 1025-1035. Jan, E., Sarnow, P., 2002. Factorless ribosom e assembly on the internal ribosome entry site of cricket paralysis virus . Journal of Molecular Biology 324, 889-902. Johnson, K.N., Christian, P.D., 1998. The novel genome organization of the insect picorna-like virus Drosophila C virus suggests this virus belo ngs to a previously undescribed virus family. Jour nal of General Virology 79, 191-203. Kanamori, Y., Nakashima, N., 2001. A tertiary structure model of the internal ribosome entry site (IRES) for methionine-independent initiation of translation. RNA 7, 266274. Kanga, L.H.B., Jones, W.A., Humber, R.A., Boyd, D.W., 2004. Fungal pathogens of the glassy-winged sharpshooter Homalodisca coagulata (Homoptera: Cicadellidae). Florida Entomologist 87(2), 225-228. Kitajima, E.W., Bakarcic, M., Fernandez-Vali ela, M.V., 1975. Association of rickettsialike bacteria with plum leaf scal d disease. Phytopathology 65, 476-479.

PAGE 65

54 Koonin, E.V., Dolja, V.V., 1993. Evolution and taxonomy of positive-strand RNA viruses: implications of comparative an alysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28(5), 375-430. Lai, V.C., Kao, C.C., Ferrari, E., Park, J., Uss, A.S., Wright-Minogue, J., Hong, Z., Lau, J.Y., 1999. Mutational analysis of bovine viral diarrhea virus RNA-dependent RNA polymerase. Journal of Virology 73, 10129-10136. Leat, N., Ball, B., Govan, V., Davison, S., 2000. Analysis of the complete genome sequence of black queen-cell virus , a picorna-like virus of honey bees. Journal of General Virology 81, 2111-2119. Lijas, L., Tate, J., Lin, T., Christian, P., Johnson, J.E., 2002. Evolutionary and taxonomic implications of conserved structural motifs between pi cornaviruses and insect picorna-like viruses. Ar chives of Virology 147, 59-84. Lima, J.E.O., Miranda, V.S., Hartung, J.S., Br lanski, R.H., Coutinho, A., Roberto, S.R., Carlos, F.F., 1998. Coffee leaf scorch bact erium: axenic culture, pathogenicity, and comparison with Xylella fastidiosa of citrus. Plant Disease 82, 94-97. Love, R.A., Maegley, K.A., Y u, X., Ann Ferre, R., Lingardo, L.K., Diehl, W., Parge, H.E., Dragovich, P.S., Fuhrman, S.A., 2004. The crystal structure of the RNAdependent polymerase from human rhinovirus : a dual function target for common cold antiviral therapy. Structure 12, 1533-1544. Mari, J., Poulos, B.T., Lightner, D.V., Bonami, J.-R., 2002. Shrimp Taura syndrome virus : genomic characterization and sim ilarity with members of the genus Cricket paralysis-like viruses . Journal of General Virology 83, 915-926. Mayo, M. A., 2002. Virology division news: virus taxonomy – Houston 2002. Archives of Virology 147, 1071-1076. Minor P.D., Brown F., Domingo E., Hoey E., King A., Knowles N., Lemon S., Palmenberg, A., Rueckert R.R., Stanwa y G., Wimmer E., Yin-Murphy M., 1995. Picornaviridae. In: Murphy F.A., Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W., Martelli G.P., Mayo M.A., Summers M.D. (Eds.), Virus Taxonomy: Classification and Nomenclature of Viruse s. Sixth Report of the International Committee on Taxonomy of Viruses. Sp ringer-Verlag, Wien and New York, pp. 329-336. Mircetich, S.M., Lowe, S.K., Moller, W.J., Nyland, G., 1976. Etiology of almond leaf scorch disease and transmission of the causal agent. P hytopathology 66, 17-24. Mitchell, M.S., Matsuzaki, S., Imai, S ., Rao, V.B., 2002. Sequence analysis of bacteriophage T4 DNA packaging/terminase genes 16 and 17 reveals a common ATPase center in the large subunit of viral terminases. Nucleic Acids Research 30(18), 4009-4021.

PAGE 66

55 Mizell III, R.F., Andersen, P.C., Tipping, C., Brodbeck, B.V., 2003. Xylella fastidiosa diseases and their leafhopper vectors. EDIS. Available at: http://edis.ifas.ufl.edu/IN174 . (verified 4/2/2005) Moon, J.-S., Domier, L.L., McCoppin, N.K., D’Arcy, C.J., Jin, H., 1998. Nucleotide sequence analysis shows that Rhopalosiphum padi virus is a member of a novel group of insect-infecting RNA viruses. Virology 243, 54-65. Muscio, O.A., La Torre J.L., Scodell er E.A., 1988. Characterization of Triatoma virus , a picorna-like virus isolated from the triatomine bug Triatoma infestans . Journal of General Virology 69, 2929-2934. Nakashima, N., Sasaki, J., Toriyama, S., 1999. Determining the nuc leotide sequence and capsid-coding region of Himetobi P virus : a member of a novel group of RNA viruses that infect insects. Archives of Virology 144, 2051-2058. Opgenorth, D., 1995. Oleander leaf scorch associated with Xylella fastidiosa. California Plant Pest Disease Report 14, 60-61. Pestova, T.V., Lomakin, I.B., Hellen, C.U.T., 2004. Position of the CrPV IRES on the 40S subunit and factor dependence of IRES/80S ribosome assembly. EMBO Reports 5(9), 906-913. Purcell, A.H., 2001. Xylella fastidiosa web site. University of California at Berkeley. Available at: http://www.cnr.berkeley.edu/xylella/index.html . (verified 4/2/2005) Purcell, A.H., Saunders, S.R., Hendson, M., Grebus, M.E., Henry, M.J., 1999. Causal role of Xylella fastidiosa in oleander leaf scorch disease. Phytopathology 89, 5358. Roistacher, C.N., 1992. CVC: a warni ng and an appeal. Citrograph 77, 17-18. Rozen, S., Skaletsky, H.J., 2000. In: Krawetz, S., Misener, S. (Eds.), Bioinformatics Methods and Protocols: Methods in Molecular Biology, Humana Press, New Jersey, pp. 365-386. Ryan, M.D., Flint, M., 1997. Virus-encoded proteinases of the picornavirus super-group. Journal of General Virology 78, 699-723. Sasaki, J., Nakashima, N., Saito, H., Noda, H., 1998. An insect picorna-like virus, Plautia stali intestine virus , has genes of capsid proteins in the 3 part of the genome. Virology 244, 50-58. Sasaki, J., Nakashima, N. 1999. Translati on initiation at the CUU codon is mediated by the internal ribosome entry site of an insect picorna-like virus in vitro . Journal of Virology 73, 1219-1226.

PAGE 67

56 Sasaki, J., Nakashima, N., 2000. Methionine-i ndependent initiation of translation in the capsid protein of an insect RNA virus. Proceedings of the National Academy of Science (USA) 97, 1512-1515. Sherald, J.L., Wells, J.M., Hurtt, S.S., Ko stka, S.J., 1987. Association of fastidous xylem-inhabiting bacteria with leaf scorch in red maple. Plant Disease 71, 930933. Sorenson, S.J., Gill, R.J., 1996. A range extension of Homalodisca coagulata (Say) (Hemiptera: Clypeorrhyncha: Ciacadelli dae) to southern Ca lifornia. The PanPacific Entomologist 72, 160-161. Stothard, P., 2000. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA se quences. BioTechniques 28, 1102-1104 Strommer, J.N., Gregerson R., Vayda, M., 1993. Isolation and characterization of plant mRNA. Methods in Plant Molecu lar Biology and Biotechnology 49-65. Swofford, D. L., 2003. PAUP*: phylogeneti c analysis using parsimony (* and other methods), version 4.0b 10. Sinauer A ssociates, Sunderland, Massachusetts. Thole, V., Hull, R., 1998. Rice tungro s pherical virus polyprotein processing: identification of a virus-encoded proteas e and mutational analysis of putative cleavage sites. Virology 247(1), 106-114. Thompson, A.A., Peersen, O.B., 2004. Struct ural basis for proteolysis-dependent activation of the poliovirus RNA-dependent RNA polymerase. The EMBO Journal 23, 3462-3471. Thompson, J.D., Gibson, T.J., Plewniak, F ., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tool s. Nucleic Acids Research 25(24), 487682. Valles, S.M., Strong, C.A., Dang, P.M., Hunter , W.B., Pereira, R.M., Oi, D.H., Shapiro, A.M., Williams, D.F., 2004. A picorna-like virus from the red imported fire ant, Solenopsis invicta : initial discovery, genome sequence, and characterization. Virology 328, 151-157. van Dijk, A.A., Makeyev, E.V., Bamford, D.H. , 2004. Initiation of viral RNA-dependent RNA polymerization. Journal of General Virology 85, 1077-1093. van Munster, M., Dullemans, A.M., Verbeek, M., van den Heuvel, J.F.J.M., Clrivet, A., van der Wilk, F., 2002. Sequence analys is and genomic organization of a phid lethal paralysis virus : a new member of the family Dicistroviridae . Journal of General Virology 83, 3131-3138.

PAGE 68

57 Walker, J., Saraste, M., Runs wick, M., Gay, N., 1982. Distantly related sequences in the and -subunits of ATP synthase, myosi n, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. The EMBO Journal 1, 945-951. Wells, J.M., Raju, B.C., Hung, H.Y., Weisbur g, W.G., Paul, L.M., Brenner, D.J., 1987. Xylella fastidiosa gen. nov. , sp. nov : gram-negative, xylem-limited, fastidious plant bacteria related to Xanthomonas spp. International Journal of Systematic Bacteriology 37, 136-143. Wilson, J.E., Powell, M.J., Hoover, S.E ., Sarnow, P., 2000. Naturally occurring dicistronic cricket paralysis virus RNA is regulated by two internal ribosome entry sites. Molecular and Cellular Biology 20, 4990-4999. Woolaway, K.E., Lazaridis, K., Belsham, G.J ., Carter, M.J., Roberts, L.O., 2001. The 5 untranslated region of Rhopalosiphum padi virus contains an internal ribosome entry site which functions efficiently in mammalian, plant, and insect translation systems. Journal of Virology 75(21), 10244-10249. Wu, C.-Y., Lo, C.-F., Huang, C.-J., Yu, H.-T., Wang, C.-H., 2002. The complete genome sequence of Perina nuda picorna-like virus , an insect-infecting RNA virus with genome organization similar to th at of the mammalian picornaviruses. Virology 294, 312-323. Xu, X. Liu, Y., Weiss, S., Arnold, E., Sara fianos, S.G., Ding, J., 2003. Molecular model of SARS coronavirus polymerase: implications for biochemical functions and drug design. Nucleic Acids Research 31(24), 7117-7130. Yoon-Robarts, M., Blouin, A.G., Bleker, S., Kleinschmidt, J.A., Aggarwal, A.K., Escalante, C.R., Linden, R.M., 2004. Residues within the B motif are critical for DNA binding by the superfamily 3 helicase Rep40 of adeno-associated virus type 2. The Journal of Biological Chemistry 279(48), 50472-50481. Young, D.A., 1958. A synopsis of the species of Homalodisca in the United States. Bulletin of the Brooklyn Entomo logical Society 53(1), 7-13. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31(13), 3406-15.

PAGE 69

BIOGRAPHICAL SKETCH Laura Elizabeth Hunnicutt, the third child of Melbourne Kermit Hunnicutt II and Barbara Hunnicutt-Greenwell, was born on N ovember 6, 1974, in Mobile, Alabama. She was raised in Altamonte Springs, Florid a, where she attended Lake Brantley High School. Laura assumed her undergraduate studi es at the Universi ty of Florida in Gainesville, Florida, beginning in 1995 thr ough May of 1997, at which time she received a Bachelor of Science Degree in agricultu re operations management with a focus on bioprocess management. Her passion for an imals subsequently led her to pursue a second bachelor’s in animal science. Duri ng this time, Laura was hired as a Research Technician under Dr. Everett Mitchell at the USDA ARS Center for Medical, Agricultural and Veterinary Entomology wher e she reared and maintained Lepidopteran colonies for use in biologi cal control studies. Concurre ntly, she began a technical appointment at the University of Florida’s Co llege of Veterinary Medicine Department of Pathobiology under Dr. Sandra Allan where sh e carried out experiments designed to examine the efficacy of entomopathogenic f ungal foliar applications as a biocontrol method of ticks. In 2001, Laura relocated to Ft. Pierce, Florida, where she was offered a term field technician position at the USDA ARS U.S. Hortic ultural Research Laboratory (USHRL) Insect Ecology Laboratory manage d by Dr. Stephen Lapointe. Under his direction, she conducted field tr ials to measure the effects of Kaolin particle film application on citrus root weevil leaf notching and egg production as well as direct/indirect effects on non-ta rget populations. With aspi rations of exploring a more 58

PAGE 70

59 advanced technical position, she later accepted a position under Dr. Wayne Hunter in the USDA ARS USHRL Insect Vector s Laboratory. Since that tim e, she has completed eight large-scale expressed sequence tag (EST ) sequencing projects encompassing seven distinct insect species including Diaprepes abbreviatus (L.), Homalodisca coagulata (Say), Oncometopia nigricans (Walker), Diaphorina citri Kuwayama, Toxoptera citricida (Kirkaldy), Anoplophora glabripennis (Motschulsky) and Graphocephala atropunctata (Signoret). As a result, she has be en extensively trained in the use of robotics and sequencing protocols. In addition, the knowle dge and skill-set that she has acquired has enabled her to take an activ e role in the USHRL’s functional genomics program including the development of severa l standard operating procedures detailing RNA extraction and library synt hesis methodologies as well as the design of a standard EST annotation system. Upon graduation, Laur a plans to pursue a Ph.D. in molecular biology with emphasis on virology and struct ural biology, marrying her enthusiasm for animal science and intimate knowledge of insect systems in order to elucidate known viral systems and char acterize novel insect-vec tored viral pathogens.